Você está na página 1de 355

Provas Vestibular UFRGS

2011 - 2014

ufrgs.br/peac
alternativacidada.blogspot.com
peac@ufrgs.br

(51) 8438-1124

Sumrio
Fsica

Literatura

39

Espanhol

82

Ingls
Portugus

106
131

Biologia

163

Qumica

197

Geografia

232

Histria

279

Matemtica

314

Gabaritos

354

2011
FSICA
Instruo: As questes 01 e 02 esto relacionadas ao enunciado abaixo.
Um objeto lanado da superfcie da Terra verticalmente para cima e atinge a altura de 7,2 m.
(Considere o mdulo da acelerao da gravidade igual a 10 m/s2 e despreze a resistncia do ar.)
01. Qual o mdulo da velocidade com que o objeto foi lanado?
(A)
(B)
(C)
(D)
(E)

144 m/s.
72 m/s.
14,4 m/s.
12 m/s.
1,2 m/s.

02. Sobre o movimento do objeto, so feitas as seguintes afirmaes.


I - Durante a subida, os vetores velocidade e acelerao tm sentidos opostos.
II - No ponto mais alto da trajetria, os vetores velocidade e acelerao so nulos.
III- Durante a descida, os vetores velocidade e acelerao tm mesmo sentido.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas
Apenas
Apenas
Apenas
Apenas

I.
II.
I e II.
I e III.
II e III.

03. Um satlite geoestacionrio est em rbita circular com raio de aproximadamente 42.000 km em
relao ao centro da Terra.
(Considere o perodo de rotao da Terra em torno de seu prprio eixo igual a 24h.)
Sobre esta situao, so feitas as seguintes afirmaes.
I - O perodo de revoluo do satlite de 24h.
II - O trabalho realizado pela Terra sobre o satlite nulo.
III- O mdulo da velocidade do satlite constante e vale 3.500 km/h.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas I.
Apenas II.
Apenas I e III.
Apenas II e III.
I, II e III.

UFRGS CV/2011 FIS

04. Um cubo macio e homogneo, cuja massa de 1,0 kg, est em repouso sobre uma superfcie plana
horizontal. O coeficiente de atrito esttico entre o cubo e a superfcie vale 0,30. Uma fora F,
horizontal, ento aplicada sobre o centro de massa do cubo.
(Considere o mdulo da acelerao da gravidade igual a 10 m/s2.)
Assinale o grfico que melhor representa a intensidade f da fora de atrito esttico em funo da
intensidade F da fora aplicada.

(B)

(A)

(D)

(C)

(E)

UFRGS CV/2011 FIS

05. Considere o raio mdio da rbita de Jpiter


em torno do Sol igual a 5 vezes o raio mdio
da rbita da Terra.
Segundo a 3 Lei de Kepler, o perodo de
revoluo de Jpiter em torno do Sol de
aproximadamente
(A)

5 anos.

(B)

11 anos.

(C)

25 anos.

07. O resgate de trabalhadores presos em uma


mina subterrnea no norte do Chile foi
realizado atravs de uma cpsula introduzida
numa perfurao do solo at o local em que
se encontravam os mineiros, a uma
profundidade da ordem de 600 m. Um motor
com potncia total aproximadamente igual a
200,0 kW puxava a cpsula de 250 kg
contendo um mineiro de cada vez.

(D) 110 anos.


(E) 125 anos.
06. Assinale
a
alternativa
que
preenche
corretamente as lacunas no fim do enunciado
que segue, na ordem em que aparecem.
Um objeto desloca-se de um ponto A at
um ponto B do espao seguindo um
determinado caminho. A energia mecnica
do objeto nos pontos A e B assume,
respectivamente, os valores EA e E B , sendo
E B < EA . Nesta situao, existem foras
........ atuando sobre o objeto, e a
diferena de energia EB EA ........ do
........ entre os pontos A e B.

Fonte: <http://www.nytimes.com/interactive/2010/
10/12/world/20101013-chile.html?ref=americas>.

Considere que para o resgate de um mineiro


de 70 kg de massa a cpsula gastou 10
minutos para completar o percurso e suponha
que a acelerao da gravidade local 9,8 m/s2.
No se computando a potncia necessria
para compensar as perdas por atrito, a
potncia efetivamente fornecida pelo motor
para iar a cpsula foi de
(A)

686 W.

(A) dissipativas depende caminho

(B)

2.450 W.

(B) dissipativas depende deslocamento

(C)

3.136 W.

(D) 18.816 W.

(C) dissipativas independe caminho

(E) 41.160 W.

(D) conservativas independe caminho


(E) conservativas depende deslocamento

08. Duas bolas de bilhar colidiram de forma


completamente elstica. Ento, em relao
situao anterior coliso,
(A) suas
energias
cinticas
permaneceram iguais.

individuais

(B) suas
quantidades
de
movimento
individuais permaneceram iguais.
(C) a energia cintica total e a quantidade de
movimento
total
do
sistema
permaneceram iguais.
(D) as bolas de bilhar se movem, ambas, com
a mesma velocidade final.
(E) apenas a quantidade de movimento total
permanece igual.
UFRGS CV/2011 FIS

09. Considere as afirmaes abaixo, referentes a


um lquido incompressvel em repouso.
I - Se a superfcie do lquido, cuja densidade
, est submetida a uma presso pa,, a
presso p no interior desse lquido, a uma
profundidade h, tal que p = pa + gh,
onde g a acelerao da gravidade local.

11. Um balo meteorolgico fechado tem


volume de 50,0 m3 ao nvel do mar, onde a
presso atmosfrica de 1,0x105 Pa e a
temperatura de 27 o C. Quando o balo
atinge a altitude de 25 km na atmosfera
terrestre, a presso e a temperatura
assumem, respectivamente, os valores de
5,0 x 103 Pa e 63 o C.

II - A presso aplicada em um ponto do


lquido, confinado a um recipiente,
transmite-se integralmente a todos os
pontos do lquido.

Considerando-se que o gs contido no balo


se comporta como um gs ideal, o volume do
balo nessa altitude de

III- O mdulo do empuxo sobre um objeto


mergulhado no lquido igual ao mdulo
do peso do volume de lquido deslocado.

(A)

14,0 m3.

(B)

46,7 m3.

(C)

700,0 m3.

Quais esto corretas?

(D) 1.428,6 m3.


(E) 2.333,3 m3.

(A) Apenas I.
(B) Apenas II.

12. A figura abaixo apresenta o diagrama da


presso p(Pa) em funo do volume V(m3) de
um sistema termodinmico que sofre trs
transformaes sucessivas: XY, YZ e ZX.

(C) Apenas III.


(D) Apenas I e III.
(E) I, II e III.
10. Uma mesma quantidade de calor Q
fornecida a massas iguais de dois lquidos
diferentes, 1 e 2. Durante o aquecimento,
os lquidos no alteram seu estado fsico e
seus calores especficos permanecem
constantes, sendo tais que c1 = 5 c2 .
Na situao acima, os lquidos 1 e 2 sofrem,
respectivamente, variaes de temperatura
T1 e T2 , tais que T1 igual a

O trabalho total realizado pelo sistema aps


as trs transformaes igual a

(A) T2 /5.
(B) 2 T2 /5.

(A) 0.

(C) T2.

(B) 1,6 x 105 J.

(D) 5 T2 /2.

(C) 2,0 x 105 J.

(E) 5T2.

(D) 3,2 x 105 J.


(E) 4,8 x 105 J.

UFRGS CV/2011 FIS

13. Uma amostra de uma substncia encontra-se,


inicialmente, no estado slido na temperatura
T0. Passa, ento, a receber calor at atingir a
temperatura final Tf , quando toda a amostra
j se transformou em vapor.
O grfico abaixo representa a variao da
temperatura T da amostra em funo da
quantidade de calor Q por ela recebida.

Considere as seguintes afirmaes, referentes


ao grfico.
I - T1 e T2 so, respectivamente, as
temperaturas de fuso e de vaporizao
da substncia.

14. Assinale
a
alternativa
que
preenche
corretamente as lacunas no fim do enunciado
que segue, na ordem em que aparecem.
Trs esferas metlicas idnticas, A, B e C, so
montadas em suportes isolantes. A esfera A
est positivamente carregada com carga Q,
enquanto as esferas B e C esto eletricamente
neutras. Colocam-se as esferas B e C em
contato uma com a outra e, ento, coloca-se
a esfera A em contato com a esfera B,
conforme representado na figura.

Depois de assim permanecerem por alguns


instantes,
as
trs
esferas
so
simultaneamente separadas. Considerando-se
que o experimento foi realizado no vcuo
(k0 = 9 x 109 N.m2 /C2 ) e que a distncia
final (d) entre as esferas A e B muito
maior que seu raio, a fora eletrosttica
entre essas duas esferas ........ e de
intensidade igual a ........ .
(A) repulsiva

k0Q2/(9d2)

(B) atrativa

k0Q2/(9d2)

III- No intervalo Y, coexistem os estados


slido, lquido e gasoso da substncia.

(C) repulsiva

k0Q2/(6d2)

(D) atrativa

k0Q2/(4d2)

Quais esto corretas?

(E) repulsiva

k0Q2/(4d2)

II - No intervalo X, coexistem os estados


slido e lquido da substncia.

(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e II.
(E) I, II e III.

UFRGS CV/2011 FIS

15. Considere uma casca condutora esfrica eletricamente carregada e em equilbrio eletrosttico. A
respeito dessa casca, so feitas as seguintes afirmaes.
I - A superfcie externa desse condutor define uma superfcie equipotencial.
II - O campo eltrico em qualquer ponto da superfcie externa do condutor perpendicular
superfcie.
III- O campo eltrico em qualquer ponto do espao interior casca nulo.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.
16. Considere o circuito abaixo.

Neste circuito, todos os resistores so idnticos, e C1 e C2 so dois interruptores que podem estar
abertos ou fechados, de acordo com os esquemas numerados a seguir.

(1)

(2)

(3)

(4)

Assinale a alternativa que apresenta corretamente o ordenamento dos esquemas de ligao, em


ordem crescente da corrente eltrica que passa no resistor R4.
(A) (4) (2) (3) (1)
(B) (1) (3) (2) (4)
(C) (2) (4) (3) (1)
(D) (2) (3) (4) (1)
(E) (3) (2) (1) (4)
8

UFRGS CV/2011 FIS

17. Assinale
a
alternativa
que
preenche
corretamente as lacunas no fim do enunciado
que segue, na ordem em que aparecem.

18. Observe a figura abaixo.

Um eltron atravessa, com velocidade


constante de mdulo v, uma regio do espao
onde existem campos eltrico e magntico
uniformes e perpendiculares entre si. Na
figura abaixo, esto representados o campo
magntico, de mdulo B, e a velocidade do
eltron, mas o campo eltrico no est
representado.

Desconsiderando-se qualquer outra interao,


correto afirmar que o campo eltrico ........
pgina, perpendicularmente, e que seu
mdulo vale ........ .
(A) penetra na vB

Esta figura representa dois circuitos, cada um


contendo uma espira de resistncia eltrica no
nula. O circuito A est em repouso e
alimentado por uma fonte de tenso constante V.
O circuito B aproxima-se com velocidade
constante de mdulo v, mantendo-se paralelos
os planos das espiras. Durante a aproximao,
uma fora eletromotriz (f.e.m.) induzida aparece
na espira do circuito B, gerando uma corrente
eltrica que medida pelo galvanmetro G.
Sobre essa situao, so feitas as seguintes
afirmaes.
I - A intensidade da f.e.m. induzida depende
de v.

(B) emerge da vB
(C) penetra na eB

II - A corrente eltrica induzida em B tambm


gera campo magntico.

(D) emerge da eB

III- O valor da corrente eltrica induzida em B


independe da resistncia eltrica deste
circuito.

(E) penetra na E/B

Quais esto corretas?


(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e II.
(E) I, II e III.

UFRGS CV/2011 FIS

19. Uma corda composta de dois segmentos de


densidades de massa bem distintas. Um pulso
criado no segmento de menor densidade e
se propaga em direo juno entre os
segmentos, conforme representa a figura
abaixo.

20. Em cada uma das imagens abaixo, um trem


de ondas planas move-se a partir da
esquerda.

(1)

(2)

(3)

Os fenmenos ondulatrios apresentados nas


figuras 1, 2 e 3 so, respectivamente,
Assinale, entre as alternativas, aquela que
melhor representa a corda quando o pulso
refletido est passando pelo mesmo ponto x
indicado no diagrama acima.

(A) refrao

interferncia difrao.

(B) difrao

interferncia refrao.

(C) interferncia difrao

refrao.

(D) difrao

interferncia.

refrao

(E) interferncia refrao

difrao.

(A)

Instruo: As questes 21 e 22 esto


relacionadas ao enunciado abaixo.
A nanotecnologia, to presente nos nossos
dias, disseminou o uso do prefixo nano (n)
junto a unidades de medida. Assim,
comprimentos de onda da luz visvel so,
modernamente, expressos em nanmetros
(nm), sendo 1 nm = 1 x 10-9 m.

(B)

(C)

(Considere a velocidade da luz no ar igual


a 3 x 108 m/s.)
21. Um feixe de luz monocromtica de
comprimento de onda igual a 600 nm,
propagando-se no ar, incide sobre um bloco
de vidro, cujo ndice de refrao 1,5. O
comprimento de onda e a frequncia do feixe
que se propaga dentro do vidro so,
respectivamente,

(D)

(A) 400 nm e 5,0 x 1014 Hz.

(E)

(B) 400 nm e 7,5 x 1014 Hz.


(C) 600 nm e 5,0 x 1014 Hz.
(D) 600 nm e 3,3 x 1014 Hz.
(E) 900 nm e 3,3 x 1014 Hz.

10

UFRGS CV/2011 FIS

10

22. Cerca de 60 ftons devem atingir a crnea


para que o olho humano perceba um flash de
luz, e aproximadamente metade deles so
absorvidos ou refletidos pelo meio ocular. Em
mdia, apenas 5 dos ftons restantes so
realmente absorvidos pelos fotorreceptores
(bastonetes) na retina, sendo os responsveis
pela percepo luminosa.
(Considere a constante de Planck h igual a
6,6 x 10-34 J.s.)
Com base nessas informaes, correto
afirmar que, em mdia, a energia absorvida
pelos fotorreceptores quando luz verde com
comprimento de onda igual a 500 nm atinge o
olho humano igual a
(A)
(B)
(C)
(D)
(E)

3,30
3,96
1,98
3,96
1,98

x
x
x
x
x

24. De acordo com a Teoria da Relatividade,


quando objetos se movem atravs do espaotempo com velocidades da ordem da
velocidade da luz, as medidas de espao e
tempo sofrem alteraes. A expresso da
contrao espacial dada por
L = L0 (1-v2/c2)1/2,
onde v a velocidade relativa entre o objeto
observado e o observador, c a velocidade
de propagao da luz no vcuo, L o
comprimento medido para o objeto em
movimento, e L0 o comprimento medido
para o objeto em repouso.
A distncia Sol-Terra para um observador
fixo na Terra L0 = 1,5x1011 m. Para um
nutron com velocidade v = 0,6 c, essa
distncia de

10-41 J.
10-33 J.
10-32 J.
10-19 J.
10-18 J.

(A) 1,2 x 1010 m.


(B) 7,5 x 1010 m.

23. Assinale
a
alternativa
que
preenche
corretamente as lacunas no fim do enunciado
que segue, na ordem em que aparecem.

(C) 1,0 x 1011 m.

O olho humano um sofisticado instrumento


ptico. Todo o globo ocular equivale a um
sistema de lentes capaz de focalizar, na
retina, imagens de objetos localizados desde
distncias muito grandes at distncias
mnimas de cerca de 25 cm.

(E) 1,5 x 1011 m.

O olho humano pode apresentar pequenos


defeitos, como a miopia e a hipermetropia,
que podem ser corrigidos com o uso de lentes
externas. Quando raios de luz paralelos
incidem sobre um olho mope, eles so
focalizados antes da retina, enquanto a
focalizao ocorre aps a retina, no caso de
um olho hipermtrope.
Portanto, o globo ocular humano equivale a
um sistema de lentes ........ . As lentes
corretivas para um olho mope e para um olho
hipermtrope devem ser, respectivamente,
........ e ........ .
(A)
(B)
(C)
(D)
(E)

convergentes divergente divergente


convergentes divergente convergente
convergentes convergente divergente
divergentes divergente convergente
divergentes convergente divergente

UFRGS CV/2011 FIS

(D) 1,2 x 1011 m.

25. Em 2011, Ano Internacional da Qumica,


comemora-se o centenrio do Prmio Nobel
de Qumica concedido a Marie Curie pela
descoberta dos elementos radioativos Rdio
(Ra) e Polnio (Po).
Os processos de desintegrao do 224Ra em
220
Rn e do 216Po em 212Pb so acompanhados,
respectivamente, da emisso de radiao
(A) e .
(B) e .
(C) e .
(D) e .
(E) e .

11

11

2012
FSICA
Instruo: As questes 01 a 03 esto
relacionadas ao enunciado abaixo.
O tempo de reao tR de um condutor de um
automvel definido como o intervalo de
tempo decorrido entre o instante em que o
condutor se depara com uma situao de
perigo e o instante em que ele aciona os
freios.
(Considere dR e dF, respectivamente, as
distncias percorridas pelo veculo durante o
tempo de reao e de frenagem; e dT, a
distncia total percorrida. Ento, dT = dR +
dF).
Um automvel trafega com velocidade
constante de mdulo v = 54,0 km/h em uma
pista horizontal. Em dado instante, o condutor
visualiza uma situao de perigo, e seu tempo
de reao a essa situao de 4/5 s, como
ilustrado na sequncia de figuras abaixo.

01. Considerando-se que a velocidade do


automvel permaneceu inalterada durante o
tempo de reao tR, correto afirmar que a
distncia dR de
(A)

3,0 m.

(B) 12,0 m.
(C) 43,2 m.
(D) 60,0 m.
(E) 67,5 m.
02. Ao reagir situao de perigo iminente, o
motorista aciona os freios, e a velocidade do
automvel passa a diminuir gradativamente, com
acelerao constante de mdulo 7,5 m/s2.
Nessas condies, correto afirmar que a
distncia dF de
(A)

2,0 m.

(B)

6,0 m.

(C) 15,0 m.
(D) 24,0 m.
(E) 30,0 m.
03. Em comparao com as distncias dR e dF, j
calculadas, e lembrando que dT = dR + dF,
considere as seguintes afirmaes sobre as
distncias percorridas pelo automvel, agora com
o dobro da velocidade inicial, isto , 108 km/h.

I - A distncia percorrida pelo automvel


durante o tempo de reao do condutor
de 2dR.
II - A distncia percorrida pelo automvel
durante a frenagem de 2dF.
III- A distncia total
automvel de 2dT.

percorrida

pelo

Quais esto corretas?


(A) Apenas I.
(B) Apenas II.
(C) Apenas I e II.
(D) Apenas I e III.
(E) I, II e III.

UFRGS CV/2012 FIS

12

04. A figura abaixo apresenta, em dois instantes,


as velocidades v1 e v2 de um automvel que,
em um plano horizontal, se desloca numa
pista circular.

06. As foras resultantes sobre m1 e m2 so,


respectivamente,

Com base nos dados da figura, e sabendo-se


que os mdulos dessas velocidades so tais
que v1 > v2 correto afirmar que

07. Um objeto, com massa de 1,0 kg, lanado, a


partir do solo, com energia mecnica de 20 J.
Quando o objeto atinge a altura mxima, sua
energia potencial gravitacional relativa ao solo
de 7,5 J.

(A) a componente centrpeta da acelerao


diferente de zero.
(B) a componente tangencial da acelerao
apresenta a mesma direo e o mesmo
sentido da velocidade.

(A)
(B)
(C)
(D)
(E)

3,0
4,5
4,5
6,0
6,0

N
N
N
N
N

e
e
e
e
e

1,5
1,5
3,0
3,0
4,5

Desprezando-se a resistncia do ar, e


considerando-se a acelerao da gravidade
com mdulo de 10 m/s2, a velocidade desse
objeto no ponto mais alto de sua trajetria

(C) o movimento do automvel circular


uniforme.

(A) zero.

(D) o
movimento
do
automvel
uniformemente acelerado.

(C) 5,0 m/s.

(E) os vetores velocidade e acelerao so


perpendiculares entre si.
Instruo: As questes 05 e 06 referem-se ao
enunciado abaixo.
Dois blocos, de massas m1=3,0 kg e m2=1,0
kg, ligados por um fio inextensvel, podem
deslizar sem atrito sobre um plano horizontal.
Esses blocos so puxados por uma fora
horizontal F de mdulo F=6 N, conforme a
figura abaixo.
(Desconsidere a massa do fio.)

N.
N.
N.
N.
N.

(B) 2,5 m/s.


(D) 12,5 m/s.
(E) 25,0 m/s.
08. Um bloco, deslizando com velocidade v sobre
uma superfcie plana sem atrito, colide com
outro bloco idntico, que est em repouso. As
faces dos blocos que se tocam na coliso so
aderentes, e eles passam a se mover como
um nico objeto.
Sobre esta situao, so feitas as seguintes
afirmaes.
I - Antes da coliso, a energia cintica total
do blocos o dobro da energia cintica
total aps a coliso.
II - Ao colidir, os blocos sofreram uma coliso
elstica.
III- Aps a coliso, a velocidade dos blocos
v/2.

05. A tenso no fio que liga os dois blocos

Quais esto corretas?

(A) zero.

(A)
(B)
(C)
(D)
(E)

(B) 2,0 N.
(C) 3,0 N.
(D) 4,5 N.
(E) 6,0 N.

Apenas I.
Apenas II.
Apenas III.
Apenas I e III.
I, II e III.
3

UFRGS CV/2012 FIS

13

09. Considerando que o mdulo da acelerao da


gravidade na Terra igual a 10 m/s2,
correto afirmar que, se existissem um planeta
cuja massa e cujo raio fossem quatro vezes
superiores aos da Terra, a acelerao da
gravidade seria de
(A)

2,5 m/s2.

(B)

5 m/s2.

12. A figura abaixo apresenta um diagrama p x V


que ilustra um ciclo termodinmico de um gs
ideal. Este ciclo, com a realizao de trabalho
de 750 J, ocorre em trs processos
sucessivos.
No processo AB, o sistema sofre um aumento
de presso mantendo o volume constante; no
processo BC, o sistema se expande mantendo
a temperatura constante e diminuindo a
presso; e, finalmente, no processo CA, o
sistema retorna ao estado inicial sem variar a
presso.

(C) 10 m/s2.
(D) 20 m/s2.
(E) 40 m/s2.
10. Uma pedra encontra-se completamente
submersa e em repouso no fundo de um
recipiente cheio de gua; P e E so,
respectivamente, os mdulos do peso da
pedra e do empuxo sobre ela. Com base
nesses dados, correto afirmar que o mdulo
da fora aplicada pelo fundo do recipiente
sobre a pedra igual a
(A) E.
(B) P.
(C) P E.
(D) P + E.
(E) zero.
11. Em um calormetro so colocados 2,0 kg de
gua, no estado lquido, a uma temperatura
de 0 0C. A seguir, so adicionados 2,0 kg de
gelo, a uma temperatura no especificada.
Aps algum tempo, tendo sido atingido o
equilbrio trmico, verifica-se que a temperatura
da mistura de 0 C e que a massa de gelo
aumentou em 100 g.
Considere que o calor especfico do gelo (c
= 2,1 kJ/kg. 0 C) a metade do calor
especfico da gua e que o calor latente de
fuso do gelo de 330 kJ/kg; e
desconsidere a capacidade trmica do
calormetro e a troca de calor com o
exterior.

O trabalho realizado no processo BC e a


relao entre as temperaturas TA e TB so,
respectivamente,
(A) 1310 J

TA = TB/8.

(B) 1310 J

TA = 8TB.

(C) 560 J

TA = TB/8.

(D) 190 J

TA = TB/8.

(E) 190 J

TA = 8TB.

Nessas condies, a temperatura do gelo que


foi inicialmente adicionado gua era,
aproximadamente,
(A)
(B)
(C)
(D)
(E)

0 0C.
2,6 0C.
3,9 0C.
6,1 0C.
7,9 0C.

UFRGS CV/2012 FIS

14

13. O grfico abaixo representa o calor absorvido


por unidade de massa, Q/m, em funo das
variaes de temperatura T para as
substncias ar, gua e lcool, que recebem
calor em processos em que a presso
mantida constante.

14. As cargas eltricas +Q, -Q e +2Q esto


dispostas num crculo de raio R, conforme
representado na figura abaixo.

(Considere que os valores de calor especfico


do ar, do lcool e da gua so,
respectivamente, 1,0 kJ/kg.C., 2,5 kJ/kg.C e
4,2 kJ/kg.C.)

Com base nos dados da figura, correto


afirmar que, o campo eltrico resultante no
ponto situado no centro do crculo est
representado pelo vetor

Com base nesses dados, correto afirmar que


as linhas do grfico identificadas pelas letras
X, Y e Z, representam, respectivamente,

(A)
(B)
(C)
(D)
(E)

E 1.
E 2.
E 3.
E 4.
E 5.

(A) o ar, o lcool e a gua.

15. Considere que U a energia potencial eltrica


de duas partculas com cargas +2Q e -2Q,
fixas a uma distncia R uma da outra. Uma
nova partcula de carga +Q agregada a este
sistema entre as duas partculas iniciais,
conforme representado na figura abaixo.

(B) o ar, a gua e o lcool.


(C) a gua, o ar e o lcool.
(D) a gua, o lcool e o ar.
(E) o lcool, a gua e o ar.

A energia potencial eltrica


configurao do sistema
(A)
(B)
(C)
(D)
(E)

desta

nova

zero.
U/4.
U/2.
U.
3U.
5

UFRGS CV/2012 FIS

15

16. Considere o circuito abaixo.

18. Circuitos
eltricos
especiais
provocam
oscilaes de eltrons em antenas emissoras
de estaes de rdio. Esses eltrons
acelerados emitem ondas de rdio que,
atravs de modulao controlada da
amplitude ou da frequncia, transportam
informaes.

Qual , aproximadamente, o comprimento de


onda das ondas emitidas pela estao de
rdio da UFRGS, que opera na frequncia de
1080 kHz?
No circuito, por onde passa uma corrente
eltrica de 4.A, trs resistores esto
conectados a uma fonte ideal de fora
eletromotriz de 20 V.

(Considere a velocidade de propagao das


ondas eletromagnticas na atmosfera igual a
3 x 108 m/s.)

Os valores da resistncia total deste circuito e


da resistncia RX so, respectivamente,

(A)
(B)
(C)
(D)
(E)

(A)

0,8

2,6 .

(B)

0,8

4,0 .

(C)

5,0

5,0 .

(D)

5,0

e 10,0 .

(E) 10,0

3,6
3,6
2,8
2,8
2,8

x
x
x
x
x

10-6 m.
10-3 m.
102 m.
105 m.
108 m.

19. Considere as seguintes afirmaes sobre


ondas eletromagnticas.

4,0 .

17. A figura abaixo representa trs posies, P1,


P2 e P3, de um anel condutor que se desloca
com velocidade v constante numa regio em
que h um campo magntico B, perpendicular
ao plano da pgina.

I - Frequncias de ondas de rdio so


menores que frequncias da luz visvel.
II - Comprimentos de onda de microondas
so maiores que comprimentos de onda
da luz visvel.
III- Energias de ondas de rdio so menores
que energias de microondas.
Quais esto corretas?

(A)
(B)
(C)
(D)
(E)

Com base nestes dados, correto afirmar que


uma corrente eltrica induzida no anel surge
em
(A) P1.
(B) P3.
(C) P1 e P3.

20. Um determinado pndulo simples oscila com


pequena amplitude em um dado local da
superfcie terrestre, e seu perodo de oscilao
de 8.s. Reduzindo-se o comprimento desse
pndulo para 1/4 do comprimento original,
sem alterar sua localizao, correto afirmar
que sua frequncia, em Hz, ser de
(A)
(B)
(C)
(D)
(E)

(D) P2 e P3.
(E) P1, P2 e P3.

Apenas I.
Apenas II.
Apenas III.
Apenas II e III.
I, II e III.

2.
1/2.
1/4.
1/8.
1/16.
UFRGS CV/2012 FIS

16

21. Um estudante, para determinar a velocidade


da luz num bloco de acrlico, fez incidir um
feixe de luz sobre o bloco. Os ngulos de
incidncia e refrao medidos foram,
respectivamente, 45 e 30.
(Dado: sen 30 =

2
1
; sen 45 =
)
2
2

Sendo c a velocidade de propagao da luz no


ar, o valor obtido para a velocidade de
propagao da luz no bloco
(A) c

(B) c

Para que os seguranas possam controlar o


movimento
dos
clientes,
muitos
estabelecimentos
comerciais
instalam
espelhos convexos em pontos estratgicos
das lojas.
A adoo desse procedimento deve-se ao fato
de que esses espelhos aumentam o campo de
viso do observador. Isto acontece porque a
imagem de um objeto formada por esses
espelhos ........ , ........ e ........ objeto.
(A) virtual direta

menor que o

(B) virtual invertida maior que o

(C) c
(D)

22. Assinale
a
alternativa
que
preenche
corretamente as lacunas do enunciado abaixo,
na ordem em que aparecem.

(C) virtual invertida igual ao


2c

(E) 2c

(D) real

invertida menor que o

(E) real

direta

igual ao

23. Em 1905, Einstein props uma teoria simples e revolucionria para explicar o efeito fotoeltrico, a
qual considera que a luz constituda por partculas sem massa, chamadas de ftons. Cada fton
carrega uma energia dada por hf, onde h.=4,1 x 10-15 eV.s a constante de Planck, e f a
frequncia da luz. Einstein relacionou a energia cintica, E, com que o eltron emerge da superfcie
do material, frequncia da luz incidente sobre ele e funo trabalho, W, atravs da equao
E=hf-W. A funo trabalho W corresponde energia necessria para um eltron ser ejetado do
material.

Em uma experincia realizada com os


elementos Potssio (K), Chumbo (Pb) e Platina
(Pt), deseja-se obter o efeito fotoeltrico
fazendo incidir radiao eletromagntica de
mesma frequncia sobre cada um desses
elementos.
Dado que os valores da funo trabalho para
esses elementos so WK = 2,1 eV, WPb = 4,1 eV
e WPt = 6,3 eV, correto afirmar que o efeito
fotoeltrico ser observado, nos trs
elementos, na frequncia
(A) 1,2 x 1014 Hz.
(B) 3,1 x 1014 Hz.
(C) 5,4 x 1014 Hz.
(D) 1,0 x 1015 Hz.
(E) 1,6 x 1015 Hz.

UFRGS CV/2012 FIS

17

24. Assinale a alternativa que preenche corretamente as lacunas do enunciado abaixo, na ordem em
que aparecem.

Uma caracterstica importante das radiaes diz respeito ao seu poder de penetrao na matria.
Chama-se alcance a distncia que uma partcula percorre at parar. Para partculas e de mesma
energia, o alcance da partcula ........ da partcula .
Raios X e raios so radiaes de mesma natureza, mas enquanto os raios X se originam ....... , os
raios tm origem ........ do tomo.
(A) maior que o

na eletrosfera no ncleo

(B) maior que o

no ncleo

na eletrosfera

(C) igual ao

no ncleo

na eletrosfera

(D) menor que o

no ncleo

na eletrosfera

(E) menor que o

na eletrosfera no ncleo

25. Assinale a alternativa que preenche corretamente as lacunas do enunciado abaixo, na ordem em
que aparecem.

As reaes nucleares
2

H1 + 2H1 3He2 + n

e
n+

235

U92

91

Kr36 +

142

Ba56 + 3 n

liberam energia e so, respectivamente, exemplos de reaes nucleares chamadas ........ e ........ .
(A) fisso nuclear

fuso nuclear

(B) fuso nuclear

fisso nuclear

(C) reao em cadeia fuso nuclear


(D) reao em cadeia fisso nuclear
(E) reao em cadeia reao em cadeia

UFRGS CV/2012 FIS

18

2013
FSICA
Instruo: As questes 01 e 02 referem-se ao enunciado abaixo.
Um automvel desloca-se por uma estrada retilnea plana e horizontal, com velocidade constante de
mdulo v.
01. Em certo momento, o automvel alcana um longo caminho. A oportunidade de ultrapassagem
surge e o automvel acelerado uniformemente at que fique completamente frente do
caminho. Nesse instante, o motorista alivia o p e o automvel reduz a velocidade
uniformemente at voltar velocidade inicial v. A figura abaixo apresenta cinco grficos de distncia
(d) x tempo (t). Em cada um deles, est assinalado o intervalo de tempo (t) em que houve
variao de velocidade.
Escolha qual dos grficos melhor reproduz a situao descrita acima.

UFRGS CV/2013 FIS

19

02. Aps algum tempo, os freios so acionados e o automvel percorre uma distncia d com as rodas
travadas at parar. Desconsiderando o atrito com o ar, podemos afirmar corretamente que, se a
velocidade inicial do automvel fosse duas vezes maior, a distncia percorrida seria
(A) d/4.
(B) d/2.
(C) d.
(D) 2d.
(E) 4d.

03. Nas figuras (X) e (Y) abaixo, est representado um limpador de janelas trabalhando em um andaime
suspenso pelos cabos 1 e 2, em dois instantes de tempo.

Durante o intervalo de tempo limitado pelas figuras, voc observa que o trabalhador caminha sobre
o andaime indo do lado esquerdo, figura (X), para o lado direito, figura (Y).
Assinale a alternativa que preenche corretamente as lacunas da sentena abaixo, na ordem em que
aparecem.
Aps o trabalhador ter-se movido para a direita (figura (Y)), podemos afirmar corretamente que, em
relao situao inicial (figura (X)), a soma das tenses nos cabos 1 e 2 ........, visto que ........ .
(A) permanece a mesma as tenses nos cabos 1 e 2 permanecem as mesmas
(B) permanece a mesma a diminuio da tenso no cabo 1 corresponde a igual aumento na
tenso no cabo 2
(C) aumenta aumenta a tenso no cabo 2 e permanece a mesma tenso no cabo 1
(D) aumenta aumenta a tenso no cabo 1 e permanece a mesma tenso no cabo 2
(E) diminui diminui a tenso no cabo 1 e permanece a mesma tenso no cabo 2

UFRGS CV/2013 FIS

20

04. A figura apresenta esquematicamente o


sistema de transmisso de uma bicicleta
convencional.

Na bicicleta, a coroa A conecta-se catraca B


atravs da correia P. Por sua vez, B ligada
roda traseira R, girando com ela quando o
ciclista est pedalando.

05. Em 6 de agosto de 2012, o jipe Curiosity


pousou em Marte. Em um dos mais
espetaculares empreendimentos da era
espacial, o veculo foi colocado na superfcie
do planeta vermelho com muita preciso.
Diferentemente das misses anteriores, nesta,
depois da usual descida balstica na atmosfera
do planeta e da diminuio da velocidade
provocada por um enorme paraquedas, o
veculo de quase 900 kg de massa, a partir de
20 m de altura, foi suave e lentamente
baixado at o solo, suspenso por trs cabos,
por um tipo de guindaste voador estabilizado
no ar por meio de 4 pares de foguetes
direcionais. A ilustrao abaixo representa o
evento.

Nesta situao, supondo que a bicicleta se


move sem deslizar, as magnitudes das
velocidades angulares, A, B e R, so tais
que
(A) A < B = R .
(B) A = B < R .
(C) A = B = R .
(D) A < B < R .
(E) A > B = R .

Disponvel em:<http://www.nasa.gov/mission_
pages/msl/multimedia/gallery/pia14839.html>.
Acesso em: 19 set. 2012.

O cabo ondulado que aparece na figura serve


apenas para comunicao e transmisso de
energia entre os mdulos.
Considerando as seguintes razes: massa da
Terra/massa de Marte ~ 10 e raio mdio da
Terra/raio mdio de Marte ~ 2, a comparao
com descida similar, realizada na superfcie
terrestre, resulta que a razo correta entre a
tenso em cada cabo de suspenso do jipe
em Marte e na Terra (TM/TT) ,
aproximadamente, de
(A) 0,1.
(B) 0,2.
(C) 0,4.
(D) 2,5.
(E) 5,0.
UFRGS CV/2013 FIS

21

Instruo: As questes 06 e 07 referem-se ao enunciado abaixo.


Um estudante movimenta um bloco homogneo de massa M, sobre uma superfcie horizontal, com
foras de mesmo mdulo F, conforme representa a figura abaixo.

Em X, o estudante empurra o bloco; em Y, o estudante puxa o bloco; em Z, o estudante empurra o


bloco com fora paralela ao solo.
06. A fora normal exercida pela superfcie , em mdulo, igual ao peso do bloco

(A)
(B)
(C)
(D)
(E)

apenas na situao X.
apenas na situao Y.
apenas na situao Z.
apenas nas situaes X e Y.
em X, Y e Z.

07. O trabalho realizado pelo estudante para mover o bloco nas situaes apresentadas, por uma
mesma distncia d, tal que
(A)
(B)
(C)
(D)
(E)

WX
WX
WX
WX
WX

=
=
>
>
<

WY
WY
WY
WY
WY

=
<
>
=
<

WZ.
WZ.
WZ.
WZ.
WZ.

08. Assinale a alternativa que preenche corretamente as lacunas da sentena abaixo, na ordem em que
aparecem.
Dois blocos, 1 e 2, de massas iguais, movem-se com velocidades constantes de mdulos V1i > V2i,
seguindo a mesma direo orientada sobre uma superfcie horizontal sem atrito. Em certo momento, o
bloco 1 colide com o bloco 2. A figura representa dois instantneos desse movimento, tomados antes
(X) e depois (Y) de o bloco 1 colidir com o bloco 2. A coliso ocorrida entre os instantes representados
tal que as velocidades finais dos blocos 1 e 2 so, respectivamente, V1f = V2i e V2f = V1i.
V1i

V2i

V1f

V2f
Y

Com base nessa situao, podemos afirmar corretamente que a coliso foi ........ e que o mdulo do
impulso sobre o bloco 2 foi ........ que o mdulo do impulso sobre o bloco 1.
(A)
(B)
(C)
(D)
(E)

inelstica o mesmo
inelstica maior
perfeitamente elstica maior
perfeitamente elstica o mesmo
perfeitamente elstica menor
UFRGS CV/2013 FIS

22

09. Uma esfera macia de ao est suspensa em


um dinammetro, por meio de um fio de
massa desprezvel, e todo este aparato est
imerso no ar. A esfera, ainda suspensa ao
dinammetro,

ento
mergulhada
completamente num lquido de densidade
desconhecida. Nesta situao, a leitura do
dinammetro sofre uma diminuio de 30%
em relao situao inicial. Considerando a
densidade do ao igual a 8 g/cm3, a
densidade do lquido, em g/cm,
aproximadamente

11. Uma amostra de gs ideal evolui de um


estado A para um estado B, atravs de um
processo, em que a presso P e o volume V
variam conforme o grfico abaixo.

(A) 1,0.
Considere as seguintes afirmaes sobre esse
processo.

(B) 1,1.
(C) 2,4.

I - A temperatura do gs diminuiu.

(D) 3,0.

II - O gs realizou trabalho positivo.

(E) 5,6.

III- Este processo adiabtico.


Quais esto corretas?

10. Duas esferas macias e homogneas, X e Y,


de mesmo volume e materiais diferentes,
esto ambas na mesma temperatura T.
Quando ambas so sujeitas a uma mesma
variao de temperatura T, os volumes de X
e Y aumentam de 1% e 5%, respectivamente.

(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e III.
(E) I, II e III.

A razo entre os coeficientes de dilatao


linear dos materiais de X e Y, x/y,
(A) 1.
(B) 1/2.
(C) 1/4.
(D) 1/5.

12. Um projeto prope a construo de trs


mquinas trmicas, M1, M2 e M3, que devem
operar entre as temperaturas de 250 K e 500 K,
ou seja, que tenham rendimento ideal igual a
50%. Em cada ciclo de funcionamento, o calor
absorvido por todas o mesmo: Q = 20 kJ,
mas espera-se que cada uma delas realize o
trabalho W mostrado na tabela abaixo.

(E) 1/10.

Mquina
M1
M2
M3

W
20 kJ
12 kJ
8 kJ

De acordo com a segunda lei da


termodinmica, verifica-se que somente
possvel a construo da(s) mquina(s)
(A) M1.
(B) M2.
(C) M3.
(D) M1 e M2.
(E) M2 e M3.
UFRGS CV/2013 FIS

23

Instruo: As questes 13 e 14 referem-se ao


enunciado seguinte.
Uma onda transversal propaga-se com
velocidade de 12 m/s numa corda tensionada.
O grfico abaixo representa a configurao
desta onda na corda, num dado instante de
tempo.

15. Assinale
a
alternativa
que
preenche
corretamente as lacunas do texto abaixo, na
ordem em que aparecem.
A radiao luminosa emitida por uma lmpada
a vapor de ltio atravessa um bloco de vidro
transparente, com ndice de refrao maior
que o do ar.
Ao penetrar no bloco de vidro, a radiao
luminosa tem sua frequncia ........ . O
comprimento de onda da radiao no bloco
........ que no ar e sua velocidade de
propagao ........ que no ar.
(A) alterada

maior

menor

(B) alterada

o mesmo maior

(C) inalterada maior

menor

(D) inalterada menor

menor

(E) inalterada menor

a mesma

16. No diagrama abaixo,


13. O comprimento de onda e a amplitude desta
onda transversal so, respectivamente,

(A) 4 cm e 3 cm.
(B) 4 cm e 6 cm.
(C) 6 cm e 3 cm.

i representa um raio luminoso propagando-se


no ar, que incide e atravessa um bloco
triangular
de
material
transparente
desconhecido.

(D) 8 cm e 3 cm.
(E) 8 cm e 6 cm.

Com base na trajetria completa do raio


luminoso, o ndice de refrao deste material
desconhecido

14. A frequncia da onda, em Hz, igual a


(A) 2/3.

(Dados: ndice de refrao do ar = 1;

(B) 3/2.

sen 30 = cos 60 =

(C) 200/3.
(D) 96.

1
3
; sen 60 = cos 30 =
.)
2
2

3
.
2
2
(B)
.
3
(A)

(E) 150.

(C)

3.
4
(D)
.
3
(E)

2 3.
UFRGS CV/2013 FIS

24

17. Nos diagramas abaixo, 0 representa um pequeno objeto luminoso que est colocado diante de um
espelho plano P, perpendicular pgina, ambos imersos no ar; I representa a imagem do objeto
formada pelo espelho, e o olho representa a posio de quem observa a imagem.
Qual dos diagramas abaixo representa corretamente a posio da imagem e o traado dos raios que
chegam ao observador?

UFRGS CV/2013 FIS

25

18. Um dos grandes problemas ambientais decorrentes do aumento da


produo industrial mundial o aumento da poluio atmosfrica.
A fumaa, resultante da queima de combustveis fsseis como
carvo ou leo, carrega partculas slidas quase microscpicas
contendo, por exemplo, carbono, grande causador de dificuldades
respiratrias. Faz-se ento necessria a remoo destas partculas
da fumaa, antes de ela chegar atmosfera. Um dispositivo
idealizado para esse fim est esquematizado na figura abaixo.

A fumaa poluda, ao passar pela grade metlica negativamente carregada, ionizada e


posteriormente atrada pelas placas coletoras positivamente carregadas. O ar emergente fica at
99% livre de poluentes. A filtragem do ar idealizada neste dispositivo um processo
fundamentalmente baseado na
(A) eletricidade esttica.
(B) conservao da carga eltrica.
(C) conservao da energia.
(D) fora eletromotriz.
(E) conservao da massa.

UFRGS CV/2013 FIS

10

26

19. Na figura abaixo, est mostrada uma srie de


quatro configuraes de linhas de campo
eltrico.

20. Duas partculas, com cargas q1 e q2 e massas


m1 e m2, penetram com a mesma velocidade
de mdulo v, atravs do orifcio P, em uma
regio de campo magntico uniforme B,
dirigido perpendicularmente para fora desta
pgina, conforme representa a figura abaixo.

As partculas descrevem rbitas circunferenciais


de raios diferentes R1 e R2, tais que R2 = 2 R1.
Com base na descrio acima, podemos garantir
que estas partculas possuem
(A) o mesmo perodo orbital.
(B) valores iguais de quantidade de movimento
linear.
(C) m1 = m2/2.
(D) q1 = 2 q2.
(E) q1/m1 = 2 q2/m2.
21. A figura abaixo representa um dispositivo
eletrnico D conectado a uma bateria
recarregvel B, que o pe em funcionamento.
i a corrente eltrica que aciona D.

A respeito desse sistema, considere as seguintes


afirmaes.

Assinale
a
alternativa
que
preenche
corretamente as lacunas da sentena abaixo,
na ordem em que aparecem.
Nas figuras ........ , as cargas so de mesmo
sinal e, nas figuras ........ , as cargas tm
magnitudes distintas.

I - As cargas eltricas de i so consumidas


ao atravessarem D.
II - O processo de recarga no coloca
cargas em B.
III- Toda a carga eltrica que atravessa D
origina-se em B.
Quais esto corretas ?

(A) 1 e 4 1 e 2

(A) Apenas I.

(B) 1 e 4 2 e 3

(B) Apenas II.

(C) 3 e 4 1 e 2

(C) Apenas III.

(D) 3 e 4 2 e 3

(D) Apenas II e III.

(E) 2 e 3 1 e 4

(E) I, II e III.

UFRGS CV/2013 FIS

11

27

22. O aumento da concentrao populacional nas


reas urbanas impe o desenvolvimento de
transportes de massa mais eficientes. Um
candidato bastante promissor para esse trabalho
o trem MAGLEV, abreviatura inglesa de
Magnetic Levitation, que significa Levitao
Magntica.
Diferentemente
dos
trens
convencionais, os trens MAGLEV no possuem
motores, sendo assim mais leves, e a principal
forma de atrito encontrada durante seu movimento a resistncia do ar, o que lhes permite
alcanar velocidades maiores do que 500 km/h.
O princpio de funcionamento relativamente simples e um dos sistemas em uso, a chamada
Suspenso Eletrodinmica (ou levitao por repulso), emprega correntes eltricas induzidas em
condutores submetidos a fluxos magnticos variveis.
A figura abaixo ilustra o processo bsico: campos magnticos intensos, criados por bobinas fixas no
trem, induzem foras eletromotrizes variveis nas bobinas em forma de 8, fixas nos trilhos. As
correntes eltricas resultantes nessas bobinas originam campos magnticos com polaridades
invertidas, conforme mostra a figura a). Assim, as bobinas fixas no trem sero atradas pelas
metades superiores e repelidas pelas metades inferiores das bobinas dos trilhos (figura b),
promovendo a levitao.

Com base na descrio acima, podemos afirmar corretamente que o trem MAGLEV uma aplicao
direta do Eletromagnetismo, em particular da
(A) lei de Coulomb.
(B) lei de Ohm.
(C) lei de Ampre.
(D) lei de Faraday-Lenz.
(E) lei de Biot-Savart.

UFRGS CV/2013 FIS

12

28

23. O diagrama abaixo representa alguns nveis


de energia do tomo de hidrognio.

25. Neste ano de 2013, comemora-se o


centenrio da publicao do modelo atmico
de Bohr, uma das bases da moderna teoria
quntica.
A respeito desse modelo, so feitas as
seguintes afirmaes.
I - Os eltrons movem-se em torno do
ncleo em rbitas circunferenciais, sob
influncia da atrao coulombiana, e
satisfazem as leis de Newton.

tomos de hidrognio, inicialmente no estado


fundamental, comeam a ser incididos
continuamente por radiaes eletromagnticas
de diferentes energias Ei: E1=2,3 eV, E2=1,9 eV e
E3=10,2 eV. Quais destas radiaes sero
absorvidas pelos tomos de H, sem causar
ionizao?

II - Emisso ou absoro de radiao ocorre


apenas quando o eltron faz uma
transio entre rbitas permitidas.
III- Nem todas as rbitas so permitidas,
apenas aquelas nas quais a energia um
mltiplo inteiro de uma quantidade
fundamental.
Quais esto corretas?

(A) Apenas E1.


(B) Apenas E2.

(A) Apenas I.

(C) Apenas E1 e E2.

(B) Apenas I e II.

(D) Apenas E2 e E3.

(C) Apenas I e III.

(E) E1, E2 e E3.

(D) Apenas II e III.

24. A medicina nuclear designa o conjunto das


aplicaes em que substncias radioativas so
associadas ao diagnstico e terapia. Em
algumas radioterapias, um radiofrmaco
injetado no paciente visando ao tratamento
de rgo alvo. Assim, por exemplo, o rnio
(186Re) utilizado para aliviar doenas
reumticas, e o fsforo (32P) para reduzir a
produo excessiva de glbulos vermelhos na
medula ssea.

(E) I, II e III.

Considere que a meia vida do rnio de 3,5


dias e a do fsforo 14 dias. Aps 14 dias da
aplicao
destes
radiofrmacos,
as
quantidades
restantes
destes
istopos
radioativos no paciente sero, em relao s
quantidades iniciais, respectivamente,
(A) 1/2 e 1/2.
(B) 1/4 e 0.
(C) 1/4 e 1/2.
(D) 1/16 e 0.
(E) 1/16 e 1/2.
UFRGS CV/2013 FIS

13

29

2014
FSICA
Instruo: Sempre que for necessrio utilizar valores dos mdulos da acelerao da gravidade na
superfcie da Terra ou da velocidade da luz no vcuo, considere esses valores como 9,80 m/s2 e
3,00 x 108 m/s, respectivamente.
01. Cada um dos grficos abaixo representa a posio em funo do tempo para um movimento
unidimensional (as partes curvas devem ser consideradas como segmentos de parbolas).

No conjunto de grficos a seguir, est representada a velocidade em funo do tempo para seis
situaes distintas.

Considerando que as divises nos eixos dos tempos so iguais em todos os grficos, assinale a
alternativa que combina corretamente os grficos que descrevem, por pares, o mesmo movimento.
(A) 1(c) 2(d) 3(b).
(B) 1(e) 2(f) 3(a).
(C) 1(a) 2(d) 3(e).
(D) 1(c) 2(f) 3(d).
(E) 1(e) 2(d) 3(b).

UFRGS CV/2014 FIS

30

02. Um mvel percorre uma trajetria fechada, representada na figura abaixo, no sentido anti-horrio.

Ao passar pela posio P, o mvel est freando. Assinale a alternativa que melhor indica, nessa
posio, a orientao do vetor acelerao total do mvel.
(A) 1.
(B) 2.
(C) 3.
(D) 4.
(E) 5.
03. Na figura abaixo, blocos idnticos esto
suspensos por cordas idnticas em trs
situaes distintas, (1), (2) e (3).

Assinale a alternativa que apresenta as


situaes
na
ordem
crescente
de
probabilidade de rompimento das cordas. (O
sinal de igualdade abaixo indica situaes com
a mesma probabilidade de rompimento.)
(A) (3), (2), (1).

04. Assinale com V (verdadeiro) ou F (falso) as


afirmaes abaixo.
( ) Um objeto colocado em uma altitude de 3
raios terrestres acima da superfcie da
Terra sofrer uma fora gravitacional 9
vezes menor do que se estivesse sobre a
superfcie.
( ) O mdulo da fora gravitacional exercida
sobre um objeto pode sempre ser
calculado por meio do produto da massa
desse objeto e do mdulo da acelerao
da gravidade do local onde ele se
encontra.
( ) Objetos em rbitas terrestres no sofrem
a ao da fora gravitacional.
( ) Se a massa e o raio terrestre forem
duplicados, o mdulo da acelerao da
gravidade na superfcie terrestre reduz-se
metade.

(B) (3), (2) = (1).


(C) (1), (2), (3).
(D) (1) = (2), (3).

A sequncia correta de preenchimento dos


parnteses, de cima para baixo,

(E) (1) = (2) = (3).

(A) V V F F.
(B) F V F V.
(C) F F V F.
(D) V F F V.
(E) V V V F.
UFRGS CV/2014 FIS

31

05. Um objeto de massa igual a 2 kg move-se em


linha reta com velocidade constante de 4 m/s. A
partir de um certo instante, uma fora de mdulo
igual a 2 N exercida por 6 s sobre o objeto, na
mesma direo de seu movimento. Em seguida,
o objeto colide frontalmente com um obstculo e
tem seu movimento invertido, afastando-se com
velocidade de 3 m/s.

07. Uma bomba arremessada, seguindo uma


trajetria parablica, conforme representado
na figura abaixo. Na posio mais alta da
trajetria, a bomba explode.

O mdulo do impulso exercido pelo obstculo


e a variao da energia cintica do objeto,
durante a coliso, foram, respectivamente,
(A) 26 Ns e -91 J.
(B) 14 Ns e -91 J.
(C) 26 Ns e -7 J.
(D) 14 Ns e -7 J.
(E)

7 Ns e -7 J.

06. O termo horsepower , abreviado hp, foi


inventado por James Watt (1783), durante
seu trabalho no desenvolvimento das
mquinas a vapor. Ele convencionou que
um cavalo, em mdia, eleva 3,30 x 10 4
libras de carvo (1 libra ~ 0,454 Kg)
altura de um p (~.0,305 m) a cada
minuto, definindo a potncia correspondente
como 1 hp (figura abaixo).

Assinale
a
alternativa
que
preenche
corretamente as lacunas do enunciado abaixo,
na ordem em que aparecem.
A exploso da bomba um evento que ........
a energia cintica do sistema. A trajetria do
centro de massa do sistema constitudo pelos
fragmentos da bomba segue ......... .
(A) no conserva verticalmente para o solo
(B) no conserva a trajetria do fragmento
mais massivo da bomba
(C) no conserva a mesma parbola anterior
exploso
(D) conserva a mesma parbola anterior
exploso

1 horsepower (hp)

(E) conserva verticalmente para o solo

Posteriormente, James Watt teve seu nome


associado unidade de potncia no Sistema
Internacional de Unidades, no qual a potncia
expressa em watts (W).
Com base nessa associao, 1 hp corresponde
aproximadamente a
(A) 76,2 W.
(B) 369 W.
(C) 405 W.
(D) 466 W.
(E) 746 W.
UFRGS CV/2014 FIS

32

08. Um plano inclinado com 5 m de comprimento


usado como rampa para arrastar uma caixa
de 120 kg para dentro de um caminho, a
uma altura de 1,5 m, como representa a
figura abaixo.

Considerando que a fora de atrito cintico


entre a caixa e a rampa seja de 564 N, o
trabalho mnimo necessrio para arrastar a
caixa para dentro do caminho
(A)

10. A figura abaixo representa o movimento de


um pndulo que oscila sem atrito entre os
pontos x1 e x2.

Qual dos seguintes grficos melhor representa


a energia mecnica total do pndulo ET
em funo de sua posio horizontal?

846 J.

(B) 1056 J.
(C) 1764 J.
(D) 2820 J.
(E) 4584 J.
09. Na figura abaixo, esto representados trs
blocos (A, B e C) de mesmas dimenses, que
esto em equilbrio mecnico na gua.

Os blocos A e B tm, respectivamente, e


de seus volumes acima da superfcie, enquanto
o bloco C est totalmente submerso.
Considerando que o bloco C tem peso P, os
pesos de A e B so, respectivamente,
(A) P/4, P/4.
(B) P/4, 3P/4.
(C) P/4, 4P/3.
(D) 3P/4, 3P/4.
(E) P, P.
UFRGS CV/2014 FIS

33

11. Uma cmera fotogrfica caseira pode ser


construda a partir de uma caixa escura, com
um minsculo orifcio (O, na figura) em um
dos lados, e uma folha de papel fotogrfico
no lado interno oposto ao orifcio. A imagem
de um objeto formada, segundo o diagrama
abaixo.

13. A frequncia do som emitido pela sirene de


certa ambulncia de 600 Hz. Um observador
em repouso percebe essa frequncia como
sendo de 640 Hz. Considere que a velocidade
da onda emitida de 1200 km/h e que no
h obstculos entre o observador e a
ambulncia.
Com base nos dados acima, assinale a
alternativa que preenche corretamente as
lacunas do enunciado abaixo, na ordem em
que aparecem.
A ambulncia ........ do observador com
velocidade de ........ .

O fenmeno ilustrado ocorre porque

(A) afasta-se

75 km/h

(B) afasta-se

80 km/h

(B) a direo da luz variada quando passa


atravs de uma pequena abertura.

(C) afasta-se

121km/h

(C) a luz produz uma imagem virtual.

(E) aproxima-se 121km/h

(A) a luz apresenta ngulos de incidncia e


de reflexo iguais.

(D) aproxima-se 80 km/h

(D) a luz viaja em linha reta.


(E) a luz contorna obstculos.
12. Assinale
a
alternativa
correta
sobre
caractersticas de fenmenos ondulatrios.
(A) Uma nota musical propagando-se no ar
uma onda estacionria.
(B) O claro proveniente de uma descarga
eltrica

composto
por
ondas
transversais.
(C) A frequncia de uma onda dependente
do meio no qual a onda se propaga.
(D) Uma onda mecnica transporta energia e
matria.

14. Considere um processo adiabtico no qual o


volume ocupado por um gs ideal reduzido
a 1/5 do volume inicial.
correto afirmar que, nesse processo,
(A) a energia interna do gs diminui.
(B) a razo T/p (T=temperatura, p=presso)
torna-se 5 vezes o valor inicial.
(C) a presso e a temperatura do gs
aumentam.
(D) o trabalho realizado sobre o gs igual
ao calor trocado com o meio externo.
(E) a densidade do gs permanece constante.

(E) A velocidade de uma onda mecnica no


depende do meio no qual se propaga.

UFRGS CV/2014 FIS

34

Instruo: As questes 15 e 16 referem-se aos


enunciados e grfico abaixo.
O grfico representa, em um processo
isobrico, a variao em funo do tempo da
temperatura de uma amostra de um elemento
puro cuja massa de 1,0 kg, observada
durante 9 minutos.

17. Materiais com mudana de fase so bastante


utilizados na fabricao de tecidos para roupas
termorreguladoras, ou seja, que regulam sua
temperatura em funo da temperatura da pele
com a qual esto em contato. Entre as fibras do
tecido, so includas microcpsulas contendo,
por exemplo, parafina, cuja temperatura de
fuso est prxima da temperatura de conforto
da pele, 31 0C. Considere que um atleta, para
manter sua temperatura interna constante
enquanto se exercita, libere 1,5 x 104 J de calor
atravs da pele em contato com a roupa
termorreguladora e que o calor de fuso da
parafina LF=2,0 x 105 J/kg.
Para manter a temperatura de conforto da
pele, a massa de parafina encapsulada deve
ser de, no mnimo,
(A) 500 g.
(B) 450 g.
(C) 80 g.

A amostra est no estado slido a 0. C no


instante t=0 e aquecida por uma fonte de
calor que lhe transmite energia a uma taxa de
2,0 x 103 J/min, supondo que no haja perda
de calor.
15. A partir dos dados do grfico, pode-se afirmar
que
esse
elemento
apresenta
uma
temperatura de fuso e um calor especfico no
estado lquido que so, respectivamente,

(D) 75 g.
(E) 13 g.
18. Considere dois bales de borracha, A e B. O
balo B tem excesso de cargas negativas; o
balo A, ao ser aproximado do balo B,
repelido por ele. Por outro lado, quando certo
objeto metlico isolado aproximado do
balo A, este atrado pelo objeto.
Assinale
a
alternativa
que
preenche
corretamente as lacunas do enunciado abaixo,
na ordem em que aparecem.

(A) 70 0C e 180 J/(kg.K).


(B) 70 0C e 200 J/(kg.K).
(C) 40 0C e 150 J/(kg.K).

A respeito das cargas eltricas lquidas no balo A


e no objeto, pode-se concluir que o balo A s
pode ........ e que o objeto s pode ........ .

(D) 40 0C e 180 J/(kg.K).


(E) 40 0C e 200 J/(kg.K).

16. O processo que ocorre na fase slida envolve


um trabalho total de 0,1 kJ. Nessa fase, a
variao da energia interna da amostra

(A) 6,1 kJ.


(B) 5,9 kJ.
(C) 6,0 kJ.
(D) -5,9 kJ.

(A) ter excesso de cargas negativas ter


excesso de cargas positivas
(B) ter excesso de cargas negativas ter
excesso de cargas positivas ou estar
eletricamente neutro
(C) ter excesso de cargas negativas estar
eletricamente neutro
(D) estar eletricamente neutro ter excesso
de cargas positivas ou estar eletricamente
neutro
(E) estar eletricamente neutro ter excesso
de cargas positivas

(E) - 6,1 kJ.

UFRGS CV/2014 FIS

35

19. Na figura, esto representadas, no plano XY,


linhas equipotenciais espaadas entre si de 1 V.

21. Considere o circuito formado por trs


lmpadas idnticas ligadas em paralelo
bateria, conforme representa a figura (1).

Considere as seguintes afirmaes sobre essa


situao.
I - O trabalho realizado pela fora eltrica
para mover uma carga eltrica de 1 C de
D at A de -1 J.
II - O mdulo do campo eltrico em C maior
do que em B.

Como a chave C foi aberta na figura (2),


considere as afirmaes abaixo sobre a figura
(2), em comparao situao descrita na
figura (1).

III- O mdulo do campo eltrico em D zero.

I - A potncia fornecida pela bateria a


mesma.

Quais esto corretas?

II - A diferena de potencial aplicada a cada


lmpada acesa a mesma.

(A) Apenas I.

III- As correntes eltricas que percorrem as


lmpadas acesas so menores.

(B) Apenas II.


(C) Apenas I e II.

Quais esto corretas?

(D) Apenas II e III.


(E) I, II e III.

(A) Apenas II.


(B) Apenas III.

20. Observe o segmento de circuito.

(C) Apenas I e II.


(D) Apenas I e III.
(E) I, II e III.

No circuito, VA=-20 V e VB=10 V so os


potenciais nas extremidades A e B; e R1=2 k ,
R2=8 k e R3=5 k so os valores das
resistncias
eltricas
presentes.
Nessa
situao, os potenciais nos pontos a e b so,
respectivamente,
(A) -24 V e 0 V.
(B) -16 V e 0 V.
(C) - 4 V e 0 V.
(D) 4 V e 5 V.
(E) 24 V e 5 V.
UFRGS CV/2014 FIS

36

22. Um trabalhador carregando uma esquadria


metlica de resistncia eltrica R sobe, com
velocidade de mdulo constante, uma escada
colocada abaixo de um fio conduzindo uma
corrente eltrica intensa, i. A situao est
esquematizada na figura abaixo.

23. Escolha a opo que associa as colunas da


tabela abaixo, de modo a completar
corretamente as lacunas pontilhadas nas
reaes nucleares indicadas na coluna da
esquerda.
Reao

I-

Assinale a alternativa correta sobre essa


situao.
(A) Como a esquadria tem, aos pares, lados
paralelos, a fora resultante exercida pelo
fio acima nula.
(B) Visto que o fio no atravessa a esquadria,
a lei de Ampre afirma que no existem
correntes eltricas na esquadria.
(C) medida que sobe a escada, o
trabalhador sente a esquadria ficar mais
leve, resultado da fora atrativa exercida
pelo fio, como previsto pela lei de BiotSavart.
(D) medida que sobe a escada, o
trabalhador sente a espira ficar mais
pesada, resultado da fora de repulso
estabelecida entre a corrente eltrica no
fio e a corrente eltrica induzida,
conforme explicado pela lei de FaradayLenz.

II-

III-

IV-

222
88

143
61

14
6

218
86

Ra

.....

Rn

143
61

Pm

Complemento
23
12

Mg

(b)

14
7

(c)

(d)

.....

Pm

(a)

.....

(e)

......

Na

23
11

12
6

(f)

(g)

24
11

(h)

4
2

Na

(A) (h) (d) (b) (g)


(B) (c) (d) (e) (g)
(C) (h) (f) (b) (a)
(D) (c) (f) (e) (a)
(E) (h) (d) (b) (a)

(E) Como o trabalhador sobe com velocidade


de mdulo constante, no h o
aparecimento de corrente eltrica na
esquadria.

UFRGS CV/2014 FIS

10

37

24. No texto abaixo, Richard Feynman, Prmio Nobel


de Fsica de 1965, ilustra os conhecimentos sobre
a luz no incio do sculo XX.
Naquela poca, a luz era uma onda nas
segundas, quartas e sextas-feiras, e um
conjunto de partculas nas teras, quintas e
sbados. Sobrava o domingo para refletir
sobre a questo!
Fonte: QED-The Strange Theory of Light and
Matter. Princeton University Press, 1985.

Assinale com V (verdadeiro) ou F (falso) as


afirmaes abaixo.
( ) As partculas que Feynman menciona
so os ftons.
( ) A grandeza caracterstica da onda que
permite calcular a energia dessas
partculas sua frequncia , atravs da
relao E=h .
( ) Uma experincia que coloca em evidncia
o comportamento ondulatrio da luz o
efeito fotoeltrico.
( ) O carter corpuscular da luz
evidenciado
por
experincias
de
interferncia e de difrao.
A sequncia correta de preenchimento dos
parnteses, de cima para baixo,

25. Os mons csmicos so partculas de altas


energias, criadas na alta atmosfera terrestre.
A velocidade de alguns desses mons (v)
prxima da velocidade da luz (c), tal que
v2=0,998 c2, e seu tempo de vida em um
referencial em repouso aproximadamente
t0=2x10-6 s. Pelas leis da mecnica clssica,
com esse tempo de vida to curto, nenhum
mon poderia chegar ao solo, no entanto
eles so detectados na Terra. Pelos
postulados da relatividade restrita, o tempo
de vida do mon em um referencial
terrestre (t) e o tempo t 0 so relacionados
pelo fator relativstico
.

1
v2
1 2
c

Para um observador terrestre a distncia que


o mon pode percorrer antes de se
desintegrar , aproximadamente,
(A) 6,0 x 102 m.
(B) 6,0 x 103 m.
(C) 13,5 x 103 m.
(D) 17,5 x 103 m.
(E) 27,0 x 103 m.

(A) F V F F.
(B) F F V V.
(C) V V F V.
(D) V F V F.
(E) V V F F.

UFRGS CV/2014 FIS

11

38

2011
LITERATURA DE LNGUA PORTUGUESA
26. Leia os seguintes fragmentos.
1.
Viu, um deles, umas contas de rosrio, brancas, e acenou que lhas dessem; folgou muito com elas e
lanou-as ao pescoo; depois tirou-as e enrolou-as no brao e acenava para a terra e ento para as
contas e para o colar do Capito, como [a dizer] que dariam ouro por aquilo. Isso entendamos ns,
por assim desejarmos; mas se ele queria dizer que levaria as contas e mais o colar, isto no
queramos ns entender porque no havamos de dar.
Extrado de: Pero Vaz de Caminha, Carta ao Rei D. Manuel, do sculo XVI.

2.
Velas baixaram. E desembarcaram.
- Terra, como teu nome?
Cortaram pau. Saiu sangue.
- Isso Brasil!

No outro dia
O sol do lado de fora assistiu missa.
Terra em que Deus anda de p no cho!
Outros chegaram depois. Outros. Mais outros.
- Queremos ouro!
A floresta no respondeu.
Ento
Eles marcharam por uma geografia-do-sem-lhe-achar-fim.
Rios enigmticos apontavam o Oeste.
A gua obediente conduziu o homem.
Comeou da um Brasil sem-histria-certa.
A terra acordou-se com o alarido de caa
De animais e de homens.
Mato-grande foi cmplice de novas plantaes de sangue.
Extrado de: Raul Bopp, Histria, parte de Poemas brasileiros, de 1946.

Assinale com V (verdadeiro) ou F (falso) as seguintes afirmaes sobre esses fragmentos.


( ) O eu-lrico do poema de Bopp denuncia a forma violenta como se deu a colonizao do Brasil, o
que pode ser evidenciado nas duas ocorrncias da palavra sangue.
( ) O fragmento da carta de Caminha expe a inteno dos portugueses de trocar colares por
metais preciosos existentes na nova terra.
( ) O texto de Bopp, ao referir que comeou um Brasil sem-histria-certa, exemplifica a
perspectiva modernista de releitura crtica do passado nacional.
( ) Ambos os fragmentos, embora pertencentes a pocas distintas, reafirmam a supremacia do
interesse religioso da conquista ao referirem, respectivamente, contas do rosrio e missa.
A sequncia correta de preenchimento dos parnteses, de cima para baixo,
(A)
(B)
(C)
(D)
(E)

V
F
V
F
V

V
F
F
V
F

V
V
V
F
F

F.
V.
F.
V.
F.

12

UFRGS CV/2011 LIT

39

Instruo: As questes 27 e 28 esto relacionadas ao trecho abaixo, extrado do Sermo de Santo


Antnio, de padre Antnio Vieira.
verdade que Portugal era um cantinho ou um canteirinho da Europa: mas nesse cantinho de terra pura e
mimosa de Deus: Fide purum, et pietate dilectum : e nesse cantinho quis o Cu depositar a F, que dali se
havia de derivar a todas estas vastssimas terras, introduzida com tanto valor, regada com tanto sangue,
recolhida com tantos suores, e metida, finalmente, nos celeiros da Igreja, debaixo das chaves de Pedro,
com tanta glria. Medindo-se Portugal consigo mesmo, e reconhecendo-se to pequeno vista de uma
empresa to imensa, pudera dizer o que disse Jeremias, quando Deus o escolheu para Profeta das gentes:
Et Prophetam in gentibus dedi te : E que disse Jeremias: Et dixit: A, A, A, Domine Deus, quia puer ego sum.
A, A, A, Deus meu, onde me mandais que sou muito pequeno para tamanha empresa? O mesmo pudera
dizer Portugal. Mas tirando-lhe Deus da boca estes trs AAA, ao primeiro A escreveu frica; ao segundo A,
escreveu sia; ao terceiro A, escreveu Amrica; sujeitando todas trs ao seu Imprio, como Senhor, e sua
doutrina, como luz: Vos estis lux mundi.
27. Considere as seguintes afirmaes, sobre o trecho.
I - Vieira transforma os trs AAA que manifestaram a dvida de Jeremias nas iniciais dos trs continentes
(frica, sia e Amrica), onde se desenvolvia a misso civilizadora e catequtica dos portugueses.
II - possvel identificar a ndole militante e nacionalista do padre e uma enftica defesa da ao
violenta de Portugal e de seus aliados.
III- O sermonista justifica eventos histricos, como a grandeza do Imprio portugus no perodo da
expanso ultramarina, a partir de casos exemplares extrados da Bblia, como a escolha que Deus fez
de Jeremias para a difcil misso de profetizar.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e III.
(E) I, II e III.
28. Considere as seguintes afirmaes, sobre o mesmo trecho.
I - Ao referir-se a elementos como cantinho de terra pura e mimosa de Deus e celeiros da
Igreja, Vieira celebra a capacidade de Portugal de suprir a carncia europeia de alimentos.
II - Jeremias, por sentir-se frgil, questiona sua capacidade de empreender com sucesso a ao
proftica.
III- A inteno do sermo exaltar a conquista de trs continentes por um reino to pequeno como
o portugus.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.
UFRGS CV/2011 LIT

13

40

29. Assinale a alternativa correta sobre o poema O Uraguai, de Baslio da Gama.


(A) Lindoia espera por Cacambo, mas assediada pelo perverso padre Balda, que procura seduzi-la
com presentes e carcias insinuantes.
(B) Cacambo, ao retornar ao aldeamento, interceptado por emissrios dos jesutas que o desviam
do caminho e tratam de envenen-lo.
(C) Lindoia, tomada de dor pela morte de seu amado, retira-se para uma choa longe da aldeia,
onde tem vises que prenunciam a guerra na Europa.
(D) Lindoia, um pouco antes da morte de Cacambo, morre atingida por uma flecha, e seu corpo
carregado por Caitutu.
(E) Cacambo, depois de atear fogo ao acampamento inimigo, retorna para sua terra, onde espera
encontrar Lindoia e dar notcia do seu feito.

30. Assinale com V (verdadeiro) ou F (falso) as seguintes afirmaes, sobre Memrias de um Sargento
de Milcias, de Manuel Antnio de Almeida.
( ) Leonardo Pataca o pai de um jovem indisciplinado, mas generoso, cujas aventuras e
desacertos compem a maior parte do romance.
( ) A narrativa marcada pelo humor com que so caracterizados os personagens que percorrem
as ruas do Rio de Janeiro.
( ) O romance expe o tratamento que era dispensado aos escravos no sculo XIX e prope o fim
do trfico escravista.
( ) Vidigal tem a tarefa de manter o respeito ordem no romance, mas no apela para a violncia
fsica e faz uso do dilogo e do convencimento.
A sequncia correta de preenchimento dos parnteses, de cima para baixo,
(A) V F F F.
(B) F V V F.
(C) V V F V.
(D) F F V V.
(E) V V F F.

14

UFRGS CV/2011 LIT

41

31. Leia os fragmentos abaixo. O primeiro de Luiz Gama, um ex-escravo que se tornou militante do
abolicionismo. O segundo de Castro Alves, conhecido poeta abolicionista.
1.
Escravo - no, no morri,
Nos ferros da escravido;
L nos palmares vivi,
Tenho livre o corao!
Nas minhas carnes rasgadas,
Nas faces ensanguentadas
Sinto as torturas de c;
Deste corpo desgraado
Meu esprito soltado
No partiu ficou-me l!...

2.
Ontem a Serra Leoa,
A guerra, a caa ao leo,
O sono dormido toa
Sob as tendas damplido...
Hoje... o poro negro, fundo,
Infecto, apertado, imundo,
Tendo a peste por jaguar...
E o sono sempre cortado
Pelo arranque de um finado,
E o baque de um corpo ao mar...

Naquelas quentes areias


Naquela terra de fogo,
Onde livre de cadeias
Eu corria em desafogo...
L nos confins do horizonte...
L nas plancies... nos montes...
L nas alturas do cu...
De sobre a mata florida
Esta minhalma perdida
No veio s parti eu.

Ontem plena liberdade,


A vontade por poder...
Hoje... cumlo* de maldade
Nem so livres pra... morrer...
Prende-os a mesma corrente
- Frrea, lgubre serpente
Nas roscas da escravido.
E assim roubados morte,
Dana a lgubre coorte
Ao som do aoite... Irriso!...
* cmulo

Assinale com V (verdadeiro) ou F (falso) as seguintes afirmaes, sobre esses fragmentos.


( ) Ambos os poemas foram escritos por abolicionistas que confrontam o passado, vivido em
liberdade, com o presente, vivido sob a tirania da escravido.
( ) A opo pela primeira pessoa, no excerto de Gama, simboliza a resistncia do escravo que,
mesmo com o corpo preso, mantm o esprito livre.
( ) As reticncias do poema de Castro Alves reforam o tom dramtico que o eu-lrico imprime
cena descrita, da qual ele no participa, posto que apenas um observador.
( ) O segundo texto, ao descrever o movimento do escravo aoitado como uma dana, suaviza a
violncia do chicote e da prpria condio servil.
A sequncia correta de preenchimento dos parnteses, de cima para baixo,
(A) V V V F.
(B) F V V V.
(C) V F V F.
(D) F V F F.
(E) V F F V.

UFRGS CV/2011 LIT

15

42

32. Assinale com V (verdadeiro) ou F (falso) as


seguintes afirmaes, sobre Lucola, de
Jos de Alencar.
( ) Paulo, recm-chegado ao Rio de Janeiro,
sente-se atrado por uma jovem na Festa
da Glria, ainda sem saber que se trata de
uma bela prostituta chamada Lucola.
( ) Lucola, prostituta muito solicitada,
recusa as propostas de exclusividade
de seus servios, seja quem for o autor
da proposta.
( ) Paulo apaixona-se por Lucola, mas
reprova sua vida dissoluta; por isso,
tenta convenc-la a abandonar o Rio de
Janeiro e partir com ele para a Europa.
( ) Lucola o nome forjado de Maria da
Glria, moa que foi violentada por seu
padrasto e obrigada a se prostituir
depois de expulsa de casa.
A sequncia correta de preenchimento dos
parnteses, de cima para baixo,
(A)
(B)
(C)
(D)
(E)

V
F
V
F
V

V
V
V
F
F

F
V
F
V
F

V.
F.
F.
V.
V.

34. Assinale

alternativa

correta,

sobre

Memrias Pstumas de Brs Cubas, de


Machado de Assis.

(A) Brs Cubas candidatou-se a deputado,


foi eleito e proferiu discursos que
causaram impacto a ponto de ter seu
nome considerado para o cargo de
ministro.
(B) Brs Cubas estudou Direito em
Coimbra, como outros brasileiros de
sua classe, mas confessa ter aprendido
pouco ao longo do curso.
(C) Dona
Plcida,
depois
que
um
pretendente lhe props casamento,
abandonou a tarefa de alcoviteira do
amor clandestino entre Brs e Virglia.
(D) Quincas Borba considera Brs Cubas
seu discpulo, mas s lhe revela alguns
aspectos de sua filosofia para no
causar mal-estar ao amigo.
(E) O cunhado Cotrim um homem
desagradvel, mas bom pagador, e
discreto a ponto de evitar que suas aes
de caridade venham a ser divulgadas.

33. Considere as seguintes afirmaes, sobre


Memrias Pstumas de Brs Cubas, de
Machado de Assis.
I - Brs Cubas manteve um caso amoroso
com Marcela na juventude e, depois de
conhecer a filosofia de Quincas Borba,
voltou a tentar conquistar a antiga
namorada.
II - Virglia conheceu Brs Cubas antes de
casar-se com Lobo Neves; no
resistindo aos encantos do antigo
namorado, manteve um caso com Brs
Cubas depois da morte de Nh-Lol.
III- Brs Cubas conheceu Quincas Borba
quando eram crianas, mas a
convivncia estabeleceu-se mais tarde,
quando Quincas Borba veio a
apresentar sua filosofia ao amigo.

35. Considere as seguintes afirmaes, sobre


contos de Machado de Assis indicados
como leitura obrigatria.
I - O fato de Candinho percorrer ruas de
nomes como da Ajuda e do Parto
antecipa, com ironia, o destino da
escrava por ele capturada.
II - O riso para dentro e as cicatrizes na
pele so marcas da violncia da Sinh
sobre o esprito e o corpo de Lucrcia.
III- A futilidade da personagem Mariana
demonstra que Machado escrevia para
agredir seu pblico leitor, basicamente
feminino e burgus.
Quais esto corretas?

Quais esto corretas?

(A) Apenas I.

(A)
(B)
(C)
(D)
(E)

(B) Apenas II.

Apenas I.
Apenas III.
Apenas I e II.
Apenas II e III.
I, II e III.

(C) Apenas I e II.


(D) Apenas II e III.
(E) I, II e III.

16

UFRGS CV/2011 LIT

43

36. Leia o trecho abaixo, extrado do romance


O Primo Baslio, de Ea de Queirs.
Estavam parados ao p da confeitaria. Na
vidraa, por trs deles, emprateleirava-se
uma exposio de garrafas de malvasia
com os seus letreiros muito coloridos,
transparncias avermelhadas de gelatinas,
amarelides enjoativas de doces de ovos, e
queques de um castanho-escuro tendo
espetados cravos tristes de papel branco ou
cor-de-rosa.
Velhas
natas
lvidas
amolentavam-se no oco dos folhados;
ladrilhos
grossos
de
marmelada
esbeiavam-se ao calor; as empadinhas de
marisco aglomeravam as suas crostas
ressequidas.
Com relao a este trecho, assinale a
alternativa que preenche corretamente as
lacunas do enunciado abaixo, na ordem em
que aparecem.
No trecho do romance, percebe-se a
preocupao do escritor com a ........ dos
pormenores do ambiente, caracterstica
prpria do estilo ........ . Termos como
enjoativas, tristes e ressequidas,
empregados neste contexto, concretizam a
visada ........ que o narrador expressa sobre
a sociedade lisboeta.
(A) descrio realista

37. Considere as seguintes afirmaes sobre


obras de trs escritores do sculo XIX.
I - O Ateneu, de Raul Pompeia, examina e
avalia, mediante narrador em primeira
pessoa, a experincia do menino Srgio,
que
tenta
adaptar-se,
contestar,
estabelecer amizades, etc., no ambiente
hostil do colgio, sob a autoridade de
Aristarco.
II - O Cortio, de Alusio Azevedo, registra o
rduo cotidiano das camadas populares,
na segunda metade do sculo XIX,
atravs de um relato pontuado de
comentrios
irnicos
quanto
s
explicaes pretensamente cientficas do
comportamento humano.
III- Triste Fim de Policarpo Quaresma, de
Lima Barreto, narra as desventuras de um
burocrata patriota que, antes de combater
a Revolta da Armada, tenta incrementar a
produtividade rural mediante distribuio
de terras e dilogo com os lavradores.
Quais esto corretas?
(A) Apenas I.
(B) Apenas III.
(C) Apenas I e II.
(D) Apenas II e III.
(E) I, II e III.

crtica

(B) narrao impressionista crtica


(C) descrio realista

nostlgica

(D) narrao realista

nostlgica

(E) descrio impressionista crtica

38. Assinale a alternativa que preenche


corretamente as lacunas do enunciado
abaixo, na ordem em que aparecem.

Contos Gauchescos, de Simes Lopes Neto,


so narrados por ........ , gacho ........ ,
que conta suas estrias para ........; o
conjunto revela um extraordinrio painel da
vida campeira.
(A) Romualdo jovem e rebelde uma
plateia
(B) Blau Nunes maduro e altivo uma
plateia
(C) Blau Nunes jovem e rebelde um
interlocutor silencioso
(D) Romualdo maduro e altivo um
interlocutor silencioso
(E) Blau Nunes maduro e altivo um
interlocutor silencioso

UFRGS CV/2011 LIT

17

44

39. Leia os seguintes fragmentos, o primeiro


extrado do poema Ode Triunfal, e o
segundo, do poema Tabacaria, ambos de
Fernando Pessoa.
1.
Ah, poder exprimir-me todo como um
motor se exprime!
Ser completo como uma mquina!
Poder ir na vida triunfante como um
automvel ltimo modelo!
Poder
ao
menos
penetrar-me
fisicamente de tudo isto,
Rasgar-me
todo,
abrir-me
completamente, tornar-me passento,
A todos os perfumes de leos e calores
e carves
Desta flora estupenda, negra, artificial e
insacivel
2.
O mundo para quem nasce para o
conquistar
E no para quem sonha que pode
conquist-lo, ainda que tenha razo.
Tenho sonhado mais que o que
Napoleo fez.
Tenho apertado ao peito hipottico mais
humanidades do que Cristo.
Tenho feito filosofias em segredo que
nenhum Kant escreveu.
Mas sou, e talvez serei sempre, o da
mansarda,
Ainda que no more nela;
Serei sempre o que no nasceu para isso;
Serei sempre s o que tinha qualidades ;
Serei sempre o que esperou que lhe
abrissem a porta ao p de uma parede
sem porta.
Sobre esses fragmentos, so feitas as
seguintes afirmaes.
I - Como representante da corrente
futurista, Ode Triunfal celebra o
progresso, a velocidade, a mquina,
em suma, o novo.
II - No segundo fragmento, o eu-lrico
define sua existncia a partir de
negatividades e impossibilidades.
III- O eu-lrico do segundo fragmento
associa-se a grandes vultos histricos
com vistas a superar o carter
provinciano portugus.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

40. Considere as seguintes afirmaes, sobre


obras de dois escritores do sculo XX.
I - Em O Retrato, de Erico Verissimo,
prossegue a saga do cl Terra Cambar,
tendo por foco principal a trajetria de
Rodrigo Cambar, bisneto do clebre
capito.
II - Em Angstia, de Graciliano Ramos, Lus
da Silva tem parcos rendimentos como
funcionrio pblico e obtm algum
dinheiro
escrevendo
artigos
sob
encomenda.
III- Em So Bernardo, de Graciliano Ramos,
Paulo Honrio entra em crise depois
que sua mulher foge da fazenda para
voltar a ser professora.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

41. Considere as seguintes afirmaes, sobre


Porteira Fechada, de Cyro Martins.
I - O narrador em terceira pessoa
distanciado e no se permite muitos
comentrios e avaliaes sobre os
personagens da obra, no que se
assemelha ao narrador do romance Os
Ratos, de Dyonlio Machado.
II - H uma ntida diferena entre o
registro de linguagem do narrador e o
registro de linguagem dos personagens
incultos, cujos desvios em relao
norma gramatical so reproduzidos
com algum detalhe.
III- Joo Guedes a encarnao do peo
de estncia que, embora nunca tenha
possudo terra e bens, orgulha-se de
manter seu cavalo e de prestar servios
na lide pecuria e na atividade
guerreira.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas I.
Apenas II.
Apenas III.
Apenas I e II.
I, II e III.

18

Apenas I.
Apenas III.
Apenas I e II.
Apenas II e III.
I, II e III.

Apenas I.
Apenas II.
Apenas I e III.
Apenas II e III.
I, II e III.
UFRGS CV/2011 LIT

45

42. Com base no texto Campo Geral, da obra Manuelzo e Miguilim, de Joo Guimares Rosa, associe
adequadamente cada uma das descries da coluna da esquerda, abaixo, ao respectivo
personagem, citado na coluna da direita.
( ) Tinha m ndole; pregava peas nos outros
e tinha interesse nos assuntos da
sexualidade.
( ) Destacava-se pela sensatez e pela coragem;
queria tudo observar e dava respostas
sbias.
( ) Vestia-se de preto e chamava ateno pela
magreza; gostava do escuro e de rezar.
( ) Pensava muito na morte; era sensvel,
solitrio e no compreendia o mundo dos
adultos.

1 - Dito
2 - Patori
3 - Maitia
4 - Miguilim
5 - Vov Izidra

A sequncia correta de preenchimento dos parnteses, de cima para baixo,


(A) 3 4 5 2
(B) 4 1 3 5.
(C) 5 2 3 4.
(D) 2 1 5 4.
(E) 2 4 1 3.
43. Considere as seguintes afirmaes, sobre o texto Uma Estria de Amor, da obra Manuelzo e
Miguilim, de Joo Guimares Rosa.
I - Como numa romaria, o povo dirigia-se fazenda Samarra para oferecer presentes para a
inaugurao da capela de Nossa Senhora do Socorro: apareceram desde conchas, plantas e
bichos at objetos bizarros e artesanatos de folha de buriti.
II - Manuelzo construiu a casa da fazenda margem de um riachinho que secou misteriosamente;
na mesma poca, o vaqueiro passou a sentir-se doente, com medo da morte.
III- A fora da histria do Boi Bonito, que era tido como invencvel e misterioso, contada pelo velho
Camilo, seduziu Manuelzo e o fez compreender seu destino.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas II e III.
(E) I, II e III.

UFRGS CV/2011 LIT

19

46

44. Considere o poema abaixo, de Carlos


Drummond de Andrade.
CONFISSO

45. Assinale a alternativa correta em relao


pea O Pagador de Promessas, de Dias
Gomes.
(A) O padre recusou a entrada de Z-doBurro na igreja por entender que,
realizando sua promessa, o campons
entregaria a alma ao Diabo.

No amei bastante meu semelhante,


no catei o verme nem curei a sarna.
S proferi algumas palavras,
melodiosas, tarde, ao voltar da festa.

(B) O reprter explicita os interesses de Zdo-Burro ao descrev-lo no jornal como


um Messias que pregava a revoluo.
(C) Z-do-Burro mantm-se coerente ao
longo de todo seu percurso, que culmina
com a morte, quando, carregado pelos
capoeiristas, finalmente consegue entrar
na igreja com a cruz.

Dei sem dar e beijei sem beijo.


(Cego talvez quem esconde os olhos
embaixo do catre.) E na meia-luz
tesouros fanam-se, os mais excelentes.
Do que restou, como compor um homem
e tudo que ele implica de suave,
de concordncias vegetais, murmrios
de riso, entrega, amor e piedade?

(D) Z-do-Burro um heri pico porque


desafiou os poderes da Igreja e do Estado
quando deu o exemplo de distribuir as
terras entre seus empregados.

No amei bastante sequer a mim mesmo,


contudo prximo. No amei ningum.
Salvo aquele pssaro vinha azul e doido
que se esfacelou na asa do avio.

(E) Com o fracasso de Z-do-Burro, o autor


defende a inviabilidade do sincretismo
religioso no Brasil, pois uma promessa
feita num terreiro nunca poderia ser
paga numa igreja.

Com base neste poema, correto afirmar


que o eu-lrico

46. Assinale a alternativa correta em relao a


poemas de Estrela da Vida Inteira, de
Manuel Bandeira.

(A) declara que proferiu alguns poemas


depois de ter tentado diminuir o
sofrimento do semelhante.

(A) Ao defender o poeta srdido como


aquele em cuja poesia h a marca
suja da vida, Bandeira expressa sua
crtica ao uso de temas vulgares na
poesia modernista.

(B) declara
que
procurou
tesouros
desaparecidos apesar da cegueira
provocada pela sombra do catre.
(C) se pergunta como admirar um homem,
se ele se esconde sob concordncias
vegetais e murmrios de riso.
(D) se pergunta sobre murmrios de riso,
entrega
e
piedade,
os
quais
esconderiam a mulher amada.
(E) declara que no amou a si mesmo nem
a ningum, a no ser o pssaro que
colidiu contra a asa do avio.

(B) No poema Trem de Ferro, versos como


Vou depressa / Vou correndo / Vou na
roda / Que s levo / Pouca gente /
Pouca gente / Pouca gente...
reproduzem o ritmo e a rotina
repetitivos do trem.
(C) Nos versos Andarei de bicicleta /
Montarei em burro brabo / Subirei no paude-sebo / Tomarei banhos de mar, de
Vou-me embora pra Pasrgada, o eu-lrico
quer realizar no lugar idealizado coisas
tpicas do mundo desenvolvido.
(D) Ao mencionar Perdi o jeito de sofrer. /
Ora essa. / No sinto mais aquele gosto
cabotino da tristeza, percebe-se a
inclinao de Bandeira pelo ideal
romntico que entende a poesia como
sofrimento.
(E) No trecho O meu reino pelas trs
mulheres do sabonete Arax, o eulrico critica o poder da propaganda
sobre sua existncia.

20

UFRGS CV/2011 LIT

47

48. Considere as seguintes afirmaes, sobre o


livro de contos Feliz Ano Novo, de Rubem
Fonseca.

47. Considere os seguintes trechos de canes.

SAMBA E AMOR
Chico Buarque

I - O conto Agruras de um Jovem Escritor


um dos poucos escrito em terceira
pessoa; seu personagem principal
certo escritor pouco conhecido, mas
premiado, que tenta livrar-se de Lgia,
sua namorada impertinente e talentosa.
II - O conto Feliz Ano Novo apresenta um
violento assalto ocorrido em uma manso
do Rio de Janeiro: trs assaltantes
perpetram brutalidades que incluem
estupro, espancamento e assassinato,
narrados por um dos criminosos.

Eu fao samba e amor at mais tarde


E tenho muito sono de manh
Escuto a correria da cidade, que arde
E apressa o dia de amanh
De madrugada a gente ainda se ama
E a fbrica comea a buzinar
O trnsito contorna a nossa cama, reclama
Do nosso eterno espreguiar

SAMPA
Caetano Veloso
Alguma coisa acontece no meu corao
Que s quando cruza a Ipiranga e a
avenida So Joo
que quando eu cheguei por aqui eu nada
entendi
Da dura poesia concreta de tuas esquinas
Da deselegncia discreta de tuas meninas
Ainda no havia para mim Rita Lee
A tua mais completa traduo
Alguma coisa acontece no meu corao
Que s quando cruza a Ipiranga e a
avenida So Joo
Considere as seguintes afirmaes, sobre
os trechos destas canes.
I - Em Samba e Amor, encontra-se
estabelecida uma situao em que o
eu-lrico se entrega arte e ao amor,
em oposio ao movimento urbano que
vai associado velocidade e a apelos
ao trabalho.
II - Em Sampa, o eu-lrico est imerso no
quadro urbano, cruzando ruas e avenidas,
ao mesmo tempo em que enuncia sua
recusa e protesto contra a deselegncia
das meninas e a msica de Rita Lee.
III- Nas duas canes, o ambiente urbano
faz contraste com as declaraes do
eu-lrico, que podem oscilar entre a
crtica s ms condies de trfego e a
idealizao de smbolos cosmopolitas.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

III- O conto Intestino Grosso composto


pela entrevista de um escritor famoso
que responde s perguntas de outro
ficcionista, o qual se mostra satisfeito
com as respostas que ostentam cinismo
pedante, arrogncia exibicionista e
desrespeito pelo pblico leitor.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas I.
Apenas II.
Apenas I e III.
Apenas II e III.
I, II e III.

49. Assinale a alternativa correta, sobre o romance


O Filho Eterno, de Cristvo Tezza.
(A) O pai de Felipe narra sua complexa
relao com o filho portador de deficincia
e, ao mesmo tempo, repassa sua carreira
de escritor e de professor.
(B) O menino Felipe passa por um
tratamento psicomotor que o deixa trs
anos afastado do pai, o qual s o
encontra nos fins de semana.
(C) O menino Felipe passa os primeiros dez
anos de vida reduzido ao crculo
familiar, uma vez que as creches e
escolas no o recebem.
(D) O pai de Felipe, o narrador da estria,
engaja-se no tratamento do filho
depois do episdio em que o menino se
perdeu ao sair de casa.

Apenas I.
Apenas II.
Apenas III.
Apenas I e III.
I, II e III.

(E) O menino Felipe demonstra serenidade


e maturidade no episdio em que o pai,
descontrolado, se envolve em uma
briga de trnsito.

UFRGS CV/2011 LIT

21

48

50. Leia o fragmento abaixo, de Histria do


Cerco de Lisboa, de Jos Saramago, nico
autor de lngua portuguesa que, at o
presente, recebeu o prmio Nobel de
Literatura.
[] com a mo firme segura a
esferogrfica e acrescenta uma palavra
pgina, uma palavra que o historiador no
escreveu, que em nome da verdade
histrica no poderia ter escrito nunca, a
palavra No, agora o que o livro passou a
dizer que os cruzados No auxiliaro os
portugueses a conquistar Lisboa, assim est
escrito e portanto passou a ser verdade,
ainda que diferente, o que chamamos falso
prevaleceu sobre o que chamamos
verdadeiro, tomou o seu lugar [].
Considere as seguintes afirmaes, sobre
esse fragmento.
I - Evidencia-se um modelo de narrador
que se intromete no relato colocando
em
evidncia
seus
modos
de
construo.
II - O historiador substitui o narrador na
tarefa de relatar o episdio do cerco de
Lisboa, porque a histria tem o
compromisso com a verdade dos fatos.
III- Questionam-se os limites entre histria
e fico, bastando, nesse caso, uma
palavra para modificar uma viso
anteriormente estabelecida sobre o
passado.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e III.
(E) I, II e III.

22

UFRGS CV/2011 LIT

49

2012
LITERATURA DE LNGUA PORTUGUESA
Informao

A literatura, ao longo da histria das civilizaes, tem desempenhado papis dos quais no se pode
prescindir. Um deles, talvez o mais universal, o tratamento das condies do estar no mundo, ou seja, o que faz
de cada um o que ele , seus sentimentos, seus pensamentos, seus desejos, seus sonhos em dilogo com a
realidade. Outra dimenso importante da literatura percebida na representao das coletividades e das
sociedades. Por meio da produo literria de uma poca, pode-se conhecer o contexto histrico e cultural dessa
poca. Nessa perspectiva, a literatura testemunha a passagem do tempo e possibilita conhecer o passado, a
percepo dos que viveram em outros tempos e os acontecimentos que marcaram a vida de nossos antepassados.
Por ltimo, sendo criao do esprito humano, a literatura busca na linguagem verbal mecanismos para construir o
sentido e para estimular a imaginao do leitor, ou at para subverter a prpria linguagem.
Com base nessa informao, as 25 questes desta prova foram divididas em trs conjuntos: o ser
humano e seus sentimentos; as relaes entre cultura e sociedade; e a construo do texto literrio.

O SER HUMANO E SEUS SENTIMENTOS


26. Leia os seguintes fragmentos de letras de canes, o primeiro extrado de Milonga de Sete Cidades,
de Vitor Ramil, e o segundo de Noites do Serto, de Milton Nascimento e Tavinho Moura.
1.

