Título: A maior lista de genética da história!

Professor: André Braga Turma: AeB
Questão 1 O texto que se segue foi extraído de "Xadrez, truco e outras guerras", de José Roberto Torero. Servimos-nos de algumas de suas estruturas para introduzir a(s) questão(ões) seguintes. "Os abutres, sábios animais que se alimentavam do mais farto dos pastos, já começavam a sobrevoar a ala dos estropiados quando o General mandou que acampassem. Naquela tarde assaram trinta bois, quantidade ínfima para abastecer os homens que ainda sobravam.... O plano dos comandantes era assaltar fazendas da região e tomar-lhes o gado... À noite a ração foi ainda mais escassa, e, para enganar a fome, fizeram-se fogueiras para assar as últimas batatas e umas poucas raízes colhidas pelo caminho. Como o frio também aumentava, surgiu um impasse: quem ficaria perto do fogo: os coléricos, que logo morreriam, ou os sãos, que precisavam recuperar as forças para a luta?" (TORERO, J. Roberto. "Xadrez, truco e outras guerras") "(...) os coléricos, que logo morreriam, ou os sãos, que precisavam recuperar as forças para a luta?" Muitas doenças podem provocar a morte. a) A afirmação "os coléricos, que logo morreriam" é falsa ou verdadeira? Justifique. b) Justifique e exemplifique: Muitas doenças são hereditárias e sua manifestação está na dependência da ação de genes específicos ou de alterações cromossômicas. Questão 2 O texto abaixo refere-se às questões: 2 a 3 O experimento clássico de Meselson e Stahl, em 1957, demonstrou que a replicação do DNA era semiconservativa, ou seja, cada fita do DNA serve de molde para sua própria duplicação, formando moléculas de DNA idênticas à original. Nesse experimento, os cientistas cultivaram células de 'Escherichia coli' inicialmente em presença de fonte de ¢¥N (isótopo de nitrogênio leve), trocando, a seguir, por ¢¦N (isótopo pesado), que é incorporado às bases nitrogenadas do DNA. Colheram, então, amostras de DNA após a primeira e a segunda gerações de células crescidas em ¢¦N e analisaram essas amostras quanto à densidade do DNA formado. Considere como PESADO o DNA dupla hélice marcado com ¢¦N; como LEVE o marcado com ¢¥N; como INTERMEDIÁRIO o marcado com ¢¥N e ¢¦N. Justifique por que, após a troca da fonte de nitrogênio, a primeira geração de células foi totalmente constituída com DNA dupla hélice do tipo INTERMEDIÁRIO. Questão 3 Calcule as proporções dos três tipos de DNA dupla hélice LEVE, INTERMEDIÁRIO E PESADO - formados em células da segunda geração, após a troca da fonte de nitrogênio. Questão 4 "O agronegócio responde por um terço do PIB, 42% das exportações e 37% dos empregos. Com clima privilegiado, solo fértil, disponibilidade de água, rica biodiversidade e mão-de-obra qualificada, o Brasil é capaz de colher até duas safras anuais de grãos. As palavras são do Ministério da Agricultura e correspondem aos fatos. Essa é, no entanto, apenas metade da história. Há uma série de questões pouco debatidas: Como se distribui a riqueza gerada no campo? Que impactos o agronegócio causa na sociedade, na forma de desemprego, concentração de renda e poder, êxodo rural, contaminação da água e do solo e destruição de biomas? Quanto tempo essa bonança vai durar, tendo em vista a exaustão dos recursos naturais? O descuido socioambiental vai servir de argumento para a criação de barreiras não-tarifárias, como a que vivemos com a China na questão da soja contaminada por agrotóxicos?" (Adaptado de Amália Safatle e Flávia Pardini, Grãos na Balança. "Carta Capital", 01/09/2004, p. 42.) A contaminação por agrotóxicos também é mencionada no texto. A aplicação intensiva de agrotóxicos a partir da década de 1940 aumentou a produtividade na agricultura. Atualmente, são produzidas e cultivadas plantas
1

transgênicas, isto é, geneticamente modificadas para serem resistentes à ação de insetos. Um exemplo conhecido é o milho geneticamente modificado com um gene da bactéria 'Bacillus thuringensis' (Bt), o que lhe confere resistência a ataques de insetos. Contudo, alguns pesquisadores têm observado que diferentes espécies de insetos adquirem resistência às toxinas bioinseticidas produzidas por essas plantas. a) Explique como os insetos se tornam resistentes. b) Sabe-se que a aplicação intensiva de agrotóxicos, como o DDT, pode afetar a cadeia alimentar tanto de ambientes aquáticos como de solos. Explique por que isso ocorre. Questão 5 Atualmente, um grande esforço tem sido feito por diversos centros de pesquisa e de tratamento de pessoas queimadas para produzir grandes áreas de pele, do próprio indivíduo, que possam recobrir imediatamente áreas destruídas. Explique a vantagem de se utilizar a pele do próprio indivíduo para recobrir as áreas destruídas, ao invés de serem utilizados enxertos de pele de outras pessoas. Questão 6 O desenho a seguir mostra a síntese de um polipeptídio a partir da molécula de DNA num certo organismo. Esse organismo é um procarioto ou um eucarioto? Por quê?

b) A clonagem de bactérias, comparada à clonagem de animais, é um processo mais complexo ou mais simples? Justifique. Questão 8 O gráfico a seguir demonstra a distribuição citoplasmática do número de ribossomas isolados e polirribossomas, em comparação com o número de cadeias polipeptídicas em formação durante um certo período de tempo.

1.1.3.2

(Adaptado de ALBERTS, Bruce & outros. "Molecular biology of the cell". New York, Garland Publishing, 1994, p.239) a) Defina a relação existente entre os ribossomas isolados e a formação das cadeias polipeptídicas. Justifique sua resposta. b) Descreva a estrutura das cadeias polipeptídicas e a dos polirribossomas. Questão 9

1.1.1.2 Um certo tipo de macromolécula destinada à membrana plasmática celular, depende de etapas nucleares e citoplasmáticas para sua produção, de acordo com os percursos esquematizados a seguir:

Questão 7 Nas bactérias, a cadeia respiratória encontra-se associada à membrana plasmática e os ácidos nucléicos estão associados ao citoplasma. a) É assim também em um protista, em um animal e em um vegetal? Justifique.
2

Questão 12 Ribossomos são formados por RNA e proteínas, sintetizados pelos processos de transcrição e tradução, respectivamente. a) Onde esses processos ocorrem na célula eucariótica? b) O que acontecerá com os processos de transcrição e tradução, se ocorrer uma inativação na Região Organizadora do Nucléolo? Justifique. Questão 13 a) Por que essas etapas começam no núcleo? b) Qual é a composição da macromolécula ao final do percurso I? E do percurso II? Esclareça a diferença, baseando-se nas funções das organelas citoplasmáticas envolvidas em cada percurso. Questão 10 Uma espécie de lombriga de cavalo possui apenas um par de cromossomos no zigoto (2n=2). Um macho dessa espécie, heterozigótico quanto a dois pares de alelos (Aa Bb) formou, ao final da gametogênese, quatro tipos de espermatozóides normais com diferentes genótipos quanto a esses genes. a) Qual é o número de cromossomos e o número de moléculas de DNA no núcleo de cada espermatozóide? b) Quais são os genótipos dos espermatozóides formados? c) Por que, a partir das informações fornecidas, não é possível estimar a proporção em que cada um dos quatro tipos de espermatozóides aparece? Explique. Questão 11 Uma mulher com a idade de 40 anos está grávida do primeiro filho. Ela sabe que, devido à sua idade, o bebê tem maior probabilidade de ser portador de alguma anomalia cromossômica. A cariotipagem pré-natal é o exame mais indicado para esclarecer estas dúvidas na fase uterina. Pergunta-se: a) Em que consiste este exame? b) Que exemplos de anomalias cromossômicas podem ser detectadas através deste exame (cite dois exemplos). Criadores e sitiantes sabem que a mula (exemplar fêmea) e o burro (exemplar macho) são híbridos estéreis que apresentam grande força e resistência. São o produto do acasalamento do jumento ('Equus asinus', 2n = 62 cromossomos) com a égua ('Equus caballus', 2n = 64 cromossomos). a) Quantos cromossomos têm o burro ou a mula? Justifique sua resposta. b) Considerando os eventos da meiose I para a produção de gametas, explique por que o burro e a mula são estéreis. Questão 14 Considere as duas fases da meiose, de um organismo com 2n=6 cromossomos, esquematizadas a seguir e responda:

1.1.3.2

1.1.5.2

a) Que fases estão representadas na figura A e na B? Justifique. b) Que tipo de alteração aparece em uma das figuras? Em relação aos cromossomos, como serão as células resultantes de um processo de divisão com essa alteração? c) Dê um exemplo de anomalia que seja causada por este tipo de alteração na espécie humana, cujo número normal de cromossomos é 2n = 46.

3

Questão 15 O gato siamês é um animal de rara beleza pois a pelagem de seu corpo é clara com extremidades - orelhas, focinho, pés e cauda - pretas. A presença do pigmento que dá a cor negra a essas extremidades é o resultado da atividade de uma enzima que fica inativada acima de 34°C. Explique por que esses animais têm a pelagem negra nas extremidades do corpo. Questão 16 Desde 1995 alguns estados norte-americanos estão excluindo o ensino da teoria de evolução biológica dos seus currículos escolares alegando, entre outras razões, que ninguém estava presente quando a vida surgiu na Terra. Alguns cientistas defendem a teoria da evolução argumentando que, se é necessário "ver para crer", então não poderemos acreditar na existência dos átomos, pois estes também não podem ser vistos. (Adaptado da "ISTO É", 25/08/1999.) a) Apresente três evidências que apóiam a teoria da evolução biológica. b) A mutação gênica é considerada um dos principais fatores evolutivos. Por quê? Questão 17 Dois 'loci' de uma população, cada um com dois gens alelos, sofrem a ação da seleção natural por muitas gerações, como é mostrado nas tabelas abaixo. O coeficiente de seleção (S) indica os valores com que a seleção natural atua contra o genótipo. O valor adaptativo (W) representa os valores com que a seleção natural favorece o genótipo. Note que (W+S)=1. Qual dos gens, A‚ ou B‚, apresentará a maior freqüência na população? Explique. Questão 18 No porquinho-da-índia existe um par de genes autossômicos que determina a cor da pelagem: o alelo dominante B determina a cor preta e o recessivo b, a cor branca. Descreva um experimento que possa evidenciar se um porquinho preto é homozigoto ou heterozigoto. Questão 19 Nos porquinhos-da-índia, a pelagem negra é dominante sobre a pelagem branca. Um criador tem um lote de porquinhos-da-índia negros, com o mesmo genótipo. O que deve fazer para descobrir se esses animais são homozigotos ou heterozigotos? Justifique sua resposta. Questão 20 Uma anomalia genética autossômica recessiva é condicionada por uma alteração na seqüência do DNA. Um homem portador dessa anomalia apresenta a seqüência timina-citosina-timina enquanto sua mulher, que é normal, apresenta a seqüência timina-adenina-timina. A análise do DNA de um filho do casal mostrou que ele é portador tanto da seqüência de bases do pai quanto da mãe. a) O filho terá a doença? Por quê? b) Qual a probabilidade de um outro filho do casal apresentar as duas seqüências iguais à da mãe? Questão 21 Um homem afetado por uma doença genética muito rara, de herança dominante, casa-se com uma mulher, não consangüínea. Imagine que o casal tenha doze descendentes, seis filhos e seis filhas. Responda,
4

1.4.1.6

justificando sua resposta, qual será a proporção esperada de filhas e filhos afetados pela doença do pai no caso do gene em questão estar localizado. a) em um autossomo; b) no cromossomo X. Questão 22 Em ervilhas o caráter semente lisa é condicionado por um gene dominante R e semente rugosa pelo seu alelo recessivo r. Quais são as proporções genotípica e fenotípica obtidas na autofecundação de uma variedade comprovadamente heterozigota? Questão 23 "Hormônios são proteínas cuja função é regular os complicados mecanismos do organismo - como o aumento e redução do peso do corpo (...) Em outubro, o geneticista Jeffrey Friediman (...) isolou o primeiro hormônio capaz de controlar o peso, chamado leptina. Ele é produzido por um gene que, quando funciona mal, o organismo ganha peso (...)". (In: "Superinteressante" - ano 10, nŽ 3, mar., 1996.) Com base no texto, RESPONDA: a) Como se denomina o local que o gene ocupa no cromossomos? b) Considerando de forma simplificada a existência de dois alelos para o gene da leptina, um normal (L) e outro mutante (L'), quantos genótipos diferentes são possíveis em humanos diplóides? Quais são eles? c) COMENTE sobre um mecanismo que pode levar à mutação gênica. Questão 24 No início do século XX, a transmissão das informações genéticas para os descendentes era explicada por algumas hipóteses sobre as leis da hereditariedade, como a mendeliana e a por mistura. Observe os esquemas:

1.5.1.1

Suponha que, em um indivíduo de uma população com reprodução sexuada, apareça, por mutação, um gene raro que confira ao seu portador características vantajosas. Indique, para cada uma das hipóteses representadas, se há ou não possibilidade de aumento da freqüência do gene mutante na descendência desse indivíduo e justifique suas respostas. Questão 25 Leia o texto a seguir. "A Doença de Alzheimer (D.A.) (...) é uma afecção neurodegenerativa progressiva e irreversível, que acarreta perda de memória e diversos distúrbios cognitivos. Em geral, a D.A. de acometimento tardio, de incidência ao redor de 60 anos de idade, ocorre de forma esporádica, enquanto que a D.A. de acometimento precoce, de incidência ao redor de 40 anos, mostra recorrência familiar. (...) Cerca de um terço dos casos de D.A. apresentam familiaridade e comportam-se de acordo com um padrão de herança monogênica autossômica dominante. Estes casos, em geral, são de acometimento precoce e famílias extensas têm sido periodicamente estudadas." Smith, M.A.C. (Revista Brasileira de Psiquiatria, 1999) Considerando o texto e o histórico familiar a seguir, responda ao que se pede. Histórico familiar: "Um rapaz cujas duas irmãs mais velhas, o pai e a avó paterna manifestaram Doença de Alzheimer de acometimento precoce."

5

b) aa x aa c) aa x Aa d) Aa x Aa e) Aa x AA 1.5.1.1 Questão 28 No gado bovino da raça Ayrshire a cor mogno é determinada pelo genótipo A A e a cor vermelha pelo genótipo A‚ A‚, mas o genótipo A A‚ é mogno nos machos e vermelho nas fêmeas. Com base nessas informações, qual é o sexo de um filhote vermelho, cuja mãe é uma vaca mogno? Justifique a sua resposta. Questão 29 A formação de uma característica fenotípica depende, em alguns casos, apenas de fatores genéticos. Em outros casos, prevalece a influência de fatores ambientais. Na maioria das vezes há uma interação entre fatores genéticos e ambientais. Um dos métodos utilizados para avaliar a importância relativa dos genes e dos fatores ambientais na formação de uma característica é o estudo comparativo entre irmãos gêmeos monozigóticos criados juntos e criados separados. A tabela a seguir, elaborada a partir de um grande número de pares de gêmeos, indica o grau de concordância de quatro características. Uma concordância significa que quando um irmão possui a característica, o outro também a possui.

I. Montar o heredograma para o histórico familiar apresentado. II. Qual a probabilidade de o rapaz em questão também ser portador do gene responsável pela forma de acometimento precoce da doença? III. Quais indivíduos do heredograma são seguramente heterozigotos para esse gene? IV. Explicar o padrão de herança mencionado no texto. Questão 26 Mendel não acreditava na mistura de caracteres herdados. De acordo com suas conclusões, a partir dos cruzamentos realizados com ervilhas do gênero 'Pisum', as características não se misturam, permanecem separadas e são transmitidas independentemente. HENIG, Robin. "O monge no jardim". Rio de Janeiro: Rocco, 2001. a) Considerando as leis de Mendel para a hereditariedade, no momento da fecundação os cromossomos herdados dos progenitores se juntam, porém os alelos dos seus genes não se misturam. A partir dessa idéia, qual fenômeno explicaria a ocorrência de características intermediárias na progênie, que parecem ser uma mistura daquelas dos progenitores? b) Posteriormente, estudos de grupos de geneticistas indicaram que pode haver troca de material genético entre cromossomos homólogos herdados do pai e da mãe. Em que etapa isso pode ocorrer e como se chama este processo? Questão 27 Determine as probabilidades de aparecerem indivíduos afetados (aa), normais (AA) e heterozigotos (Aa), nas proles dos casamentos: a) aa x AA

1.5.1.1

Indique a característica que mais depende de fatores ambientais. Justifique sua resposta.

6

Em grandes altitudes. heterozigota e do sexo masculino? d) Represente o provável heredograma desse casal. 7 Calcule a proporção esperada da prole destes camundongos que será portadora do gene que codifica o HCR. quem engravidou e deu à luz foi a mãe da referida mulher. Questão 31 Um pesquisador observou que uma certa espécie de planta apresentava uma grande variação de produtividade relacionada à altitude onde a planta se desenvolvia. foram plantadas ao nível do mar em idênticas condições ambientais.1. A célula-ovo transgênica se desenvolveu. solicitou aconselhamento genético sobre a possibilidade de vir a ter crianças apresentando a condição albina. teve seu óvulo fertilizado "in vitro". quando o genótipo é recessivo. a produtividade era muito baixa. Assim.1 Identifique se é o componente genético ou o componente ambiental que predomina no condicionamento da produtividade dessas plantas. quando o genótipo é homozigoto dominante ou heterozigoto.Questão 30 Um pesquisador teve sucesso na integração de uma cópia do gene que codifica o hormônio do crescimento de rato (HCR) em um dos cromossomos autossômicos de uma célula-ovo de camundongo. Este camundongo transgênico foi cruzado com uma fêmea de camundongo normal. a produtividade aumentava. dando origem a um camundongo macho.1. realizou um experimento em que sementes dessa espécie. a produtividade dessas plantas foi medida e apresentou os seguintes resultados: .5. Ele. os meios de comunicação noticiaram o caso de uma mulher norte-americana que. coletadas em diversas altitudes. não portadora do gene HCR.1 1. Questão 33 A mamona ('Ricinus communis') produz inflorescências contendo somente flores pistiladas (flores femininas). Qual a probabilidade desse casal ter: a) quatro crianças albinas? b) uma criança albina e do sexo feminino? c) uma criança normal. Após algum tempo. e inflorescências mistas (flores femininas e flores masculinas). 1. então. à medida que a altitude se aproximava do nível do mar. Justifique sua resposta. impossibilitada de ter filhos por anomalia no útero. Com base nessas afirmações. isto é. e este foi implantado no útero de sua mãe. que tipos de inflorescências serão produzidas nos descendentes dos seguintes cruzamentos: a) NN x Nn? b) Nn x Nn? Questão 34 Recentemente. Questão 32 Um determinado casal normal.5. admitindo-se que as suposições feitas nas letras (b) e (c) realmente se concretizem. mas heterozigoto para o albinismo. Justifique sua resposta.

sementes rugosas. que. observou que alguns dos animais de sua criação apresentavam uma característica incomum nos chifres. são mais vigorosos e mais produtivos que os parentais. um par de genes. dois pesquisadores retiraram os ovários de uma cobaia albina e implantaram-lhe um ovário obtido de uma cobaia preta. c) Se fosse possível implantar os pêlos da fêmea preta na fêmea albina. Qual a proporção fenotípica esperada em F se a) o modo de herança for do tipo dominante? b) o modo de herança for do tipo co-dominante? Questão 36 Suponha que você tenha em seu jardim exemplares da mesma espécie de ervilha utilizada por Mendel em seus experimentos. as plantas resultantes foram medidas e os dados obtidos no experimento são mostrados no gráfico A. portanto por genótipos LL ou Ll e. a) Explique o resultado obtido. Após um determinado tempo de crescimento. em vez de transplantar o ovário. em geral. pesquisadores observaram que essas plantas apresentavam um gradiente decrescente de tamanho. o resultado não será o mesmo. Questão 39 Em várias culturas vegetais. b) Qual a porcentagem de genes herdados da parturiente que se encontram no patrimônio genético da criança? Questão 35 Em gatos. a) planeje um cruzamento experimental entre flores de exemplares diferentes que lhe permita determinar se uma planta que produz sementes lisas é homozigota ou heterozigota para esse caráter. b) No caso de ocorrer autofecundação em uma planta que produz sementes lisas e é heterozigota. Sabendo que a característica "lisa" das sementes da ervilha é determinada por um alelo dominante L. Como o criador poderia fazer para determinar se essa variação é decorrente de uma mutação genética ou de uma alteração causada por fatores ambientais? Questão 38 Em experimento feito no início do século. são então cruzadas e produzem os híbridos. pelo menos. o resultado seria o mesmo? Justifique. que as flores são hermafroditas e que sementes produzidas por autofecundação são viáveis. qual seria a interpretação? 8 . homozigotas para alelos diferentes. as cores marrom e branca dos pelos têm sido descritas como devidas a. Mais tarde. quem é a mãe da criança? Justifique. Considere o cruzamento de gatos homozigotos brancos e marrons. a) Esses indivíduos híbridos são geneticamente iguais entre si? Explique. b) Se o resultado do experimento tivesse sido o representado no gráfico B. b) Se o agricultor utilizar as sementes produzidas pelo híbrido nos plantios subsequentes. a) Sabendo-se que o albinismo é característica recessiva. qual seria a proporção esperada de descendentes com sementes rugosas? Questão 37 Um criador de cabras. Duas linhagens. depois de muitos anos nesse ramo. o animal foi cruzado com um macho albino e deu origem a uma prole toda preta. Por quê? Questão 40 Ao estudar a distribuição de uma espécie de planta da família dos girassóis em altitudes crescentes na costa oeste dos Estados Unidos. Alguns desses exemplares produzem sementes lisas e outros. os programas de melhoramento utilizam a heterose (vigor do híbrido). Sementes dessas plantas foram coletadas nas várias altitudes e plantadas em uma mesma região localizada ao nível do mar.Responda: a) Do ponto de vista genético. como você explica esse resultado? b) Indique os genótipos da fêmea preta e da prole. Nesses programas são desenvolvidas linhagens homozigotas por meio de sucessivas gerações autofecundadas. sabendo ainda. expresso no gráfico A.

é letal na fase adulta. b) Represente os alelos por letras e indique os genótipos dos indivíduos parentais e dos descendentes no cruzamento IV.1. analise as afirmações abaixo. Baseando-se nessa explicação.2 Questão 44 Considere uma certa espécie de planta que pode apresentar flores com três tipos de cor: azul. cor branca . e (b) talassemia maior. b) Afirmação de um casal de olhos castanhos: "nosso bebê poderá ter olhos azuis porque o avô paterno tem olhos azuis". a talassemia menor e os pretos a talassemia maior. mas a saúde é essencialmente normal. oval ou redonda. na qual os eritrócitos são pequenos (microcitemia) e em grande número (policitemia).em um jardim de plantas com flores de cor azul não nascem plantas com flores de cor azul-claro. aumento do baço. Questão 43 A talassemia é um defeito da hemoglobina em seres humanos. determine o modo de herança indicando os possíveis genótipos dos indivíduos envolvidos.5. Essa última forma geralmente culmina em morte antes de atingir a idade reprodutiva. microcitemia e policitemia. azul-claro e branca. Foram realizados quatro tipos de cruzamento entre plantas dessa espécie e obtidos e seguintes resultados: 1.a flor de cor branca nunca se abre. Sabe-se que: . (a) talassemia menor. verificando se elas têm fundamento.2 . proferidas por casais em relação à cor dos olhos de seu bebê.1. Estas cores são determinadas por combinações de dois alelos de um único locus.1. a) Afirmação de um casal de olhos azuis: "nosso bebê poderá ter olhos castanhos porque as avós têm olhos castanhos".1. determinando cor castanha) e a (recessivo. sendo que a manifestação em homozigose de um dos alelos . Justifique sua resposta. caracterizada por uma anemia severa. determinando cor azul). Questão 42 Em uma espécie de planta a forma dos frutos pode ser alongada.1 a) Formule uma hipótese consistente com os resultados obtidos para explicar a herança da forma dos frutos nessa espécie. Questão 41 A herança da cor do olho na espécie humana geralmente é representada simplificadamente como um par de alelos. . A partir do heredograma hipotético a seguir onde os símbolos claros representam pessoas normais. os hachurados.5. A (dominante.5. entre outros sintomas. Ela ocorre em duas formas.aa. Na expressão fenotípica de tais cores não há relação de dominância entre os alelos. 9 1.

as sementeiras foram distribuídas a diversas pessoas. ou seja. venha a se desenvolver um rabanete de raiz ovalada? Justifique a sua resposta. Considere um casal de anões pseudo-acondroplásicos. A partir das sementes obtidas. A princípio. por isso. a cor da pelagem vermelha. como o fazendeiro deverá proceder para estabelecer uma linhagem pura de animais brancos e sem chifres? Por que ele não conseguirá resolver o problema dos chifres rapidamente? Questão 47 O gráfico a seguir mostra a mortalidade de mosquitos de uma determinada espécie quando expostos a diferentes concentrações de um inseticida. Justifique a resposta. foram obtidas quatrocentas sementes que foram plantadas em sementeiras individuais. às vezes só origina prole sem chifres. provocando aborto precocemente. Entretanto. produz efeito letal durante o desenvolvimento embrionário.5. Os fenótipos formados são três: arredondado. A resistência ou susceptibilidade ao inseticida é devida a um locus com dois alelos. que conclusão se pode tirar sobre as relações de dominância entre os alelos deste locus? Explique. aparecem os dois tipos em igual número. para responder às seguintes questões: 10 . você recebeu uma delas. na sua sementeira. a forma da raiz é determinada por um par de genes alelos. Utilizando apenas cruzamentos naturais. Justifique a resposta. em outros cruzamentos. sem recorrer à inseminação artificial. Questão 45 Em rabanetes. b) Realizaram-se os cruzamentos possíveis entre as plantas com flores das cores mencionadas. Cruzamentos entre plantas de raízes alongadas com plantas de raízes arredondadas produziram apenas indivíduos com raízes ovaladas. a) Qual a relação de dominância entre os caracteres em questão? b) Qual a probabilidade de que. formou-se um jardim. ovalado ou alongado. Questão 48 A pseudo-acondroplasia é um tipo de nanismo determinado geneticamente pelo alelo D autossômico dominante que interfere no crescimento dos ossos durante o desenvolvimento. brancos e sem chifres. Antes que as sementes germinassem.a) Realizou-se o cruzamento entre as plantas com flores azul-claro e. e o cruzamento de animais com chifres versus animais sem chifres. a partir das sementes obtidas. quando em dose dupla. pensou-se que o fenótipo anão seria expresso pelo genótipo D/D ou D/d. Um fazendeiro tem uma grande boiada constituída de animais vermelhos. Questão 46 Em gado. ocasionalmente produzem prole com chifres. formou-se outro jardim. 1. foi considerado que a severidade do alelo dominante. c) Os indivíduos de cada um dos genótipos não se comportam da mesma forma quanto à resistência ao inseticida e.1. Determine a cor das flores que têm maior possibilidade de se abrirem neste jardim. presentes em igual quantidade. Essas diferenças podem ser atribuídas a efeitos pleiotrópicos de outros genes? Justifique sua resposta utilizando o conceito de efeito pleiotrópico. os quais. e. ruões. os pontos distribuem-se ao longo da curva. A e A‚. Em cruzamentos desses indivíduos ovalados entre si. é controlada por genes codominantes. ruão e branca. Determine a cor das flores que têm menor possibilidade de se abrirem neste jardim.2 a) Qual é o genótipo mais resistente? Como você chegou a essa conclusão? b) Observando as três curvas.

qual é a probabilidade de. dominante. Questão 51 Gatos Manx são heterozigotos para uma mutação que resulta na ausência de cauda (ou cauda muito curta). qual é a probabilidade dela nascer geneticamente com a pseudo-acondroplasia? c) Como o casal já tem três crianças com a pseudo-acondroplasia.1. e seu alelo c recessivo. qual é a probabilidade que se espera para este evento? e) Em uma outra família. b) A partir de 40 ovos.4 11 . Um geneticista observou que o cruzamento de ratos de pelagem amarela com ratos de pelagem cinza resultou descendentes amarelos e cinzas em igual proporção. presença de pernas traseiras grandes e um andar diferente dos outros. a) Qual a explicação para esse resultado? b) Dê os genótipos dos parentais e dos descendentes. em um eventual quarto nascimento.5. em vez de três para um (3:1). originados do cruzamento de machos amarelos e fêmeas cinzas. quantas fêmeas amarelas adultas são esperadas? Justifique. a) Qual cruzamento apresenta resultado de acordo com os valores esperados? b) Como você explicaria o resultado do cruzamento em que os valores observados não estão de acordo com os valores esperados? Questão 50 Em ratos. o cruzamento de ratos amarelos entre si produziu 2/3 de descendentes de pelagem amarela e 1/3 de descendentes de pelagem cinza. como seria esperado pela genética mendeliana. a) A partir de 20 ovos. quantas destas crianças são homozigotas no loco correspondente a este tipo de nanismo? Questão 49 Observe os cruzamentos a seguir.a) Quais são os genótipos de cada indivíduo do referido casal? b) Caso a mulher deste casal venha dar à luz uma criança. com 3 meninas e 2 meninos. (Utilize as letras B e b para as suas respostas). 1. O cruzamento de dois gatos Manx produziu dois gatinhos Manx para cada gatinho normal de cauda longa (2:1). responsável pela coloração amarela. responsável pela coloração cinza. CRUZAMENTO I (Aa × Aa) 240 amarelos 120 cinzas CRUZAMENTO II (Aa × aa) 240 amarelos 240 cinzas Analise os resultados destes cruzamentos e responda. originados do cruzamento entre ratos amarelos. quantos machos cinzas deverão atingir a idade adulta? Justifique. Questão 52 O heredograma a seguir representa uma família com pessoas afetadas por uma doença hereditária. onde o alelo (A) condiciona a cor amarela em camundongos e é dominante sobre o alelo (a). sendo o gene C. que condiciona a cor cinza. todos apresentando a pseudo-acondroplasia. porém. a criança nascer também afetada? d) Se o casal tem planos para ter uma menina normal em relação a esta condição genética. a cor da pelagem é condicionada por gene autossômico.

4 No heredograma adiante o indivíduo 3 é afetado pelo albinismo.4 Questão 56 A figura a seguir.1.5 % e cinqüenta vezes maior do que entre o restante da população do Maranhão.5.4 .5. onde a freqüência de albinos é de 1. mostra a transmissão do albinismo. situada a oeste de São Luís. Os indivíduos I .4 1. a) Qual a probabilidade de o indivíduo 3 ser heterozigoto? b) Qual a probabilidade de o indivíduo 5 ser homozigoto recessivo? c) Qual a probabilidade de o indivíduo 6 ser homozigoto dominante? Questão 54 1.a) A doença tem herança dominante ou recessiva? Por quê? b) A doença tem herança autossômica ou ligada ao cromossomo X? Por quê? Questão 53 Analisando a genealogia adiante. na Família de Raimundo e Eleílde da Silva. na população. V . adaptada da Folha de São Paulo de 17/03/96. um grupo de cientistas do "Genetics & IVF Institute" vem testando um novo método que permite a seleção dos espermatozóides a partir de sua coloração.5.5. numa dada geração.5 são albinos. de uma característica expressa em antepassados remotos? b) O albinismo se deve a alelo dominante ou a alelo recessivo? Explique com base na figura. qual é a probabilidade de que o casal 4 × 5 tenha uma menina albina? Analise a figura onde se admite que a pigmentação da pele é devida a um par de alelos (A.3 e V . a freqüência de heterozigoto para o albinismo é de 1/50. Sabendo-se que. c) Qual a probabilidade de os indivíduos de pigmentação normal da geração V serem todos heterozigotos? Questão 57 Questão 55 No heredograma a seguir os símbolos cheios representam indivíduos portadores de uma anomalia genética. II . Responda. então: a) Que nome se dá ao aparecimento. responda: anomalia? 1. Qual é a probabilidade de o indivíduo 9 ser portador dessa Nos Estados Unidos.1. moradores da ilha dos Lençóis. V .2.1.1. de acordo com a presença ou ausência do 12 1.a).6.1. de geração.

como representado nos heredogramas a seguir: 1.1.5. além de satisfazer os anseios de vários casais na escolha do sexo do filho. o professor lhe apresenta o heredograma a seguir.5. 1. e responda às seguintes questões: a) Qual o padrão de herança envolvido na determinação da característica representada no heredograma 1 e no heredograma 2? Justifique sua resposta.4 13 .5. b) Suponha que a mulher 3 da família I case-se com o homem 4 da família III. II e III). Qual a probabilidade de nascer uma criança doente? Justifique. a) Qual o tipo de herança da doença? Justifique sua resposta. considerando que o caráter é determinado por um único par de genes.1.2 gerarem uma criança afetada do sexo masculino. Questão 59 O padrão de herança de uma doença. Questão 58 O heredograma a seguir refere-se ao caso de braquidactilia.1. Questão 60 Numa aula de genética.1 e III. Ao analisar os indivíduos afetados por esta anomalia. Tal método. Identifique e justifique o tipo de herança.4 1. b) Em qual das duas situações seria mais recomendado o uso da técnica ('Microsort') para a escolha de um bebê do sexo feminino? Por quê? c) Considerando o heredograma nŽ1.5.4 1.4 Analise os dois heredogramas anteriores.1. calcule a chance de os indivíduos III. poderá ser benéfico quando utilizado por famílias portadoras de determinadas anomalias genéticas.cromossomo Y ('Microsort'). foi analisada em três famílias diferentes (I. que se suspeita ser autossômica recessiva ou ligada ao sexo. que mostra a ocorrência de uma anomalia causada pela ação de um par de genes (A e a) em várias gerações de uma família. você conclui que se trata de uma herança autossômica dominante.

se a mulher (4) da geração F3 tiver filhos com um homem que apresente essa anomalia? Questão 61 No heredograma abaixo a cor preta indica indivíduos com pelagem negra.4 1. B e C a seguir representam três famílias diferentes.5. Questão 64 Analise a genealogia. Analise esta genealogia e responda.4 1.Baseando-se EXCLUSIVAMENTE no heredograma apresentado acima. 1. Os círculos representam mulheres e os quadrados. Questão 63 Na genealogia adiante. responda: a) Por que a anomalia NÃO pode ser recessiva? b) Por que a anomalia NÃO pode ser ligada ao cromossomo X? c) Qual a probabilidade de nascer uma criança afetada pela anomalia.1. os homens. a) Esta doença hereditária é condicionada por gene dominante ou recessivo? b) Dos dez indivíduos que compõem esta genealogia.5. fenótipo determinado por um gene autossômico dominante A. Justifique sua resposta para cada família. Justifique. qual o único que não pode ter seu genótipo definido? Explique por quê. a menos que haja evidência contrária. A cor branca indica pelagem branca determinada por um gene recessivo. os indivíduos em escuro apresentam uma doença hereditária. Quadrados ou círculos escuros representam indivíduos afetados por uma característica comum na população.4 Qual a probabilidade de que o cruzamento entre o indivíduo 9 e o indivíduo 10 gere um indivíduo de pelagem branca? Questão 62 Os heredogramas A. Os círculos representam as mulheres e os quadrados. a) Identifique os heredogramas que são compatíveis com uma herança autossômica recessiva.1.1. 14 . que apresenta indivíduos afetados por uma doença recessiva e indivíduos normais. enquanto os outros exibem fenótipo normal. homens.5. b) Determine se em algum dos casos apresentados existe herança ligada ao cromossomo Y. Os indivíduos 5 e 8 devem ser considerados homozigotos (AA).

tanto monozigóticos como dizigóticos.5. Questão 69 Considere a figura a seguir que representa o resultado da primeira divisão meiótica de uma célula feminina: Toda pessoa na qual o alelo recessivo é detectado recebe orientação a respeito dos riscos de vir a ter um descendente com a anomalia. 1.4 Questão 68 Alguns centros de pesquisa na Inglaterra estão realizando um programa de triagem populacional para detectar a fibrose cística. c) Se Paulo e Joana tiverem uma primeira criança afetada pela mesma doença genética. todos normais. As diferenças registradas entre os irmãos dizigóticos foram praticamente da mesma magnitude que as encontradas entre os irmãos monozigóticos. tem uma criança afetada por uma doença muito rara de herança autossômica recessiva. Justifique sua resposta. Discuta a importância dos fatores genéticos na manifestação dessa característica. Um inglês heterozigoto para essa característica é casado com uma mulher normal. qual é a probabilidade de que uma sua irmã tenha esse mesmo gene A? Por quê? Questão 67 Dois irmãos (Pedro e Paulo) casam-se com duas irmãs (Maria e Joana). sendo ambos do sexo masculino e afetados? Questão 65 Uma determinada característica foi estudada em centenas de pares de gêmeos.5. Pedro e Maria. a) Indique o genótipo do embrião formado a partir da fecundação do óvulo resultante dessa célula por um espermatozóide de um macho recessivo para os dois pares de genes considerados. filha de pais normais.1 Calcule a probabilidade de que esse casal venha a ter uma criança com fibrose cística. mostrando como chegou aos resultados dos itens b) e c). a) Quais os indivíduos representados na genealogia que são obrigatoriamente heterozigotos? b) Qual a probabilidade de o casal formado pelos indivíduos II2 e II3 ter mais dois filhos. O primeiro casal. uma doença autossômica recessiva grave particularmente comum em caucasianos.1. b) Quais os possíveis genótipos dos filhos possíveis do mesmo casal? 15 . qual será o risco de que uma 1. b) Qual é a probabilidade de que uma futura criança de Paulo e Joana venha a ser afetada por essa mesma doença genética? Considere desprezível a probabilidade de uma nova mutação. Questão 66 Se uma abelha operária tem o gene A herdado de seu pai. vítima de fibrose cística.segunda criança desse casal também seja afetada por essa mesma doença? Por quê? Justifique suas respostas. mas cujo irmão morreu na infância. a) Desenhe o heredograma representando os dois casais e seus respectivos pais.2.

a cor preta é condicionada pelo alelo dominante D e a cor marrom. filhos legítimos de um mesmo casal. a cor do pêlo negro é determinada por um gene dominante (A) enquanto seu alelo (a) determina a cor branca. localiza-se o gene responsável pelo padrão da coloração: o alelo dominante M determina padrão uniforme (uma única cor) e o alelo recessivo m. Questão 73 Quatro irmãos.1 1. Questão 74 Em uma raça de cachorros. O cruzamento de um macho de cor preta uniforme com uma fêmea de cor marrom uniforme produz uma ninhada de oito filhotes: 3 de cor preta uniforme. D e E que se segregam independentemente. pelo alelo recessivo d. Em um outro cromossomo.Questão 70 Em cobaias.2. sendo o alelo dominante (B) para pêlo curto e o alelo recessivo (b) para pêlo longo. Caso você examine a prole de um grande número de casamentos em que ambos os cônjuges são duplo heterozigotos para esses dois pares de genes. após vários cruzamentos. responda: a) Por que na geração F1 não foram encontradas sementes rugosas ou verdes? b) O que são os fatores hereditários referidos por Mendel e onde estão situados? c) Faça um diagrama de cruzamento para exemplificar as proporções fenotípicas encontradas na geração F2. que proporção fenotípica você espera encontrar? Questão 72 Observe a tabela a seguir.1 a) Os genes para a cor e tamanho de pêlo estão no mesmo par de cromossomas? Justifique sua resposta.5. 1. De acordo com a tabela. apresentam marcantes diferenças em suas características físicas. utilizando qualquer uma das características apresentadas na tabela. b) Quais são os genótipos mais prováveis dos pais em cada casal? Justifique sua resposta. a) Quais os genótipos dos pais? b) Se o filho preto e branco for cruzado com uma fêmea cujo genótipo é igual ao da mãe dele. A tabela a seguir apresenta os fenótipos dos pais e os fenótipos das respectivas proles.2.5. O tamanho do pêlo também é controlado por um par de genes. 3 de cor marrom uniforme. qual a proporção esperada de descendentes iguais a ele? Questão 71 A audição normal depende da presença de pelo menos um dominante de dois pares de genes. 16 . realizados com ervilhas. 1 preto e branco e 1 marrom e branco. Descreva três mecanismos biológicos potencialmente responsáveis por essa variabilidade genética e explique como atuam. o padrão malhado (preto / branco ou marrom / branco). que mostra parte dos resultados dos experimentos de Mendel.

gene B (dominante) ou gene b (recessivo). quais serão os genótipos das quatro células haplóides geradas? b) Considerando o conjunto total de espermatozóides produzidos por esse animal. Questão 79 Considere duas linhagens homozigotas de plantas.2. Os genes para comprimento do caule e forma do fruto segregam-se independentemente. a) Qual será a constituição cromossômica da planta adulta originada desse zigoto? Justifique. O alelo que determina caule longo é dominante. quando cruzados entre si. os homozigotos têm pêlo liso ou crespo. podem formar indivíduos com os genótipos mostrados na Tabela 1. Suponha uma planta superior originada de um zigoto no qual dois dos pares de cromossomos.5. as proporções fenotípicas dependem de os referidos locos estarem ou não no mesmo cromossomo. Questão 76 A figura mostra a segregação de dois pares de cromossomos homólogos na anáfase da primeira divisão meiótica de uma célula testicular de um animal heterozigótico quanto a dois genes. Para a cor do pêlo. A e B.gene A (dominante) ou gene a (recessivo). Cruzando indivíduos AABB com indivíduos aabb. As localizações dos alelos desses genes. foram analisadas duas características com segregação independente e herança co-dominante: cor e textura do pêlo. Para a textura. foram obtidos 100% de indivíduos AaBb que. Sem interação entre os dois locos. Calcule a porcentagem esperada de descendentes fêmeas com pêlo vermelho crespo oriundas do cruzamento de dois animais duplamente heterozigotos. assim como o alelo para fruto redondo.Questão 75 Um pesquisador está estudando a genética de uma espécie de moscas. Na Tabela 2. têm a constituição AA‚BB‚. cada um com dois genes alelos: loco 1 . loco 2 . Questão 78 1.2. Despreze a parte fracionária de seu resultado. 1. b) Se essa planta se reproduzir por autofecundação.1 Identifique qual dos dois casos tem maior probabilidade de representar dois locos no mesmo cromossomo. Justifique sua resposta. quais serão seus genótipos e em que proporção espera-se que eles sejam produzidos? Questão 77 Em uma determinada espécie animal. caso exista. uma com caule longo e frutos ovais e outra com caule curto e frutos redondos. estão indicadas nos cromossomos representados no desenho. identificados pelas letras Aa e Bb. os homozigotos podem ser vermelhos ou brancos. 17 . considerando apenas dois locos.1 a) Ao final da segunda divisão meiótica dessa célula. estão representadas duas proporções fenotípicas (casos 1 e 2) que poderiam resultar do cruzamento de dois indivíduos AaBb.5. a constituição cromossômica de seus descendentes será igual à da planta mãe? Justifique.

b para forma dos frutos. Utilize as letras A. b) Em que proporção essas plantas de caule curto e frutos ovais serão obtidas? Questão 80 Considere dois genes e seus respectivos alelos: A e a. SBPC. pergunta-se: a) qual é o grupo sangüíneo do homem em questão? b) qual ou quais os possíveis grupos sangüíneos usados erroneamente na transfusão? Questão 87 "Os grupos sangüíneos são determinados pela presença ou ausência de antígenos na superfície das hemácias. p. a) Qual será o grupo sangüíneo de Eugênio após o transplante? Por quê? b) Sabendo-se que a mãe e a esposa de Eugênio têm sangue do tipo O.a) De que forma podem ser obtidas plantas com caule curto e frutos ovais a partir das linhagens originais? Explique indicando o(s) cruzamento(s). 19/nŽ 113. CIÊNCIA HOJE. 58. Questão 81 Do cruzamento de AaBbccDd x aaBbCcDd. set. A condição normal (I_) produz um fenótipo normal. B e b. a) Quais os genótipos do pai e da mãe? b) Qual é a probabilidade de que ambos os gêmeos tenham sangue do tipo O? Questão 86 Um homem faleceu por causa de uma transfusão de sangue. 95. Eugênio. cujo grupo sangüíneo é A. Sabendo-se que seus pais pertenciam aos grupos B (homozigoto) e AB. Admite-se que dedos nas mãos anormalmente curtos (braquidactilia) sejam devido a um genótipo heterozigoto para um gene letal embrionário (BBL). a) O veredicto é aceitável? Por quê? b) Na hipótese de Chaplin ter tido filhos com a referida mulher. b) estão ligados. ("Reserva estratégica de sangue". qual será a probabilidade de um futuro filho do casal ter sangue do tipo A? E do tipo B? Questão 85 O pai e a mãe de um par de gêmeos monozigóticos têm tipo sangüíneo A. explique o que significa dizer que esses dois genes a) segregam-se independentemente na formação dos gametas. Em termos de localização cromossômica. de que tipos sangüíneos eles poderiam ser? Questão 84 Um tratamento utilizado para certos tipos de doenças do sangue é a destruição completa da medula óssea do paciente e implante de células medulares sadias provenientes de um doador. a para comprimento do caule e B. cujo grupo sangüíneo é B. Chaplin foi considerado como sendo um possível pai da criança. o famoso cineasta Charlie ChapIin foi acusado de ser o pai de uma criança. AB e ausentes no grupo O". fato que ele não admitia. B. recebeu um transplante de medula óssea de seu irmão Valentim. Ao final do julgamento. Uma outra criança desse casal é do grupo sangüíneo O. de Ricardo Lorzetto.) a) O que são antígenos? b) Qual a importância de se identificar a presença de antígenos eritrocitários (presentes nas hemácias ou eritrócitos) no sangue humano? 18 . a criança do grupo B e Chaplin do grupo O. e a operação foi bem sucedida. o homozigoto (BB) é normal e o outro homozigoto (BLBL) morre prematuramente. vol. No caso do Sistema ABO. Os exames de sangue revelaram que a mãe era do grupo A. qual será a probabilidade de nascer um indivíduo de genótipo aabbCcDD? Questão 82 Idiotia amaurótica infantil é uma doença hereditária recessiva (ii) que causa a morte nos primeiros anos de vida. Qual é a probabilidade de um casal de braquidáctilos e heterozigotos para a idiotia amaurótica infantil vir a ter um descendente normal? Questão 83 Nos anos 40. os antígenos estão presentes no sangue dos grupos A.

O tipo de sangue. Questão 90 Pode-se usar o sistema ABO para "excluir" um suposto pai em uma investigação de paternidade.B Doaldo .5. tinha sangue AB e era daltônico. 5) mulher. é determinado por um gene localizado no cromossomo sexual X. por comparação com os fenótipos e genótipos do filho e da mãe.O Saildo . verificar se o homem acusado pode ser considerado como um pai impossível. com sangue tipo A e visão normal. visão normal. respectivamente? Questão 92 Ao descobrir que seu genótipo era homozigoto. sangue O.Questão 88 O daltonismo. Com os dois maridos.3.5. Lalau (indivíduo II-1) elaborou o seguinte heredograma sobre a herança de grupos sangüíneos do sistema ABO. A tabela a seguir mostra os fenótipos do filho e da mãe em três casos.AB Cassilda . Para tal. sangue A. sangue A. e não aglutina quando colocado em presença de imunoglobulinas ou aglutininas anti-B. basta determinar o genótipo e o fenótipo do suposto pai e. Iß. responda: a) Quem do grupo anterior NÃO possui os aglutinogênios em suas hemácias? b) Por que Joana pode receber sangue de outros membros do grupo? c) Que tipo de aglutinina possuem Cassilda e Saildo. sangue A. 1. que apresenta aglutinações inversas. Um dos maridos. José. 3) mulher. 1. Qual dos homens foi o primeiro marido? Justifique sua resposta. Orlando casa-se com Leila. tinha sangue A e visão normal. a mulher teve cinco filhos na seguinte ordem: 1) homem. i. foram encontrados os seguintes tipos sangüíneos: Joana . sangue B. daltônica. 2) homem. ou cegueira para as cores. grupo ABO. visão normal. é determinado por três alelos autossômicos: IÞ. ficou viúva e casou pela segunda vez.A Com base nesta relação. a) Qual o genótipo dos pais? b) Qual a probabilidade de esse casal ter uma criança cujo sangue aglutine nos dois tipos de soro? Justifique sua resposta. Questão 89 O sangue de Orlando aglutina quando colocado em presença de soro contendo imunoglobulinas ou aglutininas anti-A.1 Indique os fenótipos dos pais que NÃO poderiam ser os pais biológicos de cada caso. Questão 91 Nas quatro pessoas relacionadas a seguir.3. o Sr.1 19 . o outro marido. daltônico. Paulo. 4) mulher. Uma mulher. O casal tem um filho cujo sangue não aglutina em nenhum dos dois tipos de soro. daltônico.

cujos resultados obtidos são mostrados na tabela adiante.3. pelo sistema ABO e.qual a probabilidade de ter outra com os mesmos fenótipos sangüíneos? Obs.1 Questão 95 O rei Salomão resolveu uma disputa entre duas mulheres que reclamavam a posse de uma criança. que 20 1. uma das mulheres desistiu. b) Qual deveria ser o grupo sangüíneo do homem para que a decisão pudesse ser conclusiva? c) Com base no teste de DNA. a) Explique por quê. .: indique os passos que você seguiu para chegar às respostas. Questão 97 Um exemplo clássico de alelos múltiplos é o sistema de grupos sangüíneos humano.5. calcule a probabilidade. o juiz não pôde chegar a nenhuma decisão conclusiva. O rei então concluiu que aquela que havia desistido era de fato a mãe verdadeira. b) Explique por que uma pessoa com sangue tipo O é doadora universal mas só pode receber sangue do tipo O. Analisando-os. B e O. caso exista. Nos tribunais modernos. AB. enquanto uma pessoa com sangue AB é receptora universal mas não pode doar para os outros tipos. Por que o teste de DNA permite tirar conclusões tão precisas em casos como este? Questão 96 Os grupos sangüíneos humanos podem ser classificados em 4 tipos: A. Ao propor dividir a criança ao meio. em porcentagem.5. Despreze a parte fracionária do seu resultado. o juiz concluiu que o homem era pai da criança. pode-se identificar os pais de cada bebê. a) Explique como o sangue de uma pessoa pode ser identificado em relação aos sistemas ABO e Rh. Questão 94 Com base no heredograma a seguir. qual é a probabilidade dela ser uma menina e do grupo sangüíneo "B"? Questão 93 Dois casais suspeitavam da troca de seus bebês no berçário da maternidade. em que o alelo IÞ. que codifica para o antígeno A. de acordo com o sistema Rh. Analisando uma situação em que uma mulher de sangue A atribuía a paternidade de seu filho de sangue O a um homem de sangue B. como Rh® e Rh−. responda: a) Qual a probabilidade de o casal formado por 5 e 6 ter duas crianças com sangue AB Rh®? b) Se o casal em questão já tiver uma criança com sangue AB Rh ®. 1. Lalau poderá ser receptor de sangue de seu genro para transfusão? d) O indivíduo III-5 NÃO poderá ser de qual grupo sangüíneo? e) No caso do casal III-3 e III-4 ter uma segunda criança. de que um futuro irmão deste bebê seja do sexo masculino e venha a ter tipo sangüíneo diferente do irmão. em a e b.1 Após identificar os pais do bebê nŽ 2.a) Identifique o grupo sangüíneo do indivíduo I-1: b) Qual o genótipo do indivíduo II-5? c) O Sr. Os casais e os bebês foram submetidos à tipagem do sangue quanto ao sistema ABO. é codominante sobre o alelo Iß. um juiz pode utilizar a análise dos grupos sangüíneos e teste de DNA para ajudar a solucionar questões semelhantes.3.

a) Complete o quadro a seguir com os genótipos e as reações antigênicas (represente com os sinais + e -) dos grupos sangüíneos indicados.2 Nas transfusões sangüíneas. B. são necessários para a identificação dos quatro grupos sangüíneos: A.2 1. AB e O. na falta de sangue do mesmo tipo. por que cada indivíduo é portador de somente dois alelos? Questão 98 Uma população humana foi testada quanto ao sistema MN de grupos sanguíneos. Dois tipos de soros. Érica. Questão 100 Na eritroblastose fetal ocorre destruição das hemácias. sofreu um acidente e precisa urgentemente de uma transfusão de sangue. apresentou a doença hemolítica ou eritroblastose fetal. anti-A e anti-B. Em situações de emergência.1 Qual das mulheres poderia ser a verdadeira mãe daquela criança? Justifique sua resposta. Pedro. Questão 103 Um casal tem cinco filhos: Alex. Na impossibilidade de se fazer um exame dos tipos sangüíneos.5.3. O sangue das duas mulheres foi testado . Certo ou errado? Justifique sua resposta. Ambos os alelos são dominantes sobre o alelo i. 1. B ou AB. ao nascer. Dois dos irmãos são gêmeos univitelinos. que não codifica para qualquer antígeno. B ou AB. Explique o problema que pode ocorrer se forem fornecidos grandes volumes de sangue O para pacientes A. responda: 21 b) Embora 3 alelos distintos determinem os grupos sangüíneos ABO humanos. o doador deve ter o mesmo tipo de sangue que o receptor com relação ao sistema ABO. o que pode levar recém-nascidos à morte. e os únicos doadores disponíveis são seus irmãos. Érica e Ana.5. Os dados obtidos compõem a tabela a seguir: a) Quais as freqüências dos alelos M e N nessa população? b)Essa população está em equilíbrio de Hardy-Weinberg para esse loco gênico? Questão 99 Duas mulheres disputam a maternidade de uma criança.3. b) Como evitar sua ocorrência? c) Qual o procedimento usual para salvar a vida do recém-nascido com eritroblastose fetal? Questão 101 Um indivíduo pertencente aos grupos sangüíneos AB e Rh positivo é considerado receptor universal ideal.5. com o uso do soro anti-Rh (anti-D) como mostra o esquema a seguir. um dos gêmeos. podem ser feitas transfusões de pequenos volumes de sangue O para pacientes dos grupos A. Mário. que.codifica para o antígeno B. a) Explique como ocorre a eritroblastose fetal.3. Questão 102 1.

Um labrador macho. Utilizando a tabela a seguir determine o genótipo do galo e das três galinhas. marrom e dourada) são condicionadas pela interação de dois genes autossômicos.4 a) Explique o fenômeno que ocorreria com as hemácias de um indivíduo do grupo A ao receber sangue de um indivíduo do grupo B. Os cães homozigóticos recessivos "ee" não depositam pigmentos nos pêlos e apresentam. Questão 108 As reações enzimáticas a seguir indicam a passagem metabólica que sintetiza pigmentos em uma planta. rosa e ervilha. Questão 105 As três cores de pelagem de cães labradores (preta. noz. com pelagem dourada. 1. as duas colunas da direita demonstram esquematicamente o aspecto "in vitro" das reações no sangue dos indivíduos de cada grupo sangüíneo ABO aos anti-A e Anti-B. b) Sabe-se que o aglutinogênio é uma proteína da membrana das hemácias. pelagem dourada. a) Qual é o genótipo do macho dourado. com a galinha B de crista ervilha produziu 3 noz: 1 rosa: 3 ervilha: 1 simples e com a galinha C de crista noz a geração tinha 100% crista noz. Em ambos os cruzamentos. 1/8 ervilha e 1/8 simples. A partir desses dados responda: a) Quais os genótipos paternos? b) Os genes em questão obedecem a segunda lei de Mendel? Justifique. Crista Rosa = R_ee Crista Ervilha = rrE_ Crista Noz = R_E_ Crista Simpes = rree Um galo com crista noz foi cruzado com três galinhas. Explique por que a aglutinação não ocorreria se o aglutinogênio fosse uma proteína citoplasmática. Com a galinha A de crista noz produziu na geração 3 noz: 1 rosa. Um galo de crista noz cruzado com uma galinha de crista rosa produziu a seguinte geração: 3/8 noz. quanto aos dois genes mencionados? b) Que tipos de gameta e em que proporção esse macho 22 . Assim o genótipo R_E_ determina crista noz. Observe os fenótipos e genótipos. Questão 104 No quadro a seguir. pretos e marrons. qual seria a pessoa mais indicada para ser o doador? b) Justifique sua resposta. foram produzidos descendentes dourados.3. foi cruzado com uma fêmea preta e com uma fêmea marrom. forma? c) Qual é o genótipo da fêmea preta? d) Qual é o genótipo da fêmea marrom? Questão 106 Em galinhas há quatro tipos de cristas: simples. Questão 107 Em galinhas domésticas o tipo de crista é determinado por dois pares de genes com segregação independente. enquanto os com genótipos "BB" ou "Bb" apresentam pelagem preta. por isso. cada um deles com dois alelos: "Ee" e "Bb".5.a) Entre seus irmãos. Na determinação desses tipos de cristas atuam dois pares de genes (Rr e Ee). R_ee crista rosa. Já os cães com genótipos "EE" ou "Ee" apresentam pigmento nos pêlos. 3/8 rosa. que pode ser preto ou marrom. rrE_ crista ervilha e o genótipo eerr determina crista simples. dependendo do outro gene: os cães homozigóticos recessivos "bb" apresentam pelagem marrom.

DÊ os genótipos dos camundongos envolvidos no cruzamento. 23 .1. A _ B _ = Aguti A _ bb = Preto aaB _ e aabb = Albinos 1. Observe os dois pares de genes envolvidos e os fenótipos relativos aos tipos de coloração dos camundongos. c) CITE a probabilidade de se obterem camundongos pretos do cruzamento de albinos (duplo homozigotos) com aguti (duplo heterozigotos). Os genes A e B são dominantes sobre os seus alelos.4. enquanto os alelos a e b produzem enzimas inativas. os alelos A e B produzem enzimas funcionais. Determine a proporção esperada entre as cores das plantas descendentes na primeira geração do cruzamento AaBb×AABb. devido à não produção de enzima X.4.1 Considere as seguintes condições: .uma única cópia funcional da enzima A ou da enzima B é suficiente para catalisar normalmente a sua respectiva reação. temos que: O gene A é epistático sobre o gene B e.2 Utilizando essas informações e seus conhecimentos. Questão 109 Analisando a via metabólica hipotética.5.5. b) Do cruzamento de dois camundongos aguti obtiveram-se descendentes na seguinte proporção: 9 aguti: 3 pretos: 4 albinos. CITE todos os genótipos possíveis para os camundongos albinos obtidos e APRESENTE UMA EXPLICAÇÃO para a alteração da proporção 9:3:3:1 (esperada em cruzamento de diíbridos) para 9:3:4. encontrado comumente na natureza. . em homozigose recessiva. impede a produção dos pigmentos rosa e vermelho.para as enzimas A e B. faça o que se pede. Responda: a) No cruzamento entre indivíduos de genótipos AaBb×aabb. a) Do cruzamento entre camundongos preto e albino obtiveram-se 100% de camundongos aguti. o tipo selvagem. Duas outras colorações são também observadas: preta e albina. impossibilita a conversão de pigmento rosa em vermelho. O gene B. qual será a proporção fenotípica esperada na progênie? b) Quais são os possíveis genótipos para os indivíduos vermelhos? c) Quais os fenótipos esperados e suas respectivas proporções em F‚ obtidos a partir de parentais AABB × aabb? Questão 110 Em camundongos. apresenta pelagem de coloração acinzentada (aguti). quando em homozigose recessiva (aa).

O duplo recessivo condiciona fruto verde. nessa espécie desconhecida. 3/8 de plantas com frutos amarelos e 1/8 de plantas com frutos verdes.5. II. responda: a) Como se chama esse tipo de interação? b) Qual a proporção fenotípica correta entre os descendentes do cruzamento de plantas heterozigotas para esses dois pares de genes? Questão 113 Existe um gene em cobaias que suprime o efeito do gene que determina a coloração nesses animais. O gene B produz frutos amarelos. O indivíduo duplo recessivo produz frutos verdes. produtora de frutos verdes. foi cruzada com outra planta. estão envolvidos dois pares de genes A/a e B/b. Uma planta. considerando-se que não ocorreu mutação? Justifique. b) O erro ocorreu na primeira ou na segunda divisão da meiose? Explique. XXY. respectivamente. Esse gene está localizado em um cromossomo diferente daquele em que está o gene que determine a cor do animal. conseguindo formar dez pares de cromossomos. pergunta-se: a) Por que é o pai quem determina o sexo da prole? b) Por que os filhos homens de pai hemofílico nunca herdam essa característica do pai? Questão 116 Um geneticista. adotando o mesmo critério utilizado para a montagem de cariótipo da espécie humana. com cariótipo 47. dois cromossomos de tamanhos distintos. justificando sua resposta. que será chamada de planta I. na presença do gene A. além desses. Considere o padrão de determinação de sexo. nos espermatozóides e nas células musculares dessa espécie animal. Uma planta homozigota.Questão 111 Na herança da cor do fruto da moranga. a) Qual genitor formou o gameta com 24 cromossomos? Explique. Questão 114 O daltonismo tem herança recessiva ligada ao X. filha desse cruzamento. o gene B condiciona fruto branco e o gene A condiciona fruto amarelo. Seus genitores tinham visão normal para cores. restando. ele é inibido e produz frutos brancos.1 24 . como o seu alelo b. Questão 115 Com relação à espécie humana. Considerando que tais genes apresentam segregação independentemente um do outro. igual ao do humano e determine: a) quantos cromossomos existem. mas. nos óvulos. O cruzamento entre a planta I e a planta II produziu 4/8 de plantas com frutos brancos. b) o sexo a que pertence o animal da espécie em questão. Um indivíduo anormal.5. Como isto pode ser explicado. Responda: a) Que denominação se dá a este tipo de interação entre os genes A e B? b) Quais os genótipos das plantas I e II? Questão 112 Numa dada planta. 1. montou o cariótipo de certa espécie animal desconhecida. produtora de frutos brancos. era daltônico. é cruzada com outra. mas o gene B inibe a ação do gene A. produtora de frutos amarelos. Questão 117 Esta figura representa uma célula humana na qual uma estrutura está indicada pela seta. Cobaias albinas homozigotas foram cruzadas e todos os descendentes nasceram pretos.

ele é eliminado ou congelado para uso futuro. b) Por que esse mosaico não pode aparecer em um homem? Questão 122 Certos tipos de câncer. Algumas mulheres.5. O alelo que determina a coloração carijó é dominante sobre o alelo para a cor branca. usando um "kit" que determina a presença do cromossomo Y. Caso contrário. a) CITE o nome da célula representada e sua principal função. Promovendo o intercruzamento destes descendentes.1 a) Explique a formação dessas manchas do ponto de vista genético. ficam com a pele toda manchada.Com base na figura e em conhecimentos sobre o assunto. quando se passa um corante sobre a pele. isto é. d) DENOMINE a síndrome que designa o indivíduo cujo sexo é compatível com a presença da estrutura indicada. qual seria a proporção fenotípica esperada? Demonstre os cruzamentos. O cruzamento de uma galinha branca com um galo carijó produziu somente aves carijós. Numa determinada raça. b) CITE o nome da estrutura indicada pela seta e JUSTIFIQUE a existência da estrutura nessa célula. Esse gene se localiza no cromossomo sexual X. c) Utilizando a letra A para designar um conjunto de autossomos e as letras convencionalmente usadas para representar os cromossomos sexuais. Após o transplante de medula é possível identificar os cromossomos de células de diversos órgãos e tecidos. 1. a troca de seqüências de ADN entre cromossomos homólogos. Questão 118 Em galinhas domésticas. Se o embrião for fêmea. portadoras desse gene em heterozigose. determinar o sexo dos embriões logo após a fertilização. em especial aqueles ligados às células do sangue. formando um mosaico de manchas claras e escuras. qual a vantagem dessa prévia determinação do sexo dos embriões? b) Por que o "kit" pesquisa somente a presença do cromossomo Y? Questão 120 Durante o processo de meiose ocorre a recombinação gênica. CITE o número cromossômico dessa célula caso ela pertença a um indivíduo normal e um indivíduo cujo sexo não é compatível com a presença da estrutura indicada. Nesses transplantes. mas não a possui. 25 . Identifique o cromossomo humano que sofre menos recombinação. é reimplantado no útero da vaca. A tabela a seguir mostra os resultados da classificação dos cromossomos de 4 tecidos de um paciente submetido a transplante de medula. Questão 121 Na espécie humana existe um gene raro que causa a displasia ectodérmica anidrótica. Justifique sua resposta. a) Para esses fazendeiros. atualmente.5. a coloração das penas é uma característica condicionada pelo gene C e é ligada ao sexo. uma parte da medula óssea de um doador sadio é introduzida na coluna vertebral de um paciente cujas células da medula óssea foram previamente eliminadas com auxílio de drogas ou de radiação. que é uma anomalia caracterizada pela ausência das glândulas sudoríparas. Questão 119 Fazendeiros que criam gado leiteiro podem. o sexo feminino é heterogamético. são tratados com transplantes de medula óssea.

dando origem a um descendente com cariótipo 2AXXY. 26 1. Questão 124 Em uma 'Drosophila melanogaster'. Com esse objetivo. mas por um balanço gênico entre genes femininizantes e masculinizantes. pergunta-se: a) Qual é o sexo do descendente com cariótipo 2AXXY? b) Sabendo-se que o sexo da 'Drosophila melanogaster' pode ser definido por um índice sexual (I.1 Com base nesses resultados. a determinação do sexo não é feita simplesmente pela presença ou ausência do cromossomo Y. Este corpúsculo é conhecido hoje como cromatina sexual ou corpúsculo de Barr. Questão 123 O governo de uma sociedade totalitária decidiu conter a expansão demográfica reduzindo a proporção de homens na população. .5. As demais mulheres poderiam continuar a ter filhos até que tivessem um filho homem. Responda: a) Quantos cromossomos X tem esta mulher? b) Se ela se casar com um homem normal. Os testículos da atleta fora extirpados para que ela pudesse competir na equipe feminina de judô a) Que vantagem a atleta levaria sobre as demais competidoras se tivesse os testículos durante a competição? b) Sabendo-se que ela foi considerada do sexo feminino.). a) Qual é a probabilidade de que uma filha desse casal apresente a doença? b) Qual é a probabilidade de que um outro filho desse casal seja também hemofílico? Justifique suas respostas. qual a probabilidade de ter uma filha com constituição cromossômica igual à sua? Questão 127 Essa lei atingirá o objetivo desejado depois de algumas gerações? Justifique sua resposta.S. a) A que corresponde tal corpúsculo e em que tipo de células (somáticas ou germinativas) ele aparece? b) Qual a sua importância e por que ele não ocorre nas células masculinas? Questão 126 A análise dos núcleos interfásicos de células da mucosa oral de uma mulher. A matéria dizia.5.) do descendente acima referido? Uma revista publicou uma reportagem com o título "Atleta com anomalia genética faz operação para definir seu sexo e poder competir na classe feminina de judô". um pequeno corpúsculo de cromatina intensamente corado. que testes citogenéticos você faria para comprovar esta afirmação? Questão 128 Um casal de não hemofílicos tem um filho com hemofilia.S. Se o cromossomo X de uma fêmea com cariótipo 2AXX sofrer não-disjunção meiótica e o óvulo resultante com 2 cromossomos X for fecundado por um espermatozóide normal. que a jovem era um caso de pseudo-hermafroditismo. fenotipicamente normal. pois apresentava órgãos sexuais internos masculinos e órgãos sexuais externos femininos. foi então promulgada uma lei segundo a qual todas as mulheres que tivessem um filho homem não mais poderiam ter filhos. Justifique sua resposta.Questão 125 Na década de 40 descobriu-se que algumas células retiradas de mulheres apresentavam no núcleo interfásico. identifique o sexo do paciente e o sexo do doador. portador de um cromossomo Y. ainda. revelou a existência de duas cromatinas sexuais em todos eles. qual é a relação que expressa esse índice? c) Qual é o índice sexual (I.

todos afetados por uma doença genética muito rara. Com base nessas informações e nas contidas na árvore genealógica adiante. ela teve quatro filhos.5. qual é a probabilidade de 27 . em ambos os casos com indivíduos normais e que não eram seus consangüíneos. que causa aborto espontâneo. 1.2 Questão 133 O gene recessivo d está localizado no cromossomo X e é responsável pelo daltonismo na espécie humana. b) Se os dois maridos da mulher fossem irmãos isto poderia alterar sua resposta anterior? Por quê? Questão 131 No heredograma a seguir. qual era o fenótipo da avó materna? Justifique sua resposta. ocorrem dois meninos hemofílicos. Conforme mostrado na genealogia a seguir.5.5. Supondo que quinze de suas gestações se completem. 1. qual é a probabilidade de que o próximo filho homem desse casal venha a ser hemofílico? a) Que padrão de herança explica melhor a genealogia? Justifique sua resposta. Com base nessas informações e nas contidas na árvore genealógica adiante. responda à seguinte pergunta: se a mulher 4 casar com um homem normal e seu primeiro filho for um menino hemofílico. responda à seguinte pergunta: se a mulher 5 se casar com um homem daltônico.2 a) Qual é a probabilidade de que uma segunda criança de II-4 e II-5 seja afetada? b) Qual é a probabilidade de II-2 ser portadora do alelo que causa a hemofilia? c) Se o avô materno de II-4 era afetado.2 Questão 132 O gene recessivo h está localizado no cromossomo X e é responsável pela hemofilia na espécie humana. A hemofilia tem herança recessiva ligada ao cromossomo X.Questão 129 Uma mulher é portadora de um gene letal ligado ao sexo. 1. entre as que nascerem? Justifique sua resposta. Questão 130 Uma mulher clinicamente normal casou-se duas vezes.5. dois de cada casamento.5.5. qual o número esperado para crianças do sexo masculino.

Preocupado com a possibilidade de transmitir essa doença. Nele. que causa aborto espontâneo. de Maranguape. ao casar com uma mulher normal. preparou o heredograma abaixo. 1. b) Calcule os valores correspondentes à probabilidade de que o primo doente do consultante.2 Questão 134 Uma mulher é portadora de um gene letal ligado ao sexo. Questão 136 O daltonismo (cegueira para as cores) se deve a uma mutação recessiva ligada ao sexo.5.2 28 . gere filhas e filhos afetados pela doença.Daltônica Na figura a seguir.que o próximo filho homem desse casal venha a ser daltônico? a) Sabendo que a doença em questão é um caso de herança ligada ao sexo.Visão normal XdY . bem como a inexistência de casamentos consangüíneos. diversos membros são afetados por raquitismo resistente ao tratamento com vitamina D. Questão 135 Um homem pertence a uma família na qual.5. consultou um geneticista que.5. qual o número esperado para crianças do sexo feminino entre as que nascerem? Justifique sua resposta. Sendo assim. Supondo que nove de suas gestações se completem.Daltônico Mulheres: XDXD .2 1.Visão normal XdXd . isto é.5. localizada na parte não homóloga do cromossomo X.5. Homens: XDY . há gerações. o consultante está indicado por uma seta. formule a conclusão do geneticista quanto à possibilidade de o consultante transmitir a doença a seus descendentes diretos.Visão normal XDXd . os símbolos sombreados representam indivíduos daltônicos em um dos ramos da família Abreu. 1.5. após constatar que a família reside em um grande centro urbano. podemos representar genótipos e fenótipos de homens e mulheres como no quadro a seguir.

responda: a) A mãe do cruzamento I é homozigota ou heterozigota? Justifique.5.7. A figura a seguir mostra o heredograma de um tipo de diabetes que leva a problemas no metabolismo do fosfato e dos carboidratos. IV. considerando o seu casamento com um homem normal (indivíduo III‰).2 Questão 139 1.2 e IV. c) Quais todos os genótipos prováveis para os descendentes (filhos e filhas) de um possível casamento entre IV. a) Qual a principal característica clínica da hemofilia A? Justifique por que esse sintoma clínico aparece nos afetados. Os resultados mostraram um aumento significativo na produção do fator VIII nos indivíduos tratados.Analisando a figura. Questão 137 Na espécie humana há algumas condições dominantes ligadas ao cromossomo X. responda: a) Quais os genótipos dos indivíduos II. Estas células receberam cópias do gene normal para o fator VIII e foram posteriormente reintroduzidas no indivíduo. ela ser do sexo masculino e daltônico? Justifique sua resposta.1. b) Quais são os prováveis genótipos dos indivíduos II-2.2 e IV.9? b) Qual a probabilidade de. explique por que o pêlo de uma gata pode ter três cores.5. no quadro anterior. b) Analise a Árvore Genealógica de MS e informe: 1. III-4 e III-5? Questão 138 MS (indivíduo IIIˆ) está grávida.5.9 e III. Um deles é responsável pela cor preta e o outro pela cor amarela. 2. tendo em vista as informações e usando os símbolos dados.risco de sua prima (indivíduo III„) vir a ter uma outra criança hemofílica do mesmo casamento com o indivíduo III…. III.9? Justifique sua resposta. embora sejam raras. Como não tem recursos para fazer o diagnóstico pré-natal dessa doença pelo estudo do DNA fetal. por meio das . para representar os genes. Ela quer obter mais informações sobre a hemofilia A e conhecer. Questão 140 Uma das primeiras experiências de terapia genética foi realizada com indivíduos hemofílicos cujo gene para o fator VIII de coagulação era defeituoso. Com essas informações. 1. leis da probabilidade. procurou um geneticista. Existe um terceiro gene autossômico (não localizado nos cromossomos sexuais) que é responsável pela cor branca. enquanto o pêlo de um gato só pode ter duas cores.2 A cor do pêlo dos gatos depende de um par de genes alelos situados no cromossomo X.risco de ela vir a ter uma criança hemofílica. Supondo que o indivíduo tratado venha a ter filhos com 29 Com base no enunciado e na análise do heredograma.10. o seu risco e também o de sua família de vir a ter uma criança com essa doença.5. tem vários parentes com hemofilia clássica ou hemofilia A. Na terapia foram retiradas células da pele do paciente. nascendo uma criança de III.

5.5. ou. fenótipo dos indivíduos. explique por que a doença da família 2 ainda poderia ser encontrada em indivíduos da geração VI (netos da geração IV).uma mulher cujos genes para o fator VIII sejam defeituosos.2 1. Questão 142 Os heredogramas a seguir representam duas famílias com doenças hereditárias distintas.2 30 . existe possibilidade de nascimento de uma criança não hemofílica? Justifique sua resposta. atenda às solicitações a seguir. A doença que acomete a família 1 provoca retardamento mental acentuado. dois caracteres genéticos com mecanismos de herança distintos. a) indique os genótipos dos indivíduos. Questão 143 Com o objetivo de reconstruir a história familiar de um caso de herança de daltonismo.5. enquanto que a da família 2 é uma doença degenerativa fatal que aparece em torno dos 40 anos de idade. b) Considerando que a seleção natural pode eliminar doenças genéticas.2 e considerando que os indivíduos apresentam. Após analisar os heredogramas. o heredograma a seguir começou a ser elaborado para que fosse determinado o genótipo e.5.5.5. a) Quais os tipos de herança envolvidos na transmissão das doenças de cada família? Justifique sua resposta. Sabendo-se que o loco do gene para o daltonismo está no cromossomo X. c) discuta a possibilidade de uma mulher hemofílica e albina ser filha biológica dos pais propostos no heredograma que você construiu. simultaneamente. responda: 1. b) construa um heredograma no qual três desses indivíduos sejam os filhos biológicos (legítimos) dos outros dois. Questão 141 Seguindo a representação a seguir 1. e ausente no Y.

