Título: A maior lista de genética da história!

Professor: André Braga Turma: AeB
Questão 1 O texto que se segue foi extraído de "Xadrez, truco e outras guerras", de José Roberto Torero. Servimos-nos de algumas de suas estruturas para introduzir a(s) questão(ões) seguintes. "Os abutres, sábios animais que se alimentavam do mais farto dos pastos, já começavam a sobrevoar a ala dos estropiados quando o General mandou que acampassem. Naquela tarde assaram trinta bois, quantidade ínfima para abastecer os homens que ainda sobravam.... O plano dos comandantes era assaltar fazendas da região e tomar-lhes o gado... À noite a ração foi ainda mais escassa, e, para enganar a fome, fizeram-se fogueiras para assar as últimas batatas e umas poucas raízes colhidas pelo caminho. Como o frio também aumentava, surgiu um impasse: quem ficaria perto do fogo: os coléricos, que logo morreriam, ou os sãos, que precisavam recuperar as forças para a luta?" (TORERO, J. Roberto. "Xadrez, truco e outras guerras") "(...) os coléricos, que logo morreriam, ou os sãos, que precisavam recuperar as forças para a luta?" Muitas doenças podem provocar a morte. a) A afirmação "os coléricos, que logo morreriam" é falsa ou verdadeira? Justifique. b) Justifique e exemplifique: Muitas doenças são hereditárias e sua manifestação está na dependência da ação de genes específicos ou de alterações cromossômicas. Questão 2 O texto abaixo refere-se às questões: 2 a 3 O experimento clássico de Meselson e Stahl, em 1957, demonstrou que a replicação do DNA era semiconservativa, ou seja, cada fita do DNA serve de molde para sua própria duplicação, formando moléculas de DNA idênticas à original. Nesse experimento, os cientistas cultivaram células de 'Escherichia coli' inicialmente em presença de fonte de ¢¥N (isótopo de nitrogênio leve), trocando, a seguir, por ¢¦N (isótopo pesado), que é incorporado às bases nitrogenadas do DNA. Colheram, então, amostras de DNA após a primeira e a segunda gerações de células crescidas em ¢¦N e analisaram essas amostras quanto à densidade do DNA formado. Considere como PESADO o DNA dupla hélice marcado com ¢¦N; como LEVE o marcado com ¢¥N; como INTERMEDIÁRIO o marcado com ¢¥N e ¢¦N. Justifique por que, após a troca da fonte de nitrogênio, a primeira geração de células foi totalmente constituída com DNA dupla hélice do tipo INTERMEDIÁRIO. Questão 3 Calcule as proporções dos três tipos de DNA dupla hélice LEVE, INTERMEDIÁRIO E PESADO - formados em células da segunda geração, após a troca da fonte de nitrogênio. Questão 4 "O agronegócio responde por um terço do PIB, 42% das exportações e 37% dos empregos. Com clima privilegiado, solo fértil, disponibilidade de água, rica biodiversidade e mão-de-obra qualificada, o Brasil é capaz de colher até duas safras anuais de grãos. As palavras são do Ministério da Agricultura e correspondem aos fatos. Essa é, no entanto, apenas metade da história. Há uma série de questões pouco debatidas: Como se distribui a riqueza gerada no campo? Que impactos o agronegócio causa na sociedade, na forma de desemprego, concentração de renda e poder, êxodo rural, contaminação da água e do solo e destruição de biomas? Quanto tempo essa bonança vai durar, tendo em vista a exaustão dos recursos naturais? O descuido socioambiental vai servir de argumento para a criação de barreiras não-tarifárias, como a que vivemos com a China na questão da soja contaminada por agrotóxicos?" (Adaptado de Amália Safatle e Flávia Pardini, Grãos na Balança. "Carta Capital", 01/09/2004, p. 42.) A contaminação por agrotóxicos também é mencionada no texto. A aplicação intensiva de agrotóxicos a partir da década de 1940 aumentou a produtividade na agricultura. Atualmente, são produzidas e cultivadas plantas
1

transgênicas, isto é, geneticamente modificadas para serem resistentes à ação de insetos. Um exemplo conhecido é o milho geneticamente modificado com um gene da bactéria 'Bacillus thuringensis' (Bt), o que lhe confere resistência a ataques de insetos. Contudo, alguns pesquisadores têm observado que diferentes espécies de insetos adquirem resistência às toxinas bioinseticidas produzidas por essas plantas. a) Explique como os insetos se tornam resistentes. b) Sabe-se que a aplicação intensiva de agrotóxicos, como o DDT, pode afetar a cadeia alimentar tanto de ambientes aquáticos como de solos. Explique por que isso ocorre. Questão 5 Atualmente, um grande esforço tem sido feito por diversos centros de pesquisa e de tratamento de pessoas queimadas para produzir grandes áreas de pele, do próprio indivíduo, que possam recobrir imediatamente áreas destruídas. Explique a vantagem de se utilizar a pele do próprio indivíduo para recobrir as áreas destruídas, ao invés de serem utilizados enxertos de pele de outras pessoas. Questão 6 O desenho a seguir mostra a síntese de um polipeptídio a partir da molécula de DNA num certo organismo. Esse organismo é um procarioto ou um eucarioto? Por quê?

b) A clonagem de bactérias, comparada à clonagem de animais, é um processo mais complexo ou mais simples? Justifique. Questão 8 O gráfico a seguir demonstra a distribuição citoplasmática do número de ribossomas isolados e polirribossomas, em comparação com o número de cadeias polipeptídicas em formação durante um certo período de tempo.

1.1.3.2

(Adaptado de ALBERTS, Bruce & outros. "Molecular biology of the cell". New York, Garland Publishing, 1994, p.239) a) Defina a relação existente entre os ribossomas isolados e a formação das cadeias polipeptídicas. Justifique sua resposta. b) Descreva a estrutura das cadeias polipeptídicas e a dos polirribossomas. Questão 9

1.1.1.2 Um certo tipo de macromolécula destinada à membrana plasmática celular, depende de etapas nucleares e citoplasmáticas para sua produção, de acordo com os percursos esquematizados a seguir:

Questão 7 Nas bactérias, a cadeia respiratória encontra-se associada à membrana plasmática e os ácidos nucléicos estão associados ao citoplasma. a) É assim também em um protista, em um animal e em um vegetal? Justifique.
2

Questão 12 Ribossomos são formados por RNA e proteínas, sintetizados pelos processos de transcrição e tradução, respectivamente. a) Onde esses processos ocorrem na célula eucariótica? b) O que acontecerá com os processos de transcrição e tradução, se ocorrer uma inativação na Região Organizadora do Nucléolo? Justifique. Questão 13 a) Por que essas etapas começam no núcleo? b) Qual é a composição da macromolécula ao final do percurso I? E do percurso II? Esclareça a diferença, baseando-se nas funções das organelas citoplasmáticas envolvidas em cada percurso. Questão 10 Uma espécie de lombriga de cavalo possui apenas um par de cromossomos no zigoto (2n=2). Um macho dessa espécie, heterozigótico quanto a dois pares de alelos (Aa Bb) formou, ao final da gametogênese, quatro tipos de espermatozóides normais com diferentes genótipos quanto a esses genes. a) Qual é o número de cromossomos e o número de moléculas de DNA no núcleo de cada espermatozóide? b) Quais são os genótipos dos espermatozóides formados? c) Por que, a partir das informações fornecidas, não é possível estimar a proporção em que cada um dos quatro tipos de espermatozóides aparece? Explique. Questão 11 Uma mulher com a idade de 40 anos está grávida do primeiro filho. Ela sabe que, devido à sua idade, o bebê tem maior probabilidade de ser portador de alguma anomalia cromossômica. A cariotipagem pré-natal é o exame mais indicado para esclarecer estas dúvidas na fase uterina. Pergunta-se: a) Em que consiste este exame? b) Que exemplos de anomalias cromossômicas podem ser detectadas através deste exame (cite dois exemplos). Criadores e sitiantes sabem que a mula (exemplar fêmea) e o burro (exemplar macho) são híbridos estéreis que apresentam grande força e resistência. São o produto do acasalamento do jumento ('Equus asinus', 2n = 62 cromossomos) com a égua ('Equus caballus', 2n = 64 cromossomos). a) Quantos cromossomos têm o burro ou a mula? Justifique sua resposta. b) Considerando os eventos da meiose I para a produção de gametas, explique por que o burro e a mula são estéreis. Questão 14 Considere as duas fases da meiose, de um organismo com 2n=6 cromossomos, esquematizadas a seguir e responda:

1.1.3.2

1.1.5.2

a) Que fases estão representadas na figura A e na B? Justifique. b) Que tipo de alteração aparece em uma das figuras? Em relação aos cromossomos, como serão as células resultantes de um processo de divisão com essa alteração? c) Dê um exemplo de anomalia que seja causada por este tipo de alteração na espécie humana, cujo número normal de cromossomos é 2n = 46.

3

Questão 15 O gato siamês é um animal de rara beleza pois a pelagem de seu corpo é clara com extremidades - orelhas, focinho, pés e cauda - pretas. A presença do pigmento que dá a cor negra a essas extremidades é o resultado da atividade de uma enzima que fica inativada acima de 34°C. Explique por que esses animais têm a pelagem negra nas extremidades do corpo. Questão 16 Desde 1995 alguns estados norte-americanos estão excluindo o ensino da teoria de evolução biológica dos seus currículos escolares alegando, entre outras razões, que ninguém estava presente quando a vida surgiu na Terra. Alguns cientistas defendem a teoria da evolução argumentando que, se é necessário "ver para crer", então não poderemos acreditar na existência dos átomos, pois estes também não podem ser vistos. (Adaptado da "ISTO É", 25/08/1999.) a) Apresente três evidências que apóiam a teoria da evolução biológica. b) A mutação gênica é considerada um dos principais fatores evolutivos. Por quê? Questão 17 Dois 'loci' de uma população, cada um com dois gens alelos, sofrem a ação da seleção natural por muitas gerações, como é mostrado nas tabelas abaixo. O coeficiente de seleção (S) indica os valores com que a seleção natural atua contra o genótipo. O valor adaptativo (W) representa os valores com que a seleção natural favorece o genótipo. Note que (W+S)=1. Qual dos gens, A‚ ou B‚, apresentará a maior freqüência na população? Explique. Questão 18 No porquinho-da-índia existe um par de genes autossômicos que determina a cor da pelagem: o alelo dominante B determina a cor preta e o recessivo b, a cor branca. Descreva um experimento que possa evidenciar se um porquinho preto é homozigoto ou heterozigoto. Questão 19 Nos porquinhos-da-índia, a pelagem negra é dominante sobre a pelagem branca. Um criador tem um lote de porquinhos-da-índia negros, com o mesmo genótipo. O que deve fazer para descobrir se esses animais são homozigotos ou heterozigotos? Justifique sua resposta. Questão 20 Uma anomalia genética autossômica recessiva é condicionada por uma alteração na seqüência do DNA. Um homem portador dessa anomalia apresenta a seqüência timina-citosina-timina enquanto sua mulher, que é normal, apresenta a seqüência timina-adenina-timina. A análise do DNA de um filho do casal mostrou que ele é portador tanto da seqüência de bases do pai quanto da mãe. a) O filho terá a doença? Por quê? b) Qual a probabilidade de um outro filho do casal apresentar as duas seqüências iguais à da mãe? Questão 21 Um homem afetado por uma doença genética muito rara, de herança dominante, casa-se com uma mulher, não consangüínea. Imagine que o casal tenha doze descendentes, seis filhos e seis filhas. Responda,
4

1.4.1.6

justificando sua resposta, qual será a proporção esperada de filhas e filhos afetados pela doença do pai no caso do gene em questão estar localizado. a) em um autossomo; b) no cromossomo X. Questão 22 Em ervilhas o caráter semente lisa é condicionado por um gene dominante R e semente rugosa pelo seu alelo recessivo r. Quais são as proporções genotípica e fenotípica obtidas na autofecundação de uma variedade comprovadamente heterozigota? Questão 23 "Hormônios são proteínas cuja função é regular os complicados mecanismos do organismo - como o aumento e redução do peso do corpo (...) Em outubro, o geneticista Jeffrey Friediman (...) isolou o primeiro hormônio capaz de controlar o peso, chamado leptina. Ele é produzido por um gene que, quando funciona mal, o organismo ganha peso (...)". (In: "Superinteressante" - ano 10, nŽ 3, mar., 1996.) Com base no texto, RESPONDA: a) Como se denomina o local que o gene ocupa no cromossomos? b) Considerando de forma simplificada a existência de dois alelos para o gene da leptina, um normal (L) e outro mutante (L'), quantos genótipos diferentes são possíveis em humanos diplóides? Quais são eles? c) COMENTE sobre um mecanismo que pode levar à mutação gênica. Questão 24 No início do século XX, a transmissão das informações genéticas para os descendentes era explicada por algumas hipóteses sobre as leis da hereditariedade, como a mendeliana e a por mistura. Observe os esquemas:

1.5.1.1

Suponha que, em um indivíduo de uma população com reprodução sexuada, apareça, por mutação, um gene raro que confira ao seu portador características vantajosas. Indique, para cada uma das hipóteses representadas, se há ou não possibilidade de aumento da freqüência do gene mutante na descendência desse indivíduo e justifique suas respostas. Questão 25 Leia o texto a seguir. "A Doença de Alzheimer (D.A.) (...) é uma afecção neurodegenerativa progressiva e irreversível, que acarreta perda de memória e diversos distúrbios cognitivos. Em geral, a D.A. de acometimento tardio, de incidência ao redor de 60 anos de idade, ocorre de forma esporádica, enquanto que a D.A. de acometimento precoce, de incidência ao redor de 40 anos, mostra recorrência familiar. (...) Cerca de um terço dos casos de D.A. apresentam familiaridade e comportam-se de acordo com um padrão de herança monogênica autossômica dominante. Estes casos, em geral, são de acometimento precoce e famílias extensas têm sido periodicamente estudadas." Smith, M.A.C. (Revista Brasileira de Psiquiatria, 1999) Considerando o texto e o histórico familiar a seguir, responda ao que se pede. Histórico familiar: "Um rapaz cujas duas irmãs mais velhas, o pai e a avó paterna manifestaram Doença de Alzheimer de acometimento precoce."

5

b) aa x aa c) aa x Aa d) Aa x Aa e) Aa x AA 1.5.1.1 Questão 28 No gado bovino da raça Ayrshire a cor mogno é determinada pelo genótipo A A e a cor vermelha pelo genótipo A‚ A‚, mas o genótipo A A‚ é mogno nos machos e vermelho nas fêmeas. Com base nessas informações, qual é o sexo de um filhote vermelho, cuja mãe é uma vaca mogno? Justifique a sua resposta. Questão 29 A formação de uma característica fenotípica depende, em alguns casos, apenas de fatores genéticos. Em outros casos, prevalece a influência de fatores ambientais. Na maioria das vezes há uma interação entre fatores genéticos e ambientais. Um dos métodos utilizados para avaliar a importância relativa dos genes e dos fatores ambientais na formação de uma característica é o estudo comparativo entre irmãos gêmeos monozigóticos criados juntos e criados separados. A tabela a seguir, elaborada a partir de um grande número de pares de gêmeos, indica o grau de concordância de quatro características. Uma concordância significa que quando um irmão possui a característica, o outro também a possui.

I. Montar o heredograma para o histórico familiar apresentado. II. Qual a probabilidade de o rapaz em questão também ser portador do gene responsável pela forma de acometimento precoce da doença? III. Quais indivíduos do heredograma são seguramente heterozigotos para esse gene? IV. Explicar o padrão de herança mencionado no texto. Questão 26 Mendel não acreditava na mistura de caracteres herdados. De acordo com suas conclusões, a partir dos cruzamentos realizados com ervilhas do gênero 'Pisum', as características não se misturam, permanecem separadas e são transmitidas independentemente. HENIG, Robin. "O monge no jardim". Rio de Janeiro: Rocco, 2001. a) Considerando as leis de Mendel para a hereditariedade, no momento da fecundação os cromossomos herdados dos progenitores se juntam, porém os alelos dos seus genes não se misturam. A partir dessa idéia, qual fenômeno explicaria a ocorrência de características intermediárias na progênie, que parecem ser uma mistura daquelas dos progenitores? b) Posteriormente, estudos de grupos de geneticistas indicaram que pode haver troca de material genético entre cromossomos homólogos herdados do pai e da mãe. Em que etapa isso pode ocorrer e como se chama este processo? Questão 27 Determine as probabilidades de aparecerem indivíduos afetados (aa), normais (AA) e heterozigotos (Aa), nas proles dos casamentos: a) aa x AA

1.5.1.1

Indique a característica que mais depende de fatores ambientais. Justifique sua resposta.

6

mas heterozigoto para o albinismo. Questão 32 Um determinado casal normal.5. à medida que a altitude se aproximava do nível do mar. que tipos de inflorescências serão produzidas nos descendentes dos seguintes cruzamentos: a) NN x Nn? b) Nn x Nn? Questão 34 Recentemente. quando o genótipo é recessivo. 7 Calcule a proporção esperada da prole destes camundongos que será portadora do gene que codifica o HCR. Este camundongo transgênico foi cruzado com uma fêmea de camundongo normal. Questão 31 Um pesquisador observou que uma certa espécie de planta apresentava uma grande variação de produtividade relacionada à altitude onde a planta se desenvolvia. quando o genótipo é homozigoto dominante ou heterozigoto. Assim. isto é.5. heterozigota e do sexo masculino? d) Represente o provável heredograma desse casal. Justifique sua resposta. coletadas em diversas altitudes. Ele. a produtividade era muito baixa. a produtividade dessas plantas foi medida e apresentou os seguintes resultados: . foram plantadas ao nível do mar em idênticas condições ambientais. os meios de comunicação noticiaram o caso de uma mulher norte-americana que. Após algum tempo. Qual a probabilidade desse casal ter: a) quatro crianças albinas? b) uma criança albina e do sexo feminino? c) uma criança normal. Em grandes altitudes. admitindo-se que as suposições feitas nas letras (b) e (c) realmente se concretizem.Questão 30 Um pesquisador teve sucesso na integração de uma cópia do gene que codifica o hormônio do crescimento de rato (HCR) em um dos cromossomos autossômicos de uma célula-ovo de camundongo. A célula-ovo transgênica se desenvolveu. e este foi implantado no útero de sua mãe. e inflorescências mistas (flores femininas e flores masculinas).1. Justifique sua resposta. impossibilitada de ter filhos por anomalia no útero. solicitou aconselhamento genético sobre a possibilidade de vir a ter crianças apresentando a condição albina. quem engravidou e deu à luz foi a mãe da referida mulher. Questão 33 A mamona ('Ricinus communis') produz inflorescências contendo somente flores pistiladas (flores femininas).1 1. a produtividade aumentava. realizou um experimento em que sementes dessa espécie. não portadora do gene HCR.1 Identifique se é o componente genético ou o componente ambiental que predomina no condicionamento da produtividade dessas plantas. Com base nessas afirmações. dando origem a um camundongo macho. 1. então.1. teve seu óvulo fertilizado "in vitro".

as cores marrom e branca dos pelos têm sido descritas como devidas a. quem é a mãe da criança? Justifique. o animal foi cruzado com um macho albino e deu origem a uma prole toda preta. Qual a proporção fenotípica esperada em F se a) o modo de herança for do tipo dominante? b) o modo de herança for do tipo co-dominante? Questão 36 Suponha que você tenha em seu jardim exemplares da mesma espécie de ervilha utilizada por Mendel em seus experimentos. que as flores são hermafroditas e que sementes produzidas por autofecundação são viáveis. são mais vigorosos e mais produtivos que os parentais. Duas linhagens. Mais tarde. Nesses programas são desenvolvidas linhagens homozigotas por meio de sucessivas gerações autofecundadas. Questão 39 Em várias culturas vegetais. qual seria a interpretação? 8 . as plantas resultantes foram medidas e os dados obtidos no experimento são mostrados no gráfico A. em geral. os programas de melhoramento utilizam a heterose (vigor do híbrido). como você explica esse resultado? b) Indique os genótipos da fêmea preta e da prole. Sementes dessas plantas foram coletadas nas várias altitudes e plantadas em uma mesma região localizada ao nível do mar. portanto por genótipos LL ou Ll e. um par de genes. a) Explique o resultado obtido. observou que alguns dos animais de sua criação apresentavam uma característica incomum nos chifres. sabendo ainda. o resultado seria o mesmo? Justifique. b) Qual a porcentagem de genes herdados da parturiente que se encontram no patrimônio genético da criança? Questão 35 Em gatos. são então cruzadas e produzem os híbridos. Por quê? Questão 40 Ao estudar a distribuição de uma espécie de planta da família dos girassóis em altitudes crescentes na costa oeste dos Estados Unidos. a) Sabendo-se que o albinismo é característica recessiva. depois de muitos anos nesse ramo.Responda: a) Do ponto de vista genético. pesquisadores observaram que essas plantas apresentavam um gradiente decrescente de tamanho. Como o criador poderia fazer para determinar se essa variação é decorrente de uma mutação genética ou de uma alteração causada por fatores ambientais? Questão 38 Em experimento feito no início do século. homozigotas para alelos diferentes. b) Se o resultado do experimento tivesse sido o representado no gráfico B. b) Se o agricultor utilizar as sementes produzidas pelo híbrido nos plantios subsequentes. em vez de transplantar o ovário. Considere o cruzamento de gatos homozigotos brancos e marrons. qual seria a proporção esperada de descendentes com sementes rugosas? Questão 37 Um criador de cabras. a) planeje um cruzamento experimental entre flores de exemplares diferentes que lhe permita determinar se uma planta que produz sementes lisas é homozigota ou heterozigota para esse caráter. Após um determinado tempo de crescimento. pelo menos. Alguns desses exemplares produzem sementes lisas e outros. expresso no gráfico A. o resultado não será o mesmo. dois pesquisadores retiraram os ovários de uma cobaia albina e implantaram-lhe um ovário obtido de uma cobaia preta. Sabendo que a característica "lisa" das sementes da ervilha é determinada por um alelo dominante L. sementes rugosas. c) Se fosse possível implantar os pêlos da fêmea preta na fêmea albina. a) Esses indivíduos híbridos são geneticamente iguais entre si? Explique. b) No caso de ocorrer autofecundação em uma planta que produz sementes lisas e é heterozigota. que.

9 1. (a) talassemia menor. Questão 41 A herança da cor do olho na espécie humana geralmente é representada simplificadamente como um par de alelos. oval ou redonda. Ela ocorre em duas formas. A (dominante. e (b) talassemia maior. os hachurados. sendo que a manifestação em homozigose de um dos alelos . Justifique sua resposta. .2 . Questão 42 Em uma espécie de planta a forma dos frutos pode ser alongada. mas a saúde é essencialmente normal. Sabe-se que: . determinando cor azul). A partir do heredograma hipotético a seguir onde os símbolos claros representam pessoas normais. a) Afirmação de um casal de olhos azuis: "nosso bebê poderá ter olhos castanhos porque as avós têm olhos castanhos".5. a talassemia menor e os pretos a talassemia maior.1 a) Formule uma hipótese consistente com os resultados obtidos para explicar a herança da forma dos frutos nessa espécie.em um jardim de plantas com flores de cor azul não nascem plantas com flores de cor azul-claro.a flor de cor branca nunca se abre.1. Essa última forma geralmente culmina em morte antes de atingir a idade reprodutiva. Baseando-se nessa explicação.é letal na fase adulta. microcitemia e policitemia.2 Questão 44 Considere uma certa espécie de planta que pode apresentar flores com três tipos de cor: azul. caracterizada por uma anemia severa.1. na qual os eritrócitos são pequenos (microcitemia) e em grande número (policitemia). aumento do baço. b) Afirmação de um casal de olhos castanhos: "nosso bebê poderá ter olhos azuis porque o avô paterno tem olhos azuis". cor branca . determine o modo de herança indicando os possíveis genótipos dos indivíduos envolvidos. verificando se elas têm fundamento. Questão 43 A talassemia é um defeito da hemoglobina em seres humanos. entre outros sintomas.1. analise as afirmações abaixo.1. Estas cores são determinadas por combinações de dois alelos de um único locus.aa. determinando cor castanha) e a (recessivo. Na expressão fenotípica de tais cores não há relação de dominância entre os alelos.5. b) Represente os alelos por letras e indique os genótipos dos indivíduos parentais e dos descendentes no cruzamento IV. azul-claro e branca. proferidas por casais em relação à cor dos olhos de seu bebê. Foram realizados quatro tipos de cruzamento entre plantas dessa espécie e obtidos e seguintes resultados: 1.5.

Utilizando apenas cruzamentos naturais. a) Qual a relação de dominância entre os caracteres em questão? b) Qual a probabilidade de que. brancos e sem chifres. A resistência ou susceptibilidade ao inseticida é devida a um locus com dois alelos. A partir das sementes obtidas. quando em dose dupla. como o fazendeiro deverá proceder para estabelecer uma linhagem pura de animais brancos e sem chifres? Por que ele não conseguirá resolver o problema dos chifres rapidamente? Questão 47 O gráfico a seguir mostra a mortalidade de mosquitos de uma determinada espécie quando expostos a diferentes concentrações de um inseticida. os quais. Considere um casal de anões pseudo-acondroplásicos. é controlada por genes codominantes. pensou-se que o fenótipo anão seria expresso pelo genótipo D/D ou D/d. por isso. presentes em igual quantidade. Em cruzamentos desses indivíduos ovalados entre si. foram obtidas quatrocentas sementes que foram plantadas em sementeiras individuais. os pontos distribuem-se ao longo da curva. ruão e branca. Cruzamentos entre plantas de raízes alongadas com plantas de raízes arredondadas produziram apenas indivíduos com raízes ovaladas. Determine a cor das flores que têm maior possibilidade de se abrirem neste jardim. às vezes só origina prole sem chifres. Os fenótipos formados são três: arredondado. A princípio. na sua sementeira. Determine a cor das flores que têm menor possibilidade de se abrirem neste jardim. b) Realizaram-se os cruzamentos possíveis entre as plantas com flores das cores mencionadas. para responder às seguintes questões: 10 . a cor da pelagem vermelha. formou-se outro jardim.1. ovalado ou alongado. produz efeito letal durante o desenvolvimento embrionário. e o cruzamento de animais com chifres versus animais sem chifres. as sementeiras foram distribuídas a diversas pessoas. Justifique a resposta. você recebeu uma delas. foi considerado que a severidade do alelo dominante. Um fazendeiro tem uma grande boiada constituída de animais vermelhos. formou-se um jardim. aparecem os dois tipos em igual número. A e A‚. Justifique a resposta. ruões. venha a se desenvolver um rabanete de raiz ovalada? Justifique a sua resposta.a) Realizou-se o cruzamento entre as plantas com flores azul-claro e. provocando aborto precocemente. Essas diferenças podem ser atribuídas a efeitos pleiotrópicos de outros genes? Justifique sua resposta utilizando o conceito de efeito pleiotrópico. ocasionalmente produzem prole com chifres. Questão 45 Em rabanetes. a forma da raiz é determinada por um par de genes alelos. sem recorrer à inseminação artificial. c) Os indivíduos de cada um dos genótipos não se comportam da mesma forma quanto à resistência ao inseticida e. a partir das sementes obtidas. e.5. Entretanto. Questão 46 Em gado. Antes que as sementes germinassem.2 a) Qual é o genótipo mais resistente? Como você chegou a essa conclusão? b) Observando as três curvas. que conclusão se pode tirar sobre as relações de dominância entre os alelos deste locus? Explique. ou seja. 1. em outros cruzamentos. Questão 48 A pseudo-acondroplasia é um tipo de nanismo determinado geneticamente pelo alelo D autossômico dominante que interfere no crescimento dos ossos durante o desenvolvimento.

4 11 . dominante. b) A partir de 40 ovos. originados do cruzamento entre ratos amarelos. porém. todos apresentando a pseudo-acondroplasia. em um eventual quarto nascimento. presença de pernas traseiras grandes e um andar diferente dos outros. e seu alelo c recessivo. responsável pela coloração amarela. a) A partir de 20 ovos.1.5. originados do cruzamento de machos amarelos e fêmeas cinzas. onde o alelo (A) condiciona a cor amarela em camundongos e é dominante sobre o alelo (a).a) Quais são os genótipos de cada indivíduo do referido casal? b) Caso a mulher deste casal venha dar à luz uma criança. com 3 meninas e 2 meninos. Um geneticista observou que o cruzamento de ratos de pelagem amarela com ratos de pelagem cinza resultou descendentes amarelos e cinzas em igual proporção. quantas fêmeas amarelas adultas são esperadas? Justifique. a) Qual a explicação para esse resultado? b) Dê os genótipos dos parentais e dos descendentes. responsável pela coloração cinza. quantas destas crianças são homozigotas no loco correspondente a este tipo de nanismo? Questão 49 Observe os cruzamentos a seguir. (Utilize as letras B e b para as suas respostas). 1. Questão 51 Gatos Manx são heterozigotos para uma mutação que resulta na ausência de cauda (ou cauda muito curta). que condiciona a cor cinza. qual é a probabilidade dela nascer geneticamente com a pseudo-acondroplasia? c) Como o casal já tem três crianças com a pseudo-acondroplasia. Questão 52 O heredograma a seguir representa uma família com pessoas afetadas por uma doença hereditária. em vez de três para um (3:1). qual é a probabilidade de. O cruzamento de dois gatos Manx produziu dois gatinhos Manx para cada gatinho normal de cauda longa (2:1). a cor da pelagem é condicionada por gene autossômico. sendo o gene C. a criança nascer também afetada? d) Se o casal tem planos para ter uma menina normal em relação a esta condição genética. o cruzamento de ratos amarelos entre si produziu 2/3 de descendentes de pelagem amarela e 1/3 de descendentes de pelagem cinza. quantos machos cinzas deverão atingir a idade adulta? Justifique. qual é a probabilidade que se espera para este evento? e) Em uma outra família. a) Qual cruzamento apresenta resultado de acordo com os valores esperados? b) Como você explicaria o resultado do cruzamento em que os valores observados não estão de acordo com os valores esperados? Questão 50 Em ratos. como seria esperado pela genética mendeliana. CRUZAMENTO I (Aa × Aa) 240 amarelos 120 cinzas CRUZAMENTO II (Aa × aa) 240 amarelos 240 cinzas Analise os resultados destes cruzamentos e responda.

Sabendo-se que. de uma característica expressa em antepassados remotos? b) O albinismo se deve a alelo dominante ou a alelo recessivo? Explique com base na figura. na Família de Raimundo e Eleílde da Silva. Os indivíduos I .4 Questão 56 A figura a seguir. adaptada da Folha de São Paulo de 17/03/96. de acordo com a presença ou ausência do 12 1.5. Responda.5 são albinos.a) A doença tem herança dominante ou recessiva? Por quê? b) A doença tem herança autossômica ou ligada ao cromossomo X? Por quê? Questão 53 Analisando a genealogia adiante.1. II . moradores da ilha dos Lençóis. então: a) Que nome se dá ao aparecimento.5.4 No heredograma adiante o indivíduo 3 é afetado pelo albinismo.1.3 e V .6.4 . mostra a transmissão do albinismo. situada a oeste de São Luís. a) Qual a probabilidade de o indivíduo 3 ser heterozigoto? b) Qual a probabilidade de o indivíduo 5 ser homozigoto recessivo? c) Qual a probabilidade de o indivíduo 6 ser homozigoto dominante? Questão 54 1.1. V .1. c) Qual a probabilidade de os indivíduos de pigmentação normal da geração V serem todos heterozigotos? Questão 57 Questão 55 No heredograma a seguir os símbolos cheios representam indivíduos portadores de uma anomalia genética. de geração. V .5.5. numa dada geração. a freqüência de heterozigoto para o albinismo é de 1/50. onde a freqüência de albinos é de 1. na população. responda: anomalia? 1. um grupo de cientistas do "Genetics & IVF Institute" vem testando um novo método que permite a seleção dos espermatozóides a partir de sua coloração.1. qual é a probabilidade de que o casal 4 × 5 tenha uma menina albina? Analise a figura onde se admite que a pigmentação da pele é devida a um par de alelos (A.4 1.2.5 % e cinqüenta vezes maior do que entre o restante da população do Maranhão.a). Qual é a probabilidade de o indivíduo 9 ser portador dessa Nos Estados Unidos.

Identifique e justifique o tipo de herança.4 Analise os dois heredogramas anteriores. 1.1 e III. Ao analisar os indivíduos afetados por esta anomalia. b) Em qual das duas situações seria mais recomendado o uso da técnica ('Microsort') para a escolha de um bebê do sexo feminino? Por quê? c) Considerando o heredograma nŽ1. poderá ser benéfico quando utilizado por famílias portadoras de determinadas anomalias genéticas. b) Suponha que a mulher 3 da família I case-se com o homem 4 da família III.1.5.1.cromossomo Y ('Microsort'). você conclui que se trata de uma herança autossômica dominante.5. o professor lhe apresenta o heredograma a seguir. Questão 60 Numa aula de genética.4 13 . Questão 58 O heredograma a seguir refere-se ao caso de braquidactilia. calcule a chance de os indivíduos III.5.4 1. II e III).1.4 1. como representado nos heredogramas a seguir: 1. Tal método. a) Qual o tipo de herança da doença? Justifique sua resposta. além de satisfazer os anseios de vários casais na escolha do sexo do filho.5. Questão 59 O padrão de herança de uma doença. Qual a probabilidade de nascer uma criança doente? Justifique.2 gerarem uma criança afetada do sexo masculino. e responda às seguintes questões: a) Qual o padrão de herança envolvido na determinação da característica representada no heredograma 1 e no heredograma 2? Justifique sua resposta. considerando que o caráter é determinado por um único par de genes. que mostra a ocorrência de uma anomalia causada pela ação de um par de genes (A e a) em várias gerações de uma família. que se suspeita ser autossômica recessiva ou ligada ao sexo.1. foi analisada em três famílias diferentes (I.

os indivíduos em escuro apresentam uma doença hereditária. b) Determine se em algum dos casos apresentados existe herança ligada ao cromossomo Y.4 1. enquanto os outros exibem fenótipo normal. Quadrados ou círculos escuros representam indivíduos afetados por uma característica comum na população.5. Os círculos representam as mulheres e os quadrados. responda: a) Por que a anomalia NÃO pode ser recessiva? b) Por que a anomalia NÃO pode ser ligada ao cromossomo X? c) Qual a probabilidade de nascer uma criança afetada pela anomalia. Questão 64 Analise a genealogia. a menos que haja evidência contrária. a) Esta doença hereditária é condicionada por gene dominante ou recessivo? b) Dos dez indivíduos que compõem esta genealogia. Questão 63 Na genealogia adiante. Analise esta genealogia e responda. Justifique sua resposta para cada família. A cor branca indica pelagem branca determinada por um gene recessivo. B e C a seguir representam três famílias diferentes. a) Identifique os heredogramas que são compatíveis com uma herança autossômica recessiva. os homens.4 1.4 Qual a probabilidade de que o cruzamento entre o indivíduo 9 e o indivíduo 10 gere um indivíduo de pelagem branca? Questão 62 Os heredogramas A. Justifique. que apresenta indivíduos afetados por uma doença recessiva e indivíduos normais. qual o único que não pode ter seu genótipo definido? Explique por quê. fenótipo determinado por um gene autossômico dominante A. Os indivíduos 5 e 8 devem ser considerados homozigotos (AA). homens.5. Os círculos representam mulheres e os quadrados.1.5. 1.1.1. 14 . se a mulher (4) da geração F3 tiver filhos com um homem que apresente essa anomalia? Questão 61 No heredograma abaixo a cor preta indica indivíduos com pelagem negra.Baseando-se EXCLUSIVAMENTE no heredograma apresentado acima.

vítima de fibrose cística. todos normais. c) Se Paulo e Joana tiverem uma primeira criança afetada pela mesma doença genética. As diferenças registradas entre os irmãos dizigóticos foram praticamente da mesma magnitude que as encontradas entre os irmãos monozigóticos. filha de pais normais. mas cujo irmão morreu na infância.1 Calcule a probabilidade de que esse casal venha a ter uma criança com fibrose cística. Justifique sua resposta. sendo ambos do sexo masculino e afetados? Questão 65 Uma determinada característica foi estudada em centenas de pares de gêmeos. b) Quais os possíveis genótipos dos filhos possíveis do mesmo casal? 15 . a) Quais os indivíduos representados na genealogia que são obrigatoriamente heterozigotos? b) Qual a probabilidade de o casal formado pelos indivíduos II2 e II3 ter mais dois filhos.segunda criança desse casal também seja afetada por essa mesma doença? Por quê? Justifique suas respostas. Questão 66 Se uma abelha operária tem o gene A herdado de seu pai. tem uma criança afetada por uma doença muito rara de herança autossômica recessiva.2. O primeiro casal.1. b) Qual é a probabilidade de que uma futura criança de Paulo e Joana venha a ser afetada por essa mesma doença genética? Considere desprezível a probabilidade de uma nova mutação. Um inglês heterozigoto para essa característica é casado com uma mulher normal.5.5. tanto monozigóticos como dizigóticos. a) Indique o genótipo do embrião formado a partir da fecundação do óvulo resultante dessa célula por um espermatozóide de um macho recessivo para os dois pares de genes considerados. qual é a probabilidade de que uma sua irmã tenha esse mesmo gene A? Por quê? Questão 67 Dois irmãos (Pedro e Paulo) casam-se com duas irmãs (Maria e Joana). Questão 69 Considere a figura a seguir que representa o resultado da primeira divisão meiótica de uma célula feminina: Toda pessoa na qual o alelo recessivo é detectado recebe orientação a respeito dos riscos de vir a ter um descendente com a anomalia. qual será o risco de que uma 1. Discuta a importância dos fatores genéticos na manifestação dessa característica.4 Questão 68 Alguns centros de pesquisa na Inglaterra estão realizando um programa de triagem populacional para detectar a fibrose cística. mostrando como chegou aos resultados dos itens b) e c). 1. Pedro e Maria. uma doença autossômica recessiva grave particularmente comum em caucasianos. a) Desenhe o heredograma representando os dois casais e seus respectivos pais.

D e E que se segregam independentemente.1 1.2.5. 3 de cor marrom uniforme. A tabela a seguir apresenta os fenótipos dos pais e os fenótipos das respectivas proles. sendo o alelo dominante (B) para pêlo curto e o alelo recessivo (b) para pêlo longo. utilizando qualquer uma das características apresentadas na tabela.5. a) Quais os genótipos dos pais? b) Se o filho preto e branco for cruzado com uma fêmea cujo genótipo é igual ao da mãe dele. 16 . pelo alelo recessivo d. Em um outro cromossomo. O cruzamento de um macho de cor preta uniforme com uma fêmea de cor marrom uniforme produz uma ninhada de oito filhotes: 3 de cor preta uniforme. Questão 74 Em uma raça de cachorros. a cor do pêlo negro é determinada por um gene dominante (A) enquanto seu alelo (a) determina a cor branca. 1 preto e branco e 1 marrom e branco. o padrão malhado (preto / branco ou marrom / branco). 1. Descreva três mecanismos biológicos potencialmente responsáveis por essa variabilidade genética e explique como atuam. Questão 73 Quatro irmãos. que mostra parte dos resultados dos experimentos de Mendel. De acordo com a tabela.2. a cor preta é condicionada pelo alelo dominante D e a cor marrom. Caso você examine a prole de um grande número de casamentos em que ambos os cônjuges são duplo heterozigotos para esses dois pares de genes. responda: a) Por que na geração F1 não foram encontradas sementes rugosas ou verdes? b) O que são os fatores hereditários referidos por Mendel e onde estão situados? c) Faça um diagrama de cruzamento para exemplificar as proporções fenotípicas encontradas na geração F2.Questão 70 Em cobaias. localiza-se o gene responsável pelo padrão da coloração: o alelo dominante M determina padrão uniforme (uma única cor) e o alelo recessivo m. apresentam marcantes diferenças em suas características físicas. filhos legítimos de um mesmo casal. realizados com ervilhas. O tamanho do pêlo também é controlado por um par de genes. b) Quais são os genótipos mais prováveis dos pais em cada casal? Justifique sua resposta. após vários cruzamentos. qual a proporção esperada de descendentes iguais a ele? Questão 71 A audição normal depende da presença de pelo menos um dominante de dois pares de genes.1 a) Os genes para a cor e tamanho de pêlo estão no mesmo par de cromossomas? Justifique sua resposta. que proporção fenotípica você espera encontrar? Questão 72 Observe a tabela a seguir.

Questão 76 A figura mostra a segregação de dois pares de cromossomos homólogos na anáfase da primeira divisão meiótica de uma célula testicular de um animal heterozigótico quanto a dois genes. estão representadas duas proporções fenotípicas (casos 1 e 2) que poderiam resultar do cruzamento de dois indivíduos AaBb. loco 2 . as proporções fenotípicas dependem de os referidos locos estarem ou não no mesmo cromossomo. os homozigotos têm pêlo liso ou crespo. Na Tabela 2. considerando apenas dois locos. Para a cor do pêlo. quando cruzados entre si. 17 . assim como o alelo para fruto redondo. quais serão os genótipos das quatro células haplóides geradas? b) Considerando o conjunto total de espermatozóides produzidos por esse animal. b) Se essa planta se reproduzir por autofecundação.1 Identifique qual dos dois casos tem maior probabilidade de representar dois locos no mesmo cromossomo. os homozigotos podem ser vermelhos ou brancos. Sem interação entre os dois locos. Questão 79 Considere duas linhagens homozigotas de plantas.5. Os genes para comprimento do caule e forma do fruto segregam-se independentemente.1 a) Ao final da segunda divisão meiótica dessa célula. O alelo que determina caule longo é dominante. têm a constituição AA‚BB‚.2. Justifique sua resposta.2. identificados pelas letras Aa e Bb. Cruzando indivíduos AABB com indivíduos aabb. Calcule a porcentagem esperada de descendentes fêmeas com pêlo vermelho crespo oriundas do cruzamento de dois animais duplamente heterozigotos. Questão 78 1. podem formar indivíduos com os genótipos mostrados na Tabela 1. foram obtidos 100% de indivíduos AaBb que. uma com caule longo e frutos ovais e outra com caule curto e frutos redondos. Despreze a parte fracionária de seu resultado. 1.Questão 75 Um pesquisador está estudando a genética de uma espécie de moscas. cada um com dois genes alelos: loco 1 . a constituição cromossômica de seus descendentes será igual à da planta mãe? Justifique. a) Qual será a constituição cromossômica da planta adulta originada desse zigoto? Justifique. quais serão seus genótipos e em que proporção espera-se que eles sejam produzidos? Questão 77 Em uma determinada espécie animal. As localizações dos alelos desses genes. foram analisadas duas características com segregação independente e herança co-dominante: cor e textura do pêlo.gene A (dominante) ou gene a (recessivo). A e B. Suponha uma planta superior originada de um zigoto no qual dois dos pares de cromossomos.gene B (dominante) ou gene b (recessivo).5. estão indicadas nos cromossomos representados no desenho. caso exista. Para a textura.

Questão 81 Do cruzamento de AaBbccDd x aaBbCcDd. Admite-se que dedos nas mãos anormalmente curtos (braquidactilia) sejam devido a um genótipo heterozigoto para um gene letal embrionário (BBL). A condição normal (I_) produz um fenótipo normal. fato que ele não admitia. cujo grupo sangüíneo é A. Eugênio. a) O veredicto é aceitável? Por quê? b) Na hipótese de Chaplin ter tido filhos com a referida mulher. p. 58.a) De que forma podem ser obtidas plantas com caule curto e frutos ovais a partir das linhagens originais? Explique indicando o(s) cruzamento(s). Qual é a probabilidade de um casal de braquidáctilos e heterozigotos para a idiotia amaurótica infantil vir a ter um descendente normal? Questão 83 Nos anos 40. b para forma dos frutos. Os exames de sangue revelaram que a mãe era do grupo A. set. a criança do grupo B e Chaplin do grupo O. Utilize as letras A. o homozigoto (BB) é normal e o outro homozigoto (BLBL) morre prematuramente. vol. AB e ausentes no grupo O". Em termos de localização cromossômica. No caso do Sistema ABO. a) Qual será o grupo sangüíneo de Eugênio após o transplante? Por quê? b) Sabendo-se que a mãe e a esposa de Eugênio têm sangue do tipo O. e a operação foi bem sucedida. qual será a probabilidade de um futuro filho do casal ter sangue do tipo A? E do tipo B? Questão 85 O pai e a mãe de um par de gêmeos monozigóticos têm tipo sangüíneo A. a) Quais os genótipos do pai e da mãe? b) Qual é a probabilidade de que ambos os gêmeos tenham sangue do tipo O? Questão 86 Um homem faleceu por causa de uma transfusão de sangue. a para comprimento do caule e B. Ao final do julgamento. b) estão ligados. recebeu um transplante de medula óssea de seu irmão Valentim. ("Reserva estratégica de sangue". Chaplin foi considerado como sendo um possível pai da criança. SBPC.) a) O que são antígenos? b) Qual a importância de se identificar a presença de antígenos eritrocitários (presentes nas hemácias ou eritrócitos) no sangue humano? 18 . cujo grupo sangüíneo é B. B e b. os antígenos estão presentes no sangue dos grupos A. 95. explique o que significa dizer que esses dois genes a) segregam-se independentemente na formação dos gametas. B. b) Em que proporção essas plantas de caule curto e frutos ovais serão obtidas? Questão 80 Considere dois genes e seus respectivos alelos: A e a. Sabendo-se que seus pais pertenciam aos grupos B (homozigoto) e AB. Uma outra criança desse casal é do grupo sangüíneo O. o famoso cineasta Charlie ChapIin foi acusado de ser o pai de uma criança. CIÊNCIA HOJE. pergunta-se: a) qual é o grupo sangüíneo do homem em questão? b) qual ou quais os possíveis grupos sangüíneos usados erroneamente na transfusão? Questão 87 "Os grupos sangüíneos são determinados pela presença ou ausência de antígenos na superfície das hemácias. qual será a probabilidade de nascer um indivíduo de genótipo aabbCcDD? Questão 82 Idiotia amaurótica infantil é uma doença hereditária recessiva (ii) que causa a morte nos primeiros anos de vida. de que tipos sangüíneos eles poderiam ser? Questão 84 Um tratamento utilizado para certos tipos de doenças do sangue é a destruição completa da medula óssea do paciente e implante de células medulares sadias provenientes de um doador. 19/nŽ 113. de Ricardo Lorzetto.

tinha sangue A e visão normal. Iß. daltônico. 2) homem. 1. Paulo. ou cegueira para as cores. José. Qual dos homens foi o primeiro marido? Justifique sua resposta.3. basta determinar o genótipo e o fenótipo do suposto pai e. visão normal. Para tal. Questão 91 Nas quatro pessoas relacionadas a seguir.5. Questão 90 Pode-se usar o sistema ABO para "excluir" um suposto pai em uma investigação de paternidade. com sangue tipo A e visão normal.A Com base nesta relação. O tipo de sangue. i. o outro marido. Com os dois maridos.B Doaldo . é determinado por três alelos autossômicos: IÞ. verificar se o homem acusado pode ser considerado como um pai impossível.3. Lalau (indivíduo II-1) elaborou o seguinte heredograma sobre a herança de grupos sangüíneos do sistema ABO. o Sr. visão normal. 4) mulher.AB Cassilda . a) Qual o genótipo dos pais? b) Qual a probabilidade de esse casal ter uma criança cujo sangue aglutine nos dois tipos de soro? Justifique sua resposta. daltônica. Questão 89 O sangue de Orlando aglutina quando colocado em presença de soro contendo imunoglobulinas ou aglutininas anti-A. por comparação com os fenótipos e genótipos do filho e da mãe. sangue O. tinha sangue AB e era daltônico. que apresenta aglutinações inversas. e não aglutina quando colocado em presença de imunoglobulinas ou aglutininas anti-B.O Saildo . daltônico. Orlando casa-se com Leila. A tabela a seguir mostra os fenótipos do filho e da mãe em três casos. sangue A. 5) mulher.Questão 88 O daltonismo. responda: a) Quem do grupo anterior NÃO possui os aglutinogênios em suas hemácias? b) Por que Joana pode receber sangue de outros membros do grupo? c) Que tipo de aglutinina possuem Cassilda e Saildo. Uma mulher. a mulher teve cinco filhos na seguinte ordem: 1) homem.5. sangue B. grupo ABO. Um dos maridos. 3) mulher. O casal tem um filho cujo sangue não aglutina em nenhum dos dois tipos de soro. 1. respectivamente? Questão 92 Ao descobrir que seu genótipo era homozigoto. sangue A.1 19 . foram encontrados os seguintes tipos sangüíneos: Joana .1 Indique os fenótipos dos pais que NÃO poderiam ser os pais biológicos de cada caso. ficou viúva e casou pela segunda vez. sangue A. é determinado por um gene localizado no cromossomo sexual X.

que 20 1.: indique os passos que você seguiu para chegar às respostas. um juiz pode utilizar a análise dos grupos sangüíneos e teste de DNA para ajudar a solucionar questões semelhantes. Questão 97 Um exemplo clássico de alelos múltiplos é o sistema de grupos sangüíneos humano. Nos tribunais modernos. como Rh® e Rh−. o juiz não pôde chegar a nenhuma decisão conclusiva. B e O. em que o alelo IÞ. uma das mulheres desistiu. . cujos resultados obtidos são mostrados na tabela adiante.5. Analisando uma situação em que uma mulher de sangue A atribuía a paternidade de seu filho de sangue O a um homem de sangue B. de que um futuro irmão deste bebê seja do sexo masculino e venha a ter tipo sangüíneo diferente do irmão. Lalau poderá ser receptor de sangue de seu genro para transfusão? d) O indivíduo III-5 NÃO poderá ser de qual grupo sangüíneo? e) No caso do casal III-3 e III-4 ter uma segunda criança. Os casais e os bebês foram submetidos à tipagem do sangue quanto ao sistema ABO. responda: a) Qual a probabilidade de o casal formado por 5 e 6 ter duas crianças com sangue AB Rh®? b) Se o casal em questão já tiver uma criança com sangue AB Rh ®. pode-se identificar os pais de cada bebê. Por que o teste de DNA permite tirar conclusões tão precisas em casos como este? Questão 96 Os grupos sangüíneos humanos podem ser classificados em 4 tipos: A.1 Questão 95 O rei Salomão resolveu uma disputa entre duas mulheres que reclamavam a posse de uma criança. AB.3. caso exista. a) Explique por quê.qual a probabilidade de ter outra com os mesmos fenótipos sangüíneos? Obs. de acordo com o sistema Rh. é codominante sobre o alelo Iß. b) Explique por que uma pessoa com sangue tipo O é doadora universal mas só pode receber sangue do tipo O. Questão 94 Com base no heredograma a seguir. Analisando-os. que codifica para o antígeno A. b) Qual deveria ser o grupo sangüíneo do homem para que a decisão pudesse ser conclusiva? c) Com base no teste de DNA. em a e b. a) Explique como o sangue de uma pessoa pode ser identificado em relação aos sistemas ABO e Rh.3. 1. enquanto uma pessoa com sangue AB é receptora universal mas não pode doar para os outros tipos. calcule a probabilidade. O rei então concluiu que aquela que havia desistido era de fato a mãe verdadeira.a) Identifique o grupo sangüíneo do indivíduo I-1: b) Qual o genótipo do indivíduo II-5? c) O Sr. qual é a probabilidade dela ser uma menina e do grupo sangüíneo "B"? Questão 93 Dois casais suspeitavam da troca de seus bebês no berçário da maternidade. Despreze a parte fracionária do seu resultado. Ao propor dividir a criança ao meio. pelo sistema ABO e. em porcentagem. o juiz concluiu que o homem era pai da criança.5.1 Após identificar os pais do bebê nŽ 2.

Questão 103 Um casal tem cinco filhos: Alex. o doador deve ter o mesmo tipo de sangue que o receptor com relação ao sistema ABO.5.5. apresentou a doença hemolítica ou eritroblastose fetal. Érica e Ana.3. que não codifica para qualquer antígeno. com o uso do soro anti-Rh (anti-D) como mostra o esquema a seguir. responda: 21 b) Embora 3 alelos distintos determinem os grupos sangüíneos ABO humanos. B. Dois tipos de soros. um dos gêmeos.3. podem ser feitas transfusões de pequenos volumes de sangue O para pacientes dos grupos A. Explique o problema que pode ocorrer se forem fornecidos grandes volumes de sangue O para pacientes A. Pedro. Ambos os alelos são dominantes sobre o alelo i. o que pode levar recém-nascidos à morte. Érica. sofreu um acidente e precisa urgentemente de uma transfusão de sangue. Questão 102 1.2 1. são necessários para a identificação dos quatro grupos sangüíneos: A. B ou AB. O sangue das duas mulheres foi testado . e os únicos doadores disponíveis são seus irmãos. ao nascer. Os dados obtidos compõem a tabela a seguir: a) Quais as freqüências dos alelos M e N nessa população? b)Essa população está em equilíbrio de Hardy-Weinberg para esse loco gênico? Questão 99 Duas mulheres disputam a maternidade de uma criança.2 Nas transfusões sangüíneas. na falta de sangue do mesmo tipo.5. 1. b) Como evitar sua ocorrência? c) Qual o procedimento usual para salvar a vida do recém-nascido com eritroblastose fetal? Questão 101 Um indivíduo pertencente aos grupos sangüíneos AB e Rh positivo é considerado receptor universal ideal. Em situações de emergência. Mário.3. que. a) Explique como ocorre a eritroblastose fetal. Questão 100 Na eritroblastose fetal ocorre destruição das hemácias.1 Qual das mulheres poderia ser a verdadeira mãe daquela criança? Justifique sua resposta. Na impossibilidade de se fazer um exame dos tipos sangüíneos.codifica para o antígeno B. a) Complete o quadro a seguir com os genótipos e as reações antigênicas (represente com os sinais + e -) dos grupos sangüíneos indicados. por que cada indivíduo é portador de somente dois alelos? Questão 98 Uma população humana foi testada quanto ao sistema MN de grupos sanguíneos. B ou AB. anti-A e anti-B. AB e O. Dois dos irmãos são gêmeos univitelinos. Certo ou errado? Justifique sua resposta.

rrE_ crista ervilha e o genótipo eerr determina crista simples. a) Qual é o genótipo do macho dourado. 1. dependendo do outro gene: os cães homozigóticos recessivos "bb" apresentam pelagem marrom. Em ambos os cruzamentos. Com a galinha A de crista noz produziu na geração 3 noz: 1 rosa. qual seria a pessoa mais indicada para ser o doador? b) Justifique sua resposta. pelagem dourada. Na determinação desses tipos de cristas atuam dois pares de genes (Rr e Ee). Questão 107 Em galinhas domésticas o tipo de crista é determinado por dois pares de genes com segregação independente. Os cães homozigóticos recessivos "ee" não depositam pigmentos nos pêlos e apresentam. A partir desses dados responda: a) Quais os genótipos paternos? b) Os genes em questão obedecem a segunda lei de Mendel? Justifique. enquanto os com genótipos "BB" ou "Bb" apresentam pelagem preta. Questão 108 As reações enzimáticas a seguir indicam a passagem metabólica que sintetiza pigmentos em uma planta. quanto aos dois genes mencionados? b) Que tipos de gameta e em que proporção esse macho 22 . pretos e marrons. Explique por que a aglutinação não ocorreria se o aglutinogênio fosse uma proteína citoplasmática. rosa e ervilha. Observe os fenótipos e genótipos. forma? c) Qual é o genótipo da fêmea preta? d) Qual é o genótipo da fêmea marrom? Questão 106 Em galinhas há quatro tipos de cristas: simples. Um labrador macho. foi cruzado com uma fêmea preta e com uma fêmea marrom. Um galo de crista noz cruzado com uma galinha de crista rosa produziu a seguinte geração: 3/8 noz. Crista Rosa = R_ee Crista Ervilha = rrE_ Crista Noz = R_E_ Crista Simpes = rree Um galo com crista noz foi cruzado com três galinhas. com pelagem dourada. que pode ser preto ou marrom. Assim o genótipo R_E_ determina crista noz. Questão 105 As três cores de pelagem de cães labradores (preta. cada um deles com dois alelos: "Ee" e "Bb". com a galinha B de crista ervilha produziu 3 noz: 1 rosa: 3 ervilha: 1 simples e com a galinha C de crista noz a geração tinha 100% crista noz. as duas colunas da direita demonstram esquematicamente o aspecto "in vitro" das reações no sangue dos indivíduos de cada grupo sangüíneo ABO aos anti-A e Anti-B. marrom e dourada) são condicionadas pela interação de dois genes autossômicos. b) Sabe-se que o aglutinogênio é uma proteína da membrana das hemácias. noz. 1/8 ervilha e 1/8 simples.a) Entre seus irmãos. foram produzidos descendentes dourados.4 a) Explique o fenômeno que ocorreria com as hemácias de um indivíduo do grupo A ao receber sangue de um indivíduo do grupo B. R_ee crista rosa.3.5. por isso. 3/8 rosa. Utilizando a tabela a seguir determine o genótipo do galo e das três galinhas. Já os cães com genótipos "EE" ou "Ee" apresentam pigmento nos pêlos. Questão 104 No quadro a seguir.

DÊ os genótipos dos camundongos envolvidos no cruzamento. b) Do cruzamento de dois camundongos aguti obtiveram-se descendentes na seguinte proporção: 9 aguti: 3 pretos: 4 albinos. 23 . temos que: O gene A é epistático sobre o gene B e. impede a produção dos pigmentos rosa e vermelho.2 Utilizando essas informações e seus conhecimentos. enquanto os alelos a e b produzem enzimas inativas.5. Duas outras colorações são também observadas: preta e albina. Questão 109 Analisando a via metabólica hipotética.4. Responda: a) No cruzamento entre indivíduos de genótipos AaBb×aabb.4. os alelos A e B produzem enzimas funcionais. apresenta pelagem de coloração acinzentada (aguti).1 Considere as seguintes condições: . em homozigose recessiva.1.5. O gene B. qual será a proporção fenotípica esperada na progênie? b) Quais são os possíveis genótipos para os indivíduos vermelhos? c) Quais os fenótipos esperados e suas respectivas proporções em F‚ obtidos a partir de parentais AABB × aabb? Questão 110 Em camundongos. CITE todos os genótipos possíveis para os camundongos albinos obtidos e APRESENTE UMA EXPLICAÇÃO para a alteração da proporção 9:3:3:1 (esperada em cruzamento de diíbridos) para 9:3:4. a) Do cruzamento entre camundongos preto e albino obtiveram-se 100% de camundongos aguti. devido à não produção de enzima X. faça o que se pede. quando em homozigose recessiva (aa). Determine a proporção esperada entre as cores das plantas descendentes na primeira geração do cruzamento AaBb×AABb. A _ B _ = Aguti A _ bb = Preto aaB _ e aabb = Albinos 1. encontrado comumente na natureza.para as enzimas A e B. Observe os dois pares de genes envolvidos e os fenótipos relativos aos tipos de coloração dos camundongos. impossibilita a conversão de pigmento rosa em vermelho. c) CITE a probabilidade de se obterem camundongos pretos do cruzamento de albinos (duplo homozigotos) com aguti (duplo heterozigotos). Os genes A e B são dominantes sobre os seus alelos. .uma única cópia funcional da enzima A ou da enzima B é suficiente para catalisar normalmente a sua respectiva reação. o tipo selvagem.

o gene B condiciona fruto branco e o gene A condiciona fruto amarelo. mas. pergunta-se: a) Por que é o pai quem determina o sexo da prole? b) Por que os filhos homens de pai hemofílico nunca herdam essa característica do pai? Questão 116 Um geneticista. considerando-se que não ocorreu mutação? Justifique. nos óvulos. na presença do gene A. filha desse cruzamento. que será chamada de planta I. produtora de frutos amarelos. era daltônico. além desses. XXY. Considere o padrão de determinação de sexo. como o seu alelo b. igual ao do humano e determine: a) quantos cromossomos existem. O duplo recessivo condiciona fruto verde. foi cruzada com outra planta. Responda: a) Que denominação se dá a este tipo de interação entre os genes A e B? b) Quais os genótipos das plantas I e II? Questão 112 Numa dada planta. produtora de frutos brancos. Seus genitores tinham visão normal para cores. Questão 114 O daltonismo tem herança recessiva ligada ao X. com cariótipo 47.1 24 . é cruzada com outra. O cruzamento entre a planta I e a planta II produziu 4/8 de plantas com frutos brancos. adotando o mesmo critério utilizado para a montagem de cariótipo da espécie humana. O indivíduo duplo recessivo produz frutos verdes. Cobaias albinas homozigotas foram cruzadas e todos os descendentes nasceram pretos. restando. II. nessa espécie desconhecida. produtora de frutos verdes.5. justificando sua resposta. Uma planta. Como isto pode ser explicado. 3/8 de plantas com frutos amarelos e 1/8 de plantas com frutos verdes. responda: a) Como se chama esse tipo de interação? b) Qual a proporção fenotípica correta entre os descendentes do cruzamento de plantas heterozigotas para esses dois pares de genes? Questão 113 Existe um gene em cobaias que suprime o efeito do gene que determina a coloração nesses animais. mas o gene B inibe a ação do gene A. Considerando que tais genes apresentam segregação independentemente um do outro. b) O erro ocorreu na primeira ou na segunda divisão da meiose? Explique. b) o sexo a que pertence o animal da espécie em questão. Um indivíduo anormal. Uma planta homozigota. Esse gene está localizado em um cromossomo diferente daquele em que está o gene que determine a cor do animal.5. conseguindo formar dez pares de cromossomos. O gene B produz frutos amarelos. nos espermatozóides e nas células musculares dessa espécie animal.Questão 111 Na herança da cor do fruto da moranga. respectivamente. dois cromossomos de tamanhos distintos. 1. Questão 117 Esta figura representa uma célula humana na qual uma estrutura está indicada pela seta. estão envolvidos dois pares de genes A/a e B/b. Questão 115 Com relação à espécie humana. ele é inibido e produz frutos brancos. a) Qual genitor formou o gameta com 24 cromossomos? Explique. montou o cariótipo de certa espécie animal desconhecida.

usando um "kit" que determina a presença do cromossomo Y. são tratados com transplantes de medula óssea. que é uma anomalia caracterizada pela ausência das glândulas sudoríparas. determinar o sexo dos embriões logo após a fertilização.1 a) Explique a formação dessas manchas do ponto de vista genético. qual seria a proporção fenotípica esperada? Demonstre os cruzamentos. b) CITE o nome da estrutura indicada pela seta e JUSTIFIQUE a existência da estrutura nessa célula. Promovendo o intercruzamento destes descendentes. Após o transplante de medula é possível identificar os cromossomos de células de diversos órgãos e tecidos. d) DENOMINE a síndrome que designa o indivíduo cujo sexo é compatível com a presença da estrutura indicada. quando se passa um corante sobre a pele. é reimplantado no útero da vaca. Caso contrário. Algumas mulheres. CITE o número cromossômico dessa célula caso ela pertença a um indivíduo normal e um indivíduo cujo sexo não é compatível com a presença da estrutura indicada. Questão 119 Fazendeiros que criam gado leiteiro podem. portadoras desse gene em heterozigose. o sexo feminino é heterogamético. Numa determinada raça. 25 . Questão 118 Em galinhas domésticas. a troca de seqüências de ADN entre cromossomos homólogos. em especial aqueles ligados às células do sangue. a) Para esses fazendeiros. a) CITE o nome da célula representada e sua principal função. Justifique sua resposta. Esse gene se localiza no cromossomo sexual X. Nesses transplantes. Se o embrião for fêmea. uma parte da medula óssea de um doador sadio é introduzida na coluna vertebral de um paciente cujas células da medula óssea foram previamente eliminadas com auxílio de drogas ou de radiação. b) Por que esse mosaico não pode aparecer em um homem? Questão 122 Certos tipos de câncer. a coloração das penas é uma característica condicionada pelo gene C e é ligada ao sexo. mas não a possui. ele é eliminado ou congelado para uso futuro. atualmente. qual a vantagem dessa prévia determinação do sexo dos embriões? b) Por que o "kit" pesquisa somente a presença do cromossomo Y? Questão 120 Durante o processo de meiose ocorre a recombinação gênica. ficam com a pele toda manchada. O cruzamento de uma galinha branca com um galo carijó produziu somente aves carijós. formando um mosaico de manchas claras e escuras. Questão 121 Na espécie humana existe um gene raro que causa a displasia ectodérmica anidrótica. O alelo que determina a coloração carijó é dominante sobre o alelo para a cor branca. isto é. Identifique o cromossomo humano que sofre menos recombinação.Com base na figura e em conhecimentos sobre o assunto.5. 1. c) Utilizando a letra A para designar um conjunto de autossomos e as letras convencionalmente usadas para representar os cromossomos sexuais.5. A tabela a seguir mostra os resultados da classificação dos cromossomos de 4 tecidos de um paciente submetido a transplante de medula.

A matéria dizia. identifique o sexo do paciente e o sexo do doador. Responda: a) Quantos cromossomos X tem esta mulher? b) Se ela se casar com um homem normal. 26 1.5.1 Com base nesses resultados. que testes citogenéticos você faria para comprovar esta afirmação? Questão 128 Um casal de não hemofílicos tem um filho com hemofilia. Justifique sua resposta. pergunta-se: a) Qual é o sexo do descendente com cariótipo 2AXXY? b) Sabendo-se que o sexo da 'Drosophila melanogaster' pode ser definido por um índice sexual (I. foi então promulgada uma lei segundo a qual todas as mulheres que tivessem um filho homem não mais poderiam ter filhos. mas por um balanço gênico entre genes femininizantes e masculinizantes.S. .S. a) A que corresponde tal corpúsculo e em que tipo de células (somáticas ou germinativas) ele aparece? b) Qual a sua importância e por que ele não ocorre nas células masculinas? Questão 126 A análise dos núcleos interfásicos de células da mucosa oral de uma mulher. dando origem a um descendente com cariótipo 2AXXY. a) Qual é a probabilidade de que uma filha desse casal apresente a doença? b) Qual é a probabilidade de que um outro filho desse casal seja também hemofílico? Justifique suas respostas. um pequeno corpúsculo de cromatina intensamente corado.) do descendente acima referido? Uma revista publicou uma reportagem com o título "Atleta com anomalia genética faz operação para definir seu sexo e poder competir na classe feminina de judô". Os testículos da atleta fora extirpados para que ela pudesse competir na equipe feminina de judô a) Que vantagem a atleta levaria sobre as demais competidoras se tivesse os testículos durante a competição? b) Sabendo-se que ela foi considerada do sexo feminino. Este corpúsculo é conhecido hoje como cromatina sexual ou corpúsculo de Barr. fenotipicamente normal. portador de um cromossomo Y. a determinação do sexo não é feita simplesmente pela presença ou ausência do cromossomo Y. qual a probabilidade de ter uma filha com constituição cromossômica igual à sua? Questão 127 Essa lei atingirá o objetivo desejado depois de algumas gerações? Justifique sua resposta. As demais mulheres poderiam continuar a ter filhos até que tivessem um filho homem. ainda. Questão 124 Em uma 'Drosophila melanogaster'.Questão 125 Na década de 40 descobriu-se que algumas células retiradas de mulheres apresentavam no núcleo interfásico. Questão 123 O governo de uma sociedade totalitária decidiu conter a expansão demográfica reduzindo a proporção de homens na população. revelou a existência de duas cromatinas sexuais em todos eles. qual é a relação que expressa esse índice? c) Qual é o índice sexual (I. que a jovem era um caso de pseudo-hermafroditismo.5.). Com esse objetivo. pois apresentava órgãos sexuais internos masculinos e órgãos sexuais externos femininos. Se o cromossomo X de uma fêmea com cariótipo 2AXX sofrer não-disjunção meiótica e o óvulo resultante com 2 cromossomos X for fecundado por um espermatozóide normal.

qual é a probabilidade de 27 . Com base nessas informações e nas contidas na árvore genealógica adiante.2 a) Qual é a probabilidade de que uma segunda criança de II-4 e II-5 seja afetada? b) Qual é a probabilidade de II-2 ser portadora do alelo que causa a hemofilia? c) Se o avô materno de II-4 era afetado. ocorrem dois meninos hemofílicos. Conforme mostrado na genealogia a seguir. qual é a probabilidade de que o próximo filho homem desse casal venha a ser hemofílico? a) Que padrão de herança explica melhor a genealogia? Justifique sua resposta. b) Se os dois maridos da mulher fossem irmãos isto poderia alterar sua resposta anterior? Por quê? Questão 131 No heredograma a seguir. entre as que nascerem? Justifique sua resposta. em ambos os casos com indivíduos normais e que não eram seus consangüíneos. responda à seguinte pergunta: se a mulher 5 se casar com um homem daltônico.5. que causa aborto espontâneo. responda à seguinte pergunta: se a mulher 4 casar com um homem normal e seu primeiro filho for um menino hemofílico. Com base nessas informações e nas contidas na árvore genealógica adiante.5.Questão 129 Uma mulher é portadora de um gene letal ligado ao sexo. 1.5. ela teve quatro filhos. Supondo que quinze de suas gestações se completem.2 Questão 133 O gene recessivo d está localizado no cromossomo X e é responsável pelo daltonismo na espécie humana.5. 1.5. Questão 130 Uma mulher clinicamente normal casou-se duas vezes. todos afetados por uma doença genética muito rara. 1.5. qual era o fenótipo da avó materna? Justifique sua resposta.2 Questão 132 O gene recessivo h está localizado no cromossomo X e é responsável pela hemofilia na espécie humana. qual o número esperado para crianças do sexo masculino. dois de cada casamento. A hemofilia tem herança recessiva ligada ao cromossomo X.

Visão normal XdY . isto é. bem como a inexistência de casamentos consangüíneos. 1.5.5. após constatar que a família reside em um grande centro urbano. Preocupado com a possibilidade de transmitir essa doença. que causa aborto espontâneo. Homens: XDY .2 1. de Maranguape. Questão 136 O daltonismo (cegueira para as cores) se deve a uma mutação recessiva ligada ao sexo.5. b) Calcule os valores correspondentes à probabilidade de que o primo doente do consultante.5. 1.2 28 .Daltônica Na figura a seguir. ao casar com uma mulher normal. podemos representar genótipos e fenótipos de homens e mulheres como no quadro a seguir. Supondo que nove de suas gestações se completem. consultou um geneticista que.5. formule a conclusão do geneticista quanto à possibilidade de o consultante transmitir a doença a seus descendentes diretos. localizada na parte não homóloga do cromossomo X.5. qual o número esperado para crianças do sexo feminino entre as que nascerem? Justifique sua resposta. Nele. preparou o heredograma abaixo. Sendo assim.2 Questão 134 Uma mulher é portadora de um gene letal ligado ao sexo. diversos membros são afetados por raquitismo resistente ao tratamento com vitamina D.Visão normal XDXd . Questão 135 Um homem pertence a uma família na qual. os símbolos sombreados representam indivíduos daltônicos em um dos ramos da família Abreu. há gerações.Visão normal XdXd . o consultante está indicado por uma seta.que o próximo filho homem desse casal venha a ser daltônico? a) Sabendo que a doença em questão é um caso de herança ligada ao sexo. gere filhas e filhos afetados pela doença.Daltônico Mulheres: XDXD .

embora sejam raras.5.1.9? b) Qual a probabilidade de. b) Analise a Árvore Genealógica de MS e informe: 1. nascendo uma criança de III. Existe um terceiro gene autossômico (não localizado nos cromossomos sexuais) que é responsável pela cor branca. no quadro anterior.9 e III. leis da probabilidade. IV. tem vários parentes com hemofilia clássica ou hemofilia A. o seu risco e também o de sua família de vir a ter uma criança com essa doença.2 Questão 139 1. explique por que o pêlo de uma gata pode ter três cores. III. a) Qual a principal característica clínica da hemofilia A? Justifique por que esse sintoma clínico aparece nos afetados. A figura a seguir mostra o heredograma de um tipo de diabetes que leva a problemas no metabolismo do fosfato e dos carboidratos. Como não tem recursos para fazer o diagnóstico pré-natal dessa doença pelo estudo do DNA fetal.9? Justifique sua resposta. Os resultados mostraram um aumento significativo na produção do fator VIII nos indivíduos tratados.risco de ela vir a ter uma criança hemofílica. Questão 140 Uma das primeiras experiências de terapia genética foi realizada com indivíduos hemofílicos cujo gene para o fator VIII de coagulação era defeituoso. 1. Ela quer obter mais informações sobre a hemofilia A e conhecer. considerando o seu casamento com um homem normal (indivíduo III‰). b) Quais são os prováveis genótipos dos indivíduos II-2. Com essas informações.7. enquanto o pêlo de um gato só pode ter duas cores. Supondo que o indivíduo tratado venha a ter filhos com 29 Com base no enunciado e na análise do heredograma. 2. Estas células receberam cópias do gene normal para o fator VIII e foram posteriormente reintroduzidas no indivíduo.10. tendo em vista as informações e usando os símbolos dados. Na terapia foram retiradas células da pele do paciente.risco de sua prima (indivíduo III„) vir a ter uma outra criança hemofílica do mesmo casamento com o indivíduo III….2 A cor do pêlo dos gatos depende de um par de genes alelos situados no cromossomo X. procurou um geneticista. Questão 137 Na espécie humana há algumas condições dominantes ligadas ao cromossomo X.5. ela ser do sexo masculino e daltônico? Justifique sua resposta. responda: a) Quais os genótipos dos indivíduos II.Analisando a figura. por meio das . III-4 e III-5? Questão 138 MS (indivíduo IIIˆ) está grávida.2 e IV. c) Quais todos os genótipos prováveis para os descendentes (filhos e filhas) de um possível casamento entre IV.5.2 e IV.5. responda: a) A mãe do cruzamento I é homozigota ou heterozigota? Justifique. Um deles é responsável pela cor preta e o outro pela cor amarela. para representar os genes.

5. A doença que acomete a família 1 provoca retardamento mental acentuado. e ausente no Y.5. ou. Sabendo-se que o loco do gene para o daltonismo está no cromossomo X. responda: 1. explique por que a doença da família 2 ainda poderia ser encontrada em indivíduos da geração VI (netos da geração IV). a) Quais os tipos de herança envolvidos na transmissão das doenças de cada família? Justifique sua resposta. atenda às solicitações a seguir. Questão 141 Seguindo a representação a seguir 1.2 1. enquanto que a da família 2 é uma doença degenerativa fatal que aparece em torno dos 40 anos de idade. dois caracteres genéticos com mecanismos de herança distintos. fenótipo dos indivíduos.2 30 . Após analisar os heredogramas. a) indique os genótipos dos indivíduos.5. c) discuta a possibilidade de uma mulher hemofílica e albina ser filha biológica dos pais propostos no heredograma que você construiu. o heredograma a seguir começou a ser elaborado para que fosse determinado o genótipo e.5.2 e considerando que os indivíduos apresentam.uma mulher cujos genes para o fator VIII sejam defeituosos. b) construa um heredograma no qual três desses indivíduos sejam os filhos biológicos (legítimos) dos outros dois. existe possibilidade de nascimento de uma criança não hemofílica? Justifique sua resposta. b) Considerando que a seleção natural pode eliminar doenças genéticas. simultaneamente.5. Questão 142 Os heredogramas a seguir representam duas famílias com doenças hereditárias distintas. Questão 143 Com o objetivo de reconstruir a história familiar de um caso de herança de daltonismo.5.

imediatamente fez o seguinte diagnóstico: trata-se de um caso de aneuploidia de cromossomos sexuais. ambos ligados ao sexo. a) Qual a probabilidade de João ter herdado do pai o gene para daltonismo? Qual a probabilidade de Maria ter herdado do pai o gene para daltonismo? b) Por que é mais freqüente encontrarmos homens daltônicos que mulheres daltônicas? Questão 148 1. Os círculos representam as mulheres e os quadrados.a) Se os indivíduos I . a) O que é e qual o tipo de aneuploidia que o gato de José apresenta? b) Qual a explicação dada pelo veterinário relacionando a anomalia com as cores do animal? Questão 147 O daltonismo é comumente entendido como a incapacidade de enxergar as cores verde e/ou vermelha. Como nenhum de seus parentes próximos era hemofílico. a) Qual o tipo mais provável da herança desta anomalia? Justifique. quantas pessoas A MAIS.5. Os genes que participam da síntese desses pigmentos localizam-se no cromossomo X. As cores nos gatos domésticos são determinadas por um gene A (cor amarela) e outro gene P (cor preta).5 são daltônicos. Nos indivíduos daltônicos. os homens. e o malhado apresenta os dois genes (A e P).5. 31 . Um de seus gatos apresenta hipoplasia testicular (testículos atrofiados) e é totalmente estéril. A mulher tem razão? Justifique. ao ver as cores preta e amarela do animal. também deverão apresentar este fenótipo? b) O indivíduo II . Este casal teve dois filhos: João e Maria. alguns desses pigmentos não estão presentes. responda: a) Por que o daltonismo é raro nas mulheres? b) Quantas vezes os homens daltônicos são mais freqüentes nas populações do que as mulheres daltônicas? Questão 145 A genealogia representada na figura é de uma família com uma anomalia rara na espécie humana. neste heredograma. José procurou um veterinário que. Questão 144 Na espécie humana. alterando a percepção das cores. Um homem daltônico casou-se com uma mulher de visão normal em cuja família não havia relatos de casos de daltonismo. Os símbolos em escuro representam os indivíduos com anomalia Questão 146 José é uma pessoa muito interessada na criação de gatos.2 Com base nessa genealogia. Supondo-se que a freqüência de homens daltônicos nas populações seja de 10%. O daltonismo é um caráter recessivo. b) Tendo em vista o tipo de herança mais provável. A percepção de cores é devida à presença de diferentes tipos do pigmento retinol nos cones da retina.4 vierem a se casar e ter filhos.5 poderá ter irmão normal? Justifique. ela supôs que o problema teria surgido porque o pai da criança trabalhava em uma usina nuclear e teria ficado exposto a radiações que alteraram seu material genético. c) Se os indivíduos III . quais os genótipos dos indivíduos II-4 e II-5? Uma mulher deu à luz um menino com hemofilia. poderão ter uma menina normal homozigota? Justifique.1 e III .1 e II . responda. o número de mulheres afetadas pelo daltonismo é baixo quando comparado com o número de homens afetados pela anomalia.

b) Qual será a proporção de machos e fêmeas nas duas gerações? Justifique. estabelecer com segurança o parentesco entre pessoas. Um peixe macho com manchas na nadadeira foi cruzado com uma fêmea sem manchas. Uma das filhas se casa com um homem normal e tem 7 filhos. das quais somente uma é normal. casa-se com uma mulher normal e tem 2 filhos.2 32 . Responda as três questões a seguir considerando o cruzamento de uma mosca fêmea de olhos vermelhos de uma linhagem pura para cor de olhos com um macho de olhos brancos. a) O que levou o pesquisador a concluir que não se tratava de herança ligada ao sexo? b) Por que o pesquisador teve dúvida quanto ao tipo de herança autossômica? Questão 152 Uma doença humana rara é introduzida em uma família quando uma mulher normal se casa com um homem afetado. assim como a probabilidade de filhos afetados para o casamento entre os últimos primos. Esse casal tem 5 filhos. Questão 151 Um geneticista estudou dois grupos. A irmã mais nova. afetado pela doença. e 3 mulheres. como no ser humano. a filha afetada do irmão mais velho e o filho afetado da irmã mais nova. Todas as filhas mulheres são afetadas por essa doença. a cor vermelha ou branca dos olhos é determinada por um gene localizado no cromossomo X. muitas vezes. Um alelo de um lócus do cromossomo Y do peixe 'Lebistes' determina a ocorrência de manchas na nadadeira dorsal. mesmo quando elas pertencem a gerações afastadas entre si. homens e mulheres normais. dos quais 2 são afetados. uma moça normal e 2 homens. utilize a simbologia: quadrados e círculos brancos para. desenhe o heredograma dessa família considerando o gene (A) normal e o gene (a) mutado e apresente os prováveis progenes. quadrados e círculos hachurados para homens e mulheres afetados. se casa com um homem normal e tem 3 filhos. Represente como B o alelo dominante para olhos vermelhos e como b o alelo recessivo para olhos brancos. 2 mulheres e 3 homens. biologia molecular e engenharia genética podem. uma mulher afetada e um homem normal. O heredograma a seguir mostra os descendentes do casal João e Maria. através de um cruzamento. sendo 4 homens. e o cruzamento das moscas F entre si. a) Qual será a cor dos olhos dos machos e fêmeas na primeira geração (F)? E na segunda (F‚)? Justifique.5. porém teve dúvida se se tratava de herança autossômica recessiva ou autossômica dominante com penetrância incompleta.Questão 149 No gênero Drosophila. também afetada pela doença. Questão 150 A determinação do sexo em peixes segue o sistema XY. portadores de uma doença genética que se manifestava da seguinte maneira: O pesquisador concluiu que não se tratava de uma doença com herança dominante ou recessiva ligada ao sexo. respectivamente. Questão 153 Os conhecimentos atuais de biologia celular. 1. I e II. Justifique essa conclusão. pode-se dizer que o modo de herança mais provável seja de herança ligada do X dominante. se o alelo fosse dominante e estivesse no cromossomo X do macho? Demonstre. um normal e outro afetado. Observando a genealogia.5. Para o heredograma. O irmão mais velho. a) Quais são os fenótipos de F e de F‚ desse cruzamento? b) Como seria o resultado em F e F‚.

considerando-se a Segunda Lei de Mendel (Lei da Segregação Independente). Os grupos obtiveram os seguintes resultados: Atualmente.5. quais são as freqüências esperadas para os fenótipos? b) Explique a razão das diferenças entre as freqüências esperadas e as observadas.6 33 . dentre outras. nem ser possível a coleta de material genético dos membros falecidos da família. de toda essa família. foram obtidas 160 plantas: 62 com flores púrpuras e grãos de pólen longos.a) Quanto aos pares de alelos mencionados. Por não haver documentos legais comprobatórios da relação de parentesco. foi utilizada. Cruzando-se essas plantas heterozigóticas com plantas da linhagem pura de flores vermelhas e grãos de pólen redondos. a técnica de identificação por meio do estudo do DNA extranuclear. e justifique sua resposta. 17 com flores púrpuras e grãos de pólen redondos. 66 com flores vermelhas e grãos de pólen redondos. numa célula em divisão meiótica. Indique o número de: a) bisnetos do sexo masculino e do sexo feminino que poderiam ser identificados com aproximadamente 100% de certeza.6 1. Questão 154 O esquema a seguir representa. que tipos de gameta esta célula poderá formar? b) Que pares de alelos têm segregação independente? 1. Nesses cromossomos. apenas Maria e todos os seus bisnetos estão vivos. dois pares de cromossomos com três genes em heterozigose: A/a. e se apresentaram para a identificação de herdeiros do casal citado.5. b) netos e bisnetos de João e Maria que possuíram ou possuem o cromossomo Y idêntico ao de João e justifique sua resposta.3 Questão 155 Foram realizados cruzamentos entre uma linhagem pura de plantas de ervilha com flores púrpuras e grãos de pólen longos e outra linhagem pura. a) De acordo com a Segunda Lei de Mendel. 1. Essas freqüências fenotípicas obtidas não estão de acordo com o esperado.5. Questão 156 Três grupos de alunos realizaram cruzamentos-testes entre plantas de tomate para o estudo de diferentes genes. ocorreram as permutas indicadas pelas setas 1 e 2. B/b e D/d.5. 15 com flores vermelhas e grãos de pólen longos. por técnicas que determinam a homologia entre amostras de DNA extranuclear. com flores vermelhas e grãos de pólen redondos. Todas as plantas produzidas tinham flores púrpuras e grãos de pólen longos.

Questão 157 Considere que os genes autossômicos. Justifique. faça o que se pede: a) Um casal (P1). havendo 10 unidades de recombinação (morganídeos) entre eles. mas com aptidão mediana para aprender matemática. um indivíduo heterozigoto apresenta aptidão mediana. ao se casar com um indivíduo com genótipo: Questão 158 1. 34 . deles resultando. em frações decimais. correspondam a aptidões para aprender biologia (B). um indivíduo com genótipo recessivo não apresenta aptidão. em Genética. o termo ligação? Qual é a sua utilidade para a pesquisa científica? c) Calcule a distância. matemática (M) e tocar guitarra (G). Nessas condições. e um indivíduo homozigoto dominante apresenta maior aptidão. Com base nessas informações. Em um dado loco. terá 100% dos filhos(as) com aptidão no mínimo mediana para as três características. identificados nos cromossomos (I e II).6 Os locos gênicos A e B se localizam em um mesmo cromossomo. a) Como se denomina a situação mencionada? Supondo o cruzamento AB/ab com ab/ab b) Qual será a porcentagem de indivíduos AaBb na descendência? c) Qual será a porcentagem de indivíduos Aabb? Questão 159 Numa população de 100 pessoas. qual será a porcentagem esperada de indivíduos de fenótipo dominante na próxima geração? Justifique suas respostas mostrando como chegou aos resultados numéricos. poderá esperar descendentes (F1) com qual(is) genótipo(s)? b) Se um descendente (F1) se casar com um indivíduo sem aptidão para as três habilidades. em unidades de mapa genético. qual a probabilidade desse casal ter uma criança com aptidão mediana para matemática? c) Qual o nome do mecanismo genético. formado por um indivíduo triplo homozigoto dominante e outro triplo homozigoto recessivo.5. Considere. que a característica em questão não altera o valor adaptativo dos indivíduos. a freqüência dos genes dominantes e recessivos. entre os genes pesquisados pelos alunos do grupo G2. também. em média. b) O que significa. que permitiria ao casal do item b ter filhos com aptidão mediana para aprender biologia mas sem aptidão para tocar guitarra? d) Quais os locos cuja herança não resultará em proporções segregantes dentro dos padrões da segunda Lei de Mendel? e) Uma mãe sem aptidão para aprender biologia e tocar guitarra.a) Indique o(s) grupo(s) que trabalhou (trabalharam) com genes ligados. proposto por Thomas Hunt Morgan. a) Expresse. 36 são afetadas por uma doença genética condicionada por um par de alelos de herança autossômica recessiva. igual número de descendentes. b) Quantos indivíduos são homozigotos? c) Suponha que nessa população os cruzamentos ocorram ao acaso.

sem grandes alterações de seu reservatório genético. uma população ideal deve atingir o equilíbrio. a) Cite duas das condições propostas por Hardy e Weinberg para que o equilíbrio possa ser atingido. Considere regiões geográficas em que a doença infecciosa é endêmica e regiões livres dessa infecção. ou estado estático. a fenilcetonúria. Desses. Questão 162 A SOCIOBIOLOGIA procura explicar o comportamento dos indivíduos em função de sua herança genética. Calcule a freqüência de indivíduos de fenótipo normal portadores do gene causador da fenilcetonúria nessa população. A freqüência dos genótipos desse grupo sangüíneo foi amostrada em duas populações humanas e os resultados são apresentados na tabela a seguir. Questão 165 A freqüência gênica de dois alelos em uma população. Determine a freqüência dos genes V e a freqüência dos genes v nessa população. 35 . b) Defina o conceito de evolução em função da freqüência dos genes de uma população e indique de que forma a diminuição da população afetou a evolução dos jabutis gigantes. 3) Deriva ao acaso da freqüência gênica. numa dada geração. onde p e q são as freqüências de dois alelos. Questão 164 Uma população vegetal que NÃO está em equilíbrio de Hardy-Weinberg. ou vice-versa. Alguns mecanismos evolutivos que alteram a freqüência dos genes são: 1) Seleção natural. foi de A= 80% e a=20%. Com essa equação podemos calcular a freqüência de um genótipo sabendo a freqüência de um dos alelos. desde que a população esteja em equilíbrio. 380 são homozigóticos (VV) e 40 são heterozigóticos (Vv). a qual é letal para as pessoas homozigóticas AA. Em uma das ilhas do arquipélago de Galápagos. Esta erupção teria diminuído drasticamente a população de jabutis gigantes da ilha. Um dos instrumentos mais utilizados nesses estudos é a pesquisa sobre o comportamento de gêmeos univitelinos que foram criados em ambientes diferentes. determinada por um gene autossômico recessivo. uma dessas crianças apresentou uma doença. uma das condições estabelecidas por Hardy e Weinberg para populações ideais foi seriamente afetada por uma erupção vulcânica ocorrida há cerca de cem mil anos. Espera-se encontrar diferença na freqüência de nascimento de crianças aa entre essas regiões? Por quê? Questão 161 Segundo o Teorema de Hardy Weinberg. Na geração seguinte foi observada uma freqüência de A=60% e a=40%. 2) Taxa de mutação gênica. principalmente em populações pequenas. p£+ 2pq + q£= 1. Numa determinada população em equilíbrio de Hardy-Weinberg nasceram 10. As pessoas heterozigóticas Aa são resistentes a uma doença infecciosa causada por um protozoário. Dos 420 indivíduos de flores vermelhas.Questão 160 Um determinado gene de herança autossômica recessiva causa a morte das pessoas homozigóticas aa ainda na infância. Questão 166 O grupo sangüíneo MN é determinado por dois alelos codominantes. Qual o princípio científico dessa abordagem experimental? Questão 163 Pela equação Hardy-Weinberg.000 crianças. é composta por 500 indivíduos. Qual das três possibilidades apresentadas NÃO pode ser aceita para explicar a variação na freqüência dos genes citados? Justifique sua resposta. 420 são de flores vermelhas (fenótipo dominante) e 80 são de flores brancas (fenótipo recessivo).

b) Qual o nome dado a essa alteração brusca na freqüência gênica? Questão 168 Uma das maneiras de verificar se uma determinada espécie está ou não em evolução é fazer um estudo do patrimônio genético de suas populações. Em uma amostra de 1000 pessoas desta população. que determina o grupo sangüíneo O. a) Qual a freqüência dos alelos A e a em cada uma das populações? b) Qual delas tem a maioria dos indivíduos homozigotos? Explique. respectivamente. EM PORCENTAGEM. Usando o teorema de Hardy-Weinberg pode-se determinar as freqüências gênicas de uma população e demonstrar se a espécie está em equilíbrio. aplicar o Princípio de Hardy-Weimberg. Despreze a parte fracionária de seu resultado.7 Calcule a freqüência do alelo M nas duas populações e determine se a população da Europa como um todo é uma população panmítica. é de 0.40 (40%) em uma população em equilíbrio. portanto. 40 indivíduos com genótipo Aa e 70 indivíduos com genótipo aa. isto é. a dominante e a recessiva.5.Questão 169 Em uma população. numa proporção de 10:1. é determinada por um gene dominante. Entretanto. Considerando que tal população se encontre em equilíbrio genético. em estado de não-evolução. cada uma com 200 indivíduos diplóides. a freqüência do referido gene na população. como a cor amarela. A população 1 apresenta 90 indivíduos com genótipo AA. 130 indivíduos com genótipo Aa e 25 indivíduos com genótipo aa. 1 e 2. a) Após o desastre pode-se afirmar que a freqüência do gene recessivo será zero? Justifique sua resposta. Questão 171 A freqüência do gene i. Esse gene tem um alelo que não produz essa característica. Com base nessas informações. podendo-se. com 400 alelos. Um estudo dessa população determinou que a freqüência do fenótipo amarelo era de 50% e NÃO SE SABE se essa população está em equilíbrio de Hardy-Weinberg. Questão 172 Uma característica fenotípica de uma população. Questão 167 Numa determinada ilha existia uma população animal com indivíduos possuidores de uma característica normal e indivíduos possuidores de uma característica recessiva. Explique. Questão 170 Considere duas populações diferentes. portanto. não é possível saber a freqüência do gene para cor amarela. uma população em que os casamentos ocorrem ao acaso. sendo 36% dos indivíduos recessivos. Mas um desastre ambiental provocou a morte de todos os indivíduos com a característica recessiva. Justifique sua resposta. A população 2 apresenta 45 indivíduos com genótipo AA. 1. isto é. caso exista. para que uma população se mantenha em equilíbrio genético é necessário que ela se enquadre em certas condições. alterando de forma brusca a freqüência do gene recessivo na população da ilha. calcule. quantas se espera encontrar com sangue do tipo O? Explique as etapas que você seguiu para chegar à resposta. Indique o genótipo das pessoas do grupo sangüíneo O. Escreva quatro destas condições: 36 . um determinado gene apresenta-se em duas formas.

todo o DNA tem uma densidade intermediária entre o que é constituído apenas por ¢¥N e o que contém apenas ¢¦N? b) Considerando que. Questão 174 Bactérias (Escherichia coli) foram cultivadas durante várias gerações em um meio de cultura na qual toda a fonte de nitrogênio era o isótopo pesado ¢¦N. que quantidade de DNA há na faixa superior? Questão 175 Quais são as duas propriedades fundamentais do DNA que permitem a essa substância desempenhar o papel de material genético? 37 . O DNA das bactérias das amostras B e C foi também extraído e centrifugado. na amostra C. responda: a) Qual a importância de o DNA autoduplicar-se? b) Por que essa replicação é semiconservativa? Questão 180 No DNA de um organismo. extraiu-se o DNA que foi submetido a uma técnica de centrifugação que permite separar moléculas de DNA de acordo com sua densidade.1 A figura mostra o resultado da centrifugação do DNA das três amostras de bactérias.Questão 173 No DNA de um organismo. na amostra B. O restante das bactérias foi transferido para um meio de cultura em que todo o nitrogênio disponível era o isótopo normal ¢¥N. Que outras bases nitrogenadas devem existir neste DNA e em que proporções? 1. Questão 176 Por que o processo de replicação do DNA é chamado semiconservativo? Questão 177 Dada a seqüência de bases nitrogenadas de um segmento de DNA: AAT GGC ATC responda: a) Qual é a seqüência de bases da hélice complementar a esse segmento? b) Qual é a seqüência de bases do RNA mensageiro transcrito a partir desse segmento? Questão 178 Dada a seqüência de bases nitrogenadas de um segmento de DNA a seguir. Utilizando seus conhecimentos sobre o material genético. 20% das bases nitrogenadas são constituídas por adenina. a) Por que. responda aos itens adiante. Retirou-se uma segunda amostra (amostra B).8.5. De uma amostra dessas bactérias (amostra A). a quantidade de DNA separada na faixa inferior é X. quando as bactérias completaram duas divisões celulares. quando as bactérias completaram uma divisão celular nesse novo meio e uma terceira amostra (amostra C). TTT AAT GGG CAT a) Qual é a seqüência de bases da hélice complementar a esse segmento? b) Qual é a seqüência de bases do RNA mensageiro transcrito a partir desse segmento? Questão 179 Para funcionar como material genético o ácido desoxirribonucléico (DNA) apresenta a capacidade de autoduplicação. 18% das bases nitrogenadas são constituídas por citosina. Que outras bases nitrogenadas devem existir neste DNA e em que proporções? Justifique sua resposta.

8.Questão 181 Mencione duas diferenças de natureza molecular entre o DNA e o RNA. 1.AUTODUPLICAÇÃO II . b) Quais são as diferenças observadas nos nucleotídeos que entram na composição do DNA em relação aos que entram na composição do RNA? Questão 189 1.5. que representa a estrutura da molécula de DNA.TRANSCRIÇÃO Explique essas duas propriedades. Questão 183 O que são NUCLEOTÍDEOS? Quais são as moléculas que entram em sua composição química? Questão 184 Quais são as diferenças observadas nos nucleotídeos que entram na composição do DNA em relação aos que entram na composição do RNA? Questão 185 O que representa o desenho a seguir? Qual o nome das moléculas representadas pelos números 1. respectivamente. São elas: I . Questão 186 No desenho a seguir. 38 . o que representam os números 1. a) Represente um nucleotídeo apontando seus três constituintes moleculares.8. 2 e 3 respectivamente? Questão 190 Sabendo-se que numa molécula de DNA formada por uma dupla hélice há 21% de timina.1 Para funcionar como material genético o DNA apresenta duas propriedades fundamentais.5. sabendo que se trata da unidade estrutural do ácido desoxirribonucléico (DNA)? Questão 187 Uma molécula de DNA contém 15% de guanina. responda quais são as outras bases dessa molécula e em que proporções ocorrem. Que outras bases nitrogenadas possui essa molécula e em quais proporções? Questão 188 Os ácidos nucléicos são macromoléculas definidas como polinucleotídeos. 2 e 3.1 Questão 182 Justifique o termo SEMICONSERVATIVO para caracterizar o processo de replicação do DNA.

como representado no esquema a seguir. Que outras bases nitrogenadas devem existir neste DNA e em que proporções? Questão 194 CÉLULAS IMORTAIS CONTAM AOS CIENTISTAS HISTÓRIA DA EVOLUÇÃO DA HUMANIDADE Estas células formam um livro. se o nucleosídeo radioativo usado fosse a timidina e justifique sua resposta. as células foram transferidas para um novo meio que não continha o isótopo. Esse processo marca a posição aproximada do isótopo dentro da célula. Justifique sua resposta. fixadas e submetidas a auto-radiografia.8. então. Os capítulos contam diferentes detalhes da saga do homem na terra: suas andanças pelos continentes. Questão 195 a) Quais são as bases da cadeia complementar a esse segmento? b) Se o segmento dado servir de molde para a produção de RNA. foram comparadas as características genotípicas e fenotípicas de células retiradas de um tecido de anfíbio.. Amostras destas células foram retiradas 3. conservado em tanques de nitrogênio líquido que guarda informações desconhecidas sobre a humanidade.. b) ".5. Após algum tempo. "O Globo") a) Explique por que o processo de autoduplicação do DNA dá significado à hereditariedade permitindo revelar a história da evolução da humanidade. 32% das bases nitrogenadas são constituídas por citosina. colocadas em lâmina de vidro. entre essas células: a) as características genotípicas são iguais. adicionou-se o nucleosídeo uridina marcado radioativamente com H¤ ao meio de cultura. b) as características fenotípicas são diferentes.1 a) Cite o tipo de molécula à qual a uridina se incorporou. Nomeie o processo através do qual o DNA é capaz de controlar e interferir nas características morfológicas e fisiológicas da célula. Explique por que. suas andanças pelos continentes. casamentos ancestrais e os ataques de doenças. b) Nomeie o compartimento celular que seria marcado. com as de células de tecido similar do mesmo indivíduo após atingir a idade adulta. Questão 196 Num experimento. 39 . 15 e 90 minutos após a transferência.Questão 191 Considere um segmento de DNA com a seguinte seqüência de bases nitrogenadas: ATT CTA CGC AAA GGC através de observações de características morfológicas e fisiológicas da célula. qual será a seqüência de bases desse RNA? Questão 192 Considere a seqüência de bases nitrogenadas de um segmento de DNA: AAA GGC ATT Responda: a) Qual é a seqüência de bases da hélice complementar a esse segmento? b) Qual é a seqüência de bases do RNA mensageiro transcrito a partir desse segmento? Questão 193 No DNA de um organismo. casamentos ancestrais e os ataques de doenças" podem ser estudados Em células eucariotas mantidas em cultura. sendo. 1. (adaptado de. ainda no estágio de girino.

Suponha agora a seguinte situação: um homem acusado de ser o pai de uma criança tenta burlar o teste de tipagem de DNA. Questão 199 O genoma da bactéria "Escherichia coli" tem um tamanho de 4×10§ pares de nucleotídeos. usa-se um marcador do cromossomo Y. Isto significa que cada indivíduo possui variações discretas e características na seqüência de seu DNA. ou seja. Tal evento inibiria 40 . Para replicar o genoma. o DNA possui duas propriedades. que não se altera ao longo das gerações (salvo em casos de mutações). Por que o DNA mitocondrial deve ser usado para a análise matrilínea? Questão 202 No ADN. a tipagem do DNA revela um padrão de bandas que é estável (presente no DNA de todos os tecidos) e é transmitido aos descendentes seguindo as leis de Mendel. para o genoma humano. para uma análise matrilínea (materna). a investigação dos ancestrais paternos. Assumindo que a DNA polimerase apresenta uma velocidade de reação constante para todas as espécies analisadas.coli" é de cerca de 20 minutos. Assim. Sabe-se que todas as mitocôndrias dos indivíduos afetados pela cegueira não possuem o gene normal. explique essa aparente contradição. para replicar todo o genoma de uma bactéria. sabe-se que no mesmo trecho nunca ocorre a transcrição simultânea das duas cadeias de uma molécula de ADN. a DNA polimerase. a seqüência de nucleotídeos do DNA de cada pessoa é única (excetuando-se o caso de gêmeos monozigóticos). Graças a essas características é possível atualmente realizar testes de paternidade que comparam os padrões de bandas de DNA das pessoas e revelam se um homem é de fato o pai biológico de uma outra pessoa. ao passo que a seqüência do outro gene pode estar localizada na cadeia oposta. um amigo o aconselha a receber uma transfusão de sangue 2 meses antes do teste (em geral colhe-se o sangue como fonte de células nucleadas). Identifique-as e descreva resumidamente cada uma delas. Com a utilização de técnicas de genética clássica e molecular. lança-se mão do DNA mitocondrial. Para alguns genes. existe uma enzima. e que o tempo médio de replicação de uma célula eucariota é de 12 horas. verificou-se que este gene está localizado no genoma mitocondrial. aproximadamente 43 dias! Sabemos. a) Informe a percentagem de filhas e filhos cegos de um casal: I) cuja mulher é normal e o homem é cego. no entanto. Já o genoma haplóide humano tem 3×10ª pares de nucleotídeos. No entanto. antes da divisão celular. Por outro lado. a) Qual a influência da transfusão sugerida no resultado no exame? b) Que precauções podem ser tomadas para desmascarar a tentativa de fraude? Questão 201 A tipagem de DNA é uma técnica desenvolvida recentemente que permite identificar e estabelecer o grau de parentesco entre indivíduos. isto é. a transcrição dos genes não está restrita a somente uma das suas cadeias. mas sim o gene mutado. Para se realizar uma análise patrilínea. a DNA polimerase consumiria cerca de 83 minutos e. Questão 200 O teste de tipagem de DNA revelou que nos seres humanos existe individualidade genômica. a seqüência de nucleotídeos transcrita pode estar em uma cadeia. cuja velocidade de reação é equivalente a cerca de 800 nucleotídeos/s. b) Justifique as respostas ao item a. que o tempo de geração da "E. II) cuja mulher é cega e o homem é normal. Questão 198 A mutação em um gene humano provoca cegueira. Assim.Questão 197 Para desempenhar sua função como material hereditário.

1 41 . . no mesmo trecho.Cultura de 2 geração com ¢¥N: 1200 moléculas de DNA nas quais 600 com ¢¥N e 600 com ¢¦N e ¢¥N. 23% de timina. b) Explique por que é impossível prever a proporção de citosina presente no ARN mensageiro codificado por esse trecho de ADN. nessa molécula. guanina (G) e timina (T). 27% de citosina e 27% de guanina.o processo da tradução. .Cultura de crescimento com ¢¦N: 300 moléculas de DNA todas com ¢¦N. Esses resultados foram importantes para corroborar a idéia de que o ancestral comum mais recente do 'Homo sapiens' viveu na África há cerca de 200.Cultura de 1 geração com ¢¥N: 600 moléculas de DNA todas com ¢¦N e ¢¥N. Questão 205 Considerando as propriedades de duplicação do DNA. Com base nestes dados: a) O que se pode afirmar a respeito das semelhanças entre estas duas moléculas de DNA? b) Justifique sua resposta. 27% de citosina e 27% de guanina. Justifique sua resposta. após esse crescimento promove-se o desenvolvimento de mais duas gerações. Explique por que ocorreria a inibição da tradução se a transcrição de uma cadeia do ADN ocorresse ao mesmo tempo que a transcrição da sua cadeia complementar. 23% de timina. adenina (A). 2 etapa: Extrai-se o DNA de todas as bactérias e obtém-se o seguinte resultado: Questão 206 A análise química de duas moléculas de DNA revelou a seguinte composição de bases: Molécula A 23% de adenina. 1.000 anos. observe o resultado do experimento a seguir. a) Indique as porcentagens das quatro bases. . citosina (C). Questão 204 A soma das porcentagens de guanina e citosina em uma certa molécula de ADN é igual a 58% do total de bases presentes. Explique as porcentagens obtidas em todos os extratos das diferentes culturas no experimento. Os resultados revelaram que a variabilidade genética no DNA mitocondrial de indivíduos africanos era quase o dobro da observada no DNA mitocondrial de não-africanos. Questão 203 Estudos recentes compararam as seqüências completas de DNA mitocondrial de indivíduos de várias regiões geográficas do planeta. 1 etapa: Em uma cultura com ¢¦N. obtém-se o crescimento de colônias de bactérias. Molécula B 23% de adenina. em cultura com ¢¥N.5. Explique por que a maior diversidade do DNA mitocondrial apóia a idéia da origem africana do 'Homo sapiens'.8.