2.
No se espante assim meu moo
Com a noite do meu serto
Tem mais perigo que a poesia
Do que o julgo da razo
A tormenta gera histria
to vida quanto o sol
So cavalos beirando o rio,
o corpo da menina
Ofegante ali do lado [...]

Fiz a milonga em sete cidades


Rigor, Profundidade, Clareza
Em Conciso, Pureza,
Leveza e Melancolia
Milonga feita solta no tempo
Jamais milonga solta no espao
Sete cidades frias so sua morada
Em Clareza o pampa
Infinito e exato me fez andar [...]

Considere as seguintes afirmaes sobre esses segmentos.


I - Tanto em Milonga de Sete Cidades quanto em Noites do Serto, um sentimento de melancolia
associado a lembranas que caracterizam as paisagens da infncia dos autores, o pampa e o
serto, respectivamente.
II - Vitor Ramil faz uma apologia frieza das cidades, que transforma seus habitantes em seres
solitrios; Milton Nascimento e Tavinho Moura, em contraste, acentuam a agitao noturna do
serto, permeada de tristes acontecimentos.
III- O ritmo dolente da milonga est relacionado s baixas temperaturas das cidades pampeanas;
enquanto a noite perigosa do serto remete a situaes inusitadas, visto que a tormenta gera
histria.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas I.
Apenas II.
Apenas III.
Apenas II e III.
I, II e III.
9

UFRGS CV/2012 LIT

50

27. Leia os seguintes textos, o primeiro, um soneto de Lus de Cames, e o segundo, a letra da cano
Me Acalmo, Me Desespero, de Cazuza.

1.

2.

Tanto de meu estado me acho incerto,


Que em vivo ardor estou de frio;
Sem causa, justamente, choro e rio;
O mundo todo abarco e nada aperto.

O amor deflagra guerras


No corao de quem ama
Um bandido srdido
Uma menina linda

tudo quanto sinto um desconcerto;


Da alma um fogo me sai, da vista um rio;
Agora espero, agora desconfio,
Agora desvario, agora acerto.

O amor lana seu ferro


No desamparo dos amantes
um inseto louco em volta da luz
Um lobo solitrio uivando na escurido

Estando em terra, chego ao cu voando;


Numa hora acho mil anos; e de jeito
Que em mil anos no posso achar uma hora.

Do amor pouco sei


E quase tudo espero
Amando eu me acalmo e me desespero

Se me pergunta algum porque assim ando,


Respondo que no sei; porm suspeito
Que s porque vos vi, minha Senhora.

O amor faz da minha voz


Um gemido surdo
De mim um escravo lanhado
Um tigre encurralado
O amor sombreia as trevas
Clareia at cegar
um lar que no abriga
O crime perfeito de dois assassinos

Considere as seguintes afirmaes sobre a forma como o amor descrito no soneto e na letra da
cano.
I - O amor, por ser um sentimento de natureza contraditria, leva o indivduo a ver o mundo como
um lugar instvel e desconcertante.
II - O amor um sentimento imprevisvel que deflagrado a partir da figura sedutora e angelical de
certas mulheres.
III- O amor provoca o intenso desejo daquele que ama, fazendo com que ele, o amante, mantenha
um dilogo com a mulher amada.
Quais dessas afirmaes so compartilhadas por ambos os eu-lricos?
(A) Apenas I.
(B) Apenas II.
(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.
10

UFRGS CV/2012 LIT

51

28. Assinale com V (verdadeiro) ou F (falso) as


seguintes afirmaes sobre sentimentos de
personagens de Campo Geral, da obra
Manuelzo e Miguilim, de Guimares Rosa.
( ) Miguilim odiava seu Pai, pela violncia das
surras e castigos que ele lhe impunha:
mandar embora a cadela, ou soltar os
passarinhos que estavam nas gaiolas.
( ) As rezas da av e os feitios de Mitina
enfim surtiram efeito: Miguilim passou a
se sentir culpado pela morte do irmo.
( ) Miguilim detestava o Mutum, mas, com a
ajuda dos culos do doutor, acabou
finalmente descobrindo que se tratava de
um lugar bonito.
( ) Dito sentiu inveja de Miguilim porque
Papaco-o-Paco era capaz de dizer
Miguilim, Miguilim, me d um beijim,
mas no conseguia pronunciar Dito.

30. Considere as seguintes afirmaes sobre O


Uraguai, de Baslio da Gama.
I - Sep, de modo desafiador, Cacambo, mais
diplomtico, encontram-se, antes da
batalha, com o general Andrade que os
aconselha a respeitar a autoridade da
Coroa.
II - Eufrico, o general Andrade, lder das
tropas luso-espanholas, extravasa sua
emoo celebrando, depois da batalha, a
morte de Sep.
III- Cacambo, tendo tido uma viso na qual
Sep aparecia transtornado ao lado de
Lindoia
desfalecida,
incendeia
o
acampamento
das
tropas
inimigas
durante a batalha.
Quais esto corretas?

A sequncia correta de preenchimento dos


parnteses, de cima para baixo,

(A) Apenas I.

(A)
(B)
(C)
(D)
(E)

(C) Apenas III.

F V F F.
F V F V.
V V F V.
V F V V.
V F V F.

(B) Apenas II.


(D) Apenas II e III.
(E) I, II e III.

29. A protagonista de Lucola, romance de Jos


de Alencar,

31. Considere as seguintes afirmaes sobre a


poesia de lvaro de Campos, heternimo de
Fernando Pessoa.

(A) recusa-se a receber Paulo em seus


aposentos, pois quer evitar o cime de
seus pretendentes e de seus clientes.

I - Em Todas as Cartas de Amor So, o eulrico recusa-se a escrever porque prefere


sonhar a viver.

(B) assume o papel de mulher fatal, a fim de


garantir que o homem que desonrou sua
famlia seja punido e abandonado pela
esposa.

II - No Poema em Linha Reta, a trajetria do


indivduo descrita como sendo vinculada
a fracassos e vilezas, o que provoca seu
cansao e sua revolta.

(C) participa de uma orgia em que se


embebeda, canta canonetas obscenas e
ofende os convidados com insinuaes
sobre a honra masculina.

III- Em Aniversrio, o eu-lrico, acreditando


ter recuperado a perfeio do passado,
renega os familiares mortos.

(D) evita casar com Couto, com o propsito


de preservar o patrimnio da famlia dele,
pois ela no controlava seu mpeto de
consumo e de ostentao.

Quais esto corretas?

(E) apaixona-se por Paulo que retribui o


sentimento , abandona a prostituio e
vem a morrer nos braos de seu amado.

(C) Apenas I e II.

(A) Apenas I.
(B) Apenas II.
(D) Apenas I e III.
(E) I, II e III.
11

UFRGS CV/2012 LIT

52

32. Leia o poema abaixo, de Ana Cristina Csar.


FINAL DE UMA ODE
Acontece assim: tiro as pernas do balco de onde via um sol de
inverno se pondo no Tejo e saio de fininho dolorosamente
dobradas as costas e segurando o queixo e a boca com uma das
mos. Sacudo a cabea e o tronco incontrolavelmente, mas
de maneira curta, curta, entendem? Eu estava dando
gargalhadinhas e agora estou sofrendo nosso prximo
falecimento, minhas gargalhadinhas evoluram para um
sofrimento meio nojento, meio ocasional, sinto um d extremo
do rato que se fere no poro, ai que outra dor sbita, ai que
estranheza e que lusitano torpor me atira de braos abertos
sobre as ripas do cais ou do palco ou do quartinho. Quisera
dividir o corpo em heternimos medito aqui no cho, imvel,
txico do tempo.
Considere as seguintes afirmaes sobre esse poema.
I - O eu-lrico assume postura confessional, atento aos elementos desconexos do cotidiano.
II - O eu-lrico declara sentir-se fragmentado (dividir o corpo em heternimos), pois percebe o
ambiente que o circunda a partir de pontos de vista divergentes entre si.
III- O eu-lrico sofre e se descontrola diante de sua incapacidade para mudar os fatos que o
atormentam.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas I.
Apenas II.
Apenas I e II.
Apenas I e III.
I, II e III.

33. O bloco superior, abaixo, lista quatro ttulos de romances e seus respectivos autores; o inferior
apresenta resumos de enredo de trs desses romances.
Associe corretamente o bloco inferior ao superior.
1
2
3
4

Senhora, de Jos de Alencar


Inocncia, de Visconde de Taunay
Dom Casmurro, de Machado de Assis
O Mulato, de Alusio Azevedo

( ) Moa rf de pai recebe herana, que lhe permite comprar o marido, sendo a relao
matrimonial marcada pelos atritos entre o casal.
( ) Moa prometida pelo pai a um sertanejo apaixona-se por outro homem e, a partir da, passa a
se sentir dividida entre satisfazer a promessa paterna e entregar-se ao amor.
( ) Moa de origem humilde, depois de um longo namoro, casa-se com seu vizinho, que estava
destinado ao seminrio por uma promessa de sua me.
A sequncia correta de preenchimento dos parnteses, de cima para baixo,
(A)
(B)
(C)
(D)
(E)

1
2
3
1
2

2
1
4
2
1

4.
3.
1.
3.
4.

12

UFRGS CV/2012 LIT

53

34. O personagem narrador de O Filho Eterno, de Cristovo Tezza,


(A) inconformado, deseja que seu filho, ainda beb, padea de uma cardiopatia congnita associada
trissomia 21, o que rapidamente livraria a famlia do constrangimento de ter tido um filho
deficiente.
(B) revoltado, recebe, quando jovem em Coimbra, dinheiro proveniente de um sequestro praticado
por grupos de esquerda envolvidos na luta armada contra a ditadura.
(C) insubmisso, envolve-se ao chegar Alemanha, em viagem pela Europa, com uma comunidade
hippie que pratica o amor livre e se dedica ao teatro de rua.
(D) perturbado, agride um funcionrio e a diretora da creche, que recusaram a renovao da
matrcula de seu filho deficiente sob o argumento de que a criana atrapalhava as atividades do
grupo.
(E) emocionado, orgulha-se quando Felipe, j adolescente, participa de uma pea de teatro com
forte movimentao no palco e com falas que desafiam a memria.
AS RELAES ENTRE CULTURA E SOCIEDADE
35. Leia, abaixo, a letra da cano Feitio da Vila, de Noel Rosa.
Quem nasce l na Vila
nem sequer vacila
ao abraar o samba
Que faz danar
os galhos do arvoredo
E faz a lua nascer mais cedo.
O sol da Vila triste,
Samba no assiste
porque a gente implora:
Sol, pelo amor de Deus,
No venha agora
que as morenas
vo logo embora.

A Vila tem
um feitio sem farofa,
sem vela e sem vintm,
que nos faz bem;
tendo nome de princesa
transformou o samba
num feitio decente,
que prende a gente.

L em Vila Isabel
quem bacharel
no tem medo de bamba:
So Paulo d caf,
Minas d leite
E a Vila Isabel d samba.
Eu sei tudo que fao,
sei por onde passo,
paixo no me aniquila.
Mas tenho que dizer,
modstia parte,
meus senhores, eu sou da Vila!

Considere as seguintes afirmaes sobre a letra dessa cano.


I - O sol da Vila Isabel testemunha o cotidiano de homens e mulheres que lutam para sobreviver; a
lua, por sua vez, atrada pelo gingado das mulheres, surge antes do tempo para assistir o
espetculo do samba.
II - As tradies, os versos, as crenas, os conhecimentos e os costumes dos moradores de Vila
Isabel so reforados atravs da referncia princesa que assinou a Abolio.
III- Depois de mencionar que, na Vila, bacharel pode enfrentar um bamba, Noel Rosa exalta a Vila
Isabel, ao compar-la a importantes estados da Federao.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas I.
Apenas III.
Apenas I e II.
Apenas II e III.
I, II e III.
13

UFRGS CV/2012 LIT

54

Instruo: As questes 36 e 37 esto relacionadas ao poema abaixo.


DUAS DAS FESTAS DA MORTE
Joo Cabral de Melo Neto
Recepes de cerimnia que d a morte:
o morto, vestido para um ato inaugural;
e ambiguamente: com a roupa do orador
e a da esttua que se vai inaugurar.
No caixo, meio caixo meio pedestal,
o morto mais se inaugura do que morre;
e duplamente: ora sua prpria esttua,
ora seu prprio vivo, em dia de posse.

Piqueniques infantis que d a morte:


os enterros de criana no Nordeste:
reservados a menores de treze anos,
imprprios a adultos (nem o seguem).
Festa meio excurso meio piquenique,
ao ar livre, boa para dia sem classe;
nela, as crianas brincam de boneca,
e, alis, com uma boneca de verdade.

36. Considere as seguintes afirmaes sobre esse poema.


I - Nas cerimnias fnebres, a homenagem feita pelo orador assegura que a memria dos atos do
morto sobreviver entre familiares e concidados.
II - No Nordeste, os enterros de crianas se assemelham a festas, da quais os adultos no
participam.
III- Os enterros, que parecem meio excurso meio piquenique, e o cadver da criana, que se
confunde com uma boneca, caracterizam a banalizao da morte infantil.
Quais esto corretas, de acordo com o poema?
(A) Apenas I.
(B) Apenas III.
(C) Apenas I e II.
(D) Apenas II e III.
(E) I, II e III.
37. Assinale com V (verdadeiro) ou F (falso) as seguintes afirmaes sobre o poema.
( ) O poeta refere a morte de quem homenageado e de quem sequer lembrado, valendo-se de
versos livres e termos prosaicos.
( ) O poema contrasta a formalidade da cerimnia da primeira estrofe com a informalidade do
enterro da segunda estrofe.
( ) O poeta, ao descrever a homenagem ao defunto, denuncia o desinteresse do orador pela famlia
do morto.
( ) O poema, ao associar caixo e pedestal, remete s noes de imobilidade e de exibio, o
que refora o paralelo entre o morto e a esttua.
A sequncia correta de preenchimento, de cima para baixo,
(A) V F V F.
(B) F V V F.
(C) V V F F.
(D) F V F V.
(E) V F F V.
14

UFRGS CV/2012 LIT

55

38. Ao final de Uma Estria de Amor, da obra


Manuelzo e Miguilim, de Guimares Rosa, o
Velho Camilo conta a histria do Boi Bonito,
que acaba capturado pelo Vaqueiro Menino.

40. Assinale a alternativa correta sobre a pea O


Pagador de Promessas, de Dias Gomes.
(A) A cordialidade do povo brasileiro acaba
por torn-lo forte, capaz de vencer a
represso das instituies, como simboliza
a roda de capoeira no final da pea.

Sobre o duelo entre o Boi Bonito e o Vaqueiro


Menino, considere as seguintes afirmaes.
I - O Boi, que desafiara inmeros vaqueiros,
afinal se rende ao vaqueiro que venceu o
medo, reconhecendo que para ele estava
guardado e destinado.

(B) Diante dos fatos que ocorreram na frente


da igreja, Z-do-Burro decide voltar ao
terreiro para negociar com Ians a cura
de Nicolau.

II - Aps ouvir a narrativa do duelo, Manuelzo


descobre seu destino: tocar mais uma vez a
boiada, j que no estava doente.

(C) No folheto ABC do Z-do-Burro, a


imagem do sertanejo como um rebelde
com intenes polticas amplamente
difundida.

III- Tanto a histria contada por Camilo como


a de Manuelzo so encerradas de modo
festivo, o que prprio do mundo
sertanejo.

(D) Alegando ser superstio de gente


ignorante, o doutor no aceitou usar a
pomada milagrosa para estancar a
hemorragia de Nicolau.

Quais esto corretas?


(A)
(B)
(C)
(D)
(E)

(E) Z-do-Burro, fiel sua palavra, no aceita


trocar sua promessa por outra, ainda que
isso o impea de entrar na igreja.

Apenas I.
Apenas II.
Apenas I e II.
Apenas II e III.
I, II e III.

39. Considere as seguintes afirmaes sobre o


romance Memrias Pstumas de Brs Cubas,
de Machado de Assis.

41. Considere as seguintes afirmaes sobre


contos de Feliz Ano Novo, de Rubem Fonseca.

I - Quando filiado a uma ordem religiosa, Brs


contrariou sua natureza interesseira e sentiuse verdadeiramente recompensado ao
diminuir a desgraa alheia.
II - Baseado na constatao de que, ao olhar
para o prprio nariz, o indivduo deixa de
invejar o que dos outros, Brs teoriza
sobre a utilidade da ponta do nariz para o
equilbrio das sociedades.
III- A teoria do Humanitismo de Quincas
Borba foi fundamentada no episdio da
borboleta negra, que morreu nas mos do
protagonista por no ser azul e bela.

I - Em Botando pra Quebrar, um segurana


de boate, percebendo que ser demitido,
provoca uma briga coletiva ao agredir os
clientes do estabelecimento, que fica
destrudo depois do incidente.
II - Em Passeio Noturno (parte I), um bem
pago executivo, que perdeu a famlia em
um acidente rodovirio, percorre as ruas
de So Paulo procura de vtimas a
serem atropeladas.

Entrevista,
dois
interlocutores
III- Em
annimos, um homem e uma mulher,
encontram-se em uma sala escura onde a
mulher narra os episdios violentos em
que esteve envolvida com seu marido.
Quais esto corretas?

Quais esto corretas?

(A) Apenas I.

(A) Apenas I.

(B) Apenas II.

(B) Apenas II.

(C) Apenas I e III.

(C) Apenas I e II.

(D) Apenas II e III.

(D) Apenas I e III.

(E) I, II e III.

(E) I, II e III.

15

UFRGS CV/2012 LIT

56

42. Considere o enunciado abaixo e as trs propostas para complet-lo.


No romance O Centauro no Jardim, Moacyr Scliar
1 - associa a trajetria de Guedali s transformaes por que passou o Estado de Israel, pois o
personagem, filho de pais judeus, nasceu centauro, empreendeu uma longa fuga e finalmente
sofreu uma cirurgia que o deixou na condio de bpede.
2 - retrata o comportamento da classe mdia brasileira quando Guedali revela seu passado como
centauro aos amigos do condomnio onde vive com sua famlia, mas eles, por julgarem o fato
inverossmil, debocham da inusitada situao.
3 - evidencia a hipocrisia das relaes conjugais quando Guedali, mesmo tendo sido ocasionalmente
infiel esposa, se vinga, de forma intempestiva e violenta, do jovem que, numa festa, levou
Tita ao adultrio.
Quais propostas esto corretas?
(A) Apenas 1.
(B) Apenas 2.
(C) Apenas 1 e 3.
(D) Apenas 2 e 3.
(E) 1, 2 e 3.
43. Preencha com V (verdadeiro) ou F (falso) as seguintes afirmaes sobre o romance Histria do
Cerco de Lisboa, de Jos Saramago.
( ) Mogueime, ressaltando o sangue que corria pelas ruas como um rio, narra a violenta conquista
de Santarm.
( ) Maria Sara, comovida com o relato de Raimundo Silva sobre barbries que ocorriam durante o
cerco, concorda em passar a noite na casa dele na primeira vez que o visita.
( ) Raimundo Silva relata que, acuados e famintos pelo longo cerco, os mouros foram forados a
comer at mesmo a carne dos ces de Lisboa.
( ) Afonso Henriques enfrentado por Mogueime, que diz ao rei: quem torto nasce nunca se
endireita, no queirais que nasa torto Portugal; assim, em nome da justia, exige receber a
parte do saque que fora combinada.
A sequncia correta de preenchimento dos parnteses, de cima para baixo,
(A) V F V V.
(B) F F V V.
(C) V V F F
(D) V F V F.
(E) F V F V.

16

UFRGS CV/2012 LIT

57

Instruo: As questes 44 e 45 referem-se ao texto abaixo.


Considere o fragmento abaixo, extrado do conto Mgoa que Rala, do escritor Lima Barreto, que
aborda a estada de D. Joo VI e da famlia real em terras brasileiras.
Dos chefes de Estado que tem tido o Brasil, o que mais amou, e muito profundamente o Rio de
Janeiro, foi sem dvida, D. Joo VI [...]. A gente para eles [os artistas], um pouco mais que animais,
eram uns negros toas; e a natureza, um flagelo de mosquitos e cascavis, sem possuir uma
proporcionalidade com o homem, como a de Portugal, que parecia um jardim feito para o homem.
Mesmo os nossos poetas mais velhos nunca entenderam a nossa vegetao, os nossos mares, os
nossos rios; no compreendiam as nossas coisas naturais e nunca lhes pegaram a alma, o
substractum; e se queriam dizer alguma coisa sobre ela caam no lugar comum amplificado e no
encadeamento de adjetivos grandiloquentes, quando no voltavam para a sua arcadiana livresca
floresta de lamos, pltanos, mirtos, com vagabundssimas ninfas e faunos idiotas, segundo a
retrica e a potica das suas cerebrinas escolas, cheias de pomposos tropos, de rap, de latim, e
regras de catecismo literrio. [...] como se poderia exigir de funcionrios, fidalgos limitados na sua
prpria prospia, uma maior fora de sentimento diante dos novos quadros naturais que a luminosa
Guanabara lhes dava, cercando as guas de mercrio de suas harmoniosas enseadas?
D. Joo VI, porm, nobre de alta linhagem e prncipe do sculo de Rousseau, mal enfronhado na
literatura palerma dos rcades, dos desembargadores e repentistas, estava mais apto para senti-los
de primeira mo, diretamente.
44. Considere as seguintes afirmaes sobre esse fragmento.
I - Ao abordar a estada de D. Joo VI e da famlia real em terras brasileiras, o autor condena os
artistas que no se deixaram tocar pela fora da paisagem brasileira, preferindo cenrios e
personagens artificiais.
II - Ao apresentar uma leitura amargurada sobre os burocratas e intelectuais da poca, o autor
revela sua condio social inferior: mulato pobre no aristocrtico meio intelectual da virada do
sculo XIX para o XX.
III- Ao contemplar a luminosa Guanabara, D. Joo VI, por desconhecer os preceitos da literatura
palerma dos rcades, deixou-se sensibilizar diante dos novos quadros naturais.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas I.
Apenas II.
Apenas I e III.
Apenas II e III.
I, II e III.

45. Considere o enunciado abaixo e as trs propostas para complet-lo.


De acordo com esse fragmento,
1 - os poetas mais velhos, por serem brasileiros, so capazes de falar com propriedade da natureza.
2 - os escritores tinham a sensibilidade embotada pelo excesso de erudio.
3 - os poetas brasileiros, em seu processo de criao, foram influenciados pela mistura de raas.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas 1.
Apenas 2.
Apenas 3.
Apenas 2 e 3.
1, 2 e 3.
17

UFRGS CV/2012 LIT

58

A CONSTRUO DO TEXTO LITERRIO


46. Leia os fragmentos que seguem, extrados,
respectivamente, dos textos Trezentas Onas
e No Manantial, includos em Contos
Gauchescos, de Simes Lopes Neto.
Fragmento 1
Eh-pucha! patrcio, eu sou mui rude... a gente
v caras, no v coraes...; pois o meu,
dentro do peito, naquela hora, estava como
um espinilho ao sol, num descampado, no
pino do meio-dia: era luz de deus por todos
os lados!...
E j todo no meu sossego de homem, meti a
pistola no cinto. Fechei um baio, bati o
isqueiro e comecei a pitar.
Fragmento 2
O arranchamento alegre e farto foi
desaparecendo... o feitio da mo de gente foise gastando, tudo foi minguando; as
carquejas e as embiras invadiram; o gravat
lastrou; s o umbu foi guapeando, mas
abichornado, como vivo que se deu bem em
casado...; foi ficando tapera... a tapera... que
sempre um lugar tristonho onde parece que
a gente v gente que nunca viu...
Considere as seguintes afirmaes sobre
esses fragmentos.
I - No primeiro fragmento, a presena de
termos regionais, de linguagem figurada e
de ditado popular contribui para a
caracterizao da identidade e do estado
de esprito do personagem.
II - No segundo fragmento, o uso das formas
verbais invadiram e lastrou para
descrever
mudanas
sofridas
pela
vegetao sugere uma identificao entre
a paisagem natural e o destino trgico da
famlia de Maria Altina.
III- Ambos os fragmentos exemplificam o uso
coloquial da linguagem de Blau Nunes,
que contrasta com o discurso urbano e
erudito do patrcio, reproduzido no texto.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

47. Assinale
a
alternativa
que
preenche
corretamente as lacunas do enunciado abaixo,
na ordem em que aparecem.
O livro A Educao pela Pedra, de Joo Cabral
de Melo Neto, constitui-se de poemas marcados
pela ........ e pelo andamento argumentativo,
alm de alguns deles exibirem ........ , como
se l em ........ e Comendadores Jantando.
(A) complexidade sinttica humor agressivo
Catar Feijo
(B) ambiguidade metafrica reflexo intimista
Catar Feijo
(C) complexidade sinttica reflexo intimista
O Urubu Mobilizado
(D) ambiguidade
metafrica

agressivo O Urubu Mobilizado

humor

(E) complexidade sinttica humor agressivo


O Urubu Mobilizado
48. Em Intestino Grosso, de Rubem Fonseca, o
personagem denominado Autor
(A) argumenta que sua literatura tem por
assunto a vida urbana e a violncia,
embora ele mesmo se considere um
seguidor de Guimares Rosa.
(B) alega que gostaria de escrever como
Machado de Assis, para conquistar
leitores.
(C) sustenta que, apesar dos autores
brasileiros revelarem os detalhes da vida
dos poderosos, os aspectos mais
abstratos sobre finanas e propriedade
no aparecem.
(D) comenta a importncia da literatura
brasileira e sua capacidade de dilogo
com as obras da literatura latinoamericana de tema rural.
(E) discute em que termos sua literatura
pode ser considerada pornogrfica,
argumentando longamente sobre a
pornografia na arte.

Apenas I.
Apenas II.
Apenas I e II.
Apenas II e III.
I, II e III.

18

UFRGS CV/2012 LIT

59

49. Leia o poema Tabaru, de Adlia Prado.


Vira e mexe eu penso numa toada s.
Fiz curso de filosofia pra escovar o pensamento,
no valeu. O mais universal que eu chego
a recepo de Nossa Senhora de Ftima
em Santo Antnio do Monte.
Duas mil pessoas com velas louvando a Maria
num oco de escuro, pedindo bom parto,
moo de bom gnio pra casar,
boa hora pra nascer e morrer.
O cheiro do povo espiritado,
isso eu entendo sem desatino.
Porque, merc de Deus, o poder que eu tenho
de fazer poesia, quando ela insiste feito
gua no fundo da mina, levantando morrinho de areia.
quando clareia e refresca, abre sol, chove,
conforme necessidades.
s vezes d at de escurecer de repente
com trovoada e raio. No desaponta nunca.
feito sol.
Feito amor divino.
Considere as seguintes afirmaes sobre esse poema.
I - O curso de filosofia tentaria organizar/escovar o pensamento, mas a poeta reconhece que sua
capacidade de alcanar o universal limitada: ela capaz, sim, de entender uma cena de f
coletiva, com suas solicitaes prticas e emocionadas.
II - O uso do registro oral e popular (vira e mexe, escovar o pensamento, o mais universal que
eu chego) revela a perspectiva despretensiosa e informal da poeta, que contrasta com os
versos metrificados do poema, os quais mantm, em sua maioria, o mesmo nmero de slabas.
III- A capacidade de escrever poesia associa-se a fenmenos naturais, como gua caindo sobre
areia, variao de temperatura, sol e raio, dos quais derivam as dvidas sobre a existncia de
Deus enunciadas no poema.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.

19

UFRGS CV/2012 LIT

60

50. Leia o seguinte fragmento, do romance Cidade de Deus, de Paulo Lins, publicado em 1997 e
considerado um dos precursores na abordagem da violncia das favelas cariocas a partir de dentro,
isto , por um autor que foi morador da periferia.
que arrisco a prosa mesmo com balas atravessando os fonemas. o verbo, aquele que maior
que o seu tamanho, que diz, faz e acontece. Aqui ele cambaleia baleado. Dito por bocas sem dentes
e olhares cariados, nos conchavos de becos, nas decises de morte. A areia move-se nos fundos dos
mares. A ausncia de sol escurece mesmo as matas. O lquido-morango do sorvete mela as mos. A
palavra nasce no pensamento, desprende-se dos lbios adquirindo alma nos ouvidos, e s vezes
essa magia sonora no salta boca porque engolida a seco. Massacrada no estmago com arroz e
feijo a quase palavra defecada ao invs de falada. Falha a fala. Fala a bala.
Sobre esse fragmento, considere as afirmaes que seguem.
I - A palavra sai de forma agressiva, defecada ao invs de falada, porque o narrador acaba
concordando com a ideia de que no vale a pena escrever literatura sobre a realidade urbana
perifrica.
II - O narrador usa linguagem figurada (como as balas atravessando os fonemas ou os olhares
cariados) para explicar que, mesmo vivendo em um lugar permeado de crimes e misria, se
arrisca a fazer literatura.
III- Ao mencionar que Fala a bala, o narrador d a entender que a violncia a linguagem que a
maioria dos moradores das favelas conhece.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.

20

UFRGS CV/2012 LIT

61

2013
LITERATURA DE LNGUA PORTUGUESA
26. Leia o poema abaixo, de Gregrio de Matos Guerra.
Retrato / Dona ngela
Anjo no nome, Anglica na cara
Isso ser flor, e Anjo juntamente:
Ser Anglica flor e Anjo florente
Em quem, seno em vs se uniformara?
Quem veria uma flor, que a no cortara
De verde p, de rama florescente?
E quem um Anjo vira to luzente,
Que por seu Deus o no idolatrara?
Se como Anjo sois dos meus altares,
Freis o meu custdio, e minha guarda,
Livrara eu de diablicos azares.
Mas vejo, que to bela, e to galharda
Posto que os anjos nunca do pesares
Sois Anjo, que me tenta, e no me guarda.
Disponvel em: <http://www.vestibular.ufrgs.br/cv2013/gregoriomatosguerra_seleta.doc>.
Acesso em: 10 set. 2012.

Considere as seguintes afirmaes sobre o poema.


I - O poeta explora o paralelo entre Anjo e Anglica e revela a condio perecvel e domstica da
flor, permitindo que se perceba a uniformizao pretendida pelo barroco, a qual estabelece
regras poticas rgidas.
II - A mulher Anjo Luzente, no poema, encarna tanto o anjo protetor que livra de diablicos
azares, quanto a criatura feminina tentadora que provoca a imaginao e a sensualidade.
III- A associao e o contraste da flor, que seria cortada do verde p, com o Anjo luzente a ser
idolatrado, indica o dilogo do poeta (vs) com o anjo enviado dos cus para proteger os altares
de sua esposa.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas I e II.
(D) Apenas I e III.
(E) I, II e III.

14

UFRGS CV/2013 LIT

62

27. As duas colunas, abaixo, apresentam versos de alguns poemas de Gregrio de Matos Guerra.
Associe adequadamente a coluna da direita da esquerda, indicando os tercetos que pertencem a
cada soneto, cujo quarteto inicial se encontra na coluna da esquerda.
1 - Pequei, Senhor, mas no porque hei pecado,
Da vossa piedade me despido,
Porque quanto mais tenho delinquido,
Vos tenho a perdoar mais empenhado.

( ) Eu sou, Senhor, a ovelha desgarrada


Cobrai-a, e no queirais, Pastor divino,
Perder na vossa ovelha a vossa glria.

2 - Nasce o Sol, e no dura mais que um dia,


Depois da Luz se segue a noite escura,
Em tristes sombras morre a formosura,
Em contnuas tristezas a alegria.

( ) Comea o mundo enfim pela ignorncia,


E tem qualquer dos bens por natureza
A firmeza somente na inconstncia.

3 - Triste Bahia! Oh quo dessemelhante


Ests, e estou do nosso antigo estado!
Pobre te vejo a ti, tu a mi empenhado,
Rica te vejo eu j, tu a mi abundante.

( ) Deste em dar tanto acar excelente


Pelas drogas inteis, que abelhuda
Simples aceitas do sagaz Brichote.

4 - Um soneto comeo em vosso gabo:


Contemos esta regra por primeira;
J l vo duas, e esta a terceira,
J este quartetinho est no cabo,

( ) N'esta vida um soneto j ditei;


Se d'esta agora escapo, nunca mais:
Louvado seja Deus, que o acabei.

A sequncia correta de preenchimento dos parnteses, de cima para baixo,


(A) 4 2 1 3.
(B) 3 2 1 4.
(C) 1 2 3 4.
(D) 1 4 2 3.
(E) 2 3 4 1.
28. Considere as seguintes afirmaes sobre Memrias de um sargento de milcias, de Manuel Antnio
de Almeida.
I - O romance, narrado em primeira pessoa, apresenta tipos humanos e costumes da cidade do Rio
de Janeiro e do mundo rural carioca, na poca do rei portugus D. Joo VI.
II - Leonardo, personagem principal do romance, relaciona-se com Vidinha, moa pobre e festeira,
embora se interesse tambm por Luisinha, uma jovem herdeira que se casa com outro
pretendente, mas que, depois de enviuvar, volta a encontrar Leonardo.
III- Vidigal a autoridade policial no Rio de Janeiro e comanda seus homens para que a ordem seja
mantida. Disso resulta o conflito com Leonardo, cujo comportamento, atitudes e aventuras
provocam desordem e confuso.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.
15

UFRGS CV/2013 LIT

63

29. Leia o trecho do poema A me do cativo, de


Castro Alves.
Me! no despertes est'alma que dorme,
Com o verbo sublime do Mrtir da Cruz!
O pobre que rola no abismo sem termo
Pra qu'h de sond-lo... Que morra sem luz.
No vs no futuro seu negro fadrio,
cega divina que cegas de amor?!
Ensina a teu filho - desonra, misrias,
A vida nos crimes - a morte na dor.
Que seja covarde... que marche encurvado...
Que de homem se torne sombrio reptil.
Nem core de pejo, nem trema de raiva
Se a face lhe cortam com o ltego vil.
Arranca-o do leito... seu corpo habitue-se
Ao frio das noites, aos raios do sol.
Na vida - s cabe-lhe a tanga rasgada!
Na morte - s cabe-lhe o roto lenol.
Ensina-o que morda... mas prfido oculte-se
Bem como a serpente por baixo da ch
Que impvido veja seus pais desonrados,
Que veja sorrindo mancharem-lhe a irm.
Ensina-lhe as dores de um fero trabalho...
Trabalho que pagam com ptrido po.
Depois que os amigos aoite no tronco...
Depois que adormea co'o sono de um co.
Criana - no trema dos transes de um mrtir!
Mancebo - no sonhe delrios de amor!
Marido - que a esposa conduza sorrindo
Ao leito devasso do prprio senhor! ...
So estes os cantos que deves na terra
Ao msero escravo somente ensinar.
Me que balanas a rede selvagem
Que ataste nos troncos do vasto palmar.
CASTRO ALVES. Poesia completa. Rio de Janeiro:
Nova Aguilar, 1997. v. 1, p. 265.

Considere as seguintes afirmaes sobre esse


trecho do poema.
I - O poema de Castro Alves marcado pela
denncia da escravido e pelo elogio ao
ndio, elementos tpicos do Romantismo
brasileiro.
II - O sujeito lrico dirige-se me,
aconselhando-a ironicamente a seguir as
regras da sociedade escravocrata.
III- A me apresentada como impotente diante
do destino do filho; por isso lhe resta apenas
lamentar sua ausncia e chorar sua morte.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

30. Assinale
a
alternativa
que
preenche
corretamente as lacunas do enunciado abaixo,
na ordem em que aparecem.
........ teria escrito ........ , romance no qual
aparece como personagem relevante; depois
de ........ e na condio de ........ , ele
percorre o Rio de Janeiro e presencia a
transio do Imprio Repblica.
(A) O Conselheiro Aires Esa e Jac uma
longa carreira no exterior diplomata
aposentado
(B) Bentinho Dom Casmurro se formar
em So Paulo promotor pblico
(C) O Conselheiro Aires Dom Casmurro se
formar em So Paulo diplomata
aposentado
(D) Bentinho Dom Casmurro uma longa
carreira no exterior promotor pblico
(E) O Conselheiro Aires Esa e Jac se
formar em So Paulo promotor pblico
31. Considere as seguintes afirmaes sobre Esa
e Jac, de Machado de Assis.
I - Os comentrios e as digresses do
narrador so marcados pela ironia e pelo
humor, tpicos da obra machadiana
madura, o que faz contraste e oposio
ao tratamento srio dispensado s
ambies polticas do casal Batista.
II - Os gmeos, Pedro e Paulo, estabelecem
os polos do romance, entre os quais
oscilar a jovem Flora, que cortejada
pelos dois irmos: o primeiro, a favor do
Imprio e conservador; o segundo,
republicano e inovador.
III- Pedro e Paulo tornam-se deputados e atuam
em partidos opostos. Antes da morte de
Flora, a filha do casal Batista, eles trocam
promessas de conciliao e acordo, as quais,
para desespero do Conselheiro Aires, so
logo rompidas.
Quais esto corretas?
(A) Apenas I.

Apenas I.
Apenas II.
Apenas III.
Apenas I e II.
I, II e III.

(B) Apenas II.


(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.

16

UFRGS CV/2013 LIT

64

32. Em Contos gauchescos, de Joo Simes Lopes


Neto, Blau Nunes dita os artigos de f do
gacho para que seu interlocutor os anote. No
captulo A guerra, de O Continente, da
trilogia O tempo e o vento, de Erico
Verissimo, tais mximas so recuperadas na
personagem Jos Fandango, mentor de
Licurgo Cambar.

Instruo: As questes 33 e 34 esto


relacionadas ao livro O guardador de
rebanhos, de Alberto Caeiro.
33. Leia o trecho abaixo de O guardador de

Tendo em vista essa relao entre as obras,


possvel afirmar que
(A) a valorizao do conhecimento emprico e
da tradio ocorre atravs de Blau Nunes
e de Jos Fandango, nas respectivas
obras.

rebanhos

(...)
Pensar no sentido ntimo das cousas
acrescentado, como pensar na sade
Ou levar um copo gua das fontes.
O nico sentido ntimo das cousas
elas no terem sentido ntimo nenhum.
No acredito em Deus porque nunca o vi.
Se ele quisesse que eu acreditasse nele,
Sem dvida que viria falar comigo
E entraria pela minha porta dentro
Dizendo-me, Aqui estou!

(B) a comparao do cavalo com a mulher,


como em Mulher, arma e cavalo do
andar, nada de emprestar, revela a viso
de mundo capitalista do gacho.

(Isto talvez ridculo aos ouvidos


De quem, por no saber o que olhar para as
cousas,
No compreende quem fala delas
Com o modo de falar que reparar para elas
ensina.)

(C) o desenvolvimento da cincia acabou por


comprovar alguns ensinamentos de Blau
Nunes, como Doma tu mesmo o teu
bagual: no enfrenes na lua nova, que
fica babo; no arrendes na minguante,
que te sai lerdo.

Mas se Deus as flores e as rvores


E os montes e o sol e o luar,
Ento acredito nele,
Ento acredito nele a toda a hora,
E a minha vida toda uma orao e uma missa,
E uma comunho com os olhos e pelos ouvidos.
(...)

(D) Blau Nunes e Jos Fandango se


conheceram como lanceiros na Guerra
dos Farrapos, em 1835.

Considere as seguintes afirmaes sobre o


trecho do poema.

(E) Blau Nunes e Jos Fandango encerram


suas vidas como fazendeiros bem
sucedidos.

I - O poema afirma a imanncia das coisas e


do mundo, daquilo que pode ser visto,
tocado, enfim, daquilo que apreendido
pelos sentidos do corpo, enquanto o
significado oculto das coisas renegado.
II - O poeta celebra um pacto materialista
com o mundo, o que o faz perceber as
leis cientficas em vigor na natureza,
embora aceite a dimenso eterna e
transcendente das flores e das rvores.
III- O poeta, embora afirme no acreditar em
Deus (porque nunca o vi), ao levantar a
hiptese de que Deus encontra-se em
fenmenos concretos (flores, rvores,
montes, etc.), admite que sua vida uma
orao e uma missa.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas I.
Apenas II.
Apenas I e III.
Apenas II e III.
I, II e III.
17

UFRGS CV/2013 LIT

65

34. Assinale a alternativa correta a respeito dos


poemas de Alberto Caeiro.
(A) Em vrios poemas, a busca da amada,
que uma alde ocupada com suas
tarefas, resulta em exaltao da natureza
e do prazer corporal.

35. Considere as afirmaes abaixo sobre o livro


Macunama o heri sem nenhum carter, de
Mario de Andrade.

(B) Em um clebre poema, o heternimo


Alberto Caeiro debate com o prprio autor
Fernando Pessoa, que defende a rebelio
dos sentidos contra os fatos da realidade.
(C) Na sua maioria, os poemas so rimados e
obedecem a um metro fixo, que se ope
s
pretenses
irracionalistas
e
supostamente livres do heternimo.
(D) Em vrios poemas, o heternimo Alberto
Caeiro polemiza com outros personagens,
que so descritos em seus detalhes fsicos
e psicolgicos.
(E) Em um clebre poema, surge a personagem
menino Jesus, que interage com o poeta e
se comporta como uma criana travessa,
viva e inteligente.

I - Macunama deixa a mata onde nasceu


para trabalhar com Venceslau Pietro
Pietra, de quem ganha como prmio a
pedra muiraquit, um amuleto mgico.
II - A Carta pras icamiabas, captulo IX do
livro, escrita durante a permanncia de
Macunama na cidade grande e tem por
objetivo pedir dinheiro (cacau), da o tom
formal e os artifcios retricos, que se
diferenciam do restante da narrativa.
III- Por c tudo so delcias e venturas,
porm nenhum gozo teremos e nenhum
descanso, enquanto no rehouvermos o
perdido talism. Neste trecho da Carta, o
autor remete ao poema Cano do Exlio,
de Gonalves Dias, num dilogo s
avessas, em que exalta a cidade, o c.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas I.
Apenas II.
Apenas I e III.
Apenas II e III.
I, II e III.

36. Associe adequadamente as informaes da coluna da esquerda, abaixo, ao respectivo romance,


indicado na coluna da direita.
1 - O protagonista sente-se humilhado por ser funcionrio
pblico mal-remunerado e por ser abandonado por
sua noiva, que engravida de outro pretendente.
2 - O protagonista evolui de uma conscincia ingnua
de boxeador farrista e cachaceiro para a de
militante disposto a promover uma greve entre os
estivadores do porto.
3 - Um vaqueiro e sua famlia tratam de sobreviver em
uma regio rida do Nordeste brasileiro, enquanto
o vaqueiro presta servios ao proprietrio de uma
fazenda de gado.
4 - Um funcionrio pblico endividado percorre as ruas
da cidade e, mediante vrios expedientes mais ou
menos lcitos, procura alcanar a soma que deve ao
leiteiro que abastece sua famlia.

( ) Vidas secas, de Graciliano Ramos.


( ) Os ratos, de Dyonlio Machado.
( ) Jubiab, de Jorge Amado.
( ) Angstia, de Graciliano Ramos.

A sequncia correta de preenchimento dos parnteses, de cima para baixo,


(A) 2 1 4 3.
(B) 3 2 1 4.
(C) 1 3 2 4.
(D) 4 3 1 2.
(E) 3 4 2 1.
18

UFRGS CV/2013 LIT

66

37. Assinale a alternativa que preenche corretamente as lacunas do enunciado abaixo, na ordem em
que aparecem.
No Romance de 30, no qual se destacaram, entre outros, Jorge Amado e ........ , as obras
apresentam, em geral, ........ e so narradas ........ .
(A) Guimares Rosa a tendncia digressiva e reflexiva do narrador
caipira.

em linguagem popular ou

(B) Erico Verissimo


caipira.

em linguagem popular ou

a tendncia digressiva e reflexiva do narrador

(C) Guimares Rosa o contexto econmico e social das personagens em linguagem popular ou
caipira.
(D) Guimares Rosa o contexto econmico e social das personagens em linguagem prxima do
padro culto.
(E) Erico Verissimo
padro culto.

o contexto econmico e social das personagens em linguagem prxima do

Instruo: As questes 38 e 39 esto


relacionadas ao texto Manuelzo e
Miguilim, de Guimares Rosa.

39. Assinale a alternativa correta a respeito dessa


obra de Guimares Rosa.

38. No bloco superior abaixo, esto listados cinco


nomes de personagens da obra de Guimares
Rosa; no inferior, descries de trs desses
personagens.

(A) O ponto de vista da criana mostra o


encantamento com o mundo adulto, que
entrevisto pelo leitor atravs do olhar
mope e infantil de Miguilim, que deseja
crescer depressa.

Associe adequadamente o bloco inferior ao


superior.

(B) Tio Terez e Nh Berno disputam o amor


de Nhanina, que decide se casar com o
primeiro.

1 - Bernardo Caz (Nh Berno)

(C) Dito, em uma brincadeira no meio do


mato, corta o p num caco de pote, fica
muito doente, mas sobrevive para
felicidade de todos que muito celebram
na noite de Natal.

2 - Liovaldo
3 - Dito
4 - Tio Terez
5 - Osmundo Cessim
( ) Pai do menino protagonista.
( ) Irmo mais novo do menino protagonista.
( ) Irmo mais velho do menino protagonista.
A sequncia correta de preenchimento dos
parnteses, de cima para baixo,

(D) Dito, ao aconselhar Miguilim a sempre


estar alegre por dentro, representa a
sabedoria inata, capaz de carregar uma
lio de vida.
(E) O leitor, atravs do olhar infantil, percebe
a harmonia entre os pais de Miguilim e o
grande amor do pai pela me.

(A) 1 5 3.
(B) 2 3 4.
(C) 1 3 2.
(D) 4 5 1.
(E) 2 5 3.
19

UFRGS CV/2013 LIT

67

40. Considere as seguintes afirmaes sobre


algumas peas do teatro brasileiro.
I - Em Vestido de Noiva, de Nelson
Rodrigues, so explorados trs planos: o
da realidade, dando conta do presente
em que ocorre a pea; o plano da
memria, em que se apresentam namoro
e casamento de Alade; e o plano do
delrio/fantasia, em que os desejos e
alucinaes so encenados e enunciados.
II - Em Auto da Compadecida, de Ariano
Suassuna, Joo Grilo e Chic so dois
peregrinos pobres que tentam sobreviver,
mediante arranjos e mentiras, enquanto
viajam pelo serto do Nordeste brasileiro
rumo a uma cidade grande, trajetria que
interrompida pelo aparecimento de um
bando de cangaceiros.
III- Em Eles no usam black-tie, de
Gianfrancesco Guarnieri, uma famlia de
trabalhadores enfrenta as dificuldades da
pobreza e tenta se manter unida, quando
o chefe da famlia lidera uma greve de
estivadores no cais do porto, o que
deflagra um processo de negociao em
que a filha do patro tenta seduzir um
lder grevista.

41. Considere as seguintes afirmaes a respeito da


pea O pagador de promessas, de Dias Gomes.
I - Apresenta
estrutura
de
tragdia,
principalmente marcada pelo heri, Z do
Burro.
II - Os componentes da roda de capoeira
associam-se polcia e a Bonito contra
Z do Burro.
III- Mostra a importncia da mdia como
elemento
central
na
sociedade
representada na pea.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.
Instruo: As questes 42 e 43 esto
relacionadas ao livro A educao pela
pedra, de Joo Cabral de Melo Neto.
42. Assinale com V (verdadeiro) ou F (falso) as
seguintes afirmaes.
( ) A estrutura do livro, dividido em 4 partes,
com 12 poemas cada, revela a noo de
construo e de planejamento que o
poeta imprime em sua obra.

Quais afirmaes esto corretas?


(A) Apenas I.

( ) A parte Nordeste (a) abre com a dupla


imagem do mar e do canavial,
tipicamente nordestina.

(B) Apenas II.


(C) Apenas I e III.
(D) Apenas II e III.

( ) A parte No-Nordeste (b) composta por


poemas que tratam do fazer potico,
tema caro ao poeta.

(E) I, II e III.

( ) As letras maisculas, nas partes finais de


Nordeste (A) e No-Nordeste (B), revelam
a preferncia do poeta por Sevilha, cidade
potica modelo.
A sequncia correta de preenchimento dos
parnteses, de cima para baixo,
(A) F V V F.
(B) F F F V.
(C) V F V V.
(D) F V F V.
(E) V V V F.
20

UFRGS CV/2013 LIT

68

43. Considere as seguintes afirmaes.


I - O poema A educao pela pedra serve
como chave de leitura por dar nome ao
livro, por ser o poema de abertura e por
referir a cidade de Recife.
II - O poema Catar feijo remete tcnica de
elaborao do poema, estabelecendo uma
metfora entre a tarefa de catar feijo e a
relao do poeta com as palavras.
III- O poema de fechamento Para a feira do livro
recupera o ambiente festivo deste tipo de
acontecimento literrio, descrevendo os
visitantes atentos e as barracas coloridas.
Quais esto corretas?

44. Assinale a alternativa correta a respeito do


romance O centauro no jardim, de Moacyr
Scliar.
(A) Guedali Tratskovsky conta a prpria
histria, numa narrativa em primeira
pessoa, em tom de memria.
(B) Guedali um tpico representante da religio
judaica, nascido num bairro judeu de classe
mdia, na capital do Rio Grande do Sul.
(C) O grande trauma de Guedali ter tido filhos
centauros, como ele e a esposa, Tita.
(D) A cirurgia para transformar as patas em
pernas resolve os problemas matrimoniais
de Guedali.
(E) A nica possibilidade de leitura do
romance atravs do realismo fantstico,
pois os centauros so seres mitolgicos.

(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e II.
(E) I, II e III.

45. Assinale a alternativa correta sobre os contos Agruras de um jovem escritor e Intestino grosso, do
livro Feliz Ano Novo, de Rubem Fonseca.
(A) Em Agruras..., o protagonista sofre de uma srie de manias que so agravadas pelo uso de
lcool e drogas, o que prejudica seu desempenho intelectual, a ponto de o jovem escritor vir a
ser internado.
(B) Em Intestino grosso, o Autor dispe-se a conceder a entrevista, desde que seja remunerado por
palavra; depois de alcanado o acordo, o Autor fala torrencialmente sobre o prazer de escrever
e o respeito ao pblico.
(C) Em Agruras..., o protagonista mantm um relacionamento com Lgia, a namorada que procura
disciplinar o desregrado jovem escritor, alm de se propor a datilografar o que ele dita.
(D) Em Intestino grosso, o Autor concede uma entrevista em que declara escrever livros em trs
lnguas e protesta contra a violncia policial e contra o excesso de pornografia na televiso.
(E) Em Agruras..., o protagonista leva Lgia, sua dedicada namorada, a uma crise de cime em que
ela atira em uma rival intelectualizada, para depois arrepender-se e lev-la ao hospital.

21

UFRGS CV/2013 LIT

69

46. Com base nos contos de Feliz Ano Novo, de Rubem Fonseca, associe adequadamente cada uma das
informaes da coluna da esquerda, abaixo, ao respectivo ttulo do conto, citado na coluna da
direita.
( ) Um ex-presidirio em busca de emprego
consegue tornar-se segurana de boate.

1 - Abril, no Rio, em 1970


2 - Botando pra quebrar

( ) Um rico executivo sai de casa com seu potente


carro para atropelar pedestres inocentes.

3 - Passeio noturno

( ) Um ex-reprter de polcia assume a tarefa de


responder s cartas enviadas a um jornal
dedicado ao pblico feminino.

5 - Coraes solitrios

4 - Feliz Ano Novo

( ) Um jovem jogador de futebol amador alimenta a


esperana de se tornar jogador profissional.
A sequncia correta de preenchimento dos parnteses, de cima para baixo,
(A) 2 3 1 4.
(B) 1 4 2 3.
(C) 2 3 5 1.
(D) 1 3 5 2.
(E) 5 4 2 1.
47. Leia o trecho abaixo, retirado do conto Os sobreviventes, do livro Morangos mofados, de Caio
Fernando Abreu.
[...] que acontea alguma coisa bem bonita para voc, te desejo uma f enorme, em qualquer coisa,
no importa o qu, como aquela f que a gente teve um dia, me deseja tambm uma coisa bem
bonita, uma coisa qualquer maravilhosa, que me faa acreditar em tudo de novo, que nos faa
acreditar em todos de novo, que leve para longe da minha boca esse gosto podre de fracasso, que
derrota sem nobreza, no tem jeito, companheiro, nos perdemos no meio da estrada e nunca
tivemos mapa algum, ningum d mais carona e a noite j vem chegando.
ABREU, Caio Fernando. Morangos mofados. So Paulo: Crculo do Livro, sd. p. 20.

Considere as seguintes afirmaes sobre o trecho.


I - O fragmento aponta caractersticas marcantes da prosa de Caio Fernando Abreu: perspectiva
intimista, tom confessional e coloquial.
II - O trecho refere-se ao conflito de geraes e prope como soluo a viagem e o exlio.
III- Os sobreviventes do ttulo so aqueles que saem de um casamento fracassado, mas que no
cansam de lutar pela retomada da relao.
Quais esto corretas?
(A) Apenas I.
(B) Apenas III.
(C) Apenas I e II.
(D) Apenas II e III.
(E) I, II e III.
22

UFRGS CV/2013 LIT

70

Instruo: As questes 48 e 49 dizem respeito


ao romance Histria do cerco de
Lisboa, de Jos Saramago.
48. Considere as seguintes afirmaes.
I - Maria Sara apaixona-se imediatamente
por Raimundo Silva, ao ouvi-lo relatar a
batalha ocorrida durante o cerco a Lisboa.
II - O soldado Mogueime representa as
camadas populares, por isso sua fora
moral ressaltada no romance.
III- A narrativa evidencia a valentia dos
comandantes em batalha, o que explica o
orgulho da nao portuguesa pela vitria.
Quais esto corretas?

50. Assinale com V (verdadeiro) ou F (falso) as


seguintes afirmaes sobre o romance O filho
eterno, de Cristvo Tezza.
( ) O romance conta a trajetria do pai de
um menino com Sndrome de Down, em
sua busca para aceitar e amar o filho
deficiente.
( ) Diferentemente do que o pai escritor
sempre planejara, o futebol, no a
literatura, acaba por ser o elo entre pai e
filho, ajudando, inclusive, Felipe a se
alfabetizar.
( ) A maior frustrao do pai reside no fato
de Felipe ser filho nico, e sua esposa
no poder mais engravidar.
( ) O pai, frequentemente, envergonha-se
porque Felipe no consegue manter uma
conversa coerente com as pessoas e no
tem noo da passagem do tempo.

(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas II e III.

A sequncia correta de preenchimento dos


parnteses, de cima para baixo,

(E) I, II e III.

(A) F V V F.
(B) F V F V.

49. Assinale com V (verdadeiro) ou F (falso) as


seguintes afirmaes.

(C) V F V F.

( ) Raimundo Silva, revisor profissional,


responsvel pela reviso do livro Histria
do cerco de Lisboa, infringe o cdigo tico
de edio e altera a afirmao do autor.

(E) V F F V.

(D) V V F V.

( ) Raimundo Silva considera o computador


um aliado da tarefa do revisor,
principalmente pelo sinal de deleatur.
( ) Raimundo Silva conhece Maria Sara,
autora do livro Histria do cerco de
Lisboa, e eles comeam a namorar.
( ) Raimundo Silva presta homenagem a
vrios escritores renomados que tambm
trabalharam como revisores, como Balzac,
Ea de Queirs, Cames e Dante.
(A) F V F V.
(B) V V V F.
(C) V F V V.
(D) V V F F.
(E) F F F V.
23

UFRGS CV/2013 LIT

71

2014
LITERATURA DE LNGUA PORTUGUESA
26. Leia o trecho do Sermo pelo bom sucesso das armas de Portugal contra as de Holanda , do Padre
Antnio Vieira, e o soneto de Gregrio de Matos Guerra a seguir.
Sermo pelo bom sucesso das armas de
Portugal contra as de Holanda
Pede razo J a Deus, e tem muita razo de a
pedir responde por ele o mesmo santo que
o arguiu porque se condio de Deus usar
de misericrdia, e grande e no vulgar a
glria que adquire em perdoar pecados, que
razo tem, ou pode dar bastante, de os no
perdoar? O mesmo J tinha j declarado a
fora deste seu argumento nas palavras
antecedentes, com energia para Deus muito
forte: Peccavi, quid faciam tibi? Como se
dissera: Se eu fiz, Senhor, como homem em
pecar, que razo tendes vs para no fazer
como Deus em me perdoar? Ainda disse e
quis dizer mais: Peccavi, quid faciam tibi?
Pequei, que mais vos posso fazer? E que
fizestes vs, J, a Deus em pecar? No lhe fiz
pouco, porque lhe dei ocasio a me perdoar,
e, perdoando-me, ganhar muita glria. Eu
dever-lhe-ei a ele, como a causa, a graa que
me fizer, e ele dever-me- a mim, como a
ocasio, a glria que alcanar.

A Jesus Cristo Nosso Senhor


Pequei, Senhor, mas no porque hei pecado,
Da vossa piedade me despido;
Porque, quanto mais tenho delinquido,
Vos tenho a perdoar mais empenhado.
Se basta a vos irar tanto um pecado,
A abrandar-vos sobeja um s gemido:
Que a mesma culpa, que vos h ofendido,
Vos tem para o perdo lisonjeado.
Se uma ovelha perdida e j cobrada
Glria tal e prazer to repentino
Vos deu, como afirmais na sacra histria,
Eu sou, Senhor, a ovelha desgarrada:
Cobrai-a, e no queirais, pastor divino,
Perder na vossa ovelha a vossa glria.

Considere as seguintes afirmaes sobre os dois textos.


I - Tanto Padre Vieira quanto Gregrio de Matos dirigem-se a Deus mediante a segunda pessoa do
plural (vs, vos): Gregrio argumenta que o Senhor est empenhado em perdo-lo, enquanto
Vieira dirige-se a Deus (E que fizestes vs...) para impedir que J seja perdoado.
II - Padre Vieira vale-se das palavras e do exemplo de J, figura do Velho Testamento, para
argumentar que o homem abusa da misericrdia divina ao pecar, e que Deus, de acordo com a
ocasio e os argumentos fornecidos por J, inclina-se para o castigo no lugar do perdo.
III- Tanto Padre Vieira como Gregrio de Matos argumentam sobre a misericrdia e a glria divinas:
assim como J, citado por Vieira, declara que Deus lhe dever a glria por t-lo perdoado;
Gregrio compara-se ovelha desgarrada que, se no for recuperada, pode pr a perder a
glria de Deus.
Quais esto corretas?
(A) Apenas I.
(B) Apenas III.
(C) Apenas I e II.
(D) Apenas II e III.
(E) I, II e III.

UFRGS CV/2014 LIT

12

72

27. Assinale a alternativa correta a respeito dos


textos.

29. Considere as seguintes afirmaes sobre o


romance Memrias de um Sargento de
Milcias, de Manuel Antnio de Almeida.

(A) Os autores, ao remeterem aos exemplos


bblicos de J e da ovelha perdida,
elogiam a autoridade divina capaz de
perdoar os pecados, mesmo que custa
de sua glria e de seu discernimento.

I - O romance est integrado esttica


romntica: o protagonista, Leonardo,
um heri nacional virtuoso e sem desvios
de carter.

(B) J, de acordo com Vieira, argumenta que


h tanta glria em perdoar como em no
perdoar, enquanto, para Gregrio, o
perdo concedido ao pecador renitente
a prova da glria de Deus.
(C) Os autores, ao remeterem aos exemplos
bblicos de J e da ovelha perdida, inibem
a autoridade divina que se v
constrangida a aceitar os argumentos de
dois pecadores.
(D) J, de acordo com Vieira, considera que a
ocasio e a sorte impediram que a graa
divina se manifestasse, enquanto para
Gregrio a graa divina no sofre
restries.
(E) Os autores, ao remeterem aos exemplos
bblicos de J e da ovelha perdida,
reforam seus argumentos a favor do
perdo como garantia da glria divina.

28. Assinale
a
alternativa
que
preenche
corretamente as lacunas do enunciado abaixo,
na ordem em que aparecem.
O projeto literrio de ........ consistia em
radiografar o Brasil em sua totalidade.
Assim, narrou o passado indgena, em ........,
a sociedade burguesa fluminense do sculo
XIX, em ........, e o mundo rural em ........ .
(A) Jos de Alencar A Moreninha Til

Iracema

(B) Joaquim Manuel de Macedo Iracema


Senhora A Moreninha
(C) Joaquim Manuel de Macedo Iracema
A Moreninha Til

II - O livro narrado em primeira pessoa por


Leonardo: trata-se de suas memrias
desde o abandono da terra natal Lisboa
at a nomeao como Sargento de
Milcias no Rio de Janeiro.
III- Personagens como o compadre, a
comadre e a vizinha so representantes
da classe popular a base constitutiva do
romance que, alm do mais, est
escrito em tom humorstico.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas II e III.
(E) I, II e III.
30. No bloco superior abaixo, esto listados dois
nomes de personagens da obra O cortio, de
Alusio Azevedo; no inferior, descries dessas
personagens.
Associe adequadamente o bloco inferior ao
superior.
1 Pombinha
2 Rita Baiana
( ) loura, plida, com modos de menina de
boa famlia.
( ) Casa-se, a fim de ascender socialmente.
( ) Possui farto cabelo, crespo e reluzente.
( ) Mantm personalidade
longo do romance.

A sequncia correta de preenchimento dos


parnteses, de cima para baixo,
(A) 2 1 1 2 1.
(B) 1 2 2 1 2.

(E) Jos de Alencar Iracema Senhora Til

(D) 1 1 2 2 1.

UFRGS CV/2014 LIT

ao

( ) Descobre, a certa altura do romance, sua


plenitude na prostituio.

(D) Jos de Alencar Til A Moreninha

Senhora

inalterada

(C) 1 1 2 1 2.
(E) 2 2 1 2 1.

13
2

73

31. A obra Os Sertes, de Euclides da Cunha, est


dividida em trs partes: A terra, O homem e A
luta. Esses trs elementos, no entanto, so
interdependentes: a luta do homem em
determinada terra.
Assinale a alternativa que exemplifica essa
interdependncia entre as trs partes do livro,
nos fragmentos abaixo.
(A) Ajusta-se sobre os sertes o cautrio das
secas; esterilizam-se os ares urentes;
empedra-se o cho, gretando, recrestado;
ruge o nordeste nos ermos; e, como
cilcio dilacerador, a caatinga estende
sobre a terra as ramagens de espinhos....
(B) que nessa concorrncia admirvel dos
povos, evolvendo todos em luta sem
trguas, na qual a seleo capitaliza
atributos que a hereditariedade conserva,
o mestio um intruso.
(C) Para todos os rumos e por todas as
estradas e em todos os lugares, os
escombros carbonizados das fazendas e
dos pousos, avultavam, insulando o
arraial num grande crculo isolador, de
runas. Estava pronto o cenrio para um
emocionante drama da nossa histria.
(D) (...) as caatingas so um aliado
incorruptvel do sertanejo em revolta.
Entram tambm de certo modo na luta.
Armam-se para o combate; agridem.
Tranam-se, impenetrveis, ante o
forasteiro, mas abrem-se em trilhas
multvias, para o matuto que ali nasceu e
cresceu.

32. Considere as seguintes afirmaes sobre Esa


e Jac, de Machado de Assis.
I - Pedro e Paulo, os filhos gmeos do casal
Santos, odeiam-se desde o ventre
materno, fato insinuado pela cabocla do
morro do Castelo e percebido por sua
me, Natividade, o que caracteriza uma
disposio hereditria que alinha o
romance com a tendncia naturalista e
determinista da poca.
II - Os longos trechos digressivos da narrativa
esto em sintonia com as intervenes do
Conselheiro Aires e marcados por
comentrios repletos de ironia, erudio e
humor; comentrios que podem incidir
inclusive sobre as expectativas do pblico
leitor, como fica claro no captulo XXVII,
De uma reflexo intempestiva.
III- O Conselheiro Aires mantm uma relao
polida com o banqueiro Santos, a quem
considera intelectualmente limitado e
moralmente condenvel, embora Aires
reconhea sua dedicao famlia, que o
leva a tentar amenizar a hostilidade entre
os filhos e a auxiliar com estmulos
financeiros os parentes pobres.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas I e II.
(D) Apenas II e III.
(E) I, II e III.

(E) O clima extremava-se em variaes


enormes: os dias repontavam queimosos,
as noites sobrevinham frigidssimas.

UFRGS CV/2014 LIT

14

74

33. Considere o seguinte trecho de Esa e Jac.


........ no tinha as mesmas expanses. Era
alto, e o ar sossegado dava um bom aspecto
de governo. S lhe faltava ao, mas a mulher
podia inspirar-lhe; nunca deixou de consult-la
nas crises da presidncia. Agora mesmo, se lhe
desse ouvidos j teria ido pedir alguma coisa
ao governo, mas neste ponto era firme, de
uma firmeza que nascia da fraqueza: Ho de
chamar-me, deixa estar, dizia ele a ........,
quando aparecia alguma vaga de governo
provincial. Certo que ele sentia a necessidade
de tornar vida ativa. Nele a Poltica era
menos uma opinio que uma sarna; precisava
coar-se a mido e com fora.
Assinale a alternativa que preenche correta e
respectivamente as lacunas do texto acima.
(A) Gouveia D. Rita
(B) Nbrega D. Rita
(C) Batista

D. Rita

(D) Nbrega D. Cludia


(E) Batista

D. Cludia

34. Considere as seguintes afirmaes sobre Contos


Gauchescos, de Simes Lopes Neto, e Grande
Serto: Veredas, de Joo Guimares Rosa.
I - Ambos dedicam-se principalmente
narrativa rural, embora alguns dos Contos
gauchescos sejam ambientados na
cidade.

35. A temtica gauchesca no exclusividade de


autores rio-grandenses. Na literatura da
Argentina e do Uruguai, pases com formao
histrica e social semelhante do Rio Grande
do Sul, essa temtica tambm est presente.
Leia o seguinte trecho do livro Martn Fierro,
de Jos Hernndez, um clssico da literatura
argentina.
E a chegam as desgraas,
A comea a perdio,
Porque j no h salvao;
Tu querendo ou no querendo
Para a fronteira sofrendo
Vais servir num batalho.
A empearam meus males,
Que foram males de tantos;
Se gostaram, em outros cantos
Direi tudo que sofri;
Se algum perde o que perdi
Nem com a ajuda dos santos!
Observando a relao entre esse trecho e os
Contos gauchescos de Simes Lopes Neto,
assinale
a
alternativa
que
preenche
corretamente as lacunas do enunciado abaixo,
na ordem em que aparecem.
Martn Fierro, o eu do poema, considera
servir num batalho, ou seja, participar da
guerra uma ........ . Nos Contos gauchescos,
Blau Nunes apresenta viso ........ sobre a
guerra, j que sente ........ de seu passado
militar.

II - Os narradores de ambos so homens que,


a certa altura da vida, contam suas
memrias a um interlocutor externo ao
mundo em que vivem.

(A) salvao

semelhante orgulho

(B) desgraa

semelhante orgulho

(C) desgraa

diversa

orgulho

III- Em ambos os livros, est registrada a fala


regional rural dos personagens, em
contraste com a linguagem culta dos
narradores.

(D) salvao

diversa

vergonha

(E) desgraa

diversa

vergonha

Quais esto corretas?


(A) Apenas II.
(B) Apenas I e II.
(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.
UFRGS CV/2014 LIT

15
2

75

36. Com base nos Contos Gauchescos, de Simes Lopes Neto, assinale a alternativa que associa
corretamente a descrio da personagem feminina com o seu nome e com o conto em que aparece.

(A)

(B)

(C)

(D)

(E)

Descrio da personagem feminina


Se era linda a beldade!... Sim, senhor, dum gacho de
gosto alar na garupa e depois jurar que era Deus na
terra!... E destorcida, e bem-falante, e olhava pra gente,
como o sol olha pra gua: atravessando!
(...) a china vinha calada, mas com a cabea deitada no
peito do par, olhando terneira pra ele, com uma luz de riso,
os beios encolhidos, como armando uma promessa de
boquinha (...).
Alta e delgada parecia assim um jeriv ainda novinho,
quando balanava a copa verde tocada de leve por um
vento pouco, da tarde. Tinha os ps pequenos e as mos
mui bem torneadas; cabelo cacheado, as sobrancelhas
finas, nariz alinhado. Mas o rebenqueador, o
rebenqueador..., eram os olhos!...
L estava a senhora, com a cabea arrebentada a olho de
machado... O fogo apagado, a banha coalhada, os beijus
frios... e mui a seu gosto, de papo para o ar, dormindo na
saia da morta, uma gata brasina e a sua ninhada.
(...) e enquanto se fazia uma paradita no barulho, a noiva
se punha em p como uma mola, e com uma mo grudada
no brao da ama j no chorava, tinha um coloreado no
rosto e os olhos luziam como duas estrelas pretas!...
Lindaa ficou, como uma Nossa Senhora!

Nome
Rivera

Conto

Duelo de farrapos

Lalica

Melancia Coco
Verde

Tudinha

Negro Bonifcio

Maria Altina

Jogo do osso

sia Talapa

Penar de velhos

37. Considere as seguintes afirmaes sobre os poemas de Alberto Caeiro, heternimo de Fernando
Pessoa.
I - No poema em que v Jesus (Num meio-dia de fim de primavera/ tive um sonho como uma
fotografia./ Vi Jesus Cristo descer terra.), o eu-lrico sada Jesus na condio de menino
travesso, mas obediente, que cuida das cabras do rebanho e convive carinhosamente com a
Virgem Maria.
II - No poema cujos primeiros versos so O meu olhar azul como o cu/ calmo como a gua ao
sol./ assim, azul e calmo,/ Porque no interroga nem se espanta..., a expresso direta, muito
ritmada mas sem rimas nem mtrica fixa, est a servio da enunciao da natureza imanente e
das sensaes tambm diretas que ela desperta no poeta.
III- No poema cujos primeiros versos so O Tejo mais belo que o rio que corre pela minha aldeia/
Mas o Tejo no mais belo que o rio que corre pela minha aldeia, o poeta estabelece o contraste
entre a fama e a histria do rio Tejo e a irrelevncia do rio provinciano, que amado, no entanto,
por ter s suas margens a aldeia medieval habitada h geraes pela famlia de Caeiro.
Quais esto corretas?
(A) Apenas II.
(B) Apenas III.
(C) Apenas I e II.
(D) Apenas I e III.
(E) I, II e III.
UFRGS CV/2014 LIT

16

76

38. Leia o segmento abaixo.


Em Terras do Sem-Fim, Jorge Amado narra as
lutas que ocorreram ........ pelas terras da mata
do Sequeiro Grande, frtil regio prxima a
........: Horcio Silveira e seus seguidores
disputaram, ........, com o cl Badar.
Assinale a alternativa que preenche correta e
respectivamente as lacunas do segmento acima.
(A) Em meados do sculo XIX Salvador
pelas armas e pela influncia religiosa
(B) No incio do sculo XX Ilhus pela
fora e mediante ardis legais
(C) Em meados do sculo XIX Ilhus
pelas armas e pela influncia religiosa
(D) No incio do sculo XX Salvador pela
fora e mediante ardis legais
(E) No incio do sculo XX Ilhus pelas
armas e pela influncia religiosa
39. Considere as seguintes afirmaes sobre
Terras do Sem-Fim, de Jorge Amado.
I - O romance mobiliza uma vasta gama de
personagens e tipos sociais para
reconstruir a saga do desbravamento das
terras necessrias para a produo
capitalista do cacau: de coronis violentos
a prostitutas romnticas, de homens
pobres
ambiciosos
a
capangas
obedientes.
II - Sinh Badar, chefe do cl, trata de
consultar a bblia para justificar suas
atitudes, enquanto Juca no demonstra
respeitar qualquer cdigo tico para obter
o que deseja, a ponto de encomendar a
morte do advogado Doutor Virglio, para
mais facilmente conquistar Malvina.
III- O coronel Horcio da Silveira combate
ferozmente o cl Badar e conta com o
auxlio de Doutor Virglio, jovem
advogado sem ambies polticas que se
apaixona pela esposa do prprio coronel
Horcio, uma mulher culta que humilha
seu marido com citaes eruditas e
hbitos refinados.

40. Leia o poema abaixo, de Joo Cabral de Melo


Neto.
O sertanejo falando
A fala a nvel do sertanejo engana:
as palavras dele vm, como rebuadas
(palavras confeito, plula), na glace
de uma entonao lisa, de adocicada.
Enquanto que sob ela, dura e endurece
o caroo de pedra, a amndoa ptrea,
dessa rvore pedrenta (o sertanejo)
incapaz de no se expressar em pedra.
2
Da por que o sertanejo fala pouco:
as palavras de pedra ulceram a boca
e no idioma pedra se fala doloroso;
o natural desse idioma fala fora.
Da tambm por que ele fala devagar:
tem de pegar as palavras com cuidado,
confeit-las na lngua, rebu-las;
pois toma tempo todo esse trabalho.
Assinale com V (verdadeiro) ou F (falso) as
seguintes afirmaes sobre o poema.
( ) O eu-lrico do poema o prprio sertanejo
que reflete sobre sua forma de falar.
( ) A ideia dos quatro primeiros versos da
primeira estrofe retomada nos quatro
ltimos da segunda; neles descrita a
melodia aparentemente doce da fala do
sertanejo.
( ) Os quatro ltimos versos da primeira
estrofe esto relacionados aos quatro
primeiros da segunda; neles descrita a
essncia rude do falar sertanejo.
( ) O sertanejo falando ope-se aos demais
poemas de A educao pela pedra; nele
Joo Cabral de Melo Neto apresenta um
rigor formal, uma preocupao com a
estrutura do poema, ausente no restante
do livro.
A sequncia correta de preenchimento dos
parnteses, de cima para baixo,

Quais esto corretas?


(A) Apenas I.

(A) V V V F.

(B) Apenas III.

(B) F V F V.

(C) Apenas I e II.

(C) V F V V.

(D) Apenas II e III.

(D) F F F V.

(E) I, II e III.

(E) F V V F.

UFRGS CV/2014 LIT

17
2

77

Instruo: As questes 41 e 42 esto relacionadas ao poema Legado, de Carlos Drummond de


Andrade.
41. Leia o poema abaixo.
Que lembrana darei ao pas que me deu
tudo que lembro e sei, tudo quanto senti?
Na noite do sem-fim, breve o tempo esqueceu
minha incerta medalha, e a meu nome se ri.
E mereo esperar mais do que os outros, eu?
Tu no me enganas, mundo, e no te engano a ti.
Esses monstros atuais, no os cativa Orfeu,
a vagar, taciturno, entre o talvez e o se.
No deixarei de mim nenhum canto radioso,
uma voz matinal palpitando na bruma
e que arranque de algum seu mais secreto espinho.
De tudo quanto foi meu passo caprichoso
na vida, restar, pois o resto se esfuma,
uma pedra que havia em meio do caminho.
Considere as seguintes afirmaes sobre o poema.
I - No primeiro quarteto, o poeta pergunta pelo legado que deixar para o pas a que deve tudo o que
lhe caro; no segundo quarteto, h uma invocao um tanto irnica do mundo, no se trata mais
apenas do pas: h uma ampliao da referncia que atravessaria os limites geogrficos para lidar
com o mundo/realidade.
II - A forma soneto e a referncia a Orfeu, o mitolgico poeta grego capaz de encantar a todos com
o som da sua lira, revelam que o modernismo de Drummond agora se associa com o
parnasianismo, o que permite ao poeta reivindicar uma posio fixa na tradio, em contraste
com Orfeu, perplexo entre o talvez e o se.
III- No ltimo terceto, o poeta alega que, da sua trajetria um tanto instvel, restar uma pedra que
havia em meio do caminho, o que equivale a uma parfrase, agora em registro formal e srio,
dos versos do clebre poema do incio de sua carreira modernista: No meio do caminho tinha
uma pedra/ tinha uma pedra no meio do caminho (...).
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas II.
Apenas III.
Apenas I e II.
Apenas I e III.
I, II e III.

42. Assinale a alternativa correta sobre o poema.


(A) No primeiro quarteto, o poeta alimenta fortes dvidas sobre a permanncia de sua incerta fama
e/ou glria.
(B) No segundo quarteto, a pergunta do primeiro verso apresentada ao pblico e ao mundo, que
esqueceram a obra do poeta.
(C) No segundo quarteto, a declarao de que o mundo no pode enganar o poeta revela o quanto
os leitores esto atentos.
(D) No primeiro terceto, a ausncia de canto radioso e da voz revelam que a inspirao potica
esgotou-se faz tempo.
(E) No encerramento, o passo caprichoso do poeta pode revelar, apesar dos transtornos e da pedra,
uma paisagem que se esfuma.
UFRGS CV/2014 LIT

18

78

Instruo: As questes 43 e 44 referem-se pea


Boca de Ouro, de Nelson Rodrigues.
43. Considere as seguintes afirmaes sobre a
pea de Nelson Rodrigues.
I - Dona Guigui apresenta trs verses sobre os
atos e faanhas de Boca de Ouro ao longo
da pea, que mostra uma progresso: a
primeira acumula perverses e detrata o
protagonista; a segunda revela seu passado
sofrido e ambies frustradas; e a terceira, a
disposio do bicheiro para ingressar no
circuito burgus.
II - O casal Celeste e Leleco ocupa papel
central na caracterizao de Boca de
Ouro, eles formam um tringulo amoroso
perverso cujos termos se alteram ao
longo da pea: Celeste, por exemplo,
apresentada como esposa obrigada a se
entregar ao bicheiro; depois amante
amoral
e
exibicionista;
para,
na
sequncia, encarnar a mulher adltera
que esfaqueia o marido indefeso.
III- A pea explora a linguagem coloquial, a
geografia do Rio de Janeiro (Madureira,
mata da Tijuca) e a atividade ilcita do jogo
do bicho, para se definir o protagonista
como mito sobre o qual circulam vrios
boatos e verses que confluem para a
consagrao de Boca de Ouro nas quadras
de escolas de samba do carnaval carioca.
Quais esto corretas?

44. De acordo com o texto da pea, Dona Guigui


(A) revela fatos inditos para Caveirinha, que
tenta descobrir qual o nome das damas
da alta sociedade a se relacionarem com
Boca de Ouro.
(B) revela fatos inditos para Caveirinha,
reprter encarregado de pesquisar a vida
do bicheiro e suas relaes com polticos e
delegados de polcia.
(C) apresenta trs verses contraditrias que
revelam o despeito nutrido por quem foi
obrigada a sofrer um aborto depois de
abandonar a casa dos pais.
(D) a fonte de Caveirinha para o jornal o Sol
e revela que seu marido a obrigou a
seduzir Boca de Ouro e que este a
manteve em um bordel.
(E) a fonte de Caveirinha para o jornal O
Sol, foi amante de Boca de Ouro e
mantm relacionamento tenso com seu
marido Agenor.
Instruo: As questes 45 e 46 referem-se aos
contos de Murilo Rubio.
45. Considere as seguintes afirmaes sobre os
contos de Murilo Rubio.
I - Nos contos O pirotcnico Zacarias e O exmgico da Taberna Minhota, a narrativa est
em primeira pessoa. Os narradores relatam
acontecimentos fantsticos ou seja,
inexplicveis racionalmente com a maior
naturalidade: Zacarias um cadver falante
que descreve o atropelamento que resultou
na sua morte; o ex-mgico tenta suicidar-se,
mas boicotado pela prpria magia.

(C) Apenas I e II.

II - Nos contos Os drages e Teleco, o


coelhinho, os animais tm comportamentos
de seres humanos. Os drages bebem em
botequins, envolvem-se com mulheres e
assistem a aulas de um professor; Teleco
fala, fuma e barbeia-se.

(D) Apenas II e III.

III- Nos

(A) Apenas I.
(B) Apenas II.

contos Brbara e Oflia, meu


cachimbo e o mar, as personagens

(E) I, II e III.

femininas citadas nos ttulos so,


respectivamente, uma mulher que, aps
casar-se,
comea
a
emagrecer
assustadoramente e uma menina que s
se interessa por histrias de marinheiro.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas I e II.
(D) Apenas II e III.
(E) I, II e III.

UFRGS CV/2014 LIT

19
2

79

46. Assinale com V (verdadeiro) ou F (falso) as


seguintes afirmaes sobre os contos.

48. Considere as seguintes afirmaes sobre a


relao entre espaos e personagens no
romance.

( ) Todos apresentam uma epgrafe bblica


que est relacionada com as temticas
dos contos.

I - O Chal representa a famlia: continua de


p, mas foi se deteriorando com o tempo.

( ) Todos podem ser considerados como


fantsticos e no tm relao com a
realidade brasileira.
( ) Cariba, o protagonista do conto A cidade,
preso por ser a nica pessoa que faz
perguntas na cidade.
( ) O ttulo do conto O lodo pode ser
interpretado metaforicamente, j que a
forma como o psicanalista descreve o
inconsciente de Galateu.
A sequncia correta de preenchimento dos
parnteses, de cima para baixo,

II - O sto sugere refgio, que pode ser


fsico, como no caso de Catarina, ou
simblico, como no de Anelise.
III- A cozinha representa o aconchego para
uma tradicional famlia alem que muito
penou ao instalar-se no Brasil.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas I e II.
(D) Apenas II e III.
(E) I, II e III.

(A) F V V F.
(B) V F V V.

49. Assinale a alternativa correta sobre a obra O


centauro no jardim, de Moacyr Scliar.

(C) F F F V.
(D) F V F V.
(E) V V V F.
Instruo: As questes 47 e 48 referem-se ao
romance As parceiras, de Lya Luft.
47. A narradora do romance uma
(A) menina de quatorze anos que, obrigada a
casar-se com um homem que abomina,
narra suas frustraes em um dirio.
(B) pintora bem-sucedida profissionalmente
que, no entanto, convive com a decepo
de no ter o mesmo sucesso em sua vida
amorosa.
(C) jovem an que denuncia o preconceito
das demais mulheres da famlia em um
dirio.
(D) mulher na faixa dos quarenta anos que,
aps sucessivos abortos e a separao do
marido, regressa ao antigo Chal da
famlia para tentar compreender seus
fracassos em contraponto sina das
mulheres que a cercam.
(E) mulher na faixa dos sessenta anos que
perde o marido logo aps o casamento e
narra suas desiluses de viva-virgem.

(A) O casal Guedali e Tita padece da mesma


condio, so centauros, que se
submeteram a cirurgias para eliminar as
patas traseiras, o que lhes permite levar
uma vida mais ou menos normal de
classe-mdia confortvel.
(B) Os pais de Guedali eram judeus provindos
da Rssia que se estabeleceram na zona
rural do Rio Grande do Sul, onde se
dedicaram ao comrcio varejista e
plantao de soja antes de se mudarem
para Porto Alegre.
(C) O mdico que operou Guedali era um
cirurgio
plstico
estabelecido
no
Marrocos onde mantm uma clnica
mundialmente famosa e frequentada por
membros da burguesia cosmopolita e por
portadores de deformidades.
(D) Guedali e Tita conhecem, em So Paulo,
um grupo de amigos empresrios, boa
parte de origem judaica que, alm de
frequentarem a mesma sinagoga e o
mesmo clube, tratam de planejar uma
viagem Europa e aos EUA.
(E) Guedali, ainda na condio de centauro,
ao fugir para o interior do Rio Grande do
Sul e juntar-se a um circo, dedicou-se s
aventuras
sexuais
com
moas
desavisadas e ao aperfeioamento de
suas piruetas e galopes no picadeiro.
UFRGS CV/2014 LIT

20

80

50. No bloco superior, esto listados dois perodos


de tempo presentes no romance Histria do
cerco de Lisboa, de Jos Saramago; no
inferior, episdios do romance.
Associe adequadamente o bloco inferior ao
superior.
1 Sculo XX: o presente
2 Sculo XII: o passado
( ) Histria de amor entre Raimundo e Maria
Sara.
( ) Histria de amor entre Mogueime e
Ouroana.
( ) Trabalho de reviso de textos.
( ) Confronto entre portugueses e mouros.
( ) Escrita de um livro sobre a histria
portuguesa.
A sequncia correta de preenchimento dos
parnteses, de cima para baixo,
(A) 2 1 1 1 2.
(B) 2 2 1 2 1.
(C) 1 1 2 1 2.
(D) 1 2 1 2 1.
(E) 1 2 2 2 1.

UFRGS CV/2014 LIT

21
2

81

2011
ESPANHOL
Instruo: As questes 51 a 58 esto relacionadas ao texto abaixo.
ESTO DE LA GLOBALIZACIN SIRVE PARA QUE
COMPRENDAMOS QUE LAS GENTES DE OTRAS
RAZAS Y OTRAS CULTURAS SE ENAMORAN DE
LA MISMA MANERA QUE NOSOTROS.

Y, COMO NOSOTROS, HACEN EL AMOR. Y DE


ESE AMOR NACEN HIJOS A LOS QUE CUIDAN
Y QUIEREN, COMO NOSOTROS.

1
Y TAMBIN NECESITAN MSICA PARA EXPRESARSE,
BAILAR Y DIVERTIRSE, COMO NOSOTROS.

Y LLORAN SUS PENAS CON LGRIMAS COMO


LAS NUESTRAS Y REN SUS ALEGRAS A
CARCAJADAS, COMO NOSOTROS.

HASTA ALQUILAN LAS MISMAS PELCULAS QUE


VEMOS NOSOTROS Y COMEN IGUAL FAST-FOOD
CON LAS MISMAS GASEOSAS QUE BEBEMOS AQU.

QU NOS DEMUESTRA TODO ESTO? QUE


ELLOS, APARENTEMENTE TAN DISTINTOS,
SON COMO NOSOTROS!

6
SE DICE FCIL SON COMO NOSOTROS!
CUNTO TIEMPO NOS LLEVAR EMPEZAR
A DECIRNOS SOMOS COMO ELLOS?

Disponvel em: <http://www.detrasdelespejo.es/wp-content/uploads/2008/12/


son-como-nosotros-quino.jpg>. Acesso em: 10 out. 2010.

51. De acordo com o texto,

52. Assinale a alternativa em que o verbo


apresentado entre parnteses est no mesmo
modo e tempo que o verbo sublinhado no
respectivo segmento.

(A) aos homens falta ver-se como os outros.


(B) os homens sempre acreditam que sua
raa melhor que a do vizinho.
(C) os outros povos so muito diferentes do
nosso.

(A) [...] sirve para que comprendamos [...]


(q. 1). (supimos)
(B) [...] hacen el amor (q. 2). (busquen)

(D) a globalizao tem rompido fronteiras.

(C) Y tambin necesitan msica (q. 3).


(componen)

(E) os hbitos das diferentes culturas so


sempre especiais.

(D) Cunto tiempo nos llevar [...]?


(q. 8). (exigiera)
(E) [...] empezar a decirnos [...] (q. 8).
(reconocemos)

UFRGS CV/2011 - ESP

23

82

53. Assinale a alternativa que apresenta duas


palavras acentuadas por duas diferentes
regras de acentuao.
(A) globalizacin (q. 1) aqu (q. 5)

56. Considere as seguintes afirmaes sobre o


sentido de palavras no texto.
I - A palavra penas (q. 4) poderia ser
substituda, sem alterao do sentido
contextual, por pesadumbres.
II - A palavra carcajadas (q. 4) tem, no
texto, o mesmo sentido que muecas.

(B) msica (q. 3) lgrimas (q. 4)


(C) tambin (q. 3) llevar (q. 8)
(D) ren (q. 4) alegras (q. 4)

III- A palavra gaseosas (q. 5), no contexto


em que se encontra, significa refrescos.

(E) fcil (q. 8) cunto (q. 8)

Quais esto corretas?


(A) Apenas I.

54. Assinale a alternativa que apresenta, no texto,


uma palavra invarivel.

(B) Apenas II.


(C) Apenas III.

(A) otras (q. 1)

(D) Apenas I e III.

(B) misma (q. 1)

(E) I, II e III.

(C) ese (q. 2)

57. A palavra Hasta (q. 5)


substituda, sem alterao
contextual, por

(D) sus (q. 4)


(E) esto (q. 6)

poderia ser
do sentido

(A) Incluso.
55. A frase Y tambin necesitan msica para

expresarse, bailar y divertirse,


nosotros (q. 3) significa que

como

(B) Sobre todo.


(C) Adems.
(D) Hacia.

(A) os outros povos se divertem da mesma


maneira que ns.
(B) os povos, por mais diferentes que sejam,
na essncia so iguais em tudo.

(E) Sin embargo.


58. Considere o enunciado abaixo e as trs
propostas para complet-lo.

(C) novas formas podem ser usadas para


transmitir ou demonstrar felicidade.

A palavra distintos (q. 6) tem no texto o


mesmo significado que a palavra sublinhada
na frase

(D) todos os povos comungam das mesmas


crenas.

1 - Fue una conversacin tan distendida.

(E) as semelhanas entre as raas foram


erradicadas pela globalizao.

2 - Nos ofrecieron diferentes posibilidades.


3 - Es tan caballero, es tan distinguido.
Quais propostas esto corretas?
(A) Apenas 1.
(B) Apenas 2.
(C) Apenas 3.
(D) Apenas 1 e 2.
(E) Apenas 2 e 3.

24

UFRGS CV/2011 ESP

83

Instruo: As questes 59 a 67
relacionadas ao texto abaixo.
01.
02.
03.
04.
05.
06.
07.
08.
09.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.

esto

Todo usuario de Internet ya se ha


comunicado alguna vez con un desconocido
suministrando informacin real, uno de los
errores sobre los que ms alertan las
empresas de tecnologa. Un 66% de los
usuarios ya ha hablado por chat con un
extrao. ........ 59% sinti que se le peda
informacin personal innecesariamente. Esto
permite pensar que la gente no maneja su
vida virtual con el cuidado con que maneja su
vida cotidiana. La ausencia de privacidad en la
web ha crecido mucho. Puede poner en
peligro al usuario y a su familia.
........ la utilizacin de estos sitios, un 73%
de los usuarios slo muestran las
informaciones a sus amigos. La adhesin
masiva a Facebook no es normal, y ah no
slo puede haber alguien que no sea amigo,
sino que adems pretenda delinquir.
Las informaciones que divulgan las
actividades que se van a hacer o se estn
haciendo dan lugar a delitos a los que suelen
estar muy expuestos los menores. Un
delincuente se vale de un anuncio efectuado por
el usuario para intentar convencer a los padres
de que hubo un accidente o un secuestro.
Existen nios que tienen un Facebook y
que estn expuestos al delito de suplantacin
de identidad. Un hacker puede publicar
noticias falsas en sus cuentas. Muchos nios,
incluso, tienen que dejar la escuela despus
de que alguien se apropia de su Facebook y
publica informacin mentirosa.
........ una encuesta, 80% de los hogares
no emplean filtros para contenidos online.
Tambin falta en las casas hablar sobre cmo
manejar el contacto con desconocidos.
Adaptado de: AUYANET, Sebastin El Pas Digital.
ago. 2010.

59. Assinale a alternativa que preenche,


corretamente e de acordo com o sentido do
texto, as lacunas das linhas 07, 14 e 34, na
ordem em que aparecem.
(A) Pero

Mientras

Despus

(B) Adems, En cuanto a

Segn

(C) Sin duda, Cuando

En seguida

(D) Adems

En cuanto a

Despus

(E) Pero

Siempre

En seguida

UFRGS CV/2011 ESP

60. De acordo com o texto, o maior problema das


redes sociais
(A) a
invaso
descontrolada
dos
computadores por vrus.
(B) o grande nmero de contatos de cada
usurio.
(C) a propagao virtual da violncia urbana.
(D) a falta de preocupao com a
preservao da privacidade.
(E) o tempo gasto pelo usurio em salas de
bate-papo.
61. Considere as seguintes afirmaes, a respeito
do contedo do texto.
I - Os pais no alertam seus filhos sobre o
comportamento que devem ter nos
contatos com desconhecidos na rede.
II - Mais da metade dos pesquisados
compartilha informaes pessoais nas
redes sociais.
III- Os usurios da Internet costumam ser
mais cautelosos nos relacionamentos
virtuais que nos reais.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas I.
Apenas II.
Apenas I e II.
Apenas II e III.
I, II e III.

62. As formas verbais se ha comunicado (l. 01-02)


e ha crecido (l. 12) poderiam ser substitudas,
respectivamente, sem alterao do sentido
contextual, por
(A)
(B)
(C)
(D)
(E)

se
se
se
se
se

comunicar e creciera.
comunica e crece.
comunicaba e creca.
comunicara e crecer.
comunic e creci.

63. Assinale a alternativa que apresenta os


sinnimos mais adequados, de acordo com o
contexto,
para
as
formas
verbais
suministrando (l. 03) e maneja (l. 09).
(A)
(B)
(C)
(D)
(E)

proporcionando
intentando
mereciendo
sujetando
pareciendo

conduce
siente
percibe
indaga
abarca
25

84

64. Das formas verbais abaixo, extradas do texto,


a que est no mesmo tempo e modo que a
forma alertan (l. 04)

67. As palavras suplantacin (l. 28) e hogares


(l..34)
significam
em
portugus,
respectivamente,
(A)
(B)
(C)
(D)
(E)

(A) sinti (l. 07).


(B) Puede (l. 12).
(C) sea (l. 18).
(D) pretenda (l. 19).
(E) hubo (l. 26).
65. Considere as seguintes afirmaes, sobre a
relao entre alguns pronomes do texto e os
elementos a que se referem.
I - Na expresso se le peda (l. 07), o pronome
le refere-se a un extrao (l. 06-07).
II - No segmento en sus cuentas (l. 30), a
expresso sus cuentas significa las
cuentas de los nios.
III- O pronome se (l. 32) refere-se a hacker
(l. 29).
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e III.
(E) I, II e III.
66. Considere o enunciado abaixo e as trs
propostas para complet-lo.
Sem prejuzo do sentido contextual e da
correo gramatical, possvel traduzir
1 - sitios (l. 14) por chcaras.
2 - suelen (l. 22) por habituam-se.
3 - encuesta (l. 34) por pesquisa.
Quais propostas esto corretas?
(A) Apenas 1.
(B) Apenas 2.
(C) Apenas 3.
(D) Apenas 1 e 3.

subsdio e lareiras.
substituio e lugares.
subordinao e moradias.
substituio e moradias.
subsdio e lugares.

Instruo: As questes 68 a 75
relacionadas ao texto abaixo.
01.
02.
03.
04.
05.
06.
07.
08.
09.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.

esto

Llegu a la estacin y vi que la gente suba


y bajaba, los vendedores de comida,
sandwiches y bebidas gritaban sus pregones.
A unos cinco metros un seor con una gorra
azul gritaba: Pasajeros al tren. Tren con
direccin a la capital. Yo sub al tren para ver
cmo era por dentro.
........ sent que el tren comenzaba a
moverse. Se me hizo un nudo en el estmago
por la sorpresa y el miedo instintivo a lo
desconocido me dej paralizado. La voz de
una seora que estaba sentada al frente mo
me pregunt: Vas a la capital?.
Le
respond, contndole mi historia, que por
curiosidad sub al tren. Ella me dijo: Entonces
te bajas en la prxima estacin y vas al
puesto de polica. Les dices que te has
perdido y ellos te harn llegar a tu casa.
Cuntos aos tienes? pregunt curiosa.
Seis aos, seora contest yo. Cmo te
llamas? aadi. Paco, seora contest otra
vez. Bueno, sintate a mi lado.
Yo me sent tranquilamente. Tena la
sensacin de estar protegido por esa seora.
Hasta ese momento no haba pensado mirar
por la ventanilla del tren. Cuando me di
cuenta, me acerqu lo ms posible y me
sent sobre un paquete de mercadera. Vea
desfilar ante mis ojos valles, cerros,
mercados, pueblos, gentes. Esto me hizo
recordar mucho el cinema, mejor dicho, una
pelcula que haba visto. Para m la sala del
cinema era ese tren, y la pantalla era la
ventana por donde vea desfilar la vida de la
gente. Como iba muy rpido el tren, veamos
pedazos de paisajes, pedazos de fiestas, o
sea que nuestros ojos vean un tiempo de
vida y un pedazo de espacio; en nuestra
ausencia todo segua su ritmo normal, y eran
los pasajeros los que aceleraban sus vidas y
abandonaban o cambiaban su realidad
cotidiana adaptndose a otra.
Adaptado de: ALIAGA, Francisco. El llamado de la
montaa. In: Caminos del idioma.
Paris: Didier, 1988. p. 61.

