Você está na página 1de 43

Processo Seletivo 2016

Medicina

Caderno de Provas

TATU
Nome do Candidato

Nmero de Inscrio

UNIVERSIDADE FEDERAL DE MATO GROSSO


Secretaria de Articulao e Relaes Institucionais
Gerncia de Exames e Concursos

INSTRUES
LEIA COM ATENO
1.

Este Caderno de Provas, com pginas numeradas de 1 a 41, constitudo de:


trs Provas Objetivas com 60 (sessenta) questes de mltipla escolha, cada uma com quatro alternativas, assim

distribudas:

01 a 15 Linguagens
16 a 50 Cincias da Natureza e Matemtica
51 a 60 Cincias Humanas
uma Prova de Redao.

2. Caso o Caderno de Provas esteja incompleto ou tenha qualquer defeito de impresso, solicite ao fiscal que o substitua.
3. Na prova de Linguagens, no que se refere s Lnguas Estrangeiras, considere apenas o idioma de sua opo: Ingls
(pginas 5 a 8), ou Espanhol (pginas 9 a 11).
4. Sobre a Marcao do Carto de Respostas
As respostas das questes objetivas devero ser transcritas com caneta esferogrfica de tinta azul ou preta no
porosa, fabricada em material transparente, para o Carto de Respostas, que ser o nico documento vlido para
correo.
4.1. Para cada questo existe apenas uma alternativa que a responde acertadamente. Para a marcao da
alternativa escolhida no Carto de Respostas, pinte completamente o crculo correspondente. A figura ao
lado ilustra a marcao de determinada questo que a alternativa C seja a escolhida.
4.2. Ser invalidada a questo em que houver mais de uma marcao, marcao rasurada ou emendada, ou no
houver marcao.
4.3. O candidato dever, aps o recebimento do Caderno de Provas, marcar no Carto de Respostas a figura que
identifica o seu Caderno. No caso deste Caderno de Provas, pinte o crculo correspondente ao nome da figura e
rubrique no espao frente da palavra TATU.
5. Na elaborao da Redao, poder ser usada para rascunho a pgina 40 deste Caderno de Provas, mas o texto definitivo
dever ser transcrito na Folha de Redao. Use caneta esferogrfica de tinta azul ou preta no porosa, fabricada em
material transparente.
6. No rasure nem amasse o Carto de Respostas e a Folha de Redao, pois NO haver substituio de qualquer desses
documentos por erro do candidato.
7. Todos os espaos em branco, neste Caderno de Provas, podem ser utilizados para rascunho.
8.

A durao das provas 4 (quatro) horas e 30 (trinta) minutos, j includo o tempo destinado ao preenchimento do Carto
de Respostas e da Folha de Redao.

9.

Somente aps decorridas 2 horas e 30 minutos do incio das provas, o candidato, depois de entregar seu Caderno de
Provas, seu Carto de Respostas e sua Folha de Redao, poder retirar-se da sala de prova. O candidato que insistir em
sair da sala de prova antes desse tempo dever assinar Termo de Ocorrncia declarando sua desistncia do Processo
Seletivo 2016.
10. Ser permitida a sada de candidatos levando o Caderno de Provas somente na ltima meia hora de prova.
11. Na pgina 41 deste Caderno de Provas, encontra-se a Folha de Anotao do Candidato, a qual poder ser utilizada para a
transcrio das respostas das questes objetivas. Essa folha poder ser levada pelo candidato para posterior conferncia
com o gabarito somente aps decorridas 2 horas e 30 minutos do incio das provas.
12. Aps o trmino das provas, o candidato dever, obrigatoriamente, entregar ao fiscal o Carto de Respostas e a Folha de
Redao devidamente assinados e preenchidos.

LINGUAGENS
Lngua Portuguesa
INSTRUO: Leia o texto abaixo e responda s questes 01 e 02.
Nos banquetes da Idade Mdia, no existia uma ordem para comer: a mesa era posta completa, com carnes,
ensopados, pes, tortas, queijos, bolos, mel. No havia diferenciao entre categorias de pratos e tudo era
comido ao mesmo tempo, do jeito que cada um quisesse. Um dos motivos para essa fartura de doces e
salgados era a vontade de ostentar, pois o montante de comida simbolizava a riqueza do anfitrio.
A ideia da sobremesa servida no final da refeio relativamente moderna. Segundo historiadores, se deu
graas a Catarina de Mdicis, que em 1533 saiu de Florena para se casar com o futuro rei francs Henrique II.
A italiana levou para a Frana muitos livros de receitas e seus prprios cozinheiros. A partir dela, a corte
passou a aceitar mulheres nos banquetes, a comer com garfos e a saborear a sobremesa apenas ao final da
refeio.
Mas foi s no sculo XIX que a ideia de apresentar os pratos numa certa ordem foi aceita completamente, e os
cozinheiros passaram a montar cardpios, sempre finalizando com doces.
(Revista PONTO E, n 30, 2015.)

QUESTO 01
O texto traz um histrico do uso da sobremesa ao final das refeies. Sobre o texto, analise as afirmativas.
I - Quanto mais rico o anfitrio, mais fartos os banquetes oferecidos na Idade Mdia.
II - Servir doces nos grandes banquetes ao final das refeies era costume na Idade Mdia e reforado no
sculo XVI.
III - Catarina de Mdicis, ao mudar-se para a Frana, introduziu o uso de talheres nas refeies.
IV - Cada conviva poderia comer o lhe apetecesse, salgado ou doce, nos banquetes da Idade Mdia.
Est correto o que se afirma em
(A) I e II, apenas.
(B) I, III e IV, apenas.
(C) III e IV, apenas.
(D) I, II e III, apenas

QUESTO 02
A coeso e a clareza de um texto dependem tambm do emprego adequado dos recursos lingusticos. Sobre
tais recursos no texto, marque V para as afirmativas verdadeiras e F para as falsas.
(

(
(

) A vrgula em Nos banquetes da Idade Mdia, deve-se ao fato de que esse trecho que indica uma
circunstncia de tempo encontra-se no incio da frase, deslocado de sua posio cannica no final da
frase.
) Em Um dos motivos para essa fartura de doces e salgados era a vontade de ostentar, pois o
montante de comida simbolizava a riqueza do anfitrio, a conjuno destacada introduz a ideia de
que a segunda orao conclui o que foi dito na primeira.
) A expresso A partir dela funciona como operador argumentativo, indicando no texto a direo de
sentido pretendida.
) A conjuno Mas, no incio do ltimo pargrafo, marca o contraste entre o tempo em que foi
introduzida a sobremesa no final das refeies e o tempo em que se tornou aceita completamente.

Assinale a sequncia correta.


(A) V, F, V, V
(B) V, V, F, F
(C) F, F, V, V
(D) F, V, F, F
1/41 Processo Seletivo 2016 FACIMED CADERNO TATU

QUESTO 03
Leia o excerto de Machado de Assis.
Desde os cinco anos merecera eu a alcunha de menino diabo; e verdadeiramente no era outra
coisa; fui dos mais malignos do meu tempo, arguto, indiscreto, traquinas e voluntarioso. Por exemplo, um dia
quebrei a cabea de uma escrava, porque me negara uma colher do doce de coco que estava fazendo, e, no
contente com o malefcio, deitei um punhado de cinza ao tacho, e, no satisfeito da travessura, fui dizer
minha me que a escrava que estragara o doce por pirraa; e eu tinha apenas seis anos. Prudncio, um
moleque de casa, era o meu cavalo de todos os dias; punha as mos no cho, recebia um cordel nos queixos,
guisa de freio, eu trepava-lhe ao dorso, com uma varinha na mo, fustigava-o, dava mil voltas a um e outro
lado, e ele obedecia, algumas vezes gemendo, mas obedecia sem dizer palavra, ou, quando muito, um
ai, nhonh! ao que eu retorquia: Cala a boca, besta! Esconder os chapus das visitas, deitar rabos
de papel a pessoas graves, puxar pelo rabicho das cabeleiras, dar belisces nos braos das matronas, e outras
muitas faanhas deste jaez, eram mostras de um gnio indcil, mas devo crer que eram tambm expresses
de um esprito robusto, porque meu pai tinha-me em grande admirao; e se s vezes me repreendia, vista
de gente, fazia o por simples formalidade: em particular dava-me beijos.
(Memrias pstumas de Brs Cubas. So Paulo: tica, 2002.)

O trecho acima faz parte do captulo II, O menino pai do homem. Que postura apresenta sobre os costumes
da sociedade brasileira do sculo XIX?
(A) Machado de Assis pouco faz contra a escravido, pois mostra uma cena em que o escravo maltratado,
sem punio aos culpados.
(B) O comportamento do menino exemplo de crueldade infantil, sendo pouco representativo dos costumes
familiares e sociais da poca.
(C) A cena corrobora a situao mostrada, j que marcada pela ironia, buscando efeitos de humor.
(D) O escritor mostra como funcionava a escravido no Brasil: o escravo era mercadoria da qual o senhor
poderia se utilizar da forma que quisesse.

QUESTO 04
Voc tem na carteira uma nota de cem reais [...]? D uma boa olhada nela e tente encontrar algo diferente.
Voc pode no ter percebido, mas, em pouco mais de quatro anos, ela perdeu 58% de seu valor, na
comparao com o dlar.
(Veja, 09/09/2015.)

Esse trecho inicia uma reportagem sobre o aumento do dlar, fato que evidencia a crise de credibilidade em
que o governo jogou o Brasil. A estratgia de construo do texto utilizada pelo autor de iniciar dialogando
com o leitor
(A) convoca-o a ler toda a reportagem para verificar at que ponto sua vida e a de seu pas esto sendo
influenciadas pela alta do dlar.
(B) aproxima-o da situao de perda de valor do real, visto que o governo brasileiro permitiu que houvesse
58% de desvalorizao da moeda nacional.
(C) desperta o interesse em continuar a leitura da reportagem, pois se trata de tema que, alm de real, diz
respeito a sua prpria situao financeira.
(D) instiga o desprezo pela atuao do governo brasileiro, tendo em vista que aumentou o valor do dlar sem
qualquer consulta popular.

