ÍNDICE

Prefácio 2

Resumo 3

Abbreviations 4

Artigo- "X1 is expressed in hematopoietic sites" 5

Agradecimentos 17

Annex I: PROTOCOLS 18

Annex II: SEQUENCES OF THE SELECTED CLONES 26

Preparation of manuscripts 29

1
 PREFÁCIO

O presente relatório reporta o trabalho desenvolvido durante o Estágio Profissionalizante do Aluno

Alexandre José Correia Gonçalves, que decorreu entre Agosto de 2001 e Janeiro de 2003, no

laboratório GIE Organogénese do Instituto Gulbenkian de Ciência sob orientação do Doutor Joaquín

María Rodríguez Léon.

Este trabalho consistiu na pesquisa de genes envolvidos na organogénese de Gallus gallus. A

pesquisa realizou-se mediante o screening de uma biblioteca de DNA codificante de embrião total de

galinha de estádios 5 a 10 HH. A partir dos clones da biblioteca sintetizaram-se ribosondas que foram

usadas para a realização de hibridações in situ em embriões inteiros. Seleccionaram-se os clones que

apresentavam um padrão de expressão regionalizado para a sua sequenciação e posterior estudo. X1 foi

o principal objecto de estudo deste Estágio. Procedeu-se à sua identificação, ao estudo pormenorizado

do seu padrão de expressão e ainda ao estudo da sua regulação.

As técnicas utilizadas na realização deste trabalho foram: extracção, catalogação e fixação de

embriões de galinha, inclusão e cortes histológicos, transformação de bacterias com vectores virais,

extracção e purificação de plasmídeos, síntese de ribosondas, hibridação in situ in toto, PCR

(polymerase chain reaction), ligação, subclonagem, sequenciação, estudos informáticos das

sequências, culturas de New, implantação de microesferas in ovo e em cultura, estudos fenotípicos e

obtenção de registros fotográficos.

Este trabalho encontra-se descrito no presente relatório sob o formato de artigo da revista

Development (ver regras editoriais em anexo) e intitula-se "X1 is expressed in hematopoietic sites".

2
 RESUMO

Durante os últimos anos, grandes avanços foram feitos no âmbito do desenvolvimento de Células

Estaminais. Contudo, os sinais e vias de sinalização envolvidos na manutenção do seu estado

indiferenciado encontram-se ainda pouco esclarecidos. Neste trabalho descrevemos a expressão

embrionária de um clone contendo as sequências de bbc-1 e um retrotranposão de ave em galinha. Este

clone foi isolado através de um screening de uma biblioteca de DNA codificante de embrião total de

galinha de estádios 5 a 10 HH, mediante hibridação in situ in toto de embriões de galinha de estádios 2

a 34 HH. A expressão do clone é detectada em áreas e tecidos onde ocorre hematopoiese. Em estado de

gástrula, a expressão encontra-se na area pellucida no seu limite com a area opaca. Quando se inicia a

formação do coração, a expressão é detectada no futuro sinus venosus, região onde se mantém até

estádio 23. Do estádio 12 em diante, a expressão encontra-se na endoderme e na esplancnopleura, bem

como no lábio dorsomediano do dermomiótomo. São detectados transcritos do clone no núcleo das

ilhas sanguíneas, aquando da sua formação. A expressão é mantida do estádio 15 em diante, nos

precursores e na própria alantóide. Outros sítios onde ocorre hematopoiese são o fígado e os

mesonefros, regiões onde o clone também é expresso. Em estádios avançados de desenvolvimento,

quando os membros estão quase formados, X1 é detectado nas articulações dos membros. Procedeu-se

também a estudos de sobreexpressão de FGF, BMP e Noggin no sentido de testar a influência dessas

proteínas na expressão do clone. Não se observaram alterações após os tratamentos, o que sugere que a

expressão de X1 é independente destas vias de sinalização.

3
ABBREVIATIONS

AGM – aorta-gonad-mesonephros-region
AO – area opaca
AP – area pellucida
ART – Avian Retrotransposon
BBC1 – Breast basic conserved 1
BI – blood islands
BMP – bone morphogenetic protein
DML – dorsal medial lip
EC – endothelial cells
EGF – endothelial growth factor
ESC – embryonic stem cells
EYS – extra embryonic yolk sac
FGF – fibroblast growth factor
bFGF – basic fibroblast growth factor
FYS – fetal yolk sac
GSM – germline stem cells
HC – hematopoietic stem cells
HSC – hematopoietic stem cells
ICM – inner cell mass
KS – Koller’s Sickle
LT-HCS – long term hematopoietic stem cells
MMP – multipotent progenitors
PAS – para-aortic splanchnopleura
SC – stem cells
SSC – somatic stem cells
ST-HCS – short term hematopoietic stem cells
TGF - transforming growth factor
VEGF – vascular endothelial growth factor
WNT – wingless integrated

4
X1 is expressed in hematopoietic sites
A.J. Gonçalves1,2, S. Thorsteinsdottir1,3
1
Instituto Gulbenkian de Ciência. Rua da Quinta Grande nº6, Oeiras 2781-901, Portugal.
2
Department of Animal Biology, Faculty of Sciences, University of Lisbon, Lisbon, Portugal
3
Department of Animal Biology and Centre for Environmental Biology, Faculty of Sciences, University of Lisbon,
Lisbon, Portugal
SUMMARY
Major advances in stem cell development have been
obtained during last years. However, the signals and
molecular pathways involved in the maintenance of
their undifferentiated state remains elusive. Here we
describe the embryonic expression of a clone
containing the sequences for bbc 1 and an avian
retrotransposon. We have isolated this clone by
screening a cDNA library from stage 5 to 10 HH
chicken embryos. The expression of the clone is
mainly detected in the areas and tissues where
hematopoiesis is taking place. At gastrulation stages,
the expression is found in the area pellucida, in its
limit with the area opaca. When heart begins to form,
expression is observed in the future sinus venosus,
region where the expression is maintained until stage
23. From stage 12 onwards, expression is also
detected in the endodermal tissues and
INTRODUCTION
The outstanding ability of an early embryo to diversify
and adult cells to regenerate is just one of the many
astonishing features of stem cells (SC). SC have both the
capacity to pursue one of the several differentiation
programs, by embarking on specific molecular pathways,
or just to self-renew and maintain their own cell line.
Through embryogenesis, a multicellular organism
develops from a single fertilised oocyte. But how early
cells abandon a basic organisation level and assume
different organ-specific cell fates is yet far from being
fully understood.
One of the main characteristics of SC is the capacity
to constantly undergo asymmetric divisions. Each time a
SC divides, two cells are formed. One of them reaches a
more specialised state and the other is a copy of the
mother SC, hence, assuring the cell line. Due to this
characteristic, asymmetric cell division is responsible for
the SC lineage continuity and also for later
diversification. A purely functional point of view defines
and J. Rodriguez-Leon1.
splanchnopleura as well as in the dorsomedial lip in
the dermomyotome. Transcripts are detected from
stage 10 onwards in the core of blood islands when
they begin to form. Expression is seen by stage 15
onwards in the precursors of the allantois and then in
the allantois proper. Other places where
hematopoiesis takes place, the liver and mesonephros,
are also regions where the clone is expressed. At
advanced stages of development, when the limbs are
almost formed, X1 is detected in the joints within the
appendages. We also performed overexpression
studies with FGF, BMP and Noggin in order to assess
the influence of these proteins in the expression of
the clone. No alterations were observed after the
treatments which suggests that X1 expression is
independence of this signaling pathways.
Keywords: Hematopoiesis, chick embryo, stem cells,
BMP, FGF, Noggin.
SC as units responsible for the development and
regeneration of tissues and organs (Weissman, 2000).
The totipotency of SC is first seen in the cells of the
inner cell mass (ICM) of the embryo. Those cells may
give rise to different SC types such as germline stem
cells (GSM) and somatic stem cells (SSC). Evidence that
substantiate the idea of ICM as precursors of all cell
lineages was obtained after experiments with mammalian
blastocysts. Mouse blastocysts ICM were subjected to
specific tissue culture conditions in order to maintain a
pluripotent lineage of embryonic stem cells (ESC)
indefinitely (Thomson et al., 1998). ESC injected into a
host blastocyst may give rise to all kinds of tissues in the
resultant offspring (Nichols, et al.,1998; Niwa, et al.,
1998). Furthermore, experiments with myelin-deficient
mice have shown the overwhelming therapeutic
possibilities of ESC (McDonald et al., 1999). In these
animals, ESC were able to partially restore the damaged
spinal chord when transplanted to a host mouse. Another
important clinical application was foreseen when ESC
coaxed to become glial cells were transplanted into the
5
brain of myelin-deficient rats, resulting in the formation
of myelin sheaths around host axons (Brustle et al.,
1999). This kind of experiments has showed how plastic
and totipotent ESC are and how their inherent
characteristics can be applied for therapeutic purposes.
Under a complex and specific environment,
embryonic cells may generate and maintain different SC
types. But it is not well known what happens in the
tissues of an adult organism. Adult tissues also show an
enormous plasticity under several circumstances such as
damage repair, renewal or cell differentiation
(Weissman, 2000). Adult stem cells constitute an
enormous intranet of SC types. A huge coordination is
required to accomplish a perfect homeostatic and
physiological equilibrium between the different types of
SC such as epithelial stem cells, multipotent neural stem
cells, hematopoietic stem cells and many other cell-type
precursors. The integrity of adult tissues such as
epidermis, hair, intestine, liver and the hematopoietic
system, is assured by SSC residing in those tissues
(Shizuru and Weissman, 1998). SSC exist in a quiescent
state, rather than in a mitotically active state. Evidence
for a quiescent state of SSC have been observed in the
liver (Grisham, 1996), brain (Morshead, 1994) and in
bone-marrow (Bradford, 1997), but it is still not clear if
cells are in G0 or entering slowly in G1 (reviewed by
Yannaki and Papayannopoulou, 2001). Another
important issue is whether SSC are locally restricted to
the tissue they give support to or not.
During vertebrate ontogeny, hematopoietic sites
change as new populations of hematopoietic stem cells
(HSC) emerge. Although yolk sac (YS), fetal liver,
spleen and bone marrow are common sites of
hematopoiesis in many vertebrates, their function is not
completely necessary and some organisms developed
different hematopoietic systems. Hematopoiesis in the
mouse is first observed in blood islands (BI), in the
extraembryonic yolk sac (EYS), in the intraembryonic
para-aortic splanchnopleura (PAS), aorta-gonad-
mesonephros-region (AGM), the fetal liver and later in
the bone marrow (Orkin, 2000; Weissman, 2000). The
hematopoietic events are genetically controlled by
several factors that influence the transition from
primitive hematopoiesis in the YS to the definitive or
fetal/adult hematopoiesis. The chicken does not use the
fetal liver as a major erythropoietic organ but instead
maintains blood formation in the YS and in the
mesenteric regions until bone marrow hematopoiesis is
established. Allantois was ignored for a long time until
Diterlen-Liévre and colleagues (2002) showed the
presence of red cells in the allantoic bud before blood
vessel development, suggesting an inherent capacity of
the allantoic bud to produce hematopoietic cells. Caprioli
and co-workers (1998) showed that allantoic graft-
derived cells were able to colonise the bone marrow of a
host embryo and the allantois was finally considered as a
producer of HSC. Throughout early hematopoiesis of
vertebrates, at the BI and YS as mentioned initially,
endothelial cells (EC) and hematopoietic cells (HC) are
closely associated in those specific locations. Pardanaud
and colleagues (1989, 1996, 1999) focused on the
relationship between EC and HC using the avian embryo
as a model. By doing transplantations experiments, they
clearly demonstrated that the aorta is formed by two
distinct EC lineages. The ablation of chicken caudal
somites and posterior replacement by quail caudal
somites, showed that quail cells gave rise to the
intersomitic arteries and both roof and sides of the aorta.
The same result was obtained when host somites were
replaced by somatopleural mesoderm. In contrast, EC
from the splanchnopleural mesoderm, grafted in place of
somites, are not only capable of settling in the body wall,
limb and kidney, but also visceral organs and the floor of
the aorta. In the latter location, those cells from the
splanchnopleural mesoderm, give rise to intraaortic
clusters. Consequently, one of the EC lineages is
endothelial, migrates along with myoblasts into the body
wall mesoderm, makes up the roof and sides of the aorta,
and the other, which derives from the splanchnopleural
mesoderm, gives rise to the endothelial network of
splanchnic organs (Pardanaud et al., 1996). Concluding,
splanchnopleural mesoderm has both a hematopoietic
and an endothelial potential. Shortly after, further
experiments showed that the floor of the aorta was a
possible place where intraembryonic HSC were
produced (Dieterlen-Lièvre et al., 2002). Additional
studies showed that a brief contact with endoderm
respecifies axial and somatopleural mesoderm into
expressing splanchnopleural hemangiopoietic potencial.
Endoderm activity could be mimicked with decreasing
efficiency by VEGF, bFGF or TGFb. Conversely,
ectoderm could be mimicked equally well with EGF or
TGFa, reducing the number of progenitors arising from
splanchnopleural mesoderm and restricted the potential
to angiopoiesis (Pardanaud and Dieterlen-Lièvre, 1999).
The hematopoietic and vascular compartments are
coordinately regulated so that blood cells enter the
circulation as soon as terminal differentiation has
occurred. A common progenitor cell called either a
hemangiocytoblast, hemangioblast, or angioblast, has
been postulated to exist during embryogenesis, and has
the potential to form either vascular endothelial cells or
hematopoietic cells, in the BI region (Flamme et al.,
1992; Sabin, 1920; Reagan, 1917).
Blood cell origin has been searched for quite a long
time and has been characterised and studied for the last
50 years. HSC are probably the best characterised SC
population. Pioneer experiments, showed that a
population of clonogenic bone marrow cells were able to
generate myeloerythroid colonies in the spleens of
lethally irradiated hosts (Till et al., 1961; Becker et al.,
1963; Wu et al., 1968). Those clonogenic cells were also
6
able to reconstitute all blood cell lineages of the host
(Siminovitch et al., 1963). These experiments were just
the break-through that stimulated further efforts that lead
to the present knowledge about HSC. Weissman and
coworkers (1994) proposed a hierarchical model for HSC
development dividing them into two groups, which are
multipotent, but differ in their self-renewal capacity. The
long-term HSC subset (LT-HSC) keeps self-renewing for
the lifetime of the organism, while the short-term HSC
subset (ST-HSC) maintains self-renewal capacity for
approximately 8 weeks. The lineage of multipotent cells
is LT-HSCÆST-HSCÆmultipotent progenitors (MPP,
Morrison et al, 1997). MPP differentiate into
oligolineage progenitors and show no demonstrable
degree of long-term repopulation. In the mouse, the fetal
yolk sac (FYS) is the primordial location of
hematopoietic stem cells that then moves to the fetal
liver (Ohneda et al., 1998). Further studies have shown
the ability of FYS cells to reconstitute the bone marrow
of newborn recipients but not adult animals (Yoder et al.,
1997). However, other data suggested that an
intraembryonic site could be the true initial location of
HSC genesis and amplification (Martin et al., 1978;
Lassila et al., 1978). The intraembryonic PAS zone,
which later differentiates into the AGM region both in
mammals and in avians, is hence likely to be the place
where definitive HSC are first generated (Pardanaud et
al., 1996; Godinet al, 1993; Godin et al., 1995; Garcia-
Porrero et al., 1995; Cumano et al., 1996).
A large number of extracellular signalling factors that
regulate HC determination have been identified and
described. Factors such as erythropoietin and several
interleukins, have been involved in hematopoiesis,
therefore giving a good clue from where to start
(Baldwinet al., 1992; Ogawaet al., 1994; Yoshimura and
Misawa, 1998). More recently, other molecules have
been identified whose importance in cell determination is
necessary. Having an enormous importance in many
other mechanisms, factors such as bFGF, TGFb, BMP4,
were shown to have an enormous relevance in blood cell
formation and diversification (reviewed by Zon, 1998).
In this work, we identified a clone that is expressed
during hematopoiesis in the chick embryo. The
expression is detected at very early stages and is present
in all the hematopoietic regions. Moreover, the presence
of the RNA is detected when these hematopoietic regions
begin to form. It is also shown that its regulation is
unaffected by BMP pathway and FGF overexpression.
MATERIALS AND METHODS
Embryo dissection
White leghorn chicken (Gallus gallus) fertilised eggs
(Avipronto, Benavente) were incubated at 38ºC in a
humidified incubator for specified periods of time before
harvesting. Eggs were windowed and embryos were
removed into PBS. Embryos were staged according to
Hamburger and Hamilton (1951) and fixed in 4%
paraformaldehyde in PBS for 12 hours. After fixation
dehydration was made through PBT and a graded series
of methanol/PBT (25, 50 and 75%) to 100% of methanol
and stored at -20ºC until use.
Chick whole embryo New culture
Fertilised eggs were incubated at 38ºC for a determined
period of time until embryos reached the desired
developmental stage. The eggs were opened as
mentioned above and the whole albumen was discarded.
Embryos were removed by cutting the vitelline
membrane all around the equatorial plane of the egg,
secured in a plastic ring and placed with the ventral side
up onto a 1:1 agar-albumin medium (as described in
New, 1955 and in Stern, 1993). After the manipulating
procedure, embryos were incubated for different periods
of time. Following the incubation period, embryos were
dissected and fixed as previously mentioned.
In ovo embryo manipulation
Incubated eggs were carefully opened by making a small
window. Indian ink was injected between the embryo
and the yolk to contrast it and allow an accurate in ovo
manipulation. The vitelline membrane was opened to
access the embryo and a slit was performed with a
tungsten needle in the place where beads were applied.
The eggs were then sealed with tape and put back in the
incubator.
Synthesis of riboprobes
A cDNA chick embryo library (from stages 5 to 10 HH),
with pBluescript II KS(+) vector accommodated inserts
between EcoR1 and Xho1 sites, was used to transform
SOLR‘ competent cells. After transformation, cells
were plated in LB-ampicillin agar plates at low density.
86 clones were randomly chosen. Cells were grown in
LB liquid medium with ampicillin, and plasmid DNA
was extracted from each clone on a small scale
(Quiaprep‚ Spin Miniprep Kit) and linearised using
EcoRI or Xho1. The linearised DNA served as template
for the synthesis of digoxigenin (DIG) labelled antisense
RNA probes using T7 RNA polymerase and sense
probes with T3.
Whole-mount in situ hybridisations
The expression pattern of several clones was assessed on
at least 3 embryos from stages 4 to 12 HH by using
whole-mount in situ hybridisation (Wilkinson, 1993).
DIG labelled probes where hybridised at 70ºC overnight
and detected with an alcaline phosphatase (AP)
conjugated antibody (Roche Molecular Biochemicals).
AP staining reaction was performed by using BM purple
7
according to the manufacturer’s instructions (Roche internet at http://www.ncbi.nlm.nih.gov/BLAST/.
Molecular Biochemicals). Further analysis was accomplished using the Nucleotide