1 e III . ao ver as cores preta e amarela do animal. Um de seus gatos apresenta hipoplasia testicular (testículos atrofiados) e é totalmente estéril. a) O que é e qual o tipo de aneuploidia que o gato de José apresenta? b) Qual a explicação dada pelo veterinário relacionando a anomalia com as cores do animal? Questão 147 O daltonismo é comumente entendido como a incapacidade de enxergar as cores verde e/ou vermelha. Os símbolos em escuro representam os indivíduos com anomalia Questão 146 José é uma pessoa muito interessada na criação de gatos. Este casal teve dois filhos: João e Maria.1 e II . quais os genótipos dos indivíduos II-4 e II-5? Uma mulher deu à luz um menino com hemofilia. Questão 144 Na espécie humana. Os círculos representam as mulheres e os quadrados. c) Se os indivíduos III . o número de mulheres afetadas pelo daltonismo é baixo quando comparado com o número de homens afetados pela anomalia. a) Qual o tipo mais provável da herança desta anomalia? Justifique. Nos indivíduos daltônicos. alguns desses pigmentos não estão presentes. quantas pessoas A MAIS. responda. José procurou um veterinário que. b) Tendo em vista o tipo de herança mais provável. os homens. e o malhado apresenta os dois genes (A e P). ambos ligados ao sexo. Supondo-se que a freqüência de homens daltônicos nas populações seja de 10%. neste heredograma. Os genes que participam da síntese desses pigmentos localizam-se no cromossomo X. A percepção de cores é devida à presença de diferentes tipos do pigmento retinol nos cones da retina. alterando a percepção das cores. 31 . a) Qual a probabilidade de João ter herdado do pai o gene para daltonismo? Qual a probabilidade de Maria ter herdado do pai o gene para daltonismo? b) Por que é mais freqüente encontrarmos homens daltônicos que mulheres daltônicas? Questão 148 1. O daltonismo é um caráter recessivo. Como nenhum de seus parentes próximos era hemofílico.5.a) Se os indivíduos I . também deverão apresentar este fenótipo? b) O indivíduo II . poderão ter uma menina normal homozigota? Justifique. ela supôs que o problema teria surgido porque o pai da criança trabalhava em uma usina nuclear e teria ficado exposto a radiações que alteraram seu material genético.5. As cores nos gatos domésticos são determinadas por um gene A (cor amarela) e outro gene P (cor preta). responda: a) Por que o daltonismo é raro nas mulheres? b) Quantas vezes os homens daltônicos são mais freqüentes nas populações do que as mulheres daltônicas? Questão 145 A genealogia representada na figura é de uma família com uma anomalia rara na espécie humana. Um homem daltônico casou-se com uma mulher de visão normal em cuja família não havia relatos de casos de daltonismo.5 poderá ter irmão normal? Justifique. A mulher tem razão? Justifique. imediatamente fez o seguinte diagnóstico: trata-se de um caso de aneuploidia de cromossomos sexuais.4 vierem a se casar e ter filhos.2 Com base nessa genealogia.5 são daltônicos.

e 3 mulheres. desenhe o heredograma dessa família considerando o gene (A) normal e o gene (a) mutado e apresente os prováveis progenes. a) Qual será a cor dos olhos dos machos e fêmeas na primeira geração (F)? E na segunda (F‚)? Justifique. 1. Represente como B o alelo dominante para olhos vermelhos e como b o alelo recessivo para olhos brancos. Para o heredograma. Questão 151 Um geneticista estudou dois grupos. Uma das filhas se casa com um homem normal e tem 7 filhos. pode-se dizer que o modo de herança mais provável seja de herança ligada do X dominante. como no ser humano. a) Quais são os fenótipos de F e de F‚ desse cruzamento? b) Como seria o resultado em F e F‚. mesmo quando elas pertencem a gerações afastadas entre si. assim como a probabilidade de filhos afetados para o casamento entre os últimos primos. biologia molecular e engenharia genética podem. também afetada pela doença. Justifique essa conclusão. uma moça normal e 2 homens. Questão 153 Os conhecimentos atuais de biologia celular. portadores de uma doença genética que se manifestava da seguinte maneira: O pesquisador concluiu que não se tratava de uma doença com herança dominante ou recessiva ligada ao sexo. afetado pela doença. Um peixe macho com manchas na nadadeira foi cruzado com uma fêmea sem manchas. Um alelo de um lócus do cromossomo Y do peixe 'Lebistes' determina a ocorrência de manchas na nadadeira dorsal. e o cruzamento das moscas F entre si. das quais somente uma é normal. utilize a simbologia: quadrados e círculos brancos para. O heredograma a seguir mostra os descendentes do casal João e Maria. a) O que levou o pesquisador a concluir que não se tratava de herança ligada ao sexo? b) Por que o pesquisador teve dúvida quanto ao tipo de herança autossômica? Questão 152 Uma doença humana rara é introduzida em uma família quando uma mulher normal se casa com um homem afetado. O irmão mais velho. A irmã mais nova. 2 mulheres e 3 homens. homens e mulheres normais. estabelecer com segurança o parentesco entre pessoas. b) Qual será a proporção de machos e fêmeas nas duas gerações? Justifique. sendo 4 homens. quadrados e círculos hachurados para homens e mulheres afetados. Esse casal tem 5 filhos. respectivamente.2 32 . I e II. Todas as filhas mulheres são afetadas por essa doença. Responda as três questões a seguir considerando o cruzamento de uma mosca fêmea de olhos vermelhos de uma linhagem pura para cor de olhos com um macho de olhos brancos. Questão 150 A determinação do sexo em peixes segue o sistema XY. a filha afetada do irmão mais velho e o filho afetado da irmã mais nova. casa-se com uma mulher normal e tem 2 filhos.5. muitas vezes. dos quais 2 são afetados. se casa com um homem normal e tem 3 filhos. porém teve dúvida se se tratava de herança autossômica recessiva ou autossômica dominante com penetrância incompleta.Questão 149 No gênero Drosophila. um normal e outro afetado. se o alelo fosse dominante e estivesse no cromossomo X do macho? Demonstre. Observando a genealogia. uma mulher afetada e um homem normal. através de um cruzamento. a cor vermelha ou branca dos olhos é determinada por um gene localizado no cromossomo X.5.

Por não haver documentos legais comprobatórios da relação de parentesco. Questão 156 Três grupos de alunos realizaram cruzamentos-testes entre plantas de tomate para o estudo de diferentes genes. Indique o número de: a) bisnetos do sexo masculino e do sexo feminino que poderiam ser identificados com aproximadamente 100% de certeza. Nesses cromossomos. B/b e D/d. que tipos de gameta esta célula poderá formar? b) Que pares de alelos têm segregação independente? 1. Essas freqüências fenotípicas obtidas não estão de acordo com o esperado. considerando-se a Segunda Lei de Mendel (Lei da Segregação Independente). numa célula em divisão meiótica. Cruzando-se essas plantas heterozigóticas com plantas da linhagem pura de flores vermelhas e grãos de pólen redondos.5. 17 com flores púrpuras e grãos de pólen redondos. foram obtidas 160 plantas: 62 com flores púrpuras e grãos de pólen longos.5. b) netos e bisnetos de João e Maria que possuíram ou possuem o cromossomo Y idêntico ao de João e justifique sua resposta. nem ser possível a coleta de material genético dos membros falecidos da família. 66 com flores vermelhas e grãos de pólen redondos. 1.a) Quanto aos pares de alelos mencionados. ocorreram as permutas indicadas pelas setas 1 e 2. a) De acordo com a Segunda Lei de Mendel. quais são as freqüências esperadas para os fenótipos? b) Explique a razão das diferenças entre as freqüências esperadas e as observadas. dois pares de cromossomos com três genes em heterozigose: A/a. a técnica de identificação por meio do estudo do DNA extranuclear.5.6 1. e justifique sua resposta. 15 com flores vermelhas e grãos de pólen longos.3 Questão 155 Foram realizados cruzamentos entre uma linhagem pura de plantas de ervilha com flores púrpuras e grãos de pólen longos e outra linhagem pura.6 33 . por técnicas que determinam a homologia entre amostras de DNA extranuclear. Os grupos obtiveram os seguintes resultados: Atualmente. com flores vermelhas e grãos de pólen redondos. e se apresentaram para a identificação de herdeiros do casal citado. Todas as plantas produzidas tinham flores púrpuras e grãos de pólen longos. de toda essa família.5. Questão 154 O esquema a seguir representa. dentre outras. foi utilizada. apenas Maria e todos os seus bisnetos estão vivos.

em frações decimais. um indivíduo heterozigoto apresenta aptidão mediana. a) Como se denomina a situação mencionada? Supondo o cruzamento AB/ab com ab/ab b) Qual será a porcentagem de indivíduos AaBb na descendência? c) Qual será a porcentagem de indivíduos Aabb? Questão 159 Numa população de 100 pessoas.a) Indique o(s) grupo(s) que trabalhou (trabalharam) com genes ligados. Considere. a) Expresse. Questão 157 Considere que os genes autossômicos. que a característica em questão não altera o valor adaptativo dos indivíduos. e um indivíduo homozigoto dominante apresenta maior aptidão. 36 são afetadas por uma doença genética condicionada por um par de alelos de herança autossômica recessiva. 34 . em média. que permitiria ao casal do item b ter filhos com aptidão mediana para aprender biologia mas sem aptidão para tocar guitarra? d) Quais os locos cuja herança não resultará em proporções segregantes dentro dos padrões da segunda Lei de Mendel? e) Uma mãe sem aptidão para aprender biologia e tocar guitarra. em Genética. b) Quantos indivíduos são homozigotos? c) Suponha que nessa população os cruzamentos ocorram ao acaso. proposto por Thomas Hunt Morgan. deles resultando. b) O que significa. o termo ligação? Qual é a sua utilidade para a pesquisa científica? c) Calcule a distância. também. entre os genes pesquisados pelos alunos do grupo G2. qual será a porcentagem esperada de indivíduos de fenótipo dominante na próxima geração? Justifique suas respostas mostrando como chegou aos resultados numéricos. matemática (M) e tocar guitarra (G). Em um dado loco. correspondam a aptidões para aprender biologia (B). poderá esperar descendentes (F1) com qual(is) genótipo(s)? b) Se um descendente (F1) se casar com um indivíduo sem aptidão para as três habilidades. qual a probabilidade desse casal ter uma criança com aptidão mediana para matemática? c) Qual o nome do mecanismo genético. faça o que se pede: a) Um casal (P1). em unidades de mapa genético. Com base nessas informações. um indivíduo com genótipo recessivo não apresenta aptidão. Nessas condições. Justifique.6 Os locos gênicos A e B se localizam em um mesmo cromossomo. ao se casar com um indivíduo com genótipo: Questão 158 1. havendo 10 unidades de recombinação (morganídeos) entre eles. igual número de descendentes. mas com aptidão mediana para aprender matemática. terá 100% dos filhos(as) com aptidão no mínimo mediana para as três características. identificados nos cromossomos (I e II).5. formado por um indivíduo triplo homozigoto dominante e outro triplo homozigoto recessivo. a freqüência dos genes dominantes e recessivos.

Um dos instrumentos mais utilizados nesses estudos é a pesquisa sobre o comportamento de gêmeos univitelinos que foram criados em ambientes diferentes. p£+ 2pq + q£= 1. onde p e q são as freqüências de dois alelos. Dos 420 indivíduos de flores vermelhas. Alguns mecanismos evolutivos que alteram a freqüência dos genes são: 1) Seleção natural. Determine a freqüência dos genes V e a freqüência dos genes v nessa população. Em uma das ilhas do arquipélago de Galápagos. uma população ideal deve atingir o equilíbrio.Questão 160 Um determinado gene de herança autossômica recessiva causa a morte das pessoas homozigóticas aa ainda na infância. Questão 162 A SOCIOBIOLOGIA procura explicar o comportamento dos indivíduos em função de sua herança genética. uma dessas crianças apresentou uma doença. Questão 166 O grupo sangüíneo MN é determinado por dois alelos codominantes. 3) Deriva ao acaso da freqüência gênica. ou estado estático. Numa determinada população em equilíbrio de Hardy-Weinberg nasceram 10. uma das condições estabelecidas por Hardy e Weinberg para populações ideais foi seriamente afetada por uma erupção vulcânica ocorrida há cerca de cem mil anos. Questão 165 A freqüência gênica de dois alelos em uma população. b) Defina o conceito de evolução em função da freqüência dos genes de uma população e indique de que forma a diminuição da população afetou a evolução dos jabutis gigantes. principalmente em populações pequenas. a) Cite duas das condições propostas por Hardy e Weinberg para que o equilíbrio possa ser atingido. Qual o princípio científico dessa abordagem experimental? Questão 163 Pela equação Hardy-Weinberg. desde que a população esteja em equilíbrio. Questão 164 Uma população vegetal que NÃO está em equilíbrio de Hardy-Weinberg. Calcule a freqüência de indivíduos de fenótipo normal portadores do gene causador da fenilcetonúria nessa população. A freqüência dos genótipos desse grupo sangüíneo foi amostrada em duas populações humanas e os resultados são apresentados na tabela a seguir. As pessoas heterozigóticas Aa são resistentes a uma doença infecciosa causada por um protozoário. é composta por 500 indivíduos. Espera-se encontrar diferença na freqüência de nascimento de crianças aa entre essas regiões? Por quê? Questão 161 Segundo o Teorema de Hardy Weinberg. Desses. a qual é letal para as pessoas homozigóticas AA. Qual das três possibilidades apresentadas NÃO pode ser aceita para explicar a variação na freqüência dos genes citados? Justifique sua resposta.000 crianças. Esta erupção teria diminuído drasticamente a população de jabutis gigantes da ilha. Considere regiões geográficas em que a doença infecciosa é endêmica e regiões livres dessa infecção. 420 são de flores vermelhas (fenótipo dominante) e 80 são de flores brancas (fenótipo recessivo). 35 . foi de A= 80% e a=20%. Com essa equação podemos calcular a freqüência de um genótipo sabendo a freqüência de um dos alelos. numa dada geração. sem grandes alterações de seu reservatório genético. ou vice-versa. Na geração seguinte foi observada uma freqüência de A=60% e a=40%. 380 são homozigóticos (VV) e 40 são heterozigóticos (Vv). determinada por um gene autossômico recessivo. 2) Taxa de mutação gênica. a fenilcetonúria.

a) Qual a freqüência dos alelos A e a em cada uma das populações? b) Qual delas tem a maioria dos indivíduos homozigotos? Explique. é de 0. portanto. calcule. respectivamente. cada uma com 200 indivíduos diplóides. isto é. 1 e 2. Indique o genótipo das pessoas do grupo sangüíneo O. b) Qual o nome dado a essa alteração brusca na freqüência gênica? Questão 168 Uma das maneiras de verificar se uma determinada espécie está ou não em evolução é fazer um estudo do patrimônio genético de suas populações. a freqüência do referido gene na população. Entretanto.40 (40%) em uma população em equilíbrio. isto é. em estado de não-evolução. Em uma amostra de 1000 pessoas desta população. alterando de forma brusca a freqüência do gene recessivo na população da ilha. quantas se espera encontrar com sangue do tipo O? Explique as etapas que você seguiu para chegar à resposta. EM PORCENTAGEM. Usando o teorema de Hardy-Weinberg pode-se determinar as freqüências gênicas de uma população e demonstrar se a espécie está em equilíbrio. um determinado gene apresenta-se em duas formas. uma população em que os casamentos ocorrem ao acaso. com 400 alelos. 40 indivíduos com genótipo Aa e 70 indivíduos com genótipo aa. Questão 167 Numa determinada ilha existia uma população animal com indivíduos possuidores de uma característica normal e indivíduos possuidores de uma característica recessiva. 130 indivíduos com genótipo Aa e 25 indivíduos com genótipo aa. para que uma população se mantenha em equilíbrio genético é necessário que ela se enquadre em certas condições. sendo 36% dos indivíduos recessivos. Considerando que tal população se encontre em equilíbrio genético. Questão 172 Uma característica fenotípica de uma população. Um estudo dessa população determinou que a freqüência do fenótipo amarelo era de 50% e NÃO SE SABE se essa população está em equilíbrio de Hardy-Weinberg. caso exista.5. Escreva quatro destas condições: 36 . Despreze a parte fracionária de seu resultado. portanto. a dominante e a recessiva. Mas um desastre ambiental provocou a morte de todos os indivíduos com a característica recessiva. Justifique sua resposta. a) Após o desastre pode-se afirmar que a freqüência do gene recessivo será zero? Justifique sua resposta. numa proporção de 10:1. que determina o grupo sangüíneo O.Questão 169 Em uma população. A população 1 apresenta 90 indivíduos com genótipo AA. como a cor amarela. Com base nessas informações. Questão 171 A freqüência do gene i. aplicar o Princípio de Hardy-Weimberg. Explique. 1. Esse gene tem um alelo que não produz essa característica. podendo-se. Questão 170 Considere duas populações diferentes. é determinada por um gene dominante. não é possível saber a freqüência do gene para cor amarela.7 Calcule a freqüência do alelo M nas duas populações e determine se a população da Europa como um todo é uma população panmítica. A população 2 apresenta 45 indivíduos com genótipo AA.

5. Retirou-se uma segunda amostra (amostra B). responda: a) Qual a importância de o DNA autoduplicar-se? b) Por que essa replicação é semiconservativa? Questão 180 No DNA de um organismo. Que outras bases nitrogenadas devem existir neste DNA e em que proporções? Justifique sua resposta. todo o DNA tem uma densidade intermediária entre o que é constituído apenas por ¢¥N e o que contém apenas ¢¦N? b) Considerando que. 18% das bases nitrogenadas são constituídas por citosina. Utilizando seus conhecimentos sobre o material genético. TTT AAT GGG CAT a) Qual é a seqüência de bases da hélice complementar a esse segmento? b) Qual é a seqüência de bases do RNA mensageiro transcrito a partir desse segmento? Questão 179 Para funcionar como material genético o ácido desoxirribonucléico (DNA) apresenta a capacidade de autoduplicação. extraiu-se o DNA que foi submetido a uma técnica de centrifugação que permite separar moléculas de DNA de acordo com sua densidade.Questão 173 No DNA de um organismo.1 A figura mostra o resultado da centrifugação do DNA das três amostras de bactérias. a quantidade de DNA separada na faixa inferior é X. quando as bactérias completaram duas divisões celulares. na amostra B. que quantidade de DNA há na faixa superior? Questão 175 Quais são as duas propriedades fundamentais do DNA que permitem a essa substância desempenhar o papel de material genético? 37 . O restante das bactérias foi transferido para um meio de cultura em que todo o nitrogênio disponível era o isótopo normal ¢¥N. Questão 174 Bactérias (Escherichia coli) foram cultivadas durante várias gerações em um meio de cultura na qual toda a fonte de nitrogênio era o isótopo pesado ¢¦N. Questão 176 Por que o processo de replicação do DNA é chamado semiconservativo? Questão 177 Dada a seqüência de bases nitrogenadas de um segmento de DNA: AAT GGC ATC responda: a) Qual é a seqüência de bases da hélice complementar a esse segmento? b) Qual é a seqüência de bases do RNA mensageiro transcrito a partir desse segmento? Questão 178 Dada a seqüência de bases nitrogenadas de um segmento de DNA a seguir. De uma amostra dessas bactérias (amostra A). na amostra C. O DNA das bactérias das amostras B e C foi também extraído e centrifugado. a) Por que. Que outras bases nitrogenadas devem existir neste DNA e em que proporções? 1. 20% das bases nitrogenadas são constituídas por adenina. responda aos itens adiante.8. quando as bactérias completaram uma divisão celular nesse novo meio e uma terceira amostra (amostra C).

Questão 183 O que são NUCLEOTÍDEOS? Quais são as moléculas que entram em sua composição química? Questão 184 Quais são as diferenças observadas nos nucleotídeos que entram na composição do DNA em relação aos que entram na composição do RNA? Questão 185 O que representa o desenho a seguir? Qual o nome das moléculas representadas pelos números 1.Questão 181 Mencione duas diferenças de natureza molecular entre o DNA e o RNA. Que outras bases nitrogenadas possui essa molécula e em quais proporções? Questão 188 Os ácidos nucléicos são macromoléculas definidas como polinucleotídeos. Questão 186 No desenho a seguir. o que representam os números 1. São elas: I .8. que representa a estrutura da molécula de DNA.TRANSCRIÇÃO Explique essas duas propriedades.5. b) Quais são as diferenças observadas nos nucleotídeos que entram na composição do DNA em relação aos que entram na composição do RNA? Questão 189 1.5.8.1 Para funcionar como material genético o DNA apresenta duas propriedades fundamentais. 38 . a) Represente um nucleotídeo apontando seus três constituintes moleculares. respectivamente. 2 e 3 respectivamente? Questão 190 Sabendo-se que numa molécula de DNA formada por uma dupla hélice há 21% de timina. sabendo que se trata da unidade estrutural do ácido desoxirribonucléico (DNA)? Questão 187 Uma molécula de DNA contém 15% de guanina. responda quais são as outras bases dessa molécula e em que proporções ocorrem. 2 e 3.AUTODUPLICAÇÃO II . 1.1 Questão 182 Justifique o termo SEMICONSERVATIVO para caracterizar o processo de replicação do DNA.

b) as características fenotípicas são diferentes.1 a) Cite o tipo de molécula à qual a uridina se incorporou. entre essas células: a) as características genotípicas são iguais. Que outras bases nitrogenadas devem existir neste DNA e em que proporções? Questão 194 CÉLULAS IMORTAIS CONTAM AOS CIENTISTAS HISTÓRIA DA EVOLUÇÃO DA HUMANIDADE Estas células formam um livro. adicionou-se o nucleosídeo uridina marcado radioativamente com H¤ ao meio de cultura.. 39 . conservado em tanques de nitrogênio líquido que guarda informações desconhecidas sobre a humanidade. casamentos ancestrais e os ataques de doenças. Os capítulos contam diferentes detalhes da saga do homem na terra: suas andanças pelos continentes. Nomeie o processo através do qual o DNA é capaz de controlar e interferir nas características morfológicas e fisiológicas da célula. 15 e 90 minutos após a transferência. b) Nomeie o compartimento celular que seria marcado. Esse processo marca a posição aproximada do isótopo dentro da célula.8. como representado no esquema a seguir..Questão 191 Considere um segmento de DNA com a seguinte seqüência de bases nitrogenadas: ATT CTA CGC AAA GGC através de observações de características morfológicas e fisiológicas da célula.5. fixadas e submetidas a auto-radiografia. se o nucleosídeo radioativo usado fosse a timidina e justifique sua resposta. Amostras destas células foram retiradas 3. Explique por que. b) ". as células foram transferidas para um novo meio que não continha o isótopo. qual será a seqüência de bases desse RNA? Questão 192 Considere a seqüência de bases nitrogenadas de um segmento de DNA: AAA GGC ATT Responda: a) Qual é a seqüência de bases da hélice complementar a esse segmento? b) Qual é a seqüência de bases do RNA mensageiro transcrito a partir desse segmento? Questão 193 No DNA de um organismo. Após algum tempo. "O Globo") a) Explique por que o processo de autoduplicação do DNA dá significado à hereditariedade permitindo revelar a história da evolução da humanidade. Questão 195 a) Quais são as bases da cadeia complementar a esse segmento? b) Se o segmento dado servir de molde para a produção de RNA. (adaptado de. suas andanças pelos continentes. ainda no estágio de girino. 32% das bases nitrogenadas são constituídas por citosina. com as de células de tecido similar do mesmo indivíduo após atingir a idade adulta. casamentos ancestrais e os ataques de doenças" podem ser estudados Em células eucariotas mantidas em cultura. foram comparadas as características genotípicas e fenotípicas de células retiradas de um tecido de anfíbio. colocadas em lâmina de vidro. Questão 196 Num experimento. 1. Justifique sua resposta. sendo. então.

Por outro lado. verificou-se que este gene está localizado no genoma mitocondrial. o DNA possui duas propriedades. Identifique-as e descreva resumidamente cada uma delas. existe uma enzima. a DNA polimerase. Assumindo que a DNA polimerase apresenta uma velocidade de reação constante para todas as espécies analisadas. No entanto.Questão 197 Para desempenhar sua função como material hereditário. Para replicar o genoma. b) Justifique as respostas ao item a. Assim. a) Informe a percentagem de filhas e filhos cegos de um casal: I) cuja mulher é normal e o homem é cego. um amigo o aconselha a receber uma transfusão de sangue 2 meses antes do teste (em geral colhe-se o sangue como fonte de células nucleadas). aproximadamente 43 dias! Sabemos. explique essa aparente contradição. e que o tempo médio de replicação de uma célula eucariota é de 12 horas. Questão 198 A mutação em um gene humano provoca cegueira. Tal evento inibiria 40 . no entanto. a seqüência de nucleotídeos transcrita pode estar em uma cadeia.coli" é de cerca de 20 minutos. a DNA polimerase consumiria cerca de 83 minutos e. que o tempo de geração da "E. Questão 199 O genoma da bactéria "Escherichia coli" tem um tamanho de 4×10§ pares de nucleotídeos. Questão 200 O teste de tipagem de DNA revelou que nos seres humanos existe individualidade genômica. para replicar todo o genoma de uma bactéria. ou seja. a) Qual a influência da transfusão sugerida no resultado no exame? b) Que precauções podem ser tomadas para desmascarar a tentativa de fraude? Questão 201 A tipagem de DNA é uma técnica desenvolvida recentemente que permite identificar e estabelecer o grau de parentesco entre indivíduos. Assim. II) cuja mulher é cega e o homem é normal. Para alguns genes. usa-se um marcador do cromossomo Y. sabe-se que no mesmo trecho nunca ocorre a transcrição simultânea das duas cadeias de uma molécula de ADN. para uma análise matrilínea (materna). Com a utilização de técnicas de genética clássica e molecular. isto é. Já o genoma haplóide humano tem 3×10ª pares de nucleotídeos. ao passo que a seqüência do outro gene pode estar localizada na cadeia oposta. que não se altera ao longo das gerações (salvo em casos de mutações). a investigação dos ancestrais paternos. cuja velocidade de reação é equivalente a cerca de 800 nucleotídeos/s. Por que o DNA mitocondrial deve ser usado para a análise matrilínea? Questão 202 No ADN. a tipagem do DNA revela um padrão de bandas que é estável (presente no DNA de todos os tecidos) e é transmitido aos descendentes seguindo as leis de Mendel. Para se realizar uma análise patrilínea. mas sim o gene mutado. lança-se mão do DNA mitocondrial. Graças a essas características é possível atualmente realizar testes de paternidade que comparam os padrões de bandas de DNA das pessoas e revelam se um homem é de fato o pai biológico de uma outra pessoa. antes da divisão celular. Isto significa que cada indivíduo possui variações discretas e características na seqüência de seu DNA. a transcrição dos genes não está restrita a somente uma das suas cadeias. Sabe-se que todas as mitocôndrias dos indivíduos afetados pela cegueira não possuem o gene normal. para o genoma humano. Suponha agora a seguinte situação: um homem acusado de ser o pai de uma criança tenta burlar o teste de tipagem de DNA. a seqüência de nucleotídeos do DNA de cada pessoa é única (excetuando-se o caso de gêmeos monozigóticos).

27% de citosina e 27% de guanina. Molécula B 23% de adenina. . a) Indique as porcentagens das quatro bases. . Explique as porcentagens obtidas em todos os extratos das diferentes culturas no experimento.o processo da tradução. Justifique sua resposta. em cultura com ¢¥N. 27% de citosina e 27% de guanina.Cultura de crescimento com ¢¦N: 300 moléculas de DNA todas com ¢¦N.Cultura de 1 geração com ¢¥N: 600 moléculas de DNA todas com ¢¦N e ¢¥N. Explique por que a maior diversidade do DNA mitocondrial apóia a idéia da origem africana do 'Homo sapiens'. Esses resultados foram importantes para corroborar a idéia de que o ancestral comum mais recente do 'Homo sapiens' viveu na África há cerca de 200. Questão 203 Estudos recentes compararam as seqüências completas de DNA mitocondrial de indivíduos de várias regiões geográficas do planeta. 1 etapa: Em uma cultura com ¢¦N.000 anos. 23% de timina. adenina (A). citosina (C). observe o resultado do experimento a seguir. obtém-se o crescimento de colônias de bactérias.1 41 .8. . b) Explique por que é impossível prever a proporção de citosina presente no ARN mensageiro codificado por esse trecho de ADN. Explique por que ocorreria a inibição da tradução se a transcrição de uma cadeia do ADN ocorresse ao mesmo tempo que a transcrição da sua cadeia complementar. no mesmo trecho. Questão 205 Considerando as propriedades de duplicação do DNA. após esse crescimento promove-se o desenvolvimento de mais duas gerações. 23% de timina. Com base nestes dados: a) O que se pode afirmar a respeito das semelhanças entre estas duas moléculas de DNA? b) Justifique sua resposta. 2 etapa: Extrai-se o DNA de todas as bactérias e obtém-se o seguinte resultado: Questão 206 A análise química de duas moléculas de DNA revelou a seguinte composição de bases: Molécula A 23% de adenina. 1. Os resultados revelaram que a variabilidade genética no DNA mitocondrial de indivíduos africanos era quase o dobro da observada no DNA mitocondrial de não-africanos. guanina (G) e timina (T).5. nessa molécula.Cultura de 2 geração com ¢¥N: 1200 moléculas de DNA nas quais 600 com ¢¥N e 600 com ¢¦N e ¢¥N. Questão 204 A soma das porcentagens de guanina e citosina em uma certa molécula de ADN é igual a 58% do total de bases presentes.

42 . que permitiu posteriormente decifrar o código genético determinante para a síntese protéica. RNA e síntese protéica? c) Como podemos diferenciar duas proteínas? Questão 210 Cientistas criaram em laboratório um bacteriófago (fago) composto que possui a cápsula protéica de um fago T2 e o DNA de um fago T4. Hershey e Chase cultivaram bactérias em meio de cultura contendo fósforo radioativo (¤£P) e colocaram bacteriófagos (vírus) para infectar essas células. que faz com que a produção de energia para os músculos seja deficiente. citosina. rato. ressaltando a interação entre as duas cadeias do polímero. Após esse bacteriófago composto infectar uma bactéria. Na figura. C. ocasionando dificuldades motoras para os portadores do problema. b) Que relação existe entre DNA. pintando quais serão as pessoas afetadas pela doença em F1 e em F2 b) Justifique sua resposta. aparentemente normal. em vez de fósforo. G & T representam as bases adenina. os resultados seriam os mesmos? Justifique. por sua vez. Essa pessoa casou-se com outra. quais se referem a DNA? b) Justifique o resultado obtido com a 5Ž lâmina. 1.1 a) Copie o heredograma. Explique a que correspondem os "corrimãos" e os "degraus" dessa escada. também tiveram filhos (F2).8. Os novos bacteriófagos formados estavam marcados radioativamente. um estudo de uma única página na revista inglesa Nature intitulado "A estrutura molecular dos ácidos nucléicos". tivesse sido usado enxofre radioativo (¤¦S) para marcação de proteínas. revolucionou para sempre todas as ciências da vida sejam elas do homem. planta ou bactéria. a) Como se explica que o fósforo radioativo tenha passado para o bacteriófago? b) Como se explica que as bactérias cultivadas sem a presença de fósforo radioativo tenham sido marcadas? c) Se. os fagos produzidos terão a) a cápsula protéica de qual dos fagos? E o DNA. O casal (P) teve filhos (F1) e estes.5. a) Entre estas lâminas. a pessoa A possui uma mutação no DNA de todas as suas mitocôndrias. Questão 209 Em 25 de abril de 1953.Questão 207 A análise química em amostras de cinco lâminas com ácidos nucléicos apresentou os seguintes resultados: 1Ž lâmina: ribose 2Ž lâmina: uracila 3Ž lâmina: dupla-hélice 4Ž lâmina: timina 5Ž lâmina: 15% de guanina e 25% de citosina. Questão 212 A figura a seguir mostra um trecho da estrutura do ácido desoxiribonucléico. Questão 208 Em 1952. A marcação radioativa foi detectada dentro destas bactérias. James Watson e Francis Crick descobriram a estrutura do DNA. A. será de qual deles? b) Justifique sua resposta. Questão 211 No heredograma seguinte. a) Watson e Crick demonstraram que a estrutura do DNA se assemelha a uma escada retorcida. quase ignorado de início. guanina e timina. Estes bacteriófagos marcados foram utilizados para infectar outras células bacterianas cultivadas sem a presença de fósforo radioativo. respectivamente.

2 ) Quais são as moléculas representadas pelos números 1. no genoma de um tomateiro. Justifique a sua resposta. 43 1. Observe as duas seqüências de DNA a seguir e determine qual delas precisará de uma temperatura de desnaturação maior.8. mas um deles é a composição dos nucleotídeos de um determinado DNA. utilizou-se uma técnica na qual o gene que codifica a enzima citada foi inserido. Essas pontes de hidrogênio podem ser rompidas por calor. 2 e 3. Esse processo reversível chama-se de desnaturação.5.1 .5. 2 e 3. respectivamente. sabendo-se que trata-se da unidade estrutural do ácido ribonucléico (RNA). Quantos nucleotídeos tinha o DNA que originou esse RNA? Questão 217 Um segmento de RNA mensageiro apresenta a seqüência de bases nitrogenadas a seguir: AAA UUC GGG GAU. b) Qual é o nome dessa unidade estrutural? Questão 216 Uma cadeia de RNA tem 200 nucleotídeos.5. de maneira invertida. A temperatura necessária para desnaturar o DNA depende de vários fatores. o que produz a dissociação das cadeias. é a principal responsável pela maturação de frutos como o tomate. Para retardar o amadurecimento e evitar as perdas durante o armazenamento. que digere a parede celular de células vegetais. respectivamente. 1) ACTTTAAAGATATTTACTTAAA TGAAATTTC TATAAATGAATTT 2) GCTAGGCCGATGCGGCGTGGA CGATCCGGCTACGCCGCACCT Questão 213 Considerando o modelo da estrutura molecular do DNA como representado na figura adiante.Questão 214 Que papéis desempenham o RNA mensageiro e do RNA transportador no processo de síntese das proteínas? 1.1 Questão 215 Observe o esquema adiante e responda: As linhas pontilhadas indicam as pontes de hidrogênio que são formadas entre as bases aminadas e que contribuem para manter unidas as duas cadeias do DNA.8. 1. a) Quais são as bases do segmento de DNA que deu origem a esse RNA? b) Quantos nucleotídeos existem no DNA que deu origem a essa molécula de RNA mensageiro? Questão 218 A enzima poligalacturonase. responda o que representam os componentes 1.8.

um dos principais agentes carcinogênicos presentes na fumaça do cigarro. em um dos dois sítios indicados na figura 1. O Benzo[a]pireno. B e C têm mutações em um segmento de DNA desse gene. responda: a) Quais serão os segmentos de proteínas produzidos. Usando a tabela que relaciona alguns codons aos respectivos aminoácidos e considerando que a fita molde a ser transcrita é aquela assinalada com a letra m. cuja seqüência normal está representada a seguir. pelos indivíduos A. O hábito de fumar expõe os fumantes a substâncias com atividade carcinogênica. Questão 219 De que maneira o DNA determina a seqüência de aminoácidos das moléculas de proteínas? Questão 220 Uma doença genética de herança dominante é causada por mutações em um gene localizado em um autossomo. Indique as alterações que ocorrerão na síntese da proteína X quando a mutação for localizada nos diferentes sítios. possa ser alterado em presença do Benzo[a]pireno. Suponha que um trecho da fita molde de DNA do gene X. B e C? Por quê? Seqüência normal CAA AAC TGA GGA ATG CAT TTC (m) GTT TTG ACT CCT TAC GTA AAG Indivíduo A CAA AAC TGA GGA ATT CAT TTC (m) GTT TTG ACT CCT TAA GTA AAG 44 Questão 221 O fumo está relacionado ao aumento de risco para o câncer de pulmão.3 a) Descreva a interação que ocorre entre os produtos da transcrição dos genes normal e inserido no tomate geneticamente modificado e indique a característica dessas moléculas que permite a interação. justificando cada resposta com a utilização do código genético da figura 2: .8. B e C? b) Como será o fenótipo (normal ou afetado dos indivíduos A. Os indivíduos A.5.8.2 1. b) Explique por que haverá um aumento no tempo de amadurecimento desse tomate geneticamente modificado.5. Indivíduo B CAT AAC TGA GGA ATG CAT TTC (m) GTA TTG ACT CCT TAC GTA AAG Indivíduo C CAA TAC TGA GGA ATG CAT TTC (m) GTT ATG ACT CCT TAC GTA AAG 1. ambos ativos nesse tomate geneticamente modificado. Considere que o RNA mensageiro seja formado a partir das trincas mostradas no esquema da figura 1 a seguir. tem a capacidade de promover mutações no DNA levando a mudança da base Guanina para Timina. representado a seguir.O esquema adiante mostra os produtos da transcrição do gene normal da enzima e do gene inserido. respectivamente.

apresentam.3 Com o auxílio da tabela do código genético representada a seguir.3 Entretanto. faça uma comparação entre a diversidade dos organismos encontrados nesses dois planetas.CAC . a) As proteínas A. isto é.GAG .5 bilhões de anos. Um gene é constituído por um número N de nucleotídeos que codifica uma proteína constituída por P aminoácidos. c) Se o gene de uma proteína respiratória de um organismo zbohrniano for introduzido numa bactéria terrestre. utilizando-se da tabela do código genético apresentada a seguir. respectivamente. Explique a possibilidade da ocorrência dessas três proteínas nos seres de Zbohrnya. é sempre possível deduzir-se a seqüência de aminoácidos de uma proteína a partir da seqüência de nucleotídeos do seu gene.8.AAG . forneça o produto da síntese protéica (polipeptídio parte da cadeia beta prevista para a globina humana). Questão 225 O DNA dos organismos do planeta Zbohrnya é constituído pelos mesmos 4 tipos de bases dos seres vivos terrestres.GAG .8. a partir da seqüência de aminoácidos de uma proteína. 1.CTG .8. 1. ou do RNA-m correspondentes. o oposto não é verdadeiro. 16 e 19 tipos diferentes de aminoácidos.CCT .3 b) Utilize um exemplo de alteração estrutural da globina humana (cadeia beta) para explicar como uma mutação pontual. Explique por quê.GTG . Já o código genético desses organismos é determinado por códons de 2 bases.5. B e C. b) Sabendo que a vida em Zbohrnya e na Terra existe há 3.Por que sempre encontramos N > P ? Questão 224 1. encontradas nos organismos da Terra. do tipo substituição.5.ACT . 13. Questão 222 As globinas constituem um bom exemplo da importância da informação genética na estrutura primária e na função das proteínas. a proteína produzida pela expressão desse gene será idêntica à da espécie zbohrniana? Justifique sua resposta. Questão 223 O ADN é um polímero constituído por vários nucleotídeos e as proteínas são polímeros constituídos por vários aminoácidos. pode afetar a saúde e a qualidade de vida do portador dessa mutação. cuja seqüência de nucleotídeos é 5' .5. 45 . a) Considere o segmento de DNA.3' e. não se pode deduzir a seqüência de nucleotídeos do gene.

por uma purina. --. no polipeptídio codificado por esse gene. após uma deleção do TERCEIRO nucleotídeo? Questão 228 A seguir está representada a seqüência dos 13 primeiros pares de nucleotídios da região codificadora de um gene.8. b) Utilizando a tabela de código genético fornecida.5. para resolver os itens seguintes: 1.8. esse código segue o padrão do código genético universal. na 3 base do código correspondente ao 6Ž aminoácido do polipeptídeo.4 1.5.5. a deleção do par de bases T = A)? 46 . b) Se ocorresse uma substituição. b) Cite a seqüência do anticódon correspondente ao códon de iniciação. 1. no qual três bases codificam um aminoácido. transcrito a partir desse segmento de DNA.8. originado pela perda do sexto par de nucleotídios (ou seja.Questão 226 Considere a tabela abaixo. c) Qual a seqüência de aminoácidos que resultará da tradução da molécula de RNA mensageiro? Ver figura anterior. corresponde ao aminoácido metionina. c) Qual seria a seqüência dos três primeiros aminoácidos de um polipeptídio codificado por um alelo mutante desse gene. contendo códigos de trincas de bases do DNA com os aminoácidos correspondentes. indique a seqüência dos três aminoácidos seguintes à metionina.3 Analise a tabela e faça o que se pede: a) Cite o nome da enzima que catalisa a síntese de RNA mensageiro. d) Qual a seqüência de aminoácidos que resultará da tradução da mesma molécula de mRNA. Entretanto. a) Determine a seqüência de bases do RNAm que foi utilizado para sintetizar o polipeptídeo esquematizado abaixo da tabela. A tabela a seguir mostra alguns códons do RNA mensageiro e os aminoácidos codificados por cada um deles.A T G A G T T G G C C T G ----.3 a) Escreva a seqüência de bases nitrogenadas do RNA mensageiro. qual seria o aminoácido da tabela a ser incorporado? c) Qual é anticódon correspondente ao novo aminoácido incorporado? Questão 227 A tabela adiante representa uma versão fictícia do código genético.T A C T C A A C C G G A C --A primeira trinca de pares de bases nitrogenadas à esquerda.

a partir desse RNA? Questão 231 Ribossomos são formados por RNA e proteínas. em sua cadeia complementar. mas a enzima só é encontrada nas partículas virais RNA (-). . Nesse gene existem íntrons.Questão 229 Sabendo-se que um determinado segmento de DNA apresenta capacidade de transcrever e que apresenta a seqüência de bases TAC TCC GCT TAG e. Questão 234 Em um organismo pluricelular com vários tecidos. como o da poliomielite. que sintetiza um RNA complementar a um molde de RNA. respectivamente. Analogamente. quais são as seqüências de bases de RNAm por ele produzido? Questão 230 Dado um segmento de RNA mensageiro com a seguinte seqüência de bases: AAU GUA GGC pergunta-se: a) Qual a seqüência de bases do DNA que deu origem a esse RNA? b) Quantos aminoácidos terá o polipeptídeo traduzido.nos vírus RNA (+). é correto afirmar que os ARN mensageiros (ARNm) dos diferentes tecidos são todos idênticos? Justifique sua resposta Questão 235 Suponha um gene de um eucarioto responsável pela síntese de uma proteína. foram precursores das primeiras células. para sua replicação. todas as células possuem um genoma idêntico. regiões do ADN cujas informações não estão presentes na proteína em questão. devido à simplicidade de sua estrutura. para sua replicação. b) Apresente um argumento contrário à hipótese de que os vírus. o genoma viral funciona diretamente como mensageiro. Observe que: . da enzima RNA replicase. sintetizados pelos processos de transcrição e tradução. ou seja. encontramos aqueles que são RNA (-). a seqüência ATG AGG CGA ATC. no ribossomo.o gene da enzima RNA replicase está presente no genoma dos dois tipos de vírus. a) Onde esses processos ocorrem na célula eucariótica? b) O que acontecerá com os processos de transcrição e tradução. apenas o RNA complementar a seu genoma é capaz de funcionar como mensageiro na célula infectada. a) Explique por que é necessário. e os que são RNA (+). As regiões do ARN transcrito correspondentes aos íntrons são eliminadas após o processo de transcrição. A figura a seguir representa o resultado de uma experiência de hibridação do ARN mensageiro com a cadeia de ADN que lhe deu origem. Questão 232 Sabendo-se que um determinado segmento de DNA apresenta capacidade de transcrever e que apresenta uma seqüência de bases ACTCCGCTT / TGAGGCGAA. se ocorrer uma destruição do(s) nucléolo(s) de uma célula?. enquanto os RNA (+) não precisam armazenar esta enzima. quais poderiam ser as seqüências de bases do RNA por ele produzido? Questão 233 Analisando o genoma de alguns tipos de vírus formados por fita simples de RNA.ambos os vírus necessitam. como no caso dos seres humanos.nos vírus RNA (-). 47 . que os vírus RNA (-) já contenham a enzima RNA replicase. como o do resfriado comum. . .

1. Qual o produto final da classe de genes que não codificam polipeptídios? Questão 240 O que são ácidos nucléicos? Como atuam na síntese de proteínas? Questão 241 A figura mostra cinco regiões. Certos mutantes nutricionais do fungo Neurospora só conseguem crescer quando aminoácidos são adicionados ao meio de cultura. os genes reguladores que codificam proteínas que regulam outros genes. identificadas por números de 1 a 5. obtém-se uma proteína. demonstrando como. e uma terceira classe de genes que não codificam polipeptídios. responda.5. a) Quantas uracilas e quantas guaninas comporão a fita do RNA mensageiro transcrito do DNA ativado? b) Quantos aminoácidos deverão compor a cadeia de polipepitídeos que será formada? Justifique sua resposta. Levando-se em consideração essas informações. Questão 239 Atualmente os genes podem ser desmembrados em três classes diferentes: os genes que expressam mRNA que codificam polipeptídios diversos.8.09. formado por palavras e setas. Questão 236 Em um segmento da cadeia ativa de DNA. o sinal (+) significa crescimento. Questão 237 Considere um fragmento de DNA com a seguinte seqüência de bases: GTA GCC TAG e responda: a) Qual será a seqüência do RNAm transcrito a partir deste DNA? b) O mesmo peptídio será obtido a partir deste RNAm e do RNAm da fita complementar? Explique. e o sinal (-) significa ausência de crescimento. Na tabela a seguir. que servirá de molde para a fita de RNA mensageiro.Paulo" (23.8.5 48 . Quais dessas regiões correspondem aos íntrons? Justifique sua resposta.2002) noticiou que um cientista espanhol afirmou ter encontrado proteínas no ovo fóssil de um dinossauro que poderiam ajudá-lo a reconstituir o DNA desses animais.5. é possível percorrer o caminho inverso e chegar à seqüência de DNA que a gerou? Justifique.4 a) Faça um esquema simples. Questão 238 O jornal "Folha de S. há 30 timinas e 20 guaninas. b) A partir de uma proteína. a partir de uma seqüência de DNA. No segmento correspondente da fita complementar do DNA há 12 timinas e 10 guaninas.1.

Escreva esses aminoácidos na ordem correspondente à seqüência TGA . é preferível utilizar o RNA-mensageiro para determinar a região codificante do DNA. sintetizar os seus DNA-complementares e. Os resultados do experimento estão mostrados no gráfico a seguir. à qual foram adicionadas quantidades adequadas das seguintes substâncias. 49 .5 Com base nos gráficos. adquirem uma conformação tridimensional. marcadas com isótopos: uridina ¢¥C.Sabe-se que as etapas que levam à síntese da arginina são: substrato ë (gene1) ë ornitina ë (gene2) ë citrulina ë (gene3) ë arginina Supondo que em cada mutante há apenas um gene alterado. explique a atuação dos antibióticos I e II sobre a síntese protéica. timidina ¤H e leucina ¢¦N. Questão 242 Os códons AGA. a) Considere as etapas de replicação. utilizou-se uma cultura de células.GAC de um segmento de DNA. explique o porquê do mutante Z só crescer quando se adiciona arginina ao meio de cultura. Após algum tempo. a seqüência de bases nitrogenadas codificantes. b) As proteínas. e ACU do RNA mensageiro codificam. aquela que define a estrutura primária da proteína a ser sintetizada. Ao longo do experimento.8. Questão 243 Quais os papéis do gene e do ribossomo na síntese das proteínas celulares? Questão 244 Para investigar possíveis efeitos de uma determinada droga. leucina e treonina. Em uma bactéria. primeiramente. A abordagem experimental mais freqüente.5. amostras das células foram coletadas a intervalos regulares. hoje.5 1. Cite duas ligações ou interações que atuam na manutenção da estrutura enovelada das proteínas. em genes de uma célula eucariota.5. consiste em. respectivamente os aminoácidos arginina.TCT . transcrição e tradução nas células analisadas. CUG. em organismos eucariotos. 1. ou seja. proceder ao seqüenciamento das bases presentes nesses DNA. Questão 246 Os gráficos a seguir representam o efeito inibitório de dois antibióticos (I e II) sobre a síntese protéica em culturas de 'Staphylococcus aureus'. Indique se a droga interfere em cada uma dessas etapas e justifique suas respostas.8. a droga foi também introduzida no meio de cultura. após sintetizadas. extrair os RNA-mensageiros da célula. As setas nos gráficos indicam o momento em que foram administrados os antibióticos nas culturas. Questão 245 Diversas técnicas são utilizadas para determinar. A incorporação dos isótopos foi medida em uma preparação que contém os ácidos nucléicos e as proteínas da célula. então. Explique o motivo pelo qual. é possível determinar a seqüência codificante diretamente a partir de seu cromossomo. no entanto.

porém no qual haviam todos os componentes necessários à síntese protéica. em homenagem aos pesquisadores que as detectaram. que diferem apenas em um aminoácido: Hemoglobina A: . . no lugar do ácido glutâmico? Justifique sua resposta.CAU.8..5.GAG. existe uma seqüência curta de nucleotídeos que antecede esse códon. que é chamada de Shine-Dalgarno.Sintetizaram uma cadeia de DNA com três nucleotídeos repetidos muitas vezes em uma seqüência conhecida: .AGCAGCAGCAGCAGCAGCAGCAGC. CAC leucina . No entanto. . em azul.valina-histidina-leucina-treonina-prolina-ácido glutâmico. serão anômalas? Justifique sua resposta. ACG. cada uma delas com um único tipo de aminoácido: serina ou alanina 50 a) Qual é o aminoácido que aparece.5 Explique a importância desse duplo controle da iniciação para a tradução correta da mensagem contida no ARNm.. CCA ácido glutâmico . . conhecidas como hemoglobinas A e S. b) Todas as células.. Essa seqüência. na hemoglobina S.Essa cadeia de DNA foi usada em um sistema livre de células. GUC..ACU. incluindo os diferentes aminoácidos. Diferentes repetições do experimento demonstraram que até três proteínas diferentes poderiam ser produzidas. além do código AUG.8. O diagrama a seguir ilustra a localização dessa seqüência.. o sinal para o início da síntese das proteínas (tradução) é geralmente sinalizado no ARNm pelo códon AUG.Questão 247 Na espécie humana há dois tipos de hemoglobinas.valina-histidina-leucina-treonina-prolina-x. ACA prolina .. essa cadeia de DNA sempre produzia uma proteína com um único tipo de aminoácido. quando se iniciavam as pesquisas sobre como o DNA codificava os aminoácidos de uma proteína.UUG.Nesse sistema.. A seqüência de Shine-Dalgarno está em vermelho e o códon de iniciação. CCC. GUG. ACC.CCU..5. CCG..5 . que corresponde ao aminoácido metionina. Hemoglobina S: . a partir da célula que sofre a mutação. Essa pequena diferença é suficiente para determinar que uma pessoa portadora de hemoglobina S sofra de anemia falciforme. permite que o sítio correto de iniciação da tradução seja selecionado..GUU. GAA A mutação pode ocorrer no ADN como mostra o esquema a seguir: Questão 248 Nos procariotos.. UUA treonina . um grupo de pesquisadores desenvolveu o seguinte experimento: 1.. Questão 249 Nos anos 50 e 60. Os códons de RNA-m que codificam esses aminoácidos são: valina . 1. GUA histidina .

Os genes autossômicos A. b) Pode-se dizer que seqüências idênticas de aminoácidos são sempre codificadas por seqüências idênticas de nucleotídeos? Justifique. em quatro espécies próximas. Uma mutação gênica pode determinar a alteração ou a ausência de algumas dessas proteínas. a) Considerando que tenha ocorrido a ação da DNA-polimerase. b) Por que podem ocorrer alterações nas proteínas quando o gene sofre mutação? c) Em que situação uma mutação não altera a molécula protéica? Questão 251 Abaixo estão esquematizadas as seqüências de aminoácidos de um trecho de uma proteína homóloga. Isso se deve a dois fatos: primeiro.ou glutamina.5 a) Quantos nucleotídeos são necessários para codificar a seqüência de aminoácidos nas espécies 1 e 2? Justifique. c) É possível ocorrer uma mutação em um gene sem que se altere a enzima correspondente? Justifique. Questão 253 Uma fita de DNA tem a seguinte seqüência de bases 5'ATGCGT3'. porque a lactose necessita ser 51 . b e c. 1.8. a) Por que as proteínas obtidas possuíam apenas um tipo de aminoácido? b) Por que foram obtidos 3 tipos de proteínas? Questão 250 O metabolismo celular é controlado por uma série de reações em que estão envolvidas inúmeras proteínas. a lactose não é tão facilmente incorporada pelas bactérias. Questão 252 O esquema a seguir representa a seqüência de reações que levam à formação do pigmento da pelagem de uma espécie animal.5 a) Do ponto de vista genético. qual será a seqüência de bases do RNA resultante e que nome recebe esse RNA se ele traduzir para síntese de proteínas? Questão 254 1. que tipo de mutação originou cada seqüência? Sabe-se que a bactéria 'E. qual será a seqüência de bases da fita complementar? b) Se a fita complementar for usada durante a transcrição. levando a mudanças no ciclo de vida da célula. 3 e 4 se originaram da espécie 1. B e C que atuam nesse processo metabólico. B e C são responsáveis pela produção das enzimas A.5. quantos tipos de albinismo podem ocorrer nessa espécie? Por quê? b) Demonstre o fenótipo esperado de um cruzamento entre animais de linhagens puras com dois tipos diferentes de albinismo. Cada letra representa um aminoácido. segundo. B e C produzem respectivamente os alelos recessivos a.coli' cresce mais rapidamente na presença da glicose (um monossacarídeo) do que na presença de lactose (um dissacarídeo). Mutações nos genes A. c) Considerando que as espécies 2. a) Explique a relação que existe entre gene e proteína.8.5.

Avery. dando origem a indivíduos adultos. a concentração de glicose e o número de bactérias no meio de cultura em função do tempo.1 Suponha que os zigotos podem crescer normalmente.5. Em relação a esses três animais e ao processo de origem da mula. em pneumococos com cápsula.9. não-patogênicas. Questão 259 A mula é um animal oriundo do cruzamento da égua (2n=64) e do burro (2n=62). M. em 1944. MacLeod e M. correlacione os parâmetros concentração de ’-galactosidase. 52 . conhecido como "experiência do liquidificador" na qual utilizaram isótopos radioativos de enxofre (S¤¦) e de fósforo (P¤£) para 'marcar' vírus parasitas de bactérias. a formação de um zigoto híbrido. bem como suas conclusões a partir deste trabalho. a) É possível a reprodução dos zigotos pela via da reprodução sexuada? Justifique sua resposta. Questão 260 O esquema a seguir mostra. de que o "agente transformante" capaz de permitir o desenvolvimento da cápsula em pneumococos não-capsulados era o ácido desoxirribonucléico? Questão 257 O que são bacteriófagos? Qual sua importância na identificação do DNA como material genético? 1. Questão 256 Como os cientistas O.5 Identifique as curvas da figura. Questão 258 Descreva o experimento realizado por Hersey e Chase em 1952.5. As curvas no gráfico adiante representam a concentração da enzima ’-galactosidase. 1. Questão 255 Descreva os principais passos seguidos por Griffth em 1928 no experimento que demonstra a "transformação" de bactérias pneumococos sem cápsula. O gráfico a seguir resultou de experimento em que 'E.hidrolisada pela enzima ’-galactosidase em glicose e galactose. patogênicas. McCarthy chegaram à conclusão. b) E é possível pela via da reprodução assexuada? Justifique sua resposta. simplificadamente. RESPONDA: a) Qual o número de cromossomos encontrado nas células sexuais normais da égua e do burro? b) Qual o número de cromossomos encontrado nas células somáticas da mula? Como essas células se originam? c) Apesar de a mula apresentar uma alta capacidade de realizar trabalho.8. resultante do cruzamento entre duas espécies. concentração de glicose e número de bactérias e explique o comportamento da curva da enzima ’-galactosidase. EXPLIQUE os motivos que levam a tal esterilidade. ela é estéril.coli' foi inoculada num meio contendo uma mistura de glicose e lactose.

observou-se. Justifique sua resposta. Questão 263 Numa dada espécie. Adaptado de Amabis. ou seja. M e Martho. a não disjunção do cromossomo X e a geração de espermatozóides defeituosos.9. Responda se o fenômeno da não-disjunção do par de cromossomos 21 ocorreu antes ou depois da formação do zigoto. neste indivíduo. por exibirem a trissomia do cromossomo 21. sem trissomia do 21.Questão 261 Ao analisar o cariótipo de células obtidas de uma criança com síndrome de Down. responda. Que tipos de anomalias cromossômicas poderão ser formadas se esses espermatozóides fecundarem ovócitos normais? Justifique.5.1 Questão 266 1. Questão 262 Tendo um homem ingerido uma substância que causa erros na divisão meiótica da gametogênese. Esse problema pode ser decorrente da não-disjunção do cromossomo 21 em dois momentos durante a formação dos gametas. a) Qual é a aneuploidia existente na Síndrome de Down? b) Quais são os mecanismos responsáveis pelo aparecimento desta aneuploidia? c) Qual é a relação existente entre idade materna e a Síndrome de Down? Questão 265 A Síndrome de Down caracteriza-se pela presença de um cromossomo 21 a mais nas células dos indivíduos afetados. São Paulo: Moderna.5. 46 cromossomos. "Biologia das células". 1. um indivíduo trissômico apresenta um cariótipo contendo 97 cromossomos. Por quê? Questão 267 O quadro a seguir destaca dois conceitos biológicos: câncer e sistema respiratório de insetos.9. 2002. G. indicando na lacuna pontilhada qual delas foi escolhida para ser representada.1 Uma alteração no DNA pode modificar o funcionamento de uma célula. Considerando a ocorrência de tal não-disjunção. 53 . R. Qual o número de cromossomos que deve ser encontrado em um espermatozóide normal nessa espécie? Questão 264 A ilustração adiante mostra o cariótipo de um indivíduo do sexo masculino com Síndrome de Down. observou-se que 70% das células apresentavam 47 cromossomos. J. e que 30% das células apresentavam um cariótipo normal. a) Em quais momentos ela pode ocorrer? b) Utilize os contornos a seguir para representar uma das duas possibilidades.

1. genes reguladores da divisão celular. tem sido propagada assexuadamente através de mudas e enxertia. proliferação celular descontrolada.3 Identifique as duas alterações nos códons do RNA que mais provavelmente explicariam a transformação de ácido glutâmico em valina. Examinando a tabela do código genético a seguir. Explique como essa única mutação pontual pode fazer com que a síntese da proteína seja interrompida prematuramente. não produzindo gametas viáveis. Questão 269 Qualquer alteração no DNA pode modificar o funcionamento de uma célula? Justifique. Justifique sua resposta. Verificou-se que um desses mutantes produzia uma dada proteína que diferia da original pela ausência de 35 aminoácidos em uma das extremidades da cadeia peptídica. Certo ou errado? Justifique. por não possuir sementes. e 3) segregação independente (recombinação aleatória de cromossomos dos diferentes pares de homólogos).2) mutação (modificação da seqüência de nucleotídeos de uma molécula de ADN). garantindo que em seu texto apareçam. Questão 272 A anemia falciforme é uma doença que resulta da substituição de um aminoácido ácido glutâmico pela valina. Por ser uma variedade triplóide (3n) de laranja. fumo. 54 . mutação. Sabe-se que a variabilidade genética de uma população depende dos seguintes fatores: 1) permutação cromossômica ou crossing-over (troca de fragmentos entre cromossomos de um mesmo par de homólogos). Após tratar culturas de bactérias com doses de um agente mutagênico capaz de induzir uma única mutação pontual (que afeta apenas um nucleotídeo por célula). na hemoglobina. Questão 270 A laranja-da-baía surgiu em 1810 e. os seguintes conceitos: tumor.9. sua meiose é anormal. Questão 268 A substituição de uma única base na molécula de DNA leva necessariamente à substituição de um aminoácido na proteína a ser sintetizada pela célula. analisou-se a seqüência de aminoácidos de uma determinada proteína em diversos mutantes gerados.3 Identifique qual(is) deste(s) fator(es) pode(m) contribuir para a variabilidade genética da laranja-da-baía. 1.5.9.5. Atualmente. Questão 271 a) Faça uma breve descrição de como o nefasto hábito de fumar está associado ao desenvolvimento de câncer de pulmão. b) Descreva o caminho da fumaça de um cigarro desde o meio externo até as células do corpo de uma barata. Justifique a sua resposta. é possível identificar as alterações no RNA que formam o códon da valina na hemoglobina da anemia falciforme. de forma relacionada. milhões de pés de laranja-da-baía estão espalhados em plantações no Brasil e nos Estados Unidos.

Era um dia claro e quente de verão e às 8h. b) um nucleotídeo é substituído por outro. "agentes mutagênicos". Questão 274 Analise as seguintes informações. 31 de julho de 2005 . tem sua seqüência duplicada e acrescentada ao DNA. a) Qual a vantagem desse tipo de mutação no aparecimento de novas espécies? b) Se uma mutação gênica ocorre em um dos genes duplicados. A tabela resumida do código genético mostra alguns códons e seus aminoácidos correspondentes. aumentando assim a probabilidade de desenvolvimento de câncer.3 Em qual das mudanças (1 ou 2) há risco de perda ou de diminuição da atividade biológica? Justifique sua resposta. As células devem dividir-se e conter a divisão. Sabe-se que essas funções são geneticamente controladas. 55 1. agente de natureza biológica que podem aumentar a taxa de mutações gênicas.9. manter uma especialização característica apropriada e ocupar o lugar apropriado. Suponha que mutações no DNA tenham causado as seguintes mudanças nas duas moléculas de mRNA (1 e 2). Àquela altura. de forma que o indivíduo passa a apresentar uma ou mais cópias do mesmo gene no mesmo cromossomo. Em 2001 a indústria Shell do Brasil S."O GLOBO" Gilberto Scofield Jr. A situação "a". a) Que relações podem ser estabelecidas entre as informações I e II? Inclua na sua resposta os conceitos de "mutação gênica". considere duas situações: a) um nucleotídeo é suprimido. como todos os jovens japoneses durante a Segunda Guerra Mundial. b) Dê exemplos de um agente de natureza física e de um . Questão 275 Em um segmento de DNA que codifica determinada proteína. Explique por quê. com resíduos de Endrin. ela havia abandonado os estudos para se dedicar ao esforço de guerra. foi responsabilizada pela contaminação das áreas em torno de sua fábrica de agrotóxicos em Paulínia.Questão 273 As seqüências de RNA mensageiro a seguir codificam peptídeos com atividades biológicas específicas. Questão 276 Entre os diferentes tipos de processos que criam nova variabilidade genética. Questão 277 FIM DA 2 GUERRA MUNDIAL . Nesse tipo de mutação. Um aumento significativo no número de casos de câncer na região tem sido associado à exposição dos moradores a essas substâncias. a duplicação gênica é muito importante na criação de novidades evolutivas. geralmente. Diedrin e Aldrin. um determinado gene. Hiroshima e Nagasaki hoje lideram luta contra essas armas Domingo. além de replicar-se. é mais drástica que a situação "b". Enviado especial Hiroshima.BOMBA ATÔMICA SESSENTA ANOS DE TERROR NUCLEAR Destruídas por bombas.5. sobreviver e morrer. A renovação dos tecidos requer um controle complexo para coordenar o comportamento de células individuais e as necessidades do organismo como um todo. fazendo com que o gene não funcione. Japão "Shizuko Abe tinha 18 anos no dia 6 de agosto de 1945 e. "descontrole dos mecanismos de divisão celular" e "câncer". I. II. SP. sempre de acordo com as necessidades do organismo.A. o indivíduo morre? Justifique sua resposta. Shizuko e seus colegas iniciavam a derrubada de parte das casas de madeira do centro de Hiroshima para tentar criar um cordão de isolamento antiincêndio no caso de um bombardeio incendiário aéreo.

a ação do soro e da vacina segundo estes tópicos: 1. e entrar em nosso corpo. a) Nesse combate.é nunca esquecer o passado. responda: a) Para que é usada? b) De que é feita? c) Como funciona? Questão 283 Um protozoário conhecido como 'Trypanosoma gambiense' provoca no homem a chamada "doença do sono".ninguém imaginava que Hiroshima seria o laboratório de outro tipo de bombardeio. respectivamente. Apesar de rica e moderna com seus 1. Questão 281 Explique o que é uma vacina e como funciona. aponte dois motivos pelos quais essas populações humanas devem ser monitoradas ainda hoje. que é transmitida pela picada da mosca tsé-tsé. Questão 282 Sobre a vacina. 1. Compare.10 56 . Passear pelas ruas de Hiroshima hoje 60 anos depois da tragédia que matou 140 mil pessoas e deixou cicatrizes eternas em outros 60 mil. Japão. os monumentos às vítimas do terror atômico estão em todos os lugares". O estudo da reação imunitária do organismo humano aos antígenos da superfície dos parasitas está demonstrado no esquema abaixo. numa população de 400 mil .A duração da imunização 4.A ação imediata ou não 3. a) Como a radiação está relacionada ao aumento na incidência de câncer? b) Como se explica que muitos dos efeitos da bomba atômica se manifestem nos descendentes dos sobreviventes? c) Por que algumas pessoas que foram viver nessas cidades tempos depois da explosão também foram afetadas? Questão 279 Soros e vacinas fazem parte do arsenal usado no combate às doenças infecciosas (imunidade adquirida). Dados mostram que a incidência do câncer nas duas cidades japonesas é muito alta. b) Indique a reação de combate que é específica para cada agente infeccioso e as células diretamente responsáveis por esse tipo de resposta. Indique o processo que leva à destruição do patógeno bem como as células que o realizam.1 milhão de habitantes circulando em bem cuidadas ruas e avenidas. Após sessenta anos da explosão da bomba atômica sobre as cidades de Hiroshima e Nagasaki. Com base nos efeitos biológicos das radiações sobre os seres vivos. Questão 278 Os recentes testes nucleares e o cinqüentenário da explosão da bomba atômica em Hiroshima e Nagasaki em 1995 provocaram discussões sobre os efeitos da radiação no meio ambiente e nos seres humanos.5. O sistema imunitário age para combatê-las. por exemplo num ferimento. no Japão.A natureza da imunização 2. "Hiroshima. para o qual os abrigos antiincêndio foram inúteis". muito mais devastador e letal. uma reação inicial inespecífica é efetuada por células do sangue. as populações dessas cidades continuam a ser monitoradas.O emprego curativo ou preventivo Questão 280 As bactérias podem vencer a barreira da pele.

Explique por que. a mãe produz anticorpos contra o fator Rh do filho. mesmo nessas circunstâncias. Questão 285 O termo amamentação designa o ato de amamentar. Paulo e Luisa. deve ser repetido a intervalos de tempo relativamente curtos. Dois dos filhos do casal são gêmeos monozigóticos e os outros dois são gêmeos dizigóticos. o primeiro filho nunca é afetado. João. Questão 287 Um casal tem quatro filhos: João. Justifique por que esse tratamento deve ser feito logo após a picada do animal e. Qual dos dois indivíduos é originário da região com alta incidência do vírus X? Justifique. b) apresente um exemplo de imunização ativa artificial e um de imunização passiva natural. de aceitar uma criança no próprio peito. porém. b) Na eritroblastose fetal. Mais do que um simples ato de amor. 1. fungos. tecidos ou órgãos transplantados. 57 . Questão 288 As curvas abaixo mostram a produção de anticorpos específicos de dois indivíduos inoculados com antígenos protéicos do vírus X no dia 0. b) Justifique o aumento do número de parasitas com antígeno B na semana 2. suspeitou-se de que um dos indivíduos fosse originário de uma região onde a infeção pelo vírus X atinge grande número de indivíduos. Questão 286 As respostas imunológicas constituem mecanismos de defesa vitais para os organismos. Com base nas respostas de cada um deles ao antígeno. A esse respeito. Escreva a importância da amamentação PARA A MÃE E PARA O FILHO. a partir da segunda gravidez.a) Explique por que os parasitas com antígeno A desapareceram na semana 2 e cite o principal tipo celular participante da reação responsável por esse desaparecimento. representa a maneira mais eficiente e prática de alimentar e nutrir o filho sem os riscos que a alimentação artificial pode oferecer. Maria. em função do tempo. precisa de um transplante de um órgão.5. em duas condições: vacinação ou soroterapia.10 Um dos gráficos mostrados corresponde à variação da concentração de anticorpo antiofídico no sangue de uma pessoa mordida por uma serpente e tratada com uma dose do soro apropriado. vírus. Questão 284 A função do sistema imunológico é a de defender o organismo contra invasores. em casos mais graves. e mesmo simples moléculas. Bactérias. por que. a) explique a diferença entre a resposta ativa e a passiva. a) Os gráficos a seguir mostram a variação da concentração de anticorpos contra um determinado antígeno no sangue de uma pessoa. A doença só se manifesta. podem ser reconhecidos pelo organismo como agentes agressores. um dos gêmeos monozigóticos. Indique a condição que deve estar presente no feto para o desenvolvimento da eritroblastose em filhos de mulheres que não produzem fator Rh. Qual seria a pessoa da família mais indicada para ser o doador? Justifique sua resposta.

B e C) do parasita causador da malária (plasmódio) foi testada em uma pesquisa. Países que não vacinam seus rebanhos contra febre aftosa restringem a importação de carne de países onde a vacinação ocorre. e não a detecção do próprio vírus na carne.10 1. O voluntário 6 não recebeu nenhum dos antígenos. Cinco meses depois desse evento. Tal fenômeno é denominado imunidade de grupo. O gráfico a seguir reproduz os dois momentos em que ocorreram as contaminações. Determine se os resultados dos testes seriam positivos ou negativos tanto para animais infectados quanto para vacinados. A linha pontilhada representa a SUBSTÂNCIA TÓXICA. que mostra o título (quantidade) de anticorpos específicos contra os antígenos A. Justifique sua resposta. As restrições à importação de carne se baseiam no fato de que os testes disponíveis utilizam a detecção de anticorpos contra o vírus. Justifique sua resposta. a) Explique por que a imunidade de grupo é eficiente no controle de doenças como a gripe. Questão 292 Uma pessoa foi contaminada por uma substância tóxica. indica os resultados observados. Questão 290 A resposta imune de seis voluntários a três diferentes antígenos (A. enquanto a linha contínua representa a SUBSTÂNCIA ESPECÍFICA. pode-se considerar que toda a população está protegida se uma alta proporção dos indivíduos estiver imunizada. 58 . como medicamento. a pessoa foi novamente contaminada e outra vez a substância específica foi usada. de origem orgânica.1.10 Questão 289 A febre aftosa é uma doença virótica que afeta diversos animais de importância econômica.5.5. Estes testes geram resultados semelhantes para animais vacinados e animais que contraíram a doença. pelo médico. A figura a seguir. b) Explique por que a imunidade de grupo não é eficiente no controle de doenças como. mas sim uma substância inócua (placebo) para servir de controle negativo. Para tratá-la o médico introduziu em seu organismo uma substância específica. Questão 291 No caso de algumas doenças infecciosas. avalie se a estratégia de vacinação com esses antígenos seria eficaz. dificultando as relações comerciais internacionais. tais como vacas e ovelhas. Com base nos resultados apresentados. o cólera e a hepatite. B e C no soro de cada um dos voluntários. por exemplo.

Questão 295 Analise o gráfico. em intervalos diferentes. a) A que tipo de imunização se referem as aplicações? b) Analise os resultados apresentados pelo gráfico e explique o fato observado com a 2 aplicação do antígeno. Todas eram ordenhadoras e tinham se contaminado com "cowpox". mas que não causava a morte dos animais.5. responda: a) Qual a função do antígeno e qual curva corresponde às respostas primária e secundária? b) Explique o que acontece em relação aos anticorpos nas fases das respostas primária e secundária.10 A substância específica de combate. 1. Edward Jenner.5. um médico inglês. Questão 294 O gráfico representa o resultado de duas aplicações de um mesmo antígeno. responda. constatou que estes indivíduos mantinham-se 59 .5.5. Questão 296 Leia os seguintes fragmentos de textos: 1. a) Que tendência pode ser observada quando se comparam as taxas de mortalidade por doenças contagiosas e por doenças degenerativas (também chamadas "doenças da velhice") no início e no final do século XX? b) Cite dois fatores que podem explicar as mudanças observadas nas taxas de mortalidade por doenças contagiosas.10 1. Após uma série de experiências. uma doença do gado semelhante à varíola pela formação de pústulas. é um soro ou uma vacina? Justifique sua resposta.10 Analisando o gráfico. inoculada no paciente. Considerando que esse quadro retrata as condições encontradas em outros países industrializados.10 1. Questão 293 O gráfico a seguir mostra as respostas primária e secundária da produção de anticorpos quando um indivíduo é submetido a injeções de antígenos.1. que descreve causas de óbitos humanos nos Estados Unidos no início e no final do século XX. observou no final do século XVIII que um número expressivo de pessoas mostrava-se imune à varíola.

cascavel. coral e urutu são exemplos de cobras venenosas que ocorrem no Brasil. Joseph Meister. nos fragmentos de textos 1 e 2? Que relação existe entre o fenômeno observado no relato 1 e as chamadas células de memória? Questão 297 Jararaca. (www. b) Explique que mecanismos induzem a proliferação de linfócitos nos gânglios linfáticos.bio. foi feito o seguinte experimento: 60 . Ao todo. é mais eficiente o uso do soro ou da vacina? Justifique. que havia sido mordido por um cão raivoso. mesmo quando inoculados com o vírus. Pasteur. injetou na criança material proveniente de medula de um coelho infectado. a) Explique como macrófagos. os resultados representados no gráfico 1 tenham influenciado os resultados representados no gráfico 2 ou o inverso? Justifique.fiocruz.br) 2. O soro antiofídico poderia ser denominado vacina antiofídica? Explique. respectivamente. de 1982 a 1997. 1. Gráfico 1: Cobertura da vacinação contra sarampo em menores de um ano no Brasil. que atua no combate a infecções. A 6 de julho de 1885. Se picada por uma delas.fiocruz. Meister não chegou a contrair a doença. Questão 299 Observe atentamente os dois gráficos apresentados. a vítima deve ser tratada com soro antiofídico. o ano de 1997. de 1980 a 1997.bio. É mais correto supor que. ao longo desse ano. chegava ao laboratório de Louis Pasteur um menino alsaciano de nove anos. Questão 300 Procurando compreender a importância de determinadas células sangüíneas para o sistema imunológico. Gráfico 2: Taxa da incidência anual de sarampo em menores de um ano no Brasil.refratários à varíola. O sistema imunitário.5. nos dois gráficos. 1 ou 2.) a) O gráfico 2 indica claramente a ocorrência de epidemias de sarampo em dois anos distintos no Brasil.10 (Programa Nacional de Imunizações. foram 13 inoculações. cada uma com material mais virulento. (www. Questão 298 Os médicos verificam se os gânglios linfáticos estão inchados e doloridos para avaliar se o paciente apresenta algum processo infeccioso. Ministério da Saúde. refere-se a processos de imunização passiva? Justifique sua resposta.br) a) Qual dos fragmentos. b) Considere. é constituído por diferentes tipos de glóbulos brancos e pelos órgãos responsáveis pela produção e maturação desses glóbulos. b) Que tipos de produtos (medicamentos) puderam ser produzidos a partir das experiências relatadas. que vinha desenvolvendo pesquisas na atenuação do vírus da raiva. linfócitos T e linfócitos B atuam no sistema imunitário. Para reduzir rapidamente e de imediato o número de doentes durante uma epidemia.

esperada para a primeira geração de um cruzamento entre dois indivíduos com os genótipos AABBCC e aabbCC. Determine a altura. qual é a proporção de cada classe fenotípica obtida em F‚? Questão 304 A altura dos espécimes de uma determinada planta encontrada no cerrado varia entre 12cm e 108cm. originou 7 fenótipos diferentes. autofecundada. responda às perguntas a seguir. duas características são condicionadas por genes dominantes (A e B). Do cruzamento entre linhagens homozigóticas que produzem frutos de 150g. Justifique sua resposta. Questão 305 Em um concurso de cães. histológica e citologicamente a cor da pele? Histologicamente: Citologicamente: b) O que confere a diferença na cor da pele de indivíduos negros em relação à dos indivíduos brancos? c) Evolutivamente. que ganham nota zero. Um criador. Qual o nome que se dá a esse método profilático? Questão 301 Atualmente.5. O homozigoto dominante para estas duas características recebe mais pontos que os heterozigotos e estes. reponda: a) quantos pares de genes estão envolvidos na determinação do peso dos frutos desta espécie vegetal? b) qual é o efeito aditivo de cada gene? c) de acordo com o triângulo de Pascal. Questão 302 A massa de um determinado tipo de fruto depende da ação de dois genes A e B. qual a importância da existência dessa variabilidade na cor da pele para o ser humano? d) Especifique a forma de herança genética responsável pela determinação da cor da pele. o Governo Federal vem discutindo a implantação de quotas para negros nas universidades. Considerando a cor da pele de negros e de brancos responda: a) Onde é determinada. 61 Com base no exposto. Os responsáveis por essa variação são 3 pares de genes com segregação independente. em centímetros. ambos heterozigotos para os dois genes.1. alelos de A e B . independentes e de ação cumulativa (polimeria). obtendo uma descendência com todos os genótipos possíveis. não alelos.10 respectivamente. desejando participar do concurso. O fruto de uma planta de genótipo AABB tem 40 gramas de massa enquanto o de uma planta de genótipo aabb tem 20 gramas. que interferem igualmente na altura da planta. Esses genes contribuem com valores idênticos para o acréscimo de massa. Sabendo-se que o peso do fruto é um caso de herança quantitativa. Questão 303 O peso dos frutos (fenótipos) de uma determinada espécie vegetal varia de 150g a 300g. Os genes a e b. cruzou um macho e uma fêmea. Determine a massa do fruto de uma planta de genótipo AABb. a) Que tipo específico de célula sangüínea foi afetada pela irradiação? b) Que tipo de molécula essa célula do sangue passa a produzir quando estimulada pela proteína estranha? c) A introdução de moléculas estranhas ao organismo com o objetivo de provocar uma resposta imune é um método bastante usado na prevenção de determinadas doenças. com linhagens homozigóticas que produzem frutos de 300g. não contribuem para o acréscimo de massa. obteve-se uma geração F que. mais pontos que os recessivos.

a) Qual a probabilidade do criador obter um animal com a pontuação máxima? Qual a probabilidade de obter um animal homozigoto recessivo para os dois genes? b) Considerando que todos os descendentes do referido cruzamento participaram do concurso. responsáveis pelos fenótipos aguti.5. rosa e amarela. II) apenas flores de rosa médio.5. C2). Responda: a) Quais as proporções fenotípicas e genotípicas esperadas na progênie do cruzamento entre um coelho aguti (Cc¢) e um coelho chinchila (c£c¤)? b) Como você explicaria o aparecimento de coelhos albinos a partir de um cruzamento entre coelhos himalaios? Questão 310 As videiras podem produzir uvas de coloração vermelha. d¢ e d£) tem seu locus no cromossomo II. c£ e c¤. a¢.12 1. O cruzamento entre plantas com esses fenótipos produziu as seguintes proles na geração F1. responda ao que se pede: a) Quantos alelos estão envolvidos na determinação do caráter cor de fruto e qual a relação de dominância entre eles? b) Qual a proporção genotípica e fenotípica do cruzamento entre plantas de fruto vinho do cruzamento parental (2) com plantas de fruto vinho do cruzamento parental (4)? c) Quantas plantas com frutos amarelos serão geradas. A3. produzindo sempre as seguintes freqüências fenotípicas na geração (F‚): Questão 309 A cor da pelagem em coelhos é determinada por uma série de alelos múltiplos composta pelos genes C. quantos genótipos diferentes são. 1. A2. e que cada gene dominante contribui com 5 pontos na premiação. possíveis na população? . Os descendentes (F) foram cruzados entre si. Em relação a essas duas séries de alelos. himalaio e albino. Qual dos dois mecanismos explica a maior parte das variações fenotípicas nas populações? Justifique. B2 e C1. a partir de 200 sementes oriundas do cruzamento entre plantas de frutos vinho do cruzamento parental (4) com plantas de frutos rosa do cruzamento parental (2)? Questão 311 Uma determinada característica depende de um locus que possui 4 alelos (A1. porém são 62 a) Qual o tipo da herança da cor da flor da paineira? b) Indique as possibilidades de se obter em um cruzamento: I) apenas flores de cor branca. chinchila. A ordem de dominância existente entre os genes é C > c¢ > c£ > c¤. c¢. a£ e a¤) tem seu locus no cromossomo I e outra série de três alelos (D. quantos pontos devem ter obtido os vice-campeões e os cães classificados em penúltimo lugar? Questão 306 Certas características fenotípicas são determinadas por poucos genes (herança mendeliana). respectivamente. Outra característica também depende de 4 genes (B1. Questão 307 Um pesquisador cruzou paineiras de flores "pink" com paineiras de flores brancas. vinho. enquanto outras são determinadas por muitos genes (herança poligênica). Questão 308 Admitamos que numa certa espécie de animal quatro alelos (A. teoricamente. A4).11 Com base nos resultados apresentados.

