Você está na página 1de 82

Biologia 2

Gentica

Captulo 01
0 1. Unisa-SP A palavra fentipo indica a manifestao, num indviduo, de suas caractersticas: a) unicamente morfolgicas. b) morfolgicas e fisiolgicas apenas. c) herdveis e no-herdveis. d) hereditrias, congnitas e adquiridas. e) estruturais, funcionais e comportamentais. 0 2. Genes dominantes: a) existem em maior nmero na populao. b) tendem a desaparecer com o tempo. c) sempre condicionam caractersticas favorveis. d) sempre expressam a sua caracterstica. e) nunca condicionam anomalias hereditrias. 03 . UFF-RJ Genes que se localizam no mesmo lcus em ambos os cromossomos de um par e que respondem pela manifestao de um certo carter denominam-se: a) homlogos. d) homozigticos. b) alelos. e) hbridos. c) co-dominantes. 0 4. Dizemos que um determinado gene recessivo quando sua expresso (fentipo): a) s acontece em heterozigose. b) s ocorre quando em dose dupla. c) independe da presena de seu alelo. d) depende de caractersticas congnitas. e) reproduz uma caracterstica provocada pelo ambiente. 05. UFRN A figura a seguir apresenta os tipos de lobo da orelha, uma caracterstica que determinada pelos alelos E (livre ou descolado) e e (preso ou colado). Os gentipos possveis para os tipos de lobo da orelha so: a) E, e, Ee. b) EE, ee. c) Ee, ee. d) EE, Ee, ee. 06. UFMG Algumas pessoas demonstram uma transpirao excessiva mesmo em condies ambientais normais. Esse carter determinado por um alelo dominante S. Como ser o gentipo de uma pessoa normal? a) ss d) S b) SS e) s c) Ss 07. UFPA Ordene a primeira coluna de acordo com a segunda e assinale a ordem correta. I. Gene recessivo IV. Gene alelo II. Fentipo V. Gentipo III. Gene ( ) Unidade de transmisso hereditria. ( ) Patrimnio gentico de um indivduo. ( ) Genes que ocupam o mesmo lcus em cromossomos homlogos. ( ) Aspectos externos (morfolgicos ou funcionais) de um indivduo. ( ) S manifesta o carter quando est em dose dupla. a) b) c) d) e) III, V, IV, II, I V, III, II, IV, I III, II, IV, V, I III, II, I, V, IV III, V, I, II, IV

08. PUC-SP modificado Casais cuja pigmentao da pele normal e que apresentam gentipo I podem ter filhos albinos. O gene para o albinismo II e no se manifesta nos indivduos III . So albinos apenas os indivduos de gentipo IV . No trecho acima, as lacunas I, II, III e IV devem ser preenchidas, correta e respectivamente, por: a) AA, dominante, homozigotos e aa. b) AA, recessivo, homozigotos e Aa. c) Aa, dominante, heterozigotos e aa. d) Aa, recessivo, heterozigotos e aa. e) aa, dominante, heterozigotos e AA.
65

PV2D-07-BIO-24

09. Devido ao fenmeno da dominncia: a) dois gentipos diferentes podem apresentar o mesmo fentipo. b) dois fentipos diferentes podem corresponder ao mesmo gentipo. c) a correspondncia entre fentipos e gentipos muito varivel. d) cada fentipo corresponde sempre a um nico gentipo. e) dois gentipos diferentes correspondem sempre a dois fentipos diferentes. 10. Vunesp Certo tipo de anomalia aparece em filhos de pais normais e, no entanto, trata-se de uma manifestao hereditria. Como voc explica esse fato? a) Os pais so homozigticos. b) Os filhos anormais so heterozigticos. c) A anomalia condicionada por gene dominante. d) O gene para a anomalia recessivo. e) Os filhos anormais so mutantes. 11. Fuvest-SP Dois clones de mudas obtidas a partir de um mesmo clone de plantas verdes foram colocados em ambientes diferentes: um claro e outro escuro. Depois de alguns dias, as plantas que ficaram no escuro estavam estioladas (plantas pobres em cor, mais longas que o normal), o que significa que os dois grupos apresentavam: a) o mesmo gentipo e fentipos diferentes. b) o mesmo fentipo e gentipos diferentes. c) gentipos e fentipos iguais. d) gentipos e fentipos diferentes. e) gentipos variados em cada grupo. 12. Fuvest-SP Certa planta apresenta duas variedades: uma, encontrada ao nvel do mar, produz sementes redondas; a outra, encontrada nas montanhas, produz sementes ovais. Descreva um experimento que permita verificar se a diferena na forma das sementes decorre de diferenas entre seus gentipos ou das diferenas ambientais. 13. O cruzamento de 2 linhagens de tomate, uma que produz estames vermelhos e outra que produz estames amarelos, resultou na gerao seguinte, indivduos produzindo estames vermelhos. A cor vermelha dos estames deve ser: a) caracterstica recessiva. b) caracterstica semidominante. c) caracterstica dominante. d) caracterstica transmitida de forma no mendeliana. e) caracterstica no hereditria.
66

14. FCC-SP Suponha que as plantas produtoras de flores vermelhas tenham sido cruzadas durante vrias geraes, dando sempre descendentes de flores vermelhas. Esses dados permitem supor que: a) o gene para a cor vermelha dominante. b) o gene para a cor vermelha recessivo. c) as plantas cruzadas eram homozigotas para o gene que determina flores vermelhas. d) as plantas cruzadas eram heterozigotas para o gene que determina flores vermelhas. e) a cor vermelha da flor resulta de um fator ambiental. 15. Fuvest-SP modificado Como se pode explicar o carter hereditrio da fibrose cstica, sabendo-se que, em todos os casos, os doentes so filhos de pais normais? a) um carter recessivo, os pais so normais e homozigotos. b) um carter dominante, os pais so normais e homozigotos. c) um carter recessivo, os pais so normais e heterozigotos. d) um carter dominante, os pais so normais e heterozigotos. e) um carter recessivo, ligado aos cromossomos sexuais. 16. UESC-BA Correlacione os termos utilizados em gentica com seus conceitos. I. Lcus II. Gentipo III. Cromossomos homlogos IV. Fentipo 1. forma como um carter se expressa 2. possuem a mesma seqncia gnica 3. local ocupado 4. constituio gentica de um indivduo Assinale a alternativa que possui as correlaes corretas. a) I 1; II 2; III 3; IV 4 b) I 4; II 3; III 2; IV 1 c) I 2; II 1; III 4; IV 3 d) I 3; II 4; III 2; IV 1 e) I 3; II 1; III 4; IV 2 17. Unisa-SP Do cruzamento de um casal de ratos de cauda curta nasceram ratinhos de cauda curta e um ratinho de cauda longa. Foram, ento, feitas vrias suposies a respeito da transmisso desse carter. Assinale a que lhe parecer mais correta. a) Cauda curta dominante sobre a cauda longa. b) Ambos os pais so homozigotos. c) Ambos os pais so heterozigotos. d) Cauda longa dominante sobre cauda curta. e) As suposies a e c so aceitveis.

18. Fuvest-SP No porquinho-da-ndia existe um par de genes autossmicos que determina a cor da pelagem: o alelo dominante B determina a cor preta, e o recessivo b, a cor branca. Descreva um experimento que possa evidenciar se um porquinho preto homozigoto ou heterozigoto. 19. FGV-SP Sabe-se que o casamento consangneo, ou seja, entre indivduos que so parentes prximos, resulta numa maior freqncia de indivduos com anomalias genticas. Isso pode ser justificado pelo fato de os filhos apresentarem: a) maior probabilidade de heterozigoses recessivas. b) maior probabilidade de homozigoses recessivas. c) menor probabilidade de heterozigoses dominantes. d) menor probabilidade de homozigoses dominantes. e) menor probabilidade de homozigoses recessivas. 20. UFC-CE modificado Os termos a seguir fazem parte da nomenclatura gentica bsica. Assinale as alternativas que trazem o significado correto de cada um desses termos. 01. Gene sinnimo de molcula de DNA. 02. Gentipo a constituio gentica de um indivduo. 04. Dominante um dos membros de um par de alelos que se manifesta inibindo a expresso do outro. 08. Fentipo a expresso do gene em determinado ambiente. 16. Genoma o conjunto de todo o DNA contido nos cromossomos de uma espcie. Some os nmeros dos itens corretos.

21. Unicamp-SP Ao estudar a distribuio de uma espcie de planta da famlia dos girassis em altitudes crescentes na costa oeste dos Estados Unidos, pesquisadores observam que essas plantas apresentavam um gradiente decrescente de tamanho. Sementes dessas plantas foram coletadas nas vrias altitudes e plantadas em uma mesma regio localizada ao nvel do mar. Aps um determinado tempo de crescimento, as plantas resultantes foram medidas e os dados obtidos no experimento so mostrados no grfico A.

a) Explique o resultado obtido, expresso no grfico A. b) Se o resultado do experimento tivesse sido o representado no grfico B, qual seria a interpretao?

Captulo 02
22. UFPI Uma ovelha branca, ao cruzar com um carneiro branco, teve um filhote de cor preta. Quais os gentipos dos pais, se a cor branca dominante? a) Ambos so homozigotos recessivos. b) Ambos so brancos heterozigotos. c) Ambos so homozigotos dominantes. d) A me Bb e o pai BB. e) A me bb e o pai Bb. 23. Fuvest-SP Uma mulher normal, cujo pai apresentava surdomudez de herana autossmica recessiva, casou-se com um homem normal, cuja me era surda-muda. Quais os possveis gentipos correspondentes na prole do casal? 24. Um touro amarelo (caracu) cruzou vrias vezes com uma vaca preta da raa Polled angus e desse cruzamento resultaram trs bezerros amarelos e dois pretos. O mesmo touro cruzou vrias vezes com outra vaca preta da mesma raa, e desse cruzamento resultaram seis bezerros pretos. a) Explique o tipo de herana. b) Qual o gentipo do touro e das duas vacas? 25. PUC-SP Na mosca-das-frutas (drosfila), a cor cinzenta do corpo completamente dominante sobre a preta. O cruzamento de um indivduo preto com um heterozigoto produziu 90 moscas, incluindo pretas e cinzentas. Qual o nmero mais provvel de moscas pretas, entre as 90 moscas? a) 22 b) 25 c) 45 d) 75 e) 7 26. Fuvest-SP O gene autossmico que condiciona plos curtos no coelho dominante em relao ao gene que determina plos longos. Do cruzamento entre coelhos heterozigotos nasceram 480 coelhinhos, dos quais 360 tinham plos curtos. Entre esses coelhinhos de plos curtos, o nmero esperado de heterozigotos : a) 180 b) 240 c) 90 d) 120 e) 360
67

PV2D-07-BIO-24

27. Vunesp Um pesquisador selecionou casais de ratos em que ambos os pais eram cinza e tinham filhotes brancos e cinza. Entre os 60 filhotes cinza encontrados na prole desses casais, o nmero provvel de filhotes heterozigotos : a) 40 d) 15 b) 30 e) 10 c) 20 28. PUCCamp-SP Nos coelhos, a cor preta dos plos dominante em relao cor branca. Cruzaram-se coelhos pretos heterozigotos entre si e nasceram 360 filhotes. Destes, o nmero de heterozigotos provavelmente : a) zero d) 270 b) 90 e) 360 c) 180 29. Fuvest-SP Numa certa espcie de inseto, a presena de asas condicionada por um gene autossmico (gene que se encontra em cromossomo que no participa da definio de sexo) dominante A, sendo que o recessivo a, quando em dose dupla, determina a ausncia de asas. Do cruzamento de uma fmea com asas, cujo pai no tinha asas, com um macho sem asas nascem 800 descendentes. Quantos insetos sem asas esperamos encontrar entre eles? a) 50 d) 400 b) 100 e) 800 c) 200 30. FCMSC-SP Em coelhos, o gene L condiciona plos curtos e o seu alelo d condiciona plos longos. Vrios cruzamentos entre indivduos heterozigotos produziram 66 coelhos com plos curtos e 21 coelhos com plos longos. Se todos os 66 coelhos, com plos curtos, forem cruzados com indivduos com plos longos e cada cruzamento produzir 6 filhotes, quantos filhotes com plos longos esperamos desses cruzamentos? 31. UFMA A galactosemia uma doena gentica causada por um gene autossmico recessivo em humanos. Indivduos galactosmicos apresentam, entre outras manifestaes, a incapacidade de degradar a lactose existente no leite materno. Considerando os smbolos G e g para representar os alelos dominantes e recessivos, respectivamente, responda s questes abaixo. a) Qual seria o fentipo de indivduos GG, Gg e gg? b) Qual seria o resultado do percentual fenotpico do cruzamento entre um indivduo galactosmico com indivduo normal, filho de um galactosmico? 32. Unisa-SP Do casamento de Antnio com Marlia, ambos normais para o carter pigmentao da pele, nasceu Clarice, que albina. Qual a probabilidade de o segundo filho desse casal ser tambm albino? a) 100% d) 25% b) 85% e) 10% c) 60%
68

33. A polidactilia (dedo a mais) determinada por um gene dominante. A me e o marido de uma mulher so normais, porm ela apresenta a polidactilia. Qual a probabilidade de o casal ter uma criana com esse carter? a) 1/2 d) 1/4 b) 3/4 e) 1/16 c) 3/8 34. FEI-SP Num homem heterozigoto, para determinado carter, a porcentagem provvel de espermatozides que contero o gene recessivo desse carter de: a) 0% d) 75% b) 25% e) 100% c) 50% 35. Fuvest-SP Qual a porcentagem de descendentes Aa nascidos de uma me Aa? a) 25% d) 100% b) 50% e) Depende do pai. c) 75% 36. UFPI Denise, de olhos escuros, casada com Lauro, de olhos claros. Sr. Luiz, pai de Denise, tinha olhos claros. Sabendo que os olhos escuros so dominantes sobre os olhos claros, pode-se afirmar corretamente que: ( ) a probabilidade de o casal ter filhos com olhos claros de 25%. ( ) a probabilidade de o quarto filho do casal ter olhos claros de 50%. ( ) a probabilidade de o casal ter filhos com olhos escuros de 75%. ( ) a me de Denise possui olhos escuros. 37. Fuvest-SP Em uma famlia, h vrias geraes, aparecem indivduos afetados por um defeito conhecido como ectrodactilia, que se caracteriza por uma fenda que d s mos dos indivduos afetados o aspecto de garra de lagosta. A ectrodactilia tem herana autossmica dominante. A chance de um indivduo heterozigoto, afetado por ectrodactilia, ter uma criana com ectrodactilia, se casar com uma mulher normal, de: a) 10% d) 50% b) 20% e) 80% c) 40% 38. UFV-MG Observe o quadro abaixo. Gametas BX bX BY BB (flores lilases) Bb (flores lilases) bY Bb (flores lilases) bb (flores brancas)

BB e bb flores lilases e flores brancas, respectivamente, homozigticas ou puras Bb flores lilases heterozigticas

Com base nas informaes acima, assinale a afirmativa correta. a) As caractersticas recessivas so aquelas que no se manifestam na gerao F1 e que permanecem ocultas na gerao F2. b) O cruzamento de plantas com flores lilases puras resulta numa gerao seguinte constituda somente por plantas de flores lilases. c) Os fatores genticos passam de pais para filhos por meio dos gametas, que so formados na meiose. d) O cruzamento de plantas lilases heterozigticas com plantas brancas pode resultar em 50% de plantas lilases puras e 50% de brancas. e) As caractersitcas dominantes so aquelas que aparecem nos indivduos da gerao F2. 39. Mackenzie-SP Em uma determinada planta, o padro das nervuras foliares pode ser regular ou irregular. Do cruzamento entre duas plantas com nervuras irregulares, originou-se uma F1 composta por plantas com nervuras regulares e outras com nervuras irregulares. A partir desses dados, assinale a alternativa incorreta. a) As plantas cruzadas so heterozigotas. b) A proporo fenotpica em F1 de 3/4 de indivduos irregulares e de 1/4 de indivduos regulares. c) Todos os F1 com nervuras irregulares so heterozigotos. d) Se um indivduo F1 com nervuras regulares for cruzado com um indivduo da gerao P, surgiro indivduos regulares e irregulares na proporo 1 : 1. e) Os indivduos F1 de nervuras regulares s podem ser homozigotos. 40. Fuvest-SP Um gato preto (A) foi cruzado com duas gatas (B e C) tambm pretas. O cruzamento do gato A com a gata B produziu 8 filhotes, todos pretos; o cruzamento do gato A com a gata C produziu 6 filhotes pretos e 2 amarelos. A anlise desses resultados permite concluir que: a) a cor preta dominante, A e C so homozigotos. b) a cor preta dominante, A e B so homozigotos. c) a cor preta dominante, A e C so heterozigotos. d) a cor preta recessiva, A e C so homozigotos. e) a cor preta recessiva, B e C so heterozigotos. 41. Fuvest-SP Em uma populao de mariposas, 96% dos indivduos tm cor clara e 4% cor escura. Indivduos escuros cruzados entre si produzem, na maioria das vezes, descendentes claros e escuros. J os cruzamentos entre indivduos claros produzem sempre apenas descendentes de cor clara. Esses resultados sugerem que a cor dessas mariposas condicionada por:

a) um par de alelos, sendo o alelo para cor clara dominante sobre o que condiciona cor escura. b) um par de alelos, sendo o alelo para cor escura dominante sobre o que condiciona cor clara. c) um par de alelos, que no apresenta dominncia um sobre o outro. d) manifestao do carter que depende do alimento disponvel para o indivduo. e) fatores ambientais, como a colorao dos troncos onde elas pousam. 42. Unifesp Em um cruzamento de um indivduo AA com outro aa, considerando que o alelo A dominante sobre a, a proporo fenotpica observada em F2 significa exatamente que: a) 25% da prole expressa o fentipo determinado pelo alelo dominante e 75% no o expressa. b) em 25% da prole, o fentipo recessivo mascarado pelo fentipo dominante. c) 75% da prole expressa o fentipo determinado pelo alelo A e 25% no o expressa. d) em 50% da prole, o fentipo dominante mascarado pelo fentipo recessivo. e) 50% da prole possui um nico tipo de alelo e 50% possui outro tipo de alelo. 43. Fuvest-SP Em seu trabalho com ervilhas, publicado em 1866, Mendel representou os fatores hereditrios determinantes dos estados amarelo e verde do carter cor da semente pelas letras A e a, respectivamente. O conhecimento atual a respeito da natureza do material hereditrio permite dizer que a letra A usada por Mendel simboliza: a) um segmento de DNA com informao para uma cadeia polipeptdica. b) um segmento de DNA com informao para um RNA ribossmico. c) um aminocido em uma protena. d) uma trinca de bases do RNA mensageiro. e) uma trinca de bases do RNA transportador. 44. Fuvest-SP A acondroplasia uma doena esqueltica de nanismo com encurtamento dos membros e aumento da cabea. Uma mulher acondroplsica, casada com um primo igualmente acondroplsico, tem dois filhos; o primeiro apresenta acondroplasia e o segundo no apresenta a anomalia em questo. A partir desses dados, correto afirmar que: a) a acondroplasia tem herana recessiva e o casal homozigoto dominante. b) a acondroplasia tem herana dominante e o casal homozigoto recessivo. c) o filho acondroplsico s pode ser homozigoto, j que afetado pela doena. d) o filho normal heterozigoto, pois os pais so homozigotos AA e aa. e) a acondroplasia determinada por alelo dominante e o casal heterozigoto.
69

PV2D-07-BIO-24

45. Uma pequena cidade interiorana do Nordeste brasileiro chamou a ateno de pesquisadores da Universidade de So Paulo pela alta incidncia de uma doena autossmica recessiva neurodegenerativa. As pesquisas realizadas revelaram que tambm alto o nmero de casamentos consangneos na cidade. Outro dado interessante levantado pelos pesquisadores foi que a populao da cidade acredita que a doena seja transmitida de uma gerao a outra atravs do sangue.
Pesquisa Fapesp, julho de 2005.

Pelas informaes fornecidas no texto, podemos afirmar que: a) pais saudveis de filhos que apresentam a doena so necessariamente homozigotos. b) homens e mulheres tm a mesma probabilidade de apresentar a doena. c) em situaes como a descrita, casamentos consangneos no aumentam a probabilidade de transmisso de doenas recessivas. d) pais heterozigotos tm 25% de probabilidade de terem filhos tambm heterozigotos. e) pais heterozigotos tm 50% de probabilidade de terem filhos que iro desenvolver a doena. 46. UFRJ modificado A matria publicada no jornal O Globo, em 02 de julho de 1995, com o ttulo Teste ajuda a evitar doenas congnitas foi ilustrada com o esquema abaixo, representando o mecanismo de transmisso da fibrose cstica.

47. Unicamp-SP Em experimento feito no incio do sculo, dois pesquisadores retiraram os ovrios de uma cobaia albina e implantaram-lhe um ovrio obtido de uma cobaia preta. Mais tarde, o animal foi cruzado com um macho albino e deu origem a uma prole toda preta. a) Sabendo-se que o albinismo caracterstica recessiva, como voc explica esse resultado? b) Indique os gentipos da fmea preta e da prole. c) Se fosse possvel implantar os plos da fmea preta na fmea albina, em vez de transplantar o ovrio, o resultado seria o mesmo? Justifique. 48. Vunesp Suponha que voc tenha em seu jardim exemplares da mesma espcie de ervilha utilizada por Mendel em seus experimentos. Alguns desses exemplares produzem sementes lisas e outros, sementes rugosas. Sabendo que a caracterstica lisa das sementes da ervilha determinada por um alelo dominante L, portanto por gentipos LL ou Ll, e sabendo, ainda, que as flores so hermafroditas e que sementes produzidas por autofecundao so viveis: a) planeje um cruzamento experimental entre flores de exemplares diferentes que lhe permita determinar se uma planta que produz sementes lisas homozigota ou heterozigota para esse carter. b) no caso de ocorrer autofecundao em uma planta que produz sementes lisas e heterozigota, qual seria a proporo esperada de descendentes com sementes rugosas? 49. UFC-CE Rogrio, um fazendeiro do municpio de Redeno, estava muito feliz com a sua nova compra, um legtimo touro mocho (sem chifres) que lhe custou os olhos da cara, como se diz no interior. No entanto, ele teve uma grande surpresa quando cruzou o touro com 3 vacas e obteve os seguintes filhotes: com a vaca I foram obtidos, somente, descendentes sem chifres; com a vaca II, chifruda, obteve-se um descendente chifrudo; e, finalmente, com a vaca III, mocha, foi obtido um descendente chifrudo. Para esta raa de animal, o carter mocho (sem chifres) determinado por um gene autossmico dominante em relao ao carter presena de chifres. Rogrio, sem entender muito de hereditariedade, e muito zangado, foi procurar uma geneticista da UFC com as seguintes perguntas: Obs.: utilizar a letra maiscula A para o gene dominante e a minscula a para o recessivo. a) Quais os gentipos dos animais envolvidos nos cruzamentos? b) Aps a identificao dos gentipos dos animais, que explicao gentica foi dada a Rogrio, a respeito da sua infelicidade na compra do touro? 50. Udesc Nas plantas de arroz (Oryza sativa L.), as espiguetas podem ser com arista ou sem arista (mtica). A partir do cruzamento de duas cultivares completamente

O esquema publicado apresenta um erro. Assinale a opo que faz referncia a esse erro. a) Os indivduos de 3 a 6 so heterozigotos para a fibrose cstica. b) A fibrose cstica causada pela presena de um par de genes recessivos. c) A doena se manifesta quando dois indivduos portadores so cruzados. d) O indivduo 8 portador do alelo para a fibrose cstica. e) O indivduo 18 afetado pela fibrose cstica e no portador desta doena.
70

homozigotas (puras) para essa caracterstica, sendo uma com arista e outra sem arista, foram obtidos os seguintes resultados: Populaes Pai Me F1 (primeira gerao aps o cruzamento) F2 (segunda gerao aps o cruzamento) Fentipos das plantas Com arista Sem arista 400 0 0 320 560 370 0 125

53. Fafifor-CE A capacidade de sentir o gosto de uma substncia amarga chamada feniltiocarbamida (PTC) deve-se a um gene dominante. A probabilidade de um casal (sensvel a essa substncia e heterozigtico) ter um filho de sexo feminino e sensvel ao PTC : a) 1/4 c) 3/4 b) 1/8 d) 3/8 54. UFMT modificado Qual a probabilidade de haver descendentes heterozigotos do sexo feminino nascidos de pais heterozigotos? a) 1/4 d) 1/32 b) 3/8 e) 1/2 c) 1/16 55. Um casal, no albino, teve dois filhos, os dois albinos. Qual a probabilidade de a prxima criana do casal ser uma menina normal, mas portadora do alelo para o albinismo? a) 50% d) 12,5% b) 75% e) 100% c) 25% 56. PUC-RS Estudos genticos permitiram verificar que um casal tem 1/4 de probabilidade de ter um descendente com uma determinada anomalia. Esse casal tem _________ de probabilidade de ter um descendente do sexo masculino e portador da disfuno gentica mencionada. a) 2/3 b) 3/9 c) 1/8 d) 2/5 e) 1/25 57. UFPR modificado Considere um casal em que ambos os indivduos so heterozigotos. A probabilidade de virem a ter um filho homem e heterozigoto para este gene de: a) 25% b) 75% c) 12,5% d) 0% e) 50% 58. Unimontes-MG O albinismo uma doena autossmica recessiva. Considerando um casal em que a mulher normalmente pigmentada, mas portadora do gene mutado, e o homem tem albinismo, qual a chance de que, entre os quatro filhos do casal, nesta ordem, uma criana seja normal e as outras trs portadoras da doena? a) 1/2 b) 1/8 c) 2/8 d) 1/16
71

A respeito disso: a) fornea uma provvel explicao para a herana do carter; b) especifique o gentipo das plantas envolvidas nos cruzamentos; c) qual a proporo fenotpica das plantas F2; d) conceitue gene e alelo. 51. UFMG O mal de Huntington uma doena autossmica dominante caracterizada por deteriorao mental progressiva, convulses e morte. Os indivduos afetados so heterozigotos. Analise este grfico, em que se mostra o percentual de indivduos doentes entre aqueles que possuem gentipo favorvel.

Com base nas informaes desse grfico e em outros conhecimentos sobre o assunto, incorreto afirmar que: a) em torno dos 65 anos, cerca de 85% dos indivduos heterozigotos j manifestaram a doena. b) antes de atingirem a idade de 15 anos, indivduos portadores do alelo mutante podem expressar a doena. c) aos 30 anos, aproximadamente 75% dos indivduos Aa se apresentam sem os sinais clnicos da doena. d) aos 40 anos, filhos de casais Aa x aa tm 50% de probabilidade de manifestar a doena. 52. A fenilcetonria uma doena causada pela presena de um alelo recessivo p em homozigose. Um casal normal, mas portador do gene que causa a doena, tem uma filha. Qual a probabilidade de essa menina apresentar a fenilcetonria?

PV2D-07-BIO-24

59. Fuvest-SP Mendel, realizando cruzamentos entre heterozigotos, obteve 8.023 sementes de ervilhas, das quais 6.022 apresentavam colorao amarela e 2.001, verde. Teo-ricamente, quantas se deveriam esperar de cada colorao, em 8.024 sementes? a) Todas amarelas b) Todas verdes c) 6.018 amarelas e 2.006 verdes d) 6.018 verdes e 2.006 amarelas e) 4.012 de cada cor 60. Em um determinado pssaro, o alelo A determina penas pretas na cauda. O alelo recessivo a determina pelagem branca. Uma fmea preta, ao acasalar com um macho preto, colocou 4 ovos. O primeiro passarinho nasceu branco. Qual a probabilidade de o segundo passarinho, ao nascer, independentemente do sexo, ser preto heterozigoto para o referido par de alelos? a) 2/3 d) 2/4 b) 1/4 e) 0 c) 1/3 61. Retinoblastoma (tumor maligno na retina) uma anomalia condicionada por um gene dominante. Uma mulher cujo pai normal apresentou retinoblastoma e foi operada. Essa mulher casou-se com um homem normal e teve 3 filhos normais. A probabilidade de o 4 filho apresentar a anomalia de: a) 100% d) 25% b) 75% e) 0% c) 50% 62. UFJF-MG A polidactilia (presena de mais de 5 dedos em cada membro) condicionada por um gene dominante P. Se um homem com polidactilia, filho de me normal, casa-se com uma mulher normal, qual a probabilidade de que o casal, em sucessivas gestaes, venha a ter 6 crianas com polidactilia? a) 1/16 d) 1/128 b) 1/32 e) 1/256 c) 1/64 63. Vunesp Em organismos diplides (2n) sexuados, cada par de cromossomos formado por um cromossomo de origem paterna e um de origem materna. Qual a probabilidade de os espermatozides conterem apenas os cromossomos de origem materna, em um organismo com quatro pares de cromossomos? a) 1/2 b) 1/16 c) 1/8 d) 1/16 e) 1/32
72

64. FEI-SP Sabendo que o albinismo um carter recessivo, determine a porcentagem de descendentes com o fentipo igual ao do pai, resultantes do casamento de um homem heterozigoto, para esse fator, com uma mulher de igual gentipo. a) 0% b) 25% c) 50% d) 75% e) 100% 65. Um casal heterozigoto para albinismo teve uma criana normal. Qual a chance de essa criana ser heterozigtica? a) 1/4 b) 1/2 c) 3/4 d) 2/3 e) nula 66. A cor preta dos plos em coelhos dominante em relao cor branca. Um casal de coelhos pretos, filhos de mes brancas, foi cruzado e teve 6 filhotes pretos. Quantos desses filhotes devem ser homozigotos? 67. Fuvest-SP Uma planta heterozigota de ervilha com vagens infladas produziu por autofecundao descendncia constituda por dois tipos de indivduos: com vagens infladas e com vagens achatadas. a) Tomando ao acaso um desses descendentes, qual a probabilidade de ele ser heterozigoto? b) Tomando ao acaso um descendente com vagens infladas, qual a probabilidade de ele ser homozigoto? 68. Sentir o gosto amargo substncia PTC (feniltiocarbamida) uma caracterstica condicionada por um gene dominante I, sendo a insensibilidade devida ao gene i. a) Um casal sensvel ao PTC pode ter um filho insensvel ? Em caso afirmativo, com que probabilidade? b) Qual a probabilidade de um casal heterozigoto para esse carter ter duas crianas sensveis ao PTC? 69. Se um homem for heterozigoto para albinismo: I. qual a proporo entre os espermatozides que contero o gene dominante e os que contero o gene recessivo?

II. e se casar com uma mulher albina, quais os provveis tipos de filhos? III. e se casar com uma mulher heterozigota, qual a possibilidade de nascimento de uma criana albina? a) I 100% A II todos normais III 25% b) I 50% A e 50% a II todos normais III 25% c) I 50% A e 50% a II todos albinos III 50% d) I 50% A e 50% a II normais ou albinos III 25% e) I 50% A e 50% a II normais ou albinos III 50% 70. FCMSC-SP Carneiros produtores de l preta so devidos ao alelo recessivo p e os que produzem l branca, ao alelo dominante P. Um carneiro branco cruzado com uma ovelha branca, sendo ambos portadores do alelo para l preta. Eles procriam um carneiro branco, que, por sua vez, retrocruzado com a ovelha genitora. Qual a probabilidade de o descendente do retrocruzamento ser preto? 71. Um casal tem pigmentao normal, porm os pais de ambos so heterozigotos para o albinismo. Qual a probabilidade de terem um filho albino, no importando o sexo? 72. Nos heredogramas abaixo, os indivduos em preto so incapazes de enrolar verticalmente a lngua. Assinale a nica situao que nos leva a concluir que essa uma caracterstica determinada por um par de genes autossmicos recessivos.

73. PUC-MG Observe o heredograma abaixo.

O cruzamento que nos permite diagnosticar, com certeza, qual dos dois caracteres dominante : a) 1 x 2 b) 5 x 6 c) 3 x 4 d) 7 x 8 e) 11 x 12 74. Faam-SP Na genealogia abaixo, pode-se deduzir que a caracterstica em negrito recessiva, graas ao casal:

a) b) c) d) e)

12 34 56 78 9 10

75. UEBA Na genealogia abaixo, os smbolos preenchidos representam indivduos afetados por uma anomalia recessiva.

PV2D-07-BIO-24

So comprovadamente heterozigotos apenas: a) 1 e 6. b) 3 e 4. c) 4 e 5. d) 3, 4, e 5. e) 2, 4, 5 e 7.

73

76. FCC-SP Quais dos indivduos representados por nmeros certamente apresentaro o carter dominante determinado pelo gene A?

79. PUC-SP Na genealogia abaixo, as pessoas indicadas pelos nmeros 1, 2, 4, 5 e 7 apresentam uma anomalia condicionada por gene autossmico dominante. J as pessoas indicadas pelos nmeros 3 e 6 tm fentipo normal.

a) 1 2 3 4 b) 2 3 5 6 c) 1 4 5 6

d) 1 2 5 6 e) 3 4 5 6

77. Vunesp Na genealogia abaixo, os indivduos representados em preto apresentam uma anomalia condicionada por gene autossmico recessivo, enquanto os outros exibem fentipo normal.

Aps a anlise da genealogia, pode-se concluir que: a) apenas as pessoas indicadas pelos nmeros 1 e 2 so heterozigticas. b) a pessoa indicada pelo nmero 4 necessariamente homozigtica. c) a pessoa indicada pelo nmero 3 transmitiu o gene recessivo para seu descendente indicado pelo nmero 7. d) no h possibilidade de a pessoa indicada pelo nmero 5 ser heterozigtica. e) o casal indicado pelos nmeros 6 e 7 no poder ter descendentes com fentipo normal. 80. UFPI O heredograma adiante representa a herana de um fentipo anormal na espcie humana. Analise-o e assinale a alternativa correta.

Examinando a genealogia, so obrigatoriamente heterozigotos os indivduos: a) I-1, I-4, II-3, II-4, III-2 e III-3. b) II-1, II-2, II-4, III-2 e III-3. c) I-1, I-4, II-2, II-5, III-2 e III-3. d) II-3, II-4, III-2 e III-3. e) II-1, II-2, II-3, II-4, II-5 e II-6. 78. Na espcie humana, o albinismo determinado por um gene recessivo em homozigose. J a polidactilia (presena de mais de cinco dedos, em cada mo e/ou p) est na dependncia de um gene dominante. As fichas contendo os heredogramas de duas famlias, uma de um paciente albino e outra de um paciente polidctilo, so misturadas na mesa de um mdico geneticista. Uma dessas fichas tem o seu grfico reproduzido a seguir. a) Os indivduos II-3 e II-4 so homozigotos, pois do origem a indivduos anormais. b) O fentipo anormal recessivo, pois os indivduos II-3 e II-4 tiveram crianas anormais. c) Os indivduos III-1 e III-2 so heterozigotos, pois so afetados pelo fentipo anormal. d) Todos os indivduos afetados so heterozigotos, pois a caracterstica dominante. e) Os indivduos I-1 e I-4 so homozigotos. 81. UFF-RJ O heredograma mostra a incidncia de uma anomalia gentica em um grupo familiar.

Responda ao que se pede. a) A qual dos pacientes pertence a ficha que contm o heredograma acima? b) O paciente (integrante do grfico) est apontado pela seta. Indique o seu gentipo.
74

Aps a anlise do heredograma, pode-se afirmar que: a) todos os indivduos normais so homozigotos recessivos. b) a anomalia condicionada por um gene recessivo. c) a anomalia ocorre apenas em homozigotos dominantes. d) todos os indivduos normais so homozigotos dominantes. e) todos os indivduos normais so homozigotos dominantes ou heterozigotos. 82.

85. No heredograma, as figuras 6, 10 e 12 representam indivduos que, na fase adulta, desenvolveram a mesma doena hereditria.

Examine as afirmaes. I. uma doena de carter dominante autossmica. II. As pessoas 1 e 2 so heterozigotas. III. A mulher representada pelo nmero 5 tem possibilidade de ser homozigota. IV. Se houver casamento consangneo entre 9 e 11, com certeza os eventuais filhos nascero afetados. So corretas as afirmaes: a) I, II, III e IV. b) apenas I, II e III. c) apenas II e III. d) apenas II, III e IV. e) Apenas uma das afirmaes correta. 86. Vunesp O diagrama representa o padro de herana de uma doena gentica que afeta uma determinada espcie de animal silvestre, observado a partir de cruzamentos controlados realizados em cativeiro.

Analisando o heredograma acima, pode-se concluir que os gentipos dos indivduos 1, 6, 12 e 15 so, respectivamente: a) b) c) d) e) 1 Aa AA aa Aa Aa 6 Aa aa Aa aa aa 12 aa AA aa Aa AA 15 aa aa Aa aa aa

83. Fatec-SP O heredograma refere-se a uma caracterstica C, controlada por um nico par de genes.

Em relao ao heredograma, pode-se afirmar que: a) a caracterstica C dominante. b) os indivduos 1, 2, 3 e 8 so homozigotos. c) os indivduos 4, 9, 10 e 11 so obrigatoriamente heterozigotos. d) a probabilidade de o casal 7 x 8 vir a ter um filho com a caracterstica C ser de 0,5. e) a probabilidade de o casal 7 x 8 vir a ter um filho com a caracterstica C ser de 0,75. 84. F M Santos-SP Analise o seguinte heredograma:

a) A anomalia causada por um gene dominante ou recessivo? Justifique. b) Qual a probabilidade de o casal no 4 ter um filho que apresenta a anomalia?

