Título: A maior lista de genética da história!

Professor: André Braga Turma: AeB
Questão 1 O texto que se segue foi extraído de "Xadrez, truco e outras guerras", de José Roberto Torero. Servimos-nos de algumas de suas estruturas para introduzir a(s) questão(ões) seguintes. "Os abutres, sábios animais que se alimentavam do mais farto dos pastos, já começavam a sobrevoar a ala dos estropiados quando o General mandou que acampassem. Naquela tarde assaram trinta bois, quantidade ínfima para abastecer os homens que ainda sobravam.... O plano dos comandantes era assaltar fazendas da região e tomar-lhes o gado... À noite a ração foi ainda mais escassa, e, para enganar a fome, fizeram-se fogueiras para assar as últimas batatas e umas poucas raízes colhidas pelo caminho. Como o frio também aumentava, surgiu um impasse: quem ficaria perto do fogo: os coléricos, que logo morreriam, ou os sãos, que precisavam recuperar as forças para a luta?" (TORERO, J. Roberto. "Xadrez, truco e outras guerras") "(...) os coléricos, que logo morreriam, ou os sãos, que precisavam recuperar as forças para a luta?" Muitas doenças podem provocar a morte. a) A afirmação "os coléricos, que logo morreriam" é falsa ou verdadeira? Justifique. b) Justifique e exemplifique: Muitas doenças são hereditárias e sua manifestação está na dependência da ação de genes específicos ou de alterações cromossômicas. Questão 2 O texto abaixo refere-se às questões: 2 a 3 O experimento clássico de Meselson e Stahl, em 1957, demonstrou que a replicação do DNA era semiconservativa, ou seja, cada fita do DNA serve de molde para sua própria duplicação, formando moléculas de DNA idênticas à original. Nesse experimento, os cientistas cultivaram células de 'Escherichia coli' inicialmente em presença de fonte de ¢¥N (isótopo de nitrogênio leve), trocando, a seguir, por ¢¦N (isótopo pesado), que é incorporado às bases nitrogenadas do DNA. Colheram, então, amostras de DNA após a primeira e a segunda gerações de células crescidas em ¢¦N e analisaram essas amostras quanto à densidade do DNA formado. Considere como PESADO o DNA dupla hélice marcado com ¢¦N; como LEVE o marcado com ¢¥N; como INTERMEDIÁRIO o marcado com ¢¥N e ¢¦N. Justifique por que, após a troca da fonte de nitrogênio, a primeira geração de células foi totalmente constituída com DNA dupla hélice do tipo INTERMEDIÁRIO. Questão 3 Calcule as proporções dos três tipos de DNA dupla hélice LEVE, INTERMEDIÁRIO E PESADO - formados em células da segunda geração, após a troca da fonte de nitrogênio. Questão 4 "O agronegócio responde por um terço do PIB, 42% das exportações e 37% dos empregos. Com clima privilegiado, solo fértil, disponibilidade de água, rica biodiversidade e mão-de-obra qualificada, o Brasil é capaz de colher até duas safras anuais de grãos. As palavras são do Ministério da Agricultura e correspondem aos fatos. Essa é, no entanto, apenas metade da história. Há uma série de questões pouco debatidas: Como se distribui a riqueza gerada no campo? Que impactos o agronegócio causa na sociedade, na forma de desemprego, concentração de renda e poder, êxodo rural, contaminação da água e do solo e destruição de biomas? Quanto tempo essa bonança vai durar, tendo em vista a exaustão dos recursos naturais? O descuido socioambiental vai servir de argumento para a criação de barreiras não-tarifárias, como a que vivemos com a China na questão da soja contaminada por agrotóxicos?" (Adaptado de Amália Safatle e Flávia Pardini, Grãos na Balança. "Carta Capital", 01/09/2004, p. 42.) A contaminação por agrotóxicos também é mencionada no texto. A aplicação intensiva de agrotóxicos a partir da década de 1940 aumentou a produtividade na agricultura. Atualmente, são produzidas e cultivadas plantas
1

transgênicas, isto é, geneticamente modificadas para serem resistentes à ação de insetos. Um exemplo conhecido é o milho geneticamente modificado com um gene da bactéria 'Bacillus thuringensis' (Bt), o que lhe confere resistência a ataques de insetos. Contudo, alguns pesquisadores têm observado que diferentes espécies de insetos adquirem resistência às toxinas bioinseticidas produzidas por essas plantas. a) Explique como os insetos se tornam resistentes. b) Sabe-se que a aplicação intensiva de agrotóxicos, como o DDT, pode afetar a cadeia alimentar tanto de ambientes aquáticos como de solos. Explique por que isso ocorre. Questão 5 Atualmente, um grande esforço tem sido feito por diversos centros de pesquisa e de tratamento de pessoas queimadas para produzir grandes áreas de pele, do próprio indivíduo, que possam recobrir imediatamente áreas destruídas. Explique a vantagem de se utilizar a pele do próprio indivíduo para recobrir as áreas destruídas, ao invés de serem utilizados enxertos de pele de outras pessoas. Questão 6 O desenho a seguir mostra a síntese de um polipeptídio a partir da molécula de DNA num certo organismo. Esse organismo é um procarioto ou um eucarioto? Por quê?

b) A clonagem de bactérias, comparada à clonagem de animais, é um processo mais complexo ou mais simples? Justifique. Questão 8 O gráfico a seguir demonstra a distribuição citoplasmática do número de ribossomas isolados e polirribossomas, em comparação com o número de cadeias polipeptídicas em formação durante um certo período de tempo.

1.1.3.2

(Adaptado de ALBERTS, Bruce & outros. "Molecular biology of the cell". New York, Garland Publishing, 1994, p.239) a) Defina a relação existente entre os ribossomas isolados e a formação das cadeias polipeptídicas. Justifique sua resposta. b) Descreva a estrutura das cadeias polipeptídicas e a dos polirribossomas. Questão 9

1.1.1.2 Um certo tipo de macromolécula destinada à membrana plasmática celular, depende de etapas nucleares e citoplasmáticas para sua produção, de acordo com os percursos esquematizados a seguir:

Questão 7 Nas bactérias, a cadeia respiratória encontra-se associada à membrana plasmática e os ácidos nucléicos estão associados ao citoplasma. a) É assim também em um protista, em um animal e em um vegetal? Justifique.
2

Questão 12 Ribossomos são formados por RNA e proteínas, sintetizados pelos processos de transcrição e tradução, respectivamente. a) Onde esses processos ocorrem na célula eucariótica? b) O que acontecerá com os processos de transcrição e tradução, se ocorrer uma inativação na Região Organizadora do Nucléolo? Justifique. Questão 13 a) Por que essas etapas começam no núcleo? b) Qual é a composição da macromolécula ao final do percurso I? E do percurso II? Esclareça a diferença, baseando-se nas funções das organelas citoplasmáticas envolvidas em cada percurso. Questão 10 Uma espécie de lombriga de cavalo possui apenas um par de cromossomos no zigoto (2n=2). Um macho dessa espécie, heterozigótico quanto a dois pares de alelos (Aa Bb) formou, ao final da gametogênese, quatro tipos de espermatozóides normais com diferentes genótipos quanto a esses genes. a) Qual é o número de cromossomos e o número de moléculas de DNA no núcleo de cada espermatozóide? b) Quais são os genótipos dos espermatozóides formados? c) Por que, a partir das informações fornecidas, não é possível estimar a proporção em que cada um dos quatro tipos de espermatozóides aparece? Explique. Questão 11 Uma mulher com a idade de 40 anos está grávida do primeiro filho. Ela sabe que, devido à sua idade, o bebê tem maior probabilidade de ser portador de alguma anomalia cromossômica. A cariotipagem pré-natal é o exame mais indicado para esclarecer estas dúvidas na fase uterina. Pergunta-se: a) Em que consiste este exame? b) Que exemplos de anomalias cromossômicas podem ser detectadas através deste exame (cite dois exemplos). Criadores e sitiantes sabem que a mula (exemplar fêmea) e o burro (exemplar macho) são híbridos estéreis que apresentam grande força e resistência. São o produto do acasalamento do jumento ('Equus asinus', 2n = 62 cromossomos) com a égua ('Equus caballus', 2n = 64 cromossomos). a) Quantos cromossomos têm o burro ou a mula? Justifique sua resposta. b) Considerando os eventos da meiose I para a produção de gametas, explique por que o burro e a mula são estéreis. Questão 14 Considere as duas fases da meiose, de um organismo com 2n=6 cromossomos, esquematizadas a seguir e responda:

1.1.3.2

1.1.5.2

a) Que fases estão representadas na figura A e na B? Justifique. b) Que tipo de alteração aparece em uma das figuras? Em relação aos cromossomos, como serão as células resultantes de um processo de divisão com essa alteração? c) Dê um exemplo de anomalia que seja causada por este tipo de alteração na espécie humana, cujo número normal de cromossomos é 2n = 46.

3

Questão 15 O gato siamês é um animal de rara beleza pois a pelagem de seu corpo é clara com extremidades - orelhas, focinho, pés e cauda - pretas. A presença do pigmento que dá a cor negra a essas extremidades é o resultado da atividade de uma enzima que fica inativada acima de 34°C. Explique por que esses animais têm a pelagem negra nas extremidades do corpo. Questão 16 Desde 1995 alguns estados norte-americanos estão excluindo o ensino da teoria de evolução biológica dos seus currículos escolares alegando, entre outras razões, que ninguém estava presente quando a vida surgiu na Terra. Alguns cientistas defendem a teoria da evolução argumentando que, se é necessário "ver para crer", então não poderemos acreditar na existência dos átomos, pois estes também não podem ser vistos. (Adaptado da "ISTO É", 25/08/1999.) a) Apresente três evidências que apóiam a teoria da evolução biológica. b) A mutação gênica é considerada um dos principais fatores evolutivos. Por quê? Questão 17 Dois 'loci' de uma população, cada um com dois gens alelos, sofrem a ação da seleção natural por muitas gerações, como é mostrado nas tabelas abaixo. O coeficiente de seleção (S) indica os valores com que a seleção natural atua contra o genótipo. O valor adaptativo (W) representa os valores com que a seleção natural favorece o genótipo. Note que (W+S)=1. Qual dos gens, A‚ ou B‚, apresentará a maior freqüência na população? Explique. Questão 18 No porquinho-da-índia existe um par de genes autossômicos que determina a cor da pelagem: o alelo dominante B determina a cor preta e o recessivo b, a cor branca. Descreva um experimento que possa evidenciar se um porquinho preto é homozigoto ou heterozigoto. Questão 19 Nos porquinhos-da-índia, a pelagem negra é dominante sobre a pelagem branca. Um criador tem um lote de porquinhos-da-índia negros, com o mesmo genótipo. O que deve fazer para descobrir se esses animais são homozigotos ou heterozigotos? Justifique sua resposta. Questão 20 Uma anomalia genética autossômica recessiva é condicionada por uma alteração na seqüência do DNA. Um homem portador dessa anomalia apresenta a seqüência timina-citosina-timina enquanto sua mulher, que é normal, apresenta a seqüência timina-adenina-timina. A análise do DNA de um filho do casal mostrou que ele é portador tanto da seqüência de bases do pai quanto da mãe. a) O filho terá a doença? Por quê? b) Qual a probabilidade de um outro filho do casal apresentar as duas seqüências iguais à da mãe? Questão 21 Um homem afetado por uma doença genética muito rara, de herança dominante, casa-se com uma mulher, não consangüínea. Imagine que o casal tenha doze descendentes, seis filhos e seis filhas. Responda,
4

1.4.1.6

justificando sua resposta, qual será a proporção esperada de filhas e filhos afetados pela doença do pai no caso do gene em questão estar localizado. a) em um autossomo; b) no cromossomo X. Questão 22 Em ervilhas o caráter semente lisa é condicionado por um gene dominante R e semente rugosa pelo seu alelo recessivo r. Quais são as proporções genotípica e fenotípica obtidas na autofecundação de uma variedade comprovadamente heterozigota? Questão 23 "Hormônios são proteínas cuja função é regular os complicados mecanismos do organismo - como o aumento e redução do peso do corpo (...) Em outubro, o geneticista Jeffrey Friediman (...) isolou o primeiro hormônio capaz de controlar o peso, chamado leptina. Ele é produzido por um gene que, quando funciona mal, o organismo ganha peso (...)". (In: "Superinteressante" - ano 10, nŽ 3, mar., 1996.) Com base no texto, RESPONDA: a) Como se denomina o local que o gene ocupa no cromossomos? b) Considerando de forma simplificada a existência de dois alelos para o gene da leptina, um normal (L) e outro mutante (L'), quantos genótipos diferentes são possíveis em humanos diplóides? Quais são eles? c) COMENTE sobre um mecanismo que pode levar à mutação gênica. Questão 24 No início do século XX, a transmissão das informações genéticas para os descendentes era explicada por algumas hipóteses sobre as leis da hereditariedade, como a mendeliana e a por mistura. Observe os esquemas:

1.5.1.1

Suponha que, em um indivíduo de uma população com reprodução sexuada, apareça, por mutação, um gene raro que confira ao seu portador características vantajosas. Indique, para cada uma das hipóteses representadas, se há ou não possibilidade de aumento da freqüência do gene mutante na descendência desse indivíduo e justifique suas respostas. Questão 25 Leia o texto a seguir. "A Doença de Alzheimer (D.A.) (...) é uma afecção neurodegenerativa progressiva e irreversível, que acarreta perda de memória e diversos distúrbios cognitivos. Em geral, a D.A. de acometimento tardio, de incidência ao redor de 60 anos de idade, ocorre de forma esporádica, enquanto que a D.A. de acometimento precoce, de incidência ao redor de 40 anos, mostra recorrência familiar. (...) Cerca de um terço dos casos de D.A. apresentam familiaridade e comportam-se de acordo com um padrão de herança monogênica autossômica dominante. Estes casos, em geral, são de acometimento precoce e famílias extensas têm sido periodicamente estudadas." Smith, M.A.C. (Revista Brasileira de Psiquiatria, 1999) Considerando o texto e o histórico familiar a seguir, responda ao que se pede. Histórico familiar: "Um rapaz cujas duas irmãs mais velhas, o pai e a avó paterna manifestaram Doença de Alzheimer de acometimento precoce."

5

b) aa x aa c) aa x Aa d) Aa x Aa e) Aa x AA 1.5.1.1 Questão 28 No gado bovino da raça Ayrshire a cor mogno é determinada pelo genótipo A A e a cor vermelha pelo genótipo A‚ A‚, mas o genótipo A A‚ é mogno nos machos e vermelho nas fêmeas. Com base nessas informações, qual é o sexo de um filhote vermelho, cuja mãe é uma vaca mogno? Justifique a sua resposta. Questão 29 A formação de uma característica fenotípica depende, em alguns casos, apenas de fatores genéticos. Em outros casos, prevalece a influência de fatores ambientais. Na maioria das vezes há uma interação entre fatores genéticos e ambientais. Um dos métodos utilizados para avaliar a importância relativa dos genes e dos fatores ambientais na formação de uma característica é o estudo comparativo entre irmãos gêmeos monozigóticos criados juntos e criados separados. A tabela a seguir, elaborada a partir de um grande número de pares de gêmeos, indica o grau de concordância de quatro características. Uma concordância significa que quando um irmão possui a característica, o outro também a possui.

I. Montar o heredograma para o histórico familiar apresentado. II. Qual a probabilidade de o rapaz em questão também ser portador do gene responsável pela forma de acometimento precoce da doença? III. Quais indivíduos do heredograma são seguramente heterozigotos para esse gene? IV. Explicar o padrão de herança mencionado no texto. Questão 26 Mendel não acreditava na mistura de caracteres herdados. De acordo com suas conclusões, a partir dos cruzamentos realizados com ervilhas do gênero 'Pisum', as características não se misturam, permanecem separadas e são transmitidas independentemente. HENIG, Robin. "O monge no jardim". Rio de Janeiro: Rocco, 2001. a) Considerando as leis de Mendel para a hereditariedade, no momento da fecundação os cromossomos herdados dos progenitores se juntam, porém os alelos dos seus genes não se misturam. A partir dessa idéia, qual fenômeno explicaria a ocorrência de características intermediárias na progênie, que parecem ser uma mistura daquelas dos progenitores? b) Posteriormente, estudos de grupos de geneticistas indicaram que pode haver troca de material genético entre cromossomos homólogos herdados do pai e da mãe. Em que etapa isso pode ocorrer e como se chama este processo? Questão 27 Determine as probabilidades de aparecerem indivíduos afetados (aa), normais (AA) e heterozigotos (Aa), nas proles dos casamentos: a) aa x AA

1.5.1.1

Indique a característica que mais depende de fatores ambientais. Justifique sua resposta.

6

1 1. quem engravidou e deu à luz foi a mãe da referida mulher. a produtividade era muito baixa. Assim. mas heterozigoto para o albinismo. à medida que a altitude se aproximava do nível do mar. coletadas em diversas altitudes. a produtividade dessas plantas foi medida e apresentou os seguintes resultados: . Este camundongo transgênico foi cruzado com uma fêmea de camundongo normal. quando o genótipo é homozigoto dominante ou heterozigoto. foram plantadas ao nível do mar em idênticas condições ambientais. Com base nessas afirmações. Ele. Qual a probabilidade desse casal ter: a) quatro crianças albinas? b) uma criança albina e do sexo feminino? c) uma criança normal. Em grandes altitudes. admitindo-se que as suposições feitas nas letras (b) e (c) realmente se concretizem. Após algum tempo. realizou um experimento em que sementes dessa espécie. impossibilitada de ter filhos por anomalia no útero. isto é. heterozigota e do sexo masculino? d) Represente o provável heredograma desse casal. e inflorescências mistas (flores femininas e flores masculinas). os meios de comunicação noticiaram o caso de uma mulher norte-americana que. então. dando origem a um camundongo macho. Questão 31 Um pesquisador observou que uma certa espécie de planta apresentava uma grande variação de produtividade relacionada à altitude onde a planta se desenvolvia. 7 Calcule a proporção esperada da prole destes camundongos que será portadora do gene que codifica o HCR. Justifique sua resposta. não portadora do gene HCR. teve seu óvulo fertilizado "in vitro".1. Questão 32 Um determinado casal normal.5. 1. e este foi implantado no útero de sua mãe. solicitou aconselhamento genético sobre a possibilidade de vir a ter crianças apresentando a condição albina. Questão 33 A mamona ('Ricinus communis') produz inflorescências contendo somente flores pistiladas (flores femininas). a produtividade aumentava.1.1 Identifique se é o componente genético ou o componente ambiental que predomina no condicionamento da produtividade dessas plantas. quando o genótipo é recessivo. A célula-ovo transgênica se desenvolveu. que tipos de inflorescências serão produzidas nos descendentes dos seguintes cruzamentos: a) NN x Nn? b) Nn x Nn? Questão 34 Recentemente.5. Justifique sua resposta.Questão 30 Um pesquisador teve sucesso na integração de uma cópia do gene que codifica o hormônio do crescimento de rato (HCR) em um dos cromossomos autossômicos de uma célula-ovo de camundongo.

Considere o cruzamento de gatos homozigotos brancos e marrons. b) Se o agricultor utilizar as sementes produzidas pelo híbrido nos plantios subsequentes. depois de muitos anos nesse ramo. que as flores são hermafroditas e que sementes produzidas por autofecundação são viáveis. são então cruzadas e produzem os híbridos. pelo menos.Responda: a) Do ponto de vista genético. Por quê? Questão 40 Ao estudar a distribuição de uma espécie de planta da família dos girassóis em altitudes crescentes na costa oeste dos Estados Unidos. qual seria a proporção esperada de descendentes com sementes rugosas? Questão 37 Um criador de cabras. Mais tarde. em vez de transplantar o ovário. qual seria a interpretação? 8 . b) No caso de ocorrer autofecundação em uma planta que produz sementes lisas e é heterozigota. Qual a proporção fenotípica esperada em F se a) o modo de herança for do tipo dominante? b) o modo de herança for do tipo co-dominante? Questão 36 Suponha que você tenha em seu jardim exemplares da mesma espécie de ervilha utilizada por Mendel em seus experimentos. quem é a mãe da criança? Justifique. a) Esses indivíduos híbridos são geneticamente iguais entre si? Explique. observou que alguns dos animais de sua criação apresentavam uma característica incomum nos chifres. Duas linhagens. sabendo ainda. o resultado seria o mesmo? Justifique. Sabendo que a característica "lisa" das sementes da ervilha é determinada por um alelo dominante L. os programas de melhoramento utilizam a heterose (vigor do híbrido). Alguns desses exemplares produzem sementes lisas e outros. dois pesquisadores retiraram os ovários de uma cobaia albina e implantaram-lhe um ovário obtido de uma cobaia preta. o animal foi cruzado com um macho albino e deu origem a uma prole toda preta. Nesses programas são desenvolvidas linhagens homozigotas por meio de sucessivas gerações autofecundadas. o resultado não será o mesmo. Como o criador poderia fazer para determinar se essa variação é decorrente de uma mutação genética ou de uma alteração causada por fatores ambientais? Questão 38 Em experimento feito no início do século. portanto por genótipos LL ou Ll e. são mais vigorosos e mais produtivos que os parentais. Após um determinado tempo de crescimento. sementes rugosas. pesquisadores observaram que essas plantas apresentavam um gradiente decrescente de tamanho. a) planeje um cruzamento experimental entre flores de exemplares diferentes que lhe permita determinar se uma planta que produz sementes lisas é homozigota ou heterozigota para esse caráter. c) Se fosse possível implantar os pêlos da fêmea preta na fêmea albina. b) Qual a porcentagem de genes herdados da parturiente que se encontram no patrimônio genético da criança? Questão 35 Em gatos. Questão 39 Em várias culturas vegetais. a) Explique o resultado obtido. b) Se o resultado do experimento tivesse sido o representado no gráfico B. expresso no gráfico A. a) Sabendo-se que o albinismo é característica recessiva. que. em geral. um par de genes. homozigotas para alelos diferentes. Sementes dessas plantas foram coletadas nas várias altitudes e plantadas em uma mesma região localizada ao nível do mar. as plantas resultantes foram medidas e os dados obtidos no experimento são mostrados no gráfico A. as cores marrom e branca dos pelos têm sido descritas como devidas a. como você explica esse resultado? b) Indique os genótipos da fêmea preta e da prole.

Essa última forma geralmente culmina em morte antes de atingir a idade reprodutiva. Justifique sua resposta. caracterizada por uma anemia severa.1.aa. Ela ocorre em duas formas.1.em um jardim de plantas com flores de cor azul não nascem plantas com flores de cor azul-claro. entre outros sintomas. Na expressão fenotípica de tais cores não há relação de dominância entre os alelos. determine o modo de herança indicando os possíveis genótipos dos indivíduos envolvidos. aumento do baço. a talassemia menor e os pretos a talassemia maior. b) Afirmação de um casal de olhos castanhos: "nosso bebê poderá ter olhos azuis porque o avô paterno tem olhos azuis".2 . b) Represente os alelos por letras e indique os genótipos dos indivíduos parentais e dos descendentes no cruzamento IV. e (b) talassemia maior. azul-claro e branca. verificando se elas têm fundamento. Questão 43 A talassemia é um defeito da hemoglobina em seres humanos. Estas cores são determinadas por combinações de dois alelos de um único locus. a) Afirmação de um casal de olhos azuis: "nosso bebê poderá ter olhos castanhos porque as avós têm olhos castanhos".1. analise as afirmações abaixo. . A partir do heredograma hipotético a seguir onde os símbolos claros representam pessoas normais. mas a saúde é essencialmente normal. (a) talassemia menor. 9 1. microcitemia e policitemia. determinando cor castanha) e a (recessivo. Sabe-se que: . Questão 42 Em uma espécie de planta a forma dos frutos pode ser alongada. oval ou redonda. A (dominante.5. proferidas por casais em relação à cor dos olhos de seu bebê. Baseando-se nessa explicação. cor branca . determinando cor azul).5.1. na qual os eritrócitos são pequenos (microcitemia) e em grande número (policitemia).2 Questão 44 Considere uma certa espécie de planta que pode apresentar flores com três tipos de cor: azul.é letal na fase adulta. os hachurados.5. Questão 41 A herança da cor do olho na espécie humana geralmente é representada simplificadamente como um par de alelos.a flor de cor branca nunca se abre. Foram realizados quatro tipos de cruzamento entre plantas dessa espécie e obtidos e seguintes resultados: 1. sendo que a manifestação em homozigose de um dos alelos .1 a) Formule uma hipótese consistente com os resultados obtidos para explicar a herança da forma dos frutos nessa espécie.

1. venha a se desenvolver um rabanete de raiz ovalada? Justifique a sua resposta. e o cruzamento de animais com chifres versus animais sem chifres. pensou-se que o fenótipo anão seria expresso pelo genótipo D/D ou D/d. ruões. Utilizando apenas cruzamentos naturais. Um fazendeiro tem uma grande boiada constituída de animais vermelhos. produz efeito letal durante o desenvolvimento embrionário. sem recorrer à inseminação artificial. que conclusão se pode tirar sobre as relações de dominância entre os alelos deste locus? Explique. ovalado ou alongado. a) Qual a relação de dominância entre os caracteres em questão? b) Qual a probabilidade de que. A e A‚. Questão 45 Em rabanetes. Justifique a resposta. é controlada por genes codominantes. foram obtidas quatrocentas sementes que foram plantadas em sementeiras individuais. A partir das sementes obtidas. Cruzamentos entre plantas de raízes alongadas com plantas de raízes arredondadas produziram apenas indivíduos com raízes ovaladas. Justifique a resposta.2 a) Qual é o genótipo mais resistente? Como você chegou a essa conclusão? b) Observando as três curvas.1. Entretanto. Determine a cor das flores que têm menor possibilidade de se abrirem neste jardim. em outros cruzamentos. foi considerado que a severidade do alelo dominante. às vezes só origina prole sem chifres. Essas diferenças podem ser atribuídas a efeitos pleiotrópicos de outros genes? Justifique sua resposta utilizando o conceito de efeito pleiotrópico. formou-se um jardim. e. b) Realizaram-se os cruzamentos possíveis entre as plantas com flores das cores mencionadas. A resistência ou susceptibilidade ao inseticida é devida a um locus com dois alelos. Considere um casal de anões pseudo-acondroplásicos. você recebeu uma delas. os pontos distribuem-se ao longo da curva. provocando aborto precocemente. Questão 46 Em gado. na sua sementeira. os quais. por isso. Os fenótipos formados são três: arredondado. brancos e sem chifres. a forma da raiz é determinada por um par de genes alelos. a partir das sementes obtidas. c) Os indivíduos de cada um dos genótipos não se comportam da mesma forma quanto à resistência ao inseticida e. presentes em igual quantidade. ocasionalmente produzem prole com chifres.5. ruão e branca.a) Realizou-se o cruzamento entre as plantas com flores azul-claro e. Questão 48 A pseudo-acondroplasia é um tipo de nanismo determinado geneticamente pelo alelo D autossômico dominante que interfere no crescimento dos ossos durante o desenvolvimento. formou-se outro jardim. para responder às seguintes questões: 10 . Em cruzamentos desses indivíduos ovalados entre si. A princípio. Antes que as sementes germinassem. as sementeiras foram distribuídas a diversas pessoas. quando em dose dupla. a cor da pelagem vermelha. como o fazendeiro deverá proceder para estabelecer uma linhagem pura de animais brancos e sem chifres? Por que ele não conseguirá resolver o problema dos chifres rapidamente? Questão 47 O gráfico a seguir mostra a mortalidade de mosquitos de uma determinada espécie quando expostos a diferentes concentrações de um inseticida. Determine a cor das flores que têm maior possibilidade de se abrirem neste jardim. aparecem os dois tipos em igual número. ou seja.

com 3 meninas e 2 meninos. dominante. quantas destas crianças são homozigotas no loco correspondente a este tipo de nanismo? Questão 49 Observe os cruzamentos a seguir. Um geneticista observou que o cruzamento de ratos de pelagem amarela com ratos de pelagem cinza resultou descendentes amarelos e cinzas em igual proporção. qual é a probabilidade dela nascer geneticamente com a pseudo-acondroplasia? c) Como o casal já tem três crianças com a pseudo-acondroplasia. Questão 51 Gatos Manx são heterozigotos para uma mutação que resulta na ausência de cauda (ou cauda muito curta). presença de pernas traseiras grandes e um andar diferente dos outros. em vez de três para um (3:1). onde o alelo (A) condiciona a cor amarela em camundongos e é dominante sobre o alelo (a). originados do cruzamento entre ratos amarelos. a criança nascer também afetada? d) Se o casal tem planos para ter uma menina normal em relação a esta condição genética. qual é a probabilidade que se espera para este evento? e) Em uma outra família.1. a) A partir de 20 ovos.4 11 . CRUZAMENTO I (Aa × Aa) 240 amarelos 120 cinzas CRUZAMENTO II (Aa × aa) 240 amarelos 240 cinzas Analise os resultados destes cruzamentos e responda. a) Qual a explicação para esse resultado? b) Dê os genótipos dos parentais e dos descendentes. porém.5. e seu alelo c recessivo. todos apresentando a pseudo-acondroplasia. que condiciona a cor cinza. responsável pela coloração cinza. responsável pela coloração amarela. originados do cruzamento de machos amarelos e fêmeas cinzas. a cor da pelagem é condicionada por gene autossômico. sendo o gene C. O cruzamento de dois gatos Manx produziu dois gatinhos Manx para cada gatinho normal de cauda longa (2:1). quantos machos cinzas deverão atingir a idade adulta? Justifique. (Utilize as letras B e b para as suas respostas). como seria esperado pela genética mendeliana. Questão 52 O heredograma a seguir representa uma família com pessoas afetadas por uma doença hereditária.a) Quais são os genótipos de cada indivíduo do referido casal? b) Caso a mulher deste casal venha dar à luz uma criança. o cruzamento de ratos amarelos entre si produziu 2/3 de descendentes de pelagem amarela e 1/3 de descendentes de pelagem cinza. a) Qual cruzamento apresenta resultado de acordo com os valores esperados? b) Como você explicaria o resultado do cruzamento em que os valores observados não estão de acordo com os valores esperados? Questão 50 Em ratos. b) A partir de 40 ovos. em um eventual quarto nascimento. quantas fêmeas amarelas adultas são esperadas? Justifique. 1. qual é a probabilidade de.

4 Questão 56 A figura a seguir.5.5. Qual é a probabilidade de o indivíduo 9 ser portador dessa Nos Estados Unidos. então: a) Que nome se dá ao aparecimento.5 % e cinqüenta vezes maior do que entre o restante da população do Maranhão. moradores da ilha dos Lençóis.4 1. Sabendo-se que.a). numa dada geração.4 No heredograma adiante o indivíduo 3 é afetado pelo albinismo. II . mostra a transmissão do albinismo. responda: anomalia? 1.6. V . qual é a probabilidade de que o casal 4 × 5 tenha uma menina albina? Analise a figura onde se admite que a pigmentação da pele é devida a um par de alelos (A. de uma característica expressa em antepassados remotos? b) O albinismo se deve a alelo dominante ou a alelo recessivo? Explique com base na figura. adaptada da Folha de São Paulo de 17/03/96. c) Qual a probabilidade de os indivíduos de pigmentação normal da geração V serem todos heterozigotos? Questão 57 Questão 55 No heredograma a seguir os símbolos cheios representam indivíduos portadores de uma anomalia genética.3 e V . de acordo com a presença ou ausência do 12 1. situada a oeste de São Luís. de geração. na população.1.a) A doença tem herança dominante ou recessiva? Por quê? b) A doença tem herança autossômica ou ligada ao cromossomo X? Por quê? Questão 53 Analisando a genealogia adiante. onde a freqüência de albinos é de 1. a) Qual a probabilidade de o indivíduo 3 ser heterozigoto? b) Qual a probabilidade de o indivíduo 5 ser homozigoto recessivo? c) Qual a probabilidade de o indivíduo 6 ser homozigoto dominante? Questão 54 1.1.5.5.5 são albinos.4 . um grupo de cientistas do "Genetics & IVF Institute" vem testando um novo método que permite a seleção dos espermatozóides a partir de sua coloração. V .1.2.1. a freqüência de heterozigoto para o albinismo é de 1/50. Responda.1. na Família de Raimundo e Eleílde da Silva. Os indivíduos I .

Questão 58 O heredograma a seguir refere-se ao caso de braquidactilia.cromossomo Y ('Microsort').2 gerarem uma criança afetada do sexo masculino. além de satisfazer os anseios de vários casais na escolha do sexo do filho. a) Qual o tipo de herança da doença? Justifique sua resposta.4 Analise os dois heredogramas anteriores.1.1. poderá ser benéfico quando utilizado por famílias portadoras de determinadas anomalias genéticas.1 e III. o professor lhe apresenta o heredograma a seguir.4 1. Ao analisar os indivíduos afetados por esta anomalia.4 1. como representado nos heredogramas a seguir: 1. b) Suponha que a mulher 3 da família I case-se com o homem 4 da família III. II e III). Tal método. b) Em qual das duas situações seria mais recomendado o uso da técnica ('Microsort') para a escolha de um bebê do sexo feminino? Por quê? c) Considerando o heredograma nŽ1. Questão 59 O padrão de herança de uma doença.1.5. foi analisada em três famílias diferentes (I. Identifique e justifique o tipo de herança. considerando que o caráter é determinado por um único par de genes.5.5. Questão 60 Numa aula de genética. que se suspeita ser autossômica recessiva ou ligada ao sexo.5. Qual a probabilidade de nascer uma criança doente? Justifique.1. e responda às seguintes questões: a) Qual o padrão de herança envolvido na determinação da característica representada no heredograma 1 e no heredograma 2? Justifique sua resposta. calcule a chance de os indivíduos III.4 13 . que mostra a ocorrência de uma anomalia causada pela ação de um par de genes (A e a) em várias gerações de uma família. você conclui que se trata de uma herança autossômica dominante. 1.

a menos que haja evidência contrária. A cor branca indica pelagem branca determinada por um gene recessivo.4 1.Baseando-se EXCLUSIVAMENTE no heredograma apresentado acima. se a mulher (4) da geração F3 tiver filhos com um homem que apresente essa anomalia? Questão 61 No heredograma abaixo a cor preta indica indivíduos com pelagem negra. Quadrados ou círculos escuros representam indivíduos afetados por uma característica comum na população. a) Identifique os heredogramas que são compatíveis com uma herança autossômica recessiva.4 Qual a probabilidade de que o cruzamento entre o indivíduo 9 e o indivíduo 10 gere um indivíduo de pelagem branca? Questão 62 Os heredogramas A.5. B e C a seguir representam três famílias diferentes. que apresenta indivíduos afetados por uma doença recessiva e indivíduos normais.4 1. qual o único que não pode ter seu genótipo definido? Explique por quê.5. Os indivíduos 5 e 8 devem ser considerados homozigotos (AA). Justifique sua resposta para cada família. os indivíduos em escuro apresentam uma doença hereditária. b) Determine se em algum dos casos apresentados existe herança ligada ao cromossomo Y. Questão 64 Analise a genealogia. os homens.1.1. Questão 63 Na genealogia adiante. Os círculos representam as mulheres e os quadrados. Os círculos representam mulheres e os quadrados. responda: a) Por que a anomalia NÃO pode ser recessiva? b) Por que a anomalia NÃO pode ser ligada ao cromossomo X? c) Qual a probabilidade de nascer uma criança afetada pela anomalia. enquanto os outros exibem fenótipo normal. 1. fenótipo determinado por um gene autossômico dominante A.5. Justifique. 14 . Analise esta genealogia e responda. a) Esta doença hereditária é condicionada por gene dominante ou recessivo? b) Dos dez indivíduos que compõem esta genealogia.1. homens.

filha de pais normais. tem uma criança afetada por uma doença muito rara de herança autossômica recessiva.4 Questão 68 Alguns centros de pesquisa na Inglaterra estão realizando um programa de triagem populacional para detectar a fibrose cística.5. b) Quais os possíveis genótipos dos filhos possíveis do mesmo casal? 15 . Um inglês heterozigoto para essa característica é casado com uma mulher normal. Pedro e Maria. vítima de fibrose cística. b) Qual é a probabilidade de que uma futura criança de Paulo e Joana venha a ser afetada por essa mesma doença genética? Considere desprezível a probabilidade de uma nova mutação. sendo ambos do sexo masculino e afetados? Questão 65 Uma determinada característica foi estudada em centenas de pares de gêmeos. a) Quais os indivíduos representados na genealogia que são obrigatoriamente heterozigotos? b) Qual a probabilidade de o casal formado pelos indivíduos II2 e II3 ter mais dois filhos. todos normais. O primeiro casal. a) Indique o genótipo do embrião formado a partir da fecundação do óvulo resultante dessa célula por um espermatozóide de um macho recessivo para os dois pares de genes considerados. Discuta a importância dos fatores genéticos na manifestação dessa característica. mostrando como chegou aos resultados dos itens b) e c). Questão 66 Se uma abelha operária tem o gene A herdado de seu pai. Justifique sua resposta. a) Desenhe o heredograma representando os dois casais e seus respectivos pais.1 Calcule a probabilidade de que esse casal venha a ter uma criança com fibrose cística.segunda criança desse casal também seja afetada por essa mesma doença? Por quê? Justifique suas respostas. tanto monozigóticos como dizigóticos. uma doença autossômica recessiva grave particularmente comum em caucasianos. Questão 69 Considere a figura a seguir que representa o resultado da primeira divisão meiótica de uma célula feminina: Toda pessoa na qual o alelo recessivo é detectado recebe orientação a respeito dos riscos de vir a ter um descendente com a anomalia. c) Se Paulo e Joana tiverem uma primeira criança afetada pela mesma doença genética. qual será o risco de que uma 1. 1.5. mas cujo irmão morreu na infância.1.2. qual é a probabilidade de que uma sua irmã tenha esse mesmo gene A? Por quê? Questão 67 Dois irmãos (Pedro e Paulo) casam-se com duas irmãs (Maria e Joana). As diferenças registradas entre os irmãos dizigóticos foram praticamente da mesma magnitude que as encontradas entre os irmãos monozigóticos.

2. 16 . D e E que se segregam independentemente. responda: a) Por que na geração F1 não foram encontradas sementes rugosas ou verdes? b) O que são os fatores hereditários referidos por Mendel e onde estão situados? c) Faça um diagrama de cruzamento para exemplificar as proporções fenotípicas encontradas na geração F2. 1. utilizando qualquer uma das características apresentadas na tabela. qual a proporção esperada de descendentes iguais a ele? Questão 71 A audição normal depende da presença de pelo menos um dominante de dois pares de genes. 1 preto e branco e 1 marrom e branco. O cruzamento de um macho de cor preta uniforme com uma fêmea de cor marrom uniforme produz uma ninhada de oito filhotes: 3 de cor preta uniforme. o padrão malhado (preto / branco ou marrom / branco). Questão 73 Quatro irmãos. b) Quais são os genótipos mais prováveis dos pais em cada casal? Justifique sua resposta. O tamanho do pêlo também é controlado por um par de genes. apresentam marcantes diferenças em suas características físicas. Questão 74 Em uma raça de cachorros. Caso você examine a prole de um grande número de casamentos em que ambos os cônjuges são duplo heterozigotos para esses dois pares de genes.1 1. pelo alelo recessivo d. De acordo com a tabela. filhos legítimos de um mesmo casal.1 a) Os genes para a cor e tamanho de pêlo estão no mesmo par de cromossomas? Justifique sua resposta. 3 de cor marrom uniforme. após vários cruzamentos. A tabela a seguir apresenta os fenótipos dos pais e os fenótipos das respectivas proles. que mostra parte dos resultados dos experimentos de Mendel. Descreva três mecanismos biológicos potencialmente responsáveis por essa variabilidade genética e explique como atuam.5. a cor preta é condicionada pelo alelo dominante D e a cor marrom. a cor do pêlo negro é determinada por um gene dominante (A) enquanto seu alelo (a) determina a cor branca. localiza-se o gene responsável pelo padrão da coloração: o alelo dominante M determina padrão uniforme (uma única cor) e o alelo recessivo m.5. a) Quais os genótipos dos pais? b) Se o filho preto e branco for cruzado com uma fêmea cujo genótipo é igual ao da mãe dele.2. sendo o alelo dominante (B) para pêlo curto e o alelo recessivo (b) para pêlo longo. que proporção fenotípica você espera encontrar? Questão 72 Observe a tabela a seguir. Em um outro cromossomo.Questão 70 Em cobaias. realizados com ervilhas.

1 a) Ao final da segunda divisão meiótica dessa célula. quais serão os genótipos das quatro células haplóides geradas? b) Considerando o conjunto total de espermatozóides produzidos por esse animal. O alelo que determina caule longo é dominante. Os genes para comprimento do caule e forma do fruto segregam-se independentemente. estão indicadas nos cromossomos representados no desenho.5. as proporções fenotípicas dependem de os referidos locos estarem ou não no mesmo cromossomo. considerando apenas dois locos. Despreze a parte fracionária de seu resultado. 17 . foram analisadas duas características com segregação independente e herança co-dominante: cor e textura do pêlo. a constituição cromossômica de seus descendentes será igual à da planta mãe? Justifique. foram obtidos 100% de indivíduos AaBb que. podem formar indivíduos com os genótipos mostrados na Tabela 1.gene A (dominante) ou gene a (recessivo). os homozigotos têm pêlo liso ou crespo.2. identificados pelas letras Aa e Bb. Suponha uma planta superior originada de um zigoto no qual dois dos pares de cromossomos. 1. Sem interação entre os dois locos. Questão 78 1. os homozigotos podem ser vermelhos ou brancos. As localizações dos alelos desses genes. quais serão seus genótipos e em que proporção espera-se que eles sejam produzidos? Questão 77 Em uma determinada espécie animal. estão representadas duas proporções fenotípicas (casos 1 e 2) que poderiam resultar do cruzamento de dois indivíduos AaBb. Calcule a porcentagem esperada de descendentes fêmeas com pêlo vermelho crespo oriundas do cruzamento de dois animais duplamente heterozigotos. cada um com dois genes alelos: loco 1 .2. b) Se essa planta se reproduzir por autofecundação. Questão 76 A figura mostra a segregação de dois pares de cromossomos homólogos na anáfase da primeira divisão meiótica de uma célula testicular de um animal heterozigótico quanto a dois genes. loco 2 . têm a constituição AA‚BB‚. Questão 79 Considere duas linhagens homozigotas de plantas.5. quando cruzados entre si. caso exista. Para a cor do pêlo.gene B (dominante) ou gene b (recessivo). Na Tabela 2. assim como o alelo para fruto redondo.Questão 75 Um pesquisador está estudando a genética de uma espécie de moscas.1 Identifique qual dos dois casos tem maior probabilidade de representar dois locos no mesmo cromossomo. Cruzando indivíduos AABB com indivíduos aabb. uma com caule longo e frutos ovais e outra com caule curto e frutos redondos. Justifique sua resposta. Para a textura. A e B. a) Qual será a constituição cromossômica da planta adulta originada desse zigoto? Justifique.

set. b) Em que proporção essas plantas de caule curto e frutos ovais serão obtidas? Questão 80 Considere dois genes e seus respectivos alelos: A e a. qual será a probabilidade de nascer um indivíduo de genótipo aabbCcDD? Questão 82 Idiotia amaurótica infantil é uma doença hereditária recessiva (ii) que causa a morte nos primeiros anos de vida. Eugênio. explique o que significa dizer que esses dois genes a) segregam-se independentemente na formação dos gametas. o famoso cineasta Charlie ChapIin foi acusado de ser o pai de uma criança. o homozigoto (BB) é normal e o outro homozigoto (BLBL) morre prematuramente. 19/nŽ 113. Qual é a probabilidade de um casal de braquidáctilos e heterozigotos para a idiotia amaurótica infantil vir a ter um descendente normal? Questão 83 Nos anos 40. Os exames de sangue revelaram que a mãe era do grupo A. a criança do grupo B e Chaplin do grupo O. a) Quais os genótipos do pai e da mãe? b) Qual é a probabilidade de que ambos os gêmeos tenham sangue do tipo O? Questão 86 Um homem faleceu por causa de uma transfusão de sangue. ("Reserva estratégica de sangue". No caso do Sistema ABO. cujo grupo sangüíneo é A. qual será a probabilidade de um futuro filho do casal ter sangue do tipo A? E do tipo B? Questão 85 O pai e a mãe de um par de gêmeos monozigóticos têm tipo sangüíneo A.a) De que forma podem ser obtidas plantas com caule curto e frutos ovais a partir das linhagens originais? Explique indicando o(s) cruzamento(s). Uma outra criança desse casal é do grupo sangüíneo O. a) Qual será o grupo sangüíneo de Eugênio após o transplante? Por quê? b) Sabendo-se que a mãe e a esposa de Eugênio têm sangue do tipo O. CIÊNCIA HOJE. vol. SBPC. B e b. a para comprimento do caule e B. recebeu um transplante de medula óssea de seu irmão Valentim. de que tipos sangüíneos eles poderiam ser? Questão 84 Um tratamento utilizado para certos tipos de doenças do sangue é a destruição completa da medula óssea do paciente e implante de células medulares sadias provenientes de um doador. AB e ausentes no grupo O". 95. A condição normal (I_) produz um fenótipo normal. de Ricardo Lorzetto. Chaplin foi considerado como sendo um possível pai da criança. Admite-se que dedos nas mãos anormalmente curtos (braquidactilia) sejam devido a um genótipo heterozigoto para um gene letal embrionário (BBL). fato que ele não admitia. e a operação foi bem sucedida. b) estão ligados.) a) O que são antígenos? b) Qual a importância de se identificar a presença de antígenos eritrocitários (presentes nas hemácias ou eritrócitos) no sangue humano? 18 . B. pergunta-se: a) qual é o grupo sangüíneo do homem em questão? b) qual ou quais os possíveis grupos sangüíneos usados erroneamente na transfusão? Questão 87 "Os grupos sangüíneos são determinados pela presença ou ausência de antígenos na superfície das hemácias. Ao final do julgamento. b para forma dos frutos. p. a) O veredicto é aceitável? Por quê? b) Na hipótese de Chaplin ter tido filhos com a referida mulher. 58. os antígenos estão presentes no sangue dos grupos A. Utilize as letras A. Em termos de localização cromossômica. Questão 81 Do cruzamento de AaBbccDd x aaBbCcDd. cujo grupo sangüíneo é B. Sabendo-se que seus pais pertenciam aos grupos B (homozigoto) e AB.

Lalau (indivíduo II-1) elaborou o seguinte heredograma sobre a herança de grupos sangüíneos do sistema ABO. ficou viúva e casou pela segunda vez. visão normal. Para tal. O tipo de sangue.A Com base nesta relação. a mulher teve cinco filhos na seguinte ordem: 1) homem. Questão 89 O sangue de Orlando aglutina quando colocado em presença de soro contendo imunoglobulinas ou aglutininas anti-A.1 Indique os fenótipos dos pais que NÃO poderiam ser os pais biológicos de cada caso. 2) homem. O casal tem um filho cujo sangue não aglutina em nenhum dos dois tipos de soro. é determinado por três alelos autossômicos: IÞ. daltônico. ou cegueira para as cores. basta determinar o genótipo e o fenótipo do suposto pai e.3. 4) mulher.O Saildo . Orlando casa-se com Leila. grupo ABO. o outro marido.3. sangue A. com sangue tipo A e visão normal. Questão 90 Pode-se usar o sistema ABO para "excluir" um suposto pai em uma investigação de paternidade. foram encontrados os seguintes tipos sangüíneos: Joana . 5) mulher. verificar se o homem acusado pode ser considerado como um pai impossível. tinha sangue AB e era daltônico. Iß.AB Cassilda .5. Um dos maridos. que apresenta aglutinações inversas. 1.Questão 88 O daltonismo. a) Qual o genótipo dos pais? b) Qual a probabilidade de esse casal ter uma criança cujo sangue aglutine nos dois tipos de soro? Justifique sua resposta. daltônica. responda: a) Quem do grupo anterior NÃO possui os aglutinogênios em suas hemácias? b) Por que Joana pode receber sangue de outros membros do grupo? c) Que tipo de aglutinina possuem Cassilda e Saildo. visão normal. i. sangue A. o Sr.1 19 . sangue B. é determinado por um gene localizado no cromossomo sexual X. Questão 91 Nas quatro pessoas relacionadas a seguir. e não aglutina quando colocado em presença de imunoglobulinas ou aglutininas anti-B. sangue O. A tabela a seguir mostra os fenótipos do filho e da mãe em três casos. Com os dois maridos.B Doaldo . sangue A. 3) mulher. Qual dos homens foi o primeiro marido? Justifique sua resposta. respectivamente? Questão 92 Ao descobrir que seu genótipo era homozigoto. daltônico. 1. Uma mulher. Paulo. por comparação com os fenótipos e genótipos do filho e da mãe. José.5. tinha sangue A e visão normal.

cujos resultados obtidos são mostrados na tabela adiante.1 Após identificar os pais do bebê nŽ 2. pode-se identificar os pais de cada bebê. uma das mulheres desistiu.1 Questão 95 O rei Salomão resolveu uma disputa entre duas mulheres que reclamavam a posse de uma criança. Lalau poderá ser receptor de sangue de seu genro para transfusão? d) O indivíduo III-5 NÃO poderá ser de qual grupo sangüíneo? e) No caso do casal III-3 e III-4 ter uma segunda criança. a) Explique como o sangue de uma pessoa pode ser identificado em relação aos sistemas ABO e Rh. é codominante sobre o alelo Iß. b) Explique por que uma pessoa com sangue tipo O é doadora universal mas só pode receber sangue do tipo O.5. que 20 1. em porcentagem. em que o alelo IÞ. Nos tribunais modernos. Por que o teste de DNA permite tirar conclusões tão precisas em casos como este? Questão 96 Os grupos sangüíneos humanos podem ser classificados em 4 tipos: A. a) Explique por quê. qual é a probabilidade dela ser uma menina e do grupo sangüíneo "B"? Questão 93 Dois casais suspeitavam da troca de seus bebês no berçário da maternidade. que codifica para o antígeno A. enquanto uma pessoa com sangue AB é receptora universal mas não pode doar para os outros tipos. Analisando uma situação em que uma mulher de sangue A atribuía a paternidade de seu filho de sangue O a um homem de sangue B.5. Os casais e os bebês foram submetidos à tipagem do sangue quanto ao sistema ABO. responda: a) Qual a probabilidade de o casal formado por 5 e 6 ter duas crianças com sangue AB Rh®? b) Se o casal em questão já tiver uma criança com sangue AB Rh ®. AB.qual a probabilidade de ter outra com os mesmos fenótipos sangüíneos? Obs.3. o juiz não pôde chegar a nenhuma decisão conclusiva. . um juiz pode utilizar a análise dos grupos sangüíneos e teste de DNA para ajudar a solucionar questões semelhantes. Questão 94 Com base no heredograma a seguir. b) Qual deveria ser o grupo sangüíneo do homem para que a decisão pudesse ser conclusiva? c) Com base no teste de DNA. Ao propor dividir a criança ao meio. 1. caso exista. o juiz concluiu que o homem era pai da criança. como Rh® e Rh−. calcule a probabilidade. B e O. de que um futuro irmão deste bebê seja do sexo masculino e venha a ter tipo sangüíneo diferente do irmão.: indique os passos que você seguiu para chegar às respostas.a) Identifique o grupo sangüíneo do indivíduo I-1: b) Qual o genótipo do indivíduo II-5? c) O Sr. de acordo com o sistema Rh. O rei então concluiu que aquela que havia desistido era de fato a mãe verdadeira. Questão 97 Um exemplo clássico de alelos múltiplos é o sistema de grupos sangüíneos humano. em a e b. pelo sistema ABO e.3. Analisando-os. Despreze a parte fracionária do seu resultado.

por que cada indivíduo é portador de somente dois alelos? Questão 98 Uma população humana foi testada quanto ao sistema MN de grupos sanguíneos. na falta de sangue do mesmo tipo. b) Como evitar sua ocorrência? c) Qual o procedimento usual para salvar a vida do recém-nascido com eritroblastose fetal? Questão 101 Um indivíduo pertencente aos grupos sangüíneos AB e Rh positivo é considerado receptor universal ideal. e os únicos doadores disponíveis são seus irmãos. Érica e Ana.5.1 Qual das mulheres poderia ser a verdadeira mãe daquela criança? Justifique sua resposta. O sangue das duas mulheres foi testado . Os dados obtidos compõem a tabela a seguir: a) Quais as freqüências dos alelos M e N nessa população? b)Essa população está em equilíbrio de Hardy-Weinberg para esse loco gênico? Questão 99 Duas mulheres disputam a maternidade de uma criança. a) Complete o quadro a seguir com os genótipos e as reações antigênicas (represente com os sinais + e -) dos grupos sangüíneos indicados. responda: 21 b) Embora 3 alelos distintos determinem os grupos sangüíneos ABO humanos. que.2 Nas transfusões sangüíneas. B ou AB. sofreu um acidente e precisa urgentemente de uma transfusão de sangue. o que pode levar recém-nascidos à morte. ao nascer. Dois dos irmãos são gêmeos univitelinos.codifica para o antígeno B. B. Em situações de emergência. B ou AB. 1. Questão 103 Um casal tem cinco filhos: Alex.3.5. um dos gêmeos. podem ser feitas transfusões de pequenos volumes de sangue O para pacientes dos grupos A.3. AB e O. anti-A e anti-B. a) Explique como ocorre a eritroblastose fetal. apresentou a doença hemolítica ou eritroblastose fetal. Ambos os alelos são dominantes sobre o alelo i. que não codifica para qualquer antígeno. Pedro. com o uso do soro anti-Rh (anti-D) como mostra o esquema a seguir. Érica. Dois tipos de soros. Questão 100 Na eritroblastose fetal ocorre destruição das hemácias. são necessários para a identificação dos quatro grupos sangüíneos: A. Questão 102 1.2 1. Explique o problema que pode ocorrer se forem fornecidos grandes volumes de sangue O para pacientes A.5. Mário. Na impossibilidade de se fazer um exame dos tipos sangüíneos. Certo ou errado? Justifique sua resposta.3. o doador deve ter o mesmo tipo de sangue que o receptor com relação ao sistema ABO.

R_ee crista rosa. noz. rosa e ervilha. foi cruzado com uma fêmea preta e com uma fêmea marrom. com pelagem dourada. forma? c) Qual é o genótipo da fêmea preta? d) Qual é o genótipo da fêmea marrom? Questão 106 Em galinhas há quatro tipos de cristas: simples. a) Qual é o genótipo do macho dourado. Assim o genótipo R_E_ determina crista noz. que pode ser preto ou marrom. Um galo de crista noz cruzado com uma galinha de crista rosa produziu a seguinte geração: 3/8 noz. Um labrador macho. A partir desses dados responda: a) Quais os genótipos paternos? b) Os genes em questão obedecem a segunda lei de Mendel? Justifique. marrom e dourada) são condicionadas pela interação de dois genes autossômicos. Em ambos os cruzamentos. Questão 108 As reações enzimáticas a seguir indicam a passagem metabólica que sintetiza pigmentos em uma planta. Explique por que a aglutinação não ocorreria se o aglutinogênio fosse uma proteína citoplasmática. cada um deles com dois alelos: "Ee" e "Bb". Questão 105 As três cores de pelagem de cães labradores (preta. pretos e marrons. com a galinha B de crista ervilha produziu 3 noz: 1 rosa: 3 ervilha: 1 simples e com a galinha C de crista noz a geração tinha 100% crista noz. dependendo do outro gene: os cães homozigóticos recessivos "bb" apresentam pelagem marrom. as duas colunas da direita demonstram esquematicamente o aspecto "in vitro" das reações no sangue dos indivíduos de cada grupo sangüíneo ABO aos anti-A e Anti-B. Na determinação desses tipos de cristas atuam dois pares de genes (Rr e Ee).3. Os cães homozigóticos recessivos "ee" não depositam pigmentos nos pêlos e apresentam.a) Entre seus irmãos. qual seria a pessoa mais indicada para ser o doador? b) Justifique sua resposta. 1. por isso. Observe os fenótipos e genótipos. quanto aos dois genes mencionados? b) Que tipos de gameta e em que proporção esse macho 22 .5. Utilizando a tabela a seguir determine o genótipo do galo e das três galinhas. Questão 104 No quadro a seguir. 3/8 rosa. 1/8 ervilha e 1/8 simples. pelagem dourada. rrE_ crista ervilha e o genótipo eerr determina crista simples. Crista Rosa = R_ee Crista Ervilha = rrE_ Crista Noz = R_E_ Crista Simpes = rree Um galo com crista noz foi cruzado com três galinhas. Já os cães com genótipos "EE" ou "Ee" apresentam pigmento nos pêlos. Com a galinha A de crista noz produziu na geração 3 noz: 1 rosa. b) Sabe-se que o aglutinogênio é uma proteína da membrana das hemácias.4 a) Explique o fenômeno que ocorreria com as hemácias de um indivíduo do grupo A ao receber sangue de um indivíduo do grupo B. enquanto os com genótipos "BB" ou "Bb" apresentam pelagem preta. Questão 107 Em galinhas domésticas o tipo de crista é determinado por dois pares de genes com segregação independente. foram produzidos descendentes dourados.

impossibilita a conversão de pigmento rosa em vermelho. enquanto os alelos a e b produzem enzimas inativas. Duas outras colorações são também observadas: preta e albina. c) CITE a probabilidade de se obterem camundongos pretos do cruzamento de albinos (duplo homozigotos) com aguti (duplo heterozigotos). a) Do cruzamento entre camundongos preto e albino obtiveram-se 100% de camundongos aguti. encontrado comumente na natureza. o tipo selvagem. DÊ os genótipos dos camundongos envolvidos no cruzamento. O gene B. A _ B _ = Aguti A _ bb = Preto aaB _ e aabb = Albinos 1.para as enzimas A e B.1. impede a produção dos pigmentos rosa e vermelho. Observe os dois pares de genes envolvidos e os fenótipos relativos aos tipos de coloração dos camundongos.2 Utilizando essas informações e seus conhecimentos. Determine a proporção esperada entre as cores das plantas descendentes na primeira geração do cruzamento AaBb×AABb. faça o que se pede.4. qual será a proporção fenotípica esperada na progênie? b) Quais são os possíveis genótipos para os indivíduos vermelhos? c) Quais os fenótipos esperados e suas respectivas proporções em F‚ obtidos a partir de parentais AABB × aabb? Questão 110 Em camundongos. em homozigose recessiva.5.uma única cópia funcional da enzima A ou da enzima B é suficiente para catalisar normalmente a sua respectiva reação. os alelos A e B produzem enzimas funcionais. quando em homozigose recessiva (aa). apresenta pelagem de coloração acinzentada (aguti).1 Considere as seguintes condições: . devido à não produção de enzima X. Os genes A e B são dominantes sobre os seus alelos. b) Do cruzamento de dois camundongos aguti obtiveram-se descendentes na seguinte proporção: 9 aguti: 3 pretos: 4 albinos. Responda: a) No cruzamento entre indivíduos de genótipos AaBb×aabb.4. CITE todos os genótipos possíveis para os camundongos albinos obtidos e APRESENTE UMA EXPLICAÇÃO para a alteração da proporção 9:3:3:1 (esperada em cruzamento de diíbridos) para 9:3:4. 23 . . temos que: O gene A é epistático sobre o gene B e.5. Questão 109 Analisando a via metabólica hipotética.

filha desse cruzamento. mas o gene B inibe a ação do gene A. O duplo recessivo condiciona fruto verde. Um indivíduo anormal. dois cromossomos de tamanhos distintos. como o seu alelo b. responda: a) Como se chama esse tipo de interação? b) Qual a proporção fenotípica correta entre os descendentes do cruzamento de plantas heterozigotas para esses dois pares de genes? Questão 113 Existe um gene em cobaias que suprime o efeito do gene que determina a coloração nesses animais. justificando sua resposta. pergunta-se: a) Por que é o pai quem determina o sexo da prole? b) Por que os filhos homens de pai hemofílico nunca herdam essa característica do pai? Questão 116 Um geneticista. XXY. restando. Considere o padrão de determinação de sexo. nos espermatozóides e nas células musculares dessa espécie animal. Como isto pode ser explicado. foi cruzada com outra planta. mas. Esse gene está localizado em um cromossomo diferente daquele em que está o gene que determine a cor do animal. II. é cruzada com outra. O cruzamento entre a planta I e a planta II produziu 4/8 de plantas com frutos brancos. ele é inibido e produz frutos brancos. Questão 117 Esta figura representa uma célula humana na qual uma estrutura está indicada pela seta. produtora de frutos verdes. montou o cariótipo de certa espécie animal desconhecida.1 24 . O indivíduo duplo recessivo produz frutos verdes. além desses.Questão 111 Na herança da cor do fruto da moranga.5. que será chamada de planta I. b) O erro ocorreu na primeira ou na segunda divisão da meiose? Explique. estão envolvidos dois pares de genes A/a e B/b. produtora de frutos amarelos. Considerando que tais genes apresentam segregação independentemente um do outro. considerando-se que não ocorreu mutação? Justifique. igual ao do humano e determine: a) quantos cromossomos existem. 3/8 de plantas com frutos amarelos e 1/8 de plantas com frutos verdes.5. com cariótipo 47. conseguindo formar dez pares de cromossomos. o gene B condiciona fruto branco e o gene A condiciona fruto amarelo. nos óvulos. Cobaias albinas homozigotas foram cruzadas e todos os descendentes nasceram pretos. Seus genitores tinham visão normal para cores. b) o sexo a que pertence o animal da espécie em questão. produtora de frutos brancos. Responda: a) Que denominação se dá a este tipo de interação entre os genes A e B? b) Quais os genótipos das plantas I e II? Questão 112 Numa dada planta. 1. Questão 115 Com relação à espécie humana. Questão 114 O daltonismo tem herança recessiva ligada ao X. Uma planta homozigota. Uma planta. respectivamente. era daltônico. adotando o mesmo critério utilizado para a montagem de cariótipo da espécie humana. a) Qual genitor formou o gameta com 24 cromossomos? Explique. nessa espécie desconhecida. na presença do gene A. O gene B produz frutos amarelos.

5. Identifique o cromossomo humano que sofre menos recombinação. Após o transplante de medula é possível identificar os cromossomos de células de diversos órgãos e tecidos. quando se passa um corante sobre a pele. usando um "kit" que determina a presença do cromossomo Y. Questão 119 Fazendeiros que criam gado leiteiro podem. Questão 121 Na espécie humana existe um gene raro que causa a displasia ectodérmica anidrótica. b) CITE o nome da estrutura indicada pela seta e JUSTIFIQUE a existência da estrutura nessa célula. O alelo que determina a coloração carijó é dominante sobre o alelo para a cor branca. b) Por que esse mosaico não pode aparecer em um homem? Questão 122 Certos tipos de câncer. uma parte da medula óssea de um doador sadio é introduzida na coluna vertebral de um paciente cujas células da medula óssea foram previamente eliminadas com auxílio de drogas ou de radiação. o sexo feminino é heterogamético. isto é. ficam com a pele toda manchada. CITE o número cromossômico dessa célula caso ela pertença a um indivíduo normal e um indivíduo cujo sexo não é compatível com a presença da estrutura indicada.5. a troca de seqüências de ADN entre cromossomos homólogos. ele é eliminado ou congelado para uso futuro.1 a) Explique a formação dessas manchas do ponto de vista genético. Esse gene se localiza no cromossomo sexual X. a) Para esses fazendeiros. qual seria a proporção fenotípica esperada? Demonstre os cruzamentos. qual a vantagem dessa prévia determinação do sexo dos embriões? b) Por que o "kit" pesquisa somente a presença do cromossomo Y? Questão 120 Durante o processo de meiose ocorre a recombinação gênica. Caso contrário. portadoras desse gene em heterozigose. Nesses transplantes. O cruzamento de uma galinha branca com um galo carijó produziu somente aves carijós. formando um mosaico de manchas claras e escuras. Algumas mulheres.Com base na figura e em conhecimentos sobre o assunto. 1. a coloração das penas é uma característica condicionada pelo gene C e é ligada ao sexo. Se o embrião for fêmea. são tratados com transplantes de medula óssea. Questão 118 Em galinhas domésticas. c) Utilizando a letra A para designar um conjunto de autossomos e as letras convencionalmente usadas para representar os cromossomos sexuais. mas não a possui. Numa determinada raça. Justifique sua resposta. que é uma anomalia caracterizada pela ausência das glândulas sudoríparas. A tabela a seguir mostra os resultados da classificação dos cromossomos de 4 tecidos de um paciente submetido a transplante de medula. 25 . a) CITE o nome da célula representada e sua principal função. d) DENOMINE a síndrome que designa o indivíduo cujo sexo é compatível com a presença da estrutura indicada. determinar o sexo dos embriões logo após a fertilização. é reimplantado no útero da vaca. atualmente. Promovendo o intercruzamento destes descendentes. em especial aqueles ligados às células do sangue.

. pois apresentava órgãos sexuais internos masculinos e órgãos sexuais externos femininos. foi então promulgada uma lei segundo a qual todas as mulheres que tivessem um filho homem não mais poderiam ter filhos. Os testículos da atleta fora extirpados para que ela pudesse competir na equipe feminina de judô a) Que vantagem a atleta levaria sobre as demais competidoras se tivesse os testículos durante a competição? b) Sabendo-se que ela foi considerada do sexo feminino. que a jovem era um caso de pseudo-hermafroditismo. a determinação do sexo não é feita simplesmente pela presença ou ausência do cromossomo Y. fenotipicamente normal. um pequeno corpúsculo de cromatina intensamente corado. a) A que corresponde tal corpúsculo e em que tipo de células (somáticas ou germinativas) ele aparece? b) Qual a sua importância e por que ele não ocorre nas células masculinas? Questão 126 A análise dos núcleos interfásicos de células da mucosa oral de uma mulher. Responda: a) Quantos cromossomos X tem esta mulher? b) Se ela se casar com um homem normal. mas por um balanço gênico entre genes femininizantes e masculinizantes.S. identifique o sexo do paciente e o sexo do doador. Questão 123 O governo de uma sociedade totalitária decidiu conter a expansão demográfica reduzindo a proporção de homens na população. A matéria dizia. ainda. 26 1.1 Com base nesses resultados. qual a probabilidade de ter uma filha com constituição cromossômica igual à sua? Questão 127 Essa lei atingirá o objetivo desejado depois de algumas gerações? Justifique sua resposta. revelou a existência de duas cromatinas sexuais em todos eles. Com esse objetivo. a) Qual é a probabilidade de que uma filha desse casal apresente a doença? b) Qual é a probabilidade de que um outro filho desse casal seja também hemofílico? Justifique suas respostas.).5. Se o cromossomo X de uma fêmea com cariótipo 2AXX sofrer não-disjunção meiótica e o óvulo resultante com 2 cromossomos X for fecundado por um espermatozóide normal. que testes citogenéticos você faria para comprovar esta afirmação? Questão 128 Um casal de não hemofílicos tem um filho com hemofilia. Este corpúsculo é conhecido hoje como cromatina sexual ou corpúsculo de Barr.S. qual é a relação que expressa esse índice? c) Qual é o índice sexual (I.) do descendente acima referido? Uma revista publicou uma reportagem com o título "Atleta com anomalia genética faz operação para definir seu sexo e poder competir na classe feminina de judô".Questão 125 Na década de 40 descobriu-se que algumas células retiradas de mulheres apresentavam no núcleo interfásico.5. Questão 124 Em uma 'Drosophila melanogaster'. pergunta-se: a) Qual é o sexo do descendente com cariótipo 2AXXY? b) Sabendo-se que o sexo da 'Drosophila melanogaster' pode ser definido por um índice sexual (I. portador de um cromossomo Y. As demais mulheres poderiam continuar a ter filhos até que tivessem um filho homem. Justifique sua resposta. dando origem a um descendente com cariótipo 2AXXY.

qual é a probabilidade de que o próximo filho homem desse casal venha a ser hemofílico? a) Que padrão de herança explica melhor a genealogia? Justifique sua resposta. 1. dois de cada casamento. Conforme mostrado na genealogia a seguir. ocorrem dois meninos hemofílicos.5.5. qual o número esperado para crianças do sexo masculino. Com base nessas informações e nas contidas na árvore genealógica adiante. b) Se os dois maridos da mulher fossem irmãos isto poderia alterar sua resposta anterior? Por quê? Questão 131 No heredograma a seguir. 1.5. todos afetados por uma doença genética muito rara.2 Questão 133 O gene recessivo d está localizado no cromossomo X e é responsável pelo daltonismo na espécie humana. Com base nessas informações e nas contidas na árvore genealógica adiante. Questão 130 Uma mulher clinicamente normal casou-se duas vezes. responda à seguinte pergunta: se a mulher 4 casar com um homem normal e seu primeiro filho for um menino hemofílico.2 a) Qual é a probabilidade de que uma segunda criança de II-4 e II-5 seja afetada? b) Qual é a probabilidade de II-2 ser portadora do alelo que causa a hemofilia? c) Se o avô materno de II-4 era afetado. entre as que nascerem? Justifique sua resposta. A hemofilia tem herança recessiva ligada ao cromossomo X.Questão 129 Uma mulher é portadora de um gene letal ligado ao sexo.5.2 Questão 132 O gene recessivo h está localizado no cromossomo X e é responsável pela hemofilia na espécie humana.5. 1. qual é a probabilidade de 27 . responda à seguinte pergunta: se a mulher 5 se casar com um homem daltônico. qual era o fenótipo da avó materna? Justifique sua resposta.5. que causa aborto espontâneo. ela teve quatro filhos. em ambos os casos com indivíduos normais e que não eram seus consangüíneos. Supondo que quinze de suas gestações se completem.

5.5. preparou o heredograma abaixo. b) Calcule os valores correspondentes à probabilidade de que o primo doente do consultante. gere filhas e filhos afetados pela doença. após constatar que a família reside em um grande centro urbano.5. qual o número esperado para crianças do sexo feminino entre as que nascerem? Justifique sua resposta.2 Questão 134 Uma mulher é portadora de um gene letal ligado ao sexo.5. isto é. de Maranguape. o consultante está indicado por uma seta. Questão 136 O daltonismo (cegueira para as cores) se deve a uma mutação recessiva ligada ao sexo. Preocupado com a possibilidade de transmitir essa doença. formule a conclusão do geneticista quanto à possibilidade de o consultante transmitir a doença a seus descendentes diretos. 1. ao casar com uma mulher normal. bem como a inexistência de casamentos consangüíneos. Sendo assim. 1.2 28 . os símbolos sombreados representam indivíduos daltônicos em um dos ramos da família Abreu.5. Questão 135 Um homem pertence a uma família na qual. localizada na parte não homóloga do cromossomo X. consultou um geneticista que.2 1. diversos membros são afetados por raquitismo resistente ao tratamento com vitamina D.Visão normal XDXd . há gerações.5.Visão normal XdXd .que o próximo filho homem desse casal venha a ser daltônico? a) Sabendo que a doença em questão é um caso de herança ligada ao sexo.Daltônica Na figura a seguir. Supondo que nove de suas gestações se completem.Daltônico Mulheres: XDXD . Homens: XDY . que causa aborto espontâneo. Nele.Visão normal XdY . podemos representar genótipos e fenótipos de homens e mulheres como no quadro a seguir.

1. tendo em vista as informações e usando os símbolos dados.2 e IV.7. a) Qual a principal característica clínica da hemofilia A? Justifique por que esse sintoma clínico aparece nos afetados. A figura a seguir mostra o heredograma de um tipo de diabetes que leva a problemas no metabolismo do fosfato e dos carboidratos.risco de sua prima (indivíduo III„) vir a ter uma outra criança hemofílica do mesmo casamento com o indivíduo III…. IV. procurou um geneticista. tem vários parentes com hemofilia clássica ou hemofilia A. Existe um terceiro gene autossômico (não localizado nos cromossomos sexuais) que é responsável pela cor branca. III-4 e III-5? Questão 138 MS (indivíduo IIIˆ) está grávida. no quadro anterior.2 Questão 139 1. considerando o seu casamento com um homem normal (indivíduo III‰). o seu risco e também o de sua família de vir a ter uma criança com essa doença.5. para representar os genes.2 e IV. b) Analise a Árvore Genealógica de MS e informe: 1.9? b) Qual a probabilidade de. ela ser do sexo masculino e daltônico? Justifique sua resposta. Supondo que o indivíduo tratado venha a ter filhos com 29 Com base no enunciado e na análise do heredograma.2 A cor do pêlo dos gatos depende de um par de genes alelos situados no cromossomo X. explique por que o pêlo de uma gata pode ter três cores. Questão 140 Uma das primeiras experiências de terapia genética foi realizada com indivíduos hemofílicos cujo gene para o fator VIII de coagulação era defeituoso. Como não tem recursos para fazer o diagnóstico pré-natal dessa doença pelo estudo do DNA fetal. Um deles é responsável pela cor preta e o outro pela cor amarela. leis da probabilidade.5. responda: a) A mãe do cruzamento I é homozigota ou heterozigota? Justifique.Analisando a figura. 2. enquanto o pêlo de um gato só pode ter duas cores.5. Os resultados mostraram um aumento significativo na produção do fator VIII nos indivíduos tratados. Na terapia foram retiradas células da pele do paciente. Estas células receberam cópias do gene normal para o fator VIII e foram posteriormente reintroduzidas no indivíduo. embora sejam raras.9? Justifique sua resposta.9 e III. III. b) Quais são os prováveis genótipos dos indivíduos II-2. Com essas informações.1.5. nascendo uma criança de III. c) Quais todos os genótipos prováveis para os descendentes (filhos e filhas) de um possível casamento entre IV. Questão 137 Na espécie humana há algumas condições dominantes ligadas ao cromossomo X. responda: a) Quais os genótipos dos indivíduos II.risco de ela vir a ter uma criança hemofílica.10. Ela quer obter mais informações sobre a hemofilia A e conhecer. por meio das .

b) Considerando que a seleção natural pode eliminar doenças genéticas.2 e considerando que os indivíduos apresentam. fenótipo dos indivíduos. dois caracteres genéticos com mecanismos de herança distintos.5.5.5. Sabendo-se que o loco do gene para o daltonismo está no cromossomo X. o heredograma a seguir começou a ser elaborado para que fosse determinado o genótipo e. a) Quais os tipos de herança envolvidos na transmissão das doenças de cada família? Justifique sua resposta. explique por que a doença da família 2 ainda poderia ser encontrada em indivíduos da geração VI (netos da geração IV). c) discuta a possibilidade de uma mulher hemofílica e albina ser filha biológica dos pais propostos no heredograma que você construiu.2 30 . enquanto que a da família 2 é uma doença degenerativa fatal que aparece em torno dos 40 anos de idade. e ausente no Y. atenda às solicitações a seguir. a) indique os genótipos dos indivíduos. ou. Após analisar os heredogramas.5.5. simultaneamente.5. existe possibilidade de nascimento de uma criança não hemofílica? Justifique sua resposta. Questão 141 Seguindo a representação a seguir 1. Questão 143 Com o objetivo de reconstruir a história familiar de um caso de herança de daltonismo. Questão 142 Os heredogramas a seguir representam duas famílias com doenças hereditárias distintas. A doença que acomete a família 1 provoca retardamento mental acentuado. responda: 1.2 1. b) construa um heredograma no qual três desses indivíduos sejam os filhos biológicos (legítimos) dos outros dois.uma mulher cujos genes para o fator VIII sejam defeituosos.

imediatamente fez o seguinte diagnóstico: trata-se de um caso de aneuploidia de cromossomos sexuais. quais os genótipos dos indivíduos II-4 e II-5? Uma mulher deu à luz um menino com hemofilia. ambos ligados ao sexo. b) Tendo em vista o tipo de herança mais provável. alguns desses pigmentos não estão presentes. A percepção de cores é devida à presença de diferentes tipos do pigmento retinol nos cones da retina.5. Este casal teve dois filhos: João e Maria. Um homem daltônico casou-se com uma mulher de visão normal em cuja família não havia relatos de casos de daltonismo. c) Se os indivíduos III .5 são daltônicos. os homens. Os círculos representam as mulheres e os quadrados.2 Com base nessa genealogia. poderão ter uma menina normal homozigota? Justifique. O daltonismo é um caráter recessivo.1 e III . Os genes que participam da síntese desses pigmentos localizam-se no cromossomo X. neste heredograma. Um de seus gatos apresenta hipoplasia testicular (testículos atrofiados) e é totalmente estéril. Questão 144 Na espécie humana. José procurou um veterinário que. alterando a percepção das cores. 31 . a) Qual o tipo mais provável da herança desta anomalia? Justifique.1 e II . As cores nos gatos domésticos são determinadas por um gene A (cor amarela) e outro gene P (cor preta).5. Os símbolos em escuro representam os indivíduos com anomalia Questão 146 José é uma pessoa muito interessada na criação de gatos.4 vierem a se casar e ter filhos.5 poderá ter irmão normal? Justifique. responda: a) Por que o daltonismo é raro nas mulheres? b) Quantas vezes os homens daltônicos são mais freqüentes nas populações do que as mulheres daltônicas? Questão 145 A genealogia representada na figura é de uma família com uma anomalia rara na espécie humana. a) Qual a probabilidade de João ter herdado do pai o gene para daltonismo? Qual a probabilidade de Maria ter herdado do pai o gene para daltonismo? b) Por que é mais freqüente encontrarmos homens daltônicos que mulheres daltônicas? Questão 148 1. Supondo-se que a freqüência de homens daltônicos nas populações seja de 10%.a) Se os indivíduos I . quantas pessoas A MAIS. ela supôs que o problema teria surgido porque o pai da criança trabalhava em uma usina nuclear e teria ficado exposto a radiações que alteraram seu material genético. também deverão apresentar este fenótipo? b) O indivíduo II . ao ver as cores preta e amarela do animal. A mulher tem razão? Justifique. a) O que é e qual o tipo de aneuploidia que o gato de José apresenta? b) Qual a explicação dada pelo veterinário relacionando a anomalia com as cores do animal? Questão 147 O daltonismo é comumente entendido como a incapacidade de enxergar as cores verde e/ou vermelha. responda. o número de mulheres afetadas pelo daltonismo é baixo quando comparado com o número de homens afetados pela anomalia. Como nenhum de seus parentes próximos era hemofílico. e o malhado apresenta os dois genes (A e P). Nos indivíduos daltônicos.

Questão 149 No gênero Drosophila. Questão 150 A determinação do sexo em peixes segue o sistema XY. como no ser humano. 1. a) Qual será a cor dos olhos dos machos e fêmeas na primeira geração (F)? E na segunda (F‚)? Justifique. b) Qual será a proporção de machos e fêmeas nas duas gerações? Justifique. biologia molecular e engenharia genética podem. mesmo quando elas pertencem a gerações afastadas entre si. porém teve dúvida se se tratava de herança autossômica recessiva ou autossômica dominante com penetrância incompleta. se o alelo fosse dominante e estivesse no cromossomo X do macho? Demonstre. quadrados e círculos hachurados para homens e mulheres afetados.2 32 . O irmão mais velho. Represente como B o alelo dominante para olhos vermelhos e como b o alelo recessivo para olhos brancos. Para o heredograma. afetado pela doença. muitas vezes. homens e mulheres normais. Observando a genealogia. respectivamente. a cor vermelha ou branca dos olhos é determinada por um gene localizado no cromossomo X. I e II. Responda as três questões a seguir considerando o cruzamento de uma mosca fêmea de olhos vermelhos de uma linhagem pura para cor de olhos com um macho de olhos brancos. Um peixe macho com manchas na nadadeira foi cruzado com uma fêmea sem manchas. também afetada pela doença. e o cruzamento das moscas F entre si. assim como a probabilidade de filhos afetados para o casamento entre os últimos primos. Um alelo de um lócus do cromossomo Y do peixe 'Lebistes' determina a ocorrência de manchas na nadadeira dorsal. uma moça normal e 2 homens. um normal e outro afetado. e 3 mulheres. Todas as filhas mulheres são afetadas por essa doença. a) Quais são os fenótipos de F e de F‚ desse cruzamento? b) Como seria o resultado em F e F‚. A irmã mais nova. desenhe o heredograma dessa família considerando o gene (A) normal e o gene (a) mutado e apresente os prováveis progenes. Questão 151 Um geneticista estudou dois grupos. se casa com um homem normal e tem 3 filhos. Uma das filhas se casa com um homem normal e tem 7 filhos. a) O que levou o pesquisador a concluir que não se tratava de herança ligada ao sexo? b) Por que o pesquisador teve dúvida quanto ao tipo de herança autossômica? Questão 152 Uma doença humana rara é introduzida em uma família quando uma mulher normal se casa com um homem afetado. pode-se dizer que o modo de herança mais provável seja de herança ligada do X dominante. a filha afetada do irmão mais velho e o filho afetado da irmã mais nova. 2 mulheres e 3 homens. O heredograma a seguir mostra os descendentes do casal João e Maria. através de um cruzamento. casa-se com uma mulher normal e tem 2 filhos. utilize a simbologia: quadrados e círculos brancos para. Esse casal tem 5 filhos.5. Questão 153 Os conhecimentos atuais de biologia celular. portadores de uma doença genética que se manifestava da seguinte maneira: O pesquisador concluiu que não se tratava de uma doença com herança dominante ou recessiva ligada ao sexo. Justifique essa conclusão. das quais somente uma é normal. uma mulher afetada e um homem normal. sendo 4 homens.5. estabelecer com segurança o parentesco entre pessoas. dos quais 2 são afetados.

de toda essa família. Nesses cromossomos. a técnica de identificação por meio do estudo do DNA extranuclear. B/b e D/d. Os grupos obtiveram os seguintes resultados: Atualmente. Cruzando-se essas plantas heterozigóticas com plantas da linhagem pura de flores vermelhas e grãos de pólen redondos. b) netos e bisnetos de João e Maria que possuíram ou possuem o cromossomo Y idêntico ao de João e justifique sua resposta. a) De acordo com a Segunda Lei de Mendel.6 1. nem ser possível a coleta de material genético dos membros falecidos da família. numa célula em divisão meiótica. Questão 156 Três grupos de alunos realizaram cruzamentos-testes entre plantas de tomate para o estudo de diferentes genes. Por não haver documentos legais comprobatórios da relação de parentesco. Indique o número de: a) bisnetos do sexo masculino e do sexo feminino que poderiam ser identificados com aproximadamente 100% de certeza.5.a) Quanto aos pares de alelos mencionados. por técnicas que determinam a homologia entre amostras de DNA extranuclear. dois pares de cromossomos com três genes em heterozigose: A/a. e justifique sua resposta. e se apresentaram para a identificação de herdeiros do casal citado.5.6 33 .3 Questão 155 Foram realizados cruzamentos entre uma linhagem pura de plantas de ervilha com flores púrpuras e grãos de pólen longos e outra linhagem pura. considerando-se a Segunda Lei de Mendel (Lei da Segregação Independente). Todas as plantas produzidas tinham flores púrpuras e grãos de pólen longos. ocorreram as permutas indicadas pelas setas 1 e 2. 15 com flores vermelhas e grãos de pólen longos. 17 com flores púrpuras e grãos de pólen redondos. apenas Maria e todos os seus bisnetos estão vivos. 66 com flores vermelhas e grãos de pólen redondos. Questão 154 O esquema a seguir representa. foram obtidas 160 plantas: 62 com flores púrpuras e grãos de pólen longos. quais são as freqüências esperadas para os fenótipos? b) Explique a razão das diferenças entre as freqüências esperadas e as observadas. 1.5. foi utilizada. que tipos de gameta esta célula poderá formar? b) Que pares de alelos têm segregação independente? 1. com flores vermelhas e grãos de pólen redondos. dentre outras. Essas freqüências fenotípicas obtidas não estão de acordo com o esperado.5.

que permitiria ao casal do item b ter filhos com aptidão mediana para aprender biologia mas sem aptidão para tocar guitarra? d) Quais os locos cuja herança não resultará em proporções segregantes dentro dos padrões da segunda Lei de Mendel? e) Uma mãe sem aptidão para aprender biologia e tocar guitarra. a) Expresse. Em um dado loco. o termo ligação? Qual é a sua utilidade para a pesquisa científica? c) Calcule a distância. proposto por Thomas Hunt Morgan. Justifique. e um indivíduo homozigoto dominante apresenta maior aptidão.5. correspondam a aptidões para aprender biologia (B). Nessas condições. qual a probabilidade desse casal ter uma criança com aptidão mediana para matemática? c) Qual o nome do mecanismo genético. Com base nessas informações. a) Como se denomina a situação mencionada? Supondo o cruzamento AB/ab com ab/ab b) Qual será a porcentagem de indivíduos AaBb na descendência? c) Qual será a porcentagem de indivíduos Aabb? Questão 159 Numa população de 100 pessoas. matemática (M) e tocar guitarra (G). poderá esperar descendentes (F1) com qual(is) genótipo(s)? b) Se um descendente (F1) se casar com um indivíduo sem aptidão para as três habilidades. em Genética. deles resultando. b) Quantos indivíduos são homozigotos? c) Suponha que nessa população os cruzamentos ocorram ao acaso.a) Indique o(s) grupo(s) que trabalhou (trabalharam) com genes ligados. Considere. b) O que significa. 36 são afetadas por uma doença genética condicionada por um par de alelos de herança autossômica recessiva. terá 100% dos filhos(as) com aptidão no mínimo mediana para as três características. também. em unidades de mapa genético. faça o que se pede: a) Um casal (P1). entre os genes pesquisados pelos alunos do grupo G2. em frações decimais. havendo 10 unidades de recombinação (morganídeos) entre eles. qual será a porcentagem esperada de indivíduos de fenótipo dominante na próxima geração? Justifique suas respostas mostrando como chegou aos resultados numéricos. a freqüência dos genes dominantes e recessivos. um indivíduo heterozigoto apresenta aptidão mediana. 34 . formado por um indivíduo triplo homozigoto dominante e outro triplo homozigoto recessivo. identificados nos cromossomos (I e II). um indivíduo com genótipo recessivo não apresenta aptidão. em média.6 Os locos gênicos A e B se localizam em um mesmo cromossomo. Questão 157 Considere que os genes autossômicos. que a característica em questão não altera o valor adaptativo dos indivíduos. ao se casar com um indivíduo com genótipo: Questão 158 1. igual número de descendentes. mas com aptidão mediana para aprender matemática.

a fenilcetonúria. numa dada geração. 2) Taxa de mutação gênica. 35 . Qual das três possibilidades apresentadas NÃO pode ser aceita para explicar a variação na freqüência dos genes citados? Justifique sua resposta. Dos 420 indivíduos de flores vermelhas. uma população ideal deve atingir o equilíbrio. Com essa equação podemos calcular a freqüência de um genótipo sabendo a freqüência de um dos alelos. Espera-se encontrar diferença na freqüência de nascimento de crianças aa entre essas regiões? Por quê? Questão 161 Segundo o Teorema de Hardy Weinberg. 380 são homozigóticos (VV) e 40 são heterozigóticos (Vv). Questão 162 A SOCIOBIOLOGIA procura explicar o comportamento dos indivíduos em função de sua herança genética. uma dessas crianças apresentou uma doença. uma das condições estabelecidas por Hardy e Weinberg para populações ideais foi seriamente afetada por uma erupção vulcânica ocorrida há cerca de cem mil anos. é composta por 500 indivíduos. ou vice-versa. desde que a população esteja em equilíbrio. b) Defina o conceito de evolução em função da freqüência dos genes de uma população e indique de que forma a diminuição da população afetou a evolução dos jabutis gigantes. Um dos instrumentos mais utilizados nesses estudos é a pesquisa sobre o comportamento de gêmeos univitelinos que foram criados em ambientes diferentes. 3) Deriva ao acaso da freqüência gênica. principalmente em populações pequenas. Esta erupção teria diminuído drasticamente a população de jabutis gigantes da ilha. Questão 166 O grupo sangüíneo MN é determinado por dois alelos codominantes. A freqüência dos genótipos desse grupo sangüíneo foi amostrada em duas populações humanas e os resultados são apresentados na tabela a seguir. Determine a freqüência dos genes V e a freqüência dos genes v nessa população. 420 são de flores vermelhas (fenótipo dominante) e 80 são de flores brancas (fenótipo recessivo). Em uma das ilhas do arquipélago de Galápagos. ou estado estático. foi de A= 80% e a=20%. sem grandes alterações de seu reservatório genético. As pessoas heterozigóticas Aa são resistentes a uma doença infecciosa causada por um protozoário. p£+ 2pq + q£= 1. a qual é letal para as pessoas homozigóticas AA. Considere regiões geográficas em que a doença infecciosa é endêmica e regiões livres dessa infecção.000 crianças. Qual o princípio científico dessa abordagem experimental? Questão 163 Pela equação Hardy-Weinberg. a) Cite duas das condições propostas por Hardy e Weinberg para que o equilíbrio possa ser atingido. Na geração seguinte foi observada uma freqüência de A=60% e a=40%. Questão 165 A freqüência gênica de dois alelos em uma população. Questão 164 Uma população vegetal que NÃO está em equilíbrio de Hardy-Weinberg.Questão 160 Um determinado gene de herança autossômica recessiva causa a morte das pessoas homozigóticas aa ainda na infância. Desses. determinada por um gene autossômico recessivo. onde p e q são as freqüências de dois alelos. Numa determinada população em equilíbrio de Hardy-Weinberg nasceram 10. Alguns mecanismos evolutivos que alteram a freqüência dos genes são: 1) Seleção natural. Calcule a freqüência de indivíduos de fenótipo normal portadores do gene causador da fenilcetonúria nessa população.

Usando o teorema de Hardy-Weinberg pode-se determinar as freqüências gênicas de uma população e demonstrar se a espécie está em equilíbrio. com 400 alelos. a) Qual a freqüência dos alelos A e a em cada uma das populações? b) Qual delas tem a maioria dos indivíduos homozigotos? Explique. Com base nessas informações. como a cor amarela. numa proporção de 10:1. Esse gene tem um alelo que não produz essa característica. 40 indivíduos com genótipo Aa e 70 indivíduos com genótipo aa. Questão 167 Numa determinada ilha existia uma população animal com indivíduos possuidores de uma característica normal e indivíduos possuidores de uma característica recessiva. Questão 171 A freqüência do gene i. é de 0. Questão 172 Uma característica fenotípica de uma população. isto é. a) Após o desastre pode-se afirmar que a freqüência do gene recessivo será zero? Justifique sua resposta. caso exista. respectivamente. portanto. Despreze a parte fracionária de seu resultado. aplicar o Princípio de Hardy-Weimberg. Mas um desastre ambiental provocou a morte de todos os indivíduos com a característica recessiva. que determina o grupo sangüíneo O. Questão 170 Considere duas populações diferentes. uma população em que os casamentos ocorrem ao acaso. portanto. EM PORCENTAGEM. b) Qual o nome dado a essa alteração brusca na freqüência gênica? Questão 168 Uma das maneiras de verificar se uma determinada espécie está ou não em evolução é fazer um estudo do patrimônio genético de suas populações. A população 1 apresenta 90 indivíduos com genótipo AA. calcule. Considerando que tal população se encontre em equilíbrio genético. sendo 36% dos indivíduos recessivos. isto é. em estado de não-evolução. a freqüência do referido gene na população. A população 2 apresenta 45 indivíduos com genótipo AA. Explique. Justifique sua resposta. 1. Escreva quatro destas condições: 36 . cada uma com 200 indivíduos diplóides. quantas se espera encontrar com sangue do tipo O? Explique as etapas que você seguiu para chegar à resposta. Indique o genótipo das pessoas do grupo sangüíneo O. 1 e 2.40 (40%) em uma população em equilíbrio.5.7 Calcule a freqüência do alelo M nas duas populações e determine se a população da Europa como um todo é uma população panmítica. Em uma amostra de 1000 pessoas desta população. a dominante e a recessiva. 130 indivíduos com genótipo Aa e 25 indivíduos com genótipo aa. é determinada por um gene dominante. alterando de forma brusca a freqüência do gene recessivo na população da ilha. para que uma população se mantenha em equilíbrio genético é necessário que ela se enquadre em certas condições. podendo-se. não é possível saber a freqüência do gene para cor amarela. Um estudo dessa população determinou que a freqüência do fenótipo amarelo era de 50% e NÃO SE SABE se essa população está em equilíbrio de Hardy-Weinberg. Entretanto.Questão 169 Em uma população. um determinado gene apresenta-se em duas formas.

que quantidade de DNA há na faixa superior? Questão 175 Quais são as duas propriedades fundamentais do DNA que permitem a essa substância desempenhar o papel de material genético? 37 . Questão 176 Por que o processo de replicação do DNA é chamado semiconservativo? Questão 177 Dada a seqüência de bases nitrogenadas de um segmento de DNA: AAT GGC ATC responda: a) Qual é a seqüência de bases da hélice complementar a esse segmento? b) Qual é a seqüência de bases do RNA mensageiro transcrito a partir desse segmento? Questão 178 Dada a seqüência de bases nitrogenadas de um segmento de DNA a seguir. O DNA das bactérias das amostras B e C foi também extraído e centrifugado. todo o DNA tem uma densidade intermediária entre o que é constituído apenas por ¢¥N e o que contém apenas ¢¦N? b) Considerando que. De uma amostra dessas bactérias (amostra A).1 A figura mostra o resultado da centrifugação do DNA das três amostras de bactérias. responda aos itens adiante. TTT AAT GGG CAT a) Qual é a seqüência de bases da hélice complementar a esse segmento? b) Qual é a seqüência de bases do RNA mensageiro transcrito a partir desse segmento? Questão 179 Para funcionar como material genético o ácido desoxirribonucléico (DNA) apresenta a capacidade de autoduplicação. extraiu-se o DNA que foi submetido a uma técnica de centrifugação que permite separar moléculas de DNA de acordo com sua densidade. na amostra C. Questão 174 Bactérias (Escherichia coli) foram cultivadas durante várias gerações em um meio de cultura na qual toda a fonte de nitrogênio era o isótopo pesado ¢¦N. 20% das bases nitrogenadas são constituídas por adenina.5. Utilizando seus conhecimentos sobre o material genético.8.Questão 173 No DNA de um organismo. 18% das bases nitrogenadas são constituídas por citosina. responda: a) Qual a importância de o DNA autoduplicar-se? b) Por que essa replicação é semiconservativa? Questão 180 No DNA de um organismo. Que outras bases nitrogenadas devem existir neste DNA e em que proporções? Justifique sua resposta. a quantidade de DNA separada na faixa inferior é X. quando as bactérias completaram uma divisão celular nesse novo meio e uma terceira amostra (amostra C). a) Por que. O restante das bactérias foi transferido para um meio de cultura em que todo o nitrogênio disponível era o isótopo normal ¢¥N. Retirou-se uma segunda amostra (amostra B). quando as bactérias completaram duas divisões celulares. Que outras bases nitrogenadas devem existir neste DNA e em que proporções? 1. na amostra B.

o que representam os números 1.8. responda quais são as outras bases dessa molécula e em que proporções ocorrem. Que outras bases nitrogenadas possui essa molécula e em quais proporções? Questão 188 Os ácidos nucléicos são macromoléculas definidas como polinucleotídeos. Questão 186 No desenho a seguir. que representa a estrutura da molécula de DNA.AUTODUPLICAÇÃO II . 2 e 3 respectivamente? Questão 190 Sabendo-se que numa molécula de DNA formada por uma dupla hélice há 21% de timina. sabendo que se trata da unidade estrutural do ácido desoxirribonucléico (DNA)? Questão 187 Uma molécula de DNA contém 15% de guanina.5.5.1 Para funcionar como material genético o DNA apresenta duas propriedades fundamentais. 1. São elas: I .8. Questão 183 O que são NUCLEOTÍDEOS? Quais são as moléculas que entram em sua composição química? Questão 184 Quais são as diferenças observadas nos nucleotídeos que entram na composição do DNA em relação aos que entram na composição do RNA? Questão 185 O que representa o desenho a seguir? Qual o nome das moléculas representadas pelos números 1. 2 e 3.TRANSCRIÇÃO Explique essas duas propriedades.1 Questão 182 Justifique o termo SEMICONSERVATIVO para caracterizar o processo de replicação do DNA. a) Represente um nucleotídeo apontando seus três constituintes moleculares.Questão 181 Mencione duas diferenças de natureza molecular entre o DNA e o RNA. respectivamente. 38 . b) Quais são as diferenças observadas nos nucleotídeos que entram na composição do DNA em relação aos que entram na composição do RNA? Questão 189 1.

adicionou-se o nucleosídeo uridina marcado radioativamente com H¤ ao meio de cultura. "O Globo") a) Explique por que o processo de autoduplicação do DNA dá significado à hereditariedade permitindo revelar a história da evolução da humanidade. foram comparadas as características genotípicas e fenotípicas de células retiradas de um tecido de anfíbio. Após algum tempo. Esse processo marca a posição aproximada do isótopo dentro da célula.8. 39 .. suas andanças pelos continentes. como representado no esquema a seguir. Amostras destas células foram retiradas 3. as células foram transferidas para um novo meio que não continha o isótopo. casamentos ancestrais e os ataques de doenças. Justifique sua resposta. com as de células de tecido similar do mesmo indivíduo após atingir a idade adulta. 15 e 90 minutos após a transferência. Questão 195 a) Quais são as bases da cadeia complementar a esse segmento? b) Se o segmento dado servir de molde para a produção de RNA. ainda no estágio de girino. sendo. então. Que outras bases nitrogenadas devem existir neste DNA e em que proporções? Questão 194 CÉLULAS IMORTAIS CONTAM AOS CIENTISTAS HISTÓRIA DA EVOLUÇÃO DA HUMANIDADE Estas células formam um livro.5. Questão 196 Num experimento. 32% das bases nitrogenadas são constituídas por citosina.1 a) Cite o tipo de molécula à qual a uridina se incorporou. entre essas células: a) as características genotípicas são iguais.Questão 191 Considere um segmento de DNA com a seguinte seqüência de bases nitrogenadas: ATT CTA CGC AAA GGC através de observações de características morfológicas e fisiológicas da célula. b) Nomeie o compartimento celular que seria marcado. Explique por que. b) as características fenotípicas são diferentes. b) ". 1. conservado em tanques de nitrogênio líquido que guarda informações desconhecidas sobre a humanidade. Nomeie o processo através do qual o DNA é capaz de controlar e interferir nas características morfológicas e fisiológicas da célula. qual será a seqüência de bases desse RNA? Questão 192 Considere a seqüência de bases nitrogenadas de um segmento de DNA: AAA GGC ATT Responda: a) Qual é a seqüência de bases da hélice complementar a esse segmento? b) Qual é a seqüência de bases do RNA mensageiro transcrito a partir desse segmento? Questão 193 No DNA de um organismo.. casamentos ancestrais e os ataques de doenças" podem ser estudados Em células eucariotas mantidas em cultura. colocadas em lâmina de vidro. se o nucleosídeo radioativo usado fosse a timidina e justifique sua resposta. Os capítulos contam diferentes detalhes da saga do homem na terra: suas andanças pelos continentes. (adaptado de. fixadas e submetidas a auto-radiografia.

ao passo que a seqüência do outro gene pode estar localizada na cadeia oposta. que não se altera ao longo das gerações (salvo em casos de mutações). lança-se mão do DNA mitocondrial.coli" é de cerca de 20 minutos. a DNA polimerase. Para replicar o genoma. Assim. Já o genoma haplóide humano tem 3×10ª pares de nucleotídeos. usa-se um marcador do cromossomo Y. a investigação dos ancestrais paternos. explique essa aparente contradição. no entanto. b) Justifique as respostas ao item a. Por que o DNA mitocondrial deve ser usado para a análise matrilínea? Questão 202 No ADN. Por outro lado. aproximadamente 43 dias! Sabemos. a DNA polimerase consumiria cerca de 83 minutos e. Questão 199 O genoma da bactéria "Escherichia coli" tem um tamanho de 4×10§ pares de nucleotídeos. a tipagem do DNA revela um padrão de bandas que é estável (presente no DNA de todos os tecidos) e é transmitido aos descendentes seguindo as leis de Mendel. para o genoma humano. II) cuja mulher é cega e o homem é normal. Sabe-se que todas as mitocôndrias dos indivíduos afetados pela cegueira não possuem o gene normal. Para alguns genes. para uma análise matrilínea (materna). a seqüência de nucleotídeos do DNA de cada pessoa é única (excetuando-se o caso de gêmeos monozigóticos). o DNA possui duas propriedades. existe uma enzima. Para se realizar uma análise patrilínea. para replicar todo o genoma de uma bactéria. Isto significa que cada indivíduo possui variações discretas e características na seqüência de seu DNA. Graças a essas características é possível atualmente realizar testes de paternidade que comparam os padrões de bandas de DNA das pessoas e revelam se um homem é de fato o pai biológico de uma outra pessoa. Suponha agora a seguinte situação: um homem acusado de ser o pai de uma criança tenta burlar o teste de tipagem de DNA. antes da divisão celular. ou seja. Assumindo que a DNA polimerase apresenta uma velocidade de reação constante para todas as espécies analisadas. a seqüência de nucleotídeos transcrita pode estar em uma cadeia. sabe-se que no mesmo trecho nunca ocorre a transcrição simultânea das duas cadeias de uma molécula de ADN. verificou-se que este gene está localizado no genoma mitocondrial. e que o tempo médio de replicação de uma célula eucariota é de 12 horas. Assim. isto é. a) Informe a percentagem de filhas e filhos cegos de um casal: I) cuja mulher é normal e o homem é cego. Com a utilização de técnicas de genética clássica e molecular. que o tempo de geração da "E.Questão 197 Para desempenhar sua função como material hereditário. Identifique-as e descreva resumidamente cada uma delas. cuja velocidade de reação é equivalente a cerca de 800 nucleotídeos/s. mas sim o gene mutado. um amigo o aconselha a receber uma transfusão de sangue 2 meses antes do teste (em geral colhe-se o sangue como fonte de células nucleadas). a transcrição dos genes não está restrita a somente uma das suas cadeias. No entanto. a) Qual a influência da transfusão sugerida no resultado no exame? b) Que precauções podem ser tomadas para desmascarar a tentativa de fraude? Questão 201 A tipagem de DNA é uma técnica desenvolvida recentemente que permite identificar e estabelecer o grau de parentesco entre indivíduos. Questão 198 A mutação em um gene humano provoca cegueira. Tal evento inibiria 40 . Questão 200 O teste de tipagem de DNA revelou que nos seres humanos existe individualidade genômica.

Cultura de 2 geração com ¢¥N: 1200 moléculas de DNA nas quais 600 com ¢¥N e 600 com ¢¦N e ¢¥N. após esse crescimento promove-se o desenvolvimento de mais duas gerações. Questão 203 Estudos recentes compararam as seqüências completas de DNA mitocondrial de indivíduos de várias regiões geográficas do planeta. 2 etapa: Extrai-se o DNA de todas as bactérias e obtém-se o seguinte resultado: Questão 206 A análise química de duas moléculas de DNA revelou a seguinte composição de bases: Molécula A 23% de adenina.5. Com base nestes dados: a) O que se pode afirmar a respeito das semelhanças entre estas duas moléculas de DNA? b) Justifique sua resposta.Cultura de crescimento com ¢¦N: 300 moléculas de DNA todas com ¢¦N. adenina (A). 1 etapa: Em uma cultura com ¢¦N. Os resultados revelaram que a variabilidade genética no DNA mitocondrial de indivíduos africanos era quase o dobro da observada no DNA mitocondrial de não-africanos.000 anos.Cultura de 1 geração com ¢¥N: 600 moléculas de DNA todas com ¢¦N e ¢¥N. . obtém-se o crescimento de colônias de bactérias. observe o resultado do experimento a seguir. citosina (C). Esses resultados foram importantes para corroborar a idéia de que o ancestral comum mais recente do 'Homo sapiens' viveu na África há cerca de 200. 27% de citosina e 27% de guanina. . em cultura com ¢¥N. a) Indique as porcentagens das quatro bases. 1.o processo da tradução. Explique por que a maior diversidade do DNA mitocondrial apóia a idéia da origem africana do 'Homo sapiens'. Molécula B 23% de adenina. Justifique sua resposta. Explique por que ocorreria a inibição da tradução se a transcrição de uma cadeia do ADN ocorresse ao mesmo tempo que a transcrição da sua cadeia complementar. .1 41 . no mesmo trecho. nessa molécula. guanina (G) e timina (T). Questão 205 Considerando as propriedades de duplicação do DNA.8. b) Explique por que é impossível prever a proporção de citosina presente no ARN mensageiro codificado por esse trecho de ADN. 23% de timina. Questão 204 A soma das porcentagens de guanina e citosina em uma certa molécula de ADN é igual a 58% do total de bases presentes. 23% de timina. 27% de citosina e 27% de guanina. Explique as porcentagens obtidas em todos os extratos das diferentes culturas no experimento.

Após esse bacteriófago composto infectar uma bactéria. A. em vez de fósforo. ressaltando a interação entre as duas cadeias do polímero. quase ignorado de início. tivesse sido usado enxofre radioativo (¤¦S) para marcação de proteínas. G & T representam as bases adenina. Questão 211 No heredograma seguinte. Questão 212 A figura a seguir mostra um trecho da estrutura do ácido desoxiribonucléico. um estudo de uma única página na revista inglesa Nature intitulado "A estrutura molecular dos ácidos nucléicos". que permitiu posteriormente decifrar o código genético determinante para a síntese protéica. Na figura. Os novos bacteriófagos formados estavam marcados radioativamente. Questão 208 Em 1952. A marcação radioativa foi detectada dentro destas bactérias. C. James Watson e Francis Crick descobriram a estrutura do DNA. os fagos produzidos terão a) a cápsula protéica de qual dos fagos? E o DNA. a pessoa A possui uma mutação no DNA de todas as suas mitocôndrias. respectivamente. a) Entre estas lâminas. b) Que relação existe entre DNA. por sua vez.8.Questão 207 A análise química em amostras de cinco lâminas com ácidos nucléicos apresentou os seguintes resultados: 1Ž lâmina: ribose 2Ž lâmina: uracila 3Ž lâmina: dupla-hélice 4Ž lâmina: timina 5Ž lâmina: 15% de guanina e 25% de citosina. também tiveram filhos (F2). a) Watson e Crick demonstraram que a estrutura do DNA se assemelha a uma escada retorcida.1 a) Copie o heredograma. Explique a que correspondem os "corrimãos" e os "degraus" dessa escada. O casal (P) teve filhos (F1) e estes. 1.5. guanina e timina. revolucionou para sempre todas as ciências da vida sejam elas do homem. Estes bacteriófagos marcados foram utilizados para infectar outras células bacterianas cultivadas sem a presença de fósforo radioativo. ocasionando dificuldades motoras para os portadores do problema. Essa pessoa casou-se com outra. pintando quais serão as pessoas afetadas pela doença em F1 e em F2 b) Justifique sua resposta. será de qual deles? b) Justifique sua resposta. que faz com que a produção de energia para os músculos seja deficiente. Questão 209 Em 25 de abril de 1953. planta ou bactéria. citosina. RNA e síntese protéica? c) Como podemos diferenciar duas proteínas? Questão 210 Cientistas criaram em laboratório um bacteriófago (fago) composto que possui a cápsula protéica de um fago T2 e o DNA de um fago T4. quais se referem a DNA? b) Justifique o resultado obtido com a 5Ž lâmina. rato. aparentemente normal. 42 . Hershey e Chase cultivaram bactérias em meio de cultura contendo fósforo radioativo (¤£P) e colocaram bacteriófagos (vírus) para infectar essas células. os resultados seriam os mesmos? Justifique. a) Como se explica que o fósforo radioativo tenha passado para o bacteriófago? b) Como se explica que as bactérias cultivadas sem a presença de fósforo radioativo tenham sido marcadas? c) Se.