Em abelhas. Questão 312 Em abelhas. bem como as localizações 63 .não ocorreu permuta entre os genes A e C. Esses resultados contrariam a segunda lei de Mendel ou lei da segregação independente? Justifique sua resposta. 25% para cada um deles. qual é a seqüência mais provável desses 4 genes no cromossomo. qual o número esperado de machos e de fêmeas na descendência? Dos machos esperados. em proporções iguais. A figura a seguir ilustra um par de cromossomos homólogos duplicados (A e B). . que é homozigoto recessivo para os mesmos alelos. sabendo-se que a freqüência de permutação é de 10%? Questão 315 Que tipos de gametas e em que proporções produzirá um organismo com genótipo Cd/cD. com a seguinte relação de dominância: marrom>pérola>neve>creme>amarelo.ocorreu 20% de permuta entre os genes A e B. Uma rainha de olho marrom. é cruzado com outro. produziu 600 ovos e foi inseminada artificialmente por espermatozóides que portavam. a partir do gene A? b) Justifique sua resposta. sendo que "A" e "B" são dominantes. o evolucionista John Maynard-Smith escreveu sobre a meiose. Um desses dois tipos de determinismo genético apresenta um número maior de genótipos possíveis na população. Questão 318 Sabendo que a maioria das mutações é deletéria (prejudicial ao organismo). A prole resultante foi: 40% AaBb 40% aabb 10% Aabb 10% aaBb O pesquisador ficou surpreso.dois pares de alelos localizados em pares de cromossomos homólogos diferentes. O retrocruzamento de F1 (com o duplo recessivo) mostra os seguintes resultados: . Cada loco tem dois alelos "A" e "a" e "B" e "b". existe um processo denominado partenogênese. Um pesquisador cruzou um indivíduo "AaBb" com um indivíduo "aabb". 30% entre A e D.ocorreu 10% de permuta entre os genes B e D. outro com o motor quebrado e. durante a produção de gametas: "A meiose é o equivalente a ter dois carros. com eles. pois esperava obter os quatro genótipos na mesma proporção. a) Baseando-se nos resultados acima. quantos terão o olho de cor marrom? Questão 313 Um organismo. um com a transmissão quebrada. a cor do olho é condicionada por uma série de alelos múltiplos. heterozigota para pérola. Identifique esses genótipos. Quantos deverão ser diferentes dos pais. Somente 40% dos ovos dessa rainha foram fertilizados e toda a descendência teve a mesma oportunidade de sobrevivência. homozigoto para os genes A B C D. os cinco alelos. porém. a) O que é partenogênese? Em abelhas. sabendo-se que a freqüência de permutação é de 36%? Questão 316 Quais são os gametas produzidos por um indivíduo de genótipo Ab/aB? Em que proporções serão formados sabendo-se que os genes A e b permutam com uma freqüência de 16%? Questão 317 Considere a existência de dois locos em um indivíduo. produzir um único carro que funcione". todos localizados em um mesmo cromossomo. constituída por cinco alelos. que descendência resulta deste processo? b) Na inseminação realizada. Questão 314 O cruzamento CD/cd x cd/cd produziu 600 descendentes. .

Questão 319 Os locos M. Massey. Um indivíduo homozigótico para os alelos M.) a) A partir do exemplo apresentado no texto. 25% de permuta entre os locos M e O. Artmed. se ingeridas. o. explique em que consistem. A. H. um folheto à população alertando sobre os perigos da ingestão de transgênicos na alimentação. 2002. N. hoje. Sua doença era a mesma que a do "menino da bolha". O.13 vida em um ambiente estéril. p. p. Os cientistas do National Institute of Health dos Estados Unidos coletaram sangue da menina. constava uma que afirmava incorretamente que "para serem criadas plantas transgênicas são usados os vírus da AIDS" e que tais plantas. A paciente foi uma menina com a doença da imunodeficiência combinada severa. que viveu sua curta . homozigótico para os alelos m. a) O que são transgênicos ou organismos geneticamente modificados (OGMs)? b) Explique por que o vírus da AIDS não poderia infectar uma planta e por que a ingestão de uma planta transgênica não seria capaz de transmitir o vírus da AIDS. N.. poderiam infectar com o vírus da AIDS toda a população. (Adaptado de "O Globo". Entre as advertências.5. Não houve descendentes com permuta entre os locos M e P. P foi cruzado com outro. 1. (Kreuzer. os tratamentos denominados "terapia gênica". A técnica combina o uso de células-tronco de embriões e terapia genética. A causa da doença da menina era um defeito em um gene que codifica a enzima adenosina desaminase (ADA). "Engenharia Genética e Biotecnologia". n. P estão localizados em um mesmo cromossomo. o. b) Por que não houve descendentes recombinantes com permuta entre os locos M e P? Questão 320 O primeiro teste de terapia gênica humana utilizou células sangüíneas. indicando as distâncias entre os locos. Esta criança possuía um sistema imune extremamente deficiente e não podia defender-se contra infecções. de maneira geral. Então eles reintroduziram os linfócitos na paciente. Questão 321 Alguns grupos radicalmente contrários ao uso de organismos geneticamente modificados (transgênicos) na agricultura divulgaram recentemente. Porto Alegre. a menina é mais saudável do que antes. b) Selecione e transcreva o segmento do texto que justifica a afirmação de que a terapia gênica é um exemplo de engenharia genética. pois estas são de fácil obtenção e de fácil reintrodução no corpo. a) Qual a seqüência mais provável desses locos no cromossomo? Faça um esquema do mapa genético desse trecho do cromossomo. O. A geração F foi então retrocruzada com o homozigótico m. A descendência desse retrocruzamento apresentou 15% de permuta entre os locos M e N. no procedimento 64 Um indivíduo que possui os cromossomos A e B poderá formar gametas que não sejam portadores dos alelos M e N? Justifique sua resposta.dos alelos deletérios "M" (presente somente no cromossomo A) e "N" (presente somente no cromossomo B). separaram os linfócitos (células brancas) e usaram um retrovírus para introduzir uma cópia correta do gene nestas células. no Sul do país. 08/09/2000) Explique a vantagem da utilização. As células alteradas produziram a enzima que faltava e. 10% de permuta entre os locos N e O. Questão 322 CÉLULAS-TRONCO PODEM TRATAR LESÕES CEREBRAIS Empresa usa unidade estrutural de embriões para recuperar vítimas de derrame. Responda. n.

b) o resultado da experiência seria diferente se tivessem sido usados núcleos de células germinativas. 6/8/98) baseia-se no livro Remaking Eden (Refazendo o Éden) de Lee Silver. Identifique qual das duas hipóteses é confirmada pelos processos de clonagem. desenvolveu-se. Justifique sua resposta. no qual todas as células são inicialmente indiferenciadas. Questão 323 Dois cientistas realizaram uma experiência com o objetivo de estudar a transmissão das informações contidas nos genes do núcleo de células de diferentes tecidos. que a diferenciação não implicava perda de DNA. previamente anucleado. até o estágio adulto. nos quais o núcleo da célula de um tecido de um indivíduo adulto é introduzido em um ovócito anucleado que. resultaram na formação de embriões normais. Na segunda. A célula assim formada foi implantada no útero do indivíduo 3. do indivíduo 2. origina outro organismo. de células-tronco ao invés de células já diferenciadas. postulava-se a idéia de que ocorria perda de material genético enquanto a célula se diferenciava. e deu origem a um novo ser. Questão 325 Em uma experiência de reprodução com uma espécie de mamífero adotou-se o seguinte procedimento: fundiu-se uma célula do indivíduo 1 com um óvulo. retiradas de uma mesma rã.1 . Historicamente. o qual afirma que cenas como estas não só são possíveis. Em uma delas. com seus novos núcleos. Esse processo é conhecido como diferenciação celular. Os cientistas observaram que a grande maioria destas células. Explique por que: a) esses núcleos transplantados de células somáticas de diferentes tecidos deram origem a indivíduos normais e idênticos. que chamaremos de H1.5. responda: a) Como o bebê da figura acima poderia ter sido gerado? b) Qual seria o sexo do bebê gerado por esse processo? Justifique sua resposta. Questão 327 "CIENTISTAS DA UNIVERSIDADE DO HAVAÍ CLONAM MAMÍFERO ADULTO DO SEXO MASCULINO A clonagem deixou de ser uma técnica aplicável exclusivamente às fêmeas. composto por até centenas de diferentes tipos de células. H2.15. Cientistas da Universidade do 65 1.descrito. Núcleos de óvulos de rã não-fertilizados foram substituídos por núcleos de células somáticas. Admitindo-se a possibilidade de clonar seres humanos e com base no que tem sido publicado nos principais jornais e revistas do País. como inevitáveis. havia duas hipóteses a respeito da diferenciação celular. ao 2 ou ao 3? Justifique sua resposta. Questão 324 A figura a seguir (Folha de São Paulo. ao se desenvolver. Questão 326 No desenvolvimento de um organismo ocorre a transição de um estágio embrionário. Esse novo ser é geneticamente idêntico ao indivíduo 1.

Uma fêmea (animal X) é estimulada com hormônios a produzir vários óvulos.O embrião é reimplantado no útero de um terceiro animal (animal W) dando origem a um novo animal.. .Essa fêmea é então inseminada artificialmente. um cientista apresenta duas técnicas. Clones. 4 . chegando-se assim à fórmula para recuperar a espécie.Cada metade é reimplantada no útero de outra fêmea (receptora). A nova célula assim formada começa a se dividir formando um embrião. no entanto. Pergunta-se: a) Todos os animais produzidos pela técnica I são genotipicamente iguais ao animal X? Justifique.Havaí clonaram o primeiro mamífero adulto do sexo masculino. 3 . 66 1. e descartaram seus núcleos. b) O novo animal formado pela técnica II pode ser chamado "clone" do animal Y. nŽ55. Em vez de utilizar células relacionadas ao sistema reprodutivo feminino para preencher os óvulos. TÉCNICA I 1 . segundo trabalho publicado na revista "Nature Genetics". caso um dos animais seja sensível a uma bactéria que cause pneumonia? b) Justifique sua resposta. os cientistas criaram Fibro a partir de um pedaço do rabo de um camundongo. lembra o geneticista Ademar Freire Maia em um artigo do Boletim "Germinis" do Conselho Federal de Biologia. 3 . que poderiam ser usados e que estão descritas nos quadros. Eles colheram 700 óvulos.1 Adaptado da Revista Época: Ano II. 7/6/99. Com o sangue. gerando um novo animal. extintos há 65 milhões de anos. de maio/junho de 1997. 4 .15. 2 . Por que os cientistas extraíram os núcleos dos óvulos antes de inserir as células da cauda do doador? Questão 328 No filme "Parque dos Dinossauros".) Agora. Apenas 274 embriões resultaram dessa operação e foram implantados em 25 ratinhas que funcionaram como 'mães de aluguel'.89. Z ou W? Justifique.. Um dos objetivos dessa pesquisa é a melhoria da pecuária.Óvulos não fecundados são retirados de um segundo animal (animal Z). considerada o primeiro clone de mamífero gerado artificialmente.Após alguns dias.O núcleo retirado da célula somática do animal Y é implantado no óvulo sem núcleo do animal Z. I e II. TÉCNICA II 1 . ocorrem naturalmente no cotidiano. p. O núcleo de cada um desses óvulos é retirado. como havia sido feito até agora. a) O que se poderia dizer dos exemplares recuperados.5. 2 . Questão 330 No início deste ano. a) Qual seria a desvantagem biológica de um rebanho de clones? b) Dê um exemplo de clone que ocorre naturalmente. O material foi substituído por células extraídas da cauda do doador. pesquisadores anunciaram o nascimento da ovelha Dolly. Trata-se de um camundongo batizado de Fibro. uma brincadeira com a palavra fibroblasto. um cientista cria em laboratório novas gerações de dinossauros. tipo de célula usada na criação do animal (.Células somáticas são retiradas do corpo de um animal (animal Y). através da formação de rebanhos homogêneos. os zigotos são retirados da fêmea e divididos em dois. por meio do sangue conservado em mosquitos que os teriam picado e que permaneceram fossilizados no âmbar. Considere a possibilidade de que o DNA obtido pertença a um único dinossauro e que deste DNA foram recuperados vários exemplares. foi possível determinar o DNA dos dinossauros. das quais são retirados os núcleos. os pesquisadores Ryuzo Yanagimachi e Teruhiko Wakayama mostram que um macho adulto também pode ser replicado." Questão 329 Respondendo a uma questão sobre a possibilidade de se clonarem animais para livrá-los de extinção. da mesma espécie. produzidos por ratas.

2 1.15. 1. 3.Justifique. 67 . Nesse caso. . as matariam.2 a) Explique a causa da diferença no crescimento dos camundongos 2 e 3. poderia ser usado um retrovírus modificado. b) Com base em sua resposta ao item a. estão esquematizadas a partícula viral original. deveriam ser realizadas três etapas: 1. 2. colocar as células coletadas em contato com o retrovírus modificado. Questão 332 A terapia génica. indicado em lagumas figuras.X representa o trecho de ácido nucléico viral. na talassemia. Questão 331 Um pesquisador construiu um camundongo transgênico que possui uma cópia extra de um gene Z.Y representa o trecho de ácido nucléico introduzido. . Por exemplo. Essas plantas toleram concentrações maiores de agrotóxico sem alterar as propriedades tóxicas dos defensivos agrícolas. apresentados nos esquemas acima. IV e V).5. no caso do tratamento da talassemia. destacamos duas: 1) Plantas resistentes a certos vírus patogênicos que. para que essas sejam infectadas. indica que a partícula viral contém as enzimas transcriptase reversa e integrase (insere o material genético de origem viral no genoma da célula). realizou uma cirurgia e removeu a hipófise. contendo a informação para a síntese da ’-globina. estudou o crescimento desses camundongos.5. Entre as várias estratégias de produção de plantas transgênicas. uma promessa da biotecnologia moderna. Obteve as seguintes curvas de crescimento corporal: manipulação (Esquema I) . Questão 333 As técnicas modernas de engenharia genética tornaram possível a produção de plantas transgênicas que possuem genes introduzidos artificialmente no seu genoma. antes da . as células retiradas da medula óssea são as indicadas para serem infectadas com as partículas virais adequadamente modificadas.15. A seguir. III. coletar células da medula óssea do paciente. consiste na cura de defeitos genéticos pela introdução de genes normais em celulas de indivíduos doentes. 2) Plantas mais resistentes aos efeitos dos defensivos agrícolas (agrotóxicos). que codifica as proteínas necessárias para a formação de novas partículas virais no interior da célula hospedeira. b) Indique qual dos retrovírus modificados. não transgênico e com hipófise. a) Explique por que. Algumas metodologias em estudo utilizam retrovírus modificados como veículo de introdução do gene desejado. Em um outro camundongo jovem. seria o mais indicado para ser usado nesse tratamento. Em seguida. Justifique sua resposta. que contém a informação para a síntese da cadeia ’ da globina. doença caracterizada pela produção de hemoglobina anormal devido a uma deleção no gene que codifica a cadeia ’ da globina. elabore uma hipótese para a causa da diferença no crescimento dos camundongos 1 e 2. comparando com o crescimento de um camundongo. e quatro diferentes partículas virais modificadas (Esquemas II. na ausência do gene de resistência.o símbolo esférico e negro. reintroduzir as células infectadas no paciente.

como a fenilcetonúria. para aumentar a produção leiteira. a) Explique. onde cada traço indica a posição e o tamanho dos fragmentos num 68 1. explique a) como os três grupos de seres se diferenciam entre si. Essas resultam em fragmentos de tamanhos diferentes que podem ser utilizados como marcadores genéticos. Analisando-os quanto à variabilidade gênica. No entanto. Questão 334 Considere os seguintes seres: I) cabra selecionada artificialmente. III) soja transgênica clonada para melhoria da qualidade biológica de suas proteínas. por cruzamentos sucessivos. b) Defina um organismo transgênico. No esquema a seguir. pois. no que se refere à perpetuação de sua própria espécie. c) Indique um benefício decorrente da utilização de organismos transgênicos e um possível risco para o ambiente ou para a saúde humana. em caso de ocorrer uma catástrofe ambiental. Questão 337 Uma mutação no gene que codifica a enzima fenilalanina hidroxilase pode acarretar o acúmulo do aminoácido fenilalanina no sangue. pontos de quebra por enzimas especiais.5. da mãe e da criança estão indicados na figura 2. Justifique. Questão 338 Considere estes dados como hipotéticos. porém. Esse casal tem uma criança com Síndrome de Down devida à trissomia do cromossomo 21. os fragmentos são indicados por Kb (1Kb=1000 pares de bases nitrogenadas). não há ainda como avaliar os riscos que os organismos transgênicos apresentam.Do ponto de vista ambiental. II) cana-de-açúcar obtida através de mudas. Questão 336 Existem mecanismos que normalmente impedem a troca de genes entre espécies distintas. as fronteiras entre as espécies vêm sendo rompidas com a criação de organismos transgênicos. Questão 335 entre espécies distintas. do ponto de vista genético. o desenvolvimento de novas metodologias nas áreas da bioquímica e da biologia molecular permitiu a implementação de exames diagnósticos. b) Apresente dois testes laboratoriais para a detecção de portadores de fenilcetonúria e explique os princípios desses testes.15. b) de que forma os três grupos poderiam ser afetados. por que o tratamento iniciado logo após o nascimento. indubitavelmente importantes no caso de doenças tratáveis. A introdução de soja e de outras plantas transgênicas tem gerado muita polêmica.2 Explique o que é alimento transgênico e como é obtido. sendo o excesso transformado em compostos tóxicos que comprometem o desenvolvimento físico e mental da criança fenilcetonúrica. indicados no esquema por setas. Nos últimos anos. a) Cite dois mecanismos que impedem a troca de genes . em seus cromossomos de número 21. qual das duas estratégias não é recomendável? Justifique sua resposta. o qual inclui uma dieta restritiva à fenilalanina. pode melhorar a qualidade de vida das crianças afetadas por fenilcetonúria. Os resultados obtidos com o estudo dos marcadores para o cromossomo 21 do pai. Um casal apresenta. apesar de seus inúmeros benefícios.

5. Justifique sua resposta. que permaneceu anônimo. Esse projeto contou com a participação de diversos laboratórios. 2) Determine o estágio da meiose. II) extrair todos os ARNs mensageiros. Foi feito um experimento em que o ADN do organismo 1 (ADN radioativo) foi "hibridado" com o ADN não radioativo de três outros organismos. é possível medir quanto ADN radioativo existe num ADN de cadeia dupla. mais . constatou-se que a criança apresentava Síndrome de Down. determine: O genitor onde ocorreu a não-disjunção. O ADN radioativo é então desnaturado (suas cadeias são separadas por calor) e posto em contato com o ADN de um outro organismo. Questão 339 No início do projeto do genoma humano. 1) Identifique o genitor que transmitiu dois cromossomos 21 à criança. portanto. pressupõe-se que a criança deve ser normal. Nos dois casos. foi realizado para o feto através de punção do líquido amniótico. que o ADN era de um indivíduo do sexo masculino. I ou II. então. 3) Suponha que a mulher está novamente grávida e que o exame para marcadores do cromossomo 21. igualmente desnaturado. a técnica de seqüenciamento era a mesma. A fase da meiose em que o fenômeno ocorreu. Por que foi importante determinar a seqüência do ADN de um homem e não de uma mulher? 69 1. Entretanto. produzir ADN a partir desses ARNs mensageiros e seqüenciar apenas esse ADN. após o nascimento. havia duas estratégias a considerar: I) seqüenciar o ADN total dos cromossomos diretamente. Após a hibridação (reassociação formando moléculas híbridas). que individualmente determinaram a seqüência de vários trechos diferentes do ADN de todos os cromossomos. Sabe-se. foi publicada a seqüência quase completa do genoma humano.campo de eletroforese.15. obtendo-se os seguintes resultados: ADN do organismo 1 + ADN do organismo 1 = 100% de radioatividade no ADN híbrido ADN do organismo 1 + ADN do organismo 2 = 10% de radioatividade no ADN híbrido ADN do organismo 1 + ADN do organismo 3 = 40% de radioatividade no ADN híbrido ADN do organismo 1 + ADN do organismo 4 = 85% de radioatividade no ADN híbrido Qual o organismo que pertence à mesma espécie do organismo 1? Justifique sua resposta. como descrito no texto. em que ocorreu o fenômeno de não-separação ou não-disjunção dos cromossomos. Questão 341 Em Junho de 2001. Justifique sua resposta. Por que a segunda estratégia é mais rápida e. marcado com fósforo radioativo. econômica? Questão 340 Uma técnica usada como uma ferramenta da taxonomia emprega a seguinte abordagem: extrai-se o ADN de um organismo e este é. a partir da amostra de somente um indivíduo. porém não radioativo. amniocentese. Pelos resultados apresentados na figura. Com base nessa informação.3 Com base nas informações apresentadas e em conhecimentos sobre o assunto responda ao que se pede. Analise o resultado obtido na figura 3. no entanto.

A presença do marcador no genoma de um indivíduo pode ser visualizada como uma banda. que identificou o genoma de uma bactéria. II. gêmeos dizigóticos.Questão 342 Considerando situações hipotéticas. Paula engravidou-se ao manter relações sexuais com dois irmãos. No entanto. III e IV). uma vez que pode ser associada com algum fenótipo em particular. formado por indivíduos tipo I e III. pois a maioria das frutas não se desenvolve. Após receber os resultados. As frases a seguir constam numa lista de "mitos e verdades sobre o teste de DNA" encontrada na internet (http://www. II. Em outra situação. as pessoas têm muitas dúvidas a respeito desse tipo de exame. ter um descendente com essa disfunção muscular? Questão 344 Recentemente. Questão 346 1. O esquema abaixo representa a análise de marcadores de DNA de quatro embriões humanos (I. Observe o padrão de bandas do DNA de cada embrião e responda: a) Dentre os embriões analisados.3 O teste de paternidade usando o DNA tornou-se muito freqüente hoje. Questão 345 O exame de paternidade através da comparação de DNA seqüenciado vem sendo utilizado para determinar progenitores. ambas reclamaram na Justiça o reconhecimento de paternidade. a Justiça pronunciou-se sobre a paternidade de uma das crianças e ficou impossibilitada de pronunciar-se sobre a paternidade da outra criança. Apenas a presença de duas bandas (A e B) é indicativo positivo para o indivíduo apresentar uma certa disfunção muscular quando adulto. quais NÃO deverão apresentar a disfunção muscular quando adultos? b) Supondo que os quatros embriões sejam irmãos. determinando o Juiz a realização dos testes de DNA. Maria manteve relações sexuais com dois irmãos. quais as principais deficiências que a planta sofre? Justifique. 'Xylella fastidiosa'. 70 . a) Explique o que é genoma e indique uma possível conseqüência econômica dos resultados desta pesquisa. Detectou-se ainda que esses marcadores ocupam o MESMO loco.15. nascendo destas relações Alfredo. nascendo Renato. III e IV) mais provável PARA CADA UM de seus pais? c) Qual é a probabilidade de um certo casal. os jornais e a revista científica internacional "Nature" publicaram com destaque um grande feito de um grupo de cientistas brasileiros. conhecida como amarelinho. Responda: a) sobre a paternidade de qual criança o juiz pronunciou-se? b) por que não pôde o juiz se pronunciar sobre a paternidade da outra criança? Questão 343 Com técnicas de biologia molecular é possível verificar a presença ou não de certas regiões de interesse na fita de DNA. qual é o padrão de bandas (I. Abandonadas. Dessa forma. que causa uma doença nas laranjeiras. b) Se o xilema é bloqueado.com. Cada uma dessas regiões recebe o nome de marcador. também hipotética. podemos descobrir se um embrião poderá apresentar uma determinada característica ou doença genética pela análise de seus marcadores.br).5. É possível determinar o pai de um recém-nascido quando a dúvida sobre a paternidade desse recém-nascido está entre gêmeos univitelinos? Justifique sua resposta.gene. gêmeos monozigóticos. O xilema das plantas produtoras de laranja é parcialmente bloqueado. reduzindo a produção.

c) Cite dois produtos. que foram obtidos a partir da aplicação da tecnologia do DNA recombinante. Questão 347 A virulência do 'Bacillus anthracis'. que antes eram disponíveis em quantidades extremamente reduzidas. Questão 348 A partir da década de 70. Questão 349 Na tecnologia do DNA recombinante são utilizadas enzimas bacterianas que têm a propriedade de cortar a molécula de DNA em pontos específicos. ao contrário da toxina. "O exame de DNA só pode ser feito com sangue. e é atenuada quando um deles está ausente. Nunca poderei provar que ele era o pai do meu filho. clonados em bactérias ou vírus. está diretamente associada à presença conjunta dos componentes toxina e cápsula bacteriana. b) A cápsula do 'Bacillus anthracis'. Por meio dessa tecnologia. Dentre as linhagens apresentadas.I. causador do antraz. Pergunta-se: a) Qual é o nome genérico que se dá a estas enzimas? 1. indique a que pode ser utilizada na elaboração de uma vacina composta por bactérias vivas com virulência atenuada. que passam a produzir sistematicamente tais proteínas. células de fígado são cultivadas em laboratório. contendo um gene que. o que permite. as moléculas de ácidos nucléicos da célula passaram a ser exploradas através da utilização de novas metodologias.15. Justifique sua indicação." Justifique por que cada uma das frases constitui um "mito".5. O esquema abaixo representa quatro diferentes linhagens de 'Bacillus anthracis'. Um vírus é inserido nas células. mesmo que eu não seja o verdadeiro pai. De acordo com a técnica esquematizada a seguir. que genes humanos que codificam proteínas de interesse médico ou comercial sejam extraídos. em grande escala. de determinadas proteínas. indústria ganharam alternativas eficientes para a produção. não possui antígenos capazes de provocar reação imunológica protetora em mamíferos. a) Qual é a função das endonucleases de restrição e a das ligases na aplicação da tecnologia anteriormente citada? b) Explique como a tecnologia do DNA recombinante participa no processo de produção de organismos transgênicos. utilizados pelo homem. 71 .5 a) Explique a utilidade dos plasmídios bacterianos no desenvolvimento de técnicas de DNA recombinante. e depois sejam transferidos para animais de laboratório. qual deve ser o papel desempenhado por elas? d) Como são chamados os organismos que recebem e incorporam genes de outra espécie? Questão 350 CONVERSÃO CELULAR: Cientistas israelenses induzem células hepáticas a produzir insulina em laboratório e propõem técnica para tratar diabetes tipo 1. em células do pâncreas. "Sou primo da mãe e estou com medo do resultado ser positivo. Os constituintes da toxina são codificados por genes existentes no plasmídeo pX01." III. a medicina e a b) O que confere a especificidade a estas enzimas? c) Na natureza. por exemplo. e os da cápsula por genes existentes no plasmídeo pX02. "Ele já morreu e não deixou nenhum outro parente vivo. conhecidas como tecnologia do DNA recombinante." II.

6 72 . há interesse em usá-las para reparar danos de tecidos que normalmente não se regeneram. Atualmente é possível produzir células-tronco heterólogas (retiradas diretamente de um embrião qualquer) ou homólogas. 1. O esquema a seguir apresenta algumas etapas dessa técnica. a) Analise as etapas I. quando comparada ao tratamento de diabéticos com transplante de células de pâncreas de indivíduos mortos? Questão 351 Na engenharia genética. Questão 352 A melhor fonte de células-tronco são os embriões em estágios iniciais de desenvolvimento. da revista Época. a) Cite UMA desvantagem do uso de vírus como vetores de terapia gênica. em local próximo à lesão.o ovócito transplantado é induzido a proliferar.5. Por esse motivo. respectivamente: a) o pareamento das bases? a‚) a ação das enzimas de restrição? aƒ) a ação da DNA ligase? b) "Os agricultores americanos.o núcleo de uma célula do paciente é transplantado para um ovócito maduro. 8 de junho de 1998). a técnica de DNA recombinante vem sendo utilizada na pesquisa e no desenvolvimento. por exemplo. II e III. 1. de vacinas e medicamentos.5. Em quais delas se desenvolvem. Conceitue os organismos transgênicos.está ligado à produção de insulina. já estão plantando as sementes da terceira safra de milho. As células se diferenciam em cultura. algodão e soja transgênicos.15. Os cientistas acreditam que as células transformadas possam futuramente ser usadas no combate ao diabetes tipo 1. responda os itens a seguir.5. b) Qual é a vantagem da terapia gênica descrita.15." (Adaptação do artigo "Revolução invisível na mesa". pois essas células indiferenciadas podem se transformar em qualquer tecido.ao atingir o estágio de blástula. 2 . cujo núcleo foi previamente removido.15.5 1. ficando mais parecidas com as que existem no pâncreas (células beta). O procedimento para o preparo de células-tronco embrionárias homólogas está ilustrado de modo simplificado a seguir e envolve as seguintes etapas: 1 .5 Com relação ao procedimento descrito. por exemplo. as células do embrião são separadas umas das outras e injetadas diretamente no paciente. 3 .

a) Se a mãe já foi vacinada ou já teve sarampo.7. Dessa forma. Esse indivíduo. a) Explique o que é esperado para a freqüência do gene S em presença da malária.1 Note que. Suas epidemias. infecções oportunistas por fungos. As mutações ocorrem numa proteína chamada HA. os linfócitos T CD4. e ele continua sua reprodução sem ser molestado." a) Por que o sistema imunológico de uma pessoa não reconhece um vírus mutante.seu material genético . que ainda ocorrem todo o ano. que fica espetada na membrana do vírus. o conteúdo do vírus . de infecções oportunistas? Questão 355 Notícias recentes veiculadas pela imprensa informam que o surto de sarampo no Estado de São Paulo foi devido à diminuição do número de pessoas vacinadas nos últimos anos. apresentam duas populações de mitocôndrias diferentes em seus tecidos. ocorrem quando o vírus sofre uma mutação que o torna mais virulento e irreconhecível pelos sistemas imunológicos das pessoas infectadas. É ela que os glóbulos brancos reconhecem e procuram atacar.é liberado no interior da célula. Questão 353 Leia atentamente o texto adiante e responda as perguntas propostas a seguir: "A gripe é uma das doenças que mais matou na história do homem. A HA se liga à superfície de uma célula. Indivíduos com anemia falciforme são homozigotos (SS) e morrem na infância. quase sempre no inverno. Os heterozigotos (Ss) apresentam forma atenuada da anemia. mesmo que já tenha tido uma forma da doença? b) Explique como o vírus consegue "enganar" uma célula e infectá-la. fazendo com que ela acione suas defesas e "engula" o vírus com uma bolsa digestiva. Foram essas infecções. nesse indivíduo. os indivíduos heterozigotos para anemia falciforme são resistentes à malária. As autoridades sanitárias também atribuíram o alto número de casos em crianças abaixo de um ano ao fato de muitas mães nunca terem recebido a vacina contra o sarampo. No entanto. Por que pacientes infectados com HIV e não tratados sofrem. a célula solta ácidos para digerir o vírus. somente após cerca de 60 meses. parasitas e bactérias. 1. apareceram. que faz com que a membrana do vírus se funda com a membrana da célula. já assustaram mais do que a AIDS. Questão 354 O gráfico a seguir mostra a variação do número de um tipo de leucócitos. incapazes de transportar o gás oxigênio. b) Explique por que o uso de células-tronco embrionárias homólogas reduz potencialmente os problemas pós-tratamento para os pacientes. e da quantidade de vírus HIV no sangue de um indivíduo ao longo do tempo. onde a malária é endêmica.a) Explique por que indivíduos transplantados com células-tronco embrionárias. Toda a interação inicial entre vírus e célula do paciente ocorre através da HA. Por quê? b) Por que uma pessoa que teve sarampo ou foi vacinada fica permanentemente imune à doença? De que forma a vacina atua no organismo? Questão 356 A anemia falciforme é caracterizada por hemácias em forma de foice. não teve acesso a tratamento algum durante o período mostrado. em geral. em função da produção de moléculas anormais de hemoglobina. Dentro dessa bolsa. E em ausência da malária? b) Qual é a explicação para o fato dos heterozigotos para anemia serem resistentes à malária? 73 . quanto heterólogas. que levaram o paciente à morte. As epidemias. o bebê fica temporariamente protegido contra essa doença. Na África. tanto homólogas. o aumento da acidez provoca a mudança de forma na HA. portador da síndrome de imunodeficiência causada pelo vírus HIV (AIDS/ SIDA). e não o vírus propriamente dito.

com o objetivo de produzir rosas azuis. como uma rosa azul. Questão 358 Um menino colocou a mão em um buraco onde havia uma cobra e. Seu pai. indique o número cromossômico dos indivíduos de cada uma das castas e descreva como ocorre a diferenciação em castas nesses insetos. foi picado por ela. conforme exemplificado pela reação abaixo. O nome da bactéria deriva do fato de que ela se estabelece nos vasos do xilema da planta hospedeira. tratando-o com soro antiofídico. seria o indicado para receber esse gene e justifique sua resposta. de 1Ž. possuem tal enzima. As petúnias. fossem inseridas cópias de seu RNA mensageiro. Anteriormente.07. que passaram a ter cor azul? Qual o significado biológico do fato de certas plantas apresentarem flores com cores tão vistosas? b) Qual é a relação entre esta técnica recente para a produção de flores azuis e aquela empregada para a produção de alimentos transgênicos? Questão 362 O oxigênio é um elemento imprescindível à manutenção da vida dos seres aeróbicos. mesmo sem ver a cobra.Questão 357 As abelhas vivem em colônias constituídas por indivíduos de três castas: a rainha. não é possível obter rosas dessa cor. Por quê? c) Em que consiste o seqüenciamento de um genoma? Questão 361 Esforços de cientistas criaram a primeira rosa do mundo com pigmento para cor azul. b) Qual é a substância imunológica presente no soro antiofídico responsável pela inativação do veneno? Como este soro é produzido? Questão 359 A indústria de flores movimenta bilhões de dólares por ano e está continuamente buscando criar novas variedades. a) Que característica desse réptil levou o pai a deduzir que se tratava de cobra peçonhenta? Cite outra característica morfológica facilmente identificada na maioria dessas cobras. apesar de não tê-la tocado. Indique se há ou não possibilidade de produção de rosas azuis nesse caso e justifique sua resposta. pois participa do processo de extração de energia dos alimentos. Segundo o jornal "The Japan Times on line". mas não eram consideradas azuis verdadeiras. C†H‚O† + 6 O‚ ë 6 H‚O + 6 CO‚ Em virtude de sua configuração eletrônica. como aceptor final de elétrons. a) Cite o tipo de célula indiferenciada de roseira que. o oxigênio tem 74 . a) Que processo fisiológico da planta é diretamente prejudicado pela presença da bactéria? Justifique. pois a enzima que sintetiza esse pigmento está ausente nas roseiras.2004. Questão 360 Uma importante realização da pesquisa científica brasileira foi o seqüenciamento do genoma da bactéria 'Xylella fastidiosa'. causadora da doença chamada amarelinho ou clorose variegada dos citros (CVC). Encontra-se em fase de teste uma técnica que possibilita inserir em células de roseira o gene da petúnia responsável pela codificação da enzima que produz o pigmento azul. a) Como se chamam as estruturas mais vistosas e atraentes destas flores. Sabendo-se que as fêmeas férteis de 'Apis mellifera' têm 32 cromossomos. deduziu que ela era peçonhenta e socorreu o filho. b) Não se pode atribuir à 'Xylella fastidiosa' a morte das células que constituem os vasos do xilema maduro. foi extraído do amor-perfeito e ativado nas rosas. delfinidina. um biólogo. b) Suponha que. rosas de coloração azul já eram produzidas através de cruzamento. os zangões e as operárias. em vez de ser introduzido o gene da petúnia que define a cor azul. a técnica recentemente utilizada consistiu no seguinte: o gene da enzima que produz o pigmento azul. Pelos métodos tradicionais. entretanto.

indique a etapa responsável pela formação de espécies reativas de oxigênio e o local da célula onde essas reações ocorrem. Por exemplo. Questão 364 Uma conquista recente no campo da biotecnologia é o uso de bactérias para a produção de proteína animal de interesse comercial. por serem muito reativas. denominadas espécies reativas de oxigênio. a) Estes gêmeos devem ser monozigóticos ou dizigóticos? Por quê? b) Se um dos gêmeos herdou o alelo dominante A de sua mãe heterozigótica Aa. Pergunta-se: a) Qual dos parentes você escolheria como doador do órgão? b) Justifique sua resposta. o que são gêmeos? b) Analisando a figura. quais são geneticamente idênticos? Justifique sua resposta. um indivíduo necessita de um transplante de rim.10. hoje já estão sendo comercializadas insulina e somatotrofina (ou somatropina) humanas produzidas por bactérias. a estrutura primária da proteína codificada pelo gene. primo em primeiro grau e irmão gêmeo dizigótico. Questão 363 Em um hospital. Dispõe ele dos seguintes doadores: tio. 1.10. a) Considerando o processo de oxidação completa da glicose pela célula eucariótica. ocorrendo o mesmo na sua segunda gestação. a) Em que locais do corpo humano são produzidas essas proteínas e qual é a principal função de cada uma delas no organismo? b) Explique sucintamente o processo por meio do qual se modificam bactérias para que elas passem a produzir proteínas humanas. fato que pode induzir mutações tanto em células somáticas quanto em células germinativas. o par de gêmeos é do sexo masculino. Qual o percentual esperado de ocorrência desse fato? Questão 368 A figura adiante representa o fenômeno biológico que ocorre com um tipo de célula que sai do vaso sangüíneo para exercer sua função no tecido conjuntivo.9 a) Sob o ponto de vista embriológico.forte tendência a receber um elétron de cada vez. Justifique por que não houve alteração da estrutura da proteína. sem alterar. que são fortes agentes oxidantes. amigo. acarretando a substituição de uma base guanina por uma adenina. Questão 365 Em uma gravidez gemelar. causam alterações. dando origem a moléculas intermediárias. Questão 367 Uma mulher teve uma menina em sua primeira gravidez. inclusive no DNA. qual é a probabilidade de que esse alelo também esteja presente no outro gêmeo? Questão 366 O esquema a seguir resume a seqüência do desenvolvimento de irmãos gêmeos: 1. b) Uma espécie reativa de oxigênio induziu uma mutação no gene de uma célula.11 75 . Essas moléculas. porém.

Descreva a função da transcriptase reversa no mecanismo de replicação do vírus da Aids. uma com pecíolo normal e outra com pecíolo curto. plantas com pecíolo normal e com pecíolo curto.1 76 . característica determinada por um gene. 1. Dois espécimes de variedades diferentes de uma planta oleaginosa foram cruzados visando à obtenção de uma variedade mais resistente à seca. Questão 370 O texto abaixo refere-se às questões: ** a ** O cruzamento entre plantas de variedades diferentes de uma mesma espécie é muito utilizado para a obtenção de cultivares mais produtivos. respectivamente. P . As plantas de amendoim podem apresentar folhas com pecíolo normal ou curto. com dois alelos. e) 3:1. em F2. c) folha sem cera.5. Para determinar qual alelo é dominante. se o alelo para pecíolo curto for recessivo. se o alelo para pecíolo normal for recessivo. proteínas. o fenótipo que apresenta o maior número de genótipos possíveis é a) semente com "pêlos". procuram descobrir novas substâncias que sejam inibidoras específicas dessa enzima. b) 1:2:1. sais minerais e vitaminas. pois a mesma é lipossolúvel. d) folha com cera.1 Das combinações possíveis resultantes do cruzamento entre esses mesmos parentais. carboidratos. b) semente lisa.semente com "pêlos" p .folha coberta com cera c . são definidas por alelos segregados independentemente. c) 2:1.semente lisa C . se o alelo para pecíolo normal for dominante.5. O gráfico que representa o número de alelos encontrados na mitose de uma célula obtida de uma planta resultante do cruzamento entre os parentais é: Questão 371 1. se o alelo para pecíolo curto for dominante. d) 3:1.a) Identifique esta célula e nomeie o fenômeno biológico apresentado. Questão 372 O amendoim é uma planta originária da América do Sul.folha sem cera Os gráficos a seguir mostram a composição dos alelos para essas duas características nas plantas parentais. referentes à folha e à semente. Sua importância econômica está relacionada ao fato das sementes possuírem sabor agradável e serem ricas em óleo. ainda servem de veículo de transporte para a vitamina E. Considere que duas das características dessa planta. Muitos pesquisadores.1. Espera-se encontrar. foi feito um cruzamento entre duas linhagens puras. atualmente. b) Qual a importância do fenômeno apresentado para a função desta célula? Questão 369 A enzima transcriptase reversa é encontrada em retrovírus. Os ácidos graxos insaturados presentes no amendoim. na proporção de a) 1:1. conforme a lista a seguir.2. se os alelos forem codominantes.

seqüência de aminoácidos ... resulta em produto que determinara o desenvolvimento da resposta imunológica. Com o cultivo das novas variedades de cerejas resistentes. verde. As formas mutantes para esse loco. d) pais heterozigotos têm 25% de probabilidade de terem filhos também heterozigotos. d) a crença da população pode ser explicada pelo fato de o sangue do feto ser fornecido pela mãe.. existe uma . Se as cerejeiras referidas no texto são transgênicas. é a utilização de cerejas coloridas. muitos cientistas também acreditavam que as características genéticas eram transmitidas pelo sangue. Questão 374 Em relação à crença da população sobre o processo de transmissão de características hereditárias.. Questão 375 O texto abaixo refere-se às questões: Notícia de algum jornal do futuro. podemos afirmar que: a) pais saudáveis de filhos que apresentam a doença são necessariamente homozigotos.... Outra inovação dessas cerejas é a resistência às moscas Anastrepha fraterculus que. b) a população não está tão equivocada. c) em situações como a descrita.... e) a crença da população não faz o menor sentido. pois os genes estão presentes apenas nas células sangüíneas e nas células germinativas.. INICIA A CAMPANHA NACIONAL DE VACINAÇÃO CONTRA SARAMPO E TUBERCULOSE. neste ano. O destaque da campanha de vacinação. depois de liberadas pela digestão..) Pelas informações fornecidas no texto. Apesar de passar por todas as etapas do ciclo reprodutivo. que foi introduzida para ser transcrita e originar um . ligam-se á membrana plasmática dos linfócitos e sofrem endocitose. a) núcleo . não interferem na eficiência das plantas transgênicas como produtoras de vacinas. por mutação no gene responsável pela produção de pigmento na casca do fruto.. anteriormente. incapazes de produzir sementes.. as plantas apresentam resistência aos nematóides que atacavam a raiz principal do sistema axial desses vegetais. espera-se que essas pragas mantenham-se afastadas dos pomares de vacinas. uma vez que células sangüíneas não apresentam as estruturas básicas que guardam as informações genéticas. (Pesquisa FAPESP. julho de 2005. e) pais heterozigotos têm 50% de probabilidade de terem filhos que irão desenvolver a doença. Segundo a bióloga Josefa da Silva. casamentos consangüíneos não aumentam a probabilidade de transmissão de doenças recessivas. roxa e branca) haviam sido obtidas. as substâncias que. em algum cromossomo. responsável pela equipe que desenvolveu os novos frutos.Uma pequena cidade interiorana do Nordeste brasileiro chamou a atenção de pesquisadores da Universidade de São Paulo pela alta incidência de uma doença autossômica recessiva neurodegenerativa. diz a pesquisadora. podemos afirmar que: a) no século XIX. e o processo cessa nas primeiras divisões celulares do zigoto.RNA transportador 77 ** a ** . estabeleceram-se como pragas importantes do cultivo de cerejas-vacina... técnicas especiais de cruzamento foram aplicadas em dois tipos de cerejeiras transgênicas. das células dessas plantas. ao ser traduzido... que.. por algum tempo. Da mesma forma. resultando na obtenção de plantas triplóides (3n = 72).. nos frutos. b) homens e mulheres têm a mesma probabilidade de apresentar a doença... determinando o desenvolvimento da resposta imunológica... então no .proteína . Assinale a alternativa que completa as lacunas de modo correto... nos últimos anos. As pesquisas realizadas revelaram que é também alto o número de casamentos consangüíneos na cidade.. c) este é um exemplo claro no qual o conhecimento elaborado pelo senso comum coincide com os conhecimentos atuais dos cientistas.RNA mensageiro b) citoplasma . não há a formação de endosperma. Elas continuam apresentando.. Outro dado interessante levantado pelos pesquisadores foi que a população da cidade acredita que a doença seja transmitida de uma geração a outra através do sangue. sem sementes.. As novas cores (amarela.

4% Ab = 2. "(. será possível obter plantas com frutos coloridos a partir do cruzamento de plantas com frutos brancos. dando formação. Um pesquisador apresentou a seus alunos o heredograma a seguir..5.1. pode-se afirmar: ( ) a doença é causada por um alelo recessivo. pode(m)-se afirmar: I . AB = 47. ( ) é um caso de polialelia com epistasia recessiva. Questão 377 O texto abaixo refere-se às questões: ** a ** Na(s) questão(ões) a seguir escreva nos parênteses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. e) apenas II e III.6% aB = 2.seqüência de nucleotídeos .As mutações responsáveis pelas cores da cereja ocorreram em vários cromossomos. b) apenas II.o anticódon.RNA transportador Questão 376 A partir das informações do texto. ( ) trata-se de um caso de herança ligada ao sexo.. ( ) a doença é causada por um alelo dominante. a uma proteína funcional. ( ) A molécula de DNA transcreve no núcleo uma molécula de RNA mensageiro (RNAm) com várias seqüências de três bases ..seqüência de aminoácidos .4% 78 1. ( ) Os diversos aminoácidos unem-se através de ligações do tipo éster. ( ) Cada códon do RNA mensageiro determinará a colocação de um aminoácido específico na cadeia polipeptídica.) mutação no gene responsável pela produção de pigmento (. pequenas moléculas de RNA transportador (RNAt). ( ) O processo de síntese de proteínas a respeito do citoplasma é também conhecido como transcrição genética. ligadas a aminoácidos.)" e "As formas mutantes (obtidas) para esse loco (... Questão 379 Analise os dados apresentados a seguir.. ( ) trata-se de um caso de herança parcialmente ligada ao sexo. c) apenas I e II. Questão 378 As proposições a seguir são relativas ao processo de síntese de proteínas nas células vivas. relativo a uma certa doença observada por ele em humanos.6% ab = 47.)". ao final da leitura do RNAm.os códons.RNA mensageiro d) núcleo . Ill . se uma planta heterozigota para esses alelos apresentar frutos com a casca roxa. que trata dos tipos e percentuais de gametas produzidos por um indivíduo de genótipo não divulgado (indivíduo parental). Esta(ão) correta(s) a) apenas I. unem-se ao RNAm por uma seqüência de três bases .proteína .4 . ( ) No local onde houver um ribossomo. Sabendo-se que os indivíduos afetados estão representados em negrito e os normais em branco.Se a coloração branca for recessiva.O alelo responsável pela "casca roxa" será considerado dominante em relação ao alelo que determina a "casca verde". II . d) apenas III.RNA mensageiro e) citoplasma .c) núcleo .

uma mistura de índios. ( ) O indivíduo parental é um heterozigoto AB/ab e. a) Z. utilizada como "mãe de aluguel". L. Retirou-se uma célula da glândula mamária da vaca W. duas cadeias polinucleotídicas paralelas e complementares entre si. "o índio". 2004). convivemos com grupos indígenas. protagonizaram a nossa história. II.. ainda hoje. W e Y não têm parentesco." O DNA presente nas mitocôndrias tem composição e estrutura típicas desse tipo de ácido nucléico. Santa Cruz do Sul: EDUNISC. Após algumas divisões. alemães. as três raças se mesclam em nossos descendentes. mãe de aluguel. o embrião foi implantado no útero de uma terceira vaca Y. uma pentose e um radical "fosfato". III. b) apenas II. uma cadeia de nucleotídeos em que as bases nitrogenadas interagem. deixaram-nos um legado que. Considerando-se que os animais Z. O núcleo foi isolado e conservado. pode-se inferir que ocorreu quiasma entre os locos "A" e "B" em 94. apenas d) Z e da W. d) apenas I e II. "Nossos ancestrais. O núcleo foi desprezado. através dos vestígios materiais encontrados nas pesquisas arqueológicas. um heterozigoto "Trans". nucleotídeos que são compostos por uma base nitrogenada. A. No entanto. apenas e) Z. anteriores aos citados. B. como os Kaingáng. A célula reconstituída foi estimulada para entrar em divisão. for a mãe biológica da vaca W. determinando uma distribuição 1:1:1:1: ( ) 5. ( ) O indivíduo parental é um heterozigoto aB/Ab. através dos pareamentos de aminoácidos.( ) Trata-se de um caso de genes de segregação independente. apenas c) Y. brancos e negros. II. e) apenas II e III.2% dos gametas são recombinantes. O embrião se desenvolveu e deu origem ao clone. foi selecionada a área temática CULTURA e as questões foram construídas com base na obra "Os Primeiros Habitantes do Rio Grande do Sul" (Custódio. um heterozigoto "Cis". formando ligações fosfo-diéster. c) apenas III. portanto é formado por I. Nosso chimarrão nos identifica em qualquer parte do mundo. desprezando-se o resto da célula. ( ) Considerando que 5. III. IV.2% dos gametas apresentam combinações alélicas diferentes daquelas existentes nos cromossomos do indivíduo parental. 79 . W e Y Questão 381 Se a vaca Y. obtendo-se um óvulo anucleado. Retirou-se um óvulo da vaca Z. Questão 380 O texto abaixo refere-se às questões: ** a ** A seqüência a seguir indica de maneira simplificada os passos seguidos por um grupo de cientistas para a clonagem de uma vaca: I. Está(ão) correta(s) a) apenas I.8% das células meióticas que originaram estes gametas. italianos e de outros povos. sabemos que outros povos. organizador. muitas vezes. Diante da relevância do contexto e da vontade de valorizar o nosso povo nativo. apenas b) W. ou seja. O núcleo da célula da glândula mamária foi introduzido no óvulo anucleado. IPHAN. portanto. pode-se afirmar que o animal resultante da clonagem tem as características genéticas da vaca. Ainda hoje. a porcentagem de genes da "mãe de aluguel" presente no clone será a) 0 % b) 25 % c) 50 % d) 75 % e) 100 % Questão 382 A história da maioria dos municípios gaúchos coincide com a chegada dos primeiros portugueses. diferencia-nos.

Considere os segmentos de DNA a seguir: rata-se de um caso de mutação por a) perda de um par de bases no DNA. d) inversão de um par de bases no DNA. Doença pode ser definida como um desequilíbrio do organismo ou ausência de bem-estar físico e mental. b) José. conseqüentemente. que é constituído por plasma e algumas células especializadas. c) Pedro. Uma mãe. onde a anemia falciforme não sofra influência de outros fatores e onde novas mutações não estejam ocorrendo. Rh®. Questão 386 O sangue. os heterozigotos (Ss) são mais resistentes à malária do que os normais (SS). EXCETO: a) A malária atua como agente seletivo. nutrientes etc. mas tem dúvidas sobre qual dos três namorados é o pai da criança: João tem tipo sangüíneo A. Rh® e Pedro é A. b) O indivíduo ss leva vantagem em relação ao SS. e) José ou Pedro. Questão 384 Verificou-se que em populações de regiões onde a malária é endêmica. e) inversão de um par de bases no DNA. sem alteração do aminoácido codificado. O indivíduo SS é normal. Rh−. tem um filho O. c) inversão de um par de bases no DNA. José tem tipo AB. sem alteração do aminoácido codificado. com alteração do aminoácido codificado. É condicionada por um alelo mutante s. d) Quando a malária for erradicada. Ela 80 . c) S tende a aumentar. O geneticista consultado informou que o pai pode ser a) João. mas não da proteína correspondente. Nesse caso são verdadeiras as afirmações a seguir.5. e) Quando a malária for erradicada. e) s tende a aumentar. b) adição de um par de bases no DNA.Questão 383 O texto abaixo refere-se às questões: ** a ** 1. Um adulto de peso médio tem cerca de 5 litros de sangue em circulação. artérias. Supondo populações africanas com incidência endêmica de malária. Questão 387 O texto abaixo refere-se às questões: ** a ** Na(s) questão(ões) a seguir escreva nos parênteses a soma dos itens corretos. Rh®. Questão 385 O esquema a seguir mostra a seqüência do DNA que leva à formação da hemoglobina normal e a que leva à formação da hemoglobina alterada.3 A anemia falciforme ou siclemia é uma doença hereditária que leva à formação de hemoglobina anormal e. d) s permanece constante.9. de hemácias que se deformam. circula pelo coração. ser heterozigoto deixará de ser vantagem. vasos e capilares transportando gases. b) S tende a diminuir. o Ss apresenta anemia atenuada e o ss geralmente morre. com alteração do aminoácido codificado e da proteína correspondente. haverá mudança na freqüência gênica da população. com tipo sangüíneo O. a freqüência do gene a) S permanece constante. c) O indivíduo Ss leva vantagem em relação ao SS. Rh−. d) João ou José. sem alteração do aminoácido codificado.

Sobre esse processo é CORRETO afirmar: (01) Os clones são como irmãos gêmeos fraternos do doador das células. (08) Doenças funcionais resultam do mau desempenho ou da perda de um órgão ou sistema. através do material genético. escreva no espaço apropriado a soma dos itens corretos. A probabilidade desta mulher ter uma criança do sexo masculino e hemofílico é igual a 1/4. (02) Doenças genéticas são aquelas causadas por alterações do patrimônio genético e podem passar de pais para filhos.pode ter inúmeras causas e variar de intensidade e manifestação. Com relação a esse tema. (32) O mongolismo é um exemplo de doença hereditária. enquanto a eritroblastose fetal é uma doença congênita. (02) a b D (04) portador apenas de B ou d. (02) Uma mulher. (08) A B D (16) a B D (32) portador apenas de D. por esse processo. terá 50% de seus filhos afetados. a ciência do melhoramento genético procura encontrar soluções que aumentem a produtividade de certas espécies. sem alelos B e D. (02) O material genético do doador das células e do clone é idêntico. independentemente do sexo. (32) Se o doador de células sofrer a perda de um membro antes de ser realizada a clonagem. Soma = ( ) Questão 388 Considerando inclusive a possibilidade de permuta genética. seu clone possuirá. Soma ( ) (04) Se o doador das células possuir um defeito genético. filha de um indivíduo hemofílico. os cientistas provocam modificações nessas espécies em busca de seus benefícios e atuam à semelhança da natureza. nascerá sem o referido membro. (08) Órgãos transplantados do clone para o doador das células serão sempre rejeitados. Leia o texto adiante e compare-o com o esquema. (64) A b D Soma ( ) Questão 389 Clones são seres vivos obtidos pelo desenvolvimento de células retiradas de indivíduos já existentes. casado com uma mulher homozigota normal. certamente será hemofílica. o gene (h) para hemofilia está localizado no cromossoma X e é recessivo em relação ao gene (h+) para coagulação normal do sangue. um indivíduo portador do genótipo ABD//abD poderá produzir os seguintes gametas: (01) Portador apenas de A ou a. Com base nesta informação. (16) Doenças transmissíveis são as transmitidas por patógenos ou por seus produtos. também. em humanos. terá todos os seus filhos normais. o organismo originado posteriormente. usando técnicas sofisticadas. (16) Já existem seres humanos que foram originados e desenvolvidos plenamente por clonagem. Questão 391 Em parte motivada pela necessidade mundial de aumentar a produção de alimentos. Soma ( ) Questão 390 O texto abaixo refere-se às questões: ** a ** Na(s) questão(ões) adiante. independentemente do sexo. A clonagem é um processo que vem sendo desenvolvido rapidamente com vários organismos e. etc. casado com uma mulher homozigota normal. é correto afirmar: (01) Um homem hemofílico. Muitas vezes. 81 . encontra barreiras de ordem ética. (04) Doenças traumáticas são aquelas que se originam de acidentes. No homem. o tabagismo e a dependência de outras drogas são exemplos de causas que podem resultar em doenças. (08) Um homem hemofílico teve uma filha normal. como o albinismo. sem alelos A e D. sem alelos A e B. podendo resultar em fratura de ossos. hemorragias. é CORRETO afirmar: (01) O alcoolismo. (04) Um homem hemofílico. essa anomalia.

ou morte celular espontânea. constata que a criança possui ausência de enzimas oxidases em uma das organelas celulares. 1/4. Essa proteína." (Veja. e) Aa x Aa. em um tipo de organela de suas células. pois a criança não possui. Abaixo está transcrito um pequeno trecho de uma recente entrevista. após alguns exames. escolheram e reproduziram aquelas cujas plantas apresentassem a capacidade de produzir uma proteína inseticida. 1/8. a produtividade das lavouras será bem maior. escolheram e reproduziram aquelas cujas plantas apresentassem a capacidade de produzir uma proteína inseticida" está relacionada aos itens 4 e 5 do esquema. que liderou uma pesquisa genética sobre a composição étnica do povo brasileiro. ao se colocar H‚O‚ em ferimentos. Entre S/G‚ algumas proteínas checam possíveis falhas e erros na linha de produção. 1/8. Livre dos mesmos. é monogênica com herança autossômica recessiva. Portanto. O geneticista clínico explica aos pais que a criança tem uma doença de origem genética. decidem se o ciclo celular avança ou é paralisado iniciando um processo de destruição do material genético. Os cientistas alteraram o código genético dessas sementes e. e proteínas especiais controlam a evolução do ciclo celular das novas células. da Universidade Federal de Minas Gerais. a produtividade das lavouras será bem maior" refere-se ao item 6 do esquema. a inativação de qualquer um dos componentes ou operadores do sistema de checagem ou de apoptose poderia provocar a proliferação contínua das células e possível desenvolvimento de tumores cancerosos. é encaminhada pelo pediatra a um geneticista clínico. Soma = ( ) O ciclo celular é interrompido entre as fases G/S e G‚/mitose. nos testes experimentais.2 (01) A afirmativa "Os cientistas alteraram o código genético dessas sementes" está relacionada somente ao item 1 do esquema. GALILEU: "É correta a noção de que a maior parte dos 82 . 1/4. (04) A afirmativa "nos testes experimentais. c) Aa x Aa. 1/2. com acentuado atraso psicomotor.15. (16) A afirmativa "Livre dos mesmos. é correto afirmar: Questão 392 Uma criança de aproximadamente 1 ano. conhecido como APOPTOSE. 2 e 4 do esquema. as enzimas que deveriam proteger contra a ação dos radicais livres. 21/02/1996) Da comparação entre o texto e o esquema. concedida à Revista Galileu pelo cientista Sérgio Danilo Pena."Nos próximos meses chegam às lavouras dos Estados Unidos e Canadá sementes de milho. (08) A afirmativa "nos testes experimentais. (02) A afirmativa "Os cientistas alteraram o código genético dessas sementes" está relacionada aos itens 1. No caso dessa criança. Qual é o genótipo dos pais da criança descrita no texto e qual a probabilidade de o casal ter outro filho com essa mesma doença? a) AA x aa. b) Aa x aa. matava os insetos que atacavam as plantações. quando ingerida com as folhas. Esse problema pode ser evidenciado no dia-a-dia. escolheram e reproduziram aquelas cujas plantas apresentassem a capacidade de produzir uma proteína inseticida" está relacionada aos itens 3 e 4 do esquema.5. para destruir as pragas que atacam essas culturas. Diz também que a doença é muito grave. Este. Um exemplo observável das conseqüências de apoptoses é o descamar da pele após sua exposição prolongada a radiação solar intensa. a H‚O‚ "não ferve". d) Aa x aa. batata e algodão alteradas geneticamente em laboratório. Questão 393 1.

Dona Benta (permito-me eu). Em "Emília no país da Gramática". Já depois de ler a "Aritmética da Emília". Emília é uma abelhuda crítica e irreverente. as experiências realizadas por Emília e pelo Visconde geram monstros: ¢alteram o funcionamento de "Dona Pituitária" em insetos. Benta uma verdadeira manifestação ecológica: ". Nesse mesmo livro. opinar sem ser pretensioso. e se está no ponto em que está. num período especialmente sombrio da história do nosso país e trágico da história universal. inesquecíveis companheiras de aventuras por vários tempos e espaços. nas expressões. qualquer um admirará a facilidade com que se explica a formação e as propriedades do vidro. do carvão. proporções e propriedades. que incluía a exploração estatal do "ouro negro" (como também a do ferro)." A resposta do geneticista aliada aos seus conhecimentos permite afirmar. Questão 394 Instruções: Leia atentamente o texto adiante para responder às questões a seguir. passariam a citar de boca cheia. passando pelo uso do fogo. em 1941. existem mil razões para isso. MONTEIRO LOBATO (1882-1947) 1. EXCETO: a) O DNA do cromossomo Y e das mitocôndrias apresenta genes que determinam a cor da pele humana. pelas revoluções do século XVIII. de formação e de classes de palavras. Quanto da história e da mitologia grega não se aprende ao lado da boneca Emília. do petróleo. que assim adquirem novas formas. b) O DNA mitocondrial é de origem materna. aparecem logo muitas conseqüências £que não previmos.. há esta frase da boneca que muito lingüista moderno poderia adotar como lema. vai-se da origem do universo (sabiamente explicada pela vovó Benta como hipótese). o jovem leitor lamentará que Lobato não tenha entrado na Álgebra e na Geometria. reformar a natureza! Quem somos nós para corrigir qualquer coisa que existe? E quando reformamos qualquer coisa. espantando os vizinhos e provocando em D. até à chamada "era dos milagres". Emília. seu "Hans Staden" 83 . Quanto ao petróleo.. Sempre foi intenção de Lobato ensinar sem ser chato.brasileiros tem algum antepassado com pai branco europeu e mãe negra ou índia ?" PENA: "É.Mas que absurdo. 3. que tagarela pedantemente com Péricles ou com Hércules? Na "História do mundo para as crianças".para que o escritor lhe apresentasse alguns dos "bichos de sete cabeças" da Matemática com a mesma graça e eficácia com que iniciara os meninotes nas frações e nos números complexos. pelo império romano.. das roldanas. que termina com esta frase da vovó sabida: "O tempo.. o homem continua brincando. e às vezes sem confessar. Tudo quanto existe levou milhões de anos a formar-se. e seus brinquedos são cada vez mais fantásticos e perigosos. onde não faltam lições de fonética. Em "O poço do Visconde". Benta acerca da clonagem e dos transgênicos? 4. fazendo coro com os alunos: ". telefone. epílogo também do livro. pelos assírios e babilônios. jorra o precioso óleo em pleno sítio.. nas equações de todos os graus. As adaptações que faz Lobato de obras ficcionais ou a recuperação de fatos históricos são também notáveis: seu "D.Que peste é a tal Gramática!". Meu cromossomo Y é europeu e meu DNA mitocondrial é ameríndio. pelos tempos da cavalaria. nas seqüências e nas funções . quando marmanjos. 2. uma porção de coisas que aprenderam com as personagens do Sítio do Picapau Amarelo.. d) Pelo estudo acima. não custa lembrar que a campanha nacionalista de Lobato..que é ser muito criança ainda". e não falta a chegada do técnico norte-americano para tentar tomar conta da situação e acabar escorraçado pelos indignados habitantes. Também um iniciante na Física não pode se queixar. Em "A reforma da natureza". lendo a "História das invenções": são sugestivas as explicações sobre a operação das alavancas (que permitiu ao homem a construção das pirâmides). Meu caso é exatamente esse. a adaptar-se. dos guindastes. As obras "infantis" de Monteiro Lobato ajudaram muito na formação de milhares de pequenos brasileiros que. Quixote" é alegre e comovente. cinema . só o tempo pode curar o grande defeito da humanidade . dos moinhos. que é como Lobato batizou a vida com luz elétrica." Que diria hoje D. das dragas (com as quais se escavou o Canal do Panamá). Se Dona Benta é uma velha de óculos e muita leitura. c) O cromossomo Y apresenta genes exclusivamente paternos. pelos hieróglifos. custou-lhe seis meses de cadeia. somente o genoma de indivíduos do sexo masculino pode ser utilizado para a determinação da ancestralidade paterna.e com o manejo atômico que deu na tragédia de Hiroshima..

Bolívar e Lincoln." (Traduzido e adaptado de: William R. Um exemplo delas constitui a matéria publicada recentemente em um jornal. Esta. Sem isso. e) clonado útil para a erradicação da leishmaniose. forjado no caldeirão de raças e culturas de que procedemos. ou morte programada das células. humor e vivacidade crítica . contradição nossa até hoje.combinação que. da difusão de novas seitas. a célula começa a destruir todo o DNA de seu núcleo. Soube admirar tanto a mangueira frondosa quanto a técnica fecunda. III. o quanto ela tem de orgânico. O que espanta nessa pluralidade é que nada surge como aleatório. . 84 . inédito) Que diria hoje "D. sem concessões à famigerada "literatura infantil"). Logo que essas instruções sejam recebidas e processadas. incluindo sua própria morte. dizem alguns. Os termos a seguir fazem parte da nomenclatura genética básica. uma célula da camada germinativa da epiderme. SEX AND THE ORIGINS OF DEATH. 7. Lobato parece ter querido reunir a beleza natural do primitivo ao encantamento pelo enciclopédico. Clark. tudo parece fazer parte de uma didática natural. cada aspecto da vida de nossas células é regulado por seu DNA. 1996. (02) GENÓTIPO é a constituição genética de um indivíduo. foi o que deu a vitória aos ingleses. Se num livro o autor se referia. referem-se à morte da célula. Se nada mais sobrasse da obra de Lobato. provavelmente estaria batalhando pelo desenvolvimento sustentável. nem falta a apresentação de personagens como Marco Polo. Assinale as alternativas que trazem o significado correto de cada um desses termos: (01) GENE é sinônimo de molécula de DNA. por exemplo à máquina a vapor. New York: Oxford University Press. Esse exemplo refere-se à construção de um organismo a) transgênico útil para a erradicação da malária. está fadada a morrer. A apoptose. Sempre haverá a curiosidade nossa de saber o que Emília pensaria hoje da globalização. se vivesse nos dias de hoje. apesar de poder continuar exercendo determinadas funções durante certo tempo. dos conflitos religiosos. 32-5) Considere os seguintes fatos: I. resume algo de nosso "temperamento".. uma célula morta pelas toxinas produzidas por bactérias invasoras. "mais o ferro. reuniu a seu modo as realidades de um país ainda arcaico e já moderno. p. enviadas ao citoplasma. De certa forma. (04) DOMINANTE é um dos membros de um par de alelos que se manifesta inibindo a expressão do outro. dispondo-se a dali falar de tudo e a contar qualquer história (numa linguagem ao mesmo tempo exata. c) transgênico útil para a erradicação da leishmaniose. 5. II. segundo a qual cientistas ingleses estão conseguindo transferir certos genes de bactérias para mosquitos anofelinos. a Inglaterra seria um quase nada. que morre e sofre queratinização. O leitor que percorra essa obra notará. proveitosa e sempre polemizada pela palpiteira Emília. como o fora antes da invenção de Watt". As últimas instruções do DNA. partindo-o em milhares de pedaços que não mais conseguem enviar instruções úteis à célula. b) transgênico útil para a erradicação da esquistossomose. em outro esse invento vem associado ao carvão-de-pedra que. 6. (Eurípides de Souza e Passos. em muitos pontos.introduz o leitor num capítulo importante de nossa história colonial. Estes genes teriam a capacidade de impedir a instalação de determinadas fases do protozoário 'Plasmodium' no estômago e nas glândulas salivares do mosquito. Questão 395 "Virtualmente. imaginativa e fluente. é verificada SOMENTE em a) I b) II c) III d) I e II e) I e III Questão 396 Na(s) questão(ões) a seguir escreva no espaço apropriado a soma dos itens corretos. processo este decididamente irreversível. conhecido por suas frases lapidares. das ações terroristas.. essa vivíssima boneca de pano expressaria sempre um fundamento de malandragem. Ao instalar suas criaturas numa base rural. d) clonado útil para a erradicação da malária. Benta" acerca da "clonagem" e dos "transgênicos"? Atualmente ela teria notícias freqüentes sobre técnicas de manipulação do DNA. uma célula do miocárdio morta por falta de oxigênio durante um ataque cardíaco.

entro na Internet. Brutus?".. misturava povos e séculos com grande facilidade.(08) FENÓTIPO é a expressão do gene em determinado ambiente. "vim. do meu canteirinho de temperos ou da safra nacional de grãos. a que vem ao caso: folheto ou livro que. Já ouvi a expressão "cultura de almanaque". pelo qual já se entrevia uma América (como os EUA gostam de se chamar) com ares de dona do mundo. Eu não trocaria três exemplares do almanaque de um certo biotônico pela coleção completa das SELEÇÕES. (16) GENOMA é o conjunto de todos os alelos de um indivíduo.entre o sentimento da melancolia e o funcionamento do fígado. Meu professor de Ciências fechou a cara quando lhe perguntei se era hábito de Arquimedes tomar banho na banheira brincando com bichinhos que bóiam. de circulação regular e internacional. 5. O "buscador" da HOME PAGE é uma espécie de oráculo de Delfos de efeito 85 . o humor era bem-comportado. e se nunca os fiz subir ou rodar era porque meu controle motor já não dava inveja a ninguém. todas as portas do mundo: posso falar da minha rua ou de Bagdad. Sim. palavras cruzadas. da reunião do meu condomínio ou da assembléia da ONU. e lá estava. horóscopo. recordes mundiais.READER'S DIGEST . se viesse a cair dentro de uma. esse almanaque multidisciplinaríssimo de última geração. dita em tom pejorativo. Almanaque não se emprestava a ninguém: ao contrário de um bumerangue. Como explicar ao meu leitor mais jovem o que é (ou o que era) um ALMANAQUE? Vamos ao dicionário. O leitor não faz idéia do que cabia nesse etc. Agora sou autor do meu próprio almanaque."o fogo de constelações extintas há milênios" . enigmas policiais. Não tinha o charme dos almanaques: levava-se muito a sério. Soma ( ) Questão 397 Cultura dos almanaques 1. por exemplo. que eu achei familiar quando a li pintada no pára-choque de um fordinho com chapa 1932 (relíquia de um paulista orgulhoso?). do fracasso de Napoleão em Waterloo.é também uma constatação da astrofísica. 4. ou a história de expressões como "vitória de Pirro".pasme. leitor . Um bom leitor de almanaque explica como uma bela expressão de Manuel Bandeira . a relação que Pitágoras encontrou não apenas entre catetos e hipotenusa. das angústias de Colombo em alto mar. anedotas. da guilhotina francesa. mas ainda hoje me valho das informações de almanaque para explicar. poesias. as matérias tinham um tom meio autoritário e moralista. caricaturas. Lá está. Não tinha a galhofa. vi e venci" e "até tu. traz diversas indicações úteis. Um outro ensinava a fazer balão e pipa. Em compensação. Talvez não seja inútil conhecer as dimensões das três pirâmides. astúcias da matemática. porque despertavam a classe sonolenta. a separar as chamadas áreas do conhecimento. E alguns professores sempre implicavam quando eu os contestava ou argüía. 2. provérbios. 6. Deixei de lado os almanaques e entrei no funil apertado das tendências vocacionais. trechos literários. mas . Adolescente. receitas caseiras. Com o tempo. Pouco depois dos almanaques vim a conhecer as SELEÇÕES .. o curso e o regime do rio São Francisco. curiosidades etc. a manejar um pião. Lembro-me de um exemplar que falava com tanta expressão da guerra fria e de espionagem que me proporcionou um prazer equivalente ao das boas páginas de ficção. as SELEÇÕES talvez tenham sido o principal meio de difusão do AMERICAN WAY OF LIFE. 3. Algum risco sempre havia: não foi boa idéia tentar fazer algumas experiências químicas com produtos caseiros. fazia prodígios com ímãs e saberia perfeitamente reconhecer uma voçoroca. o descompromisso macunaímico dos nossos almanaques em papel ordinário. Tirando Hollywood. aprendi a me especializar nas disciplinas curriculares. Pense em algo publicável.: charadas.uma espécie de almanaque de luxo. dicas de viagem. conhecia todas as propriedades de uma carnaubeira. E me arrepiava a descrição do ataque à base naval de Pearl Harbor. além do calendário do ano. entre outras acepções. Acho injusto. a concretização editorial do SLOGAN famoso: TIME IS MONEY. de novo. descobri este emprego de cronista que me abre. Pegadinhas do tipo "quais são os números que têm relações de parentesco?" ou questões como "por que uma mosca não se esborracha no vidro dentro de um carro em alta velocidade?" não eram bem-vindas. Se fico sem assunto. nunca voltaria para o dono. com base no almanaque. move-se!". e minha professora de História fingiu que não me ouviu quando lhe perguntei de quem era mesmo a frase "E no entanto. da queda de Ícaro.

aumentar as taxas de mutação em todos os seres vivos. como o benzeno. o sentido de outro SLOGAN prestigiado. Questão 399 O texto abaixo refere-se às questões: ** a ** Ação à distância. Hiroshima. no caso deles).2 milhões de toneladas na safra 2002/03.contaminantes biológicos. Mas a linha de 86 . podendo acarretar o fim da espécie convencional.impedir o funcionamento dos ácidos nucléicos. no Brasil. Foram necessários milhares de anos para passar do barco a remo à caravela ou da energia eólica ao motor de explosão. deve I . II e III. e em algumas décadas se passou do dirigível ao avião. Assinale a alternativa que contém argumentos favoráveis à produção. O custo dessa aceleração da descoberta é a hiperespecialização. de alimentos geneticamente modificados. especialmente durante a transcrição e a tradução.Paulo" de 23/09/03. que podem transformar as águas em fontes de transmissão de doenças. o que significa uma elevação de 19% em comparação à colheita anterior. é assustadora. se globalizou pra valer: meus filhos já aprenderam. O equivalente tecnológico da separação dos saberes foi a linha de montagem. e) I. não apenas no homem. e) O desenvolvimento desta tecnologia poderá aumentar a produtividade em relação à tradicional. podem interferir no funcionamento dos seres vivos. Nesta. NO PAIN. O benzeno. . da hélice ao turborreator e daí ao foguete interplanetário. Segundo a "Folha de S.compostos orgânicos que. mas não possui mais o saber que lhe permitiria dar-se conta de que seu produto irá provocar um buraco na camada de ozônio. III . que podem ser exemplificados pelos esteróides. Em algumas dezenas de anos. Questão 398 A qualidade da água pode ser alterada por vários fatores: .. Um excelente químico pode imaginar um excelente desodorante. como podeis ver. Se eu fosse um nostálgico. Está(ão) correta(s) a) apenas I. comunicação.quase instantâneo. tanto mais fácil submeter a ciência aos cálculos do poder. mesmo em baixas concentrações. NO GAIN (ou GAME. enfim. assistiu-se ao triunfo das teorias revolucionárias de Einstein e a seu questionamento. Parte dessa safra refere-se à produção da soja. diria que. c) apenas III. cada um conhece apenas uma fase do trabalho. Esse fenômeno está intimamente ligado ao fato de ter sido neste século que os homens colocaram mais diretamente em questão a sobrevivência do planeta. (Argemiro Fonseca) A produção brasileira de grãos ultrapassou 115.e isso ocorre com freqüência. b) apenas II. os velhos almanaques me deixaram saudades. triunfo das massas. Mas o horror desses acontecimentos não reside apenas na quantidade. por alterar a seqüência de nucleotídeos do DNA.permitir o surgimento de novos alelos. Privado da satisfação de ver o produto acabado.5 milhões de toneladas. o que representaria uma vantagem comercial ao país que os proíbe. E o inglês. linha de montagem. que é um agente mutagênico. na prática. Holocausto: através das metáforas e das realidades que marcaram esses cem últimos anos. Não é um balanço tranqüilizador. c) Pode haver cruzamento entre a cultura convencional e a geneticamente modificada. velocidade. d) apenas I e II. por ser mutagênico. de 96. b) O mercado europeu é resistente a este tipo de alimento. certamente. a) Há muitas dúvidas sobre eventuais danos à saúde do consumidor provocados pelas alterações genéticas nos alimentos. Mas não sou. cada um é também liberado de qualquer responsabilidade. aparece a verdadeira doença do progresso. O século que chega ao fim é o que presenciou o Holocausto. cerca de 8% da produção nacional da soja é biologicamente adulterada. Estamos em via de viver a tragédia dos saberes separados: quanto mais os separamos. os massacres do Camboja e assim por diante. II . os regimes dos Grandes Irmãos e dos Pequenos Pais. apesar de todo esse avanço. Poderia produzir venenos sem que o soubesse .. que. e os hormônios humanos. d) Pode haver efeitos sobre várias espécies de insetos protetores da flora e de polinizadores. que se operou e continua a se operar em ritmos antes inconcebíveis. Nosso século é o da aceleração tecnológica e científica.

morte. vida mais longa. Aperta-se um botão e um país inteiro explode. que podia ser reduzida. ao passo que os resíduos (inclusive os radioativos) nascem do bem-estar que ninguém quer mais perder. tecnologia. e) reforço do sistema imunológico. devolveram essa energia para o ambiente. realizando cada qual um gesto que nada tinha de aterrador. num regime de separação dos saberes. onde foi abandonada uma cápsula contendo pó de Césio-137 e que foi aberta por pessoas desavisadas. mas o sistema do computador não tem defesa diante da má intenção de um garoto precoce. Sem essa aceleração. III e IV Questão 400 Apesar da "aceleração tecnológica e científica de nosso século" nem todos os problemas puderam ser solucionados. afinal restrito. 87 . VEJA. Para tais conseqüências. de pessoas responsáveis e de executantes diretos (sádicos e loucos). É bom que tudo se tenha resolvido no espaço de trinta anos. Hoje. tecnologicamente eficaz e buscou o consenso servindo-se das comunicações de massa e do prestígio da ciência. O Holocausto foi possível porque se podia aceitá-lo e justificá-lo sem ver seus resultados. mas irresponsabiliza o crime.montagem permite também fabricar aspirina em quantidade para o mundo todo. Poderíamos destruir o planeta num dia. estão corretas SOMENTE a) I e II b) I e III c) II e IV d) I. b) choque anafilático. mas não o de eliminar os resíduos. como a Grande Muralha da China. O século do triunfo tecnológico foi também o da descoberta da fragilidade. comunicação. o Muro de Berlim poderia ter durado milênios. Um exemplo ocorreu em 1987. este século soube fazer do melhor de si o pior de si. Nosso século foi o da comunicação instantânea. d) embolia. III . esquecimento. tempo. absolvição. A perseguição racial e o genocídio não foram uma invenção de nosso século. Encontramos o meio de eliminar a sujeira. crime. Porque a sujeira nascia da indigência.As emissões radioativas introduziram energia nas células. ação à distância. A ação à distância salva numerosas vidas. o fato de certas pessoas. Tudo o que aconteceu de terrível a seguir não foi se não repetição. especialmente por um grande número desses insetos. E rápido. Rápida Utopia. indignação. informação.. A um ritmo de STRESS. o químico que aplicava os gases asfixiantes não julgava necessário ter opiniões sobre a antropologia física. Reflexões para o futuro. Aperta-se um botão e um foguete é lançado a Marte.As células reagiram e. presenciou o triunfo da ação à distância. Espaço. desconhecido dos séculos anteriores. IV . Mas o que torna tão terrível o genocídio nazista é que foi rápido. Ciência. O século está estressado porque não sabe de quem se deve defender. Assim. deram-se as seguintes explicações: I . princípio da linha de montagem: tudo isso tornou possível o Holocausto. Se forem novamente picadas. nem como: somos demasiado poderosos para poder evitar nossos inimigos. São Paulo. (Adaptado de Umberto Eco. mas pagamos o preço dessa rapidez. castigo. 1993). como por exemplo. Além de um número. Nosso século é o do enfarte. II e III e) II. aperta-se um botão e entra-se em comunicação com Pequim. descoberta. Um moinho de vento podia ser reparado. sob a forma de calor.A energia provocou alterações nos compostos químicos das células.As células humanas estão adaptadas a receber energia com os comprimentos de onda do Césio-137. 25 anos. Eis porque nosso século foi o da angústia e da utopia de curá-la. Foi fácil fazer passar por ciência uma teoria pseudocientífica porque. em Goiânia. que sofreram graves danos em conseqüência desse ato. quando picadas por abelhas. tudo em altíssima velocidade. arrependimento. elas poderão apresentar uma reação denominada a) hemólise.. II . milhões de outros puderam colaborar à distância. herdamos do passado o hábito de brandir a ameaça de um complô judeu para desviar o descontentamento dos explorados. No texto. c) choque térmico. apresentarem uma reação alérgica à toxina desses animais. crítica. Tudo se passa num ritmo acelerado. o autor menciona que não conseguimos eliminar os resíduos radioativos do ambiente. sem grande inovação. nascimento. Dessas explicações.

da mãe.Rr.rr.2003.Rr.Rr. c) não se trata de uma questão que envolva biotecnologia e bioética.Rr. depois de selecionado. uma vez que na concepção de Jamie foram empregadas técnicas de fertilização in vitro. Ela o informou de que já era sua terceira gestação. b) Pai .rr. Folha de S. Mãe .Rr. MAIS! 29. uma vez que o embrião. o professor esquematizou o processo de síntese protéica. Questão 404 Aproveitando a pergunta de Zeca. professor Astrogildo perguntou-lhe se seria seu primeiro filho. Nessa situação. Mãe . Ciência em Dia. Algumas das questões propostas por professor Astrogildo estão apresentadas a seguir para que você responda. é implantado no útero materno. d) Pai . 2Ž Filho .Rr.rr. os genótipos do pai das crianças. onde. "Já está na hora de voltar. Paulo. Questão 403 Quando a garçonete se aproximou. 2Ž Filho . c) a calvície é uma característica genética cuja herança é ligada ao sexo. Como foi concebido por técnicas de fertilização "in vitro". podemos afirmar que: a) ao fazer referência à técnica de fertilização in vitro e de escolha de genótipos de seres humanos. 1Ž Filho . M.5. 2Ž Filho . na segunda. O irmão de Jamie se chama Charlie e sofre de uma forma rara de anemia causada por anomalia genética. pois as técnicas de fertilização in vitrojá são de total domínio e amplamente utilizadas pelos especialistas na área de reprodução humana. Durante o trajeto.RR.Rr. embora envolva questões de biotecnologia. II. d) a mulher só será careca se tiver os dois alelos recessivos. de fato. Na primeira. pois não envolve escolha de genótipo de seres humanos. o seu filho nasceu normal e.Rr.06. Mãe . professor Astrogildo ia propondo desafios a partir das situações do dia-a-dia vivenciadas ao longo do passeio. b) a expressão do gene depende da presença de hormônios masculinos. 1. do primeiro e do segundo filhos seriam: a) Pai . Jamie é o que já está sendo chamado de "irmão salvador" pelos tablóides (jornais populares) do Reino Unido. nada tem a ver com aspectos de bioética. o texto nos coloca diante de situações concretas de biotecnologia e de bioética..Rr. c) Pai . Mãe .3 88 . III e IV representam moléculas de ácidos nucléicos. 1Ž Filho ..Questão 401 Jamie Whitaker mal nasceu e já se tornou celebridade. por que não se vê mulher careca?" O professor respondeu que a ocorrência de calvície em mulheres era muito rara. 2Ž Filho . Isso ocorre porque a) o gene responsável pela calvície está no cromossomo Y. d) o caso relatado não envolve problemas de bioética. Vamos!" A turma entrou muito animada no ônibus e Ariosvaldo percebeu que o motorista era calvo.rr. 1Ž Filho .RR. uma criança gerada para fornecer tecidos vivos para tentar salvar a vida de outro filho de seus pais. se dá o desenvolvimento do feto. 1Ž Filho . b) o fato relatado. Ariosvaldo refletiu e perguntou: "Professor.8. com a intenção de mostrar os efeitos ambientais produzidos por aquela atividade. Questão 402 O texto abaixo refere-se às questões: ** a ** Professor Astrogildo combinou com seus alunos visitar uma região onde ocorria extração de minério a céu aberto. (Leite.. uma forma de confirmar sua compatibilidade com as de Charlie.) Em relação ao texto. e) não se pode associar a fertilização "in vitro" com biotecnologia ou com bioética.. O motorista está buzinando.Rr. a criança teve eritroblastose fetal. em que os números I. Jamie pôde ter suas células testadas no útero.