Explique a que correspondem os "corrimãos" e os "degraus" dessa escada. em vez de fósforo. A marcação radioativa foi detectada dentro destas bactérias. Os novos bacteriófagos formados estavam marcados radioativamente. será de qual deles? b) Justifique sua resposta. b) Que relação existe entre DNA. pintando quais serão as pessoas afetadas pela doença em F1 e em F2 b) Justifique sua resposta.1 a) Copie o heredograma. que faz com que a produção de energia para os músculos seja deficiente. tivesse sido usado enxofre radioativo (¤¦S) para marcação de proteínas. Questão 211 No heredograma seguinte. Hershey e Chase cultivaram bactérias em meio de cultura contendo fósforo radioativo (¤£P) e colocaram bacteriófagos (vírus) para infectar essas células. ressaltando a interação entre as duas cadeias do polímero. planta ou bactéria. C. a) Como se explica que o fósforo radioativo tenha passado para o bacteriófago? b) Como se explica que as bactérias cultivadas sem a presença de fósforo radioativo tenham sido marcadas? c) Se. G & T representam as bases adenina. 1. 42 . guanina e timina. citosina. os resultados seriam os mesmos? Justifique. Questão 212 A figura a seguir mostra um trecho da estrutura do ácido desoxiribonucléico. A. Estes bacteriófagos marcados foram utilizados para infectar outras células bacterianas cultivadas sem a presença de fósforo radioativo. RNA e síntese protéica? c) Como podemos diferenciar duas proteínas? Questão 210 Cientistas criaram em laboratório um bacteriófago (fago) composto que possui a cápsula protéica de um fago T2 e o DNA de um fago T4. James Watson e Francis Crick descobriram a estrutura do DNA. também tiveram filhos (F2). aparentemente normal. O casal (P) teve filhos (F1) e estes. Questão 209 Em 25 de abril de 1953. a pessoa A possui uma mutação no DNA de todas as suas mitocôndrias. os fagos produzidos terão a) a cápsula protéica de qual dos fagos? E o DNA. a) Entre estas lâminas. rato.5. por sua vez. quais se referem a DNA? b) Justifique o resultado obtido com a 5Ž lâmina.8. respectivamente.Questão 207 A análise química em amostras de cinco lâminas com ácidos nucléicos apresentou os seguintes resultados: 1Ž lâmina: ribose 2Ž lâmina: uracila 3Ž lâmina: dupla-hélice 4Ž lâmina: timina 5Ž lâmina: 15% de guanina e 25% de citosina. Após esse bacteriófago composto infectar uma bactéria. Essa pessoa casou-se com outra. a) Watson e Crick demonstraram que a estrutura do DNA se assemelha a uma escada retorcida. ocasionando dificuldades motoras para os portadores do problema. Questão 208 Em 1952. que permitiu posteriormente decifrar o código genético determinante para a síntese protéica. um estudo de uma única página na revista inglesa Nature intitulado "A estrutura molecular dos ácidos nucléicos". Na figura. revolucionou para sempre todas as ciências da vida sejam elas do homem. quase ignorado de início.

sabendo-se que trata-se da unidade estrutural do ácido ribonucléico (RNA). b) Qual é o nome dessa unidade estrutural? Questão 216 Uma cadeia de RNA tem 200 nucleotídeos. é a principal responsável pela maturação de frutos como o tomate. Essas pontes de hidrogênio podem ser rompidas por calor. Esse processo reversível chama-se de desnaturação. respectivamente. no genoma de um tomateiro.Questão 214 Que papéis desempenham o RNA mensageiro e do RNA transportador no processo de síntese das proteínas? 1. Observe as duas seqüências de DNA a seguir e determine qual delas precisará de uma temperatura de desnaturação maior. 2 e 3.5.5.1 . responda o que representam os componentes 1. Quantos nucleotídeos tinha o DNA que originou esse RNA? Questão 217 Um segmento de RNA mensageiro apresenta a seqüência de bases nitrogenadas a seguir: AAA UUC GGG GAU. 2 e 3.8. 1) ACTTTAAAGATATTTACTTAAA TGAAATTTC TATAAATGAATTT 2) GCTAGGCCGATGCGGCGTGGA CGATCCGGCTACGCCGCACCT Questão 213 Considerando o modelo da estrutura molecular do DNA como representado na figura adiante. o que produz a dissociação das cadeias.8. de maneira invertida. 43 1. que digere a parede celular de células vegetais. utilizou-se uma técnica na qual o gene que codifica a enzima citada foi inserido. Justifique a sua resposta.1 Questão 215 Observe o esquema adiante e responda: As linhas pontilhadas indicam as pontes de hidrogênio que são formadas entre as bases aminadas e que contribuem para manter unidas as duas cadeias do DNA. respectivamente.2 ) Quais são as moléculas representadas pelos números 1. 1. Para retardar o amadurecimento e evitar as perdas durante o armazenamento. mas um deles é a composição dos nucleotídeos de um determinado DNA.5. A temperatura necessária para desnaturar o DNA depende de vários fatores. a) Quais são as bases do segmento de DNA que deu origem a esse RNA? b) Quantos nucleotídeos existem no DNA que deu origem a essa molécula de RNA mensageiro? Questão 218 A enzima poligalacturonase.8.

5. Suponha que um trecho da fita molde de DNA do gene X. Considere que o RNA mensageiro seja formado a partir das trincas mostradas no esquema da figura 1 a seguir. responda: a) Quais serão os segmentos de proteínas produzidos. B e C têm mutações em um segmento de DNA desse gene. Usando a tabela que relaciona alguns codons aos respectivos aminoácidos e considerando que a fita molde a ser transcrita é aquela assinalada com a letra m. tem a capacidade de promover mutações no DNA levando a mudança da base Guanina para Timina. cuja seqüência normal está representada a seguir.8. b) Explique por que haverá um aumento no tempo de amadurecimento desse tomate geneticamente modificado. ambos ativos nesse tomate geneticamente modificado. em um dos dois sítios indicados na figura 1. B e C? b) Como será o fenótipo (normal ou afetado dos indivíduos A. Questão 219 De que maneira o DNA determina a seqüência de aminoácidos das moléculas de proteínas? Questão 220 Uma doença genética de herança dominante é causada por mutações em um gene localizado em um autossomo.2 1. respectivamente.5. pelos indivíduos A. B e C? Por quê? Seqüência normal CAA AAC TGA GGA ATG CAT TTC (m) GTT TTG ACT CCT TAC GTA AAG Indivíduo A CAA AAC TGA GGA ATT CAT TTC (m) GTT TTG ACT CCT TAA GTA AAG 44 Questão 221 O fumo está relacionado ao aumento de risco para o câncer de pulmão. O hábito de fumar expõe os fumantes a substâncias com atividade carcinogênica. Os indivíduos A. O Benzo[a]pireno.O esquema adiante mostra os produtos da transcrição do gene normal da enzima e do gene inserido. Indivíduo B CAT AAC TGA GGA ATG CAT TTC (m) GTA TTG ACT CCT TAC GTA AAG Indivíduo C CAA TAC TGA GGA ATG CAT TTC (m) GTT ATG ACT CCT TAC GTA AAG 1. justificando cada resposta com a utilização do código genético da figura 2: .3 a) Descreva a interação que ocorre entre os produtos da transcrição dos genes normal e inserido no tomate geneticamente modificado e indique a característica dessas moléculas que permite a interação. representado a seguir. um dos principais agentes carcinogênicos presentes na fumaça do cigarro.8. possa ser alterado em presença do Benzo[a]pireno. Indique as alterações que ocorrerão na síntese da proteína X quando a mutação for localizada nos diferentes sítios.

Por que sempre encontramos N > P ? Questão 224 1.GAG .5. c) Se o gene de uma proteína respiratória de um organismo zbohrniano for introduzido numa bactéria terrestre.AAG . cuja seqüência de nucleotídeos é 5' . isto é. 1.CCT .5 bilhões de anos. 1. a partir da seqüência de aminoácidos de uma proteína. encontradas nos organismos da Terra.GTG .8. a) Considere o segmento de DNA. Explique a possibilidade da ocorrência dessas três proteínas nos seres de Zbohrnya.3 b) Utilize um exemplo de alteração estrutural da globina humana (cadeia beta) para explicar como uma mutação pontual. ou do RNA-m correspondentes.3 Com o auxílio da tabela do código genético representada a seguir. do tipo substituição. 45 . utilizando-se da tabela do código genético apresentada a seguir. B e C. Um gene é constituído por um número N de nucleotídeos que codifica uma proteína constituída por P aminoácidos. 13.5. b) Sabendo que a vida em Zbohrnya e na Terra existe há 3. não se pode deduzir a seqüência de nucleotídeos do gene.CAC .3' e. Questão 222 As globinas constituem um bom exemplo da importância da informação genética na estrutura primária e na função das proteínas.5. a proteína produzida pela expressão desse gene será idêntica à da espécie zbohrniana? Justifique sua resposta.ACT . faça uma comparação entre a diversidade dos organismos encontrados nesses dois planetas. o oposto não é verdadeiro. Questão 223 O ADN é um polímero constituído por vários nucleotídeos e as proteínas são polímeros constituídos por vários aminoácidos. respectivamente.8. 16 e 19 tipos diferentes de aminoácidos. pode afetar a saúde e a qualidade de vida do portador dessa mutação.CTG . apresentam. Explique por quê. é sempre possível deduzir-se a seqüência de aminoácidos de uma proteína a partir da seqüência de nucleotídeos do seu gene.8. a) As proteínas A. Questão 225 O DNA dos organismos do planeta Zbohrnya é constituído pelos mesmos 4 tipos de bases dos seres vivos terrestres. forneça o produto da síntese protéica (polipeptídio parte da cadeia beta prevista para a globina humana).3 Entretanto. Já o código genético desses organismos é determinado por códons de 2 bases.GAG .

8.5.T A C T C A A C C G G A C --A primeira trinca de pares de bases nitrogenadas à esquerda. após uma deleção do TERCEIRO nucleotídeo? Questão 228 A seguir está representada a seqüência dos 13 primeiros pares de nucleotídios da região codificadora de um gene.3 a) Escreva a seqüência de bases nitrogenadas do RNA mensageiro. contendo códigos de trincas de bases do DNA com os aminoácidos correspondentes. c) Qual a seqüência de aminoácidos que resultará da tradução da molécula de RNA mensageiro? Ver figura anterior. Entretanto. b) Utilizando a tabela de código genético fornecida.A T G A G T T G G C C T G ----.8.4 1. a) Determine a seqüência de bases do RNAm que foi utilizado para sintetizar o polipeptídeo esquematizado abaixo da tabela.Questão 226 Considere a tabela abaixo. na 3 base do código correspondente ao 6Ž aminoácido do polipeptídeo. b) Se ocorresse uma substituição. b) Cite a seqüência do anticódon correspondente ao códon de iniciação. d) Qual a seqüência de aminoácidos que resultará da tradução da mesma molécula de mRNA.5. no polipeptídio codificado por esse gene. a deleção do par de bases T = A)? 46 . c) Qual seria a seqüência dos três primeiros aminoácidos de um polipeptídio codificado por um alelo mutante desse gene.8. A tabela a seguir mostra alguns códons do RNA mensageiro e os aminoácidos codificados por cada um deles. no qual três bases codificam um aminoácido. qual seria o aminoácido da tabela a ser incorporado? c) Qual é anticódon correspondente ao novo aminoácido incorporado? Questão 227 A tabela adiante representa uma versão fictícia do código genético. --. transcrito a partir desse segmento de DNA.3 Analise a tabela e faça o que se pede: a) Cite o nome da enzima que catalisa a síntese de RNA mensageiro. 1. originado pela perda do sexto par de nucleotídios (ou seja.5. para resolver os itens seguintes: 1. esse código segue o padrão do código genético universal. corresponde ao aminoácido metionina. indique a seqüência dos três aminoácidos seguintes à metionina. por uma purina.

a partir desse RNA? Questão 231 Ribossomos são formados por RNA e proteínas. a) Onde esses processos ocorrem na célula eucariótica? b) O que acontecerá com os processos de transcrição e tradução. para sua replicação. Questão 234 Em um organismo pluricelular com vários tecidos. enquanto os RNA (+) não precisam armazenar esta enzima. da enzima RNA replicase. como no caso dos seres humanos. o genoma viral funciona diretamente como mensageiro. se ocorrer uma destruição do(s) nucléolo(s) de uma célula?. ou seja. Observe que: . b) Apresente um argumento contrário à hipótese de que os vírus. devido à simplicidade de sua estrutura. encontramos aqueles que são RNA (-). a) Explique por que é necessário.ambos os vírus necessitam. quais poderiam ser as seqüências de bases do RNA por ele produzido? Questão 233 Analisando o genoma de alguns tipos de vírus formados por fita simples de RNA. .o gene da enzima RNA replicase está presente no genoma dos dois tipos de vírus. As regiões do ARN transcrito correspondentes aos íntrons são eliminadas após o processo de transcrição. como o da poliomielite. 47 . todas as células possuem um genoma idêntico. no ribossomo. Questão 232 Sabendo-se que um determinado segmento de DNA apresenta capacidade de transcrever e que apresenta uma seqüência de bases ACTCCGCTT / TGAGGCGAA.nos vírus RNA (+). sintetizados pelos processos de transcrição e tradução.nos vírus RNA (-). A figura a seguir representa o resultado de uma experiência de hibridação do ARN mensageiro com a cadeia de ADN que lhe deu origem. foram precursores das primeiras células. a seqüência ATG AGG CGA ATC. respectivamente. para sua replicação. quais são as seqüências de bases de RNAm por ele produzido? Questão 230 Dado um segmento de RNA mensageiro com a seguinte seqüência de bases: AAU GUA GGC pergunta-se: a) Qual a seqüência de bases do DNA que deu origem a esse RNA? b) Quantos aminoácidos terá o polipeptídeo traduzido. e os que são RNA (+). mas a enzima só é encontrada nas partículas virais RNA (-). como o do resfriado comum.Questão 229 Sabendo-se que um determinado segmento de DNA apresenta capacidade de transcrever e que apresenta a seqüência de bases TAC TCC GCT TAG e. . em sua cadeia complementar. apenas o RNA complementar a seu genoma é capaz de funcionar como mensageiro na célula infectada. regiões do ADN cujas informações não estão presentes na proteína em questão. é correto afirmar que os ARN mensageiros (ARNm) dos diferentes tecidos são todos idênticos? Justifique sua resposta Questão 235 Suponha um gene de um eucarioto responsável pela síntese de uma proteína. Analogamente. Nesse gene existem íntrons. que sintetiza um RNA complementar a um molde de RNA. . que os vírus RNA (-) já contenham a enzima RNA replicase.

Paulo" (23. Questão 236 Em um segmento da cadeia ativa de DNA. identificadas por números de 1 a 5. formado por palavras e setas. Na tabela a seguir.1. Levando-se em consideração essas informações.09. é possível percorrer o caminho inverso e chegar à seqüência de DNA que a gerou? Justifique. e uma terceira classe de genes que não codificam polipeptídios.2002) noticiou que um cientista espanhol afirmou ter encontrado proteínas no ovo fóssil de um dinossauro que poderiam ajudá-lo a reconstituir o DNA desses animais. Quais dessas regiões correspondem aos íntrons? Justifique sua resposta.8. demonstrando como. b) A partir de uma proteína.8. Questão 239 Atualmente os genes podem ser desmembrados em três classes diferentes: os genes que expressam mRNA que codificam polipeptídios diversos. que servirá de molde para a fita de RNA mensageiro. Questão 238 O jornal "Folha de S. os genes reguladores que codificam proteínas que regulam outros genes. responda. a partir de uma seqüência de DNA. Questão 237 Considere um fragmento de DNA com a seguinte seqüência de bases: GTA GCC TAG e responda: a) Qual será a seqüência do RNAm transcrito a partir deste DNA? b) O mesmo peptídio será obtido a partir deste RNAm e do RNAm da fita complementar? Explique. No segmento correspondente da fita complementar do DNA há 12 timinas e 10 guaninas. há 30 timinas e 20 guaninas.5.5 48 . o sinal (+) significa crescimento. Qual o produto final da classe de genes que não codificam polipeptídios? Questão 240 O que são ácidos nucléicos? Como atuam na síntese de proteínas? Questão 241 A figura mostra cinco regiões. obtém-se uma proteína. e o sinal (-) significa ausência de crescimento. a) Quantas uracilas e quantas guaninas comporão a fita do RNA mensageiro transcrito do DNA ativado? b) Quantos aminoácidos deverão compor a cadeia de polipepitídeos que será formada? Justifique sua resposta. 1.4 a) Faça um esquema simples.5. Certos mutantes nutricionais do fungo Neurospora só conseguem crescer quando aminoácidos são adicionados ao meio de cultura.

Os resultados do experimento estão mostrados no gráfico a seguir. Questão 246 Os gráficos a seguir representam o efeito inibitório de dois antibióticos (I e II) sobre a síntese protéica em culturas de 'Staphylococcus aureus'. Ao longo do experimento. As setas nos gráficos indicam o momento em que foram administrados os antibióticos nas culturas. Questão 242 Os códons AGA. respectivamente os aminoácidos arginina. em genes de uma célula eucariota. a seqüência de bases nitrogenadas codificantes. marcadas com isótopos: uridina ¢¥C. A incorporação dos isótopos foi medida em uma preparação que contém os ácidos nucléicos e as proteínas da célula. hoje.TCT . CUG. b) As proteínas. ou seja. A abordagem experimental mais freqüente. Escreva esses aminoácidos na ordem correspondente à seqüência TGA . no entanto. Cite duas ligações ou interações que atuam na manutenção da estrutura enovelada das proteínas. Questão 243 Quais os papéis do gene e do ribossomo na síntese das proteínas celulares? Questão 244 Para investigar possíveis efeitos de uma determinada droga.5. e ACU do RNA mensageiro codificam. após sintetizadas. Após algum tempo. 1. amostras das células foram coletadas a intervalos regulares. em organismos eucariotos. então. a) Considere as etapas de replicação. sintetizar os seus DNA-complementares e. Indique se a droga interfere em cada uma dessas etapas e justifique suas respostas.5 1. é possível determinar a seqüência codificante diretamente a partir de seu cromossomo. aquela que define a estrutura primária da proteína a ser sintetizada. leucina e treonina. à qual foram adicionadas quantidades adequadas das seguintes substâncias.5. primeiramente. proceder ao seqüenciamento das bases presentes nesses DNA. timidina ¤H e leucina ¢¦N. explique o porquê do mutante Z só crescer quando se adiciona arginina ao meio de cultura.Sabe-se que as etapas que levam à síntese da arginina são: substrato ë (gene1) ë ornitina ë (gene2) ë citrulina ë (gene3) ë arginina Supondo que em cada mutante há apenas um gene alterado. utilizou-se uma cultura de células. explique a atuação dos antibióticos I e II sobre a síntese protéica. é preferível utilizar o RNA-mensageiro para determinar a região codificante do DNA. Explique o motivo pelo qual. consiste em.5 Com base nos gráficos.8.GAC de um segmento de DNA.8. Questão 245 Diversas técnicas são utilizadas para determinar. extrair os RNA-mensageiros da célula. adquirem uma conformação tridimensional. a droga foi também introduzida no meio de cultura. transcrição e tradução nas células analisadas. Em uma bactéria. 49 .

CCG. que é chamada de Shine-Dalgarno.. conhecidas como hemoglobinas A e S. a partir da célula que sofre a mutação.GUU. ACG.8. existe uma seqüência curta de nucleotídeos que antecede esse códon. A seqüência de Shine-Dalgarno está em vermelho e o códon de iniciação.AGCAGCAGCAGCAGCAGCAGCAGC. essa cadeia de DNA sempre produzia uma proteína com um único tipo de aminoácido. GAA A mutação pode ocorrer no ADN como mostra o esquema a seguir: Questão 248 Nos procariotos.8. em azul..GAG. UUA treonina . incluindo os diferentes aminoácidos. cada uma delas com um único tipo de aminoácido: serina ou alanina 50 a) Qual é o aminoácido que aparece. o sinal para o início da síntese das proteínas (tradução) é geralmente sinalizado no ARNm pelo códon AUG..Essa cadeia de DNA foi usada em um sistema livre de células. CAC leucina .Sintetizaram uma cadeia de DNA com três nucleotídeos repetidos muitas vezes em uma seqüência conhecida: .5 Explique a importância desse duplo controle da iniciação para a tradução correta da mensagem contida no ARNm.Nesse sistema. que corresponde ao aminoácido metionina.5. quando se iniciavam as pesquisas sobre como o DNA codificava os aminoácidos de uma proteína.. Questão 249 Nos anos 50 e 60.. . em homenagem aos pesquisadores que as detectaram.5.UUG. um grupo de pesquisadores desenvolveu o seguinte experimento: 1. O diagrama a seguir ilustra a localização dessa seqüência. serão anômalas? Justifique sua resposta. permite que o sítio correto de iniciação da tradução seja selecionado. GUA histidina . Essa pequena diferença é suficiente para determinar que uma pessoa portadora de hemoglobina S sofra de anemia falciforme. Diferentes repetições do experimento demonstraram que até três proteínas diferentes poderiam ser produzidas. Os códons de RNA-m que codificam esses aminoácidos são: valina . Hemoglobina S: .. No entanto. além do código AUG. ACA prolina .CCU.valina-histidina-leucina-treonina-prolina-ácido glutâmico. ACC..CAU. na hemoglobina S..ACU..valina-histidina-leucina-treonina-prolina-x. GUC. 1.. Essa seqüência. . CCC. GUG.. b) Todas as células..5 .Questão 247 Na espécie humana há dois tipos de hemoglobinas. CCA ácido glutâmico . . no lugar do ácido glutâmico? Justifique sua resposta. que diferem apenas em um aminoácido: Hemoglobina A: . porém no qual haviam todos os componentes necessários à síntese protéica.

1. Questão 252 O esquema a seguir representa a seqüência de reações que levam à formação do pigmento da pelagem de uma espécie animal. Os genes autossômicos A.5. b) Por que podem ocorrer alterações nas proteínas quando o gene sofre mutação? c) Em que situação uma mutação não altera a molécula protéica? Questão 251 Abaixo estão esquematizadas as seqüências de aminoácidos de um trecho de uma proteína homóloga. 3 e 4 se originaram da espécie 1. b) Pode-se dizer que seqüências idênticas de aminoácidos são sempre codificadas por seqüências idênticas de nucleotídeos? Justifique. Cada letra representa um aminoácido. a lactose não é tão facilmente incorporada pelas bactérias. Uma mutação gênica pode determinar a alteração ou a ausência de algumas dessas proteínas. B e C são responsáveis pela produção das enzimas A. b e c. a) Por que as proteínas obtidas possuíam apenas um tipo de aminoácido? b) Por que foram obtidos 3 tipos de proteínas? Questão 250 O metabolismo celular é controlado por uma série de reações em que estão envolvidas inúmeras proteínas.coli' cresce mais rapidamente na presença da glicose (um monossacarídeo) do que na presença de lactose (um dissacarídeo). que tipo de mutação originou cada seqüência? Sabe-se que a bactéria 'E. segundo. qual será a seqüência de bases da fita complementar? b) Se a fita complementar for usada durante a transcrição. B e C produzem respectivamente os alelos recessivos a.ou glutamina.5 a) Quantos nucleotídeos são necessários para codificar a seqüência de aminoácidos nas espécies 1 e 2? Justifique. c) É possível ocorrer uma mutação em um gene sem que se altere a enzima correspondente? Justifique. quantos tipos de albinismo podem ocorrer nessa espécie? Por quê? b) Demonstre o fenótipo esperado de um cruzamento entre animais de linhagens puras com dois tipos diferentes de albinismo. c) Considerando que as espécies 2.5 a) Do ponto de vista genético. a) Considerando que tenha ocorrido a ação da DNA-polimerase. levando a mudanças no ciclo de vida da célula. Questão 253 Uma fita de DNA tem a seguinte seqüência de bases 5'ATGCGT3'. Isso se deve a dois fatos: primeiro. a) Explique a relação que existe entre gene e proteína. qual será a seqüência de bases do RNA resultante e que nome recebe esse RNA se ele traduzir para síntese de proteínas? Questão 254 1.5.8. Mutações nos genes A. em quatro espécies próximas.8. porque a lactose necessita ser 51 . B e C que atuam nesse processo metabólico.

Questão 258 Descreva o experimento realizado por Hersey e Chase em 1952. a) É possível a reprodução dos zigotos pela via da reprodução sexuada? Justifique sua resposta. simplificadamente.9. em 1944. concentração de glicose e número de bactérias e explique o comportamento da curva da enzima ’-galactosidase. 52 . Questão 260 O esquema a seguir mostra. conhecido como "experiência do liquidificador" na qual utilizaram isótopos radioativos de enxofre (S¤¦) e de fósforo (P¤£) para 'marcar' vírus parasitas de bactérias. 1. bem como suas conclusões a partir deste trabalho. b) E é possível pela via da reprodução assexuada? Justifique sua resposta.coli' foi inoculada num meio contendo uma mistura de glicose e lactose.hidrolisada pela enzima ’-galactosidase em glicose e galactose. M.5 Identifique as curvas da figura. Avery.1 Suponha que os zigotos podem crescer normalmente. Questão 259 A mula é um animal oriundo do cruzamento da égua (2n=64) e do burro (2n=62). a formação de um zigoto híbrido.5. ela é estéril. de que o "agente transformante" capaz de permitir o desenvolvimento da cápsula em pneumococos não-capsulados era o ácido desoxirribonucléico? Questão 257 O que são bacteriófagos? Qual sua importância na identificação do DNA como material genético? 1. O gráfico a seguir resultou de experimento em que 'E. patogênicas.8. não-patogênicas. As curvas no gráfico adiante representam a concentração da enzima ’-galactosidase. McCarthy chegaram à conclusão. a concentração de glicose e o número de bactérias no meio de cultura em função do tempo. RESPONDA: a) Qual o número de cromossomos encontrado nas células sexuais normais da égua e do burro? b) Qual o número de cromossomos encontrado nas células somáticas da mula? Como essas células se originam? c) Apesar de a mula apresentar uma alta capacidade de realizar trabalho. correlacione os parâmetros concentração de ’-galactosidase. Questão 255 Descreva os principais passos seguidos por Griffth em 1928 no experimento que demonstra a "transformação" de bactérias pneumococos sem cápsula. Questão 256 Como os cientistas O. MacLeod e M. em pneumococos com cápsula. EXPLIQUE os motivos que levam a tal esterilidade. Em relação a esses três animais e ao processo de origem da mula.5. resultante do cruzamento entre duas espécies. dando origem a indivíduos adultos.

a) Qual é a aneuploidia existente na Síndrome de Down? b) Quais são os mecanismos responsáveis pelo aparecimento desta aneuploidia? c) Qual é a relação existente entre idade materna e a Síndrome de Down? Questão 265 A Síndrome de Down caracteriza-se pela presença de um cromossomo 21 a mais nas células dos indivíduos afetados. Responda se o fenômeno da não-disjunção do par de cromossomos 21 ocorreu antes ou depois da formação do zigoto. Qual o número de cromossomos que deve ser encontrado em um espermatozóide normal nessa espécie? Questão 264 A ilustração adiante mostra o cariótipo de um indivíduo do sexo masculino com Síndrome de Down. Questão 263 Numa dada espécie.1 Questão 266 1. "Biologia das células". observou-se que 70% das células apresentavam 47 cromossomos.9. responda. Adaptado de Amabis.Questão 261 Ao analisar o cariótipo de células obtidas de uma criança com síndrome de Down. 46 cromossomos. São Paulo: Moderna. a não disjunção do cromossomo X e a geração de espermatozóides defeituosos. J. Esse problema pode ser decorrente da não-disjunção do cromossomo 21 em dois momentos durante a formação dos gametas. M e Martho.9.5.1 Uma alteração no DNA pode modificar o funcionamento de uma célula. neste indivíduo. Por quê? Questão 267 O quadro a seguir destaca dois conceitos biológicos: câncer e sistema respiratório de insetos. 2002. 1. indicando na lacuna pontilhada qual delas foi escolhida para ser representada. Considerando a ocorrência de tal não-disjunção. G. Questão 262 Tendo um homem ingerido uma substância que causa erros na divisão meiótica da gametogênese. observou-se. Justifique sua resposta. R. ou seja. um indivíduo trissômico apresenta um cariótipo contendo 97 cromossomos. 53 . a) Em quais momentos ela pode ocorrer? b) Utilize os contornos a seguir para representar uma das duas possibilidades.5. por exibirem a trissomia do cromossomo 21. sem trissomia do 21. Que tipos de anomalias cromossômicas poderão ser formadas se esses espermatozóides fecundarem ovócitos normais? Justifique. e que 30% das células apresentavam um cariótipo normal.

5. na hemoglobina. por não possuir sementes. tem sido propagada assexuadamente através de mudas e enxertia. Sabe-se que a variabilidade genética de uma população depende dos seguintes fatores: 1) permutação cromossômica ou crossing-over (troca de fragmentos entre cromossomos de um mesmo par de homólogos). Explique como essa única mutação pontual pode fazer com que a síntese da proteína seja interrompida prematuramente. Questão 272 A anemia falciforme é uma doença que resulta da substituição de um aminoácido ácido glutâmico pela valina. Justifique sua resposta. Questão 271 a) Faça uma breve descrição de como o nefasto hábito de fumar está associado ao desenvolvimento de câncer de pulmão. Após tratar culturas de bactérias com doses de um agente mutagênico capaz de induzir uma única mutação pontual (que afeta apenas um nucleotídeo por célula).2) mutação (modificação da seqüência de nucleotídeos de uma molécula de ADN). os seguintes conceitos: tumor. Examinando a tabela do código genético a seguir. 1. Questão 268 A substituição de uma única base na molécula de DNA leva necessariamente à substituição de um aminoácido na proteína a ser sintetizada pela célula. Certo ou errado? Justifique.3 Identifique as duas alterações nos códons do RNA que mais provavelmente explicariam a transformação de ácido glutâmico em valina. não produzindo gametas viáveis. 54 . Justifique a sua resposta. Verificou-se que um desses mutantes produzia uma dada proteína que diferia da original pela ausência de 35 aminoácidos em uma das extremidades da cadeia peptídica. Questão 270 A laranja-da-baía surgiu em 1810 e. sua meiose é anormal. b) Descreva o caminho da fumaça de um cigarro desde o meio externo até as células do corpo de uma barata. Atualmente. Por ser uma variedade triplóide (3n) de laranja.9. Questão 269 Qualquer alteração no DNA pode modificar o funcionamento de uma célula? Justifique.9.5. analisou-se a seqüência de aminoácidos de uma determinada proteína em diversos mutantes gerados. proliferação celular descontrolada. genes reguladores da divisão celular.3 Identifique qual(is) deste(s) fator(es) pode(m) contribuir para a variabilidade genética da laranja-da-baía. é possível identificar as alterações no RNA que formam o códon da valina na hemoglobina da anemia falciforme. e 3) segregação independente (recombinação aleatória de cromossomos dos diferentes pares de homólogos). de forma relacionada. 1. fumo. milhões de pés de laranja-da-baía estão espalhados em plantações no Brasil e nos Estados Unidos. garantindo que em seu texto apareçam. mutação.

Àquela altura. SP. um determinado gene. I. Questão 274 Analise as seguintes informações.A. Diedrin e Aldrin. manter uma especialização característica apropriada e ocupar o lugar apropriado. 55 1.9. o indivíduo morre? Justifique sua resposta."O GLOBO" Gilberto Scofield Jr.3 Em qual das mudanças (1 ou 2) há risco de perda ou de diminuição da atividade biológica? Justifique sua resposta. Em 2001 a indústria Shell do Brasil S. b) Dê exemplos de um agente de natureza física e de um . considere duas situações: a) um nucleotídeo é suprimido. Japão "Shizuko Abe tinha 18 anos no dia 6 de agosto de 1945 e. II. Nesse tipo de mutação. Suponha que mutações no DNA tenham causado as seguintes mudanças nas duas moléculas de mRNA (1 e 2). A tabela resumida do código genético mostra alguns códons e seus aminoácidos correspondentes. sempre de acordo com as necessidades do organismo.5. é mais drástica que a situação "b". geralmente. A situação "a". Enviado especial Hiroshima. sobreviver e morrer. b) um nucleotídeo é substituído por outro. a) Qual a vantagem desse tipo de mutação no aparecimento de novas espécies? b) Se uma mutação gênica ocorre em um dos genes duplicados. ela havia abandonado os estudos para se dedicar ao esforço de guerra. "descontrole dos mecanismos de divisão celular" e "câncer". aumentando assim a probabilidade de desenvolvimento de câncer. "agentes mutagênicos". Era um dia claro e quente de verão e às 8h. As células devem dividir-se e conter a divisão. tem sua seqüência duplicada e acrescentada ao DNA. 31 de julho de 2005 . a) Que relações podem ser estabelecidas entre as informações I e II? Inclua na sua resposta os conceitos de "mutação gênica".Questão 273 As seqüências de RNA mensageiro a seguir codificam peptídeos com atividades biológicas específicas. Questão 275 Em um segmento de DNA que codifica determinada proteína. Explique por quê. de forma que o indivíduo passa a apresentar uma ou mais cópias do mesmo gene no mesmo cromossomo. a duplicação gênica é muito importante na criação de novidades evolutivas. Sabe-se que essas funções são geneticamente controladas.BOMBA ATÔMICA SESSENTA ANOS DE TERROR NUCLEAR Destruídas por bombas. com resíduos de Endrin. foi responsabilizada pela contaminação das áreas em torno de sua fábrica de agrotóxicos em Paulínia. como todos os jovens japoneses durante a Segunda Guerra Mundial. Questão 276 Entre os diferentes tipos de processos que criam nova variabilidade genética. Questão 277 FIM DA 2 GUERRA MUNDIAL . Shizuko e seus colegas iniciavam a derrubada de parte das casas de madeira do centro de Hiroshima para tentar criar um cordão de isolamento antiincêndio no caso de um bombardeio incendiário aéreo. Hiroshima e Nagasaki hoje lideram luta contra essas armas Domingo. A renovação dos tecidos requer um controle complexo para coordenar o comportamento de células individuais e as necessidades do organismo como um todo. fazendo com que o gene não funcione. agente de natureza biológica que podem aumentar a taxa de mutações gênicas. além de replicar-se. Um aumento significativo no número de casos de câncer na região tem sido associado à exposição dos moradores a essas substâncias.

Japão. as populações dessas cidades continuam a ser monitoradas. Indique o processo que leva à destruição do patógeno bem como as células que o realizam. O sistema imunitário age para combatê-las.1 milhão de habitantes circulando em bem cuidadas ruas e avenidas.5. Questão 282 Sobre a vacina. "Hiroshima. Passear pelas ruas de Hiroshima hoje 60 anos depois da tragédia que matou 140 mil pessoas e deixou cicatrizes eternas em outros 60 mil. respectivamente. no Japão. Apesar de rica e moderna com seus 1. aponte dois motivos pelos quais essas populações humanas devem ser monitoradas ainda hoje. 1. Questão 278 Os recentes testes nucleares e o cinqüentenário da explosão da bomba atômica em Hiroshima e Nagasaki em 1995 provocaram discussões sobre os efeitos da radiação no meio ambiente e nos seres humanos. os monumentos às vítimas do terror atômico estão em todos os lugares". Com base nos efeitos biológicos das radiações sobre os seres vivos.A ação imediata ou não 3. uma reação inicial inespecífica é efetuada por células do sangue.é nunca esquecer o passado.O emprego curativo ou preventivo Questão 280 As bactérias podem vencer a barreira da pele. a ação do soro e da vacina segundo estes tópicos: 1.ninguém imaginava que Hiroshima seria o laboratório de outro tipo de bombardeio. b) Indique a reação de combate que é específica para cada agente infeccioso e as células diretamente responsáveis por esse tipo de resposta. que é transmitida pela picada da mosca tsé-tsé.A natureza da imunização 2.A duração da imunização 4. Após sessenta anos da explosão da bomba atômica sobre as cidades de Hiroshima e Nagasaki. a) Nesse combate.10 56 . por exemplo num ferimento. para o qual os abrigos antiincêndio foram inúteis". numa população de 400 mil . Questão 281 Explique o que é uma vacina e como funciona. muito mais devastador e letal. responda: a) Para que é usada? b) De que é feita? c) Como funciona? Questão 283 Um protozoário conhecido como 'Trypanosoma gambiense' provoca no homem a chamada "doença do sono". O estudo da reação imunitária do organismo humano aos antígenos da superfície dos parasitas está demonstrado no esquema abaixo. e entrar em nosso corpo. a) Como a radiação está relacionada ao aumento na incidência de câncer? b) Como se explica que muitos dos efeitos da bomba atômica se manifestem nos descendentes dos sobreviventes? c) Por que algumas pessoas que foram viver nessas cidades tempos depois da explosão também foram afetadas? Questão 279 Soros e vacinas fazem parte do arsenal usado no combate às doenças infecciosas (imunidade adquirida). Compare. Dados mostram que a incidência do câncer nas duas cidades japonesas é muito alta.

em casos mais graves. Dois dos filhos do casal são gêmeos monozigóticos e os outros dois são gêmeos dizigóticos. Paulo e Luisa. Questão 285 O termo amamentação designa o ato de amamentar. Justifique por que esse tratamento deve ser feito logo após a picada do animal e. Qual seria a pessoa da família mais indicada para ser o doador? Justifique sua resposta. porém. vírus. Explique por que. Questão 287 Um casal tem quatro filhos: João. mesmo nessas circunstâncias. a mãe produz anticorpos contra o fator Rh do filho. A esse respeito. Questão 288 As curvas abaixo mostram a produção de anticorpos específicos de dois indivíduos inoculados com antígenos protéicos do vírus X no dia 0. Maria. e mesmo simples moléculas. podem ser reconhecidos pelo organismo como agentes agressores.a) Explique por que os parasitas com antígeno A desapareceram na semana 2 e cite o principal tipo celular participante da reação responsável por esse desaparecimento. João. a partir da segunda gravidez. o primeiro filho nunca é afetado. 1. Mais do que um simples ato de amor. em duas condições: vacinação ou soroterapia.5. representa a maneira mais eficiente e prática de alimentar e nutrir o filho sem os riscos que a alimentação artificial pode oferecer. A doença só se manifesta. suspeitou-se de que um dos indivíduos fosse originário de uma região onde a infeção pelo vírus X atinge grande número de indivíduos. b) Justifique o aumento do número de parasitas com antígeno B na semana 2. Escreva a importância da amamentação PARA A MÃE E PARA O FILHO. a) Os gráficos a seguir mostram a variação da concentração de anticorpos contra um determinado antígeno no sangue de uma pessoa. Indique a condição que deve estar presente no feto para o desenvolvimento da eritroblastose em filhos de mulheres que não produzem fator Rh. fungos. Questão 286 As respostas imunológicas constituem mecanismos de defesa vitais para os organismos. em função do tempo. tecidos ou órgãos transplantados. Bactérias. por que. Qual dos dois indivíduos é originário da região com alta incidência do vírus X? Justifique. a) explique a diferença entre a resposta ativa e a passiva. 57 . Com base nas respostas de cada um deles ao antígeno. Questão 284 A função do sistema imunológico é a de defender o organismo contra invasores. precisa de um transplante de um órgão. deve ser repetido a intervalos de tempo relativamente curtos. de aceitar uma criança no próprio peito. b) apresente um exemplo de imunização ativa artificial e um de imunização passiva natural.10 Um dos gráficos mostrados corresponde à variação da concentração de anticorpo antiofídico no sangue de uma pessoa mordida por uma serpente e tratada com uma dose do soro apropriado. um dos gêmeos monozigóticos. b) Na eritroblastose fetal.

A linha pontilhada representa a SUBSTÂNCIA TÓXICA. Determine se os resultados dos testes seriam positivos ou negativos tanto para animais infectados quanto para vacinados. que mostra o título (quantidade) de anticorpos específicos contra os antígenos A.1. b) Explique por que a imunidade de grupo não é eficiente no controle de doenças como. e não a detecção do próprio vírus na carne. 58 . B e C) do parasita causador da malária (plasmódio) foi testada em uma pesquisa. Países que não vacinam seus rebanhos contra febre aftosa restringem a importação de carne de países onde a vacinação ocorre. avalie se a estratégia de vacinação com esses antígenos seria eficaz. Estes testes geram resultados semelhantes para animais vacinados e animais que contraíram a doença. de origem orgânica. Tal fenômeno é denominado imunidade de grupo. mas sim uma substância inócua (placebo) para servir de controle negativo. dificultando as relações comerciais internacionais. enquanto a linha contínua representa a SUBSTÂNCIA ESPECÍFICA. Questão 290 A resposta imune de seis voluntários a três diferentes antígenos (A. a pessoa foi novamente contaminada e outra vez a substância específica foi usada. como medicamento. Questão 292 Uma pessoa foi contaminada por uma substância tóxica.5. pode-se considerar que toda a população está protegida se uma alta proporção dos indivíduos estiver imunizada. pelo médico. Justifique sua resposta. O gráfico a seguir reproduz os dois momentos em que ocorreram as contaminações. O voluntário 6 não recebeu nenhum dos antígenos. Para tratá-la o médico introduziu em seu organismo uma substância específica. A figura a seguir. Questão 291 No caso de algumas doenças infecciosas. Cinco meses depois desse evento.10 Questão 289 A febre aftosa é uma doença virótica que afeta diversos animais de importância econômica. B e C no soro de cada um dos voluntários. As restrições à importação de carne se baseiam no fato de que os testes disponíveis utilizam a detecção de anticorpos contra o vírus.10 1.5. tais como vacas e ovelhas. por exemplo. o cólera e a hepatite. Com base nos resultados apresentados. Justifique sua resposta. a) Explique por que a imunidade de grupo é eficiente no controle de doenças como a gripe. indica os resultados observados.

Questão 294 O gráfico representa o resultado de duas aplicações de um mesmo antígeno. uma doença do gado semelhante à varíola pela formação de pústulas.1.5. responda: a) Qual a função do antígeno e qual curva corresponde às respostas primária e secundária? b) Explique o que acontece em relação aos anticorpos nas fases das respostas primária e secundária. a) A que tipo de imunização se referem as aplicações? b) Analise os resultados apresentados pelo gráfico e explique o fato observado com a 2 aplicação do antígeno.5.5. constatou que estes indivíduos mantinham-se 59 .10 1. Todas eram ordenhadoras e tinham se contaminado com "cowpox". a) Que tendência pode ser observada quando se comparam as taxas de mortalidade por doenças contagiosas e por doenças degenerativas (também chamadas "doenças da velhice") no início e no final do século XX? b) Cite dois fatores que podem explicar as mudanças observadas nas taxas de mortalidade por doenças contagiosas. Edward Jenner. Questão 296 Leia os seguintes fragmentos de textos: 1. em intervalos diferentes. inoculada no paciente. 1.10 A substância específica de combate. mas que não causava a morte dos animais. responda.10 1. que descreve causas de óbitos humanos nos Estados Unidos no início e no final do século XX.10 Analisando o gráfico. é um soro ou uma vacina? Justifique sua resposta. Considerando que esse quadro retrata as condições encontradas em outros países industrializados. Após uma série de experiências.5. um médico inglês. Questão 295 Analise o gráfico. observou no final do século XVIII que um número expressivo de pessoas mostrava-se imune à varíola. Questão 293 O gráfico a seguir mostra as respostas primária e secundária da produção de anticorpos quando um indivíduo é submetido a injeções de antígenos.

Questão 300 Procurando compreender a importância de determinadas células sangüíneas para o sistema imunológico. cada uma com material mais virulento. é constituído por diferentes tipos de glóbulos brancos e pelos órgãos responsáveis pela produção e maturação desses glóbulos. b) Considere. O soro antiofídico poderia ser denominado vacina antiofídica? Explique.fiocruz. Questão 298 Os médicos verificam se os gânglios linfáticos estão inchados e doloridos para avaliar se o paciente apresenta algum processo infeccioso. nos fragmentos de textos 1 e 2? Que relação existe entre o fenômeno observado no relato 1 e as chamadas células de memória? Questão 297 Jararaca.br) 2.refratários à varíola. nos dois gráficos. Para reduzir rapidamente e de imediato o número de doentes durante uma epidemia. 1. os resultados representados no gráfico 1 tenham influenciado os resultados representados no gráfico 2 ou o inverso? Justifique.10 (Programa Nacional de Imunizações.5. ao longo desse ano. Pasteur. que havia sido mordido por um cão raivoso. mesmo quando inoculados com o vírus. Joseph Meister. (www. Meister não chegou a contrair a doença. Ministério da Saúde. respectivamente. (www. que atua no combate a infecções.fiocruz. a) Explique como macrófagos. A 6 de julho de 1885. linfócitos T e linfócitos B atuam no sistema imunitário. de 1980 a 1997. que vinha desenvolvendo pesquisas na atenuação do vírus da raiva.br) a) Qual dos fragmentos.bio. foi feito o seguinte experimento: 60 . O sistema imunitário. injetou na criança material proveniente de medula de um coelho infectado. 1 ou 2. coral e urutu são exemplos de cobras venenosas que ocorrem no Brasil. a vítima deve ser tratada com soro antiofídico. Se picada por uma delas. É mais correto supor que. é mais eficiente o uso do soro ou da vacina? Justifique. Gráfico 2: Taxa da incidência anual de sarampo em menores de um ano no Brasil. chegava ao laboratório de Louis Pasteur um menino alsaciano de nove anos. Ao todo. cascavel. b) Que tipos de produtos (medicamentos) puderam ser produzidos a partir das experiências relatadas. b) Explique que mecanismos induzem a proliferação de linfócitos nos gânglios linfáticos. Questão 299 Observe atentamente os dois gráficos apresentados. de 1982 a 1997.) a) O gráfico 2 indica claramente a ocorrência de epidemias de sarampo em dois anos distintos no Brasil. refere-se a processos de imunização passiva? Justifique sua resposta.bio. foram 13 inoculações. o ano de 1997. Gráfico 1: Cobertura da vacinação contra sarampo em menores de um ano no Brasil.

autofecundada. Os responsáveis por essa variação são 3 pares de genes com segregação independente. mais pontos que os recessivos. Questão 303 O peso dos frutos (fenótipos) de uma determinada espécie vegetal varia de 150g a 300g. Justifique sua resposta. Um criador. O homozigoto dominante para estas duas características recebe mais pontos que os heterozigotos e estes. com linhagens homozigóticas que produzem frutos de 300g. responda às perguntas a seguir. não contribuem para o acréscimo de massa. ambos heterozigotos para os dois genes. Do cruzamento entre linhagens homozigóticas que produzem frutos de 150g. Determine a altura. originou 7 fenótipos diferentes. Os genes a e b. 61 Com base no exposto. esperada para a primeira geração de um cruzamento entre dois indivíduos com os genótipos AABBCC e aabbCC. Questão 302 A massa de um determinado tipo de fruto depende da ação de dois genes A e B.1. Questão 305 Em um concurso de cães. obtendo uma descendência com todos os genótipos possíveis.10 respectivamente. Esses genes contribuem com valores idênticos para o acréscimo de massa. histológica e citologicamente a cor da pele? Histologicamente: Citologicamente: b) O que confere a diferença na cor da pele de indivíduos negros em relação à dos indivíduos brancos? c) Evolutivamente. desejando participar do concurso. a) Que tipo específico de célula sangüínea foi afetada pela irradiação? b) Que tipo de molécula essa célula do sangue passa a produzir quando estimulada pela proteína estranha? c) A introdução de moléculas estranhas ao organismo com o objetivo de provocar uma resposta imune é um método bastante usado na prevenção de determinadas doenças. Qual o nome que se dá a esse método profilático? Questão 301 Atualmente. o Governo Federal vem discutindo a implantação de quotas para negros nas universidades. independentes e de ação cumulativa (polimeria). que ganham nota zero. obteve-se uma geração F que. Considerando a cor da pele de negros e de brancos responda: a) Onde é determinada. Determine a massa do fruto de uma planta de genótipo AABb. qual a importância da existência dessa variabilidade na cor da pele para o ser humano? d) Especifique a forma de herança genética responsável pela determinação da cor da pele. não alelos. duas características são condicionadas por genes dominantes (A e B). Sabendo-se que o peso do fruto é um caso de herança quantitativa. O fruto de uma planta de genótipo AABB tem 40 gramas de massa enquanto o de uma planta de genótipo aabb tem 20 gramas. reponda: a) quantos pares de genes estão envolvidos na determinação do peso dos frutos desta espécie vegetal? b) qual é o efeito aditivo de cada gene? c) de acordo com o triângulo de Pascal. cruzou um macho e uma fêmea. que interferem igualmente na altura da planta. em centímetros. alelos de A e B .5. qual é a proporção de cada classe fenotípica obtida em F‚? Questão 304 A altura dos espécimes de uma determinada planta encontrada no cerrado varia entre 12cm e 108cm.

5. responda ao que se pede: a) Quantos alelos estão envolvidos na determinação do caráter cor de fruto e qual a relação de dominância entre eles? b) Qual a proporção genotípica e fenotípica do cruzamento entre plantas de fruto vinho do cruzamento parental (2) com plantas de fruto vinho do cruzamento parental (4)? c) Quantas plantas com frutos amarelos serão geradas. d¢ e d£) tem seu locus no cromossomo II. 1. Outra característica também depende de 4 genes (B1. Questão 308 Admitamos que numa certa espécie de animal quatro alelos (A. quantos genótipos diferentes são.12 1.11 Com base nos resultados apresentados. Os descendentes (F) foram cruzados entre si. C2). Em relação a essas duas séries de alelos. possíveis na população? . A4). a£ e a¤) tem seu locus no cromossomo I e outra série de três alelos (D. porém são 62 a) Qual o tipo da herança da cor da flor da paineira? b) Indique as possibilidades de se obter em um cruzamento: I) apenas flores de cor branca. A2. a¢. Qual dos dois mecanismos explica a maior parte das variações fenotípicas nas populações? Justifique. a partir de 200 sementes oriundas do cruzamento entre plantas de frutos vinho do cruzamento parental (4) com plantas de frutos rosa do cruzamento parental (2)? Questão 311 Uma determinada característica depende de um locus que possui 4 alelos (A1. enquanto outras são determinadas por muitos genes (herança poligênica). rosa e amarela. Responda: a) Quais as proporções fenotípicas e genotípicas esperadas na progênie do cruzamento entre um coelho aguti (Cc¢) e um coelho chinchila (c£c¤)? b) Como você explicaria o aparecimento de coelhos albinos a partir de um cruzamento entre coelhos himalaios? Questão 310 As videiras podem produzir uvas de coloração vermelha. A ordem de dominância existente entre os genes é C > c¢ > c£ > c¤. O cruzamento entre plantas com esses fenótipos produziu as seguintes proles na geração F1. c¢. respectivamente. B2 e C1.5. e que cada gene dominante contribui com 5 pontos na premiação. vinho. A3.a) Qual a probabilidade do criador obter um animal com a pontuação máxima? Qual a probabilidade de obter um animal homozigoto recessivo para os dois genes? b) Considerando que todos os descendentes do referido cruzamento participaram do concurso. quantos pontos devem ter obtido os vice-campeões e os cães classificados em penúltimo lugar? Questão 306 Certas características fenotípicas são determinadas por poucos genes (herança mendeliana). chinchila. Questão 307 Um pesquisador cruzou paineiras de flores "pink" com paineiras de flores brancas. responsáveis pelos fenótipos aguti. himalaio e albino. c£ e c¤. produzindo sempre as seguintes freqüências fenotípicas na geração (F‚): Questão 309 A cor da pelagem em coelhos é determinada por uma série de alelos múltiplos composta pelos genes C. II) apenas flores de rosa médio. teoricamente.

existe um processo denominado partenogênese. um com a transmissão quebrada.não ocorreu permuta entre os genes A e C. Um pesquisador cruzou um indivíduo "AaBb" com um indivíduo "aabb". A prole resultante foi: 40% AaBb 40% aabb 10% Aabb 10% aaBb O pesquisador ficou surpreso. com eles. porém. Somente 40% dos ovos dessa rainha foram fertilizados e toda a descendência teve a mesma oportunidade de sobrevivência. a cor do olho é condicionada por uma série de alelos múltiplos. qual o número esperado de machos e de fêmeas na descendência? Dos machos esperados. constituída por cinco alelos. sabendo-se que a freqüência de permutação é de 10%? Questão 315 Que tipos de gametas e em que proporções produzirá um organismo com genótipo Cd/cD. Questão 314 O cruzamento CD/cd x cd/cd produziu 600 descendentes. a) Baseando-se nos resultados acima. com a seguinte relação de dominância: marrom>pérola>neve>creme>amarelo. . em proporções iguais. a partir do gene A? b) Justifique sua resposta. produzir um único carro que funcione". homozigoto para os genes A B C D. Questão 318 Sabendo que a maioria das mutações é deletéria (prejudicial ao organismo). a) O que é partenogênese? Em abelhas. é cruzado com outro. todos localizados em um mesmo cromossomo. os cinco alelos. Em abelhas. Cada loco tem dois alelos "A" e "a" e "B" e "b".ocorreu 10% de permuta entre os genes B e D. que descendência resulta deste processo? b) Na inseminação realizada. 25% para cada um deles. outro com o motor quebrado e. Um desses dois tipos de determinismo genético apresenta um número maior de genótipos possíveis na população. A figura a seguir ilustra um par de cromossomos homólogos duplicados (A e B). sendo que "A" e "B" são dominantes. produziu 600 ovos e foi inseminada artificialmente por espermatozóides que portavam. quantos terão o olho de cor marrom? Questão 313 Um organismo. Esses resultados contrariam a segunda lei de Mendel ou lei da segregação independente? Justifique sua resposta. que é homozigoto recessivo para os mesmos alelos. o evolucionista John Maynard-Smith escreveu sobre a meiose. 30% entre A e D.dois pares de alelos localizados em pares de cromossomos homólogos diferentes. Quantos deverão ser diferentes dos pais. Identifique esses genótipos. Questão 312 Em abelhas. Uma rainha de olho marrom. sabendo-se que a freqüência de permutação é de 36%? Questão 316 Quais são os gametas produzidos por um indivíduo de genótipo Ab/aB? Em que proporções serão formados sabendo-se que os genes A e b permutam com uma freqüência de 16%? Questão 317 Considere a existência de dois locos em um indivíduo. bem como as localizações 63 .ocorreu 20% de permuta entre os genes A e B. qual é a seqüência mais provável desses 4 genes no cromossomo. . pois esperava obter os quatro genótipos na mesma proporção. O retrocruzamento de F1 (com o duplo recessivo) mostra os seguintes resultados: . heterozigota para pérola. durante a produção de gametas: "A meiose é o equivalente a ter dois carros.

Massey. A causa da doença da menina era um defeito em um gene que codifica a enzima adenosina desaminase (ADA). (Adaptado de "O Globo". separaram os linfócitos (células brancas) e usaram um retrovírus para introduzir uma cópia correta do gene nestas células. H.dos alelos deletérios "M" (presente somente no cromossomo A) e "N" (presente somente no cromossomo B). N. um folheto à população alertando sobre os perigos da ingestão de transgênicos na alimentação. N. Um indivíduo homozigótico para os alelos M. homozigótico para os alelos m. poderiam infectar com o vírus da AIDS toda a população. constava uma que afirmava incorretamente que "para serem criadas plantas transgênicas são usados os vírus da AIDS" e que tais plantas. A descendência desse retrocruzamento apresentou 15% de permuta entre os locos M e N. os tratamentos denominados "terapia gênica". que viveu sua curta .13 vida em um ambiente estéril. a) O que são transgênicos ou organismos geneticamente modificados (OGMs)? b) Explique por que o vírus da AIDS não poderia infectar uma planta e por que a ingestão de uma planta transgênica não seria capaz de transmitir o vírus da AIDS.. p. Não houve descendentes com permuta entre os locos M e P. 1. indicando as distâncias entre os locos. O. (Kreuzer. no Sul do país. 25% de permuta entre os locos M e O. Porto Alegre. explique em que consistem. se ingeridas. p. Artmed. 10% de permuta entre os locos N e O. b) Selecione e transcreva o segmento do texto que justifica a afirmação de que a terapia gênica é um exemplo de engenharia genética.) a) A partir do exemplo apresentado no texto. b) Por que não houve descendentes recombinantes com permuta entre os locos M e P? Questão 320 O primeiro teste de terapia gênica humana utilizou células sangüíneas. Sua doença era a mesma que a do "menino da bolha". o. A paciente foi uma menina com a doença da imunodeficiência combinada severa. "Engenharia Genética e Biotecnologia". n. A técnica combina o uso de células-tronco de embriões e terapia genética. Questão 319 Os locos M. As células alteradas produziram a enzima que faltava e. P foi cruzado com outro. A geração F foi então retrocruzada com o homozigótico m. O. 08/09/2000) Explique a vantagem da utilização. Questão 322 CÉLULAS-TRONCO PODEM TRATAR LESÕES CEREBRAIS Empresa usa unidade estrutural de embriões para recuperar vítimas de derrame. P estão localizados em um mesmo cromossomo. a) Qual a seqüência mais provável desses locos no cromossomo? Faça um esquema do mapa genético desse trecho do cromossomo. Entre as advertências. 2002. a menina é mais saudável do que antes.5. de maneira geral. hoje. Responda. Os cientistas do National Institute of Health dos Estados Unidos coletaram sangue da menina. Esta criança possuía um sistema imune extremamente deficiente e não podia defender-se contra infecções. Questão 321 Alguns grupos radicalmente contrários ao uso de organismos geneticamente modificados (transgênicos) na agricultura divulgaram recentemente. n. o. Então eles reintroduziram os linfócitos na paciente. A. pois estas são de fácil obtenção e de fácil reintrodução no corpo. no procedimento 64 Um indivíduo que possui os cromossomos A e B poderá formar gametas que não sejam portadores dos alelos M e N? Justifique sua resposta.

Explique por que: a) esses núcleos transplantados de células somáticas de diferentes tecidos deram origem a indivíduos normais e idênticos. composto por até centenas de diferentes tipos de células. Os cientistas observaram que a grande maioria destas células. e deu origem a um novo ser. Esse novo ser é geneticamente idêntico ao indivíduo 1. que chamaremos de H1.descrito. Justifique sua resposta. previamente anucleado. responda: a) Como o bebê da figura acima poderia ter sido gerado? b) Qual seria o sexo do bebê gerado por esse processo? Justifique sua resposta.5. havia duas hipóteses a respeito da diferenciação celular. b) o resultado da experiência seria diferente se tivessem sido usados núcleos de células germinativas. Questão 326 No desenvolvimento de um organismo ocorre a transição de um estágio embrionário. Admitindo-se a possibilidade de clonar seres humanos e com base no que tem sido publicado nos principais jornais e revistas do País. Esse processo é conhecido como diferenciação celular. Na segunda. Identifique qual das duas hipóteses é confirmada pelos processos de clonagem. Questão 323 Dois cientistas realizaram uma experiência com o objetivo de estudar a transmissão das informações contidas nos genes do núcleo de células de diferentes tecidos.1 . retiradas de uma mesma rã. H2. Em uma delas. origina outro organismo. Questão 325 Em uma experiência de reprodução com uma espécie de mamífero adotou-se o seguinte procedimento: fundiu-se uma célula do indivíduo 1 com um óvulo. no qual todas as células são inicialmente indiferenciadas.15. Questão 327 "CIENTISTAS DA UNIVERSIDADE DO HAVAÍ CLONAM MAMÍFERO ADULTO DO SEXO MASCULINO A clonagem deixou de ser uma técnica aplicável exclusivamente às fêmeas. Cientistas da Universidade do 65 1. com seus novos núcleos. 6/8/98) baseia-se no livro Remaking Eden (Refazendo o Éden) de Lee Silver. postulava-se a idéia de que ocorria perda de material genético enquanto a célula se diferenciava. nos quais o núcleo da célula de um tecido de um indivíduo adulto é introduzido em um ovócito anucleado que. o qual afirma que cenas como estas não só são possíveis. ao 2 ou ao 3? Justifique sua resposta. Núcleos de óvulos de rã não-fertilizados foram substituídos por núcleos de células somáticas. Questão 324 A figura a seguir (Folha de São Paulo. resultaram na formação de embriões normais. Historicamente. que a diferenciação não implicava perda de DNA. A célula assim formada foi implantada no útero do indivíduo 3. até o estágio adulto. como inevitáveis. do indivíduo 2. ao se desenvolver. desenvolveu-se. de células-tronco ao invés de células já diferenciadas.

3 . como havia sido feito até agora. I e II. das quais são retirados os núcleos. Considere a possibilidade de que o DNA obtido pertença a um único dinossauro e que deste DNA foram recuperados vários exemplares.Havaí clonaram o primeiro mamífero adulto do sexo masculino. a) Qual seria a desvantagem biológica de um rebanho de clones? b) Dê um exemplo de clone que ocorre naturalmente. ocorrem naturalmente no cotidiano. O núcleo de cada um desses óvulos é retirado." Questão 329 Respondendo a uma questão sobre a possibilidade de se clonarem animais para livrá-los de extinção. 2 . 3 . da mesma espécie. os cientistas criaram Fibro a partir de um pedaço do rabo de um camundongo. Clones. os zigotos são retirados da fêmea e divididos em dois. segundo trabalho publicado na revista "Nature Genetics".89. 4 .15..Células somáticas são retiradas do corpo de um animal (animal Y). b) O novo animal formado pela técnica II pode ser chamado "clone" do animal Y. um cientista cria em laboratório novas gerações de dinossauros. de maio/junho de 1997. que poderiam ser usados e que estão descritas nos quadros. extintos há 65 milhões de anos. pesquisadores anunciaram o nascimento da ovelha Dolly. A nova célula assim formada começa a se dividir formando um embrião. um cientista apresenta duas técnicas. Eles colheram 700 óvulos. Por que os cientistas extraíram os núcleos dos óvulos antes de inserir as células da cauda do doador? Questão 328 No filme "Parque dos Dinossauros". tipo de célula usada na criação do animal (. TÉCNICA I 1 . foi possível determinar o DNA dos dinossauros. os pesquisadores Ryuzo Yanagimachi e Teruhiko Wakayama mostram que um macho adulto também pode ser replicado. gerando um novo animal. considerada o primeiro clone de mamífero gerado artificialmente. 2 .Após alguns dias. Apenas 274 embriões resultaram dessa operação e foram implantados em 25 ratinhas que funcionaram como 'mães de aluguel'.Essa fêmea é então inseminada artificialmente.Uma fêmea (animal X) é estimulada com hormônios a produzir vários óvulos. Em vez de utilizar células relacionadas ao sistema reprodutivo feminino para preencher os óvulos.) Agora. O material foi substituído por células extraídas da cauda do doador.O núcleo retirado da célula somática do animal Y é implantado no óvulo sem núcleo do animal Z. lembra o geneticista Ademar Freire Maia em um artigo do Boletim "Germinis" do Conselho Federal de Biologia. p. através da formação de rebanhos homogêneos. chegando-se assim à fórmula para recuperar a espécie.O embrião é reimplantado no útero de um terceiro animal (animal W) dando origem a um novo animal. 4 . por meio do sangue conservado em mosquitos que os teriam picado e que permaneceram fossilizados no âmbar. Z ou W? Justifique. Um dos objetivos dessa pesquisa é a melhoria da pecuária. TÉCNICA II 1 .5. Com o sangue. produzidos por ratas.Óvulos não fecundados são retirados de um segundo animal (animal Z). a) O que se poderia dizer dos exemplares recuperados.. nŽ55.Cada metade é reimplantada no útero de outra fêmea (receptora). no entanto. Trata-se de um camundongo batizado de Fibro. e descartaram seus núcleos. caso um dos animais seja sensível a uma bactéria que cause pneumonia? b) Justifique sua resposta. 7/6/99. uma brincadeira com a palavra fibroblasto. 66 1. . Questão 330 No início deste ano.1 Adaptado da Revista Época: Ano II. Pergunta-se: a) Todos os animais produzidos pela técnica I são genotipicamente iguais ao animal X? Justifique.

Questão 332 A terapia génica.Justifique. estão esquematizadas a partícula viral original. apresentados nos esquemas acima. Por exemplo. Entre as várias estratégias de produção de plantas transgênicas.2 a) Explique a causa da diferença no crescimento dos camundongos 2 e 3. IV e V). realizou uma cirurgia e removeu a hipófise. elabore uma hipótese para a causa da diferença no crescimento dos camundongos 1 e 2. as matariam. . doença caracterizada pela produção de hemoglobina anormal devido a uma deleção no gene que codifica a cadeia ’ da globina. Questão 333 As técnicas modernas de engenharia genética tornaram possível a produção de plantas transgênicas que possuem genes introduzidos artificialmente no seu genoma. 2) Plantas mais resistentes aos efeitos dos defensivos agrícolas (agrotóxicos). reintroduzir as células infectadas no paciente. comparando com o crescimento de um camundongo. na ausência do gene de resistência. 3. . na talassemia. Essas plantas toleram concentrações maiores de agrotóxico sem alterar as propriedades tóxicas dos defensivos agrícolas. Em seguida. consiste na cura de defeitos genéticos pela introdução de genes normais em celulas de indivíduos doentes. Justifique sua resposta.Y representa o trecho de ácido nucléico introduzido. destacamos duas: 1) Plantas resistentes a certos vírus patogênicos que. que codifica as proteínas necessárias para a formação de novas partículas virais no interior da célula hospedeira. e quatro diferentes partículas virais modificadas (Esquemas II. 2. indica que a partícula viral contém as enzimas transcriptase reversa e integrase (insere o material genético de origem viral no genoma da célula). seria o mais indicado para ser usado nesse tratamento. estudou o crescimento desses camundongos.15. Questão 331 Um pesquisador construiu um camundongo transgênico que possui uma cópia extra de um gene Z. Nesse caso. 1. no caso do tratamento da talassemia. coletar células da medula óssea do paciente. b) Indique qual dos retrovírus modificados.5. b) Com base em sua resposta ao item a. para que essas sejam infectadas. não transgênico e com hipófise. uma promessa da biotecnologia moderna. poderia ser usado um retrovírus modificado. contendo a informação para a síntese da ’-globina.X representa o trecho de ácido nucléico viral. antes da . Em um outro camundongo jovem. a) Explique por que.5. A seguir.o símbolo esférico e negro. as células retiradas da medula óssea são as indicadas para serem infectadas com as partículas virais adequadamente modificadas. indicado em lagumas figuras.2 1. que contém a informação para a síntese da cadeia ’ da globina. 67 . colocar as células coletadas em contato com o retrovírus modificado. III. Algumas metodologias em estudo utilizam retrovírus modificados como veículo de introdução do gene desejado.15. Obteve as seguintes curvas de crescimento corporal: manipulação (Esquema I) . deveriam ser realizadas três etapas: 1.

Questão 337 Uma mutação no gene que codifica a enzima fenilalanina hidroxilase pode acarretar o acúmulo do aminoácido fenilalanina no sangue. a) Cite dois mecanismos que impedem a troca de genes . III) soja transgênica clonada para melhoria da qualidade biológica de suas proteínas. No esquema a seguir. por que o tratamento iniciado logo após o nascimento. explique a) como os três grupos de seres se diferenciam entre si. Questão 336 Existem mecanismos que normalmente impedem a troca de genes entre espécies distintas.5. os fragmentos são indicados por Kb (1Kb=1000 pares de bases nitrogenadas). b) Defina um organismo transgênico. Essas resultam em fragmentos de tamanhos diferentes que podem ser utilizados como marcadores genéticos. onde cada traço indica a posição e o tamanho dos fragmentos num 68 1. em seus cromossomos de número 21. Nos últimos anos. não há ainda como avaliar os riscos que os organismos transgênicos apresentam. Questão 335 entre espécies distintas. o qual inclui uma dieta restritiva à fenilalanina. pois. b) de que forma os três grupos poderiam ser afetados. a) Explique.2 Explique o que é alimento transgênico e como é obtido. para aumentar a produção leiteira. No entanto. no que se refere à perpetuação de sua própria espécie. pontos de quebra por enzimas especiais. A introdução de soja e de outras plantas transgênicas tem gerado muita polêmica.15. pode melhorar a qualidade de vida das crianças afetadas por fenilcetonúria. apesar de seus inúmeros benefícios. em caso de ocorrer uma catástrofe ambiental. por cruzamentos sucessivos. as fronteiras entre as espécies vêm sendo rompidas com a criação de organismos transgênicos. Questão 338 Considere estes dados como hipotéticos. Analisando-os quanto à variabilidade gênica. porém. II) cana-de-açúcar obtida através de mudas. Esse casal tem uma criança com Síndrome de Down devida à trissomia do cromossomo 21. sendo o excesso transformado em compostos tóxicos que comprometem o desenvolvimento físico e mental da criança fenilcetonúrica. indubitavelmente importantes no caso de doenças tratáveis. c) Indique um benefício decorrente da utilização de organismos transgênicos e um possível risco para o ambiente ou para a saúde humana. o desenvolvimento de novas metodologias nas áreas da bioquímica e da biologia molecular permitiu a implementação de exames diagnósticos. indicados no esquema por setas. do ponto de vista genético. b) Apresente dois testes laboratoriais para a detecção de portadores de fenilcetonúria e explique os princípios desses testes. como a fenilcetonúria. Os resultados obtidos com o estudo dos marcadores para o cromossomo 21 do pai. Questão 334 Considere os seguintes seres: I) cabra selecionada artificialmente. Um casal apresenta. da mãe e da criança estão indicados na figura 2. qual das duas estratégias não é recomendável? Justifique sua resposta. Justifique.Do ponto de vista ambiental.

pressupõe-se que a criança deve ser normal. A fase da meiose em que o fenômeno ocorreu. Justifique sua resposta. que permaneceu anônimo. Entretanto. Analise o resultado obtido na figura 3. Questão 341 Em Junho de 2001. no entanto.3 Com base nas informações apresentadas e em conhecimentos sobre o assunto responda ao que se pede. a partir da amostra de somente um indivíduo. 3) Suponha que a mulher está novamente grávida e que o exame para marcadores do cromossomo 21. Por que foi importante determinar a seqüência do ADN de um homem e não de uma mulher? 69 1. em que ocorreu o fenômeno de não-separação ou não-disjunção dos cromossomos.campo de eletroforese. igualmente desnaturado. é possível medir quanto ADN radioativo existe num ADN de cadeia dupla. a técnica de seqüenciamento era a mesma. 1) Identifique o genitor que transmitiu dois cromossomos 21 à criança. Nos dois casos.15. como descrito no texto. Sabe-se. porém não radioativo. O ADN radioativo é então desnaturado (suas cadeias são separadas por calor) e posto em contato com o ADN de um outro organismo. portanto. Justifique sua resposta. Com base nessa informação. Por que a segunda estratégia é mais rápida e. Questão 339 No início do projeto do genoma humano. Pelos resultados apresentados na figura. marcado com fósforo radioativo. 2) Determine o estágio da meiose. obtendo-se os seguintes resultados: ADN do organismo 1 + ADN do organismo 1 = 100% de radioatividade no ADN híbrido ADN do organismo 1 + ADN do organismo 2 = 10% de radioatividade no ADN híbrido ADN do organismo 1 + ADN do organismo 3 = 40% de radioatividade no ADN híbrido ADN do organismo 1 + ADN do organismo 4 = 85% de radioatividade no ADN híbrido Qual o organismo que pertence à mesma espécie do organismo 1? Justifique sua resposta. havia duas estratégias a considerar: I) seqüenciar o ADN total dos cromossomos diretamente. após o nascimento. I ou II. foi publicada a seqüência quase completa do genoma humano. II) extrair todos os ARNs mensageiros. amniocentese. econômica? Questão 340 Uma técnica usada como uma ferramenta da taxonomia emprega a seguinte abordagem: extrai-se o ADN de um organismo e este é. constatou-se que a criança apresentava Síndrome de Down. foi realizado para o feto através de punção do líquido amniótico.5. então. que o ADN era de um indivíduo do sexo masculino. Após a hibridação (reassociação formando moléculas híbridas). que individualmente determinaram a seqüência de vários trechos diferentes do ADN de todos os cromossomos. produzir ADN a partir desses ARNs mensageiros e seqüenciar apenas esse ADN. determine: O genitor onde ocorreu a não-disjunção. Foi feito um experimento em que o ADN do organismo 1 (ADN radioativo) foi "hibridado" com o ADN não radioativo de três outros organismos. Esse projeto contou com a participação de diversos laboratórios. mais .

quais NÃO deverão apresentar a disfunção muscular quando adultos? b) Supondo que os quatros embriões sejam irmãos. conhecida como amarelinho. Responda: a) sobre a paternidade de qual criança o juiz pronunciou-se? b) por que não pôde o juiz se pronunciar sobre a paternidade da outra criança? Questão 343 Com técnicas de biologia molecular é possível verificar a presença ou não de certas regiões de interesse na fita de DNA. podemos descobrir se um embrião poderá apresentar uma determinada característica ou doença genética pela análise de seus marcadores. Cada uma dessas regiões recebe o nome de marcador. uma vez que pode ser associada com algum fenótipo em particular. III e IV) mais provável PARA CADA UM de seus pais? c) Qual é a probabilidade de um certo casal.5. nascendo Renato. II. Abandonadas. O xilema das plantas produtoras de laranja é parcialmente bloqueado. pois a maioria das frutas não se desenvolve. II.com. que identificou o genoma de uma bactéria.br). reduzindo a produção. As frases a seguir constam numa lista de "mitos e verdades sobre o teste de DNA" encontrada na internet (http://www. Observe o padrão de bandas do DNA de cada embrião e responda: a) Dentre os embriões analisados. formado por indivíduos tipo I e III.3 O teste de paternidade usando o DNA tornou-se muito freqüente hoje. as pessoas têm muitas dúvidas a respeito desse tipo de exame. Questão 346 1. a) Explique o que é genoma e indique uma possível conseqüência econômica dos resultados desta pesquisa. ter um descendente com essa disfunção muscular? Questão 344 Recentemente. III e IV). Maria manteve relações sexuais com dois irmãos. O esquema abaixo representa a análise de marcadores de DNA de quatro embriões humanos (I. a Justiça pronunciou-se sobre a paternidade de uma das crianças e ficou impossibilitada de pronunciar-se sobre a paternidade da outra criança. gêmeos dizigóticos. Dessa forma. determinando o Juiz a realização dos testes de DNA. É possível determinar o pai de um recém-nascido quando a dúvida sobre a paternidade desse recém-nascido está entre gêmeos univitelinos? Justifique sua resposta. ambas reclamaram na Justiça o reconhecimento de paternidade. b) Se o xilema é bloqueado. qual é o padrão de bandas (I. 70 .gene.15. os jornais e a revista científica internacional "Nature" publicaram com destaque um grande feito de um grupo de cientistas brasileiros. que causa uma doença nas laranjeiras. Em outra situação. também hipotética. Após receber os resultados. Apenas a presença de duas bandas (A e B) é indicativo positivo para o indivíduo apresentar uma certa disfunção muscular quando adulto. Detectou-se ainda que esses marcadores ocupam o MESMO loco. No entanto. gêmeos monozigóticos.Questão 342 Considerando situações hipotéticas. Questão 345 O exame de paternidade através da comparação de DNA seqüenciado vem sendo utilizado para determinar progenitores. quais as principais deficiências que a planta sofre? Justifique. A presença do marcador no genoma de um indivíduo pode ser visualizada como uma banda. Paula engravidou-se ao manter relações sexuais com dois irmãos. nascendo destas relações Alfredo. 'Xylella fastidiosa'.

células de fígado são cultivadas em laboratório. Justifique sua indicação.15. e depois sejam transferidos para animais de laboratório. Pergunta-se: a) Qual é o nome genérico que se dá a estas enzimas? 1. utilizados pelo homem. que genes humanos que codificam proteínas de interesse médico ou comercial sejam extraídos. b) A cápsula do 'Bacillus anthracis'. o que permite. indústria ganharam alternativas eficientes para a produção.5 a) Explique a utilidade dos plasmídios bacterianos no desenvolvimento de técnicas de DNA recombinante. que antes eram disponíveis em quantidades extremamente reduzidas. qual deve ser o papel desempenhado por elas? d) Como são chamados os organismos que recebem e incorporam genes de outra espécie? Questão 350 CONVERSÃO CELULAR: Cientistas israelenses induzem células hepáticas a produzir insulina em laboratório e propõem técnica para tratar diabetes tipo 1. Questão 349 Na tecnologia do DNA recombinante são utilizadas enzimas bacterianas que têm a propriedade de cortar a molécula de DNA em pontos específicos. Os constituintes da toxina são codificados por genes existentes no plasmídeo pX01. "Ele já morreu e não deixou nenhum outro parente vivo. que foram obtidos a partir da aplicação da tecnologia do DNA recombinante. Um vírus é inserido nas células. De acordo com a técnica esquematizada a seguir. "O exame de DNA só pode ser feito com sangue. não possui antígenos capazes de provocar reação imunológica protetora em mamíferos. conhecidas como tecnologia do DNA recombinante." III. e é atenuada quando um deles está ausente. que passam a produzir sistematicamente tais proteínas. contendo um gene que. Questão 348 A partir da década de 70. "Sou primo da mãe e estou com medo do resultado ser positivo. em células do pâncreas. e os da cápsula por genes existentes no plasmídeo pX02. indique a que pode ser utilizada na elaboração de uma vacina composta por bactérias vivas com virulência atenuada. Por meio dessa tecnologia." Justifique por que cada uma das frases constitui um "mito". c) Cite dois produtos. está diretamente associada à presença conjunta dos componentes toxina e cápsula bacteriana. causador do antraz. de determinadas proteínas.5. Dentre as linhagens apresentadas. a medicina e a b) O que confere a especificidade a estas enzimas? c) Na natureza. clonados em bactérias ou vírus. mesmo que eu não seja o verdadeiro pai. Nunca poderei provar que ele era o pai do meu filho. a) Qual é a função das endonucleases de restrição e a das ligases na aplicação da tecnologia anteriormente citada? b) Explique como a tecnologia do DNA recombinante participa no processo de produção de organismos transgênicos. por exemplo. ao contrário da toxina. as moléculas de ácidos nucléicos da célula passaram a ser exploradas através da utilização de novas metodologias.I. O esquema abaixo representa quatro diferentes linhagens de 'Bacillus anthracis'." II. 71 . em grande escala. Questão 347 A virulência do 'Bacillus anthracis'.

1.5." (Adaptação do artigo "Revolução invisível na mesa". 2 . ficando mais parecidas com as que existem no pâncreas (células beta). 1.15.ao atingir o estágio de blástula.5. Por esse motivo. Os cientistas acreditam que as células transformadas possam futuramente ser usadas no combate ao diabetes tipo 1.15. respectivamente: a) o pareamento das bases? a‚) a ação das enzimas de restrição? aƒ) a ação da DNA ligase? b) "Os agricultores americanos. Atualmente é possível produzir células-tronco heterólogas (retiradas diretamente de um embrião qualquer) ou homólogas.5. O esquema a seguir apresenta algumas etapas dessa técnica.15. já estão plantando as sementes da terceira safra de milho. Questão 352 A melhor fonte de células-tronco são os embriões em estágios iniciais de desenvolvimento. da revista Época. O procedimento para o preparo de células-tronco embrionárias homólogas está ilustrado de modo simplificado a seguir e envolve as seguintes etapas: 1 . há interesse em usá-las para reparar danos de tecidos que normalmente não se regeneram. 3 .6 72 . por exemplo. em local próximo à lesão. de vacinas e medicamentos. a técnica de DNA recombinante vem sendo utilizada na pesquisa e no desenvolvimento. As células se diferenciam em cultura. a) Cite UMA desvantagem do uso de vírus como vetores de terapia gênica. Em quais delas se desenvolvem. b) Qual é a vantagem da terapia gênica descrita.está ligado à produção de insulina.o núcleo de uma célula do paciente é transplantado para um ovócito maduro.o ovócito transplantado é induzido a proliferar. cujo núcleo foi previamente removido. 8 de junho de 1998). por exemplo. a) Analise as etapas I.5 Com relação ao procedimento descrito.5 1. responda os itens a seguir. II e III. pois essas células indiferenciadas podem se transformar em qualquer tecido. algodão e soja transgênicos. quando comparada ao tratamento de diabéticos com transplante de células de pâncreas de indivíduos mortos? Questão 351 Na engenharia genética. as células do embrião são separadas umas das outras e injetadas diretamente no paciente. Conceitue os organismos transgênicos.

de infecções oportunistas? Questão 355 Notícias recentes veiculadas pela imprensa informam que o surto de sarampo no Estado de São Paulo foi devido à diminuição do número de pessoas vacinadas nos últimos anos. ocorrem quando o vírus sofre uma mutação que o torna mais virulento e irreconhecível pelos sistemas imunológicos das pessoas infectadas. No entanto.é liberado no interior da célula. somente após cerca de 60 meses. Suas epidemias. não teve acesso a tratamento algum durante o período mostrado. o aumento da acidez provoca a mudança de forma na HA. e ele continua sua reprodução sem ser molestado. quanto heterólogas. que ainda ocorrem todo o ano. Foram essas infecções. Toda a interação inicial entre vírus e célula do paciente ocorre através da HA. fazendo com que ela acione suas defesas e "engula" o vírus com uma bolsa digestiva. Dessa forma. já assustaram mais do que a AIDS. o conteúdo do vírus . infecções oportunistas por fungos. que fica espetada na membrana do vírus. Os heterozigotos (Ss) apresentam forma atenuada da anemia.a) Explique por que indivíduos transplantados com células-tronco embrionárias. onde a malária é endêmica. parasitas e bactérias. nesse indivíduo. os linfócitos T CD4. a) Se a mãe já foi vacinada ou já teve sarampo. os indivíduos heterozigotos para anemia falciforme são resistentes à malária.1 Note que. Esse indivíduo. a) Explique o que é esperado para a freqüência do gene S em presença da malária. e não o vírus propriamente dito. As mutações ocorrem numa proteína chamada HA. b) Explique por que o uso de células-tronco embrionárias homólogas reduz potencialmente os problemas pós-tratamento para os pacientes. portador da síndrome de imunodeficiência causada pelo vírus HIV (AIDS/ SIDA). Por que pacientes infectados com HIV e não tratados sofrem. em função da produção de moléculas anormais de hemoglobina. Questão 353 Leia atentamente o texto adiante e responda as perguntas propostas a seguir: "A gripe é uma das doenças que mais matou na história do homem. em geral. As epidemias. Na África.seu material genético . a célula solta ácidos para digerir o vírus. Por quê? b) Por que uma pessoa que teve sarampo ou foi vacinada fica permanentemente imune à doença? De que forma a vacina atua no organismo? Questão 356 A anemia falciforme é caracterizada por hemácias em forma de foice. Questão 354 O gráfico a seguir mostra a variação do número de um tipo de leucócitos. que levaram o paciente à morte. tanto homólogas. E em ausência da malária? b) Qual é a explicação para o fato dos heterozigotos para anemia serem resistentes à malária? 73 . 1. e da quantidade de vírus HIV no sangue de um indivíduo ao longo do tempo. apresentam duas populações de mitocôndrias diferentes em seus tecidos. o bebê fica temporariamente protegido contra essa doença. incapazes de transportar o gás oxigênio. que faz com que a membrana do vírus se funda com a membrana da célula. Dentro dessa bolsa. A HA se liga à superfície de uma célula." a) Por que o sistema imunológico de uma pessoa não reconhece um vírus mutante. As autoridades sanitárias também atribuíram o alto número de casos em crianças abaixo de um ano ao fato de muitas mães nunca terem recebido a vacina contra o sarampo. Indivíduos com anemia falciforme são homozigotos (SS) e morrem na infância. É ela que os glóbulos brancos reconhecem e procuram atacar. quase sempre no inverno. apareceram. mesmo que já tenha tido uma forma da doença? b) Explique como o vírus consegue "enganar" uma célula e infectá-la.7.

fossem inseridas cópias de seu RNA mensageiro. Segundo o jornal "The Japan Times on line". b) Qual é a substância imunológica presente no soro antiofídico responsável pela inativação do veneno? Como este soro é produzido? Questão 359 A indústria de flores movimenta bilhões de dólares por ano e está continuamente buscando criar novas variedades. indique o número cromossômico dos indivíduos de cada uma das castas e descreva como ocorre a diferenciação em castas nesses insetos. As petúnias. os zangões e as operárias. seria o indicado para receber esse gene e justifique sua resposta. possuem tal enzima. tratando-o com soro antiofídico. com o objetivo de produzir rosas azuis. a) Que característica desse réptil levou o pai a deduzir que se tratava de cobra peçonhenta? Cite outra característica morfológica facilmente identificada na maioria dessas cobras. foi extraído do amor-perfeito e ativado nas rosas. Sabendo-se que as fêmeas férteis de 'Apis mellifera' têm 32 cromossomos. como uma rosa azul.07. Anteriormente. conforme exemplificado pela reação abaixo. C†H‚O† + 6 O‚ ë 6 H‚O + 6 CO‚ Em virtude de sua configuração eletrônica. a) Que processo fisiológico da planta é diretamente prejudicado pela presença da bactéria? Justifique. b) Suponha que. Pelos métodos tradicionais. b) Não se pode atribuir à 'Xylella fastidiosa' a morte das células que constituem os vasos do xilema maduro. Por quê? c) Em que consiste o seqüenciamento de um genoma? Questão 361 Esforços de cientistas criaram a primeira rosa do mundo com pigmento para cor azul. a técnica recentemente utilizada consistiu no seguinte: o gene da enzima que produz o pigmento azul. foi picado por ela.Questão 357 As abelhas vivem em colônias constituídas por indivíduos de três castas: a rainha. causadora da doença chamada amarelinho ou clorose variegada dos citros (CVC). O nome da bactéria deriva do fato de que ela se estabelece nos vasos do xilema da planta hospedeira. pois a enzima que sintetiza esse pigmento está ausente nas roseiras. Encontra-se em fase de teste uma técnica que possibilita inserir em células de roseira o gene da petúnia responsável pela codificação da enzima que produz o pigmento azul. deduziu que ela era peçonhenta e socorreu o filho. rosas de coloração azul já eram produzidas através de cruzamento. Seu pai. entretanto. a) Como se chamam as estruturas mais vistosas e atraentes destas flores.2004. Questão 358 Um menino colocou a mão em um buraco onde havia uma cobra e. pois participa do processo de extração de energia dos alimentos. o oxigênio tem 74 . de 1Ž. a) Cite o tipo de célula indiferenciada de roseira que. não é possível obter rosas dessa cor. um biólogo. delfinidina. mesmo sem ver a cobra. apesar de não tê-la tocado. que passaram a ter cor azul? Qual o significado biológico do fato de certas plantas apresentarem flores com cores tão vistosas? b) Qual é a relação entre esta técnica recente para a produção de flores azuis e aquela empregada para a produção de alimentos transgênicos? Questão 362 O oxigênio é um elemento imprescindível à manutenção da vida dos seres aeróbicos. Questão 360 Uma importante realização da pesquisa científica brasileira foi o seqüenciamento do genoma da bactéria 'Xylella fastidiosa'. como aceptor final de elétrons. Indique se há ou não possibilidade de produção de rosas azuis nesse caso e justifique sua resposta. em vez de ser introduzido o gene da petúnia que define a cor azul. mas não eram consideradas azuis verdadeiras.

porém. qual é a probabilidade de que esse alelo também esteja presente no outro gêmeo? Questão 366 O esquema a seguir resume a seqüência do desenvolvimento de irmãos gêmeos: 1. ocorrendo o mesmo na sua segunda gestação. Questão 363 Em um hospital. por serem muito reativas. Justifique por que não houve alteração da estrutura da proteína. acarretando a substituição de uma base guanina por uma adenina.9 a) Sob o ponto de vista embriológico.10. Pergunta-se: a) Qual dos parentes você escolheria como doador do órgão? b) Justifique sua resposta. a) Estes gêmeos devem ser monozigóticos ou dizigóticos? Por quê? b) Se um dos gêmeos herdou o alelo dominante A de sua mãe heterozigótica Aa. causam alterações. sem alterar. a) Considerando o processo de oxidação completa da glicose pela célula eucariótica. b) Uma espécie reativa de oxigênio induziu uma mutação no gene de uma célula. denominadas espécies reativas de oxigênio. inclusive no DNA.11 75 . primo em primeiro grau e irmão gêmeo dizigótico. o que são gêmeos? b) Analisando a figura. Por exemplo. a estrutura primária da proteína codificada pelo gene. quais são geneticamente idênticos? Justifique sua resposta. um indivíduo necessita de um transplante de rim. a) Em que locais do corpo humano são produzidas essas proteínas e qual é a principal função de cada uma delas no organismo? b) Explique sucintamente o processo por meio do qual se modificam bactérias para que elas passem a produzir proteínas humanas. dando origem a moléculas intermediárias.forte tendência a receber um elétron de cada vez. que são fortes agentes oxidantes. Questão 365 Em uma gravidez gemelar. indique a etapa responsável pela formação de espécies reativas de oxigênio e o local da célula onde essas reações ocorrem. o par de gêmeos é do sexo masculino. hoje já estão sendo comercializadas insulina e somatotrofina (ou somatropina) humanas produzidas por bactérias. amigo. Qual o percentual esperado de ocorrência desse fato? Questão 368 A figura adiante representa o fenômeno biológico que ocorre com um tipo de célula que sai do vaso sangüíneo para exercer sua função no tecido conjuntivo. Dispõe ele dos seguintes doadores: tio. Essas moléculas. fato que pode induzir mutações tanto em células somáticas quanto em células germinativas. 1.10. Questão 364 Uma conquista recente no campo da biotecnologia é o uso de bactérias para a produção de proteína animal de interesse comercial. Questão 367 Uma mulher teve uma menina em sua primeira gravidez.

Questão 370 O texto abaixo refere-se às questões: ** a ** O cruzamento entre plantas de variedades diferentes de uma mesma espécie é muito utilizado para a obtenção de cultivares mais produtivos. referentes à folha e à semente. Os ácidos graxos insaturados presentes no amendoim.1 Das combinações possíveis resultantes do cruzamento entre esses mesmos parentais.semente com "pêlos" p . característica determinada por um gene. As plantas de amendoim podem apresentar folhas com pecíolo normal ou curto. plantas com pecíolo normal e com pecíolo curto.5. pois a mesma é lipossolúvel. com dois alelos. O gráfico que representa o número de alelos encontrados na mitose de uma célula obtida de uma planta resultante do cruzamento entre os parentais é: Questão 371 1. c) folha sem cera. ainda servem de veículo de transporte para a vitamina E. 1.folha coberta com cera c . Para determinar qual alelo é dominante. Muitos pesquisadores. se o alelo para pecíolo curto for recessivo.2. conforme a lista a seguir. proteínas. Considere que duas das características dessa planta. Descreva a função da transcriptase reversa no mecanismo de replicação do vírus da Aids.semente lisa C . b) 1:2:1. o fenótipo que apresenta o maior número de genótipos possíveis é a) semente com "pêlos". d) folha com cera. se o alelo para pecíolo curto for dominante.a) Identifique esta célula e nomeie o fenômeno biológico apresentado. uma com pecíolo normal e outra com pecíolo curto.folha sem cera Os gráficos a seguir mostram a composição dos alelos para essas duas características nas plantas parentais. se o alelo para pecíolo normal for recessivo. b) Qual a importância do fenômeno apresentado para a função desta célula? Questão 369 A enzima transcriptase reversa é encontrada em retrovírus. Espera-se encontrar. d) 3:1. na proporção de a) 1:1. sais minerais e vitaminas. procuram descobrir novas substâncias que sejam inibidoras específicas dessa enzima.1. b) semente lisa. P . se o alelo para pecíolo normal for dominante. c) 2:1. Questão 372 O amendoim é uma planta originária da América do Sul.1 76 . carboidratos. são definidas por alelos segregados independentemente. Dois espécimes de variedades diferentes de uma planta oleaginosa foram cruzados visando à obtenção de uma variedade mais resistente à seca. foi feito um cruzamento entre duas linhagens puras. Sua importância econômica está relacionada ao fato das sementes possuírem sabor agradável e serem ricas em óleo. se os alelos forem codominantes. respectivamente. em F2.5. e) 3:1. atualmente.

... técnicas especiais de cruzamento foram aplicadas em dois tipos de cerejeiras transgênicas. roxa e branca) haviam sido obtidas.... resulta em produto que determinara o desenvolvimento da resposta imunológica.Uma pequena cidade interiorana do Nordeste brasileiro chamou a atenção de pesquisadores da Universidade de São Paulo pela alta incidência de uma doença autossômica recessiva neurodegenerativa... e) pais heterozigotos têm 50% de probabilidade de terem filhos que irão desenvolver a doença.. d) a crença da população pode ser explicada pelo fato de o sangue do feto ser fornecido pela mãe. Segundo a bióloga Josefa da Silva. podemos afirmar que: a) no século XIX. julho de 2005. c) em situações como a descrita.. as substâncias que. Elas continuam apresentando.. As novas cores (amarela.) Pelas informações fornecidas no texto. diz a pesquisadora. que. então no . Se as cerejeiras referidas no texto são transgênicas.. estabeleceram-se como pragas importantes do cultivo de cerejas-vacina. Questão 374 Em relação à crença da população sobre o processo de transmissão de características hereditárias.. incapazes de produzir sementes. pois os genes estão presentes apenas nas células sangüíneas e nas células germinativas..seqüência de aminoácidos . b) a população não está tão equivocada.. c) este é um exemplo claro no qual o conhecimento elaborado pelo senso comum coincide com os conhecimentos atuais dos cientistas. As formas mutantes para esse loco. nos últimos anos. Com o cultivo das novas variedades de cerejas resistentes..RNA transportador 77 ** a ** .. existe uma . Questão 375 O texto abaixo refere-se às questões: Notícia de algum jornal do futuro.. podemos afirmar que: a) pais saudáveis de filhos que apresentam a doença são necessariamente homozigotos. ao ser traduzido. casamentos consangüíneos não aumentam a probabilidade de transmissão de doenças recessivas.proteína . não interferem na eficiência das plantas transgênicas como produtoras de vacinas. não há a formação de endosperma.. e o processo cessa nas primeiras divisões celulares do zigoto. espera-se que essas pragas mantenham-se afastadas dos pomares de vacinas.. neste ano. determinando o desenvolvimento da resposta imunológica. sem sementes. resultando na obtenção de plantas triplóides (3n = 72).. por algum tempo. das células dessas plantas. verde. em algum cromossomo. depois de liberadas pela digestão. responsável pela equipe que desenvolveu os novos frutos. (Pesquisa FAPESP. Assinale a alternativa que completa as lacunas de modo correto...RNA mensageiro b) citoplasma .. as plantas apresentam resistência aos nematóides que atacavam a raiz principal do sistema axial desses vegetais. Outro dado interessante levantado pelos pesquisadores foi que a população da cidade acredita que a doença seja transmitida de uma geração a outra através do sangue. a) núcleo . anteriormente. Da mesma forma.. é a utilização de cerejas coloridas. por mutação no gene responsável pela produção de pigmento na casca do fruto.. uma vez que células sangüíneas não apresentam as estruturas básicas que guardam as informações genéticas. muitos cientistas também acreditavam que as características genéticas eram transmitidas pelo sangue.. INICIA A CAMPANHA NACIONAL DE VACINAÇÃO CONTRA SARAMPO E TUBERCULOSE. e) a crença da população não faz o menor sentido. b) homens e mulheres têm a mesma probabilidade de apresentar a doença. Outra inovação dessas cerejas é a resistência às moscas Anastrepha fraterculus que. nos frutos. que foi introduzida para ser transcrita e originar um . ligam-se á membrana plasmática dos linfócitos e sofrem endocitose. As pesquisas realizadas revelaram que é também alto o número de casamentos consangüíneos na cidade.. Apesar de passar por todas as etapas do ciclo reprodutivo. d) pais heterozigotos têm 25% de probabilidade de terem filhos também heterozigotos. O destaque da campanha de vacinação..

5.. Questão 378 As proposições a seguir são relativas ao processo de síntese de proteínas nas células vivas. Um pesquisador apresentou a seus alunos o heredograma a seguir. se uma planta heterozigota para esses alelos apresentar frutos com a casca roxa.4 . II . ( ) No local onde houver um ribossomo. ( ) trata-se de um caso de herança ligada ao sexo. pequenas moléculas de RNA transportador (RNAt). ( ) a doença é causada por um alelo dominante. ( ) é um caso de polialelia com epistasia recessiva.RNA mensageiro e) citoplasma .) mutação no gene responsável pela produção de pigmento (. b) apenas II. Esta(ão) correta(s) a) apenas I. a uma proteína funcional.os códons.o anticódon. Questão 379 Analise os dados apresentados a seguir. ( ) trata-se de um caso de herança parcialmente ligada ao sexo.1.. Questão 377 O texto abaixo refere-se às questões: ** a ** Na(s) questão(ões) a seguir escreva nos parênteses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa.O alelo responsável pela "casca roxa" será considerado dominante em relação ao alelo que determina a "casca verde".Se a coloração branca for recessiva. ligadas a aminoácidos.RNA transportador Questão 376 A partir das informações do texto.As mutações responsáveis pelas cores da cereja ocorreram em vários cromossomos. Sabendo-se que os indivíduos afetados estão representados em negrito e os normais em branco.RNA mensageiro d) núcleo . pode-se afirmar: ( ) a doença é causada por um alelo recessivo. ao final da leitura do RNAm.6% ab = 47.. relativo a uma certa doença observada por ele em humanos.4% Ab = 2. ( ) A molécula de DNA transcreve no núcleo uma molécula de RNA mensageiro (RNAm) com várias seqüências de três bases . c) apenas I e II.seqüência de aminoácidos . e) apenas II e III..proteína . pode(m)-se afirmar: I ..6% aB = 2. unem-se ao RNAm por uma seqüência de três bases . será possível obter plantas com frutos coloridos a partir do cruzamento de plantas com frutos brancos. AB = 47. dando formação.)". ( ) Os diversos aminoácidos unem-se através de ligações do tipo éster. que trata dos tipos e percentuais de gametas produzidos por um indivíduo de genótipo não divulgado (indivíduo parental). ( ) Cada códon do RNA mensageiro determinará a colocação de um aminoácido específico na cadeia polipeptídica. Ill .c) núcleo . "(..seqüência de nucleotídeos .4% 78 1. d) apenas III.)" e "As formas mutantes (obtidas) para esse loco (. ( ) O processo de síntese de proteínas a respeito do citoplasma é também conhecido como transcrição genética.

Santa Cruz do Sul: EDUNISC. W e Y não têm parentesco.( ) Trata-se de um caso de genes de segregação independente. o embrião foi implantado no útero de uma terceira vaca Y. ( ) O indivíduo parental é um heterozigoto AB/ab e. O núcleo foi isolado e conservado. III. e) apenas II e III. III. c) apenas III." O DNA presente nas mitocôndrias tem composição e estrutura típicas desse tipo de ácido nucléico. 79 . utilizada como "mãe de aluguel". II. 2004). como os Kaingáng. pode-se inferir que ocorreu quiasma entre os locos "A" e "B" em 94. anteriores aos citados. diferencia-nos. apenas b) W. muitas vezes. No entanto.8% das células meióticas que originaram estes gametas. W e Y Questão 381 Se a vaca Y. ( ) O indivíduo parental é um heterozigoto aB/Ab. portanto. nucleotídeos que são compostos por uma base nitrogenada. através dos vestígios materiais encontrados nas pesquisas arqueológicas. Diante da relevância do contexto e da vontade de valorizar o nosso povo nativo. apenas d) Z e da W. sabemos que outros povos. B. b) apenas II. mãe de aluguel. formando ligações fosfo-diéster. IPHAN. determinando uma distribuição 1:1:1:1: ( ) 5. pode-se afirmar que o animal resultante da clonagem tem as características genéticas da vaca. "Nossos ancestrais. A célula reconstituída foi estimulada para entrar em divisão. Está(ão) correta(s) a) apenas I. italianos e de outros povos. II. O núcleo da célula da glândula mamária foi introduzido no óvulo anucleado. portanto é formado por I.2% dos gametas apresentam combinações alélicas diferentes daquelas existentes nos cromossomos do indivíduo parental. as três raças se mesclam em nossos descendentes. uma mistura de índios. Retirou-se um óvulo da vaca Z. uma pentose e um radical "fosfato". O embrião se desenvolveu e deu origem ao clone. ( ) Considerando que 5. L. um heterozigoto "Cis". ou seja. Questão 380 O texto abaixo refere-se às questões: ** a ** A seqüência a seguir indica de maneira simplificada os passos seguidos por um grupo de cientistas para a clonagem de uma vaca: I. convivemos com grupos indígenas. Após algumas divisões. Nosso chimarrão nos identifica em qualquer parte do mundo.. A. a) Z. protagonizaram a nossa história. deixaram-nos um legado que. uma cadeia de nucleotídeos em que as bases nitrogenadas interagem. for a mãe biológica da vaca W. um heterozigoto "Trans". apenas c) Y. ainda hoje. organizador. através dos pareamentos de aminoácidos. Retirou-se uma célula da glândula mamária da vaca W. alemães. d) apenas I e II. O núcleo foi desprezado.2% dos gametas são recombinantes. brancos e negros. apenas e) Z. desprezando-se o resto da célula. duas cadeias polinucleotídicas paralelas e complementares entre si. "o índio". Ainda hoje. foi selecionada a área temática CULTURA e as questões foram construídas com base na obra "Os Primeiros Habitantes do Rio Grande do Sul" (Custódio. Considerando-se que os animais Z. a porcentagem de genes da "mãe de aluguel" presente no clone será a) 0 % b) 25 % c) 50 % d) 75 % e) 100 % Questão 382 A história da maioria dos municípios gaúchos coincide com a chegada dos primeiros portugueses. IV. obtendo-se um óvulo anucleado.

Uma mãe. Doença pode ser definida como um desequilíbrio do organismo ou ausência de bem-estar físico e mental. com alteração do aminoácido codificado e da proteína correspondente. c) Pedro. c) inversão de um par de bases no DNA. Questão 387 O texto abaixo refere-se às questões: ** a ** Na(s) questão(ões) a seguir escreva nos parênteses a soma dos itens corretos. d) inversão de um par de bases no DNA. mas não da proteína correspondente. sem alteração do aminoácido codificado. Ela 80 . e) Quando a malária for erradicada. c) O indivíduo Ss leva vantagem em relação ao SS. conseqüentemente. b) O indivíduo ss leva vantagem em relação ao SS. com tipo sangüíneo O. d) João ou José. EXCETO: a) A malária atua como agente seletivo. sem alteração do aminoácido codificado. vasos e capilares transportando gases. ser heterozigoto deixará de ser vantagem. Rh®. onde a anemia falciforme não sofra influência de outros fatores e onde novas mutações não estejam ocorrendo. d) s permanece constante. a freqüência do gene a) S permanece constante. haverá mudança na freqüência gênica da população. O indivíduo SS é normal. José tem tipo AB. Questão 385 O esquema a seguir mostra a seqüência do DNA que leva à formação da hemoglobina normal e a que leva à formação da hemoglobina alterada. c) S tende a aumentar. e) José ou Pedro. tem um filho O. b) José. e) s tende a aumentar. nutrientes etc. Um adulto de peso médio tem cerca de 5 litros de sangue em circulação. de hemácias que se deformam. circula pelo coração. o Ss apresenta anemia atenuada e o ss geralmente morre. Supondo populações africanas com incidência endêmica de malária. Considere os segmentos de DNA a seguir: rata-se de um caso de mutação por a) perda de um par de bases no DNA. Questão 384 Verificou-se que em populações de regiões onde a malária é endêmica. os heterozigotos (Ss) são mais resistentes à malária do que os normais (SS). que é constituído por plasma e algumas células especializadas. Rh−. Rh−. mas tem dúvidas sobre qual dos três namorados é o pai da criança: João tem tipo sangüíneo A. Rh®. b) S tende a diminuir. Nesse caso são verdadeiras as afirmações a seguir. O geneticista consultado informou que o pai pode ser a) João. e) inversão de um par de bases no DNA. sem alteração do aminoácido codificado. b) adição de um par de bases no DNA.9.Questão 383 O texto abaixo refere-se às questões: ** a ** 1. É condicionada por um alelo mutante s. d) Quando a malária for erradicada.5.3 A anemia falciforme ou siclemia é uma doença hereditária que leva à formação de hemoglobina anormal e. com alteração do aminoácido codificado. Questão 386 O sangue. artérias. Rh® e Pedro é A.

Com base nesta informação. (08) A B D (16) a B D (32) portador apenas de D.pode ter inúmeras causas e variar de intensidade e manifestação. (16) Já existem seres humanos que foram originados e desenvolvidos plenamente por clonagem. sem alelos A e D. (08) Doenças funcionais resultam do mau desempenho ou da perda de um órgão ou sistema. (02) Doenças genéticas são aquelas causadas por alterações do patrimônio genético e podem passar de pais para filhos. enquanto a eritroblastose fetal é uma doença congênita. Questão 391 Em parte motivada pela necessidade mundial de aumentar a produção de alimentos. (08) Órgãos transplantados do clone para o doador das células serão sempre rejeitados. etc. 81 . Com relação a esse tema. terá todos os seus filhos normais. um indivíduo portador do genótipo ABD//abD poderá produzir os seguintes gametas: (01) Portador apenas de A ou a. nascerá sem o referido membro. é correto afirmar: (01) Um homem hemofílico. terá 50% de seus filhos afetados. a ciência do melhoramento genético procura encontrar soluções que aumentem a produtividade de certas espécies. independentemente do sexo. encontra barreiras de ordem ética. casado com uma mulher homozigota normal. Sobre esse processo é CORRETO afirmar: (01) Os clones são como irmãos gêmeos fraternos do doador das células. (16) Doenças transmissíveis são as transmitidas por patógenos ou por seus produtos. certamente será hemofílica. por esse processo. (08) Um homem hemofílico teve uma filha normal. escreva no espaço apropriado a soma dos itens corretos. (64) A b D Soma ( ) Questão 389 Clones são seres vivos obtidos pelo desenvolvimento de células retiradas de indivíduos já existentes. filha de um indivíduo hemofílico. (02) Uma mulher. também. sem alelos A e B. Muitas vezes. (04) Doenças traumáticas são aquelas que se originam de acidentes. Soma ( ) (04) Se o doador das células possuir um defeito genético. é CORRETO afirmar: (01) O alcoolismo. (32) O mongolismo é um exemplo de doença hereditária. A probabilidade desta mulher ter uma criança do sexo masculino e hemofílico é igual a 1/4. o gene (h) para hemofilia está localizado no cromossoma X e é recessivo em relação ao gene (h+) para coagulação normal do sangue. No homem. seu clone possuirá. através do material genético. Soma = ( ) Questão 388 Considerando inclusive a possibilidade de permuta genética. (04) Um homem hemofílico. casado com uma mulher homozigota normal. como o albinismo. A clonagem é um processo que vem sendo desenvolvido rapidamente com vários organismos e. os cientistas provocam modificações nessas espécies em busca de seus benefícios e atuam à semelhança da natureza. independentemente do sexo. Leia o texto adiante e compare-o com o esquema. em humanos. (02) a b D (04) portador apenas de B ou d. essa anomalia. usando técnicas sofisticadas. (02) O material genético do doador das células e do clone é idêntico. hemorragias. podendo resultar em fratura de ossos. sem alelos B e D. o tabagismo e a dependência de outras drogas são exemplos de causas que podem resultar em doenças. (32) Se o doador de células sofrer a perda de um membro antes de ser realizada a clonagem. Soma ( ) Questão 390 O texto abaixo refere-se às questões: ** a ** Na(s) questão(ões) adiante. o organismo originado posteriormente.

