Você está na página 1de 24

salabioquimica.blogspot.

com

Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

Gentica e evoluo Lista 5


TEXTO PARA AS PRXIMAS 2 QUESTES. (Uerj 2001) O experimento clssico de Meselson e Stahl, em 1957, demonstrou que a replicao do DNA era semiconservativa, ou seja, cada fita do DNA serve de molde para sua prpria duplicao, formando molculas de DNA idnticas original. Nesse experimento, os cientistas cultivaram clulas de 'Escherichia coli' inicialmente em presena de fonte de N (istopo de nitrognio leve), trocando, a seguir, por N (istopo pesado), que incorporado s bases nitrogenadas do DNA. Colheram, ento, amostras de DNA aps a primeira e a segunda geraes de clulas crescidas em N e analisaram essas amostras quanto densidade do DNA formado. Considere como PESADO o DNA dupla hlice marcado com N; como LEVE o marcado com N; como INTERMEDIRIO o marcado com N e N. 4. (Uerj 98) O grfico a seguir demonstra a distribuio citoplasmtica do nmero de ribossomas isolados e polirribossomas, em comparao com o nmero de cadeias polipeptdicas em formao durante um certo perodo de tempo.

1. Justifique por que, aps a troca da fonte de nitrognio, a primeira gerao de clulas foi totalmente constituda com DNA dupla hlice do tipo INTERMEDIRIO.

2. Calcule as propores dos trs tipos de DNA dupla hlice - LEVE, INTERMEDIRIO E PESADO - formados em clulas da segunda gerao, aps a troca da fonte de nitrognio. 3. (Fuvest 89) O desenho a seguir mostra a sntese de um polipeptdio a partir da molcula de DNA num certo organismo. Esse organismo um procarioto ou um eucarioto? Por qu? (Adaptado de ALBERTS, Bruce & outros. "Molecular biology of the cell". New York, Garland Publishing, 1994, p.239)

a) Defina a relao existente entre os ribossomas isolados e a formao das cadeias polipeptdicas. Justifique sua resposta. b) Descreva a estrutura das cadeias polipeptdicas e a dos polirribossomas.

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO


9. (Fuvest 2004) Bactrias (Escherichia coli) foram cultivadas durante vrias geraes em um meio de cultura na qual toda a fonte de nitrognio era o istopo pesado N. De uma amostra dessas bactrias (amostra A), extraiu-se o DNA que foi submetido a uma tcnica de centrifugao que permite separar molculas de DNA de acordo com sua densidade. O restante das bactrias foi transferido para um meio de cultura em que todo o nitrognio disponvel era o istopo normal N. Retirou-se uma segunda amostra (amostra B), quando as bactrias completaram uma diviso celular nesse novo meio e uma terceira amostra (amostra C), quando as bactrias completaram duas divises celulares. O DNA das bactrias das amostras B e C foi tambm extrado e centrifugado.

5. (Unicamp 96) Um certo tipo de macromolcula destinada membrana plasmtica celular, depende de etapas nucleares e citoplasmticas para sua produo, de acordo com os percursos esquematizados a seguir:

a) Por que essas etapas comeam no ncleo? b) Qual a composio da macromolcula ao final do percurso I? E do percurso II? Esclarea a diferena, baseando-se nas funes das organelas citoplasmticas envolvidas em cada percurso.

6. (Unicamp 92) Ribossomos so formados por RNA e protenas, sintetizados pelos processos de transcrio e traduo, respectivamente. a) Onde esses processos ocorrem na clula eucaritica? b) O que acontecer com os processos de transcrio e traduo, se ocorrer uma inativao na Regio Organizadora do Nuclolo? Justifique. A figura mostra o resultado da centrifugao do DNA das trs amostras de bactrias. a) Por que, na amostra B, todo o DNA tem uma densidade 7. (Unesp 2003) Criadores e sitiantes sabem que a mula (exemplar fmea) e o burro (exemplar macho) so hbridos estreis que apresentam grande fora e resistncia. So o produto do acasalamento do jumento ('Equus asinus', 2n = 62 cromossomos) com a gua ('Equus caballus', 2n = 64 cromossomos). a) Quantos cromossomos tm o burro ou a mula? Justifique sua resposta. b) Considerando os eventos da meiose I para a produo de gametas, explique por que o burro e a mula so estreis. intermediria entre o que constitudo apenas por N e o que contm apenas N? b) Considerando que, na amostra C, a quantidade de DNA separada na faixa inferior X, que quantidade de DNA h na faixa superior?

8. (Fuvest 95) No DNA de um organismo, 18% das bases nitrogenadas so constitudas por citosina. Que outras bases nitrogenadas devem existir neste DNA e em que propores? Justifique sua resposta.

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

10. (Uerj 97) CLULAS IMORTAIS CONTAM AOS CIENTISTAS HISTRIA DA EVOLUO DA HUMANIDADE

Estas clulas formam um livro, conservado em tanques de nitrognio lquido que guarda informaes desconhecidas sobre a humanidade. Os captulos contam diferentes detalhes da saga do homem na terra: suas andanas pelos continentes, casamentos ancestrais e os ataques de doenas. (adaptado de, "O Globo")

a) Explique por que o processo de autoduplicao do DNA d significado hereditariedade permitindo revelar a histria da evoluo da humanidade. b) "... suas andanas pelos continentes, casamentos ancestrais e os ataques de doenas" podem ser estudados atravs de observaes de caractersticas morfolgicas e fisiolgicas da clula. Nomeie o processo atravs do qual o DNA capaz de controlar e interferir nas caractersticas morfolgicas e fisiolgicas da clula. 11. (Uerj 99) Em clulas eucariotas mantidas em cultura, adicionouse o nucleosdeo uridina marcado radioativamente com H ao meio de cultura. Aps algum tempo, as clulas foram transferidas para um novo meio que no continha o istopo. Amostras destas clulas foram retiradas 3, 15 e 90 minutos aps a transferncia, sendo, ento, colocadas em lmina de vidro, fixadas e submetidas a autoradiografia. Esse processo marca a posio aproximada do istopo dentro da clula, como representado no esquema a seguir. Explique por que, entre essas clulas: a) as caractersticas genotpicas so iguais; b) as caractersticas fenotpicas so diferentes. 12. (Uerj 2006) Num experimento, foram comparadas as caractersticas genotpicas e fenotpicas de clulas retiradas de um tecido de anfbio, ainda no estgio de girino, com as de clulas de tecido similar do mesmo indivduo aps atingir a idade adulta. b) Nomeie o compartimento celular que seria marcado, se o nucleosdeo radioativo usado fosse a timidina e justifique sua resposta. a) Cite o tipo de molcula qual a uridina se incorporou. Justifique sua resposta.

13. (Ufal 99) Para desempenhar sua funo como material hereditrio, o DNA possui duas propriedades. Identifique-as e descreva resumidamente cada uma delas.