2/41 Processo Seletivo 2016 FACIMED CADERNO TATU

QUESTO 05
Leia o texto abaixo publicado em 3 de agosto de 2015 no jornal eletrnico /www.jornalcapitaldocafe.com.br, acessado
em 24/09/2015 (adaptado).
A agricultura familiar uma forma de produo onde predomina a interao entre gesto e trabalho; so os
agricultores familiares que dirigem o processo produtivo, dando nfase diversificao e utilizando o trabalho familiar,
eventualmente complementado pelo trabalho assalariado.
O PRONAF (Programa Nacional de Fortalecimento da Agricultura Familiar) tem como objetivo o fortalecimento
das atividades desenvolvidas pelo produtor familiar, de forma a integr-lo cadeia de agronegcios, proporcionandolhe aumento de renda e agregando valor ao produto e propriedade, mediante a modernizao do sistema produtivo,
valorizao do produtor rural e a profissionalizao dos produtores familiares.
Tambm objetiva construir um padro de desenvolvimento sustentvel para os agricultores familiares e suas
famlias, visando o aumento e a diversificao da produo, com o consequente crescimento dos nveis de emprego e
renda, proporcionando bem-estar social e qualidade de vida.
Sobre os recursos lingusticos constantes da superfcie textual do texto, marque V para as afirmativas verdadeiras e F
para as falsas.
(
(
(
(
(

) Por ser um texto informativo, as formas verbais, a exemplo de dirigem e objetiva, esto no presente do
indicativo, indicando fatos que ocorrem no momento em que so enunciados.
) No segundo pargrafo, os pronomes lo e lhe funcionam como elementos coesivos anafricos e retomam o
mesmo sentido: produtor familiar.
) No segundo pargrafo, a preposio mediante tem valor semntico de finalidade e pode ser substituda por
a fim de.
) Os pronomes onde e que, no primeiro pargrafo, podem ser substitudos por no qual e nos quais,
respectivamente.
) Quanto escrita culta, o trecho visando o aumento e a diversificao da produo apresenta um problema
de regncia verbal: o verbo visar, no sentido empregado, exige preposio a.

Assinale a sequncia correta.


(A) F, V, F, V, V
(B) V, F, V, V, F
(C) V, V, F, F, V
(D) F, V, V, F, F
INSTRUO: Leia os poemas de Cludio Manoel da Costa e Oswald de Andrade e responda s questes de 06 a 08.
Leia a posteridade, ptrio Rio,
Em meus versos teu nome celebrado;
Por que vejas uma hora despertado
O sono vil do esquecimento frio:
No vs nas tuas margens o sombrio,
Fresco assento de um lamo copado;
No vs ninfa cantar, pastar o gado
Na tarde clara do calmoso estio.
Turvo banhando as plidas areias
Nas pores do riqussimo tesouro
O vasto campo da ambio recreias.
Que de seus raios o planeta louro
Enriquecendo o influxo em tuas veias,
Quanto em chamas fecunda, brota em ouro.
Sonetos de Cludio Manoel da Costa.

SABAR
Este crrego h trezentos anos
Que atrai os faiscadores
Debaixo das serras
No fundo da bateia lavada
O sol brilha como ouro
Outrora havia negros a cada metro de margem
Para virar o rio metlico
Que ia no dorso dos burros
E das caravelas
Borba Gato
Os paulistas trados
Sacrilgios
O vento
Roteiro de Minas. Poesia Pau Brasil.

3/41 Processo Seletivo 2016 FACIMED CADERNO TATU

QUESTO 06
Qual temtica se comprova no poema Leia a posteridade, ptrio Rio?
(A) A identificao entre a natureza mineira e o locus amoenus clssico: solar e primaveril.
(B) Crtica aos danos trazidos pela minerao de ouro natureza, numa visada ecolgica.
(C) Descrio do espao rural de Minas em contraposio ao meio urbano, construdo a partir dele.
(D) Lamento do mineiro pelas riquezas exploradas pelos bandeirantes paulistas.

QUESTO 07
Sobre os sentidos do texto de Oswald de Andrade, assinale a afirmativa correta.
(A) A voz lrica faz um balano do ciclo da minerao sculos depois, ressaltando a exportao do capital e a explorao
do trabalho escravo.
(B) A poesia da primeira gerao modernista retoma os princpios do Arcadismo, revisitando os modelos clssicos.
(C) O poema enquadra-se na produo de cunho neorrealista, apresentando uma seleo de tipos regionais
emblemticos.
(D) O texto traz uma viso ufanista da figura do bandeirante, o heri da colonizao do interior do pas.

QUESTO 08
Em relao linguagem dos dois poemas, analise as afirmativas abaixo.

I - Os dois poemas trabalham com a relao sol/ouro, gerando metforas que se explicam pelo contexto histrico.
II - O poema rcade apresenta uma sintaxe latinizante, em que predomina a inverso.
III - Atento s proposies formais das Vanguardas, principalmente do Futurismo, o poema modernista abole a
pontuao e adota a frase nominal.

IV - Os dois poemas utilizam-se da variedade oral do portugus brasileiro.


Est correto o que se afirma em
(A) I e III, apenas.
(B) III e IV, apenas.
(C) II e IV, apenas.
(D) I, II e III, apenas.

QUESTO 09
A gente nunca para para pensar, mas, dentro de nosso corpo, inmeras batalhas so travadas todos os dias. Vrus,
bactrias, agentes infecciosos em geral e at clulas que teimam em ser defeituosas e querem a todo custo vencer
nosso exrcito de defesa e nos dominar. Na maioria das vezes, samos vitoriosas, mas h perodos em que no
conseguimos derrotar nem aquela gripe. Para entender o segredo da sade de ferro, preciso ir alm da vitamina C.
(Viva Sempre Bem, n 17, 2015.)

Em relao ao texto acima, analise as afirmativas.

I - Em A gente nunca para para pensar, o primeiro para preposio com valor de finalidade e o segundo verbo.
II - A expresso A gente apresenta valor semntico equivalente ao pronome reto ns, tanto que na continuidade do
texto usada a primeira pessoa do plural.

III - A presena de adjetivo feminino em Na maioria das vezes, samos vitoriosas sugere que o texto tenha sido escrito
por mulheres.

IV - A presena de subjetividade no texto revela-se pelo uso da primeira pessoa e de expresses como a todo custo e
aquela gripe.
Esto corretas as afirmativas
(A) I, III e IV.
(B) II, III e IV.
(C) II e III, apenas.
(D) I e II, apenas.
4/41 Processo Seletivo 2016 FACIMED CADERNO TATU

QUESTO 10
Leia a tira abaixo.

Em relao tira, sentido e linguagem, analise as afirmativas.


I - A fala de Hagar, no primeiro quadrinho, sugere que os vikings so ambiciosos e apegados s coisas
materiais.
II - O uso do adjetivo pequenas anteposto ao substantivo coisas, no segundo quadrinho, imprime ao
substantivo o sentido figurado de simples, sem valor.
III - A fala de Hagar, no terceiro quadrinho, obriga a alterao de sentido do adjetivo pequenas do segundo
quadrinho, passando a significar diminutas.
IV - O humor da tira est na relao entre pequenas coisas e grandes coisas que, para Hagar, so a mesma
coisa.
V - As locues adjetivas de ouro e de prata podem ser substitudas pelos adjetivos ureas e argnteas.
Est correto o que se afirma em
(A) I, II, III e IV.
(B) I, II, IV e V.
(C) I, III e IV, apenas.
(D) II, III e V, apenas.

LNGUA ESTRANGEIRA
Ingls
QUESTO 11
Na figura apresentada uma piada do site The laugh factory comedy network.

Para construir o sentido humorstico do texto, o autor


(A) recorre construo sinttica interrogativa com o uso do advrbio How.
(B) associa o vocbulo party ao conhecimento do leitor sobre astronomia.
(C) utiliza o substantivo planet, do mesmo campo semntico de astronomers em lugar de plan it.
(D) usa o pronome they para retomar o sentido de astronomers estabelecendo adequada coeso.
5/41 Processo Seletivo 2016 FACIMED CADERNO TATU

QUESTO 12
CAMPAIGNS

WORLD TOILET DAY, 19 NOVEMBER

Of the worlds seven billion people, 2.5 billion people do not have improved sanitation. 1 billion people still
defecate in the open. Women and girls risk sexual harrassment and abuse because they have no toilet that
offers privacy.
19 November was formally recognized by the United Nations General Assembly as the World Toilet Day in a
resolution of 24 July 2013. The objective is to make sanitation for all a global development priority and urge
changes in both behaviour and policy on issues ranging from improving water management to ending open-air
defecation.
World Toilet Day is coordinated by UN-Water in collaboration with Governments and relevant stakeholders.
(Disponvel em www.unwater.org/campaigns/en/. Acesso em 26/09/2015.)

Esse texto uma campanha da organizao UN-Water vinculada s Naes Unidas que reconhecem o dia 19
de novembro como Dia Mundial do Banheiro. Essa campanha justifica-se
(A) porque a falta de privacidade pode submeter mulheres a situaes vulnerveis.
(B) porque 4,5 bilhes de pessoas so afetadas pela precariedade sanitria em todo o mundo.
(C) como alerta em defesa das pessoas que no tm acesso a banheiros pblicos para defecar.
(D) ao amparar-se em polticas pblicas que resguardam o direito da pessoa privacidade e higiene.
INSTRUO: Leia os textos I e II a seguir e responda s questes 13 e 14.
TEXTO I
Imagine
() Imagine there's no countries
It isn't hard to do
Nothing to kill or die for
And no religion too
Imagine all the people
Living life in peace
You may say
I'm a dreamer
But I'm not the only one
I hope some day
You'll join us
And the world will be as one
Imagine no possessions
I wonder if you can
No need for greed or hunger
A brotherhood of man
Imagine all the people
Sharing all the world ()
(LENNON, J. Imagine. Nova York: Record Plant Studios, 1971 (fragmento).)
6/41 Processo Seletivo 2016 FACIMED CADERNO TATU

TEXTO II

(Disponvel em www.nationalmemo.com/cartoon-what-to-do-about-african-immigration-to-europe/. Acesso em 25/09/2015.)

