Você está na página 1de 8

LISTA DE EXERCCIOS SUBSTNCIAS ORGNICAS E INORGNICAS

PROF. MARIA DIOCELI 1 ANO EM


1. Escreva nos parnteses a letra (V), se a rirmativa for verdadeira, ou (F), se for falsa. Os sais minerais existem nos seres vivos de forma imobilizada ou dissociados em ons. Pequenas variaes nas porcentagens de ons podem modificar profundamente a permeabilidade, irritabilidade e viscosidade da clula. Analise as propostas apresentadas. ( ) Magnsio (Mg++) presente na clorofila , portanto, necessrio fotossntese. ( ) Clcio (Ca++) necessrio para a ao de certas enzimas em importantes processos fisiolgicos. ( ) Ferro (Fe++), presente na hemoglobina, faz parte de pigmentos importantes na respirao (citocromos). ( ) Fosfato (PO3--) o principal ction extra e intracelular. ( ) Cloreto (Cl-) importante ction presente tanto na hemoglobina quanto na clorofila. 2. Escreva, no espao apropriado, a soma dos itens corretos. Sobre as substncias que compem os seres vivos, correto afirmar que:
(1) os carboidratos, os lipdeos e as vitaminas so fontes de energia para os seres vivos (2) a gua a substncia encontrada em maior quantidade nos seres vivos; (4) alm de sua funo energtica, os carboidratos esto presentes na formao de alguma estruturas dos seres vivos; (08) as gorduras constituem o principal componente estrutural dos seres vivos; (16) os seres vivos apresentam uma composio qumica mais complexa do que a matria bruta, sendo formados por substncias orgnicas, como as protenas, os lipdeos, os carboidratos, as vitaminas e os cidos nuclicos.

Soma = ( ) 3. No processo de contrao e relaxamento muscular, o elemento mineral mais diretamente presente o: A clcio B iodo. C mercrio. D ferro. 4. Para a realizao de alguns processos fisiolgicos, o organismo humano tem necessidade de ons de clcio. Dentre os mecanismos que dependem diretamenle destes ons para sua realizao, temos: A B C D E excreo de toxinas e atividade da tireide. digesto de alimentos bsicos e respirao. coagulao do sangue e conlrao muscular. atividade neurolgica e oferta de O2 s clulas. crescimento dos ossos e atividade da hipfise.

5. "A taxa de gua varia em funo de trs falores bsicos: atividade do tecido ou rgo (a quantidade de H2O diretamenle proporcional atividade melablica do rgo ou tecido em questo); idade (a taxa de gua decresce com a idade) e a espcie em questo (homem 63%, fungos 83%, celenterados 96% ele.)". Baseado nestes dados, o item que represenla um conjunto com maior taxa hdrica : A B C D E corao, ancio, cogumelo. estmago, criana, abacateiro. msculo da perna, recm-nascido, medusa. ossos, adulto, "orelha-de-pau". pele, jovem adolescente, coral.

6. A quantidade de gua nas clulas e nos tecidos: A B C D E 7. A B C D E tende a diminuir com o aumento da idade. tende a aumentar com o aumento da idade. permanece constante com o aumento da idade. no tem qualquer relao com a idade. tem relao com a idade mas a mesma em qualquer espcie. Com relao ao papel desempenhado pela gua nas estruturas celulares dos seres vivos, qual das afirmaes no correta? o veculo de eliminao dos excretas provenientes do metabolismo celular. Age como catalisador enzimtico de numerosas reaes intracelulares. Oferece grandes condies de estabilidade aos colides protoplasmticos. Tem participao direta nos fenmenos osmticos entre a clula e o meio extracelular. Participa das reaes de hidrlise.

8. A porcentagem de gua progressivamente decrescente nos seguintes tecidos: A B C D E adiposo, muscular, substncia cinzenta do crebro. muscular, tecido nervoso do embrio, tecido nervoso do adulto. muscular, sseo e adiposo. epitelial, sseo e nervoso. nervoso, adiposo e muscular.

9. O papel principal dos ons HCO3- na clula : A manter o equilbrio osmtico. B formar ligaes de alta energia. C atuar como oxidante energtico. D l regular o equilbrio cido-bsico mantendo o pH l neutro da clula. E atuar como catalisador em reaes metablicas intracelulares. 10. A gua imprescindvel para todos os seres vivos. Sua quantidade varia nos organismos, dependendo de 3 fatores: atividade do tecido ou rgo, idade do organismo e espcie estudada. Em relao a este fato, todas as alternativas abaixo esto corretas, exceto:

A B C D E

quanto maior metabolismo de um tecido, maior a taxa de gua que nele existe. a taxa de gua normalmente decresce com a idade. as espcies mais evoludas apresentam uma taxa maior de gua no seu organismo. em todos os seres vivos a gua favorece ocorrncia de reaes qumicas. ao nvel de organismo, a gua tem muita importncia na manuteno da temperatura. Em face do seu calor especfico elevado (capacidade de conservar o calor), a gua:

11. A B C D E

contribui para a manuteno do estado coloidal do protoplasma. importante para os animais homeotermos. age como veculo de substncias no trnsito atravs da membrana celular. conserva o equilbrio osmtico da clula. mantm estvel o equilbrio hidrossalino intercelular.