1 . responda o que representam os componentes 1.5.8. 43 1. no genoma de um tomateiro. b) Qual é o nome dessa unidade estrutural? Questão 216 Uma cadeia de RNA tem 200 nucleotídeos. Essas pontes de hidrogênio podem ser rompidas por calor. Quantos nucleotídeos tinha o DNA que originou esse RNA? Questão 217 Um segmento de RNA mensageiro apresenta a seqüência de bases nitrogenadas a seguir: AAA UUC GGG GAU. 1) ACTTTAAAGATATTTACTTAAA TGAAATTTC TATAAATGAATTT 2) GCTAGGCCGATGCGGCGTGGA CGATCCGGCTACGCCGCACCT Questão 213 Considerando o modelo da estrutura molecular do DNA como representado na figura adiante. Esse processo reversível chama-se de desnaturação. Justifique a sua resposta. 2 e 3. de maneira invertida. Observe as duas seqüências de DNA a seguir e determine qual delas precisará de uma temperatura de desnaturação maior.Questão 214 Que papéis desempenham o RNA mensageiro e do RNA transportador no processo de síntese das proteínas? 1.2 ) Quais são as moléculas representadas pelos números 1. respectivamente. respectivamente. Para retardar o amadurecimento e evitar as perdas durante o armazenamento. 2 e 3. A temperatura necessária para desnaturar o DNA depende de vários fatores. sabendo-se que trata-se da unidade estrutural do ácido ribonucléico (RNA).8.5.8. a) Quais são as bases do segmento de DNA que deu origem a esse RNA? b) Quantos nucleotídeos existem no DNA que deu origem a essa molécula de RNA mensageiro? Questão 218 A enzima poligalacturonase. 1. é a principal responsável pela maturação de frutos como o tomate. mas um deles é a composição dos nucleotídeos de um determinado DNA. que digere a parede celular de células vegetais. utilizou-se uma técnica na qual o gene que codifica a enzima citada foi inserido.1 Questão 215 Observe o esquema adiante e responda: As linhas pontilhadas indicam as pontes de hidrogênio que são formadas entre as bases aminadas e que contribuem para manter unidas as duas cadeias do DNA.5. o que produz a dissociação das cadeias.

O Benzo[a]pireno. O hábito de fumar expõe os fumantes a substâncias com atividade carcinogênica. um dos principais agentes carcinogênicos presentes na fumaça do cigarro. B e C têm mutações em um segmento de DNA desse gene. representado a seguir. ambos ativos nesse tomate geneticamente modificado. Questão 219 De que maneira o DNA determina a seqüência de aminoácidos das moléculas de proteínas? Questão 220 Uma doença genética de herança dominante é causada por mutações em um gene localizado em um autossomo. em um dos dois sítios indicados na figura 1. cuja seqüência normal está representada a seguir. pelos indivíduos A. B e C? Por quê? Seqüência normal CAA AAC TGA GGA ATG CAT TTC (m) GTT TTG ACT CCT TAC GTA AAG Indivíduo A CAA AAC TGA GGA ATT CAT TTC (m) GTT TTG ACT CCT TAA GTA AAG 44 Questão 221 O fumo está relacionado ao aumento de risco para o câncer de pulmão. Indivíduo B CAT AAC TGA GGA ATG CAT TTC (m) GTA TTG ACT CCT TAC GTA AAG Indivíduo C CAA TAC TGA GGA ATG CAT TTC (m) GTT ATG ACT CCT TAC GTA AAG 1.8. Os indivíduos A. Suponha que um trecho da fita molde de DNA do gene X. justificando cada resposta com a utilização do código genético da figura 2: . possa ser alterado em presença do Benzo[a]pireno. b) Explique por que haverá um aumento no tempo de amadurecimento desse tomate geneticamente modificado.2 1.O esquema adiante mostra os produtos da transcrição do gene normal da enzima e do gene inserido. Usando a tabela que relaciona alguns codons aos respectivos aminoácidos e considerando que a fita molde a ser transcrita é aquela assinalada com a letra m. B e C? b) Como será o fenótipo (normal ou afetado dos indivíduos A. Considere que o RNA mensageiro seja formado a partir das trincas mostradas no esquema da figura 1 a seguir.3 a) Descreva a interação que ocorre entre os produtos da transcrição dos genes normal e inserido no tomate geneticamente modificado e indique a característica dessas moléculas que permite a interação.5. Indique as alterações que ocorrerão na síntese da proteína X quando a mutação for localizada nos diferentes sítios. responda: a) Quais serão os segmentos de proteínas produzidos.5. tem a capacidade de promover mutações no DNA levando a mudança da base Guanina para Timina.8. respectivamente.

13.AAG . c) Se o gene de uma proteína respiratória de um organismo zbohrniano for introduzido numa bactéria terrestre. faça uma comparação entre a diversidade dos organismos encontrados nesses dois planetas. a) As proteínas A.ACT .Por que sempre encontramos N > P ? Questão 224 1. Questão 225 O DNA dos organismos do planeta Zbohrnya é constituído pelos mesmos 4 tipos de bases dos seres vivos terrestres. a proteína produzida pela expressão desse gene será idêntica à da espécie zbohrniana? Justifique sua resposta.8. Já o código genético desses organismos é determinado por códons de 2 bases. do tipo substituição.GAG . a) Considere o segmento de DNA. 45 . utilizando-se da tabela do código genético apresentada a seguir. 16 e 19 tipos diferentes de aminoácidos.CTG .3 Entretanto. Explique a possibilidade da ocorrência dessas três proteínas nos seres de Zbohrnya.5 bilhões de anos. Explique por quê.CAC .5.8. 1. pode afetar a saúde e a qualidade de vida do portador dessa mutação. encontradas nos organismos da Terra. o oposto não é verdadeiro. é sempre possível deduzir-se a seqüência de aminoácidos de uma proteína a partir da seqüência de nucleotídeos do seu gene. ou do RNA-m correspondentes. Um gene é constituído por um número N de nucleotídeos que codifica uma proteína constituída por P aminoácidos.GAG .GTG . não se pode deduzir a seqüência de nucleotídeos do gene. B e C. isto é. 1.3 b) Utilize um exemplo de alteração estrutural da globina humana (cadeia beta) para explicar como uma mutação pontual. b) Sabendo que a vida em Zbohrnya e na Terra existe há 3. respectivamente.CCT . cuja seqüência de nucleotídeos é 5' .5. a partir da seqüência de aminoácidos de uma proteína.3 Com o auxílio da tabela do código genético representada a seguir.3' e. forneça o produto da síntese protéica (polipeptídio parte da cadeia beta prevista para a globina humana). Questão 222 As globinas constituem um bom exemplo da importância da informação genética na estrutura primária e na função das proteínas. apresentam.8.5. Questão 223 O ADN é um polímero constituído por vários nucleotídeos e as proteínas são polímeros constituídos por vários aminoácidos.

para resolver os itens seguintes: 1.4 1.5. por uma purina. b) Utilizando a tabela de código genético fornecida. no polipeptídio codificado por esse gene.8. a) Determine a seqüência de bases do RNAm que foi utilizado para sintetizar o polipeptídeo esquematizado abaixo da tabela.8.Questão 226 Considere a tabela abaixo. c) Qual seria a seqüência dos três primeiros aminoácidos de um polipeptídio codificado por um alelo mutante desse gene.8. esse código segue o padrão do código genético universal. Entretanto. d) Qual a seqüência de aminoácidos que resultará da tradução da mesma molécula de mRNA. b) Se ocorresse uma substituição. a deleção do par de bases T = A)? 46 .A T G A G T T G G C C T G ----. na 3 base do código correspondente ao 6Ž aminoácido do polipeptídeo.3 Analise a tabela e faça o que se pede: a) Cite o nome da enzima que catalisa a síntese de RNA mensageiro. --. contendo códigos de trincas de bases do DNA com os aminoácidos correspondentes.5. 1. qual seria o aminoácido da tabela a ser incorporado? c) Qual é anticódon correspondente ao novo aminoácido incorporado? Questão 227 A tabela adiante representa uma versão fictícia do código genético. A tabela a seguir mostra alguns códons do RNA mensageiro e os aminoácidos codificados por cada um deles.3 a) Escreva a seqüência de bases nitrogenadas do RNA mensageiro. corresponde ao aminoácido metionina. indique a seqüência dos três aminoácidos seguintes à metionina.5. transcrito a partir desse segmento de DNA. b) Cite a seqüência do anticódon correspondente ao códon de iniciação. originado pela perda do sexto par de nucleotídios (ou seja. no qual três bases codificam um aminoácido. após uma deleção do TERCEIRO nucleotídeo? Questão 228 A seguir está representada a seqüência dos 13 primeiros pares de nucleotídios da região codificadora de um gene. c) Qual a seqüência de aminoácidos que resultará da tradução da molécula de RNA mensageiro? Ver figura anterior.T A C T C A A C C G G A C --A primeira trinca de pares de bases nitrogenadas à esquerda.

é correto afirmar que os ARN mensageiros (ARNm) dos diferentes tecidos são todos idênticos? Justifique sua resposta Questão 235 Suponha um gene de um eucarioto responsável pela síntese de uma proteína. ou seja. Questão 234 Em um organismo pluricelular com vários tecidos. em sua cadeia complementar. quais são as seqüências de bases de RNAm por ele produzido? Questão 230 Dado um segmento de RNA mensageiro com a seguinte seqüência de bases: AAU GUA GGC pergunta-se: a) Qual a seqüência de bases do DNA que deu origem a esse RNA? b) Quantos aminoácidos terá o polipeptídeo traduzido. e os que são RNA (+). a) Explique por que é necessário. regiões do ADN cujas informações não estão presentes na proteína em questão. foram precursores das primeiras células. b) Apresente um argumento contrário à hipótese de que os vírus. que sintetiza um RNA complementar a um molde de RNA. . a partir desse RNA? Questão 231 Ribossomos são formados por RNA e proteínas. A figura a seguir representa o resultado de uma experiência de hibridação do ARN mensageiro com a cadeia de ADN que lhe deu origem. no ribossomo. da enzima RNA replicase. se ocorrer uma destruição do(s) nucléolo(s) de uma célula?. Observe que: . respectivamente. todas as células possuem um genoma idêntico.Questão 229 Sabendo-se que um determinado segmento de DNA apresenta capacidade de transcrever e que apresenta a seqüência de bases TAC TCC GCT TAG e. a) Onde esses processos ocorrem na célula eucariótica? b) O que acontecerá com os processos de transcrição e tradução. Analogamente. sintetizados pelos processos de transcrição e tradução. 47 . As regiões do ARN transcrito correspondentes aos íntrons são eliminadas após o processo de transcrição. . como no caso dos seres humanos.o gene da enzima RNA replicase está presente no genoma dos dois tipos de vírus. apenas o RNA complementar a seu genoma é capaz de funcionar como mensageiro na célula infectada. . devido à simplicidade de sua estrutura. como o do resfriado comum. para sua replicação. a seqüência ATG AGG CGA ATC. para sua replicação.nos vírus RNA (+). mas a enzima só é encontrada nas partículas virais RNA (-). enquanto os RNA (+) não precisam armazenar esta enzima. como o da poliomielite.ambos os vírus necessitam. Nesse gene existem íntrons. o genoma viral funciona diretamente como mensageiro. Questão 232 Sabendo-se que um determinado segmento de DNA apresenta capacidade de transcrever e que apresenta uma seqüência de bases ACTCCGCTT / TGAGGCGAA. quais poderiam ser as seqüências de bases do RNA por ele produzido? Questão 233 Analisando o genoma de alguns tipos de vírus formados por fita simples de RNA. encontramos aqueles que são RNA (-). que os vírus RNA (-) já contenham a enzima RNA replicase.nos vírus RNA (-).

5 48 . Questão 239 Atualmente os genes podem ser desmembrados em três classes diferentes: os genes que expressam mRNA que codificam polipeptídios diversos. e o sinal (-) significa ausência de crescimento. é possível percorrer o caminho inverso e chegar à seqüência de DNA que a gerou? Justifique. Qual o produto final da classe de genes que não codificam polipeptídios? Questão 240 O que são ácidos nucléicos? Como atuam na síntese de proteínas? Questão 241 A figura mostra cinco regiões. o sinal (+) significa crescimento. que servirá de molde para a fita de RNA mensageiro. Questão 237 Considere um fragmento de DNA com a seguinte seqüência de bases: GTA GCC TAG e responda: a) Qual será a seqüência do RNAm transcrito a partir deste DNA? b) O mesmo peptídio será obtido a partir deste RNAm e do RNAm da fita complementar? Explique.Paulo" (23.2002) noticiou que um cientista espanhol afirmou ter encontrado proteínas no ovo fóssil de um dinossauro que poderiam ajudá-lo a reconstituir o DNA desses animais. identificadas por números de 1 a 5. b) A partir de uma proteína.5. há 30 timinas e 20 guaninas. responda. Questão 238 O jornal "Folha de S. a partir de uma seqüência de DNA. 1.5. e uma terceira classe de genes que não codificam polipeptídios. obtém-se uma proteína. Questão 236 Em um segmento da cadeia ativa de DNA.8.4 a) Faça um esquema simples. Quais dessas regiões correspondem aos íntrons? Justifique sua resposta. Certos mutantes nutricionais do fungo Neurospora só conseguem crescer quando aminoácidos são adicionados ao meio de cultura.1. a) Quantas uracilas e quantas guaninas comporão a fita do RNA mensageiro transcrito do DNA ativado? b) Quantos aminoácidos deverão compor a cadeia de polipepitídeos que será formada? Justifique sua resposta. Na tabela a seguir. demonstrando como. os genes reguladores que codificam proteínas que regulam outros genes.09. formado por palavras e setas. Levando-se em consideração essas informações.8. No segmento correspondente da fita complementar do DNA há 12 timinas e 10 guaninas.

explique a atuação dos antibióticos I e II sobre a síntese protéica. adquirem uma conformação tridimensional. é preferível utilizar o RNA-mensageiro para determinar a região codificante do DNA.TCT . 49 . ou seja. a) Considere as etapas de replicação.8. Ao longo do experimento. sintetizar os seus DNA-complementares e. As setas nos gráficos indicam o momento em que foram administrados os antibióticos nas culturas. Questão 246 Os gráficos a seguir representam o efeito inibitório de dois antibióticos (I e II) sobre a síntese protéica em culturas de 'Staphylococcus aureus'. Questão 242 Os códons AGA. então. e ACU do RNA mensageiro codificam. proceder ao seqüenciamento das bases presentes nesses DNA. respectivamente os aminoácidos arginina.GAC de um segmento de DNA. Questão 245 Diversas técnicas são utilizadas para determinar. CUG. após sintetizadas. extrair os RNA-mensageiros da célula. amostras das células foram coletadas a intervalos regulares. Os resultados do experimento estão mostrados no gráfico a seguir. 1. explique o porquê do mutante Z só crescer quando se adiciona arginina ao meio de cultura. é possível determinar a seqüência codificante diretamente a partir de seu cromossomo. primeiramente. no entanto. hoje. a droga foi também introduzida no meio de cultura.Sabe-se que as etapas que levam à síntese da arginina são: substrato ë (gene1) ë ornitina ë (gene2) ë citrulina ë (gene3) ë arginina Supondo que em cada mutante há apenas um gene alterado. Questão 243 Quais os papéis do gene e do ribossomo na síntese das proteínas celulares? Questão 244 Para investigar possíveis efeitos de uma determinada droga. Explique o motivo pelo qual.5. leucina e treonina. consiste em. transcrição e tradução nas células analisadas. marcadas com isótopos: uridina ¢¥C. em organismos eucariotos. timidina ¤H e leucina ¢¦N. Cite duas ligações ou interações que atuam na manutenção da estrutura enovelada das proteínas. em genes de uma célula eucariota. Indique se a droga interfere em cada uma dessas etapas e justifique suas respostas.8. aquela que define a estrutura primária da proteína a ser sintetizada. a seqüência de bases nitrogenadas codificantes.5 Com base nos gráficos.5 1. utilizou-se uma cultura de células. Em uma bactéria.5. à qual foram adicionadas quantidades adequadas das seguintes substâncias. A abordagem experimental mais freqüente. Escreva esses aminoácidos na ordem correspondente à seqüência TGA . Após algum tempo. b) As proteínas. A incorporação dos isótopos foi medida em uma preparação que contém os ácidos nucléicos e as proteínas da célula.

No entanto. o sinal para o início da síntese das proteínas (tradução) é geralmente sinalizado no ARNm pelo códon AUG. Hemoglobina S: . GUA histidina .8. conhecidas como hemoglobinas A e S. CAC leucina .5.ACU.5 Explique a importância desse duplo controle da iniciação para a tradução correta da mensagem contida no ARNm. GAA A mutação pode ocorrer no ADN como mostra o esquema a seguir: Questão 248 Nos procariotos. existe uma seqüência curta de nucleotídeos que antecede esse códon. permite que o sítio correto de iniciação da tradução seja selecionado.Sintetizaram uma cadeia de DNA com três nucleotídeos repetidos muitas vezes em uma seqüência conhecida: . . CCC. incluindo os diferentes aminoácidos. Diferentes repetições do experimento demonstraram que até três proteínas diferentes poderiam ser produzidas.Essa cadeia de DNA foi usada em um sistema livre de células.valina-histidina-leucina-treonina-prolina-ácido glutâmico.5 . O diagrama a seguir ilustra a localização dessa seqüência.. . que diferem apenas em um aminoácido: Hemoglobina A: ..CAU.. Questão 249 Nos anos 50 e 60.Nesse sistema..GUU. além do código AUG. UUA treonina . um grupo de pesquisadores desenvolveu o seguinte experimento: 1. Essa pequena diferença é suficiente para determinar que uma pessoa portadora de hemoglobina S sofra de anemia falciforme. em azul...GAG. em homenagem aos pesquisadores que as detectaram.. GUG. ACG.5. na hemoglobina S.8. serão anômalas? Justifique sua resposta. que é chamada de Shine-Dalgarno. CCG.valina-histidina-leucina-treonina-prolina-x. CCA ácido glutâmico .. . no lugar do ácido glutâmico? Justifique sua resposta. A seqüência de Shine-Dalgarno está em vermelho e o códon de iniciação. quando se iniciavam as pesquisas sobre como o DNA codificava os aminoácidos de uma proteína. essa cadeia de DNA sempre produzia uma proteína com um único tipo de aminoácido. que corresponde ao aminoácido metionina. ACA prolina ..CCU.. Essa seqüência.UUG.AGCAGCAGCAGCAGCAGCAGCAGC. b) Todas as células. cada uma delas com um único tipo de aminoácido: serina ou alanina 50 a) Qual é o aminoácido que aparece. a partir da célula que sofre a mutação.Questão 247 Na espécie humana há dois tipos de hemoglobinas. GUC. ACC.. 1. porém no qual haviam todos os componentes necessários à síntese protéica.. Os códons de RNA-m que codificam esses aminoácidos são: valina .

que tipo de mutação originou cada seqüência? Sabe-se que a bactéria 'E. Isso se deve a dois fatos: primeiro.8.5. Mutações nos genes A.5 a) Quantos nucleotídeos são necessários para codificar a seqüência de aminoácidos nas espécies 1 e 2? Justifique. em quatro espécies próximas.8. Questão 252 O esquema a seguir representa a seqüência de reações que levam à formação do pigmento da pelagem de uma espécie animal. qual será a seqüência de bases da fita complementar? b) Se a fita complementar for usada durante a transcrição. c) Considerando que as espécies 2.coli' cresce mais rapidamente na presença da glicose (um monossacarídeo) do que na presença de lactose (um dissacarídeo). b e c.5. B e C que atuam nesse processo metabólico. levando a mudanças no ciclo de vida da célula. b) Pode-se dizer que seqüências idênticas de aminoácidos são sempre codificadas por seqüências idênticas de nucleotídeos? Justifique. porque a lactose necessita ser 51 . qual será a seqüência de bases do RNA resultante e que nome recebe esse RNA se ele traduzir para síntese de proteínas? Questão 254 1.ou glutamina. quantos tipos de albinismo podem ocorrer nessa espécie? Por quê? b) Demonstre o fenótipo esperado de um cruzamento entre animais de linhagens puras com dois tipos diferentes de albinismo. Questão 253 Uma fita de DNA tem a seguinte seqüência de bases 5'ATGCGT3'. Cada letra representa um aminoácido. a lactose não é tão facilmente incorporada pelas bactérias. B e C são responsáveis pela produção das enzimas A. B e C produzem respectivamente os alelos recessivos a. b) Por que podem ocorrer alterações nas proteínas quando o gene sofre mutação? c) Em que situação uma mutação não altera a molécula protéica? Questão 251 Abaixo estão esquematizadas as seqüências de aminoácidos de um trecho de uma proteína homóloga.5 a) Do ponto de vista genético. 3 e 4 se originaram da espécie 1. c) É possível ocorrer uma mutação em um gene sem que se altere a enzima correspondente? Justifique. Os genes autossômicos A. a) Por que as proteínas obtidas possuíam apenas um tipo de aminoácido? b) Por que foram obtidos 3 tipos de proteínas? Questão 250 O metabolismo celular é controlado por uma série de reações em que estão envolvidas inúmeras proteínas. a) Considerando que tenha ocorrido a ação da DNA-polimerase. a) Explique a relação que existe entre gene e proteína. 1. segundo. Uma mutação gênica pode determinar a alteração ou a ausência de algumas dessas proteínas.

b) E é possível pela via da reprodução assexuada? Justifique sua resposta.coli' foi inoculada num meio contendo uma mistura de glicose e lactose. dando origem a indivíduos adultos.5.8.hidrolisada pela enzima ’-galactosidase em glicose e galactose. 52 . Questão 258 Descreva o experimento realizado por Hersey e Chase em 1952. concentração de glicose e número de bactérias e explique o comportamento da curva da enzima ’-galactosidase. conhecido como "experiência do liquidificador" na qual utilizaram isótopos radioativos de enxofre (S¤¦) e de fósforo (P¤£) para 'marcar' vírus parasitas de bactérias. Questão 260 O esquema a seguir mostra. em 1944. O gráfico a seguir resultou de experimento em que 'E. ela é estéril. simplificadamente. Questão 256 Como os cientistas O. não-patogênicas. Questão 259 A mula é um animal oriundo do cruzamento da égua (2n=64) e do burro (2n=62). resultante do cruzamento entre duas espécies. McCarthy chegaram à conclusão. patogênicas. a) É possível a reprodução dos zigotos pela via da reprodução sexuada? Justifique sua resposta. RESPONDA: a) Qual o número de cromossomos encontrado nas células sexuais normais da égua e do burro? b) Qual o número de cromossomos encontrado nas células somáticas da mula? Como essas células se originam? c) Apesar de a mula apresentar uma alta capacidade de realizar trabalho.5 Identifique as curvas da figura. Avery. de que o "agente transformante" capaz de permitir o desenvolvimento da cápsula em pneumococos não-capsulados era o ácido desoxirribonucléico? Questão 257 O que são bacteriófagos? Qual sua importância na identificação do DNA como material genético? 1.1 Suponha que os zigotos podem crescer normalmente. As curvas no gráfico adiante representam a concentração da enzima ’-galactosidase. MacLeod e M. a formação de um zigoto híbrido. bem como suas conclusões a partir deste trabalho. Questão 255 Descreva os principais passos seguidos por Griffth em 1928 no experimento que demonstra a "transformação" de bactérias pneumococos sem cápsula. EXPLIQUE os motivos que levam a tal esterilidade. Em relação a esses três animais e ao processo de origem da mula. M. em pneumococos com cápsula.9. a concentração de glicose e o número de bactérias no meio de cultura em função do tempo. 1. correlacione os parâmetros concentração de ’-galactosidase.5.

a) Em quais momentos ela pode ocorrer? b) Utilize os contornos a seguir para representar uma das duas possibilidades. São Paulo: Moderna. neste indivíduo. sem trissomia do 21. Adaptado de Amabis.5. e que 30% das células apresentavam um cariótipo normal. a) Qual é a aneuploidia existente na Síndrome de Down? b) Quais são os mecanismos responsáveis pelo aparecimento desta aneuploidia? c) Qual é a relação existente entre idade materna e a Síndrome de Down? Questão 265 A Síndrome de Down caracteriza-se pela presença de um cromossomo 21 a mais nas células dos indivíduos afetados. "Biologia das células".1 Questão 266 1. 46 cromossomos. Questão 263 Numa dada espécie.9. 1.1 Uma alteração no DNA pode modificar o funcionamento de uma célula. Responda se o fenômeno da não-disjunção do par de cromossomos 21 ocorreu antes ou depois da formação do zigoto. Que tipos de anomalias cromossômicas poderão ser formadas se esses espermatozóides fecundarem ovócitos normais? Justifique. observou-se. Qual o número de cromossomos que deve ser encontrado em um espermatozóide normal nessa espécie? Questão 264 A ilustração adiante mostra o cariótipo de um indivíduo do sexo masculino com Síndrome de Down.5. ou seja. G. Por quê? Questão 267 O quadro a seguir destaca dois conceitos biológicos: câncer e sistema respiratório de insetos. 2002. responda. Questão 262 Tendo um homem ingerido uma substância que causa erros na divisão meiótica da gametogênese. observou-se que 70% das células apresentavam 47 cromossomos. Justifique sua resposta. Esse problema pode ser decorrente da não-disjunção do cromossomo 21 em dois momentos durante a formação dos gametas.9.Questão 261 Ao analisar o cariótipo de células obtidas de uma criança com síndrome de Down. M e Martho. indicando na lacuna pontilhada qual delas foi escolhida para ser representada. a não disjunção do cromossomo X e a geração de espermatozóides defeituosos. por exibirem a trissomia do cromossomo 21. R. um indivíduo trissômico apresenta um cariótipo contendo 97 cromossomos. J. 53 . Considerando a ocorrência de tal não-disjunção.

Por ser uma variedade triplóide (3n) de laranja. 1. os seguintes conceitos: tumor. de forma relacionada. analisou-se a seqüência de aminoácidos de uma determinada proteína em diversos mutantes gerados. Justifique sua resposta. b) Descreva o caminho da fumaça de um cigarro desde o meio externo até as células do corpo de uma barata. Atualmente. mutação. sua meiose é anormal. Sabe-se que a variabilidade genética de uma população depende dos seguintes fatores: 1) permutação cromossômica ou crossing-over (troca de fragmentos entre cromossomos de um mesmo par de homólogos). Verificou-se que um desses mutantes produzia uma dada proteína que diferia da original pela ausência de 35 aminoácidos em uma das extremidades da cadeia peptídica.2) mutação (modificação da seqüência de nucleotídeos de uma molécula de ADN).9. Justifique a sua resposta. tem sido propagada assexuadamente através de mudas e enxertia.3 Identifique as duas alterações nos códons do RNA que mais provavelmente explicariam a transformação de ácido glutâmico em valina. garantindo que em seu texto apareçam. Questão 271 a) Faça uma breve descrição de como o nefasto hábito de fumar está associado ao desenvolvimento de câncer de pulmão. fumo. Examinando a tabela do código genético a seguir.5. não produzindo gametas viáveis. Explique como essa única mutação pontual pode fazer com que a síntese da proteína seja interrompida prematuramente. Certo ou errado? Justifique. na hemoglobina.9. 1.5. por não possuir sementes. Questão 268 A substituição de uma única base na molécula de DNA leva necessariamente à substituição de um aminoácido na proteína a ser sintetizada pela célula. Após tratar culturas de bactérias com doses de um agente mutagênico capaz de induzir uma única mutação pontual (que afeta apenas um nucleotídeo por célula). é possível identificar as alterações no RNA que formam o códon da valina na hemoglobina da anemia falciforme.3 Identifique qual(is) deste(s) fator(es) pode(m) contribuir para a variabilidade genética da laranja-da-baía. milhões de pés de laranja-da-baía estão espalhados em plantações no Brasil e nos Estados Unidos. Questão 269 Qualquer alteração no DNA pode modificar o funcionamento de uma célula? Justifique. proliferação celular descontrolada. Questão 270 A laranja-da-baía surgiu em 1810 e. Questão 272 A anemia falciforme é uma doença que resulta da substituição de um aminoácido ácido glutâmico pela valina. e 3) segregação independente (recombinação aleatória de cromossomos dos diferentes pares de homólogos). genes reguladores da divisão celular. 54 .

Era um dia claro e quente de verão e às 8h.5.Questão 273 As seqüências de RNA mensageiro a seguir codificam peptídeos com atividades biológicas específicas. Diedrin e Aldrin. Questão 277 FIM DA 2 GUERRA MUNDIAL . b) um nucleotídeo é substituído por outro. As células devem dividir-se e conter a divisão. "agentes mutagênicos". Hiroshima e Nagasaki hoje lideram luta contra essas armas Domingo. foi responsabilizada pela contaminação das áreas em torno de sua fábrica de agrotóxicos em Paulínia. I. sempre de acordo com as necessidades do organismo. Em 2001 a indústria Shell do Brasil S. agente de natureza biológica que podem aumentar a taxa de mutações gênicas. considere duas situações: a) um nucleotídeo é suprimido. Shizuko e seus colegas iniciavam a derrubada de parte das casas de madeira do centro de Hiroshima para tentar criar um cordão de isolamento antiincêndio no caso de um bombardeio incendiário aéreo. II. com resíduos de Endrin. o indivíduo morre? Justifique sua resposta. Explique por quê. Sabe-se que essas funções são geneticamente controladas."O GLOBO" Gilberto Scofield Jr.A. sobreviver e morrer. manter uma especialização característica apropriada e ocupar o lugar apropriado. de forma que o indivíduo passa a apresentar uma ou mais cópias do mesmo gene no mesmo cromossomo.9. 55 1. aumentando assim a probabilidade de desenvolvimento de câncer. A tabela resumida do código genético mostra alguns códons e seus aminoácidos correspondentes. geralmente. fazendo com que o gene não funcione. A renovação dos tecidos requer um controle complexo para coordenar o comportamento de células individuais e as necessidades do organismo como um todo. Um aumento significativo no número de casos de câncer na região tem sido associado à exposição dos moradores a essas substâncias. como todos os jovens japoneses durante a Segunda Guerra Mundial. Àquela altura. Nesse tipo de mutação. Questão 274 Analise as seguintes informações. ela havia abandonado os estudos para se dedicar ao esforço de guerra. b) Dê exemplos de um agente de natureza física e de um .BOMBA ATÔMICA SESSENTA ANOS DE TERROR NUCLEAR Destruídas por bombas. tem sua seqüência duplicada e acrescentada ao DNA. Suponha que mutações no DNA tenham causado as seguintes mudanças nas duas moléculas de mRNA (1 e 2). a duplicação gênica é muito importante na criação de novidades evolutivas. a) Que relações podem ser estabelecidas entre as informações I e II? Inclua na sua resposta os conceitos de "mutação gênica". Questão 275 Em um segmento de DNA que codifica determinada proteína. 31 de julho de 2005 . "descontrole dos mecanismos de divisão celular" e "câncer". um determinado gene. Japão "Shizuko Abe tinha 18 anos no dia 6 de agosto de 1945 e.3 Em qual das mudanças (1 ou 2) há risco de perda ou de diminuição da atividade biológica? Justifique sua resposta. Enviado especial Hiroshima. a) Qual a vantagem desse tipo de mutação no aparecimento de novas espécies? b) Se uma mutação gênica ocorre em um dos genes duplicados. Questão 276 Entre os diferentes tipos de processos que criam nova variabilidade genética. SP. é mais drástica que a situação "b". além de replicar-se. A situação "a".

Japão. muito mais devastador e letal. no Japão.1 milhão de habitantes circulando em bem cuidadas ruas e avenidas.é nunca esquecer o passado.5. Passear pelas ruas de Hiroshima hoje 60 anos depois da tragédia que matou 140 mil pessoas e deixou cicatrizes eternas em outros 60 mil. a) Como a radiação está relacionada ao aumento na incidência de câncer? b) Como se explica que muitos dos efeitos da bomba atômica se manifestem nos descendentes dos sobreviventes? c) Por que algumas pessoas que foram viver nessas cidades tempos depois da explosão também foram afetadas? Questão 279 Soros e vacinas fazem parte do arsenal usado no combate às doenças infecciosas (imunidade adquirida). aponte dois motivos pelos quais essas populações humanas devem ser monitoradas ainda hoje. O sistema imunitário age para combatê-las.A natureza da imunização 2. os monumentos às vítimas do terror atômico estão em todos os lugares". para o qual os abrigos antiincêndio foram inúteis". responda: a) Para que é usada? b) De que é feita? c) Como funciona? Questão 283 Um protozoário conhecido como 'Trypanosoma gambiense' provoca no homem a chamada "doença do sono".ninguém imaginava que Hiroshima seria o laboratório de outro tipo de bombardeio. que é transmitida pela picada da mosca tsé-tsé. b) Indique a reação de combate que é específica para cada agente infeccioso e as células diretamente responsáveis por esse tipo de resposta. Apesar de rica e moderna com seus 1.10 56 . Compare. Dados mostram que a incidência do câncer nas duas cidades japonesas é muito alta. e entrar em nosso corpo. uma reação inicial inespecífica é efetuada por células do sangue.O emprego curativo ou preventivo Questão 280 As bactérias podem vencer a barreira da pele. Após sessenta anos da explosão da bomba atômica sobre as cidades de Hiroshima e Nagasaki. Questão 282 Sobre a vacina. Indique o processo que leva à destruição do patógeno bem como as células que o realizam. Com base nos efeitos biológicos das radiações sobre os seres vivos. Questão 281 Explique o que é uma vacina e como funciona.A duração da imunização 4. "Hiroshima. O estudo da reação imunitária do organismo humano aos antígenos da superfície dos parasitas está demonstrado no esquema abaixo. as populações dessas cidades continuam a ser monitoradas. respectivamente. 1. Questão 278 Os recentes testes nucleares e o cinqüentenário da explosão da bomba atômica em Hiroshima e Nagasaki em 1995 provocaram discussões sobre os efeitos da radiação no meio ambiente e nos seres humanos. por exemplo num ferimento. numa população de 400 mil . a) Nesse combate.A ação imediata ou não 3. a ação do soro e da vacina segundo estes tópicos: 1.

Maria. suspeitou-se de que um dos indivíduos fosse originário de uma região onde a infeção pelo vírus X atinge grande número de indivíduos. Questão 287 Um casal tem quatro filhos: João. Questão 288 As curvas abaixo mostram a produção de anticorpos específicos de dois indivíduos inoculados com antígenos protéicos do vírus X no dia 0. 57 . Indique a condição que deve estar presente no feto para o desenvolvimento da eritroblastose em filhos de mulheres que não produzem fator Rh. um dos gêmeos monozigóticos. representa a maneira mais eficiente e prática de alimentar e nutrir o filho sem os riscos que a alimentação artificial pode oferecer. a) Os gráficos a seguir mostram a variação da concentração de anticorpos contra um determinado antígeno no sangue de uma pessoa. a mãe produz anticorpos contra o fator Rh do filho. vírus. Escreva a importância da amamentação PARA A MÃE E PARA O FILHO. 1.5. A doença só se manifesta. a partir da segunda gravidez. b) Justifique o aumento do número de parasitas com antígeno B na semana 2. deve ser repetido a intervalos de tempo relativamente curtos. em duas condições: vacinação ou soroterapia. Qual seria a pessoa da família mais indicada para ser o doador? Justifique sua resposta. e mesmo simples moléculas. de aceitar uma criança no próprio peito. fungos. b) Na eritroblastose fetal. precisa de um transplante de um órgão. porém. em casos mais graves. o primeiro filho nunca é afetado. Explique por que. Questão 284 A função do sistema imunológico é a de defender o organismo contra invasores. Justifique por que esse tratamento deve ser feito logo após a picada do animal e. Bactérias. Questão 285 O termo amamentação designa o ato de amamentar. podem ser reconhecidos pelo organismo como agentes agressores.a) Explique por que os parasitas com antígeno A desapareceram na semana 2 e cite o principal tipo celular participante da reação responsável por esse desaparecimento. Dois dos filhos do casal são gêmeos monozigóticos e os outros dois são gêmeos dizigóticos. Paulo e Luisa. Mais do que um simples ato de amor. João. em função do tempo. mesmo nessas circunstâncias. Com base nas respostas de cada um deles ao antígeno. tecidos ou órgãos transplantados. b) apresente um exemplo de imunização ativa artificial e um de imunização passiva natural. a) explique a diferença entre a resposta ativa e a passiva. A esse respeito. Qual dos dois indivíduos é originário da região com alta incidência do vírus X? Justifique. por que.10 Um dos gráficos mostrados corresponde à variação da concentração de anticorpo antiofídico no sangue de uma pessoa mordida por uma serpente e tratada com uma dose do soro apropriado. Questão 286 As respostas imunológicas constituem mecanismos de defesa vitais para os organismos.

b) Explique por que a imunidade de grupo não é eficiente no controle de doenças como. a) Explique por que a imunidade de grupo é eficiente no controle de doenças como a gripe. Questão 290 A resposta imune de seis voluntários a três diferentes antígenos (A. A figura a seguir. A linha pontilhada representa a SUBSTÂNCIA TÓXICA. como medicamento.5. a pessoa foi novamente contaminada e outra vez a substância específica foi usada. dificultando as relações comerciais internacionais. pode-se considerar que toda a população está protegida se uma alta proporção dos indivíduos estiver imunizada. Tal fenômeno é denominado imunidade de grupo. Países que não vacinam seus rebanhos contra febre aftosa restringem a importação de carne de países onde a vacinação ocorre. e não a detecção do próprio vírus na carne.10 1. de origem orgânica. Determine se os resultados dos testes seriam positivos ou negativos tanto para animais infectados quanto para vacinados. avalie se a estratégia de vacinação com esses antígenos seria eficaz. Justifique sua resposta. O voluntário 6 não recebeu nenhum dos antígenos. B e C no soro de cada um dos voluntários. Justifique sua resposta. pelo médico. Cinco meses depois desse evento. Com base nos resultados apresentados. Questão 291 No caso de algumas doenças infecciosas. mas sim uma substância inócua (placebo) para servir de controle negativo.1. enquanto a linha contínua representa a SUBSTÂNCIA ESPECÍFICA. indica os resultados observados. Para tratá-la o médico introduziu em seu organismo uma substância específica. por exemplo. O gráfico a seguir reproduz os dois momentos em que ocorreram as contaminações. B e C) do parasita causador da malária (plasmódio) foi testada em uma pesquisa. Questão 292 Uma pessoa foi contaminada por uma substância tóxica. que mostra o título (quantidade) de anticorpos específicos contra os antígenos A.10 Questão 289 A febre aftosa é uma doença virótica que afeta diversos animais de importância econômica. As restrições à importação de carne se baseiam no fato de que os testes disponíveis utilizam a detecção de anticorpos contra o vírus. tais como vacas e ovelhas. Estes testes geram resultados semelhantes para animais vacinados e animais que contraíram a doença.5. o cólera e a hepatite. 58 .

1. inoculada no paciente. mas que não causava a morte dos animais.5. Questão 296 Leia os seguintes fragmentos de textos: 1. a) Que tendência pode ser observada quando se comparam as taxas de mortalidade por doenças contagiosas e por doenças degenerativas (também chamadas "doenças da velhice") no início e no final do século XX? b) Cite dois fatores que podem explicar as mudanças observadas nas taxas de mortalidade por doenças contagiosas. Edward Jenner. uma doença do gado semelhante à varíola pela formação de pústulas. é um soro ou uma vacina? Justifique sua resposta. constatou que estes indivíduos mantinham-se 59 . que descreve causas de óbitos humanos nos Estados Unidos no início e no final do século XX. Considerando que esse quadro retrata as condições encontradas em outros países industrializados. Questão 293 O gráfico a seguir mostra as respostas primária e secundária da produção de anticorpos quando um indivíduo é submetido a injeções de antígenos. Todas eram ordenhadoras e tinham se contaminado com "cowpox". responda: a) Qual a função do antígeno e qual curva corresponde às respostas primária e secundária? b) Explique o que acontece em relação aos anticorpos nas fases das respostas primária e secundária.10 1. um médico inglês.5. em intervalos diferentes.10 Analisando o gráfico. 1. responda.10 1.5. Questão 295 Analise o gráfico. Após uma série de experiências. observou no final do século XVIII que um número expressivo de pessoas mostrava-se imune à varíola.10 A substância específica de combate. a) A que tipo de imunização se referem as aplicações? b) Analise os resultados apresentados pelo gráfico e explique o fato observado com a 2 aplicação do antígeno.5. Questão 294 O gráfico representa o resultado de duas aplicações de um mesmo antígeno.

cada uma com material mais virulento.bio. que vinha desenvolvendo pesquisas na atenuação do vírus da raiva. 1 ou 2. Questão 300 Procurando compreender a importância de determinadas células sangüíneas para o sistema imunológico. injetou na criança material proveniente de medula de um coelho infectado. ao longo desse ano. Gráfico 2: Taxa da incidência anual de sarampo em menores de um ano no Brasil. Pasteur. cascavel.) a) O gráfico 2 indica claramente a ocorrência de epidemias de sarampo em dois anos distintos no Brasil. refere-se a processos de imunização passiva? Justifique sua resposta.fiocruz. é constituído por diferentes tipos de glóbulos brancos e pelos órgãos responsáveis pela produção e maturação desses glóbulos. nos dois gráficos.refratários à varíola. linfócitos T e linfócitos B atuam no sistema imunitário. foram 13 inoculações. a vítima deve ser tratada com soro antiofídico. (www. O soro antiofídico poderia ser denominado vacina antiofídica? Explique.br) 2. b) Que tipos de produtos (medicamentos) puderam ser produzidos a partir das experiências relatadas. Ao todo. mesmo quando inoculados com o vírus. foi feito o seguinte experimento: 60 . é mais eficiente o uso do soro ou da vacina? Justifique. Meister não chegou a contrair a doença. Ministério da Saúde. que atua no combate a infecções.br) a) Qual dos fragmentos. coral e urutu são exemplos de cobras venenosas que ocorrem no Brasil.5. (www. o ano de 1997. de 1980 a 1997. Questão 298 Os médicos verificam se os gânglios linfáticos estão inchados e doloridos para avaliar se o paciente apresenta algum processo infeccioso.10 (Programa Nacional de Imunizações. Joseph Meister. chegava ao laboratório de Louis Pasteur um menino alsaciano de nove anos. a) Explique como macrófagos. de 1982 a 1997. que havia sido mordido por um cão raivoso. É mais correto supor que.fiocruz. Se picada por uma delas. b) Explique que mecanismos induzem a proliferação de linfócitos nos gânglios linfáticos.bio. os resultados representados no gráfico 1 tenham influenciado os resultados representados no gráfico 2 ou o inverso? Justifique. Para reduzir rapidamente e de imediato o número de doentes durante uma epidemia. respectivamente. nos fragmentos de textos 1 e 2? Que relação existe entre o fenômeno observado no relato 1 e as chamadas células de memória? Questão 297 Jararaca. 1. A 6 de julho de 1885. Questão 299 Observe atentamente os dois gráficos apresentados. Gráfico 1: Cobertura da vacinação contra sarampo em menores de um ano no Brasil. O sistema imunitário. b) Considere.

originou 7 fenótipos diferentes. alelos de A e B . o Governo Federal vem discutindo a implantação de quotas para negros nas universidades. Questão 302 A massa de um determinado tipo de fruto depende da ação de dois genes A e B. autofecundada. Os genes a e b. Um criador.10 respectivamente. 61 Com base no exposto. Justifique sua resposta. com linhagens homozigóticas que produzem frutos de 300g. independentes e de ação cumulativa (polimeria). Qual o nome que se dá a esse método profilático? Questão 301 Atualmente. qual a importância da existência dessa variabilidade na cor da pele para o ser humano? d) Especifique a forma de herança genética responsável pela determinação da cor da pele. que ganham nota zero. duas características são condicionadas por genes dominantes (A e B). que interferem igualmente na altura da planta. a) Que tipo específico de célula sangüínea foi afetada pela irradiação? b) Que tipo de molécula essa célula do sangue passa a produzir quando estimulada pela proteína estranha? c) A introdução de moléculas estranhas ao organismo com o objetivo de provocar uma resposta imune é um método bastante usado na prevenção de determinadas doenças. desejando participar do concurso. mais pontos que os recessivos. esperada para a primeira geração de um cruzamento entre dois indivíduos com os genótipos AABBCC e aabbCC. O homozigoto dominante para estas duas características recebe mais pontos que os heterozigotos e estes. Questão 305 Em um concurso de cães. não alelos. reponda: a) quantos pares de genes estão envolvidos na determinação do peso dos frutos desta espécie vegetal? b) qual é o efeito aditivo de cada gene? c) de acordo com o triângulo de Pascal. Considerando a cor da pele de negros e de brancos responda: a) Onde é determinada.1. qual é a proporção de cada classe fenotípica obtida em F‚? Questão 304 A altura dos espécimes de uma determinada planta encontrada no cerrado varia entre 12cm e 108cm. Determine a massa do fruto de uma planta de genótipo AABb. cruzou um macho e uma fêmea. histológica e citologicamente a cor da pele? Histologicamente: Citologicamente: b) O que confere a diferença na cor da pele de indivíduos negros em relação à dos indivíduos brancos? c) Evolutivamente. Do cruzamento entre linhagens homozigóticas que produzem frutos de 150g. Os responsáveis por essa variação são 3 pares de genes com segregação independente. Questão 303 O peso dos frutos (fenótipos) de uma determinada espécie vegetal varia de 150g a 300g. Esses genes contribuem com valores idênticos para o acréscimo de massa. O fruto de uma planta de genótipo AABB tem 40 gramas de massa enquanto o de uma planta de genótipo aabb tem 20 gramas. obtendo uma descendência com todos os genótipos possíveis. ambos heterozigotos para os dois genes. Determine a altura.5. não contribuem para o acréscimo de massa. em centímetros. obteve-se uma geração F que. responda às perguntas a seguir. Sabendo-se que o peso do fruto é um caso de herança quantitativa.

Em relação a essas duas séries de alelos. A4). C2). Qual dos dois mecanismos explica a maior parte das variações fenotípicas nas populações? Justifique. teoricamente. Questão 308 Admitamos que numa certa espécie de animal quatro alelos (A. c¢. A ordem de dominância existente entre os genes é C > c¢ > c£ > c¤.11 Com base nos resultados apresentados.12 1. Questão 307 Um pesquisador cruzou paineiras de flores "pink" com paineiras de flores brancas. respectivamente.5. A2. enquanto outras são determinadas por muitos genes (herança poligênica). Outra característica também depende de 4 genes (B1. a¢. chinchila. II) apenas flores de rosa médio. responsáveis pelos fenótipos aguti. c£ e c¤. a£ e a¤) tem seu locus no cromossomo I e outra série de três alelos (D. rosa e amarela.a) Qual a probabilidade do criador obter um animal com a pontuação máxima? Qual a probabilidade de obter um animal homozigoto recessivo para os dois genes? b) Considerando que todos os descendentes do referido cruzamento participaram do concurso. responda ao que se pede: a) Quantos alelos estão envolvidos na determinação do caráter cor de fruto e qual a relação de dominância entre eles? b) Qual a proporção genotípica e fenotípica do cruzamento entre plantas de fruto vinho do cruzamento parental (2) com plantas de fruto vinho do cruzamento parental (4)? c) Quantas plantas com frutos amarelos serão geradas. quantos pontos devem ter obtido os vice-campeões e os cães classificados em penúltimo lugar? Questão 306 Certas características fenotípicas são determinadas por poucos genes (herança mendeliana). Responda: a) Quais as proporções fenotípicas e genotípicas esperadas na progênie do cruzamento entre um coelho aguti (Cc¢) e um coelho chinchila (c£c¤)? b) Como você explicaria o aparecimento de coelhos albinos a partir de um cruzamento entre coelhos himalaios? Questão 310 As videiras podem produzir uvas de coloração vermelha. possíveis na população? . porém são 62 a) Qual o tipo da herança da cor da flor da paineira? b) Indique as possibilidades de se obter em um cruzamento: I) apenas flores de cor branca. A3.5. quantos genótipos diferentes são. himalaio e albino. d¢ e d£) tem seu locus no cromossomo II. a partir de 200 sementes oriundas do cruzamento entre plantas de frutos vinho do cruzamento parental (4) com plantas de frutos rosa do cruzamento parental (2)? Questão 311 Uma determinada característica depende de um locus que possui 4 alelos (A1. e que cada gene dominante contribui com 5 pontos na premiação. O cruzamento entre plantas com esses fenótipos produziu as seguintes proles na geração F1. produzindo sempre as seguintes freqüências fenotípicas na geração (F‚): Questão 309 A cor da pelagem em coelhos é determinada por uma série de alelos múltiplos composta pelos genes C. 1. B2 e C1. vinho. Os descendentes (F) foram cruzados entre si.

dois pares de alelos localizados em pares de cromossomos homólogos diferentes. . em proporções iguais. sendo que "A" e "B" são dominantes. qual o número esperado de machos e de fêmeas na descendência? Dos machos esperados. a cor do olho é condicionada por uma série de alelos múltiplos. com eles. Questão 314 O cruzamento CD/cd x cd/cd produziu 600 descendentes. sabendo-se que a freqüência de permutação é de 36%? Questão 316 Quais são os gametas produzidos por um indivíduo de genótipo Ab/aB? Em que proporções serão formados sabendo-se que os genes A e b permutam com uma freqüência de 16%? Questão 317 Considere a existência de dois locos em um indivíduo. Um desses dois tipos de determinismo genético apresenta um número maior de genótipos possíveis na população. produzir um único carro que funcione". Quantos deverão ser diferentes dos pais. é cruzado com outro. outro com o motor quebrado e. Questão 312 Em abelhas. produziu 600 ovos e foi inseminada artificialmente por espermatozóides que portavam. Somente 40% dos ovos dessa rainha foram fertilizados e toda a descendência teve a mesma oportunidade de sobrevivência.ocorreu 20% de permuta entre os genes A e B. sabendo-se que a freqüência de permutação é de 10%? Questão 315 Que tipos de gametas e em que proporções produzirá um organismo com genótipo Cd/cD. o evolucionista John Maynard-Smith escreveu sobre a meiose. Questão 318 Sabendo que a maioria das mutações é deletéria (prejudicial ao organismo). A figura a seguir ilustra um par de cromossomos homólogos duplicados (A e B). com a seguinte relação de dominância: marrom>pérola>neve>creme>amarelo. Um pesquisador cruzou um indivíduo "AaBb" com um indivíduo "aabb". a) Baseando-se nos resultados acima. Identifique esses genótipos. que descendência resulta deste processo? b) Na inseminação realizada. 30% entre A e D. . Em abelhas. homozigoto para os genes A B C D. que é homozigoto recessivo para os mesmos alelos. qual é a seqüência mais provável desses 4 genes no cromossomo. Cada loco tem dois alelos "A" e "a" e "B" e "b". heterozigota para pérola. Uma rainha de olho marrom. 25% para cada um deles. durante a produção de gametas: "A meiose é o equivalente a ter dois carros. Esses resultados contrariam a segunda lei de Mendel ou lei da segregação independente? Justifique sua resposta. um com a transmissão quebrada. a) O que é partenogênese? Em abelhas. constituída por cinco alelos. os cinco alelos. O retrocruzamento de F1 (com o duplo recessivo) mostra os seguintes resultados: . A prole resultante foi: 40% AaBb 40% aabb 10% Aabb 10% aaBb O pesquisador ficou surpreso. todos localizados em um mesmo cromossomo. pois esperava obter os quatro genótipos na mesma proporção. existe um processo denominado partenogênese.não ocorreu permuta entre os genes A e C. a partir do gene A? b) Justifique sua resposta. porém. bem como as localizações 63 .ocorreu 10% de permuta entre os genes B e D. quantos terão o olho de cor marrom? Questão 313 Um organismo.

separaram os linfócitos (células brancas) e usaram um retrovírus para introduzir uma cópia correta do gene nestas células. (Adaptado de "O Globo". N. A técnica combina o uso de células-tronco de embriões e terapia genética. Entre as advertências. indicando as distâncias entre os locos.5. 2002. P foi cruzado com outro. A geração F foi então retrocruzada com o homozigótico m. Responda. Os cientistas do National Institute of Health dos Estados Unidos coletaram sangue da menina. Massey. Artmed. Então eles reintroduziram os linfócitos na paciente. um folheto à população alertando sobre os perigos da ingestão de transgênicos na alimentação. p. n. a) O que são transgênicos ou organismos geneticamente modificados (OGMs)? b) Explique por que o vírus da AIDS não poderia infectar uma planta e por que a ingestão de uma planta transgênica não seria capaz de transmitir o vírus da AIDS. Questão 319 Os locos M. Um indivíduo homozigótico para os alelos M. Esta criança possuía um sistema imune extremamente deficiente e não podia defender-se contra infecções.. Questão 321 Alguns grupos radicalmente contrários ao uso de organismos geneticamente modificados (transgênicos) na agricultura divulgaram recentemente. o. o. homozigótico para os alelos m.) a) A partir do exemplo apresentado no texto. n. a) Qual a seqüência mais provável desses locos no cromossomo? Faça um esquema do mapa genético desse trecho do cromossomo. explique em que consistem. A descendência desse retrocruzamento apresentou 15% de permuta entre os locos M e N. 1. no procedimento 64 Um indivíduo que possui os cromossomos A e B poderá formar gametas que não sejam portadores dos alelos M e N? Justifique sua resposta.dos alelos deletérios "M" (presente somente no cromossomo A) e "N" (presente somente no cromossomo B). "Engenharia Genética e Biotecnologia". no Sul do país. b) Por que não houve descendentes recombinantes com permuta entre os locos M e P? Questão 320 O primeiro teste de terapia gênica humana utilizou células sangüíneas. os tratamentos denominados "terapia gênica". As células alteradas produziram a enzima que faltava e. hoje. pois estas são de fácil obtenção e de fácil reintrodução no corpo. A paciente foi uma menina com a doença da imunodeficiência combinada severa. 08/09/2000) Explique a vantagem da utilização. Porto Alegre. se ingeridas. 25% de permuta entre os locos M e O. p. A. O. P estão localizados em um mesmo cromossomo. que viveu sua curta . Não houve descendentes com permuta entre os locos M e P. 10% de permuta entre os locos N e O. constava uma que afirmava incorretamente que "para serem criadas plantas transgênicas são usados os vírus da AIDS" e que tais plantas. A causa da doença da menina era um defeito em um gene que codifica a enzima adenosina desaminase (ADA). N. b) Selecione e transcreva o segmento do texto que justifica a afirmação de que a terapia gênica é um exemplo de engenharia genética. (Kreuzer. Questão 322 CÉLULAS-TRONCO PODEM TRATAR LESÕES CEREBRAIS Empresa usa unidade estrutural de embriões para recuperar vítimas de derrame. de maneira geral.13 vida em um ambiente estéril. poderiam infectar com o vírus da AIDS toda a população. H. a menina é mais saudável do que antes. Sua doença era a mesma que a do "menino da bolha". O.

Historicamente.1 . Identifique qual das duas hipóteses é confirmada pelos processos de clonagem. do indivíduo 2. Admitindo-se a possibilidade de clonar seres humanos e com base no que tem sido publicado nos principais jornais e revistas do País. Questão 327 "CIENTISTAS DA UNIVERSIDADE DO HAVAÍ CLONAM MAMÍFERO ADULTO DO SEXO MASCULINO A clonagem deixou de ser uma técnica aplicável exclusivamente às fêmeas. Questão 325 Em uma experiência de reprodução com uma espécie de mamífero adotou-se o seguinte procedimento: fundiu-se uma célula do indivíduo 1 com um óvulo. Na segunda. Em uma delas. havia duas hipóteses a respeito da diferenciação celular. previamente anucleado. composto por até centenas de diferentes tipos de células. o qual afirma que cenas como estas não só são possíveis. até o estágio adulto. Justifique sua resposta. retiradas de uma mesma rã. como inevitáveis. desenvolveu-se. ao se desenvolver.5. que chamaremos de H1. b) o resultado da experiência seria diferente se tivessem sido usados núcleos de células germinativas. postulava-se a idéia de que ocorria perda de material genético enquanto a célula se diferenciava. Esse processo é conhecido como diferenciação celular.descrito. nos quais o núcleo da célula de um tecido de um indivíduo adulto é introduzido em um ovócito anucleado que. Questão 326 No desenvolvimento de um organismo ocorre a transição de um estágio embrionário. Questão 324 A figura a seguir (Folha de São Paulo. que a diferenciação não implicava perda de DNA. H2. e deu origem a um novo ser. 6/8/98) baseia-se no livro Remaking Eden (Refazendo o Éden) de Lee Silver. Os cientistas observaram que a grande maioria destas células. Esse novo ser é geneticamente idêntico ao indivíduo 1. Explique por que: a) esses núcleos transplantados de células somáticas de diferentes tecidos deram origem a indivíduos normais e idênticos. resultaram na formação de embriões normais. Cientistas da Universidade do 65 1. Questão 323 Dois cientistas realizaram uma experiência com o objetivo de estudar a transmissão das informações contidas nos genes do núcleo de células de diferentes tecidos. de células-tronco ao invés de células já diferenciadas. com seus novos núcleos.15. A célula assim formada foi implantada no útero do indivíduo 3. no qual todas as células são inicialmente indiferenciadas. origina outro organismo. responda: a) Como o bebê da figura acima poderia ter sido gerado? b) Qual seria o sexo do bebê gerado por esse processo? Justifique sua resposta. ao 2 ou ao 3? Justifique sua resposta. Núcleos de óvulos de rã não-fertilizados foram substituídos por núcleos de células somáticas.

Óvulos não fecundados são retirados de um segundo animal (animal Z). Clones. 3 . TÉCNICA II 1 .Havaí clonaram o primeiro mamífero adulto do sexo masculino. p. 3 . 66 1.O embrião é reimplantado no útero de um terceiro animal (animal W) dando origem a um novo animal.89. lembra o geneticista Ademar Freire Maia em um artigo do Boletim "Germinis" do Conselho Federal de Biologia. I e II. A nova célula assim formada começa a se dividir formando um embrião. uma brincadeira com a palavra fibroblasto.Essa fêmea é então inseminada artificialmente.Uma fêmea (animal X) é estimulada com hormônios a produzir vários óvulos. 4 . Considere a possibilidade de que o DNA obtido pertença a um único dinossauro e que deste DNA foram recuperados vários exemplares. um cientista cria em laboratório novas gerações de dinossauros. 2 . por meio do sangue conservado em mosquitos que os teriam picado e que permaneceram fossilizados no âmbar.. considerada o primeiro clone de mamífero gerado artificialmente. O núcleo de cada um desses óvulos é retirado. Com o sangue. a) O que se poderia dizer dos exemplares recuperados. os zigotos são retirados da fêmea e divididos em dois. TÉCNICA I 1 . Pergunta-se: a) Todos os animais produzidos pela técnica I são genotipicamente iguais ao animal X? Justifique. como havia sido feito até agora. segundo trabalho publicado na revista "Nature Genetics".1 Adaptado da Revista Época: Ano II. caso um dos animais seja sensível a uma bactéria que cause pneumonia? b) Justifique sua resposta. Apenas 274 embriões resultaram dessa operação e foram implantados em 25 ratinhas que funcionaram como 'mães de aluguel'. Questão 330 No início deste ano. ocorrem naturalmente no cotidiano.Após alguns dias. que poderiam ser usados e que estão descritas nos quadros. a) Qual seria a desvantagem biológica de um rebanho de clones? b) Dê um exemplo de clone que ocorre naturalmente. e descartaram seus núcleos. foi possível determinar o DNA dos dinossauros. os pesquisadores Ryuzo Yanagimachi e Teruhiko Wakayama mostram que um macho adulto também pode ser replicado. gerando um novo animal. no entanto. extintos há 65 milhões de anos. através da formação de rebanhos homogêneos.) Agora.Células somáticas são retiradas do corpo de um animal (animal Y). da mesma espécie.Cada metade é reimplantada no útero de outra fêmea (receptora). b) O novo animal formado pela técnica II pode ser chamado "clone" do animal Y. 4 . Z ou W? Justifique. Um dos objetivos dessa pesquisa é a melhoria da pecuária. Trata-se de um camundongo batizado de Fibro. pesquisadores anunciaram o nascimento da ovelha Dolly. os cientistas criaram Fibro a partir de um pedaço do rabo de um camundongo. de maio/junho de 1997.5. O material foi substituído por células extraídas da cauda do doador. 2 ." Questão 329 Respondendo a uma questão sobre a possibilidade de se clonarem animais para livrá-los de extinção.O núcleo retirado da célula somática do animal Y é implantado no óvulo sem núcleo do animal Z. nŽ55. 7/6/99.15. das quais são retirados os núcleos.. tipo de célula usada na criação do animal (. produzidos por ratas. . Em vez de utilizar células relacionadas ao sistema reprodutivo feminino para preencher os óvulos. Eles colheram 700 óvulos. Por que os cientistas extraíram os núcleos dos óvulos antes de inserir as células da cauda do doador? Questão 328 No filme "Parque dos Dinossauros". um cientista apresenta duas técnicas. chegando-se assim à fórmula para recuperar a espécie.

realizou uma cirurgia e removeu a hipófise. . .5. antes da . uma promessa da biotecnologia moderna.X representa o trecho de ácido nucléico viral. consiste na cura de defeitos genéticos pela introdução de genes normais em celulas de indivíduos doentes.o símbolo esférico e negro. Entre as várias estratégias de produção de plantas transgênicas. Questão 331 Um pesquisador construiu um camundongo transgênico que possui uma cópia extra de um gene Z. Em um outro camundongo jovem. estudou o crescimento desses camundongos. Em seguida. indica que a partícula viral contém as enzimas transcriptase reversa e integrase (insere o material genético de origem viral no genoma da célula). Por exemplo. 3.2 1. elabore uma hipótese para a causa da diferença no crescimento dos camundongos 1 e 2. as matariam. na ausência do gene de resistência. Justifique sua resposta. colocar as células coletadas em contato com o retrovírus modificado.5. que codifica as proteínas necessárias para a formação de novas partículas virais no interior da célula hospedeira. na talassemia. Nesse caso.15. doença caracterizada pela produção de hemoglobina anormal devido a uma deleção no gene que codifica a cadeia ’ da globina. e quatro diferentes partículas virais modificadas (Esquemas II.Y representa o trecho de ácido nucléico introduzido. destacamos duas: 1) Plantas resistentes a certos vírus patogênicos que.2 a) Explique a causa da diferença no crescimento dos camundongos 2 e 3. b) Indique qual dos retrovírus modificados. coletar células da medula óssea do paciente. deveriam ser realizadas três etapas: 1. reintroduzir as células infectadas no paciente. Questão 332 A terapia génica. A seguir.15. Algumas metodologias em estudo utilizam retrovírus modificados como veículo de introdução do gene desejado. 1. estão esquematizadas a partícula viral original. III. não transgênico e com hipófise. 2) Plantas mais resistentes aos efeitos dos defensivos agrícolas (agrotóxicos). no caso do tratamento da talassemia. comparando com o crescimento de um camundongo.Justifique. para que essas sejam infectadas. 67 . que contém a informação para a síntese da cadeia ’ da globina. contendo a informação para a síntese da ’-globina. IV e V). apresentados nos esquemas acima. poderia ser usado um retrovírus modificado. a) Explique por que. b) Com base em sua resposta ao item a. Obteve as seguintes curvas de crescimento corporal: manipulação (Esquema I) . 2. seria o mais indicado para ser usado nesse tratamento. Questão 333 As técnicas modernas de engenharia genética tornaram possível a produção de plantas transgênicas que possuem genes introduzidos artificialmente no seu genoma. indicado em lagumas figuras. Essas plantas toleram concentrações maiores de agrotóxico sem alterar as propriedades tóxicas dos defensivos agrícolas. as células retiradas da medula óssea são as indicadas para serem infectadas com as partículas virais adequadamente modificadas.

Nos últimos anos. Justifique.15. Questão 337 Uma mutação no gene que codifica a enzima fenilalanina hidroxilase pode acarretar o acúmulo do aminoácido fenilalanina no sangue. II) cana-de-açúcar obtida através de mudas. o desenvolvimento de novas metodologias nas áreas da bioquímica e da biologia molecular permitiu a implementação de exames diagnósticos. qual das duas estratégias não é recomendável? Justifique sua resposta. Questão 336 Existem mecanismos que normalmente impedem a troca de genes entre espécies distintas. Questão 338 Considere estes dados como hipotéticos. porém. a) Cite dois mecanismos que impedem a troca de genes . por que o tratamento iniciado logo após o nascimento. III) soja transgênica clonada para melhoria da qualidade biológica de suas proteínas. para aumentar a produção leiteira. não há ainda como avaliar os riscos que os organismos transgênicos apresentam. do ponto de vista genético.5. o qual inclui uma dieta restritiva à fenilalanina. b) de que forma os três grupos poderiam ser afetados. a) Explique. indicados no esquema por setas. da mãe e da criança estão indicados na figura 2. Um casal apresenta. No esquema a seguir. em caso de ocorrer uma catástrofe ambiental. como a fenilcetonúria.2 Explique o que é alimento transgênico e como é obtido. pode melhorar a qualidade de vida das crianças afetadas por fenilcetonúria. por cruzamentos sucessivos. apesar de seus inúmeros benefícios. onde cada traço indica a posição e o tamanho dos fragmentos num 68 1. em seus cromossomos de número 21. sendo o excesso transformado em compostos tóxicos que comprometem o desenvolvimento físico e mental da criança fenilcetonúrica. Os resultados obtidos com o estudo dos marcadores para o cromossomo 21 do pai. Esse casal tem uma criança com Síndrome de Down devida à trissomia do cromossomo 21. b) Apresente dois testes laboratoriais para a detecção de portadores de fenilcetonúria e explique os princípios desses testes.Do ponto de vista ambiental. no que se refere à perpetuação de sua própria espécie. indubitavelmente importantes no caso de doenças tratáveis. explique a) como os três grupos de seres se diferenciam entre si. c) Indique um benefício decorrente da utilização de organismos transgênicos e um possível risco para o ambiente ou para a saúde humana. Questão 334 Considere os seguintes seres: I) cabra selecionada artificialmente. No entanto. as fronteiras entre as espécies vêm sendo rompidas com a criação de organismos transgênicos. Analisando-os quanto à variabilidade gênica. pontos de quebra por enzimas especiais. b) Defina um organismo transgênico. Questão 335 entre espécies distintas. A introdução de soja e de outras plantas transgênicas tem gerado muita polêmica. os fragmentos são indicados por Kb (1Kb=1000 pares de bases nitrogenadas). Essas resultam em fragmentos de tamanhos diferentes que podem ser utilizados como marcadores genéticos. pois.

marcado com fósforo radioativo.5. é possível medir quanto ADN radioativo existe num ADN de cadeia dupla. como descrito no texto. Com base nessa informação. Esse projeto contou com a participação de diversos laboratórios. igualmente desnaturado. Questão 339 No início do projeto do genoma humano.campo de eletroforese. que permaneceu anônimo. havia duas estratégias a considerar: I) seqüenciar o ADN total dos cromossomos diretamente. Foi feito um experimento em que o ADN do organismo 1 (ADN radioativo) foi "hibridado" com o ADN não radioativo de três outros organismos. constatou-se que a criança apresentava Síndrome de Down. Justifique sua resposta. a técnica de seqüenciamento era a mesma. no entanto. que individualmente determinaram a seqüência de vários trechos diferentes do ADN de todos os cromossomos. O ADN radioativo é então desnaturado (suas cadeias são separadas por calor) e posto em contato com o ADN de um outro organismo. amniocentese. obtendo-se os seguintes resultados: ADN do organismo 1 + ADN do organismo 1 = 100% de radioatividade no ADN híbrido ADN do organismo 1 + ADN do organismo 2 = 10% de radioatividade no ADN híbrido ADN do organismo 1 + ADN do organismo 3 = 40% de radioatividade no ADN híbrido ADN do organismo 1 + ADN do organismo 4 = 85% de radioatividade no ADN híbrido Qual o organismo que pertence à mesma espécie do organismo 1? Justifique sua resposta. a partir da amostra de somente um indivíduo. mais . 3) Suponha que a mulher está novamente grávida e que o exame para marcadores do cromossomo 21. Questão 341 Em Junho de 2001. 2) Determine o estágio da meiose. A fase da meiose em que o fenômeno ocorreu. Justifique sua resposta. portanto. Sabe-se.15. foi realizado para o feto através de punção do líquido amniótico. Pelos resultados apresentados na figura.3 Com base nas informações apresentadas e em conhecimentos sobre o assunto responda ao que se pede. produzir ADN a partir desses ARNs mensageiros e seqüenciar apenas esse ADN. econômica? Questão 340 Uma técnica usada como uma ferramenta da taxonomia emprega a seguinte abordagem: extrai-se o ADN de um organismo e este é. pressupõe-se que a criança deve ser normal. que o ADN era de um indivíduo do sexo masculino. foi publicada a seqüência quase completa do genoma humano. Por que foi importante determinar a seqüência do ADN de um homem e não de uma mulher? 69 1. determine: O genitor onde ocorreu a não-disjunção. I ou II. porém não radioativo. Nos dois casos. Por que a segunda estratégia é mais rápida e. 1) Identifique o genitor que transmitiu dois cromossomos 21 à criança. II) extrair todos os ARNs mensageiros. então. em que ocorreu o fenômeno de não-separação ou não-disjunção dos cromossomos. Analise o resultado obtido na figura 3. Entretanto. após o nascimento. Após a hibridação (reassociação formando moléculas híbridas).

br). 70 . A presença do marcador no genoma de um indivíduo pode ser visualizada como uma banda. Maria manteve relações sexuais com dois irmãos. que causa uma doença nas laranjeiras.gene. quais NÃO deverão apresentar a disfunção muscular quando adultos? b) Supondo que os quatros embriões sejam irmãos. b) Se o xilema é bloqueado.15. 'Xylella fastidiosa'. a) Explique o que é genoma e indique uma possível conseqüência econômica dos resultados desta pesquisa. nascendo destas relações Alfredo. conhecida como amarelinho. a Justiça pronunciou-se sobre a paternidade de uma das crianças e ficou impossibilitada de pronunciar-se sobre a paternidade da outra criança. Cada uma dessas regiões recebe o nome de marcador. II.5. uma vez que pode ser associada com algum fenótipo em particular. qual é o padrão de bandas (I. nascendo Renato. Questão 345 O exame de paternidade através da comparação de DNA seqüenciado vem sendo utilizado para determinar progenitores. Paula engravidou-se ao manter relações sexuais com dois irmãos. Observe o padrão de bandas do DNA de cada embrião e responda: a) Dentre os embriões analisados. III e IV). II. também hipotética. gêmeos dizigóticos.com. Após receber os resultados. Detectou-se ainda que esses marcadores ocupam o MESMO loco. Responda: a) sobre a paternidade de qual criança o juiz pronunciou-se? b) por que não pôde o juiz se pronunciar sobre a paternidade da outra criança? Questão 343 Com técnicas de biologia molecular é possível verificar a presença ou não de certas regiões de interesse na fita de DNA. Dessa forma. Abandonadas. ambas reclamaram na Justiça o reconhecimento de paternidade. reduzindo a produção. É possível determinar o pai de um recém-nascido quando a dúvida sobre a paternidade desse recém-nascido está entre gêmeos univitelinos? Justifique sua resposta. ter um descendente com essa disfunção muscular? Questão 344 Recentemente.3 O teste de paternidade usando o DNA tornou-se muito freqüente hoje. O xilema das plantas produtoras de laranja é parcialmente bloqueado. Questão 346 1. As frases a seguir constam numa lista de "mitos e verdades sobre o teste de DNA" encontrada na internet (http://www. formado por indivíduos tipo I e III. as pessoas têm muitas dúvidas a respeito desse tipo de exame. determinando o Juiz a realização dos testes de DNA. gêmeos monozigóticos.Questão 342 Considerando situações hipotéticas. quais as principais deficiências que a planta sofre? Justifique. podemos descobrir se um embrião poderá apresentar uma determinada característica ou doença genética pela análise de seus marcadores. O esquema abaixo representa a análise de marcadores de DNA de quatro embriões humanos (I. Em outra situação. os jornais e a revista científica internacional "Nature" publicaram com destaque um grande feito de um grupo de cientistas brasileiros. pois a maioria das frutas não se desenvolve. III e IV) mais provável PARA CADA UM de seus pais? c) Qual é a probabilidade de um certo casal. Apenas a presença de duas bandas (A e B) é indicativo positivo para o indivíduo apresentar uma certa disfunção muscular quando adulto. que identificou o genoma de uma bactéria. No entanto.

"Sou primo da mãe e estou com medo do resultado ser positivo. mesmo que eu não seja o verdadeiro pai. em células do pâncreas. e depois sejam transferidos para animais de laboratório." II. não possui antígenos capazes de provocar reação imunológica protetora em mamíferos. em grande escala. o que permite. Um vírus é inserido nas células. conhecidas como tecnologia do DNA recombinante. Por meio dessa tecnologia. indústria ganharam alternativas eficientes para a produção. por exemplo. que passam a produzir sistematicamente tais proteínas. qual deve ser o papel desempenhado por elas? d) Como são chamados os organismos que recebem e incorporam genes de outra espécie? Questão 350 CONVERSÃO CELULAR: Cientistas israelenses induzem células hepáticas a produzir insulina em laboratório e propõem técnica para tratar diabetes tipo 1. b) A cápsula do 'Bacillus anthracis'. causador do antraz. as moléculas de ácidos nucléicos da célula passaram a ser exploradas através da utilização de novas metodologias. Questão 349 Na tecnologia do DNA recombinante são utilizadas enzimas bacterianas que têm a propriedade de cortar a molécula de DNA em pontos específicos. que genes humanos que codificam proteínas de interesse médico ou comercial sejam extraídos. Pergunta-se: a) Qual é o nome genérico que se dá a estas enzimas? 1. De acordo com a técnica esquematizada a seguir. O esquema abaixo representa quatro diferentes linhagens de 'Bacillus anthracis'. clonados em bactérias ou vírus. Justifique sua indicação.I. ao contrário da toxina. contendo um gene que. c) Cite dois produtos." III. Os constituintes da toxina são codificados por genes existentes no plasmídeo pX01. e os da cápsula por genes existentes no plasmídeo pX02. "Ele já morreu e não deixou nenhum outro parente vivo.5 a) Explique a utilidade dos plasmídios bacterianos no desenvolvimento de técnicas de DNA recombinante." Justifique por que cada uma das frases constitui um "mito". que antes eram disponíveis em quantidades extremamente reduzidas. Questão 347 A virulência do 'Bacillus anthracis'. indique a que pode ser utilizada na elaboração de uma vacina composta por bactérias vivas com virulência atenuada.5. que foram obtidos a partir da aplicação da tecnologia do DNA recombinante. e é atenuada quando um deles está ausente. "O exame de DNA só pode ser feito com sangue. Dentre as linhagens apresentadas. Nunca poderei provar que ele era o pai do meu filho. células de fígado são cultivadas em laboratório. Questão 348 A partir da década de 70. a medicina e a b) O que confere a especificidade a estas enzimas? c) Na natureza. a) Qual é a função das endonucleases de restrição e a das ligases na aplicação da tecnologia anteriormente citada? b) Explique como a tecnologia do DNA recombinante participa no processo de produção de organismos transgênicos. utilizados pelo homem. 71 . de determinadas proteínas. está diretamente associada à presença conjunta dos componentes toxina e cápsula bacteriana.15.

a técnica de DNA recombinante vem sendo utilizada na pesquisa e no desenvolvimento." (Adaptação do artigo "Revolução invisível na mesa". 1. pois essas células indiferenciadas podem se transformar em qualquer tecido. a) Cite UMA desvantagem do uso de vírus como vetores de terapia gênica. Atualmente é possível produzir células-tronco heterólogas (retiradas diretamente de um embrião qualquer) ou homólogas. 2 .15. II e III. 8 de junho de 1998). cujo núcleo foi previamente removido. há interesse em usá-las para reparar danos de tecidos que normalmente não se regeneram.o núcleo de uma célula do paciente é transplantado para um ovócito maduro. respectivamente: a) o pareamento das bases? a‚) a ação das enzimas de restrição? aƒ) a ação da DNA ligase? b) "Os agricultores americanos. Por esse motivo. de vacinas e medicamentos.15.15. Os cientistas acreditam que as células transformadas possam futuramente ser usadas no combate ao diabetes tipo 1. ficando mais parecidas com as que existem no pâncreas (células beta). por exemplo.5.6 72 . O procedimento para o preparo de células-tronco embrionárias homólogas está ilustrado de modo simplificado a seguir e envolve as seguintes etapas: 1 .ao atingir o estágio de blástula. Conceitue os organismos transgênicos. Questão 352 A melhor fonte de células-tronco são os embriões em estágios iniciais de desenvolvimento. a) Analise as etapas I.está ligado à produção de insulina. 1.5. responda os itens a seguir. em local próximo à lesão. quando comparada ao tratamento de diabéticos com transplante de células de pâncreas de indivíduos mortos? Questão 351 Na engenharia genética. As células se diferenciam em cultura.5 1. já estão plantando as sementes da terceira safra de milho. por exemplo. as células do embrião são separadas umas das outras e injetadas diretamente no paciente. Em quais delas se desenvolvem. O esquema a seguir apresenta algumas etapas dessa técnica.5 Com relação ao procedimento descrito.o ovócito transplantado é induzido a proliferar. 3 . algodão e soja transgênicos. b) Qual é a vantagem da terapia gênica descrita.5. da revista Época.

a célula solta ácidos para digerir o vírus. Por que pacientes infectados com HIV e não tratados sofrem. e ele continua sua reprodução sem ser molestado. Toda a interação inicial entre vírus e célula do paciente ocorre através da HA. Suas epidemias. As autoridades sanitárias também atribuíram o alto número de casos em crianças abaixo de um ano ao fato de muitas mães nunca terem recebido a vacina contra o sarampo. o bebê fica temporariamente protegido contra essa doença. b) Explique por que o uso de células-tronco embrionárias homólogas reduz potencialmente os problemas pós-tratamento para os pacientes.7. onde a malária é endêmica. mesmo que já tenha tido uma forma da doença? b) Explique como o vírus consegue "enganar" uma célula e infectá-la. que fica espetada na membrana do vírus. não teve acesso a tratamento algum durante o período mostrado. parasitas e bactérias. que faz com que a membrana do vírus se funda com a membrana da célula. No entanto. o aumento da acidez provoca a mudança de forma na HA. Os heterozigotos (Ss) apresentam forma atenuada da anemia." a) Por que o sistema imunológico de uma pessoa não reconhece um vírus mutante. A HA se liga à superfície de uma célula. os indivíduos heterozigotos para anemia falciforme são resistentes à malária. E em ausência da malária? b) Qual é a explicação para o fato dos heterozigotos para anemia serem resistentes à malária? 73 . Foram essas infecções.a) Explique por que indivíduos transplantados com células-tronco embrionárias. o conteúdo do vírus . infecções oportunistas por fungos. já assustaram mais do que a AIDS. 1. e da quantidade de vírus HIV no sangue de um indivíduo ao longo do tempo. Questão 353 Leia atentamente o texto adiante e responda as perguntas propostas a seguir: "A gripe é uma das doenças que mais matou na história do homem. nesse indivíduo. a) Se a mãe já foi vacinada ou já teve sarampo. Dessa forma. apareceram. As mutações ocorrem numa proteína chamada HA. Dentro dessa bolsa. Esse indivíduo. a) Explique o que é esperado para a freqüência do gene S em presença da malária. fazendo com que ela acione suas defesas e "engula" o vírus com uma bolsa digestiva. somente após cerca de 60 meses. Questão 354 O gráfico a seguir mostra a variação do número de um tipo de leucócitos. de infecções oportunistas? Questão 355 Notícias recentes veiculadas pela imprensa informam que o surto de sarampo no Estado de São Paulo foi devido à diminuição do número de pessoas vacinadas nos últimos anos.seu material genético . tanto homólogas. Indivíduos com anemia falciforme são homozigotos (SS) e morrem na infância. ocorrem quando o vírus sofre uma mutação que o torna mais virulento e irreconhecível pelos sistemas imunológicos das pessoas infectadas.é liberado no interior da célula. Por quê? b) Por que uma pessoa que teve sarampo ou foi vacinada fica permanentemente imune à doença? De que forma a vacina atua no organismo? Questão 356 A anemia falciforme é caracterizada por hemácias em forma de foice. e não o vírus propriamente dito.1 Note que. Na África. quase sempre no inverno. As epidemias. É ela que os glóbulos brancos reconhecem e procuram atacar. quanto heterólogas. que ainda ocorrem todo o ano. em geral. os linfócitos T CD4. incapazes de transportar o gás oxigênio. em função da produção de moléculas anormais de hemoglobina. apresentam duas populações de mitocôndrias diferentes em seus tecidos. que levaram o paciente à morte. portador da síndrome de imunodeficiência causada pelo vírus HIV (AIDS/ SIDA).

Questão 357 As abelhas vivem em colônias constituídas por indivíduos de três castas: a rainha. causadora da doença chamada amarelinho ou clorose variegada dos citros (CVC). a) Que característica desse réptil levou o pai a deduzir que se tratava de cobra peçonhenta? Cite outra característica morfológica facilmente identificada na maioria dessas cobras. apesar de não tê-la tocado. pois a enzima que sintetiza esse pigmento está ausente nas roseiras. conforme exemplificado pela reação abaixo. com o objetivo de produzir rosas azuis. a técnica recentemente utilizada consistiu no seguinte: o gene da enzima que produz o pigmento azul. Seu pai. entretanto.2004. de 1Ž. o oxigênio tem 74 . Pelos métodos tradicionais. Questão 360 Uma importante realização da pesquisa científica brasileira foi o seqüenciamento do genoma da bactéria 'Xylella fastidiosa'. Segundo o jornal "The Japan Times on line". a) Como se chamam as estruturas mais vistosas e atraentes destas flores. rosas de coloração azul já eram produzidas através de cruzamento. deduziu que ela era peçonhenta e socorreu o filho. foi extraído do amor-perfeito e ativado nas rosas. a) Cite o tipo de célula indiferenciada de roseira que. pois participa do processo de extração de energia dos alimentos. indique o número cromossômico dos indivíduos de cada uma das castas e descreva como ocorre a diferenciação em castas nesses insetos. fossem inseridas cópias de seu RNA mensageiro.07. O nome da bactéria deriva do fato de que ela se estabelece nos vasos do xilema da planta hospedeira. a) Que processo fisiológico da planta é diretamente prejudicado pela presença da bactéria? Justifique. mas não eram consideradas azuis verdadeiras. como aceptor final de elétrons. Encontra-se em fase de teste uma técnica que possibilita inserir em células de roseira o gene da petúnia responsável pela codificação da enzima que produz o pigmento azul. mesmo sem ver a cobra. que passaram a ter cor azul? Qual o significado biológico do fato de certas plantas apresentarem flores com cores tão vistosas? b) Qual é a relação entre esta técnica recente para a produção de flores azuis e aquela empregada para a produção de alimentos transgênicos? Questão 362 O oxigênio é um elemento imprescindível à manutenção da vida dos seres aeróbicos. um biólogo. Por quê? c) Em que consiste o seqüenciamento de um genoma? Questão 361 Esforços de cientistas criaram a primeira rosa do mundo com pigmento para cor azul. os zangões e as operárias. C†H‚O† + 6 O‚ ë 6 H‚O + 6 CO‚ Em virtude de sua configuração eletrônica. não é possível obter rosas dessa cor. foi picado por ela. b) Qual é a substância imunológica presente no soro antiofídico responsável pela inativação do veneno? Como este soro é produzido? Questão 359 A indústria de flores movimenta bilhões de dólares por ano e está continuamente buscando criar novas variedades. como uma rosa azul. em vez de ser introduzido o gene da petúnia que define a cor azul. Sabendo-se que as fêmeas férteis de 'Apis mellifera' têm 32 cromossomos. Anteriormente. seria o indicado para receber esse gene e justifique sua resposta. Indique se há ou não possibilidade de produção de rosas azuis nesse caso e justifique sua resposta. b) Não se pode atribuir à 'Xylella fastidiosa' a morte das células que constituem os vasos do xilema maduro. delfinidina. As petúnias. tratando-o com soro antiofídico. b) Suponha que. possuem tal enzima. Questão 358 Um menino colocou a mão em um buraco onde havia uma cobra e.

por serem muito reativas. causam alterações. que são fortes agentes oxidantes. Questão 363 Em um hospital. o que são gêmeos? b) Analisando a figura. Dispõe ele dos seguintes doadores: tio.forte tendência a receber um elétron de cada vez. inclusive no DNA. Pergunta-se: a) Qual dos parentes você escolheria como doador do órgão? b) Justifique sua resposta. porém. fato que pode induzir mutações tanto em células somáticas quanto em células germinativas. ocorrendo o mesmo na sua segunda gestação. quais são geneticamente idênticos? Justifique sua resposta. b) Uma espécie reativa de oxigênio induziu uma mutação no gene de uma célula.11 75 .10. dando origem a moléculas intermediárias. o par de gêmeos é do sexo masculino. amigo. primo em primeiro grau e irmão gêmeo dizigótico. um indivíduo necessita de um transplante de rim. a) Estes gêmeos devem ser monozigóticos ou dizigóticos? Por quê? b) Se um dos gêmeos herdou o alelo dominante A de sua mãe heterozigótica Aa. Por exemplo. Questão 365 Em uma gravidez gemelar. Questão 367 Uma mulher teve uma menina em sua primeira gravidez. qual é a probabilidade de que esse alelo também esteja presente no outro gêmeo? Questão 366 O esquema a seguir resume a seqüência do desenvolvimento de irmãos gêmeos: 1. indique a etapa responsável pela formação de espécies reativas de oxigênio e o local da célula onde essas reações ocorrem. 1.9 a) Sob o ponto de vista embriológico. acarretando a substituição de uma base guanina por uma adenina. hoje já estão sendo comercializadas insulina e somatotrofina (ou somatropina) humanas produzidas por bactérias.10. a) Em que locais do corpo humano são produzidas essas proteínas e qual é a principal função de cada uma delas no organismo? b) Explique sucintamente o processo por meio do qual se modificam bactérias para que elas passem a produzir proteínas humanas. sem alterar. Questão 364 Uma conquista recente no campo da biotecnologia é o uso de bactérias para a produção de proteína animal de interesse comercial. a estrutura primária da proteína codificada pelo gene. Essas moléculas. Qual o percentual esperado de ocorrência desse fato? Questão 368 A figura adiante representa o fenômeno biológico que ocorre com um tipo de célula que sai do vaso sangüíneo para exercer sua função no tecido conjuntivo. denominadas espécies reativas de oxigênio. Justifique por que não houve alteração da estrutura da proteína. a) Considerando o processo de oxidação completa da glicose pela célula eucariótica.

2. d) 3:1.folha coberta com cera c . na proporção de a) 1:1. característica determinada por um gene. As plantas de amendoim podem apresentar folhas com pecíolo normal ou curto. b) 1:2:1. P .folha sem cera Os gráficos a seguir mostram a composição dos alelos para essas duas características nas plantas parentais. se o alelo para pecíolo normal for recessivo. Para determinar qual alelo é dominante. pois a mesma é lipossolúvel. Questão 372 O amendoim é uma planta originária da América do Sul. são definidas por alelos segregados independentemente.1 Das combinações possíveis resultantes do cruzamento entre esses mesmos parentais. Considere que duas das características dessa planta. respectivamente. b) Qual a importância do fenômeno apresentado para a função desta célula? Questão 369 A enzima transcriptase reversa é encontrada em retrovírus. referentes à folha e à semente.a) Identifique esta célula e nomeie o fenômeno biológico apresentado. Espera-se encontrar. se o alelo para pecíolo curto for dominante. proteínas. carboidratos. atualmente. Sua importância econômica está relacionada ao fato das sementes possuírem sabor agradável e serem ricas em óleo.5. sais minerais e vitaminas. com dois alelos. 1.semente com "pêlos" p . Muitos pesquisadores. uma com pecíolo normal e outra com pecíolo curto. foi feito um cruzamento entre duas linhagens puras. plantas com pecíolo normal e com pecíolo curto. procuram descobrir novas substâncias que sejam inibidoras específicas dessa enzima.1 76 . o fenótipo que apresenta o maior número de genótipos possíveis é a) semente com "pêlos".1. Os ácidos graxos insaturados presentes no amendoim. O gráfico que representa o número de alelos encontrados na mitose de uma célula obtida de uma planta resultante do cruzamento entre os parentais é: Questão 371 1. se o alelo para pecíolo normal for dominante. em F2.5. se os alelos forem codominantes. se o alelo para pecíolo curto for recessivo. e) 3:1. Descreva a função da transcriptase reversa no mecanismo de replicação do vírus da Aids. c) folha sem cera. c) 2:1.semente lisa C . d) folha com cera. Questão 370 O texto abaixo refere-se às questões: ** a ** O cruzamento entre plantas de variedades diferentes de uma mesma espécie é muito utilizado para a obtenção de cultivares mais produtivos. conforme a lista a seguir. Dois espécimes de variedades diferentes de uma planta oleaginosa foram cruzados visando à obtenção de uma variedade mais resistente à seca. ainda servem de veículo de transporte para a vitamina E. b) semente lisa.

nos frutos. não interferem na eficiência das plantas transgênicas como produtoras de vacinas.. incapazes de produzir sementes. é a utilização de cerejas coloridas. por algum tempo. então no .RNA transportador 77 ** a ** . julho de 2005. roxa e branca) haviam sido obtidas. casamentos consangüíneos não aumentam a probabilidade de transmissão de doenças recessivas..Uma pequena cidade interiorana do Nordeste brasileiro chamou a atenção de pesquisadores da Universidade de São Paulo pela alta incidência de uma doença autossômica recessiva neurodegenerativa. (Pesquisa FAPESP.RNA mensageiro b) citoplasma .proteína . ligam-se á membrana plasmática dos linfócitos e sofrem endocitose. b) homens e mulheres têm a mesma probabilidade de apresentar a doença. responsável pela equipe que desenvolveu os novos frutos. diz a pesquisadora. a) núcleo . Elas continuam apresentando... Outra inovação dessas cerejas é a resistência às moscas Anastrepha fraterculus que. sem sementes....seqüência de aminoácidos .. e) pais heterozigotos têm 50% de probabilidade de terem filhos que irão desenvolver a doença.. existe uma . As pesquisas realizadas revelaram que é também alto o número de casamentos consangüíneos na cidade.. Assinale a alternativa que completa as lacunas de modo correto.. resulta em produto que determinara o desenvolvimento da resposta imunológica. c) em situações como a descrita. das células dessas plantas. as substâncias que.. não há a formação de endosperma. d) pais heterozigotos têm 25% de probabilidade de terem filhos também heterozigotos. Apesar de passar por todas as etapas do ciclo reprodutivo. as plantas apresentam resistência aos nematóides que atacavam a raiz principal do sistema axial desses vegetais. anteriormente.. e o processo cessa nas primeiras divisões celulares do zigoto. muitos cientistas também acreditavam que as características genéticas eram transmitidas pelo sangue. espera-se que essas pragas mantenham-se afastadas dos pomares de vacinas. que foi introduzida para ser transcrita e originar um . c) este é um exemplo claro no qual o conhecimento elaborado pelo senso comum coincide com os conhecimentos atuais dos cientistas. depois de liberadas pela digestão. nos últimos anos. Outro dado interessante levantado pelos pesquisadores foi que a população da cidade acredita que a doença seja transmitida de uma geração a outra através do sangue. estabeleceram-se como pragas importantes do cultivo de cerejas-vacina.... ao ser traduzido. resultando na obtenção de plantas triplóides (3n = 72). verde... neste ano. por mutação no gene responsável pela produção de pigmento na casca do fruto. técnicas especiais de cruzamento foram aplicadas em dois tipos de cerejeiras transgênicas. em algum cromossomo. e) a crença da população não faz o menor sentido. As novas cores (amarela. Questão 375 O texto abaixo refere-se às questões: Notícia de algum jornal do futuro... podemos afirmar que: a) pais saudáveis de filhos que apresentam a doença são necessariamente homozigotos. d) a crença da população pode ser explicada pelo fato de o sangue do feto ser fornecido pela mãe.. As formas mutantes para esse loco. Com o cultivo das novas variedades de cerejas resistentes. que.. determinando o desenvolvimento da resposta imunológica. Se as cerejeiras referidas no texto são transgênicas.) Pelas informações fornecidas no texto. Questão 374 Em relação à crença da população sobre o processo de transmissão de características hereditárias. Da mesma forma... pois os genes estão presentes apenas nas células sangüíneas e nas células germinativas. Segundo a bióloga Josefa da Silva.. podemos afirmar que: a) no século XIX.. INICIA A CAMPANHA NACIONAL DE VACINAÇÃO CONTRA SARAMPO E TUBERCULOSE... b) a população não está tão equivocada. O destaque da campanha de vacinação. uma vez que células sangüíneas não apresentam as estruturas básicas que guardam as informações genéticas..

d) apenas III. Questão 379 Analise os dados apresentados a seguir. ( ) No local onde houver um ribossomo. que trata dos tipos e percentuais de gametas produzidos por um indivíduo de genótipo não divulgado (indivíduo parental).c) núcleo .4% 78 1..seqüência de nucleotídeos . ( ) é um caso de polialelia com epistasia recessiva. Ill .4% Ab = 2.RNA mensageiro e) citoplasma .6% ab = 47.RNA mensageiro d) núcleo .. dando formação. pode(m)-se afirmar: I . Um pesquisador apresentou a seus alunos o heredograma a seguir. ( ) trata-se de um caso de herança parcialmente ligada ao sexo. ao final da leitura do RNAm. ( ) Os diversos aminoácidos unem-se através de ligações do tipo éster. ( ) trata-se de um caso de herança ligada ao sexo.O alelo responsável pela "casca roxa" será considerado dominante em relação ao alelo que determina a "casca verde".RNA transportador Questão 376 A partir das informações do texto. II .proteína . unem-se ao RNAm por uma seqüência de três bases . Sabendo-se que os indivíduos afetados estão representados em negrito e os normais em branco.. Esta(ão) correta(s) a) apenas I. relativo a uma certa doença observada por ele em humanos.seqüência de aminoácidos . Questão 377 O texto abaixo refere-se às questões: ** a ** Na(s) questão(ões) a seguir escreva nos parênteses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. pode-se afirmar: ( ) a doença é causada por um alelo recessivo. ( ) O processo de síntese de proteínas a respeito do citoplasma é também conhecido como transcrição genética. Questão 378 As proposições a seguir são relativas ao processo de síntese de proteínas nas células vivas. c) apenas I e II. ( ) Cada códon do RNA mensageiro determinará a colocação de um aminoácido específico na cadeia polipeptídica. a uma proteína funcional..1.os códons.)".5.)" e "As formas mutantes (obtidas) para esse loco (..As mutações responsáveis pelas cores da cereja ocorreram em vários cromossomos. ligadas a aminoácidos. ( ) a doença é causada por um alelo dominante.Se a coloração branca for recessiva.6% aB = 2..4 . pequenas moléculas de RNA transportador (RNAt).) mutação no gene responsável pela produção de pigmento (. "(.o anticódon. AB = 47. ( ) A molécula de DNA transcreve no núcleo uma molécula de RNA mensageiro (RNAm) com várias seqüências de três bases . b) apenas II. e) apenas II e III. será possível obter plantas com frutos coloridos a partir do cruzamento de plantas com frutos brancos. se uma planta heterozigota para esses alelos apresentar frutos com a casca roxa.

organizador. W e Y Questão 381 Se a vaca Y. Retirou-se um óvulo da vaca Z. ( ) Considerando que 5. diferencia-nos. alemães. uma mistura de índios. mãe de aluguel. a) Z. e) apenas II e III. 79 . deixaram-nos um legado que. a porcentagem de genes da "mãe de aluguel" presente no clone será a) 0 % b) 25 % c) 50 % d) 75 % e) 100 % Questão 382 A história da maioria dos municípios gaúchos coincide com a chegada dos primeiros portugueses. obtendo-se um óvulo anucleado. utilizada como "mãe de aluguel". Nosso chimarrão nos identifica em qualquer parte do mundo. ou seja. Questão 380 O texto abaixo refere-se às questões: ** a ** A seqüência a seguir indica de maneira simplificada os passos seguidos por um grupo de cientistas para a clonagem de uma vaca: I. b) apenas II. uma cadeia de nucleotídeos em que as bases nitrogenadas interagem. um heterozigoto "Cis". como os Kaingáng. A. 2004). determinando uma distribuição 1:1:1:1: ( ) 5. W e Y não têm parentesco. O núcleo da célula da glândula mamária foi introduzido no óvulo anucleado. sabemos que outros povos. "o índio". pode-se inferir que ocorreu quiasma entre os locos "A" e "B" em 94. c) apenas III. ( ) O indivíduo parental é um heterozigoto AB/ab e. O núcleo foi desprezado. pode-se afirmar que o animal resultante da clonagem tem as características genéticas da vaca. portanto. formando ligações fosfo-diéster. ( ) O indivíduo parental é um heterozigoto aB/Ab. IV. através dos vestígios materiais encontrados nas pesquisas arqueológicas. for a mãe biológica da vaca W.2% dos gametas são recombinantes. um heterozigoto "Trans". III. muitas vezes. protagonizaram a nossa história. Ainda hoje.( ) Trata-se de um caso de genes de segregação independente. nucleotídeos que são compostos por uma base nitrogenada. apenas b) W. uma pentose e um radical "fosfato". italianos e de outros povos. duas cadeias polinucleotídicas paralelas e complementares entre si. Está(ão) correta(s) a) apenas I. o embrião foi implantado no útero de uma terceira vaca Y. portanto é formado por I.8% das células meióticas que originaram estes gametas. B. A célula reconstituída foi estimulada para entrar em divisão. III. anteriores aos citados. No entanto. através dos pareamentos de aminoácidos. Santa Cruz do Sul: EDUNISC.2% dos gametas apresentam combinações alélicas diferentes daquelas existentes nos cromossomos do indivíduo parental." O DNA presente nas mitocôndrias tem composição e estrutura típicas desse tipo de ácido nucléico. d) apenas I e II. ainda hoje. Após algumas divisões.. as três raças se mesclam em nossos descendentes. apenas e) Z. brancos e negros. "Nossos ancestrais. Retirou-se uma célula da glândula mamária da vaca W. convivemos com grupos indígenas. II. IPHAN. apenas d) Z e da W. L. apenas c) Y. O núcleo foi isolado e conservado. O embrião se desenvolveu e deu origem ao clone. Considerando-se que os animais Z. desprezando-se o resto da célula. II. foi selecionada a área temática CULTURA e as questões foram construídas com base na obra "Os Primeiros Habitantes do Rio Grande do Sul" (Custódio. Diante da relevância do contexto e da vontade de valorizar o nosso povo nativo.

b) adição de um par de bases no DNA. e) José ou Pedro. Doença pode ser definida como um desequilíbrio do organismo ou ausência de bem-estar físico e mental. Rh®. mas não da proteína correspondente. Questão 385 O esquema a seguir mostra a seqüência do DNA que leva à formação da hemoglobina normal e a que leva à formação da hemoglobina alterada. sem alteração do aminoácido codificado. a freqüência do gene a) S permanece constante. Questão 384 Verificou-se que em populações de regiões onde a malária é endêmica. c) Pedro. os heterozigotos (Ss) são mais resistentes à malária do que os normais (SS). circula pelo coração. Rh−. sem alteração do aminoácido codificado. José tem tipo AB. conseqüentemente. com alteração do aminoácido codificado. Supondo populações africanas com incidência endêmica de malária. o Ss apresenta anemia atenuada e o ss geralmente morre. tem um filho O. Questão 386 O sangue. c) O indivíduo Ss leva vantagem em relação ao SS. c) S tende a aumentar. Questão 387 O texto abaixo refere-se às questões: ** a ** Na(s) questão(ões) a seguir escreva nos parênteses a soma dos itens corretos. com tipo sangüíneo O. nutrientes etc. e) inversão de um par de bases no DNA. b) José. com alteração do aminoácido codificado e da proteína correspondente. d) Quando a malária for erradicada. b) O indivíduo ss leva vantagem em relação ao SS. Considere os segmentos de DNA a seguir: rata-se de um caso de mutação por a) perda de um par de bases no DNA. O indivíduo SS é normal. Ela 80 . Rh−. É condicionada por um alelo mutante s.5. Um adulto de peso médio tem cerca de 5 litros de sangue em circulação. d) inversão de um par de bases no DNA. Rh®. Rh® e Pedro é A. EXCETO: a) A malária atua como agente seletivo. d) s permanece constante.Questão 383 O texto abaixo refere-se às questões: ** a ** 1. onde a anemia falciforme não sofra influência de outros fatores e onde novas mutações não estejam ocorrendo. artérias. b) S tende a diminuir. O geneticista consultado informou que o pai pode ser a) João. Nesse caso são verdadeiras as afirmações a seguir. sem alteração do aminoácido codificado. d) João ou José. mas tem dúvidas sobre qual dos três namorados é o pai da criança: João tem tipo sangüíneo A. e) s tende a aumentar.3 A anemia falciforme ou siclemia é uma doença hereditária que leva à formação de hemoglobina anormal e.9. que é constituído por plasma e algumas células especializadas. c) inversão de um par de bases no DNA. vasos e capilares transportando gases. e) Quando a malária for erradicada. haverá mudança na freqüência gênica da população. ser heterozigoto deixará de ser vantagem. de hemácias que se deformam. Uma mãe.

como o albinismo. sem alelos A e D. (64) A b D Soma ( ) Questão 389 Clones são seres vivos obtidos pelo desenvolvimento de células retiradas de indivíduos já existentes. Sobre esse processo é CORRETO afirmar: (01) Os clones são como irmãos gêmeos fraternos do doador das células. seu clone possuirá. sem alelos B e D. enquanto a eritroblastose fetal é uma doença congênita. podendo resultar em fratura de ossos. Com relação a esse tema. independentemente do sexo. encontra barreiras de ordem ética. casado com uma mulher homozigota normal. 81 . No homem. certamente será hemofílica. Questão 391 Em parte motivada pela necessidade mundial de aumentar a produção de alimentos. (08) Doenças funcionais resultam do mau desempenho ou da perda de um órgão ou sistema. A clonagem é um processo que vem sendo desenvolvido rapidamente com vários organismos e. (32) O mongolismo é um exemplo de doença hereditária. também. em humanos. sem alelos A e B. Com base nesta informação. o gene (h) para hemofilia está localizado no cromossoma X e é recessivo em relação ao gene (h+) para coagulação normal do sangue. terá 50% de seus filhos afetados. (08) Órgãos transplantados do clone para o doador das células serão sempre rejeitados. um indivíduo portador do genótipo ABD//abD poderá produzir os seguintes gametas: (01) Portador apenas de A ou a. usando técnicas sofisticadas. (16) Doenças transmissíveis são as transmitidas por patógenos ou por seus produtos. filha de um indivíduo hemofílico. escreva no espaço apropriado a soma dos itens corretos. terá todos os seus filhos normais. através do material genético. hemorragias. (32) Se o doador de células sofrer a perda de um membro antes de ser realizada a clonagem. é CORRETO afirmar: (01) O alcoolismo. (02) Uma mulher. casado com uma mulher homozigota normal. Soma ( ) (04) Se o doador das células possuir um defeito genético. (02) O material genético do doador das células e do clone é idêntico. Soma = ( ) Questão 388 Considerando inclusive a possibilidade de permuta genética. (02) a b D (04) portador apenas de B ou d. A probabilidade desta mulher ter uma criança do sexo masculino e hemofílico é igual a 1/4. (08) Um homem hemofílico teve uma filha normal. independentemente do sexo. etc. Soma ( ) Questão 390 O texto abaixo refere-se às questões: ** a ** Na(s) questão(ões) adiante. é correto afirmar: (01) Um homem hemofílico. (02) Doenças genéticas são aquelas causadas por alterações do patrimônio genético e podem passar de pais para filhos. Muitas vezes. os cientistas provocam modificações nessas espécies em busca de seus benefícios e atuam à semelhança da natureza. por esse processo. a ciência do melhoramento genético procura encontrar soluções que aumentem a produtividade de certas espécies.pode ter inúmeras causas e variar de intensidade e manifestação. Leia o texto adiante e compare-o com o esquema. essa anomalia. o organismo originado posteriormente. (16) Já existem seres humanos que foram originados e desenvolvidos plenamente por clonagem. nascerá sem o referido membro. (08) A B D (16) a B D (32) portador apenas de D. (04) Doenças traumáticas são aquelas que se originam de acidentes. (04) Um homem hemofílico. o tabagismo e a dependência de outras drogas são exemplos de causas que podem resultar em doenças.