QUESTO 13
O trecho da letra da cano de John Lennon e a charge sobre a imigrao africana para Europa relacionam-se
na medida em que
(A) os pases e as religies so representados como os sujeitos de solues pacficas para a questo
migratria da Europa.
(B) o ttulo de cada texto cria a expectativa no leitor de algo provvel ou possvel de ser alcanado.
(C) estabelecem um dilogo com o leitor nos trechos You may say Im a dreamer e Youll have to be patient,
interpelando-o para uma reflexo.
(D) ambos empregam elementos que caracterizam a linguagem potica na construo dos sentidos.

QUESTO 14
Na charge (texto II), o personagem usa a expresso Im afraid para
(A) indicar o sentimento de preocupao perante a situao vivida.
(B) expressar com polidez uma informao que no ser bem-vinda ao seu interlocutor.
(C) introduzir o uso da linguagem informal em situaes que envolvem relaes diplomticas entre pases.
(D) enfatizar o aspecto contraditrio e constrangedor da posio do personagem em relao ao seu
interlocutor.

7/41 Processo Seletivo 2016 FACIMED CADERNO TATU

QUESTO 15
Observe atentamente a figura.

(Disponvel em http://www.weather.gov/. Acesso em 08/10/2015.)

O site National Weather Service um noticirio governamental


(A) que possibilita ao internauta buscar informaes especficas sobre o tempo em uma dada localidade.
(B) interativo que, por ser um veculo noticioso, restringe-se a informaes atuais sobre o clima em todo o
pas.
(C) cujos informes visam atender unicamente ao servio de proteo contra tempestades da costa martima
norte-americana.
(D) que oferece links a sites de acesso a informaes de emergncias climticas em todo territrio nacional.

8/41 Processo Seletivo 2016 FACIMED CADERNO TATU

Espanhol
QUESTO 11
Carmen Maura: Ser actriz es un chollo
- Por qu le dio por ser actriz?
- Cuando empec a ser actriz me pareca la tpica chorrada facilona que no me costaba ningn trabajo.
Siempre me lo he tomado as. Tengo un ngel de la guardia fantstico que me ha puesto en momentos
especiales y en sitios especiales. Yo me dedico a esto porque me diverta jugar a las casitas. Eso es todo. No
haba pensado nunca en ser conocida ni en nada.
-Le sigue pareciendo una chorrada facilona?
-Creo que este trabajo sinceramente es un chollo. Es aprenderte la letra y si ests dotado para hacer
mentirijillas hacerlas. Cuando vienen actores con historias me aburro. Lo importante es tener el texto bien
aprendido y saber qu el director quiere. Tengo la suerte que nunca me pongo nerviosa cuando se pone en
marcha la cmara. Simplemente hace falta estar relajada. Para hacer a una loca no necesito irme dos semanas
a un psiquitrico.
(C. M. Carmen Maura: ser actriz es un chollo: entrevista. [21 set. 2015]. Madri: El mundo [online]. Cine. Entrevista
concedida a Custodio Pastor. Disponvel em: <http://www.elmundo.es/>. Acesso em: 22 set. 2015. (fragmento).)

Nessa entrevista, a atriz espanhola Carmen Maura define o seu trabalho empregando a expresso idiomtica
es un chollo. Ao utilizar essa expresso, a atriz se refere
(A) monotonia que a rotina de gravaes lhe impe.
(B) ao processo de incorporao do real na interpretao.
(C) facilidade com que desempenha seus papis.
(D) ao aspecto ldico que o trabalho de atriz tem para ela.

QUESTO 12

(Disponvel em <http://www.e-faro.info/>. Acesso em: 23 set. 2015.)

Os textos que circulam na sociedade possuem funes especficas. Nesse sentido, essa charge tem o objetivo
de
(A) contrapor as distintas vises de duas geraes a respeito da formao das crianas.
(B) ressaltar a importncia da leitura de publicaes especializadas para a educao dos filhos.
(C) destacar a relevncia da interao com outras crianas para o processo de desenvolvimento infantil.
(D) contestar a rigidez dos pais que permitem brincadeiras ao ar livre apenas em ocasies especiais.
9/41 Processo Seletivo 2016 FACIMED CADERNO TATU

QUESTO 13
Nio muerto en la playa
La fotografa de Aylan Kurdi, un nio sirio de tres aos muerto en una playa de Turqua cuando con su familia
trataba de emigrar a Europa, conmovi al mundo entero. []
Es bueno que haya ahora, en los pases ms prsperos y libres del mundo, una conciencia mayor de la disyuntiva
moral que les plantea el problema de estas migraciones masivas y espontneas, pero sera necesario que, por positivo
que sea el esfuerzo que hagan los pases avanzados para admitir ms refugiados en su seno, no se hicieran ilusiones
pensando que de este modo se resolver el problema. Nada ms inexacto. Aunque los pases occidentales practicaran la
poltica de fronteras abiertas que los liberales radicales defienden defendemos, nunca habra suficiente
infraestructura ni trabajo en ellos para todos quienes quisieran huir de la miseria y la violencia que asolan ciertas
regiones del mundo. El problema est all y slo all puede encontrar una solucin real y duradera. Tal como se
presentan las cosas en frica y Medio Oriente, por desgracia, aquello tomar todava algn tiempo. Pero los pases
desarrollados podran acortarlo si orientaran sus esfuerzos en esa direccin, sin distraerse en paliativos momentneos
de dudosa eficacia.
(VARGAS LLOSA, M. Nio muerto en la playa. El pas [online], Madri, 20 set. 2015. Opinin.
Disponvel em: <http://elpais.com/>. Acesso em: 22 set. 2015. Adaptado.)

Nesse artigo de opinio, o escritor peruano Mario Vargas Llosa discorre sobre a crise da migrao de refugiados da
frica e do Oriente Mdio para a Europa. No texto, a opinio do autor sobre uma possvel resoluo para esse drama
social a de que os pases europeus deveriam
(A) praticar uma poltica de fronteiras abertas com a finalidade de receber maior nmero de refugiados.
(B) ajudar os pases da frica e do Oriente Mdio a resolver seus problemas na origem a fim de evitar a migrao.
(C) proteger os imigrantes da violncia e da misria a que so submetidos em seus pases de origem.
(D) desenvolver conscincia da gravidade do problema que atinge os imigrantes da frica e do Oriente Mdio.

QUESTO 14
La frontera caliente
Hay que mencionar, para no terminar en el dulce sino en la amargura, lo ms triste: la gente, las personas. De
repente el discurso bolivariano (siempre tan elocuente en su retrica fcil: todos somos hermanos bolivarianos) ha
cambiado de cuo: de la noche a la maana los hermanos colombianos se volvieron contrabandistas, asesinos,
ladrones, paramilitares. Las cdulas de nacionalidad chavista tambin se devaluaron, y hoy sus portadores son
ciudadanos de segunda categora y se exponen al destierro. A veces les rasgan la cdula en la cara. El seor Maduro
empez a deportarlos por miles sin frmula de juicio. Como su denostado Israel, seala y tumba las casas de los
supuestos delincuentes, y los empuja a salir, sin dejarlos usar siquiera los puentes, atravesando ros y montaas. Otros,
con miedo, empiezan a huir antes de que los deporten sin dejarlos sacar siquiera los corotos. Y en la frontera
colombiana se vive una crisis humanitaria que crece cada da: ya son 12.000 los que han cruzado, y podran llegar a
decenas de miles, si la locura xenfoba bolivariana no se detiene. El gobierno colombiano dice que recibe a sus
compatriotas con los brazos abiertos. Pero esos brazos abiertos se necesita de repente que vengan con agua, comida,
techo, escuela, trabajo. Las palabras bonitas no reemplazan la leche ni el arroz. Se requerira la solidaridad de toda
Amrica, pero lo ms vergonzoso es que Brasil, Argentina, Ecuador y muchos otros gobiernos populares prefieren
mirar hipcritamente para otro lado. Mientras tanto la tragedia econmica y moral de chavismo llega a Colombia bajo la
forma ms triste: expulsados y refugiados con hambre y miedo.
(ABAD FACIOLINCE, H. La frontera caliente. El pas [online], Madri, 06 set. 2015. Internacional.
Disponvel em: <http://elpais.com/>. Acesso em: 23 set. 2015. (fragmento).)

O texto apresenta uma reflexo sobre a recente crise na fronteira entre Colmbia e Venezuela. Segundo o autor, o
aspecto mais grave dessa crise
(A) o despreparo do governo colombiano para receber seus cidados refugiados.
(B) o dilema da populao colombiana expulsa do territrio venezuelano.
(C) a falta de validade dos documentos venezuelanos concedidos aos colombianos.
(D) a omisso de outras naes latino-americanas para ajudar na resoluo da crise.
10/41 Processo Seletivo 2016 FACIMED CADERNO TATU

QUESTO 15

(Disponvel em <https://www.nlm.nih.gov>. Acesso em: 23 de set. 2015.)

Na estrutura desse infogrfico, a gradao temporal tem a intencionalidade de


(A) persuadir o fumante dos benefcios progressivos de se abandonar o hbito de fumar.
(B) informar o leitor sobre os riscos de se desenvolver doenas relacionadas ao tabagismo.
(C) mostrar como um ex-fumante pode alcanar os ndices de sade de um no fumante.
(D) ressaltar a rapidez do processo de recuperao da sade de um ex-fumante.