(E) 1, 2 e 3.

26

UFRGS CV/2011 ESP

85

68. El hueco de la lnea 08


correctamente rellenado por
(A)
(B)
(C)
(D)
(E)

puede

ser

De repente.
Asimismo.
Siquiera.
Por supuesto.
Al contrario.

72. Las mejores traducciones para las palabras


pregones (l. 03), nudo (l. 09) y pantalla
(l. 33) son, respectivamente,
(A)
(B)
(C)
(D)
(E)

produtos, medo y janela.


propagandas, n y tela.
reclames, aperto y televiso.
avisos, frio y lmpada.
notcias, dor y luz.

69. El mejor ttulo para el texto sera


(A)
(B)
(C)
(D)
(E)

73. La alternativa en que la palabra frente


expresa la misma idea que en la expresin
sentada al frente mo (l. 12) es

El tren de viajeros.
Una aventura peligrosa.
El nio despistado.
La estacin campestre.
Primer viaje en tren.

70. Seale con V (verdadero) o F (falso) las


siguientes afirmaciones acerca de Paco, segn
correspondan o no al contenido del texto.
(
(
(
(

)
)
)
)

Encontr a una amiga de su madre.


No conoca el interior de un tren.
Disfrut del paisaje que vea desde el tren.
Fue detenido por la polica al fin del viaje.

La secuencia correcta para llenar


parntesis, de arriba para bajo, es
(A)
(B)
(C)
(D)
(E)

V
V
F
F
F

V
F
F
V
F

F
F
V
V
F

los

F.
V.
V.
F.
V.

(A) Recib un golpe en la frente.


(B) La parroquia quiere recuperar el frente de
la iglesia.
(C) Enviaron a un grupo de soldados al frente.
(D) Se jubil y dej a su hijo al frente de la
empresa.
(E) Todo pas frente a m.
74. Una forma verbal que expresa idea opuesta a
me acerqu (l. 27) es
(A)
(B)
(C)
(D)
(E)

me
me
me
me
me

calm.
alargu.
aproxim.
alej.
concentr.

75. Considere el texto a seguir.

71. Considere lo dicho a seguir y las tres


propuestas para completarlo.
Si en el texto fuese utilizado el tiempo futuro,
sera necesario sustituir, entre otras, la forma
verbal
1 - Llegu (l. 01) por Llegar.

La voz de una seora me pregunt: Vas a la


capital? Despus: Cuntos aos tienes?,
me interrog curiosa. Y me invit: Sintate a
mi lado.
Seale la alternativa que presenta las formas
correctas para rellenar los huecos de este
texto en el discurso indirecto.

Qu propuestas estn correctas?

La voz de una seora me pregunt si yo ........


a la capital. Despus, curiosa, ........ saber
cuntos aos ........ . Y me invit a ........ a
........ lado.

(A)
(B)
(C)
(D)
(E)

(A)
(B)
(C)
(D)
(E)

2 - sub (l. 06) por suba.


3 - respond (l. 14) por responder.

Slo 1.
Slo 2.
Slo 1 y 3.
Slo 2 y 3.
1, 2 y 3.

UFRGS CV/2011 ESP

voy quiso tengo sentarme mi


iba quise tena que me siente su
iba quiso tena sentarme su
voy quiso tuve sentarme su
vaya quise tengo que me siente mi
27

86

2012
ESPANHOL
Instruo:
As questes 51
relacionadas ao texto abaixo.
01.
02.
03.
04.
05.
06.
07.
08.
09.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.

58

esto

Por mi parte soy o creo ser duro de nariz,


mnimo de ojos, escaso de pelos ........ la
cabeza, creciente de abdomen, largo de
piernas, ancho de suelas, amarillo de tez,
generoso de amores, imposible de clculos,
confuso de palabras, tierno de manos,
lento de andar, inoxidable de corazn,
aficionado a las estrellas, mareas, terremotos,
admirador de escarabajos, caminante de
arenas,
torpe ........ instituciones, chileno a perpetuidad,
amigo de mis amigos, mudo para enemigos,
entrometido entre pjaros, maleducado en
casa,
tmido en los salones, arrepentido sin objeto,
psimo administrador, navegante de boca,
yerbatero de la tinta, discreto entre
animales,
afortunado de nubarrones, investigador en
mercados,
oscuro en las bibliotecas, melanclico en las
cordilleras,
incansable en los bosques, lentsimo de
contestaciones,
ocurrente aos despus, vulgar durante todo
el ao,
resplandeciente con mi cuaderno,
monumental de apetito,
tigre para dormir, sosegado en la alegra,
inspector del cielo nocturno, trabajador
invisible,
desordenado, persistente, valiente por
necesidad,
cobarde sin pecado, sooliento de vocacin,
amable de mujeres, activo por padecimiento,
poeta por maldicin y tonto de capirote.

52. De acordo com o poema,


apresenta-se como um homem

eu-lrico

(A) persistente em suas escolhas e entusiasta


da astrologia.
(B) dedicado profisso e ufanista inveterado.
(C) amigvel com os vizinhos e admirador da
escurido.
(D) caminhante compulsivo e acanhado com
as mulheres.
(E) prdigo de afetos e amante da natureza.

53. No texto, a expresso mnimo de ojos (l. 02)


significa
(A) tuerto de un ojo.
(B) de poca intuicin.
(C) de mirada inteligente.
(D) de ojos pequeos.
(E) de mirada penetrante.

54. A melhor traduo para a expresso ancho


de suelas (l. 04) seria
(A) de p grande.
(B) de p chato.
(C) de p quebrado.
(D) de p torto.
(E) de p descalo.

NERUDA, Pablo. Antologa General.


Madrid: Ed. Alfaguara, 2010. p 136.

51. Assinale
a
alternativa
que
preenche
corretamente, e de acordo com o sentido do
texto, as lacunas das linhas 02 e 11, nesta
ordem.
(A) en

de

(B) entre

hasta

(C) por

desde

(D) entre

de

(E) en

hasta

87

55. Considere as seguintes propostas de substituio de palavras do poema.


1 - lento de andar (l. 07) : pasos pequeos
2 - afortunado de nubarrones (l. 19) : con suerte en la vida
3 - tigre para dormir (l. 29) : sueo pesado
Quais propostas esto corretas e so contextualmente adequadas?
(A) Apenas 1.
(B) Apenas 2.
(C) Apenas 3.
(D) Apenas 1 e 2.
(E) 1, 2 e 3.
56. A palavra melanclica (l. 21) acentuada pela mesma razo que a palavra
(A) adulacin.
(B) azcar.
(C) estircol.
(D) rgimen.
(E) ahnco.

57. A palavra sosegado (l. 29) poderia ser substituda, sem alterao do sentido contextual, por
(A) confianzudo.
(B) discreto.
(C) inerte.
(D) enajenado.
(E) introvertido.

58. No poema, a expresso tonto de capirote (l. 36) significa


(A) inseguro.
(B) simplrio.
(C) incrdulo.
(D) imprudente.
(E) abobalhado.

88

Instruo: As questes 59 a 67
relacionadas ao texto abaixo.

01.
02.
03.
04.
05.
06.
07.
08.
09.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.

esto

La literatura tambin termina permaneciendo


en el lenguaje corriente. La palabra nnfula,
por ejemplo, se convirti en un aporte al
espaol tras la ola de reacciones suscitadas
por la novela Lolita, de Nabokov. Se aplica a
una nia que es especialmente atractiva.
........, es una palabra que se pronuncia con
una intencin socarrona y que viene
acompaada por una sonrisa que demanda
del oyente un exceso de complicidad.
Por cierto, la palabra y el concepto remiten
a las mticas ninfas, adorables deidades de la
antigedad dispersas por los bosques, el mar,
los ros y los pequeos arroyos. Se trata de
nias ms imaginarias que reales.
De cualquier forma, causa ms asombro
que nosotros hayamos adoptado la palabra
lolita para designar informalmente a las
quinceaeras. De lolita derivan minilola
(preadolescente), lolosaurio, alolado y hasta
lolsimo, que fue el nombre de un programa
de rock transmitido en la televisin.
........, las bellas letras se afincan tambin
en el uso lingstico a travs de la
adjetivacin del apellido de algunos autores
para calificar situaciones cotidianas. De ah
que todo incendio sea dantesco, como
kafkiano todo trmite burocrtico. Borges,
quien detestaba ese tipo de trminos, ha
proporcionado contra su voluntad, ........ , el
vocablo borgiano, utilizado para referirse a
rias de compadritos y a prdigos metafsicos
librescos. En un mbito menos popular los
encontramos tambin en expresiones como
un cosmos cervantino, un hambre rabelesiana
y una lata heideggeriana.
Adaptado de: El Mercurio, 31 jul. 2011. p. E 21.

UFRGS CV/2014 ESP

59. Assinale a alternativa que completa corretamente, e de acordo com o sentido do texto, as
lacunas das linhas 07, 23 e 30, nesta ordem.
(A) Sin embargo Por ejemplo no menos
(B) Sin embargo Por otro lado no
obstante
(C) As De cualquier forma si bien
(D) Restrictivamente Por ejemplo por
ejemplo
(E) As Por otro lado si bien

60. Considere as seguintes afirmaes acerca do


contedo do texto.
I - Em decorrncia da popularidade da
novela Lolita, termos literrios entraram
na linguagem coloquial.
II - As ninfas eram meninas que viviam
apenas nas guas.
III- A palavra lolita deu origem a outras
palavras em espanhol.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e III.
(E) I, II e III.
61. O melhor ttulo para o texto seria
(A) La presencia de Nabokov en la literatura y
el lenguaje.
(B) Sobre la literatura mundial y las nuevas
palabras.
(C) Los usos lingsticos en la literatura.
(D) La influencia de los bestsellers en la
cultura popular.
(E) Literatura y escritores en el lenguaje de
todos los das.

89

62. Assinale a alternativa que apresenta os


sinnimos mais adequados, de acordo com o
contexto, para a palavra suscitadas (l. 04) e
para o segmento se afincan (l. 23).
(A) auguradas

se establecen

(B) provocadas

se encuentran

(C) motivadas

se hunden

(D) auguradas

se encuentran

(E) provocadas

se establecen

63. Considere as seguintes propostas


substituio de advrbios do texto.

65. Assinale com V (verdadeiro) ou F (falso) as


seguintes propostas de alterao da ordem de
adjetivos no texto.
( ) Deslocar adorables (l. 12) para
imediatamente aps deidades (l. 12).
( ) Deslocar pequeos (l. 14) para
imediatamente aps arroyos (l. 14).
( ) Deslocar
bellas
(l.
23)
imediatamente aps letras (l. 23).

para

( ) Deslocar
cotidianas (l. 26) para
imediatamente antes de situaciones (l. 26).
de

I - Substituir especialmente (l. 06) por muy.


II - Substituir informalmente (l. 18) por de
manera informal.
III - Substituir contra (l. 30) por de manera
contraria.
Quais propostas esto corretas?
(A) Apenas I.

A sequncia correta de preenchimento dos


parnteses, de cima para baixo,
(A) F V F V.
(B) V F V F.
(C) F F V V.
(D) V V F F.
(E) F F F V.

66. As palavras deidades (l. 12) e apellido (l. 25)


significam em portugus, respectivamente,

(B) Apenas II.


(C) Apenas III.

(A) deusas e alcunha.

(D) Apenas I e II.

(B) divindades e apelido.

(E) I, II e III.

(C) divas e sobrenome.


(D) deusas e apelido.

64. Considere as seguintes afirmaes sobre a


relao entre pronomes do texto e as palavras
a que eles se referem.
I - O pronome que (l. 08) refere-se a
intencin (l. 08).
II - O pronome que (l. 21) refere-se a
alolado (l. 20).
III- O pronome los (l. 33) refere-se a
trminos (l. 29).

(E) divindades e sobrenome.

67. As formas verbais hayamos adoptado (l. 17)


e ha proporcionado (l. 29-30) poderiam ser
substitudas, sem alterao de sentido
contextual, por
(A) adoptaremos e proporciono.
(B) adoptramos e proporcion.

Quais esto corretas?

(C) habremos adoptado e proporcion.

(A) Apenas I.

(D) habremos adoptado e proporciono.

(B) Apenas II.

(E) adoptramos e proporciono.

(C) Apenas III.


(D) Apenas I e II.
(E) I, II e III.
4

UFRGS CV/2014 ESP

90

Instruccin: Las preguntas 68 a 75 estn relacionadas al texto abajo.

Anmese. No sea tmido, cumpa.


Peor sera comprar sostenes.

Oiga, compadre Condorito.


Me acompaa al pueblo a
comprar calzoncillos?
Bueno, cumpa, total, a usted
lo he acompaado a cosas
ms terribles.

Dme um paquete de
siete calzoncillos.

Creo que cometen

un error! Es una
mala estrategia
comercial.

Lo siento, seor, pero


slo los tenemos
en paquetes de
media docena.

Fjese...lunes, martes,
mircoles, jueves, viernes,
sbado y domingo.
siete ... Entiende?

Creo que tiene toda la


razn, seor. As lo haremos
de ahora en adelante.

........ los genios idelogos y cabezas de huevo


brotan hasta debajo de las piedras.
Oiga, cumpa, me acompaa
usted a comprar calzoncillos?
Acaban de pagarme un trabajo.

Dme un paquete
de doce calzoncillos.

Vamos, lo
acompao.

Imposible. Ahora
los empaquetamos
de a siete, como
sugiri su
amigo.

........ lo recuerdo
perfectamente,
pero...

Es que yo le estoy hablando de


enero, febrero, marzo, abril...!!!

Adaptado de: PEPO. Condorito de oro; seleccin de los mejores chistes. n. 12. Chile. 10 set. 1990. p. 42.

UFRGS CV/2014 ESP

91

68. Seale
la
alternativa
que
completa,
correctamente y de acuerdo con el sentido del
texto, las lagunas de las lminas 5 y 7,
respectivamente.

71. Las palabras calzoncillos (lmina 1) e


sostenes (lmina 2) podran ser sustitudas,
sin alterar el sentido del texto, por
(A) corbatas y ligas.

Eso

(B) shorts y medias.

(B) Como

Sobre todo

(C) calzones y bragas.

(C) Sino

Sobre todo

(D) slips y sujetadores.

(D) Pero

Sin embargo

(E) bermudas y pauelos.

(A) Pero

(E) Como

Eso

69. Seale con V (verdadero) o F (falso) las


afirmaciones abajo, conforme si estn o no de
acuerdo con el texto.

I - El pronombre lo de lo he acompaado
(lmina 1) se refiere a usted (lmina 1).

( ) Condorito no es siempre solidario.


( ) Condorito y su amigo viven en las afueras
de la ciudad.
( ) El dependiente no atiende bien a los
clientes.
( ) El amigo de Condorito es tmido.
La

secuencia correcta para rellenar


parntesis, de arriba para bajo, es

72. Considere las siguientes afirmaciones sobre la


relacin entre algunos pronombres del texto y
los elementos a que se refieren.

los

II - El pronombre los de los tenemos


(lmina 3) se refiere a paquetes (lmina
3).
III- El pronombre lo de As lo haremos
(lmina 4) se refiere a un error (lmina
4)
Cules estn correctas?
(A)
(B)
(C)
(D)
(E)

(A) F V F V.
(B) F F V F.
(C) V V F F.
(D) F V V F.

Slo I.
Slo II.
Slo III.
Slo II y III.
I, II y III.

(E) V F F V.

70. Seale la alternativa en que las formas


verbales extradas del texto estn conjugadas
en la misma persona, el mismo tiempo y el
mismo modo.
(A) Oiga (lmina 1)
(lmina 1)

Acompaa

73. Seale la alternativa en que el verbo entre


parntesis est en el mesmo modo y tiempo
que el verbo subrayado en el respectivo
segmento.
(A) [...] No sea tmido [...] (lmina 2)
(fuera)
(B) [...] cometen un error [...] (lmina 4)
(procedieran)

(B) Anmese (lmina 2) Dme (lmina 3)


(C) Siento (lmina 3)

tiene (lmina 4)

(D) Fjese (lmina 4)

acaban (lmina 5)

(E) Brotan (lmina 5)

Vamos (lmina 5)

(C) [...] me acompaa usted a [...] (lmina


5) (pide)
(D) Dme un paquete [...] (lmina 6)
(pasamos)
(E) [...] le estoy hablando de [...] (lmina
8) (est hablando)

UFRGS CV/2014 ESP

92

74. Considere las tres propuestas que presentan


un significado sinnimo al de la expresin de
ahora en adelante (lmina 4) segn el
texto.
I - Esto es una continuacin de lo anterior.
II - Dejaremos los puntos conflictivos para un
momento ms adelante.
III- Lo haremos de esta forma a partir de este
momento.
Cules estn correctas?
(A) Slo I.
(B) Slo II.
(C) Slo III.
(D) Slo I y III.
(E) I, II y III.

75. La expresin cabezas de huevo (lmina 5),


podra sustituirse, sin alterar el sentido del
texto, por
(A) halageos.
(B) lelos.
(C) peritos.
(D) escasos.
(E) cuerdos.

UFRGS CV/2014 ESP

93

2013
ESPANHOL
Instruo: As questes 51 a 58
relacionadas ao texto abaixo.

esto

I - O eu lrico faz uma comparao entre os


hemisfrios norte e sul, destacando que o
norte se caracteriza por sucumbir
ordem do sistema mundial.

El Sur tambin existe


01.
02.
03.
04.
05.
06.
07.
08.
09.
10.

Con su ritual de acero


sus grandes chimeneas
sus sabios clandestinos
su canto de sirenas
sus cielos de nen
sus ventas navideas
su culto de dios padre
y de las charreteras
con sus llaves del reino
el norte es el que ordena

11.
12.
13.
14.
15.
16.
17.
18.
19.
20.

pero aqu abajo abajo


el hambre disponible
recurre al fruto amargo
de lo que otros deciden
mientras el tiempo pasa
y pasan los desfiles
y se hacen otras cosas
que el norte no prohbe
con su esperanza dura
el sur tambin existe

II - O poema afirma ao mundo que os pases


do hemisfrio sul, embora subjugados
pelos pases do hemisfrio norte, so
espaos de esperana e de conservao
da memria.
III- A concluso do poema demonstra a
impossibilidade do reconhecimento dos
pases
do
hemisfrio
sul
como
componentes representativos de uma
nova ordem mundial.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e II.
(E) I, II e III.

()
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.

con su corno francs


y su academia sueca
su salsa americana
y sus llaves inglesas
con todos sus misiles
y sus enciclopedias
su guerra de galaxias
y su saa opulenta
con todos sus laureles
el norte es el que ordena

31.
32.
33.
34.
35.
36.
37.
38.
39.
40.

pero aqu abajo abajo


cerca de las races
es donde la memoria
ningn recuerdo omite
y hay quienes desaparecen
y hay quienes se desviven
y as entre todos logran
lo que era un imposible
que todo el mundo sepa
que el Sur tambin existe

51. Considere as seguintes afirmaes a respeito


do poema.

52. Os possessivos su e sus, da primeira estrofe


do poema (l. 01-10), referem-se a
(A) grandes chimeneas (l. 02).
(B) sabios clandestinos (l. 03).
(C) culto de dios padre (l. 07).
(D) llaves del reino (l. 09).
(E) el norte (l. 10).
53. As palavras acero (l. 01) e saa (l. 28)
significam, respectivamente,
(A) acervo e furor.
(B) acervo e rancor.
(C) acessrio e rancor.
(D) ao e furor.

Adaptado de: BENEDETTI, Mario. Preguntas al azar.


Buenos Aires: Editorial Sudamericana, 1986.
p. 153-154.

24

(E) ao e estupor.

UFRGS CV/2013 ESP

94

54. As palavras que seguem a mesma regra de formao do plural de chimeneas (l. 02), misiles
(l. 25) e races (l. 32) so, respectivamente,
(A)
(B)
(C)
(D)
(E)

mesas, mujeres e luces.


libros, estilos e irlandeses.
coches, hombres e lpices.
canales, tigres e digitales.
zapatos, televisiones e azules.

55. Considere as seguintes afirmaes sobre regras de acentuao.


I - As palavras nen (l. 05), aqu (l. 11 e 31) e francs (l. 21) so oxtonas e seguem a mesma
regra de acentuao.
II - As palavras prohbe (l. 18) e tambin (l. 20) so acentuadas porque formam hiatos.
III- as palavras ningn (l. 34) e as (l. 37) so acentuadas por seguirem diferentes regras de acentuao.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas I.
Apenas II.
Apenas III.
Apenas I e II.
I, II e III.

56. No poema, a expresso ventas navideas (l. 06) significa


(A)
(B)
(C)
(D)
(E)

ventos de Natal.
vendas de novidades.
notcias anunciadas.
invenes.
vendas natalinas.

57. A palavra que expressa uma ideia oposta a cerca (l. 32)
(A)
(B)
(C)
(D)
(E)

debajo.
lejos.
encima.
prximo.
enfrente.

58. Assinale a alternativa que apresenta a traduo mais adequada, de acordo com o contexto, para a
palavra logran (l. 37).
(A)
(B)
(C)
(D)
(E)

induzem
impossibilitam
conseguem
perguntam
enganam

UFRGS CV/2013 ESP

25

95

Instruo: As questes 59 a 67
relacionadas ao texto abaixo.
01.
02.
03.
04.
05.
06.
07.
08.
09.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.

esto

Cerca del 90% de los jvenes espaoles


de entre 18 y 24 aos viven con sus padres.
Esta realidad es "preocupante" para el
socilogo Enrique Gil Calvo, ........ es una
manera de retrasar la asuncin de
responsabilidades, a diferencia de lo que
ocurre en los pases no mediterrneos de la
Unin Europea.
El socilogo afirm que los actuales
jvenes pertenecen a una generacin perdida,
un calificativo que ha atribuido a la costumbre
que tienen los medios de comunicacin de
simplificarlo todo.
Gil Calvo hizo hincapi en un problema de
la juventud de este pas y de la del resto de
los pases del arco mediterrneo, como es la
superproteccin que ejercen las familias y que
se extiende en muchos casos hasta la
treintena. "La verdadera enfermedad de los
jvenes es el dficit de autonoma personal",
sentenci Gil Calvo, que tambin explic que
la crisis actual puede provocar la reaccin de
estos jvenes para "salir del letargo y no
dejarse llevar por el fatalismo".
En este sentido, el socilogo expuso cuatro
modelos de juventud. Por un lado, est el
nrdico, marcado por jvenes que abandonan
el hogar familiar sobre los 18 aos con la
ayuda del estado, para alcanzar la
emancipacin total a los treinta. Algo parecido
ocurre con el modelo anglosajn, ........ en
este caso los jvenes salen de casa gracias a
las oportunidades del mercado laboral.
Por otro lado, est el modelo francoalemn o continental, en el que es la propia
familia la que ayuda a los jvenes a salir de
casa cuando llegan a ser mayores de edad. A
su vez, el modelo mediterrneo, en el que se
incluye a Espaa, est marcado por la
proteccin que ejercen las familias y que
retrasa la adquisicin de responsabilidades.
Como consecuencia de esto, los jvenes
espaoles son poco activos, conformistas,
inmovilistas, poco receptivos a la movilidad
geogrfica y con baja iniciativa.
Como conclusin, este experto socilogo
aclar que ahora, ms que nunca, los jvenes
tienen en su mano ser o no una generacin
perdida. "Depende de ellos", sentenci.
Adaptado de: <http://novapolis.es/index.php/
deportes-cultura-y-espectaculos-163/17807>.
Acesso em: 25 out. 2012.

26

59. Assinale
a
alternativa
que
preenche
corretamente, e de acordo com o sentido do
texto, as lacunas das linhas 04 e 31, nesta
ordem.
(A) por que sino
(B) para que mientras
(C) aunque pero
(D) porque

aunque

(E) forma de todava

60. Assinale a alternativa que melhor sintetiza o tema


do texto e que poderia servir-lhe de ttulo
(A) Las diferencias
treintenos.

entre

los

jvenes

(B) La emancipacin de los jvenes europeos.


(C) Los jvenes espaoles se emancipan muy
tarde.
(D) La superproteccin
espaoles.

de

los

padres

(E) La generacin perdida.

61. Assinale com V (verdadeiro) ou F (falso) as


afirmaes abaixo, de acordo com o sentido
do texto.
( ) Los jvenes espaoles buscan retrasar su
salida de casa debido a la crisis
econmica.
( ) Los padres alemanes estn a favor de la
salida de los jvenes de casa.
( ) Los jvenes escandinavos salen de casa
con ayuda del estado.
( ) Los jvenes de Europa
autonoma laboral.

carecen

de

A sequncia correta de preenchimento dos


parnteses, de cima para baixo,
(A) F V V F.
(B) V F F V.
(C) F V V V.
(D) V F V F.
(E) V V F V.

UFRGS CV/2013 ESP

96

62. Considere as seguintes afirmaes sobre o


contedo do texto.

65. A expresso hizo hincapi (l. 14) significa,


em portugus,

I - La juventud actual tiene la perspectiva de


acabar con el estigma de la generacin
perdida.

(A) manteve-se firme.

II - Los jvenes espaoles slo consiguen


autonoma despus de los 30 aos.

(C) props sem convico.

III- Los jvenes ibricos son conformistas y


aceptan la proteccin de sus padres.
Quais esto corretas?

(D) afirmou com premncia.


(E) apresentou como argumento.
66. Considere o enunciado abaixo e as trs
propostas para complet-lo.

(A) Apenas I.
(B) Apenas II.

No trecho y que se extiende en muchos


casos hasta la treintena (l. 17-19), a
partcula se tem a mesma funo que em

(C) Apenas III.


(D) Apenas I e II.
(E) I, II e III.

1 - se necesita vendedor.

63. Assinale a alternativa que apresenta a


traduo mais adequada, de acordo com o
contexto, para as palavras asuncin (l. 05) e
calificativo (l. 11).

2 - se levanta tarde.
3 - se debe tomar cuidado con la situacin.
Quais propostas esto corretas?
(A) Apenas 1.

(A) implicao ttulo

(B) Apenas 2.

(B) suposio registro


(C) elevao

(B) deu pouca importncia.

(C) Apenas 3.

nome

(D) Apenas 1 e 3.

(D) aceitao apelido

(E) 1, 2 e 3.

(E) proposio nota


64. No

fragmento un calificativo que ha

atribuido a la costumbre que tienen los


medios de comunicacin de simplificarlo
todo. (l. 11-13), o trecho sublinhado
expressa

67. A palavra sobre (l. 28) pode ser substituda,


sem alterao do sentido contextual, por
(A) con.
(B) a los.

(A) ao futura que tem relao com o


presente.

(C) unos.

(B) ao passada que tem relao com o


presente.

(E) de.

(D) alrededor.

(C) ao contnua que no tem relao com o


presente.
(D) ao condicional
presente.

que

necessita

do

(E) ao hipottica que relaciona o passado


ao presente.

UFRGS CV/2013 ESP

27

97

Instruo: As questes 68 a 75
relacionadas ao texto abaixo.
01.
02.
03.
04.
05.
06.
07.
08.
09.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.

esto

El cientfico Manuel Mandianes ha sealado


que los mayas predijeron en su calendario
que en 2012 se producira alguna catstrofe
pero, "en ningn momento se habla del fin del
mundo". Segn este cientfico, el calendario
maya "no se puede seguir de la misma
manera como hoy lo contemplamos", pues
"su forma de elaborarlo era proyectando para
el futuro lo que haban vivido en el pasado".
"Siglos atrs, por la concordancia de
planetas, estrellas y otros astros, se habra
producido alguna mala cosecha o pestes; por
ello, los mayas, adivinando que en 2012
probablemente se dara la misma confluencia,
profetizaron que se producira alguna
catstrofe", ha sealado Mandianes.
La preocupacin fundamental del pueblo
maya era el tiempo, y su filosofa y su religin
estn
construidas
a
partir
de
l.
"Prcticamente la totalidad de sus divinidades
tenan que ver con algn periodo, algn ciclo
del tiempo o alguna hora del da", ha
destacado el cientfico.
El tiempo era como el mito del eterno
retorno. ......... , crean que si conocan lo que
haba ocurrido en los siglos pasados podran
adivinar lo que sucedera en el futuro.
As se "ha llegado a la profeca de que el
mundo puede acabarse". Los expertos nunca
han afirmado que los mayas hayan predicho
el fin del mundo, explica Mandianes, que dice
que esa idea cal en la sociedad por otros
canales.
........, para Mandianes, la pregunta que
habra que hacerse ante un acontecimiento
como ste es "por qu la gente del ao 2012,
que es mucho ms cientfica y vive en la era
de la nuevas tecnologas y grandes
telescopios, da tanta importancia a lo que
dijeron unos sacerdotes mayas que no tenan
los instrumentos que se tienen hoy en da".
Aunque el estudio del tiempo cclico de los
mayas no es "muy acertado", Mandianes ha
explicado que su cultura ha realizado grandes
aportaciones a la astronoma puesta al
servicio de la astrologa. A pesar de que las
profecas alertaban de que el fin del mundo
llegara el 21 de diciembre de este ao, el
pasado mes de mayo un equipo de cientficos
descubra que existan nuevas escrituras del
calendario maya que acabaran con las
previsiones del fin del mundo.

68. Seale
la
alternativa
que
completa,
correctamente y de acuerdo con el sentido del
texto, las lagunas de las lneas 25 y 34,
respectivamente.
(A) De este modo

De hecho

(B) De esta manera Para efecto


(C) De este modo

De pronto

(D) De esta forma

Para efecto

(E) De esta forma

De verdad

69. Considere las siguientes afirmaciones sobre el


contenido del texto.
I - El tiempo de los mayas era cotidiano,
segn Mandianes.
II - Los nuevos descubrimientos no confirman
el fin del mundo para 2012.
III- Los mayas crean en el tiempo; todo se
basaba en eso.
Cules son correctas?
(A) Slo I.
(B) Slo II.
(C) Slo III.
(D) Slo I y II.
(E) Slo II y III.
sustantivos
cientfico (l. 01),
cosecha (l. 12) y expertos (l. 29)

70. Los

significan, en portugus, respectivamente,


(A) cientfico, colheita y espertos.
(B) cientista, colheita y especialistas.
(C) cientfico, plantao y especialistas.
(D) cientista, colheita y espertos.
(E) cientfico, plantao y espertos.

Adaptado de: <http://www.20minutos.es/noticia/


1576677/0/mayas-2012/catastrofe/fin-del-mundo>.
Acceso en: 07 set. 2012.

28

UFRGS CV/2013 ESP

98

71. El pronombre lo (l. 07) se refiere a


(A) fin del mundo (l. 04-05).
(B) cientfico (l. 05).
(C) calendario maya (l. 05-06).
(D) futuro (l. 09).
(E) pasado (l. 09).
72. En Siglos atrs, por la concordancia de

planetas, estrellas y otros astros, se


habra producido alguna mala cosecha o
pestes; por ello [...]. (l. 10-13), la expresin
por ello puede ser sustituida por
(A) por eso.
(B) por l.
(C) por lo.
(D) por aquello.
(E) por ellos.

73. Seale la alternativa en que las formas


verbales extradas del texto estn conjugadas,
en la misma persona, el mismo tiempo y el
mismo modo.
(A) habra producido (l. 11-12) ha
explicado (l. 43-44)
(B) tenan (l. 21) acabaran (l. 51)
(C) era (l. 24) crean (l. 25)
(D) dijeron (l. 40) habra (l. 35)
(E) alertaban (l. 47) tenan (l. 40)
74. La forma verbal han afirmado (l. 30) podra ser
sustituida, sin alterar el sentido del texto, por
(A) afirmaron.
(B) afirmaran.
(C) afirmaban.
(D) afirman.
(E) afirmaran.
75. Seale la alternativa que presenta el sinnimo
ms adecuado para cal (l. 32).
(A) exhibi
(B) protegi
(C) penetr
(D) se adelant
(E) se sustent
UFRGS CV/2013 ESP

29

99

2014
51. Considere as seguintes afirmaes a respeito
do poema.

ESPANHOL
Instruo: As questes 51 a 59
relacionadas ao texto abaixo.

esto

I - O eu lrico faz uma reflexo sobre a


banalidade da vida.
II - O eu lrico evidencia
experincia de vida.

Versos Sencillos

Yo soy un hombre sincero


De donde crece la palma,
Y antes de morirme quiero
Echar mis versos del alma.

05.
06.
07.
08.

Yo vengo de todas partes,


Y hacia todas partes voy:
Arte soy entre las artes,
En los montes, monte soy.

09.
10.
11.
12.
13.
14.
15.
16.
17.

Yo s los nombres extraos


De las yerbas y las flores,
Y de mortales engaos,
Y de sublimes dolores.
()
Oculto en mi pecho bravo
La pena que me lo hiere:
El hijo de un pueblo esclavo
Vive por l, calla y muere.

18.
19.
20.
21.

Todo es hermoso y constante,


Todo es msica y razn,
Y todo, como el diamante,
Antes que luz es carbn.

22.
23.
24.
25.

Yo s que el necio se entierra


Con gran lujo y con gran llanto.
Y que no hay fruta en la tierra
Como la del camposanto.

26.
27.
28.
29.

Callo, y entiendo, y me quito


La pompa del rimador:
Cuelgo de un rbol marchito
Mi muceta de doctor.

grande

III- O eu lrico afirma que sabe compor um


poema.

I-YO SOY UN HOMBRE SINCERO...


01.
02.
03.
04.

uma

Quais esto corretas?


(A)
(B)
(C)
(D)
(E)

Apenas I.
Apenas II.
Apenas III.
Apenas I e II.
I, II e III.

52. Assinale a alternativa que apresenta, de


acordo com o texto, o sinnimo mais adequado,
em lngua espanhola, para echar (l. 04).
(A) delinear
(B) mantener
(C) expulsar
(D) inscribir
(E) borrar
53. Se for alterado o sujeito da primeira pessoa
do singular para a terceira pessoa do singular
do presente do indicativo nos versos Yo
vengo de todas partes / Y hacia todas
partes voy (l. 05-06), as formas verbais
corretas seriam
(A) vino e ande.
(B) vino e va.
(C) viene e ande.
(D) viene e va.
(E) venga e vas.

MART, Jos. Versos Sencillos. 1891.


Disponvel em: <http://www.jose-marti.org>.
Acesso em: 20 ago. 2013.

54. A palavra hacia (l. 06) possui o sentido de


(A) origem.
(B) limite.
(C) determinao.
(D) modo.
(E) direo.
UFRGS CV/2014 ESP

22

100

55. Nas linhas 07 e 08, o eu lrico afirma que


Artes soy entre las artes / En los montes,
monte soy. Esses versos significam que
(A) ele demonstra versatilidade para
adaptar em diferentes espaos.

58. A palavra quito (l. 26) poderia ser


substituda, sem alterao de sentido, por
(A) permito.

se

(B) tengo.
(C) hago.

(B) ele nega completamente toda experincia


que viveu.

(D) saco.
(E) tolero.

(C) a poesia a melhor das artes e lhe


permite transformaes.
(D) a vida artstica e a vida contemplativa lhe
so indiferentes.
(E) ele prefere a arte natureza.

59. Considere o emprego da palavra cuelgo nos


enunciados abaixo.

56. Considere as seguintes afirmaes sobre


regras de acentuao.
I - As palavras s (l. 09) e l (l. 17) so
monosslabos e possuem acentuao
diferencial.
II - A palavra flores (l. 10) uma paroxtona
acabada em s e, portanto, no se acentua
ortograficamente.

I - Despus del trabajo, cuelgo todos los


das mi ropa para que no se arrugue.
II - Cuando las personas me insultan al
telfono, les cuelgo inmediatamente.
III- A veces, les cuelgo injustamente a las
personas hechos en los que no
participaron.
Em quais enunciados a palavra tem o mesmo
sentido que cuelgo (l. 28)?

III- As palavras razn (l. 19) e rbol (l. 28)


so acentuadas ortograficamente, embora
por regras diferentes.

(A) Apenas I.

Quais esto corretas?

(C) Apenas III.

(B) Apenas II.


(D) Apenas I e III.

(A) Apenas I.

(E) I, II e III.

(B) Apenas II.


(C) Apenas III.
(D) Apenas I e II.
(E) I, II e III.
57. O pronome lo (l. 15) refere-se a
(A) pecho (l. 14).
(B) hijo (l. 16).
(C) pueblo (l. 16).
(D) diamante (l. 20).
(E) carbn (l. 21).

UFRGS CV/2014 ESP

23

101

Instruo: As questes 60 a 66
relacionadas ao texto abaixo.
01.
02.
03.
04.
05.
06.
07.
08.
09.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.

esto

El socilogo cataln Manuel Castells


presenta en su obra ms reciente, Redes de
Indignacin y Esperanza, una radiografa de
los movimientos que se han ido extendiendo
por la geografa mundial en los ltimos aos.
Las revoluciones pacficas en las que sus
participantes toman los espacios pblicos para
mostrar su indignacin son estudiadas por el
autor para extraer sus elementos comunes
como medio para comprender el alcance de
este nuevo tipo de motor de cambio social
tanto de manera global . local.
Superadas las formas de cambio social
basadas en golpes de estado, revoluciones
polticas o guerras, movimientos sociales
como los Indignados de Espaa, Occupy Wall
Street de Estados Unidos o los acaecidos en la
Plaza Tahir de Tnez surgen como nueva
forma de transformacin. Ante las injusticias
percibidas por la sociedad, el autor identifica
cuatro fases que, a su vez, son el origen de
estas revoluciones: Un primer momento de
miedo ante la situacin (por ejemplo, la crisis
financiera de 2008, detonante de la mayora
de estas reivindicaciones) una segunda fase
de ira ante las injusticias derivadas de esta
problemtica un tercer momento en el que la
ira se transforma en indignacin y se decide
actuar, . siempre de manera pacfica y
un ltimo estadio en el que la esperanza de
cambio se convierte en el motor principal de
estos movimientos. Es lo que Castells define
como la transicin de la indignacin a la
esperanza.
El papel de la Internet es clave para
entender la viralidad de estos movimientos
sociales, gracias a las posibilidades de difusin
inmediata que proporciona la red. Sin
embargo, el autor destaca que estos
movimientos
buscan
materializar
su
indignacin y sus propuestas ms all del
ciberespacio, reivindicando para s un espacio
pblico y ocupndolo para proclamar sus
reivindicaciones. De esta forma, el espacio
urbano, normalmente en lugares simblicos,
se convierte en un espacio poltico
asambleario en el que, a travs de la creacin
de un fuerte sentimiento de comunidad
basado en la esperanza de cambio, la
sociedad se reivindica a s misma frente a las
injusticias latentes propiciadas por el poder.

60. Assinale
a
alternativa
que
preenche
corretamente, e de acordo com o sentido do
texto, as lacunas das linhas 12 e 29, nesta
ordem.
(A) como todava
(B) cuanto todava
(C) cuanto pero
(D) cuanto aunque
(E) como aunque

61. Considere as seguintes afirmaes a respeito


do texto.
I - O socilogo Manuel Castells, ao estudar a
ocupao dos espaos pblicos em vrias
cidades do mundo, busca os elementos
diferentes entre as manifestaes, na
tentativa de compreender o alcance
internacional desses protestos.
II - O texto afirma que o papel da Internet
fundamental
na
divulgao
dos
movimentos
sociais,
porm
os
manifestantes devem ocupar fisicamente
os espaos pblicos como forma de
legitimar suas reivindicaes.
III- Quando a ira se transforma em
indignao, a atuao dos manifestantes
deve ocorrer sempre de modo pacfico.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas II e III.
(E) I, II e III.

Adaptado de: SORDE, Teresa. Disponvel em:


<http://www.hipatiapress.info/hpjournals/index.
php/rise/article/viewfile/537/457>.
Acesso em: 09 jun. 2013.
UFRGS CV/2014 ESP

24

102

62. Se a expresso Las revoluciones pacficas (l. 06) for substituda por La revolucin pacfica,
quantas outras alteraes seriam necessrias, da linha 06 linha 12, para fins de concordncia?
(A) 3.
(B) 4.
(C) 5.
(D) 6.
(E) 7.
63. Assinale a alternativa que apresenta a traduo mais adequada, de acordo com o contexto, para a
palavra acaecidos (l. 17).
(A) previstos
(B) motivados
(C) ensandecidos
(D) ocorridos
(E) violentos

64. A alternativa que apresenta uma palavra que possui o mesmo gnero, em lngua espanhola, que
crisis (l. 23)
(A) cutis.
(B) anlisis.
(C) nfasis.
(D) frontis.
(E) tesis.
65. O possessivo su (l. 40) refere-se a
(A) el autor (l. 39).
(B) estos movimientos (l. 39-40).
(C) propuestas (l. 41).
(D) ciberespacio (l. 42).
(E) espacio pblico (l. 42-43).
66. A palavra latentes (l. 51) pode ser traduzida, sem alterao do sentido contextual, por
(A) organizadas.
(B) geradas.
(C) subjacentes.
(D) inerentes.
(E) dominantes.
UFRGS CV/2014 ESP

25

103

Instruo: As questes 67 a 75
relacionadas ao texto abaixo.
01.
02.
03.
04.
05.
06.
07.
08.
09.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.

esto

Una de las costumbres que caracteriz a la


desaparecida revista Estadio era la de publicar
en la portada una foto de algn deportista
destacado del momento. En la edicin nmero
1.572, el honor fue del delantero Manuel
Garca, la estrella del momento. ........, su
historia tiene una gran peculiaridad: Garca
fue la portada de Estadio aquel martes 11 de
septiembre de 1973. El mismo da en que la
historia de Chile cambi.
A 40 aos de esta imagen, Garca
comenta: " Es mi tesoro ms preciado. No era
fcil ser la portada de Estadio. ........, me toc.
Ahora, cuando la veo, me acuerdo de las
amarguras que se sucedieron", relata con voz
embargada el ex jugador. A la fecha del golpe
militar, era la gran figura de Rangers, su
equipo.
Previo al 11 de septiembre de 1973, el
plantel haba realizado una gira a Bolivia.
"Nosotros regresamos el 9 de septiembre a
Chile. Me fui a Coronel (su lugar de
residencia) el 10 de septiembre, y viv el golpe
all.
"Un
mes
despus
retomamos
el
entrenamiento. La gente iba en masa a
vernos. El estadio estaba siempre lleno. Lo
que ms recuerdo de ese tiempo es que le
entregamos alegra, para que se olvidara de lo
que estaba pasando. Eso era lo que ms feliz
me haca.
El ex artillero de Rangers se enter slo
dos aos despus de que fue portada de
Estadio el 11 de septiembre de 1973.
Dos son los significados que tiene para el
ex futbolista la imagen publicada hace 40
aos. Uno es de alegra, "porque me recuerda
cuando fui futbolista. Fue una bendicin haber
jugado"; el otro, sin embargo, es de pena:
fue lamentable todo lo que pas despus de
ese da. Lo siento en el alma... Partieron
muchos
amigos
que
tena",
revela
acongojado.
Con
ese
mismo
tono
meditabundo, entrega una ltima reflexin
sobre lo que vino despus del 11 de
septiembre: "Volver atrs me recuerda
muchas cosas bonitas, pero tambin que
pasaron muchas cosas feas. Uno trataba de
hacerse el tonto, pero tambin pensaba en
todo lo que ocurra. Que nunca ms suceda lo
que pas", cierra.

67. Seale
la
alternativa
que
completa,
correctamente y de acuerdo con el sentido del
texto, las lagunas de las lneas 06 y 13.
(A) A pesar de ello As pues
(B) Sin embargo

De esta forma

(C) A pesar de ello No obstante


(D) No obstante

Sin embargo

(E) Sin embargo

As pues

68. Considere las siguientes afirmaciones sobre el


contenido del texto.
I - La revista Estadio lleg hasta la edicin
nmero 1572.
II - La revista Estadio esconde tesoros del
ftbol chileno.
III- La revista Estadio tuvo una edicin el
martes 11 de septiembre de 1973.
Cules son correctas?
(A) Slo I.
(B) Slo II.
(C) Slo III.
(D) Slo I y II.
(E) Slo I y III.
69. Las palabras portada (l. 03), embargada
(l. 16) y se enter (l. 32) significan, en
portugus, respectivamente,
(A) capa, emocionada, soube.
(B) edio, forte, percebeu.
(C) edio, tnue, soube.
(D) capa, baixa, percebeu.
(E) capa, baixa, soube.

Adaptado de: <http://www.latercera.com/noticia/


deportes/2013/09/656-541858-9-el-triste-recuerdodel-goleador-que-fue-portada-de-la-revistaestadio-el-11-de.shtml>. Acceso en: 17 set. 2014.
UFRGS CV/2014 ESP

26

104

70. El pronombre la (l. 14) se refiere a

74. Un antnimo de la palabra acongojado (l. 43),


en lengua espaola, sera

(A) estrella (l. 06).


(B) historia (l. 07).

(A) acobardado.

(C) peculiaridad (l. 07).

(B) exultante.

(D) imagen (l. 11).

(C) compenetrado.

(E) figura (l. 17).

(D) dubitativo.
(E) atolondrado.

71. La frase A la fecha del golpe militar, era la


gran figura de Rangers (l. 16-17) se podra
reescribir como
(A) Al prepararse el golpe militar, era la gran
figura de Rangers.

75. La expresin hacerse el tonto (l. 49) podra


substituirse, en espaol, por

(B) Cuando aconteci el golpe militar, era la


gran figura de Rangers.

(A) adornar lo acontecido.


(B) distinguir lo acontecido.

(C) Tras el golpe militar, era la gran figura de


Rangers.

(C) colorear lo acontecido.

(D) Al ultimarse los preparativos del golpe


militar, era la gran figura de Rangers.

(E) soslayar lo acontecido.

(D) engalanar lo acontecido.

(E) Cuando acabaron los preparativos del


golpe militar, era la gran figura de
Rangers.
72. Si el trecho Nosotros regresamos el 9 de

septiembre a Chile. Me fui a Coronel (su


lugar de origen) el 10 de septiembre, y
viv el golpe all (l. 21-24) estuviera en la
tercera persona del plural, las formas verbales
de pasado que habra que cambiar seran
(A) regresan, se haban ido, vivieron.
(B) regresaron, se fueron, vivieron.
(C) regresaran, se fueron, viven.
(D) regresen, se haban ido, vivan.
(E) regresaran, se haban ido, vivieran.

73. El pronombre le (l. 28) se refiere a


(A) gente (l. 26).
(B) entrenamiento (l. 26).
(C) estadio (l. 27).
(D) tiempo (l. 28).
(E) artillero (l. 32).
UFRGS CV/2014 ESP

27

105

2011
INGLS
Instruo: As questes 51 a 55 esto relacionadas ao texto abaixo.
CAN YOU LEND
ME A DOLLAR,
SARGE?

I HATE TO SPEND
THE LAST OF MY
OWN MONEY. THEN
ID BE ........
TILL PAYDAY.

SORRY, BEETLE.
OUR STOMACHS
HAVE PLANS
FOR EVERY CENT
IVE GOT.

ME TOO. BUT I
NEED A MILKSHAKE
AND A HAMBURGER
IN THE WORST WAY.

ZERO WRITING
PHILOSOPHY?!
HA! HA! I GOTTA
SEE THIS!

LOOKS LIKE
HES TRYING
TO WRITE SOME
PHILOSOPHICAL
GRAFFITI ........
YOU WRITE.

Call up an old friend. Wash a window.


Take an ordinary object and find beauty
in it. Show a child how to whistle.
Think of three good things about
the person you are with and
tell him. Forgive a mistake.
Do what someone
else wants to do
today.
Be patient.

Want a better world? Pet a dog.


Plant a flower.
Smile at the bus driver.
Smile at a stranger. Go barefoot.
Pick up someone elses litter. Look for
funny shapes in the clouds.
Visit an old person.
Stop an argument.
Warm a
heart.

THIS OUGHTA
BE FUNNY!

Put yourself
in.anothers.place..
Saythank.you.with
meaning. Look
for truth..Inspire
someone. Lower your
voice. Make time for
a young person. Let
your.kindness......... .
Erase worry
and fear of the
unknown.
Have some fun.

THATS IT!
LETS GO FIND
ZERO!

1
THERE HE
IS... BUT
WHAT IS
HE
DOING?

NOBODYS DUMB
........ TO LEND
US MONEY.

I COULDNT
THINK OF
ANYTHING
VERY GREAT.

FOR
ME?!

Adaptado de: <http://www.praytoranimation.com/mbeetlebailey.jpg>. Acesso em: 20 out. 2010.

51. Assinale
a
alternativa
que
completa
corretamente as lacunas dos quadrinhos 2, 3,
4 e 8, nesta ordem.
(A) broke

still

(B) injured

enough as

(C) penniless a lot


(D) broke

52. Assinale com V (verdadeiro) ou F (falso) as


afirmaes abaixo, conforme estejam ou no
de acordo com o texto.

like comes out


came out

how coming out

enough like come out

(E) penniless still

as

to come out

( ) Beetle e Plato no tm dinheiro sequer


para comprar um lanche.
( ) Beetle e Plato procuram Zero para lhe
pedir dinheiro emprestado.
( ) Beetle e Plato encontram Zero escrevendo
pensamentos filosficos na parede.
( ) Beetle e Plato acham engraado o fato de
Zero escrever com muita rapidez em uma
parede.
A sequncia correta de preenchimento dos
parnteses, de cima para baixo,
(A)
(B)
(C)
(D)
(E)

UFRGS CV/2011 ING

V
F
V
F
F

V
V
F
F
V

V
V
F
V
F

F.
F.
V.
V.
F.
23

106

53. Considere o enunciado abaixo e as trs


propostas para complet-lo.
Ao lerem o que Zero escreveu na parede,
Beetle e Plato
1 - mudam de opinio a respeito dele.
2 - tentam convenc-lo a comprar-lhes um
lanche.
3 - confirmam suas suspeitas sobre ele.
Quais esto corretas, de acordo com o texto?
(A) Apenas 1.
(B) Apenas 2.
(C) Apenas 3.
(D) Apenas 1 e 2.
(E) 1, 2 e 3.
54. Associe as expresses da coluna da esquerda
sua melhor traduo, que se encontra na
coluna da direita.
(..).Go barefoot (q. 6)
(..).Forgive a mistake
(q. 7)
(..).Erase worry (q. 8)

1.-.Esquea um erro
2.-.Ande descalo
3.-.Livre-se.da.preocupao
4.-.Perdoe um erro
5.-.Faa um passeio

A sequncia correta de preenchimento


parnteses, de cima para baixo,

dos

(A) 3 1 4.
(B) 2 4 5.
(C) 5 1 3.

Instruo: As questes 56 a 64 esto relacionadas


ao texto abaixo.
01.
02.
03.
04.
05.
06.
07.
08.
09.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.

Beware. There is a new danger on the


streets. And you might not spot it until its too
late.
Pedestrians wearing iPod or MP3 music
player headphones have a habit of stepping
out into the road, oblivious to traffic.
Podestrians, as they have been called,
now account for nearly one in ten minor
accidents involving sudden braking and
shunts, according to ........ from an insurance
company.
Well over half of the ........ are described
as young people, teenagers or children.
We have seen a significant increase in
drivers citing such individuals as having been
a factor in accidents, a spokesman for the
company said.
The most common ........ involves a
podestrian stepping into the road without
looking properly and failing to hear an
oncoming vehicle.
This can force the driver to brake
suddenly, risking collision with the car behind.
And if a head full of music isnt bad
enough, some podestrians are talking on their
mobile phones at the same time.
'The problem of music players masking
the noise of cars can often be compounded
by the simultaneous use of mobile phones,
the spokesman said.
People have enjoyed listening to music on
foot ever since the first Walkmans were
introduced in the late 1970s. But 30 years on
there seems to be a rising number of
pedestrians who are isolated from traffic
noise.
Adaptado de: Daily Mail, 8 out. 2008.

(D) 5 2 1.
(E) 2 4 3.
55. A estrutura do caso possessivo, presente em
in anothers place (q. 8), a mesma que
ocorre em

56. Assinale
a
alternativa
que
preenche
corretamente as lacunas das linhas 10, 12 e
18, na ordem em que aparecem.

(A) Marys lost her pencil.


(B) The painters tools are in the box.
(C) The postmans finished his work.
(D) Their sons upset.

(A) computers effects

scene

(B) officials

doubts

event

(C) data

wrongdoers characteristic

(D) figures

culprits

(E) employees offenders

(E) Her daughters been ill.


24

scenario
solution

UFRGS CV/2011 ING

107

57. De acordo com o texto,


(A) o barulho do trfego torna difcil a
locomoo de pedestres.

60. Assinale a alternativa em que a forma verbal


est acompanhada da expresso que mais se
aproxima de seu significado no texto.

(B) tem havido reduo de acidentes nas ruas.

(A) Beware (l. 01)

Watch out

(C) h um novo tipo de ameaa segurana


nas ruas.

(B) spot (l. 02)

place in

(C) citing (l. 15)

regretting at

(D) failing (l. 20)

lacking of

(E) masking (l. 27)

showing off

(D) o excesso de jovens nas ruas est


causando mais acidentes.
(E) o uso de fones de ouvido por motoristas
jovens tem aumentado.
58. Assinale com V (verdadeiro) ou F (falso) as
seguintes afirmaes, conforme elas estejam
ou no de acordo com o texto.

61. Considere as seguintes afirmaes, sobre a


relao entre pronomes e os segmentos a que
eles se referem.

( ) Alm de ouvirem msica em fones de


ouvido, alguns pedestres falam, ao
mesmo tempo, ao celular.

1 - A palavra it no segmento spot it (l. 02),


refere-se a iPod or MP3 (l. 04).

( ) Segundo uma companhia de seguros, a


maioria dos pedestres comportam-se
adequadamente nas ruas.

2 - A palavra they (l. 07) refere-se a

Pedestrians wearing iPod or MP3


music player headphones (l. 04-05).

( ) No incio dos anos 70, foram introduzidos


os Walkmans, e as pessoas passaram a
escutar msica enquanto caminhavam.

3 - A palavra We (l. 14) refere-se a young


people, teenagers or children (l. 13).

( ) Nos ltimos 30 anos, o nmero de


pedestres que se isolam do rudo do
trfego diminuiu.

Quais esto corretas?

A sequncia correta de preenchimento dos


parnteses, de cima para baixo,

(B) Apenas 2.

(A) Apenas 1.

(C) Apenas 3.

(A) F V F V.

(D) Apenas 1 e 3.

(B) V F F V.

(E) 1, 2 e 3.

(C) F V F F.
(D) F V V V.

62. A traduo mais adequada para o


segmento braking and shunts (l. 9-10)

(E) V F F F.
59. Assinale
a
alternativa
que
preenche
corretamente a lacuna da frase abaixo.

(A) freada e derrapagens.

Since the introduction of iPod or MP3 music


player headphones many minor street
accidents ........ .

(B) derrapagem e freadas.

(A) occurs

(D) coliso e derrapagens.

(B) is occurring

(E) coliso e desvios.

(C) freada e desvios.

(C) had occurred


(D) have occurred
(E) were occurring
UFRGS CV/2011 ING

25

108

63. Assinale a alternativa em que a forma -ing


exigida pela mesma razo gramatical que
determina seu uso na forma verbal looking
(l. 20).
(A) stepping (l. 05)
(B) oncoming (l. 21)
(C) talking (l. 25)
(D) listening (l. 31)
(E) rising (l. 34)
64. A palavra compounded (l. 28) poderia ser
substituda, sem alterao do sentido
contextual, por
(A) comprised.
(B) worsened.
(C) covered.
(D) disguised.
(E) mistaken.

25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.

Adapted from: SWARUP, Vikas. Slumdog Millionaire.


2005. p. 148-149.

Instruo: As questes 65 a 75 esto relacionadas


ao texto abaixo.
01.
02.
03.
04.
05.
06.
07.
08.
09.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.

New Dehlis Paharganj rail station is


humming with sound and crawling with
people. The gray platforms are bathed in
white light. The train engines belch smoke
and whistle like impatient bulls.
If you were to search for me in the
crowded maze, where would you look? You
would probably try to find me among the
dozens of street children who are stretched
out on the smooth concrete floor in various
stages of rest and slumber. You might even
imagine me as an adolescent vendor,
peddling plastic bottles containing tap water
from the stations toilet as pure Himalayan
mineral water. You could visualize me as one
of the sweepers in dirty shirts and torn pants
shuffling ........ the platform, with a long
swishing broom transferring dirt from the
pavement ........ the track. Or you could look
for me among the regiments of reduniformed porters bustling about with heavy
loads on their heads.
Well, think again, because I am neither a
vendor, nor porter, nor sweeper. Today I am

a genuine passenger, travelling to Mumbai, in


the sleeper class no less, and with a proper
reservation. I am wearing a starched white
bush shirt made 100% cotton and Levis
jeans-yes, Levis jeans, bought from the
Tibetan Market. I am walking purposefully
........ platform number five to board the
Paschim Express for Mumbai. There is a
porter trudging along by my side carrying a
light-brown suitcase on his head. The porter
has been hired by me, and the suitcase on his
head belongs to me. The suitcase does not
contain any money. I have heard too many
stories about robbers on trains that drug you
at night and make off with your belongings to
take the chance of keeping the most precious
cargo of my life-my salary from the Taylors-in
my suitcase. It is inside my underwear. I take
a quick look ........ the loose notes in my front
pocket. I reckon I will have just enough to
take an auto-rickshaw from Bandra Terminus
to Salims room in the Ghatkopar slum. Wont
Salim be surprised to see me arrive in a
three-wheeler instead of on the local train?
And when he sees the game I bought for
him, I hope he doesnt faint from happiness.

65. Select the alternative which correctly completes


the blanks in lines 17, 19, 31 and 43.
(A) to

along out

toward

(B) to

along out

down

(C) across onto toward at


(D) to

along toward with

(E) across onto through off

66. According to the text, the narrator has money


because he

26

(A) has received an inheritance.


(B) has won an award.
(C) has misappropriated the money.
(D) has found a large sum of money.
(E) has earned it.
UFRGS CV/2011 ING

109

67. We can deduce, after reading the text, that


the narrators feelings are of

70. Consider the segment The train engines belch


smoke (l. 04).
Which alternative below presents the same
sentence structure?

(A) contempt.
(B) sorrow.
(C) condescension.

(A) I carried out my promise.

(D) fulfilment.

(B) The coach is at the end of the train.

(E) regret.

(C) I kept my mouth shut.


(D) I tipped him a further two rupees.

68. Salim would be surprised to see the narrator


because the narrator

(E) He was a rather strong man.


71. Observe the segments below.

(A) has become a vendor.


(B) is wearing Levis jeans.

1 - [...].various stages of rest and slumber


(l. 10-11)

(C) is using hired transportation.


(D) has arrived by train.

2 - [...].pure Himalayan mineral water


(l. 14-15)

(E) is carrying a suitcase.

3 - [...].the regiments of red-uniformed


porters (l. 20-21)

69. Consider the conditional sentence below and


the sentences following it.

The main words of the segments are,


respectively,

If you were to search for me in the


crowded maze, where would you look?

(A) stages Himalayan porters.

(l. 06-07)

(B) rest and slumber mineral regiments.

1 - If I offered you a piece of cake, will you


accept it?

(C) rest and slumber mineral porters.


(D) stages water regiments.

2 - If I had gone to the party, would I have


met her?

(E) various water red-uniformed.

3 - If you studied more, would you succeed?


72. The modal verbs might (l. 11) and could (l. 15)
are being used to express

4 - If I go to the concert, would I enjoy it?


Which of the following
grammatically correct?

alternatives

are

(A) possibility.
(B) ability.

(A) Only 1 and 2.

(C) necessity.

(B) Only 1 and 3.

(D) obligation.

(C) Only 2 and 3.

(E) request.

(D) Only 2 and 4.


(E) 1, 2, 3 and 4.
UFRGS CV/2011 ING

27

110

73. The word sleeper (l. 26) has in the text the
same function as
(A) slumber (l. 11).

74. The segment that drug you at night and


make off with your belongings (l. 38-39)
is used to refer to
(A) passenger (l. 25).

(B) sweeper (l. 24).

(B) porter (l. 33).

(C) passenger (l. 25).

(C) stories (l. 38).

(D) proper (l. 26).

(D) robbers (l. 38).

(E) three-wheeler (l. 48).

(E) salary (l. 41).

75. Consider the following passages extracted or adapted from the text.
1 - I reckon I will have just enough to take an auto-rickshaw (l. 44-45)
2 - I hope Salim doesnt faint from happiness (l. 50)
Which alternative correctly and respectively completes the blanks of the two passages below?
1 - The narrator said he ........ he ........ just enough to take an auto-rickshaw.
2 - The narrator said he ........ Salim ........ from happiness.
(A) reckons

had

hoped

didnt faint

(B) reckoned

would have

hoped

didnt faint

(C) reckons

would have

hopes

faints

(D) reckoned

will have

had hoped fainted

(E) has reckoned had

hopes

28

fainted

UFRGS CV/2011 ING

111

2012
INGLS
Instruo: As questes 51 a 59 esto relacionadas a um soneto de William Shakespeare. Na coluna da
esquerda, consta o texto original, escrito em lngua inglesa do sculo XVII; na da direita,
uma parfrase deste soneto em ingls contemporneo.
Texto original
01.
02.
03.
04.
05.
06.
07.
08.
09.
10.
11.
12.
13.
14.

Parfrase

My mistress' eyes are nothing like the sun;


Coral is far more red than her lips' red;
If snow be white, why then her breasts are dun;
If hairs be wires, black wires grow on her head;
I have seen roses damaskd, red and white,
But no such roses see I in her cheeks;
And in some perfumes is there more delight
Than in the breath that from my mistress reeks:
I love to hear her speak, yet well I know
That music hath a far more pleasing sound;
I grant I never saw a goddess go;
My mistress, when she walks, treads on the ground.
And yet, by heaven, I think my love as rare
As any she belied with false compare.

My mistress's eyes are nothing like the sun;


Coral is far more red than her lips;
If snow is white, then her breasts are a brownish gray;
If hairs are like wires, hers are black and not golden.
I have seen damask roses, red and white [streaked],
But I do not see such colors in her cheeks;
And some perfumes give more delight
Than the horrid breath of my mistress.
I love to hear her speak, but I know
That music has a more pleasing sound.
I've never seen a goddess walk;
But I know that my mistress walks only on the ground.
And yet I think my love as rare
As any woman who has been misrepresented by
[ridiculous comparisons.

SHAKESPEARE, William. Soneto 130. Disponvel em: <http://www.shakespeare-online.com/>.


Acesso em: 01 dez. 2011.

51. A leitura do soneto permite concluir que o eu-lrico

(A) idealiza a figura da mulher amada, pois caracteriza sua beleza fsica valendo-se de comparaes
com elementos da natureza.
(B) enxerga a mulher amada como tendo qualidades superiores a deusas, como ilustra a passagem
em que ele comenta que, ao contrrio das deusas, sua amada caminha no cho.
(C) afirma que no precisamos lanar mo de comparaes infundadas para descrever a beleza de
quem amamos.
(D) declara que seu sentimento pela mulher amada, mesmo que ela no tenha os traos da beleza
idealizada, especial.
(E) admite ser incapaz de expressar publicamente o amor desbaratado que lhe consome a alma
quando contempla o rosto singular da amada.

23

UFRGS CV/2012 ING

112

52. Assinale a alternativa que apresenta a ordem correta em que so descritas, no soneto, algumas das
caractersticas da mulher amada pelo poeta.
1
2
3
4

(A)
(B)
(C)
(D)
(E)

o perfume
os lbios
o cabelo
as faces rosadas
2
1
3
2
2

4
3
2
3
4

3
2
1
4
1

1
4
3
1
3

53. Considere o enunciado abaixo e as trs propostas para complet-lo.


A leitura do verso My mistresss eyes are nothing like the sun (l. 01) permite concluir que os
olhos da pessoa que o poeta ama
1 - em nada ao sol se parecem.
2 - como o sol, no se parecem com nada.
3 - nada so sob a luz do sol.
Quais propostas esto corretas, de acordo com o soneto?
(A)
(B)
(C)
(D)
(E)

Apenas 1.
Apenas 2.
Apenas 3.
Apenas 1 e 2.
1, 2 e 3.

54. O significado que mais se aproxima em portugus do sentido que a palavra delight (l. 07) tem no
soneto
(A)
(B)
(C)
(D)
(E)

brandura.
frescor.
deleite.
delicadeza.
suavidade.

55. O sufixo -ess presente em goddess (l. 11) tambm ocorre em


(A)
(B)
(C)
(D)
(E)

stress.
wireless.
actress.
seriousness.
less.

56. Assinale a alternativa que apresenta o significado que mais se aproxima do sentido que o segmento
And yet (l. 13) tem no soneto.
(A)
(B)
(C)
(D)
(E)

alm disso
assim como
e assim
afora disso
mesmo assim

24

UFRGS CV/2012 ING

113

Instruo: As questes 57 a 68
relacionadas ao texto abaixo.
01.
02.
03.
04.
05.
06.
07.
08.
09.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.

esto

Facebook is the worlds largest social


network, with 800 million users worldwide as
of September 2011.
More than any other company, it has
defined what .. see as the social' era of
the Internet, in which connections made
among people replace algorithm-driven
searches. And its policies, more than any
others, seem to be driving the definition of
privacy in this new age.
Every day, Facebook users comment or
press the like button more than 2 billion
times and upload more than 250 million
photos. The McKinsey Global Institute has
estimated that the networks users post 30
billion pieces of content .. month.
The company, founded in 2004 by a
Harvard sophomore, Mark Zuckerberg, began
life catering first to Harvard students and then
to all high school and college students. It has
since evolved into a broadly popular online
destination used by teenagers and adults of
all ages. In country after country, Facebook
has cemented itself as the leader, often
displacing other social networks.
It is .. surprise that Facebook has
become one of the titans of the Internet,
challenging even Google with its vision of a
Web tied together by personal relationships
and recommendations, rather than by search
algorithms. In a major expansion, Facebook
has spread itself across other Web sites by
offering members the chance to Like
something share it with their network
without leaving the Web page they are on.
At the Facebook developer conference in
September, the company announced the
release of a product called Timeline, which
offers a highly visual view of a users
Facebook profile and organizes content into
photos, events and apps, all based on a
timeline view that stretches back to the
beginning of a users time on Facebook.
Timeline is designed to work on mobile
devices, too.

57. Assinale a alternativa que preenche correta


e respectivamente as lacunas das linhas 05, 16 e
26.
(A)

some

every no

(B)

some

all

(C)

some

every none

(D)

any

each

(E)

any

every none

no
no

58. A pergunta que pode ser respondida com


base nas informaes do texto
(A) How old was Mark Zuckerberg in 2004?
(B) When was the Facebook founded?
(C) What makes the social network enter a
new era?
(D) Who directs
Institute?

the

McKinsey

Global

(E) Where was Mark Zuckerberg born?

59. Assinale a alternativa que apresenta uma


inferncia correta de acordo com o quarto
pargrafo do texto (l. 17-25).
(A) O Google a mais completa rede de
busca da atualidade.
(B) O Facebook consolidou-se como a rede
social mais utilizada em todo o mundo.
(C) O Facebook iniciou suas atividades com o
objetivo de atender a estudantes de
ensino mdio.
(D) O Facebook prioriza as relaes pessoais
do pblico jovem.
(E) O Facebook foi idealizado visando auxiliar
exclusivamente o pblico da Universidade
de Harvard.

Adaptado de: WYLD, Adrian. Facebook.


Disponvel em: http://topics.nytimes.com>.
Acesso em: 01 dez. 2011.

25

UFRGS CV/2012 ING

114

60. Considere o enunciado abaixo e as trs


propostas para complet-lo.

63. Considere as afirmaes que seguem.


I - O pronome Its (l. 08) refere-se a people
(l. 07).
II - O pronome its (l. 28) refere-se a
Facebook (l. 26).
III- O pronome which (l. 38) refere-se a
product (l. 38).

De acordo com o texto, o Facebook


1 - a maior rede social do mundo.
2 - foi idealizado por um aluno da Universidade
de Harvard.
3 - criou uma ferramenta visual que permite
organizar cronologicamente todas as informaes disponibilizadas pelos usurios.

Quais esto corretas?

Quais propostas esto corretas?


(A)
(B)
(C)
(D)
(E)

(A)
(B)
(C)
(D)
(E)

Apenas 1.
Apenas 2.
Apenas 3.
Apenas 1 e 3.
1, 2 e 3.

61. As tradues mais adequadas para as


palavras replace (l. 07), policies (l. 08) e
conference (l. 36), no contexto em que se
encontram, so, respectivamente,

Apenas I.
Apenas III.
Apenas I e II.
Apenas II e III.
I, II e III.

64. Assinale a alternativa em que as trs palavras


designam conceitos do mesmo campo de
significao.
(A)
(B)
(C)
(D)
(E)

(A) reposiciona, polticas e congresso.


(B) substitui, polticas e anlise.
(C) substitui, polticas e congresso.

privacy (l. 10) emergency secret


sophomore (l. 18) senior freshman
catering (l. 19) food tourism
timeline (l. 42) figure period
mobile (l. 44) furniture portability

(D) reconfigura, polcias e anlise.


(E) reconfigura, polticos e conferncia.

65. Considere o enunciado abaixo e as trs


propostas para complet-lo.

62. Uma expresso composta da mesma forma


que algorithm-driven searches (l. 07-08)

(A) high-tech development.


(B) toll-free number.

A melhor traduo para a expresso In


country after country (l. 23)
1 - em um pas e depois em outro.
2 - de pas em pas.
3 - neste pas e em outro.
Quais propostas esto corretas, de acordo
com o texto?

(C) part-time job.


(D) two-seater watercraft.

(A)
(B)
(C)
(D)
(E)

(E) gas-powered engine.

26

Apenas 1.
Apenas 2.
Apenas 3.
Apenas 1 e 2.
1, 2 e 3.

UFRGS CV/2012 ING

115

66. Assinale a alternativa que apresenta uma palavra em que o sufixo -er desempenha a mesma funo
que exerce na formao da palavra developer (l. 36).
(A)
(B)
(C)
(D)
(E)

bigger
danger
power
follower
offer

67. Assinale a alternativa que preenche corretamente a lacuna do enunciado abaixo.


The passive version of the sentence [] the company announced the release of a product
called Timeline (l. 37-38) is the sentence [...] the release of a product called Timeline
by the company.
(A) was announced
(B) had been announced
(C) were being announced
(D) have been announced
(E) was being announced
68. A melhor traduo para a palavra highly (l. 39), como empregada no texto,
(A) altamente.
(B) favoravelmente.
(C) especial.
(D) levemente.
(E) completa.

27

UFRGS CV/2012 ING

116

Instruction: Questions 69 to 71 are related to the comic strip below.

4
Available: <http://3.bp.blogspot.com/>. Access:
December 1, 2011.

69. Select the correct alternative to fill the gap in panel 1.


(A) At the time.
(B) No yet.
(C) No longer.
(D) Just now.
(E) Right now.
70. According to the comic strip, Calvin
(A) says that his parents are shaking with fright.
(B) watches the stars during the night.
(C) makes his friend Hobbes very worried about him.
(D) has the courage to confront some UFOs.
(E) expects to find an unidentified flying object.

71. The best translation for sooner or later (panel 2) is


(A) antes tarde do que nunca.
(B) logo cedo ou mais tarde.
(C) mais cedo ou mais tarde.
(D) o mais cedo possvel.
(E) quanto mais cedo melhor.

28

UFRGS CV/2012 ING

117

Instruction: Questions 72 to 73 are related to


the comic strip below.

Available: <http://2.bp.blogspot.com/>. Access: December 1, 2011.

72. Select the correct alternative to fill the gaps in


panels 1 and 2, respectively.
(A)
(B)
(C)
(D)
(E)

extremely
hopelessly
finally

irremediably
slightly

and

the

The best translations into Portuguese for


1 - be prepared (panel 2) is estamos
preparados.
2 - with this full backpack (panel 3) is
com esta mochila cheia.
3 - Just so long as we dont get hungry
(panel 4) is S enquanto no
sentirmos fome.

Adapted from: <http://1.bp.blogspot.com/>. Access: December 1,


2011.

74. Select the correct alternative to fill the gap in


panel 4.
(A)
(B)
(C)
(D)
(E)

Unfortunately
Fortunately
Incredibly
Unhappily
surprisingly

73. Consider the sentence below


suggestions to complete it.

Instruction: Questions 74 to 75 are related to


the comic strip below.

defend
inquired
excused
disconnect
accused

75. Consider the following sentence and the three


alternatives to complete it.
Calvin said, I will never teach maths. In the
indirect speech this becomes
1 - Calvin said that he would never teach
maths.
2 - Calvin said that he is never going to teach
maths.
3 - Calvin said that he was never going to
teach maths.

Which of the suggestions above can be


considered correct according to the text?

Which of the alternatives above can be


considered grammatically correct?

(A)
(B)
(C)
(D)
(E)

(A)
(B)
(C)
(D)
(E)

Only 1.
Only 2.
Only 3.
Only 2 and 3.
1, 2 and 3.

Only 1.
Only 2.
Only 1 and 2.
Only 2 and 3.
1, 2 and 3.
29

UFRGS CV/2012 ING

118

2013
INGLS
Instruo: As questes 51 a 58
relacionadas ao texto abaixo.
01.
02.
03.
04.
05.
06.
07.
08.
09.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.

51. Assinale
a
alternativa
que
corretamente a lacuna da linha 24.
esto

An Amazonian tribe has been discovered


that has no concept of time or dates.
The Amondawa people of Brazil do not
even have words for "time", "week", "month"
or "year", said Chris Sinha, of the University
of Portsmouth.
He argues that it is the first time scientists
have been able to prove time is not a deeply
entrenched universal human concept, as
previously thought.
According to Professor Sinha we can now
say without doubt that there is at least one
language and culture which does not have a
concept of time as something that can be
measured, counted or talked about in the
abstract, which doesn't mean that the
Amondawa are "people outside time": they
live in a world of events, rather than seeing
events as being embedded in time.
There are no words for such concepts as
"next week" or "last year", only divisions of
day and night and rainy and dry seasons. It
was also found nobody in the community has
an age. .. , they change their names to
reflect their life-stage and position within their
society. For example, a little child will give up
his or her name to a newborn sibling and take
on a new one.
Professor Sinha said: "We have so many
metaphors for time and its passing - we think
of time as a 'thing' - we say 'the weekend is
nearly gone', 'she's coming up to her exams',
'I haven't got the time', and so on, and we
think such statements are objective, but they
aren't. We've created these metaphors and
they have become the way we think. The
Amondawa don't talk like this and don't think
like this, unless they learn another language.
For these fortunate people time isn't money,
they aren't racing against the clock to
complete anything, and nobody is discussing
next week or next year. You could say they
enjoy a certain freedom".

Adaptado de: Daily Mail, 20 mai 2011. Disponvel em:


<http://www.dailymail.co.uk/sciencetech/article1389070/Amazon-Amondawa-tribe-age-words-likemonth-year-dont-exist.html#ixzz25dEZL89p>.
Acesso em: 05 set. 2012.

24

(A)
(B)
(C)
(D)
(E)

preenche

Because
Whereas
Meanwhile
Therefore
Instead

52. Considere as seguintes afirmaes em relao


ao contedo do texto.
I - A descoberta dos Amondawa e de sua
lngua importante para a cincia, pois
demonstra que o conceito de tempo
relativo e no universal.
II - A lngua dos Amondawa no dispe de
palavras que denotem o passar do tempo,
por isso eles no registram fases, idades
ou perodos, apenas os eventos vividos.
III- O Prof. Sinha acredita que, ao
aprenderem outras lnguas, os Amondawa
podem assimilar noes de temporalidade
de outras culturas.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas
Apenas
Apenas
Apenas
Apenas

I.
II.
I e II.
I e III.
II e III.

53. Assinale a alternativa que apresenta uma


inferncia correta em relao ao contedo do
texto.
(A) Os Amondawa no reconhecem o
amadurecimento e o envelhecimento dos
membros da tribo, por no possurem
palavras que denotem idade.
(B) O prof. Sinha considera libertadora certa
limitao lingustica, em relao ao
planejamento de aes dos membros da
tribo Amondawa.
(C) A inexistncia de datas, na cultura
Amondawa, impede o registro de eventos
passados.
(D) As culturas que usam metforas para a
passagem do tempo so mais avanadas
e objetivas.
(E) Os Amondawa so, sem dvida, o nico
povo que no entende o tempo como
algo que possa ser medido ou contado de
forma abstrata.
UFRGS CV/2013 ING

119

54. Considere o trecho abaixo e as subsequentes


propostas de sua reescrita.

An
Amazonian
tribe
has
been
discovered that has no concept of time
or dates (l. 01-02).

55. Assinale a alternativa que apresenta a traduo


mais adequada para o trecho scientists have
been able to prove (l. 07-08).
(A) cientistas tm sido capazes de comprovar
(B) cientistas tm sido hbeis em comprovar

I - An Amazonian tribe that has no concept


of time or dates has been discovered.

(C) cientistas esto podendo comprovar

II - An Amazonian tribe which has no concept


of time or dates has been discovered.

(D) cientistas puderam comprovar


(E) cientistas comprovaram

III- An Amazonian tribe what has no concept


of time or dates has been discovered.
Quais propostas so gramaticalmente corretas
e preservam o sentido do trecho original?
(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e II.
(E) Apenas II e III.

56. Assinale com V (verdadeiro) ou F (falso) as seguintes afirmaes sobre segmentos do texto.
( ) O pronome which (l. 13) refere-se a one language and culture (l. 12-13).
( ) O pronome they (l. 17) refere-se a the Amondawa (l. 16-17).
( ) O pronome its (l. 30) refere-se a time (l. 30).
( ) O pronome they (l. 42) refere-se a next week or next year (l. 42).
A sequncia correta de preenchimento dos parnteses, de cima para baixo,
(A) V F F V.
(B) V V F V.
(C) V V V F.
(D) F F V F.
(E) F V V F.
57. Considere a proposta de substituio de child
(l. 26) por children.

58. No texto, a palavra sibling (l. 27) significa

Nesse contexto, assinale a alternativa que


apresenta, respectivamente, o nmero de
palavras que devem ser suprimidas e o
nmero de palavras que devem ser alteradas,
para fins de concordncia.
(A) uma

trs

(B) trs

seis

(A) parent.
(B) brother or sister.
(C) friend.
(D) villager.
(E) companion.

(C) quatro seis


(D) seis

trs

(E) seis

quatro
25

UFRGS CV/2013 ING

120

Instruo: As questes 59 a 66 esto relacionadas ao texto abaixo.


01. Advice Gratis to Certain Women By a Woman
02.
03.
04.
05.

O, my strong-minded sisters, aspiring to vote,


And to row with your brothers, all in the same boat,
When you come out to speak to the public your mind,
Leave your tricks, and your airs, and your graces behind!

06.
07.
08.
09.

For instance, when you by the world would be seen


As reporter, or editor (first-class, I mean),
I think just to come to the point in one line
What you write will be finer, if 'tis not too fine.

10.
11.
12.
13.

Pray, don't let the thread of your subject be strung


With "golden," and "shimmer," "sweet," "filter," and "flung;"
Nor compel, by your style, all your readers to guess
You've ........ looking up words Webster marks obs.

14.
15.
16.
17.

And another thing: whatever else you may say,


Do keep personalities out of the way;
Don't try every sentence to make people see
What a dear, charming creature the writer must be!

18.
19.
20.
21.

Don't mistake me; I mean that the public's not home,


You must do as the Romans do, when you're in Rome;
I would have you be womanly, while you are wise;
'Tis the weak and the womanish tricks I despise.

22.
23.
24.
25.

'Tis a good thing to write, and to rule in the state,


But to be a true, womanly woman is great:
And if ever you come to be that, 'twill be when
You can cease to be babies, nor try to be men!
Adaptado de: CAREY, Phoebe. Advice Gratis to Certain Women. In: RATTINER, Susan (ed.). Great Poems by
American Women: An Anthology. Mineola: Dover Thrift, 1998. p. 72.

59. Assinale a alternativa que completa corretamente a lacuna da linha 13.


(A) be
(B) been
(C) being
(D) to be
(E) are

26

UFRGS CV/2013 ING

121

60. Publicado na segunda metade do sculo XIX,


o poema traduz atitudes e opinies pessoais
da autora em relao ao ento emergente
movimento feminista nos EUA.

62. Uma expresso composta da mesma forma que


strong-minded sisters (l. 02)
(A) heart-felt apologies.
(B) long-term consequences.

Com base nesse contexto e na leitura do


texto, assinale a alternativa correta.

(C) never-ending stories.

(A) A autora ridiculariza o movimento


feminista, ao afirmar que suas defensoras
tentam ser homens e comportam-se de
forma agressiva.

(E) deep-frozen foods.

(D) coffee-table books.

63. O verbo modal must (l. 17) estabelece uma


relao de

(B) A autora aconselha suas leitoras a no se


deixarem levar pela retrica feminista,
assumindo que o lugar da mulher o lar
e no os espaos pblicos.

(A) obrigao.

(C) A autora, ao invocar o provrbio que pode


ser traduzido por Quando em Roma, faa
como os romanos, prope a inutilidade
das reivindicaes feministas, defendendo
que as mulheres atenham-se ao que
socialmente esperado delas.

(D) permisso.

(D) A autora identifica-se com a causa feminista,


mas sugere s companheiras de luta que
evitem atitudes e discursos masculinizados
ou infantis.
(E) A autora, sendo uma feminista que luta
pelo direito ao voto, sugere s suas
irms que no permitam que mulheres
submissas e frgeis venham a pblico
expressar suas ideias, pois isso prejudica
o movimento sufragista.
61. Considere as seguintes propostas de reescrita
do ttulo Advice Gratis to Certain Women
(l. 01).

(B) sugesto.
(C) deduo.
(E) proibio.
64. Assinale a alternativa que apresenta uma
expresso de sentido equivalente ao de Don't
mistake me (l. 18), conforme empregada no
texto.
(A) Don't mislead me.
(B) Don't get me wrong.
(C) Don't get in my way.
(D) Watch out.
(E) Mark my words.
65. Assinale a frase em que s est empregado com
o mesmo sentido e com a mesma funo
sinttica que em I mean that the public's not
home (l. 18).
(A)
(B)
(C)
(D)
(E)

I - A Free Advice to Certain Women


II - Free Advice to Certain Women
III- Free Pieces of Advice to Certain Women
Quais propostas mantm o sentido do ttulo
sem prejuzo da correo gramatical?
(A) Apenas I.

She's the best singer of her generation.


My kid's classmates aren't friendly.
The store's opened a new branch.
Aviation's no-smoking policy is very strict.
My wife's not arrived yet.

66. Qual das alternativas abaixo poderia


substituir o trecho You can cease to be
babies (l. 25), sem alterao de sentido ou
prejuzo da correo gramatical?

(B) Apenas II.

(A)
(B)
(C)
(D)
(E)

(C) Apenas III.


(D) Apenas II e III.
(E) I, II e III.

You
You
You
You
You

can stop being babies.


can to stop being babies.
can stop to be babies.
can stop be babies.
can stopping to be babies.
27

UFRGS CV/2013 ING

122

Instruo: As questes 67 a 75
relacionadas ao texto abaixo.

esto

67. Select the alternative which correctly fills in


the blank in line 02.

01. Txting: frNd or foe?

(A) had

02.
03.
04.
05.
06.
07.
08.
09.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.

(C) would have

(B) have

If I ........ a pound for every time I heard


someone predicting a language disaster
because of a new technological development,
I would be a very rich man. If I were a time
traveller, my bank balance would have started
to grow with the arrival in the Middle Ages of
printing, thought by many to be the invention
of the devil. It would have increased with the
telegraph, telephone and broadcasting. And I
would have been able to retire on the profits
from text messaging.
All the popular beliefs about texting are
wrong. It isnt just used by the young
generation: the vast majority of texts
circulating in cyberspace are among adults,
especially by and to institutions.
Only ........ very tiny part of text messaging
uses
a
distinctive
orthography.
The
abbreviations are not a totally new
phenomenon. Young people dont use them in
essays, nor in exam scripts. And research is
piling up that text messaging helps rather
than hinders literacy. Texting has, indeed,
added a new dimension to language use, but
its long-term impact on existing varieties of
language is negligible. It is not a disaster.
The popular impression is quite the
opposite. People think that the written
language seen on mobile phone screens is
new and alien. It has been labelled textese,
slanguage, and a digital virus. It has been
described as foreign and outlandish.
However, ........ most striking characteristic
of text messages is the combination of
standard and non-standard features. Although
many texters like to be different and enjoy
breaking linguistic rules, they also know they
need to be understood. There is no point in
paying for a message if it breaks so many
rules that it ceases to be intelligible. There is
always ........ unconscious pressure to use the
standard orthography.

(D) will have


(E) to have
68. Select the alternative which correctly fills in
the blanks in lines 18, 34 and 42, in this
order.
(A) a

the

(B) the a

an

(C) the the

(D) an

an

the

(E) a

the

an

69. According to the text, David Crystal believes


text messaging
(A) is a disaster that can make him rich.
(B) seems to be revolutionary, but has not
brought anything really new to languages.
(C) is mostly used by young people and
influences their academic writing.
(D) is an interesting and rich phenomenon,
but its impact is limited.
(E) is a revolutionary process that breaks
linguistic rules.
70. Consider the statements below.

Adapted from: CRYSTAL, David. Txting: frNd or foe? The


Linguist, v. 47, n. 06, Dec. 2008/Jan 2009. Available at:
<http://www.davidcrystal.com/DC_articles/
Internet16.pdf>. Access on: Sept 09, 2012.

I - Research indicates that text messages


harm languages by breaking their
grammar and spelling rules.
II - Text messaging is a digital virus used
mostly by young people.
III- Texting is only one out of a variety of
technological developments that have had
an impact in the way languages are used.
Which are correct, according to the text?
(A) Only I.
(B) Only II.
(C) Only III.
(D) Only I and III.
(E) I, II and III.

28

UFRGS CV/2013 ING

123

71. Select the alternative that presents the correct references for the pronouns It (l. 09), them (l. 21)
and its (l. 26), according to the text.
(A) bank balance (l. 06)

phenomenon (l. 21) Texting (l. 24)

(B) bank balance (l. 06)

abbreviations (l. 20) language use (l. 25)

(C) bank balance (l. 06)

abbreviations (l. 20) Texting (l. 24)

(D) invention of the devil (l. 08-09) phenomenon (l. 21) language use (l. 25)
(E) invention of the devil (l. 08-09)

abbreviations (l. 20) Texting (l. 24)

72. Select the best translation for the word


hinders (l. 24) as it is used in the text.

74. Select the alternative in which the suffix ish


has the same meaning and function as in
outlandish (l. 33).

(A) impossibilita
(B) sugere

(A) fish

(C) favorece

(B) parish

(D) nega

(C) womanish

(E) atrapalha

(D) Spanish
(E) anguish

sentence It has been labelled


textese, slanguage, and a digital
virus (l. 31-32) could be rewritten as

73. The

75. The word Although (l. 36) can be replaced,


without any change in form or meaning, by

(A) Critics have labelled it textese,


slanguage, and a digital virus.

(A) Though.

(B) Critics have been labelled it textese,


slanguage, and a digital virus.

(C) However.

(C) Critics have being labelling it textese,


slanguage, and a digital virus.

(E) In spite of.

(B) Despite.
(D) Even so.

(D) It
was
being
labelled
textese,
slanguage, and a digital virus.
(E) It was labelled textese, slanguage and
a digital virus.

29

UFRGS CV/2013 ING

124

2014
INGLS
Instruo: As questes 51 a 58
relacionadas ao texto abaixo.
01.
02.
03.
04.
05.
06.
07.
08.
09.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.

esto

Britain has met the heir who will certainly


change the face of monarchy for ever. Kate
and Williams son enters this world as a Royal
Highness, destined to be king of his country.
Though his mother is a Duchess, the title
........ disguise the fact that there has never
been a royal child quite like Kates. For while
William descends from a line of monarchs,
this baby boys maternal grandparents once
worked for British Airways and now run their
own company.
This new prince will become the first
British monarch with working-class blood
running through his veins. Monarchy these
days is a precarious business, and increasingly
hard to justify not only in terms of the funds
taxpayers donate to the Crown, but in a wider
world in which royal families seem ever more
anachronistic. This baby has arrived at a time
of profound social change and evolution
........ is why I believe a royal child with
middle-class antecedents can provide the
social alchemy that will secure the future of
the House of Windsor.
William and Kate, a modern couple, lived
together quite openly for several years before
their marriage, a sensible decision condoned
by the Queen, which ........ been seen as
unthinkable less than a decade earlier. This
was after prince Charles had moved in with
his divorced former mistress, Camila Parker
Bowles, a situation that would have been
equally unacceptable a few years ago.
All this evidences a rapidly evolving
monarchy. Who would have suspected that
the Queen would have been seen pretending
to parachute into the Olympic stadium with
James Bond? And who ........ predict how far
this process of evolution will have travelled by
the time the new prince reaches the throne?
From the pit to the Palace in three
generations? Surely it is the perfect fairytale
for a nation that grows more middle-class by
the year.

51. Assinale a alternativa que preenche, correta e


respectivamente, as lacunas das linhas 06, 21
e 38.
(A) cannot

which can

(B) cant

than

will

(C) can

that

wont

(D) should

which must

(E) have

that

can

52. Assinale
a
alternativa
que
corretamente a lacuna da linha 28.

completa

(A) was
(B) should
(C) would
(D) can have
(E) would have
53. Considere as seguintes afirmaes a respeito
do texto.
I - O fato de o filho de William e Kate ter
antecedentes da classe trabalhadora pode
tornar incerto o futuro da monarquia.
II - As mudanas sociais que ocorrem no
Reino Unido refletem-se na famlia real e
tm alterado algumas de suas tradies.
III- O fato de a Rainha Elizabeth ter aceito
participar de uma encenao nas
Olimpadas comprova a evoluo da
monarquia.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas II e III.
(E) I, II e III.

Adaptado de: THORTON, Michael. A very middle class


baby who will secure the future of the royal family.
Daily Mail. 22 jul 2013. Disponvel em: < http://www.
dailymail.co.uk/news/article-2374279/Kate-Middletongives-birth-middle-class-Royal-baby-boy-securemonarchys-future.html>. Acesso em: 06 set. 2013.
UFRGS CV/2014 ING

22

125

54. Assinale com V (verdadeiro) ou F (falso) as


afirmaes abaixo, de acordo com o sentido
do texto.

56. Associe as palavras da coluna da esquerda s


suas respectivas tradues, na coluna da
direita, de acordo com o sentido que tm no
texto.

( ) A existncia da monarquia, cada vez


mais, precisa ser justificada em funo de
seu alto custo coberto pelos impostos.

( ) sensible (l. 27)


( ) condoned (l. 27)

( ) A classe mdia est, gradativamente,


diminuindo no Reino Unido.

( ) pretending (l. 36)

( ) O novo beb real, em virtude de sua


ascendncia, poder ser o trunfo da
permanncia da famlia real.

1.
2.
3.
4.
5.
6.

simulando
sensvel
aceita
pretendendo
sensata
condenada

A sequncia correta de preenchimento dos


parnteses, de cima para baixo,

( ) O casamento de Charles com sua ex-amante


divorciada ainda visto como escandaloso
pela famlia real.

(A) 2 3 1.
(B) 2 6 4.

A sequncia correta de preenchimento dos


parnteses, de cima para baixo,

(C) 5 3 1.
(D) 2 1 6.

(A) V V F F.

(E) 5 3 4.

(B) V F V F.
(C) V F V V.

57. Assinale a alternativa que apresenta a


expresso de sentido mais prximo de by the
year (l. 43-44).

(D) F F V F.
(E) F V F V.

(A) every year

55. Assinale a alternativa que poderia substituir


once worked (l. 09-10), sem significativa
alterao de sentido ou prejuzo da correo
gramatical.

(B) after years


(C) in years
(D) with the years
(E) this year

(A) were working


(B) had worked
(C) used to work
(D) have been working

58. Assinale
a
alternativa
que
preenche
corretamente as lacunas do segmento abaixo,
na ordem em que aparecem.

(E) once would work


If the present Queen ........ for another ten
years, Charles ........ to the throne at 75.

UFRGS CV/2014 ING

(A) survives

comes

(B) survives

will come

(C) will survive

comes

(D) survived

can come

(E) survives

would come

23

126

Instruo: As questes 59 a 66
relacionadas ao texto abaixo.
01.
02.
03.
04.
05.
06.
07.
08.
09.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.

esto

I am happy to join ........ you today in


what will go down in history as the greatest
demonstration for freedom in the history of
our nation.
In the process ........ gaining our rightful
place we must not be guilty of wrongful
deeds. Let us not seek to satisfy our thirst for
freedom ........ drinking from the cup of
bitterness and hatred. We must forever
conduct our struggle on the high plane of
dignity and discipline. We must not allow our
creative protest to degenerate into physical
violence. The marvelous new militancy which
has engulfed the Negro community must not
lead us to distrust of all white people, for
many of our white brothers, as evidenced by
their presence here today, have come to
realize that their destiny is tied up with our
destiny and their freedom is inextricably
bound to our freedom. We cannot walk alone.
I have a dream that one day this nation
will rise up and live out the true meaning of
its creed: "We hold these truths to be selfevident: that all men are created equal." I
have a dream that my four little children will
one day live in a nation where they will not be
judged by the color of their skin but by the
content of their character.
This is our hope. This is the faith that I go
back to the South with. When we allow
freedom to ring, when we let it ring from
every state and every city, we will speed up that
day when all of God's children, black men and
white men, Jews and Gentiles, Protestants and
Catholics, will join hands and sing the old Negro
spiritual, "Free at last! free at last! thank God
Almighty, we are free at last!"

60. O texto apresenta trechos de um famoso


discurso do pastor Martin Luther King Jr.,
proferido em Washington, D.C., em 1963, por
ocasio de uma das maiores manifestaes
pelos direitos civis j registradas no mundo.
Valendo-se de referncias polticas e
religiosas, pode-se dizer que o texto
(A) incita desobedincia civil no violenta e
pede, por tratar-se de uma manifestao
da militncia negra, o afastamento dos
irmos brancos.
(B) celebra a conquista da liberdade negra,
mas afirma que ainda h sentimentos de
amargura e de dio a serem aplacados.
(C) conclama negros e brancos, judeus e
gentios, protestantes e catlicos a sonhar
por uma nao livre.
(D) revela a revolta do pastor contra o
racismo, a amargura e o dio que
imperam em uma nao que no pe em
prtica a mxima de que todos os
homens so iguais.
(E) exorta os negros a no se entregarem
violncia nos protestos e a no
desconfiarem de todos os brancos, pois
muitos esto irmanados na luta pelos
direitos civis.
61. Considere as seguintes afirmaes sobre o
texto.

Adaptado de: LUTHER KING JR., Martin. I have a dream.


Disponvel em: <http://www.archives.gov/press/
exhibits/dream-speech.pdf>. Acesso em: 06 set. 2013.

59. Assinale a alternativa que preenche, correta e


respectivamente, as lacunas das linhas 01, 05
e 08.

I - O protesto, segundo o pastor, um ato


criativo, e apenas degenerados se
entregam violncia fsica.
II - O pastor sonhou que seus quatro filhos
viviam em um pas onde no havia
racismo.
III- A liberdade que diferentes crenas
pregam s ser plena, segundo Martin
Luther King Jr., quando tambm os
negros puderem sentir-se livres.
Quais esto corretas?
(A) Apenas I.

(A) with of by

(B) Apenas II.

(B) with to with

(C) Apenas III.

(C) of

of with

(D) Apenas I e III.

(D) on

to by

(E) Apenas II e III.

(E) on

of in
UFRGS CV/2014 ING

24

127

62. Assinale a alternativa que poderia substituir o


trecho The marvelous new militancy

which
has
engulfed
the
Negro
community (l. 13-14), sem significativa

65. A melhor traduo para live out (l. 22),


conforme empregado no texto,
(A) deixar de fora.

alterao de sentido ou prejuzo da correo


gramatical.

