Você está na página 1de 26

CONTEÚDO DO PASSO N.

4
 BIOLOGIA  HISTÓRIA
RESPIRAÇÃO AERÓBIA E ANAERÓBIA PERÍODO COLONIAL
EXAMES DE DNA EXPANSÃO MARITMO-COMERCIAL
SEQUENCIAMENTO DO DNA MERCANTILISMO
SÍNTESE DE PROTEÍNAS (DNA RNA PROTEÍNA) REFORMA RELIGIOSA
TCPD
TECIDO EPITELIAL DE REVESTIMENTO  GEOGRAFIA
TECIDO MUSCULAR HIDROGRAFIA
TEORIAS DA ORIGEM DA VIDA RELEVO
FATORES LIMITANTES DA FOTOSSÍNTESE
 FÍSICA
 MATEMÁTICA CINEMÁTICA VETORIAL E MOVIMENTOS
FUNÇÃO EXPONENCIAL CIRCULARES
FUNÇÃO QUADRÁTICA
 PORTUGUÊS
GRÁFICOS
TEXTOS CIENTÍFICOS
ÁREAS DAS FIGURAS PLANAS
IMAGENS
CIRCUNFÊNCIA E CÍRCULO
FIGURA DE LINGUAGENS
POLÍGONOS
HUMANISMO / BARROCO
RELAÇÕES MÉTRICAS EM UM TRIÂNGULO
BARROCO
QUALQUER
TEXTOS TÉCNICOS
SEMELHANÇA DE TRIÂNGULOS
TEXTOS JORNALISTICOS

 QUÍMICA
CLASSIFICAÇÃO PERIÓDICA DOS ELEMENTOS
DESCRITIVA
ELETRÓLITOS
EQUACIONAMENTO E BALANCEAMENTO DE
REAÇÕES
FÓRMULAS
FUNÇÕES INORGÂNICAS
INDICADORES
MASSA ATÔMICA
MUDANÇAS DE ESTADO

 SOCIOLOGIA E FILOSOFIA
DEFINIÇÕES DE FILOSOFIA
DUURKEIM
CADERNO PASSO 4 EXAMES DE DNA
1. (Fuvest 2008) TESTE DE DNA CONFIRMA PATERNIDADE
BIOLOGIA: PARTE A DE BEBÊ PERDIDO NO TSUNAMI
RESPIRAÇÃO AERÓBIA E ANAERÓBIA Um casal do Sri Lanka que alegava ser os pais de um bebê
1. (Uerj 2008) Três diferentes tipos de células, X, Y e Z, foram encontrado após o tsunami que atingiu a Ásia, em dezembro,
cultivados em meios de cultura apropriados, em ambientes obteve a confirmação do fato através de um exame de DNA. O
fechados e sob iluminação constante, na presença de ar menino, que ficou conhecido como "Bebê 81" por ser o 810.
atmosférico para as células dos tipos X e Y e de N2 para as sobrevivente a dar entrada no hospital de Kalmunai, era
células do tipo Z. reivindicado por nove casais diferentes.
A tabela a seguir mostra a variação das concentrações de três "Folhaonline", 14/02/2005 (adaptado).
parâmetros, medidas ao fim de algum tempo de cultivo.
Algumas regiões do DNA são sequências curtas de bases
nitrogenadas que se repetem no genoma, e o número de
repetições dessas regiões varia entre as pessoas. Existem
procedimentos que permitem visualizar essa variabilidade,
revelando padrões de fragmentos de DNA que são "uma
impressão digital molecular". Não existem duas pessoas com o
Amebas, dinoflagelados e leveduras podem ter um mesmo padrão de fragmentos com exceção dos gêmeos
comportamento similar ao apresentado, respectivamente, pelas monozigóticos. Metade dos fragmentos de DNA de uma pessoa é
células do tipo: herdada de sua mãe e metade, de seu pai.
a) X, Y e Z Com base nos padrões de fragmentos de DNA representados a
b) Z, Y e X seguir, qual dos casais pode ser considerado como pais
c) Y, X e Z biológicos do Bebê 81?
d) X, Z e Y

2. (Unesp 2013) A figura apresenta a tampa de um vidro de


molho em conserva, na qual há a seguinte advertência:

2. (Ufrgs 2011) Uma das técnicas atualmente utilizadas para


analisar casos de paternidade civil é o emprego de marcadores
Sobre a inscrição da tampa, um estudante de biologia levantou de microssatélites. Os microssatélites são repetições de trechos
duas hipóteses: de DNA que ocorrem em número variável na população. O
número de repetições é transmitido geneticamente.
1ª) se o produto estiver contaminado, os micro-organismos irão A análise de microssatélites foi utilizada em um teste de
proliferar-se utilizando os glicídios do molho para a obtenção paternidade. A tabela abaixo apresenta os resultados relativos ao
de energia. número de repetições encontradas para a mãe, para o suposto
2ª) o metabolismo dos micro-organismos promoverá a liberação pai e para o filho, em diferentes locos.
de CO2, que aumentará a pressão no interior do recipiente,
estufando a tampa. Amostras de acordo
com o número de
Mãe Suposto pai Filho
Com relação às hipóteses levantadas, é correto dizer que repetições
a) ambas as hipóteses estão corretas, mas o contido na 2ª não é Locos
consequência do que se afirma na 1ª. 1 12 ; 13 9 ; 14 13 ; 14
b) ambas as hipóteses estão corretas, e o contido na 2ª é 2 32 ; 35 29 ; 32 35 ; 35
consequência do que se afirma na 1ª. 3 8 ; 10 10 ; 12 10 ; 10
c) ambas as hipóteses estão erradas, pois a área azul abaixada é 4 7;9 6;9 7;7
indicativa de que há vácuo no interior da embalagem, o que 5 12 ; 14 11 ; 12 12 ; 14
garante que, na ausência de ar, o produto não se deteriore. 6 15 ; 17 15 ; 15 15 ; 15
d) a 1ª hipótese está correta e a 2ª está errada, pois durante a 7 18 ; 22 17 ; 19 21 ; 22
fermentação não se produz CO2.
e) a 2ª hipótese está correta e 1ª está errada, pois as bactérias Com base nos dados apresentados na tabela, é correto afirmar
obtêm energia dos lipídios do molho, mas não dos glicídios. que
a) apenas um indivíduo, pela análise, é homozigoto para o loco 6.
b) os locos 2, 4 e 7 excluem a possibilidade de paternidade do pesquisa concluiu que o genoma do 'A. aegypti' tem 1,38 bilhões
suposto pai. de bases. Aos cientistas brasileiros, da Universidade de São
c) o filho é heterozigoto para a maioria dos locos analisados. Paulo (USP) e do Instituto Butantan coube o sequenciamento dos
d) a mãe referida não é mãe biológica deste filho. genes ativos, ou seja, aqueles que codificam proteínas envolvidas
e) os locos 1 e 3 excluem a possibilidade de paternidade do nas diversas funções e características do organismo. O processo
suposto pai. foi complexo, uma vez que se constatou que o genoma desse
inseto contém milhões de bases que se repetem e não têm
SEQUENCIAMENTO DO DNA atuação específica (os elementos de transposição ou
1. (Upe 2011) O exemplo mostrado no texto a seguir revela o transposons), o que dificultou a definição dos genes ativos.
potencial que as ferramentas usadas em genética podem ter para "Mapear quais são e onde se localizam os genes ativos é
inibir a exploração e o comércio de produtos e espécimes da fundamental para se entender o genoma por completo", afirma
fauna, auxiliando na conservação das espécies ameaçadas. um dos autores do artigo, o bioquímico Sergio Verjovski-Almeida,
do Departamento de Bioquímica da USP.
Um dos casos mais interessantes da genética molecular forense (Rodrigues, João Gabriel "Ciência Hoje On-line",
envolveu o comércio ilegal de carne de baleias no Japão e 17.05.2007)
Coréia. A pedido do Earthrust, Baker e Palumbi (1996)
desenvolveram um sistema para monitorar esse comércio, A respeito desse tema, analise as afirmações a seguir:
utilizando sequências de DNAmt e PCR, que distinguiam, com
confiança, uma variedade de espécies de baleias umas das I - As bases citadas no texto são as nitrogenadas que no DNA
outras e de golfinhos. As análises revelaram que parte das correspondem a: adenina, timina, citosina e guanina.
amostras obtidas em mercados varejistas não era de baleias II - Os genes ativos são aqueles que codificam uma proteína.
Minke, nas quais o Japão caçava para “fins científicos”, mas sim III - O RNA difere do DNA pela presença de uma uracila, além
de baleias Azuis, Jubartes, Fin e de Bryde, as quais são das bases citadas acima.
protegidas por lei. Além disso, parte da “carne de baleia” era na IV - A transcrição do DNA ocorre no interior do núcleo celular em
realidade de golfinhos, botos, ovelhas e cavalos. Assim, além da todos os tipos de células.
ilegalidade da caça das baleias, os consumidores estavam sendo
ludibriados. Estão corretas:
Fonte: Adaptado de Fankham et al., 2008 – Genética da a) apenas I e II.
Conservação. b) apenas II e IV.
c) apenas I e III.
Leia as proposições abaixo sobre a reação em cadeia da d) I, II e III.
polimerase (PCR): e) II, III e IV.
I. Antes da PCR, para se detectarem genes ou VNTRs (número
variável de repetições em sequência), havia a obrigação de se SÍNTESE DE PROTEÍNAS (DNA RNA PROTEÍNA)
ter grande quantidade de DNA alvo. 1. (Fuvest 2012) Uma mutação, responsável por uma doença
II. Pela PCR, promove-se a deleção de trechos do DNA in vivo, sanguínea, foi identificada numa família. Abaixo estão
usando polimerases de DNA. representadas sequências de bases nitrogenadas, normal e
III. A técnica da PCR permitiu a obtenção de grandes quantidades mutante; nelas estão destacados o sítio de início da tradução e a
de fragmentos específicos do DNA por meio da amplificação base alterada.
em ciclos.
IV. O DNA a ser amplificado não pode ser submetido a
temperaturas altas, acima de 40°C, sob pena de desnaturar e
não mais renaturar.
Apenas é correto afirmar o que está contido nas proposições
a) I e II.
b) I e III.
c) II e III.
d) II e IV.
e) III e IV.
O ácido nucleico representado acima e o número de aminoácidos
2. (Pucpr 2008) Sequenciado genoma do 'Aedes aegypti'.
codificados pela sequência de bases, entre o sítio de início da
tradução e a mutação, estão corretamente indicados em:
Análise pode ajudar a explicar ligação simbiótica entre mosquito e a) DNA; 8.
os vírus da dengue e febre amarela.
b) DNA; 24.
c) DNA; 12.
Um consórcio de pesquisadores de vários países, inclusive do
d) RNA; 8.
Brasil, deu mais um importante passo na luta contra doenças e) RNA; 24.
transmitidas pelo 'Aedes aegypti': a dengue e a febre amarela. O
genoma do mosquito acaba de ser sequenciado, o que pode
fornecer pistas sobre a interação do vetor com os vírus. O estudo,
detalhado na revista "Science" desta semana, permitirá a busca
de novos caminhos para tentar erradicar essas doenças. A
2. (Ufsm 2013) Ao percorrerem uma trilha ecológica, os
escoteiros encontraram duas plantas que eram fenotipicamente Fonte: AMABIS, J.; MARTHO, G. Biologia - Biologia das Células.
idênticas, porém tinham aromas distintos, uma exalava citral, 3. ed. São Paulo: Moderna, 2010. vol. 1. p. 227. (adaptado)
outra canela. Com permissão do fiscal, levaram amostras para
análise de DNA. A seguir, tem-se parte das sequências obtidas Com base nessas informações, determinou-se que as plantas
das plantas. citral e canela são diferentes genotipicamente. Os aminoácidos
correspondentes a elas são, respectivamente,
citral:...‘AACAAGCCAACCAGCACGCGGAAA’... a) leu–fen–gli–trp–ser–cis–ala–fen e pro–fen–pro–gli–fen–gli–fen–
e pro.
canela:...‘GGGAAAGGACCAAAACCAAAAGGC’... b) asn–lis–pro–tre–tre–pro–arg–lis e gli–lis–gli–pro–lis–pro–lis–gli.
c) asn–lis–pro–tre–tre–pro–arg–lis e pro–fen–pro–gli–fen–gli–fen–
TABELA DO CÓDIGO pro.
GENÉTICO d) leu–lis–gli–tre–ser–pro–ala–lis e pro–lis–pro–pro–fen–pro–pro–
Segunda Base do Códon gli.
U C A G e) leu–fen–gli–trp–ser–cis–ala–fen e gli–lis–gli–pro–lis–pro–lis–gli.
UUU UCU UAU UGU
Phe Ser Tyr Cys
UUC UCC UAC UGC U DNA (citral): ... AAC AAG CCA ACC
Phe Ser Tyr Cys C RNAm: ... UUG UUC GGU UGG
U aminoácidos: ... leu fen gli trp
UUA UCA UAA UGA A
Leu Ser pare* pare* G ...
UUG UCG UAG UGG DNA (canela): ... GGG AAA GGA CCA
Leu Ser pare* Trp RNAm: ... CCC UUU CCU GGU
CUU CCU CAU CGU aminoácidos: ... pro fen pro gli
Leu Pro His Arg
CUC CCC CAC CGC U
Leu Pro His Arg C TCPD
C 1. (Ufrgs 2011) O esquema abaixo mostra alguns dos
CUA CCA CAA CGA A
Leu Pro Gin Arg G componentes do tecido conjuntivo frouxo.
Primeira CUG CCG CAG CGG Terceira
Base Leu Pro Gin Arg Base
do AUU ACU AAU AGU do
Códon Ile Thr Asn Ser Códon
AUC ACC AAC AGC U
Ile Thr Asn Ser C
A
AUA ACA AAA AGA A
Ile Thr Lys Arg G
AUG ACG AAG AGG
Met Thr Lys Arg
GUU GCU GAU GGU
Val Ala Asp Gly
GUC GCC GAC GGC U
Val Ala Asp Gly C
G Assinale a alternativa correta em relação ao tecido conjuntivo
GUA GCA GAA GGA A
Val Ala Glu Gly G frouxo.
GUG GCG GAG GGG a) Nele não ocorre vascularização.
Val Ala Glu Gly b) Ele apresenta distribuição corporal restrita.
c) A célula marcada com a seta 1 é um fibroblasto.
Abreviaturas dos aminoácidos d) A célula marcada com a seta 2 é uma hemácia.
Phe ou fen = fenilalanina His = histidina e) As fibras assinaladas com as setas 3 são de actina e miosina.
Leu = leucina Gln = glutamina
Ile ou iso = isoleucina Asn = aspargina 2. (Ifsul 2011) Podemos classificar os tecidos conjuntivos de
Met = metionina Lys ou lis = lisina acordo com suas funções.
Val = valina Asp = ácido aspártico Com relação aos diferentes tipos de tecido conjuntivo, considere
Ser = serina Glu = ácido glutâmico as afirmativas abaixo.
Pro = prolina Cys ou cis = cisteína I. O tecido conjuntivo propriamente dito frouxo é muito flexível,
Thr ou tre = treonina Trp = triptofano possui poucas fibras de colágeno e as células características
Ala = alanina Arg = arginina estão imersas na substância fundamental amorfa.
Tyr ou tir = tirosina Gly ou gli = glicina II. O tecido conjuntivo propriamente dito denso possui grande
*A abreviatura pare corresponde aos códons de parada. resistência a trações e pode ser de três tipos: modelado, não
modelado e fibroso.
III. O tecido conjuntivo denso não modelado compõe os tendões e
os ligamentos.
IV. O tecido conjuntivo denso fibroso forma a derme e os
envoltórios de cartilagens.