12. Que tipo de substncia impermeabiliza o tecido vegetal contra a perda excessiva de agua e fornece energia? A B C D E cidos nuclicos. protenas. lipdeos. vitaminas. ons orgnicos.

13. Dos hidratatos de carbono abaixo citados, quais no so polissacardeos? I. Galactose II. Celobiose III. Glicognio IV. Maltose V. Celulose Duas ou mais das substncias, acima numeradas, podem responder questo. Escolha a alternativa: A B C D E se II e IV esto corretas. se I, II e III esto corretas. se III e V esto corretas. se I, II e IV esto corretas. se todas esto corretas.

14. Reservas de carboidrato nos msculos ficam na forma de:

A B C D E

glicognio. lactose. amido. sacarose. glicose.

15. Qual o tipo de substncia orgnica que exerce,fundamentalmente, funo energtica no mecanismo metablico das clulas?

A protena.

B C D E

hidratos de carbono. fasfolipdeos. enzimas. vitaminas.

16. Na maioria dos animais e vegetais a armazena gem de carboidratos se d:

A respectivamente, na forma de glicognio e amido, B respectivamente, na forma de amido e celulose, C respectivamente, na forma de maltose e glicose D exclusivamente, na forma de amido, E exclusivamente, na forma de glicognio.
17. H alguns meses, foi lanado no mercado um novo produto alimentcio voltado para o consumidor vegetariano: uma bebida sabor iogurte feita a base de leite de soja. poca, os comerciais informavam tratar-se do primeiro iogurte totalmente isento de produtos de origem animal.

A B C D E

colesterol e carboidratos. lactose e colesterol. protenas e colesterol. protenas e lactose. lactose e carboidratos.

18. Glicognio e celulose tm em comum, na sua composio, molculas de:

A aminocidos. B cidos graxos. C carboidratos. D protenas. E glicerol.


19. Os polissacardeo formado por unidades de glicose e que representa a principal forma de armazenamento intracelular de glicdios nos animais, denominado.

A B C D E

amido. colesterol. ergosterol. volutina. glicognio.

20. As substncias usadas pelos organismos vivos como fonte de energia e como reserva energtica so, respectivamente: A B C D E gua e glicdios. gua e sais minerais. lipdeos e sais minerais. glicdios e sais minerais. glicdios e lipdeos.

21. Cerca de 27 milhes de brasileiros tm intolerncia ao leite, por deficincia na produo de uma enzima do intestino.
Folha de S.Paulo, 09/ago./1998.

Sobre a enzima citada no artigo, e as enzimas em geral, podemos afirmar que: A B C D E aumentam a energia de ativao necessria para as reaes. atuam de forma inversamente proporcional ao aumento da temperatura. so altamente especficas em funo de seu perfil caracterstico. so estimuladas pela variao do grau de acidez do meio. so consumidas durante o processo, no podendo realizar nova reao do mesmo tipo.

22. Nos laboratrios qumicos, a maneira mais frequente de ativar uma reao fornecendo calor, que funciona como energia de ativao. Nos seres vivos, isso no possvel, pois corre-se o risco de as protenas serem desnaturadas. A estratgia desenvolvida pelos seres vivos para superar a barreira inicial das reaes foi a utilizao de: A B C D E ATP. enzimas. hormnios. glicose. clorofila.

23. Assinale a alternativa correta de acordo com as proposies apresentadas: I. As molculas de protena so formadas por uma sequncia de aminocidos. II. Os carboidratos, os lipdeos e os protdios so os constituintes inorgnicos da clula. III. A membrana plasmtica apresenta uma constituio lipoprotica. A B C D E somente a I est correta. a I e a II esto corretas. somente a II est correta. a I e a III esto corretas. somente a III est correta.

24. Considerando-se a definio de enzimas, assinale a alternativa correta: I. So catalisadores orgnicos, de natureza proteica, sensveis s variaes de temperatura. II. Substncias qumicas, de natureza lipdica, sendo consumidas durante o processo qumico. III. Apresentam uma regio chamada rea ativa, qual se adapta a molcula do substrato. A Apenas a afirmativa I correta. B Apenas as afirmativas II e III so corretas. C Apenas as afirmativas I e III so corretas. D Todas as afirmaes so corretas. E Nenhuma afirmao correta.