(B) eliminar.
(C) viver fora.
(D) pr em prtica.

(A) The Negro community which has engulfed


in this marvelous new militancy
(B) The Negro community which has been
engulfed in this marvelous new militancy
(C) The Negro community that was engulfed
in this marvelous new militancy

(E) defender.

66. Considere o segmento a seguir.

(D) The marvelous new militancy in which the


Negro community has been engulfed
(E) The marvelous new militancy that the
Negro community has been engulfed
63. Assinale a alternativa que apresenta os
referentes de their (l. 17), its (l. 23) e it
(l. 31), respectivamente.

This is our hope. This is the faith that I


go back to the South with (l. 29-30).
Assinale a alternativa que apresenta a
reescrita mais adequada do segmento acima,
em discurso indireto.
(A) This was my hope. This was the faith that
I would go back to the South with.
(B) That was their hope. That was the faith
that he would go back to the South with.

(A) all white people (l. 15) dream (l. 21)


freedom (l. 31)

(C) That has been their hope. That has been


the faith that they have gone back to the
South with.

(B) all white people (l. 15) this nation


(l. 21) ring (l. 31)

(D) That was our hope. That was the faith


with which we went back to the South.

(C) many of our white brothers (l. 16)


this nation (l. 21) freedom (l. 31)

(E) Those were their hopes. Those were the


faiths with which they went back to the
South.

(D) many of our white brothers (l. 16)


this nation (l. 21) day (l. 33)
(E) Negro community (l. 14) meaning
(l. 22) freedom (l. 31)
64. Assinale a alternativa que poderia substituir
inextricably bound (l. 19-20) sem prejuzo
do sentido e da correo gramatical.
(A) deeply associated
(B) unexplainably subject
(C) slightly dependent
(D) excessively rooted
(E) superficially connected

UFRGS CV/2014 ING

25

128

Instruo: As questes 67 a 75
relacionadas ao texto abaixo.
01.
02.
03.
04.
05.
06.
07.
08.
09.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.

esto

Fan is ........ abbreviated form of


fanatic, which has ........ roots in ........ Latin
word fanaticus, which simply meant
belonging to the temple, a devotee. But
these words quickly assumed negative
connotations, to the point of becoming
references to excessive religious belief and to any
mistaken enthusiasm.
Based on such connotations, news reports
frequently characterize fans as psychopaths
........ frustrated fantasies of intimate
relationships with stars or unsatisfied desires
to achieve stardom take violent and antisocial
forms. Whether viewed as a religious fanatic,
a psychopathic killer, a neurotic fantasist, or a
lust-crazed groupie, the fan remains a
fanatic with interests alien to the realm of
normal cultural experience and a mentality
dangerously out of touch with reality.
To understand the logic behind this
discursive construction of fans, we must
reconsider what we mean by taste. Concepts
of good taste, appropriate conduct, or
aesthetic merit are not natural or universal;
rather, they are rooted in social experience
and reflect particular class interests. Taste
becomes one of the important means by
which social distinctions are maintained and
class identities are forged. Those who
naturally
possess
appropriate
tastes
deserve a privileged position, while the
tastes of others are seen as underdeveloped.
Taste distinctions determine desirable and
undesirable ways of relating to cultural
objects, strategies of interpretation and styles
of consumption.
The stereotypical conception of the fan
reflects anxieties about the violation of
dominant cultural hierarchies. The fans
transgression of bourgeois taste disrupt
dominant cultural hierarchies, insuring that
their preferences be seen as abnormal and
threatening by those who have an interest in
the maintenance of these standards (even by
those who may share similar tastes but
express them in different ways).

67. Select the alternative which correctly fills in


the gaps in lines 01 and 02, in the order they
appear.
(A) the the

(B) the its

(C) the its

the

(D) an

its

the

(E) an

its

the

68. Select the alternative which correctly fills in


the gap in line 11.
(A) who
(B) that
(C) which
(D) whose
(E) whatever

69. According to the text,

Adapted from: JENKINS, Henry. Textual Poachers:


Television Fans and Participatory Culture. New York /
London: Routledge, 1992. p. 12-16.

(A) the word fan is just short for fanatic


and both forms mean basically the same
as their Latin root did.
(B) though the word fanatic refers only to
religious excesses, fan has a broader
meaning, being associated to forms of
antisocial behavior and abnormal taste.
(C) despite the bad connotations of the word
fanatic, fans are generally perceived as
people of good taste who hold privileged
positions in society.
(D) the words fanatic and fan evolved
from quite negative references to forms
of religious worship to a fairly democratic
view on cultural tastes and styles of
consumption.
(E) the word fan is often used in
prejudicious and stereotypical references
to people who display excessive
enthusiasm in stating their cultural tastes.

UFRGS CV/2014 ING

26

129

70. Consider the statements below.


I - Fans are fanatic people who often display
antisocial behavior due to excessive
enthusiasm.

73. Select the alternative which could replace


rather (l. 25) without significant change in
meaning.
(A) instead

II - The characterization of fans as fanatic


mirrors social hierarchies based on the
notion of taste.

(B) indeed
(C) but

III- Fans have an important social role


because they challenge artistic standards
by transgressing bourgeois taste.
Which are correct, according to the text?

(D) although
(E) however
74. Select the alternative which has the same
function and is formed by the same process
as undesirable (l. 34).

(A) Only I.
(B) Only II.
(C) Only III.

(A) understandable

(D) Only II and III.

(B) unnecessary

(E) I, II and III.

(C) underdevelop
(D) unhealthily

71. Select the alternative which could replace


assumed (l. 05) without significant change in
meaning.

(E) unemployment
75. Which of the alternatives below has the same
structure as The fans transgression of
bourgeois taste (l. 39-40)?

(A) took on
(B) became
(C) earned
(D) got into
(E) formed
72. Consider the clauses below.
I - One must reconsider what one means by
taste.
II - We must reconsider what is meant by
taste.

(A) The governments interference


middle class education.

with

(B) The studentss


argument.

their

discussion

and

(C) The girls reading an interesting book.


(D) The fans harsh criticizing went unnoticed.
(E) The teachers introduced quite complex
matters.

III- We may reconsider what taste means.


Which could replace, without significant changes
in meaning, the clause we must reconsider
what we mean by taste (l. 21-22)?
(A) Only I.
(B) Only II.
(C) Only I and II.
(D) Only II and III.
(E) I, II and III.
UFRGS CV/2014 ING

27

130

2011
LNGUA PORTUGUESA
Instruo: As questes 01 a 08
relacionadas ao texto abaixo.
01.
02.
03.
04.
05.
06.
07.
08.
09.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.

esto

Escrevendo em 1971, Pasolini dizia que o


futebol uma linguagem, e comparava
jogadores italianos com escritores seus
contemporneos, vendo analogias entre estilos
e atitudes inerentes a seus discursos. Mais do
que isso, falava de um futebol jogado em prosa
e de outro jogado como poesia, identificando
processos comuns aos campos da literatura e
do esporte breto: via na prosa a vocao linear
e finalista do futebol (nfase defensiva, contraataque, cruzamento e finalizao), e na poesia a
irrupo de eventos no lineares e imprevisveis
(criao de espaos, ........, autonomia dos
dribles, motivao atacante congnita). Sugeria
com isso uma maneira de abordar o jogo por
dentro, e nos dava, de quebra, uma chave para
tratar da singularidade do futebol brasileiro.
Embora sumria, sua teoria contemplava a
necessria imbricao da poesia e da prosa no
tecido do futebol. Pontuava suas gradaes,
passando pelo que ele via como a prosa realista
de ingleses e alemes, a prosa ........ dos
italianos e a poesia sul-americana. Estas seriam
vias alternativas para se chegar ao delrio
universal do gol, que suspende as oposies
porque necessariamente um paroxismo
potico. Nada nos impede de dizer, nesta tica,
que os lances criativos mais surpreendentes no
dispensam a prosa corrente do arroz-comfeijo do jogo, necessrio em toda competio.
Ou de constatar, na literatura como no futebol,
que a prosa pode ser bela, ntegra, articulada
e fluente, ou burocrtica e andina, e a
poesia, imprevista, fulgurante e eficaz, ou
firula retrica sem nervo e sem alvo.
O mote ........ foi formulado num momento
de apogeu do futebol-arte, em que a distino
entre a prosa e a poesia futebolsticas era de
uma evidncia e de uma pertinncia centrais.
Permanece como um modelo simples e
estimulante para comentar as transformaes
do futebol ao longo do tempo e,
especialmente, a insistente natureza elptica do
futebol brasileiro, com sua ancestral compulso
a driblar a linearidade do esporte britnico.

01. Assinale
a
alternativa
que
preenche
corretamente as lacunas das linhas 13, 22 e
36, nesta ordem.
(A) corta-luzes estetisante pasolineano
(B) cortas-luzes estetizante pasolineano
(C) cortas-luz

estetisante pasoliniano

(D) corta-luzes estetizante pasoliniano


(E) cortas-luzes estetisante pasoliniano

02. Considere os trs itens abaixo, cada um dos


quais sintetiza um dos trs pargrafos do
texto.
1 - validao da teoria de Pasolini acerca da
relao entre futebol e literatura por sua
aplicao a aspectos do futebol
2 - esclarecimento da importncia que o
autor do texto atribui teoria de Pasolini
como modelo para a compreenso do
futebol
3 - explicitao dos elementos bsicos da
teoria de Pasolini sobre a comparao do
futebol com a literatura
O primeiro, o segundo e o terceiro pargrafos
do texto esto sintetizados, respectivamente,
pelos itens
(A) 1, 2 e 3.
(B) 3, 1 e 2.
(C) 2, 3 e 1.
(D) 3, 2 e 1.
(E) 2, 1 e 3.

Adaptado de: WISNIK, J. M. Veneno remdio : o


futebol e o Brasil. So Paulo: Companhia das
Letras, 2008. p. 13-14.

UFRGS CV/2011 LP

131

03. Considere as seguintes afirmaes, sobre o


contedo do texto.
I - De acordo com a teoria de Pasolini, uma
analogia pode ser estabelecida entre
literatura e futebol, pois, assim como
acontece na prosa e na poesia, o futebol
comporta estilos diferentes e muitas
vezes opostos.

05. Assinale a alternativa em que se estabelece


uma relao correta entre um pronome ou
expresso do texto e aquilo a que se refere.
(A) seus discursos (l. 05) discursos
dos escritores.
(B) isso (l. 15) o fato de ver na prosa a
vocao linear do futebol e na poesia seu
carter imprevisvel
(C) suas gradaes (l. 20) gradaes de
Pasolini
(D) nesta tica (l. 27) na tica do delrio
universal do gol
(E) em que (l. 37) no futebol-arte

II - Embora restrita ao futebol sul-americano,


a teoria de Pasolini mostra claramente
que o bom futebol precisa dar margem
diversidade, inovar, surpreender e, acima
de tudo, primar pela esttica dos passes e
dos lances.
III- Segundo Wisnik, no se pode adotar um
modelo simples para compreender o futebol,
j que a prtica deste esporte apresenta
enorme diversidade de estilos e atitudes.

06. Considere, abaixo, propostas de alteraes no


emprego de sinais de pontuao no texto.
1 - substituio dos dois-pontos na linha 09
por ponto-e-vrgula
2 - supresso das vrgulas que isolam o
segmento de quebra na linha 16
3 - substituio do ponto final da linha 30 por
vrgula, iniciando com letra minscula a
conjuno Ou da linha 31
4 - supresso do travesso da linha 42

Quais afirmaes esto de acordo com o


texto?
(A) Apenas I.
(B) Apenas II.
(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.

As propostas que manteriam a correo das


frases, sem alterar significativamente seu
sentido, so

04. Considere as seguintes propostas de


alteraes na ordem de expresses do texto.

(A)
(B)
(C)
(D)
(E)

1 - deslocamento de seus (l. 03) para depois


de contemporneos (l. 04), sem
modificaes adicionais
2 - deslocamento de necessariamente (l. 26)
para depois de potico (l. 27), com a
colocao de uma vrgula entre estas duas
palavras
3 - deslocamento de ao longo do tempo
as
(l.
42)
para
antes
de
transformaes (l. 41), com a
colocao de vrgulas antes e depois da
expresso deslocada

1 e 2.
2 e 3.
3 e 4.
1, 2 e 3.
2, 3 e 4.

07. Considere as seguintes propostas


substituio de palavras do texto.

1 - irrupo (l. 12) por transbordamento


2 - imbricao (l. 19) por entrelaamento
3 - elptica (l. 43) por imprevisvel

Quais alteraes manteriam a correo e o


sentido do perodo?

Quais propostas esto corretas


contextualmente adequadas?

(A) Apenas 1.

(A)
(B)
(C)
(D)
(E)

(B) Apenas 2.
(C) Apenas 3.
(D) Apenas 1 e 2.
(E) Apenas 1 e 3.
4

de

so

Apenas 1.
Apenas 2.
Apenas 3.
Apenas 2 e 3.
1, 2 e 3.
UFRGS CV/2011 LP

132

08. Na coluna da esquerda, abaixo, esto listadas


quatro palavras do texto; entre as palavras da
coluna da direita, sinnimos daquelas quatro
palavras.
Associe adequadamente as palavras da coluna
da esquerda s da coluna da direita.
(
(
(
(

)
)
)
)

paroxismo (l. 26)


andina (l. 33)
fulgurante (l. 34)
firula (l. 35)

1
2
3
4
5

insignificante
brilhante
extremo
rodeio
paliativo

A sequncia correta de preenchimento dos


parnteses, de cima para baixo,
(A) 3 4 1 5.
(B) 2 1 3 5.
(C) 3 1 2 4.
(D) 2 4 3 1.
(E) 4 3 5 2.
Instruo: As questes 09 a 17
relacionadas ao texto abaixo.
01.
02.
03.
04.
05.
06.
07.
08.
09.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.

esto

Pede-se a quem souber


do paradeiro de Lusa Porto
avise sua residncia Rua Santos leos, 48.
Previna urgente
solitria me enferma
entrevada h longos anos
erma de seus cuidados.
Pede-se a quem avistar Lusa Porto, 37 anos,
que aparea, que escreva, que mande dizer
onde est.
Suplica-se ao reprter-amador,
ao caixeiro, ao mata-mosquitos,
ao transeunte,
a qualquer do povo e da classe mdia,
at mesmo aos senhores ricos,
que tenham pena de me aflita
e lhe restituam a filha volatilizada
ou pelo menos dem informaes.
alta, magra, morena;
rosto penugento, dentes alvos,
sinal de nascena junto ao olho esquerdo,
levemente estrbica.
Vestidinho simples. culos.
Sumida h trs meses.
Me entrevada chamando.
Foi fazer compras na feira da praa.
No voltou.

31.
32.
33.
34.
35.
36.
37.

terremoto, chegada de rei.


As ruas mudaram de rumo,
para que demore tanto, noite.
Mas h de voltar, espontnea
ou trazida por mo benigna,
o olhar desviado e terno,
cano.

38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.

Mas se acharem
que a sorte dos povos mais importante
e que no devemos atentar
nas dores individuais,
se fecharem ouvidos
a este apelo de campainha,
no faz mal, insultem a me de Lusa,
virem a pgina:
Deus ter compaixo
da abandonada e da ausente,
erguer a enferma, e os membros perclusos
j se desatam em forma de busca.
Deus lhe dir: Vai,
procura tua filha, beija-a
e fecha-a para sempre em teu corao.
Ou talvez no seja preciso esse favor divino.
A me de Lusa (somos pecadores)
sabe-se indigna de tamanha graa.
E resta a espera, que sempre um dom.
Sim, os extraviados um dia regressam,
ou nunca, ou pode ser, ou ontem.
E de pensar realizamos.

Adaptado de: ANDRADE, Carlos Drummond de.


Desaparecimento de Lusa Porto. In: Novos
Poemas, v. 1, de Carlos Drummond de Andrade:
Nova Reunio 19 Livros de Poesia. Rio de
Janeiro: Jos Olympio, 1983. p. 230-234.

09. Considere as seguintes afirmaes sobre o


poema.

28. Nada de insinuaes quanto moa casta


29. que no tinha, no tinha namorado.
30. Algo de extraordinrio ter acontecido,
UFRGS CV/2011 LP

I - O poema tem origem no desaparecimento


de Lusa Porto, mas esta personagem no
um participante ativo do poema isto
, no "quem fala" nem "quem escuta"
no poema.
II - No h
ativos no
"voz que
poeta e a

explicitao dos participantes


poema; mas possvel ver na
fala" uma identificao entre o
me de Lusa Porto.

III- A "voz que fala" revela esperana e alguma


crena na interveno alheia; mas tambm
ceticismo quanto a esta interveno e,
consequentemente, resignao.
Quais esto corretas de acordo com o poema?
(A)
(B)
(C)
(D)
(E)

Apenas I.
Apenas II.
Apenas III.
Apenas II e III.
I, II e III.
5

133

10. Alm da identificao dos "participantes" do


poema, tambm seus elementos estruturais
so complexos. Mas possvel identificar
objetivos da "voz que fala" nas estrofes.
Na coluna da direita, abaixo, esto listados
alguns desses objetivos; na da esquerda,
referncias s trs estrofes do poema.
Associe adequadamente a coluna da esquerda
da direita.
1 - primeira estrofe
(l. 01-27)

(...).advertir a quem l

2 - segunda estrofe
(l. 28-37)

(...).expressar indiferena
com a atitude de
quem l

3 - terceira estrofe
(l. 38-59)

12. Assinale a alternativa em que se identifica


corretamente o sujeito da forma verbal
indicada.
(A) Previna (l. 04) a me
(B) aparea (l. 09) Lusa
(C) est (l. 10) quem avistar Lusa
(D) Foi (l. 26) a me

(...).exortar a quem l

(...).explicar a causa do
desaparecimento de
Lusa Porto

(E) demore (l. 33) Lusa

13. Considere as seguintes afirmaes sobre a


equivalncia entre expresses pertencentes a
classes gramaticais diferentes.

A sequncia correta de preenchimento dos


parnteses, de cima para baixo,
(A)
(B)
(C)
(D)
(E)

1
2
2
3
3

2
1
3
1
2

3
3
1
2
2

3.
2.
1.
3.
1.

I - Embora

tenha

forma

de

adjetivo,

urgente (l. 04) usado como advrbio e

poderia
ser
substitudo
por
urgentemente,
sem
mudana
significativa no sentido da frase.

11. Considere as propostas de reescrita abaixo


para o seguinte trecho do texto (l. 01-03).

Pede-se a quem souber


do paradeiro de Lusa Porto
Avise sua residncia Rua Santos leos, 48.

II - A substituio do adjetivo espontnea


(l. 34) pelo advrbio espontaneamente
mudaria o sentido da frase.
III- Embora seja locuo verbal, pode ser
(l. 58) usado em paralelo aos advrbios
nunca (l. 58) e ontem (l. 58) porque
expressa sentido semelhante ao do
advrbio talvez.

1 - Na mensagem, pedia-se, s pessoas que


soubessem do paradeiro de Lusa Porto,
que avisassem a residncia dela, situada
Rua Santos leos, 48.

Quais esto corretas?

2 - Na mensagem, pediu-se que as pessoas


que sabiam do paradeiro de Lusa Porto
avisem a residncia dela, situada Rua
Santos leos, 48.

(B) Apenas II.

3 - Na mensagem, fazia-se um pedido a quem


tivesse conhecimento do paradeiro de Lusa
Porto, que desse aviso residncia dela,
situada Rua Santos leos, 48.

(A) Apenas I.

(C) Apenas I e III.


(D) Apenas II e III.
(E) I, II e III.

Quais propostas manteriam a correo


gramatical e o sentido do referido trecho?
(A)
(B)
(C)
(D)
(E)

Apenas 2.
Apenas 3.
Apenas 1 e 2.
Apenas 1 e 3.
1, 2 e 3.

UFRGS CV/2011 LP

134

14. Avalie
as
seguintes
propostas
de
deslocamento de palavras e expresses do
texto, desconsiderando o uso de iniciais
maisculas e pontos finais.

16. Considere as propostas de reescrita abaixo


para o seguinte trecho do poema (l. 30-33).

Algo de extraordinrio ter acontecido,


terremoto, chegada de rei.
As ruas mudaram de rumo,
para que demore tanto, noite.

1 - deslocar
alvos
(l.
20)
para
imediatamente antes de dentes (l. 20)

1 - Algo
de
extraordinrio
deve
ter
acontecido terremoto, chegada de rei,
as ruas mudaram de rumo para que
demore tanto, noite.

2 - deslocar Vestidinho (l. 23) para


imediatamente depois de simples (l. 23)
3 - deslocar
divino
(l.
53)
para
imediatamente antes de favor (l. 53)

2 - Algo de extraordinrio ter acontecido


terremoto, chegada de rei; talvez, as ruas
tenham mudado de rumo para que
demore tanto; afinal, noite.

Quais manteriam o significado da frase do texto?

3 - noite para que demore tanto; algo de


extraordinrio ter acontecido: terremoto,
chegada de rei; talvez, as ruas tenham
mudado de rumo.

(A) Apenas 1.
(B) Apenas 2.
(C) Apenas 3.

Quais propostas esto gramaticalmente corretas?

(D) Apenas 1 e 2.

(A) Apenas 1.

(E) Apenas 2 e 3.

(B) Apenas 2.
(C) Apenas 1 e 2.
(D) Apenas 2 e 3.

15. Considere as seguintes afirmaes, referentes


interpretao de palavras e segmentos do
texto.
I - O adjetivo entrevada (l. 06) tem o
mesmo sentido que o adjetivo perclusos
(l. 48).

(E) 1, 2 e 3.
17. Considere as propostas de reescrita abaixo
para o seguinte trecho do poema (l. 50-52).

palavras volatilizada (l. 17) e


Sumida (l. 24) so semanticamente

II - As

equivalentes no texto.

III- O segmento da abandonada e da


ausente (l. 47) diz respeito ao segmento
me de Luiza (l. 44).
Quais esto corretas?

Deus lhe dir: Vai,


procura tua filha, beija-a
e fecha-a para sempre em teu corao.
1 - Deus dir me de Lusa Porto que v,
que procure sua filha, que a beije e que a
feche para sempre em seu corao.
2 - Deus recomendar me de Lusa Porto
que v, procure sua filha, beije-a e fechea para sempre no seu corao.
3 - Deus aconselhar me de Lusa Porto ir,
procurar sua filha, beij-la e fech-la para
sempre em seu corao.

(A) Apenas II.

Quais propostas mantm a correo e o


sentido do texto original?

(B) Apenas I e II.


(C) Apenas I e III.

(A) Apenas 1.

(D) Apenas II e III.

(B) Apenas 2.

(E) I, II e III.

(C) Apenas 1 e 2.
(D) Apenas 1 e 3.
(E) 1, 2 e 3.

UFRGS CV/2011 LP

135

Instruo: As questes 18 a 25
relacionadas ao texto abaixo.
01.
02.
03.
04.
05.
06.
07.
08.
09.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.

esto

A histria no tem sido favorvel Polnia e


sua literatura. Os duzentos anos durante os
quais o pas esteve dividido entre as potncias
vizinhas Rssia, Prssia e ustria exerceram
uma influncia de longo alcance sobre sua
literatura. Os opressores no apenas tentaram
impor seu domnio poltico, mas erradicar a
cultura do povo conquistado. Um dos principais
alvos era a lngua: ........ do uso oficial e das
cerimnias pblicas. A literatura polonesa teve
de adotar o difcil papel de guardi do idioma,
ameaado pela expanso dos opressores e de
sua lngua. As obras literrias passaram a ser o
nico santurio onde a lngua ameaada poderia
florescer.
Consequentemente, o pas, que tinha ficado
privado de seu exrcito regular, formou uma
diviso de poetas, com a crena profunda de
que ........ mais efetivos que unidades militares.
A lngua era sua nica arma contra a opresso
do Estado. Acreditava-se que perder a lngua
nacional significaria perder a identidade cultural,
crena essa jamais questionada.
Assim, a poesia polonesa sentiu, desde a
poca das parties, o terrvel peso do dever
pblico. Isso originou uma srie de conflitos
dentro da prpria literatura. Os poetas, cuja
principal tarefa era preservar por via da lngua
o sentido de identidade nacional, tiveram de
refrear a voz individual, uma vez que serviam
causa polonesa, supraindividual. Tiveram de
suspender a alegria criativa da picardia e da
irresponsabilidade, por causa da gravidade de
seus objetivos. A poesia estava associada,
inextricavelmente, extrema seriedade da
misso. E, mesmo que ........ obras escritas por
poetas em momentos descomprometidos da
vida, quando desfrutavam dos prazeres terrenos
ou se deliciavam com horas de cio, estes no
tinham sido includos no cnone literrio. Na
Polnia, a seriedade do objetivo modelou a ideia
popular do que a poesia e deveria ser.

18. Assinale
a
alternativa
que
preenche
corretamente as lacunas das linhas 09, 19 e
36, nesta ordem.
(A) excluram-lhe provariam ser houvesse
(B) excluiu-se-lhe se provariam ser
houvessem
(C) excluiu-se-lhe provaria serem
houvessem
(D) excluram-na provariam ser houvesse
(E) excluram-na se provariam ser
houvessem
19. Considere as seguintes afirmaes.
I - A fim de impor seu domnio poltico e de
erradicar a cultura polonesa, Rssia,
Prssia e ustria impediram o idioma
polons de ser usado oficialmente.
II - Os poloneses acreditavam firmemente
que seus poetas seriam mais efetivos na
defesa da lngua que os militares na
defesa do Estado.
III- A poesia polonesa sentiu o peso do dever
pblico, e poetas que escreveram em
momentos descomprometidos acabaram
excludos do cnone literrio.
Quais esto de acordo com o texto?
(A)
(B)
(C)
(D)
(E)

Apenas I.
Apenas II.
Apenas I e III.
Apenas II e III.
I, II e III.

20. Considere o enunciado abaixo e as trs


propostas para complet-lo.

Adaptado de: JARNIEWICZ, J. Lngua contra lngua.


In: PETERSON, M. (Org.) A literatura soberana :
ensaios sobre as literaturas da Europa CentroOriental. So Paulo: Humanitas, 2010. p. 191-192.

Sem prejuzo da correo gramatical e do


significado contextual, seria possvel substituir
1 - tem sido (l. 01) por foi.
2 - tinha ficado (l. 16) por ficara.
3 - serviam (l. 30) por serviriam.
Quais propostas esto corretas?
(A) Apenas 2.
(B) Apenas 3.
(C) Apenas 1 e 2.
(D) Apenas 2 e 3.
(E) 1, 2 e 3.

UFRGS CV/2011 LP

136

21. Assinale com V (verdadeiro) ou F (falso) as


afirmaes abaixo, referentes a funes
sintticas de palavras e segmentos do texto.

23. Considere as seguintes afirmaes sobre o


nexo no apenas ... mas, usado no perodo
que inicia na linha 06.
I - Estabelece um paralelismo sinttico entre
impor seu domnio poltico (l. 07) e

( ) O segmento Polnia (l. 01) exerce


funo de objeto indireto.

erradicar a cultura
conquistado (l. 07-08).

( ) O segmento o nico santurio (l. 13-14)


exerce a funo de predicativo do sujeito.

( ) O pronome se (l. 39) um ndice de


indeterminao do sujeito.

Quais esto corretas?


(A)
(B)
(C)
(D)
(E)

A sequncia correta de preenchimento dos


parnteses, de cima para baixo,
(A) F V V F.
(B) F F V V.

(E) V F V F.

(A)
(B)
(C)
(D)
(E)

22. Considere o enunciado abaixo e as trs


propostas para complet-lo.
No que diz respeito a segmentos do texto que
introduzem oraes relativas, seria possvel,
sem prejuzo da correo gramatical e do
significado contextual, substituir

os

Apenas II.
Apenas III.
Apenas I e II.
Apenas I e III.
I, II e III.

24. Assinale a alternativa que apresenta expresses


contextualmente
equivalentes
aos
nexos
Consequentemente (l. 16), Assim (l. 24) e
mesmo que (l. 36), nesta ordem.

(D) V V F F.

1 - durante
quando.

povo

II - Introduz uma ideia de oposio entre o


significado das formas verbais impor
(l. 07) e erradicar (l. 07).
III- Poderia
ser
complementado
com
tambm, sem prejuzo do significado
original do perodo.

( ) O pronome que (l. 16) desempenha a


funo de sujeito da orao em que
aparece.

(C) V F F V.

do

quais

(l.

02-03)

Logo
Logo
Por isso
Logo
Por isso

Por isso

Desse modo
Desse modo
Por isso

Desse modo

at que
ainda que
ainda que
ainda que
at que

25. Considere o enunciado abaixo e as trs


propostas para complet-lo.

por

2 - onde (l. 14) por que.


3 - cuja principal tarefa (l. 27-28) por de
quem a principal tarefa.
Quais propostas esto corretas?

Sem prejuzo da correo gramatical e do


significado
contextual,
seria
possvel
introduzir, entre a conjuno e (l. 42) e a
forma verbal deveria (l. 42), o segmento
1 - do que.
2 - do que ela.
3 - daquilo que ela.
Quais propostas esto corretas?

(A) Apenas 1.
(B) Apenas 2.

(A)
(B)
(C)
(D)
(E)

(C) Apenas 3.
(D) Apenas 1 e 2.
(E) Apenas 1, 2 e 3.
UFRGS CV/2011 LP

Apenas 2.
Apenas 3.
Apenas 1 e 2.
Apenas 1 e 3.
1, 2 e 3.
9

137

2012
LNGUA PORTUGUESA
Instruo: As questes 01 a 11
relacionadas ao texto abaixo.
01.
02.
03.
04.
05.
06.
07.
08.
09.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.

esto

Por volta de 1928, Henry Ford debatia-se com


uma ideia fixa: queria encontrar uma frmula
salvadora para o problema do suprimento da
borracha para sua indstria. Estava cansado de
aturar os preos que os ingleses de Ceilo lhe
impunham. Como? Plantando borracha na
Amaznia. No havia o sdito ingls Henry
Wickham transportado s escondidas para a
Inglaterra as mudas da seringueira da Amaznia?
Tudo estava em organizar seringais homogneos
em terras apropriadas. Por conseguinte, rumo ao
Brasil, rumo Amaznia.
O Brasil exultou. E logo o governo brasileiro
recebe os emissrios de Ford como costuma
receber os americanos em geral: de braos
abertos. Comea o trabalho. A mata resiste, mas
........ . Ao passo que os tratores vo fazendo a
derrubada para a clareira, j as casas comeam a
surgir, o hospital, os postos de higiene, as
quadras de tnis, as manses dos diretores.
Dentro da floresta amaznica, o ianque fizera
surgir uma nova cidade. E tudo ........ como
convinha. Trs mil caboclos trabalhavam; um
milho de ps de seringueira eram plantados. A
floresta arquejava, mas cedia. E quando,
decorridos apenas dois anos, as seringueiras
comeam a despontar em pelotes, em
batalhes, em regimentos, ningum mais tem
dvida sobre o desfecho da luta.
Entretanto, Ford ia recebendo e lendo
relatrios. E estes contavam histrias diferentes
das que figuravam nos frontispcios dos jornais:
definhavam as seringueiras pelo excesso de sol
e pela falta de umidade e de humo. Estavam
murchando ao sol da regio. falta de proteo
das sombras da floresta tropical, o exrcito de
seringueiras de Mr. Ford ........ ao sol. Triunfava
o desordenado da selva contra a disciplina do
seringal.
Devemos concluir da que na Amaznia seja
de todo impossvel estabelecer florestas
homogneas ou que o grande vale seja de todo
imprprio para o florescimento de uma grande
civilizao? Ainda no. Por enquanto, a concluso
a tirar outra. Na verdade, o que se fez nas
margens do Tapajs foi transplantar para o
trpico a tcnica, os mtodos e os processos de
resultados comprovados apenas em climas
temperados ou frios a cincia e a tcnica do
cultivo da terra prprias para os trpicos esto
ainda em fase emprica e elementar.

01. Assinale
a
alternativa
que
preenche
corretamente as lacunas das linhas 17, 22 e
37, nesta ordem.
(A) recua

caminhava ia morrer

(B) recuou caminhara morreria


(C) recuara caminha
(D) recua

morreu

caminharia morrer

(E) recuou caminhara morria


02. Em seu sentido global, o texto discute
(A) os efeitos ambientais da globalizao em
seus primeiros anos.
(B) as relaes entre comrcio, indstria e
produo agrcola.
(C) as relaes econmicas desiguais entre
Estados Unidos e Brasil.
(D) o empreendedorismo norte-americano,
representado pela figura de Ford.
(E) a eficcia de mtodos agrcolas norteamericanos no Brasil.
03. Considere as seguintes afirmaes sobre o
contedo do texto.
I - Os ingleses exportavam ltex a preos
mais altos do que os brasileiros, por volta
de 1928.
II - As aes de Ford no Brasil eram notcia
de capa em jornais da poca.
III- O conhecimento emprico intil ou
insuficiente no cultivo agrcola.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e III.
(E) I, II e III.

Adaptado de: MOOG, Vianna. Bandeirantes e pioneiros:


paralelo entre duas culturas. 9. ed. Rio de Janeiro:
Civilizao Brasileira, 1969. p. 27.

UFRGS CV/2012 LP

138

04. Assinale a proposta de mudana no emprego


de vrgula em segmento do texto que
manteria a correo e o sentido da frase
original.

06. Considere as trs afirmaes abaixo, em que


se propem modos de completar segmentos
frasais do texto.
1 - Plantando borracha na Amaznia
(l. 06-07) poderia ser reescrito como
Ele poderia resolver o problema
plantando borracha na Amaznia.

(A) Colocao de vrgula imediatamente aps


preos (l. 05).

2 - Por conseguinte, rumo ao Brasil,


rumo Amaznia (l. 11-12) poderia ser
reescrito como Por conseguinte, era
necessrio levar as mudas de
seringueira rumo ao Brasil, rumo

(B) Colocao de vrgulas imediatamente


aps ingls (l. 07) e Wickham (l. 08).
(C) Colocao de vrgula logo aps Ford (l. 14).

Amaznia.

(D) Omisso da vrgula da linha 18.


(E) Colocao de vrgulas antes e depois de
na Amaznia (l. 40).

3 - Ainda no (l. 44) poderia ser reescrito


como O grande vale ainda no de
todo imprprio para o florescimento
de uma grande civilizao.

05. Considere as seguintes propostas de alterao


de segmentos do texto.

Quais propostas esto corretas e mantm o


sentido do trecho original?
(A)
(B)
(C)
(D)
(E)

I - A substituio do pronome lhe (l. 05) por


a ele manteria a correo da frase e a
relao estabelecida no texto entre esse
pronome e seu antecedente no pargrafo.
II - A
insero
do
pronome
lhe
imediatamente antes da forma verbal
convinha (l. 23) manteria a correo da
frase e enfatizaria a relao estabelecida
no texto entre essa forma verbal e o
segmento o ianque (l. 21).

07. Assinale a alternativa em que a segunda palavra


constitui sinnimo adequado da primeira,
considerando o contexto em que esta ocorre.
(A)
(B)
(C)
(D)
(E)

III- A substituio da preposio de (l. 47)


por cujos manteria a correo da frase,
desde que a forma verbal estavam fosse
inserida antes de comprovados (l. 48).
Quais propostas esto corretas?
(A) Apenas I.
(B) Apenas II.

Apenas 1.
Apenas 2.
Apenas 1 e 3.
Apenas 2 e 3.
1, 2 e 3.

apropriadas (l. 11) conquistadas


emissrios (l. 14) mandatrios
desfecho (l. 29) clmax
estabelecer (l. 41) localizar
elementar (l. 51) bsica

08. Assinale a alternativa que apresenta


expresses contextualmente equivalentes aos
nexos Por conseguinte (l. 11), Ao passo
que (l. 17) e locuo adverbial de todo
(l. 41), nesta ordem.

(C) Apenas III.

(A) Portanto Assim que de modo geral

(D) Apenas I e III.

(B) Em contrapartida Enquanto absolutamente

(E) I, II e III.

(C) Desse modo Ao mesmo tempo que no


todo
(D) Assim medida que inteiramente
(E) Logo em seguida proporo que
totalmente
4

UFRGS CV/2012 LP

139

09. Considere as propostas de reescrita abaixo para o seguinte trecho do texto.

E logo o governo brasileiro recebe os emissrios de Ford como costuma receber os


americanos de modo geral: de braos abertos. (l. 13-16)
I - E logo os emissrios americanos de Ford so recebidos como costuma o governo brasileiro
receber de modo geral: de braos abertos.
II - E logo os emissrios de Ford so recebidos pelo governo brasileiro como costumam ser
recebidos os americanos de modo geral: de braos abertos.
III- E logo os emissrios de Ford so recebidos pelo governo brasileiro como este costuma receber
os americanos de modo geral: de braos abertos.
Quais propostas mantm a correo e o sentido original do trecho?
(A)
(B)
(C)
(D)
(E)

Apenas I.
Apenas II.
Apenas III.
Apenas I e III.
I, II e III.

10. O delocamento da ordem de palavras de um texto pode ou no afetar as relaes de sentido


estabelecidas.
De acordo com o significado do texto, mantendo-se a correo e o sentido da frase original, pode-se
deslocar
(A) logo (l. 13) para imediatamente depois de governo brasileiro (l. 13).
(B) j (l. 18) para imediatamente depois da forma verbal vo (l. 17).
(C) apenas (l. 26) para imediatamente antes de quando (l. 25).
(D) mais (l. 28) para imediatamente aps dvida (l. 29).
(E) grande (l. 43) para imediatamente depois de civilizao (l. 44).

11. A derrubada da mata amaznica e o plantio de seringais so tratados, ao longo do texto, por meio
de imagens militares, como em exrcito de seringueiras (l. 36-37).
Assinale com M as imagens que se referem mata e com S aquelas que se aplicam aos seringais.
( ) arquejava (l. 25)
( ) batalhes (l. 28)
( ) Triunfava (l. 37)
( ) disciplina (l. 38)
A sequncia correta de preenchimento dos parnteses, de cima para baixo,
(A) S M S S.
(B) M S M S.
(C) M M S M.
(D) M S S M.
(E) S M M S.
5

UFRGS CV/2012 LP

140

Instruo: As questes 12 a 19
relacionadas ao texto abaixo.
01.
02.
03.
04.
05.
06.
07.
08.
09.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.

esto

Havia naquele cemitrio uma sepultura em


torno ........ a imaginao popular tecera
lendas. Ficava ao lado da capela, perto dos
grandes jazigos, e consistia numa lpide
cinzenta, com a inscrio j ........ apagada
por baixo duma cruz em alto-relevo. Seus
devotos acreditavam que a alma cujo corpo
ali jazia tinha o dom de obrar milagres como
os de Santo Antnio. Floriano leu a inscrio:
Antnia Weber Toni 1895-1915. Talvez ali
estivesse o ponto de partida de seu prximo
romance...
Um jovem novelista visita o cemitrio de
sua terra e fica particularmente interessado
numa sepultura singela a que a superstio
popular atribui poderes milagrosos. Vem-lhe
ento o desejo de, atravs da magia da
fico, trazer de volta vida aquela morta
obscura. Sai procura de habitantes mais
antigos e a eles pergunta: "Quem foi Antnia
Weber?" Alguns nada sabem. Outros contam
o pouco de que se lembram. Um teutobrasileiro sessento (Floriano j comeava a
visualizar as personagens, a inventar a
intriga), ao ouvir o nome da defunta, fica
perturbado e fecha-se num mutismo
ressentido. "Aqui h drama", diz o escritor
para si prprio. E conclui: "Este homem talvez
tenha amado Antnia Weber...". Ao cabo de
vrias tentativas, consegue arrancar dele uma
histria fragmentada, cheia de reticncias
que, entretanto, o novelista vai preenchendo
com trechos de depoimentos de terceiros. Por
fim, de posse de vrias peas do quebracabea, pe-se a arm-lo e o resultado o
romance duma tal Antnia Weber, natural de
Hannover e que emigrou com os pais para o
Brasil e estabeleceu-se em Santa F, onde...
Mas qual! exclamou Floriano, parando
sombra dum pltano e passando o leno pela
testa mida. Ia cair de novo nos alapes que
seu temperamento lhe armava. Os crticos
no negavam mrito a seus romances, mas
afirmavam que em suas histrias ........ o
cheiro do suor humano e da terra: achavam
que, quanto forma, eram tecnicamente bem
escritas; quanto ao contedo, porm, tendiam
mais para o artifcio que para a arte, fugindo
sempre ao drama essencial. Pouco lhe
importaria o que outros pensassem se ele
prprio no estivesse de acordo com essas
restries. Chegara concluso de que,

53.
54.
55.
56.
57.
58.
59.

embora a percia no devesse ser


menosprezada, para fazer bom vinho era
necessrio antes de mais nada ter uvas, e
uvas de boa qualidade. No caso do romance a
uva era o tema o tema legtimo, isto , algo
que o autor pelo menos tivesse sentido, se
no propriamente vivido.
Adaptado de: VERISSIMO, Erico. O tempo e o
vento: o retrato. v. 2. So Paulo: Companhia
das Letras, 2010. p. 331-333.

12. Assinale
a
alternativa
que
preenche
corretamente as lacunas das linhas 02, 05 e
44, nesta ordem.
(A)
(B)
(C)
(D)
(E)

do qual meia faltavam


da qual meio faltava
da qual meio faltavam
do qual meio faltavam
da qual meia faltava

13. O texto apresenta dois nveis de narrativa: a


histria narrada como um todo e, dentro
desta, a histria concebida por Floriano.
No bloco superior, abaixo, esto identificados,
de acordo com sua participao nos nveis de
narrativa, trs tipos de personagens; no
inferior, esto listados quatro personagens do
texto.
Associe adequadamente o bloco inferior ao
superior.
1 - personagens da histria narrada no texto
como um todo
2 - personagens da histria concebida por
Floriano
3 - personagens das duas histrias
(
(
(
(

)
)
)
)

Floriano
Toni Weber
o novelista
os crticos

A sequncia correta de preenchimento dos


parnteses, de cima para baixo,
(A)
(B)
(C)
(D)
(E)

3
2
1
3
1

2
1
3
1
3

3
1
2
2
3

1.
2.
1.
3.
2.
UFRGS CV/2012 LP

141

14. Assinale com V (verdadeiro) ou F (falso) as afirmaes abaixo, conforme descrevam ou no fatos
que acontecem no primeiro nvel de narrativa, isto , na histria narrada no texto como um todo.
( ) Floriano faz uma visita ao cemitrio da cidade onde se encontra.
( ) Floriano entrevista os habitantes mais antigos da cidade.
( ) Floriano escreve um livro sobre Antnia Weber.
( ) Os livros de Floriano so criticados porque carecem de drama legtimo.
A sequncia correta de preenchimento dos parnteses, de cima para baixo,
(A)
(B)
(C)
(D)
(E)

F
V
V
F
V

V V F.
F F V.
V F F.
F V V.
F V F.

15. Considere os seguintes segmentos retirados do texto.


1 - a imaginao popular tecera lendas (l. 02-03)
2 - milagres como os de Santo Antnio (l. 08-09)
3 - atravs da magia da fico (l. 17-18)
4 - uma histria fragmentada, cheia de reticncias (l. 30-31)
Em quais deles h emprego de linguagem metafrica?
(A)
(B)
(C)
(D)
(E)

Apenas 1 e 2.
Apenas 2 e 3.
Apenas 3 e 4.
Apenas 1, 3 e 4.
1, 2, 3 e 4.

16. Considere o enunciado abaixo e as trs propostas para complet-lo.


Em razo de alterao de regncia, acarretaria outras mudanas na frase a substituio de
1 - consistia (l. 04) por ostentava.
2 - atribui (l. 16) por concede.
3 - se lembram (l. 22) por tm memria.
Quais propostas esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas 1.
Apenas 2.
Apenas 3.
Apenas 1 e 3.
1, 2 e 3.
7

UFRGS CV/2012 LP

142

17. Considere as trs propostas de reescrita de trechos do texto; as propostas envolvem transposio do
presente histrico para o pretrito, e do discurso direto para o indireto.
I - Sai procura de habitantes mais antigos e a eles pergunta: "Quem foi Antnia
Weber?" (l. 19-21)
Saiu procura de habitantes mais antigos e a eles perguntou quem tinha sido Antnia Weber.
II - Aqui h drama", diz o escritor para si prprio. (l. 27-28)
O escritor disse para si prprio que ali havia drama.
III- E conclui: "Este homem talvez tenha amado Antnia Weber...". (l. 28-29)
E concluiu que aquele homem talvez ame Antnia Weber.
Quais propostas esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e II.
(E) I, II e III.
18. Se substitussemos Os crticos (l. 42) por A crtica, quantas outras alteraes seriam necessrias,
no texto, para fins de concordncia?
(A) 1.
(B) 2.
(C) 3.
(D) 4.
(E) 5.
19. Considere as propostas de reescrita abaixo para o seguinte trecho adaptado do texto (l. 52-56).
Chegara concluso de que, embora a percia no devesse ser menosprezada, para fazer
bom vinho era necessrio antes de mais nada ter uvas de boa qualidade.
I - Embora a percia no devesse ser menosprezada, chegara a uma concluso: antes de mais nada
era necessrio ter uvas de boa qualidade para fazer bom vinho.
II - Chegara a uma concluso: antes de mais nada era necessrio ter uvas de boa qualidade,
embora a percia no devesse ser menosprezada para fazer bom vinho.
III- Chegara a uma concluso: era necessrio, para fazer bom vinho, ter, antes de mais nada, uvas
de boa qualidade, embora a percia no devesse ser menosprezada.
Quais propostas so gramaticalmente corretas e preservam o sentido do trecho original?
(A)
(B)
(C)
(D)
(E)

Apenas
Apenas
Apenas
Apenas
Apenas

I.
II.
III.
I e II.
II e III.

UFRGS CV/2012 LP

143

Instruo: As questes 20 a 25
relacionadas ao texto abaixo.
01.
02.
03.
04.
05.
06.
07.
08.
09.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.

esto

No sculo XV, viu-se a Europa invadida por


uma raa de homens que, vindos ningum
sabe de onde, se espalharam em bandos por
todo o seu territrio. Gente inquieta e
andarilha, deles afirmou Paul de Saint-Victor
que era mais fcil predizer o .......... das
nuvens ou dos gafanhotos do que seguir as
pegadas da sua invaso. Uns risonhos
despreocupados: passavam a vida esquecidos
do passado e descuidados do futuro. Cada
novo dia era uma nova aventura em busca do
escasso alimento para os manter naquela
jornada. Trajo? No mais completo .......... :
.......... sujos e pudos cobriam-lhes os corpos
queimados do sol. Nmades, aventureiros,
despreocupados eram os bomios.
Assim nasceu a semntica da palavra
bomio. O nome gentlico de Bomia passou a
aplicar-se ao indivduo despreocupado, de
existncia irregular, relaxado no vesturio,
vivendo
ao
deus-dar,

toa,
na
vagabundagem alegre. Da tambm o
substantivo bomia. Na definio de Antenor
Nascentes: vida despreocupada e alegre,
vadiao, estrdia, vagabundagem. Aplicou-se
depois o termo, especializadamente, vida
desordenada e sem preocupaes de artistas
e escritores mais dados aos prazeres da noite
que aos trabalhos do dia. Eis um exemplo
clssico do que se chama degenerescncia
semntica. De limpo gentlico natural ou
habitante da Bomia bomio acabou
carregado de todas essas conotaes
desfavorveis.
A respeito do substantivo bomia, vale
dizer que a forma de uso, ao menos no Brasil,
boemia, acento tnico em -mi-. E natural
que assim seja, considerando-se que -ia
sufixo que exprime condio, estado,
alegria,
anarquia,
ocupao.
Conferir:
barbaria, rebeldia, tropelia, pirataria... Penso
que sobretudo palavras como folia e orgia
devem ter infludo na fixao da tonicidade de
boemia.
Notar
tambm
o
par
abstmio/abstemia. Alm do mais, a prosdia
bomia estava prejudicada na origem pelo
nome prprio Bomia: esses bomios no so
os que vivem na Bomia...

20. Assinale
a
alternativa
que
completa
corretamente as lacunas das linhas 06, 13 e
14, nesta ordem.
(A) etinerrio desleicho molambos
(B) etinerrio desleixo mulambos
(C) itinerrio desleixo molambos
(D) itinerrio desleixo mulambos
(E) itinerrio desleicho mulambos
21. Considere as seguintes afirmaes.
I - O substantivo comum bomio pode
designar tanto um indivduo que pertence
ao povo originrio da Bomia quanto um
indivduo de vida alegre e despreocupada,
dado aos prazeres da noite.
II - O termo bomio designava por causa
do modo de vida irregular, aventureiro e
despreocupado o povo que invadiu a
Europa no sculo XV.
III- O substantivo que exprime a condio ou
o estado correspondente a bomio, no
Brasil, tem a forma boemia, razo por que
incorreto utilizarmos bomia.
Quais esto corretas, de acordo com o texto?
(A)
(B)
(C)
(D)
(E)

Apenas I.
Apenas II.
Apenas I e III.
Apenas II e III.
I, II e III.

22. Associe cada ocorrncia de sinal de pontuao


esquerda com a noo que expressa no
contexto em que ocorre.

Adaptado de: LUFT, Celso Pedro. Bomios, Bomia e


boemia. In: O romance das palavras. So Paulo: tica,
1996. p. 30-31.

( ) dois-pontos da l. 09
( ) dois-pontos da l. 24
( ) dois-pontos da l. 40

1
2
3
4

definio
conformidade
explicao
exemplificao

A sequncia correta de preenchimento dos


parnteses, de cima para baixo,
(A)
(B)
(C)
(D)
(E)

1
1
2
3
4

2
3
3
2
1

3.
4.
4.
4.
2.
9

UFRGS CV/2012 LP

144

23. Considere os pares de palavras abaixo.


1 - pudos (l. 14) e indivduo (l. 19)
2 - Bomia (l. 18) e prprio (l. 47)
3 - deus-dar (l. 21) e Da (l. 22)
Em quais pares as palavras respeitam a mesma regra de acentuao ortogrfica?
(A)
(B)
(C)
(D)
(E)

Apenas
Apenas
Apenas
Apenas
Apenas

1.
2.
3.
1 e 2.
1 e 3.

24. No bloco superior, abaixo, esto listados quatro processos pelos quais uma palavra pode ter seu uso
alterado; no inferior, snteses de passagens do texto que exemplificam trs desses processos.
Associe adequadamente o bloco inferior ao superior.
1 - analogia a palavra passa a ser usada como outras por semelhana de forma com elas
2 - degenerescncia semntica a palavra passa a ser usada em funo de elementos
negativos de seu significado
3 - enobrecimento semntico a palavra passa a ser usada em funo de elementos positivos
de seu significado
4 - especializao ela passa a ser usada apenas para um subcaso daqueles que originalmente
cobria
( ) bomio passa a designar pessoa despreocupada, desleixada, vadia (l. 17-22)
( ) bomio passa a designar artistas amantes da vida noturna (l. 25-29)
( ) bomia passa a ser pronunciada como boemia (l. 35-40)
A sequncia correta de preenchimento dos parnteses, de cima para baixo,
(A)
(B)
(C)
(D)
(E)

1
2
2
3
1

2
3
4
4
3

3.
4.
1.
2.
4.

25. Considere as seguintes afirmaes sobre as relaes morfolgicas que se estabelecem com palavras
do texto.
I - alegria (l. 40) e rebeldia (l. 41) so palavras derivadas de adjetivos, assim como valentia.
II - anarquia (l. 40) e orgia (l. 42) so palavras que, apesar de apresentarem a terminao ia,
no derivam de outras palavras.
III- pirataria (l. 41) palavra derivada de substantivo, assim como chefia.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas I.
Apenas III.
Apenas I e II.
Apenas II e III.
I, II e III.

10

UFRGS CV/2011 LP

145

2013
LNGUA PORTUGUESA
Instruo: As questes 01 a 09
relacionadas ao texto abaixo.
01.
02.
03.
04.
05.
06.
07.
08.
09.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.

esto

Se, em um tempo futuro, muito distante, s


tivessem sobrado de ns vestgios e alguns deles
fossem encontrados, e entre esses, fotografias,
pensemos que um fato seria possvel: por meio
delas, para os que as encontrariam, poderia se
operar uma revelao. As fotografias diriam
sobre quem fomos e como vivemos. Caso os
habitantes do futuro encontrassem, por acaso,
soterrado um arquivo de fotografias de guerra,
quem sabe deduziriam a ........ condio daquela
humanidade perdida e suspirariam de alvio pela
nossa ........ . Se, ao contrrio, o que
encontrassem fossem lbuns de uma prosaica
famlia, apreciariam crianas fotografadas, ao
longo dos anos, sempre to divertidas, cenas de
trivial alegria.
Por um lado, reduo: h como superar a
finitude. Por outro, castigo: no se esquecer
enquanto houver a fotografia. O que se lembra
diante do retrato de um annimo fotografado no
sc. XIX? H sempre um encanto imanente
nessas imagens do passado; so como pontos
que no se cruzam, como caminhos indicados
por setas que parecem levar a lugar nenhum.
Mas nos fazem desejar, pela expectativa do que
se pode ver do outro lado, cruz-los.
Um postulado pode ser enunciado nos termos
de que, se est na imagem, existe; ou, tratandose de fotografia, se est na foto, existiu e pode
ou no ainda existir. Na esteira dessa lgica,
ento, seria aceitvel considerar que esquecer
humano e lembrar fotogrfico. Se remontarmos
s nossas experincias, considerando o lbum de
famlia, seguramente a maioria de ns dar como
depoimento a surpresa do encontro com o
passado. A palavra encontro talvez seja um
superlativo do que realmente acontece, visto que
o mximo que a fotografia nos oferece a
possibilidade de uma projeo do aproximar-se
com o que foi. H uma tendncia em
acreditarmos na foto, desde, claro, que a
informao nela contida no ........ nossas
certezas projetadas em imagens mentais sobre o
passado. Uma personagem de Virginia Wolf
comenta: No possumos as palavras. Elas esto
por trs dos olhos, no sobre os lbios. E sem as
palavras, o que contariam as fotografias? Talvez
no possam contar, mas seguramente alguma
coisa do passado vem evocada nelas, como a
dvida, ou no mnimo a nostalgia daquele fato
fragmentado em imagem, na referncia a outra
pessoa em uma festa perdida na lembrana.

01. Assinale
a
alternativa
que
preenche
corretamente as lacunas das linhas 10, 12 e
42, nesta ordem.
(A) egnbil extinso dezestabilise
(B) ignbil

estino desestabilize

(C) egnbil extino desestabilise


(D) ignobil

extinso dezestabilize

(E) ignbil

extino desestabilize

02. Em seu sentido global, o texto afirma que


(A) as fotografias de crianas, festas,
reunies de famlia so sempre registros
da prosaica felicidade de que se constitui
o cotidiano.
(B) as imagens do passado suscitam
sentimentos de nostalgia ou dvida, mas
no
permitem
a
construo
de
conhecimentos acerca desse passado.
(C) as fotografias, embora no recontem o
passado que registram, so indcios que
permitem sua recordao.
(D) as imagens mentais de cenas vividas no
passado no podem ser refutadas por
registros fotogrficos.
(E) a fotografia, ao contrrio das palavras,
reproduz fielmente a realidade e, como
tal, prova mais confivel de sua
existncia.
03. Considere as seguintes propostas
substituio de palavras do texto.

Adaptado de: MICHELON, F. F. Introduo. In:


MICHELON, F. F.; TAVARES, F. S. (orgs.). Fotografia e
memria. Pelotas, RS: EdUFPel, 2008. p. 7-15.
UFRGS CV/2013 LP

de

1 - vestgios (l. 02) por resqucios.


2 - superar (l. 17) por vencer.
3 - nostalgia (l. 50) por lembrana.
Quais propostas indicam que a segunda
palavra constitui sinnimo adequado da
primeira, considerando o contexto em que
esta ocorre?
(A) Apenas 1.
(B) Apenas 2.
(C) Apenas 3.
(D) Apenas 1 e 2.
(E) 1, 2 e 3.
3

146

04. A partir da linha 08 at o final do primeiro


pargrafo do texto, quantos verbos esto no
plural, em virtude de estabelecerem relao
com o segmento os habitantes do futuro
(l. 07-08)?

06. Considere as seguintes afirmaes a respeito


do emprego correto de tempos verbais no
texto.

(A) Trs.
(B) Quatro.
(C) Cinco.
(D) Seis.
(E) Sete.
05. Nas alternativas abaixo, so sugeridas
reordenaes de segmentos do texto.
Desconsiderando mudanas de pontuao,
assinale aquela em que se mantm o sentido
da frase original.
(A) Deslocamento de por acaso (l. 08) para
imediatamente depois de soterrado (l. 09).

I - A supresso da expresso quem sabe


(l. 10) tornaria necessria a alterao
do tempo verbal empregado nas
deduziriam
(l.
10)
e
formas
suspirariam (l. 11).
II - A supresso do advrbio talvez (l. 36)
tornaria necessria a alterao do modo
verbal empregado na forma seja (l. 36).
III- A forma verbal possam (l. 48) poderia
ser substituda por pudessem, sem a
necessidade de outras alteraes das
formas verbais no seguimento da frase.
Quais esto corretas?

(B) Antecipao de cruz-los (l. 26) para


imediatamente depois da forma verbal
desejar (l. 25).

(A) Apenas I.

(C) Deslocamento do advrbio realmente


(l. 37) para imediatamente antes de
um superlativo (l. 36-37).

(C) Apenas I e III.

(D) Colocao de claro (l. 41) entre H


(l. 40) e uma (l. 40).

(B) Apenas II.


(D) Apenas II e III.
(E) I, II e III.

(E) Deslocamento de seguramente (l. 48)


para
imediatamente
antes
de
fragmentado (l. 51).
07. Para abordar o tema, a autora utiliza diferentes mecanismos de organizao interna dos pargrafos.
Na coluna da direita abaixo, esto listados esses mecanismos; na da esquerda, os pargrafos do
texto que correspondem presena ou ao predomnio desses mecanismos.
Associe adequadamente a coluna da direita da esquerda.
1 - Primeiro pargrafo (l. 01-16).

( ) Predomnio de mecanismos de contraste e de oposio,


indicados por nexos articuladores.

2 - Segundo pargrafo (l. 17-26).

( ) Presena de mecanismos de explicao e de concluso,


indicados por nexos articuladores.

3 - Terceiro pargrafo (l. 27-52).

( ) Predomnio de mecanismos de hipteses e de suposio,


indicados por conjunes.

( ) Presena do mecanismo de citao, indicado por sinal de


pontuao.
A sequncia correta de preenchimento dos parnteses, de cima para baixo,
(A)
(B)
(C)
(D)
(E)

1
1
2
2
3

2
3
3
2
1

3
2
1
1
2

1.
1.
3.
3.
3.

UFRGS CV/2013 LP

147

08. Considere a passagem do texto abaixo transcrita e as sugestes de reescrita que a seguem.

Um postulado pode ser enunciado nos termos de que, se est na imagem, existe; ou,
tratando-se de fotografia, se est na foto, existiu e pode ou no ainda existir (l. 27-30).
I - Pode-se enunciar um postulado nos seguintes termos: se est na imagem, existe; ou, tratandose de fotografia, se est na foto, existiu e pode ou no ainda existir.
II - Tratando-se de fotografia, um postulado pode enunciar-se nos seguintes termos: se est numa
foto ou numa imagem, existiu e pode ou no existir ainda.
III- Pode ser postulado um enunciado nos seguintes termos: se est na imagem, existe; ou seja,
tratando-se de fotos, se est numa fotografia, existiu e no pode ainda existir.
Quais propostas mantm a correo e o sentido original do trecho?
(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e II.
(E) I, II e III.

09. Assinale a alternativa que, de acordo com o texto, pode substituir adequadamente os nexos de
articulao textual ento (l. 31), visto que (l. 37) e mas (l. 48), nesta ordem.
(A) portanto

uma vez que pois

(B) portanto

uma vez que porm

(C) com efeito por isso

pois

(D) com efeito por isso

porm

(E) portanto

pois

por isso

UFRGS CV/2013 LP

148

Instruo: As questes de 10 a 17 esto


relacionadas ao texto abaixo.
01.
02.
03.
04.
05.
06.
07.
08.
09.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.

Em julho, na Nhecolndia, Pantanal de


Mato Grosso, encontrei um vaqueiro que
reunia em si, em qualidade e cor, quase tudo
o que ........ literatura empresta esparso aos
vaqueiros principais. Era to de carne-e-osso,
que nele no poderia empessoar-se o cedio e
fcil da pequena lenda. Apenas um
profissional esportista: um tcnico, amoroso
de sua oficina. Mas denso, presente, almado,
bom-condutor de sentimentos, crepitante de
calor humano, governador de si mesmo; e
inteligente. Essa pessoa, este homem, o
vaqueiro Jos Mariano da Silva, meu amigo.
Comeamos por uma conversa de trs
horas, ........ luz de um lampio, na copa da
Fazenda Firme. Eu tinha preciso de aprender
mais, sobre a alma dos bois, e instigava-o a
fornecer-me fatos, casos. Enrolado no
poncho, as mos plantadas definitivamente na
toalha da mesa, como as de um bicho em
vigia, ele procurava atender-me. Seu rosto, de
feitura franca, muito moreno, fino, tomava o
ar de seriedade, meio em excesso, de um
homem-de-ao posto em tarefa meditativa.
Contou-me muita coisa.
Falou do boi Carocongo. Do garrote
Guabiru que, quando chegava em casa, de
tardinha, berrava nove vezes, e s por isso
no o matavam, e porque tinha o berro mais
saudoso.
Da
vaquinha
Burivi,
que
acompanhava ao campo sua dona moa,
........ colher as guaviras, ou para postar-se
........ margem do poo, guardando o banho
dela, sem deixar vir perto nenhuma criatura.
Discorreu muito. Quando estacava, para
tomar flego ou recordao, fechava os olhos.
Prazia ver esse modo, em que eu o imaginava
tornado a sentir-se cavaleiro sozinho.
Ponderava, para me responder, truz e cruz,
no coloquial, misto de guasca e de mineiro.
O sono diminua os olhos do meu amigo;
era tarde, para quem precisava de levantar-se
com trevas ainda na terra, com os chopins
cantantes. Nos despedimos. O cu estava
extenso. Longe, os carands eram blocos
mais pretos, de um s contorno. As estrelas
rodeavam: estrelas grandes, prximas,
desengastadas. Um cavalo relinchou, rasgado
a distncia, repetindo. Os grilos, mil, mil, se
telegrafavam: que o Pantanal no dorme, que
o Pantanal enorme, que as estrelas vo

52.
53.
54.
55.

chover... Jos Mariano caminhava embora, no


andar bamboleado, cabea baixa, ruminando
seu cansao. Se abria e unia, com ele vaca
negra a noite, vaca.

Adaptado de: ROSA, Guimares. Estas histrias. 3. ed.


Rio de Janeiro: Nova Fronteira, 1985. p. 93-103.

10. Assinale
a
alternativa
que
preenche
corretamente as lacunas das linhas 04, 15, 32
e 33, nesta ordem.

(A) a a
(B) a a
(C) a
(D) a
(E) a a a

UFRGS CV/2013 LP

149

11. Na coluna da esquerda, abaixo, so listados modos diferentes de apresentao, pelo narrador, do
personagem, dos cenrios e dos acontecimentos; na coluna da direita, passagens que correspondem
caracterizao.
Associe corretamente a coluna da direita da esquerda.
1 - Apresentao de uma cena,
assemelhando-se a uma imagem
fotogrfica.
dos
2 - Movimento
cronolgico
acontecimentos da narrativa.
3 - Avaliao e sensaes do narrador
sobre
o
personagem
que
apresenta na narrativa.

( ) ...encontrei um vaqueiro...(l. 02)


( ) Enrolado no poncho, as mos plantadas
definitivamente na toalha da mesa, (l. 18-20)
( ) Contou-me muita coisa. (l. 25)
( ) Prazia ver esse modo, em que eu o

imaginava tornado a sentir-se cavaleiro


sozinho. (l. 37-38)

( ) O cu estava extenso. Longe, os carands


eram blocos mais pretos, de um s contorno.
(l. 44-46)

A sequncia correta de preenchimento dos parnteses, de cima para baixo,


(A) 1 3 2 2 1.
(B) 2 1 3 3 2.
(C) 2 1 2 3 1.
(D) 3 2 1 2 3.
(E) 3 3 2 3 1.
12. H no texto empregos do mecanismo de
formao de palavras por composio, como
recurso de estilo do autor.

13. Considere as seguintes afirmaes sobre o


sentido de passagens do texto.

Assinale a alternativa que apresenta dois


empregos desse mecanismo.
(A) qualidade e cor (l. 03) e alma dos
bois (l. 17)
(B) carne-e-osso (l. 05) e homem-de-ao
(l. 24)
(C) bom-condutor (l. 10) e toalha da
mesa (l. 20)
(D) bicho em vigia (l. 20-21) e em excesso
(l. 23)
(E) de tardinha (l. 27-28) e dona moa (l. 31)

I - A forma verbal empresta (l. 04) tem


sentido equivalente a confere e
concede no contexto.
II - O segmento que inicia em Seu rosto
(l. 21) e vai at o final daquele
pargrafo sugere que o personagem
demonstrou incapacidade para contar,
por esta ser tarefa meditativa.
III- O segmento que inicia em Ponderava
(l. 39) e vai at o final do pargrafo sugere
que, embora usasse palavras corriqueiras, o
vaqueiro dava respostas refletidas.
Quais esto de acordo com o texto?
(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e III.
(E) I, II e III.

UFRGS CV/2013 LP

150

14. Associe cada ocorrncia de sinal de pontuao,


esquerda, com o sentido, direita, que tal sinal
auxilia a expressar no contexto em que ocorre.
( ) Ponto-e-vrgula (l. 11)

1 - Explicao

( ) Vrgulas (l. 30-31)

2 - nfase

( ) Reticncias (l. 52)

3 - Exemplificao

16. Considere as propostas de reescrita abaixo


para o seguinte trecho.

O sono diminua os olhos do meu amigo;


era tarde, para quem precisava de
levantar-se com trevas ainda na terra,
com os chopins cantantes (l. 41-44).
I - Substituio de para quem (l. 42) por ele.

4 - Continuidade

II - Substituio de precisava (l. 42) por


necessitava.

A sequncia correta de preenchimento dos


parnteses, de cima para baixo,

III- Retirada da preposio de (l. 42) aps


precisava.

(A) 1 3 2.

Quais propostas so gramaticalmente corretas


e preservam o sentido original do trecho?

(B) 2 1 4.
(C) 2 3 1.

(A) Apenas I.

(D) 3 1 2.

(B) Apenas II.

(E) 1 4 2.

(C) Apenas I e II.

15. Assinale com V (verdadeiro) ou F (falso) as


afirmaes abaixo, referentes s relaes
sintticas e semnticas entre palavras e
expresses do texto.
( ) O emprego de as (l. 20) tem funo
pronominal, uma vez que retoma mos
(l. 19).

(D) Apenas II e III.


(E) I, II e III.
17. Considere as seguintes afirmaes sobre a
passagem Os grilos, mil, mil, se

( ) As palavras muita (l. 25) e muito (l. 35)


assinalam que o narrador intensifica o
fato de seu amigo, o vaqueiro, ser um
contador de vrios casos.
( ) As expresses do boi Carocongo (l. 26),
Do garrote Guabiru (l. 26-27) e Da
vaquinha Burivi (l. 30) complementam
o sentido do verbo Falou (l. 26).
( ) As palavras mais (l. 29) e pretos (l. 46)
modificam o sentido, respectivamente, de
berro (l. 29) e carands (l. 45). Por isso,
so adjetivos.
A sequncia correta de preenchimento dos
parnteses, de cima para baixo,

telegrafavam: que o Pantanal no


dorme, que o Pantanal enorme, que as
estrelas vo chover... (l. 49-52).

I - O segmento que o Pantanal no

dorme, que o Pantanal enorme,


que as estrelas vo chover (l. 50-52)

refere-se ao contedo dito pelos grilos em


seus cantos, constituindo, na narrativa, o
discurso indireto.

II - A relao do verbo telegrafavam (l. 50)


com o sujeito grilos (l. 49) produz um
sentido metafrico na narrativa.
III- Os dois-pontos marcam a insero de
uma enumerao de oraes que
constituem complementos para o verbo
telegrafavam (l. 50).
Quais esto corretas?

(A) F F F V.

(A) Apenas I.

(B) F V F F.

(B) Apenas II.

(C) V F V F.

(C) Apenas I e II.

(D) V F V V.

(D) Apenas I e III.

(E) V V V F.

(E) I, II e III.

UFRGS CV/2013 LP

151

Instruo: As questes de 18 a 25 esto


relacionadas ao texto abaixo.
01.
02.
03.
04.
05.
06.
07.
08.
09.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.

A pesquisa em gramtica tambm tem


seus mistrios aspectos da lngua que
ningum conseguiu at hoje formular direito.
Acho que no exagero se disser que a maioria
dos fenmenos gramaticais j observados no
tem uma explicao satisfatria. Vejamos um
exemplo.
Sabemos que, em muitas frases, o sujeito
exprime o ser que pratica a ao (ou, mais
exatamente, que causa o evento). Isso
acontece na frase: Minervina entortou meu
guarda-chuva. Acontece que, com o verbo
entortar, nem sempre o sujeito exprime quem
pratica a ao. Se no houver objeto, isto ,
se s houver o sujeito e o verbo, o sujeito
exprime quem sofre a ao, como em Meu
Essa
frase,
guarda-chuva
entortou.
naturalmente, no significa que o guardachuva praticou a ao de entortar alguma
coisa, mas que ele ficou torto. Mesmo se o
sujeito fosse o nome de uma pessoa (que, em
princpio, poderia praticar uma ao), o efeito
se verifica: Minervina entortou. Essa frase
quer dizer que Minervina ficou torta, no que
ela entortou alguma coisa.
A mudana de significado do sujeito que
vimos acima acontece com muitos verbos do
portugus; por exemplo, quebrar, esquentar,
rasgar. Uma vez que bastante regular, esse
comportamento deve (ou deveria) ser includo
na gramtica portuguesa.
Agora, o mistrio: em certos casos, o
fenmeno da mudana de significado do
sujeito no ocorre, e ningum sabe ao certo
por qu. Assim, podemos dizer O leite
esquentou, e isso significa que o leite se
tornou quente, no que ele esquente alguma
coisa. Mas na frase Esse cobertor esquenta,
entende-se que o cobertor esquenta a gente
(isto , causa o aquecimento), e no que ele
se torne quente. Ningum sabe direito por
que verbos como esquentar (e vrios outros)
no se comportam como o esperado em
frases como essa. Provavelmente, o
fenmeno tem a ver com a situao evocada
pelo verbo. Mas falta ainda um estudo
sistemtico, e, por enquanto, esses fatos no
cabem em teoria nenhuma.
Enfim, para quem gosta de certezas e
seguranas, tenho ms notcias: a gramtica
no est pronta. Para quem gosta de
desafios, tenho boas notcias: a gramtica no

53. est pronta. Um mundo de questes e


54. problemas continua sem soluo, espera de
55. novas ideias, novas anlises, novas cabeas.
Adaptado de: PERINI, M. A. Pesquisa em gramtica. In:
Sofrendo a gramtica: ensaios sobre linguagem. So
Paulo: tica, 2000. p. 82-85.

18. Assinale
a
alternativa
que
expressa
corretamente o sentido global do texto.

UFRGS CV/2013 LP

(A) A gramtica um campo de investigao


no qual muito do que j foi observado
permanece
apenas
parcialmente
compreendido.
(B) A gramtica sempre uma teoria
inacabada, em virtude da dinmica das
lnguas, que mudam constantemente.
(C) A gramtica um campo pouco propcio
queles que gostam de certezas, pois no
d lugar ao estabelecimento de normas.
(D) Os verbos em portugus, conforme se
pode constatar por meio da reunio de
vrios exemplos, ainda no foram
estudados sistematicamente.
(E) A gramtica um conjunto de
generalizaes sintticas que expressam
comportamentos regulares de expresses
de uma lngua.

152

19. Assinale com V (verdadeiro) ou F (falso) as


afirmaes abaixo, referentes a relaes entre
convenes ortogrficas e pronncia de
palavras empregadas no texto.

21. Este texto dirigido ao pblico em geral,


valendo-se o autor de diversos recursos
textuais para se aproximar do leitor.
Considere as seguintes afirmaes, a respeito
desses recursos.

( ) A regra de acentuao grfica vlida para


a palavra mistrios (l. 02) pode ser
includa na mesma que rege o emprego
de acento grfico em gramtica (l. 01) e
sistemtico (l. 47).

I - O emprego da primeira pessoa do plural


Vejamos (l. 06) e vimos (l. 27) inclui
autor e leitor na ao descrita, o que cria
um efeito de participao conjunta no
desenvolvimento da argumentao.

( ) O som representado pela letra /s/ na


palavra conseguiu (l. 03) representado
por duas outras letras na palavra
explicao (l. 06).

II - O emprego de expresses como Acontece


que (l. 12) sabe direito (l. 41) e Um
mundo (l. 53) remete a usos coloquiais da
lngua portuguesa.

( ) O acento grfico em (l. 14)


diferencial; ou seja, no corresponde a
nenhuma distino de pronncia relativa
forma no acentuada.

III- O emprego de pronomes oblquos em


posies variadas, como em entende-se
(l. 39) e se torne (l. 41) s se justifica
pela coloquialidade do texto, uma vez
que, nas convenes de escrita padro do
portugus, o pronome s pode ocorrer
depois do verbo.

( ) A palavra significa (l. 18), na pronncia


coloquial, permite a ocorrncia de uma
vogal no representada na forma
ortogrfica.

Quais esto corretas?

A sequncia correta de preenchimento dos


parnteses, de cima para baixo,

(A) Apenas I.

(A) V F V F.

(C) Apenas I e II.

(B) Apenas II.


(D) Apenas II e III.

(B) V V F V.

(E) I, II e III.

(C) F V V V.
(D) V V F F.

22. Considere as seguintes afirmaes acerca da


formao de palavras por derivao.

(E) F F V V.
20. Assinale a alternativa em que se estabelece
uma relao correta entre um pronome ou
expresso e aquilo a que se refere.
(A) seus mistrios (l. 02) mistrios da
pesquisa em gramtica
(B) que (l. 02) lngua
(C) ela (l. 25) essa frase
(D) esse comportamento (l.
comportamento das frases

29-30)

(E) ele (l. 37) o fenmeno da mudana de


significado

I - Os verbos engravidar, endireitar e


ensacar so formados pela adio de
prefixo e sufixo a adjetivos, de modo
semelhante a entortar (l. 13).
II - A adio de prefixo e sufixo pode derivar
um verbo a partir de portugus (l. 28).
III- O substantivo aquecimento (l. 40)
formado pela adio de um sufixo a um
verbo.
Quais esto corretas?
(A) Apenas II.
(B) Apenas III.
(C) Apenas I e II.
(D) Apenas II e III.
(E) I, II e III.

10

UFRGS CV/2013 LP

153

23. Considere as seguintes sugestes de alterao


de segmentos do texto.

25. Considere os seguintes verbos do portugus.

I - O pronome quem (l. 16) poderia ser


substitudo por aquele que, neste
contexto, sem prejuzo da correo da
frase em questo.
II - O pronome ele (l. 20) poderia ser elidido
da orao, sem prejuzo da correo e da
referncia a guarda-chuva (l. 18-19).
III- A substituio da forma verbal vimos
(l. 27) por nos ocupamos acarretaria
outra alterao na frase para ajuste de
regncia.
Quais esto corretas?

1 - amassar
2 - entrar
3 - entregar
4 - secar
Assinale a alternativa que apresenta os verbos
que tm o mesmo comportamento daqueles
listados nas linhas 28-29.
(A) 1 4.
(B) 1 2.
(C) 1 3.
(D) 2 4.

(A) Apenas I.

(E) 2 3.

(B) Apenas II.


(C) Apenas III.
(D) Apenas I e III.
(E) I, II e III.
24. Considere as seguintes sugestes de alterao
da pontuao do texto.
I - Supresso das vrgulas que isolam o
adjunto adverbial naturalmente (l. 18).
II - Substituio dos parnteses da linha 30
por vrgulas.
III- Supresso dos parnteses que separam e
vrios outros (l. 42).
Quais delas poderiam ser realizadas,
mantendo-se a correo da frase?
(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e II.
(E) I, II e III.

UFRGS CV/2013 LP

11

154

2014
LNGUA PORTUGUESA
Instruo: As questes de 01 a 11 esto
relacionadas ao texto abaixo.
01.
02.
03.
04.
05.
06.
07.
08.
09.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.

O que havia de to revolucionrio na


Revoluo Francesa? Soberania popular,
liberdade civil, igualdade perante a lei as
palavras hoje so ditas com tanta facilidade
que somos incapazes de imaginar seu carter
explosivo em 1789. Para os franceses do
Antigo Regime, os homens eram desiguais, e a
desigualdade era uma boa coisa, adequada
ordem hierrquica que fora posta na natureza
pela prpria obra de Deus. A liberdade
significava privilgio isto , literalmente, lei
privada, uma prerrogativa especial para fazer
algo negado a outras pessoas. O rei, como
fonte de toda a lei, distribua privilgios, pois
havia sido ungido como o agente de Deus na
terra.
Durante todo o sculo XVIII, os filsofos
do
Iluminismo
questionaram
esses
pressupostos, e os panfletistas profissionais
conseguiram empanar a aura sagrada da coroa.
Contudo, a desmontagem do quadro mental
do Antigo Regime demandou violncia
iconoclasta,
destruidora
do
mundo,
revolucionria.
Seria timo se pudssemos associar a
Revoluo exclusivamente Declarao dos
Direitos do Homem e do Cidado, mas ela
nasceu na violncia e imprimiu seus princpios
em um mundo violento. Os conquistadores da
Bastilha no se limitaram a destruir um
smbolo do despotismo real. Entre eles, 150
foram mortos ou feridos no assalto priso e,
quando os sobreviventes apanharam o
diretor, cortaram sua cabea e desfilaram-na
por Paris na ponta de uma lana.
Como podemos captar esses momentos de
loucura, quando tudo parecia possvel e o
mundo se afigurava como uma tbula rasa,
apagada por uma onda de comoo popular e
pronta para ser redesenhada? Parece incrvel
que um povo inteiro fosse capaz de se
levantar e transformar as condies da vida
cotidiana. Duzentos anos de experincias com
admirveis mundos novos tornaram-nos
cticos quanto ao planejamento social.
Retrospectivamente, a Revoluo pode
parecer um preldio ao totalitarismo.
Pode ser. Mas um excesso de viso
histrica retrospectiva pode distorcer o
panorama de 1789. Os revolucionrios
franceses no eram nossos contemporneos.
E eram um conjunto de pessoas no

53.
54.
55.
56.
57.
58.
59.
60.
61.

excepcionais em circunstncias excepcionais.


Quando as coisas se desintegraram, eles
reagiram a uma necessidade imperiosa de
dar-lhes sentido, ordenando a sociedade
segundo novos princpios. Esses princpios
ainda permanecem como uma denncia da
tirania e da injustia. Afinal, em que estava
empenhada a Revoluo Francesa? Liberdade,
igualdade, fraternidade.

Adaptado de: DARNTON, Robert. O beijo de Lamourette.


In: ____. O beijo de Lamourette: mdia, cultura e
revoluo. So Paulo: Cia. das Letras, 2010. p. 30-39.

01. Em seu sentido global, o texto


(A) sustenta que o carter aparentemente
libertrio da Revoluo Francesa era, de
fato, tirano e injusto.
(B) expe os sistemas filosficos do
Iluminismo.
(C) explica a Revoluo Francesa, com base
no conflito entre ideias Iluministas
panfletrias e o quadro mental do Antigo
Regime.
(D) enfatiza a importncia dos princpios
defendidos na Revoluo Francesa,
apesar da violncia nela presente.
(E) alerta para a irrelevncia de se julgar de
modo crtico a Revoluo Francesa,
retrospectivamente.
02. Embora no descreva a Revoluo Francesa,
arrolando fatos e elementos de seu contexto
histrico, vrios desses fatos e elementos so
mencionados no texto. Considere as seguintes
afirmaes relacionadas a essas menes.

UFRGS CV/2014 LP

I - A Revoluo Francesa esteve relacionada


a um fenmeno histrico denominado
Antigo Regime.
II - A data de 1789 apresentada como
marco temporal no qual o processo
denominado Revoluo Francesa atinge
seu limite.
III- A conquista de uma priso denominada
Bastilha, cujo diretor foi degolado, um
fato relevante na Revoluo Francesa.
Que afirmaes podem ser inferidas a partir
das informaes contidas no texto?
(A)
(B)
(C)
(D)
(E)

Apenas I.
Apenas II.
Apenas III.
Apenas I e III.
I, II e III.
3

155

03. Assinale a alternativa que contm a correta


passagem de um segmento que ocorre em
voz passiva no texto para a voz ativa.

05. Na coluna da esquerda, esto quatro palavras


retiradas do texto; na coluna da direita,
descries relacionadas formao dessas
palavras.

(A) dizemos as palavras hoje com tanta


facilidade... (l. 03- 04)

Associe corretamente a coluna da esquerda


da direita.

(B) que a prpria obra de Deus pusera


na natureza. (l. 09-10)
(C) pois o agente de Deus na terra o
ungira. (l. 14-16)
(D) Entre eles, 150 feriram-se ou
mataram-se no assalto priso...
(l. 31-32)
(E) Afinal, em que se empenhou
Revoluo Francesa? (l. 59-60)

( ) desiguais (l. 07)

1 -.contm sufixo que


forma substantivos a
partir de verbos

( ) pressupostos (l. 19)

2 -.contm prefixo com


sentido de negao
.

( ) totalitarismo (l. 47)

na forma
linha 25
o futuro do
Seria, na

4 -.contm sufixo que


designa movimentos
ideolgicos
.

A sequncia correta de preenchimento dos


parnteses, de cima para baixo,

I - O emprego do pretrito imperfeito ao


longo do primeiro pargrafo, a partir da
linha 07, d aos eventos narrados um
carter de continuidade, estabelecendo as
caractersticas do Antigo Regime como
um pano de fundo.

III- O emprego do pretrito


subjuntiva que ocorre na
exigido por sua relao com
pretrito do indicativo em
mesma linha.

( ) planejamento (l. 45) 3 -.contm prefixo que


designa anterioridade

04. Considere as seguintes afirmaes acerca do


emprego de tempos verbais no texto.

II - O emprego do pretrito perfeito no


segundo pargrafo representa o passado
de modo pontual.

(A) 4 2 3 1.
(B) 3 1 2 4.
(C) 2 3 1 4.
(D) 1 4 2 3.
(E) 1 2 3 4.
06. Ao referir-se ideia de lei privada como uma
explicao literal de privilgio (l. 11-12), o autor
est fazendo referncia origem latina dessa
palavra, relacionada a algumas das formas que
tomava, naquela lngua, a palavra equivalente a
lei por exemplo, legis.
Considere as seguintes palavras do portugus.

Quais esto corretas?

1 - legal
2 - legio

(A) Apenas I.

3 - legtimo

(B) Apenas II.

4 - legvel

(C) Apenas III.

Quais tm tambm relao semntica com a


palavra lei, revelando, por sua forma, a
origem latina?

(D) Apenas I e III.


(E) I, II e III.

(A) Apenas 1 e 3.
(B) Apenas 1, 3 e 4.
(C) Apenas 2 e 3.
(D) Apenas 2 e 4.
(E) 1, 2, 3 e 4.
UFRGS CV/2014 LP

156

07. Assinale a alternativa que apresenta


sinnimos para as palavras especial (l. 12),
empanar (l. 20) e cticos (l. 45), no
contexto em que ocorrem.
(A) notvel

anular

10. Considere
as
seguintes
afirmaes
relacionadas a sentidos do terceiro pargrafo
do texto.
I - O emprego da conjuno se e dos tempos
e modos verbais na linha 25 sinalizam que a
Revoluo Francesa no pode ser
exclusivamente associada Declarao dos
Direitos do Homem e do Cidado.

descrentes

(B) maravilhosa embaar

desfavorveis

(C) exclusiva

obscurecer descrentes

(D) exclusiva

anular

(E) notvel

obscurecer desfavorveis

II - O emprego de no se limitaram (l. 30)


expressa que os conquistadores destruram
um smbolo e fizeram algo alm disso.

08. Considere as seguintes ocorrncias de artigo


no texto.

III- O emprego do nome prprio Paris (l. 35)


localiza a sociedade sobre a qual incidem
os novos princpios revolucionrios.

incrdulos

I - O artigo definido na linha 15.

Quais esto corretas?

II - O artigo definido singular na linha 17.


III- O artigo definido na linha 46.

(A) Apenas I.

Quais poderiam ser omitidos, preservando a


correo de seus contextos?

(B) Apenas II.

(A) Apenas I.

(D) Apenas I e II.

(B) Apenas II.

(E) I, II e III.

(C) Apenas III.

(C) Apenas III.


(D) Apenas I e II.
(E) I, II e III.

09. Considere a seguinte definio de metonmia.

11. A separao de alguns adjuntos adverbiais


antecipados opcional em portugus, e, em
alguns casos, realizada para dar-lhes
destaque. Considere, nessa perspectiva, as
seguintes sugestes de alterao de emprego
de vrgula com relao ao texto.

A metomnia figura de linguagem em que se


emprega uma palavra que tem uma relao de
contiguidade com o referente expresso; por
exemplo, pode-se expressar o sentido do todo
pelo uso de uma palavra que refere uma parte.

1 - Insero de vrgula imediatamente aps


novos (l. 44).

Assinale a alternativa em que a palavra


sublinhada um emprego de metonmia no
respectivo trecho do texto.

3 - Insero de vrgula imediatamente aps


histrica (l. 49).

(A) ungido como o agente de Deus (l. 15).


(B) a aura sagrada da coroa (l. 20).
(C) um smbolo
(l. 30-31).

do

despotismo real

2 - Retirada
da
vrgula
que
ocorre
imediatamente aps Retrospectivamente
(l. 46).

4 - Retirada
da
vrgula
que
ocorre
imediatamente aps desintegraram (l. 54).
Quais preservariam a correo em termos de
pontuao?
(A) Apenas 1.

(D) na ponta de uma lana (l. 35).

(B) Apenas 2.

(E) preldio ao totalitarismo (l. 47).

(C) Apenas 1 e 4.
(D) Apenas 2 e 4.
(E) Apenas 3 e 4.

UFRGS CV/2014 LP

157

Instruo: As questes 12 a 19
relacionadas ao texto abaixo.
01.
02.
03.
04.
05.
06.
07.
08.
09.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.

esto

O menino sentado minha frente meu


irmo, assim me disseram; e bem pode ser
verdade, ele regula pelos dezessete anos,
justamente o tempo em que estive solto no
mundo, sem contato nem notcia.
A princpio quero trat-lo como intruso,
mostrar-lhe ........ minha hostilidade, no
abertamente para no choc-lo, mas de
maneira a no lhe deixar dvida, como se lhe
perguntasse com todas as letras: que direito
tem voc de estar aqui na intimidade de
minha famlia, entrando nos nossos segredos
mais ntimos, dormindo na cama onde eu
dormi, lendo meus velhos livros, talvez
sorrindo das minhas anotaes margem,
tratando meu pai com intimidade, talvez
discutindo a minha conduta, talvez at
criticando-a? Mas depois vou notando que ele
no totalmente estranho. De repente fereme ........ ideia de que o intruso talvez seja
eu, que ele tenha mais direito de hostilizar-me
do que eu a ele, que vive nesta casa h
dezessete anos. O intruso sou eu, no ele.
Ao pensar nisso vem-me o desejo urgente
de entend-lo e de ficar amigo. Fao-lhe
perguntas e noto a sua avidez em respondlas, mas logo vejo a inutilidade de prosseguir
nesse caminho, as perguntas parecem-me
formais e as respostas foradas e
complacentes.
Tenho tanta coisa a dizer, mas no sei
como comear, at a minha voz parece ter
perdido a naturalidade. Ele me olha, e vejo
que est me examinando, procurando decidir
se devo ser tratado como irmo ou como
estranho, e imagino que as suas dificuldades
no devem ser menores do que as minhas.
Ele me pergunta se eu moro em uma casa
grande, com muitos quartos, e antes de
responder procuro descobrir o motivo da
pergunta. Por que falar em casa? E qual a
importncia de muitos quartos? Causarei
inveja nele se responder que sim? No, no
tenho casa, h muitos anos que tenho
morado em hotel. Ele me olha, parece que
fascinado, diz que deve ser bom viver em
hotel, e conta que, toda vez que faz reparos
........ comida, mame diz que ele deve ir para
um hotel, onde pode reclamar e exigir. De
repente o fascnio se transforma em alarme, e
ele observa que se eu vivo em hotel no
posso ter um co em minha companhia, o

53.
54.
55.
56.
57.

jornal disse uma vez que um homem foi


processado por ter um co em um quarto de
hotel. Confirmo ........ proibio. Ele suspira e
diz que ento no viveria em um hotel nem de
graa.
Adaptado de: VEIGA, Jos J. Entre irmos. In:
MORICONI, talo M. Os Cem Melhores Contos
Brasileiros do Sculo. Rio de Janeiro: Objetiva,
2001. p. 186-189

12. Assinale
a
alternativa
que
preenche
corretamente as lacunas das linhas 07, 20, 48
e 55, nesta ordem.
(A) a a
(B) a a
(C) a a
(D) a a a
(E) a a

13. Assinale
a
alternativa
que
expressa,
adequadamente, o sentido global do texto.
(A) O narrador-personagem retorna para casa,
porque deseja estar com a sua famlia e
se aproximar do irmo.
(B) O narrador-personagem sai do quarto do
hotel, porque no pde ter um co como
companhia.
(C) O irmo do narrador-personagem, por ter
aproximadamente dezessete anos, vive
em casa com os pais.
(D) O narrador-personagem, ao conhecer seu
irmo, vive um conflito relacionado falta
de intimidade e busca de proximidade
com ele.
(E) O narrador-personagem distancia-se de
sua casa, porque considera seu irmo um
estranho e um intruso na famlia.

UFRGS CV/2014 LP

158

14. Na coluna da direita, abaixo, esto presentes ideias que resumem o sentido de pargrafos do texto;
na da esquerda, indicaes desses pargrafos.
Associe adequadamente a coluna da direita da esquerda.
1 - Primeiro pargrafo (l. 01-05)
2 - Segundo pargrafo (l. 06- 23)

( ) Desejo do narrador-personagem de
aproximar-se do irmo.

3 - Terceiro pargrafo (l. 24-30)

( ) Contato inicial entre os irmos.

4 - Quarto pargrafo (l. 31-57)

( ) Momento de aproximao
irmos por meio do dilogo.

dos

( ) Momento em que o narradorpersonagem depara-se com o conflito


entre o distante e o familiar.
A sequncia correta de preenchimento dos parnteses, de cima para baixo,
(A) 2 1 4 3.
(B) 2 1 3 4.
(C) 3 1 4 2.
(D) 1 3 4 2.
(E) 3 1 2 4.
15. Considere as seguintes afirmaes, referentes
interpretao de palavras e segmentos do texto.

16. Considere as afirmaes abaixo, sobre os usos


de e e mas no texto.

I - A substituio de nem (l. 05) por ou


mantm a ideia de privao contida no
segmento.
II - As ocorrncias do advrbio talvez, no
segundo pargrafo (l. 06-23), em sua
relao
com
as
formas
verbais
perguntasse (l. 10), seja (l. 20) e
tenha (l. 21) indicam dvidas e hipteses
do narrador.
III- As formas muitos (l. 42) e muitos (l. 44)
so de mesma classe gramatical e, na
relao com outras formas no texto,
apresentam o mesmo sentido.

I - Nas linhas 08, 18 e 27, a conjuno mas


tem o papel de mostrar, por meio de
oposies de sentido, os conflitos do
narrador-personagem.
II - Na linha 41, a conjuno E funciona como
um articulador das dvidas do irmo do
narrador-personagem sobre o motivo da
pergunta.
III- Nas linhas 47, 50 e 55, a conjuno e,
alm de estabelecer relao aditiva entre
oraes de idntica funo, tambm
sinaliza a mudana de aes na narrativa.
Quais esto corretas?

Quais esto corretas?


(A) Apenas I.

(A) Apenas I.

(B) Apenas II.

(B) Apenas II.

(C) Apenas I e II.

(C) Apenas I e III.

(D) Apenas II e III.

(D) Apenas II e III.

(E) I, II e III.

(E) I, II e III.

UFRGS CV/2014 LP

159

17. Associe cada ocorrncia de sinal de pontuao esquerda com a funo, direita, que tal sinal
auxilia a expressar no contexto em que ocorre.
( ) dois pontos (l. 10)

1 Assinala explicao do narrador-personagem.

( ) vrgula (l. 22)

2 Assinala sujeitos distintos em perodo coordenado.

( ) vrgula (l. 33)

3 Assinala a introduo de uma pergunta, em forma direta,


suposta pelo narrador-personagem.
4 Assinala enumerao de aes do irmo do narradorpersonagem.

A sequncia correta de preenchimento dos parnteses, de cima para baixo,


(A) 3 1 2.
(B) 3 2 1.
(C) 2 1 4.
(D) 1 4 2.
(E) 1 2 3.
18. Se as expresses perguntas (l. 26), as perguntas (l. 28) e as respostas (l. 29) fossem
substitudas, respectivamente, por uma pergunta, a pergunta e a resposta, quantas outras
alteraes seriam necessrias no texto, para fins de concordncia?
(A) 1.
(B) 2.
(C) 3.
(D) 4.
(E) 5.
19. O texto apresenta distintos participantes narrador como personagem principal, seu irmo e sua me.
Assinale com V (verdadeiro) ou F (falso) as afirmaes abaixo, acerca do modo de aparecimento
das vozes dos personagens no interior do texto.
( ) A sequncia Ele me pergunta se eu moro em uma casa grande, com muitos quartos (l. 38-39)
revela a fala, em discurso direto, do irmo do narrador-personagem.
( ) O narrador-personagem pergunta para seu irmo: Por que falar em casa? (l. 41).
( ) A sequncia iniciada por No, no tenho casa, h muito tempo que tenho morado em
hotel (l. 43-45) revela o dilogo do narrador-personagem com seu irmo.
( ) O texto apresenta a voz da me do narrador-personagem, em discurso direto, dizendo para seu
irmo que ele deveria ir para um hotel.
A sequncia correta de preenchimento dos parnteses, de cima para baixo,
(A) F F V F.
(B) F F V V.
(C) V V F V.
(D) V F F F.
(E) F V V V.
UFRGS CV/2014 LP

160

Instruo: As questes de 20 a 25 esto


relacionadas ao texto abaixo.
01.
02.
03.
04.
05.
06.
07.
08.
09.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.

Entre as situaes lingusticas que o


portugus j viveu em seu contato com outras
lnguas, cabe considerar uma situao que se
realiza em nossos dias: aquela em que ele
uma lngua de emigrantes. Para o leitor
brasileiro, soar talvez estranho que falemos
aqui do portugus como uma lngua de
EMIGRANTES, pois o Brasil foi antes de mais
nada um pas para o qual se dirigiam em
massa, durante mais de dois sculos, pessoas
nascidas em vrios pases europeus e
asiticos; assim, para a maioria dos
brasileiros, a representao mais natural a
da convivncia no Brasil com IMIGRANTES
vindos de outros pases. Sabemos, entretanto,
que, nos ltimos cem anos, muitos falantes
do portugus foram buscar melhores
condies de vida, partindo no s de
Portugal para o Brasil, mas tambm desses
dois pases para a Amrica do Norte e para
vrios pases da Europa: em certo momento,
na dcada de 1970, viviam na regio
parisiense mais de um milho de portugueses
uma populao superior que tinha ento a
cidade de Lisboa. Do Brasil, tm ........ nas
ltimas
dcadas
muitos
jovens
e
trabalhadores, dirigindo-se aos quatro cantos
do mundo.
A existncia de comunidades de imigrantes
sempre uma situao delicada para os
prprios imigrantes e para o pas que os
recebeu: normalmente, os imigrantes vo a
pases que tm interesse em usar sua fora
de trabalho, mas qualquer oscilao na
economia faz com que os nativos ........ sua
presena como indesejvel; as diferenas na
cultura e na fala podem alimentar
preconceitos e desencadear problemas reais
de diferentes ordens.
Em geral, proteger a cultura e a lngua do
imigrante no um objetivo prioritrio dos
pases hospedeiros, mas no caso do
portugus tem havido ........ . Em certo
momento, o portugus foi uma das lnguas
estrangeiras mais estudadas na Frana; e, em
algumas cidades do Canad e dos Estados
Unidos, um mnimo de vida associativa tem
garantido a sobrevivncia de jornais editados
em portugus, mantidos pelas prprias
comunidades de origem portuguesa e
brasileira.