CINCIAS DA NATUREZA E MATEMTICA


Biologia
QUESTO 16
inegvel que se vive dias difceis, a violncia em toda sua plenitude tem envolvido grande parte da
sociedade mundial. No Brasil, a violncia tem feito milhares de vtimas sendo a maioria jovem; em alguns
casos esse ato praticado pela prpria famlia, alm de inmeros outros ocorridos nas ruas. O Brasil responde
por 10% de todos os homicdios praticados no mundo, segundo dados de um estudo realizado a pedido do
governo suo, divulgado no ano de 2008, em Genebra. Quanto a essa situao, acredita-se que apenas a
diminuio da idade criminal no contribuir muito para minimizar esse quadro, porque fatores que
contribuem para essa situao no so considerados pelas polticas pblicas.
(Disponvel em Web Mundo Educao. Acesso em 02/10/2015. Adaptado.)

Marque a alternativa que apresenta fator relevante para o quadro retratado.


(A) Implantao do Estatuto da Criana e do Adolescente (ECA).
(B) Incapacidade de diferenciar o individual do individualismo.
(C) Acelerado xodo rural para os grandes centros que no programaram infraestruturas urbanas.
(D) Campanhas de desarmamento.
11/41 Processo Seletivo 2016 FACIMED CADERNO TATU

QUESTO 17
A Revista Cincia Hoje, de abril de 2001, publicou matria sobre um novo mtodo para produzir insulina
artificialmente utilizando-se de tecnologia do DNA recombinante. Essa tecnologia foi desenvolvida por
pesquisadores do Departamento de Biologia Celular da Universidade de Braslia (UnB) em parceria com a iniciativa
privada e se caracteriza por modificar geneticamente a bactria Escherichia coli tornando-a capaz de sintetizar o
hormnio. Esse processo permitiu a fabricao de insulina em maior quantidade e, em apenas 30 dias,
correspondendo a 1/3 do tempo necessrio para obt-la pelo mtodo tradicional que consiste em extrair o
hormnio a partir do pncreas de animais abatidos. A produo de insulina pela tcnica do DNA recombinante tem
como consequncia:
(A) Aprimorar seres transgnicos.
(B) Impacto favorvel na sade de pessoas diabticas.
(C) Potencializar processo de seleo microbitica.
(D) Avano tecnolgico que permite manipular as clulas troncos.

QUESTO 18
Em relao ao surgimento de vida na Terra, a Teoria da Panspermia Csmica defende que tal fato ocorreu a partir
de seres vivos ou substncias precursoras da vida, provenientes de outros locais do universo. A Teoria da Evoluo
Qumica ou Teoria da Evoluo Molecular, proposta inicialmente pelo bilogo ingls Thomas Huxley e aprofundada
anos depois pelo tambm bilogo ingls John Burdon S. Haldane e pelo bioqumico russo Aleksandr I. Oparin,
pressupe que a vida teria surgido a partir de um processo de evoluo qumica, onde compostos inorgnicos
combinaram-se originando molculas orgnicas simples (acares, aminocidos, bases nitrogenadas, cidos graxos
etc.), que se combinaram produzindo molculas mais complexas como protenas, lipdeos, cidos nucleicos etc.,
que originaram estruturas com capacidade de autoduplicao e metabolismo, dando origem aos primeiros
sistemas vivos.
Quanto a essas teorias, correto afirmar:
(A) As duas teorias no entram em conflito, pois tanto os defensores da Panspermia Csmica quanto os da
Evoluo Qumica concordam que, onde quer que a vida tenha se originado, o processo deve ter ocorrido por
evoluo molecular.
(B) As duas teorias so conflitantes uma vez que a Teoria da Panspermia sugere abiognese, e no explica como
se deu o processo de formao de molculas com capacidade de se autoduplicar.
(C) A Teoria da Panspermia Csmica aceita atualmente por toda a comunidade cientfica, pois responde
perguntas que a Teoria da Evoluo Molecular no consegue responder plenamente.
(D) Ambas, de certa forma, sugerem a possibilidade de abiognese e ou gerao espontnea, j que admitem a
origem dos sistemas vivos a partir de substncias inorgnicas.

QUESTO 19
A Lei n 11/1987 define ambiente como conjunto dos sistemas fsicos, qumicos, biolgicos, sociais e culturais
com efeito direto ou indireto, mediato ou imediato, sobre os seres vivos e a qualidade de vida do Ser Humano, e a
Poltica Nacional do Meio Ambiente (PNMA) estabelecida pela Lei n 6.938/1981, regulamentada pelo Decreto n
99.271/1990, define meio ambiente como sendo conjunto de condies, leis, influncias e interaes de ordem
fsica, qumica e biolgica que permite, e rege a vida em todas suas formas. Nesse sentido, correto inferir:
(A) Espao, rea ou lugar ocupado por uma comunidade de organismos ou por algum componente da Ecofuno
podem ser considerados como responsveis pela manuteno da biocenose.
(B) Os processos prprios dos fatores que integram, exclusivamente, os fenmenos que envolvem elementos
biticos devem ser conservados.
(C) Para manuteno da qualidade de vida de qualquer ser humano necessrio obter um padro de vida que
possibilite acesso pleno s tecnologias.
(D) Qualidade do ambiente a adequao de todos os seus componentes s necessidades humanas, bem como a
preservao dos ecossistemas naturais em geral.
12/41 Processo Seletivo 2016 FACIMED CADERNO TATU

QUESTO 20
Analise a cadeia alimentar hipottica a seguir.

9
4

3
1

Assinale a alternativa que apresenta corretamente as funes trficas dos organismos vivos representados
nessa cadeia.
(A) 6 e 8 consumidores tercirios; 9 onvoro.
(B) 2, 3 e 7 consumidores secundrios.
(C) 1, 2 e 3 consumidores primrios.
(D) 4 e 5 produtores.

QUESTO 21
O bioma Cerrado caracteriza-se, entre outros aspectos, pela presena de lenol fretico profundo, altas
temperaturas devido grande insolao, perodo de seca bem definido e ocorrncia de incndios naturais.
Dentre as diversas espcies vegetais nativas desse bioma, que caracterstica foliar e de razes seriam mais
adequadas para um projeto de reflorestamento exitoso?
(A) Razes fasciculadas e superfcie foliar com cobertura de cera e latifolhada.
(B) Razes profundas e superfcie foliar com cobertura espinhosa.
(C) Razes profundas e superfcie foliar com cobertura de cera.
(D) Razes do tipo axial com profundidade mdia e superfcie foliar coberta de cera.

QUESTO 22
Sobre os transgnicos, marque V para as afirmativas verdadeiras e F para as falsas.
(
(
(
(
(

) A pesquisa e o cultivo de organismos geneticamente modificados so proibidos somente em terras


indgenas e em unidades de conservao.
) Um dos objetivos da pesquisa com transgnicos seria entender os mecanismos moleculares que
controlam a expresso dos genes durante o desenvolvimento fetal e tecido adulto.
) Na produo dos transgnicos, um antibitico utilizado normalmente como um agente de seleo.
) Em uma das etapas de produo de plantas transgnicas, a regio do T-DNA insere-se no genoma da
planta.
) A soja Roundup Ready, resistente ao herbicida glifosato, aguarda liberao para ser utilizada no Brasil.

Assinale a sequncia correta.


(A) F, F, V, F, V
(B) F, V, F, V, F
(C) V, F, F, V, V
(D) V, V, V, V, F

13/41 Processo Seletivo 2016 FACIMED CADERNO TATU

QUESTO 23
A molcula de DNA responsvel pelas caractersticas hereditrias de um indivduo a partir da combinao de
nucleotdeos. Considere a sequncia de DNA hipottica abaixo.
3 TACCTGGTAGGGGTACGCTTCACCCGAGGGATGACTTGCTGCCC 5

(Disponvel em http://essaseoutras.xpg.uol.com.br/tabela-do-codigo-genetico-universal-com-codons-de-rnam-aminoacidos/. Acesso set/2015.)

Com base na transcrio e traduo dessa sequncia, assinale o nmero de aminocidos produzidos por ela.
(A) 14
(B) 12
(C) 11
(D) 15

QUESTO 24
A clula, unidade morfofisiolgica dos sistemas vivos, possui estruturas responsveis pelo processo
metablico celular. Sobre os componentes celulares e suas funes, correto afirmar:
(A) As clulas que sintetizam grandes quantidades de protena apresentam nuclolo bastante reduzido
devido maior presena de ribossomos.
(B) Dois processos so realizados pelos lisossomos: a autlise, que a digesto de estruturas celulares em
desuso para a renovao celular, e a autofagia, que a desintegrao celular.
(C) A membrana plasmtica formada por uma bicamada fosfolipdica onde esto inseridas algumas
protenas. O modelo que descreve sua estrutura recebe o nome de modelo fosfolipdico.
(D) Os peroxissomos produzem a catalase, enzima que transforma a gua oxigenada em gua e oxignio.

14/41 Processo Seletivo 2016 FACIMED CADERNO TATU

QUESTO 25
Um heredograma pode determinar o provvel padro de herana de uma doena. Analise o heredrograma
abaixo.

no afetado
afetado

(Disponvel em www.infoescola.com/genetica/heredograma/exercicios/. Acesso em set/ 2015.)

Com base na anlise desse heredograma, considere:


I - Trata-se de um casamento consanguneo entre os indivduos III-4 e III-5.
II - O indivduo II-2 com certeza heterozigoto para o gene em questo.
III - A doena em questo possui padro de herana autossmica dominante.

Est correto o que se afirma em


(A) I e II, apenas.
(B) I e III, apenas.
(C) II e III, apenas.
(D) I, II e III.