1/8. em um tipo de organela de suas células. que liderou uma pesquisa genética sobre a composição étnica do povo brasileiro. a inativação de qualquer um dos componentes ou operadores do sistema de checagem ou de apoptose poderia provocar a proliferação contínua das células e possível desenvolvimento de tumores cancerosos. 2 e 4 do esquema. Este. Qual é o genótipo dos pais da criança descrita no texto e qual a probabilidade de o casal ter outro filho com essa mesma doença? a) AA x aa. Essa proteína. escolheram e reproduziram aquelas cujas plantas apresentassem a capacidade de produzir uma proteína inseticida" está relacionada aos itens 3 e 4 do esquema. (04) A afirmativa "nos testes experimentais. a produtividade das lavouras será bem maior. Esse problema pode ser evidenciado no dia-a-dia. escolheram e reproduziram aquelas cujas plantas apresentassem a capacidade de produzir uma proteína inseticida" está relacionada aos itens 4 e 5 do esquema. pois a criança não possui. ou morte celular espontânea. b) Aa x aa. é monogênica com herança autossômica recessiva. concedida à Revista Galileu pelo cientista Sérgio Danilo Pena. as enzimas que deveriam proteger contra a ação dos radicais livres. Entre S/G‚ algumas proteínas checam possíveis falhas e erros na linha de produção.2 (01) A afirmativa "Os cientistas alteraram o código genético dessas sementes" está relacionada somente ao item 1 do esquema. Um exemplo observável das conseqüências de apoptoses é o descamar da pele após sua exposição prolongada a radiação solar intensa. Soma = ( ) O ciclo celular é interrompido entre as fases G/S e G‚/mitose." (Veja. é correto afirmar: Questão 392 Uma criança de aproximadamente 1 ano. batata e algodão alteradas geneticamente em laboratório. d) Aa x aa. Os cientistas alteraram o código genético dessas sementes e. Livre dos mesmos. Diz também que a doença é muito grave. (08) A afirmativa "nos testes experimentais. a H‚O‚ "não ferve". 1/4. 1/2.15. GALILEU: "É correta a noção de que a maior parte dos 82 ."Nos próximos meses chegam às lavouras dos Estados Unidos e Canadá sementes de milho. (16) A afirmativa "Livre dos mesmos. 21/02/1996) Da comparação entre o texto e o esquema. O geneticista clínico explica aos pais que a criança tem uma doença de origem genética. e) Aa x Aa.5. (02) A afirmativa "Os cientistas alteraram o código genético dessas sementes" está relacionada aos itens 1. matava os insetos que atacavam as plantações. Portanto. com acentuado atraso psicomotor. é encaminhada pelo pediatra a um geneticista clínico. ao se colocar H‚O‚ em ferimentos. a produtividade das lavouras será bem maior" refere-se ao item 6 do esquema. após alguns exames. decidem se o ciclo celular avança ou é paralisado iniciando um processo de destruição do material genético. conhecido como APOPTOSE. constata que a criança possui ausência de enzimas oxidases em uma das organelas celulares. c) Aa x Aa. nos testes experimentais. Questão 393 1. 1/8. Abaixo está transcrito um pequeno trecho de uma recente entrevista. 1/4. e proteínas especiais controlam a evolução do ciclo celular das novas células. quando ingerida com as folhas. da Universidade Federal de Minas Gerais. No caso dessa criança. para destruir as pragas que atacam essas culturas. escolheram e reproduziram aquelas cujas plantas apresentassem a capacidade de produzir uma proteína inseticida.

que tagarela pedantemente com Péricles ou com Hércules? Na "História do mundo para as crianças". uma porção de coisas que aprenderam com as personagens do Sítio do Picapau Amarelo. Benta acerca da clonagem e dos transgênicos? 4." Que diria hoje D. pelos assírios e babilônios. a adaptar-se. Meu caso é exatamente esse. pelo império romano. do carvão. dos moinhos. do petróleo.. Quixote" é alegre e comovente." A resposta do geneticista aliada aos seus conhecimentos permite afirmar. Tudo quanto existe levou milhões de anos a formar-se.. d) Pelo estudo acima. Em "A reforma da natureza". o homem continua brincando. Questão 394 Instruções: Leia atentamente o texto adiante para responder às questões a seguir. seu "Hans Staden" 83 . quando marmanjos. só o tempo pode curar o grande defeito da humanidade . reformar a natureza! Quem somos nós para corrigir qualquer coisa que existe? E quando reformamos qualquer coisa. telefone. Em "Emília no país da Gramática". em 1941. aparecem logo muitas conseqüências £que não previmos. jorra o precioso óleo em pleno sítio... não custa lembrar que a campanha nacionalista de Lobato.Que peste é a tal Gramática!". fazendo coro com os alunos: ". Também um iniciante na Física não pode se queixar. nas expressões. que incluía a exploração estatal do "ouro negro" (como também a do ferro). MONTEIRO LOBATO (1882-1947) 1. passariam a citar de boca cheia. das dragas (com as quais se escavou o Canal do Panamá). existem mil razões para isso. Quanto da história e da mitologia grega não se aprende ao lado da boneca Emília. as experiências realizadas por Emília e pelo Visconde geram monstros: ¢alteram o funcionamento de "Dona Pituitária" em insetos. cinema . pelos tempos da cavalaria. e às vezes sem confessar. vai-se da origem do universo (sabiamente explicada pela vovó Benta como hipótese). Emília é uma abelhuda crítica e irreverente. e seus brinquedos são cada vez mais fantásticos e perigosos. Sempre foi intenção de Lobato ensinar sem ser chato. de formação e de classes de palavras. inesquecíveis companheiras de aventuras por vários tempos e espaços.e com o manejo atômico que deu na tragédia de Hiroshima. nas seqüências e nas funções ... até à chamada "era dos milagres". pelas revoluções do século XVIII. que termina com esta frase da vovó sabida: "O tempo. lendo a "História das invenções": são sugestivas as explicações sobre a operação das alavancas (que permitiu ao homem a construção das pirâmides). epílogo também do livro. 3. proporções e propriedades. As obras "infantis" de Monteiro Lobato ajudaram muito na formação de milhares de pequenos brasileiros que. há esta frase da boneca que muito lingüista moderno poderia adotar como lema. opinar sem ser pretensioso. espantando os vizinhos e provocando em D. Se Dona Benta é uma velha de óculos e muita leitura. custou-lhe seis meses de cadeia.. Quanto ao petróleo. que é como Lobato batizou a vida com luz elétrica. passando pelo uso do fogo. pelos hieróglifos. somente o genoma de indivíduos do sexo masculino pode ser utilizado para a determinação da ancestralidade paterna. Benta uma verdadeira manifestação ecológica: ". b) O DNA mitocondrial é de origem materna. o jovem leitor lamentará que Lobato não tenha entrado na Álgebra e na Geometria. e se está no ponto em que está.. qualquer um admirará a facilidade com que se explica a formação e as propriedades do vidro. que assim adquirem novas formas. dos guindastes. onde não faltam lições de fonética. As adaptações que faz Lobato de obras ficcionais ou a recuperação de fatos históricos são também notáveis: seu "D.brasileiros tem algum antepassado com pai branco europeu e mãe negra ou índia ?" PENA: "É. num período especialmente sombrio da história do nosso país e trágico da história universal. Nesse mesmo livro.que é ser muito criança ainda". das roldanas. Já depois de ler a "Aritmética da Emília".Mas que absurdo. Emília. e não falta a chegada do técnico norte-americano para tentar tomar conta da situação e acabar escorraçado pelos indignados habitantes. Em "O poço do Visconde". Meu cromossomo Y é europeu e meu DNA mitocondrial é ameríndio. c) O cromossomo Y apresenta genes exclusivamente paternos. 2. Dona Benta (permito-me eu). EXCETO: a) O DNA do cromossomo Y e das mitocôndrias apresenta genes que determinam a cor da pele humana.para que o escritor lhe apresentasse alguns dos "bichos de sete cabeças" da Matemática com a mesma graça e eficácia com que iniciara os meninotes nas frações e nos números complexos. nas equações de todos os graus.

introduz o leitor num capítulo importante de nossa história colonial. c) transgênico útil para a erradicação da leishmaniose. 1996. Se nada mais sobrasse da obra de Lobato. dizem alguns. a Inglaterra seria um quase nada. cada aspecto da vida de nossas células é regulado por seu DNA. tudo parece fazer parte de uma didática natural. Sempre haverá a curiosidade nossa de saber o que Emília pensaria hoje da globalização. a célula começa a destruir todo o DNA de seu núcleo. como o fora antes da invenção de Watt". De certa forma. A apoptose. Sem isso. foi o que deu a vitória aos ingleses. partindo-o em milhares de pedaços que não mais conseguem enviar instruções úteis à célula. Benta" acerca da "clonagem" e dos "transgênicos"? Atualmente ela teria notícias freqüentes sobre técnicas de manipulação do DNA. que morre e sofre queratinização.combinação que. uma célula morta pelas toxinas produzidas por bactérias invasoras. uma célula da camada germinativa da epiderme. Lobato parece ter querido reunir a beleza natural do primitivo ao encantamento pelo enciclopédico. O leitor que percorra essa obra notará. Clark. As últimas instruções do DNA. reuniu a seu modo as realidades de um país ainda arcaico e já moderno. está fadada a morrer.. resume algo de nosso "temperamento". das ações terroristas. (04) DOMINANTE é um dos membros de um par de alelos que se manifesta inibindo a expressão do outro. dispondo-se a dali falar de tudo e a contar qualquer história (numa linguagem ao mesmo tempo exata. d) clonado útil para a erradicação da malária. o quanto ela tem de orgânico." (Traduzido e adaptado de: William R. "mais o ferro. incluindo sua própria morte. referem-se à morte da célula.. humor e vivacidade crítica . (Eurípides de Souza e Passos. se vivesse nos dias de hoje. dos conflitos religiosos. imaginativa e fluente. enviadas ao citoplasma. New York: Oxford University Press. Esta. contradição nossa até hoje. II. Bolívar e Lincoln. 32-5) Considere os seguintes fatos: I. 5. Logo que essas instruções sejam recebidas e processadas. provavelmente estaria batalhando pelo desenvolvimento sustentável. e) clonado útil para a erradicação da leishmaniose. 7. SEX AND THE ORIGINS OF DEATH. p. III. nem falta a apresentação de personagens como Marco Polo. O que espanta nessa pluralidade é que nada surge como aleatório. conhecido por suas frases lapidares. 6. b) transgênico útil para a erradicação da esquistossomose. processo este decididamente irreversível. forjado no caldeirão de raças e culturas de que procedemos. é verificada SOMENTE em a) I b) II c) III d) I e II e) I e III Questão 396 Na(s) questão(ões) a seguir escreva no espaço apropriado a soma dos itens corretos. apesar de poder continuar exercendo determinadas funções durante certo tempo. essa vivíssima boneca de pano expressaria sempre um fundamento de malandragem. em muitos pontos. proveitosa e sempre polemizada pela palpiteira Emília. Questão 395 "Virtualmente. Assinale as alternativas que trazem o significado correto de cada um desses termos: (01) GENE é sinônimo de molécula de DNA. 84 . Um exemplo delas constitui a matéria publicada recentemente em um jornal. (02) GENÓTIPO é a constituição genética de um indivíduo. por exemplo à máquina a vapor. sem concessões à famigerada "literatura infantil"). uma célula do miocárdio morta por falta de oxigênio durante um ataque cardíaco. . Ao instalar suas criaturas numa base rural. Soube admirar tanto a mangueira frondosa quanto a técnica fecunda. Esse exemplo refere-se à construção de um organismo a) transgênico útil para a erradicação da malária. segundo a qual cientistas ingleses estão conseguindo transferir certos genes de bactérias para mosquitos anofelinos. inédito) Que diria hoje "D. ou morte programada das células. em outro esse invento vem associado ao carvão-de-pedra que. Os termos a seguir fazem parte da nomenclatura genética básica. da difusão de novas seitas. Estes genes teriam a capacidade de impedir a instalação de determinadas fases do protozoário 'Plasmodium' no estômago e nas glândulas salivares do mosquito. Se num livro o autor se referia.

"o fogo de constelações extintas há milênios" . Acho injusto. nunca voltaria para o dono. da guilhotina francesa. trechos literários. dita em tom pejorativo. Eu não trocaria três exemplares do almanaque de um certo biotônico pela coleção completa das SELEÇÕES. leitor . anedotas. Se fico sem assunto.uma espécie de almanaque de luxo. esse almanaque multidisciplinaríssimo de última geração. mas ainda hoje me valho das informações de almanaque para explicar. astúcias da matemática. Algum risco sempre havia: não foi boa idéia tentar fazer algumas experiências químicas com produtos caseiros. Pense em algo publicável. vi e venci" e "até tu. Pegadinhas do tipo "quais são os números que têm relações de parentesco?" ou questões como "por que uma mosca não se esborracha no vidro dentro de um carro em alta velocidade?" não eram bem-vindas. move-se!". 2. de circulação regular e internacional. porque despertavam a classe sonolenta. a separar as chamadas áreas do conhecimento. as SELEÇÕES talvez tenham sido o principal meio de difusão do AMERICAN WAY OF LIFE. Já ouvi a expressão "cultura de almanaque".(08) FENÓTIPO é a expressão do gene em determinado ambiente. a relação que Pitágoras encontrou não apenas entre catetos e hipotenusa. Um outro ensinava a fazer balão e pipa. a concretização editorial do SLOGAN famoso: TIME IS MONEY. Adolescente. pelo qual já se entrevia uma América (como os EUA gostam de se chamar) com ares de dona do mundo. O leitor não faz idéia do que cabia nesse etc. com base no almanaque. e se nunca os fiz subir ou rodar era porque meu controle motor já não dava inveja a ninguém. Pouco depois dos almanaques vim a conhecer as SELEÇÕES . Talvez não seja inútil conhecer as dimensões das três pirâmides. conhecia todas as propriedades de uma carnaubeira. enigmas policiais. Sim.: charadas. caricaturas. e lá estava. se viesse a cair dentro de uma.entre o sentimento da melancolia e o funcionamento do fígado. Não tinha o charme dos almanaques: levava-se muito a sério. das angústias de Colombo em alto mar. e minha professora de História fingiu que não me ouviu quando lhe perguntei de quem era mesmo a frase "E no entanto. O "buscador" da HOME PAGE é uma espécie de oráculo de Delfos de efeito 85 . além do calendário do ano. por exemplo. poesias. receitas caseiras. da queda de Ícaro. Deixei de lado os almanaques e entrei no funil apertado das tendências vocacionais. as matérias tinham um tom meio autoritário e moralista. o descompromisso macunaímico dos nossos almanaques em papel ordinário. Não tinha a galhofa. Tirando Hollywood.pasme. mas . Um bom leitor de almanaque explica como uma bela expressão de Manuel Bandeira .é também uma constatação da astrofísica.READER'S DIGEST . Almanaque não se emprestava a ninguém: ao contrário de um bumerangue. do fracasso de Napoleão em Waterloo. a que vem ao caso: folheto ou livro que. horóscopo. de novo. Como explicar ao meu leitor mais jovem o que é (ou o que era) um ALMANAQUE? Vamos ao dicionário. entro na Internet. o humor era bem-comportado. curiosidades etc. Lembro-me de um exemplar que falava com tanta expressão da guerra fria e de espionagem que me proporcionou um prazer equivalente ao das boas páginas de ficção. provérbios. E alguns professores sempre implicavam quando eu os contestava ou argüía. dicas de viagem. descobri este emprego de cronista que me abre.. Meu professor de Ciências fechou a cara quando lhe perguntei se era hábito de Arquimedes tomar banho na banheira brincando com bichinhos que bóiam. (16) GENOMA é o conjunto de todos os alelos de um indivíduo. da reunião do meu condomínio ou da assembléia da ONU. palavras cruzadas. Lá está. a manejar um pião. "vim. Com o tempo. misturava povos e séculos com grande facilidade. E me arrepiava a descrição do ataque à base naval de Pearl Harbor. Em compensação. 6. 4. Agora sou autor do meu próprio almanaque. traz diversas indicações úteis. ou a história de expressões como "vitória de Pirro". o curso e o regime do rio São Francisco. que eu achei familiar quando a li pintada no pára-choque de um fordinho com chapa 1932 (relíquia de um paulista orgulhoso?). fazia prodígios com ímãs e saberia perfeitamente reconhecer uma voçoroca.. 5. Soma ( ) Questão 397 Cultura dos almanaques 1. 3. todas as portas do mundo: posso falar da minha rua ou de Bagdad. do meu canteirinho de temperos ou da safra nacional de grãos. aprendi a me especializar nas disciplinas curriculares. Brutus?". entre outras acepções. recordes mundiais.

diria que. especialmente durante a transcrição e a tradução.. cerca de 8% da produção nacional da soja é biologicamente adulterada. O equivalente tecnológico da separação dos saberes foi a linha de montagem. Segundo a "Folha de S. aparece a verdadeira doença do progresso. assistiu-se ao triunfo das teorias revolucionárias de Einstein e a seu questionamento.contaminantes biológicos. por ser mutagênico. NO GAIN (ou GAME.impedir o funcionamento dos ácidos nucléicos. os regimes dos Grandes Irmãos e dos Pequenos Pais. O século que chega ao fim é o que presenciou o Holocausto. Mas a linha de 86 . E o inglês. no caso deles). Se eu fosse um nostálgico.. os massacres do Camboja e assim por diante. c) Pode haver cruzamento entre a cultura convencional e a geneticamente modificada. que podem ser exemplificados pelos esteróides. o sentido de outro SLOGAN prestigiado. b) O mercado europeu é resistente a este tipo de alimento. na prática. e os hormônios humanos. tanto mais fácil submeter a ciência aos cálculos do poder. e) I. triunfo das massas. Em algumas dezenas de anos. os velhos almanaques me deixaram saudades. mas não possui mais o saber que lhe permitiria dar-se conta de que seu produto irá provocar um buraco na camada de ozônio. deve I . cada um conhece apenas uma fase do trabalho. O custo dessa aceleração da descoberta é a hiperespecialização. (Argemiro Fonseca) A produção brasileira de grãos ultrapassou 115. de alimentos geneticamente modificados. b) apenas II.2 milhões de toneladas na safra 2002/03.quase instantâneo. enfim.aumentar as taxas de mutação em todos os seres vivos. O benzeno. Hiroshima. Estamos em via de viver a tragédia dos saberes separados: quanto mais os separamos. podem interferir no funcionamento dos seres vivos. que.Paulo" de 23/09/03. Privado da satisfação de ver o produto acabado. e) O desenvolvimento desta tecnologia poderá aumentar a produtividade em relação à tradicional. Mas o horror desses acontecimentos não reside apenas na quantidade. que se operou e continua a se operar em ritmos antes inconcebíveis. o que representaria uma vantagem comercial ao país que os proíbe. Holocausto: através das metáforas e das realidades que marcaram esses cem últimos anos. que é um agente mutagênico. da hélice ao turborreator e daí ao foguete interplanetário. d) apenas I e II. no Brasil. Um excelente químico pode imaginar um excelente desodorante. é assustadora. comunicação. Esse fenômeno está intimamente ligado ao fato de ter sido neste século que os homens colocaram mais diretamente em questão a sobrevivência do planeta. e em algumas décadas se passou do dirigível ao avião. cada um é também liberado de qualquer responsabilidade. não apenas no homem. Poderia produzir venenos sem que o soubesse . II . de 96. III . podendo acarretar o fim da espécie convencional. Questão 399 O texto abaixo refere-se às questões: ** a ** Ação à distância. Está(ão) correta(s) a) apenas I. apesar de todo esse avanço. Não é um balanço tranqüilizador. se globalizou pra valer: meus filhos já aprenderam. linha de montagem. certamente. Questão 398 A qualidade da água pode ser alterada por vários fatores: . Mas não sou. Parte dessa safra refere-se à produção da soja. Nesta. . c) apenas III. como podeis ver.compostos orgânicos que. II e III. por alterar a seqüência de nucleotídeos do DNA. Foram necessários milhares de anos para passar do barco a remo à caravela ou da energia eólica ao motor de explosão. como o benzeno. que podem transformar as águas em fontes de transmissão de doenças.e isso ocorre com freqüência. Assinale a alternativa que contém argumentos favoráveis à produção. Nosso século é o da aceleração tecnológica e científica. velocidade. a) Há muitas dúvidas sobre eventuais danos à saúde do consumidor provocados pelas alterações genéticas nos alimentos.permitir o surgimento de novos alelos.5 milhões de toneladas. NO PAIN. o que significa uma elevação de 19% em comparação à colheita anterior. mesmo em baixas concentrações. d) Pode haver efeitos sobre várias espécies de insetos protetores da flora e de polinizadores.

Eis porque nosso século foi o da angústia e da utopia de curá-la. elas poderão apresentar uma reação denominada a) hemólise. Reflexões para o futuro. Assim. e) reforço do sistema imunológico. de pessoas responsáveis e de executantes diretos (sádicos e loucos). Espaço. Aperta-se um botão e um país inteiro explode. No texto. Hoje. A um ritmo de STRESS.. Se forem novamente picadas. O século do triunfo tecnológico foi também o da descoberta da fragilidade. descoberta. Ciência. IV . c) choque térmico. o autor menciona que não conseguimos eliminar os resíduos radioativos do ambiente. E rápido. aperta-se um botão e entra-se em comunicação com Pequim. ação à distância. que podia ser reduzida. num regime de separação dos saberes. onde foi abandonada uma cápsula contendo pó de Césio-137 e que foi aberta por pessoas desavisadas. que sofreram graves danos em conseqüência desse ato. A perseguição racial e o genocídio não foram uma invenção de nosso século. presenciou o triunfo da ação à distância. mas pagamos o preço dessa rapidez. crime. Um exemplo ocorreu em 1987. o Muro de Berlim poderia ter durado milênios.. quando picadas por abelhas. estão corretas SOMENTE a) I e II b) I e III c) II e IV d) I. Mas o que torna tão terrível o genocídio nazista é que foi rápido. tecnologicamente eficaz e buscou o consenso servindo-se das comunicações de massa e do prestígio da ciência. Sem essa aceleração. arrependimento. herdamos do passado o hábito de brandir a ameaça de um complô judeu para desviar o descontentamento dos explorados. Aperta-se um botão e um foguete é lançado a Marte. III . É bom que tudo se tenha resolvido no espaço de trinta anos. Tudo se passa num ritmo acelerado. d) embolia. Poderíamos destruir o planeta num dia. mas o sistema do computador não tem defesa diante da má intenção de um garoto precoce. O Holocausto foi possível porque se podia aceitá-lo e justificá-lo sem ver seus resultados. castigo. crítica. 25 anos.A energia provocou alterações nos compostos químicos das células. vida mais longa.montagem permite também fabricar aspirina em quantidade para o mundo todo. Rápida Utopia. 1993). comunicação. o químico que aplicava os gases asfixiantes não julgava necessário ter opiniões sobre a antropologia física. b) choque anafilático. Foi fácil fazer passar por ciência uma teoria pseudocientífica porque. Além de um número. A ação à distância salva numerosas vidas. princípio da linha de montagem: tudo isso tornou possível o Holocausto. 87 . mas irresponsabiliza o crime. como a Grande Muralha da China. sem grande inovação. este século soube fazer do melhor de si o pior de si. absolvição. Porque a sujeira nascia da indigência. desconhecido dos séculos anteriores. morte. Nosso século é o do enfarte. ao passo que os resíduos (inclusive os radioativos) nascem do bem-estar que ninguém quer mais perder. em Goiânia. realizando cada qual um gesto que nada tinha de aterrador. O século está estressado porque não sabe de quem se deve defender. como por exemplo. São Paulo. Tudo o que aconteceu de terrível a seguir não foi se não repetição. III e IV Questão 400 Apesar da "aceleração tecnológica e científica de nosso século" nem todos os problemas puderam ser solucionados. Um moinho de vento podia ser reparado. afinal restrito. Encontramos o meio de eliminar a sujeira. milhões de outros puderam colaborar à distância. mas não o de eliminar os resíduos.As células reagiram e. especialmente por um grande número desses insetos.As células humanas estão adaptadas a receber energia com os comprimentos de onda do Césio-137. sob a forma de calor. VEJA. tecnologia. esquecimento. Dessas explicações. nascimento. II e III e) II. informação. devolveram essa energia para o ambiente. Nosso século foi o da comunicação instantânea. apresentarem uma reação alérgica à toxina desses animais. deram-se as seguintes explicações: I . nem como: somos demasiado poderosos para poder evitar nossos inimigos. tempo.As emissões radioativas introduziram energia nas células. II . o fato de certas pessoas. (Adaptado de Umberto Eco. tudo em altíssima velocidade. indignação. Para tais conseqüências.

com a intenção de mostrar os efeitos ambientais produzidos por aquela atividade. uma vez que na concepção de Jamie foram empregadas técnicas de fertilização in vitro. 1Ž Filho . (Leite. de fato. b) a expressão do gene depende da presença de hormônios masculinos. 1Ž Filho . 2Ž Filho . 1Ž Filho . da mãe.rr. Jamie é o que já está sendo chamado de "irmão salvador" pelos tablóides (jornais populares) do Reino Unido. d) a mulher só será careca se tiver os dois alelos recessivos. professor Astrogildo perguntou-lhe se seria seu primeiro filho. uma vez que o embrião.Rr. Vamos!" A turma entrou muito animada no ônibus e Ariosvaldo percebeu que o motorista era calvo.Rr. Paulo. III e IV representam moléculas de ácidos nucléicos. Folha de S. os genótipos do pai das crianças.. 2Ž Filho .. onde. o seu filho nasceu normal e. Algumas das questões propostas por professor Astrogildo estão apresentadas a seguir para que você responda. Questão 404 Aproveitando a pergunta de Zeca. M. Questão 402 O texto abaixo refere-se às questões: ** a ** Professor Astrogildo combinou com seus alunos visitar uma região onde ocorria extração de minério a céu aberto. uma criança gerada para fornecer tecidos vivos para tentar salvar a vida de outro filho de seus pais. b) Pai . c) não se trata de uma questão que envolva biotecnologia e bioética. se dá o desenvolvimento do feto. Ariosvaldo refletiu e perguntou: "Professor. 2Ž Filho . na segunda. embora envolva questões de biotecnologia.Rr. 2Ž Filho . depois de selecionado.2003. Mãe .RR. c) a calvície é uma característica genética cuja herança é ligada ao sexo.Rr. Mãe .) Em relação ao texto. pois não envolve escolha de genótipo de seres humanos.Rr. Ela o informou de que já era sua terceira gestação.5. Isso ocorre porque a) o gene responsável pela calvície está no cromossomo Y. Mãe . professor Astrogildo ia propondo desafios a partir das situações do dia-a-dia vivenciadas ao longo do passeio. o professor esquematizou o processo de síntese protéica. o texto nos coloca diante de situações concretas de biotecnologia e de bioética. e) não se pode associar a fertilização "in vitro" com biotecnologia ou com bioética. por que não se vê mulher careca?" O professor respondeu que a ocorrência de calvície em mulheres era muito rara.Rr.rr. a criança teve eritroblastose fetal.rr. c) Pai .3 88 . Nessa situação. b) o fato relatado. "Já está na hora de voltar. Durante o trajeto. O motorista está buzinando. nada tem a ver com aspectos de bioética.Questão 401 Jamie Whitaker mal nasceu e já se tornou celebridade.8. II. Ciência em Dia.Rr. do primeiro e do segundo filhos seriam: a) Pai .rr. O irmão de Jamie se chama Charlie e sofre de uma forma rara de anemia causada por anomalia genética. 1Ž Filho .06. é implantado no útero materno. podemos afirmar que: a) ao fazer referência à técnica de fertilização in vitro e de escolha de genótipos de seres humanos. d) Pai . d) o caso relatado não envolve problemas de bioética.Rr..Rr.. uma forma de confirmar sua compatibilidade com as de Charlie. Na primeira. Jamie pôde ter suas células testadas no útero. Como foi concebido por técnicas de fertilização "in vitro". Questão 403 Quando a garçonete se aproximou. 1.RR. Mãe . MAIS! 29.Rr. pois as técnicas de fertilização in vitrojá são de total domínio e amplamente utilizadas pelos especialistas na área de reprodução humana. em que os números I.

Iß. se forem machos. b) O somente das cores marrom ou pérola. por que as células alfa desse mesmo órgão não assumem esta função?" A síntese da insulina não ocorre nas células alfa porque o(s) a) gene da insulina está defeituoso. Essa rainha produziu. 1. b) II corresponde ao RNA que catalisa a união do I com o III. Questão 406 O texto abaixo refere-se às questões: ** a ** Em uma espécie de abelha. Os indivíduos afetados apresentam a cor da urina vermelho pardacenta devido a uma alteração no metabolismo normal da fenilalanina. foi inseminada por espermatozóides provenientes de machos com olhos das cores marrom (20%). as cinco cores serão possíveis. neve (20%). nas fêmeas. e. d) da cor marrom ou pérola. creme (20%) e amarelo (20%). durante o processo de transcrição.6 89 . a) 1250 fêmeas. se forem fêmeas. se forem machos. é correto afirmar que a) I corresponde ao RNA que contém o código genético determinando a seqüência de aminoácidos da proteína. 625 machos e) 500 fêmeas. em um dia. nos machos. pérola (20%). c) da cor marrom se forem fêmeas. i ). a cor dos olhos é condicionada por uma série de cinco alelos. as cinco cores serão possíveis. b) cromossomos não têm o gene da insulina. d) IV corresponde ao RNA que catalisa a ligação dos nucleotídeos com a desoxirribose. Assinale a alternativa da tabela que indica corretamente o número esperado de descendentes dessa rainha. 1 250 gametas dos quais 80% foram fecundados. e) da cor marrom ou pérola. Todos os gametas produzidos resultaram em descendentes. Questão 408 O texto abaixo refere-se às questões: ** a ** A alcaptunúria é uma disfunção extremamente rara do metabolismo humano. já que as células beta do pâncreas de um diabético não são capazes de sintetizar insulina. d) cromossomo com o gene da insulina não está presente. onde também encontramos os genes que determinam os grupos sangüíneos ABO ( IÞ. Questão 405 Zeca perguntou: "Professor.partir do esquema. (zero) machos b) 1000 fêmeas.5. da cor pérola. 500 machos Questão 407 Os descendentes dessa rainha terão olhos a) somente da cor marrom. O gene determinante dessa disfunção está localizado no cromossomo 9. para a qual o tipo sangüíneo de cada um dos membros está indicado. 250 machos d) 625 fêmeas. (zero) machos c) 1000 fêmeas. O heredograma a seguir foi montado para se estudar a disfunção em uma determinada família. c) gene da insulina está inativo. heterozigótica para pérola. c) III corresponde ao RNA que contém o anticódon complementar ao códon existente em I. entre os quais há a seguinte relação de dominância: a¢ > a£ > a¤ > a¥ >a a¢ : marrom a£ : pérola a¤ : neve a¥ : creme a : amarelo Uma rainha de olhos marrons. e.

" (Kehl apud BIZZO. como na citação: "Os cromossomos. conseqüentemente. em diferentes ambientes. b) 45% de A normais. p. terá uma melhor oportunidade de sobrevivência e. no par de cromossomos 9. apud FREIRE-MAIA. d) 50% B normais ou afetados.5% AB normais. EXCETO: a) A alcaptonúria é um caráter determinado por gene autossômico recessivo. que se ocupa do aperfeiçoamento físico e mental da espécie humana. (32) Variações referidas por Darwin transmitem-se à descendência segundo o padrão mendeliano de herança. os mais fortes. Questão 409 (Darwin. (16) O trabalho de Darwin afirma a constância genética do mundo biológico.6 posição ocupada pelos alelos que determinam grupo sangüíneo e alcapatonúria. exemplificadas nos textos. A freqüência de recombinação entre os dois loci gênicos é de 10%. apud DARNELL. que violam princípios sociais e admitem conceitos biológicos errôneos.. p. Soma ( ) 1. esperada em F2. 2 . segue-se que qualquer organismo que varia de modo proveitoso para si próprio. pode-se afirmar: (01) A subordinação aos princípios mendelianos reduz a variabilidade nas espécies que se reproduzem sexuadamente. selecionam-se. (02) A herança de um caráter é determinada pela fusão dos fatores condicionantes na descendência. p.nalisando-se o heredograma..5. 90 . (Mendel.) se entrechocam. e persistindo nos pronúcleos resultantes os mais aptos. sob condições de vida complexas e algumas vezes variáveis. b) O indivíduo 3 pode ter recebido um gameta recombinante de sua mãe. EXCETO: a) 22. perigosamente em alta em países desenvolvidos da Europa. pode-se dizer: (01) As "plantas que permanecem constantes" ao longo das gerações são homozigotas. é possível afirmar.) os determinantes (. (. de ser "naturalmente selecionado". enquanto a outra metade produz plantas que permanecem constantes e recebem os caracteres dominantes e recessivos em partes iguais. d) A chance de o indivíduo 9 ser heterozigoto para o caráter alcaptonúria é de 2/3. lutam entre si.. os inferiores. Questão 411 A idéia da eugenia. há uma freqüente luta pela existência.. 1117) Em relação às idéias de Darwin e de Mendel. está representada para o indivíduo 7 ao lado do heredograma. assim. (08) A seleção natural pode preservar características diferentes. eliminando-se com o glóbulo polar os mais fracos. se sustenta em premissas incorretas. c) 50% de afetados. São freqüências esperadas de descendentes para o cruzamento 6 X 7. Questão 410 O texto abaixo refere-se às questões: ** a ** Na(s) questão(ões) a seguir escreva nos parênteses a soma dos itens corretos. TEXTO I: Como muito mais organismos de cada espécie nascem do que provavelmente sobrevivem e como. de cada par de caracteres diferenciais. 30) Considerando-se os princípios biológicos que regem a herança. (04) A citação de Mendel expressa a proporção genotípica 1:2:1. formam sementes das quais a metade novamente desenvolve a forma híbrida. c) O indivíduo 6 certamente não recebeu um gameta recombinante da sua mãe ou do seu pai.traduzido) TEXTO II: Os híbridos.

c) permitem a origem de novas espécies cada vez melhor adaptadas. como também a identificação da paternidade. as mutações ocorrem naturalmente e têm uma grande importância evolutiva porque a) geram a variabilidade sobre a qual a seleção natural pode agir. (16) Os genes que condicionam o "xeroderma pigmentosum" são característicos de células epidérmicas. p. extrema sensibilidade à luz solar. ou como fontes de radiações. Soma ( ) o processo evolutivo. hidrologia. em células epidérmicas. que permitem a sobrevivência das espécies. (04) O efeito de um determinado gene depende do ambiente em que ele é expresso. indústria. ( ) Genes alelos são genes que ocupam o mesmo "locus" gênico em cromossomos homólogos. seja por atuarem como traçadores radioativos. No entanto. ( ) Cariótipo é o conjunto de informações sobre os cromossomos de uma determinada espécie. ( ) Na espécie humana distinguem-se 3 tipos sangüíneos. (04) A condição genética dos indivíduos com "xeroderma pigmentosum" é determinada pela exposição à radiação ultravioleta. que parecem resultar da morte prematura de células nervosas. como a dos trilobitas. (GARDNER. Alguns desses pacientes também desenvolvem anormalidades neurológicas. e) são o único processo evolutivo agindo atualmente no homem. b) geram as adaptações. (08) A morte prematura de células nervosas resulta dos efeitos do acúmulo de lesões na molécula de DNA. exercem importante papel na sociedade atual. repercutem além dela. é aleatória. em que são considerados básicos alguns conceitos de genética. principalmente na face. na primeira divisão meiótica. antropologia e à pesquisa acadêmica em diversas áreas do conhecimento. atingindo sua prole. (16) A aplicação de princípios eugênicos comprometeria a sobrevivência da espécie humana. O temor da população em relação aos radioisótopos relaciona-se à capacidade desses elementos produzirem mutações nos seres vivos. (32) A ocorrência de alterações em células nervosas e em células epidérmicas pode estar relacionada à sua origem embriológica comum. apesar de temidos pela população que os associa a acidentes nucleares e danos ambientais. Sobre esses conceitos. (64) A precisão dos sistemas de reparo do DNA inviabiliza Na(s) questão(ões) a seguir julgue os itens e escreva nos parênteses (V) se for verdadeiro ou (F) se for falso. e os indivíduos do grupo sangüíneo AB são considerados doadores universais. Questão 414 Questão 412 Indivíduos portadores da doença "xeroderma pigmentosum". Soma ( ) Questão 413 Os radioisótopos. 91 . adquiridas por indivíduos de uma geração. julgue os itens. São hoje praticamente indispensáveis à medicina. condição genética autossômica recessiva. (08) Os fatores genéticos se misturam e se diluem ao longo das gerações. resultando em alta freqüência de câncer de pele. d) são responsáveis por extinções em massa. apresentam. A elucidação de crimes.adaptação) Uma análise da situação apresentada anteriormente permite afirmar: (01) Agentes mutagênicos incluem fatores físicos que alteram a estrutura da molécula de DNA. vêm sendo efetuadas com certa facilidade e segurança através do uso de técnicas apropriadas. Estudos genéticos em células de organismos afetados revelam a existência de defeitos no sistema enzimático responsável pelo reparo de moléculas de DNA danificadas pela exposição a agentes mutagênicos.(02) A segregação dos cromossomos homólogos. 307-8 . (02) A falha em mecanismos celulares que preservam a fidelidade da mensagem genética predispõe ao câncer. (32) Alterações do fenótipo. ( ) Um dos catalisadores do processo de duplicação do DNA é a enzima DNA polimerase. engenharia. (64) As repercussões da eugenia em populações humanas descartam sua aplicação para qualquer fim.

Ele dispõe de material para ilustrar. Desse cruzamento resultaram oito filhotes que. enquanto seu alelo recessivo determina a cor escura. Também serão convocados a responder a questões básicas no campo da Biologia. uma criança hemofílica nascida de pais normais só poderá ser do sexo feminino. Nesse passeio. "Lei da Segregação Independente dos Caracteres". quando necessário. e quais as conseqüências disso. (08) Estes problemas envolvem a Segunda Lei de Mendel. vocês estarão em contato com a natureza. Soma ( ) . é grande a variabilidade de espécies. contarão com a companhia de Ribossomildo. e o passeio será muito proveitoso. dos oito cãezinhos. Observou-se. reduzindo o vigor da ninhada. ou polimeria. efeitos nocivos que podem surgir devido a genótipos recessivos produzidos através do cruzamento entre indivíduos aparentados. onde verão um maravilhoso ecossistema. verão de perto a diversidade da fauna e da flora. é correto afirmar que: (01) 9/16 dos descendentes desse cruzamento terão olhos normais e com pigmentação escura. que lhes servirá de guia. os genes de um par agem combinando-se com outro par (ou outros pares). escreva no espaço apropriado a soma dos itens corretos. especializado na criação de dálmatas. será heterozigota para o caráter se entre os seus descendentes aparecerem alguns com sementes amarelas e outros com sementes brancas. escolheu dois irmãos de uma ninhada e os cruzou. (08) Segregação monogênica dominante. Vamos lá?!!! Como você já devem ter percebido. Fiquem tranqüilos: vocês estão preparados. fixando aleatoriamente alguns genes. pois Ribossomildo só lhes dará informações cientificamente corretas. um experiente pesquisador. (04) 4/16 dos descendentes nascerão sem olhos. (04) Indivíduos heterozigotos para duas características produzem quatro tipos de gametas. Para tanto. que. ou seja. autofecundada. entretanto. alterando-o. a fim de condicionar um determinado fenótipo. soma = ( ) Questão 418 O texto abaixo refere-se às questões: ** a ** Caros candidatos. (02) 3/16 dos descendentes desse cruzamento terão olhos normais e com pigmentação clara. (04) Herança ligada ao cromossomo sexual. (02) Efeito genético da consangüinidade. essa atividade de campo. (02) Uma mulher do grupo sangüíneo A cuja mãe é do grupo O. (32) Semiletalidade. Feito um cruzamento entre dois indivíduos duplamente heterozigóticos. na sua maioria. ou seja. se reproduzem e como se dão alguns fenômenos biológicos nos seres que vivem ali e até naqueles que visitam esse ambiente.Questão 415 O texto abaixo refere-se às questões: ** a ** Na(s) questão(ões) a seguir. (16) Sendo a hemofilia uma anomalia condicionada por um gene recessivo ligado ao sexo. Um outro gene B dominante determina a pigmentação clara do olho. apresentaram as mesmas características dos pais. (16) Deriva genética. é correto afirmar que: (01) Uma planta de sementes brancas. terá filhos apenas do grupo sangüíneo O. Sabe-se que o gene A está em um cromossomo e B em outro. compreenderão como as espécies se inter-relacionam. dois nasceram cegos. comportamentos. esse fato pode ser explicado porque houve: (01) Heterose. Vocês terão a oportunidade de verificar de que maneira o homem pode interferir nesse meio. Vocês estão convidados a fazer um passeio numa área de Mata Atlântica. 92 Questão 416 Com base nos estudos de Genética. Soma ( ) Questão 417 Um canil. (08) Na interação gênica. À luz dos conhecimentos de genética. e adaptações na Mata Atlântica. Imagine uma espécie animal na qual um gene A determina a formação do olho e seu alelo recessivo determina a ausência de olhos. casando-se com um homem doador-universal.

L. a) replicação do DNA b) transcrição de RNA transportador c) tradução de RNA mensageiro d) síntese das proteínas arque a opção em que se relaciona adequadamente a figura ao evento biológico. sabemos que outros povos. trazendo contribuições à nossa cultura. "o índio"." Variedades de milho cultivadas pelos indígenas são usadas hoje em cruzamentos.8. Considere que a característica baixa estatura é dominante sobre a característica porte elevado e que apenas um loco gênico está envolvido na determinação da estatura das plantas. com o objetivo de melhorar a produção de grãos. através dos vestígios materiais encontrados nas pesquisas arqueológicas. etapas da divisão celular como as representadas nas figuras abaixo justificam essa variabilidade. IPHAN. Questão 419 Ribossomildo diz: Vejam quantos folhas novas. a) Na figura I. quantos filhotes de animais! O que deve estar ocorrendo no interior das células desses seres. ele apresenta a figura abaixo. organizador. Questão 420 A história da maioria dos municípios gaúchos coincide com a chegada dos primeiros portugueses.1 ssinale a opção correspondente ao evento representado na figura. b) Na figura II. Assinale a alternativa que completa corretamente a lacuna. B. c) Na figura I.. ensinando a plantar diferentes espécies e a usar plantas frutíferas e medicinais. a permutação entre cromossomos heterólogos aumenta a variabilidade genética. No entanto. Diante da relevância do contexto e da vontade de valorizar o nosso povo nativo.5. d) Na figura II. que ilustra um dos eventos imprescindíveis ao processo de crescimento dos organismos. a migração das cromátides-irmãs para pólos opostos eleva a recombinação gênica. O resultado para a F1 de um cruzamento de plantas com baixa estatura X plantas com estatura elevada será _________________________. protagonizaram a nossa história. 2004). A. foi selecionada a área temática CULTURA e as questões foram construídas com base na obra "Os Primeiros Habitantes do Rio Grande do Sul" (Custódio. a segregação independente dos cromossomos contribui para o aumento da diversidade dos gametas.Essa variabilidade fenotípica está relacionada à constituição genética do indivíduo e pode ser observada até dentro da mesma espécie.1 1. alemães. 93 . Segundo Ribossomildo. a formação de quiasma eleva a probabilidade de ocorrência de mutação dos genes.2. que lhes permite crescer?! Para facilitar a resposta a essa pergunta. se os indivíduos cruzados forem homozigotos para esse loco gênico. anteriores aos citados. italianos e de outros povos. "Da Amazônia vieram os tupis-guaranis.5. 1. Santa Cruz do Sul: EDUNISC.

sais minerais. ornitina e arginina. O sinal + indica que houve crescimento do fungo. citrulina e ornitina. III . b) ornitina.Agentes ambientais. não necessariamente nessa ordem. II . alcançando um número razoável de células e estabelecendo uma rede de vasos sangüíneos que passa a alimentá-las. cada uma delas deficiente em uma das enzimas participantes dessa via biossintética. para as enzimas a) 1.5. c) 2. tornando-as invulneráveis à ação do sistema imunológico.A inativação dos oncogenes é uma das condições essenciais para que as células citadas no texto se multipliquem desordenadamente. tal como na via biossintética representada na figura 1. determinado assim uma acentuada queda na sobrevida do indivíduo. b) 1. 2 e 3. o sinal . aos compostos a) ornitina. Y e Z correspondem à citrulina. constituído de água.5 As letras X.O comportamento celular descrito na última frase do texto é chamado metástase. O fungo utiliza esses elementos como precursores para a síntese de vários compostos. arginina e ornitina. o qual pode ser determinado pela perda da inibição por contato nas células. . respectivamente. se algumas células mutantes se tornam invulneráveis elas podem se multiplicar.indica que não houve crescimento. respectivamente. Y e Z correspondem. 3 e 2. Questão 422 1. d) citrulina. Considere as seguintes afirmativas: I . arginina e citrulina. d) 2. não deficiente em qualquer uma das enzimas. O esquema na figura 2 apresenta os resultados obtidos quando essas diferentes linhagens foram colocadas para crescer em diferentes meios de cultura. A linhagem D é o tipo selvagem. No entanto.5 As linhagens A. tais como radiações solares e agrotóxicos. e) 3.8. podem provocar alterações genéticas nas células. c) citrulina. Os compostos X. 1 e 2. citrulina e arginina. Um pesquisador obteve três diferentes linhagens desse fungo.5.8. Assinale a opção que contém a(s) afirmativa(s) 94 1. 1 e 3. Após essa fase várias dessas células podem cair na corrente sangüínea e invadir outros órgãos.a) 100% com estatura elevada b) 100% com estatura baixa c) 1/2 com estatura elevada e 1/2 com estatura baixa d) 1/4 com estatura elevada e) 3/4 com estatura elevada Questão 421 O texto abaixo refere-se às questões: ** a ** O tipo selvagem do fungo Neurospora é capaz de crescer em um meio de cultura simples. Questão 423 Quando as células do corpo humano se multiplicam. arginina e ornitina. espera-se que aquelas produzidas com defeitos sejam destruídas pelo sistema imunológico. e) arginina. 3 e 1. açúcar e uma vitamina. B e C são deficientes.

verdadeira(s). a) Apenas I e II. b) Apenas I e III. c) Apenas II e III. d) Apenas III. e) I, II, III. Questão 424 A síntese protéica envolve um complexo de estruturas celulares que trabalham harmonicamente, como mostra o esquema adiante.

1.1.4

1.1.3.2

Segundo a tirinha, a amiga de Calvin tem DOIS CROMOSSOMOS X. Com base neste dado podemos concluir que: a) a amiga de Calvin é mutante, por isso é hostil. b) um cromossomo X da amiga de Calvin é ativo e o outro é chamado de cromatina sexual. c) a heterocromatina ocorre em Calvin, pois ele é XY. d) os dois cromossomos X de que Calvin fala é da cobra que quer comê-lo. e) não há cromatina sexual em meninas. Questão 426

Com base no esquema e em conhecimentos correlatos, julgue os itens a seguir. (0) O esquema mostra a síntese protéica em uma célula procariótica. (1) Os tipos de RNA necessários para a síntese protéica em procariotos e eucariotos são essencialmente diferentes. (2) Na expressão de um gene eucariótico, a transcrição e a tradução ocorrem simultaneamente. (3) Uma molécula de RNAm pode ser utilizada para a síntese concomitante de várias moléculas da proteína. Questão 425 Leia com atenção a tirinha a seguir:

Qual das alternativas se refere a um cromossomo? a) Um conjunto de moléculas de DNA com todas as informações genéticas da espécie. b) Uma única molécula de DNA com informação genética para algumas proteínas. c) Um segmento de molécula de DNA com informação para uma cadeia polipeptídica. d) Uma única molécula de RNA com informação para uma cadeia polipeptídica. e) Uma seqüência de três bases nitrogenadas do RNA mensageiro correspondente a um aminoácido na cadeia polipeptídica. Questão 427 Quando afirmamos que o metabolismo da célula é controlado pelo núcleo celular, isso significa que a) todas as reações metabólicas são catalisadas por moléculas e componentes nucleares. b) o núcleo produz moléculas que, no citoplasma, promovem a síntese de enzimas catalisadoras das reações metabólicas. c) o núcleo produz e envia, para todas as partes da célula, moléculas que catalisam as reações metabólicas.
95

d) dentro do núcleo, moléculas sintetizam enzimas catalisadoras das reações metabólicas. e) o conteúdo do núcleo passa para o citoplasma e atua diretamente nas funções celulares, catalisando as reações metabólicas. Questão 428 Considere uma espécie de vertebrado cujas células embrionárias têm oito cromossomos. Em quantos grupos de ligações seus genes estarão associados? a) Dois. b) Quatro. c) Oito. d) Dezesseis. e) Número variável. Questão 429 A ilustração representa o cariótipo humano que permite determinar o número e a forma dos cromossomos.

Questão 431 Os cromossomos são constituídos principalmente por: a) fosfolipídeos. b) proteínas. c) ácido ribonucléico. d) enzimas. e) ácido desoxirribonucléico. Questão 432 A cromatina sexual compreende: a) o citoplasma de células gaméticas masculinas que se apresentam mais coradas que as femininas. b) o citoplasma de células gaméticas femininas que se apresentam mais coradas que as masculinas. c) cromossomo Y condensado em núcleos de hemácias humanas. d) um dos cromossomos X da mulher, que permanece condensado no núcleo das células, facilmente visualizado na mucosa oral. e) cromossomos X e Y condensados durante o período da interfase. Questão 433 Responder à questão com base no cariótipo (conjunto de cromossomas) humano representado abaixo.

1.1.4

Analisando-se a figura, é correto concluir que se refere a um indivíduo portador da síndrome de a) Klinefelter. b) Patau. c) Turner. d) Down. Questão 430 A presença de cromatina sexual predominante em número de células femininas está relacionada a cromossomos: a) Y inativos b) X inativos c) autossômicos inativos d) autossômicos que não se dividiram e) autossômicos agregados

1.1.4

cariótipo é de um indivíduo do sexo com síndrome de __________. a) feminino - Klinefelter b) masculino - Klinefelter c) masculino - Down d) feminino - Turner e) masculino - Turner

96

Questão 434 Numere a coluna inferior, relacionando-a com a superior. Indivíduos: 1 - 45, X 2 - 46, XX 3 - 49, XXXXX 4 - 49, XXXXY 5 - 47, XXX Quantidade de cromatinas sexuais (corpúsculos de Barr) ( ) quatro ( ) duas ( ) nenhuma ( ) uma ( ) três Assinale a opção que apresenta a seqüência correta de numeração. a) 2, 4, 1, 3, 5 b) 3, 5, 1, 2, 4 c) 2, 3, 1, 4, 5 d) 3, 2, 1, 4, 5 e) 2, 1, 3, 4, 5 Questão 435

Analisando o desenho esquemático que representa o núcleo de uma célula animal qualquer, podemos identificar que o componente responsável pela síntese de RNA que forma o ribossomo é assinalado pelo número: a) 1 b) 2 c) 3 d) 4 e) 5 Questão 436 Muitas vezes, durante a realização de eventos esportivos, é realizada a determinação do sexo genético. Este exame é feito pela observação dos cromossomos de células epiteliais. Pode-se afirmar que neste exame a) mulheres normais deveriam apresentar uma estrutura chamada corpúsculo de Barr, que corresponde a um dos cromossomos X. b) homens normais deveriam apresentar uma estrutura chamada corpúsculo de Barr, que corresponde ao cromossomo Y. c) mulheres normais deveriam apresentar duas estruturas chamadas corpúsculos de Barr, que correspondem aos dois cromossomos X. d) homens normais deveriam apresentar uma estrutura chamada corpúsculo de Barr, correspondente ao cromossomo X. e) mulheres normais na fase adulta não deveriam apresentar corpúsculo de Barr. Questão 437

1.1.4

Analise o esquema a seguir, o qual mostra o mecanismo de ação de algumas drogas antimitóticas que inibem a progressão a partir dos pontos indicados.

1.1.5.1

97

Assinale a afirmativa INCORRETA. a) A puromicina não tem qualquer efeito sobre o crescimento ou multiplicação celular. b) A mitomicina não permite a ocorrência da fase 5 do ciclo celular. c) Pelo menos duas das drogas interferem diretamente na síntese protéica. d) Nem todos os tipos de nucleotídeos sofrem ação da droga arabinosilcitosídeo. Questão 438 A figura a seguir representa _______________ , que ocorre na _______________ e tem como conseqüência _______________.

1.1.5.2

1.1.5.2

( ) O número de gametas AB deverá ser idêntico ao de gametas ab. ( ) A freqüência de gametas recombinantes deverá ser igual a de gametas não-recombinantes. ( ) Trezentos e sessenta gametas não- recombinantes são esperados. ( ) Vinte gametas recombinantes são esperados no caso descrito. ( ) A taxa de recombinação no caso citado é de 10%; logo, os locos A e B distam de 10 unidades de mapa. Questão 440 "Devo, finalmente, chamar a atenção para a possibilidade do pareamento dos cromossomos paternos e maternos, e sua subseqüente separação durante a divisão reducional, constituírem as bases físicas das leis de Mendel" (Walter S. Sutton, 1902). O que Sutton achava possível sabe-se, hoje, ser verdade, isto é: I. os genes estão localizados nos cromossomos. II. dois ou mais genes localizados no mesmo cromossomo são herdados, na maioria dos casos, em gametas diferentes. III. dois ou mais genes localizados em cromossomos diferentes segregam de maneira independente. Sobre as afirmativas acima, pode-se dizer que: a) somente III está correta. b) I e II estão corretas. c) II e III estão corretas. d) I e III estão corretas. e) somente II está correta.

A alternativa que preenche correta e respectivamente os espaços anteriores é: a) o crossing-over; metáfase da mitose; a variabilidade genética. b) o pareamento de cromátides-irmãs; anáfase I da meiose; a troca de genes alelos. c) o crossing-over; prófase I da meiose; a variabilidade genética. d) a segregação de cromossomos homólogos; anáfase I da meiose; a formação de células haplóides. e) o pareamento de cromossomos homólogos; metáfase da mitose; a formação de gametas. Questão 439 Analise as proposições abaixo, considerando a seguinte situação: Em uma amostra de 100 (cem) espermatogônias, de um organismo genotipicamente (AB//ab), ocorreu permutação meiótica entre os locos A e B, em 20 (vinte) espermatogônias, tendo sido observada uma segregação gamética como ilustrado na figura abaixo.

98

Questão 441

Questão 443 Quanto aos cromossomos sexuais X e Y, podemos afirmar que: a) como não são completamente homólogos, não se pareiam na meiose. b) como são completamente homólogos, pareiam-se na meiose. c) se pareiam na meiose, pois possuem uma região homóloga. d) não se pareiam na meiose, pois possuem uma região não homóloga. e) os genes que se encontram na região não homóloga do X condicionam um tipo de herança chamado herança restrita ao sexo. Questão 444 As variações das cargas elétricas das moléculas das proteínas W, X, Y e Z, em função do pH do meio, estão representadas no gráfico a seguir.

1.1.5.2

AMABIS e MARTHO. "Fundamentos da Biologia Moderna". São Paulo: Moderna, 1997. p. 499. A figura representa a a) mitose e explica a separação dos cromossomos durante a divisão. b) meiose e explica a segregação independente dos genes previstos pela segunda lei de Mendel. c) mitose e explica a segregação dos genes demonstrando a dominância e a recessividade. d) meiose, que é um processo de formação de gametas mas que não tem nenhuma relação com as leis de Mendel. e) mitose, que é um processo de divisão celular mas que não tem nenhuma relação com as leis de Mendel. Questão 442 Os gatos possuem 38 cromossomos, com o sistema XX/XY de determinação sexual. No desenvolvimento embrionário de fêmeas, um dos cromossomos X é inativado aleatoriamente em todas as células do organismo. Em gatos domésticos, a pelagem de cor preta (dominante) e amarela (recessiva) são determinadas por alelos de um gene localizado no cromossomo X. Fêmeas heterozigóticas para cor da pelagem são manchadas de amarelo e preto. Um geneticista colocou um anúncio oferecendo recompensa por gatos machos manchados de amarelo e preto. A constituição cromossômica desses gatos é a) 37, YO. b) 37, XO. c) 38, XX. d) 39, XXY. e) 39, XXX.

1.1.7.3

molécula do DNA, em pH fisiológico, apresenta carga elétrica negativa, devido a sua natureza ácida. No núcleo celular, ela está associada a proteínas, de caráter básico, denominadas histonas. De acordo com o gráfico, a proteína que apresenta propriedades compatíveis com as de uma histona é a representada pela seguinte letra: a) W b) X c) Y d) Z

99

Questão 445 Considere a rota metabólica que produz o aminoácido arginina na figura adiante.

grupamentos amina e hidroxila. Questão 447 O metabolismo celular depende de uma série de reações químicas controladas por enzimas, isto é, proteínas que atuam como catalisadores e que podem sofrer mutações genéticas sendo modificadas ou eliminadas. Assinale a alternativa correta, levando em conta os ácidos nucléicos, a ocorrência de mutações e as conseqüentes mudanças do ciclo de vida da célula. a) O DNA é constituído por códons, que determinam a seqüência de bases do RNA mensageiro, necessária à formação dos anticódons, responsáveis pela produção das proteínas. b) No caso de uma mutação acarretar a transformação de um códon em outro relacionado ao mesmo aminoácido, não haverá alteração na molécula protéica formada, nem no metabolismo celular. c) A mutação altera a seqüência de aminoácidos do DNA, acarretando alterações na seqüência de bases do RNA mensageiro e, conseqüentemente, na produção das proteínas. d) As mutações atuam diretamente sobre as proteínas, provocando a desnaturação dessas moléculas e, conseqüentemente, a inativação delas. e) Quando algumas proteínas são alteradas por mutações, suas funções no metabolismo celular passam a ser realizadas pelos aminoácidos. Questão 448 Organelas citoplasmáticas que contêm DNA: a) mitocôndria e ribossomo. b) mitocôndria e cloroplasto. c) nucléolo e cloroplasto. d) lisossomo e ribossomo. e) ribossomo e cromossomo. Questão 449 A hipótese de que os cloroplastos e as mitocôndrias tenham surgido através de uma associação simbiótica de um eucarioto primitivo com, respectivamente, bactérias fotossintetizantes e bactérias aeróbicas, é reforçada pelo fato daquelas organelas celulares: a) serem estruturas equivalentes, com grande superfície interna.
100

1.1.7.3

Em um experimento, três linhagens de bactérias foram irradiadas com raios X, que causaram mutações nos genes envolvidos na rota metabólica acima representada. Para descobrir quais enzimas da rota metabólica foram afetadas, as três linhagens foram cultivadas em meios suplementados com ornitina, citrulina e arginina, obtendo-se o resultado mostrado na tabela acima: Sobre esse experimento, podemos afirmar que a) o gene que codifica a enzima 1 na linhagem I foi afetado. b) o gene que codifica a enzima 2 na linhagem I foi afetado. c) o gene que codifica a enzima 3 na linhagem II foi afetado. d) o gene que codifica a enzima 1 na linhagem II foi afetado. e) o gene que codifica a enzima 3 na linhagem III foi afetado. Questão 446 Além de serem as macromoléculas mais abundantes nas células vivas, as proteínas desempenham diversas funções estruturais e fisiológicas no metabolismo celular. Com relação a essas substâncias é CORRETO afirmar que: a) são todas constituídas por seqüências monoméricas de aminoácidos e monossacarídeos. b) além de função estrutural, são também as mais importantes moléculas de reserva energética e de defesa. c) cada indivíduo produz as suas proteínas, que são codificadas de acordo com o seu material genético. d) a sua estrutura terciária é determinada pela forma, mas não interfere na sua função ou especificidade. e) são formadas pela união de nucleotídeos por meio dos

um fungo e uma samambaia apresentam em comum a) produção de glicose através da utilização de energia solar. É correto prever que. e) ribossomos. c) nucléolos e nas mitocôndrias. b) 19 cromossomos duplicados e 38 moléculas de DNA.. Questão 454 Uma bactéria. b) UACGUGGA.6 . respectivamente. e) ATGCACCT. na produção e consumo de oxigênio. d) ribossomo. c) estarem envolvidas. Questão 455 O gato doméstico ('Felis domestica') apresenta 38 cromossomos em suas células somáticas. c) utilização de oxigênio no interior de mitocôndrias. Ao longo do processo de diferenciação das células do mesmo organismo ocorre a) duplicação de alguns genes. e) recombinação entre genes ativados. Questão 451 Células vegetais.1. tanto do ponto de vista estrutural como funcional. depois de mantidas em meio de cultura contendo uracila marcada. (. d) ribossomos e nos cloroplastos. no citoplasma.. Questão 450 "Captura aminoácidos que se encontram dissolvidos no citoplasma e carrega-os ao local da síntese de proteínas". e) 19 cromossomos duplicados e 19 moléculas de DNA. Questão 452 A célula muscular cardíaca e a esquelética têm a mesma origem porém são diferentes. b) perda dos genes não expressos. e) produção de ATP no interior de plastos. Essa função é desempenhada pelo a) RNA mensageiro. b) presença de carioteca envolvendo os componentes do núcleo celular. d) 38 cromossomos simples e 19 moléculas de DNA.b) apresentarem DNA próprio. os planos do arquiteto montam 46 101 1. nos cloroplastos e nas mitocôndrias. foram fixadas e submetidas à autoradiografia. Questão 453 A seqüência de nucleotídeos ATGCACCT forma um segmento de DNA dupla hélice ao se ligar à fita complementar a) AUGCACCU. e) serem encontradas tanto em organismos superiores como inferiores. para comprovar os locais que possuíam esse material. d) TCCACGTA. d) apresentarem tilacóides e cristas como as bactérias.7. b) ribossomos. b) RNA transportador. c) TACGTGGA. c) expressão diferencial dos genes. c) RNA ribossômico. d) presença de DNA como material genético.) No homem. d) indução de mutações específicas. c) 38 cromossomos simples e 38 moléculas de DNA. No núcleo do óvulo normal de uma gata são esperados: a) 19 cromossomos simples e 19 moléculas de DNA. e) DNA. Questão 456 É como se em cada quarto de um imenso prédio existisse uma estante contendo os planos do arquiteto para todo o prédio. encontre-se uracila radioativa SOMENTE nos a) nucléolos.

e) somente II e III são verdadeiras. a saber. analise a figura e as proposições a seguir. se liga ao ribossomo. Questão 459 Cinco amostras com ácidos nucléicos foram analisadas quimicamente e apresentaram os seguintes resultados: I . Nessa analogia. Pode-se afirmar.4 amostra: uracila V .1 amostra: ribose II . e) Apenas II e V. ( ) O aminoácido metionina (I) é trazido ao ribossomo pelo RNAt cujo anticódon é UAC (II). Considerando esse tema. Sabendo-se que os códons 5 e 6 trazem a informação para um mesmo aminoácido. se chega a um códon de parada (V). Cada cromossomo possui uma única molécula de DNA. de modo correto.5 amostra: 20% de guanina e 30% de citosina Entre estas amostras.7. cada página de cada volume contém um texto formado por uma seqüência de: a) fenótipos b) aminoácidos c) cromossomos d) bases nitrogenadas Questão 457 Analise as afirmativas a seguir. c) somente I e II são verdadeiras.6 . ou para a metionina ou para o triptofano. ( ) Quando se estabelece uma ligação peptídica entre os dois primeiros aminoácidos. UUG.2 amostra: timina III . c) Apenas II e III. ( ) Na etapa seguinte da tradução. ( ) O final da tradução ocorre quando. para os quais não há aminoácido correspondente. III. na leitura da mensagem genética. quais se referem a DNA? a) Apenas I e II.3 amostra: dupla hélice IV. acerca dos elementos constituintes do núcleo celular eucariótico. transcrevendo a seqüência de bases de uma cadeia de DNA. II. para o qual existe apenas uma trinca de codificação. b) Apenas I e III. d) somente I e III são verdadeiras. onde se dá a produção de cadeias peptídicas. Os nucléolos podem atuar na síntese de carboidratos que migram do núcleo para o citoplasma.volumes. b) somente II é verdadeira. proposta por Richard Dawkins no livro "O gene egoísta". Com relação às características dessa molécula. d) Apenas II e IV. que: a) somente I é verdadeira. UUA ou GUA.1. ao papel que ela desempenha nos seres vivos e aos processos em que se encontra envolvida é CORRETO afirmar que: 102 1. I. Histonas são proteínas relativamente pequenas que se ligam fortemente ao RNA. encaixa-se no sítio destinado à entrada de aminoácidos na cadeia peptídica. Questão 460 Neste ano de 2003. O RNAm no citoplasma. cujo anticódon é complementar ao segundo códon do RNAm geralmente onde há uma trinca UAA. um segundo RNAt (III). ( ) 61 códons correspondem aos aminoácidos que compõem as proteínas. são comemorados os 50 anos da "descoberta" da estrutura tridimensional do DNA. UAG ou UGA. o RNAt do primeiro aminoácido é liberado (IV) no citoplasma. complementar ao códon AUG do RNAm. podemos afirmar que os códons 5 e 6 codificam. Questão 458 A molécula de RNAm é sintetizada no núcleo.

c) apenas II e III. da maneira como foi veiculada. (02) Em sua composição é possível encontrar quatro bases nitrogenadas diferentes: a adenina. c) Os nucleotídeos são polimerizados por meio de ligações fosfodiéster entre o fosfato e a base nitrogenada. assinale a alternativa CORRETA: a) Uma cadeia simples de DNA é constituída de nucleotídeos. existem regiões cromossômicas com alta taxa de mutação. III e IV. porque o Projeto decifrou os genes dos cromossomos humanos. A informação contida no DNA pode ser copiada em uma fita de RNA. pois independe da existência de uma fita molde. por serem herdáveis. apenas. Questão 462 Este ano comemorou-se 50 anos da publicação do trabalho de Francis Crick e James Watson. que estabeleceu o modelo da estrutura da molécula de ácido desoxirribonucléico (DNA). compostos por uma desoxirribose ligada a um fosfato e a um aminoácido. II. Questão 463 Erros podem ocorrer. (64) Em alguns organismos primitivos. c) na replicação e na transcrição. (32) Nos organismos procariontes. IV. porque o código genético diz respeito à correspondência entre os códons do DNA e os aminoácidos nas proteínas. d) apenas I. apenas. e suas seqüências de bases são complementares. não as proteínas que eles codificam. durante os processos de replicação. e) As duas cadeias de uma dupla-hélice possuem a mesma orientação. o aminoácido e a proteína. a citosina. d) na transcrição e na tradução. Está(ão) correta(s) a) apenas I. d) Duas cadeias simples de DNA formam uma dupla-hélice. d) errada. DNA e RNA são os ácidos nucléicos encontrados tanto em células eucariontes como procariontes. ela apresenta apenas uma fileira de nucleotídeos. apenas.(01) É formada por duas fileiras de nucleotídeos torcidas juntas em forma de hélice. (08) Nela está contida a informação genética necessária para a formação de um organismo. porque agora se sabe toda a seqüência de nucleotídeos dos cromossomos humanos. através do processo denominado transcrição. Dentre as afirmativas abaixo. as conseqüências desses erros podem ser mais graves. porque agora se sabe toda a seqüência de genes dos cromossomos humanos. c) errada. III. através do processo denominado tradução. A informação presente no RNA pode ser transformada em uma seqüência de aminoácidos. III e IV. b) na replicação. transcrição e tradução do DNA. ela fica estocada dentro do núcleo das células. e) em qualquer um dos três processos. porque não é possível decifrar todo o código genético. por meio da formação de pontes de hidrogênio entre as bases nitrogenadas. b) A polimerização de uma fita simples de DNA é dita semiconservativa. Questão 461 Analise as afirmativas: I. (16) A mensagem nela contida pode ser transcrita para uma outra molécula denominada RNA. b) apenas I e II. a finalização do Projeto Genoma Humano foi noticiada por vários meios de comunicação como sendo a "decifração do código genético humano". embora em baixa freqüência. Questão 464 Em abril de 2003. b) correta. Entretanto. As proteínas e os ácidos nucléicos são formados por aminoácidos. quando ocorrem a) na transcrição. e) errada. apenas. e) apenas II. está a) correta. (04) Ela tem a capacidade de se autoduplicar. A informação. 103 .

a) As espécies Homo sapiens e Pan troglodites surgiram há 6 milhões de anos. d) A longo prazo. ao longo de 100 anos. Questão 468 O gráfico mostra a variação dos números de indivíduos do tipo original e do tipo mutante. b) 99.6% de diferenças pode contribuir para entendermos como. apenas um deles desenvolve a capacidade de compor música. terão algum impacto no curso da evolução humana.4% de identidade entre os genes humanos e de chimpanzés. removidos durante a diferenciação. não fertilizado e cujo núcleo tenha sido removido. d) Os 97 genes comuns são os responsáveis pela diferenças entres seres humanos e chimpanzés. Questão 467 Descobertas recentes na medicina e na saúde pública. 104 . c) A longo prazo. uma vez que o núcleo injetado não possui alguns genes. Assinale a alternativa que mostra. DIZ ESTUDO. b) Os genótipos que produzem pouca ou nenhuma resistência se tornariam comuns. Questão 466 CHIMPANZÉ TAMBÉM É "GENTE". c) a formação de um clone de células não diferenciadas. de construir prédios e de fazer pesquisa científica. (Fonte: "Folha de S. haveria adaptação genética a resistência a muitas doenças. que não faz parte das seqüências que podem ser transcritas e traduzidas. nos 6 milhões de anos que separam a evolução do homem e do chimpanzé de um ancestral comum. Estudar estes 0. A idéia surgiu pela primeira vez em 1998 quando a análise de seqüências de DNA de humanos e de chimpanzés revelou 98. d) a formação de um girino normal a partir do ovo. se aplicadas consistentemente. Mais recentemente. corretamente. removidos durante a diferenciação. mais pessoas se tornariam independentes de procedimentos médicos. como o sarampo e a difteria. em uma mesma área de floresta. e) a expulsão do núcleo injetado por meio de exocitose realizada pela célula-ovo. os efeitos da imunização em massa sobre a freqüência da resistência ou susceptibilidade inata às doenças. que até o momento tem o Homo sapiens como único representante vivo. e) Não haveria alteração alguma na freqüência desses alelos. em 21/05/2003. conferiria vantagem seletiva a uma família. biologicamente não somos tão diferentes dos chimpanzés como muitos crêem.) Tendo em vista o texto apresentado. assinale a afirmativa CORRETA.4% dos genes apresentam a mesma seqüência de DNA. A diferença nos percentuais de identidade dos dois estudos se deve ao fato de que em 1998 foi estudado o DNA não-codificante.4% de identidade. a) A freqüência dos alelos que conferem resistência inata às doenças seria aumentada.Paulo". b) a morte da célula-ovo. a comparação da seqüência de DNA de 97 genes comuns de humanos e de chimpanzés revelou 99. Alguns cientistas dos EUA afirmam que os chimpanzés (Pan troglodites) são geneticamente tão parecidos com os homens que deveriam ser incluídos no gênero Homo. uma vez que o núcleo injetado proveniente da célula diferenciada contém DNA cuja composição de bases nitrogenadas é diferente da célula-ovo. uma vez que o núcleo injetado não contém determinados genes. Na realidade. ocorrerá: a) a morte da célula-ovo. c) Seqüências de DNA que podem ser expressas como proteínas apresentaram maiores semelhanças que as seqüências não codificadoras. uma vez que o núcleo injetado contém toda a informação (DNA) necessária à formação do girino. Qualquer resistência às doenças infecciosas (de caráter hereditário).Questão 465 Ao se injetar o núcleo de uma célula diferenciada de uma rã em um ovo de outra rã.

VAL .GLU . 1.PRO .VAL .1. presente em praticamente todos os animais. deixa de existir o efeito de dominância do alelo para o tipo original sobre aquele para o tipo mutante.LEU espécie C: MET .VAL .7 análise do gráfico permite concluir que: a) o tipo original permanece melhor adaptado ao longo do período analisado.LEU .GLU . a forma PX.ALA ALA . espécie A: MET .ARG .ARG .ALA ARG . III.PRO . b) de asa longa.ALA. Indique a alternativa que mostra as proteínas encontradas nos grupos de animais I a V. com base na forma da proteína presente nos grupos de animais I. 1.10 105 . A ocorrência dessas mutações pôde ser localizada nos pontos indicados pelos retângulos escuros na árvore filogenética. d) fenótipo igual ao seu.LEU .ARG .ALA .LEU espécie B: MET . b) o tipo original e o tipo mutante estão igualmente adaptados à mesma área de floresta. e) fenótipo dominante. B e C).HIS .ARG ALA .Questão 470 A seguir estão representadas três seqüências de aminoácidos de proteínas retiradas de diferentes espécies (A.LEU .ARG .ARG . o procedimento correto é analisar a prole resultante do cruzamento desta mosca com outra de: a) asa vestigial.4. a árvore filogenética que melhor expressa o parentesco evolutivo entre as três é: 1. Questão 469 Um determinado tipo de proteína.ARG .1.LEU . II.LEU .PRO . e a forma PY.10 Questão 471 Moscas de asas longas cruzadas entre si fornecem moscas com asas vestigiais.1.ARG .GLU .PHE . Para determinarmos se uma mosca de asa longa é homozigota ou heterozigota quanto ao par de genes que condicionam este caráter.LEU Admitindo-se um ancestral comum para as três espécies. resultante de mutação no gene que codifica PX.HIS . ocorre em três formas diferentes: a forma P.ARG . c) a mudança de ambiente provocou alteração nas freqüências gênicas.PHE .HIS . d) a partir de 50 anos.4. IV e V.4. c) genótipo igual ao seu.PHE . resultante de mutação no gene que codifica P. e) após 50 anos. o tipo mutante passou a parasitar o tipo original.

Questão 475 Sabendo-se que o albinismo é um caráter recessivo. e) de um caso de herança ligada ao cromossomo Y e de 50% a probabilidade de o casal n¡. d) de um caso que pode ser tanto de herança ligada ao sexo como de herança autossômica. é possível afirmar que se trata a) exclusivamente de um caso de herança ligada ao sexo. sendo a anomalia determinada por um gene recessivo e de 50% a probabilidade de o casal n¡. sendo a anomalia causada por um gene recessivo e de 75% a probabilidade de o casal n¡. 3 ter um descendente com a anomalia.5. b) mutação gênica. b) exclusivamente de um caso de herança autossômica.5. A mudança ocorrida na coloração do pêlo em função da queda de temperatura demonstra o efeito da: a) norma de reação.1.1. 2 ter um descendente com a anomalia. e) alteração do genótipo pelo ambiente. mas heterozigota. Questão 473 Na espécie humana. sendo a anomalia causada por um gene dominante e de 75% a probabilidade de o casal n¡. 3 ter um descendente com a anomalia. determine a porcentagem de descendentes com o fenótipo igual ao do pai. 2 ter um descendente com a anomalia. o albinismo é causado por um gene autossômico recessivo. A probabilidade do primeiro filho de um homem albino casado com uma mulher normal.1 1. a) 0% b) 25% c) 50% d) 75% e) 100% 106 . sendo a anomalia determinada por um gene recessivo e impossível o casal n¡. d) penetrância de um gene. com uma mulher de igual genótipo. c) de um caso que pode ser tanto de herança ligada ao sexo como de herança autossômica. c) expressividade de um gene.1 esquema anterior mostra uma experiência com um coelho himalaia. 2 ter um descendente do sexo masculino com a anomalia. resultantes do casamento de um homem heterozigoto para esse fator.Questão 472 1. ser albino e do sexo masculino é: a) nula b) 25 % c) 50 % d) 75 % e) 100 % Questão 474 A incidência de determinada anomalia foi investigada nos indivíduos da espécie humana representados no heredograma a seguir: Sabendo-se que os símbolos escuros representam portadores da anomalia.

c) está num autossomo. c) fenótipo depende do genótipo e do meio ambiente. dominante. Essa expressão significa que a) o ambiente altera o genótipo do indivíduo. A tabela a seguir apresenta resultados de vários cruzamentos feitos com diversas linhagens dessa planta: 1. Esse gene: a) está no cromossomo X. A e C são homozigotos. entre indivíduos que são parentes próximos. b) genótipo depende do ambiente. visando à sua adaptação. d) a cor preta é recessiva. todos pretos. O cruzamento do gato A com a gata B produziu 8 filhotes. Questão 481 Um gato preto (A) foi cruzado com duas gatas (B e C) também pretas.1 107 . c) a cor preta é dominante. determina a cor púrpura e (a). em qualquer que seja o ambiente. B e C são heterozigotos. d) genótipo depende do fenótipo e do meio ambiente. Esta mudança indica que o: a) fenótipo depende do ambiente. João e Maria. Isso pode ser justificado pelo fato de os filhos apresentarem: a) maior probabilidade de heterozigoses recessivas b) maior probabilidade de homozigozes recessivas c) menor probabilidade de heterozigoses dominantes d) menor probabilidade de homozigoses dominantes e) menor probabilidade de homozigoses recessivas Questão 479 Na genética.Questão 476 Num homem heterozigoto para determinado caráter. ou seja. A análise desses resultados permite concluir que: a) a cor preta é dominante. b) a cor preta é dominante. resulta numa maior freqüência de indivíduos com anomalias genéticas. b) o genótipo do indivíduo é o resultado da ação do ambiente sobre seu fenótipo. Questão 480 Pedro e seus filhos.5. d) o genótipo do indivíduo pode variar como resultado da expressão de seu fenótipo em diferentes ambientes. Questão 478 Sabe-se que o casamento consangüíneo. e) o fenótipo do indivíduo é invariável e resulta da expressão de seu genótipo. a porcentagem provável de espermatozóides que conterão o gene recessivo desse caráter é de: a) 0% b) 25% c) 50% d) 75% e) 100% Questão 477 Algumas variedades de canários mudam de cor dependendo da alimentação que recebem. Questão 482 Dois genes alelos atuam na determinação da cor das sementes de uma planta: (A). e) genótipo depende dos genes. e) pode estar num cromossomo ou num autossomo.1. e) a cor preta é recessiva. Não há outros afetados na família. b) está no cromossomo Y. uma expressão bastante conhecida diz que fenótipo é o genótipo mais o ambiente. determina a cor amarela. A e B são homozigotos. c) o fenótipo do indivíduo é o resultado da expressão de seu genótipo em um dado ambiente. o cruzamento do gato A com a gata C produziu 6 filhotes pretos e 2 amarelos. A e C são heterozigotos. A e C são homozigotos. recessivo. têm uma doença determinada por um gene dominante. d) pode estar no cromossomo X ou no Y.

d) a freqüência do alelo a é 0. I. Questão 487 De uma população de 100 camundongos foi retirado ao acaso um indivíduo com deficiência da enzima E. b) o mesmo fenótipo e genótipos diferentes.1. Vv x Vv III. II e III. produz vagens com sementes amarelas e com sementes verdes. 96% dos indivíduos têm cor clara e 4%. c) genótipos e fenótipos iguais. É correto afirmar que a) seus pais podem ser fenotipicamente normais. Esses resultados sugerem que a cor dessas mariposas é 108 . Questão 485 Considere uma ovogônia de uma mulher heterozigota para o par de alelos Dd.2. podemos encontrar: a) quatro óvulos Dd. b) apenas do cruzamento II. Já os cruzamentos entre indivíduos claros produzem sempre apenas descendentes de cor clara. Depois de alguns dias. c) a freqüência do alelo a é 0. casada com um portador de doença genética de herança autossômica dominante. b) quatro óvulos D e quatro óvulos d. b) seus pais são certamente heterozigotos. pode resultar a) apenas do cruzamento I.presentam genótipo (Aa) as linhagens: a) I e III b) II e III c) II e IV d) I e IV e) III e IV I Questão 483 Considere os seguintes cruzamentos para ervilha. heterozigoto e que. Vv x vv Um pé de ervilha. Indivíduos escuros cruzados entre si produzem. que determina cor verde. descendentes claros e escuros. d) apenas dos cruzamentos II e III. e) dos cruzamentos I. sabendo que V representa o gene que determina cor amarela dos cotilédones e é dominante sobre o alelo v. está grávida de um par de gêmeos. caráter condicionado por um alelo recessivo a. respectivamente. Questão 484 Dois grupos de mudas obtidas a partir de um mesmo clone de plantas verdes foram colocados em ambientes diferentes: um claro e outro escuro. c) dois óvulos D e dois óvulos d. as plantas que ficaram no escuro estavam estioladas o que significa que os dois grupos apresentam: a) o mesmo genótipo e fenótipos diferentes. d) apenas um óvulo Dd. Entre os possíveis gametas formados por essa ovogônia. e) apenas um óvulo D ou um óvulo d. gêmeos monozigóticos ou dizigóticos? a) 25% e 50% b) 25% e 75% c) 50% e 25% d) 50% e 50% e) 50% e 75% Questão 489 Em uma população de mariposas. Qual é a probabilidade de que pelo menos um dos gêmeos venha a ser afetado pela doença no caso de serem. cor escura. e) genótipos variados em cada grupo. c) apenas do cruzamento III. VVx vv II. portanto. e) 1% dos indivíduos da população têm deficiência da enzima E. na maioria das vezes. d) genótipos e fenótipos diferentes. Questão 488 Uma mulher normal. Questão 486 Qual a porcentagem de descendentes Aa nascidos de uma mãe Aa? a) 25% b) 50% c) 75% d) 100% e) depende do pai.

200 aa e 200 Aa. Questão 493 Dizemos que um determinado gene é recessivo quando sua expressão (fenótipo): a) só acontece em heterozigose. meiose. e) reproduz uma característica provocada pelo ambiente. b) trouxe gametas femininos com alelos para baixa estatura.100.800. aa . Mendel fez fecundações cruzadas. aa . meiose.200. Mendel ao enunciar essa lei já admitia. autofecundação. b) só ocorre quando em dose dupla. normalmente. a existência das seguintes estruturas e processo de divisão celular.50.100. Aa . b) núcleos. Para estudar os mecanismos de herança. o procedimento correto é analisar a prole resultante do cruzamento dessa mosca com outra de a) cor preta.500.condicionada por a) um par de alelos. Aa . sobre seu estigma. Questão 490 Uma população experimental contém 200 indivíduos AA. d) dois genes ligados com alta taxa de recombinação entre si. Questão 492 Em plantas de ervilha ocorre. removendo as anteras da flor de uma planta homozigótica de alta estatura e colocando. aa . 109 . d) genes.200. como a coloração dos troncos onde elas pousam. Aa .100 d) AA . publicado em 1866. respectivamente. Questão 495 "Cada caráter é condicionado por um par de fatores que se separam na formação dos gametas". c) um aminoácido em uma proteína. d) depende de características congênitas. e) impediu o encontro de gametas com alelos diferentes para estatura.50 b) AA . Com esse procedimento. d) uma trinca de bases do RNA mensageiro. Aa . que não apresentam dominância um sobre o outro. Aa . mitose. d) promoveu o encontro de gametas com os mesmos alelos para estatura.200. e) uma trinca de bases do RNA transportador. sendo o alelo para cor escura dominante sobre o que condiciona cor clara. pólen recolhido da flor de uma planta homozigótica de baixa estatura. e) fenótipo dominante.400. Todos os indivíduos AA foram cruzados com indivíduos aa e os indivíduos Aa foram cruzados entre si. c) genótipo igual ao seu.1000. Para determinarmos se uma mosca cinza é homozigota ou heterozigota quanto ao par de genes que condicionam esse caráter.100 Questão 491 Em seu trabalho com ervilhas. b) um par de alelos. espera-se encontrar entre os filhotes: a) AA . b) um segmento de DNA com informação para um RNA ribossômico. c) um par de alelos. b) cor cinza. c) trouxe gametas masculinos com alelos para baixa estatura. c) independe da presença de seu alelo. O conhecimento atual a respeito da natureza do material hereditário permite dizer que a letra A usada por Mendel simboliza a) um segmento de DNA com informação para uma cadeia polipeptídica. d) fenótipo igual ao seu. mitose. Considerando que cada casal produziu 2 descendentes. e) genes.100 c) AA .200 e) AA . sendo o alelo para cor clara dominante sobre o que condiciona cor escura. mitose. respectivamente: a) cromossomos. aa . e) fatores ambientais. aa . embora sem conhecer. o pesquisador a) impediu o amadurecimento dos gametas femininos. Questão 494 Moscas de coloração acinzentada cruzadas entre si fornecem moscas de cor preta. c) núcleos. Mendel representou os fatores hereditários determinantes dos estados amarelo e verde do caráter cor da semente pelas letras A e a.

000 b) 6. d) Todos os indivíduos marrons eram homozigotos. presença ou ausência de manchas nas axilas foliares. A partir desses resultados. Questão 499 Do cruzamento de duas moscas com asas nasceram 120 descendentes com asas e 40 sem asas.Questão 496 Em tomates. b) A proporção fenotípica em F1 é de 3/4 de indivíduos irregulares e de 1/4 de indivíduos regulares. Questão 498 Em uma determinada planta. respectivamente. em alguns casos.5.000 Questão 500 Em genética. assinale a alternativa correta. assinale a alternativa INCORRETA. cor das sementes. surgirão indivíduos regulares e irregulares na proporção 1:1. um único par de alelos determina mais de uma característica no organismo. 75% dos filhotes produzidos em F‚ tinham pêlo preto e 25% apresentavam pêlo marrom. d) Se um indivíduo F1 com nervuras regulares for cruzado com um indivíduo da geração P. com ervilhas. produzindo uma F composta por indivíduos marrons e pretos em igual quantidade. obteve-se uma geração F composta apenas de indivíduos com estames de cor púrpura. a) As plantas cruzadas são heterozigotas. originou-se uma F1 composta por plantas com nervuras regulares e outras com nervuras irregulares. Se os 120 descendentes com asas forem cruzados com moscas sem asas e se cada cruzamento originar 100 indivíduos. em que um único par de alelos é responsável por três características fenotípicas: cor das flores. b) Os indivíduos pretos de F eram homozigotos. 1. então a porcentagem de descendentes com estames verdes será de: a) 25% b) 50% c) 75% d) 0 e) 100% Questão 497 Em porquinhos da Índia. Uma fêmea preta foi cruzada com um macho marrom. e) Os indivíduos pretos da geração F eram heterozigotos e a fêmea parental era homozigota. Retrocruzando-se um macho preto de F com a fêmea parental. c) Todos os indivíduos pretos de F‚ eram heterozigotos.1 110 . o número esperado de indivíduos com asas e sem asas será. c) Todos os F1 com nervuras irregulares são heterozigotos.000 e 4. Isso ocorre. o estame pode ser de cor púrpura ou verde.000 e 4. o pêlo pode ser preto ou marrom.1.000 d) 9. Do cruzamento entre duas plantas com nervuras irregulares. Se esses indivíduos forem retrocruzados com os parentais de estames verdes. e) Os indivíduos F1 de nervuras regulares só podem ser homozigotos. A partir desses dados.000 e 3.000 e 3.000 e) 12. o padrão das nervuras foliares pode ser regular ou irregular.000 e 6. Cruzando-se plantas de estames de cor púrpura com plantas de estames verdes. a) 50% dos indivíduos pretos de F‚ eram heterozigotos. por exemplo. a) 6.000 c) 8. Esse fenômeno é conhecido como: a) herança aditiva b) poligenia c) pleiotropia d) codominância Questão 501 Analise o heredograma para um fenótipo recessivo esquematizado a seguir e assinale a afirmativa INCORRETA.

b) AA. c) Aa. Questão 502 Os bulbos da cebola podem ser brancos. recessivo. amarelos ou roxos. As duas enzimas são codificadas por genes alelos dominantes com segregação independente. 1/2 Aa e 1/4 aa c) 1/3 AA e 1/4 aa d) 1/4 Aa. c) O fenótipo ocorre igualmente em ambos os sexos. onde há predadores naturais da espécie. Porém. respectivamente. o alelo recessivo pode ser herdado por descendentes fenotipicamente normais. por: a) AA. dominante. as lacunas I.1 Analisando as informações apresentadas de acordo com os seus conhecimentos. existe um precursor incolor que. 1/2 AA e 1/4 aa e) É impossível determinar os genótipos utilizando os dados acima. Questão 503 Quando duas populações da espécie vegetal 'Zea mays' (milho). O gene para o albinismo é __(II)__ e não se manifesta nos indivíduos __(III)__. quando a geração F1 se intercruza. pois os genótipos serão: a) 1/2 AA e 1/2 aa b) 1/4 AA. e) aa. Nesses vegetais. São albinos apenas os indivíduos de genótipo __(IV)__. heterozigotos e aa. homozigoto e Aa. embora seja heterozigota. dominante. a proporção Em uma certa espécie de mamíferos. 111 . Animais com os três genótipos foram introduzidos em duas regiões diferentes designadas por I e II. b) haverá igual chance de adaptação de animais com os três genótipos apenas na região I. c) roxo com planta de bulbo roxo pode produzir todos os três fenótipos mencionados. fenotípica mendeliana 3:1 aparecerá na geração F2. que chamaremos de E1." No trecho acima. que apresentam genótipo __(I)__ podem ter filhos albinos. III e IV devem ser preenchidas correta e. se transforma em um pigmento amarelo. que a enzima E2 transforma em roxo. heterozigotos e aa. Questão 504 "Casais de pigmentação da pele normal. II. Nos dois ambientes. b) amarelo com planta de bulbo amarelo não produz plantas com bulbo roxo. c) haverá maior número de animais com genótipos EE e CC do que com genótipo EC na região I. é INCORRETO afirmar que o cruzamento de plantas de bulbo: a) incolor com planta de bulbo incolor só pode originar fenótipo incolor. de acordo com o esquema a seguir. EC e CC. heterozigotos e AA. d) amarelo com planta de bulbo incolor não produz plantas com bulbo roxo. uma homozigota para o alelo dominante (AA) e uma homozigota para um alelo recessivo (aa). Pode-se prever que a) haverá igual chance de adaptação de animais com os três genótipos nas duas regiões. Questão 505 1. b) Aproximadamente 1/4 das crianças de pais não-afetados pode ser afetado. há um caráter mendeliano com co-dominância e genótipos EE. Em I não há registro da presença do vírus X e em II ele é transmitido por contato com as presas da espécie.a) As pessoas afetadas possuem pelo menos um dos pais obrigatoriamente afetado. homozigoto e aa. os animais de genótipo CC são mais facilmente capturados pelos predadores.1. sob a ação de uma enzima. toda a descendência da primeira geração (F1) assemelha-se ao tipo parental dominante (Aa). recessivo. d) Aa.5. são cruzadas. d) Se um dos pais é heterozigoto. Sabe-se que animais heterozigóticos são mais resistentes a um dado vírus X do que os homozigóticos. dominante.

V e IV d) IV. que já tem uma menina normal.Fenótipo IV . só é possível concluir que a) o caráter é recessivo. I . c) os animais cruzados eram homozigotos. b) o caráter é dominante. II. A partir desses dados. d) os animais cruzados eram heterozigotos. também só originaram filhotes de cauda longa. De acordo com tais dados. associando os conceitos aos respectivos termos. Os descendentes. A seqüência correta é: a) II. III. mas não são obrigatoriamente iguais. Questão 508 Em cobaias. IV e III 112 . vir a ter um menino acondroplásico? a) 1 b) 3/4 c) 3/8 d) 1/4 e) 1/8 Questão 507 Considere que o comprimento da cauda. numa proporção de 3 descendentes vermelhos para cada branco (3:1). V. e) a seleção natural será mais favorável aos animais com genótipo EE na região II. II. I. quando cruzados entre si. pelo alelo recessivo. II.bastante numerosa. ( ) atuam sobre a mesma característica.Gene ( ) troca de fragmentos de cromossomos homólogos na primeira divisão da meiose. a cor preta do pêlo é condicionada por um alelo dominante e a cor branca. Se esses descendentes pretos forem cruzados entre si. Qual é a probabilidade de um casal de acondroplásicos. Questão 506 No homem. os cientistas constataram que apenas um em cada três descendentes vermelhos era homozigoto para essa característica. obteve-se uma primeira geração . numa dada espécie. V e IV c) II.F .Alelo V . a proporção fenotípica esperada na prole será de a) 3 pretos :1 branco b) 2 pretos :1 branco c) 1 preto : 3 brancos d) 1 preto : 2 brancos e) 1 preto :1 branco Questão 509 Sabe-se que a transmissão hereditária da cor das flores conhecidas como copo-de-leite se dá por herança mendeliana simples. seja condicionado por um par de alelos. ( ) segmento do DNA capaz de transcrever uma molécula de RNA. a acondroplasia é uma anomalia determinada por um gene autossômico dominante.d) a seleção natural será mais favorável aos animais com genótipo EC na região II. ( ) conjunto de genes organizados nos cromossomos. Em um cruzamento experimental de copos-de-leite vermelhos. I. V. IV e III b) III. Um cruzamento-teste de um indivíduo de cor preta produziu descendentes brancos e pretos em igual número.Crossing-over III . III e V e) I. e) o genótipo dos descendentes difere do dos pais. I.Genoma II . com dominância completa. Analisando o genótipo da F. Animais com cauda longa foram cruzados repetidas vezes entre si originando sempre descendentes com cauda longa. ( ) conjunto de características detectáveis de um indivíduo. pode-se afirmar que a produção genotípica da F desse cruzamento experimental foi: a) 4 Aa b) 2 Aa : 2 aa c) 3 AA : 1 Aa d) 1 AA : 2 Aa : 1 aa Questão 510 Numere a segunda coluna de acordo com a primeira. I.

em conseqüência da alta a) interação de genes recessivos. Assinale: a) se somente I e II estiverem corretas.A calvície pode ser originada por causas ambientais. b) X. b) taxa de crossing-over. mas na maioria dos casos é claramente hereditária. 100% de mudas altas ao cruzar mudas altas em P1 com mudas altas em F2. O enunciado da Primeira Lei de Mendel diz que os alelos de um gene separam-se durante a formação dos gametas. sejam mais produtivas. a 2 e a 3 são corretas. c) se somente I estiver correta. c) freqüência de genes em heterozigose. 1.1. I. Questão 512 Com o enorme crescimento populacional. e) se I. d) inativação de alelos codominantes. 100% de mudas altas ao cruzar mudas altas em F2. e) ocorrência de pleiotropia.poderiam apresentar mudas com alturas diferentes. e) Apenas a 2. d) se somente II e III estiverem corretas. por exemplo. c) Apenas a 1. o que estimula a obtenção de culturas vegetais com máxima produtividade. c) Y. 5 . 100% de mudas altas ao cruzar mudas altas em P1 com mudas médias em F2.Um homem calvo (homozigoto) transmite a característica da calvície a todos os filhos homens nascidos de seu casamento com uma mulher não calva. A fase da meiose. há também uma necessidade crescente de alimentos. e) Y. é a Anáfase I. sabe-se que o cruzamento de duas linhagens homozigotas selecionadas pode produzir espigas maiores e de melhor qualidade comercial. O enunciado da Segunda Lei de Mendel diz que quando dois ou mais genes estão envolvidos. podese afirmar que se obtém na espécie: a) X e na espécie Y.Uma mulher será calva se seus pais forem calvos e se sua mãe (heterozigota) possuir um de seus genitores calvo.Em nenhuma hipótese a calvície ocorre na mulher. a 4 e a 5 são corretas. cada um atua e segrega independentemente dos demais. b) Apenas a 1. Muitas vezes esse melhoramento lança mão do conhecimento da herança genética de um determinado carácter como.A calvície é dominante no sexo masculino 4 . III. 3 . II. d) Apenas a 1.Questão 511 Considere as seguintes proposições: 1 . realizou-se cruzamento entre mudas altas e baixas das duas espécies (P1). 2 . 100% de mudas altas ao cruzar as mudas médias em F2. b) se somente I e III estiverem corretas. II e III estiverem corretas. a 3 e a 4 são corretas. Supondo-se que duas espécies vegetais . a 2 . tanto da espécie X quanto da espécie Y.1 113 . Questão 513 No que se refere ao desenvolvimento do chamado milho híbrido. a 3 e a 4 são corretas. Questão 514 Considere as proposições seguintes. Concluiu-se com relação a estas proposições que: a) Apenas a 2.X e Y . 50% de mudas altas ao cruzar as mudas altas em F1.5. obtendo F1 que ao serem fenótipos resultantes dos cruzamentos foram representados nos gráficos a seguir: upondo que as plantas altas. a altura. responsável pela ocorrência da Segunda Lei de Mendel. a 3 e a 4 são corretas. a 3. por se tratar de herança ligada ao sexo. d) Y.

obteve na primeira geração (F) todos os descendentes de coloração verde. mutantes. as plantas de flores brancas. Questão 519 Esta figura representa o cruzamento de drosófilas de asas normais com indivíduos de asas enroladas.1. Questão 516 A primeira Lei de Mendel refere-se a) ao efeito do ambiente para formar o fenótipo. Se Mendel utilizasse como genitor masculino as plantas de flores púrpuras e como feminino. A figura a seguir representa um dos cruzamentos realizados por Mendel entre plantas de ervilhas com flores púrpuras e plantas com flores brancas. b) um cruzamento de dois genitores homozigotos contrastantes.5.1. EXCETO: a) A expressão do alelo recessivo do gene desaparece apenas em F. d) 50% de flores púrpuras e 50% de flores brancas. e) 100% de flores de coloração rósea. d) o processo de seleção natural. Questão 518 A coloração das flores de ervilha é determinada por herança autossômica. e) Os indivíduos que apresentam vagens de coloração verde em F‚ são heterozigotos. b) As plantas com vagens verdes ou amarelas da geração parental devem ser homozigotas. c) um cruzamento de dois genitores heterozigotos. criadas em temperatura de 25°C. 1. c) a transmissão dos caracteres adquiridos.Questão 515 A primeira lei de Mendel ou lei da segregação significa: a) um cruzamento onde se considera apenas um gene. c) O alelo dominante do gene se expressa em cor verde. Questão 520 Analise esta tabela: MÉDIA DAS DIFERENÇAS NAS CARACTERÍSTICAS ENTRE GÊMEOS MONOZIGÓTICOS E DIZIGÓTICOS 114 . representado por dois alelos. os descendentes obtidos em F1 apresentariam 1. e) à união dos gametas para formar o zigoto. d) à ocorrência de genótipos diferentes em uma população. d) a separação de um par de alelos durante a formação dos gametas. c) à ocorrência de fenótipos diferentes em uma população. Todas as alternativas apresentam conclusões a partir desses resultados. c) 75% de flores púrpuras e 25% de flores brancas.1 a) 100% de flores brancas. apresentam asas normais.5. O resultado desse fenômeno ilustra a) a adaptação dos mutantes. b) 100% de flores púrpuras. Questão 517 Quando Mendel cruzou plantas de ervilha apresentando vagens de coloração verde com plantas de vagens de coloração amarelas. Na segunda geração (F‚) obteve 428 verdes e 152 amarelas.1 s moscas de genótipo igual ao do tipo III. b) à segregação do par de alelos durante a formação dos gametas. d) O caráter é controlado por um par de genes. b) a influência do ambiente na expressão do genótipo. e) um caráter controlado por dois ou mais genes. quando criadas em temperatura de 16°C.

5. d) o comprimento da cabeça apresenta maior influência ambiental.5. Analise este gráfico.1. om base nos dados dessa tabela e em outros conhecimentos sobre o assunto. a) em torno dos 65 anos. As sardas aparecem igualmente em homens e em mulheres. filhos de casais Aa × aa têm 50% de probabilidade de manifestar a doença. b) as diferenças entre gêmeos MZ indicam diferenças genéticas entre eles.1 1. c) aos 30 anos.1. d) aos 40 anos.1. a) Ligação genética b) Penetrância completa c) Pleiotropia d) Herança quantitativa e) Polialelia Questão 523 A presença de sardas em seres humanos é uma característica hereditária determinada por um par de alelos. é CORRETO afirmar que a) o peso é a característica que apresenta maior influência genética. é INCORRETO afirmar que. indivíduos portadores do alelo mutante podem expressar a doença. a surdez congênita e a esclerótica azulada. Questão 522 Na espécie humana há um gene que exerce ação simultaneamente sobre a fragilidade óssea.1 Com base nas informações desse gráfico e em outros conhecimentos sobre o assunto. aproximadamente 75% dos indivíduos Aa se apresentam sem os sinais clínicos da doença. convulsões e morte.5. podem ser transmitidas de pai para filho. cerca de 85% dos indivíduos heterozigotos já manifestaram a doença. e só pessoas com sardas podem ter filhos com sardas (veja no heredograma abaixo). c) a influência ambiental pode ser avaliada em gêmeos MZ. b) antes de atingirem a idade de 15 anos.1 115 .1. ocorrem em todas as gerações. em que se mostra o percentual de indivíduos doentes entre aqueles que possuem genótipo favorável: 1. Os indivíduos afetados são heterozigotos. Assinale a alternativa que define o caso. Questão 521 O mal de Huntington é uma doença autossômica dominante caracterizada por deterioração mental progressiva.

(32) Numa prole numerosa. origina descendentes predominantemente heterozigotos. (16) Um indivíduo híbrido é aquele que resulta da união entre dois indivíduos geneticamente diferentes. Machos e fêmeas sentem-se atraídos por odores de linhagens não relacionadas. (04) A probabilidade de acondroplasia na descendência é igual a zero. Em relação aos descendentes deste último casamento e ao caráter em questão. b) a presença de sardas se deve a um alelo recessivo ligado ao cromossomo X. (02) O cruzamento entre indivíduos geneticamente diferentes. a freqüência fenotípica será de 1 acondroplásico para 1 normal. Soma ( ) 1. Soma ( ) Questão 526 Cheiros e odores corporais fazem parte do aparato de comunicação em várias espécies de mamíferos. seleção de parceiros e restrições ao endocruzamento. da mesma espécie. é correto afirmar: (01) O descendente será obrigatoriamente heterozigoto. (08) A probabilidade de heterozigose na descendência em relação a este locus é igual a zero.5.1. Quais os genótipos dos pais. A respeito desse assunto. e) a presença de sardas se deve a um alelo autossômico dominante. c) a presença de sardas se deve a um alelo dominante ligado ao sexo. Este se casa com uma mulher normal cujos pais eram normais (conforme heredograma abaixo). d) a presença de sardas se deve a um alelo autossômico recessivo. (16) A freqüência fenotípica numa prole numerosa será 3:1. Questão 524 Uma ovelha branca ao cruzar com um carneiro branco teve um filhote de cor preta. (08) O endocruzamento não interfere no valor adaptativo. é possível deduzir que a) a presença de sardas se deve a um alelo recessivo ligado ao cromossomo Y. reconhecimento da prole. dispersão dos filhotes ainda jovens.abendo disso. (04) O endocruzamento pode causar uma redução no valor adaptativo pela maior probabilidade de ocorrência de genótipos ou combinações homozigotas de alelos recessivos deletérios.1 116 . Da união de um homem acondroplásico com uma mulher normal resulta um filho normal. é correto afirmar: (01) O cruzamento entre indivíduos geneticamente diferentes. por exemplo. origina descendentes homozigotos. se a cor branca é dominante? a) Ambos são homozigotos recessivos b) Ambos são brancos heterozigotos c) Ambos são homozigotos dominantes d) A mãe é Bb e o pai é BB e) A mãe é bb e o pai é Bb Questão 525 A acondroplasia (uma das formas de nanismo) é causada por um gene dominante autossômico. da mesma espécie. influenciando uma variedade de atividades como. considerando ausência de mutação. (02) A freqüência genotípica na descendência será 1:2:1.

amplamente utilizado em experimentos na área de genética e evolução. ( ( ( ( ( ) Apresenta variantes genéticas facilmente observáveis. Os produtos de uma cadeia de reações podem ser utilizados em muitas outras vias metabólicas. com a mesma característica. de 117 . Os pais de Maria também têm pigmentação normal. representando o mecanismo de transmissão da fibrose cística: Questão 529 A Primeira Lei de Mendel ou Lei da Segregação dos Genes pode ser relacionada a uma das fases do processo meiótico. Assinale com V (verdadeiro) ou F (falso) as afirmações a seguir sobre esse inseto. por parte de mãe. A afirmação acima se refere ao conceito de a) dominância incompleta. Assinale a alternativa que apresenta a fase referida. em 02 de julho de 1995. Que informações permitem avaliar com maior precisão as chances de João e Maria terem um filho albino? a) O fenótipo da irmã de João e o genótipo do avô de Maria. Seus pais não são albinos. ) Apresenta pequeno número de cromossomos. são interligadas e freqüentemente interdependentes. iniciaram-se as comemorações do centenário da utilização da 'Drosophila' sp. porém João tem uma tia paterna albina e um primo. João tem um irmão albino e uma irmã com pigmentação normal. e) fenocópia. Assim. c) O fenótipo do irmão de João e o fenótipo da irmã de Maria. Assinale a opção que faz referência a esse erro. c) A doença somente se manifesta quando dois indivíduos portadores são cruzados. em sua maioria. d) O genótipo do primo de João e o fenótipo da mãe de Maria. b) A fibrose cística é causada pela presença de um par de genes recessivos. na pesquisa científica. e) O fenótipo do pai de João e o genótipo do pai de Maria. a) Prófase I b) Metáfase I c) Anáfase I d) Metáfase II e) Telófase II Questão 530 João e Maria estão pensando em ter um filho. ) Não apresenta dimorfismo sexual. Questão 531 Em 2005.1. ) Apresenta autofecundação. A seqüência correta de preenchimento dos parênteses. ) Apresenta ciclo reprodutivo curto e fecundidade alta. foi ilustrada com o esquema a seguir.Questão 527 A matéria publicada no Jornal O GLOBO.5. c) pleiotropia. a) Os indivíduos 3 a 6 são heterozigotos para a fibrose cística. b) O genótipo da tia de João e o genótipo do irmão de Maria. Questão 528 As reações bioquímicas. 1. não é surpreendente que a expressão fenotípica de um gene envolva mais do que uma característica. b) heterogeneidade genética. d) O indivíduo 8 é homozigoto dominante para a fibrose cística. e) O indivíduo 18 é afetado pela fibrose cística e não um portador desta doença. Já Maria tem um avô materno e uma irmã albinos e um irmão com pigmentação normal. d) alelismo múltiplo.1 O esquema publicado apresenta um erro. com o título "Teste ajuda a evitar doenças congênitas".

