Você está na página 1de 15

Rede PROSAB Microbiologia para o Saneamento Bsico

PCR PARA QUANTIFICAO DE ARQUIAS


EM LODOS ANAERBIOS
Procedimento Operacional Padro (POP)
rea: Bacteriologia

rika Ferreira de Abreu* e Juliana Calbria de Arajo


*

Universidade Federal de Minas Gerais, Escola de Engenharia, Departamento de Engenharia


Sanitria e Ambiental, Laboratrio de Microbiologia. Av. Prof. Antnio Carlos, 6.627- bloco II

sala 4546, 31270-901, Pampulha, Belo Horizonte, MG.


Documento original 15/10/2011
Reviso
Referncia bibliogrfica deste documento:
ABREU, E. F. e ARAJO, J. C. PCR para Quantificao de Arquias em Lodos Anaerbios. Procedimento
Operacional Padro. Belo Horizonte: Universidade Federal de Minas Gerais, 2011. 14p. Documento da Rede
PROSAB Microbiologia para o Saneamento Ambiental. rea: Bacteriologia. Disponvel em:
<http://www.prosabmicrobiologia.org.br/rede/manuais>.
Disponvel em: <http://www.prosabmicrobiologia.org.br/rede/manuais>. Acesso em: XX XXX. XXXX. dia ms
(trs primeiras letras). ano.

Belo Horizonte
2011

2
SUMRIO
1 OBJETIVOS......................................................................................................................................... 3
2
CONCEITOS BSICOS ..................................................................................................................... 3
3
INTRODUO................................................................................................................................... 3
3.1
Princpio do Mtodo ........................................................................................................................ 4
3.2
Interferncias ................................................................................................................................... 4
3.3
Lista de Abreviaturas e Siglas ......................................................................................................... 4
4
MATERIAIS E SOLUES .............................................................................................................. 6
4.1
Materiais .......................................................................................................................................... 6
4.1.1
Aparelhagem ............................................................................................................................... 6
4.1.2
Outros Materiais .......................................................................................................................... 6
4.2
Reagentes ........................................................................................................................................ 6
4.3
Solues .......................................................................................................................................... 7
4.3.1
Soluo de EDTA 0,5 M, pH 8,0 (Soluo Estoque) ................................................................... 7
4.3.2
Soluo de Tris-HCl 1 M, pH 7,5-7,8 (Soluo-Estoque)........................................................... 8
4.3.3
Tampo TAE 50X, pH 7,5 (Soluo-Estoque) ............................................................................. 8
4.3.4
Tampo TAE 1X (Soluo de Uso Frequente)............................................................................. 9
4.3.5
Agarose 2% (Soluo-Estoque).................................................................................................... 9
4.3.6
Tampo de Amostra 6X ............................................................................................................. 10
4.3.7
Soluo de lcool 70% ............................................................................................................... 10
4.3.8
Brometo de Etdio ...................................................................................................................... 11
5
PREPARO DA PCR, TERMOCICLAGEM E ANLISE DOS RESULTADOS............................ 11
5.1
Preparo do Master Mix da PCR ..................................................................................................... 11
5.2
Preparo do Gel de Agarose e Eletroforese .................................................................................... 13
6
CONTROLE DE QUALIDADE ....................................................................................................... 14
6.1
Critrios de Qualidade para Aceitao de Resultado para Validao de Laboratrio Externo ...... 15
7
REFERNCIAS BIBLIOGRFICAS .............................................................................................. 15

PROSAB MICROBIOLOGIA

3
1

OBJETIVOS

Este Procedimento Operacional Padro descreve o mtodo de deteco de arquias


metanognicas pela tcnica da Reao em Cadeia da Polimerase (PCR) aplicado anlise de
lodos anaerbios oriundos de sistemas de tratamento de efluentes.
2

CONCEITOS BSICOS

Taq DNA polimerase: Enzima termoestvel recombinante da bactria Thermus aquaticus


(extremfila encontrada em fontes hidrotermais). responsvel pela incorporao de
nucleotdeos fita molde de DNA durante a PCR. dNTP: nucleotdeos fosfatados (dATP, dCTP,
dGTP e dTTP) necessrios para a sntese das novas molculas de DNA.
MgCl2: Cloreto de magnsio. Fornece o on Mg2+, co-fator essencial para a atividade da enzima
Taq DNA polimerase.
Primer ou iniciador: Oligonucleotdeo (constitudo geralmente por 15 a 30 nucleotdeos)
necessrio para o incio da replicao do DNA. Possui seqncia nucleotdica especfica ,
previamente determinada de acordo com o trecho de DNA que se deseja amplificar. O primer se
hibrida na regio complementar sua sequncia gentica, deixando uma extremidade OH livre
para que a enzima Taq polimerase inicie a sntese de DNA.
Arquias metanognicas: Microrganismos procariontes pertencentes ao Filo Euryarchaeota
(Domnio Archaea) que realizam a etapa final da digesto anaerbia (metanognese). Existem
trs grupos fisiolgicos: metilotrficas, que utilizam compostos metilados como metilaminas,
metanol e metanotiol; hidrogenotrficas (maioria das espcies), que utilizam o gs carbnico e
o hidrognio, formiato ou alguns lcoois; acetotrficas ou acetoclsticas, que utilizam acetatos.
Em reatores anaerbios, as principais arquias metanognicas encontradas so as
hidrogenotrficas e as acetoclsticas, sendo que estas ltimas tm grande importncia, uma vez
que 70% do metano produzido nestes sistemas resultante da degradao de acetatos.
Eletroforese em gel de Agarose: O resultado da reao da PCR analisado aplicando-se o
produto da PCR em gel de agarose (de 0,8 a 2,0%, dependendo do tamanho do fragmento a ser
analisado, em funo dos primers utilizados). Este gel de agarose submetido a uma eletroforese
na qual os produtos da PCR (DNA) sero separados em funo do peso molecular. A corrida do
produto da PCR ser comparada com a corrida do marcador de peso molecular (DNA ladder),
que aplicado como controle, e por comparao das bandas e da posio que elas migraram
verifica-se o peso molecular do fragmento da PCR.
O resultado considerado positivo: quando observa-se no gel fragmento de DNA de tamanho
esperado (em funo dos primers usados).
O resultado da reao considerado negativo: quando no observa-se no gel qualquer
fragmento de DNA (indicando que a reao de amplificao foi negativa), ou, quando observa-se
fragmento de DNA de tamanho diferente daquele esperado (amplificao inespecfica), e/ou
quando no tubo de reao usado como o branco de reao (sem adio de DNA, mas com gua
em substituio) observa-se DNA no gel indicando que houve amplificao.
3

INTRODUO

A PCR uma tcnica de biologia molecular que permite a replicao in vitro do DNA de forma
extremamente rpida. Com a PCR, quantidades mnimas de material gentico podem ser
amplificadas milhes de vezes em poucas horas, permitindo a deteco rpida e confivel de
microrganismos. Este POP descreve reaes da PCR com primers especficos para
amplificao de DNA extrado de culturas puras de arquias e de lodos de sistemas de
3

PROSAB MICROBIOLOGIA

4
tratamento de efluentes. Essas anlises podem ser adotadas para investigao desses
microrganismos em outros tipos de amostras.
3.1

Princpio do Mtodo

A PCR constitui-se de ciclos de replicao in vitro de DNA, cada qual contendo trs etapas
bsicas: desnaturao do DNA, anelamento dos primers e extenso Na desnaturao
(normalmente a 94 C) ocorre a separao da duplafita de DNA para exposio dos stios - alvo .
Na segunda etapa, com a diminuio da temperatura (por exemplo, a 55 C) ocorre o anelamento
dos primers em regies especficas de cada fita de DNA separada, que serve como molde,
delimitando, assim, a regio inicial e a regio final da seqncia gentica a ser amplificada.
Finalmente, na etapa de extenso, ocorre a sntese de DNA complementar fita molde e;
geralmente, feita em uma temperatura em torno de 72C. Em teoria, aps 25 a 40 ciclos
possvel produzir em poucas horas milhes de cpias especficas de DNA , mesmo se amostra de
partida contiver apenas uma seqncia alvo original.
3.2

Interferncias
Quantidade de DNA adicionada reao: excesso de DNA pode inibir a reao da PCR ou
gerar bandas inespecficas, causando rastros no gel (smears), acima e/ou abaixo da banda de
interesse. Para uma reao de 50L, a quantidade de DNA genmico que deve ser aplicada
est entre 10pg a 1,0g. Sugere-se realizar testes de PCR com DNA diludo (por exemplo,
1:10, 1:20, 1:50, 1:100) e verificar qual amplificao oferece maior rendimento de produto,
sem rastros inespecficos;
Excesso de reagentes (enzima Taq polimerase, MgCl2, primers, dNTP) podem gerar
amplificaes inespecficas. Porm, esses reagentes em quantidade insuficiente podem
interferir na eficincia da reao;
Baixa temperatura de anelamento dos primers pode causar amplificao inespecfica;
M qualidade do DNA extrado: presena de substncias hmicas, fenol, protenas, etc.,
podem inibir a reao.

Cada reao individual e, por isso, ajustes adequados em seus parmetros geram resultados de
maior sucesso. Em caso de necessidade de alteraes, observar as recomendaes abaixo da
quantidade dos reagentes da PCR (www.fermentas.com ; www.phoneutria.com.br).
Componentes
Quantidade
Tampo da PCR 10X
5,0L
dNTP (2 mM cada)
5,0L
Primer foward
0,11,0M
Primer reverse
0,11,0M
MgCl2 25 mM *
1,04,0M
Taq DNA polimerase
0,51,25U
DNA-molde
10 pg1,0g
gua ultra-pura, livre de nuclease
at 50L
Volume
50L
* Opcional: em alguns casos, o MgCl2 j vem includo no tampo da PCR
3.3

Lista de Abreviaturas e Siglas


4

PROSAB MICROBIOLOGIA

PCR
dNTP
MgCl2
Na2EDTA
TAE
Tris
UV

Polymerase Chain Reaction ou Reao em Cadeia da Polimerase


desoxirribonucleotdeos trifosfatos (dATP, dTTP, dCTP, dGTP)
cloreto de magnsio
Etileno amino tetraacetato de sdio diidratado
[CH2N(CH2.COOH)CH2.COONa]2.2H2O
Tampo Tris, cido actico glacial e Na2EDTA
(hidroximetil) aminometano C4H11NO3
ultra violeta

PROSAB MICROBIOLOGIA

6
4

MATERIAIS E SOLUES

4.1

Materiais

4.1.1

Aparelhagem

Agitador magntico;
Capela de fluxo laminar;
Capela de exausto;
Microcentrfuga;
Termociclador para PCR;
Cuba de eletroforese horizontal;
Fonte para a eletroforese;
Transiluminador de UV com cmera digital;
Computador com software de registro e anlise de imagem;
Balana digital;
Forno microondas;
Autoclave.

4.1.2

4.2

Outros Materiais

Barra magntica;
Bqueres (200 e 1000mL);
Bales volumtricos (100 e 1000mL);
Microtubos do tipo Eppendorf (1,5 mL e 200L) estreis;
Micropipetas (1mL, 200L, 10L);
e ponteiras (1mL, 200L, 10L) estreis;
Plstico tipo Parafilm;
Banho de gelo para microtubos;
Suporte tipo microplaca (96 poos);
Recipientes de plstico escuro (ou coberto com papel alumnio);
Esptula de plstico;
Tubo tipo Falcon (50mL);
Frascos tipo Shott (250mL);
Provetas (100 e 1000mL);
culos de proteo contra luz UV.
Reagentes
gua destilada;
Na2EDTA (para biologia molecular);
Tris base (para biologia molecular);
HCl concentrado;
NaOH (microprolas);
cido actico glacial (grau analtico);
Azul de bromofenol;
Xileno cianol;
Glicerol;
Agarose;
6

PROSAB MICROBIOLOGIA

gua ultra-pura;
Enzima DNApolimerase Taq pht (Phoneutria Biotecnolgia e Servios, Belo Horizonte,
Brasil);
Tampo 10X para PCR (com 50 mM de cloreto de magnsio);
Mistura de desoxinucleotdeos (dNTPs) Fermentas (Fermentas Life Sciences, Vilnius,
Litunia);
Iniciadores ou primers (concentrao de cada um: 25 pmol/L) Fermentas;
Marcador de peso molecular de 25 a 700 pb (DNA ladder, marca: Fermentas);
Brometo de etdio (0,5 g/mL).

4.3

Solues

As solues descritas no item 4.3.1 foram baseadas na literatura SAMBROOK et al.,1989.


4.3.1

Soluo de EDTA 0,5 M, pH 8,0 (Soluo Estoque)

a) Frmula
Na2EDTA
gua destilada

18,61g
100mL

b) Preparo

Em um bquer (200mL), pesar o Na2EDTA;


Adicionar 80mL de gua destilada;
Colocar a soluo no agitador magntico com barra magntica e adicionar aos poucos as
microprolas de NaOH at dissolver completamente a soluo;
Ajustar o pH para 8,0 com HCl concentrado;
Completar o volume com gua destilada para 100mL em balo volumtrico;
Esterilizar a soluo em autoclave por 20 minutos a 121C.

c)

Armazenamento

Temperatura ambiente (< 30C).


d) Validade
30 dias. Observar a qualidade da soluo que dever estar isenta de slidos suspensos e fungos.

PROSAB MICROBIOLOGIA

8
4.3.2

Soluo de Tris-HCl 1 M, pH 7,5-7,8 (Soluo-Estoque)

a) Frmula
Tris base
gua destilada

12,11g
100mL

b) Preparo

Em um bquer (200mL), pesar 12,1g de Tris base;


Adicionar 80mL de gua destilada;
Colocar a barra magntica no bquer, lev-lo para o agitador magntico e misturar bem at
dissolver completamente a soluo;
Levar a soluo para a capela de exausto e ajustar o pH com HCl concentrado para uma
faixa entre 7,5 e 8,0;
Completar o volume para 100mL em balo volumtrico.
Esterilizar a soluo em autoclave por 20 minutos a 121C.

c)

Armazenamento

Temperatura ambiente (< 30C).


d) Validade
30 dias. Observar a qualidade da soluo que dever estar isenta de slidos suspensos e fungos.
4.3.3

Tampo TAE 50X, pH 7,5 (Soluo-Estoque)

a) Frmula
Tris-base
cido actico glacial
Na2EDTA 0,5M pH 8,0
gua destilada

242 g
57,1mL
100mL
1000mL

b) Preparo

Em um bquer (1000mL), pesar 242g de Tris-base e adicionar 100mL de EDTA 0,5M


(pH=8,0);
Adicionar 600mL de gua destilada;
Colocar a barra magntica no bquer, lev-lo para a capela de exausto e adicionar 57,1mL
de cido actico glacial;
Misturar bem at dissolver completamente todos os reagentes;
Ajustar o pH para 7,5 com adio de HCl concentrado;
Completar o volume com gua destilada para 1000 mL em balo volumtrico;
Esterilizar a soluo em autoclave por 20 minutos a 121C.

c) Armazenamento
Temperatura ambiente (< 30C).
8

PROSAB MICROBIOLOGIA

d) Validade
30 dias. Observar a qualidade da soluo que dever estar isenta de slidos suspensos e fungos.
4.3.4

Tampo TAE 1X (Soluo de Uso Frequente)

a) Frmula
TAE 50X
gua destilada

20mL
1000mL

b) Preparo

Adicionar 20mL de TAE 50X em 980mL de gua;


Homogeneizar e colocar a soluo em um frasco tipo Shott.

c)

Armazenamento

Temperatura ambiente (< 30C).


d) Validade
30 dias. Observar a qualidade da soluo que dever estar isenta de slidos suspensos e fungos.
4.3.5

Agarose 2% (Soluo-Estoque)

a) Frmula
Agarose
TAE 1X

2g
100mL

A concentrao da agarose utilizada na eletroforese depende do tamanho dos fragmentos de


DNA, conforme apresentado na tabela abaixo. Para extraes de DNA genmico utiliza-se
concentraes mais baixas (de 0,8 a 1,0% de agarose) a fim de facilitar a migrao dos
fragmentos de DNA.
Concentrao de agarose (%p/v)

Tamanho de fragmentos (Kb)

0,3

1,0-70,0

0,5

0,7-45,0

0,8

0,4-20,0

1,0

0,3-10,0

1,2

0,2-8,0

1,5

0,2-6,0

2,0

0,1-5,0
9

PROSAB MICROBIOLOGIA

10
b) Preparo

Pesar a agarose diretamente em um frasco tipo Schott;


Adicionar 100mL de tampo TAE 1X e misturar bem;
Levar ao microondas e aquecer, sem deixar ferver, at obter uma mistura homognea.
Interromper o aquecimento em alguns momentos para misturar a soluo;
Armazenar a soluo-gel em temperatura ambiente.

c)

Armazenamento

Temperatura ambiente (< 30C).


d) Validade
30 dias.
4.3.6

Tampo de Amostra 6X

a) Frmula
Azul de bromofenol 0,25%
Xileno cianol 0,25%
Glicerol 30%
gua destilada

0,025g
0,025g
7,0mL
3,0mL

b) Preparo

Pesar 0,025g de azul de bromofenol e 0,025g de xileno cianol;


Dissolver os dois reagentes em 7,0ml de gua destilada;
Completar o volume para 10mL com 3,0ml de glicerol.

c)

Armazenamento

Alquota-estoque: 4 C (geladeira). Alquota de uso: temperatura ambiente (< 30C).


d) Validade
Indeterminada.
4.3.7

Soluo de lcool 70%

a) Frmula
lcool comum (comercial)
gua destilada

70mL
30mL

b) Preparo

Misturar o lcool com gua destilada;


10

PROSAB MICROBIOLOGIA

11

Acondicionar em pissetas e utilizar na limpeza de bancadas.

c)

Armazenamento

Temperatura ambiente (< 30C).


d) Validade
30 dias.
4.3.8

Brometo de Etdio

a) Frmula
Brometo de etdio
gua destilada

1 gota
400mL

b) Preparo

Adicionar uma gota de brometo de etdio em 400mL de gua destilada (concentrao final:
cerca de 0,5 g/mL).

O brometo de etdio um corante utilizado para corar gis de agarose aps a corrida das
amostras de DNA. um corante fluorescente que se intercala entre as bases da duplafita de
DNA. Quando irradiado com luz UV, emite-se uma fluorescncia, o que permite a visualizao
do DNA no gel. A substncia cancergena e o laboratorista no se deve entrar em contato com
esta soluo. O gel corado deve ser manipulado com uma esptula grande e larga.
c)

Armazenamento

A soluo deve ser armazenada, em temperatura ambiente (< 30C), em recipiente escuro ou
embalado com papel-alumnio para proteo contra a luz. O recipiente e esptula devem ser
devidamente identificados, inclusive como contaminados, e separados de outras vidrarias e
objetos de uso comum no laboratrio. Sugere-se incluir um recipiente com gua destilada para
descorar o gel por alguns minutos, aps colorao na soluo de brometo de etdio, para melhor
visualizao da corrida.
d) Validade
15 dias.
5
PREPARO
RESULTADOS
5.1
1.
2.

DA

PCR,

TERMOCICLAGEM

ANLISE

DOS

Preparo do Master Mix da PCR


Limpar a capela de fluxo laminar com soluo de lcool 70%, ligar o fluxo e a lmpada UV
por 15 minutos.
Limpar a rea reservada para manipulao de amostra de DNA com soluo de lcool 70%;
11

PROSAB MICROBIOLOGIA

12
3.

4.

Descongelar as amostras e reagentes da PCR (tampo 10X contendo MgCl2, H2O ultra-pura,
dNTP, primers) e homogeneiz-los gentilmente (se necessrio, centrifugar rapidamente para
concentrar os reagentes no fundo do microtubo). Mant-los em banho de gelo. A Taq DNA
polimerase dever ser retirada do freezer a 20 C somente no momento do uso;
Calcular, pelo nmero de amostras e incluindo o branco, os volumes necessrios de cada
reagente utilizando a Tabela 1 como referncia. Adicionar uma reao extra para compensar
erros de pipetagem. Para cada lote de reao, deve-se incluir sempre o branco de reao, que
o microtubo contendo somente o mix, sem adio de DNA. O branco de reao utilizado
para checar possveis contaminaes nos reagentes utilizados na PCR.

Tabela 1.

Concentrao dos reagentes da PCR.

Reagentes
H2O ultra-pura
Tampo de PCR
dNTPs
Primer foward
Primer reverse
Taq polimerase
Amostra de DNA
Volume final

Concentrao
estoque
10X
10 mM cada
25 pmol/L
25 pmol/L
5,0 U/L
1:10 a 1:20
-

Concentrao final
por reao
1X
200 M cada
300 nM
300 nM
0,04 U/L
-

Volume por
reao (L)
20,2
2,5
0,5
0,3
0,3
0,2
1,0
25

Reaes
Multiplicar os
valores
da
coluna ao lado
pelo nmero
total
de
amostras,
controles
e
branco

5.

Adicionar os reagentes em um microtubo de 500L ou 1,5mL para preparao das reaes


(master mix), com exceo da amostra de DNA, na ordem apresentada na Tabela 1;
6. Retirar a enzima Taq DNA polimerase do freezer e homogeneizar. Adicionar o volume
necessrio de enzima soluo master mix, retornando-a ao freezer;
7. Mantendo o microtubo em banho de gelo, homogeneizar gentilmente a soluo master mix
com a pipeta;
8. Sob banho de gelo, distribuir 24,0L da soluo master mix nos microtubos para PCR de
200L previamente identificados, deve-se colocar sempre a soluo no fundo do tubo;
9. Levar as reaes no banho de gelo para a rea reservada para manipulao de DNA. Retirar
do freezer (ou da geladeira) as amostras de DNA previamente diludas, descongel-las e
mant-las em banho de gelo;
10. Adicionar 1,0L de amostra de DNA nos respectivos microtubos, incluindo as amostras
referentes ao controles positivo. Separar uma reao para controle negativo (sem adio de
DNA). O volume de DNA a ser adicionado pode tambm ser alterado em funo de sua
concentrao inicial (0,5 a 2,0uL) neste caso corrigir a quantidade de gua adicionada no
master mix;
11. Aps pipetar a amostra, homogeneizar a reao com a pipeta. Realizar uma centrifugao
rpida nas reaes para concentrar toda a soluo no fundo dos microtubos;
12. Levar os microtubos para o termociclador pr-aquecido e acionar o programa de execuo
para o par de primers utilizado (Tabela 2);

12

PROSAB MICROBIOLOGIA

13
Tabela 1.

Primers utilizados para amplificao de genes de RNAr 16S de arquias e perfis


de temperatura para PCR.

Grupo-alvo
Arquias em geral
(Domnio Archaea)
Gnero
Methanosaeta
(verificar obs.
no item 6)
Gnero
Methanosarcina
Gnero
Methanobacterium

Par de
primers
Arch-348
Arch-786

GYGCAGCAGGCGCGAAA
GGACTACVSGGGTATCTAAT

Msaet-387
Msaet-573

GATAAGGGRAYCTCGAGTGCY
GGCCGRCTACAGACCCT

Msarc-450
Msarc-589
Mbac398
Mbac578

TAGCAAGGGCCGGGCAAGA
ATCCCGGAGGACTGACCAAA
CCCAAGTGCCACTCTTAACG
AGACTTATCAARCCGGCTACGA

Seqncia (5-3)

Perfis de
temperatura a
95C por 20s;
55C por 20s;
72C por 2
min
(40 ciclos)

Referncia

Adaptado de
SAWAYAM
A et al.
(2006)

Todas as reaes da PCR iniciam com desnaturao em 95C por 3 minutos e finalizam com
a etapa de extenso 72C por 10 minutos.

Ao preparar o programa de ciclos de temperatura no termociclador, deve-se colocar a


temperatura da tampa (lid) a 105 C para evitar evaporao da reao. Sugere-se tambm
colocar no programa uma temperatura de 4 C aps a etapa de extenso final.
13. Ao final da reao, estocar os produtos da PCR amplificados a temperatura de 4C at o
processamento da eletroforese para verificao do resultado da amplificao.
14. Ao trmino da reao da PCR, verificar o sucesso da amplificao por meio de uma
eletroforese em gel de agarose 2%.
5.2
1.

2.
3.
4.
5.
6.
7.
8.
9.

Preparo do Gel de Agarose e Eletroforese


Levar a soluo-estoque de agarose 2% ao microondas e aquecer, sem deixar ferver, at
obter uma mistura homognea. Interromper o aquecimento em alguns momentos para
misturar o gel;
Verter cerca de 25mL da soluo no tubo Falcon e deixar esfriar at cerca de 50C.
Enquanto isso, preparar o molde para receber o gel. Tamanho do molde: 6 cm x 10 cm;
Verter a soluo no molde e colocar cuidadosamente o pente. Deixar o gel esfriar por
aproximadamente 30 minutos;
Remover cuidadosamente o pente e colocar o gel na cuba de eletroforese. No caso de uso
posterior, o gel pode ser envolvido em filme plstico e armazenado a 4C por 1 a 2 dias;
Preencher a cuba de eletroforese com tampo TAE 1X. Esse tampo pode ficar armazenado
na prpria cuba e ser reutilizado por trs corridas eletroforticas;
Na primeira canaleta do gel de agarose, aplicar 5,0L do marcador de peso molecular (DNA
ladder);
Colocar um pedao de plstico Parafilm sobre um suporte tipo microplaca e fazer uma leve
presso;
Sobre o plstico, aplicar 1,0L de tampo de amostra e 5,0L de produto da PCR,
homogeneizar bem;
Coletar a amostra misturada com tampo e dispensar dentro da segunda canaleta do gel de
agarose. Fazer isso com as outras amostras, preenchendo assim as outras canaletas do gel;
13

PROSAB MICROBIOLOGIA

14
10. Ligar a fonte e iniciar a eletroforese com a aplicao de um campo eltrico de 100 V por 40
minutos;
11. Aps a corrida, colocar o gel na soluo de brometo de etdio (0,5 g/mL) durante 10
minutos;
Cuidado: Durante todo o procedimento de preparao do gel de agarose, aplicao e
colorao com brometo de etdio, o laboratorista deve usar luvas e jaleco.
Opcional: Em caso do gel ficar muito corado, pode-se descor-lo em banho de gua destilada
por cerca de 10 minutos no intuito de melhorar a visualizao das bandas de DNA
no transiluminador.
12. Aps registro da imagem do gel (realizado atravs de programa de imagem no computador),
deve-se descartar o gel em recipiente adequado destinado para este tipo de resduo. Limpar o
transiluminador com leno de papel e gua destilada (sempre usando luvas).
Cuidado: A luz UV nociva aos olhos e pele expostos a esta. Usar mscara e culos de
proteo quando estiver operando equipamentos contendo esta fonte de luz e que
no estiverem em cabines fechadas!
6

CONTROLE DE QUALIDADE
Realizar a extrao de DNA, mix da PCR, reao da PCR (termociclador) e a eletroforese
em setores separados dentro do laboratrio para evitar contaminaes;
De preferncia, o mix da PCR deve ser preparado dentro de uma capela de fluxo laminar
previamente esterilizada com luz UV por no mnimo cinco minutos;
Deve-se separar um conjunto de trs micropipetas (10 L, 100 L e 1000 L) para cada
etapa: i) extrao de DNA, ii) preparo de mix da PCR, iii) manipulao e diluio de DNA,
para evitar contaminao das amostras e das reaes;
As ponteiras e microtubos, antes de serem utilizados, devem ser esterilizados em autoclave
por 20 minutos a 121 C e, logo aps, colocados em estufa para secar;
Em cada reao da PCR, separar uma para ser o branco de reao (reao sem adio de
DNA) para checar ausncia de contaminao do mix;
Separar uma reao para ser o controle positivo da PCR, contendo DNA extrado de uma
cultura pura de arquia de referncia que amplifique com o par de primer utilizado;
Averiguar o tamanho do fragmento amplificado, em termos de pares de base: a posio da
banda do produto da PCR no gel deve ser aproximadamente a mesma que a posio da
banda do marcador de peso molecular (DNA Ladder) que apresente o peso desejado.
No caso de testar outros pares de primers, avaliar sua especificidade com DNA extrado de
culturas de referncia (sempre que possvel).

No caso dos primers deste protocolo, foram feitos testes com DNA de culturas puras de arquias
de referncia (Methanosaeta concilii DSM 6752, Methanosarcina barkeri DSM 800 e
Methanobacterium formicium DSM 1535). Verificou-se que os primers Arch 348/786
amplificaram com sucesso o DNA das trs culturas puras. Os primers Mbac 398/578 e Msarc
450/589 se mostraram especficos, amplificando somente DNA de Methanobacterium
formicium e Methanosarcina barkeri, respectivamente. O par Msaet 387/573, entretanto,
amplificou DNA de Methanosaeta concilii e de Methanosarcina barkeri, no sendo, portanto,
especfico para o gnero Methanosaeta, conforme diz o artigo (SAWAYAMA et al., 2006).
14

PROSAB MICROBIOLOGIA

15
Apesar disso, esse par de primer pode ser til para detectar populaes de arquias
acetoclsticas, uma vez que ambos os gnero, Methanosaeta e Methanosarcina, constituem as
nicas arquias produtoras de metano a partir da degradao do acetato. Os quatro pares de
primers foram tambm testados com DNA de bactria (Escherichia coli) e, em todos os testes, o
resultado foi negativo (sem nenhuma amplificao).
6.1

Critrios de Qualidade para Aceitao de Resultado para Validao de


Laboratrio Externo

Para validao de resultados da PCR para deteco de arquias, necessrio que os


experimentos alcancem os seguintes resultados:

Tanto as reaes como o controle positivo devem ter um produto amplificado com banda
simples e ntida, sem rastros;
As bandas devem apresentar o tamanho esperado (em funo do par de primer utilizado)
mediante comparao com a banda de mesmo tamanho (usando o marcador de peso
molecular como referncia (DNA Ladder);
O controle negativo tem que apresentar ausncia de amplificao, e deve ser realizado
sempre em cada reao de amplificao;
Repetir a reao por mais 2 eventos distintos de amplificao de modo a confirmar os
resultados.
REFERNCIAS BIBLIOGRFICAS

SAMBROOK, J. ; FRITSCH, E. F.; MANIATIS, T. Molecular cloning: a laboratory manual.


Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 2nd edition, New York, United States,
1989.
SAWAYAMA, S.; TSUKAHARA, K.; YAGISHITA, T. Phylogenetic description of
immobilized methanogenic community using real-time PCR in a fixed-bed anaerobic digester.
Bioresource Technology, 97, p. 69-76, 2006.
Site Fermentas Life Sciences: www.fermentas.com
Site Phoneutria Biotecnologia e Sevios: www.phoneutria.com.br

15

PROSAB MICROBIOLOGIA