Você está na página 1de 25

DNA FINGER PRINT

PROF. ALEXANDRE S. OSÓRIO


GENOMA NUCLEAR
MICROSSATÉLITES
• Seqüências hipervariáveis (também chamadas
polimórficas) repetitivas de 1 a 4 pb com distribuição ao
longo do genoma.
• O polimorfismo destas seqüências é resultado de
diferentes rearranjos envolvendo segmentos de DNA de
tamanhos diferentes.
• Herança Mendeliana (os filhos sempre recebem metade
dos alelos de origem materna e metade de origem
paterna).
MICROSSATÉLITES
Exemplos de seqüências de microssatélites:
• Repetição de 1 base:
GTAAAAAAAAAAAAAAAGGAT
• Repetição de 2 bases:
GTCACACACACACACACAGGAT (dinucleotídeo)
• •Repetição de 3 bases:
GTCACCACCACCACCACCACGGAT (trinucleotídeo)
• •Repetição de 4 bases:
GTCAGACAGACAGACAGAGGAT (tetranucleotídeo)

- Polimorfismos são devidos às diferenças no número de repetições


- São também conhecidos como “short tandem repeat” (STR).
- O número de repetições em seqüência pode variar, sendo chamadas
de VNTRs (Variable Number of Tandem Repeats = número variável
de repetições em seqüência) .
IMPRESSÕES DIGITAIS DO DNA
(DNA FINGERPRINTS)
O QUE SIGNIFICA?

Com base no estudo de uma bateria de 12-20 microssatélites, é


possível obter perfis genéticos praticamente indivíduo-específicos,
muito úteis na investigação de paternidade, identificação de vítimas
e criminosos.

TÉCNICAS

• RFLP (Restriction Fragment Lenght Polymorphism).


• PCR (Polymerase Chain Reaction).
Polimorfismo de Comprimento de
Fragmento de Restrição
1) Coleta de amostras biológicas que podem ser
saliva, sangue, esperma e cabelo com raiz, entre
outros.
2) Extração e purificação do DNA.
3) Corte com enzimas de restrição (tesouras
moleculares que reconhecem e cortam seqüências
específicas do DNA).
4) Eletroforese: onde, através de uma corrente
elétrica, são separados os fragmentos de DNA por
tamanho.
A partir daí, é formada uma espécie de código de
barras que é a identificação individual e
intransferível de cada indivíduo.
As enzimas de restrição
Fazem parte de um sistema da célula bacteriana denominado
sistema de modificação-restrição. Este sistema consiste numa
endonuclease de restrição.

Sítios de reconhecimento, modificação e clivagem por


O nome dado a enzima alguns enzimas de restrição

refere-se ao organismo de
onde foi isolado. A primeira Enzima Local de restrição Organismo de origem

letra representa o gênero e


as outras duas a espécie, Escherichia coli
EcoRI
seguido de um algarismo
romano (ou outra letra) que
Haemophilus influenza
indica a ordem da HindIII

descoberta ou a linhagem
da qual foi isolado. Smal
Serratia marcescens
Enzimas
Uma de restrição
enzima de restrição ou endonuclease de
restrição é um tipo de nuclease que cliva uma
cadeia dupla de DNA sempre que identificar uma
sequência específica de 4 a 8 pares de bases que
seja o local de restrição da enzima (Smith &
Wilcox, 1970).

As seqüências
reconhecidas
apresentam nas
duas cadeias
complementares
seqüências idênticas
mas invertidas –
palíndromo.
PCR – REAÇÃO EM CADEIA DE
POLIMERASE
• Aquecimento do DNA a ser amplificado a temperatura de 94°C por
1 minuto, o que provoca separação da dupla hélice. Depois, com a
temperatura mais baixa, são empregadas as polimerases, que
atuam em cada uma das cadeias do DNA, complementando os
pares de bases.
• A cada ciclo, a quantidade de DNA-alvo é duplicada, de modo que
em 10 ciclos obtêm-se 1024 vezes mais DNA-alvo; em 20 ciclos,
cerca de 1 milhão de vezes mais DNA-alvo.
• Propicia um aumento na eficiência da análise de material genético
• Polimerases são enzimas que ocorrem nas células e catalisam
reações de polimerização (formação de moléculas de cadeias
longas)
• Pela técnica PCR promove-se a duplicação de trechos do DNA in
vitro.
PCR
VISUALIZAÇÃO DO DNA
Uso de sondas: pequenos segmentos de DNA radioativados, cuja
seqüência de bases é conhecida. Acoplam-se às seqüências de
DNA das quais são complementares, ligando-se às mesmas.

SLP: detecta um único segmento de


DNA repetitivo em um único
cromossomo. Seu uso resulta em
um padrão que contém no máximo
duas bandas: uma para cada
segmento de DNA reconhecido em
cada membro do par de
cromossomos homólogos. Para a
obtenção de padrões mais
característicos de cada pessoa, são
necessárias várias sondas. Devido
à sua sensibilidade, são
empregadas nas investigações
criminais.
SLP (single-locus probe)
VISUALIZAÇÃO DO DNA
MLP: detecta vários segmentos de
DNA repetitivo localizados em
muitos cromossomos. O padrão
obtido consiste em
aproximadamente 20 a 30 bandas.
Por isso, a probabilidade de duas
pessoas tomadas ao acaso
apresentarem todas as bandas
exatamente com a mesma posição
é extremamente baixa (1:10
trilhões).
MLP (multi-locus-probe)
RESULTADOS DE TESTES
Mary Higgins foi violentada no Central Park em Nova York. Três
suspeitos foram presos. O DNA revelou o verdadeiro agressor.
RESULTADOS DE TESTES
O assassinato de Jon Bennet Ramsey: um crime sem solução?

Tristeza ou remorso ?
RESULTADOS DE TESTES
Em 1987: casal de noivos – Matthew Brock e Kelly Lynn Perry
(também estuprada) – é achado baleado na cabeça (bala de rifle
calibre 30) em Rodman Dam, área de recreação na Flórida.
Principais suspeitos: os adolescentes Randall Scott Jones e Chris
Reesh.