Clone Sequence Length A c c e s s i o n number / Homology Identical

(nucleotides Homologous s e q u e n c e (%) Nucleotides
number) identification (relative to
the
homologous
fragments )
X1 3816 L25262: C o m p l e t e (96%) 1235/1279
retrotransposon, ART {Gallus
gallus}
D26318: human bbc1 (breast (99%) 527/530
basic conserved gene)
homologue {Gallus gallus}
X2 546 TC12744: rho globbin b-chain 99% 375/376
{Gallus gallus}
X4 563 BC015576: similar to E- 97% 513/525
cadherin type 1, clone
MGC:23017 {Homo sapiens}
q4 605 AC091561.4: chromosome 8, 100% 21/21
clone RP11-388G22 { Homo
sapiens}

Table 1. Summary of homology comparison of the chosen clones to the NCBI database.
Histological sections
Embryos were sectioned using different histological
techniques. A Leica VT1000S Vibratome was used to
make 30-40 mm sections of PBS/0.5% gelatine/30%
albumin/20% sucrose included embryos. Some embryos
were included in Technovit 8100 (Heraeus Kulzer) and
25 mm sections obtained employing a LKB Ultratome III
type 8801A ultramicrotome. Stage 23 embryos were
included in PBS/7.5% gelatine/15% sucrose medium and
were sectioned using a Cryocut-E cryostat.
DNA sequencing and sequence analysis
Selected clones were sequenced from both 5’ and 3’ ends
using the T7 and T3 universal primers (GIBCO) in
conjunction with a Big Dye Terminator kit and ABI
PRISM‰ 377 DNA Sequencer. Custom primers where
designed from the 3' end of the T7 sequenced fragments
using MacVector‰ 7.1.1 (Accelrys) and prepared by
Invitrogen‰ Life Technologies. The following primers
were used: (5’ to 3’): TCCAGCCAGTTTCAAAGGG;
AAATGACCACCTTGAGC;ATCACTCACAATCACC
CG. Sequences were analysed using the DNA
Sequencing Analysis Software version 3.3 (PE Applied
Biosystems). Nucleic acid sequence homology searches
were performed on the National Center for
Biotechnology Information using the Standard
nucleotide-nucleotide BLASTn program accessed by
Identify X, NIX, program from the UK Human Genome
Mapping Project Resource Centre,
http://www.hgmp.mrc.ac.uk/.
Subcloning Breast Basic Conserved 1 (bbc-1)
gene
Restriction maps were prepared using DNA strider
program software and restriction enzymes were selected
according to the designated fragment. Both bbc-1
fragment and vector were digested with the same
restriction enzymes and ligated with T4 ligase
afterwards. Competent cells were transformed and plated
as mentioned before. The plasmid was extracted and
linearised as described above. Sense and antisense DIG
labelled probes were synthesised using SP6 and T7 RNA
polymerases respectively. bbc-1 expression pattern was
then assessed by in situ hybridisation.
Beads implantation into embryos in ovo and
New-cultured embryos
Heparin acrylic beads (Sigma H-5263) were used as
carriers for administration of the selected proteins. Beads
ranging between 100 and 150 mm in diameter were
selected, washed in PBS and incubated in the desired
protein solution for 1 hour at room temperature. Proteins
were used at different concentration, recombinant human
FGF-2 (R&D Systems) at 0.5 mg/ml, recombinant human

8
BMP-4 (R&D Systems) at 0.1 mg/ml and recombinant
mouse Noggin (R&D Systems) at 0.1 mg/ml. Control
beads were incubated in PBS. BMP-4 and Noggin beads
were implanted under the epiblast in the anterior left
region of stage 4-5 embryos cultured by New method,
near the limit area pellucida (AP) boundary. FGF-2
beads were inserted in the lateral plate mesoderm,
between somites 5 and 6, of in ovo and New-cultured 9-
11 HH staged embryos. The embryos were then
incubated at 38ºC for different periods of time.
Sequence analysis of X1 clone
A sequence of 3816 base pairs (bp) long was found for
X1 clone. The sequence is subdivided into three main
clusters. The first one is 534 bp long and presents a high
homology with chicken bbc-1. The second domain,
containing bases between 636 and 1720, has no
homology with any known sequence. The third part of
X1 clone contains more that 2000 bp which share a 96%
of homology with avian retrotransposon in chicken
(ART-CH) (fig. 1).

