Você está na página 1de 39

PCR

O que PCR
Por que usar?

Reao em Cadeia da Polimerase

PCR (Polymerase Chain Reaction)


um mtodo de amplificao (de criao de mltiplas cpias) de DNA sem o uso de um organismo vivo (bactrias ou leveduras) Consiste em fazer cpias de DNA in vitro, usando os elementos bsicos do processo de replicao natural do DNA

A PCR muito diferente da clonagem gnica, em vez de utilizar uma srie de manipulaes envolvendo clulas vivas, a PCR executada em um nico tubo.

A PCR foi inventada por Kary Mullis em 1983, tendo-lhe sido posteriormente atribudo o Prmio Nobel de Qumica pelo seu trabalho, em 1994.

PCR
uma ferramenta muito til em vrias reas:
Sequenciamento de genes Fingerprint gentico (testes de paternidade e medicina forense) Diagnstico de doenas Criao de organismos transgnicos Melhoramento gentico, etc

PCR
Solues para amplificao
dNTP+MgCl2+Tampo+H2O+DNA+Primers+Taq Primer Incio da sntese
Tampo dNTP Taq DNA

Arbitrrio
Especfico

MgCl2
Primers H2O

Termociclador

Primers ou iniciadores

Os primers arbitrrios so comprados prontos. Ex: OPL-19 (GAGTGGTGAC - Operon Technologies Inc.)
Programa para desenhar os primers especficos: http://frodo.wi.mit.edu/
GAGTGGTGACCATATATCAACTGGGGACAAAGATGCTATCCTACTTTTCAAGGCAG CTGTCTATTTTAGTCTCCATCTTACACCACCCTTCGCTTCGTGAATTTCTCACCACAA TCAATGAGCTTCCAAGTTAGTTTATAGCTAGTTGAACATTATTTTTGACGAGTCGAT GGTGATGATGATGATAATTGTGATCACTGCAGAGTTGAGAACAGATGTAGTATGAC AGTTTGTAACAGTTAGATTCCTAGCTTCTGCTGTAACGTCATTATTCTTGGCTGATG AGAGCAATAGCATGGTCGAACTGGGGATGTGGCTTATACTTGACTGTTTGCTTAAG AGTTCAGACGGAGTGTGTGCTTGTCTTGTTTTGTAGTATTACTTTTTATCCTCGAAA GAAAAACAAGATTTTCTGCCAAAAAAAAAAAAAAAA

Termociclador

Etapas da PCR:
1.Desnaturao do DNA (92 a 94C)

2.Anelamento dos oligonucleotdeos (primers ou iniciadores) (50 a 60C) 3.Sntese de DNA (Taq polimerase) (72 a 74C) 4.Nova desnaturao do DNA (94C) e assim sucessivamente por vrios ciclos Ex) 45 ciclos de: Desnaturao a 95C por 15 segundos,
Anelamento a 59C por 15 segundos, e sntese a 72C por 30 segundos

PCR Polimerase Chain Reaction

Princpio

Variao de Temperatura
Denaturao
Anelamento Elongao

Atividade da Taq (Thermus aquaticus)


(bactria termoflica, suporta altas temperaturas 70 a 95)

Taq polimerase
Foi identificada pela primeira vez na arqueobactria Thermus aquaticus, encontrada em fontes hidrotermais. A Taq polimerase suporta as elevadas temperaturas usadas em PCR, suporta 94 C por at 40 minutos.
Fonte hidrotermal no Parque Nacional de Yellowstone USA onde vive a bactria Thermus aquaticus

Nmero de ciclos 1 2

Cpias do DNA alvo 1 2

3
4 5 6 20 30

8
16 32 64 1.048.576 1.073.741.824

Animao PCR

http://www.youtube.com/watch?v=_YgXc J4n-kQ&feature=related

Etapas da PCR:

1.Isolamento do DNA

2.PCR
3.Eletroforese - aps a amplificao
feita uma eletroforese em um gel para a visualizao do DNA

Substrato

Agarose (acima de 100 pb a 20Kb)

Separao por peso molecular

Malha de agarose

Sistema de Eletroforese

Aplicao e migrao do DNA no gel

Deteco e visualizao
Brometo de etdio Luz UV

Sistema de captura de imagem

Marcador de peso molecular (ladder)

Gel de poliacrilamida
mais difcil de preparar. Como o oxignio inibe a polimerizao da poliacrilamida, o gel precisa ser montado entre placas de vidro.
Acrilamida: potente neurotxico e deve ser manipulado com cuidado!!!Luvas e mscaras devem ser usadas para pesar o p.

Gis de poliacrilamida possuem baixa capacidade de separao, mas alta capacidade de resoluo. A poliacrilamida usada para separar fragmentos menores que 500 bp. s vezes podem ser separados fragmentos com tamanho de apenas uma base de diferena.

24 h

36 h

48h

Impregnao do gel com nitrato de prata Nucleotdeos marcados com 33P exposio do gel a filme de Raio-X

Animao gel de agarose


http://www.youtube.com/watch?v=9f2VSyVhsGI&featur e=related

PCR em Tempo Real (PCR Real Time)


O PCR convencional no apresenta valores quantitativos, por isso foi desenvolvido o PCR em tempo real, que uma tcnica descrita como quantitativa porque consegue realizar a avaliao do nmero de molculas produzidas a cada ciclo.

uma amplificao convencional de DNA, porm a deteco do resultado feita ao longo dos ciclos. Para que isso ocorra um fluorforo (SYBR green) adicionado reao. Conforme a amplificao ocorre, ao final de cada ciclo emitido um sinal fluorescente que captado por um sistema tico e convertido em um grfico de amplificao. Alta sensibilidade e menor risco de contaminao.

O SYBR Green se liga entre a fita dupla de DNA e com a excitao da luz emitida pelo sistema tico do termociclador, emite uma fluorescncia verde.

Sistema tico para excitao da fluorescncia

Nmero de ciclos
10 12 14 16 18 20 22 24 26 28
3000 2500
Fluorescence

2000 1500 1000 500 0

Cycle Number

Quantificao clssica (baseado em gel)

Real-time Quantitativo (fluorescente, no baseado em gel)