20. Assinale
a
alternativa
que
preenche
corretamente as lacunas das linhas 25, 35 e
43, nesta ordem.
(A) imigrado

incarem excees

(B) emigrado incarem excees


(C) emigrado encarem excees
(D) imigrado

encarem excesses

(E) emigrado encarem excesses


21. Assinale
a
alternativa
que
expressa
corretamente o sentido global do texto.
(A) Os preconceitos vividos por falantes de
lngua portuguesa que moram em outros
pases.
(B) A situao lingustica, nos ltimos cem
anos, do portugus, como uma lngua de
emigrantes.
(C) A relao do imigrante com o pas de
origem, como modo de sobrevivncia no
pas hospedeiro.
(D) Os motivos culturais de emigrao dos
falantes do portugus do Brasil e de
Portugal para outros pases.
(E) A circulao de publicaes em lngua
portuguesa em pases nos quais h
imigrantes brasileiros e portugueses.
22. Assinale a alternativa em que se estabelece
uma relao correta entre uma expresso e
aquilo a que se refere.
(A) aquela (l. 04) lngua
(B) aqui (l. 07) Brasil
(C) o qual (l. 09) Brasil
(D) que (l. 24) cidade de Lisboa
(E) sua presena (l. 35-36) presena dos
imigrantes

Adaptado de: ILARI, Rodolfo; BASSO, Renato. O


portugus como lngua de emigrantes. In:___. O
portugus da gente: a lngua que estudamos a lngua
que falamos. So Paulo: Contexto, 2006. p. 42-43.
UFRGS CV/2014 LP

161

23. Desconsiderando questes de emprego de


letra maiscula, assinale a alternativa em que
se sugere um deslocamento de adjunto
adverbial que preservaria tanto a correo
quanto o sentido do segmento original.

25. Considere as seguintes sugestes de alterao


de segmentos do texto.

(A) Colocao de Para o leitor brasileiro


(l. 05-06) entre vrgulas, imediatamente
aps aqui (l. 07).
(B) Deslocamento de entretanto (l. 15) para
imediatamente aps partindo (l. 18).
(C) Passagem de tambm (l. 19) para
imediatamente aps e (l. 20).
(D) Deslocamento de normalmente (l. 32)
para imediatamente aps usar (l. 33).
(E) Colocao de Em geral (l. 40) entre
vrgulas, imediatamente aps (l. 41).

I - A forma (l. 24) poderia ser substituda


por quela, porque no acarretaria
problemas de uso da norma culta do
portugus.
II - A preposio para poderia ser substituda
por entre na linha 30 e elidida na linha 31,
preservando a correo e o sentido do
trecho original.
III- A preposio com (l. 35) poderia ser
elidida da orao sem prejuzo da
correo gramatical.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.

24. Considere as seguintes afirmaes sobre o


sentido de passagens do texto.
I - A forma verbal soar (l. 06), no
contexto, tem sentido equivalente a emitir
som e falar.

(C) Apenas III.


(D) Apenas I e II.
(E) I, II e III.

II - A palavra representao (l. 13), no


contexto em que aparece, tem o sentido
de imagem ou ideia que se concebe do
mundo.
III- O segmento dirigindo-se aos quatro
cantos do mundo (l. 27-28) refere-se
ao fato de trabalhadores e jovens
brasileiros dirigirem-se a quatro pases:
Portugal, Frana, Canad e Estados
Unidos.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e III.
(E) I, II e III.

UFRGS CV/2014 LP

10

162

2011
BIOLOGIA
01. Aps publicar os resultados de seus experimentos que levaram construo da primeira clula
bacteriana controlada por um genoma sinttico, Craig Venter declarou: Esta a primeira criatura
do planeta capaz de se replicar cujo pai um computador.
Em relao a esse experimento inovador, correto afirmar que
(A) o genoma sinttico construdo equivalia ao de uma bactria com um dos maiores genomas
conhecidos.
(B) um erro na insero de uma nica base nitrogenada no genoma sinttico pode prejudicar o
funcionamento do genoma.
(C) o genoma sinttico desenvolveu seu prprio citoplasma.
(D) o DNA da bactria hospedeira foi retirado de seu ncleo celular.
(E) as bactrias so organismos especiais para esse tipo de experimento por no apresentarem
recombinao gentica.
02. A farinha popularizada com o nome de rao
humana o resultado de uma mistura de
produtos base de fibras. Uma receita
amplamente difundida dessa farinha contm
os seguintes componentes: fibra de trigo, leite
de soja em p, linhaa marrom, acar
mascavo, aveia em flocos, gergelim com
casca, grmen de trigo, gelatina sem sabor,
guaran em p, levedura de cerveja e cacau
em p.

03. A figura abaixo mostra dois peixes


identificados pelos nmeros 1 e 2 que
apresentam adaptaes fisiolgicas para
sobreviver em diferentes ambientes. As setas
indicam o fluxo de sais e de gua em cada
peixe.
1

2
GUA

Com base na receita e em seus constituintes,


assinale com V (verdadeiro) ou F (falso) as
afirmaes que seguem.
( ) A receita rica nas fontes alimentares de
vitaminas do complexo B.
( ) A levedura de cerveja utilizada em
pesquisa como modelo experimental.
( ) A receita rica nas fontes alimentares
das vitaminas A e C.
( ) O acar mascavo no
restrio de uso pelos
dependentes de insulina.

apresenta
diabticos

A sequncia correta de preenchimento dos


parnteses, de cima para baixo,

SAIS

Peixe telesteo
de gua doce

SAIS

Peixe telesteo
marinho

Considere as seguintes afirmaes, sobre


caractersticas desses peixes.
I - O peixe 1 hipertnico em relao ao
ambiente.
II - O peixe 1 capta sais por transporte ativo.
III- O peixe 2 perde gua para o meio por
osmose.
Quais esto corretas?

(A) V V F F.

(A) Apenas I.

(B) V F V V.

(B) Apenas II.

(C) F V V F.

(C) Apenas I e III.

(D) F V F V.

(D) Apenas II e III.

(E) V F V F.

(E) I, II e III.

UFRGS CV/2011 BIO

GUA

163

04. Assinale
a
alternativa
que
preenche
corretamente as lacunas do enunciado abaixo,
na ordem em que aparecem.

06. A fotossntese consiste em um processo


metablico pelo qual a energia da luz solar
utilizada na converso de dixido de carbono
e de gua em carboidratos e oxignio.

Os
........
encontram-se
nos
centros
organizadores de ........ da maioria dos
eucariontes e esto envolvidos na formao
do fuso mittico.

Com relao a esse processo, considere as


seguintes afirmaes.
I - A produo de carboidratos ocorre na
etapa fotoqumica.

(A) ribossomos microfilamentos

II - A gua a fonte do oxignio produzido


pela fotossntese.

(B) lisossomos filamentos intermedirios


(C) centrolos

microtbulos

III- A etapa qumica ocorre no estroma dos


cloroplastos.

(D) ribossomos filamentos intermedirios


(E) centrolos

microfilamentos

Quais esto corretas?


(A) Apenas I.

05. A coluna da esquerda, abaixo, apresenta


diferentes fases da meiose; a da direita, as
fontes de variabilidade gentica de duas
dessas fases.

(B) Apenas II.


(C) Apenas I e III.
(D) Apenas II e III.

Associe adequadamente a coluna da direita


da esquerda.
1 - prfase I
2 - anfase I
3 - prfase II
4 - metfase II

(...) permutao
(...) segregao independente de homlogos

(E) I, II e III.
07. Assinale
a
alternativa
que
preenche
corretamente as lacunas do enunciado abaixo,
na ordem em que aparecem.

5 - anfase II
A sequncia correta de preenchimento dos
parnteses, de cima para baixo,

A ........ o processo no qual os folhetos


germinativos embrionrios so formados. Nos
vertebrados, o folheto denominado ........
originar o corao, os vasos e as clulas
sanguneas.

(A) 1 e 2.

(A) clivagem

ectoderma

(B) 2 e 3.

(B) gastrulao

mesoderma

(C) 3 e 4.

(C) neurulao

endoderma

(D) 4 e 5.

(D) clivagem

endoderma

(E) 5 e 1.

(E) gastrulao

ectoderma

UFRGS CV/2011 BIO

164

08. O esquema abaixo mostra alguns dos componentes do tecido conjuntivo frouxo.

Assinale a alternativa correta em relao ao tecido conjuntivo frouxo.


(A) Nele no ocorre vascularizao.
(B) Ele apresenta distribuio corporal restrita.
(C) A clula marcada com a seta 1 um fibroblasto.
(D) A clula marcada com a seta 2 uma hemcia.
(E) As fibras assinaladas com as setas 3 so de actina e miosina.
09. O Programa Nacional de Imunizao do Ministrio da Sade disponibiliza, na rede pblica, vacinas
imprescindveis para a sade de crianas de diferentes idades.
Assinale a alternativa que apresenta apenas doenas virais que podem ser prevenidas pelo uso de
vacinas previstas pelo programa citado.
(A) tuberculose

hepatite B

difteria

meningite

(B) poliomielite

ttano

pneumonia

febre amarela

(C) sarampo

febre tifide

coqueluche

hepatite B

(D) poliomielite

rubola

caxumba

sarampo

(E) difteria

ttano

coqueluche

varicela

10. Diversos rgos vegetais fazem parte de nossa alimentao.


Em termos biolgicos, a abbora, o tomate e o pimento constituem
(A) frutos verdadeiros.
(B) pseudofrutos.
(C) legumes.
(D) infrutescncias.
(E) frutos partenocrpicos.
UFRGS CV/2011 BIO

165

11. Alguns elementos qumicos denominados


macronutrientes so essenciais e necessrios,
em quantidades relativamente grandes, ao
crescimento vegetal.

14. Com relao s aves, considere as seguintes


afirmaes.
I - Elas apresentam taxa metablica elevada.
II - Suas penas atuam como isolante trmico.

So macronutrientes os elementos qumicos

III- Sua excreta nitrogenada a ureia.

(A) C, H, O.

Quais esto corretas?

(B) N, P, Cu.

(A) Apenas I.

(C) N, Fe, Ca.

(B) Apenas II.

(D) Ca, B, K.

(C) Apenas III.

(E) Na, P, K.

(D) Apenas I e II.


(E) I, II e III.

12. A planta denominada erva-de-passarinho


uma hemiparasita. Nesse caso, o tecido
vegetal da rvore hospedeira, onde os
elementos nutritivos so absorvidos, o

15. Um reduzido suprimento de sangue no


msculo cardaco de mamferos acarreta
(A) a diminuio do suprimento de oxignio.

(A) colnquima.

(B) o aumento do nmero de hemcias.

(B) floema.

(C) o aumento do nmero de mitocndrias.

(C) esclernquima.

(D) o aumento do metabolismo oxidativo.

(D) parnquima.

(E) a diminuio da concentrao de cido


lctico.

(E) xilema.

16. Recentemente, ocorreu um campeonato de


permanncia em sauna mida na Finlndia que
ocasionou a morte de um dos competidores.

13. Leia a tira abaixo.


A MINHOCA SERIA A FORMA
MAIS BAIXA DE VIDA QUE
EXISTE? NO CONSIGO PENSAR

Em relao capacidade termorreguladora


corporal na situao descrita, considere as
seguintes afirmaes.

EM OUTRA.

A PULGA!
A PULGA!

Adaptado de: VERISSIMO, Luis Fernando.


Terramagazine. So Paulo, 26 dez. 2006.

Invertebrados como os citados na tira tm em


comum

I - O calor produziu vasodilatao


capilares perifricos da pele.

dos

II - A presso arterial diminuiu.


III- O suor produzido reduziu a temperatura
da pele.
Quais esto corretas?

(A) exoesqueleto de quitina.

(A) Apenas I.

(B) circulao fechada.

(B) Apenas II.

(C) respirao traqueal.

(C) Apenas I e III.

(D) excreo por meio de nefrdeos.

(D) Apenas II e III.

(E) corpo metamerizado.

(E) I, II e III.

UFRGS CV/2011 BIO

166

17. Uma das tcnicas atualmente utilizadas para analisar casos de paternidade civil o emprego de
marcadores de microssatlites. Os microssatlites so repeties de trechos de DNA que ocorrem
em nmero varivel na populao. O nmero de repeties transmitido geneticamente.
A anlise de microssatlites foi utilizada em um teste de paternidade. A tabela abaixo apresenta os
resultados relativos ao nmero de repeties encontradas para a me, para o suposto pai e para o
filho, em diferentes locos.
Amostras de acordo com o
nmero de repeties

Me

Suposto pai

Filho

12 ; 13

9 ; 14

13 ; 14

32 ; 35

29 ; 32

35 ; 35

8 ; 10

10 ; 12

10 ; 10

7;9

6;9

7;7

12 ; 14

11 ; 12

12 ; 14

15 ; 17

15 ; 15

15 ; 15

18 ; 22

17 ; 19

21 ; 22

Locos

Com base nos dados apresentados na tabela, correto afirmar que


(A) apenas um indivduo, pela anlise, homozigoto para o loco 6.
(B) os locos 2, 4 e 7 excluem a possibilidade de paternidade do suposto pai.
(C) o filho heterozigoto para a maioria dos locos analisados.
(D) a me referida no me biolgica deste filho.
(E) os locos 1 e 3 excluem a possibilidade de paternidade do suposto pai.

18. As flores de uma determinada planta podem ser brancas, vermelhas ou creme. A cor branca
(ausncia de deposio de pigmento) condicionada por alelo recessivo (aa). O alelo A determina a
deposio de pigmento. O alelo dominante B produz pigmento vermelho, enquanto seu recessivo, a
cor creme. Cruzando-se plantas heterozigotas para os dois genes entre si, a probabilidade de
obtermos uma planta branca de
(A) 13/16.
(B) 14/16.
(C) 17/16.
(D) 19/16.
(E) 12/16.

UFRGS CV/2011 BIO

167

19. Em geral, os cromossomos sexuais de


mamferos fmeas consistem de um par de
cromossomos X. Machos possuem um
cromossomo X e um cromossomo sexual que
no encontrado em fmeas: o cromossomo Y.
Assinale com V (verdadeiro) ou F (falso) as
afirmaes abaixo, referentes ao sistema XY
de determinao sexual de mamferos.

21. Trs espcies diploides diferentes de plantas


da famlia do girassol, convivendo em uma
mesma rea geogrfica, geraram hbridos
frteis incapazes de cruzar com as espcies
ancestrais.
Essas
espcies
novas
se
espalharam por uma rea geogrfica maior
que a ocupada pelas espcies parentais.
Nesse caso, o processo e o mecanismo de
especiao que melhor se adaptam situao
descrita so, respectivamente,

( ) Os genes ligados ao cromossomo X so


os que apresentam como funo a
diferenciao sexual.
( ) Os cromossomos X e Y pareiam durante a
meiose.

(A) a alopatria e o efeito do fundador.


(B) a simpatria e a poliploidia.

( ) A inativao de um dos cromossomos X


em fmeas permite o mecanismo de
compensao de dose.
( ) Fentipos recessivos ligados ao X so mais
frequentes em fmeas que em machos.
A sequncia correta de preenchimento dos
parnteses, de cima para baixo,
(A)
(B)
(C)
(D)
(E)

F
F
F
V
V

F
V
V
F
V

F
F
V
F
V

V.
V.
F.
V.
F.

(C) a parapatria e o fluxo gnico.


(D) a alopatria e a seleo sexual.
(E) a simpatria e o efeito do fundador.
22. Observe a teia alimentar representada no
diagrama abaixo.
mosquito
gamb
homem
gavio

20. Entre as adaptaes da presa contra a


predao, est o mimetismo. No mimetismo
batesiano, uma espcie comestvel mimetiza
uma espcie no comestvel, ou nociva.
Considere as seguintes afirmaes, referentes
estabilidade desse tipo de mimetismo.
I - O predador que captura um indivduo de
uma espcie no comestvel ou nociva evita
qualquer presa de aparncia semelhante.
II - O mmico evolui em direo aparncia de
uma espcie no comestvel mais depressa
do que a espcie no comestvel acumula
diferenas em relao ao mmico.
III- O mmico deve ser de uma espcie menos
comum que a espcie no comestvel.

pssaro
galinha

ovo
inseto

milho

Com base neste


afirmao correta.

cobra

rato

gato

diagrama,

assinale

(A) O mosquito e o gavio ocupam nveis


trficos diferentes.
(B) O nvel trfico dos produtores no est
representado no diagrama.

Quais esto corretas?

(C) O homem e o gamb ocupam o mesmo


nvel trfico.

(A)
(B)
(C)
(D)
(E)

(D) O pssaro e o gato ocupam o mesmo


nicho ecolgico.

Apenas I.
Apenas II.
Apenas I e III.
Apenas II e III.
I, II e III.

(E) O gavio e o gamb so equivalentes


ecolgicos.

UFRGS CV/2011 BIO

168

23. A reao qumica abaixo est relacionada


origem de vrios produtos.
6CO2 + 6H2O C6H1206 + 6O2

25. O cdigo florestal brasileiro protege a


vegetao ribeirinha situada margem dos
cursos dgua, inclusive dos menores
crregos.

Considere os produtos citados a seguir.

Com relao a essas comunidades vegetais,


assinale com V (verdadeiro) ou F (falso) as
afirmaes que seguem.

1 - lcool combustvel (etanol)


2 - petrleo

( ) Elas contribuem para o controle da eroso


e para a reteno de agroqumicos que
podem ser carreados para a gua.

3 - papel higinico
4 - leo de soja
5 - po
Quais desses produtos tm sua origem
relacionada equao apresentada acima?
(A) Apenas 1 e 2.

( ) Elas constituem nichos ecolgicos para


espcies animais e vegetais que se
podem desenvolver na interface desses
sistemas terrestres e aquticos.
( ) Elas exercem a funo de corredores
ecolgicos, impedindo o fluxo gnico
entre comunidades distantes.

(B) Apenas 3 e 4.
(C) Apenas 1, 4 e 5.
(D) Apenas 2, 3 e 5.

( ) Elas se propagam predominantemente


por estaquia.

(E) 1, 2, 3, 4 e 5.
24. Os ecossistemas terrestres transferem atravs
dos rios um grande fluxo de elementos para
os mares.
Com relao ao fluxo de materiais e
nutrientes em sentido inverso, ou seja, dos
mares para os sistemas terrestres, considere
as seguintes afirmaes.
I - A extrao de petrleo em grandes
profundidades do subsolo ocenico
transfere para os ecossistemas terrestres
o fsforo utilizado na adubao agrcola.

A sequncia correta de preenchimento dos


parnteses, de cima para baixo,
(A) F V F V.
(B) F F V V.
(C) V V F F.
(D) V F V F.
(E) F V V F.

II - Os ecossistemas terrestres recebem


alguns elementos do meio ocenico
atravs da brisa marinha (maresia).
III- O consumo de peixe marinho pela
populao humana transfere elementos
do meio ocenico para o terrestre.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.
UFRGS CV/2011 BIO

169

2012
BIOLOGIA
01. Considere o enunciado abaixo e as trs
propostas para complet-lo.

02. Em certas espcies de rpteis, a temperatura


de incubao do ovo durante certo perodo do
desenvolvimento o fator determinante na
proporo sexual.

Fleming, um microbiologista, ao examinar


placas de cultivo semeadas com bactrias,
observou que elas eram incapazes de crescer
perto
de
uma
colnia
de
fungos
contaminantes. A identificao posterior dos
antibiticos comprovou a hiptese formulada
pelo pesquisador de que os fungos produzem
substncias que inibem o crescimento das
bactrias.

O grfico abaixo refere-se proporo sexual


dependente da temperatura observada em
trs espcies de rpteis.

Sabendo-se que Fleming aplicou em sua


pesquisa o mtodo cientfico, correto
afirmar que
1 - ele formulou uma hiptese de pesquisa
tendo como base a observao de que
as bactrias no proliferavam em
determinado ambiente.
2 - ele realizou experimentos de acordo com
predies decorrentes da formulao de
uma hiptese, ou seja, a de que
substncias produzidas por fungos inibem
o crescimento bacteriano.
3 - ele concluiu, baseado em suas reflexes
sobre a reproduo de fungos, que a
substncia por eles produzida inibia a
diviso mittica de bactrias.
Quais esto corretas?
(A) Apenas 1.

Adaptado de: GILBERT S. F. Development Biology.


6. ed. Suderland (MA): Sinauer Associates, 2000.

Com base
nos dados apresentados no
grfico, considere as afirmaes abaixo.
I - Para a espcie nmero 1, temperaturas
entre 28C e 30C daro origem a
indivduos de somente um dos sexos.
II - Para a espcie nmero 3, uma variao
de temperatura de apenas 1C pode
transformar uma maioria de fmeas em
maioria de machos.
III- Para a espcie nmero 2, os ovos geram
machos em temperaturas frias e fmeas
em temperaturas quentes.

(B) Apenas 2.
(C) Apenas 3.
(D) Apenas 1 e 2.

Quais esto corretas?

(E) 1, 2 e 3.

(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e II.
(E) I, II e III.

UFRGS CV/2012 BIO

170

03. Os cidos nucleicos so polmeros que atuam no armazenamento, na transmisso e no uso da


informao gentica.
Com base na estrutura e funo destes polmeros, assinale com V (verdadeiro) ou F (falso) as
afirmaes abaixo.
(
(
(
(

)
)
)
)

Seus
Seus
Suas
Suas

monmeros so denominados nucleotdeos.


monmeros esto unidos por meio de ligaes fosfodisteres.
bases nitrogenadas esto diretamente ligadas aos fosfatos.
bases nitrogenadas podem ser pricas ou pirimdicas.

A sequncia correta de preenchimento dos parnteses, de cima para baixo,


(A)
(B)
(C)
(D)
(E)

V V F V.
V F V F.
F V V F.
F F V V.
V F F V.

04. No bloco superior, abaixo, so citados dois componentes do sistema de membranas internas de uma
clula eucaritica; no inferior, funes desempenhadas por esses componentes.
Associe adequadamente o bloco inferior ao superior.
1 - retculo endoplasmtico liso
2 - sistema golgiense
(
(
(
(

)
)
)
)

modificao de substncias txicas


sntese de lipdeos e esteroides
secreo celular
sntese de polissacardeos da parede celular vegetal.

A sequncia correta de preenchimento dos parnteses, de cima para baixo,


(A)
(B)
(C)
(D)
(E)

1
1
1
2
2

2
1
2
2
1

2
2
2
1
1

1.
2.
2.
1.
1.

05. A membrana plasmtica uma estrutura que atua como limite externo da clula, permitindo que
esta realize suas funes.
Com relao membrana plasmtica, considere as afirmaes abaixo.
I - Sua estrutura molecular tem como componentes bsicos lipdeos e protenas.
II - Os fosfolipdeos apresentam uma regio hidroflica que fica voltada para o ambiente no aquoso.
III- O esteroide colesterol um lipdeo presente na membrana plasmtica de clulas animais e
vegetais.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas I.
Apenas II.
Apenas I e III.
Apenas II e III.
I, II e III.

UFRGS CV/2012 BIO

171

06. Durante as fases da respirao celular aerbia, a produo de CO2 e gua, ocorre, respectivamente,
(A) na gliclise e no ciclo de Krebs.
(B) no ciclo de Krebs e na cadeia respiratria.
(C) na fosforilao oxidativa e na cadeia respiratria.
(D) no ciclo de Krebs e na fermentao.
(E) na gliclise e na cadeia respiratria.
07. O quadro abaixo representa o cdigo gentico universal.

U
UUU
Fen
UUC
UUA Leu
UUG
CUU
CUC
Leu
CUA
CUG
AUU
AUC Ile
AUA
AUG Met/Incio
GUU
GUC
Val
GUA
GUG

C
UCU
UCC
UCA
UCG
CCU
CCC
CCA
CCG
ACU
ACC
ACA
ACG
GCU
GCC
GCA
GCG

Ser

Pro

Tre

Ala

A
UAU
UAC
UAA
UAG
CAU
CAC
CAA
CAG
AAU
AAC
AAA
AAG
GAU
GAC
GAA
GAG

Tir
Fim
His
GIn
Ans
Lis
Asp
Glu

G
UGU
Cis
UGC
UGA Fim
UGG Trp
CGU
CGC
Arg
CGA
CGG
AGU
Ser
AGC
AGA
Arg
AGG
GGU
GGC
Gli
GGA
GGG

U
C
A
G
U
C
A
G
U
C
A
G
U
C
A
G

A molcula de RNA mensageiro com a sequncia CGAAUGACAAAAGGAUAACGU produz o segmento


de protena
(A) Met Tre Lis Gli Arg.
(B) Tre Arg Met.
(C) Arg Met Tre Lis Gli.
(D) Met Tre Lis Gli.
(E) Leu Arg Met Tre Lis Gli.
08. Assinale a alternativa que preenche corretamente as lacunas do enunciado abaixo, na ordem em
que aparecem.
Em mamferos, o ........ e as clulas trofoblsticas interagem com o tero materno para formar a
........, a qual fornece nutrientes e atua nas trocas gasosas do embrio.
(A) saco vitelino cavidade amnitica
(B) alantoide

vilosidade corinica

(C) alantoide

placenta

(D) crion

placenta

(E) mnio

vilosidade corinica

UFRGS CV/2012 BIO

172

09. O quadro abaixo apresenta, na primeira linha, tipos de antgenos; na segunda, clulas
apresentadoras desses antgenos; e, na terceira, clulas que interagem com as apresentadoras no
contexto especificado.

JANEWAYE, C.A.(cols.) Imunologia: o sistema imune na sade e na doena.


5. ed. Porto Alegre: Artmed, 2002.

Assinale a alternativa que apresenta a sequncia de termos que correspondem, respectivamente,


aos nmeros 1, 2 e 3 no quadro.
(A) clulas mortas linfcitos T auxiliares (CD4) clula B
(B) vrus clulas de memria clula dendrtica
(C) parasitas clulas de memria linfcitos T citotxicos (CD8)
(D) clulas mortas linfcitos T citotxicos (CD8) clula dendrtica
(E) vrus linfcitos T auxiliares (CD4) clula B

10. Assinale com V (verdadeiro) ou F (falso) as afirmaes abaixo, referentes aos protozorios.
( ) Os radiolrios e os foraminferos apresentam espcies que fazem parte do plncton.
( ) As amebas so dotadas de clios e de, no mnimo, dois ncleos.
( ) Os flagelados causam, em humanos, doenas como a leishmaniose e a toxoplasmose.
( ) os esporozorios so organismos exclusivamente parasitas, desprovidos de um vacolo contrtil.
A sequncia correta de preenchimento dos parnteses, de cima para baixo,
(A) V V F V.
(B) V F V F.
(C) F V V F.
(D) F F V V.
(E) V F F V.

UFRGS CV/2012 BIO

173

11. A figura abaixo apresenta algumas das


caractersticas compartilhadas por grupos de
plantas.

13. Assinale a alternativa correta, em relao


conduo da seiva bruta em angiospermas.
(A) O fluxo da seiva bruta ocorre das folhas
para outras partes da planta atravs do
floema.
(B) A explicao para a seiva bruta mover-se
pela planta dada pela hiptese do fluxo
por presso.
(C) A transpirao aumenta a presso
osmtica e promove o fluxo da gua
desde as razes at as folhas, no interior
do xilema.
(D) A absoro de CO2 na fotossntese pode
aumentar o fluxo da seiva bruta para as
folhas.
(E) Ao retirarmos um anel ao redor do caule
(anel de Malpighi), possvel verificar a
morte da planta pela interrupo do fluxo
da seiva bruta.

Adaptado de: SADAVA et al. Vida: a cincia da


biologia. 8. ed. Porto Alegre: Artmed, 2009.

As caractersticas associadas aos nmeros 1 e


2 representam, respectivamente, a presena
de

14. Os caros so quelicerados que, para os


humanos, podem causar reaes alrgicas na
pele e no sistema respiratrio.
Assinale a alternativa que apresenta somente
animais quelicerados.

(A) esporfito haploide e folhas verdadeiras.


(B) gametfito haploide e sementes.
(C) esporfito haploide e estmatos.

(A) aranha pulga tatuzinho-de-jardim

(D) embrio protegido e tecido vascular.

(B) aranha escorpio carrapato

(E) embrio protegido e sementes.

(C) joaninha pulga carrapato


(D) joaninha lacraia opilio

12. As estruturas sexuais das angiospermas so


as flores. Com relao s estruturas florais,
correto afirmar que
(A) as anteras contm os megasporngios,
que produzem o plen.

(E) lacraia escorpio tatuzinho-de-jardim


15. Assinale
a
alternativa
que
preenche
corretamente as lacunas do enunciado abaixo
na ordem em que aparecem.

(B) a superfcie terminal do pistilo que recebe


os gros de plen chamada estame.
(C) as folhas externas estreis constituem o
clice.
(D) as flores so designadas perfeitas quando
apresentam clice e corola.
(E) plantas em que ocorrem tanto flores
mega como microesporangiadas so
denominadas dioicas.

UFRGS CV/2012 BIO

O desenvolvimento padro das ........ caracteriza-se por fecundao ........ , desenvolvimento ........ e ........ .
(A) rs interna indireto viviparidade
(B) tartarugas externa direto
ovoviviparidade
(C) aves externa indireto oviparidade
(D) aves interna direto ovoviviparidade
(E) tartarugas interna direto oviparidade

174

16. Assinale a alternativa que preenche corretamente as lacunas do enunciado abaixo, na ordem em
que aparecem.
A ........ humana contm dois tipos de fotorreceptores: os cones e os bastonetes. Os cones
contribuem pouco para a viso noturna por ........ .
(A)
(B)
(C)
(D)
(E)

retina
crnea
ris
retina
crnea

terem menor sensibilidade luz


serem menos abundantes que os bastonetes
terem maior sensibilidade luz
absorverem igualmente todos os comprimentos de onda
serem responsveis pela percepo das cores

17. Leia a tira abaixo.

Disponvel em: http://www2.uol.com.br/niquel/seletas_vampiros.shtml. Acesso em: 22 nov. 2011.

As sanguessugas, como as citadas na tira, produzem nas glndulas salivares a substncia chamada
hirudina, um peptdeo inibidor de trombina.
A hirudina provoca a no coagulao do sangue, pois
(A)
(B)
(C)
(D)
(E)

a tromboplastina no ser liberada aps o rompimento das plaquetas.


a trombina no catalisar a reao de transformao do fibrinognio em fibrina.
a tromboplastina no se ligar protrombina para sua converso em trombina.
as hemceas no se rompero para o incio do processo de coagulao sangunea.
a trombina ser bloqueada em sua transformao em tromboplastina.

18. Darwin sofreu durante a maior parte de sua vida adulta de uma doena debilitante que pode ter sido
a Sndrome dos Vmitos Cclicos (SVC). A hiptese corrente sugere que a doena seja provocada por
uma mutao mitocondrial j descrita na literatura. Sabe-se que a me e o tio materno de Darwin
apresentavam os mesmos sintomas que ele. Sabe-se, tambm, que Darwin era casado com uma
prima em primeiro grau, que no apresentava a sndrome, e que o casal teve vrios filhos e filhas,
no havendo nenhum sindrmico entre eles.
Com base no exposto acima, assinale a alternativa correta.
(A) A SVC pode ter padro de herana dominante ligado ao sexo.
(B) A inexistncia de filhos sindrmicos est de acordo com a hiptese da origem mitocondrial da
doena de Darwin.
(C) De acordo com a hiptese da origem mitocondrial, tanto a av quanto o av materno de Darwin
podem ter passado a sndrome para seus filhos.
(D) A consanguinidade entre Darwin e sua esposa sustenta a hiptese de herana mitocondrial da
sndrome.
(E) De acordo com a hiptese da origem mitocondrial da sndrome, todas as filhas de Darwin devem
ser portadoras do gene mutado.
6

UFRGS CV/2012 BIO

175

19. Em rabanetes, um nico par de alelos de um


gene controla a forma da raiz. Trs formas
so observadas: oval, redonda e longa.
Cruzamentos
entre
estes
trs
tipos
apresentam os seguintes resultados:
P
Redondo
Redondo
Oval
Redondo
Longo

x
x
x
x
x

Oval
Longo
Longo
Redondo
Longo

21. Assinale a alternativa correta, com relao s


estruturas anlogas.
(A) Elas surgem a partir de convergncia
evolutiva.

F1

(B) Elas derivam de estruturas existentes em


um ancestral comum.

Oval e Redondo (1:1)


Oval
Oval e Longo (1:1)
Redondo
Longo

(C) Elas evidenciam os parentescos evolutivos


entre as espcies.

Qual a proporo de prognie esperada do


cruzamento oval x oval?

(D) Elas tm a mesma origem embriolgica


nas diferentes espcies.

(A)
(B)
(C)
(D)
(E)

(E) Elas podem apresentar diferentes funes


nas espcies.

3
1
1
3
1

ovais : 1 longo
redondo: 1 longo
oval: 2 redondos: 1 longo
redondos: 1 longo
redondo: 2 ovais: 1 longo

22. Com relao biomassa e distribuio de


energia nos diferentes nveis trficos,
considere as seguintes afirmaes.

20. Um dos maiores problemas mundiais de sade


pblica a infeco hospitalar. Recentemente,
constatou-se que a bactria Klebsiella
pneumoniae, responsvel pela pneumonia e
por infeces da corrente sangunea, tornouse resistente a todos os antibiticos utilizados
atualmente. Essa resistncia, por sua vez, foi
propagada por conjugao para a bactria
Escherichia coli, que vive nos intestinos de
animais de sangue quente e onipresente em
nosso ambiente.
Considere as afirmaes abaixo, sobre a
situao apresentada.
I - A utilizao de antibiticos exerce presso
seletiva para a aquisio de resistncia.
II - A utilizao de antibiticos causa
mutaes que conferem resistncia s
bactrias.
III- As bactrias podem adquirir resistncia
sem terem sido expostas aos antibiticos.

II - Na maioria dos ecossistemas


as plantas fotossintetizantes
tanto em relao quantidade
que representam quanto em
biomassa que contm.

terrestres,
dominam
de energia
relao

III- Na maioria dos ecossistemas aquticos,


uma pequena biomassa de produtores
pode alimentar uma biomassa muito
maior de consumidores primrios.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas I e III.

Quais esto corretas?


(A)
(B)
(C)
(D)
(E)

I - Na maioria dos ecossistemas terrestres, a


quantidade de biomassa inversamente
proporcional quantidade de energia
qumica
disponvel
nas
molculas
orgnicas.

(D) Apenas II e III.

Apenas I.
Apenas II.
Apenas I e III.
Apenas II e III.
I, II e III.

(E) I, II e III.

UFRGS CV/2012 BIO

176

23. Considere as seguintes afirmaes sobre as


interaes intraespecficas desarmnicas.

25. As chuvas cidas so causadas


alteraes humanas nos ciclos do

I - O canibalismo sexual observado em


fmeas de louva-a-deus um exemplo
desse tipo de interao.
II - Esse tipo de interao no ocorre em
plantas.
III- A disputa por fmeas entre machos de
uma espcie exemplifica esse tipo de
interao.

pelas

(A) carbono e do fsforo.


(B) carbono e do enxofre.
(C) carbono e da gua.
(D) nitrognio e do enxofre.
(E) nitrognio e do fsforo.

Quais esto corretas?


(A)
(B)
(C)
(D)
(E)

Apenas I.
Apenas II.
Apenas I e III.
Apenas II e III.
I, II e III.

24. O efeito estufa leva ao aquecimento global


que, a longo prazo, pode ocasionar
derretimento das calotas polares, aumento
dos nveis dos mares e alterao nos ciclos
das chuvas.
Com base nas causas do efeito estufa,
assinale com V (verdadeiro) ou F (falso) as
afirmaes abaixo.
( ) O metano um potente gs-estufa que
contribui para o aquecimento global.
( ) Depsitos massivos de metano presos sob
camadas de gelo muito antigas que esto
derretendo iro agravar o efeito estufa
nos prximos anos.
( ) O aumento da concentrao de fsforo
atmosfrico intensifica o efeito estufa.
( ) Duas grandes fontes de emisso de
metano so a flatulncia dos ruminantes
e as plantaes de arroz.
A sequncia correta de preenchimento dos
parnteses, de cima para baixo,
(A)
(B)
(C)
(D)
(E)

V V F V.
V F V F.
F V V F.
F F V V.
V F F V.

UFRGS CV/2012 BIO

177

2013
BIOLOGIA
01. Leia a tira abaixo.

Adaptado de:<http://www.redemetro.com>. Acesso em: 17 ago. 2012.

Com base nos dados apresentados na tira acima e em seus conhecimentos sobre a presena de vida
na Terra, considere as afirmaes abaixo.
I - A presena de metano poderia ser indcio de vida em Marte, uma vez que algumas espcies
procariontes conhecidas produzem metano atravs da reduo de CO2.
II - A atmosfera de Marte apresenta os mesmos componentes da atmosfera atual da Terra, mas, em
nosso planeta, o oxignio o componente predominante.
III- A capacidade de quebrar molculas de gua, na Terra, levou liberao de O2, o que abriu
caminho para a evoluo das reaes de oxidao aerbicas.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas I.
Apenas II.
Apenas I e III.
Apenas II e III.
I, II e III.

02. Sabe-se que a replicao do DNA semiconservativa.


Com base nesse mecanismo de replicao, assinale com V (verdadeiro) ou F (falso) as afirmaes
abaixo.
( ) O DNA original atua como molde, e cada novo DNA possui uma fita antiga e outra nova.
( ) Os quatro ribonucleosdeos trifosfatados, dATP, dGTP, dCTP e dUTP, devem estar presentes.
( ) O DNA deve ser desnaturado (desenrolado) para tornar-se acessvel ao pareamento das novas
bases.
( ) A enzima DNA polimerase adiciona nucleotdeos novos de acordo com o molde de DNA.
A sequncia correta de preenchimento dos parnteses, de cima para baixo,
(A)
(B)
(C)
(D)
(E)

V V F F.
F V V V.
V F V V.
F V F F.
F F F V.

UFRGS CV/2013 BIO

178

03. Considere o enunciado abaixo e as quatro


propostas para complet-lo.
No processo de transporte,
membrana, pode ocorrer

atravs

da

05. A fotossntese e a respirao celular, em


termos energticos e metablicos, so
caracterizadas,
respectivamente,
como
processos
(A) endotrmicos e anablicos.

1 - a difuso facilitada, um tipo de transporte


passivo.

(B) endotrmicos e catablicos.

2 - o transporte passivo, a favor do gradiente


de concentrao.

(C) exotrmicos e anablicos.

3 - o transporte ativo, feito com gasto de


energia.

(E) isotrmicos e catablicos.

4 - a difuso simples, independemente do


gradiente de concentrao.

(D) exotrmicos e catablicos.

06. A figura abaixo representa o ciclo celular de


uma clula eucaritica.

Quais propostas esto corretas?


(A) Apenas 2.
(B) Apenas 2 e 4.
(C) Apenas 1, 2 e 3.
(D) Apenas 1, 2 e 4.
(E) Apenas 1, 3 e 4.
04. Com
relao
s
estruturas
celulares
encontradas
nas
clulas
eucariontes,
considere as afirmaes abaixo.
I - O citoesqueleto e os centrolos so
encontrados somente em clulas animais.
II - O cloroplasto e a parede celular so
encontrados
somente
em
clulas
vegetais.
III- O complexo golgiense e os lisossomos so
encontrados somente em clulas animais.

PURVES, W.K. e cols.Vida: a cincia da Biologia. 6. ed.


Porto Alegre: Artmed, 2002.

Assinale a alternativa correta em relao


interfase.

Quais esto corretas?


(A) Apenas I.

(A) A interfase o perodo em que no


ocorre diviso celular, e a clula
permanece sem atividade metablica.

(B) Apenas II.


(C) Apenas I e III.
(D) Apenas II e III.

(B) As clulas que no se dividem so


normalmente mantidas em G0.

(E) I, II e III.

(C) O nuclolo desaparece durante o G1.


(D) A quantidade de DNA permanece
constante durante o perodo S.
(E) O G2 caracteriza-se pela presena de
cromossomos constitudos de uma nica
cromtide.

UFRGS CV/2013 BIO

179

07. Assinale a afirmativa correta, referente s


doenas sexualmente transmissveis (DST).

09. Bactrias so agentes causadores de diversas


doenas, e algumas delas podem ser muito
graves.

(A) A sfilis causada por um protozorio e,


se no tratada, pode levar a alteraes no
sistema nervoso, circulatrio e urinrio.

Considere as afirmaes abaixo, a respeito de


doenas.

(B) A gonorria causada por um vrus que


pode ser tratado com antibiticos.

I - A clera causada por um vibrio, que


eliminado junto com as fezes.

(C) A tricomonase provocada por uma


bactria, e sua maior ocorrncia em
homens.

II - A gastrite bacteriana causada pela


Helicobacter pylori, que pode levar ao
cncer.

(D) A pediculose pubiana causada por um


inseto que provoca coceira na regio
pubiana.

III- A dengue hemorrgica causada por


bactrias, do tipo bacilo, eliminadas no
sangue.

(E) O cncer de colo de tero causado pelo


HPV, e seu avano pode ser controlado
com antifngicos.

Quais esto corretas?


(A) Apenas I.

08. Considere a figura abaixo, que representa


uma vista lateral de um joelho humano.

(B) Apenas III.


(C) Apenas I e II.
(D) Apenas II e III.
(E) I, II e III.
10. Assinale
a
alternativa
que
preenche
corretamente as lacunas do enunciado abaixo,
na ordem em que aparecem.
As dicotiledneas apresentam ........ e ........,
o que lhes permite crescimento secundrio.
(A) protoderme

procmbio

(B) cmbio vascular felognio


Assinale a alternativa que apresenta os tipos
dos tecidos conjuntivos que correspondem,
respectivamente, aos nmeros 1, 2, 3 da
figura.
(A) cartilaginoso denso

frouxo

(B) reticular

frouxo

cartilaginoso

(C) frouxo

reticular

frouxo

(D) cartilaginoso frouxo


(E) frouxo

(C) coifa

procmbio

(D) protoderme

felognio

(E) coifa

anis anuais

denso

cartilaginoso denso

UFRGS CV/2013 BIO

180

11. A coluna da esquerda, abaixo, lista quatro grupos de plantas atuais; a da direita, caractersticas
desses grupos.
Associe adequadamente a coluna da direita da esquerda.
1 - Brifita

( ) plantas avasculares que apresentam rizoides

2 - Pteridfita

( ) plantas sem sementes que apresentam esporngios

3 - Gimnosperma

( ) plantas com estrbilos que apresentam sementes nuas

4 - Angiosperma
A sequncia correta de preenchimento dos parnteses, de cima para baixo,
(A) 3 2 1.
(B) 3 1 4.
(C) 1 4 3.
(D) 2 3 4.
(E) 1 2 3.
12. A coluna da esquerda, abaixo, apresenta caractersticas de diferentes grupos de invertebrados; a da
direita, trs grupos de invertebrados.
Associe adequadamente a coluna da direita da esquerda.
1 - Rdula como estrutura para alimentao

) Crustceos

2 - Locomoo realizada pelo sistema ambulacrrio

) Moluscos

3 - Corpo composto de exoesqueleto

) Equinodermas

4 - Presena de respirao por espirculos


A sequncia correta de preenchimento dos parnteses, de cima para baixo,
(A) 3 4 1.
(B) 3 1 2.
(C) 1 4 3.
(D) 2 1 4.
(E) 1 2 3.

UFRGS CV/2013 BIO

181

13. Observe os esquemas abaixo que representam sistemas circulatrios de vertebrados.

Em relao aos dois esquemas, considere as seguintes afirmaes.


I - O vertebrado do esquema A possui brnquias; o do B, pulmes.
II - O esquema A representa circulao simples; o B, circulao dupla.
III- O esquema A caracterstico de anfbios.
Quais esto corretas?
(A) Apenas I.
(B) Apenas III.
(C) Apenas I e II.
(D) Apenas II e III.
(E) I, II e III.
14. A coluna da esquerda, abaixo, lista cinco estruturas que fazem parte do sistema nervoso; a da
direita, caractersticas de trs dessas estruturas.
Associe adequadamente a coluna da direita da esquerda.
1 - bulbo

( ) responsvel pelo controle das funes motoras do corpo.

2 - cerebelo

( ) Possui grupos de neurnios envolvidos no controle de respirao e circulao.

3 - hipfise

( ) Possui o centro do controle para manuteno da temperatura corporal.

4 - hipotlamo
5 - medula espinhal
A sequncia correta de preenchimento dos parnteses, de cima para baixo,
(A) 3 5 4.
(B) 2 4 3.
(C) 3 5 1.
(D) 2 1 4.
(E) 5 1 3.

UFRGS CV/2013 BIO

182

15. Assinale com V (verdadeiro) ou F (falso) as


afirmaes abaixo, referentes fisiologia
respiratria humana.
( ) O principal msculo respiratrio o
diafragma.

17. O estudo de gmeos utilizado para a anlise


de
caractersticas
genticas
humanas.
Gmeos monozigticos, exceto por raras
mutaes somticas, so geneticamente
idnticos. Os gmeos dizigticos, por outro
lado, tm, em mdia, 50% de seus alelos em
comum.

( ) O dixido de carbono (CO2) ,


principalmente, transportado dissolvido
no plasma como bicarbonato (HCO3-).
( ) A enzima anidrase carbnica, presente no
plasma, participa no transporte de
oxignio.
( ) A mioglobina funciona como a reserva de
oxignio para os msculos.
A sequncia correta de preenchimento dos
parnteses, de cima para baixo,
(A) V F V V.
(B) F F V F.

O quadro abaixo apresenta a concordncia


obtida para gmeos mono e dizigticos em
um estudo relacionado a trs diferentes
caractersticas.

Caracterstica

Concordncia
em
monozigticos

Concordncia
em
dizigticos

Cor dos olhos

100%

40%

Tuberculose

5%

5%

Presso alta

70%

40%

Adaptado de: PIERCE, B.A. (ed.) Gentica um enfoque


conceitual. Rio de Janeiro: Guanabara Koogan, 2004.

(C) F V F V.

Com base no quadro acima e em seus


conhecimentos de gentica, assinale com V
(verdadeiro) ou F (falso) as afirmaes abaixo.

(D) V V F V.
(E) V V V F.
16. A puberdade o perodo de maturao sexual
em humanos. Essa fase do desenvolvimento
caracteriza-se pelo
(A) aumento da produo de gonadotropinas
e de esteroides sexuais.
(B) decrscimo da produo do hormnio
luteinizante.
(C) incio da produo de esteroides sexuais,
como a testosterona e o estradiol.
(D) aumento da produo dos hormnios
trficos da neuro-hipfise.
(E) decrscimo da produo de andrgenos,
de estrgenos e de progesterona.

( ) A cor dos olhos parece ter influncia


ambiental, uma vez que a concordncia
em gmeos dizigticos baixa.
( ) A tuberculose no tem influncia
gentica, j que apresenta o mesmo
baixo grau de concordncia nos dois tipos
de gmeos.
( ) A presso alta parece ser influenciada
tanto por fatores genticos, quanto por
fatores ambientais.
( ) A cor dos olhos e a presso alta
apresentam o mesmo grau de influncia
ambiental, uma vez que compartilham
uma concordncia de 40% entre os
gmeos dizigticos.
A sequncia correta de preenchimento dos
parnteses, de cima para baixo,
(A)
(B)
(C)
(D)
(E)

V V F V.
V F V F.
F F V V.
V F F V.
F V V F.
UFRGS CV/2013 BIO

183

18. Um estudante de biologia suspeita que uma determinada caracterstica recessiva em ces ligada
ao sexo. Aps um nico cruzamento entre um macho com fentipo dominante e uma fmea com
fentipo recessivo, obtida uma prole constituda de trs machos com fentipo recessivo e quatro
fmeas com fentipo dominante.
Com base nesse experimento, assinale a alternativa correta.
(A) O resultado obtido compatvel com herana ligada ao sexo, mas no exclui herana
autossmica.
(B) O resultado obtido exclui herana ligada ao sexo.
(C) O resultado obtido compatvel com herana ligada ao sexo e exclui herana autossmica.
(D) O resultado obtido compatvel com herana autossmica, desde que os pais sejam
homozigotos.
(E) O resultado obtido compatvel com herana autossmica, e as propores da prole esto de
acordo com o esperado.
19. Analise as informaes abaixo, relacionadas aos mecanismos de isolamento reprodutivo.
1 - Os sapos do gnero Scaphiopus vivem em diferentes tipos de solo.
2 - Existem insetos que se acasalam em diferentes horrios, durante a noite.
3 - As fmeas de vagalumes no respondem aos sinais de luz emitidos pelos machos de outras
espcies.
4 - O plen de uma espcie de angiosperma transferido ao estigma de outra espcie, mas os
tubos polnicos no atingem os vulos, por crescerem lentamente.
Com relao s informaes apresentadas, assinale a alternativa correta.
(A) Em 1, o mecanismo de isolamento mecnico, e os parceiros potenciais encontram-se.
(B) Em 1 e 2, os mecanismos de isolamento so, respectivamente, de habitat e de tempo, e os
parceiros potenciais no se encontram.
(C) Em 2 e 3, os mecanismos de isolamento so etolgicos, e os parceiros potenciais encontram-se,
mas no copulam.
(D) Em 3, o mecanismo de isolamento mecnico, e os parceiros potenciais no se encontram.
(E) Em 4, o mecanismo de isolamento reprodutivo ps-zigtico.

UFRGS CV/2013 BIO

184

20. Na figura abaixo, os nmeros esquerda indicam a porcentagem da diferena entre os DNAs de
primatas superiores; os nmeros direita, uma estimativa dos milhes de anos transcorridos desde
que eles tiveram um ancestral em comum.
rvore genealgica dos primatas superiores

DIAMOND, Jared. O terceiro chimpanz. Rio de Janeiro, So Paulo: Record, 2010.

Com base nos dados apresentados na figura, assinale com V (verdadeiro) ou F (falso) as afirmaes
abaixo.
( ) O parentesco entre os humanos e os chimpanzs mais prximo do que o de qualquer um dos
dois com os macacos do Velho Mundo.
( ) Gorilas e chimpanzs so mais similares entre si do que com os humanos, uma vez que os
humanos se separaram antes da divergncia ocorrida entre gorilas e chimpanzs.
( ) Humanos, gorilas e chimpanzs so equidistantes em sua estrutura gentica geral.
( ) A distncia gentica que separa os humanos dos chimpanzs menor do que a existente entre
as duas espcies de gibes, mostradas na figura.
A sequncia correta de preenchimento dos parnteses, de cima para baixo,
(A) V V F V.
(B) V F V F.
(C) F F V V.
(D) V F F V.
(E) F V V F.
10

UFRGS CV/2013 BIO

185

21. Considere as afirmaes abaixo sobre os fsseis.


I - Partes de organismos so consideradas fsseis, somente se encontradas em rochas
sedimentares.
II - O processo de fossilizao requer condies ambientais especficas, o que contribui para a sua
raridade.
III- Fsseis mais antigos podem ser encontrados na camada superior do sedimento, em funo das
movimentaes da crosta terrestre.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.
22. O mapa abaixo representa os principais biomas brasileiros.

Disponvel em: <http://www.guiadoestudante.abril.com.br>. Acesso em: 10 set. 2012.

Assinale a alternativa correta com relao aos biomas representados.


(A) O 2 pobre em recursos hdricos.
(B) O 3 caracteriza-se pela presena de vegetao caduciflia.
(C) O 4 caracteriza-se pela presena de vegetais com pneumatforos.
(D) O 5 o que perdeu a maior parte de sua rea original.
(E) O 6 caracteriza-se pela inundao de grandes reas, nos meses de cheia.
UFRGS CV/2013 BIO

11

186

23. Ao longo do tempo, ocorrem mudanas na


repartio de energia, na estrutura das
espcies e nos processos de uma comunidade
biolgica, e essa sequncia de mudanas
denominada sucesso ecolgica.

25. A figura abaixo apresenta trs padres


hipotticos de curvas de sobrevivncia,
frequentemente encontrados na natureza.

Com relao sucesso ecolgica, considere


as afirmaes abaixo.
I - O estgio inicial de uma sucesso
caracteriza-se pela presena de plantas
pioneiras que exibem altas taxas de
crescimento.
II - A sucesso secundria leva mais tempo
para atingir o clmax, do que a primria.
III- O estgio de clmax caracteriza-se por
baixa diversidade de espcies, em funo
do aumento dos nichos ecolgicos.
Quais esto corretas?
(A) Apenas I.
(B) Apenas III.
(C) Apenas I e II.
(D) Apenas II e III.
(E) I, II e III.

Assinale com V (verdadeiro) ou F (falso) as


afirmaes abaixo, referentes a essas curvas.

24. Assinale com V (verdadeiro) ou F (falso) as


afirmaes abaixo, referentes a alteraes do
equilbrio ambiental.
( ) A borracha, o plstico e o isopor so
exemplos de materiais no biodegradveis.
( ) Os lixes a cu aberto so responsveis
pela proliferao de animais que causam
doenas, como a leptospirose.
( ) Nos aterros sanitrios, o lixo contamina o
solo.
( ) As pilhas e baterias so ricas em metais
pesados e devem ser recolhidas e
depositadas em aterros sanitrios.
A sequncia correta de preenchimento dos
parnteses, de cima para baixo,
(A) V F V V.

( ) A curva I ilustra uma situao na qual a


probabilidade
de
sobrevivncia

aproximadamente igual, durante a maior


parte da vida.
( ) A curva II caracteriza organismos com
poucos
descendentes
e
muito
investimento parental.
( ) A curva III tpica de organismos em que
a sobrevivncia baixa entre os jovens.
( ) A curva III caracteriza organismos com
muitos descendentes e nenhum cuidado
parental.
A sequncia correta de preenchimento dos
parnteses, de cima para baixo,
(A) V V F F.
(B) F V V V.

(B) F F V F.

(C) V F V V.

(C) F V F V.

(D) F V F F.

(D) V V V F.

(E) F F V V.

(E) V V F F.
12

UFRGS CV/2013 BIO

187

2014
BIOLOGIA
01. Os quatro tipos de macromolculas biolgicas
esto presentes, aproximadamente, nas
mesmas propores, em todos os organismos
vivos.
Sobre essas macromolculas,
alternativa correta.

assinale

03. No bloco superior abaixo, so citadas duas


estruturas
celulares;
no
inferior,
caractersticas dessas estruturas.
Associe adequadamente o bloco inferior ao
superior.

a
1. Lisossomos
2. Ribossomos

(A) As
vitaminas
so
triglicerdeos
sintetizados no fgado e podem funcionar
como coenzimas.

( ) esto presentes em procariontes


( ) realizam digesto de nutrientes

(B) Os polissacardeos, como a frutose e o


glicognio,
so
respectivamente
compostos armazenadores de energia em
plantas e animais.
(C) As protenas tm, entre as suas funes,
o suporte estrutural, a catlise e a defesa
dos organismos.

( ) realizam autofagia
( ) constituem subunidades de tamanhos
distintos
A sequncia correta de preenchimento dos
parnteses, de cima para baixo,

(D) Os cidos nucleicos so polmeros de


nucleotdeos,
caracterizados
pela
presena de hexoses.

(A) 1 2 2 1.
(B) 1 1 2 2.

(E) Os carboidratos, assim como os cidos


nucleicos, podem funcionar como material
hereditrio.

(C) 1 2 2 2.
(D) 2 1 1 1.
(E) 2 1 1 2.

02. A teoria da endossimbiose, relacionada


evoluo eucaritica, baseia-se em vrias
evidncias.

04. A rota metablica da respirao celular


responsvel pela maior produo de ATP

Com relao a essa teoria, considere as


afirmaes abaixo.
I - As membranas duplas das mitocndrias e
dos cloroplastos corroboram a teoria
endossimbitica.
II - Os procariontes que do origem s
organelas mantm o seu DNA intacto.
III- Um procarionte fotossintetizador pequeno,
englobado por um procarionte maior, pode
contribuir com monossacardeos e receber
proteo.

(A) a gliclise, que ocorre no citoplasma.


(B) a fermentao, que ocorre na membrana
externa da mitocndria.
(C) a oxidao do piruvato, que ocorre na
membrana externa da mitocndria.
(D) a cadeia de transporte de eltrons, que
ocorre na membrana interna da
mitocndria.
(E) o ciclo do cido ctrico, que ocorre na
matriz da mitocndria.

Quais esto corretas?


(A) Apenas I.
(B) Apenas II.
(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.
UFRGS CV/2014 BIO

188

05. O grfico abaixo apresenta a taxa de reao


de trs diferentes enzimas em funo do pH,
em seres humanos.

06. Observe o desenho abaixo, que representa


uma clula em diviso.

Taxa de reao

3
1

O desenho refere-se a uma clula


(A) germinativa em metfase I.

Com base no grfico, considere as seguintes


afirmaes.

(B) somtica em prfase.


(C) germinativa em prfase II.

I - A enzima 1 pode ser a pepsina, pois sua


atividade mxima ocorre em meio cido.

(D) somtica em metfase.


(E) germinativa em anfase II.

II - A enzima 2 pode ser a amilase salivar,


pois sua atividade mxima ocorre em um
meio prximo ao neutro.
III- A enzima 3 pode atuar no duodeno, pois
sua atividade mxima ocorre em pH
bsico.

07. As glndulas sudorparas contribuem para a


manuteno da temperatura corporal. Essas
glndulas so

Quais esto corretas?

(A) pluricelulares, apcrinas e endcrinas.


(B) pluricelulares, mercrinas e excrinas.

(A) Apenas I.

(C) pluricelulares, holcrinas e mistas.

(B) Apenas II.

(D) unicelulares, apcrinas e excrinas.

(C) Apenas I e III.

(E) unicelulares, mercrinas e mistas.

(D) Apenas II e III.


(E) I, II e III.

08. As dores que acompanham a fadiga muscular


tm como causa
(A) a utilizao de lipdeos como fonte de
energia.
(B) o acmulo de oxignio produzido pela
respirao.
(C) a perda da capacidade de relaxamento do
msculo.
(D) o acmulo de cido ltico resultante da
anaerobiose.
(E) a utilizao do gs carbnico resultante
da fermentao.

UFRGS CV/2014 BIO

189

09. Leia a tira abaixo.

ESSE TEM
DETERGENTE...

NON CHEGUEM
PERTO DO
MEU VINHO!

O SUCO TAMBM COM


DETERGENTE...

LEITE COM
UREIA

Adaptado de: Zero Hora, 01 maio 2013.

Doenas transmitidas por alimentos (DTAs) so aquelas causadas pela ingesto de comida ou
bebida contaminada por agentes biolgicos ou qumicos.
Assinale com V (verdadeiro) ou F (falso) as afirmaes abaixo, referentes s DTAs.
( ) A ureia o principal produto nitrogenado eliminado na excreo das aves.
( ) A salmonela uma bactria comumente encontrada nas intoxicaes causadas por produtos
base de ovos.
( ) A intoxicao por estafilococos pode estar relacionada manuteno de alimentos em
temperatura inadequada.
( ) A coqueluche pode ser causada pela contaminao fecal de alimentos e apresenta como
sintomas a tosse e a sudorese noturna.
A sequncia correta de preenchimento dos parnteses, de cima para baixo,
(A) V V F V.
(B) V F V F.
(C) F V V F.
(D) F F V V.
(E) V F F V.
10. Os organismos que se caracterizam simultaneamente por ausncia de pigmento fotossintetizante,
presena de paredes celulares com quitina e reproduo por esporos so
(A) as Bactrias.
(B) os Fungos.
(C) os Vrus.
(D) as Pteridfitas.
(E) os Protozorios.

UFRGS CV/2014 BIO

190

11. Considere as seguintes afirmaes sobre as relaes hdricas e fotossintticas das plantas.
I - A gua absorvida pelas razes percorre uma nica via, atravs dos espaos intercelulares.
II - A abertura dos estmatos permite a sada do vapor de gua e a entrada do CO 2 atmosfrico por
difuso.
III- Apenas uma frao da gua absorvida retida na planta e utilizada em seu metabolismo.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.

12. Leia a tira abaixo, que ilustra as decises alimentares do Hagar.

O ESTRESSE
SOBRE UM LDER
VIKING COMO EU
INACREDITVEL...

DEVO PEGAR OUTRA PORO


DE CREME DE MILHO OU
OUTRA PORO DE PUR
DE BATATAS?

E TOMAR
DECISES A
PARTE MAIS
DIFCIL.

Adaptado de: Zero Hora, 24 ago. 2013.

Assinale a alternativa que apresenta a afirmao correta sobre os vegetais citados na tira.
(A) Os dois apresentam amido como substncia de reserva.
(B) O gro de milho um fruto deiscente.
(C) Os dois apresentam folhas com nervao paralelinrvea.
(D) A parte comestvel da batata-inglesa a raiz.
(E) O milho apresenta crescimento secundrio no caule.

UFRGS CV/2014 BIO

191

13. As afirmaes abaixo referem-se s plantas


que se desenvolvem sobre as rvores.
I - Caracterizam-se pela presena de bulbos,
tubrculos e rizomas.

15. Em agosto de 2013, foi divulgada a


descoberta de um mamfero, o olinguito, que
parece uma mistura de gato domstico e urso
de pelcia, nativo das florestas da Colmbia e
do Equador.

II - Podem
apresentar
adaptaes
morfolgicas como os haustrios nas
razes e as escamas nas folhas.
III- Apresentam sementes ou frutos com
ganchos para facilitar a disperso por
mamferos como capivaras e graxains.
Quais esto corretas?

Disponvel em: <http://exame.abril.com.br/ciencia/


noticias/americano-olinguito-e-o-mais-novomamifero-descoberto>. Acesso em: 20 ago. 2013.

Sobre esse mamfero, pode-se afirmar que


deve necessariamente apresentar
(A) sistema circulatrio duplo.
(B) glndulas uropigianas.
(C) pecilotermia.

(A) Apenas I.

(D) glndulas
mamrias
endodrmica.

(B) Apenas II.


(C) Apenas I e III.

com

origem

(E) notocorda como principal estrutura de


sustentao.

(D) Apenas II e III.


(E) I, II e III.

14. A Organizao para a Alimentao e a


Agricultura (FAO) lanou, em maio de 2013,
um documento intitulado Insetos Comestveis:

Perspectivas Futuras para a Segurana


Alimentar, no qual afirma que esses animais
so uma alternativa produo convencional
de carne.

Sobre esse grupo de animais, correto


afirmar que
(A) podem apresentar uma modificao
morfolgica significativa entre um estgio
e outro de desenvolvimento.
(B) so parasitas do homem os que possuem
corpo composto por cefalotrax e
abdmen.
(C) se alimentam
especializados,
quelceras.

atravs de rgos
denominados
de

(D) so as larvas os principais polinizadores


das plantas com flores.
(E) podem apresentar quatro pares de patas
que favorecem o seu deslocamento.

UFRGS CV/2014 BIO

192

16. O quadro abaixo apresenta, na primeira coluna, tipos de hormnios; na segunda, glndulas que os
produzem; e, na terceira, as funes desses hormnios.
Hormnio

Glndula

Funo

(I)

Tireoide

Regula o desenvolvimento e o metabolismo geral

Ocitocina

(II)

Estimula a contrao da musculatura uterina

Paratormnio

Paratireoides

(III)

Assinale a alternativa que apresenta a sequncia de termos e funes que correspondem,


respectivamente, a I, II e III no quadro.
(A) tiroxina ovrios estimula o crtex adrenal.
(B) tireotrfico neuroipfise regula a presso sangunea.
(C) tireotrfico ovrios inibe a produo de insulina.
(D) tiroxina neuroipfise regula a taxa de clcio.
(E) tirocalcitonina adenoipfise estimula o crtex adrenal.

17. Leia a tira abaixo.

CRIES! PEIXES DE
RIO TEM CRIES POR
CAUSA DA GUA DOCE

QUAL A DIFERENA
ENTRE PEIXES DE RIO
E PEIXES DE MAR?

Adaptado de: Zero Hora, 07 set. 2013.

Sobre esses peixes e suas relaes com o meio, correto afirmar que os
(A) cartilaginosos marinhos apresentam bexiga natatria.
(B) sseos de gua doce absorvem sais atravs das brnquias por transporte ativo.
(C) cartilaginosos ocorrem, na maioria, na gua doce.
(D) sseos de gua doce apresentam uremia fisiolgica.
(E) sseos marinhos no possuem oprculo protegendo as brnquias.

UFRGS CV/2014 BIO

193

18. O heredograma abaixo se refere herana da


calvcie em alguns membros da famlia real
britnica.

19. Em julho de 2013, pesquisadores da


Universidade de Massachusetts publicaram
artigo, demonstrando ser possvel desligar o
cromossomo 21 extra, responsvel pela
Sndrome de Down. Os autores mimetizaram
o
processo
natural
de
desligamento
cromossmico conhecido para mamferos.
Assinale com V (verdadeiro) ou F (falso) as
afirmaes abaixo, referentes a esse processo
natural.
( ) O desligamento cromossmico ocorre em
fmeas.
( ) O cromossomo desligado naturalmente
o X.

Supondo que, nessa famlia, a calvcie tenha


herana autossmica influenciada pelo sexo,
ou seja, homens so calvos em homo e
heterozigose e mulheres, somente em
homozigose, considere as afirmaes abaixo,
assinalando-as com V (verdadeiro) ou F
(falso).

( ) O corpsculo de Barr corresponde a um


cromossomo especfico de fmeas.

( ) A calvcie em questo ocasionada pelo


cromossomo X.

(A) V V F F.

( ) Diana transmitiu para William o alelo


responsvel pela sua calvcie.

(C) F V V F.

( ) O desligamento cromossmico ocorre a


partir da puberdade.
A sequncia correta de preenchimento dos
parnteses, de cima para baixo,

(B) V F V F.
(D) F F V V.

( ) Charles recebeu de seu pai um alelo para


calvcie.
( ) George ter 75% de chance de ser calvo,
considerando Kate heterozigota.
A sequncia correta de preenchimento dos
parnteses, de cima para baixo,

(E) V F F V.
20. Assinale
a
alternativa
que
preenche
corretamente a lacuna do texto abaixo.

O ........ consiste na contribuio reprodutiva


de um gentipo ou fentipo para a
composio
gentica
de
geraes
subsequentes, com relao contribuio de
outros gentipos ou fentipos.

(A) V V F V.
(B) V F V F.
(C) F V V F.
(D) F V F V.

(A) valor adaptativo

(E) V F F V.

(B) efeito do fundador


(C) tamanho populacional
(D) pool gentico
(E) gargalo de garrafa

UFRGS CV/2014 BIO

194

21. Considere as afirmaes abaixo sobre o


surgimento de novas espcies.
I - O processo pode ocorrer pela modificao
gradual de uma populao ao longo do
tempo, em resposta a alteraes
ambientais.

23. Em 2013, a Fundao Estadual de Proteo


ao Meio Ambiente (Fepam) proibiu a atividade
de minerao de areia no Rio Jacu.
Posteriormente, liberou a extrao somente a
uma distncia mnima de 60 metros das
margens do rio, e o limite de 10 metros de
profundidade.

II - O processo pode ocorrer por meio do


isolamento geogrfico de subpopulaes
de uma espcie seguida de diferenciao
gentica e isolamento reprodutivo.
III- O processo pode ocorrer pela poliploidia
atravs do cruzamento de indivduos
tetraploides com diploides, originando
triploides que so frteis.

Disponvel em: <http://zerohora.clicrbs.com.br/rs/


economia/noticia/2013/07/com-acordo-extracaode-areia-no-rio-jacui-voltara-ao-normal-em-ate30-dias-4199130.html>. Acesso em: 12 jul. 2013.

Sobre os efeitos que a extrao de areia em


grandes propores nos rios pode provocar,
assinale com V (verdadeiro) ou F (falso) as
afirmaes abaixo.

Quais esto corretas?

( ) Diminuio de reas de praias ao longo


das margens.

(A) Apenas I.

( ) Aumento da diversidade e da biomassa da


ictiofauna bentnica.

(B) Apenas III.

( ) Diminuio do nmero de espcies da


vegetao ribeirinha.

(C) Apenas I e II.


(D) Apenas II e III.

( ) Aumento dos processos erosivos nas


margens.

(E) I, II e III.

22. Considere as afirmaes abaixo sobre a


introduo de espcies exticas em um
ecossistema, como a dos javalis na regio da
fronteira oeste do Rio Grande do Sul.
I - A disseminao dos javalis causa
problemas pela escassez de predadores
naturais que controlem a populao
desses animais.

A sequncia correta de preenchimento dos


parnteses, de cima para baixo,
(A) V V F F.
(B) V F V V.
(C) V F F V.
(D) F F V F.
(E) F V V F.

II - A degradao dos ambientes naturais


favorece as espcies exticas a ocupar
ambientes anteriormente usados pelas
espcies nativas.
III- As espcies exticas invasoras so
consideradas uma das causas da perda de
biodiversidade.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.
UFRGS CV/2014 BIO

195

24. Considere as seguintes afirmaes sobre


conceitos utilizados em ecologia.
I - Nicho ecolgico a posio biolgica ou
funcional que um ecossistema ocupa em
um determinado meio.
II - A zona de transio que faz limite entre
dois bitopos recebe o nome de nvel
trfico.
III- O estudo do comportamento animal em
uma perspectiva evolutiva denomina-se
Etologia.
Quais esto corretas?
(A) Apenas I.
(B) Apenas III.
(C) Apenas I e II.
(D) Apenas II e III.
(E) I, II e III.

25. Em relao aos ciclos biogeoqumicos,


correto afirmar que

(A) a principal reserva de


encontra-se na gua doce.

nitrognio

(B) a precipitao da gua impede a


transferncia de elementos qumicos dos
ambientes terrestres para a gua doce e
para os oceanos.
(C) as erupes vulcnicas representam a
principal fonte de iodo, cobalto e selnio.
(D) as concentraes elevadas de fsforo no
solo de plantaes levam a uma
diminuio de fsforo em rios e lagos.
(E) a queima de vegetais e de combustveis
fsseis a principal responsvel pela
liberao de CO2 na atmosfera, no Brasil.

UFRGS CV/2014 BIO

10

196

2011
QUMICA
CLASSIFICAO PERIDICA DOS ELEMENTOS
Com massas atmicas referidas ao istopo 12 do carbono

18

13

14

15

16

17

He

1,01
3

4,0
10

Li

Be

Ne

6,94

9,01

10,8

12,0

14,0

16,0

19,0

20,2

11

12

13

14

15

16

17

18

Na

Mg

Al

Si

Cl

Ar

23,0

24,3

27,0

28,1

31,0

32,1

35,5

39,9

19

20

21

22

23

24

25

26

27

28

29

30

31

32

33

34

35

36

Ca

Sc

Ti

Cr

Mn

Fe

Co

Ni

Cu

Zn

Ga

Ge

As

Se

Br

Kr

39,1

40,1

45,0

47,9

50,9

52,0

54,9

55,8

58,9

58,7

63,5

65,4

69,7

72,6

74,9

79,0

79,9

83,8

37

38

39

40

41

42

43

44

45

46

47

48

49

50

51

52

53

54

Rb

Sr

Zr

Nb

Mo

Tc

Ru

Rh

Pd

Ag

Cd

In

Sn

Sb

Te

Xe

85,5

87,6

88,9

91,2

92,9

95,9

(98)

101

102,9

106,4

107,8

112,4

114,8

118,7

121,7

127,6

126,9

131,3

55

56

57-71

72

73

74

75

76

77

78

79

80

81

82

83

84

85

86

Cs

Ba

Hf

Ta

Re

Os

Ir

Pt

Au

Hg

TI

Pb

Bi

Po

At

Rn

132,9
87

137,3
88

178,5
104

181
105

183,8
106

186,2
107

190,2
108

192,2
109

195
110

197
111

200,5

204,3

207,2

209

(209)

(210)

(222)

Fr

Ra

Rf

Db

Sg

Bh

Hs

Mt

Ds

Rg

(223)

(226)

(261)

(262)

(266)

(264)

(277)

(268)

(281)

(272)

Srie dos
Lantandios

89-103
Srie dos
Actindios

10

11

12

Srie dos Lantandios


57

58

59

60

61

62

63

64

65

66

67

68

69

70

71

Nmero Atmico

La

Ce

Pr

Nd

Pm

Sm

Eu

Gd

Tb

Dy

Ho

Er

Tm

Yb

Lu

Smbolo

139

140

141

144,2

(145)

150,3

152

157,2

159

162,5

165

167,2

169

173

175

97

98

99

100

101

102

103

Cf

Es

Fm

Md

No

Lr

(251)

(252)

(257)

(258)

(259)

(262)

Massa Atmica
( ) N de massa do
istopo mais estvel

Srie dos Actindios


89

90

91

92

93

94

95

96

Ac

Th

Pa

Np

Pu

Am

Cm Bk

(227)

232,0

231

238

(237)

(244)

(243)

(247)

(247)

Informaes para a resoluo de questes

1. Algumas cadeias carbnicas nas questes de qumica orgnica foram desenhadas na sua forma
simplificada apenas pelas ligaes entre seus carbonos. Alguns tomos ficam, assim,
subentendidos.
e
indicam, respectivamente, ligaes que se
2. As ligaes com as representaes
aproximam do observador e ligaes que se afastam do observador.

10

UFRGS CV/2011 QUI

197

26. Considere os seguintes processos realizados


por um estudante em um laboratrio.
1 - filtrao de uma soluo aquosa de
KMnO4 de cor violeta
2 - destilao de uma soluo aquosa de
K2Cr2O7 de colorao alaranjada

28. Na
fabricao
de
vidros,
utilizam-se,
principalmente, areia (dixido de silcio), cal
(xido de clcio) e barrilha (carbonato de sdio).
Outras substncias que passam por reaes
qumicas especficas tambm podem ser includas
nesse processo.
Abaixo, so apresentadas frmulas de cinco
substncias que participam de reaes
realizadas na fabricao do vidro.

3 - decantao de uma soluo aquosa de


CuSO4 de colorao azul
Aps a realizao de cada um desses
processos, o estudante constatou que a fase
lquida obtida incolor em

1.- SiO2 2.- SO2 3.- CO 4.- Na2CO3 5.- CaO

(A) apenas 1.

(A) As substncias 1, 4 e 5 so slidas na


temperatura ambiente.
(B) Somente a substncia 4 pode ser
considerada inica.
(C) Todas as substncias podem ser
consideradas xidos.
(D) A substncia 2 insolvel em gua.
(E) As substncias 1 e 3 so apolares com
baixos pontos de fuso.

Assinale a afirmao correta, sobre essas


substncias.

(B) apenas 2.
(C) apenas 3.
(D) apenas 1 e 2.
(E) 1, 2 e 3.
27. Desde o sculo XIX, uma das questes mais
preocupantes para os qumicos era a definio
do peso dos tomos. Atualmente, as massas
atmicas dos elementos qumicos so
representadas, em sua maior parte, por
nmeros fracionrios.
O elemento magnsio, por exemplo,
apresenta massa atmica aproximada de 24,3
unidades de massa atmica.

29. Usando-se a tcnica de espectrometria de


massas, possvel determinar a razo 13C/12C
no vinho espumante e em suas bolhas de gs
carbnico. Dependendo do valor dessa razo,
possvel afirmar se o acar e o gs
carbnico foram formados somente pelo
processo natural de fermentaco ou se houve
adio desses compostos durante o processo
de produo do vinho espumante.

Uma justificativa adequada para este valor


fracionrio que
(A) os
tomos
de
magnsio
podem
apresentar um nmero de eltrons
diferente do nmero de prtons.
(B) o nmero de nutrons sempre maior
que o nmero de prtons nos tomos de
magnsio.
(C) o elemento magnsio pode originar
diferentes variedades alotrpicas.
(D) a massa de um tomo de magnsio
relativamente 24,3 vezes maior que a de
um tomo do istopo 12 do carbono.
(E) o elemento magnsio formado por uma
mistura de istopos naturais que
apresentam massas atmicas diferentes.
UFRGS CV/2011 QUI

Considere as seguintes afirmaes,


relao s espcies 12C e 13C.

em

I - As espcies 12C e 13C ocupam a mesma


posio na tabela peridica.
II - A espcie 13C mais densa que a espcie
12
C, porque ela apresenta um prton a
mais.
III- A espcie 13C mais eletronegativa que a
espcie 12C, porque ela apresenta um
eltron a mais.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas
Apenas
Apenas
Apenas
Apenas

I.
II.
III.
I e II.
II e III.
11

198

30. Em 2010, o Prmio Nobel de Qumica foi


atribudo aos pesquisadores Richard F. Heck,
Ei-ichi Negishi e Akira Suzuki. Eles dividiram o
prmio por terem desenvolvido novos
mtodos que revolucionaram a maneira de se
obterem molculas complexas levando
produo de novos medicamentos e de outros
materiais teis no nosso cotidiano. Esses
mtodos consistem em acoplar, na presena
de um catalisador, um haleto orgnico com
uma olefina (Reao de Heck), um
organozinco (Reao de Negishi) ou um
organoboro (Reao de Suzuki), propiciando a
formao de uma nova ligao carbonocarbono.

31. A grande importncia da gua para a vida


est diretamente relacionada especificidade
de suas propriedades.
Considere as seguintes afirmaes, sobre as
propriedades da substncia gua.
I - A forma esfrica das gotas de gua
consequncia de sua tenso superficial
particularmente elevada.
II - A gua, nas condies ambiente,
apresenta-se no estado lquido devido s
fortes ligaes de hidrognio entre suas
molculas.
III- A presena de dois tomos de hidrognio
para cada tomo de oxignio confere
molcula uma geometria trigonal que
determina sua elevada polaridade.

Abaixo, so mostrados exemplos de reagentes


utilizados nessas reaes.
1

CH=CH2

Quais esto corretas?


(A) Apenas I.

(B) Apenas II.

(C) Apenas I e II.


(D) Apenas II e III.

CH3

ZnCl

(E) I, II e III.

Considere as seguintes afirmaes, sobre


esses exemplos de reagentes.
I - Todos os carbonos do composto
apresentam geometria trigonal-plana.
II - No composto 2, o
geometria tetradrica.

boro

apresenta

32. O tiossulfato de sdio utilizado na


formulao de banhos fixadores para
materiais fotogrficos. A obteno do
tiossulfato de sdio ocorre a partir de uma
soluo que contm sulfeto de sdio e
carbonato de sdio, atravs da qual se passa
uma corrente de dixido de enxofre, conforme
a equao abaixo.

III- No
composto
3,
dois
carbonos
apresentam geometria linear, e um
carbono apresenta geometria tetradrica.
Quais esto corretas?
(A) Apenas II.

Na2CO3 + x Na2S + y SO2 z Na2S2O3 + r CO2


Para que essa equao qumica seja
corretamente ajustada a partir de um mol de
carbonato de sdio, os coeficientes x, y, z e r
devem ser, respectivamente,

(B) Apenas III.

(A) 1, 2, 2 e 1.

(C) Apenas I e II.

(B) 1, 3, 2 e 3.

(D) Apenas I e III.

(C) 2, 1, 3 e 2.

(E) I, II e III.

(D) 2, 4, 3 e 1.
(E) 3, 2, 4 e 2.

12

UFRGS CV/2011 QUI

199

33. Para retirar manchas de roupas coloridas,


existe, no mercado, um produto alvejante
sem cloro, cuja eficcia est associada ao seu
poder O2. O principal componente desse
produto o percarbonato de sdio, cuja
frmula 2Na2CO3.3H2O2.
A adio de carbonato de sdio permite a
obteno de um perxido de hidrognio mais
estvel, de fcil transporte, e que se dissolve
com facilidade em gua, liberando H2O e O2
gasoso, o qual tem o poder de branquear e
desinfetar.

35. A substituio de ao por alumnio permite a


fabricao de veculos mais leves, com
consequente reduo do consumo de
combustveis e aumento da resistncia
corroso.
Modelos
mais
recentes
j
empregam em torno de 90 kg de alumnio por
unidade produzida. O alumnio geralmente
extrado da bauxita, minrio que contm
Al2O3.
Quantos automveis podem ser produzidos
com o alumnio obtido a partir de 2.040 kg de
bauxita, com 50% de Al2O3?

Na decomposio do perxido de hidrognio


em H2O e O2 gasoso, o perxido de
hidrognio

(A) 5.
(B) 6.
(C) 9.

(A) somente um agente oxidante.

(D) 12 .

(B) somente um agente redutor.

(E) 54.

(C) atua como detergente tensoativo.


(D) atua como catalisador.
(E) atua simultaneamente como oxidante e
como redutor.

36. A estrutura correta para um hidrocarboneto


aliftico saturado que tem frmula molecular
C11H22 e que apresenta grupamentos etila e
isopropila em sua estrutura

34. A coluna da esquerda, abaixo, relaciona cinco


misturas realizadas experimentalmente; a
coluna da direita, os tipos de classificao de
quatro daquelas misturas.

(A)

Associe corretamente a coluna da direita da


esquerda.

(B)

1
2
3
4
5

(C)

NaNO3
NH4Cl
CaO
C6H14
C6H12O6

+ H 2O
+ H2O
+ H 2O
+ H 2O
+ H2O

( ) soluo bsica
( ) soluo no
eletroltica
( ) soluo cida
( ) mistura com duas
fases lquidas

(D)

A sequncia correta de preenchimento dos


parnteses, de cima para baixo,
(E)

(A) 1 5 2 4.
(B) 2 4 3 1.
(C) 2 1 3 4.
(D) 3 4 1 5.
(E) 3 5 2 4.
UFRGS CV/2011 QUI

13

200

37. Pasteur foi o primeiro cientista a realizar a


separao de uma mistura racmica nos
respectivos enantimeros. Ele separou dois
tipos de cristais do tartarato duplo de amnio
e sdio que haviam sido obtidos por
cristalizao em tanques de fermentao de
uvas. Estes cristais eram de duas formas
quirais opostas, um dos quais correspondia
imagem especular no superponvel do outro.

39. A capsaicina e a zingerona so molculas


responsveis pela sensao de ardor que
sentimos ao ingerir pimenta malagueta e
gengibre, respectivamente.

Sobre esses cristais, so feitas as seguintes


afirmaes.
I - Os dois tipos de cristais apresentam o
mesmo ponto de fuso.
II - Se um dos tipos de cristal for dissolvido
em gua e originar uma soluo
dextrgira, ao prepararmos outra soluo,
de mesma concentrao, com o outro tipo
de cristal, teremos uma soluo levgira.
III- Uma soluo aquosa que contenha a
mesma quantidade de matria dos dois
tipos de cristais no dever apresentar
atividade tica.

Os grupos funcionais
molculas so

Quais esto corretas?

(B) cetona e hidroxila fenlica.

comuns

duas

(A) amida, ter e hidroxila alcolica.


(C) ster e hidroxila alcolica.

(A) Apenas I.

(D) cetona e ster.

(B) Apenas II.

(E) ter e hidroxila fenlica.

(C) Apenas I e III.


(D) Apenas II e III.
(E) I, II e III.

40. Assinale
a
alternativa
que
preenche
corretamente a lacuna do enunciado abaixo.

38. Observe os seguintes compostos.

hexano

hexan-3-ona

hexan-1,3,6-triol

Em relao a estes compostos, correto


afirmar que o mais voltil e o mais solvel em
gua so, respectivamente,
(A) hexan-3-ona e hexan-1,3,6-triol.

O polietileno obtido atravs da reao de


polimerizao do etileno, que, por sua vez,
proveniente do petrleo. Recentemente, foi
inaugurada, no Polo Petroqumico do RS, uma
planta para a produo de plstico verde.
Nesse caso, o etileno usado na reao de
polimerizao obtido a partir do etanol, uma
fonte natural renovvel, e no do petrleo. A
reao
de
transformao
do
etanol
(CH3CH2OH) em etileno (CH2=CH2) uma
reao de ........ .
(A) substituio

(B) hexan-3-ona e hexano.


(C) hexano e hexan-3-ona.

(B) adio

(D) hexano e hexan-1,3,6-triol.

(C) hidrlise

(E) hexan-1,3,6-triol e hexan-3-ona.

(D) eliminao
(E) oxidao

14

UFRGS CV/2011 QUI

201

41. A lisina oxidada no organismo, formando a


hidroxilisina, que um componente do
colgeno. Por outro lado, a degradao da
lisina por bactrias durante a putrefao de
tecidos animais leva formao da
cadaverina, cujo nome d uma ideia de seu
odor.
H2 N

H2 N

NH2

OH

lisina

H 2N

OH

43. A Lei de Hess, elaborada pelo qumico suo


Germain Henry Hess em 1840, afirma, em
terminologia moderna, que a variao de
entalpia de uma reao qumica depende
apenas dos reagentes de partida e dos
produtos finais, e no depende do nmero de
etapas ou intermedirios necessrios para a
converso dos primeiros nos ltimos.

A respeito da Lei de Hess, considere as


seguintes afirmaes.

OH
NH 2
hidroxilisina

I - O metabolismo de um mol de glicose no


organismo, formando gs carbnico e
gua, e a combusto de um mol de
glicose num calormetro liberam a mesma
quantidade de calor.

NH2
cadaverina

Assinale a afirmao correta em relao a


estes compostos.

II - Se numa reao de isomerizao o


contedo de entalpia do produto for
inferior ao do reagente, a reao ser
exotrmica.

(A) A hidroxilisina um glicdio.


(B) A cadaverina um lipdio.

III- H sempre a mesma variao de entalpia


para uma dada reao de combusto de
hidrocarbonetos, no importando se a
gua formada for lquida ou gasosa.

(C) A lisina uma protena.


(D) A lisina e a hidroxilisina so aminocidos.
(E) A hidroxilisina apresenta ligao peptdica.

Quais esto corretas?


42. O cido frmico um cido fraco, de frmula
HCOOH, encontrado nas formigas e na urtiga,
e o responsvel pela sensao de
queimadura.

(A)
(B)
(C)
(D)
(E)

Considere as seguintes afirmaes, a respeito


de solues aquosas deste cido.
I - Quanto mais diluda for uma soluo de
cido frmico, maior a concentrao de
ons H+ presentes.
II - O pH da soluo de cido frmico
aumenta com o aumento da diluio do
cido.
III- O pH de uma soluo com 0,1 mol L1 de
cido frmico igual ao pH de uma
soluo de mesma concentrao de cido
frmico contendo 0,1 mol L1 de formiato
de sdio (HCOONa).

Apenas I.
Apenas II.
Apenas I e II.
Apenas II e III.
I, II e III.

44. Quando se adiciona gua cal viva, formase a cal extinta, de acordo com a reao
abaixo.

Quais esto corretas?


(A) Apenas I.

CaO (s) + H2O (l) Ca(OH)2 (s)


H = 236 kcal mol1
Se 5,6 g de cal viva forem adicionados a 1 kg
de gua, inicialmente a 20 C, a temperatura
final da gua com cal, sabendo-se que o calor
especfico da gua de 1 cal g1(C)1, ser
de aproximadamente
(A) 23,6 C.

(B) Apenas II.

(B) 33,6 C.

(C) Apenas I e II.

(C) 43,6 C.

(D) Apenas II e III.

(D) 53,6 C.

(E) I, II e III.

(E) 63,6 C.

UFRGS CV/2011 QUI

15

202

45. A reao relgio, equacionada abaixo, uma curiosa reao bastante usada em demonstraes, na
qual duas solues quase incolores so misturadas e, aps um determinado tempo, a mistura
adquire subitamente uma colorao azul intensa, devido formao de um complexo do iodo
molecular com amido adicionado como indicador.
2 I (aq) + S2O8
I2 (aq) +2 S2O3

2-

2-

(aq) I2 (aq) + 2 SO4

2-

(aq) (lenta)

(aq) 2 I (aq) + S4O6

2-

(aq) (rpida)

A respeito dessa reao, considere as seguintes afirmaes.


I - A colorao azul aparece quando o iodo molecular formado na primeira etapa acumula, pois no
mais consumido na segunda etapa da reao.
II - O tempo necessrio para o aparecimento da cor azul no depende da concentrao de
tiossulfato.
III- Para que haja formao da colorao azul, necessrio que o tiossulfato esteja
estequiometricamente em excesso.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas I e II.
(D) Apenas II e III.
(E) I, II e III.
46. Considere o enunciado abaixo e as trs propostas para complet-lo.
A produo de cido sulfrico de uma nao considerada como bom indicador de sua fora
industrial. O cido sulfrico produzido a partir de enxofre, de oxignio e de gua, por via do
processo de contato.
Uma das etapas desse processo consiste na oxidao do dixido de enxofre a trixido de enxofre,
com o uso de oxignio na presena de pentxido de vandio, que atua como catalisador, conforme a
equao qumica abaixo.

2 SO2

O2(g)

V2O5

2 SO3

A ao do pentxido de vandio nessa reao de


1 - diminuir o valor da constante de equilbrio da reao.
2 - aumentar a concentrao de SO3 no equilbrio.
3 - possibilitar outro mecanismo para a reao com energia de ativao menor.
Quais propostas esto corretas?
(A) Apenas 1.
(B) Apenas 2.
(C) Apenas 3.
(D) Apenas 2 e 3.
(E) 1, 2 e 3.
16

UFRGS CV/2011 QUI

203

47. A constante de equilbrio da reao de


converso abaixo tem o valor de 0,5.
Glicose 6-Fosfato

Frutose 6-Fosfato

Se essa reao parte de Glicose 6-Fosfato


pura, o grau de converso deste reagente
em produto, quando a reao atinge o
equilbrio, de aproximadamente
(A)
(B)
(C)
(D)
(E)

10%.
25%.
33%.
50%.
66%.

48. A sacarose extraordinariamente solvel em


gua, como mostram os dados da tabela
abaixo.
T (C)
Solubilidade (gSAC/100 g H2O)

30
220

50
260

50. Em viagens espaciais, crucial que os


mantimentos sejam leves e ocupem pouco
espao. Nestas situaes, os alimentos so
preparados por liofilizao e precisam,
antes do consumo, ser reidratados e
reaquecidos. No processo de liofilizao, a
temperatura da amostra reduzida at
abaixo de 0 C, de modo que toda a gua
presente congele. Na sequncia, a presso
reduzida at abaixo da presso do ponto
triplo e, finalmente, o alimento
lentamente aquecido at uma temperatura
acima do ponto de congelamento, de modo
que a gua sublime lentamente. Como
resultado das trs etapas do processo, h
perda de at 97% do contedo de gua.
Considere o diagrama de fases da gua
esquematizado abaixo.

Prepara-se
uma
soluo
saturada
dissolvendo 65 g de sacarose em 25 g de
gua a 50 C. A quantidade de gua a ser
adicionada a esta soluo inicial, de modo
que, quando a soluo resultante for
resfriada at 30 C, tenhamos uma soluo
saturada de sacarose em gua, sem
presena
de
precipitados,

de
aproximadamente
(A)
(B)
(C)
(D)
(E)

2,5 g.
4,5 g.
10,0 g.
15,8 g.
40,0 g.

O processo de liofilizao acima descrito


pode ser representado neste diagrama pela
sequncia de etapas

49. A obteno de metais puros por


eletrodeposio uma das aplicaes
prticas da eletroqumica. A eletrodeposio
pode ser entendida como uma reao entre
eltrons e ons.
Sabendo-se que um mol de eltrons tem a
carga de 96.500 C (constante de Faraday),
a massa de alumnio que ser depositada a
partir de uma soluo de Al2(SO4)3 por uma
corrente de 1,0 A fluindo durante 3 horas
de aproximadamente

(A) 1, 2 e 3.
(B) 2, 3 e 4.
(C) 3, 4 e 5.
(D) 4, 5 e 1.
(E) 4, 5 e 2.

(A) 21,0 g.
(B)
(C)
(D)
(E)

22,0
23,0
29,0
27,0

g.
g.
g.
g.

UFRGS CV/2011 QUI

17

204

2012
QUMICA
CLASSIFICAO PERIDICA DOS ELEMENTOS
Com massas atmicas referidas ao istopo 12 do carbono

18

13

14

15

16

17

He

1,01
3

4,0
10

Li

Be

Ne

6,94

9,01

10,8

12,0

14,0

16,0

19,0

20,2

11

12

13

14

15

16

17

18

Na

Mg

Al

Si

Cl

Ar

23,0

24,3

27,0

28,1

31,0

32,1

35,5

39,9

19

20

21

22

23

24

25

26

27

28

29

30

31

32

33

34

35

36

Ca

Sc

Ti

Cr

Mn

Fe

Co

Ni

Cu

Zn

Ga

Ge

As

Se

Br

Kr

39,1

40,1

45,0

47,9

50,9

52,0

54,9

55,8

58,9

58,7

63,5

65,4

69,7

72,6

74,9

79,0

79,9

83,8

37

38

39

40

41

42

43

44

45

46

47

48

49

50

51

52

53

54

Rb

Sr

Zr

Nb

Mo

Tc

Ru

Rh

Pd

Ag

Cd

In

Sn

Sb

Te

Xe

85,5

87,6

88,9

91,2

92,9

95,9

(98)

101

102,9

106,4

107,8

112,4

114,8

118,7

121,7

127,6

126,9

131,3

55

56

57-71

72

73

74

75

76

77

78

79

80

81

82

83

84

85

86

Cs

Ba

Hf

Ta

Re

Os

Ir

Pt

Au

Hg

TI

Pb

Bi

Po

At

Rn

132,9
87

137,3
88

178,5
104

181
105

183,8
106

186,2
107

190,2
108

192,2
109

195
110

197
111

200,5

204,3

207,2

209

(209)

(210)

(222)

Fr

Ra

Rf

Db

Sg

Bh

Hs

Mt

Ds

Rg

(223)

(226)

(261)

(262)

(266)

(264)

(277)

(268)

(281)

(272)

Srie dos
Lantandios

89-103
Srie dos
Actindios

10

11

12

Srie dos Lantandios


57

58

59

60

61

62

63

64

65

66

67

68

69

70

71

Nmero Atmico

La

Ce

Pr

Nd

Pm

Sm

Eu

Gd

Tb

Dy

Ho

Er

Tm

Yb

Lu

Smbolo

139

140

141

144,2

(145)

150,3

152

157,2

159

162,5

165

167,2

169

173

175

97

98

99

100

101

102

103

Cf

Es

Fm

Md

No

Lr

(251)

(252)

(257)

(258)

(259)

(262)

Massa Atmica
( ) N de massa do
istopo mais estvel

Srie dos Actindios


89

90

91

92

93

94

95

96

Ac

Th

Pa

Np

Pu

Am

Cm Bk

(227)

232,0

231

238

(237)

(244)

(243)

(247)

(247)

Informaes para a resoluo de questes

1. Algumas cadeias carbnicas nas questes de qumica orgnica foram desenhadas na sua forma
simplificada apenas pelas ligaes entre seus carbonos. Alguns tomos ficam, assim,
subentendidos.
e
indicam, respectivamente, ligaes que se
2. As ligaes com as representaes
aproximam do observador e ligaes que se afastam do observador.

UFRGS CV/2012 QUI

11

205

26. Uma hiptese para o acidente com o voo


AF447, na rota Rio-Paris, de que tenha
havido erro de leitura nos indicadores de
velocidade, devido ao congelamento dos
sensores denominados tubos de Pitot. No
momento
do
acidente,
a
aeronave
atravessava uma forte tempestade, fato que
pode ter ocasionado condies atpicas de
temperatura e de presso, que teriam levado
formao de gua super-resfriada. Essa
gua super-resfriada teria congelado instantaneamente ao encontrar a superfcie metlica
dos tubos de Pitot. Estima-se que a temperatura
externa da aeronave no momento do acidente
estava em torno de 40C.