(zero) machos b) 1000 fêmeas. nos machos. e) da cor marrom ou pérola. se forem machos. pérola (20%). as cinco cores serão possíveis. se forem fêmeas. b) II corresponde ao RNA que catalisa a união do I com o III. 250 machos d) 625 fêmeas. b) cromossomos não têm o gene da insulina. i ). a) 1250 fêmeas. Essa rainha produziu.partir do esquema. em um dia. Assinale a alternativa da tabela que indica corretamente o número esperado de descendentes dessa rainha. (zero) machos c) 1000 fêmeas. 500 machos Questão 407 Os descendentes dessa rainha terão olhos a) somente da cor marrom. onde também encontramos os genes que determinam os grupos sangüíneos ABO ( IÞ. b) O somente das cores marrom ou pérola. se forem machos. e. 1. Questão 405 Zeca perguntou: "Professor. entre os quais há a seguinte relação de dominância: a¢ > a£ > a¤ > a¥ >a a¢ : marrom a£ : pérola a¤ : neve a¥ : creme a : amarelo Uma rainha de olhos marrons. O heredograma a seguir foi montado para se estudar a disfunção em uma determinada família. O gene determinante dessa disfunção está localizado no cromossomo 9. Questão 406 O texto abaixo refere-se às questões: ** a ** Em uma espécie de abelha. 625 machos e) 500 fêmeas. da cor pérola. d) da cor marrom ou pérola. 1 250 gametas dos quais 80% foram fecundados. Os indivíduos afetados apresentam a cor da urina vermelho pardacenta devido a uma alteração no metabolismo normal da fenilalanina. c) III corresponde ao RNA que contém o anticódon complementar ao códon existente em I. Questão 408 O texto abaixo refere-se às questões: ** a ** A alcaptunúria é uma disfunção extremamente rara do metabolismo humano. heterozigótica para pérola. c) gene da insulina está inativo. foi inseminada por espermatozóides provenientes de machos com olhos das cores marrom (20%). Iß. por que as células alfa desse mesmo órgão não assumem esta função?" A síntese da insulina não ocorre nas células alfa porque o(s) a) gene da insulina está defeituoso. durante o processo de transcrição. a cor dos olhos é condicionada por uma série de cinco alelos. para a qual o tipo sangüíneo de cada um dos membros está indicado. as cinco cores serão possíveis. é correto afirmar que a) I corresponde ao RNA que contém o código genético determinando a seqüência de aminoácidos da proteína. e. neve (20%). d) cromossomo com o gene da insulina não está presente. Todos os gametas produzidos resultaram em descendentes.5. creme (20%) e amarelo (20%).6 89 . já que as células beta do pâncreas de um diabético não são capazes de sintetizar insulina. nas fêmeas. c) da cor marrom se forem fêmeas. d) IV corresponde ao RNA que catalisa a ligação dos nucleotídeos com a desoxirribose.

d) 50% B normais ou afetados. pode-se afirmar: (01) A subordinação aos princípios mendelianos reduz a variabilidade nas espécies que se reproduzem sexuadamente. que violam princípios sociais e admitem conceitos biológicos errôneos. Questão 410 O texto abaixo refere-se às questões: ** a ** Na(s) questão(ões) a seguir escreva nos parênteses a soma dos itens corretos. enquanto a outra metade produz plantas que permanecem constantes e recebem os caracteres dominantes e recessivos em partes iguais. p. exemplificadas nos textos.. (16) O trabalho de Darwin afirma a constância genética do mundo biológico. Questão 409 (Darwin. Soma ( ) 1. os mais fortes. que se ocupa do aperfeiçoamento físico e mental da espécie humana. (.. se sustenta em premissas incorretas. EXCETO: a) A alcaptonúria é um caráter determinado por gene autossômico recessivo. c) 50% de afetados. 1117) Em relação às idéias de Darwin e de Mendel. há uma freqüente luta pela existência. b) O indivíduo 3 pode ter recebido um gameta recombinante de sua mãe.) os determinantes (.. formam sementes das quais a metade novamente desenvolve a forma híbrida. p. 2 . (32) Variações referidas por Darwin transmitem-se à descendência segundo o padrão mendeliano de herança. conseqüentemente. (Mendel. 30) Considerando-se os princípios biológicos que regem a herança. em diferentes ambientes.5% AB normais. de ser "naturalmente selecionado". selecionam-se. esperada em F2. perigosamente em alta em países desenvolvidos da Europa. lutam entre si.nalisando-se o heredograma. segue-se que qualquer organismo que varia de modo proveitoso para si próprio. eliminando-se com o glóbulo polar os mais fracos. (02) A herança de um caráter é determinada pela fusão dos fatores condicionantes na descendência. (08) A seleção natural pode preservar características diferentes. TEXTO I: Como muito mais organismos de cada espécie nascem do que provavelmente sobrevivem e como. apud FREIRE-MAIA. d) A chance de o indivíduo 9 ser heterozigoto para o caráter alcaptonúria é de 2/3. e persistindo nos pronúcleos resultantes os mais aptos. pode-se dizer: (01) As "plantas que permanecem constantes" ao longo das gerações são homozigotas. terá uma melhor oportunidade de sobrevivência e. (04) A citação de Mendel expressa a proporção genotípica 1:2:1. como na citação: "Os cromossomos. EXCETO: a) 22.6 posição ocupada pelos alelos que determinam grupo sangüíneo e alcapatonúria. no par de cromossomos 9.5. A freqüência de recombinação entre os dois loci gênicos é de 10%. está representada para o indivíduo 7 ao lado do heredograma. Questão 411 A idéia da eugenia. São freqüências esperadas de descendentes para o cruzamento 6 X 7. p.traduzido) TEXTO II: Os híbridos. de cada par de caracteres diferenciais..) se entrechocam. os inferiores. sob condições de vida complexas e algumas vezes variáveis. apud DARNELL. 90 ." (Kehl apud BIZZO. b) 45% de A normais. é possível afirmar. c) O indivíduo 6 certamente não recebeu um gameta recombinante da sua mãe ou do seu pai. assim.

(32) Alterações do fenótipo. ( ) Cariótipo é o conjunto de informações sobre os cromossomos de uma determinada espécie. 91 . julgue os itens. A elucidação de crimes. apresentam. Alguns desses pacientes também desenvolvem anormalidades neurológicas. exercem importante papel na sociedade atual. engenharia. Estudos genéticos em células de organismos afetados revelam a existência de defeitos no sistema enzimático responsável pelo reparo de moléculas de DNA danificadas pela exposição a agentes mutagênicos. como também a identificação da paternidade. (04) O efeito de um determinado gene depende do ambiente em que ele é expresso. hidrologia. que permitem a sobrevivência das espécies. Soma ( ) Questão 413 Os radioisótopos. (64) As repercussões da eugenia em populações humanas descartam sua aplicação para qualquer fim. ou como fontes de radiações. antropologia e à pesquisa acadêmica em diversas áreas do conhecimento. (64) A precisão dos sistemas de reparo do DNA inviabiliza Na(s) questão(ões) a seguir julgue os itens e escreva nos parênteses (V) se for verdadeiro ou (F) se for falso. Soma ( ) o processo evolutivo.(02) A segregação dos cromossomos homólogos. O temor da população em relação aos radioisótopos relaciona-se à capacidade desses elementos produzirem mutações nos seres vivos. ( ) Na espécie humana distinguem-se 3 tipos sangüíneos. p. em células epidérmicas. principalmente na face.adaptação) Uma análise da situação apresentada anteriormente permite afirmar: (01) Agentes mutagênicos incluem fatores físicos que alteram a estrutura da molécula de DNA. Questão 414 Questão 412 Indivíduos portadores da doença "xeroderma pigmentosum". extrema sensibilidade à luz solar. repercutem além dela. seja por atuarem como traçadores radioativos. vêm sendo efetuadas com certa facilidade e segurança através do uso de técnicas apropriadas. d) são responsáveis por extinções em massa. 307-8 . é aleatória. como a dos trilobitas. c) permitem a origem de novas espécies cada vez melhor adaptadas. (32) A ocorrência de alterações em células nervosas e em células epidérmicas pode estar relacionada à sua origem embriológica comum. ( ) Genes alelos são genes que ocupam o mesmo "locus" gênico em cromossomos homólogos. e) são o único processo evolutivo agindo atualmente no homem. (02) A falha em mecanismos celulares que preservam a fidelidade da mensagem genética predispõe ao câncer. No entanto. adquiridas por indivíduos de uma geração. atingindo sua prole. Sobre esses conceitos. (08) Os fatores genéticos se misturam e se diluem ao longo das gerações. (16) Os genes que condicionam o "xeroderma pigmentosum" são característicos de células epidérmicas. (16) A aplicação de princípios eugênicos comprometeria a sobrevivência da espécie humana. (GARDNER. indústria. apesar de temidos pela população que os associa a acidentes nucleares e danos ambientais. as mutações ocorrem naturalmente e têm uma grande importância evolutiva porque a) geram a variabilidade sobre a qual a seleção natural pode agir. na primeira divisão meiótica. (04) A condição genética dos indivíduos com "xeroderma pigmentosum" é determinada pela exposição à radiação ultravioleta. b) geram as adaptações. e os indivíduos do grupo sangüíneo AB são considerados doadores universais. que parecem resultar da morte prematura de células nervosas. em que são considerados básicos alguns conceitos de genética. resultando em alta freqüência de câncer de pele. São hoje praticamente indispensáveis à medicina. (08) A morte prematura de células nervosas resulta dos efeitos do acúmulo de lesões na molécula de DNA. condição genética autossômica recessiva. ( ) Um dos catalisadores do processo de duplicação do DNA é a enzima DNA polimerase.

Observou-se. Soma ( ) Questão 417 Um canil. será heterozigota para o caráter se entre os seus descendentes aparecerem alguns com sementes amarelas e outros com sementes brancas. quando necessário. Feito um cruzamento entre dois indivíduos duplamente heterozigóticos. (04) Herança ligada ao cromossomo sexual. alterando-o. na sua maioria. Para tanto. (04) Indivíduos heterozigotos para duas características produzem quatro tipos de gametas. apresentaram as mesmas características dos pais. e quais as conseqüências disso. (08) Na interação gênica. comportamentos. essa atividade de campo. contarão com a companhia de Ribossomildo. terá filhos apenas do grupo sangüíneo O. Um outro gene B dominante determina a pigmentação clara do olho. enquanto seu alelo recessivo determina a cor escura. onde verão um maravilhoso ecossistema. escolheu dois irmãos de uma ninhada e os cruzou. (02) 3/16 dos descendentes desse cruzamento terão olhos normais e com pigmentação clara. é correto afirmar que: (01) 9/16 dos descendentes desse cruzamento terão olhos normais e com pigmentação escura. que lhes servirá de guia. Desse cruzamento resultaram oito filhotes que. Também serão convocados a responder a questões básicas no campo da Biologia. Sabe-se que o gene A está em um cromossomo e B em outro. pois Ribossomildo só lhes dará informações cientificamente corretas. Vocês terão a oportunidade de verificar de que maneira o homem pode interferir nesse meio. compreenderão como as espécies se inter-relacionam. vocês estarão em contato com a natureza. (32) Semiletalidade. (02) Uma mulher do grupo sangüíneo A cuja mãe é do grupo O. autofecundada. efeitos nocivos que podem surgir devido a genótipos recessivos produzidos através do cruzamento entre indivíduos aparentados. verão de perto a diversidade da fauna e da flora. entretanto. (02) Efeito genético da consangüinidade. dois nasceram cegos. reduzindo o vigor da ninhada. a fim de condicionar um determinado fenótipo. se reproduzem e como se dão alguns fenômenos biológicos nos seres que vivem ali e até naqueles que visitam esse ambiente. dos oito cãezinhos. À luz dos conhecimentos de genética. uma criança hemofílica nascida de pais normais só poderá ser do sexo feminino. (16) Deriva genética. (04) 4/16 dos descendentes nascerão sem olhos. e adaptações na Mata Atlântica. (16) Sendo a hemofilia uma anomalia condicionada por um gene recessivo ligado ao sexo. ou polimeria. ou seja. e o passeio será muito proveitoso. especializado na criação de dálmatas. Nesse passeio. 92 Questão 416 Com base nos estudos de Genética. Vamos lá?!!! Como você já devem ter percebido. (08) Segregação monogênica dominante. Ele dispõe de material para ilustrar. "Lei da Segregação Independente dos Caracteres". escreva no espaço apropriado a soma dos itens corretos. (08) Estes problemas envolvem a Segunda Lei de Mendel. um experiente pesquisador. casando-se com um homem doador-universal. é correto afirmar que: (01) Uma planta de sementes brancas. fixando aleatoriamente alguns genes. soma = ( ) Questão 418 O texto abaixo refere-se às questões: ** a ** Caros candidatos. Fiquem tranqüilos: vocês estão preparados. é grande a variabilidade de espécies. os genes de um par agem combinando-se com outro par (ou outros pares). que. Imagine uma espécie animal na qual um gene A determina a formação do olho e seu alelo recessivo determina a ausência de olhos. ou seja.Questão 415 O texto abaixo refere-se às questões: ** a ** Na(s) questão(ões) a seguir. Vocês estão convidados a fazer um passeio numa área de Mata Atlântica. Soma ( ) . esse fato pode ser explicado porque houve: (01) Heterose.

ele apresenta a figura abaixo. Questão 420 A história da maioria dos municípios gaúchos coincide com a chegada dos primeiros portugueses. A. que lhes permite crescer?! Para facilitar a resposta a essa pergunta. O resultado para a F1 de um cruzamento de plantas com baixa estatura X plantas com estatura elevada será _________________________. No entanto. a segregação independente dos cromossomos contribui para o aumento da diversidade dos gametas. B. foi selecionada a área temática CULTURA e as questões foram construídas com base na obra "Os Primeiros Habitantes do Rio Grande do Sul" (Custódio. alemães. Considere que a característica baixa estatura é dominante sobre a característica porte elevado e que apenas um loco gênico está envolvido na determinação da estatura das plantas. através dos vestígios materiais encontrados nas pesquisas arqueológicas. protagonizaram a nossa história. "Da Amazônia vieram os tupis-guaranis.1 1. 1. ensinando a plantar diferentes espécies e a usar plantas frutíferas e medicinais.1 ssinale a opção correspondente ao evento representado na figura. trazendo contribuições à nossa cultura.2. 93 . Diante da relevância do contexto e da vontade de valorizar o nosso povo nativo. etapas da divisão celular como as representadas nas figuras abaixo justificam essa variabilidade. Segundo Ribossomildo. a formação de quiasma eleva a probabilidade de ocorrência de mutação dos genes.5.. organizador. a permutação entre cromossomos heterólogos aumenta a variabilidade genética. que ilustra um dos eventos imprescindíveis ao processo de crescimento dos organismos.Essa variabilidade fenotípica está relacionada à constituição genética do indivíduo e pode ser observada até dentro da mesma espécie. c) Na figura I. Questão 419 Ribossomildo diz: Vejam quantos folhas novas. com o objetivo de melhorar a produção de grãos. a) replicação do DNA b) transcrição de RNA transportador c) tradução de RNA mensageiro d) síntese das proteínas arque a opção em que se relaciona adequadamente a figura ao evento biológico.8. "o índio". quantos filhotes de animais! O que deve estar ocorrendo no interior das células desses seres. b) Na figura II. IPHAN. anteriores aos citados. Santa Cruz do Sul: EDUNISC. se os indivíduos cruzados forem homozigotos para esse loco gênico. Assinale a alternativa que completa corretamente a lacuna. a migração das cromátides-irmãs para pólos opostos eleva a recombinação gênica.5. italianos e de outros povos. a) Na figura I. L. 2004). sabemos que outros povos." Variedades de milho cultivadas pelos indígenas são usadas hoje em cruzamentos. d) Na figura II.

b) 1.a) 100% com estatura elevada b) 100% com estatura baixa c) 1/2 com estatura elevada e 1/2 com estatura baixa d) 1/4 com estatura elevada e) 3/4 com estatura elevada Questão 421 O texto abaixo refere-se às questões: ** a ** O tipo selvagem do fungo Neurospora é capaz de crescer em um meio de cultura simples. c) 2. A linhagem D é o tipo selvagem. para as enzimas a) 1. Y e Z correspondem à citrulina.indica que não houve crescimento.A inativação dos oncogenes é uma das condições essenciais para que as células citadas no texto se multipliquem desordenadamente. e) arginina. Após essa fase várias dessas células podem cair na corrente sangüínea e invadir outros órgãos. tais como radiações solares e agrotóxicos. O sinal + indica que houve crescimento do fungo. d) citrulina. açúcar e uma vitamina. o sinal . o qual pode ser determinado pela perda da inibição por contato nas células. não deficiente em qualquer uma das enzimas. não necessariamente nessa ordem. Questão 422 1. d) 2. espera-se que aquelas produzidas com defeitos sejam destruídas pelo sistema imunológico. tal como na via biossintética representada na figura 1. 1 e 3. c) citrulina. determinado assim uma acentuada queda na sobrevida do indivíduo. respectivamente. podem provocar alterações genéticas nas células.5. II .O comportamento celular descrito na última frase do texto é chamado metástase. arginina e citrulina. III . Questão 423 Quando as células do corpo humano se multiplicam. ornitina e arginina.5 As linhagens A. Assinale a opção que contém a(s) afirmativa(s) 94 1. e) 3. alcançando um número razoável de células e estabelecendo uma rede de vasos sangüíneos que passa a alimentá-las. Y e Z correspondem. Os compostos X. sais minerais. arginina e ornitina. cada uma delas deficiente em uma das enzimas participantes dessa via biossintética. Um pesquisador obteve três diferentes linhagens desse fungo. aos compostos a) ornitina. .5 As letras X.8. citrulina e arginina. 1 e 2. O esquema na figura 2 apresenta os resultados obtidos quando essas diferentes linhagens foram colocadas para crescer em diferentes meios de cultura. respectivamente. tornando-as invulneráveis à ação do sistema imunológico. 3 e 1. citrulina e ornitina. 2 e 3. No entanto. se algumas células mutantes se tornam invulneráveis elas podem se multiplicar. arginina e ornitina. Considere as seguintes afirmativas: I . b) ornitina.8. O fungo utiliza esses elementos como precursores para a síntese de vários compostos. B e C são deficientes.Agentes ambientais. 3 e 2.5. constituído de água.

verdadeira(s). a) Apenas I e II. b) Apenas I e III. c) Apenas II e III. d) Apenas III. e) I, II, III. Questão 424 A síntese protéica envolve um complexo de estruturas celulares que trabalham harmonicamente, como mostra o esquema adiante.

1.1.4

1.1.3.2

Segundo a tirinha, a amiga de Calvin tem DOIS CROMOSSOMOS X. Com base neste dado podemos concluir que: a) a amiga de Calvin é mutante, por isso é hostil. b) um cromossomo X da amiga de Calvin é ativo e o outro é chamado de cromatina sexual. c) a heterocromatina ocorre em Calvin, pois ele é XY. d) os dois cromossomos X de que Calvin fala é da cobra que quer comê-lo. e) não há cromatina sexual em meninas. Questão 426

Com base no esquema e em conhecimentos correlatos, julgue os itens a seguir. (0) O esquema mostra a síntese protéica em uma célula procariótica. (1) Os tipos de RNA necessários para a síntese protéica em procariotos e eucariotos são essencialmente diferentes. (2) Na expressão de um gene eucariótico, a transcrição e a tradução ocorrem simultaneamente. (3) Uma molécula de RNAm pode ser utilizada para a síntese concomitante de várias moléculas da proteína. Questão 425 Leia com atenção a tirinha a seguir:

Qual das alternativas se refere a um cromossomo? a) Um conjunto de moléculas de DNA com todas as informações genéticas da espécie. b) Uma única molécula de DNA com informação genética para algumas proteínas. c) Um segmento de molécula de DNA com informação para uma cadeia polipeptídica. d) Uma única molécula de RNA com informação para uma cadeia polipeptídica. e) Uma seqüência de três bases nitrogenadas do RNA mensageiro correspondente a um aminoácido na cadeia polipeptídica. Questão 427 Quando afirmamos que o metabolismo da célula é controlado pelo núcleo celular, isso significa que a) todas as reações metabólicas são catalisadas por moléculas e componentes nucleares. b) o núcleo produz moléculas que, no citoplasma, promovem a síntese de enzimas catalisadoras das reações metabólicas. c) o núcleo produz e envia, para todas as partes da célula, moléculas que catalisam as reações metabólicas.
95

d) dentro do núcleo, moléculas sintetizam enzimas catalisadoras das reações metabólicas. e) o conteúdo do núcleo passa para o citoplasma e atua diretamente nas funções celulares, catalisando as reações metabólicas. Questão 428 Considere uma espécie de vertebrado cujas células embrionárias têm oito cromossomos. Em quantos grupos de ligações seus genes estarão associados? a) Dois. b) Quatro. c) Oito. d) Dezesseis. e) Número variável. Questão 429 A ilustração representa o cariótipo humano que permite determinar o número e a forma dos cromossomos.

Questão 431 Os cromossomos são constituídos principalmente por: a) fosfolipídeos. b) proteínas. c) ácido ribonucléico. d) enzimas. e) ácido desoxirribonucléico. Questão 432 A cromatina sexual compreende: a) o citoplasma de células gaméticas masculinas que se apresentam mais coradas que as femininas. b) o citoplasma de células gaméticas femininas que se apresentam mais coradas que as masculinas. c) cromossomo Y condensado em núcleos de hemácias humanas. d) um dos cromossomos X da mulher, que permanece condensado no núcleo das células, facilmente visualizado na mucosa oral. e) cromossomos X e Y condensados durante o período da interfase. Questão 433 Responder à questão com base no cariótipo (conjunto de cromossomas) humano representado abaixo.

1.1.4

Analisando-se a figura, é correto concluir que se refere a um indivíduo portador da síndrome de a) Klinefelter. b) Patau. c) Turner. d) Down. Questão 430 A presença de cromatina sexual predominante em número de células femininas está relacionada a cromossomos: a) Y inativos b) X inativos c) autossômicos inativos d) autossômicos que não se dividiram e) autossômicos agregados

1.1.4

cariótipo é de um indivíduo do sexo com síndrome de __________. a) feminino - Klinefelter b) masculino - Klinefelter c) masculino - Down d) feminino - Turner e) masculino - Turner

96

Questão 434 Numere a coluna inferior, relacionando-a com a superior. Indivíduos: 1 - 45, X 2 - 46, XX 3 - 49, XXXXX 4 - 49, XXXXY 5 - 47, XXX Quantidade de cromatinas sexuais (corpúsculos de Barr) ( ) quatro ( ) duas ( ) nenhuma ( ) uma ( ) três Assinale a opção que apresenta a seqüência correta de numeração. a) 2, 4, 1, 3, 5 b) 3, 5, 1, 2, 4 c) 2, 3, 1, 4, 5 d) 3, 2, 1, 4, 5 e) 2, 1, 3, 4, 5 Questão 435

Analisando o desenho esquemático que representa o núcleo de uma célula animal qualquer, podemos identificar que o componente responsável pela síntese de RNA que forma o ribossomo é assinalado pelo número: a) 1 b) 2 c) 3 d) 4 e) 5 Questão 436 Muitas vezes, durante a realização de eventos esportivos, é realizada a determinação do sexo genético. Este exame é feito pela observação dos cromossomos de células epiteliais. Pode-se afirmar que neste exame a) mulheres normais deveriam apresentar uma estrutura chamada corpúsculo de Barr, que corresponde a um dos cromossomos X. b) homens normais deveriam apresentar uma estrutura chamada corpúsculo de Barr, que corresponde ao cromossomo Y. c) mulheres normais deveriam apresentar duas estruturas chamadas corpúsculos de Barr, que correspondem aos dois cromossomos X. d) homens normais deveriam apresentar uma estrutura chamada corpúsculo de Barr, correspondente ao cromossomo X. e) mulheres normais na fase adulta não deveriam apresentar corpúsculo de Barr. Questão 437

1.1.4

Analise o esquema a seguir, o qual mostra o mecanismo de ação de algumas drogas antimitóticas que inibem a progressão a partir dos pontos indicados.

1.1.5.1

97

Assinale a afirmativa INCORRETA. a) A puromicina não tem qualquer efeito sobre o crescimento ou multiplicação celular. b) A mitomicina não permite a ocorrência da fase 5 do ciclo celular. c) Pelo menos duas das drogas interferem diretamente na síntese protéica. d) Nem todos os tipos de nucleotídeos sofrem ação da droga arabinosilcitosídeo. Questão 438 A figura a seguir representa _______________ , que ocorre na _______________ e tem como conseqüência _______________.

1.1.5.2

1.1.5.2

( ) O número de gametas AB deverá ser idêntico ao de gametas ab. ( ) A freqüência de gametas recombinantes deverá ser igual a de gametas não-recombinantes. ( ) Trezentos e sessenta gametas não- recombinantes são esperados. ( ) Vinte gametas recombinantes são esperados no caso descrito. ( ) A taxa de recombinação no caso citado é de 10%; logo, os locos A e B distam de 10 unidades de mapa. Questão 440 "Devo, finalmente, chamar a atenção para a possibilidade do pareamento dos cromossomos paternos e maternos, e sua subseqüente separação durante a divisão reducional, constituírem as bases físicas das leis de Mendel" (Walter S. Sutton, 1902). O que Sutton achava possível sabe-se, hoje, ser verdade, isto é: I. os genes estão localizados nos cromossomos. II. dois ou mais genes localizados no mesmo cromossomo são herdados, na maioria dos casos, em gametas diferentes. III. dois ou mais genes localizados em cromossomos diferentes segregam de maneira independente. Sobre as afirmativas acima, pode-se dizer que: a) somente III está correta. b) I e II estão corretas. c) II e III estão corretas. d) I e III estão corretas. e) somente II está correta.

A alternativa que preenche correta e respectivamente os espaços anteriores é: a) o crossing-over; metáfase da mitose; a variabilidade genética. b) o pareamento de cromátides-irmãs; anáfase I da meiose; a troca de genes alelos. c) o crossing-over; prófase I da meiose; a variabilidade genética. d) a segregação de cromossomos homólogos; anáfase I da meiose; a formação de células haplóides. e) o pareamento de cromossomos homólogos; metáfase da mitose; a formação de gametas. Questão 439 Analise as proposições abaixo, considerando a seguinte situação: Em uma amostra de 100 (cem) espermatogônias, de um organismo genotipicamente (AB//ab), ocorreu permutação meiótica entre os locos A e B, em 20 (vinte) espermatogônias, tendo sido observada uma segregação gamética como ilustrado na figura abaixo.

98

Questão 441

Questão 443 Quanto aos cromossomos sexuais X e Y, podemos afirmar que: a) como não são completamente homólogos, não se pareiam na meiose. b) como são completamente homólogos, pareiam-se na meiose. c) se pareiam na meiose, pois possuem uma região homóloga. d) não se pareiam na meiose, pois possuem uma região não homóloga. e) os genes que se encontram na região não homóloga do X condicionam um tipo de herança chamado herança restrita ao sexo. Questão 444 As variações das cargas elétricas das moléculas das proteínas W, X, Y e Z, em função do pH do meio, estão representadas no gráfico a seguir.

1.1.5.2

AMABIS e MARTHO. "Fundamentos da Biologia Moderna". São Paulo: Moderna, 1997. p. 499. A figura representa a a) mitose e explica a separação dos cromossomos durante a divisão. b) meiose e explica a segregação independente dos genes previstos pela segunda lei de Mendel. c) mitose e explica a segregação dos genes demonstrando a dominância e a recessividade. d) meiose, que é um processo de formação de gametas mas que não tem nenhuma relação com as leis de Mendel. e) mitose, que é um processo de divisão celular mas que não tem nenhuma relação com as leis de Mendel. Questão 442 Os gatos possuem 38 cromossomos, com o sistema XX/XY de determinação sexual. No desenvolvimento embrionário de fêmeas, um dos cromossomos X é inativado aleatoriamente em todas as células do organismo. Em gatos domésticos, a pelagem de cor preta (dominante) e amarela (recessiva) são determinadas por alelos de um gene localizado no cromossomo X. Fêmeas heterozigóticas para cor da pelagem são manchadas de amarelo e preto. Um geneticista colocou um anúncio oferecendo recompensa por gatos machos manchados de amarelo e preto. A constituição cromossômica desses gatos é a) 37, YO. b) 37, XO. c) 38, XX. d) 39, XXY. e) 39, XXX.

1.1.7.3

molécula do DNA, em pH fisiológico, apresenta carga elétrica negativa, devido a sua natureza ácida. No núcleo celular, ela está associada a proteínas, de caráter básico, denominadas histonas. De acordo com o gráfico, a proteína que apresenta propriedades compatíveis com as de uma histona é a representada pela seguinte letra: a) W b) X c) Y d) Z

99

Questão 445 Considere a rota metabólica que produz o aminoácido arginina na figura adiante.

grupamentos amina e hidroxila. Questão 447 O metabolismo celular depende de uma série de reações químicas controladas por enzimas, isto é, proteínas que atuam como catalisadores e que podem sofrer mutações genéticas sendo modificadas ou eliminadas. Assinale a alternativa correta, levando em conta os ácidos nucléicos, a ocorrência de mutações e as conseqüentes mudanças do ciclo de vida da célula. a) O DNA é constituído por códons, que determinam a seqüência de bases do RNA mensageiro, necessária à formação dos anticódons, responsáveis pela produção das proteínas. b) No caso de uma mutação acarretar a transformação de um códon em outro relacionado ao mesmo aminoácido, não haverá alteração na molécula protéica formada, nem no metabolismo celular. c) A mutação altera a seqüência de aminoácidos do DNA, acarretando alterações na seqüência de bases do RNA mensageiro e, conseqüentemente, na produção das proteínas. d) As mutações atuam diretamente sobre as proteínas, provocando a desnaturação dessas moléculas e, conseqüentemente, a inativação delas. e) Quando algumas proteínas são alteradas por mutações, suas funções no metabolismo celular passam a ser realizadas pelos aminoácidos. Questão 448 Organelas citoplasmáticas que contêm DNA: a) mitocôndria e ribossomo. b) mitocôndria e cloroplasto. c) nucléolo e cloroplasto. d) lisossomo e ribossomo. e) ribossomo e cromossomo. Questão 449 A hipótese de que os cloroplastos e as mitocôndrias tenham surgido através de uma associação simbiótica de um eucarioto primitivo com, respectivamente, bactérias fotossintetizantes e bactérias aeróbicas, é reforçada pelo fato daquelas organelas celulares: a) serem estruturas equivalentes, com grande superfície interna.
100

1.1.7.3

Em um experimento, três linhagens de bactérias foram irradiadas com raios X, que causaram mutações nos genes envolvidos na rota metabólica acima representada. Para descobrir quais enzimas da rota metabólica foram afetadas, as três linhagens foram cultivadas em meios suplementados com ornitina, citrulina e arginina, obtendo-se o resultado mostrado na tabela acima: Sobre esse experimento, podemos afirmar que a) o gene que codifica a enzima 1 na linhagem I foi afetado. b) o gene que codifica a enzima 2 na linhagem I foi afetado. c) o gene que codifica a enzima 3 na linhagem II foi afetado. d) o gene que codifica a enzima 1 na linhagem II foi afetado. e) o gene que codifica a enzima 3 na linhagem III foi afetado. Questão 446 Além de serem as macromoléculas mais abundantes nas células vivas, as proteínas desempenham diversas funções estruturais e fisiológicas no metabolismo celular. Com relação a essas substâncias é CORRETO afirmar que: a) são todas constituídas por seqüências monoméricas de aminoácidos e monossacarídeos. b) além de função estrutural, são também as mais importantes moléculas de reserva energética e de defesa. c) cada indivíduo produz as suas proteínas, que são codificadas de acordo com o seu material genético. d) a sua estrutura terciária é determinada pela forma, mas não interfere na sua função ou especificidade. e) são formadas pela união de nucleotídeos por meio dos

No núcleo do óvulo normal de uma gata são esperados: a) 19 cromossomos simples e 19 moléculas de DNA.1. Questão 451 Células vegetais. Ao longo do processo de diferenciação das células do mesmo organismo ocorre a) duplicação de alguns genes. um fungo e uma samambaia apresentam em comum a) produção de glicose através da utilização de energia solar. Questão 455 O gato doméstico ('Felis domestica') apresenta 38 cromossomos em suas células somáticas.) No homem. b) ribossomos. Questão 454 Uma bactéria.7. d) 38 cromossomos simples e 19 moléculas de DNA. b) 19 cromossomos duplicados e 38 moléculas de DNA. tanto do ponto de vista estrutural como funcional. depois de mantidas em meio de cultura contendo uracila marcada. c) estarem envolvidas. e) produção de ATP no interior de plastos. c) TACGTGGA. c) expressão diferencial dos genes. b) perda dos genes não expressos. d) ribossomo. (. os planos do arquiteto montam 46 101 1.. Questão 453 A seqüência de nucleotídeos ATGCACCT forma um segmento de DNA dupla hélice ao se ligar à fita complementar a) AUGCACCU. c) utilização de oxigênio no interior de mitocôndrias. b) presença de carioteca envolvendo os componentes do núcleo celular. respectivamente. Questão 450 "Captura aminoácidos que se encontram dissolvidos no citoplasma e carrega-os ao local da síntese de proteínas". d) apresentarem tilacóides e cristas como as bactérias. e) recombinação entre genes ativados. foram fixadas e submetidas à autoradiografia. e) ribossomos. b) UACGUGGA. d) indução de mutações específicas. encontre-se uracila radioativa SOMENTE nos a) nucléolos. na produção e consumo de oxigênio. d) TCCACGTA. Questão 456 É como se em cada quarto de um imenso prédio existisse uma estante contendo os planos do arquiteto para todo o prédio. c) 38 cromossomos simples e 38 moléculas de DNA. e) 19 cromossomos duplicados e 19 moléculas de DNA. e) DNA. d) ribossomos e nos cloroplastos. no citoplasma. e) serem encontradas tanto em organismos superiores como inferiores. Questão 452 A célula muscular cardíaca e a esquelética têm a mesma origem porém são diferentes. Essa função é desempenhada pelo a) RNA mensageiro. para comprovar os locais que possuíam esse material.. b) RNA transportador. d) presença de DNA como material genético. c) nucléolos e nas mitocôndrias. e) ATGCACCT. c) RNA ribossômico.b) apresentarem DNA próprio.6 . nos cloroplastos e nas mitocôndrias. É correto prever que.

e) Apenas II e V. UUA ou GUA. ( ) O final da tradução ocorre quando. cada página de cada volume contém um texto formado por uma seqüência de: a) fenótipos b) aminoácidos c) cromossomos d) bases nitrogenadas Questão 457 Analise as afirmativas a seguir. Considerando esse tema.6 . ( ) 61 códons correspondem aos aminoácidos que compõem as proteínas. ( ) Na etapa seguinte da tradução. UAG ou UGA.7. na leitura da mensagem genética. III. um segundo RNAt (III). transcrevendo a seqüência de bases de uma cadeia de DNA. Cada cromossomo possui uma única molécula de DNA. que: a) somente I é verdadeira.2 amostra: timina III . I. ( ) Quando se estabelece uma ligação peptídica entre os dois primeiros aminoácidos. UUG. Nessa analogia. encaixa-se no sítio destinado à entrada de aminoácidos na cadeia peptídica. de modo correto. o RNAt do primeiro aminoácido é liberado (IV) no citoplasma. analise a figura e as proposições a seguir. complementar ao códon AUG do RNAm. para os quais não há aminoácido correspondente.1 amostra: ribose II . ( ) O aminoácido metionina (I) é trazido ao ribossomo pelo RNAt cujo anticódon é UAC (II). se chega a um códon de parada (V). d) Apenas II e IV. e) somente II e III são verdadeiras. Histonas são proteínas relativamente pequenas que se ligam fortemente ao RNA.1. cujo anticódon é complementar ao segundo códon do RNAm geralmente onde há uma trinca UAA.volumes.3 amostra: dupla hélice IV.5 amostra: 20% de guanina e 30% de citosina Entre estas amostras. onde se dá a produção de cadeias peptídicas. Com relação às características dessa molécula. se liga ao ribossomo. podemos afirmar que os códons 5 e 6 codificam. b) somente II é verdadeira. c) somente I e II são verdadeiras. quais se referem a DNA? a) Apenas I e II. Sabendo-se que os códons 5 e 6 trazem a informação para um mesmo aminoácido. são comemorados os 50 anos da "descoberta" da estrutura tridimensional do DNA.4 amostra: uracila V . d) somente I e III são verdadeiras. II. ou para a metionina ou para o triptofano. proposta por Richard Dawkins no livro "O gene egoísta". a saber. Pode-se afirmar. para o qual existe apenas uma trinca de codificação. Os nucléolos podem atuar na síntese de carboidratos que migram do núcleo para o citoplasma. O RNAm no citoplasma. ao papel que ela desempenha nos seres vivos e aos processos em que se encontra envolvida é CORRETO afirmar que: 102 1. Questão 458 A molécula de RNAm é sintetizada no núcleo. acerca dos elementos constituintes do núcleo celular eucariótico. Questão 460 Neste ano de 2003. Questão 459 Cinco amostras com ácidos nucléicos foram analisadas quimicamente e apresentaram os seguintes resultados: I . c) Apenas II e III. b) Apenas I e III.

a finalização do Projeto Genoma Humano foi noticiada por vários meios de comunicação como sendo a "decifração do código genético humano". b) A polimerização de uma fita simples de DNA é dita semiconservativa. d) Duas cadeias simples de DNA formam uma dupla-hélice. e) apenas II. da maneira como foi veiculada.(01) É formada por duas fileiras de nucleotídeos torcidas juntas em forma de hélice. (04) Ela tem a capacidade de se autoduplicar. 103 . III e IV. por serem herdáveis. (02) Em sua composição é possível encontrar quatro bases nitrogenadas diferentes: a adenina. porque agora se sabe toda a seqüência de genes dos cromossomos humanos. através do processo denominado tradução. compostos por uma desoxirribose ligada a um fosfato e a um aminoácido. c) na replicação e na transcrição. e) em qualquer um dos três processos. II. apenas. e) errada. Questão 462 Este ano comemorou-se 50 anos da publicação do trabalho de Francis Crick e James Watson. (32) Nos organismos procariontes. Questão 461 Analise as afirmativas: I. quando ocorrem a) na transcrição. A informação presente no RNA pode ser transformada em uma seqüência de aminoácidos. a citosina. A informação. Questão 464 Em abril de 2003. apenas. apenas. (64) Em alguns organismos primitivos. porque o Projeto decifrou os genes dos cromossomos humanos. (08) Nela está contida a informação genética necessária para a formação de um organismo. As proteínas e os ácidos nucléicos são formados por aminoácidos. não as proteínas que eles codificam. c) errada. transcrição e tradução do DNA. b) na replicação. c) Os nucleotídeos são polimerizados por meio de ligações fosfodiéster entre o fosfato e a base nitrogenada. Dentre as afirmativas abaixo. e suas seqüências de bases são complementares. d) apenas I. durante os processos de replicação. o aminoácido e a proteína. Questão 463 Erros podem ocorrer. c) apenas II e III. Entretanto. porque o código genético diz respeito à correspondência entre os códons do DNA e os aminoácidos nas proteínas. Está(ão) correta(s) a) apenas I. e) As duas cadeias de uma dupla-hélice possuem a mesma orientação. porque agora se sabe toda a seqüência de nucleotídeos dos cromossomos humanos. através do processo denominado transcrição. pois independe da existência de uma fita molde. b) correta. III. apenas. d) na transcrição e na tradução. ela fica estocada dentro do núcleo das células. que estabeleceu o modelo da estrutura da molécula de ácido desoxirribonucléico (DNA). está a) correta. por meio da formação de pontes de hidrogênio entre as bases nitrogenadas. d) errada. (16) A mensagem nela contida pode ser transcrita para uma outra molécula denominada RNA. assinale a alternativa CORRETA: a) Uma cadeia simples de DNA é constituída de nucleotídeos. embora em baixa freqüência. DNA e RNA são os ácidos nucléicos encontrados tanto em células eucariontes como procariontes. III e IV. A informação contida no DNA pode ser copiada em uma fita de RNA. porque não é possível decifrar todo o código genético. b) apenas I e II. ela apresenta apenas uma fileira de nucleotídeos. existem regiões cromossômicas com alta taxa de mutação. IV. as conseqüências desses erros podem ser mais graves.

removidos durante a diferenciação. e) a expulsão do núcleo injetado por meio de exocitose realizada pela célula-ovo. nos 6 milhões de anos que separam a evolução do homem e do chimpanzé de um ancestral comum. apenas um deles desenvolve a capacidade de compor música. Alguns cientistas dos EUA afirmam que os chimpanzés (Pan troglodites) são geneticamente tão parecidos com os homens que deveriam ser incluídos no gênero Homo. b) 99. Qualquer resistência às doenças infecciosas (de caráter hereditário). Estudar estes 0. em 21/05/2003. Mais recentemente. A idéia surgiu pela primeira vez em 1998 quando a análise de seqüências de DNA de humanos e de chimpanzés revelou 98. d) a formação de um girino normal a partir do ovo.Questão 465 Ao se injetar o núcleo de uma célula diferenciada de uma rã em um ovo de outra rã. mais pessoas se tornariam independentes de procedimentos médicos. uma vez que o núcleo injetado não contém determinados genes. ocorrerá: a) a morte da célula-ovo. uma vez que o núcleo injetado contém toda a informação (DNA) necessária à formação do girino. c) a formação de um clone de células não diferenciadas. de construir prédios e de fazer pesquisa científica. assinale a afirmativa CORRETA. Questão 466 CHIMPANZÉ TAMBÉM É "GENTE".) Tendo em vista o texto apresentado. c) A longo prazo. não fertilizado e cujo núcleo tenha sido removido. a comparação da seqüência de DNA de 97 genes comuns de humanos e de chimpanzés revelou 99. Questão 467 Descobertas recentes na medicina e na saúde pública. terão algum impacto no curso da evolução humana. A diferença nos percentuais de identidade dos dois estudos se deve ao fato de que em 1998 foi estudado o DNA não-codificante. uma vez que o núcleo injetado não possui alguns genes. Questão 468 O gráfico mostra a variação dos números de indivíduos do tipo original e do tipo mutante.4% de identidade. c) Seqüências de DNA que podem ser expressas como proteínas apresentaram maiores semelhanças que as seqüências não codificadoras. que não faz parte das seqüências que podem ser transcritas e traduzidas. b) Os genótipos que produzem pouca ou nenhuma resistência se tornariam comuns. biologicamente não somos tão diferentes dos chimpanzés como muitos crêem. Assinale a alternativa que mostra. ao longo de 100 anos. e) Não haveria alteração alguma na freqüência desses alelos. em uma mesma área de floresta. haveria adaptação genética a resistência a muitas doenças. (Fonte: "Folha de S. conferiria vantagem seletiva a uma família. se aplicadas consistentemente. a) A freqüência dos alelos que conferem resistência inata às doenças seria aumentada.6% de diferenças pode contribuir para entendermos como. 104 . removidos durante a diferenciação. como o sarampo e a difteria. DIZ ESTUDO.4% de identidade entre os genes humanos e de chimpanzés. d) Os 97 genes comuns são os responsáveis pela diferenças entres seres humanos e chimpanzés. Na realidade. uma vez que o núcleo injetado proveniente da célula diferenciada contém DNA cuja composição de bases nitrogenadas é diferente da célula-ovo. corretamente. que até o momento tem o Homo sapiens como único representante vivo. os efeitos da imunização em massa sobre a freqüência da resistência ou susceptibilidade inata às doenças. d) A longo prazo. a) As espécies Homo sapiens e Pan troglodites surgiram há 6 milhões de anos. b) a morte da célula-ovo.Paulo".4% dos genes apresentam a mesma seqüência de DNA.

e) após 50 anos. Para determinarmos se uma mosca de asa longa é homozigota ou heterozigota quanto ao par de genes que condicionam este caráter. d) fenótipo igual ao seu.PHE . d) a partir de 50 anos. Indique a alternativa que mostra as proteínas encontradas nos grupos de animais I a V. ocorre em três formas diferentes: a forma P.ARG . 1. IV e V.Questão 470 A seguir estão representadas três seqüências de aminoácidos de proteínas retiradas de diferentes espécies (A.10 Questão 471 Moscas de asas longas cruzadas entre si fornecem moscas com asas vestigiais.1.ALA.ALA ALA . a forma PX.ARG . deixa de existir o efeito de dominância do alelo para o tipo original sobre aquele para o tipo mutante.VAL . b) o tipo original e o tipo mutante estão igualmente adaptados à mesma área de floresta. com base na forma da proteína presente nos grupos de animais I. resultante de mutação no gene que codifica PX. resultante de mutação no gene que codifica P. Questão 469 Um determinado tipo de proteína.LEU .1.LEU espécie C: MET .4.ARG .LEU .VAL .1. b) de asa longa.ARG . B e C).ARG .PRO .VAL .HIS . e a forma PY. c) genótipo igual ao seu.LEU .ALA .GLU .LEU . III.4.HIS .ARG .ALA ARG .ARG . 1.LEU espécie B: MET . II. e) fenótipo dominante.HIS .ARG ALA .PHE .10 105 .LEU Admitindo-se um ancestral comum para as três espécies. espécie A: MET . o tipo mutante passou a parasitar o tipo original.GLU .PRO .ARG . c) a mudança de ambiente provocou alteração nas freqüências gênicas.4. A ocorrência dessas mutações pôde ser localizada nos pontos indicados pelos retângulos escuros na árvore filogenética.PRO . o procedimento correto é analisar a prole resultante do cruzamento desta mosca com outra de: a) asa vestigial.PHE .7 análise do gráfico permite concluir que: a) o tipo original permanece melhor adaptado ao longo do período analisado.GLU . a árvore filogenética que melhor expressa o parentesco evolutivo entre as três é: 1. presente em praticamente todos os animais.LEU .

A probabilidade do primeiro filho de um homem albino casado com uma mulher normal. sendo a anomalia causada por um gene dominante e de 75% a probabilidade de o casal n¡.5. é possível afirmar que se trata a) exclusivamente de um caso de herança ligada ao sexo. 2 ter um descendente com a anomalia.Questão 472 1.1. 3 ter um descendente com a anomalia. sendo a anomalia determinada por um gene recessivo e impossível o casal n¡. Questão 475 Sabendo-se que o albinismo é um caráter recessivo. d) de um caso que pode ser tanto de herança ligada ao sexo como de herança autossômica. c) expressividade de um gene. ser albino e do sexo masculino é: a) nula b) 25 % c) 50 % d) 75 % e) 100 % Questão 474 A incidência de determinada anomalia foi investigada nos indivíduos da espécie humana representados no heredograma a seguir: Sabendo-se que os símbolos escuros representam portadores da anomalia. 2 ter um descendente com a anomalia. resultantes do casamento de um homem heterozigoto para esse fator. c) de um caso que pode ser tanto de herança ligada ao sexo como de herança autossômica. d) penetrância de um gene. determine a porcentagem de descendentes com o fenótipo igual ao do pai. b) mutação gênica. Questão 473 Na espécie humana.1 esquema anterior mostra uma experiência com um coelho himalaia. o albinismo é causado por um gene autossômico recessivo. 2 ter um descendente do sexo masculino com a anomalia. e) de um caso de herança ligada ao cromossomo Y e de 50% a probabilidade de o casal n¡.1. e) alteração do genótipo pelo ambiente. 3 ter um descendente com a anomalia.1 1.5. sendo a anomalia causada por um gene recessivo e de 75% a probabilidade de o casal n¡. mas heterozigota. sendo a anomalia determinada por um gene recessivo e de 50% a probabilidade de o casal n¡. com uma mulher de igual genótipo. a) 0% b) 25% c) 50% d) 75% e) 100% 106 . A mudança ocorrida na coloração do pêlo em função da queda de temperatura demonstra o efeito da: a) norma de reação. b) exclusivamente de um caso de herança autossômica.

todos pretos. Não há outros afetados na família. Essa expressão significa que a) o ambiente altera o genótipo do indivíduo. a porcentagem provável de espermatozóides que conterão o gene recessivo desse caráter é de: a) 0% b) 25% c) 50% d) 75% e) 100% Questão 477 Algumas variedades de canários mudam de cor dependendo da alimentação que recebem.5. resulta numa maior freqüência de indivíduos com anomalias genéticas. ou seja.Questão 476 Num homem heterozigoto para determinado caráter. Questão 480 Pedro e seus filhos. A tabela a seguir apresenta resultados de vários cruzamentos feitos com diversas linhagens dessa planta: 1. têm uma doença determinada por um gene dominante. Questão 481 Um gato preto (A) foi cruzado com duas gatas (B e C) também pretas. O cruzamento do gato A com a gata B produziu 8 filhotes.1. o cruzamento do gato A com a gata C produziu 6 filhotes pretos e 2 amarelos. A e C são homozigotos. recessivo. d) a cor preta é recessiva. determina a cor púrpura e (a). b) genótipo depende do ambiente. em qualquer que seja o ambiente. visando à sua adaptação. Questão 482 Dois genes alelos atuam na determinação da cor das sementes de uma planta: (A). e) pode estar num cromossomo ou num autossomo. e) a cor preta é recessiva. A e C são heterozigotos. d) o genótipo do indivíduo pode variar como resultado da expressão de seu fenótipo em diferentes ambientes. entre indivíduos que são parentes próximos. uma expressão bastante conhecida diz que fenótipo é o genótipo mais o ambiente. c) o fenótipo do indivíduo é o resultado da expressão de seu genótipo em um dado ambiente. A análise desses resultados permite concluir que: a) a cor preta é dominante. d) genótipo depende do fenótipo e do meio ambiente. A e C são homozigotos. c) está num autossomo. d) pode estar no cromossomo X ou no Y. Questão 478 Sabe-se que o casamento consangüíneo. e) genótipo depende dos genes. João e Maria. Esse gene: a) está no cromossomo X. determina a cor amarela. c) fenótipo depende do genótipo e do meio ambiente. e) o fenótipo do indivíduo é invariável e resulta da expressão de seu genótipo. b) está no cromossomo Y. Esta mudança indica que o: a) fenótipo depende do ambiente. B e C são heterozigotos. dominante. A e B são homozigotos. Isso pode ser justificado pelo fato de os filhos apresentarem: a) maior probabilidade de heterozigoses recessivas b) maior probabilidade de homozigozes recessivas c) menor probabilidade de heterozigoses dominantes d) menor probabilidade de homozigoses dominantes e) menor probabilidade de homozigoses recessivas Questão 479 Na genética. b) o genótipo do indivíduo é o resultado da ação do ambiente sobre seu fenótipo. c) a cor preta é dominante. b) a cor preta é dominante.1 107 .

Qual é a probabilidade de que pelo menos um dos gêmeos venha a ser afetado pela doença no caso de serem. e) apenas um óvulo D ou um óvulo d. e) genótipos variados em cada grupo. Vv x vv Um pé de ervilha. caráter condicionado por um alelo recessivo a. I. na maioria das vezes. II e III. casada com um portador de doença genética de herança autossômica dominante. 96% dos indivíduos têm cor clara e 4%. Questão 484 Dois grupos de mudas obtidas a partir de um mesmo clone de plantas verdes foram colocados em ambientes diferentes: um claro e outro escuro.presentam genótipo (Aa) as linhagens: a) I e III b) II e III c) II e IV d) I e IV e) III e IV I Questão 483 Considere os seguintes cruzamentos para ervilha. d) genótipos e fenótipos diferentes. descendentes claros e escuros. d) apenas um óvulo Dd. podemos encontrar: a) quatro óvulos Dd. Questão 488 Uma mulher normal. b) apenas do cruzamento II. cor escura. Questão 486 Qual a porcentagem de descendentes Aa nascidos de uma mãe Aa? a) 25% b) 50% c) 75% d) 100% e) depende do pai.1. VVx vv II. portanto. b) seus pais são certamente heterozigotos. b) o mesmo fenótipo e genótipos diferentes. c) a freqüência do alelo a é 0. d) apenas dos cruzamentos II e III. Questão 487 De uma população de 100 camundongos foi retirado ao acaso um indivíduo com deficiência da enzima E. Questão 485 Considere uma ovogônia de uma mulher heterozigota para o par de alelos Dd. está grávida de um par de gêmeos. Vv x Vv III. É correto afirmar que a) seus pais podem ser fenotipicamente normais. Esses resultados sugerem que a cor dessas mariposas é 108 . gêmeos monozigóticos ou dizigóticos? a) 25% e 50% b) 25% e 75% c) 50% e 25% d) 50% e 50% e) 50% e 75% Questão 489 Em uma população de mariposas. c) apenas do cruzamento III. pode resultar a) apenas do cruzamento I. b) quatro óvulos D e quatro óvulos d. Já os cruzamentos entre indivíduos claros produzem sempre apenas descendentes de cor clara. sabendo que V representa o gene que determina cor amarela dos cotilédones e é dominante sobre o alelo v. c) genótipos e fenótipos iguais. e) dos cruzamentos I. respectivamente. Depois de alguns dias. produz vagens com sementes amarelas e com sementes verdes.2. as plantas que ficaram no escuro estavam estioladas o que significa que os dois grupos apresentam: a) o mesmo genótipo e fenótipos diferentes. heterozigoto e que. Indivíduos escuros cruzados entre si produzem. d) a freqüência do alelo a é 0. Entre os possíveis gametas formados por essa ovogônia. e) 1% dos indivíduos da população têm deficiência da enzima E. c) dois óvulos D e dois óvulos d. que determina cor verde.

Questão 492 Em plantas de ervilha ocorre. mitose. d) depende de características congênitas. mitose. b) só ocorre quando em dose dupla. embora sem conhecer.100 Questão 491 Em seu trabalho com ervilhas. d) fenótipo igual ao seu. e) impediu o encontro de gametas com alelos diferentes para estatura. b) um segmento de DNA com informação para um RNA ribossômico. Questão 495 "Cada caráter é condicionado por um par de fatores que se separam na formação dos gametas".200. 109 . Aa . c) um par de alelos.400. O conhecimento atual a respeito da natureza do material hereditário permite dizer que a letra A usada por Mendel simboliza a) um segmento de DNA com informação para uma cadeia polipeptídica. e) genes.500. b) cor cinza.800. Para determinarmos se uma mosca cinza é homozigota ou heterozigota quanto ao par de genes que condicionam esse caráter. aa . Questão 493 Dizemos que um determinado gene é recessivo quando sua expressão (fenótipo): a) só acontece em heterozigose. mitose. a existência das seguintes estruturas e processo de divisão celular. e) fenótipo dominante. Considerando que cada casal produziu 2 descendentes. sendo o alelo para cor clara dominante sobre o que condiciona cor escura. Para estudar os mecanismos de herança. aa . c) independe da presença de seu alelo. b) um par de alelos. como a coloração dos troncos onde elas pousam.100 d) AA . o procedimento correto é analisar a prole resultante do cruzamento dessa mosca com outra de a) cor preta. Questão 490 Uma população experimental contém 200 indivíduos AA. Questão 494 Moscas de coloração acinzentada cruzadas entre si fornecem moscas de cor preta.100 c) AA . meiose. removendo as anteras da flor de uma planta homozigótica de alta estatura e colocando. sendo o alelo para cor escura dominante sobre o que condiciona cor clara. normalmente.50. d) genes. aa .200. publicado em 1866. Aa . Mendel representou os fatores hereditários determinantes dos estados amarelo e verde do caráter cor da semente pelas letras A e a.100. e) reproduz uma característica provocada pelo ambiente.200 e) AA . c) genótipo igual ao seu. aa . b) núcleos. Mendel ao enunciar essa lei já admitia.50 b) AA . c) trouxe gametas masculinos com alelos para baixa estatura. d) uma trinca de bases do RNA mensageiro.condicionada por a) um par de alelos. d) dois genes ligados com alta taxa de recombinação entre si. espera-se encontrar entre os filhotes: a) AA .1000. Todos os indivíduos AA foram cruzados com indivíduos aa e os indivíduos Aa foram cruzados entre si. Aa . Mendel fez fecundações cruzadas.200. Aa . que não apresentam dominância um sobre o outro. d) promoveu o encontro de gametas com os mesmos alelos para estatura. autofecundação. e) fatores ambientais. pólen recolhido da flor de uma planta homozigótica de baixa estatura. c) núcleos. sobre seu estigma.100. aa . Aa . meiose. e) uma trinca de bases do RNA transportador. b) trouxe gametas femininos com alelos para baixa estatura. c) um aminoácido em uma proteína. Com esse procedimento. respectivamente: a) cromossomos. o pesquisador a) impediu o amadurecimento dos gametas femininos. 200 aa e 200 Aa. respectivamente.

1 110 . Cruzando-se plantas de estames de cor púrpura com plantas de estames verdes.000 e) 12.000 d) 9. obteve-se uma geração F composta apenas de indivíduos com estames de cor púrpura. d) Todos os indivíduos marrons eram homozigotos. surgirão indivíduos regulares e irregulares na proporção 1:1. A partir desses dados. a) 50% dos indivíduos pretos de F‚ eram heterozigotos. o estame pode ser de cor púrpura ou verde. Retrocruzando-se um macho preto de F com a fêmea parental. 1. produzindo uma F composta por indivíduos marrons e pretos em igual quantidade. assinale a alternativa INCORRETA.000 e 3. Se esses indivíduos forem retrocruzados com os parentais de estames verdes. a) As plantas cruzadas são heterozigotas. Se os 120 descendentes com asas forem cruzados com moscas sem asas e se cada cruzamento originar 100 indivíduos. Questão 498 Em uma determinada planta. o padrão das nervuras foliares pode ser regular ou irregular. 75% dos filhotes produzidos em F‚ tinham pêlo preto e 25% apresentavam pêlo marrom. o número esperado de indivíduos com asas e sem asas será. cor das sementes. com ervilhas. o pêlo pode ser preto ou marrom.000 e 3. em que um único par de alelos é responsável por três características fenotípicas: cor das flores. c) Todos os indivíduos pretos de F‚ eram heterozigotos.1. por exemplo. originou-se uma F1 composta por plantas com nervuras regulares e outras com nervuras irregulares. assinale a alternativa correta. Isso ocorre. presença ou ausência de manchas nas axilas foliares.000 c) 8.000 Questão 500 Em genética. Do cruzamento entre duas plantas com nervuras irregulares. respectivamente. A partir desses resultados.000 e 6. c) Todos os F1 com nervuras irregulares são heterozigotos. b) Os indivíduos pretos de F eram homozigotos.000 b) 6.000 e 4.5. um único par de alelos determina mais de uma característica no organismo. b) A proporção fenotípica em F1 é de 3/4 de indivíduos irregulares e de 1/4 de indivíduos regulares. Uma fêmea preta foi cruzada com um macho marrom. Esse fenômeno é conhecido como: a) herança aditiva b) poligenia c) pleiotropia d) codominância Questão 501 Analise o heredograma para um fenótipo recessivo esquematizado a seguir e assinale a afirmativa INCORRETA.Questão 496 Em tomates. então a porcentagem de descendentes com estames verdes será de: a) 25% b) 50% c) 75% d) 0 e) 100% Questão 497 Em porquinhos da Índia.000 e 4. e) Os indivíduos F1 de nervuras regulares só podem ser homozigotos. a) 6. d) Se um indivíduo F1 com nervuras regulares for cruzado com um indivíduo da geração P. Questão 499 Do cruzamento de duas moscas com asas nasceram 120 descendentes com asas e 40 sem asas. e) Os indivíduos pretos da geração F eram heterozigotos e a fêmea parental era homozigota. em alguns casos.

5. o alelo recessivo pode ser herdado por descendentes fenotipicamente normais. recessivo.1 Analisando as informações apresentadas de acordo com os seus conhecimentos.1. As duas enzimas são codificadas por genes alelos dominantes com segregação independente. São albinos apenas os indivíduos de genótipo __(IV)__. as lacunas I. Nesses vegetais. por: a) AA. EC e CC. que chamaremos de E1. Questão 504 "Casais de pigmentação da pele normal. O gene para o albinismo é __(II)__ e não se manifesta nos indivíduos __(III)__. homozigoto e aa. heterozigotos e aa. sob a ação de uma enzima. b) Aproximadamente 1/4 das crianças de pais não-afetados pode ser afetado. homozigoto e Aa." No trecho acima. Sabe-se que animais heterozigóticos são mais resistentes a um dado vírus X do que os homozigóticos. embora seja heterozigota. existe um precursor incolor que. heterozigotos e aa. heterozigotos e AA. Questão 503 Quando duas populações da espécie vegetal 'Zea mays' (milho). e) aa.a) As pessoas afetadas possuem pelo menos um dos pais obrigatoriamente afetado. d) Aa. toda a descendência da primeira geração (F1) assemelha-se ao tipo parental dominante (Aa). onde há predadores naturais da espécie. Nos dois ambientes. Porém. Questão 505 1. d) Se um dos pais é heterozigoto. b) haverá igual chance de adaptação de animais com os três genótipos apenas na região I. há um caráter mendeliano com co-dominância e genótipos EE. b) AA. respectivamente. recessivo. amarelos ou roxos. Pode-se prever que a) haverá igual chance de adaptação de animais com os três genótipos nas duas regiões. d) amarelo com planta de bulbo incolor não produz plantas com bulbo roxo. II. dominante. quando a geração F1 se intercruza. 1/2 Aa e 1/4 aa c) 1/3 AA e 1/4 aa d) 1/4 Aa. fenotípica mendeliana 3:1 aparecerá na geração F2. dominante. que a enzima E2 transforma em roxo. são cruzadas. 1/2 AA e 1/4 aa e) É impossível determinar os genótipos utilizando os dados acima. c) Aa. c) roxo com planta de bulbo roxo pode produzir todos os três fenótipos mencionados. 111 . dominante. c) O fenótipo ocorre igualmente em ambos os sexos. se transforma em um pigmento amarelo. c) haverá maior número de animais com genótipos EE e CC do que com genótipo EC na região I. de acordo com o esquema a seguir. Animais com os três genótipos foram introduzidos em duas regiões diferentes designadas por I e II. Em I não há registro da presença do vírus X e em II ele é transmitido por contato com as presas da espécie. os animais de genótipo CC são mais facilmente capturados pelos predadores. Questão 502 Os bulbos da cebola podem ser brancos. b) amarelo com planta de bulbo amarelo não produz plantas com bulbo roxo. que apresentam genótipo __(I)__ podem ter filhos albinos. é INCORRETO afirmar que o cruzamento de plantas de bulbo: a) incolor com planta de bulbo incolor só pode originar fenótipo incolor. uma homozigota para o alelo dominante (AA) e uma homozigota para um alelo recessivo (aa). pois os genótipos serão: a) 1/2 AA e 1/2 aa b) 1/4 AA. a proporção Em uma certa espécie de mamíferos. III e IV devem ser preenchidas correta e.

I. V.Alelo V . A seqüência correta é: a) II. associando os conceitos aos respectivos termos. com dominância completa. V e IV c) II.bastante numerosa. pelo alelo recessivo. c) os animais cruzados eram homozigotos. Animais com cauda longa foram cruzados repetidas vezes entre si originando sempre descendentes com cauda longa. que já tem uma menina normal. II. I. d) os animais cruzados eram heterozigotos. Analisando o genótipo da F.Genoma II . a proporção fenotípica esperada na prole será de a) 3 pretos :1 branco b) 2 pretos :1 branco c) 1 preto : 3 brancos d) 1 preto : 2 brancos e) 1 preto :1 branco Questão 509 Sabe-se que a transmissão hereditária da cor das flores conhecidas como copo-de-leite se dá por herança mendeliana simples. a acondroplasia é uma anomalia determinada por um gene autossômico dominante. Questão 508 Em cobaias. IV e III 112 .Crossing-over III . numa dada espécie. mas não são obrigatoriamente iguais. III e V e) I. quando cruzados entre si. só é possível concluir que a) o caráter é recessivo. III. a cor preta do pêlo é condicionada por um alelo dominante e a cor branca. I . II. Questão 506 No homem. Qual é a probabilidade de um casal de acondroplásicos. ( ) conjunto de genes organizados nos cromossomos.F . vir a ter um menino acondroplásico? a) 1 b) 3/4 c) 3/8 d) 1/4 e) 1/8 Questão 507 Considere que o comprimento da cauda. b) o caráter é dominante. V. A partir desses dados.d) a seleção natural será mais favorável aos animais com genótipo EC na região II. I. V e IV d) IV. os cientistas constataram que apenas um em cada três descendentes vermelhos era homozigoto para essa característica. Os descendentes.Fenótipo IV . e) a seleção natural será mais favorável aos animais com genótipo EE na região II. Se esses descendentes pretos forem cruzados entre si. Em um cruzamento experimental de copos-de-leite vermelhos. seja condicionado por um par de alelos. ( ) conjunto de características detectáveis de um indivíduo. pode-se afirmar que a produção genotípica da F desse cruzamento experimental foi: a) 4 Aa b) 2 Aa : 2 aa c) 3 AA : 1 Aa d) 1 AA : 2 Aa : 1 aa Questão 510 Numere a segunda coluna de acordo com a primeira. ( ) atuam sobre a mesma característica. ( ) segmento do DNA capaz de transcrever uma molécula de RNA. também só originaram filhotes de cauda longa. IV e III b) III. De acordo com tais dados. numa proporção de 3 descendentes vermelhos para cada branco (3:1). I. II. Um cruzamento-teste de um indivíduo de cor preta produziu descendentes brancos e pretos em igual número. e) o genótipo dos descendentes difere do dos pais.Gene ( ) troca de fragmentos de cromossomos homólogos na primeira divisão da meiose. obteve-se uma primeira geração .

a 2 . 50% de mudas altas ao cruzar as mudas altas em F1. responsável pela ocorrência da Segunda Lei de Mendel. Questão 514 Considere as proposições seguintes. 1. a 2 e a 3 são corretas.1. d) se somente II e III estiverem corretas. Questão 512 Com o enorme crescimento populacional.A calvície pode ser originada por causas ambientais. e) se I. a 3 e a 4 são corretas. e) ocorrência de pleiotropia. mas na maioria dos casos é claramente hereditária. e) Y. Assinale: a) se somente I e II estiverem corretas. 100% de mudas altas ao cruzar mudas altas em P1 com mudas altas em F2.A calvície é dominante no sexo masculino 4 . c) Y. b) se somente I e III estiverem corretas. III. 100% de mudas altas ao cruzar mudas altas em F2. sejam mais produtivas. c) Apenas a 1. d) inativação de alelos codominantes. c) se somente I estiver correta.5. a altura. e) Apenas a 2. O enunciado da Primeira Lei de Mendel diz que os alelos de um gene separam-se durante a formação dos gametas. 2 . tanto da espécie X quanto da espécie Y.Questão 511 Considere as seguintes proposições: 1 . cada um atua e segrega independentemente dos demais. sabe-se que o cruzamento de duas linhagens homozigotas selecionadas pode produzir espigas maiores e de melhor qualidade comercial.Uma mulher será calva se seus pais forem calvos e se sua mãe (heterozigota) possuir um de seus genitores calvo.Em nenhuma hipótese a calvície ocorre na mulher. b) taxa de crossing-over. a 3 e a 4 são corretas. Questão 513 No que se refere ao desenvolvimento do chamado milho híbrido. a 3. a 4 e a 5 são corretas. a 3 e a 4 são corretas. realizou-se cruzamento entre mudas altas e baixas das duas espécies (P1).poderiam apresentar mudas com alturas diferentes. o que estimula a obtenção de culturas vegetais com máxima produtividade. I. Concluiu-se com relação a estas proposições que: a) Apenas a 2. 100% de mudas altas ao cruzar mudas altas em P1 com mudas médias em F2. d) Y. obtendo F1 que ao serem fenótipos resultantes dos cruzamentos foram representados nos gráficos a seguir: upondo que as plantas altas. II. por exemplo. é a Anáfase I. em conseqüência da alta a) interação de genes recessivos. Muitas vezes esse melhoramento lança mão do conhecimento da herança genética de um determinado carácter como. 3 . b) X. b) Apenas a 1.X e Y . A fase da meiose. 100% de mudas altas ao cruzar as mudas médias em F2. há também uma necessidade crescente de alimentos. 5 .1 113 . II e III estiverem corretas. d) Apenas a 1. c) freqüência de genes em heterozigose.Um homem calvo (homozigoto) transmite a característica da calvície a todos os filhos homens nascidos de seu casamento com uma mulher não calva. O enunciado da Segunda Lei de Mendel diz que quando dois ou mais genes estão envolvidos. podese afirmar que se obtém na espécie: a) X e na espécie Y. por se tratar de herança ligada ao sexo. Supondo-se que duas espécies vegetais .

b) 100% de flores púrpuras. b) um cruzamento de dois genitores homozigotos contrastantes. EXCETO: a) A expressão do alelo recessivo do gene desaparece apenas em F. Questão 519 Esta figura representa o cruzamento de drosófilas de asas normais com indivíduos de asas enroladas. obteve na primeira geração (F) todos os descendentes de coloração verde.1. b) à segregação do par de alelos durante a formação dos gametas. c) 75% de flores púrpuras e 25% de flores brancas. c) a transmissão dos caracteres adquiridos.1 a) 100% de flores brancas. d) a separação de um par de alelos durante a formação dos gametas. c) O alelo dominante do gene se expressa em cor verde. Questão 516 A primeira Lei de Mendel refere-se a) ao efeito do ambiente para formar o fenótipo. O resultado desse fenômeno ilustra a) a adaptação dos mutantes. Todas as alternativas apresentam conclusões a partir desses resultados. Questão 518 A coloração das flores de ervilha é determinada por herança autossômica.5. criadas em temperatura de 25°C.1. apresentam asas normais. b) As plantas com vagens verdes ou amarelas da geração parental devem ser homozigotas. e) um caráter controlado por dois ou mais genes. 1. d) 50% de flores púrpuras e 50% de flores brancas. e) à união dos gametas para formar o zigoto. b) a influência do ambiente na expressão do genótipo. quando criadas em temperatura de 16°C. c) à ocorrência de fenótipos diferentes em uma população. representado por dois alelos. d) o processo de seleção natural. A figura a seguir representa um dos cruzamentos realizados por Mendel entre plantas de ervilhas com flores púrpuras e plantas com flores brancas. e) Os indivíduos que apresentam vagens de coloração verde em F‚ são heterozigotos. c) um cruzamento de dois genitores heterozigotos.Questão 515 A primeira lei de Mendel ou lei da segregação significa: a) um cruzamento onde se considera apenas um gene. Se Mendel utilizasse como genitor masculino as plantas de flores púrpuras e como feminino.5. d) O caráter é controlado por um par de genes.1 s moscas de genótipo igual ao do tipo III. d) à ocorrência de genótipos diferentes em uma população. Na segunda geração (F‚) obteve 428 verdes e 152 amarelas. mutantes. Questão 520 Analise esta tabela: MÉDIA DAS DIFERENÇAS NAS CARACTERÍSTICAS ENTRE GÊMEOS MONOZIGÓTICOS E DIZIGÓTICOS 114 . as plantas de flores brancas. os descendentes obtidos em F1 apresentariam 1. e) 100% de flores de coloração rósea. Questão 517 Quando Mendel cruzou plantas de ervilha apresentando vagens de coloração verde com plantas de vagens de coloração amarelas.