A partir da anlise da ocorrncia da doena entre os indivduos nascidos dos diferentes cruzamentos, foram feitas as afirmaes seguintes. I. Trata-se de uma doena autossmica recessiva. II. Os indivduos I-1 e I-3 so obrigatoriamente homozigotos dominantes. III. No h nenhuma possibilidade de que um filhote nascido do cruzamento entre os indivduos II-5 e II-6 apresente a doena. IV. O indivduo III-1 s deve ser cruzado com o indivduo II-5, uma vez que so nulas as possibilidades de que desse cruzamento resulte um filhote que apresente a doena. verdadeiro o que se afirma em: a) I, apenas. d) I e IV, apenas. b) II e III, apenas. e) III e IV, apenas. c) I, II e III, apenas.
75

PV2D-07-BIO-24

87. UFSC Na genealogia abaixo, os indivduos que manifestam uma determinada doena hereditria so mostrados em preto. Com base na anlise da mesma, assinale a(s) proposio(es) correta(s).

A probabilidade de II-5 e II-6 terem uma criana do sexo feminino e normal : a) 1/2 b) 1/3 c) 1/4 d) 1/6 e) 1/5 89. Unirio-RJ O popular teste do pezinho, feito em recm-nascidos, pode detectar a doena fenilcetonria. Tal doena deve-se presena de uma enzima defeituosa que no metaboliza corretamente o aminocido fenilalanina, cuja ingesto provoca retardamento mental. Na genealogia a seguir, os indivduos que apresentam fenilcetonria esto em preto. Sabendo-se que a determinao do carter se deve apenas a um par de genes autossmicos, determine o cruzamento que permite diagnosticar a recessividade do gene que condiciona a fenilcetonria e a probabilidade de nascer uma menina afetada a partir do cruzamento 12 X 18.

01. Na genealogia esto representadas 2 geraes. 02. O padro da herana desta doena autossmico dominante. 04. Os indivduos I-1, II-3 e III-3 podem ser homozigotos. 08. Do casamento consangneo, apresentado na genealogia, existem 33,3% de possibilidade de nascer um descendente com a doena. 16 III-3 e III-4 tm 50% de probabilidade de terem um descendente com a doena. 88. PUC-MG O heredograma a seguir representa uma anomalia autossmica denominada polidactilia, em que os indivduos afetados apresentam mais de 5 dedos.

a) b) c) d) e)

C e 50% C e 25% B e 6,25% B e 8,25% C e 75%

90. UFJF-MG Numa aula de gentica, o professor apresenta aos alunos o heredograma a seguir, que mostra a ocorrncia de uma anomalia causada pela ao de um par de genes (A e a) em vrias geraes de uma famlia. Ao analisar os indivduos afetados por essa anomalia, conclui-se que se trata de uma herana autossmica dominante.

Baseando-se exclusivamente no heredograma apresentado acima, responda: a) Por que a anomalia no pode ser recessiva? b) Qual a probabilidade de nascer uma criana afetada pela anomalia, se a mulher (4) da gerao F3 tiver filhos com um homem que apresenta essa anomalia?
76

91. Vunesp modificado Analise a genealogia abaixo, que apresenta indivduos afetados por uma doena gentica.

95. Unirio-RJ A mucoviscidose uma doena gentica grave que associa problemas digestivos e respiratrios. Os pulmes das pessoas afetadas apresentam um muco espesso que promove infeces bacterianas. Observe e analise o esquema a seguir, que representa a rvore genealgica de uma famlia onde alguns indivduos so afetados pela doena.

a) A doena determinada por gene dominante ou recessivo? Justifique a sua resposta. b) Qual a probabilidade de o casal formado pelos indivduos II-2 e II-3 ter uma criana afetada pela doena? 92. Vunesp modificado Analise a genealogia abaixo, que apresenta indivduos afetados por uma doena recessiva e indivduos normais.

Qual a probabilidade de o casal II-1 x II-2 vir a ter uma criana com mucoviscidose? a) 1/8 d) 1/2 b) 1/4 e) 2/3 c) 1/3 96.

a) Quais os indivduos representados na genealogia que so obrigatoriamente homozigotos e heterozigotos, respectivamente? b) Qual a probabilidade de o casal formado pelos indivduos II-2 e II-3 ter mais dois filhos, sendo ambos do sexo feminino e afetados? 93. UFV-MG Um determinado casal normal, mas heterozigoto para o albinismo, solicitou aconselhamento gentico sobre a possibilidade de vir a ter crianas apresentando a condio albina. Qual a probabilidade de esse casal ter: a) quatro crianas albinas? b) uma criana albina e do sexo feminino? c) uma criana normal heterozigota e do sexo masculino? d) Represente o provvel heredograma desse casal, admitindo-se que as suposies feitas nas letras (b) e (c) realmente se concretizem. 94. No heredograma a seguir, os smbolos cheios representam indivduos portadores de uma anomalia gentica. Qual a probabilidade de o indivduo 9 ser portador dessa anomalia? Se o indivduo no 7 se casar com uma mulher portadora do carter, a probabilidade de terem uma criana tambm afetada ser: a) 1/2 d) nula b) 1/6 e) 1/16 c) 1/3 97. Na genealogia seguinte, o indivduo 7 o portador do gene a, que provoca fibrose cstica. Qual a probabilidade de o indivduo 9, produto de casamento consagneo, ser afetado pela fibrose cstica?

a) 1/2 b) 1/4 c) 1/8 d) 1/16 e) zero

PV2D-07-BIO-24

77

98. UFRJ No heredograma abaixo, a cor preta indica indivduos com pelagem negra, fentipo determinado por um gene autossmico dominante A. A cor branca indica pelagem branca determinada por um gene recessivo. Os indivduos 5 e 8 devem ser considerados homozigotos (AA), a menos que haja evidncia contrria.

a) procede, apenas considerando gmeos obrigatoriamente dizigticos. b) no procede, pois impossvel uma fecundao dupla. c) procede quando houver fecundao dupla, nascendo gmeos univitelinos. d) no procede. Quando h uma dupla fecundao, os embries formados sofrem degenerao. e) no h como definir. 101. Maria e Mrcia (I) so gmeas monozigticas e Paulo e Paula (II) so gmeos dizigticos. Portanto: a) o par I originou-se da fecundao de dois vulos por 2 espermatozides. b) o par II originou-se da fecundao de dois vulos. c) os pares I e II originaram-se da fecundao de um vulo por um espermatozide e os 2 blastmeros iniciais transformaram-se em embries diferentes. d) o par I um exemplo de poliembrionia. e) Paulo e Paula possuem mais genes em comum do que Maria e Mrcia. 102. PUC-SP Os gmeos Renato e Marcelo e as gmeas Cristina e Fernanda originaram-se de zigotos distintos. J Eduardo e Rodrigo desenvolveram-se a partir de blastmeros originados de um mesmo zigoto. Assinale a alternativa correta relativa aos gmeos citados. a) Os trs pares de gmeos so fraternos. b) Os trs pares de gmeos so univitelinos. c) Dois dos pares de gmeos so fraternos. d) Apenas Eduardo e Rodrigo so gmeos fraternos. e) Apenas os gmeos Renato e Marcelo e as gmeas Cristina e Fernanda so univitelinos. 103 . Vunesp Uma senhora deu luz dois gmeos de sexos diferentes. O marido, muito curioso, deseja saber informaes sobre o desenvolvimento de seus filhos, a partir da fecundao. O mdico respondeu-lhe, corretamente, que: a) dois vulos foram fecundados por um nico espermatozide. b) um vulo, fecundado por um espermatozide, originou um zigoto, o qual dividiu-se em dois zigotos, formando dois embries. c) um vulo foi fecundado por dois espermatozides, constituindo dois embries. d) dois vulos, isoladamente, foram fecundados, cada um por um espermatozide, originando dois embries. e) o uso de medicamentos durante a gestao causou alteraes no zigoto, dividindo-o em dois. 104 . Carlos, Manoel e Lcia so irmos, logo: a) se Carlos e Manoel forem gmeos, sero obrigatoriamente univitelinos.

Qual a probabilidade de que o cruzamento entre o indivduo 9 e o indivduo 10 gere um indivduo de pelagem branca? 99. UFC-CE Leia o texto a seguir. A Doena de Alzheimer (D.A.) (...) uma afeco neurodegenerativa progressiva e irreversvel, que acarreta perda de memria e diversos distrbios cognitivos. Em geral, a D.A. de acometimento tardio, de incidncia ao redor de 60 anos de idade, ocorre de forma espordica, enquanto que a D.A. de acometimento precoce, de incidncia ao redor de 40 anos, mostra recorrncia familiar. (...) Cerca de um tero dos casos de D.A. apresentam familiaridade e comportam-se de acordo com um padro de herana monognica autossmica dominante. Estes casos, em geral, so de acometimento precoce e famlias extensas tm sido periodicamente estudadas.
Smith, M.A.C. Revista Brasileira de Psiquiatria, 1999.

Considerando o texto acima e o histrico familiar a seguir, responda ao que se pede. Histrico familiar: Um rapaz cujas duas irms mais velhas, o pai e a av paterna manifestaram Doena de Alzheimer de acometimento precoce.

a) Monte o heredograma para o histrico familiar acima. b) Qual a probabilidade de o rapaz em questo tambm ser portador do gene responsvel pela forma de acometimento precoce da doena? c) Quais indivduos do heredograma so seguramente heterozigotos para esse gene? d) Explique o padro de herana mencionado no texto. 100. Uma mulher est grvida de duas crianas gmeas de dois homens diferentes ao mesmo tempo. Esta informao:
78

b) se Manoel e Lcia forem gmeos, podero ser univitelinos ou bivitelinos. c) se Carlos e Lcia forem gmeos, provavelmente sero univitelinos. d) Carlos e Manoel podem ser gmeos monozigticos ou dizigticos, mas Lcia nunca poder ter irmos gmeos. e) se Lcia tiver um irmo gmeo, eles sero obrigatoriamente dizigticos. 105. Fuvest-SP Um pesquisador, estudando pares de gmeos monozigticos, de gmeos dizigticos e de irmos no-gmeos, sups que uma determinada doena psiquitrica tem herana multifatorial. Se sua hiptese for verdadeira, a concordncia da caracterstica ser: a) igual entre os gmeos monozigticos e gmeos dizogticos. b) igual entre gmeos monozigticos e irmos nogmeos. c) maior entre gmeos monozigticos do que entre gmeos dizigticos. d) menor entre gmeos dizigticos do que entre irmos no-gmeos. e) igual nos trs grupos estudados. 106 . Fuvest-SP Em uma gravidez gemelar, o par de gmeos do sexo masculino. a) Estes gmeos devem ser monozigticos ou dizigticos? Por qu? b) Se um dos gmeos herdou o alelo dominante A de sua me heterozigtica Aa, qual a probabilidade de que esse alelo tambm esteja presente no outro gmeo? 107 . UFSCar-SP Considerando situaes hipotticas, Maria manteve relaes sexuais com dois irmos, gmeos dizigticos, nascendo destas relaes Alfredo. Em outra situao, tambm hipottica, Paula engravidou-se ao manter relaes sexuais com dois irmos, gmeos monozigticos, nascendo Renato. Abandonadas, ambas reclamaram na Justia o reconhecimento de paternidade, determinando o juiz a realizao dos testes de DNA. Aps receber os resultados, a Justia pronunciou-se sobre a paternidade de uma das crianas e ficou impossibilitada de pronunciar-se sobre a paternidade da outra criana. Responda ao que se pede. a) Sobre a paternidade de qual criana o juiz pronunciou-se? b) Por que no pde o juiz se pronunciar sobre a paternidade da outra criana?
PV2D-07-BIO-24

Da anlise desse esquema, podemos concluir que esses gmeos: a) resultam da fecundao de um nico vulo por dois espermatozides. b) negam a possibilidade de poliembrionia humana. c) sero siameses, ou xifpagos, porque se originam de um nico ovo. d) podero apresentar sexos iguais ou diferentes. e) tero obrigatoriamente sexos iguais. 109 . UFV-MG O esquema a seguir mostra o modo da formao de cinco indivduos (A, B, C, D e E), nascidos no mesmo parto. Sabendo-se que o indivduo A do sexo feminino, pode-se afirmar que:

a) os outros quatro so do sexo masculino. b) B do sexo feminino e C, D e E, masculino. c) os outros quatro podem ser do sexo feminino ou masculino. d) os outros quatro so do sexo feminino. e) A, B e C so do sexo feminino e D e E, do masculino. 110 . O filme Gattaca, direo de Andrew Niccol, EUA, 1997, apresenta uma sociedade na qual os indivduos so identificados pelo seu DNA. Os personagens da estria no usam documentos ou crachs para identificao e acesso a prdios e reparties; apenas encostam a ponta do dedo em um equipamento que recolhe uma gota de sangue e a identificao feita com um teste de DNA.
79

108 . Vunesp A formao de um tipo de gmeos pode ser explicada pelo seguinte esquema:

Na vida real e cotidiana, j se utilizam equipamentos para identificao que dispensam a apresentao de documentos. Em portarias de alguns clubes, por exemplo, um aparelho acoplado ao computador faz a leitura de nossas impresses digitais, dispensando a apresentao da carteirinha. Considerando-se dois irmos gmeos e a eficcia dos dois equipamentos citados em diferenci-los, assinale a alternativa correta. a) Ambos os equipamentos podero diferenci-los, mesmo que os irmos sejam gmeos monozigticos. b) Os equipamentos s podero diferenci-los se os irmos forem gmeos dizigticos. c) Se os irmos forem gmeos monozigticos, apenas o equipamento do filme poder diferenci-los. d) Se os irmos forem gmeos monozigticos, apenas o equipamento do clube poder diferenci-los. e) Nenhum dos equipamentos poder diferencilos, quer os irmos sejam gmeos dizigticos ou monozigticos. 111 . UFRJ A sociobiologia procura explicar o comportamento dos indivduos em funo de sua herana gentica. Um dos instrumentos mais utilizados nesses estudos a pesquisa sobre o comportamento de gmeos univitelinos que foram criados em ambientes diferentes. Qual o princpio cientfico dessa abordagem experimental? 112 . UFRN A planta maravilha Mirabilis jalapa apresenta duas variedades para a colorao das flores: a alba (flores brancas) e a rubra (flores vermelhas). Cruzando as duas variedades, obtm-se, em F1, somente flores rseas. Do cruzamento entre duas plantas heterozigotas, a porcentagem fenotpica para a cor rsea de: a) 25% c) 75% b) 50% d) 30% 113 . Mackenzie-SP As flores da planta maravilha podem ser vermelhas, brancas ou rosa. As flores vermelhas e brancas so homozigotas, enquanto as rosa so heterozigotas. Para se obterem 50% de flores brancas, necessrio cruzar: a) duas plantas de flores rosa. b) uma planta de flores brancas com outra de flores rosa. c) uma planta de flores rosa com outra de flores vermelhas. d) uma planta de flores vermelhas com outra de flores brancas. e) duas plantas de flores brancas. 114. UFC-CE A herana da cor da flor de Mirabilis jalapa um exemplo de ausncia de dominncia. Do cruzamento entre duas plantas mvmb, qual a porcentagem esperada, respectivamente, de descendentes com flores vermelhas, rosa e brancas?
80

a) b) c) d) e)

100%, 0%, 0% 0%, 0%, 100% 0%, 100%, 0% 50%, 0%, 50% 25%, 50%, 25%

115 . Unifor-CE modificado Numa determinada espcie vegetal, no h dominncia quanto ao carter cor vermelha e cor branca das flores, tendo o heterozigoto flor de cor rosa. A probabilidade de se obter uma planta de flor branca, a partir do cruzamento de uma planta de flor branca com uma de flor rosa, : a) 25,00% b) 18,75% c) 12,75% d) 50% e) nula. 116 . UFBA De acordo com as indicaes a seguir, espera-se, na F2, a ocorrncia do fentipo ruo na porcentagem de:

a) b) c) d) e)

0% 25% 50% 75% 100%

117. Um fazendeiro tinha um touro vermelho e uma vaca branca, que geraram descendentes de cor intermediria. Desejando obter novos animais vermelhos e sabendo que a herana devida a um par de alelos sem dominncia, dever: a) cruzar uma novilha hbrida com o pai. b) cruzar um novilho com a me. c) cruzar os descendentes com outro touro branco. d) insistir no cruzamento do touro vermelho com a vaca branca. e) utilizar outro mtodo no mencionado aqui. 118 . Quando cruzamos galinhas com penas salpicadas de branco com galos de penas pretas, seus descendentes so todos azulados (azul de Andaluza). Quando as aves azuis de Andaluzas so cruzadas entre si, produzem descendentes com penas salpicadas de branco, azuis e pretas na razo de 1 : 2 : 1, respectivamente. a) Como so herdadas estas caractersticas das penas? b) Aplicando qualquer dos smbolos apropriados, indique os gentipos para cada fentipo.

119. A talassemia um defeito da hemoglobina em seres humanos. Ela ocorre de duas formas: (a) talassemia menor, na qual os eritrcitos so pequenos (microcitemia) e em grande nmero (policitemia), mas a sade essencialmente normal, e (b) talassemia maior, caracterizada por uma anemia severa, aumento do bao, microcitemia e policitemia, entre outros sintomas. Essa ltima forma geralmente culmina em morte, antes de atingir a idade reprodutiva. A partir do heredograma hipottico a seguir, onde os smbolos claros representam pessoas normais, os hachurados, a talassemia menor e o preto, a talassemia maior, determine o modo de herana indicando os possveis gentipos dos indivduos envolvidos.

123. Unifor-CE Em certa espcie vegetal, a cor das flores determinada por um par de alelos entre os quais no h dominncia. Um jardineiro fez os seguintes cruzamentos de plantas de: I. flor vermelha flor rosa II. flor vermelha flor branca III. flor rosa flor rosa IV. flor rosa flor branca So esperadas plantas com flores brancas somente nos cruzamentos: a) I e II. d) II e III. b) I e III. e) III e IV. c) I e IV. 124. UFRJ Em rabanetes, a forma da raiz determinada por um par de genes alelos. Os fentipos formados so trs: arredondado, ovalado ou alongado. Cruzamentos entre plantas de razes alongadas com plantas de razes arredondadas produziram apenas indivduos com razes ovaladas. Em cruzamento desses indivduos ovalados entre si, foram obtidas quatrocentas sementes, que foram plantadas em sementeiras individuais. Antes que as sementes germinassem, elas foram distribudas a diversas pessoas; voc recebeu uma delas. a) Qual a relao de dominncia entre os caracteres em questo? b) Qual a probabilidade de que, na sua sementeira, venha a se desenvolver um rabanete de raiz ovalada? Justifique a sua resposta. 125 . Fuvest-SP Em uma espcie de planta, a forma dos frutos pode ser alongada, oval ou redonda. Foram realizados quatro tipos de cruzamento entre plantas dessa espcie e obtidos os seguintes resultados: Cruzamento I Tipos de planta Desendncia cruzados obtida Fruto longo 100% fruto oval Fruto redondo Fruto longo 50% fruto longo 50% fruto oval Fruto oval Fruto redondo 50% fruto redondo 50% fruto oval Fruto oval Fruto oval 25% fruto longo 50% fruto oval Fruto oval 25% fruto redondo

120. Unifesp Em gentica, a dominncia parcial e a co-dominncia entre alelos definem-se, de forma mais precisa: a) nos gentipos heterozigotos. b) nos gentipos homozigotos. c) nos gentipos dominantes. d) nos gentipos recessivos. e) na ligao gnica. 121 . Vunesp Em gatos, as cores marrom e branca dos plos tm sido descritas como devidas a, pelo menos, um par de genes. Considere o cruzamento de gatos homozigotos brancos e marrons. Qual a proporo fenotpica esperada em F1 se: a) o modo de herana for do tipo dominante? b) o modo de herana for do tipo sem dominncia (intermediria)? c) o modo de herana for do tipo co-dominante? 122. Em uma espcie de planta, no cruzamento entre plantas homozigotas (para o gene que determina cor das ptalas) com flores vermelhas e plantas homozigotas com flores brancas, foram obtidas em F1 plantas com flores rosas. Podemos concluir que se trata: a) de um caso de dominncia completa, definido mais precisamente no gentipo homozigoto dominante. b) de um caso de alelos letais, em que s sobrevivem as plantas com flores rosas. c) de um caso de herana intermediria, definido mais precisamente no gentipo heterozigoto. d) de um caso de dominncia completa, em que as flores brancas so albinas e apresentam gentipo recessivo. e) de um caso de herana intermediria, em que ter o gentipo intermedirio sempre mais vantajoso.

II

III

IV

PV2D-07-BIO-24

a) Formule uma hiptese consistente com os resultados obtidos para explicar a herana da forma dos frutos nessa espcie. b) Represente os alelos por letras e indique os gentipos dos indivduos parentais e dos descendentes no cruzamento IV.
81

126. UFSC Um experimentador cruzou duas linhagens puras de uma planta denominada boca-de-leo, uma constituda de plantas com flores brancas e outra com flores vermelhas. A descendncia originada (F1) apresentou apenas plantas com flores cor-de-rosa. Da autofecundao das plantas da F1, foram obtidas plantas com flores exclusivamente brancas, vermelhas ou cor-de-rosa. Assinale a(s) proposio(es) verdadeira(s), considerando que neste experimento: 01. ocorreu a expresso de trs fentipos: o branco, o vermelho e o cor-de-rosa. 02. a proporo genotpica esperada nas plantas de F2 : 1 planta com flores cor-de-rosa: 2 plantas brancas: 1 planta vermelha. 04. as linhagens puras, que deram origem ao experimento, certamente apresentam gentipos homozigotos. 08. os indivduos de F1 eram, certamente, heterozigotos. 16. a F2 esperada ser constituda de 50% de indivduos homozigotos e 50% de indivduos heterozigotos. 127. Vunesp A talassemia uma doena hereditria que resulta em anemia. Indivduos homozigotos MM apresentam a forma mais grave, identificada como talassemia maior, e os heterozigotos MN apresentam uma forma mais branda, chamada de talassemia menor. Indivduos homozigotos NN so normais. Sabendo-se que todos os indivduos com talassemia maior morrem antes da maturidade sexual, qual das alternativas a seguir representa a frao de indivduos adultos, descendentes do cruzamento de um homem e uma mulher portadores de talassemia menor, que sero anmicos? a) 1/2 d) 2/3 b) 1/4 e) 1/8 c) 1/3 128. PUC-SP Em uma certa espcie de mamferos, h um carter mendeliano com co-dominncia e gentipos EE, EC e CC. Sabe-se que animais heterozigticos so mais resistentes a um dado vrus X do que os homozigticos. Animais com os trs gentipos foram introduzidos em duas regies diferentes designadas por I e II, onde h predadores naturais da espcie. Nos dois ambientes, os animais de gentipo CC so mais facilmente capturados pelos predadores. Em I no h registro da presena do vrus X e em II ele transmitido por contato com as presas da espcie. Pode-se prever que: a) haver igual chance de adaptao de animais com os trs gentipos nas duas regies. b) haver igual chance de adaptao de animais com os trs gentipos apenas na regio I. c) haver maior nmero de animais com gentipos EE e CC do que com gentipo EC na regio I. d) a seleo natural ser mais favorvel aos animais com gentipo EC na regio II. e) a seleo natural ser mais favorvel aos animais com gentipo EE na regio II.
82

129. UFTM-MG Em certa variedade de camundongos, a herana da cor do plo determinada por um par de alelos com relao de dominncia completa: A, dominante, que condiciona plo amarelo, e a, recessivo, que condiciona plo aguti. O gene A em homozigose letal, determinando a morte do portador. A proporo fenotpica esperada do cruzamento de camundongos amarelos de: a) 3 amarelos para 1 aguti. b) 3 agutis para 1 amarelo. c) 2 amarelos para 1 aguti. d) 2 agutis para 1 amarelo. e) 2 agutis para 2 amarelos. 130. Galinhas com asas e pernas curtas so chamadas rastejantes (creepers). Quando galinhas rastejantes so cruzadas com aves normais, produzem descendentes normais e rastejantes, com freqncia igual. Quando as rastejantes so cruzadas com rastejantes, produzem 2 rastejantes para 1 normal. Cruzamentos entre os descendentes normais produzem somente prognie normal. Como poderemos explicar estes resultados? 131. UFRGS-RS Camundongos com gentipo homozigoto recessivo tm colorao cinzenta. Os heterozigotos so amarelos, e os homozigotos dominantes morrem no incio do desenvolvimento embrionrio. De um experimento de cruzamento entre animais amarelos resultaram 120 descendentes. O nmero provvel de descendentes cinzentos : a) 30 d) 80 b) 40 e) 120 c) 60 132. Nos coelhos, a anomalia de Pelger envolve uma segmentao anormal nos glbulos brancos do sangue. Os coelhos Pelger so heterozigotos(Pp); os normais so homozigotos (PP). O gentipo recessivo (pp) deforma grosseiramente o esqueleto desses coelhos, que geralmente morrem antes ou logo aps o nascimento. Se coelhos Pelger so cruzados entre si, que proporo fenotpica podemos prever para a F2 adulta? 133. Vunesp Observe os cruzamentos a seguir, em que o alelo (A) condiciona a cor amarela em camundongos e dominante sobre o alelo (a), que condiciona a cor cinza. Cruzamento I (Aa Aa) Cruzamento II (Aa aa) 240 amarelos 240 amarelos 120 cinza 240 cinza  Analise os resultados destes cruzamentos e responda s questes. a) Qual cruzamento apresenta resultado de acordo com os valores esperados? b) Como voc explicaria o resultado do cruzamento em que os valores observados no esto de acordo com os valores esperados?

134. UFRJ A cor cinza da pelagem de ratos pode ser alterada por um gene dominante (A) para uma cor amarelada. Em cruzamentos sucessivos em laboratrio entre ratos amarelos, sempre aparecem, na prole, ratos de cor cinza. Alm disso, nesses cruzamentos entre ratos amarelos verificam-se dois fatos: o tamanho da prole 25% menor do que entre ratos de cor cinza, e constatase tambm a existncia de embries mortos. A tabela abaixo mostra os resultados de vrios cruzamentos feitos em laboratrio: Pais cinza cinza cinza amarelo amarelo cinza amarelo amarelo No de filhos 12 12 12 8 Fentipos da prole 100% cinza 1/2 amarelo : 1/2 cinza 1/2 amarelo : 1/2 cinza 2/3 amarelos : 1/3 cinza

137. FCMSC-SP Usando 40 ovos seguramente fertilizados, provenientes de um casal sem asas, o criador dever obter quantos machos adultos sem asas? a) 5 b) 10 c) 15 d) 20 e) 30 138. UFRJ Uma determinada doena transmitida por um gene autossmico (no est nos cromossomos sexuais) que codifica uma enzima. Indivduos doentes caracterizaram-se pela ausncia de atividade enzimtica no sangue (0 unidade/mL). A atividade da enzima, em indivduos normais, de 100 unidades/mL do sangue. Um homem e uma mulher, cada um com uma atividade enzimtica de 50 unidades/mL, tiveram quatro filhos. Em um dos filhos, a atividade da enzima de 100 unidades/mL, em outro ela de 50 unidades/mL, e nos outros dois a atividade ausente (0 unidade/mL). a) Obedecida a proporo mendeliana clssica, qual seria a distribuio genotpica entre os filhos do casal? b) Como voc explica a diferena entre a proporo obtida nesse caso e a proporo prevista na teoria mendeliana? 139. UEL-PR Numa variedade de planta, os alelos que condicionam flores brancas (F), amarelas (fa) e alaranjadas (f) constituem uma srie de alelos mltiplos com a seguinte relao de dominncia: F > fa > f. Cruzandose uma planta de flores brancas com uma de flores amarelas, obtiveram-se descendentes com flores brancas, amarelas e alaranjadas. Os gentipos das plantas parentais so: a) Ff faf d) Ffa faF b) Ff ff e) FF faf c) Ff fafa 140. Um coelho himalaia foi cruzado com uma fmea aguti, originando descendentes himalaia, aguti e albino. Quais os gentipos dos pais e dos filhos? 141. PUC-MG Em um caso de polialelismo, trs genes, Z, z1 e z2, com suas respectivas relaes de dominncia, Z > z1 > z2, so responsveis pela cor da pelagem de um animal. Z produz pigmentao vermelha; z1, pigmentao preta; z2 no produz nenhum tipo de pigmento, nascendo os indivduos com a cor branca. Dois indivduos de constituio Zz1 e z1z2 se cruzaram. Na prole, sero encontrados indivduos com pelagem de cor: a) vermelha e preta. b) vermelha e branca. c) preta e branca. d) somente vermelha. e) somente branca.
83

Qual deve ser o gentipo dos embries mortos? Justifique sua resposta. 135. Vunesp Em ratos, a cor da pelagem condicionada por gene autossmico, sendo o gene C, dominante, responsvel pela colorao amarela e seu alelo c, recessivo, responsvel pela colorao cinza. Um geneticista observou que o cruzamento de ratos de pelagem amarela com ratos de pelagem cinza resultou descendentes amarelos e cinza em igual proporo; porm, o cruzamento de ratos amarelos entre si produziu 2/3 de descendentes de pelagem amarela e 1/3 de descendentes de pelagem cinza. a) A partir de vinte ovos, originados do cruzamento de machos amarelos e fmeas cinza, quantas fmeas amarelas adultas so esperadas? Justifique. b) A partir de quarenta ovos, originados do cruzamento entre ratos amarelos, quantos machos cinza devero atingir a idade adulta? Justifique. As informaes a seguir referem-se s questes de nmeros 136 e 137. Em pombos, a ausncia de asas condicionada geneticamente. Um criador observou que, do cruzamento entre indivduos normais e sem asas, nascem filhotes normais e sem asas, em propores iguais. O criador observou ainda que, do cruzamento sem asas e sem asas, nascem filhotes normais e sem asas, mas na proporo, respectivamente, igual a 1/3 : 2/3. 136 . FCMSC-SP Usando 40 ovos seguramente fertilizados, provenientes de um casal em que o macho era sem asas e a fmea normal, o criador dever obter quantos machos adultos sem asas? a) 5 b) 10 c) 15 d) 20 e) 30

PV2D-07-BIO-24

142. UFAL A cor da pelagem em determinada raa de ces determinada por uma srie de alelos mltiplos: o alelo A determina cor preta, o alelo am, cor marrom e o alelo a, cor branca. A relao de dominncia entre os alelos a seguinte: A > am > a. Indique os possveis gentipos e respectivos fentipos. 143 . Cesgranrio-RJ Em coelhos, conhecem-se alelos para a cor do plo: C (selvagem), cch (chinchila), ch (himalaia) e ca (albino). A ordem de dominncia de um gene sobre outro ou outros a mesma em que foram citados. Cruzando-se dois coelhos vrias vezes, foram obtidas vrias ninhadas. Ao final de alguns anos, a soma dos descendentes deu 78 coelhos himalaias e 82 coelhos albinos. Quais os gentipos dos coelhos cruzantes? a) Cch x cchca b) CC x caca c) cchca x caca d) chca x caca e) cchch x caca 144 . UFTM-MG Para a cor da pelagem de coelhos, sabe-se que a transmisso do carter ocorre por quatro alelos, colocados na seguinte ordem hierrquica de dominncia: aguti (C), pelagem cinza-acastanhada; chinchila (cch), pelagem cinza-clara; himalaia (ch), pelagem branca, patas, focinho, cauda e orelhas pretos; e albino (ca), pelagem branca e olho vermelho. a) Quais os fentipos esperados no cruzamento entre um macho aguti heterozigoto para albino com uma fmea himalaia heterozigota para albino? b) Quais os gentipos esperados nesse mesmo cruzamento? 145. A cor da pelagem em coelhos determinada por uma srie de alelos mltiplos composta pelos genes C, cch, ch e ca, responsveis pelos fentipos aguti, chinchila, himalaio e albino, respectivamente. A ordem de dominncia existente entre os genes C > cch > ch > ca. Responda s questes abaixo. a) Quais as propores fenotpicas e genotpicas esperadas na prognie do cruzamento entre um coelho aguti (Ccch) e um coelho chinchila (cchch)? b) Como voc explicaria o aparecimento de coelhos albinos a partir de um cruzamento entre coelhos himalaios? 146. A cor da pelagem de coelhos determinada por alelos mltiplos, ocorrendo os seguintes fentipos para cada alelo: selvagem C chinchila cch himalaio ch albino c A relao de dominncia se d da seguinte maneira: C > cch > ch > c
84

Assim, no cruzamento de um macho chinchila, portador do alelo para fentipo himalaio, com uma fmea selvagem, portadora de alelo para albinismo, esperamos encontrar: a) 25% de coelhos albinos. b) 75% de coelhos selvagens. c) 50% de coelhos himalaios. d) 25% de coelhos chinchilas. e) 100% de coelhos selvagens. 147. Fuvest-SP Em uma variedade de prmula de cor amarela, determinada pelo gene an, ocorreram mutaes dando o gene a recessivo, que determina corola dourada, e o gene A dominante, que determina corola branca. Cruzando uma planta de flores brancas com uma de flores amarelas, obtiveram-se 36 plantas de flores brancas, 17 de flores amarelas e 19 de flores douradas. Qual o gentipo dos pais? a) Aan x ana b) Aa x ana c) AA x anan d) AA x ana e) Aa x anan 148. UCMG No milho, foi evidenciada a presena de um gene capaz de determinar a produo de uma cor vermelhoforte nos gros, quando expostos luz solar. Existe, entretanto, um alelo desse gene que determina uma cor vermelho-fraca. E a observao prtica mostrou depois existir mais outro alelo, este provocando uma colorao desbotada dos gros que ficou conhecida como vermelho-diludo. Os alelos referidos revelam dominncia na ordem em que foram mencionados. Do cruzamento de vermelho-forte com vermelho-fraco, obteve-se o seguinte resultado: 52 vermelho-fortes, 24 vermelho-fracos e 25 vermelho-diludos. Quais os gentipos dos cruzamentos? a) Vv vf v b) Vv vf vf c) VV vv d) Vvf Vvf e) vf v vv 149. A flor Primula sinensis tem, normalmente, uma mancha amarela na base da ptala. H uma mutao recessiva que produz uma mancha muito grande (prmula-rainha) e outra mutao do mesmo gene, dominante em relao ao tipo normal, condicionando uma mancha branca (alexandra). Os trs genes A (alexandra), an (normal) e a formam uma srie de alelos mltiplos. a) Quais so os possveis gentipos do tipo alexandra? b) Uma planta alexandra cruzada com uma planta normal produz 45 plantas alexandra, 22 normais e 23 plantas prmula-rainha. Quais so os gentipos das plantas cruzadas?

150. A determinao da cor da pelagem em coelhos um dos exemplos conhecidos de polialelia. Nesse carter, esto envolvidos 4 genes alelos mltiplos: C (aguti), cch (chinchila), ch (himalaia) e c (albino). Em relao a esses genes, qual das alternativas abaixo est correta? a) Um coelho heterozigoto possui os quatro alelos em sua clulas. b) Os gametas masculinos podem apresentar apenas um dos alelos, mas os vulos sempre possuem dois. c) Cada coelho pode apresentar dois dos alelos, no mximo, e apenas um deles em cada gameta. d) Para a cor da pelagem, o nmero de genes pode variar de 1 a 4 em cada animal. e) O nmero de gentipos possveis para os 4 alelos igual a 12. 151. UCBA O esquema abaixo representa a genealogia de uma famlia.