1/2. Entre S/G‚ algumas proteínas checam possíveis falhas e erros na linha de produção. escolheram e reproduziram aquelas cujas plantas apresentassem a capacidade de produzir uma proteína inseticida" está relacionada aos itens 3 e 4 do esquema. ao se colocar H‚O‚ em ferimentos. para destruir as pragas que atacam essas culturas. a H‚O‚ "não ferve". (04) A afirmativa "nos testes experimentais. as enzimas que deveriam proteger contra a ação dos radicais livres. escolheram e reproduziram aquelas cujas plantas apresentassem a capacidade de produzir uma proteína inseticida" está relacionada aos itens 4 e 5 do esquema. Portanto. (02) A afirmativa "Os cientistas alteraram o código genético dessas sementes" está relacionada aos itens 1. 1/8. Esse problema pode ser evidenciado no dia-a-dia. (08) A afirmativa "nos testes experimentais. Este. é monogênica com herança autossômica recessiva. nos testes experimentais. d) Aa x aa. Soma = ( ) O ciclo celular é interrompido entre as fases G/S e G‚/mitose. matava os insetos que atacavam as plantações. 1/4. escolheram e reproduziram aquelas cujas plantas apresentassem a capacidade de produzir uma proteína inseticida. é correto afirmar: Questão 392 Uma criança de aproximadamente 1 ano. 21/02/1996) Da comparação entre o texto e o esquema. c) Aa x Aa. 2 e 4 do esquema. No caso dessa criança. decidem se o ciclo celular avança ou é paralisado iniciando um processo de destruição do material genético. GALILEU: "É correta a noção de que a maior parte dos 82 . Abaixo está transcrito um pequeno trecho de uma recente entrevista. concedida à Revista Galileu pelo cientista Sérgio Danilo Pena." (Veja.15. pois a criança não possui. batata e algodão alteradas geneticamente em laboratório. que liderou uma pesquisa genética sobre a composição étnica do povo brasileiro. da Universidade Federal de Minas Gerais. e proteínas especiais controlam a evolução do ciclo celular das novas células. a produtividade das lavouras será bem maior" refere-se ao item 6 do esquema. (16) A afirmativa "Livre dos mesmos. é encaminhada pelo pediatra a um geneticista clínico. conhecido como APOPTOSE. a produtividade das lavouras será bem maior. em um tipo de organela de suas células. 1/8. Questão 393 1. Os cientistas alteraram o código genético dessas sementes e. Diz também que a doença é muito grave.5. Livre dos mesmos. após alguns exames. quando ingerida com as folhas. b) Aa x aa.2 (01) A afirmativa "Os cientistas alteraram o código genético dessas sementes" está relacionada somente ao item 1 do esquema. Essa proteína. e) Aa x Aa. com acentuado atraso psicomotor. Um exemplo observável das conseqüências de apoptoses é o descamar da pele após sua exposição prolongada a radiação solar intensa. a inativação de qualquer um dos componentes ou operadores do sistema de checagem ou de apoptose poderia provocar a proliferação contínua das células e possível desenvolvimento de tumores cancerosos. 1/4. Qual é o genótipo dos pais da criança descrita no texto e qual a probabilidade de o casal ter outro filho com essa mesma doença? a) AA x aa. O geneticista clínico explica aos pais que a criança tem uma doença de origem genética. constata que a criança possui ausência de enzimas oxidases em uma das organelas celulares. ou morte celular espontânea."Nos próximos meses chegam às lavouras dos Estados Unidos e Canadá sementes de milho.

d) Pelo estudo acima. há esta frase da boneca que muito lingüista moderno poderia adotar como lema. inesquecíveis companheiras de aventuras por vários tempos e espaços. Tudo quanto existe levou milhões de anos a formar-se. proporções e propriedades. até à chamada "era dos milagres". nas seqüências e nas funções . opinar sem ser pretensioso. e se está no ponto em que está. que incluía a exploração estatal do "ouro negro" (como também a do ferro).. Se Dona Benta é uma velha de óculos e muita leitura. 3. em 1941. Meu caso é exatamente esse. nas expressões. a adaptar-se. c) O cromossomo Y apresenta genes exclusivamente paternos. Em "A reforma da natureza". somente o genoma de indivíduos do sexo masculino pode ser utilizado para a determinação da ancestralidade paterna.. onde não faltam lições de fonética. dos guindastes... pelo império romano. Benta acerca da clonagem e dos transgênicos? 4. Quanto ao petróleo. aparecem logo muitas conseqüências £que não previmos. passando pelo uso do fogo. que assim adquirem novas formas. das roldanas. reformar a natureza! Quem somos nós para corrigir qualquer coisa que existe? E quando reformamos qualquer coisa. passariam a citar de boca cheia. cinema . do petróleo. não custa lembrar que a campanha nacionalista de Lobato. Dona Benta (permito-me eu). Meu cromossomo Y é europeu e meu DNA mitocondrial é ameríndio. num período especialmente sombrio da história do nosso país e trágico da história universal. EXCETO: a) O DNA do cromossomo Y e das mitocôndrias apresenta genes que determinam a cor da pele humana. Benta uma verdadeira manifestação ecológica: ". Emília é uma abelhuda crítica e irreverente.. e seus brinquedos são cada vez mais fantásticos e perigosos. Em "O poço do Visconde". b) O DNA mitocondrial é de origem materna. Em "Emília no país da Gramática". jorra o precioso óleo em pleno sítio. de formação e de classes de palavras. telefone. uma porção de coisas que aprenderam com as personagens do Sítio do Picapau Amarelo. quando marmanjos. vai-se da origem do universo (sabiamente explicada pela vovó Benta como hipótese). nas equações de todos os graus. lendo a "História das invenções": são sugestivas as explicações sobre a operação das alavancas (que permitiu ao homem a construção das pirâmides).brasileiros tem algum antepassado com pai branco europeu e mãe negra ou índia ?" PENA: "É. Nesse mesmo livro. MONTEIRO LOBATO (1882-1947) 1. Sempre foi intenção de Lobato ensinar sem ser chato. As adaptações que faz Lobato de obras ficcionais ou a recuperação de fatos históricos são também notáveis: seu "D. Emília. pelos assírios e babilônios. e não falta a chegada do técnico norte-americano para tentar tomar conta da situação e acabar escorraçado pelos indignados habitantes.para que o escritor lhe apresentasse alguns dos "bichos de sete cabeças" da Matemática com a mesma graça e eficácia com que iniciara os meninotes nas frações e nos números complexos. pelos hieróglifos. as experiências realizadas por Emília e pelo Visconde geram monstros: ¢alteram o funcionamento de "Dona Pituitária" em insetos. dos moinhos.e com o manejo atômico que deu na tragédia de Hiroshima. Já depois de ler a "Aritmética da Emília". fazendo coro com os alunos: "." Que diria hoje D. 2. pelos tempos da cavalaria.. pelas revoluções do século XVIII. Quanto da história e da mitologia grega não se aprende ao lado da boneca Emília.Que peste é a tal Gramática!". do carvão. o jovem leitor lamentará que Lobato não tenha entrado na Álgebra e na Geometria. Quixote" é alegre e comovente. só o tempo pode curar o grande defeito da humanidade . o homem continua brincando.Mas que absurdo. que termina com esta frase da vovó sabida: "O tempo.. As obras "infantis" de Monteiro Lobato ajudaram muito na formação de milhares de pequenos brasileiros que. e às vezes sem confessar. epílogo também do livro." A resposta do geneticista aliada aos seus conhecimentos permite afirmar.. existem mil razões para isso. Também um iniciante na Física não pode se queixar. seu "Hans Staden" 83 . espantando os vizinhos e provocando em D. qualquer um admirará a facilidade com que se explica a formação e as propriedades do vidro. custou-lhe seis meses de cadeia. que é como Lobato batizou a vida com luz elétrica.que é ser muito criança ainda". Questão 394 Instruções: Leia atentamente o texto adiante para responder às questões a seguir. das dragas (com as quais se escavou o Canal do Panamá). que tagarela pedantemente com Péricles ou com Hércules? Na "História do mundo para as crianças".

segundo a qual cientistas ingleses estão conseguindo transferir certos genes de bactérias para mosquitos anofelinos. Esse exemplo refere-se à construção de um organismo a) transgênico útil para a erradicação da malária. 1996. "mais o ferro. conhecido por suas frases lapidares. resume algo de nosso "temperamento". se vivesse nos dias de hoje." (Traduzido e adaptado de: William R. Os termos a seguir fazem parte da nomenclatura genética básica. (02) GENÓTIPO é a constituição genética de um indivíduo. Se nada mais sobrasse da obra de Lobato. Bolívar e Lincoln. Assinale as alternativas que trazem o significado correto de cada um desses termos: (01) GENE é sinônimo de molécula de DNA. uma célula morta pelas toxinas produzidas por bactérias invasoras. SEX AND THE ORIGINS OF DEATH. De certa forma. New York: Oxford University Press. proveitosa e sempre polemizada pela palpiteira Emília. dizem alguns. por exemplo à máquina a vapor. Sem isso. provavelmente estaria batalhando pelo desenvolvimento sustentável. uma célula do miocárdio morta por falta de oxigênio durante um ataque cardíaco. 84 . dos conflitos religiosos. está fadada a morrer. humor e vivacidade crítica . em outro esse invento vem associado ao carvão-de-pedra que. Questão 395 "Virtualmente. Soube admirar tanto a mangueira frondosa quanto a técnica fecunda.. Estes genes teriam a capacidade de impedir a instalação de determinadas fases do protozoário 'Plasmodium' no estômago e nas glândulas salivares do mosquito. uma célula da camada germinativa da epiderme. que morre e sofre queratinização. III.combinação que.introduz o leitor num capítulo importante de nossa história colonial. Sempre haverá a curiosidade nossa de saber o que Emília pensaria hoje da globalização. imaginativa e fluente. c) transgênico útil para a erradicação da leishmaniose. . o quanto ela tem de orgânico. essa vivíssima boneca de pano expressaria sempre um fundamento de malandragem. enviadas ao citoplasma. O que espanta nessa pluralidade é que nada surge como aleatório. II. das ações terroristas. contradição nossa até hoje.. como o fora antes da invenção de Watt". 5. é verificada SOMENTE em a) I b) II c) III d) I e II e) I e III Questão 396 Na(s) questão(ões) a seguir escreva no espaço apropriado a soma dos itens corretos. p. processo este decididamente irreversível. da difusão de novas seitas. a Inglaterra seria um quase nada. cada aspecto da vida de nossas células é regulado por seu DNA. inédito) Que diria hoje "D. reuniu a seu modo as realidades de um país ainda arcaico e já moderno. apesar de poder continuar exercendo determinadas funções durante certo tempo. Se num livro o autor se referia. 32-5) Considere os seguintes fatos: I. tudo parece fazer parte de uma didática natural. Benta" acerca da "clonagem" e dos "transgênicos"? Atualmente ela teria notícias freqüentes sobre técnicas de manipulação do DNA. partindo-o em milhares de pedaços que não mais conseguem enviar instruções úteis à célula. e) clonado útil para a erradicação da leishmaniose. d) clonado útil para a erradicação da malária. em muitos pontos. (04) DOMINANTE é um dos membros de um par de alelos que se manifesta inibindo a expressão do outro. Logo que essas instruções sejam recebidas e processadas. ou morte programada das células. incluindo sua própria morte. 7. Um exemplo delas constitui a matéria publicada recentemente em um jornal. 6. (Eurípides de Souza e Passos. Esta. Lobato parece ter querido reunir a beleza natural do primitivo ao encantamento pelo enciclopédico. b) transgênico útil para a erradicação da esquistossomose. forjado no caldeirão de raças e culturas de que procedemos. dispondo-se a dali falar de tudo e a contar qualquer história (numa linguagem ao mesmo tempo exata. As últimas instruções do DNA. sem concessões à famigerada "literatura infantil"). A apoptose. Ao instalar suas criaturas numa base rural. a célula começa a destruir todo o DNA de seu núcleo. Clark. referem-se à morte da célula. O leitor que percorra essa obra notará. foi o que deu a vitória aos ingleses. nem falta a apresentação de personagens como Marco Polo.

todas as portas do mundo: posso falar da minha rua ou de Bagdad. Meu professor de Ciências fechou a cara quando lhe perguntei se era hábito de Arquimedes tomar banho na banheira brincando com bichinhos que bóiam. Adolescente. caricaturas. fazia prodígios com ímãs e saberia perfeitamente reconhecer uma voçoroca. 5. de novo. Em compensação. entro na Internet. curiosidades etc. a relação que Pitágoras encontrou não apenas entre catetos e hipotenusa. da guilhotina francesa. que eu achei familiar quando a li pintada no pára-choque de um fordinho com chapa 1932 (relíquia de um paulista orgulhoso?). O "buscador" da HOME PAGE é uma espécie de oráculo de Delfos de efeito 85 . do meu canteirinho de temperos ou da safra nacional de grãos. leitor . a separar as chamadas áreas do conhecimento. misturava povos e séculos com grande facilidade. Um outro ensinava a fazer balão e pipa. "vim. 6. porque despertavam a classe sonolenta. Pouco depois dos almanaques vim a conhecer as SELEÇÕES .entre o sentimento da melancolia e o funcionamento do fígado. horóscopo. dicas de viagem. de circulação regular e internacional. com base no almanaque. por exemplo. enigmas policiais. Eu não trocaria três exemplares do almanaque de um certo biotônico pela coleção completa das SELEÇÕES. o descompromisso macunaímico dos nossos almanaques em papel ordinário. a concretização editorial do SLOGAN famoso: TIME IS MONEY. O leitor não faz idéia do que cabia nesse etc. Lá está. Agora sou autor do meu próprio almanaque. Deixei de lado os almanaques e entrei no funil apertado das tendências vocacionais. Já ouvi a expressão "cultura de almanaque". E me arrepiava a descrição do ataque à base naval de Pearl Harbor. ou a história de expressões como "vitória de Pirro".pasme.. se viesse a cair dentro de uma. e lá estava. Pense em algo publicável. Talvez não seja inútil conhecer as dimensões das três pirâmides. além do calendário do ano. provérbios. E alguns professores sempre implicavam quando eu os contestava ou argüía. Acho injusto. astúcias da matemática. nunca voltaria para o dono.. Soma ( ) Questão 397 Cultura dos almanaques 1.é também uma constatação da astrofísica. do fracasso de Napoleão em Waterloo. a manejar um pião. Algum risco sempre havia: não foi boa idéia tentar fazer algumas experiências químicas com produtos caseiros. 4. Brutus?". Não tinha a galhofa.: charadas. recordes mundiais. da reunião do meu condomínio ou da assembléia da ONU.uma espécie de almanaque de luxo. da queda de Ícaro.(08) FENÓTIPO é a expressão do gene em determinado ambiente. Pegadinhas do tipo "quais são os números que têm relações de parentesco?" ou questões como "por que uma mosca não se esborracha no vidro dentro de um carro em alta velocidade?" não eram bem-vindas. Tirando Hollywood. e se nunca os fiz subir ou rodar era porque meu controle motor já não dava inveja a ninguém. das angústias de Colombo em alto mar. receitas caseiras. as SELEÇÕES talvez tenham sido o principal meio de difusão do AMERICAN WAY OF LIFE. Almanaque não se emprestava a ninguém: ao contrário de um bumerangue. traz diversas indicações úteis. conhecia todas as propriedades de uma carnaubeira. esse almanaque multidisciplinaríssimo de última geração."o fogo de constelações extintas há milênios" . mas ainda hoje me valho das informações de almanaque para explicar. Se fico sem assunto. pelo qual já se entrevia uma América (como os EUA gostam de se chamar) com ares de dona do mundo. vi e venci" e "até tu. move-se!". (16) GENOMA é o conjunto de todos os alelos de um indivíduo. Com o tempo. palavras cruzadas. aprendi a me especializar nas disciplinas curriculares. o curso e o regime do rio São Francisco. o humor era bem-comportado. descobri este emprego de cronista que me abre. Sim. entre outras acepções.READER'S DIGEST . trechos literários. Lembro-me de um exemplar que falava com tanta expressão da guerra fria e de espionagem que me proporcionou um prazer equivalente ao das boas páginas de ficção. as matérias tinham um tom meio autoritário e moralista. a que vem ao caso: folheto ou livro que. poesias. 2. Não tinha o charme dos almanaques: levava-se muito a sério. Como explicar ao meu leitor mais jovem o que é (ou o que era) um ALMANAQUE? Vamos ao dicionário. mas . dita em tom pejorativo. 3. anedotas. Um bom leitor de almanaque explica como uma bela expressão de Manuel Bandeira . e minha professora de História fingiu que não me ouviu quando lhe perguntei de quem era mesmo a frase "E no entanto.

Parte dessa safra refere-se à produção da soja.e isso ocorre com freqüência. d) apenas I e II. comunicação. de alimentos geneticamente modificados. que é um agente mutagênico. d) Pode haver efeitos sobre várias espécies de insetos protetores da flora e de polinizadores. O custo dessa aceleração da descoberta é a hiperespecialização. certamente.contaminantes biológicos. Assinale a alternativa que contém argumentos favoráveis à produção. deve I . que se operou e continua a se operar em ritmos antes inconcebíveis. triunfo das massas. Em algumas dezenas de anos. por alterar a seqüência de nucleotídeos do DNA.. Questão 398 A qualidade da água pode ser alterada por vários fatores: .Paulo" de 23/09/03. III .5 milhões de toneladas. Esse fenômeno está intimamente ligado ao fato de ter sido neste século que os homens colocaram mais diretamente em questão a sobrevivência do planeta. no caso deles). mesmo em baixas concentrações. como o benzeno. Poderia produzir venenos sem que o soubesse .impedir o funcionamento dos ácidos nucléicos. Holocausto: através das metáforas e das realidades que marcaram esses cem últimos anos. O século que chega ao fim é o que presenciou o Holocausto. é assustadora.aumentar as taxas de mutação em todos os seres vivos. a) Há muitas dúvidas sobre eventuais danos à saúde do consumidor provocados pelas alterações genéticas nos alimentos. o que significa uma elevação de 19% em comparação à colheita anterior. II e III. Nesta. no Brasil. . mas não possui mais o saber que lhe permitiria dar-se conta de que seu produto irá provocar um buraco na camada de ozônio. assistiu-se ao triunfo das teorias revolucionárias de Einstein e a seu questionamento. Hiroshima. os regimes dos Grandes Irmãos e dos Pequenos Pais. c) apenas III. não apenas no homem. Estamos em via de viver a tragédia dos saberes separados: quanto mais os separamos. os massacres do Camboja e assim por diante. O benzeno. aparece a verdadeira doença do progresso. e em algumas décadas se passou do dirigível ao avião. o que representaria uma vantagem comercial ao país que os proíbe. Questão 399 O texto abaixo refere-se às questões: ** a ** Ação à distância. linha de montagem.permitir o surgimento de novos alelos. os velhos almanaques me deixaram saudades. tanto mais fácil submeter a ciência aos cálculos do poder. e os hormônios humanos. O equivalente tecnológico da separação dos saberes foi a linha de montagem. Está(ão) correta(s) a) apenas I. de 96. que. velocidade. como podeis ver. Nosso século é o da aceleração tecnológica e científica. se globalizou pra valer: meus filhos já aprenderam. b) O mercado europeu é resistente a este tipo de alimento.2 milhões de toneladas na safra 2002/03. especialmente durante a transcrição e a tradução. que podem transformar as águas em fontes de transmissão de doenças. Mas a linha de 86 . Não é um balanço tranqüilizador. NO PAIN. enfim. e) I. diria que. cada um é também liberado de qualquer responsabilidade. Segundo a "Folha de S. b) apenas II. apesar de todo esse avanço.. Mas o horror desses acontecimentos não reside apenas na quantidade. podendo acarretar o fim da espécie convencional. na prática. cerca de 8% da produção nacional da soja é biologicamente adulterada. por ser mutagênico. e) O desenvolvimento desta tecnologia poderá aumentar a produtividade em relação à tradicional. Foram necessários milhares de anos para passar do barco a remo à caravela ou da energia eólica ao motor de explosão. Privado da satisfação de ver o produto acabado.quase instantâneo. podem interferir no funcionamento dos seres vivos. E o inglês. Um excelente químico pode imaginar um excelente desodorante. Mas não sou. da hélice ao turborreator e daí ao foguete interplanetário. que podem ser exemplificados pelos esteróides. c) Pode haver cruzamento entre a cultura convencional e a geneticamente modificada.compostos orgânicos que. Se eu fosse um nostálgico. NO GAIN (ou GAME. (Argemiro Fonseca) A produção brasileira de grãos ultrapassou 115. II . cada um conhece apenas uma fase do trabalho. o sentido de outro SLOGAN prestigiado.

O Holocausto foi possível porque se podia aceitá-lo e justificá-lo sem ver seus resultados. presenciou o triunfo da ação à distância. quando picadas por abelhas. Eis porque nosso século foi o da angústia e da utopia de curá-la. Sem essa aceleração. Poderíamos destruir o planeta num dia. E rápido. Nosso século foi o da comunicação instantânea. especialmente por um grande número desses insetos. VEJA. Reflexões para o futuro. Encontramos o meio de eliminar a sujeira. Um exemplo ocorreu em 1987. (Adaptado de Umberto Eco. o Muro de Berlim poderia ter durado milênios. A ação à distância salva numerosas vidas. II e III e) II. Tudo o que aconteceu de terrível a seguir não foi se não repetição.As emissões radioativas introduziram energia nas células.A energia provocou alterações nos compostos químicos das células. tecnologia. 25 anos. O século do triunfo tecnológico foi também o da descoberta da fragilidade. Porque a sujeira nascia da indigência. castigo. b) choque anafilático. mas o sistema do computador não tem defesa diante da má intenção de um garoto precoce. princípio da linha de montagem: tudo isso tornou possível o Holocausto. em Goiânia. ação à distância. 87 . desconhecido dos séculos anteriores. Tudo se passa num ritmo acelerado. morte. que sofreram graves danos em conseqüência desse ato.montagem permite também fabricar aspirina em quantidade para o mundo todo. apresentarem uma reação alérgica à toxina desses animais. afinal restrito. aperta-se um botão e entra-se em comunicação com Pequim. tecnologicamente eficaz e buscou o consenso servindo-se das comunicações de massa e do prestígio da ciência. indignação. Ciência. Mas o que torna tão terrível o genocídio nazista é que foi rápido. Para tais conseqüências. nem como: somos demasiado poderosos para poder evitar nossos inimigos. que podia ser reduzida. o químico que aplicava os gases asfixiantes não julgava necessário ter opiniões sobre a antropologia física. mas não o de eliminar os resíduos. São Paulo. Se forem novamente picadas. crítica. II . Um moinho de vento podia ser reparado. vida mais longa. absolvição. tempo. deram-se as seguintes explicações: I . d) embolia. como a Grande Muralha da China. ao passo que os resíduos (inclusive os radioativos) nascem do bem-estar que ninguém quer mais perder. sem grande inovação. Dessas explicações. devolveram essa energia para o ambiente. onde foi abandonada uma cápsula contendo pó de Césio-137 e que foi aberta por pessoas desavisadas. Nosso século é o do enfarte.As células humanas estão adaptadas a receber energia com os comprimentos de onda do Césio-137. realizando cada qual um gesto que nada tinha de aterrador. mas pagamos o preço dessa rapidez. e) reforço do sistema imunológico. herdamos do passado o hábito de brandir a ameaça de um complô judeu para desviar o descontentamento dos explorados. o fato de certas pessoas. num regime de separação dos saberes. Assim. esquecimento.. Hoje. Aperta-se um botão e um país inteiro explode.As células reagiram e. de pessoas responsáveis e de executantes diretos (sádicos e loucos). nascimento. estão corretas SOMENTE a) I e II b) I e III c) II e IV d) I. É bom que tudo se tenha resolvido no espaço de trinta anos. c) choque térmico. O século está estressado porque não sabe de quem se deve defender. No texto. Foi fácil fazer passar por ciência uma teoria pseudocientífica porque. milhões de outros puderam colaborar à distância. IV . sob a forma de calor. 1993). crime. o autor menciona que não conseguimos eliminar os resíduos radioativos do ambiente. mas irresponsabiliza o crime. III . A perseguição racial e o genocídio não foram uma invenção de nosso século. como por exemplo. este século soube fazer do melhor de si o pior de si. Além de um número. arrependimento. Rápida Utopia. III e IV Questão 400 Apesar da "aceleração tecnológica e científica de nosso século" nem todos os problemas puderam ser solucionados. tudo em altíssima velocidade. informação. Espaço. comunicação.. descoberta. elas poderão apresentar uma reação denominada a) hemólise. A um ritmo de STRESS. Aperta-se um botão e um foguete é lançado a Marte.

O motorista está buzinando.Rr. Na primeira. Ciência em Dia.2003. b) a expressão do gene depende da presença de hormônios masculinos.rr. o seu filho nasceu normal e. uma forma de confirmar sua compatibilidade com as de Charlie. uma vez que na concepção de Jamie foram empregadas técnicas de fertilização in vitro.rr.. Questão 403 Quando a garçonete se aproximou. Mãe .3 88 .) Em relação ao texto.06.rr. d) Pai . Mãe . Como foi concebido por técnicas de fertilização "in vitro".5.rr.Rr. Isso ocorre porque a) o gene responsável pela calvície está no cromossomo Y. Nessa situação. Durante o trajeto. 1Ž Filho . 2Ž Filho . 2Ž Filho . "Já está na hora de voltar. Questão 402 O texto abaixo refere-se às questões: ** a ** Professor Astrogildo combinou com seus alunos visitar uma região onde ocorria extração de minério a céu aberto.Rr. O irmão de Jamie se chama Charlie e sofre de uma forma rara de anemia causada por anomalia genética. da mãe.Rr. pois as técnicas de fertilização in vitrojá são de total domínio e amplamente utilizadas pelos especialistas na área de reprodução humana. podemos afirmar que: a) ao fazer referência à técnica de fertilização in vitro e de escolha de genótipos de seres humanos. na segunda. d) a mulher só será careca se tiver os dois alelos recessivos. Jamie pôde ter suas células testadas no útero. pois não envolve escolha de genótipo de seres humanos.RR. Jamie é o que já está sendo chamado de "irmão salvador" pelos tablóides (jornais populares) do Reino Unido. depois de selecionado. Mãe . Folha de S. II.Rr. MAIS! 29. do primeiro e do segundo filhos seriam: a) Pai . se dá o desenvolvimento do feto. 1. uma vez que o embrião. 1Ž Filho .Rr. os genótipos do pai das crianças. c) não se trata de uma questão que envolva biotecnologia e bioética.Rr. M.8. Algumas das questões propostas por professor Astrogildo estão apresentadas a seguir para que você responda. b) Pai . c) a calvície é uma característica genética cuja herança é ligada ao sexo. a criança teve eritroblastose fetal.Questão 401 Jamie Whitaker mal nasceu e já se tornou celebridade. 2Ž Filho . é implantado no útero materno. c) Pai . b) o fato relatado. Ela o informou de que já era sua terceira gestação. e) não se pode associar a fertilização "in vitro" com biotecnologia ou com bioética. com a intenção de mostrar os efeitos ambientais produzidos por aquela atividade. de fato.. Questão 404 Aproveitando a pergunta de Zeca. Vamos!" A turma entrou muito animada no ônibus e Ariosvaldo percebeu que o motorista era calvo. Ariosvaldo refletiu e perguntou: "Professor. por que não se vê mulher careca?" O professor respondeu que a ocorrência de calvície em mulheres era muito rara. 2Ž Filho . professor Astrogildo perguntou-lhe se seria seu primeiro filho. em que os números I. Paulo. 1Ž Filho .RR. uma criança gerada para fornecer tecidos vivos para tentar salvar a vida de outro filho de seus pais. III e IV representam moléculas de ácidos nucléicos. d) o caso relatado não envolve problemas de bioética. nada tem a ver com aspectos de bioética. professor Astrogildo ia propondo desafios a partir das situações do dia-a-dia vivenciadas ao longo do passeio. embora envolva questões de biotecnologia. 1Ž Filho ..Rr.. (Leite.Rr. Mãe . o texto nos coloca diante de situações concretas de biotecnologia e de bioética.Rr. o professor esquematizou o processo de síntese protéica. onde.

as cinco cores serão possíveis. em um dia. c) gene da insulina está inativo. Questão 406 O texto abaixo refere-se às questões: ** a ** Em uma espécie de abelha. Questão 405 Zeca perguntou: "Professor. Iß.6 89 . da cor pérola. a) 1250 fêmeas. c) III corresponde ao RNA que contém o anticódon complementar ao códon existente em I. c) da cor marrom se forem fêmeas. Os indivíduos afetados apresentam a cor da urina vermelho pardacenta devido a uma alteração no metabolismo normal da fenilalanina. e) da cor marrom ou pérola. b) II corresponde ao RNA que catalisa a união do I com o III. d) da cor marrom ou pérola. d) cromossomo com o gene da insulina não está presente. (zero) machos c) 1000 fêmeas. b) cromossomos não têm o gene da insulina. se forem machos. Essa rainha produziu. durante o processo de transcrição. pérola (20%). as cinco cores serão possíveis. nas fêmeas. b) O somente das cores marrom ou pérola. para a qual o tipo sangüíneo de cada um dos membros está indicado. Assinale a alternativa da tabela que indica corretamente o número esperado de descendentes dessa rainha. foi inseminada por espermatozóides provenientes de machos com olhos das cores marrom (20%). creme (20%) e amarelo (20%). é correto afirmar que a) I corresponde ao RNA que contém o código genético determinando a seqüência de aminoácidos da proteína. nos machos. por que as células alfa desse mesmo órgão não assumem esta função?" A síntese da insulina não ocorre nas células alfa porque o(s) a) gene da insulina está defeituoso. neve (20%). d) IV corresponde ao RNA que catalisa a ligação dos nucleotídeos com a desoxirribose.5. heterozigótica para pérola. 625 machos e) 500 fêmeas. se forem machos. onde também encontramos os genes que determinam os grupos sangüíneos ABO ( IÞ. O gene determinante dessa disfunção está localizado no cromossomo 9. Todos os gametas produzidos resultaram em descendentes. e. O heredograma a seguir foi montado para se estudar a disfunção em uma determinada família. Questão 408 O texto abaixo refere-se às questões: ** a ** A alcaptunúria é uma disfunção extremamente rara do metabolismo humano. entre os quais há a seguinte relação de dominância: a¢ > a£ > a¤ > a¥ >a a¢ : marrom a£ : pérola a¤ : neve a¥ : creme a : amarelo Uma rainha de olhos marrons. 250 machos d) 625 fêmeas.partir do esquema. se forem fêmeas. i ). 1. a cor dos olhos é condicionada por uma série de cinco alelos. já que as células beta do pâncreas de um diabético não são capazes de sintetizar insulina. (zero) machos b) 1000 fêmeas. e. 1 250 gametas dos quais 80% foram fecundados. 500 machos Questão 407 Os descendentes dessa rainha terão olhos a) somente da cor marrom.

b) O indivíduo 3 pode ter recebido um gameta recombinante de sua mãe.. e persistindo nos pronúcleos resultantes os mais aptos. b) 45% de A normais. 90 . em diferentes ambientes. A freqüência de recombinação entre os dois loci gênicos é de 10%. EXCETO: a) A alcaptonúria é um caráter determinado por gene autossômico recessivo. Questão 409 (Darwin. c) O indivíduo 6 certamente não recebeu um gameta recombinante da sua mãe ou do seu pai. terá uma melhor oportunidade de sobrevivência e. apud FREIRE-MAIA. lutam entre si. os inferiores. d) A chance de o indivíduo 9 ser heterozigoto para o caráter alcaptonúria é de 2/3. que se ocupa do aperfeiçoamento físico e mental da espécie humana. perigosamente em alta em países desenvolvidos da Europa. pode-se dizer: (01) As "plantas que permanecem constantes" ao longo das gerações são homozigotas.nalisando-se o heredograma. Questão 410 O texto abaixo refere-se às questões: ** a ** Na(s) questão(ões) a seguir escreva nos parênteses a soma dos itens corretos. (32) Variações referidas por Darwin transmitem-se à descendência segundo o padrão mendeliano de herança. está representada para o indivíduo 7 ao lado do heredograma. os mais fortes.. segue-se que qualquer organismo que varia de modo proveitoso para si próprio. como na citação: "Os cromossomos. no par de cromossomos 9. (16) O trabalho de Darwin afirma a constância genética do mundo biológico. é possível afirmar.) os determinantes (. conseqüentemente. (Mendel.. assim. formam sementes das quais a metade novamente desenvolve a forma híbrida. EXCETO: a) 22." (Kehl apud BIZZO. se sustenta em premissas incorretas. (.5% AB normais. São freqüências esperadas de descendentes para o cruzamento 6 X 7.) se entrechocam. 2 .traduzido) TEXTO II: Os híbridos. selecionam-se. enquanto a outra metade produz plantas que permanecem constantes e recebem os caracteres dominantes e recessivos em partes iguais.5. p. há uma freqüente luta pela existência. eliminando-se com o glóbulo polar os mais fracos. pode-se afirmar: (01) A subordinação aos princípios mendelianos reduz a variabilidade nas espécies que se reproduzem sexuadamente. (08) A seleção natural pode preservar características diferentes. Soma ( ) 1. exemplificadas nos textos. TEXTO I: Como muito mais organismos de cada espécie nascem do que provavelmente sobrevivem e como.. de cada par de caracteres diferenciais. p. que violam princípios sociais e admitem conceitos biológicos errôneos. (04) A citação de Mendel expressa a proporção genotípica 1:2:1. esperada em F2. apud DARNELL. c) 50% de afetados. sob condições de vida complexas e algumas vezes variáveis. d) 50% B normais ou afetados. de ser "naturalmente selecionado". p. Questão 411 A idéia da eugenia. (02) A herança de um caráter é determinada pela fusão dos fatores condicionantes na descendência.6 posição ocupada pelos alelos que determinam grupo sangüíneo e alcapatonúria. 1117) Em relação às idéias de Darwin e de Mendel. 30) Considerando-se os princípios biológicos que regem a herança.

seja por atuarem como traçadores radioativos. (16) Os genes que condicionam o "xeroderma pigmentosum" são característicos de células epidérmicas. extrema sensibilidade à luz solar. p. as mutações ocorrem naturalmente e têm uma grande importância evolutiva porque a) geram a variabilidade sobre a qual a seleção natural pode agir. em que são considerados básicos alguns conceitos de genética. No entanto. resultando em alta freqüência de câncer de pele. vêm sendo efetuadas com certa facilidade e segurança através do uso de técnicas apropriadas. atingindo sua prole.(02) A segregação dos cromossomos homólogos. Sobre esses conceitos. c) permitem a origem de novas espécies cada vez melhor adaptadas.adaptação) Uma análise da situação apresentada anteriormente permite afirmar: (01) Agentes mutagênicos incluem fatores físicos que alteram a estrutura da molécula de DNA. (04) A condição genética dos indivíduos com "xeroderma pigmentosum" é determinada pela exposição à radiação ultravioleta. (64) As repercussões da eugenia em populações humanas descartam sua aplicação para qualquer fim. principalmente na face. (08) Os fatores genéticos se misturam e se diluem ao longo das gerações. adquiridas por indivíduos de uma geração. condição genética autossômica recessiva. Alguns desses pacientes também desenvolvem anormalidades neurológicas. que parecem resultar da morte prematura de células nervosas. engenharia. julgue os itens. hidrologia. b) geram as adaptações. exercem importante papel na sociedade atual. (16) A aplicação de princípios eugênicos comprometeria a sobrevivência da espécie humana. (32) A ocorrência de alterações em células nervosas e em células epidérmicas pode estar relacionada à sua origem embriológica comum. O temor da população em relação aos radioisótopos relaciona-se à capacidade desses elementos produzirem mutações nos seres vivos. apresentam. ( ) Genes alelos são genes que ocupam o mesmo "locus" gênico em cromossomos homólogos. Soma ( ) o processo evolutivo. Questão 414 Questão 412 Indivíduos portadores da doença "xeroderma pigmentosum". Estudos genéticos em células de organismos afetados revelam a existência de defeitos no sistema enzimático responsável pelo reparo de moléculas de DNA danificadas pela exposição a agentes mutagênicos. ( ) Na espécie humana distinguem-se 3 tipos sangüíneos. na primeira divisão meiótica. (32) Alterações do fenótipo. ( ) Cariótipo é o conjunto de informações sobre os cromossomos de uma determinada espécie. 307-8 . 91 . (64) A precisão dos sistemas de reparo do DNA inviabiliza Na(s) questão(ões) a seguir julgue os itens e escreva nos parênteses (V) se for verdadeiro ou (F) se for falso. em células epidérmicas. como também a identificação da paternidade. (08) A morte prematura de células nervosas resulta dos efeitos do acúmulo de lesões na molécula de DNA. indústria. que permitem a sobrevivência das espécies. antropologia e à pesquisa acadêmica em diversas áreas do conhecimento. (GARDNER. e os indivíduos do grupo sangüíneo AB são considerados doadores universais. São hoje praticamente indispensáveis à medicina. (04) O efeito de um determinado gene depende do ambiente em que ele é expresso. e) são o único processo evolutivo agindo atualmente no homem. é aleatória. como a dos trilobitas. A elucidação de crimes. repercutem além dela. apesar de temidos pela população que os associa a acidentes nucleares e danos ambientais. Soma ( ) Questão 413 Os radioisótopos. ( ) Um dos catalisadores do processo de duplicação do DNA é a enzima DNA polimerase. ou como fontes de radiações. d) são responsáveis por extinções em massa. (02) A falha em mecanismos celulares que preservam a fidelidade da mensagem genética predispõe ao câncer.

terá filhos apenas do grupo sangüíneo O. (04) Indivíduos heterozigotos para duas características produzem quatro tipos de gametas. ou polimeria. alterando-o. (02) 3/16 dos descendentes desse cruzamento terão olhos normais e com pigmentação clara. Para tanto. Soma ( ) Questão 417 Um canil. casando-se com um homem doador-universal. uma criança hemofílica nascida de pais normais só poderá ser do sexo feminino. compreenderão como as espécies se inter-relacionam. (04) Herança ligada ao cromossomo sexual. que lhes servirá de guia. apresentaram as mesmas características dos pais. Desse cruzamento resultaram oito filhotes que. é correto afirmar que: (01) 9/16 dos descendentes desse cruzamento terão olhos normais e com pigmentação escura. Feito um cruzamento entre dois indivíduos duplamente heterozigóticos. Observou-se. onde verão um maravilhoso ecossistema. ou seja. fixando aleatoriamente alguns genes. os genes de um par agem combinando-se com outro par (ou outros pares). quando necessário. entretanto. e quais as conseqüências disso. Ele dispõe de material para ilustrar. essa atividade de campo. que. (08) Estes problemas envolvem a Segunda Lei de Mendel. escolheu dois irmãos de uma ninhada e os cruzou. "Lei da Segregação Independente dos Caracteres". Sabe-se que o gene A está em um cromossomo e B em outro. Vocês estão convidados a fazer um passeio numa área de Mata Atlântica. Fiquem tranqüilos: vocês estão preparados. comportamentos. e o passeio será muito proveitoso. À luz dos conhecimentos de genética. se reproduzem e como se dão alguns fenômenos biológicos nos seres que vivem ali e até naqueles que visitam esse ambiente. um experiente pesquisador. verão de perto a diversidade da fauna e da flora. e adaptações na Mata Atlântica. dos oito cãezinhos. escreva no espaço apropriado a soma dos itens corretos. Soma ( ) . soma = ( ) Questão 418 O texto abaixo refere-se às questões: ** a ** Caros candidatos. (08) Segregação monogênica dominante. vocês estarão em contato com a natureza. é correto afirmar que: (01) Uma planta de sementes brancas. autofecundada. a fim de condicionar um determinado fenótipo. (02) Efeito genético da consangüinidade. (04) 4/16 dos descendentes nascerão sem olhos. pois Ribossomildo só lhes dará informações cientificamente corretas. enquanto seu alelo recessivo determina a cor escura. é grande a variabilidade de espécies. na sua maioria. 92 Questão 416 Com base nos estudos de Genética.Questão 415 O texto abaixo refere-se às questões: ** a ** Na(s) questão(ões) a seguir. Um outro gene B dominante determina a pigmentação clara do olho. Vocês terão a oportunidade de verificar de que maneira o homem pode interferir nesse meio. ou seja. dois nasceram cegos. efeitos nocivos que podem surgir devido a genótipos recessivos produzidos através do cruzamento entre indivíduos aparentados. contarão com a companhia de Ribossomildo. (16) Deriva genética. especializado na criação de dálmatas. reduzindo o vigor da ninhada. (16) Sendo a hemofilia uma anomalia condicionada por um gene recessivo ligado ao sexo. (02) Uma mulher do grupo sangüíneo A cuja mãe é do grupo O. esse fato pode ser explicado porque houve: (01) Heterose. (32) Semiletalidade. Nesse passeio. Também serão convocados a responder a questões básicas no campo da Biologia. Vamos lá?!!! Como você já devem ter percebido. Imagine uma espécie animal na qual um gene A determina a formação do olho e seu alelo recessivo determina a ausência de olhos. (08) Na interação gênica. será heterozigota para o caráter se entre os seus descendentes aparecerem alguns com sementes amarelas e outros com sementes brancas.

ele apresenta a figura abaixo. a formação de quiasma eleva a probabilidade de ocorrência de mutação dos genes. a segregação independente dos cromossomos contribui para o aumento da diversidade dos gametas. sabemos que outros povos. Questão 419 Ribossomildo diz: Vejam quantos folhas novas. italianos e de outros povos. Diante da relevância do contexto e da vontade de valorizar o nosso povo nativo. Assinale a alternativa que completa corretamente a lacuna. No entanto.8.2. Considere que a característica baixa estatura é dominante sobre a característica porte elevado e que apenas um loco gênico está envolvido na determinação da estatura das plantas.. protagonizaram a nossa história. a) Na figura I. a migração das cromátides-irmãs para pólos opostos eleva a recombinação gênica. Questão 420 A história da maioria dos municípios gaúchos coincide com a chegada dos primeiros portugueses. quantos filhotes de animais! O que deve estar ocorrendo no interior das células desses seres. b) Na figura II. que lhes permite crescer?! Para facilitar a resposta a essa pergunta. alemães. 93 . que ilustra um dos eventos imprescindíveis ao processo de crescimento dos organismos. 1. B." Variedades de milho cultivadas pelos indígenas são usadas hoje em cruzamentos. c) Na figura I. se os indivíduos cruzados forem homozigotos para esse loco gênico. 2004). "Da Amazônia vieram os tupis-guaranis. etapas da divisão celular como as representadas nas figuras abaixo justificam essa variabilidade.1 ssinale a opção correspondente ao evento representado na figura. A.1 1. a) replicação do DNA b) transcrição de RNA transportador c) tradução de RNA mensageiro d) síntese das proteínas arque a opção em que se relaciona adequadamente a figura ao evento biológico.Essa variabilidade fenotípica está relacionada à constituição genética do indivíduo e pode ser observada até dentro da mesma espécie. "o índio". trazendo contribuições à nossa cultura. com o objetivo de melhorar a produção de grãos. IPHAN. Santa Cruz do Sul: EDUNISC. ensinando a plantar diferentes espécies e a usar plantas frutíferas e medicinais. foi selecionada a área temática CULTURA e as questões foram construídas com base na obra "Os Primeiros Habitantes do Rio Grande do Sul" (Custódio. através dos vestígios materiais encontrados nas pesquisas arqueológicas. Segundo Ribossomildo.5. d) Na figura II. L.5. a permutação entre cromossomos heterólogos aumenta a variabilidade genética. organizador. O resultado para a F1 de um cruzamento de plantas com baixa estatura X plantas com estatura elevada será _________________________. anteriores aos citados.

5. No entanto. . d) citrulina. 1 e 3. não deficiente em qualquer uma das enzimas. 3 e 2. sais minerais. Considere as seguintes afirmativas: I . o sinal . arginina e ornitina. Questão 423 Quando as células do corpo humano se multiplicam. arginina e ornitina. 2 e 3. A linhagem D é o tipo selvagem. o qual pode ser determinado pela perda da inibição por contato nas células.indica que não houve crescimento. Questão 422 1. III . se algumas células mutantes se tornam invulneráveis elas podem se multiplicar. respectivamente. não necessariamente nessa ordem. B e C são deficientes. constituído de água. arginina e citrulina. Os compostos X.O comportamento celular descrito na última frase do texto é chamado metástase. para as enzimas a) 1. 3 e 1.A inativação dos oncogenes é uma das condições essenciais para que as células citadas no texto se multipliquem desordenadamente. ornitina e arginina. Assinale a opção que contém a(s) afirmativa(s) 94 1. O fungo utiliza esses elementos como precursores para a síntese de vários compostos. podem provocar alterações genéticas nas células. II . açúcar e uma vitamina. citrulina e arginina.5. c) 2. alcançando um número razoável de células e estabelecendo uma rede de vasos sangüíneos que passa a alimentá-las. Após essa fase várias dessas células podem cair na corrente sangüínea e invadir outros órgãos. determinado assim uma acentuada queda na sobrevida do indivíduo. O esquema na figura 2 apresenta os resultados obtidos quando essas diferentes linhagens foram colocadas para crescer em diferentes meios de cultura.5 As linhagens A. tais como radiações solares e agrotóxicos. respectivamente.5 As letras X.a) 100% com estatura elevada b) 100% com estatura baixa c) 1/2 com estatura elevada e 1/2 com estatura baixa d) 1/4 com estatura elevada e) 3/4 com estatura elevada Questão 421 O texto abaixo refere-se às questões: ** a ** O tipo selvagem do fungo Neurospora é capaz de crescer em um meio de cultura simples. e) arginina. tal como na via biossintética representada na figura 1.8. 1 e 2. b) ornitina. Y e Z correspondem. O sinal + indica que houve crescimento do fungo.Agentes ambientais. cada uma delas deficiente em uma das enzimas participantes dessa via biossintética. e) 3. citrulina e ornitina. b) 1. Um pesquisador obteve três diferentes linhagens desse fungo. c) citrulina.8. Y e Z correspondem à citrulina. aos compostos a) ornitina. espera-se que aquelas produzidas com defeitos sejam destruídas pelo sistema imunológico. d) 2. tornando-as invulneráveis à ação do sistema imunológico.

verdadeira(s). a) Apenas I e II. b) Apenas I e III. c) Apenas II e III. d) Apenas III. e) I, II, III. Questão 424 A síntese protéica envolve um complexo de estruturas celulares que trabalham harmonicamente, como mostra o esquema adiante.

1.1.4

1.1.3.2

Segundo a tirinha, a amiga de Calvin tem DOIS CROMOSSOMOS X. Com base neste dado podemos concluir que: a) a amiga de Calvin é mutante, por isso é hostil. b) um cromossomo X da amiga de Calvin é ativo e o outro é chamado de cromatina sexual. c) a heterocromatina ocorre em Calvin, pois ele é XY. d) os dois cromossomos X de que Calvin fala é da cobra que quer comê-lo. e) não há cromatina sexual em meninas. Questão 426

Com base no esquema e em conhecimentos correlatos, julgue os itens a seguir. (0) O esquema mostra a síntese protéica em uma célula procariótica. (1) Os tipos de RNA necessários para a síntese protéica em procariotos e eucariotos são essencialmente diferentes. (2) Na expressão de um gene eucariótico, a transcrição e a tradução ocorrem simultaneamente. (3) Uma molécula de RNAm pode ser utilizada para a síntese concomitante de várias moléculas da proteína. Questão 425 Leia com atenção a tirinha a seguir:

Qual das alternativas se refere a um cromossomo? a) Um conjunto de moléculas de DNA com todas as informações genéticas da espécie. b) Uma única molécula de DNA com informação genética para algumas proteínas. c) Um segmento de molécula de DNA com informação para uma cadeia polipeptídica. d) Uma única molécula de RNA com informação para uma cadeia polipeptídica. e) Uma seqüência de três bases nitrogenadas do RNA mensageiro correspondente a um aminoácido na cadeia polipeptídica. Questão 427 Quando afirmamos que o metabolismo da célula é controlado pelo núcleo celular, isso significa que a) todas as reações metabólicas são catalisadas por moléculas e componentes nucleares. b) o núcleo produz moléculas que, no citoplasma, promovem a síntese de enzimas catalisadoras das reações metabólicas. c) o núcleo produz e envia, para todas as partes da célula, moléculas que catalisam as reações metabólicas.
95

d) dentro do núcleo, moléculas sintetizam enzimas catalisadoras das reações metabólicas. e) o conteúdo do núcleo passa para o citoplasma e atua diretamente nas funções celulares, catalisando as reações metabólicas. Questão 428 Considere uma espécie de vertebrado cujas células embrionárias têm oito cromossomos. Em quantos grupos de ligações seus genes estarão associados? a) Dois. b) Quatro. c) Oito. d) Dezesseis. e) Número variável. Questão 429 A ilustração representa o cariótipo humano que permite determinar o número e a forma dos cromossomos.

Questão 431 Os cromossomos são constituídos principalmente por: a) fosfolipídeos. b) proteínas. c) ácido ribonucléico. d) enzimas. e) ácido desoxirribonucléico. Questão 432 A cromatina sexual compreende: a) o citoplasma de células gaméticas masculinas que se apresentam mais coradas que as femininas. b) o citoplasma de células gaméticas femininas que se apresentam mais coradas que as masculinas. c) cromossomo Y condensado em núcleos de hemácias humanas. d) um dos cromossomos X da mulher, que permanece condensado no núcleo das células, facilmente visualizado na mucosa oral. e) cromossomos X e Y condensados durante o período da interfase. Questão 433 Responder à questão com base no cariótipo (conjunto de cromossomas) humano representado abaixo.

1.1.4

Analisando-se a figura, é correto concluir que se refere a um indivíduo portador da síndrome de a) Klinefelter. b) Patau. c) Turner. d) Down. Questão 430 A presença de cromatina sexual predominante em número de células femininas está relacionada a cromossomos: a) Y inativos b) X inativos c) autossômicos inativos d) autossômicos que não se dividiram e) autossômicos agregados

1.1.4

cariótipo é de um indivíduo do sexo com síndrome de __________. a) feminino - Klinefelter b) masculino - Klinefelter c) masculino - Down d) feminino - Turner e) masculino - Turner

96

Questão 434 Numere a coluna inferior, relacionando-a com a superior. Indivíduos: 1 - 45, X 2 - 46, XX 3 - 49, XXXXX 4 - 49, XXXXY 5 - 47, XXX Quantidade de cromatinas sexuais (corpúsculos de Barr) ( ) quatro ( ) duas ( ) nenhuma ( ) uma ( ) três Assinale a opção que apresenta a seqüência correta de numeração. a) 2, 4, 1, 3, 5 b) 3, 5, 1, 2, 4 c) 2, 3, 1, 4, 5 d) 3, 2, 1, 4, 5 e) 2, 1, 3, 4, 5 Questão 435

Analisando o desenho esquemático que representa o núcleo de uma célula animal qualquer, podemos identificar que o componente responsável pela síntese de RNA que forma o ribossomo é assinalado pelo número: a) 1 b) 2 c) 3 d) 4 e) 5 Questão 436 Muitas vezes, durante a realização de eventos esportivos, é realizada a determinação do sexo genético. Este exame é feito pela observação dos cromossomos de células epiteliais. Pode-se afirmar que neste exame a) mulheres normais deveriam apresentar uma estrutura chamada corpúsculo de Barr, que corresponde a um dos cromossomos X. b) homens normais deveriam apresentar uma estrutura chamada corpúsculo de Barr, que corresponde ao cromossomo Y. c) mulheres normais deveriam apresentar duas estruturas chamadas corpúsculos de Barr, que correspondem aos dois cromossomos X. d) homens normais deveriam apresentar uma estrutura chamada corpúsculo de Barr, correspondente ao cromossomo X. e) mulheres normais na fase adulta não deveriam apresentar corpúsculo de Barr. Questão 437

1.1.4

Analise o esquema a seguir, o qual mostra o mecanismo de ação de algumas drogas antimitóticas que inibem a progressão a partir dos pontos indicados.

1.1.5.1

97

Assinale a afirmativa INCORRETA. a) A puromicina não tem qualquer efeito sobre o crescimento ou multiplicação celular. b) A mitomicina não permite a ocorrência da fase 5 do ciclo celular. c) Pelo menos duas das drogas interferem diretamente na síntese protéica. d) Nem todos os tipos de nucleotídeos sofrem ação da droga arabinosilcitosídeo. Questão 438 A figura a seguir representa _______________ , que ocorre na _______________ e tem como conseqüência _______________.

1.1.5.2

1.1.5.2

( ) O número de gametas AB deverá ser idêntico ao de gametas ab. ( ) A freqüência de gametas recombinantes deverá ser igual a de gametas não-recombinantes. ( ) Trezentos e sessenta gametas não- recombinantes são esperados. ( ) Vinte gametas recombinantes são esperados no caso descrito. ( ) A taxa de recombinação no caso citado é de 10%; logo, os locos A e B distam de 10 unidades de mapa. Questão 440 "Devo, finalmente, chamar a atenção para a possibilidade do pareamento dos cromossomos paternos e maternos, e sua subseqüente separação durante a divisão reducional, constituírem as bases físicas das leis de Mendel" (Walter S. Sutton, 1902). O que Sutton achava possível sabe-se, hoje, ser verdade, isto é: I. os genes estão localizados nos cromossomos. II. dois ou mais genes localizados no mesmo cromossomo são herdados, na maioria dos casos, em gametas diferentes. III. dois ou mais genes localizados em cromossomos diferentes segregam de maneira independente. Sobre as afirmativas acima, pode-se dizer que: a) somente III está correta. b) I e II estão corretas. c) II e III estão corretas. d) I e III estão corretas. e) somente II está correta.

A alternativa que preenche correta e respectivamente os espaços anteriores é: a) o crossing-over; metáfase da mitose; a variabilidade genética. b) o pareamento de cromátides-irmãs; anáfase I da meiose; a troca de genes alelos. c) o crossing-over; prófase I da meiose; a variabilidade genética. d) a segregação de cromossomos homólogos; anáfase I da meiose; a formação de células haplóides. e) o pareamento de cromossomos homólogos; metáfase da mitose; a formação de gametas. Questão 439 Analise as proposições abaixo, considerando a seguinte situação: Em uma amostra de 100 (cem) espermatogônias, de um organismo genotipicamente (AB//ab), ocorreu permutação meiótica entre os locos A e B, em 20 (vinte) espermatogônias, tendo sido observada uma segregação gamética como ilustrado na figura abaixo.

98

Questão 441

Questão 443 Quanto aos cromossomos sexuais X e Y, podemos afirmar que: a) como não são completamente homólogos, não se pareiam na meiose. b) como são completamente homólogos, pareiam-se na meiose. c) se pareiam na meiose, pois possuem uma região homóloga. d) não se pareiam na meiose, pois possuem uma região não homóloga. e) os genes que se encontram na região não homóloga do X condicionam um tipo de herança chamado herança restrita ao sexo. Questão 444 As variações das cargas elétricas das moléculas das proteínas W, X, Y e Z, em função do pH do meio, estão representadas no gráfico a seguir.

1.1.5.2

AMABIS e MARTHO. "Fundamentos da Biologia Moderna". São Paulo: Moderna, 1997. p. 499. A figura representa a a) mitose e explica a separação dos cromossomos durante a divisão. b) meiose e explica a segregação independente dos genes previstos pela segunda lei de Mendel. c) mitose e explica a segregação dos genes demonstrando a dominância e a recessividade. d) meiose, que é um processo de formação de gametas mas que não tem nenhuma relação com as leis de Mendel. e) mitose, que é um processo de divisão celular mas que não tem nenhuma relação com as leis de Mendel. Questão 442 Os gatos possuem 38 cromossomos, com o sistema XX/XY de determinação sexual. No desenvolvimento embrionário de fêmeas, um dos cromossomos X é inativado aleatoriamente em todas as células do organismo. Em gatos domésticos, a pelagem de cor preta (dominante) e amarela (recessiva) são determinadas por alelos de um gene localizado no cromossomo X. Fêmeas heterozigóticas para cor da pelagem são manchadas de amarelo e preto. Um geneticista colocou um anúncio oferecendo recompensa por gatos machos manchados de amarelo e preto. A constituição cromossômica desses gatos é a) 37, YO. b) 37, XO. c) 38, XX. d) 39, XXY. e) 39, XXX.

1.1.7.3

molécula do DNA, em pH fisiológico, apresenta carga elétrica negativa, devido a sua natureza ácida. No núcleo celular, ela está associada a proteínas, de caráter básico, denominadas histonas. De acordo com o gráfico, a proteína que apresenta propriedades compatíveis com as de uma histona é a representada pela seguinte letra: a) W b) X c) Y d) Z

99

Questão 445 Considere a rota metabólica que produz o aminoácido arginina na figura adiante.

grupamentos amina e hidroxila. Questão 447 O metabolismo celular depende de uma série de reações químicas controladas por enzimas, isto é, proteínas que atuam como catalisadores e que podem sofrer mutações genéticas sendo modificadas ou eliminadas. Assinale a alternativa correta, levando em conta os ácidos nucléicos, a ocorrência de mutações e as conseqüentes mudanças do ciclo de vida da célula. a) O DNA é constituído por códons, que determinam a seqüência de bases do RNA mensageiro, necessária à formação dos anticódons, responsáveis pela produção das proteínas. b) No caso de uma mutação acarretar a transformação de um códon em outro relacionado ao mesmo aminoácido, não haverá alteração na molécula protéica formada, nem no metabolismo celular. c) A mutação altera a seqüência de aminoácidos do DNA, acarretando alterações na seqüência de bases do RNA mensageiro e, conseqüentemente, na produção das proteínas. d) As mutações atuam diretamente sobre as proteínas, provocando a desnaturação dessas moléculas e, conseqüentemente, a inativação delas. e) Quando algumas proteínas são alteradas por mutações, suas funções no metabolismo celular passam a ser realizadas pelos aminoácidos. Questão 448 Organelas citoplasmáticas que contêm DNA: a) mitocôndria e ribossomo. b) mitocôndria e cloroplasto. c) nucléolo e cloroplasto. d) lisossomo e ribossomo. e) ribossomo e cromossomo. Questão 449 A hipótese de que os cloroplastos e as mitocôndrias tenham surgido através de uma associação simbiótica de um eucarioto primitivo com, respectivamente, bactérias fotossintetizantes e bactérias aeróbicas, é reforçada pelo fato daquelas organelas celulares: a) serem estruturas equivalentes, com grande superfície interna.
100

1.1.7.3

Em um experimento, três linhagens de bactérias foram irradiadas com raios X, que causaram mutações nos genes envolvidos na rota metabólica acima representada. Para descobrir quais enzimas da rota metabólica foram afetadas, as três linhagens foram cultivadas em meios suplementados com ornitina, citrulina e arginina, obtendo-se o resultado mostrado na tabela acima: Sobre esse experimento, podemos afirmar que a) o gene que codifica a enzima 1 na linhagem I foi afetado. b) o gene que codifica a enzima 2 na linhagem I foi afetado. c) o gene que codifica a enzima 3 na linhagem II foi afetado. d) o gene que codifica a enzima 1 na linhagem II foi afetado. e) o gene que codifica a enzima 3 na linhagem III foi afetado. Questão 446 Além de serem as macromoléculas mais abundantes nas células vivas, as proteínas desempenham diversas funções estruturais e fisiológicas no metabolismo celular. Com relação a essas substâncias é CORRETO afirmar que: a) são todas constituídas por seqüências monoméricas de aminoácidos e monossacarídeos. b) além de função estrutural, são também as mais importantes moléculas de reserva energética e de defesa. c) cada indivíduo produz as suas proteínas, que são codificadas de acordo com o seu material genético. d) a sua estrutura terciária é determinada pela forma, mas não interfere na sua função ou especificidade. e) são formadas pela união de nucleotídeos por meio dos

É correto prever que. b) 19 cromossomos duplicados e 38 moléculas de DNA. c) nucléolos e nas mitocôndrias. nos cloroplastos e nas mitocôndrias. Questão 456 É como se em cada quarto de um imenso prédio existisse uma estante contendo os planos do arquiteto para todo o prédio. d) apresentarem tilacóides e cristas como as bactérias. e) recombinação entre genes ativados. depois de mantidas em meio de cultura contendo uracila marcada. Questão 455 O gato doméstico ('Felis domestica') apresenta 38 cromossomos em suas células somáticas.. No núcleo do óvulo normal de uma gata são esperados: a) 19 cromossomos simples e 19 moléculas de DNA. Questão 454 Uma bactéria.b) apresentarem DNA próprio.6 . b) presença de carioteca envolvendo os componentes do núcleo celular. e) ATGCACCT. Questão 453 A seqüência de nucleotídeos ATGCACCT forma um segmento de DNA dupla hélice ao se ligar à fita complementar a) AUGCACCU. tanto do ponto de vista estrutural como funcional.) No homem. os planos do arquiteto montam 46 101 1. Questão 450 "Captura aminoácidos que se encontram dissolvidos no citoplasma e carrega-os ao local da síntese de proteínas". Essa função é desempenhada pelo a) RNA mensageiro. um fungo e uma samambaia apresentam em comum a) produção de glicose através da utilização de energia solar. encontre-se uracila radioativa SOMENTE nos a) nucléolos. b) UACGUGGA. d) indução de mutações específicas. Questão 451 Células vegetais. d) TCCACGTA. e) 19 cromossomos duplicados e 19 moléculas de DNA.. b) ribossomos.1. para comprovar os locais que possuíam esse material. c) expressão diferencial dos genes. d) ribossomo. Ao longo do processo de diferenciação das células do mesmo organismo ocorre a) duplicação de alguns genes. c) RNA ribossômico. e) produção de ATP no interior de plastos. foram fixadas e submetidas à autoradiografia. e) DNA. d) 38 cromossomos simples e 19 moléculas de DNA. e) ribossomos. (. d) ribossomos e nos cloroplastos. b) RNA transportador.7. e) serem encontradas tanto em organismos superiores como inferiores. respectivamente. c) TACGTGGA. c) utilização de oxigênio no interior de mitocôndrias. no citoplasma. b) perda dos genes não expressos. Questão 452 A célula muscular cardíaca e a esquelética têm a mesma origem porém são diferentes. c) 38 cromossomos simples e 38 moléculas de DNA. d) presença de DNA como material genético. c) estarem envolvidas. na produção e consumo de oxigênio.

5 amostra: 20% de guanina e 30% de citosina Entre estas amostras. Questão 459 Cinco amostras com ácidos nucléicos foram analisadas quimicamente e apresentaram os seguintes resultados: I . podemos afirmar que os códons 5 e 6 codificam. para o qual existe apenas uma trinca de codificação. se chega a um códon de parada (V). Nessa analogia. I. O RNAm no citoplasma. que: a) somente I é verdadeira. Histonas são proteínas relativamente pequenas que se ligam fortemente ao RNA. quais se referem a DNA? a) Apenas I e II. de modo correto. um segundo RNAt (III).7. o RNAt do primeiro aminoácido é liberado (IV) no citoplasma. e) somente II e III são verdadeiras. d) Apenas II e IV. ou para a metionina ou para o triptofano. para os quais não há aminoácido correspondente. b) Apenas I e III. acerca dos elementos constituintes do núcleo celular eucariótico. se liga ao ribossomo. Sabendo-se que os códons 5 e 6 trazem a informação para um mesmo aminoácido. Cada cromossomo possui uma única molécula de DNA. Questão 460 Neste ano de 2003. ( ) Na etapa seguinte da tradução. UUA ou GUA. ( ) O aminoácido metionina (I) é trazido ao ribossomo pelo RNAt cujo anticódon é UAC (II). e) Apenas II e V. onde se dá a produção de cadeias peptídicas. Os nucléolos podem atuar na síntese de carboidratos que migram do núcleo para o citoplasma. na leitura da mensagem genética. Considerando esse tema. UAG ou UGA. analise a figura e as proposições a seguir. d) somente I e III são verdadeiras. transcrevendo a seqüência de bases de uma cadeia de DNA. II. ao papel que ela desempenha nos seres vivos e aos processos em que se encontra envolvida é CORRETO afirmar que: 102 1. são comemorados os 50 anos da "descoberta" da estrutura tridimensional do DNA. ( ) 61 códons correspondem aos aminoácidos que compõem as proteínas.2 amostra: timina III . Questão 458 A molécula de RNAm é sintetizada no núcleo.3 amostra: dupla hélice IV. encaixa-se no sítio destinado à entrada de aminoácidos na cadeia peptídica. complementar ao códon AUG do RNAm. proposta por Richard Dawkins no livro "O gene egoísta". cujo anticódon é complementar ao segundo códon do RNAm geralmente onde há uma trinca UAA. Pode-se afirmar.1. Com relação às características dessa molécula. ( ) O final da tradução ocorre quando. III. UUG. b) somente II é verdadeira. cada página de cada volume contém um texto formado por uma seqüência de: a) fenótipos b) aminoácidos c) cromossomos d) bases nitrogenadas Questão 457 Analise as afirmativas a seguir.6 .volumes. c) somente I e II são verdadeiras. ( ) Quando se estabelece uma ligação peptídica entre os dois primeiros aminoácidos.4 amostra: uracila V . a saber.1 amostra: ribose II . c) Apenas II e III.

porque agora se sabe toda a seqüência de nucleotídeos dos cromossomos humanos. d) Duas cadeias simples de DNA formam uma dupla-hélice. embora em baixa freqüência. A informação presente no RNA pode ser transformada em uma seqüência de aminoácidos. da maneira como foi veiculada. porque agora se sabe toda a seqüência de genes dos cromossomos humanos. e) errada. A informação. d) apenas I. b) correta. (16) A mensagem nela contida pode ser transcrita para uma outra molécula denominada RNA. ela fica estocada dentro do núcleo das células. III e IV. e) apenas II. durante os processos de replicação. III. através do processo denominado tradução. está a) correta. As proteínas e os ácidos nucléicos são formados por aminoácidos. assinale a alternativa CORRETA: a) Uma cadeia simples de DNA é constituída de nucleotídeos. (32) Nos organismos procariontes. b) A polimerização de uma fita simples de DNA é dita semiconservativa. c) Os nucleotídeos são polimerizados por meio de ligações fosfodiéster entre o fosfato e a base nitrogenada. 103 . d) na transcrição e na tradução. transcrição e tradução do DNA. e) As duas cadeias de uma dupla-hélice possuem a mesma orientação. (64) Em alguns organismos primitivos. apenas. porque não é possível decifrar todo o código genético.(01) É formada por duas fileiras de nucleotídeos torcidas juntas em forma de hélice. por serem herdáveis. as conseqüências desses erros podem ser mais graves. apenas. c) na replicação e na transcrição. b) na replicação. a finalização do Projeto Genoma Humano foi noticiada por vários meios de comunicação como sendo a "decifração do código genético humano". e suas seqüências de bases são complementares. Questão 461 Analise as afirmativas: I. Questão 464 Em abril de 2003. através do processo denominado transcrição. c) errada. A informação contida no DNA pode ser copiada em uma fita de RNA. Questão 462 Este ano comemorou-se 50 anos da publicação do trabalho de Francis Crick e James Watson. c) apenas II e III. pois independe da existência de uma fita molde. (04) Ela tem a capacidade de se autoduplicar. apenas. d) errada. a citosina. DNA e RNA são os ácidos nucléicos encontrados tanto em células eucariontes como procariontes. Entretanto. IV. não as proteínas que eles codificam. III e IV. Questão 463 Erros podem ocorrer. b) apenas I e II. que estabeleceu o modelo da estrutura da molécula de ácido desoxirribonucléico (DNA). compostos por uma desoxirribose ligada a um fosfato e a um aminoácido. por meio da formação de pontes de hidrogênio entre as bases nitrogenadas. ela apresenta apenas uma fileira de nucleotídeos. e) em qualquer um dos três processos. II. (02) Em sua composição é possível encontrar quatro bases nitrogenadas diferentes: a adenina. apenas. porque o Projeto decifrou os genes dos cromossomos humanos. o aminoácido e a proteína. (08) Nela está contida a informação genética necessária para a formação de um organismo. porque o código genético diz respeito à correspondência entre os códons do DNA e os aminoácidos nas proteínas. Está(ão) correta(s) a) apenas I. quando ocorrem a) na transcrição. Dentre as afirmativas abaixo. existem regiões cromossômicas com alta taxa de mutação.

DIZ ESTUDO. Qualquer resistência às doenças infecciosas (de caráter hereditário). haveria adaptação genética a resistência a muitas doenças.4% de identidade entre os genes humanos e de chimpanzés.4% de identidade. b) Os genótipos que produzem pouca ou nenhuma resistência se tornariam comuns. a comparação da seqüência de DNA de 97 genes comuns de humanos e de chimpanzés revelou 99. d) a formação de um girino normal a partir do ovo. conferiria vantagem seletiva a uma família. c) a formação de um clone de células não diferenciadas. terão algum impacto no curso da evolução humana. c) Seqüências de DNA que podem ser expressas como proteínas apresentaram maiores semelhanças que as seqüências não codificadoras.4% dos genes apresentam a mesma seqüência de DNA. A diferença nos percentuais de identidade dos dois estudos se deve ao fato de que em 1998 foi estudado o DNA não-codificante. em 21/05/2003. mais pessoas se tornariam independentes de procedimentos médicos. Questão 468 O gráfico mostra a variação dos números de indivíduos do tipo original e do tipo mutante. (Fonte: "Folha de S. uma vez que o núcleo injetado contém toda a informação (DNA) necessária à formação do girino. Questão 466 CHIMPANZÉ TAMBÉM É "GENTE".) Tendo em vista o texto apresentado. Alguns cientistas dos EUA afirmam que os chimpanzés (Pan troglodites) são geneticamente tão parecidos com os homens que deveriam ser incluídos no gênero Homo. Questão 467 Descobertas recentes na medicina e na saúde pública. como o sarampo e a difteria.Questão 465 Ao se injetar o núcleo de uma célula diferenciada de uma rã em um ovo de outra rã.6% de diferenças pode contribuir para entendermos como. d) A longo prazo. removidos durante a diferenciação. uma vez que o núcleo injetado não possui alguns genes. não fertilizado e cujo núcleo tenha sido removido. de construir prédios e de fazer pesquisa científica. c) A longo prazo. a) As espécies Homo sapiens e Pan troglodites surgiram há 6 milhões de anos. uma vez que o núcleo injetado não contém determinados genes. que até o momento tem o Homo sapiens como único representante vivo. que não faz parte das seqüências que podem ser transcritas e traduzidas.Paulo". Na realidade. se aplicadas consistentemente. b) a morte da célula-ovo. Estudar estes 0. os efeitos da imunização em massa sobre a freqüência da resistência ou susceptibilidade inata às doenças. a) A freqüência dos alelos que conferem resistência inata às doenças seria aumentada. e) Não haveria alteração alguma na freqüência desses alelos. uma vez que o núcleo injetado proveniente da célula diferenciada contém DNA cuja composição de bases nitrogenadas é diferente da célula-ovo. nos 6 milhões de anos que separam a evolução do homem e do chimpanzé de um ancestral comum. Assinale a alternativa que mostra. Mais recentemente. ocorrerá: a) a morte da célula-ovo. d) Os 97 genes comuns são os responsáveis pela diferenças entres seres humanos e chimpanzés. 104 . A idéia surgiu pela primeira vez em 1998 quando a análise de seqüências de DNA de humanos e de chimpanzés revelou 98. removidos durante a diferenciação. ao longo de 100 anos. assinale a afirmativa CORRETA. corretamente. b) 99. em uma mesma área de floresta. e) a expulsão do núcleo injetado por meio de exocitose realizada pela célula-ovo. apenas um deles desenvolve a capacidade de compor música. biologicamente não somos tão diferentes dos chimpanzés como muitos crêem.

HIS .VAL . IV e V.LEU espécie C: MET .ARG .PHE .GLU .7 análise do gráfico permite concluir que: a) o tipo original permanece melhor adaptado ao longo do período analisado.LEU . e) após 50 anos. e a forma PY. o tipo mutante passou a parasitar o tipo original. resultante de mutação no gene que codifica P.ALA ALA . o procedimento correto é analisar a prole resultante do cruzamento desta mosca com outra de: a) asa vestigial. d) fenótipo igual ao seu.1.ARG .ARG .ARG .GLU .LEU espécie B: MET .LEU .LEU .VAL . ocorre em três formas diferentes: a forma P. Para determinarmos se uma mosca de asa longa é homozigota ou heterozigota quanto ao par de genes que condicionam este caráter. a forma PX.HIS . III. II. Indique a alternativa que mostra as proteínas encontradas nos grupos de animais I a V. d) a partir de 50 anos.LEU .4.ARG .4. e) fenótipo dominante.ALA . presente em praticamente todos os animais.ALA.Questão 470 A seguir estão representadas três seqüências de aminoácidos de proteínas retiradas de diferentes espécies (A.ARG ALA .GLU .PHE .HIS .ALA ARG . c) a mudança de ambiente provocou alteração nas freqüências gênicas. 1. Questão 469 Um determinado tipo de proteína. a árvore filogenética que melhor expressa o parentesco evolutivo entre as três é: 1.ARG .4.LEU .VAL .ARG . b) de asa longa.PRO .PRO . deixa de existir o efeito de dominância do alelo para o tipo original sobre aquele para o tipo mutante.10 105 . resultante de mutação no gene que codifica PX.PRO .1. A ocorrência dessas mutações pôde ser localizada nos pontos indicados pelos retângulos escuros na árvore filogenética.ARG . B e C). 1. b) o tipo original e o tipo mutante estão igualmente adaptados à mesma área de floresta.PHE .10 Questão 471 Moscas de asas longas cruzadas entre si fornecem moscas com asas vestigiais. espécie A: MET . com base na forma da proteína presente nos grupos de animais I.1. c) genótipo igual ao seu.LEU Admitindo-se um ancestral comum para as três espécies.

o albinismo é causado por um gene autossômico recessivo. determine a porcentagem de descendentes com o fenótipo igual ao do pai.Questão 472 1. sendo a anomalia determinada por um gene recessivo e de 50% a probabilidade de o casal n¡.5.1 esquema anterior mostra uma experiência com um coelho himalaia. e) de um caso de herança ligada ao cromossomo Y e de 50% a probabilidade de o casal n¡. c) expressividade de um gene. d) penetrância de um gene. d) de um caso que pode ser tanto de herança ligada ao sexo como de herança autossômica. A mudança ocorrida na coloração do pêlo em função da queda de temperatura demonstra o efeito da: a) norma de reação. a) 0% b) 25% c) 50% d) 75% e) 100% 106 . 2 ter um descendente com a anomalia. Questão 475 Sabendo-se que o albinismo é um caráter recessivo. sendo a anomalia causada por um gene recessivo e de 75% a probabilidade de o casal n¡. b) exclusivamente de um caso de herança autossômica. mas heterozigota.1. e) alteração do genótipo pelo ambiente. Questão 473 Na espécie humana. com uma mulher de igual genótipo. sendo a anomalia determinada por um gene recessivo e impossível o casal n¡. 3 ter um descendente com a anomalia. sendo a anomalia causada por um gene dominante e de 75% a probabilidade de o casal n¡. 2 ter um descendente com a anomalia.1 1. é possível afirmar que se trata a) exclusivamente de um caso de herança ligada ao sexo. resultantes do casamento de um homem heterozigoto para esse fator. 3 ter um descendente com a anomalia. b) mutação gênica. A probabilidade do primeiro filho de um homem albino casado com uma mulher normal. ser albino e do sexo masculino é: a) nula b) 25 % c) 50 % d) 75 % e) 100 % Questão 474 A incidência de determinada anomalia foi investigada nos indivíduos da espécie humana representados no heredograma a seguir: Sabendo-se que os símbolos escuros representam portadores da anomalia. c) de um caso que pode ser tanto de herança ligada ao sexo como de herança autossômica.1.5. 2 ter um descendente do sexo masculino com a anomalia.

e) pode estar num cromossomo ou num autossomo.1. Questão 481 Um gato preto (A) foi cruzado com duas gatas (B e C) também pretas. o cruzamento do gato A com a gata C produziu 6 filhotes pretos e 2 amarelos.Questão 476 Num homem heterozigoto para determinado caráter. Questão 478 Sabe-se que o casamento consangüíneo. Essa expressão significa que a) o ambiente altera o genótipo do indivíduo. d) genótipo depende do fenótipo e do meio ambiente. A e C são homozigotos. b) a cor preta é dominante.1 107 . todos pretos. c) o fenótipo do indivíduo é o resultado da expressão de seu genótipo em um dado ambiente. recessivo. e) a cor preta é recessiva. e) genótipo depende dos genes. A e C são homozigotos. e) o fenótipo do indivíduo é invariável e resulta da expressão de seu genótipo. b) o genótipo do indivíduo é o resultado da ação do ambiente sobre seu fenótipo. em qualquer que seja o ambiente. Esta mudança indica que o: a) fenótipo depende do ambiente. dominante. entre indivíduos que são parentes próximos. João e Maria. d) pode estar no cromossomo X ou no Y. c) fenótipo depende do genótipo e do meio ambiente. b) genótipo depende do ambiente. d) o genótipo do indivíduo pode variar como resultado da expressão de seu fenótipo em diferentes ambientes. Questão 482 Dois genes alelos atuam na determinação da cor das sementes de uma planta: (A). b) está no cromossomo Y. ou seja. determina a cor púrpura e (a). O cruzamento do gato A com a gata B produziu 8 filhotes. Questão 480 Pedro e seus filhos. B e C são heterozigotos. A tabela a seguir apresenta resultados de vários cruzamentos feitos com diversas linhagens dessa planta: 1. resulta numa maior freqüência de indivíduos com anomalias genéticas. visando à sua adaptação. Não há outros afetados na família. A e B são homozigotos. A análise desses resultados permite concluir que: a) a cor preta é dominante. d) a cor preta é recessiva. uma expressão bastante conhecida diz que fenótipo é o genótipo mais o ambiente.5. A e C são heterozigotos. a porcentagem provável de espermatozóides que conterão o gene recessivo desse caráter é de: a) 0% b) 25% c) 50% d) 75% e) 100% Questão 477 Algumas variedades de canários mudam de cor dependendo da alimentação que recebem. Esse gene: a) está no cromossomo X. determina a cor amarela. têm uma doença determinada por um gene dominante. c) a cor preta é dominante. c) está num autossomo. Isso pode ser justificado pelo fato de os filhos apresentarem: a) maior probabilidade de heterozigoses recessivas b) maior probabilidade de homozigozes recessivas c) menor probabilidade de heterozigoses dominantes d) menor probabilidade de homozigoses dominantes e) menor probabilidade de homozigoses recessivas Questão 479 Na genética.

portanto. Vv x Vv III. É correto afirmar que a) seus pais podem ser fenotipicamente normais. c) dois óvulos D e dois óvulos d. Esses resultados sugerem que a cor dessas mariposas é 108 . c) genótipos e fenótipos iguais. Questão 486 Qual a porcentagem de descendentes Aa nascidos de uma mãe Aa? a) 25% b) 50% c) 75% d) 100% e) depende do pai. e) 1% dos indivíduos da população têm deficiência da enzima E. casada com um portador de doença genética de herança autossômica dominante. b) quatro óvulos D e quatro óvulos d. cor escura. Vv x vv Um pé de ervilha. Questão 488 Uma mulher normal. que determina cor verde. produz vagens com sementes amarelas e com sementes verdes. b) o mesmo fenótipo e genótipos diferentes. está grávida de um par de gêmeos.2. sabendo que V representa o gene que determina cor amarela dos cotilédones e é dominante sobre o alelo v. na maioria das vezes. c) apenas do cruzamento III. e) apenas um óvulo D ou um óvulo d. heterozigoto e que. as plantas que ficaram no escuro estavam estioladas o que significa que os dois grupos apresentam: a) o mesmo genótipo e fenótipos diferentes. Entre os possíveis gametas formados por essa ovogônia. VVx vv II.presentam genótipo (Aa) as linhagens: a) I e III b) II e III c) II e IV d) I e IV e) III e IV I Questão 483 Considere os seguintes cruzamentos para ervilha. respectivamente. d) a freqüência do alelo a é 0. descendentes claros e escuros. c) a freqüência do alelo a é 0. Depois de alguns dias. d) genótipos e fenótipos diferentes. d) apenas um óvulo Dd. Questão 485 Considere uma ovogônia de uma mulher heterozigota para o par de alelos Dd. II e III. e) genótipos variados em cada grupo. b) apenas do cruzamento II. podemos encontrar: a) quatro óvulos Dd. d) apenas dos cruzamentos II e III. e) dos cruzamentos I. I. gêmeos monozigóticos ou dizigóticos? a) 25% e 50% b) 25% e 75% c) 50% e 25% d) 50% e 50% e) 50% e 75% Questão 489 Em uma população de mariposas. Questão 484 Dois grupos de mudas obtidas a partir de um mesmo clone de plantas verdes foram colocados em ambientes diferentes: um claro e outro escuro. 96% dos indivíduos têm cor clara e 4%. Questão 487 De uma população de 100 camundongos foi retirado ao acaso um indivíduo com deficiência da enzima E. Já os cruzamentos entre indivíduos claros produzem sempre apenas descendentes de cor clara. pode resultar a) apenas do cruzamento I. b) seus pais são certamente heterozigotos. caráter condicionado por um alelo recessivo a. Indivíduos escuros cruzados entre si produzem.1. Qual é a probabilidade de que pelo menos um dos gêmeos venha a ser afetado pela doença no caso de serem.

que não apresentam dominância um sobre o outro. d) depende de características congênitas. Questão 494 Moscas de coloração acinzentada cruzadas entre si fornecem moscas de cor preta.100. publicado em 1866.50 b) AA . c) independe da presença de seu alelo. b) cor cinza. Mendel representou os fatores hereditários determinantes dos estados amarelo e verde do caráter cor da semente pelas letras A e a.100 d) AA . Mendel ao enunciar essa lei já admitia. sendo o alelo para cor escura dominante sobre o que condiciona cor clara. d) genes. c) núcleos. c) um aminoácido em uma proteína. sobre seu estigma. Mendel fez fecundações cruzadas. meiose. Questão 490 Uma população experimental contém 200 indivíduos AA. Aa . pólen recolhido da flor de uma planta homozigótica de baixa estatura. c) um par de alelos. b) um par de alelos. Questão 495 "Cada caráter é condicionado por um par de fatores que se separam na formação dos gametas". o procedimento correto é analisar a prole resultante do cruzamento dessa mosca com outra de a) cor preta. o pesquisador a) impediu o amadurecimento dos gametas femininos. b) trouxe gametas femininos com alelos para baixa estatura.200.400.condicionada por a) um par de alelos. d) uma trinca de bases do RNA mensageiro. aa . Questão 493 Dizemos que um determinado gene é recessivo quando sua expressão (fenótipo): a) só acontece em heterozigose. b) um segmento de DNA com informação para um RNA ribossômico. mitose. 200 aa e 200 Aa. mitose. b) só ocorre quando em dose dupla.100. Para determinarmos se uma mosca cinza é homozigota ou heterozigota quanto ao par de genes que condicionam esse caráter. b) núcleos. Aa . Questão 492 Em plantas de ervilha ocorre. espera-se encontrar entre os filhotes: a) AA . e) fenótipo dominante.500. removendo as anteras da flor de uma planta homozigótica de alta estatura e colocando. respectivamente. aa .200 e) AA .800. aa .100 Questão 491 Em seu trabalho com ervilhas.200. e) impediu o encontro de gametas com alelos diferentes para estatura. c) genótipo igual ao seu. Para estudar os mecanismos de herança. como a coloração dos troncos onde elas pousam. d) dois genes ligados com alta taxa de recombinação entre si. aa . c) trouxe gametas masculinos com alelos para baixa estatura.50. Aa . d) fenótipo igual ao seu. d) promoveu o encontro de gametas com os mesmos alelos para estatura. O conhecimento atual a respeito da natureza do material hereditário permite dizer que a letra A usada por Mendel simboliza a) um segmento de DNA com informação para uma cadeia polipeptídica. Com esse procedimento. Aa . Todos os indivíduos AA foram cruzados com indivíduos aa e os indivíduos Aa foram cruzados entre si. autofecundação. embora sem conhecer. 109 . Considerando que cada casal produziu 2 descendentes. normalmente. meiose. respectivamente: a) cromossomos. e) fatores ambientais. aa . e) genes. e) reproduz uma característica provocada pelo ambiente. a existência das seguintes estruturas e processo de divisão celular. mitose.200. Aa .100 c) AA . e) uma trinca de bases do RNA transportador. sendo o alelo para cor clara dominante sobre o que condiciona cor escura.1000.

o número esperado de indivíduos com asas e sem asas será. o pêlo pode ser preto ou marrom. por exemplo. b) A proporção fenotípica em F1 é de 3/4 de indivíduos irregulares e de 1/4 de indivíduos regulares. a) 6. Se os 120 descendentes com asas forem cruzados com moscas sem asas e se cada cruzamento originar 100 indivíduos. em que um único par de alelos é responsável por três características fenotípicas: cor das flores. b) Os indivíduos pretos de F eram homozigotos. produzindo uma F composta por indivíduos marrons e pretos em igual quantidade.000 b) 6. assinale a alternativa INCORRETA. em alguns casos.5.000 e 3. c) Todos os F1 com nervuras irregulares são heterozigotos. a) 50% dos indivíduos pretos de F‚ eram heterozigotos. e) Os indivíduos F1 de nervuras regulares só podem ser homozigotos. A partir desses resultados.000 e) 12. assinale a alternativa correta. Cruzando-se plantas de estames de cor púrpura com plantas de estames verdes. então a porcentagem de descendentes com estames verdes será de: a) 25% b) 50% c) 75% d) 0 e) 100% Questão 497 Em porquinhos da Índia. originou-se uma F1 composta por plantas com nervuras regulares e outras com nervuras irregulares. surgirão indivíduos regulares e irregulares na proporção 1:1.000 c) 8. d) Todos os indivíduos marrons eram homozigotos. obteve-se uma geração F composta apenas de indivíduos com estames de cor púrpura. d) Se um indivíduo F1 com nervuras regulares for cruzado com um indivíduo da geração P. 1. Retrocruzando-se um macho preto de F com a fêmea parental.000 e 4. Isso ocorre.000 d) 9. Do cruzamento entre duas plantas com nervuras irregulares.000 e 3.Questão 496 Em tomates. o padrão das nervuras foliares pode ser regular ou irregular. Questão 499 Do cruzamento de duas moscas com asas nasceram 120 descendentes com asas e 40 sem asas.000 e 4. cor das sementes.000 e 6.000 Questão 500 Em genética. Questão 498 Em uma determinada planta. Uma fêmea preta foi cruzada com um macho marrom. o estame pode ser de cor púrpura ou verde. c) Todos os indivíduos pretos de F‚ eram heterozigotos. presença ou ausência de manchas nas axilas foliares. 75% dos filhotes produzidos em F‚ tinham pêlo preto e 25% apresentavam pêlo marrom.1. e) Os indivíduos pretos da geração F eram heterozigotos e a fêmea parental era homozigota. respectivamente. A partir desses dados. com ervilhas. a) As plantas cruzadas são heterozigotas. Se esses indivíduos forem retrocruzados com os parentais de estames verdes. um único par de alelos determina mais de uma característica no organismo.1 110 . Esse fenômeno é conhecido como: a) herança aditiva b) poligenia c) pleiotropia d) codominância Questão 501 Analise o heredograma para um fenótipo recessivo esquematizado a seguir e assinale a afirmativa INCORRETA.

5. EC e CC. de acordo com o esquema a seguir. homozigoto e aa. há um caráter mendeliano com co-dominância e genótipos EE. d) amarelo com planta de bulbo incolor não produz plantas com bulbo roxo. Questão 505 1. d) Aa. II. dominante. recessivo. a proporção Em uma certa espécie de mamíferos. heterozigotos e AA. que a enzima E2 transforma em roxo. Em I não há registro da presença do vírus X e em II ele é transmitido por contato com as presas da espécie. dominante. As duas enzimas são codificadas por genes alelos dominantes com segregação independente. é INCORRETO afirmar que o cruzamento de plantas de bulbo: a) incolor com planta de bulbo incolor só pode originar fenótipo incolor. pois os genótipos serão: a) 1/2 AA e 1/2 aa b) 1/4 AA. se transforma em um pigmento amarelo. os animais de genótipo CC são mais facilmente capturados pelos predadores. 111 ." No trecho acima.1 Analisando as informações apresentadas de acordo com os seus conhecimentos.1. uma homozigota para o alelo dominante (AA) e uma homozigota para um alelo recessivo (aa). heterozigotos e aa. fenotípica mendeliana 3:1 aparecerá na geração F2. b) haverá igual chance de adaptação de animais com os três genótipos apenas na região I. Pode-se prever que a) haverá igual chance de adaptação de animais com os três genótipos nas duas regiões. d) Se um dos pais é heterozigoto. o alelo recessivo pode ser herdado por descendentes fenotipicamente normais. por: a) AA. e) aa. toda a descendência da primeira geração (F1) assemelha-se ao tipo parental dominante (Aa). dominante. b) AA.a) As pessoas afetadas possuem pelo menos um dos pais obrigatoriamente afetado. c) Aa. as lacunas I. recessivo. amarelos ou roxos. que chamaremos de E1. Questão 502 Os bulbos da cebola podem ser brancos. homozigoto e Aa. que apresentam genótipo __(I)__ podem ter filhos albinos. c) O fenótipo ocorre igualmente em ambos os sexos. Porém. sob a ação de uma enzima. III e IV devem ser preenchidas correta e. Questão 503 Quando duas populações da espécie vegetal 'Zea mays' (milho). respectivamente. Nesses vegetais. Questão 504 "Casais de pigmentação da pele normal. c) roxo com planta de bulbo roxo pode produzir todos os três fenótipos mencionados. O gene para o albinismo é __(II)__ e não se manifesta nos indivíduos __(III)__. heterozigotos e aa. Sabe-se que animais heterozigóticos são mais resistentes a um dado vírus X do que os homozigóticos. b) amarelo com planta de bulbo amarelo não produz plantas com bulbo roxo. quando a geração F1 se intercruza. são cruzadas. c) haverá maior número de animais com genótipos EE e CC do que com genótipo EC na região I. Nos dois ambientes. b) Aproximadamente 1/4 das crianças de pais não-afetados pode ser afetado. 1/2 AA e 1/4 aa e) É impossível determinar os genótipos utilizando os dados acima. onde há predadores naturais da espécie. São albinos apenas os indivíduos de genótipo __(IV)__. 1/2 Aa e 1/4 aa c) 1/3 AA e 1/4 aa d) 1/4 Aa. Animais com os três genótipos foram introduzidos em duas regiões diferentes designadas por I e II. embora seja heterozigota. existe um precursor incolor que.

numa proporção de 3 descendentes vermelhos para cada branco (3:1).Fenótipo IV . associando os conceitos aos respectivos termos. II.Crossing-over III . Qual é a probabilidade de um casal de acondroplásicos. II. Animais com cauda longa foram cruzados repetidas vezes entre si originando sempre descendentes com cauda longa. que já tem uma menina normal. V e IV c) II.bastante numerosa. e) o genótipo dos descendentes difere do dos pais. pode-se afirmar que a produção genotípica da F desse cruzamento experimental foi: a) 4 Aa b) 2 Aa : 2 aa c) 3 AA : 1 Aa d) 1 AA : 2 Aa : 1 aa Questão 510 Numere a segunda coluna de acordo com a primeira. ( ) conjunto de genes organizados nos cromossomos.F . a proporção fenotípica esperada na prole será de a) 3 pretos :1 branco b) 2 pretos :1 branco c) 1 preto : 3 brancos d) 1 preto : 2 brancos e) 1 preto :1 branco Questão 509 Sabe-se que a transmissão hereditária da cor das flores conhecidas como copo-de-leite se dá por herança mendeliana simples. Questão 508 Em cobaias. ( ) atuam sobre a mesma característica.Genoma II . I . os cientistas constataram que apenas um em cada três descendentes vermelhos era homozigoto para essa característica. Em um cruzamento experimental de copos-de-leite vermelhos. A partir desses dados. Se esses descendentes pretos forem cruzados entre si.Gene ( ) troca de fragmentos de cromossomos homólogos na primeira divisão da meiose. I. III e V e) I. obteve-se uma primeira geração . e) a seleção natural será mais favorável aos animais com genótipo EE na região II. b) o caráter é dominante. a acondroplasia é uma anomalia determinada por um gene autossômico dominante. ( ) segmento do DNA capaz de transcrever uma molécula de RNA. De acordo com tais dados. c) os animais cruzados eram homozigotos. d) os animais cruzados eram heterozigotos.d) a seleção natural será mais favorável aos animais com genótipo EC na região II. quando cruzados entre si. só é possível concluir que a) o caráter é recessivo. mas não são obrigatoriamente iguais. III. também só originaram filhotes de cauda longa. I.Alelo V . I. IV e III b) III. V. Os descendentes. Um cruzamento-teste de um indivíduo de cor preta produziu descendentes brancos e pretos em igual número. numa dada espécie. I. V e IV d) IV. vir a ter um menino acondroplásico? a) 1 b) 3/4 c) 3/8 d) 1/4 e) 1/8 Questão 507 Considere que o comprimento da cauda. com dominância completa. ( ) conjunto de características detectáveis de um indivíduo. IV e III 112 . Analisando o genótipo da F. a cor preta do pêlo é condicionada por um alelo dominante e a cor branca. pelo alelo recessivo. Questão 506 No homem. V. seja condicionado por um par de alelos. A seqüência correta é: a) II. II.

c) Y. 100% de mudas altas ao cruzar mudas altas em P1 com mudas médias em F2. 100% de mudas altas ao cruzar mudas altas em P1 com mudas altas em F2. Concluiu-se com relação a estas proposições que: a) Apenas a 2. 2 .Um homem calvo (homozigoto) transmite a característica da calvície a todos os filhos homens nascidos de seu casamento com uma mulher não calva. A fase da meiose. obtendo F1 que ao serem fenótipos resultantes dos cruzamentos foram representados nos gráficos a seguir: upondo que as plantas altas. a 3 e a 4 são corretas. III.5. b) X. 1. realizou-se cruzamento entre mudas altas e baixas das duas espécies (P1). Muitas vezes esse melhoramento lança mão do conhecimento da herança genética de um determinado carácter como. Questão 513 No que se refere ao desenvolvimento do chamado milho híbrido. 100% de mudas altas ao cruzar mudas altas em F2.poderiam apresentar mudas com alturas diferentes. Assinale: a) se somente I e II estiverem corretas. tanto da espécie X quanto da espécie Y. cada um atua e segrega independentemente dos demais. b) Apenas a 1. Questão 514 Considere as proposições seguintes.Uma mulher será calva se seus pais forem calvos e se sua mãe (heterozigota) possuir um de seus genitores calvo. d) se somente II e III estiverem corretas. há também uma necessidade crescente de alimentos. b) taxa de crossing-over. a 3. mas na maioria dos casos é claramente hereditária. e) ocorrência de pleiotropia. e) Y. d) Y. a 3 e a 4 são corretas. 3 . a 2 . e) se I. a altura. c) Apenas a 1. por exemplo. Supondo-se que duas espécies vegetais . c) freqüência de genes em heterozigose. a 2 e a 3 são corretas. sabe-se que o cruzamento de duas linhagens homozigotas selecionadas pode produzir espigas maiores e de melhor qualidade comercial. I. d) Apenas a 1. responsável pela ocorrência da Segunda Lei de Mendel. 100% de mudas altas ao cruzar as mudas médias em F2. é a Anáfase I.X e Y .1 113 .1.Questão 511 Considere as seguintes proposições: 1 . 5 . II. O enunciado da Primeira Lei de Mendel diz que os alelos de um gene separam-se durante a formação dos gametas. c) se somente I estiver correta. em conseqüência da alta a) interação de genes recessivos. b) se somente I e III estiverem corretas. e) Apenas a 2. a 3 e a 4 são corretas. II e III estiverem corretas. sejam mais produtivas. Questão 512 Com o enorme crescimento populacional. 50% de mudas altas ao cruzar as mudas altas em F1.Em nenhuma hipótese a calvície ocorre na mulher. a 4 e a 5 são corretas.A calvície é dominante no sexo masculino 4 . O enunciado da Segunda Lei de Mendel diz que quando dois ou mais genes estão envolvidos.A calvície pode ser originada por causas ambientais. podese afirmar que se obtém na espécie: a) X e na espécie Y. por se tratar de herança ligada ao sexo. o que estimula a obtenção de culturas vegetais com máxima produtividade. d) inativação de alelos codominantes.

c) O alelo dominante do gene se expressa em cor verde.5. e) Os indivíduos que apresentam vagens de coloração verde em F‚ são heterozigotos. Se Mendel utilizasse como genitor masculino as plantas de flores púrpuras e como feminino.1 a) 100% de flores brancas. Questão 517 Quando Mendel cruzou plantas de ervilha apresentando vagens de coloração verde com plantas de vagens de coloração amarelas. Na segunda geração (F‚) obteve 428 verdes e 152 amarelas. Questão 518 A coloração das flores de ervilha é determinada por herança autossômica. d) à ocorrência de genótipos diferentes em uma população. mutantes. b) à segregação do par de alelos durante a formação dos gametas. apresentam asas normais. b) As plantas com vagens verdes ou amarelas da geração parental devem ser homozigotas. e) 100% de flores de coloração rósea. Todas as alternativas apresentam conclusões a partir desses resultados. c) 75% de flores púrpuras e 25% de flores brancas. os descendentes obtidos em F1 apresentariam 1. b) um cruzamento de dois genitores homozigotos contrastantes. d) 50% de flores púrpuras e 50% de flores brancas. c) à ocorrência de fenótipos diferentes em uma população. b) a influência do ambiente na expressão do genótipo. e) um caráter controlado por dois ou mais genes. as plantas de flores brancas. EXCETO: a) A expressão do alelo recessivo do gene desaparece apenas em F. c) um cruzamento de dois genitores heterozigotos. b) 100% de flores púrpuras.1.1. 1. criadas em temperatura de 25°C. Questão 516 A primeira Lei de Mendel refere-se a) ao efeito do ambiente para formar o fenótipo. d) O caráter é controlado por um par de genes. d) a separação de um par de alelos durante a formação dos gametas. quando criadas em temperatura de 16°C. d) o processo de seleção natural.5. A figura a seguir representa um dos cruzamentos realizados por Mendel entre plantas de ervilhas com flores púrpuras e plantas com flores brancas. Questão 519 Esta figura representa o cruzamento de drosófilas de asas normais com indivíduos de asas enroladas.Questão 515 A primeira lei de Mendel ou lei da segregação significa: a) um cruzamento onde se considera apenas um gene. Questão 520 Analise esta tabela: MÉDIA DAS DIFERENÇAS NAS CARACTERÍSTICAS ENTRE GÊMEOS MONOZIGÓTICOS E DIZIGÓTICOS 114 .1 s moscas de genótipo igual ao do tipo III. e) à união dos gametas para formar o zigoto. obteve na primeira geração (F) todos os descendentes de coloração verde. c) a transmissão dos caracteres adquiridos. O resultado desse fenômeno ilustra a) a adaptação dos mutantes. representado por dois alelos.

1.1 Com base nas informações desse gráfico e em outros conhecimentos sobre o assunto. om base nos dados dessa tabela e em outros conhecimentos sobre o assunto. b) antes de atingirem a idade de 15 anos. c) aos 30 anos. Analise este gráfico.1 1. filhos de casais Aa × aa têm 50% de probabilidade de manifestar a doença.1.1 115 . podem ser transmitidas de pai para filho. d) aos 40 anos. em que se mostra o percentual de indivíduos doentes entre aqueles que possuem genótipo favorável: 1. cerca de 85% dos indivíduos heterozigotos já manifestaram a doença. Os indivíduos afetados são heterozigotos.5. d) o comprimento da cabeça apresenta maior influência ambiental. a surdez congênita e a esclerótica azulada. c) a influência ambiental pode ser avaliada em gêmeos MZ. ocorrem em todas as gerações. convulsões e morte. a) Ligação genética b) Penetrância completa c) Pleiotropia d) Herança quantitativa e) Polialelia Questão 523 A presença de sardas em seres humanos é uma característica hereditária determinada por um par de alelos.5.5. Questão 521 O mal de Huntington é uma doença autossômica dominante caracterizada por deterioração mental progressiva.1. é CORRETO afirmar que a) o peso é a característica que apresenta maior influência genética. a) em torno dos 65 anos. é INCORRETO afirmar que. e só pessoas com sardas podem ter filhos com sardas (veja no heredograma abaixo). indivíduos portadores do alelo mutante podem expressar a doença. Assinale a alternativa que define o caso. As sardas aparecem igualmente em homens e em mulheres.1. Questão 522 Na espécie humana há um gene que exerce ação simultaneamente sobre a fragilidade óssea. b) as diferenças entre gêmeos MZ indicam diferenças genéticas entre eles. aproximadamente 75% dos indivíduos Aa se apresentam sem os sinais clínicos da doença.

Quais os genótipos dos pais. dispersão dos filhotes ainda jovens. (16) A freqüência fenotípica numa prole numerosa será 3:1. Da união de um homem acondroplásico com uma mulher normal resulta um filho normal. Machos e fêmeas sentem-se atraídos por odores de linhagens não relacionadas. é possível deduzir que a) a presença de sardas se deve a um alelo recessivo ligado ao cromossomo Y. Soma ( ) Questão 526 Cheiros e odores corporais fazem parte do aparato de comunicação em várias espécies de mamíferos. é correto afirmar: (01) O cruzamento entre indivíduos geneticamente diferentes. d) a presença de sardas se deve a um alelo autossômico recessivo. (16) Um indivíduo híbrido é aquele que resulta da união entre dois indivíduos geneticamente diferentes. (08) O endocruzamento não interfere no valor adaptativo. Em relação aos descendentes deste último casamento e ao caráter em questão. considerando ausência de mutação.1.1 116 . origina descendentes homozigotos. (02) O cruzamento entre indivíduos geneticamente diferentes.abendo disso. (32) Numa prole numerosa. b) a presença de sardas se deve a um alelo recessivo ligado ao cromossomo X. da mesma espécie. Questão 524 Uma ovelha branca ao cruzar com um carneiro branco teve um filhote de cor preta. (04) O endocruzamento pode causar uma redução no valor adaptativo pela maior probabilidade de ocorrência de genótipos ou combinações homozigotas de alelos recessivos deletérios. Soma ( ) 1. c) a presença de sardas se deve a um alelo dominante ligado ao sexo. por exemplo. reconhecimento da prole. a freqüência fenotípica será de 1 acondroplásico para 1 normal. seleção de parceiros e restrições ao endocruzamento. origina descendentes predominantemente heterozigotos. (08) A probabilidade de heterozigose na descendência em relação a este locus é igual a zero. Este se casa com uma mulher normal cujos pais eram normais (conforme heredograma abaixo). se a cor branca é dominante? a) Ambos são homozigotos recessivos b) Ambos são brancos heterozigotos c) Ambos são homozigotos dominantes d) A mãe é Bb e o pai é BB e) A mãe é bb e o pai é Bb Questão 525 A acondroplasia (uma das formas de nanismo) é causada por um gene dominante autossômico. A respeito desse assunto. e) a presença de sardas se deve a um alelo autossômico dominante. (04) A probabilidade de acondroplasia na descendência é igual a zero. influenciando uma variedade de atividades como. (02) A freqüência genotípica na descendência será 1:2:1. da mesma espécie.5. é correto afirmar: (01) O descendente será obrigatoriamente heterozigoto.

não é surpreendente que a expressão fenotípica de um gene envolva mais do que uma característica. Assinale a alternativa que apresenta a fase referida. b) A fibrose cística é causada pela presença de um par de genes recessivos. e) O fenótipo do pai de João e o genótipo do pai de Maria.1 O esquema publicado apresenta um erro. b) O genótipo da tia de João e o genótipo do irmão de Maria. representando o mecanismo de transmissão da fibrose cística: Questão 529 A Primeira Lei de Mendel ou Lei da Segregação dos Genes pode ser relacionada a uma das fases do processo meiótico. Os pais de Maria também têm pigmentação normal. em 02 de julho de 1995. foi ilustrada com o esquema a seguir.Questão 527 A matéria publicada no Jornal O GLOBO. Que informações permitem avaliar com maior precisão as chances de João e Maria terem um filho albino? a) O fenótipo da irmã de João e o genótipo do avô de Maria. ( ( ( ( ( ) Apresenta variantes genéticas facilmente observáveis. ) Apresenta ciclo reprodutivo curto e fecundidade alta. são interligadas e freqüentemente interdependentes. d) O indivíduo 8 é homozigoto dominante para a fibrose cística. b) heterogeneidade genética. Assim. por parte de mãe. João tem um irmão albino e uma irmã com pigmentação normal. Já Maria tem um avô materno e uma irmã albinos e um irmão com pigmentação normal.1. d) alelismo múltiplo. Os produtos de uma cadeia de reações podem ser utilizados em muitas outras vias metabólicas. porém João tem uma tia paterna albina e um primo. e) fenocópia. ) Apresenta autofecundação. 1. Assinale a opção que faz referência a esse erro. a) Prófase I b) Metáfase I c) Anáfase I d) Metáfase II e) Telófase II Questão 530 João e Maria estão pensando em ter um filho. a) Os indivíduos 3 a 6 são heterozigotos para a fibrose cística. ) Apresenta pequeno número de cromossomos. A afirmação acima se refere ao conceito de a) dominância incompleta. c) pleiotropia. Questão 528 As reações bioquímicas. de 117 . Seus pais não são albinos. Assinale com V (verdadeiro) ou F (falso) as afirmações a seguir sobre esse inseto. na pesquisa científica. amplamente utilizado em experimentos na área de genética e evolução. A seqüência correta de preenchimento dos parênteses. e) O indivíduo 18 é afetado pela fibrose cística e não um portador desta doença. c) A doença somente se manifesta quando dois indivíduos portadores são cruzados. c) O fenótipo do irmão de João e o fenótipo da irmã de Maria. com o título "Teste ajuda a evitar doenças congênitas". d) O genótipo do primo de João e o fenótipo da mãe de Maria. Questão 531 Em 2005. com a mesma característica.5. iniciaram-se as comemorações do centenário da utilização da 'Drosophila' sp. ) Não apresenta dimorfismo sexual. em sua maioria.

V . e) V ... sua avó materna era.V. e) sua avó materna ser heterozigota...Simas é heterozigoto para o caráter bruxo...V . c) V .V . d) seu pai ser heterozigoto. tendo sido realizados os cruzamentos a seguir: 1..V. Questão 535 Considere que o caráter analisado . foi sugerido que a característica de ser ou não bruxo seguiria padrão de segregação mendeliana.. a) 3/8 . resultando em 192 descendentes. Quais estão corretas? a) Apenas I.3/8 d) 6/8 . somente em homozigose. embora seus pais não fossem calvos. Assinale o número esperado de descendentes com pelagem branca.V. Rony. De acordo com a hipótese de segregação de fatores proposta por Mendel..F. na ordem em que aparecem. Assim concluiu que a chance de Leandro vir a ser calvo era de 50%.obedece ao proposto pela 1 Lei de Mendel.F .V . consultou um amigo que estava estudando genética.1/8 Questão 534 Leandro. Seu amigo explicou que a calvície é uma característica influenciada pelo sexo e que se expressa nos homens em homo e heterozigose e nas mulheres.F. d) Apenas II e III.V .F . Simas é bruxo. preocupado com a possiblidade de vir a ser calvo. c) Apenas I e III... 118 . de ervilhas amarelas e .cima para baixo é a) F .. 776).V . não havia histórico de calvície.Harry é menos bruxo que Rony. d) V .. III . a produção de uma geração Fƒ a partir da autofertilização da geração F‚ resultante do cruzamento de ervilhas parentais homozigotas amarelas (AA) e verdes (aa) produziria .V . considere as seguintes afirmações sobre o caráter bruxo em termos genéticos.. b) seu avô paterno ser calvo.1.Contou que. Na família do avô materno.F . provenientes de famílias bruxas tradicionais.cor da pelagem em coelhos . Hermione é bruxa mas filha de trouxas (não bruxos).F .. b) F . e) I.F . c) sua avó paterna ser heterozigota.. de ervilhas verdes. Com base no texto. filhos de pais bruxos.4/8 c) 5/8 . sendo sua mãe filha de trouxas.1 Todos os descendentes pretos de F2 foram cruzados com os F1.Hermione apresenta dois alelos para o caráter bruxo... Harry é bruxo. II e III.. filho de uma bruxa e de um trouxa.F .. I . Neville e Draco.. filho de bruxos..F .5... II . Questão 532 Conforme correspondência publicada na revista científica "Nature" de agosto de 2005 (p.. Neville e Draco são bruxos. Essa conclusão baseia-se no fato de a) sua mãe ser heterozigota.5/8 b) 4/8 ..F .. b) Apenas II..2/8 e) 7/8 . Questão 533 Assinale a alternativa que preenche corretamente as lacunas do texto a seguir.