.3/8 d) 6/8 . não havia histórico de calvície.V . De acordo com a hipótese de segregação de fatores proposta por Mendel. Hermione é bruxa mas filha de trouxas (não bruxos).V .1 Todos os descendentes pretos de F2 foram cruzados com os F1. c) Apenas I e III. II e III. somente em homozigose.V . 118 .V .5/8 b) 4/8 . III . filho de uma bruxa e de um trouxa. preocupado com a possiblidade de vir a ser calvo. Assim concluiu que a chance de Leandro vir a ser calvo era de 50%. resultando em 192 descendentes..F . na ordem em que aparecem. Questão 532 Conforme correspondência publicada na revista científica "Nature" de agosto de 2005 (p..1/8 Questão 534 Leandro.V.1...F . e) sua avó materna ser heterozigota.V . Rony.. filho de bruxos.5. e) I.F . c) sua avó paterna ser heterozigota. 776)..V .. c) V . Essa conclusão baseia-se no fato de a) sua mãe ser heterozigota. Com base no texto... d) Apenas II e III. I ...V..V . Seu amigo explicou que a calvície é uma característica influenciada pelo sexo e que se expressa nos homens em homo e heterozigose e nas mulheres. sua avó materna era.obedece ao proposto pela 1 Lei de Mendel.F ..Hermione apresenta dois alelos para o caráter bruxo. embora seus pais não fossem calvos.. consultou um amigo que estava estudando genética. a) 3/8 .F . b) Apenas II.Simas é heterozigoto para o caráter bruxo.. Simas é bruxo. II .F..V.F . de ervilhas verdes. foi sugerido que a característica de ser ou não bruxo seguiria padrão de segregação mendeliana. considere as seguintes afirmações sobre o caráter bruxo em termos genéticos.2/8 e) 7/8 . d) V .. Neville e Draco. Na família do avô materno.. provenientes de famílias bruxas tradicionais.F. filhos de pais bruxos... a produção de uma geração Fƒ a partir da autofertilização da geração F‚ resultante do cruzamento de ervilhas parentais homozigotas amarelas (AA) e verdes (aa) produziria .Contou que. e) V . Questão 535 Considere que o caráter analisado .cor da pelagem em coelhos .F ...Harry é menos bruxo que Rony. b) seu avô paterno ser calvo. Harry é bruxo.4/8 c) 5/8 . d) seu pai ser heterozigoto. Assinale o número esperado de descendentes com pelagem branca... tendo sido realizados os cruzamentos a seguir: 1.. Neville e Draco são bruxos... Questão 533 Assinale a alternativa que preenche corretamente as lacunas do texto a seguir.F . b) F . de ervilhas amarelas e . Quais estão corretas? a) Apenas I. sendo sua mãe filha de trouxas.cima para baixo é a) F .

d) Pode ser muito difícil determinar se o fenótipo resulta mais do efeito gênico do que o ambiental. d) Analisando apenas as filhas. Esse único evento resultou na formação de um alelo (S) autossômico e dominante. Questão 537 Por meio da técnica do DNA recombinante.Questão 536 Em vários cultivos.1. de zigoto de camundongo. gerando um camundongo macho gigante. Desta forma. uma cópia de um gene humano. 25% poderá ser de meninos-aranha. d) 100%. Considerando que o homem-aranha é o único a ter essa mutação. provavelmente. por exemplo. 119 . d) formada por homozigotos para o alelo dominante. Se o pólen de uma planta heterozigota para um determinado loco gênico fecundar os óvulos de uma planta também heterozigota para esse loco. d) 75% com alelo dominante e 25% com alelo recessivo. Para a produção de milho. um indivíduo heterozigoto para um caráter regulado por dominância completa provavelmente produzirá a seguinte porcentagem Suponha que um evento de mutação permitiu ao homem-aranha secretar a seda formadora de teia. mas com expressão influenciada pelo sexo. b) 50% dominante e 50% recessiva. Questão 540 1. espera-se que a F seja a) 100% heterozigota. não portadora do gene do hormônio do crescimento. e) Na presença de genes recessivos. Questão 539 Os mecanismos da herança apresentam diferentes maneiras pelas quais os genes interagem entre si e com o ambiente para manifestarem seus efeitos no fenótipo dos seres vivos.1 Se o camundongo macho gigante cruzar com uma fêmea normal. c) Os genes dominantes são independentes dos fatores ambientais para se expressarem. 50% delas deverão ser normais. c) 50% heterozigota. e) 75% com alelo recessivo e 25% com alelo dominante. Com relação aos princípios básicos da hereditariedade. c) 50%. responsável pela síntese do hormônio do crescimento (somatotrofina). Assinale a afirmativa CORRETA: a) Terá filhas-aranha se casar com uma prima de primeiro grau. a expectativa quanto aos fenótipos de seus futuros descendentes poderá ser uma entre as possibilidades abaixo. Este zigoto foi implantado em uma "mãe de aluguel". b) Todos os seus meninos deverão ter o fenótipo "aranha". mulheres-aranha seriam esperadas na população apenas se tal alelo ocorresse em homozigose (SS). b) Na expressão gênica os efeitos do ambiente celular não são considerados. 25% homozigota dominante e 25% homozigota recessiva. Questão 538 De acordo com a primeira lei de Mendel. na fase G do ciclo celular. o que se deseja é a produção de sementes. e) formada por homozigotos recessivos. b) 100% com alelo dominante. será igual a a) zero. foi integrada a um único cromossomo. a fração de descendentes gigantes. é necessário que ocorra a polinização. c) Na geração F1.5. assinale a alternativa CORRETA: a) Os genes codominantes têm menor influência no fenótipo do que os fatores ambientais. c) 50% com alelo recessivo e 50% com alelo dominante. apenas o efeito ambiental prevalece no fenótipo. b) 25%. e) Quem herdar o cromossomo Y deverá ser uma criança-aranha. de gametas: a) 100% com alelo recessivo.

5. b) 60.5. das quais 240 tinham pêlos curtos. pois o genótipo dos filhos não é alterado pela insulina. Entre as cobaias de pêlos curtos.1 120 . julgue os itens abaixo. pois nesses casos o genótipo pode ser alterado evitando a manifestação da doença nos filhos. Se detectada a tempo. Questão 543 O gene autossômico. por meio do qual se identifica a fenilcetonúria. o número esperado de heterozigotos é: a) 45. (4) A probabilidade de que o casal formado pelos indivíduos 10 e 11 tenha um descendente do sexo masculino fenilcetonúrico é igual a 12. e) 180. d) 160. d) Sim. que pode apresentar dominância ou recessividade. (2) O cruzamento entre os indivíduos 10 e 11 ilustra como a consangüinidade influencia o aparecimento de doenças hereditárias. os sintomas podem ser evitados por meio de injeções diárias de insulina.1. (3) Os homens normais representados no heredograma são necessariamente heterozigotos. e) Depende do tipo de diabete.Questão 541 No Brasil. 1.5%. foram realizados cruzamentos entre esses animais.1 Considerando o heredograma.1. Do cruzamento de cobaias heterozigotas nasceram 300 cobaias. Questão 544 Considerando-se que a cor da pelagem de cobaias é determinada por um par de alelos. uma lei determina que os recém-nascidos sejam submetidos ao "teste do pezinho". pois tanto o genótipo como o fenótipo dos filhos são alterados pela insulina. Questão 542 Os vários tipos de diabete são hereditários. Em algumas dessas formas. doença hereditária que pode levar ao retardamento mental. c) 90. O heredograma seguinte ilustra uma situação em que há indivíduos fenilcetonúricos. embora o distúrbio possa aparecer em crianças cujos pais são normais. é dominante em relação ao gene que determina pêlos longos. essa doença pode ser controlada ministrando-se ao recém-nascido uma dieta especial. (1) O caráter fenilcetonúrico apresenta herança autossômica dominante. que condiciona pêlos curtos em cobaias. com prejuízo da fala e dos movimentos. c) Sim. conforme a tabela. b) Não. A administração de insulina aos diabéticos evitará que eles tenham filhos com este distúrbio? a) Não. pois a insulina é incorporada no sangue fazendo com que os filhos não apresentem o distúrbio. (5) A dieta especial a que devem ser submetidos os recém-nascidos fenilcetonúricos tende a alterar a freqüência do gene da fenilcetonúria na população. pois a insulina é incorporada nas células e terá ação nos filhos. 1.

os pais são heterozigotos. e) ligada ao cromossomo Y e recessiva. d) no cruzamento IV. os genótipos dos pais podem ser diferentes. Isto se explica porque: a) muitas plantas verdes são heterozigóticas. o fenótipo recessivo é mascarado pelo fenótipo dominante. pode-se dizer que o tipo de herança responsável por essa síndrome é a) autossômica recessiva. normais. c) no cruzamento III. nasceram 15 filhotes azulados. Indique qual será o resultado do cruzamento da variedade de flores rosas (F‚). d) em 50% da prole. considerando que o alelo Aé dominante sobre a. b) em 25% da prole. respectivamente: a) herança quantitativa e homozigotos dominantes. e) 50% da prole possuem um único tipo de alelo e 50% possuem outro tipo de alelo. o fenótipo dominante é mascarado pelo fenótipo recessivo.análise da tabela permite concluir que a) no cruzamento I. a proporção fenotípica observada em F‚ significa exatamente que: a) 25% da prole expressam o fenótipo determinado pelo alelo dominante e 75% não o expressam. podem ocorrer três genótipos diferentes entre os descendentes. e) epistasia e homozigotos dominantes. é necessário cruzar: a) duas plantas de flores rosas. entre outras manifestações. 7 brancos e 8 pretos. As flores vermelhas e brancas são homozigotas. Questão 550 As flores da planta maravilha podem ser vermelhas. por suscetibilidade aumentada a infecções e tendência a sangramentos. é possível o aparecimento de indivíduos albinos. Na geração F todas as flores eram rosas. c) 75% da prole expressam o fenótipo determinado pelo alelo A e 25% não o expressam. a) 25% brancas : 25% vermelhas : 50% rosas b) 25% brancas : 50% vermelhas : 25% rosas c) 100% rosas d) 50% vermelhas : 50% rosas e) 50% brancas : 25% vermelhas : 25% rosas Questão 549 Do cruzamento entre aves andaluzas de coloração azulada. d) herança ligada ao sexo e homozigotos recessivos. existe uma síndrome caracterizada. Trata-se de um caso de _____________ e os indivíduos parentais são _______________. enquanto as rosas são heterozigotas. Ao fazer a genealogia de vários indivíduos. e) no cruzamento V. brancas ou rosas. d) ligada ao cromossomo X e recessiva. os pais são heterozigotos. c) plantas albinas tornam-se verdes na presença de luz. Para se obter 50% de flores brancas. b) uma planta de flores brancas com outra de flores rosas. b) autossômica dominante. O preenchimento correto das lacunas é. Essa síndrome é mais freqüente em descendentes de casais aparentados e ocorre em machos e fêmeas em proporção relativamente igual. d) o gene para albinismo é ativado no escuro. b) codominância e heterozigotos c) linkage e heterozigotos. Com base nessas informações. b) plantas normais homozigóticas tornam-se albinas na ausência de luz. Embora plantas albinas morram antes de produzirem sementes. a característica "albinismo" não desaparece entre elas. Questão 548 Mendel cruzou duas variedades de 'Mirabilis jalapa'. Questão 546 Em um cruzamento de um indivíduo AA com outro aa. observou-se que a síndrome não se manifesta em algumas gerações e pode ocorrer em indivíduos que aparentemente têm pais normais. Questão 545 Em gatos. Questão 547 No cruzamento de plantas verdes. c) uma planta de flores rosas com outra de flores 121 . são observados dois fenótipos e três genótipos entre os descendentes. e) o albinismo impede a síntese de clorofila. b) no cruzamento II. c) ligada ao cromossomo X e dominante. uma com flores vermelhas e outra com flores brancas.

Essa distribuição é característica de um padrão de herança a) recessiva. essas pessoas perdem a capacidade de digerir o açúcar do leite. no Canadá. o caráter tonalidade da cor das folhas e ramos é transmitido geneticamente através do citoplasma dos óvulos. causada pela deficiência da enzima lactase. Questão 551 A maioria das populações é composta por pessoas que manifestam perda progressiva da lactase intestinal após o desmame. Este gene. c) as plantas de flor rosa eram recessivas. Agosto de 1999. d) uma planta de flores vermelhas com outra de flores brancas. A tabela abaixo apresenta o resultado de seis possíveis cruzamentos. notou a existência de plantas de uma mesma espécie que possuíam indivíduos com flores brancas. 1. e) trata-se de um caso de gene letal. codifica a síntese de uma enzima que 122 . estas últimas em quantidade duas vezes maior que as plantas de flor branca e vermelha. afirmam que o gene CYP2A6 está ligado à dependência das pessoas ao cigarro. d) O fenótipo pode ser influenciado por fatores ambientais. e) duas plantas de flores vermelhas. e) quantitativa. nas populações ocorrem três fenótipos relacionados à atividade da enzima: indivíduos sem atividade de lactase. em sua forma normal. é INCORRETO afirmar: a) A propagação vegetativa de uma planta verde deve produzir plantas verdes. Três fenótipos são observados: verde. Valéria promoveu uma autofecundação nas plantas de cor rosa e. Essa característica é autossômica e. b) dominante. verde pálido. pesquisadores da Universidade de Toronto. (Adaptado de "Ciência Hoje". 49) A alergia ao leite pode ser hereditária. variegadas (pigmentação irregular). obtendo plantas que só davam flores de cor rosa. respectivamente. Em conseqüência da falta dessa enzima. obteve plantas que davam flores brancas.1. rosas e vermelhas. d) co-dominante. c) epistática. p.2 e acordo com a tabela e com seus conhecimentos. Observando seu jardim. Questão 552 Valéria gostava muito de flores. b) Genes estão envolvidos na determinação dos fenótipos. vermelhas e rosas. para sua surpresa. Curiosa para saber como se dava a transmissão desse caráter.5. a lactose. a) 1 : 3 : 1 e 3 : 1 b) 1 : 2 : 1 e 1 : 2 : 1 c) 1 : 1 : 2 e 1 : 1 : 1 d) 1 : 3 : 1 e 3 : 1 : 3 e) 1 : 1 : 1 e 3 : 1 Questão 555 Em estudo publicado na revista Nature de 25 de junho passado. Questão 554 No monoibridismo com co-dominância ou dominância intermediária.vermelhas. d) as plantas de flor vermelha eram dominantes e as de cor branca recessivas. c) É uma herança ligada ao sexo em vegetais. b) trata-se de um caso de co-dominância entre os genes alelos que determinam o padrão de cor. indivíduos com atividade de lactase e indivíduos com atividade parcial da lactase. pois o cruzamento de plantas de flores brancas e vermelhas só originou flores rosas. Questão 553 Em "Mirabilis jalapa" (maravilha). Valéria concluiu CORRETAMENTE que: a) trata-se de dominância da cor rosa sobre as demais. as proporções genotípicas e fenotípicas observadas na segunda geração dos filhos serão.

pois o fenótipo apresenta uma continuidade entre dependentes e não dependentes. b) os indivíduos HbA/HbS e HbS/HbS devem apresentar os mesmos níveis de hemoglobina anormal. é CORRETO afirmar que a) o gene HbA é dominante sobre o gene HbS. portadores de um alelo normal e outro defeituoso. Fumantes portadores de dois alelos normais (homozigoto para o alelo normal) são altamente dependentes do cigarro. c) os indivíduos que produzem só hemácias anormais podem ser curados por meio de transfusão sangüínea. é correto afirmar que a dependência ao cigarro determinada pelo gene CYP2A6 é um caso de: a) herança quantitativa.2 Considerando-se as informações contidas nesta tabela e outros conhecimentos sobre o assunto. d) o gene que determina "plumagem azulada" é dominante sobre os genes que determinam "plumagem preta" ou "plumagem branca". ainda. enquanto que portadores de dois dos alelos defeituosos. são moderadamente dependentes.1. três alelos para este gene: um normal e dois defeituosos. tornando as pessoas dependentes. Questão 557 Analise esta tabela. b) pleiotropia. é INCORRETO afirmar que a) os pares de genes que determinam o "tipo" e a "cor" da asa nas moscas estão localizados em cromossomas não-homólogos. c) as plantas da F2 com "sementes rugosas". cada uma delas. fumantes heterozigotos. d) um determinado genótipo pode produzir diferentes fenótipos. b) as características "tipo de semente" e "cor de plumagem" são determinadas.metaboliza a nicotina.5. resultantes dos cruzamentos de linhagens puras de três organismos diferentes: 1. pois qualquer um dos alelos defeituosos inibe. por um único par de gene.5.1.2 1. originam apenas descendentes com sementes rugosas. consumindo 20% menos cigarros que os fumantes inteiramente dependentes. parcialmente. em que estão relacionadas características das gerações F1 e F2. na espécie humana. Questão 556 Observe o esquema. jamais se tornam dependentes. c) epistasia recessiva. Por outro lado. Com base nesse esquema e em conhecimentos sobre o assunto. e) dominância incompleta entre a forma normal e as defeituosas do gene CYP2A6. pois o heterozigoto apresenta fenótipo diferente de ambos os homozigotos. apesar de fumantes. quando autofecundadas. Eles afirmam. d) dominância completa da forma normal do gene CYP2A6 sobre as formas defeituosas. a ação do alelo normal. 123 . que há. Com base no texto anterior.

enquanto mulheres C¢C¢ são calvas e C¢C£ são normais. Questão 559 Um experimentador cruzou duas linhagens puras de uma planta denominada boca-de-leão. II e III são. Questão 560 A talassemia é uma doença hereditária que resulta em anemia. portanto. Indivíduos homozigotos com genótipos (CßCß) apresentam flores brancas. co-dominância e expressão gênica influenciada pelo sexo. certamente apresentam genótipos homozigotos. descendentes do cruzamento de um homem e uma mulher portadores de talassemia menor. cujo genótipo (CÑCÑ) define cor vermelha nas flores. heterozigotos. (16) a F‚ esperada será constituída de 50% de indivíduos homozigotos e 50% de indivíduos heterozigotos. b) dominância incompleta. o genótipo IÞIß determina tipo sangüíneo AB. o vermelho e o cor-de-rosa. O primeiro morreu aos 5 anos de idade. Herança: dominância completa. o segundo é normal e bastante suscetível a malária (doença endêmica na região). qual das alternativas a seguir representa a fração de indivíduos adultos. Herança: epistasia dominante. foram obtidas plantas com flores exclusivamente brancas. Na planta boca-de-leão. c) 3Ž filho ë heterozigoto. corretamente. (04) as linhagens puras. d) epistasia. c) co-dominância. dominantes com relação ao alelo i. Da autofecundação das plantas da F. Sabendo-se que todos os indivíduos com talassemia maior morrem antes da maturidade sexual. Os heterozigotos resultantes do cruzamento entre essas duas linhagens (CÑCß) apresentam flores de cor rosa.Questão 558 Um casal de africanos teve três filhos. que deram origem ao experimento. b) pai ë heterozigoto. a) 2Ž filho ë homozigoto recessivo. identificada como talassemia maior e os heterozigotos MN. Herança: co-dominância. Homens com genótipo C¢C¢ (homozigotos) ou C¢C£ (heterozigotos) são calvos. I. indivíduos com genótipos IÞIÞ ou IÞi apresentam tipo sangüíneo A e os com genótipos IßIß ou Ißi apresentam tipo sangüíneo B. (02) a proporção genotípica esperada nas plantas de F‚ é: 1 planta com flores cor-de-rosa: 2 plantas brancas: 1 planta vermelha. Tanto homens quanto mulheres C£C£ são normais. Herança: pleiotropia. Indivíduos homozigotos NN são normais. Em humanos. há indivíduos homozigotos. uma constituída de plantas com flores brancas e outra com flores vermelhas. o membro da família com seu respectivo genótipo e o padrão de herança da anemia falciforme. e) herança poligênica. em conseqüência de anemia falciforme. (08) os indivíduos de F eram. o último é normal. que serão anêmicos? a) 1/2 b) 1/4 c) 1/3 d) 2/3 e) 1/8 Questão 561 Considere as seguintes formas de herança: I. apresentam uma forma mais branda chamada de talassemia menor. 124 . Assinale a opção em que se indicam. dominância incompleta e expressão gênica influenciada pelo sexo. certamente. respectivamente. III. porém pouco suscetível a malária. co-dominância e dominância incompleta. pleiotropia e penetrância incompleta. d) mãe ë homozigoto dominante. A calvície é determinada por um alelo autossômico. Os alelos IÞe Iß são. epistasia e pleiotropia. II. A descendência originada (F) apresentou apenas plantas com flores cor-de-rosa. Indivíduos homozigotos MM apresentam a forma mais grave. vermelhas ou cor-de-rosa. exemplos de a) dominância incompleta. Por outro lado. considerando que neste experimento: (01) ocorreu a segregação de três fenótipos: o branco. Assinale a(s) proposição(ões) VERDADEIRA(S).

4 a) autossômica dominante . c) pleiotrópico.Ss. Questão 563 Os gráficos I e II representam a freqüência de plantas com flores de diferentes cores em uma plantação de cravos (I) e rosas (II). a pelagem branca é condicionada pela presença do gene "A". c) I: 1 gene com dominância incompleta. b) nos genótipos homozigotos. assinale a opção correta quanto ao tipo de herança e os genótipos dos indivíduos 1. letal em homozigose. II: 1 gene com alelos múltiplos. e) I: 2 genes com interação. Seu alelo recessivo "a" condiciona pelagem preta. Ss. II: 2 genes com dominância incompleta. a dominância parcial e a codominância entre alelos definem-se. II: vários genes com interação.5. Questão 564 Em aves. e) autossômica recessiva . Ss e SS. Quando aves anômalas heterozigóticas são cruzadas.SS. ss e ss.1. esperam-se as seguintes proporções de camundongos de pelagem branca e preta. e) epistático. ss. originam uma descendência com indivíduos anômalos e normais numa proporção de 2 :1. Ss e Ss. é possível deduzir que o alelo que condiciona a anomalia é a) letal em homozigose. d) I: 3 genes com dominância incompleta. No heredograma a seguir. a) nos genótipos heterozigotos. 2. ss. d) nos genótipos recessivos. ss. b) I: 1 gene com dominância incompleta. respectivamente. e) na ligação gênica. Ss e Ss. 3 e 4. Na espécie humana há um tipo de surdez hereditária que é determinada por um par de genes.Ss. respectivamente: a) 1/2 e 1/2 b) 1/4 e 3/4 c) 2/3 e 1/3 d) 3/4 e 1/4 Questão 566 1. Questão 565 Em determinado tipo de camundongo.SS. II: 1 gene com dominância incompleta. de forma mais precisa. Para os filhotes vivos de um cruzamento de um casal de heterozigotos.ss.2 Os padrões de distribuição fenotípica são devidos a: a) I: 1 gene com dominância. as pessoas surdas estão representadas por símbolos hachurados: Com base nessa afirmação. respectivamente: 1. d) hipostático. existe uma anomalia que se caracteriza pelo encurtamento das asas.1.5. II: vários genes com interação. c) nos genótipos dominantes. b) autossômica dominante . SS. A partir desses dados. SS e SS. 125 . c) autossômica dominante .Questão 562 Em genética. d) autossômica recessiva . b) letal recessivo.

5. onde os indivíduos masculinos são representados por quadrados e os femininos por círculos. Questão 568 Analise o heredograma a seguir. 4 b) 1.5. 5.Questão 567 A fenilcetonúria (PKU) é uma doença de origem genética bastante conhecida. b) VI possui dois alelos mutados.4 obre as informações contidas no heredograma. 1. quanto à presença de alelos mutantes de fenilalanina hidroxilase nos membros da família marcados com algarismos romanos. 3. respectivamente.1. apresentam uma série de complicações como retardo mental. 8 d) 4. Pacientes acometidos desse mal. 2. 9 Questão 569 No heredograma. epilepsia. respectivamente. não conseguem metabolizar a fenilalanina e.1. entre outras. Caso a anomalia seja condicionada por um alelo recessivo ligado ao cromossomo X. as probabilidades de o pai (A) e de a mãe (B) do menino (C) serem portadores desse alelo são.5. 2. num segmento sem homologia com o cromossomo Y. Se a doença for condicionada por um par de alelos recessivos localizados em cromossomos autossômicos. II. podemos afirmar que os indivíduos heterozigotos são: a) 1. 7 e) 3. III e IV. além de não sintetizarem catecolaminas corretamente. as probabilidades de o pai e de a mãe serem portadores desse alelo são.1. Assinale a alternativa que mostra as porcentagens que preenchem corretamente os espaços I. que: a) VIII pode ter um alelo mutado. odemos dizer. e) I é necessariamente homozigoto. hipopigmentação. causada por uma deficiência da enzima fenilalanina hidroxilase. c) V é necessariamente homozigoto.4 1. 2. 5 c) 1. 6. os quadrados cheios representam meninos afetados por uma doença genética. Considere o heredograma a seguir de uma família com membros acometidos (símbolos cheios) e normais (símbolos vazados). assim. (I) e (II). 5. 1. d) III possui apenas um alelo mutado. 6. 4.4 126 . (III) e (IV).

Questão 572 O tipo de herança genética apresentada pelos indivíduos afetados é: a) autossômica dominante.4 om base na análise do heredograma.4 nalisando-se a genealogia.1. d) recessivo. e) recessivo.5. localizado no cromossomo X.5. localizado no cromossomo y. pode-se concluir que a característica em questão é condicionada por gene a) dominante. c) ligada ao x dominante. Questão 571 No heredograma a seguir. b) autossômica recessiva. c) dominante. e) ligada ao y. d) recessivo.1. localizado em um autossomo.4 1. 1. localizado em autossomo. quadrados representam homens e símbolos preenchidos representam indivíduos portadores de certa característica.1. localizado no cromossomo x. b) dominante. localizado no cromossomo X. c) dominante. conclui-se que a anomalia é determinada por gene a) dominante. a probabilidade desse casal ter uma filha com o mesmo fenótipo do avô materno é de: a) 1/2 b) 1/4 c) 1/8 d) 1/3 e) 2/3 1.Questão 570 O esquema a seguir representa indivíduos de três gerações de uma família.4 1.5.1. localizado em autossomo.5. localizado em um autossomo. localizado no cromossomo y. círculos representam mulheres. d) ligada ao x recessiva. e) localizado no cromossomo Y. Questão 574 127 . Os símbolos escuros indicam os portadores de uma anomalia hereditária. Questão 573 Se os indivíduos 7 e 11 se casarem. b) recessivo.

c) É do tipo recessiva autossômica porque o número de indivíduos afetados é menor do que o de não afetados. é correto afirmar. d) 0 e 25%. 1. d) É do tipo recessiva ligada ao sexo porque todo progenitor masculino afetado transmite a característica para suas filhas.5.5. c) 50% e 50%.4 No heredograma acima. os indivíduos 3 e 5 são afetados por uma anomalia genética recessiva. d) O caráter em estudo pode ser ligado ao sexo. b) É do tipo dominante autossômica porque o genótipo pode estar presente na prole de ambos os sexos sem estar presente nos pais. 128 . Questão 576 No heredograma adiante. as probabilidades dos casais 7×8 e 9×10 terem crianças normais são.1. c) A probabilidade de o indivíduo 7 ser heterozigoto é de 18%.4 1.5. Questão 575 Analise o seguinte heredograma de uma característica transmitida geneticamente: om base nessa análise. e) 100% e 75%.4 Considerando-se que a família acima representada faz parte de uma população em equilíbrio de Hardy-Weimberg. EXCETO: a) A segunda geração pode ser composta apenas por indivíduos homozigotos.1. e) É do tipo dominante ligada ao sexo porque todos os filhos homens herdam a característica da mãe. se os indivíduos marcados são afetados por uma característica genética. b) 0 e 75%. de: a) 100% e 50%. indique a opção que apresenta a afirmativa correta sobre a herança da característica referida no heredograma. b) O indivíduo 8 apresenta o mesmo fenótipo e o mesmo genótipo do avô para o caráter em questão.1. a) É do tipo recessiva autossômica porque o genótipo pode estar presente na prole de ambos os sexos sem estar presente nos pais. respectivamente. na qual a freqüência de indivíduos afetados é de 1%.1.

e os indicados em branco não a apresentam. as figuras 6. os indivíduos afetados por DH estão indicados em negro. II . na fase adulta. com certeza. Questão 578 Responder à questão com base no heredograma a seguir. e) Apenas uma das afirmações. III e IV. com uma progressiva perda do controle motor e problemas psiquiátricos como demência e distúrbios afetivos.Questão 577 No heredograma. No heredograma a seguir. causada por um gene autossômico influenciado pelo sexo. causada por um gene autossômico dominante. II e III.1. 1. Questão 579 A Doença de Huntington (DH) é uma anomalia autossômica com caráter dominante cuja manifestação ocorre na fase adulta. causada por um gene recessivo ligado ao sexo. c) a hemofilia. c) Apenas II e III.5. e) a incapacidade de enrolar a língua. é correto concluir que tal característica é a) a calvície.Se houver casamento consangüíneo entre 9 e 11. b) o lóbulo da orelha livre. d) Apenas II. IV .É uma doença de caráter dominante autossômica. causada por um gene autossômico recessivo. III e IV.4 onsiderando que os indivíduos indicados em preto são afetados por uma característica genética.5. São corretas as afirmações: a) I. causada por um gene restrito ao sexo.4 1.As pessoas 1 e 2 são heterozigotas. xamine as afirmações: I .5.1.4 129 . desenvolveram a mesma doença hereditária: 1.A mulher representada pelo número 5 tem possibilidade de ser homozigota. b) Apenas I. III . II.1. d) a hipertricose. os eventuais filhos nascerão afetados. 10 e 12 representam indivíduos que.

que é determinado por um par de genes: 130 .V .1. os indivíduos 1. 3.F c) V . onde foi estudado o caráter BRAQUIDACTILIA (dedos curtos).4 Questão 581 Analise a genealogia a seguir.F . c) tem dedos normais e é homozigoto.F . II-1 e II-3 são homozigotos. de cima para baixo. III-2.F d) V .4 essa família. nos parênteses. 2. 1.V . Assinale.F . 2. Questão 582 Na genealogia a seguir.V b) F . I-2.V . Considerando essas informações e desprezando a possibilidade de ocorrência de mutação.4 1. V para as verdadeiras e F para as falsas.5. 4 e 7 são braquidáctilos. ( ) Os indivíduos II-1 e II-3 são heterozigotos.1.V Questão 580 Qual dos heredogramas a seguir ilustra uma condição biologicamente IMPOSSÍVEL? 1. pode-se afirmar que o indivíduo 6: a) é braquidáctilo e homozigoto.F .5.5. ( ) Os indivíduos III-1. b) é braquidáctilo e heterozigoto. ( ) Os indivíduos I-1.s afirmativas abaixo referem-se aos possíveis genótipos dos indivíduos indicados no heredograma. Já as pessoas indicadas pelos números 3 e 6 têm fenótipo normal.1. enquanto os indivíduos 5 e 8 apresentam dedos normais.V . III-3 e III-4 são homozigotos.F . 5 e 7 apresentam uma anomalia condicionada por gene autossômico dominante. é a) F .V . e) pode ser ou não braquidáctilo e é homozigoto. ( ) Os indivíduos II-2 e II-4 são heterozigotos. as pessoas indicadas pelos números 1. A seqüência correta de preenchimento dos parênteses. d) tem dedos normais e é heterozigoto. 4.V e) V .

1.1. b) a pessoa indicada pelo número 4 é homozigótica.Após a análise da genealogia. Questão 583 A calvície é uma característica influenciada pelo sexo e o gene que a condiciona se comporta como recessivo no sexo feminino e dominante no sexo masculino.5.5. 131 . pode-se concluir que: a) apenas as pessoas indicadas pelos números 1 e 2 são heterozigóticas.4 probabilidade do casal 3×4 ter o primeiro filho homem e que venha a ser calvo. d) não há possibilidade de a pessoa indicada pelo número 5 ser heterozigótica. Observe a genealogia a seguir.4 No heredograma abaixo. Os símbolos escuros representam indivíduos que exibem a característica recessiva. 1. 1. relativa a essa característica. c) a pessoa indicada pelo número 3 transmitiu o gene recessivo para seu descendente indicado pelo número 7. é: a) 1/2 b) 1/4 c) 1/8 d) 1/6 Questão 584 O heredograma a seguir representa a herança de um par de genes entre os quais há dominância.1. e) o casal indicado pelos números 6 e 7 não poderá ter descendentes com fenótipo normal. os símbolos escuros representam indivíduos que possuem uma anomalia.5.4 esse heredograma NÃO se pode determinar o genótipo do indivíduo a) 1 b) 3 c) 5 d) 6 e) 7 Questão 585 1.

c) a anomalia ocorre apenas em homozigotos dominantes. 1/2 c) 1/4.4 1. a linhagem pôde ser reestabelecida por meio do acasalamento descrito a seguir: 1.onsidere as seguintes afirmativas sobre esse heredograma: I. III. 1/4 d) 1/2. e) todos os indivíduos normais são homozigotos dominantes ou heterozigotos.4 Questão 587 O heredograma mostra a incidência de uma anomalia genética em grupo familiar.1.5.1. II. Após uma infecção em que apenas uma fêmea nocaute sobreviveu. a criança II-1 tem fibrose cística. 2/2 1.5. 132 . 1/4 e) 1/2. As probabilidades de que sua irmã (II-2) não afetada seja carreadora ou não carreadora da fibrose cística são. podemos afirmar: a) todos os indivíduos normais são homozigotos recessivos. A anomalia é condicionada por um alelo dominante. 1/4 b) 1/4. Todos os indivíduos que apresentam a anomalia são homozigóticos.4 pós a análise deste heredograma. respectivamente: a) zero. Questão 588 Foi estabelecida uma linhagem de camundongos nocaute esses animais se caracterizam por não expressar um determinado gene.5. uma doença causada por um alelo recessivo autossômico. É correto o que se afirma APENAS em a) I b) II c) III d) I e II e) II e III Questão 586 No heredograma adiante.1. d) todos os indivíduos normais são homozigotos dominantes. O único indivíduo que não pode ter o seu genótipo definido é o I-4. b) a anomalia é condicionada por um gene recessivo.

5. c) O indivíduo III. c) A herança pode representar uma família de hemofílicos. 133 .2 não possui pais afetados. por isso é improvável uma herança dominante ligada ao X. d) I-1 e I-2 podem ser heterozigotos. c) O acasalamento do macho 3 com a fêmea 5 produzirá maior número de camundongos nocaute do que o acasalamento desse macho com a fêmea 4.2 seriam normais. uma estudante concluiu que a característica transmitida. 75% do filhotes nascerão normais. todas as alternativas são possíveis. se a herança fosse recessiva ligada ao X.1.4 m relação à característica representada no heredograma. essa estudante considerou todas as seguintes hipóteses. b) Em F‚.ode-se afirmar que: a) Por meio do acasalamento do macho 3 com a fêmea nocaute. 50% dos filhotes são animais com o genótipo heterozigoto. c) a probabilidade de mulheres descendentes de IV-1 serem afetadas é zero. portanto a herança não deve ser autossômica dominante.1.4 Observe este heredograma: 1.5 também seria afetado. pós analisar esse heredograma. na família representada. Para chegar a tal conclusão. e) II-2. é autossômica recessiva. d) O cruzamento do macho 2 com uma das fêmeas de F originará camundongos dos quais 75% serão heterozigotos. Questão 589 Analise o heredograma que representa a herança de um tipo de disfunção dos músculos esquelético e cardíaco em seres humanos. é correto afirmar-se que a) a herança para esse tipo de característica é recessiva e ligada ao sexo. e) o casamento de III-4 com indivíduo de fenótipo igual a II-4 tem como resultado esperado 100% de mulheres afetadas.4 Com relação ao heredograma. b) O indivíduo II.3 tem filha normal. d) Os filhos homens de I. b) A herança pode ser ligada ao sexo.5. d) as mulheres afetadas apresentam fenótipos idênticos aos de suas mães. e) A herança do caráter nocaute é autossômica dominante. se a herança fosse ligada ao Y. EXCETO a) A herança pode ser autossômica.1. Questão 591 1. Questão 590 Analise o heredograma.5. b) a ocorrência da característica nessa família se deve aos casamentos consangüíneos. EXCETO a) O indivíduo I. II-5 e III-1 podem ser homozigotos dominantes. 1.

conhecida como daltonismo. c) o risco de III.Questão 592 As pessoas podem detectar a substância química feniltiocarbamida .4 Esse diagrama representa: ( ) o modelo de herança recessiva ligada ao cromossomo X. é representado abaixo.5. Questão 593 Analise este heredograma. são homozigotos. é INCORRETO afirmar que a) os indivíduos normais. não sentir qualquer sabor. deseja saber qual a probabilidade de ela não ser portadora deste alelo.1.2 será normal. b) o loco do gene em estudo está situado em um cromossomo autossômico. é INCORRETO afirmar que a) o alelo para a capacidade de sentir o gosto do PTC é dominante. cuja avó materna e avô paterno eram albinos.1 são heterozigotos.2 ser heterozigoto é de dois terços.como um gosto amargo ou. ( ) um modelo de herança idêntico ao da cegueira para cores. Questão 594 1. Observe este heredograma para a capacidade de sentir o gosto dessa substância: onsiderando-se as informações desse heredograma e outros conhecimentos sobre o assunto. de pai para filha e mãe para filha. preocupada com a possibilidade de transmitir o alelo para o albinismo a seus filhos.1. ( ) a característica passada de geração a geração.5.1. ( ) um modelo de herança idêntico ao do albinismo.PTC . mesmo.1 e II. Assinale a alternativa que responde ao questionamento de Renata. d) a probabilidade de o indivíduo III. cujo diagrama.3 nascer incapaz de sentir o gosto do PTC é de 50%.5.4 Um geneticista estabeleceu o heredograma para uma determinada doença hereditária. a) 0 b) 1/4 c) 3/4 134 1.4 . ( ) o modelo de herança autossômica recessiva.1 x II. b) a ocorrência do tumor é uma característica autossômica. Questão 595 Renata (III. d) os indivíduos I. em todas as gerações. típica daquelas não vinculadas aos cromossomos X e Y. mostrando-os indivíduos afetados.1). que representa uma família em que há indivíduos afetados por um tipo de tumor de gengiva: 1. c) o próximo filho do casal II. om base nesse heredograma e em outros conhecimentos sobre o assunto.

5. os indivíduos assinalados com preto apresentam uma anomalia determinada por um gene dominante. e) Apenas os indivíduos I:1 e I:2 são homozigotos. 135 . Questão 597 Considerando o heredograma abaixo.5. pois a característica é dominante. Soma ( ) 1. onde os indivíduos afetados pela síndrome unha-rótula (deformação nas unhas e nas rótulas) aparecem em preto.1.4 Questão 596 O heredograma adiante representa a herança de um fenótipo anormal na espécie humana. (32) Trata-se de Herança Intermediária. II:1 e II:5 são heterozigotos. (01) A anomalia é causada por gene provavelmente recessivo. d) Todos os indivíduos afetados são heterozigotos. (02) A anomalia é causada por gene provavelmente dominante. (08) Trata-se de gene localizado no cromossomo Y. c) Apenas o indivíduo I:1 é heterozigoto. Analise-o e assinale a alternativa correta. (16) Trata-se de gene autossômico. (04) Trata-se de gene localizado no cromossomo X. (64) Trata-se de Herança Holândrica.1. b) O fenótipo anormal é recessivo.5. a) Os indivíduos II-3 e II-4 são homozigotos. c) Os indivíduos III-1 e III-2 são heterozigotos. pois os indivíduos II-3 e II-4 tiveram crianças anormais. b) Todos os indivíduos não afetados são heterozigotos.d) 1/3 e) 1 1. pois dão origem a indivíduos anormais. é correto afirmar: 1. pois são afetados pelo fenótipo anormal.1.1. d) Apenas os indivíduos I:1.5.4 1.4 Analisando essa genealogia. e) Os indivíduos I-1 e I-4 são homozigotos. é correto afirmar: a) Todos os indivíduos afetados são homozigotos.4 Questão 598 Na genealogia a seguir.

os indivíduos que manifestam uma determinada doença hereditária são mostrados em preto.1 é neto(a) de I .2. e) II .3 e II . (32) II . (04) Os indivíduos I .3 forem heterozigotos e os indivíduos I . III . enquanto II .4 (01) Na genealogia estão representadas 2 gerações. II . (04) III .4. 3. são indivíduos afetados pela característica que está sendo estudada. (16) II .2.4 136 .5.4 A anemia falciforme é causada pela presença de uma hemoglobina anormal.3 podem ser homozigotos.1. II .1 e I . Questão 601 Com relação a essa figura é CORRETO afirmar que: (01) Os indivíduos II . os homens.2 e I . 1. 1. Questão 602 Os heredogramas a seguir apresentam o padrão de herança de um mesmo caráter em cinco diferentes famílias.1. c) Apenas II . portanto está ligada ao cromossomo X. b) Apenas II . Considerando o heredograma apresentado inicialmente os indivíduos I .5. d) II .2.1 é mais jovem do que II .2.2.3.4 têm 50% de probabilidade de terem um descendente portador da doença. Os círculos representam as mulheres e os quadrados.1 e II . respectivamente. II . assinale a(s) proposição(ões) CORRETA(S).3.3 e II .2. (64) Com exceção de II . apresentado na genealogia.3 não tem nenhuma relação genética com I . identificadas por 1.1 e III .2 é sobrinho(a) de II . 1. 4 e 5.5. (32) A doença só se manifesta nas mulheres.1 e III .1.5. Com base na análise da mesma. um homem e uma mulher. por exemplo. existe 33.1.1 e III .1.4 representam. os demais indivíduos da segunda geração são irmãos. (16) III .2 e II .1 e I . (02) Os indivíduos I .3. Questão 600 Na genealogia a seguir.Questão 599 A figura a seguir apresenta uma genealogia hipotética.1. 2. (08) Do casamento consangüíneo.3 e III . Essa doença é herdada como autossômica recessiva. II . (08) III .5.3 não o são. Os símbolos cheios indicam que o indivíduo é portador do caráter.3 e III . (02) O padrão da herança desta doença é autossômico dominante.3% de possibilidade de nascer um descendente com a doença. quem poderá ser afetado pela doença? a) Apenas III .1 e II .4 forem homozigotos normais.4.

porque o gene para a miopia é recessivo. porque a mulher tem o gene dominante em homozigose. apenas. Trata-se de uma doença autossômica recessiva.4 A probabilidade do casal I x II ter uma criança míope é a) imprevisível. a) A família l permite concluir que se trata de um caráter dominante ligado ao cromossomo X. O indivíduo III-1 só deve ser cruzado com o indivíduo II-5. IV. b) II e III. apenas. apenas. c) A família 3 permite concluir que se trata de um caráter recessivo. apenas. O diagrama representa o padrão de herança de uma doença genética que afeta uma determinada espécie de animal silvestre. apenas. foram feitas as afirmações seguintes. Questão 603 O esquema mostra a genealogia de uma família.1. uma vez que são nulas as possibilidades de que desse cruzamento resulte um filhote que apresente a doença. ligado ao cromossomo Y. c) I. Os indivíduos I-1 e I-3 são obrigatoriamente homozigotos dominantes. e) A família 5 mostra que o caráter não pode ser controlado por gene ligado ao cromossomo X. 1. d) A família 4 permite concluir que se trata de um caráter recessivo.4 . II.1. 137 1.4 A partir da análise da ocorrência da doença entre os indivíduos nascidos dos diferentes cruzamentos. d) I e IV. É verdadeiro o que se afirma em a) I.5. b) nula. observado a partir de cruzamentos controlados realizados em cativeiro. Questão 604 upondo que não haja mutação. e os claros os indivíduos de visão normal. porque 50% dos gametas da mulher transportam o gene recessivo. II e III. porque o casal já tem três filhos com visão normal. analise os heredogramas e assinale a alternativa correta. e) 1/4. ligado ao cromossomo X. d) 1/4. e) III e IV. Não há nenhuma possibilidade de que um filhote nascido do cruzamento entre os indivíduos II-5 e II-6 apresente a doença. I. III. Os símbolos escuros representam os indivíduos míopes.1.5.1. c) 1/2.5. porque a mulher tanto pode ser homozigota como heterozigota. b) A família 2 permite concluir que se trata de um caráter autossômico recessivo.

o indivíduo afetado tem pais afetados Questão 608 O popular "Teste-do-pezinho" feito em recém-nascidos pode detectar a doença fenilcetonúria. d) Os pais dos aquirópodos são primos.5 possuem o genótipo AA. o indivíduo afetado tem pelo menos um pai afetado b) homens e mulheres afetados é aproximadamente igual. No heredograma a seguir. a característica deve aparecer em todas as gerações. assinale a afirmativa INCORRETA. os indivíduos afetados têm geralmente pais normais. Os pulmões das pessoas afetadas apresentam um muco espesso que promove infecções bacterianas. os indivíduos afetados têm geralmente pais normais. cerca de 75% da prole de pais portadores do gene deve apresentar a característica e) homens afetados é maior do que o de mulheres afetadas. b) Pode-se assumir que os indivíduos II. já que a condição herdada em análise é muito rara. Observe e analise o esquema a seguir. c) Não é possível ter certeza sobre o genótipo de alguns indivíduos. e) O genótipo dos indivíduos IV.1 .5.4 1. . a característica deve aparecer em todas as gerações.5.2 vir a ter uma criança com mucoviscidose? a) 1/8 b) 1/4 c) 1/3 d) 1/2 e) 2/3 Questão 607 Para analisar heredogramas de famílias de seres humanos.3 e III. os principais critérios para a identificação de um gene recessivo autossômico são aqueles em que o número de: a) homens afetados é diferente do número de mulheres afetadas.2 e IV. cerca de 25% da prole de pais portadores do gene deve apresentar a característica d) homens e mulheres afetados é aproximadamente igual. 1.4 ual a probabilidade de o casal II. os aquirópodos estão representados por símbolos hachurados.1.1 e II. como é o caso dos indivíduos II.II. o indivíduo afetado tem pelo menos um pai afetado c) homens e mulheres afetados é aproximadamente igual. a) Pode-se dizer que a Aquiropodia é condicionada por um alelo recessivo a. Questão 606 A mucoviscidose é uma doença genética grave que associa problemas digestivos e respiratórios. Tal doença deve-se à presença de uma enzima defeituosa que não metaboliza 138 om base na análise do heredograma.1.Questão 605 Na espécie humana há um tipo de doença hereditária muito rara denominada Aquiropodia. a característica deixa de aparecer em várias gerações. que representa a árvore genealógica de uma família onde alguns indivíduos são afetados pela doença.4 é aa.5. que é determinada por um par de genes.

b) 120. Questão 613 Sabe-se que o albinismo é determinado pela ação de um gene recessivo autossômico. determine o cruzamento que permite diagnosticar a recessividade do gene que condiciona a fenilcetonúria e a probabilidade de nascer uma menina afetada a partir do cruzamento 12 X 18. e) 240.1. d) 2/5. Em certa comunidade européia. Considere um casal normal que teve 6 crianças todas normais. c) 16.corretamente o aminoácido fenilalanina. cuja ingestão provoca retardamento mental. d) 40.25% e) C e 75% d) 1/12 e) 2/3 Questão 611 Em drosófilas. Em 800 casamentos ocorridos entre membros sadios dessa comunidade. Um macho puro de asa longa é cruzado com uma fêmea de asa curta.4 Questão 609 A fenilcetonúria é uma doença com herança autossômica recessiva. e) 1/25.5. Supondo que todas sofram metamorfose. será: a) 0% b) 25% c) 50% d) 75% e) 100% 1. Questão 610 Um casal. em que ambos são polidáctilos. Sabendo-se que o avô paterno e a avó materna das crianças eram albinos. Um indivíduo de F1 é retrocruzado com a fêmea parental e se obtém 480 larvas. qual o número esperado de casamentos com risco de gerar crianças fenilcetonúricas? a) 2. Sabendo-se que a determinação do caráter se deve apenas a um par de genes autossômicos. uma em cada 20 pessoas com fenótipo normal é heterozigótica quanto ao gene que determina a fenilcetonúria. d) 360. podemos afirmar com certeza que a probabilidade de um novo filho vir a ser albino (sem considerar o sexo). tem uma filha também polidáctila e um filho normal. Esse casal tem __________ de probabilidade de ter um descendente do sexo masculino e portador da disfunção genética mencionada.25% d) B e 8. c) 1/8. a) 2/3. o número esperado de indivíduos de asa curta é de: a) 480. os indivíduos que apresentam fenilcetonúria estão em negro. a) C e 50% b) C e 25% c) B e 6. b) 3/9. Na genealogia a seguir. Questão 612 Estudos genéticos permitiram verificar que um casal tem 1/4 de probabilidade de ter um descendente com uma determinada anomalia. b) 8. o caráter asa vestigial é recessivo em relação ao caráter asa longa. e) 80. c) 180. A probabilidade de o casal vir a ter uma filha normal é de: a) 1/4 b) 1/6 c) 1/8 139 .

Um homem canhoto e sensível ao PTC. Questão 615 A anemia falciforme é uma doença hemolítica grave cujas manifestações clínicas incluem anemia. no Rio Grande do Sul. d) 75%. Questão 617 Em determinada planta. b) 1/4. a habilidade para o uso da mão direita é condicionada pelo gene dominante E . cujo pai era insensível. d) 180.1. e) 100%. espera-se que o número de plantas com flores vermelhas e folhas curtas seja a) 20. Um casal decide ter um filho. c) 50%. antes de realizar qualquer exame. sendo a habilidade para o uso da mão esquerda devida a seu alelo recessivo e . b) 60. o baço e os pulmões. folhas longas são condicionadas por um gene dominante e folhas curtas por seu alelo recessivo. Esses dois pares de alelos apresentam segregação independente. e a insensibilidade a essa substância é devida a seu alelo recessivo i . c) 160. e) 4/9. Desses. Questão 618 Na espécie humana. e) 320. c) 1/9. já que cada um dos cônjuges tem um irmão com anemia falciforme. Devido a sua importância. icterícia. casa-se com uma mulher destra. no teste do pezinho.Questão 614 Admita que uma determinada doença neurodegenerativa que provoca convulsões e leve à morte em pouco mais de 10 meses seja determinada por um gene dominante. Não há outros casos conhecidos nas famílias. Essa doença manifesta-se tardiamente como representado no gráfico a seguir: Questão 616 Fenilcetonúria é uma doença hereditária humana resultante da inabilidade do organismo de processar o aminoácido fenilalanina. Se você fosse o geneticista. flores vermelhas são condicionadas por um gene dominante e flores brancas por seu alelo recessivo. a chance de a criança vir a manifestar a doença corresponde a a) 0 %. podendo ser fatal se não tratada no início da infância. e é causada por um alelo recessivo por herança Mendeliana simples. b) 25%. a detecção de portadores de anemia falciforme está sendo incluída. sensível. mas consulta um geneticista porque o homem tem uma irmã com fenilcetonúria. que está presente nas proteínas da dieta humana. qual a resposta correta que daria à pergunta sobre a probabilidade de nascimento de uma criança com este tipo de anemia? a) 1/2 b) 1/4 c) 1/8 d) 1/9 e) 1/16 . O seu padrão de herança é autossômico recessivo. d) 2/3.5. e a mulher tem um irmão com esta mesma doença. Do cruzamento entre plantas heterozigóticas para os dois caracteres resultaram 320 descendentes. obstrução vascular e infartos dolorosos em vários órgãos como os ossos. A sensibilidade à feniltiocarbamida (PTC) é condicionada pelo gene dominante I. A probabilidade de sua primeira criança ter fenilcetonúria é de: a) 1/2.5 e um casal com 35 anos tiver um filho. Esses dois pares de alelos localizam-se em cromossomos diferentes. Um casal normal que pretende ter um filho consulta um geneticista. 140 1. cuja mãe era canhota e insensível.

b) amarelas-lisas = 100. d) 3/16. c) amarelas-lisas = 200. d) aaCC. aacc. originou 800 indivíduos. AaCc. amarelas-rugosas = 300. AaCc. amarelas-rugosas = 200. verdes-lisas = 300. Quantos indivíduos devem ser esperados para cada um dos fenótipos obtidos? a) amarelas-lisas = 80.1 141 . AaCC. verdes-lisas = 200. Questão 623 Observe o heredograma a seguir: 1. amarelas-rugosas = 150. amarelas-rugosas = 320. nasceram duas crianças. c) 100% de plantas de altura normal com vagens com constrições. nasce uma criança albina e de olhos claros. A probabilidade de que uma terceira criança seja albina com cabelos crespos é: a) 75% b) 50% c) 37. e) amarelas-lisas = 450. AACC. d) amarelas-lisas = 300. AaCc.5. Deste casal. o gene que determina a forma lisa da vagem (C) é dominante sobre o gene que determina vagens com constrições (c). Questão 622 Um homem albino e de olhos claros casa-se com uma mulher de pele normal e de olhos escuros. cuja mãe é albina. b) Aacc. b) 3/8. Qual o genótipo dos pais da criança? a) aacc. uma com cabelos crespos e outra com cabelos lisos. b) 100% de plantas anãs com vagens com constrições. aacc. aacc. c) AaCC. espera-se obter na descendência: a) 50% de plantas anãs com vagens lisas e 50% de plantas de altura normal com vagens com constrições. e) aacc. c) 1/4. verdes-lisas = 150. verdes-rugosas=50. O gene que determina plantas de altura normal (H) é dominante sobre o gene que determina plantas anãs (h). verdes-rugosas = 200. verdes-rugosas = 80. verdes-rugosas=100.5% Questão 620 O cruzamento entre duas linhagens de ervilhas. verdes-rugosas = 300. uma com sementes amarelas e lisas (VvRr) e outra com sementes amarelas e rugosas (Vvrr). d) 100% de plantas anãs com vagens lisas. Questão 621 Em ervilha. verdes-lisas = 320. Aacc. amarelas-rugosas = 100.5% d) 25% e) 12.2. e) 100% de plantas de altura normal com vagens lisas. Cruzando-se plantas CCHH com plantas CcHh. Questão 619 Do casamento entre uma mulher albina com cabelos crespos e um homem normal com cabelos crespos. AaCc. verdes-lisas = 100. e) 1/8.A probabilidade de esse casal vir a ter uma criança canhota e sensível ao PTC é de a) 3/4.

III . c) se somente as afirmativas II e III forem corretas. d) se somente as afirmativas I e II forem corretas.Sabendo-se que a miopia e o uso da mão esquerda são condicionados por genes recessivos. e) se somente a afirmativa II for correta. b) se somente as afirmativas I e III forem corretas.Os indivíduos 2 e 4 têm o mesmo genótipo. então.5% e) 25% Questão 628 Qual é a probabilidade de um casal de duplo heterozigotos para dois pares de genes autossômicos com segregação independente vir a ter um descendente com apenas uma característica dominante? a) 15/16 b) 9/16 c) 6/16 d) 3/16 142 1. A probabilidade desse casal ter uma criança normal para as duas características é: a) 1/8 b) 1/2 c) 3/8 d) 7/8 e) 3/4 Questão 627 Em ervilhas. analise a genealogia a seguir e responda. tem uma criança normal para polidactilia. diíbrida. a) zero b) 75% c) 50% d) 12.O indivíduo 5 é heterozigoto para o gene do uso da mão esquerda e o indivíduo 6 é heterozigoto para o gene da miopia. Assinale: a) se todas as afirmativas forem corretas. assinale a alternativa que apresenta a porcentagem de gametas produzidos por essa planta com pelo menos um gene dominante. diferentes. com um homem normal para fenilcetonúria e míope. filha de mãe com fenilcetonúria e pai míope. Questão 624 Sabendo-se que a miopia e o uso da mão esquerda são condicionados por genes recessivos. Considerando uma planta de sementes lisas e amarelas. terão 25% de chance de ter uma filha canhota e de visão normal. Considerando-se que ambas as anomalias são autossômicas e os respectivos genes estão em cromossomos . Do casamento entre uma mulher normal. a probabilidade do casal ter outra criança normal para as duas características é: a) 1 b) 1/16 c) 3/16 d) 9/16 e) 0 Questão 626 A fenilcetonúria e a miopia são doenças decorrentes da ação de genes autossômicos recessivos.5. mas míope. considere as seguintes afirmações: I . nasceu uma criança de visão normal e fenilcetonúrica.2.1 A probabilidade do casal 4 x 5 ter uma criança diíbrida é: a) 1/8 b) 3/16 c) 1/16 d) 1/4 e) 1/2 Questão 625 Um casal. ambos polidáctilos (com mais de 5 dedos) e de visão normal.Se o indivíduo 3 se casar com um homem de visão normal (heterozigoto) e canhoto. os genes que determinam sementes lisas e amarelas são dominantes em relação aos genes que determinam sementes rugosas e verdes. II .

pelo menos. Como resultado. vvA_ ou vvaa.(MmBb) Questão 630 Considere que a surdez no homem esteja relacionada a dois pares de genes (Dd . na qual promoveu autofecundação.(mmBb). III . III .(mmbb). II . Assinale. IV . Quantos caracteres esse pesquisador estudava? a) 1 b) 2 c) 3 d) 4 e) 5 Questão 634 Assinale a alternativa que indica os genótipos dos pais que têm ou poderão ter filhos nas seguintes proporções ou percentuais: 143 . II . os indivíduos com audição normal possuem. III . Os indivíduos homozigotos dd ou ee são surdos. IV .(mmBb).(MmBb). manchas brancas em qualquer cor de pelagem. a) I .(MMbb).(MmBb) d) I .(Mmbb) c) I . o gene B determina coloração uniforme e seu alelo b. Dois pares de genes (Vv e Aa) determinam essa característica: plantas V_A_ produzem flores vermelhas e plantas V_aa. é cruzado com uma fêmea marrom com manchas brancas (III). 1. cujo pai era marrom uniforme (II).1 os pares de alelos abaixo aplica-se a segunda lei de Mendel SOMENTE a a) Aa e Mm b) Aa e Dd c) Aa e Nn d) Bb e Nn e) Dd e Mm Questão 633 Um pesquisador averiguava a transmissão de caracteres em vegetais ao longo de gerações.2.(MmBb). flores amarelas. IV . Os alelos de cinco genes estão indicados por letras. III . determinados por genes que se segregavam independentemente. III .(Mmbb). a alternativa que contém os genótipos dos indivíduos mencionados.(mmBb).(mmBb).(Mmbb). Um macho preto com manchas brancas (I). Cruzando dois indivíduos homozigotos. Na descendência do cruzamento VvAa x VvAa espera-se encontrar uma proporção fenotípica de a) 1 vermelha: 1 amarela b) 9 amarelas: 7 vermelhas c) 9 vermelhas: 7 amarelas d) 15 amarelas: 1 vermelha e) 15 vermelhas: 1 amarela Questão 632 O esquema abaixo representa o núcleo de uma célula de um organismo com 2n=4 cromossomos.(mmbb). na proporção de 9:3:3:1. cor marrom. II . obteve quatro tipos de fenótipos. II . II .Ee) localizados em cromossomos não homólogos. Qual é a probabilidade de um casal DdEE × ddEe vir a ter uma criança com surdez? a) 0% b) 25% c) 50% d) 75% e) 100% Questão 631 As flores de uma determinada planta podem ser vermelhas ou amarelas. O gene M condiciona cor preta e seu alelo m.(mmbb) b) I .(mmBb). ele obteve a primeira linhagem.e) 1/16 Questão 629 Considere que em cavalos a coloração do pêlo resulta da ação de dois pares de genes autossômicos localizados em cromossomos não homólogos.(Mmbb). cuja mãe era preta uniforme (IV). um gene D e um E.(Mmbb). IV .5.(mmbb). a seguir. IV . sendo um dominante e outro recessivo.(mmBb) e) I .

o albinismo é condicionado por um gene recessivo.75% de filhos com olhos castanhos. duas características autossômicas dominantes com segregação independente: BRAQUIDACTILIA (dedos curtos) e PROGNATISMO MANDIBULAR (projeção da mandíbula para frente).c gen para mão destra . um homem com pés e mãos normais. e) o embrião tenha constituição AaBb.25% de filhos com olhos azuis. e) Maria produzirá gametas de 4 tipos diferentes para essas características.C gen para olhos azuis . os esporos dão origem à geração gametofítica. sendo os indivíduos homozigotos recessivos portadores de pés e mãos normais (com 5 dedos cada). polidáctila a e filha de um homem homozigoto e normal para os dois caracteres e de uma mulher albina e polidáctila. em uma família. A partir das informações anteriores. c) o endosperma. . Dados: gen para olhos castanhos . espera-se que a) um dos núcleos gaméticos do tubo polínico tenha constituição a e o outro constituição b. podendo ser destros ou canhotos. por meio do processo de mitose. . podendo ser destros ou canhotos.D gen para mão canhota . Questão 637 Em humanos a polidactilia é condicionada por um gene dominante. Suponha que um exemplar da planta produza todos os esporos femininos com constituição genética AB e todos os esporos masculinos com constituição ab.75% de filhos destros. obrigatoriamente. homozigota para as duas características. b . casa-se com Maria. Por sua vez. Ambos os locos citados são autossômicos. Como.com segregação independente. As pessoas indicadas pelos números 1. enquanto 2 e 4 têm dedos e mandíbula normais.2. d) o zigoto tenha constituição AB ou ab. 3. b) Não existe qualqueir chance de nascer um filho polidáctilo dessa relação. Considere este caso: Antônio. a) Todos os filhos desse casal deverão ser albinos. a e B. Questão 636 Em uma planta com autopolinização são estudados dois pares de genes . sendo triplóide. sendo que o alelo dominante produz em seus portadores pigmentação normal.1 probabilidade de o casal 5x6 ter um descendente simultaneamente braquidáctilo e prognata é de a) 1/16 b) 3/16 c) 9/16 d) 3/4 e) 1/4 . porém albino.d a) CCDD e CCDD b) ccdd e ccdd c) CCdd e ccDD d) CcDd e CcDd e) CcDd e ccdd Questão 635 Foram analisadas. b) a oosfera (gameta feminino) tenha constituição AB ou ab. mulher normal para o albinismo.25% de filhos canhotos. 144 1. podendo ter olhos castanhos ou azuis. podendo ter olhos castanhos ou azuis. .A. c) Antônio poderá produzir 2 tipos de gametas diferentes para essas características.5. 5 e 6 são braquidáctilas e prognatas. d) A mãe de Maria é. tenha constituição AaB ou Aab.. assinale a alternativa CORRETA.

7 e 13 d) 6. c) 1 preto: 1 albino. . 2. 9. 7. Considerando que ocorra segregação independente entre esses genes. uais são os indivíduos que seguramente produzem um só tipo de gameta? a) 6.1 1. o gene P produz pelagem preta e o seu alelo recessivo p. 4. pelagem parda desde que esteja presente o gene A.1 uais são os indivíduos obrigatoriamente heterozigotos para as duas características? a) 6. 14 e 16 c) 5. 9. 9. 7. 13 e 14 b) 5. patas sem plumas. 15 e 16 e) 1. Questão 642 Numa ave doméstica. o gene P determina patas com plumas e o seu alelo recessivo. espera-se que a proporção de aves homozigotas para os dois pares de genes seja de a) 9/16 b) 6/16 c) 4/16 145 1. 4 e 13 Questão 641 Em coelhos. Uma ave branca com patas com plumas. 13 e 14 b) 6. está representada a herança de duas características determinadas por genes autossômicos. o gene C condiciona plumagem branca e o seu alelo recessivo. a partir do cruzamento PpAa x ppaa espera-se uma proporção fenotípica de a) 1 preto: 1 pardo: 2 albinos. Os animais aa são sempre albinos. 9. 7. a probabilidade de ocorrência na F de indivíduos com o mesmo genótipo dos pais. e) 1 pardo: 3 albinos. 2. 10. 8. 4.2. d) 1 preto: 3 albinos. é: a) zero b) 1/2 c) 1/4 d) 1/8 Questão 639 Na genealogia a seguir. 12 e 15 d) 3.Questão 638 Do cruzamento entre dois indivíduos portadores do genótipo CcDd. 2. 11. 8. 11. 8. 3. está representada a herança de duas características determinadas por genes autossômicos. 4. Se os decendentes obtidos forem cruzados entre si.5. Esses pares de genes são autossômicos e segregam-se independentemente. 12 e 15 c) 1. 3. 3.2. 8. foi cruzada com uma colorida com patas sem plumas. b) 1 preto: 1 pardo. 13 e 15 Questão 640 Na genealogia a seguir. homozigota para os dois pares de genes.5. plumagem colorida. 9. 9 e 15 e) 1. 10. 14.

latir ou não latir durante a corrida são características definidas por um par de genes alélicos. Uma mulher com polidactilia e miopia. aproximadamente. Sabendo-se que os alelos representados por letras maiúsculas são dominantes e que os não-alelos sofrem segregação independente. Quando se cruzam papagaios verdes silvestres com os de cor branca. respectivamente. a polidactilia é um caráter dominante e a miopia. Dentre esses. Os papagaios verdes são os únicos normalmente encontrados na natureza. a) 3 e 2 b) 6 e 3 c) 9 e 4 d) 12 e 8 e) 16 e 9 Questão 646 Em cães.d) 3/16 e) 1/16 Questão 643 No homem. existem quatro variedades: verdes. Neste caso. pelo alelo recessivo. Através do intercruzamento de plantas duplo-heterozigóticas. Considerando-se que os genes para a melanina e o 146 . geram-se papagaios verdes na primeira geração (F1). cuja mãe era normal para as duas características. de: a) 6. amarelos e brancos. O cruzamento da F1 gera os quatro tipos de cores na F2. Os genes responsáveis por essas características situam-se em autossomos e apresentam segregação independente. Latir enquanto corre e possuir orelhas eretas são características dominantes. a folha recortada é determinada por um alelo dominante e a lisa.7% Questão 647 Em tomateiros. azuis. pelo alelo recessivo. o número esperado de indivíduos com hipocótilo púrpura e folhas lisas é a) 30 b) 90 c) 160 d) 240 e) 270 Questão 648 Numa dada espécie de papagaio. cujo pai era míope. A probabilidade deste casal ter uma criança com polidactilia e miopia é a) 0% b) 25% c) 50% d) 75% e) 100% Questão 644 No cruzamento entre indivíduos heterozigotos para dois pares de genes que se segregam independentemente. e os brancos não têm nem melanina azul nem pigmento amarelo nas penas. Os azuis carecem de pigmento amarelo. os amarelos carecem de grânulos de melanina.2% d) 43.2% b) 18.7% c) 31. foram obtidos 480 descendentes. a cor do hipocótilo púrpura é condicionada por um alelo dominante e a cor verde. os números de genótipos e de fenótipos diferentes entre os descendentes desses cruzamentos são. uma anomalia recessiva. enquanto não latir durante a corrida e possuir orelhas caídas são recessivas. é casada com um homem normal. espera-se que a proporção de descendentes heterozigotos para apenas um par de genes seja a) 9/16 b) 1/2 c) 1/4 d) 3/16 e) 1/16 Questão 645 Plantas de genótipo AaBb foram intercruzadas. a probabilidade de que nasçam filhotes que latem enquanto correm e que possuem orelhas caídas é. Esses genes estão localizados em cromossomos que se segregam independentemente. O mesmo ocorre para os caracteres orelhas eretas ou orelhas caídas. Considere o cruzamento entre um casal de cães heterozigotos para ambos os pares de alelos.

1 branco. 64 descendentes. 4 brancos. casco fendido. está ocorrendo segregação independente. a cor dos pêlos pode ser branca (P_) ou preta (pp). quanto às características consideradas? a) 9 b) 16 c) 30 d) 45 e) 80 Questão 652 Quando se estuda uma célula meiótica duplo-heterozigota AaBb e se diz que. b) 100% de animais com pelagem branca. c) os genes A e B que se situam em diferentes pares de homólogos distribuem-se ao acaso em diferentes gametas. d) os genes A e B estão em grupos de ligação separados. d) 4 animais com pelagem branca : 3 com pelagem vermelha : 9 com pelagem preta. pelo seu recessivo v. b) 4 papagaios amarelos. pois o gene para a cor é dominante. c) os indivíduos da geração F1 são homozigotos. e o padrão malhado. a freqüência esperada de cada um dos tipos de papagaio é a) 9 papagaios brancos. 3 amarelos. Questão 651 A cor preta da pelagem dos cães da raça 'Cocker Spaniel' é governada por um alelo dominante V e a cor vermelha. O padrão uniforme é governado pelo alelo dominante que segrega independentemente no locus M. é INCORRETO afirmar que a) as características pêlo preto e curto são dominantes. O cruzamento entre um touro de pelagem preta (HhBb) com uma vaca de pelagem preta (HhBb) produzirá uma prole com: a) 100% de animais com pelagem preta. b) pode ocorrer recombinação entre os genes A e B. 2 verdes. Questão 653 Em porcos. 1 verde. Entre as várias ninhadas foram vendidos apenas os filhotes malhados de vermelho. d) os indivíduos da geração P formam um só tipo de gameta.pigmento amarelo se encontram em cromossomos diferentes. sendo que F_ condiciona casco indiviso e ff. 3 verdes. b) as duas características segregam-se independentemente. 1 azul. a pelagem colorida é determinada pelo alelo H. d) 1 papagaio verde. Questão 649 Em bovinos. 3 amarelos. para esses genes. pois o gene para a cor é epistático. por seu alelo recessivo m. e o tipo de casco é determinado por alelos que segregam em outro cromossomo. 1 branco. 1 azul. Se porcos diíbridos são cruzados entre si e produzem. 1 branco. Questão 650 Um criador fez cruzamentos entre porquinhos-da-índia para estudar as características: cor e tamanho do pêlo. 1 amarelo. Observou os seguintes resultados: GERAÇÃO P: pêlo preto curto X pêlo marrom longo GERAÇÃO F: pêlo preto curto GERAÇÃO F‚: 81 pêlo preto curto 27 pêlo preto longo 27 pêlo marrom curto 09 pêlo marrom longo Com base nesses resultados. Outro gene determina a pigmentação da pelagem na cor vermelha (b) ou preta (B). c) 9 papagaios verdes. e) 9 papagaios azuis. entre várias ninhadas. 3 azuis. se espera que sejam fenotipicamente idênticos ao pai. enquanto o alelo h determina a pelagem branca. e) os genes A e B não são alelos. quantos desses apresentarão fenótipo diferente dos pais? 147 . que eram em número de cinco. e) 9 animais com pelagem preta : 7 com pelagem vermelha. 4 amarelos. Quantos filhotes do total nascido das várias ninhadas. 1 azul. Um macho preto foi cruzado com fêmeas genotipicamente iguais entre si e fenotipicamente iguais a ele. c) 12 animais com pelagem branca : 1 com pelagem vermelha : 3 com pelagem preta. é INCORRETO afirmar que a) os cromossomos de origem materna e paterna que contêm esses genes podem combinar-se livremente.

c) somente I e III. b) Pelos resultados.1 148 .5. Cruzando-se um macho de corpo cinza e asas vestigiais com uma fêmea de corpo ébano e asas longas (parentais P) obteve-se F que deu origem a F‚ através da autofecundação.2. d) somente II e III. III .A lei da segregação independente (2 lei) está relacionada às conseqüências do arranjo. estiverem localizados em cromossomos diferentes. foram produzidas 371 plantas com flores avermelhadas e 287 com flores brancas. e) O exemplo é de interação gênica já que está envolvido apenas um loco. e) I. e) 60. deduz-se que é um padrão de herança intermediária. de pares de cromossomos homólogos na placa metafásica. Após autofecundação das plantas F1. b) 16. 1. Está(ão) correta(s): a) somente I. A F1 resultante apresentou 100% das ervilhas com flores avermelhadas. se 1.Dois pares de genes se segregam independentemente. II e III. na geração F2. logo estão relacionadas com o comportamento cromossômico na meiose. na meiose.2. II . b) somente I e II.1 nalise este padrão de herança e assinale a afirmativa CORRETA: a) Trata-se de um exemplo típico da primeira Lei de Mendel. I . c) 28.5. como mostra a figura a seguir.As 1 e 2 Leis de Mendel abordam o comportamento dos genes na formação dos gametas. Questão 655 As afirmativas a seguir relacionam a Genética Mendeliana à Divisão Celular. d) O gene para a cor avermelhada é codominante em relação ao alelo. Questão 656 A mosca-de-fruta 'Drosophila melanogaster' pode apresentar asas vestigiais ou longas e corpo cinza ou ébano. c) A proporção fenotípica 9:7 é um padrão de segregação independente. d) 36.a) 4. ao acaso. Questão 654 O esquema a seguir representa o cruzamento entre duas variedades puras de ervilha-de-cheiro ('Lathyrus odoratus') de flor branca.

c) Quatro.O gene para corpo ébano só está presente na geração P e em parte de F‚.A probabilidade de ocorrência do mesmo genótipo dos indivíduos de F em F‚ é de 4/16. alça ou verticilo.Os genes para cor do corpo e pra tipo de asa estão localizados num mesmo cromossoma. um gene dominante. Sabendo-se que os zangões surgem de óvulos que se desenvolvem por partenogênese. e) III. c) DDEE. pelo menos. II e V . em homozigose. apenas. e) ADF e adf. c) AaddFF. apenas. e) DDee. a probabilidade de ocorrência de homozigose dominante é a mesma de homozigose recessiva. é Obs. relativos a esses cinco pares de genes podem apresentar os zangões filhos dessa rainha? a) Um. b) Dois. duplo recessivo para o gene "D" e homozigoto dominante para o gene "F". IV e V. IV . relativos a esses quatro pares de genes. d) DdEe. d) Oito. d) II. apenas.Após a análise dos resultados dos cruzamentos. V . Sabendo-se que a surdez é determinada por qualquer dos genes recessivos d ou e.Os genes para cor do corpo e forma das asas segregam-se independentemente durante a formação dos gametas. Sabe-se que os padrões dermatóglifos são de herança multifatorial. apenas. I . b) Ddee. As afirmativas corretas são: a) I. Questão 658 Uma abelha rainha tem os seguintes pares de genes alelos que segregam independentemente: AaBbDdEe. a probabilidade de surgir um descendente com genótipo que apresenta. apenas. A figura a seguir mostra padrões digitais que formam figuras denominadas de arco. b) I. III e V . Entre os gametas que poderão se formar encontraremos apenas a(s) combinação(ões): a) AdF. III . Considere ainda que todos esses genes situam-se em cromossomos diferentes. e) Dezesseis. b) AADDFF. d) AdF e adF. Sabendo-se que os zangões surgem de óvulos que se desenvolvem por partenogênese. podem apresentar os zangões filhos dessa rainha? a) Um b) Dois c) Quatro d) Oito e) Dezesseis Questão 659 Considere um homem heterozigoto para o gene "A". III e IV . artelhos e solas dos pés. espera-se que o genótipo dos filhos seja a) ddee. quantos genótipos diferentes. II e IV. II . Questão 660 Uma abelha rainha tem os seguintes pares de genes alelos que se segregam independentemente: AaBBccDdEE.Em F‚. a) 1/64 b) 63/64 c) 1/32 d) 1/16 e) 1/4 Questão 662 Os dermatóglifos são padrões típicos das cristas dérmicas nos dedos e palmas das mãos. quantos genótipos diferentes. 149 . c) I.: Considere um tipo de herança mendeliana. foram feitas as afirmativas abaixo. Questão 657 Um casal de surdos teve dois filhos com audição normal. Questão 661 Do cruzamento de dois indivíduos com genótipo AaBbCc.

abcdE. E. D. a) a. b. aBcdE. de semente lisa e amarela. Nessas condições. B. Uma planta pura. BbDd. c. ccDd. Se as plantas da geração F forem intercruzadas. Para estes 4 genes. baixa. c) aa. A cor da semente pode ser amarela devido ao alelo "Y" e branca devido ao alelo "y".2 Sobre esse assunto. e) 6. Questão 663 A análise de 4 genes autossômicos. um indivíduo que apresente o genótipo AaBBCcDD produzirá gametas ABCD com a freqüência de: a) 75%. d) 12%. dE. a textura da semente pode ser lisa devido ao alelo "Su" e rugosa devido ao alelo "su". d) aaBb. quantos tipos diferentes de gametas poderia produzir o filho de Janaína e Pedro? a) 4 b) 8 c) 16 d) 32 e) 64 Questão 664 Considere quatro pares de genes que segregam de maneira independente. como a Síndrome de Down. cD. com o genótipo AaBBCCDDEE. d) O número de cristas dérmicas não varia entre indivíduos da mesma família. é INCORRETO afirmar: a) Quanto mais semelhantes forem as mãos de gêmeos.25%. b) Esses padrões podem ser úteis ao diagnóstico de certas síndromes cromossômicas. maior será a probabilidade de que eles sejam monozigóticos. é correto afirmar: 150 1.2. de semente rugosa e branca. Na geração F. aaEE. observaram-se 100% das plantas altas. e) aB. A planta pode ser alta devido ao alelo "Br" e baixa devido ao alelo "br". o número de gametas produzidos pelas plantas F e a proporção fenotípica esperada na geração F‚ será.Questão 665 No milho. permitiu constatar que Janaína tem o genótipo AAbbCCDD e Pedro tem o genótipo aaBBccDD. EE. cc.5. d. Dd. cada um com um par de alelos. Analisando a figura. b) aBcDE. foi cruzada com outra planta pura. c) 25%. Questão 667 Um organismo diplóide. . c) A análise dos padrões digitais não se presta para a determinação de paternidade. poderá produzir quantos tipos geneticamente distintos de gametas? a) 2 b) 4 c) 8 d) 16 e) 32 Questão 668 O desenho abaixo corresponde ao núcleo de uma célula em metáfase de uma espécie cujo número n de cromossomos é 3. Bb. b) 50%. abcDE. bc. de semente lisa e amarela. alta. respectivamente: a) 4 e 3:3:3:1:1:1 b) 8 e 27:9:9:9:3:3:3:1 c) 8 e 9:3:3:1 d) 16 e 9:3:3:1 e) 16 e 27:9:9:9:3:3:3:1 Questão 666 Considere a segunda lei de Mendel ou lei da distribuição independente e indique os gametas produzidos pelo genótipo aaBbccDdEE.

aabbcc e) AaBbCc Questão 673 Se a meiose ocorre numa célula de genótipo AaBbCc.8 .2 .2.4 . sofrem meiose. onde os três pares de genes estão em pares de cromossomos distintos. aBC. abC. e) 180 espermatozóides.5.2 1.4 c) 2 . quais serão os genótipos das células resultantes? a) Aa. poderão ser encontrados 64 genótipos diferentes. sendo.4 -16 . abc b) ABC. abc c) Aa. (16) Como resultado de uma autofecundação. .5. apresentando a constituição ABC. poderão ser formados 4 diferentes tipos de gametas. (02) Em relação aos genes em questão. (08) Como resultado de uma autofecundação.8 .4 -16 .1. ABc. com a constituição representada na figura. poderão ser encontrados 9 genótipos diferentes. Em experimentos envolvendo três características independentes (triibridismo). respectivamente. os genótipos das células resultantes serão: a) ABC.8 Questão 670 Sessenta células de um animal.8 . se for realizado um cruzamento entre indivíduos AaBbCc. impossível calcular tanto o número de genótipos quanto o de fenótipos. (32) O sistema em questão é polialélico. poderão ser formados 8 diferentes tipos de gametas.4 . AaBBcc. d) 120 espermatozóides. Abc. AaBB. Cc d) AABBCC. quantos tipos de gametas diferentes? a) 4 . b) 60 espermatozóides.8 . a) 30 espermatozóides. (04) Como resultado de uma autofecundação. Questão 671 Assinale a alternativa correta.4 e) 2 . portanto. a freqüência de descendentes AABbcc será igual a a) 8/64 b) 1/16 c) 3/64 d) 1/4 e) 1/32 Questão 672 Se a mitose ocorre em uma célula de genótipo AaBbCc.8 .8 b) 4 . AaBbCc.2 .2 (01) Em relação aos genes em questão. Soma ( ) ão esperados. Bb. AaBbcc podem formar. AbC. c) 90 espermatozóides.8 d) 4 .2 .2. onde os três pares de genes estão em pares de cromossomos separados. Bb e Cc 151 Questão 669 Indivíduos com os genótipos AaBb. poderão ser encontrados 16 genótipos diferentes.4 .

Qual a probabilidade de esse casal ter uma criança com fenótipo igual ao do pai? a) 1/2 b) 1/4 c) 1/8 152 ssinale a alternativa correta. filho de pai O. c) 1/8.3 1. Questão 676 No heredograma a seguir. b) O indivíduo 3 deve ter herdado os alelos dessas duas características apenas de sua mãe. AbC. filho de pai míope. que teve eritroblastose fetal ao nascer e é filha de pai do tipo O. a miopia e a habilidade para a mão esquerda são caracteres condicionados por genes recessivos que se segregam de forma independente. Sabendo que o daltonismo é condicionado por um gene recessivo ligado ao sexo e que a miopia é uma herança autossômica recessiva. e) A probabilidade de o casal 4 × 5 ter uma criança míope e canhota é de 3/8. c) A probabilidade de o casal 1 × 2 ter uma criança destra e de visão normal é de 1/4.2.5. Um homem de visão normal e destro. os indivíduos marcados apresentam um tipo de cegueira noturna. A probabilidade de esse casal ter uma criança que possa doar sangue para o pai é de: a) 1/2. d) Todos os descendentes de pai míope e canhoto possuem essas características. e) 1. Questão 678 Na espécie humana. cuja mãe era canhota. Questão 677 Um indivíduo de sangue tipo B. a) O indivíduo 2 deve ser heterozigoto para os alelos dessas duas características. d) zero. O casal já tem uma filha daltônica e míope. abC e abc d) AaBbCc e) AABBCC e aabbcc Questão 674 Sabendo-se que a miopia e o uso da mão esquerda são condicionados por genes autossômicos recessivos. casa-se com uma mulher de sangue tipo A. aBC. casa-se com uma mulher míope e destra.3 probabilidade do casal 4X5 ter uma criança de sexo feminino e de visão normal é de: a) 1/6. Questão 675 Um indivíduo daltônico e não míope. aBc. c) 3/4. ABc. Rh−. b) 1/4. e) 1/3. cujo pai tinha miopia e era canhoto. considere a genealogia a seguir.5. a probabilidade de terem uma menina normal para ambas as características é de: a) 3/16 b) 1/4 c) 1/16 d) 1/2 e) 9/16 . Abc.2. b) 1/4.b) ABC e abc c) ABC. Rh®. d) 1/2. 1. Rh®. casa-se com uma mulher normal para ambas as características.

em um organismo onde o número haplóide (n) é igual a 3. casa-se com uma mulher de olhos livres de catarata mas com ossos frágeis.O ou A ou B. Levando-se em consideração que na espécie humana ocorre a permuta gênica.Se casar-se com uma mulher de sangue tipo A.5. pergunta-se: I . O pai da mulher tem ossos normais.zero b) (I) . pode-se afirmar que um descendente do casal tem: (01) 100% de probabilidade de nascer livre de ambas as anomalias. o alelo B condiciona padrão uniforme e o b. A partir do cruzamento Mmbb × mmBb. Soma ( ) Questão 682 Sendo um homem de sangue tipo O.50% 153 1.Se esse homem casar-se com uma mulher de sangue tipo AB. qual a probabilidade do nascimento de uma criança do tipo AB? A alternativa que responde corretamente às perguntas anteriores é: a) (I) . com a reprodução sexuada.3 . (16) 50% de probabilidade de vir a apresentar apenas uma das anomalias.A ou B ou O. Assim. a cor preta é determinada pelo alelo dominante M e a marrom pelo alelo m. presença de manchas brancas. (04) 25% de probabilidade de vir a ter olhos normais e ossos frágeis. a probabilidade de nascer um filhote marrom com manchas é a) 1/16 b) 3/16 c) 1/4 d) 1/2 e) 3/4 Questão 680 A diversidade biológica dos seres vivos está relacionada.2. (02) 50% de probabilidade de vir a sofrer de catarata e ter ossos normais. Esses dois pares de alelos autossômicos segregam-se independentemente. pode-se afirmar que a melhor expressão para o número (w) de gametas possíveis está representada em: a) w = 2£¤ b) w > 2£¤ c) w < 2£¤ d) w = 2¢¤ e) w¤ 2¢¤ Questão 681 A cegueira provocada pela catarata e a extrema fragilidade dos ossos são características que podem aparecer em seres humanos e resultam da ação de dois genes dominantes autossômicos presentes em cromossomos diferentes. podemos observar que o número possível de gametas (w) em uma espécie é igual a 2¾. A figura a seguir demonstra a distribuição independente de cromossomos maternos e paternos. (II) . que ocorre durante a meiose. O principal evento responsável por essa diversidade ocorre durante a formação dos gametas. (08) 50% de probabilidade de vir a apresentar ambas as anomalias. quais os prováveis tipos de sangue dos filhos do casal? II . Um homem com catarata e ossos normais cujo pai tem olhos normais.d) 3/4 e) 3/8 Questão 679 Em determinada raça animal. (II) . Nessas condições. principalmente.

Rh−. b) menor que a chance de nascerem todos com sangue do tipo AB.c) (I) . A tabela a seguir resume os resultados parciais da análise de grupos sangüíneos (do menino. O e) A. B. Se o casal vier a ter outros 5 filhos. casada com um homem de sangue tipo B. e) os resultados de DNA contradizem os resultados dos grupos sangüíneos. A probabilidade de os pais desse menino terem mais um filho com o mesmo fenótipo de seu irmão.5. A e B. 154 . podemos afirmar que: 1. correspondentes a um segmento localizado num autossomo e outro no cromossomo X. B.1 a) os resultados dos grupos sangüíneos excluem a possibilidade do homem ser o pai da criança. B. A e A. os outros exames foram desnecessários. AB d) A.zero e) (I) .A ou B. Questão 687 Uma mulher de sangue tipo A. c) os resultados dos grupos sangüíneos e de DNA não excluem a possibilidade do homem ser pai da criança. o grupo sangüíneo e o fator Rh é de a) 1/16 b) 1/12 c) 1/8 d) 1/4 e) 1/2 Questão 684 Nas hemácias de um indivíduo pertencente ao grupo sangüíneo B: a) existe o aglutinógeno B b) existe o aglutinógeno A c) existe a aglutinina A d) existe a aglutinina B e) existem o aglutinógeno A e a aglutinina B Questão 685 Um homem de genótipo AB casa-se com uma mulher receptora universal. A. mas possuidor do antígeno Rh. d) menor que a chance de nascerem sucessivamente com sangue do tipo AB. Os tipos de sangue dos filhos são apenas: a) A e AB b) A e B c) A. . mas a seqüência de DNA do cromossomo X exclui. B. . foram realizados exames para identificação de grupos sangüíneos e análise de DNA. (II) . Rh−. levando em conta o sexo.A ou B.mãe de tipo sangüíneo B. d) os três resultados foram necessários para confirmar que o homem é mesmo o pai da criança.25% Questão 683 Considere os seguintes dados: . de sua mãe e do suposto pai) e de duas seqüências de DNA (do menino e do suposto pai). B.3. teve um filho de sangue tipo O. b) os resultados dos grupos sangüíneos não excluem a possibilidade do homem ser o pai da criança.50% d) (I) .menino de tipo sangüíneo A. Considerando apenas a tabela adiante. (II) .A ou B. a chance deles nascerem todos com sangue do tipo O é a) igual à chance de nascerem todos com sangue do tipo AB. c) maior que a chance de nascerem todos com sangue do tipo AB.pai sem aglutininas do sistema ABO no sangue. e) maior que a chance de nascerem sucessivamente com sangue do tipo AB. (II) . O Questão 686 Num caso de investigação de paternidade.

a) heterozigoto .1 155 . soro anti-B na segunda e soro anti-Rh na terceira. a cada uma. c) A e Rh negativo. quanto aos grupos sanguíneos ABO e fator Rh. foi colocada uma gota de sangue humano em cada uma delas.1 om relação a esses resultados.5. c) polialelia. b) heterozigoto .homozigoto dominante.5.3. Questão 690 Utilizando-se três lâminas de microscopia. Questão 692 Qual das opções a seguir relaciona os grupos sangüíneos de um doador universal ideal? a) ARh− b) ABRh® c) ORh® d) ABRh− e) ORh− Questão 693 Considerando os casamentos a seguir.3. uma criança de tipo sangüíneo B. e) A e Rh positivo. em relação aos locos dos sistemas ABO e Rh. respectivamente: 1. Após a mistura do sangue com os respectivos soros.heterozigoto. notou-se aglomeração de hemácias apenas no local onde havia soros anti-B e anti-A. Rh+ poderá ser filha: 1. anti-Rh e anti-B. adicionando-se. d) pleiotropia. foi observada aglutinação nas duas primeiras lâminas.Questão 688 Para se determinar o tipo sangüíneo de uma pessoa. d) AB e Rh positivo. foram colocadas três gotas de seu sangue sobre uma lâmina de vidro. e) homozigoto . A cada gota foi juntada igual quantidade de soro anti-A na primeira.heterozigoto. assinale a opção correspondente ao possível genótipo da pessoa em teste: a) IÞIÞRR b) IÞIßrr c) IßiRr d) IÞirr e) iiRR Questão 689 No heredograma a seguir estão indicados os fenótipos dos grupos sangüíneos ABO e Rh. é: a) B e Rh positivo. conforme o esquema adiante. Após alguns segundos. soros anti-A. b) quantitativa.homozigoto recessivo. d) homozigoto .homozigoto dominante. b) AB e Rh negativo. O indivíduo 6 deverá ser. Questão 691 A herança do sistema ABO é do tipo: a) com dominância. A partir desses dados podemos afirmar que o indivíduo. c) heterozigoto . e) poligênica.

a probabilidade de nascer uma menina do tipo O. a probabilidade do casal ter uma criança do tipo A. que mostra a tipagem ABO e Rh dos indivíduos. Rh® é de: a) 1/6 b) 1/8 c) 1/2 d) 1/4 e) 1/3 Questão 698 O heredograma a seguir mostra os diferentes tipos sangüíneos existentes em uma família. d) IÞIß e IÞIÞ. e) IÞi e IßIß. 156 .3. Questão 694 Jorge.3. recebeu transfusão de sangue de sua mulher Tânia. que é filha de pai e mãe do tipo B. c) IÞi e Ißi.5.1 Considere o heredograma acima. c) O indivíduo 6 é homozigoto. os genótipos do casal são: a) IÞi e IÞi. Rh® é: a) 100% b) 25% c) 75% d) 50% e) 0 Questão 695 Uma mulher que possui aglutinina anti-B no seu sangue teve um filho do grupo O. Questão 696 A respeito do heredograma acima. Sabendo-se que o marido tem o aglutinogênio B. e) O indivíduo 8 é heterozigoto. b) IÞIÞ e Ißi.5. Rh− e é filho de pai tipo A e mãe tipo B. a) O indivíduo 9 pode ser doador universal. que tem tipo sangüíneo A. Sabendo-se que Tânia teve eritroblastose fetal ao nascer. d) O indivíduo 1 é receptor universal.3. b) O indivíduo 7 pertence ao grupo sangüíneo A. assinale a alternativa INCORRETA. d) somente do casal II e) do casal I ou do casal II ou do casal III. Sabendo que o casal 5×6 já perdeu uma criança com eritroblastose fetal. c) o casal III ou do casal IV.1.5.1 1. Questão 697 1. b) do casal I ou do casal IV. que considera o sistema sangüíneo ABO.1 a) somente do casal I.

157 . somente. um A.Indivíduos que apresentem os dois alelos dominantes IÞ e Iß pertencem ao grupo AB.1 ou negativo.Indivíduos que apresentem apenas alelo dominante Iß e não apresentem IÞ pertencem ao grupo B. Epaminondas. b) B e B. FATOR Rh: positivo. e) TIPO SANGÜÍNEO: O. FATOR Rh: negativo. mas não se sabia o seu grupo sangüíneo. d) A e B. somente. Questão 702 ssinale a alternativa que contém.IÞi c) A . respectivamente. FATOR Rh: negativo ou positivo. Entretanto sabe que seu pai é A+.1. somente. FATOR Rh: positivo No ambulatório de uma pequena cidade do interior estava D. Josefa apresenta sangue do grupo: a) A b) B c) AB d) O Questão 703 O esquema apresenta uma árvore genealógica de alguns primatas e seus possíveis grupos sangüíneos no sistema ABO.5. o fenótipo e o genótipo do indivíduo II. FATOR Rh: positivo. sua mãe O+ e seu irmão é A-. Como faltavam anti-soros para a determinação dos grupos sangüíneos no sistema ABO. Quantos filhos biológicos tem esse casal? a) 5 b) 4 c) 3 d) 2 e) 1 Questão 700 Uma criança tem tipo sangüíneo do tipo AB. Questão 701 Alexsander não sabe qual é o seu grupo sangüíneo e o seu tipo de Rh. d) TIPO SANGÜÍNEO: A ou O.2 a) O . Os tipos sangüíneos dos pais biológicos dessa criança são: a) A e A.Indivíduos que apresentem apenas alelos recessivos ii pertencem ao grupo O. Josefa. Josefa não era capaz de aglutinar as hemácias do Dr. usou de um outro recurso: retirou um pouco de seu próprio sangue do qual separou o soro. . somente.ii b) A .IÞIß Questão 699 Pais cujo grupo sanguíneo são AB e O têm cinco filhos com os seguintes fenótipos: dois são O. que precisava urgentemente de transfusão sangüínea. de acordo com a seguinte composição genética: . . Assinale a opção que contém o(s) grupo(s) sangüíneo(s) e o(s) tipo(s) de Rh que Alexsander pode ter: a) TIPO SANGÜÍNEO: A. b) TIPO SANGÜÍNEO: O. e) AB e O. Epaminondas.3. fazendo o mesmo com o sangue de D. . Dr. mas o soro de D. que é do grupo A. Josefa. c) TIPO SANGÜÍNEO: A ou O.Indivíduos que apresentem apenas alelo dominante IÞ e não apresentem Iß pertencem ao grupo A. Dr.IÞIÞ d) B . somente. somente. c) A e O.Ißi e) AB . A partir dos resultados. um B e um AB. Josefa. O teste subseqüente revelou que o soro do Dr. Epaminondas pode concluir que D. Epaminondas provocava aglutinação das hemácias de D.

d) As pessoas pertencentes ao grupo AB são recessivas e. Assim. apresentam pouca chance de existir numa população. Questão 706 Observe a árvore genealógica a seguir para o grupo sangüíneo (ABO) em uma família: 158 .1 1.Questão 705 Suponha que um grupo de pessoas. Assim. portanto. Nas tabelas a seguir. os casamentos entre as pessoas O e A e entre pessoas O e B produzem apenas descendentes pertencentes ao grupo O. Essa situação leva a uma menor freqüência dessas pessoas na população.3. b) Orangotangos podem apresentar três grupos sangüíneos. é correto afirmar.5.5. EXCETO: a) Apenas dois dos primatas citados podem apresentar indivíduos doadores universais no sistema ABO. mas chimpanzés. apenas dois. c) O gene O é recessivo e.5. são mostradas as freqüências aproximadas dos grupos sangüíneos do sistema ABO da população original (tabela 1) e da população atual (tabela 2). o casamento entre pessoas pertencentes ao grupo O origina apenas descendentes do grupo O. os casamentos entre pessoas O e A e entre pessoas O e B apresentam 50% de chance de produzir descendentes pertencentes ao grupo O. d) Alguns gorilas podem receber sangue de alguns orangotangos. Considerando-se apenas os antígenos do sistema ABO. Questão 704 Os esquemas mostram as possíveis transfusões de sangue tradicionais em relação aos sistemas ABO e Rh. b) O gene O é dominante sobre os genes A e B.1 Pode-se dizer que os tipos sanguíneos mais difíceis e mais fáceis para receber sangue são. e) As pessoas pertencentes ao grupo AB só recebem sangue de AB. A população originária desse grupo vive até hoje no mesmo local. 1. totalmente isolada.3.1 De acordo com o esquema. portanto. respectivamente: a) O Rh® e O Rh− b) O Rh− e AB Rh® c) A Rh− e OB Rh® d) AB Rh® e O Rh− Qual das alternativas a seguir apresenta uma explicação possível para a mudança na freqüência dos grupos sangüíneos nessa população? a) O gene O é dominante sobre os genes A e B. mas não de chimpanzés.3. 1. imigrou para uma região há mais de meio século. c) Apenas dois dos primatas da árvore podem apresentar indivíduos receptores universais no sistema ABO. somente humanos podem apresentar os quatro grupos sangüíneos no sistema ABO. pertences a uma determinada seita religiosa.

Rh® teve três crianças com pais distintos: 1. Rh− c. A.1 CRIANÇAS I.c.b c) I . II . B.c.1 .b. III . AB × AB 159 OBS: 1.b. outro é do grupo AB e outro do grupo O.c d) I . III . numa família. III . o único que pode ser dos pais desses indivíduos é a) ii × Ißi b) IÞi × IÞIß c) IÞi × Ißi d) IÞIÞ × IÞIß e) IÞIÞ × IßIß Questão 710 Os tipos sangüíneos do sistema ABO de três casais e três crianças são mostrados a seguir. N.b. dois irmãos são do grupo sangüíneo A.5.c b) I .5.b. CASAIS I. Rh® III. AB.a Questão 709 Sabe-se que.3. MN. O indivíduo 4 é homem do grupo sangüíneo "B" 3. Rh− PAIS a. Dos pares de genótipos a seguir. N. marque a opção correta: a) o indivíduo 3 é do grupo sangüíneo "AB" b) o indivíduo 1 pode ser do grupo sangüíneo "AB" c) o indivíduo 1 é do grupo sangüíneo "A" d) o indivíduo 1 é do grupo sangüíneo "O" Questão 707 Observe a árvore genealógica a seguir. N. M.a. O indivíduo 2 é mulher do grupo sangüíneo "A" 2. N. II . Rh− II.Legenda: Grupo "A": A/A ou A/O Grupo "B": B/B ou B/O Grupo "AB": A/B Grupo "O": O/O arque a opção correta: a) o indivíduo nŽ 5 pode ser de grupo sangüíneo "AB" b) o indivíduo nŽ 1 é do grupo sangüíneo "AB" c) o indivíduo nŽ 6 é do grupo sangüíneo "AB" d) o indivíduo nŽ 7 não pode ser filho do casal 5×6 Questão 708 Uma mulher com grupos sangüíneos B.a. O indivíduo 5 é mulher do grupo sangüíneo "O" Sobre a árvore anterior.a. III . B. Rh− b. II . III . para o grupo sangüíneo ABO em uma família: 1. A. N. II . a) I . O.a e) I . II . Rh® Assinale a alternativa que relaciona corretamente cada criança ao seu pai.c.3.

II. B × B III. A × O CRIANÇAS a. A b. O c. AB Sabendo-se que cada criança é filha de um dos casais, alternativa que associa corretamente cada casal a seu filho é a) I - a; II - b; III - c b) I - a; II - c; III - b c) I - b; II - a; III - c d) I - c; II - a; III - b e) I - c; II - b; III - a Questão 711 Uma criança necessita urgentemente de uma transfusão de sangue. Seu pai tem sangue do tipo B e sua mãe, do tipo O. Que outro(s) tipo(s) de sangue, além do tipo O, poderia(m) ser utilizado(s) na transfusão, mesmo sem a realização de teste, sabendo-se que o avô paterno da criança tem sangue do tipo AB e sua avó paterna tem sangue do tipo O? a) Tipo AB. b) Tipo A. c) Tipo B. d) Tipo A e tipo B. e) Nenhum outro tipo. Questão 712 Na herança do sistema sangüíneo ABO, há três alelos autossômicos principais: IÞ (para sangue do tipo A), Iß (para sangue do tipo B) e i (para sangue do tipo O). Sabe-se, ainda, que IÞ e Iß são codominantes, ambos dominando sobre i. Uma mulher do tipo A, casada com um homem do tipo B, teve uma filha do tipo O. O homem não quis reconhecer a paternidade alegando infidelidade por parte da mulher. Como na época em que o fato ocorreu não havia o "exame do DNA", o Juiz recorreu a um geneticista que lhe apresentou um parecer sobre o caso. Assinale a alternativa que contém a conclusão correta do geneticista. a) O homem tem razão, pois, por se tratar de um caso de herança ligada ao sexo, a filha dos dois teria que ser, obrigatoriamente, do tipo A.

b) O homem tem razão, pois, pais com tipos A e B, quaisquer que sejam seus genótipos, jamais poderiam ter filhos ou filhas do tipo O. c) O homem não tem razão, pois, pais com tipos A e B, dependendo de seus genótipos, podem ter filhos ou filhas com qualquer um dos tipos sangüíneos (A, B, AB e O). d) O homem não tem razão, pois, por se tratar de herança autossômica, filhos e filhas teriam que ser, obrigatoriamente, do tipo O. e) O homem tem razão, pois, pais com tipos A e B, só podem ter filhos ou filhas do tipo AB, visto que IÞ e Iß são codominantes. Questão 713 Mulher branca, submetida à inseminação artificial, deu à luz gêmeos de cor negra. O fato causou polêmica, já que o pai também é branco. A grande dúvida é saber se houve troca de embriões ou apenas de um dos gametas. Adaptado do "Jornal do Brasil", 1Ž de agosto de 2002 Considere o fato relatado e suponha que a mãe tenha sangue tipo A e seja filha de pai e mãe com sangue tipo AB. Nesse caso, o tipo sangüíneo dos gêmeos poderia ser: a) A ou O b) A ou AB c) B ou O d) B ou A e) AB ou O Questão 714 É necessário o conhecimento do tipo sangüíneo em caso de transfusão. Em relação ao sistema ABO, ( ) indivíduos do grupo sangüíneo O podem doar sangue para pessoas do seu próprio tipo sangüíneo e para os demais . ( ) indivíduos do grupo AB podem receber sangue de qualquer tipo. ( ) indivíduos portadores de sangue do tipo A possuem aglutinogênios A. ( ) indivíduos do grupo B possuem aglutinina anti-A.

160

Questão 715 Além do teste de DNA, há exames mais simples que podem ajudar a esclarecer dúvidas sobre paternidade. Por exemplo, o teste de tipagem sangüínea do sistema ABO permite determinar quem não pode ser o pai. Assinale a alternativa que apresenta uma situação em que esse exame assegura a exclusão da paternidade: a) O filho é do tipo O, a mãe do tipo O e o suposto pai do tipo A. b) O filho é do tipo AB, a mãe do tipo AB e o suposto pai do tipo O. c) O filho é do tipo AB, a mãe do tipo A e o suposto pai do tipo B. d) O filho é do tipo B, a mãe do tipo B e o suposto pai do tipo O. e) O filho é do tipo A, a mãe do tipo A e o suposto pai do tipo B. Questão 716 O heredograma a seguir representa uma família na qual foram determinados os grupos sangüíneos do sistema ABO para alguns dos membros, e do sistema Rh para todos os membros. Com base nas informações contidas no heredograma e em seus conhecimentos sobre o assunto, é INCORRETO afirmar-se que

a) a probabilidade do indivíduo I-2 formar gametas iR é de 50%. b) a probabilidade de II-4 ter uma criança com eritroblastose fetal é de O%. c) os indivíduos Rh positivos da geração II pertencem ao grupo sangüíneo A, e os Rh negativos, ao grupo O. d) o indivíduo I-1 é heterozigoto para uma das características. e) os indivíduos II-3 e II-4 podem apresentar os dois tipos de aglutinina do sistema ABO. Questão 717 Nas situações em que vítimas de acidentes necessitam de transfusão de sangue, sem que se conheça o tipo sangüíneo de cada uma delas, é recomendável utilizar-se o tipo "O negativo". É CORRETO afirmar que, nesse caso, tal tipo sangüíneo é o mais adequado porque, nas hemáceas do doador, estão a) presentes os antígenos correspondentes aos anticorpos do receptor. b) ausentes os anticorpos correspondentes aos antígenos do receptor. c) ausentes os antígenos correspondentes aos anticorpos do receptor. d) presentes os anticorpos correspondentes aos antígenos do receptor. Questão 718 Com relação à genética dos grupos sangüíneos ABO, pode-se afirmar que: a) existem 16 modalidades de cruzamentos de gametas. b) existem 9 possibilidades de acasalamentos. c) indivíduo com grupo sangüíneo O não pode ser filho de acasalamento de indivíduos dos grupos O e AB. d) indivíduo do grupo sangüíneo B não pode ser filho de acasalamento de indivíduos dos grupos O e AB. e) indivíduo com grupo sangüíneo AB pode ser filho de acasalamento de indivíduos dos grupos O e B. Questão 719 A respeito dos grupos sangüíneos avalie as proposições abaixo. ( ) Grupo sangüíneo: A
161

1.5.3.1

Antígenos: A Anticorpos: Anti-B Doa: A, AB Recebe: A, O ( ) Grupo sangüíneo: B Antígenos: B Anticorpos: Anti-A Doa: B, AB Recebe: B, O ) Grupo sangüíneo: AB Antígenos: A e B Anticorpos: Anti-A e Anti-B Doa: AB Recebe: AB, A , B, O ) Grupo sangüíneo: O Antígenos: O Anticorpos: Não tem Doa: O, A, B, AB Recebe: O ) Grupo sangüíneo: A Antígenos: A Anticorpos: Anti-A Doa: A, AB Recebe: A, O Questão 720 Na figura a seguir são mostrados os genótipos e fenótipos possíveis, considerando-se os alelos IÞ, Iß e i determinantes dos grupos sangüíneos do sistema ABO no homem. De acordo com a figura, analise as proposições a seguir.

(

) Todos os descendentes de um casal de genótipo tipo 2 serão do grupo A e apresentarão em suas hemácias o aglutinogênio A. 2) Indivíduos do grupo sangüíneo B de genótipo 3 ou 4 apresentam na membrana de suas hemácias aglutinogênio B e, no plasma, aglutinina anti-A. 3) Os descendentes de um casal (genótipo 5) do grupo sangüíneo AB serão fenotipicamente AB e, como têm em seus genótipos os alelos IÞ e Iß, apresentam, na membrana de suas hemácias, os antígenos A e B. 4) Indivíduos do grupo sangüíneo O de genótipo 6, apresentam aglutinogênios A e B no plasma, mas não têm aglutininas anti-A e anti-B na membrana de suas hemácias. Está(ão) correta(s) apenas: a) 2 b) 1 e 4 c) 2 e 4 d) 2 e 3 e) 2, 3 e 4 Questão 721 Três irmãos (João, José e Maria) realizaram um exame de sangue em laboratório para identificar os seus tipos sangüíneos, com o objetivo de verificar a possibilidade de doarem sangue ao pai, que necessitaria de uma transfusão após uma cirurgia. Um deles (João) ficou surpreso ao descobrir seu tipo sangüíneo - O - e achou que não era filho biológico do casal que o criou. Seu pai e o irmão apresentam sangue do tipo A e sua mãe e a irmã apresentam sangue do tipo B. Todos são RH®. Com base no texto e em seus conhecimentos sobre a herança dos tipos sangüíneos, é correto afirmar que a) João não pode ser filho biológico do casal, pois de acordo com a herança genética possível do tipo sangüíneo, os filhos somente poderiam apresentar sangues dos tipos A, B e AB. Dos filhos biológicos, somente José pode doar sangue ao pai, pois as hemácias de seu sangue apresentam aglutinogênio A. b) João pode ser filho biológico do casal, desde que pelo menos um dos pais seja heterozigoto e apresente o alelo responsável pela presença de aglutininas anti-A e anti-B no plasma. O pai não pode receber sangue de Maria, pois seu sangue apresenta aglutinina anti-B. c) João não pode ser filho biológico do casal, assim como seus dois irmãos, pois de acordo com a herança genética
162

(

(

1.5.3.1

possível do tipo sangüíneo, os filhos somente poderiam apresentar sangues dos tipos AB. O pai pode receber sangue de João e José, pois o sangue dele apresenta aglutinina anti-A, assim como o de seus filhos. d) Se Maria engravidar de um homem com o mesmo genótipo para o tipo sangüíneo de seu irmão João, existe a probabilidade de 100% de seu filho ter sangue do tipo B. Porém, se ela engravidar de um homem com o mesmo genótipo para o tipo sangüíneo de seu irmão José, existe a probabilidade de 50% de seu filho ter sangue do tipo AB, 25% do tipo A e 25% do tipo B. e) João pode ser filho biológico do casal, desde que ambos os pais sejam heterozigotos e apresentem o alelo responsável pela ausência de aglutinogênio. João pode doar sangue para seu pai, pois as hemácias do seu sangue não apresentam aglutinogênios. Questão 722 Jorge, portador de grupo sangüíneo AB Rh-, e Júlia, que é AB Rh+, têm uma filha, Joana, que aos 3 anos de idade necessita de uma transfusão sangüínea. Os exames laboratoriais por hemaglutinação dão os seguintes resultados:

b) seus eritrócitos não contêm anticorpos anti-A e anti-B. c) seu plasma não contém antígenos A e B. d) seus eritrócitos não contêm antígenos A e B. e) seu sangue não contém antígenos nem anticorpos. Questão 724 A herança dos tipos sangüíneos do sistema ABO constitui um exemplo de alelos múltiplos (polialelia) na espécie humana. Com relação ao sistema ABO é CORRETO afirmar que: (01) o tipo O é muito freqüente e, por este motivo, o alelo responsável por sua expressão é dominante sobre os demais. (02) os indivíduos classificam-se em um dos quatro genótipos possíveis: grupo A, grupo B, grupo AB e grupo O. (04) existem três alelos: o IÞ, o Iß e o i. (08) os alelos IÞ e Iß são codominantes. (16) se um indivíduo do grupo A for heterozigoto, ele produzirá gametas portadores de IÞ ou de i. (32) os indivíduos de tipo sangüíneo O possuem aglutinogênios em suas hemácias, porém não possuem aglutininas no plasma. (64) em alguns cruzamentos, entre indivíduos do grupo A com indivíduos do grupo B, é possível nascerem indivíduos do grupo O. Questão 725 Em relação ao sistema sangüíneo ABO, um garoto, ao se submeter ao exame sorológico, revelou ausência de aglutininas. Seus pais apresentaram grupos sangüíneos diferentes e cada um apresentou apenas uma aglutinina. Os prováveis genótipos dos pais do menino são a) Ißi - ii. b) IÞi - ii. c) IÞIß - IÞi. d) IÞIß - IÞIÞ. e) IÞi - Ißi.