Texto para as questes 153 e 154 Em uma espcie de abelha, a cor dos olhos condicionada por uma srie de cinco alelos, entre os quais h a seguinte relao de dominncia: a1 > a2 > a3 > a4 > a a1: marrom a2: prola a3: neve a4: creme a: amarelo Uma rainha de olhos marrons heterozigtica para prola foi inseminada por espermatozides provenientes de machos com olhos das cores marrom (20%), prola (20%), neve (20%), creme (20%) e amarelo (20%). Essa rainha produziu, em um dia, 1.250 gametas, dos quais 80% foram fecundados. Todos os gametas, produzidos resultaram em descendentes. 153. PUCCamp-SP Assinale a alternativa da tabela que indica corretamente o nmero esperado de descendentes dessa rainha. a) 1.250 fmeas; (zero) macho b) 1.000 fmeas; (zero) macho c) 1.000 fmeas; 250 machos. d) 625 fmeas; 625 machos e) 500 fmeas; 500 machos 154. PUCCamp-SP Os descendentes dessa rainha tero olhos: a) somente da cor marrom. b) somente das cores marrom ou prola. c) da cor marrom, se forem fmeas; da cor prola, se forem machos. d) da cor marrom ou prola, se forem fmeas, e, nos machos, as cinco cores sero possveis. e) da cor marrom ou prola, se forem machos, e, nas fmeas, as cinco cores sero possveis. 155. UFSC O padro de pelagem em coelhos condicionado por uma srie allica, constituida por quatro alelos: C, padro aguti; cch, padro chinchila; ch, padro himalaia; ca, padro albino. O alelo C dominante sobre todos os demais; o alelo cch dominante sobre ch e ca e, finalmente, o ch dominante em relao ao ca. Com basenessas informaes, assinale a(s) proposio(es) verdadeira(s). 01. A descendncia de um cruzamento entre coelhos aguti e chinchila poder ter indivduos aguti, chinchila e albino. 02. Do cruzamento entre indivduos com padro himalaia podero surgir indivduos himalaia e albino. 04. O cruzamento entre coelhos albinos originar, sempre, indivduos fenotipicamente semelhantes aos pais. 08. Coelhos aguti, chinchila e himalaia podero ser homozigotos ou heterozigotos. 16. Todo coelho albino ser homozigoto. D como resposta o resultado da soma das proposies corretas.
85

Das afirmaes abaixo, qual a nica que est inteiramente de acordo com os dados? a) Cabelo ondulado caracterstica determinada por gene dominante. b) Os indivduos 3 e 4 so heterozigotos. c) O casal 6-7 poder ter filhos de cabelos crespos. d) Se o indivduo 5 se casar com uma mulher de cabelos crespos, todos os seus filhos tero cabelos ondulados. e) Os pais do indivduo 2 tm, obrigatoriamente, gentipo igual ao do filho. 152. FCMSC-SP Admita que, em abelhas, a cor dos olhos condicionada geneticamente por uma srie allica constituda por 5 genes, sendo que o alelo selvagem (marrom) dominante sobre os demais (prola, neve, creme e amarelo). Uma rainha, de olho marrom, porm heterozigota para prola, produziu 500 gametas e foi inseminada por espermatozides que portavam em iguais propores os 5 alelos. Toda a descendncia tem a mesma oportunidade de sobrevivncia, porm a fertilizao ocorreu em 70% dos ovos somente. Qual o nmero aproximado de machos que tero cor de olho marrom? a) 75 d) 200 b) 90 e) 250 c) 150

PV2D-07-BIO-24

156. Fuvest-SP No coelho, h uma srie de quatro alelos que determinam a cor da pelagem. Quantos desses alelos devem estar presentes em cada coelho? Por qu? 157. Quantas combinaes genotpicas possvel aparecer em uma populao que apresenta 7 alelos mltiplos para um determinado carter? 158. Vunesp Em coelhos, os alelos C, cch, ch e ca condicionam, respectivamente, pelagem dos tipos selvagem, chinchila, himalaia e albino. Em uma populao de coelhos em que estejam presentes os quatro alelos, o nmero possvel de gentipos diferentes ser: a) 4 b) 6 c) 8 d) 10 e) 12 159. Um carter determinado por um par de genes alelos (A e a) pode originar trs gentipos possveis: AA, Aa e aa. Quantos gentipos so possveis para uma caracterstica condicionada por cinco alelos? 160. Em seres humanos, a homozigose de um gene recessivo provoca um crescimento excessivo das mos e dos ps e, ao mesmo tempo, defeitos cardacos e problemas na viso. Que tipo de herana caracteriza o texto acima? Justifique sua resposta. 161. UFPI modificado Na drosfila, a homozigose dos genes recessivos que condicionam asas vestigiais (de tamanho reduzido) determina ao mesmo tempo vrias outras deformidades nos msculos das asas, na disposio das cerdas (plos do corpo), no desenvolvimento corporal, na fertilidade e na longevidade. Este um caso de: a) poliibridismo. b) alelos mltiplos. c) co-dominncia. d) dominncia incompleta. e) pleiotropia. 162. UFRN modificado A manifestao da cor da pelagem e do grau de agressividade dos camundongos evidencia que esses dois caracteres so condicionados pelo mesmo par de genes. Da afirmar-se que todo camundongo branco manso e que todo camundongo cinzento arisco e indomesticvel. No h como recombinar tais caracteres nesses animais, pois o mesmo gene que

faz o animal ser branco tambm o faz dcil e lerdo; o mesmo gene que o faz cinzento tambm o torna gil e fugitivo. A descrio acima caracteriza a atividade gnica do tipo: a) polialelia. b) pleiotropia. c) interao gnica. d) fatores complementares. e) epistasia. 163. Na espcie humana, a sndrome de Marfan, decorrente da ao de um par de genes alelos, caracteriza-se pela ocorrncia de anomalias cardacas associadas aracnodactilia e a defeitos oculares. Assim, correto afirmar que a sndrome de Marfan um exemplo de: a) genes letais. b) pleiotropia. c) mutao cromossmica. d) polialelia. e) epistasia. 164. UFSC Considere um gene que apresenta 3 alelos, aqui denominados alfa, beta e gama. Considere que os alelos alfa e beta so co-dominantes e gama recessivo em relao a ambos. Tal gene deve determinar: 01. trs fentipos, correspondentes a cinco gentipos. 02. trs fentipos, cada um correspondente a um gentipo. 04. quatro fentipos, cada um correspondente a dois gentipos. 08. seis fentipos, correspondentes a quatro gentipos. 16. quatro fentipos, correspondentes a seis gentipos. 165. UFJF-MG Na histria da prova dos 100 metros rasos, 45 atletas conseguiram completar a prova em menos de 10 segundos. Coincidncia ou no, todos eram negros. Esse fato tem levado vrias pessoas a especularem sobre as diferenas genticas entre etnias.
O Globo, 26/06/2005

A velocidade uma caracterstica determinada por muitos genes (poligenia). Sobre a poligenia, incorreto afirmar que: a) as diferenas fenotpicas entre indivduos apresentam variao contnua. b) o nmero de classes fenotpicas depende do nmero de genes. c) os alelos efetivos contribuem igualmente para o fentipo. d) o ambiente tambm pode influenciar o fentipo. e) a relao entre os genes de pleiotropia.

86

Captulo 03
166. Identifique os tipos sangneos presentes em cada lmina. Com base nesta relao, responda ao que se pede. a) Quem do grupo anterior no possui os aglutinognios em suas hemcias? b) Por que Joana pode receber sangue de outros membros do grupo? c) Que tipo de aglutinina possuem Cassilda e Saildo, respectivamente? 169. UFPE A respeito dos grupos sangneos, avalie as proposies a seguir. ( ) Grupo sangneo:A Antgenos: A Anticorpos: Anti-B Doa: A, AB Recebe: A,O ( ) Grupo sangneo: B Antgenos: B Anticorpos: Anti-A Doa: B, AB Recebe: B,O ( ) Grupo sangneo: AB Antgenos: A e B Anticorpos: Anti-A e Anti-B Doa: A, B Recebe: AB, A ,B, AB ( ) Grupo sangneo: O Antgenos: O Anticorpos: No tem Doa: B,AB,A,O Recebe: O ( ) Grupo sangneo: A Antgenos: A Anticorpos: Anti-A Doa: A, AB Recebe: A, O 170. UECE Observe o diagrama geral das possveis trocas sangneas por doao e recepo no sistema ABO.

a)

b)

c)

d)

167. PUCCamp-SP Assinale a alternativa que esquematiza as transfuses que podem ser feitas entre indivduos com diferentes grupos sangneos do sistema ABO (as setas indicam o sentido das transfuses). a)

b)

c)

d)

e) 168. UFV-MG Nas quatro pessoas relacionadas a seguir, foram encontrados os seguintes tipos sangneos: Joana AB Doaldo O Cassilda B Saildo A
87
PV2D-07-BIO-24

A(s) seta(s) cujo(s) sentido(s) (doao recepo) est(o) errado(s) (so): a) 4 e 5 c) 1 b) 2 d) 3 171. Fuvest-SP modificado Um banco de sangue possui 5 litros de sangue AB, 3 litros de sangue A, 8 litros de sangue B e 2 litros de sangue O. Para transfuses em indivduos O, A, B e AB esto disponveis quantos litros de sangue? 172. Mackenzie-SP Um homem sofreu um acidente e precisou de transfuso sangnea. Analisando o seu sangue, verificou-se a presena de anticorpos anti-A e ausncia de anti-B. No banco de sangue do hospital, havia trs bolsas disponveis, sendo que o sangue da bolsa 1 apresentava todos os tipos de antgenos do sistema ABO, o sangue da bolsa 2 possua anticorpos anti-A e anti-B e a bolsa 3 possua sangue com antgenos somente do tipo B. Esse homem pode receber sangue: a) apenas da bolsa 1. b) apenas da bolsa 3. c) da bolsa 2 ou da bolsa 3. d) da bolsa 1 ou da bolsa 2. e) apenas da bolsa 2. 173. Num banco de sangue, foram selecionados os seguintes doadores: Grupo O = 15 Grupo A = 10 Grupo B = 9 Grupo AB = 5 O primeiro pedido de doao partiu de um hospital que tinha trs pacientes nas seguintes condies: paciente X possui aglutininas anti-B; paciente Y possui aglutinognios A e B; paciente Z possui aglutininas anti-A e anti-B. Responda a estas questes. a) Quantos doadores estavam disponveis para o paciente X? b) Quais seriam os doadores para o paciente Y? c) Qual grupo sangneo pode doar para o paciente Z? 174. Vunesp A transfuso de sangue do tipo B para uma pessoa de grupo A resultaria em: a) reao de anticorpos anti-B do receptor com os glbulos vermelhos do doador. b) reao dos antgenos B do receptor com os anticorpos anti-B do doador. c) formao de anticorpos anti-A e anti-B pelo receptor. d) nenhuma reao, porque A receptor universal. e) reao de anticorpos anti-B do doador com antgenos A do receptor. 175. UERJ No quadro a seguir, as duas colunas da direita demonstram esquematicamente o aspecto in vitro das reaes no sangue dos indivduos de cada grupo sangneo ABO aos anti-A e anti-B.
88

Explique o fenmeno que ocorreria com as hemcias de um indivduo do grupo A ao receber sangue de um indivduo do grupo B. 176. UFRJ Nas transfuses sangneas, o doador deve ter o mesmo tipo de sangue que o receptor com relao ao sistema ABO. Em situaes de emergncia, na falta de sangue do mesmo tipo, podem ser feitas transfuses de pequenos volumes de sangue O para pacientes dos grupos A, B ou AB. Explique o problema que pode ocorrer se forem fornecidos grandes volumes de sangue O para pacientes A, B ou AB. 177. Vunesp Um casal tem cinco filhos: Alex, Pedro, Mrio, rica e Ana. Dois dos irmos so gmeos univitelinos. rica, um dos gmeos, sofreu um acidente e precisa urgentemente de uma transfuso de sangue, e os nicos doadores disponveis so seus irmos. Na impossibilidade de se fazer um exame dos tipos sangneos, responda ao que se pede. a) Entre seus irmos, qual seria a pessoa mais indicada para ser o doador? b) Justifique sua resposta. 178. Udesc Os grupos sangneos so determinados pela presena ou ausncia de antgenos na superfcie das hemcias. No caso do sistema ABO, os antgenos esto presentes no sangue dos grupos A, B, AB e ausentes no grupo O.
Reserva estratgica de sangue, de Ricardo Lorzetto. Cincia Hoje, SBPC, vol. 19/nZ 113, set. 95, p. 58.

a) O que so antgenos? b) Qual a importncia de se identificar a presena de antgenos eritrocitrios (presentes nas hemcias ou eritrcitos) no sangue humano? 179. PUC-SP Em um hospital, h um homem necessitando de uma transfuso de emergncia. Sabe-se que ele pertence ao grupo sangneo A e que, no hospital, h quatro indivduos que se ofereceram para doar sangue. Foi realizada a determinao de grupos sangneos do sistema ABO dos quatro indivduos, com a utilizao de duas gotas de sangue de cada um deles, que, colocadas em uma lmina, foram, em seguida, misturadas aos soros anti-A e anti-B. Os resultados so apresentados a seguir:

soro anti-A Indivduo I soro anti-A Indivduo III

soro anti-B

soro anti-A

soro anti-B Indivduo II

soro anti-B

soro anti-A

soro anti-B

Indivduo IV

Observao: o sinal + significa aglutinao de hemcias; o sinal significa ausncia de aglutinao. A partir dos resultados observados, podero doar sangue ao referido homem os indivduos: a) I e II. d) II e IV. b) I e III. e) III e IV. c) II e III. 180. UFG-GO necessrio o conhecimento do tipo sangneo, em caso de transfuso. Em relao ao sistema ABO, marque V (verdadeiro) ou F (falso). I. Indivduos do grupo sangneo O podem doar sangue para pessoas do seu prprio tipo sangneo e para os demais. II. Indivduos do grupo AB podem receber sangue de qualquer tipo. III. Indivduos portadores de sangue do tipo A possuem aglutinognios A. IV. Indivduos do grupo B possuem aglutinina anti-A. 181. A transfuso de sangue tipo AB para uma pessoa com sangue tipo B: a) pode ser realizada sem problema, porque as hemcias AB no possuem antgenos que possam interagir com anticorpos anti-A presentes no sangue do receptor. b) pode ser realizada sem problema, porque as hemcias AB no possuem antgenos que possam interagir com anticorpos anti-B presentes no sangue do receptor. c) pode ser realizada sem problema, porque, apesar de as hemcias AB apresentarem antgeno A e antgeno B, o sangue do receptor no possui anticorpos contra eles. d) no deve ser realizada, pois os anticorpos anti-B presentes no sangue do receptor podem reagir com os antgenos B presentes nas hemcias AB. e) no deve ser realizada, pois os anticorpos anti-A presentes no sangue do receptor podem reagir com os antgenos A presentes nas hemcias AB. 182. Um homem faleceu por causa de uma transfuso de sangue. Sabendo-se que seus pais pertenciam ao grupo B (homozigoto) e AB, pergunta-se: a) Qual o grupo sangneo do homem em questo? b) Qual ou quais os possveis grupos sangneos usados erroneamente na transfuso?

183. UEL-PR Uma criana necessita urgentemente de uma transfuso de sangue. Seu pai tem sangue do tipo B e sua me, do tipo O. Que outro(s) tipo(s) de sangue, alm do tipo O, poderia(m) ser utilizado(s) na transfuso, mesmo sem a realizao de teste, sabendo-se que o av paterno da criana tem sangue do tipo AB e sua av paterna tem sangue do tipo O? a) Tipo AB d) Tipo A e tipo B b) Tipo A e) Nenhum outro tipo c) Tipo B 184. UFSCar-SP Em relao ao sistema sangneo ABO, um garoto, ao se submeter ao exame sorolgico, revelou ausncia de aglutininas. Seus pais apresentaram grupos sangneos diferentes e cada um apresentou apenas uma aglutinina. Os provveis gentipos dos pais do menino so: a) IBi ii. d) IAIB IAIA . b) IAi ii. e) IAi IBi. A B A c) I I I i. 185. PUCCamp-SP O heredograma a seguir mostra os diferentes tipos sangneos existentes em uma famlia.

Assinale a alternativa que contm, respectivamente, o fentipo e o gentipo do indivduo II 2. a) O ii d) B IBi b) A IAi e) AB IAIB c) A IAIA 186. Fuvest-SP Uma mulher do grupo sangneo A, cuja me era do grupo O, casa-se com um homem doador universal. Os grupos sangneos dos provveis filhos do casal podero ser: a) A ou AB. d) apenas O. b) A ou B. e) A ou O. c) apenas A. 187. UFRGS-RS Um homem do grupo sangneo O acusado por uma antiga namorada de ser o pai de seu filho. Essa namorada tem um pai de grupo sangneo A, e sua me e seu irmo so do grupo O. O filho em questo do grupo sangneo B. As chances de a namorada ser do grupo sangneo A e de o homem ser pai da criana so, respectivamente, de: a) 25% e 0%. b) 25% e 25%. c) 25% e 50%. d) 50% e 0%. e) 50% e 25%.
89

PV2D-07-BIO-24

188. Um homem do grupo sangneo B, filho de pai O e me AB, tem uma irm do grupo A que se casa com um homem do grupo B, cujo pai do grupo AB e a me, do grupo A. Deste casamento, nasceram dois meninos: um AB e outro A. Determine todos os gentipos dos indivduos mencionados. 189. Fuvest-SP Nos anos 1940, o famoso cineasta Charlie Chaplin foi acusado de ser o pai de uma criana, fato que ele no admitia. Os exames de sangue revelaram que a me era do grupo A, a criana do grupo B e Chaplin do grupo O. Ao final do julgamento, Chaplin foi considerado como sendo um possvel pai da criana. a) O veredito aceitvel? Por qu? b) Na hiptese de Chaplin ter tido filhos com a referida mulher, de que tipos sangneos eles poderiam ser? 190. Fuvest-SP Uma mulher de sangue tipo A, casada com um homem de sangue tipo B, teve um filho de sangue tipo O. Se o casal vier a ter outros 5 filhos, a chance de eles nascerem todos com sangue do tipo O : a) igual chance de nascerem todos com sangue do tipo AB. b) menor que a chance de nascerem todos com sangue do tipo AB. c) maior que a chance de nascerem todos com sangue do tipo AB. d) menor que a chance de nascerem, sucessivamente, com sangue do tipo AB, A, B, A e B. e) maior que a chance de nascerem, sucessivamente, com sangue do tipo AB, B, B, A e A. 191. UFPI Sandra teve uma filha, Maria, e afirma que Lucas o pai da criana. Sabendo que Sandra do grupo sangneo A e que Maria pertence ao grupo O, podese afirmar que: a) se Lucas tambm for do grupo sangneo A ele no poder ser o pai de Maria. b) Lucas s poder ser o pai de Maria se pertencer ao grupo sangneo AB. c) o pai de Maria pode pertencer ao grupo sangneo A, B ou O. d) somente sendo Lucas um indivduo homozigoto do grupo sangneo B, ele poder ser pai de Maria. e) desde que Lucas seja homozigoto para os genes do sistema sangneo ABO, ele poder ser o pai de Maria se pertencer ao grupo A ou B. 192. Determine os gentipos nos trs casos seguintes. a) Pai e me de grupo A, com trs filhos A e uma filha O. b) Pai A, me B, crianas em que os quatro grupos esto representados. c) Pai AB, me B, com filhos B, AB e A.
90

193. FCMSC-SP O av materno de uma mulher pertence ao grupo sangneo AB, enquanto todos os demais avs so do grupo O. Qual a probabilidade de que essa mulher seja, respectivamente, do grupo A, B, AB e O? a) 0, 0, 1/2, 1/2 d) 1/4, 1/4, 0, 1/2 b) 1/2, 1/2, 0, 1/4 e) 1/8, 1/8, 1/4, 1/4 c) 1/2, 1/2, 1/4, 1/4 194. UFMG Observe a figura que se refere determinao do grupo sangneo ABO.

Com base nas informaes contidas nessa figura e nos conhecimentos sobre o assunto, pode-se afirmar que: a) crianas dos grupos A e O podem nascer da unio de indivduos dos tipos determinados em 1 e 4. b) indivduos do tipo determinado em 2 formam os dois tipos de antgenos. c) indivduos do tipo determinado em 3 podem ter gentipo IBIB ou IBi. d) indivduos do tipo determinado em 4 podem doar sangue para 1 e 3. e) indivduos do tipo determinado em 1 podem receber sangue de todos os outros tipos. 195. UFSM-RS Para os grupos sangneos do sistema ABO, existem trs alelos comuns na populao humana. Dois (alelos A e B) so co-dominantes entre si, o outro (alelo O) recessivo em relao aos outros dois. De acordo com essas informaes, pode(m)-se afirmar: I. Se os pais so do grupo sangneo O, os filhos tambm sero do grupo sangneo O. II. Se um dos pais do grupo sangneo A e o outro do grupo sangneo B, todos os filhos sero do grupo sangneo AB. III. Se os pais so do grupo sangneo A, os filhos podero ser do grupo sangneo A ou O. Est(o) correta(s): a) apenas I. b) apenas II. c) apenas III. d) apenas I e III. e) I, lI e III.

196. UFSC modificado A herana dos tipos sangneos do sistema ABO constitui um exemplo de alelos mltiplos (polialelia) na espcie humana.

Com relao ao sistema ABO correto afirmar que: 01. o tipo O muito freqente e, por esse motivo, o alelo responsvel por sua expresso dominante sobre os demais. 02. os indivduos classificam-se em um dos trs gentipos possveis: grupo A, grupo B e grupo O. 04. existem trs alelos: o IA, o IB e o i. 08. os alelos IA e IB so co-dominantes. 16. se um indivduo do grupo A for heterozigoto, ele produzir gametas portadores de IA ou de i. 32. os indivduos de tipo sangneo O possuem aglutinognios em suas hemcias, porm no possuem aglutininas no plasma. 64. em alguns cruzamentos, entre indivduos do grupo A com indivduos do grupo B, possvel nascerem indivduos do grupo O. 197. UFPA No quadro abaixo, esto representados os resultados da reao de aglutinao de hemcias de quatro indivduos, na presena de anticorpos anti-A, anti-B e anti-Rh. Anti-A Joo Paulo Maria Ana + + Anti-B + + Anti-Rh + +

Indivduo 1 2 3 4 5

Soro Anti-A aglutinou aglutinou aglutinou no aglutinou no aglutinou

Soro Anti-B no aglutinou aglutinou aglutinou no aglutinou no aglutinou

Soro Anti-Rh no aglutinou no aglutinou aglutinou no aglutinou aglutinou

Com base nesses resultados, indique quais os indivduos que sero considerados, respectivamente, receptor e doador universal. 200. Na genealogia a seguir, esto representados os tipos sangneos de cada indivduo quanto ao sistema ABO e Rh.

Com base nos resultados apresentados no teste de aglutinao, marque qual das alternativas contm a afirmativa correta. a) Ana pertence ao grupo sangneo O, Rh+. b) Maria poder receber sangue de Paulo. c) Maria possui aglutininas anti-A e anti-B no plasma. d) Joo possui aglutinognio ou antgeno B em suas hemcias. e) Paulo possui aglutinognio ou antgeno A em suas hemcias. 198. Vunesp Um determinado banco de sangue possui 4 litros de sangue tipo AB, 7 litros de sangue tipo A, 1 litro de sangue tipo B e 9 litros de sangue tipo O, todos Rh+. Se houver necessidade de transfuses sangneas para um indivduo com sangue tipo AB, Rh+, estaro disponveis para ele, do total acima mencionado: a) 4 litros. b) 8 litros. c) 12 litros. d) 13 litros. e) 21 litros. 199. Vunesp Um laboratrio realizou exames de sangue em cinco indivduos e analisou as reaes obtidas com os reagentes anti-A, anti-B e anti-Rh, para a determinao da tipagem sangnea dos sistemas ABO e Rh. Os resultados obtidos encontram-se no quadro a seguir.

Qual a probabilidade de o indivduo 5 ser receptor universal para os dois sistemas? 201. Fuvest-SP Lcia e Joo so do tipo sangneo Rh positivo e seus irmos, Pedro e Marina, so do tipo Rh negativo. Quais dos quatro irmos podem vir a ter filhos com eritroblastose fetal? a) Marina e Pedro b) Lcia e Joo c) Lcia e Marina d) Pedro e Joo e) Joo e Marina 202. UFRGS-RS Assinale a alternativa que completa corretamente as lacunas do texto a seguir. Uma mulher do tipo sangneo Rh, homozigota recessiva, e seu marido Rh+. Se ele for ______________, _______________ Rh+, a me reconhecer os glbulos vermelhos do embrio como estranhos e produzir anticorpos anti-Rh. Isso s acontecer quando houver passagem do sangue do embrio para a circulao materna. a) homozigoto, nenhum dos filhos ser. b) heterozigoto, todos os filhos sero. c) homozigoto, todos os filhos sero. d) heterozigoto, nenhum dos filhos ser. e) homozigoto, metade dos filhos ser.
91

PV2D-07-BIO-24

203. PUC-MG Um casal possui o seguinte gentipo para o fator Rh: pai Rr e me rr. Considerando apenas o fator Rh, a probabilidade de esse casal vir a ter um filho do sexo masculino, com ocorrncia de eritroblastose fetal, : 1 a) 1 d) 4 1 1 b) e) 2 8 c) 1 3

206. UFRS Em um banco de sangue de um hospital, as etiquetas que identificavam os tipos sangneos estavam em cdigo, e, por acidente, o livro em que estavam registrados os cdigos foi perdido. Para que os frascos contendo sangue fossem identificados, foram feitos testes com amostras correspondentes a cada cdigo, e o resultado foi o seguinte: Cdigo I II III IV V Volume Soro do Soro do Soro do em litros grupo A grupo B grupo Rh no 15 aglutinou aglutinou aglutinou no no 15 aglutinou aglutinou aglutinou no 30 aglutinou aglutinou aglutinou 30 aglutinou aglutinou aglutinou no no 20 aglutinou aglutinou aglutinou no no no 25 aglutinou aglutinou aglutinou

204. Mackenzie-SP

Considere o heredograma acima, que mostra a tipagem ABO e Rh dos indivduos.Sabendo que o casal 5 x 6 ja perdeu uma criana com eritroblastose fetal, a probabilidade de nascer uma menina do tipo O, Rh+ de: 1 1 a) d) 6 4 b) c) 1 8 1 2 e) 1 3

VI

205. Unitau-SP A tabela a seguir foi elaborada a partir de testes para determinao dos grupos sangneos de seis pessoas de uma academia de ginstica. O sinal positivo (+) significa aglutina e o sinal negativo () significa no aglutina. Aps analisar a tabela, assinale a alternativa que indica os grupos sangneos de todas as pessoas quanto aos sistemas ABO e Rh, mantendo a seqncia disposta na tabela. Nome Amanda Gustavo Patrcia Pedro Lus Augusto Cludio a) b) c) d) e)
92

Baseados nesse teste, podemos afirnar que: a) existem 105 litros de sangue disponveis para um receptor AB Rh+. b) existem 135 litros de sangue disponveis para um receptor AB Rh. c) existem 105 litros de sangue disponveis para um receptor A Rh+. d) existem 135 litos de sangue disponveis para um receptor O Rh+. e) existem 25 litros de sangue disponveis para um receptor O Rh. 207. Vunesp Os mdicos informaram que o pai, gravemente ferido em um acidente de automvel, precisava de transfuso de sangue. A esposa era de tipo sanguneo A Rh. Entre os trs filhos, todos Rh+, s no havia o tipo O. Esposa e filhos se apresentaram para doao, mas o tipo sangneo do pai s lhe permitia receber sangue de um de seus familiares. Dentre esposa e filhos, o doador escolhido apresentava: a) aglutinognio do tipo B e aglutinina anti A. b) aglutinognio do tipo A e aglutinina anti B. c) aglutinognio dos tipos A e B. d) aglutininas anti A e anti B. e) Rh, ou seja, sua esposa. 208. PUC-SP Qual dos indivduos abaixo pode ser pai de uma criana do grupo O Rh, se a me do grupo A Rh+? a) IAIARr b) IBiRr c) IBiRR d) IAIBrr e) iiRR

Soro Anti-A + + +

Soro Anti-B + + + +

Soro Anti-Rh + + +

O, Rh / AB, Rh+/ R, Rh / A, Rh+/ O, Rh+/ A, Rh O, Rh+/ AB, Rh / B, Rh+/ A, Rh / O, Rh / A, Rh+ AB, Rh / O, Rh+/ A, Rh / B, Rh+/ AB, Rh+/ B, Rh AB, Rh+/ O, Rh / A, Rh+/ B, Rh / AB, Rh / B, Rh+ AB, Rh+/ O, Rh / B, Rh+/ A, Rh / AB, Rh / A, Rh+

209. PUC-MG Alexsander no sabe qual o seu grupo sangneo e o seu tipo de Rh. Entretanto, sabe que seu pai A+, sua me O+ e seu irmo A. Assinale a opo que contm o(s) grupo(s) sangneo(s) e o(s) tipo(s) de Rh que Alexsander pode ter: a) Tipo sangneo: A, somente; Fator Rh: positivo ou negativo. b) Tipo sangneo: O, somente; Fator Rh: positivo, somente. c) Tipo sangneo: A ou O; Fator Rh: negativo ou positivo, d) Tipo sangneo: A ou O; Fator Rh: positivo, somente. e) Tipo sangneo: O, somente; Fator Rh: negativo ou positivo. 210. Fuvest-SP Um casal teve quatro filhos cujos fentipos, em relao aos grupos sangneos ABO e Rh, so os seguintes: 1a criana: A, Rh positivo 2a criana: B, Rh negativo 3a criana: AB, Rh positivo 4a criana: O, Rh negativo Sabendo-se que o sistema ABO determinado pelos alelos IA , IB, e i, e considerando que o fator Rh determinado pelos alelos R e r, podemos concluir que, provavelmente, os pais so: a) IAi, Rr e IAi, Rr d) IAi, rr e IBi, rr b) IAi, Rr e IBi, Rr e) IAIB, rr e ii, RR c) IAIB, Rr e ii, rr 211. Um homem que, ao nascer, apresentou eritroblastose fetal, apresenta qual chance de ter uma criana com gentipo igual ao seu para o fator Rh? a) Depende da me. d) 75% b) 25% e) nula c) 50% 212. Unicamp-SP Um homem (I) do grupo sangneo A e Rh+ casado com uma mulher (II) do grupo sangneo B e Rh+. Sabe-se que o pai desse homem e a me dessa mulher pertencem ao grupo sangneo O e so Rh. Qual a probabilidade de o casal I, II ter um descendente: a) O e Rh? b) AB e Rh+? 213. Unicamp-SP Com base no heredograma a seguir, responda ao que se pede.

a) Qual a probabilidade de o casal formado por 5 e 6 ter duas crianas com sangue AB Rh+? b) Se o casal em questo j tiver uma criana com sangue AB Rh+, qual a probabilidade de ter outra com os mesmos fentipos sangneos? 214. PUC-RJ Uma famlia apresentou o seguinte histrico em relao ao fator Rh:

A anlise do henograma mostra que o fentipo da famlia para a caracterstica em questo : Pai a) b) c) d) e) Rr rr rr Rr Rr Me 1o filho 2o filho 3o filho 4o filho rr Rr RR Rr rr Rr rr RR rr Rr Rr Rr RR rr rr rr rr rr Rr Rr Rr Rr Rr rr rr

215. PUC-SP Duas mulheres disputam a maternidade de uma criana, que, ao nascer, apresentou a doena hemoltica ou eritroblastose fetal. O sangue das duas mulheres foi testado com o uso do soro anti-Rh, e os resultados so apresentados abaixo.

Qual das mulheres poderia ser a verdadeira me daquela criana? Justifique sua resposta. 216. Vunesp Mrcia desconhecia qual era o seu fator Rh, embora soubesse que nao poderia receber transfuso de sangue Rh positivo; sabia, ainda, que um dos seus irmos, ao nascer, havia apresentado eritroblastose fetal e que seu pai era Rh positivo, filho de me Rh negativo. Com base nas informaes, pode-se admitir que, em termos do fator sangneo Rh, Mrcia: a) pertence ao mesmo grupo da me, embora ela seja homozigota e sua me, heterozigota. b) necessariamente homozigota, a exemplo do que acontece com o fentipo de seu pai. c) poderia receber tranfuso sangnea de seu pai, mas nunca poderia receb-la de sua me. d) pertence a um grupo diferente do de seu pai, mas apresenta gentipo e fentipo iguais aos de sua me. e) nescessariamente heterozigota, a exemplo do que acontece com o gentipo de sua me.
93

PV2D-07-BIO-24

217. PUC-MG Indivduos sem antgeno Rh nas hemcias so considerados recessivos. Carlos, que tem Rh+ e homozigoto, casou-se com Elaine, que tem Rh. Ambos possuem o mesmo grupo sangneo. Fazendo um exame pr-natal e relatando esse fato ao mdico, o mesmo ficou: a) despreocupado e no fez qualquer recomendao relativa ao fato. b) despreocupado, no fez qualquer recomendao, apenas solicitando ao casal que o procurasse no momento da segunda gestao. c) preocupado, recomendando que, logo aps o parto, a me recebesse soro anti-Rh. Numa segunda gravidez, entretanto, disse que esse procedimento no seria mais necessrio. d) bastante preocupado, inclusive pela informao de compatibilidade de grupo sangneo, recomendando bastante ateno em cada gravidez, de maneira que, aps cada parto, a me recebesse soro anti-Rh. e) bastante preocupado, dizendo ao casal que a gravidez era de altssimo risco e eles no poderiam mais ter outro filho. 218. Na determinao dos grupos sangneos de 6 pessoas de uma firma, foi possvel a construo do quadro abaixo, no qual o sinal + significa aglutinina, e o sinal significa no-aglutinina. Sangue do(a) Cludio Csar Alexandre Sandra Cristiane Vera Soro Anti-A + + + Soro Anti-B + + + + Soro Anti-Rh + + +

220. Mackenzie-SP

No heredrograma acima, esto representados os tipos sangneos de cada indivduo. Assinale a alternativa correta. a) O casal 3 x 4 no poder ter filhos com eritroblastose fetal. b) O indivduo 2 certamente homozigoto para o grupo sangneo ABO. c) A mulher 4 no pode ser filha de me Rh. d) O indivduo 3 pode ter um irmo receptor universal. e) O casal 3 x 4 tem 50% de probabilidade de ter outra criana pertencente ao grupo O. 221. Mackenzie-SP O quadro abaixo mostra os resultados das tipagens ABO e Rh de um casal e de seu filho. O sinal + indica reao positiva e o sinal indica reao negativa. Soro Anti-A Pai Me Criana + Soro Anti-B + Soro Anti-Rh + +

Considere as seguintes afirmaes. I. Essa mulher poder dar luz uma criana com eritroblastose fetal. II. Em caso de transfuso sangnea, a criana poder receber sangue tanto da me quanto do pai. III. O gentipo do pai pode ser IAIARR. Assinale: a) se somente III estiver correta. b) se somente II estiver correta. c) se somente I estiver correta. d) se somente I e III estiverem corretas. e) se somente II e III estiverem corretas. 222. Mackenzie-SP Analise o heredograma abaixo.

Indique: a) os grupos sangneos de todas as pessoas quanto aos sistemas ABO E Rh; b) as pessoas do sexo masculino que poderiam ser pais de uma criana com eritroblastose fetal caso a esposa fosse Rh negativo; c) a pessoa que poderia doar sangue a qualquer outra da relao, sem problemas de incompatibilidade sangnea; d) as pessoas para quem Alexandre poderia doar sangue sem problemas de aglutinao nem de sensibilidade ao fator Rh. 219. Unicamp-SP Na eritroblastose fetal ocorre destruio das hemcias, o que pode levar recm-nascidos morte. a) Explique como ocorre a eritroblastose fetal. b) Como evitar sua ocorrncia? c) Qual o procedimento usual para salvar a vida do recm-nascido com eritroblastose?
94

Sabendo-se que a mulher 7 pertence mesma tipagem Rh da sua me, qual a probabilidade de o casal 7 8 ter uma criana doadora universal para a tipagem Rh e ABO? a) 1/2 b) 3/4 c) 1/4 d) 1/8 e) 2/6 223. Mackenzie-SP Um indivduo de sangue do tipo B, Rh+, filho de pai O, Rh, casa-se com uma mulher de sangue do tipo A, Rh+, que teve eritroblastose fetal ao nascer e filha de pai do tipo O. A probabilidade de esse casal ter uma criana que possa doar sangue para o pai de: a) 1/2 b) 1/4 c) 3/4 d) zero e) 1 224. UFMS A herana dos grupos sangneos do sistema MN determinada por: a) um par de alelos com dominncia entre eles. b) um par de alelos sem dominncia entre eles. c) um par de alelos em interao com os genes do sistema ABO. d) alelos mltiplos em interao com os genes do sistema ABO. e) alelos mltiplos sem interao com os genes do sistema ABO. 225. Assinale a alternativa que rene caractersticas genticas determinadas por herana com co-dominncia e herana com dominncia incompleta ou intermediria. Co-dominncia a) b) c) d) e) Sistema MN Polidactilia Sistema MN Albinismo Sistema ABO Herana intermediria Albinismo Colorao de ervilhas-decheiro de Mendel Colorao de Mirabilis jalapa Polidactilia Sistema Rh

227. Fuvest-SP Uma criana tem sangue do tipo O, Rh+, M. O tipo sangneo de sua me B, Rh, MN. O pai da criana poderia ser: a) AB, Rh+, MN. d) A, Rh, MN. b) B, Rh+, M. e) O, Rh, MN. c) O, Rh+, N. 228. PUC-SP A tabela abaixo indica os resultados das determinaes dos grupos sangneos dos sistemas ABO e MN para um casal. Soro anti-A Y X + Soro anti-B + + Soro anti-M + + Soro anti-N +

Esses resultados nos permitem concluir que esse casal poder ter um filho com qualquer um dos fentipos a seguir, exceto: a) B, N d) A, MN b) AB, M e) A, M c) B, MN 229. UFU-MG Discute-se a paternidade de uma criana com o seguinte fentipo sangneo: A, MN, Rh. Sua me pertence ao grupo B, N, Rh+. Qual o fentipo do suposto pai? a) B; MN, Rh b) AB; N; Rh c) A; N, Rh+ d) AB, M; Rh+ 230. UFOP-MG Um casal afirma que uma determinada criana encontrada pela polcia seu filho desaparecido. Diante de tal situao, foram realizados exames para verificar tal possibilidade, sendo que os resultados dos testes para os grupos sangneos foram: suposto pai: Rh+, A, M; suposta me: Rh+, B, N; criana: Rh, O, MN. Explique como esses resultados excluem ou no a possibilidade de que a criana em questo seja o filho do casal. 231. Mackenzie-SP Considerando os casamentos a seguir, uma criana de tipo sangneo B, Rh+, M poder ser filha:

226. UFES Paula pertence ao grupo sangneo A, Rh+, M e teve uma criana do grupo sangneo O, Rh, MN. Qual dos indivduos, cujos grupos sangneos esto abaixo relacionados, pode ser excludo como pai dessa criana? a) A, Rh+, MN b) B, Rh, N c) O, Rh+, N d) AB, Rh, N e) O, Rh, MN

PV2D-07-BIO-24

95

a) b) c) d) e)

somente do casal I. do casal I ou do casal IV. do casal III ou do casal IV. somente do casal III. do casal I ou do casal II ou do casal III.

232. Na genealogia abaixo, esto representados os grupos sangneos dos sistemas ABO, Rh e MN para 4 indivduos:

e Lcia (O, MN, Rh+). Tomando como base apenas os tipos sangneos dos envolvidos, possvel que Joo seja o pai: a) das quatro crianas. b) de Pedro apenas. c) de Mrcia e de Pedro apenas. d) de Carlos apenas. e) de Carlos e de Lcia apenas. 236. PUC-SP Em uma lmina, trs gotas de sangue de um indivduo foram misturadas a trs tipos de soros: anti-A, anti-Rh e anti-M. Os resultados esto apresentados abaixo.