Esse único evento resultou na formação de um alelo (S) autossômico e dominante. Questão 537 Por meio da técnica do DNA recombinante. c) 50%. provavelmente. 25% poderá ser de meninos-aranha. será igual a a) zero. d) 75% com alelo dominante e 25% com alelo recessivo. d) Analisando apenas as filhas. Se o pólen de uma planta heterozigota para um determinado loco gênico fecundar os óvulos de uma planta também heterozigota para esse loco. é necessário que ocorra a polinização. um indivíduo heterozigoto para um caráter regulado por dominância completa provavelmente produzirá a seguinte porcentagem Suponha que um evento de mutação permitiu ao homem-aranha secretar a seda formadora de teia. e) 75% com alelo recessivo e 25% com alelo dominante. mulheres-aranha seriam esperadas na população apenas se tal alelo ocorresse em homozigose (SS). c) Na geração F1. foi integrada a um único cromossomo. 119 . o que se deseja é a produção de sementes. apenas o efeito ambiental prevalece no fenótipo. uma cópia de um gene humano. Questão 538 De acordo com a primeira lei de Mendel. Questão 540 1.1 Se o camundongo macho gigante cruzar com uma fêmea normal. responsável pela síntese do hormônio do crescimento (somatotrofina). c) 50% com alelo recessivo e 50% com alelo dominante. 25% homozigota dominante e 25% homozigota recessiva. e) formada por homozigotos recessivos. d) Pode ser muito difícil determinar se o fenótipo resulta mais do efeito gênico do que o ambiental. na fase G do ciclo celular. espera-se que a F seja a) 100% heterozigota. Com relação aos princípios básicos da hereditariedade. de gametas: a) 100% com alelo recessivo. Para a produção de milho. Este zigoto foi implantado em uma "mãe de aluguel". de zigoto de camundongo. não portadora do gene do hormônio do crescimento. assinale a alternativa CORRETA: a) Os genes codominantes têm menor influência no fenótipo do que os fatores ambientais. d) formada por homozigotos para o alelo dominante. por exemplo. a expectativa quanto aos fenótipos de seus futuros descendentes poderá ser uma entre as possibilidades abaixo. d) 100%. c) 50% heterozigota. gerando um camundongo macho gigante. Questão 539 Os mecanismos da herança apresentam diferentes maneiras pelas quais os genes interagem entre si e com o ambiente para manifestarem seus efeitos no fenótipo dos seres vivos.5. Desta forma. e) Na presença de genes recessivos. 50% delas deverão ser normais. mas com expressão influenciada pelo sexo. Considerando que o homem-aranha é o único a ter essa mutação. a fração de descendentes gigantes. b) 25%. e) Quem herdar o cromossomo Y deverá ser uma criança-aranha. c) Os genes dominantes são independentes dos fatores ambientais para se expressarem. b) 100% com alelo dominante.1. b) Na expressão gênica os efeitos do ambiente celular não são considerados. Assinale a afirmativa CORRETA: a) Terá filhas-aranha se casar com uma prima de primeiro grau. b) Todos os seus meninos deverão ter o fenótipo "aranha". b) 50% dominante e 50% recessiva.Questão 536 Em vários cultivos.

1. pois a insulina é incorporada no sangue fazendo com que os filhos não apresentem o distúrbio. que pode apresentar dominância ou recessividade. pois nesses casos o genótipo pode ser alterado evitando a manifestação da doença nos filhos. d) 160. foram realizados cruzamentos entre esses animais. A administração de insulina aos diabéticos evitará que eles tenham filhos com este distúrbio? a) Não. com prejuízo da fala e dos movimentos.Questão 541 No Brasil. O heredograma seguinte ilustra uma situação em que há indivíduos fenilcetonúricos. 1. o número esperado de heterozigotos é: a) 45. das quais 240 tinham pêlos curtos. b) Não. Questão 542 Os vários tipos de diabete são hereditários. Se detectada a tempo. é dominante em relação ao gene que determina pêlos longos. Do cruzamento de cobaias heterozigotas nasceram 300 cobaias.5. conforme a tabela. (3) Os homens normais representados no heredograma são necessariamente heterozigotos. e) 180. b) 60. c) 90.1. pois a insulina é incorporada nas células e terá ação nos filhos. d) Sim.1 120 .1 Considerando o heredograma. que condiciona pêlos curtos em cobaias. Questão 544 Considerando-se que a cor da pelagem de cobaias é determinada por um par de alelos. (1) O caráter fenilcetonúrico apresenta herança autossômica dominante. essa doença pode ser controlada ministrando-se ao recém-nascido uma dieta especial. (2) O cruzamento entre os indivíduos 10 e 11 ilustra como a consangüinidade influencia o aparecimento de doenças hereditárias. Questão 543 O gene autossômico. por meio do qual se identifica a fenilcetonúria.5. embora o distúrbio possa aparecer em crianças cujos pais são normais. pois o genótipo dos filhos não é alterado pela insulina. uma lei determina que os recém-nascidos sejam submetidos ao "teste do pezinho".1. pois tanto o genótipo como o fenótipo dos filhos são alterados pela insulina. c) Sim. Em algumas dessas formas. os sintomas podem ser evitados por meio de injeções diárias de insulina. doença hereditária que pode levar ao retardamento mental.5%. julgue os itens abaixo. Entre as cobaias de pêlos curtos. (4) A probabilidade de que o casal formado pelos indivíduos 10 e 11 tenha um descendente do sexo masculino fenilcetonúrico é igual a 12. e) Depende do tipo de diabete. (5) A dieta especial a que devem ser submetidos os recém-nascidos fenilcetonúricos tende a alterar a freqüência do gene da fenilcetonúria na população.

são observados dois fenótipos e três genótipos entre os descendentes. d) herança ligada ao sexo e homozigotos recessivos. c) no cruzamento III. é possível o aparecimento de indivíduos albinos. o fenótipo recessivo é mascarado pelo fenótipo dominante. o fenótipo dominante é mascarado pelo fenótipo recessivo. As flores vermelhas e brancas são homozigotas. a proporção fenotípica observada em F‚ significa exatamente que: a) 25% da prole expressam o fenótipo determinado pelo alelo dominante e 75% não o expressam. entre outras manifestações. c) uma planta de flores rosas com outra de flores 121 . os pais são heterozigotos.análise da tabela permite concluir que a) no cruzamento I. nasceram 15 filhotes azulados. Questão 548 Mendel cruzou duas variedades de 'Mirabilis jalapa'. Indique qual será o resultado do cruzamento da variedade de flores rosas (F‚). enquanto as rosas são heterozigotas. Questão 546 Em um cruzamento de um indivíduo AA com outro aa. observou-se que a síndrome não se manifesta em algumas gerações e pode ocorrer em indivíduos que aparentemente têm pais normais. Essa síndrome é mais freqüente em descendentes de casais aparentados e ocorre em machos e fêmeas em proporção relativamente igual. Isto se explica porque: a) muitas plantas verdes são heterozigóticas. c) 75% da prole expressam o fenótipo determinado pelo alelo A e 25% não o expressam. e) no cruzamento V. respectivamente: a) herança quantitativa e homozigotos dominantes. 7 brancos e 8 pretos. podem ocorrer três genótipos diferentes entre os descendentes. Para se obter 50% de flores brancas. b) em 25% da prole. os pais são heterozigotos. d) o gene para albinismo é ativado no escuro. b) uma planta de flores brancas com outra de flores rosas. e) 50% da prole possuem um único tipo de alelo e 50% possuem outro tipo de alelo. Embora plantas albinas morram antes de produzirem sementes. d) em 50% da prole. Com base nessas informações. c) plantas albinas tornam-se verdes na presença de luz. b) no cruzamento II. existe uma síndrome caracterizada. O preenchimento correto das lacunas é. d) no cruzamento IV. b) plantas normais homozigóticas tornam-se albinas na ausência de luz. d) ligada ao cromossomo X e recessiva. considerando que o alelo Aé dominante sobre a. por suscetibilidade aumentada a infecções e tendência a sangramentos. Questão 545 Em gatos. Na geração F todas as flores eram rosas. b) codominância e heterozigotos c) linkage e heterozigotos. é necessário cruzar: a) duas plantas de flores rosas. normais. e) o albinismo impede a síntese de clorofila. Questão 547 No cruzamento de plantas verdes. a) 25% brancas : 25% vermelhas : 50% rosas b) 25% brancas : 50% vermelhas : 25% rosas c) 100% rosas d) 50% vermelhas : 50% rosas e) 50% brancas : 25% vermelhas : 25% rosas Questão 549 Do cruzamento entre aves andaluzas de coloração azulada. brancas ou rosas. e) epistasia e homozigotos dominantes. os genótipos dos pais podem ser diferentes. pode-se dizer que o tipo de herança responsável por essa síndrome é a) autossômica recessiva. b) autossômica dominante. Ao fazer a genealogia de vários indivíduos. Trata-se de um caso de _____________ e os indivíduos parentais são _______________. uma com flores vermelhas e outra com flores brancas. c) ligada ao cromossomo X e dominante. Questão 550 As flores da planta maravilha podem ser vermelhas. e) ligada ao cromossomo Y e recessiva. a característica "albinismo" não desaparece entre elas.

d) uma planta de flores vermelhas com outra de flores brancas. pesquisadores da Universidade de Toronto. c) É uma herança ligada ao sexo em vegetais. é INCORRETO afirmar: a) A propagação vegetativa de uma planta verde deve produzir plantas verdes. essas pessoas perdem a capacidade de digerir o açúcar do leite. Valéria concluiu CORRETAMENTE que: a) trata-se de dominância da cor rosa sobre as demais. 1. notou a existência de plantas de uma mesma espécie que possuíam indivíduos com flores brancas.2 e acordo com a tabela e com seus conhecimentos. variegadas (pigmentação irregular). pois o cruzamento de plantas de flores brancas e vermelhas só originou flores rosas. b) Genes estão envolvidos na determinação dos fenótipos. no Canadá. nas populações ocorrem três fenótipos relacionados à atividade da enzima: indivíduos sem atividade de lactase. verde pálido. b) dominante. estas últimas em quantidade duas vezes maior que as plantas de flor branca e vermelha. Questão 553 Em "Mirabilis jalapa" (maravilha). as proporções genotípicas e fenotípicas observadas na segunda geração dos filhos serão. Essa característica é autossômica e. b) trata-se de um caso de co-dominância entre os genes alelos que determinam o padrão de cor.1.vermelhas. Três fenótipos são observados: verde. e) quantitativa. (Adaptado de "Ciência Hoje". o caráter tonalidade da cor das folhas e ramos é transmitido geneticamente através do citoplasma dos óvulos. vermelhas e rosas. obteve plantas que davam flores brancas. Valéria promoveu uma autofecundação nas plantas de cor rosa e. Observando seu jardim. indivíduos com atividade de lactase e indivíduos com atividade parcial da lactase. d) as plantas de flor vermelha eram dominantes e as de cor branca recessivas. afirmam que o gene CYP2A6 está ligado à dependência das pessoas ao cigarro. obtendo plantas que só davam flores de cor rosa. e) trata-se de um caso de gene letal. c) epistática. Questão 551 A maioria das populações é composta por pessoas que manifestam perda progressiva da lactase intestinal após o desmame. d) O fenótipo pode ser influenciado por fatores ambientais. d) co-dominante. Questão 554 No monoibridismo com co-dominância ou dominância intermediária. p. 49) A alergia ao leite pode ser hereditária. para sua surpresa. codifica a síntese de uma enzima que 122 .5. c) as plantas de flor rosa eram recessivas. rosas e vermelhas. Essa distribuição é característica de um padrão de herança a) recessiva. a) 1 : 3 : 1 e 3 : 1 b) 1 : 2 : 1 e 1 : 2 : 1 c) 1 : 1 : 2 e 1 : 1 : 1 d) 1 : 3 : 1 e 3 : 1 : 3 e) 1 : 1 : 1 e 3 : 1 Questão 555 Em estudo publicado na revista Nature de 25 de junho passado. Agosto de 1999. Questão 552 Valéria gostava muito de flores. Curiosa para saber como se dava a transmissão desse caráter. a lactose. Este gene. em sua forma normal. A tabela abaixo apresenta o resultado de seis possíveis cruzamentos. Em conseqüência da falta dessa enzima. respectivamente. causada pela deficiência da enzima lactase. e) duas plantas de flores vermelhas.

resultantes dos cruzamentos de linhagens puras de três organismos diferentes: 1. d) dominância completa da forma normal do gene CYP2A6 sobre as formas defeituosas. b) os indivíduos HbA/HbS e HbS/HbS devem apresentar os mesmos níveis de hemoglobina anormal. d) o gene que determina "plumagem azulada" é dominante sobre os genes que determinam "plumagem preta" ou "plumagem branca". c) epistasia recessiva. quando autofecundadas. Por outro lado.5. b) as características "tipo de semente" e "cor de plumagem" são determinadas.1.5. parcialmente. é CORRETO afirmar que a) o gene HbA é dominante sobre o gene HbS. Questão 557 Analise esta tabela. c) os indivíduos que produzem só hemácias anormais podem ser curados por meio de transfusão sangüínea. Fumantes portadores de dois alelos normais (homozigoto para o alelo normal) são altamente dependentes do cigarro. c) as plantas da F2 com "sementes rugosas". em que estão relacionadas características das gerações F1 e F2. na espécie humana. pois o heterozigoto apresenta fenótipo diferente de ambos os homozigotos. é correto afirmar que a dependência ao cigarro determinada pelo gene CYP2A6 é um caso de: a) herança quantitativa. a ação do alelo normal. consumindo 20% menos cigarros que os fumantes inteiramente dependentes. cada uma delas. são moderadamente dependentes. apesar de fumantes.2 1. b) pleiotropia.1. é INCORRETO afirmar que a) os pares de genes que determinam o "tipo" e a "cor" da asa nas moscas estão localizados em cromossomas não-homólogos. fumantes heterozigotos. pois o fenótipo apresenta uma continuidade entre dependentes e não dependentes. portadores de um alelo normal e outro defeituoso. pois qualquer um dos alelos defeituosos inibe.metaboliza a nicotina. Eles afirmam. Com base nesse esquema e em conhecimentos sobre o assunto. jamais se tornam dependentes. Questão 556 Observe o esquema. Com base no texto anterior. enquanto que portadores de dois dos alelos defeituosos. por um único par de gene.2 Considerando-se as informações contidas nesta tabela e outros conhecimentos sobre o assunto. tornando as pessoas dependentes. originam apenas descendentes com sementes rugosas. três alelos para este gene: um normal e dois defeituosos. ainda. 123 . d) um determinado genótipo pode produzir diferentes fenótipos. que há. e) dominância incompleta entre a forma normal e as defeituosas do gene CYP2A6.

o genótipo IÞIß determina tipo sangüíneo AB. Herança: pleiotropia. qual das alternativas a seguir representa a fração de indivíduos adultos. III. o último é normal. b) dominância incompleta. d) epistasia. cujo genótipo (CÑCÑ) define cor vermelha nas flores. Os heterozigotos resultantes do cruzamento entre essas duas linhagens (CÑCß) apresentam flores de cor rosa. (04) as linhagens puras. o segundo é normal e bastante suscetível a malária (doença endêmica na região). A calvície é determinada por um alelo autossômico. que serão anêmicos? a) 1/2 b) 1/4 c) 1/3 d) 2/3 e) 1/8 Questão 561 Considere as seguintes formas de herança: I. descendentes do cruzamento de um homem e uma mulher portadores de talassemia menor. e) herança poligênica. II. Questão 560 A talassemia é uma doença hereditária que resulta em anemia. Homens com genótipo C¢C¢ (homozigotos) ou C¢C£ (heterozigotos) são calvos. dominantes com relação ao alelo i. (02) a proporção genotípica esperada nas plantas de F‚ é: 1 planta com flores cor-de-rosa: 2 plantas brancas: 1 planta vermelha. identificada como talassemia maior e os heterozigotos MN. Indivíduos homozigotos MM apresentam a forma mais grave. corretamente. Sabendo-se que todos os indivíduos com talassemia maior morrem antes da maturidade sexual. O primeiro morreu aos 5 anos de idade. Os alelos IÞe Iß são. vermelhas ou cor-de-rosa. Por outro lado. certamente apresentam genótipos homozigotos. b) pai ë heterozigoto. uma constituída de plantas com flores brancas e outra com flores vermelhas. Herança: co-dominância. o vermelho e o cor-de-rosa. (08) os indivíduos de F eram. o membro da família com seu respectivo genótipo e o padrão de herança da anemia falciforme. c) co-dominância. certamente. d) mãe ë homozigoto dominante. em conseqüência de anemia falciforme. Indivíduos homozigotos com genótipos (CßCß) apresentam flores brancas. exemplos de a) dominância incompleta. apresentam uma forma mais branda chamada de talassemia menor. Indivíduos homozigotos NN são normais. enquanto mulheres C¢C¢ são calvas e C¢C£ são normais.Questão 558 Um casal de africanos teve três filhos. Tanto homens quanto mulheres C£C£ são normais. (16) a F‚ esperada será constituída de 50% de indivíduos homozigotos e 50% de indivíduos heterozigotos. Na planta boca-de-leão. Da autofecundação das plantas da F. A descendência originada (F) apresentou apenas plantas com flores cor-de-rosa. 124 . Em humanos. I. co-dominância e expressão gênica influenciada pelo sexo. respectivamente. heterozigotos. pleiotropia e penetrância incompleta. Assinale a(s) proposição(ões) VERDADEIRA(S). c) 3Ž filho ë heterozigoto. Herança: dominância completa. portanto. Herança: epistasia dominante. que deram origem ao experimento. epistasia e pleiotropia. há indivíduos homozigotos. a) 2Ž filho ë homozigoto recessivo. Assinale a opção em que se indicam. considerando que neste experimento: (01) ocorreu a segregação de três fenótipos: o branco. indivíduos com genótipos IÞIÞ ou IÞi apresentam tipo sangüíneo A e os com genótipos IßIß ou Ißi apresentam tipo sangüíneo B. Questão 559 Um experimentador cruzou duas linhagens puras de uma planta denominada boca-de-leão. porém pouco suscetível a malária. co-dominância e dominância incompleta. foram obtidas plantas com flores exclusivamente brancas. II e III são. dominância incompleta e expressão gênica influenciada pelo sexo.

5.SS. 3 e 4. Ss e Ss. respectivamente.1. e) na ligação gênica. as pessoas surdas estão representadas por símbolos hachurados: Com base nessa afirmação. b) letal recessivo. c) I: 1 gene com dominância incompleta. d) nos genótipos recessivos. b) nos genótipos homozigotos. II: 1 gene com dominância incompleta. ss. d) autossômica recessiva . respectivamente: a) 1/2 e 1/2 b) 1/4 e 3/4 c) 2/3 e 1/3 d) 3/4 e 1/4 Questão 566 1. Seu alelo recessivo "a" condiciona pelagem preta. e) autossômica recessiva . 125 . Para os filhotes vivos de um cruzamento de um casal de heterozigotos. a pelagem branca é condicionada pela presença do gene "A". Quando aves anômalas heterozigóticas são cruzadas. No heredograma a seguir. assinale a opção correta quanto ao tipo de herança e os genótipos dos indivíduos 1. 2. a dominância parcial e a codominância entre alelos definem-se. II: vários genes com interação.SS. d) hipostático. Questão 564 Em aves. ss. II: 2 genes com dominância incompleta. SS e SS. c) nos genótipos dominantes. b) I: 1 gene com dominância incompleta. originam uma descendência com indivíduos anômalos e normais numa proporção de 2 :1.Ss. de forma mais precisa. respectivamente: 1. esperam-se as seguintes proporções de camundongos de pelagem branca e preta. e) I: 2 genes com interação. existe uma anomalia que se caracteriza pelo encurtamento das asas. letal em homozigose. Questão 563 Os gráficos I e II representam a freqüência de plantas com flores de diferentes cores em uma plantação de cravos (I) e rosas (II). c) autossômica dominante . e) epistático. A partir desses dados. II: 1 gene com alelos múltiplos.Ss. Questão 565 Em determinado tipo de camundongo. d) I: 3 genes com dominância incompleta. b) autossômica dominante . Ss e SS. Ss e Ss.2 Os padrões de distribuição fenotípica são devidos a: a) I: 1 gene com dominância. c) pleiotrópico. II: vários genes com interação. ss. a) nos genótipos heterozigotos. ss e ss.ss.1. Na espécie humana há um tipo de surdez hereditária que é determinada por um par de genes.4 a) autossômica dominante .5. Ss. é possível deduzir que o alelo que condiciona a anomalia é a) letal em homozigose.Questão 562 Em genética. SS.

Caso a anomalia seja condicionada por um alelo recessivo ligado ao cromossomo X. apresentam uma série de complicações como retardo mental. (III) e (IV).Questão 567 A fenilcetonúria (PKU) é uma doença de origem genética bastante conhecida. 4 b) 1.4 126 .1. 1. b) VI possui dois alelos mutados. e) I é necessariamente homozigoto. 5 c) 1. (I) e (II). odemos dizer. Se a doença for condicionada por um par de alelos recessivos localizados em cromossomos autossômicos. as probabilidades de o pai (A) e de a mãe (B) do menino (C) serem portadores desse alelo são. hipopigmentação. 1. onde os indivíduos masculinos são representados por quadrados e os femininos por círculos. além de não sintetizarem catecolaminas corretamente. c) V é necessariamente homozigoto. as probabilidades de o pai e de a mãe serem portadores desse alelo são.5. respectivamente. 2. 7 e) 3. 5. 8 d) 4.5. d) III possui apenas um alelo mutado. causada por uma deficiência da enzima fenilalanina hidroxilase. 6.1.4 1. que: a) VIII pode ter um alelo mutado.1. 2. 2. Assinale a alternativa que mostra as porcentagens que preenchem corretamente os espaços I. 9 Questão 569 No heredograma. podemos afirmar que os indivíduos heterozigotos são: a) 1. 5. não conseguem metabolizar a fenilalanina e.4 obre as informações contidas no heredograma. Pacientes acometidos desse mal. 4. num segmento sem homologia com o cromossomo Y. quanto à presença de alelos mutantes de fenilalanina hidroxilase nos membros da família marcados com algarismos romanos.5. epilepsia. III e IV. 3. Considere o heredograma a seguir de uma família com membros acometidos (símbolos cheios) e normais (símbolos vazados). 6. respectivamente. entre outras. os quadrados cheios representam meninos afetados por uma doença genética. Questão 568 Analise o heredograma a seguir. II. assim.

Questão 571 No heredograma a seguir.1. b) autossômica recessiva. localizado em autossomo.1.5. localizado no cromossomo y. localizado no cromossomo X. b) recessivo. e) localizado no cromossomo Y. Os símbolos escuros indicam os portadores de uma anomalia hereditária. localizado no cromossomo y. b) dominante.Questão 570 O esquema a seguir representa indivíduos de três gerações de uma família. 1. e) recessivo. localizado no cromossomo X. d) recessivo.5. localizado em um autossomo.4 om base na análise do heredograma. d) recessivo. a probabilidade desse casal ter uma filha com o mesmo fenótipo do avô materno é de: a) 1/2 b) 1/4 c) 1/8 d) 1/3 e) 2/3 1. localizado em um autossomo. Questão 573 Se os indivíduos 7 e 11 se casarem.4 nalisando-se a genealogia. e) ligada ao y.5. d) ligada ao x recessiva. c) dominante. c) dominante. localizado no cromossomo x. círculos representam mulheres. conclui-se que a anomalia é determinada por gene a) dominante. localizado em autossomo. Questão 574 127 .5.4 1. quadrados representam homens e símbolos preenchidos representam indivíduos portadores de certa característica. c) ligada ao x dominante. pode-se concluir que a característica em questão é condicionada por gene a) dominante.1.4 1.1. Questão 572 O tipo de herança genética apresentada pelos indivíduos afetados é: a) autossômica dominante.

4 1. e) É do tipo dominante ligada ao sexo porque todos os filhos homens herdam a característica da mãe. c) A probabilidade de o indivíduo 7 ser heterozigoto é de 18%. EXCETO: a) A segunda geração pode ser composta apenas por indivíduos homozigotos. é correto afirmar.5. c) É do tipo recessiva autossômica porque o número de indivíduos afetados é menor do que o de não afetados. se os indivíduos marcados são afetados por uma característica genética. e) 100% e 75%. os indivíduos 3 e 5 são afetados por uma anomalia genética recessiva.1. d) 0 e 25%. b) 0 e 75%. 1. Questão 576 No heredograma adiante.1. Questão 575 Analise o seguinte heredograma de uma característica transmitida geneticamente: om base nessa análise.5. de: a) 100% e 50%.4 No heredograma acima. as probabilidades dos casais 7×8 e 9×10 terem crianças normais são. indique a opção que apresenta a afirmativa correta sobre a herança da característica referida no heredograma. b) É do tipo dominante autossômica porque o genótipo pode estar presente na prole de ambos os sexos sem estar presente nos pais. respectivamente. d) É do tipo recessiva ligada ao sexo porque todo progenitor masculino afetado transmite a característica para suas filhas.1.1. na qual a freqüência de indivíduos afetados é de 1%. 128 .4 Considerando-se que a família acima representada faz parte de uma população em equilíbrio de Hardy-Weimberg. d) O caráter em estudo pode ser ligado ao sexo. a) É do tipo recessiva autossômica porque o genótipo pode estar presente na prole de ambos os sexos sem estar presente nos pais. c) 50% e 50%.5. b) O indivíduo 8 apresenta o mesmo fenótipo e o mesmo genótipo do avô para o caráter em questão.

c) a hemofilia. II. os eventuais filhos nascerão afetados.4 1.5.4 129 .A mulher representada pelo número 5 tem possibilidade de ser homozigota. IV . Questão 578 Responder à questão com base no heredograma a seguir.1.4 onsiderando que os indivíduos indicados em preto são afetados por uma característica genética. b) Apenas I. e) a incapacidade de enrolar a língua. causada por um gene restrito ao sexo. São corretas as afirmações: a) I.5. as figuras 6. III . causada por um gene autossômico dominante. causada por um gene autossômico influenciado pelo sexo.As pessoas 1 e 2 são heterozigotas. na fase adulta. xamine as afirmações: I . II . causada por um gene autossômico recessivo. Questão 579 A Doença de Huntington (DH) é uma anomalia autossômica com caráter dominante cuja manifestação ocorre na fase adulta. II e III.1.Questão 577 No heredograma. e) Apenas uma das afirmações.É uma doença de caráter dominante autossômica. c) Apenas II e III. desenvolveram a mesma doença hereditária: 1. d) a hipertricose. é correto concluir que tal característica é a) a calvície. os indivíduos afetados por DH estão indicados em negro.Se houver casamento consangüíneo entre 9 e 11.1. com uma progressiva perda do controle motor e problemas psiquiátricos como demência e distúrbios afetivos. III e IV. causada por um gene recessivo ligado ao sexo. b) o lóbulo da orelha livre. com certeza. III e IV. No heredograma a seguir. e os indicados em branco não a apresentam. d) Apenas II. 10 e 12 representam indivíduos que.5. 1.

1.5. Assinale.V . ( ) Os indivíduos I-1.V b) F .F .1. I-2.F . e) pode ser ou não braquidáctilo e é homozigoto. d) tem dedos normais e é heterozigoto. que é determinado por um par de genes: 130 .5. nos parênteses. ( ) Os indivíduos III-1.V .4 Questão 581 Analise a genealogia a seguir. 1.V . pode-se afirmar que o indivíduo 6: a) é braquidáctilo e homozigoto. 5 e 7 apresentam uma anomalia condicionada por gene autossômico dominante. enquanto os indivíduos 5 e 8 apresentam dedos normais. as pessoas indicadas pelos números 1.4 1. 4.F .F . 3.4 essa família. II-1 e II-3 são homozigotos. b) é braquidáctilo e heterozigoto. 2. 4 e 7 são braquidáctilos.5.V . A seqüência correta de preenchimento dos parênteses. ( ) Os indivíduos II-1 e II-3 são heterozigotos. Questão 582 Na genealogia a seguir.s afirmativas abaixo referem-se aos possíveis genótipos dos indivíduos indicados no heredograma. onde foi estudado o caráter BRAQUIDACTILIA (dedos curtos).1. III-2. 2. de cima para baixo. é a) F . III-3 e III-4 são homozigotos. c) tem dedos normais e é homozigoto. os indivíduos 1. V para as verdadeiras e F para as falsas.V e) V . Já as pessoas indicadas pelos números 3 e 6 têm fenótipo normal.F .V Questão 580 Qual dos heredogramas a seguir ilustra uma condição biologicamente IMPOSSÍVEL? 1.F c) V . ( ) Os indivíduos II-2 e II-4 são heterozigotos.V . Considerando essas informações e desprezando a possibilidade de ocorrência de mutação.F d) V .

1.5. Observe a genealogia a seguir.4 probabilidade do casal 3×4 ter o primeiro filho homem e que venha a ser calvo.1. 1.5.5. c) a pessoa indicada pelo número 3 transmitiu o gene recessivo para seu descendente indicado pelo número 7. Questão 583 A calvície é uma característica influenciada pelo sexo e o gene que a condiciona se comporta como recessivo no sexo feminino e dominante no sexo masculino.4 No heredograma abaixo. e) o casal indicado pelos números 6 e 7 não poderá ter descendentes com fenótipo normal. pode-se concluir que: a) apenas as pessoas indicadas pelos números 1 e 2 são heterozigóticas.4 esse heredograma NÃO se pode determinar o genótipo do indivíduo a) 1 b) 3 c) 5 d) 6 e) 7 Questão 585 1.1. 131 . d) não há possibilidade de a pessoa indicada pelo número 5 ser heterozigótica. os símbolos escuros representam indivíduos que possuem uma anomalia. relativa a essa característica. Os símbolos escuros representam indivíduos que exibem a característica recessiva. b) a pessoa indicada pelo número 4 é homozigótica. é: a) 1/2 b) 1/4 c) 1/8 d) 1/6 Questão 584 O heredograma a seguir representa a herança de um par de genes entre os quais há dominância. 1.Após a análise da genealogia.

A anomalia é condicionada por um alelo dominante.4 Questão 587 O heredograma mostra a incidência de uma anomalia genética em grupo familiar. Todos os indivíduos que apresentam a anomalia são homozigóticos.onsidere as seguintes afirmativas sobre esse heredograma: I. podemos afirmar: a) todos os indivíduos normais são homozigotos recessivos.4 pós a análise deste heredograma. III.1.1. 1/4 d) 1/2. e) todos os indivíduos normais são homozigotos dominantes ou heterozigotos. 1/2 c) 1/4. É correto o que se afirma APENAS em a) I b) II c) III d) I e II e) II e III Questão 586 No heredograma adiante. As probabilidades de que sua irmã (II-2) não afetada seja carreadora ou não carreadora da fibrose cística são.5.5. a criança II-1 tem fibrose cística. Questão 588 Foi estabelecida uma linhagem de camundongos nocaute esses animais se caracterizam por não expressar um determinado gene.4 1. respectivamente: a) zero.5. c) a anomalia ocorre apenas em homozigotos dominantes. Após uma infecção em que apenas uma fêmea nocaute sobreviveu.1. 1/4 e) 1/2. 1/4 b) 1/4. 2/2 1. d) todos os indivíduos normais são homozigotos dominantes. uma doença causada por um alelo recessivo autossômico. O único indivíduo que não pode ter o seu genótipo definido é o I-4. a linhagem pôde ser reestabelecida por meio do acasalamento descrito a seguir: 1. II. b) a anomalia é condicionada por um gene recessivo. 132 .

1.3 tem filha normal. 50% dos filhotes são animais com o genótipo heterozigoto.5. e) II-2. Questão 589 Analise o heredograma que representa a herança de um tipo de disfunção dos músculos esquelético e cardíaco em seres humanos. c) O indivíduo III. na família representada. EXCETO a) O indivíduo I.2 não possui pais afetados. todas as alternativas são possíveis. portanto a herança não deve ser autossômica dominante. é autossômica recessiva. 1. c) O acasalamento do macho 3 com a fêmea 5 produzirá maior número de camundongos nocaute do que o acasalamento desse macho com a fêmea 4. e) A herança do caráter nocaute é autossômica dominante. Questão 591 1.4 m relação à característica representada no heredograma.5. c) a probabilidade de mulheres descendentes de IV-1 serem afetadas é zero. por isso é improvável uma herança dominante ligada ao X. Para chegar a tal conclusão. 133 . Questão 590 Analise o heredograma. se a herança fosse recessiva ligada ao X.2 seriam normais. d) I-1 e I-2 podem ser heterozigotos. c) A herança pode representar uma família de hemofílicos.1.4 Observe este heredograma: 1.4 Com relação ao heredograma. é correto afirmar-se que a) a herança para esse tipo de característica é recessiva e ligada ao sexo. pós analisar esse heredograma. d) Os filhos homens de I. se a herança fosse ligada ao Y. d) O cruzamento do macho 2 com uma das fêmeas de F originará camundongos dos quais 75% serão heterozigotos. uma estudante concluiu que a característica transmitida. e) o casamento de III-4 com indivíduo de fenótipo igual a II-4 tem como resultado esperado 100% de mulheres afetadas. essa estudante considerou todas as seguintes hipóteses. b) a ocorrência da característica nessa família se deve aos casamentos consangüíneos. EXCETO a) A herança pode ser autossômica. b) A herança pode ser ligada ao sexo. II-5 e III-1 podem ser homozigotos dominantes.ode-se afirmar que: a) Por meio do acasalamento do macho 3 com a fêmea nocaute.5 também seria afetado.1. b) Em F‚. d) as mulheres afetadas apresentam fenótipos idênticos aos de suas mães.5. b) O indivíduo II. 75% do filhotes nascerão normais.

Questão 595 Renata (III.5. cujo diagrama. c) o risco de III. é INCORRETO afirmar que a) os indivíduos normais. conhecida como daltonismo.1. b) a ocorrência do tumor é uma característica autossômica. Questão 594 1. d) a probabilidade de o indivíduo III. mostrando-os indivíduos afetados.1 são heterozigotos.4 Esse diagrama representa: ( ) o modelo de herança recessiva ligada ao cromossomo X. b) o loco do gene em estudo está situado em um cromossomo autossômico. deseja saber qual a probabilidade de ela não ser portadora deste alelo.1 e II. ( ) um modelo de herança idêntico ao do albinismo.3 nascer incapaz de sentir o gosto do PTC é de 50%. mesmo.5. ( ) a característica passada de geração a geração. de pai para filha e mãe para filha.1). são homozigotos. d) os indivíduos I.4 Um geneticista estabeleceu o heredograma para uma determinada doença hereditária. c) o próximo filho do casal II.1. ( ) um modelo de herança idêntico ao da cegueira para cores. que representa uma família em que há indivíduos afetados por um tipo de tumor de gengiva: 1. a) 0 b) 1/4 c) 3/4 134 1.5.1 x II.2 será normal. cuja avó materna e avô paterno eram albinos. em todas as gerações.2 ser heterozigoto é de dois terços. preocupada com a possibilidade de transmitir o alelo para o albinismo a seus filhos. om base nesse heredograma e em outros conhecimentos sobre o assunto. Assinale a alternativa que responde ao questionamento de Renata.Questão 592 As pessoas podem detectar a substância química feniltiocarbamida . não sentir qualquer sabor.1. ( ) o modelo de herança autossômica recessiva. é representado abaixo.4 . Observe este heredograma para a capacidade de sentir o gosto dessa substância: onsiderando-se as informações desse heredograma e outros conhecimentos sobre o assunto. típica daquelas não vinculadas aos cromossomos X e Y. é INCORRETO afirmar que a) o alelo para a capacidade de sentir o gosto do PTC é dominante.como um gosto amargo ou.PTC . Questão 593 Analise este heredograma.

d) 1/3 e) 1 1.4 1. os indivíduos assinalados com preto apresentam uma anomalia determinada por um gene dominante. pois dão origem a indivíduos anormais.5. é correto afirmar: a) Todos os indivíduos afetados são homozigotos.4 Analisando essa genealogia. (01) A anomalia é causada por gene provavelmente recessivo. pois os indivíduos II-3 e II-4 tiveram crianças anormais.4 Questão 598 Na genealogia a seguir.5. a) Os indivíduos II-3 e II-4 são homozigotos. (02) A anomalia é causada por gene provavelmente dominante.1.5. Analise-o e assinale a alternativa correta. (64) Trata-se de Herança Holândrica. é correto afirmar: 1. II:1 e II:5 são heterozigotos. Soma ( ) 1. e) Os indivíduos I-1 e I-4 são homozigotos. (32) Trata-se de Herança Intermediária. e) Apenas os indivíduos I:1 e I:2 são homozigotos. pois são afetados pelo fenótipo anormal. 135 . d) Todos os indivíduos afetados são heterozigotos. d) Apenas os indivíduos I:1. (04) Trata-se de gene localizado no cromossomo X. onde os indivíduos afetados pela síndrome unha-rótula (deformação nas unhas e nas rótulas) aparecem em preto. Questão 597 Considerando o heredograma abaixo. (16) Trata-se de gene autossômico. c) Os indivíduos III-1 e III-2 são heterozigotos.5. b) Todos os indivíduos não afetados são heterozigotos. c) Apenas o indivíduo I:1 é heterozigoto.1. pois a característica é dominante.1. b) O fenótipo anormal é recessivo.1. (08) Trata-se de gene localizado no cromossomo Y.4 Questão 596 O heredograma adiante representa a herança de um fenótipo anormal na espécie humana.

Questão 600 Na genealogia a seguir.1 e II . os demais indivíduos da segunda geração são irmãos. um homem e uma mulher.2.1 é mais jovem do que II .4 A anemia falciforme é causada pela presença de uma hemoglobina anormal. Questão 602 Os heredogramas a seguir apresentam o padrão de herança de um mesmo caráter em cinco diferentes famílias. (02) O padrão da herança desta doença é autossômico dominante.3 e II . d) II . (04) III . 2.1.4 forem homozigotos normais.2.5.1. 3.5.2. (08) III .2.2 é sobrinho(a) de II . (32) II .3. Essa doença é herdada como autossômica recessiva.4. II . 1. enquanto II . Os símbolos cheios indicam que o indivíduo é portador do caráter.1 e I .5. (64) Com exceção de II . Com base na análise da mesma. identificadas por 1. (32) A doença só se manifesta nas mulheres. 1.3.5. são indivíduos afetados pela característica que está sendo estudada.3 não tem nenhuma relação genética com I .2 e II .Questão 599 A figura a seguir apresenta uma genealogia hipotética.4 (01) Na genealogia estão representadas 2 gerações.2.1 e III . assinale a(s) proposição(ões) CORRETA(S). (16) III . por exemplo. (02) Os indivíduos I . III .3 forem heterozigotos e os indivíduos I . 4 e 5. (16) II . apresentado na genealogia. Considerando o heredograma apresentado inicialmente os indivíduos I .1.4 têm 50% de probabilidade de terem um descendente portador da doença.3 podem ser homozigotos.1 e III .1 é neto(a) de I . II .3 e III . respectivamente.4 representam.3.3% de possibilidade de nascer um descendente com a doença. II . c) Apenas II . (08) Do casamento consangüíneo.3 e II .1 e II . Questão 601 Com relação a essa figura é CORRETO afirmar que: (01) Os indivíduos II . 1. os homens. portanto está ligada ao cromossomo X. quem poderá ser afetado pela doença? a) Apenas III .1 e I . II .1.4. e) II .3 e III . existe 33.1 e III . os indivíduos que manifestam uma determinada doença hereditária são mostrados em preto.1.1. b) Apenas II . Os círculos representam as mulheres e os quadrados.4 136 .5.3 não o são. (04) Os indivíduos I .2 e I .2.

III. apenas. b) nula. O indivíduo III-1 só deve ser cruzado com o indivíduo II-5. É verdadeiro o que se afirma em a) I. apenas. ligado ao cromossomo Y. d) 1/4.4 A probabilidade do casal I x II ter uma criança míope é a) imprevisível. porque 50% dos gametas da mulher transportam o gene recessivo. Questão 603 O esquema mostra a genealogia de uma família.1. 1.4 A partir da análise da ocorrência da doença entre os indivíduos nascidos dos diferentes cruzamentos.5. apenas. II. porque a mulher tem o gene dominante em homozigose. foram feitas as afirmações seguintes. apenas.5. observado a partir de cruzamentos controlados realizados em cativeiro. e os claros os indivíduos de visão normal. e) 1/4. Questão 604 upondo que não haja mutação. c) A família 3 permite concluir que se trata de um caráter recessivo. e) A família 5 mostra que o caráter não pode ser controlado por gene ligado ao cromossomo X.1. IV.1.5. I. b) A família 2 permite concluir que se trata de um caráter autossômico recessivo.4 . II e III. O diagrama representa o padrão de herança de uma doença genética que afeta uma determinada espécie de animal silvestre. porque o casal já tem três filhos com visão normal. c) I.1. porque a mulher tanto pode ser homozigota como heterozigota. apenas. d) I e IV. analise os heredogramas e assinale a alternativa correta. c) 1/2. a) A família l permite concluir que se trata de um caráter dominante ligado ao cromossomo X. Não há nenhuma possibilidade de que um filhote nascido do cruzamento entre os indivíduos II-5 e II-6 apresente a doença. Trata-se de uma doença autossômica recessiva. 137 1. Os símbolos escuros representam os indivíduos míopes. d) A família 4 permite concluir que se trata de um caráter recessivo. Os indivíduos I-1 e I-3 são obrigatoriamente homozigotos dominantes. e) III e IV. porque o gene para a miopia é recessivo. uma vez que são nulas as possibilidades de que desse cruzamento resulte um filhote que apresente a doença. b) II e III. ligado ao cromossomo X.

Observe e analise o esquema a seguir. o indivíduo afetado tem pelo menos um pai afetado b) homens e mulheres afetados é aproximadamente igual.5 possuem o genótipo AA. que representa a árvore genealógica de uma família onde alguns indivíduos são afetados pela doença. .4 ual a probabilidade de o casal II.3 e III. os aquirópodos estão representados por símbolos hachurados. No heredograma a seguir.2 vir a ter uma criança com mucoviscidose? a) 1/8 b) 1/4 c) 1/3 d) 1/2 e) 2/3 Questão 607 Para analisar heredogramas de famílias de seres humanos. Os pulmões das pessoas afetadas apresentam um muco espesso que promove infecções bacterianas.2 e IV.Questão 605 Na espécie humana há um tipo de doença hereditária muito rara denominada Aquiropodia. o indivíduo afetado tem pais afetados Questão 608 O popular "Teste-do-pezinho" feito em recém-nascidos pode detectar a doença fenilcetonúria. e) O genótipo dos indivíduos IV.5.1 e II. 1.4 1.1 .5. Tal doença deve-se à presença de uma enzima defeituosa que não metaboliza 138 om base na análise do heredograma. já que a condição herdada em análise é muito rara.4 é aa. cerca de 75% da prole de pais portadores do gene deve apresentar a característica e) homens afetados é maior do que o de mulheres afetadas. o indivíduo afetado tem pelo menos um pai afetado c) homens e mulheres afetados é aproximadamente igual.1. como é o caso dos indivíduos II.5. os indivíduos afetados têm geralmente pais normais. d) Os pais dos aquirópodos são primos. cerca de 25% da prole de pais portadores do gene deve apresentar a característica d) homens e mulheres afetados é aproximadamente igual. a característica deve aparecer em todas as gerações. os principais critérios para a identificação de um gene recessivo autossômico são aqueles em que o número de: a) homens afetados é diferente do número de mulheres afetadas. a) Pode-se dizer que a Aquiropodia é condicionada por um alelo recessivo a.II. a característica deixa de aparecer em várias gerações. c) Não é possível ter certeza sobre o genótipo de alguns indivíduos. assinale a afirmativa INCORRETA. a característica deve aparecer em todas as gerações. Questão 606 A mucoviscidose é uma doença genética grave que associa problemas digestivos e respiratórios. b) Pode-se assumir que os indivíduos II. que é determinada por um par de genes. os indivíduos afetados têm geralmente pais normais.1.

determine o cruzamento que permite diagnosticar a recessividade do gene que condiciona a fenilcetonúria e a probabilidade de nascer uma menina afetada a partir do cruzamento 12 X 18. Questão 612 Estudos genéticos permitiram verificar que um casal tem 1/4 de probabilidade de ter um descendente com uma determinada anomalia. em que ambos são polidáctilos. d) 2/5.25% e) C e 75% d) 1/12 e) 2/3 Questão 611 Em drosófilas. Questão 610 Um casal. a) 2/3. Em certa comunidade européia. b) 8. e) 1/25. podemos afirmar com certeza que a probabilidade de um novo filho vir a ser albino (sem considerar o sexo).25% d) B e 8. d) 40. Esse casal tem __________ de probabilidade de ter um descendente do sexo masculino e portador da disfunção genética mencionada. Sabendo-se que o avô paterno e a avó materna das crianças eram albinos.corretamente o aminoácido fenilalanina. b) 120.1. uma em cada 20 pessoas com fenótipo normal é heterozigótica quanto ao gene que determina a fenilcetonúria.4 Questão 609 A fenilcetonúria é uma doença com herança autossômica recessiva. o caráter asa vestigial é recessivo em relação ao caráter asa longa. cuja ingestão provoca retardamento mental. será: a) 0% b) 25% c) 50% d) 75% e) 100% 1. tem uma filha também polidáctila e um filho normal.5. Considere um casal normal que teve 6 crianças todas normais. Supondo que todas sofram metamorfose. Em 800 casamentos ocorridos entre membros sadios dessa comunidade. Sabendo-se que a determinação do caráter se deve apenas a um par de genes autossômicos. os indivíduos que apresentam fenilcetonúria estão em negro. Um macho puro de asa longa é cruzado com uma fêmea de asa curta. e) 80. c) 1/8. c) 16. b) 3/9. d) 360. a) C e 50% b) C e 25% c) B e 6. Na genealogia a seguir. qual o número esperado de casamentos com risco de gerar crianças fenilcetonúricas? a) 2. A probabilidade de o casal vir a ter uma filha normal é de: a) 1/4 b) 1/6 c) 1/8 139 . Questão 613 Sabe-se que o albinismo é determinado pela ação de um gene recessivo autossômico. o número esperado de indivíduos de asa curta é de: a) 480. e) 240. Um indivíduo de F1 é retrocruzado com a fêmea parental e se obtém 480 larvas. c) 180.

antes de realizar qualquer exame. a detecção de portadores de anemia falciforme está sendo incluída. Do cruzamento entre plantas heterozigóticas para os dois caracteres resultaram 320 descendentes. espera-se que o número de plantas com flores vermelhas e folhas curtas seja a) 20.5. cujo pai era insensível. e é causada por um alelo recessivo por herança Mendeliana simples. Não há outros casos conhecidos nas famílias. 140 1. podendo ser fatal se não tratada no início da infância. Um casal normal que pretende ter um filho consulta um geneticista. Um homem canhoto e sensível ao PTC. no Rio Grande do Sul. Desses. Questão 615 A anemia falciforme é uma doença hemolítica grave cujas manifestações clínicas incluem anemia. Um casal decide ter um filho. d) 75%. qual a resposta correta que daria à pergunta sobre a probabilidade de nascimento de uma criança com este tipo de anemia? a) 1/2 b) 1/4 c) 1/8 d) 1/9 e) 1/16 .Questão 614 Admita que uma determinada doença neurodegenerativa que provoca convulsões e leve à morte em pouco mais de 10 meses seja determinada por um gene dominante. flores vermelhas são condicionadas por um gene dominante e flores brancas por seu alelo recessivo. Se você fosse o geneticista. obstrução vascular e infartos dolorosos em vários órgãos como os ossos. b) 1/4. b) 60. casa-se com uma mulher destra. e a mulher tem um irmão com esta mesma doença. e) 100%. c) 50%. Esses dois pares de alelos localizam-se em cromossomos diferentes. A probabilidade de sua primeira criança ter fenilcetonúria é de: a) 1/2. e a insensibilidade a essa substância é devida a seu alelo recessivo i . mas consulta um geneticista porque o homem tem uma irmã com fenilcetonúria. c) 160. o baço e os pulmões. folhas longas são condicionadas por um gene dominante e folhas curtas por seu alelo recessivo. O seu padrão de herança é autossômico recessivo. a chance de a criança vir a manifestar a doença corresponde a a) 0 %. e) 320. e) 4/9. Essa doença manifesta-se tardiamente como representado no gráfico a seguir: Questão 616 Fenilcetonúria é uma doença hereditária humana resultante da inabilidade do organismo de processar o aminoácido fenilalanina. b) 25%. Questão 618 Na espécie humana. que está presente nas proteínas da dieta humana. sensível. Devido a sua importância. sendo a habilidade para o uso da mão esquerda devida a seu alelo recessivo e . Questão 617 Em determinada planta.5 e um casal com 35 anos tiver um filho.1. icterícia. d) 180. no teste do pezinho. cuja mãe era canhota e insensível. já que cada um dos cônjuges tem um irmão com anemia falciforme. c) 1/9. A sensibilidade à feniltiocarbamida (PTC) é condicionada pelo gene dominante I. a habilidade para o uso da mão direita é condicionada pelo gene dominante E . d) 2/3. Esses dois pares de alelos apresentam segregação independente.

verdes-rugosas = 300. verdes-lisas = 150. AACC. c) 1/4. aacc. O gene que determina plantas de altura normal (H) é dominante sobre o gene que determina plantas anãs (h). Questão 621 Em ervilha. AaCC. amarelas-rugosas = 320. Deste casal. e) amarelas-lisas = 450.5. Cruzando-se plantas CCHH com plantas CcHh. Questão 622 Um homem albino e de olhos claros casa-se com uma mulher de pele normal e de olhos escuros. d) 100% de plantas anãs com vagens lisas. e) 100% de plantas de altura normal com vagens lisas. verdes-rugosas = 200. verdes-rugosas=100. b) Aacc. aacc. c) amarelas-lisas = 200. cuja mãe é albina. amarelas-rugosas = 200. e) 1/8. uma com cabelos crespos e outra com cabelos lisos. o gene que determina a forma lisa da vagem (C) é dominante sobre o gene que determina vagens com constrições (c). Quantos indivíduos devem ser esperados para cada um dos fenótipos obtidos? a) amarelas-lisas = 80. AaCc.A probabilidade de esse casal vir a ter uma criança canhota e sensível ao PTC é de a) 3/4. verdes-rugosas=50. Qual o genótipo dos pais da criança? a) aacc. b) 3/8. b) amarelas-lisas = 100.2. d) aaCC. c) 100% de plantas de altura normal com vagens com constrições. c) AaCC. verdes-lisas = 100. AaCc.5% d) 25% e) 12. Aacc. A probabilidade de que uma terceira criança seja albina com cabelos crespos é: a) 75% b) 50% c) 37. originou 800 indivíduos. verdes-lisas = 320. uma com sementes amarelas e lisas (VvRr) e outra com sementes amarelas e rugosas (Vvrr). espera-se obter na descendência: a) 50% de plantas anãs com vagens lisas e 50% de plantas de altura normal com vagens com constrições. AaCc. Questão 623 Observe o heredograma a seguir: 1. d) amarelas-lisas = 300. aacc. Questão 619 Do casamento entre uma mulher albina com cabelos crespos e um homem normal com cabelos crespos. amarelas-rugosas = 150. verdes-lisas = 300.5% Questão 620 O cruzamento entre duas linhagens de ervilhas.1 141 . verdes-lisas = 200. verdes-rugosas = 80. AaCc. amarelas-rugosas = 300. amarelas-rugosas = 100. d) 3/16. b) 100% de plantas anãs com vagens com constrições. e) aacc. nasceram duas crianças. nasce uma criança albina e de olhos claros.

1 A probabilidade do casal 4 x 5 ter uma criança diíbrida é: a) 1/8 b) 3/16 c) 1/16 d) 1/4 e) 1/2 Questão 625 Um casal. considere as seguintes afirmações: I . Considerando-se que ambas as anomalias são autossômicas e os respectivos genes estão em cromossomos . assinale a alternativa que apresenta a porcentagem de gametas produzidos por essa planta com pelo menos um gene dominante. então. d) se somente as afirmativas I e II forem corretas. A probabilidade desse casal ter uma criança normal para as duas características é: a) 1/8 b) 1/2 c) 3/8 d) 7/8 e) 3/4 Questão 627 Em ervilhas. a probabilidade do casal ter outra criança normal para as duas características é: a) 1 b) 1/16 c) 3/16 d) 9/16 e) 0 Questão 626 A fenilcetonúria e a miopia são doenças decorrentes da ação de genes autossômicos recessivos.5% e) 25% Questão 628 Qual é a probabilidade de um casal de duplo heterozigotos para dois pares de genes autossômicos com segregação independente vir a ter um descendente com apenas uma característica dominante? a) 15/16 b) 9/16 c) 6/16 d) 3/16 142 1. nasceu uma criança de visão normal e fenilcetonúrica. c) se somente as afirmativas II e III forem corretas. e) se somente a afirmativa II for correta. mas míope. II .O indivíduo 5 é heterozigoto para o gene do uso da mão esquerda e o indivíduo 6 é heterozigoto para o gene da miopia. tem uma criança normal para polidactilia. b) se somente as afirmativas I e III forem corretas.Os indivíduos 2 e 4 têm o mesmo genótipo.Sabendo-se que a miopia e o uso da mão esquerda são condicionados por genes recessivos. os genes que determinam sementes lisas e amarelas são dominantes em relação aos genes que determinam sementes rugosas e verdes.5. com um homem normal para fenilcetonúria e míope. Considerando uma planta de sementes lisas e amarelas. Do casamento entre uma mulher normal. ambos polidáctilos (com mais de 5 dedos) e de visão normal. terão 25% de chance de ter uma filha canhota e de visão normal. filha de mãe com fenilcetonúria e pai míope.2. diferentes. analise a genealogia a seguir e responda. Questão 624 Sabendo-se que a miopia e o uso da mão esquerda são condicionados por genes recessivos. III . Assinale: a) se todas as afirmativas forem corretas.Se o indivíduo 3 se casar com um homem de visão normal (heterozigoto) e canhoto. diíbrida. a) zero b) 75% c) 50% d) 12.

e) 1/16 Questão 629 Considere que em cavalos a coloração do pêlo resulta da ação de dois pares de genes autossômicos localizados em cromossomos não homólogos.(Mmbb).(mmbb).(mmBb).(Mmbb). um gene D e um E.(mmbb). cor marrom.(MmBb). Como resultado. Qual é a probabilidade de um casal DdEE × ddEe vir a ter uma criança com surdez? a) 0% b) 25% c) 50% d) 75% e) 100% Questão 631 As flores de uma determinada planta podem ser vermelhas ou amarelas. Os indivíduos homozigotos dd ou ee são surdos. IV . pelo menos. O gene M condiciona cor preta e seu alelo m. manchas brancas em qualquer cor de pelagem.(mmBb). a alternativa que contém os genótipos dos indivíduos mencionados. é cruzado com uma fêmea marrom com manchas brancas (III). II . determinados por genes que se segregavam independentemente.(Mmbb).(Mmbb). Na descendência do cruzamento VvAa x VvAa espera-se encontrar uma proporção fenotípica de a) 1 vermelha: 1 amarela b) 9 amarelas: 7 vermelhas c) 9 vermelhas: 7 amarelas d) 15 amarelas: 1 vermelha e) 15 vermelhas: 1 amarela Questão 632 O esquema abaixo representa o núcleo de uma célula de um organismo com 2n=4 cromossomos.(MmBb) Questão 630 Considere que a surdez no homem esteja relacionada a dois pares de genes (Dd .(mmbb) b) I . a) I .Ee) localizados em cromossomos não homólogos.(mmBb).(MmBb) d) I . os indivíduos com audição normal possuem. III . ele obteve a primeira linhagem. IV .(Mmbb) c) I . obteve quatro tipos de fenótipos.2.(MmBb).(mmBb) e) I . III . III .(mmBb). sendo um dominante e outro recessivo. 1. II . IV .5. Quantos caracteres esse pesquisador estudava? a) 1 b) 2 c) 3 d) 4 e) 5 Questão 634 Assinale a alternativa que indica os genótipos dos pais que têm ou poderão ter filhos nas seguintes proporções ou percentuais: 143 .(MMbb). Um macho preto com manchas brancas (I). Os alelos de cinco genes estão indicados por letras. II . cujo pai era marrom uniforme (II). o gene B determina coloração uniforme e seu alelo b. IV . na proporção de 9:3:3:1. vvA_ ou vvaa. cuja mãe era preta uniforme (IV). Cruzando dois indivíduos homozigotos. Dois pares de genes (Vv e Aa) determinam essa característica: plantas V_A_ produzem flores vermelhas e plantas V_aa. flores amarelas. II .1 os pares de alelos abaixo aplica-se a segunda lei de Mendel SOMENTE a a) Aa e Mm b) Aa e Dd c) Aa e Nn d) Bb e Nn e) Dd e Mm Questão 633 Um pesquisador averiguava a transmissão de caracteres em vegetais ao longo de gerações.(mmbb). IV . III .(mmBb). Assinale. II . a seguir. na qual promoveu autofecundação. III .

75% de filhos destros. Suponha que um exemplar da planta produza todos os esporos femininos com constituição genética AB e todos os esporos masculinos com constituição ab. obrigatoriamente. sendo triplóide.A. casa-se com Maria.com segregação independente.d a) CCDD e CCDD b) ccdd e ccdd c) CCdd e ccDD d) CcDd e CcDd e) CcDd e ccdd Questão 635 Foram analisadas. Por sua vez. b) Não existe qualqueir chance de nascer um filho polidáctilo dessa relação.25% de filhos canhotos.. os esporos dão origem à geração gametofítica. podendo ter olhos castanhos ou azuis. podendo ser destros ou canhotos. e) Maria produzirá gametas de 4 tipos diferentes para essas características. por meio do processo de mitose. b . Ambos os locos citados são autossômicos. sendo que o alelo dominante produz em seus portadores pigmentação normal.1 probabilidade de o casal 5x6 ter um descendente simultaneamente braquidáctilo e prognata é de a) 1/16 b) 3/16 c) 9/16 d) 3/4 e) 1/4 .75% de filhos com olhos castanhos. tenha constituição AaB ou Aab. Dados: gen para olhos castanhos . a) Todos os filhos desse casal deverão ser albinos. assinale a alternativa CORRETA. 3. e) o embrião tenha constituição AaBb. a e B. enquanto 2 e 4 têm dedos e mandíbula normais. . b) a oosfera (gameta feminino) tenha constituição AB ou ab. 5 e 6 são braquidáctilas e prognatas.5. As pessoas indicadas pelos números 1. A partir das informações anteriores. Questão 636 Em uma planta com autopolinização são estudados dois pares de genes . sendo os indivíduos homozigotos recessivos portadores de pés e mãos normais (com 5 dedos cada). podendo ser destros ou canhotos. em uma família.D gen para mão canhota . .C gen para olhos azuis . homozigota para as duas características. 144 1. c) Antônio poderá produzir 2 tipos de gametas diferentes para essas características. mulher normal para o albinismo. d) A mãe de Maria é. Como. polidáctila a e filha de um homem homozigoto e normal para os dois caracteres e de uma mulher albina e polidáctila. podendo ter olhos castanhos ou azuis. Considere este caso: Antônio. Questão 637 Em humanos a polidactilia é condicionada por um gene dominante. um homem com pés e mãos normais. duas características autossômicas dominantes com segregação independente: BRAQUIDACTILIA (dedos curtos) e PROGNATISMO MANDIBULAR (projeção da mandíbula para frente). porém albino.25% de filhos com olhos azuis. espera-se que a) um dos núcleos gaméticos do tubo polínico tenha constituição a e o outro constituição b.2. c) o endosperma.c gen para mão destra . . o albinismo é condicionado por um gene recessivo. d) o zigoto tenha constituição AB ou ab.

o gene P produz pelagem preta e o seu alelo recessivo p. foi cruzada com uma colorida com patas sem plumas. 3. 8.1 1. 4. 9. patas sem plumas.5. está representada a herança de duas características determinadas por genes autossômicos. espera-se que a proporção de aves homozigotas para os dois pares de genes seja de a) 9/16 b) 6/16 c) 4/16 145 1.1 uais são os indivíduos obrigatoriamente heterozigotos para as duas características? a) 6. d) 1 preto: 3 albinos. 2. 9. 7. 3. pelagem parda desde que esteja presente o gene A. . Considerando que ocorra segregação independente entre esses genes. Uma ave branca com patas com plumas. 4 e 13 Questão 641 Em coelhos. o gene P determina patas com plumas e o seu alelo recessivo. Esses pares de genes são autossômicos e segregam-se independentemente.Questão 638 Do cruzamento entre dois indivíduos portadores do genótipo CcDd. 4. 7 e 13 d) 6. é: a) zero b) 1/2 c) 1/4 d) 1/8 Questão 639 Na genealogia a seguir.2. 9. 8. 11. 13 e 14 b) 6. homozigota para os dois pares de genes. 2. 13 e 14 b) 5. 8. 13 e 15 Questão 640 Na genealogia a seguir. 10.2. 7. Se os decendentes obtidos forem cruzados entre si. 15 e 16 e) 1. Questão 642 Numa ave doméstica. Os animais aa são sempre albinos. 14. 14 e 16 c) 5. a probabilidade de ocorrência na F de indivíduos com o mesmo genótipo dos pais. 12 e 15 c) 1. e) 1 pardo: 3 albinos. a partir do cruzamento PpAa x ppaa espera-se uma proporção fenotípica de a) 1 preto: 1 pardo: 2 albinos. 8. 9 e 15 e) 1. 11. 10. o gene C condiciona plumagem branca e o seu alelo recessivo. 7. b) 1 preto: 1 pardo. 9. uais são os indivíduos que seguramente produzem um só tipo de gameta? a) 6. 2. plumagem colorida. 12 e 15 d) 3. 9. está representada a herança de duas características determinadas por genes autossômicos. c) 1 preto: 1 albino. 3. 4.5.

cujo pai era míope. O mesmo ocorre para os caracteres orelhas eretas ou orelhas caídas. existem quatro variedades: verdes. Dentre esses. e os brancos não têm nem melanina azul nem pigmento amarelo nas penas. Considerando-se que os genes para a melanina e o 146 . os números de genótipos e de fenótipos diferentes entre os descendentes desses cruzamentos são. O cruzamento da F1 gera os quatro tipos de cores na F2. a folha recortada é determinada por um alelo dominante e a lisa. espera-se que a proporção de descendentes heterozigotos para apenas um par de genes seja a) 9/16 b) 1/2 c) 1/4 d) 3/16 e) 1/16 Questão 645 Plantas de genótipo AaBb foram intercruzadas. Sabendo-se que os alelos representados por letras maiúsculas são dominantes e que os não-alelos sofrem segregação independente.2% b) 18. Esses genes estão localizados em cromossomos que se segregam independentemente. Latir enquanto corre e possuir orelhas eretas são características dominantes. Através do intercruzamento de plantas duplo-heterozigóticas. Os genes responsáveis por essas características situam-se em autossomos e apresentam segregação independente. azuis. a cor do hipocótilo púrpura é condicionada por um alelo dominante e a cor verde. latir ou não latir durante a corrida são características definidas por um par de genes alélicos. Considere o cruzamento entre um casal de cães heterozigotos para ambos os pares de alelos. os amarelos carecem de grânulos de melanina. foram obtidos 480 descendentes. respectivamente.7% c) 31.d) 3/16 e) 1/16 Questão 643 No homem. a polidactilia é um caráter dominante e a miopia. é casada com um homem normal. o número esperado de indivíduos com hipocótilo púrpura e folhas lisas é a) 30 b) 90 c) 160 d) 240 e) 270 Questão 648 Numa dada espécie de papagaio. geram-se papagaios verdes na primeira geração (F1). Os papagaios verdes são os únicos normalmente encontrados na natureza. de: a) 6. uma anomalia recessiva. pelo alelo recessivo. A probabilidade deste casal ter uma criança com polidactilia e miopia é a) 0% b) 25% c) 50% d) 75% e) 100% Questão 644 No cruzamento entre indivíduos heterozigotos para dois pares de genes que se segregam independentemente. enquanto não latir durante a corrida e possuir orelhas caídas são recessivas. aproximadamente. a) 3 e 2 b) 6 e 3 c) 9 e 4 d) 12 e 8 e) 16 e 9 Questão 646 Em cães. pelo alelo recessivo. Uma mulher com polidactilia e miopia.7% Questão 647 Em tomateiros. cuja mãe era normal para as duas características. amarelos e brancos. a probabilidade de que nasçam filhotes que latem enquanto correm e que possuem orelhas caídas é. Neste caso.2% d) 43. Quando se cruzam papagaios verdes silvestres com os de cor branca. Os azuis carecem de pigmento amarelo.

Questão 653 Em porcos. 1 branco. e) os genes A e B não são alelos. Questão 649 Em bovinos. por seu alelo recessivo m. e) 9 papagaios azuis. e o tipo de casco é determinado por alelos que segregam em outro cromossomo. para esses genes. Questão 651 A cor preta da pelagem dos cães da raça 'Cocker Spaniel' é governada por um alelo dominante V e a cor vermelha. 1 branco. enquanto o alelo h determina a pelagem branca. b) 100% de animais com pelagem branca. 3 amarelos. 4 brancos. 1 azul. pois o gene para a cor é dominante. b) pode ocorrer recombinação entre os genes A e B. 3 azuis. 1 azul. casco fendido. 64 descendentes. Observou os seguintes resultados: GERAÇÃO P: pêlo preto curto X pêlo marrom longo GERAÇÃO F: pêlo preto curto GERAÇÃO F‚: 81 pêlo preto curto 27 pêlo preto longo 27 pêlo marrom curto 09 pêlo marrom longo Com base nesses resultados. pois o gene para a cor é epistático.pigmento amarelo se encontram em cromossomos diferentes. d) 4 animais com pelagem branca : 3 com pelagem vermelha : 9 com pelagem preta. que eram em número de cinco. c) 9 papagaios verdes. Quantos filhotes do total nascido das várias ninhadas. a cor dos pêlos pode ser branca (P_) ou preta (pp). sendo que F_ condiciona casco indiviso e ff. 1 verde. e o padrão malhado. 4 amarelos. quantos desses apresentarão fenótipo diferente dos pais? 147 . c) os indivíduos da geração F1 são homozigotos. é INCORRETO afirmar que a) os cromossomos de origem materna e paterna que contêm esses genes podem combinar-se livremente. 3 verdes. Questão 650 Um criador fez cruzamentos entre porquinhos-da-índia para estudar as características: cor e tamanho do pêlo. b) as duas características segregam-se independentemente. 1 azul. c) 12 animais com pelagem branca : 1 com pelagem vermelha : 3 com pelagem preta. O padrão uniforme é governado pelo alelo dominante que segrega independentemente no locus M. d) 1 papagaio verde. Um macho preto foi cruzado com fêmeas genotipicamente iguais entre si e fenotipicamente iguais a ele. d) os genes A e B estão em grupos de ligação separados. 1 amarelo. 3 amarelos. está ocorrendo segregação independente. pelo seu recessivo v. entre várias ninhadas. 1 branco. Outro gene determina a pigmentação da pelagem na cor vermelha (b) ou preta (B). b) 4 papagaios amarelos. quanto às características consideradas? a) 9 b) 16 c) 30 d) 45 e) 80 Questão 652 Quando se estuda uma célula meiótica duplo-heterozigota AaBb e se diz que. c) os genes A e B que se situam em diferentes pares de homólogos distribuem-se ao acaso em diferentes gametas. a pelagem colorida é determinada pelo alelo H. O cruzamento entre um touro de pelagem preta (HhBb) com uma vaca de pelagem preta (HhBb) produzirá uma prole com: a) 100% de animais com pelagem preta. d) os indivíduos da geração P formam um só tipo de gameta. e) 9 animais com pelagem preta : 7 com pelagem vermelha. a freqüência esperada de cada um dos tipos de papagaio é a) 9 papagaios brancos. 2 verdes. é INCORRETO afirmar que a) as características pêlo preto e curto são dominantes. Entre as várias ninhadas foram vendidos apenas os filhotes malhados de vermelho. Se porcos diíbridos são cruzados entre si e produzem. se espera que sejam fenotipicamente idênticos ao pai.

se 1. 1. e) I.a) 4. de pares de cromossomos homólogos na placa metafásica. d) O gene para a cor avermelhada é codominante em relação ao alelo. II e III. deduz-se que é um padrão de herança intermediária. c) somente I e III.A lei da segregação independente (2 lei) está relacionada às conseqüências do arranjo. III .5. logo estão relacionadas com o comportamento cromossômico na meiose.5. A F1 resultante apresentou 100% das ervilhas com flores avermelhadas. como mostra a figura a seguir. Está(ão) correta(s): a) somente I. estiverem localizados em cromossomos diferentes. d) somente II e III. e) 60. Após autofecundação das plantas F1. c) A proporção fenotípica 9:7 é um padrão de segregação independente. c) 28. Questão 654 O esquema a seguir representa o cruzamento entre duas variedades puras de ervilha-de-cheiro ('Lathyrus odoratus') de flor branca.2. e) O exemplo é de interação gênica já que está envolvido apenas um loco. b) somente I e II. ao acaso. Questão 655 As afirmativas a seguir relacionam a Genética Mendeliana à Divisão Celular.1 nalise este padrão de herança e assinale a afirmativa CORRETA: a) Trata-se de um exemplo típico da primeira Lei de Mendel. b) 16. b) Pelos resultados.As 1 e 2 Leis de Mendel abordam o comportamento dos genes na formação dos gametas. I . na geração F2.2. foram produzidas 371 plantas com flores avermelhadas e 287 com flores brancas. Questão 656 A mosca-de-fruta 'Drosophila melanogaster' pode apresentar asas vestigiais ou longas e corpo cinza ou ébano.1 148 . II . Cruzando-se um macho de corpo cinza e asas vestigiais com uma fêmea de corpo ébano e asas longas (parentais P) obteve-se F que deu origem a F‚ através da autofecundação.Dois pares de genes se segregam independentemente. na meiose. d) 36.

c) I. apenas. c) DDEE. Questão 658 Uma abelha rainha tem os seguintes pares de genes alelos que segregam independentemente: AaBbDdEe. um gene dominante. IV . III e IV . b) AADDFF. II e IV. a probabilidade de surgir um descendente com genótipo que apresenta. pelo menos. duplo recessivo para o gene "D" e homozigoto dominante para o gene "F". artelhos e solas dos pés. e) Dezesseis. V . II . Questão 657 Um casal de surdos teve dois filhos com audição normal. II e V . apenas. espera-se que o genótipo dos filhos seja a) ddee. III e V .Em F‚. Considere ainda que todos esses genes situam-se em cromossomos diferentes. Sabe-se que os padrões dermatóglifos são de herança multifatorial.A probabilidade de ocorrência do mesmo genótipo dos indivíduos de F em F‚ é de 4/16. d) Oito. As afirmativas corretas são: a) I. I . d) II. apenas.: Considere um tipo de herança mendeliana. relativos a esses cinco pares de genes podem apresentar os zangões filhos dessa rainha? a) Um. apenas. d) DdEe. Questão 661 Do cruzamento de dois indivíduos com genótipo AaBbCc. podem apresentar os zangões filhos dessa rainha? a) Um b) Dois c) Quatro d) Oito e) Dezesseis Questão 659 Considere um homem heterozigoto para o gene "A".Os genes para cor do corpo e pra tipo de asa estão localizados num mesmo cromossoma. a) 1/64 b) 63/64 c) 1/32 d) 1/16 e) 1/4 Questão 662 Os dermatóglifos são padrões típicos das cristas dérmicas nos dedos e palmas das mãos.Após a análise dos resultados dos cruzamentos. d) AdF e adF. e) DDee. e) III. é Obs. quantos genótipos diferentes. Sabendo-se que os zangões surgem de óvulos que se desenvolvem por partenogênese. quantos genótipos diferentes. apenas. b) Dois. Sabendo-se que a surdez é determinada por qualquer dos genes recessivos d ou e. IV e V. alça ou verticilo. A figura a seguir mostra padrões digitais que formam figuras denominadas de arco. e) ADF e adf. Entre os gametas que poderão se formar encontraremos apenas a(s) combinação(ões): a) AdF. 149 .O gene para corpo ébano só está presente na geração P e em parte de F‚. em homozigose. foram feitas as afirmativas abaixo. c) AaddFF. Sabendo-se que os zangões surgem de óvulos que se desenvolvem por partenogênese. c) Quatro. Questão 660 Uma abelha rainha tem os seguintes pares de genes alelos que se segregam independentemente: AaBBccDdEE.Os genes para cor do corpo e forma das asas segregam-se independentemente durante a formação dos gametas. b) I. III . b) Ddee. a probabilidade de ocorrência de homozigose dominante é a mesma de homozigose recessiva. relativos a esses quatro pares de genes.

de semente rugosa e branca. cD. E. b) Esses padrões podem ser úteis ao diagnóstico de certas síndromes cromossômicas. observaram-se 100% das plantas altas. cc. é INCORRETO afirmar: a) Quanto mais semelhantes forem as mãos de gêmeos. abcDE. c) A análise dos padrões digitais não se presta para a determinação de paternidade. poderá produzir quantos tipos geneticamente distintos de gametas? a) 2 b) 4 c) 8 d) 16 e) 32 Questão 668 O desenho abaixo corresponde ao núcleo de uma célula em metáfase de uma espécie cujo número n de cromossomos é 3. Questão 667 Um organismo diplóide. ccDd. A planta pode ser alta devido ao alelo "Br" e baixa devido ao alelo "br". Para estes 4 genes. a) a.5. permitiu constatar que Janaína tem o genótipo AAbbCCDD e Pedro tem o genótipo aaBBccDD. Questão 663 A análise de 4 genes autossômicos. um indivíduo que apresente o genótipo AaBBCcDD produzirá gametas ABCD com a freqüência de: a) 75%. bc. a textura da semente pode ser lisa devido ao alelo "Su" e rugosa devido ao alelo "su". EE. Nessas condições. quantos tipos diferentes de gametas poderia produzir o filho de Janaína e Pedro? a) 4 b) 8 c) 16 d) 32 e) 64 Questão 664 Considere quatro pares de genes que segregam de maneira independente. . A cor da semente pode ser amarela devido ao alelo "Y" e branca devido ao alelo "y". abcdE. c) 25%. foi cruzada com outra planta pura. alta. Dd. Uma planta pura. Bb.2. d. aaEE. b. B. d) 12%. Analisando a figura. e) aB. como a Síndrome de Down. Se as plantas da geração F forem intercruzadas. Na geração F. b) 50%. o número de gametas produzidos pelas plantas F e a proporção fenotípica esperada na geração F‚ será. c) aa. c. BbDd.2 Sobre esse assunto. de semente lisa e amarela.Questão 665 No milho. baixa. cada um com um par de alelos. d) O número de cristas dérmicas não varia entre indivíduos da mesma família. D. e) 6. respectivamente: a) 4 e 3:3:3:1:1:1 b) 8 e 27:9:9:9:3:3:3:1 c) 8 e 9:3:3:1 d) 16 e 9:3:3:1 e) 16 e 27:9:9:9:3:3:3:1 Questão 666 Considere a segunda lei de Mendel ou lei da distribuição independente e indique os gametas produzidos pelo genótipo aaBbccDdEE. com o genótipo AaBBCCDDEE. b) aBcDE. dE. aBcdE. d) aaBb. de semente lisa e amarela. maior será a probabilidade de que eles sejam monozigóticos.25%. é correto afirmar: 150 1.

4 .5.4 .8 b) 4 . poderão ser encontrados 9 genótipos diferentes. sendo. os genótipos das células resultantes serão: a) ABC. a freqüência de descendentes AABbcc será igual a a) 8/64 b) 1/16 c) 3/64 d) 1/4 e) 1/32 Questão 672 Se a mitose ocorre em uma célula de genótipo AaBbCc. onde os três pares de genes estão em pares de cromossomos distintos. com a constituição representada na figura.8 d) 4 . onde os três pares de genes estão em pares de cromossomos separados. portanto. abc c) Aa.8 .2.8 Questão 670 Sessenta células de um animal. poderão ser encontrados 64 genótipos diferentes. abc b) ABC. (32) O sistema em questão é polialélico. (08) Como resultado de uma autofecundação.8 .4 e) 2 . Bb e Cc 151 Questão 669 Indivíduos com os genótipos AaBb. d) 120 espermatozóides. se for realizado um cruzamento entre indivíduos AaBbCc. AbC. poderão ser formados 8 diferentes tipos de gametas. abC.4 -16 . Soma ( ) ão esperados.4 c) 2 . quantos tipos de gametas diferentes? a) 4 . apresentando a constituição ABC. e) 180 espermatozóides. Em experimentos envolvendo três características independentes (triibridismo).2 . b) 60 espermatozóides.5.8 . (16) Como resultado de uma autofecundação. . AaBbcc podem formar. impossível calcular tanto o número de genótipos quanto o de fenótipos. (04) Como resultado de uma autofecundação. ABc. Cc d) AABBCC. aBC.4 . AaBBcc. AaBbCc.8 . (02) Em relação aos genes em questão.2 .8 . Questão 671 Assinale a alternativa correta. AaBB. sofrem meiose. poderão ser formados 4 diferentes tipos de gametas. Abc.4 -16 . respectivamente. aabbcc e) AaBbCc Questão 673 Se a meiose ocorre numa célula de genótipo AaBbCc.2 1. quais serão os genótipos das células resultantes? a) Aa.1. Bb.2.2 . c) 90 espermatozóides. a) 30 espermatozóides. poderão ser encontrados 16 genótipos diferentes.2 (01) Em relação aos genes em questão.

c) 3/4. filho de pai O. 1. Questão 678 Na espécie humana. Qual a probabilidade de esse casal ter uma criança com fenótipo igual ao do pai? a) 1/2 b) 1/4 c) 1/8 152 ssinale a alternativa correta. e) 1/3.5. Um homem de visão normal e destro.5. os indivíduos marcados apresentam um tipo de cegueira noturna. abC e abc d) AaBbCc e) AABBCC e aabbcc Questão 674 Sabendo-se que a miopia e o uso da mão esquerda são condicionados por genes autossômicos recessivos. b) 1/4. d) zero. casa-se com uma mulher normal para ambas as características. cujo pai tinha miopia e era canhoto. Questão 677 Um indivíduo de sangue tipo B. a probabilidade de terem uma menina normal para ambas as características é de: a) 3/16 b) 1/4 c) 1/16 d) 1/2 e) 9/16 . O casal já tem uma filha daltônica e míope. Rh®.b) ABC e abc c) ABC. ABc. AbC. a miopia e a habilidade para a mão esquerda são caracteres condicionados por genes recessivos que se segregam de forma independente. Abc. e) 1.3 1. Questão 675 Um indivíduo daltônico e não míope. A probabilidade de esse casal ter uma criança que possa doar sangue para o pai é de: a) 1/2. a) O indivíduo 2 deve ser heterozigoto para os alelos dessas duas características. que teve eritroblastose fetal ao nascer e é filha de pai do tipo O. cuja mãe era canhota. casa-se com uma mulher míope e destra. Sabendo que o daltonismo é condicionado por um gene recessivo ligado ao sexo e que a miopia é uma herança autossômica recessiva. filho de pai míope. casa-se com uma mulher de sangue tipo A. Rh®. aBc. considere a genealogia a seguir. c) A probabilidade de o casal 1 × 2 ter uma criança destra e de visão normal é de 1/4. aBC. Questão 676 No heredograma a seguir. d) Todos os descendentes de pai míope e canhoto possuem essas características. b) 1/4.3 probabilidade do casal 4X5 ter uma criança de sexo feminino e de visão normal é de: a) 1/6. Rh−. c) 1/8.2. e) A probabilidade de o casal 4 × 5 ter uma criança míope e canhota é de 3/8. b) O indivíduo 3 deve ter herdado os alelos dessas duas características apenas de sua mãe.2. d) 1/2.

(04) 25% de probabilidade de vir a ter olhos normais e ossos frágeis. pergunta-se: I . podemos observar que o número possível de gametas (w) em uma espécie é igual a 2¾. Levando-se em consideração que na espécie humana ocorre a permuta gênica. casa-se com uma mulher de olhos livres de catarata mas com ossos frágeis. (02) 50% de probabilidade de vir a sofrer de catarata e ter ossos normais. em um organismo onde o número haplóide (n) é igual a 3. O principal evento responsável por essa diversidade ocorre durante a formação dos gametas.A ou B ou O.d) 3/4 e) 3/8 Questão 679 Em determinada raça animal.2. (II) . A figura a seguir demonstra a distribuição independente de cromossomos maternos e paternos. A partir do cruzamento Mmbb × mmBb. qual a probabilidade do nascimento de uma criança do tipo AB? A alternativa que responde corretamente às perguntas anteriores é: a) (I) .O ou A ou B. a probabilidade de nascer um filhote marrom com manchas é a) 1/16 b) 3/16 c) 1/4 d) 1/2 e) 3/4 Questão 680 A diversidade biológica dos seres vivos está relacionada. Esses dois pares de alelos autossômicos segregam-se independentemente. com a reprodução sexuada.zero b) (I) . Soma ( ) Questão 682 Sendo um homem de sangue tipo O.Se casar-se com uma mulher de sangue tipo A. a cor preta é determinada pelo alelo dominante M e a marrom pelo alelo m. (08) 50% de probabilidade de vir a apresentar ambas as anomalias. (16) 50% de probabilidade de vir a apresentar apenas uma das anomalias.Se esse homem casar-se com uma mulher de sangue tipo AB. pode-se afirmar que um descendente do casal tem: (01) 100% de probabilidade de nascer livre de ambas as anomalias. quais os prováveis tipos de sangue dos filhos do casal? II . (II) . o alelo B condiciona padrão uniforme e o b.5. que ocorre durante a meiose. pode-se afirmar que a melhor expressão para o número (w) de gametas possíveis está representada em: a) w = 2£¤ b) w > 2£¤ c) w < 2£¤ d) w = 2¢¤ e) w¤ 2¢¤ Questão 681 A cegueira provocada pela catarata e a extrema fragilidade dos ossos são características que podem aparecer em seres humanos e resultam da ação de dois genes dominantes autossômicos presentes em cromossomos diferentes. presença de manchas brancas. Nessas condições. Um homem com catarata e ossos normais cujo pai tem olhos normais.50% 153 1. Assim. O pai da mulher tem ossos normais.3 . principalmente.

c) os resultados dos grupos sangüíneos e de DNA não excluem a possibilidade do homem ser pai da criança. 154 .c) (I) . b) menor que a chance de nascerem todos com sangue do tipo AB. e) os resultados de DNA contradizem os resultados dos grupos sangüíneos. A probabilidade de os pais desse menino terem mais um filho com o mesmo fenótipo de seu irmão.zero e) (I) . d) menor que a chance de nascerem sucessivamente com sangue do tipo AB. Rh−. mas possuidor do antígeno Rh. AB d) A. B. mas a seqüência de DNA do cromossomo X exclui.pai sem aglutininas do sistema ABO no sangue.50% d) (I) . foram realizados exames para identificação de grupos sangüíneos e análise de DNA. A.A ou B. .A ou B. Os tipos de sangue dos filhos são apenas: a) A e AB b) A e B c) A. B.1 a) os resultados dos grupos sangüíneos excluem a possibilidade do homem ser o pai da criança. (II) .menino de tipo sangüíneo A.5. c) maior que a chance de nascerem todos com sangue do tipo AB.A ou B. . o grupo sangüíneo e o fator Rh é de a) 1/16 b) 1/12 c) 1/8 d) 1/4 e) 1/2 Questão 684 Nas hemácias de um indivíduo pertencente ao grupo sangüíneo B: a) existe o aglutinógeno B b) existe o aglutinógeno A c) existe a aglutinina A d) existe a aglutinina B e) existem o aglutinógeno A e a aglutinina B Questão 685 Um homem de genótipo AB casa-se com uma mulher receptora universal. podemos afirmar que: 1. B. (II) .mãe de tipo sangüíneo B. O e) A. A tabela a seguir resume os resultados parciais da análise de grupos sangüíneos (do menino. e) maior que a chance de nascerem sucessivamente com sangue do tipo AB. casada com um homem de sangue tipo B. B. b) os resultados dos grupos sangüíneos não excluem a possibilidade do homem ser o pai da criança. Questão 687 Uma mulher de sangue tipo A. A e A.25% Questão 683 Considere os seguintes dados: . (II) . correspondentes a um segmento localizado num autossomo e outro no cromossomo X. Rh−. d) os três resultados foram necessários para confirmar que o homem é mesmo o pai da criança. Considerando apenas a tabela adiante. Se o casal vier a ter outros 5 filhos. de sua mãe e do suposto pai) e de duas seqüências de DNA (do menino e do suposto pai). a chance deles nascerem todos com sangue do tipo O é a) igual à chance de nascerem todos com sangue do tipo AB. os outros exames foram desnecessários. B. levando em conta o sexo. A e B.3. O Questão 686 Num caso de investigação de paternidade. teve um filho de sangue tipo O.

Após alguns segundos. respectivamente: 1. foram colocadas três gotas de seu sangue sobre uma lâmina de vidro.homozigoto recessivo. c) heterozigoto . b) quantitativa.heterozigoto. adicionando-se. c) polialelia. c) A e Rh negativo.Questão 688 Para se determinar o tipo sangüíneo de uma pessoa.homozigoto dominante. d) homozigoto .1 155 .heterozigoto. assinale a opção correspondente ao possível genótipo da pessoa em teste: a) IÞIÞRR b) IÞIßrr c) IßiRr d) IÞirr e) iiRR Questão 689 No heredograma a seguir estão indicados os fenótipos dos grupos sangüíneos ABO e Rh.5. b) heterozigoto .1 om relação a esses resultados. conforme o esquema adiante. em relação aos locos dos sistemas ABO e Rh.5. e) homozigoto . e) poligênica. A cada gota foi juntada igual quantidade de soro anti-A na primeira.homozigoto dominante. A partir desses dados podemos afirmar que o indivíduo. a) heterozigoto . soros anti-A. a cada uma. é: a) B e Rh positivo. b) AB e Rh negativo. soro anti-B na segunda e soro anti-Rh na terceira. Questão 691 A herança do sistema ABO é do tipo: a) com dominância.3.3. Após a mistura do sangue com os respectivos soros. anti-Rh e anti-B. foi observada aglutinação nas duas primeiras lâminas. d) AB e Rh positivo. Questão 692 Qual das opções a seguir relaciona os grupos sangüíneos de um doador universal ideal? a) ARh− b) ABRh® c) ORh® d) ABRh− e) ORh− Questão 693 Considerando os casamentos a seguir. foi colocada uma gota de sangue humano em cada uma delas. d) pleiotropia. notou-se aglomeração de hemácias apenas no local onde havia soros anti-B e anti-A. Rh+ poderá ser filha: 1. quanto aos grupos sanguíneos ABO e fator Rh. Questão 690 Utilizando-se três lâminas de microscopia. uma criança de tipo sangüíneo B. O indivíduo 6 deverá ser. e) A e Rh positivo.

3. c) o casal III ou do casal IV. Questão 696 A respeito do heredograma acima.3.3.5. c) O indivíduo 6 é homozigoto. a) O indivíduo 9 pode ser doador universal. b) O indivíduo 7 pertence ao grupo sangüíneo A. Questão 694 Jorge. Rh® é: a) 100% b) 25% c) 75% d) 50% e) 0 Questão 695 Uma mulher que possui aglutinina anti-B no seu sangue teve um filho do grupo O. e) IÞi e IßIß. e) O indivíduo 8 é heterozigoto.1. 156 .1 a) somente do casal I.5. b) do casal I ou do casal IV. d) O indivíduo 1 é receptor universal. b) IÞIÞ e Ißi.1 1. Questão 697 1. a probabilidade do casal ter uma criança do tipo A. Sabendo que o casal 5×6 já perdeu uma criança com eritroblastose fetal. Sabendo-se que Tânia teve eritroblastose fetal ao nascer. que mostra a tipagem ABO e Rh dos indivíduos.5. assinale a alternativa INCORRETA. os genótipos do casal são: a) IÞi e IÞi.1 Considere o heredograma acima. Sabendo-se que o marido tem o aglutinogênio B. d) IÞIß e IÞIÞ. que tem tipo sangüíneo A. Rh− e é filho de pai tipo A e mãe tipo B. d) somente do casal II e) do casal I ou do casal II ou do casal III. que considera o sistema sangüíneo ABO. que é filha de pai e mãe do tipo B. recebeu transfusão de sangue de sua mulher Tânia. a probabilidade de nascer uma menina do tipo O. c) IÞi e Ißi. Rh® é de: a) 1/6 b) 1/8 c) 1/2 d) 1/4 e) 1/3 Questão 698 O heredograma a seguir mostra os diferentes tipos sangüíneos existentes em uma família.

IÞIß Questão 699 Pais cujo grupo sanguíneo são AB e O têm cinco filhos com os seguintes fenótipos: dois são O. e) AB e O.2 a) O . Epaminondas. Dr.Indivíduos que apresentem apenas alelo dominante Iß e não apresentem IÞ pertencem ao grupo B. somente. d) A e B. o fenótipo e o genótipo do indivíduo II. um B e um AB.Indivíduos que apresentem apenas alelo dominante IÞ e não apresentem Iß pertencem ao grupo A. FATOR Rh: positivo. Josefa.5. c) A e O. somente. b) B e B. O teste subseqüente revelou que o soro do Dr. um A. Josefa. FATOR Rh: positivo No ambulatório de uma pequena cidade do interior estava D.3. Entretanto sabe que seu pai é A+. b) TIPO SANGÜÍNEO: O. . somente. Josefa apresenta sangue do grupo: a) A b) B c) AB d) O Questão 703 O esquema apresenta uma árvore genealógica de alguns primatas e seus possíveis grupos sangüíneos no sistema ABO. respectivamente. Epaminondas. somente. que é do grupo A. FATOR Rh: negativo ou positivo.1.Indivíduos que apresentem os dois alelos dominantes IÞ e Iß pertencem ao grupo AB. e) TIPO SANGÜÍNEO: O. que precisava urgentemente de transfusão sangüínea. somente. Dr. FATOR Rh: negativo. somente. fazendo o mesmo com o sangue de D. Questão 702 ssinale a alternativa que contém. Assinale a opção que contém o(s) grupo(s) sangüíneo(s) e o(s) tipo(s) de Rh que Alexsander pode ter: a) TIPO SANGÜÍNEO: A.Indivíduos que apresentem apenas alelos recessivos ii pertencem ao grupo O. c) TIPO SANGÜÍNEO: A ou O. de acordo com a seguinte composição genética: .Ißi e) AB . Epaminondas pode concluir que D.1 ou negativo. . sua mãe O+ e seu irmão é A-.IÞi c) A . usou de um outro recurso: retirou um pouco de seu próprio sangue do qual separou o soro. Questão 701 Alexsander não sabe qual é o seu grupo sangüíneo e o seu tipo de Rh. Os tipos sangüíneos dos pais biológicos dessa criança são: a) A e A. mas não se sabia o seu grupo sangüíneo. Quantos filhos biológicos tem esse casal? a) 5 b) 4 c) 3 d) 2 e) 1 Questão 700 Uma criança tem tipo sangüíneo do tipo AB. d) TIPO SANGÜÍNEO: A ou O. Josefa.IÞIÞ d) B . A partir dos resultados. Josefa não era capaz de aglutinar as hemácias do Dr. . Como faltavam anti-soros para a determinação dos grupos sangüíneos no sistema ABO. Epaminondas provocava aglutinação das hemácias de D. mas o soro de D. FATOR Rh: positivo.ii b) A . 157 .

Questão 705 Suponha que um grupo de pessoas. o casamento entre pessoas pertencentes ao grupo O origina apenas descendentes do grupo O.3. b) Orangotangos podem apresentar três grupos sangüíneos. c) O gene O é recessivo e. A população originária desse grupo vive até hoje no mesmo local. são mostradas as freqüências aproximadas dos grupos sangüíneos do sistema ABO da população original (tabela 1) e da população atual (tabela 2). d) Alguns gorilas podem receber sangue de alguns orangotangos. apenas dois.1 1. Essa situação leva a uma menor freqüência dessas pessoas na população. 1. portanto. os casamentos entre pessoas O e A e entre pessoas O e B apresentam 50% de chance de produzir descendentes pertencentes ao grupo O. Nas tabelas a seguir. mas chimpanzés. Questão 704 Os esquemas mostram as possíveis transfusões de sangue tradicionais em relação aos sistemas ABO e Rh.3. Assim. somente humanos podem apresentar os quatro grupos sangüíneos no sistema ABO.5. d) As pessoas pertencentes ao grupo AB são recessivas e. b) O gene O é dominante sobre os genes A e B. totalmente isolada. apresentam pouca chance de existir numa população.5. pertences a uma determinada seita religiosa. e) As pessoas pertencentes ao grupo AB só recebem sangue de AB. é correto afirmar. imigrou para uma região há mais de meio século. Considerando-se apenas os antígenos do sistema ABO.1 De acordo com o esquema. EXCETO: a) Apenas dois dos primatas citados podem apresentar indivíduos doadores universais no sistema ABO. mas não de chimpanzés.5. 1. os casamentos entre as pessoas O e A e entre pessoas O e B produzem apenas descendentes pertencentes ao grupo O. portanto. Assim.3. c) Apenas dois dos primatas da árvore podem apresentar indivíduos receptores universais no sistema ABO. respectivamente: a) O Rh® e O Rh− b) O Rh− e AB Rh® c) A Rh− e OB Rh® d) AB Rh® e O Rh− Qual das alternativas a seguir apresenta uma explicação possível para a mudança na freqüência dos grupos sangüíneos nessa população? a) O gene O é dominante sobre os genes A e B. Questão 706 Observe a árvore genealógica a seguir para o grupo sangüíneo (ABO) em uma família: 158 .1 Pode-se dizer que os tipos sanguíneos mais difíceis e mais fáceis para receber sangue são.

3. marque a opção correta: a) o indivíduo 3 é do grupo sangüíneo "AB" b) o indivíduo 1 pode ser do grupo sangüíneo "AB" c) o indivíduo 1 é do grupo sangüíneo "A" d) o indivíduo 1 é do grupo sangüíneo "O" Questão 707 Observe a árvore genealógica a seguir. II .b. II . III . II . MN.5. AB × AB 159 OBS: 1. dois irmãos são do grupo sangüíneo A.a e) I . Rh− b. N.c. Dos pares de genótipos a seguir.b c) I . III .a. III . AB.3. B. CASAIS I. N.c b) I . III . A.c. Rh− c. a) I . O indivíduo 4 é homem do grupo sangüíneo "B" 3. Rh® teve três crianças com pais distintos: 1. III . N.a.b. II . o único que pode ser dos pais desses indivíduos é a) ii × Ißi b) IÞi × IÞIß c) IÞi × Ißi d) IÞIÞ × IÞIß e) IÞIÞ × IßIß Questão 710 Os tipos sangüíneos do sistema ABO de três casais e três crianças são mostrados a seguir.a Questão 709 Sabe-se que. Rh− PAIS a.b. Rh− II. N. para o grupo sangüíneo ABO em uma família: 1. Rh® Assinale a alternativa que relaciona corretamente cada criança ao seu pai. Rh® III.Legenda: Grupo "A": A/A ou A/O Grupo "B": B/B ou B/O Grupo "AB": A/B Grupo "O": O/O arque a opção correta: a) o indivíduo nŽ 5 pode ser de grupo sangüíneo "AB" b) o indivíduo nŽ 1 é do grupo sangüíneo "AB" c) o indivíduo nŽ 6 é do grupo sangüíneo "AB" d) o indivíduo nŽ 7 não pode ser filho do casal 5×6 Questão 708 Uma mulher com grupos sangüíneos B.5.a.c.1 CRIANÇAS I. O indivíduo 2 é mulher do grupo sangüíneo "A" 2. numa família.b. N. M. II . B. outro é do grupo AB e outro do grupo O. O indivíduo 5 é mulher do grupo sangüíneo "O" Sobre a árvore anterior.1 . A. O.c d) I .

II. B × B III. A × O CRIANÇAS a. A b. O c. AB Sabendo-se que cada criança é filha de um dos casais, alternativa que associa corretamente cada casal a seu filho é a) I - a; II - b; III - c b) I - a; II - c; III - b c) I - b; II - a; III - c d) I - c; II - a; III - b e) I - c; II - b; III - a Questão 711 Uma criança necessita urgentemente de uma transfusão de sangue. Seu pai tem sangue do tipo B e sua mãe, do tipo O. Que outro(s) tipo(s) de sangue, além do tipo O, poderia(m) ser utilizado(s) na transfusão, mesmo sem a realização de teste, sabendo-se que o avô paterno da criança tem sangue do tipo AB e sua avó paterna tem sangue do tipo O? a) Tipo AB. b) Tipo A. c) Tipo B. d) Tipo A e tipo B. e) Nenhum outro tipo. Questão 712 Na herança do sistema sangüíneo ABO, há três alelos autossômicos principais: IÞ (para sangue do tipo A), Iß (para sangue do tipo B) e i (para sangue do tipo O). Sabe-se, ainda, que IÞ e Iß são codominantes, ambos dominando sobre i. Uma mulher do tipo A, casada com um homem do tipo B, teve uma filha do tipo O. O homem não quis reconhecer a paternidade alegando infidelidade por parte da mulher. Como na época em que o fato ocorreu não havia o "exame do DNA", o Juiz recorreu a um geneticista que lhe apresentou um parecer sobre o caso. Assinale a alternativa que contém a conclusão correta do geneticista. a) O homem tem razão, pois, por se tratar de um caso de herança ligada ao sexo, a filha dos dois teria que ser, obrigatoriamente, do tipo A.

b) O homem tem razão, pois, pais com tipos A e B, quaisquer que sejam seus genótipos, jamais poderiam ter filhos ou filhas do tipo O. c) O homem não tem razão, pois, pais com tipos A e B, dependendo de seus genótipos, podem ter filhos ou filhas com qualquer um dos tipos sangüíneos (A, B, AB e O). d) O homem não tem razão, pois, por se tratar de herança autossômica, filhos e filhas teriam que ser, obrigatoriamente, do tipo O. e) O homem tem razão, pois, pais com tipos A e B, só podem ter filhos ou filhas do tipo AB, visto que IÞ e Iß são codominantes. Questão 713 Mulher branca, submetida à inseminação artificial, deu à luz gêmeos de cor negra. O fato causou polêmica, já que o pai também é branco. A grande dúvida é saber se houve troca de embriões ou apenas de um dos gametas. Adaptado do "Jornal do Brasil", 1Ž de agosto de 2002 Considere o fato relatado e suponha que a mãe tenha sangue tipo A e seja filha de pai e mãe com sangue tipo AB. Nesse caso, o tipo sangüíneo dos gêmeos poderia ser: a) A ou O b) A ou AB c) B ou O d) B ou A e) AB ou O Questão 714 É necessário o conhecimento do tipo sangüíneo em caso de transfusão. Em relação ao sistema ABO, ( ) indivíduos do grupo sangüíneo O podem doar sangue para pessoas do seu próprio tipo sangüíneo e para os demais . ( ) indivíduos do grupo AB podem receber sangue de qualquer tipo. ( ) indivíduos portadores de sangue do tipo A possuem aglutinogênios A. ( ) indivíduos do grupo B possuem aglutinina anti-A.

160

Questão 715 Além do teste de DNA, há exames mais simples que podem ajudar a esclarecer dúvidas sobre paternidade. Por exemplo, o teste de tipagem sangüínea do sistema ABO permite determinar quem não pode ser o pai. Assinale a alternativa que apresenta uma situação em que esse exame assegura a exclusão da paternidade: a) O filho é do tipo O, a mãe do tipo O e o suposto pai do tipo A. b) O filho é do tipo AB, a mãe do tipo AB e o suposto pai do tipo O. c) O filho é do tipo AB, a mãe do tipo A e o suposto pai do tipo B. d) O filho é do tipo B, a mãe do tipo B e o suposto pai do tipo O. e) O filho é do tipo A, a mãe do tipo A e o suposto pai do tipo B. Questão 716 O heredograma a seguir representa uma família na qual foram determinados os grupos sangüíneos do sistema ABO para alguns dos membros, e do sistema Rh para todos os membros. Com base nas informações contidas no heredograma e em seus conhecimentos sobre o assunto, é INCORRETO afirmar-se que

a) a probabilidade do indivíduo I-2 formar gametas iR é de 50%. b) a probabilidade de II-4 ter uma criança com eritroblastose fetal é de O%. c) os indivíduos Rh positivos da geração II pertencem ao grupo sangüíneo A, e os Rh negativos, ao grupo O. d) o indivíduo I-1 é heterozigoto para uma das características. e) os indivíduos II-3 e II-4 podem apresentar os dois tipos de aglutinina do sistema ABO. Questão 717 Nas situações em que vítimas de acidentes necessitam de transfusão de sangue, sem que se conheça o tipo sangüíneo de cada uma delas, é recomendável utilizar-se o tipo "O negativo". É CORRETO afirmar que, nesse caso, tal tipo sangüíneo é o mais adequado porque, nas hemáceas do doador, estão a) presentes os antígenos correspondentes aos anticorpos do receptor. b) ausentes os anticorpos correspondentes aos antígenos do receptor. c) ausentes os antígenos correspondentes aos anticorpos do receptor. d) presentes os anticorpos correspondentes aos antígenos do receptor. Questão 718 Com relação à genética dos grupos sangüíneos ABO, pode-se afirmar que: a) existem 16 modalidades de cruzamentos de gametas. b) existem 9 possibilidades de acasalamentos. c) indivíduo com grupo sangüíneo O não pode ser filho de acasalamento de indivíduos dos grupos O e AB. d) indivíduo do grupo sangüíneo B não pode ser filho de acasalamento de indivíduos dos grupos O e AB. e) indivíduo com grupo sangüíneo AB pode ser filho de acasalamento de indivíduos dos grupos O e B. Questão 719 A respeito dos grupos sangüíneos avalie as proposições abaixo. ( ) Grupo sangüíneo: A
161

1.5.3.1

Antígenos: A Anticorpos: Anti-B Doa: A, AB Recebe: A, O ( ) Grupo sangüíneo: B Antígenos: B Anticorpos: Anti-A Doa: B, AB Recebe: B, O ) Grupo sangüíneo: AB Antígenos: A e B Anticorpos: Anti-A e Anti-B Doa: AB Recebe: AB, A , B, O ) Grupo sangüíneo: O Antígenos: O Anticorpos: Não tem Doa: O, A, B, AB Recebe: O ) Grupo sangüíneo: A Antígenos: A Anticorpos: Anti-A Doa: A, AB Recebe: A, O Questão 720 Na figura a seguir são mostrados os genótipos e fenótipos possíveis, considerando-se os alelos IÞ, Iß e i determinantes dos grupos sangüíneos do sistema ABO no homem. De acordo com a figura, analise as proposições a seguir.

(

) Todos os descendentes de um casal de genótipo tipo 2 serão do grupo A e apresentarão em suas hemácias o aglutinogênio A. 2) Indivíduos do grupo sangüíneo B de genótipo 3 ou 4 apresentam na membrana de suas hemácias aglutinogênio B e, no plasma, aglutinina anti-A. 3) Os descendentes de um casal (genótipo 5) do grupo sangüíneo AB serão fenotipicamente AB e, como têm em seus genótipos os alelos IÞ e Iß, apresentam, na membrana de suas hemácias, os antígenos A e B. 4) Indivíduos do grupo sangüíneo O de genótipo 6, apresentam aglutinogênios A e B no plasma, mas não têm aglutininas anti-A e anti-B na membrana de suas hemácias. Está(ão) correta(s) apenas: a) 2 b) 1 e 4 c) 2 e 4 d) 2 e 3 e) 2, 3 e 4 Questão 721 Três irmãos (João, José e Maria) realizaram um exame de sangue em laboratório para identificar os seus tipos sangüíneos, com o objetivo de verificar a possibilidade de doarem sangue ao pai, que necessitaria de uma transfusão após uma cirurgia. Um deles (João) ficou surpreso ao descobrir seu tipo sangüíneo - O - e achou que não era filho biológico do casal que o criou. Seu pai e o irmão apresentam sangue do tipo A e sua mãe e a irmã apresentam sangue do tipo B. Todos são RH®. Com base no texto e em seus conhecimentos sobre a herança dos tipos sangüíneos, é correto afirmar que a) João não pode ser filho biológico do casal, pois de acordo com a herança genética possível do tipo sangüíneo, os filhos somente poderiam apresentar sangues dos tipos A, B e AB. Dos filhos biológicos, somente José pode doar sangue ao pai, pois as hemácias de seu sangue apresentam aglutinogênio A. b) João pode ser filho biológico do casal, desde que pelo menos um dos pais seja heterozigoto e apresente o alelo responsável pela presença de aglutininas anti-A e anti-B no plasma. O pai não pode receber sangue de Maria, pois seu sangue apresenta aglutinina anti-B. c) João não pode ser filho biológico do casal, assim como seus dois irmãos, pois de acordo com a herança genética
162

(

(

1.5.3.1

possível do tipo sangüíneo, os filhos somente poderiam apresentar sangues dos tipos AB. O pai pode receber sangue de João e José, pois o sangue dele apresenta aglutinina anti-A, assim como o de seus filhos. d) Se Maria engravidar de um homem com o mesmo genótipo para o tipo sangüíneo de seu irmão João, existe a probabilidade de 100% de seu filho ter sangue do tipo B. Porém, se ela engravidar de um homem com o mesmo genótipo para o tipo sangüíneo de seu irmão José, existe a probabilidade de 50% de seu filho ter sangue do tipo AB, 25% do tipo A e 25% do tipo B. e) João pode ser filho biológico do casal, desde que ambos os pais sejam heterozigotos e apresentem o alelo responsável pela ausência de aglutinogênio. João pode doar sangue para seu pai, pois as hemácias do seu sangue não apresentam aglutinogênios. Questão 722 Jorge, portador de grupo sangüíneo AB Rh-, e Júlia, que é AB Rh+, têm uma filha, Joana, que aos 3 anos de idade necessita de uma transfusão sangüínea. Os exames laboratoriais por hemaglutinação dão os seguintes resultados:

b) seus eritrócitos não contêm anticorpos anti-A e anti-B. c) seu plasma não contém antígenos A e B. d) seus eritrócitos não contêm antígenos A e B. e) seu sangue não contém antígenos nem anticorpos. Questão 724 A herança dos tipos sangüíneos do sistema ABO constitui um exemplo de alelos múltiplos (polialelia) na espécie humana. Com relação ao sistema ABO é CORRETO afirmar que: (01) o tipo O é muito freqüente e, por este motivo, o alelo responsável por sua expressão é dominante sobre os demais. (02) os indivíduos classificam-se em um dos quatro genótipos possíveis: grupo A, grupo B, grupo AB e grupo O. (04) existem três alelos: o IÞ, o Iß e o i. (08) os alelos IÞ e Iß são codominantes. (16) se um indivíduo do grupo A for heterozigoto, ele produzirá gametas portadores de IÞ ou de i. (32) os indivíduos de tipo sangüíneo O possuem aglutinogênios em suas hemácias, porém não possuem aglutininas no plasma. (64) em alguns cruzamentos, entre indivíduos do grupo A com indivíduos do grupo B, é possível nascerem indivíduos do grupo O. Questão 725 Em relação ao sistema sangüíneo ABO, um garoto, ao se submeter ao exame sorológico, revelou ausência de aglutininas. Seus pais apresentaram grupos sangüíneos diferentes e cada um apresentou apenas uma aglutinina. Os prováveis genótipos dos pais do menino são a) Ißi - ii. b) IÞi - ii. c) IÞIß - IÞi. d) IÞIß - IÞIÞ. e) IÞi - Ißi.