14. (Uff 99) A mutao em um gene humano provoca cegueira. Com a utilizao de tcnicas de gentica clssica e molecular, verificou-se que este gene est localizado no genoma mitocondrial. Sabe-se que todas as mitocndrias dos indivduos afetados pela cegueira no possuem o gene normal, mas sim o gene mutado.

a) Informe a percentagem de filhas e filhos cegos de um casal: I) cuja mulher normal e o homem cego; II) cuja mulher cega e o homem normal.

b) Justifique as respostas ao item a.

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO


17. (Ufrj 99) A tipagem de DNA uma tcnica desenvolvida recentemente que permite identificar e estabelecer o grau de parentesco entre indivduos. Para se realizar uma anlise patrilnea, isto , a investigao dos ancestrais paternos, usa-se um marcador do cromossomo Y, que no se altera ao longo das geraes (salvo em casos de mutaes).

15. (Ufrj 96) O genoma da bactria "Escherichia coli" tem um tamanho de 410 pares de nucleotdeos. J o genoma haplide humano tem 310 pares de nucleotdeos. Para replicar o genoma, antes da diviso celular, existe uma enzima, a DNA polimerase, cuja velocidade de reao equivalente a cerca de 800 nucleotdeos/s.

Assim, para replicar todo o genoma de uma bactria, a DNA polimerase consumiria cerca de 83 minutos e, para o genoma humano, aproximadamente 43 dias!

Por outro lado, para uma anlise matrilnea (materna), lana-se mo do DNA mitocondrial. Por que o DNA mitocondrial deve ser usado para a anlise matrilnea?

Sabemos, no entanto, que o tempo de gerao da "E.coli" de cerca de 20 minutos, e que o tempo mdio de replicao de uma clula eucariota de 12 horas. 18. (Ufrj 2001) No ADN, a transcrio dos genes no est restrita a somente uma das suas cadeias. Para alguns genes, a seqncia de nucleotdeos transcrita pode estar em uma cadeia, ao passo que a Assumindo que a DNA polimerase apresenta uma velocidade de reao constante para todas as espcies analisadas, explique essa aparente contradio. seqncia do outro gene pode estar localizada na cadeia oposta. No entanto, sabe-se que no mesmo trecho nunca ocorre a transcrio simultnea das duas cadeias de uma molcula de ADN. Tal evento inibiria o processo da traduo. 16. (Ufrj 96) O teste de tipagem de DNA revelou que nos seres humanos existe individualidade genmica. Isto significa que cada indivduo possui variaes discretas e caractersticas na seqncia de seu DNA, ou seja, a seqncia de nucleotdeos do DNA de cada pessoa nica (excetuando-se o caso de gmeos monozigticos). 19. (Ufrj 2004) Estudos recentes compararam as seqncias Assim, a tipagem do DNA revela um padro de bandas que estvel (presente no DNA de todos os tecidos) e transmitido aos descendentes seguindo as leis de Mendel. Os resultados revelaram que a variabilidade gentica no DNA Graas a essas caractersticas possvel atualmente realizar testes de paternidade que comparam os padres de bandas de DNA das pessoas e revelam se um homem de fato o pai biolgico de uma outra pessoa. mitocondrial de indivduos africanos era quase o dobro da observada no DNA mitocondrial de no-africanos. Esses resultados foram importantes para corroborar a idia de que o ancestral comum mais recente do 'Homo sapiens' viveu na frica h cerca de 200.000 anos. completas de DNA mitocondrial de indivduos de vrias regies geogrficas do planeta. Explique por que ocorreria a inibio da traduo se a transcrio de uma cadeia do ADN ocorresse ao mesmo tempo em que a transcrio da sua cadeia complementar, no mesmo trecho.

Suponha agora a seguinte situao: um homem acusado de ser o pai de uma criana tenta burlar o teste de tipagem de DNA; um amigo o aconselha a receber uma transfuso de sangue 2 meses antes do teste (em geral colhe-se o sangue como fonte de clulas nucleadas).

Explique por que a maior diversidade do DNA mitocondrial apia a idia da origem africana do 'Homo sapiens'.

a) Qual a influncia da transfuso sugerida no resultado do exame? b) Que precaues podem ser tomadas para desmascarar a tentativa de fraude?

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO


22. (Unesp 90) A anlise qumica de duas molculas de DNA revelou a seguinte composio de bases:

20. (Ufrj 2005) A soma das porcentagens de guanina e citosina em uma certa molcula de ADN igual a 58% do total de bases presentes.

a) Indique as porcentagens das quatro bases, adenina (A), citosina (C), guanina (G) e timina (T), nessa molcula. b) Explique por que impossvel prever a proporo de citosina presente no ARN mensageiro codificado por esse trecho de ADN.

Molcula A 23% de adenina, 23% de timina, 27% de citosina e 27% de guanina;

21. (Ufrrj 99) Considerando as propriedades de duplicao do DNA, observe o resultado do experimento a seguir. Molcula B 23% de adenina, 1 etapa: Em uma cultura com N, obtm-se o crescimento de colnias de bactrias; aps esse crescimento promove-se o desenvolvimento de mais duas geraes, em cultura com N. 23% de timina, 27% de citosina e 27% de guanina.

2 etapa: Extrai-se o DNA de todas as bactrias e obtm-se o seguinte resultado:

Com base nestes dados: a) O que se pode afirmar a respeito das semelhanas entre estas duas molculas de DNA?

- Cultura de crescimento com N: 300 molculas de DNA todas com N.

b) Justifique sua resposta.

23. (Unesp 97) A anlise qumica em amostras de cinco lminas com - Cultura de 1 gerao com N: 600 molculas de DNA todas com N e N. 1. lmina: ribose - Cultura de 2 gerao com N: 1200 molculas de DNA nas quais 600 com N e 600 com N e N. 2. lmina: uracila 3. lmina: dupla-hlice 4. lmina: timina Explique as porcentagens obtidas em todos os extratos das diferentes culturas no experimento. Justifique sua resposta. a) Entre estas lminas, quais se referem a DNA? b) Justifique o resultado obtido com a 5. lmina. 5. lmina: 15% de guanina e 25% de citosina. cidos nuclicos apresentou os seguintes resultados:

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO


27. (Unifesp 2003) No heredograma seguinte, a pessoa A possui uma mutao no DNA de todas as suas mitocndrias, que faz com que a produo de energia para os msculos seja deficiente, ocasionando dificuldades motoras para os portadores do problema. Essa pessoa casou-se com outra, aparentemente normal. O casal (P) teve filhos (F1) e estes, por sua vez, tambm tiveram filhos (F2).

24. (Unicamp 97) Em 1952, Hershey e Chase cultivaram bactrias em meio de cultura contendo fsforo radioativo (P) e colocaram bacterifagos (vrus) para infectar essas clulas. Os novos bacterifagos formados estavam marcados radioativamente. Estes bacterifagos marcados foram utilizados para infectar outras clulas bacterianas cultivadas sem a presena de fsforo radioativo. A marcao radioativa foi detectada dentro destas bactrias.

a) Como se explica que o fsforo radioativo tenha passado para o bacterifago? b) Como se explica que as bactrias cultivadas sem a presena de fsforo radioativo tenham sido marcadas? c) Se, em vez de fsforo, tivesse sido usado enxofre radioativo (S) para marcao de protenas, os resultados seriam os mesmos? Justifique.