Qual a probabilidade de o indivduo n 5 ser O, Rh, MN? a) 1/16 b) 1/8 c) 1/4 d) 1/32 e) 1/64 233. UEL-PR Uma mulher com grupos sangneos B, N, Rh+ teve trs crianas com pais distintos: Crianas I. II. III. O, MN, AB, N, Rh Rh+ a. b. c. Pais A, N, Rh A, M, Rh B, N, Rh+

Pela anlise dos resultados, podemos afirmar corretamente que esse indivduo: a) pertence aos grupos sangneos A, Rh+ e M. b) pertence aos grupos sangneos B, Rh e N. c) pertence aos grupos sangneos AB, Rh+ e MN. d) apresenta aglutinognios A, Rh e M. e) no apresenta aglutinognios A, Rh e M. 237. Duas mulheres disputam a maternidade de uma criana, as quais, para os sistemas ABO e Rh, apresentam as mesmas chances. O resultado a seguir mostra uma tipagem sangnea para o sistema MN de ambas.

B, N, Rh

Assinale a alternativa que relaciona corretamente cada criana ao seu pai: a) I a; II b; III c d) I b; II c; III a b) I a; II c; III b e) I c; II b; III a c) I b; II a; III c 234. Fatec-SP So os seguintes os fatos apresentados num caso de paternidade duvidosa: me: sangue A, Rh, M filho: sangue AB, MN; apresentou eritroblastose fetal ao nascer. Dos homens indiciados, pode ser pai da criana: a) Manoel: sangue A, N, Rh positivo. b) Pedro: sangue B, N, Rh negativo. c) Jaime: sangue B, MN, Rh positivo. d) Jurandir: sangue AB, M, Rh positivo. e) Paulo: sangue O, M, Rh negativo. 235. Fuvest-SP Maria, com fentipo A MN Rh+, pleiteia na justia, de Joo, que possui fentipo AB, M, Rh, o reconhecimento da paternidade de seus quatro filhos: Carlos (AB, N, Rh); Mrcia (A, MN, Rh); Pedro (B, M, Rh+)
96

A criana apresenta aglutinognios M e N em suas hemcias. O pai apresenta apenas aglutinognio N. Qual das mulheres poderia ser a me verdadeira? Justifique sua resposta. 238. PUC-MG Josivaldo no sabe qual o seu grupo sangneo e o seu tipo de Rh, nem seu sistema MN. Entretanto, sabe que seu pai AB+ MN, sua me, O+ MN e seu irmo, A MN. Assinale a opo que contm o(s) grupo(s) sangneo(s), o(s) tipo(s) de Rh e o sistema MN que Josivaldo pode ter. a) Tipo sangneo: A, somente; fator Rh: positivo ou negativo; tipo MN: M, N ou MN. b) Tipo sangneo: O, somente; fator Rh: positivo, somente; tipo MN: N ou MN. c) Tipo sangneo: A ou B; fator Rh: positivo ou negativo; tipo MN: M, N ou MN. d) Tipo sangneo: A ou O; fator Rh: positivo, somente; tipo MN: M ou N. e) Tipo sangneo: O, somente; fator Rh: negativo, somente; tipo MN: somente N.

239. Uma mulher MN, B, Rh+, cujo pai O, casada com um homem com o mesmo gentipo. A probabilidade de esse casal vir a ter uma criana N, O, Rh+ : a) b) c) d) e) 1 16 3 32 1 64 3 64 3 16

242. UFMG O heredograma a seguir representa uma famlia na qual foram determinados os grupos sangneos do sistema ABO para alguns dos membros, o sistema MN para outros e do sistema Rh para todos os membros. Com base nas informaes contidas no heredograma e em seus conhecimentos sobre o assunto, incorreto afirmar que:

240. UCMG Um homem de gentipo AB,MN, Rr casa-se com uma mulher AB, MM, rr. No sistema MN, os genes M e N no revelam dominncia entre si trata-se de um caso de co-dominncia. Sabendo-se que os loci gnicos determinantes dos sistemas ABO, MN e Rh esto localizados em cromossomos distintos, qual a probabilidade de virem a nascer, desse casamento, duas meninas A, MM, rr? a) 1/1.024 b) 1/512 c) 1/256 d) 1/128 e) 1/84 241. Cesgranrio-RJ A observao do esquema a seguir, que representa a genealogia de uma famlia em relao aos grupos sangneos MN, permite-nos afirmar que:

a) A probabilidade de o indivduo I-2 formar gametas iR de 50% e N de 100%. b) A probabilidade de II-4 ter uma criana com eritroblastose fetal de 0%. c) Os indivduos Rh-positivos da gerao II pertencem ao grupo sangneo A, e os Rh-negativos, ao grupo O. d) O indivduo I-1 heterozigoto para duas das caractersticas. e) Os indivduos II-3 e II-4 podem apresentar os dois tipos de aglutinina do sistema ABO e um tipo para o sistema MN. 243. UFRJ O sangue de Clodoaldo aglutina quando colocado em presena de soro contendo imunoglobulinas ou aglutininas anti-M e no com anti-N, e no aglutina quando colocado em presena de imunoglobulinas ou aglutininas anti-B nem anti-A. Clodoaldo casa-se com Julieta, que apresenta aglutinaes inversas. O casal tem um filho cujo sangue no aglutina em nenhum dos dois tipos de soro, porm aglutina para o sistema MN. a) Qual o gentipo dos pais? b) Qual a probabilidade de esse casal ter uma criana cujo sangue aglutine nos dois tipos de soro para o sistema MN? Justifique sua resposta. 244. Uma senhora B, M, Rh+ casada com um senhor A, MN, Rh. Deste casal nasce um filho O, Rh, que se casa com uma jovem filha de pai B, M, Rh+ e me O, N, Rh .Deste casamento nasce um filho B, N, Rh+. Determine os possveis gentipos dos indivduos citados.

a) sangue MN caracterstica determinada por gene dominante. b) os indivduos 4 e 5 so heterozigotos. c) os casais 3 e 4 podero ter filhos dos trs tipos de grupos sangneos. d) se o indivduo 5 casar-se com uma mulher de sangue N, todos os filhos sero heterozigotos. e) um prximo filho do casal 6 e 7 poder ser do grupo N.
PV2D-07-BIO-24

97

Captulo 04
245. FMU-SP A polidactilia determinada por um gene dominante P e a queratose devida a um gene dominante Q. Um homem com polidactilia e de pele normal casa com uma mulher sem polidactilia e com queratose. Tiveram um filho com polidactilia e queratose e outro filho com polidactilia e sem queratose. Qual o gentipo dos pais? a) ppQq P_qq d) PPQq PpQq b) PpQq ppQQ e) P_qq ppQ_ c) P_qq ppQq 246. Unicamp-SP Sabe-se que, em coelhos, o gene L faz os plos se mostrarem curtos, enquanto o seu alelo recessivo d torna os plos longos. Num outro par de alelos (situado em outro par de cromossomos), est o gene M, responsvel pela cor negra do plo, e o seu alelo recessivo m, que torna o plo marrom. Se de um casal de coelhos de plo curto e negro resultar uma cria de plo longo e marrom, que se poder concluir em relao aos gentipos dos cruzantes? 247. Uma determinada condio normal depende da presena de pelo menos um dominante de dois pares de genes, A e B, que se segregam independentemente. Caso voc examine a prole de um grande nmero de casamentos em que ambos os cnjuges so duplo heterozigotos para esses dois pares de genes, que proporo fenotpica voc espera encontrar? 248. UFMG 250. PUC-SP Em certas raas de cavalo, a cor negra do plo devida ao gene dominante C e a cor castanha, ao seu alelo recessivo c. O carter troteiro devido ao gene dominante M, o marchador ao alelo recessivo m. Como sero os descendentes do cruzamento de um troteiro negro homozigoto com um marchador castanho? 251. UFC-CE Observe a tabela a seguir, que mostra parte dos resultados dos experimentos de Mendel, realizados com ervilhas.
Carter Gerao P Nmeros obtidos (cruzamento na gerao F2 Propores Gerao entre duas (originada da reais obtidas F1 plantas autofecundao em F2 puras) de F1) Lisa e rugosa Amarela e verde Todas lisas Todas amarelas 5.474 lisas 1.850 rugosas 6.022 amarelas 2.001 verdes 2,96 lisas: 1 rugosa 3,01 amarelas: 1 verde

Forma da semente Cor da semente

De acordo com a tabela, responda ao que se pede. a) Por que na gerao F1 no foram encontradas sementes rugosas ou verdes? b) O que so os fatores hereditrios referidos por Mendel e onde esto situados? c) Faa um esquema de cruzamento para exemplificar as propores fenotpicas encontradas na gerao F2, utilizando qualquer uma das caractersticas apresentadas na tabela. 252. UCBA Um casal tem o seguinte gentipo: Y AaBbCC; X aaBbcc. A probabilidade de esse casal ter um filho portador dos genes bb : a) 1/4 d) 1/64 b) 1/2 e) 3/64 c) 3/27 253. UGF-RJ Certo tipo de miopia um carter condicionado por um gene recessivo m. A adontia hereditria determinada por um gene dominante D. Um homem com adontia e viso normal casa-se com uma mulher mope e com dentes, tendo o casal uma criana mope e com dentes. Se o casal tiver mais uma criana, qual a probabilidade de ele ser homem e normal para ambos os caracteres? 254. Unirio-RJ Um homem destro, heterozigoto para este carter, que no possui a capacidade de enrolar a lngua, casa-se com uma mulher canhota, com a capacidade de enrolar a lngua, heterozigota para o ltimo carter. Qual a probabilidade de o casal mencionado vir a ter uma menina homozigota para ambos os caracteres? a) 1/2 d) 1/8 b) 1/6 e) 1/10 c) 1/4

Observe o esquema de uma clula diplide de um organismo resultante da fecundao ocorrida entre dois gametas normais. Os gametas que originaram esse organismo deveriam ter os gentipos indicados em: a) AaB + Bee. b) AAe + aBB. c) Aae + BBe. d) ABe + ABe. e) ABe + aBe. 249. Fuvest-SP Um indivduo heterozigoto quanto a dois pares de genes (Aa e Bb), localizados em diferentes pares de cromossomos. Em relao a esses genes, que tipos de gametas se formaro, e em que proporo?
98

255. Em experimentos envolvendo quatro caractersticas independentes (poliibridismo), foi realizado o cruzamento entre o indivduo I (AaBbccDd) e o indivduo II (aaBbCcdd). Responda s questes a seguir. a) Quantos tipos de gametas produzem cada um dos indivduos? b) Qual ser a probabilidade de nascer um indivduo de gentipo aabbCcDd? c) Qual a probabilidade de nascer um indivduo com gentipo que apresenta, pelo menos, um gene dominante? 256. UFU-MG Em experimentos envolvendo trs caractersticas independentes (triibridismo), se for realizado um cruzamento entre indivduos AaBbCc, a freqncia de descendentes AABbcc ser igual a: a) 8/64 d) 1/4 b) 1/16 e) 1/32 c) 3/64 257. FCC-SP De acordo com a segunda lei de Mendel, se dois indivduos de gentipo TtRrSs forem cruzados, a proporo de descendentes de gentipo ttRrSS ser: a) 27 : 64 d) 2 : 64 b) 9 : 64 e) 1 : 64 c) 3 : 64 258. PUC-SP Um homem de pigmentao e viso normais e insensvel ao PTC casa-se com uma mulher albina, de viso normal e sensvel ao PTC. O primeiro filho do casal trirrecessivo: albino, mope e insensvel ao PTC. A probabilidade de que o segundo filho desse casal tenha o mesmo fentipo do irmo : a) 1 2 b) 1 4 c) 1 8 259. Nos tomates, a fruta vermelha dominante sobre a amarela, frutas biloculadas sobre multiloculadas e plantas altas so dominantes sobre plantas baixas. Um cultivador tem plantas puras de fentipos: baixas, vermelhas e biloculadas e plantas altas, amarelas e multiloculadas. Ele deseja uma linhagem de plantas vermelhas, multiloculadas e altas. a) Se ele cruzar essas duas linhagens, que proporo em F2 ser, em aparncia,do tipo que ele deseja? b) Que proporo destes ser homozigota para todos os caracteres? 260. Na mandioca existem dois pares de genes situados em dois pares de cromossomos diferentes, que atuam d) e) 1 16 1 32

respectivamente sobre a cor da raiz e a largura dos fololos. As relaes de dominncia para os gentipos e fentipos so as que se seguem. Razes Gentipo BB Bb bb Fentipo Marrons Brancas LL Ll ll Flolos Gentipo Fentipo Estreitos Largos

De um vegetal de razes marrons de fololos estreitos, cruzado com outro, resultam 40 vegetais com fololos estreitos, 50% dos quais tinham razes marrons e 50% razes brancas. Escolha, entre as alternativas, o gentipo dos vegetais que poderiam ter produzido tal descendncia. a) BBLl bbLl b) BBLL bbll c) BbLL bbll d) BBll bbll 261. PUCCamp-SP Com relao pelagem de uma determinada raa de ces, a cor preta condicionada pelo gene dominante B, e a branca, pelo seu alelo recessivo b; o tipo crespo condicionado por um outro gene dominante L, e o liso, pelo seu alelo recessivo l. Do cruzamento entre um exemplar preto-crespo e um preto-liso, nasceram 2 filhotes preto-crespos, 2 preto-lisos, 1 branco-crespo e 1 branco-liso. Os provveis gentipos dos pais e dos filhotes de pelagem branca so: a) b) c) d) e) Pais BbLL Bbll bbLl bbll BbLl Bbll BbLl Bbll BbLl BbLl Filhotes bbLl bbll BbLl Bbll bbLl bbll BbLl Bbll bbLl bbll

262. Fuvest-SP Considere um homem heterozigoto para o gene A, duplo recessivo para o gene D e homozigoto dominante para o gene F. Considere ainda que todos esses genes situam-se em cromossomos diferentes. Entre os gametas que podero se formar encontraremos apenas a(s) combinao(es): a) Ad d) AdF e adF b) AADDFF e) ADF e adf c) AaddFF 263. Fuvest-SP Um indivduo heterozigoto para dois pares de genes (A e a; B e b), localizados em dois pares diferentes de cromossomos, formar que tipos de gametas e em que propores? a) 75% AB e 25% ab b) 50% Aa e 50% Bb c) 25% aa, 50% AB e 25% bb d) 25% AA, 50% ab e 25% BB e) 25% AB, 25% aB, 25% Ab e 25% ab
99

PV2D-07-BIO-24

264. Cesgranrio-RJ De acordo com o mendelismo, um indivduo afetado por albinismo recessivo e heterozigoto para os caracteres dominantes para braquidactilia, condrodistrofia e cabelos crespos dever produzir, em relao aos alelos desses genes: a) 2 tipos diferentes de gametas. b) 4 tipos diferentes de gametas. c) 8 tipos diferentes de gametas. d) 16 tipos diferentes de gametas. e) 32 tipos diferentes de gametas. 265. UFRGS-RS Indivduos com os gentipos AaBb, AaBB, AaBbCc, AaBBcc, AaBbcc podem formar, respectivamente, quantos tipos de gametas diferentes? a) 4 4 8 8 8 d) 4 2 8 2 4 b) 4 2 8 4 4 e) 2 4 16 4 8 c) 2 4 16 8 8 266. Fuvest-SP Em ervilha, o gene que determina a forma lisa da vagem (C) dominante sobre o gene que determina vagens com constries (c). O gene que determina plantas de altura normal (H) dominante sobre o gene que determina plantas ans (h). Cruzando-se plantas CC HH com plantas Cc Hh, espera-se obter na descendncia: a) 50% de plantas ans com vagens lisas e 50% de plantas de altura normal com vagens com constries. b) 100% de plantas ans com vagens com constries. c) 100% de plantas de altura normal com vagens com constries. d) 100% de plantas ans com vagens lisas. e) 100% de plantas de altura normal com vagens lisas. 267. Em milho, o alelo recessivo su responsvel por sementes enrugadas e seu alelo dominante Su, por sementes lisas. O alelo recessivo br produz plantas baixas e seu dominannte Br, plantas altas. A partir do cruzamento de plantas homozigotas de sementes lisas e baixas com plantas homozigotas de sementes enrugadas e altas foi obtida a gerao F1. a) Qual a proporo de plantas de fentipo sementes lisas e altas na gerao F2? b) Se as plantas da gerao F1 forem retrocruzadas com o progenitor de sementes lisas e baixas, qual a proporo de plantas de fentipo sementes enrugadas e baixas? 268. Unifor-CE Numa espcie vegetal, os genes recessivos que condicionam plantas baixas e flores brancas esto situados em cromossomos no-homlogos. Cruzando-se plantas duplamente heterozigotas, esperam-se descendentes que apresentem, ao mesmo tempo, plantas baixas e flores brancas na proporo de: a) 1/32 d) 1/4 b) 1/16 e) 1/2 c) 1/8
100

269. UFU-MG A cor do caule dos tomateiros determinada por um par de genes alelos, sendo que o gene dominante A confere a cor prpura, enquanto o gene recessivo a determina a cor verde. O aparecimento de duas cavidades no tomate determinado por um gene dominante M, enquanto cavidades mltiplas so determinadas pelo alelo recessivo m. Considerando que esses dois loci gnicos segregam-se independentemente, a proporo fenotpica esperada na gerao F1 de uma planta dibrida submetida a um cruzamento-teste de: a) 9 : 3 : 3 : 1 d) 1 : 1 : 1 : 1 b) 4 : 2 : 2 : 1 e) 9 : 6 : 1 c) 9 : 7 270. Mackenzie-SP Em cobaias, a pelagem preta condicionada por um gene dominante sobre o gene que condiciona pelagem marrom; o gene que condiciona plo curto dominante sobre o que condiciona plo longo. Uma fmea de plo marrom curto, que j tinha tido filhotes de plo longo, foi cruzada com um macho dibrido. Entre os filhotes produzidos, a proporo esperada de indivduos com pelagem preta e curta de: a) 1/8 d) 3/8 b) 1/4 e) 7/8 c) 1/2 271. Fuvest-SP Numa espcie de planta, a cor amarela da semente dominante sobre a cor verde, e a textura lisa da casca da semente dominante sobre a rugosa. Os loci dos genes que condicionam esses dois caracteres esto em cromossomos diferentes. Da autofecundao de uma planta duplo-heterozigota, foram obtidas 800 plantas. Qual o nmero esperado de plantas: a) com sementes verdes rugosas; b) com sementes amarelas. 272. PUC-SP Em uma determinada espcie vegetal foram analisadas duas caractersticas com segregao independente: cor da flor e tamanho da folha. Os fentipos e gentipos correspondentes a essas caractersticas esto relacionados a seguir: Cor da flor Fentipo Vermelho Rseo Branco Gentipo VV VB BB Tamanho da folha Fentipo Largo Intermedirio Estreito Gentipo LL LE EE

Se uma planta de flor rsea, com folha de largura intermediria, for cruzada com outra de mesmo fentipo, qual a probabilidade de se obter: a) plantas com flor rsea e folha de largura intermediria; b) plantas simultaneamente homozigotas para as duas caractersticas.

273. Em cobaias, a cor da pelagem determinada por um par de genes, sendo a cor preta condicionada pelo alelo dominante (M) e a cor marrom pelo alelo recessivo (m). O comprimento dos plos curto ou longo determinado pelos alelos dominante(L) e recessivo (I), respectivamente. Os dois genes, cor e comprimento, segregam-se independentemente. Do cruzamento entre cobaias pretas e de plo curto, heterozigotas para os dois genes, qual a probabilidade de nascerem filhotes com o mesmo gentipo dos pais? a) 1/2 d) 9/16 b) 1/4 e) 3/16 c) 3/4 274. Uma planta maravilha Mirabilis jalapa rsea de haste longa heterozigota cruzada com outra, originada de ascendentes vermelha de haste curta e branca de haste longa, homozigota, originando uma planta de flores brancas e haste curta. Considerando que haste longa (C) domina a curta (c) e que entre a cor vermelha (V) e cor branca (B) no h dominncia, responda ao que se pede. a) Quais os gentipos das plantas citadas? b) Qual a probabilidade de nascer uma planta vermelha de haste longa? 275. Fuvest-SP Do casamento entre uma mulher albina com cabelos crespos e um homem normal com cabelos crespos, cuja me albina, nasceram duas crianas, uma com cabelos crespos e outra com cabelos lisos. A probabilidade de que uma terceira criana seja albina com cabelos crespos : a) 75% d) 25% b) 50% e) 12,5% c) 37,5% 276. Um homem mope e albino casou-se com uma mulher de pigmentao e viso normais, cujo pai era mope e albino. Sabendo-se que a miopia e o albinismo so caracteres recessivos, deseja-se saber: a) qual a probabilidade de o casal ter um filho mope com pigmentao normal; b) quais os gentipos dos pais. 277. No homem, a aniridia (tipo de cegueira) depende de um gene dominante. A hemicrania (tipo de enxaqueca) o resultado de um outro gene dominante. Um homem com aniridia, cuja me no era cega, casa-se com uma mulher que sofre de hemicrania, cujo pai no sofre. Qual a probabilidade de nascer um filho de qualquer sexo com aniridia e hemicrania?
PV2D-07-BIO-24

vo a, plo curto. No segundo par, o gene dominante B determina plo amarelo e seu recessivo b, plo preto. Sabe-se tambm que o gene B, em dose dupla, causa a morte dos indivduos na fase embrionria. Um casal de plo longo e amarelo duplo-heterozigoto cruzado. Qual a chance de surgir um indivduo com o mesmo fentipo dos pais? 279. Vunesp Na espcie humana, a sensibilidade ao PTC (feniltiocarbamida) devida a um gene dominante I e a insensibilidade condicionada pelo alelo recessivo i. A habilidade para o uso da mo direita condicionada por um gene dominante E, e a habilidade para o uso da mo esquerda determinada pelo alelo recessivo e. Um homem destro e sensvel, cuja me era canhota e insensvel ao PTC, casa-se com uma mulher canhota e sensvel ao PTC cujo pai era insensvel. A probabilidade de o casal ter uma criana destra e sensvel de: a) 1/2 d) 1/8 b) 1/4 e) 3/8 c) 3/4 280. UFPR Um homem de pele com pigmentao normal e olhos castanhos casa-se com uma mulher de fentipo igual ao seu. Sabendo-se que o casal j tem um filho albino de olhos azuis, qual a probabilidade de, num prximo nascimento, esse casal vir a ter uma filha de olhos azuis e com a pigmentao da pele normal? a) 2/16 d) 3/32 b) 4/32 e) 7/16 c) 6/16 281. PUC-SP Foram analisadas, em uma famlia, duas caractersticas autossmicas dominantes com segregao independente: braquidactilia (dedos curtos) e prognatismo mandibular (projeo da mandbula para frente). As pessoas indicadas pelos nmeros 1, 3, 5 e 6 so braquidctilas e prognatas, enquanto 2 e 4 tm dedos e mandbula normais.

A probabilidade de o casal 5 x 6 ter um descendente simultaneamente braquidctilo e prognata de: a) b) c) 1 16 3 16 9 16


101

278. UFRJ Em uma certa espcie animal, existem dois pares de genes de segregao independente que determinam duas caractersticas da pelagem. No primeiro par, o gene dominante A determina plo longo e seu recessi-

d) 3 4 e) 1 4

282. PUC-SP Dois caracteres com segregao independente foram analisados em uma famlia: grupos sangneos do sistema ABO e miopia. A partir dessa anlise, obtiveram-se os seguintes dados:

a) Ao final da segunda diviso meitica dessa clula, quais sero os gentipos das quatro clulas haplides geradas? b) Considerando o conjunto total de espermatozides produzidos por esse animal, quais sero seus gentipos e em que proporo espera-se que eles sejam produzidos? 285. UEBA Na ervilha-de-cheiro, sementes amarelas so dominantes sobre sementes verdes, e sementes lisas so dominantes sobre sementes rugosas. Plantas homozigotas com sementes amarelas lisas foram cruzadas com plantas com sementes verdes rugosas. A gerao F1 foi autofecundada produzindo a gerao F2, contendo 200 plantas com sementes de fentipo duplo recessivo. O nmero total esperado de plantas na gerao F2 de: a) 400 d) 3.200 b) 600 e) 4.800 c) 1.800 286. Na espcie humana, mecha branca nos cabelos, sardas e polidactilia so manifestaes determinadas por genes dominantes. Um indivduo com mecha branca nos cabelos, sardento e portador de polidactilia, cujo pai no tinha mecha branca nem era sardento, mas tinha polidactilia, e cuja me tinha mecha, era sardenta, mas no tinha polidactilia, casa-se com uma prima de gentipo idntico ao seu. Qual a probabilidade de terem crianas sem mecha, sem sardas e sem polidactilia? 287. UEL-PR Na genealogia a seguir, est representada a herana de duas caractersticas determinadas por genes autossmicos:

I. 1, 2 e 3 pertencem ao grupo O. II. 4 pertence ao grupo AB. III. 4 e 5 so mopes. Qual a probabilidade de o casal 5 e 6 ter uma criana do grupo sangneo O e mope? a) b) c) 283. Fuvest-SP Uma espcie de lombriga de cavalo possui apenas um par de cromossomos no zigoto (2n = 2). Um macho dessa espcie, heterozigtico quanto a dois pares de alelos (Aa Bb) formou, ao final da gametognese, quatro tipos de espermatozides normais com diferentes gentipos quanto a esses genes. a) Qual o nmero de cromossomos e o nmero de molculas de DNA no ncleo de cada espermatozide? b) Quais so os gentipos dos espermatozides formados? 284. UFSCar-SP A figura mostra a segregao de dois pares de cromossomos homlogos na anfase da primeira diviso meitica de uma clula testicular de um animal heterozigtico quanto a dois genes. As localizaes dos alelos desses genes, identificados pelas letras Aa e Bb, esto indicadas nos cromossomos representados no desenho. d) e)

Quais so os indivduos obrigatoriamente heterozigotos para as duas caractersticas? a) 6, 7, 13 e 14. b) 5, 8, 9, 12 e 15. c) 1, 2, 3, 4, 7 e 13. d) 6, 9, 10, 11, 14, 15 e 16. e) 1, 2, 3, 4, 7, 9, 13 e 15.
102

288. UEPG-PR um fenmeno inverso ao da pleiotropia: a) interao gnica. d) polialelia. b) epistasia. e) alelos mltiplos. c) criptomeria. 289. UFAL A forma da crista em galinhas condicionada pela interao de dois pares de alelos localizados em cromossomos no-homlogos. A presena do alelo E determina crista ervilha e a do R, crista rosa. A presena de E e R em um mesmo indivduo condiciona crista noz e a ausncia, crista simples. Se uma ave heterozigtica de crista ervilha for cruzada com uma homozigtica de crista rosa, espera-se na descendncia uma proporo fenotpica de: a) 9 noz : 3 ervilha : 3 rosa : 1 simples. b) 9 noz : 6 ervilha : 1 rosa. c) 3 rosa : 1 ervilha. d) 1 ervilha : 1 rosa. e) 1 noz : 1 rosa. 290. Na galinha existem dois pares de genes implicados na determinao da crista. Um deles, R, resulta em crista rosa e seu alelo recessivo r determina crista simples. O gene E determina crista ervilha e seu alelo recessivo e produz crista simples. Quando R e E ocorrem juntos, produzem um novo tipo de crista: noz. Qual ser o gentipo F1, resultante do cruzamento RRee x rrEE? a) Crista rosa b) Crista simples c) Crista ervilha d) Crista noz e) Crista rosa e crista ervilha 291. Em galinhas, a presena do gene E (dominante) determina crista ervilha e a presena do gene R (dominante), crista rosa. Se ambos os genes dominantes estiverem presentes, a crista do tipo noz. A ausncia de ambos os genes dominantes determina crista simples. Qual a proporo genotpica e fenotpica resultante do cruzamento EERr com Eerr? 292. Em camundongos, o gene B determina colorao da pelagem acinzentada, trata-se da variedade aguti, a mais encontrada na natureza. O alelo recessivo b, determina colorao preta. Na presena de outro alelo recessivo a, os camundongos, independentemente do alelo b que apresentam, so albinos. Do cruzamento entre dois camundongos aguti obtiveram-se descendentes na seguinte proporo: 9 agutis : 3 pretos : 4 albinos. a) Cite todos os gentipos possveis para os camundongos albinos obtidos. b) Apresente uma explicao para a alterao da proporo 9:3:3:1 (esperada no cruzamento de dibridos) para 9:3:4.

293. Mackenzie-SP Em galinhas, a cor da plumagem determinada por dois pares de genes. O gene C condiciona plumagem colorida, enquanto seu alelo c determina plumagem branca. O gene I impede a expresso do gene C, enquanto seu alelo i no interfere nessa expresso. Com esses dados, conclui-se que se trata de um caso de: a) epistasia recessiva. b) herana quantitativa. c) pleiotropia. d) co-dominncia. e) epistasia dominante. 294. UFMG Observe a figura:

Todas as alternativas contm gentipos possveis para os porquinhos vermelhos de F2, exceto: a) AABB d) AaBb b) AaBB e) AABb c) Aabb 295. Galinhas com o gene dominante C tm penas coloridas, a no ser que esteja presente o gene dominante I, que inibe o gene C e produz cor branca. O gene recessivo i no tem efeito inibidor, e o gentipo cc origina cor branca. Qual o resultado do cruzamento de duas aves duplamente heterozigotas? 296. Unaerp-SP Considere os fentipos em ratos aguti (com pigmento preto e amarelo), preto e albino. Os genes e seus efeitos so: P = preto A = amarelo p = inibe cor a = no produz pigmento Se o cruzamento PpAa x PpAa produzir 9P_A_; 3P_aa; 3ppA_; 1ppaa
9 aguti 3 pretos 4 brancos

o caso acima ser identificado como: a) pleitropia. b) epistasia recessiva. c) epistasia dominante. d) interao gnica. e) segregao independente.
103

PV2D-07-BIO-24

297. Vunesp Em ratos, a colorao do plo depende da ao de dois pares de genes independentes. O gene C leva formao de pigmento e seu alelo c, em condio homozigtica, impede a formao de pigmento. O gene B produz cor preta e seu alelo b determina a cor marrom. Um rato preto heterozigoto (para os dois loci gnicos) cruzado com um rato albino homozigoto recessivo (para os dois loci gnicos). Assinale a proporo fenotpica esperada na descendncia desse cruzamento: a) 3 pretos : 1 albino. b) 1 preto : 1 marrom : 2 albinos. c) 2 marrons : 1 albino. d) 2 pretos : 2 albinos. e) 2 pretos : 1 marrom : 1 albino. 298. UFRGS-RS Nas ervilhas-de-cheiro (Lathyrus odoratus), a presena dos genes C ou P isoladamente produz flores brancas. Quando no gentipo do indivduo se encontram C e P juntos, as flores so prpura. Uma planta de flor prpura cruzada com outra flor branca originou uma gerao com 3/8 de prpura e 5/8 de brancas. Se uma delas for heterozigtica apenas no par C, qual ser o gentipo da outra? a) Ccpp d) CcPp b) CCPP e) CCPp c) CcPP 299. Um exemplo de interao ocorre com a flor de ervilha, que pode ser colorida ou branca. Para haver cor, preciso que estejam presentes dois genes dominantes, P e C. Na ausncia de um desses dominantes, a flor ser branca. No cruzamento entre duas plantas de flores coloridas e duplo heterozigotas, a proporo fenotpica ser: a) 9 : 7 d) 12 : 4 b) 1 : 15 e) 13 : 3 c) 1 : 3 300. Vunesp Numa dada planta, o gene B condiciona fruto branco e o gene A condiciona fruto amarelo, mas o gene B inibe a ao do gene A. O duplo recessivo condiciona fruto verde. Considerando que tais genes apresentam segregao independentemente um do outro, responda s perguntas abaixo. a) Como se chama esse tipo de interao? b) Qual a proporo fenotpica correta entre os descendentes do cruzamento de plantas heterozigotas para esses dois pares de genes? 301. Em ces labradores, a pelagem determinada por dois pares de genes. O alelo C determina a formao de pigmentos, enquanto o alelo c inibe a formao de pigmentos. Caso tenha formao de pigmentos, os ces podem ser pretos, se apresentarem o alelo M, ou marrons se apresentarem o alelo m em homozigose. Com esses dados, conclui-se que se trata de um caso de:
104

a) b) c) d) e)

epistasia recessiva. herana quantitativa. pleiotropia. co-dominncia. epistasia dominante.

302. Em ces labradores, a pelagem condicionada por dois pares de genes. O alelo C determina a produo de pigmentos, enquanto o alelo c inibe a produo de pigmentos. Caso haja a formao de pigmentos, os ces podem ser pretos, se apresentarem o alelo M, ou marrons se apresentarem o alelo m em homozigose. Do cruzamento de indivduos CCmm com indivduos CcMm, quais os gentipos e fentipos esperados? 303. FM ABC-SP Em ces, o gene I, que determina a cor branca, episttico em relao ao gene B, que determina a cor preta, e ao seu alelo b, que determina cor marrom. Sabe-se tambm que o gene I e seu alelo i segregamse independentemente do gene B e de seu alelo b. Do cruzamento entre machos e fmeas com gentipo IiBb esperam-se descendentes que se distribuam na seguinte proporo fenotpica: a) 13 : 3 b) 9 : 3 : 3 : 1 c) 9 : 6 : 1 d) 9 : 4 : 3 e) 12 : 3 : 1 304. Nos ces, a cor da pelagem est na dependncia de pelo menos dois pares de genes alelos. Um gene B, de um dos pares, episttico em relao aos genes do outro par Me, quando ela ocorre, os animais apresentam pelagem branca. Porm, em caso de homozigose do alelo recessivo de B (bb), os genes M e m podem manifestar, condicionando, pelagem preta e marrom, respectivamente. Uma cadela marrom teve, entre os descendentes de um cruzamento, animais brancos, pretos e marrom. Pergunta-se: a) Qual o gentipo e o fentipo do co com a qual a cadela foi cruzada? b) Qual os possveis gentipos dos descendentes de cor branca? 305. PUC-SP No homem, a surdez devida homozigose de apenas um dos dois genes recessivos, d ou e. So necessrios os dois genes dominantes D e E para a audio normal. Desse modo, Fernando, que surdo, casou-se com Lcia, que tambm surda. Tiveram 6 filhos, todos de audio normal. Portanto, voc pode concluir que o gentipo dos filhos : a) Ddee b) ddEE c) DdEe d) DDEE e) DDEe

306. Considere que a surdez no homem esteja relacionada a dois pares de genes (Dd Ee) localizados em cromossomos no homlogos. Os indivduos homozigotos dd ou ee so surdos; os indivduos com audio normal possuem, pelo menos, um gene D e um E. Qual a probabilidade de um casal DdEE ddEe vir a ter uma criana com surdez de gentipo ddEE? a) 0% b) 25% c) 50% d) 75% e) 100% 307. UFJF-MG Em bovinos, a pelagem colorida determinada pelo alelo H, enquanto o alelo h determina pelagem branca. Outro gene determina a pigmentao da pelagem na cor vermelha b ou preta B. O cruzamento de um touro de pelagem preta HhBb com uma vaca de pelagem preta HhBb produzir uma prole com: a) 100% de animais com pelagem preta, pois o gene para a cor dominante. b) 100% de animais com pelagem branca, pois o gene para a cor episttico. c) 12 animais com pelagem branca, 1 com pelagem vermelha, 3 com pelagem preta. d) 4 animais com pelagem branca, 3 com pelagem vermelha, 9 com pelagem preta. e) 9 animais com pelagem preta, 7 com pelagem vermelha. 308. UEL-PR Em coelhos, o gene P produz pelagem preta e o seu alelo recessivo p, pelagem parda, desde que esteja presente o gene A. Os animais aa so sempre albinos. Considerando que ocorra segregao independente entre esses genes, a partir do cruzamento PpAa x ppaa espera-se uma proporo fenotpica de: a) 1 preto : 1 pardo : 2 albinos. b) 1 preto : 1 pardo. c) 1 preto : 1 albino. d) 1 preto : 3 albinos. e) 1 pardo : 3 albinos. 309. Um gene M impede a manifestao de outro gene N, que condiciona ausncia de dentes numa espcie animal. Um criador conseguiu isolar indivduos puros de gentipos MMnn e mmNN. a) Qual o aspecto desses indivduos quanto aos dentes? b) Qual o resultado do cruzamento entre eles em F1 e em F2? c) Que tipo de herana est envolvido neste caso?
PV2D-07-BIO-24

a) uma caracterstica provocada pelo ambiente, como surdez por infeco, imitar uma caracterstica gentica, como a surdez hereditria. b) vrios pares de genes no alelos influenciarem na determinao de uma mesma caracterstica. c) um nico gene ter efeito simultneo sobre vrias caractersticas do organismo. d) dois pares de gene estarem no mesmo par de cromossomos homlogos. e) dois cromossomos se unirem para formar um gameta. 311. Na determinao dos tipos de cristas em galinceos, esto presentes gentipos e fentipos: E_rr ervilha; eeR_ rosa; E_R_ noz; eerr simples. D os resultados possveis para os seguintes cruzamentos abaixo: a) EeRR x eeRr; b) eeRr x eerr; c) eeRr x Eerr. 312. Em galinhas domsticas o tipo de crista determinado por dois pares de genes com segregao independente. Observe os fentipos e gentipos. Crista rosa = R_ee Crista ervilha = rrE_ Crista noz = R_E_ Crista simples = rree Um galo com crista noz foi cruzado com trs galinhas. Com a galinha A, de crista noz, produziu a gerao 3 noz : 1 rosa, com a galinha B, de crista ervilha, produziu 3 noz : 1 rosa : 3 ervilha : 1 simples, e com a galinha C de crista noz a gerao tinha 100% crista noz. Determine o gentipo do galo e das trs galinhas. 313. Em galinhas Leghorn, o gene C determina a manifestao de cor, porm inibido pelo gene I, que episttico sobre ele. Um galo branco, cruzado com uma galinha branca produziu F1: 50% de aves brancas e 50% de aves coloridas. A provvel frmula gentica dos cruzantes deve ser: a) Iicc x iicc b) IiCc x iicc c) IiCc x iicc d) iiCc x iiCc e) IICC x iicc 314. Fuvest-SP A pigmentao da plumagem de galinhas est condicionada por dois pares de genes autossmicos, situados em cromossomos diferentes. O gene C determina a sntese de pigmento e seu alelo c inativo, determinando a cor branca. O gene I inibe a formao de pigmentos e seu alelo i no o faz. Do cruzamento de indivduos CCii com indivduos CcIi, quais os gentipos e fentipos esperados?
105

310. PUC-RJ Em gentica, o fenmeno de interao gnica consiste no fato de:

315. FCC-SP Em camundongos, a colorao da pelagem determinada por dois pares de genes, Aa e Cc, com segregao independente. O gene A determina colorao aguti e dominante sobre seu alelo a, que condiciona colorao preta. O gene C determina a produo de pigmentos e dominante sobre seu alelo c, que inibe a formao de pigmentos, dando origem a indivduos albinos. Do cruzamento de um camundongo preto com um albino, foram obtidos apenas descendentes agutis. Qual o gentipo desse casal ? a) aaCC x aacc d) AaCc x AaCc b) Aacc x aaCc e) aaCC x AAcc c) aaCc x AAcc 316. UEL-PR Em ratos a cor do plo pode ser aguti, que resulta da interao dos genes A e B. A combinao de genes A___bb resulta em plo canela e a combinao aaB___resulta em plo preto. O indivduo duplamente recessivo ter plo castanho. Os genes Aa e Bb somente se manifestam na presena de um gene C. Os indivduos cc so albinos. Qual o resultado do seguinte cruzamento: AABBCc x aabbcc? a) 1/2 aguti: 1/2 albino b) 1/2 canela: 1/2 preto c) 3/4 aguti: 1/4 castanho d) 1/4 aguti: 1/4 canela: 1/4 preto: 1/4 castanho e) 1/4 aguti: 1/4 preto:1/4 castanho: 1/4 albino 317. PUCCamp-SP Nos camundongos, a pelagem pode ser aguti, preta ou albina. A figura a seguir mostra as reaes bioqumicas envolvidas na sntese de pigmentos.