5. Questão 522 Na espécie humana há um gene que exerce ação simultaneamente sobre a fragilidade óssea. c) a influência ambiental pode ser avaliada em gêmeos MZ. a) Ligação genética b) Penetrância completa c) Pleiotropia d) Herança quantitativa e) Polialelia Questão 523 A presença de sardas em seres humanos é uma característica hereditária determinada por um par de alelos. indivíduos portadores do alelo mutante podem expressar a doença. cerca de 85% dos indivíduos heterozigotos já manifestaram a doença. em que se mostra o percentual de indivíduos doentes entre aqueles que possuem genótipo favorável: 1.1 115 . ocorrem em todas as gerações. om base nos dados dessa tabela e em outros conhecimentos sobre o assunto. aproximadamente 75% dos indivíduos Aa se apresentam sem os sinais clínicos da doença.1 1.1. Questão 521 O mal de Huntington é uma doença autossômica dominante caracterizada por deterioração mental progressiva. é INCORRETO afirmar que. Os indivíduos afetados são heterozigotos. d) aos 40 anos. a) em torno dos 65 anos. d) o comprimento da cabeça apresenta maior influência ambiental. b) antes de atingirem a idade de 15 anos. filhos de casais Aa × aa têm 50% de probabilidade de manifestar a doença.1. c) aos 30 anos. b) as diferenças entre gêmeos MZ indicam diferenças genéticas entre eles. e só pessoas com sardas podem ter filhos com sardas (veja no heredograma abaixo).5. convulsões e morte. podem ser transmitidas de pai para filho.1 Com base nas informações desse gráfico e em outros conhecimentos sobre o assunto.5. Analise este gráfico.1.1. As sardas aparecem igualmente em homens e em mulheres. é CORRETO afirmar que a) o peso é a característica que apresenta maior influência genética. a surdez congênita e a esclerótica azulada. Assinale a alternativa que define o caso.

origina descendentes homozigotos. (16) A freqüência fenotípica numa prole numerosa será 3:1. Em relação aos descendentes deste último casamento e ao caráter em questão. A respeito desse assunto.5. é possível deduzir que a) a presença de sardas se deve a um alelo recessivo ligado ao cromossomo Y.1 116 . a freqüência fenotípica será de 1 acondroplásico para 1 normal. da mesma espécie. (08) O endocruzamento não interfere no valor adaptativo. da mesma espécie. origina descendentes predominantemente heterozigotos. é correto afirmar: (01) O descendente será obrigatoriamente heterozigoto. Questão 524 Uma ovelha branca ao cruzar com um carneiro branco teve um filhote de cor preta. (04) O endocruzamento pode causar uma redução no valor adaptativo pela maior probabilidade de ocorrência de genótipos ou combinações homozigotas de alelos recessivos deletérios. Soma ( ) Questão 526 Cheiros e odores corporais fazem parte do aparato de comunicação em várias espécies de mamíferos. Quais os genótipos dos pais. dispersão dos filhotes ainda jovens. se a cor branca é dominante? a) Ambos são homozigotos recessivos b) Ambos são brancos heterozigotos c) Ambos são homozigotos dominantes d) A mãe é Bb e o pai é BB e) A mãe é bb e o pai é Bb Questão 525 A acondroplasia (uma das formas de nanismo) é causada por um gene dominante autossômico. reconhecimento da prole. é correto afirmar: (01) O cruzamento entre indivíduos geneticamente diferentes. (08) A probabilidade de heterozigose na descendência em relação a este locus é igual a zero. d) a presença de sardas se deve a um alelo autossômico recessivo. b) a presença de sardas se deve a um alelo recessivo ligado ao cromossomo X. (32) Numa prole numerosa. (02) A freqüência genotípica na descendência será 1:2:1. seleção de parceiros e restrições ao endocruzamento. e) a presença de sardas se deve a um alelo autossômico dominante.abendo disso. (04) A probabilidade de acondroplasia na descendência é igual a zero. (02) O cruzamento entre indivíduos geneticamente diferentes. considerando ausência de mutação. (16) Um indivíduo híbrido é aquele que resulta da união entre dois indivíduos geneticamente diferentes. c) a presença de sardas se deve a um alelo dominante ligado ao sexo.1. Este se casa com uma mulher normal cujos pais eram normais (conforme heredograma abaixo). Soma ( ) 1. influenciando uma variedade de atividades como. por exemplo. Da união de um homem acondroplásico com uma mulher normal resulta um filho normal. Machos e fêmeas sentem-se atraídos por odores de linhagens não relacionadas.

Questão 531 Em 2005. com a mesma característica. em 02 de julho de 1995. Que informações permitem avaliar com maior precisão as chances de João e Maria terem um filho albino? a) O fenótipo da irmã de João e o genótipo do avô de Maria. d) O genótipo do primo de João e o fenótipo da mãe de Maria. de 117 . d) alelismo múltiplo. b) A fibrose cística é causada pela presença de um par de genes recessivos. Já Maria tem um avô materno e uma irmã albinos e um irmão com pigmentação normal. João tem um irmão albino e uma irmã com pigmentação normal. Assinale a opção que faz referência a esse erro. ) Apresenta pequeno número de cromossomos. não é surpreendente que a expressão fenotípica de um gene envolva mais do que uma característica. na pesquisa científica. b) heterogeneidade genética. Questão 528 As reações bioquímicas. Os produtos de uma cadeia de reações podem ser utilizados em muitas outras vias metabólicas. a) Os indivíduos 3 a 6 são heterozigotos para a fibrose cística. c) A doença somente se manifesta quando dois indivíduos portadores são cruzados. amplamente utilizado em experimentos na área de genética e evolução. A afirmação acima se refere ao conceito de a) dominância incompleta. Assinale com V (verdadeiro) ou F (falso) as afirmações a seguir sobre esse inseto. ) Apresenta autofecundação. porém João tem uma tia paterna albina e um primo.1 O esquema publicado apresenta um erro. Assim.5. Seus pais não são albinos.Questão 527 A matéria publicada no Jornal O GLOBO. 1. ( ( ( ( ( ) Apresenta variantes genéticas facilmente observáveis. iniciaram-se as comemorações do centenário da utilização da 'Drosophila' sp. são interligadas e freqüentemente interdependentes. Os pais de Maria também têm pigmentação normal. e) O indivíduo 18 é afetado pela fibrose cística e não um portador desta doença. por parte de mãe. c) O fenótipo do irmão de João e o fenótipo da irmã de Maria. com o título "Teste ajuda a evitar doenças congênitas". em sua maioria. A seqüência correta de preenchimento dos parênteses.1. c) pleiotropia. ) Apresenta ciclo reprodutivo curto e fecundidade alta. representando o mecanismo de transmissão da fibrose cística: Questão 529 A Primeira Lei de Mendel ou Lei da Segregação dos Genes pode ser relacionada a uma das fases do processo meiótico. d) O indivíduo 8 é homozigoto dominante para a fibrose cística. e) fenocópia. a) Prófase I b) Metáfase I c) Anáfase I d) Metáfase II e) Telófase II Questão 530 João e Maria estão pensando em ter um filho. e) O fenótipo do pai de João e o genótipo do pai de Maria. foi ilustrada com o esquema a seguir. ) Não apresenta dimorfismo sexual. b) O genótipo da tia de João e o genótipo do irmão de Maria. Assinale a alternativa que apresenta a fase referida.

somente em homozigose. Simas é bruxo. I ...5.Hermione apresenta dois alelos para o caráter bruxo. na ordem em que aparecem.. d) V . d) seu pai ser heterozigoto.. foi sugerido que a característica de ser ou não bruxo seguiria padrão de segregação mendeliana. e) I. Assinale o número esperado de descendentes com pelagem branca.F .obedece ao proposto pela 1 Lei de Mendel. Na família do avô materno..5/8 b) 4/8 . preocupado com a possiblidade de vir a ser calvo..2/8 e) 7/8 .. e) sua avó materna ser heterozigota.. de ervilhas verdes.V ..F ..V .3/8 d) 6/8 . resultando em 192 descendentes.F.V. Hermione é bruxa mas filha de trouxas (não bruxos). c) Apenas I e III..F .. e) V .V .F .. filho de uma bruxa e de um trouxa.F .F. c) V ..F .. consultou um amigo que estava estudando genética. Questão 535 Considere que o caráter analisado . III .V . Neville e Draco são bruxos.V. sua avó materna era. a produção de uma geração Fƒ a partir da autofertilização da geração F‚ resultante do cruzamento de ervilhas parentais homozigotas amarelas (AA) e verdes (aa) produziria . a) 3/8 .F .V . Essa conclusão baseia-se no fato de a) sua mãe ser heterozigota. Com base no texto.Harry é menos bruxo que Rony. d) Apenas II e III. de ervilhas amarelas e .... Questão 533 Assinale a alternativa que preenche corretamente as lacunas do texto a seguir.. b) seu avô paterno ser calvo.4/8 c) 5/8 . De acordo com a hipótese de segregação de fatores proposta por Mendel.Contou que. 118 . sendo sua mãe filha de trouxas. Assim concluiu que a chance de Leandro vir a ser calvo era de 50%.1. 776).V .. considere as seguintes afirmações sobre o caráter bruxo em termos genéticos. filho de bruxos.V.. Neville e Draco. tendo sido realizados os cruzamentos a seguir: 1. embora seus pais não fossem calvos. não havia histórico de calvície. Harry é bruxo.... b) Apenas II. c) sua avó paterna ser heterozigota..V . Rony. Quais estão corretas? a) Apenas I.Simas é heterozigoto para o caráter bruxo.. filhos de pais bruxos.1 Todos os descendentes pretos de F2 foram cruzados com os F1. II .1/8 Questão 534 Leandro.cor da pelagem em coelhos ..cima para baixo é a) F .. Seu amigo explicou que a calvície é uma característica influenciada pelo sexo e que se expressa nos homens em homo e heterozigose e nas mulheres. b) F . Questão 532 Conforme correspondência publicada na revista científica "Nature" de agosto de 2005 (p.F . provenientes de famílias bruxas tradicionais. II e III.

Questão 538 De acordo com a primeira lei de Mendel. apenas o efeito ambiental prevalece no fenótipo. c) 50%. b) Na expressão gênica os efeitos do ambiente celular não são considerados. d) 100%. Considerando que o homem-aranha é o único a ter essa mutação. c) 50% com alelo recessivo e 50% com alelo dominante. c) 50% heterozigota. Questão 537 Por meio da técnica do DNA recombinante. 119 . responsável pela síntese do hormônio do crescimento (somatotrofina). por exemplo. uma cópia de um gene humano. e) formada por homozigotos recessivos.Questão 536 Em vários cultivos. 25% poderá ser de meninos-aranha.1. Desta forma. c) Os genes dominantes são independentes dos fatores ambientais para se expressarem. o que se deseja é a produção de sementes. Este zigoto foi implantado em uma "mãe de aluguel". b) 25%. de gametas: a) 100% com alelo recessivo. não portadora do gene do hormônio do crescimento.5. Com relação aos princípios básicos da hereditariedade. d) Pode ser muito difícil determinar se o fenótipo resulta mais do efeito gênico do que o ambiental. Para a produção de milho. b) 50% dominante e 50% recessiva. e) Na presença de genes recessivos.1 Se o camundongo macho gigante cruzar com uma fêmea normal. um indivíduo heterozigoto para um caráter regulado por dominância completa provavelmente produzirá a seguinte porcentagem Suponha que um evento de mutação permitiu ao homem-aranha secretar a seda formadora de teia. foi integrada a um único cromossomo. Assinale a afirmativa CORRETA: a) Terá filhas-aranha se casar com uma prima de primeiro grau. assinale a alternativa CORRETA: a) Os genes codominantes têm menor influência no fenótipo do que os fatores ambientais. mulheres-aranha seriam esperadas na população apenas se tal alelo ocorresse em homozigose (SS). provavelmente. a expectativa quanto aos fenótipos de seus futuros descendentes poderá ser uma entre as possibilidades abaixo. será igual a a) zero. gerando um camundongo macho gigante. e) Quem herdar o cromossomo Y deverá ser uma criança-aranha. Questão 539 Os mecanismos da herança apresentam diferentes maneiras pelas quais os genes interagem entre si e com o ambiente para manifestarem seus efeitos no fenótipo dos seres vivos. b) 100% com alelo dominante. Se o pólen de uma planta heterozigota para um determinado loco gênico fecundar os óvulos de uma planta também heterozigota para esse loco. d) 75% com alelo dominante e 25% com alelo recessivo. c) Na geração F1. 25% homozigota dominante e 25% homozigota recessiva. é necessário que ocorra a polinização. a fração de descendentes gigantes. mas com expressão influenciada pelo sexo. Questão 540 1. na fase G do ciclo celular. d) Analisando apenas as filhas. Esse único evento resultou na formação de um alelo (S) autossômico e dominante. de zigoto de camundongo. d) formada por homozigotos para o alelo dominante. e) 75% com alelo recessivo e 25% com alelo dominante. espera-se que a F seja a) 100% heterozigota. b) Todos os seus meninos deverão ter o fenótipo "aranha". 50% delas deverão ser normais.

e) Depende do tipo de diabete. com prejuízo da fala e dos movimentos. c) Sim. Questão 543 O gene autossômico. por meio do qual se identifica a fenilcetonúria. e) 180. (3) Os homens normais representados no heredograma são necessariamente heterozigotos. pois tanto o genótipo como o fenótipo dos filhos são alterados pela insulina. A administração de insulina aos diabéticos evitará que eles tenham filhos com este distúrbio? a) Não. b) 60. pois nesses casos o genótipo pode ser alterado evitando a manifestação da doença nos filhos. b) Não. Questão 542 Os vários tipos de diabete são hereditários. das quais 240 tinham pêlos curtos. 1. foram realizados cruzamentos entre esses animais. d) 160.5. embora o distúrbio possa aparecer em crianças cujos pais são normais. (5) A dieta especial a que devem ser submetidos os recém-nascidos fenilcetonúricos tende a alterar a freqüência do gene da fenilcetonúria na população. d) Sim. os sintomas podem ser evitados por meio de injeções diárias de insulina.Questão 541 No Brasil. Questão 544 Considerando-se que a cor da pelagem de cobaias é determinada por um par de alelos. é dominante em relação ao gene que determina pêlos longos.1. pois a insulina é incorporada no sangue fazendo com que os filhos não apresentem o distúrbio. (2) O cruzamento entre os indivíduos 10 e 11 ilustra como a consangüinidade influencia o aparecimento de doenças hereditárias. doença hereditária que pode levar ao retardamento mental. Do cruzamento de cobaias heterozigotas nasceram 300 cobaias.5%. que condiciona pêlos curtos em cobaias.1. que pode apresentar dominância ou recessividade. o número esperado de heterozigotos é: a) 45. essa doença pode ser controlada ministrando-se ao recém-nascido uma dieta especial.1 Considerando o heredograma. conforme a tabela. (4) A probabilidade de que o casal formado pelos indivíduos 10 e 11 tenha um descendente do sexo masculino fenilcetonúrico é igual a 12. julgue os itens abaixo. pois o genótipo dos filhos não é alterado pela insulina.5. Entre as cobaias de pêlos curtos. (1) O caráter fenilcetonúrico apresenta herança autossômica dominante. Se detectada a tempo. O heredograma seguinte ilustra uma situação em que há indivíduos fenilcetonúricos. c) 90. Em algumas dessas formas. pois a insulina é incorporada nas células e terá ação nos filhos. 1.1 120 . uma lei determina que os recém-nascidos sejam submetidos ao "teste do pezinho".

d) herança ligada ao sexo e homozigotos recessivos. c) no cruzamento III. enquanto as rosas são heterozigotas. Questão 548 Mendel cruzou duas variedades de 'Mirabilis jalapa'. b) codominância e heterozigotos c) linkage e heterozigotos. d) no cruzamento IV. Embora plantas albinas morram antes de produzirem sementes. e) ligada ao cromossomo Y e recessiva. os pais são heterozigotos. d) o gene para albinismo é ativado no escuro. c) plantas albinas tornam-se verdes na presença de luz. Trata-se de um caso de _____________ e os indivíduos parentais são _______________. o fenótipo dominante é mascarado pelo fenótipo recessivo. entre outras manifestações. brancas ou rosas. por suscetibilidade aumentada a infecções e tendência a sangramentos. As flores vermelhas e brancas são homozigotas. d) em 50% da prole.análise da tabela permite concluir que a) no cruzamento I. 7 brancos e 8 pretos. e) o albinismo impede a síntese de clorofila. existe uma síndrome caracterizada. os pais são heterozigotos. O preenchimento correto das lacunas é. Indique qual será o resultado do cruzamento da variedade de flores rosas (F‚). é necessário cruzar: a) duas plantas de flores rosas. b) em 25% da prole. normais. respectivamente: a) herança quantitativa e homozigotos dominantes. pode-se dizer que o tipo de herança responsável por essa síndrome é a) autossômica recessiva. Essa síndrome é mais freqüente em descendentes de casais aparentados e ocorre em machos e fêmeas em proporção relativamente igual. b) uma planta de flores brancas com outra de flores rosas. a proporção fenotípica observada em F‚ significa exatamente que: a) 25% da prole expressam o fenótipo determinado pelo alelo dominante e 75% não o expressam. nasceram 15 filhotes azulados. e) epistasia e homozigotos dominantes. Questão 547 No cruzamento de plantas verdes. d) ligada ao cromossomo X e recessiva. o fenótipo recessivo é mascarado pelo fenótipo dominante. Questão 546 Em um cruzamento de um indivíduo AA com outro aa. Com base nessas informações. a) 25% brancas : 25% vermelhas : 50% rosas b) 25% brancas : 50% vermelhas : 25% rosas c) 100% rosas d) 50% vermelhas : 50% rosas e) 50% brancas : 25% vermelhas : 25% rosas Questão 549 Do cruzamento entre aves andaluzas de coloração azulada. e) no cruzamento V. uma com flores vermelhas e outra com flores brancas. c) uma planta de flores rosas com outra de flores 121 . c) 75% da prole expressam o fenótipo determinado pelo alelo A e 25% não o expressam. b) no cruzamento II. observou-se que a síndrome não se manifesta em algumas gerações e pode ocorrer em indivíduos que aparentemente têm pais normais. Na geração F todas as flores eram rosas. b) plantas normais homozigóticas tornam-se albinas na ausência de luz. c) ligada ao cromossomo X e dominante. considerando que o alelo Aé dominante sobre a. b) autossômica dominante. são observados dois fenótipos e três genótipos entre os descendentes. e) 50% da prole possuem um único tipo de alelo e 50% possuem outro tipo de alelo. Questão 550 As flores da planta maravilha podem ser vermelhas. a característica "albinismo" não desaparece entre elas. os genótipos dos pais podem ser diferentes. é possível o aparecimento de indivíduos albinos. Ao fazer a genealogia de vários indivíduos. Questão 545 Em gatos. podem ocorrer três genótipos diferentes entre os descendentes. Para se obter 50% de flores brancas. Isto se explica porque: a) muitas plantas verdes são heterozigóticas.

para sua surpresa. (Adaptado de "Ciência Hoje". a) 1 : 3 : 1 e 3 : 1 b) 1 : 2 : 1 e 1 : 2 : 1 c) 1 : 1 : 2 e 1 : 1 : 1 d) 1 : 3 : 1 e 3 : 1 : 3 e) 1 : 1 : 1 e 3 : 1 Questão 555 Em estudo publicado na revista Nature de 25 de junho passado. pesquisadores da Universidade de Toronto. causada pela deficiência da enzima lactase. e) duas plantas de flores vermelhas. b) trata-se de um caso de co-dominância entre os genes alelos que determinam o padrão de cor. d) co-dominante. é INCORRETO afirmar: a) A propagação vegetativa de uma planta verde deve produzir plantas verdes. Questão 553 Em "Mirabilis jalapa" (maravilha). Essa característica é autossômica e. d) as plantas de flor vermelha eram dominantes e as de cor branca recessivas. Em conseqüência da falta dessa enzima. Questão 551 A maioria das populações é composta por pessoas que manifestam perda progressiva da lactase intestinal após o desmame. estas últimas em quantidade duas vezes maior que as plantas de flor branca e vermelha. d) uma planta de flores vermelhas com outra de flores brancas.2 e acordo com a tabela e com seus conhecimentos. e) trata-se de um caso de gene letal. respectivamente. Questão 552 Valéria gostava muito de flores. 1. b) dominante. a lactose. Agosto de 1999. Três fenótipos são observados: verde.5. no Canadá. em sua forma normal. 49) A alergia ao leite pode ser hereditária. notou a existência de plantas de uma mesma espécie que possuíam indivíduos com flores brancas. codifica a síntese de uma enzima que 122 . o caráter tonalidade da cor das folhas e ramos é transmitido geneticamente através do citoplasma dos óvulos. c) as plantas de flor rosa eram recessivas.vermelhas. Este gene. Curiosa para saber como se dava a transmissão desse caráter. Questão 554 No monoibridismo com co-dominância ou dominância intermediária. c) epistática. obteve plantas que davam flores brancas. vermelhas e rosas. nas populações ocorrem três fenótipos relacionados à atividade da enzima: indivíduos sem atividade de lactase. pois o cruzamento de plantas de flores brancas e vermelhas só originou flores rosas. indivíduos com atividade de lactase e indivíduos com atividade parcial da lactase. Essa distribuição é característica de um padrão de herança a) recessiva. as proporções genotípicas e fenotípicas observadas na segunda geração dos filhos serão. c) É uma herança ligada ao sexo em vegetais.1. Observando seu jardim. verde pálido. A tabela abaixo apresenta o resultado de seis possíveis cruzamentos. p. Valéria concluiu CORRETAMENTE que: a) trata-se de dominância da cor rosa sobre as demais. afirmam que o gene CYP2A6 está ligado à dependência das pessoas ao cigarro. b) Genes estão envolvidos na determinação dos fenótipos. d) O fenótipo pode ser influenciado por fatores ambientais. obtendo plantas que só davam flores de cor rosa. rosas e vermelhas. variegadas (pigmentação irregular). e) quantitativa. Valéria promoveu uma autofecundação nas plantas de cor rosa e. essas pessoas perdem a capacidade de digerir o açúcar do leite.

1. portadores de um alelo normal e outro defeituoso. apesar de fumantes. é CORRETO afirmar que a) o gene HbA é dominante sobre o gene HbS. Questão 557 Analise esta tabela. Com base no texto anterior.5. na espécie humana. jamais se tornam dependentes. pois o heterozigoto apresenta fenótipo diferente de ambos os homozigotos. é correto afirmar que a dependência ao cigarro determinada pelo gene CYP2A6 é um caso de: a) herança quantitativa. consumindo 20% menos cigarros que os fumantes inteiramente dependentes. Questão 556 Observe o esquema.2 Considerando-se as informações contidas nesta tabela e outros conhecimentos sobre o assunto. c) os indivíduos que produzem só hemácias anormais podem ser curados por meio de transfusão sangüínea. em que estão relacionadas características das gerações F1 e F2. Fumantes portadores de dois alelos normais (homozigoto para o alelo normal) são altamente dependentes do cigarro. b) os indivíduos HbA/HbS e HbS/HbS devem apresentar os mesmos níveis de hemoglobina anormal. pois o fenótipo apresenta uma continuidade entre dependentes e não dependentes. d) o gene que determina "plumagem azulada" é dominante sobre os genes que determinam "plumagem preta" ou "plumagem branca". ainda.metaboliza a nicotina. três alelos para este gene: um normal e dois defeituosos. é INCORRETO afirmar que a) os pares de genes que determinam o "tipo" e a "cor" da asa nas moscas estão localizados em cromossomas não-homólogos. e) dominância incompleta entre a forma normal e as defeituosas do gene CYP2A6. que há. pois qualquer um dos alelos defeituosos inibe. a ação do alelo normal.2 1. b) as características "tipo de semente" e "cor de plumagem" são determinadas. c) epistasia recessiva.1. c) as plantas da F2 com "sementes rugosas". são moderadamente dependentes. enquanto que portadores de dois dos alelos defeituosos. Com base nesse esquema e em conhecimentos sobre o assunto. tornando as pessoas dependentes. Por outro lado. resultantes dos cruzamentos de linhagens puras de três organismos diferentes: 1. Eles afirmam. 123 . originam apenas descendentes com sementes rugosas. cada uma delas. b) pleiotropia. d) dominância completa da forma normal do gene CYP2A6 sobre as formas defeituosas. d) um determinado genótipo pode produzir diferentes fenótipos. quando autofecundadas. parcialmente. fumantes heterozigotos.5. por um único par de gene.

descendentes do cruzamento de um homem e uma mulher portadores de talassemia menor. considerando que neste experimento: (01) ocorreu a segregação de três fenótipos: o branco. d) epistasia. I. b) dominância incompleta. heterozigotos. Sabendo-se que todos os indivíduos com talassemia maior morrem antes da maturidade sexual. co-dominância e expressão gênica influenciada pelo sexo. A descendência originada (F) apresentou apenas plantas com flores cor-de-rosa. Homens com genótipo C¢C¢ (homozigotos) ou C¢C£ (heterozigotos) são calvos. c) 3Ž filho ë heterozigoto. Os heterozigotos resultantes do cruzamento entre essas duas linhagens (CÑCß) apresentam flores de cor rosa. Da autofecundação das plantas da F. foram obtidas plantas com flores exclusivamente brancas. Assinale a(s) proposição(ões) VERDADEIRA(S). pleiotropia e penetrância incompleta. O primeiro morreu aos 5 anos de idade. há indivíduos homozigotos. Questão 560 A talassemia é uma doença hereditária que resulta em anemia. Na planta boca-de-leão. e) herança poligênica. portanto. qual das alternativas a seguir representa a fração de indivíduos adultos. dominantes com relação ao alelo i. Indivíduos homozigotos com genótipos (CßCß) apresentam flores brancas. 124 . dominância incompleta e expressão gênica influenciada pelo sexo. enquanto mulheres C¢C¢ são calvas e C¢C£ são normais. corretamente. exemplos de a) dominância incompleta. Assinale a opção em que se indicam. certamente apresentam genótipos homozigotos. Questão 559 Um experimentador cruzou duas linhagens puras de uma planta denominada boca-de-leão. que serão anêmicos? a) 1/2 b) 1/4 c) 1/3 d) 2/3 e) 1/8 Questão 561 Considere as seguintes formas de herança: I. vermelhas ou cor-de-rosa. (02) a proporção genotípica esperada nas plantas de F‚ é: 1 planta com flores cor-de-rosa: 2 plantas brancas: 1 planta vermelha. Herança: co-dominância. cujo genótipo (CÑCÑ) define cor vermelha nas flores. respectivamente. o segundo é normal e bastante suscetível a malária (doença endêmica na região). III. (16) a F‚ esperada será constituída de 50% de indivíduos homozigotos e 50% de indivíduos heterozigotos. em conseqüência de anemia falciforme.Questão 558 Um casal de africanos teve três filhos. Indivíduos homozigotos NN são normais. apresentam uma forma mais branda chamada de talassemia menor. porém pouco suscetível a malária. II. d) mãe ë homozigoto dominante. A calvície é determinada por um alelo autossômico. o vermelho e o cor-de-rosa. que deram origem ao experimento. o último é normal. c) co-dominância. o genótipo IÞIß determina tipo sangüíneo AB. Os alelos IÞe Iß são. II e III são. Em humanos. indivíduos com genótipos IÞIÞ ou IÞi apresentam tipo sangüíneo A e os com genótipos IßIß ou Ißi apresentam tipo sangüíneo B. Herança: pleiotropia. identificada como talassemia maior e os heterozigotos MN. Indivíduos homozigotos MM apresentam a forma mais grave. co-dominância e dominância incompleta. Tanto homens quanto mulheres C£C£ são normais. (04) as linhagens puras. certamente. Herança: epistasia dominante. (08) os indivíduos de F eram. uma constituída de plantas com flores brancas e outra com flores vermelhas. Por outro lado. o membro da família com seu respectivo genótipo e o padrão de herança da anemia falciforme. epistasia e pleiotropia. Herança: dominância completa. a) 2Ž filho ë homozigoto recessivo. b) pai ë heterozigoto.

II: 2 genes com dominância incompleta.1. existe uma anomalia que se caracteriza pelo encurtamento das asas. 2. II: 1 gene com dominância incompleta. Questão 565 Em determinado tipo de camundongo. c) I: 1 gene com dominância incompleta. ss.5. b) nos genótipos homozigotos.1. d) I: 3 genes com dominância incompleta. Questão 563 Os gráficos I e II representam a freqüência de plantas com flores de diferentes cores em uma plantação de cravos (I) e rosas (II). ss. 3 e 4. respectivamente: 1. originam uma descendência com indivíduos anômalos e normais numa proporção de 2 :1. de forma mais precisa. e) I: 2 genes com interação. Questão 564 Em aves. II: vários genes com interação. respectivamente: a) 1/2 e 1/2 b) 1/4 e 3/4 c) 2/3 e 1/3 d) 3/4 e 1/4 Questão 566 1.Ss.5.4 a) autossômica dominante . as pessoas surdas estão representadas por símbolos hachurados: Com base nessa afirmação. Ss e SS. b) I: 1 gene com dominância incompleta. e) epistático. d) autossômica recessiva . SS.2 Os padrões de distribuição fenotípica são devidos a: a) I: 1 gene com dominância. esperam-se as seguintes proporções de camundongos de pelagem branca e preta. Ss. Ss e Ss. c) pleiotrópico. Seu alelo recessivo "a" condiciona pelagem preta. b) letal recessivo. d) hipostático.ss. a pelagem branca é condicionada pela presença do gene "A". A partir desses dados. d) nos genótipos recessivos. 125 . e) na ligação gênica. II: 1 gene com alelos múltiplos.Questão 562 Em genética. SS e SS. Ss e Ss. respectivamente. letal em homozigose. c) nos genótipos dominantes. assinale a opção correta quanto ao tipo de herança e os genótipos dos indivíduos 1. Quando aves anômalas heterozigóticas são cruzadas. é possível deduzir que o alelo que condiciona a anomalia é a) letal em homozigose. ss.SS. Na espécie humana há um tipo de surdez hereditária que é determinada por um par de genes.SS. a) nos genótipos heterozigotos. II: vários genes com interação. No heredograma a seguir. ss e ss. b) autossômica dominante . a dominância parcial e a codominância entre alelos definem-se. e) autossômica recessiva . c) autossômica dominante .Ss. Para os filhotes vivos de um cruzamento de um casal de heterozigotos.

1.4 obre as informações contidas no heredograma. (III) e (IV). onde os indivíduos masculinos são representados por quadrados e os femininos por círculos. 2. quanto à presença de alelos mutantes de fenilalanina hidroxilase nos membros da família marcados com algarismos romanos. os quadrados cheios representam meninos afetados por uma doença genética. 5 c) 1.1. 6. c) V é necessariamente homozigoto.4 126 . b) VI possui dois alelos mutados. Assinale a alternativa que mostra as porcentagens que preenchem corretamente os espaços I. 5. Se a doença for condicionada por um par de alelos recessivos localizados em cromossomos autossômicos.5. 5. Questão 568 Analise o heredograma a seguir. 4. num segmento sem homologia com o cromossomo Y. Considere o heredograma a seguir de uma família com membros acometidos (símbolos cheios) e normais (símbolos vazados). 9 Questão 569 No heredograma.5.1. 7 e) 3. III e IV. 4 b) 1. e) I é necessariamente homozigoto. 1. 2.1. 2. Pacientes acometidos desse mal. 8 d) 4. as probabilidades de o pai (A) e de a mãe (B) do menino (C) serem portadores desse alelo são. 6. apresentam uma série de complicações como retardo mental. as probabilidades de o pai e de a mãe serem portadores desse alelo são. não conseguem metabolizar a fenilalanina e. 3. odemos dizer. Caso a anomalia seja condicionada por um alelo recessivo ligado ao cromossomo X. respectivamente. podemos afirmar que os indivíduos heterozigotos são: a) 1. d) III possui apenas um alelo mutado. além de não sintetizarem catecolaminas corretamente. assim. que: a) VIII pode ter um alelo mutado. (I) e (II). epilepsia. hipopigmentação.4 1.Questão 567 A fenilcetonúria (PKU) é uma doença de origem genética bastante conhecida. causada por uma deficiência da enzima fenilalanina hidroxilase. respectivamente.5. entre outras. II.

localizado no cromossomo X. b) recessivo.1.4 1. localizado no cromossomo x. conclui-se que a anomalia é determinada por gene a) dominante. Questão 572 O tipo de herança genética apresentada pelos indivíduos afetados é: a) autossômica dominante. c) dominante. d) ligada ao x recessiva.4 om base na análise do heredograma. localizado em autossomo. d) recessivo. e) localizado no cromossomo Y. c) ligada ao x dominante.4 1.1.1. Questão 571 No heredograma a seguir. d) recessivo. círculos representam mulheres. 1. quadrados representam homens e símbolos preenchidos representam indivíduos portadores de certa característica. localizado no cromossomo y. localizado no cromossomo y. e) recessivo. localizado em um autossomo.5. b) dominante. c) dominante. localizado em autossomo. b) autossômica recessiva.1. e) ligada ao y. Os símbolos escuros indicam os portadores de uma anomalia hereditária. Questão 574 127 .5. localizado no cromossomo X.4 nalisando-se a genealogia. Questão 573 Se os indivíduos 7 e 11 se casarem.5.5. pode-se concluir que a característica em questão é condicionada por gene a) dominante. a probabilidade desse casal ter uma filha com o mesmo fenótipo do avô materno é de: a) 1/2 b) 1/4 c) 1/8 d) 1/3 e) 2/3 1.Questão 570 O esquema a seguir representa indivíduos de três gerações de uma família. localizado em um autossomo.

c) É do tipo recessiva autossômica porque o número de indivíduos afetados é menor do que o de não afetados. indique a opção que apresenta a afirmativa correta sobre a herança da característica referida no heredograma. c) A probabilidade de o indivíduo 7 ser heterozigoto é de 18%.1.4 1.1. as probabilidades dos casais 7×8 e 9×10 terem crianças normais são. d) É do tipo recessiva ligada ao sexo porque todo progenitor masculino afetado transmite a característica para suas filhas.5. d) O caráter em estudo pode ser ligado ao sexo.5. c) 50% e 50%. na qual a freqüência de indivíduos afetados é de 1%. é correto afirmar.5. b) É do tipo dominante autossômica porque o genótipo pode estar presente na prole de ambos os sexos sem estar presente nos pais. EXCETO: a) A segunda geração pode ser composta apenas por indivíduos homozigotos.4 Considerando-se que a família acima representada faz parte de uma população em equilíbrio de Hardy-Weimberg.1. b) 0 e 75%.4 No heredograma acima.1. se os indivíduos marcados são afetados por uma característica genética. Questão 576 No heredograma adiante. os indivíduos 3 e 5 são afetados por uma anomalia genética recessiva. 1. de: a) 100% e 50%. d) 0 e 25%. respectivamente. b) O indivíduo 8 apresenta o mesmo fenótipo e o mesmo genótipo do avô para o caráter em questão. Questão 575 Analise o seguinte heredograma de uma característica transmitida geneticamente: om base nessa análise. e) É do tipo dominante ligada ao sexo porque todos os filhos homens herdam a característica da mãe. 128 . a) É do tipo recessiva autossômica porque o genótipo pode estar presente na prole de ambos os sexos sem estar presente nos pais. e) 100% e 75%.

as figuras 6. b) Apenas I.1.5.A mulher representada pelo número 5 tem possibilidade de ser homozigota.5.Questão 577 No heredograma. d) Apenas II. causada por um gene restrito ao sexo. e) a incapacidade de enrolar a língua. os eventuais filhos nascerão afetados. com certeza. III e IV.1. causada por um gene autossômico dominante. II . Questão 579 A Doença de Huntington (DH) é uma anomalia autossômica com caráter dominante cuja manifestação ocorre na fase adulta. No heredograma a seguir. causada por um gene recessivo ligado ao sexo. d) a hipertricose. IV . é correto concluir que tal característica é a) a calvície. III e IV. causada por um gene autossômico influenciado pelo sexo. III .4 129 . e os indicados em branco não a apresentam. 1.4 1. c) a hemofilia.Se houver casamento consangüíneo entre 9 e 11. b) o lóbulo da orelha livre. na fase adulta. II e III. e) Apenas uma das afirmações. 10 e 12 representam indivíduos que.4 onsiderando que os indivíduos indicados em preto são afetados por uma característica genética. Questão 578 Responder à questão com base no heredograma a seguir.1.É uma doença de caráter dominante autossômica.As pessoas 1 e 2 são heterozigotas. II. os indivíduos afetados por DH estão indicados em negro. causada por um gene autossômico recessivo. c) Apenas II e III. São corretas as afirmações: a) I. xamine as afirmações: I . com uma progressiva perda do controle motor e problemas psiquiátricos como demência e distúrbios afetivos.5. desenvolveram a mesma doença hereditária: 1.

5. 4.F .F c) V .1.4 essa família. de cima para baixo.1. Questão 582 Na genealogia a seguir. 5 e 7 apresentam uma anomalia condicionada por gene autossômico dominante.5. ( ) Os indivíduos II-1 e II-3 são heterozigotos. 4 e 7 são braquidáctilos. c) tem dedos normais e é homozigoto.V . A seqüência correta de preenchimento dos parênteses. Considerando essas informações e desprezando a possibilidade de ocorrência de mutação. 3. I-2. nos parênteses. ( ) Os indivíduos II-2 e II-4 são heterozigotos.V . 2.V .V b) F . b) é braquidáctilo e heterozigoto.F . II-1 e II-3 são homozigotos.F . 1. Assinale.V . ( ) Os indivíduos I-1.5. ( ) Os indivíduos III-1. e) pode ser ou não braquidáctilo e é homozigoto. que é determinado por um par de genes: 130 .4 Questão 581 Analise a genealogia a seguir.F . 2.F .1. III-2. V para as verdadeiras e F para as falsas. d) tem dedos normais e é heterozigoto. Já as pessoas indicadas pelos números 3 e 6 têm fenótipo normal. onde foi estudado o caráter BRAQUIDACTILIA (dedos curtos). III-3 e III-4 são homozigotos.F d) V . é a) F .s afirmativas abaixo referem-se aos possíveis genótipos dos indivíduos indicados no heredograma. enquanto os indivíduos 5 e 8 apresentam dedos normais. as pessoas indicadas pelos números 1.V e) V . pode-se afirmar que o indivíduo 6: a) é braquidáctilo e homozigoto.4 1.V Questão 580 Qual dos heredogramas a seguir ilustra uma condição biologicamente IMPOSSÍVEL? 1. os indivíduos 1.V .

1.4 probabilidade do casal 3×4 ter o primeiro filho homem e que venha a ser calvo.1.5. 1.5. Os símbolos escuros representam indivíduos que exibem a característica recessiva. Observe a genealogia a seguir. Questão 583 A calvície é uma característica influenciada pelo sexo e o gene que a condiciona se comporta como recessivo no sexo feminino e dominante no sexo masculino.4 No heredograma abaixo.1.Após a análise da genealogia. os símbolos escuros representam indivíduos que possuem uma anomalia. d) não há possibilidade de a pessoa indicada pelo número 5 ser heterozigótica. pode-se concluir que: a) apenas as pessoas indicadas pelos números 1 e 2 são heterozigóticas. relativa a essa característica. 1. b) a pessoa indicada pelo número 4 é homozigótica.4 esse heredograma NÃO se pode determinar o genótipo do indivíduo a) 1 b) 3 c) 5 d) 6 e) 7 Questão 585 1. 131 . c) a pessoa indicada pelo número 3 transmitiu o gene recessivo para seu descendente indicado pelo número 7. é: a) 1/2 b) 1/4 c) 1/8 d) 1/6 Questão 584 O heredograma a seguir representa a herança de um par de genes entre os quais há dominância. e) o casal indicado pelos números 6 e 7 não poderá ter descendentes com fenótipo normal.5.

Todos os indivíduos que apresentam a anomalia são homozigóticos. a linhagem pôde ser reestabelecida por meio do acasalamento descrito a seguir: 1. 1/4 b) 1/4. 132 . É correto o que se afirma APENAS em a) I b) II c) III d) I e II e) II e III Questão 586 No heredograma adiante. III.onsidere as seguintes afirmativas sobre esse heredograma: I.4 Questão 587 O heredograma mostra a incidência de uma anomalia genética em grupo familiar.4 1. 1/4 e) 1/2.5. respectivamente: a) zero. 2/2 1. e) todos os indivíduos normais são homozigotos dominantes ou heterozigotos. a criança II-1 tem fibrose cística. Após uma infecção em que apenas uma fêmea nocaute sobreviveu.4 pós a análise deste heredograma. 1/4 d) 1/2. c) a anomalia ocorre apenas em homozigotos dominantes. A anomalia é condicionada por um alelo dominante.1.1. O único indivíduo que não pode ter o seu genótipo definido é o I-4.1. b) a anomalia é condicionada por um gene recessivo. Questão 588 Foi estabelecida uma linhagem de camundongos nocaute esses animais se caracterizam por não expressar um determinado gene. 1/2 c) 1/4. As probabilidades de que sua irmã (II-2) não afetada seja carreadora ou não carreadora da fibrose cística são.5. uma doença causada por um alelo recessivo autossômico.5. II. podemos afirmar: a) todos os indivíduos normais são homozigotos recessivos. d) todos os indivíduos normais são homozigotos dominantes.

na família representada.4 Com relação ao heredograma.1. 1. uma estudante concluiu que a característica transmitida. b) O indivíduo II. 50% dos filhotes são animais com o genótipo heterozigoto.5.5 também seria afetado.4 m relação à característica representada no heredograma. se a herança fosse ligada ao Y. se a herança fosse recessiva ligada ao X. EXCETO a) A herança pode ser autossômica.ode-se afirmar que: a) Por meio do acasalamento do macho 3 com a fêmea nocaute.3 tem filha normal.5. Questão 589 Analise o heredograma que representa a herança de um tipo de disfunção dos músculos esquelético e cardíaco em seres humanos. por isso é improvável uma herança dominante ligada ao X. c) A herança pode representar uma família de hemofílicos. d) O cruzamento do macho 2 com uma das fêmeas de F originará camundongos dos quais 75% serão heterozigotos. d) Os filhos homens de I.2 não possui pais afetados. b) A herança pode ser ligada ao sexo. Questão 590 Analise o heredograma. e) A herança do caráter nocaute é autossômica dominante. e) o casamento de III-4 com indivíduo de fenótipo igual a II-4 tem como resultado esperado 100% de mulheres afetadas. b) a ocorrência da característica nessa família se deve aos casamentos consangüíneos. d) as mulheres afetadas apresentam fenótipos idênticos aos de suas mães. b) Em F‚.1. pós analisar esse heredograma. e) II-2. II-5 e III-1 podem ser homozigotos dominantes. é autossômica recessiva. todas as alternativas são possíveis.5.4 Observe este heredograma: 1. 133 . c) O indivíduo III. Questão 591 1. essa estudante considerou todas as seguintes hipóteses. d) I-1 e I-2 podem ser heterozigotos. Para chegar a tal conclusão.2 seriam normais. é correto afirmar-se que a) a herança para esse tipo de característica é recessiva e ligada ao sexo.1. 75% do filhotes nascerão normais. portanto a herança não deve ser autossômica dominante. c) O acasalamento do macho 3 com a fêmea 5 produzirá maior número de camundongos nocaute do que o acasalamento desse macho com a fêmea 4. EXCETO a) O indivíduo I. c) a probabilidade de mulheres descendentes de IV-1 serem afetadas é zero.

1 e II.como um gosto amargo ou. conhecida como daltonismo. típica daquelas não vinculadas aos cromossomos X e Y. c) o risco de III. de pai para filha e mãe para filha.3 nascer incapaz de sentir o gosto do PTC é de 50%.5. Questão 594 1.1. preocupada com a possibilidade de transmitir o alelo para o albinismo a seus filhos. em todas as gerações. cujo diagrama. ( ) um modelo de herança idêntico ao do albinismo. Assinale a alternativa que responde ao questionamento de Renata. cuja avó materna e avô paterno eram albinos. não sentir qualquer sabor.4 . a) 0 b) 1/4 c) 3/4 134 1.PTC . ( ) um modelo de herança idêntico ao da cegueira para cores.5. ( ) o modelo de herança autossômica recessiva. om base nesse heredograma e em outros conhecimentos sobre o assunto. é INCORRETO afirmar que a) o alelo para a capacidade de sentir o gosto do PTC é dominante.1 x II. b) o loco do gene em estudo está situado em um cromossomo autossômico. Observe este heredograma para a capacidade de sentir o gosto dessa substância: onsiderando-se as informações desse heredograma e outros conhecimentos sobre o assunto. mostrando-os indivíduos afetados. d) a probabilidade de o indivíduo III.1.Questão 592 As pessoas podem detectar a substância química feniltiocarbamida .4 Esse diagrama representa: ( ) o modelo de herança recessiva ligada ao cromossomo X. c) o próximo filho do casal II. que representa uma família em que há indivíduos afetados por um tipo de tumor de gengiva: 1.4 Um geneticista estabeleceu o heredograma para uma determinada doença hereditária. b) a ocorrência do tumor é uma característica autossômica. são homozigotos. d) os indivíduos I.2 ser heterozigoto é de dois terços.5. Questão 595 Renata (III.1 são heterozigotos.1). ( ) a característica passada de geração a geração.1. deseja saber qual a probabilidade de ela não ser portadora deste alelo. mesmo. é representado abaixo.2 será normal. é INCORRETO afirmar que a) os indivíduos normais. Questão 593 Analise este heredograma.

pois a característica é dominante. e) Os indivíduos I-1 e I-4 são homozigotos. 135 . Soma ( ) 1. (01) A anomalia é causada por gene provavelmente recessivo.1. d) Todos os indivíduos afetados são heterozigotos.1. e) Apenas os indivíduos I:1 e I:2 são homozigotos. (04) Trata-se de gene localizado no cromossomo X.4 Questão 596 O heredograma adiante representa a herança de um fenótipo anormal na espécie humana. d) Apenas os indivíduos I:1.4 1. (32) Trata-se de Herança Intermediária. c) Apenas o indivíduo I:1 é heterozigoto.1. (02) A anomalia é causada por gene provavelmente dominante. pois dão origem a indivíduos anormais. os indivíduos assinalados com preto apresentam uma anomalia determinada por um gene dominante. a) Os indivíduos II-3 e II-4 são homozigotos. (08) Trata-se de gene localizado no cromossomo Y. b) Todos os indivíduos não afetados são heterozigotos. b) O fenótipo anormal é recessivo.4 Questão 598 Na genealogia a seguir. (16) Trata-se de gene autossômico. onde os indivíduos afetados pela síndrome unha-rótula (deformação nas unhas e nas rótulas) aparecem em preto. pois são afetados pelo fenótipo anormal. Analise-o e assinale a alternativa correta. é correto afirmar: a) Todos os indivíduos afetados são homozigotos.5.4 Analisando essa genealogia.5. c) Os indivíduos III-1 e III-2 são heterozigotos.5.5. II:1 e II:5 são heterozigotos. pois os indivíduos II-3 e II-4 tiveram crianças anormais. (64) Trata-se de Herança Holândrica.1. Questão 597 Considerando o heredograma abaixo. é correto afirmar: 1.d) 1/3 e) 1 1.

3 e III .2. Essa doença é herdada como autossômica recessiva.1. Os círculos representam as mulheres e os quadrados.2.4 136 . c) Apenas II . 2.3 e III . (02) Os indivíduos I . (64) Com exceção de II . um homem e uma mulher. 1.1. existe 33. (02) O padrão da herança desta doença é autossômico dominante. (16) II .3.4 (01) Na genealogia estão representadas 2 gerações.2. (08) Do casamento consangüíneo. e) II .1 e II .1 e III . (04) Os indivíduos I .3 e II .2 é sobrinho(a) de II . enquanto II .3 podem ser homozigotos. os indivíduos que manifestam uma determinada doença hereditária são mostrados em preto. (16) III . são indivíduos afetados pela característica que está sendo estudada.4.1. III . os demais indivíduos da segunda geração são irmãos.5. b) Apenas II .5. quem poderá ser afetado pela doença? a) Apenas III .2. por exemplo. Questão 600 Na genealogia a seguir. II . (04) III .3 forem heterozigotos e os indivíduos I .1 e I . Questão 602 Os heredogramas a seguir apresentam o padrão de herança de um mesmo caráter em cinco diferentes famílias.1 e I .3% de possibilidade de nascer um descendente com a doença.1 e III . 1. (08) III . 1.1. 4 e 5.5.3. (32) A doença só se manifesta nas mulheres. Considerando o heredograma apresentado inicialmente os indivíduos I .3 não o são.4 forem homozigotos normais. 3. portanto está ligada ao cromossomo X.4.2 e I . os homens.5. apresentado na genealogia.2 e II .1 é neto(a) de I .1 e III . II .3 não tem nenhuma relação genética com I . Questão 601 Com relação a essa figura é CORRETO afirmar que: (01) Os indivíduos II . d) II .Questão 599 A figura a seguir apresenta uma genealogia hipotética. II .1. Com base na análise da mesma. assinale a(s) proposição(ões) CORRETA(S).1. (32) II .3 e II . Os símbolos cheios indicam que o indivíduo é portador do caráter.3.4 têm 50% de probabilidade de terem um descendente portador da doença.1 é mais jovem do que II . identificadas por 1.4 A anemia falciforme é causada pela presença de uma hemoglobina anormal. respectivamente.2.1 e II .5. II .2.4 representam.

b) nula. e) 1/4. porque o casal já tem três filhos com visão normal. Os indivíduos I-1 e I-3 são obrigatoriamente homozigotos dominantes. 1. uma vez que são nulas as possibilidades de que desse cruzamento resulte um filhote que apresente a doença. O diagrama representa o padrão de herança de uma doença genética que afeta uma determinada espécie de animal silvestre. Os símbolos escuros representam os indivíduos míopes.1. apenas. porque o gene para a miopia é recessivo.5. c) A família 3 permite concluir que se trata de um caráter recessivo. É verdadeiro o que se afirma em a) I. ligado ao cromossomo X. e) A família 5 mostra que o caráter não pode ser controlado por gene ligado ao cromossomo X. Não há nenhuma possibilidade de que um filhote nascido do cruzamento entre os indivíduos II-5 e II-6 apresente a doença. c) I. porque a mulher tem o gene dominante em homozigose. IV.1. Trata-se de uma doença autossômica recessiva. foram feitas as afirmações seguintes. II. I. apenas. 137 1. II e III.4 A probabilidade do casal I x II ter uma criança míope é a) imprevisível. d) 1/4. d) A família 4 permite concluir que se trata de um caráter recessivo. III. c) 1/2.4 . d) I e IV. e os claros os indivíduos de visão normal. Questão 604 upondo que não haja mutação. apenas. apenas.4 A partir da análise da ocorrência da doença entre os indivíduos nascidos dos diferentes cruzamentos. apenas. ligado ao cromossomo Y. porque 50% dos gametas da mulher transportam o gene recessivo. a) A família l permite concluir que se trata de um caráter dominante ligado ao cromossomo X. b) II e III. Questão 603 O esquema mostra a genealogia de uma família. observado a partir de cruzamentos controlados realizados em cativeiro. porque a mulher tanto pode ser homozigota como heterozigota.1. e) III e IV.5. O indivíduo III-1 só deve ser cruzado com o indivíduo II-5. analise os heredogramas e assinale a alternativa correta.5. b) A família 2 permite concluir que se trata de um caráter autossômico recessivo.1.

c) Não é possível ter certeza sobre o genótipo de alguns indivíduos. d) Os pais dos aquirópodos são primos. No heredograma a seguir. o indivíduo afetado tem pais afetados Questão 608 O popular "Teste-do-pezinho" feito em recém-nascidos pode detectar a doença fenilcetonúria. os principais critérios para a identificação de um gene recessivo autossômico são aqueles em que o número de: a) homens afetados é diferente do número de mulheres afetadas. a) Pode-se dizer que a Aquiropodia é condicionada por um alelo recessivo a.1 e II. que representa a árvore genealógica de uma família onde alguns indivíduos são afetados pela doença.5 possuem o genótipo AA. já que a condição herdada em análise é muito rara. cerca de 75% da prole de pais portadores do gene deve apresentar a característica e) homens afetados é maior do que o de mulheres afetadas. os indivíduos afetados têm geralmente pais normais. como é o caso dos indivíduos II.1. Os pulmões das pessoas afetadas apresentam um muco espesso que promove infecções bacterianas.1 . Observe e analise o esquema a seguir. b) Pode-se assumir que os indivíduos II.4 1.2 e IV. a característica deve aparecer em todas as gerações. os aquirópodos estão representados por símbolos hachurados. a característica deve aparecer em todas as gerações.4 é aa. .1.4 ual a probabilidade de o casal II. os indivíduos afetados têm geralmente pais normais. a característica deixa de aparecer em várias gerações.5.5. o indivíduo afetado tem pelo menos um pai afetado b) homens e mulheres afetados é aproximadamente igual. que é determinada por um par de genes. Questão 606 A mucoviscidose é uma doença genética grave que associa problemas digestivos e respiratórios. cerca de 25% da prole de pais portadores do gene deve apresentar a característica d) homens e mulheres afetados é aproximadamente igual. o indivíduo afetado tem pelo menos um pai afetado c) homens e mulheres afetados é aproximadamente igual.5. Tal doença deve-se à presença de uma enzima defeituosa que não metaboliza 138 om base na análise do heredograma. e) O genótipo dos indivíduos IV.II. 1.2 vir a ter uma criança com mucoviscidose? a) 1/8 b) 1/4 c) 1/3 d) 1/2 e) 2/3 Questão 607 Para analisar heredogramas de famílias de seres humanos.3 e III. assinale a afirmativa INCORRETA.Questão 605 Na espécie humana há um tipo de doença hereditária muito rara denominada Aquiropodia.

Supondo que todas sofram metamorfose. os indivíduos que apresentam fenilcetonúria estão em negro. Questão 610 Um casal. c) 1/8. e) 240. Um indivíduo de F1 é retrocruzado com a fêmea parental e se obtém 480 larvas. determine o cruzamento que permite diagnosticar a recessividade do gene que condiciona a fenilcetonúria e a probabilidade de nascer uma menina afetada a partir do cruzamento 12 X 18. Um macho puro de asa longa é cruzado com uma fêmea de asa curta. Na genealogia a seguir. Esse casal tem __________ de probabilidade de ter um descendente do sexo masculino e portador da disfunção genética mencionada. uma em cada 20 pessoas com fenótipo normal é heterozigótica quanto ao gene que determina a fenilcetonúria. Sabendo-se que a determinação do caráter se deve apenas a um par de genes autossômicos. b) 120.4 Questão 609 A fenilcetonúria é uma doença com herança autossômica recessiva. e) 1/25. a) 2/3. d) 2/5. Questão 613 Sabe-se que o albinismo é determinado pela ação de um gene recessivo autossômico. e) 80. Em certa comunidade européia. b) 8. Considere um casal normal que teve 6 crianças todas normais. Questão 612 Estudos genéticos permitiram verificar que um casal tem 1/4 de probabilidade de ter um descendente com uma determinada anomalia. qual o número esperado de casamentos com risco de gerar crianças fenilcetonúricas? a) 2. Sabendo-se que o avô paterno e a avó materna das crianças eram albinos.1.corretamente o aminoácido fenilalanina. A probabilidade de o casal vir a ter uma filha normal é de: a) 1/4 b) 1/6 c) 1/8 139 . o número esperado de indivíduos de asa curta é de: a) 480. a) C e 50% b) C e 25% c) B e 6. c) 16. d) 40. Em 800 casamentos ocorridos entre membros sadios dessa comunidade. podemos afirmar com certeza que a probabilidade de um novo filho vir a ser albino (sem considerar o sexo). tem uma filha também polidáctila e um filho normal. d) 360. b) 3/9. cuja ingestão provoca retardamento mental. será: a) 0% b) 25% c) 50% d) 75% e) 100% 1. c) 180.5. o caráter asa vestigial é recessivo em relação ao caráter asa longa.25% e) C e 75% d) 1/12 e) 2/3 Questão 611 Em drosófilas.25% d) B e 8. em que ambos são polidáctilos.

a habilidade para o uso da mão direita é condicionada pelo gene dominante E . e) 320. cujo pai era insensível. cuja mãe era canhota e insensível. Um casal normal que pretende ter um filho consulta um geneticista. a chance de a criança vir a manifestar a doença corresponde a a) 0 %. e) 4/9. Questão 617 Em determinada planta.5 e um casal com 35 anos tiver um filho. b) 25%. flores vermelhas são condicionadas por um gene dominante e flores brancas por seu alelo recessivo. obstrução vascular e infartos dolorosos em vários órgãos como os ossos. icterícia. Do cruzamento entre plantas heterozigóticas para os dois caracteres resultaram 320 descendentes. Devido a sua importância. e a insensibilidade a essa substância é devida a seu alelo recessivo i . Não há outros casos conhecidos nas famílias. Um homem canhoto e sensível ao PTC.Questão 614 Admita que uma determinada doença neurodegenerativa que provoca convulsões e leve à morte em pouco mais de 10 meses seja determinada por um gene dominante. no teste do pezinho. Esses dois pares de alelos localizam-se em cromossomos diferentes.1. c) 1/9. A sensibilidade à feniltiocarbamida (PTC) é condicionada pelo gene dominante I. Um casal decide ter um filho. e é causada por um alelo recessivo por herança Mendeliana simples. Esses dois pares de alelos apresentam segregação independente. Desses. sensível. O seu padrão de herança é autossômico recessivo. d) 180. Questão 615 A anemia falciforme é uma doença hemolítica grave cujas manifestações clínicas incluem anemia. Questão 618 Na espécie humana. no Rio Grande do Sul. sendo a habilidade para o uso da mão esquerda devida a seu alelo recessivo e . c) 160. d) 75%. Essa doença manifesta-se tardiamente como representado no gráfico a seguir: Questão 616 Fenilcetonúria é uma doença hereditária humana resultante da inabilidade do organismo de processar o aminoácido fenilalanina. e) 100%. mas consulta um geneticista porque o homem tem uma irmã com fenilcetonúria. a detecção de portadores de anemia falciforme está sendo incluída. 140 1. b) 60. podendo ser fatal se não tratada no início da infância. espera-se que o número de plantas com flores vermelhas e folhas curtas seja a) 20. antes de realizar qualquer exame. qual a resposta correta que daria à pergunta sobre a probabilidade de nascimento de uma criança com este tipo de anemia? a) 1/2 b) 1/4 c) 1/8 d) 1/9 e) 1/16 . Se você fosse o geneticista. casa-se com uma mulher destra. b) 1/4.5. A probabilidade de sua primeira criança ter fenilcetonúria é de: a) 1/2. o baço e os pulmões. c) 50%. e a mulher tem um irmão com esta mesma doença. folhas longas são condicionadas por um gene dominante e folhas curtas por seu alelo recessivo. já que cada um dos cônjuges tem um irmão com anemia falciforme. que está presente nas proteínas da dieta humana. d) 2/3.

d) 3/16. b) 3/8.5. AaCC. AaCc. verdes-lisas = 200. nasce uma criança albina e de olhos claros. AaCc.1 141 . amarelas-rugosas = 200. verdes-lisas = 100. AACC. e) aacc.5% Questão 620 O cruzamento entre duas linhagens de ervilhas. Questão 623 Observe o heredograma a seguir: 1. aacc. Deste casal. espera-se obter na descendência: a) 50% de plantas anãs com vagens lisas e 50% de plantas de altura normal com vagens com constrições. Aacc. b) Aacc. Questão 619 Do casamento entre uma mulher albina com cabelos crespos e um homem normal com cabelos crespos. Quantos indivíduos devem ser esperados para cada um dos fenótipos obtidos? a) amarelas-lisas = 80. Qual o genótipo dos pais da criança? a) aacc. Questão 621 Em ervilha. e) 1/8. verdes-lisas = 150. d) amarelas-lisas = 300. uma com cabelos crespos e outra com cabelos lisos. d) 100% de plantas anãs com vagens lisas. aacc. nasceram duas crianças. cuja mãe é albina. verdes-rugosas = 80. AaCc. c) 100% de plantas de altura normal com vagens com constrições. amarelas-rugosas = 100. e) 100% de plantas de altura normal com vagens lisas. b) amarelas-lisas = 100. verdes-rugosas = 300.2. e) amarelas-lisas = 450. c) 1/4. uma com sementes amarelas e lisas (VvRr) e outra com sementes amarelas e rugosas (Vvrr). amarelas-rugosas = 320. Questão 622 Um homem albino e de olhos claros casa-se com uma mulher de pele normal e de olhos escuros.A probabilidade de esse casal vir a ter uma criança canhota e sensível ao PTC é de a) 3/4. c) AaCC. A probabilidade de que uma terceira criança seja albina com cabelos crespos é: a) 75% b) 50% c) 37. verdes-rugosas=50. Cruzando-se plantas CCHH com plantas CcHh. amarelas-rugosas = 300. b) 100% de plantas anãs com vagens com constrições.5% d) 25% e) 12. d) aaCC. verdes-lisas = 320. O gene que determina plantas de altura normal (H) é dominante sobre o gene que determina plantas anãs (h). originou 800 indivíduos. verdes-rugosas=100. amarelas-rugosas = 150. verdes-lisas = 300. AaCc. c) amarelas-lisas = 200. o gene que determina a forma lisa da vagem (C) é dominante sobre o gene que determina vagens com constrições (c). verdes-rugosas = 200. aacc.

2. Assinale: a) se todas as afirmativas forem corretas.Os indivíduos 2 e 4 têm o mesmo genótipo. a probabilidade do casal ter outra criança normal para as duas características é: a) 1 b) 1/16 c) 3/16 d) 9/16 e) 0 Questão 626 A fenilcetonúria e a miopia são doenças decorrentes da ação de genes autossômicos recessivos.5% e) 25% Questão 628 Qual é a probabilidade de um casal de duplo heterozigotos para dois pares de genes autossômicos com segregação independente vir a ter um descendente com apenas uma característica dominante? a) 15/16 b) 9/16 c) 6/16 d) 3/16 142 1. c) se somente as afirmativas II e III forem corretas. Questão 624 Sabendo-se que a miopia e o uso da mão esquerda são condicionados por genes recessivos. d) se somente as afirmativas I e II forem corretas.Se o indivíduo 3 se casar com um homem de visão normal (heterozigoto) e canhoto. tem uma criança normal para polidactilia.5. diíbrida. A probabilidade desse casal ter uma criança normal para as duas características é: a) 1/8 b) 1/2 c) 3/8 d) 7/8 e) 3/4 Questão 627 Em ervilhas. Considerando uma planta de sementes lisas e amarelas.1 A probabilidade do casal 4 x 5 ter uma criança diíbrida é: a) 1/8 b) 3/16 c) 1/16 d) 1/4 e) 1/2 Questão 625 Um casal. filha de mãe com fenilcetonúria e pai míope. III . nasceu uma criança de visão normal e fenilcetonúrica. Considerando-se que ambas as anomalias são autossômicas e os respectivos genes estão em cromossomos . a) zero b) 75% c) 50% d) 12. os genes que determinam sementes lisas e amarelas são dominantes em relação aos genes que determinam sementes rugosas e verdes. com um homem normal para fenilcetonúria e míope. II . e) se somente a afirmativa II for correta.Sabendo-se que a miopia e o uso da mão esquerda são condicionados por genes recessivos. ambos polidáctilos (com mais de 5 dedos) e de visão normal. então. b) se somente as afirmativas I e III forem corretas. considere as seguintes afirmações: I . assinale a alternativa que apresenta a porcentagem de gametas produzidos por essa planta com pelo menos um gene dominante. mas míope. analise a genealogia a seguir e responda.O indivíduo 5 é heterozigoto para o gene do uso da mão esquerda e o indivíduo 6 é heterozigoto para o gene da miopia. Do casamento entre uma mulher normal. diferentes. terão 25% de chance de ter uma filha canhota e de visão normal.

ele obteve a primeira linhagem.(MmBb) d) I . os indivíduos com audição normal possuem. II .(Mmbb). o gene B determina coloração uniforme e seu alelo b. Como resultado.(Mmbb) c) I . III . II . Qual é a probabilidade de um casal DdEE × ddEe vir a ter uma criança com surdez? a) 0% b) 25% c) 50% d) 75% e) 100% Questão 631 As flores de uma determinada planta podem ser vermelhas ou amarelas.(mmBb).(mmBb).(MmBb). cujo pai era marrom uniforme (II). Assinale.(Mmbb). Um macho preto com manchas brancas (I). a) I .(mmBb) e) I . sendo um dominante e outro recessivo.(mmbb). determinados por genes que se segregavam independentemente. II . um gene D e um E. a seguir.(mmBb).(mmbb).Ee) localizados em cromossomos não homólogos. III . IV . Os indivíduos homozigotos dd ou ee são surdos. a alternativa que contém os genótipos dos indivíduos mencionados. vvA_ ou vvaa.e) 1/16 Questão 629 Considere que em cavalos a coloração do pêlo resulta da ação de dois pares de genes autossômicos localizados em cromossomos não homólogos.(mmbb) b) I .(mmBb). 1. II . IV . III .(Mmbb). III . pelo menos. IV . na proporção de 9:3:3:1.(mmbb). Na descendência do cruzamento VvAa x VvAa espera-se encontrar uma proporção fenotípica de a) 1 vermelha: 1 amarela b) 9 amarelas: 7 vermelhas c) 9 vermelhas: 7 amarelas d) 15 amarelas: 1 vermelha e) 15 vermelhas: 1 amarela Questão 632 O esquema abaixo representa o núcleo de uma célula de um organismo com 2n=4 cromossomos. O gene M condiciona cor preta e seu alelo m. obteve quatro tipos de fenótipos.2.5.(MMbb). Dois pares de genes (Vv e Aa) determinam essa característica: plantas V_A_ produzem flores vermelhas e plantas V_aa. Quantos caracteres esse pesquisador estudava? a) 1 b) 2 c) 3 d) 4 e) 5 Questão 634 Assinale a alternativa que indica os genótipos dos pais que têm ou poderão ter filhos nas seguintes proporções ou percentuais: 143 . IV .1 os pares de alelos abaixo aplica-se a segunda lei de Mendel SOMENTE a a) Aa e Mm b) Aa e Dd c) Aa e Nn d) Bb e Nn e) Dd e Mm Questão 633 Um pesquisador averiguava a transmissão de caracteres em vegetais ao longo de gerações. é cruzado com uma fêmea marrom com manchas brancas (III).(MmBb) Questão 630 Considere que a surdez no homem esteja relacionada a dois pares de genes (Dd . flores amarelas. na qual promoveu autofecundação. III . Os alelos de cinco genes estão indicados por letras.(mmBb). cor marrom. II . manchas brancas em qualquer cor de pelagem.(MmBb). cuja mãe era preta uniforme (IV). Cruzando dois indivíduos homozigotos. IV .(Mmbb).

a) Todos os filhos desse casal deverão ser albinos. d) o zigoto tenha constituição AB ou ab. homozigota para as duas características. e) Maria produzirá gametas de 4 tipos diferentes para essas características. o albinismo é condicionado por um gene recessivo.75% de filhos com olhos castanhos. mulher normal para o albinismo. Questão 636 Em uma planta com autopolinização são estudados dois pares de genes . Dados: gen para olhos castanhos . As pessoas indicadas pelos números 1.25% de filhos canhotos.. casa-se com Maria. 5 e 6 são braquidáctilas e prognatas. e) o embrião tenha constituição AaBb. Questão 637 Em humanos a polidactilia é condicionada por um gene dominante. c) Antônio poderá produzir 2 tipos de gametas diferentes para essas características.d a) CCDD e CCDD b) ccdd e ccdd c) CCdd e ccDD d) CcDd e CcDd e) CcDd e ccdd Questão 635 Foram analisadas. podendo ter olhos castanhos ou azuis. em uma família. sendo que o alelo dominante produz em seus portadores pigmentação normal. podendo ter olhos castanhos ou azuis. obrigatoriamente.c gen para mão destra . espera-se que a) um dos núcleos gaméticos do tubo polínico tenha constituição a e o outro constituição b. podendo ser destros ou canhotos. porém albino.2. d) A mãe de Maria é. b) Não existe qualqueir chance de nascer um filho polidáctilo dessa relação. Suponha que um exemplar da planta produza todos os esporos femininos com constituição genética AB e todos os esporos masculinos com constituição ab.75% de filhos destros. b .C gen para olhos azuis . um homem com pés e mãos normais. assinale a alternativa CORRETA. sendo triplóide. tenha constituição AaB ou Aab. por meio do processo de mitose. Ambos os locos citados são autossômicos. a e B.A.1 probabilidade de o casal 5x6 ter um descendente simultaneamente braquidáctilo e prognata é de a) 1/16 b) 3/16 c) 9/16 d) 3/4 e) 1/4 . podendo ser destros ou canhotos. A partir das informações anteriores. b) a oosfera (gameta feminino) tenha constituição AB ou ab.25% de filhos com olhos azuis. Como. enquanto 2 e 4 têm dedos e mandíbula normais. sendo os indivíduos homozigotos recessivos portadores de pés e mãos normais (com 5 dedos cada). Por sua vez.D gen para mão canhota . 3. .5. duas características autossômicas dominantes com segregação independente: BRAQUIDACTILIA (dedos curtos) e PROGNATISMO MANDIBULAR (projeção da mandíbula para frente). .com segregação independente. Considere este caso: Antônio. c) o endosperma. 144 1. polidáctila a e filha de um homem homozigoto e normal para os dois caracteres e de uma mulher albina e polidáctila. os esporos dão origem à geração gametofítica. .

2.1 uais são os indivíduos obrigatoriamente heterozigotos para as duas características? a) 6. b) 1 preto: 1 pardo. homozigota para os dois pares de genes. 14.2. 11. Questão 642 Numa ave doméstica. 3. 8. é: a) zero b) 1/2 c) 1/4 d) 1/8 Questão 639 Na genealogia a seguir. 13 e 14 b) 6. 8. o gene C condiciona plumagem branca e o seu alelo recessivo. 8. e) 1 pardo: 3 albinos. 7. 4. 7. 9. 14 e 16 c) 5. 7. 10. 9. a probabilidade de ocorrência na F de indivíduos com o mesmo genótipo dos pais. espera-se que a proporção de aves homozigotas para os dois pares de genes seja de a) 9/16 b) 6/16 c) 4/16 145 1. 8. a partir do cruzamento PpAa x ppaa espera-se uma proporção fenotípica de a) 1 preto: 1 pardo: 2 albinos. 3. 9. pelagem parda desde que esteja presente o gene A. o gene P determina patas com plumas e o seu alelo recessivo. 7 e 13 d) 6. 2. 11. 4. plumagem colorida. 12 e 15 c) 1. Os animais aa são sempre albinos. Uma ave branca com patas com plumas. 12 e 15 d) 3. 4. 9. Esses pares de genes são autossômicos e segregam-se independentemente. c) 1 preto: 1 albino. Considerando que ocorra segregação independente entre esses genes. está representada a herança de duas características determinadas por genes autossômicos. 10. 15 e 16 e) 1. 3. o gene P produz pelagem preta e o seu alelo recessivo p.1 1.Questão 638 Do cruzamento entre dois indivíduos portadores do genótipo CcDd. uais são os indivíduos que seguramente produzem um só tipo de gameta? a) 6.5. está representada a herança de duas características determinadas por genes autossômicos.5. 2. foi cruzada com uma colorida com patas sem plumas. 9. 13 e 14 b) 5. 2. 4 e 13 Questão 641 Em coelhos. . d) 1 preto: 3 albinos. patas sem plumas. Se os decendentes obtidos forem cruzados entre si. 9 e 15 e) 1. 13 e 15 Questão 640 Na genealogia a seguir.

7% c) 31. O cruzamento da F1 gera os quatro tipos de cores na F2. uma anomalia recessiva. amarelos e brancos. os amarelos carecem de grânulos de melanina. Sabendo-se que os alelos representados por letras maiúsculas são dominantes e que os não-alelos sofrem segregação independente.7% Questão 647 Em tomateiros. Dentre esses. Considerando-se que os genes para a melanina e o 146 . a) 3 e 2 b) 6 e 3 c) 9 e 4 d) 12 e 8 e) 16 e 9 Questão 646 Em cães. os números de genótipos e de fenótipos diferentes entre os descendentes desses cruzamentos são. a polidactilia é um caráter dominante e a miopia.2% b) 18. A probabilidade deste casal ter uma criança com polidactilia e miopia é a) 0% b) 25% c) 50% d) 75% e) 100% Questão 644 No cruzamento entre indivíduos heterozigotos para dois pares de genes que se segregam independentemente. cuja mãe era normal para as duas características. Através do intercruzamento de plantas duplo-heterozigóticas. cujo pai era míope. a folha recortada é determinada por um alelo dominante e a lisa. Uma mulher com polidactilia e miopia. a cor do hipocótilo púrpura é condicionada por um alelo dominante e a cor verde. Quando se cruzam papagaios verdes silvestres com os de cor branca. existem quatro variedades: verdes. pelo alelo recessivo. Latir enquanto corre e possuir orelhas eretas são características dominantes. Neste caso. pelo alelo recessivo. o número esperado de indivíduos com hipocótilo púrpura e folhas lisas é a) 30 b) 90 c) 160 d) 240 e) 270 Questão 648 Numa dada espécie de papagaio. a probabilidade de que nasçam filhotes que latem enquanto correm e que possuem orelhas caídas é. foram obtidos 480 descendentes. respectivamente. é casada com um homem normal. enquanto não latir durante a corrida e possuir orelhas caídas são recessivas.2% d) 43. de: a) 6. e os brancos não têm nem melanina azul nem pigmento amarelo nas penas. Os azuis carecem de pigmento amarelo. espera-se que a proporção de descendentes heterozigotos para apenas um par de genes seja a) 9/16 b) 1/2 c) 1/4 d) 3/16 e) 1/16 Questão 645 Plantas de genótipo AaBb foram intercruzadas. geram-se papagaios verdes na primeira geração (F1). Os genes responsáveis por essas características situam-se em autossomos e apresentam segregação independente. Esses genes estão localizados em cromossomos que se segregam independentemente.d) 3/16 e) 1/16 Questão 643 No homem. Os papagaios verdes são os únicos normalmente encontrados na natureza. Considere o cruzamento entre um casal de cães heterozigotos para ambos os pares de alelos. O mesmo ocorre para os caracteres orelhas eretas ou orelhas caídas. aproximadamente. latir ou não latir durante a corrida são características definidas por um par de genes alélicos. azuis.

enquanto o alelo h determina a pelagem branca. d) 1 papagaio verde. 4 amarelos. c) os genes A e B que se situam em diferentes pares de homólogos distribuem-se ao acaso em diferentes gametas. c) os indivíduos da geração F1 são homozigotos. quantos desses apresentarão fenótipo diferente dos pais? 147 . a cor dos pêlos pode ser branca (P_) ou preta (pp). b) 4 papagaios amarelos. casco fendido. 1 azul. é INCORRETO afirmar que a) os cromossomos de origem materna e paterna que contêm esses genes podem combinar-se livremente. b) 100% de animais com pelagem branca. 3 amarelos. pois o gene para a cor é dominante. d) 4 animais com pelagem branca : 3 com pelagem vermelha : 9 com pelagem preta. O padrão uniforme é governado pelo alelo dominante que segrega independentemente no locus M. que eram em número de cinco. a pelagem colorida é determinada pelo alelo H. quanto às características consideradas? a) 9 b) 16 c) 30 d) 45 e) 80 Questão 652 Quando se estuda uma célula meiótica duplo-heterozigota AaBb e se diz que. 1 amarelo. Questão 650 Um criador fez cruzamentos entre porquinhos-da-índia para estudar as características: cor e tamanho do pêlo. Entre as várias ninhadas foram vendidos apenas os filhotes malhados de vermelho. e o tipo de casco é determinado por alelos que segregam em outro cromossomo. Um macho preto foi cruzado com fêmeas genotipicamente iguais entre si e fenotipicamente iguais a ele. c) 9 papagaios verdes. para esses genes. 1 branco. está ocorrendo segregação independente. 4 brancos. 2 verdes. pelo seu recessivo v. a freqüência esperada de cada um dos tipos de papagaio é a) 9 papagaios brancos. Questão 653 Em porcos. b) pode ocorrer recombinação entre os genes A e B. e) 9 animais com pelagem preta : 7 com pelagem vermelha. é INCORRETO afirmar que a) as características pêlo preto e curto são dominantes. Questão 649 Em bovinos. Quantos filhotes do total nascido das várias ninhadas. Observou os seguintes resultados: GERAÇÃO P: pêlo preto curto X pêlo marrom longo GERAÇÃO F: pêlo preto curto GERAÇÃO F‚: 81 pêlo preto curto 27 pêlo preto longo 27 pêlo marrom curto 09 pêlo marrom longo Com base nesses resultados. e) 9 papagaios azuis. 1 branco. 1 azul. Outro gene determina a pigmentação da pelagem na cor vermelha (b) ou preta (B). 3 verdes. O cruzamento entre um touro de pelagem preta (HhBb) com uma vaca de pelagem preta (HhBb) produzirá uma prole com: a) 100% de animais com pelagem preta. 3 amarelos. d) os genes A e B estão em grupos de ligação separados. Questão 651 A cor preta da pelagem dos cães da raça 'Cocker Spaniel' é governada por um alelo dominante V e a cor vermelha. e o padrão malhado. 1 verde. Se porcos diíbridos são cruzados entre si e produzem. se espera que sejam fenotipicamente idênticos ao pai. 3 azuis. 64 descendentes. por seu alelo recessivo m. entre várias ninhadas. sendo que F_ condiciona casco indiviso e ff. b) as duas características segregam-se independentemente. 1 branco. pois o gene para a cor é epistático. c) 12 animais com pelagem branca : 1 com pelagem vermelha : 3 com pelagem preta. d) os indivíduos da geração P formam um só tipo de gameta. 1 azul. e) os genes A e B não são alelos.pigmento amarelo se encontram em cromossomos diferentes.