X1 clone expression pattern analysis

RESULTS A detailed expression pattern analysis was made by
whole-mount in situ hibridisations using X1 probe in
Identification of clones involved in embryos from stage 2 to 34 HH. This probe only
organogenesis contains part of the retrotransposon sequence.
In order to identify genes involved in organogenesis, we The expression pattern of X1 during gastrulation
screened a cDNA chicken library using whole-mount in stages is mainly restricted to the limit between area
situ hybridisation in chicken embryos. The library was opaca (AO) and AP with slight differences among
previously constructed by members of our laboratory by stages. At stage 2 HH, X1 expression is detected as a thin
1 GTCTAAAACTACCGGATCCCCCGGGCTGCAGGAATTCTGCACGAGGCGCGCCCCGCCCTGTGGCTGGGCCCATCCGGCCCATCGTGAGGTGCCCGACTGT
101 CAGATACCACAAAAAAGTTCGTGCTGGCAGAGGATTCAGCCTAGAAGAGCTTAAACTGGCGGGCATTAACAAAAGGTTTGCTCGGACGATTGGAATCTCC
201 GTGGATCCCAGGCGAAGAAACAAATCTACAGAGTCACTGCAAGCCAACGTGCAGCGGCTGAAGGAGTATCGCTCCAAGCTTATCCTCTTCCCAAGGAAGC
301 CGTCTGCACCGAAGAAAGGAGACAGCTCTCCTGAGGAACTCAAGATGGCAACTCAGCTGTCCGGACCGGTTATGCCGATCAGGAACGTTTTCAAACGGGA
401 GAAGGCCCGTGTTATCTCAGAGGAGGAGAAGAACTTCAAGGCTTTGCCAGCCTGCGCATGGCCCGGGCAAACGCTCGTCTCTTTGGGATCCGTGCAAAAC
501 GTGCCAAAGAAGCGGCGGAGCAGGACGTGGAGAAAAAGAAATGAACCGTTCTTGGTAGAACTGTCAATA(…)CCGAATTCGGCACGAGGATGCGGACAGG
1720 GGGCATAGCCTACCGTCTCTGGTCACTCCCAGGGGCGGTAGTGCGAGTGATAGTGTAGAAGAGAAAGAAGGGACTGGCTTTGAGTGCAGGGGGAAGGAT
1820 CAAATGACGGACTGGAATGGATTAGATCGGAGGCTTTGGAAAGGTATAGTTCCAAGGCATTCCGGGTGATTGTGAGTGATCGTGGTCCCGAATGGGTGCC
1920 GCTGACCCCGGGGGTGTTACGCGCCTGGTGGAATTTATGGATAAAAGAGGCCTGAATCGCCTCTGACATTAAATGCACTACAAACTTTGGCTGCACTGGG
2020 GCCTCTCTTCCCCCGTGACATCACAAACTTAATGCGTATGGTGCTCAGGCTGGTTCAATATACGTTATGGGAGACGGACTGGGTGGCCGAGTTGGGGGGC
2120 CGTGCCGGGGCGACAGGGGTCGGCCCGGGCTGCTCCCTGCATGGGACCGGAATACAGCGGCTTTCAGGGAAGGCCGTGGGAGTGGCTTCGCCCCAGGGC
2220 CAGCTAGCGAGACTAAGGCCAGGGGAGCTAATAGCAGCCACAGATGCAGTGGTGGAAGCGTTTAATAAACTTGTGCATAAGGCCGAACCACCTACTCCGT
2320 GCACAGATATTACCCAGGGCCCGAATGAATCCTTTCAAAGCTTTACAGACAGGCTTTTAGCTGCTGCAGAGGGGTCTGATCTCCTGGTACCGGCCCAAGG
2420 GCCAGTGATCATTGACTGCTTGCAGCAGAAATCGCATGACAATGTTAAGGCATTGCTGCGAGCCGGCCGAAGTACGCTTAATACCTCGGGAGCCGGCCGA
2520 AGTACGCTTAATACTCGGGAGAAGTTATTCAGTATGTCTTAGATAAGCTCAAGGTGGCTCATTTAACTAATGAAAGGCTAGTCACAGCTATTGTCGTAGCT
2620 GTTGGCCTGCGACAGCAAAGATCGCTGCAGCAGCAAGGGCTGTGTTTCCGATACGGCCAGTATGGCCATGTTAGAGCACAATGCCCCTGTGGGGGAGGCC
2720 AGTCAGGGCCTCCTGATCACAGGAAGGGCTTGCTAAAGGGTATCCGTGGTCGGGTATGCAGCAGTTAAATATCATGAATCTGGGAAATTCTGTGGGTACC
2820 ATCGCGAAAAGTAATACCAGATATAAGTAGCATATCTGCAAAAACTGAGTCTAGGTGCGAGTTTTCTACAGAAATTCTTCGTTGGCAGACCGAAGCCAACT
2920 CCAGAACAACTGAGGGACAGACGATGGGATCAAGAACCACTCGTCAAGAGGAGCACTACACCTGCAACGCTGACACTTCCGATGTTGCCGATGTTTATGG
3020 TGTCCATGGCGATTACAGAGTGTCACAACAACTACAATGGACACAAGAACATATGCAGAAATTAAAGAAGAGCGTGATCCCTTTGAAACTGGCTGGACGG
3120 ACTGTTTGGGAACGGGTTCATGGTTAAAGCAATTGCTTAAAGCTCTCGCAGTAGATTTGCAATCTTTGTGTGTATTCTAATCTGTCTTCCATGCTTTGTAGA
3220 TGCTTGCAGAACTGCCTTCAACGAATGATGGCAAGACTTTTGACTATCACATTGAGTATCATAGATTGCGTGAAAAATTATAGAGGGTTTAGGTTGTTGCG
3320 TTCGTGCTGTAACGGGGCAAGGCTTGGCCGAGCACGGAAAAGAATTCCCTGTTGCTCTGATGATTGCTTAAGAACTGTAGTAGAAAATAGTAGGAATAGT
3420 GTGCTGAAATATATTTAGGATTAGGCGTTTTGCGCTGCTTCGCGATGTACGGGTTAGGTGTGTGTGTAAGTAGTATTTAGCTTAGGGAGGGGGAGATGTTG
3520 TAGTAGGCGTCTTGCGGGGGCACGGGATGTACGGGACAGGCCTCTCCCTAAACATAGAGAGATAGTGCTATCGTGCTGACCTTGTTGCAGAGAAAACAGG
3720 AGAAGAAGAAGGATGATAAAAGAATGTGGAAACGGCCAAATAAGGCACAATGTTATCTGGTGTGAACTAATCAGAGTGGGACATGACAGCACGGTTATCT
3820 AGGTAAAAATGTATATAAGCTGTGTTTAGTAGTGAATAAACG
Fig.1. X1 sequence. Homology fragment for bbc-1 in green, non homologous fragment in blue and ART-CH homologous fragment
in red
using RNA from stage 5 to 10 HH chicken embryos. line in the AP in the frontier with the AO (fig. 2A). A
Clones from the library were selected randomly. 4 wider expression is observed in the anterior region of the
clones, among 86, where chosen according to their AP opposite to the Koller’s Sickle (KS). At stage 3 and 4
regionalised expression patterns. The clones were HH (full primitive strike stage), embryos show an
sequenced and a homology comparison was made using enlarged full ring-shaped expression on the periphery of
the Standard nucleotide-nucleotide BLAST program of AP (fig. 2B). This ring-shaped expression pattern
the National Center for Biotechnology Information, changes as the embryo develops becoming enlarged in
NCBI, http://www.ncbi.nlm.nih.gov/BLAST/index.html the germinal crescent region by stage 6 to 7 HH (fig.
(Table 1). To obtain the complete sequence of clone X1, 2C). Once the heart begins to form, the expression
several primers were made using the 3' end of the T7 condenses in the anterior and lateral parts of the AP in
primer sequenced fragment, each advance on the the place where the heart tube is forming (fig. 2D). Low
sequence was used to design a new primer (primer levels of expression are observed in the posterior limit
sequences are shown in materials and methods). between AP and AO. At these stages, expression begins
One clone, X1, was selected for further analysis. to be detected in the AO cells. Histological sections of
stage 8 HH embryos show a restricted expression in

9
Fig.2. Expression of X1 clone at early stages. A) At stage 2 HH, X1 is mainly detected on the anterior part of the AP and in a
very thin layer between the AP and AO. B) At stage 4, expression is observed in the AP close to the AO as a ring. C) By
stage 6 HH, the ring shaped expression pattern is maintained and becomes enlarged in the germinal crescent region. D), At
stage 8 HH the expression spreads along the anterior mesenchyme and heart tube. At this stage, the expression level is quite
reduced in the posterior part of the embryo, although it is still present. Transverse sections of stage 8 HH embryo in D at
levels E and F as pointed. E) Transverse section showing strong expression in the endoderm and splanchnopleure. F) At this
level, a cross-section shows a narrow but strong expression in the endoderm. Scale bar 1 mm in A-D and 100mm in E and F.

10
Fig.3. Whole-mount in situ hybridised embryos for X1. A) At stage 10, there is a slight expression in the anterior mesenchyme area.
Small clusters of cells express X1 near and within the future sinus venosus. B) Later on, at stage 12 HH the expression pattern is more
restrict to the sinoatrial region and well defined BI. C) By stage 15 HH, the expression becomes stronger within the cranial intestinal
portal, foregut and cranial liver rudiment, as well as the contiguous sinus venosus. In the posterior area, there is a low expression in the
end of the caudal intestinal portal. D) Cross-section of the embryo shown in A presenting a strong expression in the splanchnic mesoderm
and BI. E) An amplification of the dotted box E in embryo D shows a clearly specified expression in the embryonic splanchnic mesoderm
underneath the conotruncus. F) Amplification of the box F in embryo D where staining of the BI inner-core is observed. Scale bar 1 mm
for A, B, C, 100 mm in D and 50mm in E and F.

Fig.4. Whole-mount in situ hybridisation of stage 19 and 23 HH embryos with X1 probe. A) At stage 19, the expression becomes more
regionalized to the area dorsal to the heart (white arrowheads). The early formed allantois presents a high expression of X1 (red
arrowhead). Transcripts are also present in the dorsomedial lip of the dermomyotome (black arrowhead). B) An amplification of the
dotted box B in embryo A shows that the expression is located in the liver region (white arrowheads) and dorsomedial lip of the
myotome (black arrowhead). C) By stage 23, the expression pattern becomes stronger in the dorsomedial lip which is better observed in
a dorsal view (D). F) Ventral view of the embryo in C shows expression in the mesonephros (white arrowheads), heart was removed for
a better observation. E) Cross-section at level E in embryo D shows a precise expression in the dorsomedial lip (black arrowheads). G)
Transverse section at level G showing the expression in the mesonephros (white arrowheads).Scale bars 1 mm in A,B,C,D and F and
200 mm in E and G.
the endoderm and splanchnopleure at the anterior region maintained through stage 12 and 13 HH (fig. 2B). At
(fig. 2E and 2F). At stages 9 and 10 HH, expression is these stages, expression in blood islands is still evident.
observed in the two symmetrical heart forming fields of When the heart has almost looped, stages 14 to 16 HH,
the sinoatrial region and in the cells that will form the expression in the sinus venosus and posterior part of this
sinus venosus (fig.3A). Transverse sections of chick organ is maintained (fig 3 C). By stage 16 HH,
embryos at stage 10 HH in the heart-forming area level transcripts of the clone appear in the cranial intestinal
(fig. 3 D,E,F) shows a very regionalised expression in portal, foregut and cranial liver rudiment and are also
the splanchnic mesoderm contiguous to the lower part of detected in these areas until stage 19 HH. Expression at
the conotruncus, as well as in a more lateral position. stage 16 HH begins to be observed at the caudal
Future BI at stage 10 HH localised in the AO present a intestinal portal, the area where the allantois will form
strong and homogeneous expression in their core (fig. 3 (fig 3C).
D,F). Expression in sinus venosus and atrium is