Pode-se considerar correto o que afirmado em: a) I, somente. d) II e III, somente. b) III, somente. e) I, II e III. c) I e II, somente. 318. Em uma espcie vegetal, um gene dominante A determina o aparecimento de flores vermelhas, enquanto o seu alelo recessivo a determina flores amarelas. Um outro locus, localizado em um outro par de cromossomos homlogos, tem um alelo i que, quando em dose dupla, inibe a produo dos pigmentos nas flores, que surgem brancas. Esse efeito no manifestado pelo seu alelo I. Uma planta de flores brancas foi cruzada com uma de flores amarelas, tendo surgido na descendncia plantas de flores vermelhas, de flores amarelas e de flores brancas. Qual deve ser o gentipo da planta de flores brancas empregada no cruzamento? a) AA ii d) AA Ii b) Aa ii e) aa II c) aa ii 319. UFU-MG Na interao gnica complementar, a manifestao de um fentipo vai depender da presena de dois ou mais genes que se complementam. Um exemplo desse tipo de interao ocorre com a flor de ervilha-de-cheiro (Lathyrus) que pode ser colorida ou branca. Para haver cor, preciso que estejam presentes dois genes dominantes P e C. Na ausncia de um desses genes dominantes, a flor ser branca. No cruzamento entre duas plantas de flores coloridas e duplo-heterozigotas (PpCc) a proporo de plantas com flores coloridas para plantas com flores brancas ser de: a) 9 : 7. d) 12 : 4. b) 1 : 15. e) 13 : 3. c) 1 : 3. 320. UEL-PR Em cebola, dois pares de genes que apresentam segregao independente participam na determinao da cor do bulbo: o alelo dominante I impede a manifestao de cor e o recessivo i permite a expresso; o alelo dominante A determina cor vermelha e o recessivo a, cor amarela. Uma proporo de 2 incolores : 1 vermelho : 1 amarelo esperada entre os descendentes do cruzamento: a) II AA x Ii Aa d) Ii Aa x Ii Aa b) Ii AA x ii Aa e) Ii Aa x ii aa c) II aa x ii aa

Com base na figura apresentada foram feitas as seguintes afirmaes: I. A formao de qualquer pigmento no plo depende da presena do alelo P. II. Quando animais pretos homozigticos so cruzados com certos albinos tambm homozigticos, os descendentes so todos agutis. III. Trata-se de um caso de interao gnica do tipo epistasia recessiva.
106

321. PUC-Campinas-SP A cor do bulbo das cebolas condicionada pelo gene V (vermelho ou v (amarelo). Mas existe um outro par no-alelo deste, no qual o gene I episttico sobre V e v. O gene i no interfere na produo dos pigmentos vermelho e amarelo. Do cruzamento de uma planta de bulbo branco com outra de igual fentipo resultou uma prognie com 12/6 brancas, 3/16 vermelhas e 1/16 amarelas.

Quais os gentipos dos parentais? a) IIVV x IIVV d) IiVv x Iivv b) Iivv x iiVV e) IiVv x IiVv c) iiVv x iiVv 322. UERJ As reaes enzimticas abaixo indicam a passagem metablica que sintetiza pigmentos em uma planta.
Composto 1 (Incolor)
Enzima A

preto e o alelo recessivo b determina a produo de pigmento marrom. A deposio de pigmentos nos plos condicionada pelo gene dominante E, enquanto o alelo recessivo e impede essa deposio. Assim, um cachorro homozigoto recessivo ee no depositar pigmento nos plos e ter a pelagem dourada.

Pigmento 2 (Vermelho)

Enzima B

Pigmento 3 (Prpura)

Considere as seguintes condies: para as enzimas A e B, os alelos A e B produzem enzimas funcionais, enquanto os alelos a e b produzem enzimas inativas; uma nica cpia funcional da enzima A ou da enzima B suficiente para catalisar normalmente a sua respectiva reao. Determine a proporo esperada entre as cores das plantas descendentes na primeira gerao do cruzamento AaBb AABb. 323. Vunesp Epistasia o fenmeno em que um gene (chamado episttico) inibe a ao de outro que no seu alelo (chamado hiposttico). Em ratos, o alelo dominante B determina cor de plo acinzentada, enquanto o gentipo homozigoto bb define cor preta. Em outro cromossomo, um segundo lcus afeta uma etapa inicial na formao dos pigmentos dos plos. O alelo dominante A nesse lcus possibilita o desenvolvimento normal da cor (como definido pelos gentipos B_ou bb), mas o gentipo aa bloqueia toda a produo de pigmentos e o rato torna-se albino. Considerando os descendentes do cruzamento de dois ratos, ambos com gentipo AaBb, os filhotes de cor preta podero apresentar gentipos: a) Aabb e AAbb. b) Aabb e aabb. c) AAbb e aabb. d) AABB e Aabb. e) aaBB, AaBB e aabb. 324. Em ces labradores, dois genes, cada um com dois alelos (B/b e E/e), condicionam as trs pelagens tpicas da raa: preta, marrom e dourada. A pelagem dourada condicionada pela presena do alelo recessivo e em homozigose no gentipo. Os ces portadores de pelo menos um alelo dominante E sero pretos, se tiverem pelo menos um alelo dominante B; ou marrons, se forem homozigticos bb. O cruzamento de um macho dourado com uma fmea marrom produziu descendentes pretos, marrons e dourados. O gentipo do macho : a) Ee BB. d) ee BB. b) Ee Bb. e) ee Bb. c) ee bb.
PV2D-07-BIO-24

De cruzamentos entre um macho preto com uma fmea preta (1), foram obtidos descendentes pretos e dourados na proporo de 3:1. De cruzamentos entre este mesmo macho preto com outra fmea preta (2), foram obtidos descendentes pretos, marrons e dourados na proporo de 9:3:4. Os provveis gentipos do macho, da fmea (1) e da fmea (2) so, respectivamente: a) BBEe, BbEe e BbEe. b) BbEe, BbEe e BBEe. c) BbEe, BBEe e BbEe. d) BBEe, BbEe, BBEe. 326. UFU-MG Assinale a alternativa correta. A cor da pelagem em cavalos depende, dentre outros fatores, da ao de dois pares de genes, Bb e Ww. O gene B determina plos pretos e o seu alelo b determina plos marrons. O gene dominante W inibe a manifestao da cor, fazendo com que o plo fique branco, enquanto o alelo recessivo W permite a manifestao da cor. Cruzando indivduos heterozigotos para os dois pares de genes, obtm-se: a) 3 brancos: 1 preto. b) 9 brancos: 3 pretos: 3 mesclados de marrom e preto: 1 branco. c) 1 preto: 2 brancos : 1 marrom. d) 12 brancos : 3 pretos : 1 marrom. e) 3 pretos : 1 branco. 327. Na espcie humana, o desenvolvimento embrionrio da cclea e do nervo acstico est na dependncia de um par de alelos dominantes C e A, respectivamente. Os indivduos que possuam um dos genes recessivos em homozigose sero surdos por agenesia (no formao) da cclea ou do nervo acstico. Espera-se que a propoo de indivduos surdos, nascidos em F2, a partir do casamento de um indivduo normal com uma mulher surda, ambos homozigotos, seja de: a) 9/16 d) 3/16 b) 4/16 e) 2/16 c) 7/16 328. UFMG Em camundongos, o tipo selvagem, encontrado comumente na natureza, apresenta pelagem de colorao acizentada (agouti). Duas outras coloraes so tambm, observadas preta e albina.
107

325. UFU-MG Em ces labradores, a cor da pelagem condicionada por dois pares de genes com segregao independente. O gene B determina a produo de pigmento

Observe os dois pares de genes envolvidos e os fentipos relativos aos tipos de colorao dos camundongos. A_B_= agouti A_bb = preto aaB_ e aabb = albinos Utilizando essas informaes e seus conhecimentos faa o que se pede. a) Do cruzamento entre camundongos preto e albino obtiveram-se 100% de camundongos agouti. D os gentipos dos camundongos envolvidos no cruzamento. b) Do cruzamento de dois camundongos agouti obtiveram-se descendentes na seguinte proporo: 9 agouti: 3 pretos: 4 albinos. Cite todos os gentipos possveis para os camundongos albinos obtidos e apresente uma explicao para a alterao da proporo 9 : 3 : 3 : 1 (esperada em cruzamento de dibridos) para 9 : 3 : 4. c) Cite a probabilidade de se obterem camundongos pretos do cruzamento de albinos (duplo homozigotos) com agouti (duplo heterozigotos). 329. Os genes A e B so complementares nas ervilhas-decheiro. Quando atuam simultaneamente, determinam flores vermelhas. As flores brancas so condicionadas por qualquer outra combinao gentica. a) Cruzando-se uma planta AAbb com outra AaBb, qual o resultado esperado? b) Para confirmar o gentipo de uma planta vermelha, que tipo de teste voc realizaria? 330. UFES Analisando a via metablica hipottica, temos que:

E1, se transforma em um pigmento amarelo, que a enzima E2 transforma em roxo. A duas enzimas so codificadas por genes alelos dominantes com segregao independente, de acordo com o esquema abaixo. Analisando as informaes acima de acordo com os seus conhecimentos, incorreto afirmar que o cruzamento de plantas dde bulbo:

a) incolor com planta de bulbo incolor s pode originar fentipo incolor. b) amarelo com planta de bulbo amarelo no produz plantas com bulbo roxo. c) roxo com planta de bulbo roxo pode produzir todos os trs fentipos mencionados. d) amarelo com planta de bulbo incolor no produz plantas com bulbo roxo. 332. Fuvest-SP As trs cores de pelagem de ces labradores (preta, marrom e dourada) so condicionadas pela interao de dois genes autossmicos, cada um deles com dois alelos: Ee e Bb. Os ces homozigticos recessivos ee no depositam pigmentos nos plos e apresentam, por isso, pelagem dourada. J os ces com gentipos EE ou Ee apresentam pigmento nos plos, que pode ser preto ou marrom, dependendo do outro gene: os ces homozigticos recessivos bb apresentam pelagem marrom, enquanto os com gentipos BB ou Bb apresentam pelagem preta. Um labrador macho, com pelagem dourada, foi cruzado com uma fmea preta e com uma fmea marrom. Em ambos os cruzamentos, foram produzido descendentes dourados, pretos e marrons. a) Qual o gentipo do macho dourado, quanto aos dois genes mencionados? b) Que tipos de gameta e em que proporo esse macho forma? c) Qual o gentipo da fmea preta? d) Qual o gentipo da fmea marrom? 333. PUC-SP Cruzamentos entre indivduos heterozigotos para dois pares de alelos (AaBb AaBb) apresentaram os seguintes resultados: Fentipos I II III IV V Propores 1 4 6 4 1

O gene A episttico sobre o gene B e, quando em homozigose recessiva (aa), impede a produo dos pigmentos rosa e vermelho, devido no-produo de enzima X. O gene B, em homozigose recessiva, impossibilita a converso de pigmento rosa em vermelho. Os genes A e B so dominantes sobre os seus alelos. Responda ao que se pede. a) No cruzamento entre indivduos de gentipos AaBb x aabb, qual ser a proporo fenotpica esperada na prognie? b) Quais so os possveis gentipos para os indivduos vermelhos? c) Quais os fentipos esperados e suas respectivas propores em F2 obtidos a partir de parentais AABB x aabb? 331. PUC-MG Os bulbos da cebola podem ser brancos, amarelos ou roxos. Nesses vegetais, existe um precursor incolor que, sob a ao de uma enzima, que chamaremos de
108

a) Os resultados apresentados indicam qual tipo de herana? b) Justifique.

334. Unicamp-SP Um pesquisador cruzou paineiras de flores pink com paineiras de flores brancas. Os descendentes (F1) foram cruzados entre si, produzindo sempre as seguintes freqncias fenotpicas na gerao F2:

a) b) c) d) e)

AABb = 8, AAbb = 8, AaBb = 8, Aabb = 8. AABb = 8, AAbb = 5, AaBb = 8, Aabb = 5. AABb = 13, AAbb = 10, AaBb = 11, Aabb = 9. AABb = 10, AAbb = 5, AaBb = 13, Aabb = 8. AABb = 13, AAbb = 10, AaBb = 12, Aabb = 9.

a) Qual o tipo de herana da cor da flor da paineira? b) Indique as possibilidades de se obterem em um cruzamento: I. apenas flores de cor branca; II. apenas flores de cor rosa mdio. 335. Qual o nmero de classes fenotpicas possveis para a cor da pele na espcie humana, supondo que o carter seja dominado por trs pares de genes com efeito cumulativo? 336. PUC-MG Num caso de herana quantitativa em que so observados cinco fentipos, um indivduo apresenta o fentipo intermedirio. O gentipo desse indivduo : a) AAbb. b) AaBbCc. c) AAbbCCdd. d) AaBbCcDdE. e) AAbbCCddEEff. 337. UCMG Num determinado vegetal, a dimenso do p da planta varia entre 100 cm e 200 cm de altura. Os tipos intermedirios tm variaes constantes de 10 cm. Sabendo-se que se trata de um caso de herana quantitativa, pergunta-se quantos pares de genes esto envolvidos nessa herana? a) 12 d) 5 b) 11 e) 4 c) 10 338. Vunesp Suponha que existam dois pares de genes A e B que contribuem aditivamente e sem dominncia para o crescimento da haste principal de um dado vegetal na seguinte proporo: A = 2; a = 1; B = 6; e b = 3. Do cruzamento de um indivduo AABb com outro de constituio gentica Aabb, tem-se os descendentes com os seguintes valores:

339. Vunesp A altura de uma certa espcie de planta determinada por dois pares de genes A e B e seus respectivos alelos a e b. Os alelos A e B apresentam efeito aditivo e, quando presentes, cada alelo acrescenta planta 0,15 m. Verificou-se que as plantas desta espcie variam de 1,00 m a 1,60 m de altura. Cruzando-se as plantas AaBB com aabb pode-se prever que, entre os descendentes: a) 100% tero 1,30 m de altura. b) 75% tero 1,30 m e 25% tero 1,45 m de altura. c) 25% tero 1,00 m e 75% tero 1,60 m de altura. d) 50% tero 1,15 m e 50% tero 1,30 m de altura. e) 25% tero 1,15 m, 25% 1,30 m, 25% 1,45 m e 25% 1,60 m de altura. 340. Mackenzie-SP Suponha que, em uma espcie de planta, a altura do caule seja condicionada por 3 pares de genes com efeito aditivo. A menor planta, com gentipo recessivo, mede 40 cm e cada gene dominante acrescenta 5 cm altura. Uma planta de gentipo aaBbCc foi autofecundada. A proporo de descendentes que sero capazes de atingir a altura de 50 cm de: a) 1/16 d) 6/16 b) 1/4 e) 1/2 c) 3/16 341. UFOP-MG Numa determinada famlia humana, a estatura dos indivduos varia entre 1,50 metro e 1,80 metro, a saber, de 5 em 5 centmetros. Sabendo-se que se trata de um caso de herana quantitativa e que os poligenes apresentam efeitos iguais, pergunta-se: a) quantos pares de genes esto envolvidos nessa herana? b) quais os gentipos dos indivduos com fentipos extremos? (Indique com as primeiras letras do alfabeto.) c) qual o resultado fenotpico do casamento entre dois tipos extremos? d) com quantos centmetros contribui cada gene dominante para essas diferenas de estatura? 342. PUC-SP A variao da cor da pele humana pode ser explicada atravs da interao de dois pares de genes aditivos. Os indivduos homozigotos para os genes A e B seriam pretos e, para os genes a e b, seriam brancos. Do casamento de indivduos com esses dois gentipos resultariam mulatos de cor intermediria entre as dos pais. O gentipo dos mulatos mencionados acima seria: a) AABB. d) AAbb. b) aabb. e) Aabb. c) AaBb.
109

PV2D-07-BIO-24

343. A determinao da cor da pele na espcie humana est na dependncia dos genes A e B que, quando atuam simultaneamente, determinam pigmentao mxima. Seus alelos recessivos a e b determinam pigmentao mnima quando presentes no mesmo gentipo. Determine os fentipos apresentados pelos descendentes, nos seguintes casamentos: a) AABb AABB; b) AaBb AaBb. 344. A cor da pele na espcie humana determinada pela interao de 2 pares de genes, com efeito aditivo: os indivduos homozigotos, para os genes R e S, so negros e os homozigotos, para os genes r e s, so brancos. Se dois mulatos mdios heterozigotos para os dois pares de genes se casam, qual a probabilidade do casal ter uma criana negra ? 345. Cesgranrio-RJ Supondo-se que a cor da pele humana seja condicionada por apenas dois pares de genes autossmicos (A e B) aditivos, qual a probabilidade de um casal de mulatos mdios, ambos com gentipo AaBb, ter um filho branco? a) 1 16 b) 4 16 c) 5 16 d) 6 16 e) 8 16

Os padres de distribuio fenotpica so devidos a: a) I: 1 gene com dominncia; II: 1 gene com dominncia incompleta. b) I: 1 gene com dominncia incompleta; II: vrios genes com interao. c) I: 1 gene com dominncia incompleta; II: 1 gene com alelos mltiplos. d) I: 3 genes com dominncia incompleta; II: vrios genes com interao. e) I: 2 genes com interao; II: 2 genes com dominncia incompleta. 348. Fuvest-SP Um criador que desejasse aumentar a mdia de pesos de seus porcos deveria usar qual dos mtodos expostos? a) Cruzar porcas de peso mdio com porcos de peso mdio. b) Cruzar porcos de peso pequeno com porcas de peso elevado. c) Cruzar porcos e porcas ao acaso, at obter aumento da mdia de peso. d) Cruzar porcos e porcas de maior peso possvel. e) Cruzar porcos e porcas ao acaso, para aumentar a concorrncia de mutaes. 349. Unicamp-SP Certas caractersticas fenotpicas so determinadas por poucos genes (herana mendeliana), enquanto outras so determinadas por muitos genes (herana polignica). Qual dos dois mecanismos explica a maior parte das variaes fenotpicas nas populaes? Justifique. 350. PUC-SP Para determinada planta, suponha que a diferena entre um fruto de 10 cm de comprimento e um de 20 cm de comprimento seja devida a dois genes, cada um com dois alelos, que tm efeito aditivo e que se segregam independentemente. Na descendncia do cruzamento entre dois indivduos que produzem frutos com 15 cm, espera-se uma proporo de plantas com frutos de 17,5 cm igual a: a) 1/8 b) 1/4 c) 3/16 d) 1/2 e) 9/16

346. A figura, a seguir, mostra os possveis fentipos para o carter cor de pele. Segundo Davenport, existem dois pares de genes com ausncia de dominncia condicionando essa caracterstica; o fentipo seria o resultado da soma das expresses parciais para cor de pele de cada um destes genes. Assim, o negro possuiria dois pares de genes para negro (AABB) e o branco, dois pares de genes para branco (aabb). De acordo com o que foi exposto acima, responda s questes abaixo.

a) Quais os possveis gentipos de um indivduo mulato escuro, de um mulato mdio e de um mulato claro? b) Do cruzamento de um homem mulato mdio, heterozigoto para os dois pares de genes, com uma mulher branca, qual a chance de nascer uma criana branca? 347. Unifesp Os grficos I e II representam a freqncia de plantas com flores de diferentes cores em uma plantao de cravos (I) e rosas (II).
110

351. FCMSC-SP Um concurso de gado considera 3 caractersticas condicionadas por genes dominantes em que, para cada uma, o homozigoto recebe mais pontos que o heterozigoto e este recebe mais pontos que o homozigoto recessivo (que recebe zero na caracterstica correspondente). Um criador tem um touro e uma vaca, ambos heterozigotos para as trs caractersticas. Desejando entrar no concurso, fez com que seus animais se cruzassem. Qual , respectivamente, a chance mais aproximada do criador obter, na F1 de tais reprodutores, um descendente capaz de tirar o 1o lugar (isto , conseguir o mximo de pontos possvel) e um descendente que tiraria o ltimo lugar (isto , no conseguiria um ponto sequer)? a) 30% e 15% d) 1,5% e 1,5% b) 15% e 15% e) 0,3% e 0,3% c) 3% e 1,5% 352. Vunesp Polticas de incluso que consideram cotas para negros ou afrodescendentes nas universidades pblicas foram colocadas em prtica pela primeira vez na Universidade Estadual do Rio de Janeiro (UERJ), em 2001. Propostas como essas geram polmicas e dividem opinies. H vrios argumentos contra e a favor. Os bilogos tm participado desse debate, contribuindo com os conhecimentos biolgicos referentes raa e herana da cor da pele humana, entre outros. Assinale a afirmao considerada correta do ponto de vista da biologia. a) Os critrios para se definir duas populaes como raas diferentes so cientfica e consensualmente determinados. b) No encontramos, na histria da biologia, dvidas sobre a existncia de raas na espcie humana. c) A cor da pele humana um exemplo de herana quantitativa ou polignica, o que significa que vrios genes atuam na sua definio. d) O fato de a cor da pele no ser influenciada por fatores ambientais refora a hiptese da existncia de raas na espcie humana. e) A determinao da cor da pele humana segue os padres do tipo de herana qualitativa e um exemplo de co-dominncia. 353. UFCE Considere como verdadeira a tabela mostrada, que relaciona o gentipo com a cor da pele: Gentipo AABB AABb AaBB AAbb AaBb aaBB Aabb aaBb aabb Fentipo negro mulato escuro mulato escuro mulato mdio mulato mdio mulato mdio mulato claro mulato claro branco

354. Unirio-RJ (...) O cncer de pele o mais comum entre os cnceres e se manifesta de duas formas: os carcinomas e os melanomas. Mais freqente, o carcinoma tem malignidade baixa. Provoca grandes deformaes, mas no leva morte. J o melanoma, que a transformao malgna dos melancitos (clulas produtoras de pigmentos), o cncer que mais cresce no mundo nos ltimos dez anos aumentou 20%. As pessoas, principalmente em pases tropicais como o Brasil, se expem excessivamente aos raios ultravioleta do sol, que so prejudiciais epiderme (camada superficial da pele). Esta exposio exagerada um dos fatores, mas no o nico. O cncer de pele tambm provocado por fatores genticos e ambientais, como a destruio da camada de oznio. As pessoas de pele clara esto mais sujeitas a ter problemas de pele e devem dar ateno especial ao auto-exame por toda a rea do corpo. (...)
http://www.saudevidaonline.com.br/cpele.htm

A incidncia desta doena est relacionada diretamente concentrao de melanina nas clulas epiteliais dos indivduos. A formao deste pigmento depende de uma cadeia de reaes qumicas. Logo, a produo de melanina depende da interao entre todos os genes envolvidos (interao gnica). Considerando que a cor da pele dos seres humanos pode ser classificada em negra, mulata escura, mulata mdia, mulata clara e branca. Qual seria o gentipo de um casal para que o cruzamento entre eles produzisse uma prole com todas as possibilidades fenotpicas? a) SSTT SsTt d) SStt ssTT b) SsTt SsTt e) SsTt SsTT c) SSTT sstt 355. UFC-CE Atualmente, o Governo Federal vem discutindo a implantao de quotas para negros nas universidades. Considerando a cor da pele de negros e de brancos responda s questes a seguir. a) Onde determinada, histolgica e citologicamente a cor da pele? b) O que confere a diferena na cor da pele de indivduos negros em relao dos indivduos brancos? c) Evolutivamente, qual a importncia da existncia dessa variabilidade na cor da pele para o ser humano? d) Especifique a forma de herana gentica responsvel pela determinao da cor da pele. 356. UFU-MG O peso dos frutos (fentipo) de uma determinada espcie vegetal varia de 150 g a 300 g. Do cruzamento entre linhagens homozigticas que produzem frutos de 150 g e linhagens homozigticas que produzem frutos de 300 g, obteve-se uma gerao F1 que, autofecundada, originou 7 fentipos diferentes. Sabendo-se que o peso do fruto um caso de herana quantitativa, responda ao que se pede. a) Quantos pares de genes esto envolvidos na determinao do peso dos frutos desta espcie vegetal? b) Qual o efeito aditivo de cada gene?
111

PV2D-07-BIO-24

Qual a probabilidade de um mulato claro (aaBb), ao casar-se com uma mulata escura (AaBB), ter, nos dois primeiros filhos, um casal de mulatos mdios ?

357. Vunesp Em um concurso de ces, duas caractersticas so condicionadas por genes dominantes (A e B). O homozigoto dominante para essas duas caractersticas recebe mais pontos que os heterozigotos e estes, mais pontos que os recessivos, que ganham nota zero. Um criador, desejando participar do concurso, cruzou um macho e uma fmea, ambos heterozigotos para os dois genes, obtendo uma descendncia com todos os gentipos possveis. a) Qual a probabilidade do criador obter um animal com a pontuao mxima? Qual a probabilidade de obter um animal homozigoto recessivo para os dois genes? b) Considerando que todos os descendentes do referido cruzamento participaram do concurso, e que cada gene dominante contribui com 5 pontos na premiao, quantos pontos devem ter obtido os vice-campees e os ces classificados em penltimo lugar? 358. PUC-MG Em Ovinus hipothetyccus, a velocidade de crescimento depende da interao de trs pares de genes alelos aditivos e com segregao independente. A tabela abaixo representa trs desses animais, com seus respectivos gentipos e massas corporais, aps seis meses de crescimento em condies padronizadas. Animal I II III Gentipo aabbcc AaBbCc AABBCC Massa corporal (kg) 18 21 24

Com base nos dados apresentados e em seus conhecimentos sobre o assunto, assinale a alternativa incorreta. a) Cada gene aditivo pode contribuir para o incremento de 1 kg na massa corporal do animal aps seis meses de crescimento nas condies padronizadas acima referidas. b) So sete as diferentes classes fenotpicas para o carter acima referido. c) O animal II pode produzir oito tipos de gameta genotipicamente diferentes. d) O cruzamento dos animais II III sempre produzir descendentes com maior velocidade de crescimento do que a dos descendentes do cruzamento de II II. e) O cruzamento de III I sempre produzir descendentes com o mesmo gentipo para o carter acima referido. 359. Unicamp-SP No ser humano, a ausncia de pigmento (albinismo: dd) e a cor da pele (cor branca: aabb; cor negra: AABB) so caractersticas autossmicas. Do casamento entre um homem e uma mulher negros, nasceu um menino albino. Do casamento desse rapaz com uma mulher branca, nasceram dois filhos mulatos intermedirios e uma filha albina. Com base nesses dados, responda ao que se pede. a) Indique os gentipos de todas as pessoas citadas no texto. (Use as notaes indicadas no texto para identificar os alelos.) b) Se um dos descendentes mulatos intermedirios se casar com uma mulher branca albina, qual ser a proporo esperada de filhos albinos? c) A que tipo de herana se refere a caracterstica cor de pele? Justifique.

Captulo 05
360. UEL-PR Se um gentipo representado por + d porque os genes em questo: c+ a) situam-se no mesmo par de homlogos. b) situam-se em cromossomos sexuais. c) segregam-se independentemente. d) so alelos mltiplos. e) determinam dois caracteres recessivos. 361. UFRGS-RS O esquema a seguir representa determinados genes alelos, localizados no mesmo par de homlogos. Assinale a alternativa correta. a) Em I, a freqncia de crossing over mais significativa. b) Em II, a probabilidade de ligao maior. c) Em II, a probabilidade de recombinao gnica menor. d) Em I, a ligao menos freqente. e) Em II, a probabilidade de recombinao maior.
112

362. Considere as clulas A e B representadas abaixo e suponha que elas pertenam a linhagens germinativas de dois diferentes organismos. Aps sofrer a meiose, uma clula A e uma clula B originaro, respectivamente, quantos e quais tipos de gametas, se no houver permutao na meiose?

a) b) c) d) e)

50% Ab, 50% Ba. 25% A, 25% B, 25% a, 25% b. 100% AaBb. 50% AB, 50% ab. 50% Aa, 50% Bb.

366. PUC-SP Generalizando a formao dos gametas de uma fmea de drosfila com linkage, no absoluto, onde ocorre crossing over, poderamos afirmar que em I, II, III e IV os cromossomos transportam os seguintes genes, respectivamente:

a) b) c) d) e)

2 (Ab/aB), 4 (cD/Cd/CD/cd) 2 (Ab/aB), 2 (CD/cd ou Cd e cD) 1 (Ab ou aB), 4 (CD/Cd/cD/cd) 4 (Ab/aB/AB/ab), 2 (CD/cd) 1 (Ab ou aB), 2 (CD/cd ou Cd e cD)

363. UEL-PR Em tomates, o fruto vermelho (V) dominante sobre fruto o amarelo (v). A planta alta (A) dominante sobre a planta baixa (a). Os dois genes esto localizados no mesmo cromossomo e no apresentam crossing over. Quais os fentipos esperados para os descendentes de dois indivduos com o seguinte gentipo: a) AB, Ab, aB e ab b) Ab, ab, aB e ab c) AB, Ab, ab e AB a) b) c) d) e) apenas altos e vermelhos. apenas amarelos e baixos. altos e vermelhos e amarelos e baixos. baixos e vermelhos e altos e amarelos. altos e vermelhos, amarelos e baixos, baixos e vermelhos e altos e amarelos. d) AB, AB, AB e AB e) ab, ab, ab e ab

367. UCBA Um indivduo apresenta os seguintes cromossomos:

364. Suponha que o gene que determina o albinismo (a) esteja em ligao fatorial total com um gene (l) que letal recessivo. No cruzamento abaixo, qual a probabilidade de aparecerem, na descendncia, indivduos albinos? AL / al x Al / aL 365. UFU-MG Consideremos a segregao de dois pares de alelos AB durante a meiose. Supondo-se que no houve ab crossing over entre os dois cromossomos, os gametas formados so:

e produz gametas dos seguintes tipos:

Durante a meiose ocorreu: a) mutao. b) dominncia. c) permuta. d) no-disjuno. e) segregao independente.


113

PV2D-07-BIO-24

368. UFRGS-RS O esquema abaixo refere-se a uma clula diplide que, durante a meiose, sofrer permutao entre os genes A e B.

372. UFTM-MG Considere duas caractersticas determinadas por dois diferentes pares de genes situados em um mesmo par de cromossomos autossmicos, como exemplificado no esquema.

Assinale a alternativa que apresenta todos os tipos de gametas normais que podem ser formados por essa clula. a) AbCe; abCe; aBCe; ABCe b) AbC; e; ABC; e c) AbCe; ABCe d) AbCe; aBCe e) AabCe; AaBCe; AbCe; aBCe 369. Fuvest-SP Em determinada espcie, os loci dos genes A e B situam-se no mesmo cromossomo. Na meiose de um indivduo duplo heterozigoto AB/ab, ocorre permutao entre esses loci em 80% das clulas. A porcentagem esperada de gametas Ab que o indivduo formar : a) 10% d) 40% b) 20% e) 80% c) 30% 370. UEL-PR Na meiose de um indivduo AB/ab, ocorre crossing over entre esses genes em 40% das clulas. A freqncia de gametas AB, Ab, aB e ab produzidos por esse indivduo deve ser, respectivamente: a) 10%, 40%, 40% e 10%. b) 30%, 20%, 20% e 30%. c) 30%, 30%, 20% e 20%. d) 40%, 10%, 10% e 40%. e) 40%, 40%, 10% e 10%. 371. Unirio-RJ Suponha que 100 clulas germinativas entrem em meiose e que essas clulas tenham o seguinte gentipo:

Suponha que 500 clulas germinativas, com o mesmo gentipo da clula anterior, entrem em meiose e que 20% dessas clulas apresentem permutao. O nmero de gametas recombinantes que se espera encontrar ao final do processo : a) 200 b) 400 c) 500 d) 1.000 e) 2.000 373. Mackenzie-SP A figura a seguir representa _________________, que ocorre na ______________ e tem como conseqncia _______________

A alternativa que preenche, correta e respectivamente, os espaos anteriores : a) crossing over, metfase da mitose; a variabilidade gentica. b) o pareamento de cromtides-irms; anfase I da meiose; a troca de genes alelos. c) o crossing over, prfase I da meiose; a variabilidade gentica. d) a segregao de cromossomos homlogos; anfase I da meiose; a formao de clulas haplides. e) o pareamento de cromossomos homlogos; metfase da mitose; a formao de gametas. 374. Um indivduo de gentipo AaBb cujos genes se encontram em linkage em posio cis, apresenta crossing over em 40% de suas clulas. a) Quais os tipos e propores de gametas gerados por esse indivduo? b) Qual a taxa de crossing over entre os genes citados?

Quantos gametas recombinantes sero formados se 20 das 100 clulas apresentarem permutao na meiose? a) 20 d) 160 b) 40 e) 180 c) 80
114

375. UFPE Na elaborao de mapas cromossmicos, devem ser consideradas as taxas de recombinao entre os loci gnicos. Considerando o gentipo ilustrado na figura e as freqncias de recombinao mostradas para os gametas oriundos, correto afirmar que:

a) esto ligados, e h permuta entre eles. b) esto ligados, e no h permuta entre eles. c) segregam-se independentemente, e h permuta entre eles. d) segregam-se independentemente, e no h permuta entre eles. e) no esto ligados, logo segregam-se independentemente. 378. PUC-SP Suponha que, em uma certa espcie de dpteros, os genes para cor do olho e tamanho da asa estejam localizados no mesmo cromossomo. Sabe-se que o olho marrom (M) dominante sobre o olho branco (m) e que a asa longa (L) denominante sobre asa curta (l). Uma fmea de olho marrom e asa longa cruzada com um macho de olho branco e asa curta produziu a seguinte descendncia: Fentipos Olho marrom, asa curta Olho branco, asa longa Olho marrom, asa longa Olho branco, asa curta Freqncias 45% 45% 5% 5%

A constituio da fmea utilizada no cruzamento : a) d)

b) a) os gametas AB e ab (parentais) sero observados em maior freqncia. b) os gametas recombinantes ocorrerro com freqncia de 60% (figura 1). c) os gametas no-recombinantes ocorrerro com freqncia de 40% (figura 2). d) o processo de permutao (figura 1) ocorre na prfase II da meiose. e) os gametas duplo-recessivos so obtidos em menor freqncia. 376. UFMT Cruzando-se os indivduos PpRr pprr, obtiveram-se os seguintes descendentes, nas propores indicadas: PpRr = 40% Pprr = 10% ppRr = 10% pprr = 40% Esses resultados permitem concluir que os genes P e R: a) situam-se no mesmo cromossomo. b) segregam-se independentemente. c) interagem. d) fazem parte de uma srie de alelos. e) situam-se nos cromossomos sexuais. 377. Unirio-RJ Um cruzamento entre dois indivduos, com os gentipos DdEe ddee, originou 42 descendentes com gentipo DdEe, 160 Ddee, 168 ddEe e 40 ddee. Sobre os genes D e E, podemos concluir que:
PV2D-07-BIO-24

e)

c)

379. Mackenzie-SP Considere o seguinte cruzamento: AaBb x aabb. Descendncia: Aa Bb = 40 Aa bb = 160 aa Bb = 160 aa bb = 40 Total = 400 O gentipo do indivduo heterozigoto ________, e a taxa de permutao entre os genes a e b ___________.