25. (Unicamp 2005) Em 25 de abril de 1953, um estudo de uma nica pgina na revista inglesa "Nature" intitulado "A estrutura molecular dos cidos nuclicos", quase ignorado de incio, revolucionou para sempre todas as cincias da vida sejam elas do homem, rato, planta ou bactria. James Watson e Francis Crick descobriram a estrutura do DNA, que permitiu posteriormente decifrar o cdigo gentico determinante para a sntese protica. a) Copie o heredograma, pintando quais sero as pessoas afetadas pela doena em F1 e em F2 b) Justifique sua resposta.

a) Watson e Crick demonstraram que a estrutura do DNA se assemelha a uma escada retorcida. Explique a que correspondem os "corrimos" e os "degraus" dessa escada. b) Que relao existe entre DNA, RNA e sntese protica? c) Como podemos diferenciar duas protenas?

26. (Unifesp 2003) Cientistas criaram em laboratrio um bacterifago (fago) composto que possui a cpsula protica de um fago T2 e o DNA de um fago T4. Aps esse bacterifago composto infectar uma bactria, os fagos produzidos tero

a) a cpsula protica de qual dos fagos? E o DNA, ser de qual deles? b) Justifique sua resposta.

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

28. (Unirio 2002) A figura a seguir mostra um trecho da estrutura do cido desoxiribonuclico, ressaltando a interao entre as duas cadeias do polmero. Na figura, A, C, G & T representam as bases adenina, citosina, guanina e timina, respectivamente.

30. (Fuvest 92) De que maneira o DNA determina a seqncia de aminocidos das molculas de protenas? 31. (Fuvest 96) Uma doena gentica de herana dominante causada por mutaes em um gene localizado em um autossomo. Os indivduos A, B e C tm mutaes em um segmento de DNA desse As linhas pontilhadas indicam as pontes de hidrognio que so formadas entre as bases aminadas e que contribuem para manter unidas as duas cadeias do DNA. Essas pontes de hidrognio podem ser rompidas por calor, o que produz a dissociao das cadeias. Esse processo reversvel chama-se de desnaturao. A temperatura necessria para desnaturar o DNA depende de vrios fatores, mas um deles a composio dos nucleotdeos de um determinado DNA. Observe as duas seqncias de DNA a seguir e determine qual delas precisar de uma temperatura de desnaturao maior. Justifique a sua resposta. gene, cuja seqncia normal est representada a seguir. Usando a tabela que relaciona alguns cdons aos respectivos aminocidos e considerando que a fita molde a ser transcrita aquela assinalada com a letra m, responda: a) Quais sero os segmentos de protenas produzidos, respectivamente, pelos indivduos A, B e C? b) Como ser o fentipo (normal ou afetado dos indivduos A, B e C? Por qu? Seqncia normal CAA AAC TGA GGA ATG CAT TTC (m) GTT TTG ACT CCT TAC GTA AAG 1) ACTTTAAAGATATTTACTTAAA TGAAATTTC TATAAATGAATTT Indivduo A CAA AAC TGA GGA ATT CAT TTC (m) GTT TTG ACT CCT TAA GTA AAG 2) GCTAGGCCGATGCGGCGTGGA CGATCCGGCTACGCCGCACCT 29. (Unitau 95) Considerando o modelo da estrutura molecular do DNA como representado na figura adiante, responda o que representam os componentes 1, 2 e 3, respectivamente. Indivduo CAT AAC TGA GGA ATG CAT TTC (m) GTA TTG ACT CCT TAC GTA AAG Indivduo CAA TAC TGA GGA ATG CAT TTC (m) GTT ATG ACT CCT TAC GTA AAG

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO


33. (Uff 2004) O fumo est relacionado ao aumento de risco para o cncer de pulmo. O hbito de fumar expe os fumantes a substncias com atividade carcinognica. O Benzo[a]pireno, um dos principais agentes carcinognicos presentes na fumaa do cigarro, tem a capacidade de promover mutaes no DNA levando a mudana da base Guanina para Timina. Suponha que um trecho da fita molde de DNA do gene X, representado a seguir, possa ser alterado em presena do Benzo[a]pireno, em um dos dois stios indicados na figura 1. Considere que o RNA mensageiro seja formado a partir das trincas mostradas no esquema da figura 1 a seguir. Indique as alteraes que ocorrero na sntese da protena X quando a

32. (Ueg 2007) O esquema a seguir uma representao do cdigo gentico.

mutao for localizada nos diferentes stios, justificando cada resposta com a utilizao do cdigo gentico da figura 2:

34. (Ufg 2005) As globinas constituem um bom exemplo da De acordo com o esquema apresentado, responda ao que se pede. a) O que o cdigo gentico? b) Explique por que se diz que ele degenerado. a) Considere o segmento de DNA, cuja seqncia de nucleotdeos 5' - GTG - CAC - CTG - ACT - CCT - GAG - GAG - AAG - 3' e, utilizando-se da tabela do cdigo gentico apresentada a seguir, fornea o produto da sntese protica (polipeptdio parte da cadeia beta prevista para a globina humana). importncia da informao gentica na estrutura primria e na funo das protenas.

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO


37. (Ufv 2000) Considere a tabela abaixo, contendo cdigos de trincas de bases do DNA com os aminocidos correspondentes, para resolver os itens seguintes:

b) Utilize um exemplo de alterao estrutural da globina humana (cadeia beta) para explicar como uma mutao pontual, do tipo substituio, pode afetar a sade e a qualidade de vida do portador dessa mutao. a) Determine a seqncia de bases do RNAm que foi utilizado para sintetizar o polipeptdeo esquematizado abaixo da tabela. 35. (Ufrj 97) O ADN um polmero constitudo por vrios nucleotdeos e as protenas so polmeros constitudos por vrios aminocidos. Um gene constitudo por um nmero N de nucleotdeos que codifica uma protena constituda por P aminocidos. Por que sempre encontramos N > P? c) Qual anticdon correspondente ao novo aminocido 36. (Ufrj 99) Com o auxlio da tabela do cdigo gentico representada a seguir, sempre possvel deduzir-se a seqncia de aminocidos de uma protena a partir da seqncia de nucleotdeos do seu gene, ou do RNA-m correspondentes. incorporado? 38. (Ufv 2004) A tabela adiante representa uma verso fictcia do cdigo gentico. Entretanto, esse cdigo segue o padro do cdigo gentico universal, no qual trs bases codificam um aminocido. b) Se ocorresse uma substituio, por uma purina, na 3 base do cdigo correspondente ao 6. aminocido do polipeptdeo, qual seria o aminocido da tabela a ser incorporado?