28. O hidrxido de sdio, NaOH, uma substncia de ampla utilizao industrial, sendo
obtida atravs da eletrlise em soluo aquosa
do NaCl, de acordo com a reao abaixo.
2 NaCl + 2 H2O  Cl2 + H2 + 2 NaOH

Considere as seguintes afirmaes, a respeito


da quantidade de partculas atmicas
presentes em algumas espcies qumicas
dessa reao.
I - As quantidades de prtons existentes nos
tomos de sdio e de cloro presentes no
NaCl permanecem inalteradas quando
esses tomos formam os produtos Cl2 e
NaOH .
II - A substncia cloro gasoso constituda
por molculas neutras formadas por
tomos de cloro que apresentam 17
eltrons cada um.
III- No on positivo do elemento sdio, o
nmero de eltrons maior que o
existente em um tomo neutro de sdio.

O termo gua super-resfriada corresponde a


uma situao metaestvel na qual a gua se
encontra
(A) no estado slido em uma temperatura
abaixo do seu ponto de congelamento.

Quais esto corretas?

(B) no estado lquido em uma temperatura


superior e prxima ao seu ponto de
congelamento

(A)
(B)
(C)
(D)
(E)

(C) no estado lquido em uma temperatura


abaixo do seu ponto de congelamento
(D) no estado slido em uma temperatura
superior e prxima ao seu ponto de
congelamento.
(E) nos estados slido, lquido e gasoso,
simultaneamente, em uma temperatura
abaixo do seu ponto de congelamento.
27. A cultura egpcia desenvolveu tcnicas
avanadas de mumificao para a preservao
dos corpos. Em uma das etapas mais
importantes do processo de mumificao, a
desidratao do corpo, utilizava-se uma soluo
de sais de natro. Essa soluo constituda por
uma mistura de sais de carbonato, bicarbonato,
cloreto e sulfato de sdio.

Apenas I.
Apenas II.
Apenas III.
Apenas I e II.
I, II e III.

29. Em 2011, um intenso terremoto seguido de


tsunami provocou srias avarias nos reatores da
usina nuclear de Fukushima, no Japo,
ocasionando a liberao de iodo radioativo em
dosagem muito superior aos limites aceitveis.
Como medida de preveno, foram distribudos
populao evacuada tabletes de iodo. A OMS
indica, preferencialmente, que esses tabletes
sejam constitudos da substncia iodato de
potssio (KIO3), em vez da substncia iodeto de
potssio (KI), que tem menor durabilidade.

Quando os sais de natro so dissolvidos em


gua, os ons presentes, alm do Na+, so
(A) CO23 , HCO3 , ClO e HSO4.
(B) CO23 , HCO3 , ClO e SO42.
(C) CO32, H2CO3, Cl e SO32.
(D) CO32 , H2CO3 , Cl e HSO4.
(E) CO32 , HCO3, Cl e SO42.
12

Sobre essas substncias, correto afirmar que


(A) o iodeto de potssio um sal bsico e
insolvel em gua.
(B) o iodato de potssio um sal neutro e
solvel em gua.
(C) o iodato de potssio apresenta o elemento
iodo em seu estado mnimo de oxidao.
(D) o iodato de potssio um xido,
enquanto o iodeto de potssio um sal
no oxigenado.
(E) o iodeto de potssio pode ser utilizado
como agente oxidante, pois sofre reduo
com facilidade em contato com o oxignio
do ar.
UFRGS CV/2012 QUI

206

30. A coluna da esquerda, abaixo, apresenta


cinco espcies moleculares que tm o
elemento enxofre como tomo central; a da
direita, tipos de geometria molecular que
correspondem a quatro dessas espcies.

32. Num parque temtico oferecida a atrao


da neve artificial, obtida a partir de gua da
chuva e nitrognio lquido, em contineres
que funcionam como cmaras frias.
Considere as afirmaes abaixo sobre o
processo de produo de neve artificial
contidas no prospecto informativo do parque.

Associe corretamente a coluna da direita da


esquerda.
1 - SO2

( ) trigonal-plana

2 - SOCl2

( ) tetradrica

3 - H2SO4

( ) piramidal

4 - SO3

( ) angular

I - A neve artificial que imita o fenmeno


natural produzida pela reao entre
nitrognio e gua.
II - A fabricao de neve artificial refere-se ao
setor da criogenia, tecnologia para a
produo de temperaturas muito abaixo
do ponto de congelamento da gua,
principalmente com a utilizao de
nitrognio lquido.

5 - H2S
A sequncia correta de preenchimento dos
parnteses, de cima para baixo,

(D) 4 3 2 1.

III- A gua lquida injetada nos contineres


atravs de um sistema de flautas, sendo
que a gua aspersada (borrifada) se
divide em molculas, as quais se
transformam em cristais formando os
flocos de neve.

(E) 4 2 3 5.

Quais esto corretas?

(A) 2 3 1 4.
(B) 2 4 3 1.
(C) 3 2 1 5.

(A) Apenas I.

31. Um experimento clssico em aulas prticas de


Qumica consiste em mergulhar pastilhas de
zinco em soluo de cido clordrico. Atravs
desse procedimento, pode-se observar a
formao de pequenas bolhas, devido
liberao de hidrognio gasoso, conforme
representado na reao ajustada abaixo.

(B) Apenas II.


(C) Apenas III.
(D) Apenas II e III.
(E) I, II e III.
33. Observe as duas reaes abaixo envolvendo a
dimetilamina.

Zn + 2 HCl ZnCl2 + H2
Ao realizar esse experimento, um aluno
submeteu 2 g de pastilhas de zinco a um
tratamento com cido clordrico em excesso.

1- (CH3)2NH + HCl [(CH3)2NH2]+Cl


2- (CH3)2NH + C4H9Li (CH3)2N Li+ + C4H10

Com base nesses dados, correto afirmar


que, no experimento realizado pelo aluno, as
bolhas formadas liberaram uma quantidade
de gs hidrognio de, aproximadamente,

A dimetilamina atua nas reaes 1 e 2,


respectivamente, como

(A) 0,01 mols.

(B) base e redutor.

(B) 0,02 mols.

(C) oxidante e redutor.

(C) 0,03 mols.

(D) oxidante e cido.

(D) 0,06 mols.

(E) redutor e catalisador.

(A) base e cido.

(E) 0,10 mols.


UFRGS CV/2012 QUI

13

207

34. O sulfeto de hidrognio (H2S) um gs incolor de cheiro desagradvel altamente txico. No


segmento industrial, a procedncia do H2S oriunda, geralmente, de processos de remoo de
gases cidos e de tratamento de efluentes, como exemplificado nas reaes abaixo.
Assinale com V (verdadeiro) as reaes abaixo em que ocorre tanto oxidao quanto reduo do
enxofre e com F (falso) as demais.
( ) FeS2 + H2O (alta temperatura)  FeO + H2S + S
( ) CuS + H2SO4  CuSO4 + H2S
( ) 4 Na2SO3 + 2 H2O (vapor)  3 Na2SO4 + 2 NaOH + H2S
( ) CH4 + 4 S (vapor)  CS2 + 2 H2S
A sequncia correta de preenchimento dos parnteses, de cima para baixo,
(A) V F F F.
(B) F F V F.
(C) V F V F.
(D) F V F V.
(E) F V V V.
35. A destilao de folhas de plantas ou cascas de algumas frutas com vapor de gua produz misturas
lquidas de fragrncias chamadas de leos essenciais. Muitos desses leos so usados como
matrias-primas para as indstrias cosmtica, farmacutica e alimentcia. Abaixo, so mostradas as
estruturas e frmulas moleculares dos principais componentes de alguns leos essenciais.

H
O

mirceno (leo de louro)

C10H16

limoneno (leo de casca de laranja ou limo)

C10H16

citronelal (leo de citronela)

C10H18O

Considere as seguintes afirmaes, a respeito da combusto completa desses compostos.


I - A combusto de um mol de cada um desses compostos leva formao da mesma quantidade
de CO2.
II - A combusto de um mol de mirceno e de um mol de limoneno leva formao da mesma
quantidade de gua.
III- A combusto de um mol de limoneno e de um mol de citronelal leva formao de diferentes
quantidades de gua.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas I e II.
(D) Apenas II e III.
(E) I, II e III.
14

UFRGS CV/2012 QUI

208

36. Existe um mito de que produto qumico e produto txico so sinnimos e que um produto, por ser
natural, no faz mal sade. No sculo IV a.C., os gregos coletavam amostras do veneno cicuta de
uma planta (Conium maculatum). Coniina e conicena, cujas estruturas so mostradas abaixo, so
os principais alcalides presentes nesta planta, sendo os responsveis por sua toxidez.

Coniina

Conicena

Com base nas estruturas desses compostos, considere as afirmaes abaixo.


I - A conicena apresenta o menor ponto de ebulio.
II - A coniina no apresenta carbono assimtrico em sua estrutura.
III- Tanto a conicena quanto a coniina so aminas secundrias.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(D) Apenas III.
(D) Apenas I e II.
(E) Apenas II e III .
37. Um teste clssico para a identificao de alcenos o descoramento de uma soluo de bromo.
Bromo, que tem uma colorao vermelho-castanho, se adiciona dupla ligao formando um
produto dibromado incolor, conforme mostra a equao abaixo.
CH3CH2CH2CH2CH=CH2
incolor

Br2

CH3CH2CH2CH2CHBrCH2Br

vermelho-castanho

incolor

Para a realizao desse teste, primeiramente, adiciona-se, em trs tubos de ensaio, hex-1-eno; em
seguida, bromo, conforme se registrou na tabela abaixo.
Tubo de ensaio
A
B
C

Hex-1-eno
2,1 g
4,2 g
8,4 g

Br2
4,4 g
8,4 g
15,0 g

Ao final do teste, quais sero os tubos de ensaio que apresentaro uma soluo incolor?
Considere massa molar do Hex-1-eno como 84 g/mol.
(A) Apenas A.
(B) Apenas B.
(C) Apenas C.
(D) Apenas A e B.
(E) Apenas B e C.
UFRGS CV/2012 QUI

15

209

38. Observe os seguintes aminocidos.


H2N

CH2

COOH

glicina

H2N

CH

COOH

alanina

39. O cido ndico, cuja estrutura mostrada


abaixo, um antibitico isolado de cogumelos
como o Tricholoma nudum.

HO2C

CH3
H2N

CH

COOH

cistena

CH2SH

Em relao a uma molcula de cido ndico,


correto afirmar que o nmero total de tomos
de hidrognio, de ligaes duplas e de
ligaes triplas , respectivamente,

A reao entre o grupo cido carboxlico de


uma molcula de aminocido e o grupo amina
de outra molcula de aminocido, com
eliminao de gua, forma uma ligao
peptdica (-CO-NH-), gerando um dipeptdio.

(A) 1 1 2.
(B) 1 2 3.

Qual o nmero mximo de dipeptdios


diferentes que podem ser formados a partir
de uma mistura equimolar de glicina, alanina
e cistena?
(A)
(B)
(C)
(D)
(E)

CN

cido ndico

(C) 3 1 2.
(D) 3 2 3.
(E) 5 1 3.

2.
3.
6.
8.
9.

40. Assinale a alternativa que completa corretamente as lacunas do enunciado abaixo, na ordem em que
aparecem.
O brometo de benzila pode ser transformado em lcool benzlico, que, por sua vez, pode conduzir ao
cido benzoico, conforme a sequncia de reaes mostrada abaixo.
CH2Br

NaOH aquoso

CH2OH

KMnO4 aquoso

COOH

Com base nesses dados, correto afirmar que a primeira etapa uma reao de ........ , e, a
segunda, uma reao de ........ .
(A) substituio oxidao
(B) substituio adio
(C) eliminao

oxidao

(D) eliminao

substituio

(E) eliminao

adio

16

UFRGS CV/2012 QUI

210

41. Assinale
a
alternativa
que
completa
corretamente as lacunas do enunciado abaixo,
na ordem em que aparecem.
Uma sopa muito salgada aquecida numa
panela aberta. Nessas condies, a sopa deve
entrar em ebulio numa temperatura ........
100 C. Assim, medida que a gua da sopa
evapora, a temperatura da sopa ........ .
(A) acima de

aumenta

(B) acima de

diminui

(C) abaixo de aumenta


(D) igual a

permanece constante

(E) igual a

aumenta

42. Um estudante realizou uma diluio, conforme


mostrado na figura abaixo.

43. A solubilidade aquosa do KNO3, a 25 C, de


36 g/100 mL, e a 35 C, de 55 g/100 mL.
Uma soluo de KNO3 preparada em gua a
30 C, contendo 55 g deste sal em 100 mL de
gua ser uma
(A) soluo saturada, porm sem precipitado.
(B) soluo saturada na presena de
precipitado.
(C) soluo no saturada, porm, sem
precipitado.
(D) soluo no saturada na presena de
precipitado.
(E) mistura heterogna formada por sal
precipitado e gua pura.
44. Apesar da pequena quantidade de oxignio
gasoso (O2) dissolvido na gua, sua presena
essencial para a existncia de vida aqutica.
Sabendo-se que na gua de um lago h uma
molcula de oxignio (O2) para cada 0,2
milhes
de
molculas
de
gua
e
considerando-se que em 1 litro de gua h
55,55 mols de molculas de gua, a
concentrao em mol L1 do oxignio na gua
desse lago ser de
(A) 0,2 10

(B) 5,0 10

(C) 2,4 10

(D) 2,8 10

(E) 3,3 10

.
.
.
.
.

45. A reao
N2O4 (g) 2 NO2 (g)
Supondo-se que a densidade da gua, bem
como da soluo inicial, sejam de 1,0 g mL1,
qual ser o volume de gua a ser adicionado
para que a soluo passe a ter concentrao
de 0,2 mol L1 ?
(A)

25 mL.

(B)

50 mL.

(C)

100 mL.

um processo que segue uma cintica de


primeira ordem, e sua constante de
velocidade a 25 C de 1,0 10-3 s-1.
Partindo-se de uma concentrao inicial
2,00 mol L1 de N2 O4 , a taxa inicial de
formao de NO 2 ser
(A) 1,0 10-3 mol L1 s-1.
(B) 2,0 10-3 mol L1 s-1.
(C) 4,0 10-3 mol L1 s-1.

(D) 200 mL.

(D) 8,0 10-3 mol L1 s-1.

(E)

(E) 16,0 10-3 mol L1 s-1.

250 mL.

UFRGS CV/2012 QUI

19

211

46. No metabolismo dos vegetais, quando se considera o balano energtico, deve-se levar em conta
que a energia dos vegetais obtida atravs da queima de substncias como a glicose, cuja
combusto metablica pode ser equacionada da seguinte maneira:
C6H12O6 (s) + 6 O2 (g) 6 CO2 (g) + 6 H2O (l)

A glicose, por sua vez, sintetizada numa das reaes mais importantes da natureza, a fotossntese,
cuja equao est representada abaixo.
6 CO2 (g) + 6 H2O (l) C6H12O6 (s) + 6 O2 (g)

II

Com base nesses dados, assinale a alternativa correta, a respeito do balano energtico no
metabolismo de vegetais.
(A) Para que o vegetal no consuma, na sntese da glicose, toda a energia obtida na sua
combusto, deve-se ter HI - HII.
(B) As duas reaes so excees da Lei de Hess.
(C) Para que haja um bom rendimento em termos energticos, deve-se ter, em mdulo, HI >> HII.
(D) Como, em mdulo, HI < HII, os vegetais precisam necessariamente de outras fontes
energticas alm da glicose.
(E) A combinao das duas reaes constitui exemplo de interconverso de energia.
47. Abaixo, est representado o perfil de energia ao longo do caminho da reao de isomerizao do
cis-but-2-eno para o trans-but-2-eno.

Considere as seguintes afirmaes a respeito da velocidade dessa reao.


I - A barreira de energia de ativao da reao direta de 256 kJ.
II - Como a reao exotrmica, sua velocidade diminuir com o aumento da temperatura.
III- A presena de catalisador tornar a reao mais exotrmica.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e II.
(E) Apenas I, II e III.
UFRGS CV/2012 QUI

19

212

49. A quantidade de etanol presente na gasolina


deve respeitar os limites estabelecidos pela
Agncia Nacional do Petrleo. Para forar a
diminuio do preo do etanol, o Governo tem
reduzido o teor de etanol na gasolina.

48. A constante de equilbrio da reao

CO(g) + 2H2(g)

CH3OH(g)

tem o valor de 14,5 a 500 K. As concentraes


de metanol e de monxido de carbono foram
medidas nesta temperatura em condies de
equilbrio, encontrando-se, respectivamente,
1 mol L1.
0,145 mol L1 e
Com base nesses dados, correto afirmar que
a concentrao de hidrognio, em mol L1,
dever ser
(A) 0,01.
(B) 0,1.

Um aluno, para determinar o teor de etanol


presente
na
gasolina,
realizou
um
experimento adicionando 50 mL de gasolina e
50 mL de gua a um cilindro graduado com
tampa. Aps agitar a soluo, o aluno
observou a presena de duas fases, uma
superior e outra inferior, constatando que a
fase superior continha 35 mL de lquido.
Sabendo-se
que
a
densidade
dos
hidrocarbonetos menor que a da gua,
correto afirmar que, na gasolina testada pelo
aluno, o teor de lcool, em volume/volume
de, aproximadamente,
(A)
(B)
(C)
(D)
(E)

(C) 1.
(D) 1,45.
(E) 14,5.

15%.
30%.
35%.
60%.
70%.

50. O ano de 2011 foi proclamado como o Ano Internacional da Qumica, que abordou o tema
Qumica - a nossa vida, o nosso futuro, envolvendo vrios projetos no mundo todo.
Um dos projetos desenvolvidos foi denominado pH do planeta - Experimento global sobre a
qualidade da gua. Neste projeto, alunos do mundo inteiro foram convidados a coletar amostras
de gua em suas regies, a fim de mapear as condies de gua no planeta.
No quadro abaixo, so mostrados alguns dados coletados no Brasil.
Local

Rio Itaja do
Sul-SC

Dique do
Toror-BA

Baa de
Guanabara-RJ

Rio So
Francisco-AL

Praia do
Pina-PE

Natureza da gua

Fluvial

Manancial de
gua doce

Salgada

Fluvial

Salgada

6.8

8.0

7.7

6.4

8.2

pH

Sobre esses dados so feitas as seguintes afirmaes.


+

-7

I - As guas fluviais analisadas apresentam concentraes de H maiores que 10

mol L1.

II - A gua do dique do Toror imprpria para consumo humano, devido a sua excessiva acidez.
+

III- As guas salgadas analisadas apresentam concentraes de H menores que as concentraes


+
de H das guas fluviais analisadas.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas I.
Apenas III.
Apenas I e II.
Apenas I e III.
I, II e III.

UFRGS CV/2012 QUI

19

213

2013
QUMICA
CLASSIFICAO PERIDICA DOS ELEMENTOS
Com massas atmicas referidas ao istopo 12 do carbono

18

13

14

15

16

17

He

1,01
3

4,0
10

Li

Be

Ne

6,94

9,01

10,8

12,0

14,0

16,0

19,0

20,2

11

12

13

14

15

16

17

18

Na

Mg

Al

Si

Cl

Ar

23,0

24,3

27,0

28,1

31,0

32,1

35,5

39,9

19

20

21

22

23

24

25

26

27

28

29

30

31

32

33

34

35

36

Ca

Sc

Ti

Cr

Mn

Fe

Co

Ni

Cu

Zn

Ga

Ge

As

Se

Br

Kr

39,1

40,1

45,0

47,9

50,9

52,0

54,9

55,8

58,9

58,7

63,5

65,4

69,7

72,6

74,9

79,0

79,9

83,8

37

38

39

40

41

42

43

44

45

46

47

48

49

50

51

52

53

54

Rb

Sr

Zr

Nb

Mo

Tc

Ru

Rh

Pd

Ag

Cd

In

Sn

Sb

Te

Xe

85,5

87,6

88,9

91,2

92,9

95,9

(98)

101

102,9

106,4

107,8

112,4

114,8

118,7

121,7

127,6

126,9

131,3

55

56

57-71

72

73

74

75

76

77

78

79

80

81

82

83

84

85

86

Cs

Ba

Hf

Ta

Re

Os

Ir

Pt

Au

Hg

TI

Pb

Bi

Po

At

Rn

132,9
87

137,3
88

178,5
104

181
105

183,8
106

186,2
107

190,2
108

192,2
109

195
110

197
111

200,5

204,3

207,2

209

(209)

(210)

(222)

Fr

Ra

Rf

Db

Sg

Bh

Hs

Mt

Ds

Rg

(223)

(226)

(261)

(262)

(266)

(264)

(277)

(268)

(281)

(272)

Srie dos
Lantandios

89-103
Srie dos
Actindios

10

11

12

Srie dos Lantandios


57

58

59

60

61

62

63

64

65

66

67

68

69

70

71

Nmero Atmico

La

Ce

Pr

Nd

Pm

Sm

Eu

Gd

Tb

Dy

Ho

Er

Tm

Yb

Lu

Smbolo

139

140

141

144,2

(145)

150,3

152

157,2

159

162,5

165

167,2

169

173

175

97

98

99

100

101

102

103

Cf

Es

Fm

Md

No

Lr

(251)

(252)

(257)

(258)

(259)

(262)

Massa Atmica
( ) N de massa do
istopo mais estvel

Srie dos Actindios


89

90

91

92

93

94

95

96

Ac

Th

Pa

Np

Pu

Am

Cm Bk

(227)

232,0

231

238

(237)

(244)

(243)

(247)

(247)

Informaes para a resoluo de questes

1. Algumas cadeias carbnicas nas questes de qumica orgnica foram desenhadas na sua forma
simplificada apenas pelas ligaes entre seus carbonos. Alguns tomos ficam, assim,
subentendidos.
e
indicam, respectivamente, ligaes que se
2. As ligaes com as representaes
aproximam do observador e ligaes que se afastam do observador.

UFRGS CV/2013 QUI

13

214

28. Considere a reao abaixo.

26. Considere os seguintes processos.

Ca(OH)2 + (NH4)2SO4 CaSO4 + 2 NH3 + 2 H2O

I - Formao de neve em condies


adequadas de temperatura, umidade e
presso.
II - Clareamento
oxigenada.

dos

pelos

com

Analisando as propriedades das substncias


participantes dessa reao, verificou-se que
uma delas apresenta o seguinte diagrama,
quando submetida a processos de mudanas
de estado fsico.

gua

III- Adio de adoante do tipo aspartame no


caf.
Quais processos
qumica?

envolvem

uma

reao

(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e II.
(E) Apenas II e III.
A substncia participante da reao que
corresponde ao diagrama acima

27. Considere as seguintes situaes qumicas.


1 - Nanotubos de carbono so organizados
na forma de tubos de dimenso
nanomtrica. No fulereno, a estrutura
assemelha-se a uma bola de futebol, e
o grafeno apresenta uma estrutura
planar. Todos eles so constitudos
exclusivamente por carbono, mas as
diferenas nas suas estruturas propiciam
aplicaes tecnolgicas diferentes.
2 - O urnio encontrado na natureza uma
forma combinada, em que a espcie mais
abundante o urnio-238, o qual no
adequado
para
ser
usado
como
combustvel nas usinas nucleares. Assim,
para um melhor aproveitamento, o urnio
submetido a um processo de
enriquecimento,
que
consiste
em
aumentar o teor de urnio-235, o qual
possui alto poder de fisso.

(A) Ca(OH)2.
(B) (NH4)2SO4.
(C) CaSO4.
(D) NH3.
(E) H2O.
29. Na reunio da IUPAC, que celebrou o fim do
Ano Internacional da Qumica, os mais novos
elementos foram oficialmente denominados
de flervio, em homenagem ao fsico russo
Georgiy Flerov, e de livermrio, em
homenagem ao Laboratrio Livermore da
Califrnia. Esses so os dois elementos mais
pesados da tabela peridica e so altamente
radioativos. O flervio (Fl) apresenta nmero
atmico 114 e nmero de massa 289, e o
livermrio (Lv) apresenta nmero atmico 116
e nmero de massa 292.

As espcies qumicas citadas nas situaes 1 e


2 so, respectivamente, exemplos de

O nmero de nutrons em cada tomo do


elemento flervio e o nmero de nutrons em
cada tomo do elemento livermrio so,
respectivamente,

(A) altropos e istopos.

(A) 114 e 116.

(B) enantimeros e isbaros.

(B) 175 e 176.

(C) ismeros e antpodas.

(C) 189 e 192.

(D) isomorfos e altropos.

(D) 289 e 292.

(E) istopos e ismeros.

14

(E) 403 e 408.

215

UFRGS CV/2013 QUI

30. O nitrito de sdio um aditivo utilizado em alimentos industrializados base de carnes, que atua na
fixao da cor e na preveno do crescimento de certas bactrias, apresentando elevado fator de
risco toxicolgico. A identificao de nions nitritos pode ser realizada pela adio de um sal ferroso
em meio cido, produzindo xido ntrico, que, por sua vez, se combina com o excesso de ons
ferrosos para formar um complexo de cor marrom que identifica a presena de nitrito.
A primeira etapa do processo de identificao de nitritos representada pela reao abaixo
2 FeSO4 + 2 NaNO2 + 2 H2SO4 Fe2(SO4)3 + 2 NO + 2 H2O + Na2SO4.

Pode-se afirmar que, nessa etapa do processo,


(A) ocorre reduo dos nions nitritos por ao do sal ferroso.
(B) ocorre oxidao dos ons H+ do cido por ao do sal ferroso.
(C) o on H+ do cido atua como agente redutor dos nions nitritos.
(D) o nitrognio, no xido ntrico, est em um estado mais oxidado do que no nion nitrito.
(E) o ferro no FeSO4 est em um estado mais oxidado do que no Fe2(SO4)3.

31. Muitas vezes, necessrio descartar tipos de lixo nos quais existem resduos que, embora possam
ser reaproveitados, no devem ser enviados reciclagem comum, devido aos efeitos nocivos que
podem provocar sade e ao meio ambiente. Esses resduos devem ser coletados em locais
especficos, de acordo com sua procedncia.
A coluna da esquerda, abaixo, relaciona cinco tipos de lixo que no devem ser enviados reciclagem
comum; a da direita, as principais substncias responsveis pelos efeitos nocivos de cada tipo de
lixo.
Associe corretamente a coluna da direita da esquerda.
1 - lmpadas fluorescentes

( ) sais de prata

2 - toner para fotocopiadoras

( ) nquel e cdmio

3 - chapas de raios-X

( ) negro de fumo (p de carbono)

4 - bateria de celular

( ) mercrio (vapor)

5 - antibitico com validade vencida


A sequncia correta de preenchimento dos parnteses, de cima para baixo,
(A) 2 5 3 4.
(B) 2 4 3 5.
(C) 3 4 2 1.
(D) 3 2 4 5.
(E) 4 5 2 1.

UFRGS CV/2013 QUI

216

15

32. Na coluna da esquerda, abaixo, esto listados


cinco pares de substncias, em que a primeira
substncia de cada par apresenta ponto de
ebulio mais elevado do que o da segunda
substncia, nas mesmas condies de
presso. Na coluna da direita, encontra-se o
fator mais significativo que justificaria o ponto
de ebulio mais elevado para a primeira
substncia do par.

34. Por muito tempo, acreditou-se que os gases


nobres seriam incapazes de formar compostos
qumicos. Entretanto, atualmente, sabe-se
que, sob determinadas condies, possvel
reagir um gs nobre, como o xennio, e
formar, por exemplo, o composto cuja sntese
e caracterizao foi descrita em 2010 e cuja
estrutura est mostrada abaixo.

Associe corretamente a coluna da direita da


esquerda.
1 - CCl4 e CH4
2 - CHCl3 e CO2
3 - NaCl e HCl
4 - H2O e H2S

( ) intensidade das ligaes


de hidrognio
( ) massa molecular mais
elevada
( ) estabelecimento de
ligao inica

5 - SO2 e CO2

( ) polaridade da molcula

A sequncia correta de preenchimento dos


parnteses, de cima para baixo,

(A)
(B)
(C)
(D)
(E)

2
2
3
4
4

4
4
5
1
5

1
3
4
3
1

3.
5.
1.
5.
3.

Considere as seguintes afirmaes sobre o


composto acima.

33. Em avies, quando as mscaras de oxignio


caem, elas ficam presas por um cabo de
acionamento. Quando a mscara puxada,
esse cabo aciona o gatilho do gerador de
oxignio, provocando uma reao exotrmica
entre limalha de ferro e sal clorato de sdio,
contidos no recipiente armazenador. O calor
liberado aquece ainda mais o clorato restante,
que se decompe rapidamente, liberando
oxignio.
Qual
das
reaes
abaixo representa
corretamente a reao de decomposio do
clorato de sdio, que ocorre no gerador de
oxignio?

I - Nesse composto, o xennio est ligado a


um on fluoreto e a um on nitrato.
II - Nesse composto, o xennio tem
geometria linear; e o nitrognio tem
geometria trigonal plana.
III- Nesse composto, o xennio tem estado
de oxidao zero.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e II.
(E) Apenas II e III.

16

(A) 2NaClO

2Na + Cl2+ O2

(B) 2NaClO

2NaCl+ ClO2

(C) 2NaClO2

2Na + Cl2+ 2O2

(D) 2NaClO3

2Na + Cl2+ 3O2

(E) 2NaClO3

2NaCl + 3O2

217

UFRGS CV/2013 QUI

35. Em 2012, aps dcadas de pesquisas,


cientistas anunciaram, na Sua, terem
detectado uma partcula compatvel com o
denominado bson de Higgs, partcula que d
origem massa. Essa partcula foi detectada
no maior acelerador de partculas do mundo,
o Large Hadron Collider (LHC), onde so
realizadas experincias que consistem em
acelerar, em direes opostas, feixes de
prtons em velocidades prximas da luz,
fazendo-os colidirem entre si para provocar
sua
decomposio.
Nos
experimentos
realizados no LHC, so injetados, no
acelerador, feixes contendo cerca de 100
bilhes de prtons, obtidos da ruptura de
tomos de hidrognio.
Para obter 100 bilhes de prtons,
necessria uma quantidade de tomos de
hidrognio de, aproximadamente,
(A) 6,02 x 1011

mols.

(B) 1,66 x 105

mols.

-1

(C) 6,02 x 10

37. A anlise elementar de um hidrocarboneto


mostrou que ele composto por 20% de
hidrognio e 80% de carbono.
O composto abaixo que apresenta essa
composio o
(A) eteno.
(B) benzeno.
(C) etino.
(D) etano.
(E) metanol.
38. Salvinorina A, cuja estrutura mostrada
abaixo, um dos mais potentes alucingenos
naturais que se conhece. Esse composto
encontrado na Salvia divinorum, uma planta
rara do Mxico.

mols.

(D) 3,01 x 10-10 mols.


(E) 1,66 x 10-13 mols.

36. Na combusto do diesel, o enxofre presente


convertido em dixido de enxofre (SO2), que
uma das principais causas de chuva cida. At o
fim de 2013, o diesel S1800, que contm 1800
ppm de enxofre (ppm = partes por milho
expressa em massa), ser totalmente abolido no
pas. Atualmente, o diesel mais vendido o diesel
S500 (500 ppm de enxofre).
A emisso de SO2, por tonelada de diesel,
para S500 e S1800, , respectivamente, de

A respeito da estrutura da Salvinorina A,


considere as seguintes afirmaes.
I - Contm anis heterocclicos.
II - Contm carbonos assimtricos.
III- No apresenta carbonos tercirios.

(A) 500 g e 1800 g.


(B) 640 g e 900 g.

Quais esto corretas?

(C) 1000 g e 3600 g.

(A) Apenas II.

(D) 1600 g e 3200 g.

(B) Apenas III.

(E) 2000 g e 7200 g.

(C) Apenas I e II.


(D) Apenas II e III.
(E) I, II e III.

UFRGS CV/2013 QUI

218

17

39. O carmaterol, cuja estrutura mostrada


abaixo, est em fase de testes clnicos para o
uso no tratamento de asma.

41. A respeito de biomolculas, considere as


afirmaes abaixo.
I - O acar extrado da cana de acar a
sacarose, que um dissacardeo
composto de glicose e frutose.
II - Os cidos graxos insaturados contm, na
sua estrutura, pelo menos uma ligao
dupla carbono-carbono.
III- As ligaes peptdicas so rompidas no
processo de desnaturao de protenas.

Assinale a alternativa que contm funes


orgnicas presentes no carmaterol.

Quais esto corretas?

(A) cido carboxlico, ter e fenol

(A) Apenas II.

(B) Amina, amida e fenol

(B) Apenas III.

(C) lcool, ster e fenol

(C) Apenas I e II.

(D) Aldedo, amina e ter

(D) Apenas I e III.

(E) lcool, amina e ster

(E) I, II e III.

40. Assinale
a
alternativa
que
preenche
corretamente as lacunas do enunciado abaixo,
na ordem em que aparecem.

42. Assinale com V (verdadeiro) ou F (falso) as


afirmaes abaixo.

A reao do 2-bromo-2-metilpropano com o


etxido de sdio, usando etanol como
solvente, leva formao de 3% de ter e de
97% de alceno, conforme representado
abaixo.

( ) O ter dietlico e o butan-1-ol tm como


frmula
estrutural
condensada,
respectivamente, CH3..CH2..O..CH2..CH3 e
CH3..CH2..CH2..CH2..OH.
( ) O ter dietlico e o butan-1-ol so
ismeros.
( ) O ter dietlico apresenta ponto de
ebulio maior que o butan-1-ol.
( ) O n-butano tem maior solubilidade em
gua que o butan-1-ol.

Em relao aos produtos, correto afirmar


que o ter formado por uma reao de
........, e o alceno formado por uma reao
de ........ .

(C) V F V F.

(B) substituio desidrataco

18

eliminao

(D) adio

hidrogenao

(E) adio

desidratao

(A) V V F F.
(B) V V F V.

(A) substituio eliminao


(C) oxidao

A sequncia correta de preenchimento dos


parnteses, de cima para baixo,

(D) F F V F.
(E) F F V V.

219

UFRGS CV/2013 QUI

43. A dose adequada de paracetamol para uma


criana com febre de 12 mg kg1. Sabendo
que o paracetamol de uso peditrico tem
concentrao de 200 mg mL1 e que 20 gotas
perfazem 1 mL, quantas gotas um pediatra
receitaria para uma criana que pesa 30 kg?

46. A crise energtica mundial impulsionou a procura


por combustveis alternativos e renovveis.
Considere os dados contidos no quadro abaixo.
Combustvel
Hidrognio
Propano
Gasolina
Etanol

(A) 50 gotas.
(B) 36 gotas.
(C) 30 gotas.

Poder calorfico
(kJ/g)
140
50
45
30

Densidade (g/mL)
8,2 10 5
1,8 10 3
0,750
0,790

Com base nesses dados, correto afirmar que

(D) 20 gotas.
(E) 18 gotas.

(A) o hidrognio o combustvel mais eficaz


entre os relacionados, considerando
iguais volumes de combustvel.

44. Mesmo quando a gua destilada


extremamente pura, no se pode injet-la
diretamente no sangue de um paciente, pois
h o risco de

(B) o propano o combustvel mais eficaz


entre os relacionados, considerando
massas iguais de combustvel.

produzindo

(C) todos os combustveis do quadro acima


geram CO2 na sua combusto total.

(B) aumento da concentrao de oxignio do


sangue.

(D) por sua maior densidade, o poder


calorfico do etanol, medido em kJ por
litro, o maior entre todos.

(A) autodissociao
cido.

da

gua,

(C) aumento sbito do pH do sangue.

(E) por causa de sua baixa densidade, o


poder calorfico do hidrognio, medido em
kJ por litro, muito baixo.

(D) precipitao de sais minerais.


(E) ruptura
das
hemcias,
devido

diminuio da presso osmtica do


sangue.

47. Considere a reao abaixo.

45. O selnio um elemento que exibe alotropia,


isto , pode ser encontrado em mais de uma
forma slida diferente. A forma mais estvel
o selnio cinza, mas esse elemento tambm
pode ser encontrado como selnio e como
selnio vtreo.
Sabendo que a entalpia de formao do
selnio de 6,7 kJ mol1, e que a entalpia
de formao do xido de selnio gasoso de
53,4 kJ mol1, a entalpia da reao

Para determinar a velocidade da reao,


monitorou-se a concentrao de hidrognio
ao longo do tempo, obtendo-se os dados
contidos no quadro que segue.
Tempo
(s)
0
120

Concentrao
(mol L1)
1,00
0,40

Com base nos dados apresentados, correto


afirmar que a velocidade mdia de formao
da amnia ser

2 Se (s,) + O2 (g) 2 SeO (g)


ser

(A) 0,10 mol L 1min1.

(A) 120,2 kJ mol 1.


(B)

N2 (g) + 3 H2 (g) 2 NH3 (g)

(B) 0,20 mol L 1min1.

60,1 kJ mol 1.

(C)

46,7 kJ mol 1.

(C) 0,30 mol L 1min1.

(D)

93,4 kJ mol 1.

(D) 0,40 mol L 1min1.

(E)

106,8 kJ mol 1.

UFRGS CV/2013 QUI

(E) 0,60 mol L 1min1.

220

19

48. Apesar de o papel queimar com muita


facilidade, no se observa a queima de uma
folha de papel, sozinha, sem que se coloque
fogo.
Considere as seguintes afirmaes a respeito
da reao de combusto do papel.

50. Os
potenciais
padro
de
reduo,
determinados
mediante
processos
eletroqumicos, podem ser empregados para
prever a espontaneidade de reaes, mesmo
quando essas no constituem pilhas ou
baterias.

I - Essa reao no termodinamicamente


espontnea.
II - A energia de ativao deve ser maior que
a energia trmica disponvel para as
molculas, na temperatura ambiente.
III- A variao de entalpia negativa.

Observe o quadro a seguir.


Ag+ (aq) + e Ag (s)

(aq) + 2e Co (s)

= 0,28 V

3+

= 1,66 V

= 2,90 V

Co
Al
Ba

= 0,80 V

2+

2+

(aq) + 3e Al (s)
(aq) + 2e Ba (s)

Com base no quadro, considere as reaes


abaixo.

Quais esto corretas?


(A) Apenas I.

I - Ba(NO3)2 + 2 Ag 2 AgNO3 + Ba.

(B) Apenas II.

II - 2Al(NO3)3 + 3 Co 3 Co(NO3)2 + 2 Al.

(C) Apenas III.

III- 3AgNO3 + Al Al(NO3)3 + 3 Ag.

(D) Apenas I e III.

Quais reaes sero espontneas?

(E) Apenas II e III.

(A) Apenas I.
49. O sulfeto de cdmio, CdS, um sal pouco
solvel, e o gs sulfdrico, H2S, comporta-se,
em soluo aquosa, como um cido muito
fraco.

(B) Apenas II.

Considere as afirmaes abaixo sobre o


acrscimo de CdS gua.

(E) I, II e III.

(C) Apenas III.


(D) Apenas I e III.

I - A soluo bsica.
II - A adio de H2S aumenta a concentrao
de ons cdmio em soluo.
III- A adio de cido forte soluo provoca
a liberao de gs sulfdrico.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e III.
(E) Apenas II e III.

20

221

UFRGS CV/2013 QUI

2014
QUMICA
CLASSIFICAO PERIDICA DOS ELEMENTOS
Com massas atmicas referidas ao istopo 12 do carbono

18

1,01

13

14

15

16

17

He
4,0

10

Li

Be

Ne

6,94

9,01

10,8

12,0

14,0

16,0

19,0

20,2

11

12

13

14

15

16

17

18

Na

Mg

Si

Cl

Ar

23,0

24,3

28,1

31,0

32,1

35,5

39,9

19

20

21

22

23

24

25

26

27

28

29

30

31

32

33

34

35

36

Ca

Sc

Ti

Cr

Mn

Fe

Co

Ni

Cu

Zn

Ga

Ge

As

Se

Br

Kr

39,1

40,1

45,0

47,9

50,9

52,0

54,9

55,8

58,9

58,7

63,5

65,4

69,7

72,6

74,9

79,0

79,9

83,8

37

38

39

40

41

42

43

44

45

46

47

48

49

50

51

52

53

54

Rb

Sr

Zr

Nb

Mo

Tc

Ru

Rh

Pd

Ag

Cd

In

Sn

Sb

Te

Xe

85,5

87,6

88,9

91,2

92,9

95,9

(98)

101

102,9

106,4

107,8

112,4

114,8

118,7

121,7

127,6

126,9

131,3

55

56

57-71

72

73

74

75

76

77

78

79

80

81

82

83

84

85

86

Cs

Ba

Srie dos
Lantandios

Hf

Ta

Re

Os

Ir

Pt

Au

Hg

TI

Pb

Bi

Po

At

Rn

132,9

137,3

178,5

181

183,8

186,2

190,2

192,2

195

197

200,5

204,3

207,2

209

(209)

(210)

(222)

87

88

89-103

104

105

106

107

108

109

110

111

112

114

116

Fr

Ra

Db

Sg

Bh

Hs

Mt

Ds

Rg

Cn

Fl

Lv

(226)

Srie dos
Actindios

Rf

(223)

(261)

(262)

(266)

(264)

(270)

(268)

(281)

(272)

(285)

(289)

(293)

10

11

12 Al
27,0

Srie dos Lantandios


57

58

59

60

61

62

63

64

65

66

67

68

69

70

71

Nmero Atmico

La

Ce

Pr

Nd

Pm

Sm

Eu

Gd

Tb

Dy

Ho

Er

Tm

Yb

Lu

Smbolo

139

140

141

144,2

(145)

150,3

152

157,2

159

162,5

165

167,2

169

173

175

Massa Atmica
( ) N de massa do
istopo mais estvel

Srie dos Actindios


89

90

91

92

93

94

95

96

97

98

99

100

101

102

103

Ac

Th

Pa

Np

Pu

Am

Cm

Bk

Cf

Es

Fm

Md

No

Lr

(227)

232,0

231

238

(237)

(244)

(243)

(247)

(247)

(251)

(252)

(257)

(258)

(259)

(262)

Informaes para a resoluo de questes

1. Algumas cadeias carbnicas nas questes de qumica orgnica foram desenhadas na sua forma
simplificada apenas pelas ligaes entre seus carbonos. Alguns tomos ficam, assim,
subentendidos.

e
2. As ligaes com as representaes
indicam, respectivamente, ligaes que se
aproximam do observador e ligaes que se afastam do observador.

UFRGS CV/2014 QUI

11

222

26. Um tanque de flutuao contm uma soluo


aquosa, com elevada concentrao de sais, que
imita as condies do Mar Morto, ideais para
que uma pessoa flutue. Em um tanque desse
tipo, foi realizado um experimento para verificar
a flutuao de certos materiais, cujos dados
obtidos so apresentados no quadro abaixo.
Material
Bloco de
chumbo
Bloco de
borracha
Bloco de
ferro

Flutuao
no

Massa
m1

Volume
V1

sim

m2

V2

no

m3

V3

27. Glow sticks so tubos plsticos luminosos,


utilizados como pulseiras em festas e que
exemplificam
o
fenmeno
da
quimioluminescncia. Eles contm uma
mistura que inclui difenil-oxalato e um
corante. Dentro do tubo, encontra-se um tubo
de vidro menor que contm perxido de
hidrognio. Quando o tubo exterior
dobrado, o tubo interior quebra-se e libera o
perxido de hidrognio. Este reage com o
difenil-oxalato, formando fenol e um perxido
cclico, o qual reage com o corante e forma
dixido de carbono. No decorrer do processo,
eltrons das molculas do corante so
promovidos a estados eletrnicos excitados.

Considere as seguintes afirmaes com base


nos dados do quadro acima.

reao

(A) emisso do CO2.

I - Se m1 = m2 ento V2 > V1
II - Se V2 = V3 ento m2 > m3
III- Se m2 > m1 ento V1 = V2

(B) oxidao do perxido de hidrognio.


(C) adio desses eltrons excitados aos
tomos de oxignio do perxido.

Quais esto corretas?


(A)
(B)
(C)
(D)
(E)

A
produo
de
luz
nessa
quimioluminescente ocorre devido

(D) ao retorno dos eltrons excitados para um


nvel inferior de energia onde a estabilidade
maior.

Apenas I.
Apenas III.
Apenas I e II.
Apenas II e III.
I, II e III.

(E) liberao das molculas do corante para


o interior do tubo.

28. A usina nuclear de Fukushima continua apresentando problemas de vazamento de materiais


radioativos. Estima-se que grandes quantidades de csio e estrncio radioativo teriam chegado ao
Oceano Pacfico, atravs da gua subterrnea acumulada no subsolo da usina. Os istopos
radioativos mais significativos nesses vazamentos seriam csio-134, csio-137 e estrncio-90.
Sobre os tomos de csio e estrncio, considere as afirmaes abaixo.
I - Csio o mais eletropositivo e o de menor potencial de ionizao entre todos os elementos
qumicos, exceo do frncio que tecnicamente tem sua abundncia considerada como zero
em termos prticos.
II - O istopo radioativo estrncio-90 representa um srio risco, tendo em vista que pode substituir
com facilidade o clcio dos ossos, pois ambos formam ctions com carga 2+ e apresentam raios
inicos com valores relativamente prximos.
III- Os tomos dos istopos de csio-134, de csio-137 e de estrncio-90 emitem radiaes
altamente ionizantes devido grande eletronegatividade desses istopos.
Quais esto corretas?
(A) Apenas I.
(B) Apenas III.
(C) Apenas I e II.
(D) Apenas II e III.
(E) I, II e III.
UFRGS CV/2014 QUI

12

223

29. O governo francs estabeleceu, no sculo XVIII, um prmio para quem criasse um processo simples
de transformao de sal comum em carbonato de sdio (barrilha). Assim, Nicolas Leblanc
desenvolveu um processo que pode ser representado pela sequncia de reaes abaixo, j
balanceadas.
1 - 2 NaC(s) + H2SO4 (aq) Na2SO4 (s) + 2 HC(g)
2 - Na2SO4 (s) + 4 C (s)

X + 4 CO (g)

3 - Na2S (s) + CaCO3 (s)

Y + CaS (s)

Nessa sequncia de reaes, os produtos X e Y so, respectivamente,


(A) Na2S

Na2O.

(B) Na2S

Na2CO3.

(C) NaS2

NaCO3.

(D) Na2SO3 e

NaCO3.

(E) NaS2

Na2CO3.

30. A tabela a seguir contm alguns dados sobre as substncias cido acetilsaliclico, paracetamol e
dipirona sdica, utilizadas como frmacos analgsicos.
Substncia
Frmula
Massa Molar ( g mol

cido acetilsaliclico Paracetamol

Dipirona sdica

C9H8O4

C8H9O2N

C13H16O4N3SNa

151

333

-1

) 180

Levando em conta trs amostras que contm, cada uma, 10 g de uma dessas substncias puras,
considere as afirmaes, abaixo, sobre elas.
I - A amostra de paracetamol apresentar o maior nmero de mols de substncia.
II - A amostra de dipirona apresentar a maior massa de oxignio.
III- As amostras de cido acetilsaliclico e de dipirona apresentaro o mesmo nmero de mols de
tomos de oxignio.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.

UFRGS CV/2014 QUI

13

224

31. Cinco substncias foram analisadas, e os resultados so mostrados no quadro abaixo.


Assinale a alternativa que apresenta uma correta correspondncia entre a substncia analisada e as
propriedades determinadas.
Substncia
(A)

hexano

Solubilidade
em H2O
solvel

(B)

nitrato de potssio

insolvel

insolvel

(C)

alumnio metlico

insolvel

solvel

(D)

etanol

solvel

insolvel

(E)

tetracloreto de
carbono

insolvel

solvel

32. O dixido de enxofre lanado na atmosfera


pode provocar srios prejuzos ambientais.
Para minimizar esses efeitos, pode-se realizar
o tratamento das emisses de chamins que
liberam SO2 com uma pasta mida de
calcrio, em presena de um oxidante.
Essa pasta de calcrio, em contato com o
SO2, produz a reao abaixo j ajustada.
SO2(g) + 1/2 O2(g)
CaSO4(s) + CO2 (g)

CaCO3(s)

Solubilidade
em gasolina
insolvel

Condutividade eltrica

alta quando dissolvida em


gua
alta

baixa

alta quando dissolvida em


gua
no conduz

33. A pirita, de frmula FeS2, foi uma das primeiras


estruturas cristalinas resolvidas por mtodos de
difrao de raios X, e os cristais cbicos simples
mostram claramente a ligao enxofre-enxofre
[S-S], com carga total 2-, dentro das unidades.
Assim, FeS2 poderia ser chamado de persulfeto
de ferro, ao invs de dissulfeto de ferro como
usualmente denominado.

Considere que a chamin de uma


determinada indstria emite 160 kg de SO2 ao
dia. Qual a massa diria de carbonato de
clcio necessria para consumir essa
quantidade de SO2?
(A) 40 kg.
(B) 50 kg.

O nome persulfeto de ferro seria adequado, pois


(A) o estado de oxidao do enxofre nesse
composto -1, semelhante ao oxignio
nos perxidos.
(B) o estado de oxidao do ferro nesse
composto +4, e o estado mais
oxidado possvel do ferro.
(C) o estado de oxidao do ferro nesse
composto +1, e este o estado menos
oxidado do ferro.
(D) o enxofre nesse composto tem estado de
oxidao -.4, semelhante ao enxofre no
cido persulfrico que fortemente
oxidante.

(C) 100 kg.


(D) 150 kg.
(E) 250 kg.

(E) esse composto tem estado total de oxidao


diferente de zero, podendo ser considerado
como um on positivo complexo.

UFRGS CV/2014 QUI

14

225

34. Solues formadas por constituintes lquidos


costumam ter sua concentrao expressa em
porcentagem de volume. Em solues
alcolicas, essa porcentagem indicada em
GL (graus Gay-Lussac). No rtulo de um
vinho produzido na serra gacha, l-se que o
teor de lcool (etanol) de 13 GL.
Isso significa que,
(A) em 130 mL desse vinho, existem 100 mL
de etanol.

36. Em 2013, cientistas conseguiram pela


primeira vez fotografar uma reao de
rearranjo de uma molcula orgnica em
resoluo atmica (3 = 3 x 10-10 m), usando
microscopia de fora atmica. A imagem
obtida mostrada abaixo. A representao
das estruturas do reagente e do produto,
como se costuma encontrar em livros de
qumica, tambm est mostrada abaixo, e a
semelhana entre ambas marcante.

(B) em 870 mL desse vinho, existem 100 mL


de etanol.
(C) em 870 mL desse vinho, existem 130 mL
de etanol.
(D) em 1000 mL desse vinho, existem 130 mL
de etanol.
(E) em 1000mL desse vinho, existem 870 mL
de etanol.
35. Os xampus tm usualmente, como base de
sua formulao, um tensoativo aninico,
como
o
laurilsulfato
de
sdio
[CH3(CH2)11OSO2O-Na+]. Cloreto de sdio
adicionado na faixa de 0,2 a 0,6% para
aumentar a viscosidade dos xampus. Nos
ltimos anos, tm aparecido no mercado
muitos xampus com a denominao sem sal*.
O asterisco indica que no foi adicionado
cloreto de sdio. Nesses casos, normalmente
pode ser usado o cloreto de potssio como
agente espessante.
Considere as afirmaes abaixo, sobre a
situao descrita.
I - Se um xampu contm laurilsulfato de
sdio, ento necessariamente ele contm
um sal na sua composio.
II - Se um xampu contm laurilsulfato de sdio
e cloreto de potssio na sua formulao,
ento, apesar de no ter sido adicionado
cloreto de sdio, o produto final contm
nions cloreto e ctions sdio.
III- A semelhana entre o laurilsulfato de
sdio e o cloreto de sdio que ambos
apresentam o mesmo nion.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Disponvel em: <http://www.cchem.berkeley.edu/


frfgrp/index.html>. Acesso em: 3 set. 2013.

Reagente (C26H14)

Produto (C26H14)

Considere as seguintes afirmaes a respeito


desses compostos.
I - Ambos so hidrocarbonetos aromticos.
II - Ambos tm na sua estrutura a presena
de carbonos com geometria trigonal
plana.
III- Reagentes e produtos so compostos
ismeros.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e II.

Apenas I.
Apenas II.
Apenas III.
Apenas I e II.
I, II e III.

(E) I, II e III.

UFRGS CV/2014 QUI

15

226

37. A levedura Saccharomyces cerevisiae responsvel por transformar o caldo de cana em etanol.
Modificaes genticas permitem que esse micro-organismo secrete uma substncia chamada
farneseno, em vez de etanol. O processo produz, ento, um combustvel derivado da cana-deacar, com todas as propriedades essenciais do diesel de petrleo, com as vantagens de ser
renovvel e no conter enxofre.

farneseno
Considere as seguintes afirmaes a respeito do farneseno.
I - A frmula molecular do farneseno C16H24.
II - O farneseno um hidrocarboneto acclico insaturado.
III- O farneseno apresenta apenas um nico carbono secundrio.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e II.
(E) I, II e III.
38. Recentemente, cientistas sintetizaram um hbrido curcumin-talidomida. A estrutura desse hbrido
est mostrada abaixo, em que a parte esquerda da ligao em negrito vem do curcumin, e a parte
direita vem da talidomida. Essa combinao permitiu obter um composto muito mais eficaz contra
clulas cancerosas que o curcumin ou a talidomida sozinhos, ou que uma mistura dos dois.

hbrido curcumin-talidomida
As funes orgnicas presentes na estrutura desse hbrido so
(A) hidroxila fenlica, ter e cetona.
(B) amina, ster e hidroxila fenlica.
(C) amida, ster e cetona.
(D) amida, hidroxila fenlica e ster.
(E) cido carboxlico, amina e cetona.

UFRGS CV/2014 QUI

16

227

39. Em um cenrio de fico cientfica, um cientista chamado Dr S. Cooper constri uma mquina de
teletransporte, na qual todas as ligaes qumicas dos compostos presentes na cabine A so
quebradas, e os tomos so transportados para a cabine B, na qual as ligaes so refeitas. Para o
teste de teletransporte, foi escolhido o composto usque lactona (I), presente no carvalho e um dos
responsveis pelo sabor do usque.
A figura abaixo mostra um teste hipottico, em que, colocando o composto I na cabine A, aps o
teletransporte, foi observado o composto II na cabine B.

Assinale a alternativa correta sobre esse experimento.


(A) O experimento foi um sucesso, pois o composto II exatamente a mesma molcula que o composto I.
(B) O experimento foi um sucesso, pois, embora os compostos I e II sejam enantimeros, eles
apresentam propriedades fsicas e qumicas iguais.
(C) O experimento no foi um sucesso total, pois os compostos I e II tm propriedades diferentes,
sendo ismeros de funo.
(D) O experimento no foi um sucesso total, pois os compostos I e II tm propriedades diferentes,
sendo ismeros geomtricos (trans e cis).
(E) O experimento no foi um sucesso total, pois os compostos I e II tm propriedades diferentes,
sendo ismeros de posio.
40. Observe a reao abaixo que ilustra a sntese do paracetamol.

p-aminofenol
M = 109 g mol -1

anidrido actico
M = 102 g mol -1

paracetamol
M = 151 g mol -1

cido actico
M = 60 g mol -1

Foi realizada uma sntese de paracetamol usando 218 g de p-aminofenol e 102 g de anidrido
actico. Considerando que, para cada comprimido, so necessrios 500 mg de paracetamol, qual a
quantidade mxima de comprimidos que pode ser obtida?
(A) 204.
(B) 218.
(C) 302.
(D) 422.
(E) 640.
UFRGS CV/2014 QUI

17

228

41. O cido lactobinico usado na conservao de


rgos de doadores. A sua sntese feita a
partir da lactose, na qual um grupo aldedo
convertido em grupo cido carboxlico.
A reao em que um cido carboxlico formado
a partir de um aldedo uma reao de
(A)
(B)
(C)
(D)
(E)

44. Um sistema constitudo de gelo e gua, em


repouso a 0 C, aquecido gradualmente at
que se obtenha apenas gua lquida, na
temperatura ambiente. Qual dos grficos a
seguir melhor representa a curva da
temperatura em funo do tempo?

desidratao.
hidrogenao.
oxidao.
descarboxilao.
substituio.

42. Um estudante analisou trs solues aquosas de


cloreto de sdio, adicionando 0,5 g deste
mesmo sal em cada uma delas. Aps deixar as
solues em repouso em recipientes fechados,
ele observou a eventual presena de precipitado
e filtrou as solues, obtendo as massas de
precipitado mostradas no quadro abaixo.
Soluo

Precipitado

Nenhum

0,5 g

0,8 g

O estudante concluiu que as solues


originais 1, 2 e 3 eram, respectivamente,
(A)
(B)
(C)
(D)
(E)

no saturada, no saturada e saturada.


no saturada, saturada e supersaturada.
saturada, no saturada e saturada.
saturada, saturada e supersaturada.
supersaturada, supersaturada e saturada.

43. Assinale
a
alternativa
que
preenche
corretamente as lacunas do enunciado abaixo,
na ordem em que aparecem.
Uma soluo injetvel foi preparada de modo
inadequado, pois, ao entrar na corrente
sangunea, promoveu o inchamento e a
ruptura dos glbulos vermelhos. A soluo
portanto ........ em relao ao soro sanguneo,
e a concentrao de soluto ........ quela
que deveria ter sido preparada.
(A) hipotnica

superior

(B) hipotnica

inferior

(C) isotnica

superior

(D) hipertnica

superior

(E) hipertnica

inferior
UFRGS CV/2014 QUI

18

229

45. O tempo de meia-vida definido como o


tempo necessrio para que a concentrao
inicial de reagente seja reduzida metade.
Uma reao qumica do tipo A
B tem a
concentrao do reagente A e a velocidade
instantnea de decomposio monitoradas ao
longo do tempo, resultando na tabela abaixo.
1

47. Abaixo esto mostradas duas reaes em fase


gasosa, com suas respectivas constantes de
equilbrio.

[A] (mol L )

v (mol L min )

1,20

0,0832

0,85

0,0590

10

0,60

0,0416

15

0,42

0,0294

20

0,30

0,0208

CO2 (g) + H2 (g) K = 0,23

CH4 (g) + H2O (g)

CO (g) + 3 H2 (g) K = 0,20

Pode-se concluir que, nessas mesmas


condies, a constante de equilbrio para a
reao

t (min)

CO (g) + H2O (g)

CH4 (g) + 2H2O (g)

CO2 (g) + 4 H2 (g)

de
(A) 0,030.

A ordem dessa reao e o tempo de meiavida do reagente A so, respectivamente,

(B) 0,046.

(A) ordem zero, 5 minutos.

(D) 0,430.

(C) 0,230.

(B) primeira ordem, 5 minutos.

(E) 1,150.

(C) primeira ordem, 10 minutos.


(D) segunda ordem, 5 minutos.

48. Uma soluo diluda de HC, utilizada para


limpeza, apresenta pH igual a 3,0.

(E) segunda ordem, 10 minutos.


46. A reao global de oxidao do SO2
representada por
SO2 (g) + O2

SO3 (g).

(A) 11,0

Na presena de NO2, essa reao


processada em duas etapas que ocorrem no
mesmo recipiente, conforme representado
abaixo.
NO2 (g) + SO2 (g)
NO (g) + O2 (g)

Quais so as concentraes de OH e C, em
mol L1, respectivamente, nessa soluo?
7

e 3,0

10

(B) 1,0

10

e 1,0

10

(C) 1,0

10

11

e 1,0

10

e 1,0

10

e 3,0

10

(D) 11,0
(E) 1,0

SO3 (g) + NO (g)

10

10
10

12

NO2 (g)

Assinale
a
alternativa
que
preenche
corretamente as lacunas do enunciado abaixo,
na ordem em que aparecem.
Em relao reao global, o NO 2 um ........
e sua concentrao ........ com o tempo.
(A) reagente

diminui

(B) reagente

no se altera

(C) catalisador diminui


(D) catalisador no se altera
(E) produto

aumenta

UFRGS CV/2014 QUI

19

230

49. Clulas eletroqumicas podem ser construdas


com uma ampla gama de materiais, at
mesmo metais nobres como prata e ouro.
Observe, abaixo, as semirreaes de reduo.
Ag+ (aq) + e
3+

Au

(aq) + 3e

Ag (s)

Au (s)

= 0,80 V

50. Para a anlise da qualidade do leite so


monitorados
vrios
parmetros
fsicoqumicos. As avaliaes de propriedades
como, por exemplo, densidade, crioscopia e
teor de protena, o qual calculado pelo teor
mdio de nitrognio, so utilizadas para
detectar possveis adulteraes.

= 1,50 V

Assinale com V (verdadeiro) ou F (falso) as


seguintes afirmaes a respeito de uma
clula eletroqumica, constituda de ouro e
prata.
( ) Um dos eletrodos poderia ser construdo
com ouro em gua pura; e o outro, prata
em gua pura.
( ) Uma pilha construda com placas
metlicas de ouro e prata, em contato
com os respectivos sais, teria fora
eletromotriz padro de 0,70 V.
( ) Essa clula eletroqumica produz aumento
da massa do ouro metlico.
A sequncia correta de preenchimento dos
parnteses, de cima para baixo,

F.

(C) V F

V.

I - A adio de gua ao leite facilmente


detectvel, pois diminui a densidade e
aumenta a temperatura de congelamento.
II - A adio de ureia pode compensar a
diminuio de densidade e a diminuio
de teor mdio de nitrognio, causadas
pela adio de gua.
III- A adio de sacarose pode compensar a
diminuio de densidade e a diminuio
de teor mdio de nitrognio, causadas
pela adio de gua, sem o efeito txico
apresentado pela ureia.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.

(A) V V V.
(B) V F

Considere as afirmaes abaixo, sobre os


possveis mtodos de adulterao do leite.

(C) Apenas III.


(D) Apenas I e II.
(E) I, II e III.

(D) F V V.
(E) F V F.

UFRGS CV/2014 QUI

20

231

2011
GEOGRAFIA
51. Leia o enunciado abaixo.
Bolvar Cambar viajar, na prxima semana,
de nibus de Porto Alegre a So Paulo pela
BR 101. Ao comprar sua passagem, conseguiu
com a vendedora um assento junto janela
do nibus para receber diretamente os raios
solares no turno da manh.

53. Um professor solicita aos alunos uma cpia


reduzida
de
um
mapa
atravs
de
fotocopiadora. No mapa original, a distncia
entre A e B, que de um centmetro,
representa 500 metros na realidade.
A respeito desta
alternativa correta.

situao,

assinale

as

(A) A distncia entre A e B, na cpia


reduzida, continua a representar 500
metros.

I -A
viagem
de
Bolvar
Cambar
representar um deslocamento no pas no
sentido sul-norte.

(B) A escala do mapa original 1:50.000, e a


da cpia reduzida 1:25.000.

Com base nesses dados,


seguintes afirmaes.

considere

(C) A distncia entre A e B, na cpia reduzida,


passa a representar 1.000 metros.

II - Bolvar Cambar ocupar um assento no


lado direito do nibus.

(D) A escala do mapa original 1:5.000, e a


da cpia reduzida 1:10.000.

III- O assento de Bolvar Cambar ficar junto


a uma janela voltada para o leste.

(E) A distncia entre A e B, na cpia


reduzida, representa 50 metros.

Quais esto corretas?


(A) Apenas I.

54. A coluna da esquerda, abaixo, apresenta o nome


de duas das principais projees cartogrficas; a
da direita, caractersticas relacionadas a uma ou
a outra dessas projees.

(B) Apenas II.


(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.

Associe adequadamente a coluna da direita


da esquerda.

52. Observe o quadro abaixo, que apresenta as


coordenadas geogrficas de cinco cidades do
mundo.
Cidade
1
2
3
4
5

Latitude
43 N
38 N
36 S
15 N
10 N

Longitude
1 E
9 W
174 E
157 W
66 W

1 - projeo de ( ) mantm as formas dos


continentes
Mercator
2 - projeo de
Peters

Com base nos dados do quadro, correto


afirmar que

( ) as regies polares aparecem muito exageradas


( ) d destaque ao mundo
subdesenvolvido
( ) excelente para a
navegao

(A) a cidade 1 se localiza no hemisfrio


ocidental.

A sequncia correta de preenchimento dos


parnteses, de cima para baixo,

(B) a cidade 2 se situa na zona tropical do


hemisfrio norte.

(A) 1 1 1 2.

(C) o ponto antpoda da cidade 3 36 N e


174 W.

(B) 1 1 2 1.

(D) a cidade 4 se encontra na China.

(D) 2 2 1 1.

(E) a cidade 5 tem temperatura mdia anual


de aproximadamente 23 C.

(E) 2 2 1 2.

18

(C) 2 1 2 1.

UFRGS CV/2011 GEO

232

55. Observe a figura abaixo, que representa a disposio das placas litosfricas.

2
C
1
D
C
3

E
E

BAUD, P.; BOURGEAT, S.; BRAS, C. Dicionrio de Geografia. Lisboa (Portugal): 1999. p. 402.

Assinale a alternativa correta a respeito desta figura.


(A) A letra C indica o limite entre placas litosfricas convergentes.
(B) O nmero 3 indica a placa litosfrica denominada Nazca.
(C) O nmero 1 indica a placa litosfrica denominada Pacfica.
(D) O nmero 2 indica a placa litosfrica denominada Americana.
(E) A letra D indica o limite entre placas litosfricas divergentes.
56. A figura abaixo representa uma bacia hidrogrfica e sua rede de drenagem.
A

Oceano

Os elementos destacados com as letras A, B e C indicam, respectivamente,


(A) afluente, foz e efluente.
(B) nascente, exutrio e divisor de guas.
(C) nascente, afluente e divisor de guas.
(D) divisor de guas, exutrio e afluente.
(E) efluente, divisor de guas e foz.
UFRGS CV/2011 GEO

19

233

57. As figuras abaixo representam uma comparao entre um riacho natural e outro canalizado.

Riacho natural

Riacho canalizado

Adaptado de: KELLER, E. A.; BLODGETT, R. H. Riesgos naturales . Madrid (Espaa):


Pearson Educacin, 2007. p. 137.

Considere as seguintes afirmaes, sobre os efeitos da canalizao na dinmica de um curso dgua.


I - A retirada da cobertura vegetal ocasiona o desaparecimento da sombra, causando danos flora
e aos organismos aquticos sensveis ao calor.
II - A eliminao dos meandros fluviais e da cobertura vegetal aumenta a velocidade das guas do riacho.
III- A canalizao consiste em retilinizar, aprofundar e revestir leitos fluviais, com o objetivo de aumentar
a capacidade de infiltrao dos solos e, assim, diminuir o extravasamento do leito fluvial.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e II.
(E) I, II e III.
58. Assinale com V (verdadeiro) ou F (falso) as afirmaes abaixo, referentes constituio e
formao dos solos.
( ) O horizonte A de um perfil de solo a camada mineral mais prxima superfcie e caracterizase pela concentrao de matria orgnica.
( ) Os solos das regies ridas e semiridas, quando comparados aos solos das regies midas,
comumente apresentam grandes quantidades de argila e de matria orgnica.
( ) Nas reas de declividade acentuada, os solos so mais rasos porque a alta velocidade de
escoamento das guas diminui a infiltrao e, consequentemente, o intemperismo.
( ) A acidificao dos solos um processo que ocorre naturalmente na biosfera, porm os solos das
regies tropicais so submetidos o ano inteiro a altas temperaturas e ao intensa das chuvas,
favorecendo a formao de solos mais cidos.
A sequncia correta de preenchimento dos parnteses, de cima para baixo,
(A) F V F V.
(B) V F V V.
(C) F F V V.
(D) F V V F.
(E) V F F F.
20

UFRGS CV/2011 GEO

234

59. Considere o enunciado abaixo e as trs


propostas para complet-lo.
O fenmeno ocenico-atmosfrico La Nia
caracteriza-se por um resfriamento anormal
nas guas superficiais do oceano Pacfico
Equatorial nos setores central e oriental.

61. Assinale
a
alternativa
que
preenche
corretamente as lacunas do texto abaixo, na
ordem em que aparecem.

Entre os efeitos desse fenmeno, pode-se


citar corretamente
1 - a tendncia de chuvas abundantes no
norte e no leste da Amaznia.
2 - o aumento da precipitao e da vazo dos
rios no Uruguai.
3 - a existncia de chuvas abaixo da normal
climatolgica no Rio Grande do Sul.

O chaparral, ou vegetao mediterrnea,


um bioma marcado por veres secos e
quentes. A paisagem formada basicamente
por maquis e garrigues, espcies arbustivas
de folhas duras e grossas, sempre verdes,
adaptadas longa estiagem. Tipicamente
europeia, essa paisagem vegetal aparece
tambm nas extremidades setentrional e
meridional da frica e em reas costeiras da
Austrlia meridional, do ........ e ........ .
(A) sul da Argentina de Madagascar
(B) sul da Argentina da Nova Zelndia

Quais propostas esto corretas?


(A) Apenas 1.

(C) sul da Argentina do sudeste dos


Estados Unidos

(B) Apenas 2.

(D) Chile do sudoeste dos Estados Unidos

(C) Apenas 3.

(E) Chile do Peru

(D) Apenas 1 e 3.
(E) Apenas 2 e 3.
60. Considere as afirmaes abaixo, sobre grandes
paisagens naturais do globo.
I - Os desertos, como o Saara, o Gobi e o
Kalahari, caracterizam-se pelos contrastes
trmicos entre o dia, extremamente quente,
e a noite, bastante fria.
II - Os Alpes, na Europa, os Andes, no
continente americano, o Atlas, na frica,
so cadeias montanhosas formadas por
dobramentos antigos de idade prcambriana.
III- As amplitudes trmicas dos climas tropical e
equatorial, tanto dirias quanto anuais, so
baixas; consequentemente, a variao da
temperatura geralmente pequena.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.
UFRGS CV/2011 GEO

21

235

62. Observe a figura abaixo.


NORUEGA

ISLNDIA

COREIA
DO SUL

CANAD

REINO
UNIDO

DINAMARCA
RSSIA
CHINA

ALEMANHA
BLGICA
ESTADOS UNIDOS

TURQUIA
SUA
ISRAEL

FRANA
ITLIA
ESPANHA
MARROCOS
MXICO

JAPO

EGITO

NDIA

FILIPINAS

ARBIA
CINGAPURA
SAUDITA
INDONSIA
AUSTRLIA

PORTO RICO
VENEZUELA

CHILE

PERU

FRICA
DO SUL

BRASIL
ARGENTINA

SIMIELLI, M. E. Geoatlas. 33. ed. So Paulo: tica, 2010. p. 31.

A anamorfose geogrfica um recurso cartogrfico que representa as superfcies dos pases em


reas proporcionais a uma determinada quantidade.
A anamorfose acima representa
(A) o Produto Nacional Bruto (PNB).
(B) a populao mundial.
(C) as reservas de petrleo.
(D) a produo de energia hidroeltrica.
(E) o ndice de Desenvolvimento Humano (IDH).

22

UFRGS CV/2011 GEO

236

63. Observe a figura abaixo, que apresenta informaes sobre o petrleo mundial.

EQUADOR

VISENTINI, J. W. Geografia: Geografia Geral e do Brasil. So Paulo: tica, 2005. p. 129.

Em relao figura, considere as afirmaes que seguem.


I - Entre as reas favorveis, destacam-se as exploraes petrolferas localizadas em territrio
russo e no Oriente Mdio.
II - O local do vazamento de petrleo ocorrido nos Estados Unidos em abril de 2010 no
corresponde a uma regio de alta produtividade de petrleo.
III- As regies de alta produtividade correspondem s reas de maior nmero de campos
petrolferos.

Quais esto corretas?


(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas II e III.
(E) I, II e III.

UFRGS CV/2011 GEO

23

237

64. Observe o mapa do continente africano


abaixo.
0

Trpico de Cncer

65. O relatrio da Organizao para Cooperao e


Desenvolvimento
Econmico
(OCDE),
2009,
denominado
publicado
em
Perspectivas Econmicas da Amrica Latina
2010, informa que mais de 20 milhes de
latino-americanos e caribenhos residem fora
de seu pas de nascimento, encontrando-se
cerca de 75% deles nos Estados Unidos.
Em relao a essa temtica, considere os
enunciados abaixo.

Equador

1 A imigrao de haitianos historicamente


significativa no pas. Os trabalhadores haitianos
foram inicialmente atrados pela escassez de mo
de obra e pelos salrios relativamente elevados
nas plantaes de cana-de-acar.

2 O pas registrou fluxos de emigrao em


grande escala nas ltimas dcadas e,
atualmente, cerca de 4,7% dos nacionais desse
pas vivem no exterior. Venezuela e Estados
Unidos so os principais pases de destino,
seguidos por Espanha, Equador e Panam.

2000 km

Em relao rea sombreada do mapa, so


feitas as seguintes afirmaes.

Os pases a que se referem os enunciados 1 e


2 so, respectivamente,

I - Nela, encontra-se a Nigria, pas com


grandes reservas de ouro e diamante,
cobiadas por grupos rebeldes que
reivindicam melhor distribuio das
receitas advindas da explorao das
minas.
II - Em parte do litoral, localiza-se a Somlia,
que enfrenta um caos poltico e
institucional, devido aos ataques de
piratas e embarcaes que navegam nas
guas prximas costa.

(A) Mxico e Peru.


(B)
(C)
(D)
(E)

Jamaica e Bolvia.
Repblica Dominicana e Colmbia.
Cuba e Costa Rica.
Belize e Suriname.

66. A final da Copa do Mundo FIFA de 2010 deu-se


entre dois pases europeus: Espanha e Pases
Baixos (tambm conhecido como Holanda).

III- Na rea, atuam foras militares da


Organizao das Naes Unidas (ONU) e
da Unio Africana (UA), que tentam
prevenir os ataques e as ameaas contra
civis na regio do Darfur, no oeste do
Sudo, palco de conflito entre rabes e
no-rabes.
Quais esto corretas?

Com relao a cada um desses pases,


considere as afirmaes abaixo.
1 - integrante da Unio Europeia.
2 - Adota como moeda nica o euro.
3 - O regime poltico adotado o de
Repblica Parlamentarista.
4 - A maior parte de seu PIB de origem
agropecuria e industrial.
So vlidas para ambos os pases somente as
afirmaes

(A) Apenas I.

(A) 1 e 2.

(B) Apenas II.

(B) 1 e 3.

(C) Apenas III.

(C) 2 e 3.

(D) Apenas II e III.

(D) 2 e 4.

(E) I, II e III.

(E) 3 e 4.

24

UFRGS CV/2011 GEO

238

67. Assinale com V (verdadeiro) ou com F (falso) as afirmaes abaixo, referentes s formas do relevo
brasileiro.
( ) Chapadas so superfcies com no mximo 100 metros de altitude, formadas por morros ou
cadeias de morros com topos em crista, caractersticas das regies Sudeste e Sul do Brasil.
( ) Planaltos so superfcies planas com altitudes acima de 1.000 metros, formados pela acumulao
recente de material de origem marinha e fluvial, ocupando quase um tero do territrio brasileiro.
( ) Depresses so superfcies com 100 a 500 metros de altitude, situadas abaixo do nvel altimtrico das
regies adjacentes, como as colinas e morros da Depresso Central do Rio Grande do Sul.
( ) Tabuleiros so superfcies com 20 a 50 metros de altitude, em contato com o oceano, geralmente com
topo plano e limite abrupto em direo ao mar, tpicos da regio costeira do Nordeste brasileiro.
A sequncia correta de preenchimento dos parnteses, de cima para baixo,
(A) F V F V.
(B) V F F V.
(C) F F V V.
(D) F V V F.
(E) V V F F.
68. Assinale com V (verdadeiro) ou F (falso) as
afirmaes abaixo, referentes ao litoral
brasileiro.
( ) Os manguezais brasileiros tm ampla
distribuio longitudinal, e cerca de 85%
deles concentram-se no litoral dos estados
de So Paulo, Paran e Santa Catarina.
( ) A Ilha da Trindade e o Arquiplago de
Martin Vaz so pontos emersos de uma
cadeia de vulces submarinos extintos,
situados defronte costa do estado do
Esprito Santo.

69. Em 2010, o Instituto de Pesquisa Econmica


Aplicada (IPEA) publicou comunicado sobre
estudo que analisa a situao da pobreza
brasileira entre 1995 e 2008. As linhas de
pobreza absoluta e de pobreza extrema,
utilizadas no estudo, foram estabelecidas pelo
critrio de rendimento mdio domiciliar per
capita, respectivamente, de at meio salrio
mnimo mensal e de at um quarto de salrio
mnimo mensal.

( ) Na poro oeste do oceano Atlntico, na


costa nordeste do Brasil, a Corrente
Equatorial Sul interceptada pelo continente
sul-americano, desviando-se para sul e para
norte, formando as correntes do Brasil e das
Guianas, respectivamente.
( ) O nico fenmeno da ressurgncia
costeira bem conhecido no Brasil o da
regio de Salvador, na Bahia, o que
contribui para tornar a regio uma das
mais produtivas de pescado no pas.
A sequncia correta de preenchimento dos
parnteses, de cima para baixo,
(A)
(B)
(C)
(D)
(E)

Em relao a essa temtica, correto afirmar


que
(A) a diminuio das taxas de pobreza
absoluta e extrema entre os estados
brasileiros ocorreu de maneira simtrica e
uniforme.
(B) os estados que apresentaram maior
diminuio das taxas de pobreza
absoluta, no perodo de 1995 a 2008,
foram Santa Catarina e Paran.
(C) as taxas de pobreza tanto absoluta
quanto extrema caram em todas as
grandes regies brasileiras, exceto no
Nordeste, onde ocorreu aumento da
pobreza absoluta e extrema.
(D) o forte crescimento econmico verificado
no perodo de 1995 a 2008 no pas foi
suficiente para elevar o padro de vida de
todos os brasileiros.

V V F F.
F V V F.
V F F V.
F V F V.
F F V V.

(E) Pernambuco, Cear e Bahia foram os


estados que, em 2008, apresentaram a
maior desigualdade de renda no pas.

UFRGS CV/2011 GEO

25

239

70. Recente pesquisa, divulgada em 2010 pelo


IBGE, retratou a situao atual do
saneamento bsico brasileiro, a partir de
dados de 2000-2008.

72. O mapa abaixo apresenta algumas das bacias


hidrogrficas do estado do Rio Grande do Sul.

Em relao a esse tema, correto afirmar que


(A) aumentou o percentual de municpios
brasileiros que destinam seus resduos
slidos a vazadouros a cu aberto (lixes).
(B) apenas um tero dos domiclios brasileiros
so abastecidos de gua por rede geral.
(C) Par e Amazonas esto entre os estados
brasileiros com o maior percentual de
municpios que distribuem gua sem
nenhum tipo de tratamento.
(D) a quase totalidade dos municpios da Regio
Sul tem rede coletora de esgoto.
(E) dois teros dos municpios brasileiros com
rede de esgotamento geral fazem o
tratamento de seus esgotos.
71. Com relao ao recente processo de urbanizao
brasileiro, correto afirmar que

30 S
3

55 W

180 km

Em relao a essas bacias hidrogrficas, so


feitas as seguintes afirmaes.
I - O rio Santa Maria o principal curso
fluvial da bacia identificada pelo nmero
1, que se caracteriza pela expanso da
atividade
mineradora,
graas

abundncia de carvo naquela rea.

(A) o
fenmeno
urbano,
no
Brasil,
caracteriza-se
pelo
crescimento
homogneo das aglomeraes urbanas,
sobretudo pelo aumento da produo
industrial.

II - A bacia identificada pelo nmero 2


corresponde dos rios Vacaca-VacacaMirim, cujo rio principal desemboca no rio
Jacu e, portanto, faz parte da Regio
Hidrogrfica do Guaba.

(B) o maior controle por parte do Estado


brasileiro contribui para a diminuio do
crescimento
das
grandes
cidades
brasileiras.

III- A bacia identificada pelo nmero 3 integra


a
Regio
Hidrogrfica
Litornea,
abrangendo rea de municpios como
Bag, Caapava do Sul e Tapes.

(C) o aumento da participao das cidades


mdias, na economia nacional, favorece a
desconcentrao da riqueza dos grandes
centros urbanos do Brasil.

Quais esto corretas?

(D) a acelerao do movimento migratrio


para as grandes metrpoles nacionais
impulsionada pelo crescimento industrial
e pelas melhorias na qualidade de vida.
(E) o aumento de organizaes criminosas
com poder paralelo ao Estado dificulta o
crescimento das mdias cidades e a
implementao de polticas habitacionais.

26

(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e II.
(E) Apenas II e III.

UFRGS CV/2011 GEO

240

73. Considere as seguintes afirmaes, sobre os problemas ambientais no Rio Grande do Sul.
I - Entre os assentamentos humanos mais atingidos por inundaes, nesta ltima dcada, esto os que se
localizam s margens dos rios dos Sinos, Gravata e Ca, que fazem parte da bacia hidrogrfica do
Guaba.
II - A partir de 1950, difundiram-se, no estado, monoculturas agrcolas em grandes extenses com o uso
de mecanizao, resultando no surgimento de processos erosivos e perdas de solos, principalmente
nas regies do alto Uruguai e do alto Jacu.
III- Nos meses de vero, frequentemente, constata-se a elevao dos ndices de coliformes fecais
nas praias, rios e lagoas de alguns municpios da plancie costeira, devido ocupao mais
intensa e falta de infraestrutura em saneamento bsico.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.

74. Observe as pirmides populacionais abaixo, referentes populao do Rio Grande do Sul.
populao RS 2000
70 E MAIS
65 70
60 65
55 60
50 55
45 50
40 45
35 40
30 35
25 30
20 25
15 20
10 15
5 10
05

populao RS 2010 - projeo


70 E MAIS
65 70
60 65
55 60
50 55
45 50
40 45
35 40
30 35
25 30
20 25
15 20
10 15
5 10
05

500 400 300 200 100

0 100 200 300 400 500

Sexo feminino

Sexo masculino

populao RS 2020 - projeo


70 E MAIS
65 70
60 65
55 60
50 55
45 50
40 45
35 40
30 35
25 30
20 25
15 20
10 15
5 10
05

500 400 300 200 100

0 100 200 300 400 500

Sexo feminino

Sexo masculino

500 400 300 200 100


Sexo feminino

0 100 200 300 400 500


Sexo masculino

Adaptado de: <http://www.seplag.rs.gov.br/atlas/atlas.asp?menu=304>. Acesso em: 2 nov. 2010.

Com base na leitura destas pirmides populacionais, considere as seguintes afirmaes, referentes
ao intervalo de 2000 a 2020.
I - A populao maior de 60 anos diminui.
II - A populao total aumenta.
III- A expectativa de vida aumenta.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e II.
(E) Apenas II e III.
UFRGS CV/2011 GEO

27

241

75. A tabela abaixo fornece dados de alguns dos


municpios gachos que, em 2008, tinham
mais de 100 mil habitantes.
Municpio

rea
(km2)

Populao
(hab.)

PIB per

capita

1.643,9

402.163

em R$
(2007)
24.589

5.715,8

125.695

17.050

70,8

208.812

4.551

1.608,8

343.925

9.349
Fonte: FEE-RS

Assinale a alternativa que apresenta os nomes


dos municpios gachos correspondentes aos
nmeros 1, 2, 3 e 4, respectivamente.
(A) Uruguaiana Alvorada Pelotas Caxias
do Sul
(B) Caxias do Sul Uruguaiana Alvorada
Pelotas
(C) Caxias do Sul Uruguaiana Pelotas
Alvorada
(D) Pelotas Alvorada Uruguaiana Caxias
do Sul
(E) Pelotas Uruguaiana Alvorada Caxias
do Sul

28

UFRGS CV/2011 GEO

242

2012
GEOGRAFIA

51. Observe o mapa abaixo.

Equador

LOWE, Norman. Histria do mundo contemporneo. Porto Alegre: Penso, 2011. p. 605.

Este mapa representa a diviso entre


(A)
(B)
(C)
(D)
(E)

pases
pases
pases
pases
pases

industrializados e os de Terceiro Mundo.


de economia monoprodutora e os de economia diversificada.
de clima quente e os de clima frio.
colonizadores e suas respectivas colnias no sculo XVI.
signatrios do Protocolo de Kioto e os no signatrios.

52. Assinale com V (verdadeiro) ou F (falso) as seguintes afirmaes sobre questes econmicas da
atualidade.
( ) A recente ascenso de pases da sia e da Amrica Latina, tem provocado uma nova
organizao nas foras polticas e econmicas do sistema financeiro internacional.
( ) A industrializao acelerada na Amrica do Norte, nos pases europeus e pases asiticos tem
acarretado problemas ambientais de mbito global.
( ) A crise da economia europeia tem provocado a diminuio da populao em pases como a
Espanha e Portugal, pois tanto o cidado imigrante quanto o nacional esto procurando novas
oportunidades de trabalho em outros pases.
( ) Os altos custos de produo industrial nos tigres do Pacfico (Cingapura, Taiwan, Coria do Sul
e China), ocasionou, por parte dos pases do norte, a reduo de seus investimentos naqueles
pases.
A sequncia correta de preenchimento dos parnteses, de cima para baixo,
(A)
(B)
(C)
(D)
(E)

F F V V.
V V V F.
V F F V.
V V F V.
F F V F.

UFRGS CV/2012 GEO

243

53. Considere as seguintes afirmaes sobre a globalizao mundial.


I - Existe uma grande proteo alfandegria produo industrial nacional.
II - A produo industrial dirige suas aes para a reduo de estoques e pronto fornecimento (Justin-time).
III- As unidades da federao praticam a renncia fiscal para atrair investimentos externos,
descentralizando a produo industrial.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas I.
Apenas II.
Apenas I e III.
Apenas II e III.
I, II e III.

54. Observe o mapa abaixo.

VESENTINI, W. Geografia: Geografia geral e do Brasil. So Paulo: tica, 2005. p. 356.

Em relao s reas sombreadas no mapa, so feitas as seguintes afirmaes.


I - Essas reas apresentam clima temperado continental com alta amplitude trmica diria.
II - Nelas, as alteraes antrpicas no meio natural so contnuas, e, por isso, a vegetao (taiga,
pradaria, mediterrnea, campos, etc.) raramente encontrada em sua forma original.
III- Nelas, ocorre confronto de massas de ar entre frentes frias, oriundas das massas polares continentais
ou martimas, e frentes quentes, originrias de massas tropicais, continentais ou martimas.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas I.
Apenas II.
Apenas I e II.
Apenas II e III.
I, II e III.

UFRGS CV/2012 GEO

244

55. Observe, abaixo, a representao esquemtica da formao do solo e de sua relao com o clima e
com a vegetao.

Adaptado de: WICANDER, R.; MONROE, J. S. Fundamentos de geologia.


So Paulo: Cengage Learning, 2009. p. 135.

Com base nas informaes contidas nessa representao, considere as seguintes afirmaes acerca
dos processos de formao do solo.
I - Os solos dos climas rticos e desrticos apresentam detritos de rochas derivados do
intemperismo mecnico.
II - Os processos de formao do solo operam mais vigorosamente onde a vazo hdrica regular, e
as temperaturas no ultrapassam 20 C.
III- Os horizontes de solo mais desenvolvidos esto relacionados s altas temperaturas e s
precipitaes, assim como densa cobertura vegetal.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.

UFRGS CV/2012 GEO

245

56. As bolsas de valores mesmo localizadas em diferentes pases do mundo funcionam diariamente
entre 9h e 18h.
A esse repeito, considere as seguintes afirmaes.
I - O aumento do valor das aes de uma companhia multinacional ocorrido s 10 horas do dia
20/01/2012 na bolsa de valores de Tquio influenciar, neste mesmo momento, as operaes
relativas a essas aes na bolsa de valores de Nova Iorque.
II - O encerramento das atividades da bolsa de valores de Tquio ocorre no mesmo dia em que a
bolsa de valores de So Paulo inicia suas atividades s 9h.
III- O encerramento das atividades da bolsa de valores de Nova Iorque no dia 1/12/2011 ocorre no
mesmo horrio da abertura das atividades da bolsa de valores de Tquio no dia 02/12/2011.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas
Apenas
Apenas
Apenas
Apenas

I.
II.
III.
I e II.
II e III.

57. Observe o mapa abaixo, que representa as riquezas naturais exploradas no continente africano.

1
3
1

4
EQUADOR
0

1.000 km

Adaptado de: ATLAS LE MONDE DIPLOMATIQUE III.


Buenos Aires: Capital Intelectual, 2009.

Identifique, nos parnteses, abaixo, a riqueza natural destacada na figura pelos nmeros 1, 2, 3 e 4.
(
(
(
(

)
)
)
)

gs e petrleo
ouro, prata, cobre, bauxita e diamantes
bosques florestais
urnio e carvo

A sequncia correta de preenchimento dos parnteses, de cima para baixo,


(A)
(B)
(C)
(D)
(E)

1
1
2
3
3

2
2
3
4
4

3
4
4
1
2

4.
3.
1.
2.
1.

UFRGS CV/2012 GEO

246

58. Considere as seguintes afirmaes sobre a Austrlia.


I - A Austrlia no recebe fluxos migratrios significativos, apesar de ser considerado um pas
industrializado.
II - O subsolo da Austrlia rico em reservas minerais, entre as quais se destacam o ouro, o carvo
mineral, o nquel e a bauxita.
III- O setor tercirio, que representa cerca de 70% da economia do pas, vem se consolidando pela
prestao de servios qualificados e pelo desenvolvimento de tecnologia de ponta.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.
59. Considere as seguintes afirmaes sobre acordos econmicos firmados na Amrica Latina.
I - O principal acordo em volume de negcios e superfcie territorial na Amrica Latina o Mercosul.
II - A Aliana Bolivariana para os Povos de Nossa Amrica composta por Cuba, Bolvia, Equador
e Venezuela.
III- Chile, Peru e Colmbia firmaram o Tratado de Livre Comrcio com os Estados Unidos.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas I.
Apenas II.
Apenas I e II.
Apenas II e III.
I, II e III.

60. No ano de 2011, o vulco Puyehue, no Chile, entrou em atividade.


Sobre esse vulco e suas atividades recentes, so feitas as seguintes afirmaes.
I - As cinzas do Puyehue chegaram s cidades de Buenos Aires, Montevidu e ao sul do Brasil,
trazidas pelas frentes frias, atingindo a Austrlia.
II - Os vulces, como o Puyehue, situados na Cordilheira dos Andes, so constitudos de rochas
cristalinas de idade Pr-Cambriana.
III- Os vulces na Terra do Fogo, a exemplo do Puyehue, encontram-se numa zona de atividade ssmica.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e III.
(E) I, II e III.
UFRGS CV/2012 GEO

247

61. Observe o mapa hidrogrfico abaixo, que representa a Bacia do Prata.

BRASIL
PARAGUAI

B
Oceano
Atlntico

ARGENTINA

400 km

URUGUAI

Limite Bacia do Prata

Os pontos destacados pelas letras A, B, C e D indicam, respectivamente, os rios


(A) Paraguai Paran

Uruguai Paran

(B) Paran

Paraguai Uruguai Paran

(C) Paran

Paraguai Negro

(D) Paraguai Paran


(E) Paran

Paraguai

Uruguai Paraguai

Paraguai Negro

Paran

62. Assinale a alternativa que preenche corretamente as lacunas do enunciado abaixo, na ordem em
que aparecem.
Uma famlia residente em Porto Alegre, Brasil, mudar para Maputo, em Moambique. Pretende
levar suas plantas de jardim e saber como o sol incidir sobre elas no novo local. Nessa situao,
importante saber que, em Moambique, o sol nasce no ........ , passa pelo ........ e se ope no ........ .
As plantas expostas na face ........ recebero luz solar durante todo o dia.
(A) oeste norte leste sul
(B) leste sul

oeste norte

(C) oeste sul

leste norte

(D) leste sul

oeste sul

(E) leste norte oeste norte


6

UFRGS CV/2012 GEO

248

63. Considere as afirmaes abaixo sobre escala cartogrfica.


I - Em um mapa, a menor distncia entre duas cidades representada por 5 cm. Sabendo-se que a
distncia real entre ambas de 250 km, em linha reta, o mapa foi elaborado na escala
1:5.000.000.
II - Sabendo-se que duas cidades distam uma da outra 150 km em linha reta, em um mapa de
escala 1:1.000.000, a distncia grfica entre as duas cidades de 10 cm.
III- Foram elaborados dois mapas do municpio de Porto Alegre; um na escala 1:100.000 e outro na
escala 1:25.000. O mapa na escala 1:25.000 apresenta maior grau de detalhamento no traado
dos elementos representados.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.
64. No bloco superior, abaixo, so listados os nomes de quatro biomas brasileiros; no inferior,
caracterizaes de trs deles.
Associe adequadamente as caracterizaes aos respectivos biomas.
1 - Floresta Ombrfila Mista
2 - Floresta Ombrfila Densa
3 - Floresta Paludosa
4 - Manguezal
( ) Desenvolve-se em reas permanentemente inundadas e com guas de circulao lenta.
( ) Encontra-se sob clima subtropical, sem estao seca e, embora haja dominncia de uma espcie
(Araucaria angustiflia), apresenta uma submata desenvolvida.
( ) um bioma de interface situado sobre pntano salobro, composto pela mistura de guas da
drenagem dos continentes e do oceano Atlntico.
A sequncia correta de preenchimento dos parnteses, de cima para baixo,
(A) 4 3 2.
(B) 3 1 4.
(C) 3 2 1.
(D) 2 1 4.
(E) 3 4 2.

UFRGS CV/2012 GEO

249

65. Observe o mapa e o perfil esquemtico abaixo.

Adaptado de: ROSS, J.L.S. Geografia do Brasil.


So Paulo: Edusp, 2008.

Adaptado de: ROSS, J. L. S. (org.) Geografia do Brasil. So Paulo: Edusp, 2005. p. 55.

Os compartimentos de relevo destacados no perfil (A A) com as letras A, B e C indicam, respectivamente,


(A) a Plancie e o Pantanal Mato-grossense o Planalto e a Chapada dos Parecis a Depresso do
Tocantins.
(B) a Depresso da Amaznia Ocidental a Depresso Cuiabana a Plancie do Rio Araguaia.
(C) a Depresso do Araguaia o Planalto e as Serras de Gois/Minas as Plancies Litorneas.
(D) a Depresso Sertaneja o Planalto da Borborema as Plancies e os Tabuleiros Costeiros.
(E) os Planaltos e a Chapada dos Parecis a Depresso Perifrica a Depresso do Miranda.
66. Assinale a alternativa que preenche corretamente as lacunas do enunciado abaixo, na ordem em
que aparecem.
Nos meses de inverno, no Brasil, frequente a ocorrncia de ........ no sul, ........ no centro-oeste e
......... no sudeste.
(A) geada

seca

inverso trmica

(B) neve

chuvas frontais inundao

(C) chuvas convectivas

inundao

(D) geada

chuvas frontais inundao

(E) chuvas convectivas

seca

inverso trmica
neve

UFRGS CV/2012 GEO

250

67. Observe o mapa do Brasil abaixo.

500 km

SIMIELLI, M. E. Geoatlas. So Paulo:


tica, 2010. p. 115.

Este mapa representa


(A)
(B)
(C)
(D)
(E)

o transporte areo de carga.


as famlias assentadas no campo.
as unidades industriais.
a agroindstria.
a populao indgena.

68. A tabela abaixo fornece dados de alguns estados brasileiros, identificados pelas letras A, B, C e D,
segundo publicao do IBGE.
Indicadores Sociais das Condies de Vida da
Populao Brasileira
Populao
Total (Hab) (2010)

19.597.330

41.262.199

6.248.436

3.120.494

1,67

1,78

2,08

2,29

Taxa de mortalidade infantil


(2009)

19%0

15%0

15%0

46,4%0

Analfabetismo em pessoas com mais de 15 anos


(2009)

8,5%

4,7%

4,9%

24,6%

26,6%

26,6%

27,19%

59,54%

Taxa de fecundidade
Total (2009)

Incidncia de pobreza
(2003)

Adaptado de: <http://www.ibge.gov.br/cidadesat/topwindow.htm?1>. Acesso em: 14 set. 2011.