1.5.3.1

Em face dos dados apresentados, assinale a alternativa correta. a) Joana não pode ser filha natural de Júlia. b) Joana não pode receber sangue O Rh-. c) Jorge não pode ser o pai natural de Joana. d) Joana pode receber sangue AB Rh-. e) Joana pode ser homozigota para B. Questão 723 Em uma transfusão sangüínea, indivíduos do grupo O são considerados doadores universais porque a) seu plasma não contém anticorpos anti-A e anti-B.

163

Questão 726 Para os grupos sangüíneos do sistema ABO, existem três alelos comuns na população humana. Dois (alelos A e B) são co-dominantes entre si e o outro (alelo O) é recessivo em relação aos outros dois. De acordo com essas informações, pode(m)-se afirmar: I. Se os pais são do grupo sangüíneo O, os filhos também serão do grupo sangüíneo O. II. Se um dos pais é do grupo sangüíneo A e o outro é do grupo sangüíneo B, todos os filhos serão do grupo sangüíneo AB. III. Se os pais são do grupo sangüíneo A, os filhos poderão ser do grupo sangüíneo A ou O. Está(ão) correta(s) a) apenas I. b) apenas II. c) apenas III. d) apenas I e III. e) I, II e III. Questão 727 Observe a genealogia.

ara o casal (5 e 6) que pretende ter muitos filhos, foram feitas as quatro afirmações a seguir. I - O casal só terá filhos AB e Rh positivo. II - Para o sistema ABO, o casal poderá ter filhos que não poderão doar sangue para qualquer um dos pais. III - O casal poderá ter filhos Rh positivo, que terão suas hemácias lisadas por anticorpos anti-Rh produzidos durante a gravidez da mãe. IV - Se for considerado apenas o sistema Rh, o pai poderá doar sangue a qualquer um de seus filhos. São corretas, apenas, as afirmações a) II e IV b) I, II e IV c) II, III e IV d) I, II e III. e) I e III. Questão 728 Em um acidente de carro, três jovens sofreram graves ferimentos e foram levados a um hospital, onde foi constatada a necessidade de transfusão de sangue devido a forte hemorragia nos três acidentados. O hospital possuía em seu estoque 1 litro de sangue do tipo AB, 4 litros do tipo B, 6 litros do tipo A e 10 litros do tipo O. Ao se fazer a tipagem sangüínea dos jovens, verificou-se que o sangue de Carlos era do tipo O, o de Roberto do tipo AB e o de Marcos do tipo A. Considerando apenas o sistema ABO, os jovens para os quais havia maior e menor disponibilidade de sangue em estoque eram, respectivamente, a) Carlos e Marcos. b) Marcos e Roberto. c) Marcos e Carlos. d) Roberto e Carlos. e) Roberto e Marcos. Questão 729 Considerando o casamento entre um homem tipo sangüíneo A®, cujo pai era O−, com uma mulher B® cuja mãe era A−, assinale a(s) alternativa(s) correta(s). (01) A probabilidade de nascer 1 filha mulher B® é 3/16. (02) A probabilidade de nascer 1 filho homem O− é nula. (04) A probabilidade de nascer 1 filho homem e 1 filha mulher AB é 9/1024.
164

1.5.3.1

(08) A probabilidade de nascer filho homem AB− é 1/16. (16) A probabilidade de nascer 1 filho homem A® é 1/8. (32) A probabilidade de nascer 2 filhas mulheres A− é 1/1024. Questão 730 Uma mulher Rh− casou-se e teve um filho. Numa segunda gestação a criança apresentou um quadro de eritroblastose fetal. Com estes dados, indique qual a opção que apresenta o fenótipo para o fator Rh da mãe, do pai e da criança, respectivamente. a) Mãe Rh negativo, Pai Rh positivo e Criança Rh positivo. b) Mãe Rh positivo, Pai Rh positivo e Criança Rh negativo. c) Mãe Rh positiva, Pai Rh negativo e Criança Rh negativa. d) Mãe Rh positivo, Pai Rh negativo e Criança Rh positivo. e) Mãe Rh negativo, Pai Rh positivo e Criança Rh negativo. Questão 731 A observação do esquema a seguir, que representa a genealogia de uma família em relação aos grupos sanguíneos MN, nos permite afirmar que:

a) Rh positivo e Rh negativo. b) Rh negativo e Rh positivo. c) Rh positivo e Rh positivo. d) Rh negativo e Rh negativo. e) Rh positivo e Rh neutro. Questão 733 A doença hemolítica do recém-nascido é um problema causado pela incompatibilidade sangüínea entre mãe e feto. Assinale a alternativa que contém a família na qual é possível a ocorrência da citada doença. a) Mãe: Pai: 1Ž bebê: 2Ž bebê: b) Mãe: Pai: 1Ž bebê: 2Ž bebê: c) Mãe: Pai: 1Ž bebê: 2Ž bebê: IÞi Ißi IÞIß Ißi IÞIÞ IßIß IÞIß IÞIß ii ii ii ii rh Rh Rh Rh rh rh rh rh

Rh rh rh rh Rh rh rh rh rh rh rh rh Rh Rh Rh Rh rh Rh rh rh rh rh rh rh rh rh rh rh rh rh rh rh

1.5.3.2

d) Mãe: ii Pai: Ißi 1Ž bebê: Ißi 2Ž bebê: ii e) Mãe: IÞi Pai: ii 1Ž bebê: IÞi 2Ž bebê: ii Questão 734

a) sangue MN é característica determinada por gene dominante. b) os indivíduos 4 e 5 são heterozigotos. c) o casal 3 e 4 poderá ter filhos dos três tipos de grupos sanguíneos. d) se o indivíduo 5 casar-se com uma mulher de sangue N, todos os filhos serão heterozigotos. e) um próximo filho do casal 6 e 7 poderá ser do grupo N. Questão 732 Quanto ao surgimento da eritroblastose fetal, ou doença hemolítica do recém-nascido, podemos afirmar que ela ocorre quando o pai e a mãe respectivamente apresentam:

Paula, portadora do aglutinogênio B e Rh negativo casou-se com João, portador dos aglutinogênios A e B e Rh positivo. Sabendo-se que a mãe de Paula não possui aglutinogênios e que João teve um irmão com doença hemolítica do recém nascido, conclui-se que a probabilidade de o casal ter um filho Rh positivo e sangue tipo A é: a) 9/16
165

que tem Rh−. Pedro e Marina.2 onsidere as seguintes afirmações: I . Carlos. c) a mãe pode pertencer ao tipo sangüíneo O. Questão 738 O quadro abaixo mostra os resultados das tipagens ABO e Rh de um casal e de seu filho. Fazendo um exame pré-natal e relatando esse fato ao médico. pois o primeiro filho em geral não tem a anemia. Questão 739 Indivíduos sem antígeno Rh nas hemácias são considerados recessivos. b) despreocupado. III . pois todos os filhos desse casal serão abortados. Questão 737 Uma criança tem genótipo igual ao pai. b) o pai possui genótipo IÞIß. são do tipo Rh negativo. não serão atingidos pela Eritroblastose fetal. e) se somente II e III estiverem corretas. Quais dos quatro irmãos podem vir a ter filhos com eritroblastose fetal? a) Marina e Pedro. Assinale: a) se somente III estiver correta. II . 1. d) bastante preocupado.3. disse que esse procedimento não seria mais necessário. c) Lúcia e Marina. d) Pedro e João. inclusive pela informação de 166 .5.O genótipo do pai pode ser IÞIÞRR. b) é correta.b) 3/16 c) 1/4 d) 1/8 e) 1/2 Questão 735 Lúcia e João são do tipo sangüíneo Rh positivo e seus irmãos. d) se somente I e III estiverem corretas. c) preocupado. entretanto. e) é incorreta. Numa segunda gravidez. pois todos os filhos desse casal terão uma doença grave fetal caracterizada por uma anemia profunda (Eritroblastose fetal). pois não existe influência do fator Rh positivo ou negativo nos casos de Eritroblastose fetal. recomendando que. b) Lúcia e João. que tem Rh® e é homozigoto.Em caso de transfusão sangüínea. b) se somente II estiver correta. o mesmo ficou: a) despreocupado e não fez qualquer recomendação relativa ao fato. apenas solicitando ao casal que o procurasse no momento da segunda gestação. bem como todos os filhos Rh− não serão atingidos pela doença e esta só atinge uma pequena fração de casos em outras gestações de filhos Rh®. c) é incorreta. d) essa criança é certamente heterozigota para o fator Rh. O sinal + indica reação positiva e o sinal . não fez qualquer recomendação. d) é incorreta.indica reação negativa. tanto da mãe quanto do pai. mesmo sendo Rh®. c) se somente I estiver correta.Essa mulher poderá dar à luz uma criança com eritroblastose fetal. logo após o parto. pois filhos Rh®. e) a mãe pode ter genótipo IÞi. a criança poderá receber sangue. Questão 736 A afirmação que uma mulher Rh− não deve casar-se com um homem Rh®: a) é correta. Ambos possuem o mesmo grupo sangüíneo. a mãe recebesse soro anti-Rh. e) João e Marina. Então é INCORRETO afirmar que: a) a mãe é certamente Rh−. mesmo no caso de glóbulos vermelhos atingirem a circulação materna em sucessivas gestações. que é receptor universal e teve eritroblastose fetal. casou-se com Elaine.

positivo.Rh−.Rh−. a DHR poderia ser evitada. cuja mãe é Rh−. c) negativo. após o contato com o antígeno Rh®. a mãe receba o soro anti-Rh. e) positivo.Rh® d) MÃE.Rh−. CRIANÇA . após cada parto.Rh®. negativo. de maneira que.Rh®. assinale a afirmativa INCORRETA. dizendo ao casal que a gravidez era de altíssimo risco e eles não poderiam mais ter outro filho. CRIANÇA .Rh− c) MÃE. é casada com um homem Rh®. Se uma mulher foi orientada a usar a vacina anti-Rh logo após o nascimento do primeiro filho. Assinale a alternativa do quadro abaixo que identifica corretamente os grupos sangüíneos dessa família.Rh® b) MÃE. positivo. CRIANÇA . negativo. Questão 742 Uma mulher com sangue do tipo A / Rh® / MM é casada com um homem com tipo sangüíneo B / Rh® / NN.5. a) MÃE. podemos dizer que seu fator Rh. Questão 740 Um casal possui o seguinte genótipo para o fator Rh: Pai = Rr. PAI .compatibilidade de grupo sangüíneo. e) bastante preocupado.Rh® 1. respectivamente: a) negativo. negativo. b) negativo. A probabilidade desse casal vir a ter uma criança Rh− é de a) 100% b) 75% c) 50% d) 25% e) 0% Questão 744 Um casal teve uma criança com eritroblastose fetal. com ocorrência de eritroblastose fetal.3.Rh− e) MÃE. d) Se. d) positivo.Rh−. negativo.Rh−.2 a) A placenta normalmente funciona como uma barreira que separa as células sangüíneas fetais e maternas. c) Em III. Questão 745 A incompatibilidade materno-fetal ao antígeno Rh pode determinar um doença denominada Eritroblastose Fetal. logo após o parto da 1 gravidez. 167 . CRIANÇA . PAI . Qual das alternativas abaixo indica o tipo sangüíneo de uma criança que NÃO poderia ter sido gerada por este casal? a) A / Rh® / NN b) A / Rh− / MN c) AB / Rh− / MN d) O / Rh® / MN e) O / Rh− / MN Questão 743 Uma mulher Rh®. a probabilidade de esse casal vir a ter um filho do sexo masculino. é: a) 1 b) 1/2 c) 1/3 d) 1/4 e) 1/8 Questão 741 Interpretando a figura a seguir sobre a Doença Hemolítica do recém-nascido (DHR). os antígenos fetais não serão capazes de induzir a produção de anticorpos anti-Rh pela mãe. negativo. a mãe produz anticorpos anti-Rh que podem ser transferidos para a corrente sangüínea fetal. Considerando apenas o fator Rh. o do seu marido e o da criança são. positivo. PAI . b) Após a 1 gravidez.Rh−.Rh®. positivo. CRIANÇA . recomendando bastante atenção em cada gravidez. PAI . cujo pai é Rh−. Mãe = rr. a mãe recebesse anticorpos anti-Rh. PAI . positivo.Rh®.

.5.. Uma mulher é do tipo sangüíneo Rh−. no quadro apresentado...2 ela observação dos gráficos e considerando que essa mulher teve um filho em cada gestação e nunca recebeu transfusão de sangue. Questão 749 Assinale a alternativa que completa corretamente as lacunas no texto a seguir.. o qual não teve eritroblastose fetal. c) quando a mãe é Rh− e o pai Rh®.. a) homozigoto.. A mãe reconhecerá os glóbulos vermelhos do embrião como estranhos e produzirá anticorpos anti-Rh.... .. todos os filhos serão c) homozigoto. homozigota recessiva e seu marido é Rh®.. e) independente do Rh materno. o qual teve eritroblastose fetal. d) em Y. Esta condição é provocada por incompatibilidade sangüínea do fator Rh. a mãe foi sensibilizada com o fator Rh. icterícia e aumento do baço e fígado.3. é correto concluir que... o filho é Rh−. b) quando a mãe é Rh− e o filho Rh®.... b) em X.Questão 746 A eritroblastose fetal é uma doença hemolítica adquirida apresentada por alguns recém-nascidos. do primeiro filho e do segundo filho. nenhum dos filhos será b) heterozigoto. d) quando a mãe é Rh® e o pai Rh−. Questão 747 No segundo parto de uma mulher. exclusivamente: a) quando a mãe é Rh® e o filho Rh−. Seu caso foi diagnosticado. Rh®. o feto apresentou o quadro de hemólise de hemácias. uma mãe abortou três vezes. além da anemia.. respectivamente.....do 1Ž filho.5. a mãe transferiu anticorpos anti-Rh para o 2Ž filho Rh+. 1. metade dos filhos será Questão 750 Após uma primeira gravidez bem sucedida. sendo observado. em consulta médica. a) em X. e assinale abaixo a alternativa que indica.3. nenhum dos filhos será e) homozigoto.. Em relação à patologia observada nesta família... Isto só acontecerá quando houver passagem do sangue do embrião para a circulação materna. como eritroblastose fetal. e teve seu primeiro filho sem qualquer anormalidade. assinale a alternativa CORRETA: a) A mãe é Rh positivo.. c) Este casal jamais poderá ter outros filhos.. . Considerando o fato de que essa mulher não foi submetida à transfusão de sangue em toda a sua vida anterior.. 168 1.. b) Os abortados certamente eram Rh negativo. a mãe foi sensibilizada com o sangue Rh+ do 2Ž filho.2 Questão 748 Os dois gráficos a seguir representam as quantidades de anticorpos anti-Rh presentes no sangue de uma mulher (Rh-) em gestações distintas. c) em Y. o qual não teve eritroblastose fetal. todos os filhos serão d) heterozigoto. o qual teve eritroblastose fetal.... esse conhecido por doença hemolítica do recém-nascido (DHRN) ou eritroblastose fetal.. Se ele for . analise os genótipos descritos. a mãe transferiu anticorpos anti-Rh para o 1Ž filho Rh-. os genótipos da mãe.

8. 10 e 18 litros. será Rh®. Para transfusões em indivíduos O. o livro onde estavam registrados os códigos foi perdido. O que o casal não sabia é que a "mãe de aluguel" tivera três filhos. A. 1. e o resultado foi o seguinte: 169 . por acidente. 13 e 5 litros.5.3.3 Questão 754 Observe o diagrama geral das possíveis trocas sangüíneas por doação e recepção no sistema "ABO": 1. 3 litros de tipo A.3 (s) seta(s) cujo sentido (doação ë recepção) está(ão) errado(s) é(são): a) 4 e 5 b) 2 c) 1 d) 3 Questão 755 Em um banco de sangue de um hospital. sendo que o último apresentara a doença hemolítica do recém-nascido. 5. Para que os frascos contendo sangue fossem identificados. Questão 753 Assinale a alternativa que esquematiza as transfusões que podem ser feitas entre indivíduos com diferentes grupos sanguíneos do sistema ABO (as setas indicam o sentido das transfusões). 5 e 8 litros. Questão 751 Uma mulher com útero infantil. as etiquetas que identificavam os tipos sangüíneos estavam em código.d) A criança é Rh negativo. Impedida de ter filhos. visto que seu pai é Rh−. Rh® homozigota. e. casa-se com um homem Rh−. Questão 752 Um banco de sangue possui 5 litros de sangue tipo AB. e) 2. c) 18. com absoluta certeza. 5. B e AB estão disponíveis. c) alta. b) mínima. d) 2. o casal decide ter um "bebê de proveta" e contrata uma "mãe de aluguel" para receber em seu útero o zigoto formado por aquele casal. 3. 8 litros B e 2 litros O. pois a "mãe de aluguel" é Rh®. e) O pai é Rh positivo.3. b) 2. d) nula. visto que a doença hemolítica do recém-nascido só ocorre quando a mãe é Rh− e o pai Rh®. 8 e 16 litros. e) alta. foram feitos testes com amostras correspondentes a cada código. 3. visto que sua mãe genética é Rh®. A probabilidade de o "bebê de proveta" nascer com a doença hemolítica do recém-nascido é: a) mínima.5. já que o "bebê de proveta". respectivamente: a) 2. 18 e 10 litros.

I. d) da bolsa 1 ou da bolsa 2. Questão 757 Um determinado banco de sangue possui 4 litros de sangue tipo AB. Esse homem pode receber sangue: a) apenas da bolsa 1. c) pode ser realizada sem problema. porque. todos Rh®. e) não deve ser realizada. do total acima mencionado: a) 4 litros. c) formação de anticorpos anti-A e anti-B pelo receptor.3 necessidade de transfusões sanguíneas para um indivíduo com sangue tipo AB. Analisado o seu sangue. d) 13 litros. d) nenhuma reação. e) reação de anticorpos anti-B do doador com antígenos A do receptor. podemos afirmar que a) existem 105 litros de sangue disponíveis para um receptor AB Rh® b) existem 135 litros de sangue disponíveis para um receptor AB Rh− c) existem 105 litros de sangue disponíveis para um receptor A Rh® d) existem 135 litros de sangue disponíveis para um receptor O Rh® e) existem 25 litros de sangue disponíveis para um receptor O Rh− Questão 756 A transfusão de sangue tipo AB para uma pessoa com sangue tipo B a) pode ser realizada sem problema. b) reação dos antígenos B do receptor com os anticorpos anti-B do doador. apesar de as hemácias AB apresentarem antígeno A e antígeno B. havia três bolsas disponíveis. c) 12 litros. pois os anticorpos anti-A presentes no sangue do receptor podem reagir com os antígenos A presentes nas hemácias AB. b) pode ser realizada sem problema. d) não deve ser realizada. Questão 759 Um homem sofreu um acidente e precisou de transfusão sangüínea. o sangue da bolsa 2 possuía anticorpos anti-A e anti-B e a bolsa 3 possuía sangue com antígenos somente do tipo B. pois os anticorpos anti-B presentes no sangue do receptor podem reagir com os antígenos B presentes nas hemácias AB. hemácias de indivíduos dos grupos sangüíneos AB. separada e respectivamente. na alternativa a seguir. b) apenas da bolsa 3. estarão disponíveis para ele.5. 1 litro de sangue tipo B e 9 litros de sangue tipo O. a opção que corresponde à condição de aglutinação (+) ou não aglutinação (-) de hemácias resultante de reação antígeno-anticorpo: 170 .1. 7 litros de sangue tipo A. Rh®. porque as hemácias AB não possuem antígenos que possam interagir com anticorpos anti-B presentes no sangue do receptor. III e IV. Questão 760 O soro sangüíneo de um indivíduo do grupo O foi colocado em quatro tubos de ensaio.3. Se houver A transfusão de sangue do tipo B para uma pessoa do grupo A. aos quais foram adicionadas. o sangue do receptor não possui anticorpos contra eles. Marque. porque A é receptor universal. verificou-se a presença de anticorpos anti-A e ausência de anti-B. e) apenas da bolsa 2. resultaria em a) reação de anticorpos anti-B do receptor com os glóbulos vermelhos do doador. Questão 758 aseados nesse teste. c) da bolsa 2 ou da bolsa 3. e) 21 litros. A. No banco de sangue do hospital. II. porque as hemácias AB não possuem antígenos que possam interagir com anticorpos anti-A presentes no sangue do receptor. b) 8 litros. B e O. sendo que o sangue da bolsa 1 apresentava todos os tipos de antígenos do sistema ABO.

anti-B. com a utilização de duas gotas de sangue de cada um deles.3.3. 1. que. Tubo III (-) e Tubo IV (+). A partir dos resultados observados.significa ausência de aglutinação. Tubo III (+) e Tubo IV (-). como receptor e doador universal: a) 4 e 2 b) 4 e 3 c) 1 e 5 d) 2 e 4 e) 5 e 1 Questão 762 Em um hospital há um homem necessitando de uma transfusão de emergência. exames de sangue para a determinação da tipagem sangüínea dos Sistemas ABO e Rh. no hospital. anti-Rh. Foram obtidas reações com a aplicação dos reagentes anti-A. Os resultados obtidos encontram-se no quadro seguinte. Os resultados obtidos foram: 1.4 om base no quadro. foram. poderão doar sangue ao referido homem. Tubo III (-) e Tubo IV (+). e) Tubo I (-).5. Tubo III (+) e Tubo IV (-).4 bservação: o sinal + significa aglutinação de hemácias.5. em cinco indivíduos. d) Tubo I (+). Os resultados são apresentados a seguir: Um laboratorista realizou exames de sangue em cinco indivíduos e analisou as reações obtidas com os reagentes anti-A. conclui-se que são classificados. Foi realizada a determinação de grupos sangüíneos do sistema ABO dos quatro indivíduos. em seguida.a) Tubo I (-). respectivamente.3. Sabe-se que ele pertence ao grupo sangüíneo A e que. Tubo II (+). colocadas em uma lâmina. Questão 761 Num laboratório foram realizados.4 171 . Tubo II (+). anti-B e anti-Rh. c) Tubo I (+). o sinal . Tubo II (-). Tubo III (-) e Tubo IV (+). os indivíduos: a) I e II b) I e III c) II e III d) II e IV e) III e IV Questão 763 1. Tubo II (-). para a determinação da tipagem sangüínea dos sistemas ABO e Rh. b) Tubo I (-).5. Tubo II (+). há quatro indivíduos que se ofereceram para doar sangue. misturadas aos soros anti-A e anti-B.

indique quais os indivíduos que serão considerados. Rh®/ AB. Rh®/ A.1 ituações como essa são conhecidas como: a) polialelia.Rh− b) O. Tiveram 9 filhos. casou-se com uma surda. Rh®/ B. Questão 767 Na ervilha-de-cheiro existem dois pares de genes que condicionam a cor da flor (Cc e Pp).Rh®/ A. O sinal positivo (+) significa "aglutina" e o sinal negativo (-) significa "não aglutina". Rh® e) AB. e) alelos múltiplos.Com base nesses resultados. na proporção de 3 brancas: 1 colorida. d) DDee. Rh−/AB. c) Ddee. b) 4 e 3. b) DdEe. Os genótipos das plantas cruzadas são. Após analisar a tabela. a) 5 e 2. está ocorrendo a ação conjunta de dois gens. mantendo a seqüência disposta na tabela. assinale a alternativa que indica os grupos sangüíneos de todas as pessoas quanto aos sistemas ABO e Rh. Quando hereditária. Rh®/ AB. depende da homozigose de apenas um dos dois genes recessivos. c) norma de reação.4 a) O. d) interação gênica. Rh®/ O. A audição normal depende da presença de pelo menos dois genes dominantes diferentes (D) e (E). . A presença de ambos simultaneamente produz flor púrpura. e) 1 e 4. Rh®/ O. c) 3 e 4. Questão 766 A surdez pode ser uma doença hereditária ou adquirida. Rh−/ AB. Rh®/ B.5. Rh−/ B. Rh−/ AB. (d) ou (e). Rh®/ B. Rh®/ A. Cruzando-se duas plantas de flores brancas.4.3. receptor e doador universal. Rh−/ O. Rh® Questão 765 O esquema a seguir evidencia que a formação de melanina não depende apenas da ação de um gen. d) 2 e 5. b) poligens. 1. No processo ali representado. respectivamente: a) CCpp x ccPP b) CCpp x ccPp c) Ccpp x ccPP d) Ccpp x ccPp 172 1. Rh−/ A. A presença do gene C ou P ou ausência de ambos produz flor branca. Rh−/ B. Rh−/ B. Rh®/ A. respectivamente. Rh−/ B. e) DDEE. obtém-se em F plantas produtoras de flores coloridas. todos de audição normal.5. Rh® c) AB.Rh®/ O. Rh−/ A. Um homem surdo. Questão 764 A tabela a seguir foi elaborada a partir de testes para determinação dos grupos sangüíneos de seis pessoas de uma academia de ginástica. simultaneamente. Assim. Rh− d) AB. podemos concluir que o genótipo dos filhos é: a) ddEE. Rh−/ O. Rh−/ A. Rh−/ A.

o indivíduo é albino. Os genótipos das plantas com flores vermelhas e brancas da geração parental são. Nesse caso.e. ocorrem flores vermelhas somente se a planta possuir os alelos dominantes A e B. o fenômeno da interação gênica consiste no fato de: a) uma característica provocada pelo ambiente. por isso.1 odas as alternativas contêm genótipos possíveis para os porquinhos vermelhos de F2. a) AABB e AaBb b) AaBb e Aabb c) AABb e aabb d) aaBb e Aabb e) aabb e aabb Questão 771 1.5. b) vários pares de genes não alelos influenciarem na determinação de uma mesma característica. como a surdez hereditária. e) 3/64.4. Cruzando-se plantas de flores vermelhas com plantas de flores brancas. como surdez por infecção. Um casal de mulatos médios diíbridos tem uma criança albina. A probabilidade de nascer uma criança branca não albina é de: a) 1/16.e) CcPp x CcPp Questão 768 Suponha que. e) dois cromossomos se unirem para formar um gameta. Neste esquema.4. 1. d) dois pares de genes estarem no mesmo par de cromossomos homólogos.1 expressão desses genes pode ser impedida pela presença de um par de genes autossômicos recessivos. c) um único gene ter efeito simultâneo sobre várias características do organismo.5. imitar uma característica genética. a pigmentação da pele seja devida a dois pares de genes autossômicos com efeito aditivo. Questão 770 Em determinada espécie vegetal. respectivamente. d) 3/16. b) 1/2. A tabela abaixo indica os fenótipos existentes. Questão 769 Em genética. c) 1/5. na espécie humana. EXCETO a) AABB b) AaBB c) Aabb d) AaBb e) AABb Questão 772 Os indivíduos albinos não possuem melanina . obtiveram-se 3 plantas de folhas vermelhas para 5 plantas de flores brancas na geração F.pigmento responsável pela cor e proteção da pele . Observe a figura. está representada parte da via biossintética para a produção desse pigmento: 173 . são muito sensíveis à luz solar.

a partir de um casal genotipicamente igual ao mostrado na F1. c) diferentes genótipos podem dar origem ao albinismo.5. c) ee bb. b) Ee Bb.1 om base nesse esquema e em outros conhecimentos sobre o assunto. condicionam as três pelagens típicas da raça: preta. Questão 774 Em cães labradores. O cruzamento de um macho dourado com uma fêmea marrom produziu descendentes pretos. Questão 773 Em uma exaustiva análise de genealogias humanas. 174 . cada um com dois alelos (B/b e E/e). b) herança quantitativa. ou marrons. ( ) A probabilidade do nascimento de uma criança normal para a audição. marrom e dourada. O genótipo do macho é a) Ee BB. ( ) A surdez congênita é determinada por alelos múltiplos em um loco autossômico.4. com relação à surdez congênita na descendência de pais normais para a audição. respectivamente. como ilustrado no quadro a seguir. ( ) Cinco distintas classes genotípicas são observadas entre os descendentes surdos citados. marrons e dourados. Questão 775 1. ( ) Interação gênica entre dois locos justificam esses dados.1. dois genes. enquanto seu alelo i não interfere nessa expressão.4. cujos progenitores eram surdos. b) casamentos entre indivíduos albinos podem gerar descendentes com melanina. Considerando esses dados. se tiverem pelo menos um alelo dominante B. se forem homozigóticos bb.1 Em galinhas. d) codominância. Com esses dados. e) ee Bb. conclui-se que se trata de um caso de: a) epistasia recessiva. O gene I impede a expressão do gene C. a cor da plumagem é determinada por 2 pares de genes. d) ee BB. e) epistasia dominante. Os cães portadores de pelo menos um alelo dominante E serão pretos. d) indivíduos AABB formam gametas do tipo AA e BB. c) pleiotropia.56. O gene C condiciona plumagem colorida enquanto seu alelo c determina plumagem branca. A pelagem dourada é condicionada pela presença do alelo recessivo e em homozigose no genótipo. é INCORRETO afirmar que a) a ausência da Enzima 1 resulta em um aumento da concentração de tirosina. é de aproximadamente de 0. foi observado que a distribuição fenotípica para normais e surdos obedecia a uma proporção de 9:7. ( ) Na determinação da característica analisada atuam locos gênicos ligados que distam entre si em 16 unidades de mapa. analise as proposições com verdadeiro ou falso.5.

2 om base nos resultados. b) Os duplos heterozigotos apresentam flores coloridas.4. O caráter em estudo é a cor das flores.A formação de qualquer pigmento no pêlo depende da presença do alelo P. 1. II . a pelagem pode ser aguti. e) I.5. que se reproduz por autopolinização (em F). d) II e III. EXCETO: a) Trata-se de um caráter determinado por interação gênica.2 1.4. om base na figura foram feitas as seguintes afirmações: I . II e III. produzem quatro tipos de gametas para o caráter em estudo. b) III.Trata-se de um caso de interação gênica do tipo epistasia recessiva. preta ou albina. somente. somente. d) A fecundação cruzada das plantas com flores brancas de F‚ produzirá sempre o mesmo fenótipo. 1.2 175 . c) Os indivíduos de F.5. Questão 777 O esquema abaixo representa o cruzamento artificial (em P) de duas variedades puras de um determinado vegetal. somente. os descendentes são todos aguti.5. é correto afirmar. Pode-se considerar correto o que é afirmado em a) I. a cor da pelagem é determinada por um tipo de interação gênica epistática de acordo com o esquema a seguir.Quando animais pretos homozigóticos são cruzados com certos albinos também homozigóticos. A figura a seguir mostra as reações bioquímicas envolvidas na síntese de pigmentos.4. Questão 778 Em cães da raça Labrador Retriever. c) I e II.Questão 776 Nos camundongos. somente. III .

d) I. c) 13/16 de cebolas brancas e 3/16 de cebolas coloridas. dois pares de genes que apresentam segregação independente participam na determinação da cor do bulbo: o alelo dominante I impede a manifestação de cor e o recessivo i permite a expressão. Uma proporção de 2 incolores: 1 vermelho: 1 amarelo é esperada entre os descendentes do cruzamento a) IIAA x IiAa b) IiAA x iiAa c) IIaa x ii aa d) IiAa x IiAa e) IiAa x iiaa Questão 781 Sobre interação gênica. No cruzamento da fêmea amarela com um de seus filhotes de F1. impede a manifestação de outro gene. (04) Ocorre poligenia quando um gene tem efeito simultâneo sobre várias características do organismo. d) 15/16 de cebolas brancas e 1/16 de cebolas coloridas. Questão 782 Na cebola. 176 . que condiciona coloração preta. Questão 779 Em camundongos. III e IV apenas. não-alelo. a enzima que catalisa a formação de pigmento não é produzida (cebolas brancas). apresenta o alelo B. II. espera-se que 50% dos descendentes apresentem pelagem amarela. não se espera a produção de descendentes com fenótipo chocolate. Do cruzamento de um camundongo preto com um albino. III e IV apenas. que inibe a formação de pigmentos dando origem a indivíduos albinos. espera-se que 25% dos descendentes apresentem pelagem chocolate. Outro gene. e) 16/16 de cebolas brancas. Homozigotos bb não têm a manifestação da cor do bulbo impedida. herdado de forma independente. vários pares de genes não-alelos influem na determinação de uma característica. b) 12/16 de cebolas brancas e 4/16 de cebolas coloridas. II. completando seus efeitos. o alelo dominante A determina cor vermelha e o recessivo a. O gene C determina a produção de pigmentos e é dominante sobre seu alelo c. a coloração da pelagem é determinada por dois pares de genes.Sabendo que o cruzamento (geração Parental) entre um macho com fenótipo chocolate e uma fêmea de fenótipo amarela gera apenas filhotes com pelagem preta (geração F1). cor amarela. enquanto os pais são homozigotos para os dois pares de genes. Qual é o genótipo desse casal? a) aaCC x aacc b) Aacc x aaCc c) aaCc x AAcc d) AaCc x AaCc e) aaCC x AAcc Questão 780 Em cebolas. II e III apenas. em cebolas cc. Quais as proporções fenotípicas esperadas do cruzamento de cebolas homozigotas coloridas com BBcc? a) 9/16 de cebolas brancas e 7/16 de cebolas coloridas. a presença de um alelo dominante C determina a produção de bulbo pigmentado. complementando seus efeitos e produzindo um fenótipo igual aos fenótipos produzidos por cada gene isoladamente. b) II. III. O gene A determina coloração aguti e é dominante sobre seu alelo a. Todos os filhotes produzidos nesse cruzamento são heterozigotos. No cruzamento entre os filhotes de F1. (16) Durante o desenvolvimento do organismo. Aa e Cc. com segregação independente. ao invés de determinar uma característica. um criador fez as seguintes afirmações: I. III e IV. (01) Ocorre poligenia quando dois genes não-alelos colaboram na mesma característica. foram obtidos apenas descendentes agutis. c) I. (08) Ocorre epistasia quando um gene. assinale o que for correto. (02) Dois genes não-alelos colaboram na mesma característica. São afirmações CORRETAS: a) I. No cruzamento da fêmea parental com qualquer cão de pelagem preta. IV. que impede a manifestação de gene C.

dentre outros fatores. enquanto o genótipo homozigoto bb define cor preta. o cariótipo de células somáticas de machos e fêmeas se apresenta como mostram os desenhos a seguir: 1. análise desses cariótipos revela que. O alelo dominante A nesse lócus possibilita o desenvolvimento normal da cor (como definido pelos genótipos B_ ou bb). (2) Indivíduos albinos podem apresentar homozigose recessiva bb e cc. um segundo lócus afeta uma etapa inicial na formação dos pigmentos dos pêlos. O gene dominante W "inibe" a manifestação da cor. julgue os itens seguintes. Questão 786 Em uma espécie animal. Considerando os descendentes do cruzamento de dois ratos. cujo 2n = 6. c) AAbbe aabb. e) aaBB. Em outro cromossomo. os filhotes de cor preta poderão apresentar genótipos: a) Aabbe AAbb. o alelo dominante B determina cor de pêlo acinzentada. d) AABBe Aabb. ambos com genótipo AaBb. (3) Um casal de indivíduos albinos pode ter filhos com pigmentação normal. atuam três mRNAs. Cruzando-se indivíduos heterozigotos para os dois pares de genes obtém-se: a) 3 brancos: 1 preto b) 9 brancos: 3 pretos: 3 mesclados de marrom e preto: 1 branco c) 1 preto: 2 brancos: 1 marrom d) 12 brancos: 3 pretos: 1 marrom e) 3 pretos: 1 branco Questão 784 As diversas substâncias ingeridas pelo homem são transformadas em outras. a determinação do sexo é feita por um sistema. AaBBe aabb.2 1. O gene B determina pêlos pretos e o seu alelo b determina pêlos marrons.5. Essas transformações são catalisadas por diferentes enzimas. (4) O gene B é epistático sobre o gene C. b) Aabbe aabb. respectivamente: a) XY e XX b) YO e XX c) XO e XX d) XY e XO e) XO e XY 177 . em que o macho e a fêmea são. nessa espécie. durante os processos metabólicos.1 Com base no esquema e sabendo que indivíduos incapazes de sintetizar a melanina são albinos. mas o genótipo aa bloqueia toda a produção de pigmentos e o rato torna-se albino.5. (1) Na produção de melanina a partir de fenilalanina.4. Em ratos. Questão 785 Epistasia é o fenômeno em que um gene (chamado epistático) inibe a ação de outro que não é seu alelo (chamado hipostático). da ação de dois pares de genes Bb e Ww.5. O esquema abaixo representa alguns passos da síntese de melanina.Questão 783 A cor da pelagem em cavalos depende. enquanto que o alelo recessivo w permite a manifestação da cor. fazendo com que o pêlo fique branco.

1. Assim.5. têm visão normal em um dos olhos e daltonismo no outro. Questão 789 O médico confirmou que se tratava de gêmeos monozigóticos. simultaneamente. X e Y. Questão 790 O esquema a seguir mostra a formação dos gametas responsáveis pela produção de um indivíduo com alteração do seu número cromossomial. heterozigotas para os grupos sangüíneos. c) na mulher um cromossomo X está sempre condensado e recebe o nome de cromatina sexual.Questão 787 Na espécie humana a determinação sexual é feita por um par de cromossomos. Tal fato deve-se à perda de a) um cromossomo X na gametogênese da mãe das crianças. 178 . c) cariótipo normal. na gametogênese do pai ou da mãe das crianças. c) um cromossomo sexual.5. independentemente dos genes que possuem. b) caracteres sexuais desenvolvidos. b) um cromossomo Y na gametogênese do pai das crianças. X ou Y. b) O sexo feminino é homogamético e o gameta feminino normal sempre apresenta um cromossomo X. e) Toda doença hereditária e recessiva ligada ao cromossomo X só afeta as mulheres. b) Algumas mulheres. e) um cromossomo Y quando da divisão mitótica do zigoto. heterozigotas para a cor dos olhos. contudo um deles era menino e o outro menina. porém a menina era portadora da síndrome de Turner." Assinale a alternativa que confirma o texto anterior. heterozigotas para a cor do cabelo. em 1961. que possuem apenas uma cópia funcional dos genes ligados ao cromossomo X. Mulheres heterozigotas para os genes ligados aos cromossomos X expressam o alelo dominante em algumas células e o alelo recessivo em outras. e nos blastômeros iniciais do desenvolvimento embrionário. O indivíduo do sexo feminino apresenta dois cromossomos X enquanto que o indivíduo de sexo masculino apresenta um cromossomo X e outro cromossomo Y. são tipo A e B simultaneamente.1 ntre as características que esse indivíduo passará a apresentar. são loiras e castanhas. têm manchas brancas e pretas. as mulheres apresentam células geneticamente diferentes entre si. têm um olho azul e outro castanho. a hipótese de que fêmeas de mamíferos compensariam a dose dupla de genes do cromossomo X através da inativação de um desses cromossomos. heterozigotas para o daltonismo (XD Xd). Com base neste texto é INCORRETO afirmar: a) O sexo masculino é heterogamético e é sempre o homem quem determina o sexo dos filhos. A inativação do cromossomo X ocorre ao acaso. "A pesquisadora inglesa Mary Lyon propôs. d) Algumas mulheres. Questão 788 Leia o texto a seguir referente à Hipótese de Lyon. a) Algumas mulheres. teremos: a) sexo masculino. as células femininas ficariam iguais às masculinas. pois em algumas estão ativos os genes provenientes do cromossomo X materno e em outras do cromossomo X paterno. simultaneamente. e) Algumas mulheres. Logo. c) Algumas mulheres. e) estatura elevada. A análise cromossômica dos gêmeos indicou que o menino era normal. d) ausência de cromatina sexual. d) A hipertricose auricular é uma característica restrita ao sexo masculino. pois o gene está localizado no cromossomo Y. d) um cromossomo X quando da divisão mitótica do zigoto. heterozigotas para a cor da pele.

fizeram-se as seguintes afirmações: I. incluindo 2 cromossomos sexuais. Questão 793 Acerca da relação entre os cromossomos de um menino e os de seus avós.5. 1.F: galinha preta.F: galinha barrada. II. Com base nesses dados. de acordo com a tabela abaixo. F‚: galinha barrada b) I . está(ão) correta(s) APENAS a) I b) II c) III d) I e III e) II e III Questão 794 Em galinhas. Entre seus autossomos. machos de penas pretas × fêmeas de penas barradas Assinale a alternativa que indica corretamente as gerações nas quais espera-se encontrar galinhas pretas. 4 óvulos humanos.F: galinha preta. machos homozigóticos de penas barradas × fêmeas de penas pretas II. é possível dizer que o sistema de determinação do sexo nessa espécie é do tipo a) XX : XY b) XX : XO c) XX : YO d) ZZ : ZW e) ZZ : ZO Questão 792 O carneiro ('Ovis aries') apresenta 27 cromossomos em seus gametas normais. Dessas afirmações.F: galinha barrada. F‚: galinha barrada II . F‚: galinha preta c) I .F: galinha barrada. F‚: galinha preta d) I . O alelo dominante determina penas barradas e o recessivo. e) Uma célula muscular de carneiro deve apresentar 54 autossomos. A partir desse dado. além de 2 cromossomos sexuais. F‚: galinha preta II . há descendentes de autossomos de seus avós. b) Um linfócito de carneiro deve apresentar 54 cromossomos.F: galinha preta. a) Um neurônio de carneiro deve apresentar 52 autossomos.5.F: galinha barrada. todos igualmente viáveis.F: galinha barrada. assinale a alternativa INCORRETA com relação ao número de cromossomos encontrado em diversas células nessa espécie. geraram 4 embriões. a cor das penas apresenta herança ligada ao sexo. F‚: galinha preta e) I . F‚: galinha barrada II . F‚: galinha barrada II . Considere os seguintes cruzamentos a partir dos quais obtiveram-se as gerações F e F‚: I. Seu cromossomo X é descendente de um X de sua avó paterna. III.F: galinha barrada.1 179 .Questão 791 A análise do cariótipo de exemplares de uma dada espécie revelou que o número diplóide é idêntico em ambos os sexos e que o sexo heterogamético é o feminino. d) Uma célula de carneiro que está na metáfase da mitose deve apresentar 54 cromossomos duplicados. c) Um óvulo de ovelha deve apresentar 26 autossomos. Seu cromossomo Y é descendente do Y de seu avô paterno. quando incubados com 4 suspensões de espermatozóides. a) I . F‚: galinha preta Questão 795 Em uma experiência de fecundação "in vitro".F: galinha preta. F‚: galinha preta II . penas pretas.

A quantidade de DNA encontrada em uma célula somática de zangão. não observou a presença do cromossomo Y. b) uma fêmea aneuplóide. ( ) A síndrome de Down é causada pela presença de um cromossomo X extra no cariótipo. e) um intersexuado. no período correspondente à prófase da mitose é. ( ) O sexo heterogamético é o masculino. Além disso. por partenogênese. 1. Questão 799 Alguns métodos em desenvolvimento poderão permitir aos pais a escolha do sexo de seus futuros filhos. caso os pais desejem um filho do sexo feminino.0 × 10−¢¢ d) 5. a seguir. c) um macho normal. são: a) espermatócitos secundários diplóides portando os cromossomos X e Y. Nesse inseto. b) oócitos primários diplóides portando os cromossomos Y. encontrou a proporção de 1X : 2A (onde a letra A simboliza o conjunto haplóide de autossomos).onsiderando a experiência descrita. igual a: a) 1. embora as fêmeas se originem de reprodução sexuada. os machos originam-se de óvulos não-fecundados. os gametas que precisam ser necessariamente identificados e separados para uso no processo de fecundação. Dentre eles.0 × 10−¢¡ b) 2. Dentre as opções abaixo. Questão 800 Observe a figura.5 × 10−ª c) 5. o ovo fertilizado no útero da mãe. implantando. ao analisar os cromossomos de 'Drosophila'. d) óvulos haplóides portando o cromossomo Y. e) oogônias portando o cromossomo X e espermatogônias portando o cromossomo Y. Analisando os dados do estudante.5. ( ) O corpúsculo de Barr ou cromatina sexual corresponde a um cromossomo X inativo. c) espermatozóides derivados de espermátides portando o cromossomo X. ( ) O genitor do sexo feminino determina o sexo dos descendentes.5. alguns se baseiam em executar a fecundação em tubo de ensaio. Questão 798 Um estudante. ( ) O indivíduo hermafrodita é formado por células XX e XY.0 × 10−¢¨ Questão 797 As afirmações a seguir relacionam-se à DETERMINAÇÃO CROMOSSÔMICA DO SEXO na espécie humana.1 180 . em mg. o gráfico que indica as probabilidades de os 4 embriões serem do sexo masculino é o de número: a) 1 b) 2 c) 3 d) 4 Questão 796 Considere que um óvulo de abelha possui 5×10−¢¥ g de DNA. podemos concluir que a mosca é a) uma fêmea normal. d) um macho estéril.

5.5. d) os testículos estão ausentes nos indivíduos 46. ter descendentes machos sem mancha é de 50%. b) a determinação do sexo. a presença do cromossoma Y determina o fenótipo masculino. é CORRETO afirmar que a) os indivíduos 46. Questão 801 A figura a seguir se refere à determinação do sexo em algumas espécies de tartarugas e lagartos. d) temperaturas maiores que 28°C produzem fêmeas tanto em tartarugas quanto em lagartos. XY que. presente nesse cromossoma. Questão 804 A figura a seguir mostra esquematicamente o tipo de reprodução em abelhas do gênero 'Apis'. XYY apresentam dois testículos a mais. Questão 803 Nos mamíferos. e) machos são produzidos em baixas temperaturas tanto para tartarugas quanto para lagartos. Com relação ao padrão de herança desse caráter. na idade adulta. sofrem mutação nesse gene perdem as características sexuais. c) mapeamento do genoma humano. c) os indivíduos trissômicos 47. em tartarugas.5. 1.1 181 . b) a probabilidade de uma fêmea com mancha. pode ser útil em condições de manejo de espécies em extinção.ssa figura representa a herança do caráter mancha negra numa espécie de peixes em que a determinação do sexo segue o padrão mais comum nas aves. Com base nessa figura pode-se afirmar que Questão 802 A identificação do fator que origina indivíduos com síndrome de Down tornou-se possível pela utilização da técnica de a) contagem e identificação dos cromossomos. c) indivíduos de sexo indeterminado. c) as fêmeas de F‚ e P sem mancha negra possuem genótipos diferentes. cruzada com macho sem mancha. d) o caráter mancha negra é exclusivo de indivíduos homozigotos. b) cultura de células e tecidos. 1. sob controle de temperatura. Considerando-se essas informações e outros conhecimentos sobre o assunto. é correto afirmar-se que a) a probabilidade do casal em F ter um descendente macho e sem mancha negra é zero. XXY possuem órgãos reprodutores masculinos e femininos. são produzidos em temperaturas abaixo de 28°C.5. O gene SRY.1 a) a determinação do sexo nesses animais é independente da localização dos ovos no ninho e da época da postura. d) produção de DNA recombinante. e) o sexo heterogamético nessa espécie de peixes é o masculino. induz à diferenciação dos testículos. XY com deleção do gene SRY. b) os indivíduos trissômicos com cariótipo 47.

c) o sexo das abelhas é determinado pela ploidia do indivíduo. das quais uma seria a escolhida para ser a futura sucessora da rainha. Essa história mostra que a) os zangões são haplóides e produzem os espermatozóides por meiose. (16) Ccom Síndrome de Edwards. a cor clara dos olhos é condicionada pelo alelo recessivo a de um determinado gene.nalise as seguintes afirmativas sobre o esquema da figura. I. A produção de zangões caracteriza o processo de reprodução assexuada denominado partenogênese. II. (32) Com cariótipo normal. b) I e II estão corretas. e os zangões são monóicos. (08) Com Síndrome de Patau. e são diplóides. III. Questão 805 Analisando a figura adiante. foi inseminada artificialmente com espermatozóides de machos de olhos escuros. d) a rainha e as operárias são dióicas. Espera-se que a prole dessa rainha tenha a seguinte composição: 1. (64) Com uma anomalia numérica de autossomos.5. e) I e III estão corretas. uma vez que não houve a fecundação dos óvulos que os originaram. Questão 807 Os machos de abelha originam-se de óvulos não fecundados e são haplóides. através da meiose. As operárias são estéreis devido à espermatogênese nos zangões produzir. a determinação do sexo cromossômico do zigoto (XX ou XY) depende do gameta masculino que fecunda o óvulo. heterozigótica Aa. havia uma rainha que tinha tido apenas filhos do sexo masculino (zangões) e precisava de uma sucessora para o trono. d) apenas II está correta. e nasceram filhas operárias.5. Os zangões podem ser considerados clones perfeitos da abelha rainha. é correto afirmar que se trata do cariótipo de um indivíduo: Questão 806 No reino Colméia. (04) Com Síndrome de Down. Em uma linhagem desses insetos.1 I. As fêmeas resultam da fusão entre óvulos e espermatozóides. Uma abelha rainha de olhos escuros. Em humanos. b) o sexo das abelhas é determinado pelos cromossomos sexuais. Da análise das afirmativas acima podemos assegurar que: a) apenas I está correta. gametas com um número de cromossomos 4 (quatro) vezes menor.1 (01) Do sexo masculino. (02) Do sexo feminino. Soma ( ) Questão 808 Considere as afirmações: 1. A rainha se casou com um belo zangão plebeu. c) II e III estão corretas.5. enquanto a cor escura é condicionada pelo alelo dominante A. que representa um cariótipo humano. 182 .5.

Questão 810 Durante as Olimpíadas é comum fazer-se teste da cromatina sexual ou corpúsculo de Barr nas mulheres. III e IV. d) Três cromossomos X. II e III). Em mamíferos. Em uma célula eucariótica animal. Toda a informação genética necessária para formar um organismo completo está contida em seqüências de timinas. sendo que um deles é a cromatina sexual.1 Adaptado de: AMABIS. têm sua origem no núcleo. sendo exceção a essa regra os cromossomos sexuais X e Y. sendo que dois deles formam a cromatina sexual. II. sendo que um deles é a cromatina 183 . Questão 812 A reprodução da maioria dos seres vivos envolve um processo sexual onde se alternam os fenômenos de meiose e fecundação. Uma mulher normal apresentará em suas células bucais: a) Dois cromossomos X. e) III. Numa proteína com 500 aminoácidos. III. A informação genética pode ser passada de uma geração para outra. de uma célula a outra. todas as moléculas de RNA. Em mamíferos. d) apenas I e II. d) Apenas I está correto. em um mesmo indivíduo. dois. III. d) II. b) I e II estão corretos. sexual. Qual dos pares de gametas representados a seguir poderá originar um zigoto que desenvolverá um embrião normal do sexo masculino? 1. pode-se afirmar que: a) I e III estão corretos. Esse teste permite o diagnóstico citológico do sexo feminino. b) Três cromossomos Y. c) II e III estão corretos. citosinas e guaninas arranjadas em diferentes combinações. Questão 809 O diagrama a seguir está dividido em 3 segmentos (I. 2001. V. b) apenas II. Com relação a esses segmentos. III e V. porém. I. c) Dois cromossomos X e blocos de cromatina sexual. os quais contêm conceitos relacionados aos diferentes sistemas de determinação do sexo. c) apenas III. nas células somáticas de fêmeas normais. de pais para filhos. Questão 811 Considere as cinco afirmações seguintes. J. adeninas. é possível observar o cromossomo X que foi inativado. "Conceitos de Biologia". São Paulo: Moderna. IV e V. IV. II e III. pois este corresponde ao corpúsculo de Barr ou cromatina sexual. II e IV.5. b) I. não pode ser passada.5. e) apenas I e III. e) Um cromossomo X apenas. Estão corretas: a) I. No homem. c) II. a meiose é gamética. as fêmeas possuem apenas um cromossomo X e os machos. e a fecundação reconstitui a diploidia. o RNA mensageiro que saiu do núcleo continha 1500 códons e a seqüência que serviu de molde para a transcrição possuía 3000 nucleotídeos. com exceção do RNA mitocondrial. G. cromossomos homólogos contêm a mesma seqüência linear de genes.M e MARTHO. Em mamíferos.R. Está(ão) correta(s) a) apenas I.II.

estão associadas a genes do cromossomo Y. c) O genótipo de 4 será XHY. Para esclarecer tais suspeitas utiliza-se a) a identificação da cromatina sexual. 184 .5. c) o cromossoma Y paterno pode apresentar o gene para a doença. Feita a análise desse gráfico. há suspeitas sobre o sexo de certas atletas.5. Questão 816 Observe o esquema a seguir: 1.5. II .5. podemos afirmar corretamente que: a) a anomalia é causada por um gene dominante.características como a hemofilia. Indique-a.quando pareados. d) O genótipo de 6 será XHXH ou XHXh.5. por exemplo. Questão 814 Em relação aos cromossomos sexuais X e Y. ocasionalmente. e) a análise radiográfica da bacia. c) o exame radiológico dos órgãos sexuais.5.2 análise do esquema permite formular as conclusões a seguir. d) a pesquisa de hormônios sexuais femininos através de um exame de sangue. fazem parte do cromossomo X.características como o daltonismo. cujo desempenho ou mesmo a aparência sugerem fraude. III . e) O indivíduo 5 com certeza é hemofílico.2 Questão 813 Em eventos esportivos internacionais como os Jogos Pan-americanos ou as Olimpíadas. são exemplos de cromossomos homólogos. b) O casal 5/6 formará homens hemofílicos.1 1. e) os indivíduos III e V podem ser homozigotos ou heterozigotos. No gráfico anterior temos representado um exemplo de doença ligada ao sexo onde apenas o indivíduo IV é afetado. são feitas as seguintes afirmações: I .Questão 815 1. b) o indivíduo I é obrigatoriamente homozigoto. d) o casal apresenta 50% de probabilidade de ter filhas afetadas. EXCETO uma. Estão corretas as seguintes afirmações: a) apenas I b) apenas II c) apenas III d) apenas II e III e) todas. a) O casal 1/2 nunca formará mulheres hemofílicas. b) a contagem de hemácias cuja quantidade é maior nos homens. por exemplo.

c) mulheres hemofílicas precisam de dois alelos dominantes.Não é possível identificar o genótipo de 2. analise as afirmações de I a IV e assinale a alternativa correta. e) é causada por um alelo típico do cromossoma Y. d) Apenas as afirmações II e III são verdadeiras. ligado ao cromossomo X. IV . Questão 819 A distrofia muscular de Duchenne é devida a um gene recessivo. é suficiente nos homens apenas um alelo para que a doença se manifeste. O heredograma a seguir refere-se a uma família com esta anomalia. II . III .5." (Handin R.2 Questão 820 A hemofilia é uma doença genética cuja herança é ligada ao sexo. b) Apenas as afirmações I e II são verdadeiras. A probabilidade de A ser portador da anomalia.Questão 817 "Tem sido verificado que aproximadamente 25% dos casos de hemofilia A em meninos são decorrentes de mutações novas.100% dos filhos homens do casal 3 e 4 serão daltônicos. I .100% das filhas do casal 3 e 4 serão normais portadoras. Analise o heredograma adiante e assinale a alternativa correta. aprendemos que ela é mais comum nos homens porque: a) os homens são mais propensos à doença devido à influência do hormônio testosterona. d) mulheres hemofílicas morrem nos primeiros sangramentos menstruais.50% das filhas do casal 3 e 4 serão normais portadoras e 50% daltônicas.5. 1955) Quando nos debruçamos sobre a hemofilia. que é masculinizante.5. a doença se manifesta em meninos que não tem história familiar de hemofilia.5.. isto é.2 1. ao passo que os homens só necessitam de um alelo.I. BLOOD AND PRACTICE OF HEMATOLOGY. 185 . c) Apenas as afirmações I. e) Apenas as afirmações II e IV são verdadeiras. b) sendo uma herança ligada ao sexo. III e IV são verdadeiras. De acordo com o heredograma. Questão 818 O daltonismo é uma anomalia que apresenta um tipo de herança ligada ao sexo. sabendo-se que a mulher B é homozigota é de a) 1/8 b) 3/8 c) 1/2 d) 1/4 e) 3/4 1. a) Todas as afirmações são verdadeiras.

os indivíduos representados com símbolos escuros são daltônicos e os demais têm visão normal para as cores. portadoras do gene para o daltonismo. Na genealogia abaixo. certamente. vão receber US$ 24. que pediram para não ser identificados. Questão 825 VÍTIMAS DE HIROSHIMA NO BRASIL SERÃO INDENIZADAS. e) portadores de novas mutações.5.5. porém herdaram de suas respectivas mães os genes para daltonismo e hemofilia.5. o genótipo para hemofilia XHY fenotipicamente representa: a) homem normal b) homem hemofílico c) mulher normal d) mulher hemofílica e) homem normal. 3 e 7 são portadores do gene para o daltonismo. b) as mulheres 2 e 4 são. d) Todos os filhos e filhas do indivíduo 10 serão hemofílicos. e) se o pai de 2 era afetado pelo daltonismo.2 1.2 correto afirmar que a) a mulher 6 é homozigota. A probabilidade deste casal vir a ter uma filha hemofílica é igual a: a) zero b) 50% c) 25% d) 12. ("Folha de S.02.2006) 186 1. Pode-se dizer que. da qual herdaram os genes para daltonismo e hemofilia. Questão 821 O daltonismo é causado por um gene recessivo localizado no cromossomo X na região não-homóloga ao cromossomo Y. do qual herdaram os genes para daltonismo e hemofilia.5. mais provavelmente.5% e) 100% Questão 824 Meio-irmãos é o termo utilizado para designar os indivíduos que são irmãos só por parte de pai ou só por parte de mãe. c) O indivíduo 9 não pode ser hemofílico. heterozigotas. Os três homens. 09. certamente.7 mil. porém herdaram de seus respectivos pais os genes para daltonismo e hemofilia. d) as filhas do casal 6 e 7 são. b) O indivíduo 8 é portador do gene para hemofilia. c) filhos do mesmo pai. . Seus genitores são normais. d) filhos da mesma mãe. João e Pedro sejam a) filhos do mesmo pai. porém portador Questão 823 a) Os indivíduos 1 e 2 são homozigotos normais. decidiu um tribunal japonês. Um homem hemofílico casa-se com uma mulher normal e homozigota para este caráter. e) O indivíduo 14 pode ser homo ou heterozigoto.Paulo". ocorridas independentemente da herança materna ou paterna. João e Pedro são meio-irmãos e ambos são daltônicos e hemofílicos. c) os homens 1.Questão 822 Na espécie humana. certamente a mãe tinha fenótipo normal. b) filhos da mesma mãe.

todos seriam hemofílicos. uma vez que é determinada por um alelo no cromossomo Y.5 %. Shiguero. c) autossômico dominante. Questão 826 Na genealogia a seguir. e) errada. 90 são daltônicos. por sua vez. A princesa Beatriz. Takashi. Questão 828 Acredita-se que a rainha Vitória da Inglaterra tenha sido a introdutora do gene para hemofilia . Shiguero.na família real inglesa. Como a hemofilia é um caráter recessivo e só se manifesta nos homozigotos para esse alelo. porque a doença afeta os dois sexos. os símbolos cheios representam pessoas afetadas por uma doença genética rara. A hemofilia é uma doença que prejudica a coagulação do sangue. o Sr. porque não há transmissão de homem para homem. migrou para o Brasil. Observe a árvore genealógica: 187 . filha de Vitória. Shiguero faleceu de leucemia. onde se casou e teve um filho. a doença de seu filho Mário é causada pela presença de um alelo herdado pela via paterna e por outro herdado pela via materna. era uma vítima indireta da radiação liberada pela bomba. e muito mais freqüente em homens que em mulheres. Questão 827 O daltonismo é causado por um alelo recessivo de um gene localizado no cromossomo X. b) 4. também poderia ter provocado mutações nas células de seu tecido reprodutivo que. entre 1000 homens analisados. portador de hemofilia do tipo A.81 %. b) autossômico dominante. Mário só pode ter herdado esse alelo de seu pai. acreditava que seu único filho.2 padrão de herança que melhor explica o heredograma é a) autossômico dominante. d) errada. Do mesmo modo como a radiação provocou a leucemia do Sr. Anos depois. porque a doença aparece em todas as gerações. A hemofilia ocorre mais freqüentemente em homens. que. ligada ao sexo. c) 9 %.5. Afinal. foi um dos sobreviventes da bomba de Hiroshima. Mário. ou que Mário seja portador de uma nova mutação sem qualquer relação com a radiação a que o Sr. introduziu o gene na família real espanhola. É mais provável que a hemofilia de Mário seja determinada por um alelo herdado por via materna.5. Depois da notícia do jornal. e) 83 %. que o teria herdado do Sr. Shiguero. Emília havia lido que a doença é genética. e) recessivo ligado ao sexo. Emília passou a acreditar que seu filho talvez pudesse se beneficiar com alguma indenização.Emília interessou-se pela notícia. b) correta. Shiguero foi submetido. se seu filho Mário tivesse herdado o alelo do pai. d) 16 %. O sogro de Emília. Após a guerra. 1. Qual é a porcentagem esperada de mulheres daltônicas nessa população? a) 0. c) apenas parcialmente correta. pode-se dizer que Emília está a) correta. porque aproximadamente 50% da prole é afetada.ligado ao X . a mais grave delas. Em uma amostra representativa da população. casou-se com Takashi e atribuía a doença de seu filho Mário à herança genética do avô Shiguero. Emília. Shiguero. Sobre suas convicções quanto à origem da doença de Mário. Sr. Como a hemofilia é um caráter dominante. Deste modo. d) dominante ligado ao sexo. porque todas as filhas de homens afetados são afetadas. o herdou do Sr. transmitidas à Takashi. que não tem ascendência oriental. e deste à se filho. provocaram a hemofilia de Mário.

casa-se com um homem daltônico e tem uma criança do sexo masculino e daltônica. provavelmente. e) dominante ligado ao cromossomo Z. Sabendo que o uso da mão esquerda é uma característica recessiva. É correto afirmar que: a) essa mulher é daltônica. e) se ela tiver um irmão. b) dominante ligado ao sexo. filha de pai normal e mãe portadora do gene para o daltonismo.. então a probabilidade do segundo filho ser do sexo masculino e com fenótipos dominantes é: a) 1/2 b) 1/4 c) 1/6 d) 1/8 e) 1 1. este será hemofílico também.5. b) A mãe dessa mulher terá obrigatoriamente o mesmo genótipo para o daltonismo que ela. É correto afirmar. c) O pai dessa mulher é daltônico. assinale a alternativa correta. que: a) o pai é normal. Questão 833 O gene que determina o daltonismo na espécie humana caracteriza o seguinte tipo de herança a) autossômico dominante. Questão 832 Um casal tem uma criança de sexo masculino e hemofílica. b) essa mulher poderia ter uma irmã daltônica. b) o pai é normal e a mãe é hemofílica. A anomalia. d) ela recebeu da mãe o gene para a hemofilia. Questão 834 Uma criança do sexo feminino. Sabendo-se que a polidactilia é uma herança autossômica dominante. d) recessivo ligado ao sexo. c) o filho dessa mulher herdou do seu pai o gene para o daltonismo.Questão 831 Uma mulher. c) autossômico recessivo.. d) o genótipo dessa mulher é igual ao de sua mãe. Questão 830 Um homem de visão normal e com número normal de dedos casa-se com uma mulher polidáctila e daltônica. c) o pai e a mãe são hemofílicos. e) Os filhos homens desse casal serão sempre daltônicos e não polidáctilos. a) Esse casal poderá ter uma filha polidáctila e daltônica. b) autossômico recessivo. 188 .5. com certeza. d) recessivo ligado ao cromossomo Z.2 probabilidade da princesa Maria vir a ter um menino hemofílico é de: a) 100% b) 75% c) 50% d) 25% e) 0% Questão 829 O estudo de linhagens de galinhas em que aparecia uma anomalia hereditária mostrou que fêmeas afetadas cruzadas com machos normais davam sempre todos os descendentes machos com a anomalia e as fêmeas normais. daltônica e canhota possui pai daltônico e destro e mãe de visão normal e canhota. d) A mulher é obrigatoriamente filha de pai e mãe polidáctilos. e) interação gênica. e) essa mulher não poderá ter uma filha daltônica. é determinada por gene a) autossômico dominante. c) recessivo ligado ao cromossomo X.

XDXd.XdY 189 . c) III é verdadeira.XDY.XdY.sua avó paterna NÃO apresenta o gene para a hemofilia.As filhas de pai normal serão sempre normais. considere as seguintes afirmações. Avô . é possível considerar que APENAS a) I é verdadeira. Sabendo-se que o gene em questão é recessivo e ligado ao sexo. III e IV. Um macho de olhos brancos foi cruzado com uma fêmea heterozigota. c) I. II. São corretas: a) I.XdXd. Assinale a alternativa correta quanto aos genótipos do homem e de seus avós maternos. a cor dos olhos é determinada por um gene localizado no cromossomo X sem o correspondente alelo no cromossomo Y. todos os seus filhos do sexo masculino também serão afetados. e) III e IV apenas. Avó . O primeiro filho desse casal nasceu hemofílico e surdo-mudo. enquanto a cor branca é devida ao gene W. Avó .XDXd. Questão 839 Considere as seguintes afirmações sobre uma mulher hemofílica: I.XDXd. nasceu uma menina normal.Os homens só apresentam dois genótipos possíveis.XdY. e) I e III são verdadeiras.XDY. e excluindo-se a possibilidade de mutação. d) II e IV apenas. Questão 840 Um homem tem avó materna e pai com visão normal. enquanto as mulheres apresentam três genótipos possíveis. a) Homem . Avó .XDY e) Homem . A probabilidade do nascimento de um menino também normal é: a) 50% b) 75% c) 25% d) 100% e) 0 Questão 836 Em 'Drosophila'. Avô . Avó . b) I e III apenas. I . Do casamento entre uma mulher afetada e um homem normal.XdY b) Homem . d) I e II são verdadeiras.XDXd.Se a mãe for afetada.As mulheres heterozigotas têm fenótipo normal.sua mãe possui um gene para a hemofilia. II . III e IV apenas. b) II é verdadeira. IV .seu pai é hemofílico. Considerando a surdo-mudez como uma característica autossômica recessiva. Avô . a porcentagem de indivíduos de olhos brancos em F será de: a) zero b) 100 % c) 25 % d) 75 % e) 50 % Questão 837 Um homem de audição normal e não hemofílico casa-se com uma mulher com o mesmo fenótipo. II. III.XDY d) Homem .XdY c) Homem . Considerando que nesses indivíduos o sexo heterogamético é o masculino. Avô .XdY. III . e avô materno e mãe com daltonismo. a probabilidade desse casal ter uma criança do sexo feminino normal para ambas as características é de: a) 3/8 b) 1/8 c) 1/2 d) 3/4 e) zero Questão 838 A respeito das heranças recessivas ligadas ao sexo (genes situados no cromossomo X). Avó . Avô . A cor vermelha é determinada pelo gene W+.Questão 835 O raquitismo resistente à vitamina D é uma doença provocada por um gene dominante ligado ao X.

e) de homens daltônicos sempre portam alelo para daltonismo. d) apenas hemofílico. que nasceu com SÍNDROME DE KLINEFELTER e DALTONISMO. espera-se que esse filho do casal seja a) normal. c) e as filhas de homens daltônicos são sempre heterozigotos. a probabilidade desse casal ter um menino afetado é a) 3/4 b) 1/2 c) 1/4 d) 1/8 e) 1/16 Questão 842 Um homem hemofílico e uma mulher daltônica tiveram um filho com síndrome de Klinefelter (47. que tratam de um caso e hemofilia: 1. Um homem normal casou-se com uma mulher daltônica.5. Além disso. quanto à hemofilia e ao daltonismo. XXY). embora seus pais não apresentem alterações cromossômicas numéricas em suas células 190 .2 e uma das irmãs desse indivíduo casar-se com um homem sadio. A probabilidade de terem um filho homem e normal é de: a) 0 b) 1/4 c) 1/3 d) 1/2 e) 1 Questão 845 Observe os heredogramas a seguir. É correto afirmar que os filhos a) e as filhas de homens daltônicos são sempre daltônicos. Questão 843 O cientista John Dalton é bastante conhecido por suas contribuições para a Química e Física. c) daltônico ou hemofílico. b) daltônico e hemofílico. causada por um alelo recessivo ligado ao cromossomo X. recebeu o nome de daltonismo. e) apenas daltônico.5. b) e as filhas de mulheres daltônicas são sempre daltônicos.5.2 abendo que o indivíduo 7 é do sexo feminino. Essa doença hereditária. Dalton descreveu uma doença hereditária que o impossibilitava de distinguir a cor verde da vermelha.Questão 841 O heredograma a seguir representa uma família em que um dos filhos é afetado por doença determinada por um alelo recessivo localizado no cromossomo X. Admitindo-se que o gameta anormal tenha sido produzido pela mulher. O daltonismo é condicionado por um gene recessivo ligado ao sexo. d) de mulheres daltônicas sempre portam alelo para daltonismo. Questão 844 1.5. a probabilidade de apresentar hemofilia é: a) 1 b) 1/2 c) 1/4 d) 1/8 e) 1/16 Questão 846 O esquema a seguir representa a ontogênese de João.

esse pai é obrigatoriamente daltônico. d) Se a mãe de João é daltônica. é correto afirmar. a) A permutação na espermatogênese permitiu que o pai tenha dado para a filha gameta contendo o alelo dominante para hemofilia. O DNA ativo no nível de transcrição. Questão 847 Em geral. b) Se foi o pai de João quem contribuiu com o gameta contendo um cromossomo a mais. a hemofilia e o daltonismo são características recessivas ligadas ao sexo. c) A mãe de João pode ser daltônica.2 nalisando as informações e os heredogramas acima de acordo com seus conhecimentos. Sabendo que filhas de pai apenas hemofílico e mãe apenas daltônica e homozigota para hemofilia são normais para os dois caracteres. é correto afirmar. situação que. EXCETO: a) Os dois caracteres DMD e AME acima são recessivos. c) Algumas células somáticas de cada filha apresentam o cromossomo X de origem paterna condensado. O heredograma a seguir indica. 1. assinale a alternativa que traz uma explicação possível para o fato apresentado. O caráter Distrofia Muscular de Duchenne (DMD) é uma herança ligada ao sexo. é vista como uma mancha escura chamada corpúsculo de Barr.somáticas. Questão 848 abendo que o daltonismo é uma herança recessiva ligada ao sexo. é menos condensado para permitir acesso da maquinaria de transcrição. torna os indivíduos afetados incapazes de se reproduzir.5.5. Na espécie humana. sendo somente transmitido pelas mães. b) Não podem ser gerados descendentes do sexo feminino afetados por DMD. b) O "crossing-over" na gametogênese da mãe garante que Os dois heredogramas a seguir foram montados para duas famílias que apresentavam distúrbios musculares geneticamente determinados. mas pode não ser ela quem contribuiu com o gameta responsável pela síndrome do filho.5. enquanto a outra parte. pelo menos um dos avós de João também é daltônico. c) A AME pode ser um caráter ligado ao sexo. A Atrofia Muscular Espinhal (AME) não impede a reprodução e pode ser transmitida pelo pai. O gene que codifica para a produção desse fator está localizado no cromossomo X em uma região que não apresenta homologia em Y. ele obrigatoriamente contribuiu com o gameta responsável pela síndrome do filho. 1.5. EXCETO: a) Se o pai de João é daltônico. conhecido como eucromatina.2 a filha receba dela os alelos dominantes para daltonismo e hemofilia no mesmo cromossomo. Questão 849 A hemofilia é um distúrbio genético humano. Um exemplo disso é a inativação completa de um dos dois cromossomos X em fêmeas de mamíferos. que se caracteriza pela falta de um dos fatores de coagulação sangüínea. o que permite expressar os dois alelos dominantes. ao microscópio. d) Os dois caracteres DMD e AME não podem estar localizados no mesmo par de homólogos. 191 . o DNA não-expresso é altamente condensado na forma de heterocromatina. d) A não-expressão dos alelos dominantes recebidos garante que a filha seja normal para os dois caracteres. o cromossomo X de origem materna condensado.

d) A chance de o casal II-5 × II-6 ter uma criança afetada por esse caráter é de 1/4. B e C) que apresentam. c) O padrão da plumagem das galinhas depende dos alelos que recebem do seu progenitor do sexo masculino. b) Não existem indivíduos portadores do gene da hemofilia na família B. Maria.5. é INCORRETO afirmar: a) O pai de Maria não é portador. Questão 850 Um homem e uma mulher com visão normal tiveram uma filha. 1.5. O fenótipo mais marcante dessa síndrome é a ausência de glândulas sudoríparas na pele. d) Se o gêmeo afetado por daltonismo for do sexo feminino. sendo um deles daltônico e outro normal.000 nascimentos. Questão 852 A Displasia Ectodérmica Anidrótica (DEA) apresenta prevalência na população de 1:100. constituem o sexo homogamético (macho ZZ). Do casamento de Maria com Manuel nasceu um casal de gêmeos. sendo uma síndrome hereditária recessiva ligada ao cromossomo X. c) Na família C. Dessa forma as galinhas constituem o sexo heterogamético (feminino ZW).na segunda e terceira gerações. é correto afirmar. Questão 851 Em Galináceos a determinação do sexo (sistema ZW) segue um padrão inverso ao que se observa em mamíferos (sistema XY). três famílias (A. um progenitor afetado por essa anomalia. Sabendo-se que o daltonismo é uma característica determinada por gene recessivo ligado ao sexo. mas Maria é portadora do gene que causa daltonismo. pelo menos dois indivíduos apresentam o gene causador de hemofilia. c) Se o gêmeo afetado for o do sexo masculino. Os experimentos a seguir foram desenvolvidos para se estudar a herança do caráter padrão da plumagem de galináceos da raça Langshan Black (fenótipo Lisa) cruzados com galináceos da raça Plymouth Rock (fenótipo Listrada). Manuel certamente é normal.5. receberam o alelo dominante de seu progenitor do sexo feminino. EXCETO: a) Na família A. EXCETO: a) Os galos com padrão de plumagem listrada representados.2 1.2 Analisando-se o heredograma. d) O caráter plumagem lisa é recessivo em relação ao caráter plumagem listrada. enquanto os galos O caráter descrito é uma herança ligada ao sexo. b) Nos dois experimentos. é correto afirmar. pelo menos um indivíduo apresenta o gene causador de hemofilia. De acordo com as informações apresentadas. b) Os dois gêmeos podem ter recebido o gene recessivo que determina o daltonismo. em comum.5. 192 . também com visão normal para daltonismo. os galos listrados de F são heterozigotos quanto aos alelos que determinam esse caráter. Manuel é certamente daltônico.

Nicolau II. b) Robson. e) Michele e Robson podem ser filhos de mãe daltônica e Aline a tia materna. Um irmão da czarina Alexandra também era afetado por essa doença. Tatiana. mesmo que o pai seja daltônico. II e III. sua esposa Alexandra.Questão 854 Robson. c) Metade dos descendentes machos das gêmeas deverão apresentar a síndrome. O genoma humano é de 46 cromossomos. Michele e Aline são membros de uma mesma família.5. O daltonismo é transmitido por herança genética. é INCORRETO afirmar: a) As manchas na pele das gêmeas representadas podem ser o resultado da ocorrência de heterocromatina para o cromossomo que carrega o alelo dominante. III. d) Um macho com o alelo recessivo pode passá-lo para suas filhas e filhos.2 A figura apresenta duas gêmeas univitelínicas. que apresentarão o fenótipo da síndrome.5. No entanto. A probabilidade de que Olga. d) Somente I e III. heterozigotas e. Maria. poderíamos estabelecer os seguintes graus de parentesco. II. suas quatro filhas (Olga.5. a) Robson pode ser filho de Aline. b) I. Está correta ou estão corretas: a) Somente I e II. filha do casal. Anastasia) e seu filho Alexis. c) Somente II e III. Com base nas informações dadas e em seus conhecimentos. as manchas que aparecem nessas mulheres são produzidas por um corante especial capaz de revelar áreas com poucas ou nenhuma glândula sudorípara.2 fotografia mostra o último czar da Rússia. não apresentam a síndrome. e) Nenhuma. portanto. as pessoas citadas apresentam o seguinte genótipo: Robson Michele Aline (Xd) Y (XD) (Xd) (XD) (XD) 1. Para o caráter daltonismo. d) Robson pode ser pai de Aline e de Michele. Questão 853 Analise as afirmações: I. Michele e Aline podem ser irmãos. Questão 855 1. A hemofilia é uma herança genética ligada aos cromossomas sexuais. Baseados nos mecanismos genéticos.5. c) Michele pode ser mãe de Robson e de Aline. fosse portadora do alelo para hemofilia é de a) 1/4 b) 1/64 c) 1/2 d) 1/8 e) 1/32 193 . que sofria de hemofilia. b) As gêmeas podem ter herdado o alelo recessivo tanto de seu pai quando de sua mãe.

Se um homem daltônico casa-se com uma mulher normal.5.5. e) recebeu o gene de seu pai. as pessoas indicadas pelos números 3 e 6 apresentam uma doença rara determinada por um gene dominante localizado no cromossomo X. Questão 858 O daltonismo é uma doença hereditária e ligada ao sexo na espécie humana. d) recebeu o gene de seu pai. a probabilidade desse casal ter um filho homem e daltônico é: a) 25 % b) 8 % c) 12. o homem de etnia amarela apresenta uma característica determinada por um gene recessivo ligado ao sexo. Na tira de quadrinhos. e) terá todos os seus descendentes com a doença. c) recebeu o gene de sua mãe. pode-se dizer que ele a) é homozigoto recessivo para esse gene.Questão 856 1. d) poderá ter metade de seus descendentes com a doença. heterozigoto para essa característica. heterozigota para essa característica. Questão 857 Na genealogia a seguir. Assinale a descendência 194 .5. uma vez que o loco gênico está no cromossomo Y.2 a) não terá chance de apresentar descendentes com a doença.5.2 1. não portadora do gene para o daltonismo. b) poderá ter apenas descendentes do sexo feminino com a doença. b) é heterozigoto para essa característica. Descendendo de pais com visão normal.5 % d) 0 % Questão 859 Observe a árvore genealógica a seguir. c) poderá ter apenas descendentes do sexo masculino com a doença.5. porém portador do gene para o daltonismo d) os indivíduos 4 e 5 são daltônicos Questão 860 Em drosófilas. referente a uma família com herança para daltonismo (herança ligada ao sexo e deve-se a um gene recessivo). a cor amarela do corpo é determinada por um gene recessivo localizado no cromossomo X.5. O casal indicado pelos números 5 e 6 1. podemos afirmar: a) somente o indivíduo 2 é daltônico b) o genótipo do indivíduo 4 é XdY c) o indivíduo 1 é normal. e a cor cinza pelo alelo dominante.2 elativamente aos indivíduos anteriores.

(08) O mecanismo genético da hemofilia se deve à presença de um gene ligado ao sexo. a) machos: 100% amarelos .5.5. b) dominante. ou seja. b) tanto os filhos quanto as filhas sejam sempre afetados. (02) É uma doença mais comum em homens que em mulheres. assinale o que for correto. uma forma de daltonismo que provoca cegueira para as cores vermelho e verde. Questão 862 Considere o heredograma a seguir.esperada a partir do cruzamento entre uma fêmea amarela e um macho cinzento. c) tanto os filhos quanto as filhas sejam sempre normais.fêmeas: 100% amarelas. atinge indivíduos de um único sexo. (01) É restrita ao sexo. (04) As mulheres hemofílicas geralmente morrem na menarca. b) machos: 100% cinzentos . d) apenas as filhas sejam afetadas.fêmeas: 50% cinzentas e 50% amarelas. c) Homem daltônico e mulher daltônica. localizado no cromossomo X.5. e) recessivo. é possível concluir que a anomalia é devida provavelmente a um alelo a) localizado no cromossomo Y. 1. d) machos: 50% cinzentos e 50% amarelos . Na prole de um homem afetado casado com uma mulher normal. e) apenas os filhos sejam afetados.5. c) recessivo. (16) Se transmite de pai para filho. situado num autossomo. d) dominante. d) Homem daltônico e mulher normal. é determinada pelo gene recessivo d. c) machos: 100% amarelos . em virtude da não-coagulação do sangue. Questão 863 Em seres humanos. anomalia hereditária caracterizada por uma deficiência na coagulação do sangue. espera-se que a) tanto os filhos quanto as filhas possam ser normais ou afetados. localizado no cromossomo X. Ao consultar um médico. Qual das opções fenotípicas abaixo corresponde à do casal em questão? a) Homem normal e mulher normal. e) Homem normal e mulher normal. situado num autossomo. Questão 864 Sobre a hemofilia. já as meninas serão normais.2 partir da sua análise. porém portadora de gene recessivo d.fêmeas: 50% cinzentas e 50% amarelas. Questão 861 O raquitismo resistente à vitamina D é uma doença determinada por um gene dominante de herança ligada ao sexo. ligado ao cromossomo X. um casal fica sabendo que todos os seus filhos do sexo masculino serão daltônicos.2 195 . b) Homem normal e mulher daltônica.fêmeas: 100% cinzentas.fêmeas: 100% cinzentas. Questão 865 Considere o heredograma: 1. e) machos: 50% cinzentos e 50% amarelos .

o R. Fêmea sem pêlo: 1/8 Questão 869 Observe a figura a seguir que apresenta o heredograma de uma família na qual alguns membros apresentam hemofilia. responsável por animal peludo. Joana teve um filho que apresentou síndrome hemorrágica caracterizada por baixo nível plasmático do fator VIII da coagulação. Macho sem pêlo: 1/4. A partir do cruzamento XrY × XRXr. Macho sem pêlo: 3/16. e) esta anomalia não será transmitida a nenhum descendente. Fêmea peluda: 9/64. Macho sem pêlo: 9/64. e 58 autosomos mais XY no macho. como a cor da pele. é: a) 100% para todas as mulheres da família b) 100% para Joana. ( ) O caráter em questão é condicionado por um gene recessivo e ligado ao sexo.abe-se que o pai. Em relação aos descendentes deste casal é CORRETO afirmar que: a) esta anomalia será transmitida a todos os filhos do sexo masculino. XX na fêmea. ( ) Essa árvore genealógica representa um caso de anomalia hereditária. Essa figura indica os grupos sangüíneos do sistema ABO de alguns dos seus membros.5. Questão 867 Um homem possui uma anomalia dominante ligada ao cromossomo X e é casado com uma mulher normal. b) esta anomalia será transmitida à metade dos filhos do sexo masculino. analise os itens. O gene responsável pela quantidade de pêlos no animal está situado no cromossomo X. ( ) Essa genealogia apresenta um tipo de interação gênica. Questão 868 Em bovinos ocorrem 60 cromossomos na célula somática. Fêmea peluda: 1/4. o marido. A probabilidade genética de serem portadoras do gene para a hemofilia A. determinada por um gene presente no cromossomo Y. neste caso. Fêmea peluda: 3/16. c) esta anomalia será transmitida a todas as filhas. sendo 58 autossomos mais dois cromossomos sexuais. Esse gene é representado por dois alelos. recessivo. Fêmea sem pêlo: 1/8 d) Macho peludo: 36/64. Fêmea peluda: 3/8.5. sua mãe e sua filha c) 100% para Joana e 50% para sua filha d) 100% para Joana e 50% para as outras mulheres da família e) 100% para Joana e 25% para sua filha Questão 866 Tendo em vista o heredograma. 196 . os cinco irmãos homens e um sobrinho de Joana são normais. Fêmea sem pêlo: 1/16 c) Macho peludo: 3/8. responsável por animal sem pêlo. ( ) Esse pedigree mostra um exemplo de herança passada do avô ou da avó para o neto por meio da mãe portadora. grave anomalia relacionada à alteração no tempo de coagulação do sangue. Macho sem pêlo: 3/8.2 as proporções fenotípicas esperadas na descendência são: a) Macho peludo: 1/4. influenciada pelo meio ambiente. Fêmea peluda: 3/8. d) esta anomalia será transmitida à metade das filhas. e o r. 1. Entretanto. Fêmea sem pêlo: 1/4 b) Macho peludo: 9/16. Macho sem pêlo: 1/8. Fêmea sem pêlo: 10/64 e) Macho peludo: 1/8.

b) a probabilidade de nascimento de outra criança hemofílica e do grupo B para o casal III-6 e III-7 é de 25%.5. e) o indivíduo I-1 é heterozigoto para o sistema ABO. b) Autossômica recessiva.5. d) o indivíduo II-5 tem 50% de probabilidade de formar gametas do tipo iXh. c) Ligada ao Y. O gene que determina a ausência de G-6-PD é recessivo e situa-se no cromossoma X. em indivíduos afetados. a) Ligada ao X. é INCORRETO afirmar-se que a) a probabilidade de II-3 ser portadora do gene da hemofilia é de 50%. 1.2 1.5.2 a) 1 b) 2 c) 3 d) 4 197 .5. provocando sua destruição.Questão 871 Analise o heredograma.5. torna as hemácias sensíveis a certas drogas e nutrientes.5. Questão 872 A enzima G-6-PD (glicose-6-fosfato desidrogenase) está presente nas hemácias de indivíduos normais.5. ssinale a alternativa que NÃO contém um tipo de herança compatível com a anomalia representada no heredograma. d) Autossômica dominante. A ausência dessa enzima. Observe o heredograma que representa uma família com essa característica. 1. Questão 870 Ao fazer um exame de vista para tirar carteira de motorista. c) o indivíduo III-4 pode receber sangue de III-6.2 Com base nas informações do heredograma e considerando-se que não ocorreu mutação. um rapaz descobriu que era daltônico.2 1.5. Assinale entre as alternativas a seguir aquela que contém o heredograma que NÃO poderia representar a família desse rapaz.

1.1 e I. um gene para ausência de G-6-PD. Questão 874 Analise este heredograma. doença recessiva ligada ao cromossomo X. d) os filhos do sexo masculino de II. c) casais como I. analise os itens: 1. A mulher III. pelo menos. A mulher II.5. A mulher III.2 198 . inicia-se na infância e impede a reprodução dos afetados.5. d) o indivíduo II-3 pode ter recebido o gene da G-6-PD tanto do seu pai quanto de sua mãe. condicionada por gene recessivo localizado no cromossoma X: Considerando-se as informações contidas nesse heredograma e outros conhecimentos sobre o assunto. b) indivíduos do sexo masculino afetados por essa distrofia muscular são filhos de mães heterozigotas.2 . é CORRETO afirmar que a) cada um dos indivíduos representados tem.4 é homozigota 4. d) mulheres afetadas recebem os cromossomos X materno e paterno com o gene para essa distrofia. A mulher I. em que está representada a herança do daltonismo.2 apresenta o fenótipo normal e é portador do gene do daltonismo. independentemente do genótipo do seu pai.5. b) essa família apresenta dois indivíduos heterozigotos para o gene que determina a G-6-PD.5 é heterozigota 5. é INCORRETO afirmar que a) casais com filhos afetados têm 25% de probabilidade de ter outra criança com essa doença. caracteriza-se por debilidade muscular progressiva e deformidades ósseas.2 serão daltônicos.om base nesse heredograma.5. A mulher I.2 têm maior probabilidade de ter filhos do sexo masculino daltônicos.1 x I. Questão 875 Considerando que o heredograma a seguir é o de uma herança dominante.2 têm probabilidade maior de ter filhos afetados do que de ter filhas afetadas. c) os casais como I. Considerando-se essas informações e outros conhecimentos sobre o assunto. b) o indivíduo II.4 recebeu o gene do daltonismo de qualquer um de seus genitores. Questão 873 A distrofia muscular do tipo Duchenne.9 é homozigota Está(ão) correto(s) apenas: a) 1 b) 2 c) 3 d) 1 e 3 e) 1 e 2 Questão 876 A figura a seguir faz referência a uma genealogia que ilustra a ocorrência de uma determinada doença genética. ligada ao X.2 é homozigota 2. Analise-a e avalie as proposições dadas. é CORRETO afirmar que a) o indivíduo I. c) indivíduos do sexo masculino que possuem um gene mutante para essa distrofia manifestam a doença.2 é heterozigota 3.

considerando que os indivíduos 2 e 4 são irmãs. III. III„ e III…) manifestam a característica em consideração. b) III e IV. ( ) Observando-se que a maioria dos machos (I. Questão 878 O diagrama abaixo mostra a surdez em três gerações de uma família. São Paulo: Ed. um dos tipos mais graves..5. sendo responsável por este tipo de hemofilia. IV. pode-se concluir que se trata da herança de genes localizados no cromossomo Y. analise as afirmativas. O indivíduo 7 é hemofílico. II. G. AMABIS. somente o indivíduo 6 é portador do alelo recessivo que causa a hemofilia. Com base nos textos e em seus conhecimentos. o alelo normal (H) produz o fator VIII e condiciona fenótipo não hemofílico. enquanto que o indivíduo 5 não apresenta este alelo.5. condicionou a manifestação do alelo deletério h para hemofilia. Questão 877 A hemofilia é uma doença hereditária em que há uma falha no sistema de coagulação do sangue. respectivamente. Moderna. e o indivíduo 8 pode ou não ser portador deste alelo recessivo. o alelo mutante (h) condiciona ausência do fator VIII. III. II„. Esse fator é uma proteína cujo gene codificador encontra-se no cromossomo X. o fator VIII. d) I e II. 1) de uma família em que ocorre a hemofilia A. pois herdou o alelo recessivo para ausência do fator VIII de sua mãe. 199 . ( ) A identidade genotípica é também observada entre II e IIƒ.2 ( ) A característica mostrada no heredograma é determinada por uma série polialélica de genes autossômicos. J.5.5.2 1. V3. As irmãs 2 e 4 apresentam. Estão corretas apenas as afirmativas a) I e IV. Um quadrado preto representa um homem surdo e um quadrado branco um homem normal. MARTHO.M. Observe o heredograma (fig.1. I. é causada pela deficiência de um dos fatores que agem na coagulação. Um círculo preto representa uma mulher surda e um círculo branco representa uma mulher normal. através da união entre primos irmãos (indivíduos 5 e 6). 2003. Dos primos que se casaram. ( ) Os descendentes III„ e III… apresentam o mesmo genótipo.R. a probabilidade de terem filhos hemofílicos é de 50% e de terem filhas hemofílicas é de 0%. ( ) O loco gênico determinante deste caráter deve estar localizado na porção não-homóloga do cromossomo X. e) I e III. III‚. pois herdou da mãe o alelo normal (H). A hemofilia A. Se o indivíduo 7 tiver filhos com uma mulher que tenha o mesmo genótipo para hemofilia de sua avó materna. c) II. "Conceitos de Biologia". genótipos da figura 2 e a consangüinidade.

5. Seu alelo recessivo é responsável pelo fenótipo cauda normal. a probabilidade é zero. Se uma fêmea de cauda normal for cruzada com um macho de cauda retorcida. c) dominante ligada ao sexo. . a probabilidade é 100%. b) o pai é heterozigoto para a cegueira da cor verde. o fenótipo cauda curta e retorcida é determinado por um gene dominante denominado "Bent". d) recessiva ligada ao sexo. b) autossômica recessiva. Questão 879 A cegueira da cor verde na espécie humana é uma característica recessiva ligada ao sexo. a filha possui visão normal. c) o pai é homozigoto para a cegueira da cor verde.ela está casada com um homem normal. 200 . b) machos e fêmeas com cauda curta e retorcida na proporção de 2:1. Qual a probabilidade de que um(a) filho(a) deste casal venha a ser afetado pela doença? a) Se a mulher for homozigota. Soma ( ) Questão 881 condição de surdez mostrada no heredograma é herdada como uma característica: a) autossômica dominante. É correto afirmar que: a) a mãe obrigatoriamente apresenta a cegueira da cor verde. . localizado na região não homóloga do cromossomo X. Em camundongos. .seus pais não são afetados.5. d) todos os machos com cauda curta e retorcida e todas as fêmeas com cauda normal. (02) Esse gene deve se manifestar com maior freqüência nas fêmeas. Questão 880 Genes situados na porção ímpar do cromossomo X são transmitidos segundo um padrão definido como Herança Ligada ao Sexo. c) machos e fêmeas com cauda normal na proporção de 100%. Questão 882 Existe uma doença condicionada por um gene recessivo. (16) Machos afetados descendem de machos também afetados. b) Se a mulher for homozigota. enquanto o filho não enxerga a cor verde. c) Se a mulher for homozigota. a probabilidade é 25%. Considerando um gene recessivo e localizado nessa porção do cromossomo X. sua descendência apresentará a seguinte proporção: a) machos e fêmeas com cauda curta e retorcida na proporção de 100%. (64) Fêmeas afetadas são necessariamente descendentes de fêmeas afetadas.1. (32) Machos afetados descendem de fêmeas portadoras ou afetadas. d) Se a mulher for heterozigota. a probabilidade é 75%. que leva a uma debilidade muscular progressiva (distrofia muscular progressiva).2 (08) Esse gene deve se manifestar apenas nos machos. Em uma família. d) a mãe é pelo menos heterozigota para a cegueira da cor verde. (04) Esse gene deve se manifestar com maior freqüência nos machos. e) todos os machos com cauda normal e todas as fêmeas com cauda curta e retorcida. é correto afirmar: (01) Esse gene deve se manifestar com igual freqüência em machos e fêmeas. e) o pai obrigatoriamente apresenta a cegueira da cor verde. e) holândrica. localizado no cromossomo sexual comum aos dois sexos.Uma mulher com fenótipo normal tem um irmão afetado e um tio materno também afetado pela doença.

o gene para o daltonismo encontra-se: a) em todas as células somáticas. I . assinale a(s) proposição(ões) CORRETA(S).e) Se a mulher for heterozigota. 201 1. estão envolvidos um homem que tem a doença e outro que não a tem. e possui um alelo ligado ao X recessivo b. e) Apenas II e III. b) em todas as células gaméticas. Aa.5. c) A mãe é amarela e o pai. de que cores são os pais? a) A mãe é malhada e o pai. II . (01) Não é possível a existência de mulheres hemofílicas. Questão 888 A hemofilia é uma doença hereditária em que há um retardo no tempo de coagulação do sangue. c) apenas nas células do globo ocular.2 dentifique o mais provável padrão de herança representado no heredograma. (Hemofilia: herança recessiva ligada ao X) Analise as afirmações abaixo a esse respeito. Com relação a essa doença. III . (04) Entre as mulheres. . Quais estão corretas? a) Apenas I. amarelo. em uma região sem homologia no cromossomo Y. a) autossômica dominante b) ligada ao X dominante c) ligada ao Y dominante d) ligada ao Y recessiva e) ligada ao X recessiva Questão 884 Um homem é heterozigoto para um gene autossômico. os machos podem se pretos ou amarelos e as fêmeas podem ser pretas amarelas ou malhadas.O homem não hemofílico pode ser o pai do menino. e metade dos machos é amarela. a probabilidade é 100%.O homem hemofílico não pode ser o pai do menino. b) Apenas II. Questão 886 Em um caso de disputa da paternidade de um menino hemofílico. amarelo. b) A mãe é malhada e o pai. Quando metade das fêmeas de uma ninhada é malhada. Questão 887 Assinale a proposição CORRETA. e) apenas nos gametas com cromossomo y. preto. (02) É condicionada por um gene que se localiza no cromossomo X. Assim. e decorre do não funcionamento de um dos fatores bioquímicos de coagulação. do sexo masculino. a outra metade é preta.5. Questão 883 Interprete o heredograma abaixo. c) Apenas III. Que proporção dos seus espermatozóides espera-se que seja A/Xö ? a) 0 % b) 25 % c) 50 % d) 75 % e) 100 % Questão 885 Nos gatos domésticos a cor do pêlo é ligada ao cromossomo X. e) A mãe e o pai são pretos.As bases genéticas da hemofilia apoiam a paternidade do homem hemofílico. preto. d) apenas nas células-mãe dos gametas. é possível encontrar um máximo de três fenótipos e dois genótipos. d) A mãe é preta e o pai. Em um indivíduo daltônico. d) Apenas I e II.

Analise as afirmativas abaixo. c) 1/4. e) 3/4. . o caráter cerdas retorcidas é determinado por um gene recessivo e ligado ao sexo.menina com visão normal para as cores. c) 1/2.A distrofia muscular de Duchenne é uma doença que ocorre exclusivamente no sexo masculino. mesmo no caso de pequenos ferimentos. Questão 889 A hemofilia é uma doença recessiva ligada ao sexo. que se caracteriza pela dificuldade de coagulação do sangue. Uma fêmea heterozigota foi cruzada com um macho normal. Em um casal em que a mulher é heterozigota para a hemofilia e o marido é normal. b) 1/3. as mulheres heterozigotas para o gene da distrofia muscular de Duchenne podem apresentar graduações da característica. 50% de fêmeas com cerdas retorcidas e 50% de fêmeas normais. (32) É um exemplo de herança ligada ao sexo. há uma maior incidência dessa doença entre eles. d) 100% de machos com cerdas retorcidas e 100% de fêmeas normais. Questão 890 Em drosófila. que ocorre nas células das fêmeas dos mamíferos (hipótese de Lyon). a possibilidade de esse casal ter uma filha com daltonismo é a) zero. . espera-se que 50% deles sejam normais e 50% sejam hemofílicos. b) 50% de machos normais.(08) Entre os homens. Questão 891 Um casal que possui visão normal para as cores. d) 1/8. a distrofia muscular de Duchenne é uma doença condicionada por um gene recessivo localizado no cromossomo X.A distrofia muscular de Duchenne é uma doença que ocorre quase que exclusivamente em meninos. d) 3/4. Soma ( ) . II.Devido à inativação ao acaso de um cromossomo X. III. não portadora. (16) Entre os descendentes de um homem hemofílico e de uma mulher normal. por isso. que acarreta degeneração e atrofia dos músculos. b) 1/4. Questão 893 Observe a genealogia abaixo sobre uma família que apresenta pessoas afetadas por uma anomalia hereditária. São corretas as afirmativas a) apenas III. d) I e II.menino com visão normal para as cores. A descendência esperada será de a) 50% de machos e 50% de fêmeas normais e 50% de machos e 50% de fêmeas com cerdas retorcidas. O alelo dominante determina cerdas normais (não retorcidas). tem 3 filhos com as seguintes características: 202 . 50% de machos com cerdas retorcidas e 100% de fêmeas normais. e) 100% de machos normais e 100% de fêmeas com cerdas retorcidas. e) 1. é possível ocorrer apenas um genótipo. Sabendo-se que o daltonismo é uma herança ligada ao X. Os homens afetados começam a apresentar os sintomas na primeira infância e não se reproduzem porque morrem antes de atingir o período reprodutivo. c) II e III. I. Questão 892 Na espécie humana.menino com daltonismo. c) 100% de machos normais. em que os indivíduos afetados têm graves hemorragias. b) I e III. a probabilidade de nascimento de uma criança do sexo masculino e hemofílica é a) 1/2.

5. serão manchados. (0) O caráter cor da pelagem. II .5. mas daltônicas do outro.2 anomalia em questão é transmitida por meio de um gene a) recessivo ligado ao cromossomo X.2 Utilizando as informações anteriores. não havendo dominância. a calvície hereditária é uma característica influenciada pelo sexo. é condicionado por genes ligados ao cromossomo X.5. cruzada com um macho preto.É possível que o casal tenha filhas não-calvas. Marque a alternativa correta. (3) Um gato macho não transmite para seus filhos machos os genes para cor da pelagem. d) autossômico dominante.5. b) I e III são corretas. c) dominante ligado ao cromossomo X.A mulher é dupla heterozigota para os genes em questão. c) II e III são corretas. de visão normal em um dos olhos. (1) As fêmeas manchadas são heterozigotas para o caráter cor da pelagem. d) O genótipo do Sr 9 é XHY. podemos afirmar corretamente: a) O genótipo da Sra 5 é XHXH.5.1. observam-se os seguintes fenótipos: 1.2 1. b) autossômico recessivo. Um casal não-calvo e de visão normal tem um filho calvo e daltônico. I . b) O genótipo da Sra 5 é XHXh. III . julgue os itens a seguir. O gene que condiciona a calvície é dominante nos homens e recessivo nas mulheres.25% das filhas do casal poderão ser calvas e daltônicas. d) Apenas III está correta.5. (2) Os descendentes de uma fêmea amarela. O daltonismo é de herança recessiva ligada ao cromossomo X. Questão 896 Com relação à coloração da pelagem de gatos. Com base no heredograma a seguir. a) I e II são corretas. Questão 894 Na espécie humana. 203 . Considerando os dados apresentados. nos gatos. Questão 895 O gene h que determina a hemofilia na espécie humana é recessivo e está localizado no cromossomo X. e) O genótipo da Sra 8 é XhXh. analise as afirmativas a seguir. c) O genótipo da Sra 8 é XHXH.

certamente.5. (02) O daltonismo é determinado por um gene recessivo.2 Assinale dentre as alternativas que se seguem. portadores do gene. (32) O genótipo do indivíduo 9 é XdY. Qual é a probabilidade de se obter uma fêmea de olhos brancos deste cruzamento? a) 1. (64) O genótipo do indivíduo 5 é XdXd. sendo que seu alelo dominante condiciona visão normal.00.00.50. (16) O casal 1 x 2 pode ter filhos homens daltônicos.5. a cor branca dos olhos é devida à herança ligada ao sexo. Questão 901 Um casal não hemofílico teve um filho do sexo masculino com hemofilia. o número esperado de crianças do sexo masculino será a) 1. certamente. b) 0. portadoras do gene. b) 2. e) 0. Questão 900 A genealogia abaixo nos mostra uma forma de transmissão do daltonismo. (08) O indivíduo 8 tem o mesmo fenótipo de sua avó materna. d) 0. Uma mosca fêmea com olhos coloridos. c) 3. 204 . a(s) correta(s).5. certamente. em seis partos diferentes. e) os homens 1 e 4 são.Questão 897 Em moscas de frutas. (04) O indivíduo 1 transmite a todas as suas filhas um cromossomo Xd. b) as filhas do casal 3 e 4 são. Questão 898 Considere o heredograma.5. Indique a alternativa com a probabilidade desse casal ter uma filha hemofílica: a) 0% b) 25% c) 50% d) 75% e) 100% 1.67. cruza-se com macho de olhos brancos. e) 5. Se esta mulher der à luz seis crianças normais. c) as mulheres 2 e 3 são. cuja mãe tinha olhos brancos. podemos afirmar que a) a mulher 2 é homozigota. 1.25. Questão 899 Uma mulher é portadora de um gene letal presente no cromossomo X. portadoras do gene. d) todas as filhas do casal 1 e 2 são portadoras do gene. Este gene provoca aborto espontâneo algumas semanas após a formação do zigoto. que representa uma família portadora de caráter recessivo condicionado por um gene situado em um dos cromossomos sexuais.2 respeito desta genealogia. c) 0. d) 4. (01) O daltonismo está relacionado com genes localizados em cromossomos autossômicos.