115

380. Um indivduo homozigoto para os genes a e b cruzado com um homozigoto dominante e, o F1 retrocruzado com o tipo parental duplo-recessivo. Obtm-se os seguintes descendentes: AB ( 451) ab ab ( 450 ) ab Ab ( 48 ) ab aB ( 51) ab

385. Um indivduo duplo-heterozigoto (AaBb), cujos genes se encontram em posio cis, apresenta crossing over em 40% de suas clulas. Quais tipos de gametas so produzidos e em que proporo? Quais so os tipos formados atravs da recombinao? Qual a freqncia de crossing over formada? 386. Unisa-SP Plantas altas, de flores vermelhas, foram cruzadas com plantas baixas, de flores brancas, resultando apenas em descendentes altos e de flores vermelhas. Feito o retrocruzamento, os quatro fentipos possveis da descendncia surgiram na proporo de 1:1:1:1. Isso significa que os genes para altura e cor das flores das plantas: a) apresentam vinculao (linkage). b) no se situam no mesmo cromossomo. c) so eqidistantes do centrmero no mesmo cromossomo. d) apresentam taxa de permuta de 25%. e) apresentam epistasia. 387. UFRJ Considere a existncia de dois loci em um indivduo. Cada loco tem dois alelos A e a e B e b, sendo que A e B so dominantes. Um pesquisador cruzou um indivduo AaBb com um indivduo aabb. A prole resultante foi: 40% AaBb; 10% Aabb; 40% aabb; 10% aaBb. O pesquisador ficou surpreso, pois esperava obter os quatro gentipos na mesma proporo, 25% para cada um deles. Esses resultados contrariam a 2 lei de Mendel ou lei da segregao independente? Justifique sua resposta. 388. Em alguns casos, na gentica, a proporo dos gametas formados no obedece 2 lei de Mendel. Neste caso, temos um caso de ________ ou ________. Nesta situao, os gametas que so formados em maior proporo so ditos ________, e os gametas formados em menor proporo so ditos ________. Assinale a alternativa que trz as palavras que preenchem, correta e respectivamente, as lacunas do texto. a) epistasia interao gnica maiorais filiais b) ligao gnica recombinao gentica dominantes recessivos c) epistasia recombinao gnica parentais recombinantes d) ligao gnica linkage parentais recombinantes e) interao gnica linkage dominantes recessivos 389. Mendel, nas primeiras experincias sobre hereditariedade, trabalhou com apenas uma caracterstica de cada vez. Posteriormente, ele acompanhou a transmisso de dois caracteres ao mesmo tempo, e os resultados levaram-no a concluir que: fatores para dois ou

Qual a freqncia aproximada de permuta entre a e b? a) 5% d) 20% b) 10% e) 25% c) 15% 381. FM Santos-SP Um indivduo homozigoto para os genes c e d cruzado com um homozigoto selvagem, e o F1 retrocruzado com o tipo parental duplo recessivo. So obtidos os seguintes descendentes:

A porcentagem de recombinao entre c e d de: a) 2% d) 5% b) 0,5% e) 3% c) 10% 382. UFPE A freqncia de recombinao entre os loci A e B de 10%. Em que percentual sero esperados descendentes de gentipo AB // ab, a partir de progenitores com os gentipos mostrados na figura?

a b a b
a) 5% b) 90% c) 45%

A B a b
d) 10% e) 20%

383. PUC-MG Em um caso de linkage, dois genes A e B, autossmicos, distam entre si 20 UR. Considere o seguinte cruzamento: fmea (Ab/ aB) macho (ab/ ab). Qual a freqncia esperada de machos com o gentipo AB/ab? a) 100% d) 10% b) 50% e) 5% c) 25% 384. No milho, so conhecidos dois pares de genes em ligao fatorial linkage: V planta arroxeada B planta alta v planta verde b planta baixa Sabendo-se que a freqncia de permutao entre os genes V e B de 20%, determine, para um total de 1.000 indivduos, como ser a descendncia do cruzamento abaixo: BbVv bbvv (posio cis)
116

mais caracteres so transmitidos para os gametas de modo totalmente independente. Esta observao foi enunciada como 2 lei de Mendel ou lei da segregao independente, a qual no vlida para os genes que esto em ligao gnica ou linkage, isto , genes que esto localizados nos mesmos cromossomos. Observe as seguintes propores de gametas produzidos pelo dibrido AaBb em trs situaes distintas: I. AB (25%); Ab (25%); aB (25%); ab (25%) II. AB (50%); ab (50%) III. AB (40%); Ab (10%); aB (10%); ab (40%) Quais os mecanismos presentes em I, II e III? 390. UFG-GO A transferncia das mensagens genticas se faz atravs da reproduo, que, quando sexuada, permite que cromossomos homlogos pareiem genes alelos. Considerando o exposto: a) diferencie, exemplificando, genes ligados e a segunda lei de Mendel; b) explique o fenmeno da permutao e cite duas de suas conseqncias. 391. UFJF-MG Complete o quadro abaixo, informando o tipo de herana e como os genes se localizam nos cromossomos: Informaes: os tipos de gametas produzidos 1/4 AB O indivduo AaBb produz 1/4 Ab 1/4 aB 1/4 ab O indivduo EeFf produz 1/2 CD 1/2 cd 40% EF O indivduo CcDd produz 10% Ef 10% eF 40% ef 392. Fuvest-SP Foram realizados cruzamentos entre uma linhagem pura de plantas de ervilha com flores prpuras e gros de plen longos e outra linhagem pura, com flores vermelhas e gros de plen redondos. Todas as plantas produzidas tinham flores prpuras e gros de plen longos. Cruzando-se essas plantas heterozigticas com plantas da linhagem pura de flores vermelhas e gros de plen redondos, foram obtidas 160 plantas: 62 com flores prpuras e gros de plen longos; 66 com flores vermelhas e gros de plen redondos; 17 com flores prpuras e gros de plen redondos; 15 com flores vermelhas e gros de plen longos. Essas freqncias fenotpicas obtidas no esto de acordo com o esperado, considerando-se a segunda lei de Mendel (lei da segregao independente). Localizao Tipo de dos genes no herana cromossomo

a) De acordo com a 2 lei de Mendel, quais so as freqncias esperadas para os fentipos? b) Explique a razo das diferenas entre as freqncias esperadas e as observadas. 393. Unisa-SP Thomas Morgan elaborou os mapas cromossmicos de Drosophila melanogaster, onde assinalava as distncias relativas entre os genes situados num mesmo cromossomo. A construo desses mapas s foi possvel aceitando-se uma suposio bsica de que: a) a ocorrncia do crossing over ocorresse durante a meiose. b) os genes alelos ocupassem os mesmos loci. c) os genes alelos estivessem em dose dupla. d) os genes no-alelos de um mesmo cromossomo estivessem dispostos linearmente ao longo dele. e) s houvesse crossing over na gametognese das fmeas. 394. ESAN-RN Em drosfilas, os genes que determinam cor do corpo e comprimento das asas situam-se no mesmo cromossomo e, entre eles, h 17 unidades de recombinao (UR). Por isso, a porcentagem de crossing over entre esses genes : a) 68% b) 34% c) 17% d) 8,5% e) 4,25% 395. Mackenzie-SP Analisando-se dois pares de genes em ligamento fatorial (linkage) representados pelo hbrido BbRr, uma certa espcie apresentou a seguinte proporo de gametas: 48,5% BR 48,5% br 1,5% Br 1,5% bR Pela anlise dos resultados, pode-se concluir que a distncia entre os genes B e R de: a) 48,5 morgandeos. b) 97 morgandeos. c) 1,5 morgandeo. d) 3 morgandeos. e) 50 morgandeos. 396. O cruzamento de indivduos produziu a seguinte descendncia: Ab aB ab AB = 41, 5%, = 41, 5%, = 8, 5% e = 8, 5% ab ab ab ab Qual a distncia relativa entre os genes considerados? a) 34 UR b) 17 UR c) 8,5 UR d) 4,2 UR e) 0,85 UR
117

PV2D-07-BIO-24

397. Vunesp Se num mapa gentico, a distncia entre os loci A e B de 16 morgandeos, qual a freqncia relativa dos gametas AB, Ab, aB, ab produzidos pelo gentipo AB/ab? AB a) b) c) d) e) 36% 34% 42% 8% 44% Ab 14% 16% 8% 42% 6% aB 14% 16% 8% 42% 6% ab 36% 34% 42% 8% 44%

poder concluir que os genes se situam no cromossomo na ordem y-w-bi, a freqncia de permuta entre y e bi deve ser igual a: a) 1,5% d) 6,9% b) 3,9% e) 8,4% c) 5,4% 403. PUC-RJ Considere o seguinte esquema dos genes A B C situados em um mesmo cromossomo: C ------------ A ------------------------ B Qual das seguintes alternativas apresenta corretamente as possveis freqncias de permuta entre os genes? A-B a) b) c) d) e) 4% 4% 6% 6% 2% A-C 2% 6% 2% 4% 6% B-C 6% 2% 4% 2% 4%

398. Um indivduo apresenta o seguinte gentipo Ab//aB. Sabendo que a distncia entre os dois loci de 8 UR, quais so as freqncias que podem ser esperadas na produo de gametas? 399. PUC-SP Sabendo-se que a distncia entre dois genes, A e B, localizados num mesmo cromossomo, de 16 unidades de recombinao, pode-se dizer que os gametas Ab produzidos por um indivduo sero: aB AB a) b) c) d) e) 8 42 16 34 25 Ab 42 8 64 16 25 aB 42 8 34 16 25 ab 8 42 16 34 25

404. UEL-PR Considere a tabela seguinte, que representa as taxas de permuta entre quatro genes. Genes XY YZ ZW WX Taxa de permuta em % 2 7 9 4

400. PUC-MG Um indivduo apresenta o gentipo . Sabendo-se que a distncia entre os dois loci de 6 unidades de recombinao, quais so as freqncias que podero ser esperadas na produo dos gametas? AB a) b) c) d) e) 0,47 0,44 0,00 0,03 0,25 Ab 0,03 0,06 0,50 0,47 0,25 aB 0,03 0,06 0,50 0,47 0,25 ab 0,47 0,44 0,00 0,03 0,25

A taxa de permuta entre X e Z : a) 11% d) 3% b) 7% e) 2% c) 5% 405. Fuvest-SP Os genes X, Y e Z de um cromossomo tm as seguintes freqncias de recombinao: Genes XeY YeZ ZX Freqncia de recombinao 15% 30% 45%

401. Sabendo-se que a freqncia de permutao entre os genes A e C de 20% e que entre os genes B e C de 10%, ento a distncia entre os genes A e B ser: a) 10 morgandeos. b) 30 morgandeos. c) 10 ou 30 morgandeos. d) 20 morgandeos. e) 20 ou 10 morgandeos. 402. FCMSC-SP Em drosfilas, a freqncia de permuta entre os genes w e bi de 5,4% e entre os genes w e y de 1,5%. Para
118

Qual a posio relativa desses trs genes no cromossomo? a) Z X Y d) X Z Y b) X Y Z e) Y X Z c) Y Z X 406. UFC-CE A porcentagem de permutao entre os genes de um par de cromossomos fornece uma indicao da distncia que existe entre eles. Entre os genes X, Y e Z, verificaram-se as seguintes porcentagens de permutao: X e Y = 25% X e Z = 13% Y e Z = 12%

Assinale a opo que indica a correta disposio desses genes no cromossomo. a) X, Y e Z. c) Z, X e Y. b) X, Z e Y. d) Y, X e Z. 407. Para um certo organismo, so descritos trs pares de alelos ligados A, B, C. Verificou-se que a freqncia de permuta A e B de 3,5%, a de A e C de 17% e a de B e C de 13,5%. Como se dispem esses alelos no cromossomo? a) ABC d) CAB b) ACB e) BAC c) BCA 408. UEL-PR Quatro genes, A, B, C e D, localizados no mesmo cromossomo, apresentam as seguintes freqncias de recombinao: A B = 32% B C = 13% A C = 45% B D = 20% A D = 12% C D = 33% A seqncia mais provvel desses genes no cromossomo : a) ABCD d) ADBC b) ABDC e) ADCB c) ACDB 409. Para a planta do tomate foram descritos quatro pares de genes ligados: D, P, O e S. Verificou-se que as freqncias de recombinao entre D P de 3,5%; D O de 17,4% ; entre P O de 13,9% ; entre S O de 12,8%. Sabendo-se que a soma de recombinaes entre D O e S O de 30,2%, qual a seqncia mais provvel destes genes no cromossomo? 410. PUC-SP As distncias entre cinco genes localizados num grupo de ligao de um determinado organismo esto contidas na figura abaixo. Identifique o mapeamento correto para tal grupo de ligao. Gene A B C D E a) CBADE b) EABCD c) DEABC A 8 12 4 1 B 8 4 12 9 C 12 4 16 13 D 4 12 16 3 E 1 9 13 3

a) Qual a distncia entre os genes em questo, em unidades de recombinao? b) Qual a posio dos genes nos cromossomos do heterozigoto utilizado no cruzamento? 412. Um indivduo cis para os genes A e B com taxa de recombinao de 10% foi cruzado com um duplo recessivo. a) Represente os gentipos dos indivduos envolvidos. b) Calcule a proporo genotpica dos descendentes do cruzamento. c) Qual a distncia entre os genes? 413. UMC-SP Um indivduo de gentipo desconhecido produziu os seguintes gametas: 4% MN 46% Mn 46% mN 4% mn Responda s questes abaixo. a) Quais desses gametas so parentais e quais so recombinantes? b) Qual o gentipo do indivduo? Ele cis ou trans? c) Qual a taxa de recombinao entre M e n? d) Qual a distncia dos loci m e n no mapa gentico? e) Se 40% das clulas desse indivduo sofrerem crossing over, qual ser a nova taxa de recombinao? f) Se um indivduo cis para os referidos genes com taxa de recombinao (TR) = 10% fosse cruzado com um duplo recessivo, quais seriam os descendentes do cruzamento e em qual proporo? 414. Fuvest-SP Um organismo, homozigoto para os genes A,B,C,D, todos localizados em um mesmo cromossomo, cruzado com outro, que homozigoto recessivo para os mesmos alelos. O retrocruzamento de F1 (com o duplo recessivo) mostra os seguintes resultados: no ocorreu permuta entre os genes A e C; ocorreu 20% de permuta entre os genes A e B; 30% entre A e D; ocorreu 10% entre B e D. a) Baseando-se nos resultados acima, responda qual a seqncia mais provvel desses quatro genes no cromossomo a partir do gene A. b) Justifique sua resposta. 415. Unifesp Os loci M, N, O, P esto localizados em um mesmo cromossomo. Um indivduo homozigtico para os alelos M, N, O, P foi cruzado com outro, homozigtico para os alelos m, n, o, p. A gerao F1 foi ento retrocruzada com o homozigtico m, n, o, p. A descendncia desse retrocruzamento apresentou: 15% de permuta entre os loci M e N; 25% de permuta entre os loci M e O; 10% de permuta entre os loci N e O. No houve descendentes com permuta entre os loci M e P. a) Qual a seqncia mais provvel desses loci no cromossomo? Faa um esquema do mapa gentico desse trecho do cromossomo, indicando as distncias entre os locos. b) Por que no houve descendentes recombinantes com permuta entre os loci M e P?
119

d) ABCDE e) ABCED

411. Fuvest-SP O cruzamento AaBb aabb produziu a seguinte descendncia:


PV2D-07-BIO-24

Gentipos AaBb aaBb Aabb aabb

Freqncias 48% 2% 2% 48%

416. PUC-SP Suponha que, em uma certa espcie de dpteros, os genes para cor do olho e tamanho da asa estejam localizados no mesmo cromossomo. Sabe-se que o olho marrom (M) dominante sobre o olho branco (m), e que a asa longa (L) dominante sobre a asa curta (l). Uma fmea de olho marrom e asa longa cruzada com um macho de olho branco e asa curta produziu a seguinte descendncia: Fentipos Olho marrom, asa curta Olho branco, asa longa Olho marrom, asa longa Olho branco, asa curta Freqncias 45% 45% 5% 5%

418. Dois loci gnicos esto em um mesmo par de cromossomos homlogos e distam 36 umc. Um macho duplo-heterozigoto do tipo trans cruzado com uma fmea heterozigota para um dos pares e homozigota recessiva para outro par. Qual a probabilidade de nascimento de um filhote homozigoto recessivo para ambos os pares de genes considerados? a) 9,0% d) 25,0% b) 12,5% e) 36,0% c) 18,0% 419. Unioeste-PR A gentica o ramo da cincia que estuda as leis da transmisso dos caracteres hereditrios. Analise as alternativas abaixo e assinale a correta. a) Tratando-se de genes A e B ligados, distantes 20 unidades de recombinao, uma planta com gentipo AB/ab formar 40% de gametas AB, 40% de gametas ab, 10% de gametas Ab e 10% de gametas aB. b) Tratando-se de genes A e B no ligados, uma planta com gentipo AaBb formar somente gametas AB e ab. c) Em um indivduo, gentipo o conjunto das caractersticas morfolgicas ou funcionais, e fentipo a constituio gentica. d) Co-dominncia e dominncia incompleta so denominaes diferentes para formas idnticas de interaes allicas. e) Epistasia uma herana monognica que ocorre devido interao por alelos mltiplos.

A distncia entre os loci em questo, em unidades de recombinao, : a) 5 b) 10 c) 45 d) 50 e) 90 417. Unicamp-SP Os loci gnicos A e B se localizam em um mesmo cromossomo, havendo 10 unidades de recombinao (morgandeos) entre eles. a) Como se denomina a situao mencionada, supondo se o cruzamento AB/ab com ab/ab? b) Qual ser a porcentagem de indivduos AaBb na descendncia? c) Qual ser a porcentagem de indivduos Aabb?

Captulo 06
420. FAC-SP O nmero de cromossomos presentes nas clulas humanas de: a) 42 pares de cromossomos somticos. b) 44 cromossomos somticos e 2 cromossomos sexuais. c) 44 cromossomos somticos e 1 cromossomo sexual. d) 23 pares de cromossomos somticos. e) 20 pares de cromossomos somticos e 2 pares de cromossomos sexuais. 421. Assinale a alternativa em que temos possveis espermatozides normais para a espcie humana. a) 22A + Y, apenas. d) 23A + Y. b) 22A + X, apenas. e) 22A + Y e 22A + X. c) 23A. 422. UFRJ As chances de um beb nascer menino ou menina so aproximadamente iguais. Do ponto de vista gentico, como voc explicaria este fato?
120

423. PUC-SP Uma certa espcie de mamferos tem 40 cromossomos em suas clulas somticas (2n = 40). A determinao do sexo semelhante da espcie humana. Pode-se afirmar corretamente que, nessa espcie: a) um gameta normal tem 18 autossomos e 2 cromossomos sexuais. b) um gameta normal tem 40 cromossomos. c) um gameta normal tem 19 autossomos e 1 cromossomo sexual. d) uma clula somtica normal tem 40 autossomos. e) uma clula somtica normal tem 39 autossomos e 1 cromossomo sexual. 424. UFRJ Fazendeiros que criam gado leiteiro podem, atualmente, determinar o sexo dos embries logo aps a fertilizao, usando um kit que determina a presena do cromossomo Y. Se o embrio for fmea, reimplantado no tero da vaca. Caso contrrio, ele eliminado ou congelado para uso futuro. a) Para esses fazendeiros, qual a vantagem dessa prvia determinao do sexo dos embries? b) Por que o kit pesquisa somente a presena do cromossomo Y?

425. PUC-RS Uma dada espcie de inseto segue o sistema XO na determinao do sexo. Estudando-se as clulas somticas de um indivduo dessa espcie, encontraram-se 23 cromossomos. Qual o sexo desse indivduo e qual o valor de 2n no sexo oposto? a) Macho e 46 d) Fmea e 24 b) Fmea e 46 e) Macho e 24 c) Macho e 42 426. Fuvest-SP Nos gafanhotos, a determinao do sexo obedece ao sistema XX/XO, sendo o masculino o sexo heterogamtico. A anlise de clulas somticas de um indivduo mostrou 23 cromossomos. De acordo com esse resultado, o indivduo em questo : a) uma fmea, tendo o macho da espcie nmero 2n = 24. b) uma fmea, tendo o macho da espcie nmero 2n = 23. c) uma fmea, tendo o macho da espcie nmero 2n = 12. d) um macho, tendo a fmea da espcie nmero 2n = 12. e) um macho, tendo a fmea da espcie nmero 2n = 24. 427. PUCCamp-SP A anlise do caritipo de uma dada espcie revelou que o nmero diplide idntico em ambos os sexos e que o sexo heterogamtico o feminino. Com base nesses dados, possvel dizer que o sistema de determinao do sexo nessa espcie do tipo: a) XX : XY d) ZZ : ZW b) XX : XO e) ZZ : ZO c) XX : YO 428. A cromatina sexual est presente apenas em clulas somticas femininas. Ela est relacionada a cromossomos: a) Y ativos. d) Y inativos. b) X inativos. e) autossomos mutantes. c) autossomos ativos. 429. Na dcada de 40, Barr, examinando o ncleo de clulas somticas de fmeas de mamferos, observou uma mancha que veio a se chamar corpsculo de Barr ou cromatina sexual. Qual seu significado? 430. Unirio-RJ Em eventos esportivos internacionais como os Jogos Pan-americanos ou as Olimpadas, ocasionalmente, h suspeitas sobre o sexo de certas atletas, cujo desempenho ou mesmo a aparncia sugerem fraudes. Para esclarecer tais suspeitas, utiliza-se: a) a identificao da cromatina sexual. b) a contagem de hemcias cuja quantidade maior nos homens. c) o exame radiolgico dos rgos sexuais.

d) a pesquisa de hormnios sexuais femininos atravs de um exame de sangue. e) a anlise radiogrfica da bacia. 431. UFF-RJ Numere a coluna inferior, relacionando-a com a superior. Indivduos: 1. 45, X 4. 49, XXXXY 2. 46, XX 5. 47, XXX 3. 49, XXXXX Quantidade de cromatinas sexuais (corpsculos de Barr) ( ) quatro ( ) uma ( ) duas ( ) trs ( ) nenhuma Assinale a opo que apresenta a seqncia correta de numerao. a) 2, 4, 1, 3, 5 d) 3, 2, 1, 4, 5 b) 3, 5, 1, 2, 4 e) 2, 1, 3, 4, 5 c) 2, 3, 1, 4, 5 432. Unisa-SP Nos rpteis e nas aves, o sexo heterogamtico o feminino (fmea = ZW e macho = ZZ). Nesses grupos, a cromatina sexual deve ser procurada: a) nas clulas somticas dos machos. b) nos gametas dos machos. c) nas clulas somticas das fmeas. d) nos gametas das fmeas. e) nos gametas de machos e fmeas. 433. FMT-SP Partenognese um tipo particular de reproduo, em que a formao do novo ser se d a partir de: a) fragmento do organismo parental. b) esporo. c) vulo fecundado. d) vulo no fecundado. 434. FCMSC-SP Considere o seguinte dilogo imaginrio entre dois zanges que esto brigando: Zango 1: Vou contar a meu pai tudo o que voc fez, e voc vai se ver com ele! Zango 2: Pode contar. Estou tremendo, morrendo de preocupao... Na sua opinio, qual dos dois zanges sabe mais gentica? O que justificou a resposta irnica do segundo zango? 435. UFRN No reino Colmeia, havia uma rainha que tinha tido apenas filhos do sexo masculino (zanges) e precisava de uma sucessora para o trono. A rainha se casou com um belo zango plebeu, e nasceram filhas operrias, das quais uma seria a escolhida para ser a futura sucessora da rainha.
121

PV2D-07-BIO-24

Essa histria mostra que: a) os zanges so haplides e produzem os espermatozides por meiose. b) o sexo das abelhas determinado pelos cromossomos sexuais. c) o sexo das abelhas determinado pela ploidia do indivduo. d) a rainha e as operrias so diicas, e os zanges so monicos. 436. PUC-SP O carneiro (Ovis aries) apresenta 27 cromossomos em seus gametas normais. A partir desse dado, assinale a alternativa incorreta com relao ao nmero de cromossomos encontrado em diversas clulas nessa espcie. a) Um neurnio de carneiro deve apresentar 52 autossomos. b) Um linfcito de carneiro deve apresentar 54 cromossomos, incluindo 2 cromossomos sexuais. c) Um vulo de ovelha deve apresentar 26 autossomos. d) Uma clula de carneiro que est na metfase da mitose deve apresentar 54 cromossomos duplicados. e) Uma clula muscular de carneiro deve apresentar 54 autossomos, alm de 2 cromossomos sexuais. 437. UFF-RJ Um geneticista, adotando o mesmo critrio utilizado para a montagem de caritipo da espcie humana, montou o caritipo de certa espcie animal desconhecida, conseguindo formar dez pares de cromossomos, restando, alm desses, dois cromossomos de tamanhos distintos. Considere o padro de determinao de sexo, nessa espcie desconhecida, igual ao do humano e determine: a) quantos cromossomos existem, respectivamente, nos vulos, nos espermatozides e nas clulas musculares dessa espcie animal; b) o sexo a que pertence o animal da espcie em questo, justificando sua resposta. 438. Na maioria dos organismos, a determinao do sexo feita atravs dos cromossomos sexuais. Explique como ocorre esse processo na espcie humana. 439. UEL-PR Acerca da relao entre cromossomos de um menino e os de seus avs, fizeram-se as seguintes afirmaes: I. Seu cromossomo Y descendente do Y de seu av paterno. II. Seu cromossomo X descendente de um X de sua av paterna. III. Entre seus autossomos, h descendentes de autossomos de seus avs. Dessas afirmaes, esto corretas apenas: a) I b) II c) III d) I e III e) II e III
122

440. PUC-SP Duas mulheres disputam a maternidade de uma menina. Foi realizada a anlise de um mesmo trecho do DNA, obtido de um dos cromossomos X de cada mulher e da menina. As seqncias de bases do referido trecho gnico esto esquematizadas adiante:

Os dados obtidos: a) so suficientes para excluir a possibilidade de qualquer uma das mulheres ser a me da menina. b) so suficientes para excluir a possibilidade de uma das mulheres ser a me da menina. c) no so suficientes, pois o cromossomo X da menina analisado pode ser o de origem paterna. d) no so suficientes, pois a menina recebe seus dois cromossomos X da me e apenas um deles foi analisado. e) no podem ser considerados, pois uma menina no recebe cromossomo X de sua me. 441. Cesgranrio-RJ Em uma espcie animal, cujo 2n = 6, o caritipo de clulas somticas de machos e fmeas apresenta-se como mostram os desenhos a seguir:

A anlise desses caritipos revela que, nessa espcie, a determinao do sexo feita por um sistema em que o macho e a fmea so, respectivamente: a) XY e XX b) Y0 e XX c) X0 e XX d) XY e X0 e) X0 e XY 442. Cesgranrio-RJ Assinale a opo que contm as frmulas cromossmicas de indivduos masculinos, diplides, na seguinte ordem: homem drosfila ave.

Homem a) b) c) d) e) 2A + XX 2A + XY 2A + XY 2A + ZZ 2A + XX

Drosfila 2A + XX 2Z + ZW 2A + XY 2A + X 2A + XY

Ave 2A + ZW 2A + Y 2A + ZZ 2A + XX 2A + ZW

443. UFRJ No gado bovino da raa Ayrshire, a cor mogno determinada pelo gentipo A1A1 e a cor vermelha, pelo gentipo A2A2, mas o gentipo A1A2 mogno nos machos e vermelho nas fmeas. Com base nessas informaes, qual o sexo de um filhote vermelho cuja me uma vaca mogno? Justifique sua resposta. 444. UFMG A figura a seguir se refere a determinao do sexo em algumas espcies de tartarugas e lagartos.

446. Vunesp Na dcada de 40, descobriu-se que algumas clulas retiradas de mulheres apresentavam, no ncleo interfsico, um pequeno corpsculo de cromatina intensamente corado. Esse corpsculo conhecido hoje como cromatina sexual ou corpsculo de Barr. a) A que corresponde tal corpsculo e em que tipo de clulas (somticas ou germinativas) ele aparece? b) Qual a sua importncia e por que ele no ocorre nas clulas masculinas? 447. Cesgranrio-RJ A cromatina sexual aparece, microscopia ptica, como uma massa densa colada ao envoltrio nuclear de clulas em intrfase. Nos esquemas a seguir esto diagramados padres de cromatina sexual (1, 2, 3) e de caritipos (4, 5 e 6). Quais as correlaes corretas?

a) b) c) d) e) Com base nessa figura, pode-se afirmar que: a) a determinao do sexo nesses animais independente da localizao dos ovos no ninho e da poca da postura. b) a determinao do sexo sob controle de temperatura pode ser til em condies de manejo de espcies em extino. c) indivduos de sexo indeterminado, em tartarugas, so produzidos em temperaturas abaixo de 28 C. d) temperaturas maiores que 28 C produzem fmeas tanto em tartarugas quanto em lagartos. e) machos so produzidos em baixas temperaturas tanto para tartarugas quanto para lagartos. 445. PUC-MG A cromatina sexual compreende: a) o citoplasma de clulas gamticas masculinas que se apresentam mais coradas que as femininas. b) o citoplasma de clulas gamticas femininas que se apresentam mais coradas que as masculinas. c) cromossomo Y condensado em ncleos de hemcias humanas. d) um dos cromossomos X da mulher, que permanece condensado no ncleo das clulas, facilmente visualizado na mucosa oral. e) cromossomos X e Y condensados durante o perodo da intrfase.

24 e 15 15 e 36 24 e 36 14 e 25 35 e 16

448. Vunesp A anlise dos ncleos interfsicos de clulas da mucosa oral de uma mulher, fenotipicamente normal, revelou a existncia de duas cromtides sexuais em todos eles. Responda s questes abaixo. a) Quantos cromossomos X tem essa mulher? b) Se ela se casar com um homem normal, qual a probabilidade de ter uma filha com constituio cromossmica igual sua? 449. FAAP-SP Leia com ateno a tirinha a seguir. Calvin by Watterson

PV2D-07-BIO-24

Segundo a tirinha, a amiga do Calvin tem dois cromossomos X. Com base neste dado, podemos concluir que:
123

a) a amiga de Calvin mutante, por isso hostil. b) um cromossomo X da amiga do Calvin ativo e o outro chamado de cromatina sexual. c) a heterocromatina ocorre no Calvin, pois ele XY. d) os dois cromossomos X de que o Calvin fala da cobra que quer com-lo. e) no h cromatina sexual em meninas. 450. UFRGS-RS Muitas vezes, durante a realizao de eventos esportivos, realizada a determinao do sexo gentico. Esse exame feito pela observao dos cromossomos de clulas epiteliais. Pode-se afirmar que nesse exame: a) mulheres normais deveriam apresentar uma estrutura chamada corpsculo de Barr, que corresponde a um dos cromossomos X. b) homens normais deveriam apresentar uma estrutura chamada corpsculo de Barr, que corresponde ao cromossomo Y. c) mulheres normais deveriam apresentar duas estruturas chamadas corpsculos de Barr, que correspondem aos dois cromossomos X. d) homens normais deveriam apresentar uma estrutura chamada corpsculo de Barr, correspondente ao cromossomo X. e) mulheres normais na fase adulta no deveriam apresentar corpsculo de Barr. 451. PUC-SP Uma mulher triplo-X frtil e produz vulos normais e vulos com dois cromossomos X. Sendo casada com um homem cromossomicamente normal, essa mulher ter chance de apresentar: a) apenas descendentes cromossomicamente normais. b) apenas descendentes cromossomicamente anormais. c) 50% dos descendentes cromossomicamente normais e 50% cromossomicamente anormais. d) 25% dos descendentes cromossomicamente normais e 75% cromossomicamente anormais. e) 75% dos descendentes cromossomicamente normais e 25% cromossomicamente anormais. 452. Vunesp Os quadrados a seguir representam, em esquema, clulas de seis indivduos, numerados de 1 a 6, com a indicao do nmero de cromossomos sexuais (X e Y) presentes em cada uma delas.

Est(o) correta(s) a(s) afirmao(es): a) I, apenas. b) II, apenas. c) I e II, apenas. d) I e III, apenas. e) II e III, apenas. 453. UFRGS-RS As abelhas constituem exemplo de himenpteros sociais cujas fmeas monogamticas pem, em clulas distintas dos favos, ovos fecundados e ovos no-fecundados (vulos). Estes ltimos: a) so estreis, no se desenvolvendo. b) se desenvolvem em larvas estreis, origem das operrias. c) possuem o cromossomo sexual Y. d) se desenvolvem, por partenognese, nos machos (zanges). e) do origem s rainhas haplides, novamente monogamticas. 454. Unicamp-SP As abelhas vivem em colnias constitudas por indivduos de trs castas: a rainha, os zanges e as operrias. Sabendo-se que as fmeas frteis de Apis mellifera tm 32 cromossomos, indique o nmero cromossmico dos indivduos de cada uma das castas e descreva como ocorre a diferenciao em castas nesses insetos. 455. A figura a seguir mostra esquematicamente o tipo de reproduo em abelhas do gnero Apis.
Rainha (fmea frtil diplide) Zango (macho frtil haplide)

MEIOSE vulos (n)

Espermatozide FECUNDAO Zigoto (2n)

Em relao a estes indivduos e s clulas representadas, foram feitas as afirmaes seguintes. I. Os indivduos 3, 5 e 6 so normais e pertencem espcie humana. II. A clula do indivduo 2 pode ser igual de um gameta do indivduo 1. III. A clula 4 (22A + X) pode ser um gameta de um indivduo do sexo masculino ou do sexo feminino.
124

Sobre o esquema, assinale a alternativa correta. a) Os zanges so clones perfeitos da abelha rainha, uma vez que no houve a fecundao dos vulos que os originaram. b) Os zanges so produzidos pelo processo denominado partenognese.

Zango

Operria (fmea estril diplide)

Rainha

c) Os zanges diplides (2n) so produzidos sem que haja fecundao. d) Os zanges so haplides (n) pelo fato de serem originados do vulo das operrias. e) As operrias so estreis devido ao fato de a espermatognese nos zanges produzir, atravs da meiose, gametas com um nmero de cromossomos 4 (quatro) vezes menor. 456. UFRJ Durante o processo de meiose, ocorre a recombinao gnica, isto , a troca de seqncias de DNA entre cromossomos homlogos. Identifique o cromossomo humano que sofre menos recombinao. Justifique sua resposta. 457. UFF-RJ Alguns mtodos em desenvolvimento podero permitir aos pais a escolha do sexo de seus futuros filhos. Dentre eles, alguns se baseiam em executar a fecundao em tubo de ensaio, implantando, a seguir, o ovo fertilizado no tero da me. Dentre as opes abaixo, os gametas que precisam ser necessariamente identificados e separados para uso no processo de fecundao, caso os pais desejem um filho do sexo feminino, so: a) espermatcitos secundrios diplides portando os cromossomos X e Y. b) ocitos primrios diplides portando os cromossomos Y. c) espermatozides derivados de espermtides portando o cromossomo X. d) vulos haplides portando o cromossomo Y. e) oognias portando o cromossomo X e espermatognias portando o cromossomo Y. 458. UFRJ Certos tipos de cncer, em especial aqueles ligados s clulas do sangue, so tratados com transplantes de medula ssea. Nesses transplantes, uma parte da medula ssea de um doador sadio introduzida na medula ssea de um paciente cujas clulas sangneas foram previamente eliminadas com o auxlio de drogas ou de radiao. Aps o transplante de medula, possvel identificar os cromossomos de clulas de diversos rgos e tecidos. A tabela a seguir mostra os resultados da classificao dos cromossomos de 4 tecidos de um paciente submetido a transplante de medula. Tipo celular Epitlio intestinal Linfcitos B
PV2D-07-BIO-24

459. UFU-MG O diagrama a seguir est dividido em 3 segmentos (I, II e III), os quais contm conceitos relacionados aos diferentes sistemas de determinao do sexo.

Adaptado de: AMABIS, J.M e MARTHO, G.R. Conceitos de Biologia. So Paulo: Moderna, 2001.

Com relao a esses segmentos, pode-se afirmar que: a) I e III esto corretos. c) II e III esto corretos. b) I e II esto corretos. d) Apenas I est correto. 460. Na espcie humana, a determinao do sexo feita pelo sistema XY de cromossomo; em alguns insetos, pelo sistema XO e, em outros, pelo sistema haplodiplide, observando-se a partenognese. a) O que significa sexo homogamtico e heterogamtico? Os besouros esto inseridos no sistema XO. Qual dos dois sexos o homogamtico? Justifique. b) Em relao s abelhas (Apis mellfera), podemos falar em sexo homo e heterogamtico? Justifique. 461. UFSM-RS Considere as afirmaes. I. Em humanos, a determinao do sexo cromossmico do zigoto (XX ou XY) depende do gameta masculino que fecunda o vulo. II. Em mamferos, as fmeas possuem apenas um cromossomo X e os machos, dois. III. Em mamferos, nas clulas somticas de fmeas normais, possvel observar o cromossomo X que foi inativado, pois este corresponde ao corpsculo de Barr ou cromatina sexual. Est(o) correta(s): a) apenas I. d) apenas I e II. b) apenas II. e) apenas I e III. c) apenas III.
125

Caritipo 46, XY 46, XX 46, XY 46, XX

Msculo liso Macrfagos

Com base nesses resultados, identifique o sexo do paciente e o sexo do doador. Justifique sua resposta.