Assinale a alternativa que apresenta os nomes dos estados brasileiros correspondentes s letras A,
B, C e D, respectivamente.
(A)
(B)
(C)
(D)
(E)

Rio Grande do Sul Rio de Janeiro Gois Tocantins


Minas Gerais So Paulo Santa Catarina Alagoas
Rio Grande do Sul Pernambuco Cear Sergipe
Paran So Paulo Gois Alagoas
Minas Gerais Pernambuco Santa Catarina Tocantins

UFRGS CV/2012 GEO

251

69. Observe as pirmides populacionais abaixo, referentes populao brasileira.

2050
_____________________

80 +_______________________
75 - 79_________________

_________________
__________

70 - 74___________
65 - 69______

_____

60 - 64______

_______

55 - 59_____

_______

50 - 54__

_____
______

45 - 49___
40 - 44_______

__________

35 - 39_________

Populao por Sexo e Grupos de Idade 1980-2050


Grupos Etrios Abertos (80 anos ou +)
2050___
2040________
2030____________
2020______________
2010________________
2005________________
2000_________________
1990__________________
1980__________________
HOMENS

___
_________
_______________
_________________
____________________
____________________
_____________________
______________________
_______________________
MULHERES

_____________

30 - 34__________

______________

25 - 29___________

_______________

20 - 24____________

_________________
___________________

15 - 19______________
10 - 14_______________

_____________________

5 - 9__________________

______________________

0 - 4___________________

_______________________
HOMENS

MULHERES

Grupos Quinquenais de idade (50 a 54 anos)


2050_
2040_
2030___
2020_____
2010_________
2005__________
2000____________
1990______________
1980_______________
HOMENS

____
____
______
________
___________
_____________
_______________
_________________
___________________
MULHERES

Adaptado de: <http://www.ibge.gov.br/home/estatistica/populacao/projecao_da_populacao/2008>.


Acesso em: 14 set. 2011.

Com base na leitura dessas pirmides populacionais, considere as afirmaes abaixo, referentes
projeo do crescimento da populao brasileira pelo IBGE para o ano de 2050.
I - Tanto a populao jovem quanto a idosa diminuir.
II - Haver um envelhecimento da populao.
III- O crescimento da populao com mais de 80 anos mais acentuado que o da populao entre a
idade de 50 a 54 anos.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas II e III.
(E) I, II e III.

10

UFRGS CV/2012 GEO

252

70. Assinale a alternativa correta em relao ao processo de urbanizao.


(A) As cidades de So Paulo e do Rio de Janeiro so chamadas de megalpoles regionais, pois seus
parques tecnolgicos incrementam o desenvolvimento de indstrias na Regio Sudeste.
(B) A rede urbana da Regio Nordeste muito preparada para o turismo internacional e conta com
quatro metrpoles nacionais, como as cidades de Recife, Salvador, Fortaleza e So Lus.
(C) A verticalizao das cidades um termo que se utiliza quando a cidade cresce em reas de
grande declividade do terreno.
(D) Uma Regio Metropolitana assim considerada apenas quando o municpio integrante encontrase em conurbao.
(E) A chamada terciarizao das cidades o fenmeno de especializao com elevada parte da sua
populao trabalhando no setor de servios.
71. As figuras abaixo representam as alteraes nos volumes de balano hdrico entre um cenrio sem
urbanizao e um urbanizado no Brasil.
Cenrio urbanizado

Cenrio sem urbanizao

Adaptado de: TUCCI, C .E. M. Inundaes urbanas. Porto Alegre: ABRH/RHAMA, 2007. p. 96.

Considere as seguintes afirmaes sobre os efeitos da urbanizao na dinmica do balano hdrico.


I - A infiltrao no solo reduzida, mantendo estvel o nvel do lenol fretico.
II - O volume de escoamento superficial aumenta devido retirada da superfcie permevel e da
cobertura vegetal.
III- As perdas por evapotranspirao so mais intensas no cenrio urbanizado.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e III.
(E) I, II e III.

UFRGS CV/2012 GEO

11

253

Instruo: As questes 72 e 73 esto relacionadas


aos mapas abaixo, que representam,
respectivamente, trs tipos de cultivos
agrcolas praticados no Brasil.

72. Os cultivos representados nos mapas 1, 2 e 3,


so, respectivamente,
(A) fumo, soja e arroz.

(B) soja, laranja e banana.


(C) cana-de-acar, arroz e uva.

(D) laranja, banana e uva.


(E) arroz, cana-de-acar e fumo.
73. Com base nos dados dos mapas, considere as
seguintes afirmaes.

100

I - Diferentemente do que aconteceu com a


Floresta Amaznica, a opinio pblica no
se sensibilizou com a destruio do bioma
da caatinga, a qual decorre do cultivo
representado no mapa 1.

200 400 600 Km

II - Antes da utilizao de alta tecnologia de


correo e manejo dos solos, o cultivo
representado no mapa 3 no era
praticado,
pois
o
clima
regional
predominante, quente e mido, no
permitia seu desenvolvimento.

100

III- O cultivo representado no mapa 2,


praticado nos solos do cerrado, que,
antes da difuso de tecnologia agrcola,
era considerado inapto para a agricultura,
devido elevada acidez e pobreza em
nutrientes.

200 400 600 Km

Quais esto corretas?


(A) Apenas I.

(B) Apenas II.


(C) Apenas III.
(D) Apenas II e III.
(E) I, II e III.

100

200 400 600 Km

3
GIRARDI, E.P. Atlas da questo agrria. Disponvel
em: <http://www2.fet.unesp.br/nera/atlas>.
Acesso em: 14 set. 2011.

12

UFRGS CV/2012 GEO

254

Km

74. Considere as seguintes afirmaes, em


relao ao crescimento da populao do
estado do Rio Grande do Sul, referentes ao
Censo de 2010 realizado pelo IBGE.
I - Caxias do Sul teve um crescimento
populacional entre 2000 e 2010, atrado
pela produo do polo metal-mecnico.
II - O crescimento populacional no estado
apresentou uma das maiores taxas da
Federao brasileira, devido alta taxa de
fecundidade, semelhante dos pases
europeus.
III- Porto Alegre teve um crescimento
populacional expressivo, passando do 10
para o 5 lugar na classificao entre as
capitais.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas
Apenas
Apenas
Apenas
Apenas

I.
II.
III.
I e III.
II e III.

75. Considere as seguintes afirmaes, referentes


s caractersticas atuais da urbanizao no Rio
Grande do Sul.
I - O aumento da populao urbana concentrase,
essencialmente,
no
crescimento
vegetativo e na migrao de carter
urbano-urbano e rural-urbano.
II - Entre os municpios com populao
superior a 100 mil habitantes, os que mais
cresceram no ltimo decnio foram os do
Planalto Meridional: Passo Fundo, Bag e
Pelotas.
III- A Aglomerao Urbana do Nordeste,
constituda por municpios como Caxias
do Sul, Bento Gonalves e Garibaldi, a
maior do estado, depois da Regio
Metroplitana de Porto Alegre.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas I.
Apenas II.
Apenas I e III.
Apenas II e III.
I, II e III.

UFRGS CV/2012 GEO

13

255

2013
53. Leia a letra da cano, Ora Bolas, de Paulo
Tatit e Edith Derdyk.

GEOGRAFIA
51. Assinale
a
alternativa
que
preenche
corretamente as lacunas do enunciado abaixo,
na ordem em que aparecem.

Oi, oi, oi,


Olha aquela bola,
A bola pula bem no p,
No p do menino.
Esse menino meu vizinho.
Onde ele mora?
Mora l naquela casa.
Onde est a casa?
A casa t na rua.
Onde est a rua?
T dentro da cidade.
Onde est a cidade?
T do lado da floresta.
Onde a floresta?
A floresta no Brasil.
Onde est o Brasil?
T na Amrica do Sul,
No continente Americano cercado de oceano
E das terras mais distantes,
De todo o planeta.
E como que o planeta?
O planeta uma bola,
Que rebola l no cu.
Oi, oi, oi,
Olha aquela bola.

O fenmeno da super Lua ocorre quando a


Lua est em sua fase ........, o satlite est
........ da Terra, situao chamada de ........, e
a sua aparncia ........ em relao ao
normal.
(A) cheia mais perto

perigeu maior

(B) nova mais perto

apogeu menor

(C) cheia mais perto

apogeu maior

(D) nova mais distante perigeu maior


(E) cheia mais distante perigeu menor

52. Como consequncia dos movimentos de


rotao e translao, realizados pelo planeta
Terra, h uma variao na incidncia dos
raios solares sobre a superfcie terrestre, no
decorrer do ano.
A esse respeito, considere as seguintes
afirmaes.

TATIT, Paulo. Ora bolas. Canes de brincar. So Paulo:


Palavra Cantada, 1996. 1 CD-ROM.

I - Os raios solares atingem a superfcie da


Terra durante o dia e, noite, a superfcie
se resfria.
II - A incidncia de radiao solar diminui em
direo s regies de alta latitude.
III- A incidncia da radiao solar, nas
regies localizadas em zonas temperadas,
varia muito ao longo do ano.

A cano aborda uma temtica importante


para compreender a produo do espao
geogrfico e essa temtica pode ser definida
como
(A) migrao intraurbana.
(B) diferentes nveis de escala geogrfica.
(C) transformaes na paisagem natural.

Quais esto corretas?

(D) formao do espao urbano.

(A) Apenas I.

(E) integrao econmica


americano.

no

continente

(B) Apenas II.


(C) Apenas III.
(D) Apenas II e III.
(E) I, II e III.

UFRGS CV/2013 GEO

21

256

54. Assinale com V (verdadeiro) e F (falso) as afirmaes abaixo, referentes dinmica das placas
litosfricas.
( ) A primeira teoria a defender que a crosta terrestre uma camada composta de fragmentos
mveis e, no, uma camada rgida inteiria de rochas ficou conhecida como Teoria do Ciclo
Geogrfico.
( ) O afastamento ou a coliso entre placas litosfricas um movimento muito lento, que ocorre a
uma velocidade mdia de dois a trs centmetros por ano.
( ) O deslocamento das placas litosfricas decorrente de foras endgenas do planeta, geradas
pelas correntes de conveco no interior do manto terrestre.
( ) O movimento entre duas placas, em sentido contrrio, provoca grandes dobramentos em suas
bordas de contato, devido ao fenmeno de subduco.
A sequncia correta de preenchimento dos parnteses, de cima para baixo,
(A) V F F V.
(B) F V V F.
(C) V F F F.
(D) F F V V.
(E) F V F F.
55. Observe o mapa abaixo.

Equador

LEINZ, V.; AMARAL, S. E. Geologia geral. So Paulo: Nacional, 2003. p. 284.

As reas mais escuras do mapa correspondem aos


(A) terrenos de cobertura sedimentar e metamrfica.
(B) relevos de estruturas dobradas.
(C) terrenos vulcnicos e sedimentares.
(D) relevos de plancies continentais.
(E) terrenos cristalinos de Idade Pr-cambriana.

22

UFRGS CV/2013 GEO

257

56. Uma pequena parte de gua doce do planeta


flui, no estado lquido, por cursos de gua e
lagos nas reas continentais.

58. Considere as seguintes afirmaes sobre rios


e bacias hidrogrficas brasileiras.
I - O rio Amazonas considerado um rio de
plancie, navegvel e com baixo potencial
hidroeltrico.

Assinale com V (verdadeiro) ou F (falso) as


seguintes afirmaes sobre as guas
continentais superficiais.

II - Os rios Negro, Trombetas e Jari esto


entre os maiores e mais importantes
afluentes do Amazonas, pela margem
direita, e dispem de grande potencial
para gerar energia hidroeltrica.

( ) Foz de curso de gua em forma de


esturio ocorre quando ele desgua no
oceano, formando canais e ilhas.
( ) Cursos de gua, localizados em regies
com ndices pluviomtricos anuais altos,
possuem regime fluvial perene.
( ) Cheias ou inundaes dos cursos de gua
ocorrem na estao mais chuvosa; e as
vazantes, nas estaes de menor
precipitao.
( ) Canalizao o processo pelo qual o
curso de gua conduzido por meio de
canais ou valas escavadas, retilinizando
seu leito e regularizando sua direo.

III- Os principais afluentes da Bacia TocantinsAraguaia tm potencial hidroeltrico,


formando a maior bacia localizada
totalmente em territrio brasileiro.
Quais esto corretas?
(A) Apenas I.
(B) Apenas III.

A sequncia correta de preenchimento dos


parnteses, de cima para baixo,
(A)
(B)
(C)
(D)
(E)

V
F
V
F
V

F
V
V
F
V

F
V
F
V
V

V.
V.
F.
V.
F.

(C) Apenas I e III.


(D) Apenas II e III.
(E) I, II e III.
59. Considere as seguintes afirmaes sobre
atividades mineradoras e impactos ambientais.
I-

57. O Brasil um pas com grande disponibilidade de


recursos hdricos, mas enfrenta o problema de
escassez de gua potvel em alguns lugares.
A esse respeito, considere as seguintes
afirmaes.

No Rio Grande do Sul, o chamado Escudo


Sul-rio-grandense a unidade geolgica
de extrao mineral mais antiga do
Estado.

II- No Planalto Basltico, no Rio Grande do Sul,


a presena de ametista e gata tem induzido
agricultores atividade de extrao mineral.

I - As Regies Sul e Sudeste concentram o


maior potencial hdrico e o maior
contingente populacional do pas.
II - A Regio Nordeste possui o menor
potencial hdrico do pas e o segundo
maior contingente populacional entre as
demais regies do Brasil.
III- A impermeabilizao do solo urbano e a
manuteno dos ndices de crescimento
populacional,
nas
grandes
cidades
brasileiras, garantem a disponibilidade de
gua potvel.

III- Nas regies carbonferas dos estados da


Regio Sul, a poluio hdrica mais
importante decorrente da infiltrao da
gua da chuva, sob os rejeitos gerados nas
atividades de lavra e de beneficiamento.

Quais esto corretas?

(D) Apenas II e III.

(A)
(B)
(C)
(D)
(E)

(E) I, II e III.

Apenas I.
Apenas II.
Apenas III.
Apenas II e III.
I, II e III.

UFRGS CV/2013 GEO

Quais esto corretas?


(A) Apenas I.
(B) Apenas II.
(C) Apenas III.

23

258

60. Considere as afirmaes abaixo a respeito da


extrao e da produo de derivados de
petrleo no Brasil.

62. No que diz respeito aos furaces, assinale a


alternativa correta.

I - As refinarias de petrleo, no Brasil, esto


localizadas prximas s regies de maior
concentrao industrial, a fim de atender s
necessidades de matria-prima nesse setor.

(A) Furaces, tufes, ciclones, tempestades


ciclnicas e ciclones tropicais tm origens
diferentes e ocorrem nos mesmos
espaos geogrficos do planeta.

II - A atividade petrolfera, no Brasil,


monoplio da Petrobrs, empresa que
controla refinarias e distribuio de
combustveis e derivados.

(B) Eles ocorrem quando do resfriamento da


massa de ar, imediatamente acima da gua
dos oceanos, provocando evaporao e
consequente aumento da umidade.

III- O Brasil atingiu, em 2009, a autossuficincia


e, assim, o pas deixou de importar petrleo,
j que todas as refinarias esto adaptadas
para o refino da produo.

(C) Eles geralmente se originam no oceano


Pacfico, estando associados s correntes
marinhas frias no Hemisfrio Norte.
(D) A maior ocorrncia de furaces no Caribe
e na Amrica do Norte est associada aos
meses frios do inverno boreal.

Quais esto corretas?


(A) Apenas I.

(E) A ocorrncia do furaco Sandy, no ms


de outubro de 2012, o resultado do
aumento da intensidade do vento entre
regies com grandes diferenas de
temperaturas frias (presso maior) e
quentes (presso menor).

(B) Apenas II.


(C) Apenas III.
(D) Apenas II e III.
(E) I, II e III.
61. Com relao Amaznia brasileira, considere
as afirmaes abaixo.

63. Com relao dinmica climtica, considere


as afirmaes abaixo.

I - Apesar de os cursos de gua serem


considerados vias de transporte, as estradas
de rodagem so, atualmente, os principais
corredores de escoamento de populao e
de produtos ao longo da floresta amaznica.

I - O deslocamento das massas de ar um


fenmeno atmosfrico que ocorre na
troposfera e que interfere nas condies
meteorolgicas.

II - A maioria dos desmatamentos ocorre no


chamado arco de desflorestamento da
Amaznia, faixa de terra que vai do
noroeste do Par, passando pelo norte do
Mato Grosso e por Rondnia, at o Acre.
III- O avano das empresas agropecurias e
madeireiras sobre as reas indgenas tem
aumentado os conflitos sociais na
Amaznia, principalmente nos estados do
Par, Mato Grosso e Rondnia.
Quais esto corretas?

II - As massas de ar polares tm origem nos


polos Norte e Sul do planeta e, conforme
a rea por onde se deslocam, podem ser
secas ou midas.
III- As chamadas frentes de transio, que se
formam nas reas onde ocorre o encontro
entre massas de ar, podem ser frentes
frias ou quentes.
Quais esto corretas?
(A) Apenas I.

(A) Apenas I.

(B) Apenas II.

(B) Apenas II.

(C) Apenas III.

(C) Apenas III.

(D) Apenas II e III.

(D) Apenas II e III.

(E) I, II e III.

(E) I, II e III.
24

UFRGS CV/2013 GEO

259

64. O mapa abaixo representa os estudos realizados pelo gegrafo brasileiro Aziz Nacib AbSaber, sobre
os domnios morfoclimticos do Brasil, que resultam da interao entre relevo, clima e vegetao.

Equador

N
0

600 km

ABSABER, A.N. Os domnios de natureza no Brasil. So Paulo: Ateli Editorial, 2003. p. 16.

Considere as seguintes afirmaes a respeito dos domnios morfoclimticos e a respectiva


localizao no mapa.
I - Domnio da Caatinga (1 no mapa): relevo formado por depresses e planaltos. Possui clima
semirido, com chuvas concentradas em alguns meses do ano. A vegetao de arbustos
espinhosos e cactceas sofre alteraes desde a poca do Brasil colnia.
II - Domnio do Cerrado (2 no mapa): a vegetao tem sido intensamente alterada para dar lugar s
reas de pastagens e para a instalao de lavouras (sobretudo o cultivo da soja).
III- Domnio das Araucrias (3 no mapa): regio caracterizada pela presena de planaltos em
estruturas dobradas, com muitas serras e morros.
IV - Faixas de Transio (4 no mapa): reas intermedirias que possuem caractersticas ambientais
de dois ou mais domnios morfoclimticos, como o caso do Pantanal mato-grossense.
Quais esto corretas?
(A) Apenas I e II.
(B) Apenas I e III.
(C) Apenas II e III.
(D) Apenas II e IV.
(E) Apenas III e IV.
UFRGS CV/2013 GEO

25

260

65. No bloco superior abaixo, esto listados


quatro termos; no inferior, definies de
conceitos referentes a trs desses termos.

67. Considere as seguintes afirmaes sobre as


transformaes recentes no Mercosul.

Associe adequadamente o bloco inferior ao


superior.

I - A integrao da Venezuela ao Mercosul


contou com apoio dos governos do
Uruguai, da Argentina e do Brasil.

1 - Regio
2 - Territrio
3 - Biosfera
4 - Bioma
( ) Parcela da superfcie terrestre que forma
uma unidade distinta em virtude de
determinadas caractersticas temticas.
( ) Apropriao de uma parcela geogrfica
por um indivduo ou uma coletividade.
( ) Um conjunto de ecossistemas.

II - A suspenso provisria do Paraguai do


Mercosul ocorreu em virtude do processo
poltico que levou ao impeachment o
ento presidente paraguaio Fernando
Lugo, em junho de 2012.
III- O Brasil tem interesse na entrada do Chile
como membro permanente do Mercosul,
uma vez que a economia daquele pas
centralizada em petrleo.

A sequncia correta de preenchimento dos


parnteses, de cima para baixo,

Quais esto corretas?

(A) 1 2 4.

(A) Apenas I.

(B) 1 2 3.

(B) Apenas II.

(C) 2 3 1.

(C) Apenas I e II.

(D) 3 4 2.

(D) Apenas II e III.

(E) 3 4 1.

(E) I, II e III.

66. Considere as seguintes afirmaes sobre a


crise do Euro e a geopoltica na Europa.
I - Uma das razes da crise do Euro a
dificuldade de alguns pases europeus na
manuteno de uma poltica de bem-estar
social em uma economia neoliberal.
II - Pases como Portugal, Espanha, Itlia e
Grcia baixaram seus custos e retomaram as
barreiras alfandegrias internas.
III- O dficit oramental da Grcia fez com que
os investidores exigissem taxas de juros
muito altas para emprestar dinheiro ao pas.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas I e II.
(D) Apenas I e III.
(E) I, II e III.
26

UFRGS CV/2013 GEO

261

68. Observe a figura abaixo a respeito da produo agrcola de orgnicos.

8.100.000
220.000
37

SIA

AMRICA DO NORTE

EUROPA

2.500.000
14.062
178

3.300.000
400.000
8

FRICA

900.000
470.000
2

AMRICA DO SUL

OCEANIA

8.200.000
260.000
31

REA (ha)
NR DE PRODUTORES
REA POR PRODUTOR (ha)

12.100.000
7.749
1.561

Adaptado de: <http://ipd.org.br/upload/tiny_mce/arquivos/Perfil_do_mercado_organico_brasileiro_


como_processo_de_inclusao_social.pdf>. Acesso em: set. 2012.

Com base na figura acima, considere as seguintes afirmaes sobre a produo agrcola de
orgnicos.
I - A Oceania, diferente dos demais continentes, tem sua produo em grande escala.
II - A Europa e a Amrica do Sul tm a produo de orgnicos com caractersticas muito
semelhantes.
III- A Amrica do Norte tem sua produo de orgnicos centrada em produtores com maior rea de
cultivo.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas I e II.
(D) Apenas I e III.
(E) I, II e III.

UFRGS CV/2013 GEO

27

262

69. Observe o quadro abaixo referente produo de orgnicos no Brasil e estrutura fundiria.
DISTRIBUIO DO SEGMENTO ORGNICO NO BRASIL
REA (ha)

VALOR (Milhes R$)

REA POR
ESTABELECIMENTO (ha)

REGIES

ESTABELECIMENTOS

NORTE

6.133

618.079

75,3

100,8

NORDESTE

42.236

1.574.008

423,4

37,8

CENTRO-OESTE

4.138

1.233.150

75,3

298,0

SUDESTE

18.715

970.685

262,9

51,9

SUL

19.275

539.551

193,8

28,0

Adaptado de: Censo Agropecurio 2006, IBGE. Disponvel em: <http://ipd.org.br/upload/


tiny_mce/arquivos/Perfil_do_mercado_organico_brasileiro_como_processo_de_inclusao_social.pdf>.
Acesso em: 12 set. 2012.

Com base nos dados do quadro acima, considere as seguintes afirmaes sobre a produo de
orgnicos.
I - Nos estados da Regio Sul, a agricultura orgnica desenvolve-se, em mdia, em pequenos
estabelecimentos.
II - Nos estados da Regio Centro-Oeste, o valor da produo por rea , em mdia, o maior entre
as regies.
III- Na Regio Nordeste, encontra-se o menor valor de produo entre as regies.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas I e II.
(D) Apenas I e III.
(E) I, II e III.

28

UFRGS CV/2013 GEO

263

70. Observe o quadro abaixo.


Ano

Produo de leite (mil litros)

1975
1980
1985
1990
1995
2000
2005
2010
2011

7.947.382
11.162.245
12.078.398
14.484.414
16.474.365
19.767.206
24.620.859
30.715.460
32.296.120

Produtividade
litros/vaca/ano
646
676
715
759
801
1.105
1.194
1.340
1.374

Fonte: IBGE/Censo Agropecurio e Pesquisa da Pecuria Municipal.

Com base nos dados do quadro, considere as seguintes afirmaes sobre a produo leiteira no
Brasil.
I - A produo leiteira foi maior no perodo de 2000 a 2011.
II - A produtividade do leite pouco cresceu, visto que acompanhou apenas o crescimento
proporcional da produo de leite.
III- O rebanho bovino leiteiro cresceu no perodo de 1975 a 2011, conforme demonstram a
produo e a produtividade de leite.
Quais esto corretas?
(A) Apenas I.
(B) Apenas III.
(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.
71. O desenvolvimento tecnolgico dos sculos XIX e XX alterou as formas de trabalho, as paisagens
geogrficas, os hbitos e os costumes das populaes.
Assinale a alternativa correta em relao a essas alteraes.
(A) A produo de elevadores e automveis, no final do sculo XIX e incio do sculo XX, contribuiu
para a verticalizao e a intensificao da estrutura viria no espao urbano.
(B) O conhecimento tcnico-cientfico, nos sculos XIX e XX, contribuiu para reduzir a degradao
ambiental.
(C) A criao de equipamentos agrcolas modernos viabilizou o cultivo de grandes extenses de
terras e o aumento da demanda por trabalhadores no campo.
(D) O desenvolvimento econmico, tecnolgico e social, que transformou as paisagens geogrficas, tem
sua origem nas polticas nacionalistas, implantadas pelos regimes autoritrios, no final do sculo XIX.
(E) Tecnologias avanadas, direcionadas para a automao da produo, proporcionaram o
aumento da produtividade, exigindo maior esforo fsico e mental dos trabalhadores para
realizar as atividades.

UFRGS CV/2013 GEO

29

264

72. Observe o quadro abaixo.

Porte das cidades

Nmero de cidades/dcadas
1940

1950

1960

1970

1980

1991

2000

2008

Entre 100 e 200 mil habitantes

18

38

56

78

114

137

Entre 200 e 500 mil habitantes

15

32

45

78

92

Mais de 500 mil habitantes

13

22

30

37

Mais de 1 milho de habitantes

13

14

BOLIGIAN, L; BOLIGIAN, A. T. A. A Geografia; espao e vivncia. So Paulo: Saraiva, 2010. v.2, p. 82.

Considere as seguintes afirmaes a respeito dos dados populacionais das cidades brasileiras.
I - Na dcada de 1950, existiam no Brasil quatorze cidades consideradas de porte mdio.
II - A partir da dcada de 2000, h o crescimento no nmero de mdias cidades, o que configura
uma desconcentrao populacional no Brasil.
III- A partir da dcada de 1970, o crescimento dos maiores centros urbanos contribuiu para o
surgimento das principais metrpoles do Brasil.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas II e III.
(E) I, II e III.

30

UFRGS CV/2013 GEO

265

Instruo: As questes 73 e 74 esto relacionadas s pirmides populacionais abaixo, referentes


populao indgena em duas regies brasileiras, em 2010.

Pirmide 1

MULHERES

Regio Norte

HOMENS

Pirmide 2

HOMENS

Regio Sudeste

MULHERES

Adaptado de: <http://www.ibge.gov.br/indigenas/piramide_indigena.html>. Acesso em: 12 set. 2012.

UFRGS CV/2013 GEO

31

266

73. Com base nos dados apresentados pelas duas


pirmides
populacionais,
considere
as
afirmaes abaixo.

74. Assinale a alternativa correta, de acordo com


os dados constantes nas duas pirmides.
(A) As
informaes
das
pirmides
demonstram que a populao indgena
tem um crescimento populacional inverso
ao da populao brasileira em geral,
quanto
aos
fatores
ruralidade
e
urbanidade.

I - A anlise das formas das pirmides


permite concluir que a pirmide 1
representa uma regio com a populao
indgena predominantemente rural.
II - A pirmide 2 aponta uma diminuio do
nmero de idosos, isto , indica uma
menor expectativa de vida.

(B) A projeo do crescimento da populao


indgena na pirmide 1 aponta maior
expectativa de vida.

III- A base da pirmide 1 caracterstica de


uma regio com baixo ndice de
urbanizao.

(C) A comparao entre as duas bases das


pirmides permite concluir que o
crescimento vegetativo da populao
indgena maior na pirmide 2.

Quais esto corretas?

(D) A pirmide 1
crescimento da
adulta.

(A) Apenas I.
(B) Apenas II.

reflete um grande
populao indgena

(E) O formato da pirmide 2 indica que as


populaes indgenas residentes em reas
urbanizadas so mais longevas, porm
com taxa de natalidade menor.

(C) Apenas I e III.


(D) Apenas II e III.
(E) I, II e III.

75. Assinale a alternativa que preenche corretamente as lacunas do enunciado abaixo, na ordem em
que aparecem.
Na cidade de Alegrete, na fronteira oeste do estado do Rio Grande do Sul, a amplitude trmica anual
........ que na cidade de Tramanda, localizada no litoral norte, devido ......... . J na cidade de
So Francisco de Paula, localizada no Planalto Meridional, as temperaturas mdias sofrem a
influncia da ........, que as ........ .
(A) menor maritimidade

latitude

aumenta

(B) maior continentalidade

altitude

diminui

altitude

mantm

(D) maior continentalidade

latitude

mantm

continentalidade

altitude

diminui

(C) igual
(E) igual

maritimidade

32

UFRGS CV/2013 GEO

267

2014
GEOGRAFIA
Instruo: As questes 51 e 52 esto relacionadas ao mapa abaixo.
Mundo poltico

Fonte: Adaptado de: <http://www.mapasparacolorir.com.br/mapa-mundi.php>. Acesso em: 5 set. 2013.

51. De acordo com o mapa, assinale a alternativa correta sobre a posio e a orientao geogrfica dos
pases.
(A) Os Estados Unidos localizam-se a sudeste da frica do Sul.
(B) A Argentina est localizada a leste do Chile e tambm a sudoeste da Espanha.
(C) A Rssia situa-se a nordeste do Brasil e ao sul da Austrlia.
(D) O Uruguai est a noroeste da ndia que, por sua vez, est a nordeste da Frana.
(E) O Canad situa-se a norte dos Estados Unidos e a leste da Inglaterra.
52. Assinale com V (verdadeiro) ou com F (falso) as seguintes afirmaes sobre a posio geogrfica
das cidades 1, 2, 3 e 4.
( ) A cidade 4, localizada no hemisfrio oriental, est em latitude maior que a cidade 3.
( ) A cidade 2 est em maior latitude e longitude que a cidade 3.
( ) A cidade 1 localiza-se no hemisfrio ocidental em alta latitude.
( ) A cidade 3 est no hemisfrio oeste e latitude maior do que a cidade 1.
(A) F V F V.
(B) V F V F.
(C) F V F F.
(D) V F F V.
(E) F V V F.
UFRGS CV/2014 GEO

21

268

53. Observe as cidades A e B e suas posies


geogrficas em relao ao crculo de
iluminao solar, a partir da dinmica do
movimento de rotao da Terra.

54. No hemisfrio sul, nos dias em que ocorrem o


equincio
e
o
solstcio
de
vero,
respectivamente, o sol est perpendicular s
cidades brasileiras de
(A) Macap e So Paulo.
(B) Manaus e Rio de Janeiro.
(C) Teresina e Curitiba.
(D) Fortaleza e Belo Horizonte.
(E) So Lus e Florianpolis.

55. Leia o texto abaixo.

Fonte: Adaptado de: <http://www.cdcc.


usp.br/cda/producao/sbpc93/>.
Acesso em: 17 de set. 2013.

Considere as seguintes afirmaes sobre as


cidades.
I - Os moradores da cidade B tero uma
longa noite pela frente.
II - Um morador da cidade A, ao amanhecer,
prepara-se para as atividades do dia.
III- Os moradores da cidade A tm os seus
relgios adiantados em relao aos
moradores da cidade B.
Quais esto corretas?

Depois de umas enormes formaes rochosas,


que aqui pareciam torres, nada mais se viu
seno areia e areia. Muito vento, do nordeste.
[...]
Sentado mesa em que escrevo, estou vendo
o forte do Rio Grande, precrio daqui, parece
muito frgil. Nenhuma pedra, s uma
elevao coberta aqui e ali com capim. [...] A
paisagem inspida, batida pelo vento. Vento
que levanta a areia e cobre a praia de uma
tnue camada branca.
ASSIS BRASIL, Luiz Antnio de. Um quarto de
lgua em quadro. Porto Alegre: Editora
Movimento, 1976. p. 57 e 59.

O que descrito no texto, de forma literria?


(A) A Plancie Costeira e a atuao da Massa
Polar Atlntica.
(B) A Depresso Central e a atuao da
Massa Tropical Atlntica.

(A) Apenas I.

(C) O Escudo Sul-riograndense e a atuao


da Massa Tropical Atlntica.

(B) Apenas II.


(C) Apenas III.

(D) A Plancie Costeira e a atuao da Massa


Tropical Atlntica.

(D) Apenas I e II.


(E) Apenas II e III.

(E) O Planalto e a atuao da Massa Polar


Atlntica.

UFRGS CV/2014 GEO

22

269

56. Observe a sequncia de mapas, elaborados a partir de imagens de satlite, que mostram o
deslocamento de uma frente fria sobre o Brasil, entre os dias 06 e 10 de agosto de 2007.
Dia 06/08/07

Dia 08/08/07

Dia 10/08/07

Fonte: O Estado de So Paulo, 07, 09 e 11 ago. 2007.

Assinale a alternativa que melhor caracteriza a condio de tempo atmosfrico na sequncia dos dias.
(A) Em 10/08/07, o tempo atmosfrico sobre o Rio Grande do Sul est estvel, porm as
temperaturas esto mais baixas que em 06/08/07.
(B) Em 06/08/07, as temperaturas caem bruscamente e uma intensa tempestade atinge a Regio Sul.
(C) Em 08/08/07, aps a passagem da frente fria, as temperaturas voltam a subir, mas a
nebulosidade sobre o Sul do Brasil intensa.
(D) Em 10/08/07, a nebulosidade dissipa-se no Rio Grande do Sul, pois a frente fria migrou para o
sul do oceano Atlntico.
(E) Em 08/08/07, a frente fria j passou pela Regio Sul, deixando um rastro de nuvens,
caracterstico do tempo atmosfrico ps-frente fria.
57. Analise os climogramas abaixo, no hemisfrio sul.

Chuvas 2.890mm (anuais)


mm
425
400
375
350
325
300
275
250
225
200
175
150
125
100
75
50
25
0

Temperatura

C
31
30
29
28
27
26
25
24
23
22
21
20
19
18
17
16
15
14

Chuvas 1.600mm (anuais)


mm
400
375
350
325
300
275
250
225
200
175
150
125
100
75
50
25
0

Temperatura
C
30
29
28
27
26
25
24
23
22
21
20
19
18
17
16
15
14

Chuvas 1.350mm (anuais)


mm
425
400
375
350
325
300
275
250
225
200
175
150
125
100
75
50
25
0

F M

Temperatura

C
31
30
29
28
27
26
25
24
23
22
21
20
19
18
17
16
15
14

Comparando esses climogramas, possvel afirmar que


(A) o 1 apresenta as variaes mais significativas de pluviosidade e temperatura, indicando um
clima equatorial mido.
(B) o 2 apresenta uma relao direta entre pluviosidade e temperatura, indicando um clima com
veres quentes e midos.
(C) o 3 apresenta uma relao inversa entre pluviosidade e temperatura, indicando um clima com
invernos midos.
(D) o 1 e o 2 apresentam condies de considervel pluviosidade nos meses de temperaturas mais
altas.
(E) o 2 e o 3 indicam variaes significativas de pluviosidade e temperatura, com estaes definidas
para ambos.

UFRGS CV/2014 GEO

23

270

58. Observe abaixo a figura do continente


africano com os pases identificados pelos
nmeros de 1 a 5.

59. Considere as seguintes afirmaes sobre o


ambiente antrtico.
I - Glaciar a designao dada ao gelo
formado pela acumulao de camadas de
neve, transformadas em gelo, devido
presso causada pelo peso.
II - Na Antrtica, esto, aproximadamente,
60% das reservas de gua doce do
planeta, e a borda de sua base, em
contato com a gua aquecida dos
oceanos, ocasiona o derretimento do
gelo.

Fonte: <http://www.gangamacota.blogspot.com.br/
2012/03/africa-mapa-sem-escala-paracolorir.html>. Acesso em: 23 set. 2013.

No bloco superior abaixo, esto listados


pases do continente africano; no inferior, a
paisagem desses pases.
Associe adequadamente o bloco inferior ao
superior.
(1)
(2)
(3)
(4)
(5)

III- O grande fluxo de turistas para o


continente antrtico pode levar doenas
desconhecidas populao e fauna
local.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.

Nambia
Egito
Congo
Uganda
Zmbia

(C) Apenas III.


(D) Apenas I e II.
(E) I, II e III.

( ) A alta nebulosidade que se desenvolve


sobre este pas, em virtude da insolao
intensa, propicia o desenvolvimento de
uma floresta tropical bastante biodiversa.
( ) As guas frias do oceano, neste pas,
dificultam a formao de nuvens, criando
condies para o surgimento de um
deserto litorneo.
( ) Este pas, famoso pela paisagem
desrtica, tem 95% de seu territrio
coberto por areias, em que a amplitude
trmica grande, oscilando entre 50 oC
durante o dia e -5 oC noite.
( ) O clima, neste pas, amenizado pela
altitude e alterna estao chuvosa e seca.
Tal caracterstica justifica a cobertura de
savanas sobre a maior parte do territrio,
que abriga grande variedade de animais.
A sequncia correta de preenchimento dos
parnteses, de cima para baixo,
(A)
(B)
(C)
(D)
(E)

3
4
3
5
2

2
5
1
1
1

5
3
2
2
5

1.
1.
5.
3.
4.
UFRGS CV/2014 GEO

24

271

61. Considere as seguintes afirmaes em relao


ocorrncia dos desertos.

60. Observe a charge abaixo.

I - A presena dos ventos alsios nas zonas


tropicais determinante para a ocorrncia
de desertos.
II - As correntes frias ocenicas, a exemplo
das correntes de Humboldt e Benguela,
contribuem para as formaes desrticas
do Atacama e da Nambia.
III- A presena dos ventos das Mones a
causa principal da formao desrtica do
Saara, o maior deserto do planeta.
Quais esto corretas?
Adaptado de: <http://raesidecartoon.com/dbtest/
index.php?com=default&o=0&i=2961&category=
16#image>. Acesso em: 15 set. 2013.

(A)
(B)
(C)
(D)
(E)

Com relao ao tema apresentado na charge,


considere as seguintes afirmaes.
I - A alterao de habitats, provocada pela
expanso urbana, no oferece riscos s
espcies, uma vez que os animais
conseguem adaptar-se a essa nova
condio.

Apenas I.
Apenas II.
Apenas III.
Apenas II e III.
I, II e III.

62. Considere as seguintes afirmaes sobre os


problemas ambientais dos oceanos.

II - Recentes casos, veiculados na mdia,


sobre animais selvagens circulando em
reas urbanizadas podem ser explicados
pela alterao e degradao do seu
habitat original.
III- A expanso das reas urbanas e a
ampliao desordenada das fronteiras
agropecurias dentro de reas nativas
levam alterao da biodiversidade,
podendo causar a extino de espcies
encontradas apenas nesse habitat.
Quais esto corretas?
(A) Apenas II.

I - As grandes extenses dos oceanos reduzem


a concentrao dos poluentes, oriundos de
atividades humanas, no oferecendo riscos
significativos fauna marinha.
II - A pesca predatria em escala industrial
retira do mar milhares de toneladas de
peixes sem nenhum controle quanto
seleo das espcies e poca de
reproduo, podendo levar cardumes
inteiros ao desaparecimento.
III- O vazamento de petrleo pode ocorrer
em navios petroleiros, nas plataformas de
extrao e nos oleodutos de distribuio,
causando danos enormes ao ecossistema
marinho.
Quais esto corretas?

(B) Apenas I e II.

(A)
(B)
(C)
(D)
(E)

(C) Apenas I e III.


(D) Apenas II e III.
(E) I, II e III.

UFRGS CV/2014 GEO

Apenas I.
Apenas II.
Apenas III.
Apenas II e III.
I, II e III.

25

272

63. Observe a figura abaixo.

Desmatamento na regio dos formadores do rio Xingu

Adaptado de: <http://www.socioambiental.org>. Acesso em: 21 set. 2013.

Legenda:
Estimulada pelos altos preos internacionais e pela poltica de crdito agrcola, a atividade que mais
contribui para o desmatamento desta regio a
(A) lavoura de arroz.
(B) lavoura de soja.
(C) pecuria bovina de corte.
(D) lavoura de cana de acar.
(E) produo de uva para produo de vinhos.
UFRGS CV/2014 GEO

26

273

64. Leia o segmento abaixo.


A floresta precisa ter valor em p. Este era o
mantra da gegrafa poltica Bertha Becker,
que faleceu no ltimo dia 13, sbado, aos 83
anos, deixando um legado de quase meio
sculo de estudos sobre a Amaznia. Para
Bertha, era preciso pensar o desenvolvimento
da floresta, no apenas sua preservao; dar
motivos para aqueles que enriquecem, ou
simplesmente tiram seu sustento da mata,
quererem preserv-la.

65. Leia o trecho extrado do vdeo A Histria das


Coisas, produzido por Annie Leonard.

Adaptado de: <http://oglobo.globo.com/amanha/


bertha-becker-deixa-legado-sobre-desenvolvimentoda-amazonia-em-pe-9140213#ixzz2fH7OcZhU>.
Acesso em: 18 set. 2013.

Sobre o desenvolvimento econmico


Amaznia, assinale a alternativa correta.

da

(A) O potencial dos cursos fluviais nunca foi


aproveitado como recurso energtico,
devido ao relevo extremamente plano da
regio.
(B) A inexistncia de institutos de pesquisa na
regio comprometeu a explorao de
seus recursos minerais.
(C) As atividades econmicas desenvolveramse sem impactos significativos ao
ambiente, uma vez que a floresta
Amaznica ainda bastante extensa,
cobrindo pouco menos que a metade do
territrio brasileiro.
(D) A integrao da Amaznia economia
nacional
baseou-se
nas
atividades
agrcolas e minerais que promoveram o
desenvolvimento sustentvel da regio.
(E) A Amaznia tem uma contribuio
significativa nas atividades de extrao e
transformao mineral, porm essas
atividades
tm
desterritorializado
as
populaes tradicionais e degradado o
ambiente.

UFRGS CV/2014 GEO

Onde eu vivo, nos Estados Unidos, resta-nos


menos de 4% da nossa floresta original, 40%
dos cursos de gua esto imprprios para o
consumo. E o nosso problema no apenas
estarmos utilizando demasiados recursos, mas
o fato de estarmos utilizando mais do que a
nossa parte. Temos 5% da populao
mundial, mas usamos 30% dos recursos
mundiais. Se todos consumissem ao ritmo dos
Estados Unidos, precisaramos de 3 a 5
planetas. E sabe de uma coisa: s temos um!
Fonte: A Histria das Coisas. Disponvel em:
<http://www.youtube.com/watch?v=
7qFiGMSnNjw>. Acesso em: 17 set. 2013.

Sobre o padro de consumo de pases como


os Estados Unidos e sua relao com a
explorao da natureza, correto afirmar que
(A) os Estados Unidos possuem recursos
prprios em quantidade suficiente para
atender suas necessidades, o que torna o
padro de consumo estadunidense
sustentvel.
(B) o modelo de consumo estadunidense no
impacta os recursos mundiais, uma vez
que existem pases que no tm esse
mesmo padro de consumo.
(C) o padro de consumo estadunidense,
para atingir uma economia sustentvel,
deve ser disseminado entre os diferentes
povos.
(D) o padro de consumo estadunidense
evidencia uma relao socioambiental de
uso predatrio da natureza, tornando-se
insustentvel.
(E) os pases em desenvolvimento podem
alcanar o atual padro estadunidense
sem riscos ao ambiente.

27

274

66. A frica comeou a ser mais intensamente explorada pelas naes europeias nos fins do sculo XIX,
por liderana do Rei Leopoldo II, da Blgica, em busca dos produtos da floresta tropical. Ao sul,
metais nobres e diamantes motivaram a forte presena da colonizao inglesa, que se arrastou por
quase todo o sculo XX.
O texto acima diz respeito
(A)
(B)
(C)
(D)
(E)

ao processo de descolonizao do continente africano.


ao momento mais intenso da escravizao.
ao processo da partilha do continente africano.
ao domnio luso-espanhol no continente africano.
integrao do continente africano ao processo de industrializao.

67. A populao do Estado do Rio Grande do Sul foi a que menos cresceu nos ltimos dez anos no pas,
de acordo com dados do Censo 2010. De 2000 a 2010, o crescimento populacional mdio do Estado
ficou em 0,49% ao ano. A mdia brasileira anual foi de 1,17% na ltima dcada.
Observe, abaixo, o mapa da Taxa Geomtrica de Crescimento Anual da populao 2000-2010.

Disponvel em: <http://www.scp.rs.gov.br/atlas/conteudo.asp?cod_menu_filho=808&cod_menu=


805&tipo_menu=POPULA&cod_conteudo=1400>. Acesso em: 18 set. 2013.

Sobre a dinmica do crescimento populacional dos municpios do Rio Grande do Sul, possvel afirmar que
(A) muitos municpios localizados na poro oeste do Estado j experimentam o decrscimo da sua
populao.
(B) todos os municpios do Estado apresentam crescimento abaixo da taxa nacional.
(C) o Rio Grande do Sul apresenta-se bastante homogneo no que se refere ao crescimento da
populao, que acontece lentamente em todos os municpios do Estado.
(D) os municpios do leste do Estado esto crescendo mais lentamente do que os demais.
(E) os municpios com maior crescimento populacional localizam-se nas reas litorneas.
UFRGS CV/2014 GEO

28

275

68. Observe o quadro abaixo.


Taxa mdia geomtrica de crescimento anual (%) da populao residente
Brasil e grandes regies, 1980/1991, 1991/2000 e 2001/2005
Pas/Regies
1980/1991
1991/2000
2001/2005
Brasil
1,93
1,64
1,67
Norte
3,85
2,86
2,64
Nordeste
1,83
1,31
1,36
Sudeste
1,77
1,62
1,66
Sul
1,38
1,43
1,46
Centro-Oeste
3,01
2,39
2,31
Fonte: IBGE: Censo Demogrfico 1980, 1991 e 2000 e Estimativas Demogrficas 2001 e 2005.

Considere as seguintes afirmaes sobre a taxa mdia geomtrica de crescimento anual da


populao residente no Brasil.
I - As regies Nordeste, Sudeste e Sul apresentaram um pequeno aumento na taxa de crescimento;
as regies Centro-Oeste e Norte apresentaram um declnio na mesma taxa no perodo de
1991/2000 a 2001/2005.
II - As regies Norte e Centro-Oeste apresentaram os valores mais elevados nos trs perodos,
refletindo atividades de expanso econmica, atrativas de influxos migratrios.
III- A regio Nordeste apresentou a menor taxa de crescimento desde a dcada de 1980, devido
diminuio dos nveis de fecundidade e, principalmente, diminuio da emigrao para outras
regies do pas.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas
Apenas
Apenas
Apenas
Apenas

I.
II.
I e II.
I e III.
II e III.

69. Considere o grfico abaixo sobre a distribuio da populao brasileira em grandes grupos de idade (%).

Fonte: IBGE, Censo Demogrfico de 1980, 1991, 2000 e 2010, e Contagem da Populao 1996.

Sobre a dinmica desses trs grupos populacionais, correto afirmar que


(A) o grupo de pessoas entre 15 e 64 anos est encolhendo, pois o de idosos est aumentando.
(B) a parcela de jovens entre 0 e 14 anos menor, porm isso no se reflete em um aumento do
grupo entre 15 e 64 anos de idade.
(C) o nmero de pessoas por grupo de idade no se alterou, exceto o do grupo entre 0 e 14 anos.
(D) o decrscimo da qualidade de vida do brasileiro explica a diminuio do nmero de pessoas
entre 0 e 14 anos.
(E) o aumento da expectativa de vida est relacionado ao crescimento do grupo de adultos e idosos no Brasil.
UFRGS CV/2014 GEO

29

276

70. Sobre as relaes de consumo que se


estabelecem na atualidade, considere as
seguintes afirmaes.

72. Considere o segmento abaixo, a respeito do


Plano Diretor de uma cidade.

I - A reserva de mercado exclusivamente


para os produtos nacionais uma
consequncia da economia globalizada.
II - Uma das funes do crdito, no modelo
capitalista de consumo, permitir s pessoas
de baixo poder aquisitivo o acesso a bens de
consumo, muitas vezes acarretando o
comprometimento de sua renda futura.
III- O atual modelo de consumo mundial
exerce forte presso sobre a natureza,
devido demanda por matrias-primas.
Quais esto corretas?
(A) Apenas I.
(B) Apenas I e II.

Segundo a Associao Brasileira de Normas


Tcnicas (ABNT), o Plano Diretor de uma
cidade instrumento bsico de um processo
de
planejamento
municipal
para
a
implantao da poltica de desenvolvimento
urbano. Em uma sociedade desigual como a
brasileira, o resultado do planejamento
urbano e a sua execuo geraram uma srie
de insatisfaes na populao.
Assinale com V (verdadeiro) ou F (falso) as
afirmaes abaixo, sobre os resultados da
aplicao do Plano Diretor como causa das
demandas de mobilidade urbana.
( ) A criao de bairros funcionais, a exemplo
dos comerciais, residenciais, mistos e
industriais, aumenta a necessidade de
deslocamentos e o uso de transporte
pblico.

(C) Apenas I e III.


(D) Apenas II e III.
(E) I, II e III.
71. A manchete e a imagem abaixo retratam uma
cena que se repete cotidianamente na BR
116, estrada que liga Porto Alegre/RS a
municpios da regio metropolitana.

( ) O desequilbrio do uso dos equipamentos


urbanos, a valorizao e o uso do solo
urbano evitam a criao de centros e
periferias.
( ) O estmulo ao transporte pblico em vias
principais promove um maior deslocamento
das pessoas.

Congestionamentos aumentam nos


dois sentidos da BR-116

( ) O estmulo ao transporte coletivo, atravs


de malha abrangente e rpida, evita o
transporte individual.
A sequncia correta de preenchimento dos
parnteses, de cima para baixo,
(A) V V F F.
Disponvel em: <http://www.jornalvs.com.br/tudotrancado/470334/congestionamentos-aumentam-nosdois-sentidos-da-br-116.html>. Acesso em: 18 set. 2013.

Entre os inmeros fatores que causam essa


situao, pode-se destacar o fluxo de pessoas
residentes em outros municpios que se
deslocam, diariamente, para trabalhar ou
estudar na capital. Esse movimento
denominado
(A)
(B)
(C)
(D)
(E)

(B) F V F V.
(C) V F V F.
(D) F F V F.
(E) V V F V.

xodo rural.
migrao pendular.
transumncia.
emigrao.
xodo urbano.
UFRGS CV/2014 GEO

30

277

73. O leilo do Campo de Libra, na Bacia de


Campos, na costa brasileira, concede reas
para explorao de petrleo e gs natural na
regio do pr-sal, sob o regime de partilha de
produo.

75. No bloco superior abaixo, esto listadas


quatro orientaes de ventos; no inferior, trs
situaes decorrentes da ocorrncia desses
ventos.

A esse respeito, considere as seguintes


afirmaes.

Associe adequadamente o bloco inferior ao


superior, a partir da cidade de Porto Alegre,
de sua bacia hdrica e do Lago Guaba.

I - A Petrobrs ser a nica operadora de


todos os campos, mesmo sob o regime de
partilha de produo.

(1) Vento Sul

II - A expectativa que a rea de Libra seja a


maior reserva de petrleo j descoberta
no pas.

(3) Vento Leste

III- Os setores de educao e sade recebero


os royalties dos novos contratos da Unio.

( ) Represamento das guas em tempo de


enchentes

Quais esto corretas?

( ) Brisa martima nos meses de janeiro e


fevereiro

(A) Apenas I.

( ) Ventos quentes carregados de umidade


nos meses de vero

(B) Apenas II.

(2) Vento Norte


(4) Vento Oeste

A sequncia correta de preenchimento dos


parnteses, de cima para baixo,

(C) Apenas III.


(D) Apenas II e III.
(E) I, II e III.

(A) 1 3 2.
(B) 1 2 3.

74. A poro interior da Regio Nordeste do Brasil


vem sofrendo transformaes significativas na
produo agrcola, a exemplo

(C) 4 3 1.
(D) 2 1 4.
(E) 3 4 2.

(A) do fumo para o mercado nacional.


(B) da cana-de-acar para a produo de
polmeros.
(C) da uva para a produo de vinho tipo
exportao.
(D) da laranja para a produo de suco.
(E) do eucalipto para a produo de celulose.

UFRGS CV/2014 GEO

31

278

2011
HISTRIA
01. Na frica, durante a Antiguidade, entre
3.000 a.C. e 332 a.C., desenvolveu-se o
primeiro Imprio unificado historicamente
conhecido, cuja longevidade e continuidade
ainda despertam a ateno de arquelogos
e historiadores.

03. A Idade Mdia tambm foi denominada o


tempo das catedrais. Data deste perodo da
Histria a construo da catedral de Burgos,
na Espanha, reproduzida na figura abaixo.

Esse Imprio
(A) legou

humanidade
compilaes de leis.

cdigos

(B) desenvolveu
a
escrita
alfabtica,
dominada por amplos setores da
sociedade.
(C) retinha
parcela
insignificante
excedente econmico disponvel.

do

(D) sustentou a crena de que o carter


divino
dos
reis
se
transmitia
exclusivamente pela via paterna.
(E) dependia das cheias do rio Nilo para a
prtica da agricultura.
02. Durante a Repblica Romana, a escravido
aumentou consideravelmente sua importncia na
sociedade e na economia, contribuindo para a
crescente dependncia da Repblica Romana em
relao mo de obra escrava.
A dependncia da mo de obra escrava na
Repblica Romana devia-se
(A) expanso das grandes propriedades e ao
aniquilamento da pequena propriedade rural.
(B) s guerras de conquista empreendidas por
Roma, as quais contriburam decisivamente
para o predomnio dessa relao de trabalho.
(C) inexistncia de mo de obra livre e ao
desinteresse da populao pelos trabalhos
manuais.

O estilo arquitetnico da catedral de Burgos o


(A) renascentista.
(B) romnico.
(C) gtico.
(D) barroco.
(E) moderno.

(D) aos conflitos entre patrcios e plebeus na


luta pela terra.
(E) necessidade de ampliao da oferta de
mo de obra para o desenvolvimento do
artesanato.

UFRGS CV/2011 HIS

279

04. A chegada de Cristvo Colombo ao


continente americano, em 1492, a servio da
Espanha, um fato significativo na Histria.

06. Assinale com V (verdadeiro) ou F (falso) as


afirmaes abaixo, referentes ao perodo das
invases holandesas no Nordeste brasileiro.

Considere as afirmaes abaixo, a respeito


dos fatores que possibilitaram a viagem de
Cristvo Colombo em 1492.
I - Esta viagem constituiu-se em um
desdobramento da expanso portuguesa
iniciada no sculo XV.
II - Esta viagem foi resultado dos esforos
conjuntos de Espanha e de Portugal nas
navegaes.
III- Cristvo
Colombo
valeu-se
dos
conhecimentos nuticos e cartogrficos dos
portugueses para empreender suas viagens.
Quais esto corretas?
(A) Apenas I.

( ) A motivao principal das invases


batavas ao Brasil est relacionada
conjuntura da Unio Ibrica, que fez com
que os adversrios da Espanha se
tornassem hostis a Portugal.
( ) O ataque s regies produtoras de
acar, inicialmente na Bahia e depois em
Pernambuco,
foi
realizado
pela
Companhia das ndias Orientais.
( ) Em funo do desenvolvimento urbano e
de uma poltica conciliadora entre lusobrasileiros e batavos, o governo de
Nassau considerado a "idade de ouro"
do domnio holands na Amrica.
( ) A chamada Restaurao Pernambucana
foi uma consequncia do processo de
endividamento dos lavradores de cana
luso-brasileiros com o governo holands.

(B) Apenas II.


(C) Apenas III.
(D) Apenas I e III.
(E) I, II e III.

A sequncia correta de preenchimento dos


parnteses, de cima para baixo,

05. A partir da impresso em metal, concebida pelo


alemo Gutenberg, comeam a multiplicar-se os
textos e obras literrias.

(A) V F V V.

A esse respeito, considere as seguintes


afirmaes.

(C) F V V F.

I - A imprensa permitiu a difuso da Bblia


em lnguas vernaculares, reduzindo o
papel desempenhado pelo clero.

(B) V F F V.

(D) F F V V.
(E) V V F F.

II - Na obra Don Quijote de La Mancha,


Miguel de Cervantes criou uma stira aos
ideais da cavalaria medieval.
III- Lus Vaz de Cames, em sua obra Os
Lusadas, inspirada na viagem de Vasco da
Gama,
narra
os
feitos
martimos
portugueses.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas I.
Apenas II.
Apenas III.
Apenas I e II.
I, II e III.

UFRGS CV/2011 HIS

280

07. Observe, no mapa abaixo, as principais rotas


do trfico negreiro para o Brasil.

08. Leia o texto abaixo.


Os ilhos, huma vez que as Missoens nam se
desocuparam, j se accomodam & alguns athe
tornaram-se grandes proprietrios & abastados
fazendeiros. J nam querem mais voltar para o
Archipelago, apezar de jamais esquecerem os
padecimentos sem conta que passaram.

15
Cacheu

Bissau

Rota da Alta Guin

Costa
da Mina
0
So Reino de
Tom Loango

Rota da Costa da Mina

Belm
So Luis
Recife

ASSIS BRASIL, Luiz Antnio. Um quarto de lgua


em quadro. 5. ed. Porto Alegre: Movimento,
1986. p. 190.

Luanda

Rota de Angola

Salvador

Benguela 15

A partir da leitura do texto, considere as


afirmaes abaixo.

OCEANO
ATLNTICO

Rio de Janeiro
Santos

30

I - O autor refere-se imigrao aoriana


para o Rio Grande do Sul no sculo XVIII.

Rota do Prata
Colnia

Buenos
Aires

L
S

II - As dificuldades econmicas impossibilitaram


qualquer processo de mobilidade social.

900

0
Km

60

45

30

15

III- O foco principal da corrente migratria


dirigiu-se para a regio missioneira.

ALENCASTRO, Luiz Felipe de. O trato dos viventes. So


Paulo: Companhia das Letras, 2000. p. 250.

A esse respeito, considere as seguintes


afirmaes.

Quais esto corretas?


(A) Apenas I.

I - A rota da Alta Guin trazia escravos das


regies dos atuais Senegal, Guin-Bissau
e Serra Leoa para o denominado Estado
do Gro-Par e do Maranho.

(B) Apenas II.

II - A rota da Costa da Mina trazia escravos


das regies dos atuais Gana, Benin e
Nigria, para as capitanias setentrionais e
meridionais da Amrica portuguesa.

(E) I, II e III.

III- A rota de Angola trazia escravos para a


capitania fluminense com ramificaes
que levavam ao esturio platino.

(C) Apenas I e III.


(D) Apenas II e III.

09. A Guerra dos Sete Anos (1756-1763) conferiu


Inglaterra a condio de principal potncia
martima da Europa.
Esse conflito

Quais esto corretas?

(A) possibilitou a recuperao econmica da


Inglaterra.

(A) Apenas I.

(B) foi travado entre potncias imperiais,


tendo desdobramentos em territrios
americanos.

(B) Apenas II.


(C) Apenas I e III.

(C) decorreu da rivalidade entre Inglaterra e


Portugal.

(D) Apenas II e III.

(D) contou com expressiva participao de


escravos africanos nas disputas.

(E) I, II e III.

(E) foi encerrado com


Tratado de Londres.

UFRGS CV/2011 HIS

assinatura

do

281

10. Leia o texto abaixo.

11. Observe, no mapa abaixo, a regio platina.

Os direitos humanos s se tornam


significativos quando ganham contedo
poltico. No so os direitos de humanos num
estado de natureza: so os direitos de
humanos em sociedade. No so apenas
direitos humanos em oposio aos direitos
divinos, ou direitos humanos em oposio aos
direitos animais: so os direitos humanos vis-vis uns aos outros.

IGUAU

RIO GRANDE
DO SUL
IBICU

URUGUAI

PARAN

OCEANO
ATLNTICO
JACU

QUARA

PORTO ALEGRE

LAGOA DOS PATOS


SALTO
RIO GRANDE

HUNT, Lynn. A inveno dos direitos humanos :


uma histria. So Paulo: Companhia das
Letras, 2009.

Os
trs
documentos
histricos
que
fundamentam a gnese do princpio e da
prtica dos direitos humanos so
(A) o Bill of Rights, a Declarao dos Direitos
do Homem e do Cidado e a Declarao
Universal dos Direitos Humanos.
(B) o Bill of Rights, a Declarao dos Direitos
do Povo Trabalhador e Explorado e a
Declarao
Universal
dos
Direitos
Humanos.
(C) a Declarao de Independncia dos
Estados Unidos da Amrica, a Declarao
dos Direitos do Homem e do Cidado e a
Declarao Universal dos Direitos do
Homem.

PAYSAND

NEGRO

MELO

NDIA MUERTA
FORTE DE SANTA TERESA
BANDA ORIENTAL
COLONIA
RIO DA PRATA
BUENOS AIRES

MALDONADO

MONTEVIDU

POVOAES
INTERVENO 1811
INTERVENO 1816

80
km

Adaptado de: MIRANDA, Mrcia E. A Estalagem e o


Imprio. So Paulo: Hucitec, 2009. p. 123.

Sobre
as
intervenes
luso-brasileiras
ocorridas na Banda Oriental durante o perodo
joanino, so feitas as seguintes afirmaes.
I - O vice-rei Francisco Elio, sitiado em
Montevidu pelas tropas artiguistas,
declarou guerra Corte portuguesa em
1811, provocando a invaso das foras
militares lusitanas.

(D) a Declarao de Independncia dos


Estados Unidos da Amrica, a Declarao
dos Direitos do Povo Trabalhador e
Explorado e a Declarao Universal dos
Direitos do Homem.

II - A interveno em 1816 justificava-se pela


necessidade de se defender o Rio Grande
do Sul e de se reestabelecer a
tranquilidade dos proprietrios rurais,
ameaada pelas reformas sociais de
Artigas.

(E) a Declarao de Independncia dos


Estados Unidos da Amrica, a Declarao
dos Direitos do Homem e do Cidado e a
Declarao
do
Direito
do
Povo
Trabalhador e Explorado.

III- Na primeira interveno, as foras


militares estacionaram em Maldonado; na
segunda, alcanaram a capital oriental,
recebendo apoio do Cabildo local.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.

UFRGS CV/2011 HIS

282

12. O cargo de juiz de paz teve suas funes


regulamentadas pelo Cdigo de Processo
Criminal de 1832. Esses juzes representavam o
liberalismo brasileiro durante o perodo regencial.

14. Considere o enunciado abaixo e as quatro


propostas para complet-lo.
Durante o sculo XIX, as relaes entre Brasil
e Inglaterra foram marcadas por diversos
momentos de tenso. A denominada Questo
Christie levaria ao rompimento diplomtico
entre os dois pases em 1863.

Esses magistrados eram


(A) nomeados diretamente pelo Imperador,
exercendo as funes de chefe de polcia.

Entre as causas que motivaram o desgaste e a


ruptura diplomtica, correto citar

(B) designados diretamente pelo ministro da


Justia, exercendo as funes de
promotor pblico.

1 - a negativa de renovao dos tratados


comerciais que beneficiavam a Inglaterra.
2 - a manuteno das relaes econmicas
com os Estados Unidos.
3 - a participao brasileira na interveno
contra o governo colorado no Uruguai.
4 - o naufrgio do navio ingls Prince of
Wales no litoral do Rio Grande do Sul.

(C) eleitos pelos cidados para exercer


funes conciliatrias e de qualificao
eleitoral.
(D) eleitos pelos deputados gerais para
administrar os bens dos rfos e de
pessoas ausentes.
(E) indicados pelo presidente provincial para
pacificar os conflitos pela terra.

Quais propostas esto corretas?


(A)
(B)
(C)
(D)
(E)

13. Leia o texto abaixo.


Conhea o Brasil que o dia 20 de setembro de
1835 foi a consequncia inevitvel de uma m e
odiosa administrao; e que no tivemos outro
objeto, e no nos propusemos a outro fim que
restaurar o imprio da lei, afastando de ns um
administrador inepto e faccioso, sustentando o
trono constitucional do nosso jovem monarca e a
integridade do Imprio. (Manifesto de 25 de
setembro de 1835)

Apenas
Apenas
Apenas
Apenas
Apenas

1.
2.
1 e 3.
1 e 4.
2, 3 e 4.

15. Assinale com V (verdadeiro) ou F (falso) as


afirmaes abaixo, referentes aos propsitos e
consequncias da Lei Saraiva (1881), que
estabeleceu a eleio direta no Brasil Imperial.

Coletnea de documentos de Bento Gonalves da


Silva. Porto Alegre: Arquivo Histrico do Rio
Grande do Sul, 1985. p. 269.

Em relao ao manifesto acima, correto


afirmar que
(A) os farroupilhas defendiam, desde o
primeiro momento, o iderio republicano
e separatista.
(B) os revoltosos desejavam antecipar a posse
de Dom Pedro II, ainda menor de idade.
(C) a revolta foi motivada pelo desejo dos
farroupilhas de reintegrar a provncia ao
Imprio brasileiro.
(D) os revoltosos estavam contrariados com o
governo do presidente provincial.
(E) os farroupilhas representavam os ideais
conservadores, manifesto na defesa do
"imprio da lei".
UFRGS CV/2011 HIS

( ) A lei objetivava reduzir a participao


poltica da populao de baixa renda.
( ) A lei determinou a proibio do voto dos
analfabetos, excluindo-os do processo
eleitoral.
( ) A lei mantinha a exigncia censitria, pois
os eleitores tinham que ter uma renda
mnima.
( ) A lei possibilitou a ampliao da cidadania
poltica.
A sequncia correta de preenchimento dos
parnteses, de cima para baixo,
(A)
(B)
(C)
(D)
(E)

V
V
F
F
V

F
F
V
V
V

V
F
V
F
V

F.
V.
F.
V.
F.

283

16. Considere as afirmaes abaixo, referentes


denominada "poltica das salvaes" ocorrida
durante o governo de Hermes da Fonseca
(1910-1914).

18. Observe a charge abaixo.

I - O "salvacionismo" realizou uma sistemtica


interveno nos estados, promovendo a
substituio
dos
grupos
oligrquicos
dominantes por interventores militares.
FAUSTO, Bris. Getlio Vargas : o poder e o sorriso.
So Paulo: Companhia das Letras, 2006.

II - Uma das causas dessa poltica foi o


crescimento do poder do senador gacho
Pinheiro Machado, que tinha sob sua
influncia diversas oligarquias regionais.

Esta charge, inspirada em uma marcha de


carnaval interpretada por Francisco Alves, faz
referncia

III- As "salvaes" foram realizadas somente


em estados de pequena projeo poltica,
na sua maioria situados no Sudeste.

(A) ascenso de Getlio Vargas ao poder,


aps o golpe do Estado Novo.
(B) ao trmino do Estado Novo com a
destituio de Getlio Vargas.
(C) volta de Getlio Vargas ao poder, aps
o governo de Eurico Dutra.
(D) eleio de Getlio Vargas como
governador do Rio Grande do Sul, aps a
redemocratizao.
(E) reeleio de Getlio Vargas como
presidente, aps o governo JK.

Quais esto corretas?


(A)
(B)
(C)
(D)
(E)

Apenas I.
Apenas II.
Apenas I e III.
Apenas II e III.
I, II e III.

17. Um golpe militar na Espanha, comandado por


Francisco
Franco,
contra
o
governo
republicano iniciou um grande conflito: a
Guerra Civil Espanhola (1936-1939).
Considere as afirmaes abaixo, sobre essa
guerra.

19. Com o trmino da Segunda Guerra Mundial


(1939-1945), a geopoltica global nunca mais foi
a mesma. No caso do Oriente Mdio, a
Organizao das Naes Unidas (ONU) decidiu
pela partilha da Palestina e pela criao de dois
estados, um judeu e outro rabe.

I - Ela apresentou um carter fortemente


ideolgico e revolucionrio com atuao
das Brigadas Internacionais em apoio
Repblica.
II - Ela permitiu que a Alemanha, atravs da
Legio Condor, testasse seus armamentos
e tticas contra os republicanos.
III- Ela favoreceu Francisco Franco, graas
poltica
de
no-interveno
da
Inglaterra e da Frana.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas I.
Apenas III.
Apenas I e II.
Apenas II e III.
I, II e III.

Considere as afirmaes abaixo, sobre os


conflitos no Oriente Mdio.
I - Os conflitos, apesar de sua repercusso
internacional, tiveram como caracterstica
o fato de apresentar implicaes locais.
II - Devido polarizao decorrente da
Guerra Fria, somente a Unio Sovitica se
manifestou favoravelmente criao do
Estado de Israel.
III- No dia seguinte criao do Estado de
Israel, aps o trmino do mandato
Britnico na Palestina, tropas dos pases
rabes vizinhos invadiram a regio,
ocasionando a imediata reao israelense.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas I.
Apenas II.
Apenas I e III.
Apenas II e III.
I, II e III.

UFRGS CV/2011 HIS

284

20. A denominada "Campanha da Legalidade",


ocorrida no Rio Grande do Sul no final de
agosto de 1961, foi uma consequncia da

22. Observe a imagem abaixo.

(A) renncia do presidente Jnio Quadros,


que provocou a mobilizao poltica para
garantir a posse do vice-presidente Joo
Goulart.
(B) vitria
eleitoral
do
PTB,
que
supostamente ameaava os setores
conservadores da sociedade brasileira.
(C) renncia
do
presidente
Juscelino
Kubitschek, fato que provocou uma
extensa mobilizao militar visando
garantir a posse de Joo Goulart.

GASPARI, Elio. A ditadura escancarada. So Paulo:


Companhia das Letras, 2002.

Essa imagem fazia parte da propaganda


oficial durante o regime militar e est
associada ao governo do presidente

(D) vitria eleitoral do PSD, partido que tinha


em seus quadros diversos elementos
supostamente golpistas.

(A) Humberto Castelo Branco (1964-1967).

(E) poltica promovida por Leonel Brizola, que


queria impedir a tomada do poder pelos
grupos ligados luta armada.

(B) Arthur da Costa e Silva (1967-1969).


(C) Emlio Mdici (1969-1974).
(D) Ernesto Geisel (1974-1979).
(E) Joo Figueiredo (1979-1985).

21. Sejamos realistas, que se pea o impossvel.


A frase acima, eternizada nos muros de Paris
em maio de 1968, foi escrita durante a
radicalizao do movimento contestatrio,
quando as ruas da capital francesa foram
transformadas em cenrio de uma guerra
civil.

23. A redemocratizao no Brasil, aps a Segunda


Guerra Mundial, balizada por duas
Constituies Federais: a de 1946 e a de 1988.

A respeito desse acontecimento, correto


afirmar que ele
(A) constituiu um movimento exclusivamente
de estudantes que contestavam os
valores de uma sociedade autoritria.

Nesses 42 anos entre a promulgao das duas


cartas, diversos episdios cruciais interferiram
na normalidade poltico-institucional. Estes
episdios foram
(A) o atentado a Carlos Lacerda, o
contragolpe do General Henrique Lott e o
impeachment de Fernando Collor.

(B) contou com a solidariedade do operariado


francs que deflagrou uma greve geral.

(B) o suicdio de Getlio Vargas, a renncia


de Jnio Quadros e o fechamento poltico
com o AI-5.

(C) esteve restrito a Paris, sendo um


fenmeno isolado sem repercusso em
outros pases.

(C) o golpe do Estado Novo, a Revolta dos


Sargentos e a morte de Tancredo Neves.

(D) configurou-se como uma resposta do


operariado frente situao de crise
econmica da Frana.
(E) provocou muitas mortes decorrentes dos
grandes motins e combates nas ruas da
capital francesa.
UFRGS CV/2011 HIS

(D) a extino do partido Comunista, a


implantao do pluripartidarismo e a
reeleio do presidente da Repblica.
(E) a eleio de Joo Goulart para presidente,
a indicao de Emlio Mdici para
substituir Ernesto Geisel e a implantao
do parlamentarismo.
9

285

24. Leia o texto abaixo.


De qualquer ponto que se esteja em Tijuana
se v o paredo metlico de cinco metros de
altura. O mesmo acontece em Mexicali,
Sonoita, Nogales, gua Prieta, Ciudad Juarez,
Ojimaga, Ciudad Acua, Piedras Negras,
Nuevo Laredo, Reynosa e Matamoros. Ao todo
so mais de 3 mil quilmetros de chapas de
ferro e cimento, postes com luzes, cmaras e
sensores eletrnicos.

25. A sigla BRIC um acrnimo que se refere ao


Brasil, Rssia, ndia e China, pases que
se destacaram no cenrio mundial pelo rpido
crescimento de suas economias.

"Lourinha Americana" (Mestre Laurentino). Por


Pouco. / Mundo Livre S/A, 2000.

Considere as afirmaes abaixo, referentes s


motivaes que levaram construo desse
paredo metlico.
I - A construo teve incio em 1994 como
parte do programa Operao Guardio do
governo dos Estados Unidos da Amrica.
II - O objetivo dessa construo foi impedir a
entrada de imigrantes ilegais em territrio
norte-americano, sobretudo mexicanos e
centro-americanos.

A respeito desses pases, correto afirmar que


(A) o PIB da China, atualmente, o segundo
do mundo, tendo superado o Japo
recentemente.
(B) os quatro pases, em conjunto, possuem
atualmente 25% da populao mundial.
(C) Brasil e China so membros permanentes
do Conselho de Segurana das Naes
Unidas.
(D) a ndia ter a menor mdia de
crescimento econmico entre os pases
que compem o BRIC, devido sua
grande populao.
(E) o Brasil ser uma das grandes potncias
militares, dado seu engajamento na
corrida armamentista.

III- A construo desse paredo faz parte de


um programa federal norte-americano
para conter a ao de narcotraficantes na
fronteira.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e II.
(E) I, II e III.

10

UFRGS CV/2011 HIS

286

2012
HISTRIA
01. Considere o enunciado abaixo e as trs
propostas para complet-lo.

03. Diversos fatores motivaram a denominada


Crise do sculo XIV, ocorrida na Europa da
Baixa Idade Mdia.
Dentre
esses
corretamente

Os jogos pan-helnicos, que congregavam


povos de todas as cidades gregas, deram
origem s Olimpadas em 776 a.C.

1 - contriburam para a difuso de padres


de comportamento, crenas e costumes,
no mbito do territrio grego.
2 - contribuiram para estabelecer um sistema
de contagem de tempo, medida que foi
determinado que as Olimpadas deveriam
ocorrer de quatro em quatro anos.
3 - acentuaram as rivalidades entre as
cidades-estados,
as
quais
foram
fundamentais na difuso das guerras.

02. Considere o enunciado abaixo e as trs


propostas para complet-lo.

(C) a ecloso da Guerra dos Sete Anos, a


conquista da Frana pelos muulmanos e
a epidemia de varola.
(D) a deflagrao da Guerra da Sucesso
Espanhola, a dissoluo da Liga
Hansetica e a decadncia das comunas.
(E) o advento da Reforma Protestante, o
abandono dos arroteamentos e a ecloso
de guerras entre as cidades italianas.
04. O decrscimo populacional dos povos
indgenas instalados no litoral da Amrica
portuguesa durante o sculo XVI resultou,
entre outros fatores, de surtos epidmicos.

A frase latina Civis romanus sum significa Sou


cidado romano.
A respeito da noo de cidadania no Imprio
Romano, correto afirmar que o cidado
1 - tinha uma identidade legal, ou seja,
reconhecida pelo Imprio, atravs de um
sistema que se pretendia universal.
2 - pertencia civitas, comunidade civil
romana, palavra da qual derivou o termo
atual civilizao.
3 - vivia numa sociedade que, apesar de
manter um regime de escravido,
conferia direitos polticos a todos
segmentos da populao.
Quais propostas esto corretas?
(A)
(B)
(C)
(D)
(E)

citar

(B) a efervescncia religiosa das Cruzadas, a


ecloso da Revoluo dos Trinta Anos e o
despovoamento do Sacro Imprio.

Quais esto corretas?


Apenas 1.
Apenas 2.
Apenas 3.
Apenas 1 e 2.
1, 2 e 3.

pode-se

(A) a disseminao das guerras pelo


continente europeu, a quebra da
produo de alimentos e a mortandade
causada pela peste bubnica.

Naquele contexto histrico, as Olimpadas


foram importantes porque

(A)
(B)
(C)
(D)
(E)

fatores,

Considere as afirmaes abaixo, relativas a


essa catstrofe demogrfica.
I - A dizimao da populao indgena gerou
uma crise demogrfica e ocasionou o
desaparecimento de grupos amerndios.
II - Houve inmeros movimentos migratrios
indgenas, forados ou voluntrios, para o
interior do Brasil; para fugirem das
epidemias e da escravizao.
III- O despovoamento do litoral brasileiro
durante o primeiro sculo de ocupao
conferiu uma dimenso trgica
colonizao.
Quais esto corretas?
(A) Apenas I.

Apenas 1.
Apenas 2.
Apenas 3.
Apenas 1 e 2.
1, 2 e 3.

(B) Apenas II.


(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.

UFRGS CV/2012 HIS

287

05. Considere o enunciado abaixo e as trs propostas para complet-lo.


A unio das Monarquias Ibricas (1580-1640) foi a soluo para uma grave crise poltico-dinstica
em Portugal diante da morte de Dom Sebastio, que no tinha herdeiros ao trono. Durante sessenta
anos, Portugal foi governado por monarcas da Espanha.
Esse perodo histrico
1 - fez com que Portugal participasse de srios conflitos, principalmente aqueles travados pela
Espanha contra Inglaterra, Frana e Holanda.
2 - determinou o bloqueio econmico dos Pases Baixos (Holanda), os quais foram impedidos de
comercializar seus produtos nos portos ibricos de todo o mundo.
3 - resultou na ocupao e no estabelecimento de uma colnia holandesa no litoral nordeste do
Brasil, por mais de duas dcadas.
Quais propostas esto corretas?
(A) Apenas 1.
(B) Apenas 2.
(C) Apenas 1 e 3.
(D) Apenas 2 e 3.
(E) 1, 2 e 3.
06. No bloco superior, abaixo, so citados quatro razes que justificaram a articulao de trs
movimentos sociais no perodo de 1708 a 1789, na regio das Minas Gerais; no inferior, so listadas
as revoltas.
Associe o bloco superior ao inferior.
1 - A mobilizao partiu dos setores subalternos da sociedade colonial, particularmente de escravos
e libertos, que reivindicavam melhores condies de vida.
2 - A supremacia paulista na regio mineradora, foi ameaada pela chegada de forasteiros.
3 - A criao das Casas de Fundio para a devida cobrana dos quintos e a proibio da circulao
de ouro em p, levaram insurreio da populao local.
4 - A decadncia da produo aurfera e a ameaa da derrama sobre os habitantes da capitania
acentuavam a crise do sistema colonial.
( ) Guerra dos Emboabas
( ) Revolta de Vila Rica
( ) Inconfidncia Mineira
A sequncia correta de preenchimento dos parnteses, de cima para baixo,
(A) 2 3 4.
(B) 4 1 2.
(C) 3 1 4.
(D) 4 3 1.
(E) 2 3 1.
4

UFRGS CV/2011 HIS

288

07. Em relao invaso espanhola da Vila de Rio


Grande, ocorrida em 1763, correto afirmar que

09. Considere as seguintes afirmaes relativas a


crise da monarquia espanhola, no perodo de
1808 a 1814.

(A) o Rio Grande foi reocupado pelos lusosbrasileiros somente aps a conquista das
Misses, em 1801.

Sobre esse perodo, correto afirmar que


I - A formao da Junta de Cdiz, em 1812,
culminou na elaborao do projeto
constitucional, o qual contou com a
colaborao de representantes de todos
os territrios hispnicos.

(B) os portugueses foram retirados do sul do


Brasil pelos espanhois, a fim de que
fossem evitadas novas invases.
(C) o povoamento de outras localidades do
Continente de So Pedro foi intensificado
a partir da ocupao de Rio Grande.
(D) o governo foi transferido para Porto
Alegre, tendo em vista a instabilidade da
fronteira sul.

II - A Constituio Liberal de 1812 no


contemplou a unio de todos os
territrios da monarquia, restringindo a
apenas alguns deles a concesso de
direitos civis e polticos.

(E) os litgios de fronteira somente foram


solucionados com a assinatura do tratado
dos Campos Neutrais.

III- A independncia dos domnios hispanoamericanos foi uma consequncia do


mpeto recolonizador de Fernando VII.
Quais esto corretas?

08. Considere o enunciado abaixo e as trs


propostas para complet-lo.

(A) Apenas I.

A Independncia das treze colnias inglesas


na costa leste da Amrica est inserida na
conjuntura das revolues atlnticas.
A declarao da independncia
colnias sustentava que

(B) Apenas II.


(C) Apenas I e III.
(D) Apenas II e III.

dessas

1 - todos os homens nascem iguais, sendo


dotados de direitos inalienveis, como a
vida, a liberdade e a aspirao
felicidade.
2 - a origem de todo o poder reside no povo,
cabendo a ele a organizao de seu
prprio governo.

(E) I, II e III.

10. A respeito da Revolta dos Mals, ocorrida na


cidade de Salvador em 1835, correto afirmar
que ela foi um movimento liderado por

3 - os direitos inalienveis deveriam ser


estendidos
a
toda

populao,
extinguindo-se a escravido e o
extermnio dos ndios.
Quais propostas esto corretas?

(A) escravos oriundos da frica Oriental,


inspirados na independncia do Haiti.
(B) escravos e libertos de origem africana,
que professavam a religio muulmana.
(C) escravos nascidos no Brasil e grupos
excludos do processo poltico-partidrio.
(D) escravos e ndios aldeados no Recncavo,
que protestavam contra a explorao.

(A) Apenas 1.

(E) populares que se inspiraram na Revolta


dos Alfaiates.

(B) Apenas 2.
(C) Apenas 3.
(D) Apenas 1 e 2.
(E) 1, 2 e 3.

UFRGS CV/2012 HIS

289

11. Considere as seguintes afirmaes, relativas participao dos escravos na Guerra dos Farrapos
(1835-1845).
I - Nesta Guerra ocorreu o polmico episdio conhecido como Surpresa de Porongos, o qual
resultou no massacre de muitos escravos.
II - Nos ltimos anos da Guerra, os escravos representavam o principal contingente militar dos
rebeldes, em funo da dificuldade dos farroupilhas para recrutar soldados.
III- No final desta Guerra, foi assinada a Paz de Ponche Verde, que concedia liberdade aos escravos
que lutaram ao lado dos farroupilhas.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas I.
Apenas II.
Apenas I e III.
Apenas II e III.
I, II e III.

12. Observe a charge abaixo, publicada na imprensa ilustrada do Rio de Janeiro do sculo XIX, poca
em que ocorreu a Guerra do Paraguai.

Adaptado de: TORAL, Andr. Imagens em desordem. So Paulo: Humanitas/USP, 2001. p. 180.

Essa charge faz aluso


I - aos efeitos danosos do conflito armado sobre os soldados enviados ao front.
II - ao alistamento voluntrio de civis no combate s tropas paraguaias que haviam invadido a
fronteira oeste do Brasil.
III- prtica do recrutamento forado, habitual na arregimentao de tropas no Brasil Imperial.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas I.
Apenas II.
Apenas I e III.
Apenas II e III.
I, II e III.

UFRGS CV/2011 HIS

290

13. A Lei n 581 do Imprio do Brasil tambm


denominada de Eusbio de Queirz, foi
promulgada em 4 de setembro de 1850. Essa
lei

15. Observe a figura abaixo.

(A) provocou o confisco dos escravos ilegais,


reprimindo e condenando duramente os
senhores de escravos.
(B) determinou que os traficantes fossem
submetidos jurisdio de um tribunal
especial.
(C) suspendeu por alguns anos o trfico
transatlntico de escravos, que foi
retomado nas dcadas seguintes.
(D) obrigou os donos de escravos a
indenizarem os africanos que ingressaram
no Brasil a partir de 1808.
(E) regulamentou o trfico de escravos,
permitindo que apenas africanos do sul
do continente pudessem ser trazidos da
frica.

14. Em 1918, ocorreu no Brasil uma grande


mortalidade entre a populao do pas,
ocasionada
pela
epidemia
de
gripe
espanhola.
A respeito desse surto epidmico, considere
as afirmaes abaixo.
I - A doena chegou ao Brasil com o afluxo
de imigrantes vindos da Europa.
II - O
cotidiano
dos
brasileiros
foi
profundamente
alterado,
com
o
fechamento de locais pblicos e a
proibio de reunies noturnas.
III- Rodrigues Alves eleito Presidncia da
Repblica em 1918, no pode tomar
posse a 15 de novembro por estar
acometido da gripe espanhola.
Quais esto corretas?

A Semana de Arte Moderna, realizada em So


Paulo em 1922, representou um marco na
cultura brasileira. Tarsila do Amaral trouxe a
pblico, em 1928, a obra o Abaporu, que
passou a ser representativa do Manifesto
Antropofgico.
Esse manifesto
(A) defendia a migrao de europeus para
diminuir a importncia dos brasileiros.
(B) propunha a deglutio da cultura
europeia remodelada e devidamente
enraizada terra brasileira, sintetizada na
conhecida frase Tupi or nor tupi, thats
the question.
(C) exaltava a cultura europeia e o
transplante cultural e artstico do Velho
para o Novo Mundo.
(D) valorizava a presena da cultura
estrangeira no Brasil e tambm a
manuteno de padres arcaicos.
(E) justificava a mentalidade subserviente e o
sentimento de inferioridade do brasileiro
em relao aos europeus.

(A) Apenas I.
(B) Apenas II.
(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.
UFRGS CV/2012 HIS

291

16. A respeito da denominada Revoluo


Constitucionalista de 1932, correto afirmar
que ela significou

18. Observe a charge abaixo, relativa


administrao do presidente Joo Goulart
(1961-1964).

(A) uma reao da oligarquia paulista, aos


interventores nomeados pelo governo
federal.
(B) uma reao dos membros da oficialidade
militar, descontentes
com os rumos
polticos da Repblica Velha.
(C) uma resposta da elite fluminense aos
desmandos do Governo Provisrio.
(D) uma
resposta
da
oligarquia
pernambucana aos interventores federais
nomeados no Nordeste.

Correio da Manh, 03.10.1962, p. 12.

(E) uma reao do governo sul-rio-grandense


aos desmandos da oligarquia paulista.

A respeito da orientao poltica do governo


de Joo Goulart, correto afirmar que ela
defendia

17. Assinale com V (verdadeiro) ou F (falso) as


afirmaes abaixo, referentes participao
brasileira na Segunda Guerra Mundial.

(A) a continuidade do projeto poltico


getulista, originrio de uma dissidncia
oligrquica, mas com nfase nas reformas
sociais.

( ) A entrada dos Estados Unidos na Guerra,


em dezembro de 1941, forou uma
definio da poltica externa brasileira.

(B) a implementao de um projeto poltico


socialista, apoiado nos trabalhadores
urbanos, tendo um cunho revolucionrio
acentuado.

( ) A aproximao do Brasil e Estados Unidos


permitiu a instalao de bases militares
norte-americanas na Amaznia.
( ) A entrada efetiva do Brasil no conflito, ao
lado das foras aliadas, ocorreu em
agosto de 1942, quando navios brasileiros
foram
afundados
por
submarinos
alemes.
( ) Com o alinhamento brasileiro ao lado da
frente antifascista, foi enviada Europa
uma fora expedicionria, que lutou na
Itlia nos anos de 1944 e 1945.

(C) a hegemonia dos setores conservadores


no cenrio poltico brasileiro, sustentado
pelas oligarquias regionais.
(D) a
expresso
dos
interesses
do
imperialismo norte-americano no Brasil,
interessado em combater uma suposta
influncia sovitica.
(E) a continuidade da tradicional poltica
oligrquica da Repblica Velha, assentada
na defesa dos interesses das elites
industriais.

A sequncia correta de preenchimento dos


parnteses, de cima para baixo,
(A) V V V F.
(B) V F V V.
(C) F F V V.
(D) F V V F.
(E) V V F V.

UFRGS CV/2011 HIS

292

19. Observe a charge abaixo.

20. Considere o enunciado abaixo e as trs


propostas para complet-lo.
A Guerra do Yom Kippur, ocorrida entre Israel
e os pases rabes, em outubro de 1973,
levou o cartel da OPEP Organizao dos
Pases Exportadores de Petrleo a reduzir a
produo de petrleo mundial, at ento
abundante e barato, fato que ocasionou a
primeira grande crise energtica do Ocidente.
Essa crise

Disponvel em:
<http://www.infoescola.com/histria>.

Esta charge caracteriza um momento de


confronto ocorrido nos anos 1960 entre o
presidente John Kennedy, dos Estados
Unidos, e Nikita Kruschev, lder da Unio
Sovitica.
Considere os itens abaixo
consequncias desse confronto.

sobre

as

I - Preocupao dos Estados Unidos em


isolar Cuba para impedir o crescimento de
movimentos antiamericanos na Amrica
Latina.
II - Apoio da Unio Sovitica para a
consolidao de um regime socialista em
Cuba.

1 - provocou uma forte crise nos pases


industrializados, que dependiam do
combustvel fssil.
2 - inibiu uma poltica de diversificao e de
busca de alternativas energticas para
superar a grande dependncia do ouro
negro.
3 - aumentou o preo do barril de U$3 para
U$12 em menos de trs meses.
Quais esto corretas?
(A) Apenas 1.
(B) Apenas 2.
(C) Apenas 1 e 3.
(D) Apenas 2 e 3.
(E) 1, 2 e 3.

III- Instalao de msseis nucleares em Cuba


pela Unio Sovitica, dirigidos para os
Estados Unidos.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II
(C) Apenas III.
(D) Apenas I e III.
(E) I, II e III.

UFRGS CV/2012 HIS

293

21. O processo de descolonizao das possesses


portuguesas, ocorrido no ltimo quartel do
sculo XX, teve incio com a chamada
Revoluo dos Cravos, que marcou a retirada
lusitana da frica.

22. No bloco superior, esto listados quatro


episdios ocorridos nas ltimas dcadas, os
quais provocaram grande instabilidade
econmica, ameaando as conexes dos
mercados
internacionais;
no
inferior,
descries de trs desses episdios.

A esse respeito, considere as seguintes


afirmaes.
I - Na Guin-Bissau, em Angola e em
Moambique,
os
movimentos
nacionalistas que chegaram ao poder
tiveram apoio sovitico e cubano.
II - Na maioria dos novos pases, houve
guerras civis pela disputa do poder, com
exceo de Angola, onde os diferentes
movimentos nacionalistas implantaram
um governo de coalizo, marcado pela
conciliao poltica.
III- A descolonizao provocou o retorno a
Portugal de cerca de meio milho de
pessoas, agravando a situao de crise no
pas.
Quais esto corretas?

Associe adequadamente o bloco inferior ao


superior.
1 - Moratria Mexicana
2 - Segunda-Feira Negra
3 - Crise Asitica
4 - Crise Russa
( ) O pas suspendeu o pagamento de sua
divida externa, causando surpresa na
comunidade financeira mundial, atingindo
posteriormente a Amrica Latina.
( ) Iniciou com a desvalorizao do Bath,
levando as demais economias da regio
para uma crise que tomou propores
globais
( ) Milhares de investidores comeam a
vender as suas aes ao mesmo tempo
na Bolsa de Nova York devido a uma
especulao e desconfiana generalizada
de manipulao dos ndices das aes.

(A) Apenas I.
(B) Apenas II.
(C) Apenas I e III.

A sequncia correta de preenchimento dos


parntes, de cima para baixo,

(D) Apenas II e III.


(E) I, II e III.

(A) 1 3 2.
(B) 2 4 1.
(C) 1 3 4.
(D) 2 1 3.
(E) 4 2 1.

10

UFRGS CV/2011 HIS

294

23. Leia o enunciado abaixo.


O breve sculo XX acabou em problemas para
os quais ningum tinha, nem dizia ter,
solues. Enquanto tateavam o caminho para
o terceiro milnio em meio ao nevoeiro global
que os cercava, os cidados do fin-de-sicle
s sabiam ao certo que acabou uma era na
histria. E muito pouco mais. Assim, pela
primeira vez em dois sculos, faltava
inteiramente ao mundo da dcada de 1990
qualquer sistema ou estrutura internacional.

24. No bloco superior, esto listados os nomes de


cinco pases; no inferior, acontecimentos
ocorridos em quatro desses pases, nos anos
iniciais do sculo XXI, os quais descrevem a
ascenso e a consolidao de governos
nacionalistas na Amrica Latina.
Associe adequadamente o bloco inferior ao
superior.
1
2
3
4
5

Adaptado de: HOBSBAWN, Eric. Era dos extremos.


O breve sculo XX. So Paulo: Cia das Letras,
1995. p. 537.

Bolvia
Equador
Peru
Venezuela
Uruguai

( ) A vitria de Ollanta Humala representou a


derrocada das oligarquias tradicionais no
pas e a ascenso ao poder de um projeto
de cunho nacional.
( ) O governo de Rafael Correa imprimiu uma
diretriz de independncia na poltica
externa do pas, o que implicou na
desocupao da base militar em Manta,
que os Estados Unidos mantinham no
pas.
( ) A eleio de Evo Morales representou a
vitria de um projeto poltico com razes
indgenas, caracterizado pelo nacionalismo
econmico, expresso no controle dos
recursos naturais.
( ) Aps resistir a uma tentativa de golpe de
Estado, o governo de Hugo Chvez
procurou implantar o denominado projeto
bolivariano, aproximando-se de Cuba.

Com base nesse enunciado correto afirmar


que o fim dessa era est associado
(A) ao vazamento da usina nuclear de
Chernobyl, na extinta Unio Sovitica;
que encerrou as pesquisas nucleares,
naquele pas.
(B) Guerra do Iraque e deposio de
Sadam Hussein, fatos que originaram
anos de conflito.
(C) abertura econmica da Repblica
Popular da China, que cresceu em taxas
galopantes,
desbancando
outras
potncias.
(D) queda do Muro de Berlim, que
representou o fim da Guerra Fria e o
colapso da Unio Sovitica.
(E) ao atentado s torres gmeas, em
setembro de 2001, episdio que assinalou
o inicio da chamada Era do terror.

A sequncia correta de preenchimento dos


parnteses, de cima para baixo,
(A)
(B)
(C)
(D)
(E)

1
2
1
5
3

2
1
4
3
2

5
4
3
2
1

4.
3.
2.
1.
4.

25. Assinale a alternativa que apresenta os pases


cujos governos foram destitudos ao longo do
ano de 2011, na denominada Primavera

rabe.

(A)
(B)
(C)
(D)
(E)
UFRGS CV/2012 HIS

Moambique Egito Mauritnia


Arglia Marrocos Sudo
Lbia Congo Angola
Tunsia Lbia Egito
Africa do Sul Tunisia Etipia
11

295

2013
HISTRIA
01. Durante o reinado de Hamurbi na Babilnia
(1792 1750 a.C.), foi escrita uma relao de
sentenas legais que, modernamente,
conhecida pelo nome de Cdigo de Hamurbi.

03. Um dos elementos essenciais nas relaes


sociais da Idade Mdia Ocidental foi a
instituio da vassalagem, difundida desde o
reinado de Carlos Magno, que consistia em
(A) um juramento de compra de terras por
um vassalo a um senhor, as quais eram
trabalhadas por servos.
(B) uma relao de dependncia pessoal que
vinculava, por meio de um juramento, um
senhor a um subordinado, vassalo.
(C) uma concesso temporria de terras do
rei a funcionrios especializados da alta
administrao, que exploravam o trabalho
dos servos da gleba.
(D) uma relao contratual entre um senhor e
seus servos, que prestavam servios em
troca de proteo.

O objetivo da obra era


(A) estabelecer uma ordem constitucional
para
fundar
o
Estado
imperial
mesopotmico.
(B) enaltecer a pessoa do rei, associando-a
ao poder, justia e sabedoria.
(C) proporcionar aos cidados do imprio um
cdigo legal universal e aplicvel a todas
as situaes conflituosas.
(D) impor a lei do Talio como norma
exclusiva para a ordem constitucional
mesopotmica.
(E) promover a igualdade jurdica entre todos
os sditos do rei.