Entretanto, o oposto no verdadeiro, isto , a partir da seqncia de aminocidos de uma protena, no se pode deduzir a seqncia de nucleotdeos do gene. Explique por qu.

salabioquimica.blogspot.com
Analise a tabela e faa o que se pede:

Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO


40. (Uerj 2004) Analisando o genoma de alguns tipos de vrus formados por fita simples de RNA, encontramos aqueles que so RNA (-), como o do resfriado comum, e os que so RNA (+), como o da poliomielite. Observe que: - nos vrus RNA (-), apenas o RNA complementar a seu genoma capaz de funcionar como mensageiro na clula infectada; - nos vrus RNA (+), o genoma viral funciona diretamente como mensageiro; - ambos os vrus necessitam, para sua replicao, da enzima RNA replicase, que sintetiza um RNA complementar a um molde de RNA;

a) Cite o nome da enzima que catalisa a sntese de RNA mensageiro. b) Cite a seqncia do anticdon correspondente ao cdon de iniciao. c) Qual a seqncia de aminocidos que resultar da traduo da molcula de RNA mensageiro? Ver figura anterior. d) Qual a seqncia de aminocidos que resultar da traduo da mesma molcula de mRNA, aps uma deleo do TERCEIRO nucleotdeo?

39. (Fuvest 2005) A seguir est representada a seqncia dos 13 primeiros pares de nucleotdios da regio codificadora de um gene.

- o gene da enzima RNA replicase est presente no genoma dos dois tipos de vrus, mas a enzima s encontrada nas partculas virais RNA (-).

--- A T G A G T T G G C C T G ----- T A C T C A A C C G G A C ---

a) Explique por que necessrio, para sua replicao, que os vrus RNA (-) j contenham a enzima RNA replicase, enquanto os RNA (+) no precisam armazenar esta enzima.

A primeira trinca de pares de bases nitrogenadas esquerda, corresponde ao aminocido metionina. A tabela a seguir mostra alguns cdons do RNA mensageiro e os aminocidos codificados por cada um deles.

b) Apresente um argumento contrrio hiptese de que os vrus, devido simplicidade de sua estrutura, foram precursores das primeiras clulas.

41. (Ufrj 97) Em um organismo pluricelular com vrios tecidos, como no caso dos seres humanos, todas as clulas possuem um genoma idntico. Analogamente, correto afirmar que os ARN mensageiros (ARNm) dos diferentes tecidos so todos idnticos? Justifique sua resposta 42. (Ufrj 98) Suponha um gene de um eucarioto responsvel pela sntese de uma protena. Nesse gene existem ntrons, ou seja, regies do ADN cujas informaes no esto presentes na protena em questo. As regies do ARN transcrito correspondentes aos ntrons so eliminadas aps o processo de transcrio.A figura a seguir a) Escreva a seqncia de bases nitrogenadas do RNA mensageiro, transcrito a partir desse segmento de DNA. b) Utilizando a tabela de cdigo gentico fornecida, indique a seqncia dos trs aminocidos seguintes metionina, no polipeptdio codificado por esse gene. c) Qual seria a seqncia dos trs primeiros aminocidos de um polipeptdio codificado por um alelo mutante desse gene, originado pela perda do sexto par de nucleotdios (ou seja, a deleo do par de bases T = A)? representa o resultado de uma experincia de hibridao do ARN mensageiro com a cadeia de ADN que lhe deu origem

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO


45. (Unifesp 2003) O jornal "Folha de S.Paulo" (23.09.2002) noticiou que um cientista espanhol afirmou ter encontrado protenas no ovo fssil de um dinossauro que poderiam ajud-lo a reconstituir o DNA desses animais.

a) Faa um esquema simples, formado por palavras e setas, demonstrando como, a partir de uma seqncia de DNA, obtm-se uma protena. b) A partir de uma protena, possvel percorrer o caminho inverso e chegar seqncia de DNA que a gerou? Justifique. A figura mostra cinco regies, identificadas por nmeros de 1 a 5. Quais dessas regies correspondem aos ntrons? Justifique sua resposta. 46. (Unirio 2002) Atualmente os genes podem ser desmembrados em trs classes diferentes: os genes que expressam mRNA que codificam polipeptdios diversos; os genes reguladores que codificam protenas 43. (Unesp 2003) Em um segmento da cadeia ativa de DNA, que servir de molde para a fita de RNA mensageiro, h 30 timinas e 20 guaninas. No segmento correspondente da fita complementar do DNA h 12 timinas e 10 guaninas. Levando-se em considerao essas informaes, responda. 47. (Fuvest 93) O que so cidos nuclicos? Como atuam na sntese a) Quantas uracilas e quantas guaninas comporo a fita do RNA mensageiro transcrito do DNA ativado? b) Quantos aminocidos devero compor a cadeia de polipeptdeos que ser formada? Justifique sua resposta. de protenas? que regulam outros genes; e uma terceira classe de genes que no codificam polipeptdios. Qual o produto final da classe de genes que no codificam polipeptdios?

44. (Unicamp 94) Considere um fragmento de DNA com a seguinte seqncia de bases:

GTA GCC TAG

e responda: a) Qual ser a seqncia do RNAm transcrito a partir deste DNA? b) O mesmo peptdio ser obtido a partir deste RNAm e do RNAm da fita complementar? Explique.

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO


49. (Uerj 2006) Para investigar possveis efeitos de uma determinada droga, utilizou-se uma cultura de clulas, qual foram adicionadas quantidades adequadas das seguintes substncias, marcadas com istopos: uridina C, timidina H e leucina N. Aps algum tempo, a droga foi tambm introduzida no meio de cultura. Ao longo do experimento, amostras das clulas foram coletadas a intervalos regulares. A incorporao dos istopos foi medida em uma preparao que contm os cidos nuclicos e as protenas da clula. Os resultados do experimento esto mostrados no grfico a seguir.

48. (Fuvest-gv 91) Certos mutantes nutricionais do fungo Neurospora s conseguem crescer quando aminocidos so adicionados ao meio de cultura. Na tabela a seguir, o sinal (+) significa crescimento, e o sinal (-) significa ausncia de crescimento.

Sabe-se que as etapas que levam sntese da arginina so:

substrato (gene1) ornitina (gene2) citrulina (gene3) arginina

Supondo que em cada mutante h apenas um gene alterado, explique o porqu do mutante Z s crescer quando se adiciona arginina ao meio de cultura.

a) Considere as etapas de replicao, transcrio e traduo nas clulas analisadas. Indique se a droga interfere em cada uma dessas etapas e justifique suas respostas. b) As protenas, aps sintetizadas, adquirem uma conformao tridimensional. Cite duas ligaes ou interaes que atuam na manuteno da estrutura enovelada das protenas.

50. (Uerj 2007) Diversas tcnicas so utilizadas para determinar, em genes de uma clula eucariota, a seqncia de bases nitrogenadas codificantes, ou seja, aquela que define a estrutura primria da protena a ser sintetizada. A abordagem experimental mais freqente, hoje, consiste em, primeiramente, extrair os RNA-mensageiros da clula, sintetizar os seus DNA-complementares e, ento, proceder ao seqenciamento das bases presentes nesses DNA. Em uma bactria, no entanto, possvel determinar a seqncia codificante diretamente a partir de seu cromossomo. Explique o motivo pelo qual, em organismos eucariotos, prefervel utilizar o RNA-mensageiro para determinar a regio codificante do DNA.