II .2. d) O gene para a cor avermelhada é codominante em relação ao alelo. 1. b) 16. d) 36.1 nalise este padrão de herança e assinale a afirmativa CORRETA: a) Trata-se de um exemplo típico da primeira Lei de Mendel.A lei da segregação independente (2 lei) está relacionada às conseqüências do arranjo. ao acaso. b) Pelos resultados. c) A proporção fenotípica 9:7 é um padrão de segregação independente. II e III. Cruzando-se um macho de corpo cinza e asas vestigiais com uma fêmea de corpo ébano e asas longas (parentais P) obteve-se F que deu origem a F‚ através da autofecundação. I .Dois pares de genes se segregam independentemente. Após autofecundação das plantas F1.1 148 . b) somente I e II. na geração F2. deduz-se que é um padrão de herança intermediária. A F1 resultante apresentou 100% das ervilhas com flores avermelhadas. e) 60. Está(ão) correta(s): a) somente I. estiverem localizados em cromossomos diferentes. III . d) somente II e III.5. e) I. Questão 656 A mosca-de-fruta 'Drosophila melanogaster' pode apresentar asas vestigiais ou longas e corpo cinza ou ébano. Questão 654 O esquema a seguir representa o cruzamento entre duas variedades puras de ervilha-de-cheiro ('Lathyrus odoratus') de flor branca. e) O exemplo é de interação gênica já que está envolvido apenas um loco. como mostra a figura a seguir. se 1. foram produzidas 371 plantas com flores avermelhadas e 287 com flores brancas. Questão 655 As afirmativas a seguir relacionam a Genética Mendeliana à Divisão Celular. de pares de cromossomos homólogos na placa metafásica.2.As 1 e 2 Leis de Mendel abordam o comportamento dos genes na formação dos gametas. c) 28. c) somente I e III.5.a) 4. na meiose. logo estão relacionadas com o comportamento cromossômico na meiose.

relativos a esses quatro pares de genes. Questão 658 Uma abelha rainha tem os seguintes pares de genes alelos que segregam independentemente: AaBbDdEe. Questão 657 Um casal de surdos teve dois filhos com audição normal. Sabendo-se que os zangões surgem de óvulos que se desenvolvem por partenogênese. Questão 660 Uma abelha rainha tem os seguintes pares de genes alelos que se segregam independentemente: AaBBccDdEE. c) AaddFF.Os genes para cor do corpo e pra tipo de asa estão localizados num mesmo cromossoma. b) AADDFF. apenas.: Considere um tipo de herança mendeliana.O gene para corpo ébano só está presente na geração P e em parte de F‚. Considere ainda que todos esses genes situam-se em cromossomos diferentes. em homozigose. e) DDee. II e IV. a) 1/64 b) 63/64 c) 1/32 d) 1/16 e) 1/4 Questão 662 Os dermatóglifos são padrões típicos das cristas dérmicas nos dedos e palmas das mãos. quantos genótipos diferentes. espera-se que o genótipo dos filhos seja a) ddee. é Obs. c) Quatro. c) DDEE. d) II. II e V . alça ou verticilo.A probabilidade de ocorrência do mesmo genótipo dos indivíduos de F em F‚ é de 4/16.Em F‚. 149 . a probabilidade de surgir um descendente com genótipo que apresenta. III e V . foram feitas as afirmativas abaixo. IV . a probabilidade de ocorrência de homozigose dominante é a mesma de homozigose recessiva. II . podem apresentar os zangões filhos dessa rainha? a) Um b) Dois c) Quatro d) Oito e) Dezesseis Questão 659 Considere um homem heterozigoto para o gene "A". I . apenas. Sabe-se que os padrões dermatóglifos são de herança multifatorial. apenas. um gene dominante. e) Dezesseis. A figura a seguir mostra padrões digitais que formam figuras denominadas de arco. IV e V. duplo recessivo para o gene "D" e homozigoto dominante para o gene "F". d) Oito. b) Ddee. Sabendo-se que a surdez é determinada por qualquer dos genes recessivos d ou e. artelhos e solas dos pés. III e IV . apenas. apenas.Os genes para cor do corpo e forma das asas segregam-se independentemente durante a formação dos gametas.Após a análise dos resultados dos cruzamentos. e) ADF e adf. d) DdEe. b) Dois. e) III. Entre os gametas que poderão se formar encontraremos apenas a(s) combinação(ões): a) AdF. quantos genótipos diferentes. V . c) I. b) I. Sabendo-se que os zangões surgem de óvulos que se desenvolvem por partenogênese. pelo menos. As afirmativas corretas são: a) I. relativos a esses cinco pares de genes podem apresentar os zangões filhos dessa rainha? a) Um. III . d) AdF e adF. Questão 661 Do cruzamento de dois indivíduos com genótipo AaBbCc.

cc. de semente lisa e amarela. d) aaBb. e) aB. dE. b) aBcDE. EE. Questão 663 A análise de 4 genes autossômicos. Bb. respectivamente: a) 4 e 3:3:3:1:1:1 b) 8 e 27:9:9:9:3:3:3:1 c) 8 e 9:3:3:1 d) 16 e 9:3:3:1 e) 16 e 27:9:9:9:3:3:3:1 Questão 666 Considere a segunda lei de Mendel ou lei da distribuição independente e indique os gametas produzidos pelo genótipo aaBbccDdEE. c) A análise dos padrões digitais não se presta para a determinação de paternidade. o número de gametas produzidos pelas plantas F e a proporção fenotípica esperada na geração F‚ será. c) 25%. Dd.5. c. é INCORRETO afirmar: a) Quanto mais semelhantes forem as mãos de gêmeos. b) Esses padrões podem ser úteis ao diagnóstico de certas síndromes cromossômicas. Nessas condições.25%. aaEE. Uma planta pura. d) 12%.Questão 665 No milho.2 Sobre esse assunto. . Na geração F. cada um com um par de alelos. permitiu constatar que Janaína tem o genótipo AAbbCCDD e Pedro tem o genótipo aaBBccDD. abcdE.2. maior será a probabilidade de que eles sejam monozigóticos. cD. como a Síndrome de Down. BbDd. abcDE. Para estes 4 genes. poderá produzir quantos tipos geneticamente distintos de gametas? a) 2 b) 4 c) 8 d) 16 e) 32 Questão 668 O desenho abaixo corresponde ao núcleo de uma célula em metáfase de uma espécie cujo número n de cromossomos é 3. d) O número de cristas dérmicas não varia entre indivíduos da mesma família. d. A cor da semente pode ser amarela devido ao alelo "Y" e branca devido ao alelo "y". é correto afirmar: 150 1. a textura da semente pode ser lisa devido ao alelo "Su" e rugosa devido ao alelo "su". com o genótipo AaBBCCDDEE. quantos tipos diferentes de gametas poderia produzir o filho de Janaína e Pedro? a) 4 b) 8 c) 16 d) 32 e) 64 Questão 664 Considere quatro pares de genes que segregam de maneira independente. b. e) 6. baixa. A planta pode ser alta devido ao alelo "Br" e baixa devido ao alelo "br". B. b) 50%. Analisando a figura. alta. aBcdE. bc. c) aa. D. de semente rugosa e branca. Se as plantas da geração F forem intercruzadas. um indivíduo que apresente o genótipo AaBBCcDD produzirá gametas ABCD com a freqüência de: a) 75%. foi cruzada com outra planta pura. Questão 667 Um organismo diplóide. E. a) a. ccDd. observaram-se 100% das plantas altas. de semente lisa e amarela.

AaBB. respectivamente. poderão ser encontrados 9 genótipos diferentes. Bb e Cc 151 Questão 669 Indivíduos com os genótipos AaBb.4 c) 2 .8 b) 4 . a) 30 espermatozóides. onde os três pares de genes estão em pares de cromossomos distintos. quais serão os genótipos das células resultantes? a) Aa. poderão ser formados 8 diferentes tipos de gametas.4 . (08) Como resultado de uma autofecundação. d) 120 espermatozóides. ABc.4 e) 2 . Bb.8 . (32) O sistema em questão é polialélico. quantos tipos de gametas diferentes? a) 4 .8 d) 4 . com a constituição representada na figura. (02) Em relação aos genes em questão. AaBbCc.8 . a freqüência de descendentes AABbcc será igual a a) 8/64 b) 1/16 c) 3/64 d) 1/4 e) 1/32 Questão 672 Se a mitose ocorre em uma célula de genótipo AaBbCc. portanto. AbC. AaBBcc.5. abc c) Aa. poderão ser encontrados 64 genótipos diferentes. c) 90 espermatozóides. abc b) ABC.8 . aBC. (04) Como resultado de uma autofecundação.4 -16 . sendo.2 . apresentando a constituição ABC.2 1. os genótipos das células resultantes serão: a) ABC.4 -16 .1.4 . impossível calcular tanto o número de genótipos quanto o de fenótipos. Cc d) AABBCC.2 . Questão 671 Assinale a alternativa correta. se for realizado um cruzamento entre indivíduos AaBbCc. (16) Como resultado de uma autofecundação. AaBbcc podem formar. Abc.4 .8 . e) 180 espermatozóides.2.2 (01) Em relação aos genes em questão.8 Questão 670 Sessenta células de um animal.2 . Soma ( ) ão esperados.5. sofrem meiose. onde os três pares de genes estão em pares de cromossomos separados. b) 60 espermatozóides. poderão ser encontrados 16 genótipos diferentes. abC.8 . . poderão ser formados 4 diferentes tipos de gametas. aabbcc e) AaBbCc Questão 673 Se a meiose ocorre numa célula de genótipo AaBbCc. Em experimentos envolvendo três características independentes (triibridismo).2.

2. considere a genealogia a seguir. Rh®. Questão 678 Na espécie humana. b) O indivíduo 3 deve ter herdado os alelos dessas duas características apenas de sua mãe. c) A probabilidade de o casal 1 × 2 ter uma criança destra e de visão normal é de 1/4. c) 1/8. e) 1/3. Questão 677 Um indivíduo de sangue tipo B. Qual a probabilidade de esse casal ter uma criança com fenótipo igual ao do pai? a) 1/2 b) 1/4 c) 1/8 152 ssinale a alternativa correta. b) 1/4. Um homem de visão normal e destro. Abc. que teve eritroblastose fetal ao nascer e é filha de pai do tipo O. b) 1/4. aBc. e) 1. casa-se com uma mulher de sangue tipo A. Sabendo que o daltonismo é condicionado por um gene recessivo ligado ao sexo e que a miopia é uma herança autossômica recessiva. cujo pai tinha miopia e era canhoto. abC e abc d) AaBbCc e) AABBCC e aabbcc Questão 674 Sabendo-se que a miopia e o uso da mão esquerda são condicionados por genes autossômicos recessivos.2. A probabilidade de esse casal ter uma criança que possa doar sangue para o pai é de: a) 1/2. c) 3/4.3 probabilidade do casal 4X5 ter uma criança de sexo feminino e de visão normal é de: a) 1/6. d) 1/2. filho de pai míope. casa-se com uma mulher míope e destra. 1. a miopia e a habilidade para a mão esquerda são caracteres condicionados por genes recessivos que se segregam de forma independente. AbC. ABc. a probabilidade de terem uma menina normal para ambas as características é de: a) 3/16 b) 1/4 c) 1/16 d) 1/2 e) 9/16 . Questão 676 No heredograma a seguir. d) Todos os descendentes de pai míope e canhoto possuem essas características.5. Rh®.5. a) O indivíduo 2 deve ser heterozigoto para os alelos dessas duas características. cuja mãe era canhota. Questão 675 Um indivíduo daltônico e não míope. Rh−.3 1. O casal já tem uma filha daltônica e míope. os indivíduos marcados apresentam um tipo de cegueira noturna. d) zero. filho de pai O.b) ABC e abc c) ABC. e) A probabilidade de o casal 4 × 5 ter uma criança míope e canhota é de 3/8. aBC. casa-se com uma mulher normal para ambas as características.

O principal evento responsável por essa diversidade ocorre durante a formação dos gametas.50% 153 1. (16) 50% de probabilidade de vir a apresentar apenas uma das anomalias. (02) 50% de probabilidade de vir a sofrer de catarata e ter ossos normais.3 .Se casar-se com uma mulher de sangue tipo A. presença de manchas brancas. A figura a seguir demonstra a distribuição independente de cromossomos maternos e paternos. pergunta-se: I .A ou B ou O. principalmente. quais os prováveis tipos de sangue dos filhos do casal? II . que ocorre durante a meiose. A partir do cruzamento Mmbb × mmBb. (08) 50% de probabilidade de vir a apresentar ambas as anomalias. a probabilidade de nascer um filhote marrom com manchas é a) 1/16 b) 3/16 c) 1/4 d) 1/2 e) 3/4 Questão 680 A diversidade biológica dos seres vivos está relacionada. Assim. Nessas condições. O pai da mulher tem ossos normais. casa-se com uma mulher de olhos livres de catarata mas com ossos frágeis. Esses dois pares de alelos autossômicos segregam-se independentemente. pode-se afirmar que a melhor expressão para o número (w) de gametas possíveis está representada em: a) w = 2£¤ b) w > 2£¤ c) w < 2£¤ d) w = 2¢¤ e) w¤ 2¢¤ Questão 681 A cegueira provocada pela catarata e a extrema fragilidade dos ossos são características que podem aparecer em seres humanos e resultam da ação de dois genes dominantes autossômicos presentes em cromossomos diferentes. (II) . a cor preta é determinada pelo alelo dominante M e a marrom pelo alelo m.zero b) (I) . podemos observar que o número possível de gametas (w) em uma espécie é igual a 2¾.d) 3/4 e) 3/8 Questão 679 Em determinada raça animal. Um homem com catarata e ossos normais cujo pai tem olhos normais. Soma ( ) Questão 682 Sendo um homem de sangue tipo O.5.2. (II) . (04) 25% de probabilidade de vir a ter olhos normais e ossos frágeis. Levando-se em consideração que na espécie humana ocorre a permuta gênica.Se esse homem casar-se com uma mulher de sangue tipo AB. com a reprodução sexuada. pode-se afirmar que um descendente do casal tem: (01) 100% de probabilidade de nascer livre de ambas as anomalias.O ou A ou B. em um organismo onde o número haplóide (n) é igual a 3. o alelo B condiciona padrão uniforme e o b. qual a probabilidade do nascimento de uma criança do tipo AB? A alternativa que responde corretamente às perguntas anteriores é: a) (I) .

B.menino de tipo sangüíneo A. c) os resultados dos grupos sangüíneos e de DNA não excluem a possibilidade do homem ser pai da criança. A e B.A ou B. Questão 687 Uma mulher de sangue tipo A.A ou B. . Os tipos de sangue dos filhos são apenas: a) A e AB b) A e B c) A. (II) . (II) .50% d) (I) .zero e) (I) . mas a seqüência de DNA do cromossomo X exclui. o grupo sangüíneo e o fator Rh é de a) 1/16 b) 1/12 c) 1/8 d) 1/4 e) 1/2 Questão 684 Nas hemácias de um indivíduo pertencente ao grupo sangüíneo B: a) existe o aglutinógeno B b) existe o aglutinógeno A c) existe a aglutinina A d) existe a aglutinina B e) existem o aglutinógeno A e a aglutinina B Questão 685 Um homem de genótipo AB casa-se com uma mulher receptora universal. casada com um homem de sangue tipo B. Se o casal vier a ter outros 5 filhos. foram realizados exames para identificação de grupos sangüíneos e análise de DNA. A. 154 . AB d) A. b) os resultados dos grupos sangüíneos não excluem a possibilidade do homem ser o pai da criança. d) os três resultados foram necessários para confirmar que o homem é mesmo o pai da criança.A ou B.1 a) os resultados dos grupos sangüíneos excluem a possibilidade do homem ser o pai da criança. correspondentes a um segmento localizado num autossomo e outro no cromossomo X. Rh−. A e A. e) maior que a chance de nascerem sucessivamente com sangue do tipo AB.25% Questão 683 Considere os seguintes dados: . B. e) os resultados de DNA contradizem os resultados dos grupos sangüíneos.pai sem aglutininas do sistema ABO no sangue. mas possuidor do antígeno Rh. .3. c) maior que a chance de nascerem todos com sangue do tipo AB.mãe de tipo sangüíneo B. Considerando apenas a tabela adiante.c) (I) . levando em conta o sexo. O Questão 686 Num caso de investigação de paternidade. A tabela a seguir resume os resultados parciais da análise de grupos sangüíneos (do menino. b) menor que a chance de nascerem todos com sangue do tipo AB. os outros exames foram desnecessários. B. O e) A. (II) . B. d) menor que a chance de nascerem sucessivamente com sangue do tipo AB. teve um filho de sangue tipo O. A probabilidade de os pais desse menino terem mais um filho com o mesmo fenótipo de seu irmão. de sua mãe e do suposto pai) e de duas seqüências de DNA (do menino e do suposto pai). B.5. podemos afirmar que: 1. a chance deles nascerem todos com sangue do tipo O é a) igual à chance de nascerem todos com sangue do tipo AB. Rh−.

d) AB e Rh positivo. a cada uma. conforme o esquema adiante.homozigoto dominante. foi observada aglutinação nas duas primeiras lâminas. foi colocada uma gota de sangue humano em cada uma delas. b) heterozigoto . assinale a opção correspondente ao possível genótipo da pessoa em teste: a) IÞIÞRR b) IÞIßrr c) IßiRr d) IÞirr e) iiRR Questão 689 No heredograma a seguir estão indicados os fenótipos dos grupos sangüíneos ABO e Rh. e) A e Rh positivo. adicionando-se. O indivíduo 6 deverá ser. soro anti-B na segunda e soro anti-Rh na terceira. respectivamente: 1. a) heterozigoto . Questão 691 A herança do sistema ABO é do tipo: a) com dominância.homozigoto dominante. e) poligênica.3. soros anti-A. anti-Rh e anti-B.5. quanto aos grupos sanguíneos ABO e fator Rh. A cada gota foi juntada igual quantidade de soro anti-A na primeira.homozigoto recessivo.Questão 688 Para se determinar o tipo sangüíneo de uma pessoa. c) heterozigoto .3. uma criança de tipo sangüíneo B. A partir desses dados podemos afirmar que o indivíduo. Rh+ poderá ser filha: 1.5. notou-se aglomeração de hemácias apenas no local onde havia soros anti-B e anti-A.heterozigoto.1 om relação a esses resultados.1 155 .heterozigoto. d) pleiotropia. foram colocadas três gotas de seu sangue sobre uma lâmina de vidro. Questão 690 Utilizando-se três lâminas de microscopia. b) quantitativa. e) homozigoto . d) homozigoto . c) A e Rh negativo. b) AB e Rh negativo. Questão 692 Qual das opções a seguir relaciona os grupos sangüíneos de um doador universal ideal? a) ARh− b) ABRh® c) ORh® d) ABRh− e) ORh− Questão 693 Considerando os casamentos a seguir. em relação aos locos dos sistemas ABO e Rh. Após alguns segundos. c) polialelia. Após a mistura do sangue com os respectivos soros. é: a) B e Rh positivo.

c) o casal III ou do casal IV.5. que considera o sistema sangüíneo ABO. a) O indivíduo 9 pode ser doador universal. d) O indivíduo 1 é receptor universal. que é filha de pai e mãe do tipo B.5. recebeu transfusão de sangue de sua mulher Tânia. e) O indivíduo 8 é heterozigoto. e) IÞi e IßIß. assinale a alternativa INCORRETA. a probabilidade de nascer uma menina do tipo O. Questão 697 1. Sabendo-se que o marido tem o aglutinogênio B. que tem tipo sangüíneo A. a probabilidade do casal ter uma criança do tipo A. Rh® é: a) 100% b) 25% c) 75% d) 50% e) 0 Questão 695 Uma mulher que possui aglutinina anti-B no seu sangue teve um filho do grupo O. b) O indivíduo 7 pertence ao grupo sangüíneo A.3.5. Sabendo que o casal 5×6 já perdeu uma criança com eritroblastose fetal. b) IÞIÞ e Ißi. Questão 696 A respeito do heredograma acima.1 Considere o heredograma acima. c) IÞi e Ißi. Sabendo-se que Tânia teve eritroblastose fetal ao nascer. b) do casal I ou do casal IV. Rh® é de: a) 1/6 b) 1/8 c) 1/2 d) 1/4 e) 1/3 Questão 698 O heredograma a seguir mostra os diferentes tipos sangüíneos existentes em uma família. que mostra a tipagem ABO e Rh dos indivíduos. os genótipos do casal são: a) IÞi e IÞi.3. 156 .1. Questão 694 Jorge. d) somente do casal II e) do casal I ou do casal II ou do casal III.1 1. Rh− e é filho de pai tipo A e mãe tipo B. c) O indivíduo 6 é homozigoto. d) IÞIß e IÞIÞ.3.1 a) somente do casal I.

somente. somente. c) TIPO SANGÜÍNEO: A ou O. Epaminondas pode concluir que D. . Questão 702 ssinale a alternativa que contém. Epaminondas. Quantos filhos biológicos tem esse casal? a) 5 b) 4 c) 3 d) 2 e) 1 Questão 700 Uma criança tem tipo sangüíneo do tipo AB. Questão 701 Alexsander não sabe qual é o seu grupo sangüíneo e o seu tipo de Rh. Entretanto sabe que seu pai é A+.IÞIß Questão 699 Pais cujo grupo sanguíneo são AB e O têm cinco filhos com os seguintes fenótipos: dois são O.1 ou negativo. Josefa apresenta sangue do grupo: a) A b) B c) AB d) O Questão 703 O esquema apresenta uma árvore genealógica de alguns primatas e seus possíveis grupos sangüíneos no sistema ABO. c) A e O. b) B e B. e) TIPO SANGÜÍNEO: O. d) TIPO SANGÜÍNEO: A ou O. um B e um AB.5. somente.IÞIÞ d) B . Dr. de acordo com a seguinte composição genética: . b) TIPO SANGÜÍNEO: O. respectivamente. somente. Epaminondas provocava aglutinação das hemácias de D.ii b) A .Indivíduos que apresentem apenas alelos recessivos ii pertencem ao grupo O. sua mãe O+ e seu irmão é A-.IÞi c) A . mas não se sabia o seu grupo sangüíneo.2 a) O . .Ißi e) AB . A partir dos resultados. que precisava urgentemente de transfusão sangüínea. FATOR Rh: positivo No ambulatório de uma pequena cidade do interior estava D. Como faltavam anti-soros para a determinação dos grupos sangüíneos no sistema ABO. FATOR Rh: negativo ou positivo. fazendo o mesmo com o sangue de D. e) AB e O.Indivíduos que apresentem apenas alelo dominante IÞ e não apresentem Iß pertencem ao grupo A. FATOR Rh: positivo. d) A e B. O teste subseqüente revelou que o soro do Dr. Josefa não era capaz de aglutinar as hemácias do Dr. Josefa. Josefa. que é do grupo A. somente. Epaminondas. Assinale a opção que contém o(s) grupo(s) sangüíneo(s) e o(s) tipo(s) de Rh que Alexsander pode ter: a) TIPO SANGÜÍNEO: A. um A.3.1. usou de um outro recurso: retirou um pouco de seu próprio sangue do qual separou o soro. Dr. FATOR Rh: positivo. o fenótipo e o genótipo do indivíduo II. Josefa. Os tipos sangüíneos dos pais biológicos dessa criança são: a) A e A.Indivíduos que apresentem os dois alelos dominantes IÞ e Iß pertencem ao grupo AB. FATOR Rh: negativo.Indivíduos que apresentem apenas alelo dominante Iß e não apresentem IÞ pertencem ao grupo B. . mas o soro de D. somente. 157 .

3. os casamentos entre as pessoas O e A e entre pessoas O e B produzem apenas descendentes pertencentes ao grupo O. os casamentos entre pessoas O e A e entre pessoas O e B apresentam 50% de chance de produzir descendentes pertencentes ao grupo O. totalmente isolada. Questão 704 Os esquemas mostram as possíveis transfusões de sangue tradicionais em relação aos sistemas ABO e Rh. apenas dois. mas não de chimpanzés. somente humanos podem apresentar os quatro grupos sangüíneos no sistema ABO. é correto afirmar. Questão 706 Observe a árvore genealógica a seguir para o grupo sangüíneo (ABO) em uma família: 158 . e) As pessoas pertencentes ao grupo AB só recebem sangue de AB. c) O gene O é recessivo e. 1.5. 1. Assim. d) As pessoas pertencentes ao grupo AB são recessivas e. apresentam pouca chance de existir numa população. Assim. pertences a uma determinada seita religiosa. Essa situação leva a uma menor freqüência dessas pessoas na população. Considerando-se apenas os antígenos do sistema ABO. EXCETO: a) Apenas dois dos primatas citados podem apresentar indivíduos doadores universais no sistema ABO. são mostradas as freqüências aproximadas dos grupos sangüíneos do sistema ABO da população original (tabela 1) e da população atual (tabela 2).3.Questão 705 Suponha que um grupo de pessoas. portanto. c) Apenas dois dos primatas da árvore podem apresentar indivíduos receptores universais no sistema ABO. b) O gene O é dominante sobre os genes A e B. portanto. d) Alguns gorilas podem receber sangue de alguns orangotangos.1 1. mas chimpanzés.5. Nas tabelas a seguir.3. respectivamente: a) O Rh® e O Rh− b) O Rh− e AB Rh® c) A Rh− e OB Rh® d) AB Rh® e O Rh− Qual das alternativas a seguir apresenta uma explicação possível para a mudança na freqüência dos grupos sangüíneos nessa população? a) O gene O é dominante sobre os genes A e B. o casamento entre pessoas pertencentes ao grupo O origina apenas descendentes do grupo O.1 Pode-se dizer que os tipos sanguíneos mais difíceis e mais fáceis para receber sangue são. imigrou para uma região há mais de meio século. b) Orangotangos podem apresentar três grupos sangüíneos. A população originária desse grupo vive até hoje no mesmo local.5.1 De acordo com o esquema.

Rh− c. para o grupo sangüíneo ABO em uma família: 1.3. B. MN. marque a opção correta: a) o indivíduo 3 é do grupo sangüíneo "AB" b) o indivíduo 1 pode ser do grupo sangüíneo "AB" c) o indivíduo 1 é do grupo sangüíneo "A" d) o indivíduo 1 é do grupo sangüíneo "O" Questão 707 Observe a árvore genealógica a seguir.1 CRIANÇAS I.5. Rh− II. II . A.c d) I . AB. III . II .5. a) I .b. dois irmãos são do grupo sangüíneo A. III .a Questão 709 Sabe-se que.a e) I . O indivíduo 2 é mulher do grupo sangüíneo "A" 2. N.3. N.b. III .1 .b. O indivíduo 4 é homem do grupo sangüíneo "B" 3. CASAIS I. Rh− PAIS a. Dos pares de genótipos a seguir.c.c b) I . outro é do grupo AB e outro do grupo O.b. O indivíduo 5 é mulher do grupo sangüíneo "O" Sobre a árvore anterior. AB × AB 159 OBS: 1. N. B. II . III . M. Rh® Assinale a alternativa que relaciona corretamente cada criança ao seu pai. O.c.Legenda: Grupo "A": A/A ou A/O Grupo "B": B/B ou B/O Grupo "AB": A/B Grupo "O": O/O arque a opção correta: a) o indivíduo nŽ 5 pode ser de grupo sangüíneo "AB" b) o indivíduo nŽ 1 é do grupo sangüíneo "AB" c) o indivíduo nŽ 6 é do grupo sangüíneo "AB" d) o indivíduo nŽ 7 não pode ser filho do casal 5×6 Questão 708 Uma mulher com grupos sangüíneos B.c.b c) I . N. N. II . A. II . Rh® teve três crianças com pais distintos: 1. Rh® III.a. Rh− b.a. o único que pode ser dos pais desses indivíduos é a) ii × Ißi b) IÞi × IÞIß c) IÞi × Ißi d) IÞIÞ × IÞIß e) IÞIÞ × IßIß Questão 710 Os tipos sangüíneos do sistema ABO de três casais e três crianças são mostrados a seguir. III .a. numa família.

II. B × B III. A × O CRIANÇAS a. A b. O c. AB Sabendo-se que cada criança é filha de um dos casais, alternativa que associa corretamente cada casal a seu filho é a) I - a; II - b; III - c b) I - a; II - c; III - b c) I - b; II - a; III - c d) I - c; II - a; III - b e) I - c; II - b; III - a Questão 711 Uma criança necessita urgentemente de uma transfusão de sangue. Seu pai tem sangue do tipo B e sua mãe, do tipo O. Que outro(s) tipo(s) de sangue, além do tipo O, poderia(m) ser utilizado(s) na transfusão, mesmo sem a realização de teste, sabendo-se que o avô paterno da criança tem sangue do tipo AB e sua avó paterna tem sangue do tipo O? a) Tipo AB. b) Tipo A. c) Tipo B. d) Tipo A e tipo B. e) Nenhum outro tipo. Questão 712 Na herança do sistema sangüíneo ABO, há três alelos autossômicos principais: IÞ (para sangue do tipo A), Iß (para sangue do tipo B) e i (para sangue do tipo O). Sabe-se, ainda, que IÞ e Iß são codominantes, ambos dominando sobre i. Uma mulher do tipo A, casada com um homem do tipo B, teve uma filha do tipo O. O homem não quis reconhecer a paternidade alegando infidelidade por parte da mulher. Como na época em que o fato ocorreu não havia o "exame do DNA", o Juiz recorreu a um geneticista que lhe apresentou um parecer sobre o caso. Assinale a alternativa que contém a conclusão correta do geneticista. a) O homem tem razão, pois, por se tratar de um caso de herança ligada ao sexo, a filha dos dois teria que ser, obrigatoriamente, do tipo A.

b) O homem tem razão, pois, pais com tipos A e B, quaisquer que sejam seus genótipos, jamais poderiam ter filhos ou filhas do tipo O. c) O homem não tem razão, pois, pais com tipos A e B, dependendo de seus genótipos, podem ter filhos ou filhas com qualquer um dos tipos sangüíneos (A, B, AB e O). d) O homem não tem razão, pois, por se tratar de herança autossômica, filhos e filhas teriam que ser, obrigatoriamente, do tipo O. e) O homem tem razão, pois, pais com tipos A e B, só podem ter filhos ou filhas do tipo AB, visto que IÞ e Iß são codominantes. Questão 713 Mulher branca, submetida à inseminação artificial, deu à luz gêmeos de cor negra. O fato causou polêmica, já que o pai também é branco. A grande dúvida é saber se houve troca de embriões ou apenas de um dos gametas. Adaptado do "Jornal do Brasil", 1Ž de agosto de 2002 Considere o fato relatado e suponha que a mãe tenha sangue tipo A e seja filha de pai e mãe com sangue tipo AB. Nesse caso, o tipo sangüíneo dos gêmeos poderia ser: a) A ou O b) A ou AB c) B ou O d) B ou A e) AB ou O Questão 714 É necessário o conhecimento do tipo sangüíneo em caso de transfusão. Em relação ao sistema ABO, ( ) indivíduos do grupo sangüíneo O podem doar sangue para pessoas do seu próprio tipo sangüíneo e para os demais . ( ) indivíduos do grupo AB podem receber sangue de qualquer tipo. ( ) indivíduos portadores de sangue do tipo A possuem aglutinogênios A. ( ) indivíduos do grupo B possuem aglutinina anti-A.

160

Questão 715 Além do teste de DNA, há exames mais simples que podem ajudar a esclarecer dúvidas sobre paternidade. Por exemplo, o teste de tipagem sangüínea do sistema ABO permite determinar quem não pode ser o pai. Assinale a alternativa que apresenta uma situação em que esse exame assegura a exclusão da paternidade: a) O filho é do tipo O, a mãe do tipo O e o suposto pai do tipo A. b) O filho é do tipo AB, a mãe do tipo AB e o suposto pai do tipo O. c) O filho é do tipo AB, a mãe do tipo A e o suposto pai do tipo B. d) O filho é do tipo B, a mãe do tipo B e o suposto pai do tipo O. e) O filho é do tipo A, a mãe do tipo A e o suposto pai do tipo B. Questão 716 O heredograma a seguir representa uma família na qual foram determinados os grupos sangüíneos do sistema ABO para alguns dos membros, e do sistema Rh para todos os membros. Com base nas informações contidas no heredograma e em seus conhecimentos sobre o assunto, é INCORRETO afirmar-se que

a) a probabilidade do indivíduo I-2 formar gametas iR é de 50%. b) a probabilidade de II-4 ter uma criança com eritroblastose fetal é de O%. c) os indivíduos Rh positivos da geração II pertencem ao grupo sangüíneo A, e os Rh negativos, ao grupo O. d) o indivíduo I-1 é heterozigoto para uma das características. e) os indivíduos II-3 e II-4 podem apresentar os dois tipos de aglutinina do sistema ABO. Questão 717 Nas situações em que vítimas de acidentes necessitam de transfusão de sangue, sem que se conheça o tipo sangüíneo de cada uma delas, é recomendável utilizar-se o tipo "O negativo". É CORRETO afirmar que, nesse caso, tal tipo sangüíneo é o mais adequado porque, nas hemáceas do doador, estão a) presentes os antígenos correspondentes aos anticorpos do receptor. b) ausentes os anticorpos correspondentes aos antígenos do receptor. c) ausentes os antígenos correspondentes aos anticorpos do receptor. d) presentes os anticorpos correspondentes aos antígenos do receptor. Questão 718 Com relação à genética dos grupos sangüíneos ABO, pode-se afirmar que: a) existem 16 modalidades de cruzamentos de gametas. b) existem 9 possibilidades de acasalamentos. c) indivíduo com grupo sangüíneo O não pode ser filho de acasalamento de indivíduos dos grupos O e AB. d) indivíduo do grupo sangüíneo B não pode ser filho de acasalamento de indivíduos dos grupos O e AB. e) indivíduo com grupo sangüíneo AB pode ser filho de acasalamento de indivíduos dos grupos O e B. Questão 719 A respeito dos grupos sangüíneos avalie as proposições abaixo. ( ) Grupo sangüíneo: A
161

1.5.3.1

Antígenos: A Anticorpos: Anti-B Doa: A, AB Recebe: A, O ( ) Grupo sangüíneo: B Antígenos: B Anticorpos: Anti-A Doa: B, AB Recebe: B, O ) Grupo sangüíneo: AB Antígenos: A e B Anticorpos: Anti-A e Anti-B Doa: AB Recebe: AB, A , B, O ) Grupo sangüíneo: O Antígenos: O Anticorpos: Não tem Doa: O, A, B, AB Recebe: O ) Grupo sangüíneo: A Antígenos: A Anticorpos: Anti-A Doa: A, AB Recebe: A, O Questão 720 Na figura a seguir são mostrados os genótipos e fenótipos possíveis, considerando-se os alelos IÞ, Iß e i determinantes dos grupos sangüíneos do sistema ABO no homem. De acordo com a figura, analise as proposições a seguir.

(

) Todos os descendentes de um casal de genótipo tipo 2 serão do grupo A e apresentarão em suas hemácias o aglutinogênio A. 2) Indivíduos do grupo sangüíneo B de genótipo 3 ou 4 apresentam na membrana de suas hemácias aglutinogênio B e, no plasma, aglutinina anti-A. 3) Os descendentes de um casal (genótipo 5) do grupo sangüíneo AB serão fenotipicamente AB e, como têm em seus genótipos os alelos IÞ e Iß, apresentam, na membrana de suas hemácias, os antígenos A e B. 4) Indivíduos do grupo sangüíneo O de genótipo 6, apresentam aglutinogênios A e B no plasma, mas não têm aglutininas anti-A e anti-B na membrana de suas hemácias. Está(ão) correta(s) apenas: a) 2 b) 1 e 4 c) 2 e 4 d) 2 e 3 e) 2, 3 e 4 Questão 721 Três irmãos (João, José e Maria) realizaram um exame de sangue em laboratório para identificar os seus tipos sangüíneos, com o objetivo de verificar a possibilidade de doarem sangue ao pai, que necessitaria de uma transfusão após uma cirurgia. Um deles (João) ficou surpreso ao descobrir seu tipo sangüíneo - O - e achou que não era filho biológico do casal que o criou. Seu pai e o irmão apresentam sangue do tipo A e sua mãe e a irmã apresentam sangue do tipo B. Todos são RH®. Com base no texto e em seus conhecimentos sobre a herança dos tipos sangüíneos, é correto afirmar que a) João não pode ser filho biológico do casal, pois de acordo com a herança genética possível do tipo sangüíneo, os filhos somente poderiam apresentar sangues dos tipos A, B e AB. Dos filhos biológicos, somente José pode doar sangue ao pai, pois as hemácias de seu sangue apresentam aglutinogênio A. b) João pode ser filho biológico do casal, desde que pelo menos um dos pais seja heterozigoto e apresente o alelo responsável pela presença de aglutininas anti-A e anti-B no plasma. O pai não pode receber sangue de Maria, pois seu sangue apresenta aglutinina anti-B. c) João não pode ser filho biológico do casal, assim como seus dois irmãos, pois de acordo com a herança genética
162

(

(

1.5.3.1

possível do tipo sangüíneo, os filhos somente poderiam apresentar sangues dos tipos AB. O pai pode receber sangue de João e José, pois o sangue dele apresenta aglutinina anti-A, assim como o de seus filhos. d) Se Maria engravidar de um homem com o mesmo genótipo para o tipo sangüíneo de seu irmão João, existe a probabilidade de 100% de seu filho ter sangue do tipo B. Porém, se ela engravidar de um homem com o mesmo genótipo para o tipo sangüíneo de seu irmão José, existe a probabilidade de 50% de seu filho ter sangue do tipo AB, 25% do tipo A e 25% do tipo B. e) João pode ser filho biológico do casal, desde que ambos os pais sejam heterozigotos e apresentem o alelo responsável pela ausência de aglutinogênio. João pode doar sangue para seu pai, pois as hemácias do seu sangue não apresentam aglutinogênios. Questão 722 Jorge, portador de grupo sangüíneo AB Rh-, e Júlia, que é AB Rh+, têm uma filha, Joana, que aos 3 anos de idade necessita de uma transfusão sangüínea. Os exames laboratoriais por hemaglutinação dão os seguintes resultados:

b) seus eritrócitos não contêm anticorpos anti-A e anti-B. c) seu plasma não contém antígenos A e B. d) seus eritrócitos não contêm antígenos A e B. e) seu sangue não contém antígenos nem anticorpos. Questão 724 A herança dos tipos sangüíneos do sistema ABO constitui um exemplo de alelos múltiplos (polialelia) na espécie humana. Com relação ao sistema ABO é CORRETO afirmar que: (01) o tipo O é muito freqüente e, por este motivo, o alelo responsável por sua expressão é dominante sobre os demais. (02) os indivíduos classificam-se em um dos quatro genótipos possíveis: grupo A, grupo B, grupo AB e grupo O. (04) existem três alelos: o IÞ, o Iß e o i. (08) os alelos IÞ e Iß são codominantes. (16) se um indivíduo do grupo A for heterozigoto, ele produzirá gametas portadores de IÞ ou de i. (32) os indivíduos de tipo sangüíneo O possuem aglutinogênios em suas hemácias, porém não possuem aglutininas no plasma. (64) em alguns cruzamentos, entre indivíduos do grupo A com indivíduos do grupo B, é possível nascerem indivíduos do grupo O. Questão 725 Em relação ao sistema sangüíneo ABO, um garoto, ao se submeter ao exame sorológico, revelou ausência de aglutininas. Seus pais apresentaram grupos sangüíneos diferentes e cada um apresentou apenas uma aglutinina. Os prováveis genótipos dos pais do menino são a) Ißi - ii. b) IÞi - ii. c) IÞIß - IÞi. d) IÞIß - IÞIÞ. e) IÞi - Ißi.

1.5.3.1

Em face dos dados apresentados, assinale a alternativa correta. a) Joana não pode ser filha natural de Júlia. b) Joana não pode receber sangue O Rh-. c) Jorge não pode ser o pai natural de Joana. d) Joana pode receber sangue AB Rh-. e) Joana pode ser homozigota para B. Questão 723 Em uma transfusão sangüínea, indivíduos do grupo O são considerados doadores universais porque a) seu plasma não contém anticorpos anti-A e anti-B.

163

Questão 726 Para os grupos sangüíneos do sistema ABO, existem três alelos comuns na população humana. Dois (alelos A e B) são co-dominantes entre si e o outro (alelo O) é recessivo em relação aos outros dois. De acordo com essas informações, pode(m)-se afirmar: I. Se os pais são do grupo sangüíneo O, os filhos também serão do grupo sangüíneo O. II. Se um dos pais é do grupo sangüíneo A e o outro é do grupo sangüíneo B, todos os filhos serão do grupo sangüíneo AB. III. Se os pais são do grupo sangüíneo A, os filhos poderão ser do grupo sangüíneo A ou O. Está(ão) correta(s) a) apenas I. b) apenas II. c) apenas III. d) apenas I e III. e) I, II e III. Questão 727 Observe a genealogia.

ara o casal (5 e 6) que pretende ter muitos filhos, foram feitas as quatro afirmações a seguir. I - O casal só terá filhos AB e Rh positivo. II - Para o sistema ABO, o casal poderá ter filhos que não poderão doar sangue para qualquer um dos pais. III - O casal poderá ter filhos Rh positivo, que terão suas hemácias lisadas por anticorpos anti-Rh produzidos durante a gravidez da mãe. IV - Se for considerado apenas o sistema Rh, o pai poderá doar sangue a qualquer um de seus filhos. São corretas, apenas, as afirmações a) II e IV b) I, II e IV c) II, III e IV d) I, II e III. e) I e III. Questão 728 Em um acidente de carro, três jovens sofreram graves ferimentos e foram levados a um hospital, onde foi constatada a necessidade de transfusão de sangue devido a forte hemorragia nos três acidentados. O hospital possuía em seu estoque 1 litro de sangue do tipo AB, 4 litros do tipo B, 6 litros do tipo A e 10 litros do tipo O. Ao se fazer a tipagem sangüínea dos jovens, verificou-se que o sangue de Carlos era do tipo O, o de Roberto do tipo AB e o de Marcos do tipo A. Considerando apenas o sistema ABO, os jovens para os quais havia maior e menor disponibilidade de sangue em estoque eram, respectivamente, a) Carlos e Marcos. b) Marcos e Roberto. c) Marcos e Carlos. d) Roberto e Carlos. e) Roberto e Marcos. Questão 729 Considerando o casamento entre um homem tipo sangüíneo A®, cujo pai era O−, com uma mulher B® cuja mãe era A−, assinale a(s) alternativa(s) correta(s). (01) A probabilidade de nascer 1 filha mulher B® é 3/16. (02) A probabilidade de nascer 1 filho homem O− é nula. (04) A probabilidade de nascer 1 filho homem e 1 filha mulher AB é 9/1024.
164

1.5.3.1

(08) A probabilidade de nascer filho homem AB− é 1/16. (16) A probabilidade de nascer 1 filho homem A® é 1/8. (32) A probabilidade de nascer 2 filhas mulheres A− é 1/1024. Questão 730 Uma mulher Rh− casou-se e teve um filho. Numa segunda gestação a criança apresentou um quadro de eritroblastose fetal. Com estes dados, indique qual a opção que apresenta o fenótipo para o fator Rh da mãe, do pai e da criança, respectivamente. a) Mãe Rh negativo, Pai Rh positivo e Criança Rh positivo. b) Mãe Rh positivo, Pai Rh positivo e Criança Rh negativo. c) Mãe Rh positiva, Pai Rh negativo e Criança Rh negativa. d) Mãe Rh positivo, Pai Rh negativo e Criança Rh positivo. e) Mãe Rh negativo, Pai Rh positivo e Criança Rh negativo. Questão 731 A observação do esquema a seguir, que representa a genealogia de uma família em relação aos grupos sanguíneos MN, nos permite afirmar que:

a) Rh positivo e Rh negativo. b) Rh negativo e Rh positivo. c) Rh positivo e Rh positivo. d) Rh negativo e Rh negativo. e) Rh positivo e Rh neutro. Questão 733 A doença hemolítica do recém-nascido é um problema causado pela incompatibilidade sangüínea entre mãe e feto. Assinale a alternativa que contém a família na qual é possível a ocorrência da citada doença. a) Mãe: Pai: 1Ž bebê: 2Ž bebê: b) Mãe: Pai: 1Ž bebê: 2Ž bebê: c) Mãe: Pai: 1Ž bebê: 2Ž bebê: IÞi Ißi IÞIß Ißi IÞIÞ IßIß IÞIß IÞIß ii ii ii ii rh Rh Rh Rh rh rh rh rh

Rh rh rh rh Rh rh rh rh rh rh rh rh Rh Rh Rh Rh rh Rh rh rh rh rh rh rh rh rh rh rh rh rh rh rh

1.5.3.2

d) Mãe: ii Pai: Ißi 1Ž bebê: Ißi 2Ž bebê: ii e) Mãe: IÞi Pai: ii 1Ž bebê: IÞi 2Ž bebê: ii Questão 734

a) sangue MN é característica determinada por gene dominante. b) os indivíduos 4 e 5 são heterozigotos. c) o casal 3 e 4 poderá ter filhos dos três tipos de grupos sanguíneos. d) se o indivíduo 5 casar-se com uma mulher de sangue N, todos os filhos serão heterozigotos. e) um próximo filho do casal 6 e 7 poderá ser do grupo N. Questão 732 Quanto ao surgimento da eritroblastose fetal, ou doença hemolítica do recém-nascido, podemos afirmar que ela ocorre quando o pai e a mãe respectivamente apresentam:

Paula, portadora do aglutinogênio B e Rh negativo casou-se com João, portador dos aglutinogênios A e B e Rh positivo. Sabendo-se que a mãe de Paula não possui aglutinogênios e que João teve um irmão com doença hemolítica do recém nascido, conclui-se que a probabilidade de o casal ter um filho Rh positivo e sangue tipo A é: a) 9/16
165

Questão 739 Indivíduos sem antígeno Rh nas hemácias são considerados recessivos. mesmo no caso de glóbulos vermelhos atingirem a circulação materna em sucessivas gestações.Em caso de transfusão sangüínea. o mesmo ficou: a) despreocupado e não fez qualquer recomendação relativa ao fato. d) se somente I e III estiverem corretas. que tem Rh® e é homozigoto.5.b) 3/16 c) 1/4 d) 1/8 e) 1/2 Questão 735 Lúcia e João são do tipo sangüíneo Rh positivo e seus irmãos. b) o pai possui genótipo IÞIß. Ambos possuem o mesmo grupo sangüíneo. O sinal + indica reação positiva e o sinal . III . pois o primeiro filho em geral não tem a anemia. b) se somente II estiver correta. mesmo sendo Rh®. logo após o parto. c) a mãe pode pertencer ao tipo sangüíneo O. b) despreocupado. pois todos os filhos desse casal serão abortados. c) se somente I estiver correta. II . são do tipo Rh negativo. a criança poderá receber sangue. 1. que é receptor universal e teve eritroblastose fetal. b) Lúcia e João.indica reação negativa.2 onsidere as seguintes afirmações: I . Assinale: a) se somente III estiver correta.O genótipo do pai pode ser IÞIÞRR. Quais dos quatro irmãos podem vir a ter filhos com eritroblastose fetal? a) Marina e Pedro. bem como todos os filhos Rh− não serão atingidos pela doença e esta só atinge uma pequena fração de casos em outras gestações de filhos Rh®. e) se somente II e III estiverem corretas. apenas solicitando ao casal que o procurasse no momento da segunda gestação. e) é incorreta. pois filhos Rh®. casou-se com Elaine. disse que esse procedimento não seria mais necessário. a mãe recebesse soro anti-Rh. d) é incorreta. Carlos. pois todos os filhos desse casal terão uma doença grave fetal caracterizada por uma anemia profunda (Eritroblastose fetal). tanto da mãe quanto do pai. Questão 738 O quadro abaixo mostra os resultados das tipagens ABO e Rh de um casal e de seu filho. pois não existe influência do fator Rh positivo ou negativo nos casos de Eritroblastose fetal. Pedro e Marina. d) Pedro e João. Fazendo um exame pré-natal e relatando esse fato ao médico. não fez qualquer recomendação. c) é incorreta. c) preocupado. Questão 736 A afirmação que uma mulher Rh− não deve casar-se com um homem Rh®: a) é correta. d) essa criança é certamente heterozigota para o fator Rh. Questão 737 Uma criança tem genótipo igual ao pai. não serão atingidos pela Eritroblastose fetal. d) bastante preocupado. Então é INCORRETO afirmar que: a) a mãe é certamente Rh−. e) a mãe pode ter genótipo IÞi. recomendando que. b) é correta. entretanto. que tem Rh−. e) João e Marina. Numa segunda gravidez.Essa mulher poderá dar à luz uma criança com eritroblastose fetal. inclusive pela informação de 166 .3. c) Lúcia e Marina.

positivo.Rh−. PAI .3.Rh®. dizendo ao casal que a gravidez era de altíssimo risco e eles não poderiam mais ter outro filho. a probabilidade de esse casal vir a ter um filho do sexo masculino. negativo.Rh®. A probabilidade desse casal vir a ter uma criança Rh− é de a) 100% b) 75% c) 50% d) 25% e) 0% Questão 744 Um casal teve uma criança com eritroblastose fetal. Assinale a alternativa do quadro abaixo que identifica corretamente os grupos sangüíneos dessa família. a mãe receba o soro anti-Rh.Rh®. 167 . Considerando apenas o fator Rh. respectivamente: a) negativo. é casada com um homem Rh®. positivo. negativo. CRIANÇA . negativo. após cada parto.Rh−. cujo pai é Rh−.Rh−. com ocorrência de eritroblastose fetal. c) Em III.Rh− c) MÃE. a) MÃE.5. Mãe = rr. logo após o parto da 1 gravidez.Rh® d) MÃE. positivo. CRIANÇA . Questão 742 Uma mulher com sangue do tipo A / Rh® / MM é casada com um homem com tipo sangüíneo B / Rh® / NN. PAI . PAI . c) negativo.Rh−. CRIANÇA . b) Após a 1 gravidez. cuja mãe é Rh−.Rh−. positivo. CRIANÇA .Rh® 1. b) negativo. o do seu marido e o da criança são.2 a) A placenta normalmente funciona como uma barreira que separa as células sangüíneas fetais e maternas. após o contato com o antígeno Rh®. os antígenos fetais não serão capazes de induzir a produção de anticorpos anti-Rh pela mãe. Questão 740 Um casal possui o seguinte genótipo para o fator Rh: Pai = Rr. CRIANÇA . Questão 745 A incompatibilidade materno-fetal ao antígeno Rh pode determinar um doença denominada Eritroblastose Fetal. Se uma mulher foi orientada a usar a vacina anti-Rh logo após o nascimento do primeiro filho. a mãe produz anticorpos anti-Rh que podem ser transferidos para a corrente sangüínea fetal. é: a) 1 b) 1/2 c) 1/3 d) 1/4 e) 1/8 Questão 741 Interpretando a figura a seguir sobre a Doença Hemolítica do recém-nascido (DHR). a DHR poderia ser evitada. positivo. recomendando bastante atenção em cada gravidez. PAI . d) positivo. negativo. de maneira que. e) bastante preocupado.Rh®.Rh−. PAI . e) positivo. a mãe recebesse anticorpos anti-Rh. Qual das alternativas abaixo indica o tipo sangüíneo de uma criança que NÃO poderia ter sido gerada por este casal? a) A / Rh® / NN b) A / Rh− / MN c) AB / Rh− / MN d) O / Rh® / MN e) O / Rh− / MN Questão 743 Uma mulher Rh®.compatibilidade de grupo sangüíneo.Rh− e) MÃE. negativo. podemos dizer que seu fator Rh. assinale a afirmativa INCORRETA. d) Se.Rh® b) MÃE.

... Considerando o fato de que essa mulher não foi submetida à transfusão de sangue em toda a sua vida anterior. e) independente do Rh materno... b) Os abortados certamente eram Rh negativo. d) em Y... a mãe foi sensibilizada com o sangue Rh+ do 2Ž filho. os genótipos da mãe. é correto concluir que. Rh®. esse conhecido por doença hemolítica do recém-nascido (DHRN) ou eritroblastose fetal. o feto apresentou o quadro de hemólise de hemácias.. Questão 747 No segundo parto de uma mulher. a mãe foi sensibilizada com o fator Rh.. em consulta médica. Esta condição é provocada por incompatibilidade sangüínea do fator Rh. Em relação à patologia observada nesta família.. c) Este casal jamais poderá ter outros filhos. e assinale abaixo a alternativa que indica.2 ela observação dos gráficos e considerando que essa mulher teve um filho em cada gestação e nunca recebeu transfusão de sangue. o filho é Rh−. a mãe transferiu anticorpos anti-Rh para o 1Ž filho Rh-. ... c) quando a mãe é Rh− e o pai Rh®.. o qual não teve eritroblastose fetal. nenhum dos filhos será b) heterozigoto. d) quando a mãe é Rh® e o pai Rh−. todos os filhos serão d) heterozigoto. c) em Y. 1.... exclusivamente: a) quando a mãe é Rh® e o filho Rh−.5....2 Questão 748 Os dois gráficos a seguir representam as quantidades de anticorpos anti-Rh presentes no sangue de uma mulher (Rh-) em gestações distintas. no quadro apresentado. Seu caso foi diagnosticado. sendo observado. a) em X.do 1Ž filho. o qual não teve eritroblastose fetal..Questão 746 A eritroblastose fetal é uma doença hemolítica adquirida apresentada por alguns recém-nascidos. o qual teve eritroblastose fetal. o qual teve eritroblastose fetal. Isto só acontecerá quando houver passagem do sangue do embrião para a circulação materna. nenhum dos filhos será e) homozigoto..5.3.. 168 1. icterícia e aumento do baço e fígado. ... além da anemia. Se ele for .. e teve seu primeiro filho sem qualquer anormalidade. analise os genótipos descritos. a) homozigoto. Questão 749 Assinale a alternativa que completa corretamente as lacunas no texto a seguir. respectivamente.. como eritroblastose fetal. metade dos filhos será Questão 750 Após uma primeira gravidez bem sucedida.. uma mãe abortou três vezes. a mãe transferiu anticorpos anti-Rh para o 2Ž filho Rh+. assinale a alternativa CORRETA: a) A mãe é Rh positivo. homozigota recessiva e seu marido é Rh®. A mãe reconhecerá os glóbulos vermelhos do embrião como estranhos e produzirá anticorpos anti-Rh.3. do primeiro filho e do segundo filho. b) em X... todos os filhos serão c) homozigoto. b) quando a mãe é Rh− e o filho Rh®..... Uma mulher é do tipo sangüíneo Rh−.

3 litros de tipo A. c) alta. o livro onde estavam registrados os códigos foi perdido. 10 e 18 litros. 8 e 16 litros.3. 5. visto que sua mãe genética é Rh®. por acidente. A probabilidade de o "bebê de proveta" nascer com a doença hemolítica do recém-nascido é: a) mínima. c) 18. 13 e 5 litros. 3. b) mínima. com absoluta certeza. pois a "mãe de aluguel" é Rh®. b) 2. será Rh®. Questão 751 Uma mulher com útero infantil. respectivamente: a) 2.5. Questão 752 Um banco de sangue possui 5 litros de sangue tipo AB.3 (s) seta(s) cujo sentido (doação ë recepção) está(ão) errado(s) é(são): a) 4 e 5 b) 2 c) 1 d) 3 Questão 755 Em um banco de sangue de um hospital.d) A criança é Rh negativo. e o resultado foi o seguinte: 169 . 5 e 8 litros. e) O pai é Rh positivo.3. 8 litros B e 2 litros O. Impedida de ter filhos. O que o casal não sabia é que a "mãe de aluguel" tivera três filhos. d) 2. 18 e 10 litros. já que o "bebê de proveta". visto que seu pai é Rh−. 8. 1. o casal decide ter um "bebê de proveta" e contrata uma "mãe de aluguel" para receber em seu útero o zigoto formado por aquele casal.3 Questão 754 Observe o diagrama geral das possíveis trocas sangüíneas por doação e recepção no sistema "ABO": 1. 3. visto que a doença hemolítica do recém-nascido só ocorre quando a mãe é Rh− e o pai Rh®. casa-se com um homem Rh−. Para que os frascos contendo sangue fossem identificados. foram feitos testes com amostras correspondentes a cada código. A. e) 2. Rh® homozigota. sendo que o último apresentara a doença hemolítica do recém-nascido. Questão 753 Assinale a alternativa que esquematiza as transfusões que podem ser feitas entre indivíduos com diferentes grupos sanguíneos do sistema ABO (as setas indicam o sentido das transfusões). B e AB estão disponíveis. Para transfusões em indivíduos O. e) alta. d) nula. 5. e. as etiquetas que identificavam os tipos sangüíneos estavam em código.5.

Questão 760 O soro sangüíneo de um indivíduo do grupo O foi colocado em quatro tubos de ensaio. 7 litros de sangue tipo A. b) 8 litros. II. b) pode ser realizada sem problema. hemácias de indivíduos dos grupos sangüíneos AB. porque A é receptor universal. c) 12 litros. porque. Marque. e) apenas da bolsa 2. e) reação de anticorpos anti-B do doador com antígenos A do receptor. pois os anticorpos anti-B presentes no sangue do receptor podem reagir com os antígenos B presentes nas hemácias AB. No banco de sangue do hospital. b) apenas da bolsa 3. do total acima mencionado: a) 4 litros. verificou-se a presença de anticorpos anti-A e ausência de anti-B. e) 21 litros. d) da bolsa 1 ou da bolsa 2. I. Esse homem pode receber sangue: a) apenas da bolsa 1. Se houver A transfusão de sangue do tipo B para uma pessoa do grupo A. estarão disponíveis para ele. d) não deve ser realizada. Rh®. porque as hemácias AB não possuem antígenos que possam interagir com anticorpos anti-A presentes no sangue do receptor. o sangue da bolsa 2 possuía anticorpos anti-A e anti-B e a bolsa 3 possuía sangue com antígenos somente do tipo B. c) formação de anticorpos anti-A e anti-B pelo receptor. Questão 759 Um homem sofreu um acidente e precisou de transfusão sangüínea. a opção que corresponde à condição de aglutinação (+) ou não aglutinação (-) de hemácias resultante de reação antígeno-anticorpo: 170 . d) 13 litros. Questão 757 Um determinado banco de sangue possui 4 litros de sangue tipo AB. 1 litro de sangue tipo B e 9 litros de sangue tipo O. aos quais foram adicionadas. todos Rh®. c) da bolsa 2 ou da bolsa 3. Questão 758 aseados nesse teste. apesar de as hemácias AB apresentarem antígeno A e antígeno B. c) pode ser realizada sem problema. podemos afirmar que a) existem 105 litros de sangue disponíveis para um receptor AB Rh® b) existem 135 litros de sangue disponíveis para um receptor AB Rh− c) existem 105 litros de sangue disponíveis para um receptor A Rh® d) existem 135 litros de sangue disponíveis para um receptor O Rh® e) existem 25 litros de sangue disponíveis para um receptor O Rh− Questão 756 A transfusão de sangue tipo AB para uma pessoa com sangue tipo B a) pode ser realizada sem problema. na alternativa a seguir.5.3. Analisado o seu sangue. pois os anticorpos anti-A presentes no sangue do receptor podem reagir com os antígenos A presentes nas hemácias AB. o sangue do receptor não possui anticorpos contra eles. B e O. A. resultaria em a) reação de anticorpos anti-B do receptor com os glóbulos vermelhos do doador. e) não deve ser realizada. porque as hemácias AB não possuem antígenos que possam interagir com anticorpos anti-B presentes no sangue do receptor. b) reação dos antígenos B do receptor com os anticorpos anti-B do doador. d) nenhuma reação. III e IV. sendo que o sangue da bolsa 1 apresentava todos os tipos de antígenos do sistema ABO.3 necessidade de transfusões sanguíneas para um indivíduo com sangue tipo AB. separada e respectivamente.1. havia três bolsas disponíveis.

a) Tubo I (-). poderão doar sangue ao referido homem.3.4 om base no quadro. A partir dos resultados observados. Os resultados obtidos encontram-se no quadro seguinte. misturadas aos soros anti-A e anti-B. em cinco indivíduos. exames de sangue para a determinação da tipagem sangüínea dos Sistemas ABO e Rh. foram. b) Tubo I (-).5. como receptor e doador universal: a) 4 e 2 b) 4 e 3 c) 1 e 5 d) 2 e 4 e) 5 e 1 Questão 762 Em um hospital há um homem necessitando de uma transfusão de emergência. Tubo III (+) e Tubo IV (-). com a utilização de duas gotas de sangue de cada um deles.4 171 . o sinal . conclui-se que são classificados. Foram obtidas reações com a aplicação dos reagentes anti-A. Sabe-se que ele pertence ao grupo sangüíneo A e que. no hospital. Questão 761 Num laboratório foram realizados. Tubo II (-). Tubo II (+). anti-B. Os resultados são apresentados a seguir: Um laboratorista realizou exames de sangue em cinco indivíduos e analisou as reações obtidas com os reagentes anti-A. 1.5.4 bservação: o sinal + significa aglutinação de hemácias.3. Os resultados obtidos foram: 1. colocadas em uma lâmina. respectivamente. e) Tubo I (-).5. há quatro indivíduos que se ofereceram para doar sangue. Tubo III (-) e Tubo IV (+).3. Tubo II (-). d) Tubo I (+). Tubo III (-) e Tubo IV (+).significa ausência de aglutinação. para a determinação da tipagem sangüínea dos sistemas ABO e Rh. Tubo III (+) e Tubo IV (-). em seguida. que. anti-B e anti-Rh. c) Tubo I (+). Tubo III (-) e Tubo IV (+). Tubo II (+). os indivíduos: a) I e II b) I e III c) II e III d) II e IV e) III e IV Questão 763 1. anti-Rh. Foi realizada a determinação de grupos sangüíneos do sistema ABO dos quatro indivíduos. Tubo II (+).

b) 4 e 3. e) alelos múltiplos.Rh− b) O. Rh®/ A. Rh®/ A. Após analisar a tabela. Tiveram 9 filhos.4. respectivamente. indique quais os indivíduos que serão considerados. Os genótipos das plantas cruzadas são. Rh−/ B. Rh®/ AB.1 ituações como essa são conhecidas como: a) polialelia. Rh− d) AB. Rh®/ O. d) 2 e 5.Rh®/ O. e) 1 e 4. Questão 764 A tabela a seguir foi elaborada a partir de testes para determinação dos grupos sangüíneos de seis pessoas de uma academia de ginástica. 1. Rh−/ B. Rh−/ AB. d) DDee. Rh®/ O. todos de audição normal. Quando hereditária. Rh−/ B. mantendo a seqüência disposta na tabela. respectivamente: a) CCpp x ccPP b) CCpp x ccPp c) Ccpp x ccPP d) Ccpp x ccPp 172 1. e) DDEE. Rh−/ A. . Rh−/ B. simultaneamente. na proporção de 3 brancas: 1 colorida. Rh−/ O. Rh−/ A. depende da homozigose de apenas um dos dois genes recessivos. A audição normal depende da presença de pelo menos dois genes dominantes diferentes (D) e (E). b) DdEe. b) poligens. está ocorrendo a ação conjunta de dois gens. O sinal positivo (+) significa "aglutina" e o sinal negativo (-) significa "não aglutina".4 a) O. obtém-se em F plantas produtoras de flores coloridas. Um homem surdo. Rh−/ A. Questão 766 A surdez pode ser uma doença hereditária ou adquirida. c) Ddee. Rh−/ A. Assim. Rh−/ AB. a) 5 e 2. casou-se com uma surda. c) 3 e 4.3. Rh®/ AB.5. Rh®/ B. Cruzando-se duas plantas de flores brancas. Rh® Questão 765 O esquema a seguir evidencia que a formação de melanina não depende apenas da ação de um gen. Rh®/ B.Com base nesses resultados. podemos concluir que o genótipo dos filhos é: a) ddEE. d) interação gênica.Rh®/ A. Rh®/ A. A presença de ambos simultaneamente produz flor púrpura. (d) ou (e). receptor e doador universal. Rh−/ O.5. No processo ali representado. Questão 767 Na ervilha-de-cheiro existem dois pares de genes que condicionam a cor da flor (Cc e Pp). c) norma de reação. Rh® c) AB. A presença do gene C ou P ou ausência de ambos produz flor branca. Rh®/ B. Rh−/AB. assinale a alternativa que indica os grupos sangüíneos de todas as pessoas quanto aos sistemas ABO e Rh. Rh® e) AB.

c) um único gene ter efeito simultâneo sobre várias características do organismo.1 expressão desses genes pode ser impedida pela presença de um par de genes autossômicos recessivos. e) 3/64. b) 1/2. Cruzando-se plantas de flores vermelhas com plantas de flores brancas. d) dois pares de genes estarem no mesmo par de cromossomos homólogos. imitar uma característica genética. a pigmentação da pele seja devida a dois pares de genes autossômicos com efeito aditivo. c) 1/5. Nesse caso. a) AABB e AaBb b) AaBb e Aabb c) AABb e aabb d) aaBb e Aabb e) aabb e aabb Questão 771 1. na espécie humana. por isso. Neste esquema. como a surdez hereditária. d) 3/16. são muito sensíveis à luz solar. como surdez por infecção. e) dois cromossomos se unirem para formar um gameta. ocorrem flores vermelhas somente se a planta possuir os alelos dominantes A e B. Questão 770 Em determinada espécie vegetal.e) CcPp x CcPp Questão 768 Suponha que.4. Um casal de mulatos médios diíbridos tem uma criança albina. 1. Os genótipos das plantas com flores vermelhas e brancas da geração parental são. Questão 769 Em genética. EXCETO a) AABB b) AaBB c) Aabb d) AaBb e) AABb Questão 772 Os indivíduos albinos não possuem melanina . A tabela abaixo indica os fenótipos existentes.e. o fenômeno da interação gênica consiste no fato de: a) uma característica provocada pelo ambiente. A probabilidade de nascer uma criança branca não albina é de: a) 1/16. está representada parte da via biossintética para a produção desse pigmento: 173 .4.pigmento responsável pela cor e proteção da pele .1 odas as alternativas contêm genótipos possíveis para os porquinhos vermelhos de F2.5. respectivamente. b) vários pares de genes não alelos influenciarem na determinação de uma mesma característica. obtiveram-se 3 plantas de folhas vermelhas para 5 plantas de flores brancas na geração F.5. o indivíduo é albino. Observe a figura.

Os cães portadores de pelo menos um alelo dominante E serão pretos. O gene I impede a expressão do gene C. b) Ee Bb. d) ee BB. conclui-se que se trata de um caso de: a) epistasia recessiva. e) ee Bb. a cor da plumagem é determinada por 2 pares de genes. c) ee bb. b) casamentos entre indivíduos albinos podem gerar descendentes com melanina. com relação à surdez congênita na descendência de pais normais para a audição. O cruzamento de um macho dourado com uma fêmea marrom produziu descendentes pretos. Com esses dados. Questão 775 1. ( ) Cinco distintas classes genotípicas são observadas entre os descendentes surdos citados. c) pleiotropia. enquanto seu alelo i não interfere nessa expressão.4. ( ) A surdez congênita é determinada por alelos múltiplos em um loco autossômico. O gene C condiciona plumagem colorida enquanto seu alelo c determina plumagem branca.56.4. respectivamente. 174 . condicionam as três pelagens típicas da raça: preta. b) herança quantitativa. dois genes. cujos progenitores eram surdos. como ilustrado no quadro a seguir. Questão 774 Em cães labradores.1 om base nesse esquema e em outros conhecimentos sobre o assunto. ( ) A probabilidade do nascimento de uma criança normal para a audição. é de aproximadamente de 0. A pelagem dourada é condicionada pela presença do alelo recessivo e em homozigose no genótipo. d) indivíduos AABB formam gametas do tipo AA e BB.1 Em galinhas. Questão 773 Em uma exaustiva análise de genealogias humanas. é INCORRETO afirmar que a) a ausência da Enzima 1 resulta em um aumento da concentração de tirosina. ( ) Na determinação da característica analisada atuam locos gênicos ligados que distam entre si em 16 unidades de mapa.5. ( ) Interação gênica entre dois locos justificam esses dados. d) codominância. e) epistasia dominante. marrons e dourados. marrom e dourada.5. ou marrons. c) diferentes genótipos podem dar origem ao albinismo. cada um com dois alelos (B/b e E/e). O genótipo do macho é a) Ee BB. a partir de um casal genotipicamente igual ao mostrado na F1. se tiverem pelo menos um alelo dominante B. Considerando esses dados.1. se forem homozigóticos bb. analise as proposições com verdadeiro ou falso. foi observado que a distribuição fenotípica para normais e surdos obedecia a uma proporção de 9:7.

produzem quatro tipos de gametas para o caráter em estudo.Trata-se de um caso de interação gênica do tipo epistasia recessiva.5.5.Questão 776 Nos camundongos. d) A fecundação cruzada das plantas com flores brancas de F‚ produzirá sempre o mesmo fenótipo.5. 1. c) Os indivíduos de F. e) I.A formação de qualquer pigmento no pêlo depende da presença do alelo P. preta ou albina. 1. Pode-se considerar correto o que é afirmado em a) I. é correto afirmar. EXCETO: a) Trata-se de um caráter determinado por interação gênica.Quando animais pretos homozigóticos são cruzados com certos albinos também homozigóticos. b) Os duplos heterozigotos apresentam flores coloridas. A figura a seguir mostra as reações bioquímicas envolvidas na síntese de pigmentos.2 om base nos resultados. c) I e II.4. que se reproduz por autopolinização (em F).2 1. II e III. O caráter em estudo é a cor das flores. II .4. d) II e III.4. b) III. a cor da pelagem é determinada por um tipo de interação gênica epistática de acordo com o esquema a seguir. III . os descendentes são todos aguti. somente. somente. somente. a pelagem pode ser aguti. Questão 778 Em cães da raça Labrador Retriever.2 175 . om base na figura foram feitas as seguintes afirmações: I . somente. Questão 777 O esquema abaixo representa o cruzamento artificial (em P) de duas variedades puras de um determinado vegetal.

com segregação independente. a coloração da pelagem é determinada por dois pares de genes. Qual é o genótipo desse casal? a) aaCC x aacc b) Aacc x aaCc c) aaCc x AAcc d) AaCc x AaCc e) aaCC x AAcc Questão 780 Em cebolas. não-alelo. (16) Durante o desenvolvimento do organismo. Questão 782 Na cebola. Questão 779 Em camundongos. São afirmações CORRETAS: a) I. e) 16/16 de cebolas brancas. b) II. d) I. vários pares de genes não-alelos influem na determinação de uma característica. (04) Ocorre poligenia quando um gene tem efeito simultâneo sobre várias características do organismo. II. assinale o que for correto. Homozigotos bb não têm a manifestação da cor do bulbo impedida. Aa e Cc. a enzima que catalisa a formação de pigmento não é produzida (cebolas brancas). enquanto os pais são homozigotos para os dois pares de genes. que inibe a formação de pigmentos dando origem a indivíduos albinos. III e IV. III e IV apenas. impede a manifestação de outro gene. Outro gene. b) 12/16 de cebolas brancas e 4/16 de cebolas coloridas. apresenta o alelo B. O gene A determina coloração aguti e é dominante sobre seu alelo a. ao invés de determinar uma característica. (02) Dois genes não-alelos colaboram na mesma característica. que impede a manifestação de gene C. o alelo dominante A determina cor vermelha e o recessivo a. Do cruzamento de um camundongo preto com um albino. III. III e IV apenas. c) I. foram obtidos apenas descendentes agutis. cor amarela. d) 15/16 de cebolas brancas e 1/16 de cebolas coloridas. No cruzamento da fêmea parental com qualquer cão de pelagem preta. Quais as proporções fenotípicas esperadas do cruzamento de cebolas homozigotas coloridas com BBcc? a) 9/16 de cebolas brancas e 7/16 de cebolas coloridas. II e III apenas. espera-se que 50% dos descendentes apresentem pelagem amarela. complementando seus efeitos e produzindo um fenótipo igual aos fenótipos produzidos por cada gene isoladamente. Uma proporção de 2 incolores: 1 vermelho: 1 amarelo é esperada entre os descendentes do cruzamento a) IIAA x IiAa b) IiAA x iiAa c) IIaa x ii aa d) IiAa x IiAa e) IiAa x iiaa Questão 781 Sobre interação gênica. No cruzamento entre os filhotes de F1. 176 .Sabendo que o cruzamento (geração Parental) entre um macho com fenótipo chocolate e uma fêmea de fenótipo amarela gera apenas filhotes com pelagem preta (geração F1). completando seus efeitos. No cruzamento da fêmea amarela com um de seus filhotes de F1. II. herdado de forma independente. a presença de um alelo dominante C determina a produção de bulbo pigmentado. em cebolas cc. O gene C determina a produção de pigmentos e é dominante sobre seu alelo c. não se espera a produção de descendentes com fenótipo chocolate. (08) Ocorre epistasia quando um gene. (01) Ocorre poligenia quando dois genes não-alelos colaboram na mesma característica. que condiciona coloração preta. espera-se que 25% dos descendentes apresentem pelagem chocolate. dois pares de genes que apresentam segregação independente participam na determinação da cor do bulbo: o alelo dominante I impede a manifestação de cor e o recessivo i permite a expressão. um criador fez as seguintes afirmações: I. IV. Todos os filhotes produzidos nesse cruzamento são heterozigotos. c) 13/16 de cebolas brancas e 3/16 de cebolas coloridas.

Questão 785 Epistasia é o fenômeno em que um gene (chamado epistático) inibe a ação de outro que não é seu alelo (chamado hipostático). a determinação do sexo é feita por um sistema. (1) Na produção de melanina a partir de fenilalanina. (3) Um casal de indivíduos albinos pode ter filhos com pigmentação normal. o cariótipo de células somáticas de machos e fêmeas se apresenta como mostram os desenhos a seguir: 1. (4) O gene B é epistático sobre o gene C. enquanto o genótipo homozigoto bb define cor preta. O esquema abaixo representa alguns passos da síntese de melanina. e) aaBB. (2) Indivíduos albinos podem apresentar homozigose recessiva bb e cc.5.5. Em ratos. os filhotes de cor preta poderão apresentar genótipos: a) Aabbe AAbb. cujo 2n = 6. julgue os itens seguintes.Questão 783 A cor da pelagem em cavalos depende. d) AABBe Aabb. um segundo lócus afeta uma etapa inicial na formação dos pigmentos dos pêlos. AaBBe aabb. Considerando os descendentes do cruzamento de dois ratos. respectivamente: a) XY e XX b) YO e XX c) XO e XX d) XY e XO e) XO e XY 177 .4. O gene dominante W "inibe" a manifestação da cor. mas o genótipo aa bloqueia toda a produção de pigmentos e o rato torna-se albino. O gene B determina pêlos pretos e o seu alelo b determina pêlos marrons. c) AAbbe aabb. atuam três mRNAs.2 1. em que o macho e a fêmea são. o alelo dominante B determina cor de pêlo acinzentada. dentre outros fatores. enquanto que o alelo recessivo w permite a manifestação da cor. Essas transformações são catalisadas por diferentes enzimas. durante os processos metabólicos. fazendo com que o pêlo fique branco. Em outro cromossomo. O alelo dominante A nesse lócus possibilita o desenvolvimento normal da cor (como definido pelos genótipos B_ ou bb). análise desses cariótipos revela que. da ação de dois pares de genes Bb e Ww.1 Com base no esquema e sabendo que indivíduos incapazes de sintetizar a melanina são albinos. Cruzando-se indivíduos heterozigotos para os dois pares de genes obtém-se: a) 3 brancos: 1 preto b) 9 brancos: 3 pretos: 3 mesclados de marrom e preto: 1 branco c) 1 preto: 2 brancos: 1 marrom d) 12 brancos: 3 pretos: 1 marrom e) 3 pretos: 1 branco Questão 784 As diversas substâncias ingeridas pelo homem são transformadas em outras. nessa espécie. ambos com genótipo AaBb. b) Aabbe aabb. Questão 786 Em uma espécie animal.5.

Mulheres heterozigotas para os genes ligados aos cromossomos X expressam o alelo dominante em algumas células e o alelo recessivo em outras. d) um cromossomo X quando da divisão mitótica do zigoto. 178 . pois o gene está localizado no cromossomo Y. d) ausência de cromatina sexual. simultaneamente. e nos blastômeros iniciais do desenvolvimento embrionário." Assinale a alternativa que confirma o texto anterior. contudo um deles era menino e o outro menina.1 ntre as características que esse indivíduo passará a apresentar. têm visão normal em um dos olhos e daltonismo no outro. na gametogênese do pai ou da mãe das crianças. heterozigotas para os grupos sangüíneos. b) caracteres sexuais desenvolvidos.5. A inativação do cromossomo X ocorre ao acaso. X e Y. Assim. as células femininas ficariam iguais às masculinas. c) na mulher um cromossomo X está sempre condensado e recebe o nome de cromatina sexual. são tipo A e B simultaneamente. heterozigotas para o daltonismo (XD Xd). c) um cromossomo sexual. b) um cromossomo Y na gametogênese do pai das crianças. a hipótese de que fêmeas de mamíferos compensariam a dose dupla de genes do cromossomo X através da inativação de um desses cromossomos. e) Algumas mulheres. 1. pois em algumas estão ativos os genes provenientes do cromossomo X materno e em outras do cromossomo X paterno. Com base neste texto é INCORRETO afirmar: a) O sexo masculino é heterogamético e é sempre o homem quem determina o sexo dos filhos. O indivíduo do sexo feminino apresenta dois cromossomos X enquanto que o indivíduo de sexo masculino apresenta um cromossomo X e outro cromossomo Y. têm manchas brancas e pretas. "A pesquisadora inglesa Mary Lyon propôs. Tal fato deve-se à perda de a) um cromossomo X na gametogênese da mãe das crianças. c) Algumas mulheres. Questão 790 O esquema a seguir mostra a formação dos gametas responsáveis pela produção de um indivíduo com alteração do seu número cromossomial. heterozigotas para a cor dos olhos. e) estatura elevada. as mulheres apresentam células geneticamente diferentes entre si. b) Algumas mulheres. são loiras e castanhas. simultaneamente. teremos: a) sexo masculino. d) A hipertricose auricular é uma característica restrita ao sexo masculino. heterozigotas para a cor do cabelo. porém a menina era portadora da síndrome de Turner. X ou Y. que possuem apenas uma cópia funcional dos genes ligados ao cromossomo X.Questão 787 Na espécie humana a determinação sexual é feita por um par de cromossomos. Questão 789 O médico confirmou que se tratava de gêmeos monozigóticos. independentemente dos genes que possuem. e) um cromossomo Y quando da divisão mitótica do zigoto. d) Algumas mulheres. c) cariótipo normal. e) Toda doença hereditária e recessiva ligada ao cromossomo X só afeta as mulheres. Logo. têm um olho azul e outro castanho. em 1961. heterozigotas para a cor da pele. A análise cromossômica dos gêmeos indicou que o menino era normal.5. b) O sexo feminino é homogamético e o gameta feminino normal sempre apresenta um cromossomo X. Questão 788 Leia o texto a seguir referente à Hipótese de Lyon. a) Algumas mulheres.

F‚: galinha barrada II . F‚: galinha preta e) I .F: galinha preta. penas pretas.F: galinha barrada. II. quando incubados com 4 suspensões de espermatozóides. incluindo 2 cromossomos sexuais. d) Uma célula de carneiro que está na metáfase da mitose deve apresentar 54 cromossomos duplicados. Com base nesses dados. fizeram-se as seguintes afirmações: I. geraram 4 embriões.F: galinha barrada. b) Um linfócito de carneiro deve apresentar 54 cromossomos. machos de penas pretas × fêmeas de penas barradas Assinale a alternativa que indica corretamente as gerações nas quais espera-se encontrar galinhas pretas.F: galinha preta. Questão 793 Acerca da relação entre os cromossomos de um menino e os de seus avós. todos igualmente viáveis. assinale a alternativa INCORRETA com relação ao número de cromossomos encontrado em diversas células nessa espécie. está(ão) correta(s) APENAS a) I b) II c) III d) I e III e) II e III Questão 794 Em galinhas. F‚: galinha barrada II . F‚: galinha preta Questão 795 Em uma experiência de fecundação "in vitro". F‚: galinha barrada II . de acordo com a tabela abaixo.F: galinha preta.F: galinha barrada. F‚: galinha barrada b) I .1 179 . F‚: galinha preta II . III.F: galinha preta.F: galinha barrada.F: galinha barrada. F‚: galinha preta c) I .5. F‚: galinha preta d) I . c) Um óvulo de ovelha deve apresentar 26 autossomos. é possível dizer que o sistema de determinação do sexo nessa espécie é do tipo a) XX : XY b) XX : XO c) XX : YO d) ZZ : ZW e) ZZ : ZO Questão 792 O carneiro ('Ovis aries') apresenta 27 cromossomos em seus gametas normais.F: galinha barrada. Considere os seguintes cruzamentos a partir dos quais obtiveram-se as gerações F e F‚: I. Seu cromossomo X é descendente de um X de sua avó paterna. A partir desse dado. há descendentes de autossomos de seus avós. além de 2 cromossomos sexuais. F‚: galinha preta II . machos homozigóticos de penas barradas × fêmeas de penas pretas II. Seu cromossomo Y é descendente do Y de seu avô paterno.5. a) I . Dessas afirmações. Entre seus autossomos. 4 óvulos humanos. O alelo dominante determina penas barradas e o recessivo. a cor das penas apresenta herança ligada ao sexo. 1. e) Uma célula muscular de carneiro deve apresentar 54 autossomos.Questão 791 A análise do cariótipo de exemplares de uma dada espécie revelou que o número diplóide é idêntico em ambos os sexos e que o sexo heterogamético é o feminino. a) Um neurônio de carneiro deve apresentar 52 autossomos.

b) oócitos primários diplóides portando os cromossomos Y. igual a: a) 1. Dentre as opções abaixo. alguns se baseiam em executar a fecundação em tubo de ensaio. no período correspondente à prófase da mitose é. e) oogônias portando o cromossomo X e espermatogônias portando o cromossomo Y.5 × 10−ª c) 5. c) espermatozóides derivados de espermátides portando o cromossomo X. o ovo fertilizado no útero da mãe. e) um intersexuado. b) uma fêmea aneuplóide. A quantidade de DNA encontrada em uma célula somática de zangão. implantando. ( ) O genitor do sexo feminino determina o sexo dos descendentes. c) um macho normal. não observou a presença do cromossomo Y. podemos concluir que a mosca é a) uma fêmea normal.0 × 10−¢¨ Questão 797 As afirmações a seguir relacionam-se à DETERMINAÇÃO CROMOSSÔMICA DO SEXO na espécie humana. em mg.5. Dentre eles. encontrou a proporção de 1X : 2A (onde a letra A simboliza o conjunto haplóide de autossomos). caso os pais desejem um filho do sexo feminino. o gráfico que indica as probabilidades de os 4 embriões serem do sexo masculino é o de número: a) 1 b) 2 c) 3 d) 4 Questão 796 Considere que um óvulo de abelha possui 5×10−¢¥ g de DNA.5. embora as fêmeas se originem de reprodução sexuada. a seguir.0 × 10−¢¢ d) 5. Questão 798 Um estudante. são: a) espermatócitos secundários diplóides portando os cromossomos X e Y. Questão 799 Alguns métodos em desenvolvimento poderão permitir aos pais a escolha do sexo de seus futuros filhos. ( ) O indivíduo hermafrodita é formado por células XX e XY.0 × 10−¢¡ b) 2. ( ) A síndrome de Down é causada pela presença de um cromossomo X extra no cariótipo. os gametas que precisam ser necessariamente identificados e separados para uso no processo de fecundação.onsiderando a experiência descrita. ao analisar os cromossomos de 'Drosophila'. Nesse inseto. d) um macho estéril.1 180 . por partenogênese. d) óvulos haplóides portando o cromossomo Y. ( ) O corpúsculo de Barr ou cromatina sexual corresponde a um cromossomo X inativo. os machos originam-se de óvulos não-fecundados. Analisando os dados do estudante. ( ) O sexo heterogamético é o masculino. Questão 800 Observe a figura. 1. Além disso.

c) os indivíduos trissômicos 47. Considerando-se essas informações e outros conhecimentos sobre o assunto. na idade adulta. d) temperaturas maiores que 28°C produzem fêmeas tanto em tartarugas quanto em lagartos. em tartarugas. b) a determinação do sexo. a presença do cromossoma Y determina o fenótipo masculino.5. d) os testículos estão ausentes nos indivíduos 46. XXY possuem órgãos reprodutores masculinos e femininos. e) o sexo heterogamético nessa espécie de peixes é o masculino. d) o caráter mancha negra é exclusivo de indivíduos homozigotos.5. pode ser útil em condições de manejo de espécies em extinção. O gene SRY. e) machos são produzidos em baixas temperaturas tanto para tartarugas quanto para lagartos. XY que. XY com deleção do gene SRY. Com base nessa figura pode-se afirmar que Questão 802 A identificação do fator que origina indivíduos com síndrome de Down tornou-se possível pela utilização da técnica de a) contagem e identificação dos cromossomos. c) indivíduos de sexo indeterminado. b) os indivíduos trissômicos com cariótipo 47.5. são produzidos em temperaturas abaixo de 28°C. presente nesse cromossoma. XYY apresentam dois testículos a mais.ssa figura representa a herança do caráter mancha negra numa espécie de peixes em que a determinação do sexo segue o padrão mais comum nas aves. Questão 803 Nos mamíferos. c) as fêmeas de F‚ e P sem mancha negra possuem genótipos diferentes. sofrem mutação nesse gene perdem as características sexuais. c) mapeamento do genoma humano. 1.1 181 . é CORRETO afirmar que a) os indivíduos 46. ter descendentes machos sem mancha é de 50%. b) a probabilidade de uma fêmea com mancha. Questão 801 A figura a seguir se refere à determinação do sexo em algumas espécies de tartarugas e lagartos. induz à diferenciação dos testículos. 1. é correto afirmar-se que a) a probabilidade do casal em F ter um descendente macho e sem mancha negra é zero. Com relação ao padrão de herança desse caráter. b) cultura de células e tecidos.5. cruzada com macho sem mancha. d) produção de DNA recombinante.1 a) a determinação do sexo nesses animais é independente da localização dos ovos no ninho e da época da postura. sob controle de temperatura. Questão 804 A figura a seguir mostra esquematicamente o tipo de reprodução em abelhas do gênero 'Apis'.

Em uma linhagem desses insetos. e) I e III estão corretas. foi inseminada artificialmente com espermatozóides de machos de olhos escuros.1 I. Em humanos. (64) Com uma anomalia numérica de autossomos. As fêmeas resultam da fusão entre óvulos e espermatozóides. através da meiose.5. 182 .5.nalise as seguintes afirmativas sobre o esquema da figura. das quais uma seria a escolhida para ser a futura sucessora da rainha. (08) Com Síndrome de Patau. b) I e II estão corretas. e nasceram filhas operárias. d) apenas II está correta. Os zangões podem ser considerados clones perfeitos da abelha rainha. c) o sexo das abelhas é determinado pela ploidia do indivíduo. II.5. b) o sexo das abelhas é determinado pelos cromossomos sexuais. (02) Do sexo feminino. A rainha se casou com um belo zangão plebeu. é correto afirmar que se trata do cariótipo de um indivíduo: Questão 806 No reino Colméia. III. (04) Com Síndrome de Down. que representa um cariótipo humano. enquanto a cor escura é condicionada pelo alelo dominante A.5. a cor clara dos olhos é condicionada pelo alelo recessivo a de um determinado gene. c) II e III estão corretas. a determinação do sexo cromossômico do zigoto (XX ou XY) depende do gameta masculino que fecunda o óvulo. gametas com um número de cromossomos 4 (quatro) vezes menor. Espera-se que a prole dessa rainha tenha a seguinte composição: 1. (16) Ccom Síndrome de Edwards. d) a rainha e as operárias são dióicas. Essa história mostra que a) os zangões são haplóides e produzem os espermatozóides por meiose. A produção de zangões caracteriza o processo de reprodução assexuada denominado partenogênese. heterozigótica Aa. Questão 805 Analisando a figura adiante. Questão 807 Os machos de abelha originam-se de óvulos não fecundados e são haplóides.1 (01) Do sexo masculino. uma vez que não houve a fecundação dos óvulos que os originaram. e são diplóides. Uma abelha rainha de olhos escuros. (32) Com cariótipo normal. havia uma rainha que tinha tido apenas filhos do sexo masculino (zangões) e precisava de uma sucessora para o trono. Soma ( ) Questão 808 Considere as afirmações: 1. Da análise das afirmativas acima podemos assegurar que: a) apenas I está correta. e os zangões são monóicos. As operárias são estéreis devido à espermatogênese nos zangões produzir. I.

1 Adaptado de: AMABIS. em um mesmo indivíduo. Qual dos pares de gametas representados a seguir poderá originar um zigoto que desenvolverá um embrião normal do sexo masculino? 1. I. J. Em mamíferos. nas células somáticas de fêmeas normais. Toda a informação genética necessária para formar um organismo completo está contida em seqüências de timinas. Esse teste permite o diagnóstico citológico do sexo feminino. Em mamíferos. 2001.M e MARTHO. III. pode-se afirmar que: a) I e III estão corretos. e) III. de uma célula a outra. todas as moléculas de RNA. a meiose é gamética. sendo que um deles é a cromatina 183 . Está(ão) correta(s) a) apenas I. d) apenas I e II. A informação genética pode ser passada de uma geração para outra. Em uma célula eucariótica animal. sendo que dois deles formam a cromatina sexual. Questão 810 Durante as Olimpíadas é comum fazer-se teste da cromatina sexual ou corpúsculo de Barr nas mulheres. não pode ser passada. sexual. d) Apenas I está correto. II e III). c) apenas III. II e IV. as fêmeas possuem apenas um cromossomo X e os machos. Estão corretas: a) I. adeninas. III e V. sendo que um deles é a cromatina sexual. pois este corresponde ao corpúsculo de Barr ou cromatina sexual. c) II e III estão corretos. porém. IV e V.5. têm sua origem no núcleo. b) Três cromossomos Y. e) apenas I e III. "Conceitos de Biologia". citosinas e guaninas arranjadas em diferentes combinações. III e IV. II e III. sendo exceção a essa regra os cromossomos sexuais X e Y. dois. com exceção do RNA mitocondrial. e) Um cromossomo X apenas. os quais contêm conceitos relacionados aos diferentes sistemas de determinação do sexo. c) II. e a fecundação reconstitui a diploidia. b) apenas II. II. é possível observar o cromossomo X que foi inativado. d) II. São Paulo: Moderna. cromossomos homólogos contêm a mesma seqüência linear de genes. o RNA mensageiro que saiu do núcleo continha 1500 códons e a seqüência que serviu de molde para a transcrição possuía 3000 nucleotídeos. Uma mulher normal apresentará em suas células bucais: a) Dois cromossomos X. V. d) Três cromossomos X. Questão 811 Considere as cinco afirmações seguintes. III. b) I e II estão corretos. c) Dois cromossomos X e blocos de cromatina sexual. Questão 809 O diagrama a seguir está dividido em 3 segmentos (I. de pais para filhos. Com relação a esses segmentos. G.II.5. b) I. IV. Numa proteína com 500 aminoácidos.R. Questão 812 A reprodução da maioria dos seres vivos envolve um processo sexual onde se alternam os fenômenos de meiose e fecundação. No homem. Em mamíferos.

5.Questão 815 1.5.5. e) a análise radiográfica da bacia.2 Questão 813 Em eventos esportivos internacionais como os Jogos Pan-americanos ou as Olimpíadas.características como o daltonismo. d) O genótipo de 6 será XHXH ou XHXh.5. cujo desempenho ou mesmo a aparência sugerem fraude.quando pareados. são exemplos de cromossomos homólogos. Estão corretas as seguintes afirmações: a) apenas I b) apenas II c) apenas III d) apenas II e III e) todas. por exemplo. EXCETO uma. estão associadas a genes do cromossomo Y. e) O indivíduo 5 com certeza é hemofílico. há suspeitas sobre o sexo de certas atletas. Feita a análise desse gráfico. III . Questão 816 Observe o esquema a seguir: 1.5.características como a hemofilia. II . a) O casal 1/2 nunca formará mulheres hemofílicas. Para esclarecer tais suspeitas utiliza-se a) a identificação da cromatina sexual. Questão 814 Em relação aos cromossomos sexuais X e Y. d) o casal apresenta 50% de probabilidade de ter filhas afetadas. podemos afirmar corretamente que: a) a anomalia é causada por um gene dominante. são feitas as seguintes afirmações: I . b) a contagem de hemácias cuja quantidade é maior nos homens. 184 . b) o indivíduo I é obrigatoriamente homozigoto. c) o cromossoma Y paterno pode apresentar o gene para a doença. d) a pesquisa de hormônios sexuais femininos através de um exame de sangue. Indique-a. c) O genótipo de 4 será XHY. No gráfico anterior temos representado um exemplo de doença ligada ao sexo onde apenas o indivíduo IV é afetado.1 1. fazem parte do cromossomo X. por exemplo. b) O casal 5/6 formará homens hemofílicos. ocasionalmente.2 análise do esquema permite formular as conclusões a seguir. c) o exame radiológico dos órgãos sexuais. e) os indivíduos III e V podem ser homozigotos ou heterozigotos.5.

2 Questão 820 A hemofilia é uma doença genética cuja herança é ligada ao sexo.5. isto é. O heredograma a seguir refere-se a uma família com esta anomalia. IV .Não é possível identificar o genótipo de 2.5. II . ligado ao cromossomo X.100% dos filhos homens do casal 3 e 4 serão daltônicos. 185 .50% das filhas do casal 3 e 4 serão normais portadoras e 50% daltônicas. 1955) Quando nos debruçamos sobre a hemofilia. b) sendo uma herança ligada ao sexo. a doença se manifesta em meninos que não tem história familiar de hemofilia. e) é causada por um alelo típico do cromossoma Y.5. I . III . é suficiente nos homens apenas um alelo para que a doença se manifeste.I. BLOOD AND PRACTICE OF HEMATOLOGY. Analise o heredograma adiante e assinale a alternativa correta. d) Apenas as afirmações II e III são verdadeiras. sabendo-se que a mulher B é homozigota é de a) 1/8 b) 3/8 c) 1/2 d) 1/4 e) 3/4 1.100% das filhas do casal 3 e 4 serão normais portadoras. De acordo com o heredograma. analise as afirmações de I a IV e assinale a alternativa correta. b) Apenas as afirmações I e II são verdadeiras. e) Apenas as afirmações II e IV são verdadeiras." (Handin R. Questão 818 O daltonismo é uma anomalia que apresenta um tipo de herança ligada ao sexo. aprendemos que ela é mais comum nos homens porque: a) os homens são mais propensos à doença devido à influência do hormônio testosterona. d) mulheres hemofílicas morrem nos primeiros sangramentos menstruais. c) Apenas as afirmações I. c) mulheres hemofílicas precisam de dois alelos dominantes. ao passo que os homens só necessitam de um alelo. que é masculinizante.Questão 817 "Tem sido verificado que aproximadamente 25% dos casos de hemofilia A em meninos são decorrentes de mutações novas. a) Todas as afirmações são verdadeiras. A probabilidade de A ser portador da anomalia..5.2 1. III e IV são verdadeiras. Questão 819 A distrofia muscular de Duchenne é devida a um gene recessivo.

Questão 821 O daltonismo é causado por um gene recessivo localizado no cromossomo X na região não-homóloga ao cromossomo Y. e) O indivíduo 14 pode ser homo ou heterozigoto. da qual herdaram os genes para daltonismo e hemofilia. certamente a mãe tinha fenótipo normal. decidiu um tribunal japonês. do qual herdaram os genes para daltonismo e hemofilia.5% e) 100% Questão 824 Meio-irmãos é o termo utilizado para designar os indivíduos que são irmãos só por parte de pai ou só por parte de mãe. 3 e 7 são portadores do gene para o daltonismo.Questão 822 Na espécie humana. Questão 825 VÍTIMAS DE HIROSHIMA NO BRASIL SERÃO INDENIZADAS. João e Pedro são meio-irmãos e ambos são daltônicos e hemofílicos. certamente.2 1.5.7 mil.5. d) as filhas do casal 6 e 7 são. ("Folha de S.2 correto afirmar que a) a mulher 6 é homozigota.2006) 186 1. b) O indivíduo 8 é portador do gene para hemofilia. d) filhos da mesma mãe. c) O indivíduo 9 não pode ser hemofílico. os indivíduos representados com símbolos escuros são daltônicos e os demais têm visão normal para as cores. Pode-se dizer que. porém herdaram de suas respectivas mães os genes para daltonismo e hemofilia. d) Todos os filhos e filhas do indivíduo 10 serão hemofílicos. ocorridas independentemente da herança materna ou paterna. Os três homens. mais provavelmente.5.Paulo". que pediram para não ser identificados. A probabilidade deste casal vir a ter uma filha hemofílica é igual a: a) zero b) 50% c) 25% d) 12. Na genealogia abaixo. vão receber US$ 24. porém herdaram de seus respectivos pais os genes para daltonismo e hemofilia. . certamente. Seus genitores são normais. Um homem hemofílico casa-se com uma mulher normal e homozigota para este caráter. c) filhos do mesmo pai.5. o genótipo para hemofilia XHY fenotipicamente representa: a) homem normal b) homem hemofílico c) mulher normal d) mulher hemofílica e) homem normal. 09. c) os homens 1.02. João e Pedro sejam a) filhos do mesmo pai. portadoras do gene para o daltonismo. heterozigotas. b) filhos da mesma mãe. porém portador Questão 823 a) Os indivíduos 1 e 2 são homozigotos normais. b) as mulheres 2 e 4 são. e) se o pai de 2 era afetado pelo daltonismo. e) portadores de novas mutações.

Emília havia lido que a doença é genética. Observe a árvore genealógica: 187 . porque todas as filhas de homens afetados são afetadas. Após a guerra. uma vez que é determinada por um alelo no cromossomo Y. e deste à se filho. Shiguero foi submetido. filha de Vitória. se seu filho Mário tivesse herdado o alelo do pai. Sr. acreditava que seu único filho. foi um dos sobreviventes da bomba de Hiroshima. A princesa Beatriz. introduziu o gene na família real espanhola.2 padrão de herança que melhor explica o heredograma é a) autossômico dominante. Takashi. Como a hemofilia é um caráter recessivo e só se manifesta nos homozigotos para esse alelo. também poderia ter provocado mutações nas células de seu tecido reprodutivo que. e) recessivo ligado ao sexo. A hemofilia é uma doença que prejudica a coagulação do sangue. b) autossômico dominante. É mais provável que a hemofilia de Mário seja determinada por um alelo herdado por via materna. d) 16 %. Emília passou a acreditar que seu filho talvez pudesse se beneficiar com alguma indenização.5 %.ligado ao X . porque aproximadamente 50% da prole é afetada. Do mesmo modo como a radiação provocou a leucemia do Sr. casou-se com Takashi e atribuía a doença de seu filho Mário à herança genética do avô Shiguero. Questão 828 Acredita-se que a rainha Vitória da Inglaterra tenha sido a introdutora do gene para hemofilia .5. o Sr. a mais grave delas. a doença de seu filho Mário é causada pela presença de um alelo herdado pela via paterna e por outro herdado pela via materna. que não tem ascendência oriental. Questão 826 Na genealogia a seguir. por sua vez. Questão 827 O daltonismo é causado por um alelo recessivo de um gene localizado no cromossomo X. onde se casou e teve um filho. Deste modo. porque a doença aparece em todas as gerações. b) 4. pode-se dizer que Emília está a) correta. Emília.na família real inglesa. O sogro de Emília. Depois da notícia do jornal. o herdou do Sr. e) errada. Como a hemofilia é um caráter dominante. c) 9 %. todos seriam hemofílicos. Mário. Mário só pode ter herdado esse alelo de seu pai. Shiguero. Qual é a porcentagem esperada de mulheres daltônicas nessa população? a) 0. d) dominante ligado ao sexo. Shiguero. Afinal. transmitidas à Takashi. Em uma amostra representativa da população. 1. ligada ao sexo. migrou para o Brasil. b) correta. A hemofilia ocorre mais freqüentemente em homens. 90 são daltônicos. d) errada. Shiguero. Shiguero. era uma vítima indireta da radiação liberada pela bomba. que o teria herdado do Sr.81 %. c) autossômico dominante. porque não há transmissão de homem para homem. porque a doença afeta os dois sexos. c) apenas parcialmente correta. portador de hemofilia do tipo A. ou que Mário seja portador de uma nova mutação sem qualquer relação com a radiação a que o Sr. entre 1000 homens analisados. Shiguero faleceu de leucemia. e) 83 %.Emília interessou-se pela notícia. Sobre suas convicções quanto à origem da doença de Mário. e muito mais freqüente em homens que em mulheres. Anos depois. provocaram a hemofilia de Mário. os símbolos cheios representam pessoas afetadas por uma doença genética rara. que.5.

c) O pai dessa mulher é daltônico. d) o genótipo dessa mulher é igual ao de sua mãe.2 probabilidade da princesa Maria vir a ter um menino hemofílico é de: a) 100% b) 75% c) 50% d) 25% e) 0% Questão 829 O estudo de linhagens de galinhas em que aparecia uma anomalia hereditária mostrou que fêmeas afetadas cruzadas com machos normais davam sempre todos os descendentes machos com a anomalia e as fêmeas normais. A anomalia. Questão 833 O gene que determina o daltonismo na espécie humana caracteriza o seguinte tipo de herança a) autossômico dominante. É correto afirmar. d) recessivo ligado ao cromossomo Z. provavelmente. e) interação gênica..5. c) autossômico recessivo. e) dominante ligado ao cromossomo Z. casa-se com um homem daltônico e tem uma criança do sexo masculino e daltônica. b) essa mulher poderia ter uma irmã daltônica. e) essa mulher não poderá ter uma filha daltônica. b) A mãe dessa mulher terá obrigatoriamente o mesmo genótipo para o daltonismo que ela. e) Os filhos homens desse casal serão sempre daltônicos e não polidáctilos. daltônica e canhota possui pai daltônico e destro e mãe de visão normal e canhota. que: a) o pai é normal. assinale a alternativa correta. Questão 830 Um homem de visão normal e com número normal de dedos casa-se com uma mulher polidáctila e daltônica. c) o filho dessa mulher herdou do seu pai o gene para o daltonismo. Sabendo-se que a polidactilia é uma herança autossômica dominante.. b) o pai é normal e a mãe é hemofílica. a) Esse casal poderá ter uma filha polidáctila e daltônica. e) se ela tiver um irmão. este será hemofílico também. É correto afirmar que: a) essa mulher é daltônica. b) autossômico recessivo. Sabendo que o uso da mão esquerda é uma característica recessiva. com certeza. d) ela recebeu da mãe o gene para a hemofilia. c) o pai e a mãe são hemofílicos. filha de pai normal e mãe portadora do gene para o daltonismo. d) recessivo ligado ao sexo.Questão 831 Uma mulher.5. d) A mulher é obrigatoriamente filha de pai e mãe polidáctilos. é determinada por gene a) autossômico dominante. 188 . Questão 834 Uma criança do sexo feminino. então a probabilidade do segundo filho ser do sexo masculino e com fenótipos dominantes é: a) 1/2 b) 1/4 c) 1/6 d) 1/8 e) 1 1. b) dominante ligado ao sexo. Questão 832 Um casal tem uma criança de sexo masculino e hemofílica. c) recessivo ligado ao cromossomo X.

As mulheres heterozigotas têm fenótipo normal. III e IV apenas. enquanto as mulheres apresentam três genótipos possíveis.XdY. O primeiro filho desse casal nasceu hemofílico e surdo-mudo. nasceu uma menina normal.As filhas de pai normal serão sempre normais. Avô . Avó .Se a mãe for afetada. II. a probabilidade desse casal ter uma criança do sexo feminino normal para ambas as características é de: a) 3/8 b) 1/8 c) 1/2 d) 3/4 e) zero Questão 838 A respeito das heranças recessivas ligadas ao sexo (genes situados no cromossomo X). IV .seu pai é hemofílico. Avô . considere as seguintes afirmações. Assinale a alternativa correta quanto aos genótipos do homem e de seus avós maternos. Avó . Avó . I . II . é possível considerar que APENAS a) I é verdadeira.XDXd.sua avó paterna NÃO apresenta o gene para a hemofilia. enquanto a cor branca é devida ao gene W. a) Homem . d) I e II são verdadeiras. c) III é verdadeira.Os homens só apresentam dois genótipos possíveis. Considerando que nesses indivíduos o sexo heterogamético é o masculino. Questão 840 Um homem tem avó materna e pai com visão normal. d) II e IV apenas. e excluindo-se a possibilidade de mutação.sua mãe possui um gene para a hemofilia. A probabilidade do nascimento de um menino também normal é: a) 50% b) 75% c) 25% d) 100% e) 0 Questão 836 Em 'Drosophila'.XdY.XDY. Sabendo-se que o gene em questão é recessivo e ligado ao sexo.XdY b) Homem . Considerando a surdo-mudez como uma característica autossômica recessiva.XDY e) Homem .XdY 189 . todos os seus filhos do sexo masculino também serão afetados. e) III e IV apenas. III.Questão 835 O raquitismo resistente à vitamina D é uma doença provocada por um gene dominante ligado ao X.XDXd. a porcentagem de indivíduos de olhos brancos em F será de: a) zero b) 100 % c) 25 % d) 75 % e) 50 % Questão 837 Um homem de audição normal e não hemofílico casa-se com uma mulher com o mesmo fenótipo.XdXd. São corretas: a) I. Do casamento entre uma mulher afetada e um homem normal.XdY. Avó .XDXd. e) I e III são verdadeiras. a cor dos olhos é determinada por um gene localizado no cromossomo X sem o correspondente alelo no cromossomo Y.XDXd. Avó . III . Avô . e avô materno e mãe com daltonismo. Um macho de olhos brancos foi cruzado com uma fêmea heterozigota. Avô .XDY.XdY c) Homem .XDY d) Homem . Avô . Questão 839 Considere as seguintes afirmações sobre uma mulher hemofílica: I. b) I e III apenas. c) I. III e IV. A cor vermelha é determinada pelo gene W+. II. b) II é verdadeira.

e) apenas daltônico. d) de mulheres daltônicas sempre portam alelo para daltonismo. c) daltônico ou hemofílico. XXY). a probabilidade de apresentar hemofilia é: a) 1 b) 1/2 c) 1/4 d) 1/8 e) 1/16 Questão 846 O esquema a seguir representa a ontogênese de João. que tratam de um caso e hemofilia: 1. Essa doença hereditária. embora seus pais não apresentem alterações cromossômicas numéricas em suas células 190 .2 e uma das irmãs desse indivíduo casar-se com um homem sadio.5. b) daltônico e hemofílico. quanto à hemofilia e ao daltonismo. e) de homens daltônicos sempre portam alelo para daltonismo. A probabilidade de terem um filho homem e normal é de: a) 0 b) 1/4 c) 1/3 d) 1/2 e) 1 Questão 845 Observe os heredogramas a seguir. Questão 844 1. Admitindo-se que o gameta anormal tenha sido produzido pela mulher. Questão 843 O cientista John Dalton é bastante conhecido por suas contribuições para a Química e Física.Questão 841 O heredograma a seguir representa uma família em que um dos filhos é afetado por doença determinada por um alelo recessivo localizado no cromossomo X. que nasceu com SÍNDROME DE KLINEFELTER e DALTONISMO.5.2 abendo que o indivíduo 7 é do sexo feminino. Um homem normal casou-se com uma mulher daltônica.5. c) e as filhas de homens daltônicos são sempre heterozigotos. espera-se que esse filho do casal seja a) normal. É correto afirmar que os filhos a) e as filhas de homens daltônicos são sempre daltônicos. d) apenas hemofílico. O daltonismo é condicionado por um gene recessivo ligado ao sexo. b) e as filhas de mulheres daltônicas são sempre daltônicos. causada por um alelo recessivo ligado ao cromossomo X. recebeu o nome de daltonismo. Dalton descreveu uma doença hereditária que o impossibilitava de distinguir a cor verde da vermelha. Além disso. a probabilidade desse casal ter um menino afetado é a) 3/4 b) 1/2 c) 1/4 d) 1/8 e) 1/16 Questão 842 Um homem hemofílico e uma mulher daltônica tiveram um filho com síndrome de Klinefelter (47.5.

torna os indivíduos afetados incapazes de se reproduzir. EXCETO: a) Os dois caracteres DMD e AME acima são recessivos. 1. é correto afirmar. Um exemplo disso é a inativação completa de um dos dois cromossomos X em fêmeas de mamíferos. enquanto a outra parte. ele obrigatoriamente contribuiu com o gameta responsável pela síndrome do filho. d) Os dois caracteres DMD e AME não podem estar localizados no mesmo par de homólogos. mas pode não ser ela quem contribuiu com o gameta responsável pela síndrome do filho.2 a filha receba dela os alelos dominantes para daltonismo e hemofilia no mesmo cromossomo.5. assinale a alternativa que traz uma explicação possível para o fato apresentado. 1. que se caracteriza pela falta de um dos fatores de coagulação sangüínea. O DNA ativo no nível de transcrição. ao microscópio. EXCETO: a) Se o pai de João é daltônico. situação que. o cromossomo X de origem materna condensado.5. Questão 847 Em geral.5. conhecido como eucromatina. c) A AME pode ser um caráter ligado ao sexo. c) Algumas células somáticas de cada filha apresentam o cromossomo X de origem paterna condensado. é menos condensado para permitir acesso da maquinaria de transcrição. b) O "crossing-over" na gametogênese da mãe garante que Os dois heredogramas a seguir foram montados para duas famílias que apresentavam distúrbios musculares geneticamente determinados. d) Se a mãe de João é daltônica. O caráter Distrofia Muscular de Duchenne (DMD) é uma herança ligada ao sexo. d) A não-expressão dos alelos dominantes recebidos garante que a filha seja normal para os dois caracteres.somáticas. b) Não podem ser gerados descendentes do sexo feminino afetados por DMD. o DNA não-expresso é altamente condensado na forma de heterocromatina. b) Se foi o pai de João quem contribuiu com o gameta contendo um cromossomo a mais. pelo menos um dos avós de João também é daltônico. Questão 849 A hemofilia é um distúrbio genético humano. A Atrofia Muscular Espinhal (AME) não impede a reprodução e pode ser transmitida pelo pai. Sabendo que filhas de pai apenas hemofílico e mãe apenas daltônica e homozigota para hemofilia são normais para os dois caracteres. Questão 848 abendo que o daltonismo é uma herança recessiva ligada ao sexo. c) A mãe de João pode ser daltônica. sendo somente transmitido pelas mães. Na espécie humana. O heredograma a seguir indica. é correto afirmar. o que permite expressar os dois alelos dominantes. a hemofilia e o daltonismo são características recessivas ligadas ao sexo. é vista como uma mancha escura chamada corpúsculo de Barr.5. a) A permutação na espermatogênese permitiu que o pai tenha dado para a filha gameta contendo o alelo dominante para hemofilia. esse pai é obrigatoriamente daltônico. O gene que codifica para a produção desse fator está localizado no cromossomo X em uma região que não apresenta homologia em Y. 191 .2 nalisando as informações e os heredogramas acima de acordo com seus conhecimentos.

os galos listrados de F são heterozigotos quanto aos alelos que determinam esse caráter. c) Se o gêmeo afetado for o do sexo masculino. enquanto os galos O caráter descrito é uma herança ligada ao sexo. é correto afirmar. b) Os dois gêmeos podem ter recebido o gene recessivo que determina o daltonismo. é correto afirmar. c) Na família C.2 1.na segunda e terceira gerações. B e C) que apresentam. pelo menos dois indivíduos apresentam o gene causador de hemofilia. Manuel certamente é normal. receberam o alelo dominante de seu progenitor do sexo feminino. Questão 852 A Displasia Ectodérmica Anidrótica (DEA) apresenta prevalência na população de 1:100. b) Não existem indivíduos portadores do gene da hemofilia na família B. EXCETO: a) Os galos com padrão de plumagem listrada representados. 1. Maria.5. em comum. pelo menos um indivíduo apresenta o gene causador de hemofilia. um progenitor afetado por essa anomalia. d) O caráter plumagem lisa é recessivo em relação ao caráter plumagem listrada. Questão 850 Um homem e uma mulher com visão normal tiveram uma filha. é INCORRETO afirmar: a) O pai de Maria não é portador. Questão 851 Em Galináceos a determinação do sexo (sistema ZW) segue um padrão inverso ao que se observa em mamíferos (sistema XY). d) A chance de o casal II-5 × II-6 ter uma criança afetada por esse caráter é de 1/4. c) O padrão da plumagem das galinhas depende dos alelos que recebem do seu progenitor do sexo masculino. constituem o sexo homogamético (macho ZZ). 192 . Sabendo-se que o daltonismo é uma característica determinada por gene recessivo ligado ao sexo. três famílias (A. O fenótipo mais marcante dessa síndrome é a ausência de glândulas sudoríparas na pele.000 nascimentos. Dessa forma as galinhas constituem o sexo heterogamético (feminino ZW).5. sendo um deles daltônico e outro normal. Manuel é certamente daltônico. d) Se o gêmeo afetado por daltonismo for do sexo feminino. sendo uma síndrome hereditária recessiva ligada ao cromossomo X. também com visão normal para daltonismo.5. Os experimentos a seguir foram desenvolvidos para se estudar a herança do caráter padrão da plumagem de galináceos da raça Langshan Black (fenótipo Lisa) cruzados com galináceos da raça Plymouth Rock (fenótipo Listrada).2 Analisando-se o heredograma. De acordo com as informações apresentadas. Do casamento de Maria com Manuel nasceu um casal de gêmeos. EXCETO: a) Na família A.5. mas Maria é portadora do gene que causa daltonismo. b) Nos dois experimentos.

e) Michele e Robson podem ser filhos de mãe daltônica e Aline a tia materna. e) Nenhuma. poderíamos estabelecer os seguintes graus de parentesco. portanto. heterozigotas e. d) Um macho com o alelo recessivo pode passá-lo para suas filhas e filhos. Maria. b) I.2 A figura apresenta duas gêmeas univitelínicas. as pessoas citadas apresentam o seguinte genótipo: Robson Michele Aline (Xd) Y (XD) (Xd) (XD) (XD) 1. mesmo que o pai seja daltônico. O genoma humano é de 46 cromossomos. Baseados nos mecanismos genéticos. d) Robson pode ser pai de Aline e de Michele. Nicolau II. II. que sofria de hemofilia. Anastasia) e seu filho Alexis. c) Metade dos descendentes machos das gêmeas deverão apresentar a síndrome. O daltonismo é transmitido por herança genética. b) As gêmeas podem ter herdado o alelo recessivo tanto de seu pai quando de sua mãe. Um irmão da czarina Alexandra também era afetado por essa doença.5. Michele e Aline podem ser irmãos. Com base nas informações dadas e em seus conhecimentos. III. A probabilidade de que Olga. Para o caráter daltonismo. Questão 853 Analise as afirmações: I. Tatiana. fosse portadora do alelo para hemofilia é de a) 1/4 b) 1/64 c) 1/2 d) 1/8 e) 1/32 193 . que apresentarão o fenótipo da síndrome. d) Somente I e III. c) Michele pode ser mãe de Robson e de Aline.Questão 854 Robson. as manchas que aparecem nessas mulheres são produzidas por um corante especial capaz de revelar áreas com poucas ou nenhuma glândula sudorípara. a) Robson pode ser filho de Aline. sua esposa Alexandra.5. c) Somente II e III. é INCORRETO afirmar: a) As manchas na pele das gêmeas representadas podem ser o resultado da ocorrência de heterocromatina para o cromossomo que carrega o alelo dominante. b) Robson. II e III. suas quatro filhas (Olga. Questão 855 1. No entanto. Michele e Aline são membros de uma mesma família. Está correta ou estão corretas: a) Somente I e II. não apresentam a síndrome. A hemofilia é uma herança genética ligada aos cromossomas sexuais.5.5. filha do casal.2 fotografia mostra o último czar da Rússia.

Se um homem daltônico casa-se com uma mulher normal. c) poderá ter apenas descendentes do sexo masculino com a doença. heterozigoto para essa característica. e) terá todos os seus descendentes com a doença. pode-se dizer que ele a) é homozigoto recessivo para esse gene. c) recebeu o gene de sua mãe.2 a) não terá chance de apresentar descendentes com a doença.5. e a cor cinza pelo alelo dominante. não portadora do gene para o daltonismo. podemos afirmar: a) somente o indivíduo 2 é daltônico b) o genótipo do indivíduo 4 é XdY c) o indivíduo 1 é normal. as pessoas indicadas pelos números 3 e 6 apresentam uma doença rara determinada por um gene dominante localizado no cromossomo X.5. Na tira de quadrinhos.2 elativamente aos indivíduos anteriores.5 % d) 0 % Questão 859 Observe a árvore genealógica a seguir. Questão 858 O daltonismo é uma doença hereditária e ligada ao sexo na espécie humana. o homem de etnia amarela apresenta uma característica determinada por um gene recessivo ligado ao sexo.Questão 856 1. porém portador do gene para o daltonismo d) os indivíduos 4 e 5 são daltônicos Questão 860 Em drosófilas. b) poderá ter apenas descendentes do sexo feminino com a doença. Questão 857 Na genealogia a seguir. Assinale a descendência 194 . uma vez que o loco gênico está no cromossomo Y. heterozigota para essa característica. Descendendo de pais com visão normal.5. O casal indicado pelos números 5 e 6 1.5. referente a uma família com herança para daltonismo (herança ligada ao sexo e deve-se a um gene recessivo).5. d) recebeu o gene de seu pai. d) poderá ter metade de seus descendentes com a doença. b) é heterozigoto para essa característica.2 1. a cor amarela do corpo é determinada por um gene recessivo localizado no cromossomo X. a probabilidade desse casal ter um filho homem e daltônico é: a) 25 % b) 8 % c) 12. e) recebeu o gene de seu pai.5.

porém portadora de gene recessivo d. em virtude da não-coagulação do sangue. 1. b) tanto os filhos quanto as filhas sejam sempre afetados. é possível concluir que a anomalia é devida provavelmente a um alelo a) localizado no cromossomo Y.fêmeas: 50% cinzentas e 50% amarelas. situado num autossomo. e) Homem normal e mulher normal. localizado no cromossomo X. d) apenas as filhas sejam afetadas. (16) Se transmite de pai para filho. é determinada pelo gene recessivo d. Questão 863 Em seres humanos.5.fêmeas: 50% cinzentas e 50% amarelas. (01) É restrita ao sexo. uma forma de daltonismo que provoca cegueira para as cores vermelho e verde. assinale o que for correto. e) apenas os filhos sejam afetados. um casal fica sabendo que todos os seus filhos do sexo masculino serão daltônicos. (04) As mulheres hemofílicas geralmente morrem na menarca. Na prole de um homem afetado casado com uma mulher normal. localizado no cromossomo X.fêmeas: 100% cinzentas.fêmeas: 100% cinzentas. ou seja. (08) O mecanismo genético da hemofilia se deve à presença de um gene ligado ao sexo.5. Questão 862 Considere o heredograma a seguir. anomalia hereditária caracterizada por uma deficiência na coagulação do sangue.5. c) Homem daltônico e mulher daltônica. Questão 864 Sobre a hemofilia. (02) É uma doença mais comum em homens que em mulheres. e) machos: 50% cinzentos e 50% amarelos . d) dominante.2 partir da sua análise. Questão 861 O raquitismo resistente à vitamina D é uma doença determinada por um gene dominante de herança ligada ao sexo. Ao consultar um médico. Qual das opções fenotípicas abaixo corresponde à do casal em questão? a) Homem normal e mulher normal. d) machos: 50% cinzentos e 50% amarelos . d) Homem daltônico e mulher normal. b) Homem normal e mulher daltônica.fêmeas: 100% amarelas. já as meninas serão normais. espera-se que a) tanto os filhos quanto as filhas possam ser normais ou afetados. c) recessivo. c) tanto os filhos quanto as filhas sejam sempre normais. b) machos: 100% cinzentos . ligado ao cromossomo X. c) machos: 100% amarelos . e) recessivo. Questão 865 Considere o heredograma: 1. situado num autossomo.esperada a partir do cruzamento entre uma fêmea amarela e um macho cinzento. a) machos: 100% amarelos .5. b) dominante. atinge indivíduos de um único sexo.2 195 .

5. e) esta anomalia não será transmitida a nenhum descendente. ( ) Esse pedigree mostra um exemplo de herança passada do avô ou da avó para o neto por meio da mãe portadora.5. Macho sem pêlo: 3/8.2 as proporções fenotípicas esperadas na descendência são: a) Macho peludo: 1/4. A partir do cruzamento XrY × XRXr. Fêmea peluda: 1/4. como a cor da pele.abe-se que o pai. Fêmea sem pêlo: 10/64 e) Macho peludo: 1/8. XX na fêmea. Fêmea peluda: 3/16. Fêmea peluda: 3/8. Joana teve um filho que apresentou síndrome hemorrágica caracterizada por baixo nível plasmático do fator VIII da coagulação. responsável por animal sem pêlo. b) esta anomalia será transmitida à metade dos filhos do sexo masculino. ( ) Essa genealogia apresenta um tipo de interação gênica. Fêmea sem pêlo: 1/4 b) Macho peludo: 9/16. responsável por animal peludo. Macho sem pêlo: 3/16. Esse gene é representado por dois alelos. ( ) O caráter em questão é condicionado por um gene recessivo e ligado ao sexo. Essa figura indica os grupos sangüíneos do sistema ABO de alguns dos seus membros. Entretanto. Questão 867 Um homem possui uma anomalia dominante ligada ao cromossomo X e é casado com uma mulher normal. Fêmea sem pêlo: 1/8 d) Macho peludo: 36/64. Em relação aos descendentes deste casal é CORRETO afirmar que: a) esta anomalia será transmitida a todos os filhos do sexo masculino. O gene responsável pela quantidade de pêlos no animal está situado no cromossomo X. sendo 58 autossomos mais dois cromossomos sexuais. o R. Macho sem pêlo: 1/4. e o r. grave anomalia relacionada à alteração no tempo de coagulação do sangue. c) esta anomalia será transmitida a todas as filhas. 1. é: a) 100% para todas as mulheres da família b) 100% para Joana. influenciada pelo meio ambiente. Fêmea sem pêlo: 1/8 Questão 869 Observe a figura a seguir que apresenta o heredograma de uma família na qual alguns membros apresentam hemofilia. analise os itens. Fêmea peluda: 3/8. 196 . sua mãe e sua filha c) 100% para Joana e 50% para sua filha d) 100% para Joana e 50% para as outras mulheres da família e) 100% para Joana e 25% para sua filha Questão 866 Tendo em vista o heredograma. recessivo. ( ) Essa árvore genealógica representa um caso de anomalia hereditária. Macho sem pêlo: 1/8. Questão 868 Em bovinos ocorrem 60 cromossomos na célula somática. o marido. Fêmea peluda: 9/64. Macho sem pêlo: 9/64. A probabilidade genética de serem portadoras do gene para a hemofilia A. neste caso. determinada por um gene presente no cromossomo Y. e 58 autosomos mais XY no macho. Fêmea sem pêlo: 1/16 c) Macho peludo: 3/8. d) esta anomalia será transmitida à metade das filhas. os cinco irmãos homens e um sobrinho de Joana são normais.

c) o indivíduo III-4 pode receber sangue de III-6.5. 1. c) Ligada ao Y.5. Assinale entre as alternativas a seguir aquela que contém o heredograma que NÃO poderia representar a família desse rapaz. um rapaz descobriu que era daltônico.2 1.5. A ausência dessa enzima. e) o indivíduo I-1 é heterozigoto para o sistema ABO. ssinale a alternativa que NÃO contém um tipo de herança compatível com a anomalia representada no heredograma. é INCORRETO afirmar-se que a) a probabilidade de II-3 ser portadora do gene da hemofilia é de 50%. d) o indivíduo II-5 tem 50% de probabilidade de formar gametas do tipo iXh.5.5.2 Com base nas informações do heredograma e considerando-se que não ocorreu mutação.5. 1.2 1. Observe o heredograma que representa uma família com essa característica. d) Autossômica dominante. provocando sua destruição. em indivíduos afetados. b) Autossômica recessiva.5. b) a probabilidade de nascimento de outra criança hemofílica e do grupo B para o casal III-6 e III-7 é de 25%. Questão 872 A enzima G-6-PD (glicose-6-fosfato desidrogenase) está presente nas hemácias de indivíduos normais.Questão 871 Analise o heredograma. torna as hemácias sensíveis a certas drogas e nutrientes.2 a) 1 b) 2 c) 3 d) 4 197 . Questão 870 Ao fazer um exame de vista para tirar carteira de motorista. O gene que determina a ausência de G-6-PD é recessivo e situa-se no cromossoma X. a) Ligada ao X.5.

b) indivíduos do sexo masculino afetados por essa distrofia muscular são filhos de mães heterozigotas.5.2 . c) casais como I. um gene para ausência de G-6-PD. d) mulheres afetadas recebem os cromossomos X materno e paterno com o gene para essa distrofia.4 recebeu o gene do daltonismo de qualquer um de seus genitores. inicia-se na infância e impede a reprodução dos afetados. é INCORRETO afirmar que a) casais com filhos afetados têm 25% de probabilidade de ter outra criança com essa doença. é CORRETO afirmar que a) o indivíduo I.2 é heterozigota 3. Analise-a e avalie as proposições dadas. d) os filhos do sexo masculino de II.2 é homozigota 2.5. A mulher II. condicionada por gene recessivo localizado no cromossoma X: Considerando-se as informações contidas nesse heredograma e outros conhecimentos sobre o assunto.2 198 . d) o indivíduo II-3 pode ter recebido o gene da G-6-PD tanto do seu pai quanto de sua mãe. ligada ao X. A mulher I. A mulher III.2 têm probabilidade maior de ter filhos afetados do que de ter filhas afetadas. pelo menos. A mulher I. c) os casais como I. em que está representada a herança do daltonismo. caracteriza-se por debilidade muscular progressiva e deformidades ósseas. A mulher III.9 é homozigota Está(ão) correto(s) apenas: a) 1 b) 2 c) 3 d) 1 e 3 e) 1 e 2 Questão 876 A figura a seguir faz referência a uma genealogia que ilustra a ocorrência de uma determinada doença genética. b) essa família apresenta dois indivíduos heterozigotos para o gene que determina a G-6-PD.4 é homozigota 4.5. Considerando-se essas informações e outros conhecimentos sobre o assunto.om base nesse heredograma.2 serão daltônicos. analise os itens: 1. 1.2 têm maior probabilidade de ter filhos do sexo masculino daltônicos. Questão 874 Analise este heredograma.5. Questão 875 Considerando que o heredograma a seguir é o de uma herança dominante. é CORRETO afirmar que a) cada um dos indivíduos representados tem. c) indivíduos do sexo masculino que possuem um gene mutante para essa distrofia manifestam a doença.1 x I.1 e I. b) o indivíduo II.2 apresenta o fenótipo normal e é portador do gene do daltonismo. Questão 873 A distrofia muscular do tipo Duchenne. doença recessiva ligada ao cromossomo X. independentemente do genótipo do seu pai.5 é heterozigota 5.

1) de uma família em que ocorre a hemofilia A. Questão 878 O diagrama abaixo mostra a surdez em três gerações de uma família. A hemofilia A. analise as afirmativas. IV. Se o indivíduo 7 tiver filhos com uma mulher que tenha o mesmo genótipo para hemofilia de sua avó materna.5. ( ) A identidade genotípica é também observada entre II e IIƒ. e) I e III. e o indivíduo 8 pode ou não ser portador deste alelo recessivo. Com base nos textos e em seus conhecimentos. São Paulo: Ed. pois herdou da mãe o alelo normal (H). c) II. 199 . V3. I. J. genótipos da figura 2 e a consangüinidade. somente o indivíduo 6 é portador do alelo recessivo que causa a hemofilia. III‚. ( ) Os descendentes III„ e III… apresentam o mesmo genótipo. pois herdou o alelo recessivo para ausência do fator VIII de sua mãe.5. pode-se concluir que se trata da herança de genes localizados no cromossomo Y. condicionou a manifestação do alelo deletério h para hemofilia.M. a probabilidade de terem filhos hemofílicos é de 50% e de terem filhas hemofílicas é de 0%. b) III e IV. Estão corretas apenas as afirmativas a) I e IV. Moderna. sendo responsável por este tipo de hemofilia. As irmãs 2 e 4 apresentam. é causada pela deficiência de um dos fatores que agem na coagulação.. III„ e III…) manifestam a característica em consideração.2 1. III. o fator VIII.5. O indivíduo 7 é hemofílico. ( ) Observando-se que a maioria dos machos (I. enquanto que o indivíduo 5 não apresenta este alelo. II. Esse fator é uma proteína cujo gene codificador encontra-se no cromossomo X. "Conceitos de Biologia". III. 2003. Questão 877 A hemofilia é uma doença hereditária em que há uma falha no sistema de coagulação do sangue. o alelo normal (H) produz o fator VIII e condiciona fenótipo não hemofílico. através da união entre primos irmãos (indivíduos 5 e 6). um dos tipos mais graves.R. considerando que os indivíduos 2 e 4 são irmãs. MARTHO. Observe o heredograma (fig. ( ) O loco gênico determinante deste caráter deve estar localizado na porção não-homóloga do cromossomo X. d) I e II. AMABIS.5. o alelo mutante (h) condiciona ausência do fator VIII.2 ( ) A característica mostrada no heredograma é determinada por uma série polialélica de genes autossômicos. II„. Dos primos que se casaram. Um quadrado preto representa um homem surdo e um quadrado branco um homem normal.1. respectivamente. G. Um círculo preto representa uma mulher surda e um círculo branco representa uma mulher normal.

(32) Machos afetados descendem de fêmeas portadoras ou afetadas. Qual a probabilidade de que um(a) filho(a) deste casal venha a ser afetado pela doença? a) Se a mulher for homozigota.Uma mulher com fenótipo normal tem um irmão afetado e um tio materno também afetado pela doença. b) machos e fêmeas com cauda curta e retorcida na proporção de 2:1. Em uma família. a probabilidade é zero. Seu alelo recessivo é responsável pelo fenótipo cauda normal. e) o pai obrigatoriamente apresenta a cegueira da cor verde.1.5. a probabilidade é 75%. (02) Esse gene deve se manifestar com maior freqüência nas fêmeas. a probabilidade é 25%. Questão 880 Genes situados na porção ímpar do cromossomo X são transmitidos segundo um padrão definido como Herança Ligada ao Sexo. . é correto afirmar: (01) Esse gene deve se manifestar com igual freqüência em machos e fêmeas. É correto afirmar que: a) a mãe obrigatoriamente apresenta a cegueira da cor verde. Questão 882 Existe uma doença condicionada por um gene recessivo. enquanto o filho não enxerga a cor verde. a filha possui visão normal. o fenótipo cauda curta e retorcida é determinado por um gene dominante denominado "Bent". d) Se a mulher for heterozigota. e) holândrica. d) a mãe é pelo menos heterozigota para a cegueira da cor verde. sua descendência apresentará a seguinte proporção: a) machos e fêmeas com cauda curta e retorcida na proporção de 100%. d) todos os machos com cauda curta e retorcida e todas as fêmeas com cauda normal. d) recessiva ligada ao sexo.5. (04) Esse gene deve se manifestar com maior freqüência nos machos. Soma ( ) Questão 881 condição de surdez mostrada no heredograma é herdada como uma característica: a) autossômica dominante. Em camundongos. (64) Fêmeas afetadas são necessariamente descendentes de fêmeas afetadas. c) dominante ligada ao sexo. 200 . c) Se a mulher for homozigota. localizado na região não homóloga do cromossomo X. localizado no cromossomo sexual comum aos dois sexos. (16) Machos afetados descendem de machos também afetados. e) todos os machos com cauda normal e todas as fêmeas com cauda curta e retorcida.ela está casada com um homem normal.2 (08) Esse gene deve se manifestar apenas nos machos. . a probabilidade é 100%. c) o pai é homozigoto para a cegueira da cor verde. Questão 879 A cegueira da cor verde na espécie humana é uma característica recessiva ligada ao sexo. Considerando um gene recessivo e localizado nessa porção do cromossomo X. . b) o pai é heterozigoto para a cegueira da cor verde. b) autossômica recessiva. c) machos e fêmeas com cauda normal na proporção de 100%. b) Se a mulher for homozigota. Se uma fêmea de cauda normal for cruzada com um macho de cauda retorcida. que leva a uma debilidade muscular progressiva (distrofia muscular progressiva).seus pais não são afetados.

As bases genéticas da hemofilia apoiam a paternidade do homem hemofílico. . Aa.5. c) A mãe é amarela e o pai. assinale a(s) proposição(ões) CORRETA(S). a probabilidade é 100%. d) apenas nas células-mãe dos gametas. a) autossômica dominante b) ligada ao X dominante c) ligada ao Y dominante d) ligada ao Y recessiva e) ligada ao X recessiva Questão 884 Um homem é heterozigoto para um gene autossômico. Quais estão corretas? a) Apenas I.O homem não hemofílico pode ser o pai do menino. e) apenas nos gametas com cromossomo y.2 dentifique o mais provável padrão de herança representado no heredograma. preto. e) Apenas II e III. a outra metade é preta. d) Apenas I e II. amarelo. (Hemofilia: herança recessiva ligada ao X) Analise as afirmações abaixo a esse respeito. e metade dos machos é amarela. em uma região sem homologia no cromossomo Y. Questão 887 Assinale a proposição CORRETA. e decorre do não funcionamento de um dos fatores bioquímicos de coagulação. (01) Não é possível a existência de mulheres hemofílicas. Com relação a essa doença. do sexo masculino. I . d) A mãe é preta e o pai. (04) Entre as mulheres. Questão 886 Em um caso de disputa da paternidade de um menino hemofílico. Quando metade das fêmeas de uma ninhada é malhada. b) em todas as células gaméticas. e possui um alelo ligado ao X recessivo b. os machos podem se pretos ou amarelos e as fêmeas podem ser pretas amarelas ou malhadas. Questão 883 Interprete o heredograma abaixo. II . 201 1.e) Se a mulher for heterozigota. b) A mãe é malhada e o pai. b) Apenas II. de que cores são os pais? a) A mãe é malhada e o pai. e) A mãe e o pai são pretos. preto. c) Apenas III. Que proporção dos seus espermatozóides espera-se que seja A/Xö ? a) 0 % b) 25 % c) 50 % d) 75 % e) 100 % Questão 885 Nos gatos domésticos a cor do pêlo é ligada ao cromossomo X. c) apenas nas células do globo ocular. Em um indivíduo daltônico. (02) É condicionada por um gene que se localiza no cromossomo X. Assim. é possível encontrar um máximo de três fenótipos e dois genótipos. estão envolvidos um homem que tem a doença e outro que não a tem. III . amarelo.O homem hemofílico não pode ser o pai do menino. o gene para o daltonismo encontra-se: a) em todas as células somáticas.5. Questão 888 A hemofilia é uma doença hereditária em que há um retardo no tempo de coagulação do sangue.

Uma fêmea heterozigota foi cruzada com um macho normal. a probabilidade de nascimento de uma criança do sexo masculino e hemofílica é a) 1/2. não portadora. que se caracteriza pela dificuldade de coagulação do sangue. 50% de machos com cerdas retorcidas e 100% de fêmeas normais. Os homens afetados começam a apresentar os sintomas na primeira infância e não se reproduzem porque morrem antes de atingir o período reprodutivo.Devido à inativação ao acaso de um cromossomo X. Sabendo-se que o daltonismo é uma herança ligada ao X. Questão 893 Observe a genealogia abaixo sobre uma família que apresenta pessoas afetadas por uma anomalia hereditária. Questão 891 Um casal que possui visão normal para as cores. a distrofia muscular de Duchenne é uma doença condicionada por um gene recessivo localizado no cromossomo X. a possibilidade de esse casal ter uma filha com daltonismo é a) zero. e) 1.A distrofia muscular de Duchenne é uma doença que ocorre exclusivamente no sexo masculino. d) I e II. espera-se que 50% deles sejam normais e 50% sejam hemofílicos.(08) Entre os homens. b) 50% de machos normais. e) 100% de machos normais e 100% de fêmeas com cerdas retorcidas. b) I e III. (32) É um exemplo de herança ligada ao sexo.menino com daltonismo. é possível ocorrer apenas um genótipo. III. c) 100% de machos normais. Soma ( ) . d) 100% de machos com cerdas retorcidas e 100% de fêmeas normais. (16) Entre os descendentes de um homem hemofílico e de uma mulher normal. I. e) 3/4. o caráter cerdas retorcidas é determinado por um gene recessivo e ligado ao sexo. Em um casal em que a mulher é heterozigota para a hemofilia e o marido é normal. A descendência esperada será de a) 50% de machos e 50% de fêmeas normais e 50% de machos e 50% de fêmeas com cerdas retorcidas. em que os indivíduos afetados têm graves hemorragias. Questão 892 Na espécie humana. 50% de fêmeas com cerdas retorcidas e 50% de fêmeas normais. II. que ocorre nas células das fêmeas dos mamíferos (hipótese de Lyon). d) 1/8. Questão 889 A hemofilia é uma doença recessiva ligada ao sexo. c) 1/4. O alelo dominante determina cerdas normais (não retorcidas). b) 1/4. por isso. tem 3 filhos com as seguintes características: 202 . d) 3/4. mesmo no caso de pequenos ferimentos.menina com visão normal para as cores. as mulheres heterozigotas para o gene da distrofia muscular de Duchenne podem apresentar graduações da característica. Questão 890 Em drosófila. c) 1/2. .menino com visão normal para as cores. b) 1/3. há uma maior incidência dessa doença entre eles. . c) II e III. que acarreta degeneração e atrofia dos músculos. Analise as afirmativas abaixo. São corretas as afirmativas a) apenas III.A distrofia muscular de Duchenne é uma doença que ocorre quase que exclusivamente em meninos.

d) O genótipo do Sr 9 é XHY. (2) Os descendentes de uma fêmea amarela.É possível que o casal tenha filhas não-calvas.A mulher é dupla heterozigota para os genes em questão. (3) Um gato macho não transmite para seus filhos machos os genes para cor da pelagem.5. Questão 896 Com relação à coloração da pelagem de gatos. Questão 895 O gene h que determina a hemofilia na espécie humana é recessivo e está localizado no cromossomo X.5. b) autossômico recessivo. Um casal não-calvo e de visão normal tem um filho calvo e daltônico. de visão normal em um dos olhos. cruzada com um macho preto. serão manchados.5.2 Utilizando as informações anteriores. c) dominante ligado ao cromossomo X. observam-se os seguintes fenótipos: 1. O gene que condiciona a calvície é dominante nos homens e recessivo nas mulheres. a) I e II são corretas. e) O genótipo da Sra 8 é XhXh.5. é condicionado por genes ligados ao cromossomo X.25% das filhas do casal poderão ser calvas e daltônicas. c) O genótipo da Sra 8 é XHXH. mas daltônicas do outro. podemos afirmar corretamente: a) O genótipo da Sra 5 é XHXH. b) O genótipo da Sra 5 é XHXh. Marque a alternativa correta. O daltonismo é de herança recessiva ligada ao cromossomo X. III . d) Apenas III está correta. Questão 894 Na espécie humana. analise as afirmativas a seguir.1. (0) O caráter cor da pelagem. Com base no heredograma a seguir. não havendo dominância. d) autossômico dominante. nos gatos.5.2 anomalia em questão é transmitida por meio de um gene a) recessivo ligado ao cromossomo X. I . 203 . Considerando os dados apresentados. a calvície hereditária é uma característica influenciada pelo sexo. c) II e III são corretas. (1) As fêmeas manchadas são heterozigotas para o caráter cor da pelagem. julgue os itens a seguir.5. b) I e III são corretas. II .2 1.

Questão 899 Uma mulher é portadora de um gene letal presente no cromossomo X. podemos afirmar que a) a mulher 2 é homozigota. portadores do gene. sendo que seu alelo dominante condiciona visão normal.5. e) os homens 1 e 4 são.50. Questão 901 Um casal não hemofílico teve um filho do sexo masculino com hemofilia. e) 5. cuja mãe tinha olhos brancos. Uma mosca fêmea com olhos coloridos. (01) O daltonismo está relacionado com genes localizados em cromossomos autossômicos. (64) O genótipo do indivíduo 5 é XdXd.5. (32) O genótipo do indivíduo 9 é XdY. certamente. portadoras do gene. a cor branca dos olhos é devida à herança ligada ao sexo. 204 . d) 4. b) 0.2 Assinale dentre as alternativas que se seguem. e) 0. c) 3. o número esperado de crianças do sexo masculino será a) 1.25. portadoras do gene.67. b) 2. (16) O casal 1 x 2 pode ter filhos homens daltônicos. d) 0. (02) O daltonismo é determinado por um gene recessivo. b) as filhas do casal 3 e 4 são. (08) O indivíduo 8 tem o mesmo fenótipo de sua avó materna. Este gene provoca aborto espontâneo algumas semanas após a formação do zigoto.00.5. em seis partos diferentes. c) as mulheres 2 e 3 são.00. 1. (04) O indivíduo 1 transmite a todas as suas filhas um cromossomo Xd.2 respeito desta genealogia. Questão 898 Considere o heredograma. Qual é a probabilidade de se obter uma fêmea de olhos brancos deste cruzamento? a) 1.Questão 897 Em moscas de frutas. Questão 900 A genealogia abaixo nos mostra uma forma de transmissão do daltonismo. c) 0. d) todas as filhas do casal 1 e 2 são portadoras do gene. certamente. a(s) correta(s). que representa uma família portadora de caráter recessivo condicionado por um gene situado em um dos cromossomos sexuais.5. Indique a alternativa com a probabilidade desse casal ter uma filha hemofílica: a) 0% b) 25% c) 50% d) 75% e) 100% 1. certamente. Se esta mulher der à luz seis crianças normais. cruza-se com macho de olhos brancos.

d) pleiotropia. temos: a) a diferenciação dos testículos. ab (50%). e) exclusivas das mulheres. por genes holândricos. b) o aparecimento do corpúsculo de Barr. determinada por genes localizados no cromossomo Y. Observando as seguintes proporções de gametas produzidos pelo diíbrido AaBb em três situações distintas. ab (40%). Questão 905 O exame citogenético de um indivíduo normal revelou que o seu cromossomo Y contém. respectivamente. b) Se eu tenho este Y. a qual não é válida para os genes que estão em ligação gênica ou "linkage". d) somente nas mulheres heterozigotas. e) o albinismo. Na próxima geração dessa família esse gene se manifestará a) em todas as mulheres. Ab (25%). I . ou seja. Questão 906 A hipertricose auricular (pêlos na orelha) é transmitida apenas pelo homem e somente para os filhos do sexo masculino. isto é. em relação ao padrão de cromossomo Y presente na população.AB (25%). ab (25%). Um homem com hipertricose casa-se. apenas 50% terão esse cromossomo. talvez ele não seja meu irmão. b) II e III são situações nas quais ocorre segregação independente e ligação gênica sem "crossing-over". Questão 903 A hipertricose auricular é uma anomalia genética condicionada por um gene localizado no cromossomo Y. b) transmitidas do pai para 100% dos filhos homens. b) em todos os homens. c) herança holândrica. aB (10%).Questão 902 Na espécie humana. d) o daltonismo. Embora sem nenhuma manifestação fenotípica aparente. a determinação cromossômica do sexo é dada pelos cromossomos X e Y. e) interação gênica. c) transmitidas do pai só para as filhas. Assinale a suposição que está geneticamente coerente: a) Acho que o meu pai herdou essa condição genética da mãe dele. ele acompanhou a transmissão de dois caracteres ao mesmo tempo. Ab (10%). Questão 904 Como exemplo de característica na espécie humana. As características condicionadas por tais genes são a) transmitidas da mãe para 100% das filhas. O cromossomo Y apresenta genes holândricos. e) somente nos homens heterozigotos. d) Entre as minhas filhas. c) Se o meu irmão não tiver esse Y. b) codominância. genes que estão localizados nos mesmos cromossomos. ele fez algumas suposições sobre a herança desse cromossomo. isto é. Esta observação foi enunciada como "2 Lei de Mendel" ou "Lei da Segregação Independente". III . d) transmitidas do pai para os filhos homens e filhas em 100% dos casos. aproximadamente. aB (25%). nas primeiras experiências sobre hereditariedade. e os resultados levaram-no a concluir que: "fatores para dois ou mais caracteres são transmitidos para os gametas de modo totalmente independente". c) em 50% das mulheres e 50% dos homens.AB (50%). e todos os seus filhos são homens. e) Provavelmente esse Y ficou grande para ser o homólogo do X. c) a hemofilia. Posteriormente.AB (40%). Questão 907 Mendel. pode-se afirmar que: a) I e II são situações nas quais os genes segregam-se independentemente. genes que não possuem homologia com o cromossomo X. 30% a mais de heterocromatina na região distal. todos os meus descendentes também o terão. 205 . Este fenômeno é chamado de: a) epistasia. trabalhou com apenas uma característica de cada vez. II .

é de aproximadamente 42%. Em quantos grupos de ligações seus genes estarão associados? a) Quatro. ( ) Considerando o cruzamento ilustrado na figura. b) Seis. respectivamente. b) Quatro. em 8. em 100% das células germinativas da fêmea. Questão 908 Considere uma espécie de vertebrado cujas células embrionárias têm oito cromossomos. Questão 912 A freqüência de recombinação entre os locos A e B é de 10%.c) I e III são situações nas quais ocorre segregação independente e ligação gênica com "crossing-over". pode-se concluir que os genes "a" e "b": a) estão em um mesmo braço do cromossomo. analise a figura e as afirmações feitas a seguir. A taxa de recombinação entre eles dependerá do quanto estiverem afastados um do outro. Em quantos grupos de ligações seus genes estarão associados? a) Dois. 1. Em que percentual serão esperados descendentes de genótipo AB // ab. ocorrer permutação entre os locos A e B.6 ( ) A freqüência de recombinação entre os locos A e B é de 17%. os gametas não recombinantes e os recombinantes surgirão nas proporções esperadas de 1:1:1:1. c) Três. cada tipo de gameta recombinante (Ab e aB) aparecerá com freqüência de 25%. e) Dez. em 50% das células produtoras de gametas. A esse propósito. Questão 911 Quando dois genes estão em um mesmo cromossomo. pode-se inferir que ocorreu permutação (ou crossing-over). no cromossomo. d) são pleiotrópicos. d) Dezesseis. e) III é uma situação na qual ocorre ligação gênica sem "crossing-over". a partir do cruzamento acima indicado. Questão 909 Considere uma espécie de vertebrado cujas células somáticas têm 12 cromossomos.5% das células formadoras de gametas. ( ) Se. d) II é uma situação na qual ocorre ligação gênica com "crossing-over". b) seguem as leis do diibridismo. a partir de progenitores com os genótipos mostrados na figura? 206 . e) Número variável. ocorrer permutação entre os locos A e B. existe uma ligação gênica.5. ( ) Se. um com genótipo AaBb e outro com genótipo aabb resultou numa F com as seguintes proporções: AaBb = 35% aabb = 35% Aabb = 15% aaBb = 15% Com esses resultados. ( ) A probabilidade do aparecimento de um indivíduo AB//ab. d) Oito. c) Oito. c) constituem um caso de interação gênica. Questão 910 O cruzamento de dois indivíduos. e) são epistáticos.

A geração P é genotipicamente (AB//AB) x (ab//ab).roxo e branco -. e) em ambas as situações ficou evidenciada a ligação gênica. foi observada na progênie a seguinte proporção (situação 2): 1. pelos locos A e B.e pilosidade no cálice da flor . o hipocótilo era verde (situação 1). ocorreu permutação entre os locos A e B. ( ) Em 60% das células formadoras de gametas da F1. fenotipicamente (AB). Analise as proposições a seguir quanto à correção.6 a) 5% b) 90% c) 45% d) 10% e) 20% Questão 913 Dois fenótipos de interesse econômico. foi retrocruzada com o pai duplo-recessivo. d) em ambas as situações ficou evidenciado o efeito pleiotrópico entre os genes. b) a primeira situação pode representar um caso de pleiotropia e a segunda evidencia uma segregação independente dos genes. sendo que na segunda. Plantas homozigóticas. o que mostra uma distância menor entre os genes. Em todos os cruzamentos realizados entre plantas fenotipicamente diferentes e após avaliações em várias gerações segregantes. c) a primeira situação evidencia ligação gênica e a segunda mostra a segregação independente dos genes.5. A cor roxa da flor e do hipocótilo e a presença de pilosidade são dominantes. Com base no texto e em seus conhecimentos é correto afirmar que a) a primeira situação pode representar um caso de pleiotropia e a segunda mostra um caso de ligação gênica.6 ( ) Trata-se de um caso de ligação gênica. ambos com dominância completa. ( ) A taxa de recombinação no caso mostrado é de 30%.6 1. obtendo-se uma F2 como mostrado no quadro. ( ) Os locos A e B distam entre si de 35 unidades de mapa. fenotipicamente (AB). a ligação é mais forte do que na primeira.5. foram cruzadas com plantas de fenótipo (ab). cor do hipocótilo .com (piloso) e sem (glabro). são determinados. ao cruzarem um duplo heterozigoto para os caracteres cor da flor e pilosidade no cálice da flor com um duplo-recessivo. em milho. 1. ( ) Em 35% das células gaméticas da F1 ocorreu recombinação.Questão 914 Uma determinada espécie vegetal apresenta variação para cor da flor . 207 . foi observado que todas as plantas que apresentavam flores roxas. respectivamente. o hipocótilo era roxo e todas as plantas que apresentavam flores de cor branca.5.roxo e verde . Entretanto. A F1.

o número esperado de casamentos com risco de gerar crianças com degenerescência nervosa é: a) 0. provocando a degenerescência nervosa mortal. III.Um organismo com dois alelos idênticos para um "locus" em particular é considerado homozigoto para este "locus". Qual a explicação para o comportamento das curvas do gráfico? 1. II. III e IV c) Apenas I. que possuem efeitos similares e aditivos. para um dado "locus". nós dizemos que esta característica é uma característica poligênica. estão presentes na população. e há tentativas de tratamento com algum sucesso em poucos casos. enquanto um organismo com dois alelos diferentes para um mesmo "locus" é considerado heterozigoto para este "locus". IV e V e) I. o qual determina a doença chamada siclemia ou anemia falciforme. III. II. III e IV b) Apenas I. IV . V . Em 2. são mais resistentes à malária que os indivíduos normais.A aparência de um indivíduo com respeito a uma dada característica herdada é chamada de fenótipo.7 208 . dizemos que este "locus" possui alelos múltiplos. Os homozigotos siclêmicos morrem precocemente devido à severa anemia.Os genes em um mesmo cromossomo tendem a ser herdados juntos e são denominados "genes ligados" II . Em certas comunidades da Europa Central. II. IV e V Questão 916 Numa determinada população a capacidade de enrolar a língua é determinada por um gene dominante A.Quando uma característica particular de um organismo é governada por muitos pares de genes. III e V d) Apenas II. Nessa mesma população foi observado que 64% das pessoas apresentam esta característica. III . os heterozigotos sofrem de uma forma branda da anemia mas. uma em cada 30 pessoas apresenta fenótipo normal e é heterozigota quanto ao gene determina a doença de Tay-Sachs. por outro lado. Quais afirmativas o professor diria que estão corretas? a) Apenas II. O diagnóstico pré-natal é possível.3 b) 3 c) 45 d) 60 e) 90 Questão 918 O gráfico a seguir mostra a dinâmica das freqüências do gene s.Questão 915 Os seguintes conceitos genéticos foram escritos por um aluno que estava com dúvidas sobre a matéria e que pediu a um professor qualificado que os conferisse: I .700 casamento ocorridos entre membros sadios dessas comunidades. A freqüência esperada de indivíduos heterozigotos será de: a) 70% b) 48% c) 36% d) 16% e) 10% Questão 917 A doença de Tay-Sachs resulta da ação de um gene mutante localizado no cromossomo número 15.Quando três ou mais alelos. O gráfico refere-se ao período posterior à erradicação da malária.5.

000 é hemofílico. enquanto que a outra metade é composta por indivíduos duplo-recessivos (aa).9/16. Questão 921 A sensibilidade (gosto amargo) do ser humano ao PTC (feniltiocarbamida) se deve a um gene autossômico dominante I e a insensibilidade. Aa . os números esperados de pessoas sensíveis e insensíveis nessa população são.000 indivíduos.500 c) 1/25.4/16. se as proporções genotípicas forem: a) AA . e) Cruzamentos preferenciais entre portadores de malária.1.25.16. numa população de 1200 pessoas. a freqüência do gene h nessa população é a) 1/500 b) 1/12. as freqüências dos genes I e i são.280.280.5. b) 1.6/16.8 e 0. aa .1. era de 0.6. d) 0. numa determinada população. respectivamente: a) 960 e 240.1/16. respectivamente.2. Aa . a) AA . Aa .400.6/16.4/16. Questão 920 A freqüência de indivíduos afetados por uma anomalia genética autossômica recessiva. aa . b) 768 e 432.50. c) o nascimento de 48 indivíduos afetados entre 300 nascidos. Questão 923 Sabendo-se que uma população está em equilíbrio genético e que a freqüência de indivíduos homozigotos para um caráter autossômico e dominante (AA) é de 25%. Aa . Constatou-se a diminuição dessa freqüência após a) a morte de 5% da população total por falta de alimento. e) 816 e 384.4/16.6. c) Aumento da freqüência de mutação de S para s. d) AA . b) AA .160.00. aa . em uma dada população. d) AA . se essa população estiver em equilíbrio genético.000 209 .6. e) o crescimento da população da população devido a diminuição da predação.a) Diminuição da freqüência de mutação de S para s. e) 0.9/16.6/16. a freqüência de um gene autossômico dominante A é o triplo da freqüência do seu alelo recessivo a.120. Se. indique a alternativa que mostra o número de indivíduos para cada genótipo.8/16.560. b) a imigração de muitos indivíduos homozigotos dominantes. d) 1152 e 48.8. d) Cruzamentos preferenciais entre pessoas anêmicas. Questão 925 A hemofilia é causada por um gene recessivo (h) localizado no cromossomo X. 0.600.5% c) 25% d) 50% e) 75% Questão 924 Sabendo-se que a freqüência do gene autossômico A é igual a 0.6/16.000 d) 1/50.440. Questão 922 Numa população.560. c) 0.9/16. Aa . d) o casamento preferencial de indivíduos heterozigotos. Aa . c) 1008 e 192.2.160.1/16.280. aa . e) AA . aa . b) AA . aa . aa .1/16. Aa .320. Aa .5. aa .1. um homem em 25. numa população constituída de 8. c) AA . aa . Nessa população a freqüência do alelo A é a) impossível de se determinar.75.25% b) 12. Questão 919 Considere uma população em que metade dos indivíduos mantém-se heterozigota para um dado gene (Aa). Aa .1.120. Aa . e) AA . Essa população estará em equilíbrio genético. Sabendo-se que.6/16. ao seu alelo recessivo i. aa .320.400. concluímos que a freqüência de indivíduos homozigotos recessivos (aa) é de: a) 6. c) AA .1. b) Seleção contra os portadores do gene s.

a freqüência do alelo autossômico (b) é de 30%. a probabilidade do casal III.7 1. Esse caráter é dominante nos homens e recessivo nas mulheres. as freqüências genotípicas de um determinado par de alelos "a" se distribui de acordo com o gráfico destacado: Marque o gráfico que representa a freqüência genotípica após 12 gerações: 1. Se essa população for formada por 1000 indivíduos. que tem sua expressão influenciada pelo sexo.5. o comprimento das asas é determinado por um par de genes.5.7 Questão 929 Uma população em que atuam os princípios postulados por Hardy e Weinberg. calcularam-se outras freqüências.5. 16% apresentavam asas vestigiais. O alelo que condiciona asas longas é dominante sobre o alelo que condiciona asas vestigiais.000 Questão 926 Em uma população em equilíbrio de Hardy-Weinberg. espera-se que sejam heterozigotos a) 700 b) 420 c) 90 d) 49 e) 21 Questão 927 Analise o heredograma a seguir no qual os símbolos escuros significam a presença de uma anomalia. Sabendo-se que. Assinale a alternativa correspondente aos cálculos corretos.7 abendo-se que a freqüência de heterozigotos na população é 1/20. 1. em uma população mantida em laboratório. Questão 930 A calvície na espécie humana é determinada por um gene autossômico C. que estão indicadas na tabela abaixo.2 vir a ter uma criança com a anomalia é a) 1/420 b) 1/160 c) 1/120 d) 1/80 e) 1/50 Questão 928 Em drosófilas.1 x III. como mostra a tabela a seguir: 210 .e) 1/100.

qual a freqüência esperada de mulheres cujo genótipo pode torná-las calvas? a) 1% b) 8. em equilíbrio de Hardy-Weimberg. e) tratar-se de um caso de herança quantitativa. as freqüências esperadas de indivíduos dos grupos N e MN são. b) a mecanismo de herança da cor dos olhos não ser ainda bem conhecido. Essa diferença deve-se fato de a) a herança da cor dos olhos não obedecer às leis de Mendel.7 esta população. d) 0. d) a freqüência dos alelos para olhos escuros ser maior nas populações sul-americanas do que nas européias. 1.24 e 0.16.000 indivíduos revelando os dados apresentados no quadro abaixo. c) 0.48.5% c) 19% d) 42% e) 81% Questão 931 Para responder à questão. c) a dominância dos genes relacionados com a cor dos olhos modificar-se com o ambiente. há certas proteínas no sangue que permitem classificar as pessoas como pertencentes ao tipo sangüíneo M. b) 0. Questão 934 Na espécie humana. Espera-se que o número de indivíduos Rh positivo homozigoto nessa população seja de a) 9. Um levantamento nos prontuários médicos de um importante hospital brasileiro identificou o grupo sangüíneo MN de 10.550 d) 2. onde 81% dos homens não apresentam genótipo capaz de torná-los calvos. N ou MN.84. a freqüência de indivíduos do grupo M é 49%. 211 m uma população. as freqüências dos alelos M e N são.60 e 0.000 indivíduos. Se em uma população em equilíbrio de Hardy-Weinberg. na maioria das populações da América do Sul predomina o número de pessoas de olhos escuros. Questão 932 Numa população em equilíbrio de Hardy-Weinberg. formada por 10. existem 900 do tipo Rh negativo.16 e 0.48 e 0. enquanto em diversas populações européias acontece o inverso: pessoas de olhos escuros constituem a minoria. respectivamente. e) 0.7 . que sempre é influenciada por fatores ambientais. A análise da população estudada concluiu que a mesma se encontra em equilíbrio de Hardy-Weinberg.100 e) 900 Questão 933 Sabe-se que olhos escuros são dominantes sobre olhos azuis. Sabe-se também que.5.1.5. considere a informação a seguir.40.24.100 b) 4.36 e 0.900 c) 4. a) 0. Essa característica é determinada por um par de alelos entre os quais não há dominância.