1.5.3.1

Em face dos dados apresentados, assinale a alternativa correta. a) Joana não pode ser filha natural de Júlia. b) Joana não pode receber sangue O Rh-. c) Jorge não pode ser o pai natural de Joana. d) Joana pode receber sangue AB Rh-. e) Joana pode ser homozigota para B. Questão 723 Em uma transfusão sangüínea, indivíduos do grupo O são considerados doadores universais porque a) seu plasma não contém anticorpos anti-A e anti-B.

163

Questão 726 Para os grupos sangüíneos do sistema ABO, existem três alelos comuns na população humana. Dois (alelos A e B) são co-dominantes entre si e o outro (alelo O) é recessivo em relação aos outros dois. De acordo com essas informações, pode(m)-se afirmar: I. Se os pais são do grupo sangüíneo O, os filhos também serão do grupo sangüíneo O. II. Se um dos pais é do grupo sangüíneo A e o outro é do grupo sangüíneo B, todos os filhos serão do grupo sangüíneo AB. III. Se os pais são do grupo sangüíneo A, os filhos poderão ser do grupo sangüíneo A ou O. Está(ão) correta(s) a) apenas I. b) apenas II. c) apenas III. d) apenas I e III. e) I, II e III. Questão 727 Observe a genealogia.

ara o casal (5 e 6) que pretende ter muitos filhos, foram feitas as quatro afirmações a seguir. I - O casal só terá filhos AB e Rh positivo. II - Para o sistema ABO, o casal poderá ter filhos que não poderão doar sangue para qualquer um dos pais. III - O casal poderá ter filhos Rh positivo, que terão suas hemácias lisadas por anticorpos anti-Rh produzidos durante a gravidez da mãe. IV - Se for considerado apenas o sistema Rh, o pai poderá doar sangue a qualquer um de seus filhos. São corretas, apenas, as afirmações a) II e IV b) I, II e IV c) II, III e IV d) I, II e III. e) I e III. Questão 728 Em um acidente de carro, três jovens sofreram graves ferimentos e foram levados a um hospital, onde foi constatada a necessidade de transfusão de sangue devido a forte hemorragia nos três acidentados. O hospital possuía em seu estoque 1 litro de sangue do tipo AB, 4 litros do tipo B, 6 litros do tipo A e 10 litros do tipo O. Ao se fazer a tipagem sangüínea dos jovens, verificou-se que o sangue de Carlos era do tipo O, o de Roberto do tipo AB e o de Marcos do tipo A. Considerando apenas o sistema ABO, os jovens para os quais havia maior e menor disponibilidade de sangue em estoque eram, respectivamente, a) Carlos e Marcos. b) Marcos e Roberto. c) Marcos e Carlos. d) Roberto e Carlos. e) Roberto e Marcos. Questão 729 Considerando o casamento entre um homem tipo sangüíneo A®, cujo pai era O−, com uma mulher B® cuja mãe era A−, assinale a(s) alternativa(s) correta(s). (01) A probabilidade de nascer 1 filha mulher B® é 3/16. (02) A probabilidade de nascer 1 filho homem O− é nula. (04) A probabilidade de nascer 1 filho homem e 1 filha mulher AB é 9/1024.
164

1.5.3.1

(08) A probabilidade de nascer filho homem AB− é 1/16. (16) A probabilidade de nascer 1 filho homem A® é 1/8. (32) A probabilidade de nascer 2 filhas mulheres A− é 1/1024. Questão 730 Uma mulher Rh− casou-se e teve um filho. Numa segunda gestação a criança apresentou um quadro de eritroblastose fetal. Com estes dados, indique qual a opção que apresenta o fenótipo para o fator Rh da mãe, do pai e da criança, respectivamente. a) Mãe Rh negativo, Pai Rh positivo e Criança Rh positivo. b) Mãe Rh positivo, Pai Rh positivo e Criança Rh negativo. c) Mãe Rh positiva, Pai Rh negativo e Criança Rh negativa. d) Mãe Rh positivo, Pai Rh negativo e Criança Rh positivo. e) Mãe Rh negativo, Pai Rh positivo e Criança Rh negativo. Questão 731 A observação do esquema a seguir, que representa a genealogia de uma família em relação aos grupos sanguíneos MN, nos permite afirmar que:

a) Rh positivo e Rh negativo. b) Rh negativo e Rh positivo. c) Rh positivo e Rh positivo. d) Rh negativo e Rh negativo. e) Rh positivo e Rh neutro. Questão 733 A doença hemolítica do recém-nascido é um problema causado pela incompatibilidade sangüínea entre mãe e feto. Assinale a alternativa que contém a família na qual é possível a ocorrência da citada doença. a) Mãe: Pai: 1Ž bebê: 2Ž bebê: b) Mãe: Pai: 1Ž bebê: 2Ž bebê: c) Mãe: Pai: 1Ž bebê: 2Ž bebê: IÞi Ißi IÞIß Ißi IÞIÞ IßIß IÞIß IÞIß ii ii ii ii rh Rh Rh Rh rh rh rh rh

Rh rh rh rh Rh rh rh rh rh rh rh rh Rh Rh Rh Rh rh Rh rh rh rh rh rh rh rh rh rh rh rh rh rh rh

1.5.3.2

d) Mãe: ii Pai: Ißi 1Ž bebê: Ißi 2Ž bebê: ii e) Mãe: IÞi Pai: ii 1Ž bebê: IÞi 2Ž bebê: ii Questão 734

a) sangue MN é característica determinada por gene dominante. b) os indivíduos 4 e 5 são heterozigotos. c) o casal 3 e 4 poderá ter filhos dos três tipos de grupos sanguíneos. d) se o indivíduo 5 casar-se com uma mulher de sangue N, todos os filhos serão heterozigotos. e) um próximo filho do casal 6 e 7 poderá ser do grupo N. Questão 732 Quanto ao surgimento da eritroblastose fetal, ou doença hemolítica do recém-nascido, podemos afirmar que ela ocorre quando o pai e a mãe respectivamente apresentam:

Paula, portadora do aglutinogênio B e Rh negativo casou-se com João, portador dos aglutinogênios A e B e Rh positivo. Sabendo-se que a mãe de Paula não possui aglutinogênios e que João teve um irmão com doença hemolítica do recém nascido, conclui-se que a probabilidade de o casal ter um filho Rh positivo e sangue tipo A é: a) 9/16
165

Essa mulher poderá dar à luz uma criança com eritroblastose fetal. não fez qualquer recomendação. casou-se com Elaine. mesmo sendo Rh®.2 onsidere as seguintes afirmações: I . disse que esse procedimento não seria mais necessário. b) despreocupado. Fazendo um exame pré-natal e relatando esse fato ao médico. b) o pai possui genótipo IÞIß.3. logo após o parto. bem como todos os filhos Rh− não serão atingidos pela doença e esta só atinge uma pequena fração de casos em outras gestações de filhos Rh®. c) se somente I estiver correta. c) é incorreta. que tem Rh® e é homozigoto. d) Pedro e João. Pedro e Marina. b) Lúcia e João. pois filhos Rh®. d) é incorreta. III . d) bastante preocupado.O genótipo do pai pode ser IÞIÞRR. c) a mãe pode pertencer ao tipo sangüíneo O. e) se somente II e III estiverem corretas. 1. e) João e Marina.Em caso de transfusão sangüínea. e) a mãe pode ter genótipo IÞi. d) se somente I e III estiverem corretas. que é receptor universal e teve eritroblastose fetal. pois todos os filhos desse casal serão abortados. a criança poderá receber sangue. II . pois o primeiro filho em geral não tem a anemia. Questão 738 O quadro abaixo mostra os resultados das tipagens ABO e Rh de um casal e de seu filho.b) 3/16 c) 1/4 d) 1/8 e) 1/2 Questão 735 Lúcia e João são do tipo sangüíneo Rh positivo e seus irmãos. Então é INCORRETO afirmar que: a) a mãe é certamente Rh−. Carlos. Numa segunda gravidez. pois não existe influência do fator Rh positivo ou negativo nos casos de Eritroblastose fetal. tanto da mãe quanto do pai. d) essa criança é certamente heterozigota para o fator Rh. e) é incorreta. Questão 736 A afirmação que uma mulher Rh− não deve casar-se com um homem Rh®: a) é correta. inclusive pela informação de 166 . Assinale: a) se somente III estiver correta. mesmo no caso de glóbulos vermelhos atingirem a circulação materna em sucessivas gestações.5. pois todos os filhos desse casal terão uma doença grave fetal caracterizada por uma anemia profunda (Eritroblastose fetal). que tem Rh−. b) é correta. entretanto. são do tipo Rh negativo. c) Lúcia e Marina. recomendando que. a mãe recebesse soro anti-Rh. c) preocupado. Questão 737 Uma criança tem genótipo igual ao pai. Quais dos quatro irmãos podem vir a ter filhos com eritroblastose fetal? a) Marina e Pedro. b) se somente II estiver correta. Ambos possuem o mesmo grupo sangüíneo. apenas solicitando ao casal que o procurasse no momento da segunda gestação. o mesmo ficou: a) despreocupado e não fez qualquer recomendação relativa ao fato. O sinal + indica reação positiva e o sinal . não serão atingidos pela Eritroblastose fetal.indica reação negativa. Questão 739 Indivíduos sem antígeno Rh nas hemácias são considerados recessivos.

Se uma mulher foi orientada a usar a vacina anti-Rh logo após o nascimento do primeiro filho. é: a) 1 b) 1/2 c) 1/3 d) 1/4 e) 1/8 Questão 741 Interpretando a figura a seguir sobre a Doença Hemolítica do recém-nascido (DHR). Mãe = rr.2 a) A placenta normalmente funciona como uma barreira que separa as células sangüíneas fetais e maternas. PAI . negativo. e) positivo.Rh®.Rh−. CRIANÇA . 167 . cujo pai é Rh−. b) Após a 1 gravidez. após cada parto. d) positivo. negativo. negativo. positivo. PAI . c) negativo.Rh−.3.Rh® 1. a) MÃE.Rh− c) MÃE. após o contato com o antígeno Rh®. recomendando bastante atenção em cada gravidez. os antígenos fetais não serão capazes de induzir a produção de anticorpos anti-Rh pela mãe.Rh®. CRIANÇA .Rh−. positivo. dizendo ao casal que a gravidez era de altíssimo risco e eles não poderiam mais ter outro filho. CRIANÇA .Rh− e) MÃE.Rh−.compatibilidade de grupo sangüíneo. Assinale a alternativa do quadro abaixo que identifica corretamente os grupos sangüíneos dessa família. o do seu marido e o da criança são. a probabilidade de esse casal vir a ter um filho do sexo masculino. logo após o parto da 1 gravidez. Questão 742 Uma mulher com sangue do tipo A / Rh® / MM é casada com um homem com tipo sangüíneo B / Rh® / NN.Rh®. de maneira que. podemos dizer que seu fator Rh. Qual das alternativas abaixo indica o tipo sangüíneo de uma criança que NÃO poderia ter sido gerada por este casal? a) A / Rh® / NN b) A / Rh− / MN c) AB / Rh− / MN d) O / Rh® / MN e) O / Rh− / MN Questão 743 Uma mulher Rh®.Rh®. Questão 740 Um casal possui o seguinte genótipo para o fator Rh: Pai = Rr.Rh−. positivo.Rh® d) MÃE. PAI . CRIANÇA . c) Em III. com ocorrência de eritroblastose fetal. A probabilidade desse casal vir a ter uma criança Rh− é de a) 100% b) 75% c) 50% d) 25% e) 0% Questão 744 Um casal teve uma criança com eritroblastose fetal. a mãe recebesse anticorpos anti-Rh. cuja mãe é Rh−. positivo. negativo. d) Se. Considerando apenas o fator Rh. é casada com um homem Rh®. a mãe produz anticorpos anti-Rh que podem ser transferidos para a corrente sangüínea fetal. PAI . a DHR poderia ser evitada. negativo. CRIANÇA .Rh® b) MÃE. positivo. Questão 745 A incompatibilidade materno-fetal ao antígeno Rh pode determinar um doença denominada Eritroblastose Fetal.5. PAI . a mãe receba o soro anti-Rh. assinale a afirmativa INCORRETA. respectivamente: a) negativo. e) bastante preocupado. b) negativo.Rh−.

nenhum dos filhos será b) heterozigoto..3. b) Os abortados certamente eram Rh negativo. b) quando a mãe é Rh− e o filho Rh®. sendo observado... a mãe foi sensibilizada com o fator Rh. b) em X. o feto apresentou o quadro de hemólise de hemácias. icterícia e aumento do baço e fígado. o filho é Rh−..... c) quando a mãe é Rh− e o pai Rh®... e assinale abaixo a alternativa que indica. Questão 747 No segundo parto de uma mulher.do 1Ž filho... .. homozigota recessiva e seu marido é Rh®.. Rh®.. Isto só acontecerá quando houver passagem do sangue do embrião para a circulação materna..Questão 746 A eritroblastose fetal é uma doença hemolítica adquirida apresentada por alguns recém-nascidos.. e teve seu primeiro filho sem qualquer anormalidade. c) Este casal jamais poderá ter outros filhos.. . Se ele for . metade dos filhos será Questão 750 Após uma primeira gravidez bem sucedida.2 ela observação dos gráficos e considerando que essa mulher teve um filho em cada gestação e nunca recebeu transfusão de sangue. c) em Y..2 Questão 748 Os dois gráficos a seguir representam as quantidades de anticorpos anti-Rh presentes no sangue de uma mulher (Rh-) em gestações distintas.. todos os filhos serão c) homozigoto. além da anemia.3. o qual não teve eritroblastose fetal. d) em Y. respectivamente. o qual não teve eritroblastose fetal. analise os genótipos descritos. uma mãe abortou três vezes. todos os filhos serão d) heterozigoto. nenhum dos filhos será e) homozigoto.. Uma mulher é do tipo sangüíneo Rh−. é correto concluir que... o qual teve eritroblastose fetal. em consulta médica. a mãe transferiu anticorpos anti-Rh para o 1Ž filho Rh-. a) em X. como eritroblastose fetal. a mãe foi sensibilizada com o sangue Rh+ do 2Ž filho. esse conhecido por doença hemolítica do recém-nascido (DHRN) ou eritroblastose fetal.5. o qual teve eritroblastose fetal.. Seu caso foi diagnosticado.. no quadro apresentado. os genótipos da mãe. do primeiro filho e do segundo filho. d) quando a mãe é Rh® e o pai Rh−.. Esta condição é provocada por incompatibilidade sangüínea do fator Rh..5. 1. Considerando o fato de que essa mulher não foi submetida à transfusão de sangue em toda a sua vida anterior.. A mãe reconhecerá os glóbulos vermelhos do embrião como estranhos e produzirá anticorpos anti-Rh. Em relação à patologia observada nesta família. exclusivamente: a) quando a mãe é Rh® e o filho Rh−. a) homozigoto. assinale a alternativa CORRETA: a) A mãe é Rh positivo... e) independente do Rh materno.. Questão 749 Assinale a alternativa que completa corretamente as lacunas no texto a seguir. 168 1.... a mãe transferiu anticorpos anti-Rh para o 2Ž filho Rh+.

5 e 8 litros. Para que os frascos contendo sangue fossem identificados. por acidente. as etiquetas que identificavam os tipos sangüíneos estavam em código. visto que a doença hemolítica do recém-nascido só ocorre quando a mãe é Rh− e o pai Rh®. B e AB estão disponíveis. Rh® homozigota. d) nula. 8 e 16 litros.3 Questão 754 Observe o diagrama geral das possíveis trocas sangüíneas por doação e recepção no sistema "ABO": 1. 13 e 5 litros. visto que sua mãe genética é Rh®. o casal decide ter um "bebê de proveta" e contrata uma "mãe de aluguel" para receber em seu útero o zigoto formado por aquele casal. e) 2. 5. 5.3. 3 litros de tipo A. 8. Questão 752 Um banco de sangue possui 5 litros de sangue tipo AB. Questão 751 Uma mulher com útero infantil. A. d) 2. 10 e 18 litros.3 (s) seta(s) cujo sentido (doação ë recepção) está(ão) errado(s) é(são): a) 4 e 5 b) 2 c) 1 d) 3 Questão 755 Em um banco de sangue de um hospital. 18 e 10 litros.5. pois a "mãe de aluguel" é Rh®. respectivamente: a) 2. foram feitos testes com amostras correspondentes a cada código. será Rh®. c) alta. Para transfusões em indivíduos O. b) mínima. com absoluta certeza. b) 2. e. casa-se com um homem Rh−. c) 18.3. 3. O que o casal não sabia é que a "mãe de aluguel" tivera três filhos.5.d) A criança é Rh negativo. 8 litros B e 2 litros O. Questão 753 Assinale a alternativa que esquematiza as transfusões que podem ser feitas entre indivíduos com diferentes grupos sanguíneos do sistema ABO (as setas indicam o sentido das transfusões). já que o "bebê de proveta". visto que seu pai é Rh−. sendo que o último apresentara a doença hemolítica do recém-nascido. o livro onde estavam registrados os códigos foi perdido. 1. A probabilidade de o "bebê de proveta" nascer com a doença hemolítica do recém-nascido é: a) mínima. 3. e) alta. e o resultado foi o seguinte: 169 . Impedida de ter filhos. e) O pai é Rh positivo.

b) 8 litros.1. Questão 760 O soro sangüíneo de um indivíduo do grupo O foi colocado em quatro tubos de ensaio. c) da bolsa 2 ou da bolsa 3. e) não deve ser realizada. na alternativa a seguir. d) da bolsa 1 ou da bolsa 2. Questão 757 Um determinado banco de sangue possui 4 litros de sangue tipo AB. aos quais foram adicionadas. Marque. Se houver A transfusão de sangue do tipo B para uma pessoa do grupo A. sendo que o sangue da bolsa 1 apresentava todos os tipos de antígenos do sistema ABO. havia três bolsas disponíveis. estarão disponíveis para ele. III e IV. porque.5. Questão 759 Um homem sofreu um acidente e precisou de transfusão sangüínea. porque as hemácias AB não possuem antígenos que possam interagir com anticorpos anti-A presentes no sangue do receptor. e) 21 litros. c) formação de anticorpos anti-A e anti-B pelo receptor. todos Rh®. Esse homem pode receber sangue: a) apenas da bolsa 1.3. Analisado o seu sangue. Rh®. e) apenas da bolsa 2. c) pode ser realizada sem problema. separada e respectivamente. porque as hemácias AB não possuem antígenos que possam interagir com anticorpos anti-B presentes no sangue do receptor. pois os anticorpos anti-A presentes no sangue do receptor podem reagir com os antígenos A presentes nas hemácias AB. resultaria em a) reação de anticorpos anti-B do receptor com os glóbulos vermelhos do doador. a opção que corresponde à condição de aglutinação (+) ou não aglutinação (-) de hemácias resultante de reação antígeno-anticorpo: 170 . b) reação dos antígenos B do receptor com os anticorpos anti-B do doador. No banco de sangue do hospital. c) 12 litros. B e O. o sangue do receptor não possui anticorpos contra eles. o sangue da bolsa 2 possuía anticorpos anti-A e anti-B e a bolsa 3 possuía sangue com antígenos somente do tipo B. II. 1 litro de sangue tipo B e 9 litros de sangue tipo O. A. b) pode ser realizada sem problema. 7 litros de sangue tipo A. verificou-se a presença de anticorpos anti-A e ausência de anti-B.3 necessidade de transfusões sanguíneas para um indivíduo com sangue tipo AB. hemácias de indivíduos dos grupos sangüíneos AB. I. d) 13 litros. porque A é receptor universal. do total acima mencionado: a) 4 litros. Questão 758 aseados nesse teste. d) nenhuma reação. e) reação de anticorpos anti-B do doador com antígenos A do receptor. apesar de as hemácias AB apresentarem antígeno A e antígeno B. podemos afirmar que a) existem 105 litros de sangue disponíveis para um receptor AB Rh® b) existem 135 litros de sangue disponíveis para um receptor AB Rh− c) existem 105 litros de sangue disponíveis para um receptor A Rh® d) existem 135 litros de sangue disponíveis para um receptor O Rh® e) existem 25 litros de sangue disponíveis para um receptor O Rh− Questão 756 A transfusão de sangue tipo AB para uma pessoa com sangue tipo B a) pode ser realizada sem problema. pois os anticorpos anti-B presentes no sangue do receptor podem reagir com os antígenos B presentes nas hemácias AB. d) não deve ser realizada. b) apenas da bolsa 3.

conclui-se que são classificados. Os resultados são apresentados a seguir: Um laboratorista realizou exames de sangue em cinco indivíduos e analisou as reações obtidas com os reagentes anti-A. respectivamente. como receptor e doador universal: a) 4 e 2 b) 4 e 3 c) 1 e 5 d) 2 e 4 e) 5 e 1 Questão 762 Em um hospital há um homem necessitando de uma transfusão de emergência. Os resultados obtidos foram: 1. Tubo II (+). anti-B. Questão 761 Num laboratório foram realizados. Foi realizada a determinação de grupos sangüíneos do sistema ABO dos quatro indivíduos. Tubo III (+) e Tubo IV (-). c) Tubo I (+).4 171 .5. Os resultados obtidos encontram-se no quadro seguinte. Sabe-se que ele pertence ao grupo sangüíneo A e que. Tubo III (+) e Tubo IV (-).5. Tubo II (-). com a utilização de duas gotas de sangue de cada um deles.5. Tubo III (-) e Tubo IV (+).3. para a determinação da tipagem sangüínea dos sistemas ABO e Rh. anti-B e anti-Rh. no hospital. e) Tubo I (-). que.significa ausência de aglutinação. poderão doar sangue ao referido homem. A partir dos resultados observados. em seguida. Tubo III (-) e Tubo IV (+). os indivíduos: a) I e II b) I e III c) II e III d) II e IV e) III e IV Questão 763 1. em cinco indivíduos. anti-Rh. exames de sangue para a determinação da tipagem sangüínea dos Sistemas ABO e Rh. Tubo II (+). Tubo II (-). Tubo III (-) e Tubo IV (+). o sinal . Foram obtidas reações com a aplicação dos reagentes anti-A. 1. d) Tubo I (+).4 om base no quadro. b) Tubo I (-).4 bservação: o sinal + significa aglutinação de hemácias.3.3.a) Tubo I (-). colocadas em uma lâmina. misturadas aos soros anti-A e anti-B. foram. Tubo II (+). há quatro indivíduos que se ofereceram para doar sangue.

Rh−/ O. Rh−/ O. b) poligens. Rh®/ AB. Rh−/ A.1 ituações como essa são conhecidas como: a) polialelia. podemos concluir que o genótipo dos filhos é: a) ddEE. c) Ddee.5. na proporção de 3 brancas: 1 colorida. A presença de ambos simultaneamente produz flor púrpura. c) 3 e 4.Com base nesses resultados. . Rh® Questão 765 O esquema a seguir evidencia que a formação de melanina não depende apenas da ação de um gen. Rh®/ B. b) DdEe. e) 1 e 4. Rh® e) AB. Questão 764 A tabela a seguir foi elaborada a partir de testes para determinação dos grupos sangüíneos de seis pessoas de uma academia de ginástica. Rh−/ B. Rh−/AB. a) 5 e 2. Rh−/ A. todos de audição normal. Rh−/ B. d) DDee. Rh®/ A. Rh−/ B.4. receptor e doador universal. Rh®/ A. Rh−/ AB. simultaneamente. assinale a alternativa que indica os grupos sangüíneos de todas as pessoas quanto aos sistemas ABO e Rh.Rh®/ O. d) interação gênica. e) DDEE. mantendo a seqüência disposta na tabela. depende da homozigose de apenas um dos dois genes recessivos.5. Rh®/ AB. Os genótipos das plantas cruzadas são. Rh−/ A. respectivamente: a) CCpp x ccPP b) CCpp x ccPp c) Ccpp x ccPP d) Ccpp x ccPp 172 1. A presença do gene C ou P ou ausência de ambos produz flor branca. Cruzando-se duas plantas de flores brancas. Quando hereditária. casou-se com uma surda. Questão 767 Na ervilha-de-cheiro existem dois pares de genes que condicionam a cor da flor (Cc e Pp). Rh®/ O. Um homem surdo. Tiveram 9 filhos. Rh®/ B. Rh−/ AB. b) 4 e 3. Após analisar a tabela. d) 2 e 5. Assim. Questão 766 A surdez pode ser uma doença hereditária ou adquirida. Rh®/ O. Rh®/ B. respectivamente. Rh−/ A. está ocorrendo a ação conjunta de dois gens. Rh− d) AB. indique quais os indivíduos que serão considerados. c) norma de reação.3. Rh−/ B. obtém-se em F plantas produtoras de flores coloridas. A audição normal depende da presença de pelo menos dois genes dominantes diferentes (D) e (E). Rh®/ A. No processo ali representado. 1. (d) ou (e).Rh− b) O.4 a) O. Rh® c) AB. e) alelos múltiplos. O sinal positivo (+) significa "aglutina" e o sinal negativo (-) significa "não aglutina".Rh®/ A.

está representada parte da via biossintética para a produção desse pigmento: 173 . e) dois cromossomos se unirem para formar um gameta. são muito sensíveis à luz solar. a) AABB e AaBb b) AaBb e Aabb c) AABb e aabb d) aaBb e Aabb e) aabb e aabb Questão 771 1.pigmento responsável pela cor e proteção da pele . d) 3/16. Questão 770 Em determinada espécie vegetal. na espécie humana. 1. Cruzando-se plantas de flores vermelhas com plantas de flores brancas. c) um único gene ter efeito simultâneo sobre várias características do organismo.e) CcPp x CcPp Questão 768 Suponha que.5. Neste esquema. c) 1/5. imitar uma característica genética. o indivíduo é albino. A tabela abaixo indica os fenótipos existentes.1 expressão desses genes pode ser impedida pela presença de um par de genes autossômicos recessivos. como a surdez hereditária. d) dois pares de genes estarem no mesmo par de cromossomos homólogos.4. a pigmentação da pele seja devida a dois pares de genes autossômicos com efeito aditivo. o fenômeno da interação gênica consiste no fato de: a) uma característica provocada pelo ambiente. A probabilidade de nascer uma criança branca não albina é de: a) 1/16. por isso. Questão 769 Em genética. obtiveram-se 3 plantas de folhas vermelhas para 5 plantas de flores brancas na geração F. b) 1/2. como surdez por infecção. respectivamente. b) vários pares de genes não alelos influenciarem na determinação de uma mesma característica. e) 3/64. EXCETO a) AABB b) AaBB c) Aabb d) AaBb e) AABb Questão 772 Os indivíduos albinos não possuem melanina .1 odas as alternativas contêm genótipos possíveis para os porquinhos vermelhos de F2. ocorrem flores vermelhas somente se a planta possuir os alelos dominantes A e B. Os genótipos das plantas com flores vermelhas e brancas da geração parental são. Nesse caso.4. Um casal de mulatos médios diíbridos tem uma criança albina.5.e. Observe a figura.

analise as proposições com verdadeiro ou falso. ( ) Cinco distintas classes genotípicas são observadas entre os descendentes surdos citados. ( ) Na determinação da característica analisada atuam locos gênicos ligados que distam entre si em 16 unidades de mapa. como ilustrado no quadro a seguir. e) ee Bb. Questão 774 Em cães labradores. A pelagem dourada é condicionada pela presença do alelo recessivo e em homozigose no genótipo. é INCORRETO afirmar que a) a ausência da Enzima 1 resulta em um aumento da concentração de tirosina. Questão 775 1. ( ) Interação gênica entre dois locos justificam esses dados.1 om base nesse esquema e em outros conhecimentos sobre o assunto. com relação à surdez congênita na descendência de pais normais para a audição. a cor da plumagem é determinada por 2 pares de genes. c) ee bb. d) ee BB. c) diferentes genótipos podem dar origem ao albinismo. ( ) A surdez congênita é determinada por alelos múltiplos em um loco autossômico. dois genes.5.1 Em galinhas.4. marrons e dourados.1. é de aproximadamente de 0. d) codominância.4. condicionam as três pelagens típicas da raça: preta. se tiverem pelo menos um alelo dominante B. b) herança quantitativa. c) pleiotropia. Questão 773 Em uma exaustiva análise de genealogias humanas. cada um com dois alelos (B/b e E/e). cujos progenitores eram surdos. enquanto seu alelo i não interfere nessa expressão. e) epistasia dominante. marrom e dourada. se forem homozigóticos bb. d) indivíduos AABB formam gametas do tipo AA e BB. O cruzamento de um macho dourado com uma fêmea marrom produziu descendentes pretos. Os cães portadores de pelo menos um alelo dominante E serão pretos. respectivamente.56. b) Ee Bb. a partir de um casal genotipicamente igual ao mostrado na F1. foi observado que a distribuição fenotípica para normais e surdos obedecia a uma proporção de 9:7. ou marrons. Considerando esses dados. O gene I impede a expressão do gene C. 174 . Com esses dados. ( ) A probabilidade do nascimento de uma criança normal para a audição. O genótipo do macho é a) Ee BB. O gene C condiciona plumagem colorida enquanto seu alelo c determina plumagem branca. conclui-se que se trata de um caso de: a) epistasia recessiva.5. b) casamentos entre indivíduos albinos podem gerar descendentes com melanina.

é correto afirmar. 1.2 175 . somente.5. d) II e III.Trata-se de um caso de interação gênica do tipo epistasia recessiva. c) Os indivíduos de F. preta ou albina. 1. b) Os duplos heterozigotos apresentam flores coloridas. Pode-se considerar correto o que é afirmado em a) I. Questão 778 Em cães da raça Labrador Retriever. somente. somente.A formação de qualquer pigmento no pêlo depende da presença do alelo P. II .5. III . produzem quatro tipos de gametas para o caráter em estudo.4. om base na figura foram feitas as seguintes afirmações: I . c) I e II.5. a pelagem pode ser aguti. II e III. somente. EXCETO: a) Trata-se de um caráter determinado por interação gênica. O caráter em estudo é a cor das flores. A figura a seguir mostra as reações bioquímicas envolvidas na síntese de pigmentos.4.Questão 776 Nos camundongos.2 1. b) III.4.2 om base nos resultados.Quando animais pretos homozigóticos são cruzados com certos albinos também homozigóticos. Questão 777 O esquema abaixo representa o cruzamento artificial (em P) de duas variedades puras de um determinado vegetal. e) I. a cor da pelagem é determinada por um tipo de interação gênica epistática de acordo com o esquema a seguir. d) A fecundação cruzada das plantas com flores brancas de F‚ produzirá sempre o mesmo fenótipo. que se reproduz por autopolinização (em F). os descendentes são todos aguti.

em cebolas cc. espera-se que 50% dos descendentes apresentem pelagem amarela. II. enquanto os pais são homozigotos para os dois pares de genes. No cruzamento da fêmea parental com qualquer cão de pelagem preta. herdado de forma independente. II e III apenas. b) II. São afirmações CORRETAS: a) I. Aa e Cc. o alelo dominante A determina cor vermelha e o recessivo a. (02) Dois genes não-alelos colaboram na mesma característica. III e IV apenas. c) I. IV. (16) Durante o desenvolvimento do organismo. não-alelo. cor amarela. complementando seus efeitos e produzindo um fenótipo igual aos fenótipos produzidos por cada gene isoladamente. d) I. vários pares de genes não-alelos influem na determinação de uma característica. impede a manifestação de outro gene. espera-se que 25% dos descendentes apresentem pelagem chocolate. apresenta o alelo B. c) 13/16 de cebolas brancas e 3/16 de cebolas coloridas. Do cruzamento de um camundongo preto com um albino. foram obtidos apenas descendentes agutis. (08) Ocorre epistasia quando um gene. completando seus efeitos. que impede a manifestação de gene C. Homozigotos bb não têm a manifestação da cor do bulbo impedida. 176 . assinale o que for correto. e) 16/16 de cebolas brancas. d) 15/16 de cebolas brancas e 1/16 de cebolas coloridas. III. III e IV.Sabendo que o cruzamento (geração Parental) entre um macho com fenótipo chocolate e uma fêmea de fenótipo amarela gera apenas filhotes com pelagem preta (geração F1). O gene A determina coloração aguti e é dominante sobre seu alelo a. No cruzamento da fêmea amarela com um de seus filhotes de F1. dois pares de genes que apresentam segregação independente participam na determinação da cor do bulbo: o alelo dominante I impede a manifestação de cor e o recessivo i permite a expressão. b) 12/16 de cebolas brancas e 4/16 de cebolas coloridas. com segregação independente. Qual é o genótipo desse casal? a) aaCC x aacc b) Aacc x aaCc c) aaCc x AAcc d) AaCc x AaCc e) aaCC x AAcc Questão 780 Em cebolas. Questão 782 Na cebola. a enzima que catalisa a formação de pigmento não é produzida (cebolas brancas). No cruzamento entre os filhotes de F1. (01) Ocorre poligenia quando dois genes não-alelos colaboram na mesma característica. II. ao invés de determinar uma característica. não se espera a produção de descendentes com fenótipo chocolate. Uma proporção de 2 incolores: 1 vermelho: 1 amarelo é esperada entre os descendentes do cruzamento a) IIAA x IiAa b) IiAA x iiAa c) IIaa x ii aa d) IiAa x IiAa e) IiAa x iiaa Questão 781 Sobre interação gênica. Outro gene. III e IV apenas. que inibe a formação de pigmentos dando origem a indivíduos albinos. Questão 779 Em camundongos. Quais as proporções fenotípicas esperadas do cruzamento de cebolas homozigotas coloridas com BBcc? a) 9/16 de cebolas brancas e 7/16 de cebolas coloridas. O gene C determina a produção de pigmentos e é dominante sobre seu alelo c. a presença de um alelo dominante C determina a produção de bulbo pigmentado. (04) Ocorre poligenia quando um gene tem efeito simultâneo sobre várias características do organismo. que condiciona coloração preta. a coloração da pelagem é determinada por dois pares de genes. Todos os filhotes produzidos nesse cruzamento são heterozigotos. um criador fez as seguintes afirmações: I.

(4) O gene B é epistático sobre o gene C. a determinação do sexo é feita por um sistema. enquanto que o alelo recessivo w permite a manifestação da cor. d) AABBe Aabb. o alelo dominante B determina cor de pêlo acinzentada. mas o genótipo aa bloqueia toda a produção de pigmentos e o rato torna-se albino. fazendo com que o pêlo fique branco. os filhotes de cor preta poderão apresentar genótipos: a) Aabbe AAbb. AaBBe aabb. (1) Na produção de melanina a partir de fenilalanina.5. da ação de dois pares de genes Bb e Ww. dentre outros fatores. O alelo dominante A nesse lócus possibilita o desenvolvimento normal da cor (como definido pelos genótipos B_ ou bb). cujo 2n = 6. (2) Indivíduos albinos podem apresentar homozigose recessiva bb e cc. O esquema abaixo representa alguns passos da síntese de melanina. Essas transformações são catalisadas por diferentes enzimas. nessa espécie. O gene dominante W "inibe" a manifestação da cor.Questão 783 A cor da pelagem em cavalos depende. b) Aabbe aabb. um segundo lócus afeta uma etapa inicial na formação dos pigmentos dos pêlos. o cariótipo de células somáticas de machos e fêmeas se apresenta como mostram os desenhos a seguir: 1.1 Com base no esquema e sabendo que indivíduos incapazes de sintetizar a melanina são albinos. c) AAbbe aabb. (3) Um casal de indivíduos albinos pode ter filhos com pigmentação normal. em que o macho e a fêmea são. Em ratos. análise desses cariótipos revela que. Em outro cromossomo. e) aaBB.2 1. enquanto o genótipo homozigoto bb define cor preta. julgue os itens seguintes. Considerando os descendentes do cruzamento de dois ratos. Questão 785 Epistasia é o fenômeno em que um gene (chamado epistático) inibe a ação de outro que não é seu alelo (chamado hipostático).5. Questão 786 Em uma espécie animal. atuam três mRNAs. Cruzando-se indivíduos heterozigotos para os dois pares de genes obtém-se: a) 3 brancos: 1 preto b) 9 brancos: 3 pretos: 3 mesclados de marrom e preto: 1 branco c) 1 preto: 2 brancos: 1 marrom d) 12 brancos: 3 pretos: 1 marrom e) 3 pretos: 1 branco Questão 784 As diversas substâncias ingeridas pelo homem são transformadas em outras. ambos com genótipo AaBb. durante os processos metabólicos. respectivamente: a) XY e XX b) YO e XX c) XO e XX d) XY e XO e) XO e XY 177 .4.5. O gene B determina pêlos pretos e o seu alelo b determina pêlos marrons.

Assim. Questão 790 O esquema a seguir mostra a formação dos gametas responsáveis pela produção de um indivíduo com alteração do seu número cromossomial. e) um cromossomo Y quando da divisão mitótica do zigoto. 1. e) Algumas mulheres. Questão 788 Leia o texto a seguir referente à Hipótese de Lyon.1 ntre as características que esse indivíduo passará a apresentar. que possuem apenas uma cópia funcional dos genes ligados ao cromossomo X. têm um olho azul e outro castanho. A inativação do cromossomo X ocorre ao acaso. independentemente dos genes que possuem. Com base neste texto é INCORRETO afirmar: a) O sexo masculino é heterogamético e é sempre o homem quem determina o sexo dos filhos. c) cariótipo normal. b) O sexo feminino é homogamético e o gameta feminino normal sempre apresenta um cromossomo X. b) caracteres sexuais desenvolvidos. A análise cromossômica dos gêmeos indicou que o menino era normal.5. c) Algumas mulheres. a) Algumas mulheres. têm visão normal em um dos olhos e daltonismo no outro. d) Algumas mulheres. O indivíduo do sexo feminino apresenta dois cromossomos X enquanto que o indivíduo de sexo masculino apresenta um cromossomo X e outro cromossomo Y. são tipo A e B simultaneamente. as células femininas ficariam iguais às masculinas. são loiras e castanhas. "A pesquisadora inglesa Mary Lyon propôs. Questão 789 O médico confirmou que se tratava de gêmeos monozigóticos. pois em algumas estão ativos os genes provenientes do cromossomo X materno e em outras do cromossomo X paterno. c) um cromossomo sexual. d) ausência de cromatina sexual. heterozigotas para a cor do cabelo. Tal fato deve-se à perda de a) um cromossomo X na gametogênese da mãe das crianças. porém a menina era portadora da síndrome de Turner. heterozigotas para a cor dos olhos. em 1961. e nos blastômeros iniciais do desenvolvimento embrionário. heterozigotas para os grupos sangüíneos. na gametogênese do pai ou da mãe das crianças.5. heterozigotas para a cor da pele. d) A hipertricose auricular é uma característica restrita ao sexo masculino." Assinale a alternativa que confirma o texto anterior. Mulheres heterozigotas para os genes ligados aos cromossomos X expressam o alelo dominante em algumas células e o alelo recessivo em outras. 178 . contudo um deles era menino e o outro menina. X ou Y. teremos: a) sexo masculino. simultaneamente. e) Toda doença hereditária e recessiva ligada ao cromossomo X só afeta as mulheres. d) um cromossomo X quando da divisão mitótica do zigoto. têm manchas brancas e pretas. Logo. heterozigotas para o daltonismo (XD Xd).Questão 787 Na espécie humana a determinação sexual é feita por um par de cromossomos. e) estatura elevada. b) Algumas mulheres. c) na mulher um cromossomo X está sempre condensado e recebe o nome de cromatina sexual. a hipótese de que fêmeas de mamíferos compensariam a dose dupla de genes do cromossomo X através da inativação de um desses cromossomos. b) um cromossomo Y na gametogênese do pai das crianças. X e Y. simultaneamente. pois o gene está localizado no cromossomo Y. as mulheres apresentam células geneticamente diferentes entre si.

Seu cromossomo Y é descendente do Y de seu avô paterno.Questão 791 A análise do cariótipo de exemplares de uma dada espécie revelou que o número diplóide é idêntico em ambos os sexos e que o sexo heterogamético é o feminino.F: galinha barrada. A partir desse dado.F: galinha preta.F: galinha barrada. 1. III. é possível dizer que o sistema de determinação do sexo nessa espécie é do tipo a) XX : XY b) XX : XO c) XX : YO d) ZZ : ZW e) ZZ : ZO Questão 792 O carneiro ('Ovis aries') apresenta 27 cromossomos em seus gametas normais. O alelo dominante determina penas barradas e o recessivo.F: galinha barrada. F‚: galinha preta II . F‚: galinha barrada II . além de 2 cromossomos sexuais.F: galinha preta. F‚: galinha preta e) I . Questão 793 Acerca da relação entre os cromossomos de um menino e os de seus avós. Seu cromossomo X é descendente de um X de sua avó paterna. fizeram-se as seguintes afirmações: I. F‚: galinha barrada II . geraram 4 embriões. de acordo com a tabela abaixo. F‚: galinha barrada b) I . II. a) I . todos igualmente viáveis. 4 óvulos humanos. penas pretas. Dessas afirmações. Entre seus autossomos. F‚: galinha preta Questão 795 Em uma experiência de fecundação "in vitro".5. d) Uma célula de carneiro que está na metáfase da mitose deve apresentar 54 cromossomos duplicados. F‚: galinha preta c) I . incluindo 2 cromossomos sexuais. c) Um óvulo de ovelha deve apresentar 26 autossomos. há descendentes de autossomos de seus avós. quando incubados com 4 suspensões de espermatozóides. Considere os seguintes cruzamentos a partir dos quais obtiveram-se as gerações F e F‚: I. a) Um neurônio de carneiro deve apresentar 52 autossomos. F‚: galinha preta II . machos homozigóticos de penas barradas × fêmeas de penas pretas II. assinale a alternativa INCORRETA com relação ao número de cromossomos encontrado em diversas células nessa espécie. Com base nesses dados.F: galinha barrada.F: galinha preta.5. b) Um linfócito de carneiro deve apresentar 54 cromossomos. está(ão) correta(s) APENAS a) I b) II c) III d) I e III e) II e III Questão 794 Em galinhas.1 179 . machos de penas pretas × fêmeas de penas barradas Assinale a alternativa que indica corretamente as gerações nas quais espera-se encontrar galinhas pretas. F‚: galinha preta d) I .F: galinha barrada. F‚: galinha barrada II . a cor das penas apresenta herança ligada ao sexo.F: galinha barrada. e) Uma célula muscular de carneiro deve apresentar 54 autossomos.F: galinha preta.

os gametas que precisam ser necessariamente identificados e separados para uso no processo de fecundação. ( ) A síndrome de Down é causada pela presença de um cromossomo X extra no cariótipo. ( ) O sexo heterogamético é o masculino. alguns se baseiam em executar a fecundação em tubo de ensaio.5. e) um intersexuado. no período correspondente à prófase da mitose é. não observou a presença do cromossomo Y. ( ) O genitor do sexo feminino determina o sexo dos descendentes. Nesse inseto. Além disso. d) óvulos haplóides portando o cromossomo Y.0 × 10−¢¨ Questão 797 As afirmações a seguir relacionam-se à DETERMINAÇÃO CROMOSSÔMICA DO SEXO na espécie humana. d) um macho estéril. b) uma fêmea aneuplóide. por partenogênese. os machos originam-se de óvulos não-fecundados. podemos concluir que a mosca é a) uma fêmea normal. c) um macho normal. a seguir. o gráfico que indica as probabilidades de os 4 embriões serem do sexo masculino é o de número: a) 1 b) 2 c) 3 d) 4 Questão 796 Considere que um óvulo de abelha possui 5×10−¢¥ g de DNA.0 × 10−¢¡ b) 2. ( ) O corpúsculo de Barr ou cromatina sexual corresponde a um cromossomo X inativo. em mg. o ovo fertilizado no útero da mãe.5 × 10−ª c) 5. Analisando os dados do estudante. ao analisar os cromossomos de 'Drosophila'. Questão 799 Alguns métodos em desenvolvimento poderão permitir aos pais a escolha do sexo de seus futuros filhos. Dentre as opções abaixo.onsiderando a experiência descrita. Questão 800 Observe a figura. ( ) O indivíduo hermafrodita é formado por células XX e XY. 1. caso os pais desejem um filho do sexo feminino. implantando. igual a: a) 1. b) oócitos primários diplóides portando os cromossomos Y. Questão 798 Um estudante.5.1 180 . A quantidade de DNA encontrada em uma célula somática de zangão. são: a) espermatócitos secundários diplóides portando os cromossomos X e Y.0 × 10−¢¢ d) 5. c) espermatozóides derivados de espermátides portando o cromossomo X. e) oogônias portando o cromossomo X e espermatogônias portando o cromossomo Y. embora as fêmeas se originem de reprodução sexuada. encontrou a proporção de 1X : 2A (onde a letra A simboliza o conjunto haplóide de autossomos). Dentre eles.

c) indivíduos de sexo indeterminado. são produzidos em temperaturas abaixo de 28°C.1 181 . XYY apresentam dois testículos a mais. b) a determinação do sexo. ter descendentes machos sem mancha é de 50%. é correto afirmar-se que a) a probabilidade do casal em F ter um descendente macho e sem mancha negra é zero. c) os indivíduos trissômicos 47. b) cultura de células e tecidos.ssa figura representa a herança do caráter mancha negra numa espécie de peixes em que a determinação do sexo segue o padrão mais comum nas aves. XY que. Questão 804 A figura a seguir mostra esquematicamente o tipo de reprodução em abelhas do gênero 'Apis'. b) a probabilidade de uma fêmea com mancha. c) mapeamento do genoma humano. Considerando-se essas informações e outros conhecimentos sobre o assunto. Questão 801 A figura a seguir se refere à determinação do sexo em algumas espécies de tartarugas e lagartos. Questão 803 Nos mamíferos.1 a) a determinação do sexo nesses animais é independente da localização dos ovos no ninho e da época da postura. Com base nessa figura pode-se afirmar que Questão 802 A identificação do fator que origina indivíduos com síndrome de Down tornou-se possível pela utilização da técnica de a) contagem e identificação dos cromossomos. c) as fêmeas de F‚ e P sem mancha negra possuem genótipos diferentes.5. d) produção de DNA recombinante. XXY possuem órgãos reprodutores masculinos e femininos. sob controle de temperatura. O gene SRY. em tartarugas. sofrem mutação nesse gene perdem as características sexuais. b) os indivíduos trissômicos com cariótipo 47. Com relação ao padrão de herança desse caráter. induz à diferenciação dos testículos. pode ser útil em condições de manejo de espécies em extinção. é CORRETO afirmar que a) os indivíduos 46. cruzada com macho sem mancha.5. e) o sexo heterogamético nessa espécie de peixes é o masculino. na idade adulta. a presença do cromossoma Y determina o fenótipo masculino. 1. e) machos são produzidos em baixas temperaturas tanto para tartarugas quanto para lagartos. d) temperaturas maiores que 28°C produzem fêmeas tanto em tartarugas quanto em lagartos.5. d) o caráter mancha negra é exclusivo de indivíduos homozigotos. XY com deleção do gene SRY. d) os testículos estão ausentes nos indivíduos 46. 1.5. presente nesse cromossoma.

A rainha se casou com um belo zangão plebeu.1 (01) Do sexo masculino. e são diplóides. I. As fêmeas resultam da fusão entre óvulos e espermatozóides. enquanto a cor escura é condicionada pelo alelo dominante A. c) II e III estão corretas. e os zangões são monóicos. a determinação do sexo cromossômico do zigoto (XX ou XY) depende do gameta masculino que fecunda o óvulo. através da meiose. a cor clara dos olhos é condicionada pelo alelo recessivo a de um determinado gene. Em humanos. Da análise das afirmativas acima podemos assegurar que: a) apenas I está correta. As operárias são estéreis devido à espermatogênese nos zangões produzir. foi inseminada artificialmente com espermatozóides de machos de olhos escuros. é correto afirmar que se trata do cariótipo de um indivíduo: Questão 806 No reino Colméia. 182 . (16) Ccom Síndrome de Edwards. Uma abelha rainha de olhos escuros.5. A produção de zangões caracteriza o processo de reprodução assexuada denominado partenogênese. b) I e II estão corretas. Questão 807 Os machos de abelha originam-se de óvulos não fecundados e são haplóides. Espera-se que a prole dessa rainha tenha a seguinte composição: 1. e) I e III estão corretas. c) o sexo das abelhas é determinado pela ploidia do indivíduo. b) o sexo das abelhas é determinado pelos cromossomos sexuais.5. Questão 805 Analisando a figura adiante.nalise as seguintes afirmativas sobre o esquema da figura. (64) Com uma anomalia numérica de autossomos. (02) Do sexo feminino.5. que representa um cariótipo humano. das quais uma seria a escolhida para ser a futura sucessora da rainha.5.1 I. Em uma linhagem desses insetos. e nasceram filhas operárias. III. d) apenas II está correta. (08) Com Síndrome de Patau. uma vez que não houve a fecundação dos óvulos que os originaram. Essa história mostra que a) os zangões são haplóides e produzem os espermatozóides por meiose. II. gametas com um número de cromossomos 4 (quatro) vezes menor. Os zangões podem ser considerados clones perfeitos da abelha rainha. Soma ( ) Questão 808 Considere as afirmações: 1. d) a rainha e as operárias são dióicas. havia uma rainha que tinha tido apenas filhos do sexo masculino (zangões) e precisava de uma sucessora para o trono. heterozigótica Aa. (04) Com Síndrome de Down. (32) Com cariótipo normal.

Com relação a esses segmentos. todas as moléculas de RNA. Está(ão) correta(s) a) apenas I. Questão 810 Durante as Olimpíadas é comum fazer-se teste da cromatina sexual ou corpúsculo de Barr nas mulheres. c) II. G. adeninas. é possível observar o cromossomo X que foi inativado. nas células somáticas de fêmeas normais. Em uma célula eucariótica animal. c) apenas III. e a fecundação reconstitui a diploidia. de pais para filhos. b) I e II estão corretos. I. Em mamíferos. dois. III e V. b) Três cromossomos Y. São Paulo: Moderna. d) Três cromossomos X. II e IV. sendo exceção a essa regra os cromossomos sexuais X e Y. Uma mulher normal apresentará em suas células bucais: a) Dois cromossomos X. têm sua origem no núcleo.II. com exceção do RNA mitocondrial. Esse teste permite o diagnóstico citológico do sexo feminino. sendo que um deles é a cromatina 183 . d) apenas I e II. Questão 811 Considere as cinco afirmações seguintes. Numa proteína com 500 aminoácidos. d) Apenas I está correto.R. cromossomos homólogos contêm a mesma seqüência linear de genes.M e MARTHO. Qual dos pares de gametas representados a seguir poderá originar um zigoto que desenvolverá um embrião normal do sexo masculino? 1. porém. sexual. Questão 809 O diagrama a seguir está dividido em 3 segmentos (I. pois este corresponde ao corpúsculo de Barr ou cromatina sexual. A informação genética pode ser passada de uma geração para outra.1 Adaptado de: AMABIS. Em mamíferos. sendo que um deles é a cromatina sexual. e) Um cromossomo X apenas. d) II.5. em um mesmo indivíduo. III e IV. IV e V. 2001. J. No homem. e) apenas I e III. b) I. citosinas e guaninas arranjadas em diferentes combinações. II e III). III. II. V. a meiose é gamética. o RNA mensageiro que saiu do núcleo continha 1500 códons e a seqüência que serviu de molde para a transcrição possuía 3000 nucleotídeos. as fêmeas possuem apenas um cromossomo X e os machos. "Conceitos de Biologia". Questão 812 A reprodução da maioria dos seres vivos envolve um processo sexual onde se alternam os fenômenos de meiose e fecundação. b) apenas II. Em mamíferos. Estão corretas: a) I. pode-se afirmar que: a) I e III estão corretos. não pode ser passada.5. os quais contêm conceitos relacionados aos diferentes sistemas de determinação do sexo. II e III. Toda a informação genética necessária para formar um organismo completo está contida em seqüências de timinas. III. sendo que dois deles formam a cromatina sexual. IV. e) III. c) Dois cromossomos X e blocos de cromatina sexual. de uma célula a outra. c) II e III estão corretos.

5. e) O indivíduo 5 com certeza é hemofílico. b) a contagem de hemácias cuja quantidade é maior nos homens.Questão 815 1. são exemplos de cromossomos homólogos.5. fazem parte do cromossomo X. c) o exame radiológico dos órgãos sexuais. d) O genótipo de 6 será XHXH ou XHXh. Estão corretas as seguintes afirmações: a) apenas I b) apenas II c) apenas III d) apenas II e III e) todas. c) o cromossoma Y paterno pode apresentar o gene para a doença. d) a pesquisa de hormônios sexuais femininos através de um exame de sangue.5. 184 . Questão 816 Observe o esquema a seguir: 1. Feita a análise desse gráfico. por exemplo.características como a hemofilia.quando pareados. Questão 814 Em relação aos cromossomos sexuais X e Y. podemos afirmar corretamente que: a) a anomalia é causada por um gene dominante. ocasionalmente. por exemplo. c) O genótipo de 4 será XHY.1 1. II . são feitas as seguintes afirmações: I . No gráfico anterior temos representado um exemplo de doença ligada ao sexo onde apenas o indivíduo IV é afetado. Indique-a. b) O casal 5/6 formará homens hemofílicos. Para esclarecer tais suspeitas utiliza-se a) a identificação da cromatina sexual.5. III .características como o daltonismo. há suspeitas sobre o sexo de certas atletas. EXCETO uma. b) o indivíduo I é obrigatoriamente homozigoto. cujo desempenho ou mesmo a aparência sugerem fraude. e) os indivíduos III e V podem ser homozigotos ou heterozigotos. d) o casal apresenta 50% de probabilidade de ter filhas afetadas. a) O casal 1/2 nunca formará mulheres hemofílicas. estão associadas a genes do cromossomo Y.5.2 análise do esquema permite formular as conclusões a seguir.5.2 Questão 813 Em eventos esportivos internacionais como os Jogos Pan-americanos ou as Olimpíadas. e) a análise radiográfica da bacia.

185 . O heredograma a seguir refere-se a uma família com esta anomalia. b) Apenas as afirmações I e II são verdadeiras..5. a) Todas as afirmações são verdadeiras. c) Apenas as afirmações I. que é masculinizante. analise as afirmações de I a IV e assinale a alternativa correta. d) mulheres hemofílicas morrem nos primeiros sangramentos menstruais. De acordo com o heredograma. é suficiente nos homens apenas um alelo para que a doença se manifeste. ligado ao cromossomo X.5.50% das filhas do casal 3 e 4 serão normais portadoras e 50% daltônicas. I . e) Apenas as afirmações II e IV são verdadeiras. IV ." (Handin R. c) mulheres hemofílicas precisam de dois alelos dominantes. aprendemos que ela é mais comum nos homens porque: a) os homens são mais propensos à doença devido à influência do hormônio testosterona. Analise o heredograma adiante e assinale a alternativa correta. 1955) Quando nos debruçamos sobre a hemofilia. b) sendo uma herança ligada ao sexo.2 Questão 820 A hemofilia é uma doença genética cuja herança é ligada ao sexo. e) é causada por um alelo típico do cromossoma Y. sabendo-se que a mulher B é homozigota é de a) 1/8 b) 3/8 c) 1/2 d) 1/4 e) 3/4 1. III . ao passo que os homens só necessitam de um alelo.100% das filhas do casal 3 e 4 serão normais portadoras.Não é possível identificar o genótipo de 2. Questão 819 A distrofia muscular de Duchenne é devida a um gene recessivo. III e IV são verdadeiras. Questão 818 O daltonismo é uma anomalia que apresenta um tipo de herança ligada ao sexo.100% dos filhos homens do casal 3 e 4 serão daltônicos.5.Questão 817 "Tem sido verificado que aproximadamente 25% dos casos de hemofilia A em meninos são decorrentes de mutações novas. A probabilidade de A ser portador da anomalia.I.5. BLOOD AND PRACTICE OF HEMATOLOGY.2 1. isto é. a doença se manifesta em meninos que não tem história familiar de hemofilia. II . d) Apenas as afirmações II e III são verdadeiras.

. 09. Os três homens. c) os homens 1. e) O indivíduo 14 pode ser homo ou heterozigoto. do qual herdaram os genes para daltonismo e hemofilia.2 correto afirmar que a) a mulher 6 é homozigota. João e Pedro são meio-irmãos e ambos são daltônicos e hemofílicos. c) O indivíduo 9 não pode ser hemofílico. vão receber US$ 24. Questão 825 VÍTIMAS DE HIROSHIMA NO BRASIL SERÃO INDENIZADAS.2 1. 3 e 7 são portadores do gene para o daltonismo. certamente. heterozigotas. ("Folha de S. ocorridas independentemente da herança materna ou paterna. certamente. portadoras do gene para o daltonismo. b) as mulheres 2 e 4 são.5% e) 100% Questão 824 Meio-irmãos é o termo utilizado para designar os indivíduos que são irmãos só por parte de pai ou só por parte de mãe. e) se o pai de 2 era afetado pelo daltonismo. os indivíduos representados com símbolos escuros são daltônicos e os demais têm visão normal para as cores. Um homem hemofílico casa-se com uma mulher normal e homozigota para este caráter.5. porém herdaram de seus respectivos pais os genes para daltonismo e hemofilia.5. A probabilidade deste casal vir a ter uma filha hemofílica é igual a: a) zero b) 50% c) 25% d) 12. porém herdaram de suas respectivas mães os genes para daltonismo e hemofilia. decidiu um tribunal japonês. o genótipo para hemofilia XHY fenotipicamente representa: a) homem normal b) homem hemofílico c) mulher normal d) mulher hemofílica e) homem normal.5.Paulo". Na genealogia abaixo. certamente a mãe tinha fenótipo normal. b) filhos da mesma mãe. d) filhos da mesma mãe.7 mil. porém portador Questão 823 a) Os indivíduos 1 e 2 são homozigotos normais.Questão 822 Na espécie humana. Seus genitores são normais.02.2006) 186 1. d) as filhas do casal 6 e 7 são. b) O indivíduo 8 é portador do gene para hemofilia. c) filhos do mesmo pai. mais provavelmente. que pediram para não ser identificados. Questão 821 O daltonismo é causado por um gene recessivo localizado no cromossomo X na região não-homóloga ao cromossomo Y.5. da qual herdaram os genes para daltonismo e hemofilia. e) portadores de novas mutações. Pode-se dizer que. d) Todos os filhos e filhas do indivíduo 10 serão hemofílicos. João e Pedro sejam a) filhos do mesmo pai.

Do mesmo modo como a radiação provocou a leucemia do Sr. porque não há transmissão de homem para homem. A hemofilia ocorre mais freqüentemente em homens. Sobre suas convicções quanto à origem da doença de Mário. 1. Em uma amostra representativa da população. Shiguero. Shiguero. por sua vez. o Sr. onde se casou e teve um filho. porque todas as filhas de homens afetados são afetadas. Questão 826 Na genealogia a seguir. d) dominante ligado ao sexo. era uma vítima indireta da radiação liberada pela bomba.5 %. migrou para o Brasil. Qual é a porcentagem esperada de mulheres daltônicas nessa população? a) 0. Mário. e muito mais freqüente em homens que em mulheres. provocaram a hemofilia de Mário. d) errada.81 %. A hemofilia é uma doença que prejudica a coagulação do sangue. pode-se dizer que Emília está a) correta. Depois da notícia do jornal. que o teria herdado do Sr. acreditava que seu único filho. porque aproximadamente 50% da prole é afetada. ligada ao sexo. os símbolos cheios representam pessoas afetadas por uma doença genética rara. porque a doença aparece em todas as gerações.Emília interessou-se pela notícia. Shiguero. A princesa Beatriz. Sr. b) correta. d) 16 %. Emília. Shiguero faleceu de leucemia. Emília havia lido que a doença é genética. foi um dos sobreviventes da bomba de Hiroshima. Questão 828 Acredita-se que a rainha Vitória da Inglaterra tenha sido a introdutora do gene para hemofilia . Como a hemofilia é um caráter recessivo e só se manifesta nos homozigotos para esse alelo. 90 são daltônicos. porque a doença afeta os dois sexos. Questão 827 O daltonismo é causado por um alelo recessivo de um gene localizado no cromossomo X. a mais grave delas. portador de hemofilia do tipo A. se seu filho Mário tivesse herdado o alelo do pai. casou-se com Takashi e atribuía a doença de seu filho Mário à herança genética do avô Shiguero. Como a hemofilia é um caráter dominante. Emília passou a acreditar que seu filho talvez pudesse se beneficiar com alguma indenização. c) 9 %. Takashi.2 padrão de herança que melhor explica o heredograma é a) autossômico dominante. Shiguero foi submetido. b) 4. que. c) apenas parcialmente correta. que não tem ascendência oriental. transmitidas à Takashi. Deste modo.5. Shiguero. e) errada. b) autossômico dominante.na família real inglesa. e deste à se filho. uma vez que é determinada por um alelo no cromossomo Y. a doença de seu filho Mário é causada pela presença de um alelo herdado pela via paterna e por outro herdado pela via materna. e) 83 %. também poderia ter provocado mutações nas células de seu tecido reprodutivo que. e) recessivo ligado ao sexo. Após a guerra. Mário só pode ter herdado esse alelo de seu pai. introduziu o gene na família real espanhola. ou que Mário seja portador de uma nova mutação sem qualquer relação com a radiação a que o Sr. O sogro de Emília.ligado ao X . c) autossômico dominante. Afinal. Anos depois. filha de Vitória. entre 1000 homens analisados. É mais provável que a hemofilia de Mário seja determinada por um alelo herdado por via materna.5. todos seriam hemofílicos. o herdou do Sr. Observe a árvore genealógica: 187 .

este será hemofílico também. c) o pai e a mãe são hemofílicos. d) o genótipo dessa mulher é igual ao de sua mãe. Sabendo-se que a polidactilia é uma herança autossômica dominante. d) A mulher é obrigatoriamente filha de pai e mãe polidáctilos. com certeza. assinale a alternativa correta. c) o filho dessa mulher herdou do seu pai o gene para o daltonismo. b) autossômico recessivo. b) o pai é normal e a mãe é hemofílica.. e) interação gênica. É correto afirmar. A anomalia. c) recessivo ligado ao cromossomo X. c) autossômico recessivo. b) essa mulher poderia ter uma irmã daltônica. Questão 832 Um casal tem uma criança de sexo masculino e hemofílica.. Questão 834 Uma criança do sexo feminino. e) se ela tiver um irmão.2 probabilidade da princesa Maria vir a ter um menino hemofílico é de: a) 100% b) 75% c) 50% d) 25% e) 0% Questão 829 O estudo de linhagens de galinhas em que aparecia uma anomalia hereditária mostrou que fêmeas afetadas cruzadas com machos normais davam sempre todos os descendentes machos com a anomalia e as fêmeas normais. provavelmente.Questão 831 Uma mulher. b) dominante ligado ao sexo. é determinada por gene a) autossômico dominante. d) ela recebeu da mãe o gene para a hemofilia. d) recessivo ligado ao sexo. d) recessivo ligado ao cromossomo Z. Questão 830 Um homem de visão normal e com número normal de dedos casa-se com uma mulher polidáctila e daltônica.5. É correto afirmar que: a) essa mulher é daltônica. casa-se com um homem daltônico e tem uma criança do sexo masculino e daltônica. e) Os filhos homens desse casal serão sempre daltônicos e não polidáctilos. Questão 833 O gene que determina o daltonismo na espécie humana caracteriza o seguinte tipo de herança a) autossômico dominante. e) essa mulher não poderá ter uma filha daltônica. b) A mãe dessa mulher terá obrigatoriamente o mesmo genótipo para o daltonismo que ela. filha de pai normal e mãe portadora do gene para o daltonismo. então a probabilidade do segundo filho ser do sexo masculino e com fenótipos dominantes é: a) 1/2 b) 1/4 c) 1/6 d) 1/8 e) 1 1. c) O pai dessa mulher é daltônico. que: a) o pai é normal. 188 . daltônica e canhota possui pai daltônico e destro e mãe de visão normal e canhota. Sabendo que o uso da mão esquerda é uma característica recessiva. e) dominante ligado ao cromossomo Z.5. a) Esse casal poderá ter uma filha polidáctila e daltônica.

Do casamento entre uma mulher afetada e um homem normal. Um macho de olhos brancos foi cruzado com uma fêmea heterozigota.XDY d) Homem .Se a mãe for afetada.XDXd. II . b) I e III apenas. III e IV apenas.sua mãe possui um gene para a hemofilia. A cor vermelha é determinada pelo gene W+.XDY.XdY.XDY. São corretas: a) I.As filhas de pai normal serão sempre normais.XDXd. Avô . d) II e IV apenas.sua avó paterna NÃO apresenta o gene para a hemofilia. Assinale a alternativa correta quanto aos genótipos do homem e de seus avós maternos. I . é possível considerar que APENAS a) I é verdadeira. III . Sabendo-se que o gene em questão é recessivo e ligado ao sexo. A probabilidade do nascimento de um menino também normal é: a) 50% b) 75% c) 25% d) 100% e) 0 Questão 836 Em 'Drosophila'.XdY. d) I e II são verdadeiras. a probabilidade desse casal ter uma criança do sexo feminino normal para ambas as características é de: a) 3/8 b) 1/8 c) 1/2 d) 3/4 e) zero Questão 838 A respeito das heranças recessivas ligadas ao sexo (genes situados no cromossomo X). II. Avô . todos os seus filhos do sexo masculino também serão afetados. a cor dos olhos é determinada por um gene localizado no cromossomo X sem o correspondente alelo no cromossomo Y.XdY 189 . IV . Questão 839 Considere as seguintes afirmações sobre uma mulher hemofílica: I. Avó . e avô materno e mãe com daltonismo.As mulheres heterozigotas têm fenótipo normal. c) III é verdadeira. III. c) I. a porcentagem de indivíduos de olhos brancos em F será de: a) zero b) 100 % c) 25 % d) 75 % e) 50 % Questão 837 Um homem de audição normal e não hemofílico casa-se com uma mulher com o mesmo fenótipo. Avó . enquanto a cor branca é devida ao gene W.XDXd. Avó . II. b) II é verdadeira. a) Homem . Avó .XDY e) Homem . enquanto as mulheres apresentam três genótipos possíveis.XdY b) Homem . nasceu uma menina normal.seu pai é hemofílico.Os homens só apresentam dois genótipos possíveis. Considerando a surdo-mudez como uma característica autossômica recessiva.XDXd. Considerando que nesses indivíduos o sexo heterogamético é o masculino. Avó . Avô . e) I e III são verdadeiras.XdY.XdXd. O primeiro filho desse casal nasceu hemofílico e surdo-mudo. Questão 840 Um homem tem avó materna e pai com visão normal. e) III e IV apenas. considere as seguintes afirmações. Avô .XdY c) Homem . e excluindo-se a possibilidade de mutação.Questão 835 O raquitismo resistente à vitamina D é uma doença provocada por um gene dominante ligado ao X. Avô . III e IV.

b) e as filhas de mulheres daltônicas são sempre daltônicos. Um homem normal casou-se com uma mulher daltônica. Além disso. Admitindo-se que o gameta anormal tenha sido produzido pela mulher. Questão 843 O cientista John Dalton é bastante conhecido por suas contribuições para a Química e Física. Dalton descreveu uma doença hereditária que o impossibilitava de distinguir a cor verde da vermelha. a probabilidade de apresentar hemofilia é: a) 1 b) 1/2 c) 1/4 d) 1/8 e) 1/16 Questão 846 O esquema a seguir representa a ontogênese de João.2 e uma das irmãs desse indivíduo casar-se com um homem sadio. XXY).Questão 841 O heredograma a seguir representa uma família em que um dos filhos é afetado por doença determinada por um alelo recessivo localizado no cromossomo X. causada por um alelo recessivo ligado ao cromossomo X. Questão 844 1. que nasceu com SÍNDROME DE KLINEFELTER e DALTONISMO. c) e as filhas de homens daltônicos são sempre heterozigotos. a probabilidade desse casal ter um menino afetado é a) 3/4 b) 1/2 c) 1/4 d) 1/8 e) 1/16 Questão 842 Um homem hemofílico e uma mulher daltônica tiveram um filho com síndrome de Klinefelter (47. É correto afirmar que os filhos a) e as filhas de homens daltônicos são sempre daltônicos. d) apenas hemofílico.5.2 abendo que o indivíduo 7 é do sexo feminino.5. e) apenas daltônico. A probabilidade de terem um filho homem e normal é de: a) 0 b) 1/4 c) 1/3 d) 1/2 e) 1 Questão 845 Observe os heredogramas a seguir. d) de mulheres daltônicas sempre portam alelo para daltonismo. espera-se que esse filho do casal seja a) normal. b) daltônico e hemofílico. c) daltônico ou hemofílico. que tratam de um caso e hemofilia: 1. recebeu o nome de daltonismo. e) de homens daltônicos sempre portam alelo para daltonismo. Essa doença hereditária. embora seus pais não apresentem alterações cromossômicas numéricas em suas células 190 .5. O daltonismo é condicionado por um gene recessivo ligado ao sexo.5. quanto à hemofilia e ao daltonismo.

A Atrofia Muscular Espinhal (AME) não impede a reprodução e pode ser transmitida pelo pai. ele obrigatoriamente contribuiu com o gameta responsável pela síndrome do filho. b) Se foi o pai de João quem contribuiu com o gameta contendo um cromossomo a mais. que se caracteriza pela falta de um dos fatores de coagulação sangüínea. O caráter Distrofia Muscular de Duchenne (DMD) é uma herança ligada ao sexo.2 a filha receba dela os alelos dominantes para daltonismo e hemofilia no mesmo cromossomo. conhecido como eucromatina. O DNA ativo no nível de transcrição. enquanto a outra parte. b) Não podem ser gerados descendentes do sexo feminino afetados por DMD. o cromossomo X de origem materna condensado. c) Algumas células somáticas de cada filha apresentam o cromossomo X de origem paterna condensado. Questão 847 Em geral.5. d) A não-expressão dos alelos dominantes recebidos garante que a filha seja normal para os dois caracteres. é vista como uma mancha escura chamada corpúsculo de Barr. o que permite expressar os dois alelos dominantes. c) A mãe de João pode ser daltônica. é menos condensado para permitir acesso da maquinaria de transcrição. é correto afirmar. O gene que codifica para a produção desse fator está localizado no cromossomo X em uma região que não apresenta homologia em Y. Questão 848 abendo que o daltonismo é uma herança recessiva ligada ao sexo. a) A permutação na espermatogênese permitiu que o pai tenha dado para a filha gameta contendo o alelo dominante para hemofilia.5. é correto afirmar. assinale a alternativa que traz uma explicação possível para o fato apresentado. d) Se a mãe de João é daltônica. c) A AME pode ser um caráter ligado ao sexo. pelo menos um dos avós de João também é daltônico. Questão 849 A hemofilia é um distúrbio genético humano. O heredograma a seguir indica. 1. b) O "crossing-over" na gametogênese da mãe garante que Os dois heredogramas a seguir foram montados para duas famílias que apresentavam distúrbios musculares geneticamente determinados. Sabendo que filhas de pai apenas hemofílico e mãe apenas daltônica e homozigota para hemofilia são normais para os dois caracteres. sendo somente transmitido pelas mães. ao microscópio. torna os indivíduos afetados incapazes de se reproduzir. Na espécie humana. 191 . 1. EXCETO: a) Se o pai de João é daltônico.somáticas. o DNA não-expresso é altamente condensado na forma de heterocromatina. mas pode não ser ela quem contribuiu com o gameta responsável pela síndrome do filho.5.2 nalisando as informações e os heredogramas acima de acordo com seus conhecimentos. EXCETO: a) Os dois caracteres DMD e AME acima são recessivos. esse pai é obrigatoriamente daltônico.5. a hemofilia e o daltonismo são características recessivas ligadas ao sexo. d) Os dois caracteres DMD e AME não podem estar localizados no mesmo par de homólogos. situação que. Um exemplo disso é a inativação completa de um dos dois cromossomos X em fêmeas de mamíferos.

receberam o alelo dominante de seu progenitor do sexo feminino. é correto afirmar. Manuel certamente é normal.2 1. Questão 851 Em Galináceos a determinação do sexo (sistema ZW) segue um padrão inverso ao que se observa em mamíferos (sistema XY). Do casamento de Maria com Manuel nasceu um casal de gêmeos. 1. três famílias (A. Questão 852 A Displasia Ectodérmica Anidrótica (DEA) apresenta prevalência na população de 1:100. b) Nos dois experimentos. De acordo com as informações apresentadas. c) Se o gêmeo afetado for o do sexo masculino. O fenótipo mais marcante dessa síndrome é a ausência de glândulas sudoríparas na pele. pelo menos um indivíduo apresenta o gene causador de hemofilia. Questão 850 Um homem e uma mulher com visão normal tiveram uma filha. Os experimentos a seguir foram desenvolvidos para se estudar a herança do caráter padrão da plumagem de galináceos da raça Langshan Black (fenótipo Lisa) cruzados com galináceos da raça Plymouth Rock (fenótipo Listrada). sendo uma síndrome hereditária recessiva ligada ao cromossomo X. Maria. c) Na família C. 192 .000 nascimentos. d) A chance de o casal II-5 × II-6 ter uma criança afetada por esse caráter é de 1/4. pelo menos dois indivíduos apresentam o gene causador de hemofilia. d) Se o gêmeo afetado por daltonismo for do sexo feminino. b) Não existem indivíduos portadores do gene da hemofilia na família B. em comum. EXCETO: a) Os galos com padrão de plumagem listrada representados. constituem o sexo homogamético (macho ZZ). c) O padrão da plumagem das galinhas depende dos alelos que recebem do seu progenitor do sexo masculino. b) Os dois gêmeos podem ter recebido o gene recessivo que determina o daltonismo.5. d) O caráter plumagem lisa é recessivo em relação ao caráter plumagem listrada.5.2 Analisando-se o heredograma. Sabendo-se que o daltonismo é uma característica determinada por gene recessivo ligado ao sexo. Manuel é certamente daltônico. é INCORRETO afirmar: a) O pai de Maria não é portador. Dessa forma as galinhas constituem o sexo heterogamético (feminino ZW). é correto afirmar. também com visão normal para daltonismo.na segunda e terceira gerações. enquanto os galos O caráter descrito é uma herança ligada ao sexo. mas Maria é portadora do gene que causa daltonismo. EXCETO: a) Na família A.5. um progenitor afetado por essa anomalia. os galos listrados de F são heterozigotos quanto aos alelos que determinam esse caráter. B e C) que apresentam. sendo um deles daltônico e outro normal.5.

5. Questão 853 Analise as afirmações: I. d) Um macho com o alelo recessivo pode passá-lo para suas filhas e filhos. não apresentam a síndrome. Michele e Aline são membros de uma mesma família. Michele e Aline podem ser irmãos. Nicolau II. O genoma humano é de 46 cromossomos. A hemofilia é uma herança genética ligada aos cromossomas sexuais.5. portanto. heterozigotas e. Tatiana. b) As gêmeas podem ter herdado o alelo recessivo tanto de seu pai quando de sua mãe. filha do casal. c) Somente II e III. b) Robson. poderíamos estabelecer os seguintes graus de parentesco. e) Michele e Robson podem ser filhos de mãe daltônica e Aline a tia materna. b) I. e) Nenhuma. que sofria de hemofilia. Anastasia) e seu filho Alexis. suas quatro filhas (Olga.5. Maria. II e III. No entanto. é INCORRETO afirmar: a) As manchas na pele das gêmeas representadas podem ser o resultado da ocorrência de heterocromatina para o cromossomo que carrega o alelo dominante. as manchas que aparecem nessas mulheres são produzidas por um corante especial capaz de revelar áreas com poucas ou nenhuma glândula sudorípara. que apresentarão o fenótipo da síndrome. mesmo que o pai seja daltônico. d) Robson pode ser pai de Aline e de Michele. Para o caráter daltonismo. Com base nas informações dadas e em seus conhecimentos. Baseados nos mecanismos genéticos.2 fotografia mostra o último czar da Rússia. Um irmão da czarina Alexandra também era afetado por essa doença.2 A figura apresenta duas gêmeas univitelínicas. A probabilidade de que Olga. sua esposa Alexandra. c) Metade dos descendentes machos das gêmeas deverão apresentar a síndrome. fosse portadora do alelo para hemofilia é de a) 1/4 b) 1/64 c) 1/2 d) 1/8 e) 1/32 193 . c) Michele pode ser mãe de Robson e de Aline.Questão 854 Robson. as pessoas citadas apresentam o seguinte genótipo: Robson Michele Aline (Xd) Y (XD) (Xd) (XD) (XD) 1. d) Somente I e III.5. O daltonismo é transmitido por herança genética. III. Está correta ou estão corretas: a) Somente I e II. a) Robson pode ser filho de Aline. Questão 855 1. II.

Assinale a descendência 194 . as pessoas indicadas pelos números 3 e 6 apresentam uma doença rara determinada por um gene dominante localizado no cromossomo X.Questão 856 1. Descendendo de pais com visão normal.2 a) não terá chance de apresentar descendentes com a doença. Se um homem daltônico casa-se com uma mulher normal. O casal indicado pelos números 5 e 6 1. d) recebeu o gene de seu pai. Questão 857 Na genealogia a seguir.5. e) recebeu o gene de seu pai. heterozigota para essa característica. a cor amarela do corpo é determinada por um gene recessivo localizado no cromossomo X. não portadora do gene para o daltonismo. c) poderá ter apenas descendentes do sexo masculino com a doença. e a cor cinza pelo alelo dominante. a probabilidade desse casal ter um filho homem e daltônico é: a) 25 % b) 8 % c) 12.5. c) recebeu o gene de sua mãe. uma vez que o loco gênico está no cromossomo Y.5. podemos afirmar: a) somente o indivíduo 2 é daltônico b) o genótipo do indivíduo 4 é XdY c) o indivíduo 1 é normal.5 % d) 0 % Questão 859 Observe a árvore genealógica a seguir. e) terá todos os seus descendentes com a doença.2 elativamente aos indivíduos anteriores. heterozigoto para essa característica.5. pode-se dizer que ele a) é homozigoto recessivo para esse gene. b) poderá ter apenas descendentes do sexo feminino com a doença.5. d) poderá ter metade de seus descendentes com a doença. b) é heterozigoto para essa característica. o homem de etnia amarela apresenta uma característica determinada por um gene recessivo ligado ao sexo. Na tira de quadrinhos.5. Questão 858 O daltonismo é uma doença hereditária e ligada ao sexo na espécie humana. referente a uma família com herança para daltonismo (herança ligada ao sexo e deve-se a um gene recessivo).2 1. porém portador do gene para o daltonismo d) os indivíduos 4 e 5 são daltônicos Questão 860 Em drosófilas.

esperada a partir do cruzamento entre uma fêmea amarela e um macho cinzento. (04) As mulheres hemofílicas geralmente morrem na menarca. é determinada pelo gene recessivo d. porém portadora de gene recessivo d. (16) Se transmite de pai para filho.fêmeas: 100% cinzentas. d) apenas as filhas sejam afetadas. anomalia hereditária caracterizada por uma deficiência na coagulação do sangue.fêmeas: 50% cinzentas e 50% amarelas.fêmeas: 100% cinzentas. localizado no cromossomo X. (08) O mecanismo genético da hemofilia se deve à presença de um gene ligado ao sexo. b) tanto os filhos quanto as filhas sejam sempre afetados. em virtude da não-coagulação do sangue. Na prole de um homem afetado casado com uma mulher normal. atinge indivíduos de um único sexo.fêmeas: 100% amarelas. situado num autossomo. e) recessivo. ou seja. situado num autossomo. (02) É uma doença mais comum em homens que em mulheres. um casal fica sabendo que todos os seus filhos do sexo masculino serão daltônicos. localizado no cromossomo X. (01) É restrita ao sexo. c) Homem daltônico e mulher daltônica.5. e) apenas os filhos sejam afetados. Questão 864 Sobre a hemofilia. d) Homem daltônico e mulher normal. uma forma de daltonismo que provoca cegueira para as cores vermelho e verde. b) dominante. assinale o que for correto. c) recessivo. 1. Ao consultar um médico.5.fêmeas: 50% cinzentas e 50% amarelas. c) machos: 100% amarelos . b) machos: 100% cinzentos . já as meninas serão normais. Questão 861 O raquitismo resistente à vitamina D é uma doença determinada por um gene dominante de herança ligada ao sexo. é possível concluir que a anomalia é devida provavelmente a um alelo a) localizado no cromossomo Y. c) tanto os filhos quanto as filhas sejam sempre normais. e) Homem normal e mulher normal.5. d) machos: 50% cinzentos e 50% amarelos . Questão 862 Considere o heredograma a seguir.2 195 . d) dominante. ligado ao cromossomo X. Questão 863 Em seres humanos. Questão 865 Considere o heredograma: 1. Qual das opções fenotípicas abaixo corresponde à do casal em questão? a) Homem normal e mulher normal.5.2 partir da sua análise. a) machos: 100% amarelos . espera-se que a) tanto os filhos quanto as filhas possam ser normais ou afetados. e) machos: 50% cinzentos e 50% amarelos . b) Homem normal e mulher daltônica.

e o r.2 as proporções fenotípicas esperadas na descendência são: a) Macho peludo: 1/4. ( ) O caráter em questão é condicionado por um gene recessivo e ligado ao sexo. como a cor da pele. e) esta anomalia não será transmitida a nenhum descendente. neste caso. b) esta anomalia será transmitida à metade dos filhos do sexo masculino. A probabilidade genética de serem portadoras do gene para a hemofilia A. responsável por animal sem pêlo. o R. Fêmea peluda: 9/64. Questão 868 Em bovinos ocorrem 60 cromossomos na célula somática. O gene responsável pela quantidade de pêlos no animal está situado no cromossomo X.5. 1. ( ) Essa árvore genealógica representa um caso de anomalia hereditária. e 58 autosomos mais XY no macho. Fêmea peluda: 1/4. Fêmea sem pêlo: 1/8 d) Macho peludo: 36/64. grave anomalia relacionada à alteração no tempo de coagulação do sangue. Essa figura indica os grupos sangüíneos do sistema ABO de alguns dos seus membros. Fêmea sem pêlo: 1/8 Questão 869 Observe a figura a seguir que apresenta o heredograma de uma família na qual alguns membros apresentam hemofilia. Macho sem pêlo: 9/64. Em relação aos descendentes deste casal é CORRETO afirmar que: a) esta anomalia será transmitida a todos os filhos do sexo masculino. XX na fêmea. Entretanto. sendo 58 autossomos mais dois cromossomos sexuais. Joana teve um filho que apresentou síndrome hemorrágica caracterizada por baixo nível plasmático do fator VIII da coagulação. determinada por um gene presente no cromossomo Y. A partir do cruzamento XrY × XRXr. Fêmea sem pêlo: 10/64 e) Macho peludo: 1/8. Fêmea peluda: 3/8. Macho sem pêlo: 1/4. Fêmea peluda: 3/8. d) esta anomalia será transmitida à metade das filhas. Fêmea sem pêlo: 1/16 c) Macho peludo: 3/8. Questão 867 Um homem possui uma anomalia dominante ligada ao cromossomo X e é casado com uma mulher normal. ( ) Essa genealogia apresenta um tipo de interação gênica. responsável por animal peludo.abe-se que o pai. Esse gene é representado por dois alelos. c) esta anomalia será transmitida a todas as filhas. Fêmea peluda: 3/16. influenciada pelo meio ambiente. sua mãe e sua filha c) 100% para Joana e 50% para sua filha d) 100% para Joana e 50% para as outras mulheres da família e) 100% para Joana e 25% para sua filha Questão 866 Tendo em vista o heredograma. Fêmea sem pêlo: 1/4 b) Macho peludo: 9/16. o marido. Macho sem pêlo: 1/8. Macho sem pêlo: 3/8. os cinco irmãos homens e um sobrinho de Joana são normais.5. ( ) Esse pedigree mostra um exemplo de herança passada do avô ou da avó para o neto por meio da mãe portadora. Macho sem pêlo: 3/16. recessivo. analise os itens. é: a) 100% para todas as mulheres da família b) 100% para Joana. 196 .

b) Autossômica recessiva. A ausência dessa enzima. é INCORRETO afirmar-se que a) a probabilidade de II-3 ser portadora do gene da hemofilia é de 50%. d) Autossômica dominante. em indivíduos afetados. c) Ligada ao Y. d) o indivíduo II-5 tem 50% de probabilidade de formar gametas do tipo iXh. c) o indivíduo III-4 pode receber sangue de III-6.2 1.5.5.2 1. provocando sua destruição. Observe o heredograma que representa uma família com essa característica. Questão 872 A enzima G-6-PD (glicose-6-fosfato desidrogenase) está presente nas hemácias de indivíduos normais.5.5.5. torna as hemácias sensíveis a certas drogas e nutrientes. Questão 870 Ao fazer um exame de vista para tirar carteira de motorista. b) a probabilidade de nascimento de outra criança hemofílica e do grupo B para o casal III-6 e III-7 é de 25%. e) o indivíduo I-1 é heterozigoto para o sistema ABO.2 Com base nas informações do heredograma e considerando-se que não ocorreu mutação. Assinale entre as alternativas a seguir aquela que contém o heredograma que NÃO poderia representar a família desse rapaz. 1. a) Ligada ao X. um rapaz descobriu que era daltônico.5. ssinale a alternativa que NÃO contém um tipo de herança compatível com a anomalia representada no heredograma.Questão 871 Analise o heredograma. 1. O gene que determina a ausência de G-6-PD é recessivo e situa-se no cromossoma X.5.5.2 a) 1 b) 2 c) 3 d) 4 197 .

2 serão daltônicos. é CORRETO afirmar que a) cada um dos indivíduos representados tem. é INCORRETO afirmar que a) casais com filhos afetados têm 25% de probabilidade de ter outra criança com essa doença.1 x I.4 é homozigota 4.5 é heterozigota 5.4 recebeu o gene do daltonismo de qualquer um de seus genitores. Analise-a e avalie as proposições dadas. b) essa família apresenta dois indivíduos heterozigotos para o gene que determina a G-6-PD. ligada ao X.5. b) indivíduos do sexo masculino afetados por essa distrofia muscular são filhos de mães heterozigotas. Questão 873 A distrofia muscular do tipo Duchenne. A mulher II. independentemente do genótipo do seu pai.5. c) casais como I. A mulher I.2 é homozigota 2. Questão 875 Considerando que o heredograma a seguir é o de uma herança dominante. b) o indivíduo II. d) mulheres afetadas recebem os cromossomos X materno e paterno com o gene para essa distrofia.2 têm probabilidade maior de ter filhos afetados do que de ter filhas afetadas. c) os casais como I. Questão 874 Analise este heredograma. A mulher III. pelo menos.9 é homozigota Está(ão) correto(s) apenas: a) 1 b) 2 c) 3 d) 1 e 3 e) 1 e 2 Questão 876 A figura a seguir faz referência a uma genealogia que ilustra a ocorrência de uma determinada doença genética.5. d) os filhos do sexo masculino de II. analise os itens: 1. c) indivíduos do sexo masculino que possuem um gene mutante para essa distrofia manifestam a doença. caracteriza-se por debilidade muscular progressiva e deformidades ósseas. é CORRETO afirmar que a) o indivíduo I. A mulher I. d) o indivíduo II-3 pode ter recebido o gene da G-6-PD tanto do seu pai quanto de sua mãe. um gene para ausência de G-6-PD.2 é heterozigota 3.om base nesse heredograma.5.2 apresenta o fenótipo normal e é portador do gene do daltonismo. condicionada por gene recessivo localizado no cromossoma X: Considerando-se as informações contidas nesse heredograma e outros conhecimentos sobre o assunto. inicia-se na infância e impede a reprodução dos afetados. em que está representada a herança do daltonismo.2 198 . 1.1 e I. doença recessiva ligada ao cromossomo X.2 têm maior probabilidade de ter filhos do sexo masculino daltônicos. A mulher III.2 . Considerando-se essas informações e outros conhecimentos sobre o assunto.

sendo responsável por este tipo de hemofilia.2 1. V3.5. é causada pela deficiência de um dos fatores que agem na coagulação. G.M. I. 2003. Observe o heredograma (fig. MARTHO. IV. e) I e III. Um círculo preto representa uma mulher surda e um círculo branco representa uma mulher normal. d) I e II. 1) de uma família em que ocorre a hemofilia A. somente o indivíduo 6 é portador do alelo recessivo que causa a hemofilia.R. Questão 878 O diagrama abaixo mostra a surdez em três gerações de uma família. AMABIS. Moderna. a probabilidade de terem filhos hemofílicos é de 50% e de terem filhas hemofílicas é de 0%.2 ( ) A característica mostrada no heredograma é determinada por uma série polialélica de genes autossômicos. II„.5. II. 199 . analise as afirmativas. ( ) A identidade genotípica é também observada entre II e IIƒ.1. São Paulo: Ed. J. ( ) Os descendentes III„ e III… apresentam o mesmo genótipo. III. III. o alelo mutante (h) condiciona ausência do fator VIII. Estão corretas apenas as afirmativas a) I e IV. genótipos da figura 2 e a consangüinidade. pois herdou o alelo recessivo para ausência do fator VIII de sua mãe. As irmãs 2 e 4 apresentam.5. enquanto que o indivíduo 5 não apresenta este alelo. Esse fator é uma proteína cujo gene codificador encontra-se no cromossomo X. respectivamente. "Conceitos de Biologia". condicionou a manifestação do alelo deletério h para hemofilia. Com base nos textos e em seus conhecimentos.. considerando que os indivíduos 2 e 4 são irmãs. O indivíduo 7 é hemofílico. o fator VIII. Questão 877 A hemofilia é uma doença hereditária em que há uma falha no sistema de coagulação do sangue. pois herdou da mãe o alelo normal (H). III„ e III…) manifestam a característica em consideração. pode-se concluir que se trata da herança de genes localizados no cromossomo Y. através da união entre primos irmãos (indivíduos 5 e 6). b) III e IV. A hemofilia A. ( ) Observando-se que a maioria dos machos (I. e o indivíduo 8 pode ou não ser portador deste alelo recessivo. III‚. o alelo normal (H) produz o fator VIII e condiciona fenótipo não hemofílico. Se o indivíduo 7 tiver filhos com uma mulher que tenha o mesmo genótipo para hemofilia de sua avó materna. um dos tipos mais graves.5. c) II. Dos primos que se casaram. Um quadrado preto representa um homem surdo e um quadrado branco um homem normal. ( ) O loco gênico determinante deste caráter deve estar localizado na porção não-homóloga do cromossomo X.

2 (08) Esse gene deve se manifestar apenas nos machos. . c) dominante ligada ao sexo. é correto afirmar: (01) Esse gene deve se manifestar com igual freqüência em machos e fêmeas. Em uma família. enquanto o filho não enxerga a cor verde. Questão 880 Genes situados na porção ímpar do cromossomo X são transmitidos segundo um padrão definido como Herança Ligada ao Sexo. b) autossômica recessiva. Considerando um gene recessivo e localizado nessa porção do cromossomo X. Em camundongos. a probabilidade é zero. Se uma fêmea de cauda normal for cruzada com um macho de cauda retorcida. (32) Machos afetados descendem de fêmeas portadoras ou afetadas. É correto afirmar que: a) a mãe obrigatoriamente apresenta a cegueira da cor verde. d) todos os machos com cauda curta e retorcida e todas as fêmeas com cauda normal. Soma ( ) Questão 881 condição de surdez mostrada no heredograma é herdada como uma característica: a) autossômica dominante. b) Se a mulher for homozigota. localizado na região não homóloga do cromossomo X. Seu alelo recessivo é responsável pelo fenótipo cauda normal. d) Se a mulher for heterozigota.5. (16) Machos afetados descendem de machos também afetados. d) a mãe é pelo menos heterozigota para a cegueira da cor verde. que leva a uma debilidade muscular progressiva (distrofia muscular progressiva).Uma mulher com fenótipo normal tem um irmão afetado e um tio materno também afetado pela doença.1. o fenótipo cauda curta e retorcida é determinado por um gene dominante denominado "Bent". e) o pai obrigatoriamente apresenta a cegueira da cor verde. e) todos os machos com cauda normal e todas as fêmeas com cauda curta e retorcida. b) o pai é heterozigoto para a cegueira da cor verde.seus pais não são afetados. d) recessiva ligada ao sexo. c) o pai é homozigoto para a cegueira da cor verde. Questão 882 Existe uma doença condicionada por um gene recessivo. c) Se a mulher for homozigota. a probabilidade é 75%.5. a filha possui visão normal. a probabilidade é 25%. Qual a probabilidade de que um(a) filho(a) deste casal venha a ser afetado pela doença? a) Se a mulher for homozigota. Questão 879 A cegueira da cor verde na espécie humana é uma característica recessiva ligada ao sexo. (02) Esse gene deve se manifestar com maior freqüência nas fêmeas. b) machos e fêmeas com cauda curta e retorcida na proporção de 2:1. sua descendência apresentará a seguinte proporção: a) machos e fêmeas com cauda curta e retorcida na proporção de 100%.ela está casada com um homem normal. c) machos e fêmeas com cauda normal na proporção de 100%. . localizado no cromossomo sexual comum aos dois sexos. a probabilidade é 100%. e) holândrica. 200 . (04) Esse gene deve se manifestar com maior freqüência nos machos. (64) Fêmeas afetadas são necessariamente descendentes de fêmeas afetadas. .

de que cores são os pais? a) A mãe é malhada e o pai. estão envolvidos um homem que tem a doença e outro que não a tem. e possui um alelo ligado ao X recessivo b. Questão 887 Assinale a proposição CORRETA. a outra metade é preta. e) A mãe e o pai são pretos.5. a) autossômica dominante b) ligada ao X dominante c) ligada ao Y dominante d) ligada ao Y recessiva e) ligada ao X recessiva Questão 884 Um homem é heterozigoto para um gene autossômico. (04) Entre as mulheres. assinale a(s) proposição(ões) CORRETA(S). I . Assim. 201 1. e metade dos machos é amarela. amarelo. a probabilidade é 100%. . do sexo masculino. e) apenas nos gametas com cromossomo y.O homem não hemofílico pode ser o pai do menino. c) A mãe é amarela e o pai. e decorre do não funcionamento de um dos fatores bioquímicos de coagulação. III . o gene para o daltonismo encontra-se: a) em todas as células somáticas. Quando metade das fêmeas de uma ninhada é malhada. II .5. e) Apenas II e III. Questão 888 A hemofilia é uma doença hereditária em que há um retardo no tempo de coagulação do sangue. preto. amarelo. (01) Não é possível a existência de mulheres hemofílicas. em uma região sem homologia no cromossomo Y. Aa. Com relação a essa doença. Em um indivíduo daltônico. preto.O homem hemofílico não pode ser o pai do menino.2 dentifique o mais provável padrão de herança representado no heredograma. os machos podem se pretos ou amarelos e as fêmeas podem ser pretas amarelas ou malhadas. b) Apenas II. b) em todas as células gaméticas.As bases genéticas da hemofilia apoiam a paternidade do homem hemofílico. Quais estão corretas? a) Apenas I. (Hemofilia: herança recessiva ligada ao X) Analise as afirmações abaixo a esse respeito.e) Se a mulher for heterozigota. é possível encontrar um máximo de três fenótipos e dois genótipos. d) apenas nas células-mãe dos gametas. c) apenas nas células do globo ocular. d) A mãe é preta e o pai. d) Apenas I e II. Que proporção dos seus espermatozóides espera-se que seja A/Xö ? a) 0 % b) 25 % c) 50 % d) 75 % e) 100 % Questão 885 Nos gatos domésticos a cor do pêlo é ligada ao cromossomo X. Questão 886 Em um caso de disputa da paternidade de um menino hemofílico. c) Apenas III. (02) É condicionada por um gene que se localiza no cromossomo X. b) A mãe é malhada e o pai. Questão 883 Interprete o heredograma abaixo.

Analise as afirmativas abaixo. a distrofia muscular de Duchenne é uma doença condicionada por um gene recessivo localizado no cromossomo X. c) II e III.A distrofia muscular de Duchenne é uma doença que ocorre quase que exclusivamente em meninos. d) 1/8. São corretas as afirmativas a) apenas III. Sabendo-se que o daltonismo é uma herança ligada ao X. d) I e II. I. que acarreta degeneração e atrofia dos músculos. Questão 893 Observe a genealogia abaixo sobre uma família que apresenta pessoas afetadas por uma anomalia hereditária. a possibilidade de esse casal ter uma filha com daltonismo é a) zero. Questão 890 Em drosófila.Devido à inativação ao acaso de um cromossomo X. que ocorre nas células das fêmeas dos mamíferos (hipótese de Lyon). Questão 891 Um casal que possui visão normal para as cores. III.(08) Entre os homens. d) 3/4.A distrofia muscular de Duchenne é uma doença que ocorre exclusivamente no sexo masculino. d) 100% de machos com cerdas retorcidas e 100% de fêmeas normais. que se caracteriza pela dificuldade de coagulação do sangue. II. b) 1/3. (16) Entre os descendentes de um homem hemofílico e de uma mulher normal. as mulheres heterozigotas para o gene da distrofia muscular de Duchenne podem apresentar graduações da característica. b) 1/4. tem 3 filhos com as seguintes características: 202 . c) 100% de machos normais. o caráter cerdas retorcidas é determinado por um gene recessivo e ligado ao sexo. em que os indivíduos afetados têm graves hemorragias. Questão 889 A hemofilia é uma doença recessiva ligada ao sexo. mesmo no caso de pequenos ferimentos. Uma fêmea heterozigota foi cruzada com um macho normal. Os homens afetados começam a apresentar os sintomas na primeira infância e não se reproduzem porque morrem antes de atingir o período reprodutivo.menina com visão normal para as cores. Questão 892 Na espécie humana. por isso. O alelo dominante determina cerdas normais (não retorcidas). é possível ocorrer apenas um genótipo. há uma maior incidência dessa doença entre eles.menino com daltonismo. A descendência esperada será de a) 50% de machos e 50% de fêmeas normais e 50% de machos e 50% de fêmeas com cerdas retorcidas. e) 3/4.menino com visão normal para as cores. Soma ( ) . . b) 50% de machos normais. não portadora. espera-se que 50% deles sejam normais e 50% sejam hemofílicos. a probabilidade de nascimento de uma criança do sexo masculino e hemofílica é a) 1/2. b) I e III. 50% de machos com cerdas retorcidas e 100% de fêmeas normais. 50% de fêmeas com cerdas retorcidas e 50% de fêmeas normais. . e) 1. (32) É um exemplo de herança ligada ao sexo. Em um casal em que a mulher é heterozigota para a hemofilia e o marido é normal. c) 1/4. e) 100% de machos normais e 100% de fêmeas com cerdas retorcidas. c) 1/2.

b) O genótipo da Sra 5 é XHXh. 203 .5.5.2 anomalia em questão é transmitida por meio de um gene a) recessivo ligado ao cromossomo X.2 Utilizando as informações anteriores.5. de visão normal em um dos olhos. Um casal não-calvo e de visão normal tem um filho calvo e daltônico. II . (0) O caráter cor da pelagem. mas daltônicas do outro. (2) Os descendentes de uma fêmea amarela.1.É possível que o casal tenha filhas não-calvas. I . cruzada com um macho preto. a calvície hereditária é uma característica influenciada pelo sexo. (3) Um gato macho não transmite para seus filhos machos os genes para cor da pelagem. b) autossômico recessivo. serão manchados. c) dominante ligado ao cromossomo X. Questão 895 O gene h que determina a hemofilia na espécie humana é recessivo e está localizado no cromossomo X. O gene que condiciona a calvície é dominante nos homens e recessivo nas mulheres. a) I e II são corretas.5. julgue os itens a seguir. III . é condicionado por genes ligados ao cromossomo X. (1) As fêmeas manchadas são heterozigotas para o caráter cor da pelagem. não havendo dominância. observam-se os seguintes fenótipos: 1. analise as afirmativas a seguir. Considerando os dados apresentados. Questão 896 Com relação à coloração da pelagem de gatos. podemos afirmar corretamente: a) O genótipo da Sra 5 é XHXH. O daltonismo é de herança recessiva ligada ao cromossomo X. Questão 894 Na espécie humana.A mulher é dupla heterozigota para os genes em questão. d) O genótipo do Sr 9 é XHY. c) O genótipo da Sra 8 é XHXH. b) I e III são corretas. Com base no heredograma a seguir. nos gatos. e) O genótipo da Sra 8 é XhXh. d) Apenas III está correta. d) autossômico dominante. c) II e III são corretas.5.2 1.5.25% das filhas do casal poderão ser calvas e daltônicas. Marque a alternativa correta.

e) 5. portadoras do gene. b) 2. 204 . Questão 901 Um casal não hemofílico teve um filho do sexo masculino com hemofilia. a cor branca dos olhos é devida à herança ligada ao sexo.50.00. Este gene provoca aborto espontâneo algumas semanas após a formação do zigoto.5. o número esperado de crianças do sexo masculino será a) 1.5. c) 3. Se esta mulher der à luz seis crianças normais. (02) O daltonismo é determinado por um gene recessivo. Questão 898 Considere o heredograma.2 respeito desta genealogia. podemos afirmar que a) a mulher 2 é homozigota. d) todas as filhas do casal 1 e 2 são portadoras do gene. em seis partos diferentes. b) 0. (08) O indivíduo 8 tem o mesmo fenótipo de sua avó materna. Uma mosca fêmea com olhos coloridos. Indique a alternativa com a probabilidade desse casal ter uma filha hemofílica: a) 0% b) 25% c) 50% d) 75% e) 100% 1. Questão 900 A genealogia abaixo nos mostra uma forma de transmissão do daltonismo. portadores do gene. certamente. certamente. sendo que seu alelo dominante condiciona visão normal. (32) O genótipo do indivíduo 9 é XdY. d) 4. 1. que representa uma família portadora de caráter recessivo condicionado por um gene situado em um dos cromossomos sexuais.2 Assinale dentre as alternativas que se seguem. portadoras do gene.5. b) as filhas do casal 3 e 4 são.67. d) 0. Questão 899 Uma mulher é portadora de um gene letal presente no cromossomo X. e) 0. (04) O indivíduo 1 transmite a todas as suas filhas um cromossomo Xd. (16) O casal 1 x 2 pode ter filhos homens daltônicos.25. c) 0. Qual é a probabilidade de se obter uma fêmea de olhos brancos deste cruzamento? a) 1.5. e) os homens 1 e 4 são. a(s) correta(s). certamente. (64) O genótipo do indivíduo 5 é XdXd. c) as mulheres 2 e 3 são.Questão 897 Em moscas de frutas. cruza-se com macho de olhos brancos.00. (01) O daltonismo está relacionado com genes localizados em cromossomos autossômicos. cuja mãe tinha olhos brancos.

e) exclusivas das mulheres. Este fenômeno é chamado de: a) epistasia.Questão 902 Na espécie humana. c) em 50% das mulheres e 50% dos homens. ele fez algumas suposições sobre a herança desse cromossomo. aB (10%). aB (25%). Questão 903 A hipertricose auricular é uma anomalia genética condicionada por um gene localizado no cromossomo Y. Esta observação foi enunciada como "2 Lei de Mendel" ou "Lei da Segregação Independente". c) Se o meu irmão não tiver esse Y. genes que estão localizados nos mesmos cromossomos. As características condicionadas por tais genes são a) transmitidas da mãe para 100% das filhas. Questão 907 Mendel. II . Questão 904 Como exemplo de característica na espécie humana. genes que não possuem homologia com o cromossomo X.AB (25%).AB (50%). d) somente nas mulheres heterozigotas. e) Provavelmente esse Y ficou grande para ser o homólogo do X. e) o albinismo. aproximadamente. Na próxima geração dessa família esse gene se manifestará a) em todas as mulheres. b) transmitidas do pai para 100% dos filhos homens. respectivamente. c) herança holândrica. III . Um homem com hipertricose casa-se. determinada por genes localizados no cromossomo Y. e) interação gênica. ab (40%). Questão 905 O exame citogenético de um indivíduo normal revelou que o seu cromossomo Y contém. isto é. e) somente nos homens heterozigotos. Embora sem nenhuma manifestação fenotípica aparente. b) Se eu tenho este Y. a determinação cromossômica do sexo é dada pelos cromossomos X e Y. ab (50%). todos os meus descendentes também o terão. Ab (25%). por genes holândricos. 30% a mais de heterocromatina na região distal. ele acompanhou a transmissão de dois caracteres ao mesmo tempo. Assinale a suposição que está geneticamente coerente: a) Acho que o meu pai herdou essa condição genética da mãe dele. apenas 50% terão esse cromossomo. Ab (10%). 205 . c) a hemofilia. ou seja. Observando as seguintes proporções de gametas produzidos pelo diíbrido AaBb em três situações distintas. b) II e III são situações nas quais ocorre segregação independente e ligação gênica sem "crossing-over". b) o aparecimento do corpúsculo de Barr. Questão 906 A hipertricose auricular (pêlos na orelha) é transmitida apenas pelo homem e somente para os filhos do sexo masculino. a qual não é válida para os genes que estão em ligação gênica ou "linkage". em relação ao padrão de cromossomo Y presente na população. I . trabalhou com apenas uma característica de cada vez. pode-se afirmar que: a) I e II são situações nas quais os genes segregam-se independentemente. b) codominância. isto é. d) o daltonismo. temos: a) a diferenciação dos testículos. c) transmitidas do pai só para as filhas. Posteriormente. O cromossomo Y apresenta genes holândricos. talvez ele não seja meu irmão. e todos os seus filhos são homens. b) em todos os homens.AB (40%). nas primeiras experiências sobre hereditariedade. ab (25%). e os resultados levaram-no a concluir que: "fatores para dois ou mais caracteres são transmitidos para os gametas de modo totalmente independente". d) transmitidas do pai para os filhos homens e filhas em 100% dos casos. d) Entre as minhas filhas. d) pleiotropia.

b) Seis. em 8. e) Dez. a partir de progenitores com os genótipos mostrados na figura? 206 . c) Três.6 ( ) A freqüência de recombinação entre os locos A e B é de 17%. ocorrer permutação entre os locos A e B. c) Oito. d) Oito. A esse propósito. em 50% das células produtoras de gametas. a partir do cruzamento acima indicado. pode-se concluir que os genes "a" e "b": a) estão em um mesmo braço do cromossomo. b) seguem as leis do diibridismo.5% das células formadoras de gametas. no cromossomo. respectivamente. d) II é uma situação na qual ocorre ligação gênica com "crossing-over". d) Dezesseis. c) constituem um caso de interação gênica. e) Número variável. pode-se inferir que ocorreu permutação (ou crossing-over). Em quantos grupos de ligações seus genes estarão associados? a) Quatro. Em quantos grupos de ligações seus genes estarão associados? a) Dois. os gametas não recombinantes e os recombinantes surgirão nas proporções esperadas de 1:1:1:1. d) são pleiotrópicos. existe uma ligação gênica. ( ) A probabilidade do aparecimento de um indivíduo AB//ab. ( ) Se. A taxa de recombinação entre eles dependerá do quanto estiverem afastados um do outro. Questão 911 Quando dois genes estão em um mesmo cromossomo. um com genótipo AaBb e outro com genótipo aabb resultou numa F com as seguintes proporções: AaBb = 35% aabb = 35% Aabb = 15% aaBb = 15% Com esses resultados. b) Quatro.c) I e III são situações nas quais ocorre segregação independente e ligação gênica com "crossing-over". e) são epistáticos. ( ) Considerando o cruzamento ilustrado na figura. e) III é uma situação na qual ocorre ligação gênica sem "crossing-over". Em que percentual serão esperados descendentes de genótipo AB // ab. é de aproximadamente 42%. analise a figura e as afirmações feitas a seguir. ocorrer permutação entre os locos A e B. ( ) Se.5. cada tipo de gameta recombinante (Ab e aB) aparecerá com freqüência de 25%. Questão 910 O cruzamento de dois indivíduos. Questão 908 Considere uma espécie de vertebrado cujas células embrionárias têm oito cromossomos. Questão 909 Considere uma espécie de vertebrado cujas células somáticas têm 12 cromossomos. 1. Questão 912 A freqüência de recombinação entre os locos A e B é de 10%. em 100% das células germinativas da fêmea.

e pilosidade no cálice da flor . ( ) Os locos A e B distam entre si de 35 unidades de mapa.6 1.5. cor do hipocótilo . sendo que na segunda. obtendo-se uma F2 como mostrado no quadro. o hipocótilo era verde (situação 1). foram cruzadas com plantas de fenótipo (ab). foi observada na progênie a seguinte proporção (situação 2): 1. e) em ambas as situações ficou evidenciada a ligação gênica. o hipocótilo era roxo e todas as plantas que apresentavam flores de cor branca. Analise as proposições a seguir quanto à correção.com (piloso) e sem (glabro). fenotipicamente (AB). Plantas homozigóticas. o que mostra uma distância menor entre os genes. 1.6 a) 5% b) 90% c) 45% d) 10% e) 20% Questão 913 Dois fenótipos de interesse econômico. foi observado que todas as plantas que apresentavam flores roxas.roxo e branco -. c) a primeira situação evidencia ligação gênica e a segunda mostra a segregação independente dos genes. A F1. foi retrocruzada com o pai duplo-recessivo. ( ) Em 60% das células formadoras de gametas da F1. são determinados.roxo e verde . a ligação é mais forte do que na primeira. A geração P é genotipicamente (AB//AB) x (ab//ab). b) a primeira situação pode representar um caso de pleiotropia e a segunda evidencia uma segregação independente dos genes. ambos com dominância completa. em milho. A cor roxa da flor e do hipocótilo e a presença de pilosidade são dominantes. pelos locos A e B. ocorreu permutação entre os locos A e B. Em todos os cruzamentos realizados entre plantas fenotipicamente diferentes e após avaliações em várias gerações segregantes. ao cruzarem um duplo heterozigoto para os caracteres cor da flor e pilosidade no cálice da flor com um duplo-recessivo. d) em ambas as situações ficou evidenciado o efeito pleiotrópico entre os genes.5. respectivamente. fenotipicamente (AB). 207 . ( ) A taxa de recombinação no caso mostrado é de 30%.Questão 914 Uma determinada espécie vegetal apresenta variação para cor da flor . Com base no texto e em seus conhecimentos é correto afirmar que a) a primeira situação pode representar um caso de pleiotropia e a segunda mostra um caso de ligação gênica.6 ( ) Trata-se de um caso de ligação gênica. ( ) Em 35% das células gaméticas da F1 ocorreu recombinação. Entretanto.5.