Estão corretas apenas as afirmativas


a) I e IV.
b) I, II e III.
c) II e IV.
d) II, III e IV.

TECIDO EPITELIAL DE REVESTIMENTO


1. (Ufpr 2011) O esquema a seguir é representativo de um
epitélio de revestimento estratificado. Pode-se observar que as
camadas superiores, em contato com o meio externo, são
compostas por células cada vez mais achatadas. Além disso,
essas células achatadas geralmente estão mortas e descamam
do tecido. Um exemplo desse tipo de epitélio é encontrado no
esôfago de animais carnívoros. Tendo por base essas informações, pode-se dizer que, ao fazer
uma tatuagem, a agulha injetora de tinta penetra
a) na epiderme, para que a tinta não afete os vasos sanguíneos,
as glândulas e as terminações nervosas da derme, nem as
células adiposas da hipoderme.
b) na derme, pois, se realizada na epiderme, a tinta injetada seria
eliminada com as células queratinizadas mortas.
c) na hipoderme, para que a tinta não seja eliminada com as
células queratinizadas mortas, nem afete os vasos
sanguíneos, as glândulas e as terminações nervosas.
d) na camada superficial da epiderme, para que a tinta afete o
mínimo possível as estruturas inferiores da pele.
Qual o principal motivo que leva essas células a morrerem e e) na hipoderme, para que a tinta seja assimilada pelas células
descamarem do epitélio? adiposas, pois são células que não sofrem tantas alterações
a) O atrito causado pelos componentes de meio externo que ao longo do tempo.
entram em contato com o epitélio.
b) A justaposição das células, que cria uma falta de espaço para
que todas se acomodem na superfície do epitélio. TECIDO MUSCULAR
c) O contato com o meio externo, que leva a uma 1. (Udesc 2013) Analise as proposições abaixo em relação ao
hiperoxigenação das células. tecido muscular.
d) A distância dessas células em relação às fontes de oxigênio e
alimento, trazidos pelos tecidos adjacentes ao epitélio. I. Nos três tipos de tecidos musculares, ou seja, tecido muscular
e) O deslocamento da posição das organelas intracelulares, por estriado cardíaco, tecido muscular estriado esquelético e tecido
conta do achatamento promovido pelo citoesqueleto. muscular liso, a contração muscular ocorre por meio do
deslizamento dos filamentos de actina em relação ao de
2. (Fgv 2012) A pele humana é o maior orgão do corpo humano. miosina, diminuindo assim a distância entre as duas linhas Z (o
É constituída por dois tecidos, o tecido epitelial, a epiderme, espaço entre as duas linhas Z é chamado de sarcômero, que é
formado por células em constantes divisões, que empurram as a unidade de contração das células musculares).
mais velhas para as camadas superiores, e o tecido conjuntivo, a II. O tecido muscular estriado cardíaco é constituído por células
derme, rico em diversas estruturas, tais como vasos sanguíneos, longas com estrias transversais, e sua contração é
terminações nervosas e glândulas. Logo abaixo, não fazendo involuntária.
parte da pele, está a tela subcutânea, a hipoderme, formada III. O tecido muscular estriado esquelético é constituído por
pelas células adiposas responsáveis por armazenar gordura. células mononucleadas com estrias longitudinais, e sua
contração é lenta e involuntária.
IV. O tecido muscular liso é constituído por células
mononucleadas, sem estrias transversais, e sua contração é
involuntária.

Assinale a alternativa correta.


a) Somente as afirmativas I, II e IV são verdadeiras.
b) Somente as afirmativas I e III são verdadeiras.
c) Somente as afirmativas II e IV são verdadeiras.
d) Somente as afirmativas II e III são verdadeiras.
e) Somente as afirmativas I, II e III são verdadeiras.
2. (Pucrj 2009) A fotomicrografia apresentada é de um tecido que
tem as seguintes características: controle voluntário, presença de
células multinucleadas, condrioma desenvolvido, alto gasto
energético, riqueza de microfilamentos. Podemos afirmar que se
trata do tecido:

1. Caso houvesse disponibilidade de metano, amônia, hidrogênio


e água na atmosfera da Terra primitiva, tais compostos seriam
prováveis fontes de aminoácidos necessários à formação de
coacervados.
2. Os coacervados eram células eucariontes primitivas envoltas
por uma película de água e com funções básicas
intracelulares, como absorção e excreção.
3. Nos coacervados, as reações químicas eram promovidas com
energia de ativação fornecida pela radiação solar e pelas
descargas elétricas.

Está(ão) correta(s) apenas:


a) muscular estriado. a) 1 e 2
b) epitelial. b) 1 e 3
c) conjuntivo propriamente dito. c) 1
d) adiposo. d) 2
e) ósseo. e) 2 e 3

TEORIAS DA ORIGEM DA VIDA


1. (Upe 2013) O experimento, utilizando-se de frascos de vidro, FATORES LIMITANTES DA FOTOSSÍNTESE
com o formato de “pescoço de cisne”, contendo um “caldo 1. (Ufpr 2010) O gráfico abaixo representa o resultado de um
nutritivo” e submetido primeiramente ao isolamento e experimento em que foi medida a velocidade da fotossíntese em
posteriormente à exposição ao ar, conforme figura abaixo, foi função da temperatura na folha de um vegetal mantida sob
usado para se provar a origem da vida. iluminação constante.

Com base nesse gráfico e nos conhecimentos acerca do


processo de fotossíntese, assinale a alternativa correta.
a) A temperatura atua como fator limitante da fotossíntese porque
o calor desnatura as proteínas responsáveis pelo processo.
O autor e a teoria por ele provada foram, respectivamente: b) O aumento da temperatura ocasiona um aumento na
a) Charles Darwin e Teoria da Evolução. velocidade de fotossíntese porque a entrada de oxigênio na
b) Francesco Redi e Teoria da Abiogênese. folha torna-se mais rápida com o aumento da temperatura.
c) Aristóteles e Teoria da Geração Espontânea. c) O aumento da temperatura faz com que a fotossíntese se
d) Louis Pasteur e Teoria da Biogênese. acelere por conta do aumento da fosforilação cíclica
e) Louis Joblot e Teoria da Seleção Natural. dependente de O2.
d) Num experimento em que a temperatura fosse mantida
2. (Uespi 2012) O planeta abriga uma imensa diversidade constante e a luminosidade fosse aumentando, o resultado
biológica, cuja origem possivelmente ocorreu em lagos e oceanos permitiria a construção de um gráfico que seria igual ao
na Terra primitiva. Considerando que a formação de apresentado.
coacervados, ilustrada abaixo, poderia fornecer uma explicação e) Em temperaturas muito baixas, a velocidade da fotossíntese é
para o surgimento da vida, há bilhões de anos atrás, analise as pequena em consequência da baixa produção de CO2
afirmativas abaixo. necessário ao processo.
2. (Unicamp 2015) O crescimento das plantas é afetado pelo 2. (Unicamp 2013) A sabedoria de Sócrates, filósofo ateniense
balanço entre a fotossíntese e a respiração. O padrão de que viveu no século V a.C., encontra o seu ponto de partida na
resposta desses dois importantes processos fisiológicos em afirmação “sei que nada sei”, registrada na obra Apologia de
função da temperatura é apresentado nos gráficos abaixo, Sócrates. A frase foi uma resposta aos que afirmavam que ele
relativos a duas espécies de plantas. era o mais sábio dos homens. Após interrogar artesãos, políticos
e poetas, Sócrates chegou à conclusão de que ele se
diferenciava dos demais por reconhecer a sua própria ignorância.
O “sei que nada sei” é um ponto de partida para a Filosofia, pois
a) aquele que se reconhece como ignorante torna-se mais sábio
por querer adquirir conhecimentos.
b) é um exercício de humildade diante da cultura dos sábios do
passado, uma vez que a função da Filosofia era reproduzir os
ensinamentos dos filósofos gregos.
c) a dúvida é uma condição para o aprendizado e a Filosofia é o
saber que estabelece verdades dogmáticas a partir de
métodos rigorosos.
d) é uma forma de declarar ignorância e permanecer distante dos
problemas concretos, preocupando-se apenas com causas
Sobre as espécies X e Y, é correto afirmar: abstratas.
a) A espécie Y não apresenta ganho líquido de carbono a 15°C.
b) As duas espécies têm perda líquida de carbono a 45°C. DUURKEIM
c) A espécie Y crescerá menos do que a espécie X a 25°C. 1. (Interbits 2013)
d) As duas espécies têm ganho líquido de carbono a 45°C.