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO


52. (Ufrj 95) Na espcie humana h dois tipos de hemoglobinas, conhecidas como hemoglobinas A e S, que diferem apenas em um aminocido:

51. (Ufg 2007) Os grficos a seguir representam o efeito inibitrio de dois antibiticos (I e II) sobre a sntese protica em culturas de 'Staphylococcus aureus'. As setas nos grficos indicam o momento em que foram administrados os antibiticos nas culturas.

Hemoglobina A: ...valina-histidina-leucina-treonina-prolina-cido glutmico...

Hemoglobina S: ...valina-histidina-leucina-treonina-prolina-x...

Essa pequena diferena suficiente para determinar que uma pessoa portadora de hemoglobina S sofra de anemia falciforme.

Os cdons de RNA-m que codificam esses aminocidos so:

valina - GUU, GUG, GUC, GUA Com base nos grficos, explique a atuao dos antibiticos I e II sobre a sntese protica. histidina - CAU, CAC leucina - UUG, UUA treonina - ACU, ACC, ACG, ACA prolina - CCU, CCC, CCG, CCA cido glutmico - GAG, GAA

A mutao pode ocorrer no ADN como mostra o esquema a seguir:

a) Qual o aminocido que aparece, na hemoglobina S, no lugar do cido glutmico? Justifique sua resposta. b) Todas as clulas, a partir da clula que sofre a mutao, sero anmalas? Justifique sua resposta.

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO


55. (Ufscar 2005) Nos anos 50 e 60, quando se iniciavam as pesquisas sobre como o DNA codificava os aminocidos de uma protena, um grupo de pesquisadores desenvolveu o seguinte experimento:

53. (Ufrj 2002) Nos procariotos, o sinal para o incio da sntese das protenas (traduo) geralmente sinalizado no ARNm pelo cdon AUG, que corresponde ao aminocido metionina. No entanto, alm do cdigo AUG, existe uma seqncia curta de nucleotdeos que antecede esse cdon. Essa seqncia, que chamada de ShineDalgarno, em homenagem aos pesquisadores que as detectaram, permite que o stio correto de iniciao da traduo seja selecionado. O diagrama a seguir ilustra a localizao dessa seqncia. A seqncia de Shine-Dalgarno est em vermelho e o cdon de iniciao, em azul.

- Sintetizaram uma cadeia de DNA com trs nucleotdeos repetidos muitas vezes em uma seqncia conhecida: ...AGCAGCAGCAGCAGCAGCAGCAGC... - Essa cadeia de DNA foi usada em um sistema livre de clulas, porm no qual haviam todos os componentes necessrios sntese protica, incluindo os diferentes aminocidos. - Nesse sistema, essa cadeia de DNA sempre produzia uma protena com um nico tipo de aminocido. Diferentes repeties do experimento demonstraram que at trs protenas diferentes poderiam ser produzidas, cada uma delas com um nico tipo de aminocido: serina ou alanina ou glutamina.

a) Por que as protenas obtidas possuam apenas um tipo de aminocido? b) Por que foram obtidos 3 tipos de protenas? Explique a importncia desse duplo controle da iniciao para a traduo correta da mensagem contida no ARNm.

56. (Unicamp 98) O metabolismo celular controlado por uma srie de reaes em que esto envolvidas inmeras protenas. Uma mutao gnica pode determinar a alterao ou a ausncia de

54. (Ufrj 2008) Se extrairmos o DNA total de clulas de msculo, bao e rim de um mesmo indivduo, verificaremos que os tecidos apresentam genomas idnticos. Os RNA mensageiros das clulas desses trs tecidos sero os mesmos? Justifique sua resposta.

algumas dessas protenas, levando a mudanas no ciclo de vida da clula. a) Explique a relao que existe entre gene e protena. b) Por que podem ocorrer alteraes nas protenas quando o gene sofre mutao? c) Em que situao uma mutao no altera a molcula protica? 57. (Unicamp 2000) Abaixo esto esquematizadas as seqncias de aminocidos de um trecho de uma protena homloga, em quatro espcies prximas. Cada letra representa um aminocido.

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

a) Quantos nucleotdeos so necessrios para codificar a seqncia de aminocidos nas espcies 1 e 2? Justifique.

a) Do ponto de vista gentico, quantos tipos de albinismo podem ocorrer nessa espcie? Por qu?

b) Pode-se dizer que seqncias idnticas de aminocidos so sempre codificadas por seqncias idnticas de nucleotdeos? Justifique.

b) Demonstre o fentipo esperado de um cruzamento entre animais de linhagens puras com dois tipos diferentes de albinismo.

c) Considerando que as espcies 2, 3 e 4 se originaram da espcie 1, que tipo de mutao originou cada seqncia? 58. (Unicamp 2002) O esquema a seguir representa a seqncia de reaes que levam formao do pigmento da pelagem de uma espcie animal. Os genes autossmicos A, B e C so responsveis pela produo das enzimas A, B e C que atuam nesse processo metablico. Mutaes nos genes A, B e C produzem respectivamente os alelos recessivos a, b e c.

c) possvel ocorrer uma mutao em um gene sem que se altere a enzima correspondente? Justifique.

59. (Unifesp 2006) Uma fita de DNA tem a seguinte seqncia de bases 5'ATGCGT3'. a) Considerando que tenha ocorrido a ao da DNA-polimerase, qual ser a seqncia de bases da fita complementar? b) Se a fita complementar for usada durante a transcrio, qual ser a seqncia de bases do RNA resultante e que nome recebe esse RNA se ele traduzir para sntese de protenas?

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO


62. (Ufrj 2004) Aps tratar culturas de bactrias com doses de um agente mutagnico capaz de induzir uma nica mutao pontual (que afeta apenas um nucleotdeo por clula), analisou-se a seqncia de aminocidos de uma determinada protena em diversos mutantes gerados. Verificou-se que um desses mutantes produzia uma dada protena que diferia da original pela ausncia de 35 aminocidos em uma das extremidades da cadeia peptdica.

60. (Unirio 2002) Sabe-se que a bactria 'E.coli' cresce mais rapidamente na presena da glicose (um monossacardeo) do que na presena de lactose (um dissacardeo). Isso se deve a dois fatos: primeiro, a lactose no to facilmente incorporada pelas bactrias; segundo, porque a lactose necessita ser hidrolisada pela enzima galactosidase em glicose e galactose. O grfico a seguir resultou de experimento em que 'E.coli' foi inoculada num meio contendo uma mistura de glicose e lactose. As curvas no grfico adiante representam a concentrao da enzima -galactosidase, a concentrao de glicose e o nmero de bactrias no meio de cultura em funo do tempo.

Explique como essa nica mutao pontual pode fazer com que a sntese da protena seja interrompida prematuramente.