Quais afirmativas o professor diria que estão corretas? a) Apenas II. II.A aparência de um indivíduo com respeito a uma dada característica herdada é chamada de fenótipo. Em certas comunidades da Europa Central.3 b) 3 c) 45 d) 60 e) 90 Questão 918 O gráfico a seguir mostra a dinâmica das freqüências do gene s. nós dizemos que esta característica é uma característica poligênica. uma em cada 30 pessoas apresenta fenótipo normal e é heterozigota quanto ao gene determina a doença de Tay-Sachs. II.Questão 915 Os seguintes conceitos genéticos foram escritos por um aluno que estava com dúvidas sobre a matéria e que pediu a um professor qualificado que os conferisse: I . o número esperado de casamentos com risco de gerar crianças com degenerescência nervosa é: a) 0. III. que possuem efeitos similares e aditivos. Em 2. IV e V e) I. provocando a degenerescência nervosa mortal.5. IV e V Questão 916 Numa determinada população a capacidade de enrolar a língua é determinada por um gene dominante A. e há tentativas de tratamento com algum sucesso em poucos casos. o qual determina a doença chamada siclemia ou anemia falciforme. Nessa mesma população foi observado que 64% das pessoas apresentam esta característica. dizemos que este "locus" possui alelos múltiplos. Os homozigotos siclêmicos morrem precocemente devido à severa anemia. os heterozigotos sofrem de uma forma branda da anemia mas.Um organismo com dois alelos idênticos para um "locus" em particular é considerado homozigoto para este "locus". estão presentes na população. IV . III . enquanto um organismo com dois alelos diferentes para um mesmo "locus" é considerado heterozigoto para este "locus".Quando uma característica particular de um organismo é governada por muitos pares de genes.Os genes em um mesmo cromossomo tendem a ser herdados juntos e são denominados "genes ligados" II . V . para um dado "locus".7 208 . III e IV b) Apenas I. II. são mais resistentes à malária que os indivíduos normais. por outro lado. O diagnóstico pré-natal é possível. Qual a explicação para o comportamento das curvas do gráfico? 1.700 casamento ocorridos entre membros sadios dessas comunidades. III e V d) Apenas II.Quando três ou mais alelos. III e IV c) Apenas I. A freqüência esperada de indivíduos heterozigotos será de: a) 70% b) 48% c) 36% d) 16% e) 10% Questão 917 A doença de Tay-Sachs resulta da ação de um gene mutante localizado no cromossomo número 15. O gráfico refere-se ao período posterior à erradicação da malária. III.

indique a alternativa que mostra o número de indivíduos para cada genótipo. c) o nascimento de 48 indivíduos afetados entre 300 nascidos. se essa população estiver em equilíbrio genético.000 é hemofílico.8/16. b) a imigração de muitos indivíduos homozigotos dominantes.320.1/16.4/16.1. e) AA . d) AA .50. numa população constituída de 8.9/16. c) AA . b) AA . c) Aumento da freqüência de mutação de S para s. respectivamente.1. Questão 925 A hemofilia é causada por um gene recessivo (h) localizado no cromossomo X.6/16. um homem em 25. as freqüências dos genes I e i são. aa . Constatou-se a diminuição dessa freqüência após a) a morte de 5% da população total por falta de alimento.5.6/16.440. Aa . Aa . Questão 921 A sensibilidade (gosto amargo) do ser humano ao PTC (feniltiocarbamida) se deve a um gene autossômico dominante I e a insensibilidade. numa população de 1200 pessoas.1. d) 0. Aa . Aa .000 d) 1/50. Sabendo-se que.400. b) AA .5% c) 25% d) 50% e) 75% Questão 924 Sabendo-se que a freqüência do gene autossômico A é igual a 0.6. aa . a freqüência de um gene autossômico dominante A é o triplo da freqüência do seu alelo recessivo a.1.00.8 e 0.280. aa . em uma dada população.9/16. d) 1152 e 48.1/16. se as proporções genotípicas forem: a) AA . Aa .6/16. d) AA . Questão 923 Sabendo-se que uma população está em equilíbrio genético e que a freqüência de indivíduos homozigotos para um caráter autossômico e dominante (AA) é de 25%. respectivamente: a) 960 e 240.4/16. e) AA .8. b) 768 e 432. era de 0. a) AA .25. Nessa população a freqüência do alelo A é a) impossível de se determinar. a freqüência do gene h nessa população é a) 1/500 b) 1/12. e) Cruzamentos preferenciais entre portadores de malária.25% b) 12.560. e) o crescimento da população da população devido a diminuição da predação. os números esperados de pessoas sensíveis e insensíveis nessa população são.2.5. Se. c) 0. Aa . b) 1. d) o casamento preferencial de indivíduos heterozigotos. e) 816 e 384.75.500 c) 1/25. Aa . Questão 920 A freqüência de indivíduos afetados por uma anomalia genética autossômica recessiva. e) 0. aa .6. concluímos que a freqüência de indivíduos homozigotos recessivos (aa) é de: a) 6.600.9/16. c) AA .160. Aa .000 indivíduos. Aa .160.2.a) Diminuição da freqüência de mutação de S para s.560. Aa . aa .6. Questão 919 Considere uma população em que metade dos indivíduos mantém-se heterozigota para um dado gene (Aa). enquanto que a outra metade é composta por indivíduos duplo-recessivos (aa).6/16. Questão 922 Numa população.6/16. ao seu alelo recessivo i. aa .4/16.280.1. numa determinada população. Essa população estará em equilíbrio genético. b) Seleção contra os portadores do gene s. aa . aa .000 209 . aa .120. c) 1008 e 192.120.16.400.280. d) Cruzamentos preferenciais entre pessoas anêmicas.320.1/16. aa . 0.

7 Questão 929 Uma população em que atuam os princípios postulados por Hardy e Weinberg.5. Assinale a alternativa correspondente aos cálculos corretos. que estão indicadas na tabela abaixo.7 1. O alelo que condiciona asas longas é dominante sobre o alelo que condiciona asas vestigiais. as freqüências genotípicas de um determinado par de alelos "a" se distribui de acordo com o gráfico destacado: Marque o gráfico que representa a freqüência genotípica após 12 gerações: 1. 1. espera-se que sejam heterozigotos a) 700 b) 420 c) 90 d) 49 e) 21 Questão 927 Analise o heredograma a seguir no qual os símbolos escuros significam a presença de uma anomalia. 16% apresentavam asas vestigiais. que tem sua expressão influenciada pelo sexo. a freqüência do alelo autossômico (b) é de 30%. o comprimento das asas é determinado por um par de genes. como mostra a tabela a seguir: 210 . calcularam-se outras freqüências.2 vir a ter uma criança com a anomalia é a) 1/420 b) 1/160 c) 1/120 d) 1/80 e) 1/50 Questão 928 Em drosófilas.000 Questão 926 Em uma população em equilíbrio de Hardy-Weinberg. Sabendo-se que.1 x III. em uma população mantida em laboratório.5.5. Se essa população for formada por 1000 indivíduos. Questão 930 A calvície na espécie humana é determinada por um gene autossômico C.7 abendo-se que a freqüência de heterozigotos na população é 1/20. a probabilidade do casal III.e) 1/100. Esse caráter é dominante nos homens e recessivo nas mulheres.

000 indivíduos revelando os dados apresentados no quadro abaixo.16 e 0. Sabe-se também que. formada por 10.5. considere a informação a seguir. N ou MN. c) a dominância dos genes relacionados com a cor dos olhos modificar-se com o ambiente. onde 81% dos homens não apresentam genótipo capaz de torná-los calvos. respectivamente. Essa característica é determinada por um par de alelos entre os quais não há dominância.100 e) 900 Questão 933 Sabe-se que olhos escuros são dominantes sobre olhos azuis.5% c) 19% d) 42% e) 81% Questão 931 Para responder à questão. d) a freqüência dos alelos para olhos escuros ser maior nas populações sul-americanas do que nas européias. Se em uma população em equilíbrio de Hardy-Weinberg.36 e 0. qual a freqüência esperada de mulheres cujo genótipo pode torná-las calvas? a) 1% b) 8. as freqüências dos alelos M e N são. na maioria das populações da América do Sul predomina o número de pessoas de olhos escuros.7 . que sempre é influenciada por fatores ambientais.24 e 0. d) 0.24. as freqüências esperadas de indivíduos dos grupos N e MN são. Espera-se que o número de indivíduos Rh positivo homozigoto nessa população seja de a) 9. 211 m uma população. existem 900 do tipo Rh negativo.84.7 esta população. em equilíbrio de Hardy-Weimberg. Questão 934 Na espécie humana. enquanto em diversas populações européias acontece o inverso: pessoas de olhos escuros constituem a minoria. Questão 932 Numa população em equilíbrio de Hardy-Weinberg. e) tratar-se de um caso de herança quantitativa.900 c) 4.550 d) 2. a freqüência de indivíduos do grupo M é 49%. a) 0.000 indivíduos.100 b) 4. 1.60 e 0. b) a mecanismo de herança da cor dos olhos não ser ainda bem conhecido. há certas proteínas no sangue que permitem classificar as pessoas como pertencentes ao tipo sangüíneo M. c) 0.48 e 0. b) 0.16. Um levantamento nos prontuários médicos de um importante hospital brasileiro identificou o grupo sangüíneo MN de 10. Essa diferença deve-se fato de a) a herança da cor dos olhos não obedecer às leis de Mendel.48.1.5.40. A análise da população estudada concluiu que a mesma se encontra em equilíbrio de Hardy-Weinberg. e) 0.

são condições para que..56 e 0. Em uma população que está 212 . (64) A população está em equilíbrio apenas quando 75% dos indivíduos apresentam o fenótipo D e 25% apresentam o fenótipo R. e fatores evolutivos . e) à oscilação genética. e das freqüências fenotípicas. b) às mutações que continua a sofrer.(3). d) ao seu efeito dominante.51 b) 0.6.. (02) No equilíbrio.. (04) Em uma amostra de 1000 indivíduos de uma população em equilíbrio. Se em uma dada população em equilíbrio de Hardy-Weinberg 9% dos indivíduos são albinos. ausentes e) Pequena..66 Questão 938 Uma população de roedor está sendo estudada quanto ao equilíbrio de Hardy-Weinberg para uma característica determinada por um locus autossômico. atuantes c) Infinitamente grande. numa população. o albinismo é determinado por um alelo autossômico recessivo. (32) Quando todas as freqüências genotípicas são iguais... 24 mil apresentam o genótipo AA e 36 mil apresentam o genótipo aa.34 e 0. direcionados. atuantes Questão 937 Em uma população composta de 100 mil indivíduos. ao acaso.. (08) Com informações sobre os valores das freqüências gênicas. uma geração. as freqüências gênicas e genotípicas se mantenham constantes ao longo das gerações.. p e q. O alelo recessivo a é responsável pelo fenótipo R e tem freqüência q. é correto afirmar que a freqüência dos alelos A e a será respectivamente: a) 0.49 e 0.. a população não está em equilíbrio. a freqüência esperada de heterozigotos normais é a) 91 % b) 75% c) 49% d) 42% e) 21% Questão 940 Um par de genes determina resistência a um fungo que ataca a cana-de-açúcar e os indivíduos suscetíveis (aa) apresentam freqüência de 0.(I).44 e 0. são esperados 160 indivíduos com o fenótipo R. (2) e (3): a) Infinitamente grande. pelo menos. a freqüência desse gene tende a aumentar devido a) ao fato de ser recessivo. Questão 936 Tamanho . os genótipos AA. Com base nesses dados. Aa e aa são encontrados com as freqüências p£. 2pq e q£.. Preenchem correta e respectivamente as lacunas (1). Com o tempo.44 e) 0. cruzamentos .. c) à seleção natural. com p=0.50 d) 0. atuantes b) Infinitamente grande.25. ao acaso. é possível determinar se a população está ou não em equilíbrio. Questão 939 Na espécie humana.. direcionados. Então. para essa característica.50 e 0. (16) O conhecimento das freqüências genotípicas é suficiente para se determinar a condição da população quanto ao equilíbrio. ausentes d) Pequena.. (01) A população está em equilíbrio se estiver ocorrendo seleção natural há. ao acaso.56 c) 0. de acordo com Hardy e Weinberg. assinale o que for correto.respectivamente. respectivamente. a) 9% e 42% b) 17% e 34% c) 18% e 21% d) 21% e 18% e) 34% e 17% Questão 935 Suponha que uma variedade de determinada planta possua um gene que lhe confere vantagem em relação a uma outra variedade da mesma população.(2). O alelo dominante A condiciona o fenótipo D e ocorre com a freqüência p.

c) 50%. A probabilidade de ocorrência de indivíduos heterozigotos nessa população é a) 84%. b) 40%. d) 30% dos gametas produzidos carregam o alelo recessivo. . 30% e 30%.000 sementes de uma população panmítica. que podem desaparecer. dos quais 45 apresentam um fenótipo determinado por gene recessivo. ( ) os cruzamentos. Um agricultor colheu 20. 10% e 10%. Questão 943 Uma população em equilíbrio é constituída de 500 indivíduos. os quais acarretam troca de alelos entre populações diferentes. nas populações. A partir dessas informações pode-se afirmar que a) a freqüência do gene para coloração amarela é de 36% nessa população. Questão 944 A cor da raiz da cenoura é controlada por um par de genes autossômicos. a freqüência de indivíduos Rh negativos é de 16%. e) 80%. segundo os referidos autores. 15% e 15%.em equilíbrio de Hardy-Weinberg. uma vez que esta tende a selecionar determinados alelos em detrimento de outros. 25% e 25%. as populações sejam panmíticas. ocorram ao acaso. d) a probabilidade de formação de gametas B é de 80% nessa população. b) a freqüência de heterozigotos nessa população é de 24%. permanecem constantes. e) os heterozigotos representam 42% da população. respectivamente. sob condições especiais. geração após geração. é necessário que: ( ) não haja pressão de seleção natural. Weinberg postularam que. c) 48%.5. que surjam por mutação. c) o gene dominante é mais freqüente que o recessivo. Para que isso ocorra. d) 36%. que se cruza ao acaso. 50% e 25%. Aa e aa é. A probabilidade de se encontrarem indivíduos AA. a) 25%. pela cor amarela. Com base nesses dados é INCORRETO afirmar-se que a) a freqüência de indivíduos com fenótipo dominante é 91% b) cerca de 10% da população é homozigota. ( ) os novos alelos. das quais 12. em uma população.7 Numa população em equilíbrio. c) a freqüência de plantas com raízes amarelas será de 64% se a população se mantiver em equilíbrio.800 desenvolveram plantas com raízes brancas. em que os casamentos ocorrem ao acaso e a freqüência dos genes A e a é de 50% para cada um. ( ) não ocorram fluxos migratórios. d) 70%. e de cada genótipo. Hardy e W. H. Questão 945 G. Aa e aa numa população em equilíbrio. ou seja. a freqüência de heterozigotos será: a) 15% b) 25% c) 50% d) 75% e) 100% Questão 941 O gráfico mostra as relações entre as freqüências dos alelos A e a e as freqüências genotípicas AA. Questão 942 Numa população em equilíbrio. se 213 1. as freqüências dos alelos. b) 60%. e) a probabilidade de ocorrência de homozigotos nessa população é de 52%. e) 24%. O gene B é responsável pela cor branca e seu alelo recessivo.

é necessário que a) a população seria infinitamente grande. a) Somente a afirmativa 1 é verdadeira. Assinale a alternativa correta. Questão 949 De acordo com a Teoria de Hardy-Weimberg. Questão 950 Numa população a freqüência do gene dominante W é 0. sendo a cor azulada determinada por um alelo recessivo e a cor castanha. utiliza-se a fórmula p£ + 2pq + q£ = 1. uma vez que as freqüências gênicas foram alteradas. Se houver 48 heterozigotos. d) a população está evoluindo. os cruzamentos ocorram ao acaso e esteja isenta de fatores evolutivos. tais como mutação. os cruzamentos ocorram de modo preferencial e esteja sujeita a fatores evolutivos. e) 1/2. Se houver 30 heterozigotos. A endogamia pode ser a causa do desvio em relação ao equilíbrio de Hardy-Weinberg. seleção natural e migrações. Em 214 . Ela não pode estar em equilíbrio de Hardy-Weinberg. d) 42/100. os cruzamentos ocorram ao acaso e esteja sujeita a fatores evolutivos. c) a população seria infinitamente grande. Se os valores das freqüências gênicas de uma população. seleção natural e migrações. b) 49/100. e) os cruzamentos nessa população ocorrem ao acaso. Com relação a essa população. considere as seguintes afirmativas: 1. seleção natural e migrações. inviabilizando a aplicação do teorema. os cruzamentos ocorram de modo preferencial e esteja isenta de fatores evolutivos. c) a população encontra-se em equilíbrio genético. tais como mutação. b) o tamanho da população seja reduzido.incorporem rapidamente ao estoque gênico. em uma população em equilíbrio genético as freqüências gênicas e genotípicas permanecem constantes ao longo das gerações. Questão 948 Em mexilhões. por um dominante. os cientistas Hardy e Weinberg formularam um teorema cuja importância está no fato dele estabelecer um modelo para o comportamento dos genes nas populações naturais. se houver 76 animais castanhos. d) Somente as afirmativas 2 e 4 são verdadeiras. A probabilidade de um indivíduo desta população ser heterozigoto Ww é igual a: a) 9/100. b) Somente as afirmativas 1 e 2 são verdadeiras. 3. Qual o percentual da população que possui a vantagem heterozigótica? a) 9% b) 19% c) 42% d) 81% e) 91% Questão 947 Em 1908. ela estará em equilíbrio de Hardy-Weinberg. pode-se concluir corretamente que: a) a população estudada é infinitamente grande. forem significativamente diferentes dos valores esperados através da aplicação do teorema. 9% nascem com anemia falciforme. Em uma população de cem animais. é possível que a seleção natural seja a causa do aumento do número de heterozigotos. Questão 951 No estudo da genética de populações. a partir de seu estabelecimento. c) 3/10. c) Somente as afirmativas 1 e 3 são verdadeiras. e) Somente as afirmativas 3 e 4 são verdadeiras. foram encontrados 16 azuis. ( ) nas populações demasiadamente pequenas. tais como mutação. 4. seleção natural e migrações. tais como mutação. b) não houve a atuação dos fatores evolutivos sobre a população. 2. observada ao longo de gerações. os cruzamentos sejam ao acaso. Questão 946 Numa certa população de africanos. na qual p indica a freqüência do alelo dominante e q indica a freqüência do alelo recessivo.7. as cores externas das conchas são determinadas por dois alelos de um gene. d) a população seja de tamanho reduzido. Para tanto.

Aa .0. aa . seja igual a 1.18.0.09. e) 42%. estudou a estrutura da molécula de DNA e seu funcionamento e analisou os dados do quadro a seguir. b) haja manutenção do tamanho da população ao longo das gerações.5. a freqüência dos indivíduos do grupo MN dessa população é de: a) 79%.81.0. terapia gênica.0.25. c) reproduzam-se. numa porcentagem de 9%. serão: a) AA . produzindo células defeituosas incapazes de sobreviver.72.50. Aa . c) 50%. aa .01 b) AA . Aa . aa . numa população.5 e o genótipo homozigoto recessivo tenha freqüência q£=0.0. é 0.9.0. Assim.18. e) ocorra manutenção das mesmas freqüências genotípicas ao longo das gerações.1 e) AA . Questão 952 Sabendo-se que a freqüência de um gene recessivo a.0.1 d) AA . c) os alelos que expressam fenótipos mais adaptativos sejam favorecidos por seleção natural.0. Para conseguir entender as notícias.uma população em equilíbrio de Hardy-Weinberg espera-se que a) o genótipo homozigoto dominante tenha freqüência p£=0.25. 1. 1. aa . as freqüências genotípicas esperadas para essa população.0.1. engenharia genética. Aa . ou dos diferentes genótipos.09. o genótipo heterozigoto tenha freqüência 2pq=0.0. Questão 954 Cientistas conseguiram inserir um grande trecho de ADN estranho ao ADN de cobaias como mostra o desenho a seguir: O resultado esperado para este trabalho é que as células que receberam o implante: a) morram pela presença de ácido nucléico estranho à composição do núcleo. b) 61%. aa .8. Verificou-se que existiam. etc.5.01 c) AA .8. d) reproduzam-se.0. d) 49%. e) cresçam.25. transferindo as características implantadas para as células-filhas. se estiver em equilíbrio. Aa .0. b) morram por ficarem prejudicadas na realização da síntese protéica.25 Questão 953 Os grupos sanguíneos de uma população foram estudados no que se refere ao sistema MN dos seus indivíduos. testes de paternidade.1 Questão 955 João ficou intrigado com a grande quantidade de notícias envolvendo DNA: clonagem da ovelha Dolly. produzindo anticorpos contra as proteínas estranhas que serão fabricadas.1 215 .0.0. portadores de sangue do tipo N.0.81. d) a somatória da freqüência dos diferentes alelos.

5. C = 60%. citosina e guanina.nalisando-se o DNA de um animal. estudou a estrutura da molécula de DNA e seu funcionamento e analisou os dados do quadro a seguir. d) na molécula de DNA. citosina.8. o que garante a diversidade da vida. Para conseguir entender as notícias. e é formada por cadeias polinucleotídicas que apresentam em sua composição as bases nitrogenadas adenina. guanina e timina. pode-se concluir que: a) a molécula de DNA é formada por 2 cadeias caracterizadas por seqüências de bases nitrogenadas. terapia gênica. cada molécula de DNA dá origem a 4 moléculas de DNA exatamente iguais. sendo responsável pelo controle do seu metabolismo. podem existir diferentes tipos de complementação de bases nitrogenadas. Questão 957 A identificação da estrutura do DNA foi fundamental para compreender seu papel na continuidade da vida. e é formada por cadeias polipeptídicas que apresentam em sua composição os aminoácidos adenina. Essa substância se denomina a) DNA. pois essas células são responsáveis pela perpetuação das espécies. timina. c) a quantidade de A presente em uma das cadeias é exatamente igual à quantidade de A da cadeia complementar. os valores encontrados para as outras bases nitrogenadas foram: a) T = 40%. C = 40%. comparação das proporções permitiu concluir que ocorre emparelhamento entre as bases nitrogenadas e que elas formam a) pares de mesmo tipo em todas as espécies. G = 40% b) T = 10%. engenharia genética. b) DNA. um estudo pioneiro determinou a proporção das bases nitrogenadas que compõem moléculas de DNA de várias espécies.1 1. b) na molécula de DNA.5. C = 10%. pois esses organismos são formados por uma única célula. G = 40% c) T = 10%. procariontes e eucariontes. podem existir 5 diferentes tipos de bases nitrogenadas. c) RNA. e) pares específicos somente nas bactérias. detectou-se que 40% de suas bases nitrogenadas eram constituídas por Adenina. C = 10%. uracila. evidenciando a universalidade da estrutura do DNA. Questão 958 As técnicas utilizadas pela Engenharia Genética permitem que se atue em uma substância presente em todas as células. e) no processo de mitose. Na década de 1950.1 m I está representado o trecho de uma molécula de DNA. etc. 1. 216 . como resultado da diferenciação celular. citosina e guanina. C = 20%. testes de paternidade. e é formada por cadeias polinucleotídicas que apresentam em sua composição as bases nitrogenadas adenina. Relacionando esse valor com o emparelhamento específico das bases. Observando o quadro. c) pares diferentes em diferentes células de uma espécie. d) pares específicos apenas nos gametas. G = 10% d) T = 40%. G = 60% Questão 956 João ficou intrigado com a grande quantidade de notícias envolvendo DNA: clonagem da ovelha Dolly. b) pares diferentes de acordo com a espécie considerada.8. G = 10% e) T = 40%.

b) guanina e timina.0 Questão 962 Bactérias foram cultivadas em um meio nutritivo contendo timina radioativa. Nela identificamos 20% de adenina. Dessa cultura.0 b) 21. a) A molécula de DNA é constituída por uma fita única e por vários nucleotídeos que têm a transcrição como principal função. c) possuírem cromossomos diferentes. novos métodos de diagnóstico foram desenvolvidos e utilizados para inúmeros fins (identificação de microrganismos patogênicos. d) A molécula de DNA tem função de duplicação e é constituída por uma fita dupla. Questão 959 Uma molécula de DNA apresenta uma dupla hélice de cadeias polinucleotídicas.4% ? Guanina ? 21. Essas bactérias sofreram três divisões no novo meio. b) A molécula de DNA nas bactérias se encontra na carioteca da célula. nos DNAs do homem e do boi. células musculares e células nervosas diferem principalmente por: a) possuírem genes diferentes. e é formada por aminoácidos que apresentam em sua composição a desoxirribose. foram isoladas 100 bactérias e transferidas para um meio sem substâncias radioativas.4 e 21. Assinale a alternativa correta em relação à porcentagem de guanina. b) possuírem ribossomos diferentes. Questão 963 Em um organismo. testes de paternidade. medicina forense.d) polimerase. c) A molécula de DNA não é capaz de produzir a molécula de RNA. c) citosina e guanina.6 e 21. adenina e guanina.0 e) 30. e) citosina e uracila. a) 20% b) 30% c) 40% d) 50% e) 60% Questão 960 Depois da descoberta da estrutura da molécula do Ácido Desoxirribonucléico (DNA ou ADN). c) 400 apresentavam o DNA marcado. mapa genético. não se encontra no núcleo da célula. e) transcriptase. d) adenina e timina. mas não o RNA. Adenina 30. mas não o RNA. d) expressarem genes diferentes.0% As porcentagens que estão faltando para o homem e para o boi são. por centenas de gerações. e é formada por aminoácidos que apresentam em sua composição a ribose. entre outros).4 d) 19. sendo que cada filamento é composto por vários nucleotídeos. d) 200 apresentavam o DNA e o RNA marcados.0 e 30.6 e 29. Questão 964 Um pesquisador que pretende estudar comparativamente a síntese de DNA e RNA em uma célula deve usar nucleotídios radiativos contendo a) timina e uracila. e) todas apresentavam o DNA e o RNA marcados. nos organismos eucariontes. b) 200 apresentavam o DNA marcado. e) utilizarem código genético diferente.4 c) 29. A análise dos ácidos nucléicos mostrou que dessas 800 bactérias a) 100 apresentavam o DNA marcado. Questão 961 A tabela mostra a composição das bases nitrogenadas púricas. Assinale a afirmação correta. Homem Boi 217 . mas não o RNA. respectivamente: a) 19.0 e 30. produzindo 800 bactérias. e) A molécula de DNA.

d) ácido fosfórico só entra na composição química do DNA. c) guanina é igual a de citosina. b) uracila é uma base nitrogenada exclusiva do DNA. Questão 970 Sobre o DNA. respectivamente a) desoxirribose. a quantidade de a) adenina é igual a de citosina. ribose e base nitrogenada. ácido fosfórico e base nitrogenada. e) é formado de dupla cadeia com formato helicoidal. d) é integrante do nucléolo e dos ribossomos. Questão 971 Sobre o DNA. b) não origina o RNA mensageiro c) não é capaz de replicar-se. b) ligações iônicas. c) ribose é um açúcar que entra na composição química do RNA. .8. c) ribose. e) timina pareia com adenina no RNA. c) púricos pareiam com outros púricos. desoxirribose e base nitrogenada.1 Questão 967 Numa molécula de DNA. O fato nos permite afirmar que os nucleotídeos a) ocorrem em igual quantidade. b) citosina é igual a de timina. c) pontes de hidrogênio. d) pirimídicos pareiam com outros pirimídicos. base nitrogenada e desoxirribose. b) ocorrem aos pares na molécula de DNA. d) é integrante dos genes e dos cromossomos. ácido fosfórico e base nitrogenada. b) ácido fosfórico. 218 1. é CORRETO afirmar que a) possui a base nitrogenada uracila. Questão 966 Na figura a seguir que representa o modelo da molécula de DNA os números 1. d) citosina é igual a de adenina. Questão 972 O DNA e o RNA quanto à sua estrutura química. e) adenina é igual a de uracila. e) ácido fosfórico. d) pontes de nitrogênio. é INCORRETO afirmar que a) possui a base nitrogenada uracila.Questão 965 Importante informação que permitiu o estabelecimento de um modelo para a molécula de DNA foi a verificação de que o número de adenina-nucleotídeos era sempre igual ao de timina-nucleotídeos. e) ligam-se como se fossem o corrimão de uma escada. d) ácido fosfórico. Questão 969 Moléculas de DNA constituídas por duplo filamento helicoidal mantêm as cadeias unidas entre si por a) ligações covalentes. o mesmo ocorrendo com a guanina e citosina-nucleotídeos. e) é formado de dupla cadeia com formato helicoidal. b) nucleoproteínas. Questão 968 Comparando as estruturas dos ácidos nucléicos desoxirribonucléico (DNA) e ribonucléico (RNA) pode-se afirmar que a) timina é uma base nitrogenada exclusiva do RNA. c) polissacarídeos.5. são classificados como a) polipeptídeos. b) origina o RNA mensageiro c) reproduz-se de modo semiconservativo. 2 e 3 indicam. e) ligação metálica.

b) uracila é uma base nitrogenada exclusiva do DNA. d) Uracila. b) UUT GGC TUU UAC. desoxirribose e ácido fosfórico. a quantidade de a) adenina é igual a de citosina. b) ácido fosfórico. c) guanina é igual a de adenina. c) TTA CCG ATT ATG. e) mitocôndria e cloroplasto. d) ácido fosfórico. e) Guanina. c) Ácido fosfórico. b) Citosina. e) timina pareia com adenina no DNA. c) Adenina. d) citosina é igual a de adenina. Questão 975 Se um segmento de DNA possui a seqüência de bases nitrogenadas TTA CCG ATT ATG.1 219 . d) Adenina. e) base nitrogenada. Questão 973 Qual das seguintes bases nitrogenadas NÃO entra na composição química do DNA? a) Timina. Questão 977 Na molécula de DNA. Questão 976 Observa-se a presença de DNA nos seguintes organóides citoplasmáticos a) mitocôndria e ribossomo. Questão 979 Assinale a alternativa que relaciona corretamente o nome das moléculas representadas pelos números 1. e) adenina é igual a de timina. respectivamente.d) fosfatídeos.5. d) AAT GGC TAA UAC. c) desoxirribose. e) Guanina. Questão 978 Comparando as estruturas dos ácidos desoxirribonucléico (DNA) e ribonucléico (RNA) NÃO se pode afirmar que a) timina é uma base nitrogenada exclusiva do DNA. b) ribossomo e cromossomo.8. d) lisossomo e ribossomo. e) polinucleotídeos. e) AAU GGC UAA UAC. b) Desoxirribose. pode-se afirmar que a cadeia complementar a esse segmento terá a seqüência a) AAT GGC TAA TAC. ribose e base nitrogenada. a) base nitrogenada. c) nucléolo e cloroplasto. sabendo-se que a figura adiante representa a unidade estrutural do ácido desoxirribonucléico (DNA). c) ribose é um açúcar que entra na composição química do RNA. d) ácido fosfórico entra na composição química do DNA e do RNA. 2 e 3. Questão 974 Qual das seguintes moléculas NÃO entra na composição química do DNA? a) Ribose. 1. b) citosina é igual a de timina. desoxirribose e base nitrogenada. ribose e ácido fosfórico. base nitrogenada e ácido fosfórico.

cromossomos e complexo de Golgi. d) liquens. Timina = 34% e Adenina = 16% Questão 984 Numa molécula de DNA formada por uma dupla-hélice a quantidade de a) adenina é igual a de citosina. centríolos e cromossomos. Citosina = 40% e Timina = 40% e) Adenina = 40%. c) ausência de ácido fosfórico. b) polipeptídeos. cromossomos e mitocôndrias. Timina = 16% e Adenina = 16% b) Guanina = 16%. Questão 985 Assinale a alternativa que relaciona as estruturas celulares em se observa a presença de DNA: a) membrana plasmática. e) vacúolos. b) presença das bases nitrogenadas uracila. c) ácaros. Assinale a alternativa que relaciona corretamente as outras bases nitrogenadas e suas respectivas proporções: a) Citosina = 15%. Citosina = 30% e Timina = 30% d) Adenina = 30%. Adenina = 35% e Timina = 35% e) Citosina = 15%. d) citosina é igual a de adenina. Citosina = 20% e Timina = 30% b) Adenina = 20%. ribossomos e cromossomos. Crick em 1953. e) lisossomos. Questão 987 As evidências de que o DNA é a substância hereditária que determina as características dos seres vivos foram primeiramente observadas em a) vírus. Adenina = 15% e Timina = 15% c) Citosina = 15%. centríolos e lisossomos. complexo de Golgi e ribossomos Questão 986 Sabemos que os genes são constituídos de DNA e estão localizados nas seguintes estruturas celulares: a) lisossomos. c) adenina é igual a de uracila. Questão 988 Num dado organismo. Questão 982 Uma molécula de DNA contém 15% de Guanina. b) centríolos. b) cloroplastos. Adenina = 15% e Timina = 35% Questão 983 Uma molécula de DNA contém 16% de Citosina.Questão 980 O modelo molecular dos ácidos nucléicos (DNA e RNA) foi proposto por J. Timina = 34% e Adenina = 16% e) Guanina = 34%. cromossomos e lisossomos. ribossomos e centríolos. Questão 981 É característica do DNA: a) açúcar com quatro átomos de carbono. Citosina = 30% e Timina = 20% c) Adenina = 30%. d) enzimas. Segundo esse modelo esses ácidos são a) micromoléculas. d) ser um polipeptídeo. Adenina = 35% e Timina = 15% d) Citosina = 15%. e) guanina é igual a de citosina. Watson e F. c) retículo endoplasmático. c) polinucleotídeos. c) ribossomos. a) Adenina = 20%. complexo de Golgi e cromossomos. citosina e adenina. b) citosina é igual a de timina. e) ocorre nos cromossomos. Timina = 16% e Adenina = 16% d) Guanina = 34%. Assinale a alternativa que contém a porcentagem correta de cada uma das demais bases nitrogenadas. e) bactérias. o conteúdo de guanina no seu DNA é 30%. Adenina = 15% e Timina = 15% b) Citosina = 35%. d) membrana plasmática. Assinale a alternativa que relaciona corretamente as outras bases nitrogenadas e suas respectivas proporções? a) Guanina = 16%. mitocôndrias e cromossomos. guanina. Citosina = 30% e Timina = 40% 220 . e) lipídios. b) protozoários. Timina = 34% e Adenina = 34% c) Guanina = 34%. d) cloroplastos.

e) há grande multiplicação do DNA viral no interior da bactéria. c) I. Uma de suas bases nitrogenadas é a timina. IV. c) o DNA viral é destruído pela bactéria. estaríamos verificando a ocorrência de a) crossing-over.a d) II . d) inversão. Possui capacidade de autoduplicação.5. e) I.b b) I . Questão 991 Os itens abaixo se referem aos ácidos nucléicos: Estrutura I. 1.8. Cadeia simples II. somente. São corretas a) II e III.Questão 989 O esquema a seguir mostra um tipo de ciclo reprodutivo dos bacteriófagos. d) II. obtido de um dos cromossomos X de cada mulher e da menina. somente.b e acordo com o esquema. Seu açúcar é a desoxirribose. b) duplicação. É constituído por uma única cadeia de nucleotídeos.a c) II .a e) I . Questão 990 Considere as características do DNA abaixo discriminadas. III e IV. Síntese protéica São características do ácido desoxirribonucléico (DNA): 1. quebram-se e voltam a se soldar. III. somente. e) deleção. d) as bactérias perdem a capacidade de se dividir. Com Uracila Função a. verifica-se que a) ocorre lise da bactéria no fim do ciclo.5. Questão 993 Duas mulheres disputam a maternidade de uma menina. c) translocação.1 221 . II.2 .8. Transcrição b. Com Timina 2. II. I. porém com os segmentos trocados. As seqüências de bases do referido trecho gênico estão esquematizadas adiante: 1. b) o DNA viral se incorpora ao cromossomo bacteriano. III e IV. Foi realizada a análise de um mesmo trecho do DNA.1 . somente.2 . III e IV.1 . de uma mesma célula. Dupla hélice Composição Questão 992 Supondo que ocorra um evento genético raro em que dois cromossomos não-homólogos. b) II e IV.1 .1 a) II .

Questão 994 Com relação à composição química. RNA mensageiro e DNA. DNA e RNA. apenas. no segmento correspondente da cadeia complementar há 10 adeninas e 30 guaninas. b) as moléculas do ácido ribonucléico (RNA) são hélices duplas de polirribonucleotídeos. 10/08/97) Sabe-se que o citado mapeamento é feito a partir do conhecimento da seqüência de bases do DNA.. c) não são suficientes. já é possível detectar por meio de exames de DNA (ácido desoxirribonucleico) a probabilidade de uma pessoa desenvolver doenças (. Questão 996 Considere que um cientista esteja. d) base nitrogenada e de fosfato. timina. e) não podem ser considerados. corretamente. pois o cromossomo X da menina analisado pode ser o de origem paterna. a) Quatro diferentes tipos de nucleotídeos. transportador e ribossômico) e DNA. Questão 997 TESTES GENÉTICOS: A Ciência se antecipa à doença Com o avanço no mapeamento de 100 mil genes dos 23 pares de cromossomos do núcleo da célula (projeto Genoma. as moléculas imprescindíveis que ele deve utilizar para que possa atingir o seu objetivo. d) não são suficientes.1 Questão 998 Tendo em vista a estrutura e a função dos ácidos nucléicos. guanina. Com base nos conhecimentos sobre o tema.Os dados obtidos a) são suficientes para excluir a possibilidade de qualquer uma das mulheres ser a mãe da menina. e) As enzimas RNA e DNA polimerase. apenas. DNA e RNA.. assinale a alternativa que indica. a enzima RNA polimerase. iniciado em 1990. contendo as bases nitrogenadas adenina. Questão 995 Em um segmento de cadeia ativa de DNA há 20 adeninas e 15 guaninas. apenas. b) base nitrogenada. pois a menina recebe seus dois cromossomos X da mãe e apenas um deles foi analisado. e) base nitrogenada. conclui-se que nos segmentos de RNA originários desse DNA haverá a) 30 citosinas. b) 20 timinas. as moléculas de DNA e RNA diferem entre si quanto ao tipo de a) açúcar. b) são suficientes para excluir a possibilidade de uma das mulheres ser a mãe da menina. vinte tipos diferentes de aminoácidos. só existe um gene para cada molécula de DNA. é correto afirmar que: a) todas as trincas da molécula do mRNA especificam algum aminoácido. nos EUA). Com base nesses dados. d) 10 uracilas. c) As enzimas RNA e DNA polimerase. b) Os nucleotídeos contendo as bases nitrogenadas timina. citosina e guanina. adenina e citosina. d) as estruturas espaciais e moleculares do DNA e RNA são 222 . pois uma menina não recebe cromossomo X de sua mãe. tentando reproduzir "in vitro" a síntese de moléculas de DNA. c) 15 guaninas. é: 1. c) em todos os organismos. em um laboratório.). d) A enzima DNA polimerase. (O GLOBO. os vinte tipos diferentes de aminoácidos.5. de açúcar e de fosfato. a enzima DNA polimerase e DNA. O esquema abaixo que representa o pareamento típicos de bases encontradas na molécula de DNA. os três tipos de RNA (mensageiro. e) 10 adeninas. apenas. c) base nitrogenada e de açúcar.8.

8. codificam proteínas. Questão 1002 Um laboratório recebeu três amostras de DNA para investigar se pertenciam a espécies diferentes. que podem ser observadas nestas representações esquemáticas: 1. Questão 1001 Células provenientes de um indivíduo foram examinadas ao microscópio e revelaram diferenças estruturais. 07/07/2006.1 odas as alternativas apresentam diferenças entre essas células. é possível afirmar corretamente que: a) seus genes estavam dispostos em cromossomos circulares. ribose e fosfato. Questão 1000 Sabe-se que o homem possui em torno de 80. após a diferenciação e a especialização das células. Considerando-se essa informação e conhecimento sobre o assunto. EXCETO a) Forma ou localização dos seus núcleos.8. b) o número total de genes.diferentes. e) as duas metades da hélice dupla do DNA têm seqüências iguais de bases nitrogenadas. reduz-se. A inferência vem diretamente do DNA do mamute-lanoso ('Mammuthus primigenius'). d) Tecidos a que pertencem. Questão 999 Leia o texto a seguir.5. É uma das primeiras vezes em que os genes de um bicho extinto dão pistas sobre características suas em vida. que. O mamífero-símbolo da Idade do Gelo provavelmente tinha dois tipos de pelagem: castanho-escuro e loiro. b) Funções que realizam. de exemplares mortos há 43 mil anos na Sibéria. c) Genes que possuem. d) os genes responsáveis pelo sistema sangüíneo ABO estão presentes nas células epiteliais. sugere análise de DNA. "Folha de São Paulo". c) seus genes estavam organizados nos plasmídeos. Mamutes podem ter tido pêlo "loiro".1 223 . c) os genes cuja atividade não é necessária ao funcionamento de uma célula perdem a capacidade de duplicação.000 genes.5. b) seu DNA era composto por bases nitrogenadas. é CORRETO afirmar que a) o genótipo das células do tecido nervoso é diferente do genótipo das células do tecido epitelial. d) suas moléculas de DNA apresentavam estrutura helicoidal. e) seus genes para o tipo de pelagem localizavam-se no DNA mitocondrial. entre outras funções. mas são incapazes de se expressar. A quantidade e a relação entre as bases das amostras estão apresentadas nesta tabela: 1. Em relação às características genéticas deste mamífero.

om base nas informações dessa tabela e em outros conhecimentos sobre o assunto.1 224 . ( ) metade das moléculas da geração F2 terão a densidade leve e apenas 12. como foi antecipado por Watson e Crick.6 e 29. 1.6 e21.8. ( ) a tendência da fita de DNA pesada é desaparecer no decorrer das gerações. em 1957.5.0 e 30. que as fitas de DNA serviam de modelo para sua própria replicação. cultivaram. conforme esquematizado abaixo. b) 21.F2 e F3).4 % Guanina = ? Cão: Adenina = ? Guanina = 21. Posteriormente.5% terão a densidade intermediária em F3. respectivamente: a) 19. analise as proposições a seguir. c) 29.4.8.0. Questão 1004 Meselson e Stahl. cresceram diversas gerações das bactérias em N¢¥ (isótopo leve) e extraíram o DNA das sucessivas gerações (gerações F0.0 e 30.5.0. d) as amostras 1 e 3 apresentam alta homologia entre seus DNAs. é INCORRETO afirmar que a) as três amostras são provenientes de diferentes espécies. b) a amostra 3 possui o mais alto conteúdo de pares de bases A e T. F1 .1 A partir desse experimento pode-se afirmar que: ( ) todas as moléculas da geração F1 terão a densidade intermediária entre a pesada e a leve. d) 19. 1.4 e 21. ( ) eles concluíram. c) a amostra 2 apresenta DNA de fita simples.0 % As percentagens que estão faltando para o homem e cão são. Questão 1003 A composição das bases púricas adenina e guanina do DNA do homem e do cão são as seguintes: Homem: Adenina = 30. mediante precipitação baseada em suas diferentes densidades.0. Questão 1005 Considerando que na figura a seguir tem-se uma representação plana de um segmento da molécula de DNA. 'Escherichia coli' (geração F0) na presença de N¢¦ (isótopo pesado). ( ) A composição do meio de cultura não exerceu influência no experimento uma vez que a bactéria cresceu em todos os meios. inicialmente. e) 30.4.

Posteriormente. o qual se incorporou nas moléculas de DNA.. c) Um gene é uma proteína que tem função específica em uma determinada rota metabólica. cerca de 1/4 do DNA será híbrido. Rio de Janeiro: Guanabara Koogan. onde existia o ¢¥N como única forma de nitrogênio. pode-se prever que. plantas que adquirem resistência ao frio por expressar genes anticongelantes de peixes. nesse novo meio. mas hoje as mesmas técnicas estão . 2. Assinale a alternativa que define o que é um gene. b) ao término da 1 geração. e) Um gene é uma cadeia de aminoácidos que codifica o código genético. a) 1 apenas b) 2 e 3 apenas c) 1. c) ao término da 2 geração. resultando em tipos criados que nunca poderiam ter sido produzidos com a genética clássica. os cientistas produziram plantas que brilham porque expressam os genes de bioluminescência dos vaga-lumes. todas as moléculas de DNA apresentarão apenas ¢¥N incorporado. serão formadas moléculas de DNA apenas com ¢¦N e moléculas apenas com ¢¥N. b) Um gene é um segmento do DNA que contém a informação necessária para a produção de uma determinada proteína. 3) Um nucleotídeo com Guanina (G) em uma cadeia pareia com um nucleotídeo com Citosina (C) em outra cadeia. uma molécula do açúcar desoxirribose (II) e uma molécula de base nitrogenada.) Um nucleotídeo é formado por um grupo fosfato (I). 6 ed. Em relação ao experimento. Está(ão) correta(s).8.) Com a capacidade de mover genes de um organismo para outro. 1998) O texto acima se refere a organismos transgênicos. sendo o restante não-híbrido. a) ao final da 1 geração. sendo uma híbrida e outra não. 4) Pontes de hidrogênio se estabelecem entre as bases nitrogenadas T e A e entre as bases nitrogenadas C e G. 3 e 4 apenas e) 1. e camundongos gigante que expressam os genes do hormônio de crescimento de ratos.F.." (Griffiths. sendo aplicadas a plantas e animais. Questão 1008 Gerações sucessivas de bactérias da espécie 'Escherichia coli' foram cultivadas num meio cuja única fonte de nitrogênio era o isótopo ¢¦N. 2 e 3 apenas d) 2. para cultivo. d) ao final da 2 geração. cada molécula híbrida de DNA formará duas moléculas.5. A. essas bactérias foram transferidas para um novo meio.J. (. 3 e 4 Questão 1006 Na figura a seguir é ilustrado um processo muito importante para a vida. A obtenção dessas plantas se deve à biotecnologia. et al.1 a) Produção de proteína b) Transcrição do RNA c) Produção de RNAribossômico d) Helicoidização do DNA e) Replicação do DNA Questão 1007 Um tema que vem despertando grande polêmica no Brasil atualmente é a liberação. de plantas transgênicas. 225 1. d) Um gene é uma molécula de RNA que atua diretamente na síntese protéica. "A biotecnologia de genética molecular foi inicialmente aplicada a micróbios. Analise-o e assinale a alternativa que indica corretamente qual é este processo. "Introdução à Genética". 2) Um nucleotídeo com Timina (T) em uma cadeia pareia com um nucleotídeo com Adenina (A) em outra cadeia. que são aqueles em cujo genoma foi introduzido um gene de uma outra espécie ou mesmo um gene produzido em laboratório. a) Um gene é um cromossomo da célula vegetal ou animal.

Adaptado de SALZANO.1 . em meio contendo um isótopo pesado de nitrogênio. ¢¦N.1 . c) Apenas III. ( ) bases nitrogenadas: adenina.2 . e) não ocorreu replicação do DNA mas.2 . Considere as seguintes afirmações.2 . 1. sim.No código genético. Nesse experimento. d) não ocorreu replicação do DNA mas.2 .2 .1 . timina. ele comparou 21 genomas completos de representantes das três linhagens primárias da vida: as eubactérias.1 Com relação a esses dados. O resultado da pesquisa mostrou que o número de genes deve situar-se em torno de 150. Julgue os itens a seguir. "Ciência Hoje". podemos concluir que a) a replicação do DNA é semiconservativa. tem-se constatado um progresso fantasticamente acelerado da Biologia Molecular.8. Questão 1010 Leia o texto abaixo. Questão 1011 Numere a 2 coluna de acordo com a 1 COLUNA 1 1. d) 2 .1 . uma mutação. b) Apenas II. a cada códon deve corresponder mais de um aminoácido.Os genes envolvidos na replicação. 29. 226 . sim. c) 1 .Questão 1009 Meselson e Stahl. fizeram um experimento sobre a replicação do DNA. Koonin investigar qual seria o número mínimo de genes capazes de sustentar o funcionamento de uma célula. transcrição. F.5.RNA COLUNA 2 ( ) dupla hélice ( ) ribose ( ) fita única ou simples ( ) desoxirribose ( ) bases nitrogenadas: adenina. uracila A seqüência correta é a) 1 . d) Apenas II e III. acerca do referido ácido nucléico. até todo o seu DNA estar marcado com esse isótopo. e) I. c) a replicação do DNA é randômica. guanina. Quais delas poderiam ter embasado o raciocínio de Koonin? a) Apenas I. a bactéria 'Escherichia coli' foi cultivada.DNA 2. Esse enfoque é interessante. citosina.2 . 173. em 1957.2 . 2001. b) 2 . Questão 1012 Desde que Watson e Crick propuseram um modelo para a estrutura do DNA. sendo observado o seguinte: I . II e III.M. n. citosina. Para isso. e) 1 .2 .2 . em 1953. III .1 .2 .2.2.1 . do que é exemplo a recente clonagem de uma ovelha. II . por muitas gerações.1 . guanina.1 . A entrada na era da genômica possibilitou ao norte-americano Eugene V. as arqueobactérias e os eucariontes.2 . pois permite imaginar os primeiros sistemas genéticos surgidos por ocasião da origem da vida.Os genes compartilhados pelos genomas dos diferentes grupos devem ser essenciais. v. as bactérias foram transferidas para um meio contendo nitrogênio leve. transcrição e tradução do material genético devem fazer parte do conjunto mínimo de genes. ¢¥N.1.2.1 . As moléculas de DNA das bactérias foram então isoladas e analisadas com relação ao seu conteúdo de ¢¦N e de ¢¥N.1. Depois disso. b) a replicação do DNA é conservativa. jul.

Tais conclusões são possíveis com base em estudos moleculares. apenas. à 2 lei de Mendel. Genes localizados em regiões próximas de um mesmo cromossomo implicam em distorções das proporções mendelianas. Questão 1013 A partir dos anos 1900. à 2 lei de Mendel. enquanto a contribuição genética de povos indígenas e africanos deu-se por meio das mulheres. e) X e mitocondrial. Questão 1014 No artigo "Retrato molecular do Brasil" ("Ciência Hoje". II. e) II e V. (2) A coloração de cromossomos com vários matizes é uma técnica atual que se baseia no uso de vários corantes para os diferentes lipídios que constituem os cromossomos. (4) As mutações gênicas implicam necessariamente a modificação do fenótipo do indivíduo. b) a presença das bases nitrogenadas uracila. um segmento de DNA que corresponde a um gene funcional. citosina e adenina. guanina. 2001). a segregação de cromossomos homólogos que apresentam os mesmos alelos resulta nas proporções da geração F2 dos experimentos de Mendel. em efeito. II. II. d) Y e mitocondrial. c) Y e do cromossomo X. em efeito.(1) Apesar de ser o sexto elemento mais abundante no universo e o mais versátil de todos. Na meiose I. respectivamente. Sérgio Penna. à 1 lei de Mendel. a segregação dos homólogos de um par cromossômico corresponde. Na meiose II. ocorre a troca de. do DNA do cromossomo a) X e de autossomos. b) I. São afirmações corretas: a) I. Questão 1015 Não é característica do DNA: a) o açúcar com cinco átomos de carbono. III. I. o carbono não faz parte da estrutura do DNA. pesquisador da Universidade Federal de Minas Gerais. a segregação dos homólogos dos diferentes pares cromossômicos correspondem. b) Y e de autossomos. no mínimo. e) ocorre nos cromossomos. Na meiose I. III e V. a mãe transmite maior quantidade de DNA para o filho do que o pai. Questão 1016 O estudo do mecanismo da síntese de proteínas no interior das células confirma que: a) a transcrição gênica caracteriza-se pela autoduplicação do DNA b) três tipos de RNA participam do processo c) os anticódons localizam-se no RNA-m d) os códons são trincas de bases nitrogenadas do RNA-t e) não há evidências que permitam aceitar que o código genético seja considerado degenerado Questão 1017 Uma molécula de RNA mensageiro apresenta a seguinte seqüência de bases nitrogenadas: UUU GUG CCC AAC Assinale a alternativa que contém a seqüência de bases do segmento da molécula de DNA que deu origem a esse 227 . IV e V. IV e V. apenas. d) I. uma série de observações e experimentos indicaram uma correlação entre o comportamento dos cromossomos na célula em divisão e as leis mendelianas. (3) No processo de recombinação entre cromátides. V. apenas. III. Analise cada uma das afirmações seguintes. a segregação das cromátides dos diferentes pares cromossômicos corresponde. c) I. c) a presença de ácido fosfórico. apenas. II. (5) Nos processos de fecundação natural. em efeito. d) é polinucleotídeo. Na meiose I. II e IV. revelou que a contribuição dos europeus na composição genética do povo brasileiro fez-se basicamente por meio de indivíduos do sexo masculino. IV.

5. d) Uracila. d) é traduzido em proteínas nos ribossomos. ácido fosfórico e base nitrogenada. e) é formado de simples cadeia com formato helicoidal.2 Questão 1019 Sobre o RNA. respectivamente a) desoxirribose. 1. c) ribose.RNA. é INCORRETO afirmar que a) possui a base nitrogenada uracila. 2 e 3 indicam. ribose e base nitrogenada. base nitrogenada e desoxirribose. . Questão 1020 Qual das seguintes bases nitrogenadas NÃO entra na composição química do RNA? a) Timina. e) ácido fosfórico. e) ácido fosfórico. os números 1.2 1. b) participa da estrutura dos ribossomos. respectivamente: a) desoxirribose. ribose e base nitrogenada. b) Desoxirribose. c) Adenina. d) Adenina. a) AAA CAC GGG TTA b) TTT CAC GGG UUT c) AAA CTC GGG TTT d) TTT GAG GGG TTA e) AAA CAC CCC UUA 228 Questão 1023 Uma molécula de RNA mensageiro apresenta a seguinte seqüência de bases nitrogenadas: UUU GUG CCC AAU. ácido fosfórico e base nitrogenada.8. c) Ácido fosfórico. Questão 1021 Qual das seguintes moléculas NÃO entra na composição química do RNA? a) Ribose. e) Guanina. ácido fosfórico e base nitrogenada. Questão 1022 No modelo molecular do ácido ribonucléico (RNA) representado adiante.8. ácido fosfórico e base nitrogenada. 2 e 3 indicam. d) ácido fosfórico. desoxirribose e base nitrogenada. c) ribose. base nitrogenada e desoxirribose. d) ácido fosfórico. c) reproduz-se de modo semiconservativo. e) Guanina. desoxirribose e base nitrogenada. b) Citosina. a) AAA CAC GGG TTG b) TTT CAC GGG UUG c) AAA CTC GGG TTG d) TTT GAG GGG TTG e) AAA CAC CCC UUG Questão 1018 Na figura a seguir que representa o modelo da molécula de RNA os números 1. b) ácido fosfórico. Assinale a alternativa que contém a seqüência de bases do segmento da molécula de DNA que deu origem a esse RNA. b) ácido fosfórico.5.

Leu .Val .Val .Ile . composição e função dos ácidos nucléicos.Cis .3 e um RNA mensageiro apresenta a seqüência de bases AUU AGA UGU GUU UUA.b e) II . presença de uracila 2.pode existir mais de um códon para determinar um mesmo aminoácido. e) ocorrer nos lisossomos. .Arg . dupla hélice II. c) ausência de ácido fosfórico.a b) I . d) tRNA. Questão 1028 A tabela a seguir mostra alguns aminoácidos e as trincas de bases no DNA que os identificam: 1.Leu Questão 1029 Sobre o código genético são feitas as seguintes afirmações: I .Questão 1024 É característica do RNA: a) açúcar com quatro átomos de carbono. Questão 1027 Um pesquisador. II . As informações armazenadas nas moléculas de DNA são traduzidas em proteínas por meio de moléculas intermediárias denominadas: a) Proteases. a seqüência de aminoácidos no polipeptídeo correspondente será.5.Cis . cadeia simples .Função: a. RNA transportador de células de coelho e aminoácidos ativos de células de sapo. de acordo com a tabela anterior: a) Cis . 229 . utilizou ribossomos de células de rato.Leu e) Val .Val .a d) II . guanina.b c) II . d) ser um polipeptídeo. e) macaco e do rato.b Questão 1026 Nos últimos anos. RNA mensageiro de células de macaco. presença de timina .2 . nas mesmas condições em que essa síntese ocorre nas células. c) rRNA.1 . síntese de proteínas b. c) coelho.8. Questão 1025 Os itens a seguir referem-se à estrutura. e) mRNA. A proteína produzida teria uma seqüência de aminoácidos idêntica à do a) rato.1 .Cis .Val .Ile . transcrição gênica São características do ácido ribonucléico a) I . b) presença das bases nitrogenadas uracila. a biologia molecular tem fornecido ferramentas úteis para a produção de plantas e animais transgênicos. interessado em produzir em tubo de ensaio uma proteína. d) macaco.Cis d) Ile .Composição: 1.Arg .Ile b) Leu .Ile c) Arg .2 . citosina e adenina. b) Plasmídios.Leu .Arg .Arg .Estrutura: I.1 . b) sapo.em todos os seres vivos os códons que codificam um respectivo aminoácido são os mesmos.

c) I e II apenas. Questão 1034 Os códons UGC. d) GAA . a nível citoplasmático. II e III.UUG. lisina.FEN .UUU . e) I e III apenas. c) Fenilalanina.CUC.5.GGU . lisina. d) permite distinguir procariotos de eucariotos.8. d) Fenilalanina.cisteína . valina. que codifica a seqüência serina .5. É correto afirmar que o código genético a) varia entre os tecidos do corpo de um indivíduo. Com base na tabela fornecida e considerando um segmento hipotético de DNA. respectivamente os aminoácidos cisteína. o códon UAG é terminal.AAC. lisina. prolina. qual seria a seqüência de aminoácidos codificada? 1. Assinale a alternativa que apresenta a possível seqüência de códons para a formação do seguinte tetrapeptídeo: GLU .3 1.III . UAU. b) III apenas. prolina. mas varia de indivíduo para indivíduo.UUU . b) GAA .GGA . Assinale a 230 .TTT .AAA .alanina. Questão 1031 Um gene de bactéria com 600 pares de bases nitrogenadas produzirá uma cadeia polipeptídica com número de aminoácidos aproximadamente igual a a) 200 b) 300 c) 600 d) 1200 e) 1800 Questão 1033 O código genético é o conjunto de todas as trincas possíveis de bases nitrogenadas (códons). leucina. sofreu a perda da 9 base nitrogenada. e) Valina. c) CTT . Questão 1030 A tabela a seguir relaciona trincas de bases do DNA aos aminoácidos correspondentes. mas varia de espécie para espécie.GLI . A seqüência de códons do RNA mensageiro determina a seqüência de aminoácidos da proteína. valina.3 a) Aspargina. nos ribossomos. e) é praticamente o mesmo em todas as formas de vida. Um fragmento de DNA. prolina.UUU . GCC e AGC codificam. b) Aspargina. Está(ão) correta(s) afirmativa(s): a) II apenas. indica a interrupção da tradução. e) GUU .CUC. c) é o mesmo nos indivíduos de uma mesma espécie.8. cuja seqüência de bases é AAGTTTGGT. tirosina.tirosina .GGC . d) I. ou seja.CTC.LEU a) GUU . b) é o mesmo em todas as células de um indivíduo. Questão 1032 Considere a seguinte tabela que indica seqüências de bases do RNA mensageiro e os aminoácidos por elas codificados. lisina.GGC .CCG . alanina e serina.a tradução da seqüência de bases do RNA para a proteína é feita.

b) Todas as células do corpo têm a mesma coleção de genes. por raios-X.8. pois essa molécula de DNA alterada não é capaz de comandar esse processo. Questão 1035 Com relação ao código genético e à síntese de proteínas. que compreende a passagem do código genético do DNA para o RNA. e a tradução. citosina. que compreende o trabalho do RNA de organização dos aminoácidos na seqüência determinada pelo código genético. timina e uracil. Questão 1037 O esquema a seguir representa a seqüência de aminoácidos de um trecho de uma proteína e os respectivos anticódons dos RNA transportadores. apesar disto. foi oficialmente fundado o Projeto Genoma. mas. Este processo chama-se diferenciação celular. resultando numa molécula com 3 aminoácidos. mas. compondo os cromossomos e ribossomos na forma de moléculas complexas de nucleoproteínas.alternativa que descreve o que acontecerá com a seqüência de aminoácidos. determinando as características de um ser vivo. a) Na molécula de DNA. ou mesmo por exposição aos raios ultravioleta do sol. a) UUU CGT TTG UGC GUC b) UUU CGA AAG UGC GUC c) TTT CGT TTC TGC GTC d) TTT CGA AAG TGC GTC e) CCC TAC CCA CAT ACT Questão 1038 O quadro a seguir contém um segmento de DNA. d) A mutação constitui uma alteração na seqüência de bases nitrogenadas de um segmento de DNA e pode ser provocada por radiações. 231 . pode corrigir defeitos no código genético de um organismo. 1. c) Duas grandes etapas estão envolvidas na síntese das proteínas: a transcrição. e) Todas as células do corpo têm a mesma coleção de genes. os códons e os anticódons correspondentes. que visa decifrar e mapear o código genético humano. e) A seqüência não sofrerá prejuízo. a) O aminoácido tirosina será substituído por outro aminoácido. c) A seqüência não será traduzida. por raios cósmicos.3 ssinale a alternativa que contém a seqüência de códons do RNA mensageiro que participou dessa tradução. encontramos células com formas e funções diferentes. d) As mudanças na programação genética de um organismo não alteram a produção de proteínas. Indique a alternativa ERRADA relativa ao código genético e à síntese de proteínas: a) Os genes são formados por ácido desoxirribonucleico e controlam a produção de proteínas da célula. encontramos células com formas e funções diferentes. encontramos sempre desoxirribose e cinco tipos de bases: adenina. d) A tradução será interrompida no 2Ž aminoácido. assinale a afirmativa FALSA. que é uma técnica de manipulação dos genes. nem as suas características. apesar disso. c) A mutação é uma alteração do código genético de um organismo e pode ser provocada por radiações ou substâncias químicas. Questão 1036 Em 1987. guanina. e) A Engenharia Genética. b) O aminoácido tirosina não será traduzido. b) Os ácidos nucléicos podem aparecer livres na célula ou podem estar associados a proteínas.5. pois qualquer modificação na fita de DNA é imediatamente corrigida.

Diversos aminoácidos são codificados por mais de uma trinca de nucleotídios.CGT .CAC .ACA . Entretanto. liga-se a um aminoácido específico.CISTEÍNA - 232 . 1.HISTIDINA . Questão 1042 Considere os seguintes códons do RNA mensageiro e os aminoácidos por eles especificados: ACA = treonina GUU = valina Assinale a alternativa da tabela a seguir que indica corretamente os anticódons do RNAt e os códons do DNA relacionados com esses aminoácidos. São verdadeiras APENAS as afirmações a) I e II b) I e IV c) II e III d) II e IV e) I.ARGININA . ATT. TAA. diversas condições devem ser observadas.CCT TIROSINA . III. O RNA ribossômico contém as informações para as proteínas que devem ser sintetizadas.CGU . fundamentalmente. recebem e incorporam genes de outra espécie.8. b) o código genético é comum a todos os seres vivos. ATT.CGT . de acordo com o anticódon que possui. III e IV devem ser substituídos. Para que ocorra a síntese da proteína codificada pelo gene inserido no genoma da espécie receptora.TGT . c) o código genético é degenerado. d) a técnica permite trocar o código genético do organismo doador do gene. UCA e CUG Questão 1039 Com relação ao código genético. respectivamente.GCA .TGC .GLICINA Após a substituição de uma única base nitrogenada no segmento de DNA. o polipeptídio sintetizado passou a apresentar duas argininas.TTA e) UAU . por técnica de engenharia genética. receptoras de um gene de outro organismo (doador) que lhes confere resistência a certos herbicidas.CGC . O RNA mensageiro. A seqüência de trincas no RNA mensageiro que pode ter codificado esse polipeptídio alterado é a) CUC . Cada trinca de bases nitrogenadas de uma cadeia do DNA corresponde a um aminoácido. IV.GGU c) CGT . III e IV Questão 1040 Considere o seguinte segmento de uma cadeia de DNA e o polipeptídio sintetizado a partir dele: ATA . AUU.GGU b) TUT .CAC .GGA d) UAU .CGU . e) a técnica permite trocar o código genético do organismo receptor do gene. AUU.GGA Questão 1041 Organismos são ditos transgênicos quando. UCA e GUC c) GTC. por a) GAC.3 ara preenchê-lo corretamente.CAC . TCA e CUG e) CTG. II. TCA e GUC d) CTG. Exemplos desses organismos são as plantas transgênicas.CGT . os algarismos I.GTG . os quais podem ser transmitidos aos seus descendentes. foram feitas as seguintes afirmações: I. essa técnica é possível porque a) cada organismo apresenta seu próprio código genético.5. II. AGT e CTG b) GTC.CTU .TGC .TGT .CTU .

por conseqüência da substituição de uma única base na estrutura do DNA.o codon da metionina é também o do início da tradução. Nestas condições. bserve que: . Considere o quadro: 1.1.5. composta pelas bases adenina-A e citosina-C. podem-se identificar as possíveis seqüências de DNA que a originaram. O aminoácido encontrado no peptídio normal e aquele que o substituiu no peptídio mutante são.3 Questão 1043 Uma molécula de RNAm. foi sintetizada experimentalmente. A partir da seqüência de aminoácidos de uma proteína.3 1.os codons de término da tradução são UAA.5. pode acarretar modificações importantes na atividade biológica da proteína codificada por esse gene.8.8.3 233 . respectivamente: a) lisina e cisteína b) treonina e triptofano c) alanina e ácido glutâmico d) fenil alanina e ácido aspártico Questão 1045 A determinação da seqüência de aminoácidos de todas as proteínas da espécie humana e de outros seres vivos é de extrema importância. . UAG e UGA. Considere que a estrutura normal de um RNA mensageiro de um peptídio e sua estrutura alterada em virtude da troca de uma única base no gene correspondente são: 5' AUGUGGUUUGCACACAAAUGAUAA 3' (normal) 5' AUGUGGUUUGAACACAAAUGAUAA 3' (alterada) A tabela a seguir identifica alguns codons. sem necessidade de código de iniciação ou de terminação.8. o número de diferentes tipos de aminoácidos encontrados nos peptídeos formados será: a) 4 b) 3 c) 2 d) 1 Questão 1044 A mutação em um gene.5. Sua estrutura está representada no esquema abaixo: C-A-C-A-C-A-C-A-C-A-C-A-C-A-C-A-C-A Suponha que a síntese de um peptídeo possa ser iniciada a partir de qualquer um dos extremos dessa estrutura de RNAm.

e) O peptídeo Lys-Phe-Lys-Tyr-Tyr-Thr-Ile pode ter sido originado a partir do seguinte RNA mensageiro: AAAUUUAACUAUUACACAAUA. d) A partir da seqüência do RNA mensageiro UUAGGGGAGACUCGGCAGGAG. Trp (triptofano). 3.TAC . Para descobrir se determinado organismo produz determinada proteína. Cys (cisteína).TTC . é formado o seguinte peptídeo: Val-Val-Val-Val-Arg-Arg-Arg. Três bases nitrogenadas adjacentes codificam um aminoácido e formam um códon. Thr (treonina). His (histidina).TTC e) ATC . Estes.Cys . Cada três nucleotídeos correspondem a um aminoácido.TTC Questão 1046 OBSERVE: 1. devem estar presentes no seu mRNA? a) 100 234 .AAC .Phe a) ATG .TGT . Com base no texto e em seus conhecimentos. O inverso também pode ocorrer. Ile (isoleucina). na proteína que ele especifica. Ala (alanina).GCC . Isso é possível graças à relação existente entre os códons do RNA mensageiro (cada três nucleotídeos) e os aminoácidos presentes nas proteínas.TAC .om base no quadro apresentado. A seqüência de aminoácidos que forma uma cadeia polipeptídica compreende a estrutura secundária de uma proteína.TGT . formam as proteínas.AAT . Ser (serina). c) A partir da seqüência do RNA mensageiro GUGGUUGUCGCUCGUCGGCGG. Lys (lisina). Asp (ácido aspártico).GAA . apenas c) 3. b) A partir da seqüência do RNA mensageiro UUUCAUAGUGCUGGGAGCCAC. é correta a seguinte afirmação: a) O peptídeo Gly-Gly-Gly-His-Arg-Leu-Ile-Gln pode ter sido originado a partir do seguinte RNA mensageiro: GGCGGUGCGCACCGCCUUAUUCAA. após passarem por diferentes processamentos no Retículo endoplasmático rugoso e complexo de Golgi. pare (códon de parada). Asn (asparagina). As proteínas exercem inúmeras funções no nosso organismo. assinale a opção que indica a seqüência do DNA responsável pela síntese do peptídeo mostrado a seguir: Met . Gln (glutanina). Met (metionina). 2. Arg (arginina). apenas Questão 1047 A união de vários aminoácidos forma os peptídeos. que está representado na tabela a seguir: 1.TTT c) ATC . é formado o seguinte peptídeo Leu-Gly-Glu-Thr-Arg-Gln-Glu. Pro (prolina). portanto. a partir de uma seqüência de aminoácidos (peptídeo). Val (valina). quantos códons.AAT . é formado o seguinte peptídeo: Phe-His-Ser-Ala-Gly-Arg-His.Glu . 2 e 3 e) 2.GAA . faz-se a construção de uma fita de RNA mensageiro a partir dela. Gly (glicina). é possível obter uma seqüência de nucleotídeos (RNA mensageiros). que especificam esses aminoácidos. Glu (ácido glutâmico).GAA . Leu (leucina).TTT d) ATG .TGT . Está(ão) correta(s): a) 1.TGT .Tyr .TAC .GAA . Questão 1048 Se uma proteína possui 100 aminoácidos.3 Phe (fenilalanina).TAC . O código genético descreve a relação entre a seqüência de bases nitrogenadas e a seqüência de aminoácidos.TAC . apenas b) 1 e 3.TTT b) ATG .Asn . como por exemplo as funções enzimáticas. apenas d) 1. Tyr (tirosina).8.AAT . A correspondência entre os códons do RNA mensageiro e os aminoácidos por ele determinados constitui o código genético.AAT .5.

d) acrossomos. thr = TREONINA. arg = ARGININA. podemos dizer que I . Sônia. ser = SERINA.cisteína .arginina d) glutamina .aspartato b) metionina . he = FENILALANINA.8.aspartato . b) A inserção de um nucleotídeo entre a 4 e a 5 base não altera o código genético. respectivamente. pro = PROLINA. d) Os anticódons do 1Ž do 2Ž códon dessa seqüência são. é correto afirmar: a) Os códons dessa seqüência sinalizam os mesmos aminoácidos em seres humanos. Questão 1050 As unidades hereditárias que contêm a informação para especificar um aminoácido são denominadas a) ADN. c) Os códons GCA e GCG são degenerados porque codificam aminoácidos diferentes. tyr = TIROSINA. determine a seqüência de aminoácidos que corresponde à seqüência de DNA TAC TGA TTG CTA a) metionina . asn = ASPARAGINA. e) ribossomos.glicina c) glutamina . his = HISTIDINA. Bio Volume Único.glutamina . GCA e UGA. gly = GLICINA LOPES.treonina . ileu = ISOLEUCINA. glu = GLUTAMINA. leu = LEUCINA. met = METIONINA. val = VALINA.o código genético é degenerado.um aminoácido pode ser codificado por apenas uma trinca de nucleotídios de DNA. c) nucléolos.asparagina .glicina . trp = TRIPTOFANO. Utilizando a tabela. com os códons e os aminoácidos correspondentes. uma determinada trinca também pode codificar diferentes aminoácidos. II . Estão corretas afirmativas: a) apenas III.5. lys = LISINA. o que significa que um aminoácido pode ser codificado por mais de uma trinca.b) 33 c) 99 d) 300 e) 500 Questão 1049 Observe as seqüências de nucleotídeos de um vírus de RNA: 5' GCA UCA CAC CUC AUU GCG UAG 3' Considerando que esse segmento de RNA codifica um determinado peptídeo. asp = ASPARTATO. GAA e outras). São Paulo: Saraiva. b) códons. III .histidina .glutamina .histidina .treonina .assim como a leucina pode ser codificada por diferentes trincas.arginina e) glicina . Questão 1051 A tabela apresenta o código genético. 235 1. cys = CISTEÍNA. Assim sendo.treonina Questão 1052 O aminoácido leucina pode ser codificado por mais de uma trinca de nucleotídios do DNA (AAT. 1996. ala = ALANINA.3 .

. 236 . b) apenas I e II são corretas. Essas informações permitem afirmar que I . e) I. a TETRACICLINA liga-se aos ribossomos e impede a ligação do RNA transportador. UAC ACC UCU CGU. Considerando as informações apresentadas. d) ATA GGC TAT. (2) A molécula de DNA referente ao trecho apresentado tem 20% de adenina. Questão 1056 Existe um número muito grande de substâncias com funções antibióticas. d) apenas I e III são corretas. a MITOMICINA inibe a ação da polimerase do DNA e a ESTREPTOMICINA causa erros na leitura dos códons do RNA mensageiro. TAT GGC ATA. é responsável pela incorporação respectiva dos seguintes aminoácidos: metionina.. II . d) TTA TTT CCG AGG. d) I e III. pode-se dizer que o segmento de DNA que deu origem a esse RNA era a) TTA AAA CCG AGG.a MITOMICINA. triptofano. para os aminoácidos mencionados. Questão 1057 Dado um segmento de RNA com a seguinte seqüência de bases nitrogenadas: UUA UUU GGC UCC. impede a multiplicação da célula bacteriana. julgue os itens que se seguem. c) apenas I. b) UAU GGC UAU. (3) A perda de um nucleotídeo do DNA implicará a alteração dos aminoácidos da cadeia polipeptídica.b) apenas II. por inibir a duplicação do DNA.. TAT GGC ATA. Questão 1053 Um trecho de fita de DNA com a seqüência. Assim. (1) Os códons do mRNA. Indique qual a seqüência de RNAm é transcrito a partir deste segmento DNA: a) TTA TAA GCT CAG ATT TCT b) TTA TTA GCT CAG ATT TCT c) UUA UUU GGU CAG AUU UGU d) UUA UAA GCU CAG AUU UCU e) AAT ATT CGA GTC TAA AGA Questão 1055 Uma cadeia de DNA apresenta a seguinte seqüência de bases numa certa região de sua hélice: ATA CCG TAT. e) nenhuma delas. II e III são corretas. (4) A fumaça do cigarro.a ESTREPTOMICINA interfere na tradução e leva a célula bacteriana a produzir proteínas defeituosas. c) apenas II e III são corretas. UTU GGC UTU. c) TAT GGC ATA. III . e) TAT GGC UTU. Questão 1054 Um fragmento de DNA de uma espécie de organismo procarionte apresenta a seguinte seqüência de bases: AAT ATT CGA GTC TAA AGA. respectivamente: a) TAT GGC ATA. c) AAT AAA CCG AGG. Assinale a alternativa que reúne as afirmações corretas. UAU GGC AUA. respectivamente. e) AAU AAA CCG AGG. TUT GGC UTU. Essas substâncias diferem quanto à maneira pela qual interferem no metabolismo celular. sua cadeia complementar e o tipo de RNAm que poderá ser formado a partir das bases da hélice original são. os raios X e a luz ultravioleta podem produzir mutações na molécula de DNA. TACACCTCTCGT. são.a TETRACICLINA impede a transcrição e leva a célula bacteriana à morte por falta de RNA mensageiro. arginina e alanina.. b) AAT AAA GGC UCC. a) apenas I é correta.

Questão 1060 O esquema a seguir representa fragmentos de ácidos nucléicos no núcleo de uma célula. d) a célula encontra-se em metáfase.8. c) O processo 2 ocorre principalmente no período S da intérfase.guaninas c) idêntica . a) AAA CAC GGG TTT b) TTT CAC GGG UUU c) AAA CTC GGG TTT d) TTT GAG GGG TTT e) AAA CAC CCC UUT Questão 1059 O esquema a seguir representa dois processos observados numa célula eucariótica.complementar . Estudo de RNA rende o segundo Nobel 237 1. b) 2 representa nucleotídeos de DNA. d) Um dos mais importantes locais de ocorrência do processo 1 é o nucléolo.idêntica .8. e) trata-se do processo de transcrição.o RNA . a) idêntica . da Universidade Stanford. sendo inexistente em todas as outras organelas.o astro da semana.idêntica . é necessário bloquear o funcionamento de todo o retículo endoplasmático dessa célula.timinas Questão 1062 A mesma molécula . foi laureado por registrar em imagens o momento em que a informação genética contida no DNA no núcleo da célula é traduzida para ser enviada para fora pelo RNA . através do qual o RNA carrega consigo as instruções para a produção de proteínas (e por isso ele ganha o nome de RNA mensageiro). O americano Roger Kornberg. Esse mecanismo de transcrição.4 ssinale a alternativa correta. já era conhecido pelos cientistas desde a década de 50. a) O processo 1 somente é observado no núcleo da célula. (Girardi. e) As moléculas produzidas no processo 2 poderão ser utilizadas como catalisadoras.adeninas b) complementar . b) Para interromper o processo 2.Questão 1058 Uma molécula de RNA mensageiro apresenta a seguinte seqüência de bases nitrogenadas: UUU GUG CCC AAA. Questão 1061 A molécula de RNA sintetizada é ___________ à fita de DNA que lhe deu origem e ___________ à outra fita de DNA. sendo as _______________ substituídas pelas uracilas. 1. G.4 bservando o esquema. mas nunca serão constituintes de outras organelas. c) 3 representa nucleotídeos de RNA.adeninas e) complementar .5. . é INCORRETO afirmar que: a) 1 é uma molécula de uracila.complementar .5. Assinale a alternativa que contém a seqüência de bases do segmento da molécula de DNA que deu origem a esse RNA.complementar .citosinas d) complementar .que faturou o Nobel de Medicina ou Fisiologia na segunda-feira foi a protagonista do prêmio de Química entregue ontem.

4 Questão 1066 Considere as seguintes etapas da síntese de proteínas. b) RNA e de proteínas. I . Paulo". de a) proteínas e de RNA.8.II. após o processo de transcrição. b) I . 238 . d) RNA e de DNA. III . é necessário conhecer a estrutura da molécula de DNA e entender seu funcionamento. a) A produção de RNA mensageiro se dá por controle do material genético. c) O RNA mensageiro leva do núcleo para o citoplasma instruções transcritas a ele pelo DNA.C . o RNA mensageiro determina a seqüência de aminoácidos apresentada por uma proteína.A .I e) III .C .U b) G . farmacogenômica etc.II .C . c) DNA e de proteínas.A .U .II. Qual seria a seqüência correta encontrada na molécula de RNA mensageiro.A c) G .III .III.Fixação do RNA mensageiro aos ribossomos.G . origina a cadeia a) GUTATUTGA b) GCUAUCUGA c) GCTUTCTGU d) UCTATCTUA e) GCTATCTGA Questão 1065 Abaixo está representado o filamento I de uma molécula de ácido nucléico presente no interior do núcleo de uma célula vegetal.Transcrição do código genético do DNA em códons do RNA mensageiro. 5 out.U . e assinale a(s) proposição(ões) CORRETA(S).G . terapia gênica. Questão 1067 Há na mídia uma grande quantidade de notícias envolvendo o DNA: testes de paternidade.U 1."O Estado de S.U . e) Cada molécula de RNA mensageiro é uma longa seqüência de nucleotídeos idêntica ao DNA. transgênicos.G .Ligação dos códons de RNA mensageiro aos anticódons correspondentes dos RNAs transportadores.5.U d) C . A partir da leitura do trecho anterior e de seu conhecimento de biologia molecular.I. b) No núcleo da célula ocorre transcrição do código da molécula de DNA para a de RNA.A .III .U . d) III .G .G .C .I .A .U . e) DNA e de RNA.C . Para compreender essas notícias. clonagem terapêutica e reprodutiva. II . c) II . assinale a alternativa incorreta. d) No citoplasma. Questão 1063 Os processos de transcrição e tradução gênicas resultam na síntese.A e) C . engenharia genética. respectivamente. 2006).II . transcrita a partir do filamento II? a) G . Questão 1064 O segmento CGATAGACT de uma fita de DNA. Qual a seqüência correta dessas etapas durante o processo? a) I .U . Analise os dados dos quadros a seguir.

5. observa-se que o pareamento das bases nitrogenadas do DNA é aleatório. está indicado o processo de tradução. (16) A deleção de um dos pares de bases na seqüência mostrada em I não alteraria significativamente a seqüência de aminoácidos em III. Esse procedimento se repetiu após 15 e após 90 minutos. d) III. para o núcleo. transcrição. e) II. b) apenas II.8. d) apenas I e III. Os esquemas representam as células radioautografadas nos três momentos. onde está o DNA. que resulta na formação de polipeptídios. I. I e II. III e I.e) apenas II e III. 239 onsiderando-se apenas células eucariontes. Após 3 minutos. cuja seqüência de aminoácidos está codificada numa molécula de ácido nucléico. a informação genética é transmitida do citoplasma. Nas bactérias. Questão 1069 1. onde serão produzidas as proteínas. . Questão 1070 Algumas células de cultura de tecido foram deixadas em um meio contendo um precursor radioativo de RNA. está indicado o processo de transcrição. (04) Em II. 1. duplicação e tradução são: a) I. através do qual formam-se moléculas que contêm as mesmas bases nitrogenadas presentes no DNA. (02) O quadro I mostra uma molécula de DNA cuja duplicação ocorre de forma semiconservativa. c) apenas III. uma fita de DNA serve como molde para a produção do RNA que terá uma seqüência de nucleotídeos complementar à fita-molde. revelando a distribuição do precursor radioativo nas mesmas.8. Durante a transcrição. Posteriormente. Questão 1068 Analise as afirmativas a seguir.5. c) II. (08) Em III. as etapas que representam. transcrição e tradução ocorrem no mesmo local porque as células procariontes não possuem sistema de endomembranas. Nas células eucariontes.4 (01) Em I. III. gerando duas novas duplas hélices. I e III. III e II. b) I. algumas células foram fixadas e radioautografadas. II. Está(ão) correta(s) a) apenas I. II e III. pois cada uma das fitas originais em I serve de molde para uma nova fita.4 O esquema resume parcialmente as relações funcionais dos ácidos nucleicos que ocorrem na maioria das células vivas. essas células foram transferidas para um meio sem essa substância. respectivamente.

II . e) a síntese de RNA ocorre no núcleo. e) lise celular. Questão 1071 Os códons AGA. a) treonina. d) Apenas II e III.8. treonina. nas opções a seguir. leucina e treonina. A seqüência desses aminoácidos na proteína correspondente ao segmento do DNA que apresenta a seqüência de nucleotídeos GAC TGA TCT será. respectivamente. c) a síntese de RNA. d) a produção de RNA. d) mutação gênica. qual a seqüência correta do DNA e do RNA transportador. II e III. b) produção de energia.Um RNA-t (RNA transportador) transporta sempre um determinado aminoácido. arginina. restando apenas no citoplasma. leucina. III . que se intensifica aos 90 minutos. indique. Questão 1073 Sobre a síntese de proteínas. arginina. e) leucina. CUG e ACU do RNA mensageiro codificam.A tradução do código químico do RNA-m (RNA mensageiro) ocorre nos ribossomas localizados no retículo endoplasmático rugoso. prossegue posteriormente no citoplasma da célula. b) Apenas III. Questão 1072 Partindo-se do conhecimento do RNAm (CCU GAG).5. e) I. existem quatro tipos de genes que atuam como está demonstrado no esquema a seguir: São esses mecanismos que tornam possível a: a) diferenciação celular. b) arginina. leucina. dirige-se gradativamente para o citoplasma celular.5. Assinale a(s) afirmativa(s) correta(s): a) Apenas II. esgota toda a substância presente no núcleo. b) a substância. respectivamente. c) Apenas I e II. d) treonina.As moléculas de RNA-t apresentam numa determinada região da sua molécula uma trinca de bases denominada anticódon.1.4 1. pode ser transportado por vários RNA-t. c) leucina. buscando a situação de equilíbrio. treonina. c) duplicação de RNA. ao ser deixada em situação de desequilíbrio osmótico em relação à cultura sem isótopo.8. arginina. que ocorre inicialmente no núcleo celular. os aminoácidos arginina.5 Esses resultados ocorrem porque a) o RNA transportador leva o isótopo até o nucléolo e posteriormente ao núcleo e citoplasma celular. são feitas as seguintes afirmações: I . arginina. leucina. 240 . porém. treonina. Esse aminoácido. Questão 1074 Ao longo da molécula de DNA. sendo que posteriormente o RNA aí produzido migra para o citoplasma celular.

em última análise. A primeira etapa forma a molécula de ___(IV)___ contendo a mensagem genética e a segunda etapa é responsável pela produção da proteína. RNA ribossômico. tradução. Questão 1076 241 . aminoácidos. RNA ribossômico. d) produção de energia. d) II e III apenas. Questão 1077 Analise o texto abaixo e assinale a alternativa que contém os termos que preenchem corretamente os espaços (I).5 Questão 1078 O esquema a seguir representa a seqüência das etapas da síntese de um trecho de uma proteína a partir da molécula de DNA. proteínas. e) I. c) síntese protéica. III .5 Questão 1075 O antibiótico Estreptomicina age sobre as bactérias promovendo a leitura errada do RNAm. RNA transportador. "O controle das características fenotípicas dos seres vivos é feito pelos ___(I)___ através do comando da síntese de ___(II)___. duplicação.8. e) reprodução celular. II . e) genes. d) genes. 1. num certo organismo. II e III. A(s) afirmativa(s) correta(s) é(são): a) I apenas.qualquer proteína formada será conseqüência direta de uma transcrição do RNA. b) I e II apenas. o Cloranfenicol inibe a peptidiltransferase na subunidade ribossômica maior e a Rifampicina inibe a RNA polimerase no sítio de iniciação. de uma molécula de DNA. RNA mensageiro.5. tradução. aminoácidos. proteínas.5." a) ribossomos. c) genes. (II). c) I e III apenas. a Tetraciclina liga-se à subunidade ribossômica menor e inibe a ligação do AA-RNAt. cópia. b) ribossomos. 1.durante o processo a proteína formada depende. RNA mensageiro. (III) e (IV). b) secreção de substâncias. duplicação. aminoácidos. Sabe-se que esses antibióticos são substâncias cuja utilização médica se baseia na inibição das células bacterianas atuando no mecanismo de: a) fagocitose.análise do esquema anterior nos permite afirmar que: I .8.os ribossomas alinhados nessa molécula de RNA traduzirão os mesmos códons. No processo de elaboração de uma proteína ocorrem as etapas de transcrição e ___(III)___.

b) exclusivamente da produção de DNA.5 s espaços 1. Para codificar a seqüência dos aminoácidos do trecho da proteína apresentada no esquema são necessários 24 nucleotídeos no RNA mensageiro. c) sua síntese ocorrer no retículo endoplasmático liso e não no rugoso. c) apenas II e III estão corretas.5. que ocorrem no núcleo das células eucarióticas. GTA d) UGU. Questão 1079 A Rifampicina é um dos antibióticos utilizados para o tratamento da tuberculose.mensageiro. c) exclusivamente da produção de RNA.8. d) apenas I e III estão corretas. GAG. GUA 242 .Questão 1080 A composição química de uma proteína pode ser alterada se a) durante sua síntese houver variação dos tipos de aminoácidos disponíveis no citoplasma. Sob ação do antibiótico. d) uma base púrica substituir uma pirimídica no RNA mensageiro que a codifica. A seqüência correta de bases nitrogenadas encontradas na molécula de RNA mensageiro. e) bases da molécula de RNA . e) O DNA não se duplicar durante a interfase. b) durante sua síntese houver variação dos tipos de RNA transportadores. c) bases da molécula de DNA.8. CUC. 2 e 3 ficariam corretamente preenchidos por: a) ACA. os números 1 e 2 correspondem. III. No esquema. II. Deve-se concluir que a) apenas II está correta. Seu mecanismo de ação consiste na inibição da transcrição nas células de 'Mycobacterium tuberculosis'. complementar ao segmento da hélice de DNA apresentada é UGGUUUGGCUCA. GUG. respectivamente aos processos de tradução e transcrição. b) pentoses da molécula de RNA .transportador. GAG. d) bases da molécula de RNA . e) da produção de DNA e RNA. d) da produção de RNA e de proteínas. e) todas estão corretas. 1.ribossômico Questão 1082 Considere os seguintes fragmentos de ácidos nucléicos que participam da síntese de uma proteína.5.5 obre essa síntese foram feitas as afirmações abaixo: I. Questão 1081 A seqüência de aminoácidos de uma proteína é determinada pela seqüência de a) pentoses da molécula de DNA. nas células bacterianas haverá comprometimento a) exclusivamente da produção de proteínas. GAU b) TGT. CAT e) TGT. 1. CAU c) TCT. b) apenas I e II estão corretas. CAC.

8.Questão 1083 e) 558 Questão 1086 Tradicionalmente. e) o transporte de RNA. impedindo sua expressão. a) Essa metodologia visa reduzir os níveis de etileno nos frutos evitando seu amadurecimento. o tomate pode ser transportado já maduro e apresenta um maior tempo de prateleira. A função celular drasticamente afetada por essa mutação será a) a replicação do DNA. os tomates são colhidos ainda verdes para que sua firmeza seja mantida no transporte. que representa um fragmento de ácido nucléico. Uma delas é a síntese de proteína. b) a síntese de RNA mensageiros.5 Considerando o esquema acima. Os pesquisadores utilizaram a metodologia "anti-sense" (veja o quadro a seguir) para diminuir os níveis da enzima poligalacturonase. 243 . Numa síntese de proteína com 185 ligações peptídicas. c) O maior tempo de prateleira a que o texto se refere se deve aos baixos níveis da enzima poligalacturonase. cuja função é transportar aminoácidos. b) Cada trinca de bases.5. representada em II. Questão 1087 O esquema a seguir é um processo celular vital. que ocorre também em você. o que compromete a firmeza dos frutos. Essa enzima promove a hidrólise de componentes da parede celular. unindo-se aos aminoácidos. d) o transporte de proteínas. o filamento de DNA que proporcionou essa síntese deverá ter o seguinte número total de nucleotídeos: a) 62 b) 93 c) 186 d) 279 1. Dessa forma. Questão 1085 O DNA apresenta importantes funções celulares. O tomate Flavr Savr foi desenvolvido pela empresa de biotecnologia Calgene para amadurecer no pé mantendo a firmeza de sua pele. assinale a alternativa INCORRETA. é denominada anticódon. Questão 1084 Um mutante perdeu um segmento de DNA contendo todas as cópias dos genes que codificam RNA transportador. d) A tecnologia "anti-sense" para genes necessários à síntese do etileno poderia ser utilizada para se evitar o amadurecimento de frutos. e) Se a ação desse ácido for bloqueada. d) II pode apresentar moléculas de adenina. c) Esse ácido nucléico é produzido no núcleo e se dirige ao citoplasma. 1. b) O RNAm do gene "anti-sense" é capaz de parear com o RNAm da poligalacturonase.5. c) a síntese de proteínas. Antes de chegarem às prateleiras.8. os tomates são pulverizados com etileno para acelerar o amadurecimento e torná-los vermelhos. cuja expressão gênica é induzida pelo etileno. o processo de transcrição não ocorrerá.5 Assinale a alternativa INCORRETA. a) A substância representada em I é obrigatoriamente ribose.

Questão 1089 Na síntese protéica. 1. b) Os vertebrados citados apresentam menor percentual de transcrição em relação aos outros animais. II. poderiam desempenhar alguma função no núcleo celular. c) Os íntrons são exemplos de RNA não-codificador.5 1. no processo digestivo. mas não traduzidas. observam-se os seguintes eventos: I. b) de ovelha. d) Seqüências transcritas.5 244 . o RNA mensageiro combina-se com um complexo de ribossomo. Num experimento de laboratório hipotético.1.5. é correto afirmar.8.8. Ao final do experimento. obteve-se uma proteína a) humana. c) moléculas de defesa do corpo.5 Nesse processo ocorre produção de. RNAs transportadores e aminoácidos. d) quimérica de homem e ovelha. d) moléculas utilizadas nos processos de cicatrização. por exemplo. b) enzimas usadas. e) híbrida de homem e coelho. a proteína é sintetizada. Analisando os resultados anteriores de acordo com seus conhecimentos sobre o assunto. Questão 1090 Responder à questão com base na ilustração e afirmativas a seguir. Questão 1088 Os gráficos a seguir revelam o NÚMERO DE GENES e a relação entre RNA CODIFICADOR (que contém as seqüências que podem ser traduzidas em proteínas) e RNA NÃO-CODIFICADOR (seqüências que são transcritas. EXCETO: a) Não existe uma relação de proporcionalidade direta absoluta entre o número de genes e a complexidade dos organismos relacionados. e nos éxons estão presentes seqüências codificadoras.5. EXCETO: a) macromoléculas de reserva energética.5. III. o gene (segmento de DNA) é transcrito em RNA mensageiro. realizou-se uma síntese protéica utilizando-se: DNA de um gene humano.8. mas não são traduzidas em proteínas) de seis espécies de organismos. RNAs transportadores de ovelha e aminoácidos de coelho. c) de coelho.

]. Paulo ." Folha de S. Durante o processo B. Marcelo. Durante o processo A. b) O desenvolvimento envolve a expressão diferencial do material genético e independe do micro-ambiente em que a célula está localizada. e as células então interpretam esses valores de maneiras diferentes. denominado tradução. II. que é induzido a se expressar em resposta a fatores extrínsecos. IV. M. Essa referência deve-se ao fato de a) não ocorrer uma correlação funcional entre DNA e proteínas no meio celular. denominado replicação. b) o DNA controlar a produção de proteínas etambém atuar como catalisador de reações químicas celulares. mas a síntese dele próprio é controle do DNA d) o RNAt é responsável pela etapa de transcrição no processo de síntese de uma proteína Questão 1093 "Desenvolvimento significa. de forma que os embriões são logo divididos em regiões que essencialmente se dividem de maneira independente". B e C ocorrem no interior do núcleo. e que o sinal emitido por essas premiações aponta o verdadeiro futuro da pesquisa biológica e médica muito além dos genomas e de seu seqüenciamento (uma simples soletração). d) as proteínas não terem controle sobre o metabolismo celular.e a maior parte da formação de padrões acontece localmente. vértebras.. Muitos animais desenvolvem-se ao longo de eixos cartesianos. e) o DNA controlar a produção de proteínas e estas controlarem a atividade celular. Durante o processo C. É verdade que a Fundação Nobel ainda fala no DNA como o diretor de cena a comandar a ação das proteínas. O'NEILL. L. em grande parte. denominado transcrição. os processos A. c) O desenvolvimento das diferentes regiões de um organismo deve-se à propriedade de interação célula-célula 245 . "De volta ao seqüenciamento. "O Que é vida? 50 anos depois"... c) o material genético ser constituído por proteínas. o DNA se duplica. mas talvez não seja pretensioso supor que foi um lapso. é certo afirmar: a) os aminoácidos que estão no citoplasma são selecionados pelo RNAm b) todo o processo da síntese de uma proteína ocorre exclusivamente no núcleo da célula c) o RNAm controla a síntese de uma proteína. Uma outra característica comum parece ser a geração de estruturas periódicas como segmentos. III e IV Questão 1091 (. Considerando os processos intracelulares. In: MURPHY. como em um sistema coordenado. Uma maneira de produzir padrões é dar às células informação posicional. A importante implicação disto é que não existe relação entre o padrão inicial e o observado. ocorre a síntese de RNA. que são construídas segundo o modelo básico modificado pela informação posicional. II e III b) I. células tornando-se diferentes de maneira ordenada [.. (.raramente ultrapassam mais que 30 diâmetros de célula .) (LEITE..20/10/2002. os verdadeiros atores do drama molecular da vida. Todas as interações ocorrem a curta distância .) Com base no texto e nos conhecimentos sobre o tema.J. Lewis.) O autor refere-se às proteínas como ''atores do drama molecular'' e ao DNA como "diretor de cena".) De outro lado. todas as afirmativas corretas encontram-se na alternativa a) I. é correto afirmar: a) As células diferenciam-se de acordo com um padrão intrínseco. P. dá-se a síntese protéica.. p. contido no material genético. sendo os padrões especificados independentemente ao longo de cada um. Nos eucariotos. Questão 1092 Em se tratando do processo de síntese de proteínas. 1997. 74. penas e dentes.A. III e IV c) I e IV d) II e III e) II. (WOLPERT. São Paulo: UNESP. III.. o galardão de química ficou com os inventores de ferramentas para estudar proteínas.

d) A diferenciação caracteriza-se pela manutenção do padrão morfológico e pela alteração do padrão funcional do tecido.CUA . Gustavo não precisa destruir o fungo para obter a enzima. esta enzima passa para o complexo de Golgi e é secretada. desta forma.CTA . para o meio de cultura. Questão 1098 Na síntese protéica. b) O caminho da produção da pectinase começa com a transcrição.ACG . onde a tradução é concluída. esta enzima passa para o lisossomo. o valor de Y equivale a: a) 826 b) 706 c) 586 d) 466 Questão 1095 Considere os seguintes códons: UAC . a) O 'Aspergillus niger' é um organismo que possui mesossomo.GAU . para o meio de cultura. para ser empregada na indústria de sucos. ele simplesmente separa o meio de cultura do microrganismo e isola a enzima deste meio. via vesículas de secreção.UCG . no meio de cultura líquido. via vesículas de secreção. e) A síntese da pectinase começa no mesossomo e termina nas membranas do retículo endoplasmático rugoso.UGC . Sabe-se que X < Y < Z e que esses valores formam uma progressão aritmética. Y e Z de aminoácidos. um processo bastante complexo e fundamental para a sobrevivência das células.AUG Os anti-códons correspondentes são: a) AUG . depois para o complexo de Golgi e é secretada. Em seguida. esta enzima passa para o complexo de Golgi e é secretada. Portanto. contendo. no citoplasma. está corretamente referida em: a) O DNA transcreve a mensagem genética para o RNA.UTC d) AGT . e) O desenvolvimento ocorre como um dominó. um número X.e da quantidade de informações que a célula é capaz de processar. d) A síntese da pectinase começa no núcleo e termina nas membranas do retículo endoplasmático liso. e) a extremidade livre dos diversos tRNA tem seqüências de bases diferentes. que é traduzido por ribossomos e depois é ancorado nas membranas do retículo endoplasmático rugoso.TAC c) TUG . Questão 1094 Um RNA-mensageiro bacteriano é formado pela polimerização de 5292 nucleotídios e contém três códons de iniciação de leitura e três de terminação. Em seguida.ACT . a participação dos ácidos nucléicos.TCG .GAC e) GCA . produzida pelo fungo 'Aspergillus niger'. Esse RNA é traduzido em três diferentes proteínas.UAC b) ATG . via vesículas de secreção. assinale a alternativa correta. Em seguida.GUA . c) A síntese da pectinase começa no citoplasma e termina nas membranas do retículo endoplasmático rugoso. substâncias químicas indispensáveis à vida.CGU Questão 1096 Sobre os diferentes papéis dos ácidos nucléicos na síntese de proteínas podemos afirmar corretamente que: a) a seqüência de bases no DNA determina a seqüência de aminoácidos na cadeia polipeptídica. d) a seqüência de bases do rRNA é transcrita a partir do código do mRNA. Admita que todos os demais nucleotídios formam códons que correspondem a aminoácidos encontrados na estrutura primária das proteínas após serem sintetizadas. De acordo com o texto.CUT . b) a posição dos aminoácidos na cadeia polipeptídica depende da seqüência de bases do tRNA. que serve de modelo para a formação de uma proteína. Questão 1097 O pesquisador Gustavo obtém pectinase. 246 . em que a diferenciação de um tipo celular induz outro tipo a se diferenciar.ACG . a síntese da enzima ocorre nas membranas do mesossomo e depois ela é secretada para o meio de cultura. para o meio de cultura. c) o transporte de aminoácido para o local da síntese é feito pelo mRNA. respectivamente. do seu RNAm.CGA .

’. é INCORRETO afirmar que a) a ativação do gene responsável pela síntese da cadeia polipeptídica “ ocorre dias antes do nascimento. Questão 1100 Analise este gráfico. c) o material injetado nos ovócitos foi capaz de se autoduplicar. também. verificou que esses ovócitos. local onde ocorre a transcrição da mensagem genética. Questão 1102 No esquema. 2 e 3 substituem. e) O RNA ribossômico se une a proteínas formando o ribossomo. Questão 1099 Um pesquisador injetou RNA mensageiro (mRNA) de vírus em ovócitos de anfíbios. respectivamente: 1. d) os quatro tipos de cadeias polipeptídicas . comandando a síntese da proteína viral. que se liga ao ribossomo.b) O DNA transcreve a mensagem genética para o RNA solúvel. ’. em que está representada a produção de diferentes tipos de cadeias polipeptídicas . d) Apenas III está correta. b) Todas estão corretas. Após certo tempo. local da síntese protéica. responsáveis pela transcrição de uma cadeia polipeptídica.5. d) os ovócitos foram capazes de interpretar a informação contida no mRNA viral. a) Apenas II está correta. local de ligação com o aminoácido que ele transporta.5.‘. os números 1. além de suas próprias proteínas. c) O RNA mensageiro contém trincas de nucleotídeos denominadas códons. b) o mRNA se integrou ao DNA dos ovócitos.8. d) O RNA transportador apresenta na sua molécula uma trinca de nucleotídeos denominada anticódon. c) Estão corretas apenas I e II. e) Estão corretas apenas I e III. II) A tradução do código genético do RNAm é feita nos ribossomos localizados no retículo endoplasmático rugoso. I) Um RNAt transporta sempre o mesmo aminoácido. produziam. b) a síntese da cadeia polipeptídica ‘ permanece constante durante a mudança de produção das cadeias – e ’. Questão 1101 São feitas as seguintes afirmativas a respeito da síntese protéica.5 1.5 247 . Esses dados sugerem que a) o DNA dos ovócitos foi impedido de se expressar.8. c) o gene responsável pela síntese da cadeia polipeptídica ’ aumenta sua atividade a partir do terceiro mês da concepção. – e “ determinadas pela ação de diferentes genes e que vão compor as hemoglobinas em várias fases do desenvolvimento humano: om base nas informações contidas nesse gráfico e em outros conhecimentos sobre o assunto. III) O anticódon corresponde a uma trinca de bases localizada numa determinada região de todos os RNAt. – e “ estarão presentes no indivíduo adulto. Analise-a e assinale a alternativa correta.‘. proteínas virais.