11
 Fig.5. X1 whole-mount in situ hybridisation of 28 to 34 HH embryos. A) At stage 28 HH, day 5,5, expression is strongly detected in
the liver (black arrowheads) and in the mesonephros (white arrowheads). B) By stage 31 HH, the expression is still observed in both
lobes of the liver (black arrowheads) and in the dorsomedial lip of the tail somites. At stage 34 HH (C and D), expression is detected
in the joints specially between the phalanxes (black arrowheads) both in the forelimb (C) and the hindlimb (D).
Fig.6 Regulation of X1 expression by overexpression of
growth factors. A) Control embryo treated with a PBS soaked
bead where no changes in X1 expression is detected. B)
Exogenous application of BMP-4 in the germinal crescent
region does not alter X1 expression after 8 hours. C)
Implantation of a Noggin embedded bead during 7 hours has
no effect on X1 expression. D) Expression of X1 is not altered
by FGF-2 treatment after 15 hours. Positions of beads are
indicated by white arrowheads.
By stage 19 to 22 HH, expression in the heart begins to
disappear and an accurate staining is observed dorsally to
the heart (fig. 4 A,B) corresponding to the liver bud. At
these stages, X1 has a high expression level in the
allantois bud (fig. 4 A) and this high level of expression
is maintained until the formation of the chorion-allantoic
membrane at stage 26 HH. Transcripts of X1 are also
observed in the dorsomedial lip of the dermomyotome
from stage 19 HH (fig. 4 A, B, C, D, E, F) to 34 HH (fig
5 B). From stage 21 HH, transcripts are also observed in
the mesonephros (fig. 4 F,G).
The expression in the liver and mesonephros is
maintained at more advanced stages and can be detected
in these organs until stage 28 HH (fig. 5 A). Stage 31 HH
embryos express high levels of X1 in the liver and slight
staining in the dorsomedial lip of the dermomyotome is
still present in the somites of the tail (fig.5 B). At stage
34 HH, day 8 of development, X1 expression appears in
the areas where joints are being formed in both forelimb
(fig. 5 C) and hindlimb (fig. 5 D). The expression in the
joints between the phalanxes is extended posteriorly to
the area surrounding the phalanx cartilage (fig 5 C and 5
D).
bbc-1 expression
Since the probe for the expression described before did
not contain bbc-1, we decided to verify the isolated bbc-
1 expression pattern. bbc-1 was subcloned into pCS2+
and riboprobes were synthetised. The expression was
assessed in embryos between stage 2 and 34 HH. After
whole-mount in situ hybridisation embryos showed an
ubiquitous expression for bbc-1 (data not shown)
meaning that X1 expression pattern was not due to this
particular gene.
Gene regulation assay
We used protein soaked beads to test if two known
pathways, BMP and FGF, were involved in the
regulation of X1 expression. Beads were surgically
12
implanted in vivo and in New cultured embryos
depending on the stage. Control experiments were made
by implanting PBS soaked beads. The application of the
control beads had no effect on X1 expression after 10
and 20 hours of treatment (fig. 6 A).
BMP signalling is not involved in X1 regulation
As expression of BMPs at gastrulation stages overlaps
with the one described above, we implanted BMP4 beads
to assess its involvement in the regulation of the gene.
Beads carrying BMP4 were applied at stage 4 to 6 HH in
the anterior region of the embryo in the limit between AP
and AO. Embryos were maintained in New culture for 3
and 8 hours and no changes were detected in the
expression of X1 clone after BMP4 implantation (fig 6
B). We also performed the complementary experiment,
i.e., the treatment with a BMP antagonist. For that
purpose, Noggin soaked beads were inserted in the same
positions than BMP4 beads and embryos were incubated
for 5 and 10 hours. After inhibition of BMP signalling,
expression of X1 is still present in the embryos (fig. 5 C)
and neither inhibition nor upregulation of gene
expression could be detected.
FGF induces angiogenesis but does not induce
X1expression
It has been shown that FGF2 beads dorsally implanted
between somites 5 and 6 of stage 9 to 11 HH embryos,
induce angiogenesis. To assess if this induced
angiogenesis requires the expression of X1, we
implanted FGF2 embedded beads in both New-culture
and in ovo embryos. After manipulation embryos were
incubated for 9 and 20 hours (in New culture) and for 12
and 24 hours (in ovo manipulations). The treatment with
FGF2 had no effect on the expression of X1,
independently of the incubation periods after
manipulation (Fig 5 D).
DISCUSSION
Expression of X1 During Early Chick
Development
X1 expression is detected in early gastrula stages.
Between stages 2 HH and 8 HH, X1 expression overlaps
with that of BMP4 (Faure et al., 2002) and at stages 5
and 6 HH, X1 expression is detected in the germinal
crescent area (Rogulska et al., 1971) where precursors of
primordial germ cells are formed. These precursors
migrate into newly formed vascular veins and are
passively transported by the blood stream to the vicinity
of the embryonic gonads, which they invade (Ginsburg et
all., 1994). The overlapping of X1 expression with the
germinal crescent cells, suggests that X1 could be
involved in germ cell precursor formation. BMP-4 is
known to play an important role in determining cells at
these stages. Our experiments showed that implanting
beads with BMP4 or its antagonist Noggin in the
germinal crescent region, had no effect on the expression
of X1. This data suggest that X1 expression is
independent of the BMP pathway in this area.
X1 is expressed in hematopoietic regions
During primitive hematopoiesis (starting at stage 8 HH),
X1 is expressed in all the sites involved in this process.
At stage 8 HH, the expression starts to be observed along
the anterior mesenchyme and heart tube. As the embryo
develops, X1 transcripts are identified in the rudiments
of the heart and then detected in the mesoderm
underneath which will form the liver, a secondary
hematopoietic site in the chicken embryo. Moreover, X1
expression follows the liver organogenesis in all the
studied stages. While X1 expression is still present in the
heart process region, ventral blood islands begin to
express it. Furthermore, X1 is detected in the whole
immature blood islands but when peripheral cells
differentiate into endothelial cells, expression is only
detected in the core where erythrocyte precursors remain
(Wilt, 1965). Endothelial cells of the embryo come from
the mesoderm-derived angioblasts that assemble into a
vascular pattern (Sabin, 1920; Flamme et al., 1992;
Reagan, 1917). Considering that splanchnopleural
mesoderm is involved both in hematopoiesis and
angiogenesis (Pardanaud et al., 1994), we tested the
involvement of X1 in angiogenesis by overexpressing of
FGF2. FGF2 is important for both the induction of
angioblasts and the assembly of angioblasts into blood
vessels (Cox and Poole, 2000). The implantation of
FGF2 soaked beads into stage 9 to 11 HH embryos,
between somites 5 and 6, induces ectopic angiogenesis
(Cox and Poole, 2000) but have no effect on the
expression of X1. For this reason, this experiment
suggests that X1 is not related to angiogenesis, although
it is highly expressed in the splanchnopleural mesoderm
and thus could be involved in hematopoiesis.
Later in development, after hematopoiesis in YS
blood islands, another organs begin to form
hematopoietic precursors. Allantois is one of the organs
that contribute to hematopoiesis in the chick embryo. In
this organ, X1 expression is detected from its early
development, then it is observed at high levels at stage
22 and completely disappears by stage 26. These
observations reinforce the hypothesis that X1 could be a
hematopoietic stem cell marker. Endothelial cells and
other non-muscular cells are known to derive from the
dermomyotome (Wilting et al., 1995), but their precise
location is not confirmed. The expression of X1 in the
dorsomedial lip of the dermomyotome could be related
to endothelial cell precursors formation but this
hypothesis needs further proof, which are difficult to get
since there are no known early endothelial markers. In
13
addition, X1 transcripts start to be highly expressed in
the mesonephros by stage 21 HH. Mesonephros is also a
zone where hematopoietic precursors are located,
integrated in the aorta-gonada-mesonephros complex
(Weissman, 2000). X1 transcripts are maintained in
mesonephros until day 8 of development. The expression
of X1 in this area therefore supports the relationship
between X1 and hematopoiesis.
X1 Clone Remarkable Characteristics
The sequencing of X1 revealed not only more accurate
information, but many non-answered questions. Being
composed by bbc-1, a non homologous region and ART-
CH, X1 raises many questions and possible explanations.
bbc-1 was first observed and described as a novel gene
which displays an altered expression pattern within
benign and malignant female human breast tumours
(Adams et al., 1992). bbc-1 has been identified in several
species and it is conserved among them. Its presence in
the chicken had not yet been studied, but our results
show an ubiquitous localisation of this gene, which
suggests that it is not responsible for X1 expression
pattern. The avian retrotransposon from the chicken
genome, ART-CH, was first identified by Gudkov et al,
(1992). ART-CH is one of the several retrovirus-like
elements widely distributed in eukaryotic genomes.
Many of these elements seem to originate from germ line
infection and remain capable of being expressed and
taking part in recombination processes (Frisby et al.,
1979; Resnick et al., 1990). The presence of ART-CH
within the chicken genome causes some intriguing
questions since it is not described in other related avian
species. Hence, it must have been a recently acquired
element. ART-CH is responsible for the expression
pattern of X1. This suggests that ART-CH is under the
control of a promoter, which directs the expression of
another gene. The function of this gene could be the
maintenance of the undifferentiated state in the
hematopoietic stem cells. The mechanism behind this is
yet to be understood.
REFERENCES
Adams, S., M., Helps, N., R., Sharp, M.G.F.,
Brammar W., J., Walker, R.A. and Varley, J., M.
(1992a) Isolation and characterization of a novel gene
with differential expression in benign and malignant
human breast tumors. Hum. Mol. Genet. 1, 91-96
Becker, A., McCulloch, E. and Till, J. ( 1 9 6 3 ) .
Cytological demonstration of the clonal nature of
spleen colonies derived from transplanted mouse
marrow cell. Nature. 197, 452-454.
Baldwin, G.C. (1992). The biology of granulocyte-
macrophage colony-stimulating factor: Effects on
hematopoietic and non-hematopoietic cells. Dev Biol.
151, 352-367.
Bradford, G.B., Williams, B., Rossi, R. and
Betoncello, I. (1997). Quiescence, cycling and
turnover in the primitive hematopoietic stem cell
compartment. Exp. Hematol. 25, 445-453.
Brandon, C., Eisenberg, L.M. and Eisenberg, C.A.
(2000) WNT signaling modulates the diversification
of hematopoietic cells. Blood. 96, 4132-41.
Brustle, O., Jones, K.N., Learish, R.D. et al. (1999).
Embryonic stem cells-derived glial precursors: a
source of myalinating transplants. Science. 285, 754-
756.
Caprioli, A., Jaffredo, T., Gautier, R., Dubourg, C.
and Dieterlen-Lievre, F. (1998). Blood-borne
seeding by hematopoietic and endothelial precursors
from the allantois. Proc Natl Acad Sci . 95, 1641-6.
Christopher, M., C., and Poole J. T., (2002)
Angioblast differentiation is influenced by the local
environment: FGF-2 induces angioblasts and patterns
vessel formation in the quail embryo. Dyn. Deve.
218, 371-382.
Cox, M., C., and Poole J., T., (2002) Angioblast
differentiation is influenced by the local environment:
FGF-2 induces angioblasts and patterns vessel
formation in the quail embryo, Dev. Dyn. 218, 371-
382
Cumano, A., Dieterlen-Lievre, F. and Godin, I.
(1996). Lymphoid potential, probes before circulation
in the mouse is restricted to caudal intraembryonic
splanchnopleura. Cell. 86, 907-916.
Cumano, A. and Godin, I. (2001) Pluripotent
hematopoietic stem cell development during
embryogenesis. Curr Opin Immunol. 131, 66-71.
Denetclaw, W.F.Jr., Berdougo, E., Venters, S.J. and
Ordahl C.P. (2001). Morphogenetic cell movements
in the middle region of the dermomyotome
dorsomedial lip associated with patterning and
growth of the primary epaxial myotome.
Development. 128, 1745-55.
Denetclaw, W.F. and Ordahl C.P., (2000). The growth
of the dermomyotome and formation of early
myotome lineages in thoracolumbar somites of
chicken embryos. Development. 127, 893-905.
Dieterlen-Lievre, F., Pardanaud, L.,Caprioli, A.,
Jaffredo T. (2001) L. Zon (Ed.), Non-yolk sac
hematopoietic stem cells: the avian paradim.
Hematopoiesis a developmental approach. Oxford
University Press, New York. 201-208
Dieterlen-Lievre, F., Pardanaud, L., Bollerot, K. and
Jaffredo, T. (2002) Hemangioblasts and hemopoietic
stem cells during ontogeny. C R Biol. 325, 1013-20.
Faure, S., Santa-Barbara, P., Roberts, J., Drucilla
and Whitman, M. (2002) Endogenous Patterns of
BMP Signaling during Early Chick Development.
Dev. Biol. 244, 44-65
14
Flamme, I. and Risau, W. (1992). Induction of
vasculogenesis and hematopoiesis in vitro.
Development. 116, 435-439.
Frisby, D.,P., Weiss, R., A., Roussel M.,and Stehelin
D. (1979) The distribution of endogenous chicken
retrovirus sequences in DNA of galliform birds does
not coincide with avian phylogenetic relationships.
Cell. 17, 623-634.
Fuchs, E. and Segre, J.A., (2000). Stem cells: a new
lease on life. Cell. 100, 143-55.
Garcia-Porrero, J., Godin, I. and Dieterlen-Liévre, F.
(1995). Potential intraembryonic hemogenic sites at
preliver stages in the mouse. Anta Embryol. 192, 425-
435.
Ginsburg, M., (1994) Primordial germ cell formation in
birds. Ciba Found. Symp., 182, 52-61: discussion 61-
57
Godin, I., Garcia-Porrero, J., Coutinho, A., Dieterlen-
Liévre, F. and Marcos, M.A.R. (1993). Para-aortic
splachnopleura from early mouse embryo contains
B1a lymphocytes. Nature. 364, 67-70.
Godin, I. and Cumano, A. (2002) The hare and the
tortoise: an embryonic hematopoietic race. Nat Rev
Immunol. 2, 593-604.
Grisham, G.J. and Coleman, W-B. ( 1 9 9 6 ) ,
Neoformation of liver epithelial cells: Progenitor
cells, stem cells, and phenotypic transitions.
Gastroenterology. 110, 1311-1313.
Gudkov, A.V., Komarova, E.A., Nikiforov, M.A. and
Zaitsevskaya, T.E., (1992) ART-CH, a new chicken
retrovirus like element. J Virol. 66, 1726-36.
Hamburguer, V. and Hamilton, H.L. (1951) A series
of normal stages in the development of the chick
embryo. J. Morphol. 88, 49-92.
Helps, N. R., Adams, S.M., Brammar, W.J. and
Varley, J.M., (1995) The Drosophila melanogaster
homologue of the human BBC1 gene is highly
expressed during embryogenesis. Gene. 162, 245-8.
Lassila, O., Martin, C., Dieterlen, L.F., Nurmi, T.E.,
Eskola, J. and Toivanen, P. (1979). Is the yolk sac
the primary origin of lymphoid stem cells?
Transplant Proc. 11, 1085.
Lassila, O., Martin, C., Dieterlen, L.F., Gilmour,
D.G., Eskola, J. and Toivanen, P. (1982). Migration
of prebursal stem cells from the early chicken embryo
to the yolk sac. Scan J Immunol. 16, 265.
McDonald, J.W., Liu, X.Z., Qu, Y. et al. (1999).
Transplanted embryonic stem cells survive,
differentiate and promote recovery in injured red
spinal chord. Nat Med. 5, 1410-1412.
Miura, Y. and Wilt, F.H. (1970). The formations of
blood islands in dissociated-reagregated chick
embryo yolk sac cells Exp. Cell Research., 59, 217-
226
Morrison, S.J. and Weissman, I.L. (1994). The long
term repopulating subset of hematopoietic stem cells
is deterministic and isolatable by phenotype.
Immunity. 1, 661-663.
Morrison, S.J., Wandycz, A.M., Hemmati, H.D.,
Right, D.E. and Weissman, I.L. (1997).
Identification of a lineage of multipotent
hematopoietic progenitors. Development. 124, 1929-
1939.
Morshead, C.M., Reynolds, B.A., Craig, C.G. et al.
(1994). Neural stem cells in the adult mammalian
forebrain: a relatively quiescent subpopulation of
subependymal cell. Neuron. 13, 1071-1082.
Nichols, J., Zevnik, B., Anastassiadis, K., Niwa, H.,
Klewe-Nebenius, D., Chambers, I., Scholer. H. and
Smith, A. (1998). Formation of pluripotent stem cells
in the mammalian embryo depends on POU
transcription factor. Cell. 95, 379-391.
Nikiforov, A., M., and Gudkov V., A., (1994) ART-
CH: a VL30 in chickens? J. of Virol. Feb. 846-853
Niwa, H., Burdon, T., Chambers, I. and Smith, A.
(1998). Self-renewal of pluripotent stem cells is
mediated via activation of STAT3. Genes Dev. 12,
2048-2060.
Nikiforov, M.A. and Gudkov, A.V., (1994) ART-CH: a
VL30 in chickens? J Virol. 68, 846-53.
Ogawa, M. (1994). Hematopoiesis. J Allergy Clin
Inmunol. 94, 645-650.
Ohneda, O., Fennie, C., Zheng, Z., Donahue, C., La,
H., Villacorte, R., Caims, B. and Lasky, L.A.
(1998). Hematopoietic stem cell maintenance and
differentiation are supported by embryonic aorta-
gonad-mesonephros region-derived endothelium.
Blood. 92, 908-919.
Ordahl, C.P., Berdougo E., Venters S.J. and
Denetclaw, W.F. Jr. (2001). The dermomyotome
dorsomedial lip drives growth and morphogenesis of
both the primary myotome and dermomyotome
epithelium. Development. 128, 1731-44.
Orkin, S,H., (2000). Diversification of hematopoietic
stem cells to specific lineages.
Nat Rev Genet. 1, 57-64.
Pardanaud, L., Yassine, F. and Dieterlen-Lievre, F.
(1989) Relationship between vasculogenesis,
angiogenesis and hemopoiesis during avian ontogeny.
Development. 105, 473-85.
Pardanaud, L., Luton , D., Prigent, M., Bourcheix,
L.M., Catala, M. and Dieterlen-Lievre, F. (1996).
Two distinct endothelial lineages in ontogeny, one of
them related to hemopoiesis. Development. 122,
1363-71.
Pardanaud, L. and Dieterlen-Lievre, F. (1999).
Manipulation of the angiopoietic /hemangiopoietic
commitment in the avian embryo. Development. 126,
617-27.
Reagan, F.P. (1917). Experimental studies on the origin
of vascular endothelial and of erythrocytes. Sabin,
F.R. (1920). Studies on the origin of blood vessels
15
 and of red blood corpuscles as seen in the living of definitive lymphohematopoietic stem cells in the day
blastoderm in the chick during the second day of 9 murine yolk sac. Immunity.7, 335-344.
incubation. Contrbi. Embryol. 9, 213. Yoshimura, A. and Misawa, H. (1998). Physiology and
Resnick, R., M., et al. (1990) Rhylogenetic distribution function of the erythropoietin receptor. Curr Opin
of the novel avian endogenous provirus family EAV- Hematol. 5, 171-176.
0. J. Virol. 64, 4640-4653. Xu, Ren-he et al. (1999). Opposite effects of FGF and
Sabin, F.R. (1920). Studies on the origin of blood BMP-4 on embryonic blood formation: Roles of PV:1
vessels and of red blood corpuscles as seen in the and GATA-2. Dev. Biol. 208, 352-361
living blastoderm in the chick during the second day Zaret. K. (1998) Early liver differentiation: genetic
of incubation. Contrbi. Embryol. 9, 213. potentiation and multilevel growthfactor control.
Sacco, M.A., Flannery, D.M., Howes, K. and Current Biology. 8, 526-531
Venugopal, K. (2000) Avian endogenous retrovirus Zon, L.I., (1995). Developmental biology of
EAV-HP shares regions of identity with avian hematopoiesis. Blood. 86, 2876-91.
leucosis virus subgroup J and the avian
retrotransposon ART-CH. J Virol. 74, 1296-306.
Shizuru, J.A. and Weissman, I.L. (1998). Isolation and
characterization of hematopoietic stem cells. In
Hematopoietic cell transplantation (eds Thomas, D.,
Blume, K., and Forman, S.) pp. 65-78. USA,
Blackwell Science.
Siminovitch, L., McCulloch, E. and Till, J. (1963). The
distribution of colony-forming cells among spleen
colonies. J. Cell. Comp. Physiol. 62, 327-336.
Tajbakhsh S, Buckingham M. (2000) The birth of
muscle progenitor cells in the mouse: spatiotemporal
considerations. Curr Top Dev Biol. 48, 225-68.
Till, J.E. and McCulloch, E.A. (1961). A direct
measurement of the radiation sensivity of normal
mouse bone marrow cell. Radiat Red. 14, 1419.1430.
Thomson, J.A., Itskovitz-Eldor, J., Shapiro, S.S.,
Waknitz, M.A., Swiergiel, J.J., Marshall, V.S. and
Jones, J.M. (1998). Embryonic stem cell lines
derived from human blastocysts. Science. 282, 1145-
7.
Weissman, I. (2000). Stem cells: units of development,
units of regeneration, and units in evolution. Cell
100, 157-68.
Wendel, J.F. and Wessler, S.R. (2000)
Retrotransposon-mediated genome evolution on a
local ecological scale. Proc Natl Acad Sci. 97, 6250-
2.
Wilt F., H., (1965) Erythropoieses in chick embryo: The
role of endoderm. Science. 147, 1588-1590
Wilting, J., Brand-Saberi, B., Huang, R., Zhi, Q.,
Kontges, G., Ordahl, C.P, Christ, B., (1995)
Angiogenic potential of the avian somite. Dev Dyn.
202, 165-71.
Wu, A., Till, J., Siminovitch, L. and McCulloch, E.
(1968). Cytological evidence for a relationship between
normal hematopoietic colony-forming cells and cells of
the elinfoid system. J.Exp. Med. 127, 455-467.
Yannaki, E. and Papayannopoulou, T. (2001). Stem
cells have an identity crisis. Haema 4, 158-166.
Yoder, M.C., Hiatt, K., Dutt, P., Mukherjee, P.,
Bodine, D.M. and Orlic, D. (1997). Characterization