63. (Ufrj 2007) As seqncias de RNA mensageiro a seguir codificam peptdeos com atividades biolgicas especficas. Suponha que mutaes no DNA tenham causado as seguintes mudanas nas duas molculas de mRNA (1 e 2). A tabela resumida do cdigo gentico mostra alguns cdons e seus aminocidos correspondentes.

Identifique as curvas da figura, correlacione os parmetros concentrao de -galactosidase, concentrao de glicose e nmero de bactrias e explique o comportamento da curva da enzima galactosidase.

61. (G2) Descreva o experimento realizado por Hersey e Chase em 1952, conhecido como "experincia do liquidificador" na qual utilizaram istopos radioativos de enxofre (S) e de fsforo (P) para 'marcar' vrus parasitas de bactrias, bem como suas concluses a partir deste trabalho. Em qual das mudanas (1 ou 2) h risco de perda ou de diminuio da atividade biolgica? Justifique sua resposta.

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO


4. a) Em ribossomos isolados no h sntese de cadeias polipeptdicas. O RNA mensageiro necessrio pois transmite a mensagem gentica para a sntese dos polipeptdeos.

64. (Ufc 2008) Uma biotecnologia conhecida como "construo antisenso" (sem sentido) foi utilizada para a produo de tomate transgnico. A transformao gentica do tomateiro consistiu na incorporao (no genoma da planta) e na expresso de um segmento de DNA, que apresenta uma seqncia de nucleotdeos, complementar quela do gene natural. Esse gene natural codifica para a produo de uma enzima, essencial biossntese do etileno. Com base no exposto, responda as questes a seguir.

b) Polipeptdeos so formados a partir do encadeamento de aminocidos. Polirribossomos so constitudos de ribossomos ligados ao RNA mensageiro.

5. a) O ncleo contm DNA que comanda a produo das protenas a) Qual o resultado da transcrio do gene natural (I) e do "gene antisenso" (II), presentes no segmento de DNA (molde) das plantas modificadas, mostrado a seguir? 3'___ATTCGGC___TAAGCCG___TAAGCCG___5'(DNA) 6. a) Transcrio no ncleo ao nvel dos cromossomos e traduo no b) Segundo as regras de emparelhamento dos pares de bases, que fenmeno ocorrer como resultado do encontro, no citoplasma, entre esses dois RNA mensageiros, determinados no item anterior, e qual a conseqncia para o processo de traduo? citoplasma ao nvel dos ribossomos. b) Sem a regio organizadora do nuclolo no haver RNA ribossmico, matria-prima para a produo destes organides e, conseqentemente, cessar a sntese de protenas na clula. atravs da sntese de RNA. b) Protenas e Glicoprotenas porque os ribossomos produzem as protenas que so associadas aos acares no Complexo de Golgi.

c) A transformao gentica foi realizada de modo que a expresso do "gene anti-senso" ocorra apenas nos tecidos do ovrio floral. Qual o resultado final mais provvel de todo esse processo?

7. a) Os animais tm 2n = 63 cromossomos, porque so resultantes da unio de espermatozide, com n = 31 cromossomos, e vulo, com n = 32 cromossomos. b) Os cromossomos so de 2 espcies diferentes e, portanto, no

d) Qual a principal vantagem para os produtores de tomate que passarem a utilizar essas plantas transgnicas?

ocorre pareamento dos chamados cromossomos homlogos, impossibilitando a meiose e a gametognese.

8. Na fita dever existir 18% de guanina, 32% de adenina e 32% de

GABARITO

timina.

1. Na primeira gerao, cada hlice do DNA que contm N molda a sua hlice complementar usando bases com N. Forma-se, portanto, DNA dupla hlice do tipo intermedirio.

O DNA formado por uma dupla cadeia de polinucleotdeos. Sabendo-se que as cadeias so complementares e o pareamento sempre adenina com timina e citosina com guanina, a quantidade de citosina de ser igual a de guanina e a quantidade de adenina de ser

2. leve = zero intermedirio = 50% pesado = 50%

igual a de timina.

9. a) no tubo B a densidade intermediria devido a presena do istopo normal e do istopo pesado, dada a caracterstica do DNA ser

3. Procarioto porque no existe a carioteca separando o material gentico (DNA) do citoplasma, onde se localizam os ribossomos.

semiconservativo. b) na faixa superior, h X de DNA, com densidade menor (istopo normal).

10. a) O DNA produz cpias idnticas de si mesmo.

salabioquimica.blogspot.com
b) Sntese protica.

Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO


16. a) A influncia pode ser crucial pois analisado o DNA fornecido por clulas nucleadas, como os glbulos brancos, que

11. a) Tipo de molcula: cido ribonuclico (RNA) Justificativa: a uridina se incorpora ao cido ribonuclico. Este cido principalmente sintetizado no nuclolo, deslocando-se posteriormente para o citoplasma.

podem viver muitos anos e se duplicar ativamente. b) A fraude pode ser evitada colhendo-se clulas brancas da medula ssea vermelha do indivduo a ser testado.

17. Durante a fertilizao, somente o DNA nuclear do b) Compartimento: ncleo Justificativa: a timidina exclusiva do DNA, encontrado principalmente no ncleo. 18. Se houvesse a transcrio simultnea das cadeias complementares 12. a) Porque elas possuem DNA idnticos. dos genes, as molculas de ARN sintetizadas tambm teriam seqncias complementares. Tal situao provocaria ento a b) Porque, embora essas clulas possuam o mesmo DNA, diferentes genes podem ser ativados ou no durante as etapas do desenvolvimento do indivduo. 19. As mutaes ocorrem aleatoriamente, com uma taxa mdia 13. REPLICAO: duplicao do material gentico (DNA), relacionado com a transmisso das caractersticas hereditrias. constante. Logo, a variabilidade gentica diretamente proporcional antiguidade, o que confirma que nosso ancestral comum mais recente viveu na frica. TRANSCRIO: sntese de RNA, relacionada com o controle das atividades celulares atravs da sntese de protenas. 20. a) C = G = 29% e A = T = 21%. formao de molculas de ARN de cadeia dupla, que no poderiam ser traduzidas nos ribossomas. espermatozide penetra no vulo. Por esse motivo, o DNA mitocondrial do zigoto necessariamente materno.

14. a)

b) Porque a proporo de bases apresentada refere-se s duas cadeias da molcula de DNA, no sendo possvel determinar a proporo de

I) filhas: 0% filhos: 0%

citosina na cadeia que ser transcrita.