462. UFRJ Na espcie humana, existe um gene raro que causa a displasia ectodrmica anidrtica, que uma anomalia caracterizada pela ausncia das glndulas sudorparas. Esse gene se localiza no cromossomo sexual X. Algumas mulheres, portadoras desse gene em heterozigose, ficam com a pele toda manchada, formando um mosaico de manchas claras e escuras, quando se passa um corante sobre a pele.

465. UERJ Em uma experincia de fecundao in vitro, 4 vulos humanos, quando incubados com 4 suspenses de espermatozides, todos igualmente viveis, geraram 4 embries, de acordo com a tabela abaixo.
vulo 1 2 3 4 Embrio formado E1 E2 E3 E4 N total de espermatozides 500.000 100.000 400.000 250.000 No de espermatozides portando cromossomo X 500.000 25.000 100.000 125.000

Observe os grficos:

a) Explique a formao dessas manchas do ponto de vista gentico. b) Por que esse mosaico no pode aparecer em um homem? 463. Vunesp Uma revista publicou uma reportagem com o ttulo Atleta com anomalia gentica faz operao para definir seu sexo e pode competir na classe feminina de jud. A matria dizia, ainda, que a jovem era um caso de pseudo-hermafroditismo, pois apresentava rgos sexuais internos masculinos e rgos sexuais externos femininos. Os testculos da atleta foram extirpados para que ela pudesse competir na equipe feminina de jud. a) Que vantagem a atleta levaria sobre as demais competidoras, se tivesse os testculos durante a competio? b) Sabendo-se que ela foi considerada do sexo feminino, que testes citogenticos voc faria para comprovar essa afirmao? 464. Vunesp Em abelhas, a cor dos olhos condicionada por uma srie de alelos mltiplos, constituda por cinco alelos, com a seguinte relao de dominncia: marrom > prola > neve > creme > amarelo. Uma rainha de olho marrom, porm heterozigota para prola, produziu 600 ovos e foi inseminada artificialmente por espermatozides que portavam, em propores iguais, os cinco alelos. Somente 40% dos ovos dessa rainha foram fertilizados e toda a descendncia teve a mesma oportunidade de sobrevivncia. Em abelhas, existe um processo denominado partenognese. a) O que partenognese? Em abelhas, que descendncia resulta deste processo? b) Na inseminao realizada, qual o nmero esperado de machos e fmeas na descendncia? Dos machos esperados, quantos tero o olho de cor marrom?
126

Considerando a experincia descrita, o grfico que indica as probabilidades de os 4 embries serem do sexo masculino o de nmero: a) 1 c) 3 b) 2 d) 4 466. UFRJ O governo de uma sociedade totalitria decidiu conter a expanso demogrfica reduzindo a proporo de homens na populao. Com esse objetivo, foi ento promulgada uma lei segundo a qual todas as mulheres que tivessem um filho homem no mais poderiam ter filhos. As demais mulheres poderiam continuar a ter filhos at que tivessem um filho homem. Essa lei atingir o objetivo desejado depois de algumas geraes? Justifique sua resposta. 467. Vunesp Anomalias recessivas ligadas ao cromossomo X: a) ocorrem mais freqentemente em homens do que em mulheres. b) nunca se manifestam em mulheres. c) so herdadas por homens que tm pai afetado por elas. d) ocorrem com a mesma freqncia em homens e em mulheres. e) s ocorrem em mulheres.

468. UEBA Um gene recessivo, localizado no cromossomo X, ser transmitido pelas mulheres heterozigotas: a) a todos os seus filhos, de ambos os sexos. b) a um quarto de seus filhos, de ambos os sexos. c) metade de seus filhos, de ambos os sexos. d) somente aos filhos do sexo masculino. e) somente s filhas. 469. PUCCamp-SP Um homem tem av materna e pai com viso normal e av materno e me com daltonismo. Assinale a alternativa correta quanto aos gentipos do homem e de seus avs maternos. a) Homem XdY, Av XDXd, Av XdY b) Homem XDY, Av XDXd, Av XdY c) Homem XdY, Av XDXd, Av XDY d) Homem XDY, Av XDXd, Av XDY e) Homem XdY, Av XdXd, Av XdY 470. PUC-SP O esquema a seguir representa a genealogia de uma famlia.

473. Fuvest-SP Com relao espcie humana, responda ao que se pede. a) Por que o pai quem determina o sexo da prole? b) Por que os filhos homens de pai hemoflico nunca herdam essa caracterstica do pai? 474. Acafe-SC Na espcie humana, a hemofilia uma anomalia condicionada por um gene recessivo ligado ao sexo (cromossomos sexuais). Um casal normal tem uma criana hemoflica. A partir desses dados, assinale a afirmativa incorreta. a) A criana do sexo masculino. b) O gene para hemofilia est ligado ao cromossomo X e Y. c) A me portadora do gene para hemofilia. d) Uma filha do casal poder ser portadora. e) Uma filha do casal poder ser homozigota para a normalidade. 475. UFRGS-RS Andr e Maria apresentam coagulao sangnea normal. O pai de Maria hemoflico. Andr e Maria se casam . Eles tm medo de ter filhos hemoflicos e procuram um servio de aconselhamento gentico. A orientao correta a ser dada ao casal que: a) no h risco de o casal ter filhos hemoflicos, j que os pais so normais. b) a probabilidade de nascer uma criana hemoflica de 25%. c) a probabilidade de nascer uma criana hemoflica de 50%. d) a probabilidade de nascer uma menina hemoflica de 50%. e) o casal no deve ter filhos porque todos sero hemoflicos ou portadores do gene para hemoflia. 476. Unicamp-SP Uma mulher deu luz um menino com hemofilia. Como nenhum de seus parentes prximos era hemoflico, ela sups que o problema teria surgido porque o pai da criana trabalhava em uma usina nuclear e teria ficado exposto a radiaes que alteraram seu material gentico. A mulher tem razo? Justifique. 477. Mackenzie-SP No heredograma exposto, o indivduo assinalado hemoflico e os demais tm coagulao normal. Qual a probabilidade de o casal 6 x 7 ter um menino hemoflico?

Os gentipos dos indivduos I, II e III so, respectivamente: a) XDY, XDY, XDXd. b) XYD, XX, XYD. c) XDYD, XDXd, XDYd. d) Dd, DD, Dd. e) Dd, Dd, DD. 471. Uma mulher daltnica casou-se com um homem normal. Qual a probabilidade de terem filhos homens normais? a) 1/2 d) 1 b) 1/4 e) 0 c) 1/8 472. FMT-SP Um homem normal, cujo pai era daltnico, casa-se com mulher normal, cujo pai normal e a me daltnica. Qual a probabilidade de este casal ter um descendente afetado? a) 1/2 (50%) b) nula c) 1/4 (25%) d) 1/8 (12,5%)

PV2D-07-BIO-24

127

478. Fuvest-SP Um casal de no hemoflicos tem um filho com hemofilia. a) Qual a probabilidade de que uma filha desse casal apresente a doena? b) Qual a probabilidade de que um outro filho desse casal seja tambm hemoflico? Justifique suas respostas. 479. FCMSC-SP Considere o seguinte esquema dos cromossomos sexuais humanos:

483. PUC-SP Numa certa espcie de pssaros, o gene A condiciona plumagem preta uniforme, enquanto que seu alelo A1 condiciona a plumagem amarela uniforme. Os heterozigotos (AA1) apresentam plumagem cinzenta uniforme. Sabendo-se que o carter em questo ligado ao sexo e que nas aves o sexo heterogamtico o feminino, espera-se que o cruzamento entre um macho amarelo e uma fmea preta produza: a) somente descendentes Y pretos. b) somente descendentes Y amarelos. c) somente descendentes X cinzentas. d) Y cinzentos e X amarelas. e) Y pretos e X amarelas. 484. UFPA Em gatos, o carter cor da pelagem condicionado por genes ligados ao cromossomo X, no havendo dominncia. O gene A condiciona a cor amarela e o gene P a cor preta, sendo o heterozigoto listrado. Uma fmea amarela, cruzada com um macho, deu origem a fmeas listradas e machos amarelos. Qual a cor do macho? a) Amarelo b) Preto c) Listrado d) Amarelo ou preto indiferentemente e) Impossvel saber s com estes dados 485. Vunesp Na genealogia a seguir, o indivduo II-1 e seus filhos III-1, III-3 e III-4 tm uma malformao determinada por um gene dominante.

Os genes que determinam daltonismo e hemofilia devem estar situados: a) apenas no segmento I. b) nos segmentos I e II, respectivamente. c) nos segmentos II e I, respectivamente. d) apenas no segmento II. e) nos segmentos I e II, indiferentemente. 480. Fatec-SP A hipertricose auricular uma anomalia gentica condicionada por um gene localizado no cromossomo Y. Um homem com hipertricose casa-se, e todos os seus filhos so homens. Na prxima gerao dessa famlia esse gene se manifestar: a) em todas as mulheres. b) em todos os homens. c) em 50 % das mulheres e 50% dos homens. d) somente nas mulheres heterozigotas. e) somente nos homens heterozigotos. 481. O heredograma a seguir apresenta uma famlia em que os indivduos marcados apresentam calvcie. Quais os possveis gentipos dos indivduos?

Em relao a esse gene, pode-se dizer, com certeza, que: a) est localizado no cromossomo X. b) trata-se de um gene holndrico. c) trata-se de um gene letal. d) est localizado num autossomo. e) trata-se de um gene influenciado pelo sexo. 486. FESP-PE Qual a proporo entre filhos do sexo masculino e sexo feminino de um casal no qual a mulher heterozigota para um gene letal ligado ao sexo? a) 1 menino : 1 menina b) 1 menino : 2 meninas c) 2 meninos : 1 menina d) 1 menino : 3 meninas e) 3 meninos : 2 meninas

482. Unicamp-SP Considerando que, em aves, o sexo heterogamtico o feminino, qual a proporo entre machos e fmeas que se espera na descendncia de um macho portador de gene letal (embrionariamente), recessivo e ligado ao sexo?
128

487. UECE Um casal apresenta a seguinte constituio gentica: o marido albino e normal para o daltonismo e a mulher heterozigota para os dois loci. A probabilidade de nascer, deste casal, um filho do sexo masculino, de fentipo completamente normal, : a) 100% c) 37,5% b) 12,5% d) nula 488. Algumas doenas so transmitidas de pai para filho (sexo masculino) em 100% dos casos em que o pai apresenta a doena. O curioso que tal fato independe do gentipo da me. Elabore uma justificativa plausvel para este fato. 489. Unirio-RJ Quanto aos cromossomos sexuais X e Y, podemos afirmar que: a) como no so completamente homlogos, no pareiam na meiose. b) como so completamente homlogos, pareiam na meiose. c) se pareiam na meiose, pois possuem uma regio homloga. d) no se pareiam na meiose, pois possuem uma regio no-homloga. e) os genes que se encontram na regio no-homloga do X condicionam um tipo de herana chamada herana restrita ao sexo. 490. UFSCar-SP Em drosfila, o carter cerdas retorcidas determinado por um gene recessivo e ligado ao sexo. O alelo dominante determina cerdas normais (no retorcidas). Uma fmea heterozigota foi cruzada com um macho normal. A descendncia esperada ser de: a) 50% de machos e 50% de fmeas normais e 50% de machos e 50% de fmeas com cerdas retorcidas. b) 50% de machos normais, 50% de machos com cerdas retorcidas e 100% de fmeas normais. c) 100% de machos normais, 50% de fmeas com cerdas retorcidas e 50% de fmeas normais. d) 100% de machos com cerdas retorcidas e 100% de fmeas normais. e) 100% de machos normais e 100% de fmeas com cerdas retorcidas. 491. Vunesp Considere o heredograma, que representa uma famlia portadora de carter recessivo condicionado por um gene situado em um dos cromossomos sexuais.

A respeito dessa genealogia, podemos afirmar que: a) a mulher 2 homozigota. b) as filhas do casal 3 4 so, certamente, portadoras do gene. c) as mulheres 2 e 3 so, certamente, portadoras do gene. d) todas as filhas do casal 1 2 so portadoras do gene. e) os homens 1 e 4 so, certamente, portadores do gene. 492. UFMG modificado Na espcie humana, o daltonismo condicionado por um gene recessivo e ligado ao sexo. Um casal de viso normal tem uma criana daltnica. A partir desses dados, responda s questes a seguir. a) Qual o sexo da criana? b) Justifique. c) Qual a probabilidade de o casal ter outra criana daltnica? 493. PUC-SP Na genealogia abaixo, os indivduos 1, 4 e 6 tm viso normal, enquanto os 2 e 3 so daltnicos:

Sabendo-se que o gene para o daltonismo recessivo e localizado no cromossomo X, responda s questes propostas. a) Qual o fentipo do indivduo 5 para o referido carter? b) Que tipos de descendentes o casal 5 e 6 poder ter em relao a esse carter? (D os gentipos e os fentipos dos descendentes.) 494. Uma mulher com viso normal perguntou ao mdico se o seu filho poderia ser daltnico. O mdico obteve as seguintes informaes: um dos irmos da mulher daltnico; seus pais so normais; e o marido normal. O mdico, ento, respondeu: a) O seu filho, qualquer que seja o sexo, certamente no ser daltnico. b) de 25% a probabilidade de seu filho, sendo do sexo masculino, ser daltnico. c) de 50% a probabilidade de seu filho, sendo do sexo masculino, ser daltnico. d) de 75% a probabilidade de seu filho, sendo do sexo masculino, ser daltnico. e) de 75% a probabilidade de seu filho, sendo do sexo feminino, ser normal. 495. Fuvest-SP Um operrio de uma indstria qumica que utiliza substncias txicas teve um filho do sexo masculino afetado por hemofilia. Essa doena resulta da dificuldade de coagulao do sangue e determinada por um gene recessivo do cromossomo X. A empresa poderia ser responsabilizada por essa doena gentica do filho? Justifique.
129

PV2D-07-BIO-24

496. UFRJ Uma das primeiras experincias de terapia gentica foi realizada com indivduos hemoflicos cujo gene para o fator VIII de coagulao era defeituoso. Na terapia, foram retiradas clulas da pele do paciente. Essas clulas receberam cpias do gene normal para o fator VIII e foram posteriormente reintroduzidas no indivduo. Os resultados mostraram um aumento significativo na produo do fator VIII nos indivduos tratados. Supondo que o indivduo tratado venha a ter filhos com uma mulher cujos genes para o fator VIII sejam defeituosos, existe possibilidade de nascimento de uma criana no hemoflica? Justifique sua resposta. 497. Fuvest-SP A rvore representada a seguir refere-se herana da hemofilia. Com referncia pessoa indicada pelo n 4 do heredograma a seguir, incorreto afirmar que:

499. Assinale C (certo) e E (errado). ( ) O homem herda seu cromossomo X sempre da me. ( ) A mulher recebe um cromossomo X do pai e poder transmiti-lo aos filhos, que podero apresentar as caractersticas ligadas ao sexo presentes no av. ( ) A me de um hemoflico ou de um daltnico tem 50% de chance de ser portadora do gene para a doena. ( ) Uma caracterstica ligada ao sexo presente em um menino foi obrigatoriamente recebida do seu pai. ( ) O pai de uma mulher daltnica obrigatoriamente daltnico. 500. UFSC A hemofilia uma doena hereditria em que h um retardo no tempo de coagulao do sangue e decorre do no-funcionamento de um dos fatores bioqumicos de coagulao. Com relao a essa doena, assinale a(s) proposio(es) correta(s). 01. No possvel a existncia de mulheres hemoflicas. 02. condicionada por um gene que se localiza no cromossomo X, em uma regio sem homologia no cromossomo Y. 04. Entre as mulheres, possvel encontrar um mximo de trs fentipos e dois gentipos. 08. Entre os homens, possvel ocorrer apenas um gentipo; por isso, h maior incidncia dessa doena entre eles. 16. Entre os descendentes de um homem hemoflico e de uma mulher normal, no portadora, esperase que 50% deles sejam normais e 50% sejam hemoflicos. 32. um exemplo de herana ligada ao sexo, em que os indivduos afetados tm graves hemorragias, mesmo no caso de pequenos ferimentos. 501. UFV-MG A hipertricose na orelha condicionada por gene holndrico, localizado na parte no-homloga do cromossomo Y. Um homem com hipertricose casa-se com uma mulher normal, filha de um homem com hipertricose. Se o casal tem filhos de ambos os sexos, qual a probabilidade de o carter ser transmitido para: a) o primeiro filho; b) a primeira filha. 502. Um homem calvo, filho de pai no-calvo, casa-se com uma mulher no-calva cujo pai era calvo homozigoto. Qual a probabilidade de o casal ter um menino que futuramente seja calvo? a) 3/4 d) 3/8 b) 1/2 e) 1/4 c) 1/8

a) obrigatoriamente portadora de um gene para a hemofilia. b) o seu gene para hemofilia proveio da me. c) podemos concluir, pela sua descendncia, que um dos seus cromossomos X no traz o gene para hemofilia. d) doou um cromossomo com gene para hemofilia ao no 9. e) no poder, com o homem no 3, ter filhas hemoflicas. 498. Fuvest-SP No heredograma abaixo, ocorrem dois meninos hemoflicos. A hemofilia tem herana recessiva ligada ao cromossomo X.

a) Qual a probabilidade de que uma segunda criana de II-4 e II-5 seja afetada? b) Qual a probabilidade de II-2 ser portadora do alelo que causa a hemofilia? c) Se o av materno de II-4 era afetado, qual era o fentipo da av materna? Justifique sua resposta.
130

503. UECE A calvcie uma caracterstica influenciada pelo sexo, e o gene que a condiciona se comporta como recessivo no sexo feminino e dominante no sexo masculino. Observe a genealogia a seguir, relativa a essa caracterstica.

d) determinada por um gene recessivo ligado ao sexo. e) determinada por um gene do cromossomo Y. 507. UFPI O diagrama a seguir mostra a surdez em trs geraes de uma famlia. Um crculo preto representa uma mulher surda e um crculo branco representa uma mulher normal. Um quadrado preto representa um homem surdo e um quadrado branco, um homem normal.

A probabilidade de o casal 3 x 4 ter o primeiro filho homem e que venha a ser calvo : a) 1/2 c) 1/8 b) 1/4 d) 1/6 504. Fuvest-SP Sabe-se que, em galinceos, fmeas (ZW) que puseram ovos durante certo perodo de suas vidas podem no s sofrer uma reverso das caractersticas sexuais secundrias, mas tambm desenvolver testculos e produzir espermatozides. Um alelo B dominante, ligado ao sexo, condiciona penas listradas e seu alelo b condiciona penas no listradas. Uma fmea listrada que sofreu reverso de sexo foi cruzada com uma fmea normal no listrada. A proporo de fentipos esperada na descendncia de: a) 1/2 fmeas no listradas : 1/2 fmeas listradas. b) 1/2 fmeas no listradas : 1/2 machos listrados. c) 1/4 machos listrados : 3/4 fmeas no listradas. d) 1/4 machos listrados : 1/4 machos no listrados : 1/4 fmeas listradas : 1/4 fmeas no listradas. e) 1/3 machos listrados : 1/3 machos no listrados : 1/3 fmeas no listradas. 505. UFSC Nas aves, as fmeas constituem o sexo heterogamtico ZW, e os machos, o sexo homogamtico ZZ. O gene B, que determina plumagem colorida, dominante sobre o b, que determina plumagem branca. Tais genes ligam-se ao cromossomo Z. Assim sendo, pergunta-se: do cruzamento entre fmeas coloridas e machos brancos, qual a porcentagem esperada de fmeas coloridas? 506. A hipofosfatemia com raquitismo, resistente vitamina D, uma anomalia hereditria. Na prole de homens afetados com mulheres normais, todas as meninas so afetadas e todos os meninos normais. correto concluir que a anomalia em questo : a) determinada por um gene dominante autossmico. b) determinada por um gene dominante ligado ao sexo. c) determinada por um gene recessivo autossmico.

A condio de surdez mostrada no heredograma herdada como caracterstica: a) autossmica dominante. b) autossmica recessiva. c) dominante ligada ao sexo. d) recessiva ligada ao sexo. e) holndrica. 508. PUC-SP A genealogia a seguir mostra um carter dominante ligado ao sexo em uma famlia:

O casal I II procurou um servio de aconselhamento gentico, desejando saber se ter, obrigatoriamente, todos os seus descendentes com o referido carter. Qual seria sua resposta para o casal? Sim ou no? Justifique. 509. PUC-SP No filme O leo de Lorenzo, o personagem principal apresenta uma anomalia neurolgica determinada por um gene, que transmitido pelas mes a crianas do sexo masculino. As mes, embora portadoras do gene, no apresentam a doena. a) Em que cromossomo est localizado o referido gene? Esse gene dominante ou recessivo? Justifique sua resposta. b) Cite duas outras anomalias da espcie humana que tenham esse mesmo modo de transmisso. 510. Fuvest-SP Uma mulher portadora de um gene letal ligado ao sexo, que causa aborto espontneo. Supondo que quinze de suas gestaes se completem, qual o nmero esperado para crianas do sexo masculino entre as que nascerem? Justifique sua resposta.
131

PV2D-07-BIO-24

511. FCC-SP Uma mulher normal, filha de me daltnica e pai hemoflico, casada com um homem normal e tem um filho com daltonismo e hemofilia. Sabendo-se que os genes para hemofilia e daltonismo esto localizados no cromossomo X, a presena dessas anomalias no filho pode ser explicada pela ocorrncia de: a) epistasia dominante. b) epistasia recessiva. c) recombinao gnica. d) segregao independente. e) pleiotropia. 512. PUC-SP Um casal normal para a viso das cores e para a coagulao tem uma filha normal e um filho daltnico e hemoflico. Sendo os dois caracteres recessivos e ligados ao sexo, pode-se afirmar corretamente que: a) tanto o pai quanto a me so portadores dos dois genes recessivos. b) apenas o pai portador dos dois genes recessivos. c) apenas a me portadora dos dois genes recessivos. d) o pai portador do gene para o daltonismo e a me portadora do gene para a hemoflia. e) o pai portador do gene para a hemoflia e a me portadora do gene para o daltonismo. 513. Vunesp Os genes para o daltonismo e a hemofilia so recessivos e esto ligados ao sexo. Um casal de fentipo normal tem um filho hemoflico, um filho daltnico e duas filhas normais, para ambos os caracteres. A probabilidade de este casal vir a ter um filho daltnico e hemoflico: a) nula, considerando-se que os pais so normais. b) depender da ocorrncia de permuta na formao de gametas maternos. c) depender da ocorrncia de permuta na formao de gametas paternos. d) ser muito grande, pois a me portadora de genes recessivos. e) depender da ocorrncia da mutao gnica nos gametas paternos. 514. PUC-SP Uma mulher normal, filha de pai daltnico, casa-se com um homem de viso normal cujo pai era hemoflico. Se tanto o daltonismo quanto a hemofilia so caractersticas condicionadas ao sexo, esse casal tem a probabilidade de gerar: a) 100% dos filhos homens daltnicos e hemoflicos. b) 50% dos filhos homens daltnicos e 50% hemoflicos. c) 100% dos filhos homens daltnicos. d) 100% das filhas mulheres normais. e) 100% dos filhos homens hemoflicos e 100% das filhas mulheres daltnicas.
132

515. UFRJ Popularmente se diz que os filhos homens saem parecidos com a me e as filhas mulheres, com o pai. Apesar dessa afirmao no poder ser generalizada, existem situaes em que isto pode ocorrer. Lembrando que certas caractersticas so controladas por genes localizados no cromossomo sexual X, descreva a situao (gentipos e fentipos, paterno e materno, com os respectivos filhos e filhas) em que o dito popular tem base no mecanismo da hereditariedade. 516. FAAP-SP Na espcie humana, a determinao sexual feita por um par de cromossomos, X e Y. O indivduo do sexo feminino apresenta dois cromossomos X, enquanto o indivduo de sexo masculino apresenta um cromossomo X e outro cromossomo Y. Com base neste texto, incorreto afirmar: a) O sexo masculino heterogamtico e sempre o homem quem determina o sexo dos filhos. b) O sexo feminino homogamtico e o gameta feminino normal sempre apresenta um cromossomo X. c) Na mulher, um cromossomo X est sempre condensado e recebe o nome de cromatina sexual. d) A hipertricose auricular uma caracterstica restrita ao sexo masculino, pois o gene est localizado no cromossomo Y. e) Toda doena hereditria e recessiva ligada ao cromossomo X s afeta as mulheres. 517. UFF-RJ Cerca de 8% dos homens e 0,04% das mulheres apresentam incapacidade de distinguir determinadas cores (daltonismo). No tipo mais comum de daltonismo, os indivduos no fazem distino entre as cores verde e vermelha. Esse tipo de daltonismo conseqncia da presena de um gene recessivo (d) localizado no cromossomo X. Com relao ao daltonismo, responda ao que se pede. a) Qual o fentipo esperado para uma mulher com gentipo XD Xd? b) Como se explica o fato de algumas mulheres heterozigotas apresentarem viso normal em um dos olhos e daltonismo no outro? 518. UFPR No homem, o gene (h) para hemoflia est localizado no cromossomo X e recessivo em relao ao gene (h+) para coagulao normal do sangue. Com base nessa informao, correto afirmar que: 01. um homem hemoflico casado com uma mulher homozigota normal ter 50% de seus filhos afetados, independentemente do sexo. 02. uma mulher filha de um indivduo hemoflico certamente ser hemoflica. 04. um homem hemoflico casado com uma mulher homozigota normal ter todos os filhos normais, independentemente do sexo. 08. um homem hemoflico teve uma filha normal. A probabilidade de esta mulher ter uma criana do sexo masculino e hemoflica igual a 1/4. Some os nmeros dos itens corretos.

519. Cesgranrio-RJ Tem sido verificado que aproximadamente 25% dos casos de hemoflia A em meninos so decorrentes de mutaes novas, isto , a doena se manifesta em meninos que no tm histria familiar de hemofilia.
Handin R. I. Blood and practice of hematology, 1955.

Quando nos debruamos sobre a hemoflia, aprendemos que ela mais comum em homens porque: a) os homens so mais propensos doena devido influncia do hormnio testosterona. b) sendo uma herana ligada ao sexo, nos homens suficiente apenas um alelo para que a doena se manifeste. c) mulheres hemoflicas precisam de dois alelos dominantes, ao passo que os homens s necessitam de um alelo. d) mulheres hemoflicas morrem nos primeiros sangramentos menstruais. e) causada por um alelo tpico do cromossomo Y, que masculinizante. 520. UFU-MG Na espcie humana, a distrofia muscular de Duchenne uma doena condicionada por um gene recessivo localizado no cromossomo X, que acarreta degenerao e atrofia dos msculos. Os homens afetados comeam a apresentar os sintomas na primeira infncia e no se reproduzem porque morrem antes de atingir o perodo reprodutivo. Analise as afirmativas abaixo. I. A distrofia muscular de Duchenne uma doena que ocorre quase que exclusivamente em meninos. II. Devido inativao ao acaso de um cromossomo X, que ocorre nas clulas das fmeas dos mamferos (hiptese de Lyon), as mulheres heterozigotas para o gene da distrofia muscular de Duchenne podem apresentar graduaes da caracterstica. III. A distrofia muscular de Duchenne uma doena que ocorre exclusivamente no sexo masculino. Est(o) correta(s): a) apenas a afirmativa III. b) as afirmativas I e III. c) as afirmativas II e III. d) as afirmativas I e II. 521. Mackenzie-SP Na espcie humana, o daltonismo deve-se a um gene recessivo localizado no cromossomo X, enquanto o alelo dominante condiciona viso normal para cores. A miopia condicionada por um gene autossmico recessivo e o alelo dominante condiciona viso normal. Um homem daltnico, no mope, casa-se com uma mulher no daltnica mas mope. O casal tem uma filha
PV2D-07-BIO-24

daltnica e mope. A probabilidade de esse casal ter uma criana no-daltnica e no mope de: a) 25% b) 0% c) 50% d) 100% e) 75% 522. Unifor-CE Na espcie humana, o albinismo condicionado por um gene autossmico recessivo, e a hemofilia, por um gene recessivo localizado no cromossomo sexual X. Se uma mulher, heterozigota para os dois pares de genes, casar-se com um homem albino e no hemoflico, a probabilidade de vir a ter uma criana do sexo masculino, albina e hemoflica : a) 1/2 b) 1/4 c) 1/8 d) 1/9 e) 1/16 523. Fuvest-SP Um homem afetado por uma doena gentica muito rara, de herana dominante, casa-se com uma mulher, no consangnea. Imagine que o casal tenha doze descendentes, seis filhos e seis filhas. Responda, justificando sua resposta, qual ser a proporo esperada de filhas e filhos afetados pela doena do pai, no caso de o gene em questo estar localizado: a) em um autossomo; b) no cromossomo X. 524. UFC-CE Na espcie humana, h algumas condies dominantes ligadas ao cromossomo X, embora sejam raras. A figura a seguir mostra o heredograma de um tipo de diabetes que leva a problemas no metabolismo do fosfato e dos carboidratos.

Com base no enunciado e na anlise do heredograma, responda ao que se pede. a) A me do cruzamento I homozigota ou heterozigota? Justifique. b) Quais so os provveis gentipos dos indivduos II-2, III-4 e III-5?

133

Captulo 07
525. A alterao de uma nica base nitrogenada no DNA leva necessariamente mudana na seqncia de aminocidos de um polipeptdeo? Justifique. 526. UFRN Pode-se afirmar que a mutao: a) sempre ocorre para adaptar o indivduo ao ambiente. b) aumenta a freqncia de crossing over. c) aumenta o nmero de alelos disponveis em um locus. d) sempre dominante e prejudicial ao organismo. 527. Mutaes podem ocorrer em: I. Zigotos II. vulos III. Espermatozides IV. Clulas somticas Indique aquelas que podem ser transmitidas ao descendente, ou seja, que so hereditrias. a) I, II, III, e IV. d) II e III. b) I, II e III. e) I, II e IV. c) II, III e IV. 528. Cesgranrio-RJ Pesquisa desvenda o paladar Cientistas descobriram uma protena que tem uma significativa participao na percepo do sabor. A protena recm-descoberta, batizada de gustducina, tem estrutura muito similar s protenas da retina. A estreita semelhana entre as duas protenas uma forte evidncia que sustenta a idia de que os processos evolutivos podem partir de uma nica protena primitiva e modific-la, para que cumpra uma variedade de funes.
Trechos de texto do Jornal do Brasil de 20/06/92

IV. podem ser induzidas por substncias qumicas, como as contidas no cigarro, e por radiaes, como as ultravioleta; V. um dos processos contidos na teoria darwinista. Julgue os itens anteriores. 530. UFES Um pesquisador, submetendo uma populao de moscas a diferentes doses de raio X, observou o seguinte resultado em relao ao nmero de mutao: Dose de raios X 0 20 40 60 80 100 Nmero de mutaes 3 25 38 51 74 82

Qual dos grficos a seguir apresenta o melhor resultado? a)

b)

c)

O processo que permite o surgimento de protenas modificadas, como citado no texto acima, conseqncia do seguinte fenmeno biolgico: a) convergncia adaptativa. b) deriva gentica. c) recombinao. d) analogia. e) mutao. 529. Em relao s mutaes, so feitas as seguintes afirmaes: I. podem gerar variabilidade gentica; II. ocorrem aleatoriamente, visando criao de caractersticas benficas ao organismo; III. podem ser responsveis pelo surgimento de alguns tipos de cnceres;
134

d)

e)

531. Unicamp-SP Em um segmento de DNA que codifica determinada protena, considere duas situaes: a) um nucleotdeo suprimido; b) um nucleotdeo substitudo por outro. A situao a, geralmente, mais drstica que a situao b. Explique por qu. 532. UFBA O esquema abaixo mostra cromossomos pareados na meiose, evidenciando uma alterao denominada:

535. FCC-SP Considere o seguinte esquema.

A mutao cromossmica representada chama-se: a) deleo. d) duplicao. b) inverso. e) no-disjuno. c) translocao. a) b) c) d) e) adio. inverso. deficincia. duplicao. translocao. 536. Vunesp Melancias normais apresentam 11 cromossomos em seus gametas. Melancias triplides apresentam a vantagem de serem sem sementes. Com base nestes dados, responda: qual o nmero de cromossomos nas clulas somticas de melancias triplides? 537. UFES Vegetais maiores, mais vigorosos e, por esse motivo, mais vantajosos economicamente ocorrem casualmente na natureza. Esses vegetais podem ser reproduzidos pelo homem, artificialmente, usando tcnicas de melhoramento gentico. Como exemplo, podemos citar o uso da colchicina, que induz : a) haploidia. b) inverso cromossmica. c) poliploidia. d) recombinao gnica. e) translocao cromossmica. 538. UPF-RS A fecundao dos gametas apresentados na figura vai resultar num indivduo portador de uma anormalidade cromossmica caracterizada por uma:

533. UFAL Considere o cromossomo a seguir esquematizado. Assinale a alternativa que representa esse cromossomo aps um rearranjo do tipo inverso.

a) b) c) d) e) 534. UFSE Considere o esquema abaixo.

a) euploidia. b) triploidia. c) monossomia.

d) trissomia. e) dissomia.

PV2D-07-BIO-24

A mutao cromossmica representada um caso de: a) inverso. b) trissomia. c) translocao. d) duplicao. e) deficincia.

539. Unirio-RJ A respeito das mutaes, leia as afirmaes a seguir. I. Ocorrem para adaptar o indivduo ao ambiente. II. Ocorrem em clulas sexuais e somticas. III. Podem alterar o nmero, a forma e o tamanho dos cromossomos. A(s) afirmao(es) correta(s) (so): a) somente a II. d) somente a II e a III. b) somente a I e a II. e) a I, a II e a III. c) somente a I e a III.
135

540. UFMG A identificao do fator que origina indivduos com sndrome de Down tornou-se possvel pela utilizao da tcnica de: a) contagem e identificao dos cromossomos. b) cultura de clulas e tecidos. c) mapeamento do genoma humano. d) produo de DNA recombinante. 541. PUC-SP Uma aneuploidia freqente na espcie humana a sndrome de Down, tambm chamada de mongolismo, que se caracteriza pela: a) no-disjuno de cromossomos sexuais durante a gametognese. b) ausncia de um cromossomo sexual. c) trissomia do cromossomo 21. d) monossomia do cromossomo 21. e) trissomia de um cromossomo sexual. 542. Cesgranrio-RJ O esquema a seguir representa a formao dos gametas responsveis pela produo de um indivduo com alterao do seu nmero cromossomial.

544. UFMG Analise a figura, que representa um caritipo humano.

Com base na anlise da figura, pode-se concluir que o indivduo com esse caritipo: a) apresenta cromatina sexual. b) normal e apresenta 46 cromossomos. c) portador de trissomia do cromossomo 21. d) possui fentipo feminino. e) tem alterao numrica dos autossomos. 545. Efoa-MG O caritipo a seguir pertence a:

Entre as caractersticas que este indivduo passar a apresentar, teremos: a) sexo masculino. b) caritipo normal. c) estatura elevada. d) caracteres sexuais desenvolvidos. e) ausncia de cromatina sexual. 543. UFRGS-RS Mulheres com sndrome de Turner caracterizam-se por apresentar baixa estatura, esterilidade e pescoo alado. Esta sndrome pode ser classificada como exemplo de: a) nulissomia. b) monossomia. c) trissomia. d) euploidia. e) triploidia.

a) b) c) d) e)

homem normal. mulher normal. indivduo com sndrome de Turner. indivduo com sndrome de Klinefelter. indivduo com sndrome de Down.

546. Fesp-PE Afirmativas sobre aberraes cromossmicas na espcie humana feitas abaixo. I. A sndrome de Down ou mongolismo representa um caso de trissomia. II. A sndrome de Turner representa um caso de monossomia. III. A sndrome de Klinefelter representa um caso de tetrassomia. a) Todas esto corretas. b) I e II esto corretas. c) II e III esto corretas. d) I e III esto corretas. e) Somente a I est correta.