16
AGRADECIMENTOS

Antes de mais, estou eternamente grato ao Instituto Gulbenkian de Ciência, que me

aceitou de braços abertos e me adoptou nesta enorme e maravilhosa família.

Ao Dr. Juan Carlos Belmonte, fundador do grupo onde me integrei, GIE-Organogénese,

transmitindo o seu apoio ainda que do outro lado do Atlântico.
Ao Dr. Joaquín Rodríguez León por ter aceite a orientação do meu estágio, por tudo o
que me ensinou durante o período de trabalho, pelo constante encorajamento, incentivo e
por ter incutido em mim o sentido de rigor científico e espírito de equipa.
À Profª.Drª Sólveig Thorsteinsdóttir tudo devo, as maravilhosas aulas de
Biologia do Desenvolvimento e Embriologia Animal deixaram em em mim
a vontade de querer saber mais. Um mundo novo se abriu, um mundo onde
hoje me orgulho de pertencer.
À Sara Marques, incomparável companheira de trabalho, perigosa na ciência
que fazia e que nos deixava a todos sempre alerta.
À Drª.Simone SanMartin Gines, pela alegria, boa disposição, por me ter
ajudado a manter o ânimo mesmo nos momentos mais difíceis por que
passei.
À DrªAna Tavares, sempre pronta a ajudar, detentora de protocolos mágicos
que, com a sua preciosa ajuda, fizeram verdadeiros milagres.
À DrªAna Gaspar, que faz uns cortes histológicos maravilhosos e que me
ajudou enormemente a obter algumas das fotografias do meu trabalho.
À DrªJúlia Lobato, que fez a sequenciação dos meus clones em tempo
recorde, e me ajudou a descobrir a zona oculta do clone X1.
À DrªIsabel Marques, que ajudou a desvendar segredos dos meus clones
através da bioinformática.
À minha namorada, pela enorme compreensão dos dias e noites passadas
sem a ver.
Aos meus pais, por acreditarem em mim e me apoiarem a 100%.

Peço desculpa a todos aqueles que não mencionei mas que sabem que sem
eles este trabalho jamais teria sido realizado.

A todos, o meu sincero obrigado.

ANNEX I: PROTOCOLS

1. Working with SOLR competent cells

1.1. Preparation of competent cells, SOLR‘ Strain

Competent Escherichia coli cells SOLR‘ allows only the excised phagemide to replicate
in the host. On arrival, revive the glycerol-stocked cells by scraping off splinters of solid
ice with a sterile wire loop. Streak the splinters onto a plate containing Luria Bertani, LB,
agar 1.5% and ampicillin (50 mg/ml). Restreak the cells fresh each week.

1.1.1. Preparation of -80°C Bacterial Glycerol Stock

In a sterile 50 ml tube, inoculate 10 ml of LB medium containing ampicillin (50 mg/ml)
with one colony from the plate. Grow the cells for several hours to late log phase at 37°C
in a bacterial culture shaker. Add 4.5 ml of a sterile glycerol-liquid medium solution (5
ml of glycerol + 5 ml of LB-Agar 1.5%-ampicillin (50 mg/ml) to the bacterial culture
previously done. Mix well. Aliquot into sterile microcentrifuge tubes (1 ml/tube). This
preparation may be stored at -20°C for 1-2 years or at -80°C for more than 2 years.