(E) um contrato revogvel de prestao de


servios temporrios por parte de um
cavaleiro profissional, a servio de um
senhor.
04. Leia o enunciado abaixo.

02. No bloco superior abaixo, so listados alguns


lderes que atuaram no perodo republicano
da Antiga Roma; no inferior, so citadas
aes desses lderes.
Associe corretamente o bloco inferior ao superior.

A expanso portuguesa no pode nem deve ser


vista como um processo acumulativo: foi
marcado por continuidades e descontinuidades, e
por quebras e transformaes nos padres das
suas atividades, do Atlntico ao ndico, da ndia
ao Atlntico Sul, do Brasil frica.
BETHENCOURT, Francisco; CURTO, Diogo Ramada
(dir.). A expanso martima portuguesa, 14001800. Lisboa: Edies 70, 2010. p. 8.

1 - Otvio
2 - Caio Mrio
3 - Tibrio Graco

A partir da leitura do enunciado, considere as


seguintes afirmaes.

4 - Pompeu
( ) Operou uma reforma militar que permitiu
o recrutamento de soldados entre a
populao mais pobre de Roma.
( ) Acumulou uma srie de ttulos e cargos e
acabou por estabelecer em Roma o
sistema poltico imperial.
( ) Tentou implementar uma reforma que
permitisse a distribuio de terras pblicas
entre os cidados mais pobres de Roma.
A sequncia correta de preenchimento dos
parnteses, de cima para baixo,
(A) 2 1 4.

I - A reduzida capacidade demogrfica da


metrpole portuguesa no impediu a
constante emigrao com
destino,
principalmente, ao Brasil.
II - O trfico de escravos, iniciado pelos
portugueses, no tardou a envolver, na
Amrica, os domnios coloniais de
Espanha, Inglaterra, Frana e Holanda.
III- A Amrica Portuguesa foi um exemplo de
colnia de povoamento, que serviu para o
envio dos excedentes populacionais da
metrpole.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

(B) 1 2 4.
(C) 2 1 3.
(D) 1 2 3.
(E) 3 4 2.
2

Apenas
Apenas
Apenas
Apenas
Apenas

I.
II.
I e II.
I e III.
II e III.
UFRGS CV/2013 HIS

296

05. Leia o segmento abaixo.


O rei tomou o lugar do Estado, o rei tudo, o Estado no mais nada. Ele o dolo a quem se
oferecem as provncias, as cidades, as finanas, os grandes e os pequenos, em uma palavra, tudo.
JURIEN, Pierre. Apud ELIAS, Norbert. A sociedade de corte. Rio de Janeiro, Zahar, 2001. p. 133.

Essa afirmao de um contemporneo de Lus XIV, na Frana, diz respeito a uma forma de governo que
ficou conhecida como
(A) monarquia constitucional.
(B) autocracia desptica oriental.
(C) autocracia parlamentar.
(D) monarquia absolutista.
(E) tirania teocrtica.
06. Leia o enunciado abaixo.
A sede insacivel do ouro estimulou a tantos a deixarem suas terras e a meterem-se por caminhos to
speros como so os das minas, que dificultosamente se poder dar conta do nmero de pessoas que
atualmente l esto (...). Cada ano, vm nas frotas quantidades de portugueses e de estrangeiros para
passarem s minas. Das cidades, vilas e recncavos e sertes do Brasil, vo brancos, pardos e pretos, e
muitos ndios, de que os paulistas se servem.
ANTONIL, Andr Joo. Cultura e opulncia do Brasil. So Paulo: Melhoramentos; Braslia: INL, 1976. p. 167.
[1 edio: 1711].

A descrio acima refere-se sociedade formada na regio das Minas Gerais, no sculo XVIII.
A respeito dessa sociedade, considere as seguintes afirmaes.
I - A possibilidade de ascenso social era mais facilitada do que na atividade aucareira
empreendida no Nordeste.
II - A riqueza gerada promoveu o desenvolvimento de uma agricultura em grande escala, voltada
para a exportao.
III- O desenvolvimento acarretou uma sociedade urbana, heterognea, composta por comerciantes,
funcionrios reais, profissionais liberais e escravos.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas I e II.
(D) Apenas I e III.
(E) Apenas II e III.

UFRGS CV/2013 HIS

297

07. Observe o mapa abaixo.

Adaptado de: MAEDER, Ernesto. Los problemas de limites entre Espaa y Portugal en el Rio de la Plata.
Resistencia: Instituto de Investigaciones Geohistricas, 1986. p. 29.

A anexao de sete redues guaranis aos domnios lusitanos na Amrica, em 1801, significou a
concretizao de uma expanso idealizada, pelo menos, desde meados do sculo XVIII.
A respeito dessa anexao, considere as seguintes afirmaes.
I - Foi uma campanha militar coordenada desde Lisboa, que contou com a presena de oficiais de
alta patente, dada a importncia estratgica do territrio.
II - Representou um significativo impacto demogrfico no Rio Grande de So Pedro, diante do
acrscimo de milhares de ndios populao da capitania.
III- Houve, por parte das lideranas indgenas missioneiras, uma participao destacada na
conquista, pois sem a sua colaborao tal fato no seria possvel.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas
Apenas
Apenas
Apenas
Apenas

I.
II.
I e II.
I e III.
II e III.

UFRGS CV/2013 HIS

298

08. Em 1815, foi encerrado o Congresso de Viena


que tinha como propsito reorganizar o mapa
poltico da Europa.

10. Sobre o trabalho escravo no Rio Grande do Sul


do sculo XIX, considere as seguintes afirmaes.
I - Deixou de ser utilizado nas estncias de
criao de gado, pois a atividade pecuria
tornou-se exclusiva dos trabalhadores livres.
II - Promoveu o desenvolvimento da produo
de charque e incrementou o trfico de
escravos para o Rio Grande do Sul.
III- Esteve presente tambm nos espaos
urbanos, para execuo de servios
domsticos.

A respeito desse Congresso, considere as


seguintes afirmaes.
I - Foi realizado aps a derrota de Napoleo
Bonaparte, que havia alterado o equilbrio
de foras na Europa.
II - Resultou na formao da Santa Aliana
para coibir qualquer tentativa de
revoluo liberal.

Quais esto corretas?


(A)
(B)
(C)
(D)
(E)

III- Garantiu a Portugal e Espanha ganhos


territoriais na Europa, por terem lutado
contra as foras napolenicas.
Quais esto corretas?
(A) Apenas I.

Apenas I.
Apenas II.
Apenas I e II.
Apenas II e III.
I, II e III.

11. Leia o enunciado abaixo.

(B) Apenas II.


(C) Apenas I e II.
(D) Apenas I e III.
(E) I, II e III.
09. Em 1824, outorgada a Constituio do
Imprio do Brasil. Entre suas caractersticas,
podemos afirmar que
(A) dividia
os
poderes
do
Estado
exclusivamente em Executivo, Legislativo
e Magistratura.

A escravido levou consigo ofcios e aparelhos,


como ter sucedido a outras instituies
sociais. (...) Um deles era o ferro ao pescoo,
outro o ferro ao p; havia tambm a mscara
de folha de flandres.(...) Era grotesca tal
mscara, mas a ordem social e humana nem
sempre se alcana sem o grotesco, e alguma
vez o cruel. Os funileiros as tinham
penduradas, venda, na porta das lojas.
ASSIS, Machado de. Pai contra me. Disponvel
em: <http://www.dominiopublico.gov.br>.
Acesso em: 14 nov. 2012.

Com base no texto de Machado de Assis,


considere as seguintes afirmaes.

Primeiro

I - Sem ser participante de movimentos


abolicionistas, abordou o tema da
escravido, criticando-a em algumas de
suas obras.

(D) estabelecia o voto universal e secreto


para a populao masculina.

II - Por viver durante a vigncia do sistema


escravocrata, condenou o engajamento
na causa abolicionista.

(B) separava a Igreja Catlica do Estado


Laico.
(C) previa a
Ministro.

(E) dividia os
Executivo,
Moderador.

eleio

direta

do

poderes do Estado em
Legislativo,
Judicirio
e

III- Por ser negro, explorou o sistema escravista


como tema recorrente de suas obras, no
perodo final do Imprio brasileiro.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

UFRGS CV/2013 HIS

Apenas I.
Apenas II.
Apenas III.
Apenas II e III.
I, II e III.
5

299

12. A Primeira Repblica no Brasil (1889-1930)


iniciou com um golpe militar que derrubou a
monarquia. Depois de alguns anos de
profundas crises, o novo regime foi-se
consolidando.

13. Leia os versos abaixo, referentes conjuntura


de contestao do domnio do Partido
Republicano Rio-grandense, no governo do
Rio Grande do Sul.

A esse respeito, considere as afirmaes


abaixo.
I - Uma figura muito comum no perodo a
do coronel, geralmente um dos grandes
proprietrios rurais nos municpios
interioranos, o qual controlava parte da
populao local, que o apoiava em lutas
polticas.
II - Com a ampla autonomia permitida pela
Constituio de 1891, estados mais ricos
e populosos, e com economia integrada
ao mercado, acabaram impondo seus
interesses ao restante do pas.
III- A instabilidade gerada pelo golpe de 15
de novembro de 1889 acarretou uma
sucesso de governos militares que
caracterizaram a poltica brasileira ao
longo de todo o perodo da Primeira
Repblica.
Quais esto corretas?

Veio ao mundo to flaquito,


To esmirrado e chochinho,
Disse espantada a comadre:
Virgem do cu, Santo Padre!
Isto gente ou passarinho?
Tinha j mudado os dentes
E andava de camisola
O Chimango, um tramanzola,
Molhava noite o pelego;
Tinha medo de morcego,
Corria, vendo pistola.
No meio da gurizada,
Quando brincava de lao,
Era o Chimango o paiao,
Nunca acertava pealo;
E se montava a cavalo,
No troteava... era no passo.
JUVENAL, Amaro. Antonio Chimango: Poemeto
campestre (stira poltica). Pseud. de Ramiro
Fortes Barcellos. Porto Alegre: Martins Livreiro,
1982. p. 14 e 24. (estrofes 12, 44 e 45).

Esses versos, publicados por Ramiro Barcelos,


influenciaram a designao de chimangos,
aplicada a um grupo poltico identificado com
a

(A) Apenas I.
(B) Apenas II.
(C) Apenas I e II.
(D) Apenas I e III.

(A) Revoluo Farroupilha.

(E) I, II e III.

(B) Revoluo Federalista de 1893.


(C) Revolta da Armada.
(D) Revoluo de 1923.
(E) Revolta de Canudos.

UFRGS CV/2013 HIS

300

14. Em 1918, encerrava-se a Primeira Guerra


Mundial, que se caracterizou pelo confronto
armado direto entre as principais potncias
europeias.
A respeito do trmino dessa guerra, considere
as seguintes afirmaes.
I - Alm da adoo do regime republicano, a
Alemanha
foi
forada
a
pagar
indenizaes pelos danos causados aos
pases vencedores.

15. Em 1924, grupos de militares rebeldes, que


ficaram
conhecidos
como
tenentes,
revoltaram-se em So Paulo e no Rio Grande
do Sul. O movimento paulista liderado por
Miguel Costa; e o rio-grandense, por Lus
Carlos Prestes, unidos, iniciaram uma marcha
de protesto que percorreu o pas at 1927 e
ficou conhecida como Coluna Prestes.

II - Apesar das perdas econmicas e


demogrficas, a guerra no abalou a
hegemonia da Europa que manteve seu
poderio intato.
III- A ustria e a Hungria como estados
independentes surgiram do colapso do
Imprio Habsburgo.
Quais esto corretas?
(A) Apenas I.

Uma das principais


movimento foi

caractersticas

do

(A) a alta mobilidade dos rebeldes que


percorreram o interior do pas, evitando os
choques diretos com as foras legalistas.
(B) o combate s tropas legalistas em batalhas
constantes, demoradas e sangrentas.
(C) o
levante
das
massas
urbanas
descontentes, provocado pela passagem
do grupo nas grandes cidades do litoral
do pas.
(D) a extino da hierarquia interna do
Exrcito, ocasionando a revolta dos
sargentos e dos cabos.

(B) Apenas II.


(C) Apenas I e II.
(D) Apenas I e III.

(E) a cooptao de operrios, ligados ao


movimento anarquista.

(E) I, II e III.

16. A Revoluo de 30 promoveu uma ruptura da ordem constitucional, levando ao poder o riograndense Getlio Vargas.
A esse respeito, considere as afirmaes abaixo.
I - A Revoluo foi uma reao das oligarquias dos Estados da regio sul contra os desmandos e
desperdcios do governo da Unio, controlado pelos Estados da regio norte.
II - O movimento era em sua maioria composto por militares de alto escalo, desgostosos com os
rumos polticos do governo de Washington Luiz.
III- A Revoluo foi sustentada por uma coalizo de antigas lideranas poltico-partidrias, militares
de baixas patentes e grupos urbanos descontentes.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas II e III.
(E) I, II e III.

UFRGS CV/2013 HIS

301

17. Observe a figura abaixo.

18. Entre 1939 e 1945, o mundo esteve envolvido


na Segunda Guerra Mundial. A respeito dessa
guerra, considere as seguintes afirmaes.
I - Caracterizou-se pela perseguio de
vrios grupos populacionais, sendo alguns
deles vtimas de prticas sistemticas de
extermnio.
II - Trouxe o enfraquecimento geral dos pases
europeus e o avano do processo de
descolonizao, principalmente na sia e na
frica.

Cartaz produzido pelo Departamento de Imprensa e


Propaganda (DIP) durante o Estado Novo. In: FAUSTO,
Boris. Histria do Brasil. So Paulo: Edusp, 2009. p. 377.

Em 1 de maio de 1943, por decreto


presidencial, foi aprovada uma legislao, at
hoje em vigor, que marcou o governo Getlio
Vargas.
A respeito dessa legislao, correto afirmar
que
(A) garantiu a extenso dos direitos
trabalhistas a todos os trabalhadores
rurais do pas Lei da Reforma Agrria.

III- Teve como consequncia o fim da diviso


ideolgica mundial entre os pases com
sistemas polticos inspirados no liberalismo e
aqueles baseados no marxismo.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas I e II.
(D) Apenas I e III.
(E) Apenas II e III.

(B) desregulamentou a relao entre o capital


e o trabalho, consolidando a livre
negociao trabalhista Lei do Trabalho
Remunerado.
(C) atendeu a demanda no somente dos
trabalhadores, mas tambm de muitos
setores da sociedade, interessados em ver
o pas novamente sob o Estado de Direito
Emenda Constitucional.
(D) regulamentou o acesso s terras
devolutas pertencentes ao Estado, o que
beneficiou especialmente os pequenos
proprietrios rurais Lei de Terras.
(E) reuniu e racionalizou a legislao vigente
e introduziu e regulamentou novos
direitos
na
rea
trabalhista

Consolidao das Leis do Trabalho.

UFRGS CV/2013 HIS

302

19. Assinale com V (verdadeiro) ou F (falso) as


afirmaes abaixo, referentes Repblica
Popular da China.

20. Entre 1970 e 1973, o Chile viveu uma


experincia de profundas transformaes
socioeconmicas, a partir da vitria nas urnas
de Salvador Allende.

( ) No final da dcada de 1950, o Partido


Comunista Chins contestou a hegemonia
sovitica sobre o bloco comunista, mas
nunca rompeu diretamente com Moscou.
( ) A Grande Revoluo Cultural perseguiu
diversos intelectuais e tinha, como
objetivo, depurar o Partido Comunista
Chins das propostas revisionistas.
( ) O lder Deng Xiaoping promoveu
mudanas a partir de um plano de
reformas que reestruturou a economia
chinesa.
( ) A China, aps as reformas econmicas,
entrou em uma fase de crescimento
acelerado, tornando-se
a segunda
potncia econmica mundial.
A sequncia correta de preenchimento dos
parnteses, de cima para baixo,

Sobre esse processo, considere as seguintes


afirmaes.
I - A vitria de Allende foi o resultado de
uma aliana de partidos populares, com
tendncia marxista, representada pela
Unidade Popular.
II - O
governo
da
Unidade
Popular
nacionalizou as riquezas bsicas do pas,
especialmente o cobre, iniciando tambm
a reforma agrria.
III- A derrubada do governo de Allende
contou com o apoio do governo norteamericano, caracterizando a interveno
militar mais violenta na Amrica Latina.
Quais esto corretas?
(A) Apenas I.

(A) V V F F.

(B) Apenas II.

(B) F V V V.

(C) Apenas I e II.

(C) F F V V.

(D) Apenas I e III.

(D) V V F V.

(E) I, II e III.

(E) V F V F.

21. A reforma partidria brasileira (Lei Orgnica dos Partidos, de dezembro de 1979) visou dividir a
oposio e dar uma nova roupagem legenda de apoio ao regime ento vigente.
A respeito dessa reforma, correto afimar que uma de suas disposies foi
(A) o retorno do pluripartidarismo.
(B) o ressurgimento do bipartidarismo.
(C) a proibio da criao de novos partidos.
(D) o fim do pluripartidarismo.
(E) a proibio de legendas de oposio.

UFRGS CV/2013 HIS

303

22. O colapso da Unio Sovitica, reconhecido


oficialmente em dezembro de 1991, foi o
resultado da introduo de medidas
reformistas que visavam modernizar o
socialismo sovitico.
A respeito dessas medidas
considere as afirmaes abaixo.

reformistas,

I - Resultaram no surgimento de novas


repblicas, outrora submetidas a Moscou,
que exigiam autonomia poltica e
territorial.
II - Decorreram da ascenso de Mikhail
Gorbachev, que instaurou as aes
conhecidas como perestroika e glasnost.

Na

24. Observe a charge abaixo.

III- Tinham um ntido carter conservador, e


foram gestadas por presso de setores
populares insatisfeitos com o rumo do
pas.
Quais esto corretas?

Adaptado de: <http://www.nanihumor.com/2012_


02_01_archive.html>. Acesso em: 31 ago. 2012.

Assinale
a
alternativa
que
preenche
corretamente as lacunas do enunciado abaixo,
na ordem em que aparecem.
A charge diz respeito crise pela qual os
pases da ........ esto passando desde alguns
anos. Entre eles, um dos mais afetados
........, a quem tm sido impostas duras
medidas de conteno de gastos pblicos,
tanto por seus parceiros de bloco, quanto por
organismos internacionais de crdito, entre os
quais est ......... . Um dos problemas graves
enfrentados pelo pas o alto ......... .

(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e II.
(E) Apenas II e III.
23. Na Argentina, os dois mandatos presidenciais
de Carlos Menem (1989 a 1999) so
considerados como o auge da adoo de
medidas de orientao neoliberal.

(A) Unio Europeia a Inglaterra a


Organizao do Tratado do Atlntico
Norte (OTAN) custo dos Jogos
Olmpicos

correto afirmar que, no seu conjunto, essas


medidas resultaram em

(B) Unio Europeia a Grcia o Fundo


Monetrio Internacional (FMI) ndice de
desemprego

(A) desindustrializao do pas devido perda


de
competividade,
o
que
gerou
desemprego.

(C) Amrica do Norte o Canad o Fundo


Monetrio Internacional (FMI) ndice de
inadimplncia no setor de crdito
imobilirio

(B) retrao da atividade agropecuria diante


da desvalorizao do peso.
(C) ampliao de recursos destinados aos
programas sociais de combate fome.
(D) nacionalizao de empresas e monoplio,
por parte do Estado, dos hidrocarburetos.
(E) ampliao da capacidade da indstria
voltada ao mercado interno.
10

(D) Amrica do Sul o Paraguai a


Organizao do Tratado do Atlntico
Norte (OTAN) custo da instabilidade
poltica
(E) Unio Europeia a Itlia o Mercado
Comum do Sul (MERCOSUL) ndice de
desemprego

UFRGS CV/2013 HIS

304

25. Observe o mapa abaixo.


Resultado das eleies presidenciais norte-americanas (novembro 2012)

As afirmaes abaixo esto relacionadas Guerra da Secesso (1861-1865) e situao polticoeleitoral atual dos EUA.
I - O sistema eleitoral norte-americano, desde o final da Guerra da Secesso, passou a utilizar o
voto direto nas eleies presidenciais.
II - Alguns dos estados que votaram no candidato republicano fizeram parte dos Estados
Confederados.
III- Os estados que votaram no candidato democrata fizeram parte, na sua maioria, dos Estados da
Unio.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e II.
(E) Apenas II e III.

UFRGS CV/2013 HIS

11

305

2014
HISTRIA
01. Esta a exposio de Herdoto de Trio, para que bem os acontecimentos provocados pelos homens,
com o tempo, sejam apagados, nem as obras grandes e admirveis, trazidas luz tanto pelos
gregos quanto pelos brbaros, se tornem sem fama e, no mais, investigao tambm da causa
pela qual fizeram guerra uns contra os outros.
Herdoto, Histrias, 1, 1-5.

A narrao de Herdoto (480-420 a.C.), considerado o pai da Histria Ocidental, refere-se


(A)
(B)
(C)
(D)
(E)

s guerras mdicas e aos persas.


guerra do Peloponeso e aos espartanos.
s conquistas de Alexandre, o Grande e aos egpcios.
s guerras pnicas e aos cartagineses.
guerra de Troia e aos troianos.

02. Os dois fragmentos citados abaixo, de autoria


do filsofo Santo Agostinho (354-430 d.C.),
tratam do mesmo contexto histrico.

03. Leia o segmento abaixo.


O homem medieval pensa no cotidiano
usando os mesmos moldes de sua teologia.
HUIZINGA, Johan. O outono da Idade Mdia. So
Paulo: Cosacnaify, 2010. p. 375.

Sobre a origem, o progresso e os termos


previstos para as duas cidades, das quais uma
de Deus, a outra deste mundo (...), prometi
escrever, aps ter refutado, quanto me
ajudasse sua graa, os inimigos da cidade de
Deus, que preferem seus deuses ao fundador
desta ltima, Cristo.

A base da teologia, no mundo medieval,


sustenta-se
(A) na escolstica.
(B) no epicurismo.

Santo Agostinho, A Cidade de Deus, XVIII, I-II,1.

Neste momento, Roma foi destruda sob os


golpes da invaso dos godos que o rei Alarico
conduzia (410 d.C.): foi um grande desastre.
Os adoradores de uma multido de deuses
falsos, que chamamos ordinariamente de
pagos, esforaram-se para atribuir esse
desastre religio crist e puseram-se a
blasfemar contra o Deus verdadeiro.

(C) no protestantismo.
(D) no cristianismo primitivo.
(E) no paganismo.
04. Leia o texto abaixo.

Santo Agostinho, Retrataes, II, 1.

Considere as seguintes afirmaes, sobre


esses fragmentos.
I - Santo Agostinho retrata a tomada de
Roma, a ascenso dos pagos e a
opresso aos godos.
II - Santo Agostinho afirma que os godos eram
cristos e que os romanos eram pagos.
III- Santo Agostinho discorre sobre a queda
de Roma e a defesa do cristianismo.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas
Apenas
Apenas
Apenas
Apenas

O dia 27 de julho caiu em um domingo. (...)


Naquele domingo, na plancie de Bouvines, o rei
da Frana Filipe Augusto havia afrontado, contra
a sua vontade, a temida coalizo do Imperador
Oto, do conde de Ferrand, de Flandres, e do
conde Renaud, de Boulogne; noite, pela graa
de Deus, ele era senhor do campo de batalha. O
imperador havia fugido, os dois condes rebeldes
estavam presos. Vitria, como j foi dito e
repetido, fundadora; as bases da monarquia
francesa decididamente consolidadas.
DUBY, Georges. O domingo de Bouvines. 27 de julho
de 1214. Rio de Janeiro: Paz e Terra, 1993. p. 9-13.

O texto
dinastia

refere-se

ao

fortalecimento

da

(A) Valois.

I.
II.
III.
I e II.
I e III.

(B) Merovngia.
(C) Carolngia.
(D) Capetngia.
(E) Bourbon.

UFRGS CV/2014 HIS

306

05. Sobre o sistema feudal na Idade Mdia,


correto afirmar que
(A) a economia agrcola e pastoril,
descentralizada e voltada para o mercado
externo.

07. De acordo com Srgio Buarque de Holanda o


gosto da maravilha e do mistrio, quase
inseparvel da literatura de viagens na era
dos grandes descobrimentos martimos, ocupa
espao singularmente reduzido nos escritos
quinhentistas dos portugueses sobre o Novo
Mundo.

(B) a sociedade estrutura-se como uma


pirmide, cuja base formada pelos
servos; o meio, pela nobreza; e a parte
superior, pelo clero.

HOLANDA, Srgio Buarque de. Viso do paraso.


So Paulo: Brasiliense, 1996. p. 1.

Qual foi a motivao para essa reduo?

(C) a burguesia a classe social econmica e


politicamente mais poderosa.

(A) A
lngua
portuguesa
no
estava
suficientemente desenvolvida para expressar
o gosto pelo maravilhoso e pelo mistrio.

(D) a Igreja Catlica consolida seu poder aps


o declnio do feudalismo.

(B) Os portugueses tinham prticas anteriores


com grandes navegaes e o contato
mais frequente com outros povos,
sobretudo do Oriente.

(E) a suserania e a vassalagem constituem-se


em relaes polticas entre os servos e os
membros do clero.

(C) Os portugueses interessavam-se mais


pelo Mxico e pela Amrica do Norte.
(D) A ocupao do Novo Mundo, sobretudo
do Brasil, pelos portugueses foi imediata,
o que amenizou o impacto inicial do
contato.

06. Os humanistas dos sculos XV e XVI


procuraram validar os modelos antigos nas
artes, na filosofia, na poltica, na literatura,
desviando-se das derivaes medievais. Nesse
sentido, as inovaes do Renascimento
podem ser definidas como retomada de
concepes antigas e criaes inditas.
Considere os seguintes autores e respectivas
obras.
I - Maquiavel e a obra O Prncipe Thomas
Morus e a obra Utopia

(E) Os portugueses consideravam os povos


indgenas e a natureza do Novo Mundo
semelhante quela encontrada na Europa.
08. Em 1648, foi celebrada a Paz de Vestflia, um
conjunto de tratados que encerrava a Guerra
dos Trinta Anos e, como consequncia, o
perodo de guerras religiosas europeias,
causadas pela Reforma Protestante.

II - Montaigne e a obra Ensaios Rousseau e


a obra O contrato social

Entre os principais efeitos da Paz, pode-se


citar

III- Da Vinci e a obra Mona


Michelngelo e a obra Moiss

(A) a unificao poltica do Sacro Imprio


Romano Germnico e o surgimento do
Estado-nao alemo.

Lisa

Quais so desse perodo?

(B) o reconhecimento da soberania nacional


como elemento lapidar das relaes
internacionais entre os diferentes Estados
europeus.

(A) Apenas I.
(B) Apenas II.
(C) Apenas III.

(C) a supresso do luteranismo do Sacro


Imprio Romano Germnico e o
reconhecimento do catolicismo e do
calvinismo
como
nicas
religies
permitidas nos Estados alemes.

(D) Apenas I e II.


(E) Apenas I e III.

(D) a ascenso da Casa dos Habsburgo como a


mais poderosa das dinastias reais europeias.
(E) a subjugao completa da Revolta
Holandesa contra a Espanha e a anexao
dos Pases Baixos ao Imprio Espanhol.

UFRGS CV/2014 HIS

307

09. Considere as seguintes afirmaes sobre a


Companhia de Jesus, ordem fundada em
1534, pelo ex-militar espanhol Ignacio de
Loyola, e qual pertence o papa Francisco.

11. O texto
Francesa.

I - Foi um instrumento importante da Igreja


Catlica na luta contra a Reforma
Protestante do sculo XVI, defendendo a
ortodoxia catlica contra os movimentos
reformadores, como o luteranismo e o
calvinismo.
II - Foi banida pela bula papal Dominicus ad
Redemptor, de 21 de julho de 1773, mas
recuperou suas prerrogativas em 1814.
III- Desempenhou um papel essencial na
atividade evangelizadora dos indgenas
nas Amricas, com o estabelecimento das
chamadas redues, a partir do incio
do sculo XVII.
Quais esto corretas?

abaixo

refere-se

Revoluo

O Terror doravante um sistema de governo,


ou melhor, uma parte essencial do governo
revolucionrio. Seu brao. (...) Ele tambm
um meio de governo omnipresente, atravs
do qual a ditadura revolucionria de Paris
deve fazer sentir sua mo de ferro em todos
os lugares, tanto nas provncias quanto nas
foras armadas.
FURET, Franois ; OZOUF, Mona. Diccionnaire
critique de la Rvolution franaise. vnements.

Paris: Flammarion, 1992. p. 298-299.

Considere as seguintes afirmaes sobre o


denominado Terror.
I - O governo jacobino, dirigido por
Robespierre, e o Comit de Salvao
Pblica foram responsveis pelo perodo
do Terror.
II - O Terror foi uma poltica de extermnio
liderada pelos girondinos de origem
burguesa.

(A) Apenas I.
(B) Apenas II.

III- O objetivo dessa poltica centrava-se na


defesa da Revoluo contra os inimigos
internos e externos.

(C) Apenas I e III.


(D) Apenas II e III.
(E) I, II e III.
10. Sobre o Tratado de Madri, assinado em 1750
por Portugal e Espanha, considere as
seguintes afirmaes.
I - A Colnia de Sacramento passou para a
Espanha, e os Setes Povos das Misses
passaram para Portugal, consagrando o
princpio do uti possidetis.

Quais esto corretas?


(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e II.
(E) Apenas I e III.

II - A expulso dos jesutas foi fator


importante para a ecloso da chamada
guerra
guarantica
(1752-1756),
reduzindo os efeitos do Tratado.
III- As Misses retornaram para a Provncia
do Paraguai.
Quais esto corretas?
(A)
(B)
(C)
(D)
(E)

Apenas
Apenas
Apenas
Apenas
Apenas

I.
II.
III.
I e II.
I e III.

UFRGS CV/2014 HIS

308

12. Leia o enunciado abaixo.

14. Leia o texto abaixo.

O comrcio martimo triangular deu uma


contribuio enorme ao desenvolvimento
industrial da Inglaterra. Seus lucros fertilizaram
todo o sistema de produo do pas.

O gacho arranca o couro e o estica, preso a


estacas, ao sol. Do resto, o que no quiser,
fica para os corvos. (...) Do povoado de Goya,
os couros seguiro em viagem para o porto
de Buenos Aires e atravessaro o mar at os
curtumes de Liverpool. O preo ter sido
multiplicado muitas vezes quando os couros
regressarem ao rio da Prata, tempos depois,
transformados em botas, sapatos e rebenques
de manufatura britnica.

WILLIAMS, Eric. Capitalismo e escravido.


So Paulo: Cia. das Letras, 2012. p. 157.

Considere as seguintes afirmaes sobre o


comrcio triangular.
I - O comrcio triangular britnico consistia,
principalmente, no envio de produtos
manufaturados ingleses para a frica; de
escravos africanos para o Caribe; e de
produtos coloniais, especialmente o
acar, para a Inglaterra.

GALEANO, Eduardo. Memrias do fogo. v. 2. Porto


Alegre: LP & M, 2004. p. 160-161.

O trecho faz referncia ao contexto histrico da


Amrica Platina, do sculo XIX, e
(A) importao de matrias-primas europeias
essenciais ao processo de industrializao
da regio, iniciado ainda no sculo XIX e
consolidado no sculo XX.

II - Os lucros obtidos pelo comrcio triangular


forneceram um dos principais fluxos de
acumulao de capital que financiaram a
Revoluo Industrial inglesa.
III- A utilizao de mo-de-obra livre nas
plantations produtoras de acar garantia
altos nveis de lucratividade para seus
proprietrios.

(B) ampla dependncia dos curtumes de


Liverpool em relao aos produtos
manufaturados de Buenos Aires.

Quais esto corretas?

(D) importncia do couro ingls para


economia latino-americana do perodo.

(C) formao de economias pecuaristas de


exportao na Amrica Platina.

(A) Apenas I.

(E) retrao generalizada da atividade


pecuria em toda a Amrica Platina,
durante aquele sculo.

(B) Apenas III.


(C) Apenas I e II.
(D) Apenas II e III.
(E) I, II e III.

15. Considere as seguintes afirmaes sobre a Lei


de Terras de 1850.

13. Durante a regncia de Arajo Lima (18371840), foram criadas algumas instituies
poltico-culturais, com o objetivo de produzir
uma histria da nao, que conferisse aos
brasileiros um sentimento de pertencimento e
de nacionalidade, e assim de auxiliar na
centralizao e fortalecimento do Estado.
Uma dessas instituies foi

I - Legislou, pela primeira vez, a propriedade


privada no pas, essencial para a
modernizao capitalista da nao.
II - Possibilitou a compra de terras por
imigrantes, independente do tempo de
permanncia no pas.
III- Proibiu a doao de terras pblicas.
Quais esto corretas?

(A) a Guarda Nacional.


(B) o Instituto Histrico e Geogrfico Brasileiro.
(C) a Academia Imperial de Belas Artes.
(D) a Sociedade Auxiliadora da Indstria
Nacional.
(E) a Academia Brasileira de Letras.

(A) Apenas I.
(B) Apenas III.
(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.
UFRGS CV/2014 HIS

309

16. Leia o texto abaixo.

17. Observe a figura abaixo.

O perodo republicano pode ser considerado


emblemtico quanto questo dos conflitos
armados ocorridos no Rio Grande do Sul.
Inaugura-se
com
uma
guerra
civil,
considerada um dos mais mortferos conflitos
desse tipo havidos no Brasil algumas
estimativas referem que deixou algo em torno
de 10 mil mortos , e se estende no sentido
da superao de formas anteriores de
resoluo de pendengas poltico-partidrias,
mediante violncia fsica aberta por meios
mais brandos, formalizados.
GRIJ, L.A. Entre a barbrie e a civilizao: os
conflitos armados no perodo republicano. In:
NEUMANN, E.; GRIJ, L.A. (orgs.) O continente em
armas: uma histria da guerra no sul do Brasil. Rio
de Janeiro: Apicuri, 2010. p. 159.

Considere as seguintes afirmaes sobre o


que pode ser includo nesse perodo.
I - A revoluo Federalista de 1893, que
ops os partidrios de Gaspar Silveira
Martins do Partido Liberal, aos partidrios
do Partido Republicano Rio-Grandense,
liderados por Jlio de Castilhos.
II - A chamada Revoluo Libertadora de
1923, que colocou em campos opostos,
de um lado, federalistas (Raul Pilla) e
democratas (Assis Brasil) e, de outro, o
Partido Republicano Rio-Grandense.
III- Os distrbios que se seguiram revoluo
de 1930 e constitucionalista de 1932.
Quais esto corretas?

Adaptado de: <http://www.historiapensante.


blogspot.com.br/2010/08/o-encilhamento.html>.
Acesso em: 21 ago. 2013.

Em 1891, ocorreu uma fortssima crise


econmica no Brasil, decorrente da poltica de
Encilhamento do Governo Provisrio da
Repblica, um plano econmico que tinha por
objetivo aumentar a oferta de moeda em
circulao, expandir o crdito e promover o
desenvolvimento nacional.
Entre as consequncias dessa crise, est
(A) o aumento da especulao financeira, a
desvalorizao da moeda e o crescimento
do desemprego.
(B) um enorme fluxo de capitais britnicos
em direo ao pas, com a consequente
diminuio da dvida externa brasileira.
(C) o crescimento da importao de produtos
estrangeiros e o enfraquecimento da
indstria nacional.
(D) o fortalecimento dos setores mdios e
populares urbanos, em decorrncia da
valorizao da moeda nacional naquele
contexto.

(A) Apenas I.
(B) Apenas II.
(C) Apenas III.

(E) a crise na produo do caf, substitudo


pelo acar como o principal produto
brasileiro de exportao.

(D) Apenas I e II.


(E) I, II e III.

UFRGS CV/2014 HIS

310

18. A greve geral dos trabalhadores porto-alegrenses de 1917 marca uma inflexo nas relaes entre
estes e o governo de Borges de Medeiros, ento governador do Estado pelo PRR. O governador
aceitou em parte as demandas dos operrios paredistas, como, por exemplo, a generalizao das
oito horas de trabalho e o controle de exportaes de produtos essenciais.
Essa aceitao deveu-se
(A) ameaa de sua deposio pelos operrios armados e organizados em barricadas pela cidade.
(B) lenta e gradual adoo de polticas esquerdistas por parte de Borges de Medeiros, que
culminaram com a Revoluo de 1923, de cunho marcadamente socialista.
(C) tentativa do PRR em enquadrar parcialmente o problema operrio sua poltica de governo,
com o intuito de restabelecer rapidamente a ordem na cidade.
(D) aliana entre operrios e maragatos, notrios apoiadores do governo borgista.
(E) ao ultimato dado pelo presidente da Repblica, Venceslau Brs, ao governador, j que o
governo federal apoiava a causa operria.
19. Em 1932, Franklin Delano Roosevelt foi eleito
presidente dos Estados Unidos, em meio
maior crise econmica experimentada por
aquele pas at ento.

20. Assinale com V (verdadeiro) ou F (falso) as


afirmaes abaixo, referentes ao Estado Novo
brasileiro (1937-1945).

Considere as seguintes afirmaes a respeito


de seu governo.

( ) Significou uma ruptura com as tendncias


centralizadoras dos anos anteriores e um
retorno poltica descentralizada, tpica
da Repblica Velha.

I - A implementao do chamado New Deal


consistia em um conjunto de medidas
governamentais destinadas a sanar os
problemas econmicos do pas, como, por
exemplo, a realizao de diversas obras
pblicas e a criao do segurodesemprego para os trabalhadores sem
ocupao.

( ) Imps uma Constituio autoritria ao


pas, popularmente conhecida como
Polaca, dada sua suposta inspirao na
constitiuio polonesa de 1935.
( ) Buscou incentivar a agroexportao de
produtos primrios, em detrimento da
industrializao do pas.

II - Os Estados Unidos mantiveram-se em


uma posio de neutralidade at
dezembro de 1941, quando o ataque
japons a Pearl Harbour forou-os a
entrar no conflito, ao lado dos Aliados,
contra as foras do Eixo.

( ) Implementou uma poltica de dura


represso aos opositores do regime e de
nacionalizao das minorias tnicas,
consideradas
ameaadoras,
como
italianos e alemes.

III- A Lei Seca, que proibia a venda e o


consumo de lcool em todo o territrio
norte-americano,
foi
anulada
pelo
Congresso.

A sequncia correta de preenchimento dos


parnteses, de cima para baixo,

Quais esto corretas?

(B) F V F V.

(A) V F V F.
(C) F F V F.

(A) Apenas I.

(D) V F V V.

(B) Apenas II.

(E) V V F V.

(C) Apenas I e III.


(D) Apenas II e III.
(E) I, II e III.

UFRGS CV/2014 HIS

311

21. Leia o texto abaixo.


Em plena Europa, em pleno sculo XX, os
regimes nazista e sovitico assassinaram
cerca de 14 milhes de pessoas. O lugar onde
todas essas vtimas morreram, essa terra de
sangue, se estende do centro da Polnia at o
oeste da Rssia, passando pela Ucrnia,
Bielorrsia e os Estados blticos. Durante a
consolidao do nacional-socialismo e do
stalinismo (1933-1938), a ocupao conjunta
da Polnia pelas foras alems e soviticas
(1939-1941) e, em seguida, durante a guerra
entre Alemanha e a Unio Sovitica (19411945), a violncia em massa de um modo
jamais visto na histria se abateu sobre essa
regio.

22. No bloco superior abaixo, esto listadas as


ditaduras militares do Cone Sul da Amrica do
Sul; no inferior, alguns fatos e caractersticas
de cada uma delas.

SNYDER, Timothy. Terras de sangue. A Europa


entre Hitler e Stalin. Rio de Janeiro:
Record, 2013. p. 10.

Assinale com V (verdadeiro) ou F (falso) as


afirmaes abaixo, referentes a esse perodo.
( ) Em 1939, os governos da Alemanha e da
URSS assinaram um acordo de no
agresso que ficou conhecido como
Pacto Molotov-Ribbentrop, respeitado at
o final da guerra.
( ) As principais lideranas desse extermnio
foram Adolf Hitler e Joseph Stalin.
( ) O nacional-socialismo era a ideologia do
regime stalinista.

Associe adequadamente o bloco inferior ao


superior.
1 - Ditadura militar chilena
2 - Ditadura militar argentina
3 - Ditadura militar brasileira
4 - Ditadura militar uruguaia
( ) Foi a pioneira na implantao das polticas
neoliberais na Amrica Latina, com a
atuao dos chamados Chicago Boys em
sua equipe econmica.
( ) Foi implementada a partir do golpe de
estado dado pelo prprio presidente da
repblica Juan Mara Bordaberry, em
junho de 1973, com o apoio das Foras
Armadas do pas.
( ) Utilizou amplamente os chamados Atos
Institucionais, decretos emitidos pelo
Poder Executivo que concediam diversos
poderes extraconstitucionais aos militares
que governavam o pas.
A sequncia correta de preenchimento dos
parnteses, de cima para baixo,

( ) A terra de sangue no se limitou


cronologia da Segunda Grande Guerra
Mundial.

(A) 1 2 3.

A sequncia correta de preenchimentos dos


parnteses, de cima para baixo,

(D) 1 4 3.

(B) 4 1 2.
(C) 4 3 2.
(E) 4 1 3.

(A) F V F V.
(B) V F F F.
(C) F V V F.
(D) V F V V.
(E) F F F V.

UFRGS CV/2014 HIS

312

23. Considere as afirmaes abaixo, sobre o


regime do apartheid, vigente na frica do Sul
entre 1948 e 1994.
I - Foi estabelecido em 1948, pelo Partido
Nacional,
vinculado
aos
brancos
descendentes de holandeses, e teve por
caracterstica
principal
a
rgida
segregao racial entre brancos e negros.

24. Assinale com V (verdadeiro) ou F (falso) as


afirmaes abaixo, referentes invaso e
guerra do Iraque pelos Estados Unidos (20032011).

II - Teve como principal fora de oposio o


Congresso Nacional Africano (CNA),
liderado por Nelson Mandela, considerado
culpado de traio pelo regime em 1963
e, por isso, preso at 1991.
III- Ocupou e transformou Angola em um
protetorado, durante a guerra civil
naquele pas.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas I e II.

( ) A invaso foi justificada pelo governo


americano em face da necessidade de
derrubar o ento presidente iraquiano
Saddam Hussein e de estabelecer um
regime democrtico naquele pas.
( ) A invaso do pas obteve amplo apoio
internacional e foi autorizada pelo
Conselho de Segurana da Organizao
das Naes Unidas (ONU).
( ) Os guerrilheiros curdos, durante a guerra,
lutaram ao lado das tropas norteamericanas.
( ) A guerra culminou com a sada das tropas
norte-americanas em dezembro de 2011,
derrotadas pelos insurgentes iraquianos,
que logo fundaram uma Repblica
islmica no pas.
A sequncia correta de preenchimentos dos
parnteses, de cima para baixo,

(D) Apenas II e III.

(A)
(B)
(C)
(D)
(E)

(E) I, II e III.

V V F F.
V F V V.
F V F V.
V F V F.
F F F V.

25. Observe a figura abaixo.

Adaptado de: <http://www.biskui.com.br/blog/?p=736>. Acesso em: 26 ago. 2013.

A figura, para alm do Prmio Nobel da Paz concedido Unio Europeia em 2012, faz referncia
(A) violenta represso aos protestos populares nos pases citados pela figura, resultantes da crise
econmica que assola o continente europeu.
(B) s insurreies armadas contra a Unio Europeia que eclodiram no continente, em 2011.
(C) conteno de movimentos separatistas pelos governos italiano, grego, espanhol e irlands,
com o apoio da Unio Europeia.
(D) ao sucesso da resistncia, apoiada pela Unio Europeia, s diversas tentativas de golpe de
estado em distintos pases europeus nos anos de 2010 e 2011.
(E) bem-sucedida luta contra os terroristas que ameaavam a realizao da Eurocopa 2012.

UFRGS CV/2014 HIS

10

313

2011
MATEMTICA
NESTA PROVA SERO UTILIZADOS OS
SEGUINTES SMBOLOS E CONCEITOS
COM OS RESPECTIVOS SIGNIFICADOS:
x

: mdulo do nmero x

: unidade imaginria

sen x : seno de x

cos x : cosseno de x
log x : logaritmo decimal de x

26. Uma torneira com vazamento pinga, de


maneira constante, 25 gotas de gua por
minuto. Se cada gota contm 0,2 mL de gua,
ento, em 24 horas o vazamento ser de
(A)

0,072 L.

(B)

0,72 L.

(C)

1,44 L.

(D)

7,2 L.

(E) 14,4 L.
27. A renda per capita de um pas a razo entre
seu PIB (Produto Interno Bruto) e sua
populao. A populao chinesa, em 2009,
representava 19,7% da populao mundial.
Nesse ano, o PIB chins foi de 4,9 trilhes de
dlares e a renda per capita chinesa foi de
3.620 dlares.
Com base nesses dados, correto afirmar
que, dentre os nmeros abaixo, o mais
prximo da populao mundial, em 2009,
(A) 5,6 10 9 .
(B) 6,8 10 9 .
(C) 7,2 10 9 .
(D) 5,6 1012 .
(E) 6,81012 .

UFRGS CV/2011 MAT

314

28. A lmpada incandescente atravessou o sculo


XX, mas, hoje, devido preocupao com o
aquecimento global, tende a se apagar. Nos
anos 90, houve a expanso dos modelos
compactos das lmpadas fluorescentes; e, em
2008, foi patenteada a lmpada LED.
O quadro abaixo apresenta os gastos
estimados, ao longo de cinco anos, com o uso
desses trs tipos de lmpadas, para uma casa
com vinte lmpadas.

Adaptado de: Veja, 30 dez. 2009.

Com base nessas informaes, considere as


seguintes afirmaes.
I - Quarenta
lmpadas
incandescentes
custam mais que uma lmpada LED.
II - O consumo de energia de uma lmpada
1
LED equivale a
do consumo de energia
6
de uma lmpada incandescente.
III- Em mdia, o tempo que uma lmpada
fluorescente leva para queimar sete
vezes maior que o tempo que uma
incandescente leva para queimar.
Quais esto corretas?
(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e II.
(E) Apenas II e III.

10

UFRGS CV/2011 MAT

315

29. Muitos brasileiros acessam a internet de


banda larga via celular.
Abaixo, est indicado, em milhes de pessoas,
o nmero de brasileiros com acesso internet
de banda larga, fixa ou mvel, desde o incio
do ano de 2007 at maro de 2010, segundo
dados publicados na imprensa.

Com base nessas informaes, correto


afirmar que
(A) o nmero de usurios da internet de
banda larga fixa decresceu nesses anos.
(B) o nmero de usurios de cada uma das
duas bandas largas cresceu igualmente
nesses anos.
(C) menos de 4% dos usurios da banda
larga usavam a banda larga mvel em
2007.
(D) o nmero de usurios da banda larga
mvel era 50% do nmero dos usurios
da banda larga fixa em 2009.
(E) o nmero de usurios da banda larga era
menor que 23 milhes em maro de
2010.

UFRGS CV/2011 MAT

11

316

30. Observe os grficos abaixo e o quadro a


seguir.

Adaptado de : Veja, 19 maio 2010.

Definio de classes sociais por


renda familiar mensal
Classe
Classe
Classe
Classe

AB
C
D
E

acima de 4.806 reais


de 1.115 a 4.806 reais
de 804 a 1.114 reais
at 803 reais

Os grficos e o quadro apresentam as


divises das classes sociais brasileiras por
renda familiar mensal em 2009 e a projeo
para 2014.
Se a taxa de variao da projeo de cada
uma das classes for constante, ento, o
nmero de brasileiros na classe AB superar,
pela primeira vez, o nmero total de
brasileiros nas classes D e E entre os anos de
(A) 2009 e 2010.
(B) 2010 e 2011.
(C) 2011 e 2012.
(D) 2012 e 2013.
(E) 2013 e 2014.

12

UFRGS CV/2011 MAT

317

31. Para cada nmero real x, tal que 0 x 3 ,


definimos a funo f tal que

f ( x) = A( x) ,

sendo A(x) a rea da superfcie sombreada


dos retngulos da figura abaixo, limitada
pelos eixos coordenados e pela reta vertical
de abscissa x.

Ento, f ( x) 5 se e somente se
(A) 0 x 1 .
(B) 1 x 2 .
(C) 1 x 3 .
(D)

4
x 3.
3

(E) 2 x 3 .

32. O paraleleppedo reto A, com dimenses de


8,5 cm, 2,5 cm e 4 cm, a reproduo em
escala 1:10 do paraleleppedo B.
Ento, o volume do paraleleppedo B, em cm3,

(A) 85.
(B) 850.
(C) 8.500.
(D) 85.000.
(E) 850.000.

UFRGS CV/2011 MAT

13

318

33. Trs nmeros formam uma progresso


geomtrica de razo 3. Subtraindo 8 unidades
do terceiro nmero, obteremos uma
progresso aritmtica cuja soma dos termos
(A) 16.
(B) 18.
(C) 22.
(D) 24.
(E) 26.
34. O quociente entre o ltimo e o primeiro termo
de uma sequncia de nmeros 1.000. Os
logaritmos decimais dos termos dessa
sequncia formam uma progresso aritmtica
1
de razo .
2
Ento, o nmero de termos da sequncia
(A) 3.
(B) 4.
(C) 5.
(D) 6.
(E) 7.
35. Aproximando log..2 por 0,301, verificamos
que o nmero 1610 est entre
(A) 10 9 e 1010 .
(B) 1010 e 1011 .
(C) 1011 e 1012 .
(D) 1012 e 1013 .
(E) 1013 e 1014 .

14

UFRGS CV/2011 MAT

319

36. O grfico do polinmio de coeficientes reais

p( x) = ax 2 + bx + c

est

representado

abaixo.

Com base nos dados desse grfico, correto


afirmar que os coeficientes a, b e c
satisfazem as desigualdades
(A)

a > 0; b < 0; c < 0 .

(B) a > 0; b < 0; c > 0 .


(C) a > 0; b > 0; c > 0 .
(D) a > 0; b > 0; c < 0 .
(E) a < 0; b < 0; c < 0 .

37. Um polinmio de 5 grau com coeficientes


reais que admite os nmeros complexos
2 + i e 1 2i como razes, admite
(A) no mximo mais uma raiz complexa.
(B) 2 i e 1 + 2i como razes.
(C) uma raiz real.
(D) duas razes reais distintas.
(E) trs razes reais distintas.

UFRGS CV/2011 MAT

15

320

38. O pentgono regular representado abaixo tem


o centro na origem do sistema de
coordenadas e um vrtice no ponto (0, 2) .

Girando esse pentgono, no plano XOY, em


torno de seu centro, de um ngulo de 228
no sentido horrio, as novas coordenadas do
vrtice A sero
(A) ( 3 , 1) .
(B) ( 3 , 1) .
(C) (1,

3) .

(D) (1,

3) .

(E) ( 1,

3) .

16

UFRGS CV/2011 MAT

321

39. Dentre as opes a seguir, a que pode


representar o grfico da funo definida por

f ( x) = (sen x + cos x ) + (sen x cos x )


2

(A)

(B)

(C)

(D)

(E)

UFRGS CV/2011 MAT

17

322

40. Traando os grficos das funes


definidas

por

f e g
f ( x) = sen x
e

g ( x) = cos x , com x variando no conjunto


dos nmeros reais de - 2 a 2 , no mesmo
sistema de coordenadas, o nmero de
intersees
(A)

7.

(B)

8.

(C)

9.

(D) 10.
(E) 12.
41. As
figuras
abaixo
apresentam
uma
decomposio de um tringulo equiltero em
peas que, convenientemente justapostas,
formam um quadrado.

O lado do tringulo mede 2 cm, ento, o lado


do quadrado mede, em centmetros,

(A)

3
.
3

(B)

3
.
2

(C)

3.

(D)

3.

(E)

3.

18

UFRGS CV/2011 MAT

323

42. A

superfcie

total

do

tetraedro

regular

representado na figura abaixo 9 3 . Os


vrtices do quadriltero PQRS so os pontos
mdios de arestas do tetraedro, como indica a
figura.

O permetro do quadriltero
(A) 4.
(B) 4 2 .
(C) 6.
(D) 5 3 .
(E) 6 3 .
43. Na figura abaixo, esto representados um
cubo de aresta 3 e uma pirmide triangular de
altura 9. Os pontos A, B e C so vrtices da
pirmide e do cubo, e V pertence ao
prolongamento de BG.

O volume comum aos dois slidos

15
.
2
(B) 8.
17
.
(C)
2
(A)

(D)

9.

(E)

19
.
2

UFRGS CV/2011 MAT

19

324

44. Observe o slido S formado por 6 cubos e


representado na figura abaixo.

Dentre as opes a seguir, o objeto que,


convenientemente composto com o slido S,
forma um paraleleppedo

(A)

(B)

(C)

(D)

(E)

20

UFRGS CV/2011 MAT

325

45. Um tipo de descarga de gua para vaso


sanitrio formado por um cilindro com altura
de 2 m e dimetro interno de 8 cm.
Ento, dos valores abaixo, o mais prximo da
capacidade do cilindro
(A)

7 L.

(B)

8 L.

(C)

9 L.

(D) 10 L.
(E) 11 L.
46. Na figura abaixo, o crculo est inscrito no
tringulo equiltero.

Se a equao do crculo x
ento, o lado do tringulo mede

+ y2 = 2y ,

(A) 2.
(B) 2 3 .
(C) 3.
(D) 4.
(E) 4 3 .

UFRGS CV/2011 MAT

21

326

47. No hexgono regular representado na figura


abaixo, os pontos A e B possuem,
respectivamente, coordenadas (0,0) e (3,0).

A reta que passa pelos pontos E e B


(A) y =

3x + 3 3 .

(B) y =

3x + 3 .

(C) y = 3 x

+ 3.

(D) y = 3 x

+ 3 3.

(E)

y = 3x + 3 .

48. Rasgou-se uma das fichas onde foram


registrados o consumo e a despesa
correspondente de trs mesas de uma
lanchonete, como indicado abaixo.

Nessa lanchonete, os sucos tm um preo


nico, e os sanduches tambm.
O valor da despesa da mesa 3
(A) R$ 5,50.
(B) R$ 6,00.
(C) R$ 6,40.
(D) R$ 7,00.
(E) R$ 7,20.
22

UFRGS CV/2011 MAT

327

49. O resultado de uma partida de futebol foi 3x2.


A probabilidade de que o time vencedor tenha
marcado os dois primeiros gols
(A) 15%.
(B) 20%.
(C) 30%.
(D) 40%.
(E) 45%.
50. Uma pessoa nascida em 06/01/92 permutou a
sequncia dos dgitos 0, 6, 0, 1, 9, 2 para
compor uma senha de 6 dgitos para um
carto bancrio. A probabilidade de que na
senha escolhida o algarismo 9 aparea antes
do algarismo 2
(A) 0,2.
(B) 0,25.
(C) 0,3.
(D) 0,4.
(E) 0,5.

UFRGS CV/2011 MAT

23

328

2012
MATEMTICA

28. Sendo a, b e c nmeros reais, considere as


seguintes afirmaes.

NESTA PROVA SERO UTILIZADOS OS


SEGUINTES SMBOLOS E CONCEITOS
COM OS RESPECTIVOS SIGNIFICADOS:

I - Se a 0 , b 0 e a < b , ento
II - Se c 0 , ento

sen x : seno de x

log 2 x : logaritmo de base 2 de x

a+b a b
= + .
c
c c

b0

III- Se

1 1
< .
a b

c0,

( a b ) c = a ( b c ).

Quais esto corretas?

26. Considere que o corpo de uma determinada


pessoa contm 5,5 litros de sangue e 5
milhes de glbulos vermelhos por milmetro
cbico de sangue.

(A)
(B)
(C)
(D)
(E)

Com base nesses dados, correto afirmar que


o nmero de glbulos vermelhos no corpo
dessa pessoa

Apenas I.
Apenas II.
Apenas I e II.
Apenas II e III.
I, II e III.

29. Considere

(A) 2,75 10 9 .

ento

f (x ) = 4x

(B) 5,5 1010 .

as

funes
2
2x 1 e

f e g tais que

g( x ) = 3 2x . A

soma dos valores de f ( x ) que satisfazem a

(C) 5 10 .

igualdade f ( x ) = g ( x )

(D) 5,5 1012 .

(A) 4.

11

(B) 2.

(E) 2,75 1013 .

27. O dispensador de dinheiro do caixa eletrnico


de um banco foi abastecido apenas com
cdulas de R$ 5,00 e de R$ 20,00. Um cliente,
ao realizar um saque, constatou que o
dispensador liberou 6 cdulas. Entre elas,
havia pelo menos uma de cada valor.

(C)

0.

(D)

3.

(E)

4.

30. O

Com base nesses dados, correto afirmar que


a nica alternativa que apresenta uma
quantia que poderia ter sido sacada pelo
cliente
(A) R$ 90,00.

1+

conjunto

1
1
1+
x

soluo

igual ao conjunto soluo da equao


2
(A) x x 1 = 0 .

2
(C) x x + 1 = 0 .

(C) R$100,00.
(D) R$110,00.

2
(D) x + x + 1 = 0 .

(E) R$120,00.

2
(E) x + x 1 = 0 .

329

equao

= x , com x 0 e x 1 ,

2
(B) x + x 1 = 0 .

(B) R$ 95,00.

da

31. Os grficos abaixo apresentam, em milhes, o nmero de pobres em diferentes regies do planeta
entre os anos 1981 e 2001 e a projeo do nmero de pobres para 2015.

Adaptado de: Scientific American Brasil, ano I, n. 7, 2011.

As regies do planeta correspondentes aos nmeros I, II, III, IV, V, VI, constantes nos grficos so as
seguintes:
I
II
III
IV
V
VI

Regies do Planeta
Amrica Latina e Caribe
Oriente Mdio e norte da frica
Europa e sia Central
leste da sia e Pacfico
sul da sia
frica Subsaariana

Com base nas informaes contidas nesses grficos, correto afirmar que
(A) o sul da sia foi a regio que teve maior diminuio percentual no nmero de pobres, no
perodo de 1981 at 2001.
(B) o nmero de pobres na Europa e sia central apresentou um aumento entre 400% e 500% de
1981 at 2001.
(C) a regio com o menor nmero de pobres, em 2001, foi o leste da sia e Pacfico.
(D) a projeo de aumento do nmero de pobres da Amrica Latina e Caribe, no perodo de 1981 a
2015, de 120%.
(E) a projeo de decrscimo do nmero de pobres na frica Subsaariana, no perodo de 1990 a
2015, de 29%.

330

32. A sequncia

(a 1 , a 2 , a 3 , a 4 , a 5 , ..., a12 )

forma uma progresso aritmtica. Sabendo-se


que a 3 + a 10 = 32 , o valor da expresso

log 2 ( a 1 + a 12 ) 3

34. Na figura abaixo, ABCD um quadrado e os


tringulos
sombreados
so
tringulos
semelhantes
tais
que
as
alturas
correspondentes formam uma progresso
1
geomtrica de razo .
2

(A) 10.
(B) 15.
(C) 21.
(D) 26.
(E) 32.
33. Em um sistema de coordenadas cartesianas,

sero

traados

tringulos

issceles.

Os

vrtices da base do primeiro tringulo so os


pontos A( 1 , 2) e B(2 , 2) ; os vrtices da
base do segundo tringulo so C(3,5 , 2) e

Se o permetro do tringulo ABC 1, a soma


dos permetros dos quatro tringulos
sombreados

D(6,5 , 2) ; o terceiro tringulo tem os


vrtices de sua base nos pontos E (8 , 2) e

(A)

9
.
8

(B)

11
.
8

(C)

13
.
8

(D)

15
.
8

(E)

17
.
8

F(11 , 2) . Prosseguindo com esse padro de


construo, obtm-se uma sequncia de
tringulos.
Com base nesses dados, correto afirmar que
a abscissa do vrtice oposto base do 18
tringulo
(A) 74,5.
(B) 75,5.
(C) 76.
(D) 76,5.
(E) 77.

331

35. Considere

f (x) = k +

funo
f
tal
2 x 1
5
, com k > 0 .

que

36. O nmero log2 7 est entre

(A)
(B)
(C)
(D)
(E)

Assinale a alternativa correspondente ao


grfico que pode representar a funo f.

0
1
2
3
4

e
e
e
e
e

1.
2.
3.
4.
5.

(A)
37. Se

raiz

dupla

do

polinmio

p( x ) = 2 x 4 7 x 3 + 3x 2 + 8x 4 , ento a

soma das outras razes


(A)
(B)
(C)
(D)
(E)

(B)

38. O

-1.
-0,5.
0.
0,5.
1.
nmero

de

intersees

da

funo

f ( x ) = sen 5x com o eixo das abscissas no


intervalo [ 2 , 2 ]
(A)
(B)
(C)
(D)
(E)

(C)

10.
14.
21.
24.
27.

39. Um disco de raio 1 gira ao longo de uma reta


coordenada na direo positiva, como
representado na figura abaixo.

(D)

Considerando-se que o ponto P est


inicialmente na origem, a coordenada de P,
aps 10 voltas completas, estar entre
(E)

(A) 60 e 62.
(B) 62 e 64.
(C) 64 e 66.
(D) 66 e 68.
(E) 68 e 70.

332

40. Observe os discos de raios 2 e 4, tangentes


entre si e s semirretas s e t, representados
na figura abaixo.

43. Assinale a alternativa que apresenta


corretamente os valores, na mesma unidade
de medida, que podem representar as
medidas dos lados de um tringulo.

(A) 1 2 4
(B) 3 2 6
(C) 8 4 3
(D) 3 9 4
(E) 6 4 5
A distncia entre os pontos P e Q
(A)
(B)
(C)
(D)
(E)

44. Os crculos desenhados na figura abaixo so


tangentes dois a dois.

9.
10.
11.
12.
13.

41. Se duplicarmos a medida da aresta da base


de uma pirmide quadrangular regular e
reduzirmos sua altura metade, o volume
desta pirmide

(A)
(B)
(C)
(D)
(E)

ser reduzido quarta parte.


ser reduzido metade.
permanecer inalterado.
ser duplicado.
aumentar quatro vezes.

42. Os pontos

A(1, 2) , B(6 , 2) e C so os

vrtices de um tringulo equiltero, sendo o


segmento AB a base deste.

A razo entre a rea de um crculo e a rea


da regio sombreada

O seno do ngulo formado pela o eixo das


abscissas e a reta suporte do lado BC no
sentido anti-horrio

(A) 1.
(B) 2.

1
(A) .
2
3
.
(B)
2

(C)
(D)
(E)

1
.
2

(C)

3
.
4

(D)

.
4

(E)

2
.
4

2
.
2
3
.
2

333

45. Um cilindro tem o eixo horizontal como


representado na figura abaixo. Nessa posio,
sua altura de 2 m e seu comprimento, de
5 m.

47. Observe, abaixo, o crculo representado no


sistema de coordenadas cartesianas.

A regio sombreada representa a seo do


cilindro por um plano horizontal distante
1,5 m do solo. A rea dessa superfcie
(A)

Uma das alternativas a seguir apresenta a


equao desse crculo. Essa alternativa

3.

(B) 2 2 .
(C) 2 3 .

(A) ( x 2) 2 + ( y 3) 2 = 10 .

(D) 5 2 .

(B) ( x + 2) + ( y + 3) = 13 .

(E) 5 3 .

(C) ( x 2) + ( y 3) = 13 .

(D) ( x 2) + y = 10 .
2

46. As equaes das retas representadas no sistema


de coordenadas cartesianas abaixo so

2x + y 3 = 0 ,

(E) x + ( y + 3) = 13 .
2

48. Inovando na forma de atender aos clientes,


um restaurante serve alimentos utilizando
pratos de trs cores diferentes: verde,
amarelo e branco. Os pratos da mesma cor
custam o mesmo valor. Na mesa A, foram
consumidos os alimentos de 3 pratos verdes,
de 2 amarelos e de 4 brancos, totalizando um
gasto de R$.88,00. Na mesa B, foram
consumidos os alimentos de 2 pratos verdes e
de 5 brancos, totalizando um gasto de
R$.64,00. Na mesa C, foram consumidos os
alimentos de 4 pratos verdes e de 1 amarelo,
totalizando um gasto total de R$ 58,00

5x 4 y 8 = 0 e

x 3y + 3 = 0

Comparando o valor do prato branco com o valor


dos outros pratos, verifica-se que esse valor
(A) 80% do valor do prato amarelo.

As equaes de r e s so, respectivamente,

(B) 75% do valor do prato amarelo.

(A) 2 x + y 3 = 0

e x 3y + 3 = 0 .

(C) 50% do valor do prato verde.

(B) 2 x + y 3 = 0

e 5x 4 y 8 = 0 .

(D) maior que o valor do prato verde.

(C) 5x 4 y 8 = 0 e x 3y + 3 = 0 .
(D) x 3y + 3 = 0

e 2x + y 3 = 0 .

(E) x 3y + 3 = 0

e 5x 4 y 8 = 0 .

(E) a tera parte do valor da soma dos


valores dos outros pratos.

334

49. Uma forma de se jogar sinuca consiste em


encaapar 15 bolas numeradas de 1 a 15 , assim
distribudas: uma bola preta, duas verdes, duas
vermelhas, duas azuis, duas amarelas, duas
rosas, duas roxas e duas laranjas. Para se iniciar
o jogo, as bolas so dispostas em cinco linhas
sobre uma superfcie em forma de tringulo
equiltero; a primeira linha deve conter uma
bola; a segunda, duas; e assim sucessivamente,
como se observa na figura abaixo.

A probabilidade de que este tringulo tenha


dois de seus vrtices formados por bolas de
uma mesma cor de
(A)

1
.
8

(B)

1
.
6

(C)

1
.
5

(D)

1
.
4

(E)

1
.
3

50. Para a disputa da Copa do Mundo de 2014 as 32


selees que se classificarem sero divididas em
8 grupos, os quais sero constitudos de 4
selees cada um. Nos jogos da primeira fase,
cada seleo jogar com todas as outras selees
do seu grupo. Uma empresa adquiriu um
ingresso para cada jogo da primeira fase do
mesmo grupo. Ao sortear dois ingressos entre
seus funcionrios a probabilidade de que esses
ingressos envolvam uma mesma seleo

(A)
(B)
(C)
(D)
(E)

20%.
25%.
50%.
80%.
85%.

335

2013
MATEMTICA

NESTA PROVA SERO UTILIZADOS OS


SEGUINTES SMBOLOS E CONCEITOS
COM OS RESPECTIVOS SIGNIFICADOS:

28. A nave espacial Voyager, criada para estudar


planetas do Sistema Solar, lanada da Terra
em 1977 e ainda em movimento, possui
computadores com capacidade de memria
de 68 kB (quilo bytes). Atualmente, existem
pequenos aparelhos eletrnicos que possuem
8 GB (giga bytes) de memria.
Observe os dados do quadro a seguir.

sen x : seno de x

10n

cos x : cosseno de x

Prefixo

Smbolo

24

iota

21

zeta

18

exa

15

peta

12

tera

giga

mega

quilo

hecto

deca

da

10

| x |: mdulo de x

10

log x : logaritmo de x na base 10

10
10
26. Um adulto humano saudvel abriga cerca de
100 bilhes de bactrias, somente em seu
trato digestivo.

10

10
10

Esse nmero de bactrias pode ser escrito


como

10
10
10

(A) 10 .
(B)
(C)

1010 .

Considerando as informaes do enunciado e os


dados do quadro, a melhor estimativa, entre as
alternativas abaixo, para a razo da memria de
um desses aparelhos eletrnicos e da memria
dos computadores da Voyager,

11

10 .

(D) 10 .
12

(E)

27. O

1013 .
algarismo

das

unidades

da

(A)
100.
(B)
1.000.
(C)
10.000.
(D) 100.000.
(E) 1.000.000.

soma

4454 + 5545
(A) 0.
(B) 1.
(C) 2.
(D) 3.
(E) 4.

29. A massa das medalhas olmpicas de Londres


2012 est entre 375 g e 400 g. Uma medalha
de ouro contm 92,5% de prata e 1,34% de
ouro, com o restante em cobre. Nessa
olimpada, os Estados Unidos ganharam 46
medalhas de ouro.
Supondo que todas as medalhas de ouro
obtidas pelos atletas estadunidenses tinham a
massa mxima, a quantidade de ouro que
esses atletas ganharam em conjunto
(A) menor do que 0,3 kg.
(B) est entre 0,3 kg e 0,5 kg.
(C) est entre 0,5 kg e 1 kg.
(D) est entre 1 kg e 2 kg.
(E) maior do que 2 kg.

12

UFRGS CV/2013 MAT

336

30. O grfico e os dados abaixo mostram a


precipitao de chuva que ocorreu nos meses de
setembro, outubro e novembro no ano de 2011 e
a previso para os mesmos meses em 2012.
Tambm apresentam a mdia histrica dessa
precipitao, para as regies leste e sul do
Estado do Rio Grande do Sul.

31. A interseo dos grficos das funes f e g,

definidas por f ( x ) = x

e g ( x) = 1 x ,

os quais so desenhados no mesmo sistema


de coordenadas cartesianas, determina um
polgono.
A rea desse polgono
(A) 0,125.
(B) 0,25.
(C) 0,5.
(D) 1.
(E) 2.

32. Dada

funo

f,

definida

por

f ( x) = x + 9 6 x , o nmero de valores
2

de

que

satisfazem

f(x)= f(x)

igualdade

(A) 0.
(B) 1.
(C) 2.
(D) 3.
Adaptado de: Zero Hora, 08 set. 2012, p. 20.

(E) 4.

Com base nesses dados, correto afirmar que


(A) a previso de chuvas para o ms de
novembro de 2012, na regio leste,
exatamente 25% superior mdia
histrica da regio.
(B) a quantidade de chuvas, na regio sul, foi
igual mdia histrica da regio, nos meses
de setembro dos anos de 2011 e 2012.
(C) a previso de chuvas para a regio leste,
no ms de outubro de 2012, 60% da
quantidade de chuvas, na mesma regio,
no mesmo ms de 2011.
(D) a quantidade de chuvas, na regio sul,
em outubro de 2011, superou a mdia
histrica dessa regio em 26%.
(E) a quantidade de chuvas prevista para o
ms de novembro de 2012, na regio
leste, supera exatamente em 150% a
quantidade de chuvas da regio, no
mesmo ms, em 2011.
UFRGS CV/2013 MAT

13

337

33. Se

34. Denominando P a soma dos nmeros pares


de 1 a 100 e I a soma dos nmeros mpares
de 1 a 100, P I

(A) 49.
(B) 50.
(C) 51.
(D) 52.
(E) 53.

o grfico da funo f definida por y = f ( x ) ,


ento, das alternativas abaixo, a que pode
representar o grfico da funo z, definida por

z = f (x) ,

35. A sequncia representada, na figura abaixo,


formada por infinitos tringulos equilteros. O
lado do primeiro tringulo mede 1, e a medida
do lado de cada um dos outros tringulos

2
3

da

medida

do

lado

do

tringulo

imediatamente anterior.

(A)

(B)

A soma dos permetros dos tringulos dessa


sequncia infinita

(C)

(A) 9.

(D)

(B) 12.
(C) 15.
(D) 18.
(E) 21.

36. Se a1 , a2 ,..., a100 uma progresso aritmtica

de

razo

r,

ento

a1 a100 , a2 a99 ,..., a50 a51 ,

(E)

sequncia

uma

progresso
(A) geomtrica de razo 2r.
(B) geomtrica de razo r.
(C) aritmtica de razo r.
(D) aritmtica de razo r.
(E) aritmtica de razo 2r.

14

UFRGS CV/2013 MAT

338

37. Dez bactrias so cultivadas para uma


experincia, e o nmero de bactrias dobra a
cada 12 horas.

40. Os lados de um losango medem 4 e um dos


seus ngulos 30. A medida da diagonal
menor do losango

Tomando como aproximao para log 2 o


valor 0,3, decorrida exatamente uma semana,
o nmero de bactrias est entre
(A) 10

4,5
5

5, 5

2+ 3 .

(C) 4 2

3.

(D) 2 2 +

3.

(E) 4 2 +

3.

6,5

5, 5

3.

e 10 .

(D) 10 e 10
(E) 10

(B)

e 10 .

(B) 10 e 10
(C) 10

(A) 2 2

6,5

e 10 .

38. As razes do polinmio p ( x ) = x + 5 x + 4 x


so
3

41. Na figura abaixo, os tringulos retngulos so


congruentes e possuem catetos com medidas
a e b.

(A) -4, -1 e 0.
(B) -4, 0 e 1.
(C) -4, 0 e 4.
(D) -1, 0 e 1.
(E) 0, 1 e 4.
39. A funo f definida por f ( x ) = sen 2 x e

g uma funo cujo grfico no intercepta o


grfico de f , quando representadas no
mesmo sistema de coordenadas cartesianas.
Entre as alternativas que seguem, a nica que
pode representar g(x)
(A)

sen x .

A rea da regio sombreada

(B) log x .
(C)

(A) 2ab .

| x |.

(B) a + b .
2

(D) 2 x + 3 .

(C) a + 2ab + b .

(E) 3 + 2 .

(D)

a 2 2ab + b 2 .

(E) a b .
2

UFRGS CV/2013 MAT

15

339

42. Observe a figura abaixo.

44. Considere as seguintes proposies


modelos de planificao de um cubo.

de

No quadrado ABCD de lado 2, os lados AB e


BC so dimetros dos semicrculos. A rea da
regio sombreada
(A) 3

(B) 4

II

.
.

III

(C) 3 .
(D) 4 .
(E) 3

43. Dois crculos tangentes e de mesmo raio tm


seus respectivos centros em vrtices opostos de
um quadrado, como mostra a figura abaixo.

IV

Se a medida do lado do quadrado 2, ento


a rea do tringulo ABC mede

Entre essas proposies de modelos de


planificao, quais podem resultar em um
cubo?
(A) I, II e V.

(A) 3 2 2 .

(B) III, IV e V.

(B) 6 4 2 .

(C) II, III e IV.

(C) 12 4 2 .

(D) II, IV e V.

(
).
(E) (6 4 2 ) .

(D)

32 2

(E) I, III e V.

16

UFRGS CV/2013 MAT

340

45. Um slido geomtrico foi construdo dentro de


um cubo de aresta 8, de maneira que dois de
seus vrtices, P e Q, sejam os pontos mdios
respectivamente das arestas AD e BC, e os
vrtices da face superior desse slido
coincidam com os vrtices da face superior do
cubo, como indicado na figura abaixo.

47. Um crculo tangencia a reta r, como na figura


abaixo.

O volume desse slido

O centro do crculo o ponto (7, 2) e a reta r


definida pela equao 3 x 4 y + 12 = 0 .

(A)

64.

A equao do crculo

(B)
(C)
(D)
(E)

128.
256.
512.
1024.

(A) ( x 7) + ( y 2) = 25 .
2

(B) ( x + 7) + ( y + 2) = 25 .
2

(C) ( x 7) + ( y + 2) = 36 .
2

46. Considere os grficos das funes f e g ,

definidas

por

f ( x) = x + x 2
2

(D) ( x 7) + ( y 2) = 36 .
2

g ( x) = 6 x , representadas no mesmo
sistema de coordenadas cartesianas, e os
pontos A e B, interseo dos grficos das
funes f e g , como na figura abaixo.

(E) ( x + 7) + ( y 2) = 36 .
2

48. O sistema de equaes

5x + 4 y + 2 = 0

3x 4 y 18 = 0
possui
(A) nenhuma soluo.
(B) uma soluo.
(C) duas solues.
A distncia entre os pontos A e B

(D) trs solues.

(A) 2 2 .

(E) infinitas solues.

(B) 3 2 .
(C) 4 2 .
(D) 5 2 .
(E) 6 2 .
UFRGS CV/2013 MAT

17

341

49. Sobre uma mesa, h doze bolas numeradas de 1


a 12; seis bolas so pretas, e seis, brancas. Essas
bolas sero distribudas em 3 caixas
indistinguveis, com quatro bolas cada uma.

Escolhendo aleatoriamente uma caixa de uma


dessas distribuies, a probabilidade de que
essa caixa contenha apenas bolas pretas
(A)
(B)
(C)
(D)
(E)

1
.
33
1
.
23
2
.
33
1
.
11
1
.
3

50. Observe a figura abaixo.

Na figura, um tringulo equiltero est inscrito


em um crculo, e um hexgono regular est
circunscrito ao mesmo crculo. Quando se lana
um dardo aleatoriamente, ele atinge o desenho.
A probabilidade de que o dardo no tenha
atingido a regio triangular
(A) 32,5%.
(B) 40%.
(C) 62,5%.
(D) 75%.
(E) 82,5%.

18

UFRGS CV/2013 MAT

342

2014
MATEMTICA
26. O algarismo das unidades de 9

10

(A) 0.
(B) 1.
(C) 3.
(D) 6.
(E) 9.
27. A atmosfera terrestre contm 12.900
quilmetros cbicos de gua. Esse valor
corresponde, em litros, a
(A)

1,29 10 9 .

(B)

1,29 1012 .

(C)

1,29 1015 .

(D)

1,29 1016 .

(E)

1,29 1018 .

28. Considere a , b e c trs nmeros reais no


nulos, sendo a b c , e as afirmaes
abaixo.
(I)

a b

(II) a
(III) b

b c
b

c b

Quais afirmaes so verdadeiras?


(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e II.
(E) Apenas II e III.

UFRGS CV/2014 MAT

11

343

29. Uma

mercadoria com preo inicial de


sofreu reajustes mensais e

R$ 500,00

acumulados de 0,5%. O preo


mercadoria, ao fim de 12 meses,

dessa

(A) 500 0 ,005 .


12

(B) 500 0 ,05 .


12

(C) 500 1,005 .


12

(D) 500 1,05 .


12

(E) 500 0 ,5 .
12

30. O grfico abaixo mostra o registro das


temperaturas mximas e mnimas em uma
cidade, nos primeiros 21 dias do ms de
setembro de 2013.

Assinale a alternativa correta com base nos


dados apresentados no grfico.
(A) No dia 13, foi registrada a menor
temperatura mnima do perodo.
(B) Entre os dias 3 e 7, as temperaturas
mximas foram aumentando dia a dia.
(C) Entre os dias 13 e 19, as temperaturas
mnimas diminuram dia a dia.
(D) No dia 19, foi registrada a menor
temperatura mxima do perodo.
(E) No dia 19, foi registrada
temperatura do perodo.

a menor

UFRGS CV/2014 MAT

12

344

31. Na compra de trs unidades idnticas de uma


mesma mercadoria, o vendedor oferece um
desconto de 10% no preo da segunda
unidade e um desconto de 20% no preo da
terceira unidade. A primeira unidade no tem
desconto. Comprando trs unidades dessa
mercadoria, o desconto total
(A) 8%.
(B) 10%.
(C) 22%.
(D) 30%.
(E) 32%.
32. Construdas
coordenadas

x2

y2

no
mesmo
sistema
de
cartesianas, as inequaes

4 e y

x 1 delimitam uma

regio no plano. O nmero de pontos que


esto no interior dessa regio e possuem
coordenadas inteiras
(A) 5.
(B) 6.
(C) 7.
(D) 8.
(E) 9.

33. Considere as funes


f ( x ) 4 2x
e

f e g, definidas por
g( x ) 2 f ( x ) 2 .

Representadas no mesmo sistema


coordenadas cartesianas, a funo

de

intercepta o eixo das ordenadas no ponto A e


o eixo das abscissas no ponto B, enquanto a
funo g intercepta o eixo das ordenadas no
ponto D e o eixo das abscissas no ponto C.
A rea do polgono ABCD
(A) 4,5.
(B) 5,5.
(C) 6,5.
(D) 7,5.
(E) 8,5.
UFRGS CV/2014 MAT

13

345

34. Nas malhas de pontos da figura abaixo, dois


pontos adjacentes, na horizontal ou vertical,
encontram-se a distncia de 1 centmetro.

Considerando a sucesso de quadrilteros


desenhados em cada etapa da figura, a rea
2

do quadriltero da vigsima etapa, em cm ,


(A) 100.
(B) 200.
(C) 400.
(D) 800.
(E) 1.600.
35. Considere
o
padro
de
construo
representado pelos desenhos abaixo.

Na etapa 1, h um nico quadrado com lado


1. Na etapa 2, esse quadrado foi dividido
em nove quadrados congruentes, sendo
quatro deles retirados, como indica a
figura. Na etapa 3 e nas seguintes, o
mesmo processo repetido em cada um
dos quadrados da etapa anterior.
Nessas condies, a rea restante, na etapa 5,

(A)
(B)
(C)
(D)
(E)

125
.
729
125
.
2187
625
.
729
625
.
2187
625
.
6561
UFRGS CV/2014 MAT

14

346

36. A funo

f, definida por f ( x )

2,

intercepta o eixo das abscissas em


(A)

2.

(B)

1.

(C)

1
.
2

(D) 0 .
(E)

1
.
2

37. Atribuindo para log 2 o valor 0,3 , ento os


valores

de

log 0,2

log 20

so,

respectivamente,
(A)

0,7 e 3 .

(B)

0,7 e 1,3 .

(C)

0,3 e 1,3 .

(D)

0,7 e 2,3 .

(E)

0,7 e 3 .

38. Considere

q( x )

os
2

equao

polinmios

p( x )

x3

x . O nmero de solues da
p( x ) q( x ) , no conjunto dos

nmeros reais,
(A) 0.
(B) 1.
(C) 2.
(D) 3.
(E) 4.
UFRGS CV/2014 MAT

15

347

39. Na figura abaixo, o retngulo ABCD tem lados


que medem 6 e 9.

Se a rea do paralelogramo sombreado 6, o


cosseno de

(A)
(B)
(C)
(D)
(E)

3
.
5
2
.
3
3
.
4
4
.
5
8
.
9

40. A figura abaixo formada por oito


semicircunferncias, cada uma com centro
nos pontos mdios dos lados de um octgono
regular de lado 2.

A rea da regio sombreada


(A)

4 8 8 2 .

(B)

(C)

4 4 8 2 .

(D)

4 4 2.

(E)

2 8 2.

8 4 2.

UFRGS CV/2014 MAT

16

348

41. Os vrtices do hexgono sombreado, na


figura abaixo, so pontos mdios das arestas
de um cubo.

Se o volume do cubo 216, o permetro do


hexgono
(A)

3 2.

(B)

6 2.

(C)

9 2.

(D)

12 2 .

(E)

18 2 .

42. No cubo de aresta 10, da figura abaixo,


encontra-se
representado
um
slido
sombreado com as alturas indicadas no
desenho.

O volume do slido sombreado


(A) 300.
(B) 350.
(C) 500.
(D) 600.
(E) 700.
UFRGS CV/2014 MAT

17

349

43. Na figura abaixo, encontra-se representada a


planificao de um slido de base quadrada
cujas medidas esto indicadas.

O volume desse slido


(A) 144.
(B) 180.
(C) 216.
(D) 288.
(E) 360.

44. Considere um cilindro reto de altura 32 e raio


da base 3, e uma esfera com volume igual ao
do cilindro.

Com essas condies, o raio da esfera


(A) 4.
(B) 6.
(C) 8.
(D) 10.
(E) 12.
45. Um cone reto com raio da base medindo 10 cm e
altura de 12 cm ser seccionado por um plano
paralelo base, de forma que os slidos
resultantes da seco tenham o mesmo
volume.
A altura do cone resultante da seco deve,
em cm, ser
(A) 6 .
(B) 8 .
(C)

6 2.

(D)

63 2 .

(E)

63 4 .
UFRGS CV/2014 MAT

18

350

46. A

rea

de

um

quadrado

circunferncia de equao

inscrito

na

2y

(A)

1
.
2

(B)

1.

(C)

2.

(D)

2.

(E)

2 2.

47. No pentgono representado no sistema de


coordenadas cartesianas abaixo, os vrtices
possuem coordenadas inteiras.

As retas suporte dos


interceptam-se no ponto
(A)

5,

4
.
3

(B)

5,

5
.
2

(C)

5,

5
.
3

(D)

5,

5
.
4

(E)

5,

6
.
5

lados

AE

BC

UFRGS CV/2014 MAT

19

351

48. Para os jogos da primeira fase da Copa do


Mundo de 2014 na sede de Porto Alegre,
foram sorteados ingressos entre aqueles que
se inscreveram previamente. Esses ingressos
foram divididos em 4 categorias, identificadas
pelas letras A, B, C e D. Cada pessoa podia
solicitar, no mximo, quatro ingressos por
jogo. Os ingressos da categoria D foram
vendidos somente para residentes no pas
sede e custaram, cada um,

1
do valor unitrio
3

do ingresso da categoria C.
No quadro abaixo, esto representadas as
quantidades de ingressos, por categoria,
solicitados por uma pessoa, para cada um dos
jogos da primeira fase, e o valor total a ser
pago.
Jogo

TOTAL (em R$)

1.060,00

1.160,00

810,00

Se essa pessoa comprasse um ingresso de


cada categoria para um dos jogos da primeira
fase, ela gastaria, em reais,
(A) 860.
(B) 830.
(C) 800.
(D) 770.
(E) 740.

UFRGS CV/2014 MAT

20

352

49. Considere as retas r e s, paralelas entre si.


Sobre a reta r, marcam-se 3 pontos distintos:
A, B e C; sobre a reta s, marcam-se dois
pontos distintos: D e E.
Escolhendo ao acaso um polgono cujos
vrtices coincidam com alguns desses pontos,
a probabilidade de que o polgono escolhido
seja um quadriltero de
(A)

1
.
4

(B)

1
.
3

(C)

1
.
2

(D)

2
.
3

(E)

3
.
4

50. Considere a configurao dos nmeros


dispostos nas colunas e linhas abaixo.

O nmero localizado na linha 15 e na coluna


13
(A) 15.
(B) 91.
(C) 105.
(D) 120.
(E) 455.
UFRGS CV/2014 MAT

21

353

Gabaritos
FS
LIT
ESP
ING
POR
BIO
QU
GEO
HIS
MAT

FS
LIT
ESP
ING
POR
BIO
QU
GEO
HIS
MAT

01
D
26
C
51
A
51
D
01
D
01
B
26
B
51
E
01
E
26
D

01
B
26
C
51
A
51
D
01
A
01
D
26
C
51
A
01
D
26
E

02
D
27
B
52
C
52
B
02
B
02
A
27
E
52
E
02
B
27
B

02
C
27
A
52
E
52
D
02
E
02
B
27
E
52
B
02
D
27
A

03
E
28
B
53
E
53
A
03
A
03
E
28
A
53
A
03
C
28
B

03
A
28
D
53
D
53
A
03
B
03
A
28
D
53
D
03
A
28
B

04
C
29
E
54
E
54
E
04
D
04
C
29
A
54
B
04
D
29
C

04
A
29
E
54
A
54
C
04
E
04
B
29
B
54
D
04
E
29
C

05
B
30
E
55
A
55
B
05
B
05
A
30
D
55
A
05
E
30
D

05
D
30
A
55
C
55
C
05
D
05
A
30
D
55
C
05
E
30
A

06
A
31
A
56
D
56
D
06
E
06
D
31
C
56
B
06
A
31
E

06
B
31
B
56
D
56
E
06
A
06
B
31
C
56
E
06
A
31
B

07
C
32
C
57
A
57
C
07
C
07
B
32
D
57
D
07
E
32
D

07
C
32
C
57
B
57
A
07
E
07
D
32
B
57
B
07
C
32
B

08
C
33
B
58
B
58
E
08
C
08
C
33
E
58
B
08
A
33
B

08
D
33
D
58
E
58
B
08
D
08
D
33
A
58
D
08
D
33
E

09
E
34
B
59
B
59
D
09
E
09
D
34
E
59
D
09
B
34
E

09
A
34
A
59
B
59
B
09
C
09
E
34
C
59
C
09
C
34
D

10
A
35
C
60
D
60
A
10
B
10
A
35
B
60
C
10
C
35
D

10
C
35
B
60
C
60
E
10
A
10
E
35
E
60
D
10
B
35
A

11
C
36
A
61
C
61
B
11
D
11
A
36
C
61
D
11
D
36
A

11
E
36
D
61
E
61
C
11
B
11
D
36
A
61
A
11
E
36
C

2011
12
B
37
A
62
E
62
C
12
E
12
E
37
E
62
A
12
C
37
C

13
D
38
E
63
A
63
A
13
C
13
E
38
D
63
A
13
D
38
A

2012
12
A
37
D
62
E
62
E
12
B
12
C
37
C
62
E
12
C
37
B

13
A
38
E
63
D
63
D
13
C
13
C
38
E
63
C
13
B
38
C

354

14
A
39
D
64
B
64
B
14
A
14
D
39
E
64
D
14
D
39
B

15
E
40
C
65
B
65
C
15
B
15
A
40
D
65
C
15
E
40
B

16
C
41
B
66
C
66
E
16
D
16
E
41
D
66
A
16
B
41
C

17
B
42
D
67
D
67
D
17
E
17
B
42
B
67
C
17
E
42
C

18
D
43
E
68
A
68
C
18
D
18
B
43
C
68
B
18
C
43
E

19
E
44
E
69
E
69
C
19
C
19
C
44
C
69
B
19
C
44
A

20
B
45
C
70
D
70
A
20
A
20
E
45
A
70
C
20
A
45
D

21
A
46
B
71
C
71
D
21
A
21
B
46
C
71
C
21
B
46
B

22
E
47
A
72
B
72
A
22
C
22
C
47
C
72
E
22
C
47
A

23
B
48
B
73
E
73
D
23
D
23
E
48
B
73
E
23
B
48
A

24
D
49
A
74
D
74
D
24
C
24
D
49
A
74
E
24
D
49
C

25
A
50
D
75
C
75
B
25
E
25
C
50
B
75
B
25
A
50
E

14
B
39
B
64
C
64
B
14
B
14
B
39
D
64
B
14
E
39
B

15
D
40
E
65
D
65
B
15
D
15
E
40
A
65
D
15
B
40
D

16
D
41
C
66
E
66
D
16
A
16
A
41
A
66
A
16
A
41
D

17
C
42
B
67
B
67
A
17
D
17
B
42
B
67
E
17
B
42
E

18
C
43
A
68
A
68
A
18
C
18
B
43
B
68
B
18
A
43
E

19
E
44
C
69
A
69
B
19
C
19
E
44
D
69
D
19
E
44
D

20
C
45
B
70
B
70
E
20
C
20
C
45
C
70
E
20
C
45
E

21
B
46
C
71
D
71
C
21
A
21
A
46
E
71
B
21
C
46
A

22
A
47
E
72
A
72
B
22
D
22
D
47
A
72
E
22
A
47
C

23
E
48
E
73
C
73
D
23
B
23
C
48
B
73
C
23
D
48
A

24
E
49
A
74
C
74
C
24
C
24
A
49
B
74
A
24
E
49
C

25
B
50
D
75
B
75
A
25
E
25
D
50
D
75
C
25
D
50
D

FS
LIT
ESP
ING
PO
R
BIO
QU
GE
O
HIS
MA
T

FS
LIT
ESP
ING
POR
BIO
QU
GEO
HIS
MAT

01
A
26
B
51
B
51
E

02
E
27
C
52
E
52
D

03
B
28
D
53
D
53
B

04
A
29
B
54
A
54
D

05
C
30
A
55
A
55
D

06
C
31
B
56
E
56
C

07
B
32
A
57
B
57
D

08
D
33
C
58
C
58
B

09
C
34
E
59
D
59
B

10
D
35
D
60
C
60
D

11
A
36
E
61
A
61
D

01
C
26
B

02
C
27
A

03
C
28
D

04
B
29
B

05
B
30
A

06
B
31
C

07
D
32
D

08
A
33
E

09
C
34
D

10
B
35
E

08
C
33
D

09
E
34
B

08
E
33
E
58
D
58
B
08
A
08
D
33
A
58
C
08
B
33
E

09
B
34
A
59
A
59
A
09
B
09
C
34
D
59
E
09
E
34
D

01
E

51
A

01
B
26
C

01
A
26
B
51
B
51
A
01
D
01
C
26
A
51
B
01
A
26
B

02
C

52
E
02
C
27
B

02
D
27
E
52
C
52
E
02
D
02
C
27
D
52
E
02
C
27
D

03
D

53
B
03
B
28
D

03
A
28
E
53
D
53
D
03
B
03
E
28
C
53
B
03
A
28
A

04
C

54
B
04
C
29
A

04
B
29
C
54
E
54
B
04
E
04
D
29
B
54
A
04
D
29
C

05
B

55
C
05
D
30
D

05
A
30
D
55
A
55
C
05
C
05
E
30
A
55
D
05
B
30
E

06
D

56
B
06
D
31
C

06
E
31
D
56
E
56
C
06
A
06
A
31
E
56
A
06
E
31
B

07
C

57
B

07
E
32
B

07
C
32
B
57
A
57
A
07
C
07
B
32
E
57
E
07
B
32
B

08
A

58
C

09
B

59
E

2013
12
C
37
E
62
E
62
E

13
D
38
C
63
D
63
C

14
E
39
D
64
B
64
B

15
D
40
A
65
D
65
A

16
C
41
C
66
B
66
A

17
E
42
E
67
D
67
A

18
A
43
B
68
A
68
E

19
A
44
A
69
E
69
D

20
E
45
C
70
B
70
C

21
B
46
C
71
C
71
C

22
D
47
A
72
A
72
E

23
D
48
B
73
E
73
A

24
E
49
D
74
A
74
C

25
B
50
D
75
C
75
A

11
E
36
C

12
B
37
D

13
C
38
C

14
D
39
B

15
D
40
A

16
A
41
C

17
E
42
A

18
A
43
B

19
B
44
E

20
D
45
D

21
D
46
E

22
E
47
B

23
A
48
E

24
E
49
D

25
C
50
C

10
D
35
A

11
A
36
E

12
C
37
B

13
D
38
A

22
D
47
A

23
A
48
B

24
B
49
A

25
E
50
C

10
C
35
C
60
E
60
E
10
D
10
B
35
D
60
D
10
D
35
E

11
D
36
C
61
C
61
C
11
B
11
D
36
E
61
B
11
E
36
C

22
D
47
D
72
B
72
C
22
E
22
E
47
B
72
C
22
D
47
C

23
C
48
C
73
A
73
A
23
E
23
B
48
C
73
E
23
C
48
A

24
E
49
A
74
B
74
B
24
B
24
B
49
D
74
C
24
D
49
A

25
C
50
D
75
E
75
A
25
A
25
E
50
D
75
A
25
A
50
C

10
A

60
A

11
C

61
D

12
B

62
E

13
D

63
E

2014
12
B
37
A
62
A
62
D
12
D
12
A
37
B
62
D
12
C
37
B

13
D
38
B
63
D
63
C
13
D
13
B
38
A
63
B
13
B
38
D

355

14
B

64
D

15
E

16
D

17
E

67
C

18
A

68
C

19
B

69
A

20
A

70
C

21
C

14
D
39
E

65
A

15
A
40
C

66
D

71
A

16
C
41
D

17
E
42
E

18
C
43
A

19
B
44
E

20
E
45
C

21
A
46
E

14
C
39
A
64
E
64
A
14
C
14
A
39
E
64
E
14
C
39
D

15
E
40
E
65
B
65
D
15
E
15
A
40
C
65
D
15
C
40
A

16
B
41
D
66
C
66
B
16
C
16
D
41
C
66
C
16
E
41
E

17
D
42
A
67
D
67
E
17
A
17
B
42
B
67
A
17
A
42
C

18
B
43
B
68
C
68
D
18
E
18
D
43
B
68
C
18
C
43
A

19
B
44
E
69
A
69
E
19
A
19
A
44
A
69
E
19
E
44
B

20
B
45
C
70
D
70
D
20
C
20
A
45
C
70
D
20
B
45
E

21
A
46
B
71
B
71
A
21
B
21
C
46
D
71
B
21
A
46
D

22
D

72
D

23
E

73
C

24
E

74
E

25
A

75
B