21. Cultura de crescimento N 100% de molculas de DNA II) filhas: 100% filhos: 100% Cultura de 1 gerao 100% de molculas, cada uma com parte b) Em seres humanos, a herana do genoma mitocondrial , exclusivamente, materna, pois as mitocndrias do espermatozide no penetram no vulo. Portanto, o pai no transmitir esta caracterstica (cegueira) para a sua prole. Por outro lado, no caso de a me ser afetada (cega), esta caracterstica ser transmitida para todos os seus filhos. A justificativa se baseia na propriedade semiconservativa da duplicao do DNA. 15. Vrias molculas de DNA-polimerase iniciam a replicao do DNA, simultneamente, em diversos stios do genoma denominados stios de origem de replicao. 22. A nica afirmao possvel, face aos dados, que as duas molculas possuem as mesmas propores de bases nitrogenadas. Cultura de 2 gerao 50% de molculas com N e 50% com N - N. da hlice do DNA com N e parte com N. com N.

salabioquimica.blogspot.com
a mesma nas duas molculas.

Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

Somente seriam idnticas se a ordenao das bases fosse exatamente

23. a) Contm DNA as lminas de nmeros 3 e 4. b) As propores desiguais de citosina e guanina indicam a presena, na quinta lmina, de um cido nuclico formado por uma hlice simples, podendo ser DNA ou RNA.

24. a) Os bacterifagos utilizam nucleotdeos que contm P da bactria para construir seu material gentico (DNA). b) O tipo de herana se justifica, pois apenas o DNA mitocondrial, b) Os bacterifagos injetam seu DNA com P no interior da bactria hospedeira, deixando-a marcada com radioatividade. presente no vulo (gameta feminino) ser transmitido descendncia.

c) No. Os vrus no injetam sua capa protica na clula bacteriana. O S radioativo entra na composio de protenas e no no DNA introduzido pelo vrus.

28. Na cadeia 2 h maior quantidade de pares CG. Devido a este fato, maior o nmero de pontes de hidrognio a serem rompidas, o que justifica a necessidade de uma temperatura de desnaturao mais elevada.

25. a) Os 'corrimos' correspondem a uma sucesso alternada de fosfato e desoxirribose (acar). Os 'degraus' so constitudos por pares de bases nitrogenadas, unidas por pontes de hidrognio, onde adenina pareia com timina, e citosina com guanina. 29. 1) cido fosfrico 2) Desoxirribose 3) Base nitrogenada

b) O DNA realiza a transcrio, isto , produz o RNA mensageiro, que conduz os cdons para a sntese da protena nos ribossomos.

30. O DNA um polinucleotdeo capaz de produzir o RNA mensageiro. Cada trs nucleotdeos (cdon) do RNAm ser traduzido por um aminocido ao nvel dos ribossomos.

c) As protenas podem ser diferenciadas pelo nmero, tipos e seqncias de seus aminocidos. 31. a) Protena normal: 26. a) Os bacteriofagos produzidos pela bactria infectada tero a cpsula protica e o DNA do fago T4. b) Durante a infeco, apenas o DNA do fago T4 penetra na bactria hospedeira. O DNA do fago, passa a comandar a produo da nova linhagem viral. Indivduo A: Val - Leu - Tre - Pro Indivduo B: Val - Leu - Tre - Pro - Tir - Val - Lis Indivduo C: Val - Met - Tre - Pro - Tir - Val - Lis Val - Leu - Tre - Pro - Tir - Val - Lis

27. a) Observe a figura a seguir:

b) A afetado porque produz uma protena menor. B normal, apesar da substituio de uma base nitrogenada no seu DNA, porque o cdigo gentico degenerado. C afetado porque possui um aminocido diferente em sua protena.

salabioquimica.blogspot.com
aminocidos por eles codificados.

Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO


37. a) RNAm: UCC GUU AAU UCC GGC AAG

32. a) a correspondncia entre as trincas de bases dos cdons e os

b) Por que um nico aminocido pode ser codificado por mais de um cdon.

b) O cdon mutado, TTA, especificaria o terceiro aminocido da tabela.

33. Quando a mutao for localizada:

c) UUA

a) no stio 1 A seqncia do DNA ser modificada pelo benzo[a]pireno de ATG para ATT levando, na transcrio, a formao de um RNAm com a seqncia UAA ao invs de UAC. UAA um cdon de terminao, portanto, a mutao provocar a produo de uma protena menor.

38. a) RNA-polimerase.

b) UAC.

c) W - A - T - S - O - N - E - C - R - I - C - K.

b) no stio 2 A seqncia do DNA de CCG ser modificada para CCT levando na transcrio, a formao de um RNAm com a seqncia GGA ao invs de GGC. Nessa situao, a modificao de GGC para GGA no provocar alterao na protena; os dois cdons na traduo produzem uma protena com o aminocido glicina, nesta posio.

d) A protena no ser formada, pois foi alterado o cdon de iniciao.

39. a) AUG AGU UGG CCU G

b) Serina - triptofano - Prolina

34. a) Produto da sntese protica (polipeptdio): val - his - leu - thr - pro - glu - glu - lys

c) Metionina - Serina - Glicina

40. a) Para que o genoma RNA (-) seja expresso em protenas na b) Exemplo de mutao pontual no gene que codifica a cadeia da globina humana: substituio do nucleotdeo A por T no cdon correspondente ao cido glutmico. Conseqncia: anemia falciforme - alterao estrutural do polipeptdio (substituio do cido glutmico pela valina); - alterao da funo da protena (globina); - reduo da capacidade de transporte de oxignio; - manifestao dos sintomas da anemia falciforme. b) Os vrus s existem em virtude de sua habilidade de utilizar a maquinaria metablica das clulas hospedeiras, direcionando-a para a 35. Com a descoberta do cdigo gentico sabe-se que um aminocido sempre codificado por trs nucleotdeos. Logo, o gene que codifica uma protena tem sempre maior nmero de nucleotdeos que de aminocidos. Sabe-se ainda que existem vrios nucleotdeos do gene que servem para a funo de regulao e no so transcritos. 41. No. Os tecidos de um mesmo organismo diferenciam-se pelas diferentes protenas que contm. Assim, a diferenciao dos tecidos resulta principalmente da transcrio de genes diferentes, o que 36. Porque o cdigo gentico degenerado, isto , para um mesmo aminocido existem vrios cdons diferentes. naturalmente produz uma composio de RNAm qualitativamente diferente de tecido para tecido. formao de novas partculas virais. Portanto, os vrus s devem ter surgido aps o aparecimento das primeiras clulas. clula infectada, primeiro necessrio que seja transcrito em RNA complementar, o que feito, apenas, pela RNA replicase, que no existe na clula. Desta forma, o prprio vrus ter de j possuir a enzima em sua estrutura. Os vrus RNA (+) j funcionam como mensageiros na clula infectada, sendo diretamente traduzidos em protenas virais, inclusive a RNA replicase.

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO


47. So molculas (DNA e RNA) que comandam, atravs da sntese de enzimas, todo o metabolismo celular. Segmentos de DNA (genes) transcrevem o RNAm que, nos ribossomos, associados ao RNAt realizam a traduo do cdigo gentico em uma protena.

42. As regies 2 e 4. Essas regies formam alas justamente por no possurem as seqncias de nucleotdeos complementares, que foram eliminadas aps o processo de transcrio.