1.2. Transformation of competent bacteria

Thaw the competent bacteria on ice. Add 1 ml of plasmid suspension to 100 ml competent
cells in a 1.5 ml microcentrifuge tube. Mix carefully and keep on ice for 30 minutes.
Heat-shock the bacteria then at 37°C for 20 seconds. Put the cells back on ice for 2
minutes, add 0.5 ml of LB medium and incubate for one hour at 37°C in a bacterial
culture shaker, 1000 revolutions per minute (r.p.m.). Selection of transformed bacteria is
done by plating 50ml of the bacterial suspension on ampicillin containing LB-1.5% agar
plates. Only bacteria that have taken up the desired plasmids, which normally contain
ampicillin resistance cassette, can grow. Different volumes of bacteria suspension may be
used in order to obtain an optimised bacteria growth without colonies confluence on the
plates. One of the colonies that grow on the plate can then be expanded in LB medium
and used for DNA preparation. After usage, seal the plates with parafilm and store them
at 4°C.

2. Working with bacteria

2.1. Bacterial cultures

Plasmid transformed bacteria are selected on LB-1.5% agar plates with ampicillin (50
mg/ml). For overnight mini cultures, pick 1 colony and inoculate in 5 ml LB medium
with ampicillin and shake overnight at 37∞C incubator with shaking at 225 r.p.m..
Overnight midi cultures can be prepared by following the same procedure, changing the
culture volume to 50 ml. For a long storage period of these bacteria, a glycerol stock
culture is prepared as explained in 1.1.1..To start an overnight culture again, take out
bacteria and hold at room temperature (RT) until surface is thawed. Pick a small amount
of cells and mix into 2-5 ml culture medium and leave to grow for several hours at 37°C
in a bacterial culture shaker. The frozen stock is immediately returned to the -80°C.

1
3. General DNA techniques

3.1. Plasmid extraction and purification

3.1.1. Using kit QIAPREP Spin Miniprep

Centrifuge the previously prepared bacterial culture 5 minutes at 13200 r.p.m. in a 2.0 ml
microcentrifuge tube. Resuspend pelleted bacterial cells in 250 ml of Buffer P1. To make
the resuspension process easier you may freeze the pelleted cells in advance. Add 250 ml
of Buffer P2 and gently invert the tube 4-6 times to mix. If necessary, continue inverting
the tube until the solution becomes viscous and slightly clear. Do not allow the lyses
reaction to proceed for more than 5 minutes. Add 350 ml of Buffer N3 and invert the tube
immediately but gently 4-6 times. The solution should become cloudy. Centrifuge for 10
minutes. A compact pellet will form. Apply the supernatants to the QIAprep spin column,
placed into a 2 ml microcentrifuge tube beforehand, by decanting. To avoid dragging the
pellet, you may pipette the last portion of the supernatant. Centrifuge 60 seconds and
discard the flow-through. Wash the QIAprep spin column by adding 500 ml of Buffer PB
and centrifuging 60 seconds. Discard the flow-through and wash QIAprep spin column
again by adding 750ml of Buffer PE and centrifuging 60 seconds. Discard the flow-
through and centrifuge for an additional 1 minute to remove residual wash buffer. Place
the QIAprep spin column in a clean 1.5 ml microfuge tube. To elute the DNA, add 50 ml
of millipore-filtered water, milli-Q water, to the centre of the QIAprep column. Let it
stand for 1 minute and centrifuge 1 minute.

3.1.1.1. QIAPREP Spin Miniprep DNA precipitation

Precipitation of plasmidic DNA is to be applied when a precise concentration of DNA is
required. The quantification of plasmidic DNA already in solution is made by using the
spectrophotometer as described in 3.2.1.. To precipitate the plasmidic DNA from a 50 ml
DNA sample, add 50 ml of TE, 10 ml of AcNa pH 5.0 and 300 ml of -20°C absolute
ethanol. Vortex the mixture, fast-spin centrifuge and incubate at –80°C for 30 minutes.
Centrifuge at 13200 r.p.m. for 30 minutes at 4°C. Carefully discard the supernatant and
add 500 ml of 70% ethanol. Centrifuge at 13200 r.p.m. for 15 minutes at 4°C. Discard the
supernatant and air-dry the pellet at RT. Resuspend the pelleted DNA in a suitable
volume of milli-Q water to obtain a final concentration of 1 mg/ml. Store the sample at -
20°C.

3.1.2. Using kit QIAPREP Spin Midiprep

Centrifuge the previously prepared bacterial culture 30 minutes at 4000 r.p.m. in a 50 ml
centrifuge tube. Resuspend pelleted bacterial cells in 4 ml of Buffer P1. Add 4 ml of
Buffer P2, gently invert the tube 4-6 times to mix and incubate at RT for 5 minutes. Add
4 ml of chilled Buffer P3 and invert the tube immediately but gently 4-6 times. Pour the
lysate into the barrel of the QIAfilter Cartridge. Incubate at RT for 10 minutes,
Meanwhile, equilibrate a QIAGEN-tip 100 by applying 4 ml of Buffer QBT and allow
the column to empty by gravity flow. Remove the cap from the QIAfilter outlet nozzle.
Gently insert the plunger into the QIAfilter Midi Cartridge and filter the cell lysate into
the previously equilibrated QIAGEN-tip. Do not employ excessive force to prevent cell

2
remains to pass. Allow the cleared lysate to enter the resin by gravity flow. Wash the
QIAGEN-tip with 10 ml of Buffer QC. Repeat the Buffer QC wash process once. Prepare
a 15 ml centrifuge tube and elute the DNA with 5 ml of Buffer QF. Precipitate DNA by
adding 3.5 ml (0.7 volumes) RT isopropanol to the eluted DNA. Mix and centrifuge
immediately at 13200 r.p.m. for 30 minutes at 4°C. The precipitation solution may be
placed into several 2 ml microcentrifuge tubes to facilitate the centrifuge process if
necessary. Carefully decant the supernatant. Wash DNA pellet with 2 ml of RT 70%
ethanol and centrifuge at 13200 r.p.m. for 10 minutes. Carefully decant the supernatant
without disturbing the pellet. Air-dry the pellet for 5-10 minutes and redissolve the DNA
in 100 ml of milli-Q water. Store the sample at -20°C.

3.2. Measurement of DNA concentration and integrity analysis

3.2.1. DNA concentration quantification using a spectrophotometer

The DNA concentration is determined by using an UV spectrophotometer at wavelength
of 260 nm. Value 1 of absorvance at 260 nm corresponds to a concentration of 50 mg/ml
double stranded DNA. Identity, integrity and possible purity of the DNA can be
subsequently analysed on an agarose gel.

3.2.2. DNA integrity analysis by agarose gel electrophoresis

Double stranded DNA fragments with lengths between 0.2 kilo base pairs, Kb, and 10 Kb
can be separated according to their lengths on agarose gels. Agarose is added to 1x tris-
acetate- ethylenediaminetetraacetic acid, TAE, to obtain a final concentration of 0.8%.
Boil the suspension in the microwave until the agarose is completely solubilized. Allow
the agarose to cool down to around 50°C before adding ethidium bromide at 0.6 mg/ml
and pour into the gel apparatus. Add DNA gel loading buffer to the DNA sample and
apply on the gel. Load one lane with 5 ml of EUROGENTEC SmartLader. SmartLader
comprises 14 bands of specified sizes, from 200 to 10000 base pairs, bp. By comparison
to the bands migration distance and brightness it is possible to measure DNA sample size
and concentration. After plasmidic DNA agarose gel electrophoresis, 4 bands should be
seen corresponding to the 4 configuration forms of the circular plasmid. DNA
concentration quantification by this mean should not be used alone if an accurate
measurement is required. Electrophorese in 1x TAE buffer at 100 volts. The DNA can be
visualised under UV-light.

3.3. DNA linearization

3.3.1. Restriction enzyme digestion

Plasmidic DNA (1 mg/ml) digestion is performed by restriction enzymes in a 20 ml
reaction volume. The following are placed in a 1.5 ml microcentrifuge tube in this order:
11 ml of milli-Q water, 6 ml of DNA, 2 ml of 10x restriction enzyme digestion buffer and
1 ml of restriction enzyme (10 units, U). Vortex the mixture, fast-spin centrifuge and
incubate in a water bath at 37°C for 2 hours. Perform an electrophoresis with 1 ml of the
sample. One band only should be observed, corresponding to the linearized plasmid. If

3
the circular plasmid band is still present continue the incubation for 1 more hour. A
phenol-chloroform extraction must be done to remove the enzyme from the DNA. To the
20 ml digestion mixture volume, add 20 ml of water and 40 ml of phenol. Vortex to
mixture and centrifuge for 1 minute at 13200 r.p.m.. Carefully remove the upper phase to
another 1.5 ml tube. Add 40 ml of chloroform. Vortex and centrifuge for 1 minute.
Remove the upper phase to a new 1.5 ml centrifuge tube. A thoroughly awareness is
required in this small step. A small presence of phenol and/or chloroform may inhibit or
adulterate future usages of this DNA sample.

3.3.1.1. DNA precipitation

Add 1/10 of 3M AcNa pH 5.0 and 2.5x of -20°C absolute ethanol. Vortex the mixture,
fast-spin centrifuge and incubate at –80°C for 30 minutes. Centrifuge at 13200 r.p.m. for
30 minutes at 4°C. Carefully discard the supernatant and add 500 ml of -20°C 70%
ethanol. Centrifuge at 13200 r.p.m. for 15 minutes at 4°C. Discard the supernatant and
air-dry the pellet at RT. Resuspend the pellet in a suitable volume of milli-Q water to
obtain a final concentration of 0.5 mg/ml. Store the sample at -20°C.

3.4. DNA transcription

3.4.1. Digested/linearized DNA transcription

Prepare a transcription reaction with a total volume of 20 ml. The following are placed in
a 1.5 ml microcentrifuge tube in this order: 10 ml of milli-Q water, 4 ml of linearized
DNA (2mg), 2 ml of digoxigenin-UTP RNA labelling mix, 1 ml of RNAse inhibitor (40
U), 2 ml of 10x transcription buffer and 1 ml (20 U) of T7 RNA polymerase. Vortex the
mixture, fast-spin centrifuge and incubate in a water bath at 37°C for 2 hours. Perform an
electrophoresis with 1 ml of the sample. Two bands should be observed, corresponding to
the RNA forms. If the linearized plasmid band is still present continue the incubation for
1 more hour, or the time you find to be more suitable, until the transcription reaction is
fully performed and no DNA is present.

3.4.1.1. RNA precipitation

Add 1/10 of 4M LiCl and 2.5x of -20°C absolute ethanol. Vortex the mixture, fast-spin
centrifuge and incubate at –80°C for 30 minutes. Centrifuge at 13200 r.p.m. for 30
minutes at 4°C. Carefully discard the supernatant and add 500 ml of -20°C 70% RNAse-
free ethanol. Centrifuge at 13200 r.p.m. for 15 minutes at 4°C. Discard the supernatant
and air-dry the pellet at RT. Resuspend the pellet in 50 ml of diethylene-pyrocarbonate
(DEPC) 0.1%-milli-Q water. Store the sample at -20°C.

3.5. DNA Sequencing (Sanger dideoxy method)

3.5.1. Automated sequencing with ABI Prism BigDye Terminator kit

For each reaction, mix the following reagents to obtain a total volume of 20 ml: 8 ml of
terminator ready reaction mix, 200-500 ng of double stranded DNA, 3.2 pmol of primer
and add the suitable volume of milli-Q water to obtain the desired final volume.

4
3.5.1.1. Cycle sequencing
Place the tubes in the thermal cycler. Begin cycling as follows:
- rapid thermal ramp to 96°C (DNA denaturation temperature)
- 96°C for 10 seconds
- rapid thermal to 50°C
- 50°C for 5 seconds (annealing temperature)
- rapid thermal ramp to 60°C
- 60°C for 4 minutes (polymerisation/termination temperature)
- repeat for 25 cycles
- rapid thermal ramp to 4°C and hold until ready to purify (rapid thermal ramp is
1°C/second).
These are the standard reaction conditions for cycle sequencing. Individual sequences
may require optimisation.