Fsica
QUESTO 26
Na construo de um edifcio, um mestre de obras deseja elevar uma caamba de 1000 kg
de massa com uma talha. Alm de nmero suficiente de polias, uma corda compe a talha,
a qual dever ser puxada por 30 m para erguer a caamba a uma altura de 2 metros. O
equipamento possui uma eficincia de 70%, em funo das foras resistivas e do peso da
corda. Com base no conceito de trabalho e considerando que nenhum operrio poder
realizar fora maior que seu prprio peso, a tarefa poder ser realizada por no mnimo
(A) um operrio.
Considere a massa de cada
(B) dois operrios.
operrio igual a 70 kg.
(C) quatro operrios.
(D) trs operrios.

15/41 Processo Seletivo 2016 FACIMED CADERNO TATU

QUESTO 27
Um eletroscpio um dispositivo que consiste de uma esfera metlica ligada por um condutor a duas lminas
metlicas no interior de um recipiente de vidro (conforme figura).

Eletroscpio descarregado

Eletroscpio carregado

O equipamento, alm de detectar corpos eletricamente carregados, permite avaliar a quantidade de cargas,
de modo que, quanto maior a carga transferida ou induzida, mais afastadas estaro as lminas. Na sequncia
das operaes abaixo, utilizou-se um eletroscpio e duas esferas metlicas idnticas (mesmo material, mesma
massa e mesmo dimetro), porm, no necessariamente com a mesma carga eltrica lquida.
(i)
(ii)
(iii)

Inicialmente o eletroscpio estava descarregado.


Foi posto em contato com a esfera A, que posteriormente foi removida.
Finalmente o eletroscpio foi colocado em contato com a esfera B.
Antes de atingir o estgio final, entre as situaes (ii) e (iii), observou-se que as lminas metlicas
ficaram com uma configurao de eletroscpio descarregado.

(i)

(ii)

(iii)

Aps o terceiro estgio, pode-se afirmar:


(A) As esferas possuem mesmos sinais. A intensidade da carga da esfera B maior que a intensidade da carga
da esfera A.
(B) As esferas possuem cargas de sinais diferentes. A intensidade da carga da esfera A maior que a
intensidade da carga da esfera B.
(C) As esferas possuem mesmos sinais. A intensidade da carga da esfera A maior que a intensidade da carga
da esfera B.
(D) As esferas possuem cargas de sinais diferentes. A intensidade da carga da esfera B maior que a
intensidade da carga da esfera A.

16/41 Processo Seletivo 2016 FACIMED CADERNO TATU

QUESTO 28
Ao se medir a temperatura de uma pessoa com um termmetro de bulbo, necessrio esperar alguns
minutos at que seja atingido o equilbrio trmico entre o termmetro e a pessoa. Um fabricante de
termmetros, ao construir um com o objetivo de reduzir o tempo de espera para o equilbrio trmico, fez as
seguintes modificaes:
I - Utilizou uma substncia termomtrica com menor calor especfico.
II - Utilizou uma quantidade maior de substncia termomtrica.
III - Diminuiu a espessura das paredes do bulbo de vidro que contm a substncia termomtrica.
So modificaes eficazes para o seu objetivo:
(A) II e III, apenas.
(B) I e II, apenas.
(C) I e III, apenas.
(D) I, II e III.

QUESTO 29
Trs esquemas de rbitas de satlites artificiais terrestres foram apresentados para um estudo de sua
colocao em rbita.

(I)

(II)

(III)

Em (I), tem-se uma rbita circular cujo plano forma um ngulo de 70 com o plano do Equador terrestre e
centro coincidente com o centro da Terra; em (II), tem-se uma rbita elptica com um dos focos coincidente
com o centro da Terra e, em (III), tem-se uma rbita elptica paralela ao plano do Equador com distncia
angular 23,5 ao Sul com o eixo da Terra passando por um dos focos da elipse.
Com base nas leis de Kepler, correto concluir que so rbitas permitidas:
(A) I e III, apenas.
(B) II e III, apenas.
(C) I, II e III.
(D) I e II, apenas.

QUESTO 30
Os dispositivos eltricos so planejados de modo a aproveitar eficientemente certos fenmenos e as
propriedades eltricas dos materiais. Em relao a essa temtica, numere a coluna da direita de acordo com a
da esquerda.
1 - Chuveiro eltrico
( ) Poder das pontas
2 - Para-raios
( ) Efeito Joule
3 - Motor eltrico
( ) Gerao de campo magntico por corrente
Marque a sequncia correta.
(A) 1, 2, 3
(B) 2, 1, 3
(C) 2, 3, 1
(D) 3, 2, 1
17/41 Processo Seletivo 2016 FACIMED CADERNO TATU

QUESTO 31
Em sala de aula, uma aluna observou o seguinte esquema de escoamento de gua por trs orifcios em uma
coluna:

Marque a alternativa que apresenta o porqu do maior alcance do jato de gua no nvel marcado por III.
(A) A presso hidrosttica maior.
(B) O orifcio tem maior dimetro que os outros orifcios.
(C) O vaso mais largo.
(D) A fora gravitacional maior.

QUESTO 32
Um objeto real O est colocado sobre o eixo focal de uma lente convergente de modo que a distncia do
objeto ao vrtice igual a 3/2 da distncia focal (f), conforme a figura abaixo.

F1
3f/2

F2

Como deve ser a imagem formada?


(A) Real, menor, direita
(B) Virtual, menor, invertida
(C) Real, maior, invertida
(D) Virtual, maior, direita

18/41 Processo Seletivo 2016 FACIMED CADERNO TATU

Matemtica
QUESTO 33
O Jornal do Carro, veiculado na internet em 30/04/2015, traz uma reportagem informando que a implantao
das novas placas veiculares, com o mesmo padro para todos os pases membros do Mercosul, ocorrer a
partir de 01 de janeiro de 2017. A nova placa ser composta por 4 letras e 3 nmeros, diferente da atual que
composta por 3 trs letras e 4 nmeros. A seguir, so apresentados os modelos atual e novo de placas.
MODELO ATUAL

MODELO NOVO

Admita que as letras utilizadas so as 26 do alfabeto da lngua portuguesa e que os nmeros so os algarismos
0, 1, 2, 3, 4, 5, 6, 7, 8 e 9. Se X representa o nmero total de placas possveis do modelo atual que podem ser
feitas de forma que a primeira letra vogal, as duas letras seguintes so consoantes distintas e que os
nmeros so algarismos distintos, e Y representa o nmero total de placas possveis do modelo novo que
podem ser feitas de forma que a primeira letra e a que est entre os nmeros so consoantes distintas, a
segunda e a terceira letras so vogais e que os nmeros so algarismos distintos, qual o valor de X Y?
(A) 3.240.000
(B) 2.430.000
(C) 3.024.000
(D) 4.320.000
Espao para rascunho

19/41 Processo Seletivo 2016 FACIMED CADERNO TATU

QUESTO 34
Admita que, para calcular o valor do imposto de renda mensal a ser pago por um contribuinte, verifica-se a
faixa da Base de Clculo em que o salrio mensal desse contribuinte se enquadra, calcula-se o percentual do
salrio mensal aplicando-se a alquota correspondente e, do resultado desse clculo, subtrai-se o valor da
Parcela a Deduzir do imposto relativo faixa salarial em que esse salrio mensal se enquadra. O resultado
obtido o valor do Imposto de Renda a ser pago pelo contribuinte. A tabela a seguir apresenta a Base de
Clculo em R$, a Alquota % e a Parcela a Deduzir do imposto em reais.
Base de Clculo em R$
At 1.868,22
De 1.868,23 at 2.799,86
De 2.799,87 at 3.733,19
De 3.733,20 at 4.664,68
Acima de 4.664,68

Alquota %

7,5
15,0
22,5
27,5

Parcela a Deduzir do Imposto em R$


Isento
140,12
350,11
630,10
863,33

A partir dessas informaes, qual ser o valor do Imposto de Renda a ser pago por um contribuinte que tenha
um salrio mensal de R$ 3.500,00?
(A) R$ 350,11
(B) R$ 174,89
(C) R$ 525,00
(D) R$ 253,25
Espao para rascunho

20/41 Processo Seletivo 2016 FACIMED CADERNO TATU

QUESTO 35
A Figura 1 apresenta o prtico de boas vindas cidade de Cacoal e a Figura 2, uma representao da face
frontal da coluna desse prtico.

(Disponvel em www.cacoalnews.com.br. Acesso em 21/09/2015.)

Figura 1
A

3
4

R
B

3
4

Figura 2
Admita que AC e AC so, respectivamente, arcos das semicircunferncias de dimetro AD = 2R e AD = 2R,
que AA = EE = 9(2 2)R/2. Considerando essas informaes e as da Figura 2, a medida da rea da regio
ACCA :
(A) (16 3)R2/4
(B) (3 5)R2/5
(C) (9 )R2/3
(D) (5 2)R2/2
Espao para rascunho

21/41 Processo Seletivo 2016 FACIMED CADERNO TATU

QUESTO 36
Reportagem da revista Veja de 23/09/2015 informa que atualmente a populao de at 14 anos duas vezes
a populao com 60 anos ou mais. A figura a seguir apresenta uma adaptao dos quantitativos dessas
populaes, em milhes de habitantes, em 2000 e em 2015.

Milhes de Habitantes

54
48

15

2000

24

2015

Ano

Populao at 14 anos
Populao com 60 anos ou mais

Se as populaes de at 14 anos e com 60 anos ou mais, respectivamente, decresce e cresce segundo funes
do primeiro grau, em que ano essas populaes sero iguais?
(A) 2030
(B) 2025
(C) 2042
(D) 2039
Espao para rascunho

22/41 Processo Seletivo 2016 FACIMED CADERNO TATU

QUESTO 37
Sejam as circunferncias e , respectivamente, de centro C1 e raio R1 e de centro C2 e raio R2 e admita que
seja a distncia do centro C1 ao centro C2. A coluna da esquerda apresenta posies relativas de duas
circunferncias e da direita, a condio de ocorrncia de cada uma. Numere a coluna da direita de acordo com
a da esquerda.
1234-

Exteriores
Tangentes exteriormente
Concntricas
Coincidentes

(
(
(
(

)
)
)
)

Se, e somente se,


Se, e somente se,
Se, e somente se,
Se, e somente se,

Marque a sequncia correta.