30% a mais de heterocromatina na região distal. Esta observação foi enunciada como "2 Lei de Mendel" ou "Lei da Segregação Independente". Posteriormente. Questão 907 Mendel. ou seja. Questão 905 O exame citogenético de um indivíduo normal revelou que o seu cromossomo Y contém. c) herança holândrica. ele fez algumas suposições sobre a herança desse cromossomo. Na próxima geração dessa família esse gene se manifestará a) em todas as mulheres. I . b) o aparecimento do corpúsculo de Barr. isto é. isto é. Questão 903 A hipertricose auricular é uma anomalia genética condicionada por um gene localizado no cromossomo Y. O cromossomo Y apresenta genes holândricos. nas primeiras experiências sobre hereditariedade. Este fenômeno é chamado de: a) epistasia. e todos os seus filhos são homens.AB (50%). ab (50%). b) transmitidas do pai para 100% dos filhos homens. c) em 50% das mulheres e 50% dos homens. b) II e III são situações nas quais ocorre segregação independente e ligação gênica sem "crossing-over". II . pode-se afirmar que: a) I e II são situações nas quais os genes segregam-se independentemente. b) codominância. ab (25%). Questão 904 Como exemplo de característica na espécie humana. 205 . Observando as seguintes proporções de gametas produzidos pelo diíbrido AaBb em três situações distintas. aB (25%). ele acompanhou a transmissão de dois caracteres ao mesmo tempo. c) Se o meu irmão não tiver esse Y. d) Entre as minhas filhas.AB (40%). aB (10%). aproximadamente. Questão 906 A hipertricose auricular (pêlos na orelha) é transmitida apenas pelo homem e somente para os filhos do sexo masculino. trabalhou com apenas uma característica de cada vez.AB (25%). e) exclusivas das mulheres. Embora sem nenhuma manifestação fenotípica aparente. em relação ao padrão de cromossomo Y presente na população. d) o daltonismo. e) Provavelmente esse Y ficou grande para ser o homólogo do X. e) somente nos homens heterozigotos. e) interação gênica. As características condicionadas por tais genes são a) transmitidas da mãe para 100% das filhas. d) pleiotropia. c) a hemofilia. todos os meus descendentes também o terão. Ab (25%). genes que não possuem homologia com o cromossomo X. b) em todos os homens. d) transmitidas do pai para os filhos homens e filhas em 100% dos casos. a qual não é válida para os genes que estão em ligação gênica ou "linkage". c) transmitidas do pai só para as filhas. determinada por genes localizados no cromossomo Y. talvez ele não seja meu irmão. Assinale a suposição que está geneticamente coerente: a) Acho que o meu pai herdou essa condição genética da mãe dele. e) o albinismo. respectivamente. apenas 50% terão esse cromossomo. b) Se eu tenho este Y. genes que estão localizados nos mesmos cromossomos. d) somente nas mulheres heterozigotas. III . Um homem com hipertricose casa-se. ab (40%). por genes holândricos. a determinação cromossômica do sexo é dada pelos cromossomos X e Y. e os resultados levaram-no a concluir que: "fatores para dois ou mais caracteres são transmitidos para os gametas de modo totalmente independente". Ab (10%). temos: a) a diferenciação dos testículos.Questão 902 Na espécie humana.

d) II é uma situação na qual ocorre ligação gênica com "crossing-over". um com genótipo AaBb e outro com genótipo aabb resultou numa F com as seguintes proporções: AaBb = 35% aabb = 35% Aabb = 15% aaBb = 15% Com esses resultados. e) III é uma situação na qual ocorre ligação gênica sem "crossing-over". Questão 908 Considere uma espécie de vertebrado cujas células embrionárias têm oito cromossomos. d) Oito. Questão 912 A freqüência de recombinação entre os locos A e B é de 10%. Em quantos grupos de ligações seus genes estarão associados? a) Dois. ( ) Considerando o cruzamento ilustrado na figura. Questão 909 Considere uma espécie de vertebrado cujas células somáticas têm 12 cromossomos.5% das células formadoras de gametas. ocorrer permutação entre os locos A e B. é de aproximadamente 42%. cada tipo de gameta recombinante (Ab e aB) aparecerá com freqüência de 25%. Questão 910 O cruzamento de dois indivíduos. d) são pleiotrópicos. existe uma ligação gênica. em 100% das células germinativas da fêmea. os gametas não recombinantes e os recombinantes surgirão nas proporções esperadas de 1:1:1:1.5. e) Dez. d) Dezesseis. Em quantos grupos de ligações seus genes estarão associados? a) Quatro.c) I e III são situações nas quais ocorre segregação independente e ligação gênica com "crossing-over". b) seguem as leis do diibridismo. e) Número variável. analise a figura e as afirmações feitas a seguir. no cromossomo. a partir de progenitores com os genótipos mostrados na figura? 206 . A taxa de recombinação entre eles dependerá do quanto estiverem afastados um do outro. pode-se concluir que os genes "a" e "b": a) estão em um mesmo braço do cromossomo. Em que percentual serão esperados descendentes de genótipo AB // ab. ocorrer permutação entre os locos A e B. c) Oito. 1. pode-se inferir que ocorreu permutação (ou crossing-over). b) Seis. em 8. em 50% das células produtoras de gametas. respectivamente. ( ) Se. Questão 911 Quando dois genes estão em um mesmo cromossomo. ( ) Se. c) Três. c) constituem um caso de interação gênica. b) Quatro. a partir do cruzamento acima indicado. A esse propósito.6 ( ) A freqüência de recombinação entre os locos A e B é de 17%. ( ) A probabilidade do aparecimento de um indivíduo AB//ab. e) são epistáticos.

d) em ambas as situações ficou evidenciado o efeito pleiotrópico entre os genes.5. A geração P é genotipicamente (AB//AB) x (ab//ab). A F1.com (piloso) e sem (glabro). fenotipicamente (AB). ao cruzarem um duplo heterozigoto para os caracteres cor da flor e pilosidade no cálice da flor com um duplo-recessivo. são determinados. fenotipicamente (AB). ocorreu permutação entre os locos A e B. o hipocótilo era roxo e todas as plantas que apresentavam flores de cor branca.6 ( ) Trata-se de um caso de ligação gênica. cor do hipocótilo . Analise as proposições a seguir quanto à correção.Questão 914 Uma determinada espécie vegetal apresenta variação para cor da flor . 207 . 1. foram cruzadas com plantas de fenótipo (ab). obtendo-se uma F2 como mostrado no quadro.roxo e branco -. c) a primeira situação evidencia ligação gênica e a segunda mostra a segregação independente dos genes. A cor roxa da flor e do hipocótilo e a presença de pilosidade são dominantes. foi retrocruzada com o pai duplo-recessivo. ( ) Os locos A e B distam entre si de 35 unidades de mapa. foi observado que todas as plantas que apresentavam flores roxas. b) a primeira situação pode representar um caso de pleiotropia e a segunda evidencia uma segregação independente dos genes. Com base no texto e em seus conhecimentos é correto afirmar que a) a primeira situação pode representar um caso de pleiotropia e a segunda mostra um caso de ligação gênica.5. o hipocótilo era verde (situação 1). sendo que na segunda. ( ) A taxa de recombinação no caso mostrado é de 30%.5.6 1. Entretanto. pelos locos A e B. Em todos os cruzamentos realizados entre plantas fenotipicamente diferentes e após avaliações em várias gerações segregantes.6 a) 5% b) 90% c) 45% d) 10% e) 20% Questão 913 Dois fenótipos de interesse econômico. a ligação é mais forte do que na primeira. Plantas homozigóticas. o que mostra uma distância menor entre os genes. ambos com dominância completa.e pilosidade no cálice da flor .roxo e verde . em milho. ( ) Em 60% das células formadoras de gametas da F1. ( ) Em 35% das células gaméticas da F1 ocorreu recombinação. e) em ambas as situações ficou evidenciada a ligação gênica. respectivamente. foi observada na progênie a seguinte proporção (situação 2): 1.

nós dizemos que esta característica é uma característica poligênica.5. Os homozigotos siclêmicos morrem precocemente devido à severa anemia. III.7 208 . II. que possuem efeitos similares e aditivos. são mais resistentes à malária que os indivíduos normais. III. estão presentes na população.Um organismo com dois alelos idênticos para um "locus" em particular é considerado homozigoto para este "locus". o qual determina a doença chamada siclemia ou anemia falciforme.Questão 915 Os seguintes conceitos genéticos foram escritos por um aluno que estava com dúvidas sobre a matéria e que pediu a um professor qualificado que os conferisse: I . enquanto um organismo com dois alelos diferentes para um mesmo "locus" é considerado heterozigoto para este "locus". IV e V Questão 916 Numa determinada população a capacidade de enrolar a língua é determinada por um gene dominante A. III e V d) Apenas II. III e IV b) Apenas I. uma em cada 30 pessoas apresenta fenótipo normal e é heterozigota quanto ao gene determina a doença de Tay-Sachs.3 b) 3 c) 45 d) 60 e) 90 Questão 918 O gráfico a seguir mostra a dinâmica das freqüências do gene s. IV . V . II. III . dizemos que este "locus" possui alelos múltiplos. Qual a explicação para o comportamento das curvas do gráfico? 1.A aparência de um indivíduo com respeito a uma dada característica herdada é chamada de fenótipo. O diagnóstico pré-natal é possível. A freqüência esperada de indivíduos heterozigotos será de: a) 70% b) 48% c) 36% d) 16% e) 10% Questão 917 A doença de Tay-Sachs resulta da ação de um gene mutante localizado no cromossomo número 15. Quais afirmativas o professor diria que estão corretas? a) Apenas II. Em certas comunidades da Europa Central. IV e V e) I. para um dado "locus". e há tentativas de tratamento com algum sucesso em poucos casos.Quando uma característica particular de um organismo é governada por muitos pares de genes. o número esperado de casamentos com risco de gerar crianças com degenerescência nervosa é: a) 0.Quando três ou mais alelos. Nessa mesma população foi observado que 64% das pessoas apresentam esta característica. O gráfico refere-se ao período posterior à erradicação da malária. os heterozigotos sofrem de uma forma branda da anemia mas.Os genes em um mesmo cromossomo tendem a ser herdados juntos e são denominados "genes ligados" II . Em 2. III e IV c) Apenas I.700 casamento ocorridos entre membros sadios dessas comunidades. provocando a degenerescência nervosa mortal. por outro lado. II.

aa . Questão 920 A freqüência de indivíduos afetados por uma anomalia genética autossômica recessiva.6/16.2. d) 0. e) o crescimento da população da população devido a diminuição da predação.280. enquanto que a outra metade é composta por indivíduos duplo-recessivos (aa).1. Sabendo-se que. numa população constituída de 8. e) AA .4/16. c) 1008 e 192.320.5. Questão 919 Considere uma população em que metade dos indivíduos mantém-se heterozigota para um dado gene (Aa). b) 768 e 432. ao seu alelo recessivo i.000 é hemofílico. a freqüência de um gene autossômico dominante A é o triplo da freqüência do seu alelo recessivo a.500 c) 1/25.8 e 0. d) Cruzamentos preferenciais entre pessoas anêmicas. Aa .25.560.6. aa . d) AA .1.440. em uma dada população. concluímos que a freqüência de indivíduos homozigotos recessivos (aa) é de: a) 6.8/16.1. c) Aumento da freqüência de mutação de S para s. aa . e) AA .280. a freqüência do gene h nessa população é a) 1/500 b) 1/12.2.1.a) Diminuição da freqüência de mutação de S para s. um homem em 25. c) AA . aa .75.1/16. Aa .5% c) 25% d) 50% e) 75% Questão 924 Sabendo-se que a freqüência do gene autossômico A é igual a 0. se as proporções genotípicas forem: a) AA .6. respectivamente.00.120.8. c) AA . b) AA . era de 0. d) o casamento preferencial de indivíduos heterozigotos.400.9/16.1/16.4/16. e) 0.400. as freqüências dos genes I e i são.160. aa . se essa população estiver em equilíbrio genético. aa .9/16. numa população de 1200 pessoas.160.9/16. b) AA .000 indivíduos.5. Se.280. b) 1. Questão 922 Numa população. aa . Aa . Questão 923 Sabendo-se que uma população está em equilíbrio genético e que a freqüência de indivíduos homozigotos para um caráter autossômico e dominante (AA) é de 25%.6/16.6/16. Questão 925 A hemofilia é causada por um gene recessivo (h) localizado no cromossomo X.120. aa . Essa população estará em equilíbrio genético.16. Aa .50.25% b) 12.320. Aa . c) o nascimento de 48 indivíduos afetados entre 300 nascidos. Nessa população a freqüência do alelo A é a) impossível de se determinar. Aa . d) AA . c) 0. Aa .4/16. b) a imigração de muitos indivíduos homozigotos dominantes.1. e) Cruzamentos preferenciais entre portadores de malária. Aa .6/16. Aa . 0.6/16. Constatou-se a diminuição dessa freqüência após a) a morte de 5% da população total por falta de alimento. numa determinada população. Questão 921 A sensibilidade (gosto amargo) do ser humano ao PTC (feniltiocarbamida) se deve a um gene autossômico dominante I e a insensibilidade. Aa .000 d) 1/50. a) AA .1/16.6.600. e) 816 e 384.000 209 . d) 1152 e 48. indique a alternativa que mostra o número de indivíduos para cada genótipo. respectivamente: a) 960 e 240. b) Seleção contra os portadores do gene s.560. aa . aa . os números esperados de pessoas sensíveis e insensíveis nessa população são.

5.e) 1/100. como mostra a tabela a seguir: 210 . que tem sua expressão influenciada pelo sexo.7 Questão 929 Uma população em que atuam os princípios postulados por Hardy e Weinberg.000 Questão 926 Em uma população em equilíbrio de Hardy-Weinberg. Questão 930 A calvície na espécie humana é determinada por um gene autossômico C. as freqüências genotípicas de um determinado par de alelos "a" se distribui de acordo com o gráfico destacado: Marque o gráfico que representa a freqüência genotípica após 12 gerações: 1. calcularam-se outras freqüências. que estão indicadas na tabela abaixo. Se essa população for formada por 1000 indivíduos. O alelo que condiciona asas longas é dominante sobre o alelo que condiciona asas vestigiais. em uma população mantida em laboratório.1 x III. espera-se que sejam heterozigotos a) 700 b) 420 c) 90 d) 49 e) 21 Questão 927 Analise o heredograma a seguir no qual os símbolos escuros significam a presença de uma anomalia.5. Assinale a alternativa correspondente aos cálculos corretos.2 vir a ter uma criança com a anomalia é a) 1/420 b) 1/160 c) 1/120 d) 1/80 e) 1/50 Questão 928 Em drosófilas. Esse caráter é dominante nos homens e recessivo nas mulheres. o comprimento das asas é determinado por um par de genes. a freqüência do alelo autossômico (b) é de 30%. a probabilidade do casal III.7 abendo-se que a freqüência de heterozigotos na população é 1/20. Sabendo-se que.7 1.5. 16% apresentavam asas vestigiais. 1.

Se em uma população em equilíbrio de Hardy-Weinberg.000 indivíduos revelando os dados apresentados no quadro abaixo. e) 0. 1.5. Essa característica é determinada por um par de alelos entre os quais não há dominância. na maioria das populações da América do Sul predomina o número de pessoas de olhos escuros.7 . a) 0. b) a mecanismo de herança da cor dos olhos não ser ainda bem conhecido.36 e 0. qual a freqüência esperada de mulheres cujo genótipo pode torná-las calvas? a) 1% b) 8. A análise da população estudada concluiu que a mesma se encontra em equilíbrio de Hardy-Weinberg. existem 900 do tipo Rh negativo. d) a freqüência dos alelos para olhos escuros ser maior nas populações sul-americanas do que nas européias. Espera-se que o número de indivíduos Rh positivo homozigoto nessa população seja de a) 9.60 e 0.84. Questão 932 Numa população em equilíbrio de Hardy-Weinberg. em equilíbrio de Hardy-Weimberg. Um levantamento nos prontuários médicos de um importante hospital brasileiro identificou o grupo sangüíneo MN de 10.900 c) 4. e) tratar-se de um caso de herança quantitativa. as freqüências esperadas de indivíduos dos grupos N e MN são.16. enquanto em diversas populações européias acontece o inverso: pessoas de olhos escuros constituem a minoria. Sabe-se também que. d) 0.48. as freqüências dos alelos M e N são. N ou MN.24 e 0. a freqüência de indivíduos do grupo M é 49%. onde 81% dos homens não apresentam genótipo capaz de torná-los calvos.48 e 0. b) 0. respectivamente.24.40.7 esta população.5.1. que sempre é influenciada por fatores ambientais. formada por 10.000 indivíduos.5% c) 19% d) 42% e) 81% Questão 931 Para responder à questão.16 e 0. Questão 934 Na espécie humana. 211 m uma população. c) 0.100 e) 900 Questão 933 Sabe-se que olhos escuros são dominantes sobre olhos azuis. c) a dominância dos genes relacionados com a cor dos olhos modificar-se com o ambiente. há certas proteínas no sangue que permitem classificar as pessoas como pertencentes ao tipo sangüíneo M.550 d) 2. considere a informação a seguir.100 b) 4. Essa diferença deve-se fato de a) a herança da cor dos olhos não obedecer às leis de Mendel.

. a freqüência desse gene tende a aumentar devido a) ao fato de ser recessivo.respectivamente. para essa característica... Preenchem correta e respectivamente as lacunas (1). direcionados.. e das freqüências fenotípicas..66 Questão 938 Uma população de roedor está sendo estudada quanto ao equilíbrio de Hardy-Weinberg para uma característica determinada por um locus autossômico. o albinismo é determinado por um alelo autossômico recessivo.50 e 0..49 e 0. O alelo recessivo a é responsável pelo fenótipo R e tem freqüência q. as freqüências gênicas e genotípicas se mantenham constantes ao longo das gerações. e fatores evolutivos .34 e 0..(I). p e q. Com base nesses dados. Então. a freqüência esperada de heterozigotos normais é a) 91 % b) 75% c) 49% d) 42% e) 21% Questão 940 Um par de genes determina resistência a um fungo que ataca a cana-de-açúcar e os indivíduos suscetíveis (aa) apresentam freqüência de 0. cruzamentos . são condições para que.6.. assinale o que for correto. direcionados. b) às mutações que continua a sofrer. ausentes d) Pequena.50 d) 0. com p=0. atuantes c) Infinitamente grande. c) à seleção natural.. pelo menos. Aa e aa são encontrados com as freqüências p£.51 b) 0.56 c) 0. atuantes b) Infinitamente grande. 24 mil apresentam o genótipo AA e 36 mil apresentam o genótipo aa. é possível determinar se a população está ou não em equilíbrio. (32) Quando todas as freqüências genotípicas são iguais. (02) No equilíbrio. é correto afirmar que a freqüência dos alelos A e a será respectivamente: a) 0.44 e 0.. Com o tempo. e) à oscilação genética.56 e 0. ausentes e) Pequena. (64) A população está em equilíbrio apenas quando 75% dos indivíduos apresentam o fenótipo D e 25% apresentam o fenótipo R. (08) Com informações sobre os valores das freqüências gênicas. ao acaso.44 e) 0.(2). ao acaso. Questão 939 Na espécie humana. respectivamente.. atuantes Questão 937 Em uma população composta de 100 mil indivíduos. a) 9% e 42% b) 17% e 34% c) 18% e 21% d) 21% e 18% e) 34% e 17% Questão 935 Suponha que uma variedade de determinada planta possua um gene que lhe confere vantagem em relação a uma outra variedade da mesma população. de acordo com Hardy e Weinberg.. Se em uma dada população em equilíbrio de Hardy-Weinberg 9% dos indivíduos são albinos. Em uma população que está 212 . (16) O conhecimento das freqüências genotípicas é suficiente para se determinar a condição da população quanto ao equilíbrio. O alelo dominante A condiciona o fenótipo D e ocorre com a freqüência p. a população não está em equilíbrio. 2pq e q£. são esperados 160 indivíduos com o fenótipo R.. (01) A população está em equilíbrio se estiver ocorrendo seleção natural há. numa população. ao acaso. (04) Em uma amostra de 1000 indivíduos de uma população em equilíbrio. d) ao seu efeito dominante. Questão 936 Tamanho .25. (2) e (3): a) Infinitamente grande.(3). uma geração. os genótipos AA.

7 Numa população em equilíbrio. Questão 942 Numa população em equilíbrio. a) 25%. se 213 1.5. b) a freqüência de heterozigotos nessa população é de 24%. e) 80%. em uma população. pela cor amarela. Hardy e W. Com base nesses dados é INCORRETO afirmar-se que a) a freqüência de indivíduos com fenótipo dominante é 91% b) cerca de 10% da população é homozigota. Questão 943 Uma população em equilíbrio é constituída de 500 indivíduos. b) 60%. c) o gene dominante é mais freqüente que o recessivo. ocorram ao acaso. d) 70%. respectivamente.800 desenvolveram plantas com raízes brancas. O gene B é responsável pela cor branca e seu alelo recessivo. que surjam por mutação. Aa e aa é.em equilíbrio de Hardy-Weinberg. 10% e 10%. dos quais 45 apresentam um fenótipo determinado por gene recessivo. permanecem constantes. Para que isso ocorra.000 sementes de uma população panmítica. A probabilidade de ocorrência de indivíduos heterozigotos nessa população é a) 84%. as freqüências dos alelos. as populações sejam panmíticas. . e) a probabilidade de ocorrência de homozigotos nessa população é de 52%. que podem desaparecer. c) 50%. Questão 944 A cor da raiz da cenoura é controlada por um par de genes autossômicos. c) 48%. e de cada genótipo. d) 30% dos gametas produzidos carregam o alelo recessivo. ou seja. ( ) não ocorram fluxos migratórios. sob condições especiais. A partir dessas informações pode-se afirmar que a) a freqüência do gene para coloração amarela é de 36% nessa população. 50% e 25%. nas populações. d) a probabilidade de formação de gametas B é de 80% nessa população. Um agricultor colheu 20. a freqüência de heterozigotos será: a) 15% b) 25% c) 50% d) 75% e) 100% Questão 941 O gráfico mostra as relações entre as freqüências dos alelos A e a e as freqüências genotípicas AA. em que os casamentos ocorrem ao acaso e a freqüência dos genes A e a é de 50% para cada um. segundo os referidos autores. que se cruza ao acaso. b) 40%. 30% e 30%. ( ) os novos alelos. e) 24%. 25% e 25%. das quais 12. ( ) os cruzamentos. uma vez que esta tende a selecionar determinados alelos em detrimento de outros. geração após geração. a freqüência de indivíduos Rh negativos é de 16%. e) os heterozigotos representam 42% da população. Weinberg postularam que. c) a freqüência de plantas com raízes amarelas será de 64% se a população se mantiver em equilíbrio. d) 36%. H. A probabilidade de se encontrarem indivíduos AA. 15% e 15%. Aa e aa numa população em equilíbrio. os quais acarretam troca de alelos entre populações diferentes. é necessário que: ( ) não haja pressão de seleção natural. Questão 945 G.

A probabilidade de um indivíduo desta população ser heterozigoto Ww é igual a: a) 9/100. d) Somente as afirmativas 2 e 4 são verdadeiras. tais como mutação. Se houver 48 heterozigotos. e) Somente as afirmativas 3 e 4 são verdadeiras. c) Somente as afirmativas 1 e 3 são verdadeiras. inviabilizando a aplicação do teorema. se houver 76 animais castanhos. os cruzamentos ocorram de modo preferencial e esteja isenta de fatores evolutivos. e) 1/2. Ela não pode estar em equilíbrio de Hardy-Weinberg. é possível que a seleção natural seja a causa do aumento do número de heterozigotos. A endogamia pode ser a causa do desvio em relação ao equilíbrio de Hardy-Weinberg. Qual o percentual da população que possui a vantagem heterozigótica? a) 9% b) 19% c) 42% d) 81% e) 91% Questão 947 Em 1908. Assinale a alternativa correta.incorporem rapidamente ao estoque gênico.7. a) Somente a afirmativa 1 é verdadeira. ( ) nas populações demasiadamente pequenas. pode-se concluir corretamente que: a) a população estudada é infinitamente grande. foram encontrados 16 azuis. os cruzamentos ocorram de modo preferencial e esteja sujeita a fatores evolutivos. tais como mutação. c) 3/10. c) a população encontra-se em equilíbrio genético. sendo a cor azulada determinada por um alelo recessivo e a cor castanha. b) Somente as afirmativas 1 e 2 são verdadeiras. seleção natural e migrações. a partir de seu estabelecimento. c) a população seria infinitamente grande. Questão 948 Em mexilhões. b) o tamanho da população seja reduzido. ela estará em equilíbrio de Hardy-Weinberg. uma vez que as freqüências gênicas foram alteradas. tais como mutação. 2. Em 214 . é necessário que a) a população seria infinitamente grande. na qual p indica a freqüência do alelo dominante e q indica a freqüência do alelo recessivo. seleção natural e migrações. observada ao longo de gerações. b) não houve a atuação dos fatores evolutivos sobre a população. Questão 951 No estudo da genética de populações. em uma população em equilíbrio genético as freqüências gênicas e genotípicas permanecem constantes ao longo das gerações. tais como mutação. os cruzamentos sejam ao acaso. os cruzamentos ocorram ao acaso e esteja sujeita a fatores evolutivos. d) a população seja de tamanho reduzido. Com relação a essa população. 9% nascem com anemia falciforme. utiliza-se a fórmula p£ + 2pq + q£ = 1. b) 49/100. os cientistas Hardy e Weinberg formularam um teorema cuja importância está no fato dele estabelecer um modelo para o comportamento dos genes nas populações naturais. Questão 946 Numa certa população de africanos. 4. seleção natural e migrações. Se houver 30 heterozigotos. Para tanto. d) a população está evoluindo. os cruzamentos ocorram ao acaso e esteja isenta de fatores evolutivos. Questão 949 De acordo com a Teoria de Hardy-Weimberg. Se os valores das freqüências gênicas de uma população. 3. Em uma população de cem animais. Questão 950 Numa população a freqüência do gene dominante W é 0. e) os cruzamentos nessa população ocorrem ao acaso. por um dominante. d) 42/100. seleção natural e migrações. considere as seguintes afirmativas: 1. as cores externas das conchas são determinadas por dois alelos de um gene. forem significativamente diferentes dos valores esperados através da aplicação do teorema.

b) morram por ficarem prejudicadas na realização da síntese protéica.uma população em equilíbrio de Hardy-Weinberg espera-se que a) o genótipo homozigoto dominante tenha freqüência p£=0. b) 61%. c) 50%.0.01 c) AA . c) os alelos que expressam fenótipos mais adaptativos sejam favorecidos por seleção natural. as freqüências genotípicas esperadas para essa população. aa . etc.81.0. Aa . ou dos diferentes genótipos. é 0. e) 42%.01 b) AA . serão: a) AA . Aa .5. o genótipo heterozigoto tenha freqüência 2pq=0.18.5. e) cresçam.0. produzindo anticorpos contra as proteínas estranhas que serão fabricadas. numa porcentagem de 9%. 1.09. transferindo as características implantadas para as células-filhas. d) reproduzam-se.50.25 Questão 953 Os grupos sanguíneos de uma população foram estudados no que se refere ao sistema MN dos seus indivíduos.0.0. Assim.0.25.9. Questão 954 Cientistas conseguiram inserir um grande trecho de ADN estranho ao ADN de cobaias como mostra o desenho a seguir: O resultado esperado para este trabalho é que as células que receberam o implante: a) morram pela presença de ácido nucléico estranho à composição do núcleo. Verificou-se que existiam.8. numa população. aa . portadores de sangue do tipo N.0.1 215 . b) haja manutenção do tamanho da população ao longo das gerações.0. 1. Aa . se estiver em equilíbrio.25.09. Para conseguir entender as notícias. seja igual a 1. e) ocorra manutenção das mesmas freqüências genotípicas ao longo das gerações. aa . estudou a estrutura da molécula de DNA e seu funcionamento e analisou os dados do quadro a seguir.1 e) AA .5 e o genótipo homozigoto recessivo tenha freqüência q£=0. aa .1.0.8. a freqüência dos indivíduos do grupo MN dessa população é de: a) 79%. aa . testes de paternidade.0. d) 49%.0.0.1 d) AA . Aa .1 Questão 955 João ficou intrigado com a grande quantidade de notícias envolvendo DNA: clonagem da ovelha Dolly. Questão 952 Sabendo-se que a freqüência de um gene recessivo a. terapia gênica. produzindo células defeituosas incapazes de sobreviver.81. c) reproduzam-se.18.72.0. engenharia genética.0. d) a somatória da freqüência dos diferentes alelos.25.0. Aa .

nalisando-se o DNA de um animal. engenharia genética. C = 10%. terapia gênica. b) na molécula de DNA. Relacionando esse valor com o emparelhamento específico das bases. e) pares específicos somente nas bactérias. podem existir diferentes tipos de complementação de bases nitrogenadas. cada molécula de DNA dá origem a 4 moléculas de DNA exatamente iguais. Para conseguir entender as notícias. evidenciando a universalidade da estrutura do DNA. G = 10% d) T = 40%. c) pares diferentes em diferentes células de uma espécie. Essa substância se denomina a) DNA. c) a quantidade de A presente em uma das cadeias é exatamente igual à quantidade de A da cadeia complementar. citosina e guanina. pois esses organismos são formados por uma única célula. citosina.5. como resultado da diferenciação celular. os valores encontrados para as outras bases nitrogenadas foram: a) T = 40%. testes de paternidade. citosina e guanina. G = 60% Questão 956 João ficou intrigado com a grande quantidade de notícias envolvendo DNA: clonagem da ovelha Dolly. pois essas células são responsáveis pela perpetuação das espécies. procariontes e eucariontes. podem existir 5 diferentes tipos de bases nitrogenadas. e é formada por cadeias polinucleotídicas que apresentam em sua composição as bases nitrogenadas adenina. C = 60%. e) no processo de mitose.8. G = 40% c) T = 10%. comparação das proporções permitiu concluir que ocorre emparelhamento entre as bases nitrogenadas e que elas formam a) pares de mesmo tipo em todas as espécies.8. estudou a estrutura da molécula de DNA e seu funcionamento e analisou os dados do quadro a seguir.1 1. o que garante a diversidade da vida.1 m I está representado o trecho de uma molécula de DNA. G = 10% e) T = 40%. uracila. pode-se concluir que: a) a molécula de DNA é formada por 2 cadeias caracterizadas por seqüências de bases nitrogenadas. b) pares diferentes de acordo com a espécie considerada. 1. b) DNA. C = 40%. Questão 957 A identificação da estrutura do DNA foi fundamental para compreender seu papel na continuidade da vida. e é formada por cadeias polinucleotídicas que apresentam em sua composição as bases nitrogenadas adenina. e é formada por cadeias polipeptídicas que apresentam em sua composição os aminoácidos adenina. d) na molécula de DNA. etc. d) pares específicos apenas nos gametas. 216 . timina. Observando o quadro. Na década de 1950. Questão 958 As técnicas utilizadas pela Engenharia Genética permitem que se atue em uma substância presente em todas as células. G = 40% b) T = 10%. sendo responsável pelo controle do seu metabolismo. detectou-se que 40% de suas bases nitrogenadas eram constituídas por Adenina. C = 10%. c) RNA. guanina e timina.5. um estudo pioneiro determinou a proporção das bases nitrogenadas que compõem moléculas de DNA de várias espécies. C = 20%.

nos DNAs do homem e do boi. b) 200 apresentavam o DNA marcado. por centenas de gerações. foram isoladas 100 bactérias e transferidas para um meio sem substâncias radioativas.6 e 21.4 e 21. Homem Boi 217 . b) guanina e timina. e) transcriptase. Questão 961 A tabela mostra a composição das bases nitrogenadas púricas.0 Questão 962 Bactérias foram cultivadas em um meio nutritivo contendo timina radioativa. b) A molécula de DNA nas bactérias se encontra na carioteca da célula.0% As porcentagens que estão faltando para o homem e para o boi são. e) citosina e uracila. Assinale a afirmação correta. Nela identificamos 20% de adenina. c) possuírem cromossomos diferentes. nos organismos eucariontes. Questão 959 Uma molécula de DNA apresenta uma dupla hélice de cadeias polinucleotídicas. a) 20% b) 30% c) 40% d) 50% e) 60% Questão 960 Depois da descoberta da estrutura da molécula do Ácido Desoxirribonucléico (DNA ou ADN). A análise dos ácidos nucléicos mostrou que dessas 800 bactérias a) 100 apresentavam o DNA marcado. não se encontra no núcleo da célula. Adenina 30. e) utilizarem código genético diferente. d) expressarem genes diferentes.0 e 30. e) todas apresentavam o DNA e o RNA marcados.0 b) 21. Questão 963 Em um organismo. mas não o RNA. células musculares e células nervosas diferem principalmente por: a) possuírem genes diferentes.4% ? Guanina ? 21. e é formada por aminoácidos que apresentam em sua composição a ribose. mapa genético. Essas bactérias sofreram três divisões no novo meio. produzindo 800 bactérias. d) 200 apresentavam o DNA e o RNA marcados. c) citosina e guanina. e é formada por aminoácidos que apresentam em sua composição a desoxirribose. Dessa cultura. d) A molécula de DNA tem função de duplicação e é constituída por uma fita dupla. b) possuírem ribossomos diferentes.0 e 30. medicina forense.d) polimerase. sendo que cada filamento é composto por vários nucleotídeos. d) adenina e timina. mas não o RNA. e) A molécula de DNA. novos métodos de diagnóstico foram desenvolvidos e utilizados para inúmeros fins (identificação de microrganismos patogênicos. adenina e guanina. respectivamente: a) 19. mas não o RNA. a) A molécula de DNA é constituída por uma fita única e por vários nucleotídeos que têm a transcrição como principal função. c) A molécula de DNA não é capaz de produzir a molécula de RNA.4 d) 19. entre outros).6 e 29. c) 400 apresentavam o DNA marcado. testes de paternidade. Questão 964 Um pesquisador que pretende estudar comparativamente a síntese de DNA e RNA em uma célula deve usar nucleotídios radiativos contendo a) timina e uracila.4 c) 29. Assinale a alternativa correta em relação à porcentagem de guanina.0 e) 30.

b) não origina o RNA mensageiro c) não é capaz de replicar-se. d) pontes de nitrogênio. é CORRETO afirmar que a) possui a base nitrogenada uracila. Questão 966 Na figura a seguir que representa o modelo da molécula de DNA os números 1.5. c) pontes de hidrogênio. d) ácido fosfórico. Questão 971 Sobre o DNA. é INCORRETO afirmar que a) possui a base nitrogenada uracila. o mesmo ocorrendo com a guanina e citosina-nucleotídeos. O fato nos permite afirmar que os nucleotídeos a) ocorrem em igual quantidade. c) ribose. e) adenina é igual a de uracila.8. e) ligam-se como se fossem o corrimão de uma escada. d) ácido fosfórico só entra na composição química do DNA. e) é formado de dupla cadeia com formato helicoidal. e) ácido fosfórico. 218 1. b) uracila é uma base nitrogenada exclusiva do DNA. Questão 968 Comparando as estruturas dos ácidos nucléicos desoxirribonucléico (DNA) e ribonucléico (RNA) pode-se afirmar que a) timina é uma base nitrogenada exclusiva do RNA. Questão 969 Moléculas de DNA constituídas por duplo filamento helicoidal mantêm as cadeias unidas entre si por a) ligações covalentes.Questão 965 Importante informação que permitiu o estabelecimento de um modelo para a molécula de DNA foi a verificação de que o número de adenina-nucleotídeos era sempre igual ao de timina-nucleotídeos. d) é integrante do nucléolo e dos ribossomos. b) ácido fosfórico. d) citosina é igual a de adenina. ribose e base nitrogenada. c) ribose é um açúcar que entra na composição química do RNA. base nitrogenada e desoxirribose. 2 e 3 indicam. b) ocorrem aos pares na molécula de DNA. são classificados como a) polipeptídeos. c) guanina é igual a de citosina. d) é integrante dos genes e dos cromossomos. b) nucleoproteínas. respectivamente a) desoxirribose. b) origina o RNA mensageiro c) reproduz-se de modo semiconservativo. ácido fosfórico e base nitrogenada. b) ligações iônicas. ácido fosfórico e base nitrogenada. e) timina pareia com adenina no RNA. e) ligação metálica. e) é formado de dupla cadeia com formato helicoidal. Questão 972 O DNA e o RNA quanto à sua estrutura química. c) púricos pareiam com outros púricos. d) pirimídicos pareiam com outros pirimídicos. . a quantidade de a) adenina é igual a de citosina. c) polissacarídeos. Questão 970 Sobre o DNA. b) citosina é igual a de timina.1 Questão 967 Numa molécula de DNA. desoxirribose e base nitrogenada.

e) polinucleotídeos. e) base nitrogenada. d) Uracila. Questão 976 Observa-se a presença de DNA nos seguintes organóides citoplasmáticos a) mitocôndria e ribossomo. ribose e ácido fosfórico. c) nucléolo e cloroplasto.d) fosfatídeos. c) ribose é um açúcar que entra na composição química do RNA. 1. ribose e base nitrogenada. b) citosina é igual a de timina. e) Guanina. 2 e 3. Questão 974 Qual das seguintes moléculas NÃO entra na composição química do DNA? a) Ribose. b) Desoxirribose.5. e) Guanina. c) Adenina. pode-se afirmar que a cadeia complementar a esse segmento terá a seqüência a) AAT GGC TAA TAC. d) ácido fosfórico entra na composição química do DNA e do RNA. b) ribossomo e cromossomo. e) AAU GGC UAA UAC. base nitrogenada e ácido fosfórico. d) citosina é igual a de adenina. c) desoxirribose. b) Citosina. desoxirribose e base nitrogenada. c) TTA CCG ATT ATG.1 219 . Questão 973 Qual das seguintes bases nitrogenadas NÃO entra na composição química do DNA? a) Timina. a) base nitrogenada. e) adenina é igual a de timina. respectivamente. c) guanina é igual a de adenina. d) ácido fosfórico. b) uracila é uma base nitrogenada exclusiva do DNA. Questão 979 Assinale a alternativa que relaciona corretamente o nome das moléculas representadas pelos números 1. b) UUT GGC TUU UAC. Questão 977 Na molécula de DNA. d) Adenina. d) lisossomo e ribossomo. Questão 978 Comparando as estruturas dos ácidos desoxirribonucléico (DNA) e ribonucléico (RNA) NÃO se pode afirmar que a) timina é uma base nitrogenada exclusiva do DNA. d) AAT GGC TAA UAC. b) ácido fosfórico. a quantidade de a) adenina é igual a de citosina. e) timina pareia com adenina no DNA. desoxirribose e ácido fosfórico. e) mitocôndria e cloroplasto. sabendo-se que a figura adiante representa a unidade estrutural do ácido desoxirribonucléico (DNA). Questão 975 Se um segmento de DNA possui a seqüência de bases nitrogenadas TTA CCG ATT ATG. c) Ácido fosfórico.8.

Timina = 16% e Adenina = 16% b) Guanina = 16%. Adenina = 35% e Timina = 15% d) Citosina = 15%. d) liquens. c) ácaros. c) retículo endoplasmático. a) Adenina = 20%. Crick em 1953. e) vacúolos. complexo de Golgi e cromossomos. Timina = 16% e Adenina = 16% d) Guanina = 34%. Questão 988 Num dado organismo. b) polipeptídeos. e) lisossomos. d) enzimas. Adenina = 15% e Timina = 35% Questão 983 Uma molécula de DNA contém 16% de Citosina. o conteúdo de guanina no seu DNA é 30%. Questão 987 As evidências de que o DNA é a substância hereditária que determina as características dos seres vivos foram primeiramente observadas em a) vírus. e) guanina é igual a de citosina. centríolos e cromossomos. ribossomos e centríolos. Timina = 34% e Adenina = 34% c) Guanina = 34%. Citosina = 30% e Timina = 20% c) Adenina = 30%. complexo de Golgi e ribossomos Questão 986 Sabemos que os genes são constituídos de DNA e estão localizados nas seguintes estruturas celulares: a) lisossomos. b) centríolos. e) lipídios.Questão 980 O modelo molecular dos ácidos nucléicos (DNA e RNA) foi proposto por J. d) cloroplastos. cromossomos e complexo de Golgi. citosina e adenina. cromossomos e mitocôndrias. Citosina = 30% e Timina = 40% 220 . c) ausência de ácido fosfórico. Questão 982 Uma molécula de DNA contém 15% de Guanina. ribossomos e cromossomos. c) adenina é igual a de uracila. Adenina = 15% e Timina = 15% c) Citosina = 15%. e) ocorre nos cromossomos. d) citosina é igual a de adenina. Citosina = 30% e Timina = 30% d) Adenina = 30%. Watson e F. d) membrana plasmática. e) bactérias. Citosina = 20% e Timina = 30% b) Adenina = 20%. c) polinucleotídeos. b) presença das bases nitrogenadas uracila. d) ser um polipeptídeo. Assinale a alternativa que relaciona corretamente as outras bases nitrogenadas e suas respectivas proporções? a) Guanina = 16%. Citosina = 40% e Timina = 40% e) Adenina = 40%. Assinale a alternativa que relaciona corretamente as outras bases nitrogenadas e suas respectivas proporções: a) Citosina = 15%. mitocôndrias e cromossomos. Questão 981 É característica do DNA: a) açúcar com quatro átomos de carbono. c) ribossomos. b) citosina é igual a de timina. Timina = 34% e Adenina = 16% Questão 984 Numa molécula de DNA formada por uma dupla-hélice a quantidade de a) adenina é igual a de citosina. Segundo esse modelo esses ácidos são a) micromoléculas. centríolos e lisossomos. b) protozoários. guanina. Adenina = 15% e Timina = 15% b) Citosina = 35%. Questão 985 Assinale a alternativa que relaciona as estruturas celulares em se observa a presença de DNA: a) membrana plasmática. Adenina = 35% e Timina = 35% e) Citosina = 15%. Timina = 34% e Adenina = 16% e) Guanina = 34%. Assinale a alternativa que contém a porcentagem correta de cada uma das demais bases nitrogenadas. b) cloroplastos. cromossomos e lisossomos.

b e acordo com o esquema. 1. São corretas a) II e III. I. III e IV. Com Timina 2.1 a) II . III e IV. quebram-se e voltam a se soldar. II. e) há grande multiplicação do DNA viral no interior da bactéria. d) II. III. Uma de suas bases nitrogenadas é a timina. Dupla hélice Composição Questão 992 Supondo que ocorra um evento genético raro em que dois cromossomos não-homólogos.5. Com Uracila Função a. Seu açúcar é a desoxirribose. c) o DNA viral é destruído pela bactéria.1 . verifica-se que a) ocorre lise da bactéria no fim do ciclo.a d) II . somente. e) I. b) o DNA viral se incorpora ao cromossomo bacteriano.1 . Questão 990 Considere as características do DNA abaixo discriminadas. II. somente. b) duplicação. d) as bactérias perdem a capacidade de se dividir.a e) I .b b) I . Questão 991 Os itens abaixo se referem aos ácidos nucléicos: Estrutura I. de uma mesma célula. Síntese protéica São características do ácido desoxirribonucléico (DNA): 1. b) II e IV. III e IV.2 .Questão 989 O esquema a seguir mostra um tipo de ciclo reprodutivo dos bacteriófagos. Foi realizada a análise de um mesmo trecho do DNA.2 . Cadeia simples II. e) deleção. d) inversão. IV.5. somente. Transcrição b.1 221 . É constituído por uma única cadeia de nucleotídeos. c) translocação. c) I. Questão 993 Duas mulheres disputam a maternidade de uma menina.1 . somente. porém com os segmentos trocados. estaríamos verificando a ocorrência de a) crossing-over.8. As seqüências de bases do referido trecho gênico estão esquematizadas adiante: 1.8. Possui capacidade de autoduplicação. obtido de um dos cromossomos X de cada mulher e da menina.a c) II .

apenas. de açúcar e de fosfato. O esquema abaixo que representa o pareamento típicos de bases encontradas na molécula de DNA. adenina e citosina. e) base nitrogenada. corretamente. DNA e RNA. Questão 997 TESTES GENÉTICOS: A Ciência se antecipa à doença Com o avanço no mapeamento de 100 mil genes dos 23 pares de cromossomos do núcleo da célula (projeto Genoma. (O GLOBO. e) As enzimas RNA e DNA polimerase. pois uma menina não recebe cromossomo X de sua mãe. as moléculas imprescindíveis que ele deve utilizar para que possa atingir o seu objetivo. as moléculas de DNA e RNA diferem entre si quanto ao tipo de a) açúcar. Questão 995 Em um segmento de cadeia ativa de DNA há 20 adeninas e 15 guaninas. e) 10 adeninas. d) 10 uracilas. c) base nitrogenada e de açúcar. a enzima DNA polimerase e DNA. em um laboratório.). pois o cromossomo X da menina analisado pode ser o de origem paterna. Com base nesses dados. d) não são suficientes.1 Questão 998 Tendo em vista a estrutura e a função dos ácidos nucléicos. apenas. a) Quatro diferentes tipos de nucleotídeos. apenas.8. tentando reproduzir "in vitro" a síntese de moléculas de DNA. pois a menina recebe seus dois cromossomos X da mãe e apenas um deles foi analisado. b) Os nucleotídeos contendo as bases nitrogenadas timina. b) 20 timinas. c) 15 guaninas. os vinte tipos diferentes de aminoácidos. os três tipos de RNA (mensageiro. é correto afirmar que: a) todas as trincas da molécula do mRNA especificam algum aminoácido. timina. assinale a alternativa que indica.5. DNA e RNA.. nos EUA). contendo as bases nitrogenadas adenina. d) A enzima DNA polimerase. b) as moléculas do ácido ribonucléico (RNA) são hélices duplas de polirribonucleotídeos. Questão 996 Considere que um cientista esteja. Questão 994 Com relação à composição química. c) não são suficientes.Os dados obtidos a) são suficientes para excluir a possibilidade de qualquer uma das mulheres ser a mãe da menina. d) base nitrogenada e de fosfato. citosina e guanina. d) as estruturas espaciais e moleculares do DNA e RNA são 222 . iniciado em 1990.. conclui-se que nos segmentos de RNA originários desse DNA haverá a) 30 citosinas. vinte tipos diferentes de aminoácidos. b) são suficientes para excluir a possibilidade de uma das mulheres ser a mãe da menina. b) base nitrogenada. é: 1. c) em todos os organismos. e) não podem ser considerados. RNA mensageiro e DNA. 10/08/97) Sabe-se que o citado mapeamento é feito a partir do conhecimento da seqüência de bases do DNA. só existe um gene para cada molécula de DNA. c) As enzimas RNA e DNA polimerase. a enzima RNA polimerase. Com base nos conhecimentos sobre o tema. no segmento correspondente da cadeia complementar há 10 adeninas e 30 guaninas. transportador e ribossômico) e DNA. apenas. guanina. já é possível detectar por meio de exames de DNA (ácido desoxirribonucleico) a probabilidade de uma pessoa desenvolver doenças (.

codificam proteínas.8. A inferência vem diretamente do DNA do mamute-lanoso ('Mammuthus primigenius'). d) suas moléculas de DNA apresentavam estrutura helicoidal. ribose e fosfato. A quantidade e a relação entre as bases das amostras estão apresentadas nesta tabela: 1. e) seus genes para o tipo de pelagem localizavam-se no DNA mitocondrial. 07/07/2006. c) seus genes estavam organizados nos plasmídeos. Questão 1001 Células provenientes de um indivíduo foram examinadas ao microscópio e revelaram diferenças estruturais. entre outras funções. Questão 1002 Um laboratório recebeu três amostras de DNA para investigar se pertenciam a espécies diferentes. Considerando-se essa informação e conhecimento sobre o assunto. O mamífero-símbolo da Idade do Gelo provavelmente tinha dois tipos de pelagem: castanho-escuro e loiro. de exemplares mortos há 43 mil anos na Sibéria. "Folha de São Paulo". É uma das primeiras vezes em que os genes de um bicho extinto dão pistas sobre características suas em vida. Questão 1000 Sabe-se que o homem possui em torno de 80.5. b) Funções que realizam. c) os genes cuja atividade não é necessária ao funcionamento de uma célula perdem a capacidade de duplicação. reduz-se. d) os genes responsáveis pelo sistema sangüíneo ABO estão presentes nas células epiteliais.5. Mamutes podem ter tido pêlo "loiro". b) o número total de genes.1 odas as alternativas apresentam diferenças entre essas células. e) as duas metades da hélice dupla do DNA têm seqüências iguais de bases nitrogenadas. mas são incapazes de se expressar. é CORRETO afirmar que a) o genótipo das células do tecido nervoso é diferente do genótipo das células do tecido epitelial. Questão 999 Leia o texto a seguir. que. que podem ser observadas nestas representações esquemáticas: 1.8. Em relação às características genéticas deste mamífero.000 genes. EXCETO a) Forma ou localização dos seus núcleos. após a diferenciação e a especialização das células. b) seu DNA era composto por bases nitrogenadas.1 223 .diferentes. d) Tecidos a que pertencem. sugere análise de DNA. c) Genes que possuem. é possível afirmar corretamente que: a) seus genes estavam dispostos em cromossomos circulares.

0 e 30. ( ) metade das moléculas da geração F2 terão a densidade leve e apenas 12.5.om base nas informações dessa tabela e em outros conhecimentos sobre o assunto. b) 21. Questão 1003 A composição das bases púricas adenina e guanina do DNA do homem e do cão são as seguintes: Homem: Adenina = 30. analise as proposições a seguir. d) 19. mediante precipitação baseada em suas diferentes densidades. ( ) a tendência da fita de DNA pesada é desaparecer no decorrer das gerações.0 % As percentagens que estão faltando para o homem e cão são.4.4. F1 . 'Escherichia coli' (geração F0) na presença de N¢¦ (isótopo pesado).0. c) 29.6 e21. respectivamente: a) 19. d) as amostras 1 e 3 apresentam alta homologia entre seus DNAs. c) a amostra 2 apresenta DNA de fita simples.1 224 .4 % Guanina = ? Cão: Adenina = ? Guanina = 21.6 e 29.5. ( ) A composição do meio de cultura não exerceu influência no experimento uma vez que a bactéria cresceu em todos os meios. inicialmente. Posteriormente.1 A partir desse experimento pode-se afirmar que: ( ) todas as moléculas da geração F1 terão a densidade intermediária entre a pesada e a leve.0.0 e 30.8. como foi antecipado por Watson e Crick. conforme esquematizado abaixo. Questão 1005 Considerando que na figura a seguir tem-se uma representação plana de um segmento da molécula de DNA. cultivaram.4 e 21.8. ( ) eles concluíram.5% terão a densidade intermediária em F3. é INCORRETO afirmar que a) as três amostras são provenientes de diferentes espécies.0. 1.F2 e F3). que as fitas de DNA serviam de modelo para sua própria replicação. em 1957. Questão 1004 Meselson e Stahl. e) 30. cresceram diversas gerações das bactérias em N¢¥ (isótopo leve) e extraíram o DNA das sucessivas gerações (gerações F0. 1. b) a amostra 3 possui o mais alto conteúdo de pares de bases A e T.

de plantas transgênicas. d) ao final da 2 geração.) Com a capacidade de mover genes de um organismo para outro. 225 1. plantas que adquirem resistência ao frio por expressar genes anticongelantes de peixes. mas hoje as mesmas técnicas estão . que são aqueles em cujo genoma foi introduzido um gene de uma outra espécie ou mesmo um gene produzido em laboratório. a) 1 apenas b) 2 e 3 apenas c) 1. essas bactérias foram transferidas para um novo meio. cerca de 1/4 do DNA será híbrido.1 a) Produção de proteína b) Transcrição do RNA c) Produção de RNAribossômico d) Helicoidização do DNA e) Replicação do DNA Questão 1007 Um tema que vem despertando grande polêmica no Brasil atualmente é a liberação. para cultivo. Questão 1008 Gerações sucessivas de bactérias da espécie 'Escherichia coli' foram cultivadas num meio cuja única fonte de nitrogênio era o isótopo ¢¦N. c) ao término da 2 geração. e) Um gene é uma cadeia de aminoácidos que codifica o código genético. sendo o restante não-híbrido. e camundongos gigante que expressam os genes do hormônio de crescimento de ratos. os cientistas produziram plantas que brilham porque expressam os genes de bioluminescência dos vaga-lumes. 3) Um nucleotídeo com Guanina (G) em uma cadeia pareia com um nucleotídeo com Citosina (C) em outra cadeia.) Um nucleotídeo é formado por um grupo fosfato (I). uma molécula do açúcar desoxirribose (II) e uma molécula de base nitrogenada.F. (. todas as moléculas de DNA apresentarão apenas ¢¥N incorporado. sendo uma híbrida e outra não.J. c) Um gene é uma proteína que tem função específica em uma determinada rota metabólica.5. 4) Pontes de hidrogênio se estabelecem entre as bases nitrogenadas T e A e entre as bases nitrogenadas C e G.. Analise-o e assinale a alternativa que indica corretamente qual é este processo. o qual se incorporou nas moléculas de DNA. pode-se prever que. 2. resultando em tipos criados que nunca poderiam ter sido produzidos com a genética clássica. 6 ed." (Griffiths. Posteriormente. 2) Um nucleotídeo com Timina (T) em uma cadeia pareia com um nucleotídeo com Adenina (A) em outra cadeia. Rio de Janeiro: Guanabara Koogan. a) Um gene é um cromossomo da célula vegetal ou animal. serão formadas moléculas de DNA apenas com ¢¦N e moléculas apenas com ¢¥N. b) ao término da 1 geração.8. Está(ão) correta(s). "A biotecnologia de genética molecular foi inicialmente aplicada a micróbios. 2 e 3 apenas d) 2. b) Um gene é um segmento do DNA que contém a informação necessária para a produção de uma determinada proteína. onde existia o ¢¥N como única forma de nitrogênio. 3 e 4 apenas e) 1. a) ao final da 1 geração. Em relação ao experimento. 1998) O texto acima se refere a organismos transgênicos. et al. A. 3 e 4 Questão 1006 Na figura a seguir é ilustrado um processo muito importante para a vida. "Introdução à Genética". nesse novo meio. cada molécula híbrida de DNA formará duas moléculas. d) Um gene é uma molécula de RNA que atua diretamente na síntese protéica.. A obtenção dessas plantas se deve à biotecnologia. sendo aplicadas a plantas e animais. Assinale a alternativa que define o que é um gene.

2 .1 . transcrição.8. guanina.2 . Para isso. e) 1 .No código genético. sim. fizeram um experimento sobre a replicação do DNA. ¢¦N.1.2 .2.1 . Julgue os itens a seguir. Quais delas poderiam ter embasado o raciocínio de Koonin? a) Apenas I.Questão 1009 Meselson e Stahl. II e III. n. F. b) 2 .2 .Os genes compartilhados pelos genomas dos diferentes grupos devem ser essenciais. as arqueobactérias e os eucariontes.2 . Depois disso. 2001.1.1 . as bactérias foram transferidas para um meio contendo nitrogênio leve. uracila A seqüência correta é a) 1 .1 . Nesse experimento. citosina. Adaptado de SALZANO. uma mutação.Os genes envolvidos na replicação.1 . Koonin investigar qual seria o número mínimo de genes capazes de sustentar o funcionamento de uma célula. II .2 .2 . timina.2 . e) I. d) não ocorreu replicação do DNA mas. guanina. Considere as seguintes afirmações. III . jul. 1.1 . c) a replicação do DNA é randômica. a cada códon deve corresponder mais de um aminoácido. citosina. do que é exemplo a recente clonagem de uma ovelha.1 . b) Apenas II.2 .1 . a bactéria 'Escherichia coli' foi cultivada.1 Com relação a esses dados. em meio contendo um isótopo pesado de nitrogênio. e) não ocorreu replicação do DNA mas. sendo observado o seguinte: I . acerca do referido ácido nucléico. em 1957. ¢¥N. sim. em 1953. v. c) Apenas III.1 . Questão 1012 Desde que Watson e Crick propuseram um modelo para a estrutura do DNA. d) 2 .M. A entrada na era da genômica possibilitou ao norte-americano Eugene V. 29.2.2. até todo o seu DNA estar marcado com esse isótopo. tem-se constatado um progresso fantasticamente acelerado da Biologia Molecular. Questão 1011 Numere a 2 coluna de acordo com a 1 COLUNA 1 1. por muitas gerações.2 . "Ciência Hoje".2 . 226 .DNA 2. d) Apenas II e III. ( ) bases nitrogenadas: adenina. ele comparou 21 genomas completos de representantes das três linhagens primárias da vida: as eubactérias. Questão 1010 Leia o texto abaixo. transcrição e tradução do material genético devem fazer parte do conjunto mínimo de genes.RNA COLUNA 2 ( ) dupla hélice ( ) ribose ( ) fita única ou simples ( ) desoxirribose ( ) bases nitrogenadas: adenina. pois permite imaginar os primeiros sistemas genéticos surgidos por ocasião da origem da vida. As moléculas de DNA das bactérias foram então isoladas e analisadas com relação ao seu conteúdo de ¢¦N e de ¢¥N.5. 173. c) 1 . O resultado da pesquisa mostrou que o número de genes deve situar-se em torno de 150. b) a replicação do DNA é conservativa. Esse enfoque é interessante. podemos concluir que a) a replicação do DNA é semiconservativa.

(3) No processo de recombinação entre cromátides. IV. d) é polinucleotídeo.(1) Apesar de ser o sexto elemento mais abundante no universo e o mais versátil de todos. em efeito. Analise cada uma das afirmações seguintes. a segregação dos homólogos dos diferentes pares cromossômicos correspondem. Questão 1014 No artigo "Retrato molecular do Brasil" ("Ciência Hoje". e) X e mitocondrial. no mínimo. Questão 1016 O estudo do mecanismo da síntese de proteínas no interior das células confirma que: a) a transcrição gênica caracteriza-se pela autoduplicação do DNA b) três tipos de RNA participam do processo c) os anticódons localizam-se no RNA-m d) os códons são trincas de bases nitrogenadas do RNA-t e) não há evidências que permitam aceitar que o código genético seja considerado degenerado Questão 1017 Uma molécula de RNA mensageiro apresenta a seguinte seqüência de bases nitrogenadas: UUU GUG CCC AAC Assinale a alternativa que contém a seqüência de bases do segmento da molécula de DNA que deu origem a esse 227 . 2001). apenas. à 2 lei de Mendel. um segmento de DNA que corresponde a um gene funcional. c) I. a segregação das cromátides dos diferentes pares cromossômicos corresponde. o carbono não faz parte da estrutura do DNA. V. (2) A coloração de cromossomos com vários matizes é uma técnica atual que se baseia no uso de vários corantes para os diferentes lipídios que constituem os cromossomos. a mãe transmite maior quantidade de DNA para o filho do que o pai. Na meiose I. a segregação dos homólogos de um par cromossômico corresponde. uma série de observações e experimentos indicaram uma correlação entre o comportamento dos cromossomos na célula em divisão e as leis mendelianas. a segregação de cromossomos homólogos que apresentam os mesmos alelos resulta nas proporções da geração F2 dos experimentos de Mendel. III. e) ocorre nos cromossomos. I. c) Y e do cromossomo X. III. Na meiose I. e) II e V. Na meiose I. d) I. IV e V. do DNA do cromossomo a) X e de autossomos. em efeito. enquanto a contribuição genética de povos indígenas e africanos deu-se por meio das mulheres. Sérgio Penna. São afirmações corretas: a) I. pesquisador da Universidade Federal de Minas Gerais. b) Y e de autossomos. b) a presença das bases nitrogenadas uracila. II. guanina. Questão 1015 Não é característica do DNA: a) o açúcar com cinco átomos de carbono. Na meiose II. b) I. II e IV. Tais conclusões são possíveis com base em estudos moleculares. (4) As mutações gênicas implicam necessariamente a modificação do fenótipo do indivíduo. em efeito. respectivamente. revelou que a contribuição dos europeus na composição genética do povo brasileiro fez-se basicamente por meio de indivíduos do sexo masculino. à 2 lei de Mendel. II. c) a presença de ácido fosfórico. apenas. Genes localizados em regiões próximas de um mesmo cromossomo implicam em distorções das proporções mendelianas. à 1 lei de Mendel. ocorre a troca de. IV e V. II. apenas. III e V. apenas. citosina e adenina. Questão 1013 A partir dos anos 1900. d) Y e mitocondrial. (5) Nos processos de fecundação natural. II.

b) Desoxirribose. os números 1. base nitrogenada e desoxirribose. e) ácido fosfórico. é INCORRETO afirmar que a) possui a base nitrogenada uracila. base nitrogenada e desoxirribose. a) AAA CAC GGG TTG b) TTT CAC GGG UUG c) AAA CTC GGG TTG d) TTT GAG GGG TTG e) AAA CAC CCC UUG Questão 1018 Na figura a seguir que representa o modelo da molécula de RNA os números 1. d) é traduzido em proteínas nos ribossomos.2 1. c) Ácido fosfórico. a) AAA CAC GGG TTA b) TTT CAC GGG UUT c) AAA CTC GGG TTT d) TTT GAG GGG TTA e) AAA CAC CCC UUA 228 Questão 1023 Uma molécula de RNA mensageiro apresenta a seguinte seqüência de bases nitrogenadas: UUU GUG CCC AAU. c) reproduz-se de modo semiconservativo.RNA. d) ácido fosfórico. b) ácido fosfórico. e) é formado de simples cadeia com formato helicoidal. ácido fosfórico e base nitrogenada. . ribose e base nitrogenada. 2 e 3 indicam. b) participa da estrutura dos ribossomos. 2 e 3 indicam. desoxirribose e base nitrogenada. d) Adenina.8. b) ácido fosfórico. 1. c) ribose. Assinale a alternativa que contém a seqüência de bases do segmento da molécula de DNA que deu origem a esse RNA. e) ácido fosfórico. Questão 1021 Qual das seguintes moléculas NÃO entra na composição química do RNA? a) Ribose. respectivamente a) desoxirribose.5. ácido fosfórico e base nitrogenada. ácido fosfórico e base nitrogenada. e) Guanina.5. c) ribose. ribose e base nitrogenada.2 Questão 1019 Sobre o RNA. respectivamente: a) desoxirribose. d) Uracila. c) Adenina. d) ácido fosfórico.8. ácido fosfórico e base nitrogenada. b) Citosina. desoxirribose e base nitrogenada. e) Guanina. Questão 1020 Qual das seguintes bases nitrogenadas NÃO entra na composição química do RNA? a) Timina. Questão 1022 No modelo molecular do ácido ribonucléico (RNA) representado adiante.

de acordo com a tabela anterior: a) Cis . c) rRNA.Cis .Val . e) ocorrer nos lisossomos.a b) I .Estrutura: I.8. Questão 1028 A tabela a seguir mostra alguns aminoácidos e as trincas de bases no DNA que os identificam: 1. 229 . interessado em produzir em tubo de ensaio uma proteína. II .Questão 1024 É característica do RNA: a) açúcar com quatro átomos de carbono. b) sapo.Leu . d) macaco.Arg . nas mesmas condições em que essa síntese ocorre nas células.Cis d) Ile .b c) II . dupla hélice II.Cis .Arg .1 .5.Ile c) Arg . b) Plasmídios.a d) II . RNA mensageiro de células de macaco. citosina e adenina.Ile b) Leu . presença de uracila 2.Arg . Questão 1025 Os itens a seguir referem-se à estrutura.pode existir mais de um códon para determinar um mesmo aminoácido.Leu e) Val . b) presença das bases nitrogenadas uracila.Val . síntese de proteínas b.Val .Função: a.Arg .b Questão 1026 Nos últimos anos.Ile .Val . c) ausência de ácido fosfórico.Leu Questão 1029 Sobre o código genético são feitas as seguintes afirmações: I . . utilizou ribossomos de células de rato. a seqüência de aminoácidos no polipeptídeo correspondente será.Leu . guanina. d) tRNA. RNA transportador de células de coelho e aminoácidos ativos de células de sapo. cadeia simples .Composição: 1.Cis .em todos os seres vivos os códons que codificam um respectivo aminoácido são os mesmos. A proteína produzida teria uma seqüência de aminoácidos idêntica à do a) rato. e) macaco e do rato.2 . c) coelho. a biologia molecular tem fornecido ferramentas úteis para a produção de plantas e animais transgênicos. presença de timina . As informações armazenadas nas moléculas de DNA são traduzidas em proteínas por meio de moléculas intermediárias denominadas: a) Proteases.3 e um RNA mensageiro apresenta a seqüência de bases AUU AGA UGU GUU UUA.b e) II .1 . d) ser um polipeptídeo. transcrição gênica São características do ácido ribonucléico a) I . composição e função dos ácidos nucléicos.2 .Ile .1 . Questão 1027 Um pesquisador. e) mRNA.

b) é o mesmo em todas as células de um indivíduo.CUC. que codifica a seqüência serina .AAA . Assinale a 230 .AAC. valina.CTC. o códon UAG é terminal. b) GAA . nos ribossomos. d) I. ou seja.GGU .5.8. leucina. UAU. c) I e II apenas. e) é praticamente o mesmo em todas as formas de vida. lisina. Um fragmento de DNA. Questão 1032 Considere a seguinte tabela que indica seqüências de bases do RNA mensageiro e os aminoácidos por elas codificados. tirosina. Assinale a alternativa que apresenta a possível seqüência de códons para a formação do seguinte tetrapeptídeo: GLU . b) Aspargina. mas varia de espécie para espécie.GGA .FEN . A seqüência de códons do RNA mensageiro determina a seqüência de aminoácidos da proteína. Questão 1034 Os códons UGC.3 1. Está(ão) correta(s) afirmativa(s): a) II apenas.GGC . qual seria a seqüência de aminoácidos codificada? 1.GGC .CUC.TTT .3 a) Aspargina. c) CTT . prolina.CCG .8.UUU . c) é o mesmo nos indivíduos de uma mesma espécie. Questão 1031 Um gene de bactéria com 600 pares de bases nitrogenadas produzirá uma cadeia polipeptídica com número de aminoácidos aproximadamente igual a a) 200 b) 300 c) 600 d) 1200 e) 1800 Questão 1033 O código genético é o conjunto de todas as trincas possíveis de bases nitrogenadas (códons). prolina. alanina e serina. e) I e III apenas. valina. II e III.GLI .tirosina . lisina. mas varia de indivíduo para indivíduo.III . e) Valina.5. É correto afirmar que o código genético a) varia entre os tecidos do corpo de um indivíduo. sofreu a perda da 9 base nitrogenada. c) Fenilalanina.UUU . d) Fenilalanina. prolina. Com base na tabela fornecida e considerando um segmento hipotético de DNA. d) GAA .UUG. a nível citoplasmático. e) GUU .UUU . cuja seqüência de bases é AAGTTTGGT. d) permite distinguir procariotos de eucariotos. indica a interrupção da tradução.alanina. lisina. respectivamente os aminoácidos cisteína. Questão 1030 A tabela a seguir relaciona trincas de bases do DNA aos aminoácidos correspondentes. GCC e AGC codificam.cisteína . lisina. b) III apenas.LEU a) GUU .a tradução da seqüência de bases do RNA para a proteína é feita.

compondo os cromossomos e ribossomos na forma de moléculas complexas de nucleoproteínas. por raios-X. b) Os ácidos nucléicos podem aparecer livres na célula ou podem estar associados a proteínas. que é uma técnica de manipulação dos genes. mas. determinando as características de um ser vivo. por raios cósmicos. os códons e os anticódons correspondentes. b) O aminoácido tirosina não será traduzido. que compreende o trabalho do RNA de organização dos aminoácidos na seqüência determinada pelo código genético. que visa decifrar e mapear o código genético humano. e) A seqüência não sofrerá prejuízo. guanina. c) A mutação é uma alteração do código genético de um organismo e pode ser provocada por radiações ou substâncias químicas. 1. que compreende a passagem do código genético do DNA para o RNA. apesar disto. encontramos sempre desoxirribose e cinco tipos de bases: adenina. pode corrigir defeitos no código genético de um organismo.5.alternativa que descreve o que acontecerá com a seqüência de aminoácidos. timina e uracil. assinale a afirmativa FALSA. mas. Este processo chama-se diferenciação celular. citosina. d) A tradução será interrompida no 2Ž aminoácido. pois essa molécula de DNA alterada não é capaz de comandar esse processo. encontramos células com formas e funções diferentes. resultando numa molécula com 3 aminoácidos. a) Na molécula de DNA. e) A Engenharia Genética.8. d) As mudanças na programação genética de um organismo não alteram a produção de proteínas. pois qualquer modificação na fita de DNA é imediatamente corrigida.3 ssinale a alternativa que contém a seqüência de códons do RNA mensageiro que participou dessa tradução. c) Duas grandes etapas estão envolvidas na síntese das proteínas: a transcrição. nem as suas características. ou mesmo por exposição aos raios ultravioleta do sol. d) A mutação constitui uma alteração na seqüência de bases nitrogenadas de um segmento de DNA e pode ser provocada por radiações. encontramos células com formas e funções diferentes. e) Todas as células do corpo têm a mesma coleção de genes. Questão 1037 O esquema a seguir representa a seqüência de aminoácidos de um trecho de uma proteína e os respectivos anticódons dos RNA transportadores. Questão 1035 Com relação ao código genético e à síntese de proteínas. c) A seqüência não será traduzida. a) O aminoácido tirosina será substituído por outro aminoácido. a) UUU CGT TTG UGC GUC b) UUU CGA AAG UGC GUC c) TTT CGT TTC TGC GTC d) TTT CGA AAG TGC GTC e) CCC TAC CCA CAT ACT Questão 1038 O quadro a seguir contém um segmento de DNA. apesar disso. foi oficialmente fundado o Projeto Genoma. e a tradução. 231 . Questão 1036 Em 1987. b) Todas as células do corpo têm a mesma coleção de genes. Indique a alternativa ERRADA relativa ao código genético e à síntese de proteínas: a) Os genes são formados por ácido desoxirribonucleico e controlam a produção de proteínas da célula.

Diversos aminoácidos são codificados por mais de uma trinca de nucleotídios.TTA e) UAU .GCA . AUU. III e IV devem ser substituídos.8.CTU .CGT . Cada trinca de bases nitrogenadas de uma cadeia do DNA corresponde a um aminoácido. por a) GAC.CAC . diversas condições devem ser observadas.GGA d) UAU . São verdadeiras APENAS as afirmações a) I e II b) I e IV c) II e III d) II e IV e) I.CTU . AUU. TCA e CUG e) CTG.CAC . Questão 1042 Considere os seguintes códons do RNA mensageiro e os aminoácidos por eles especificados: ACA = treonina GUU = valina Assinale a alternativa da tabela a seguir que indica corretamente os anticódons do RNAt e os códons do DNA relacionados com esses aminoácidos. II. fundamentalmente. TAA. III e IV Questão 1040 Considere o seguinte segmento de uma cadeia de DNA e o polipeptídio sintetizado a partir dele: ATA .GGU b) TUT . O RNA mensageiro. O RNA ribossômico contém as informações para as proteínas que devem ser sintetizadas. Para que ocorra a síntese da proteína codificada pelo gene inserido no genoma da espécie receptora. c) o código genético é degenerado.TGT . II. os algarismos I.CAC . foram feitas as seguintes afirmações: I. recebem e incorporam genes de outra espécie. por técnica de engenharia genética. liga-se a um aminoácido específico. ATT.GGU c) CGT .TGC . respectivamente.TGC .CGC .GGA Questão 1041 Organismos são ditos transgênicos quando. UCA e CUG Questão 1039 Com relação ao código genético.CCT TIROSINA .GTG . d) a técnica permite trocar o código genético do organismo doador do gene. Exemplos desses organismos são as plantas transgênicas. ATT. e) a técnica permite trocar o código genético do organismo receptor do gene.CGU .ARGININA . IV.CGT . 1.TGT . A seqüência de trincas no RNA mensageiro que pode ter codificado esse polipeptídio alterado é a) CUC . de acordo com o anticódon que possui. essa técnica é possível porque a) cada organismo apresenta seu próprio código genético. receptoras de um gene de outro organismo (doador) que lhes confere resistência a certos herbicidas.ACA . TCA e GUC d) CTG. UCA e GUC c) GTC.CGT .CGU . III.GLICINA Após a substituição de uma única base nitrogenada no segmento de DNA.CISTEÍNA - 232 .HISTIDINA . Entretanto.3 ara preenchê-lo corretamente. b) o código genético é comum a todos os seres vivos.5. AGT e CTG b) GTC. os quais podem ser transmitidos aos seus descendentes. o polipeptídio sintetizado passou a apresentar duas argininas.

3 1. composta pelas bases adenina-A e citosina-C. bserve que: .3 Questão 1043 Uma molécula de RNAm.3 233 . pode acarretar modificações importantes na atividade biológica da proteína codificada por esse gene. Sua estrutura está representada no esquema abaixo: C-A-C-A-C-A-C-A-C-A-C-A-C-A-C-A-C-A Suponha que a síntese de um peptídeo possa ser iniciada a partir de qualquer um dos extremos dessa estrutura de RNAm.8. A partir da seqüência de aminoácidos de uma proteína.1.5. Considere que a estrutura normal de um RNA mensageiro de um peptídio e sua estrutura alterada em virtude da troca de uma única base no gene correspondente são: 5' AUGUGGUUUGCACACAAAUGAUAA 3' (normal) 5' AUGUGGUUUGAACACAAAUGAUAA 3' (alterada) A tabela a seguir identifica alguns codons. O aminoácido encontrado no peptídio normal e aquele que o substituiu no peptídio mutante são.5. sem necessidade de código de iniciação ou de terminação. respectivamente: a) lisina e cisteína b) treonina e triptofano c) alanina e ácido glutâmico d) fenil alanina e ácido aspártico Questão 1045 A determinação da seqüência de aminoácidos de todas as proteínas da espécie humana e de outros seres vivos é de extrema importância.8. UAG e UGA. . foi sintetizada experimentalmente. o número de diferentes tipos de aminoácidos encontrados nos peptídeos formados será: a) 4 b) 3 c) 2 d) 1 Questão 1044 A mutação em um gene. Nestas condições.8. podem-se identificar as possíveis seqüências de DNA que a originaram.o codon da metionina é também o do início da tradução. Considere o quadro: 1. por conseqüência da substituição de uma única base na estrutura do DNA.os codons de término da tradução são UAA.5.

O inverso também pode ocorrer. Tyr (tirosina). Met (metionina). Lys (lisina).TTT d) ATG . é formado o seguinte peptídeo Leu-Gly-Glu-Thr-Arg-Gln-Glu. Asp (ácido aspártico).om base no quadro apresentado.TGT .AAT . apenas d) 1. na proteína que ele especifica. apenas Questão 1047 A união de vários aminoácidos forma os peptídeos.TAC . Glu (ácido glutâmico).TGT .AAT .8. Estes.TGT . quantos códons. Gln (glutanina). apenas c) 3.TGT . Ile (isoleucina). 2 e 3 e) 2. Leu (leucina). Cada três nucleotídeos correspondem a um aminoácido. e) O peptídeo Lys-Phe-Lys-Tyr-Tyr-Thr-Ile pode ter sido originado a partir do seguinte RNA mensageiro: AAAUUUAACUAUUACACAAUA. Cys (cisteína). devem estar presentes no seu mRNA? a) 100 234 . apenas b) 1 e 3.TAC . é possível obter uma seqüência de nucleotídeos (RNA mensageiros).GAA .TAC . O código genético descreve a relação entre a seqüência de bases nitrogenadas e a seqüência de aminoácidos. Três bases nitrogenadas adjacentes codificam um aminoácido e formam um códon.3 Phe (fenilalanina).GAA . Isso é possível graças à relação existente entre os códons do RNA mensageiro (cada três nucleotídeos) e os aminoácidos presentes nas proteínas. Val (valina). A correspondência entre os códons do RNA mensageiro e os aminoácidos por ele determinados constitui o código genético. Está(ão) correta(s): a) 1.Tyr .Phe a) ATG . d) A partir da seqüência do RNA mensageiro UUAGGGGAGACUCGGCAGGAG.TTC Questão 1046 OBSERVE: 1.GAA . é correta a seguinte afirmação: a) O peptídeo Gly-Gly-Gly-His-Arg-Leu-Ile-Gln pode ter sido originado a partir do seguinte RNA mensageiro: GGCGGUGCGCACCGCCUUAUUCAA. 2. Ser (serina). Arg (arginina). 3.GCC .TTT c) ATC .AAT . a partir de uma seqüência de aminoácidos (peptídeo).TAC . Asn (asparagina). b) A partir da seqüência do RNA mensageiro UUUCAUAGUGCUGGGAGCCAC. é formado o seguinte peptídeo: Val-Val-Val-Val-Arg-Arg-Arg. Trp (triptofano). como por exemplo as funções enzimáticas.GAA . assinale a opção que indica a seqüência do DNA responsável pela síntese do peptídeo mostrado a seguir: Met . que está representado na tabela a seguir: 1.TAC . As proteínas exercem inúmeras funções no nosso organismo.TTT b) ATG . Para descobrir se determinado organismo produz determinada proteína.TTC e) ATC . Com base no texto e em seus conhecimentos. Gly (glicina). formam as proteínas.AAT . Pro (prolina). Ala (alanina). Questão 1048 Se uma proteína possui 100 aminoácidos. pare (códon de parada). His (histidina).Glu . A seqüência de aminoácidos que forma uma cadeia polipeptídica compreende a estrutura secundária de uma proteína. c) A partir da seqüência do RNA mensageiro GUGGUUGUCGCUCGUCGGCGG. é formado o seguinte peptídeo: Phe-His-Ser-Ala-Gly-Arg-His. portanto.TTC . faz-se a construção de uma fita de RNA mensageiro a partir dela. Thr (treonina). após passarem por diferentes processamentos no Retículo endoplasmático rugoso e complexo de Golgi.AAC .Asn .5. que especificam esses aminoácidos.Cys .

com os códons e os aminoácidos correspondentes. Questão 1050 As unidades hereditárias que contêm a informação para especificar um aminoácido são denominadas a) ADN. Assim sendo. ser = SERINA.um aminoácido pode ser codificado por apenas uma trinca de nucleotídios de DNA. III .8. São Paulo: Saraiva. glu = GLUTAMINA. b) códons. cys = CISTEÍNA.treonina . gly = GLICINA LOPES. leu = LEUCINA.treonina . asn = ASPARAGINA. b) A inserção de um nucleotídeo entre a 4 e a 5 base não altera o código genético. c) nucléolos. Utilizando a tabela. 235 1. GCA e UGA. c) Os códons GCA e GCG são degenerados porque codificam aminoácidos diferentes.glutamina .cisteína . o que significa que um aminoácido pode ser codificado por mais de uma trinca.3 . tyr = TIROSINA. d) acrossomos. asp = ASPARTATO. e) ribossomos.glutamina . val = VALINA.treonina Questão 1052 O aminoácido leucina pode ser codificado por mais de uma trinca de nucleotídios do DNA (AAT. trp = TRIPTOFANO. II . Sônia.aspartato .assim como a leucina pode ser codificada por diferentes trincas. uma determinada trinca também pode codificar diferentes aminoácidos. GAA e outras). ala = ALANINA. his = HISTIDINA. podemos dizer que I . he = FENILALANINA.o código genético é degenerado. respectivamente. arg = ARGININA.aspartato b) metionina . Bio Volume Único.histidina . ileu = ISOLEUCINA. thr = TREONINA.b) 33 c) 99 d) 300 e) 500 Questão 1049 Observe as seqüências de nucleotídeos de um vírus de RNA: 5' GCA UCA CAC CUC AUU GCG UAG 3' Considerando que esse segmento de RNA codifica um determinado peptídeo.arginina e) glicina . pro = PROLINA.arginina d) glutamina . determine a seqüência de aminoácidos que corresponde à seqüência de DNA TAC TGA TTG CTA a) metionina . Questão 1051 A tabela apresenta o código genético. é correto afirmar: a) Os códons dessa seqüência sinalizam os mesmos aminoácidos em seres humanos.glicina c) glutamina . 1996.glicina . Estão corretas afirmativas: a) apenas III. met = METIONINA. lys = LISINA.histidina .asparagina . d) Os anticódons do 1Ž do 2Ž códon dessa seqüência são.5.

triptofano. e) nenhuma delas. UAU GGC AUA. 236 . a) apenas I é correta.a ESTREPTOMICINA interfere na tradução e leva a célula bacteriana a produzir proteínas defeituosas. arginina e alanina.a TETRACICLINA impede a transcrição e leva a célula bacteriana à morte por falta de RNA mensageiro. c) apenas I.. Assim. d) TTA TTT CCG AGG. a TETRACICLINA liga-se aos ribossomos e impede a ligação do RNA transportador. para os aminoácidos mencionados. e) AAU AAA CCG AGG. d) I e III. (3) A perda de um nucleotídeo do DNA implicará a alteração dos aminoácidos da cadeia polipeptídica. pode-se dizer que o segmento de DNA que deu origem a esse RNA era a) TTA AAA CCG AGG. Questão 1057 Dado um segmento de RNA com a seguinte seqüência de bases nitrogenadas: UUA UUU GGC UCC. TAT GGC ATA. b) apenas I e II são corretas. b) UAU GGC UAU. respectivamente. Questão 1054 Um fragmento de DNA de uma espécie de organismo procarionte apresenta a seguinte seqüência de bases: AAT ATT CGA GTC TAA AGA.. b) AAT AAA GGC UCC. a MITOMICINA inibe a ação da polimerase do DNA e a ESTREPTOMICINA causa erros na leitura dos códons do RNA mensageiro.. Questão 1056 Existe um número muito grande de substâncias com funções antibióticas. c) TAT GGC ATA. e) TAT GGC UTU. Assinale a alternativa que reúne as afirmações corretas. UTU GGC UTU.b) apenas II. (2) A molécula de DNA referente ao trecho apresentado tem 20% de adenina. (4) A fumaça do cigarro. julgue os itens que se seguem.. (1) Os códons do mRNA. c) apenas II e III são corretas. II e III são corretas. Essas informações permitem afirmar que I . Essas substâncias diferem quanto à maneira pela qual interferem no metabolismo celular. TUT GGC UTU. c) AAT AAA CCG AGG. Considerando as informações apresentadas. é responsável pela incorporação respectiva dos seguintes aminoácidos: metionina. sua cadeia complementar e o tipo de RNAm que poderá ser formado a partir das bases da hélice original são. UAC ACC UCU CGU. por inibir a duplicação do DNA. respectivamente: a) TAT GGC ATA. III . Questão 1053 Um trecho de fita de DNA com a seqüência. são.a MITOMICINA. II . Indique qual a seqüência de RNAm é transcrito a partir deste segmento DNA: a) TTA TAA GCT CAG ATT TCT b) TTA TTA GCT CAG ATT TCT c) UUA UUU GGU CAG AUU UGU d) UUA UAA GCU CAG AUU UCU e) AAT ATT CGA GTC TAA AGA Questão 1055 Uma cadeia de DNA apresenta a seguinte seqüência de bases numa certa região de sua hélice: ATA CCG TAT. d) apenas I e III são corretas. TAT GGC ATA. TACACCTCTCGT. impede a multiplicação da célula bacteriana. os raios X e a luz ultravioleta podem produzir mutações na molécula de DNA. e) I. d) ATA GGC TAT.

4 ssinale a alternativa correta.8. Questão 1061 A molécula de RNA sintetizada é ___________ à fita de DNA que lhe deu origem e ___________ à outra fita de DNA. d) Um dos mais importantes locais de ocorrência do processo 1 é o nucléolo. b) 2 representa nucleotídeos de DNA. G.citosinas d) complementar .idêntica .5. b) Para interromper o processo 2. a) idêntica . c) 3 representa nucleotídeos de RNA. é INCORRETO afirmar que: a) 1 é uma molécula de uracila. através do qual o RNA carrega consigo as instruções para a produção de proteínas (e por isso ele ganha o nome de RNA mensageiro).8.o astro da semana. já era conhecido pelos cientistas desde a década de 50. e) As moléculas produzidas no processo 2 poderão ser utilizadas como catalisadoras. sendo inexistente em todas as outras organelas. 1. O americano Roger Kornberg.4 bservando o esquema. sendo as _______________ substituídas pelas uracilas.complementar . a) AAA CAC GGG TTT b) TTT CAC GGG UUU c) AAA CTC GGG TTT d) TTT GAG GGG TTT e) AAA CAC CCC UUT Questão 1059 O esquema a seguir representa dois processos observados numa célula eucariótica. foi laureado por registrar em imagens o momento em que a informação genética contida no DNA no núcleo da célula é traduzida para ser enviada para fora pelo RNA . Questão 1060 O esquema a seguir representa fragmentos de ácidos nucléicos no núcleo de uma célula.complementar .adeninas e) complementar . (Girardi.o RNA .adeninas b) complementar .idêntica .timinas Questão 1062 A mesma molécula .complementar . Assinale a alternativa que contém a seqüência de bases do segmento da molécula de DNA que deu origem a esse RNA. . da Universidade Stanford. c) O processo 2 ocorre principalmente no período S da intérfase.que faturou o Nobel de Medicina ou Fisiologia na segunda-feira foi a protagonista do prêmio de Química entregue ontem. d) a célula encontra-se em metáfase. é necessário bloquear o funcionamento de todo o retículo endoplasmático dessa célula. Esse mecanismo de transcrição.Questão 1058 Uma molécula de RNA mensageiro apresenta a seguinte seqüência de bases nitrogenadas: UUU GUG CCC AAA.guaninas c) idêntica . mas nunca serão constituintes de outras organelas. a) O processo 1 somente é observado no núcleo da célula.5. e) trata-se do processo de transcrição. Estudo de RNA rende o segundo Nobel 237 1.

II . d) RNA e de DNA.A . II . Questão 1064 O segmento CGATAGACT de uma fita de DNA. Paulo".A c) G . b) I .Ligação dos códons de RNA mensageiro aos anticódons correspondentes dos RNAs transportadores.C . d) III .G .III . a) A produção de RNA mensageiro se dá por controle do material genético.A e) C .G . b) RNA e de proteínas.C . farmacogenômica etc. engenharia genética. c) II ."O Estado de S.C . 2006).C .8. I .A . respectivamente.III.U b) G . após o processo de transcrição. b) No núcleo da célula ocorre transcrição do código da molécula de DNA para a de RNA.G . Para compreender essas notícias. Qual a seqüência correta dessas etapas durante o processo? a) I . A partir da leitura do trecho anterior e de seu conhecimento de biologia molecular. Analise os dados dos quadros a seguir. e assinale a(s) proposição(ões) CORRETA(S). de a) proteínas e de RNA.Transcrição do código genético do DNA em códons do RNA mensageiro.A .III .5. d) No citoplasma.U . e) Cada molécula de RNA mensageiro é uma longa seqüência de nucleotídeos idêntica ao DNA.U 1. terapia gênica. c) DNA e de proteínas.G . Questão 1067 Há na mídia uma grande quantidade de notícias envolvendo o DNA: testes de paternidade. origina a cadeia a) GUTATUTGA b) GCUAUCUGA c) GCTUTCTGU d) UCTATCTUA e) GCTATCTGA Questão 1065 Abaixo está representado o filamento I de uma molécula de ácido nucléico presente no interior do núcleo de uma célula vegetal. é necessário conhecer a estrutura da molécula de DNA e entender seu funcionamento. transcrita a partir do filamento II? a) G .U . c) O RNA mensageiro leva do núcleo para o citoplasma instruções transcritas a ele pelo DNA.4 Questão 1066 Considere as seguintes etapas da síntese de proteínas.Fixação do RNA mensageiro aos ribossomos.II.II .U . o RNA mensageiro determina a seqüência de aminoácidos apresentada por uma proteína. transgênicos. Qual seria a seqüência correta encontrada na molécula de RNA mensageiro.U d) C . Questão 1063 Os processos de transcrição e tradução gênicas resultam na síntese. 238 . assinale a alternativa incorreta.I . III .A .C . 5 out.U .U .U .G .I.II. e) DNA e de RNA.I e) III . clonagem terapêutica e reprodutiva.

I e II. 239 onsiderando-se apenas células eucariontes. algumas células foram fixadas e radioautografadas. Questão 1068 Analise as afirmativas a seguir. está indicado o processo de transcrição. Questão 1070 Algumas células de cultura de tecido foram deixadas em um meio contendo um precursor radioativo de RNA. b) I. e) II. através do qual formam-se moléculas que contêm as mesmas bases nitrogenadas presentes no DNA. b) apenas II. transcrição e tradução ocorrem no mesmo local porque as células procariontes não possuem sistema de endomembranas. uma fita de DNA serve como molde para a produção do RNA que terá uma seqüência de nucleotídeos complementar à fita-molde. (08) Em III. está indicado o processo de tradução. III.4 O esquema resume parcialmente as relações funcionais dos ácidos nucleicos que ocorrem na maioria das células vivas. gerando duas novas duplas hélices. d) III. onde está o DNA. (16) A deleção de um dos pares de bases na seqüência mostrada em I não alteraria significativamente a seqüência de aminoácidos em III. transcrição. onde serão produzidas as proteínas. Esse procedimento se repetiu após 15 e após 90 minutos. c) II.5. c) apenas III. (02) O quadro I mostra uma molécula de DNA cuja duplicação ocorre de forma semiconservativa. Após 3 minutos. respectivamente. Os esquemas representam as células radioautografadas nos três momentos.4 (01) Em I. que resulta na formação de polipeptídios. duplicação e tradução são: a) I. III e I. 1. Está(ão) correta(s) a) apenas I.e) apenas II e III. II e III. para o núcleo. essas células foram transferidas para um meio sem essa substância.5. Nas células eucariontes.8. I e III.8. d) apenas I e III. Nas bactérias. Posteriormente. I. revelando a distribuição do precursor radioativo nas mesmas. observa-se que o pareamento das bases nitrogenadas do DNA é aleatório. a informação genética é transmitida do citoplasma. cuja seqüência de aminoácidos está codificada numa molécula de ácido nucléico. III e II. as etapas que representam. (04) Em II. pois cada uma das fitas originais em I serve de molde para uma nova fita. Questão 1069 1. Durante a transcrição. II. .

são feitas as seguintes afirmações: I . e) I. buscando a situação de equilíbrio.As moléculas de RNA-t apresentam numa determinada região da sua molécula uma trinca de bases denominada anticódon. dirige-se gradativamente para o citoplasma celular. prossegue posteriormente no citoplasma da célula. que se intensifica aos 90 minutos.5.1. b) Apenas III. respectivamente. e) a síntese de RNA ocorre no núcleo. Questão 1072 Partindo-se do conhecimento do RNAm (CCU GAG). II . pode ser transportado por vários RNA-t. ao ser deixada em situação de desequilíbrio osmótico em relação à cultura sem isótopo. Esse aminoácido. indique. e) lise celular. arginina.8.8. b) arginina. leucina. 240 . nas opções a seguir.4 1. leucina e treonina. d) mutação gênica. III . respectivamente. arginina. arginina.Um RNA-t (RNA transportador) transporta sempre um determinado aminoácido.5. que ocorre inicialmente no núcleo celular. Questão 1073 Sobre a síntese de proteínas. Assinale a(s) afirmativa(s) correta(s): a) Apenas II. existem quatro tipos de genes que atuam como está demonstrado no esquema a seguir: São esses mecanismos que tornam possível a: a) diferenciação celular. c) a síntese de RNA. CUG e ACU do RNA mensageiro codificam. c) leucina. arginina. treonina. treonina.5 Esses resultados ocorrem porque a) o RNA transportador leva o isótopo até o nucléolo e posteriormente ao núcleo e citoplasma celular. porém. os aminoácidos arginina. b) a substância. d) a produção de RNA. c) duplicação de RNA.A tradução do código químico do RNA-m (RNA mensageiro) ocorre nos ribossomas localizados no retículo endoplasmático rugoso. e) leucina. b) produção de energia. leucina. Questão 1074 Ao longo da molécula de DNA. A seqüência desses aminoácidos na proteína correspondente ao segmento do DNA que apresenta a seqüência de nucleotídeos GAC TGA TCT será. II e III. esgota toda a substância presente no núcleo. leucina. sendo que posteriormente o RNA aí produzido migra para o citoplasma celular. Questão 1071 Os códons AGA. restando apenas no citoplasma. c) Apenas I e II. a) treonina. treonina. qual a seqüência correta do DNA e do RNA transportador. d) Apenas II e III. d) treonina.

Questão 1077 Analise o texto abaixo e assinale a alternativa que contém os termos que preenchem corretamente os espaços (I). e) reprodução celular. duplicação.análise do esquema anterior nos permite afirmar que: I . Sabe-se que esses antibióticos são substâncias cuja utilização médica se baseia na inibição das células bacterianas atuando no mecanismo de: a) fagocitose. (II). proteínas. No processo de elaboração de uma proteína ocorrem as etapas de transcrição e ___(III)___. 1. aminoácidos. de uma molécula de DNA. RNA transportador. d) II e III apenas. 1. RNA mensageiro.5 Questão 1078 O esquema a seguir representa a seqüência das etapas da síntese de um trecho de uma proteína a partir da molécula de DNA. cópia. tradução. b) ribossomos. (III) e (IV). num certo organismo. III . e) genes. b) secreção de substâncias. "O controle das características fenotípicas dos seres vivos é feito pelos ___(I)___ através do comando da síntese de ___(II)___. tradução. c) I e III apenas.8. II e III. duplicação.durante o processo a proteína formada depende. A(s) afirmativa(s) correta(s) é(são): a) I apenas.os ribossomas alinhados nessa molécula de RNA traduzirão os mesmos códons. e) I. em última análise. aminoácidos. c) síntese protéica. RNA ribossômico. a Tetraciclina liga-se à subunidade ribossômica menor e inibe a ligação do AA-RNAt.5.5. b) I e II apenas. aminoácidos. RNA mensageiro.qualquer proteína formada será conseqüência direta de uma transcrição do RNA. RNA ribossômico.8. Questão 1076 241 . II . d) produção de energia. A primeira etapa forma a molécula de ___(IV)___ contendo a mensagem genética e a segunda etapa é responsável pela produção da proteína. o Cloranfenicol inibe a peptidiltransferase na subunidade ribossômica maior e a Rifampicina inibe a RNA polimerase no sítio de iniciação." a) ribossomos.5 Questão 1075 O antibiótico Estreptomicina age sobre as bactérias promovendo a leitura errada do RNAm. proteínas. c) genes. d) genes.

os números 1 e 2 correspondem. respectivamente aos processos de tradução e transcrição. GAU b) TGT. CAT e) TGT.mensageiro. No esquema.5 s espaços 1. b) apenas I e II estão corretas. Sob ação do antibiótico. III. A seqüência correta de bases nitrogenadas encontradas na molécula de RNA mensageiro. e) todas estão corretas.5. GAG.Questão 1080 A composição química de uma proteína pode ser alterada se a) durante sua síntese houver variação dos tipos de aminoácidos disponíveis no citoplasma. CUC. complementar ao segmento da hélice de DNA apresentada é UGGUUUGGCUCA. c) sua síntese ocorrer no retículo endoplasmático liso e não no rugoso. GUA 242 . b) durante sua síntese houver variação dos tipos de RNA transportadores. Questão 1081 A seqüência de aminoácidos de uma proteína é determinada pela seqüência de a) pentoses da molécula de DNA.5 obre essa síntese foram feitas as afirmações abaixo: I. 2 e 3 ficariam corretamente preenchidos por: a) ACA. GAG. 1. que ocorrem no núcleo das células eucarióticas. e) bases da molécula de RNA . CAC. e) O DNA não se duplicar durante a interfase. Questão 1079 A Rifampicina é um dos antibióticos utilizados para o tratamento da tuberculose. Deve-se concluir que a) apenas II está correta. b) pentoses da molécula de RNA . II.ribossômico Questão 1082 Considere os seguintes fragmentos de ácidos nucléicos que participam da síntese de uma proteína. b) exclusivamente da produção de DNA.transportador.5. d) uma base púrica substituir uma pirimídica no RNA mensageiro que a codifica. c) apenas II e III estão corretas.8. Para codificar a seqüência dos aminoácidos do trecho da proteína apresentada no esquema são necessários 24 nucleotídeos no RNA mensageiro. GTA d) UGU. CAU c) TCT. c) bases da molécula de DNA. 1. nas células bacterianas haverá comprometimento a) exclusivamente da produção de proteínas. d) bases da molécula de RNA . Seu mecanismo de ação consiste na inibição da transcrição nas células de 'Mycobacterium tuberculosis'. c) exclusivamente da produção de RNA. d) apenas I e III estão corretas. GUG.8. e) da produção de DNA e RNA. d) da produção de RNA e de proteínas.

Numa síntese de proteína com 185 ligações peptídicas. representada em II. a) Essa metodologia visa reduzir os níveis de etileno nos frutos evitando seu amadurecimento. 243 . cuja expressão gênica é induzida pelo etileno. Questão 1084 Um mutante perdeu um segmento de DNA contendo todas as cópias dos genes que codificam RNA transportador. Antes de chegarem às prateleiras.5 Considerando o esquema acima. b) Cada trinca de bases. a) A substância representada em I é obrigatoriamente ribose. Questão 1085 O DNA apresenta importantes funções celulares. b) a síntese de RNA mensageiros. Essa enzima promove a hidrólise de componentes da parede celular. c) O maior tempo de prateleira a que o texto se refere se deve aos baixos níveis da enzima poligalacturonase. c) a síntese de proteínas. é denominada anticódon. Questão 1087 O esquema a seguir é um processo celular vital. Uma delas é a síntese de proteína. que representa um fragmento de ácido nucléico.5. d) o transporte de proteínas. assinale a alternativa INCORRETA. O tomate Flavr Savr foi desenvolvido pela empresa de biotecnologia Calgene para amadurecer no pé mantendo a firmeza de sua pele. o que compromete a firmeza dos frutos. Os pesquisadores utilizaram a metodologia "anti-sense" (veja o quadro a seguir) para diminuir os níveis da enzima poligalacturonase. o filamento de DNA que proporcionou essa síntese deverá ter o seguinte número total de nucleotídeos: a) 62 b) 93 c) 186 d) 279 1. 1. que ocorre também em você. unindo-se aos aminoácidos. e) o transporte de RNA. Dessa forma. A função celular drasticamente afetada por essa mutação será a) a replicação do DNA.5. d) A tecnologia "anti-sense" para genes necessários à síntese do etileno poderia ser utilizada para se evitar o amadurecimento de frutos.8. d) II pode apresentar moléculas de adenina. b) O RNAm do gene "anti-sense" é capaz de parear com o RNAm da poligalacturonase. cuja função é transportar aminoácidos.Questão 1083 e) 558 Questão 1086 Tradicionalmente.8. e) Se a ação desse ácido for bloqueada. impedindo sua expressão. os tomates são pulverizados com etileno para acelerar o amadurecimento e torná-los vermelhos. os tomates são colhidos ainda verdes para que sua firmeza seja mantida no transporte.5 Assinale a alternativa INCORRETA. o tomate pode ser transportado já maduro e apresenta um maior tempo de prateleira. o processo de transcrição não ocorrerá. c) Esse ácido nucléico é produzido no núcleo e se dirige ao citoplasma.

obteve-se uma proteína a) humana. mas não são traduzidas em proteínas) de seis espécies de organismos. d) moléculas utilizadas nos processos de cicatrização. o RNA mensageiro combina-se com um complexo de ribossomo.8. a proteína é sintetizada. b) enzimas usadas. é correto afirmar. b) de ovelha. II.8. Questão 1088 Os gráficos a seguir revelam o NÚMERO DE GENES e a relação entre RNA CODIFICADOR (que contém as seqüências que podem ser traduzidas em proteínas) e RNA NÃO-CODIFICADOR (seqüências que são transcritas.5. RNAs transportadores de ovelha e aminoácidos de coelho. c) moléculas de defesa do corpo.5. no processo digestivo. Num experimento de laboratório hipotético. EXCETO: a) Não existe uma relação de proporcionalidade direta absoluta entre o número de genes e a complexidade dos organismos relacionados. d) quimérica de homem e ovelha.5 244 . realizou-se uma síntese protéica utilizando-se: DNA de um gene humano. EXCETO: a) macromoléculas de reserva energética.5 1. 1.8.1. Analisando os resultados anteriores de acordo com seus conhecimentos sobre o assunto. c) de coelho. RNAs transportadores e aminoácidos.5 Nesse processo ocorre produção de. o gene (segmento de DNA) é transcrito em RNA mensageiro. III. e) híbrida de homem e coelho. poderiam desempenhar alguma função no núcleo celular. b) Os vertebrados citados apresentam menor percentual de transcrição em relação aos outros animais. c) Os íntrons são exemplos de RNA não-codificador. Questão 1090 Responder à questão com base na ilustração e afirmativas a seguir. por exemplo. d) Seqüências transcritas. mas não traduzidas. observam-se os seguintes eventos: I.5. Questão 1089 Na síntese protéica. e nos éxons estão presentes seqüências codificadoras. Ao final do experimento.

p. M. c) O desenvolvimento das diferentes regiões de um organismo deve-se à propriedade de interação célula-célula 245 . Marcelo. que é induzido a se expressar em resposta a fatores extrínsecos. Uma outra característica comum parece ser a geração de estruturas periódicas como segmentos. e) o DNA controlar a produção de proteínas e estas controlarem a atividade celular. III. B e C ocorrem no interior do núcleo. Lewis. b) O desenvolvimento envolve a expressão diferencial do material genético e independe do micro-ambiente em que a célula está localizada. células tornando-se diferentes de maneira ordenada [.) O autor refere-se às proteínas como ''atores do drama molecular'' e ao DNA como "diretor de cena". In: MURPHY. II.20/10/2002. A importante implicação disto é que não existe relação entre o padrão inicial e o observado. e que o sinal emitido por essas premiações aponta o verdadeiro futuro da pesquisa biológica e médica muito além dos genomas e de seu seqüenciamento (uma simples soletração). vértebras. o DNA se duplica. 74. Todas as interações ocorrem a curta distância . Durante o processo B..J. mas talvez não seja pretensioso supor que foi um lapso. Muitos animais desenvolvem-se ao longo de eixos cartesianos. denominado transcrição.A. São Paulo: UNESP. de forma que os embriões são logo divididos em regiões que essencialmente se dividem de maneira independente". c) o material genético ser constituído por proteínas.) (LEITE.. ocorre a síntese de RNA. os processos A. é certo afirmar: a) os aminoácidos que estão no citoplasma são selecionados pelo RNAm b) todo o processo da síntese de uma proteína ocorre exclusivamente no núcleo da célula c) o RNAm controla a síntese de uma proteína. Durante o processo A.]..raramente ultrapassam mais que 30 diâmetros de célula . II e III b) I. Paulo . dá-se a síntese protéica. Essa referência deve-se ao fato de a) não ocorrer uma correlação funcional entre DNA e proteínas no meio celular.. III e IV c) I e IV d) II e III e) II. Questão 1092 Em se tratando do processo de síntese de proteínas. b) o DNA controlar a produção de proteínas etambém atuar como catalisador de reações químicas celulares. 1997. o galardão de química ficou com os inventores de ferramentas para estudar proteínas. os verdadeiros atores do drama molecular da vida. é correto afirmar: a) As células diferenciam-se de acordo com um padrão intrínseco. III e IV Questão 1091 (. denominado replicação. É verdade que a Fundação Nobel ainda fala no DNA como o diretor de cena a comandar a ação das proteínas. como em um sistema coordenado. Considerando os processos intracelulares. e as células então interpretam esses valores de maneiras diferentes. (WOLPERT." Folha de S. que são construídas segundo o modelo básico modificado pela informação posicional. Nos eucariotos. mas a síntese dele próprio é controle do DNA d) o RNAt é responsável pela etapa de transcrição no processo de síntese de uma proteína Questão 1093 "Desenvolvimento significa. denominado tradução.. "O Que é vida? 50 anos depois". "De volta ao seqüenciamento.e a maior parte da formação de padrões acontece localmente. d) as proteínas não terem controle sobre o metabolismo celular. P. IV. Uma maneira de produzir padrões é dar às células informação posicional. O'NEILL. penas e dentes. sendo os padrões especificados independentemente ao longo de cada um.) Com base no texto e nos conhecimentos sobre o tema. em grande parte. todas as afirmativas corretas encontram-se na alternativa a) I.) De outro lado. Durante o processo C. contido no material genético... L. (.

no meio de cultura líquido. Admita que todos os demais nucleotídios formam códons que correspondem a aminoácidos encontrados na estrutura primária das proteínas após serem sintetizadas.ACT .TCG .UCG . substâncias químicas indispensáveis à vida. no citoplasma. Questão 1094 Um RNA-mensageiro bacteriano é formado pela polimerização de 5292 nucleotídios e contém três códons de iniciação de leitura e três de terminação.GUA . esta enzima passa para o lisossomo. respectivamente. para o meio de cultura. Questão 1097 O pesquisador Gustavo obtém pectinase. Questão 1098 Na síntese protéica. do seu RNAm. um processo bastante complexo e fundamental para a sobrevivência das células. desta forma.UGC . 246 . Y e Z de aminoácidos. esta enzima passa para o complexo de Golgi e é secretada. assinale a alternativa correta. contendo. Em seguida. b) O caminho da produção da pectinase começa com a transcrição. c) o transporte de aminoácido para o local da síntese é feito pelo mRNA. c) A síntese da pectinase começa no citoplasma e termina nas membranas do retículo endoplasmático rugoso. para o meio de cultura. via vesículas de secreção. depois para o complexo de Golgi e é secretada. e) A síntese da pectinase começa no mesossomo e termina nas membranas do retículo endoplasmático rugoso. ele simplesmente separa o meio de cultura do microrganismo e isola a enzima deste meio. Em seguida. Portanto. produzida pelo fungo 'Aspergillus niger'.CTA . Gustavo não precisa destruir o fungo para obter a enzima. um número X.CGA . Sabe-se que X < Y < Z e que esses valores formam uma progressão aritmética.ACG .AUG Os anti-códons correspondentes são: a) AUG . a síntese da enzima ocorre nas membranas do mesossomo e depois ela é secretada para o meio de cultura. d) A diferenciação caracteriza-se pela manutenção do padrão morfológico e pela alteração do padrão funcional do tecido.CGU Questão 1096 Sobre os diferentes papéis dos ácidos nucléicos na síntese de proteínas podemos afirmar corretamente que: a) a seqüência de bases no DNA determina a seqüência de aminoácidos na cadeia polipeptídica. b) a posição dos aminoácidos na cadeia polipeptídica depende da seqüência de bases do tRNA. a participação dos ácidos nucléicos. que serve de modelo para a formação de uma proteína. Esse RNA é traduzido em três diferentes proteínas. em que a diferenciação de um tipo celular induz outro tipo a se diferenciar. e) O desenvolvimento ocorre como um dominó.GAC e) GCA .UAC b) ATG .CUA . via vesículas de secreção. a) O 'Aspergillus niger' é um organismo que possui mesossomo.TAC c) TUG . d) A síntese da pectinase começa no núcleo e termina nas membranas do retículo endoplasmático liso. que é traduzido por ribossomos e depois é ancorado nas membranas do retículo endoplasmático rugoso. via vesículas de secreção. Em seguida.UTC d) AGT . e) a extremidade livre dos diversos tRNA tem seqüências de bases diferentes. para o meio de cultura. onde a tradução é concluída. De acordo com o texto. d) a seqüência de bases do rRNA é transcrita a partir do código do mRNA.ACG . o valor de Y equivale a: a) 826 b) 706 c) 586 d) 466 Questão 1095 Considere os seguintes códons: UAC . está corretamente referida em: a) O DNA transcreve a mensagem genética para o RNA.GAU .e da quantidade de informações que a célula é capaz de processar. para ser empregada na indústria de sucos.CUT . esta enzima passa para o complexo de Golgi e é secretada.

– e “ determinadas pela ação de diferentes genes e que vão compor as hemoglobinas em várias fases do desenvolvimento humano: om base nas informações contidas nesse gráfico e em outros conhecimentos sobre o assunto. c) Estão corretas apenas I e II. a) Apenas II está correta.b) O DNA transcreve a mensagem genética para o RNA solúvel. III) O anticódon corresponde a uma trinca de bases localizada numa determinada região de todos os RNAt. Questão 1099 Um pesquisador injetou RNA mensageiro (mRNA) de vírus em ovócitos de anfíbios.8. ’. b) a síntese da cadeia polipeptídica ‘ permanece constante durante a mudança de produção das cadeias – e ’. ’.5 1. local de ligação com o aminoácido que ele transporta. é INCORRETO afirmar que a) a ativação do gene responsável pela síntese da cadeia polipeptídica “ ocorre dias antes do nascimento.8. Esses dados sugerem que a) o DNA dos ovócitos foi impedido de se expressar.5. d) os ovócitos foram capazes de interpretar a informação contida no mRNA viral. 2 e 3 substituem. II) A tradução do código genético do RNAm é feita nos ribossomos localizados no retículo endoplasmático rugoso. Questão 1101 São feitas as seguintes afirmativas a respeito da síntese protéica. e) O RNA ribossômico se une a proteínas formando o ribossomo. além de suas próprias proteínas. b) Todas estão corretas. I) Um RNAt transporta sempre o mesmo aminoácido. – e “ estarão presentes no indivíduo adulto. Questão 1100 Analise este gráfico.‘. local onde ocorre a transcrição da mensagem genética. e) Estão corretas apenas I e III. c) O RNA mensageiro contém trincas de nucleotídeos denominadas códons. em que está representada a produção de diferentes tipos de cadeias polipeptídicas . d) os quatro tipos de cadeias polipeptídicas . local da síntese protéica. os números 1. c) o gene responsável pela síntese da cadeia polipeptídica ’ aumenta sua atividade a partir do terceiro mês da concepção. c) o material injetado nos ovócitos foi capaz de se autoduplicar. produziam. d) O RNA transportador apresenta na sua molécula uma trinca de nucleotídeos denominada anticódon. respectivamente: 1. d) Apenas III está correta. também. verificou que esses ovócitos. comandando a síntese da proteína viral.‘. b) o mRNA se integrou ao DNA dos ovócitos. que se liga ao ribossomo.5 247 . Questão 1102 No esquema. proteínas virais.5. responsáveis pela transcrição de uma cadeia polipeptídica. Após certo tempo. Analise-a e assinale a alternativa correta.

um dos descobridores da estrutura da molécula de DNA. tradução. Entre as hipóteses apresentadas naquele texto.5 248 . o mensageiro e o transportador. c) Apenas III. que podem ser de quatro tipos diferentes. repressão. Segundo esse dogma. b) a transferência de informações genéticas ocorre do DNA para o RNA. (32) existem códons específicos para concluí-lo.5.Um indivíduo com a enzima 1 inibida acumulará grandes quantidades de aminoácido 3. é CORRETO afirmar que: (01) ele ocorre nos ribossomos. e deste para a proteína. (02) dele participam três moléculas de RNA: o ribossômico. e) uma molécula de DNA difere de outra pela seqüência de seus nucleotídeos.Um indivíduo com a enzima 1 inibida deixa de produzir as enzimas 2 e 3. Quais estão corretas? a) Apenas I. Com relação a esse processo.5. d) cada molécula de DNA é formada pela reunião de nucleotídeos. c) cada polipeptídeo tem uma seqüência específica de nucleotídeos determinada pelo gene. a) o código genético é degenerado.a) repressão gênica. levando à formação de alguns hormônios: dogma central da Biologia. Questão 1105 1. tradução d) replicação.Um indivíduo com a enzima 1 inibida precisa receber os hormônios 1 e 2 de fontes externas. presente no RNA mensageiro. (04) o RNA transportador tem como função levar as proteínas produzidas no núcleo para o citoplasma. transcrição. destaca-se o 1. morto em julho de 2004. Em 1958. Questão 1106 respeito deste esquema são feitas as seguintes afirmações: I . tradução Questão 1103 O esquema a seguir mostra a via metabólica de um aminoácido. no interior do núcleo. que ocorre em nível celular. isto é. b) Apenas II.8. III . replicação. transcrição. (16) o código genético é degenerado. pois um aminoácido pode ser codificado por mais de uma trinca. e) Apenas II e III. apresentando suas hipóteses sobre a estrutura teórica da biologia molecular. (08) o ordenamento dos aminoácidos na proteína formada dá-se em função da seqüência de bases nitrogenadas. é a síntese de proteínas.8. lançando. II .5 Um dos processos metabólicos mais importantes. será lembrado como um dos mais influentes cientistas de todos os tempos. diferentes códons sempre especificam diferentes aminoácidos na cadeia polipeptídica. replicação b) replicação. publicou um manifesto sobre a síntese de proteínas. d) Apenas I e II. tradução e) transcrição. as bases para a descoberta do código genético. assim. transcrição c) amplificação gênica. Questão 1104 O cientista britânico Francis Crick.