3.5.1.2. Sequencing product ethanol precipitation

For each reaction, prepare a 1.5 ml microcentrifuge tube with the sequencing sample and
add the following in this order: 2.0 ml of 3M AcNa pH 5.0 and 50 ml of 95% ethanol.
Vortex the tubes and leave at RT for 1 hour to precipitate the extension products. Spin the
tubes in a microcentrifuge for 30 minutes at 13200 r.p.m.. Carefully aspirate the
supernatant with a micropipette tip and discard. Rinse the pellet with 250 ml of 70%
ethanol. Vortex briefly. Spin for 10 minutes in a microcentrifuge at 13200 r.p.m.. Again,
discard the supernatant and air-dry the pellet at RT.

3.5.1.3. Preparing and loading the sequencing standard for the ABI 377 Sequencer
Prepare a loading buffer by combining deionised formamide and 25 mM EDTA (pH8.0)
containing 50 mg/ml of Blue dextran in a ratio of 5:1 (formamide: EDTA/Blue dextran).
Resuspend the Standard in 5ml of loading buffer. Vortex thoroughly, then spin briefly in a
microcentrifuge. Heat the Standard at 90°C for four minutes to denature. Place on ice
until ready to load. Load 2 ml of Standard and run the ABI 377 Sequencer.

3.6. DNA subcloning

To subclone inserts from one vector into another vector, the insert can be anywhere from
30 bp to 8 Kb (possibly higher). A restriction map analysis is necessary in order to
prepare both vector and insert DNA. Use the sequencing data and utilize a bioinformatics
program such as MacVector‰ 7.1.1 software package (Accelrys) to make a full
restriction map and select the required restriction enzymes. Cross the information
between the restriction maps to select the enzymes in order to obtain compatible DNA
overhangs.

3.6.1. Insert DNA and vector preparation

3.6.1.1. Restriction enzyme digestion of DNA/insert and vector

Perform restriction enzyme digestion of insert DNA and vector to obtain compatible
overhangs. Prepare a restriction digestion reaction as follows: for a reaction with a total
volume of 20 ml, add 1-10 ml of DNA (2 mg total), 2 ml of 10x restriction enzyme

5
digestion buffer, 1-2ml (20-40 U is sufficient) of enzyme 1 and 2 and milli-Q water to 20
ml total volume. Vortex the mixture, fast-spin centrifuge and incubate in a water bath at
37°C for 2 hours. Do not over-digest to avoid star activity to happen. A phenol-
chloroform extraction and posterior precipitation must be made as explained at 3.3.1. and
3.3.1.1. respectively.

3.6.1.2. Insert DNA band extraction from TAE-1% agarose gel (GENECLEAN“ II
KIT)
In order to obtain the fragment you want to subclone, run an electrophoresis with the
previously digested DNA sample. Use the total volume of the digestion reaction, add 1/5
of DNA gel loading buffer to the DNA sample and apply on the gel. Electrophorese at 80
volts. Let it run extensively to make sure the bands are well defined and spread. The
DNA can be visualised and cut from the gel under UV light. Weight the cut gel. Place the
cut gel into a 2 ml microcentrifuge tube. Add 3x volume of NaI (0,1 g of gel equals a 100
ml volume). Incubate at RT until the gel dissolves completely, approximately 5 minutes.
If agarose is still present, place the tube in a 45-55°C water bath incubator. Add
GLASSMILK according to the final volume and amount of DNA. For a <500m l volume
and <5 mg of DNA, add 5 ml of GLASSMILK. Vortex and incubate at RT for 5 minutes.
Mix every 1-2 minutes to ensure that GLASSMILK stays suspended. Pellet the silica
matrix with the bound DNA by spinning in a microcentrifuge for approximately 5
seconds at full speed. Wash the pellet 3 times with prepared (ethanol added) NEW Wash.
Add 10-50 volumes (200-700 ml is convenient) of prepared NEW Wash to pellet. Air-dry
the pellet. Elute the DNA from GLASMILK by adding 20 ml of milli-Q water. Vortex
and microcentrifuge for 30 seconds to make a solid pellet. Carefully remove the
supernatant containing the eluted DNA and place in a new tube.

3.6.2. DNA ligation reaction

The DNA ligation reaction is to be done with previously digested DNA as explained in
3.6.1.1.. T4 DNA ligase catalyses the ligation of double-stranded DNAs between the 3'-
hydroxy and the 5'-phosphate termini in the presence of ATP. Prepare a ligation reaction
with a total volume of 20 ml in a 1.5 ml microcentrifuge tube. Place 1 ml of T4 DNA
ligase (1 U), 2 ml of 10x ligation buffer, 50-100 ng of linear vector DNA and a calculated
amount of insert DNA (with compatible ends) respecting an insert:vector molar ratio of
3:1 and milli-Q water to 20 ml total volume. Prepare a second reaction with an
insert:vector molar ratio of 5:1. The amount of insert DNA used for each ligation can be
calculated using the following formula:
ng of insert = (ng of vector X size of insert (Kb) X insert:vector molar ratio)
size of vector (Kb)
Vortex the mixture, fast-spin centrifuge and incubate at RT for 1 hour. Store the samples
at 4°C until use for 2 days maximum.

3.6.3. Transformation of competent bacteria with ligated DNA

6
Use the ligated DNA obtained as in 3.6.2. and transform the competent bacteria as
described in 1.2. with the following adaptations: transform 3 ml of ligated DNA, proceed
as explained and plate the transformed bacteria in different volumes of bacteria
suspension, 25 ml, 50 ml and 100 ml. If there is an absence, or excess, of colonies
formation, use the stored transformed bacteria and plate more suitable volumes.

4. Whole mount in situ hybridisation

Chick embryos harvested at different developmental stages were fixed overnight in 4%

paraformaldehide (PFA) in PBS at 4ºC. They were then washed two times in PBT and
dehydrated in a series of methanol/PBT solutions at 4ºC (25% methanol, 50%, 75% and
100%) and subsequently frozen at –20ºC. The washing times increase with the
developmental stage.

Day 1 – Probe hybridisation

Embryos were rehydrated in methanol/PBT washes (75% methanol, 50% and 25%) and
were rinsed two times in PBT. They were then transferred to a 6% hydrogen
peroxide/PBT solution and were incubated at room temperature for 1 hour. After the
incubation period, the embryos were washed 3 times in PBT and were treated with
proteinase K in PBT (10 mg/ml PBT). The reaction was stopped by rinsing the embryos
with glycine in PBT (2mg/ml) and then refixed for 20 minutes in a 4% PFA/ 0,2%
glutaraldehide solution. After 2 washes in PBT, the embryos were prehybridised for 3
hours at 70ºC in hybridisation buffer. The buffer was then replaced with new
hybridisation buffer with 500 ng of labeled probe per ml. Hybridisation proceeded
overnight at 70ºC.

Day 2 – Antibody binding

To remove the excess of probe the embryos were washed in two stringent solutions: they
were washed two times for 1 hour in solution 1 and two times for half an hour in solution
2. To avoid unspecific antibody binding, the embryos were rinsed in MABT two times,
transferred to MABT/ 2% blocking reagent and incubated at room temperature in a
shaker for 3 hours in MABT/ 2% blocking reagent (Roche)/ 20% goat serum. The
blocking solution was replaced with new blocking solution with 1:2000 alkaline
phosphatase conjugated anti-digoxigenin antibody (Roche) and the embryos were
incubated overnight in a shaker at 4ºC.

Day 3 – Washing and detection

The excess of antibody was removed by several washes in MABT with 2mM levamisole
depending on the embryo’s stage. The embryos were then transferred to a higher pH
buffer, NTMT, and washed in it several times. To develop color NTMT was removed and
replaced with Bmpurple (Roche). The enzymatic reaction was stopped by washing the

7
embryos in PBT three times and they were refixed in 4% PFA. The embryos were stored
at 4ºC in PBT with 1mg/ml azide.

5. Inclusion and sections

5.1. Technovit 8100 (Heraeus Kulzer) inclusion and sectioning with ultramicrotome

The embryos were dehydrated in a series of ethanol/PBT (30% ethanol, 50%, 80%, 90%
and 100%) in a shaker. After dehydration the embryos were incubated in solution A, in
the roller, overnight at 4ºC. The embryos were included in the desired position in solution
B on plastic molds. After removal of air bubbles the molds were covered with parafilm
and left at room temperature for at least 1 hour. To solidify the resin the molds were kept
at 4ºC. Sections with 25 mm of thickness were performed using an ultramicrotome (LKB
Ultratome III type 8810A)

5.2. Gelatin/Albumin inclusion and sectioning with vibratome

The embryos were fixed in 4% PFA/0,2% glutaraldehyde for 30 minutes and then washed
two times in PBS for 15 minutes at room temperature. The embryos were then
equilibrated 0,5% gelatine/ 30% albumin/ 20% sucrose in PBS. Using a small vial, molds
of aluminum foil were shaped keeping a flat bottom with approximately 1,5-2 cm of
diameter. A layer of 1 ml gelatin/albumin mix with 70 µl of 25% glutaraldehyde was
poured into the bottom of the aluminum foil mold. The embryo was placed on top of this
layer and the excess of gelatin/albumin mix was soaked with a piece of paper. A top layer
was made exactly as the bottom one. This mix turns solid almost in a matter of seconds
so the procedures described must be done very quickly. After removal of the aluminum
foil mold, the block was attached to a base that was placed parallel to the cutting plane on
a Leica VT1000S vibratome and sections of 30-40 mm were performed.

5.3. Gelatin/Sucrose inclusion and sectioning with cryostat

The embryos were fixed in 4% PFA overnight at 4ºC and then rinsed in PBS. They were
transferred to 15% sucrose in PBS, left until they sinked and then placed in a 5 ml falcon
containing 15% sucrose/7,5% gelatin in PBS. They were incubated for 30 minutes to 1
hour at 37-40ºC. Meanwhile a layer of 15% sucrose/7,5% gelatin in PBS was poured into
a Petri dish. The embryo was then placed on top of this layer when it began to solidify
and covered with another sucrose/gelatin layer. To solidify, the molds were put at 4ºC.
When solid, a block containing the embryo was cut and glued with Tissuetek on a hard
paper. A flask with isopentan was cooled on dry ice recipient and the block was diped
into the isopentan for 1 minute. The block was then placed into the cryostat and sections
of 25 mm were performed.

8
All the embryo sections were analyzed with a Leica Stereoscope - Leica MZ12.5 + CCD
camera.

6. New culture technique

The eggs were cleaned with 70% ethanol and the shell was cut while the albumin was
being removed. After that, the yolk was transferred to a bowl half filled with PBS. The
albumin attached to the viteline membrane was carefully removed with a Pasteur pipette.
The yolk was placed with the embryo on top of it and the viteline membrane was cut at
the equatorial plan. The viteline membrane was gently separated from the yolk using
forceps in order to maintain the embryo attached to it. Then, both the viteline membrane
and the embryo were transferred with a spoon to a Petri dish. The embryo was placed
with the ventral side up. A plastic ring was positioned on top of the viteline membrane
surrounding the embryo. The liquid outside of the ring was removed and all the viteline
membrane kept outside the ring was pushed over it in order to mimic the superficial
tension on the egg. After coverage of all ring with the viteline membrane, the ring was
transferred to a 50% agar/ 50% albumin 35 mm Petri dish. To allow further development
the Petri dishes containing the New cultured embryos were incubated in a plastic box
with wet paper and incubated at 38ºC.