25. (Unifor/2007.2) Uma molecula de glicose esta para uma molcula de amido do mesmo modo que uma molecula de A B C D sacarose est para o glicognio. pentose est para o DNA. esteride est para a testosterona. aminocido est para a protena.

26. No caracteristica do DNA: A B C D D o aucar com cinco atomos de carbono. a presena das basese nitrogenadas uracila, guanina, citosina e adenina. a presena de cido fofrico. ser polinucleotdeo. s vitaminas.

27. Considere um segmento de DNA com sequncia bases indicadas a seguir: TTATCGGGACCGATCATCGTA A alterao mais drstica qeu esta molcula pode sofrer a:
A B C D E supresso da segunda base nitrogenada. supresso das trs primeiras bases nitrogenadas. substituio da quarta base nitrogenada por outra. substituio das trs primeiras bases nitrogenadas. incluso de mais trs bases nitrogenadas no final da molcula.

28. Na sntese proteica, um processo bastante complexo e fundamental para a sobrevivncia das clulas, a participao dos cidos nuclicos, substncias qumicas indispensveis vida, est corretamente referida em: A O DNA transcreve a mensagem gen tica para o RNA. que serve de modelo para a formao de protenas. B O DNA transcreve a mensagem gentica para o RNA solvel, que se liga ao ribossomo, local da sntese proteica. C O RNA mensageiro contm trincas de nucleotdeos denominadas cdons, responsveis pela transcrio de uma cadeia polipeptdica. D O RNA transportador apresenta na sua molcula uma trinca de nucleotdeos denominada anticdon, local de ligao com o aminocido que ele transporta. E O RNA ribossmico se une a protenas formando o ribossomo, local onde ocorre a transcrio da mensagem gentica. 29 O estudo do mecanismo da sntese de protenas no interior das clulas, confirma que: A a transcrio gnica caracteriza-se pela autoduplicao do DNA. B trs tipos de RNA participam do processo. C os anticdons localizam-se no RNAm.

D os cdons so trincas de bases nitrogenadas do RNAt. E no h evidncias que permitam aceitar que o cdigo gentico seja considerado degenerado. 30. O segmento TGCGATAGACT de uma fita de DNA, aps o processo de transcrio, origina a cadeia: A B C D E AUGUTATUTGA. TAGCUAUCUGA. GCGCTUTCTGU. UCUCTATCTUA. ACGCTATCTGA.

31. Observe: 1. O cdigo gentico descreve a relao entre a sequncia de bases nitrogenadas e a sequncia de aminocidos, na protena que ele especifica. 2. A sequncia de aminocidos que forma uma cadeia polipeptdica compreende a estrutura secundria de uma protena. 3. Trs bases nitrogenadas adjacentes codificam um aminocido e formam um cdon. Est(o) correta(s): A B C D E 1, apenas. l e 3. 3, apenas. l, 2 e 3. 2, apenas.

32. Os processos de transcrio e traduo gnicas resultam na sntese, respectivamente, de: A B C D E protenas e de RNA. RNA e de protenas. DNA e de protenas. RNA e de DNA. DNA e de RNA.

33 A composio qumica de uma protena pode ser alterada se: A durante sua sntese houver variao dos tipos de aminocidos disponveis no citoplasma. B durante sua sntese houver variao dos tipos de RNA transportadores. C sua sntese ocorrer no retculo endoplasmtico liso e no no rugoso. D uma base prica substituir uma pirimdica no RNA mensageiro que a codifica. . E O DNA no se duplicar durante a interfase. 34. Um fragmento de DNA de uma espcie de organismo procarionte apresenta a seguinte sequncia de bases: AATATTCGAGTCTAAAGA. Indique qual a sequncia de mRNA transcrito a partir deste segmento DNA:

A Q TTATAAGCTCAGATTTCT. B D TTATTAGCTCAGATTTCT. C D UUAUUUGGUCAGAUUUGU. D O UUAUAAGCUCAGAUUUCU. E Q AATATTCGAGTCTAAAGA. 35. Sobre a sntese de protenas, so feitas seguintes afirmaes: I. Um RNAt (RNA transportador) transporta semp um determinado aminocido. Esse aminocido, porm, pode ser transportado por vrios RNAt. II. A traduo do cdigo qumico do RNAm (RNA mensageiro) ocorre nos ribossomos localizados no retculol endoplasmtico rugoso. III. As molculas de RNAt apresentam numa determinada regio da sua molcula uma trinca de bases denominada anticdon. Assinale a(s) afirmativa(s) correta(s): A B C D E Apenas II. Apenas III. Apenas I e II. Apenas II e III. Todas.