(A) 3, 2, 1, 4
(B) 4, 2, 3, 1
(C) 4, 1, 2, 3
(D) 3, 1, 4, 2
Espao para rascunho

23/41 Processo Seletivo 2016 FACIMED CADERNO TATU

= 0.
> R1 + R2.
= 0 e R1 = R2.
= R1 + R2.

QUESTO 38
O hidrmetro um equipamento instalado em residncias, lojas, indstrias e instituies pblicas para medir
a quantidade de gua consumida. Alm de quantificar o valor da conta de gua, o hidrmetro ajuda a
controlar o consumo.

Disponvel em http://www.daebauru.com.br/2014/extras/extras.php?secao=dicas_solucoes&pagina=38. Acesso em 22/09/2015.)

A figura acima apresenta um modelo de hidrmetro, com partes numeradas de 1 a 4, em que:


1 Registra o consumo em metros cbicos (m3); 1 m3 = 1.000 litros; no exemplo 3.534 m3 consumidos.
2 Registra o consumo a cada 100 litros e 10 litros; no exemplo 550 litros consumidos.
3 Cada volta completa desse ponteiro registra o consumo de 1 litro.
4 Cada volta completa desse ponteiro registra o consumo de 10 litros.
O consumo cobrado em uma conta de gua sempre o resultado da diferena entre a ltima leitura (leitura
atual) e a penltima leitura (leitura anterior). Em um determinado ms, as leituras anterior e atual de uma
residncia so respectivamente:
2 7 5 4 0 0
Leitura anterior

2 7 7 2 6 4
Leitura atual

A partir das informaes, marque V para as afirmativas verdadeiras e F para as falsas.


( ) Nesse determinado ms, o consumo de gua, em litros, nessa residncia, 18.640.
( ) Para o consumo de gua nessa residncia, nesse determinado ms, o nmero de voltas completas do
ponteiro 4 do hidrmetro dessa residncia um nmero mltiplo de 3.
( ) Para que o consumo de gua dessa residncia, nesse determinado ms, fosse 20 m 3, o ponteiro 3 do
hidrmetro dessa residncia deveria dar 1.360 voltas completas a mais.
Assinale a sequncia correta.
(A) V, V, F
(B) F, V, V
(C) V, F, V
(D) F, F, F
Espao para rascunho

24/41 Processo Seletivo 2016 FACIMED CADERNO TATU

QUESTO 39
A figura a seguir apresenta quatro cubos em que as medidas das arestas so x1, x2, x3 e x4 e as medidas dos
volumes so, respectivamente, V1, V2, V3 e V4.
V4
V3
V2
V1

x1

x2

x3

x4

Sabendo-se que x1 = 1 e x4 = 2, e que x1, x2, x3 e x4 esto em progresso geomtrica, qual o valor de
log ( 2
)?
(A) 6
(B) 1
(C) 2
(D) 9
Espao para rascunho

25/41 Processo Seletivo 2016 FACIMED CADERNO TATU

QUESTO 40
Em meio a tantos altos e baixos no preo do combustvel, o que mais preocupa o consumidor so os trs
primeiros dgitos no preo exemplo 1,69. Mas, muitas vezes escondido e at esquecido, o terceiro digito
aps a vrgula faz diferena no bolso do consumidor e, principalmente, para os lucros do dono do posto de
combustvel. A terceira casa decimal prtica comum em muitos postos de combustveis do pas e,
geralmente, apresentada como na placa promocional a seguir:

PROMOO
ETANOL COMUM

Dado: Considere que 1 ms tenha 4 semanas.

1,699
Admita que o posto que exponha tal placa promocional possua 3.000 clientes que abastecem seus veculos,
semanalmente, com 40 litros de etanol cada. A partir dessas informaes, com esse nmero de clientes que
abastece semanalmente nesse posto, quantos frentistas que recebem salrio R$ 1.080,00 mensais sero
pagos, ao final de um ms, com a diferena cobrada de R$ 1,699 em vez de R$ 1,69?
(A) 4
(B) 2
(C) 6
(D) 3
Espao para rascunho

26/41 Processo Seletivo 2016 FACIMED CADERNO TATU

QUESTO 41
Muitos fenmenos fsicos e sociais de comportamento cclico podem ser modelados com auxlio de funes
trigonomtricas, da a enorme aplicao dessas funes em campos da cincia como acstica, astronomia,
economia, engenharia, medicina etc. A funo seno, por exemplo, uma funo trigonomtrica que pode ser
escrita, de maneira generalizada, como y = a + bsen (cx + d), em que cada parmetro a, b, c e d, que pertence
aos nmeros reais, provoca alterao no valor da funo (y) e, consequentemente, no grfico. O parmetro a
modifica a imagem da funo, podendo deslocar o grfico da mesma para cima ou para baixo; o parmetro b
modifica a imagem e a amplitude da funo; o parmetro c modifica o perodo da funo; e o parmetro d
pode fazer o grfico da funo deslocar para a esquerda ou para a direita. A Figura I ilustra o esboo do grfico
da funo seno quando a = 0, b = 1, c = 1 e d = 0, ou seja, y = sen x, em que x [0, 2].
y
1

Figura I
2

-1

y
6

Figura II

Para que a funo y = a + bsen (cx + d) tenha o esboo do grfico como o apresentado na Figura II, quais so,
respectivamente, os valores de a, b, c e d?
(A) 3, 3, 0, 2
(B) 2, 1, 3, 0
(C) 1, 3, 2, 1
(D) 3, 3, 2, 0
Espao para rascunho

27/41 Processo Seletivo 2016 FACIMED CADERNO TATU

QUESTO 42
A figura abaixo apresenta os resultados dos exames de glicemia de jejum de um determinado paciente
relativos aos meses de janeiro/2015 a julho/2015.

Glicemia em jejum
115
111
109

Valores em mg/dL

110
105

103

101

100
100

98

97

95
90

janeiro fevereiro

maro

abril

maio

junho

julho

2015

Valores recomendados pela Associao Americana de Diabetes (ADA)


Normal: 70 a 99 mg/dL
Glicemia de jejum alterada: 100 a 125 mg/dL
Diabetes Mellitus: Glicemia de jejum maior que ou igual a 126 mg/dL em dois exames

A partir dessas informaes, marque V para as afirmativas verdadeiras e F para as falsas.


(
(
(

) A mediana dos resultados dos exames relativos aos meses de janeiro a julho 98.
) Nesse perodo, a glicemia de jejum desse paciente estava alterada em mais de 70% dos resultados dos
exames realizados.
) A mdia aritmtica dos resultados dos exames nos meses de fevereiro, maro, abril e julho igual ao
extremo superior do intervalo em que a glicemia de jejum normal.

Marque a sequncia correta.


(A) F, F, V
(B) V, F, F
(C) V, V, F
(D) F, V, V
Espao para rascunho

28/41 Processo Seletivo 2016 FACIMED CADERNO TATU

Qumica
QUESTO 43
A coluna da esquerda apresenta modelos atmicos e a da direita, contribuies suscitadas por eles. Numere a
coluna da direita de acordo com a da esquerda.
1234-

Modelo atmico de Dalton


Modelo atmico de Rutherford
Modelo atmico de Bohr
Modelo atmico de Sommerfield

(
(
(
(

)
)
)
)

Ncleo atmico denso com carga positiva.


tomos macios e indivisveis.
Nveis de energia divididos em subnveis de energia.
Eltrons em rbitas circulares de energia quantizada.

Marque a sequncia correta.


(A) 1, 2, 3, 4
(B) 2, 1, 4, 3
(C) 3, 4, 1, 2
(D) 4, 3, 2, 1

QUESTO 44
O estado fsico no qual uma substncia se apresenta depende de suas condies de presso e temperatura.
Desta forma, para cada substncia dizemos que h pares de valores dessas duas variveis que correspondem
fase slida, fase lquida e fase gasosa.
(Disponvel em www.mundoeducacao.com/fisica/diagrama-fases.htm. Acesso em 01/10/2015. Adaptado.)

Considere o diagrama de fase do dixido de carbono (CO2) esquematizado na figura.


B

7,3

Presso, atm

Lquido

Slido

A
O

5,1

Gs
1
56,6

78,2

Temperatura, C

Com base nesse diagrama correto afirmar:


(A) presso de 1 atm e 25C, o CO2 slido se sublima.
(B) O ponto A representa um sistema monofsico.
(C) presso de 1,5 atm e 50C, o CO2 um slido.
(D) A liquefao do CO2 se d ao longo da linha OC.

29/41 Processo Seletivo 2016 FACIMED CADERNO TATU

31,1

QUESTO 45
A temperatura de ebulio de hidrocarbonetos (compostos contendo somente carbono e hidrognio) varia
com o nmero de tomos de carbono presentes na molcula. A temperatura de ebulio de um composto a
temperatura na qual um sistema lquido passa para a fase gasosa, que tem uma relao direta com as foras
entre as molculas constituintes do lquido. Pode-se ver na figura abaixo que a temperatura de ebulio dos
alcanos varia linearmente com o nmero de tomos de carbono.

O nico fator diferenciador entre uma molcula e outra a quantidade de tomos de carbono presentes.
Entretanto, estas molculas possuem um comportamento macroscpico completamente diferente. CH 4 um
gs temperatura ambiente e C8H18 um lquido. Esta e outras caractersticas esto intimamente
relacionadas com a natureza das interaes existentes entre as molculas.
(ROCHA, W. R. Interaes Intermoleculares. Qumica Nova na Escola, n 4, maio, 2001. Adaptado.)

A fora existente entre as molculas desses hidrocarbonetos so interaes denominadas


(A) dipolo induzido dipolo induzido.
(B) on dipolo.
(C) dipolo permanente dipolo induzido.
(D) dipolo-dipolo.

QUESTO 46
Cientistas alemes e americanos fabricaram um tipo especial de clula solar que faz a converso direta da luz
solar em hidrognio com uma eficincia de 14%, o que muito prximo da eficincia das clulas solares que
convertem a luz do Sol em eletricidade. Essa converso direta tem inmeras vantagens porque o hidrognio
pode ser armazenado, eliminando a inconstncia da energia solar, e utilizado quando necessrio em uma
ampla gama de finalidades, inclusive em clulas a combustvel nas quais pode produzir eletricidade sem gerar
poluentes.
(Disponvel em www.inovacaotecnologica.com.br/noticias. Acesso em 30/09/2015.)

O hidrognio o elemento mais abundante do universo. Estima-se que 92% do universo seja composto de
hidrognio. No entanto existe muito pouco hidrognio livre na atmosfera terrestre, por se tratar de um gs
muito leve e mover-se com elevadas velocidades o campo gravitacional da terra no consegue segur-lo.
encontrado nos minerais, oceanos, combustveis fsseis e em tudo que vivo.
(Disponvel em http://brunoquimico.blogspot.com.br/2010/12/hidrogenio-e-os-hidretos.html. Acesso em 05/10/2015. Adaptado.)

O tomo de hidrognio pode alcanar estabilidade


(A) fazendo ligaes de hidrognio com F, O e N, as chamadas pontes de hidrognio.
(B) perdendo um eltron para formar H+.
(C) fazendo ligaes coordenadas com outros tomos.
(D) perdendo um eltron para formar H.
30/41 Processo Seletivo 2016 FACIMED CADERNO TATU

QUESTO 47
O clcio o mineral mais abundante no corpo humano e perfaz at 1,9% do peso corporal. Quase todo ele
(99%) est presente no esqueleto. O restante est nos dentes (0,6%), nos tecidos moles (0,6%), no plasma
(0,03%) e no fluido extracelular (0,06%). O clcio fornece um "papel estrutural" proporcionando rigidez
(estrutura e resistncia) ao esqueleto.
(Disponvel em: http://www.moh.gov.my/images/gallery/rni/14_chat.pdf. Acesso em 05/10/2015. )

Na reao do clcio com o gs oxignio, dada pela equao no balanceada Ca(s) + O2(g) CaO(s), se 12 g de
oxignio forem adicionados a 40 g de clcio, aps a reao, verificar-se-
Dadas as massas atmicas:
(A) excesso de 4 g de O2 e consumo total da massa de Ca colocada.
Ca = 40, O = 16
(B) consumo total das massas de Ca e O2 colocadas.
(C) formao de 42 g de CaO, havendo excesso de 10 g de Ca.
(D) formao de 49 g de CaO, havendo excesso de 5 g de Ca.

QUESTO 48
Um combustvel industrial sinttico importante, de fcil obteno e que gera grande quantidade de energia,
chama-se gs dgua. Este uma mistura de monxido de carbono (CO) e gs hidrognio (H 2), obtido
passando gua no estado vapor em carvo aquecido ao rubro de acordo com a seguinte equao:
C(s) + H2O(g) CO(g) + H2(g)
A partir dessas informaes e da tabela abaixo, qual quantidade de calor envolvida, em kJ, na reao de 99 g
de carvo?
Dadas as massas atmicas:
Composto H0298 (kJ.mol-1)
H = 1, C = 12, O = 16
CO(g)
110
H2O(g)
240
(A) 107,25
(B) 87,00
(C) 1.072,50
(D) 2.887,50

QUESTO 49
A gua oxigenada, produto de uso corrente e de fcil acesso no nosso dia a dia, dado que de venda livre em
farmcias, supermercados etc., no mais do que uma soluo aquosa diluda de perxido de hidrognio. O
perxido de hidrognio decompe-se facilmente produzindo gua (no estado lquido) e oxignio (no estado
gasoso), libertando calor, de acordo com a seguinte equao qumica:
2 H2O2(aq) 2 H2O (l) + O2(g)
A velocidade de decomposio depende da temperatura, da concentrao do perxido, da presena da luz, do
valor de pH e da presena de impurezas e/ou estabilizantes.
(Disponvel em www.videos.uevora.pt/quimicaparatodos/. Acesso em 04/10/2015. Adaptado.)

Em determinadas condies experimentais, a velocidade de decomposio do perxido pode ser medida


como igual a 0,2 mol por minuto. A massa de oxignio, em gramas, produzida em 30 segundos dessa
decomposio :
(A) 1,6
(B) 3,2
(C) 2,3
(D) 6,0
31/41 Processo Seletivo 2016 FACIMED CADERNO TATU

QUESTO 50
A tirosina um aminocido no essencial, importante para a formao da estrutura de todas as protenas e
utilizada na sntese da adrenalina, neurotransmissor do corpo humano. A tirosina serve para ajudar a
regenerar as clulas do sangue e as defesas do organismo. tambm importante para combater a depresso,
ansiedade e distrbios do sono tendo a capacidade de alterar o estado de humor das pessoas. A tirosina
encontrada em diversos alimentos (o leite rico em tirosina). Sua frmula estrutural representada como:

Sobre esse composto orgnico, analise as afirmativas.


III III IV -

um composto aromtico polinuclear, somente com ligaes sp2 e sp3.


Tem frmula molecular C9H11NO3 apresentando 3 insaturaes em sua cadeia carbnica.
um composto orgnico de funo mista: fenol, cido carboxlico e amina.
Apresenta apenas um tomo de carbono quaternrio na sua estrutura.

Est correto o que se afirma em


(A) I, III e IV, apenas.
(B) I, II, III e IV.
(C) I e IV, apenas.
(D) II e III, apenas.

CINCIAS HUMANAS
Histria
QUESTO 51
uma ideia grandiosa pretender formar de todo o mundo novo uma s nao com um s vnculo que ligue
suas partes entre si e com o todo. J que tem uma origem, uma lngua, um costume e uma religio, deveria
por conseguinte ter um s governo que confederasse os diferentes Estados que se formaram; mas isso
impossvel porque climas remotos, situaes diversas, interesses opostos, caractersticas diversas, dividem a
Amrica.
(BOLVAR, S. Carta da Jamaica. Disponvel em www.elaleph.com. Acesso em 28/09/2015.)

Tomando por base o trecho da Carta da Jamaica, correto afirmar que o projeto poltico de Simon Bolvar
para a Amrica Espanhola independente era:
(A) A unidade religiosa sob a gide de Roma.
(B) A integrao dos Estados americanos independentes em uma nica nao.
(C) A manuteno da diversidade cultural latino-americana.
(D) O estabelecimento de uma confederao de estados independentes.

32/41 Processo Seletivo 2016 FACIMED CADERNO TATU

QUESTO 52
Era um sonho dantesco... o tombadilho
Que das luzernas avermelha o brilho.
Em sangue a se banhar.
Tinir de ferros... estalar de aoite...
Legies de homens negros como a noite,
Horrendos a danar...
Negras mulheres, suspendendo s tetas
Magras crianas, cujas bocas pretas
Rega o sangue das mes:
Outras moas, mas nuas e espantadas,
No turbilho de espectros arrastadas,
Em nsia e mgoa vs!
E ri-se a orquestra irnica, estridente...
E da ronda fantstica a serpente
Faz doudas espirais ...
Se o velho arqueja, se no cho resvala,
Ouvem-se gritos... o chicote estala.
E voam mais e mais...
Presa nos elos de uma s cadeia,
A multido faminta cambaleia,
E chora e dana ali!
Um de raiva delira, outro enlouquece,
Outro, que martrios embrutece,
Cantando, geme e ri!
No entanto o capito manda a manobra,
E aps fitando o cu que se desdobra,
To puro sobre o mar,
Diz do fumo entre os densos nevoeiros:
"Vibrai rijo o chicote, marinheiros!
Fazei-os mais danar!..."
E ri-se a orquestra irnica, estridente...
E da ronda fantstica a serpente
Faz doudas espirais...
Qual um sonho dantesco as sombras voam!...
Gritos, ais, maldies, preces ressoam!
E ri-se Satans!...
(Disponvel em http://www.dominiopublico.gov.br/download/texto/bv000068.pdf. Acesso em 27/09/2015.)

O poema de Castro Alves retrata um fenmeno marcante da sociedade brasileira no perodo colonial e
imperial. A anlise do texto acima permite afirmar que se trata de qual fenmeno?
(A) Violncia contra a mulher
(B) Genocdio das populaes amerndias
(C) Trfico negreiro
(D) Dana como manifestao cultural dominante do Brasil
33/41 Processo Seletivo 2016 FACIMED CADERNO TATU

QUESTO 53
A pintura de ictor Meirelles de Lima intitulada A primeira missa no Brasil (18 0) representa um dos
aspectos mais importantes do processo de conquista da Amrica Portuguesa.

(Disponvel em www.google.com.br/search?q=primeira+missa+no+brasil. Acesso em 27/09/2015.)

A partir da anlise do quadro, assinale a afirmativa correta.


(A) A evangelizao dos indgenas foi uma iniciativa tanto da Igreja quanto da Coroa.
(B) As populaes pr-cabralinas tiveram seus direitos terra preservados por interveno do clero.
(C) As ordens religiosas tiveram pequena participao na converso da populao nativa.
(D) Os agentes da monarquia lusa, em contnuo confronto com o clero, incentivaram as misses protestantes.

QUESTO 54
5 Tese
O papa no quer e no pode dispensar de outras penas alm das que imps ao seu alvitre ou nem acordo com
os cnones, que so estatutos papais.
6 Tese
O papa no pode perdoar dvida, seno declarar e confirmar aquilo que j foi perdoado por Deus, ou ento o
faz nos casos que lhe foram reservados. Nestes casos, se desprezados, a dvida em absoluto deixaria de ser
anulada ou perdoada.
22 Tese
Com efeito, o papa nenhuma pena dispensa s almas do purgatrio das que, segundo os cnones da igreja,
deviam ter expiado e pago na presente vida.
24 Tese
Logo, a maioria do povo ludibriado com as pomposas promessas do indistinto perdo, impressionando-se o
homem singelo com as penas pagas.
(Disponvel em www.culturabrasil.org/zip/95teses.pdf. Acesso em 28/09/2015.)

O texto acima apresenta 4 teses retiradas das 95 elaboradas por Martinho Lutero para criticar a Igreja
Catlica. Qual vcio do Papado criticado no texto acima?
(A) Abandono da castidade pelo clero
(B) No cumprimento do voto de pobreza
(C) Venda de cargos eclesisticos
(D) Venda de indulgncias
34/41 Processo Seletivo 2016 FACIMED CADERNO TATU

QUESTO 55
Analise a charge.

(Disponvel em https://www.google.com.br/search?q=charges+segunda+guerra+mundial. Acesso em 07/10/2015.)

A imagem faz referncia a um importante episdio da Segunda Guerra Mundial. Que episdio esse?
(A) A invaso da Frana pelo exrcito nazista.
(B) O ataque japons a Pearl Harbor.
(C) A ofensiva aliada aps o dia D.
(D) A vitria dos Aliados na batalha da Inglaterra.

Geografia
QUESTO 56
A figura abaixo apresenta algumas formas de relevo, numeradas de 1 a 4.

(Disponvel em http://adrianagalves.blogspot.com.br/2011/03/brasil-regioes-relevo-e-rios.html. Acesso em 15/09/2015.)

Assinale a alternativa que identifica corretamente cada uma das formas de relevo numeradas.
(A) 1 - planalto; 2 - montanha; 3 - depresso; 4 - plancie.
(B) 1 - plancie; 2 - montanha; 3 - depresso; 4 - planalto.
(C) 1 - plancie 2 - planalto; 3 - depresso; 4 - montanha.
(D) 1 - plancie 2 - montanha; 3 - planalto; 4 - depresses.
35/41 Processo Seletivo 2016 FACIMED CADERNO TATU

QUESTO 57
A figura representa o fenmeno climtico denominado ilha de calor.

(Disponvel em http://escolaeducacao.com.br/. Acesso em 10/09/2015.)

Sobre aspectos do fenmeno ilha de calor, analise as afirmativas.


I - Ocorre principalmente em cidades com elevado grau de urbanizao.
II - Pode ser percebida nos perodos diurno e noturno por meio da diferena de temperatura entre reas
rurais e urbanas.
III - Ocorre em locais com intensa presena de vias no pavimentadas e de reas verdes.
IV - Pode ser amenizada com a implantao de ilhas de frescor, a exemplo de parques e bosques.
Est correto o que se afirma em
(A) I, II e IV.
(B) I, II e III.
(C) II, III e IV.
(D) I, III e IV.

QUESTO 58
O Sistema Nacional de Unidades de Conservao (SNUC) foi criado no ano de 2000 com o intuito de regular a
criao e o uso das unidades de conservao no Brasil. O SNUC o conjunto de unidades de conservao (UC)
federais, estaduais e municipais. composto por 12 categorias de UC, cujos objetivos especficos se
diferenciam quanto forma de proteo e usos permitidos: aquelas que precisam de maiores cuidados, pela
sua fragilidade e particularidades, e aquelas que podem ser utilizadas de forma sustentvel e conservadas ao
mesmo tempo.
(Fonte: MMA, 2015.)

Leia atentamente os textos:


Texto I
O objetivo bsico preservar a natureza, sendo admitido apenas o uso indireto dos seus recursos naturais,
com exceo dos casos previstos pela Lei do SNUC (Lei n 9.985, de 18 de julho de 2000).
Texto II
O objetivo bsico compatibilizar a conservao da natureza com o uso sustentvel de parcela dos seus
recursos naturais (Lei n 9.985, de 18 de julho de 2000).
Os textos I e II se referem, respectivamente, a que tipo de unidades de conservao?
(A) rea de preservao permanente e proteo integral.
(B) Uso sustentvel e proteo integral.
(C) rea de preservao permanente e uso sustentvel.
(D) Proteo integral e uso sustentvel.
36/41 Processo Seletivo 2016 FACIMED CADERNO TATU

QUESTO 59
Leia a letra da msica Sob o mesmo cu, de Lenine e Lula Queiroga (2000).
Brasil,
Com quantos Brasis se faz um Brasil?
Com quantos Brasis se faz um pas chamado Brasil?
Sob o mesmo cu
Cada cidade uma aldeia, uma pessoa,
Um sonho, uma nao.
Sob o mesmo cu,
Meu corao no tem fronteiras,
Nem relgio, nem bandeira,
S o ritmo de uma cano maior.
A gente vem do tambor do ndio,
A gente vem de Portugal,
Vem do batuque negro
A gente vem do interior e da capital,
A gente vem do fundo da floresta,
Da selva urbana dos arranha-cus,
A gente vem do pampa, do cerrado,
Vem da megalpole, vem do Pantanal,
A gente vem de trem, vem de galope,
De navio, de avio, motocicleta,
A gente vem a nado
A gente vem do samba, do forr,
A gente vem do futuro conhecer nosso passado.
A gente vem do rap e da favela,
A gente vem do centro e da periferia,
A gente vem da mar, da palafita,
Vem dos Orixs da Bahia,
A gente traz um desejo de alegria e de paz,
E digo mais:
A gente tem a honra de estar ao seu lado
A gente veio do futuro conhecer nosso passado.
Essa letra de musica foi uma homenagem aos 500 anos do Descobrimento do Brasil pelos portugueses. A
leitura atenta permite afirmar que a intencionalidade dos autores expressar
(A) as guerras travadas pela manuteno do territrio.
(B) a diversidade socioambiental do pas.
(C) os fluxos de imigrantes dos pases vizinhos.
(D) os processos de migrao pendular e migrao de retorno.

37/41 Processo Seletivo 2016 FACIMED CADERNO TATU

QUESTO 60
As rvores constantes da lista abaixo representam espcies de biomas brasileiros.

Essas espcies so sugeridas para aes no intuito de promover sustentabilidade e recomendadas para
arborizao do espao urbano. Tais aes promovem melhoria da qualidade de vida, em funo da
possibilidade de ocorrer
(A) controle de zoonoses.
(B) formao de ilhas de calor.
(C) mitigao das mudanas climticas.
(D) formao da base do aterro sanitrio.

38/41 Processo Seletivo 2016 FACIMED CADERNO TATU

PROVA DE REDAO
Quando discutimos o fato corrupo, entram em cena polticos e empresrios, das mais variadas esferas,
enriquecendo com dinheiro que deveria ser aplicado em benfeitorias para a populao em geral. Os prejuzos que a
corrupo causa sociedade e ao pas so enormes, minam as oportunidades de crescimento. Mas a corrupo no
unicamente o ato de roubar dinheiro pblico restrito aos polticos e empresrios. Est tambm nos pequenos atos
do dia a dia. Leia os textos de apoio abaixo.
Em pleno centro de So Paulo, a maior cidade do pas, possvel comprar diplomas falsos que permitem a
participao em concursos pblicos e, mais comum ainda, atestados mdicos, para justificar ausncias mais
prolongadas no trabalho. Tambm possvel, sem nem mesmo sair de casa, roubar o sinal da T a cabo do
vizinho, sem que ele saiba, ou comprar um aparelho decodificador de sinal pela prpria internet e us-lo para
sempre sem ter que pagar mensalidade s operadoras, que, afinal, cobram muito caro.
[...]
Na ltima semana, um cartaz colado em um muro de uma grande avenida de So Paulo perguntava aos
passantes: Habilitao suspensa?. O anncio [...] trazia um nmero de telefone e oferecia um servio: dar
um jeitinho nos pontos obtidos na carteira de motoristas que tiveram suas licenas para dirigir retiradas por
causa do excesso de multas recebidas no trnsito.
(Disponvel em http://brasil.elpais.com/brasil/2013/12/04/sociedad. Acesso em 10/09/2015.)

(Disponvel em www.google.com.br/search?q=pequenos+atos+de+corrupo. Acesso em 20/09/2015.)

PROPOSTA
A partir dos textos de apoio, de sua reflexo e dos conhecimentos
adquiridos ao longo de sua formao, produza um texto dissertativoargumentativo sobre a temtica:
A prtica cotidiana de pequenos atos de

corrupo: como acabar com esse problema?


Sua redao deve apresentar coeso, coerncia, obedincia s normas da
escrita culta e seus argumentos ou sugestes de interveno no podem
ferir os direitos humanos.
ATENO: No assine seu texto nem faa qualquer marcao que possibilite sua identificao.

39/41 Processo Seletivo 2016 FACIMED CADERNO TATU

PGINA DE RASCUNHO
01
02
03
04
05
06
07
08
09
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30

40/41 Processo Seletivo 2016 FACIMED CADERNO TATU

Processo Seletivo 2016


Medicina

Nome:__________________________________________________________________

01

21

41

02

22

42

03

23

43

04

24

44

05

25

45

06

26

46

07

27

47

08

28

48

09

29

49

10

30

50

11

31

51

12

32

52

13

33

53

14

34

54

15

35

55

16

36

56

17

37

57

18

38

58

19

39

59

20

40

60

41/41 Processo Seletivo 2016 FACIMED CADERNO TATU

Esta folha destinada para uso EXCLUSIVO do candidato.

FOLHA DE ANOTAO DO CANDIDATO