136

547. Assinale a opo cuja representao dos caritipos est de acordo com as normas internacionais.
Homem com Mulher com Homem com Mulher sndrome de sndrome sndrome de normal Down de Down Klinefelter a) b) c) d) e) 45, XX 46, XX 46, XY 45, XX 46, XX 46, XY 47, XY + 21 47, XY + 21 44, XY 47, XX + 21 44, X 45, X 44, X 45, X 44, X 44, XXY 47, XXY 47, XXY 45, XXY 47, XXY

b) a mutao do tipo I provoca a substituio de vrios aminocidos na protena codificada pelo gene. c) a mutao do tipo I tem maior potencial para alterar a composio de aminocidos na protena codificada pelo gene. d) a mutao do tipo II altera, sempre, 100% da composio de aminocidos na protena codificada pelo gene. e) a mutao do tipo II tem maior potencial para alterar a composio de aminocidos na protena codificada pelo gene. 551. Fuvest-SP Dois cromossomos no homlogos (II e V) sofreram uma quebra cada um. No reparo desse defeito, um fragmento do cromossomo II foi ligado a um fragmento do cromossomo V e vice-versa. Esse fenmeno chamado de: a) translocao. d) trissomia. b) duplicao. e) inverso. c) permutao. 552. PUC-SP Admitindo-se que dois cromossomos no-homlogos da mesma clula sofreram, simultaneamente, uma quebra cada um, e os segmentos quebrados voltaram a se soldar, porm no mais com os mesmos segmentos a que estavam ligados antes, mas sim com segmentos trocados, fala-se em: a) duplicao. d) trissomia. b) inverso. e) crossing over. c) translocao. 553. PUC-SP Em A, esto representados dois pares de cromossomos normais com seus respectivos loci gnicos. As figuras B, C, D e E representam alteraes estruturais entre eles. Essas alteraes so, respectivamente, classificadas como:

548. Cesesp-PE Sobre o fenmeno da mutao, podemos afirmar que: a) o efeito da mutao sempre muito evidente e claramente observado. b) a mutao causada por uma modificao da molcula do DNA, ocasionando alterao na informao gentica. c) a origem de novos tipos de organismos nunca est relacionada com o processo de mutao. d) s as mutaes que ocorrem nas celulas somticas so consideradas importantes para a variabilidade gentica. e) os agentes qumicos e a temperatura no interferem nas mutaes. 549. Unicamp-SP Os recentes testes nucleares e o cinqentenrio da exploso da bomba atmica em Hiroshima e Nagasaki, em 1995 provocaram discusses sobre os efeitos da radiao no meio ambiente e nos seres humanos. Dados mostram que a incidncia do cncer nas duas cidades japonesas muito alta. a) Como a radiao est relacionada ao aumento na incidncia do cncer? b) Como se explica que muitos dos efeitos da bomba atmica se manifestem nos descendentes dos sobreviventes? c) Por que algumas pessoas que foram viver nessas cidades tempos depois da exploso tambm foram afetadas? 550. FGV-SP Quando da diviso da clula, a fita de DNA se duplica de modo semiconservativo: a dupla-hlice se abre, e cada um dos filamentos serve de molde para a sntese de uma fita complementar. Isto assegura que as clulas-filhas contenham a mesma informao gentica da clula-me. Contudo, podem ocorrer erros na incorporao de bases nitrogenadas na fita complementar (mutao). Dentre esses erros, pode-se citar: I. substituio de uma base nitrogenada por outra; II. adio ou deleo de uma base entre duas bases originais da seqncia. Sobre esses dois tipos de mutao, I e II, pode-se afirmar que: a) a mutao do tipo I provoca, necessariamente, a substituio de um nico aminocido na protena codificada pelo gene.

PV2D-07-BIO-24

a) b) c) d) e)

deficincia, duplicao, translocao e inverso. duplicao, deficincia, translocao e inverso. duplicao, translocao, inverso e deficincia. inverso, deficincia, translocao e duplicao. inverso, deficincia, duplicao e translocao.
137

554. PUC-SP Um espermatcito primrio humano apresenta a constituio cromossmica 2AXYY. Assinale a alternativa abaixo que mostre combinaes que possam ser encontradas nos espermatozides derivados daquela clula. a) 2AX e 2AXY d) AX e AYY b) 2AX e AXY e) AX e AXY c) 2AYY e AXY 555. UFSC Numa dada espcie, um indivduo trissmico apresenta um caritipo contendo 97 cromossomos. Qual o nmero de cromossomos que deve ser encontrado em um espermatozide normal nessa espcie? 556. PUCCamp-SP Assinale a proposio incorreta. a) Nas mutaes gnicas, o cromossomo se modifica estruturalmente. b) Radiaes ionizantes e certas substncias qumicas so exemplos de agentes mutagnicos. c) As mutaes somticas no se transmitem prole. d) No somente as clulas germinativas, mas tambm as clulas somticas esto sujeitas aos agentes mutagnicos. 557. UFES Na figura a seguir, em I, temos uma clula diplide 2n = 6 cromossomos. Em II, III e IV, temos exemplos, respectivamente, de:

559. UFRGS-RS O paciente apresenta retardo mental, pescoo alado, pregas epicnticas, mos curtas e largas com prega simiesca e trissomia do cromossomo 21. Trata-se de um caso de sndrome de: a) Turner. d) Tay-Sachs. b) Klinefelter. e) Cri-du-chat. c) Down. 560. Unirio-RJ Se numa das cariocineses dos primeiros blastmeros de um ovo 44A + XX ocorresse a no-disjuno do heterocromossomo X, que tipo de anomalia teria o indivduo resultante do respectivo embrio? a) Mongolismo b) Sndrome de Marfan c) Sndrome de Turner d) Sndrome de Turner-mosaicismo e) Ictiose 561. PUC-SP Uma mulher com sndrome de Turner cromatina negativa e daltnica. Sabe-se que filha de um casal cujo pai daltnico e a me normal, homozigtica para a viso das cores. O responsvel pelo gameta cromossomicamente anormal foi: a) o pai, pois ele daltnico e lhe deu o cromossomo X. b) a me, pois ela normal e homozigtica. c) o pai, pois ele deu-lhe o cromossomo Y. d) a me, pois ela deu-lhe o cromossomo X. e) o pai ou a me, pois ambos apresentam no gameta o cromossomo X. 562. Fatec-SP A sndrome de Klinefelter uma anomalia gentica devido : a) presena de trs cromossomos autossmicos n 21. b) ausncia de um cromossomo autossmico n 21. c) presena de um cromossomo X e dois cromossomos Y. d) presena de um cromossomo Y e dois cromossomos X. e) ausncia de cromossomos sexuais. 563. FEEQ-CE Em um exame de laboratrio, um geneticista encontrou o caritipo 44A + XXY. De posse desse dado, podemos afirmar que o portador desse gentipo: a) deve ser do sexo feminino, com sndrome de Klinefelter. b) do sexo masculino, com sndrome de Klinefelter. c) pode ser do sexo feminino, com sndrome de Turner. d) aparenta ser do sexo masculino, com sndrome de Turner. e) do sexo masculino porm portador da sndrome de Down.

a) b) c) d) e)

haploidia; translocao; inverso. haploidia; inverso; translocao. trissomia; translocao; inverso. monossomia; translocao; inverso. monossomia; inverso; translocao.

558. PUC-SP O exame que determina a freqncia da cromatina sexual em clulas de epitlio da mucosa bucal importante para: a) a determinao do caritipo. b) o estudo do mongolismo. c) o estudo dos genes ligados ao sexo. d) o estudo das fases da mitose. e) o estudo das anomalias sexuais.
138

564. UFPR Analisando a figura abaixo, que representa um caritipo humano, correto afirmar que se trata do caritipo de um indivduo:

568. Fatec-SP Relacione as colunas P e Q: Coluna P Caritipos A. B. C. D. E. 45 autossomos, XX (trissomia do 21) 44 autossomos, XX 44 autossomos, XXY 44 autossomos, XO 45 autossomos, XY (trissomia do 21) Coluna Q Caractersticas I. II. III. IV. V. Homem com sndrome de Klinefelter Homem com sndrome de Down Mulher com sndrome de Turner Mulher normal Mulher com sndrome de Down

( ( ( ( ( ( (

) do sexo masculino. ) do sexo feminino. ) com sndrome de Down. ) com sndrome de Patau. ) com sndrome de Edwards. ) com caritipo normal. ) com uma anomalia numrica de autossomos.

565. Ulbra-RS Considere as afirmativas a seguir. I. Alteraes cromossmicas numricas podem ocorrer por no disjuno cromossmica na meiose I e/ou na meiose II. II. Indivduos com duas linhagens celulares que apresentam diferentes nmeros cromossmicos durante a mitose. III. A maior incidncia de algumas sndromes cromossmicas em filhos ou filhas de mulheres com idade avanadas pode estar relacionada com a idade do ovcito liberado. Esto corretas as afirmativas: a) apenas I. d) apenas II e III. b) apenas II. e) I,II e III. c) apenas I e III. 566. FMSA-SP Se, na ovulognese, no houver disjuno do par de cromossomos sexuais, os vulos correspondentes, sendo fecundados, podero dar origem a casos de: a) sndrome de Turner. b) sndrome de Klinefelter. c) mongolismo. d) triploidia. e) a e b so possveis. 567. UFAL modificado As afirmaes a seguir relacionam-se determinao cromossmica do sexo na espcie humana. ( ) O sexo heterogamtico o masculino. ( ) O genitor do sexo feminino determina o sexo dos descendentes. ( ) O corpsculo de Barr ou cromatina sexual corresponde a um cromossomo X inativo. ( ) A sndrome de Down causada pela presena de um cromossomo X extra no caritipo.

As colunas P e Q encontram-se relacionadas corretamente em: a) C-I; B-II; A-III; D-V. b) A-I; B-III; C-IV; D-V. c) B-I; D-II; C-IV; E-V. d) C-I; E-II; D-III; B-IV. e) A-II; C-III; D-IV; B-V. 569. Vunesp A respeito das mutaes gnicas, foram apresentadas as cinco afirmaes seguintes. I. As mutaes podem ocorrer tanto em clulas somticas como em clulas germinativas. II. Somente as mutaes ocorridas em clulas somticas podero produzir alteraes transmitidas sua descendncia, independentemente do seu sistema reprodutivo. III. Apenas as mutaes que atingem as clulas germinativas da espcie humana podem ser transmitidas aos descendentes. IV. As mutaes no podem ser espontneas, mas apenas causadas por fatores mutagnicos, tais como agentes qumicos e fsicos. V. As mutaes so fatores importantes na promoo da variabilidade gentica e para a evoluo das espcies. Assinale a alternativa que contm todas as afirmaes corretas. a) I, II e III. b) I, III e V. c) I, IV e V. d) II, III e IV. e) II, III e V.
139

PV2D-07-BIO-24

570. UFRGS-RS Analise o esquema abaixo, que representa alguns passos do metabolismo da fenilalanina e da tirosina no homem.

So feitas, com base nesse esquema, quatro afirmaes: I. uma mutao que inative o gene B originar um indivduo albino. II. uma mutao que inative o gene A originar um indivduo albino e fenilcetonrico. III. uma mutao que inative o gene C originar alterao no metabolismo da tireide. IV. uma dieta pobre em tirosina e rica em fenilalanina originar indivduos com pele mais clara. a) Apenas IV correta. d) Apenas II e IV so corretas b) Apenas I, II e III so corretas. e) Apenas II, III e IV so corretas. c) Apenas I e III so corretas. 571. UFRJ Observe a seqncia de nucleotdeos de DNA abaixo. Suponha que no ponto ocorra uma mutao por insero. Este tipo de mutao acontece quando um ou mais nucleotdeos so acrescentados cadeia. TACTAA*TGGCGAAGAGCAGCGTCACGACTA Levando em conta que este DNA codifica uma determinada protena, explique por que a mutao provocada pela entrada de apenas um nucleotdeo mais prejudicial clula do que a provocada pela entrada de 3 nucleotdeos. 572. UERJ O oxignio um elemento imprescindvel manuteno da vida dos seres aerbicos, pois participa do processo de extrao de energia dos alimentos, como aceptor final de eltrons, conforme exemplificado pela reao abaixo. C6H12O6 + 6 O2 6 H2O + 6 CO2 Em virtude de sua configurao eletrnica, o oxignio tem forte tendncia a receber um eltron de cada vez, dando origem a molculas intermedirias, denominadas espcies reativas de oxignio, que so fortes agentes oxidantes. Essas molculas, por serem muito reativas, causam alteraes, inclusive no DNA, fato que pode induzir mutaes tanto em clulas somticas quanto em clulas germinativas. a) Considerando o processo de oxidao completa da glicose pela clula eucaritica, indique a etapa responsvel pela formao de espcies reativas de oxignio e o local da clula em que essas reaes ocorrem. b) Uma espcie reativa de oxignio induziu uma mutao no gene de uma clula, acarretando a substituio de uma base guanina por uma adenina, sem alterar, porm, a estrutura primria da
140

protena codificada pelo gene. Justifique por que no houve alterao da estrutura da protena. 573. PUC-RJ O nmero diplide de um organismo 12. Se encontramos clulas com 13 cromossomos (2n + 1), diremos que: a) esse organismo apresenta triploidia. b) esse organismo apresenta monossomia. c) esse organismo apresenta tetrassomia. d) esse organismo apresenta trissomia. e) esse organismo apresenta haploidia. 574. Fuvest-SP Um homem portador de duas mutaes raras: uma em um dos cromossomos do par 17 e outra, em um dos cromossomos do par 4. Supondo que todos os gametas desse homem sejam igualmente viveis, a proporo esperada de descendentes de sexo masculino portadores das duas mutaes do pai de: a) 1/2 . b) 1/4 c) 1/8 d) 2/23 e) 2/46 575. PUC-SP Uma mulher com trissomia do cromossomo X (47, XXX) frtil e produz vulos XX e X. Sendo casada com um homem normal, teoricamente, podemos esperar desse casal: a) apenas descendentes 46, XX e 46, XY. b) apenas descendentes 47, XXX e 47. c) apenas descendentes com fentipo feminino. d) apenas descendentes com fentipo masculino. e) descendentes 46, XX; 46, XY; 47, XXX e 47, XXY.

576. Cefet-RJ Viva a diferena! Famlias de deficientes falam das dificuldades de lutar pela sociedade inclusiva. Na novela Corao de estudante, na Rede Globo, os personagens Amelinha (Adriana Esteves) e Edu (Fbio Assuno) esto aprendendo a lidar com seu filho Joozinho, que nasceu com a sndrome de Down.
Texto adaptado do jornal O Globo Caderno Jornal da Famlia de 08/09/2002.

Marque a afirmativa certa sobre a sndrome de Down. a) Histrias como essa ajudam a esclarecer questes relacionadas incluso social de pessoas com alguma deficincia, no cromossomo 18. b) O interesse pelo tema sociedade inclusiva cresceu nos ltimos anos, acelerando o desenvolvimento dos cromossomos. c) A sndrome s possui um cromossomo sexual, o X ou Y. d) A sndrome possui um cromossomo a mais no par 21 (trissomia do 21) e) A sndrome possui como caracterstica 2n = 48 cromossomos. 577. Fuvest-SP Sabe-se que indivduos afetados pela sndrome de Down so caracterizados pela presena de uma cpia extra do cromossomo 21. Trata-se de um caso de: a) mutao gnica, cuja causa mais freqente a radiao mittica. b) translocao, cuja causa mais freqente a permutao meitica. c) inverso cromossmica, cuja causa mais freqente a no-disjuno meitica. d) aneuploidia, cuja causa mais freqente a nodisjuno meitica. e) triploidia, cuja causa mais freqente a no-disjuno meitica. 578. Unicamp-SP No caritipo humano figurado abaixo existe uma dada alterao cromossmica. Identifique-a e explique um mecanismo que poderia levar sua formao, citando trs caractersticas clnicas decorrentes dessa alterao.

579. Unifesp A sndrome de Down caracteriza-se pela presena de um cromossomo 21 a mais nas clulas dos indivduos afetados. Esse problema pode ser decorrente da nodisjuno do cromossomo 21 em dois momentos durante a formao dos gametas. Considerando a ocorrncia dessa no-disjuno, responda s questes abaixo. a) Em quais momentos ela pode ocorrer? b) Utilize os contornos a seguir para representar uma das duas possibilidades, indicando, na lacuna pontilhada, qual delas foi escolhida para ser representada. No-disjuno ocorrendo em __________________.

580. Unicamp-SP Considere as duas fases da meiose de um organismo com 2n = 6 cromossomos, esquematizadas a seguir, e responda ao que se pede.

a) Quais fases esto representadas nas figuras A e B? Justifique. b) Que tipo de alterao aparece em uma das figuras? Em relao ao cromossomo, como sero as clulas resultantes de um processo de diviso com essa alterao? c) D um exemplo de anomalia que seja causada por este tipo de alterao na espcie humana, cujo nmero normal de cromossomos 2n = 46. 581. Vunesp Jos uma pessoa muito interessada na criao de gatos. Um de seus gatos apresenta hipoplasia testicular (testculos atrofiados) e totalmente estril. Jos procurou um veterinrio que, ao ver as cores preta e amarela do animal, imediatamente fez o seguinte diagnstico: trata-se de um caso de aneuploidia de cromossomos sexuais. As cores de gatos domsticos so determinadas pelo gene P (cor preta), ambos ligados ao sexo, e o malhado apresenta os dois genes (A e P). a) O que e qual o tipo de aneuploidia que o gato de Jos apresenta? b) Qual a explicao dada pelo veterinrio relacionando a anomalia com as cores do animal?
141

PV2D-07-BIO-24

582. Cesgranrio-RJ Um casal teve um par de gmeos, um do sexo masculino e outro do sexo feminino. Como a menina apresentava vrias malformaes, foi encaminhada a um servio de citogentica, onde se verificou que ela possua um caritipo 45, XO (sndrome de Turner). Os cromossomos dos demais membros da famlia tambm foram estudados, e constatou-se que o pai possua um caritipo 46,XY e a me, um caritipo 46, XX. O irmo gmeo tinha o caritipo anmalo 47, XYY. O casal de gmeos foi, ento, cuidadosamente estudado, e verificou-se que concordavam absolutamente com todos os sistemas de grupos sangneos e aceitavam reciprocamente a enxertia de pele. Como pode ser interpretado o fenmeno? a) Os dois gmeos so monozigticos: o zigoto XY sofreu, durante a primeira diviso blastomrica, o fenmeno da no-disjuno do cromossomo Y, originando duas clulas, uma XO e a outra XYY, que se separaram e evoluram no sentido dos dois indivduos descritos. b) Os dois gmeos so dizigticos pois gmeos monozogticos necessariamente possuem o mesmo sexo. c) Os dois gmeos so dizigticos, e possuem o mesmo grupo sangneo porque se desenvolveram a partir de um mesmo ovo. d) Gmeos dizigticos aceitam a enxertia de pele e possuem os mesmos grupos sangneos. e) O fenmeno no pode ser interpretado cientificamente apenas com os dados oferecidos. 583. UCMG a) Numa populao em equilbrio, o que ocorre com as freqncias gnicas e genotpicas? b) Cite quatro condies para que uma populao esteja em equilbrio. 584. Cesesp-PE A freqncia de um gene dominante para certo carter numa populao em equilbrio gentico de 0,20. A freqncia de indivduos heterozigotos nessa populao deve ser de: a) 0,04 d) 0,64 b) 0,20 e) 0,80 c) 0,32 585. FCC-SP Se, numa populao em equilbrio, a freqncia de um gene autossmico recessivo 0,60, a freqncia de indivduos heterozigotos ser: a) 0,12 d) 0,40 b) 0,24 e) 0,48 c) 0,36 586. UFSCar-SP A freqncia de um gene recessivo a em uma populao em equilbrio de 0,2. As freqncias de AA, Aa e aa sero, respectivamente: a) 0,25; 0,50; 0,25. d) 0,09; 0,42; 0,49. b) 0,26; 0,48; 0,36. e) 0,15; 0,70; 0,15. c) 0,64; 0,32; 0,04.
142

587. Fuvest-SP Numa populao em equilbrio gentico, a freqncia do gene autossmico e recessivo d, que causa deficincia mental, de 20% (0,2). Qual a porcentagem, nessa populao, de deficientes mentais devido a esse gene? 588. FCMSC-SP Quando uma populao apresenta 25% de indivduos com o fentipo determinado por um gene recessivo, a freqncia esperada de heterozigoto : a) 100% d) 25% b) 75% e) 0,25% c) 50% 589. Cesgranrio-RJ A anlise de um par de alelos autossmicos (A e a) em cinco populaes mostrou uma determinada relao genotpica. Assinale a alternativa em que as propores estejam corretamente expressas, revelando perfeito equilbrio gentico. a) 1% AA, 98% Aa, 1% aa b) 1% AA, 81% Aa, 18% aa c) 4% AA, 32% Aa, 64% aa d) 33% AA, 34% Aa, 33% aa e) 50% AA, 50% Aa, 0% aa 590. Uma populao teoricamente em equilbrio possui 16% de seus indivduos mopes e o restante com viso normal. Sabendo-se que a miopia determinada por um gene recessivo m, qual a freqncia total dos gentipos nessa populao? a) MM 42%, Mn 42%, mm 16% b) MM 40%, Mm 44%, mm 16% c) MM 36%, Mm 48%, mm 16% d) MM 16%, Mm 68%, mm 16% e) MM 25%, Mm 59%, mm 16% 591. Numa populao em equilbrio de Hardy-Weinberg, as freqncias dos genes IA e IB (do sistema ABO) so 0,3 e 0,4 respectivamente. Calcule: a) a freqncia esperada do alelo i; b) a freqncia de indivduos do tipo sangneo B. 592. Fuvest-SP Supondo-se que, em uma populao, a freqncia do daltonismo entre homens seja de 1/30, a freqncia desse carter em mulher de: a) 1/30 d) 1/600 b) 1/60 e) 1/900 c) 1/90 593. PUCCamp-SP A hemofilia causada por um gene recessivo (h) localizado no cromossomo X. Se, numa determinada populao, um homem em 25.000 hemoflico, a freqncia do gene h nessa populao : a) 1/500 d) 1/50.000 b) 1/12.500 e) 1/100.000 c) 1/25.000

594. O daltonismo nos seres humanos deve-se a um gene recessivo ligado ao sexo. O levantamento de dados relativos a 500 homens de uma populao revelou que 20 eram daltnicos. Responda ao que se pede. a) Qual a freqncia do alelo normal nesta populao? b) Que porcentagem de mulheres desta populao seria normal? 595. UFMG Uma populao em equilbrio constituda de 500 indivduos, dos quais 45 apresentam um fentipo determinado por gene recessivo. Com base nesses dados, incorreto afirmar que: a) a freqncia de indivduos com fentipo dominante 91%. b) cerca de 10% da populao homozigota. c) o gene dominante mais freqente que o recessivo. d) 30% dos gametas produzidos carregam o alelo recessivo. e) os heterozigotos representam 42% da populao. 596. UCMG Numa cidade com 10.000 pessoas, verifica-se que 900 so albinas. A freqncia do gene recessivo ser: a) 0,003 d) 0,3 b) 0,03 e) 0,9 c) 0,09 597. Em uma populao de uma ilha, encontram-se 360 indivduos AA, 480 indivduos Aa e 160 indivduos aa. Calcule a freqncia dos alelos A e a. 598. PUC-SP Numa ilha, existem 1.000 indivduos, sendo que 90 deles so albinos e 910 tm pigmentao normal. Levando em considerao que o albinismo caracterstica recessiva, calcule o nmero esperado de heterozigotos, dentre os 910 indivduos normais. Considere que a populao est em equilbrio de Hardy-Weinberg. 599. Mackenzie-SP Sabendo que a freqncia do gene autossmico A igual a 0,8 numa populao constituda de 8.000 indivduos, indique a alternativa que mostra o nmero de indivduos para cada gentipo, se essa populao estiver em equilbrio gentico. a) AA 6.400; Aa 1.440; aa 160. b) AA 6.400; Aa 1.280; aa 320. c) AA 5.120; Aa 1.280; aa 1.600. d) AA 6.560; Aa 1.280; aa 160. e) AA 5.120; Aa 2.560; aa 320. 600. UEL-PR Tamanho ...(1)..., cruzamentos ...(2)... e fatores evolutivos ...(3)... so condies para que, numa populao, as freqncias gnicas e genotpicas se mantenham constantes ao longo das geraes, de acordo com Hardy e Weinberg.

Preenchem, correta e respectivamente, as lacunas (1), (2) e (3): a) infinitamente grande ao acaso atuantes. b) infinitamente grande direcionados atuantes. c) infinitamente grande ao acaso ausentes. d) pequeno direcionados ausentes. e) pequeno ao acaso atuantes. 601. UFMG O conjunto de genes das populaes muda lentamente, devido a vrios fatores: (1) ocorrem alteraes do material gentico, introduzindo novas variaes genticas; (2) alguns alelos tornam-se mais freqentes porque trazem vantagens a seus portadores em determinados ambientes; (3) indivduos podem entrar ou sair de uma populao, alterando as freqncias dos genes.... Os nmeros 1, 2 e 3 correspondem a: a) (1) oscilao gentica; (2) seleo; (3) migrao. b) (1) mutao; (2) seleo; (3) oscilao gentica. c) (1) migrao; (2) oscilao gentica; (3) mutao. d) (1) oscilao gentica; (2) migrao; (3) seleo. e) (1) mutao; (2) seleo; (3) fluxo gnico. 602. UFRJ Numa populao em equilbrio Hardy-Weinberg, a freqncia do alelo dominante para um dado loci autossmico 0,6. Portanto, a freqncia dos heterozigotos para este loci ser: a) 0,24 d) 1,20 b) 0,48 e) 2,40 c) 0,60 603. Vunesp Constatou-se, em uma populao, que a freqncia do gene B, em porcentagem, era igual a 70% em relao a seu alelo b. Observou-se, em geraes sucessivas, que essa freqncia no se alterava. Qual a freqncia relativa do gentipo heterozigoto nessa populao? a) 0,42 b) 0,21 c) 0,09 d) 0,49 e) 0,30 604. Em uma populao em equilbrio gnico, a freqncia do gene autossmico recessivo que determina uma certa anomalia de 30%. a) Quais so as freqncias dos possveis gentipos? b) Qual a freqncia dos indivduos homozigotos? c) Quais so as freqncias do fentipo normal? 605. UFRN Numa populao, verificou-se que 16% dos indivduos eram mopes por hereditariedade. Nessa populao, esse carter recessivo e apresenta uma freqncia gnica de 0,4, enquanto o carter viso normal tem freqncia gnica de 0,6. Qual a freqncia de heterozigotos nessa populao?
143

PV2D-07-BIO-24

606. Mackenzie-SP Sabendo-se que uma populao est em equilbrio gentico e que a freqncia de indivduos homozigotos para um carter autossmico e dominante (AA) de 25%, conclumos que a freqncia de indivduos homozigotos recessivos (aa) de: a) 6,25%. d) 50%. b) 12,5%. e) 75%. c) 25%. 607. UFRGS-RS Sendo a doena cstica do pncreas (mucoviscidose) transmitida por herana mendeliana recessiva autossmica, cuja freqncia de 0,09% (q2), qual ser a freqncia dos indivduos sadios homozigotos? a) 49% d) 5,82% b) 3% e) 65,4% c) 94% 608. Unimep-PE Se uma dada comunidade com populao de 100.000 indivduos, isenta de oscilao gentica e migrao, apresenta uma freqncia de indivduos com o gentipo cc de 9%, e sendo o gene C o alelo de c, as freqncias das classes genotpicas CC, Cc e cc (cujas expresses no tm significado em termos de seleo natural) sero, respectivamente: a) 50%, 41% e 9% d) 49%, 42% e 9% b) 79%, 12% e 9% e) 61%, 30% e 9% c) 70%, 21% e 9% 609. Certa populao apresenta as seguintes freqncias para uma srie de alelos mltiplos: A = 20%; a1 = 10%; a2 = 70%. Sabendo-se que a populao est em equilbrio gentico, a freqncia de indivduos com o gentipo a1a2 : a) 4% d) 80% b) 14% e) 92% c) 35% 610. Unicamp-SP A freqncia do gene i, que determina o grupo sangneo O, de 0,40 (40%) em uma populao em equilbrio. Em uma amostra de 1.000 pessoas desta populao, quantas sero encontradas com sangue do tipo O? Explique as etapas que voc seguiu para chegar resposta. Indique o gentipo das pessoas do grupo sangneo O. 611. Fafifor-CE Considerando, por um lado, a transmisso do fator Rh um caso de herana mendeliana autossmica dominante e, por outro lado, a maior facilidade de clculo a freqncia dos indivduos Rh negativo (q2) de 16% (e, portanto, a freqncia dos indivduos Rh positivo, homo e heterozigotos, de 84%), perguntase: qual ser a freqncia dos indivduos Rh positivo homozigotos (p2)? a) 94,09% d) 48% b) 60% e) 36% c) 52%
144

612. Em uma populao humana, 25% das pessoas so Rh negativo. Sabendo-se tratar de uma caracterstica determinada por um gene autossmico recessivo, pergunta-se: a) Quais so as freqncias dos possveis gentipos? b) Quais so as freqncias dos fentipos Rh positivo e Rh negativo? 613. PUC-MG A calvcie na espcie humana determinada por um gene autossmico C, que tem sua expresso influenciada pelo sexo. Esse carter dominante nos homens e recessivo nas mulheres, como mostra a tabela a seguir. Gentipo CC Cc cc Fentipo Homens Calvo Calvo Normal Mulheres Calva Normal Norma

Em uma populao em equilbrio de Hardy-Weimberg, na qual 81% dos homens no apresentam gentipo capaz de torn-los calvos, qual a freqncia esperada de mulheres cujo gentipo pode torn-las calvas? a) 1% d) 42% b) 8,5% e) 81% c) 19% Texto para as questes 614 e 615. A anemia falciforme ou siclemia uma doena hereditria que leva formao de hemoglobina anormal e, conseqentemente, de hemcias que se deformam. condicionada por um alelo mutante s. O indivduo SS normal, o Ss apresenta anemia atenuada e o ss geralmente morre. 614. UEL-PR Supondo populaes africanas com incidncia endmica de malria, que a anemia falciforme no sofra influncia de outros fatores e que novas mutaes no estejam ocorrendo, a freqncia do gene: a) S permanece constante. b) S tende a diminuir. c) S tende a aumentar. d) s permanece constante. e) s tende a aumentar. 615. UEL-PR Verificou-se que em populaes de regies onde a malria endmica, os heterozigostos (Ss) so mais resistentes malria do que os normais (SS). Nesse caso, so verdadeiras as afirmaes a seguir, exceto: a) A malria atua como agente seletivo. b) O indivduo ss leva vantagem em relao ao SS. c) O indivduo Ss leva vantagem em relao ao SS. d) Quando a malria for erradicada, ser heterozigoto deixar de ser vantagem. e) Quando a malria for erradicada, haver mudana na freqncia gnica da populao.

616. UFPE Uma populao pan-mtica de pssaros composta por 14.000 indivduos. Estando em equilbrio de Hardy-Weinberg, essa populao apresenta a seguinte distribuio genotpica. 4.100 indivduos AA 5.300 indivduos Aa 4.600 indivduos aa Qual a freqncia do alelo a nessa populao? a) 0,48 d) 0,59 b) 0,25 e) 0,96 c) 0,52 617. Em humanos, a miopia causada pela presena de um alelo recessivo a em homozigose. Em determinada populao, sabe-se que a freqncia do alelo dominante para este mesmo lcus 0,6. Se, nesta populao, existem 2.000 indivduos, quantos no so mopes? a) 840 d) 960 b) 480 e) 1.680 c) 360 618. UEL-PR Numa populao em equilbrio de Hardy-Weinberg, formada por 10.000 indivduos, existem 900 do tipo Rh negativo. Espera-se que o nmero de indivduos Rh positivo homozigoto nessa populao seja de: a) 9.100 d) 2.100 b) 4.900 e) 900 c) 4.550 619. UFMA Em uma populao panmtica de tamanho n = 10.000 indivduos, em relao ao sistema sangneo MN, existem 900 indivduos do grupo N. Quantos indivduos MN devero ser encontrados, teoricamente? a) 9.100 d) 8.400 b) 2.100 e) 5.100 c) 4.200 620. As populaes A, B e C esto em equilbrio de HardyWeinberg, com relao aos gentipos condicionados pelos alelos D e d. A freqncia de indivduos homozigotos dd 16% na populao A, 9% na populao B e 4% na populao C. Podemos afirmar que a proporo: a) de heterozigostos Dd maior na populao C do que na B. b) de heterozigotos Dd maior na populao A do que na C. c) de homozigotos DD maior na populao B do que na C. d) de homozigotos DD maior na populao A do que na B. e) de homozigotos DD maior na populao A do que na C.

621. UFMG A cor da raiz da cenoura controlada por um par de genes autossmicos. O gene B responsvel pela cor branca e seu alelo recessivo, pela cor amarela. Um agricultor colheu 20.000 sementes de uma populao pan-mtica, que se cruza ao acaso, das quais 12.800 desenvolveram plantas com razes brancas. A partir dessas informaes, pode-se afirmar que: a) a freqncia do gene para colorao amarela de 36% nessa populao. b) a freqncia de heterozigotos nessa populao de 24%. c) a freqncia de plantas com razes amarelas ser de 64% se a populao se mantiver em equilbrio. d) a probabilidade de formao de gametas B de 80% nessa populao. e) a probabilidade de ocorrncia de homozigotos nessa populao de 52%. 622. Fuvest-SP Um determinado gene de herana autossmica recessiva causa a morte das pessoas homozigticas aa ainda na infncia. As pessoas heterozigticas Aa so resistentes a uma doena infecciosa causada por um protozorio, a qual letal para as pessoas homozigticas AA. Considere regies geogrficas em que a doena infecciosa endmica e regies livres dessa infeco. Espera-se encontrar diferena na freqncia de nascimento de crianas aa entre essas regies? Por qu? 623. Unicamp-SP A anemia falciforme caracterizada por hemcias em forma de foice, em funo da produo de molculas anormais de hemoglobina, incapazes de transportar o gs oxignio. Indivduos com anemia falciforme so homozigotos (SS) e morrem na infncia. Os heterozigotos (Ss) apresentam forma atenuada da anemia. Na frica, onde a malria endmica, os indivduos heterozigotos para anemia falciforme so resistentes malria. a) Explique o que esperado para a freqncia do gene S em presena da malria. E em ausncia da malria? b) Qual a explicao para o fato de os heterozigotos para anemia serem resistentes malria? 624. Numa populao em equilbrio e suficientemente grande, em que os cruzamentos se processam ao acaso, verificou-se que existem 2.000 indivduos com incapacidade de enrolar a lngua e 30.000 com capacidade de enrolar a lngua. Supondo que essa capacidade seja condicionada por um gene dominante, qual ser o nmero aproximado de indivduos heterozigotos na populao?
145

PV2D-07-BIO-24

625. UnB-DF Uma populao de 1.000 indivduos, com as freqncias gnicas A = 20% e a = 80%, funde-se com uma populao de 4.000 indivduos, em que as freqncias gnicas so A = 80% e a = 20%. Quais so as freqncias gnicas na populao hbrida resultante dessa miscigenao? a) A = 50%, a = 50% d) A = 96%, a = 4% b) A = 20%, a = 80% e) A = 68%, a = 32% c) A = 80%, a = 20% 626. Mackenzie-SP A sensibilidade (gosto amargo) do ser humano ao PTC (feniltiocarbamida) se deve a um gene autossmico dominante I e insensibilidade ao seu alelo recessivo i. Sabendo-se que, numa populao de 1.200 pessoas, as freqncias dos genes I e i so, respectivamente, 0,8 e 0,2, os nmeros esperados de pessoas sensveis e insensveis nessa populao so, respectivamente: a) 960 e 240. d) 1.152 e 48. b) 768 e 432. e) 816 e 384. c) 1.008 e 192. 627. PUCCamp-SP Analise o heredograma a seguir no qual os smbolos escuros significam a presena de uma anomalia.

a) Sabendo-se que, na populao, a freqncia de heterozigotos para o albinismo 1/50, qual a probabilidade de que o casal II-2 II3 tenha uma criana albina? b) Se o primeiro filho desse casal for albino, qual a probabilidade de que a prxima criana do casal tambm seja albina? 629. Vunesp Pela equao Hardy-Weinberg, p2 + 2pq + q2 = 1, onde p e q so as freqncias de dois alelos. Com essa equao podemos calcular a freqncia de um gentipo sabendo a freqncia de um dos alelos, ou vice-versa, desde que a populao esteja em equilbrio. Numa determinada populao em equilbrio de HardyWeinberg, nasceram 10.000 crianas, sendo que 100 dessas crianas apresentaram uma doena, a fenilcetonria, determinada por um gene autossmico recessivo. Calcule a freqncia de indivduos de fentipo normal portadores do gene causador de fenilcetonria nessa populao. 630. Fuvest-SP Numa populao de 100 pessoas, 36 so afetadas por uma doena gentica condicionada por um par de alelos de herana autossmica recessiva. a) Expresse, em fraes decimais, a freqncia dos alelos dominantes e recessivos. b) Quantos indivduos so homozigotos? c) Suponha que, nessa populao, os cruzamentos ocorram ao acaso, deles resultando, em mdia, igual nmero de descendentes. Considere tambm que a caracterstica em questo no altera o valor adaptativo dos indivduos. Nessas condies, qual ser a porcentagem esperada de indivduos de fentipo dominante na prxima gerao? Justifique suas respostas, mostrando como chegou aos resultados numricos. 631. Vunesp Considere duas populaes diferentes, 1 e 2, cada uma com 200 indivduos diplides, portanto, com 400 alelos. A populao 1 apresenta 90 indivduos com gentipo AA, 40 indivduos com gentipo Aa e 70 indivduos com gentipo aa. A populao 2 apresenta 45 indivduos com gentipo AA, 130 indivduos com gentipo Aa e 25 indivduos com gentipo aa. a) Qual a freqncia dos alelos A e a em cada uma das populaes? b) Qual delas tem a maioria dos indivduos homozigotos? Explique. 632. UFRJ A freqncia gnica de dois alelos em uma populao, numa dada gerao, foi de A = 80% e a = 20%. Na gerao seguinte, foi observada uma freqncia de A = 60% e a = 40%. Alguns mecanismos evolutivos que alteram a freqncia dos genes so: 1. seleo natural; 2. taxa de mutao gnica; 3. deriva ao acaso da freqncia gnica, principalmente em populaes pequenas. Qual das trs possibilidades apresentadas no pode ser aceita para explicar a variao na freqncia dos genes citados? Justifique sua resposta.

Sabendo-se que a freqncia de heterozigotos na populao 1/20, a probabilidade de o casal III.1 III.2 vir a ter uma criana com a anomalia : a) 1/420 d) 1/80 b) 1/160 e) 1/50 c) 1/120 628. Fuvest-SP No heredograma a seguir esto representados indivduos afetados pelo albinismo, que tm herana autossmica recessiva.

146