(08) o ordenamento dos aminoácidos na proteína formada dá-se em função da seqüência de bases nitrogenadas.5 248 . tradução Questão 1103 O esquema a seguir mostra a via metabólica de um aminoácido. b) Apenas II. c) Apenas III. e) Apenas II e III. será lembrado como um dos mais influentes cientistas de todos os tempos. c) cada polipeptídeo tem uma seqüência específica de nucleotídeos determinada pelo gene.Um indivíduo com a enzima 1 inibida deixa de produzir as enzimas 2 e 3. lançando.5. tradução e) transcrição.8. que podem ser de quatro tipos diferentes. Quais estão corretas? a) Apenas I. repressão. é a síntese de proteínas. diferentes códons sempre especificam diferentes aminoácidos na cadeia polipeptídica. (04) o RNA transportador tem como função levar as proteínas produzidas no núcleo para o citoplasma. pois um aminoácido pode ser codificado por mais de uma trinca. Questão 1104 O cientista britânico Francis Crick. as bases para a descoberta do código genético. II . Entre as hipóteses apresentadas naquele texto.Um indivíduo com a enzima 1 inibida acumulará grandes quantidades de aminoácido 3. Questão 1106 respeito deste esquema são feitas as seguintes afirmações: I .5. transcrição.8. e deste para a proteína. tradução. isto é. o mensageiro e o transportador. (16) o código genético é degenerado. que ocorre em nível celular. (32) existem códons específicos para concluí-lo. Com relação a esse processo. presente no RNA mensageiro. é CORRETO afirmar que: (01) ele ocorre nos ribossomos. III . morto em julho de 2004. Em 1958. d) cada molécula de DNA é formada pela reunião de nucleotídeos. publicou um manifesto sobre a síntese de proteínas. assim. tradução d) replicação. transcrição c) amplificação gênica. a) o código genético é degenerado. (02) dele participam três moléculas de RNA: o ribossômico.Um indivíduo com a enzima 1 inibida precisa receber os hormônios 1 e 2 de fontes externas.a) repressão gênica. apresentando suas hipóteses sobre a estrutura teórica da biologia molecular. Segundo esse dogma. destaca-se o 1. transcrição. d) Apenas I e II. b) a transferência de informações genéticas ocorre do DNA para o RNA. replicação.5 Um dos processos metabólicos mais importantes. replicação b) replicação. e) uma molécula de DNA difere de outra pela seqüência de seus nucleotídeos. um dos descobridores da estrutura da molécula de DNA. no interior do núcleo. Questão 1105 1. levando à formação de alguns hormônios: dogma central da Biologia.

Nas células eucariotas. III e IV correspondem.5. 249 . c) 4 representa o RNA transportador que carrega a mensagem. d) RNAm. b) RNAt.tradução . Assinale a alternativa que preenche. (4) O número de aminoácidos da proteína dependerá do tamanho do RNA mensageiro. Questão 1108 O esquema a seguir representa a síntese protéica. RNAm.tradução . (0) Ao final da síntese.5 s algarismos I. RNAm.transcrição . a) transcrição . ribossomo e códon. o número (2). o número (1) corresponde ao processo de ___________.8.No esquema. e) 4 representa o RNA mensageiro que está sendo carregado pelo RNA transportador representado pelo número 1.núcleo.8. ribossomo e anticódon. c) RNAt. corretamente. (3) O conjunto representado pode estar localizado no retículo endoplasmático rugoso.replicação . respectivamente. 1. a: a) ribossomo.5. ao processo de ___________ e o número (3) ao processo de ___________. não está representado o RNA transportador. Questão 1109 O diagrama ilustra uma fase da síntese de proteínas. ribossomo e anticódon.5. vol.tradução .citoplasma e) replicação . b) replicação . ribossomo e códon. as lacunas. b) 3 representa a proteína carregada pelo RNA mensageiro. RNAt. que também participa do processo.8. todas as proteínas representadas no esquema serão iguais.tradução .núcleo d) replicação . 1997. códon.transcrição . e) RNAm. (1) Os ribossomos estão se movendo da parte de baixo para a de cima do esquema. 1.núcleo Questão 1107 1. c) transcrição .Uma abordagem evolutiva e ecológica". II. "Biologia .citoplasma. o número a) 2 representa o RNA mensageiro que contém os códons para a síntese protéica.replicação . p.5 AVANCINI e FAVARETTO. 150. RNAt.5 Analise o esquema e julgue os itens a seguir.transcrição . São Paulo: Moderna. 1. d) 1 representa a mitocôndria onde ocorre o processo de tradução. RNAm e RNAt. os processos representados pelos números (1) e (2) ocorrem no _________. (2) No esquema.tradução . Na figura.

transcrição e ribossomo. responsável pelo sequenciamento dos aminoácidos em um peptídeo com peso molecular de 27000 daltons? a) 810 b) 300 c) 270 d) 81000 e) 2700 Questão 1113 Griffth em 1928 descobriu que pneumococos sem cápsula.5 m indivíduo tem anomalias na pigmentação do corpo e seu metabolismo é prejudicado pela falta do hormônio da tireóide. somente. d) uma enzima. que resume as principais etapas da síntese protéica que ocorre numa célula eucarionte. misturados com um extrato de pneumococos capsulados. duplicação e retículo endoplasmático. 1. e) nos genes III e IV. quantos nucleotídeos em média estão presentes em uma seqüência codificadora de ARN-m. a a) transcrição. b) o ácido indolilacético. Questão 1112 Supondo que o peso molecular médio de um aminoácido é de 100 daltons.5. b) nos genes I e II. produzem quatro tipos diferentes de enzimas. somente. 1. c) duplicação. e) uma proteína. b) o ácido indolilacético. d) transcrição. somente. transformando o aminoácido fenilalanina em quatro possíveis substâncias. De acordo com o esquema. é normal. patogênicos e mortos. Questão 1114 Em 1928 Griffth descobriu que pneumococos (bactérias) sem cápsula e não-patogênicos. c) o ácido desoxirribonucléico. Nesse extrato o agente transformante era a) o ácido ribonucléico. c) o ácido desoxirribonucléico. 3 e 4. III e IV. respectivamente. não patogênicos. causavam a morte de cobaias. d) nos genes II e III. porém. duplicação e lisossomo. d) uma enzima. e) uma proteína. somente.8. Nesse extrato o agente capaz de transformar bactérias não-patogênicas em patogênicas era a) o ácido ribonucléico.Questão 1110 O esquema representa alguns passos de uma série de reações metabólicas. b) tradução. I. tradução e ribossomo. onde quatro genes. somente. os sintomas que o indivíduo apresenta ocorrem devido às alterações a) no gene I.8. s processos assinalados como 1 e 2 e a organela representados no diagrama referem-se.5 250 . O funcionamento das glândulas supra-renais.5. transcrição e lisossomo. II. 1. e) tradução. 2. Questão 1111 Considere o diagrama. c) nos genes I e III. misturados com um extrato de pneumococos capsulados patogênicos mortos causavam a morte de cobaias.

Questão 1115 Griffth, em 1928 descobriu que bactérias pneumococos sem cápsula e não-patogênicos, misturados com um extrato de pneumococos capsulados, patogênicos e mortos, causavam a morte de cobaias. Em 1944 Avery, McLeod e McCarthy concluíram que o agente capaz de transformar as bactérias era a) o RNA. b) o AIA. c) o DNA. d) uma enzima. e) uma proteína. Questão 1116 A experiência do "liquidificador" realizada por Hersey e Chase demonstrou que a substância que determinava a destruição de bactérias parasitadas pelos vírus bacteriófagos era a) uma proteína viral. b) uma enzima viral. c) o RNA viral. d) o DNA viral. e) um lípide viral. Questão 1117 O experimento do "liquidificador" serviu para demonstrar que o DNA de certos organismos era capaz de causar a destruição de bactérias. Os organismos que podem infectar bactérias são a) fungos. b) vírus. c) algas. d) ácaros. e) protozoários. Questão 1118 Bacteriófagos são a) protozoários de vida livre. b) líquenes parasitas. c) vermes parasitas. d) vírus. e) vermes de vida livre.

Questão 1119 A experiência do "liquidificador" realizada por Hersey e Chase em 1952 demonstrou que a) o material genético é formado por proteínas. b) o material genético é formado de RNA. c) o material genético é formado de lipídios. d) o material genético é formado por açúcares. e) o material genético é formado de DNA. Questão 1120 A bactéria 'Pneumococo pneumoniae' pode possuir uma cápsula que lhe permite a) sofrer mutações. b) desenvolver flagelos. c) resistir às defesas dos hospedeiros. d) ficar imune às defesas dos hospedeiros. e) sobreviver em ambientes sem água. Questão 1121 "O século XX proporcionou uma série de pesquisas na área genética. Em 1928, Griffith realizou um importante experimento que envolvia transformações em bactérias. Esse experimento, retomado por Avery e colaboradores, em 1944, foi a base para a descoberta da molécula formadora do material genético. Nos anos 50, Watson e Crick apresentaram o modela da dupla-hélice dessa molécula, abrindo caminho para que, na década seguinte, se demonstrasse como o gene, através de sua seqüência de bases nitrogenadas, controla a produção de proteínas. Nas duas últimas décadas, o avanço biotecnológico permitiu aos cientistas a manipulação do material genético e a transferência de um gene de uma espécie para outra." Considere os itens abaixo: I. estrutura da molécula do DNA; II. descoberta do código genético; III. DNA como molécula constituinte do gene; IV. obtenção de organismos transgênicos. O texto faz referência a) apenas aos itens I, II e III.
251

b) apenas aos itens I, II e IV. c) apenas aos itens I, III e IV. d) apenas aos itens II, III e IV. e) a todos os itens considerados. 1.5.8.6 Questão 1122 Sabendo que o DNA dos vírus bacteriófagos contém fósforo e que a cápsula protéica contém enxofre, Hersey e Chase, em 1952, cultivaram vírus em meio contendo isótopos de fósforo (¤£P) e de enxofre (¤¦S). Esses pesquisadores observaram, ao introduzir os vírus marcados em meio contendo bactérias, que os isótopos de fósforo (¤£P) apareciam no interior das bactérias e que os isótopos de enxofre (¤¦S) permaneciam fora das células. Observaram também que, após lavarem a superfície das bactérias, retirando o enxofre (¤¦S), continuava ocorrendo a replicação dos vírus. Com esse experimento, eles puderam concluir que a) a informação genética necessária para a síntese de novos vírus está contida no DNA viral. b) as capas protéicas dos vírus contêm parte importante da informação genética necessária à síntese de novos vírus. c) o DNA viral precisa estar associado integralmente às capas protéicas para poder se replicar no interior das bactérias. d) a capa protéica protege o DNA viral da ação de endonucleases no interior do organismo hospedeiro. e) os vírus bacteriófagos contêm DNA como material genético, e essa molécula é muito rica em enxofre. Questão 1123 No início da década de 1950, foi desenvolvido um experimento onde um dos componentes de um tipo de bacteriófago foi marcado radiativamente com enxofre e outro, com fósforo. Esses bacteriófagos foram utilizados para infectar uma cultura de 'Escherichia coli'. Um dos componentes entrou na bactéria, e o outro foi retirado da parede da mesma, por agitação. A cultura foi, então, imediatamente, centrifugada. O resultado obtido encontra-se ilustrado no esquema a seguir.

obre o resultado do experimento, é correto afirmar que a) o DNA do bacteriófago marcado com fósforo encontra-se no depósito bacteriano. b) as proteínas do bacteriófago marcadas com enxofre encontram-se no depósito bacteriano. c) o DNA do bacteriófago marcado com enxofre encontra-se em suspensão. d) as proteínas do bacteriófago marcadas com fósforo encontram-se em suspensão. e) o DNA do bacteriófago marcado com enxofre encontra-se no depósito bacteriano. Questão 1124 Por razões pouco conhecidas, durante a meiose pode ocorrer a não-disjunção de um determinado par de cromossomas, acarretando anomalias cromossomiais. Como exemplo de anomalia cromossomial autossômica temos: a) mongolismo. b) daltonismo. c) hemofilia. d) Síndrome de Turner. e) Síndrome de Klinefelter. Questão 1125 O esquema a seguir representa a formação dos gametas responsáveis pela produção de um indivíduo com alteração do seu número cromossomial.

252

1.5.9.1

III IV a) 65 , 65. b) 65 ,130. c) 70 , 60. d) 130 , 65. e) 130 , 130. Questão 1128 Monossomia do cromossomo X, ovários rudimentares, mau desenvolvimento dos caracteres sexuais secundários, baixa estatura são, entre outros, dados que podem ser relacionados com a síndrome: a) de Marfan b) de Klinefelter c) de Down d) de Turner e) de Patau Questão 1129 A constituição genética dos indivíduos com síndrome de Klinefelter é: a) 45A XX b) 44A XYY c) 44A XXY d) 45A XO e) 47A XXY Questão 1130 A síndrome de Down ou mongolismo é uma anomalia causada por: a) uma mutação gênica b) uma deficiência cromossômica c) uma diminuição do número de cromossomos no genoma d) um aumento do número de cromossomos do genoma e) uma inversão cromossômica Questão 1131

ntre as características que este indivíduo passará a apresentar, teremos: a) sexo masculino. b) cariótipo normal. c) estatura elevada. d) caracteres sexuais desenvolvidos. e) ausência de cromatina sexual. Questão 1126 A síndrome de Klinefelter é uma anomalia genética devido à: a) presença de três cromossomos autossômicos nŽ 21. b) ausência de um cromossomo autossômico nŽ 21. c) presença de um cromossomo X e dois cromossomos Y. d) presença de um cromossomo Y e dois cromossomos X. e) ausência de cromossomos sexuais. Questão 1127 Suponha que o seguinte processo ocorre em uma comunidade onde convivem diferentes espécies de gramínea: Qual das alternativas a seguir indica corretamente o valor de 2N dos híbridos III e IV do processo esquematizado?

1.5.9.1

Se na ovulogênese, não houver disjunção do par de cromossomos sexuais, os óvulos correspondentes, sendo fecundados, poderão dar origem a casos de a) síndrome de Turner b) síndrome de Klinefelter c) síndrome de Down d) síndrome de Patau e) a e b são possíveis
253

Questão 1132 Duas espécies de plantas A(2n = 8) e B(2n = 6) foram cruzadas produzindo um híbrido interespecífico que, germinando, produz alguns grãos de pólen que foram utilizados para fecundar óvulos da espécie B. Assinale a opção que relaciona o nível de ploidia e o número de cromossomos da descendência. a) 2n = 7 b) 2n = 10 c) 3n = 7 d) 3n = 10 e) 4n = 14 Questão 1133 Duas espécies de plantas A(2n = 8) e B(2n = 10) foram cruzadas produzindo um híbrido interespecífico que, germinando, produz alguns grãos de pólen que foram utilizados para fecundar óvulos da espécie B. Assinale a opção que relaciona o nível de ploidia e o número de cromossomos da descendência. a) 2n = 7 b) 2n = 14 c) 3n = 14 d) 3n = 10 e) 4n = 14 Questão 1134 A figura a seguir representa uma sinapse (pareamento) anormal observado quando ocorre a mutação cromossômica estrutural denominada:

a) inversão pericêntrica b) translocação c) duplicação d) deleção e) isocromossomos Questão 1135 A figura a seguir representa uma sinapse (pareamento) anormal observado quando ocorre a mutação cromossômica estrutural denominada:

1.5.9.1

a) inversão pericêntrica b) translocação c) duplicação d) deleção e) isocromossomos Questão 1136 Existem algumas pessoas chamadas especiais porque possuem uma série de características diferentes da maioria da população. Entre essas, estão aquelas que possuem a 'Síndrome de Down', também conhecida como Mongolismo. Em relação a essa síndrome, podemos afirmar que: a) é uma anomalia genética, causada pela presença de 3 cromossomos 21 e transmitida sempre pela mãe. b) é uma anomalia congênita, causada pela presença de 3 cromossomos 21 e transmitida sempre pela mãe. c) é uma anomalia genética, causada pela presença de 3 cromossomos 21 e transmitida por qualquer um dos pais. d) é uma anomalia congênita, causada pela ausência de um cromossomo sexual X ou Y. e) é uma anomalia genética, causada pela translocação de um dos cromossomos 21 para um 22.

1.5.9.1

254

Questão 1137 Num dado organismo, foram encontradas células somáticas normais com seis cromossomos (I) e células aberrantes (II e III) cujos cariótipos estão esquematizados a seguir.

Questão 1139 O número de cromossomos de uma espécie é 2n=20. O sistema de determinação do sexo é do tipo ZW. O cariótipo que representa uma euploidia é: a) 20, ZW b) 20, ZZ c) 30, ZWW d) 19, ZO e) 21, ZZW Questão 1140 A figura a seguir ilustra o processo denominado AMNIOCENTESE, utilizado para diagnóstico pré-natal de doenças genéticas. A técnica consiste na remoção de uma pequena quantidade de líquido amniótico (que banha o feto durante o desenvolvimento embrionário) para análise. Nesse líquido são encontradas proteínas e células que se soltam da pele do feto e dos revestimentos das vias gastrointestinais, respiratórias e genito-urinárias. As células imersas no líquido podem ser coletadas por centrifugação e utilizadas para estabelecer culturas de amniócitos. Essas culturas podem ser analisadas citologicamente, ou por análise do DNA.

1.5.9.1

s aberrações cromossômicas dos cariótipos II e III são, respectivamente, do tipo a) monossomia e trissomia. b) monossomia e poliploidia. c) nulissomia e trissomia. d) nulissomia e poliploidia. e) nulissomia e monossomia. Questão 1138 Observe o cariótipo a seguir, obtido a partir de células diplóides de uma pessoa.

1.5.9.1

1.5.9.1

ua análise permite afirmar que ele pode pertencer a uma mulher a) normal, com 47 cromossomos. b) com síndrome de Down. c) com síndrome de Klinefelter. d) com daltonismo. e) com polidactilia.

255

obre o processo acima descrito são feitas várias afirmações. Com base em seus conhecimentos e no texto acima, assinale a alternativa que apresenta um ERRO conceitual ou processual. a) O líquido amniótico funciona como amortecedor de choques mecânicos e propicia um ambiente adequado para o desenvolvimento do feto. b) Células presentes no líquido podem ser utilizadas para a determinação de anomalias cromossômicas. c) O processo pode ser indicado para gestantes com idade avançada, para as quais é maior o risco de terem filhos com Síndrome de Down. d) A cariotipagem pode ainda ser utilizada para a detecção de erros inatos do metabolismo como, por exemplo, a hemofilia. e) A presença de alguns vírus, como o da rubéola, apontam para possibilidade de más formações congênitas na criança. Questão 1141 O daltonismo é um caráter ligado ao sexo na espécie humana. A seguir estão representados os cariótipos de cinco indivíduos que apresentam uma anomalia cromossômica numérica, além de serem todos daltônicos.

odas as afirmações a seguir referentes aos indivíduos representados são verdadeiras, EXCETO: a) O gameta com um cromossomo a mais que deu origem ao indivíduo I foi produzido por não-disjunção na segunda divisão meiótica da gametogênese masculina. b) Ao pai do indivíduo II é obrigatoriamente daltônico, e a não-disjunção que resultou na anomalia pode ter acontecido na gametogênese feminina. c) Se o pai do indivíduo III não for daltônico, a não-disjunção que resultou na anomalia ocorreu na gametogênese feminina. d) Se o pai do indivíduo IV não for daltônico, a não-disjunção que resultou na anomalia ocorreu na gametogênese feminina. e) A mãe do indivíduo V pode ou não ser daltônica. Questão 1142

1.5.9.1

1.5.9.1 Acima, representa-se esquematicamente uma alteração estrutural de um cromossomo que serve de exemplo para o fenômeno denominado a) duplicação. b) deleção. c) translocação. d) transdução. e) inversão. Questão 1143 Uma mulher triplo-X é fértil e produz óvulos normais e óvulos com dois cromossomos X. Sendo casada com um homem cromossomicamente normal, essa mulher terá chance de apresentar a) apenas descendentes cromossomicamente normais. b) apenas descendentes cromossomicamente anormais. c) 50% dos descendentes cromossomicamente normais e 50% cromossomicamente anormais.
256

que por sua vez produziam sementes normalmente. também com 2n=28. pertencentes a gêneros diferentes. viabilizando a meiose. 1.d) 25% dos descendentes cromossomicamente normais e 75% cromossomicamente anormais. b) Durante a meiose ocorrida em F1. assinale a alternativa que indica a causa mais provável para a infertilidade da F1. Questão 1145 Duas espécies de gramíneas. Em II. seguida de reprodução normal na F2: a) O tratamento com colchicina removeu as barreiras químicas existentes nos dois conjuntos de cromossomos.9. em função de alelos incompatíveis. a anomalia conhecida como síndrome de Down ou mongolismo deve-se à a) mutação de um gene autossômico. e) falta de um cromossomo X. Questão 1146 Pela análise dos cromossomas. b) mutação de um gene do cromossomo X. Meristemas desta geração de híbridos (F1) foram submetidos a um tratamento com colchicina.1 s eventos possíveis da meiose que levam à síndrome de Down são os de número: a) 1 e 4 b) 1 e 3 c) 2 e 3 d) 2 e 4 Questão 1147 Considere o cromossomo a seguir esquematizado. e) A duplicação deu-se apenas com os cromossomos viáveis de cada espécie e o número total foi completado com quebras cromossômicas. foram cruzadas e criou-se um híbrido. e) 75% dos descendentes cromossomicamente normais e 25% cromossomicamente anormais. De acordo com o texto e os conhecimentos sobre o tema. ambas com número cromossômico 2n=28. gerando plantas (F2) com 2n=56. Assinale a alternativa que representa esse cromossomo após um rearranjo do tipo inversão. d) existência de um cromossomo X extra.5. que foram seletivamente eliminados em F2. c) A primeira geração filial era infértil. que florescia.9. Questão 1144 Na espécie humana. de 257 . c) existência de um autossomo extra. III e IV. d) A duplicação do número cromossômico permitiu a formação de 28 pares de cromossomos bivalentes. 1. O esquema a seguir apresenta quatro eventos da divisão celular. havendo multiplicação apenas do lote haplóide de uma das espécies. respectivamente. temos exemplos. mas não conseguia produzir sementes.5. temos uma célula diplóide 2n = 6 cromossomos. parte dos cromossomos foi eliminada. o que resultou em uma duplicação do número cromossômico. em I.1 Questão 1148 Na figura a seguir. é possível detectar a anomalia que caracteriza a síndrome de Down.

isto é.) Todas as alternativas apresentam características biológicas do burrinho referido nesse texto. e) monossomia. por conseguinte. mais vantajosos economicamente. ( ) nos homens. entre os quais. Questão 1152 Muitas aberrações cromossômicas humanas se manifestam como síndromes bem definidas e de fácil constatação pela análise do cariótipo. apresentar alterações. e já fora tão bom.5. ou não sei onde no sertão. inversão pericêntrica.1 Questão 1153 Na Síndrome de Down. a produção de espermatozóide ocorre durante todos os anos reprodutivos. translocação. é INCORRETO afirmar que a) os pais de um indivíduo Klinefelter têm número normal de cromossomos nas células somáticas. translocação. os cromossomos sexuais são representados por XXY.9. 258 . b) inversão cromossômica. Como exemplo. ocorrem casualmente na natureza.Guimarães. J. Esses vegetais podem ser reproduzidos pelo homem. por esse motivo. translocação. podemos citar o uso da Colchicina. inversão paracêntrica. Com base nessas informações e outros conhecimentos sobre o assunto. Chamava-se Sete-de-Ouros. "Sagarana".Questão 1151 O número de cromossomos da espécie humana pode. 1. não existindo não-disjunção e. translocação. EXCETO a) É resultante do cruzamento de égua com jumento. vindo de Passa-Tempo. não levando à aneuploidia em seus filhos. b) a presença de dois cromossomos X impede a manifestação do fenótipo masculino. que induz à a) haploidia." (ROSA. d) Produz gametas inviáveis. Assinale nos parênteses V se for verdadeira ou F se a afirmação for falsa. b) Tem características morfológicas idênticas às de um dos pais. d) a fecundação de um óvulo X por um espermatozóide XY dá origem a um indivíduo Klinefelter. Na tabela a seguir são dados cinco casos cuja veracidade você deverá analisar. c) É um típico exemplo de animal híbrido. b) haploidia. miúdo e resignado. c) monossomia. Questão 1150 "Era um burrinho pedrês.5. usando-se técnicas de melhoramento genético. d) recombinação gênica. inversão pericêntrica.1 a) haploidia. translocação. inversão paracêntrica. Pessoas com síndrome de Klinefelter possuem 47 cromossomos. Questão 1149 Vegetais maiores. Conceição do Serro. inversão paracêntrica. mais vigorosos e. o fenômeno ocorre quando os cromossomos não se separam durante a primeira divisão meiótica. e) translocação cromossômica. d) monossomia. artificialmente. c) poliploidia. c) a ocorrência do fenótipo mutante é resultado de um cromossomo extra. como outro não existiu e nem pode haver igual.9. também conhecida como trissomia 21: ( ) a causa é a não-disjunção. 1. às vezes.

. Abril 2000: nŽ 159. caracteriza-se pela trissomia do cromossomo 21 e decorre do(a) a) erro de disjunção do cromossomo 21 durante a formação dos gametas. Pode-se afirmar que a) I e II estão corretas.. translocado para outro cromossomo. Nélio. e) I está correta. além do núcleo. podem-se perceber erro conceitual grave. "CIÊNCIA HOJE". esterilidade e pescoço alado. Questão 1156 Uma pesquisadora analisou células da mucosa bucal de frentistas de postos de gasolina. e) Triploidia. preconceito e tautologia em uma única linha. isso se deve à presença de um cromossomo 21 extranumerário. b) fecundação de um gameta feminino diplóide por um gameta masculino haplóide. b) substituição. Questão 1158 As anomalias cromossômicas são bastante freqüentes na população humana. em alguns casos. II e III estão corretas. ( ) o longo período de intervalo entre o início da meiose do tecido ovariano (durante o desenvolvimento fetal) e seu término (na ovulação) é a mais provável razão para a incidência aumentada em mães mais idosas. ou um segmento do cromossomo 21. III . c) II e III estão corretas.o livro confunde herança ligada ao sexo com aneuploidias. c) deleção. Questão 1155 FALHAS NO ENSINO DE CIÊNCIAS "ERROS EM LIVROS DIDÁTICOS AINDA PERSISTEM EM ESCOLAS DE MINAS E SÃO PAULO" Nélio Bizzo O autor. Na grande maioria dos casos.daltonismo e hemofilia são alterações gênicas e não cromossômicas. podemos supor que se originaram a partir de a) translocação. II . Questão 1157 Mulheres com Síndrome de Turner caracterizam-se por apresentar baixa estatura. d) Euploidia. b) Monossomia. d) I. comenta em um dos seus artigos: ". Em função do comentário do professor." BIZZO. c) senilidade dos ovócitos em mulheres com idade a partir dos 35 anos. e) bipartição. trabalhar e ter uma vida semelhante à dos demais cidadãos. Rev. analise as afirmações abaixo: I . uma aneuploidia autossômica. como por exemplo: explique por que o homem não é portador de aneuploidias.tanto o homem quanto a mulher podem ser portadores de aneuploidias. Foram encontradas muitas células que. d) fato de as células autossômicas dos portadores terem 46 cromossomos. 259 . professor da Faculdade de Educação da USP. mas apresenta a doença quando afetado. Quando bem assistidas. c) Trissomia. apresentavam micronúcleos originados em cromossomos defeituosos. Esta Síndrome pode ser classificada como exemplo de a) Nulissomia. Quanto a esses micronúcleos. Questão 1154 A Síndrome de Down. d) deslocação. p. b) I e III estão corretas. um exemplo disso é que aproximadamente uma a cada 600 crianças no mundo nasce com síndrome de Down. pessoas com síndrome de Down alcançam importantes marcos no desenvolvimento e podem estudar. 26 Os casos de aneuploidias citados no texto incluíam daltonismo e hemofilia. ( ) os portadores têm uma cópia extra do cromossomo 21.( ) afeta indivíduos que têm um autossoma extra.

XY. (02) ocorrem mais em meninas do que em meninos.9. é CORRETO afirmar que: (01) podem ocorrer tanto na espermatogênese quanto na ovulogênese. onsiderando-se os dados anteriores. d) haplóide. Entretanto. pode-se afirmar que o indivíduo é: a) trissômico. com menor escolaridade e pouca assistência médica. 1. numerados de 1 a 6. causadas por não-disjunções cromossômicas. (3) As aberrações cromossômicas numéricas causam grandes alterações no funcionamento celular. julgue os itens abaixo. com a indicação do número de cromossomos autossômicos (A) e dos tipos de cromossomos sexuais (X e Y). b) poliplóide. Questão 1160 A figura abaixo esquematiza a não-disjunção cromossômica. e) monossômico. (04) ocorrem somente em filhos e filhas de mulheres de idade avançada. um indivíduo anormal foi identificado na população e seu cariótipo foi representado pela seguinte forma: 1. (64) podem acontecer devido a erros na duplicação do DNA.5.5. em esquema. Questão 1159 Em uma certa espécie de animal selvagem. (4) As síndromes de Down e de Turner. células de seis indivíduos.1 260 . c) triplóide. são exemplo de trissomia e de monossomia.Sobre as anomalias do número de cromossomos. (32) ocorrem preferencialmente em populações de menor renda. (1) As fibras do fuso acromático têm importância fundamental para as migrações cromossômicas características da anáfase. Questão 1161 1.9. (16) ocorrem ao acaso.1 A respeito desse tema. (2) Os erros na distribuição de cromossomos que levam às aneuploidias são freqüentes no processo de meiose e raros nas mitoses.1 Os quadrados a seguir representam. devido a um erro na gametogênese. (08) estão intimamente ligadas à separação incorreta dos cromossomos na meiose.5. os machos normais apresentam complemento cromossômico igual a 2n=6. presentes em cada uma delas.9. produzindo doenças graves e até mesmo a morte.

e às células representadas. III . Down e Morgan. d) somente a II e a III. a forma e o tamanho dos cromossomos. respectivamente. Turner e Klinefelter. III . 47 cromossomos. b) II. Questão 1166 Analise as afirmativas a seguir a respeito das mutações. o que evita a permuta gênica entre eles d) Aos cromossomos X menos um serem inativados ainda na fase do desenvolvimento embrionário e) Ao cromossomo X ser o cromossomo com maior quantidade de ADN repetitivo. c) Turner. é conhecida a trissomia do cromossomo 21 (síndrome de Down). apenas. A célula do indivíduo 2 pode ser igual a de um gameta do indivíduo 1.m relação a estes indivíduos. 261 . d) Down. d) substituição das três primeiras bases nitrogenadas por outras. e) inclusão de mais três bases nitrogenadas no final da molécula. tais como: presença de um cromossomo 21 a mais. c) substituição da quarta base nitrogenada por outra. II . A que se deve esse fato? a) Ao cromossomo X ser um dos menores cromossomos do conjunto haplóide b) Ao cromossomo X ser basicamente formado por heterocromatina com poucos genes estruturais c) Ao cromossomo X não ter uma pequena parte homóloga ao cromossomo Y. Turner e Down. b) supressão das três primeiras bases nitrogenadas. que é um dos menores cromossomos da espécie. tendo apenas um X. Os indivíduos 3.Ocorrem em células sexuais e somáticas. e) II e III. foram feitas as afirmações seguintes. 5 e 6 são normais e pertencem à espécie humana. e) a I. e) Klinefelter.Podem alterar o número. c) somente a I e a III. I. sendo dois X e um Y e 45 cromossomos.As mutações transmitidas às gerações futuras são aquelas que ocorrem em células germinativas. Turner e Klinefelter. o chamado ADN lixo Questão 1164 As alterações do número de cromossomos. c) III apenas. b) somente a I e a II. apenas. a II e a III. I . I . Em relação ao cromossomo sexual X são conhecidos casos de recém-nascidos do sexo feminino com trissomia. c) I e II. apenas. Questão 1163 Na espécie humana. Está(ão) correta(s) a) I apenas b) II apenas. o ser vivo reage sofrendo uma mutação gênica. apenas. A(s) afirmação(ões) correta(s) é(são): a) somente a II. Klinefelter e Turner.Sempre que o ambiente se torna desfavorável. as síndromes de: a) Down. leia as afirmações a seguir. d) I e III. b) Morgan. tetrassomia e até pentassomia desse cromossomo. II. Questão 1165 Considere um segmento de DNA com seqüência de bases indicadas a seguir: TTA TCG GGA CCG ATC ATC GTA A alteração mais drástica que esta molécula pode sofrer é a: a) supressão da segunda base nitrogenada.Ocorrem para adaptar o indivíduo ao ambiente. Questão 1162 A respeito das mutações.As mutações ocorridas em células somáticas são de grande valor adaptativo para a perpetuação da espécie. O indivíduo 4 pode ser do sexo masculino ou do sexo feminino. II . Estão corretas as afirmações: a) I. apenas. III. determinam.

Mutações podem ocorrer espontaneamente ou serem 262 . As cianofíceas reproduzem-se apenas assexuadamente.). d) uma base púrica substituir uma pirimídica no RNA mensageiro que a codifica. seríamos ainda bactéria anaeróbia. e) o DNA não se duplicar durante a intérfase. Questão 1170 Diversas doenças estão relacionadas a mutações no material genético. mas a idéia não nos agrada muito. 2. Errar é humano. nos organismos eucariontes a) constitui a principal fonte de variabilidade genética. b) durante sua síntese houver variação dos tipos de RNA transportadores..3 onsiderando as moléculas III. Após a replicação da molécula I. b) ocorre exclusivamente pela ação de agentes mutagênicos. com a alteração de apenas uma base nitrogenada. c) o erro ser corrigido pela célula durante a tradução. d) ocorre devido a alterações na molécula de DNA. Esse texto refere-se a uma característica dos seres vivos. d) o código genético não poder sofrer alterações. b) reprodução. uma adenina sofreu uma desaminação e transformou-se em hipoxantina (H).9. Questão 1171 O esquema a seguir mostra dois ciclos de replicação de moléculas de DNA. e) mutação. e é mais difícil ainda aceitar o fato de que errar é também biológico" (Lewis Thomas. c) sua síntese ocorrer no complexo de Golgi e não no retículo endoplasmático rugoso. c) somente 1 e 2. 1979).. de modo que podemos esperar baixa variabilidade na sua população. RJ.d) I e II apenas. "A medusa e a lesma". Questão 1172 Leia as afirmativas a seguir: I. c) excitabilidade. Questão 1167 A estrutura química de uma proteína poderá ser modificada se a) durante sua síntese houver variação dos tipos de aminoácidos disponíveis no citoplasma celular. Nova Fronteira. muitas vezes não resultam em substituição efetiva do aminoácido correspondente ao códon mutado na proteína produzida. e a música não existiria (. e) origina somente combinações gênicas adaptativas. Um par de bases nitrogenadas está identificado. dizemos. II. a mutação no par de bases indicado estará presente em a) somente 1. 3 e 4. 1. Questão 1169 "A capacidade de errar ligeiramente é a verdadeira maravilha do DNA. É ela: a) seleção natural. e) 1. e) os genes mutados não serem transcritos ou traduzidos. c) origina apenas seres recessivos. Questão 1168 A mutação gênica. mutações pontuais. Isto se dá devido ao fato de: a) o código genético ser universal. e) II e III apenas. Sem esse atributo especial. d) excreção. ed.5. base que normalmente emparelha-se com citosina (C). b) o código genético ser repetitivo ou degenerado. Porém. b) somente 2. d) somente 3 e 4.

J. é: a) impedir a multiplicação de determinado vírus no interior das células . Esses fungos devem ter sofrido mutação no gene a) X. 1997. de: a) especiação e ortogênese b) mutação e seleção natural c) oscilação genética e epigênese d) variação hereditária e isolamento ecológico Questão 1176 Cometer erros é a chave para o progresso. eles são. os cientistas afirmaram que a imunidade está relacionada a uma mutação genética. apresentada por 3% dos pacientes estudados. Há momentos em que é importante não cometer erro algum . a sobrevivência dos indivíduos de uma determinada espécie depende da estabilidade genética. d) I apenas. e) II apenas.e sem os erros as tentativas não teriam levado a nada.. Essa alteração na seqüência de DNA e a eliminação do indivíduo são fenômenos que podem ser explicados pela ocorrência.) O processo que se relaciona com o conceito de evolução biológica apresentado pelo autor é: a) reparação das lesões gênicas b) indução de mutações programadas c) geração de organismos transgênicos d) alteração aleatória na estrutura do DNA Questão 1177 As mutações representam um importante mecanismo evolutivo para os organismos. Questão 1173 Em certo fungo.pergunte a qualquer cirurgião ou piloto de avião.. somente. d) X ou no gene Y. de forma significativa. b) I e II apenas. ocorre a seqüência de reações a seguir esquematizada que leva à síntese do aminoácido arginina. que permite que ela ocorra em grande número de indivíduos. (Org. por ter sido transmitida de geração em geração. A afirmativa está CORRETA em: a) I. Entretanto. In: BROCKMAN. respectivamente. das Letras. A partir do estudo de um grupo de 1850 pessoas.. (Adaptado de DENNETT. c) II e III apenas. Uma das conseqüências deste fenômeno está descrita na seguinte alternativa: a) limitação da diversidade biológica 263 1. Os cientistas consideraram esse percentual muito elevado. b) Y. As coisas são assim.). e) X ou no gene Z. São Paulo: Cia.) A evolução biológica se dá através de uma grande e inexorável seqüência de tentativas e erros .9. A característica da mutação. Questão 1174 Recentemente cientistas confirmaram suas suspeitas de que existem pessoas imunes à AIDS. Mutações constituem um fator causador de variabilidade. somente. b) evitar a ação de agentes externos sobre os genes c) representar uma vantagem para a sobrevivência d) ocorrer em resposta à necessidade de adaptação Questão 1175 Durante o processo evolutivo. e MATSON K. II e III. No entanto (. III.3 erificou-se que certos fungos mutantes só conseguem sintetizar arginina quando a ornitina é acrescentada ao meio de cultura. capaz de destruir um organismo. a única oportunidade para aprendermos algo relativamente novo.5.) os erros não são apenas oportunidades valiosas para aprendermos. como aquelas provocadas pelos raios X. pode ocorrer uma alteração permanente numa seqüência de DNA. c) Z. somente. Daniel C.. (.induzidas.

pelo menos. d) a variação do meio. e) Oscilação gênica. prioriza os indivíduos HH. analise a figura a seguir que representa uma população isolada.b) criação de novas variantes de seres vivos c) extinção de espécies nocivas ao ambiente d) produção exclusiva de alterações benéficas Questão 1178 Indivíduos portadores do genótipo HÞH sofrem uma mutação gênica no cromossomo 11 e expressam anemia falciforme ou siclemia. Questão 1181 Pode-se afirmar que a mutação a) sempre ocorre para adaptar o indivíduo ao ambiente. d) Recombinação gênica. em quaisquer das trincas indicadas.3 1. o qual é reconhecido pelo anti-códon GCU. c) aumenta o número de alelos disponíveis em um locus. em uma população. desfavorece os indivíduos HÞH. 264 . nesse caso. Com base nas informações apresentadas. b) A mutação da 3  base na trinca indicada por 9 pode traduzir um aminoácido diferente. em um período de tempo.9.5. b) aumenta a freqüência de crossing-over. a) Mutação. Sabendo-se que o continente africano possui alto índice de malária e que o 'Plasmodium malariae' tem dificuldade de sobreviver nas hemácias de indivíduos portadores do genótipo HÞH. 1.5. Questão 1180 Assinale a alternativa que indica o fator que conduz ao surgimento de variabilidade gênica nova. em uma determinada região africana que possui casos de malária. 27 aminoácidos. c) A seqüência pertence a um DNA e pode codificar um polipeptídeo contendo. d) A trinca indicada por 5 pode transcrever um códon CGA. Questão 1179 Observe a seqüência de bases nitrogenadas. e) a seleção natural. c) Seleção natural. e) A troca da primeira base. pode-se concluir que a) o aumento do número de indivíduos HÞH está diretamente associado ao aparecimento de casos de malária. b) Fluxo gênico. pode resultar na troca do aminoácido respectivo na proteína. durante um certo tempo.3 odas as afirmativas são corretas quanto à seqüência. b) a elevação do número de indivíduos HH está associada ao aparecimento de indivíduos HÞH infectados. EXCETO a) A introdução de uma adenina (A) entre as trincas indicadas por 2 e 3 pode alterar toda a transcrição a partir desse ponto. d) sempre é dominante e prejudicial ao organismo. c) os genótipos HH e HÞH estão igualmente adaptados ao longo do tempo.9.

LISINA. As mutações podem ocorrer tanto em células somáticas como em células germinativas. como representado na figura.treonina. b) isoleucina . III. III e V.alanina . independentemente do seu sistema reprodutivo.lisina. aminoácidos da proteína será a) isoleucina . foram apresentadas as cinco afirmações seguintes. apresentava casca com as duas cores. o que chamamos de fruto é um pseudofruto. pode-se prever que a seqüência de A respeito das mutações gênicas. Um alelo mutante determina casca de cor amarela. b) I.Questão 1182 A coloração vermelha da casca da maçã é determinada geneticamente. e) alguns de casca amarela.alanina . 265 . mas apenas causadas por fatores mutagênicos.lisina . na maçã. II e III. ISOLEUCINA . CGC ou CGT lisina = TTT ou TTC Se ocorrer mutação e a nova seqüência de nucleotídeos for TAT TGT CGA TAA. a fita que será transcrita apresenta a seqüência de nucleotídeos TAA TGT CGA TTC e codifica.ALANINA . Um produtor de maçãs verificou que.treonina . Somente as mutações ocorridas em células somáticas poderão produzir alterações transmitidas à sua descendência.3 onsiderando-se que. TAG ou TAT treonina = TGA.treonina . outros de casca vermelha e outros de casca bicolor.isoleucina. Apenas as mutações que atingem as células germinativas da espécie humana podem ser transmitidas aos descendentes. TGG.treonina . o único que fornece material genético novo a um determinado conjunto gênico preexistente é a: a) mutação gênica. Assinale a alternativa que contém todas as afirmações corretas. isoleucina = TAA. As mutações são fatores importantes na promoção da variabilidade genética e para a evolução das espécies. para a seqüência de aminoácidos. Questão 1183 Em um determinado gene. c) todos de casca bicolor. V. tais como agentes químicos e físicos. Dentre eles. ao invés de apresentar casca vermelha. e) reprodução sexuada. d) treonina . em uma determinada macieira. e) lisina . II.9. CGG.5. d) reprodução assexuada. a) I.treonina.lisina . b) recombinação gênica. d) alguns de casca amarela e outros de casca vermelha. IV. As mutações não podem ser espontâneas. d) II.isoleucina. III e IV. Esses aminoácidos possuem mais de um códon de DNA. e) II. IV e V.alanina . c) seleção natural. um dos frutos.alanina . c) I. Questão 1185 1. Questão 1184 Vários são os processos que atuam na evolução. ou seja. I.isoleucina .TREONINA . espera-se que as árvores originadas das sementes dessa maçã produzam frutos a) todos de casca amarela. c) lisina . b) todos de casca vermelha. III e V. TGC ou TGT alanina = CGA. no qual a parte comestível desenvolve-se a partir do receptáculo da flor.

c) I. devido à sua interação com mecanismos genéticos. 3. a) ATC GAA TAT CTA b) ATG GAA TAT CTA c) AUC UAU AAG GUA d) AUC GAA UAU CUA e) AUG G GAA UAU CUA Questão 1187 Uma experiência realizada com coelhos (linhagem pura selvagem) consistiu em submetê-los a uma descarga excessiva de raio-X. 2 e 3 e) 2. As mutações do tipo substituição de base acarretam a alteração de vários aminoácidos nas proteínas. e) III. Questão 1188 Atualmente são bem conhecidos os efeitos adversos à saúde humana. podemos esperar várias reações. Questão 1190 Analise as proposições: 1. III . IV .Mutações gênicas podem ser causadas por poluentes ambientais e provocar alterações responsáveis pelo aparecimento de genótipos diferentes numa população. Assinale as afirmações corretas: I . Os principais agentes mutagênicos são as radiações ionizantes e os raios-ultravioleta. especialmente aqueles que possuem potencialidades mutagênicas ou carcinogênicas. que resulta sempre de segregação ou recombinação cromossômica. Caso ele venha a ser pai de uma criança. II e IV. Modificações hereditárias que ocorrem num locus específico são chamadas de mutações gênicas. d) herdará os tumores. c) só herdará os tumores se for do sexo masculino. c) morte em conseqüência da dose de radiação. apenas d) 1. d) tornaram-se albinos. que passou de citidina a guanina. podem causar mutações e doenças nas gerações futuras. Após o experimento. d) IV e III.Mutação é toda alteração do material genético. apenas 266 . e) não herdará os tumores. Questão 1189 Um surfista que se expunha muito ao sol sofreu danos em seu DNA em conseqüência de radiações UV. apenas c) 3. b) produção de filhotes anormais.Questão 1186 Uma bactéria sofre uma mutação pontual em uma região do seu DNA. químicos ou biológicos com potencial mutagênico. EXCETO: a) produção de um filhote albino. 2. Indique o RNA mensageiro codificado pela seqüência de DNA mutada. o que resultou em pequenos tumores na pele. que era: TAC CTT ATA GAT Ocorreu uma mudança na terceira base. II . A alternativa que contém as afirmações corretas é: a) I e III. b) só herdará os tumores se tiver ocorrido dano em dois genes recessivos. apenas b) 1 e 3. Está(ão) correta(s): a) 1. ela a) só herdará os tumores se tiver ocorrido dano em um gene dominante. pois houve dano no material genético. os quais. causados por diversos poluentes ambientais. e) tornaram-se estéreis. b) II e III.A mutação pode ser espontânea ou induzida por agentes físicos.Mutações são modificações bruscas do material genético que podem ser transmitidas à prole (descendência ou células filhas).

onde recebem grande quantidade de antígenos. imunizado. d) não é herdável. c) não produza mais anticorpos. espera-se que o organismo: a) reaja da mesma forma como reagiu à primeira dose. c) é herdável. produzirá antígenos específicos. recentemente. b) reaja sem utilizar seus anticorpos. indícios de câncer de pele. criados em laboratório. e) produza anticorpos mais rapidamente. o comprimento de onda em que será obtida maior taxa de mutação é a) 2.) por uma proteína e por um ácido nucléico. uma vez que as radiações UV danificaram seu DNA. porque a mutação resultante é dominante. d) 2. porque a mutação resultante é recessiva. o que reduzirá a mortalidade infantil em pelo menos um terço. a utilização de câmaras de bronzeamento artificial. d) não consiga reagir a essa segunda dose.400 Angstrons. quatro meses depois.800 Angstrons. b) não é herdável. envelhecimento precoce e câncer de pele.9. após algum tempo. induzam a produção de anticorpos específicos. Uma mulher que se submeteu a dez sessões intercaladas de bronzeamento.V. b) um medicamento eficaz no combate à doença já instalada e que produza no corpo uma reação para a fabricação de anticorpos específicos e resistentes. produziu anticorpos específicos. é necessária a vacinação. reconhecidos pelo corpo como antígenos.4 Considerando a ação desses raios na célula. d) o plasma. O corpo. tais como lesões na retina. como resposta imune.000. for aplicada uma segunda dose do mesmo antígeno.Questão 1191 A ANVISA (Agência Nacional de Vigilância Sanitária) normalizou. por estar imunizado. e) é herdável. Questão 1194 Todas as estruturas citadas a seguir podem ser ligadas à defesa do organismo. queimaduras. 267 . retirado de pessoas que já tiveram a doença.500 Angstrons. Um organismo recebeu uma primeira dose de um antígeno X e. a imunização de 90% das crianças.600 Angstrons. visando diminuir os riscos dessa prática. apresentou. Questão 1192 O gráfico mostra o espectro de absorção de raios ultravioleta (U.5. c) 2. e) 2. b) 2. para que o corpo produza antígenos e anticorpos específicos. porque provoca alteração do DNA. EXCETO: a) pâncreas b) amídalas c) baço d) timo e) gânglios linfáticos Questão 1195 1. como os cavalos. e) o soro obtido através do sangue de animais. Pode-se afirmar que esse tipo de câncer a) é herdável. que consiste em injetar no organismo: a) vírus ou bactérias vivas para provocar a doença de forma branda. porque provoca alteração em células somáticas. a serem cumpridas até o ano 2. Questão 1193 Os meios de comunicação têm noticiado que a Unicef (Fundo das Nações Unidas para a Infância) estabeleceu como uma das metas. c) vírus ou bactérias mortos ou atenuado que.700 Angstrons. Para que esta meta seja atingida. Se. com duração de 15 a 30 minutos cada uma. porque provoca alteração em células germinativas.

porque estimula o organismo a produzir anticorpos. no caso o vírus "A" d) é que a vacina é feita de vírus. porque já contém anticorpos. e) vacina.10 Questão 1197 Leia com atenção a tirinha de Frank & Ernest A análise do gráfico permite concluir que 1.5. O gráfico que melhor representa as taxas de variação da quantidade de anticorpos nas crianças I e II é: Existe um erro de fundamento biológico na historinha da tirinha.Questão 1196 A variação da quantidade de anticorpos específicos foi medida por meio de uma experiência controlada. c) vacina. Para a imunização de cada uma das crianças foram utilizados dois procedimentos diferentes: Criança I: aplicação de soro imune Criança II: vacinação. ela proporciona ao nosso organismo produzir defesas. d) após o nascimento a criança depende completamente dos anticorpos maternos.5. b) soro. pois não produz os próprios anticorpos. somente doenças causadas por bactérias c) é que a vacina não combate vírus. c) o recém-nascido não produz anticorpos. você deverá procurar recurso através de a) vacina. e) após o nascimento a criança depende dos anticorpos maternos. embora já esteja produzindo os seus. porque estimula o organismo a produzir anticorpos. pois produz poucos anticorpos. em duas crianças durante um certo período de tempo. b) antes do nascimento o feto nunca produz anticorpos. inibindo a sua atividade de defesa. d) soro. portanto ela não pode destruir o que a produz e) é que o vírus impede a ação da vacina. que é o sistema "chave-fechadura" Questão 1198 Ao ser picado por uma cobra peçonhenta. que são específicos aos seus antígenos. Assinale a alternativa que esclarece o erro: a) é que vírus do tipo "A" não sofre efeito de vacina alguma b) é que a vacina não combate vírus. os anticorpos.5.10 a) na época do nascimento a criança não está protegida.10 1. 268 . Questão 1199 1. porque já contém anticorpos. porque contém antígenos específicos.

uma grande proliferação de linfócitos específicos.08. O animal foi encontrado caído em uma praça nas proximidades do centro. c) são reconhecidas pelas células de memória. O primeiro foi notificado no início do mês de junho. A Secretaria Municipal de Saúde registrou mais um caso de morcego positivo para raiva na cidade de Botucatu. 269 . 1. b) demore mais tempo para produzir a antitoxina. Questão 1202 Um coelho recebeu. que são reconhecidas por um tipo especial de anticorpo. Questão 1201 DETECTADO FOCO DE MORCEGO COM RAIVA EM BOTUCATU. (Portal da Prefeitura Municipal de Botucatu.2006) MAIS UM CASO DE MORCEGO POSITIVO PARA RAIVA NA CIDADE DE BOTUCATU. espera-se que o organismo a) reaja mais rapidamente na segunda dose. e) desconsiderar o ocorrido e informar a população que não tenha receio. no final do mês de julho. que se reproduzem e fabricam grande quantidade de histaminas.06. pois apenas os morcegos hematófagos. Confirmada a presença do vírus causador da raiva em um morcego apreendido em uma praça no centro da cidade. na região central da cidade. e) reaja na segunda vez. Questão 1203 A alergia é uma hipersensibilidade desenvolvida em relação a determinadas substâncias. recebeu outra dose. nos gânglios linfáticos. após algum tempo. d) reaja sem produzir anticorpos.Questão 1200 Analise o gráfico que se segue. a injeção de uma toxina bacteriana e manifestou a resposta imunitária produzindo a antitoxina (anticorpo). d) ligam-se aos anticorpos e migram para os órgãos imunitários primários onde são destruídas. quando foi visto por estudantes. 18. O morcego encontrado é da espécie 'Myots sp' e alimenta-se de insetos. O animal estava caído e se debatendo. pois já está imunizado. o procedimento mais adequado que deverá ser tomado pelas autoridades da referida cidade será a) promover campanha para localização e eliminação das colônias de morcegos nas áreas urbana e rural. SP. (Portal "Estadão". espera-se que ele a) não resista a essa segunda dose. 06. b) desencadeiam. De acordo com o gráfico. b) não consiga reagir a uma segunda dose.10 m organismo recebeu uma dose de um antígeno X e. representam risco de transmissão da raiva. c) produza a antitoxina mais rapidamente. c) produza anticorpos mais lentamente na segunda dose. e) produza menor quantidade de antitoxina. que reagem liberando histaminas. b) medicar com antibióticos específicos os animais domésticos que tenham entrado em contado com os morcegos. d) promover campanha para a vacinação anti-rábica da população humana. d) não produza mais a antitoxina por estar imunizado. pela primeira vez. Este é o terceiro caso de raiva em morcego registrado este ano em Botucatu. Se após certo tempo for aplicada uma segunda injeção da toxina no animal. os alergênicos.5. produzindo menos anticorpos. mas não os frugívoros ou insetívoros.2006) Para se evitar a contaminação da população humana com o vírus da raiva. O segundo caso na Vila Antártica. c) antecipar a vacinação anti-rábica de cães e gatos nas regiões onde os morcegos foram encontrados. A reação alérgica ocorre quando as moléculas do alergênico a) ligam-se a moléculas do anticorpo presas à membrana dos mastócitos. e) são fagocitadas pelos mastócitos e estimulam a fabricação das interleucinas. O morcego doente era da espécie que se alimenta de frutas.

Os termos destacados referem-se. c) leucócitos e diapedese.10 270 . em fevereiro de 1901. Hoje é um centro de pesquisa reconhecido mundialmente na área de biomédicas produzindo diversos tipos de soros antitóxicos e antivenenos. capaz de estimular a resposta imunológica. c) soro de indivíduos previamente imunizados contra aquele patógeno. respectivamente. Questão 1208 Observe a figura a seguir. mas não causar a doença. pode-se concluir que a fabricação da vacina anti-AIDS a) apresenta os mesmos problemas que a da vacina contra a gripe. d) neutrófilos e clasmocitose. b) só pode ser feita contra as formas mutantes do HIV. assinale aquela que contém argumento válido e que explica a menor procura por antivenenos no Brasil. aos a) trombócitos e fagocitose. Questão 1205 O Instituto Butantã. é possível oferecer os seus soros para outros países". Questão 1207 "Os cientistas examinaram 11 homens aidéticos. d) Falta de veneno em quantidade suficiente para a obtenção do soro. e) certamente deverá estar no mercado dentro de pouco tempo. para a produção de soro no combate à epidemia de peste bubônica. protegendo o organismo. a) As reações alérgicas e a alta mortalidade provocada pela aplicação do soro. que se multiplicam no corpo do indivíduo que recebe a vacina. dos quais 5 nunca tinham usado medicamentos anti-HIV e 6 haviam usado. que estimulam a resposta imunológica do indivíduo. Das alternativas a seguir. b) O êxodo rural e a maior concentração da população humana em centros urbanos. Questão 1206 Consideramos uma vacina um material que contém: a) anticorpos contra determinado patógeno. d) células brancas produzidas por animais.5. resistentes às drogas ministradas e passíveis de serem transmitidas a outras pessoas. Segundo o Instituto "a demanda da produção de antivenenos vem diminuindo gradativamente no Brasil. d) é fácil de ser efetuada. foi fundado por Vital Brazil. Verificaram que 8 pacientes apresentavam novas mutações do vírus. quando aparecem CÉLULAS DE DEFESA que ATRAVESSAM OS CAPILARES e caem no tecido conjuntivo. c) precisa ser feita contra a forma normal do HIV. tendo em vista a estabilidade do HIV. 1. e) Falta de animais com características adequadas para a produção do soro. b) anticorpos contra determinado patógeno produzidos por outro animal e que fornecem proteção imunológica." Pela análise do texto. b) euritrócitos e pinocitose. famoso pelo seu serpentário. c) A imunização garantida pela administração do soro.Questão 1204 Uma lesão na pele pode infeccionar. e) um patógeno vivo enfraquecido ou partes dele. Sendo assim.

Patógenos vivos não podem ser usados como vacina.tapas na preparação do soro terapêutico. b) A dose de reforço provoca produção maior e mais rápida de anticorpos. em intervalos diferentes. pois fornece para o hospedeiro a informação genética necessária para que ele fabrique o antígeno preservando todas as suas características importantes na indução de uma resposta imune eficiente. A imunidade desenvolvida pela vacina de DNA não é imediata. Assinale-a. O processo envolve a inoculação direta do DNA plasmidial. a antitoxina diftérica é um corpo estranho. II. O indivíduo geneticamente vacinado passa a produzir tanto os antígenos quanto os anticorpos. ou os problemas proporcionados pela produção das vacinas de subunidades em microorganismos.10 correto afirmar. O gráfico a seguir representa o resultado de duas aplicações de mesmo antígeno. Isso sem gerar os efeitos colaterais que podem aparecer quando são utilizados patógenos vivos. Questão 1210 A vacina de DNA é a mais recente forma de apresentação de antígeno que veio revolucionar o campo da vacinologia. 1984. d) Um animal imunizado com toxina diftérica está protegido da infecção por 'C. EXCETO: a) Doenças diferentes em intervalos menores de tempo provocariam a mesma intensidade de produção de antígenos. e) Para o sistema imunológico da cobaia A. assinale a afirmativa INCORRETA. Esse tipo de vacina apresenta uma grande vantagem sobre as demais.5. 271 . "Scientific American". c) O tipo de imunização explicitado é ativa. que possui o gene codificador da proteína antigênica. pode-se fazer todas as afirmações. a) A toxina diftérica funciona para o cavalo como uma vacina.) Com base no texto. foram feitas as seguintes afirmações: I. 1999. São afirmações CORRETAS: a) I e II b) II e IV c) III e IV d) I e III 1. Questão 1209 Os anticorpos são proteínas específicas de defesa do corpo. d) O gráfico acima exemplifica ação das vacinas. (Fonte: Desenvolvimento de vacinas gênicas. Em relação aos procedimentos observados na ilustração anterior. EXCETO uma. Questão 1211 Em relação à figura a seguir. para verificar a atividade letal da toxina na ausência do soro. induzindo a formação de anticorpos. III. MICROBIOLOGIA E IMUNOLOGIA. b) A injeção de toxina na cobaia B é utilizada como controle. Os antígenos produzidos pelo DNA plasmidial são capazes de combater patógenos que infectem o hospedeiro. IV. que representa a atividade de células T citotóxicas. c) A injeção de antitoxina e de toxina na cobaia A é usada como controle para testar a eficácia da primeira na inativação da segunda. que será expressa e produzida no interior das células do indivíduo. diphtheriae'. pois não determinam imunidade e sim doenças. mas é de longa duração. Fonte: Bier. Otto.

c) aparar a grama dos jardins e recolher folhas caídas. e células de memória. uma célula T citotóxica pode separar e atacar outra célula-alvo. dizem ter realizado com sucesso a primeira fase de testes clínicos (em humanos) de uma vacina contra a malária. d) Descamar da epiderme . Questão 1214 a) Após efetuar um "ataque letal". b) Secreções mucosas . que destrói bactérias. em Paris. c) Apesar de muito antiga. a) Fagócitos . De acordo com a teoria clonal.opõe-se à colonização da pele por alguns patógenos.lubrifica e limpa. c) Lágrima . contém lisozima. moscas e outros insetos.1. Aplicada em 36 voluntários saudáveis. que produzem anticorpos e têm vida longa.5. que realizam o ataque e morrem. Questão 1213 Aranhas e escorpiões podem apresentar efeito peçonhento ao homem.10 a) colocar lixo em sacos plásticos e mantê-los bem fechados para não atrair baratas. Assinale a alternativa que NÃO apresenta a relação correta entre o fator de defesa e sua função. células de tecidos transplantados e células infectadas por vírus. (Fonte: "Folha de S. necrosante.prendem microorganismos no trato digestivo e respiratório. b) Se o organismo apresentar imunidade positiva contra o parasita.previnem a entrada de patógenos e substâncias estranhas. uma fase de invasão e diferenciação nos hepatócitos e uma fase intra-eritrocítica. bastando que esta esteja ativada. pode-se afirmar que a vacina foi eficaz contra todos os parasitos do mesmo filo. Questão 1215 A memória imunológica e imunidade resultam da seleção clonal. EXCETO: VACINA RESISTE A PARASITO DA MALÁRIA Pesquisadores liderados por Pierre Druilhe. não acumulando entulho e lixo doméstico. c) As células T citotóxicas podem atacar algumas células tumorais. Paulo". d) tomar vacina como mecanismo de prevenção ou usar soro de preferência polivalente em caso de picada acidental. d) A degradação ou lise da célula infectada não necessita do reconhecimento e da fixação da célula T citotóxica. Segundo Druilhe e seus colegas. b) manter limpos quintais. 09/11/2005) Assinale a afirmativa INCORRETA. a) O objetivo do uso da vacina é ativar o sistema de defesa do organismo contra invasores através da produção de anticorpos. a malária continua sendo um dos principais problemas de saúde pública no mundo. cardiotóxica. O controle e prevenção de acidentes com esses animais podem ser feitos tomando-se os seguintes cuidados. d) O ciclo vital desse parasita envolve um curto período na corrente sangüínea. Esses venenos podem apresentar ação neurotóxica. apresentando o mesmo antígeno. os quais se mostraram capazes de atacar o parasito 'Plasmodium falciparum'. um linfócito ativado produz dois tipos de células-filhas: células efetoras. Questão 1212 As defesas inatas dos organismos são geralmente mecanismos de proteção que inibem a entrada ou o desenvolvimento de organismos causadores de doenças. hemolítica. b) As células T citotóxicas matam células que apresentam antígenos na superfície por meio da secreção de perforinas e linfotoxinas. trata-se do "primeiro teste clínico de uma vacina contra a malária a demonstrar claramente sua atividade contra o parasito". Em uma pessoa 272 . Os pesquisadores ainda precisam realizar mais duas fases de testes clínicos antes de confirmar a eficácia da fórmula. do Instituto Pasteur. a fórmula induziu a produção de anticorpos contra a doença. jardins e terrenos baldios.

Paulo". EXCETO: a) Ativação de resposta imune primária e produção de clones de células efetoras e de memória pelos linfócitos. que têm função antiofídica. após um certo espaço de tempo. Seja como for. d) circulação linfática. Pesquisadores da Fundação Oswaldo Cruz identificaram no sangue dos gambás duas moléculas. São Paulo: Saraiva. é INCORRETO afirmar: a) A imunidade dos gambás sul-americanos ao veneno das jararacas foi naturalmente selecionada. podem-se observar os seguintes eventos. Agora. Questão 1218 Uma pessoa que tivesse seriamente comprometida a atividade dos plasmócitos teria problemas com a a) produção de anticorpos.10 onte: LOPES. c) produção de uréia. b) Essa resistência dos gambás ao veneno de serpentes viperídeas é determinada geneticamente. entre as quais se incluem as jararacas.5. descobriram que uma solução potencialmente melhor foi 'desenvolvida' ao longo de milhões de anos pelos gambás sul-americanos. Bio. embora elas mesmas não sejam anticorpos. c) macrófagos e linfócitos. DM43 e DM64. há uma fase de espera antes de o número de moléculas de anticorpos e células T aumentar. Analisando o texto e de acordo com seus conhecimentos. 1. a DM43 e a DM64 parecem especificamente talhadas para neutralizar os principais efeitos do veneno das serpentes da família das viperídeas. b) Maior e mais rápida produção de anticorpos específicos em casos de encontros subseqüentes com o mesmo antígeno. uma resposta do organismo. a um mesmo tipo de antígeno (ex. responsáveis por 90% dos 20 mil acidentes anuais com cobras no Brasil.1999. e) produção de toxinas. b) eosinófilos e eritrócitos.: vírus) provoca. d) Um dos componentes do veneno da jararaca poderia ser útil na prevenção de tromboses. enquanto a outra neutraliza as substâncias que matam as células musculares de quem é picado. d) Promoção imediata de resposta imune secundária. São exemplos destas células. 30/08/2005." Fonte: Extraído da Reportagem: Sangue de gambá contém soro antiofídico do Jornal "Folha de S. repetidas vezes. São glicoproteínas que apresentam estrutura parecida com a de substâncias do sistema de defesa do organismo. e) leucócitos e linfócitos. As nossas células de defesa exercem o seu papel por meio da fagocitose e da produção de anticorpos. Questão 1217 Compartilhamos o ambiente com uma série de microorganismos que podem causar infecções nos seres humanos. Questão 1216 "Por décadas os cientistas tiveram de quebrar a cabeça para criar antídotos contra o veneno das cobras. d) eritrócitos e macrófagos. c) Na primeira exposição ao antígeno. 273 . A primeira molécula se opõe à ação dos compostos do veneno que causam forte hemorragia na vítima ao impedir a formação de coágulos.vacinada contra uma possível infecção. b) circulação venosa. c) Os linfócitos de gambá reagem a picadas das jararacas produzindo soro antiofídico que pode ser letal para as cobras. S. Questão 1219 O gráfico a seguir exemplifica como a exposição de um homem normal. com produção de células efetoras e de memória. respectivamente: a) linfócitos e basófilos. que se alimentam de serpentes. que controlam lentamente o invasor.

10 odemos atribuir esta resposta do organismo ao fenômeno de memória imunológica.10 s resultados acima permitem chegar à seguinte conclusão em relação a esse soro: a) na época do nascimento há presença de IgG materna b) durante a gestação diminuem os níveis de IgG fetal c) durante a gestação os níveis de IgG independem da produção fetal d) após o nascimento diminuem os níveis de IgG produzida pelo recém-nascido . participando assim da imunidade celular. b) os linfócitos T. cuja intenção é fortalecer a defesa desses indivíduos. EXCETO a) basófilos. 1. ligam-se aos anticorpos e iniciam suas ações fagocitária e secredora. c) os linfócitos B. Uma série de tipos celulares é responsável pelas reações alérgicas e por outros tipos de hipersensibilidade imune. Tal tratamento. diferenciam-se em plasmócitos. as primeiras células a serem ativadas. Havendo incompatibilidade entre o doador e o receptor de um órgão ou tecido condicionado pelo MHC. uma forte reação alérgica. e) mastócitos. na maioria das pessoas.5.5. principais responsáveis pela 274 1. para pessoas aidéticas sintomáticas. de modo que a) os macrófagos. que tem como conseqüência: a) o aumento da produção de anticorpos b) a inibição da produção de anticorpos c) o aumento da produção de antígenos d) a inibição da produção de antígenos Questão 1220 A produção de imunoglobulinas por células do sistema imunitário constitui um dos mecanismos de defesa do organismo contra infecções. d) as interleucinas inibem a proliferação de macrófagos e linfócitos T citotóxicos. mas sem os sintomas da doença. c) profilaxia. b) eritrócitos. e) vacinoterapia. c) eosinófilos. Questão 1223 As principais moléculas responsáveis pela resposta imune aos transplantes de órgãos e tecidos são os antígenos do Complexo Principal de Histocompatibilidade (MHC). contidos no plasma de pessoas contaminadas há muitos anos. multiplicam-se e diferenciam-se. após reconhecerem os antígenos apresentados pelos macrófagos. denomina-se a) imunoterapia ativa. e o sistema imune do receptor responde. estimulados por substâncias produzidas pelos linfócitos T auxiliares. d) linfócitos. b) imunoterapia passiva. dando início à imunidade humoral.Questão 1221 Um novo tipo de tratamento da AIDS começou a ser testado no Brasil e consiste em transmitir anticorpos anti-HIV. O gráfico abaixo demonstra os níveis de imunoglobulina G (IgG) no soro do feto e do recém-nascido. d) quimioterapia. produzindo assim uma quantidade maior de anticorpos. será desencadeada uma reação. Questão 1222 A urtiga é um vegetal que provoca.

e) a ciclosporina age no processo de rejeição. Traduzido e adaptado de: http:// spaceflight. b) anticorpos que persistirão ativos por toda a vida do receptor. Uma dessas. da concorrência entre esses dois países. passou a existir o desejo do bem-estar e do conforto mostrar onde se vivia melhor era fundamental. a ser realizada na Terra e no espaço. Questão 1224 Com o final da 2 Guerra Mundial. ao provocar nos indivíduos do sexo masculino o aumento da produção de urina. coqueluches. Questão 1226 As vacinas utilizadas nas campanhas de imunização em massa são constituídas de a) anticorpos que destruirão o agente infeccioso específico. A comparação dos resultados obtidos poderá indicar o quanto a resposta imunológica estará afetada. realizada por pesquisadores da NASA. enfrentaram-se as duas forças hegemônicas do pós-guerra: os Estados Unidos da América. ao mesmo tempo em que socialismo e capitalismo disputavam o predomínio na produção e nos mercados. A Guerra Fria foi o resultado óbvio dessas tensões e disputas. alterações nos comportamentos sinalizaram um novo tempo. Vencido o perigo nazista. José Paulo Paes) ". Esse desejo fez com que rapidamente se transferissem para o cotidiano dos homens os resultados práticos das inovações de guerra." ("Outro retrato". suprimindo os linfócitos B. tem o objetivo de estudar até que ponto o sistema imunológico se altera durante vôos espaciais. aparecem na infância. sarampos" são alterações no bem-estar físico do indivíduo que. consiste na análise de amostras de sangue e saliva antes e após a injeção de um determinado antígeno.. ocorre menor: a) fagocitose do antígeno mediada pelos linfócitos B b) produção de anticorpos pelos linfócitos T citotóxicos c) produção de imunoglobulinas pelos neutrófilos d) produção de anticorpos mediada pelos linfócitos B e) produção de imunoglobulinas pelos macrófagos Questão 1225 "Onde não há cozinhas pratos por lavar vigílias. Entretanto. Hoje. sem suprimir o sistema imunológico do receptor.html Se ao final da experiência mencionada for demonstrado que a resposta imunológica humoral diminui durante os vôos espaciais.nasa. sem deixar o paciente vulnerável a infecções. e a URSS.rejeição. c) drogas capazes de aumentar a resistência à infecção. campeões do capitalismo. Pesquisas biológicas vêm sendo desenvolvidas com os tripulantes dos vôos espaciais. fraldas sujas coqueluches. ( ) são típicas das regiões úmidas e frias e têm como vetores insetos do gênero 'Anopheles' sp. 275 . Cai o império soviético. ( ) comprometem os nódulos linfáticos das virilhas. nessas condições. Ao lado da política e da economia. clonagem. A corrida espacial foi um dos aspectos dessa concorrência. e) soros obtidos de animais que neutralizarão os antígenos específicos. novas tecnologias para comunicação evidenciam o progresso no século XXI. até mesmo.. A experiência. normalmente. genoma. ( ) podem ser prevenidas pela aplicação de vacinas na primeira fase da vida ou tratadas com medicamentos adequados. Estas doenças ( ) são transmitidas por vírus e enquadram-se no grupo das que causam desidratação. novas comodidades.gov/shuttle/archives/ sts-74/orbit/payloads/lifes/regimmun. d) microorganismos ou produtos deles derivados que induzirão a formação de anticorpos. iniciou-se um novo período na história da humanidade. no mundo globalizado. o conhecimento humano não tem fronteiras nem limites: DNA. Mais conforto. um novo século. sarampos. a revolução tecnológica avançava como conseqüência. conclui-se que. campeã do socialismo.

é correto afirmar que: onsiderando-se os processos de imunização representados. Com relação ao sistema imunológico humano. o organismo humano dispõe de diferentes mecanismos de defesa.5. os postos de saúde estão aplicando. podemos afirmar que: 276 . b) o código genético do patógeno é igual ao do camundongo. diz-se que ele adquiriu imunidade humoral. são produzidas células apresentadoras de antígenos. instituída pelo Ministério da Saúde do Brasil. ( ) Em (1) ilustra-se a resposta primária do organismo após um primeiro contato com um vírus X. a vacina contra pneumonia pneumocócica. proteínas que se ligam 1.10 ( ) Ao primeiro contato com um vírus X (1) . ( ) contra patógenos extracelulares. é constituído por diferentes tipos de glóbulos brancos e pelos órgãos responsáveis pela produção e maturação desses glóbulos. por exemplo (Y). também. Questão 1230 Há um número muito grande de organismos causadores de infecções. Além da vacina contra a gripe. ( ) as chamadas "células de memória" surgem da diferenciação de linfócitos T e B. podemos afirmar que: ( ) nos nódulos linfáticos e no baço. c) induzem resposta imunológica. d) o mRNA do antígeno do patógeno é traduzido em II. Questão 1229 Para o controle das infecções. estes estimulam os linfócitos B a produzirem interferons. muito ativos no combate a patógenos externos. os macrófagos. ou ainda células como as cancerosas.Questão 1227 Analise estas figuras: 1. anticorpos em nível neutralizador suficiente para inativar o vírus. se o organismo continuar a produzir anticorpos em quantidades elevadas. ( ) Em (2) ilustra-se a resposta imunológica do organismo a uma infecção bacteriana. c) o antígeno do patógeno é produzido pelo camundongo em I.10 especificamente a determinados antígenos. células produtoras de anticorpos. É CORRETO afirmar que essas vacinas protegem porque a) são constituídas de moléculas recombinantes.5. perduram no organismo e podem desencadear a resposta imune com mais rapidez. um organismo infectado por uma bactéria X produzirá mais antígenos em (2) do que em (1). Em relação a esse sistema. Questão 1228 A Campanha Nacional de Vacinação do Idoso. ( ) os linfócitos B transformam-se em plasmócitos. que atua no combate a infecções. enquanto em (1) mostra-se o efeito da pós infecção viral. d) impedem mutações dos patógenos. contra as quais o homem dispõe de um vigilante exército para a sua defesa. ( ) linfócitos T podem adquirir ação citotóxica e destruir células infectadas por vírus. o organismo ativa seus linfócitos T citotóxicos. ( ) Após um primeiro contato com um vírus X (2). imediatamente. o organismo reage e produz. b) contêm anticorpos específicos. ( ) Devido à elevada especificidade da reação antígeno-anticorpo. Com relação a este tema. como a maioria das bactérias. é INCORRETO afirmar que a) os anticorpos são produzidos tanto em I quanto em II. Questão 1231 O sistema imunitário. vem-se revelando uma das mais abrangentes dirigidas à população dessa faixa etária.

.. muitas vezes por períodos bastante longos. causando vermelhidão e edema nos processos inflamatórios. fixando-se temporariamente no ducto toráxico. produzem interleucinas.. a) imunoglobulinas .. Indique o que deve ser aplicado em cada criança. O que o relatório mostra é que... a outra.. Sabe-se que a produção de certos hemoderivados se vale de material retirado do plasma. para eliminar quimicamente o veneno. na ordem em que ocorrem. ( ) Os macrófagos são responsáveis pela secreção de histamina. 28 jul. quando estimulados.( ) Os macrófagos fagocitam elementos estranhos e imobilizam resíduos na membrana. porque contém anticorpos prontos. a qual provoca vasodilatação.. (04) São produzidos somente pela vacinação. para se prevenir contra poliomielite. ( ) Linfócitos T reconhecem antígenos nas membranas de outras células. é correto afirmar: (01) São capazes de neutralizar toxinas bacterianas..se alimenta de nutrientes ricos em ferro c) albuminas .... Adaptado de: "Veja"... Os anticorpos também são capazes de proteger o embrião humano. porque fornecerá ao organismo elementos de defesa... são proteínas sintetizadas para combater agentes externos (bactérias e vírus. a) Uma partícula b) Um organismo c) Uma molécula d) Uma célula e) Um patógeno Questão 1233 Os anticorpos.. 2004. e permanecem na corrente sangüínea prontos para nos proteger da ação de patógenos.. estimulam os linfócitos B a produzirem anticorpos e eliminam células anormais. enquanto as . Em relação às características dos anticorpos. ( ) Os linfócitos B. (02) São capazes de neutralizar os vírus.se alimenta de nutrientes ricos em ferro 277 . . em virtude de uma picada de serpente peçonhenta. (16) São dotados de memória imunológica. extraídas do plasma de europeus ficam na faixa de 3 gramas por litro. que induzirá a formação de anticorpos. e) vacina. porque é composto por antígenos específicos. deve procurar socorro através de a) soro. as dos brasileiros situam-se na faixa de 5. RESPECTIVAMENTE. Uma possível explicação é que o brasileiro . (32) São capazes de imobilizar os microorganismos.está exposto a uma maior variedade de organismos patogênicos b) hemácias . c) soro. Soma ( ) Questão 1234 Duas crianças foram levadas a um posto de saúde: uma delas. para atendimento. se diferenciam em plasmócitos que produzem anticorpos e participam da memória imunológica. por exemplo) ou seus produtos... Questão 1236 Assinale a alternativa que preenche corretamente as lacunas do texto a seguir. estimulando os linfócitosT. O relatório da Polícia Federal sobre a Operação Vampiro traz uma informação no mínimo irônica sobre o sangue dos brasileiros. componentes do nosso sistema de defesa. Questão 1232 Assinale a alternativa que melhor descreve um anticorpo. a) vacina (porque contém antígenos) e soro (porque contém anticorpos) b) soro (porque contém antígenos) e vacina (porque contém anticorpos) c) vacina (porque contém anticorpos) e soro (porque contém antígenos) d) soro (porque contém anticorpos) e vacina (porque contém antígenos) Questão 1235 Quando uma pessoa é picada por um animal peçonhento. (08) Podem atravessar a barreira placentária.2 gramas por litro. especialmente nos macrófagos. na vida intra-uterina. ( ) Os linfócitos T e B originam-se no timo e depois migram para a medula óssea.. b) soro. onde podem se multiplicar ao detectarem elemento estranhos ao organismo. d) vacina..

II . b e c) representam o que pode acontecer quando uma lesão na pele permite a entrada de bactérias que causam infecção. 278 1. Questão 1241 A revista "Veja" (28. que é a imunidade adquirida de ação menos duradoura que o soro e de emprego terapêutico. b) aplicação do soro.tende a apresentar o baço com tamanho aumentado.O tecido lesado libera sinais químicos (histamina e prostaglandinas) que promovem a dilatação dos vasos na área lesada. induzam a produção de anticorpos específicos. O corpo imunizado produzirá antígenos específicos. d) provoca imunização.10 Analise as afirmativas a seguir: I . que é um processo ativo de imunização preventiva e duradoura.tende a apresentar o baço com tamanho aumentado e) imunoglobulinas .d) albuminas . já prontos. em média. d) Apenas I é correta.A inflamação é uma resposta imune do corpo. ocasião em que o indivíduo recebe anticorpos. III . enquanto a extraída do sangue dos brasileiros é de 5. a) Apenas I e II são corretas. criados em laboratório. e) vacinação. reconhecidos pelo corpo como antígenos. quando o agente infeccioso provoca uma doença de evolução muito rápida e não há tempo para a imunização ativa. para que o corpo produza então os antígenos específicos. fagocitando os microorganismos patogênicos. resultado da ativação dos mecanismos naturais de defesa do organismo. Questão 1237 As ilustrações a seguir (a. c) microrganismos mortos ou atenuados que. como os cavalos. submetendo-se as pessoas à a) aplicação do soro. d) o plasma. c) Apenas II e III são corretas. pois as pessoas desenvolvem anticorpos contra os antígenos atenuados. produzidos pelo organismo de um animal. II e III são corretas. e) o soro obtido através do sangue de animais. Vacinar consiste em injetar no organismo: a) microrganismos vivos para provocar a doença de forma branda. d) vacinação. Marque a alternativa correta. . Questão 1238 O soro antiofídico é ministrado em pessoas picadas por cobra peçonhenta porque: a) induz a formação de anticorpos.Alguns tipos de leucócitos (glóbulos brancos) atravessam as paredes dos capilares por diapedese e deslocam-se pelo tecido. retirado de convalescentes. Questão 1239 Os meios de comunicação têm convocado dentistas e outros profissionais da saúde para a vacinação contra a hepatite B. que tem efeito terapêutico.2004) noticiou que a quantidade de imunoglobulina extraída do sangue dos europeus é.2 gramas por litro. b) uma substância que combata a doença já instalada e que produza no corpo uma reação para a fabricação de anticorpos resistentes. de 3 gramas por litro. b) contém anticorpos.07. A incidência de doenças causadas por estes agentes infecciosos poderá ser reduzida. onde recebem grande quantidade de antígenos. na tentativa de destruir agentes invasores. e) possui antígenos específicos.5. Questão 1240 Os agentes infecciosos penetram no corpo das pessoas através dos ferimentos e das mucosas. c) é um antibiótico. c) aplicação do soro. b) I.

Assinale a hipótese que pode explicar corretamente a causa de tal diferença. a) Os europeus tomam maior quantidade de vacinas ao longo de sua vida. b) Os brasileiros estão expostos a uma maior variedade de doenças. c) Os antígenos presentes no sangue do europeu são mais resistentes. d) Os anticorpos presentes no sangue do brasileiro são menos eficientes. e) Os europeus são mais resistentes às doenças que os brasileiros. Questão 1242 A partir do recente surto de sarampo na cidade do Rio de Janeiro, o governo decidiu iniciar uma campanha de imunização das crianças. A imunização contra diversos tipos de doenças é atingida através de vacinação, que consiste em injetar no organismo: a) o soro obtido através do sangue de animais criados em laboratório, como macacos, onde recebem grande quantidade de antígenos e anticorpos específicos. b) o plasma retirado de pessoas que já tiveram a doença, para que o organismo produza antígenos e anticorpos específicos. c) um agente químico eficaz no combate a doença já instalada e que produza no corpo uma reação para a fabricação de anticorpos específicos. d) vírus ou bactérias mortos ou atenuados que, reconhecidos pelo organismo como antígenos, induzem a produção de anticorpos específicos. e) vírus ou bactérias vivos, em quantidade pequena, para provocar a doença de forma branda, pois o corpo imunizado produzirá anticorpos específicos. Questão 1243 Nosso corpo está sempre sendo ameaçado de invasão por substâncias estranhas e por uma variedade enorme de microorganismos. Toda vez que isso acontece, além dos nossos mecanismos gerais de defesa, acionamos nosso sistema imune constituído por diferentes tipos de glóbulos brancos e por órgãos imunitários que, primariamente, são: a) fígado e baço. b) fígado e gânglios linfáticos.

c) tonsilas e pâncreas. d) pâncreas e medula óssea. e) medula óssea e timo. Questão 1244 A pigmentação da pele humana é condicionada por pares de genes com ausência da dominância. Suponhamos que apenas dois pares de genes estivessem envolvidos na cor de pele: o negro seria SSTT e o branco, sstt. Um homem mulato, heterozigoto nos dois pares, tem 6 filhos com uma mulher mulata de genótipo igual ao seu. Sobre os filhos do casal, pode-se afirmar que: a) todos são mulatos como os pais. b) cada um deles tem uma tonalidade de pele diferente da outro. c) um ou mais deles podem ser brancos. d) a probabilidade de serem negros é maior do que a de serem brancos. e) 50% apresentam pele branca e 50%, pele negra. Questão 1245 O gráfico a seguir representa um tipo de herança onde os caracteres variam de forma gradativa. As opções a seguir são exemplos deste tipo de herança no homem, EXCETO uma. Assinale-a.

1.5.11

a) Estatura. b) Inteligência. c) Obesidade. d) Fator RH. e) Cor da pele.

279

Questão 1246

1.5.11

dois indivíduos que produzem frutos com 15cm, espera-se uma proporção de plantas com frutos de 17,5cm igual a a) 9/16 b) 1/2 c) 3/16 d) 1/4 e) 1/8 Questão 1249 Em um caso de herança quantitativa, estão envolvidos três pares de genes, "a", "b" e "c". Cruzando-se dois indivíduos triplo heterozigotos, a proporção de homozigotos esperada é de: a) 1/2 b) 1/8 c) 1/16 d) 1/32 e) 1/64 Questão 1250 Imagine que, em um determinado animal, a retenção de água no corpo seja controlada pela interação quantitativa de dois pares de genes, existindo cinco fenótipos (da retenção baixa até a retenção máxima de água). Animais com genótipo aabb retêm baixa quantidade de água, enquanto animais com genótipo AABB apresentam retenção máxima de água. Os animais que apresentam dois genes "maiúsculos" e dois genes "minúsculos" no genótipo retêm uma quantidade intermediária de água. Na genealogia abaixo, são dados os genótipos dos animais indicados pelos números 1, 2, 3 e 6. Considerando que os genes em questão se segregam independentemente, qual a probabilidade de os indivíduos 7 e 8 apresentarem simultaneamente retenção intermediária de água? a) 1/2 b) 1/3 c) 1/4 d) 1/8 e) 1/16

A cor dos grãos de trigo é condicionada por dois pares de genes de efeito aditivo. A tabela acima mostra o número de genes dominantes e as cores determinadas por eles. Do cruzamento entre um indivíduo AaBb e um Aabb, a proporção esperada de indivíduos com grãos vermelhos é de: a) 3/8 b) 1/8 c) 3/16 d) 6/8 e) 5/8 Questão 1247 Admita que a diferença de comprimento das orelhas nos coelhos seja um caso de herança quantitativa envolvendo dois pares de genes com segregação independente. Animais sem nenhum gene dominante possuem orelhas com 4,0cm. Cada gene dominante aumenta em 1,0cm o comprimento das orelhas. O cruzamento que produzirá na descendência uma maior porcentagem de coelhos com orelhas de no mínimo 7,0cm é o a) AaBb x AaBb b) AaBb x aaBB c) AAbb x aaBB d) Aabb x AABB e) AABB x aabb Questão 1248 Para uma determinada planta, suponha que a diferença entre um fruto de 10cm de comprimento e um de 20cm de comprimento seja devida a dois genes, cada um com dois alelos, que têm efeito aditivo e que se segregam independentemente. Na descendência do cruzamento entre

280

1.5.11

de altura e cada alelo p e r determina 10cm. Assim, os indivíduos PPRR têm 80cm e os indivíduos pprr, 40cm. O gráfico a seguir representa a distribuição das classes fenotípicas observada nos descendentes dos cruzamento entre heterozigotos PpRr.

1.5.11

Questão 1251 Supondo que na aboboreira existam 3 pares de genes que influem no peso do fruto, uma planta aabbcc origina frutos com aproximadamente 1.500 gramas e uma planta AABBCC, frutos ao redor de 3.000 gramas. Se essas duas plantas forem cruzadas, o peso aproximado dos frutos produzidos pelas plantas F será de a) 3 000 gramas. b) 2 500 gramas. c) 2 250 gramas. d) 2 000 gramas. e) 1 500 gramas. Questão 1252 A tabela a seguir classifica características hereditárias da espécie humana. Assinale a alternativa que corresponde à classificação correta.

esse gráfico, os indivíduos PPRr e Pprr estão incluídos, respectivamente, em a) IV e V b) IV e II c) III e II d) III e I e) I e V Questão 1254 Um estudante de 23 anos, doador de sangue tipo universal, é moreno, tem estatura mediana e pesa 85 kg. Todas as alternativas apresentam características hereditárias desse estudante que são influenciadas pelo ambiente, EXCETO a) Altura b) Grupo sangüíneo c) Cor da pele d) Peso Questão 1255 Em um dos modelos propostos para a determinação da cor dos olhos na espécie humana (herança quantitativa), são considerados cinco diferentes fenótipos. Na descendência de pais heterozigóticos para os locos determinantes desta característica, foram observados os dados apresentados no quadro abaixo. Analise-os, juntamente com o gráfico, e identifique a correção das proposições a seguir.

1.5.11

Questão 1253 Em certa espécie vegetal, a altura dos indivíduos determinada é por dois pares de alelos de efeito aditivo e segregação independente: cada alelo P e R determina 20cm

281

1.5.11

( ) Três pares de alelos justificam os resultados apresentados. ( ) Nos indivíduos de olhos castanho-claros, os locos em questão podem estar em homozigose ou em heterozigose. ( ) Indivíduos de olhos verdes apresentam homozigose em apenas um dos locos em questão. ( ) A probabilidade do nascimento de duas crianças de olhos azuis, a partir de um casal genotipicamente igual ao do exemplo dado, é de aproximadamente 0,004. ( ) A probabilidade do casal indicado no item anterior de ter duas crianças, sendo uma de olhos castanho-claros e uma de olhos verdes é de 3/16. Questão 1256 A cor da pele humana é conseqüência do efeito cumulativo de mais de um gene, de modo que cada gene contribui igualmente para o fenótipo. O gráfico que representa a proporção fenotípica nesse tipo de herança é

são fenotipicamente homogêneas: apresentam as mesmas características quanto à altura da planta e tamanho da espiga, ao tamanho e número de grãos por espiga, e a outras características de interesse do agricultor. Porém, quando o agricultor realiza um novo plantio com sementes produzidas pelas plantas C, não obtém os resultados desejados: as novas plantas são fenotipicamente heterogêneas e não apresentam as características da planta C; têm tamanhos variados e as espigas diferem quanto a tamanho, número e qualidade dos grãos. Para as características consideradas, os genótipos das plantas A, B e C são, respectivamente, a) heterozigoto, heterozigoto e homozigoto. b) heterozigoto, homozigoto e heterozigoto. c) homozigoto, heterozigoto e heterozigoto. d) homozigoto, homozigoto e heterozigoto. e) homozigoto, homozigoto e homozigoto. Questão 1258 A altura de uma planta depende de dois pares de genes, A e B. O gráfico adiante mostra a variação da altura dos descendentes de dois indivíduos diíbridos.

1.5.11

1.5.11 Com relação ao gráfico, julgue os itens que se seguem. (1) Os efeitos quantitativos dos alelos A e B são, respectivamente, 40 e 30cm. (2) A freqüência de descendentes heterozigotos, para os dois genes, é de 50%. (3) Estão ilustrados cinco genótipos. (4) A herança apresentada é poligênica.

Questão 1257 Uma empresa agropecuária desenvolveu duas variedades de milho, A e B, que, quando entrecruzadas, produzem sementes que são vendidas aos agricultores. Essas sementes, quando plantadas, resultam nas plantas C, que

282

Questão 1259 A altura de uma certa espécie de planta é determinada por dois pares de genes A e B e seus respectivos alelos a e b. Os alelos A e B apresentam efeito aditivo e, quando presentes, cada alelo acrescenta à planta 0,15m. Verificou-se que plantas desta espécie variam de 1,00m a 1,60m de altura. Cruzando-se plantas AaBB com aabb pode-se prever que, entre os descendentes, a) 100% terão 1,30m de altura. b) 75% terão 1,30m e 25% terão 1,45m de altura. c) 25% terão 1,00m e 75% terão 1,60m de altura. d) 50% terão 1,15m e 50% terão 1,30m de altura. e) 25% terão 1,15m, 25% 1,30m, 25% 1,45m e 25% 1,60m de altura. Questão 1260 Políticas de inclusão que consideram cotas para negros ou afrodescendentes nas universidades públicas foram colocadas em prática pela primeira vez na Universidade Estadual do Rio de Janeiro (UERJ), em 2001. Propostas como essas geram polêmicas e dividem opiniões. Há vários argumentos contra e a favor. Os biólogos têm participado desse debate, contribuindo com os conhecimentos biológicos referentes à raça e à herança da cor da pele humana, entre outros. Assinale a afirmação considerada correta do ponto de vista da biologia. a) Os critérios para se definirem duas populações como raças diferentes são científica e consensualmente determinados. b) Não encontramos, na história da biologia, dúvidas sobre a existência de raças na espécie humana. c) A cor da pele humana é um exemplo de herança quantitativa ou poligênica, o que significa que vários genes atuam na sua definição. d) O fato de a cor da pele não ser influenciada por fatores ambientais reforça a hipótese da existência de raças na espécie humana. e) A determinação da cor da pele humana segue os padrões do tipo de herança qualitativa e é um exemplo de co-dominância.

Questão 1261 As diferenças hereditárias entre os indivíduos de uma população podem ser classificadas em qualitativas e quantitativas. A esse respeito, assinale a opção correta. a) Na herança de caracteres quantitativos, existe um grande contraste entre as características que um dado traço fenotípico pode apresentar. b) Na herança de caracteres qualitativos, um dado traço de fenótipo apresenta-se sob grande variedade de formas, em geral com pequenas diferenças entre si. c) Altura, peso e cor da pele são exemplos de algumas características quantitativas do homem. d) Os caracteres qualitativos, em sua maioria, sofrem grande influência do meio. e) A altura não é uma característica hereditária, já que um indivíduo cresce menos se não receber a alimentação adequada na infância. Questão 1262 Determinada característica quantitativa depende da ação de cinco pares de genes. Do cruzamento entre dois indivíduos com genótipo AaBbCcDdEe resultam a) 5 classes fenotípicas. b) 9 classes fenotípicas. c) 10 classes fenotípicas. d) 11 classes fenotípicas. e) 15 classes fenotípicas. Questão 1263 A cor dos pêlos nas cobaias é condicionada por uma série de alelos múltiplos com a seguinte escala de dominância: C (preta) > C (marrom) > C‚ (creme) > c (albino). Uma fêmea marrom teve 3 ninhadas, cada uma com um macho diferente. A tabela a seguir mostra a constituição de cada ninhada.

283

1.5.12

1.5.12

A partir desses dados é possível afirmar que o macho responsável pela ninhada: a) 1 era marrom homozigoto. b) 1 era preto homozigoto. c) 2 era albino heterozigoto. d) 2 era creme heterozigoto. e) 3 era marrom homozigoto. Questão 1264 O controle genético de determinado caráter é feito por uma série de quatro alelos de um só locus. O alelo A é dominante sobre os alelos A‚, Aƒ e A„; o alelo A‚ é dominante sobre os alelos Aƒ e A„ e o alelo Aƒ é dominante sobre A„. Do cruzamento AA‚ x AƒA„ devem ser obtidas: a) quatro classes genotípicas e quatro classes fenotípicas. b) quatro classes genotípicas e duas classes fenotípicas. c) quatro classes genotípicas e três classes fenotípicas. d) três classes genotípicas e três classes fenotípicas. e) três classes genotípicas e duas classes fenotípicas. Questão 1265 Em uma população de organismos diplóides, foram encontrados quatro alelos diferentes para um determinado locus gênico, denominados S¢, S£, S¤ e S¥. A figura a seguir mostra, à esquerda, as diferenças na seqüência de DNA que caracterizam cada um desses alelos e, à direita, o par de cromossomos homólogos (metafásicos) onde esse gene é encontrado. Diante dessas informações, se um único indivíduo desta população for escolhido ao acaso, qual combinação alelo/posição cromossômica poderia ser encontrada no par de cromossomos metafásicos deste indivíduo?

Questão 1266 Se um caráter tem três alelos possíveis, podendo haver seis genótipos, e um segundo caráter apresenta oito genótipos possíveis, quando ambos forem estudados simultaneamente, podem ocorrer a) 7 genótipos. b) 12 genótipos. c) 24 genótipos. d) 48 genótipos. e) 96 genótipos. Questão 1267 Coelhos podem ter quatro tipos de pelagem: chinchila, himalaia, aguti e albina, resultantes das combinações de quatro diferentes alelos de um mesmo loco. Num experimento, animais com diferentes fenótipos foram cruzados várias vezes. Os resultados, expressos em número de descendentes, constam na tabela a seguir.

1.5.12

284

b) 4. o número máximo de alelos representados relacionados ao caráter em questão será igual a a) 2. Questão 1268 Suponha que em uma certa espécie diplóide exista um caráter relacionado com uma série de quatro alelos (alelos múltiplos). e) 10. Considere que os alelos "alf" e "beta" são co-dominantes e gama é recessivo em relação a ambos. b) a proporção de gametas com as formas não "crossing" seria maior do que a de gametas com as formas "crossing". d) 8. (08) seis fenótipos. sabendo-se que a freqüência de permutação é de 10% a) 30 b) 15 c) 270 285 . porque só as cromátides irmãs são envolvidas. e) não é possível calcular essas proporções. Em um determinado indivíduo da espécie referida. d) as proporções entre os tipos de gametas seriam iguais às que ocorrem quando os genes estão em cromossomos diferentes. correspondentes a quatro genótipos.e o animal progenitor aguti do cruzamento 1 for utilizado para a obtenção de filhotes com o progenitor chinchila do cruzamento 4. correspondentes a cinco genótipos. cada um correspondente a dois genótipos. (02) três fenótipos. e se cada uma originar 4 (quatro) gametas. podemos afirmar que: a) todos os gametas formados conterão as combinações resultantes do "crossing". e) 3 aguti: 1 chinchila. Questão 1269 Considere um gene que apresenta 3 alelos. c) 9 aguti: 3 himalaia: 3 chinchila: 1 albino. os locos dos genes A e B situam-se no mesmo cromossomo.5. b) 1 aguti: 1 himalaia. c) a ocorrência do "crossing" não altera a seqüência dos genes nos cromossomos. Tal gene deve determinar: (01) três fenótipos. Questão 1271 Em determinada espécie. d) 2 aguti: 1 chinchila: 1 himalaia. porque os gametas recebem cromossomos ao acaso.13 a) 1 aguti: 1 chinchila. "beta" e "gama". (04) quatro fenótipos. em cujos núcleos estão os cromossomos. c) 6. A porcentagem esperada de gametas Ab que o indivíduo formará é a) 10% b) 20% c) 30% d) 40% e) 80% Questão 1272 O cruzamento CD/cd x cd/cd produziu 300 descendentes. Questão 1270 No órgão reprodutor de um animal há 1000 (mil) células. Quantos deverão ser diferentes dos pais. (16) quatro fenótipos. cada um correspondente a um genótipo. Na meiose de um indivíduo duplo-heterozigoto AB/ab ocorre permutação entre esses locos em 80% das células. que proporção de descendentes poderemos prever? 1. aqui denominados "alfa". correspondentes a seis genótipos. como mostra o desenho a seguir: Se em todas as células ocorrer "crossing-over" entre os genes A e B.

40%. 10%. 20%. Quantos deverão ser diferentes dos pais. distam entre só 20 U. aB e ab produzidos por esse indivíduo deve ser. A freqüência de gametas AB.1.5 morganídeo.48. b) do comprimento da zona centromérica. b) 97 morganídeos. c) da existência do fenômeno da pleiotropia. Considere o seguinte cruzamento: 1.R. a) da distância entre eles. 10% e 10% 286 . Questão 1275 Em um caso de "linkage".5% Br . ocorre "crossing-over" entre esses genes em 40% das células. (unidades de recombinação). pode-se concluir que a distância entre os genes B e R é de: a) 48. a freqüência esperada de machos afetados pelos dois caracteres é de: a) 0 % b) 5 % c) 10 % d) 20 % e) 40 % Questão 1277 Pelo que se conhece da disposição dos genes dos cromossomos. dois genes A e B. respectivamente.48. 10% e 40% e) 40%. sabendo-se que a freqüência de permutação é de 20% a) 30 b) 90 c) 430 d) 360 e) 45 Questão 1274 Analisando-se dois pares de genes em ligamento fatorial ("linkage") representados pelo híbrido BR/br. c) 1.1.13 esse cruzamento. é de se esperar lhe a freqüência de permutação entre dois genes esteja na dependência.5% br . 20% e 30% c) 30%.5% bR . 40%.5% Pela análise dos resultados. d) 3 morganídeos. autossômicos. 20% e 20% d) 40%. uma certa espécie apresentou a seguinte proporção de gametas: BR . heranças recessivas ligadas ao sexo.d) 290 e) 45 Questão 1273 O cruzamento AB/ab x ab/ab produziu 450 descendentes. e) 50 morganídeos. d) do tipo de polimeria existente.5. Ab. e) da ausência de nucleotídeos covalentes. 40% e 10% b) 30%. 30%. a) 10%. Questão 1278 Na meiose de um indivíduo AB/ab.5 morganídeos. Considere o seguinte cruzamento: Fêmea (Ab/aB) X Macho (ab/ab) Qual é a freqüência esperada de machos com o genótipo AB/ab? a) 100% b) 50% c) 25% d) 10% e) 5% Questão 1276 Na espécie humana os genes que determinam a distrofia muscular Duchnne e a hemofilia. distam entre si 20 UR.

150 indivíduos que produziam sementes brancas e rugosas. o alelo dominante E condiciona pêlos normais e o alelo recessivo e. o grão colorido é condicionado por um gene dominante B e o grão liso por um gene dominante R. pêlos encrespados. eA = 25. obtidos a partir de cruzamentos EEAA×eeaa. No cruzamento entre um indivíduo colorido liso com um branco rugoso. b) EA = 20. d) Br/bR. 37. Os alelos recessivos b e r condicionam. originaram os seguintes descendentes: 160 com pêlos normais e albinos 160 com pêlos encrespados e selvagens 40 com pêlos normais e selvagens 40 com pêlos encrespados e albinos Assinale a alternativa que contém as porcentagens corretas de cada tipo de gameta produzido pelos indivíduos F. respectivamente.5 U. surgiu uma F. Ea = 10.5 U. a) EA = 10. a partir de um determinado cruzamento espera-se obter os seguintes descendentes: + + 10 + d 40 c + 40 c d 10 Esse cruzamento poderia ser a) ++/++ x cd/cd b) ++/cd x cd/cd c) +d/+d x c+/c+ d) +d/c+ x cd/cd e) +d/cd x c+/cd Questão 1280 Em camundongos. ea = 10. A partir desses resultados. ea = 30.R. c) EA = 25. podemos concluir que o genótipo do indivíduo parental colorido liso e a distância entre os genes B e R são a) BR/br. 62. c) Br/bR. O alelo dominante A determina pelagem selvagem e o alelo recessivo a. podemos afirmar que o mesmo a) diminui a variabilidade genética. 250 indivíduos que produziam sementes coloridas e rugosas e 250 indivíduos que produziam sementes brancas e lisas. albina. Questão 1282 Com relação ao processo conhecido como crossing-over.5 U.5. d) aumenta a variabilidade genética.75 U. grãos brancos e rugosos. 62. ea = 25.13 287 . b) separa cromátides homólogas. Ea = 40. ao serem cruzados com animais duplo-recessivos. com os seguintes descendentes: 150 indivíduos que produziam sementes coloridas e lisas. eA = 30. 37. Questão 1281 Numa certa espécie de milho.5 U. Ea = 25. eA = 40. d) EA = 30. Ea = 30.R.R. b) BR/br. Os indivíduos F. 18. 1. eA = 10. Questão 1283 O esquema a seguir refere-se a uma célula diplóide que.Questão 1279 Se a distância entre dois locos gênicos é de 20 unidades. c) corrige a recombinação gênica. e) troca cromossomos entre genes homólogos. sofrerá permutação entre os genes A e B. e) BR/br. ea = 20.R.R. e) EA = 40. Ea = 20. eA = 20. durante a meiose. ea = 40.

e) 20 ou 10 morganídeos. b) estão ligados e não há permuta entre eles. abCe. Questão 1286 Suponha que 100 células germinativas entram em meiose e que essas células tenham o seguinte genótipo: 1. Sobre os genes D e E podemos concluir que: a) estão ligados e há permuta entre eles. ABCe d) AbCe. (08) É o pareamento de cromossomos homólogos de modo a se tornarem bivalentes. aBCe Questão 1284 Com relação ao processo denominado permutação. Qual a posição relativa desses três genes no cromossomo? a) ZXY b) XYZ c) YZX d) XZY e) YXZ Questão 1288 Sabendo-se que as freqüências de permutação entre os genes A e C é de 20% e entre os genes B e C é de 10%. com os genótipos DdEe x ddee. d) 20 morganídeos. e c) AbCe. (04) É o processo que origina novos arranjos gênicos resultantes de trocas de fragmentos de cromátides homólogas. e) não estão ligados. logo segregam-se independentemente. (02) É a troca de micronúcleos entre indivíduos unicelulares para renovar o seu material genético. é correto afirmar: (01) É a troca de gametas que ocorre durante o cruzamento de dois indivíduos da mesma espécie. ABCe b) AbC. originou 42 descendentes com genótipo DdEe. a) AbCe. Questão 1285 Um cruzamento entre dois indivíduos. (64) É o processo responsável pela variabilidade genética entre organismos de uma mesma espécie. (32) É um processo que ocorre necessariamente durante a mitose.Assinale a alternativa que apresenta todos os tipos de gametas normais que podem ser formados por essa célula. Y e Z de um cromossomo. Questão 1289 Sabendo-se que as freqüências de permutação entre os genes A e C é de 40% e entre os genes B e C é de 15%. c) 10 ou 30 morganídeos. 168 ddEe e 40 ddee. d) segregam-se independentemente e não há permuta entre eles. aBCe. então a distância entre os genes A e B será a) 10 morganídeos. (16) É o processo de duplicação dos cromossomos para garantir a manutenção da espécie. c) segregam-se independentemente e há permuta entre eles. então a distância entre os genes A e B será a) 45 morganídeos.13 uantos gametas recombinantes serão formados se 20 das 100 células apresentarem permutação na meiose? a) 10 b) 20 c) 40 d) 80 e) 160 Questão 1287 Considerando os genes X. b) 30 morganídeos. aBC. 288 . ou crossing over. entre Y e Z há 30% e entre os genes Z e X ocorre 45%.5. 160 Ddee. e. aBCe e) AabCe. AbCe. AaBCe. sabe-se que há 15% de recombinação entre os genes X e Y.

d) 25 ou 15 morganídeos. B. organismos geneticamente modificados (OGM). considere as corretas: I. II. apresentam as seguintes freqüências de recombinação: A-B = 32% A-C = 45% A-D = 12% B-C = 13% B-D = 20% C-D = 33% A seqüência mais provável desses genes no cromossomo é a) ABCD b) ABDC c) ACDB d) ADBC e) ADCB Questão 1292 Na elaboração de mapas genéticos. 289 . O arroz transgênico apresenta variedades que contêm altos teores de beta-caroteno (precursor da Vitamina A) e que acumulam maior teor de ferro. por exemplo). Tomando por base os dados fornecidos no quadro a seguir. analise as proposições seguintes. nematóides etc) diminuindo a necessidade do uso de pesticidas. para os mesmos locos (cruzamento teste). Aumentam a produtividade (caso da soja. 6. Questão 1293 Os transgênicos. e) 40 ou 15 morganídeos. ( ) A recombinação entre os locos B e C. embora em diferentes freqüências. Resistem a certas doenças e pragas (insetos.14 Questão 1290 Supondo-se que a distância entre locos gênicos seja de 16 morganídios. Para isso. Está correta ou estão corretas: a) apenas I e II b) apenas II e III c) apenas I e III d) todas e) apenas uma das três vantagens. desenvolvidas em países asiáticos. ocorreu nos genótipos 5. ( ) A seqüência dos alelos no cromossomo em questão é A -------B-------C. ácaros. c) 40 morganídeos. utiliza-se o teste dos três pontos. C e D. Das afirmativas. para três locos ligados. são avaliadas as freqüências das classes fenotípicas na descendência de cruzamento entre indivíduos heterozigóticos (ABC//abc). A. estão merecendo uma atenção especial no mundo todo.b) 25 morganídeos. 7 e 8. ( ) Os fenótipos 7 e 8 resultaram de recombinação genética apenas entre os locos C e B. localizados no mesmo cromossomo. 1. Os produtos transgênicos apresentam algumas vantagens. ( ) No mapa genético. III. a taxa de recombinação entre eles é de a) 8% b) 16% c) 32% d) 42% e) 84% Questão 1291 Quatro genes. a distância entre os locos A e B é maior que a distância entre os locos B e C.5. o que indica um avanço biotecnológico nesta área. ( ) Os fenótipos 3 e 4 resultaram de recombinação genética entre os locos A e B. e indivíduos homozigóticos recessivos (abc//abc).

um espermatozóide de um macho da mesma espécie. Dele se formou um embrião que deu origem à Dolly. pois núcleo de b) inserção do gene num vetor ë transfecção do gene ë célula de glândula mamária não pode influir nas amplificação do gene. características da "Dolly". c) amplificação do gene ë transfecção do gene ë Questão 1296 inserção do gene num vetor. também necessário. Para criar a mangueira transgênica. pode-se afirmar que genitor ou por manipulação citogenética. núcleo de uma célula somática de uma ovelha adulta A para um óvulo de uma outra ovelha B do qual foi previamente Questão 1295 eliminado o núcleo. pois a genitora é a ovelha da raça "Scottish Blackface". mas o DNA Foram retiradas as células das glândulas mamárias de uma ovelha adulta da raça "Finn Dorset". Acerca do material genético desse novo originados pela multiplicação assexuada de um único indivíduo. Recentemente os jornais publicaram uma receita de a) o DNA nuclear e o mitocondrial são iguais aos da ovelha A.Questão 1294 As mangueiras. deve-se seguir um conjunto de etapas que começa pela construção de uma seqüência iniciadora ('primer'). podemos afirmar que: a) A clonagem está correta mas não revela a tecnologia necessária para as células "hibernarem" e acertarem o tempo. o pesquisador descobriu que o ambiente favorecia o desenvolvimento de um nematóide parasita de mangueira. mas o DNA guardaram o resto. filha da ovelha da raça "Scottish Blackface". indivíduo. uma vez que "Dolly" veio de seu a) transfecção do gene ë amplificação do gene ë óvulo. d) A clonagem está correta. mitocondrial é igual ao da ovelha B. A receita propõe os seguintes passos: c) o DNA nuclear e o mitocondrial são iguais aos da ovelha Os cientistas retiraram óvulos de uma ovelha adulta da raça C. uma vez que no seu genótipo há cromossomos de seu avô. b) "Dolly" não tem pai mas é. de clonagem. continuaram com baixa produção após a poda. A seqüência correta das etapas seguintes à construção do 'primer' é. Delas são retirados os mitocondrial é igual ao da ovelha C. núcleos. que consistem em: ele começou a se dividir. pois o pai é a ovelha da raça "Finn Dorset". reprodutor da ovelha "Scottish Blackface". A comunidade científica demonstrou ser possível a Os cientistas transferiram o núcleo da célula mamária para reprodução de seres vivos através de sofisticadas técnicas o óvulo da ovelha "Scottish Blackface" Passado um tempo. "Scottish Blackface". e) Há uma falha técnica no experimento. d) amplificação do gene ë inserção do gene num vetor Uma maneira de se obter um clone de ovelha é transferir o ë transfecção do gene. pela inserção de um gene que codifica uma toxina capaz de matar o nematóide. resumidamente. O embrião resultante é implantado no útero de uma terceira ovelha C. para a transferência do núcleo para o óvulo anucleado. O pesquisador sugeriu desenvolver uma linhagem transgênica dessa mangueira. certamente. ao contrário do esperado. formando um aglomerado de a) injetar. clonagem para "fazer" a ovelha "Dolly" da raça "Finn b) o DNA nuclear e o mitocondrial são iguais aos da ovelha Dorset". c) A clonagem está errada. B. Deles removeram os núcleos e d) o DNA nuclear é igual ao da ovelha A. que cedeu o óvulo anucleado. que são guardados. onde origina um novo Clone é um população de seres geneticamente idênticos. inserção do gene num vetor. Investigando o problema. Os ingredientes foram Questão 1297 colocados numa solução química para "hibernar" e esperar um tempo para serem encaixados nos óvulos anucleados. O aglomerado celular foi transferido para o aparelho 290 . Tomando por base o texto. células. e) o DNA nuclear é igual ao da ovelha A. cujo controle era muito difícil. dentro do óvulo de uma fêmea de uma espécie.

nas células reprodutoras de uma espécie. dentro do óvulo de uma fêmea. nesta célula anucleada. obtido por meio da técnica de clonagem. c) injetar. e) constituição cromossômica e DNA mitocondrial correspondente a uma mistura das três ovelhas. o mundo foi abalado pela notícia da produção do clone de uma ovelha. Questão 1299 Os pesquisadores da área de Genética demonstraram ser possível a reprodução de seres vivos por meio de aprimoradas técnicas de clonagem. b) os autossomos do clone são iguais aos da ovelha A. e) introduzir. É CORRETO concluir que: a) todos os cromossomos do clone são iguais aos da ovelha A. alguns genes de outra espécie. dentro do óvulo da fêmea de uma espécie. e) injetar. Esses pesquisadores retiraram o núcleo da célula de uma ovelha (A) e o implantaram num óvulo colhido de uma outra ovelha (B). c) constituição cromossômica e DNA mitocondrial da ovelha B. nesta célula anucleada. necessariamente. pode-se prever que Dolly apresente a) constituição cromossômica da ovelha A e DNA mitocondrial da ovelha B. o núcleo de uma célula ovo da mesma espécie. e os cromossomos sexuais são iguais aos da ovelha A. e) existem cromossomos no clone que são diferentes de A e de B. e os cromossomos sexuais são iguais aos da ovelha B.b) retirar e descartar o núcleo do óvulo de uma fêmea de uma espécie e injetar. Nessa clonagem. originando Dolly. Questão 1298 Recentemente. d) os autossomos do clone são iguais aos da ovelha B. meiose Na formação de clones de organismos pluricelulares ocorrem. que consistem em: a) injetar. Esse óvulo fora posteriormente implantado no útero de uma terceira ovelha (C). c) retirar e descartar o núcleo de uma célula somática de uma espécie e injetar. d) retirar e descartar o núcleo do óvulo da fêmea de uma espécie e injetar neste óvulo anucleado. utilizou-se o núcleo de uma célula da mama de uma ovelha (A) e o citoplasma de um óvulo de outra ovelha (B). b) constituição cromossômica e DNA mitocondrial da ovelha A. d) retirar e descartar o núcleo de uma célula somática de uma espécie e injetar. A partir dos dados envolvidos no experimento realizado pelos pesquisadores. Questão 1301 Considere os processos adiante: I. APENAS a) I e II b) I e III c) I e IV d) II e III e) III e IV Questão 1302 Se retirarmos o núcleo de uma célula-ovo de rã e o substituirmos por outro núcleo diplóide de uma célula de tecido muscular de rã adulta. alguns genes de outra espécie. reprodução sexuada III. o núcleo de um outro óvulo da mesma espécie. o núcleo de uma célula-ovo da mesma espécie. b) introduzir. um espermatozóide de um macho da mesma espécie. dentro do óvulo de uma fêmea. neste óvulo anucleado. o núcleo de uma célula somática de um indivíduo da mesma espécie. c) todos os cromossomos do clone são iguais aos da ovelha B. o núcleo de uma célula somática de um indivíduo da mesma espécie. produção de indivíduos geneticamente idênticos IV. do qual o núcleo fora previamente removido. nas células germinativas de uma espécie. e os cromossomos sexuais são iguais aos da ovelha A. a nova célula-ovo assim 291 . Questão 1300 Em fevereiro deste ano. o núcleo de um outro óvulo da mesma fêmea. d) constituição cromossômica da ovelha A e DNA mitocondrial da ovelha C. um grupo de pesquisadores divulgou ao mundo a ovelha Dolly. reprodução assexuada II.