FILOSOFIA E SOCIOLOGIA: PARTE A


DEFINIÇÕES DE FILOSOFIA
1. (Unioeste 2010) “Reflexão significa movimento de volta sobre
si mesmo ou movimento de retorno a si mesmo. A reflexão é o
movimento pelo qual o pensamento volta-se para si mesmo,
interrogando a si mesmo. A reflexão filosófica é radical porque é
um movimento de volta do pensamento sobre si mesmo para
conhecer-se a si mesmo, para indagar como é possível o próprio
pensamento. Não somos, porém, somente seres pensantes.
Somos também seres que agem no mundo. [...] A reflexão
filosófica também se volta para essas relações que mantemos
com a realidade circundante, para o que dizemos e para as ações
que realizamos nessas relações.” (M. Chauí)
Sobre a Filosofia, conforme o texto acima, seguem as seguintes
afirmações:

I. Independentemente de seu conteúdo ou objeto, uma


característica fundamental da Filosofia é a indagação, a
interrogação.
II. A Filosofia direciona perguntas como “o que é?”, “por que é?” e Na tirinha acima, quase todas as pessoas possuem um
“como é?” ao mundo que nos cerca, ao próprio homem e às comportamento similar. Nesse caso específico, pode-se dizer que
relações que o homem estabelece. o consumo se tornou, segundo a abordagem durkheimiana:
III. A Filosofia não é algo importante porque não somos apenas a) Um fato social.
seres pensantes. b) Uma anomia social.
IV. A reflexão sobre o conhecer e o agir humanos fazem parte da c) Um erro social.
reflexão filosófica. d) Uma morte social.
V. A reflexão filosófica é radical porque é feita sem nenhum tipo e) Uma modalidade social.
de objetivo.
2. (Uel 2013) Leia o texto a seguir.
Das afirmações feitas acima
a) apenas as afirmativas I, II e IV estão corretas. Sentir-se muito angustiado com a ideia de perder seu celular ou
b) apenas as afirmativas I, II e III estão corretas. de ser incapaz de ficar sem ele por mais de um dia é a origem da
c) apenas as afirmativas I, II, III e V estão corretas. chamada “nomofobia”, contração de no mobile phobia, doença
d) todas as afirmativas estão corretas. que afeta principalmente os viciados em redes sociais que não
e) todas as afirmativas estão incorretas. suportam ficar desconectados. Uma parte da população acha
que, se não estiver conectada, perde alguma coisa. E se
perdemos alguma coisa, ou se não podemos responder
imediatamente, desenvolvemos formas de ansiedade ou b) Depressões interplanálticas semiáridas do Nordeste.
nervosismo. c) Chapadões recobertos por Cerrados.
d) Terras Baixas Florestadas da Amazônia.
(Adaptado de: O medo de não ter o celular à disposição cria nova e) Mares de Morros Florestados.
fobia. Disponível em: <exame.abril.com.br/estilo-de-
vida/comportamento/noticias/o-medo-de-nao-ter-o-celular-a- HIDROGRAFIA
disposicao-cria-nova-fobia>. Acesso em: 9 abr. 2012.) 1. (Fuvest 2015) As perspectivas ficaram mais pessimistas
porque a seca atual do Sistema Cantareira é mais crítica que a de
Com base no texto e nos conhecimentos sobre socialização e 1953, até então a pior da história e que servia de parâmetro para
instituições sociais, na perspectiva funcionalista de Durkheim, os técnicos dos governos estadual e federal.
assinale a alternativa correta. O Estado de S. Paulo, 17/03/2014. Adaptado.
a) A nomofobia reduz a possibilidade de anomia social na medida
em que aproxima o contato em tempo real dos indivíduos, Acerca da crise hídrica apontada no texto acima e vivida pela
fortalecendo a integração com a vida social. cidade de São Paulo e pela Região Metropolitana, é correto
b) As interações sociais via tecnologias digitais são uma forma de afirmar que a situação apresentada é de natureza, entre outras,
solidariedade mecânica, pois os indivíduos uniformizam seus a) geográfica e geopolítica, dado que a grave crise no
comportamentos. abastecimento experimentada por essa região levou à
c) O que faz de uma rede social virtual uma instituição é o fato de importação de água de outros estados, assim como de países
exercer um poder coercitivo e ao mesmo tempo desejável do Cone Sul.
sobre os indivíduos. b) social e demográfica, já que políticas públicas de incentivo às
d) O uso de interações sociais por recursos tecnológicos constitui migrações, na última década, promoveram o crescimento
um elemento moral a ser compreendido como fato social. desordenado da população em áreas que seriam destinadas a
e) Para a nomofobia ser considerada um fato social, faz-se represas e outros reservatórios de água.
necessário que esteja presente em uma diversidade de grupos c) climática e pedológica, pois as altas temperaturas durante o
sociais. ano provocaram a formação de chuva ácida e a consequente
laterização dos solos.
GEOGRAFIA: PARTE A d) econômica e jurídica, levando-se em conta a flexibilidade da
ESPAÇO GEOGRÁFICO legislação vigente em relação a desmatamentos em áreas de
1. (Uema 2015) Durante a 1ª fase da Copa de 2014 (fase de nascente para implantação de atividades industriais e
grupos), muitas seleções, diante das dimensões continentais do agrícolas.
Brasil, deslocaram-se pelos quatro cantos do território. A seleção e) ecológica e política, posto que a reposição de água dos
da República dos Camarões, por exemplo, jogou nas cidades de reservatórios depende de fatores naturais, assim como do
Natal, Manaus e Brasília. planejamento governamental sobre o uso desse recurso.

Durante o período em que estiveram nessas cidades, os 2. (G1 - ifsc 2015) DISTRIBUIÇÃO DOS RECURSOS
camaroneses encontraram, respectivamente, as seguintes HÍDRICOS, DA SUPERFÍCIE E DA POPULAÇÃO NO PAÍS (EM
características geográficas: %)
a) rio São Francisco em Natal, clima Equatorial em Manaus,
planaltos e serras de Goiás-Minas em Brasília. RECURSOS
REGIÃO SUPERFÍCIE POPULAÇÃO
b) Mata Atlântica em Natal, indústria de eletroeletrônicos em HÍDRICOS
Manaus, rio Paraná drenando as terras em Brasília. Norte 68,50 45,30 6,98
c) turismo e indústrias em Natal, rio Tocantins em Manaus, Centro-Oeste 15,70 18,80 6,41
serviços públicos federais em Brasília. Sul 6,50 6,80 15,05
d) clima tropical quente e úmido em Natal, Planície Amazônica Sudeste 6,00 10,80 42,65
em Manaus, domínio paisagístico de Cerrado em Brasília. Nordeste 3,30 18,30 28,91
e) planaltos e chapadas da bacia do Paranaíba em Natal, Total 100 100 100
Floresta Equatorial em Manaus, clima subtropical em Brasília.
Disponívelem:http://www.daescs.sp.gov.br/index.asp?dados=ensi
2. (Unesp 2015) Florestas tropicais recobrindo níveis de morros na&ensi=brasil. Acesso: 13 ago. 2014.
costeiros, escarpas terminais tipo “Serra do Mar” e setores
serranos mamelonizados dos planaltos compartimentados e Considerando os dados apresentados no quadro acima, assinale
acidentados do Brasil de Sudeste. Florestas biodiversas, dotadas a alternativa CORRETA.
de diferentes biotas primariamente recobrindo mais de 85% do a) Não há relação entre o crescimento populacional e o consumo
espaço total. O domínio tem mostrado ser o meio físico, ecológico de água, considerando-se que água é um recurso renovável.
e paisagístico mais complexo e difícil do país em relação às b) Infere-se do quadro acima que as maiores concentrações de
ações antrópicas. recursos hídricos estão no complexo regional da Nordeste,
onde é registrada a maior concentração populacional do Brasil.
Aziz Nacib Ab’Sáber. Os domínios de natureza no Brasil, 2003. c) Nas regiões Sul e Sudeste, para suprir a carência dos recursos
Adaptado. hídricos, uma das alternativas é substituir as hidroelétricas
pelas termoelétricas, geradas a partir do carvão mineral,
O domínio paisagístico brasileiro descrito no texto é o de considerado fonte renovável de energia como a água.
a) Planaltos das Araucárias.
d) As maiores concentrações populacionais do Brasil encontram-
se nas regiões, distantes dos grandes rios brasileiros, como o
rio Amazonas.
e) Os dados apresentados no quadro 1 indicam que o Brasil é
privilegiado no que diz respeito à quantidade de água,
considerando-se que sua distribuição é uniforme em todo
território nacional.

RELEVO
1. (Ufu 2015) d)

2. (Unicamp 2015) As restingas podem ser definidas como


depósitos arenosos produzidos por processos de dinâmica
costeira atual (fortes correntes de deriva litorânea, podendo
interagir com correntes de maré e fluxos fluviais), formando
feições alongadas, paralelas ou transversais à linha da costa.
Podem apresentar retrabalhamentos locais associados a
processos eólicos e fluviais. Quando estáveis, as restingas dão
forma às “planícies de restinga”, com desenvolvimento de
vegetação herbácea e arbustiva e até arbórea. As restingas são
áreas sujeitas a processos erosivos desencadeados, entre outros
fatores, pela dinâmica da circulação costeira, pela elevação do
nível relativo do mar e pela urbanização.

Considere a figura e assinale a quadrícula de curvas de nível que Adaptado de Célia Regina G. Souza e outros, Restinga: conceitos
se adéqua à paisagem exposta. e emprego do termo no Brasil e implicações na legislação
ambiental. São Paulo: Instituto Geológico, 2008.

É correto afirmar que as restingas existentes ao longo da faixa


litorânea brasileira são áreas
a) pouco sobrecarregadas dos ecossistemas costeiros, devido ao
modo como ocorreu a ocupação humana, com o processo de
urbanização.
b) onde a cobertura vegetal ocorre em mosaicos, encontrando-se
a) em praias, cordões arenosos, dunas, depressões, serras e
planaltos, sem apresentar diferenças fisionômicas importantes.
c) suscetíveis à erosão costeira causada, entre outros fatores, por
amplas zonas de transporte de sedimentos, elevação do nível
relativo do mar e urbanização acelerada.
d) onde o solo arenoso não apresenta dificuldade para a retenção
de água e o acesso a nutrientes necessários ao
desenvolvimento da cobertura vegetal herbácea em praias e
dunas.

b) HISTÓRIA: PARTE A
PERÍODO COLONIAL
1. (Fgv 2015) É a América Latina, as regiões das veias abertas.
Desde o descobrimento até nossos dias, tudo se transformou em
capital estrangeiro e como tal acumula-se até hoje. A causa
nacional latino-americana é, antes de tudo, uma causa social.

(Eduardo Galeano, As veias abertas da América Latina, 1978, p.


14 e 281. Adaptado)
c)
A partir do texto, é correto afirmar que
a) a luta na América pela ruptura do domínio espanhol manteve o
poder econômico dos criollos, somado ao poder político que
preservou a estrutura colonial, inclusive a escravidão, e
garantiu o livre comércio aos britânicos, enquanto a maioria
desapropriada, que lutou pela terra, continuou pobre e
excluída, submetida à elite, dominante internamente e
dominada externamente.
b) o processo de independência da América Latina transformou a Na busca das raízes do conceito de globalização, os historiadores
estrutura colonial, na medida em que a elite criolla aboliu a têm voltado suas atenções às grandes navegações, porque este
escravidão e promoveu a reforma agrária, diminuindo as momento histórico
distâncias sociais, ou seja, elaborou um projeto social próprio, a) permitiu, com anuência da Igreja, a formação de um verdadeiro
o que afastou os interesses britânicos, estimulou os mercado global de mão de obra escrava, composta de
investimentos nacionais e fez o Estado assumir sua própria indígenas.
identidade latino-americana. b) tornou a Igreja uma força política global, com hegemonia, por
c) o movimento de emancipação latino-americano restringiu-se exemplo, sobre todo o continente americano.
aos aspectos culturais, ou seja, não ocorreu a descolonização, c) representou a unificação dos mercados coloniais
pois a estrutura colonial permaneceu, exceção à escravidão, principalmente a partir do fornecimento de gêneros de
obstáculo ao avanço do liberalismo, abolida pelos criollos para subsistência.
garantir o consumo dos produtos franceses, já que o projeto d) foi decisivo na expansão da atividade comercial para além das
político dos proprietários estava em sintonia com os interesses fronteiras europeias e na ampliação dos mercados.
externos capitalistas.
d) a ruptura latino-americana com a metrópole espanhola foi 2. (Ufrgs 2015) Com o processo de expansão marítima,
revolucionária, na medida em que as classes dominantes empreendido nos séculos XV e XVI, Portugal constituiu-se como
locais, os criollos, perderam o poder que tinham na estrutura um império ultramarino, espalhado em diversas regiões do globo.
colonial, graças à luta social dos não-proprietários que
promoveram a descolonização e implantaram um projeto Assinale com V (verdadeiro) ou F (falso) as afirmações abaixo,
político identificado com os interesses populares, como o fim sobre a história do Império português e da colonização no Brasil.
da escravidão, a reforma agrária e o voto universal.
e) o movimento de quebra dos laços coloniais ocorreu de forma ( ) A organização das instituições eclesiásticas nas colônias
violenta, no qual a maioria não proprietária teve papel decisivo, lusitanas foi estabelecida a partir da subordinação do
transformando a luta em uma causa social, destruindo a Estado português à Igreja católica, prevista no chamado
estrutura colonial e construindo um projeto político que padroado régio.
atendeu tanto aos interesses dos criollos como aos dos ( ) O Estado português valeu-se, pela primeira vez no Brasil, do
ingleses, isto é, fornecer produtos para o mercado externo e trabalho escravo de africanos, posteriormente estendendo
consumir os produtos industrializados. o mesmo procedimento ao conjunto das suas colônias.
( ) A estrutura política do Império português foi marcada por
2. (Ufrgs 2015) Considere as afirmações abaixo, sobre o Império redes de poder locais que permitiam aos colonos um
Espanhol nas Américas, nos séculos XVI e XVII. considerável grau de autonomia política e econômica,
tornando, muitas vezes, conflitivas as relações entre
I. O Peru e o México, conquistados, respectivamente, dos incas e metrópole e colônias.
dos astecas, foram as regiões mais importantes desse império. ( ) Os colonos e os mercadores estabelecidos no Brasil não
II. Uma das principais atividades econômicas foi a mineração, mantinham relações comerciais com as colônias africanas,
centrada principalmente na região de Potosí, na atual Bolívia. pois todo o sistema mercantil português estava centrado na
III. A política econômica da metrópole privilegiou o livre-comércio metrópole, por onde necessariamente passavam os
entre as possessões espanholas e outras regiões europeias, produtos comercializados.
com suas colônias.
A sequência correta de preenchimento dos parênteses, de cima
Quais estão corretas? para baixo, é
a) Apenas I. a) V - V - V- F.
b) Apenas I e II. b) V - V - F - V.
c) Apenas I e III. c) F - F - V - F.
d) Apenas II e III. d) F - V - V - F.
e) I, II e III. e) F - F - F - V.

EXPANSÃO MARITMO-COMERCIAL
1. (Ufu 2015) Se essa passagem de século tem hoje um sentido MERCANTILISMO
para nós, um sentido que talvez não tinha nos séculos anteriores, 1. (Ufpr 2015) Leia o texto abaixo sobre práticas protecionistas
é porque vemos que aí é que surgem as primícias da recentes:
globalização. E essa globalização é mais que um processo de
expansão de origem ibérica. Em 1500, ainda estamos bem longe “(...) Tanto o Brasil quanto os EUA adotaram medidas
de uma economia mundial. No limiar do século XVI, a protecionistas nos últimos cinco anos. As duas principais razões
globalização corresponde ao fato de setores do mundo que se foram a crise econômica internacional e a concorrência da China.
ignoravam ou não se frequentavam diretamente serem postos em Do lado americano, o principal instrumento foi a concessão de
contato uns com os outros. subsídios. Já o Brasil fez uso de tarifas de importação, defesa
comercial e requisitos de conteúdo local.”
GRUZINSKI, Serge. A passagem do século: 1480-1520 – as BONOMO, Diego. Protecionismo brasileiro e americano. Folha de
origens da globalização. São Paulo: Companhia das Letras, 1999, S. Paulo, 10 de outubro de 2012, p. 3.
p. 96-98. (Adaptado).
Assinale a alternativa correta que identifica as diferenças de REFORMA RELIGIOSA
contexto histórico e econômico em que a prática do protecionismo 1. (Uece 2015) “(...) Anna é então interrogada – a 1º de janeiro
foi adotada no período atual e no período da Idade Moderna de 1582 – pelo Santo Ofício. Inicialmente, ela se esquiva das
europeia (século XV-XVIII). perguntas do inquisidor; depois, admite que ‘muitas e muitas
a) No período moderno, o protecionismo era parte integrante do pessoas’ lhe têm perguntado se ela viu os seus parentes
renascimento comercial, caracterizado por intervencionismo falecidos, mas ela costuma mandá-los embora rudemente. É uma
estatal, balança comercial favorável e imperialismo; no período defesa fraca; pressionada, Anna ‘nesciebat quid dicere’ (não
atual, o protecionismo é alvo de contestações em nome da sabia o que dizer). Foi mandada para casa, e no dia seguinte o
liberdade de mercado, num contexto de capitalismo financeiro interrogatório recomeçou(...)”
neoliberal.
b) No período moderno, o protecionismo era parte integrante do GINZBURG, C. Os andarilhos do bem. Feitiçaria e cultos agrários
iluminismo, caracterizado por políticas fisiocráticas, subsídios nos séculos XVI e XVII. Trad. Jônatas Batista neto. São Paulo:
estatais à agricultura e à manufatura, pacto colonial e Companhia das Letras, 2010.
metalismo; no período atual, o protecionismo é alvo de ações
antidumping por parte de países em desenvolvimento, num Sobre o Santo Ofício, é correto afirmar que
contexto de capitalismo financeiro globalizado. a) foi um colégio permanente de cardeais e clérigos submetidos
c) No período moderno, o protecionismo era parte integrante do diretamente ao Papa que respondiam sobre questões da fé
mercantilismo, caracterizado por intervencionismo estatal, católica.
metalismo, balança comercial favorável e colonialismo; no b) foi uma instituição para-eclesiástica cuja função era interrogar
período atual, o protecionismo é alvo de contestações em e punir doutrinas contrárias à ortodoxia católica.
nome da liberdade de mercado, num contexto de capitalismo c) foi um movimento da Igreja católica na primeira metade do
financeiro globalizado. século XVI com o objetivo de reformar alguns setores da
d) No período moderno, o protecionismo era parte integrante do instituição.
mercantilismo, caracterizado por imperialismo, padrão-ouro e d) foi um grupo militarizado, com fins religiosos, políticos e
intervencionismo estatal; no período atual, o protecionismo é culturais, criado no século XVI para proteger o Papa em Roma.
alvo de contestações de países desenvolvidos em nome da
liberdade de mercado, num contexto de capitalismo financeiro 2. (Imed 2015) A Reforma Protestante é resultado de
monopolista. transformações socioeconômicas e políticas que vinham
e) No período moderno, o protecionismo era parte integrante do ocorrendo na Europa Ocidental, dentre elas:
liberalismo, caracterizado por fisiocracia, metalismo, incentivo
à maquinofatura e pacto colonial; no período atual, o I. O desenvolvimento da burguesia.
protecionismo é alvo de ações antitruste em nome da II. O crescimento das relações de produção capitalistas.
liberdade de mercado, num contexto de capitalismo financeiro III. O fortalecimento do Estado Nacional absolutista.
globalizado.
Quais estão corretas?
2. (Uern 2015) Os descobrimentos marítimos europeus do século a) Apenas II.
XVI estão inseridos no contexto da política mercantilista. Essa b) Apenas I e II.
política, segundo o historiador Fernand Braudel “(...) reagrupa c) Apenas I e III.
comodamente uma série de atos e de atitudes, de projetos, de d) Apenas II e III.
ideias, de experiências que marcam, entre o século XV e XVIII, a e) I, II e III.
primeira afirmação do Estado moderno em relação aos problemas
concretos que ele tinha que enfrentar”. MATEMÁTICA: PARTE A
FUNÇÃO EXPONENCIAL
(BRAUDEL, Fernand, Civilisation, Èconomie et Capitalisme, XVº 1. (Ufpr 2014) Uma pizza a 185°C foi retirada de um forno
XVIIIº Siècle; le Jeux de L’èchange. Paris: Armand Coln, 1979. in: quente. Entretanto, somente quando a temperatura atingir 65°C
MARQUES, 2006.) será possível segurar um de seus pedaços com as mãos nuas,
sem se queimar. Suponha que a temperatura T da pizza, em
graus Celsius, possa ser descrita em função do tempo t, em
Tendo em vista a afirmação de Braudel e as características do minutos, pela expressão T  160  20,8t  25. Qual o tempo
mercantilismo, assinale a única alternativa correta referente a um necessário para que se possa segurar um pedaço dessa pizza
princípio ou ideia mercantilista. com as mãos nuas, sem se queimar?
a) A liberdade econômica e o individualismo financeiro devem a) 0,25 minutos.
prevalecer acima do bem comum e das políticas públicas. b) 0,68 minutos.
b) Todas as relações sociais de produção devem ser definidas c) 2,5 minutos.
pela liberdade de contrato entre capital e trabalho, visando o d) 6,63 minutos.
lucro coletivo. e) 10,0 minutos.
c) É preciso crer que leis naturais regem o comércio e as
indústrias, e devem, portanto, agir de acordo com a “mão 2. (Pucmg 2010) O valor de certo equipamento, comprado por
invisível” da economia. R$60.000,00, é reduzido à metade a cada 15 meses. Assim, a
d) A maneira ideal de se acumular riquezas é fazer com que mais t
mercadorias sejam vendidas e menor quantidade seja 
equação V (t) = 60.000. 2 15 , onde t é o tempo de uso em
comprada pelo país.
meses e V(t) é o valor em reais, representa a variação do valor fazer um único tipo de empacotamento, obtendo um lucro
desse equipamento. Com base nessas informações, é máximo. Para obter o lucro máximo nas vendas, os pacotes
CORRETO afirmar que o valor do equipamento após 45 meses devem conter uma quantidade de bonés igual a
de uso será igual a: a) 4.
a) R$ 3.750,00 b) 6.
b) R$ 7.500,00 c) 9.
c) R$10.000,00 d) 10.
d) R$20.000,00 e) 14.

FUNÇÃO QUADRÁTICA 2. (Uern 2012) Seja uma função do 2º grau y = ax2 + bx + c, cujo
1. (Espcex (Aman) 2014) Uma indústria produz mensalmente x gráfico está representado a seguir.
lotes de um produto. O valor mensal resultante da venda deste
produto é V(x)  3x2  12x e o custo mensal da produção é
dado por C(x)  5x2  40x  40. Sabendo que o lucro é obtido
pela diferença entre o valor resultante das vendas e o custo da
produção, então o número de lotes mensais que essa indústria
deve vender para obter lucro máximo é igual a
a) 4 lotes.
b) 5 lotes.
c) 6 lotes.
d) 7 lotes.
e) 8 lotes.
A soma dos coeficientes dessa função é
2. (G1 - ifsc 2012) A receita obtida pela venda de um a) – 2.
determinado produto é representada pela função R(x) = – x2 + b) – 3.
100x, onde x é a quantidade desse produto. O gráfico da referida c) – 4.
função é apresentado abaixo. d) – 6.

GRÁFICOS
1. (Unicamp 2013) A figura abaixo mostra a precipitação
pluviométrica em milímetros por dia (mm/dia) durante o último
verão em Campinas. Se a precipitação ultrapassar 30 mm/dia, há
um determinado risco de alagamentos na região. De acordo com
o gráfico, quantos dias Campinas teve este risco de alagamento?

a) 2 dias.
b) 4 dias.
c) 6 dias.
É CORRETO afirmar que as quantidades a serem d) 10 dias.
comercializadas para atingir a receita máxima e o valor máximo
da receita são, respectivamente, 2. (Insper 2014) Um leitor enviou a uma revista a seguinte
a) 50 e 2.000. análise de um livro recém-lançado, de 400 páginas:
b) 25 e 2.000.
c) 100 e 2.100. “O livro é eletrizante, muito envolvente mesmo! A cada página
d) 100 e 2.500. terminada, mais rápido eu lia a próxima! Não conseguia parar!”
e) 50 e 2.500.
Dentre os gráficos apresentados abaixo, o único que poderia
FUNÇÃO QUADRÁTICA representar o número de páginas lidas pelo leitor (N) em função
1. (Enem PPL 2013) Uma pequena fábrica vende seus bonés em do tempo (t) de modo a refletir corretamente a análise feita é
pacotes com quantidades de unidades variáveis. O lucro obtido é
dado pela expressão L(x) = −x2 + 12x − 20, onde x representa a
quantidade de bonés contidos no pacote. A empresa pretende
Admitindo que a espessura do acrílico seja desprezível e que
3  1,7, a área, em cm2 , do triângulo CAE equivale a:
a) 80
b) 100
c) 140
d) 180

a) 2. (Fuvest 2014) Uma das piscinas do Centro de Práticas


Esportivas da USP tem o formato de três hexágonos regulares
congruentes, justapostos, de modo que cada par de hexágonos
tem um lado em comum, conforme representado na figura abaixo.
A distância entre lados paralelos de cada hexágono é de 25
metros.

b)

c)

Assinale a alternativa que mais se aproxima da área da piscina.


a) 1.600 m2
b) 1.800 m2
c) 2.000 m2
d) 2.200 m2
d) e) 2.400 m2

ÁREAS DAS FIGURAS PLANAS


1. (Uerj 2013) Para confeccionar uma bandeirinha de festa
junina, utilizou-se um pedaço de papel com 10 cm de largura e 15
cm de comprimento, obedecendo-se às instruções abaixo.

1. Dobrar o papel ao meio, para marcar o segmento MN, e abri-lo


e) novamente:

ÁREAS DAS FIGURAS PLANAS


1. (Uerj 2014) Considere uma placa retangular ABCD de
acrílico, cuja diagonal AC mede 40cm. Um estudante, para
construir um par de esquadros, fez dois cortes retos nessa placa
nas direções AE e AC, de modo que DAE ˆ  45° e
BACˆ  30°, conforme ilustrado a seguir:

2. Dobrar a ponta do vértice B no segmento AB’, de modo que B


coincida com o ponto P do segmento MN:

Após isso, o estudante descartou a parte triangular CAE,


restando os dois esquadros.
Sabe-se que a engrenagem menor dá 1000 voltas no mesmo
3. Desfazer a dobra e recortar o triângulo ABP. tempo em que a maior dá 375 voltas, e que os comprimentos
dos dentes de ambas têm valores desprezíveis.
A medida, em centímetros, do raio da engrenagem menor
equivale a:
a) 2,5
b) 3,0
c) 3,5
d) 4,0

2. (Uerj 2012) A figura abaixo representa um círculo de centro O


e uma régua retangular, graduada em milímetros. Os pontos A, E
A área construída da bandeirinha APBCD, em cm2, é igual a: e O pertencem à régua e os pontos B, C e D pertencem,
a) 25  4  3  simultaneamente, à régua e à circunferência.

b) 25  6  3 
c) 50  2  3 
d) 50  3  3 

2. (G1 - ifsp 2014) Uma praça retangular é contornada por uma


calçada de 2 m de largura e possui uma parte interna retangular
de dimensões 15 m por 20 m, conforme a figura. Considere os seguintes dados

Medida
Segmentos
(cm)
AB 1,6
ED 2,0
EC 4,5

O diâmetro do círculo é, em centímetros, igual a:


a) 3,1
b) 3,3
c) 3,5
Nessas condições, a área total da calçada é, em metros d) 3,6
quadrados, igual a
a) 148. POLÍGONOS
b) 152. 1. (G1 - ifsp 2013) Uma pessoa pegou um mapa rasgado em que
c) 156. constava um terreno delimitado por quatro ruas. Na parte visível
d) 160. do mapa, vê-se que o ângulo formado pela rua Saturno e pela rua
e) 164. Júpiter é 90°; o ângulo formado pela rua Júpiter e pela rua
Netuno é 110° e o ângulo formado pela rua Netuno e pela rua
CIRCUNFÊNCIA E CÍRCULO Marte é 100°. Nessas condições, a medida de um ângulo
1. (Uerj 2014) Uma máquina possui duas engrenagens formado pelas ruas Marte e Saturno, na parte rasgada do mapa,
circulares, sendo a distância entre seus centros A e B igual a é de
11cm, como mostra o esquema:

a) 50°.
b) 60°.
c) 70°.
d) 80°.
e) 90°.
2. (G1 - cftrj 2013) Manuela desenha os seis vértices de um
hexágono regular (figura abaixo) e une alguns dos seis pontos
com segmentos de reta para obter uma figura geométrica. Essa
figura não é seguramente um

Nessas condições, a medida de A B̂ O, em radianos, é igual a:


a) ð - (á/4)
a) retângulo b) ð - (á/2)
b) trapézio c) ð - (2á/3)
c) quadrado d) ð - (3á/4)
d) triângulo equilátero e) ð - (3á/2)

RELAÇÕES MÉTRICAS EM UM TRIÂNGULO QUALQUER SEMELHANÇA DE TRIÂNGULOS


1. (Cefet MG 2014) A figura abaixo tem as seguintes 1. (Pucrj 2013) O retângulo DEFG está inscrito no triângulo
características: isósceles ABC, como na figura abaixo:

- o ângulo Ê é reto;
- o segmento de reta AE é paralelo ao segmento BD;
- os segmentos AE, BD e DE, medem, respectivamente, 5, 4 e
3.

Assumindo DE = GF = 12, EF = DG = 8 e AB = 15, a altura


do triângulo ABC é:
35
a)
4
150
b)
O segmento AC, em unidades de comprimento, mede 7
90
a) 8. c)
b) 12. 7
c) 13. 180
d)
d) 61. 7
28
e) 5 10. e)
5
2. (Fuvest 2009) Na figura, B, C e D são pontos distintos da
circunferência de centro O, e o ponto A é exterior a ela. Além 2. (Ufpr 2011) Um telhado inclinado reto foi construído sobre três
disso, suportes verticais de aço, colocados nos pontos A, B e C, como
mostra a figura ao lado. Os suportes nas extremidades A e C
(1) A, B, C, e A, O, D, são colineares; medem, respectivamente, 4 metros e 6 metros de altura.
(2) AB = OB;
(3) CÔD mede á radianos.
A altura do suporte em B é, então, de: c) possuir raio e carga relativamente próximos aos de íons
a) 4,2 metros. metálicos que atuam nos processos biológicos, causando
b) 4,5 metros. interferência nesses processos.
c) 5 metros. d) apresentar raio iônico grande, permitindo que ele cause
d) 5,2 metros. interferência nos processos biológicos em que, normalmente,
e) 5,5 metros. íons menores participam.
e) apresentar carga +2, o que permite que ele cause interferência
QUÍMICA: PARTE A nos processos biológicos em que, normalmente, íons com
CLASSIFICAÇÃO PERIÓDICA DOS ELEMENTOS cargas menores participam.
1. (Fuvest 2014) Observe a posição do elemento químico ródio
(Rh) na tabela periódica. DESCRITIVA
1. (Enem 1999) A água do mar pode ser fonte de materiais
utilizados pelo ser humano, como os exemplificados no esquema
a seguir.

Assinale a alternativa correta a respeito do ródio.


a) Possui massa atômica menor que a do cobalto (Co).
Os materiais I, II, III e IV existem como principal constituinte ativo
b) Apresenta reatividade semelhante à do estrôncio (Sr),
de produtos de uso rotineiro. A alternativa que associa
característica do 5º período.
corretamente ÁGUA SANITÁRIA, FERMENTO EM PÓ E
c) É um elemento não metálico.
SOLUÇÃO FISIOLÓGICA com os materiais obtidos da água do
d) É uma substância gasosa à temperatura ambiente.
mar é:
e) É uma substância boa condutora de eletricidade.
a) água sanitária - II; fermento em pó - III; solução fisiológica - IV
b) água sanitária - III; fermento em pó - I; solução fisiológica - IV
2. (Enem 2ª aplicação 2010) O cádmio, presente nas baterias,
c) água sanitária - III; fermento em pó - IV; solução fisiológica - I
pode chegar ao solo quando esses materiais são descartados de
d) água sanitária - II; fermento em pó - III; solução fisiológica - I
maneira irregular no meio ambiente ou quando são incinerados.
e) água sanitária - I; fermento em pó - IV; solução fisiológica - III
Diferentemente da forma metálica, os íons Cd2+ são
extremamente perigosos para o organismo, pois eles podem
2. (Enem 2001) Considere os seguintes acontecimentos
substituir íons Ca2+, ocasionando uma doença degenerativa dos
ocorridos no Brasil:
ossos, tornando-os muito porosos e causando dores intensas nas
- Goiás, 1987 - Um equipamento contendo césio radioativo,
articulações. Podem ainda inibir enzimas ativadas pelo cátion
utilizado em medicina nuclear, foi encontrado em um depósito
Zn2+, que são extremamente importantes para o funcionamento
de sucatas e aberto por pessoa que desconhecia o seu
dos rins. A figura mostra a variação do raio de alguns metais e
conteúdo. Resultado: mortes e consequências ambientais
seus respectivos cátions.
sentidas até hoje.
- Distrito Federal, 1999 - Cilindros contendo cloro, gás bactericida
utilizado em tratamento de água, encontrados em um depósito
de sucatas, foram abertos por pessoa que desconhecia o seu
conteúdo. Resultado: mortes, intoxicações e consequências
ambientais sentidas por várias horas.

Para evitar que novos acontecimentos dessa natureza venham a


ocorrer, foram feitas as seguintes propostas para a atuação do
Estado:
I. Proibir o uso de materiais radioativos e gases tóxicos.
II. Controlar rigorosamente a compra, uso e destino de materiais
radioativos e de recipientes contendo gases tóxicos.
III. Instruir usuários sobre a utilização e descarte destes materiais.
IV. Realizar campanhas de esclarecimentos à população sobre os
Com base no texto, a toxicidade do cádmio em sua forma iônica é riscos da radiação e da toxicidade de determinadas
consequência de esse elemento substâncias.
a) apresentar baixa energia de ionização, o que favorece a Dessas propostas, são adequadas apenas
formação do íon e facilita sua ligação a outros compostos. a) I e II. b) I e III. c) II e III.
b) possuir tendência de atuar em processos biológicos mediados d) I, III e IV. e) II, III e IV.
por cátions metálicos com cargas que variam de +1 a +3.
ELETRÓLITOS
1. (Ueg 2006) Por muito tempo, na maioria das escolas, as aulas EQUACIONAMENTO E BALANCEAMENTO DE REAÇÕES
de Química eram ministradas apenas sob forma de transmissão 1. (Mackenzie 2014) A respeito da equação iônica de
de conteúdos. Nos dias atuais, muitos professores utilizam a oxirredução abaixo, não balanceada, são feitas as seguintes
experimentação para enriquecerem suas aulas. afirmações:
Uma professora realizou junto com seus alunos as experiências
da figura 1: IO3  HSO3  I2  SO42  H  H2O

I. a soma dos menores coeficientes inteiros possível para o


balanceamento é 17.
II. o agente oxidante é o ânion iodato.
III. o composto que ganha elétrons sofre oxidação.
IV. o Nox do enxofre varia de +5 para +6.

Das afirmações acima, estão corretas somente


a) II e III. b) I e II. c) I e III. d) II e IV. e) I e IV.

2. (Enem 2014) A liberação dos gases clorofluorcarbonos (CFCs)


na atmosfera pode provocar depleção de ozônio (O3 ) na
estratosfera. O ozônio estratosférico é responsável por absorver
parte da radiação ultravioleta emitida pelo Sol, a qual é nociva
A seguir, os alunos fizeram as seguintes afirmações: aos seres vivos. Esse processo, na camada de ozônio, é ilustrado
I. A solução de água e açúcar é considerada uma solução simplificadamente na figura.
eletrolítica.
II. A solução de água e sal permite a passagem de corrente
elétrica.
III. As substâncias moleculares como HCℓ, NaCℓ e C12H22O11,
quando dissolvidas em água, sofrem ionização.
IV. Água e ácido sulfúrico, quando puros, praticamente não
conduzem corrente elétrica, porém uma solução de H2SO4 em
água é uma boa condutora de eletricidade.
Assinale a alternativa CORRETA: Quimicamente, a destruição do ozônio na atmosfera por gases
a) Apenas as afirmações I, II e III são verdadeiras. CFCs é decorrência da
b) Apenas as afirmações I e III são verdadeiras. a) clivagem da molécula de ozônio pelos CFCs para produzir
c) Apenas as afirmações II e IV são verdadeiras. espécies radicalares.
d) Todas as afirmações são verdadeiras. b) produção de oxigênio molecular a partir de ozônio, catalisada
por átomos de cloro.
2. (Ufsm 2015) Sal, vilão ou mocinho? c) oxidação do monóxido de cloro por átomos de oxigênio para
Substância imprescindível ao equilíbrio das funções orgânicas, o produzir átomos de cloro.
cloreto de sódio pode produzir efeitos indesejados se consumido d) reação direta entre os CFCs e o ozônio para produzir oxigênio
em excesso. A demanda natural desse composto fez com que ele molecular e monóxido de cloro.
superasse o ouro como valor estratégico e fosse base para e) reação de substituição de um dos átomos de oxigênio na
molécula de ozônio por átomos de cloro.
remunerar o trabalho. Tanto os íons Na como os C  são
essenciais para a manutenção da vida animal, controlando o FÓRMULAS
volume de líquidos e a manutenção da pressão arterial. 1. (Unicamp simulado 2011) Pesquisas recentes sugerem uma
ingestão diária de cerca de 2,5 miligramas de resveratrol, um dos
Fonte: Scientific American Brasil, Ano II, n. 16, p. 50, 2013. (adaptado) componentes encontrados em uvas escuras, para que se
obtenham os benefícios atribuídos a essas uvas.
O sal apresenta inúmeras utilidades, sendo considerado o mais
antigo aditivo alimentar. Dentre os usos do NaC , destaca-se o
soro fisiológico, uma solução 0,9% de cloreto de sódio.
Com base nessas informações, e correto afirmar que a solução é
do tipo
a) eletrolítica e a concentração do sal é de 0,015 molL1. Considere a fórmula estrutural da molécula dessa substância:
De acordo com essa fórmula, o resveratrol é um
b) não eletrolítica e a concentração do sal é de 0,900 molL1.
a) polifenol de fórmula molecular C14H12O3.
c) eletrolítica e a concentração do sal é de 0,900 molL1. b) ácido orgânico de fórmula molecular C14H12O3.
d) não eletrolítica e a concentração do sal é de 0,154 molL . 1 c) triol de fórmula molecular C14H3O3.
d) ácido orgânico de fórmula molecular C14H3O3.
e) eletrolítica e a concentração do sal é de 0,154 molL1.
2. (Enem 2010) O fósforo, geralmente representado pelo íon de
fosfato (PO4–3), é um ingrediente insubstituível da vida, já que é
parte constituinte das membranas celulares e das moléculas do
DNA e do trifosfato de adenosina (ATP), principal forma de
armazenamento de energia das células.
O fósforo utilizado nos fertilizantes agrícolas é extraído de minas,
b)
cujas reservas estão cada vez mais escassas.
Certas práticas agrícolas aceleram a erosão do solo, provocando
o transporte de fósforo para sistemas aquáticos, que fica
imobilizado nas rochas. Ainda, a colheita das lavouras e o
transporte dos restos alimentares para os lixões diminuem a
disponibilidade dos íons no solo. Tais fatores têm ameaçado a
sustentabilidade desse íon. c)
Uma medida que amenizaria esse problema seria:
a) Incentivar a reciclagem de resíduos biológicos, utilizando
dejetos animais e restos de culturas para produção de adubo.
b) Repor o estoque retirado das minas com um íon sintético de
fósforo para garantir o abastecimento da indústria de
fertilizantes.
d)
c) Aumentar a importação de íons fosfato dos países ricos para
suprir as exigências das indústrias nacionais de fertilizantes.
d) Substituir o fósforo dos fertilizantes por outro elemento com a
mesma função para suprir as necessidades do uso de seus
íons.
e) Proibir, por meio de lei federal, o uso de fertilizantes com
fósforo pelos agricultores, para diminuir sua extração das e)
reservas naturais.
INDICADORES
FUNÇÕES INORGÂNICAS 1. (Cefet MG 2014) Um professor de Química propôs a
1. (Unicamp 2013) Em junho de 2012 ocorreu na cidade do Rio manipulação de um indicador ácido-base que se comportasse da
de Janeiro a Conferência Rio+20. Os principais focos de seguinte maneira:
discussão dessa conferência diziam respeito à sustentabilidade
do planeta e à poluição da água e do ar. Em relação a esse pH Cor da solução
último aspecto, sabemos que alguns gases são importantes para <7 amarela
a vida no planeta. A preocupação com esses gases é justificada, =7 alaranjada
pois, de um modo geral, pode-se afirmar que >7 vermelha
a) o CH4 e o CO2 estão relacionados à radiação ultravioleta, o O3,
à chuva ácida e os NOx, ao efeito estufa. As cores das soluções aquosas de NaCN, NaC e NH4C , na
b) o CH4 está relacionado à radiação ultravioleta, o O3 e o CO2,
ao efeito estufa e os NOx, à chuva ácida. presença desse indicador, são, respectivamente
c) os NOx estão relacionados ao efeito estufa, o CH4 e o CO2, à a) amarela, alaranjada e vermelha.
radiação ultravioleta e o O3, à chuva ácida. b) amarela, vermelha e alaranjada.
d) o O3 está relacionado à radiação ultravioleta, o CH4 e o CO2, c) vermelha, alaranjada e amarela.
ao efeito estufa e os NOx, à chuva ácida. d) alaranjada, amarela e vermelha.
e) alaranjada, amarela e alaranjada.
2. (Fuvest 2012) Observa-se que uma solução aquosa saturada
de HC libera uma substância gasosa. Uma estudante de TEXTO PARA A PRÓXIMA QUESTÃO:
O suco extraído do repolho roxo pode ser utilizado como
química procurou representar, por meio de uma figura, os tipos de
indicador do caráter ácido (pH entre 0 e 7) ou básico (pH entre 7
partículas que predominam nas fases aquosa e gasosa desse
e 14) de diferentes soluções. Misturando-se um pouco de suco de
sistema – sem representar as partículas de água. A figura com a
repolho e da solução, a mistura passa a apresentar diferentes
representação mais adequada seria
cores, segundo sua natureza ácida ou básica, de acordo com a
escala adiante.
Algumas soluções foram testadas com esse indicador,
produzindo os seguintes resultados:

a)
MUDANÇAS DE ESTADO
1. (Unesp 2012) Os compostos orgânicos possuem interações
fracas e tendem a apresentar temperaturas de ebulição e fusão
menores do que as dos compostos inorgânicos. A tabela
apresenta dados sobre as temperaturas de ebulição e fusão de
alguns hidrocarbonetos.

Substância TE (ºC) TF (ºC)


metano -162 -182
propano - 42 -188
eteno -104 -169
propino -23 -101
2. (Enem 2000) De acordo com esses resultados, as soluções I,
II, III e IV têm, respectivamente, caráter-. Na temperatura de –114 ºC é correto afirmar que os estados
a) ácido / básico / básico / ácido. físicos em que se encontram os compostos, metano, propano,
b) ácido / básico / ácido / básico. eteno e propino, são, respectivamente,
c) básico / ácido / básico / ácido. a) sólido, gasoso, gasoso e líquido.
d) acido / ácido / básico / básico. b) líquido, sólido, líquido e sólido.
e) básico/básico/ácido/ácido. c) líquido, gasoso, sólido e líquido.
d) gasoso, líquido, sólido e gasoso.
MASSA ATÔMICA e) gasoso, líquido, líquido e sólido.
1. (Enem 2013) O brasileiro consome em média 500 miligramas
de cálcio por dia, quando a quantidade recomendada é o dobro. 2. (G1 - ifsp 2012) Um frasco de amostra contendo três
Uma alimentação balanceada é a melhor decisão pra evitar substâncias químicas, A, B e C, foi enviado a um laboratório
problemas no futuro, como a osteoporose, uma doença que químico para ser analisado. O rótulo apresenta os seus pontos de
atinge os ossos. Ela se caracteriza pela diminuição substancial de fusão (P.F.) e pontos de ebulição (P.E.) à pressão de 1 atm
massa óssea, tornando os ossos frágeis e mais suscetíveis a conforme o quadro a seguir:
fraturas. Substância P.F. ºC P.E. ºC
Disponível em: www.anvisa.gov.br. Acesso em: 1 ago. 2012 A - 114 78
(adaptado). B 43 182
23 1
Considerando-se o valor de 6  10 mol para a constante de C - 218 - 183
Avogadro e a massa molar do cálcio igual a 40 g/mol, qual a A primeira medida tomada pelo técnico químico foi determinar o
quantidade mínima diária de átomos de cálcio a ser ingerida para estado físico das substâncias à temperatura de 25 ºC. A
que uma pessoa supra suas necessidades? conclusão a que ele chegou em relação às substâncias,
respectivamente, de cima para baixo foi:
a) 7,5  1021 b) 1,5  1022 c) 7,5  1023 a) líquido, sólido, gasoso.
d) 1,5  1025 e) 4,8  1025 b) sólido, gasoso, líquido.
c) sólido, líquido, gasoso.
2. (G1 - ifpe 2012) Bebidas isotônicas são desenvolvidas com a d) líquido, gasoso, sólido.
finalidade de prevenir a desidratação, repondo líquidos e sais e) gasoso, líquido, sólido.
minerais que são eliminados através do suor durante o processo
de transpiração. Considere um isotônico que apresenta as PORTUGUÊS: PARTE A
informações no seu rótulo: TEXTOS CIENTÍFICOS

TABELA NUTRICIONAL TEXTO PARA AS PRÓXIMAS 2 QUESTÕES:


CADA 200mL CONTÉM A busca por vida fora da Terra
Energia 21,1 kcal
Glucídios 6,02g Um sinal eletrônico é emitido pelo Laboratório de Propulsão a
Proteínas 0,0 g Jato (JPL, sigla em inglês) da NASA, em Pasadena, Califórnia, e
Lipídios 0,0 g viaja até um robô fixado na parte inferior da camada de gelo de
30 centímetros de espessura em um lago do extremo norte do
Fibra alimentar 0,0 g
Alasca. O holofote do robô começa a brilhar. “Funcionou!”,
Sódio 69 mg
exclama John Leichty, um jovem engenheiro do JPL, que está em
Potássio 78 mg
uma barraca perto do lago congelado. Embora não pareça uma
grande façanha tecnológica, esse talvez seja o primeiro passo
Assinale a alternativa que corresponde à concentração, em para a exploração de uma lua distante.
quantidade de matéria (mol/L), de sódio e potássio,
respectivamente, nesse recipiente de 200 mL. Mais de sete mil quilômetros ao sul do Alasca, no México, a
geomicrobióloga Penelope Boston caminha por uma água turva
São dadas as massas molares, em g/mol: Na = 23 e K = 39.
que bate em seus tornozelos, em uma gruta, cerca de 15 metros
a) 0,020 e 0,02 b) 0,015 e 0,01 c) 0,22 e 0,120 abaixo da superfície. Como os outros cientistas que a
d) 0,34 e 0,980 e) 0,029 e 0,003
acompanham, Penelope carrega um respirador pesado, além do Há entre o enunciado “não atacar é o melhor ataque” e o ditado
tanque adicional de ar, de modo que possa sobreviver em meio futebolístico “a melhor defesa é o ataque” uma relação
ao sulfeto de hidrogênio, monóxido de carbono e outros gases denominada de
venenosos da caverna. Aos seus pés, a água corrente contém a) intertextualidade
ácido sulfúrico. A lanterna no capacete ilumina a gotícula de uma b) contextualidade
gosma espessa e semitranslúcida que escorre da parede. “Não é c) prolixidade
incrível?”, exclama. d) informatividade

Esses dois locais (um lago congelado no ártico e uma gruta nos 2. (Unicamp 2015) O cartaz a seguir foi usado em uma
trópicos) talvez possam fornecer pistas para um dos mistérios campanha pública para doação de sangue.
mais antigos e instigantes: existe vida fora do nosso planeta?
Criaturas em outros mundos, seja em nosso sistema solar, seja
em órbita ao redor de estrelas distantes, poderiam muito bem ter
de sobreviver em oceanos recobertos de gelo, como os que
existem em um dos satélites de Júpiter, ou em grutas fechadas e
repletas de gás, que talvez sejam comuns em Marte. Portanto, se
for possível determinar um procedimento para isolar e identificar
formas de vida em ambientes igualmente extremos aqui na Terra,
então estaremos mais preparados para empreender a busca pela
vida em outras partes do Universo.
LEMONICK, Michael D. “A busca por vida fora da Terra”. National
Geographic, jul. 2014, p. 38-40.

1. (Unicamp 2015) A partir da leitura do texto, pode-se afirmar


que:
a) O robô está presente tanto no lago congelado no ártico como
na gruta nos trópicos.
b) O jovem engenheiro do JLP e a geomicrobióloga carregam
respiradores para ajudá-los a respirar.
c) O jovem engenheiro do JLP e a geomicrobióloga estão
executando suas pesquisas sozinhos.
d) O holofote do robô é ligado a partir de um sinal emitido pelo
laboratório JPL. Glossário

2. (Unicamp 2015) Assinale a alternativa que resume Rolezinho: diminutivo de rolê ou rolé; em linguagem informal,
adequadamente o texto. significa “pequeno passeio”. Recentemente, tem designado
a) Estudos sobre formas de vida em ambientes extremos podem encontros simultâneos de centenas de pessoas em locais como
preparar os cientistas para enfrentar a questão da busca pela praças, parques públicos e shopping centers, organizados via
vida fora da Terra. internet.
b) A partir de uma caverna no Alasca, um robô revela pistas Anonymous riot: rebelião anônima.
sobre outras formas de vida no nosso sistema solar.
c) Os trabalhos científicos desenvolvidos em qualquer lugar da Considerando como os sentidos são produzidos no cartaz e o seu
Terra permitem compreender formas de vida em outros caráter persuasivo, pode-se afirmar que:
planetas. a) As figuras humanas estilizadas, semelhantes umas às outras,
d) Cientistas, trabalhando em ambientes extremos, remetem ao grupo homogêneo das pessoas que podem ajudar
desenvolveram procedimentos capazes de detectar vida fora e ser ajudadas.
da terra. b) A expressão “rolezinho” remete à meta de se reunir muitas
pessoas, em um só dia, para doar sangue.
IMAGENS c) O termo “até” indica o limite mínimo de pessoas a serem
1. (Ueg 2015) beneficiadas a partir da ação de um só indivíduo.
d) O destaque visual dado à expressão “ROLEZINHO NO
HEMORIO” tem a função de enfatizar a participação individual
na campanha.

FIGURA DE LINGUAGENS
1. (G1 - cps 2015) Leia este fragmento do poema A lua foi ao
cinema, do escritor Paulo Leminski.

“A lua foi ao cinema,


passava um filme engraçado,
a história de uma estrela
que não tinha namorado.
Não tinha porque era apenas fiai-me canada e meia,
uma estrela bem pequena, b) Branca, mana, que fazedes?
dessas que, quando apagam, meu amor, Deus vos ajude;
ninguém vai dizer, que pena! (...)” já eu estou no ataúde,
se me vós não acorredes.
(http://tinyurl.com/n4oljo7 Acesso em: 24.07.2014. Adaptado) c) Fiai-me um gentar de vinho,
e pagar-vos-ei em linho,
A figura de linguagem predominante nesse poema é que já minha lã não presta:
a) hipérbole, pois a palavra estrela foi empregada para suavizar d) Deixo por minha herdeira
um termo. e também testamenteira,
b) pleonasmo, pois a palavra história apresenta o mesmo sentido Lianor Mendes de Arruda,
de incidente. e) Diz um verso acostumado:
c) sinestesia, pois a felicidade da estrela é tratada com quem quer fogo busque lenha;
indiferença pelo poeta.
d) catacrese, pois a palavra pena foi empregada 2. (Ufpr 2012) Considerando a poesia de Gregório de Matos e o
inadequadamente, num sentido impróprio. momento literário em que sua obra se insere, avalie as seguintes
e) personificação, pois a lua vivencia uma situação que é própria afirmativas:
dos seres humanos.
1. Apresentando a luta do homem no embate entre a carne e o
2. (Ufsm 2015) Ele elevou à décima potência a disseminação do espírito, a terra e o céu, o presente e a eternidade, os poemas
conhecimento. Ele nos permite viajar sem sair do lugar, mas, religiosos do autor correspondem à sensibilidade da época e
além disso, pode guardar informações por séculos. Romanos encontram paralelo na obra de um seu contemporâneo, Padre
2escreviam em tábuas, 1egípcios, em papiros, 3e os maias e Antônio Vieira.
astecas tinham uma espécie de livro feito com casca de árvore. 2. Os poemas erótico-irônicos são um exemplo da versatilidade
Mas o papel, desenvolvido no século 2 pelos chineses, e a do poeta, mas não são representativos da melhor poesia do
prensa de Gutenberg, do século 15, foram as criações mais autor, por não apresentarem a mesma sofisticação e riqueza de
importantes para o surgimento do livro da forma como o temos recursos poéticos que os poemas líricos ou religiosos
hoje. A primeira impressão ocorreu em 1442. Depois que o uso apresentam.
da prensa se consolidou, comerciantes lançaram uma variedade 3. Como bom exemplo da poesia barroca, a poesia do autor
de títulos, muitos deles originários de manuscritos antigos. Mas o incrementa e exagera alguns recursos poéticos, deixando sua
boom ocorreu mesmo no século 19. A Revolução Industrial trouxe linguagem mais rebuscada e enredada pelo uso de figuras de
inovações tecnológicas para o papel, tornando-o mais barato e linguagem raras e de resultados tortuosos.
acessível às editoras. Sem esses calhamaços de folhas, 4. A presença do elemento mulato nessa poesia resgata para a
provavelmente boa parte da história da humanidade teria se literatura uma dimensão social problemática da sociedade baiana
perdido. da época: num país de escravos, o mestiço é um ser em conflito,
vítima e algoz em uma sociedade violentamente desigual.
Fonte: SUPERINTERESSANTE. As 101 maiores invenções da
humanidade. Ed. Especial. 2013, p. 60. (Adaptado). Assinale a alternativa correta.
a) Somente as afirmativas 1 e 2 são verdadeiras.
b) Somente as afirmativas 1, 2 e 3 são verdadeiras.
Com relação ao emprego de recursos de coesão e de pontuação c) Somente as afirmativas 1, 3 e 4 são verdadeiras.
no texto, considere as afirmativas a seguir. d) Somente as afirmativas 2 e 4 são verdadeiras.
e) Somente as afirmativas 3 e 4 são verdadeiras.
I. O livro é referido, ao longo do texto, duas vezes pelo pronome
“Ele” e duas vezes pelo pronome “o”. BARROCO
II. A vírgula que sucede “egípcios” (ref. 1 ) foi usada para indicar a 1. (Uepa 2014) Nasce o Sol, e não dura mais que um dia,
elipse da palavra “escreviam” (ref. 2 ), evitando sua repetição. Depois da luz se segue a noite escura,
III. A vírgula que antecede “e os maias e astecas” (ref. 3 ) poderia Em tristes sombras morre a formosura,
ser eliminada, sem prejuízo à norma-padrão. Em contínuas tristezas a alegria.
Gregório de Matos Guerra
Está(ão) correta(s)
a) apenas I. Assinale a alternativa que contém uma característica da
b) apenas II. comunicação poética, típica do estilo Barroco, existente no
c) apenas III. quarteto acima.
d) apenas I e II. a) Reflexão sobre o caráter humano da divindade.
e) I, II e III. b) Associação da natureza com a permanência da realidade
espiritual.
HUMANISMO / BARROCO c) Presença da irreverência satírica do poeta com base no
1. (Uepa 2014) Identifique a alternativa em que Maria Parda paradoxo.
comunica o seu desejo de beber, exagerando a consequência de d) Utilização do pleonasmo para reforçar a superioridade do
não encontrar quem lhe venda vinho fiado. cristianismo sobre o protestantismo.
a) Ó Senhora Biscainha e) Uso de ideias contrastantes com base no recurso da antítese.
TEXTO PARA A PRÓXIMA QUESTÃO:
TEXTO Entendendo-se que os gêneros textuais são os textos correntes
na sociedade, no gênero aviso da placa acima,
Senhora Dona Bahia, O certo é, pátria minha, a) a compreensão da mensagem foi totalmente prejudicada por
nobre e opulenta cidade, que fostes terra de alarves, conta dos desvios gramaticais.
madrasta dos naturais, e inda os ressábios vos duram b) o termo “do zoto” corresponde ao “dos outros”, reportando,
e dos estrangeiros madre: desse tempo e dessa idade. assim, apenas a um desvio de concordância entre artigo e
substantivo.
Dizei-me por vida vossa Haverá duzentos anos, c) caso permutasse a expressão jogar lixo por a jogada de lixo,
em que fundais o ditame nem tantos podem contar-se, nada afetaria em termos de concordância com o substantivo
de exaltar os que aqui vêm, que éreis uma aldeia pobre “proibido”.
e abater os que aqui e hoje sois rica cidade. d) a linguagem do texto está inapropriada para a linguagem do
nascem? gênero “aviso”.
Então vos pisavam índios, e) a forma como se encontra a palavra “Zoto” parece ser um
Se o fazeis pelo interesse e vos habitavam cafres, substantivo próprio, referindo-se ao nome do dono da casa
de que os estranhos vos hoje chispais fidalguias, proibida de jogar lixo.
gabem, arrojando personagens.
isso os paisanos fariam 2. (Ufsm 2015) Cada região brasileira possui hábitos alimentares
com conhecidas vantagens. Nota: entenda-se “Bahia” como próprios e pratos emblemáticos, que servem como marcadores
cidade. identitários regionais. Os textos a seguir exemplificam essa
E suposto que os louvores situação.
em boca própria não valem, Gregório de Matos
se tem força esta sentença, TEXTO 1
mor força terá a verdade.
No Rio Grande do Sul, o churrasco é a “especialidade local”. Não
Vocabulário por ser uma comida do cotidiano, mas por estar associado à
alarves - que ou quem é rústico, abrutado, grosseiro, figura do gaúcho em que “comer” e “fazer” churrasco envolvem
ignorante; que ou o que é tolo, parvo, estúpido. um grupo social, e não se refere apenas ao ato de assar a carne,
ressábios - sabor; gosto que se tem depois. mas, sim, a uma organização social que se estabelece em torno
cafres - indivíduo de raça negra. do churrasco. O “fazer um churrasco” obedece a códigos, normas
e comportamentos aceitos e reconhecidos por 2todos, o que leva
2. (Uff 2011) Todas as afirmativas sobre a construção estética ou a pensá-1los como um “ritual de comensalidade e de partilha”,
a produção textual do poema de Gregório de Matos (Texto) estão destaca Maciel (1996).
adequadas, EXCETO uma. Assinale-a.
a) Existem antíteses, características de textos no período Fonte: GOES, J.A.W. Hábitos alimentares: globalização ou
barroco. diversidade? In: FREITAS, M.C.S.;
b) Há uma personificação, pois a Bahia, ser inanimado, é tratada FONTES, G.A.V.; OLIVEIRA, N. (Orgs.). Escritas e narrativas
como ser vivo. sobre alimentação e cultura [online]. Salvador: EDUFBA, 2008, p.
c) A ausência de métrica aproxima o poema do Modernismo. 392. (adaptado)
d) O eu lírico usa o vocativo, transformando a Bahia em sua
interlocutora. TEXTO 2
e) Há diferença de tratamento para os habitantes locais e os
estrangeiros. Em Navegação de cabotagem, uma espécie de “quase-memória”
do autor, escreveu Jorge Amado: “onde quer que esteja levo o
TEXTOS TÉCNICOS Brasil comigo mas, 4ai de mim, não levo farinha de mandioca e
1. (G1 - ifce 2014) sinto falta 3todos os dias, ao almoço e ao jantar”.

Fonte: SCHWARCZ, L.M. O artista da mestiçagem. In:


SCHWARCS, L. M.; GOLDSTEIN, I.S. (Orgs.). O universo de
Jorge Amado. Caderno de leituras. São Paulo: Companhia das
Letras, 2009, p. 38.

Assinale V na(s) afirmativa(s) verdadeira(s) e F na(s) falsa(s).

( ) No texto 1, “los” (ref. 1) refere-se, no contexto, a “todos” (ref.


2). A palavra “todos”, tanto no texto 1 (ref. 2) quanto no texto 2
(ref. 3), retoma elementos mencionados anteriormente.
( ) A palavra “todos”, tanto no texto 1 (ref. 2) quanto no texto 2
(ref. 3), retoma elementos mencionados anteriormente.
( ) No texto 2, “ai de mim” (ref. 4) expressa desagrado com
relação ao consumo de farinha de mandioca como parte da
cultura vivenciada por Jorge Amado. chamada de PageRank, que faz os sites que mais recebem links
de outras páginas aparecerem nas primeiras posições. Demorou,
A sequência correta é mas o Google se tornou imensamente popular.
a) F – F – F.
b) V – F – V. Fonte: SUPERINTERESSANTE. . Ed. Especial. 2013. (adaptado)
c) F – V – F. As 101 maiores invenções da humanidade
d) V – V – F.
e) F – F – V. Com relação a ideias e recursos linguísticos do texto, assinale V
na(s) alternativa(s) verdadeira(s) e F na(s) falsa(s).
TEXTOS JORNALISTICOS
1. (Uerj 2016) Escuridão: é como o frescor da noite. (ref. 7) ( ) O primeiro desodorante comercial surgiu no mesmo ano em
que a invenção dos pneus foi patenteada.
O verbete citado apresenta uma definição poética para o termo ( ) Elementos como “inconveniente” (ref. 1), “drama” (ref. 2) e
“escuridão”. “caos” (ref. 3) remetem a situações-problema em que se
Essa afirmativa pode ser justificada pelo fato de a autora do encontrava a humanidade antes da invenção, respectivamente,
verbete ter optado por: dos pneus, do desodorante e do Google.
a) priorizar as crenças antes de se pautar pela racionalidade ( ) A estratégia problema-solução é empregada para destacar
b) construir uma figuração particular sem se ater ao fenômeno mudanças promovidas pelas invenções mencionadas, a partir das
físico quais o mundo se tornou mais aprazível.
c) expressar seu medo da noite no lugar de descrevê-la ( ) O excerto “Como rodas de pedra e madeira são sólidas,
minuciosamente provocam solavancos nos passageiros” (ref. 4) poderia ser
d) apoiar-se na linguagem denotativa ao invés de elaborar um reescrito, sem alteração do sentido, como “Rodas de pedra e
argumento conotativo madeira, por serem sólidas, provocam solavancos nos
passageiros”.
2. (Ufsm 2015) No texto a seguir, são apresentadas três a) F – F – V – V.
invenções presentes no ranking das mais importantes para a b) V – V – F – F.
humanidade. c) F – V – V – V.
d) V – F – V – F.
PNEUS e) F – V – F – F.

A roda foi uma grande descoberta, mas um tanto 1inconveniente. FÍSICA: PARTE A
4Como rodas de pedra e madeira são sólidas, provocam Semana 2: Cinemática Vetorial e Movimentos Circulares
solavancos nos passageiros. Em 1845, um rapaz de 23 anos 1. (UFSJ-MG) Um corpo percorre a trajetória circular indicada na
patenteou a solução: a roda aérea, uma circunferência inflável de figura a seguir, com movimento uniformemente acelerado.
borracha. Ainda não tínhamos carros ou bicicletas, apenas
carruagens, e o jovem escocês Robert Thomson não conseguiu
convencer o mundo de que os pneus podiam substituir as rodas
de borracha sólida que eram usadas na época. O produto só
explodiu mesmo em 1888, quando outro escocês, John Boyd
Dunlop, criou um novo pneu para bicicletas, que estavam na
moda.

DESODORANTE
O ponto em que os seus vetores velocidade e aceleração estão
Sem ele, o aglomeramento de seres humanos em ambientes indicados CORRETAMENTE é o da alternativa
fechados seria inviável. Civilizações antigas já tentavam resolver A) 2.
esse 2drama com especiarias aromáticas, como canela e incenso. B) 4.
Mas o primeiro desodorante comercial surgiu apenas em 1888, C) 3.
nos Estados Unidos. Obra de um herói anônimo, o produto era D) 1.
um creme vendido num frasco de vidro, com a marca Mum. E) 3 ou 4
Dentro, havia uma gosma com aspecto de cera que tinha cloreto
de zinco como princípio ativo, capaz de matar as bactérias que 2. (UFMG) Um ventilador acaba de ser desligado e está parando
provocam mau cheiro no corpo. vagarosamente, girando no sentido horário.

GOOGLE

Até 1997, era um 3caos navegar na internet. Ferramentas de


busca traziam resultados, mas você tinha de ter paciência para
vasculhar muitas páginas atrás daquilo que procurava. Quando o
Google foi lançado, os sites mais interessantes começaram a A direção e o sentido da aceleração da pá do ventilador no ponto
aparecer logo na primeira tela. Mágica. Por trás da busca, está P são
uma fórmula matemática (um algoritmo) que gera rankings,
B) o módulo da aceleração é 0,4 m/s2.
C) o módulo da aceleração aumenta.
D) o módulo da aceleração diminui.
E) nada se pode afirmar sobre a aceleração.

6. (FCC) A partir do repouso, um corpo descreve trajetória circular


de raio 3,6m, com aceleração tangencial com módulo constante
e, após 4,0s, sua velocidade tem módulo 1,2m/s. Neste instante,
determine:
b) as acelerações tangencial e centrípeta.
a) a aceleração vetorial do corpo em módulo.

7. (UPE) Um corpo descreve um movimento uniforme ao longo de


3. Um objeto executa um movimento cuja trajetória é mostrada na uma pista horizontal e circular de raio 10,0 m, percorrendo um
figura abaixo em linha tracejada. Considerando o trajeto do ponto arco de 15,0 m em 3,0 s. A aceleração centrípeta e o ângulo
A ao D, o módulo do vetor velocidade média do objeto é 0,40 central varrido valem, respectivamente:
m/s. A) 1,5 m/s2 e 2,5 rad.
B) 2,5 m/s2 e 1,5 rad.
C) 2,5 m/s2 e 2,5 rad.
D) 5,0 m/s2 e 2,5 rad.
E) 5,0 m/s2 e 1,0 rad.

8. Num lugar onde não se dispõe de energia elétrica, é usado um


sarilho para tirar água de um poço. Essa máquina consta de um
cilindro de raio r = 15 cm, fixo em um eixo que pode rotar apoiado
em dois suportes. Uma das extremidades de uma corda é fixada
no cilindro e a outra é amarrada em um balde. À medida que o
cilindro gira, acionado por uma manivela de cabo C, a corda
enrola-se nele numa única camada e o balde sobe 9 m em 30 s,
Calcule o intervalo de tempo para o objeto perfazer a trajetória do em movimento uniforme.
ponto A ao D, em segundos.
A) 20.
B) 25.
C) 30.
D) 35.
E) 40

4. (Unicamp-SP) A f igura abaixo representa um mapa da cidade


de Vectoria o qual indica o sentido das mãos do tráfego. Devido
ao congestionamento, os veículos trafegam com a velocidade Na operação descrita, calcule a velocidade:
média de 18 km/h. Cada quadra dessa cidade mede 200 m por a) angular do cilindro;
200 m (do centro de uma rua ao centro da outra rua). Uma b) linear do cabo C.
ambulância localizada em A precisa pegar um doente localizado
bem no meio da quadra em B, sem andar na contramão. 9. (UEPA) Um dispositivo rudimentar utilizado no interior no
Estado do Pará para ralar mandioca na fabricação de farinha
consiste de uma associação de polias com diâmetros diferentes,
como mostra a figura abaixo:

Os valores dos diâmetros das rodas mostradas na figura são DA =


a) Qual é o menor intervalo de tempo gasto (em minutos) no 1 m, DB = 10 cm e DC = 25 cm. Nessa situação, enquanto a roda
percurso de A para B? A executa uma volta completa, as voltas executadas pelas rodas
b) Qual é o módulo do vetor velocidade média (em km/h) entre os B e C são, respectivamente:
pontos A e B? A) 10 e 10.
B) 5 e 10.
5. (FEI-SP) Quando um automóvel faz uma curva de raio 1 km, C) 5 e 5.
com velocidade constante de 72 km/h, podemos afirmar que: D) 10 e 15.
A) a aceleração é nula. E) 15 e 10.
10. Na figura, as rodas dentadas R1 e R3 são iguais e seus raios 15. Um ponto na borda de um disco de 0,20 m de raio tem sua
medem 50 cm, enquanto a roda dentada R2 tem raio igual a 25 velocidade escalar alterada de 6,0 m/s para 8,0 m/s em 2,0 s. A
cm. As rodas R2 e R3 giram fixas a um mesmo eixo. A roda R1, aceleração angular constante (em rad/s2) é:
acoplada à R2, gira com frequência igual a 5 000 rpm. A) 3,0
B) 5,0
C) 2,0
D) 1,0
E) 4,0

16. (UFRGS-RS) Determine a velocidade de um projétil disparado


contra um alvo rotativo disposto a 15 m de distância, sabendo-se
que o alvo executa 300 revoluções por minuto e que o arco
medido entre o ponto visado no momento do disparo e o ponto de
impacto do projétil no alvo é de 18o. Lembre-se de que 180o = π
Determine:
radianos.
a) a frequência de rotação das rodas R2 e R3.
b) o quociente v1/v3 das velocidades escalares lineares de pontos
17. (AMAN) Um ponto material parte do repouso e se desloca em
na periferia das rodas R1 e R3 respectivamente.
movimento uniformemente variado sobre um plano horizontal em
trajetória circular de 5 m de raio. Após 10 s o ponto material
11. (UFPE) O relógio da Estação Ferroviária Central do Brasil, no
percorreu 100 m. A velocidade angular do ponto material nesse
Rio de Janeiro, tem ponteiros de minutos e de
instante vale:
horas que medem, respectivamente, 7,5 m e 5,0 m de
𝐯 A) 16 rad/s
comprimento. Qual a razão 𝐯𝐚 , entre as velocidades lineares B) 4 rad/s
𝐛
dos pontos extremos dos ponteiros de minutos e de horas? C) 20 rad/s
A) 10 D) 2 rad/s
B) 12 E) 0,4 rad/s
C) 18
D) 24 18. (UFPE) Uma nave espacial de formato cilíndrico, inicialmente
E) 30 apenas em movimento retilíneo uniforme, é posta a girar em torno
de seu eixo de modo a proporcionar gravidade artificial aos seus
12. Uma criança com uma bola nas mãos está sentada em um ocupantes. Se o raio da nave é igual a 5,0 m e sua aceleração
“gira-gira” que roda com velocidade angular constante e angular é 0,05 rad/s2, em quanto tempo, em s, a nave atinge
frequência f = 0,25 Hz. velocidade angular suficiente para simular uma gravidade de g/2
a) Considerando que a distância da bola ao centro do “gira-gira” é nos pontos de sua superfície lateral? Considere g = 10 m/s2.
2 m, determine os módulos da velocidade 𝐯⃗𝐓 e da aceleração 𝐚⃗
da bola, em relação ao chão. 19. (UFPI) Uma partícula descreve um movimento circular
Num certo instante, a criança arremessa a bola horizontalmente uniforme de raio r = 1,0m. No instante t = 0, sua velocidade 𝐯⃗𝟎 e
em direção ao centro do “gira-gira”, com velocidade 𝐯⃗𝐓 de módulo sua aceleração 𝐚⃗𝟎 apontam nas direções indicadas na figura
4 m/s, em relação a si. Determine, para um instante abaixo.
imediatamente após o lançamento,
b) o módulo da velocidade 𝐔 ⃗⃗⃗ da bola em relação ao chão;
c) o ângulo 𝛉 entre as direções das velocidades ⃗⃗⃗
𝐔 e 𝐯⃗𝐓 da bola.
Note e
anote 𝝅 = 𝟑

13. (Vunesp) Uma gota de tinta cai a 5 cm do centro de um disco


que está girando a 30 rpm. As velocidades angular e linear da Dois segundos depois, a partícula tem pela primeira vez
mancha provocada pela tinta são, respectivamente, iguais a: velocidade 𝐯⃗ = −𝐯⃗𝟎 e aceleração 𝐚⃗ = −𝐚⃗𝟎 . Os módulos de 𝐯⃗𝟎
A) π rad/s e 5π cm/s (em m/s) e de 𝐚⃗𝟎 (em m/s2) são, respectivamente:
B) 4π rad/s e 20π cm/s A) π/2 e π2/2
C) 5π rad/s e 25π cm/s B) π/4 e π2/16
D) 8π rad/s e 40π cm/s C) π/2 e π2/4
E) 10π rad/s e 50π cm/s D) π/4 e π2/8
E) π/2 e π2
14. (Fuvest-SP) Dois corredores A e B partem do mesmo ponto
de uma pista circular de 120 m de comprimento, com velocidades 20. Um disco começa a girar com movimento uniformemente
vA = 8 m/s e vB = 6 m/s. acelerado. Ao final de 10 revoluções alcança a velocidade
a) Se partirem em sentidos opostos, qual será a menor distância angular  = 20 rad/s. Determine sua aceleração angular.
entre eles, medida ao longo da pista, após 20 s?
b) Se partirem no mesmo sentido, após quanto tempo o corredor
A estará com uma volta de vantagem sobre o B?