5. São Paulo: Moderna. III e IV correspondem.5 Analise o esquema e julgue os itens a seguir. ribossomo e anticódon.núcleo Questão 1107 1. 1. (1) Os ribossomos estão se movendo da parte de baixo para a de cima do esquema.citoplasma. b) RNAt. c) 4 representa o RNA transportador que carrega a mensagem.tradução . b) 3 representa a proteína carregada pelo RNA mensageiro. respectivamente. o número (2).transcrição . o número a) 2 representa o RNA mensageiro que contém os códons para a síntese protéica. todas as proteínas representadas no esquema serão iguais. (4) O número de aminoácidos da proteína dependerá do tamanho do RNA mensageiro. RNAt. c) RNAt. "Biologia . Questão 1108 O esquema a seguir representa a síntese protéica. 1997.tradução . Assinale a alternativa que preenche. os processos representados pelos números (1) e (2) ocorrem no _________. 150. 1. p.replicação . Questão 1109 O diagrama ilustra uma fase da síntese de proteínas.núcleo. d) RNAm. RNAm. e) RNAm. (0) Ao final da síntese.No esquema. ribossomo e códon. códon.8.tradução . vol.5 AVANCINI e FAVARETTO.8. as lacunas. 249 .tradução . c) transcrição . (3) O conjunto representado pode estar localizado no retículo endoplasmático rugoso. RNAm e RNAt.núcleo d) replicação . ao processo de ___________ e o número (3) ao processo de ___________.transcrição .8.replicação .citoplasma e) replicação . não está representado o RNA transportador. ribossomo e anticódon. e) 4 representa o RNA mensageiro que está sendo carregado pelo RNA transportador representado pelo número 1. a: a) ribossomo. o número (1) corresponde ao processo de ___________. que também participa do processo. (2) No esquema.transcrição .Uma abordagem evolutiva e ecológica". RNAt. Na figura. ribossomo e códon.5. II. a) transcrição .5.5 s algarismos I. b) replicação . RNAm. 1. Nas células eucariotas. d) 1 representa a mitocôndria onde ocorre o processo de tradução. corretamente.tradução .

d) nos genes II e III. patogênicos e mortos. somente. 3 e 4. somente. que resume as principais etapas da síntese protéica que ocorre numa célula eucarionte. Nesse extrato o agente capaz de transformar bactérias não-patogênicas em patogênicas era a) o ácido ribonucléico. e) nos genes III e IV. somente. b) o ácido indolilacético. misturados com um extrato de pneumococos capsulados.5 250 . duplicação e retículo endoplasmático. 2. c) o ácido desoxirribonucléico. 1. b) o ácido indolilacético. porém. a a) transcrição. O funcionamento das glândulas supra-renais. c) duplicação.5. 1. d) uma enzima. c) nos genes I e III. somente. III e IV. produzem quatro tipos diferentes de enzimas. d) uma enzima.5 m indivíduo tem anomalias na pigmentação do corpo e seu metabolismo é prejudicado pela falta do hormônio da tireóide. quantos nucleotídeos em média estão presentes em uma seqüência codificadora de ARN-m. duplicação e lisossomo. c) o ácido desoxirribonucléico. e) tradução. transcrição e ribossomo. tradução e ribossomo. e) uma proteína.8.5. é normal. causavam a morte de cobaias. respectivamente. transformando o aminoácido fenilalanina em quatro possíveis substâncias. Nesse extrato o agente transformante era a) o ácido ribonucléico. Questão 1112 Supondo que o peso molecular médio de um aminoácido é de 100 daltons. e) uma proteína. Questão 1114 Em 1928 Griffth descobriu que pneumococos (bactérias) sem cápsula e não-patogênicos. Questão 1111 Considere o diagrama. b) nos genes I e II.8. I. não patogênicos. responsável pelo sequenciamento dos aminoácidos em um peptídeo com peso molecular de 27000 daltons? a) 810 b) 300 c) 270 d) 81000 e) 2700 Questão 1113 Griffth em 1928 descobriu que pneumococos sem cápsula. De acordo com o esquema. II. b) tradução. transcrição e lisossomo. misturados com um extrato de pneumococos capsulados patogênicos mortos causavam a morte de cobaias. d) transcrição. s processos assinalados como 1 e 2 e a organela representados no diagrama referem-se.Questão 1110 O esquema representa alguns passos de uma série de reações metabólicas. somente. os sintomas que o indivíduo apresenta ocorrem devido às alterações a) no gene I. onde quatro genes. 1.

Questão 1115 Griffth, em 1928 descobriu que bactérias pneumococos sem cápsula e não-patogênicos, misturados com um extrato de pneumococos capsulados, patogênicos e mortos, causavam a morte de cobaias. Em 1944 Avery, McLeod e McCarthy concluíram que o agente capaz de transformar as bactérias era a) o RNA. b) o AIA. c) o DNA. d) uma enzima. e) uma proteína. Questão 1116 A experiência do "liquidificador" realizada por Hersey e Chase demonstrou que a substância que determinava a destruição de bactérias parasitadas pelos vírus bacteriófagos era a) uma proteína viral. b) uma enzima viral. c) o RNA viral. d) o DNA viral. e) um lípide viral. Questão 1117 O experimento do "liquidificador" serviu para demonstrar que o DNA de certos organismos era capaz de causar a destruição de bactérias. Os organismos que podem infectar bactérias são a) fungos. b) vírus. c) algas. d) ácaros. e) protozoários. Questão 1118 Bacteriófagos são a) protozoários de vida livre. b) líquenes parasitas. c) vermes parasitas. d) vírus. e) vermes de vida livre.

Questão 1119 A experiência do "liquidificador" realizada por Hersey e Chase em 1952 demonstrou que a) o material genético é formado por proteínas. b) o material genético é formado de RNA. c) o material genético é formado de lipídios. d) o material genético é formado por açúcares. e) o material genético é formado de DNA. Questão 1120 A bactéria 'Pneumococo pneumoniae' pode possuir uma cápsula que lhe permite a) sofrer mutações. b) desenvolver flagelos. c) resistir às defesas dos hospedeiros. d) ficar imune às defesas dos hospedeiros. e) sobreviver em ambientes sem água. Questão 1121 "O século XX proporcionou uma série de pesquisas na área genética. Em 1928, Griffith realizou um importante experimento que envolvia transformações em bactérias. Esse experimento, retomado por Avery e colaboradores, em 1944, foi a base para a descoberta da molécula formadora do material genético. Nos anos 50, Watson e Crick apresentaram o modela da dupla-hélice dessa molécula, abrindo caminho para que, na década seguinte, se demonstrasse como o gene, através de sua seqüência de bases nitrogenadas, controla a produção de proteínas. Nas duas últimas décadas, o avanço biotecnológico permitiu aos cientistas a manipulação do material genético e a transferência de um gene de uma espécie para outra." Considere os itens abaixo: I. estrutura da molécula do DNA; II. descoberta do código genético; III. DNA como molécula constituinte do gene; IV. obtenção de organismos transgênicos. O texto faz referência a) apenas aos itens I, II e III.
251

b) apenas aos itens I, II e IV. c) apenas aos itens I, III e IV. d) apenas aos itens II, III e IV. e) a todos os itens considerados. 1.5.8.6 Questão 1122 Sabendo que o DNA dos vírus bacteriófagos contém fósforo e que a cápsula protéica contém enxofre, Hersey e Chase, em 1952, cultivaram vírus em meio contendo isótopos de fósforo (¤£P) e de enxofre (¤¦S). Esses pesquisadores observaram, ao introduzir os vírus marcados em meio contendo bactérias, que os isótopos de fósforo (¤£P) apareciam no interior das bactérias e que os isótopos de enxofre (¤¦S) permaneciam fora das células. Observaram também que, após lavarem a superfície das bactérias, retirando o enxofre (¤¦S), continuava ocorrendo a replicação dos vírus. Com esse experimento, eles puderam concluir que a) a informação genética necessária para a síntese de novos vírus está contida no DNA viral. b) as capas protéicas dos vírus contêm parte importante da informação genética necessária à síntese de novos vírus. c) o DNA viral precisa estar associado integralmente às capas protéicas para poder se replicar no interior das bactérias. d) a capa protéica protege o DNA viral da ação de endonucleases no interior do organismo hospedeiro. e) os vírus bacteriófagos contêm DNA como material genético, e essa molécula é muito rica em enxofre. Questão 1123 No início da década de 1950, foi desenvolvido um experimento onde um dos componentes de um tipo de bacteriófago foi marcado radiativamente com enxofre e outro, com fósforo. Esses bacteriófagos foram utilizados para infectar uma cultura de 'Escherichia coli'. Um dos componentes entrou na bactéria, e o outro foi retirado da parede da mesma, por agitação. A cultura foi, então, imediatamente, centrifugada. O resultado obtido encontra-se ilustrado no esquema a seguir.

obre o resultado do experimento, é correto afirmar que a) o DNA do bacteriófago marcado com fósforo encontra-se no depósito bacteriano. b) as proteínas do bacteriófago marcadas com enxofre encontram-se no depósito bacteriano. c) o DNA do bacteriófago marcado com enxofre encontra-se em suspensão. d) as proteínas do bacteriófago marcadas com fósforo encontram-se em suspensão. e) o DNA do bacteriófago marcado com enxofre encontra-se no depósito bacteriano. Questão 1124 Por razões pouco conhecidas, durante a meiose pode ocorrer a não-disjunção de um determinado par de cromossomas, acarretando anomalias cromossomiais. Como exemplo de anomalia cromossomial autossômica temos: a) mongolismo. b) daltonismo. c) hemofilia. d) Síndrome de Turner. e) Síndrome de Klinefelter. Questão 1125 O esquema a seguir representa a formação dos gametas responsáveis pela produção de um indivíduo com alteração do seu número cromossomial.

252

1.5.9.1

III IV a) 65 , 65. b) 65 ,130. c) 70 , 60. d) 130 , 65. e) 130 , 130. Questão 1128 Monossomia do cromossomo X, ovários rudimentares, mau desenvolvimento dos caracteres sexuais secundários, baixa estatura são, entre outros, dados que podem ser relacionados com a síndrome: a) de Marfan b) de Klinefelter c) de Down d) de Turner e) de Patau Questão 1129 A constituição genética dos indivíduos com síndrome de Klinefelter é: a) 45A XX b) 44A XYY c) 44A XXY d) 45A XO e) 47A XXY Questão 1130 A síndrome de Down ou mongolismo é uma anomalia causada por: a) uma mutação gênica b) uma deficiência cromossômica c) uma diminuição do número de cromossomos no genoma d) um aumento do número de cromossomos do genoma e) uma inversão cromossômica Questão 1131

ntre as características que este indivíduo passará a apresentar, teremos: a) sexo masculino. b) cariótipo normal. c) estatura elevada. d) caracteres sexuais desenvolvidos. e) ausência de cromatina sexual. Questão 1126 A síndrome de Klinefelter é uma anomalia genética devido à: a) presença de três cromossomos autossômicos nŽ 21. b) ausência de um cromossomo autossômico nŽ 21. c) presença de um cromossomo X e dois cromossomos Y. d) presença de um cromossomo Y e dois cromossomos X. e) ausência de cromossomos sexuais. Questão 1127 Suponha que o seguinte processo ocorre em uma comunidade onde convivem diferentes espécies de gramínea: Qual das alternativas a seguir indica corretamente o valor de 2N dos híbridos III e IV do processo esquematizado?

1.5.9.1

Se na ovulogênese, não houver disjunção do par de cromossomos sexuais, os óvulos correspondentes, sendo fecundados, poderão dar origem a casos de a) síndrome de Turner b) síndrome de Klinefelter c) síndrome de Down d) síndrome de Patau e) a e b são possíveis
253

Questão 1132 Duas espécies de plantas A(2n = 8) e B(2n = 6) foram cruzadas produzindo um híbrido interespecífico que, germinando, produz alguns grãos de pólen que foram utilizados para fecundar óvulos da espécie B. Assinale a opção que relaciona o nível de ploidia e o número de cromossomos da descendência. a) 2n = 7 b) 2n = 10 c) 3n = 7 d) 3n = 10 e) 4n = 14 Questão 1133 Duas espécies de plantas A(2n = 8) e B(2n = 10) foram cruzadas produzindo um híbrido interespecífico que, germinando, produz alguns grãos de pólen que foram utilizados para fecundar óvulos da espécie B. Assinale a opção que relaciona o nível de ploidia e o número de cromossomos da descendência. a) 2n = 7 b) 2n = 14 c) 3n = 14 d) 3n = 10 e) 4n = 14 Questão 1134 A figura a seguir representa uma sinapse (pareamento) anormal observado quando ocorre a mutação cromossômica estrutural denominada:

a) inversão pericêntrica b) translocação c) duplicação d) deleção e) isocromossomos Questão 1135 A figura a seguir representa uma sinapse (pareamento) anormal observado quando ocorre a mutação cromossômica estrutural denominada:

1.5.9.1

a) inversão pericêntrica b) translocação c) duplicação d) deleção e) isocromossomos Questão 1136 Existem algumas pessoas chamadas especiais porque possuem uma série de características diferentes da maioria da população. Entre essas, estão aquelas que possuem a 'Síndrome de Down', também conhecida como Mongolismo. Em relação a essa síndrome, podemos afirmar que: a) é uma anomalia genética, causada pela presença de 3 cromossomos 21 e transmitida sempre pela mãe. b) é uma anomalia congênita, causada pela presença de 3 cromossomos 21 e transmitida sempre pela mãe. c) é uma anomalia genética, causada pela presença de 3 cromossomos 21 e transmitida por qualquer um dos pais. d) é uma anomalia congênita, causada pela ausência de um cromossomo sexual X ou Y. e) é uma anomalia genética, causada pela translocação de um dos cromossomos 21 para um 22.

1.5.9.1

254

Questão 1137 Num dado organismo, foram encontradas células somáticas normais com seis cromossomos (I) e células aberrantes (II e III) cujos cariótipos estão esquematizados a seguir.

Questão 1139 O número de cromossomos de uma espécie é 2n=20. O sistema de determinação do sexo é do tipo ZW. O cariótipo que representa uma euploidia é: a) 20, ZW b) 20, ZZ c) 30, ZWW d) 19, ZO e) 21, ZZW Questão 1140 A figura a seguir ilustra o processo denominado AMNIOCENTESE, utilizado para diagnóstico pré-natal de doenças genéticas. A técnica consiste na remoção de uma pequena quantidade de líquido amniótico (que banha o feto durante o desenvolvimento embrionário) para análise. Nesse líquido são encontradas proteínas e células que se soltam da pele do feto e dos revestimentos das vias gastrointestinais, respiratórias e genito-urinárias. As células imersas no líquido podem ser coletadas por centrifugação e utilizadas para estabelecer culturas de amniócitos. Essas culturas podem ser analisadas citologicamente, ou por análise do DNA.

1.5.9.1

s aberrações cromossômicas dos cariótipos II e III são, respectivamente, do tipo a) monossomia e trissomia. b) monossomia e poliploidia. c) nulissomia e trissomia. d) nulissomia e poliploidia. e) nulissomia e monossomia. Questão 1138 Observe o cariótipo a seguir, obtido a partir de células diplóides de uma pessoa.

1.5.9.1

1.5.9.1

ua análise permite afirmar que ele pode pertencer a uma mulher a) normal, com 47 cromossomos. b) com síndrome de Down. c) com síndrome de Klinefelter. d) com daltonismo. e) com polidactilia.

255

obre o processo acima descrito são feitas várias afirmações. Com base em seus conhecimentos e no texto acima, assinale a alternativa que apresenta um ERRO conceitual ou processual. a) O líquido amniótico funciona como amortecedor de choques mecânicos e propicia um ambiente adequado para o desenvolvimento do feto. b) Células presentes no líquido podem ser utilizadas para a determinação de anomalias cromossômicas. c) O processo pode ser indicado para gestantes com idade avançada, para as quais é maior o risco de terem filhos com Síndrome de Down. d) A cariotipagem pode ainda ser utilizada para a detecção de erros inatos do metabolismo como, por exemplo, a hemofilia. e) A presença de alguns vírus, como o da rubéola, apontam para possibilidade de más formações congênitas na criança. Questão 1141 O daltonismo é um caráter ligado ao sexo na espécie humana. A seguir estão representados os cariótipos de cinco indivíduos que apresentam uma anomalia cromossômica numérica, além de serem todos daltônicos.

odas as afirmações a seguir referentes aos indivíduos representados são verdadeiras, EXCETO: a) O gameta com um cromossomo a mais que deu origem ao indivíduo I foi produzido por não-disjunção na segunda divisão meiótica da gametogênese masculina. b) Ao pai do indivíduo II é obrigatoriamente daltônico, e a não-disjunção que resultou na anomalia pode ter acontecido na gametogênese feminina. c) Se o pai do indivíduo III não for daltônico, a não-disjunção que resultou na anomalia ocorreu na gametogênese feminina. d) Se o pai do indivíduo IV não for daltônico, a não-disjunção que resultou na anomalia ocorreu na gametogênese feminina. e) A mãe do indivíduo V pode ou não ser daltônica. Questão 1142

1.5.9.1

1.5.9.1 Acima, representa-se esquematicamente uma alteração estrutural de um cromossomo que serve de exemplo para o fenômeno denominado a) duplicação. b) deleção. c) translocação. d) transdução. e) inversão. Questão 1143 Uma mulher triplo-X é fértil e produz óvulos normais e óvulos com dois cromossomos X. Sendo casada com um homem cromossomicamente normal, essa mulher terá chance de apresentar a) apenas descendentes cromossomicamente normais. b) apenas descendentes cromossomicamente anormais. c) 50% dos descendentes cromossomicamente normais e 50% cromossomicamente anormais.
256

gerando plantas (F2) com 2n=56.9. mas não conseguia produzir sementes. em I. a anomalia conhecida como síndrome de Down ou mongolismo deve-se à a) mutação de um gene autossômico. e) A duplicação deu-se apenas com os cromossomos viáveis de cada espécie e o número total foi completado com quebras cromossômicas. que florescia. é possível detectar a anomalia que caracteriza a síndrome de Down. b) mutação de um gene do cromossomo X. Questão 1144 Na espécie humana. ambas com número cromossômico 2n=28. 1. Questão 1146 Pela análise dos cromossomas.9. respectivamente. foram cruzadas e criou-se um híbrido. Assinale a alternativa que representa esse cromossomo após um rearranjo do tipo inversão. assinale a alternativa que indica a causa mais provável para a infertilidade da F1.5. Meristemas desta geração de híbridos (F1) foram submetidos a um tratamento com colchicina. em função de alelos incompatíveis. De acordo com o texto e os conhecimentos sobre o tema. e) 75% dos descendentes cromossomicamente normais e 25% cromossomicamente anormais.1 s eventos possíveis da meiose que levam à síndrome de Down são os de número: a) 1 e 4 b) 1 e 3 c) 2 e 3 d) 2 e 4 Questão 1147 Considere o cromossomo a seguir esquematizado. Em II. que foram seletivamente eliminados em F2. o que resultou em uma duplicação do número cromossômico. temos exemplos. III e IV. c) existência de um autossomo extra. que por sua vez produziam sementes normalmente. d) existência de um cromossomo X extra. d) A duplicação do número cromossômico permitiu a formação de 28 pares de cromossomos bivalentes. viabilizando a meiose. c) A primeira geração filial era infértil. 1. e) falta de um cromossomo X. pertencentes a gêneros diferentes.1 Questão 1148 Na figura a seguir. também com 2n=28. seguida de reprodução normal na F2: a) O tratamento com colchicina removeu as barreiras químicas existentes nos dois conjuntos de cromossomos. O esquema a seguir apresenta quatro eventos da divisão celular.5. Questão 1145 Duas espécies de gramíneas. temos uma célula diplóide 2n = 6 cromossomos.d) 25% dos descendentes cromossomicamente normais e 75% cromossomicamente anormais. parte dos cromossomos foi eliminada. havendo multiplicação apenas do lote haplóide de uma das espécies. de 257 . b) Durante a meiose ocorrida em F1.

por esse motivo. artificialmente. ocorrem casualmente na natureza. a produção de espermatozóide ocorre durante todos os anos reprodutivos. EXCETO a) É resultante do cruzamento de égua com jumento. é INCORRETO afirmar que a) os pais de um indivíduo Klinefelter têm número normal de cromossomos nas células somáticas. d) Produz gametas inviáveis. inversão paracêntrica. c) É um típico exemplo de animal híbrido. Esses vegetais podem ser reproduzidos pelo homem. Como exemplo. translocação. que induz à a) haploidia.1 Questão 1153 Na Síndrome de Down." (ROSA.5.) Todas as alternativas apresentam características biológicas do burrinho referido nesse texto. os cromossomos sexuais são representados por XXY. entre os quais. por conseguinte. usando-se técnicas de melhoramento genético. J. Pessoas com síndrome de Klinefelter possuem 47 cromossomos.1 a) haploidia. Chamava-se Sete-de-Ouros. e) monossomia. Assinale nos parênteses V se for verdadeira ou F se a afirmação for falsa. c) poliploidia. ou não sei onde no sertão. b) Tem características morfológicas idênticas às de um dos pais. translocação. d) recombinação gênica. 1. não levando à aneuploidia em seus filhos. Com base nessas informações e outros conhecimentos sobre o assunto. "Sagarana". Questão 1149 Vegetais maiores. b) inversão cromossômica. e) translocação cromossômica. inversão paracêntrica. inversão pericêntrica. mais vigorosos e. b) a presença de dois cromossomos X impede a manifestação do fenótipo masculino. miúdo e resignado. apresentar alterações. Questão 1152 Muitas aberrações cromossômicas humanas se manifestam como síndromes bem definidas e de fácil constatação pela análise do cariótipo.Questão 1151 O número de cromossomos da espécie humana pode. translocação. podemos citar o uso da Colchicina. d) monossomia. ( ) nos homens. Questão 1150 "Era um burrinho pedrês.Guimarães. c) monossomia. inversão pericêntrica. isto é. Na tabela a seguir são dados cinco casos cuja veracidade você deverá analisar. translocação. o fenômeno ocorre quando os cromossomos não se separam durante a primeira divisão meiótica. d) a fecundação de um óvulo X por um espermatozóide XY dá origem a um indivíduo Klinefelter. às vezes. vindo de Passa-Tempo. inversão paracêntrica. 258 . c) a ocorrência do fenótipo mutante é resultado de um cromossomo extra.9.9. mais vantajosos economicamente. como outro não existiu e nem pode haver igual. e já fora tão bom.5. translocação. também conhecida como trissomia 21: ( ) a causa é a não-disjunção. b) haploidia. não existindo não-disjunção e. 1. Conceição do Serro.

II e III estão corretas. analise as afirmações abaixo: I . d) Euploidia. d) deslocação. esterilidade e pescoço alado. d) fato de as células autossômicas dos portadores terem 46 cromossomos. Questão 1155 FALHAS NO ENSINO DE CIÊNCIAS "ERROS EM LIVROS DIDÁTICOS AINDA PERSISTEM EM ESCOLAS DE MINAS E SÃO PAULO" Nélio Bizzo O autor. Abril 2000: nŽ 159. "CIÊNCIA HOJE". Questão 1158 As anomalias cromossômicas são bastante freqüentes na população humana. Pode-se afirmar que a) I e II estão corretas.daltonismo e hemofilia são alterações gênicas e não cromossômicas. c) Trissomia. Quanto a esses micronúcleos. b) I e III estão corretas. isso se deve à presença de um cromossomo 21 extranumerário.. b) fecundação de um gameta feminino diplóide por um gameta masculino haplóide. 26 Os casos de aneuploidias citados no texto incluíam daltonismo e hemofilia. e) I está correta. Foram encontradas muitas células que. ou um segmento do cromossomo 21. podem-se perceber erro conceitual grave. um exemplo disso é que aproximadamente uma a cada 600 crianças no mundo nasce com síndrome de Down. Questão 1154 A Síndrome de Down. 259 . b) substituição. II ." BIZZO. mas apresenta a doença quando afetado. c) II e III estão corretas. uma aneuploidia autossômica. professor da Faculdade de Educação da USP.. ( ) os portadores têm uma cópia extra do cromossomo 21. preconceito e tautologia em uma única linha. apresentavam micronúcleos originados em cromossomos defeituosos. e) Triploidia. trabalhar e ter uma vida semelhante à dos demais cidadãos. em alguns casos.tanto o homem quanto a mulher podem ser portadores de aneuploidias. Quando bem assistidas. caracteriza-se pela trissomia do cromossomo 21 e decorre do(a) a) erro de disjunção do cromossomo 21 durante a formação dos gametas. Em função do comentário do professor. translocado para outro cromossomo. b) Monossomia.o livro confunde herança ligada ao sexo com aneuploidias. comenta em um dos seus artigos: ". Esta Síndrome pode ser classificada como exemplo de a) Nulissomia. p. d) I.( ) afeta indivíduos que têm um autossoma extra. Nélio. como por exemplo: explique por que o homem não é portador de aneuploidias. c) deleção. Questão 1157 Mulheres com Síndrome de Turner caracterizam-se por apresentar baixa estatura. e) bipartição. pessoas com síndrome de Down alcançam importantes marcos no desenvolvimento e podem estudar. podemos supor que se originaram a partir de a) translocação. Questão 1156 Uma pesquisadora analisou células da mucosa bucal de frentistas de postos de gasolina. Rev. III . Na grande maioria dos casos. além do núcleo. ( ) o longo período de intervalo entre o início da meiose do tecido ovariano (durante o desenvolvimento fetal) e seu término (na ovulação) é a mais provável razão para a incidência aumentada em mães mais idosas. c) senilidade dos ovócitos em mulheres com idade a partir dos 35 anos.

pode-se afirmar que o indivíduo é: a) trissômico. devido a um erro na gametogênese.1 Os quadrados a seguir representam. (64) podem acontecer devido a erros na duplicação do DNA. 1. causadas por não-disjunções cromossômicas.9. onsiderando-se os dados anteriores. (1) As fibras do fuso acromático têm importância fundamental para as migrações cromossômicas características da anáfase. são exemplo de trissomia e de monossomia. numerados de 1 a 6. (16) ocorrem ao acaso. (2) Os erros na distribuição de cromossomos que levam às aneuploidias são freqüentes no processo de meiose e raros nas mitoses. com menor escolaridade e pouca assistência médica.9.9. com a indicação do número de cromossomos autossômicos (A) e dos tipos de cromossomos sexuais (X e Y). Questão 1159 Em uma certa espécie de animal selvagem. (08) estão intimamente ligadas à separação incorreta dos cromossomos na meiose. d) haplóide. (32) ocorrem preferencialmente em populações de menor renda. Questão 1161 1.5. e) monossômico. Entretanto.XY. julgue os itens abaixo. Questão 1160 A figura abaixo esquematiza a não-disjunção cromossômica.1 A respeito desse tema. os machos normais apresentam complemento cromossômico igual a 2n=6. um indivíduo anormal foi identificado na população e seu cariótipo foi representado pela seguinte forma: 1.Sobre as anomalias do número de cromossomos. b) poliplóide. células de seis indivíduos. produzindo doenças graves e até mesmo a morte. (4) As síndromes de Down e de Turner. em esquema.5.5. (3) As aberrações cromossômicas numéricas causam grandes alterações no funcionamento celular. (02) ocorrem mais em meninas do que em meninos.1 260 . (04) ocorrem somente em filhos e filhas de mulheres de idade avançada. c) triplóide. é CORRETO afirmar que: (01) podem ocorrer tanto na espermatogênese quanto na ovulogênese. presentes em cada uma delas.

47 cromossomos. Klinefelter e Turner. Turner e Klinefelter.As mutações transmitidas às gerações futuras são aquelas que ocorrem em células germinativas. c) Turner. é conhecida a trissomia do cromossomo 21 (síndrome de Down). Turner e Down. e) II e III. b) Morgan. Estão corretas as afirmações: a) I. A que se deve esse fato? a) Ao cromossomo X ser um dos menores cromossomos do conjunto haplóide b) Ao cromossomo X ser basicamente formado por heterocromatina com poucos genes estruturais c) Ao cromossomo X não ter uma pequena parte homóloga ao cromossomo Y. apenas. Questão 1165 Considere um segmento de DNA com seqüência de bases indicadas a seguir: TTA TCG GGA CCG ATC ATC GTA A alteração mais drástica que esta molécula pode sofrer é a: a) supressão da segunda base nitrogenada. tais como: presença de um cromossomo 21 a mais. I . tetrassomia e até pentassomia desse cromossomo. 261 .m relação a estes indivíduos. II. d) somente a II e a III. Em relação ao cromossomo sexual X são conhecidos casos de recém-nascidos do sexo feminino com trissomia. tendo apenas um X. a forma e o tamanho dos cromossomos. apenas.Ocorrem para adaptar o indivíduo ao ambiente. e) Klinefelter. o que evita a permuta gênica entre eles d) Aos cromossomos X menos um serem inativados ainda na fase do desenvolvimento embrionário e) Ao cromossomo X ser o cromossomo com maior quantidade de ADN repetitivo. 5 e 6 são normais e pertencem à espécie humana. b) somente a I e a II. o chamado ADN lixo Questão 1164 As alterações do número de cromossomos. e) a I. apenas. o ser vivo reage sofrendo uma mutação gênica. Está(ão) correta(s) a) I apenas b) II apenas. d) substituição das três primeiras bases nitrogenadas por outras.Sempre que o ambiente se torna desfavorável. c) somente a I e a III. A célula do indivíduo 2 pode ser igual a de um gameta do indivíduo 1. II . que é um dos menores cromossomos da espécie. leia as afirmações a seguir. Questão 1163 Na espécie humana. I. determinam. III. II . sendo dois X e um Y e 45 cromossomos. III . O indivíduo 4 pode ser do sexo masculino ou do sexo feminino. c) III apenas. b) II. e) inclusão de mais três bases nitrogenadas no final da molécula. Down e Morgan. b) supressão das três primeiras bases nitrogenadas. Questão 1166 Analise as afirmativas a seguir a respeito das mutações.Ocorrem em células sexuais e somáticas.Podem alterar o número.As mutações ocorridas em células somáticas são de grande valor adaptativo para a perpetuação da espécie. respectivamente. a II e a III. III . apenas. d) I e III. foram feitas as afirmações seguintes. c) substituição da quarta base nitrogenada por outra. e às células representadas. Questão 1162 A respeito das mutações. apenas. Turner e Klinefelter. as síndromes de: a) Down. Os indivíduos 3. I . d) Down. A(s) afirmação(ões) correta(s) é(são): a) somente a II. c) I e II.

seríamos ainda bactéria anaeróbia. b) reprodução.9. b) somente 2. uma adenina sofreu uma desaminação e transformou-se em hipoxantina (H). Questão 1169 "A capacidade de errar ligeiramente é a verdadeira maravilha do DNA. b) o código genético ser repetitivo ou degenerado. e) os genes mutados não serem transcritos ou traduzidos. É ela: a) seleção natural. Errar é humano.3 onsiderando as moléculas III. e) origina somente combinações gênicas adaptativas. Sem esse atributo especial. Questão 1167 A estrutura química de uma proteína poderá ser modificada se a) durante sua síntese houver variação dos tipos de aminoácidos disponíveis no citoplasma celular.). "A medusa e a lesma". d) o código genético não poder sofrer alterações. Mutações podem ocorrer espontaneamente ou serem 262 . 1. de modo que podemos esperar baixa variabilidade na sua população. Questão 1170 Diversas doenças estão relacionadas a mutações no material genético. ed. Questão 1168 A mutação gênica. Porém.. II.. d) somente 3 e 4. base que normalmente emparelha-se com citosina (C). b) ocorre exclusivamente pela ação de agentes mutagênicos. Um par de bases nitrogenadas está identificado. muitas vezes não resultam em substituição efetiva do aminoácido correspondente ao códon mutado na proteína produzida. e) II e III apenas. As cianofíceas reproduzem-se apenas assexuadamente. 2. Esse texto refere-se a uma característica dos seres vivos. c) excitabilidade. d) uma base púrica substituir uma pirimídica no RNA mensageiro que a codifica. e é mais difícil ainda aceitar o fato de que errar é também biológico" (Lewis Thomas. mutações pontuais. c) sua síntese ocorrer no complexo de Golgi e não no retículo endoplasmático rugoso. 1979). c) origina apenas seres recessivos. c) o erro ser corrigido pela célula durante a tradução. e a música não existiria (. c) somente 1 e 2. Após a replicação da molécula I. Questão 1172 Leia as afirmativas a seguir: I. Isto se dá devido ao fato de: a) o código genético ser universal. 3 e 4. d) ocorre devido a alterações na molécula de DNA.5. Questão 1171 O esquema a seguir mostra dois ciclos de replicação de moléculas de DNA. e) mutação. e) o DNA não se duplicar durante a intérfase. mas a idéia não nos agrada muito. d) excreção. nos organismos eucariontes a) constitui a principal fonte de variabilidade genética. Nova Fronteira. e) 1. RJ. a mutação no par de bases indicado estará presente em a) somente 1.d) I e II apenas. com a alteração de apenas uma base nitrogenada. b) durante sua síntese houver variação dos tipos de RNA transportadores. dizemos.

e sem os erros as tentativas não teriam levado a nada. (.) A evolução biológica se dá através de uma grande e inexorável seqüência de tentativas e erros . eles são. c) II e III apenas.9. capaz de destruir um organismo. (Adaptado de DENNETT. Mutações constituem um fator causador de variabilidade. 1997. A característica da mutação. que permite que ela ocorra em grande número de indivíduos.. b) Y.) O processo que se relaciona com o conceito de evolução biológica apresentado pelo autor é: a) reparação das lesões gênicas b) indução de mutações programadas c) geração de organismos transgênicos d) alteração aleatória na estrutura do DNA Questão 1177 As mutações representam um importante mecanismo evolutivo para os organismos. a única oportunidade para aprendermos algo relativamente novo. os cientistas afirmaram que a imunidade está relacionada a uma mutação genética. Questão 1173 Em certo fungo. Entretanto. Daniel C. e MATSON K. respectivamente. somente. As coisas são assim. b) evitar a ação de agentes externos sobre os genes c) representar uma vantagem para a sobrevivência d) ocorrer em resposta à necessidade de adaptação Questão 1175 Durante o processo evolutivo. d) X ou no gene Y. Esses fungos devem ter sofrido mutação no gene a) X. somente. b) I e II apenas. III. Os cientistas consideraram esse percentual muito elevado. das Letras. (Org.. A partir do estudo de um grupo de 1850 pessoas.3 erificou-se que certos fungos mutantes só conseguem sintetizar arginina quando a ornitina é acrescentada ao meio de cultura. Há momentos em que é importante não cometer erro algum . São Paulo: Cia. c) Z. II e III. Uma das conseqüências deste fenômeno está descrita na seguinte alternativa: a) limitação da diversidade biológica 263 1.5. somente. Questão 1174 Recentemente cientistas confirmaram suas suspeitas de que existem pessoas imunes à AIDS. e) X ou no gene Z. de: a) especiação e ortogênese b) mutação e seleção natural c) oscilação genética e epigênese d) variação hereditária e isolamento ecológico Questão 1176 Cometer erros é a chave para o progresso. apresentada por 3% dos pacientes estudados. J.induzidas.. por ter sido transmitida de geração em geração. de forma significativa. é: a) impedir a multiplicação de determinado vírus no interior das células .) os erros não são apenas oportunidades valiosas para aprendermos. pode ocorrer uma alteração permanente numa seqüência de DNA. ocorre a seqüência de reações a seguir esquematizada que leva à síntese do aminoácido arginina. A afirmativa está CORRETA em: a) I. In: BROCKMAN. No entanto (.pergunte a qualquer cirurgião ou piloto de avião. a sobrevivência dos indivíduos de uma determinada espécie depende da estabilidade genética. como aquelas provocadas pelos raios X. Essa alteração na seqüência de DNA e a eliminação do indivíduo são fenômenos que podem ser explicados pela ocorrência.. e) II apenas. d) I apenas.).

1. c) aumenta o número de alelos disponíveis em um locus. em quaisquer das trincas indicadas. 264 . analise a figura a seguir que representa uma população isolada.9. EXCETO a) A introdução de uma adenina (A) entre as trincas indicadas por 2 e 3 pode alterar toda a transcrição a partir desse ponto. Questão 1181 Pode-se afirmar que a mutação a) sempre ocorre para adaptar o indivíduo ao ambiente. c) os genótipos HH e HÞH estão igualmente adaptados ao longo do tempo. Sabendo-se que o continente africano possui alto índice de malária e que o 'Plasmodium malariae' tem dificuldade de sobreviver nas hemácias de indivíduos portadores do genótipo HÞH. d) a variação do meio. c) Seleção natural. e) a seleção natural.3 odas as afirmativas são corretas quanto à seqüência. b) A mutação da 3  base na trinca indicada por 9 pode traduzir um aminoácido diferente. durante um certo tempo. b) aumenta a freqüência de crossing-over. e) Oscilação gênica. d) Recombinação gênica. nesse caso.b) criação de novas variantes de seres vivos c) extinção de espécies nocivas ao ambiente d) produção exclusiva de alterações benéficas Questão 1178 Indivíduos portadores do genótipo HÞH sofrem uma mutação gênica no cromossomo 11 e expressam anemia falciforme ou siclemia. Questão 1179 Observe a seqüência de bases nitrogenadas.5. d) sempre é dominante e prejudicial ao organismo. b) Fluxo gênico. em um período de tempo. em uma população.5. 27 aminoácidos. Com base nas informações apresentadas. pode-se concluir que a) o aumento do número de indivíduos HÞH está diretamente associado ao aparecimento de casos de malária. desfavorece os indivíduos HÞH. o qual é reconhecido pelo anti-códon GCU. em uma determinada região africana que possui casos de malária. b) a elevação do número de indivíduos HH está associada ao aparecimento de indivíduos HÞH infectados.9. a) Mutação. pelo menos.3 1. c) A seqüência pertence a um DNA e pode codificar um polipeptídeo contendo. d) A trinca indicada por 5 pode transcrever um códon CGA. e) A troca da primeira base. prioriza os indivíduos HH. pode resultar na troca do aminoácido respectivo na proteína. Questão 1180 Assinale a alternativa que indica o fator que conduz ao surgimento de variabilidade gênica nova.

isoleucina = TAA. IV. Questão 1185 1. a) I. b) todos de casca vermelha.alanina . c) I.LISINA. As mutações podem ocorrer tanto em células somáticas como em células germinativas. III. ISOLEUCINA .treonina.treonina . c) lisina . para a seqüência de aminoácidos. Esses aminoácidos possuem mais de um códon de DNA. Apenas as mutações que atingem as células germinativas da espécie humana podem ser transmitidas aos descendentes. Dentre eles. II e III. outros de casca vermelha e outros de casca bicolor. Um produtor de maçãs verificou que. b) isoleucina . TGG. ou seja.lisina . I. b) I. II. no qual a parte comestível desenvolve-se a partir do receptáculo da flor. III e V.lisina .ALANINA . TGC ou TGT alanina = CGA.Questão 1182 A coloração vermelha da casca da maçã é determinada geneticamente. e) II. a fita que será transcrita apresenta a seqüência de nucleotídeos TAA TGT CGA TTC e codifica. Somente as mutações ocorridas em células somáticas poderão produzir alterações transmitidas à sua descendência.alanina . Um alelo mutante determina casca de cor amarela. foram apresentadas as cinco afirmações seguintes. e) alguns de casca amarela. CGG. Questão 1184 Vários são os processos que atuam na evolução. d) treonina . apresentava casca com as duas cores. c) todos de casca bicolor.isoleucina.treonina.treonina . um dos frutos. mas apenas causadas por fatores mutagênicos.TREONINA . CGC ou CGT lisina = TTT ou TTC Se ocorrer mutação e a nova seqüência de nucleotídeos for TAT TGT CGA TAA. o único que fornece material genético novo a um determinado conjunto gênico preexistente é a: a) mutação gênica.alanina .lisina. III e V. d) reprodução assexuada. pode-se prever que a seqüência de A respeito das mutações gênicas. b) recombinação gênica.5. ao invés de apresentar casca vermelha. 265 . d) II. V.3 onsiderando-se que. aminoácidos da proteína será a) isoleucina .isoleucina. TAG ou TAT treonina = TGA. como representado na figura. Assinale a alternativa que contém todas as afirmações corretas. tais como agentes químicos e físicos.9. espera-se que as árvores originadas das sementes dessa maçã produzam frutos a) todos de casca amarela. na maçã. independentemente do seu sistema reprodutivo. c) seleção natural. IV e V. III e IV. e) reprodução sexuada. d) alguns de casca amarela e outros de casca vermelha.treonina . em uma determinada macieira. As mutações são fatores importantes na promoção da variabilidade genética e para a evolução das espécies. As mutações não podem ser espontâneas.isoleucina .alanina . o que chamamos de fruto é um pseudofruto. e) lisina . Questão 1183 Em um determinado gene.

Mutações são modificações bruscas do material genético que podem ser transmitidas à prole (descendência ou células filhas). apenas d) 1.Mutação é toda alteração do material genético. c) I. Os principais agentes mutagênicos são as radiações ionizantes e os raios-ultravioleta. a) ATC GAA TAT CTA b) ATG GAA TAT CTA c) AUC UAU AAG GUA d) AUC GAA UAU CUA e) AUG G GAA UAU CUA Questão 1187 Uma experiência realizada com coelhos (linhagem pura selvagem) consistiu em submetê-los a uma descarga excessiva de raio-X. apenas c) 3. apenas b) 1 e 3. e) III. Assinale as afirmações corretas: I . os quais. ela a) só herdará os tumores se tiver ocorrido dano em um gene dominante. especialmente aqueles que possuem potencialidades mutagênicas ou carcinogênicas. 2. Está(ão) correta(s): a) 1. e) tornaram-se estéreis. Caso ele venha a ser pai de uma criança. As mutações do tipo substituição de base acarretam a alteração de vários aminoácidos nas proteínas. que passou de citidina a guanina.Mutações gênicas podem ser causadas por poluentes ambientais e provocar alterações responsáveis pelo aparecimento de genótipos diferentes numa população. c) morte em conseqüência da dose de radiação. Questão 1190 Analise as proposições: 1. podemos esperar várias reações. d) tornaram-se albinos. d) herdará os tumores. A alternativa que contém as afirmações corretas é: a) I e III. o que resultou em pequenos tumores na pele. causados por diversos poluentes ambientais.Questão 1186 Uma bactéria sofre uma mutação pontual em uma região do seu DNA. b) só herdará os tumores se tiver ocorrido dano em dois genes recessivos. III . b) II e III. IV . II e IV. Modificações hereditárias que ocorrem num locus específico são chamadas de mutações gênicas. d) IV e III. b) produção de filhotes anormais. c) só herdará os tumores se for do sexo masculino. Questão 1189 Um surfista que se expunha muito ao sol sofreu danos em seu DNA em conseqüência de radiações UV. 3. e) não herdará os tumores. apenas 266 . 2 e 3 e) 2. podem causar mutações e doenças nas gerações futuras. Questão 1188 Atualmente são bem conhecidos os efeitos adversos à saúde humana. EXCETO: a) produção de um filhote albino. Indique o RNA mensageiro codificado pela seqüência de DNA mutada. que era: TAC CTT ATA GAT Ocorreu uma mudança na terceira base. II . devido à sua interação com mecanismos genéticos. Após o experimento.A mutação pode ser espontânea ou induzida por agentes físicos. que resulta sempre de segregação ou recombinação cromossômica. químicos ou biológicos com potencial mutagênico. pois houve dano no material genético.

c) 2. a utilização de câmaras de bronzeamento artificial.600 Angstrons. o que reduzirá a mortalidade infantil em pelo menos um terço. queimaduras. e) produza anticorpos mais rapidamente. O corpo. recentemente.500 Angstrons.4 Considerando a ação desses raios na célula. a serem cumpridas até o ano 2.800 Angstrons. b) um medicamento eficaz no combate à doença já instalada e que produza no corpo uma reação para a fabricação de anticorpos específicos e resistentes. c) é herdável. porque a mutação resultante é recessiva. porque provoca alteração em células germinativas. como resposta imune. produziu anticorpos específicos.700 Angstrons. porque provoca alteração em células somáticas. d) o plasma.V. criados em laboratório. c) não produza mais anticorpos. e) 2. a imunização de 90% das crianças. apresentou. com duração de 15 a 30 minutos cada uma. Questão 1192 O gráfico mostra o espectro de absorção de raios ultravioleta (U. envelhecimento precoce e câncer de pele.) por uma proteína e por um ácido nucléico. e) é herdável. quatro meses depois.5. espera-se que o organismo: a) reaja da mesma forma como reagiu à primeira dose. b) não é herdável. porque provoca alteração do DNA. Pode-se afirmar que esse tipo de câncer a) é herdável. EXCETO: a) pâncreas b) amídalas c) baço d) timo e) gânglios linfáticos Questão 1195 1. e) o soro obtido através do sangue de animais. Uma mulher que se submeteu a dez sessões intercaladas de bronzeamento. por estar imunizado. Questão 1193 Os meios de comunicação têm noticiado que a Unicef (Fundo das Nações Unidas para a Infância) estabeleceu como uma das metas. indícios de câncer de pele. for aplicada uma segunda dose do mesmo antígeno.Questão 1191 A ANVISA (Agência Nacional de Vigilância Sanitária) normalizou. como os cavalos. Um organismo recebeu uma primeira dose de um antígeno X e. retirado de pessoas que já tiveram a doença. que consiste em injetar no organismo: a) vírus ou bactérias vivas para provocar a doença de forma branda. após algum tempo. porque a mutação resultante é dominante.400 Angstrons.000. reconhecidos pelo corpo como antígenos. Questão 1194 Todas as estruturas citadas a seguir podem ser ligadas à defesa do organismo. onde recebem grande quantidade de antígenos. d) 2. d) não é herdável. tais como lesões na retina. uma vez que as radiações UV danificaram seu DNA. visando diminuir os riscos dessa prática. é necessária a vacinação. o comprimento de onda em que será obtida maior taxa de mutação é a) 2. d) não consiga reagir a essa segunda dose. imunizado. c) vírus ou bactérias mortos ou atenuado que. 267 . Se. produzirá antígenos específicos. induzam a produção de anticorpos específicos. b) 2. Para que esta meta seja atingida. para que o corpo produza antígenos e anticorpos específicos.9. b) reaja sem utilizar seus anticorpos.

em duas crianças durante um certo período de tempo. c) o recém-nascido não produz anticorpos. Assinale a alternativa que esclarece o erro: a) é que vírus do tipo "A" não sofre efeito de vacina alguma b) é que a vacina não combate vírus.10 Questão 1197 Leia com atenção a tirinha de Frank & Ernest A análise do gráfico permite concluir que 1. somente doenças causadas por bactérias c) é que a vacina não combate vírus. você deverá procurar recurso através de a) vacina.5. os anticorpos.10 a) na época do nascimento a criança não está protegida. b) antes do nascimento o feto nunca produz anticorpos. e) após o nascimento a criança depende dos anticorpos maternos. portanto ela não pode destruir o que a produz e) é que o vírus impede a ação da vacina. b) soro. c) vacina. d) soro. Questão 1199 1.10 1. embora já esteja produzindo os seus. porque estimula o organismo a produzir anticorpos. inibindo a sua atividade de defesa. porque estimula o organismo a produzir anticorpos.5. 268 . porque já contém anticorpos. no caso o vírus "A" d) é que a vacina é feita de vírus. que é o sistema "chave-fechadura" Questão 1198 Ao ser picado por uma cobra peçonhenta. que são específicos aos seus antígenos. e) vacina. porque contém antígenos específicos. ela proporciona ao nosso organismo produzir defesas. O gráfico que melhor representa as taxas de variação da quantidade de anticorpos nas crianças I e II é: Existe um erro de fundamento biológico na historinha da tirinha.Questão 1196 A variação da quantidade de anticorpos específicos foi medida por meio de uma experiência controlada.5. Para a imunização de cada uma das crianças foram utilizados dois procedimentos diferentes: Criança I: aplicação de soro imune Criança II: vacinação. d) após o nascimento a criança depende completamente dos anticorpos maternos. pois produz poucos anticorpos. pois não produz os próprios anticorpos. porque já contém anticorpos.

06. De acordo com o gráfico. que se reproduzem e fabricam grande quantidade de histaminas. que reagem liberando histaminas. Se após certo tempo for aplicada uma segunda injeção da toxina no animal. Confirmada a presença do vírus causador da raiva em um morcego apreendido em uma praça no centro da cidade. d) ligam-se aos anticorpos e migram para os órgãos imunitários primários onde são destruídas. (Portal da Prefeitura Municipal de Botucatu. espera-se que ele a) não resista a essa segunda dose. a injeção de uma toxina bacteriana e manifestou a resposta imunitária produzindo a antitoxina (anticorpo). produzindo menos anticorpos. recebeu outra dose. nos gânglios linfáticos. Questão 1201 DETECTADO FOCO DE MORCEGO COM RAIVA EM BOTUCATU. no final do mês de julho. A Secretaria Municipal de Saúde registrou mais um caso de morcego positivo para raiva na cidade de Botucatu. e) reaja na segunda vez. d) não produza mais a antitoxina por estar imunizado. quando foi visto por estudantes. c) antecipar a vacinação anti-rábica de cães e gatos nas regiões onde os morcegos foram encontrados. Questão 1203 A alergia é uma hipersensibilidade desenvolvida em relação a determinadas substâncias. e) produza menor quantidade de antitoxina. A reação alérgica ocorre quando as moléculas do alergênico a) ligam-se a moléculas do anticorpo presas à membrana dos mastócitos. c) produza anticorpos mais lentamente na segunda dose.Questão 1200 Analise o gráfico que se segue. e) desconsiderar o ocorrido e informar a população que não tenha receio. O morcego doente era da espécie que se alimenta de frutas. o procedimento mais adequado que deverá ser tomado pelas autoridades da referida cidade será a) promover campanha para localização e eliminação das colônias de morcegos nas áreas urbana e rural. O segundo caso na Vila Antártica. d) promover campanha para a vacinação anti-rábica da população humana. b) demore mais tempo para produzir a antitoxina. na região central da cidade. (Portal "Estadão". espera-se que o organismo a) reaja mais rapidamente na segunda dose. O animal foi encontrado caído em uma praça nas proximidades do centro. 269 . 06. que são reconhecidas por um tipo especial de anticorpo.08. Este é o terceiro caso de raiva em morcego registrado este ano em Botucatu. 18. os alergênicos. O morcego encontrado é da espécie 'Myots sp' e alimenta-se de insetos. Questão 1202 Um coelho recebeu. d) reaja sem produzir anticorpos. pois apenas os morcegos hematófagos. c) são reconhecidas pelas células de memória. pois já está imunizado. b) medicar com antibióticos específicos os animais domésticos que tenham entrado em contado com os morcegos. O primeiro foi notificado no início do mês de junho. b) não consiga reagir a uma segunda dose.5. 1. b) desencadeiam. mas não os frugívoros ou insetívoros. e) são fagocitadas pelos mastócitos e estimulam a fabricação das interleucinas. uma grande proliferação de linfócitos específicos. O animal estava caído e se debatendo.2006) Para se evitar a contaminação da população humana com o vírus da raiva.10 m organismo recebeu uma dose de um antígeno X e. representam risco de transmissão da raiva.2006) MAIS UM CASO DE MORCEGO POSITIVO PARA RAIVA NA CIDADE DE BOTUCATU. SP. c) produza a antitoxina mais rapidamente. após algum tempo. pela primeira vez.

b) só pode ser feita contra as formas mutantes do HIV. c) A imunização garantida pela administração do soro. e) um patógeno vivo enfraquecido ou partes dele. pode-se concluir que a fabricação da vacina anti-AIDS a) apresenta os mesmos problemas que a da vacina contra a gripe. a) As reações alérgicas e a alta mortalidade provocada pela aplicação do soro. assinale aquela que contém argumento válido e que explica a menor procura por antivenenos no Brasil. Das alternativas a seguir. Questão 1208 Observe a figura a seguir. b) O êxodo rural e a maior concentração da população humana em centros urbanos. que se multiplicam no corpo do indivíduo que recebe a vacina. Questão 1207 "Os cientistas examinaram 11 homens aidéticos. foi fundado por Vital Brazil. Segundo o Instituto "a demanda da produção de antivenenos vem diminuindo gradativamente no Brasil.10 270 . Questão 1206 Consideramos uma vacina um material que contém: a) anticorpos contra determinado patógeno. d) é fácil de ser efetuada. 1. e) Falta de animais com características adequadas para a produção do soro. e) certamente deverá estar no mercado dentro de pouco tempo. famoso pelo seu serpentário. dos quais 5 nunca tinham usado medicamentos anti-HIV e 6 haviam usado.Questão 1204 Uma lesão na pele pode infeccionar. mas não causar a doença. d) células brancas produzidas por animais. respectivamente. capaz de estimular a resposta imunológica. em fevereiro de 1901. b) anticorpos contra determinado patógeno produzidos por outro animal e que fornecem proteção imunológica. Sendo assim. b) euritrócitos e pinocitose. Os termos destacados referem-se. Hoje é um centro de pesquisa reconhecido mundialmente na área de biomédicas produzindo diversos tipos de soros antitóxicos e antivenenos. é possível oferecer os seus soros para outros países". protegendo o organismo. c) soro de indivíduos previamente imunizados contra aquele patógeno. quando aparecem CÉLULAS DE DEFESA que ATRAVESSAM OS CAPILARES e caem no tecido conjuntivo. d) Falta de veneno em quantidade suficiente para a obtenção do soro. resistentes às drogas ministradas e passíveis de serem transmitidas a outras pessoas. para a produção de soro no combate à epidemia de peste bubônica. c) precisa ser feita contra a forma normal do HIV. aos a) trombócitos e fagocitose.5. tendo em vista a estabilidade do HIV." Pela análise do texto. d) neutrófilos e clasmocitose. que estimulam a resposta imunológica do indivíduo. Questão 1205 O Instituto Butantã. c) leucócitos e diapedese. Verificaram que 8 pacientes apresentavam novas mutações do vírus.

III. pois fornece para o hospedeiro a informação genética necessária para que ele fabrique o antígeno preservando todas as suas características importantes na indução de uma resposta imune eficiente. pois não determinam imunidade e sim doenças. induzindo a formação de anticorpos. 1984. EXCETO uma. Assinale-a. Os antígenos produzidos pelo DNA plasmidial são capazes de combater patógenos que infectem o hospedeiro. d) O gráfico acima exemplifica ação das vacinas. Fonte: Bier. 1999.) Com base no texto. Otto. assinale a afirmativa INCORRETA. II. Questão 1209 Os anticorpos são proteínas específicas de defesa do corpo. que representa a atividade de células T citotóxicas. a) A toxina diftérica funciona para o cavalo como uma vacina. O processo envolve a inoculação direta do DNA plasmidial. que será expressa e produzida no interior das células do indivíduo. b) A injeção de toxina na cobaia B é utilizada como controle. Questão 1211 Em relação à figura a seguir. pode-se fazer todas as afirmações. EXCETO: a) Doenças diferentes em intervalos menores de tempo provocariam a mesma intensidade de produção de antígenos. mas é de longa duração. que possui o gene codificador da proteína antigênica.tapas na preparação do soro terapêutico. foram feitas as seguintes afirmações: I. MICROBIOLOGIA E IMUNOLOGIA. para verificar a atividade letal da toxina na ausência do soro.5. A imunidade desenvolvida pela vacina de DNA não é imediata. diphtheriae'. em intervalos diferentes. c) A injeção de antitoxina e de toxina na cobaia A é usada como controle para testar a eficácia da primeira na inativação da segunda. O indivíduo geneticamente vacinado passa a produzir tanto os antígenos quanto os anticorpos. São afirmações CORRETAS: a) I e II b) II e IV c) III e IV d) I e III 1. e) Para o sistema imunológico da cobaia A. a antitoxina diftérica é um corpo estranho. Questão 1210 A vacina de DNA é a mais recente forma de apresentação de antígeno que veio revolucionar o campo da vacinologia. IV.10 correto afirmar. Esse tipo de vacina apresenta uma grande vantagem sobre as demais. "Scientific American". Isso sem gerar os efeitos colaterais que podem aparecer quando são utilizados patógenos vivos. ou os problemas proporcionados pela produção das vacinas de subunidades em microorganismos. 271 . b) A dose de reforço provoca produção maior e mais rápida de anticorpos. c) O tipo de imunização explicitado é ativa. d) Um animal imunizado com toxina diftérica está protegido da infecção por 'C. Patógenos vivos não podem ser usados como vacina. Em relação aos procedimentos observados na ilustração anterior. (Fonte: Desenvolvimento de vacinas gênicas. O gráfico a seguir representa o resultado de duas aplicações de mesmo antígeno.

d) A degradação ou lise da célula infectada não necessita do reconhecimento e da fixação da célula T citotóxica. em Paris. Esses venenos podem apresentar ação neurotóxica. e células de memória. d) Descamar da epiderme .1. que produzem anticorpos e têm vida longa. d) tomar vacina como mecanismo de prevenção ou usar soro de preferência polivalente em caso de picada acidental. b) As células T citotóxicas matam células que apresentam antígenos na superfície por meio da secreção de perforinas e linfotoxinas. d) O ciclo vital desse parasita envolve um curto período na corrente sangüínea. c) aparar a grama dos jardins e recolher folhas caídas. Questão 1212 As defesas inatas dos organismos são geralmente mecanismos de proteção que inibem a entrada ou o desenvolvimento de organismos causadores de doenças. bastando que esta esteja ativada. apresentando o mesmo antígeno. Os pesquisadores ainda precisam realizar mais duas fases de testes clínicos antes de confirmar a eficácia da fórmula. Questão 1213 Aranhas e escorpiões podem apresentar efeito peçonhento ao homem. moscas e outros insetos. Em uma pessoa 272 . um linfócito ativado produz dois tipos de células-filhas: células efetoras. dizem ter realizado com sucesso a primeira fase de testes clínicos (em humanos) de uma vacina contra a malária. que realizam o ataque e morrem. c) As células T citotóxicas podem atacar algumas células tumorais. que destrói bactérias. a) O objetivo do uso da vacina é ativar o sistema de defesa do organismo contra invasores através da produção de anticorpos. Aplicada em 36 voluntários saudáveis. necrosante. cardiotóxica. c) Lágrima .previnem a entrada de patógenos e substâncias estranhas.lubrifica e limpa. a fórmula induziu a produção de anticorpos contra a doença. Questão 1215 A memória imunológica e imunidade resultam da seleção clonal. c) Apesar de muito antiga. b) Se o organismo apresentar imunidade positiva contra o parasita. a) Fagócitos . Segundo Druilhe e seus colegas. hemolítica. uma fase de invasão e diferenciação nos hepatócitos e uma fase intra-eritrocítica. contém lisozima. Questão 1214 a) Após efetuar um "ataque letal". trata-se do "primeiro teste clínico de uma vacina contra a malária a demonstrar claramente sua atividade contra o parasito".10 a) colocar lixo em sacos plásticos e mantê-los bem fechados para não atrair baratas. Assinale a alternativa que NÃO apresenta a relação correta entre o fator de defesa e sua função. O controle e prevenção de acidentes com esses animais podem ser feitos tomando-se os seguintes cuidados.prendem microorganismos no trato digestivo e respiratório. b) manter limpos quintais. do Instituto Pasteur. os quais se mostraram capazes de atacar o parasito 'Plasmodium falciparum'. uma célula T citotóxica pode separar e atacar outra célula-alvo.opõe-se à colonização da pele por alguns patógenos.5. a malária continua sendo um dos principais problemas de saúde pública no mundo. jardins e terrenos baldios. b) Secreções mucosas . 09/11/2005) Assinale a afirmativa INCORRETA. (Fonte: "Folha de S. pode-se afirmar que a vacina foi eficaz contra todos os parasitos do mesmo filo. células de tecidos transplantados e células infectadas por vírus. Paulo". não acumulando entulho e lixo doméstico. De acordo com a teoria clonal. EXCETO: VACINA RESISTE A PARASITO DA MALÁRIA Pesquisadores liderados por Pierre Druilhe.

vacinada contra uma possível infecção. d) circulação linfática. EXCETO: a) Ativação de resposta imune primária e produção de clones de células efetoras e de memória pelos linfócitos. Seja como for. a DM43 e a DM64 parecem especificamente talhadas para neutralizar os principais efeitos do veneno das serpentes da família das viperídeas. 1. São glicoproteínas que apresentam estrutura parecida com a de substâncias do sistema de defesa do organismo. Agora. repetidas vezes. Questão 1217 Compartilhamos o ambiente com uma série de microorganismos que podem causar infecções nos seres humanos. podem-se observar os seguintes eventos. b) eosinófilos e eritrócitos. que controlam lentamente o invasor. São Paulo: Saraiva. S. Questão 1216 "Por décadas os cientistas tiveram de quebrar a cabeça para criar antídotos contra o veneno das cobras. responsáveis por 90% dos 20 mil acidentes anuais com cobras no Brasil.Paulo". que se alimentam de serpentes. respectivamente: a) linfócitos e basófilos.1999. b) Essa resistência dos gambás ao veneno de serpentes viperídeas é determinada geneticamente. Questão 1218 Uma pessoa que tivesse seriamente comprometida a atividade dos plasmócitos teria problemas com a a) produção de anticorpos. é INCORRETO afirmar: a) A imunidade dos gambás sul-americanos ao veneno das jararacas foi naturalmente selecionada. d) eritrócitos e macrófagos. 273 . e) produção de toxinas. há uma fase de espera antes de o número de moléculas de anticorpos e células T aumentar. a um mesmo tipo de antígeno (ex. Analisando o texto e de acordo com seus conhecimentos. Questão 1219 O gráfico a seguir exemplifica como a exposição de um homem normal. c) Os linfócitos de gambá reagem a picadas das jararacas produzindo soro antiofídico que pode ser letal para as cobras. embora elas mesmas não sejam anticorpos. 30/08/2005.5. b) Maior e mais rápida produção de anticorpos específicos em casos de encontros subseqüentes com o mesmo antígeno. e) leucócitos e linfócitos. após um certo espaço de tempo. Pesquisadores da Fundação Oswaldo Cruz identificaram no sangue dos gambás duas moléculas. uma resposta do organismo. b) circulação venosa. A primeira molécula se opõe à ação dos compostos do veneno que causam forte hemorragia na vítima ao impedir a formação de coágulos. c) macrófagos e linfócitos.: vírus) provoca. c) produção de uréia.10 onte: LOPES. c) Na primeira exposição ao antígeno." Fonte: Extraído da Reportagem: Sangue de gambá contém soro antiofídico do Jornal "Folha de S. Bio. DM43 e DM64. d) Um dos componentes do veneno da jararaca poderia ser útil na prevenção de tromboses. As nossas células de defesa exercem o seu papel por meio da fagocitose e da produção de anticorpos. que têm função antiofídica. descobriram que uma solução potencialmente melhor foi 'desenvolvida' ao longo de milhões de anos pelos gambás sul-americanos. entre as quais se incluem as jararacas. com produção de células efetoras e de memória. São exemplos destas células. d) Promoção imediata de resposta imune secundária. enquanto a outra neutraliza as substâncias que matam as células musculares de quem é picado.

10 odemos atribuir esta resposta do organismo ao fenômeno de memória imunológica. contidos no plasma de pessoas contaminadas há muitos anos. d) as interleucinas inibem a proliferação de macrófagos e linfócitos T citotóxicos. d) linfócitos. as primeiras células a serem ativadas. multiplicam-se e diferenciam-se. de modo que a) os macrófagos. Havendo incompatibilidade entre o doador e o receptor de um órgão ou tecido condicionado pelo MHC. estimulados por substâncias produzidas pelos linfócitos T auxiliares.Questão 1221 Um novo tipo de tratamento da AIDS começou a ser testado no Brasil e consiste em transmitir anticorpos anti-HIV. dando início à imunidade humoral. d) quimioterapia. na maioria das pessoas.5. mas sem os sintomas da doença.10 s resultados acima permitem chegar à seguinte conclusão em relação a esse soro: a) na época do nascimento há presença de IgG materna b) durante a gestação diminuem os níveis de IgG fetal c) durante a gestação os níveis de IgG independem da produção fetal d) após o nascimento diminuem os níveis de IgG produzida pelo recém-nascido . ligam-se aos anticorpos e iniciam suas ações fagocitária e secredora. que tem como conseqüência: a) o aumento da produção de anticorpos b) a inibição da produção de anticorpos c) o aumento da produção de antígenos d) a inibição da produção de antígenos Questão 1220 A produção de imunoglobulinas por células do sistema imunitário constitui um dos mecanismos de defesa do organismo contra infecções. Questão 1222 A urtiga é um vegetal que provoca. b) imunoterapia passiva. participando assim da imunidade celular. Questão 1223 As principais moléculas responsáveis pela resposta imune aos transplantes de órgãos e tecidos são os antígenos do Complexo Principal de Histocompatibilidade (MHC). 1. para pessoas aidéticas sintomáticas. uma forte reação alérgica. e o sistema imune do receptor responde.5. Uma série de tipos celulares é responsável pelas reações alérgicas e por outros tipos de hipersensibilidade imune. b) eritrócitos. Tal tratamento. diferenciam-se em plasmócitos. será desencadeada uma reação. produzindo assim uma quantidade maior de anticorpos. c) eosinófilos. denomina-se a) imunoterapia ativa. principais responsáveis pela 274 1. b) os linfócitos T. após reconhecerem os antígenos apresentados pelos macrófagos. c) profilaxia. c) os linfócitos B. O gráfico abaixo demonstra os níveis de imunoglobulina G (IgG) no soro do feto e do recém-nascido. e) vacinoterapia. e) mastócitos. cuja intenção é fortalecer a defesa desses indivíduos. EXCETO a) basófilos.

novas tecnologias para comunicação evidenciam o progresso no século XXI. fraldas sujas coqueluches. ao provocar nos indivíduos do sexo masculino o aumento da produção de urina. até mesmo.gov/shuttle/archives/ sts-74/orbit/payloads/lifes/regimmun.html Se ao final da experiência mencionada for demonstrado que a resposta imunológica humoral diminui durante os vôos espaciais. b) anticorpos que persistirão ativos por toda a vida do receptor. Hoje. c) drogas capazes de aumentar a resistência à infecção.rejeição.. e) a ciclosporina age no processo de rejeição. Ao lado da política e da economia. Traduzido e adaptado de: http:// spaceflight. no mundo globalizado. a revolução tecnológica avançava como conseqüência. Entretanto. a ser realizada na Terra e no espaço. conclui-se que. d) microorganismos ou produtos deles derivados que induzirão a formação de anticorpos. campeões do capitalismo. ( ) podem ser prevenidas pela aplicação de vacinas na primeira fase da vida ou tratadas com medicamentos adequados. Questão 1226 As vacinas utilizadas nas campanhas de imunização em massa são constituídas de a) anticorpos que destruirão o agente infeccioso específico. A experiência. normalmente. Pesquisas biológicas vêm sendo desenvolvidas com os tripulantes dos vôos espaciais. A corrida espacial foi um dos aspectos dessa concorrência. genoma. um novo século. suprimindo os linfócitos B. Mais conforto. e) soros obtidos de animais que neutralizarão os antígenos específicos. ao mesmo tempo em que socialismo e capitalismo disputavam o predomínio na produção e nos mercados. nessas condições. sem deixar o paciente vulnerável a infecções. iniciou-se um novo período na história da humanidade. A Guerra Fria foi o resultado óbvio dessas tensões e disputas. Cai o império soviético. ocorre menor: a) fagocitose do antígeno mediada pelos linfócitos B b) produção de anticorpos pelos linfócitos T citotóxicos c) produção de imunoglobulinas pelos neutrófilos d) produção de anticorpos mediada pelos linfócitos B e) produção de imunoglobulinas pelos macrófagos Questão 1225 "Onde não há cozinhas pratos por lavar vigílias. sarampos" são alterações no bem-estar físico do indivíduo que. Estas doenças ( ) são transmitidas por vírus e enquadram-se no grupo das que causam desidratação. clonagem. o conhecimento humano não tem fronteiras nem limites: DNA. ( ) comprometem os nódulos linfáticos das virilhas. campeã do socialismo. José Paulo Paes) ". sarampos. tem o objetivo de estudar até que ponto o sistema imunológico se altera durante vôos espaciais. coqueluches. 275 .nasa. ( ) são típicas das regiões úmidas e frias e têm como vetores insetos do gênero 'Anopheles' sp. Esse desejo fez com que rapidamente se transferissem para o cotidiano dos homens os resultados práticos das inovações de guerra. passou a existir o desejo do bem-estar e do conforto mostrar onde se vivia melhor era fundamental. Vencido o perigo nazista. realizada por pesquisadores da NASA. enfrentaram-se as duas forças hegemônicas do pós-guerra: os Estados Unidos da América. novas comodidades. da concorrência entre esses dois países. e a URSS. A comparação dos resultados obtidos poderá indicar o quanto a resposta imunológica estará afetada. Uma dessas." ("Outro retrato". Questão 1224 Com o final da 2 Guerra Mundial. sem suprimir o sistema imunológico do receptor.. aparecem na infância. alterações nos comportamentos sinalizaram um novo tempo. consiste na análise de amostras de sangue e saliva antes e após a injeção de um determinado antígeno.

Questão 1231 O sistema imunitário. Em relação a esse sistema. b) o código genético do patógeno é igual ao do camundongo. ou ainda células como as cancerosas. c) induzem resposta imunológica. os macrófagos. podemos afirmar que: ( ) nos nódulos linfáticos e no baço. como a maioria das bactérias. Questão 1230 Há um número muito grande de organismos causadores de infecções. estes estimulam os linfócitos B a produzirem interferons. o organismo humano dispõe de diferentes mecanismos de defesa. a vacina contra pneumonia pneumocócica. d) o mRNA do antígeno do patógeno é traduzido em II. perduram no organismo e podem desencadear a resposta imune com mais rapidez. ( ) contra patógenos extracelulares. Questão 1229 Para o controle das infecções. ( ) Após um primeiro contato com um vírus X (2). d) impedem mutações dos patógenos. instituída pelo Ministério da Saúde do Brasil. b) contêm anticorpos específicos. também.10 ( ) Ao primeiro contato com um vírus X (1) . anticorpos em nível neutralizador suficiente para inativar o vírus. por exemplo (Y). c) o antígeno do patógeno é produzido pelo camundongo em I. os postos de saúde estão aplicando. proteínas que se ligam 1. ( ) linfócitos T podem adquirir ação citotóxica e destruir células infectadas por vírus. Questão 1228 A Campanha Nacional de Vacinação do Idoso.10 especificamente a determinados antígenos. ( ) Em (2) ilustra-se a resposta imunológica do organismo a uma infecção bacteriana. é correto afirmar que: onsiderando-se os processos de imunização representados. um organismo infectado por uma bactéria X produzirá mais antígenos em (2) do que em (1). que atua no combate a infecções. o organismo ativa seus linfócitos T citotóxicos. ( ) Devido à elevada especificidade da reação antígeno-anticorpo. muito ativos no combate a patógenos externos. são produzidas células apresentadoras de antígenos.Questão 1227 Analise estas figuras: 1. Além da vacina contra a gripe.5. contra as quais o homem dispõe de um vigilante exército para a sua defesa. ( ) as chamadas "células de memória" surgem da diferenciação de linfócitos T e B. ( ) os linfócitos B transformam-se em plasmócitos. É CORRETO afirmar que essas vacinas protegem porque a) são constituídas de moléculas recombinantes. imediatamente. Com relação a este tema. podemos afirmar que: 276 . é constituído por diferentes tipos de glóbulos brancos e pelos órgãos responsáveis pela produção e maturação desses glóbulos. ( ) Em (1) ilustra-se a resposta primária do organismo após um primeiro contato com um vírus X.5. se o organismo continuar a produzir anticorpos em quantidades elevadas. células produtoras de anticorpos. vem-se revelando uma das mais abrangentes dirigidas à população dessa faixa etária. enquanto em (1) mostra-se o efeito da pós infecção viral. Com relação ao sistema imunológico humano. diz-se que ele adquiriu imunidade humoral. é INCORRETO afirmar que a) os anticorpos são produzidos tanto em I quanto em II. o organismo reage e produz.

se diferenciam em plasmócitos que produzem anticorpos e participam da memória imunológica...... para atendimento. em virtude de uma picada de serpente peçonhenta... ( ) Os linfócitos T e B originam-se no timo e depois migram para a medula óssea.( ) Os macrófagos fagocitam elementos estranhos e imobilizam resíduos na membrana. a) vacina (porque contém antígenos) e soro (porque contém anticorpos) b) soro (porque contém antígenos) e vacina (porque contém anticorpos) c) vacina (porque contém anticorpos) e soro (porque contém antígenos) d) soro (porque contém anticorpos) e vacina (porque contém antígenos) Questão 1235 Quando uma pessoa é picada por um animal peçonhento... muitas vezes por períodos bastante longos. porque contém anticorpos prontos.. d) vacina.. Questão 1236 Assinale a alternativa que preenche corretamente as lacunas do texto a seguir. Em relação às características dos anticorpos. Uma possível explicação é que o brasileiro . onde podem se multiplicar ao detectarem elemento estranhos ao organismo. a outra. deve procurar socorro através de a) soro.se alimenta de nutrientes ricos em ferro 277 .se alimenta de nutrientes ricos em ferro c) albuminas . quando estimulados. é correto afirmar: (01) São capazes de neutralizar toxinas bacterianas. ( ) Os linfócitos B. para eliminar quimicamente o veneno. ( ) Os macrófagos são responsáveis pela secreção de histamina. componentes do nosso sistema de defesa. extraídas do plasma de europeus ficam na faixa de 3 gramas por litro.. a) imunoglobulinas .. Sabe-se que a produção de certos hemoderivados se vale de material retirado do plasma. causando vermelhidão e edema nos processos inflamatórios. (04) São produzidos somente pela vacinação. 28 jul. (32) São capazes de imobilizar os microorganismos. porque fornecerá ao organismo elementos de defesa. estimulam os linfócitos B a produzirem anticorpos e eliminam células anormais. b) soro. ( ) Linfócitos T reconhecem antígenos nas membranas de outras células. (16) São dotados de memória imunológica... as dos brasileiros situam-se na faixa de 5.. (02) São capazes de neutralizar os vírus. na ordem em que ocorrem. O que o relatório mostra é que. que induzirá a formação de anticorpos. Indique o que deve ser aplicado em cada criança. fixando-se temporariamente no ducto toráxico. c) soro. Soma ( ) Questão 1234 Duas crianças foram levadas a um posto de saúde: uma delas... a) Uma partícula b) Um organismo c) Uma molécula d) Uma célula e) Um patógeno Questão 1233 Os anticorpos. estimulando os linfócitosT. e permanecem na corrente sangüínea prontos para nos proteger da ação de patógenos.está exposto a uma maior variedade de organismos patogênicos b) hemácias .. O relatório da Polícia Federal sobre a Operação Vampiro traz uma informação no mínimo irônica sobre o sangue dos brasileiros. são proteínas sintetizadas para combater agentes externos (bactérias e vírus. porque é composto por antígenos específicos. a qual provoca vasodilatação. RESPECTIVAMENTE. 2004. .2 gramas por litro.. Questão 1232 Assinale a alternativa que melhor descreve um anticorpo. e) vacina. enquanto as .. Os anticorpos também são capazes de proteger o embrião humano. (08) Podem atravessar a barreira placentária. para se prevenir contra poliomielite. Adaptado de: "Veja". na vida intra-uterina.. por exemplo) ou seus produtos. especialmente nos macrófagos. produzem interleucinas.

Vacinar consiste em injetar no organismo: a) microrganismos vivos para provocar a doença de forma branda. em média. d) vacinação. c) é um antibiótico. a) Apenas I e II são corretas. Marque a alternativa correta. onde recebem grande quantidade de antígenos. e) possui antígenos específicos.Alguns tipos de leucócitos (glóbulos brancos) atravessam as paredes dos capilares por diapedese e deslocam-se pelo tecido. 278 1. . pois as pessoas desenvolvem anticorpos contra os antígenos atenuados. retirado de convalescentes. reconhecidos pelo corpo como antígenos. c) aplicação do soro. c) microrganismos mortos ou atenuados que. resultado da ativação dos mecanismos naturais de defesa do organismo. b) aplicação do soro. Questão 1237 As ilustrações a seguir (a. Questão 1238 O soro antiofídico é ministrado em pessoas picadas por cobra peçonhenta porque: a) induz a formação de anticorpos.tende a apresentar o baço com tamanho aumentado e) imunoglobulinas . criados em laboratório.2004) noticiou que a quantidade de imunoglobulina extraída do sangue dos europeus é. Questão 1241 A revista "Veja" (28. produzidos pelo organismo de um animal. e) o soro obtido através do sangue de animais. c) Apenas II e III são corretas.5.10 Analise as afirmativas a seguir: I . Questão 1240 Os agentes infecciosos penetram no corpo das pessoas através dos ferimentos e das mucosas. que tem efeito terapêutico. já prontos.2 gramas por litro. d) provoca imunização. b) uma substância que combata a doença já instalada e que produza no corpo uma reação para a fabricação de anticorpos resistentes.O tecido lesado libera sinais químicos (histamina e prostaglandinas) que promovem a dilatação dos vasos na área lesada. b) I. enquanto a extraída do sangue dos brasileiros é de 5. que é um processo ativo de imunização preventiva e duradoura.tende a apresentar o baço com tamanho aumentado. II e III são corretas. d) o plasma. b) contém anticorpos. e) vacinação.07. b e c) representam o que pode acontecer quando uma lesão na pele permite a entrada de bactérias que causam infecção. fagocitando os microorganismos patogênicos. induzam a produção de anticorpos específicos.A inflamação é uma resposta imune do corpo. O corpo imunizado produzirá antígenos específicos.d) albuminas . que é a imunidade adquirida de ação menos duradoura que o soro e de emprego terapêutico. II . A incidência de doenças causadas por estes agentes infecciosos poderá ser reduzida. de 3 gramas por litro. III . na tentativa de destruir agentes invasores. para que o corpo produza então os antígenos específicos. como os cavalos. Questão 1239 Os meios de comunicação têm convocado dentistas e outros profissionais da saúde para a vacinação contra a hepatite B. submetendo-se as pessoas à a) aplicação do soro. quando o agente infeccioso provoca uma doença de evolução muito rápida e não há tempo para a imunização ativa. d) Apenas I é correta. ocasião em que o indivíduo recebe anticorpos.

Assinale a hipótese que pode explicar corretamente a causa de tal diferença. a) Os europeus tomam maior quantidade de vacinas ao longo de sua vida. b) Os brasileiros estão expostos a uma maior variedade de doenças. c) Os antígenos presentes no sangue do europeu são mais resistentes. d) Os anticorpos presentes no sangue do brasileiro são menos eficientes. e) Os europeus são mais resistentes às doenças que os brasileiros. Questão 1242 A partir do recente surto de sarampo na cidade do Rio de Janeiro, o governo decidiu iniciar uma campanha de imunização das crianças. A imunização contra diversos tipos de doenças é atingida através de vacinação, que consiste em injetar no organismo: a) o soro obtido através do sangue de animais criados em laboratório, como macacos, onde recebem grande quantidade de antígenos e anticorpos específicos. b) o plasma retirado de pessoas que já tiveram a doença, para que o organismo produza antígenos e anticorpos específicos. c) um agente químico eficaz no combate a doença já instalada e que produza no corpo uma reação para a fabricação de anticorpos específicos. d) vírus ou bactérias mortos ou atenuados que, reconhecidos pelo organismo como antígenos, induzem a produção de anticorpos específicos. e) vírus ou bactérias vivos, em quantidade pequena, para provocar a doença de forma branda, pois o corpo imunizado produzirá anticorpos específicos. Questão 1243 Nosso corpo está sempre sendo ameaçado de invasão por substâncias estranhas e por uma variedade enorme de microorganismos. Toda vez que isso acontece, além dos nossos mecanismos gerais de defesa, acionamos nosso sistema imune constituído por diferentes tipos de glóbulos brancos e por órgãos imunitários que, primariamente, são: a) fígado e baço. b) fígado e gânglios linfáticos.

c) tonsilas e pâncreas. d) pâncreas e medula óssea. e) medula óssea e timo. Questão 1244 A pigmentação da pele humana é condicionada por pares de genes com ausência da dominância. Suponhamos que apenas dois pares de genes estivessem envolvidos na cor de pele: o negro seria SSTT e o branco, sstt. Um homem mulato, heterozigoto nos dois pares, tem 6 filhos com uma mulher mulata de genótipo igual ao seu. Sobre os filhos do casal, pode-se afirmar que: a) todos são mulatos como os pais. b) cada um deles tem uma tonalidade de pele diferente da outro. c) um ou mais deles podem ser brancos. d) a probabilidade de serem negros é maior do que a de serem brancos. e) 50% apresentam pele branca e 50%, pele negra. Questão 1245 O gráfico a seguir representa um tipo de herança onde os caracteres variam de forma gradativa. As opções a seguir são exemplos deste tipo de herança no homem, EXCETO uma. Assinale-a.

1.5.11

a) Estatura. b) Inteligência. c) Obesidade. d) Fator RH. e) Cor da pele.

279

Questão 1246

1.5.11

dois indivíduos que produzem frutos com 15cm, espera-se uma proporção de plantas com frutos de 17,5cm igual a a) 9/16 b) 1/2 c) 3/16 d) 1/4 e) 1/8 Questão 1249 Em um caso de herança quantitativa, estão envolvidos três pares de genes, "a", "b" e "c". Cruzando-se dois indivíduos triplo heterozigotos, a proporção de homozigotos esperada é de: a) 1/2 b) 1/8 c) 1/16 d) 1/32 e) 1/64 Questão 1250 Imagine que, em um determinado animal, a retenção de água no corpo seja controlada pela interação quantitativa de dois pares de genes, existindo cinco fenótipos (da retenção baixa até a retenção máxima de água). Animais com genótipo aabb retêm baixa quantidade de água, enquanto animais com genótipo AABB apresentam retenção máxima de água. Os animais que apresentam dois genes "maiúsculos" e dois genes "minúsculos" no genótipo retêm uma quantidade intermediária de água. Na genealogia abaixo, são dados os genótipos dos animais indicados pelos números 1, 2, 3 e 6. Considerando que os genes em questão se segregam independentemente, qual a probabilidade de os indivíduos 7 e 8 apresentarem simultaneamente retenção intermediária de água? a) 1/2 b) 1/3 c) 1/4 d) 1/8 e) 1/16

A cor dos grãos de trigo é condicionada por dois pares de genes de efeito aditivo. A tabela acima mostra o número de genes dominantes e as cores determinadas por eles. Do cruzamento entre um indivíduo AaBb e um Aabb, a proporção esperada de indivíduos com grãos vermelhos é de: a) 3/8 b) 1/8 c) 3/16 d) 6/8 e) 5/8 Questão 1247 Admita que a diferença de comprimento das orelhas nos coelhos seja um caso de herança quantitativa envolvendo dois pares de genes com segregação independente. Animais sem nenhum gene dominante possuem orelhas com 4,0cm. Cada gene dominante aumenta em 1,0cm o comprimento das orelhas. O cruzamento que produzirá na descendência uma maior porcentagem de coelhos com orelhas de no mínimo 7,0cm é o a) AaBb x AaBb b) AaBb x aaBB c) AAbb x aaBB d) Aabb x AABB e) AABB x aabb Questão 1248 Para uma determinada planta, suponha que a diferença entre um fruto de 10cm de comprimento e um de 20cm de comprimento seja devida a dois genes, cada um com dois alelos, que têm efeito aditivo e que se segregam independentemente. Na descendência do cruzamento entre

280

1.5.11

de altura e cada alelo p e r determina 10cm. Assim, os indivíduos PPRR têm 80cm e os indivíduos pprr, 40cm. O gráfico a seguir representa a distribuição das classes fenotípicas observada nos descendentes dos cruzamento entre heterozigotos PpRr.

1.5.11

Questão 1251 Supondo que na aboboreira existam 3 pares de genes que influem no peso do fruto, uma planta aabbcc origina frutos com aproximadamente 1.500 gramas e uma planta AABBCC, frutos ao redor de 3.000 gramas. Se essas duas plantas forem cruzadas, o peso aproximado dos frutos produzidos pelas plantas F será de a) 3 000 gramas. b) 2 500 gramas. c) 2 250 gramas. d) 2 000 gramas. e) 1 500 gramas. Questão 1252 A tabela a seguir classifica características hereditárias da espécie humana. Assinale a alternativa que corresponde à classificação correta.

esse gráfico, os indivíduos PPRr e Pprr estão incluídos, respectivamente, em a) IV e V b) IV e II c) III e II d) III e I e) I e V Questão 1254 Um estudante de 23 anos, doador de sangue tipo universal, é moreno, tem estatura mediana e pesa 85 kg. Todas as alternativas apresentam características hereditárias desse estudante que são influenciadas pelo ambiente, EXCETO a) Altura b) Grupo sangüíneo c) Cor da pele d) Peso Questão 1255 Em um dos modelos propostos para a determinação da cor dos olhos na espécie humana (herança quantitativa), são considerados cinco diferentes fenótipos. Na descendência de pais heterozigóticos para os locos determinantes desta característica, foram observados os dados apresentados no quadro abaixo. Analise-os, juntamente com o gráfico, e identifique a correção das proposições a seguir.

1.5.11

Questão 1253 Em certa espécie vegetal, a altura dos indivíduos determinada é por dois pares de alelos de efeito aditivo e segregação independente: cada alelo P e R determina 20cm

281

1.5.11

( ) Três pares de alelos justificam os resultados apresentados. ( ) Nos indivíduos de olhos castanho-claros, os locos em questão podem estar em homozigose ou em heterozigose. ( ) Indivíduos de olhos verdes apresentam homozigose em apenas um dos locos em questão. ( ) A probabilidade do nascimento de duas crianças de olhos azuis, a partir de um casal genotipicamente igual ao do exemplo dado, é de aproximadamente 0,004. ( ) A probabilidade do casal indicado no item anterior de ter duas crianças, sendo uma de olhos castanho-claros e uma de olhos verdes é de 3/16. Questão 1256 A cor da pele humana é conseqüência do efeito cumulativo de mais de um gene, de modo que cada gene contribui igualmente para o fenótipo. O gráfico que representa a proporção fenotípica nesse tipo de herança é

são fenotipicamente homogêneas: apresentam as mesmas características quanto à altura da planta e tamanho da espiga, ao tamanho e número de grãos por espiga, e a outras características de interesse do agricultor. Porém, quando o agricultor realiza um novo plantio com sementes produzidas pelas plantas C, não obtém os resultados desejados: as novas plantas são fenotipicamente heterogêneas e não apresentam as características da planta C; têm tamanhos variados e as espigas diferem quanto a tamanho, número e qualidade dos grãos. Para as características consideradas, os genótipos das plantas A, B e C são, respectivamente, a) heterozigoto, heterozigoto e homozigoto. b) heterozigoto, homozigoto e heterozigoto. c) homozigoto, heterozigoto e heterozigoto. d) homozigoto, homozigoto e heterozigoto. e) homozigoto, homozigoto e homozigoto. Questão 1258 A altura de uma planta depende de dois pares de genes, A e B. O gráfico adiante mostra a variação da altura dos descendentes de dois indivíduos diíbridos.

1.5.11

1.5.11 Com relação ao gráfico, julgue os itens que se seguem. (1) Os efeitos quantitativos dos alelos A e B são, respectivamente, 40 e 30cm. (2) A freqüência de descendentes heterozigotos, para os dois genes, é de 50%. (3) Estão ilustrados cinco genótipos. (4) A herança apresentada é poligênica.

Questão 1257 Uma empresa agropecuária desenvolveu duas variedades de milho, A e B, que, quando entrecruzadas, produzem sementes que são vendidas aos agricultores. Essas sementes, quando plantadas, resultam nas plantas C, que

282

Questão 1259 A altura de uma certa espécie de planta é determinada por dois pares de genes A e B e seus respectivos alelos a e b. Os alelos A e B apresentam efeito aditivo e, quando presentes, cada alelo acrescenta à planta 0,15m. Verificou-se que plantas desta espécie variam de 1,00m a 1,60m de altura. Cruzando-se plantas AaBB com aabb pode-se prever que, entre os descendentes, a) 100% terão 1,30m de altura. b) 75% terão 1,30m e 25% terão 1,45m de altura. c) 25% terão 1,00m e 75% terão 1,60m de altura. d) 50% terão 1,15m e 50% terão 1,30m de altura. e) 25% terão 1,15m, 25% 1,30m, 25% 1,45m e 25% 1,60m de altura. Questão 1260 Políticas de inclusão que consideram cotas para negros ou afrodescendentes nas universidades públicas foram colocadas em prática pela primeira vez na Universidade Estadual do Rio de Janeiro (UERJ), em 2001. Propostas como essas geram polêmicas e dividem opiniões. Há vários argumentos contra e a favor. Os biólogos têm participado desse debate, contribuindo com os conhecimentos biológicos referentes à raça e à herança da cor da pele humana, entre outros. Assinale a afirmação considerada correta do ponto de vista da biologia. a) Os critérios para se definirem duas populações como raças diferentes são científica e consensualmente determinados. b) Não encontramos, na história da biologia, dúvidas sobre a existência de raças na espécie humana. c) A cor da pele humana é um exemplo de herança quantitativa ou poligênica, o que significa que vários genes atuam na sua definição. d) O fato de a cor da pele não ser influenciada por fatores ambientais reforça a hipótese da existência de raças na espécie humana. e) A determinação da cor da pele humana segue os padrões do tipo de herança qualitativa e é um exemplo de co-dominância.

Questão 1261 As diferenças hereditárias entre os indivíduos de uma população podem ser classificadas em qualitativas e quantitativas. A esse respeito, assinale a opção correta. a) Na herança de caracteres quantitativos, existe um grande contraste entre as características que um dado traço fenotípico pode apresentar. b) Na herança de caracteres qualitativos, um dado traço de fenótipo apresenta-se sob grande variedade de formas, em geral com pequenas diferenças entre si. c) Altura, peso e cor da pele são exemplos de algumas características quantitativas do homem. d) Os caracteres qualitativos, em sua maioria, sofrem grande influência do meio. e) A altura não é uma característica hereditária, já que um indivíduo cresce menos se não receber a alimentação adequada na infância. Questão 1262 Determinada característica quantitativa depende da ação de cinco pares de genes. Do cruzamento entre dois indivíduos com genótipo AaBbCcDdEe resultam a) 5 classes fenotípicas. b) 9 classes fenotípicas. c) 10 classes fenotípicas. d) 11 classes fenotípicas. e) 15 classes fenotípicas. Questão 1263 A cor dos pêlos nas cobaias é condicionada por uma série de alelos múltiplos com a seguinte escala de dominância: C (preta) > C (marrom) > C‚ (creme) > c (albino). Uma fêmea marrom teve 3 ninhadas, cada uma com um macho diferente. A tabela a seguir mostra a constituição de cada ninhada.

283

1.5.12

1.5.12

A partir desses dados é possível afirmar que o macho responsável pela ninhada: a) 1 era marrom homozigoto. b) 1 era preto homozigoto. c) 2 era albino heterozigoto. d) 2 era creme heterozigoto. e) 3 era marrom homozigoto. Questão 1264 O controle genético de determinado caráter é feito por uma série de quatro alelos de um só locus. O alelo A é dominante sobre os alelos A‚, Aƒ e A„; o alelo A‚ é dominante sobre os alelos Aƒ e A„ e o alelo Aƒ é dominante sobre A„. Do cruzamento AA‚ x AƒA„ devem ser obtidas: a) quatro classes genotípicas e quatro classes fenotípicas. b) quatro classes genotípicas e duas classes fenotípicas. c) quatro classes genotípicas e três classes fenotípicas. d) três classes genotípicas e três classes fenotípicas. e) três classes genotípicas e duas classes fenotípicas. Questão 1265 Em uma população de organismos diplóides, foram encontrados quatro alelos diferentes para um determinado locus gênico, denominados S¢, S£, S¤ e S¥. A figura a seguir mostra, à esquerda, as diferenças na seqüência de DNA que caracterizam cada um desses alelos e, à direita, o par de cromossomos homólogos (metafásicos) onde esse gene é encontrado. Diante dessas informações, se um único indivíduo desta população for escolhido ao acaso, qual combinação alelo/posição cromossômica poderia ser encontrada no par de cromossomos metafásicos deste indivíduo?

Questão 1266 Se um caráter tem três alelos possíveis, podendo haver seis genótipos, e um segundo caráter apresenta oito genótipos possíveis, quando ambos forem estudados simultaneamente, podem ocorrer a) 7 genótipos. b) 12 genótipos. c) 24 genótipos. d) 48 genótipos. e) 96 genótipos. Questão 1267 Coelhos podem ter quatro tipos de pelagem: chinchila, himalaia, aguti e albina, resultantes das combinações de quatro diferentes alelos de um mesmo loco. Num experimento, animais com diferentes fenótipos foram cruzados várias vezes. Os resultados, expressos em número de descendentes, constam na tabela a seguir.

1.5.12

284

A porcentagem esperada de gametas Ab que o indivíduo formará é a) 10% b) 20% c) 30% d) 40% e) 80% Questão 1272 O cruzamento CD/cd x cd/cd produziu 300 descendentes. Questão 1270 No órgão reprodutor de um animal há 1000 (mil) células. Questão 1271 Em determinada espécie. que proporção de descendentes poderemos prever? 1. como mostra o desenho a seguir: Se em todas as células ocorrer "crossing-over" entre os genes A e B. aqui denominados "alfa". (02) três fenótipos. b) 1 aguti: 1 himalaia. Considere que os alelos "alf" e "beta" são co-dominantes e gama é recessivo em relação a ambos. cada um correspondente a um genótipo. "beta" e "gama". Quantos deverão ser diferentes dos pais. c) 6. c) a ocorrência do "crossing" não altera a seqüência dos genes nos cromossomos. (16) quatro fenótipos. Em um determinado indivíduo da espécie referida. correspondentes a seis genótipos. em cujos núcleos estão os cromossomos. podemos afirmar que: a) todos os gametas formados conterão as combinações resultantes do "crossing". correspondentes a cinco genótipos.5. (04) quatro fenótipos. c) 9 aguti: 3 himalaia: 3 chinchila: 1 albino. e) 3 aguti: 1 chinchila.e o animal progenitor aguti do cruzamento 1 for utilizado para a obtenção de filhotes com o progenitor chinchila do cruzamento 4. Questão 1269 Considere um gene que apresenta 3 alelos. d) 8. e) não é possível calcular essas proporções. Questão 1268 Suponha que em uma certa espécie diplóide exista um caráter relacionado com uma série de quatro alelos (alelos múltiplos). Tal gene deve determinar: (01) três fenótipos. sabendo-se que a freqüência de permutação é de 10% a) 30 b) 15 c) 270 285 . os locos dos genes A e B situam-se no mesmo cromossomo. b) a proporção de gametas com as formas não "crossing" seria maior do que a de gametas com as formas "crossing". e se cada uma originar 4 (quatro) gametas. Na meiose de um indivíduo duplo-heterozigoto AB/ab ocorre permutação entre esses locos em 80% das células. b) 4. e) 10. o número máximo de alelos representados relacionados ao caráter em questão será igual a a) 2. porque os gametas recebem cromossomos ao acaso. (08) seis fenótipos. cada um correspondente a dois genótipos.13 a) 1 aguti: 1 chinchila. d) 2 aguti: 1 chinchila: 1 himalaia. correspondentes a quatro genótipos. porque só as cromátides irmãs são envolvidas. d) as proporções entre os tipos de gametas seriam iguais às que ocorrem quando os genes estão em cromossomos diferentes.

heranças recessivas ligadas ao sexo. 40% e 10% b) 30%. A freqüência de gametas AB. (unidades de recombinação). e) 50 morganídeos. aB e ab produzidos por esse indivíduo deve ser. 10% e 10% 286 . respectivamente. Ab. 30%. pode-se concluir que a distância entre os genes B e R é de: a) 48. distam entre só 20 U.5% Br . ocorre "crossing-over" entre esses genes em 40% das células.R. e) da ausência de nucleotídeos covalentes. a freqüência esperada de machos afetados pelos dois caracteres é de: a) 0 % b) 5 % c) 10 % d) 20 % e) 40 % Questão 1277 Pelo que se conhece da disposição dos genes dos cromossomos.5.5% bR . c) 1. Considere o seguinte cruzamento: Fêmea (Ab/aB) X Macho (ab/ab) Qual é a freqüência esperada de machos com o genótipo AB/ab? a) 100% b) 50% c) 25% d) 10% e) 5% Questão 1276 Na espécie humana os genes que determinam a distrofia muscular Duchnne e a hemofilia. autossômicos. Considere o seguinte cruzamento: 1. sabendo-se que a freqüência de permutação é de 20% a) 30 b) 90 c) 430 d) 360 e) 45 Questão 1274 Analisando-se dois pares de genes em ligamento fatorial ("linkage") representados pelo híbrido BR/br. 20% e 20% d) 40%.5 morganídeo. uma certa espécie apresentou a seguinte proporção de gametas: BR . a) 10%. 40%.1.48. dois genes A e B. b) do comprimento da zona centromérica.5% br .1. 40%. 10% e 40% e) 40%. b) 97 morganídeos. d) do tipo de polimeria existente. 20% e 30% c) 30%.d) 290 e) 45 Questão 1273 O cruzamento AB/ab x ab/ab produziu 450 descendentes. é de se esperar lhe a freqüência de permutação entre dois genes esteja na dependência.5 morganídeos. c) da existência do fenômeno da pleiotropia.48. a) da distância entre eles. 10%. 20%.13 esse cruzamento.5% Pela análise dos resultados. Quantos deverão ser diferentes dos pais. Questão 1275 Em um caso de "linkage". distam entre si 20 UR. Questão 1278 Na meiose de um indivíduo AB/ab. d) 3 morganídeos.

R. obtidos a partir de cruzamentos EEAA×eeaa. eA = 40. ea = 25. ea = 30. Questão 1282 Com relação ao processo conhecido como crossing-over. eA = 30. com os seguintes descendentes: 150 indivíduos que produziam sementes coloridas e lisas. durante a meiose. ea = 10. A partir desses resultados. c) EA = 25. 62.5. Ea = 30. 37. 1. 62. Questão 1281 Numa certa espécie de milho. ao serem cruzados com animais duplo-recessivos. o alelo dominante E condiciona pêlos normais e o alelo recessivo e. ea = 40. 18. Os indivíduos F. c) corrige a recombinação gênica. e) EA = 40.R. a) EA = 10. Os alelos recessivos b e r condicionam. b) BR/br. d) aumenta a variabilidade genética. Ea = 10.R. grãos brancos e rugosos. podemos concluir que o genótipo do indivíduo parental colorido liso e a distância entre os genes B e R são a) BR/br. a partir de um determinado cruzamento espera-se obter os seguintes descendentes: + + 10 + d 40 c + 40 c d 10 Esse cruzamento poderia ser a) ++/++ x cd/cd b) ++/cd x cd/cd c) +d/+d x c+/c+ d) +d/c+ x cd/cd e) +d/cd x c+/cd Questão 1280 Em camundongos. surgiu uma F.Questão 1279 Se a distância entre dois locos gênicos é de 20 unidades.5 U. o grão colorido é condicionado por um gene dominante B e o grão liso por um gene dominante R. 150 indivíduos que produziam sementes brancas e rugosas. 37. pêlos encrespados. Ea = 40. c) Br/bR. eA = 25. b) separa cromátides homólogas. 250 indivíduos que produziam sementes coloridas e rugosas e 250 indivíduos que produziam sementes brancas e lisas. d) EA = 30. b) EA = 20. originaram os seguintes descendentes: 160 com pêlos normais e albinos 160 com pêlos encrespados e selvagens 40 com pêlos normais e selvagens 40 com pêlos encrespados e albinos Assinale a alternativa que contém as porcentagens corretas de cada tipo de gameta produzido pelos indivíduos F.R. albina. No cruzamento entre um indivíduo colorido liso com um branco rugoso. d) Br/bR.5 U.75 U. eA = 10. Questão 1283 O esquema a seguir refere-se a uma célula diplóide que.R.13 287 .5 U. eA = 20. Ea = 25. podemos afirmar que o mesmo a) diminui a variabilidade genética. respectivamente. O alelo dominante A determina pelagem selvagem e o alelo recessivo a. ea = 20. e) BR/br. e) troca cromossomos entre genes homólogos.5 U. sofrerá permutação entre os genes A e B. Ea = 20.

então a distância entre os genes A e B será a) 10 morganídeos. b) 30 morganídeos. logo segregam-se independentemente. (16) É o processo de duplicação dos cromossomos para garantir a manutenção da espécie.13 uantos gametas recombinantes serão formados se 20 das 100 células apresentarem permutação na meiose? a) 10 b) 20 c) 40 d) 80 e) 160 Questão 1287 Considerando os genes X. Sobre os genes D e E podemos concluir que: a) estão ligados e há permuta entre eles.Assinale a alternativa que apresenta todos os tipos de gametas normais que podem ser formados por essa célula. então a distância entre os genes A e B será a) 45 morganídeos. a) AbCe. e) 20 ou 10 morganídeos. AaBCe. d) segregam-se independentemente e não há permuta entre eles. 288 . (08) É o pareamento de cromossomos homólogos de modo a se tornarem bivalentes. c) segregam-se independentemente e há permuta entre eles. aBCe. Questão 1286 Suponha que 100 células germinativas entram em meiose e que essas células tenham o seguinte genótipo: 1. é correto afirmar: (01) É a troca de gametas que ocorre durante o cruzamento de dois indivíduos da mesma espécie. e c) AbCe. (64) É o processo responsável pela variabilidade genética entre organismos de uma mesma espécie. AbCe. com os genótipos DdEe x ddee. abCe. originou 42 descendentes com genótipo DdEe. b) estão ligados e não há permuta entre eles. c) 10 ou 30 morganídeos. ABCe b) AbC. Y e Z de um cromossomo. (32) É um processo que ocorre necessariamente durante a mitose. d) 20 morganídeos. ABCe d) AbCe. sabe-se que há 15% de recombinação entre os genes X e Y. entre Y e Z há 30% e entre os genes Z e X ocorre 45%. 160 Ddee. aBCe e) AabCe. Questão 1289 Sabendo-se que as freqüências de permutação entre os genes A e C é de 40% e entre os genes B e C é de 15%. aBC. Qual a posição relativa desses três genes no cromossomo? a) ZXY b) XYZ c) YZX d) XZY e) YXZ Questão 1288 Sabendo-se que as freqüências de permutação entre os genes A e C é de 20% e entre os genes B e C é de 10%. e) não estão ligados. Questão 1285 Um cruzamento entre dois indivíduos. 168 ddEe e 40 ddee. (02) É a troca de micronúcleos entre indivíduos unicelulares para renovar o seu material genético. e. (04) É o processo que origina novos arranjos gênicos resultantes de trocas de fragmentos de cromátides homólogas.5. aBCe Questão 1284 Com relação ao processo denominado permutação. ou crossing over.

c) 40 morganídeos. e indivíduos homozigóticos recessivos (abc//abc). C e D. Tomando por base os dados fornecidos no quadro a seguir. organismos geneticamente modificados (OGM). ( ) Os fenótipos 3 e 4 resultaram de recombinação genética entre os locos A e B. embora em diferentes freqüências. Questão 1293 Os transgênicos. o que indica um avanço biotecnológico nesta área. analise as proposições seguintes. Para isso. ( ) No mapa genético. II. 1. Das afirmativas.b) 25 morganídeos. a distância entre os locos A e B é maior que a distância entre os locos B e C. estão merecendo uma atenção especial no mundo todo. Resistem a certas doenças e pragas (insetos. ( ) A recombinação entre os locos B e C. Está correta ou estão corretas: a) apenas I e II b) apenas II e III c) apenas I e III d) todas e) apenas uma das três vantagens. apresentam as seguintes freqüências de recombinação: A-B = 32% A-C = 45% A-D = 12% B-C = 13% B-D = 20% C-D = 33% A seqüência mais provável desses genes no cromossomo é a) ABCD b) ABDC c) ACDB d) ADBC e) ADCB Questão 1292 Na elaboração de mapas genéticos. d) 25 ou 15 morganídeos. III. considere as corretas: I. B.14 Questão 1290 Supondo-se que a distância entre locos gênicos seja de 16 morganídios. para três locos ligados. utiliza-se o teste dos três pontos. nematóides etc) diminuindo a necessidade do uso de pesticidas. por exemplo). 289 . Os produtos transgênicos apresentam algumas vantagens. 7 e 8. a taxa de recombinação entre eles é de a) 8% b) 16% c) 32% d) 42% e) 84% Questão 1291 Quatro genes. para os mesmos locos (cruzamento teste). ácaros. são avaliadas as freqüências das classes fenotípicas na descendência de cruzamento entre indivíduos heterozigóticos (ABC//abc).5. ocorreu nos genótipos 5. desenvolvidas em países asiáticos. O arroz transgênico apresenta variedades que contêm altos teores de beta-caroteno (precursor da Vitamina A) e que acumulam maior teor de ferro. e) 40 ou 15 morganídeos. ( ) Os fenótipos 7 e 8 resultaram de recombinação genética apenas entre os locos C e B. 6. ( ) A seqüência dos alelos no cromossomo em questão é A -------B-------C. Aumentam a produtividade (caso da soja. localizados no mesmo cromossomo. A.

A comunidade científica demonstrou ser possível a Os cientistas transferiram o núcleo da célula mamária para reprodução de seres vivos através de sofisticadas técnicas o óvulo da ovelha "Scottish Blackface" Passado um tempo. pode-se afirmar que genitor ou por manipulação citogenética. e) Há uma falha técnica no experimento. O embrião resultante é implantado no útero de uma terceira ovelha C. continuaram com baixa produção após a poda. mas o DNA Foram retiradas as células das glândulas mamárias de uma ovelha adulta da raça "Finn Dorset". Acerca do material genético desse novo originados pela multiplicação assexuada de um único indivíduo. uma vez que no seu genótipo há cromossomos de seu avô. clonagem para "fazer" a ovelha "Dolly" da raça "Finn b) o DNA nuclear e o mitocondrial são iguais aos da ovelha Dorset". que consistem em: ele começou a se dividir. c) A clonagem está errada. "Scottish Blackface". e) o DNA nuclear é igual ao da ovelha A. núcleo de uma célula somática de uma ovelha adulta A para um óvulo de uma outra ovelha B do qual foi previamente Questão 1295 eliminado o núcleo. Para criar a mangueira transgênica. Os ingredientes foram Questão 1297 colocados numa solução química para "hibernar" e esperar um tempo para serem encaixados nos óvulos anucleados. que cedeu o óvulo anucleado.Questão 1294 As mangueiras. B. que são guardados. reprodutor da ovelha "Scottish Blackface". c) amplificação do gene ë transfecção do gene ë Questão 1296 inserção do gene num vetor. indivíduo. A receita propõe os seguintes passos: c) o DNA nuclear e o mitocondrial são iguais aos da ovelha Os cientistas retiraram óvulos de uma ovelha adulta da raça C. filha da ovelha da raça "Scottish Blackface". cujo controle era muito difícil. Tomando por base o texto. b) "Dolly" não tem pai mas é. inserção do gene num vetor. d) amplificação do gene ë inserção do gene num vetor Uma maneira de se obter um clone de ovelha é transferir o ë transfecção do gene. ao contrário do esperado. dentro do óvulo de uma fêmea de uma espécie. Deles removeram os núcleos e d) o DNA nuclear é igual ao da ovelha A. características da "Dolly". Dele se formou um embrião que deu origem à Dolly. Investigando o problema. uma vez que "Dolly" veio de seu a) transfecção do gene ë amplificação do gene ë óvulo. mas o DNA guardaram o resto. núcleos. resumidamente. d) A clonagem está correta. mitocondrial é igual ao da ovelha B. podemos afirmar que: a) A clonagem está correta mas não revela a tecnologia necessária para as células "hibernarem" e acertarem o tempo. O pesquisador sugeriu desenvolver uma linhagem transgênica dessa mangueira. deve-se seguir um conjunto de etapas que começa pela construção de uma seqüência iniciadora ('primer'). A seqüência correta das etapas seguintes à construção do 'primer' é. pois a genitora é a ovelha da raça "Scottish Blackface". formando um aglomerado de a) injetar. para a transferência do núcleo para o óvulo anucleado. o pesquisador descobriu que o ambiente favorecia o desenvolvimento de um nematóide parasita de mangueira. Recentemente os jornais publicaram uma receita de a) o DNA nuclear e o mitocondrial são iguais aos da ovelha A. certamente. O aglomerado celular foi transferido para o aparelho 290 . onde origina um novo Clone é um população de seres geneticamente idênticos. também necessário. células. de clonagem. pela inserção de um gene que codifica uma toxina capaz de matar o nematóide. um espermatozóide de um macho da mesma espécie. Delas são retirados os mitocondrial é igual ao da ovelha C. pois núcleo de b) inserção do gene num vetor ë transfecção do gene ë célula de glândula mamária não pode influir nas amplificação do gene. pois o pai é a ovelha da raça "Finn Dorset".

e os cromossomos sexuais são iguais aos da ovelha A. o núcleo de uma célula-ovo da mesma espécie. É CORRETO concluir que: a) todos os cromossomos do clone são iguais aos da ovelha A. e) existem cromossomos no clone que são diferentes de A e de B. Questão 1300 Em fevereiro deste ano. utilizou-se o núcleo de uma célula da mama de uma ovelha (A) e o citoplasma de um óvulo de outra ovelha (B). do qual o núcleo fora previamente removido. o núcleo de um outro óvulo da mesma fêmea. dentro do óvulo de uma fêmea. e os cromossomos sexuais são iguais aos da ovelha A. o núcleo de uma célula ovo da mesma espécie. A partir dos dados envolvidos no experimento realizado pelos pesquisadores. b) constituição cromossômica e DNA mitocondrial da ovelha A. o núcleo de um outro óvulo da mesma espécie. Esse óvulo fora posteriormente implantado no útero de uma terceira ovelha (C). c) retirar e descartar o núcleo de uma célula somática de uma espécie e injetar. c) constituição cromossômica e DNA mitocondrial da ovelha B. neste óvulo anucleado. e) introduzir. que consistem em: a) injetar. APENAS a) I e II b) I e III c) I e IV d) II e III e) III e IV Questão 1302 Se retirarmos o núcleo de uma célula-ovo de rã e o substituirmos por outro núcleo diplóide de uma célula de tecido muscular de rã adulta. b) introduzir. d) retirar e descartar o núcleo do óvulo da fêmea de uma espécie e injetar neste óvulo anucleado. c) injetar. Nessa clonagem. reprodução sexuada III. Questão 1298 Recentemente. nesta célula anucleada. reprodução assexuada II. nesta célula anucleada. Questão 1299 Os pesquisadores da área de Genética demonstraram ser possível a reprodução de seres vivos por meio de aprimoradas técnicas de clonagem. alguns genes de outra espécie. um grupo de pesquisadores divulgou ao mundo a ovelha Dolly. nas células reprodutoras de uma espécie. d) retirar e descartar o núcleo de uma célula somática de uma espécie e injetar. d) constituição cromossômica da ovelha A e DNA mitocondrial da ovelha C. o núcleo de uma célula somática de um indivíduo da mesma espécie. dentro do óvulo de uma fêmea.b) retirar e descartar o núcleo do óvulo de uma fêmea de uma espécie e injetar. a nova célula-ovo assim 291 . originando Dolly. necessariamente. d) os autossomos do clone são iguais aos da ovelha B. e) constituição cromossômica e DNA mitocondrial correspondente a uma mistura das três ovelhas. dentro do óvulo da fêmea de uma espécie. nas células germinativas de uma espécie. o mundo foi abalado pela notícia da produção do clone de uma ovelha. alguns genes de outra espécie. b) os autossomos do clone são iguais aos da ovelha A. Esses pesquisadores retiraram o núcleo da célula de uma ovelha (A) e o implantaram num óvulo colhido de uma outra ovelha (B). obtido por meio da técnica de clonagem. c) todos os cromossomos do clone são iguais aos da ovelha B. e os cromossomos sexuais são iguais aos da ovelha B. Questão 1301 Considere os processos adiante: I. produção de indivíduos geneticamente idênticos IV. o núcleo de uma célula somática de um indivíduo da mesma espécie. meiose Na formação de clones de organismos pluricelulares ocorrem. pode-se prever que Dolly apresente a) constituição cromossômica da ovelha A e DNA mitocondrial da ovelha B. um espermatozóide de um macho da mesma espécie. e) injetar.

devido ao seu menor grau de complexidade. em relação à seqüência funcional do DNA da célula diplóide doadora. b) os embriões resultantes da clonagem em vegetais são mais resistentes às modificações ambientais. a que apresenta a melhor explicação sobre o que ocorre neste caso. Questão 1305 Os conhecimentos científicos envolvendo a "clonagem" têm proporcionado à humanidade grandes avanços e sua utilização em vegetais tem sido mais fácil e menos controversa que em animais. c) Foi integralmente mantida ativa. d) a regulação hormonal da reprodução nos vegetais é mais facilmente controlada pelos cientistas. 4/8/99) Agricultores britânicos que produzem alimentos transgênicos prevêem novos conflitos com ambientalistas. c) os vegetais apresentam. III. I. IV. IV. Identificação da localização cromossômica dos genes. neste caso. a) II. porque a) os mecanismos de regulação gênica nos vegetais são mais simples. cientistas de todo o planeta prometem empreender uma verdadeira reforma genética na natureza. V. Alguns manifestantes. III. uma vez que o governo britânico divulgou ontem o anúncio. I. IV. VI.formada será capaz de produzir uma outra rã. Assinale a alternativa que explica. e) os vegetais produzem maior número de embriões por indivíduo. em relação à seqüência funcional do DNA da célula diplóide doadora. Surgimento da técnica de identificação das pessoas pelo exame do DNA. d) V. o "Projeto Genoma Humano". Dentre as alternativas a seguir. é: a) foi integralmente inativada b) foi integralmente mantida ativa c) expressou-se como na célula epitelial d) expressou-se como na célula germinativa Questão 1304 No fim de junho de 2000. III. Questão 1303 Se retirarmos o núcleo de uma célula-ovo de rã e o substituirmos por outro núcleo diplóide de uma célula de tecido epitelial normal de rã já adulta. ("O Estado de São Paulo. o que facilita a continuidade do processo. c) V. como forma de protesto. pela Internet. como segue. Assinale a alternativa que correlaciona os fatos mencionados anteriormente em ordem cronológica crescente. que recebeu ampla divulgação na imprensa internacional. corretamente. V. II. I. criar animais com órgãos humanos e produzir bichos que funcionem como farmácias ambulantes.) Tendo em vista as vantagens e limitações das técnicas comentadas nos textos acima. I. I. o que diminui a perda em caso de rejeição. considere as seguintes afirmativas: 292 . Numa breve história da genética. e) IV." 17/8/99. II. II. a) Foi integralmente inativada. I. Questão 1306 Desde que a criação da ovelha "Dolly " foi anunciada há dois anos. foi considerado concluído. um marco no estudo da biologia. VI. em sua maioria. de locais das novas plantações. VI. Clonagem do primeiro mamífero a partir de uma célula de um animal adulto. ("Veja". II. d) Expressou-se como na célula germinativa. e) Expressou-se como na célula muscular. V. III. O uso da técnica tem criado receio entre a população. Querem usar a clonagem para salvar pandas em extinção. a nova célula-ovo assim formada será capaz de produzir outra rã normal. Transformação genética de bactérias para a produção de insulina humana. VI. a capacidade de propagação vegetativa. b) II. VI. IV. Estabelecimento das leis da hereditariedade. VI. IV. III. depois de dez anos de trabalho. III. que teme pelos danos ao meio ambiente e à saúde. V. Observação da estrutura espiralada do DNA. o que ocorre. podemos relacionar alguns fatos que marcaram época pela sua importância científica. b) Foi parcialmente inativada. estão destruindo as plantações de transgênicos do país.

(3). para um maior aproveitamento dessas técnicas. III . Em 1997. RNA). desde que cultivadas sob condições adequadas. II e IV. ( ) Os plasmídios não contêm genes essenciais à vida das bactérias.A clonagem poderá auxiliar no esclarecimento dos mecanismos de envelhecimento e morte celular. ( ) Para cortar o DNA dos cromossomos. Por muito tempo. (1).Os estudos de clonagem podem ser proveitosos para o estabelecimento de relações filogenéticas entre os organismos fósseis e os atuais. d) embrionárias são capazes de se diferenciar em outros tipos de células.A introdução de um material genético exógeno (transgene) em organismo vivos pode determinar um risco ecológico. e o adulto (5) terá praticamente as mesmas características fenotípicas do indivíduo que doou o núcleo. nŽ 195. sendo descrita como uma estrutura membranosa que está envolvida no processo de regulação de cálcio. ( ) Um DNA recombinante pode ser obtido a partir da união de um segmento de DNA bacteriano com um segmento de DNA de um outro organismo. III e IV. b) de um paciente podem ser usadas para regenerar seus tecidos ou órgãos lesados. III e IV. ( ) Com uma única transcriptase é possível cortar o DNA de uma célula em pontos da molécula onde existem diferentes seqüências de nucleotídeos. é possível obter-se um grande número de cópias do mesmo. porém. de um organismo introduzido em uma bactéria. "Ciência Hoje". (2) e finalmente é introduzido o núcleo da célula do atleta no ovócito enucleado. independentemente do seu tecido de origem. d) apenas III e IV. II . analise as proposições abaixo. IV .15. é removido o núcleo de um ovócito.I . ainda não totalmente avaliado. Questão 1309 O esquema a seguir mostra uma clonagem reprodutiva humana. o nucléolo e enzimas. Essa nova célula. uma vez que o fenótipo é resultado do genótipo (DNA) mais as influências do ambiente.1 om base nas informações desse esquema e em outros conhecimentos sobre o assunto. eles podem ser utilizados como vetores genéticos. ( ) A partir de um segmento de DNA. o núcleo foi considerado uma organela que apresentava as seguintes estruturas: um envoltório. Nesse processo. e) I. II. c) de adulto são capazes de se diferenciar em outro tipo de célula. 293 .5. O embrião se desenvolverá. c) apenas II. b) apenas I. Questão 1307 Analise este esquema relativo à obtenção de células-tronco: Questão 1308 Considerando o processo de clonagem do DNA. que foi denominada de retículo nucleoplasmático. esses cromossomos devem estar em metáfase. Nos cortes são utilizadas as enzimas transcriptases reversas. (4). é INCORRETO afirmar que células-tronco a) retiradas de embriões congelados eliminam as questões éticas e religiosas associadas à obtenção de órgãos para transplantes. o material genético (DNA. eliminando o risco de rejeição imunológica. cientistas britânicos descobriram uma nova estrutura nuclear. II e III. São corretas a) apenas I. é transferida para um útero para que se desenvolva e forme um embrião.] 1. o núcleo de uma célula somática de um tenista é retirado. 2003 [adapt.Os cientistas ainda precisam compreender melhor os mecanismos de controle de diferenciação celular.

podem-se obter indivíduos adultos com características alteradas. com o núcleo de uma célula somática retirada de um animal que se deseja copiar. b) o nucléolo é responsável pela síntese do RNA ribossômico. originando zigotos igualmente distintos. d) I. 294 Com base no texto e em seus conhecimentos. não se justifica preservar as variedades silvestres. estão presentes várias enzimas. entre elas as envolvidas nos processos de transcrição e replicação. Óvulos distintos são fecundados por espermatozóides também distintos. (3) A cultura de tecidos vegetais facilita o melhoramento . (4) Uma vez obtida uma variedade de morangueiro com as características ideais. será a célula doadora do núcleo. II. c) I. II. (1) As plantas obtidas de uma mesma cultura de tecidos são geneticamente iguais. podemos dizer que são processos de clonagem: a) I. e) o envoltório nuclear é formado por duas membranas. e) formação da notocorda.15. a partir delas. Formação de vários embriões a partir de um único zigoto.1 genético de plantas. Com base nessa informação. Questão 1312 Considere as cinco situações seguintes. b) I e II.1. (2) Uma vantagem dessa técnica é que as plantas produzidas não são suscetíveis ao ataque de pragas. I.juntamente com proteínas . c) nêurula. Quanto a este aspecto. a eliminação de infecções virais presentes na planta-mãe e que. III. apenas. seriam passadas para as plantas-filhas. as células-tronco podem ser comparadas às células dos embriões. julgue os itens adiante. III e IV. sendo que cada uma delas é composta por duas camadas de lipídios com proteínas inseridas. Questão 1311 Um dos caminhos escolhidos pelos cientistas que trabalham com clonagens é desenvolver em humanos a clonagem terapêutica. apenas. obtêm-se plantas adultas.5. d) todo o DNA da nova célula formada na clonagem citada no texto. Uma muda de violeta formada a partir de uma única folha que tenha sido destacada de outra planta e plantada em solo úmido e bem adubado. c) a função do retículo nucleoplasmático é semelhante à do retículo endoplasmático. que é uma organela citoplasmática. muito menos produtivas. sem que tenha sido fecundado. este . b) gástrula. apenas. principalmente para a obtenção de células-tronco. por exemplo. IV. V. é INCORRETO afirmar que a) o núcleo é uma organela exclusiva das células eucarióticas. faz-se uma cultura de tecidos e. estruturas importantes no processo de tradução. que são células indiferenciadas que podem dar origem a qualquer tipo de tecido. No seu interior. (4). a partir desta. do qual se retirou o núcleo celular. d) formação do celoma. Concepção de um organismo a partir da fusão de um óvulo não fecundado. apenas. pelo procedimento tradicional. Questão 1310 Os morangos de excelente qualidade que se encontram atualmente nos supermercados são produto principalmente de técnicas de propagação vegetativa "in vitro". A partir de células de um morangueiro. Tomando-se como referência a definição genética de clone e considerando as situações descritas. pois as células podem ser manipuladas geneticamente e. O gameta feminino (óvulo) de certos animais se desenvolve formando um novo indivíduo.forma os ribossomos. Essas técnica permite. enquanto estas se encontram na fase de a) mórula. IV e V.

e) I. II. inclusive na agricultura. Ecologicamente. b) I e III. Questão 1314 Um pesquisador precisa obter células-tronco para iniciar experimentos em terapia gênica. Esses descendentes são submetidos a doses de herbicida três vezes superiores às aplicadas nas lavouras convencionais. e) III e IV. c) I e IV. Questão 1316 A Embrapa possui uma linhagem de soja transgênica resistente ao herbicida IMAZAPIR. com maior capacidade de gerar descendentes também resistentes. quando a indiferenciação é maior. já que no cordão a diferenciação é menor e o número de células. quando as células já estão mais diferenciadas. a existência de clones apenas aumenta o número de representantes de um determinado nível trófico. na prática esse procedimento é extremamente improvável porque: a) seria necessário encontrar um genoma completo e conhecer sua ordem nos cromossomas. as cinco melhores são separadas e apenas uma delas é levada a testes de segurança. até o momento. Apesar da eficiência proposta no filme. d) o DNA coletado sofre mutações durante o período em que ficou fossilizado. com relação às plantas. elas estão menos diferenciadas do que as células germinativas nos testículos de um macho adulto. A clonagem de organismos tem se voltado mais para os animais porque. ali. a) Obter células-tronco de embriões em fase de gástrula em vez de obtê-las da blástula. quando ainda não é possível conseguir células tão indiferenciadas. b) Trabalhar apenas com embriões em vez de organismos adultos. ela já é conhecida e utilizada há certo tempo. Uma linhagem de soja transgênica requer a produção inicial de 200 plantas resistentes ao herbicida e destas são selecionadas as dez mais "estáveis". I. IV e V. A planta está passando por testes de segurança nutricional e ambiental. Estão corretas: a) I e II. de Steven Spielberg. No caso dos transgênicos. considere as quatro afirmações seguintes. c) Conseguir células germinativas do ovário de uma fêmea adulta pois. d) Optar pela obtenção das células do cordão umbilical de recém-nascidos em vez de obtê-las da fase de gástrula. uma vez que em adultos não existem células-tronco. A reconstituição dessas moléculas teria sido feita através da inserção de fragmentos de DNA de rã. ou seja. e) não existem técnicas para a inserção de fragmentos de DNA de uma espécie em outra. II. IV. Um grande inconveniente entre a clonagem e a produção de transgênicos é que ambas não permitem sobreposição. Questão 1313 Sobre a clonagem de seres e a criação de organismos geneticamente modificados (transgênicos). a crítica recai sobre o fato de que não se sabe se os genes introduzidos irão se expressar exatamente como no organismo doador ou se irão ativar também alguns genes inativos do genoma do organismo receptor. Questão 1315 No filme "Jurassic Park". III. e) Obter células do embrião em fase de blástula. cientistas retiraram do intestino de insetos hematófagos fósseis moléculas de DNA de dinossauros. Em seguida. não foi possível. criar um clone transgênico. c) as características do organismo se devem à estrutura primária das proteínas e não do DNA. Tanto nos clones quanto nos transgênicos. Os riscos ambientais da soja transgênica são pequenos. pode haver também alteração de posições e de elementos na cadeia. b) a composição química do DNA dos dinossauros é diferente das encontradas em espécies atuais. em uma cadeia alimentar. já que ela não tem possibilidade de cruzamento com outras plantas e o perigo de polinização 295 . d) II e III. processo que exige cerca de três anos. III. em vez de obtê-las da gástrula ou do cordão umbilical. maior. Aponte a alternativa que relaciona o procedimento e a justificativa corretos para que tal pesquisador tenha sucesso.

2 Questão 1318 "Tracy é uma ovelha transgênica. O catálogo com a receita para a produção dessas substâncias está no genoma. respectivamente. Animal transgênico é aquele que recebe e incorpora genes de outra espécie. Questão 1317 Os transgênicos vêm ocupando parte da imprensa com opiniões ora favoráveis ora desfavoráveis. algodão colorido e cabras que produzem fatores de coagulação sangüínea humana. apresenta baixo risco ambiental porque a) a resistência ao herbicida não é estável e assim não passa para as plantas-filhas. . d) a linhagem passou por testes nutricionais e após três anos foi aprovada. c) I. IV. e) transgênica e técnica de clonagem.15. A soja transgênica. passa a apresentar novas características. c) a capacidade da linhagem de cruzar com espécies selvagens é inexistente. II. A técnica do DNA recombinante foi utilizada para obtenção de Tracy.5. III e IV. ou seja. estaria mais de acordo com esse tema tão polêmico? I. ou modificado da mesma espécie. II e III. Questão 1320 Analise as informações abaixo: I. Pense na batata (ou qualquer outra planta) como uma fábrica que produz a mesma substância (proteína. d) I. b) mutante e técnica de clonagem. segundo o texto. no seu patrimônio genético. III e IV. As substâncias utilizadas para isolar o gene a ser transplantado são denominados ENZIMAS TRANSGÊNICAS. A bactéria 'Bacillus thuringiensis' (Bt) contém um gene que leva à produção de uma enzima capaz de digerir o 296 1. Quando essa planta foi regada com a substância que o vaga-lume usa para produzir luz.). Caso você fosse escolher uma ilustração para um artigo sobre os transgênicos. qual das obras de Magritte. referentes à técnica utilizada para obtenção da Tracy. a) mutante e técnica de miscigenação. Um organismo ao receber material genético de outra espécie. Analise as afirmativas a seguir. II e IV. Para a ligação do DNA transplantado ao DNA hospedeiro a célula utiliza a ENZIMA LIGASE. Questão 1319 Uma planta de fumo foi produzida a partir de uma célula de fumo que havia recebido o gene responsável pela bioluminescência dos vaga-lumes. Suponha que você queira tomar a fábrica inexpugnável aos ataques de insetos.cruzada com outro tipo de soja é de apenas 1%. Uma saída é consultar os catálogos de outras espécies. ela começou a brilhar. etc. Assim. O belga René Magritte (1896-1967). b) I. A planta de fumo e a técnica utilizada para obtê-la são denominadas. amido. um dos pintores surrealistas mais importantes. já temos bactérias fabricando hormônios humanos. e) a linhagem obtida foi testada rigorosamente em relação a sua segurança. deixou obras enigmáticas. e) II. por exemplo. b) as doses de herbicida aplicadas nas plantas são 3 vezes superiores às usuais. II. c) mutante e técnica do DNA-recombinante. d) transgênica e técnica do DNA-recombinante. mas o catálogo não possui a receita para isso. a seguir. III. capaz de produzir uma proteína humana cuja deficiência causa problema hepático e pulmonar". Estão corretas apenas as afirmativas: a) II e III.

incluir o gene no genoma da batata. pois sabemos que o genoma humano é homogêneo. ao tipo de população e às suas riquezas naturais. d) transgênicas. A biotecnologia já encontrou bactérias ou vírus capazes de fazer essa transferência. essa planta recebeu: a) os anticódons que determinam a seqüência de 297 . A engenharia genética tem ferramentas bioquímicas para tirar cópias dessas páginas do genoma. isto é. e com certeza não haverá ser humano sensível à ação biodigestora da toxina. III. Se essa ovelha for cruzada com um macho não-transgênico. c) Estudar a dinâmica de crescimento e de regeneração natural das florestas tropicais. a) A batata geneticamente modificada é um alimento transgênico porque recebeu um genoma completo da bactéria. Assinale aquela que contém conceitos e informações científicas só disponíveis aos jovens. e) 100 %. Paulo" de 03/07/1999. ela poderá de transformar numa planta adulta que produzirá a toxina Bt. na última década do século XX. A planta inteira ficará impregnada com a toxina. c) 50 %. Agora. é preciso transferir esse gene para o genoma da batata. tiradas do jornal de "Folha de S. V. IV. c) mutantes. b) 25 %. O besouro ou a lagarta que se alimentar dela morrerá. Questão 1324 Recentemente foi noticiada a criação de uma planta transgênica. Quando uma célula meristemática for geneticamente modificada. VI. fazendo com que os novos genes sejam incorporados a seus cromossomos. e) Imobilizar o gás carbônico tanto pelo processo de fotossíntese como por meio da fabricação de móveis. genes de uma outra espécie. o que lhe conferiu resistência ao ataque de predadores. e) Podemos confiar na palavra dos biotecnólogos quando afirmam "A toxina Bt é inofensiva aos seres humanos". As alternativas a seguir apresentam algumas atividades sugeridas para a melhoria da qualidade de vida humana e da saúde ambiental. Questão 1321 A introdução de uma cópia de um gene humano no genoma do pronúcleo masculino de um zigoto originou uma ovelha transgênica. que porcentagem de descendentes portadores do gene humano espera-se obter? a) Zero. b) Cultivar espécies com crescimento rápido e utilizar esses conhecimentos para planejar plantações economicamente viáveis. Para que isso fosse possível. b) A batata passou a ser um alimento transgênico porque foi cruzada com gametas oriundos da bactéria. Após a análise das informações acima. uma nova espécie. o que lhe conferiu resistência ao ataque de predadores. a) Associar o desenvolvimento socioeconômico de cada região às suas características de relevo. assinale a alternativa correta. Essas bactérias são consideradas a) puras. d) Introduzir nas células de uma planta. c) A batata geneticamente modificada é um alimento transgênico porque recebeu parte do genoma de uma outra espécie. Questão 1323 As questões ambientais têm sido motivo de preocupação sobretudo para as últimas gerações. d) 75 %. pois a toxina digere o intestino desses animais. Segundo os biotecnólogos. b) clones. cujos intestinos não oferecem condições para ela se manifestar.intestinos dos insetos. d) A batata passou a ser uma alimento geneticamente modificado. Questão 1322 A engenharia genética possibilitou a introdução do gene humano para a produção da insulina em bactérias. capaz de produzir hemoglobina. A qualidade do ar e a importância da preservação da biodiversidade constam da pauta das discussões da humanidade há muito tempo. a toxina Bt é inofensiva aos seres humanos. a partir do cruzamento com a bactéria. constituindo.

destaque a afirmação correta: a) O objetivo dos cientistas é criar novas espécies. A esse respeito. III . d) eliminando-se as pragas da lavoura. IV . b) A aplicação da engenharia genética nos alimentos teve origem em países do terceiro mundo. c) não se conhecem os efeitos que os transgênicos podem ter na saúde das pessoas.Não se sabe quais serão as possíveis conseqüências da ingestão desses alimentos. porém. III e IV. cuja seqüência de nucleotídeos determina a seqüência de aminoácidos da hemoglobina. insulina humana para uso de diabéticos III. os alimentos transgênicos representam um tema de grande discussão. Questão 1326 Atualmente. III e IV. utilizadas para a obtenção de seres transgênicos. A transferência de genes bacterianos para o genoma de uma planta amplamente cultivada e usada na alimentação animal e humana vem gerando. aumentando a produtividade e minimizando. e) os transgênicos simplificarão muitas cadeias alimentares. I . juntamente com produtos obtidos por meios tradicionais.Pode-se gerar um animal transgênico que tenha a capacidade de produzir maior quantidade de leite com menor taxa de gordura. soja tolerante a herbicidas Desses produtos. que apresentam uma grande incidência de pragas na agricultura. Questão 1327 As técnicas de manipulação genética. b) todos os países passarão a produzir soja. d) I e III. muitas cadeias alimentares desaparecerão. e) II. apenas. b) I. apenas. prejudicando os atuais exportadores. Esta interferência do homem na natureza se dá por meio da engenharia genética. as técnicas de controle de pragas nas culturas de soja sofreram mudanças e os custos de produção diminuíram. derivam exclusivamente de engenharia 298 . Estão corretas: a) I. e) Os ambientalistas defendem o uso da engenharia genética pois os seus efeitos são totalmente previstos e controlados. beneficiando o meio ambiente.Os ecologistas temem que as plantas transgênicas possam afetar o equilíbrio ecológico. para se obter uma espécie nova que não ocorre naturalmente. milho resistente a insetos IV. batata resistente a viroses II. científico e filosófico. questionamentos de cunho político. II e IV. não trazendo perigos para a humanidade.aminoácidos nessa proteína. gerando novas combinações genéticas. Considere os quatro exemplos abaixo: I. c) o fragmento de DNA. d) O RNAm que carrega os aminoácidos usados na síntese de hemoglobina. Esses questionamentos justificam-se porque a) o custo dos transgênicos será certamente maior do que o dos produtos convencionais.Trata-se de alimentos fabricados com produtos geneticamente modificados. Questão 1328 A engenharia genética causou uma revolução na biotecnologia. Atualmente. Sobre este tema. II. e) somente os aminoácidos usados nessa proteína. d) A modificação genética dos alimentos consiste na transferência de material hereditário de um organismo para outro receptor. poucos assuntos geram tanta controvérsia como os produtos transgênicos. II . Questão 1325 Atualmente. Com o uso dessa variedade. apenas. o uso de herbicidas. o "round-up". c) Modificar um organismo geneticamente significa cruzar espécies diferentes. b) os ribossomos utilizados na produção dessa proteína. c) II e III. considere as seguintes afirmações. eliminando todos os competidores do homem e dos animais que ele cria. permitiram a criação do primeiro produto transgênico de grande impacto na agricultura: a soja resistente a um potente herbicida. por conseqüência. diversos produtos biotecnológicos estão sendo comercializados. apenas.

c) I e II somente. porém. III e IV e) II. tomateiros cujos frutos passam mais tempo amadurecendo no pé. ou então com melhores qualidades nutritivas. b) II somente. a insetos e a vírus. ("Veja". ano 36. mostarda e papinhas para crianças. favorecendo a população mundial. n. tornando-se mais saborosos. 43. III. II. 1886. III. III e IV Questão 1329 Obtiveram-se plantas transgênicas com as seguintes características: I. a possibilidade de transmitir seus genes de resistência a plantas de espécies aparentadas. p.15. Há. cereais. III. maionese. a necessidade de uso mais intenso de agrotóxicos. Um transgênico possui em seu genoma um ou mais genes provenientes de outra espécie. óleo de soja. II e III. Toda essas plantas são úteis para a espécie humana. a possibilidade de afetar insetos e outros animais do ecossistema. pés de milho cujas sementes produzem hormônios de crescimento humano. 1.2 299 . 100) Foram feitas as seguintes afirmações sobre organismos geneticamente modificados: I. O processo de inserção de genes de uma espécie em outra é realizado com a ajuda de enzimas de restrição. Questão 1332 A charge a seguir foi produzida num momento em que no Brasil se discutem as possíveis vantagens e desvantagens da liberação do plantio e comercialização de plantas transgênicas. É possível que haja polinização entre uma planta transgênica com outras de uma mesma espécie. II e III d) I. o que aumenta e barateia a produção. Há desvantagens SOMENTE em a) I b) II c) III d) I e II e) II e III Questão 1331 Os alimentos geneticamente modificados são uma realidade cotidiana. d) II e III somente. II. massas. pães.5. interferência na composição da diversidade local de insetos ocorre SOMENTE com a) I b) II c) III d) I e II e) I e III Questão 1330 Sementes transgênicas podem levar à produção de plantas resistentes a inseticidas. e) I. algodoeiros cujas folhas se tornaram impalatáveis para a herbivoria. outras conseqüências que o seu cultivo pode acarretar entre as quais estão: I. Está correto o que se afirma em a) I somente. não transgênicas. Há grãos transgênicos usados no preparo de bolachas. II. entretanto. ed.genética SOMENTE a) I e II b) III e IV c) I. São Paulo: Abril.

porém o uso dos OGM tornaria os pequenos agricultores independentes em relação às empresas fornecedoras de sementes. batata e soja. é correto afirmar: a) OGM são produtos obtidos pela transferência de gene entre espécies similares ou diferentes. e) DNA do coelho injetado no ovo se incorporou a um cromossomo e passou a conduzir a síntese de proteínas nessa célula. que gera um novo organismo por multiplicação. implicações e incertezas.(Jornal da "Ciência" . 300 . Questão 1334 O primeiro organismo transgênico foi obtido por volta de 1981. leite e ovos. A transferência do gene Bt para as variedades de milho. favorecendo toda população mundial. alterando assim o código genético do organismo. Isto envolve a natureza. fumo. o homem poderá experimentar. c) O que não é bom para os insetos pode não ser bom para os homens. o aumento do uso de agrotóxicos e a perda da fertilidade natural do solo.) Analisando-se a charge de acordo com os atuais conhecimentos biológicos. são os principais riscos ambientais.Edição 515. c) A bactéria 'Bacillus thuringiensis' (Bt) é um agente de controle biológico encontrado no solo. c) DNA do coelho injetado no ovo foi transcrito para o RNA ribossômico que conduziu a síntese de proteínas nessa célula. Mas. como grãos. b) Os defensores dos OGM enumeram a capacidade de aumento da produtividade agrícola. produtos químicos. d) RNA mensageiro do coelho injetado no ovo se incorporou a um cromossomo e foi transmitido de célula a célula através de mitoses. além de servirem para a alimentação. Nenhum cientista deixa de reconhecer o poder da tecnologia do DNA. algodão. podem ser usados para produzir remédios. oportunizando melhores condições ambientais e sociais. de animais e do homem. o surgimento de ervas daninhas resistentes a herbicidas. d) Se os insetos experimentarem. de plantas. pois a ingestão da planta não lhe fará mal. este tema não pode progredir na base do ser contra ou a favor. Questão 1335 Em revistas e em jornais. em 10 de outubro de 2003. d) Vários tipos de alimentos. O problema está em algumas de suas aplicações. b) As plantas transgênicas são perigosas para a saúde animal. que produz uma toxina contra lagartas. Os camundongos que nascidos desses ovos apresentaram hemoglobina de coelho em suas hemácias. são constantes e cada vez mais freqüentes os noticiários sobre o uso de tecnologia transgênica com fim de obter proteínas de ação farmacológica ou mesmo proteínas terapêuticas humanas. porque: a) RNA mensageiro do coelho injetado no ovo passou a conduzir a síntese de proteínas nessa célula. tornar os alimentos mais nutritivos e saudáveis e criar novos tipos de terapias e medicamentos. Questão 1333 "Muito se tem falado sobre os transgênicos e praticamente todo mundo tem alguma opinião sobre o assunto. além de mais nutritivos. e) A poluição genética. plásticos e combustíveis. regulamentados pelas normas de biossegurança. quando genes de coelhos foram injetados em ovos de camundongos que se desenvolveram no útero de fêmeas dessa espécie." ("Revista Galileu". b) retornar uma célula diferenciada ao estágio de indiferenciada. A técnica de obtenção de organismos transgênicos produtores de proteínas humanas consiste em: a) remover artificialmente alguns nucleotídeos de uma molécula de DNA. podendo misturar o DNA de microorganismos. b) DNA do coelho injetado no ovo se incorporou a um cromossomo e foi transmitido de célula a célula através de mitoses. é CORRETO afirmar: a) O que não faz mal para o homem não fará mal para os insetos. redução do uso de agrotóxicos. a perda de biodiversidade. porque suas implicações são muito sérias. as torna resistentes a certos tipos de insetos. Nov/2003) Sobre os OGM (organismos geneticamente modificados). a saúde humana e a economia.

5. c) clonado. 301 .15. d) o gene do vaga-lume controlou a produção de RNA e de proteína no interior das células do elefante.15. levando à produção de luz. a reativar os seus genes e gerar um novo ser. esse gene foi transferido para uma célula vegetal e. e) métodos biotecnológicos de cruzamentos seletivos para obtenção de novas espécies. Questão 1339 1. c) uma seqüência de RNA do vagalume foi transferida para células do elefante. c) os genes da hidra apresentaram transcrição no organismo da planária. O resultado desse experimento indica que a planta a) incorporou um segmento de RNA do vaga-lume. a partir desta. Questão 1336 Responder à questão a seguir com base na ilustração. 1. Questão 1337 No vaga-lume há um gene que determina produção de luciferase. representada na ilustração. b) incorporou um segmento de RNA do vaga-lume. e) a hidra e a planária nele utilizadas são organismos transgênicos. A tira de quadrinhos a seguir faz referência à manipulação de genes em laboratório. a partir do qual as células da planta produziram RNA e luciferase. b) híbrido. d) introdução de um ou mais genes interessantes de uma espécie em célula hospedeira. d) incorporou um segmento de DNA do vaga-lume.5. Desses ovos.2 Se esse tipo de experimento realmente fosse concretizado. que possibilitou às células da planta a produção de luciferase.c) induzir célula somática. a partir do qual as células da planta produziram DNA e luciferase. obteve-se uma planta inteira. d) transplantado. que não possibilitou a produção de RNA e nem de luciferase. a referida planta começou a emitir luz. Após ser regada com solução de luciferina. da genética atual. que porta a totalidade do genoma. Das células de vermes adultos. foram isoladas moléculas de RNA e de proteína da hidra. poder-se-ia afirmar que a) o elefante e o vaga-lume são organismos transgênicos. c) incorporou um segmento de DNA do vaga-lume. enzima responsável pela oxidação da substância luciferina. b) apenas o vaga-lume é um organismo transgênico. e) uma seqüência de DNA do elefante sofreu mutação devido à introdução do gene do vaga-lume em células daquele mamífero. d) ocorreu tradução do código genético da hidra no organismo da planária.2 través da técnica. e) transgênico. b) segmentos de DNA da hidra apresentaram capacidade de replicação durante a embriogênese da planária. e) não expressou o gene do vaga-lume. Através da engenharia genética. NÃO é correto afirmar que a) os genes da hidra se expressaram na planária. de maneira a integrar o material genético. desenvolveram-se vermes portadores de tentáculos e de cnidoblastos com filamento urticante. seria possível produzir um rato a) sintético. Questão 1338 Em um experimento. Com relação a esse experimento. foram introduzidos certos genes da hidra em ovos de planária.

Num estudo para a identificação da variedade transgênica de soja. Assim. foi medida. Essas cópias de DNA são sintetizadas em laboratório com o auxílio de uma preparação da enzima denominada de: a) RNA replicase b) RNA polimerase c) desoxirribonuclease d) transcriptase reversa Questão 1343 A enzima EPSP-sintase. por exemplo. Sobre esse fato. a atividade da EPSP-sintase em extratos de folhas de diferentes tipos desse vegetal. em crescimento no meio apropriado. após introduzidas em plasmídios. em presença ou ausência de glifosato. Estes novos segmentos de DNA introduzidos podem. na ausência do inibidor.5. ou seja. d) o RNA da canola transgênica foi transferido e incorporado ao genoma das ervas daninhas. foram constatados casos de transporte de pólen de espécies de canola transgênica para plantas silvestres (ervas daninhas). tornando-a resistente à inibição pelo herbicida glifosato. As atividades da enzima nesses extratos. presente em praticamente todos os vegetais. mas evita o crescimento de outros vegetais indesejáveis. é INCORRETO afirmar que a) as espécies de canola são transgênicas pois expressam genes que incorporaram de outras espécies. gerar novas plantas com reservas modificadas de lipídios. Questão 1341 As técnicas modernas de biologia molecular têm permitido a inserção de segmentos novos de DNA em células vegetais. produtos que sofreram 302 . Estas novas plantas são exemplos de organismos criados por engenharia genética e são genericamente conhecidos como: a) reversos b) recessivos c) dominantes d) transgênicos Questão 1342 Para a clonagem em bactérias do hormônio do crescimento humano a partir de seu RNA mensageiro. para gerar uma nova planta com novas características. Observe o gráfico: 1. amido e proteínas em suas sementes ou melhorar a resistência das plantas a pestes e vírus ou ainda aumentar a sobrevivência destes organismos em ambientes adversos. c) as espécies silvestres incorporaram e expressaram material genético da canola transgênica.15. serão expressas em culturas de bactérias contendo os plasmídios modificados. o tratamento com esse herbicida não prejudica o desenvolvimento de culturas de soja transgênica.Questão 1340 Recentemente. alto poder de resistência a herbicidas.2 A curva que corresponde à razão entre as atividades de uma enzima da variedade transgênica e as atividades dessa mesma enzima da soja comum é a indicada pela seguinte letra: a) W b) X c) Y d) Z Questão 1344 Considere o texto a seguir: "Os alimentos transgênicos. As cópias. apresentaram o mesmo valor. Estas passaram a apresentar a característica da canola transgênica. nas mesmas condições experimentais. é modificada na soja transgênica. tornando-as resistentes a agentes químicos. é inicialmente necessário que sejam sintetizadas em laboratório cópias em DNA desse RNA. e) as ervas daninhas passaram a produzir proteínas da canola transgênica. b) o pólen da canola transgênica transportou material genético para plantas silvestres.

onde também não há obrigação de alertar o consumidor. os pesquisadores criaram um coelho que produz em todas as suas células a proteína GFP (proteína verde fluorescente. utilizando técnicas de engenharia genética. Questão 1346 Os cientistas franceses que criaram animal transgênico e o artista brasileiro que fez a encomenda entram em conflito.]. Questão 1345 Pesquisadores de alguns centros de pesquisa brasileiros. Considere estas informações e assinale a opção incorreta: a) O gene para a produção de GH é. artista plástico brasileiro e professor de arte e tecnologia em Chicago. 1500 se tornaram permanentemente inválidas e 37 morreram". Os benefícios [advindos de plantas transgênicas]. o resultado mais trágico do uso de produtos transgênicos surgiu no Japão em 1989: 5000 pessoas ficaram doentes. No Brasil. introduzido no plasmídeo antes de sua introdução na célula vegetal. d) as técnicas de transferência de genes por engenharia genética são altamente seguras...2 303 . podem esconder riscos ainda não esclarecidos [. na sigla em inglês).5. Estas plantas são chamadas transgênicas. c) manipulações genéticas podem alterar o funcionamento dos genes naturais de um organismo. que: a) toda planta transgênica produz substâncias altamente tóxicas ao ser humano. Pela leitura do texto anterior. Para conferir essa característica particular.alteração genética com o objetivo de melhorar a qualidade. Eduardo Kac. 6 de agosto de 1998). d) O RNA mensageiro. mas o consumidor não sabe disso: não há lei que obrigue os fabricantes a informar que o produto sofreu alteração genética. pode-se concluir. pois os resultados das experiências podem ser imprevisíveis. Até o momento.15. corretamente. 1. plantas que produzem proteínas humanas. e) O DNA relacionado à síntese do GH pode ser obtido a partir do RNA mensageiro. e) todas as plantas transgênicas são estéreis a partir da segunda geração mutante. já ocupam prateleiras dos supermercados nos Estados Unidos e Canadá. b) plantas transgênicas são aquelas cujos fenótipos se devem mais ao ambiente do que aos genes. (FOLHA DE SÃO PAULO. em geral. quando introduzido na célula vegetal é transcrito em DNA na presença da enzima transcriptase vegetal. a multinacional Monsanto está tentando conseguir autorização do Ministério da Ciência e Tecnologia para produzir soja transgênica no país. b) a utilização de células vegetais diminui a possibilidade de contaminação humana por vírus animais. recentemente. obtiveram. presente naturalmente em medusas e que pode ser detectada sob luz ultravioleta. Criador e artista já disputam a posse da "transcoelha". batizou de Alba a coelha transgênica que tem uma propriedade peculiar: seus olhos rosados e seus pêlos brancos ficam fluorescentes quando expostos à luz ultravioleta. relacionado ao GH. c) Antes de se obter a planta produtora de GH é necessária a produção do DNA recombinante. porém. entre as quais o hormônio do crescimento (GH).

Questão 1348 O arroz dourado . 304 . d) diminui a formacao de coagulos. a partir de DNA viral. III) As células fluorescentes da coelha produzem RNA mensageiro. 08/2004) Analise os procedimentos a seguir e aponte aquele que poderia promover o desenvolvimento mais duradouro da massa muscular. Sobre este assunto. são feitas as seguintes afirmativas: I) A coelha Alba é considerada transgênica pois possui em seu genoma um segmento de DNA de medusa. Assim sendo. c) Introduzir nas células musculares nova cópia do gene do fator IGF-1. c) As enzimas de restrição agem em seqüências inespecíficas de DNA.produz ’-caroteno (vitamina A). se executado uma única vez.daptado de: http://paginas. A partir desse conhecimento é possível modular o crescimento muscular por meio de vários procedimentos. Nessas pesquisas. para que estas produzam substâncias que normalmente não seriam produzidas. a) Introduzir nas células musculares novas cópias de RNA mensageiro que codifica o fator IGF-1. e) Ainda não é possível produzir plantas com genes ativos de insetos. IV) A coelha transgênica foi produzida a partir da introdução de um núcleo extraído de uma célula de medusa em um óvulo de coelha cujo núcleo tenha sido anteriormente removido. foi mostrada a existência de duas proteínas que atuam regulando o crescimento das células musculares: o fator de crescimento IGF-1 e a miostatina. ("Scientific American Brasil". c) evita o aparecimento do bocio.com. Dentre as afirmativas acima. assinale a alternativa correta. em indivíduos sedentários. e) Injetar anticorpos produzidos contra o fator IGF-1.htm Considerando a tecnologia para obtenção de transgênicos. b) Organismos que recebem e manifestam genes de outra espécie são denominados transgênicos. II) Apenas as células somáticas tiveram o gene que codifica a proteína GFP inserido em seu genoma. b) Injetar anticorpos produzidos contra a proteína miostatina. O crescimento muscular é estimulado pelo fator IGF-1 e limitado pela miostatina. utilizando técnicas aplicadas em terapia gênica. tal como a insulina. que no processo de tradução origina a proteína GFP. e CORRETO afirmar que o uso desse grão na alimentação humana resulta em benefício para a saúde porque ele a) previne alguns tipos de cegueira. como o de transformar células de bactérias. Questão 1350 Analise as proposições a seguir. d) Injetar a proteína miostatina mutada que bloqueia a ação da miostatina normal por competir pelo seu receptor. referentes a diferentes questões de Genética. sem deixar vestígios detectáveis em exames de sangue ou urina. o homem tem desenvolvido grandes projetos.geneticamente modificado . b) aumenta o peristaltismo.br/educacao/isaacelias/coelha. somente estão corretas: a) I e II b) I e III c) I e IV d) II e III e) III e IV Questão 1347 Recentes descobertas têm provocado grande discussão por poderem alterar o futuro do esporte. chamados de bacteriófagos.terra. d) Cromossomos circulares presentes no citoplasma de bactérias. são vetores do DNA recombinante. a) As enzimas de restrição hoje conhecidas são produzidas por diversas indústrias multinacionais. Questão 1349 Através de técnicas da biologia celular.

sendo os principais produtores os Estados Unidos. ( ) Considerando o operon da lactose. em uma única gestação. Questão 1353 Escolha a alternativa que apresenta um exemplo de transgenia. d) a introdução de DNA em genomas das células dos vegetais já formados. p. já ocupam cerca de 40 milhões de hectares. II e III estão corretas Questão 1352 "A reforma da natureza Em termos de cardápio diário. Da análise das afirmativas acima podemos assegurar que: a) apenas I está correta b) apenas II está correta c) apenas I e II estão corretas d) apenas II e III estão corretas e) I. I. batata. que mostram os objetivos da manipulação genética das plantas cultivadas. de 'Escherichia coli'. cinco classes fenotípicas podem ser observadas na população. na produção de hormônios para a espécie humana. um de fenótipo mulato-médio e o outro de fenótipo branco." (Adaptado da revista VEJA. ( ) Por meios biotecnológicos.5. casada com um homem (aabb).afirmativas a seguir.) têm seu código genético alterado para ficarem mais viçosos ou resistentes a herbicidas e pragas. a pessoa expressará uma anomalia metabólica.53. em testes laboratoriais para a detecção de gravidez em estágios muito precoces. diferentes genes participam do metabolismo dos aminoácidos fenilalanina e tirosina. para ocorrer a transcrição das enzimas codificadas nos genes 2. em seu material genético. plantas transgênicas. Desenvolver variedades de plantas resistentes a geadas. II. como soja. o país vem consumindo cada vez mais alimentos geneticamente modificados. 16/06/99. por exemplo.15. Sua obtenção se dá com a) o cruzamento de duas espécies distintas. preocupação de longo prazo têm os ingleses. O DNA recombinante então obtido pode ser clonado e utilizado. Esses alimentos (. Tais anticorpos podem ser empregados. é de 1/16. algodão. dois filhos. ter. ( ) No homem. Desenvolver variedades de plantas resistentes a herbicidas ou a insetos. segmentos do DNA de outro organismo. Questão 1351 Em todo o mundo. ilustrado no esquema (figura 2). 305 1. tomate e muitas outras. b) a incorporação de RNAm na célula zigoto das espécies.) Vegetais modificados geneticamente são considerados transgênicos. reconhecidos como altamente específicos. e) a adição de DNA exógero manipulado. Desenvolver variedades de plantas que produzam frutos com melhor textura e de amadurecimento lento III. Nos últimos anos. c) a seleção de DNA mais adaptado existente numa determinada espécie. Se ocorrer uma mutação em um determinado loco. a Argentina e o Canadá. é necessário que uma molécula produzida por um gene regulador (x) não reprima o gene operador (1). ( ) Se dois pares de genes aditivos determinam a cor da pele no homem. podem ser produzidos anticorpos monoclonais. a chamada comida GM. da mesma espécie ou de outra espécie no genoma da espécie em estudo. milho.. a) Incorporação e expressão de gene humano que codifica insulina por bactérias. A probabilidade de uma mulher (AaBb).2 ( ) Certos microorganismos podem ser manipulados em laboratório para incorporarem. 3 e 4 (estruturais). No caso ilustrado no esquema (figura 1). acidez do solo e escassez de água. apresentará fenilcetonúria. por exemplo. e essa mutação determinar a produção de enzima não-funcional.. Considere as . cada um determinando a produção de uma enzima.

( ) Uma importante fonte natural de vitamina A são os vegetais com pigmentos amarelos.. Assinale verdadeira (V) ou falsa (F) nas afirmativas a seguir. com muitos genes em heterozigose. (4) As técnicas de melhoramento genético tradicionais. (16) Os organismos transgênicos são aqueles que recebem segmentos de DNA da mesma espécie. julgue os itens a seguir. ou agir como inseticidas. 306 . Questão 1354 Porcos têm sido criados transgenicamente para que seus órgãos possam ser transplantados em homens. vol. a partir de transferência de genes humanos para bactérias. (1) Transgênicos são organismos produzidos com a tecnologia do DNA recombinante. ( ) A vitamina A foi introduzida no núcleo das células. por isso o grão transgênico é mais nutritivo. incontinentimente. deixando os vegetarianos confusos com a perspectiva de cruzar animais com plantas. (32) É fundamental o estabelecimento de limites. e) Organismo mais vigoroso. na embalagem de alimentos produzidos com técnicas da biotecnologia. (08) a produção de insulina. Questão 1356 Acerca dos organismos transgênicos. resultante do cruzamento de duas variedades puras distintas. (02) Os genes alienígenas permitem ao organismo receptor produzir substâncias que nunca produziriam em condições naturais.14. A seqüência correta é a) V . (2) Organismos geneticamente modificados podem ser resistentes a produtos químicos como herbicidas. Assinale a(s) proposição(ões) VERDADEIRA(S) sobre a transgenia e suas implicações com relação à saúde e ao meio ambiente. alterando geneticamente animais e plantas. e por isso não necessitam ser testados em outras espécies de animais. como a cenoura. plantas e animais. c) V . p. pois atuam como enzimas. 1999. d) Gene que sofreu mutações. isto é.F.F . ("CICLO VITAL". à obrigatoriedade da apresentação. 4. que permite a inclusão de genes de organismos de espécies diferentes no genoma de bactérias.V.F .V . d) F . a lã cai sozinha no devido tempo. a produzir esse hormônio. de informação relativa à natureza transgênica do produto. b) V . ( ) As vitaminas são necessárias em grandes quantidades.V . (04) Os alimentos transgênicos não representam nenhuma ameaça à saúde humana.F . gens de galinha são introduzidos em batatas.F. originando múltiplos alelos para um mesmo locus.) A citação anterior mostra avanços da Engenharia Genética. é uma das experiências bem sucedidas da transgenia. (01) Cientistas interferem na evolução natural das espécies. (3) Os debates atuais a respeito dos transgênicos resumem-se à questão da rotulagem. c) Organismo que apresenta tanto estruturas reprodutoras masculinas quanto femininas. que passam. como a poliploidização. podem ser consideradas exemplos de biotecnologia aplicada à fabricação de organismos transgênicos.b) Desenvolvimento de um organismo completo a partir de uma célula somática. e) F .. cientistas desenvolvem ovelhas "auto-tosquiáveis". tanto por parte dos cientistas como dos governantes. Questão 1355 Foi transferido para plantas de arroz um gene que permite a produção e o acúmulo de vitamina A no grão das plantas transgênicas. isto é. para que as manipulações genéticas não resultem em impactos ambientais irreversíveis.F. antes de chegarem ao homem.V.

As diferenças no DNA de humanos e chimpanzés são de apenas 4% dos quase 3 bilhões de bases (letras químicas A. ao se reproduzirem. Gurdon e F. C e G) que compõem ambos os genomas.W. do gene humano para produção do hormônio de crescimento.2001) afirmou: "O que torna a técnica tão atrativa e produtora de ansiedade é que qualquer gene de qualquer espécie pode ser transferido para qualquer outra espécie". 20/08/98) Nesse tipo de teste. e) tipo de desoxirriboses presentes. Ruddle. independentemente de sua classificação. A partir destas informações. Questão 1360 "EXAME DE PATERNIDADE. injetando genes da hemoglobina de coelho em zigotos de camundongos.isto é. pode-se dizer que a maior contribuição para a diferença fenotípica entre essas espécies seja devida à 307 . pela análise do DNA das células. T.Questão 1357 A engenharia genética permitiu a introdução. Desse modo. ("Folha de S. e) é válida para todas as espécies. d) os camundongos transgênicos. e) o RNAm foi incorporado ao zigoto dos embriões em formação. identificar a paternidade de uma pessoa sem a necessidade de coleta de sangue. se as espécies forem de classes diferentes. por J. nós e esses grandes macacos africanos somos 99% iguais. se as espécies forem de filos diferentes. c) número de fosfatos contidos. em ratos. em função das informações do texto." (O GLOBO. transmitiram os genes do coelho aos seus descendentes. NO BRASIL. como a síntese de proteínas -. d) tipo de pentose existente. JÁ PODE SER FEITO COM SALIVA" "Novo teste pode. c) os camundongos receptores dos genes do coelho tiveram suas hemácias modificadas. desde que as espécies sejam da mesma ordem.H. Questão 1358 O primeiro transplante de genes bem sucedido foi realizado em 1981. b) não é válida. E boa parte dessas modificações se deu de maneira trivial ao longo dos cerca de 6 milhões de anos transcorridos desde o ancestral comum de ambos. mas não poderiam transmitir essa característica aos seus descendentes.2005) A despeito da similaridade genética. Questão 1359 Com relação à técnica de criação de organismos geneticamente modificados (transgênicos). Paulo" (07. resultando camundongos com hemoglobina de coelho em suas hemácias. o caderno Mais! do jornal "Folha de S. d) mutantes. continua-se considerando que homens e chimpanzés são espécies diferentes. 01. Essa afirmação a) não é válida.09. c) infectados. que apresentam características diferentes. desde que as espécies sejam do mesmo reino. levando à produção de ratos gigantes. e) clones. para obtenção de camundongos transgênicos. Esse tipo de teste é particularmente indicado para bebês e crianças pequenas. Essa diferença consiste na(o): a) seqüência de bases nitrogenadas. b) o DNA injetado nos camundongos poderia passar aos seus descendentes somente se fosse incorporado às células somáticas das fêmeas dos camundongos. com a mera troca de uma letra num gene. c) é válida. Quando se olha para os genes em si . a duplicação de um conjunto de letras qualquer ou a deleção de outro. b) transgênicos. os trechos de DNA que se traduzem em alguma função. Estes ratos são considerados a) isogênicos. mas não foi incorporado aos seus genomas. b) aspecto da dupla hélice presente. pode-se deduzir que a) o DNA injetado foi incorporado apenas às hemácias dos camundongos. d) é válida.Paulo". a semelhança estrutural existente entre as moléculas de DNA é tomada por base para a identificação da paternidade. Questão 1361 CONSÓRCIO DECIFRA GENOMA DO CHIMPANZÉ.10.

27/6/2000. d) descobrir novos genes com funções ainda desconhecidas. o crescimento demonstra que o gene A não é essencial. IV e V. c) a seqüência exata de nucleotídeos de cada gene. é capaz de inativá-lo. Questão 1363 Os projetos genomas. Pelas pesquisas realizadas até hoje no Projeto Genoma Humano. São afirmações CORRETAS: a) I. II. No experimento I. o seqüenciamento do DNA revolucionou a ciência e gerou novos conhecimentos sobre seres procariotos e eucariotos. isto é. 308 . II. e) seqüência de aminoácidos das proteínas. em 21 de junho de 2000. c) II. IV. II. a ausência de crescimento significa que o gene B é essencial. V. I. A bactéria 'M. c) garantir a cura de todas as patologias humanas. a humanidade viverá uma nova era. Questão 1365 Nos últimos dez anos. b) quantidade de DNA presente no núcleo das células desses organismos. e os representantes dos grupos rivais. significa que os cientistas determinaram a) a seqüência de nucleotídeos dos cromossomos humanos. III. Quando um transposon é inserido aleatoriamente dentro de um gene. que estão sendo desenvolvidos em centros de pesquisas de vários países.3 Sobre esse experimento. a era da genética. IV e V apenas. Bill Clinton. Questão 1366 "O genoma humano foi mapeado e sua seqüência estabelecida pela primeira vez na história da humanidade. Questão 1362 O anúncio do seqüenciamento do genoma humano. III. b) todos os tipos de proteína codificados pelos genes humanos. Em um laboratório. b) a expressão dos genes.5. b) compreender mecanismos que tornam uma célula imortal. o primeiro ministro britânico. EXCETO: a) selecionar embriões com características desejáveis. o genoma mínimo essencial pode ser determinado.15. empenham-se no momento em descobrir a) a interação dos genes. b) I. que possui apenas 470 genes. No experimento II. d) a seqüência de aminoácidos de todas as proteínas humanas. é possível. São Paulo .a) seqüência de bases nitrogenadas no DNA. d) expressão diferenciada dos genes. c) a seqüência de aminoácidos do DNA humano. inclusive permitiu o estabelecimento de comparações genômicas com o intuito de analisar quais genes são típicos de um organismo e quais foram perdidos no processo evolutivo. como eles agem. foram feitas algumas afirmações. realizou-se um experimento com a bactéria 'Mycoplasma genitalium'. d) I e III apenas. d) quais nucleotídeos servem de molde para a síntese de RNAm. Se cada gene pode ser inativado por mutação. Questão 1364 Pelo Projeto Genoma Humano. 1. o consórcio público internacional Projeto Genoma Humano (PGH) e a empresa norte-americana Celera. anunciaram ontem o presidente norte-americano." "Folha Ciência". e) o número correto de cromossomos da espécie humana. c) quantidade de lócus gênicos. genitalium' sobrevive sem utilizar alguns de seus genes. com o intuito de verificar se todos esses genes eram essenciais para a sobrevivência dessa espécie. e) como ocorrem a duplicação e as mutações dos nucleotídeos. IV e V apenas. Tony Blair.

dos camundongos e ratos. algumas questões de cunho ético têm sido levantadas. com exceção das hemácias. pode-se afirmar que estão CORRETAS a) apenas I e II. todas as quebras provocadas pela radiação solar. cada um de um casamento diferente. e) todas as proposições. como a hemofilia. ( ) O gene para produção de insulina no homem pode ser clonado em bactérias que passam a produzir este hormônio. nos cromossomos humanos. IV . d) apenas I. III .Leia as proposições a seguir sobre o Projeto Genoma Humano.O seqüenciamento do genoma de outras espécies. d) a hibridização de DNA. Uma das formas possíveis de identificar os despojos dos filhos dessa senhora consiste em verificar se existe homologia do: a) DNA mitocondrial da senhora com o DNA mitocondrial das vítimas b) DNA mitocondrial da senhora com o DNA nuclear das vítimas c) DNA nuclear do marido e do ex-marido da senhora com o DNA mitocondrial das vítimas d) DNA mitocondrial do marido e do ex-marido da senhora com o DNA mitocondrial das vítimas e) DNA nuclear da senhora com o DNA mitocondrial das vítimas Questão 1368 Os avanços da Engenharia Genética têm permitido o conhecimento mais amplo dos cromossomos. c) o DNA recombinante. b) a clonagem de células. o procedimento que pode afetar diretamente o equilíbrio genético de populações humanas é a) a detecção de indivíduos superdotados intelectualmente por meio de procedimentos laboratoriais. Ao lado dos inúmeros benefícios desse projeto. o método de produção do hormônio do crescimento envolve diretamente a) o seqüenciamento de DNA. março/93) Em relação a esse projeto. que tem por objetivo seqüenciar os cerca de 3 bilhões de bases nitrogenadas que compõem os cromossomos de um ser humano.O genoma humano pode ser seqüenciado a partir de qualquer célula do corpo. Questão 1367 Em um acidente. c) apenas I. hormônios e outros insumos terapêuticos. ( ) O Projeto Genoma visa a localizar. como o das bactérias ('Xylela fastidiosa'). II . e) a sonda de DNA. amostras de DNA nuclear e mitocondrial de todos os mortos. especialmente no que se refere à produção de antibióticos. foi possível preparar.O seqüenciamento do genoma humano determinou a posição exata e a função de cada gene. possibilitando a melhor compreensão dos diferentes fenótipos. ( ) O mapeamento gênico de um indivíduo permite informar se ele é portador ou não de genes causadores de doenças. a partir de fragmentos de tecidos. Faleceram no acidente dois filhos de uma senhora." ("Ciência Hoje". Considerando as proposições anteriores. ( ) O teste de paternidade com base no DNA deve ser realizado exclusivamente em indivíduos sem doenças sangüíneas. vacinas. analise os itens abaixo. embora os corpos das vítimas fatais fiquem queimados e irreconhecíveis. Na fase laboratorial. II e IV. Sobre este tema. III e IV. Questão 1369 Os avanços na área da biotecnologia permitiram melhores condições de assistência à saúde humana e animal. é de grande auxílio para o Projeto Genoma Humano.O seqüenciamento do genoma humano possibilitará a identificação dos genes envolvidos em doenças e a criação de novas abordagens preventivas ou de tratamentos mais rápidos e eficazes. b) apenas II e III. 309 . I . Questão 1370 "A nova tecnologia do DNA recombinante está permitindo que cientistas dos países do primeiro mundo desenvolvam um projeto denominado GENOMA.

por ser herdado da avó paterna. permitir traçar árvores familiares confiáveis. 310 . Antônio. A escolha desse teste está relacionada com o fato a) de o DNA mitocondrial. irmãos adotivos. permitir identificar a filiação com segurança. e o resultado foi o seguinte. os DNAs devem ser diferentes. envolveu a bactéria causadora da "praga do amarelinho". d) o registro de patentes de seqüências do genoma humano para especulação mercadológica. c) A criança é filha de João. d) de o DNA mitocondrial. Questão 1373 Maria teve um filho e Pedro. através das mitocôndrias existentes no citoplasma do ovócito da mãe. mesmo na ausência dos pais. empregando para isso testes de identificação genética. seu ex-namorado. permitir traçar árvores familiares confiáveis. para se hibridizarem. através das mitocôndrias existentes no citoplasma do espermatozóide do pai. e) o uso de testes pró-sintomáticos para a realização de seguros de vida. d) O teste não foi conclusivo. vendidas ou abandonadas em orfanatos. que são possíveis. através das mitocôndrias existentes no citoplasma do ovócito da mãe. nega a paternidade da criança. b) de o DNA mitocondrial. ou de João (primo de Pedro). do pai. Um deles. c) o emprego de testes genéticos como um novo critério para admissão a empregos.5. permitir traçar árvores familiares confiáveis. Todas as alternativas apresentam benefícios de projetos que envolvem o seqüenciamento de genomas. garantir um registro familiar que se mantém de geração a geração. alegando que o filho pode ser de Paulo (irmão de Pedro). e) de o DNA mitocondrial. A Associação Civil "Avós da Praça de Maio" tem buscado localizar essas crianças com a finalidade de restituí-las a suas famílias legítimas. na verdade. b) A criança é filha de Pedro. Para solucionar esse impasse. c) de o DNA mitocondrial. pois deveríamos ter hibridizado o DNA do pai com o da mãe. durante a ditadura militar iniciada em 1976. pois todos os resultados foram menores que 85%. EXCETO a) Aumento da produtividade na agricultura b) Compreensão mais ampla das doenças genéticas c) Determinação da posição de proteínas nos cromossomos d) Diagnóstico precoce de doenças hereditárias Questão 1372 Na Argentina. que atinge plantas cítricas. através das mitocôndrias existentes no citoplasma do ovócito da mãe. por ser herdado das duas avós.b) o aumento de seleção genética ou gamética artificial. 50% dos genes são herdados da mãe e 50%. através de uma mistura dos genes do pai e da mãe. ou ainda de um vizinho. atualmente. Paralelamente. a família de Maria resolveu fazer um teste de paternidade. a) A criança não é filha de nenhum dos supostos pais. Essas crianças foram adotadas. e) Pedro e Paulo são. por ser herdado do avô paterno. Questão 1371 Alguns projetos de seqüenciamento genômico vêm sendo desenvolvidos por pesquisadores brasileiros. (Fonte: abuelasatournet. aproximadamente.ar) A comparação entre os DNAs mitocondriais de possíveis netos e avós tem sido um dos testes utilizados nesses processos de identificação de parentesco. por exemplo. por ser herdado da avó materna. por ser herdado do avô materno.3 Assinale a alternativa que interpreta corretamente os resultados do teste.com. pois. muitas crianças foram seqüestradas com seus pais ou nasceram em centros clandestinos de detenção.15. 1. o seqüenciamento completo do genoma humano foi anunciado pela comunidade científica internacional. pois.

.). 123.. foi anunciado o seqüenciamento do genoma humano.são possíveis de serem encontradas nesse mapeamento. de algumas doenças genéticas. 10/04/2000. c) Apenas I e II. é CORRETO afirmar que: (01) o referido genoma está contido nos cromossomos. ..O genoma humano contém uma grande percentagem de seqüências de DNA que não codificam genes. que contém cromossomos das duas espécies. II e III foram registradas para a presença ou ausência dos cromossomos humanos 1 até 8. e) I. II . C e D quando o seqüenciamento é realizado a partir de RNA mensageiro. Questão 1376 1. a Citosina. (04) apenas quatro bases nitrogenadas . Depois do susto provocado no começo da semana pelos percalços jurídicos da Microsoft. a Nasdaq.Questão 1374 Na década de 1960.a Adenina.15. considere as seguintes afirmações. (. B. recentemente seqüenciado no Brasil.. Georges Barsky desenvolveu a técnica de hibridização somática. (16) um dos resultados possíveis dessa descoberta será a cura. voltou a respirar. Três linhagens somáticas híbridas designadas I.A expressão dos genes humanos depende da presença. através da terapia gênica. de cada gene no DNA de células diferenciadas. II e III.3 m relação à tabela é correto afirmar que a) o gene correspondente à proteína A está no cromossomo 1. no ano 2000. d) o gene correspondente à proteína D está no cromossomo 4. no futuro." Trecho extraído do artigo: GENOMA: O PRIMEIRO ESBOÇO DO MAPA DA VIDA. que se constitui em um grande passo no mapeamento de genes humanos. o pregão eletrônico das empresas de alta tecnologia. b) o gene correspondente à proteína B está no cromossomo 3. III . p.. I . Por isso.. publicado na "Revista Época". (02) a molécula sequenciada é o DNA. identifica-se mais facilmente um gene. Com relação a esse assunto. O oxigênio foi dado pelo anúncio de que cientistas americanos tinham chegado ao fim do rastreamento de um dos sonhos da medicina nesta virada de século: o mapeamento do genoma humano. Questão 1375 O que se imaginava impossível acabou acontecendo antes do prazo previsto: após a elucidação da seqüência de DNA de vários organismos. a Guanina e a Uracila . c) o gene correspondente à proteína C está no cromossomo 6.5. 311 .. Quais estão corretas? a) Apenas I. ou ausência. A tabela abaixo contém uma grade hipotética de dados usados para mapear genes em seus cromossomos humanos apropriados. bem como pela sua habilidade em produzir as proteínas humanas hipotéticas A. (08) esse mapeamento já permitiu aos cientistas saberem a localização de todos os genes humanos. Com relação à organização genômica. Duas células de origem diferente podem se fundir em uma única célula híbrida.O genoma humano tem organização diferente da organização do genoma da bactéria 'Xyllela fastidiosa'. e) a linhagem III contém o cromossomo 8. "A revanche veio na quinta-feira [06/4] passada. b) Apenas II. causadora da praga do amarelinho nos laranjais. d) Apenas II e III.

é um dos fatores que dificulta sua utilização em larga escala pelos segmentos populacionais menos favorecidos economicamente. a partir de testes de DNA. Soma ( ) Questão 1378 Em junho de 2000. 1999.. O resultado do teste. d) o número de doenças que podem afligir a humanidade. (adaptado) Uma modificação que poderia ser feita nesse texto. Questão 1379 O texto a seguir apresenta os resultados do projeto de estudo do genoma da 'Xylella fastidiosa'. do pai e dos filhos. em 30/07/2001. (02) o melhor material biológico para um teste de DNA é aquele extraído de núcleos de glóbulos brancos do sangue. atualmente. da fertilização "in vitro" e da barriga de aluguel. b) código genético por seqüência de aminoácidos. não sendo necessário obter informações do(a) filho(a) e de sua mãe. vem gerando grande polêmica. e) seqüência de substâncias por seqüência de aminoácidos. para torná-lo mais preciso. que transferiu para as mulheres o controle da fertilidade. ainda muito elevado no Brasil. até abril. (04) para uma investigação de paternidade. em países como a Inglaterra. O título referiu-se a uma reportagem da qual foi extraído o trecho a seguir: Depois da pílula anticoncepcional. o teste de DNA surge como uma das grandes descobertas do mundo ocidental. foi anunciada a conclusão da fase do Projeto Genoma Humano em que se determinou a seqüência de.. "Trabalhando sem parar desde o final de 1997. mas outros tecidos. representado a seguir. no ano de 1999. é a substituição de a) seqüência de substâncias por seqüência de nucleotídeos. 312 . (16) o custo do exame de DNA.. 13(1):63. b) o número de proteínas que compõem os genes humanos. como pele e ossos. contém padrões dessas marcas de uma determinada família.] a técnica só traz benefícios. coletam-se amostras biológicas do suposto pai. e) o número total de genes humanos e quais as proteínas codificadas por esses genes. uma vez que podem ser entendidos como uma violação da privacidade biológica dos indivíduos. O conhecimento dessa seqüência permitirá determinar a) o número de cromossomos presentes nas células humanas. é CORRETO afirmar que: (01) os testes de DNA podem ser empregados para finalidades de investigação de paternidade e também para identificação de supostos criminosos. eles (os pesquisadores) já decifraram 75% do código genético dessa bactéria. a partir de testes de DNA. métodos que permitem a gravidez sem sexo. não restando qualquer questionamento ou dúvida sobre os diagnósticos apresentados. "Superinteressante". Sobre a utilização dos testes de DNA. com a identificação genética de criminosos e suspeitos.Questão 1377 A revista "Época". oferecem. (08) os exames de investigação de paternidade. ou seja. anunciou em sua capa: "O DNA não falha". e as implicações dessa prática para os indivíduos e a sociedade em geral. como em casos de estupros e assassinatos. Jan. 3 bilhões de nucleotídeos do genoma humano. Esse teste baseia-se na identificação de marcas genéticas específicas que podem ser encontradas no DNA da mãe. também podem ser utilizados. Para muitos especialistas [. (32) a criação de bancos de dados. resultados com exatidão total. Outros acreditam que reflexos da descoberta vão alterar o universo das relações familiares. d) cadeia de DNA por cadeia de RNA. A idéia é descobrir. aproximadamente. a seqüência de substâncias que constituem os cerca de 2000 genes da cadeia de DNA. c) código genético por conjunto total de proteínas. c) quantas moléculas de DNA estão presentes nos cromossomos humanos. Questão 1380 O exame de paternidade tem sido muito utilizado na medicina forense. do genoma do parasita".

576 RNAs mensageiros diferentes. obter a seqüência de bases nitrogenadas do DNA de todos os cromossomos de uma pessoa. c) é o que nos permitiria conhecer qual a real proporção de proteínas em relação às moléculas de DNA que possuímos.' Os números . principais células de defesa do sangue. foi publicada a seqüência do DNA da bactéria 'Escherichia coli. d) IV pode ser filho adotivo do casal. o principal componente do sangue. (4) A 'Escherichia coli' pode produzir 8. d) é o que foi conseguido pelos pesquisadores há alguns anos. (0) Uma vez obtida a seqüência de um gene. e os genes que codificam proteínas são 4. (3) Pode-se fazer estudos da evolução das bactérias. Questão 1382 Enquanto o projeto que visa seqüenciar completamente o genoma humano segue seu curso.impressionam: são cerca de 4.15. sendo apenas um passo no conhecimento de nosso genoma. Questão 1381 Está em andamento o projeto GENOMA. Questão 1384 O mapeamento de toda a seqüência de nucleotídeos existente nos 23 pares de cromossomos humanos a) é o que ainda falta fazer após a conclusão do projeto Genoma Humano em 2003. o DNA. nos últimos 2 anos chegaram ao fim vários seqüenciamentos do genoma de bactérias. (4) Todos os genes terão a mesma proporção de adenina e guanina.6 milhões de pares de bases. assinale a alternativa INCORRETA: a) I é filho biológico do casal. (3) O projeto GENOMA tem levantado questões éticas. comparando-se a seqüência de DNA de diferentes espécies. como.3 Com o auxílio do texto. mas não das hemácias. quando extraído do sangue. que só foi descoberto depois da conclusão do projeto Genoma Humano em 2003. b) das hemácias. julgue os itens a seguir. Questão 1385 Uma loja de animais mantinha para venda 4 exemplares de 'Ara ararauna' (arara azul-e-amarela) e alegava aos fiscais que os exemplares haviam nascido em cativeiro. A esse respeito. pelo eventual uso inadequado que se possa fazer do conhecimento obtido. não se sabe a seqüência de amionoácidos da proteína. c) das hemácias. pelo qual se pretende seqüenciar totalmente o DNA humano. por exemplo. julgue os itens que se seguem. dos leucócitos e do plasma. a partir de 313 om base neste resultado. e) significa decifrar o código genético. será possível conhecer a seqüência de aminoácidos da proteína correspondente. (1) O DNA da bactéria 'Escherichia coli' tem cerca de 9. Em setembro de 1997. 38% desses genes ainda não têm uma função conhecida. (1) As seqüências obtidas corresponderão exatamente ao DNA de qualquer pessoa. 1. b) II não é filho deste pai. ou seja. c) V não pode ser filho biológico deste casal. b) é a condição necessária para se saber o número de moléculas de RNA existentes em nosso organismo. Para surpresa de muitos. mas não do plasma.288. d) dos leucócitos.2 milhões de moléculas de fosfato. Questão 1383 Nos exames para teste de paternidade. (2) Para 38% dos genes. (2) A seqüência de todos os cromossomos será do mesmo tamanho. e) III é irmão biológico de I.5. é obtido a) das hemácias e dos leucócitos. e) dos leucócitos e das globulinas. a discriminação de pessoas.

e) fazendo-se uso delas. sendo exclusivamente produtos da indústria química. Questão 1388 Por sua capacidade de cortar o DNA em pontos específicos. por exemplo). testes de laboratório utilizando a melatonina indicaram bons resultados para controlar o mal de Alzheimer. b) removem os fosfatos e as pentoses. mantido pelo criador. cortando o DNA em locais determinados. A identificação de genes responsáveis por diversas doenças. O DNA foi extraído das células por processos químicos. 314 1. colocado sobre um gel suporte e submetido à corrente elétrica. no futuro. c) cada uma pode originar fragmentos de DNA com tamanhos diferentes. Questão 1389 Duas doenças não infecciosas que preocupam o homem moderno são a diabetes e o mal de Alzheimer. fragmentado com enzimas específicas. como a diabetes. d) são utilizadas nos atuais testes de DNA. e) impedem a clonagem de moléculas de DNA recombinante. c) inibir a síntese de DNA a partir de RNA. raios X. e) apenas os exemplares 2 e 3. a) os 4 exemplares. d) apenas os exemplares 1 e 4. que serão manipuladas. pode possibilitar. que podem ser visualizadas por tratamentos específicos (coloração. por exemplo. Questão 1386 As enzimas de restrição são as principais ferramentas bioquímicas empregadas em Engenharia Genética. d) cortar DNA onde ocorrem seqüências específicas de bases.15. Contudo. deixando somente as bases nitrogenadas. os fiscais do IBAMA suspeitaram se esses exemplares teriam nascido em cativeiro ou se teriam sido capturados na natureza. c) atuam como agentes de ligação entre DNA viral e . b) apenas os exemplares machos. b) inserindo cópias extras do alelo mutado. A migração diferencial dos fragmentos forma bandas (faixas) de DNA no gel. Fragmentos menores migram mais rapidamente em direção a um dos pólos da corrente. Enquanto a cura de diabetes está sendo pesquisada através da engenharia genética. b) inibir a síntese de RNA a partir de DNA. c) apenas os exemplares fêmeas. Sobre essas enzimas é INCORRETO afirmar que: a) reconhecem seqüências específicas de bases nitrogenadas.5.4 Os resultados obtidos indicam que podem ser filhos do casal. Com relação a essas substâncias é correto afirmar que a) são altamente específicas. Para esclarecer a questão. b) não existem em seres vivos. pode-se isolar um único gene de um cromossomo. o uso da terapia gênica. são utilizadas enzimas de restrição na engenharia genética. d) permitem somente a ligação de pedaços de DNA de um mesmo tipo celular. e) modificar seqüências de bases do DNA. originando fragmentos dessa molécula.um casal mantido em um criatório autorizado pelo IBAMA. Questão 1387 Enzimas de restrição são fundamentais à Engenharia Genética porque permitem a) a passagem de DNA através da membrana celular. Essa técnica tem por objetivo "corrigir o efeito da mutação" a) induzindo mutações nos genes responsáveis pela doença. O padrão de bandas é exclusivo de cada indivíduo. ou "impressão digital de DNA". A ilustração apresenta o resultado do teste bacteriano. colheu-se uma amostra de sangue de cada um dos animais e fez-se um teste para determinação de paternidade pelo método do DNA-Fingerprint.

é correto afirmar: a) Fragmentos de DNA exógeno são inseridos no genoma de células hospedeiras por meio de plasmídeos. Questão 1393 A tecnologia do DNA recombinante permitiu a inserção e a expressão. d) auxiliar no processo de transcrição do mRNA. Questão 1392 Todas as alternativas apresentam aplicações da tecnologia do DNA recombinante nas duas últimas décadas. e) inibindo a expressão do gene mutado nas células secretoras da proteína. de proteínas humanas de interesse médico. Questão 1390 A biotecnologia tornou possível a transferência de material genético entre os mais diversos organismos. b) O genoma exógeno é inserido no núcleo hospedeiro por meio de vetores protéicos conhecidos como plasmídeos. que representa um determinado experimento.c) substituindo o alelo mutado ou adicionando uma cópia correta do alelo.5 315 . EXCETO a) Independência de pâncreas de animais para produção de insulina b) Obtenção de uma nova espécie de bactéria produtora de insulina humana c) Possibilidade de expressão em bactérias de outros genes de interesse médico d) Possibilidade de tratamento para pacientes com intolerância à insulina animal Questão 1394 Para minimizar o uso de inseticidas sintéticos na fruticultura e atender às normas de segurança alimentar da FAO ("Food and Agriculture Organization"). c) O DNA gênico endógeno é inserido no núcleo de células hospedeiras por meio de plastídeos funcionais. d) produzindo proteínas funcionais em organismos de outra espécie. e) Fragmentos de genes exógenos são inseridos no genoma das células hospedeiras por meio de plastídeos nucleares. d) O DNA endógeno é transferido para genomas hospedeiros por meio de plasmídeos mitocondriais. d) Terapia gênica de algumas doenças hereditárias. em bactérias. Todas as alternativas apresentam resultados esperados do êxito dessa técnica. estão sendo implantadas "biofábricas" de controle de pragas no Nordeste do Brasil. 1. EXCETO a) Investigação de paternidade e criminalística. Essas "biofábricas" podem adotar todas as seguintes tecnologias.5. que são administrados a pacientes de todo o planeta. que têm a propriedade de cortar o DNA em pontos específicos. provavelmente: a) proteger as bactérias contra os vírus bacteriófagos. c) auxiliar no processo de duplicação do DNA. e) auxiliar no processo de tradução do DNA. Sobre a produção de organismos geneticamente modificados. c) Produção. O papel biológico dessas enzimas bacterianas na natureza é. em bactérias. b) Recuperação de espécies extintas. Os conhecimentos da área são aplicados com sucesso na produção industrial da insulina e do hormônio de crescimento. EXCETO a) Produção de parasitas das pragas b) Extração de inseticidas naturais c) Criação de comensais das pragas d) Produção de machos estéreis das pragas Questão 1395 Analise a figura a seguir.15. do gene humano responsável pela síntese da insulina. Questão 1391 As principais ferramentas empregadas na tecnologia do DNA recombinante são as enzimas de restrição. b) reparar o DNA bacteriano que sofreu mutação deletéria.

Cada colega lembrou um aspecto das aulas. e) enzima de restrição. d) A utilização de enzimas de restrição permite cortar o DNA nos locais onde reconhecem o ácido fosfórico. soube pelos colegas que o assunto trabalhado fora Biotecnologia. plasmídio e enzima de restrição. b) enzima transcriptase reversa. a forma de atuação dessas enzimas. corretamente. separando-o sempre em nucleotídeos individuais. conhecidas como enzimas de restrição. e) As enzimas de restrição quebram o DNA. d) eletroforese. ( ) se duas diferentes moléculas de DNA forem cortadas por uma mesma enzima de restrição serão produzidos iguais conjuntos de fragmentos. plasmídio e enzima ligase. já possibilitou a obtenção de resultados benéficos para a medicina e para outras áreas do conhecimento. Com relação a esse tema. ( ) são obtidos segmentos de DNA. ( ) a tecnologia do DNA recombinante (ou Engenharia Genética) fundamenta-se na fusão de "trechos" de DNA de diferentes organismos para a construção de DNA híbrido. como a transcriptase reversa. RNA plasmidial e enzima transcriptase reversa. 316 . dispersas no citoplasma bacteriano e que têm replicação independente do cromossomo. cromossomo circular e enzima de restrição. a) As enzimas de restrição cortam o DNA apenas nos locais onde existem certas seqüências de bases nitrogenadas. b) hibridação intraespecífica. Isto pode ser feito graças ao instrumental bioquímico da engenharia genética disponível nos dias de hoje. Preocupado com os conteúdos da disciplina de Biologia. e) amniocentese. Questão 1399 Pedro estava doente e perdeu uma semana de aulas. c) aconselhamento genético. 2 e 3 indicam. RNA plasmidial e enzima exonuclease. b) As enzimas de restrição cortam o DNA nos locais onde reconhecem o açúcar desoxirribose. para o corte e a separação do segmento de DNA a ser estudado. e a inclusão em (2) do segmento obtido (gene isolado) com o auxílio de enzimas do tipo (3). d) enzima transcriptase reversa. Questão 1398 O Projeto genoma humano tem como objetivo determinar a seqüência de bases de todos os genes de nossa espécie. respectivamente: 1. como as enzimas bacterianas.5 a) enzima de restrição. Questão 1397 Para um pesquisador transferir um gene de interesse. através de cortes com exonucleases. c) DNA recombinante. ( ) promove-se o corte de moléculas de DNA com o uso de enzimas que reconhecem seqüências nucleotídicas específicas no DNA. Questão 1396 A manipulação genética de microorganismos. a extração e o rompimento de (2). Os números 1. Assinale a alternativa que apresenta. c) A utilização das enzimas de restrição permite separar moléculas de DNA de acordo com seu tamanho e carga elétrica. com genes de interesse. entre as quais: a utilização de enzima do tipo (1).5.15.) Produção de DNA recombinante (plasmídio de uma bactéria/ gene do vaga-lume) 2) Introdução do DNA em célula de tabaco 3) Multiplicação da célula de tabaco com o gene do vaga-lume 4) Desenvolvimento de uma planta de tabaco com o gene do vaga-lume (planta que fluoresce) O experimento ilustrado é: a) produção de transgênicos. principalmente a manipulação de bactérias. é verdadeiro afirmar que: ( ) são utilizadas pequenas porções circulares de DNA. diferentes etapas são cumpridas em laboratório.

EDUARDO lembrou que a identidade genética individual pode ser estabelecida pela técnica DNA 'fingerprint'.diabetes c) plasmina .. . vetor. c) apenas as afirmações de Eduardo e Joana. vetor. uma das quatro empresas em todo o mundo e a única no hemisfério sul a deter a tecnologia de produção desta insulina. (1) As técnicas de engenharia genética permitem a 317 ..5.. Com o auxílio do texto. o interferon e a calcitonina. atuando sobre a medula óssea vermelha. plasmídio e transgene. Ao grupo da UnB coube a parte de Biologia Molecular. 1.. .esterilidade Questão 1401 A figura a seguir representa de forma esquemática o processo de clonagem de genes do "Mycobacterium tuberculosis".... plasmídeos são utilizados como vetores para a clonagem de genes..15.. Indivíduos submetidos a hemodiálises são injetados com essa proteína e apresentam sua . p.leucocitose e) hormônio de crescimento . Os rins produzem esse hormônio.... 2. clone e vetor. as enzimas de restrição são aquelas que podem cortar o DNA em pontos determinados. os números 1. b) DNA recombinante. para fins terapêuticos.Segundo LAURA. a) eritropoietina . um dos mais significativos produtos do avanço científico nacional na área da engenharia genética. Mariana e Laura. b) apenas as afirmações de Mariana. .7(com adaptações).. Entre os importantes avanços conquistados pela tecnologia do DNA recombinante. d) apenas as afirmações de Rafael e Joana.. julgue os itens abaixo. . Laura e Rafael..RAFAEL definiu proteoma como o conjunto de proteínas expressas pelo genoma. que.coagulação d) fator VIII .. Questão 1400 Assinale a alternativa que preenche corretamente as lacunas do parágrafo a seguir. d) DNA transgênico. em um plasmídio de bactéria. na ordem em que aparecem.. que utiliza DNA codificante.. estimula a divisão de células-tronco...De acordo com MARIANA.. DNA recombinante e organismo transgênico.. . 3 e 4 representam. está prestes a chegar ao mercado com o nome de Biohulin: a empresa BIOBRÁS. Pedro conversou com a professora e constatou que estavam corretas a) apenas as afirmações de Eduardo. reduzida.5 om relação ao processo de clonagem gênica esquematizado acima. Questão 1402 CHEGA AO MERCADO UM NOVO FÁRMACO INTEIRAMENTE DESENVOLVIDO NO PAÍS A insulina humana recombinante (IH-r)... deu início aos trabalhos. inicia em 1999 a comercialização do produto. jan/99. DNA recombinante. Uma parceria entre a BIOBRÁS e a Universidade de Brasília (UnB). Esta conquista tecnológica permitirá o desenvolvimento de outros medicamentos. ou impressão digital genética. Informe PADCT/Ministério da Ciência e Tecnologia. Ao voltar à escola.anemia b) insulina .. em 1988. plasmídio..JOANA relatou que vacinas genéticas são usadas para inocular nas pessoas microorganismos vivos transgênicos ou atenuados. como o hormônio de crescimento. vetor e plasmídio. desenvolvendo clones de bactérias produtoras de insulina. c) DNA. está a produção de ... e) as afirmações de todos os colegas. respectivamente.. a) DNA recombinante.

Assinale a alternativa que aponta uma limitação do uso de célula-tronco para "possível e futura" cura de doenças genéticas. Questão 1406 Observe o esquema. (2) Para que uma bactéria passe a produzir insulina humana. que mostra a diferenciação de células-tronco humanas nos elementos figurados indicados. d) fundirem-se com o tecido hospedeiro. d) A célula-tronco só pode ser obtida por clonagem terapêutica.htm) Enquanto as demais células do organismo só podem fazer parte de um tecido específico. qualquer que seja a sua origem. b) a quantidade de genes nucleares.6 318 . segundo a Comissão Técnica Nacional de Biotecnologia (CTNBio). 1.15. e) O Brasil não tem cientistas especializados para a realização desse tipo de pesquisa. idênticas a si mesma. Questão 1404 Células-tronco são células indiferenciadas que têm a capacidade de se diferenciar em diversos tipos celulares. portanto.com. cromossomicamente e geneticamente.5.estadao. c) No Brasil não há permissão para o desenvolvimento de pesquisas com célula-tronco. Por essa razão seu uso para a cura de doenças é bastante promissor. provoca mutações e malformações.recombinação de genes entre organismos totalmente diferentes. e) a estrutura de genes específicos por mutações. Por reprodução ela gera células. prática que. (4) A partir da insulina produzida por bactérias. a) As células-filhas geradas por ela são cromossomicamente e geneticamente diferentes da célula-mãe originando. c) a quantidade de genes mitocondriais. eliminando as possibilidades de rejeição imunológica. c) alterarem a constituição genética do tecido hospedeiro. Questão 1403 A expectativa em torno da utilização das células-tronco decorre do fato de estas células a) incorporarem o genoma do tecido hospedeiro. o "autotransplante". (3) O Biohulin será um medicamento destinado ao tratamento de diabéticos. Para que ocorra tal diferenciação. (adaptado de http://www. a não ser nas doenças genéticas. tecidos diferentes daquele que se deseja. a "célula-tronco" tem a capacidade especial de se diferenciar e constituir diferentes tecidos no organismo. d) o padrão de atividade dos genes. pode ser obtido o hormônio de crescimento. b) eliminarem os genes causadores da doença no tecido hospedeiro.br/educando/noticias/2004/mai/10/ 69. as células-tronco terão necessariamente que alterar a) o número de cromossomos. sugere uma melhora aparente do quadro clínico em pacientes com insuficiência cardíaca. e) sofrerem diferenciação que as torna parte integrante e funcional do tecido hospedeiro. b) As células-filhas geradas são cromossomicamente e geneticamente iguais à célula-mãe inclusive no caso de haver gene "defeituoso". Questão 1405 Segundo a doutora Mayana Zats (USP) um estudo recente com células-tronco retiradas da medula e injetadas no coração da própria pessoa. ela deve receber altas doses dessa proteína.

A alternativa que contém todas as afirmativas corretas é: a) I e II b) I e IV c) III e IV d) I.6 Um jovem biólogo de São Paulo descobriu porque as células-tronco do cordão umbilical são mais eficientes em transplantes do que as da medula óssea. também. à medida que se diferenciam. vão reduzindo sua potencialidade. Questão 1408 A pesquisa com células tronco tem-se tornado de grande importância para recuperação de órgãos lesionados que não têm capacidade de regeneração de suas células. e) não se reproduzem com facilidade. assinale a afirmativa INCORRETA. II. considere as afirmativas a seguir. d) Na medula óssea de um adulto. Ele encontrou um grupo de genes que seguem um mesmo mecanismo e são mais ativos em células do cordão. portador de lesão no miocárdio. a) A célula-tronco é pluripotente com capacidade de se diferenciar em diversos tipos celulares. Fonte: "O Estado de São Paulo".Assinale a afirmativa INCORRETA. III. Ele deseja descobrir maneiras de manipular os genes para obter melhores resultados terapêuticos ou estimular a formação artificial de tecidos. Células tronco hematopoéticas apresentam potencial para diferenciar-se em qualquer célula do sangue e também gerar outras células tronco. d) Apenas 2 das células diferenciadas apresentam núcleo. Isso acontece com a pele. em cordões umbilicais e também em diversos tecidos no indivíduo adulto. b) A capacidade de diferenciação das células precursoras se deve à alteração na expressão gênica específica. com os epitélios intestinais e especialmente com o sangue. c) têm algo grau de especialização. b) Pelo menos 3 tipos de células diferenciadas no esquema dado são encontradas no sangue. As células-tronco podem ser retiradas. I. As células tronco têm grande poder de regeneração porque: a) têm todos os seus genes funcionando. c) Plaquetas e hemáceas não apresentam capacidade de proliferação mitótica. c) Células-tronco podem ser encontradas em embriões.15. que tem suas células destruídas e renovadas constantemente. como mostra o esquema a seguir: 1. Questão 1409 Alguns tecidos do organismo humano adulto se regeneram constantemente por meio de um processo complexo e finamente regulado. 14/02/2006 Sobre esse assunto. existem células-tronco capazes de dar origem a células diferenciadas de todos os tecidos humanos. IV. b) todos os seus genes estão desligados. II. A hematopoese resulta da diferenciação e da proliferação simultânea de células tronco que. III. Baseado nas informações anteriores e nos conhecimentos sobre o tema. d) são pouco especializadas. a) Células-tronco são células capazes de se diferenciar dando origem a diversos tipos de células. As diferentes linhagens hematopoéticas geradas no sistema apresentam altas taxas de proliferação. de embriões em sua fase 319 . e III e) II. Questão 1407 BIÓLOGO MAPEIA GENES DO CORDÃO UMBILICAL. Existe um aumento gradual da capacidade de auto-renovação das células durante este processo.5. IV Questão 1410 Experimentos recentes indicam que células-tronco retiradas da medula óssea de um indivíduo adulto. puderam formar tecido normal quando implantadas na região lesada do coração.

II e III.A clonagem de células-tronco embrionárias pode ser utilizada com fins terapêuticos ou reprodutivos. A origem do problema estava relacionada à degeneração do baço. Paulo". e) I. posteriormente estimulado para que se dividisse e virasse um embrião dentro da mãe adotiva. Quais estão corretas? a) Apenas I. 320 1. que autoriza a pesquisa com células-tronco obtidas a partir de embriões humanos remanescentes de tratamentos de infertilidade armazenados por pelo menos três anos. d) I e II. ("Folha de S. O animal clonado. .) A partir do texto e do que se conhece sobre clonagem. isto é. a alternativa que indica o tipo de célula que possui a característica mais vantajosa para as variáveis I. respectivamente. b) usando o mesmo pai genético. A origem do problema estava na produção de glóbulos vermelhos pela medula espinhal. II e III. c) Apenas I e II. apenas. A origem do problema estava na produção de glóbulos vermelhos a partir de células-tronco da medula óssea. Ao invés de adultos jovens.As células-tronco retêm o potencial de dar origem a células-filhas mais especializadas. 03. Analise as hipóteses apresentadas pelos cientistas para tentar explicar esses casos incomuns.08. II. considere as seguintes afirmações. Mais intrigante: a anemia dos idosos não cedia ao tratamento convencional.adulta . II . e) I. é possível obter um outro clone que seja fêmea. III . I . utilizando uma célula obtida da orelha do pai genético.embrionária Questão 1411 Em março de 2005.adulta c) embrionária . Os cientistas tiraram material genético da célula e o colocaram em um óvulo esvaziado do seu núcleo.adulta b) adulta . d) Apenas II e III.2005. c) III. é : a) embrionária . eram os idosos que apresentavam uma expressiva redução na taxa de hemoglobina.uma célula-tronco deve ter o poder de se renovar indefinidamente pela divisão celular. aquelas possíveis de serem aceitas pela comunidade científica. A tabela a seguir informa as características de algumas variáveis analisadas em células-tronco embrionárias e adultas. apenas. estão corretas: a) I. b) II. c) o clone gerado terá o genótipo Afgham e o fenótipo Labrador e será do sexo masculino. II e III. Questão 1412 Há vinte anos. recebeu o nome de Snuppy .5. casos incomuns de anemia começaram a chamar a atenção dos pesquisadores. da raça Labrador. apenas. Questão 1413 Cientistas sul-coreanos clonam pela primeira vez um cachorro. foi promulgada a Lei de Biossegurança. podemos afirmar corretamente que: a) é possível obter células-tronco embrionárias usando-se células diferenciadas de um adulto. Considerando hipóteses plausíveis. e nasceu 60 dias após. III. I.adulta . b) Apenas II.embrionária .6 Considerando o uso terapêutico das células-tronco. que nesses idosos deixou de produzir glóbulos vermelhos. Sobre essas células. da raça Afgham.inicial de desenvolvimento.15.embrionária .embrionária d) embrionária . como habitualmente. apenas.

Seu veneno tem ação proteolítica e coagulante e o antiofídico específico é o soro antibotrópico. pois o tradicional prato de "feijão. a) Beber somente água filtrada ou fervida. Questão 1414 A cólera é uma doença infecciosa causada por uma bactéria descoberta em 1884. 3 e 4 Questão 1417 Uma planta feminina de angiosperma com genótipo PP foi cruzada com uma masculina pp. como proteínas. b) malária. as lesões coronarianas reduziram-se a um nível mínimo. podendo haver gangrena. arroz. d) Lavar. Essa bactéria ataca o intestino humano fazendo com que o organismo elimine grande quantidade de água e sais minerais. Os órgãos envolvidos com a saúde pública têm mostrado preocupação constante com a dieta do povo brasileiro.Pertence ao gênero Bothrops e seu veneno tem potente ação neurotóxica e coagulante. bife e salada" está sendo substituído por comidas industrializadas e com alto teor calórico. pois elas serão degradadas em aminoácidos. que o Brasil está se tornando um país de obesos. I.Pertence ao gênero Crotalus e seu veneno tem ação neurotóxica e homolítica. Com base no texto e nos conhecimentos sobre o tema. frutas. A doença parasitária a que esse texto se refere é a a) amebíase. considere as afirmativas a seguir. causando desidratação. e com água limpa. usados como fonte na síntese 321 . considere as proposições: 1 . respectivamente. carboidratos. muito bem. e) o ambiente celular do Labrador alterou a expressão genotípica do núcleo transplantado. b) Lavar as mãos com sabão antes das refeições e ao deixar o sanitário. gorduras. 3 . Questão 1416 Um sério risco a que está exposto o trabalhador rural em nosso país é o de acidentes com animais peçonhentos. II. 4 . pesquisadores brasileiros da FIOCRUZ foram pioneiros em utilizar células-tronco da medula óssea de um paciente que apresentava insuficiência cardíaca devido a uma doença parasitária. d) doença de Chagas. As sementes resultantes devem apresentar embrião e endosperma. Com o tratamento. que posteriormente recebeu o nome de 'Vibrio cholerae'. 2 . O prato tradicionalmente consumido pelo brasileiro apresenta elementos essenciais ao metabolismo. principalmente verduras e peixes. Dentre estes um dos mais temíveis e agressivos do gênero é a cobra surucucu. c) Tomar vacina tríplice periodicamente. A ingestão de proteínas é importante. As proposições que estão corretas são as indicadas por: a) 2 e 3 b) 1. Dentre as alternativas a seguir. legumes e verduras antes de comê-los. vitaminas e sais minerais. assinale aquela que NÃO é medida de prevenção desta doença. c) doença do sono. Com relação à surucucu. Estima-se que o consumo de feijão e de arroz caiu em torno de 30% nos últimos anos.d) o núcleo do óvulo inserido em uma célula de orelha anucleada origina uma fêmea Labrador. e) Evitar comer alimentos crus. e) febre amarela. Questão 1415 Células-tronco vêm sendo utilizadas com sucesso para amenizar os sintomas de pacientes com insuficiência cardíaca devida a infarto do miocárdio. Recentemente. 2 e 4 c) 3 e 4 d) 1 e 4 e) 2.O princípio ativo do seu veneno provoca intensa dor no local da inoculação. freqüentemente. a) PP e pp b) Pp e Pp c) Pp e PPP d) Pp e PPp e) PP e Ppp Questão 1418 Os meios de comunicação têm noticiado. especialmente no caso de se utilizar torniquetes.

b) hereditária. se houver comprometimento no sistema nervoso central. que ficou famoso por interpretar o "Super-Homem". III . d) o pâncreas. Questão 1421 Em outubro de 2004 faleceu o ator cinematográfico Christopher Reeve. causada por um vírus e transmitida por mosquitos. e) II. b) I e IV. o acidentado deve ser imobilizado na horizontal e utilizar um colar cervical para ser transportado até um hospital. 322 . d) I. era um ativista a favor das pesquisas com clonagem terapêutica para obtenção de células tronco. d) podem dar origem a linfócitos T que. b) I e III são corretas.A utilização do colar cervical não evita lesões no sistema nervoso periférico. Questão 1420 O tratamento da leucemia por meio dos transplantes de medula óssea tem por princípio a transferência de células-tronco da medula de um indivíduo sadio para o indivíduo afetado. cuja lesão pode levar à paralisia.das proteínas codificadas pelo organismo. II . a) I e II são corretas. II e III. cujo sintoma é o excesso de açúcar no sangue e a falta de insulina. na forma de energia química.Após um acidente como o ocorrido com Reeve. porque no interior da coluna vertebral está a medula óssea vermelha. e) podem dar origem a todos os diferentes tipos de células sangüíneas. O sistema nervoso periférico poderá ficar inativo. c) II e IV. que ficou tetraplégico em 1995 ao cair de um cavalo. por sua vez. pois essas moléculas preservam. Os carboidratos e lipídios da dieta são fonte importante de energia para os organismos. Os ácidos nucléicos ingeridos são incorporados ao DNA do organismo. que causa má formação dos ossos. de onde são retiradas células da massa celular interna (células tronco) que têm capacidade de regenerar órgãos lesados. Marque a alternativa correta. IV. c) secretam substâncias que inibem o crescimento celular. apenas no sistema nervoso central. III e IV. e) contagiosa. analise as afirmativas a seguir. já que foram diferenciadas em outra pessoa. Reeve. b) não serão afetadas pela doença. que causa problemas de coagulação sanguínea. c) II e III são corretas.A clonagem terapêutica por transferência nuclear permite a obtenção de blastocistos. d) congênita. se houver suspeita de lesão na coluna vertebral. e) o baço. c) a hipófise. c) infecciosa. Questão 1422 A hemofilia se caracteriza por ser uma doença: a) adquirida. Recuperou-se e passou a viver normalmente. razão pela qual questiona-se o consumo de alimentos transgênicos. que causa problemas de coagulação sanguínea. boa parte da energia gasta para a sua síntese. d) Apenas III e correta. ingerem os leucócitos em excesso. Com relação ao assunto abordado. Tal procedimento fundamenta-se no fato de que essas células-tronco a) podem ser usadas para a clonagem de células sadias do paciente. um paciente teve que se submeter a uma cirurgia que removeu uma parte do seu corpo. Questão 1419 Após um traumatismo. I . III. A parte retirada era a) o fígado. Estão corretas apenas as afirmativas: a) I e III. b) o diafragma. após um acidente.

. Questão 1426 Atualmente muitos casais têm-se interessado em escolher o sexo do futuro filho. invadido por células sangüíneas e bactérias. que apresenta os cromossomos sexuais X e Y no núcleo de suas células germinativas. analise as afirmativas adiante: ( ) A opção por indivíduos do sexo masculino pode ser justificada por sua menor suscetibilidade a doenças genéticas e por apresentarem um par de genes localizados nos cromossomos X e Y. um modo como essas células do sangue podem realizar seu papel de defesa. após a meiose. ( ) Na espécie humana o sexo da prole é determinado pelo pai. processo que engloba bactérias invasoras. é correto afirmar: a) O sexo genético é determinado na fecundação. identificando a presença do cromossomo sexual por meio da análise do citoplasma.10. d) O embrião XX desenvolverá testículos e o embrião XY desenvolverá ovários. A figura a seguir mostra. c) O tecido conjuntivo. A partir dos estudos sobre herança mendeliana. São elas: a) composição química complexa e estado coloidal. de forma esquemática. b) Os cromossomos autossômicos são os responsáveis pela determinação do sexo genético do indivíduo. pois envolve um grupo de células especializadas. e) capacidade de reprodução e hereditariedade.Questão 1423 O sangue pode realizar várias funções no nosso corpo. divisão celular e comportamento dos cromossomos na meiose. c) A probabilidade de o genitor masculino produzir gametas do tipo Y é maior que a do tipo X. como ocorre na China. Acreditava-se que o sexo do embrião era definido por fatores como a nutrição materna. a de defesa contra microrganismos é realmente notável. pode apresentar um quadro inflamatório. Questão 1425 Desde a época de Aristóteles. quando ocorre a fusão dos núcleos masculino e feminino. a) Os neutrófilos são glóbulos brancos capazes de atravessar as paredes dos capilares sangüíneos. d) Os glóbulos brancos que saem dos capilares podem realizar fagocitose. Dentre elas. e) O sexo genético é determinado pelo número de cromossomos X presentes no embrião. Essa escolha é importante para estes casais uma vez que a constatação de um feto do sexo feminino pode provocar a decisão de um aborto não-natural. ( ) A tentativa de aborto por meio da ingestão de poções 323 1. d) consumo de energia e renovação contínua da matéria. comprovou-se que a determinação do sexo decorre de uma constituição cromossômica específica. b) A destruição de bactérias que invadem o tecido conjuntivo depende de moléculas enzimáticas produzidas pelos glóbulos vermelhos. especula-se sobre os mecanismos envolvidos na determinação do sexo dos humanos. ( ) O exame de urina da mãe é uma técnica usada na identificação do sexo do futuro bebê. Nesse sentido. porque detecta as células fetais existentes no líquido amniótico e na placenta. b) elevado grau de organização e execução das funções vitais. Questão 1424 Embora a continuidade da vida na Terra dependa substancialmente de todo o elenco de características que definem os sistemas viventes. que determinam uma maior longevidade para o indivíduo. estes são distribuídos entre os espermatozóides. duas dessas características assumem maior importância para a preservação da vida no planeta. Com base nos conhecimentos sobre o tema. c) manutenção da homeostase e alto nível de individualidade. onde os pais muitas vezes optam pelo nascimento de um único filho do sexo masculino.11 ssinale a afirmativa INCORRETA.

62) Atualmente as leveduras têm sido usadas para produzir vacinas. p. Em todos esses casos o 'trabalho' é feito por uma levedura (um tipo de fungo). como contra a hepatite B. Um suco de uva transforma-se em vinho e um repelente mingau de cevada e centeio torna-se uísque ou cerveja. julho de 2003. c) do DNA recombinante. b) de células-tronco.vegetais ou de outras drogas abortivas pode não eliminar o feto. Esta vacina consiste do antígeno de superfície do vírus da hepatite B produzido em células de levedura. v. mas promover a má-formação do corpo do bebê e comprometer a saúde da mãe. Ciência Hoje. Panek. Isto só é possível graças à tecnologia a) de clonagem de organismos. e) do RNA in vitro. d) do teste do DNA. Questão 1427 A levedação do pão e a fermentação alcoólica são as primeiras tecnologias de que se têm notícia. (Adaptado de Anita D. 324 . As leveduras mais usadas hoje. no 195.33. na fabricação tanto de pães quanto de vinhos. em um processo usado há milênios pela humanidade para obter alimento e prazer. são as do gênero 'Saccharomyces'.