Dentre as alternativas a seguir. a) Foi integralmente inativada. e) IV. cientistas de todo o planeta prometem empreender uma verdadeira reforma genética na natureza. VI. d) V. III. I. o "Projeto Genoma Humano". e) Expressou-se como na célula muscular. que teme pelos danos ao meio ambiente e à saúde. VI. ("Veja". considere as seguintes afirmativas: 292 . o que diminui a perda em caso de rejeição. III. em relação à seqüência funcional do DNA da célula diplóide doadora. c) Foi integralmente mantida ativa. uma vez que o governo britânico divulgou ontem o anúncio. IV. I. III. o que facilita a continuidade do processo. em relação à seqüência funcional do DNA da célula diplóide doadora. II. é: a) foi integralmente inativada b) foi integralmente mantida ativa c) expressou-se como na célula epitelial d) expressou-se como na célula germinativa Questão 1304 No fim de junho de 2000. 4/8/99) Agricultores britânicos que produzem alimentos transgênicos prevêem novos conflitos com ambientalistas. II. d) a regulação hormonal da reprodução nos vegetais é mais facilmente controlada pelos cientistas. como segue. Clonagem do primeiro mamífero a partir de uma célula de um animal adulto. I. c) V. pela Internet. Estabelecimento das leis da hereditariedade. d) Expressou-se como na célula germinativa. I. a nova célula-ovo assim formada será capaz de produzir outra rã normal. I. III. VI. de locais das novas plantações. que recebeu ampla divulgação na imprensa internacional.) Tendo em vista as vantagens e limitações das técnicas comentadas nos textos acima. foi considerado concluído. Identificação da localização cromossômica dos genes. II. estão destruindo as plantações de transgênicos do país.formada será capaz de produzir uma outra rã. Assinale a alternativa que explica. devido ao seu menor grau de complexidade. criar animais com órgãos humanos e produzir bichos que funcionem como farmácias ambulantes. porque a) os mecanismos de regulação gênica nos vegetais são mais simples. Questão 1305 Os conhecimentos científicos envolvendo a "clonagem" têm proporcionado à humanidade grandes avanços e sua utilização em vegetais tem sido mais fácil e menos controversa que em animais. neste caso. VI. Questão 1303 Se retirarmos o núcleo de uma célula-ovo de rã e o substituirmos por outro núcleo diplóide de uma célula de tecido epitelial normal de rã já adulta. a) II. podemos relacionar alguns fatos que marcaram época pela sua importância científica. O uso da técnica tem criado receio entre a população. depois de dez anos de trabalho. c) os vegetais apresentam. Transformação genética de bactérias para a produção de insulina humana. Assinale a alternativa que correlaciona os fatos mencionados anteriormente em ordem cronológica crescente. IV. e) os vegetais produzem maior número de embriões por indivíduo. VI. I. um marco no estudo da biologia. b) os embriões resultantes da clonagem em vegetais são mais resistentes às modificações ambientais. como forma de protesto. III. o que ocorre. IV. Surgimento da técnica de identificação das pessoas pelo exame do DNA. Questão 1306 Desde que a criação da ovelha "Dolly " foi anunciada há dois anos. V. Alguns manifestantes. b) II. ("O Estado de São Paulo. em sua maioria. V. V. a que apresenta a melhor explicação sobre o que ocorre neste caso. IV. corretamente. II." 17/8/99. VI. Numa breve história da genética. IV. Observação da estrutura espiralada do DNA. a capacidade de propagação vegetativa. V. III. b) Foi parcialmente inativada. Querem usar a clonagem para salvar pandas em extinção.

III e IV. ( ) Um DNA recombinante pode ser obtido a partir da união de um segmento de DNA bacteriano com um segmento de DNA de um outro organismo. (2) e finalmente é introduzido o núcleo da célula do atleta no ovócito enucleado. ( ) Com uma única transcriptase é possível cortar o DNA de uma célula em pontos da molécula onde existem diferentes seqüências de nucleotídeos. sendo descrita como uma estrutura membranosa que está envolvida no processo de regulação de cálcio.Os cientistas ainda precisam compreender melhor os mecanismos de controle de diferenciação celular. analise as proposições abaixo. é removido o núcleo de um ovócito. uma vez que o fenótipo é resultado do genótipo (DNA) mais as influências do ambiente. esses cromossomos devem estar em metáfase. eliminando o risco de rejeição imunológica. (1). ainda não totalmente avaliado. II. RNA). para um maior aproveitamento dessas técnicas. o material genético (DNA. ( ) A partir de um segmento de DNA. Questão 1309 O esquema a seguir mostra uma clonagem reprodutiva humana. São corretas a) apenas I. ( ) Os plasmídios não contêm genes essenciais à vida das bactérias. d) embrionárias são capazes de se diferenciar em outros tipos de células. eles podem ser utilizados como vetores genéticos. Por muito tempo. III e IV. IV . Essa nova célula. é possível obter-se um grande número de cópias do mesmo. II e IV.] 1. Nesse processo. II .1 om base nas informações desse esquema e em outros conhecimentos sobre o assunto. nŽ 195. o núcleo de uma célula somática de um tenista é retirado. o núcleo foi considerado uma organela que apresentava as seguintes estruturas: um envoltório. "Ciência Hoje". desde que cultivadas sob condições adequadas. 2003 [adapt. 293 . cientistas britânicos descobriram uma nova estrutura nuclear.15. c) de adulto são capazes de se diferenciar em outro tipo de célula. c) apenas II. Nos cortes são utilizadas as enzimas transcriptases reversas.5. e o adulto (5) terá praticamente as mesmas características fenotípicas do indivíduo que doou o núcleo. é transferida para um útero para que se desenvolva e forme um embrião. independentemente do seu tecido de origem. de um organismo introduzido em uma bactéria. Em 1997. porém. b) de um paciente podem ser usadas para regenerar seus tecidos ou órgãos lesados.I . (4). d) apenas III e IV.Os estudos de clonagem podem ser proveitosos para o estabelecimento de relações filogenéticas entre os organismos fósseis e os atuais. O embrião se desenvolverá.A introdução de um material genético exógeno (transgene) em organismo vivos pode determinar um risco ecológico. que foi denominada de retículo nucleoplasmático.A clonagem poderá auxiliar no esclarecimento dos mecanismos de envelhecimento e morte celular. (3). b) apenas I. II e III. e) I. o nucléolo e enzimas. III . Questão 1307 Analise este esquema relativo à obtenção de células-tronco: Questão 1308 Considerando o processo de clonagem do DNA. ( ) Para cortar o DNA dos cromossomos. é INCORRETO afirmar que células-tronco a) retiradas de embriões congelados eliminam as questões éticas e religiosas associadas à obtenção de órgãos para transplantes.

Óvulos distintos são fecundados por espermatozóides também distintos. que é uma organela citoplasmática. Concepção de um organismo a partir da fusão de um óvulo não fecundado. d) I. d) formação do celoma. c) nêurula. apenas. com o núcleo de uma célula somática retirada de um animal que se deseja copiar. do qual se retirou o núcleo celular. podemos dizer que são processos de clonagem: a) I. estruturas importantes no processo de tradução. Essas técnica permite. O gameta feminino (óvulo) de certos animais se desenvolve formando um novo indivíduo. entre elas as envolvidas nos processos de transcrição e replicação. (4). (1) As plantas obtidas de uma mesma cultura de tecidos são geneticamente iguais. principalmente para a obtenção de células-tronco.juntamente com proteínas . muito menos produtivas. apenas. a eliminação de infecções virais presentes na planta-mãe e que. apenas. 294 Com base no texto e em seus conhecimentos. pois as células podem ser manipuladas geneticamente e. sem que tenha sido fecundado. faz-se uma cultura de tecidos e. Quanto a este aspecto. pelo procedimento tradicional. podem-se obter indivíduos adultos com características alteradas.1 genético de plantas. c) a função do retículo nucleoplasmático é semelhante à do retículo endoplasmático. IV e V. b) gástrula.1. Questão 1310 Os morangos de excelente qualidade que se encontram atualmente nos supermercados são produto principalmente de técnicas de propagação vegetativa "in vitro". e) formação da notocorda. a partir desta. por exemplo. que são células indiferenciadas que podem dar origem a qualquer tipo de tecido. Com base nessa informação. (4) Uma vez obtida uma variedade de morangueiro com as características ideais. I. II. obtêm-se plantas adultas. IV. No seu interior. Tomando-se como referência a definição genética de clone e considerando as situações descritas. V. d) todo o DNA da nova célula formada na clonagem citada no texto. A partir de células de um morangueiro. é INCORRETO afirmar que a) o núcleo é uma organela exclusiva das células eucarióticas. Uma muda de violeta formada a partir de uma única folha que tenha sido destacada de outra planta e plantada em solo úmido e bem adubado. este .15. sendo que cada uma delas é composta por duas camadas de lipídios com proteínas inseridas. Questão 1312 Considere as cinco situações seguintes. apenas. (2) Uma vantagem dessa técnica é que as plantas produzidas não são suscetíveis ao ataque de pragas. julgue os itens adiante. Questão 1311 Um dos caminhos escolhidos pelos cientistas que trabalham com clonagens é desenvolver em humanos a clonagem terapêutica. (3) A cultura de tecidos vegetais facilita o melhoramento . e) o envoltório nuclear é formado por duas membranas. enquanto estas se encontram na fase de a) mórula. b) o nucléolo é responsável pela síntese do RNA ribossômico. III. c) I.forma os ribossomos. estão presentes várias enzimas. não se justifica preservar as variedades silvestres. será a célula doadora do núcleo. Formação de vários embriões a partir de um único zigoto.5. III e IV. II. as células-tronco podem ser comparadas às células dos embriões. originando zigotos igualmente distintos. a partir delas. b) I e II. seriam passadas para as plantas-filhas.

A clonagem de organismos tem se voltado mais para os animais porque. cientistas retiraram do intestino de insetos hematófagos fósseis moléculas de DNA de dinossauros. Os riscos ambientais da soja transgênica são pequenos. Estão corretas: a) I e II. c) I e IV. processo que exige cerca de três anos. ou seja. Ecologicamente. Questão 1315 No filme "Jurassic Park". criar um clone transgênico. IV. e) não existem técnicas para a inserção de fragmentos de DNA de uma espécie em outra. considere as quatro afirmações seguintes. com maior capacidade de gerar descendentes também resistentes. a crítica recai sobre o fato de que não se sabe se os genes introduzidos irão se expressar exatamente como no organismo doador ou se irão ativar também alguns genes inativos do genoma do organismo receptor. Uma linhagem de soja transgênica requer a produção inicial de 200 plantas resistentes ao herbicida e destas são selecionadas as dez mais "estáveis". em uma cadeia alimentar. na prática esse procedimento é extremamente improvável porque: a) seria necessário encontrar um genoma completo e conhecer sua ordem nos cromossomas. Aponte a alternativa que relaciona o procedimento e a justificativa corretos para que tal pesquisador tenha sucesso. elas estão menos diferenciadas do que as células germinativas nos testículos de um macho adulto. não foi possível. as cinco melhores são separadas e apenas uma delas é levada a testes de segurança. d) o DNA coletado sofre mutações durante o período em que ficou fossilizado. II. maior. d) Optar pela obtenção das células do cordão umbilical de recém-nascidos em vez de obtê-las da fase de gástrula. III. II. b) Trabalhar apenas com embriões em vez de organismos adultos. Em seguida. d) II e III. Um grande inconveniente entre a clonagem e a produção de transgênicos é que ambas não permitem sobreposição. ela já é conhecida e utilizada há certo tempo. quando as células já estão mais diferenciadas. ali. b) a composição química do DNA dos dinossauros é diferente das encontradas em espécies atuais. c) Conseguir células germinativas do ovário de uma fêmea adulta pois. Questão 1313 Sobre a clonagem de seres e a criação de organismos geneticamente modificados (transgênicos). quando ainda não é possível conseguir células tão indiferenciadas. A planta está passando por testes de segurança nutricional e ambiental. a) Obter células-tronco de embriões em fase de gástrula em vez de obtê-las da blástula. com relação às plantas. a existência de clones apenas aumenta o número de representantes de um determinado nível trófico. Tanto nos clones quanto nos transgênicos. já que ela não tem possibilidade de cruzamento com outras plantas e o perigo de polinização 295 . até o momento. Apesar da eficiência proposta no filme. e) Obter células do embrião em fase de blástula. b) I e III. c) as características do organismo se devem à estrutura primária das proteínas e não do DNA. Questão 1316 A Embrapa possui uma linhagem de soja transgênica resistente ao herbicida IMAZAPIR. A reconstituição dessas moléculas teria sido feita através da inserção de fragmentos de DNA de rã. inclusive na agricultura. já que no cordão a diferenciação é menor e o número de células. I. de Steven Spielberg. quando a indiferenciação é maior.e) I. em vez de obtê-las da gástrula ou do cordão umbilical. uma vez que em adultos não existem células-tronco. III. pode haver também alteração de posições e de elementos na cadeia. No caso dos transgênicos. Questão 1314 Um pesquisador precisa obter células-tronco para iniciar experimentos em terapia gênica. IV e V. e) III e IV. Esses descendentes são submetidos a doses de herbicida três vezes superiores às aplicadas nas lavouras convencionais.

Para a ligação do DNA transplantado ao DNA hospedeiro a célula utiliza a ENZIMA LIGASE. Analise as afirmativas a seguir. ela começou a brilhar. b) as doses de herbicida aplicadas nas plantas são 3 vezes superiores às usuais. II. Questão 1320 Analise as informações abaixo: I.). Caso você fosse escolher uma ilustração para um artigo sobre os transgênicos. d) a linhagem passou por testes nutricionais e após três anos foi aprovada. III e IV. A soja transgênica. II. etc. O belga René Magritte (1896-1967). respectivamente. Quando essa planta foi regada com a substância que o vaga-lume usa para produzir luz. ou modificado da mesma espécie. passa a apresentar novas características. A planta de fumo e a técnica utilizada para obtê-la são denominadas.15. deixou obras enigmáticas. no seu patrimônio genético. Suponha que você queira tomar a fábrica inexpugnável aos ataques de insetos. referentes à técnica utilizada para obtenção da Tracy. IV. e) a linhagem obtida foi testada rigorosamente em relação a sua segurança. Questão 1319 Uma planta de fumo foi produzida a partir de uma célula de fumo que havia recebido o gene responsável pela bioluminescência dos vaga-lumes.2 Questão 1318 "Tracy é uma ovelha transgênica. O catálogo com a receita para a produção dessas substâncias está no genoma. por exemplo. Animal transgênico é aquele que recebe e incorpora genes de outra espécie. Assim. As substâncias utilizadas para isolar o gene a ser transplantado são denominados ENZIMAS TRANSGÊNICAS. já temos bactérias fabricando hormônios humanos. b) mutante e técnica de clonagem. c) mutante e técnica do DNA-recombinante. b) I. mas o catálogo não possui a receita para isso. d) I.5.cruzada com outro tipo de soja é de apenas 1%. segundo o texto. capaz de produzir uma proteína humana cuja deficiência causa problema hepático e pulmonar". amido. e) II. e) transgênica e técnica de clonagem. c) I. algodão colorido e cabras que produzem fatores de coagulação sangüínea humana. III. A bactéria 'Bacillus thuringiensis' (Bt) contém um gene que leva à produção de uma enzima capaz de digerir o 296 1. a seguir. Estão corretas apenas as afirmativas: a) II e III. um dos pintores surrealistas mais importantes. Um organismo ao receber material genético de outra espécie. III e IV. a) mutante e técnica de miscigenação. estaria mais de acordo com esse tema tão polêmico? I. Uma saída é consultar os catálogos de outras espécies. II e III. A técnica do DNA recombinante foi utilizada para obtenção de Tracy. c) a capacidade da linhagem de cruzar com espécies selvagens é inexistente. Pense na batata (ou qualquer outra planta) como uma fábrica que produz a mesma substância (proteína. qual das obras de Magritte. apresenta baixo risco ambiental porque a) a resistência ao herbicida não é estável e assim não passa para as plantas-filhas. d) transgênica e técnica do DNA-recombinante. . Questão 1317 Os transgênicos vêm ocupando parte da imprensa com opiniões ora favoráveis ora desfavoráveis. II e IV. ou seja.

b) A batata passou a ser um alimento transgênico porque foi cruzada com gametas oriundos da bactéria. A engenharia genética tem ferramentas bioquímicas para tirar cópias dessas páginas do genoma. constituindo. c) Estudar a dinâmica de crescimento e de regeneração natural das florestas tropicais. Para que isso fosse possível. Essas bactérias são consideradas a) puras. d) Introduzir nas células de uma planta. d) A batata passou a ser uma alimento geneticamente modificado. a) Associar o desenvolvimento socioeconômico de cada região às suas características de relevo. pois sabemos que o genoma humano é homogêneo. Questão 1323 As questões ambientais têm sido motivo de preocupação sobretudo para as últimas gerações. V. uma nova espécie. d) transgênicas. incluir o gene no genoma da batata. a partir do cruzamento com a bactéria. cujos intestinos não oferecem condições para ela se manifestar. o que lhe conferiu resistência ao ataque de predadores. na última década do século XX. e com certeza não haverá ser humano sensível à ação biodigestora da toxina. pois a toxina digere o intestino desses animais. Questão 1321 A introdução de uma cópia de um gene humano no genoma do pronúcleo masculino de um zigoto originou uma ovelha transgênica. A biotecnologia já encontrou bactérias ou vírus capazes de fazer essa transferência. capaz de produzir hemoglobina. é preciso transferir esse gene para o genoma da batata. fazendo com que os novos genes sejam incorporados a seus cromossomos. ao tipo de população e às suas riquezas naturais. c) A batata geneticamente modificada é um alimento transgênico porque recebeu parte do genoma de uma outra espécie. VI. que porcentagem de descendentes portadores do gene humano espera-se obter? a) Zero. Questão 1324 Recentemente foi noticiada a criação de uma planta transgênica. c) 50 %. tiradas do jornal de "Folha de S. Paulo" de 03/07/1999. Assinale aquela que contém conceitos e informações científicas só disponíveis aos jovens. III. IV.intestinos dos insetos. Após a análise das informações acima. c) mutantes. a) A batata geneticamente modificada é um alimento transgênico porque recebeu um genoma completo da bactéria. As alternativas a seguir apresentam algumas atividades sugeridas para a melhoria da qualidade de vida humana e da saúde ambiental. d) 75 %. b) clones. ela poderá de transformar numa planta adulta que produzirá a toxina Bt. A planta inteira ficará impregnada com a toxina. Questão 1322 A engenharia genética possibilitou a introdução do gene humano para a produção da insulina em bactérias. e) Imobilizar o gás carbônico tanto pelo processo de fotossíntese como por meio da fabricação de móveis. o que lhe conferiu resistência ao ataque de predadores. A qualidade do ar e a importância da preservação da biodiversidade constam da pauta das discussões da humanidade há muito tempo. b) Cultivar espécies com crescimento rápido e utilizar esses conhecimentos para planejar plantações economicamente viáveis. Agora. Se essa ovelha for cruzada com um macho não-transgênico. Quando uma célula meristemática for geneticamente modificada. O besouro ou a lagarta que se alimentar dela morrerá. e) Podemos confiar na palavra dos biotecnólogos quando afirmam "A toxina Bt é inofensiva aos seres humanos". e) 100 %. a toxina Bt é inofensiva aos seres humanos. assinale a alternativa correta. genes de uma outra espécie. isto é. Segundo os biotecnólogos. essa planta recebeu: a) os anticódons que determinam a seqüência de 297 . b) 25 %.

e) somente os aminoácidos usados nessa proteína. Estão corretas: a) I. apenas. insulina humana para uso de diabéticos III. batata resistente a viroses II. questionamentos de cunho político. derivam exclusivamente de engenharia 298 . A transferência de genes bacterianos para o genoma de uma planta amplamente cultivada e usada na alimentação animal e humana vem gerando. b) I. Questão 1328 A engenharia genética causou uma revolução na biotecnologia. e) os transgênicos simplificarão muitas cadeias alimentares. científico e filosófico. não trazendo perigos para a humanidade. Com o uso dessa variedade. eliminando todos os competidores do homem e dos animais que ele cria. Questão 1326 Atualmente. d) A modificação genética dos alimentos consiste na transferência de material hereditário de um organismo para outro receptor. Sobre este tema. os alimentos transgênicos representam um tema de grande discussão.Não se sabe quais serão as possíveis conseqüências da ingestão desses alimentos. as técnicas de controle de pragas nas culturas de soja sofreram mudanças e os custos de produção diminuíram. II. o uso de herbicidas. d) eliminando-se as pragas da lavoura. gerando novas combinações genéticas. cuja seqüência de nucleotídeos determina a seqüência de aminoácidos da hemoglobina. b) os ribossomos utilizados na produção dessa proteína. juntamente com produtos obtidos por meios tradicionais. III e IV. II e IV. A esse respeito. d) I e III. Esta interferência do homem na natureza se dá por meio da engenharia genética. por conseqüência. soja tolerante a herbicidas Desses produtos. apenas. IV . III e IV.Trata-se de alimentos fabricados com produtos geneticamente modificados. Atualmente. beneficiando o meio ambiente. porém. para se obter uma espécie nova que não ocorre naturalmente. e) Os ambientalistas defendem o uso da engenharia genética pois os seus efeitos são totalmente previstos e controlados. prejudicando os atuais exportadores. apenas. Questão 1327 As técnicas de manipulação genética. c) II e III. que apresentam uma grande incidência de pragas na agricultura.Os ecologistas temem que as plantas transgênicas possam afetar o equilíbrio ecológico. III . muitas cadeias alimentares desaparecerão. I . o "round-up". poucos assuntos geram tanta controvérsia como os produtos transgênicos. Considere os quatro exemplos abaixo: I. e) II. II . utilizadas para a obtenção de seres transgênicos. diversos produtos biotecnológicos estão sendo comercializados.aminoácidos nessa proteína. milho resistente a insetos IV. Questão 1325 Atualmente. aumentando a produtividade e minimizando. destaque a afirmação correta: a) O objetivo dos cientistas é criar novas espécies. permitiram a criação do primeiro produto transgênico de grande impacto na agricultura: a soja resistente a um potente herbicida. c) o fragmento de DNA. c) Modificar um organismo geneticamente significa cruzar espécies diferentes. d) O RNAm que carrega os aminoácidos usados na síntese de hemoglobina.Pode-se gerar um animal transgênico que tenha a capacidade de produzir maior quantidade de leite com menor taxa de gordura. c) não se conhecem os efeitos que os transgênicos podem ter na saúde das pessoas. Esses questionamentos justificam-se porque a) o custo dos transgênicos será certamente maior do que o dos produtos convencionais. considere as seguintes afirmações. b) todos os países passarão a produzir soja. apenas. b) A aplicação da engenharia genética nos alimentos teve origem em países do terceiro mundo.

óleo de soja. 43. II e III d) I. outras conseqüências que o seu cultivo pode acarretar entre as quais estão: I. a necessidade de uso mais intenso de agrotóxicos. 100) Foram feitas as seguintes afirmações sobre organismos geneticamente modificados: I. a possibilidade de afetar insetos e outros animais do ecossistema. favorecendo a população mundial. III. porém.15. a possibilidade de transmitir seus genes de resistência a plantas de espécies aparentadas. maionese. Há grãos transgênicos usados no preparo de bolachas. Um transgênico possui em seu genoma um ou mais genes provenientes de outra espécie. III. p. II. ou então com melhores qualidades nutritivas. não transgênicas. mostarda e papinhas para crianças. Questão 1332 A charge a seguir foi produzida num momento em que no Brasil se discutem as possíveis vantagens e desvantagens da liberação do plantio e comercialização de plantas transgênicas. interferência na composição da diversidade local de insetos ocorre SOMENTE com a) I b) II c) III d) I e II e) I e III Questão 1330 Sementes transgênicas podem levar à produção de plantas resistentes a inseticidas. algodoeiros cujas folhas se tornaram impalatáveis para a herbivoria. Toda essas plantas são úteis para a espécie humana. o que aumenta e barateia a produção. III e IV e) II. pés de milho cujas sementes produzem hormônios de crescimento humano. II. Está correto o que se afirma em a) I somente. O processo de inserção de genes de uma espécie em outra é realizado com a ajuda de enzimas de restrição. ("Veja". tomateiros cujos frutos passam mais tempo amadurecendo no pé. a insetos e a vírus. III. cereais.genética SOMENTE a) I e II b) III e IV c) I. II e III. É possível que haja polinização entre uma planta transgênica com outras de uma mesma espécie. tornando-se mais saborosos. II. 1. entretanto. pães. Há desvantagens SOMENTE em a) I b) II c) III d) I e II e) II e III Questão 1331 Os alimentos geneticamente modificados são uma realidade cotidiana. 1886. n. e) I. São Paulo: Abril. massas.2 299 . ed. d) II e III somente. III e IV Questão 1329 Obtiveram-se plantas transgênicas com as seguintes características: I. ano 36. c) I e II somente. b) II somente.5. Há.

) Analisando-se a charge de acordo com os atuais conhecimentos biológicos. b) retornar uma célula diferenciada ao estágio de indiferenciada. que produz uma toxina contra lagartas. c) O que não é bom para os insetos pode não ser bom para os homens. regulamentados pelas normas de biossegurança. Isto envolve a natureza. A técnica de obtenção de organismos transgênicos produtores de proteínas humanas consiste em: a) remover artificialmente alguns nucleotídeos de uma molécula de DNA. além de servirem para a alimentação. são os principais riscos ambientais. de animais e do homem. produtos químicos. porque suas implicações são muito sérias. podendo misturar o DNA de microorganismos. o surgimento de ervas daninhas resistentes a herbicidas. Questão 1335 Em revistas e em jornais. é CORRETO afirmar: a) O que não faz mal para o homem não fará mal para os insetos. A transferência do gene Bt para as variedades de milho. o aumento do uso de agrotóxicos e a perda da fertilidade natural do solo." ("Revista Galileu". redução do uso de agrotóxicos.Edição 515. o homem poderá experimentar. Mas. além de mais nutritivos. que gera um novo organismo por multiplicação. porém o uso dos OGM tornaria os pequenos agricultores independentes em relação às empresas fornecedoras de sementes. as torna resistentes a certos tipos de insetos. c) DNA do coelho injetado no ovo foi transcrito para o RNA ribossômico que conduziu a síntese de proteínas nessa célula. quando genes de coelhos foram injetados em ovos de camundongos que se desenvolveram no útero de fêmeas dessa espécie. Nenhum cientista deixa de reconhecer o poder da tecnologia do DNA. d) Vários tipos de alimentos. Os camundongos que nascidos desses ovos apresentaram hemoglobina de coelho em suas hemácias. oportunizando melhores condições ambientais e sociais. Questão 1333 "Muito se tem falado sobre os transgênicos e praticamente todo mundo tem alguma opinião sobre o assunto. Questão 1334 O primeiro organismo transgênico foi obtido por volta de 1981. e) DNA do coelho injetado no ovo se incorporou a um cromossomo e passou a conduzir a síntese de proteínas nessa célula.(Jornal da "Ciência" . em 10 de outubro de 2003. e) A poluição genética. porque: a) RNA mensageiro do coelho injetado no ovo passou a conduzir a síntese de proteínas nessa célula. pois a ingestão da planta não lhe fará mal. d) Se os insetos experimentarem. a saúde humana e a economia. d) RNA mensageiro do coelho injetado no ovo se incorporou a um cromossomo e foi transmitido de célula a célula através de mitoses. b) Os defensores dos OGM enumeram a capacidade de aumento da produtividade agrícola. implicações e incertezas. como grãos. este tema não pode progredir na base do ser contra ou a favor. 300 . fumo. Nov/2003) Sobre os OGM (organismos geneticamente modificados). alterando assim o código genético do organismo. tornar os alimentos mais nutritivos e saudáveis e criar novos tipos de terapias e medicamentos. a perda de biodiversidade. plásticos e combustíveis. algodão. de plantas. leite e ovos. O problema está em algumas de suas aplicações. são constantes e cada vez mais freqüentes os noticiários sobre o uso de tecnologia transgênica com fim de obter proteínas de ação farmacológica ou mesmo proteínas terapêuticas humanas. podem ser usados para produzir remédios. c) A bactéria 'Bacillus thuringiensis' (Bt) é um agente de controle biológico encontrado no solo. batata e soja. é correto afirmar: a) OGM são produtos obtidos pela transferência de gene entre espécies similares ou diferentes. b) As plantas transgênicas são perigosas para a saúde animal. b) DNA do coelho injetado no ovo se incorporou a um cromossomo e foi transmitido de célula a célula através de mitoses. favorecendo toda população mundial.

c) clonado. Questão 1336 Responder à questão a seguir com base na ilustração. Desses ovos. que não possibilitou a produção de RNA e nem de luciferase. A tira de quadrinhos a seguir faz referência à manipulação de genes em laboratório.5. c) os genes da hidra apresentaram transcrição no organismo da planária. foram introduzidos certos genes da hidra em ovos de planária. representada na ilustração. que porta a totalidade do genoma. da genética atual. levando à produção de luz. de maneira a integrar o material genético. c) incorporou um segmento de DNA do vaga-lume. a reativar os seus genes e gerar um novo ser. seria possível produzir um rato a) sintético. a partir do qual as células da planta produziram RNA e luciferase. e) uma seqüência de DNA do elefante sofreu mutação devido à introdução do gene do vaga-lume em células daquele mamífero. e) a hidra e a planária nele utilizadas são organismos transgênicos. Com relação a esse experimento. a referida planta começou a emitir luz.c) induzir célula somática. que possibilitou às células da planta a produção de luciferase. a partir desta. d) incorporou um segmento de DNA do vaga-lume. b) apenas o vaga-lume é um organismo transgênico. Das células de vermes adultos. a partir do qual as células da planta produziram DNA e luciferase. Através da engenharia genética.15. c) uma seqüência de RNA do vagalume foi transferida para células do elefante. O resultado desse experimento indica que a planta a) incorporou um segmento de RNA do vaga-lume. e) transgênico. desenvolveram-se vermes portadores de tentáculos e de cnidoblastos com filamento urticante. esse gene foi transferido para uma célula vegetal e. foram isoladas moléculas de RNA e de proteína da hidra. obteve-se uma planta inteira.2 Se esse tipo de experimento realmente fosse concretizado.2 través da técnica. Questão 1338 Em um experimento. b) híbrido.15. d) transplantado. e) métodos biotecnológicos de cruzamentos seletivos para obtenção de novas espécies. Questão 1339 1.5. e) não expressou o gene do vaga-lume. d) ocorreu tradução do código genético da hidra no organismo da planária. 1. Após ser regada com solução de luciferina. enzima responsável pela oxidação da substância luciferina. b) segmentos de DNA da hidra apresentaram capacidade de replicação durante a embriogênese da planária. 301 . Questão 1337 No vaga-lume há um gene que determina produção de luciferase. d) introdução de um ou mais genes interessantes de uma espécie em célula hospedeira. poder-se-ia afirmar que a) o elefante e o vaga-lume são organismos transgênicos. d) o gene do vaga-lume controlou a produção de RNA e de proteína no interior das células do elefante. b) incorporou um segmento de RNA do vaga-lume. NÃO é correto afirmar que a) os genes da hidra se expressaram na planária.

produtos que sofreram 302 . é INCORRETO afirmar que a) as espécies de canola são transgênicas pois expressam genes que incorporaram de outras espécies. Estes novos segmentos de DNA introduzidos podem. na ausência do inibidor. serão expressas em culturas de bactérias contendo os plasmídios modificados. em presença ou ausência de glifosato. Num estudo para a identificação da variedade transgênica de soja. As atividades da enzima nesses extratos. foi medida. Estas passaram a apresentar a característica da canola transgênica. alto poder de resistência a herbicidas. foram constatados casos de transporte de pólen de espécies de canola transgênica para plantas silvestres (ervas daninhas). ou seja. é inicialmente necessário que sejam sintetizadas em laboratório cópias em DNA desse RNA. para gerar uma nova planta com novas características. gerar novas plantas com reservas modificadas de lipídios. a atividade da EPSP-sintase em extratos de folhas de diferentes tipos desse vegetal. As cópias. amido e proteínas em suas sementes ou melhorar a resistência das plantas a pestes e vírus ou ainda aumentar a sobrevivência destes organismos em ambientes adversos. apresentaram o mesmo valor. b) o pólen da canola transgênica transportou material genético para plantas silvestres. Questão 1341 As técnicas modernas de biologia molecular têm permitido a inserção de segmentos novos de DNA em células vegetais. por exemplo. mas evita o crescimento de outros vegetais indesejáveis. Essas cópias de DNA são sintetizadas em laboratório com o auxílio de uma preparação da enzima denominada de: a) RNA replicase b) RNA polimerase c) desoxirribonuclease d) transcriptase reversa Questão 1343 A enzima EPSP-sintase. e) as ervas daninhas passaram a produzir proteínas da canola transgênica. c) as espécies silvestres incorporaram e expressaram material genético da canola transgênica.5. d) o RNA da canola transgênica foi transferido e incorporado ao genoma das ervas daninhas. nas mesmas condições experimentais.2 A curva que corresponde à razão entre as atividades de uma enzima da variedade transgênica e as atividades dessa mesma enzima da soja comum é a indicada pela seguinte letra: a) W b) X c) Y d) Z Questão 1344 Considere o texto a seguir: "Os alimentos transgênicos. após introduzidas em plasmídios. o tratamento com esse herbicida não prejudica o desenvolvimento de culturas de soja transgênica. tornando-a resistente à inibição pelo herbicida glifosato. é modificada na soja transgênica. tornando-as resistentes a agentes químicos. em crescimento no meio apropriado. presente em praticamente todos os vegetais. Observe o gráfico: 1.15. Sobre esse fato. Assim. Estas novas plantas são exemplos de organismos criados por engenharia genética e são genericamente conhecidos como: a) reversos b) recessivos c) dominantes d) transgênicos Questão 1342 Para a clonagem em bactérias do hormônio do crescimento humano a partir de seu RNA mensageiro.Questão 1340 Recentemente.

d) O RNA mensageiro. No Brasil. onde também não há obrigação de alertar o consumidor. Eduardo Kac. Considere estas informações e assinale a opção incorreta: a) O gene para a produção de GH é.2 303 .. entre as quais o hormônio do crescimento (GH). utilizando técnicas de engenharia genética. e) todas as plantas transgênicas são estéreis a partir da segunda geração mutante. corretamente. Para conferir essa característica particular. Os benefícios [advindos de plantas transgênicas]. mas o consumidor não sabe disso: não há lei que obrigue os fabricantes a informar que o produto sofreu alteração genética.15. a multinacional Monsanto está tentando conseguir autorização do Ministério da Ciência e Tecnologia para produzir soja transgênica no país. porém. Criador e artista já disputam a posse da "transcoelha". d) as técnicas de transferência de genes por engenharia genética são altamente seguras. já ocupam prateleiras dos supermercados nos Estados Unidos e Canadá. pode-se concluir. 1500 se tornaram permanentemente inválidas e 37 morreram".alteração genética com o objetivo de melhorar a qualidade. e) O DNA relacionado à síntese do GH pode ser obtido a partir do RNA mensageiro. os pesquisadores criaram um coelho que produz em todas as suas células a proteína GFP (proteína verde fluorescente. Estas plantas são chamadas transgênicas. artista plástico brasileiro e professor de arte e tecnologia em Chicago. c) manipulações genéticas podem alterar o funcionamento dos genes naturais de um organismo. Questão 1346 Os cientistas franceses que criaram animal transgênico e o artista brasileiro que fez a encomenda entram em conflito. plantas que produzem proteínas humanas. o resultado mais trágico do uso de produtos transgênicos surgiu no Japão em 1989: 5000 pessoas ficaram doentes. Pela leitura do texto anterior. c) Antes de se obter a planta produtora de GH é necessária a produção do DNA recombinante. podem esconder riscos ainda não esclarecidos [. (FOLHA DE SÃO PAULO.5. obtiveram. em geral. na sigla em inglês). 1. quando introduzido na célula vegetal é transcrito em DNA na presença da enzima transcriptase vegetal.]. Questão 1345 Pesquisadores de alguns centros de pesquisa brasileiros. recentemente. b) a utilização de células vegetais diminui a possibilidade de contaminação humana por vírus animais. pois os resultados das experiências podem ser imprevisíveis. batizou de Alba a coelha transgênica que tem uma propriedade peculiar: seus olhos rosados e seus pêlos brancos ficam fluorescentes quando expostos à luz ultravioleta. Até o momento. presente naturalmente em medusas e que pode ser detectada sob luz ultravioleta. 6 de agosto de 1998). que: a) toda planta transgênica produz substâncias altamente tóxicas ao ser humano.. b) plantas transgênicas são aquelas cujos fenótipos se devem mais ao ambiente do que aos genes. introduzido no plasmídeo antes de sua introdução na célula vegetal. relacionado ao GH.

c) As enzimas de restrição agem em seqüências inespecíficas de DNA. O crescimento muscular é estimulado pelo fator IGF-1 e limitado pela miostatina. em indivíduos sedentários. referentes a diferentes questões de Genética. d) diminui a formacao de coagulos. c) evita o aparecimento do bocio. a) Introduzir nas células musculares novas cópias de RNA mensageiro que codifica o fator IGF-1. Sobre este assunto. 304 .geneticamente modificado . assinale a alternativa correta. b) aumenta o peristaltismo. são vetores do DNA recombinante.produz ’-caroteno (vitamina A). c) Introduzir nas células musculares nova cópia do gene do fator IGF-1. IV) A coelha transgênica foi produzida a partir da introdução de um núcleo extraído de uma célula de medusa em um óvulo de coelha cujo núcleo tenha sido anteriormente removido. Nessas pesquisas. III) As células fluorescentes da coelha produzem RNA mensageiro. 08/2004) Analise os procedimentos a seguir e aponte aquele que poderia promover o desenvolvimento mais duradouro da massa muscular. e) Ainda não é possível produzir plantas com genes ativos de insetos. ("Scientific American Brasil".terra. d) Injetar a proteína miostatina mutada que bloqueia a ação da miostatina normal por competir pelo seu receptor. Questão 1349 Através de técnicas da biologia celular.daptado de: http://paginas. que no processo de tradução origina a proteína GFP. se executado uma única vez. Dentre as afirmativas acima.com. como o de transformar células de bactérias. e CORRETO afirmar que o uso desse grão na alimentação humana resulta em benefício para a saúde porque ele a) previne alguns tipos de cegueira. utilizando técnicas aplicadas em terapia gênica. II) Apenas as células somáticas tiveram o gene que codifica a proteína GFP inserido em seu genoma. a) As enzimas de restrição hoje conhecidas são produzidas por diversas indústrias multinacionais. o homem tem desenvolvido grandes projetos.htm Considerando a tecnologia para obtenção de transgênicos. Questão 1348 O arroz dourado . A partir desse conhecimento é possível modular o crescimento muscular por meio de vários procedimentos. tal como a insulina. Assim sendo. Questão 1350 Analise as proposições a seguir. b) Injetar anticorpos produzidos contra a proteína miostatina. d) Cromossomos circulares presentes no citoplasma de bactérias. b) Organismos que recebem e manifestam genes de outra espécie são denominados transgênicos. sem deixar vestígios detectáveis em exames de sangue ou urina. a partir de DNA viral. chamados de bacteriófagos. são feitas as seguintes afirmativas: I) A coelha Alba é considerada transgênica pois possui em seu genoma um segmento de DNA de medusa. e) Injetar anticorpos produzidos contra o fator IGF-1.br/educacao/isaacelias/coelha. foi mostrada a existência de duas proteínas que atuam regulando o crescimento das células musculares: o fator de crescimento IGF-1 e a miostatina. somente estão corretas: a) I e II b) I e III c) I e IV d) II e III e) III e IV Questão 1347 Recentes descobertas têm provocado grande discussão por poderem alterar o futuro do esporte. para que estas produzam substâncias que normalmente não seriam produzidas.

para ocorrer a transcrição das enzimas codificadas nos genes 2.2 ( ) Certos microorganismos podem ser manipulados em laboratório para incorporarem. a Argentina e o Canadá. 3 e 4 (estruturais). I. milho. II e III estão corretas Questão 1352 "A reforma da natureza Em termos de cardápio diário. acidez do solo e escassez de água. segmentos do DNA de outro organismo. em testes laboratoriais para a detecção de gravidez em estágios muito precoces. casada com um homem (aabb). na produção de hormônios para a espécie humana. em seu material genético. plantas transgênicas.5. Tais anticorpos podem ser empregados. a) Incorporação e expressão de gene humano que codifica insulina por bactérias. é necessário que uma molécula produzida por um gene regulador (x) não reprima o gene operador (1). podem ser produzidos anticorpos monoclonais. dois filhos.) Vegetais modificados geneticamente são considerados transgênicos. cinco classes fenotípicas podem ser observadas na população. o país vem consumindo cada vez mais alimentos geneticamente modificados. reconhecidos como altamente específicos. ( ) Se dois pares de genes aditivos determinam a cor da pele no homem. c) a seleção de DNA mais adaptado existente numa determinada espécie. Nos últimos anos. por exemplo.. algodão. como soja. e) a adição de DNA exógero manipulado. A probabilidade de uma mulher (AaBb). Sua obtenção se dá com a) o cruzamento de duas espécies distintas. ( ) Por meios biotecnológicos. O DNA recombinante então obtido pode ser clonado e utilizado. a chamada comida GM. ilustrado no esquema (figura 2). Desenvolver variedades de plantas resistentes a herbicidas ou a insetos. d) a introdução de DNA em genomas das células dos vegetais já formados.) têm seu código genético alterado para ficarem mais viçosos ou resistentes a herbicidas e pragas.." (Adaptado da revista VEJA. apresentará fenilcetonúria. b) a incorporação de RNAm na célula zigoto das espécies. Questão 1351 Em todo o mundo. ter. já ocupam cerca de 40 milhões de hectares. ( ) No homem. por exemplo. ( ) Considerando o operon da lactose. Da análise das afirmativas acima podemos assegurar que: a) apenas I está correta b) apenas II está correta c) apenas I e II estão corretas d) apenas II e III estão corretas e) I.afirmativas a seguir. 16/06/99. tomate e muitas outras. é de 1/16. preocupação de longo prazo têm os ingleses. a pessoa expressará uma anomalia metabólica. Esses alimentos (. diferentes genes participam do metabolismo dos aminoácidos fenilalanina e tirosina. 305 1. um de fenótipo mulato-médio e o outro de fenótipo branco. Desenvolver variedades de plantas resistentes a geadas. em uma única gestação.53.15. batata. cada um determinando a produção de uma enzima. Questão 1353 Escolha a alternativa que apresenta um exemplo de transgenia. e essa mutação determinar a produção de enzima não-funcional. que mostram os objetivos da manipulação genética das plantas cultivadas. p. de 'Escherichia coli'. sendo os principais produtores os Estados Unidos. II. No caso ilustrado no esquema (figura 1). Desenvolver variedades de plantas que produzam frutos com melhor textura e de amadurecimento lento III. Considere as . da mesma espécie ou de outra espécie no genoma da espécie em estudo. Se ocorrer uma mutação em um determinado loco.

(01) Cientistas interferem na evolução natural das espécies. isto é. por isso o grão transgênico é mais nutritivo. julgue os itens a seguir. plantas e animais. d) Gene que sofreu mutações. Questão 1354 Porcos têm sido criados transgenicamente para que seus órgãos possam ser transplantados em homens. b) V . c) V . alterando geneticamente animais e plantas. 306 . que passam. (04) Os alimentos transgênicos não representam nenhuma ameaça à saúde humana. é uma das experiências bem sucedidas da transgenia. à obrigatoriedade da apresentação. Questão 1356 Acerca dos organismos transgênicos. (32) É fundamental o estabelecimento de limites. originando múltiplos alelos para um mesmo locus. (3) Os debates atuais a respeito dos transgênicos resumem-se à questão da rotulagem. como a cenoura. (08) a produção de insulina.F. Questão 1355 Foi transferido para plantas de arroz um gene que permite a produção e o acúmulo de vitamina A no grão das plantas transgênicas. (1) Transgênicos são organismos produzidos com a tecnologia do DNA recombinante. antes de chegarem ao homem. que permite a inclusão de genes de organismos de espécies diferentes no genoma de bactérias. e por isso não necessitam ser testados em outras espécies de animais.V . cientistas desenvolvem ovelhas "auto-tosquiáveis". de informação relativa à natureza transgênica do produto. Assinale a(s) proposição(ões) VERDADEIRA(S) sobre a transgenia e suas implicações com relação à saúde e ao meio ambiente. a produzir esse hormônio.V. deixando os vegetarianos confusos com a perspectiva de cruzar animais com plantas.F . (2) Organismos geneticamente modificados podem ser resistentes a produtos químicos como herbicidas. incontinentimente.F. tanto por parte dos cientistas como dos governantes.. A seqüência correta é a) V . com muitos genes em heterozigose. a partir de transferência de genes humanos para bactérias.14. na embalagem de alimentos produzidos com técnicas da biotecnologia..b) Desenvolvimento de um organismo completo a partir de uma célula somática.) A citação anterior mostra avanços da Engenharia Genética.V. ou agir como inseticidas. (16) Os organismos transgênicos são aqueles que recebem segmentos de DNA da mesma espécie. e) F . resultante do cruzamento de duas variedades puras distintas. c) Organismo que apresenta tanto estruturas reprodutoras masculinas quanto femininas. ( ) Uma importante fonte natural de vitamina A são os vegetais com pigmentos amarelos. ("CICLO VITAL". Assinale verdadeira (V) ou falsa (F) nas afirmativas a seguir. para que as manipulações genéticas não resultem em impactos ambientais irreversíveis. d) F . podem ser consideradas exemplos de biotecnologia aplicada à fabricação de organismos transgênicos. ( ) A vitamina A foi introduzida no núcleo das células. como a poliploidização. p. (4) As técnicas de melhoramento genético tradicionais. vol.F .V . gens de galinha são introduzidos em batatas.F. ( ) As vitaminas são necessárias em grandes quantidades. pois atuam como enzimas. e) Organismo mais vigoroso. (02) Os genes alienígenas permitem ao organismo receptor produzir substâncias que nunca produziriam em condições naturais. 1999. isto é. a lã cai sozinha no devido tempo.F . 4.

como a síntese de proteínas -. c) os camundongos receptores dos genes do coelho tiveram suas hemácias modificadas. nós e esses grandes macacos africanos somos 99% iguais. c) número de fosfatos contidos. A partir destas informações. que apresentam características diferentes. Quando se olha para os genes em si . Questão 1358 O primeiro transplante de genes bem sucedido foi realizado em 1981.10. Desse modo. levando à produção de ratos gigantes. E boa parte dessas modificações se deu de maneira trivial ao longo dos cerca de 6 milhões de anos transcorridos desde o ancestral comum de ambos.H. C e G) que compõem ambos os genomas. T. o caderno Mais! do jornal "Folha de S. desde que as espécies sejam do mesmo reino. Questão 1359 Com relação à técnica de criação de organismos geneticamente modificados (transgênicos). Essa afirmação a) não é válida. Esse tipo de teste é particularmente indicado para bebês e crianças pequenas. c) infectados.09. mas não foi incorporado aos seus genomas. ao se reproduzirem. continua-se considerando que homens e chimpanzés são espécies diferentes. Estes ratos são considerados a) isogênicos. em ratos. pela análise do DNA das células. ("Folha de S. Gurdon e F. desde que as espécies sejam da mesma ordem. Questão 1360 "EXAME DE PATERNIDADE. b) transgênicos. d) mutantes. pode-se dizer que a maior contribuição para a diferença fenotípica entre essas espécies seja devida à 307 . 20/08/98) Nesse tipo de teste. a semelhança estrutural existente entre as moléculas de DNA é tomada por base para a identificação da paternidade. mas não poderiam transmitir essa característica aos seus descendentes. pode-se deduzir que a) o DNA injetado foi incorporado apenas às hemácias dos camundongos. c) é válida. Questão 1361 CONSÓRCIO DECIFRA GENOMA DO CHIMPANZÉ. e) tipo de desoxirriboses presentes. por J.2001) afirmou: "O que torna a técnica tão atrativa e produtora de ansiedade é que qualquer gene de qualquer espécie pode ser transferido para qualquer outra espécie". As diferenças no DNA de humanos e chimpanzés são de apenas 4% dos quase 3 bilhões de bases (letras químicas A. d) tipo de pentose existente. e) o RNAm foi incorporado ao zigoto dos embriões em formação.W. injetando genes da hemoglobina de coelho em zigotos de camundongos. d) os camundongos transgênicos.isto é. Ruddle. independentemente de sua classificação.Paulo". e) é válida para todas as espécies. b) não é válida. transmitiram os genes do coelho aos seus descendentes. JÁ PODE SER FEITO COM SALIVA" "Novo teste pode.Questão 1357 A engenharia genética permitiu a introdução. b) o DNA injetado nos camundongos poderia passar aos seus descendentes somente se fosse incorporado às células somáticas das fêmeas dos camundongos. a duplicação de um conjunto de letras qualquer ou a deleção de outro. em função das informações do texto. os trechos de DNA que se traduzem em alguma função. com a mera troca de uma letra num gene. Essa diferença consiste na(o): a) seqüência de bases nitrogenadas. Paulo" (07. do gene humano para produção do hormônio de crescimento. d) é válida.2005) A despeito da similaridade genética. identificar a paternidade de uma pessoa sem a necessidade de coleta de sangue." (O GLOBO. se as espécies forem de classes diferentes. resultando camundongos com hemoglobina de coelho em suas hemácias. se as espécies forem de filos diferentes. e) clones. b) aspecto da dupla hélice presente. 01. para obtenção de camundongos transgênicos. NO BRASIL.

V. com o intuito de verificar se todos esses genes eram essenciais para a sobrevivência dessa espécie. IV e V apenas. b) quantidade de DNA presente no núcleo das células desses organismos. realizou-se um experimento com a bactéria 'Mycoplasma genitalium'. b) compreender mecanismos que tornam uma célula imortal. Quando um transposon é inserido aleatoriamente dentro de um gene. a humanidade viverá uma nova era. III. d) I e III apenas. b) todos os tipos de proteína codificados pelos genes humanos. IV e V. em 21 de junho de 2000. Questão 1364 Pelo Projeto Genoma Humano. No experimento I. Questão 1363 Os projetos genomas. o crescimento demonstra que o gene A não é essencial. d) a seqüência de aminoácidos de todas as proteínas humanas. o primeiro ministro britânico. a era da genética." "Folha Ciência". empenham-se no momento em descobrir a) a interação dos genes. e) seqüência de aminoácidos das proteínas. Em um laboratório. A bactéria 'M. No experimento II. Bill Clinton. Pelas pesquisas realizadas até hoje no Projeto Genoma Humano. e) o número correto de cromossomos da espécie humana. d) expressão diferenciada dos genes. foram feitas algumas afirmações. é capaz de inativá-lo. c) a seqüência exata de nucleotídeos de cada gene. 308 . III.3 Sobre esse experimento. Questão 1365 Nos últimos dez anos. d) quais nucleotídeos servem de molde para a síntese de RNAm. c) II. II.15. Questão 1362 O anúncio do seqüenciamento do genoma humano. c) garantir a cura de todas as patologias humanas. II. e os representantes dos grupos rivais. inclusive permitiu o estabelecimento de comparações genômicas com o intuito de analisar quais genes são típicos de um organismo e quais foram perdidos no processo evolutivo. isto é.a) seqüência de bases nitrogenadas no DNA. Questão 1366 "O genoma humano foi mapeado e sua seqüência estabelecida pela primeira vez na história da humanidade.27/6/2000. genitalium' sobrevive sem utilizar alguns de seus genes. 1. d) descobrir novos genes com funções ainda desconhecidas. como eles agem. o consórcio público internacional Projeto Genoma Humano (PGH) e a empresa norte-americana Celera. é possível. I.5. c) quantidade de lócus gênicos. e) como ocorrem a duplicação e as mutações dos nucleotídeos. b) I. IV e V apenas. que possui apenas 470 genes. IV. Se cada gene pode ser inativado por mutação. que estão sendo desenvolvidos em centros de pesquisas de vários países. anunciaram ontem o presidente norte-americano. o genoma mínimo essencial pode ser determinado. EXCETO: a) selecionar embriões com características desejáveis. a ausência de crescimento significa que o gene B é essencial. significa que os cientistas determinaram a) a seqüência de nucleotídeos dos cromossomos humanos. São Paulo . São afirmações CORRETAS: a) I. Tony Blair. b) a expressão dos genes. c) a seqüência de aminoácidos do DNA humano. o seqüenciamento do DNA revolucionou a ciência e gerou novos conhecimentos sobre seres procariotos e eucariotos. II.

foi possível preparar. I . como o das bactérias ('Xylela fastidiosa'). cada um de um casamento diferente.O seqüenciamento do genoma humano possibilitará a identificação dos genes envolvidos em doenças e a criação de novas abordagens preventivas ou de tratamentos mais rápidos e eficazes. ( ) O gene para produção de insulina no homem pode ser clonado em bactérias que passam a produzir este hormônio. todas as quebras provocadas pela radiação solar. a partir de fragmentos de tecidos. b) a clonagem de células. b) apenas II e III. Uma das formas possíveis de identificar os despojos dos filhos dessa senhora consiste em verificar se existe homologia do: a) DNA mitocondrial da senhora com o DNA mitocondrial das vítimas b) DNA mitocondrial da senhora com o DNA nuclear das vítimas c) DNA nuclear do marido e do ex-marido da senhora com o DNA mitocondrial das vítimas d) DNA mitocondrial do marido e do ex-marido da senhora com o DNA mitocondrial das vítimas e) DNA nuclear da senhora com o DNA mitocondrial das vítimas Questão 1368 Os avanços da Engenharia Genética têm permitido o conhecimento mais amplo dos cromossomos. ( ) O teste de paternidade com base no DNA deve ser realizado exclusivamente em indivíduos sem doenças sangüíneas. algumas questões de cunho ético têm sido levantadas. IV . ( ) O mapeamento gênico de um indivíduo permite informar se ele é portador ou não de genes causadores de doenças. hormônios e outros insumos terapêuticos. c) o DNA recombinante. analise os itens abaixo. é de grande auxílio para o Projeto Genoma Humano. Questão 1370 "A nova tecnologia do DNA recombinante está permitindo que cientistas dos países do primeiro mundo desenvolvam um projeto denominado GENOMA. II . especialmente no que se refere à produção de antibióticos. Ao lado dos inúmeros benefícios desse projeto." ("Ciência Hoje". e) a sonda de DNA. dos camundongos e ratos. vacinas. nos cromossomos humanos.O genoma humano pode ser seqüenciado a partir de qualquer célula do corpo. Na fase laboratorial. março/93) Em relação a esse projeto. que tem por objetivo seqüenciar os cerca de 3 bilhões de bases nitrogenadas que compõem os cromossomos de um ser humano. d) a hibridização de DNA. Sobre este tema. pode-se afirmar que estão CORRETAS a) apenas I e II. o método de produção do hormônio do crescimento envolve diretamente a) o seqüenciamento de DNA. III e IV.O seqüenciamento do genoma humano determinou a posição exata e a função de cada gene. com exceção das hemácias. o procedimento que pode afetar diretamente o equilíbrio genético de populações humanas é a) a detecção de indivíduos superdotados intelectualmente por meio de procedimentos laboratoriais. possibilitando a melhor compreensão dos diferentes fenótipos. Questão 1367 Em um acidente.Leia as proposições a seguir sobre o Projeto Genoma Humano. c) apenas I. III . Considerando as proposições anteriores. Faleceram no acidente dois filhos de uma senhora. como a hemofilia. embora os corpos das vítimas fatais fiquem queimados e irreconhecíveis. II e IV.O seqüenciamento do genoma de outras espécies. ( ) O Projeto Genoma visa a localizar. amostras de DNA nuclear e mitocondrial de todos os mortos. 309 . Questão 1369 Os avanços na área da biotecnologia permitiram melhores condições de assistência à saúde humana e animal. d) apenas I. e) todas as proposições.

empregando para isso testes de identificação genética. pois todos os resultados foram menores que 85%. através de uma mistura dos genes do pai e da mãe. do pai. b) A criança é filha de Pedro. por ser herdado do avô paterno. d) de o DNA mitocondrial. atualmente. e o resultado foi o seguinte. a família de Maria resolveu fazer um teste de paternidade. pois. permitir traçar árvores familiares confiáveis. c) A criança é filha de João. A Associação Civil "Avós da Praça de Maio" tem buscado localizar essas crianças com a finalidade de restituí-las a suas famílias legítimas. EXCETO a) Aumento da produtividade na agricultura b) Compreensão mais ampla das doenças genéticas c) Determinação da posição de proteínas nos cromossomos d) Diagnóstico precoce de doenças hereditárias Questão 1372 Na Argentina. e) de o DNA mitocondrial. garantir um registro familiar que se mantém de geração a geração. por ser herdado da avó materna. durante a ditadura militar iniciada em 1976.com. aproximadamente. b) de o DNA mitocondrial. d) o registro de patentes de seqüências do genoma humano para especulação mercadológica. através das mitocôndrias existentes no citoplasma do ovócito da mãe. 50% dos genes são herdados da mãe e 50%. a) A criança não é filha de nenhum dos supostos pais. envolveu a bactéria causadora da "praga do amarelinho".5. Paralelamente. por ser herdado do avô materno. Um deles. os DNAs devem ser diferentes. d) O teste não foi conclusivo. alegando que o filho pode ser de Paulo (irmão de Pedro). através das mitocôndrias existentes no citoplasma do espermatozóide do pai. 310 . através das mitocôndrias existentes no citoplasma do ovócito da mãe. Todas as alternativas apresentam benefícios de projetos que envolvem o seqüenciamento de genomas. seu ex-namorado. Antônio. (Fonte: abuelasatournet. Questão 1371 Alguns projetos de seqüenciamento genômico vêm sendo desenvolvidos por pesquisadores brasileiros. por ser herdado das duas avós. Essas crianças foram adotadas. c) o emprego de testes genéticos como um novo critério para admissão a empregos.3 Assinale a alternativa que interpreta corretamente os resultados do teste. vendidas ou abandonadas em orfanatos. permitir traçar árvores familiares confiáveis. que atinge plantas cítricas. por ser herdado da avó paterna. A escolha desse teste está relacionada com o fato a) de o DNA mitocondrial. nega a paternidade da criança. por exemplo. e) o uso de testes pró-sintomáticos para a realização de seguros de vida.b) o aumento de seleção genética ou gamética artificial. que são possíveis. irmãos adotivos.15. Questão 1373 Maria teve um filho e Pedro. Para solucionar esse impasse. ou de João (primo de Pedro). c) de o DNA mitocondrial. ou ainda de um vizinho. na verdade. para se hibridizarem. 1. pois deveríamos ter hibridizado o DNA do pai com o da mãe. permitir traçar árvores familiares confiáveis.ar) A comparação entre os DNAs mitocondriais de possíveis netos e avós tem sido um dos testes utilizados nesses processos de identificação de parentesco. muitas crianças foram seqüestradas com seus pais ou nasceram em centros clandestinos de detenção. o seqüenciamento completo do genoma humano foi anunciado pela comunidade científica internacional. e) Pedro e Paulo são. através das mitocôndrias existentes no citoplasma do ovócito da mãe. mesmo na ausência dos pais. permitir identificar a filiação com segurança. pois.

causadora da praga do amarelinho nos laranjais. . que contém cromossomos das duas espécies.. a Nasdaq. ou ausência. foi anunciado o seqüenciamento do genoma humano. c) o gene correspondente à proteína C está no cromossomo 6. II e III.. Por isso. no ano 2000.. 10/04/2000. II e III foram registradas para a presença ou ausência dos cromossomos humanos 1 até 8. (08) esse mapeamento já permitiu aos cientistas saberem a localização de todos os genes humanos. identifica-se mais facilmente um gene. p.Questão 1374 Na década de 1960. Depois do susto provocado no começo da semana pelos percalços jurídicos da Microsoft. bem como pela sua habilidade em produzir as proteínas humanas hipotéticas A. O oxigênio foi dado pelo anúncio de que cientistas americanos tinham chegado ao fim do rastreamento de um dos sonhos da medicina nesta virada de século: o mapeamento do genoma humano. C e D quando o seqüenciamento é realizado a partir de RNA mensageiro.. a Citosina..5. "A revanche veio na quinta-feira [06/4] passada. Quais estão corretas? a) Apenas I. Três linhagens somáticas híbridas designadas I. (16) um dos resultados possíveis dessa descoberta será a cura. recentemente seqüenciado no Brasil. e) a linhagem III contém o cromossomo 8.. de cada gene no DNA de células diferenciadas. 123. a Guanina e a Uracila . é CORRETO afirmar que: (01) o referido genoma está contido nos cromossomos. considere as seguintes afirmações. Com relação à organização genômica. Com relação a esse assunto.O genoma humano tem organização diferente da organização do genoma da bactéria 'Xyllela fastidiosa'.O genoma humano contém uma grande percentagem de seqüências de DNA que não codificam genes. Questão 1375 O que se imaginava impossível acabou acontecendo antes do prazo previsto: após a elucidação da seqüência de DNA de vários organismos. (04) apenas quatro bases nitrogenadas . 311 ." Trecho extraído do artigo: GENOMA: O PRIMEIRO ESBOÇO DO MAPA DA VIDA. publicado na "Revista Época". B. Duas células de origem diferente podem se fundir em uma única célula híbrida. II . A tabela abaixo contém uma grade hipotética de dados usados para mapear genes em seus cromossomos humanos apropriados. III . (02) a molécula sequenciada é o DNA.3 m relação à tabela é correto afirmar que a) o gene correspondente à proteína A está no cromossomo 1.15.a Adenina. Questão 1376 1. (. b) o gene correspondente à proteína B está no cromossomo 3.são possíveis de serem encontradas nesse mapeamento. que se constitui em um grande passo no mapeamento de genes humanos. de algumas doenças genéticas.). d) Apenas II e III.. no futuro. e) I. através da terapia gênica.A expressão dos genes humanos depende da presença. Georges Barsky desenvolveu a técnica de hibridização somática. I . b) Apenas II. o pregão eletrônico das empresas de alta tecnologia. d) o gene correspondente à proteína D está no cromossomo 4. c) Apenas I e II. voltou a respirar.

Para muitos especialistas [. O conhecimento dessa seqüência permitirá determinar a) o número de cromossomos presentes nas células humanas. representado a seguir. para torná-lo mais preciso. O resultado do teste. Sobre a utilização dos testes de DNA. a partir de testes de DNA. e as implicações dessa prática para os indivíduos e a sociedade em geral. Questão 1380 O exame de paternidade tem sido muito utilizado na medicina forense. a seqüência de substâncias que constituem os cerca de 2000 genes da cadeia de DNA. é a substituição de a) seqüência de substâncias por seqüência de nucleotídeos. com a identificação genética de criminosos e suspeitos. resultados com exatidão total. d) cadeia de DNA por cadeia de RNA. (04) para uma investigação de paternidade. (08) os exames de investigação de paternidade. O título referiu-se a uma reportagem da qual foi extraído o trecho a seguir: Depois da pílula anticoncepcional.. do genoma do parasita". é CORRETO afirmar que: (01) os testes de DNA podem ser empregados para finalidades de investigação de paternidade e também para identificação de supostos criminosos. anunciou em sua capa: "O DNA não falha". b) o número de proteínas que compõem os genes humanos. como pele e ossos. oferecem. (16) o custo do exame de DNA. ou seja. uma vez que podem ser entendidos como uma violação da privacidade biológica dos indivíduos. c) código genético por conjunto total de proteínas. vem gerando grande polêmica.] a técnica só traz benefícios. 1999. e) seqüência de substâncias por seqüência de aminoácidos. em países como a Inglaterra. no ano de 1999. (02) o melhor material biológico para um teste de DNA é aquele extraído de núcleos de glóbulos brancos do sangue. Soma ( ) Questão 1378 Em junho de 2000. mas outros tecidos. métodos que permitem a gravidez sem sexo. do pai e dos filhos. não restando qualquer questionamento ou dúvida sobre os diagnósticos apresentados. "Superinteressante". "Trabalhando sem parar desde o final de 1997. é um dos fatores que dificulta sua utilização em larga escala pelos segmentos populacionais menos favorecidos economicamente. Questão 1379 O texto a seguir apresenta os resultados do projeto de estudo do genoma da 'Xylella fastidiosa'. como em casos de estupros e assassinatos. b) código genético por seqüência de aminoácidos. 13(1):63. ainda muito elevado no Brasil. que transferiu para as mulheres o controle da fertilidade. coletam-se amostras biológicas do suposto pai. A idéia é descobrir.Questão 1377 A revista "Época".. a partir de testes de DNA. 3 bilhões de nucleotídeos do genoma humano. (32) a criação de bancos de dados. 312 . Jan. não sendo necessário obter informações do(a) filho(a) e de sua mãe. Esse teste baseia-se na identificação de marcas genéticas específicas que podem ser encontradas no DNA da mãe. d) o número de doenças que podem afligir a humanidade. atualmente. foi anunciada a conclusão da fase do Projeto Genoma Humano em que se determinou a seqüência de.. da fertilização "in vitro" e da barriga de aluguel. também podem ser utilizados. até abril. eles (os pesquisadores) já decifraram 75% do código genético dessa bactéria. aproximadamente. o teste de DNA surge como uma das grandes descobertas do mundo ocidental. e) o número total de genes humanos e quais as proteínas codificadas por esses genes. Outros acreditam que reflexos da descoberta vão alterar o universo das relações familiares. contém padrões dessas marcas de uma determinada família. c) quantas moléculas de DNA estão presentes nos cromossomos humanos. em 30/07/2001. (adaptado) Uma modificação que poderia ser feita nesse texto.

dos leucócitos e do plasma. Questão 1385 Uma loja de animais mantinha para venda 4 exemplares de 'Ara ararauna' (arara azul-e-amarela) e alegava aos fiscais que os exemplares haviam nascido em cativeiro. (0) Uma vez obtida a seqüência de um gene.576 RNAs mensageiros diferentes. por exemplo. que só foi descoberto depois da conclusão do projeto Genoma Humano em 2003. Questão 1381 Está em andamento o projeto GENOMA.15. d) é o que foi conseguido pelos pesquisadores há alguns anos. c) das hemácias. Questão 1384 O mapeamento de toda a seqüência de nucleotídeos existente nos 23 pares de cromossomos humanos a) é o que ainda falta fazer após a conclusão do projeto Genoma Humano em 2003. (2) Para 38% dos genes. b) das hemácias. comparando-se a seqüência de DNA de diferentes espécies. (2) A seqüência de todos os cromossomos será do mesmo tamanho. (3) O projeto GENOMA tem levantado questões éticas. obter a seqüência de bases nitrogenadas do DNA de todos os cromossomos de uma pessoa. será possível conhecer a seqüência de aminoácidos da proteína correspondente. e) significa decifrar o código genético. Em setembro de 1997.' Os números . pelo qual se pretende seqüenciar totalmente o DNA humano. d) dos leucócitos. d) IV pode ser filho adotivo do casal. mas não das hemácias. o principal componente do sangue.6 milhões de pares de bases. 1. e os genes que codificam proteínas são 4. Para surpresa de muitos. julgue os itens a seguir. como. e) dos leucócitos e das globulinas. (1) As seqüências obtidas corresponderão exatamente ao DNA de qualquer pessoa. foi publicada a seqüência do DNA da bactéria 'Escherichia coli. (1) O DNA da bactéria 'Escherichia coli' tem cerca de 9. (4) A 'Escherichia coli' pode produzir 8. c) é o que nos permitiria conhecer qual a real proporção de proteínas em relação às moléculas de DNA que possuímos. nos últimos 2 anos chegaram ao fim vários seqüenciamentos do genoma de bactérias. b) II não é filho deste pai. A esse respeito. e) III é irmão biológico de I. Questão 1383 Nos exames para teste de paternidade.impressionam: são cerca de 4. sendo apenas um passo no conhecimento de nosso genoma. (3) Pode-se fazer estudos da evolução das bactérias.5. o DNA. (4) Todos os genes terão a mesma proporção de adenina e guanina.288. julgue os itens que se seguem.3 Com o auxílio do texto. pelo eventual uso inadequado que se possa fazer do conhecimento obtido. é obtido a) das hemácias e dos leucócitos. Questão 1382 Enquanto o projeto que visa seqüenciar completamente o genoma humano segue seu curso. quando extraído do sangue. 38% desses genes ainda não têm uma função conhecida. não se sabe a seqüência de amionoácidos da proteína. assinale a alternativa INCORRETA: a) I é filho biológico do casal. mas não do plasma. principais células de defesa do sangue. a partir de 313 om base neste resultado. b) é a condição necessária para se saber o número de moléculas de RNA existentes em nosso organismo. ou seja. c) V não pode ser filho biológico deste casal.2 milhões de moléculas de fosfato. a discriminação de pessoas.

c) apenas os exemplares fêmeas. colocado sobre um gel suporte e submetido à corrente elétrica. que podem ser visualizadas por tratamentos específicos (coloração. c) cada uma pode originar fragmentos de DNA com tamanhos diferentes. no futuro. são utilizadas enzimas de restrição na engenharia genética. O DNA foi extraído das células por processos químicos. e) modificar seqüências de bases do DNA. por exemplo.4 Os resultados obtidos indicam que podem ser filhos do casal. cortando o DNA em locais determinados. d) cortar DNA onde ocorrem seqüências específicas de bases. d) apenas os exemplares 1 e 4. Para esclarecer a questão.5. a) os 4 exemplares. O padrão de bandas é exclusivo de cada indivíduo. fragmentado com enzimas específicas. c) inibir a síntese de DNA a partir de RNA. os fiscais do IBAMA suspeitaram se esses exemplares teriam nascido em cativeiro ou se teriam sido capturados na natureza. b) apenas os exemplares machos. colheu-se uma amostra de sangue de cada um dos animais e fez-se um teste para determinação de paternidade pelo método do DNA-Fingerprint. raios X. e) impedem a clonagem de moléculas de DNA recombinante. A migração diferencial dos fragmentos forma bandas (faixas) de DNA no gel. Questão 1387 Enzimas de restrição são fundamentais à Engenharia Genética porque permitem a) a passagem de DNA através da membrana celular. A ilustração apresenta o resultado do teste bacteriano. b) não existem em seres vivos. Sobre essas enzimas é INCORRETO afirmar que: a) reconhecem seqüências específicas de bases nitrogenadas. testes de laboratório utilizando a melatonina indicaram bons resultados para controlar o mal de Alzheimer. b) removem os fosfatos e as pentoses. mantido pelo criador. c) atuam como agentes de ligação entre DNA viral e . Com relação a essas substâncias é correto afirmar que a) são altamente específicas. d) permitem somente a ligação de pedaços de DNA de um mesmo tipo celular. sendo exclusivamente produtos da indústria química. 314 1. pode possibilitar. Questão 1388 Por sua capacidade de cortar o DNA em pontos específicos.15. deixando somente as bases nitrogenadas. Essa técnica tem por objetivo "corrigir o efeito da mutação" a) induzindo mutações nos genes responsáveis pela doença. Questão 1386 As enzimas de restrição são as principais ferramentas bioquímicas empregadas em Engenharia Genética. como a diabetes. originando fragmentos dessa molécula. b) inserindo cópias extras do alelo mutado.um casal mantido em um criatório autorizado pelo IBAMA. e) apenas os exemplares 2 e 3. Enquanto a cura de diabetes está sendo pesquisada através da engenharia genética. Contudo. por exemplo). A identificação de genes responsáveis por diversas doenças. que serão manipuladas. pode-se isolar um único gene de um cromossomo. d) são utilizadas nos atuais testes de DNA. e) fazendo-se uso delas. b) inibir a síntese de RNA a partir de DNA. o uso da terapia gênica. Fragmentos menores migram mais rapidamente em direção a um dos pólos da corrente. Questão 1389 Duas doenças não infecciosas que preocupam o homem moderno são a diabetes e o mal de Alzheimer. ou "impressão digital de DNA".

Questão 1390 A biotecnologia tornou possível a transferência de material genético entre os mais diversos organismos. b) O genoma exógeno é inserido no núcleo hospedeiro por meio de vetores protéicos conhecidos como plasmídeos. em bactérias. c) O DNA gênico endógeno é inserido no núcleo de células hospedeiras por meio de plastídeos funcionais. EXCETO a) Produção de parasitas das pragas b) Extração de inseticidas naturais c) Criação de comensais das pragas d) Produção de machos estéreis das pragas Questão 1395 Analise a figura a seguir. que representa um determinado experimento. Sobre a produção de organismos geneticamente modificados. c) auxiliar no processo de duplicação do DNA.c) substituindo o alelo mutado ou adicionando uma cópia correta do alelo. de proteínas humanas de interesse médico. e) auxiliar no processo de tradução do DNA. Essas "biofábricas" podem adotar todas as seguintes tecnologias. EXCETO a) Independência de pâncreas de animais para produção de insulina b) Obtenção de uma nova espécie de bactéria produtora de insulina humana c) Possibilidade de expressão em bactérias de outros genes de interesse médico d) Possibilidade de tratamento para pacientes com intolerância à insulina animal Questão 1394 Para minimizar o uso de inseticidas sintéticos na fruticultura e atender às normas de segurança alimentar da FAO ("Food and Agriculture Organization"). Questão 1393 A tecnologia do DNA recombinante permitiu a inserção e a expressão.15. b) reparar o DNA bacteriano que sofreu mutação deletéria. b) Recuperação de espécies extintas. d) Terapia gênica de algumas doenças hereditárias. e) Fragmentos de genes exógenos são inseridos no genoma das células hospedeiras por meio de plastídeos nucleares. é correto afirmar: a) Fragmentos de DNA exógeno são inseridos no genoma de células hospedeiras por meio de plasmídeos. c) Produção. do gene humano responsável pela síntese da insulina. que têm a propriedade de cortar o DNA em pontos específicos. provavelmente: a) proteger as bactérias contra os vírus bacteriófagos. Todas as alternativas apresentam resultados esperados do êxito dessa técnica. d) produzindo proteínas funcionais em organismos de outra espécie. Os conhecimentos da área são aplicados com sucesso na produção industrial da insulina e do hormônio de crescimento. estão sendo implantadas "biofábricas" de controle de pragas no Nordeste do Brasil. Questão 1391 As principais ferramentas empregadas na tecnologia do DNA recombinante são as enzimas de restrição. EXCETO a) Investigação de paternidade e criminalística. Questão 1392 Todas as alternativas apresentam aplicações da tecnologia do DNA recombinante nas duas últimas décadas. O papel biológico dessas enzimas bacterianas na natureza é. que são administrados a pacientes de todo o planeta. d) O DNA endógeno é transferido para genomas hospedeiros por meio de plasmídeos mitocondriais.5 315 . em bactérias. d) auxiliar no processo de transcrição do mRNA.5. e) inibindo a expressão do gene mutado nas células secretoras da proteína. 1.

Os números 1. c) DNA recombinante. e) enzima de restrição. d) enzima transcriptase reversa. d) eletroforese. Assinale a alternativa que apresenta. e) amniocentese. como as enzimas bacterianas. para o corte e a separação do segmento de DNA a ser estudado.5. d) A utilização de enzimas de restrição permite cortar o DNA nos locais onde reconhecem o ácido fosfórico. ( ) se duas diferentes moléculas de DNA forem cortadas por uma mesma enzima de restrição serão produzidos iguais conjuntos de fragmentos. é verdadeiro afirmar que: ( ) são utilizadas pequenas porções circulares de DNA.) Produção de DNA recombinante (plasmídio de uma bactéria/ gene do vaga-lume) 2) Introdução do DNA em célula de tabaco 3) Multiplicação da célula de tabaco com o gene do vaga-lume 4) Desenvolvimento de uma planta de tabaco com o gene do vaga-lume (planta que fluoresce) O experimento ilustrado é: a) produção de transgênicos. 316 . Isto pode ser feito graças ao instrumental bioquímico da engenharia genética disponível nos dias de hoje. corretamente. plasmídio e enzima de restrição. Questão 1397 Para um pesquisador transferir um gene de interesse.5 a) enzima de restrição. b) enzima transcriptase reversa. como a transcriptase reversa. a forma de atuação dessas enzimas. cromossomo circular e enzima de restrição. RNA plasmidial e enzima transcriptase reversa.15. soube pelos colegas que o assunto trabalhado fora Biotecnologia. ( ) promove-se o corte de moléculas de DNA com o uso de enzimas que reconhecem seqüências nucleotídicas específicas no DNA. Com relação a esse tema. Cada colega lembrou um aspecto das aulas. diferentes etapas são cumpridas em laboratório. RNA plasmidial e enzima exonuclease. Questão 1396 A manipulação genética de microorganismos. Questão 1399 Pedro estava doente e perdeu uma semana de aulas. respectivamente: 1. já possibilitou a obtenção de resultados benéficos para a medicina e para outras áreas do conhecimento. b) As enzimas de restrição cortam o DNA nos locais onde reconhecem o açúcar desoxirribose. Preocupado com os conteúdos da disciplina de Biologia. plasmídio e enzima ligase. separando-o sempre em nucleotídeos individuais. 2 e 3 indicam. c) aconselhamento genético. entre as quais: a utilização de enzima do tipo (1). Questão 1398 O Projeto genoma humano tem como objetivo determinar a seqüência de bases de todos os genes de nossa espécie. dispersas no citoplasma bacteriano e que têm replicação independente do cromossomo. ( ) são obtidos segmentos de DNA. com genes de interesse. conhecidas como enzimas de restrição. e) As enzimas de restrição quebram o DNA. a extração e o rompimento de (2). a) As enzimas de restrição cortam o DNA apenas nos locais onde existem certas seqüências de bases nitrogenadas. ( ) a tecnologia do DNA recombinante (ou Engenharia Genética) fundamenta-se na fusão de "trechos" de DNA de diferentes organismos para a construção de DNA híbrido. principalmente a manipulação de bactérias. b) hibridação intraespecífica. através de cortes com exonucleases. e a inclusão em (2) do segmento obtido (gene isolado) com o auxílio de enzimas do tipo (3). c) A utilização das enzimas de restrição permite separar moléculas de DNA de acordo com seu tamanho e carga elétrica.

plasmídio. a) eritropoietina . p.. respectivamente. julgue os itens abaixo. que utiliza DNA codificante. 3 e 4 representam. b) DNA recombinante.. . atuando sobre a medula óssea vermelha. DNA recombinante. vetor e plasmídio. 2. .leucocitose e) hormônio de crescimento . uma das quatro empresas em todo o mundo e a única no hemisfério sul a deter a tecnologia de produção desta insulina. Informe PADCT/Ministério da Ciência e Tecnologia.7(com adaptações).anemia b) insulina . DNA recombinante e organismo transgênico. c) DNA. ... o interferon e a calcitonina.5 om relação ao processo de clonagem gênica esquematizado acima... d) DNA transgênico. na ordem em que aparecem.De acordo com MARIANA. Indivíduos submetidos a hemodiálises são injetados com essa proteína e apresentam sua . clone e vetor.. deu início aos trabalhos...RAFAEL definiu proteoma como o conjunto de proteínas expressas pelo genoma. Esta conquista tecnológica permitirá o desenvolvimento de outros medicamentos.. Ao grupo da UnB coube a parte de Biologia Molecular. as enzimas de restrição são aquelas que podem cortar o DNA em pontos determinados...coagulação d) fator VIII .. como o hormônio de crescimento.. Mariana e Laura. (1) As técnicas de engenharia genética permitem a 317 . vetor. c) apenas as afirmações de Eduardo e Joana. a) DNA recombinante. Ao voltar à escola. d) apenas as afirmações de Rafael e Joana.. em 1988. Questão 1400 Assinale a alternativa que preenche corretamente as lacunas do parágrafo a seguir. b) apenas as afirmações de Mariana. e) as afirmações de todos os colegas. . Entre os importantes avanços conquistados pela tecnologia do DNA recombinante.... inicia em 1999 a comercialização do produto. um dos mais significativos produtos do avanço científico nacional na área da engenharia genética. Pedro conversou com a professora e constatou que estavam corretas a) apenas as afirmações de Eduardo.Segundo LAURA. Uma parceria entre a BIOBRÁS e a Universidade de Brasília (UnB). está prestes a chegar ao mercado com o nome de Biohulin: a empresa BIOBRÁS. plasmídio e transgene. reduzida. Questão 1402 CHEGA AO MERCADO UM NOVO FÁRMACO INTEIRAMENTE DESENVOLVIDO NO PAÍS A insulina humana recombinante (IH-r). desenvolvendo clones de bactérias produtoras de insulina. que.5. Com o auxílio do texto. vetor... Os rins produzem esse hormônio. jan/99.esterilidade Questão 1401 A figura a seguir representa de forma esquemática o processo de clonagem de genes do "Mycobacterium tuberculosis".EDUARDO lembrou que a identidade genética individual pode ser estabelecida pela técnica DNA 'fingerprint'...... ou impressão digital genética. estimula a divisão de células-tronco. Laura e Rafael. os números 1.. para fins terapêuticos.JOANA relatou que vacinas genéticas são usadas para inocular nas pessoas microorganismos vivos transgênicos ou atenuados. plasmídeos são utilizados como vetores para a clonagem de genes. em um plasmídio de bactéria.15. 1.. está a produção de . .diabetes c) plasmina ...

sugere uma melhora aparente do quadro clínico em pacientes com insuficiência cardíaca. Questão 1403 A expectativa em torno da utilização das células-tronco decorre do fato de estas células a) incorporarem o genoma do tecido hospedeiro. b) eliminarem os genes causadores da doença no tecido hospedeiro. ela deve receber altas doses dessa proteína. d) o padrão de atividade dos genes. c) No Brasil não há permissão para o desenvolvimento de pesquisas com célula-tronco. as células-tronco terão necessariamente que alterar a) o número de cromossomos. que mostra a diferenciação de células-tronco humanas nos elementos figurados indicados. o "autotransplante". Questão 1404 Células-tronco são células indiferenciadas que têm a capacidade de se diferenciar em diversos tipos celulares. d) A célula-tronco só pode ser obtida por clonagem terapêutica. a) As células-filhas geradas por ela são cromossomicamente e geneticamente diferentes da célula-mãe originando. segundo a Comissão Técnica Nacional de Biotecnologia (CTNBio). qualquer que seja a sua origem. (4) A partir da insulina produzida por bactérias.recombinação de genes entre organismos totalmente diferentes. (3) O Biohulin será um medicamento destinado ao tratamento de diabéticos. d) fundirem-se com o tecido hospedeiro. a "célula-tronco" tem a capacidade especial de se diferenciar e constituir diferentes tecidos no organismo. a não ser nas doenças genéticas.estadao. Questão 1406 Observe o esquema. Para que ocorra tal diferenciação.br/educando/noticias/2004/mai/10/ 69. cromossomicamente e geneticamente. e) a estrutura de genes específicos por mutações. pode ser obtido o hormônio de crescimento.htm) Enquanto as demais células do organismo só podem fazer parte de um tecido específico. Assinale a alternativa que aponta uma limitação do uso de célula-tronco para "possível e futura" cura de doenças genéticas. prática que.com. Por essa razão seu uso para a cura de doenças é bastante promissor. 1. eliminando as possibilidades de rejeição imunológica. (adaptado de http://www.5. b) As células-filhas geradas são cromossomicamente e geneticamente iguais à célula-mãe inclusive no caso de haver gene "defeituoso". provoca mutações e malformações. Por reprodução ela gera células.15. e) sofrerem diferenciação que as torna parte integrante e funcional do tecido hospedeiro.6 318 . portanto. e) O Brasil não tem cientistas especializados para a realização desse tipo de pesquisa. b) a quantidade de genes nucleares. Questão 1405 Segundo a doutora Mayana Zats (USP) um estudo recente com células-tronco retiradas da medula e injetadas no coração da própria pessoa. tecidos diferentes daquele que se deseja. (2) Para que uma bactéria passe a produzir insulina humana. idênticas a si mesma. c) a quantidade de genes mitocondriais. c) alterarem a constituição genética do tecido hospedeiro.

II. 14/02/2006 Sobre esse assunto. existem células-tronco capazes de dar origem a células diferenciadas de todos os tecidos humanos. Ele encontrou um grupo de genes que seguem um mesmo mecanismo e são mais ativos em células do cordão. d) Apenas 2 das células diferenciadas apresentam núcleo. Fonte: "O Estado de São Paulo". puderam formar tecido normal quando implantadas na região lesada do coração. com os epitélios intestinais e especialmente com o sangue. d) Na medula óssea de um adulto. Questão 1409 Alguns tecidos do organismo humano adulto se regeneram constantemente por meio de um processo complexo e finamente regulado. A alternativa que contém todas as afirmativas corretas é: a) I e II b) I e IV c) III e IV d) I. IV Questão 1410 Experimentos recentes indicam que células-tronco retiradas da medula óssea de um indivíduo adulto. c) Células-tronco podem ser encontradas em embriões. I. a) Células-tronco são células capazes de se diferenciar dando origem a diversos tipos de células. A hematopoese resulta da diferenciação e da proliferação simultânea de células tronco que. à medida que se diferenciam. e III e) II. As células-tronco podem ser retiradas. As células tronco têm grande poder de regeneração porque: a) têm todos os seus genes funcionando. III. b) todos os seus genes estão desligados. b) A capacidade de diferenciação das células precursoras se deve à alteração na expressão gênica específica. c) Plaquetas e hemáceas não apresentam capacidade de proliferação mitótica. Ele deseja descobrir maneiras de manipular os genes para obter melhores resultados terapêuticos ou estimular a formação artificial de tecidos. Questão 1408 A pesquisa com células tronco tem-se tornado de grande importância para recuperação de órgãos lesionados que não têm capacidade de regeneração de suas células.6 Um jovem biólogo de São Paulo descobriu porque as células-tronco do cordão umbilical são mais eficientes em transplantes do que as da medula óssea. Células tronco hematopoéticas apresentam potencial para diferenciar-se em qualquer célula do sangue e também gerar outras células tronco. Existe um aumento gradual da capacidade de auto-renovação das células durante este processo. portador de lesão no miocárdio. As diferentes linhagens hematopoéticas geradas no sistema apresentam altas taxas de proliferação. Questão 1407 BIÓLOGO MAPEIA GENES DO CORDÃO UMBILICAL. c) têm algo grau de especialização. Isso acontece com a pele. IV. a) A célula-tronco é pluripotente com capacidade de se diferenciar em diversos tipos celulares. como mostra o esquema a seguir: 1. II. III. d) são pouco especializadas.15. assinale a afirmativa INCORRETA. Baseado nas informações anteriores e nos conhecimentos sobre o tema. vão reduzindo sua potencialidade.5. em cordões umbilicais e também em diversos tecidos no indivíduo adulto. considere as afirmativas a seguir. b) Pelo menos 3 tipos de células diferenciadas no esquema dado são encontradas no sangue. de embriões em sua fase 319 . que tem suas células destruídas e renovadas constantemente. também. e) não se reproduzem com facilidade.Assinale a afirmativa INCORRETA.

b) Apenas II.embrionária . b) usando o mesmo pai genético. recebeu o nome de Snuppy . I.08. II e III. II e III. considere as seguintes afirmações. e) I.embrionária Questão 1411 Em março de 2005. O animal clonado. podemos afirmar corretamente que: a) é possível obter células-tronco embrionárias usando-se células diferenciadas de um adulto. e) I.embrionária d) embrionária . III. foi promulgada a Lei de Biossegurança. como habitualmente. 03. que nesses idosos deixou de produzir glóbulos vermelhos. isto é. d) I e II.inicial de desenvolvimento. é possível obter um outro clone que seja fêmea. que autoriza a pesquisa com células-tronco obtidas a partir de embriões humanos remanescentes de tratamentos de infertilidade armazenados por pelo menos três anos. posteriormente estimulado para que se dividisse e virasse um embrião dentro da mãe adotiva. da raça Labrador. II. A origem do problema estava na produção de glóbulos vermelhos pela medula espinhal.6 Considerando o uso terapêutico das células-tronco.embrionária .15. III . é : a) embrionária . apenas. respectivamente. A origem do problema estava relacionada à degeneração do baço. Ao invés de adultos jovens.adulta . eram os idosos que apresentavam uma expressiva redução na taxa de hemoglobina.5. b) II. Analise as hipóteses apresentadas pelos cientistas para tentar explicar esses casos incomuns. c) o clone gerado terá o genótipo Afgham e o fenótipo Labrador e será do sexo masculino. A origem do problema estava na produção de glóbulos vermelhos a partir de células-tronco da medula óssea.) A partir do texto e do que se conhece sobre clonagem. Considerando hipóteses plausíveis. utilizando uma célula obtida da orelha do pai genético.adulta .adulta b) adulta . c) Apenas I e II. d) Apenas II e III. apenas.2005. Questão 1412 Há vinte anos. Questão 1413 Cientistas sul-coreanos clonam pela primeira vez um cachorro.uma célula-tronco deve ter o poder de se renovar indefinidamente pela divisão celular. . II . ("Folha de S. e nasceu 60 dias após. da raça Afgham.adulta c) embrionária . Mais intrigante: a anemia dos idosos não cedia ao tratamento convencional. estão corretas: a) I. Os cientistas tiraram material genético da célula e o colocaram em um óvulo esvaziado do seu núcleo. II e III. casos incomuns de anemia começaram a chamar a atenção dos pesquisadores. aquelas possíveis de serem aceitas pela comunidade científica. c) III. apenas. I . A tabela a seguir informa as características de algumas variáveis analisadas em células-tronco embrionárias e adultas. Sobre essas células. a alternativa que indica o tipo de célula que possui a característica mais vantajosa para as variáveis I. apenas. 320 1.As células-tronco retêm o potencial de dar origem a células-filhas mais especializadas.A clonagem de células-tronco embrionárias pode ser utilizada com fins terapêuticos ou reprodutivos. Paulo". Quais estão corretas? a) Apenas I.

respectivamente. 3 e 4 Questão 1417 Uma planta feminina de angiosperma com genótipo PP foi cruzada com uma masculina pp. As sementes resultantes devem apresentar embrião e endosperma. Essa bactéria ataca o intestino humano fazendo com que o organismo elimine grande quantidade de água e sais minerais. usados como fonte na síntese 321 . d) doença de Chagas. Dentre as alternativas a seguir. considere as afirmativas a seguir. pois elas serão degradadas em aminoácidos. carboidratos. II. O prato tradicionalmente consumido pelo brasileiro apresenta elementos essenciais ao metabolismo. 4 . e) o ambiente celular do Labrador alterou a expressão genotípica do núcleo transplantado. As proposições que estão corretas são as indicadas por: a) 2 e 3 b) 1. como proteínas. e) Evitar comer alimentos crus. muito bem. Com o tratamento. c) doença do sono. pois o tradicional prato de "feijão. a) PP e pp b) Pp e Pp c) Pp e PPP d) Pp e PPp e) PP e Ppp Questão 1418 Os meios de comunicação têm noticiado. bife e salada" está sendo substituído por comidas industrializadas e com alto teor calórico. Questão 1414 A cólera é uma doença infecciosa causada por uma bactéria descoberta em 1884.Pertence ao gênero Bothrops e seu veneno tem potente ação neurotóxica e coagulante. Os órgãos envolvidos com a saúde pública têm mostrado preocupação constante com a dieta do povo brasileiro. que posteriormente recebeu o nome de 'Vibrio cholerae'. arroz. I. gorduras. vitaminas e sais minerais. Dentre estes um dos mais temíveis e agressivos do gênero é a cobra surucucu. Questão 1415 Células-tronco vêm sendo utilizadas com sucesso para amenizar os sintomas de pacientes com insuficiência cardíaca devida a infarto do miocárdio. b) Lavar as mãos com sabão antes das refeições e ao deixar o sanitário.Pertence ao gênero Crotalus e seu veneno tem ação neurotóxica e homolítica. Com relação à surucucu.O princípio ativo do seu veneno provoca intensa dor no local da inoculação. principalmente verduras e peixes.Seu veneno tem ação proteolítica e coagulante e o antiofídico específico é o soro antibotrópico. legumes e verduras antes de comê-los. e com água limpa. as lesões coronarianas reduziram-se a um nível mínimo. d) Lavar. b) malária. a) Beber somente água filtrada ou fervida. Questão 1416 Um sério risco a que está exposto o trabalhador rural em nosso país é o de acidentes com animais peçonhentos. A ingestão de proteínas é importante. frutas. 2 e 4 c) 3 e 4 d) 1 e 4 e) 2. Estima-se que o consumo de feijão e de arroz caiu em torno de 30% nos últimos anos. considere as proposições: 1 . especialmente no caso de se utilizar torniquetes. podendo haver gangrena. c) Tomar vacina tríplice periodicamente. que o Brasil está se tornando um país de obesos.d) o núcleo do óvulo inserido em uma célula de orelha anucleada origina uma fêmea Labrador. pesquisadores brasileiros da FIOCRUZ foram pioneiros em utilizar células-tronco da medula óssea de um paciente que apresentava insuficiência cardíaca devido a uma doença parasitária. A doença parasitária a que esse texto se refere é a a) amebíase. e) febre amarela. 3 . Com base no texto e nos conhecimentos sobre o tema. assinale aquela que NÃO é medida de prevenção desta doença. freqüentemente. 2 . causando desidratação. Recentemente.

II e III. razão pela qual questiona-se o consumo de alimentos transgênicos. cuja lesão pode levar à paralisia. c) infecciosa. II . d) o pâncreas. A parte retirada era a) o fígado. O sistema nervoso periférico poderá ficar inativo. que causa má formação dos ossos. cujo sintoma é o excesso de açúcar no sangue e a falta de insulina. que ficou famoso por interpretar o "Super-Homem". 322 .Após um acidente como o ocorrido com Reeve. Os carboidratos e lipídios da dieta são fonte importante de energia para os organismos. Recuperou-se e passou a viver normalmente. Reeve. já que foram diferenciadas em outra pessoa. I . b) I e IV. de onde são retiradas células da massa celular interna (células tronco) que têm capacidade de regenerar órgãos lesados. se houver comprometimento no sistema nervoso central. que causa problemas de coagulação sanguínea. b) I e III são corretas.das proteínas codificadas pelo organismo. analise as afirmativas a seguir. e) podem dar origem a todos os diferentes tipos de células sangüíneas.A clonagem terapêutica por transferência nuclear permite a obtenção de blastocistos. Questão 1422 A hemofilia se caracteriza por ser uma doença: a) adquirida. Os ácidos nucléicos ingeridos são incorporados ao DNA do organismo. d) I. III e IV. um paciente teve que se submeter a uma cirurgia que removeu uma parte do seu corpo.A utilização do colar cervical não evita lesões no sistema nervoso periférico. c) a hipófise. pois essas moléculas preservam. boa parte da energia gasta para a sua síntese. IV. Tal procedimento fundamenta-se no fato de que essas células-tronco a) podem ser usadas para a clonagem de células sadias do paciente. Estão corretas apenas as afirmativas: a) I e III. b) hereditária. e) contagiosa. apenas no sistema nervoso central. b) o diafragma. e) II. porque no interior da coluna vertebral está a medula óssea vermelha. a) I e II são corretas. III. c) II e IV. Marque a alternativa correta. d) Apenas III e correta. se houver suspeita de lesão na coluna vertebral. c) II e III são corretas. Questão 1420 O tratamento da leucemia por meio dos transplantes de medula óssea tem por princípio a transferência de células-tronco da medula de um indivíduo sadio para o indivíduo afetado. na forma de energia química. após um acidente. causada por um vírus e transmitida por mosquitos. Com relação ao assunto abordado. c) secretam substâncias que inibem o crescimento celular. e) o baço. d) congênita. que ficou tetraplégico em 1995 ao cair de um cavalo. por sua vez. era um ativista a favor das pesquisas com clonagem terapêutica para obtenção de células tronco. ingerem os leucócitos em excesso. o acidentado deve ser imobilizado na horizontal e utilizar um colar cervical para ser transportado até um hospital. que causa problemas de coagulação sanguínea. III . b) não serão afetadas pela doença. Questão 1421 Em outubro de 2004 faleceu o ator cinematográfico Christopher Reeve. d) podem dar origem a linfócitos T que. Questão 1419 Após um traumatismo.

.11 ssinale a afirmativa INCORRETA. ( ) Na espécie humana o sexo da prole é determinado pelo pai. e) capacidade de reprodução e hereditariedade. processo que engloba bactérias invasoras. Com base nos conhecimentos sobre o tema. analise as afirmativas adiante: ( ) A opção por indivíduos do sexo masculino pode ser justificada por sua menor suscetibilidade a doenças genéticas e por apresentarem um par de genes localizados nos cromossomos X e Y. duas dessas características assumem maior importância para a preservação da vida no planeta. comprovou-se que a determinação do sexo decorre de uma constituição cromossômica específica. A figura a seguir mostra.10. c) O tecido conjuntivo. especula-se sobre os mecanismos envolvidos na determinação do sexo dos humanos. Dentre elas. que apresenta os cromossomos sexuais X e Y no núcleo de suas células germinativas. b) A destruição de bactérias que invadem o tecido conjuntivo depende de moléculas enzimáticas produzidas pelos glóbulos vermelhos. invadido por células sangüíneas e bactérias. ( ) A tentativa de aborto por meio da ingestão de poções 323 1. que determinam uma maior longevidade para o indivíduo. a) Os neutrófilos são glóbulos brancos capazes de atravessar as paredes dos capilares sangüíneos. onde os pais muitas vezes optam pelo nascimento de um único filho do sexo masculino. Questão 1424 Embora a continuidade da vida na Terra dependa substancialmente de todo o elenco de características que definem os sistemas viventes. Acreditava-se que o sexo do embrião era definido por fatores como a nutrição materna. pode apresentar um quadro inflamatório. b) Os cromossomos autossômicos são os responsáveis pela determinação do sexo genético do indivíduo. de forma esquemática. Essa escolha é importante para estes casais uma vez que a constatação de um feto do sexo feminino pode provocar a decisão de um aborto não-natural.Questão 1423 O sangue pode realizar várias funções no nosso corpo. b) elevado grau de organização e execução das funções vitais. quando ocorre a fusão dos núcleos masculino e feminino. c) manutenção da homeostase e alto nível de individualidade. porque detecta as células fetais existentes no líquido amniótico e na placenta. um modo como essas células do sangue podem realizar seu papel de defesa. divisão celular e comportamento dos cromossomos na meiose. estes são distribuídos entre os espermatozóides. a de defesa contra microrganismos é realmente notável. após a meiose. d) consumo de energia e renovação contínua da matéria. identificando a presença do cromossomo sexual por meio da análise do citoplasma. São elas: a) composição química complexa e estado coloidal. c) A probabilidade de o genitor masculino produzir gametas do tipo Y é maior que a do tipo X. Nesse sentido. A partir dos estudos sobre herança mendeliana. Questão 1425 Desde a época de Aristóteles. e) O sexo genético é determinado pelo número de cromossomos X presentes no embrião. como ocorre na China. d) O embrião XX desenvolverá testículos e o embrião XY desenvolverá ovários. pois envolve um grupo de células especializadas. Questão 1426 Atualmente muitos casais têm-se interessado em escolher o sexo do futuro filho. d) Os glóbulos brancos que saem dos capilares podem realizar fagocitose. ( ) O exame de urina da mãe é uma técnica usada na identificação do sexo do futuro bebê. é correto afirmar: a) O sexo genético é determinado na fecundação.

c) do DNA recombinante. Questão 1427 A levedação do pão e a fermentação alcoólica são as primeiras tecnologias de que se têm notícia. b) de células-tronco. Esta vacina consiste do antígeno de superfície do vírus da hepatite B produzido em células de levedura. As leveduras mais usadas hoje. são as do gênero 'Saccharomyces'. no 195. Um suco de uva transforma-se em vinho e um repelente mingau de cevada e centeio torna-se uísque ou cerveja. Ciência Hoje. (Adaptado de Anita D. p. mas promover a má-formação do corpo do bebê e comprometer a saúde da mãe.62) Atualmente as leveduras têm sido usadas para produzir vacinas. Isto só é possível graças à tecnologia a) de clonagem de organismos. e) do RNA in vitro. como contra a hepatite B. Em todos esses casos o 'trabalho' é feito por uma levedura (um tipo de fungo).33. Panek. julho de 2003. d) do teste do DNA. v. em um processo usado há milênios pela humanidade para obter alimento e prazer.vegetais ou de outras drogas abortivas pode não eliminar o feto. na fabricação tanto de pães quanto de vinhos. 324 .

Sign up to vote on this title
UsefulNot useful