43. a) DNA cadeia complementar: 30A-20C-12T-10G cadeia ativa: 30T-20G-12A-10C 49. a) Replicao: no interfere; no h alteraes na incorporao de RNA-mensageiro: 30A-20C-12U-10G timidina marcada no DNA. Transcrio: no interfere; no h alterao na incorporao de Portador, o RNA-m ter 12 uracilas e 10 guaninas. uridina marcada no RNA. Traduo: interfere; esta etapa bloqueada porque h uma queda b) A cadeia ativa apresenta 72 bases. Cada aminocido codificado por um cdon constitudo por 3 bases. Da conclumos que 72 bases formam 24 cdons que produziro uma cadeia polipeptdica com 24 aminocidos. b) Duas dentre as ligaes ou interaes: - ponte dissulfeto - ponte de hidrognio 44. a) CAU CGG AUC - foras de van der Walls - interaes hidrofbicas b) Somente se formar o mesmo peptdeo se os cdons transcritos a partir da fita complementar especificarem os mesmos aminocidos, devido degenerao do cdigo gentico. 50. Os organismos eucariotos possuem ntrons, regies no codificantes em seu DNA, que sero eliminadas no processo de 45. a) Observe a figura a seguir: maturao do RNA-mensageiro, antes que ele seja traduzido em protena. - interaes eletrostticas acentuada na incorporao de aminocido marcado na protena. 48. Cada mutante possui um gene alterado. Z s cresce em meio com arginina, logo apenas o gene 3 do mutante Z apresenta alterao.

51. O antibitico I atua sobre a traduo, pois, ao ser administrado, reduz imediatamente a sntese protica. O antibitico II pode atuar inibindo a transcrio e/ou a replicao gnica, pois no momento da administrao at o incio da reduo da sntese protica, decorrem 20 minutos; isso significa que havia cido ribonuclico mensageiro sendo traduzido e produzindo protena.

52. a) Valina, porque houve uma substituio (T x A) no codon do DNA correspondente a esse aminocido. b) No. Sendo o cdigo gentico degenerado, diferentes trincas de nucleotdeos especificam o mesmo aminocido. 53. Como o ARNm pode conter outros cdons AUG, alm do cdon 46. Os genes que no codificam polipeptdeos transcrevem para produzir RNA ribossmico e RNA transportador. de iniciao, a iniciao da traduo poderia ocorrer em qualquer regio onde houvesse um outro cdon AUG, o que geraria peptdeos b) No, porque aps a replicao do DNA semiconservativa.

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO


58. a) Do ponto de vista gentico, poderiam ocorrer trs tipos de albinismo, pois esto envolvidos trs pares de genes para a produo

truncados ou incompletos. A traduo s ocorre quando a seqncia de Shine-Dalgarno e o cdon AUG esto presentes.

54. No, porque a diferenciao celular envolve a expresso (transcrio) e a inativao de diferentes genes nos diversos rgos.

do pigmento no animal. Defeitos no gene A, impedem a formao do composto 1, interrompendo toda a cadeia de reaes que levam ao desenvolvimento da cor. Alteraes no gene B, acarretam a no

55. a) As protenas obtidas possuam apenas um tipo de aminocido porque o DNA utilizado apresentava um nico tipo de cdon (AGC).

formao do composto 2, resultando tambm na no formao da pigmentao. Mutaes no gene C, impedindo a sntese do composto 3, tambm causariam albinismo.

b) O tipo de aminocido utilizado na produo da protena poder variar dependendo do local onde os ribossomos iniciam a traduo do cdigo gentico. O aminocido utilizado a serina quando a leitura comea no A, do cdon AGC. O aminocido a alanina quando a leitura comea no G, do cdon GCA. O aminocido utilizado a glutamina, quando a leitura comea no C, do cdon CAG. Gerao: 56. a) Gene um segmento do DNA localizado nos cromossomos. Possui um cdigo qumico representado por seqncias de bases nitrogenadas (adenina, guanina, citosina e timina). Cada trinca de bases capaz de codificar um aminocido de uma protena. A seqncia de trincas determinar a seqncia dos aminocidos de um polipeptdeo. 59. a) 3'TACGCA5'. c) Devido degenerao do cdigo gentico, um aminocido pode ser determinado por diferentes cdons. Assim, uma mutao em um gene, pode no causar qualquer alterao na protena codificada. AABbCc - 100% pigmentados AAbbCC x AABBcc b) Pais genotipicamente puros portadores de dois tipos distintos de albinismo:

b) Mutaes so modificaes na seqncia ou na composio das bases do DNA (gene) que podem causar a produo de uma protena alterada, ou mesmo a no produo da protena.

b) 5'AUGCGU3'. O RNA que ser utilizado na traduo o RNAm (RNA mensageiro).

60. Os crculos pretos representam o nmero de bactrias; os crculos c) A substituio de uma base nitrogenada no DNA pode no causar nenhuma alterao na protena produzida pela clula porque o cdigo gentico degenerado, ou seja, um mesmo aminocido pode ser codificado por diferentes trincas de bases. brancos representam a concentrao de glicose; os tringulos pretos a concentrao da enzima -galactosidase. Enquanto existe glicose no meio a -galactosidase est reprimida. Quando a glicose se esgota a expresso dessa enzima induzida.

57. a) So necessrios pelo menos 84 nucleotdeos pois cada aminocido de uma protena codificado por uma trinca de nucleotdeos.

61. 1.) bactrias 'Escherichia coli' cultivadas em meio contendo P e S bactrias marcadas com os elementos radioativos.

2.) Vrus bacteriofagos parasitam as bactrias marcadas e ficam b) No. Devido degenerao do cdigo gentico, um aminocido pode ser codificado por mais do que uma trinca de nucleotdeos. 3.) Vrus marcados parasitam bactrias no marcadas. c) A mutao que originou a espcie 2 foi uma SUBSTITUIO. Uma INVERSO produziu a alterao verificada na espcie 3 e uma DELEO acarretou o surgimento da espcie 4. 4.) Antes da lise bacteriana o preparado levado ao liquidificador e centrifugado. tambm marcados com P no DNA e S na cpsula protica.

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO


c) No haver a sntese de etileno nos tecidos do fruto, e o fruto no amadurecer;

5.) O sobrenadante apresenta as cpsulas proticas marcadas com S e no precipitado h bactrias contendo DNA marcado com P.

Concluso: O DNA viral a substncia capaz de TRANSFORMAR as bactrias em "fbricas" de novos vrus bacteriofagos. Assim o DNA foi definitivamente identificado como sendo a substncia que controla a hereditariedade.

d) Podero armazenar os frutos por mais tempo, depois de colhidos.

62. A mutao deve ter alterado um cdon que codificava um aminocido transformando-o em um cdon de parada, que interrompe a leitura do ARNm pelo ribossoma.

63. A mudana 2, pois essa a nica que provoca troca de aminocidos. Essa troca altera a estrutura do peptdeo, o que pode alterar sua funo.

64. a) (I): UAAGCCG; (II): AUUCGGC;

b) b1. Emparelhamento dos RNA / Formao de RNA de fita dupla; b2. A traduo ser inibida;

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO