Você está na página 1de 8

24/10/2015

NUCLEO
Cromatina
DNA

Cdigo Gentico e Biossntese de Protenas

Transcrio

EXON

RNA
Processamento

Gentica Mdica

CAP

Medicina (3 Semestre )

Degradao
do mRNA

UFAC

INTRON
Cauda
mRNA

CITOPLASMA CLULA
mRNA
Traduo
Polipeptdeo

Prof. Dr. Emmerson Costa


Protena Ativa

2015-1
Protena Degradada

A transcrio pode ser dividida em etapas

1) Reconhecimento do
molde
2) Iniciao
3) Dissociao da fita e
sntese
4) Liberao do fator
5) Estreitamento do canal
6) Alongamento
7) Trmino

Processamento do RNA primrio RNA mensageiro

ntron

ntron

RNA primrio
ou Pr-RNA
2

RNA mensageiro
Small nuclear RNA (snRNA): direciona o
processamento do RNA primrio para formar
o RNA mensageiro.
RETIRAR OS INTRONS

Clula Eucaritica- Organelas


Vacolos

Ribossomos

Citoesqueleto
Centrolos

Carioteca

Ribossomos

Ribossomos so os locais de sntese de


protena.
Esto dispersos no citoplasma ou aderidos
ao Retculo Endoplasmtico.
Ocorrem tanto em procariontes quanto em
eucariontes.

24/10/2015

A mensagem de RNA decodificada nos ribossomos.

A mensagem de RNA decodificada nos ribossomos


RNA ribossomal (rRNA)
Formado por molculas de RNA + Protenas

Um ribossomo contm 4 stios de ligao para molculas de RNA: um para o mRNA e


trs so para tRNAs.

Peptidil-tRNA levando
a cadeia polipetdica em
crescimento
Liberao do tRNA

Stio de entrada
do tRNA + AA

RNA
mensageiro

Um ribossomo contm 4 stios de ligao para molculas de


RNA: um para o mRNA e trs so para tRNAs.

RNA transportador (tRNA) Aminoacil tRNA


Carboxil

Amina
Cadeia Lateral

Liberao do tRNA
do stio E

Crescimento da
cadeia polipeptdica
Peptidil transferase
Ligao peptdica

Centro de decodificao

24/10/2015

Formao da Ligao Peptdica

RNA mensageiro (mRNA) de EUCARIOTOS


TRADUO do RNAm Protena

Subunidade 40S

RNA mensageiro (mRNA) de EUCARIOTOS


TRADUO do RNAm Protena

RNA mensageiro (mRNA) de EUCARIOTOS


TRADUO do RNAm Protena

Uma sequncia de mRNA


decodificada em conjuntos de
3 nucleotdeos (CDON)

60S

40S

24/10/2015

Cdons de terminao marcam o final da traduo (UAA, UAG ou UGA).

24/10/2015

Recruitment of the 43S complex to the 5 end of the mRNA

Iniciao: Captura do mRNA

AAAAAAAAA
PABP PABP

A 5 cap (m7GpppX) do mRNA capturado pela


ligao do complexo eukaryotic Initiation
Factors da famlia eIF4.

eIF3

eIF4G
eIF4E

eIF4A

eIF4B

eIF5
eIF2
eIF1

40S
GTP
Met

eIF1A

m7GpppGAUUCGAUACCAGGGAGCUUGGCACCAUGGC

eIF3 interacts with eIF4G to recruit the 43S complex

As protenas so produzidas nos polirribossomos


Poliadenilao e circulao do mRNA atravs da ligao do PABP a eIF4G.

4 nucleotdeos = 64 combinaes
20 aminocidos diferentes so encontrados nas protenas.
O cdigo gentico redundante e alguns AA so determinados por mais de um triplet.

Lodish et al. Molecular Cell Biology Fig. 4-42

Este cdigo gentico utilizado universalmente em todos os organismos.

Existem trs fases de leitura possveis na sntese de protena

24/10/2015

Traduo gera protenas de acordo com


as instrues de leitura do mRNA.

Fase de traduo
O processo de traduo dividido em trs
estgios: iniciao, alongamento e trmino.
Iniciao: apresentao do mRNA ao ribossomo e
usa um grande nmero de fatores de iniciao para
ajustar o ribossomo e iniciar a traduo.
Elongamento: quando contnuas ligaes de
aminocidos formam a protena.
Trmino: quando o ribossomo chega no cdon de
terminao, as duas subunidades do ribossomo se
separam liberando o mRNA

* mRNA traduzido atravs do encaixe do


ribossomo e sua movimentao.
* O ribossomo um multicomponente
independente,
composto
de
RNA
ribossomal e ~78 diferentes protenas.
* O ribossomo organizado em duas
subunidades: 40S e 60S (eucariotos) e 30S
e 50S (procariotos).

Incio da traduo em procariotos e eucariotos


mRNA de procariotos
Incio ocorre no codon AUG prxima de uma sequencia de 3-9 base denominada de
sequncia Shine-Delgarno (SD)

AUG

SD

AUG

AUG

SD

Cdon de iniciao com


o stioShine-Delgarno

AUG

Cdon de iniciao com


o stioShine-Delgarno

mRNA de eucaritos
O incio ocorre ~90% das vezes no primeiro cdon AUG

5 cap

AUG
Primeiro cdon AUG
prximo a 5 cap

AUG

AUG

cdon interno Met

EXERCCIO DE FIXAO
Suposta protena:
Metionina (MET) + Lisina
(LIS) + Triptofano (TRP) +
FIM

Ou seja:
MET + LIS + TRP + FIM

Protena:
Metionina (MET) + Lisina (LIS) + Triptofano (TRP) + FIM

24/10/2015

RESOLVENDO...
Suposta protena:
MET + LIS + TRP + FIM
AUG + AAA + UGG + UGA
AUG + AAA + UGG + UAA
AUG + AAA + UGG + UAG

EXERCCIO DE FIXAO
Suposta protena:
AUG + CUC + GAG + AGC + UAG
Quais os aminocidos?

AUG + AAG + UGG + UGA


AUG + AAG + UGG + UAA
AUG + AAG + UGG + UAG

RESOLVENDO...
Suposta protena:
AUG + CUC + GAG + AGC + UAG
Quais os aminocidos?
Metionina (MET) + Leucina (LEU)
+ Glutamato (GLU) + Serina (SER)
+ FIM

RESOLVENDO...
Suposta protena:
MET + LIS + TRP + FIM
AUG + AAA + UGG + UGA
AUG + AAC + UGG + UGA

MET + ASN + TRP + FIM


MUTAO
DOENA, CNCER OU
RESISTNCIA A DROGAS

24/10/2015

Quimioterpico

Inibio

Mecanismo de Ao

Patologia

Actinomicina D

RNA-polimerase

Inibe a sntese de protenas

Cncer

Rifamicina

RNA-polimerase

Inibe a sntese de protenas

Mycobaterium
tuberculosis

Aciclovir

DNA-polimerase

Inibio da replicao

Hepes vrus

Citarabina

DNA-polimerase

Inibio da replicao

Cncer

Hicantone

Intercala no DNA

Inibe a transcrio e sntese de


protenas

Esquistossomose

Ciprofoxacino

Topoisomerase II

Inibio da sntese do DNA/RNA Bactrias do trato


urinrio

Doxorrubicina
Lapachona

Topoisomerase II
Topoisomerase I e II

Cloranfenicol

Subunidade 50S do
ribossomo

Inibio da sntese de protenas

Bactrias

Gentamincina
Neomicina

Liga-se ao RNA 16S


(subunidade 30S)

Inibio da sntese de protenas

Bactrias

Ribavirina

RNA dependente de
RNA polimerase

Inibe a replicao do RNA

Vrus da hepatite C (HCV)

CONCLUINDO...
A informao nos GENES codificantes de
PROTENAS usada pela clula em 2 etapas
da transferncia de informao:
DNA

Transcrio
Inibio da sntese do DNA/RNA Cncer

RNA

Traduo
PROTENA

BIBLIOGRAFIA
INTRODUO GENTICA
GRIFFTHS, SUZUKI,...
EDITORA: GUANABARA KOOGAN

BIOLOGIA MOLECULAR DA CULA (THE CELL)


ALBERTS, WALTER,...
EDITORA: ARTMED