9
ANNEX II: SEQUENCES OF THE SELECTED CLONES

X1

GTCTAAAACTACCGGATCCCCCGGGCTGCAGGAATTCTGCACGAGGCGCGCC
CCGCCCTGTGGCTGGGCCCATCCGGCCCATCGTGAGGTGCCCGACTGTCAGA
TACCACAAAAAAGTTCGTGCTGGCAGAGGATTCAGCCTAGAAGAGCTTAAAC
TGGCGGGCATTAACAAAAGGTTTGCTCGGACGATTGGAATCTCCGTGGATCC
CAGGCGAAGAAACAAATCTACAGAGTCACTGCAAGCCAACGTGCAGCGGCT
GAAGGAGTATCGCTCCAAGCTTATCCTCTTCCCAAGGAAGCCGTCTGCACCG
AAGAAAGGAGACAGCTCTCCTGAGGAACTCAAGATGGCAACTCAGCTGTCCG
GACCGGTTATGCCGATCAGGAACGTTTTCAAACGGGAGAAGGCCCGTGTTAT
CTCAGAGGAGGAGAAGAACTTCAAGGCTTTGCCAGCCTGCGCATGGCCCGGG
CAAACGCTCGTCTCTTTGGGATCCGTGCAAAACGTGCCAAAGAAGCGGCGGA
GCAGGACGTGGAGAAAAAGAAATGAACCGTTCTTGGTAGAACTGTCAATAA
AAAGTTGGAAGTGGAAAAAAAAAAAAAAAAAACTCGAGTTTTTTTTTTTTTT
TTTCATCACTTCTGGCTTTATTTGGGTTACAGGCTCAGGGGCCGAACAACAAA
CGCTGTGTACTGAGGTCGAGTCTTCAAACATTGTATCCAATAGGCCTCGTTGG
CTATGATCCCCAATGGAAACCCCTTACCCCTTTGGGGGCCCAAACCGTTCTTA
ACGCTTCCTGCCGGGACTGCCCAGCGGCCGGCTGAAACTCTGACATGGCCTT
TATTCTGGCATGGCCTTGGGGATCTACCGGGGTGGAGGGGCAAGCTCACCTT
ACATATCCCAAACGGGGCCGGCAAGGTTTAAGTCCCCCAAAAACCTTAAAAA
TTAGGCCCCGGGTGGGAGGGCTTGACAATTTTTGCCGGCTGGCCATCCTGAA
ATCCTTTGCCCAATTCGGCCCAGGTTCCGCCAGGGGCATTCCTCCCTTTTGGC
CCTCCAGGGGGGTGGCAATGATTTTTAAAAAAAAAAAAAGGGCTGGTTTTTC
CGGGGGAGGAAAAACCGCCTGATGGTTTATCGGGGTTGGAAAGGTTTTCCAA
GCTTCCGGGATTGAAAACCGGCCCAAGGGCCCCTCCCCGGGGTCCCCCGGGA
ATTTGAAAAAGCCAAACCTTCCTTAAACCCCAACAAAAAAAAAAAAAAAAA
AACTCGAGTTTTTTTTTTTTTTTTTTCATCAGCTCCTGGCTTTATTTGTGTTACA
GGCTCAGGGCCGCAGCAGCAAACGCTGTGTTACTGAGGTCGAGTCTTCAAAC
ATTGTATCCAATCAGGCCTCGTTTGCCTATGATCTCACCAATGTAAAACCACA
TCAGCACCTCTGTGGCCACCAAACCGTTCCTCAGCGCTTCCCTGACCGTGAGC
TGCGCCAGGCGGCCGGACTGAAAGCTCCTGACCATGGCCTTCATGCTGTCGA
TGGCCTTGGGGATCTCACCGGGTGTTGGAGGTGCAAGCTCGACCTTAGCATA
GTACCAGAACGTGGCCAGGCGAGGCTTCGAGTACGCCACAGCAGCGCTCAGC
AGCTGAGGCCCGCGGGTGGTGAGGCGCTGCACCAGCTTCTGCGCGGCCTGCG
CCATGCCTGAAAGTCCCTCGTGCCGAATTCGGCACGAGGATGCGGACAGGGG
GCATAGCCTACCGTCTCTGGTCACTCCCAGGGGCGGTAGTGCGAGTGATAGT
GTAGAAGAGAAAGAAGGGACTGGCTTTGAGTGCAGGGGGAAGGATCAAATG
ACGGACTGGAATGGATTAGATCGGAGGCTTTGGAAAGGTATAGTTCCAAGGC
ATTCCGGGTGATTGTGAGTGATCGTGGTCCCGAATGGGTGCCGCTGACCCCG
GGGGTGTTACGCGCCTGGTGGAATTTATGGATAAAAGAGGCCTGAATCGCCT
CTGACATTAAATGCACTACAAACTTTGGCTGCACTGGGGCCTCTCTTCCCCCG
TGACATCACAAACTTAATGCGTATGGTGCTCAGGCTGGTTCAATATACGTTAT
GGGAGACGGACTGGGTGGCCGAGTTGGGGGGCCGTGCCGGGGCGACAGGGG
TCGGCCCGGGCTGCTCCCTGCATGGGACCGGAATACAGCGGCTTTCAGGGAA

10
GGCCGTGGGAGTGGCTTCGCCCCAGGGCCAGCTAGCGAGACTAAGGCCAGG
GGAGCTAATAGCAGCCACAGATGCAGTGGTGGAAGCGTTTAATAAACTTGTG
CATAAGGCCGAACCACCTACTCCGTGCACAGATATTACCCAGGGCCCGAATG
AATCCTTTCAAAGCTTTACAGACAGGCTTTTAGCTGCTGCAGAGGGGTCTGAT
CTCCTGGTACCGGCCCAAGGGCCAGTGATCATTGACTGCTTGCAGCAGAAAT
CGCATGACAATGTTAAGGCATTGCTGCGAGCCGGCCGAAGTACGCTTAATAC
CTCGGGAGCCGGCCGAAGTACGCTTAATACTCGGGAGAAGTTATTCAGTATG
TCTTAGATAAGCTCAAGGTGGCTCATTTAACTAATGAAAGGCTAGTCACAGC
TATTGTCGTAGCTGTTGGCCTGCGACAGCAAAGATCGCTGCAGCAGCAAGGG
CTGTGTTTCCGATACGGCCAGTATGGCCATGTTAGAGCACAATGCCCCTGTGG
GGGAGGCCAGTCAGGGCCTCCTGATCACAGGAAGGGCTTGCTAAAGGGTATC
CGTGGTCGGGTATGCAGCAGTTAAATATCATGAATCTGGGAAATTCTGTGGG
TACCATCGCGAAAAGTAATACCAGATATAAGTAGCATATCTGCAAAAACTGA
GTCTAGGTGCGAGTTTTCTACAGAAATTCTTCGTTGGCAGACCGAAGCCAACT
CCAGAACAACTGAGGGACAGACGATGGGATCAAGAACCACTCGTCAAGAGG
AGCACTACACCTGCAACGCTGACACTTCCGATGTTGCCGATGTTTATGGTGTC
CATGGCGATTACAGAGTGTCACAACAACTACAATGGACACAAGAACATATGC
AGAAATTAAAGAAGAGCGTGATCCCTTTGAAACTGGCTGGACGGACTGTTTG
GGAACGGGTTCATGGTTAAAGCAATTGCTTAAAGCTCTCGCAGTAGATTTGC
AATCTTTGTGTGTATTCTAATCTGTCTTCCATGCTTTGTAGATGCTTGCAGAAC
TGCCTTCAACGAATGATGGCAAGACTTTTGACTATCACATTGAGTATCATAGA
TTGCGTGAAAAATTATAGAGGGTTTAGGTTGTTGCGTTCGTGCTGTAACGGGG
CAAGGCTTGGCCGAGCACGGAAAAGAATTCCCTGTTGCTCTGATGATTGCTT
AAGAACTGTAGTAGAAAATAGTAGGAATAGTGTGCTGAAATATATTTAGGAT
TAGGCGTTTTGCGCTGCTTCGCGATGTACGGGTTAGGTGTGTGTGTAAGTAGT
ATTTAGCTTAGGGAGGGGGAGATGTTGTAGTAGGCGTCTTGCGGGGGCACGG
GATGTACGGGACAGGCCTCTCCCTAAACATAGAGAGATAGTGCTATCGTGCT
GACCTTGTTGCAGAGAAAACAGGAGAAGAAGAAGGATGATAAAAGAATGTG
GAAACGGCCAAATAAGGCACAATGTTATCTGGTGTGAACTAATCAGAGTGGG
ACATGACAGCACGGTTATCTAGGTAAAAATGTATATAAGCTGTGTTTAGTAG
TGAATAAACG

X2 (Rho hemoglobin)

GNTTTTNGAAAANCTCCCNCNGGTGTTCCCCCGGGCTGCAGGAATTCGGCAC
GAGGTTCTTTGATAACTTCGGGAACCTCTCCAGCCCCACCGCCATCATTGGTA
ACCCCAAGGTCCGTGCTCACGGCAAAAAAGTGCTGAGCTCCTTTGGGGAAGC
CGTGAAGAACCTGGACAACATCAAGAACACCTACGCCAAGCTGTCGGAGCTG
CACTGCGAGAAGCTGCACGTGGACCCCGAGAACTTCAGGCTCCTGGGGAACA
TCCTCATCATCGTGCTGGCCGCGCACTTCACCAAGGACTTCACCCCGACCTGC
CAGGCTGTCTGGCAGAAGCTGGTCAGCGTGGTGGCCCATGCCCTGGCCTACA
AGTACCACTGAGCTCCCAGAGCAGGACACAGTGTGAAAGTCAATAAAAAAG
CACATTGCCTGCCTCGNGGNCGNCGGGTTCNAAAGCTTGATTTNAAATTTGG
GACGAGGCTCATTNTCTGGNCNGGGCAATTTTTNGGNCAANCCTAATTTNGG
GCTT

11
X4 (E cadherin)

CTNCCCCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGG
AATTCGGCACGAGGCGAAGAAGGAGGCCGTGCCACCGAAGACGGAGGCAAA
GGCGAAGGCGCTGAAGGCCAAGAAGGCCGTCCTGAAGGGAGTCCACAGCCA
CAAGAAGAAGAAGATCCGCACATCACCCACCTTCAGGAGGCCCAAGACCCT
GCGCCTGCGACGGCAGCCCAAATACCCCCGGAAGAGCGCCCCAAGGAGGAA
CAAGCTTGACCATTATGCCATTATCAAGTTCCCTTTGACCACAGAATCTGCAA
TGAAGAAGATAGAGGATAACAATACTCTGGTTTTCATTGTTGATGTCAAGGC
AAACAAGCACCAGATCAAACAGGCAGTCAAGAAGCTGTATGATATTGATGTG
GCCAAGGTCAACACCTTAATAAGGCCTGATGGGGAGAAGAAGGCTTACGTCC
GACTGGCTCCTGACTACGATGCGTTGGATGTAGCCAACAAGATTGGAATCAT
CTAAACTGCATCTGCCAAGGACTGTACAGACAGGATAATAAACCCTGTAAAA
ACCAAAAAAAAAAAAAAAAAACTCGAGGGGGGGCCCGGTACCCAATTCGCC
CTATAGTGAGTCGTATTACAATTCACTGGCCGCGTTTACAAC

q4
TCACTCTTCGAGGGATGCTAATTCTGACTGTAAGCAGCTGAAGAGCCACTCCT
TTCTTTCTCCTCCAGCAGCCTGGTCACCACTGCTTTTCCAAGAGCTCCTCTAG
GGAAAGGCAGTGGACAGCTCAGTTTCAGACTAAAAAGCACACTTGTTGGTTT
TTGGAAAGCTCTCCCCAGAGACCTGGCAAAGGCACCCCCCTGTAACAATACA
GGAGGCAGTTCTCCCCTTGCCTTTGGAAAGGAGCTCTCTTGAAAGCCTGACTA
ATACGTTGTGAGGGATTATAGGATTAAAGAGCCTCCTAAAGGGTACAGCCCA
GCTTCTAGCAGATGCCCACTATTTCTTTATTTCAAGGATAGCGATGCTGCAGT
GTAAATGTCAACGCTTTCATGAGCCTCAGCGTTGGCAGGCCCAGCGACACAC
AANGCTTATCGGTACCCGGCCCCCGCTCTGGGAATCCACAANGCTTTTTTTTG
GTAAAAGCACATTCTATATTAAATAATTAGCTTTATGTAANAAAAGTTCAAG
GTAANAANAGGACGTTGNTTTGCTTTGCTCTGCANGCAGCCATCGCTCATGA
AATGATCTTACATAACCTCGTGCCG

12