(16) O conhecimento das freqüências genotípicas é suficiente para se determinar a condição da população quanto ao equilíbrio.. d) ao seu efeito dominante. pelo menos.respectivamente. (08) Com informações sobre os valores das freqüências gênicas..51 b) 0. a população não está em equilíbrio. a freqüência desse gene tende a aumentar devido a) ao fato de ser recessivo. (64) A população está em equilíbrio apenas quando 75% dos indivíduos apresentam o fenótipo D e 25% apresentam o fenótipo R. é correto afirmar que a freqüência dos alelos A e a será respectivamente: a) 0. direcionados. ao acaso. ausentes e) Pequena. Preenchem correta e respectivamente as lacunas (1). a) 9% e 42% b) 17% e 34% c) 18% e 21% d) 21% e 18% e) 34% e 17% Questão 935 Suponha que uma variedade de determinada planta possua um gene que lhe confere vantagem em relação a uma outra variedade da mesma população. O alelo recessivo a é responsável pelo fenótipo R e tem freqüência q.56 c) 0. (2) e (3): a) Infinitamente grande. Se em uma dada população em equilíbrio de Hardy-Weinberg 9% dos indivíduos são albinos.66 Questão 938 Uma população de roedor está sendo estudada quanto ao equilíbrio de Hardy-Weinberg para uma característica determinada por um locus autossômico. numa população. as freqüências gênicas e genotípicas se mantenham constantes ao longo das gerações. 2pq e q£. c) à seleção natural.50 e 0.. são condições para que. Em uma população que está 212 . O alelo dominante A condiciona o fenótipo D e ocorre com a freqüência p. com p=0. ao acaso. (04) Em uma amostra de 1000 indivíduos de uma população em equilíbrio. p e q.. de acordo com Hardy e Weinberg.. e das freqüências fenotípicas. para essa característica. (32) Quando todas as freqüências genotípicas são iguais. uma geração.56 e 0.50 d) 0..49 e 0. ao acaso.6. são esperados 160 indivíduos com o fenótipo R. cruzamentos .44 e 0.(2).34 e 0. Aa e aa são encontrados com as freqüências p£.. atuantes b) Infinitamente grande.. Com base nesses dados. e fatores evolutivos .44 e) 0... ausentes d) Pequena. assinale o que for correto. (02) No equilíbrio. atuantes Questão 937 Em uma população composta de 100 mil indivíduos. 24 mil apresentam o genótipo AA e 36 mil apresentam o genótipo aa. Então. Com o tempo. respectivamente.(I).. os genótipos AA. a freqüência esperada de heterozigotos normais é a) 91 % b) 75% c) 49% d) 42% e) 21% Questão 940 Um par de genes determina resistência a um fungo que ataca a cana-de-açúcar e os indivíduos suscetíveis (aa) apresentam freqüência de 0. é possível determinar se a população está ou não em equilíbrio. Questão 936 Tamanho .25. o albinismo é determinado por um alelo autossômico recessivo. Questão 939 Na espécie humana. (01) A população está em equilíbrio se estiver ocorrendo seleção natural há... b) às mutações que continua a sofrer.(3). atuantes c) Infinitamente grande. direcionados. e) à oscilação genética.

e) 24%. ocorram ao acaso. a freqüência de heterozigotos será: a) 15% b) 25% c) 50% d) 75% e) 100% Questão 941 O gráfico mostra as relações entre as freqüências dos alelos A e a e as freqüências genotípicas AA. 10% e 10%. Questão 943 Uma população em equilíbrio é constituída de 500 indivíduos. em uma população. 15% e 15%. Com base nesses dados é INCORRETO afirmar-se que a) a freqüência de indivíduos com fenótipo dominante é 91% b) cerca de 10% da população é homozigota. ( ) os novos alelos. e) a probabilidade de ocorrência de homozigotos nessa população é de 52%. a) 25%. Aa e aa numa população em equilíbrio.000 sementes de uma população panmítica. ou seja.5. A probabilidade de se encontrarem indivíduos AA. A probabilidade de ocorrência de indivíduos heterozigotos nessa população é a) 84%. nas populações. permanecem constantes. e) 80%. Weinberg postularam que. Aa e aa é. b) 40%. ( ) não ocorram fluxos migratórios. O gene B é responsável pela cor branca e seu alelo recessivo. que se cruza ao acaso. Um agricultor colheu 20. . pela cor amarela. d) 36%. 25% e 25%. b) 60%. d) 30% dos gametas produzidos carregam o alelo recessivo. c) a freqüência de plantas com raízes amarelas será de 64% se a população se mantiver em equilíbrio. em que os casamentos ocorrem ao acaso e a freqüência dos genes A e a é de 50% para cada um. Questão 945 G. b) a freqüência de heterozigotos nessa população é de 24%. H. Questão 942 Numa população em equilíbrio.800 desenvolveram plantas com raízes brancas. das quais 12. respectivamente. é necessário que: ( ) não haja pressão de seleção natural. d) 70%. que surjam por mutação. que podem desaparecer. geração após geração. a freqüência de indivíduos Rh negativos é de 16%. Hardy e W. dos quais 45 apresentam um fenótipo determinado por gene recessivo. ( ) os cruzamentos. A partir dessas informações pode-se afirmar que a) a freqüência do gene para coloração amarela é de 36% nessa população. c) 50%. se 213 1. d) a probabilidade de formação de gametas B é de 80% nessa população. c) 48%. 30% e 30%. e) os heterozigotos representam 42% da população. as freqüências dos alelos. as populações sejam panmíticas. e de cada genótipo. os quais acarretam troca de alelos entre populações diferentes.7 Numa população em equilíbrio. uma vez que esta tende a selecionar determinados alelos em detrimento de outros. sob condições especiais.em equilíbrio de Hardy-Weinberg. Questão 944 A cor da raiz da cenoura é controlada por um par de genes autossômicos. Para que isso ocorra. segundo os referidos autores. c) o gene dominante é mais freqüente que o recessivo. 50% e 25%.

9% nascem com anemia falciforme. Ela não pode estar em equilíbrio de Hardy-Weinberg. é necessário que a) a população seria infinitamente grande. as cores externas das conchas são determinadas por dois alelos de um gene. Questão 946 Numa certa população de africanos. em uma população em equilíbrio genético as freqüências gênicas e genotípicas permanecem constantes ao longo das gerações. b) Somente as afirmativas 1 e 2 são verdadeiras.7. os cruzamentos ocorram ao acaso e esteja sujeita a fatores evolutivos. b) o tamanho da população seja reduzido. tais como mutação. Questão 949 De acordo com a Teoria de Hardy-Weimberg. os cientistas Hardy e Weinberg formularam um teorema cuja importância está no fato dele estabelecer um modelo para o comportamento dos genes nas populações naturais. b) 49/100. A probabilidade de um indivíduo desta população ser heterozigoto Ww é igual a: a) 9/100. é possível que a seleção natural seja a causa do aumento do número de heterozigotos. c) Somente as afirmativas 1 e 3 são verdadeiras. d) a população está evoluindo. seleção natural e migrações. Para tanto. Questão 950 Numa população a freqüência do gene dominante W é 0. c) a população encontra-se em equilíbrio genético. uma vez que as freqüências gênicas foram alteradas. pode-se concluir corretamente que: a) a população estudada é infinitamente grande. os cruzamentos ocorram ao acaso e esteja isenta de fatores evolutivos. Se os valores das freqüências gênicas de uma população. a partir de seu estabelecimento. d) 42/100. sendo a cor azulada determinada por um alelo recessivo e a cor castanha. Em uma população de cem animais.incorporem rapidamente ao estoque gênico. foram encontrados 16 azuis. c) a população seria infinitamente grande. seleção natural e migrações. d) Somente as afirmativas 2 e 4 são verdadeiras. 2. os cruzamentos ocorram de modo preferencial e esteja sujeita a fatores evolutivos. Questão 951 No estudo da genética de populações. Com relação a essa população. na qual p indica a freqüência do alelo dominante e q indica a freqüência do alelo recessivo. e) 1/2. Se houver 30 heterozigotos. ( ) nas populações demasiadamente pequenas. b) não houve a atuação dos fatores evolutivos sobre a população. tais como mutação. ela estará em equilíbrio de Hardy-Weinberg. os cruzamentos ocorram de modo preferencial e esteja isenta de fatores evolutivos. Questão 948 Em mexilhões. observada ao longo de gerações. se houver 76 animais castanhos. 4. seleção natural e migrações. d) a população seja de tamanho reduzido. por um dominante. os cruzamentos sejam ao acaso. forem significativamente diferentes dos valores esperados através da aplicação do teorema. tais como mutação. Se houver 48 heterozigotos. tais como mutação. e) Somente as afirmativas 3 e 4 são verdadeiras. Em 214 . considere as seguintes afirmativas: 1. Qual o percentual da população que possui a vantagem heterozigótica? a) 9% b) 19% c) 42% d) 81% e) 91% Questão 947 Em 1908. Assinale a alternativa correta. utiliza-se a fórmula p£ + 2pq + q£ = 1. seleção natural e migrações. e) os cruzamentos nessa população ocorrem ao acaso. inviabilizando a aplicação do teorema. A endogamia pode ser a causa do desvio em relação ao equilíbrio de Hardy-Weinberg. 3. a) Somente a afirmativa 1 é verdadeira. c) 3/10.

Aa . 1.18. c) os alelos que expressam fenótipos mais adaptativos sejam favorecidos por seleção natural.0.9.01 b) AA .0.81.01 c) AA . produzindo anticorpos contra as proteínas estranhas que serão fabricadas. aa .5. portadores de sangue do tipo N.1 e) AA . serão: a) AA . 1. as freqüências genotípicas esperadas para essa população. e) 42%.0. aa .8.09. Aa .25.0. transferindo as características implantadas para as células-filhas. b) haja manutenção do tamanho da população ao longo das gerações. a freqüência dos indivíduos do grupo MN dessa população é de: a) 79%. aa .18.0. é 0. aa .0. b) morram por ficarem prejudicadas na realização da síntese protéica. c) reproduzam-se. Aa . b) 61%. se estiver em equilíbrio. Verificou-se que existiam. Aa . d) 49%.0. ou dos diferentes genótipos.0.1 215 . d) a somatória da freqüência dos diferentes alelos.25 Questão 953 Os grupos sanguíneos de uma população foram estudados no que se refere ao sistema MN dos seus indivíduos. etc.8. produzindo células defeituosas incapazes de sobreviver. aa .1.1 Questão 955 João ficou intrigado com a grande quantidade de notícias envolvendo DNA: clonagem da ovelha Dolly.09. c) 50%.0. e) ocorra manutenção das mesmas freqüências genotípicas ao longo das gerações. Questão 952 Sabendo-se que a freqüência de um gene recessivo a.5.0.81.25.72. d) reproduzam-se. testes de paternidade.5 e o genótipo homozigoto recessivo tenha freqüência q£=0.25.1 d) AA .0. estudou a estrutura da molécula de DNA e seu funcionamento e analisou os dados do quadro a seguir. Aa . numa população.0.0. Assim. seja igual a 1. engenharia genética. Questão 954 Cientistas conseguiram inserir um grande trecho de ADN estranho ao ADN de cobaias como mostra o desenho a seguir: O resultado esperado para este trabalho é que as células que receberam o implante: a) morram pela presença de ácido nucléico estranho à composição do núcleo. terapia gênica. o genótipo heterozigoto tenha freqüência 2pq=0.0.0.50. numa porcentagem de 9%. Para conseguir entender as notícias.uma população em equilíbrio de Hardy-Weinberg espera-se que a) o genótipo homozigoto dominante tenha freqüência p£=0. e) cresçam.

d) na molécula de DNA. um estudo pioneiro determinou a proporção das bases nitrogenadas que compõem moléculas de DNA de várias espécies.5. o que garante a diversidade da vida. etc.5. b) pares diferentes de acordo com a espécie considerada. podem existir 5 diferentes tipos de bases nitrogenadas. C = 20%. c) RNA. pode-se concluir que: a) a molécula de DNA é formada por 2 cadeias caracterizadas por seqüências de bases nitrogenadas.nalisando-se o DNA de um animal. Observando o quadro. e) no processo de mitose. c) a quantidade de A presente em uma das cadeias é exatamente igual à quantidade de A da cadeia complementar. C = 40%. C = 60%. Relacionando esse valor com o emparelhamento específico das bases. 1. e é formada por cadeias polinucleotídicas que apresentam em sua composição as bases nitrogenadas adenina. G = 10% d) T = 40%.8. citosina e guanina. procariontes e eucariontes. cada molécula de DNA dá origem a 4 moléculas de DNA exatamente iguais. G = 40% b) T = 10%. estudou a estrutura da molécula de DNA e seu funcionamento e analisou os dados do quadro a seguir. Essa substância se denomina a) DNA. b) DNA.1 1. guanina e timina. Para conseguir entender as notícias.1 m I está representado o trecho de uma molécula de DNA. engenharia genética. Questão 957 A identificação da estrutura do DNA foi fundamental para compreender seu papel na continuidade da vida. d) pares específicos apenas nos gametas. terapia gênica. 216 . e é formada por cadeias polipeptídicas que apresentam em sua composição os aminoácidos adenina. b) na molécula de DNA. citosina e guanina.8. pois essas células são responsáveis pela perpetuação das espécies. G = 40% c) T = 10%. comparação das proporções permitiu concluir que ocorre emparelhamento entre as bases nitrogenadas e que elas formam a) pares de mesmo tipo em todas as espécies. evidenciando a universalidade da estrutura do DNA. G = 10% e) T = 40%. citosina. C = 10%. como resultado da diferenciação celular. pois esses organismos são formados por uma única célula. e) pares específicos somente nas bactérias. uracila. Questão 958 As técnicas utilizadas pela Engenharia Genética permitem que se atue em uma substância presente em todas as células. podem existir diferentes tipos de complementação de bases nitrogenadas. sendo responsável pelo controle do seu metabolismo. C = 10%. detectou-se que 40% de suas bases nitrogenadas eram constituídas por Adenina. timina. Na década de 1950. e é formada por cadeias polinucleotídicas que apresentam em sua composição as bases nitrogenadas adenina. os valores encontrados para as outras bases nitrogenadas foram: a) T = 40%. testes de paternidade. c) pares diferentes em diferentes células de uma espécie. G = 60% Questão 956 João ficou intrigado com a grande quantidade de notícias envolvendo DNA: clonagem da ovelha Dolly.

nos organismos eucariontes. Homem Boi 217 . d) expressarem genes diferentes. b) possuírem ribossomos diferentes. d) adenina e timina. c) 400 apresentavam o DNA marcado. células musculares e células nervosas diferem principalmente por: a) possuírem genes diferentes. foram isoladas 100 bactérias e transferidas para um meio sem substâncias radioativas.0 Questão 962 Bactérias foram cultivadas em um meio nutritivo contendo timina radioativa. b) 200 apresentavam o DNA marcado. e) citosina e uracila. por centenas de gerações. b) A molécula de DNA nas bactérias se encontra na carioteca da célula.6 e 29. e) todas apresentavam o DNA e o RNA marcados. Nela identificamos 20% de adenina. c) A molécula de DNA não é capaz de produzir a molécula de RNA. mas não o RNA. respectivamente: a) 19. d) A molécula de DNA tem função de duplicação e é constituída por uma fita dupla. Questão 959 Uma molécula de DNA apresenta uma dupla hélice de cadeias polinucleotídicas. produzindo 800 bactérias.0% As porcentagens que estão faltando para o homem e para o boi são. adenina e guanina.4% ? Guanina ? 21. d) 200 apresentavam o DNA e o RNA marcados. c) citosina e guanina. novos métodos de diagnóstico foram desenvolvidos e utilizados para inúmeros fins (identificação de microrganismos patogênicos. nos DNAs do homem e do boi. Dessa cultura. a) A molécula de DNA é constituída por uma fita única e por vários nucleotídeos que têm a transcrição como principal função. testes de paternidade. e é formada por aminoácidos que apresentam em sua composição a ribose. mas não o RNA. mapa genético. Questão 964 Um pesquisador que pretende estudar comparativamente a síntese de DNA e RNA em uma célula deve usar nucleotídios radiativos contendo a) timina e uracila.0 e 30. Assinale a alternativa correta em relação à porcentagem de guanina. e) A molécula de DNA.d) polimerase. b) guanina e timina. Essas bactérias sofreram três divisões no novo meio.4 e 21. medicina forense. a) 20% b) 30% c) 40% d) 50% e) 60% Questão 960 Depois da descoberta da estrutura da molécula do Ácido Desoxirribonucléico (DNA ou ADN).0 b) 21. mas não o RNA.4 d) 19. e é formada por aminoácidos que apresentam em sua composição a desoxirribose.4 c) 29. e) utilizarem código genético diferente. e) transcriptase. Questão 963 Em um organismo. Adenina 30.0 e 30. entre outros). c) possuírem cromossomos diferentes. A análise dos ácidos nucléicos mostrou que dessas 800 bactérias a) 100 apresentavam o DNA marcado.6 e 21. Assinale a afirmação correta. Questão 961 A tabela mostra a composição das bases nitrogenadas púricas. sendo que cada filamento é composto por vários nucleotídeos.0 e) 30. não se encontra no núcleo da célula.

O fato nos permite afirmar que os nucleotídeos a) ocorrem em igual quantidade. ácido fosfórico e base nitrogenada. e) ligam-se como se fossem o corrimão de uma escada.1 Questão 967 Numa molécula de DNA. Questão 970 Sobre o DNA. a quantidade de a) adenina é igual a de citosina. d) é integrante dos genes e dos cromossomos. é CORRETO afirmar que a) possui a base nitrogenada uracila. Questão 972 O DNA e o RNA quanto à sua estrutura química. e) é formado de dupla cadeia com formato helicoidal. b) nucleoproteínas. e) ácido fosfórico. desoxirribose e base nitrogenada. d) é integrante do nucléolo e dos ribossomos. c) guanina é igual a de citosina. b) origina o RNA mensageiro c) reproduz-se de modo semiconservativo. b) ligações iônicas.Questão 965 Importante informação que permitiu o estabelecimento de um modelo para a molécula de DNA foi a verificação de que o número de adenina-nucleotídeos era sempre igual ao de timina-nucleotídeos. b) uracila é uma base nitrogenada exclusiva do DNA. ácido fosfórico e base nitrogenada.8.5. 218 1. c) polissacarídeos. b) não origina o RNA mensageiro c) não é capaz de replicar-se. ribose e base nitrogenada. . é INCORRETO afirmar que a) possui a base nitrogenada uracila. b) ocorrem aos pares na molécula de DNA. d) citosina é igual a de adenina. e) timina pareia com adenina no RNA. d) pirimídicos pareiam com outros pirimídicos. o mesmo ocorrendo com a guanina e citosina-nucleotídeos. c) ribose é um açúcar que entra na composição química do RNA. c) púricos pareiam com outros púricos. Questão 966 Na figura a seguir que representa o modelo da molécula de DNA os números 1. b) citosina é igual a de timina. c) pontes de hidrogênio. e) ligação metálica. e) é formado de dupla cadeia com formato helicoidal. Questão 969 Moléculas de DNA constituídas por duplo filamento helicoidal mantêm as cadeias unidas entre si por a) ligações covalentes. base nitrogenada e desoxirribose. Questão 968 Comparando as estruturas dos ácidos nucléicos desoxirribonucléico (DNA) e ribonucléico (RNA) pode-se afirmar que a) timina é uma base nitrogenada exclusiva do RNA. 2 e 3 indicam. d) ácido fosfórico. b) ácido fosfórico. são classificados como a) polipeptídeos. d) ácido fosfórico só entra na composição química do DNA. d) pontes de nitrogênio. c) ribose. respectivamente a) desoxirribose. e) adenina é igual a de uracila. Questão 971 Sobre o DNA.

ribose e base nitrogenada. 2 e 3. d) Uracila. d) AAT GGC TAA UAC. c) Ácido fosfórico. e) timina pareia com adenina no DNA. Questão 976 Observa-se a presença de DNA nos seguintes organóides citoplasmáticos a) mitocôndria e ribossomo. b) UUT GGC TUU UAC. Questão 975 Se um segmento de DNA possui a seqüência de bases nitrogenadas TTA CCG ATT ATG. b) ácido fosfórico. c) desoxirribose.5. d) ácido fosfórico. ribose e ácido fosfórico. desoxirribose e base nitrogenada.8. c) ribose é um açúcar que entra na composição química do RNA. b) Desoxirribose. b) Citosina. Questão 978 Comparando as estruturas dos ácidos desoxirribonucléico (DNA) e ribonucléico (RNA) NÃO se pode afirmar que a) timina é uma base nitrogenada exclusiva do DNA. Questão 977 Na molécula de DNA. desoxirribose e ácido fosfórico. e) base nitrogenada.1 219 . c) guanina é igual a de adenina. respectivamente. sabendo-se que a figura adiante representa a unidade estrutural do ácido desoxirribonucléico (DNA). e) Guanina. b) uracila é uma base nitrogenada exclusiva do DNA. a) base nitrogenada. d) citosina é igual a de adenina. e) Guanina. Questão 973 Qual das seguintes bases nitrogenadas NÃO entra na composição química do DNA? a) Timina.d) fosfatídeos. d) Adenina. d) ácido fosfórico entra na composição química do DNA e do RNA. c) Adenina. pode-se afirmar que a cadeia complementar a esse segmento terá a seqüência a) AAT GGC TAA TAC. Questão 974 Qual das seguintes moléculas NÃO entra na composição química do DNA? a) Ribose. d) lisossomo e ribossomo. a quantidade de a) adenina é igual a de citosina. e) mitocôndria e cloroplasto. e) AAU GGC UAA UAC. c) TTA CCG ATT ATG. Questão 979 Assinale a alternativa que relaciona corretamente o nome das moléculas representadas pelos números 1. 1. b) ribossomo e cromossomo. base nitrogenada e ácido fosfórico. c) nucléolo e cloroplasto. e) polinucleotídeos. e) adenina é igual a de timina. b) citosina é igual a de timina.

b) cloroplastos. Questão 985 Assinale a alternativa que relaciona as estruturas celulares em se observa a presença de DNA: a) membrana plasmática. e) guanina é igual a de citosina. Citosina = 40% e Timina = 40% e) Adenina = 40%. Assinale a alternativa que contém a porcentagem correta de cada uma das demais bases nitrogenadas. c) ausência de ácido fosfórico. b) protozoários. d) enzimas. Assinale a alternativa que relaciona corretamente as outras bases nitrogenadas e suas respectivas proporções? a) Guanina = 16%. guanina. Timina = 34% e Adenina = 16% Questão 984 Numa molécula de DNA formada por uma dupla-hélice a quantidade de a) adenina é igual a de citosina. d) membrana plasmática. Watson e F. Citosina = 30% e Timina = 30% d) Adenina = 30%. Timina = 16% e Adenina = 16% d) Guanina = 34%. mitocôndrias e cromossomos. Questão 982 Uma molécula de DNA contém 15% de Guanina. b) centríolos. e) bactérias. c) ácaros. Adenina = 15% e Timina = 15% c) Citosina = 15%. d) liquens. Timina = 16% e Adenina = 16% b) Guanina = 16%. centríolos e cromossomos. e) ocorre nos cromossomos. d) cloroplastos. Segundo esse modelo esses ácidos são a) micromoléculas. e) lisossomos. Citosina = 30% e Timina = 20% c) Adenina = 30%. citosina e adenina. Assinale a alternativa que relaciona corretamente as outras bases nitrogenadas e suas respectivas proporções: a) Citosina = 15%. Adenina = 35% e Timina = 15% d) Citosina = 15%. cromossomos e lisossomos. centríolos e lisossomos. d) citosina é igual a de adenina. Questão 987 As evidências de que o DNA é a substância hereditária que determina as características dos seres vivos foram primeiramente observadas em a) vírus. ribossomos e centríolos. a) Adenina = 20%. c) polinucleotídeos. Adenina = 35% e Timina = 35% e) Citosina = 15%. ribossomos e cromossomos. Timina = 34% e Adenina = 16% e) Guanina = 34%. Adenina = 15% e Timina = 15% b) Citosina = 35%. Questão 988 Num dado organismo. Crick em 1953. e) vacúolos. b) presença das bases nitrogenadas uracila. c) adenina é igual a de uracila. Adenina = 15% e Timina = 35% Questão 983 Uma molécula de DNA contém 16% de Citosina. cromossomos e mitocôndrias. d) ser um polipeptídeo.Questão 980 O modelo molecular dos ácidos nucléicos (DNA e RNA) foi proposto por J. Citosina = 30% e Timina = 40% 220 . b) citosina é igual a de timina. e) lipídios. Questão 981 É característica do DNA: a) açúcar com quatro átomos de carbono. complexo de Golgi e cromossomos. c) ribossomos. o conteúdo de guanina no seu DNA é 30%. b) polipeptídeos. complexo de Golgi e ribossomos Questão 986 Sabemos que os genes são constituídos de DNA e estão localizados nas seguintes estruturas celulares: a) lisossomos. Citosina = 20% e Timina = 30% b) Adenina = 20%. cromossomos e complexo de Golgi. Timina = 34% e Adenina = 34% c) Guanina = 34%. c) retículo endoplasmático.

d) inversão. obtido de um dos cromossomos X de cada mulher e da menina. II. e) deleção. III e IV. Síntese protéica São características do ácido desoxirribonucléico (DNA): 1. somente. somente. de uma mesma célula. É constituído por uma única cadeia de nucleotídeos. verifica-se que a) ocorre lise da bactéria no fim do ciclo. Seu açúcar é a desoxirribose. III e IV.Questão 989 O esquema a seguir mostra um tipo de ciclo reprodutivo dos bacteriófagos.b e acordo com o esquema. Possui capacidade de autoduplicação. III.1 221 . Questão 991 Os itens abaixo se referem aos ácidos nucléicos: Estrutura I. e) I. b) duplicação. porém com os segmentos trocados. IV. São corretas a) II e III. Uma de suas bases nitrogenadas é a timina. c) translocação. Foi realizada a análise de um mesmo trecho do DNA. III e IV.1 .8.a d) II .1 . Questão 990 Considere as características do DNA abaixo discriminadas. I. somente.5. Questão 993 Duas mulheres disputam a maternidade de uma menina. As seqüências de bases do referido trecho gênico estão esquematizadas adiante: 1. c) I.a c) II .2 . e) há grande multiplicação do DNA viral no interior da bactéria.5. 1.8. quebram-se e voltam a se soldar. Com Timina 2. d) as bactérias perdem a capacidade de se dividir. Transcrição b. II. b) II e IV.a e) I . c) o DNA viral é destruído pela bactéria. somente. Dupla hélice Composição Questão 992 Supondo que ocorra um evento genético raro em que dois cromossomos não-homólogos.b b) I . Cadeia simples II.1 a) II . estaríamos verificando a ocorrência de a) crossing-over.1 .2 . Com Uracila Função a. d) II. b) o DNA viral se incorpora ao cromossomo bacteriano.

a enzima DNA polimerase e DNA. b) Os nucleotídeos contendo as bases nitrogenadas timina. e) 10 adeninas. no segmento correspondente da cadeia complementar há 10 adeninas e 30 guaninas. as moléculas de DNA e RNA diferem entre si quanto ao tipo de a) açúcar. 10/08/97) Sabe-se que o citado mapeamento é feito a partir do conhecimento da seqüência de bases do DNA. e) não podem ser considerados. apenas. a) Quatro diferentes tipos de nucleotídeos. pois uma menina não recebe cromossomo X de sua mãe. c) em todos os organismos. b) 20 timinas. Questão 997 TESTES GENÉTICOS: A Ciência se antecipa à doença Com o avanço no mapeamento de 100 mil genes dos 23 pares de cromossomos do núcleo da célula (projeto Genoma.). conclui-se que nos segmentos de RNA originários desse DNA haverá a) 30 citosinas. b) são suficientes para excluir a possibilidade de uma das mulheres ser a mãe da menina. corretamente. apenas. c) As enzimas RNA e DNA polimerase. timina. em um laboratório. pois o cromossomo X da menina analisado pode ser o de origem paterna. DNA e RNA. e) As enzimas RNA e DNA polimerase. b) as moléculas do ácido ribonucléico (RNA) são hélices duplas de polirribonucleotídeos. nos EUA). c) 15 guaninas. c) base nitrogenada e de açúcar. apenas. tentando reproduzir "in vitro" a síntese de moléculas de DNA.5. Questão 995 Em um segmento de cadeia ativa de DNA há 20 adeninas e 15 guaninas. os três tipos de RNA (mensageiro. vinte tipos diferentes de aminoácidos. Com base nesses dados. d) base nitrogenada e de fosfato. citosina e guanina.1 Questão 998 Tendo em vista a estrutura e a função dos ácidos nucléicos. só existe um gene para cada molécula de DNA. Questão 996 Considere que um cientista esteja. O esquema abaixo que representa o pareamento típicos de bases encontradas na molécula de DNA. as moléculas imprescindíveis que ele deve utilizar para que possa atingir o seu objetivo. transportador e ribossômico) e DNA. apenas. é: 1. guanina.8. Questão 994 Com relação à composição química. RNA mensageiro e DNA. d) as estruturas espaciais e moleculares do DNA e RNA são 222 . (O GLOBO.. a enzima RNA polimerase. adenina e citosina. pois a menina recebe seus dois cromossomos X da mãe e apenas um deles foi analisado. é correto afirmar que: a) todas as trincas da molécula do mRNA especificam algum aminoácido. e) base nitrogenada. os vinte tipos diferentes de aminoácidos.Os dados obtidos a) são suficientes para excluir a possibilidade de qualquer uma das mulheres ser a mãe da menina. assinale a alternativa que indica. d) 10 uracilas. DNA e RNA. contendo as bases nitrogenadas adenina. d) A enzima DNA polimerase. c) não são suficientes. d) não são suficientes. b) base nitrogenada. já é possível detectar por meio de exames de DNA (ácido desoxirribonucleico) a probabilidade de uma pessoa desenvolver doenças (.. iniciado em 1990. de açúcar e de fosfato. Com base nos conhecimentos sobre o tema.

d) Tecidos a que pertencem.000 genes. A quantidade e a relação entre as bases das amostras estão apresentadas nesta tabela: 1. Considerando-se essa informação e conhecimento sobre o assunto. c) os genes cuja atividade não é necessária ao funcionamento de uma célula perdem a capacidade de duplicação. A inferência vem diretamente do DNA do mamute-lanoso ('Mammuthus primigenius'). é possível afirmar corretamente que: a) seus genes estavam dispostos em cromossomos circulares.5. de exemplares mortos há 43 mil anos na Sibéria.1 odas as alternativas apresentam diferenças entre essas células. é CORRETO afirmar que a) o genótipo das células do tecido nervoso é diferente do genótipo das células do tecido epitelial. b) o número total de genes. c) Genes que possuem. Questão 1002 Um laboratório recebeu três amostras de DNA para investigar se pertenciam a espécies diferentes. c) seus genes estavam organizados nos plasmídeos.8. que. "Folha de São Paulo".5. O mamífero-símbolo da Idade do Gelo provavelmente tinha dois tipos de pelagem: castanho-escuro e loiro. Questão 999 Leia o texto a seguir.diferentes. codificam proteínas. mas são incapazes de se expressar.1 223 . Mamutes podem ter tido pêlo "loiro". ribose e fosfato. sugere análise de DNA. d) suas moléculas de DNA apresentavam estrutura helicoidal. Em relação às características genéticas deste mamífero. e) seus genes para o tipo de pelagem localizavam-se no DNA mitocondrial. b) Funções que realizam. reduz-se. d) os genes responsáveis pelo sistema sangüíneo ABO estão presentes nas células epiteliais. 07/07/2006. Questão 1001 Células provenientes de um indivíduo foram examinadas ao microscópio e revelaram diferenças estruturais.8. b) seu DNA era composto por bases nitrogenadas. entre outras funções. e) as duas metades da hélice dupla do DNA têm seqüências iguais de bases nitrogenadas. Questão 1000 Sabe-se que o homem possui em torno de 80. que podem ser observadas nestas representações esquemáticas: 1. É uma das primeiras vezes em que os genes de um bicho extinto dão pistas sobre características suas em vida. EXCETO a) Forma ou localização dos seus núcleos. após a diferenciação e a especialização das células.

inicialmente. ( ) a tendência da fita de DNA pesada é desaparecer no decorrer das gerações.5% terão a densidade intermediária em F3. ( ) eles concluíram.4 % Guanina = ? Cão: Adenina = ? Guanina = 21. é INCORRETO afirmar que a) as três amostras são provenientes de diferentes espécies. conforme esquematizado abaixo.F2 e F3). c) a amostra 2 apresenta DNA de fita simples.5. Questão 1004 Meselson e Stahl.6 e21.8. em 1957.1 A partir desse experimento pode-se afirmar que: ( ) todas as moléculas da geração F1 terão a densidade intermediária entre a pesada e a leve. 1. b) 21.0 % As percentagens que estão faltando para o homem e cão são. cresceram diversas gerações das bactérias em N¢¥ (isótopo leve) e extraíram o DNA das sucessivas gerações (gerações F0. ( ) metade das moléculas da geração F2 terão a densidade leve e apenas 12.0. analise as proposições a seguir. b) a amostra 3 possui o mais alto conteúdo de pares de bases A e T.0. d) as amostras 1 e 3 apresentam alta homologia entre seus DNAs. ( ) A composição do meio de cultura não exerceu influência no experimento uma vez que a bactéria cresceu em todos os meios. Questão 1003 A composição das bases púricas adenina e guanina do DNA do homem e do cão são as seguintes: Homem: Adenina = 30.8.4 e 21. F1 .5.0 e 30. mediante precipitação baseada em suas diferentes densidades.om base nas informações dessa tabela e em outros conhecimentos sobre o assunto. e) 30.0 e 30.4.1 224 .4.0. 1. como foi antecipado por Watson e Crick. Questão 1005 Considerando que na figura a seguir tem-se uma representação plana de um segmento da molécula de DNA. que as fitas de DNA serviam de modelo para sua própria replicação. cultivaram. 'Escherichia coli' (geração F0) na presença de N¢¦ (isótopo pesado).6 e 29. Posteriormente. c) 29. d) 19. respectivamente: a) 19.

cerca de 1/4 do DNA será híbrido. cada molécula híbrida de DNA formará duas moléculas. que são aqueles em cujo genoma foi introduzido um gene de uma outra espécie ou mesmo um gene produzido em laboratório. d) ao final da 2 geração. sendo o restante não-híbrido. Rio de Janeiro: Guanabara Koogan. 2. 2 e 3 apenas d) 2. Posteriormente. a) ao final da 1 geração. 3 e 4 Questão 1006 Na figura a seguir é ilustrado um processo muito importante para a vida.) Um nucleotídeo é formado por um grupo fosfato (I).) Com a capacidade de mover genes de um organismo para outro. e camundongos gigante que expressam os genes do hormônio de crescimento de ratos.F. 3 e 4 apenas e) 1. Está(ão) correta(s). essas bactérias foram transferidas para um novo meio. para cultivo. os cientistas produziram plantas que brilham porque expressam os genes de bioluminescência dos vaga-lumes.J. de plantas transgênicas.5. 3) Um nucleotídeo com Guanina (G) em uma cadeia pareia com um nucleotídeo com Citosina (C) em outra cadeia. e) Um gene é uma cadeia de aminoácidos que codifica o código genético. 4) Pontes de hidrogênio se estabelecem entre as bases nitrogenadas T e A e entre as bases nitrogenadas C e G. 6 ed. Assinale a alternativa que define o que é um gene. Questão 1008 Gerações sucessivas de bactérias da espécie 'Escherichia coli' foram cultivadas num meio cuja única fonte de nitrogênio era o isótopo ¢¦N. c) ao término da 2 geração. b) ao término da 1 geração.1 a) Produção de proteína b) Transcrição do RNA c) Produção de RNAribossômico d) Helicoidização do DNA e) Replicação do DNA Questão 1007 Um tema que vem despertando grande polêmica no Brasil atualmente é a liberação. et al. Em relação ao experimento.. A. c) Um gene é uma proteína que tem função específica em uma determinada rota metabólica. b) Um gene é um segmento do DNA que contém a informação necessária para a produção de uma determinada proteína. 2) Um nucleotídeo com Timina (T) em uma cadeia pareia com um nucleotídeo com Adenina (A) em outra cadeia." (Griffiths. "Introdução à Genética". sendo uma híbrida e outra não. 1998) O texto acima se refere a organismos transgênicos. onde existia o ¢¥N como única forma de nitrogênio. mas hoje as mesmas técnicas estão . Analise-o e assinale a alternativa que indica corretamente qual é este processo. 225 1. serão formadas moléculas de DNA apenas com ¢¦N e moléculas apenas com ¢¥N. a) 1 apenas b) 2 e 3 apenas c) 1. "A biotecnologia de genética molecular foi inicialmente aplicada a micróbios. a) Um gene é um cromossomo da célula vegetal ou animal.. nesse novo meio. uma molécula do açúcar desoxirribose (II) e uma molécula de base nitrogenada. plantas que adquirem resistência ao frio por expressar genes anticongelantes de peixes. (. d) Um gene é uma molécula de RNA que atua diretamente na síntese protéica. todas as moléculas de DNA apresentarão apenas ¢¥N incorporado. resultando em tipos criados que nunca poderiam ter sido produzidos com a genética clássica. o qual se incorporou nas moléculas de DNA. pode-se prever que. sendo aplicadas a plantas e animais. A obtenção dessas plantas se deve à biotecnologia.8.

e) I. acerca do referido ácido nucléico. fizeram um experimento sobre a replicação do DNA. Questão 1012 Desde que Watson e Crick propuseram um modelo para a estrutura do DNA. F. transcrição.2 . II .1 .2 . Considere as seguintes afirmações. em 1957. a cada códon deve corresponder mais de um aminoácido. sendo observado o seguinte: I . ( ) bases nitrogenadas: adenina.2 . guanina. ele comparou 21 genomas completos de representantes das três linhagens primárias da vida: as eubactérias. b) 2 .2. ¢¦N. Questão 1011 Numere a 2 coluna de acordo com a 1 COLUNA 1 1. sim. O resultado da pesquisa mostrou que o número de genes deve situar-se em torno de 150. Adaptado de SALZANO.1 .Questão 1009 Meselson e Stahl. "Ciência Hoje". As moléculas de DNA das bactérias foram então isoladas e analisadas com relação ao seu conteúdo de ¢¦N e de ¢¥N. uracila A seqüência correta é a) 1 .Os genes compartilhados pelos genomas dos diferentes grupos devem ser essenciais. d) não ocorreu replicação do DNA mas. podemos concluir que a) a replicação do DNA é semiconservativa.2 . guanina. em meio contendo um isótopo pesado de nitrogênio. e) não ocorreu replicação do DNA mas.8. tem-se constatado um progresso fantasticamente acelerado da Biologia Molecular.M. Depois disso. Para isso. Nesse experimento. 173. e) 1 . sim. II e III.2 . ¢¥N. A entrada na era da genômica possibilitou ao norte-americano Eugene V.2 .2. do que é exemplo a recente clonagem de uma ovelha. Julgue os itens a seguir. 226 . n. Esse enfoque é interessante.RNA COLUNA 2 ( ) dupla hélice ( ) ribose ( ) fita única ou simples ( ) desoxirribose ( ) bases nitrogenadas: adenina. por muitas gerações.2 . b) a replicação do DNA é conservativa. v. 1.1 . c) Apenas III.5.2 .1 . citosina.1 .1 . Questão 1010 Leia o texto abaixo.2 . jul. b) Apenas II. as arqueobactérias e os eucariontes.1. até todo o seu DNA estar marcado com esse isótopo.1. d) 2 .1 Com relação a esses dados. c) a replicação do DNA é randômica. c) 1 .Os genes envolvidos na replicação. Koonin investigar qual seria o número mínimo de genes capazes de sustentar o funcionamento de uma célula.1 . timina.2 . III .1 .2.DNA 2. pois permite imaginar os primeiros sistemas genéticos surgidos por ocasião da origem da vida. transcrição e tradução do material genético devem fazer parte do conjunto mínimo de genes. d) Apenas II e III.2 . as bactérias foram transferidas para um meio contendo nitrogênio leve. Quais delas poderiam ter embasado o raciocínio de Koonin? a) Apenas I.No código genético. a bactéria 'Escherichia coli' foi cultivada. 29. 2001. citosina. uma mutação.1 . em 1953.

à 2 lei de Mendel. o carbono não faz parte da estrutura do DNA. Na meiose I. III e V. III. Questão 1014 No artigo "Retrato molecular do Brasil" ("Ciência Hoje". Na meiose I. um segmento de DNA que corresponde a um gene funcional. e) X e mitocondrial. Analise cada uma das afirmações seguintes. citosina e adenina. d) I. apenas. apenas. I. II. a mãe transmite maior quantidade de DNA para o filho do que o pai. d) Y e mitocondrial. em efeito. a segregação dos homólogos de um par cromossômico corresponde. em efeito. II. IV e V. no mínimo. ocorre a troca de. Questão 1013 A partir dos anos 1900. (5) Nos processos de fecundação natural. b) Y e de autossomos. à 2 lei de Mendel. a segregação das cromátides dos diferentes pares cromossômicos corresponde. revelou que a contribuição dos europeus na composição genética do povo brasileiro fez-se basicamente por meio de indivíduos do sexo masculino. uma série de observações e experimentos indicaram uma correlação entre o comportamento dos cromossomos na célula em divisão e as leis mendelianas. Sérgio Penna. IV. III.(1) Apesar de ser o sexto elemento mais abundante no universo e o mais versátil de todos. (4) As mutações gênicas implicam necessariamente a modificação do fenótipo do indivíduo. Na meiose II. V. apenas. e) II e V. e) ocorre nos cromossomos. (2) A coloração de cromossomos com vários matizes é uma técnica atual que se baseia no uso de vários corantes para os diferentes lipídios que constituem os cromossomos. São afirmações corretas: a) I. b) I. c) a presença de ácido fosfórico. do DNA do cromossomo a) X e de autossomos. a segregação dos homólogos dos diferentes pares cromossômicos correspondem. II. guanina. c) Y e do cromossomo X. pesquisador da Universidade Federal de Minas Gerais. 2001). IV e V. à 1 lei de Mendel. d) é polinucleotídeo. a segregação de cromossomos homólogos que apresentam os mesmos alelos resulta nas proporções da geração F2 dos experimentos de Mendel. II e IV. respectivamente. b) a presença das bases nitrogenadas uracila. Questão 1016 O estudo do mecanismo da síntese de proteínas no interior das células confirma que: a) a transcrição gênica caracteriza-se pela autoduplicação do DNA b) três tipos de RNA participam do processo c) os anticódons localizam-se no RNA-m d) os códons são trincas de bases nitrogenadas do RNA-t e) não há evidências que permitam aceitar que o código genético seja considerado degenerado Questão 1017 Uma molécula de RNA mensageiro apresenta a seguinte seqüência de bases nitrogenadas: UUU GUG CCC AAC Assinale a alternativa que contém a seqüência de bases do segmento da molécula de DNA que deu origem a esse 227 . c) I. em efeito. Genes localizados em regiões próximas de um mesmo cromossomo implicam em distorções das proporções mendelianas. enquanto a contribuição genética de povos indígenas e africanos deu-se por meio das mulheres. (3) No processo de recombinação entre cromátides. Questão 1015 Não é característica do DNA: a) o açúcar com cinco átomos de carbono. apenas. II. Na meiose I. Tais conclusões são possíveis com base em estudos moleculares.

d) Uracila. é INCORRETO afirmar que a) possui a base nitrogenada uracila. d) Adenina. e) ácido fosfórico. b) Desoxirribose. c) ribose.2 1. ácido fosfórico e base nitrogenada. d) ácido fosfórico. a) AAA CAC GGG TTG b) TTT CAC GGG UUG c) AAA CTC GGG TTG d) TTT GAG GGG TTG e) AAA CAC CCC UUG Questão 1018 Na figura a seguir que representa o modelo da molécula de RNA os números 1. e) é formado de simples cadeia com formato helicoidal. c) Ácido fosfórico. b) Citosina. e) Guanina. Assinale a alternativa que contém a seqüência de bases do segmento da molécula de DNA que deu origem a esse RNA. d) é traduzido em proteínas nos ribossomos. c) ribose. Questão 1022 No modelo molecular do ácido ribonucléico (RNA) representado adiante. d) ácido fosfórico. 2 e 3 indicam.8.8. os números 1. e) Guanina. b) participa da estrutura dos ribossomos.2 Questão 1019 Sobre o RNA. . ribose e base nitrogenada. desoxirribose e base nitrogenada. b) ácido fosfórico. ribose e base nitrogenada. Questão 1020 Qual das seguintes bases nitrogenadas NÃO entra na composição química do RNA? a) Timina. 1. base nitrogenada e desoxirribose. ácido fosfórico e base nitrogenada. Questão 1021 Qual das seguintes moléculas NÃO entra na composição química do RNA? a) Ribose. ácido fosfórico e base nitrogenada. respectivamente a) desoxirribose. a) AAA CAC GGG TTA b) TTT CAC GGG UUT c) AAA CTC GGG TTT d) TTT GAG GGG TTA e) AAA CAC CCC UUA 228 Questão 1023 Uma molécula de RNA mensageiro apresenta a seguinte seqüência de bases nitrogenadas: UUU GUG CCC AAU. c) Adenina. e) ácido fosfórico. b) ácido fosfórico.5. base nitrogenada e desoxirribose.5. c) reproduz-se de modo semiconservativo. desoxirribose e base nitrogenada. 2 e 3 indicam. ácido fosfórico e base nitrogenada. respectivamente: a) desoxirribose.RNA.

b) sapo.Leu .Val . d) ser um polipeptídeo.Arg .1 .Val .1 . interessado em produzir em tubo de ensaio uma proteína.Função: a. e) ocorrer nos lisossomos.Cis .Arg . As informações armazenadas nas moléculas de DNA são traduzidas em proteínas por meio de moléculas intermediárias denominadas: a) Proteases.5. A proteína produzida teria uma seqüência de aminoácidos idêntica à do a) rato. guanina. síntese de proteínas b. RNA mensageiro de células de macaco. b) presença das bases nitrogenadas uracila.2 .b c) II .Estrutura: I. Questão 1025 Os itens a seguir referem-se à estrutura.2 .Arg .Composição: 1. e) macaco e do rato.Ile b) Leu .Leu Questão 1029 Sobre o código genético são feitas as seguintes afirmações: I .Leu . RNA transportador de células de coelho e aminoácidos ativos de células de sapo.Leu e) Val . 229 . e) mRNA. presença de uracila 2.Val .3 e um RNA mensageiro apresenta a seqüência de bases AUU AGA UGU GUU UUA.a b) I . d) tRNA. Questão 1027 Um pesquisador.pode existir mais de um códon para determinar um mesmo aminoácido. c) coelho. utilizou ribossomos de células de rato. dupla hélice II. citosina e adenina. a biologia molecular tem fornecido ferramentas úteis para a produção de plantas e animais transgênicos.Ile . a seqüência de aminoácidos no polipeptídeo correspondente será. d) macaco.Ile c) Arg .Arg .a d) II .b Questão 1026 Nos últimos anos. de acordo com a tabela anterior: a) Cis .1 . b) Plasmídios. c) ausência de ácido fosfórico.Cis . Questão 1028 A tabela a seguir mostra alguns aminoácidos e as trincas de bases no DNA que os identificam: 1.Val .Cis d) Ile .Questão 1024 É característica do RNA: a) açúcar com quatro átomos de carbono. c) rRNA.Ile . nas mesmas condições em que essa síntese ocorre nas células.Cis .8. cadeia simples .em todos os seres vivos os códons que codificam um respectivo aminoácido são os mesmos. presença de timina . transcrição gênica São características do ácido ribonucléico a) I . II . . composição e função dos ácidos nucléicos.b e) II .

indica a interrupção da tradução.CCG . c) é o mesmo nos indivíduos de uma mesma espécie. É correto afirmar que o código genético a) varia entre os tecidos do corpo de um indivíduo.cisteína . Assinale a alternativa que apresenta a possível seqüência de códons para a formação do seguinte tetrapeptídeo: GLU .III .LEU a) GUU .tirosina . tirosina.3 1. Questão 1032 Considere a seguinte tabela que indica seqüências de bases do RNA mensageiro e os aminoácidos por elas codificados. o códon UAG é terminal. Questão 1034 Os códons UGC. b) é o mesmo em todas as células de um indivíduo. c) Fenilalanina. prolina. lisina.alanina. d) I. e) GUU .a tradução da seqüência de bases do RNA para a proteína é feita. cuja seqüência de bases é AAGTTTGGT. respectivamente os aminoácidos cisteína. Questão 1030 A tabela a seguir relaciona trincas de bases do DNA aos aminoácidos correspondentes. prolina. a nível citoplasmático. lisina. II e III.GGA . Está(ão) correta(s) afirmativa(s): a) II apenas.TTT . d) permite distinguir procariotos de eucariotos. valina. leucina. prolina. Questão 1031 Um gene de bactéria com 600 pares de bases nitrogenadas produzirá uma cadeia polipeptídica com número de aminoácidos aproximadamente igual a a) 200 b) 300 c) 600 d) 1200 e) 1800 Questão 1033 O código genético é o conjunto de todas as trincas possíveis de bases nitrogenadas (códons). sofreu a perda da 9 base nitrogenada. mas varia de indivíduo para indivíduo.UUU . d) Fenilalanina. Um fragmento de DNA.GGC . lisina. d) GAA . b) III apenas. e) I e III apenas. alanina e serina.GGU .UUU .5.8. c) CTT . lisina. A seqüência de códons do RNA mensageiro determina a seqüência de aminoácidos da proteína. c) I e II apenas.UUG.UUU .GGC .AAA . b) GAA . e) Valina.8.GLI . Assinale a 230 .CTC. GCC e AGC codificam. nos ribossomos. qual seria a seqüência de aminoácidos codificada? 1. valina.CUC.5.3 a) Aspargina. que codifica a seqüência serina .AAC.CUC. Com base na tabela fornecida e considerando um segmento hipotético de DNA.FEN . UAU. ou seja. e) é praticamente o mesmo em todas as formas de vida. mas varia de espécie para espécie. b) Aspargina.

Indique a alternativa ERRADA relativa ao código genético e à síntese de proteínas: a) Os genes são formados por ácido desoxirribonucleico e controlam a produção de proteínas da célula. mas. que compreende o trabalho do RNA de organização dos aminoácidos na seqüência determinada pelo código genético. que visa decifrar e mapear o código genético humano. resultando numa molécula com 3 aminoácidos. c) Duas grandes etapas estão envolvidas na síntese das proteínas: a transcrição. guanina. b) O aminoácido tirosina não será traduzido. a) Na molécula de DNA. 1. d) A mutação constitui uma alteração na seqüência de bases nitrogenadas de um segmento de DNA e pode ser provocada por radiações. pois essa molécula de DNA alterada não é capaz de comandar esse processo. 231 . que compreende a passagem do código genético do DNA para o RNA. a) O aminoácido tirosina será substituído por outro aminoácido. b) Todas as células do corpo têm a mesma coleção de genes. e) A seqüência não sofrerá prejuízo. Questão 1036 Em 1987. encontramos células com formas e funções diferentes. e) Todas as células do corpo têm a mesma coleção de genes.5. citosina.alternativa que descreve o que acontecerá com a seqüência de aminoácidos. apesar disto. foi oficialmente fundado o Projeto Genoma. c) A mutação é uma alteração do código genético de um organismo e pode ser provocada por radiações ou substâncias químicas. Este processo chama-se diferenciação celular. pois qualquer modificação na fita de DNA é imediatamente corrigida.3 ssinale a alternativa que contém a seqüência de códons do RNA mensageiro que participou dessa tradução. b) Os ácidos nucléicos podem aparecer livres na célula ou podem estar associados a proteínas. por raios-X. por raios cósmicos. d) A tradução será interrompida no 2Ž aminoácido. e a tradução. c) A seqüência não será traduzida. a) UUU CGT TTG UGC GUC b) UUU CGA AAG UGC GUC c) TTT CGT TTC TGC GTC d) TTT CGA AAG TGC GTC e) CCC TAC CCA CAT ACT Questão 1038 O quadro a seguir contém um segmento de DNA. os códons e os anticódons correspondentes. encontramos células com formas e funções diferentes. timina e uracil. e) A Engenharia Genética. pode corrigir defeitos no código genético de um organismo. Questão 1035 Com relação ao código genético e à síntese de proteínas. apesar disso. mas. que é uma técnica de manipulação dos genes.8. ou mesmo por exposição aos raios ultravioleta do sol. nem as suas características. assinale a afirmativa FALSA. encontramos sempre desoxirribose e cinco tipos de bases: adenina. d) As mudanças na programação genética de um organismo não alteram a produção de proteínas. Questão 1037 O esquema a seguir representa a seqüência de aminoácidos de um trecho de uma proteína e os respectivos anticódons dos RNA transportadores. compondo os cromossomos e ribossomos na forma de moléculas complexas de nucleoproteínas. determinando as características de um ser vivo.

TGC .8.CGU .5. IV.CAC . fundamentalmente. c) o código genético é degenerado.GGU b) TUT . o polipeptídio sintetizado passou a apresentar duas argininas. AUU. Cada trinca de bases nitrogenadas de uma cadeia do DNA corresponde a um aminoácido. ATT. 1.CAC . UCA e GUC c) GTC. São verdadeiras APENAS as afirmações a) I e II b) I e IV c) II e III d) II e IV e) I.HISTIDINA .GGA d) UAU . recebem e incorporam genes de outra espécie. O RNA mensageiro. diversas condições devem ser observadas. TCA e GUC d) CTG.ACA .CISTEÍNA - 232 . Para que ocorra a síntese da proteína codificada pelo gene inserido no genoma da espécie receptora. receptoras de um gene de outro organismo (doador) que lhes confere resistência a certos herbicidas. d) a técnica permite trocar o código genético do organismo doador do gene.CGU . respectivamente. ATT. AGT e CTG b) GTC. O RNA ribossômico contém as informações para as proteínas que devem ser sintetizadas. os quais podem ser transmitidos aos seus descendentes.GTG .CTU . UCA e CUG Questão 1039 Com relação ao código genético. os algarismos I.3 ara preenchê-lo corretamente. Diversos aminoácidos são codificados por mais de uma trinca de nucleotídios. liga-se a um aminoácido específico. por a) GAC. III e IV Questão 1040 Considere o seguinte segmento de uma cadeia de DNA e o polipeptídio sintetizado a partir dele: ATA . II.ARGININA .GCA .GGU c) CGT . b) o código genético é comum a todos os seres vivos. TCA e CUG e) CTG. II. AUU.GGA Questão 1041 Organismos são ditos transgênicos quando.CTU .TGC . Questão 1042 Considere os seguintes códons do RNA mensageiro e os aminoácidos por eles especificados: ACA = treonina GUU = valina Assinale a alternativa da tabela a seguir que indica corretamente os anticódons do RNAt e os códons do DNA relacionados com esses aminoácidos. por técnica de engenharia genética. TAA. Entretanto.TGT .CAC . e) a técnica permite trocar o código genético do organismo receptor do gene. Exemplos desses organismos são as plantas transgênicas. III e IV devem ser substituídos. essa técnica é possível porque a) cada organismo apresenta seu próprio código genético.TTA e) UAU .CGT . de acordo com o anticódon que possui. III.CGT .GLICINA Após a substituição de uma única base nitrogenada no segmento de DNA.CGT .CGC . foram feitas as seguintes afirmações: I. A seqüência de trincas no RNA mensageiro que pode ter codificado esse polipeptídio alterado é a) CUC .TGT .CCT TIROSINA .

os codons de término da tradução são UAA. Sua estrutura está representada no esquema abaixo: C-A-C-A-C-A-C-A-C-A-C-A-C-A-C-A-C-A Suponha que a síntese de um peptídeo possa ser iniciada a partir de qualquer um dos extremos dessa estrutura de RNAm. O aminoácido encontrado no peptídio normal e aquele que o substituiu no peptídio mutante são. Nestas condições. podem-se identificar as possíveis seqüências de DNA que a originaram.1. o número de diferentes tipos de aminoácidos encontrados nos peptídeos formados será: a) 4 b) 3 c) 2 d) 1 Questão 1044 A mutação em um gene.8. respectivamente: a) lisina e cisteína b) treonina e triptofano c) alanina e ácido glutâmico d) fenil alanina e ácido aspártico Questão 1045 A determinação da seqüência de aminoácidos de todas as proteínas da espécie humana e de outros seres vivos é de extrema importância.5. sem necessidade de código de iniciação ou de terminação. foi sintetizada experimentalmente.3 233 . . por conseqüência da substituição de uma única base na estrutura do DNA. Considere que a estrutura normal de um RNA mensageiro de um peptídio e sua estrutura alterada em virtude da troca de uma única base no gene correspondente são: 5' AUGUGGUUUGCACACAAAUGAUAA 3' (normal) 5' AUGUGGUUUGAACACAAAUGAUAA 3' (alterada) A tabela a seguir identifica alguns codons. A partir da seqüência de aminoácidos de uma proteína.5.3 1. composta pelas bases adenina-A e citosina-C. UAG e UGA.8.3 Questão 1043 Uma molécula de RNAm. Considere o quadro: 1. bserve que: .8.5.o codon da metionina é também o do início da tradução. pode acarretar modificações importantes na atividade biológica da proteína codificada por esse gene.

TAC . na proteína que ele especifica.TAC .GAA . é correta a seguinte afirmação: a) O peptídeo Gly-Gly-Gly-His-Arg-Leu-Ile-Gln pode ter sido originado a partir do seguinte RNA mensageiro: GGCGGUGCGCACCGCCUUAUUCAA. devem estar presentes no seu mRNA? a) 100 234 .TTC e) ATC .TAC .GAA . Para descobrir se determinado organismo produz determinada proteína. Arg (arginina). 2 e 3 e) 2.Asn . Pro (prolina).GAA . pare (códon de parada). Questão 1048 Se uma proteína possui 100 aminoácidos. O código genético descreve a relação entre a seqüência de bases nitrogenadas e a seqüência de aminoácidos. Ala (alanina). apenas Questão 1047 A união de vários aminoácidos forma os peptídeos.Cys .om base no quadro apresentado. Val (valina). que está representado na tabela a seguir: 1.TTT b) ATG . Asn (asparagina). His (histidina). Ile (isoleucina). Cada três nucleotídeos correspondem a um aminoácido. formam as proteínas. Isso é possível graças à relação existente entre os códons do RNA mensageiro (cada três nucleotídeos) e os aminoácidos presentes nas proteínas. Lys (lisina).GCC .TGT . Trp (triptofano). Met (metionina).AAT . Glu (ácido glutâmico).AAT . A seqüência de aminoácidos que forma uma cadeia polipeptídica compreende a estrutura secundária de uma proteína. apenas b) 1 e 3. portanto. Gln (glutanina).3 Phe (fenilalanina). como por exemplo as funções enzimáticas. que especificam esses aminoácidos.TAC . As proteínas exercem inúmeras funções no nosso organismo. a partir de uma seqüência de aminoácidos (peptídeo). O inverso também pode ocorrer.AAC . Tyr (tirosina). Ser (serina). após passarem por diferentes processamentos no Retículo endoplasmático rugoso e complexo de Golgi.5.TGT .TTC . Estes.Glu .AAT . faz-se a construção de uma fita de RNA mensageiro a partir dela. d) A partir da seqüência do RNA mensageiro UUAGGGGAGACUCGGCAGGAG. Thr (treonina). quantos códons. Asp (ácido aspártico).TTT c) ATC . 3. é formado o seguinte peptídeo: Phe-His-Ser-Ala-Gly-Arg-His.Phe a) ATG .TGT .TAC . b) A partir da seqüência do RNA mensageiro UUUCAUAGUGCUGGGAGCCAC. Três bases nitrogenadas adjacentes codificam um aminoácido e formam um códon. Com base no texto e em seus conhecimentos.TTC Questão 1046 OBSERVE: 1.8. assinale a opção que indica a seqüência do DNA responsável pela síntese do peptídeo mostrado a seguir: Met .TTT d) ATG . Cys (cisteína). A correspondência entre os códons do RNA mensageiro e os aminoácidos por ele determinados constitui o código genético. Gly (glicina). apenas d) 1. apenas c) 3. c) A partir da seqüência do RNA mensageiro GUGGUUGUCGCUCGUCGGCGG. Está(ão) correta(s): a) 1. é possível obter uma seqüência de nucleotídeos (RNA mensageiros).AAT . Leu (leucina). é formado o seguinte peptídeo: Val-Val-Val-Val-Arg-Arg-Arg.Tyr .TGT . é formado o seguinte peptídeo Leu-Gly-Glu-Thr-Arg-Gln-Glu. 2. e) O peptídeo Lys-Phe-Lys-Tyr-Tyr-Thr-Ile pode ter sido originado a partir do seguinte RNA mensageiro: AAAUUUAACUAUUACACAAUA.GAA .

ileu = ISOLEUCINA. met = METIONINA.arginina e) glicina . Questão 1051 A tabela apresenta o código genético. thr = TREONINA.glicina c) glutamina . o que significa que um aminoácido pode ser codificado por mais de uma trinca. he = FENILALANINA. II . cys = CISTEÍNA.histidina . ala = ALANINA. d) acrossomos.assim como a leucina pode ser codificada por diferentes trincas. glu = GLUTAMINA. Utilizando a tabela.8. e) ribossomos. Estão corretas afirmativas: a) apenas III. respectivamente.o código genético é degenerado. val = VALINA.treonina . III .histidina .5. Bio Volume Único.aspartato b) metionina . GCA e UGA. determine a seqüência de aminoácidos que corresponde à seqüência de DNA TAC TGA TTG CTA a) metionina .3 . é correto afirmar: a) Os códons dessa seqüência sinalizam os mesmos aminoácidos em seres humanos. 235 1.treonina Questão 1052 O aminoácido leucina pode ser codificado por mais de uma trinca de nucleotídios do DNA (AAT. pro = PROLINA.arginina d) glutamina .glutamina . tyr = TIROSINA.glutamina . com os códons e os aminoácidos correspondentes. b) códons.glicina . arg = ARGININA. 1996. b) A inserção de um nucleotídeo entre a 4 e a 5 base não altera o código genético. Assim sendo. GAA e outras).asparagina . leu = LEUCINA.b) 33 c) 99 d) 300 e) 500 Questão 1049 Observe as seqüências de nucleotídeos de um vírus de RNA: 5' GCA UCA CAC CUC AUU GCG UAG 3' Considerando que esse segmento de RNA codifica um determinado peptídeo. trp = TRIPTOFANO. São Paulo: Saraiva. gly = GLICINA LOPES. c) Os códons GCA e GCG são degenerados porque codificam aminoácidos diferentes. ser = SERINA. c) nucléolos. asn = ASPARAGINA.cisteína . podemos dizer que I . d) Os anticódons do 1Ž do 2Ž códon dessa seqüência são. Questão 1050 As unidades hereditárias que contêm a informação para especificar um aminoácido são denominadas a) ADN.aspartato . his = HISTIDINA. Sônia. lys = LISINA. asp = ASPARTATO.um aminoácido pode ser codificado por apenas uma trinca de nucleotídios de DNA.treonina . uma determinada trinca também pode codificar diferentes aminoácidos.

d) apenas I e III são corretas. Assinale a alternativa que reúne as afirmações corretas.a ESTREPTOMICINA interfere na tradução e leva a célula bacteriana a produzir proteínas defeituosas. Essas substâncias diferem quanto à maneira pela qual interferem no metabolismo celular. UTU GGC UTU. triptofano.. b) AAT AAA GGC UCC. Questão 1053 Um trecho de fita de DNA com a seqüência.. c) apenas I. a) apenas I é correta.a MITOMICINA. Essas informações permitem afirmar que I . sua cadeia complementar e o tipo de RNAm que poderá ser formado a partir das bases da hélice original são. arginina e alanina. 236 . Questão 1057 Dado um segmento de RNA com a seguinte seqüência de bases nitrogenadas: UUA UUU GGC UCC. Considerando as informações apresentadas. Indique qual a seqüência de RNAm é transcrito a partir deste segmento DNA: a) TTA TAA GCT CAG ATT TCT b) TTA TTA GCT CAG ATT TCT c) UUA UUU GGU CAG AUU UGU d) UUA UAA GCU CAG AUU UCU e) AAT ATT CGA GTC TAA AGA Questão 1055 Uma cadeia de DNA apresenta a seguinte seqüência de bases numa certa região de sua hélice: ATA CCG TAT. são. b) apenas I e II são corretas. para os aminoácidos mencionados. por inibir a duplicação do DNA. UAU GGC AUA. respectivamente: a) TAT GGC ATA. c) AAT AAA CCG AGG. pode-se dizer que o segmento de DNA que deu origem a esse RNA era a) TTA AAA CCG AGG. e) I.. Questão 1056 Existe um número muito grande de substâncias com funções antibióticas. b) UAU GGC UAU. e) TAT GGC UTU. TAT GGC ATA. e) nenhuma delas. d) TTA TTT CCG AGG.. é responsável pela incorporação respectiva dos seguintes aminoácidos: metionina. c) TAT GGC ATA. (1) Os códons do mRNA. (4) A fumaça do cigarro. impede a multiplicação da célula bacteriana.a TETRACICLINA impede a transcrição e leva a célula bacteriana à morte por falta de RNA mensageiro. (2) A molécula de DNA referente ao trecho apresentado tem 20% de adenina. a MITOMICINA inibe a ação da polimerase do DNA e a ESTREPTOMICINA causa erros na leitura dos códons do RNA mensageiro. Questão 1054 Um fragmento de DNA de uma espécie de organismo procarionte apresenta a seguinte seqüência de bases: AAT ATT CGA GTC TAA AGA. TACACCTCTCGT. e) AAU AAA CCG AGG. TAT GGC ATA. d) I e III. d) ATA GGC TAT. II e III são corretas. TUT GGC UTU. II . a TETRACICLINA liga-se aos ribossomos e impede a ligação do RNA transportador. Assim. respectivamente. UAC ACC UCU CGU. (3) A perda de um nucleotídeo do DNA implicará a alteração dos aminoácidos da cadeia polipeptídica. julgue os itens que se seguem. os raios X e a luz ultravioleta podem produzir mutações na molécula de DNA.b) apenas II. c) apenas II e III são corretas. III .

Questão 1060 O esquema a seguir representa fragmentos de ácidos nucléicos no núcleo de uma célula. d) Um dos mais importantes locais de ocorrência do processo 1 é o nucléolo.8.4 bservando o esquema. d) a célula encontra-se em metáfase. 1.complementar .5. é necessário bloquear o funcionamento de todo o retículo endoplasmático dessa célula. através do qual o RNA carrega consigo as instruções para a produção de proteínas (e por isso ele ganha o nome de RNA mensageiro). (Girardi. e) trata-se do processo de transcrição.adeninas e) complementar .idêntica . sendo as _______________ substituídas pelas uracilas.idêntica .o astro da semana. b) 2 representa nucleotídeos de DNA. c) O processo 2 ocorre principalmente no período S da intérfase. a) idêntica .complementar .5.citosinas d) complementar . Questão 1061 A molécula de RNA sintetizada é ___________ à fita de DNA que lhe deu origem e ___________ à outra fita de DNA.adeninas b) complementar . b) Para interromper o processo 2.4 ssinale a alternativa correta. Estudo de RNA rende o segundo Nobel 237 1. a) O processo 1 somente é observado no núcleo da célula. c) 3 representa nucleotídeos de RNA. foi laureado por registrar em imagens o momento em que a informação genética contida no DNA no núcleo da célula é traduzida para ser enviada para fora pelo RNA .timinas Questão 1062 A mesma molécula . a) AAA CAC GGG TTT b) TTT CAC GGG UUU c) AAA CTC GGG TTT d) TTT GAG GGG TTT e) AAA CAC CCC UUT Questão 1059 O esquema a seguir representa dois processos observados numa célula eucariótica. é INCORRETO afirmar que: a) 1 é uma molécula de uracila. da Universidade Stanford.complementar . sendo inexistente em todas as outras organelas.8. já era conhecido pelos cientistas desde a década de 50.o RNA . Assinale a alternativa que contém a seqüência de bases do segmento da molécula de DNA que deu origem a esse RNA. O americano Roger Kornberg. e) As moléculas produzidas no processo 2 poderão ser utilizadas como catalisadoras. mas nunca serão constituintes de outras organelas.que faturou o Nobel de Medicina ou Fisiologia na segunda-feira foi a protagonista do prêmio de Química entregue ontem. Esse mecanismo de transcrição.guaninas c) idêntica . G. .Questão 1058 Uma molécula de RNA mensageiro apresenta a seguinte seqüência de bases nitrogenadas: UUU GUG CCC AAA.

I. Paulo".III .A . e) DNA e de RNA. b) RNA e de proteínas.U . c) O RNA mensageiro leva do núcleo para o citoplasma instruções transcritas a ele pelo DNA.U . d) RNA e de DNA. de a) proteínas e de RNA.III .U .II. engenharia genética. 238 . transgênicos. a) A produção de RNA mensageiro se dá por controle do material genético.G .U .A .II .U d) C . c) DNA e de proteínas.Fixação do RNA mensageiro aos ribossomos. é necessário conhecer a estrutura da molécula de DNA e entender seu funcionamento.U 1.I . assinale a alternativa incorreta. transcrita a partir do filamento II? a) G .C .C .Ligação dos códons de RNA mensageiro aos anticódons correspondentes dos RNAs transportadores. d) No citoplasma.A e) C .5. d) III . III . terapia gênica.III. Questão 1067 Há na mídia uma grande quantidade de notícias envolvendo o DNA: testes de paternidade. 2006).G . II .A c) G . Qual seria a seqüência correta encontrada na molécula de RNA mensageiro. Analise os dados dos quadros a seguir. Questão 1064 O segmento CGATAGACT de uma fita de DNA. Para compreender essas notícias.U ."O Estado de S. e assinale a(s) proposição(ões) CORRETA(S). farmacogenômica etc.I e) III . o RNA mensageiro determina a seqüência de aminoácidos apresentada por uma proteína.II.C . A partir da leitura do trecho anterior e de seu conhecimento de biologia molecular.C .A . origina a cadeia a) GUTATUTGA b) GCUAUCUGA c) GCTUTCTGU d) UCTATCTUA e) GCTATCTGA Questão 1065 Abaixo está representado o filamento I de uma molécula de ácido nucléico presente no interior do núcleo de uma célula vegetal.G . respectivamente. clonagem terapêutica e reprodutiva.U .Transcrição do código genético do DNA em códons do RNA mensageiro.8.C . 5 out. b) No núcleo da célula ocorre transcrição do código da molécula de DNA para a de RNA. Questão 1063 Os processos de transcrição e tradução gênicas resultam na síntese.II .G . após o processo de transcrição. c) II . I .U b) G . b) I .4 Questão 1066 Considere as seguintes etapas da síntese de proteínas. Qual a seqüência correta dessas etapas durante o processo? a) I .G . e) Cada molécula de RNA mensageiro é uma longa seqüência de nucleotídeos idêntica ao DNA.A .

Durante a transcrição.8. transcrição. observa-se que o pareamento das bases nitrogenadas do DNA é aleatório. III e I. 1. algumas células foram fixadas e radioautografadas. (08) Em III.4 (01) Em I. pois cada uma das fitas originais em I serve de molde para uma nova fita.5.e) apenas II e III. Questão 1068 Analise as afirmativas a seguir. uma fita de DNA serve como molde para a produção do RNA que terá uma seqüência de nucleotídeos complementar à fita-molde. Nas células eucariontes. I e III. (02) O quadro I mostra uma molécula de DNA cuja duplicação ocorre de forma semiconservativa. Nas bactérias. Questão 1070 Algumas células de cultura de tecido foram deixadas em um meio contendo um precursor radioativo de RNA. duplicação e tradução são: a) I. para o núcleo. Após 3 minutos. está indicado o processo de transcrição. onde está o DNA. b) apenas II.5. está indicado o processo de tradução. a informação genética é transmitida do citoplasma. Os esquemas representam as células radioautografadas nos três momentos. III e II. III. Posteriormente. d) III. Esse procedimento se repetiu após 15 e após 90 minutos. onde serão produzidas as proteínas. b) I. através do qual formam-se moléculas que contêm as mesmas bases nitrogenadas presentes no DNA. . que resulta na formação de polipeptídios.4 O esquema resume parcialmente as relações funcionais dos ácidos nucleicos que ocorrem na maioria das células vivas. as etapas que representam.8. c) II. Está(ão) correta(s) a) apenas I. (16) A deleção de um dos pares de bases na seqüência mostrada em I não alteraria significativamente a seqüência de aminoácidos em III. 239 onsiderando-se apenas células eucariontes. I. (04) Em II. d) apenas I e III. transcrição e tradução ocorrem no mesmo local porque as células procariontes não possuem sistema de endomembranas. II e III. cuja seqüência de aminoácidos está codificada numa molécula de ácido nucléico. Questão 1069 1. c) apenas III. essas células foram transferidas para um meio sem essa substância. respectivamente. I e II. revelando a distribuição do precursor radioativo nas mesmas. e) II. gerando duas novas duplas hélices. II.

e) lise celular. que se intensifica aos 90 minutos. b) Apenas III. II e III. III . dirige-se gradativamente para o citoplasma celular. buscando a situação de equilíbrio. 240 . Esse aminoácido. porém. Questão 1074 Ao longo da molécula de DNA. arginina. arginina. leucina.5 Esses resultados ocorrem porque a) o RNA transportador leva o isótopo até o nucléolo e posteriormente ao núcleo e citoplasma celular. treonina.Um RNA-t (RNA transportador) transporta sempre um determinado aminoácido. d) mutação gênica.5. CUG e ACU do RNA mensageiro codificam. qual a seqüência correta do DNA e do RNA transportador.As moléculas de RNA-t apresentam numa determinada região da sua molécula uma trinca de bases denominada anticódon. os aminoácidos arginina.4 1. c) a síntese de RNA. indique.A tradução do código químico do RNA-m (RNA mensageiro) ocorre nos ribossomas localizados no retículo endoplasmático rugoso. esgota toda a substância presente no núcleo. leucina. restando apenas no citoplasma.8. Questão 1073 Sobre a síntese de proteínas. respectivamente. b) produção de energia. nas opções a seguir. Assinale a(s) afirmativa(s) correta(s): a) Apenas II. d) a produção de RNA. treonina. c) duplicação de RNA. e) I. sendo que posteriormente o RNA aí produzido migra para o citoplasma celular. prossegue posteriormente no citoplasma da célula. II . e) a síntese de RNA ocorre no núcleo. pode ser transportado por vários RNA-t. b) arginina. treonina. arginina. ao ser deixada em situação de desequilíbrio osmótico em relação à cultura sem isótopo. a) treonina. A seqüência desses aminoácidos na proteína correspondente ao segmento do DNA que apresenta a seqüência de nucleotídeos GAC TGA TCT será. c) Apenas I e II. que ocorre inicialmente no núcleo celular. d) treonina. Questão 1071 Os códons AGA. Questão 1072 Partindo-se do conhecimento do RNAm (CCU GAG).1. respectivamente. arginina. são feitas as seguintes afirmações: I .5. e) leucina. leucina. b) a substância. existem quatro tipos de genes que atuam como está demonstrado no esquema a seguir: São esses mecanismos que tornam possível a: a) diferenciação celular. d) Apenas II e III. leucina e treonina. c) leucina.8.

1. b) I e II apenas.durante o processo a proteína formada depende. d) produção de energia. RNA ribossômico. RNA mensageiro. c) síntese protéica. duplicação. c) I e III apenas. aminoácidos. de uma molécula de DNA.qualquer proteína formada será conseqüência direta de uma transcrição do RNA. No processo de elaboração de uma proteína ocorrem as etapas de transcrição e ___(III)___.5 Questão 1075 O antibiótico Estreptomicina age sobre as bactérias promovendo a leitura errada do RNAm.os ribossomas alinhados nessa molécula de RNA traduzirão os mesmos códons. tradução. e) genes. e) reprodução celular. proteínas. tradução. Questão 1077 Analise o texto abaixo e assinale a alternativa que contém os termos que preenchem corretamente os espaços (I). d) II e III apenas. aminoácidos. d) genes. num certo organismo. b) secreção de substâncias. A primeira etapa forma a molécula de ___(IV)___ contendo a mensagem genética e a segunda etapa é responsável pela produção da proteína.8. III . o Cloranfenicol inibe a peptidiltransferase na subunidade ribossômica maior e a Rifampicina inibe a RNA polimerase no sítio de iniciação. a Tetraciclina liga-se à subunidade ribossômica menor e inibe a ligação do AA-RNAt. (III) e (IV). RNA mensageiro. (II).5. em última análise.5. A(s) afirmativa(s) correta(s) é(são): a) I apenas. proteínas. duplicação. e) I. RNA transportador.5 Questão 1078 O esquema a seguir representa a seqüência das etapas da síntese de um trecho de uma proteína a partir da molécula de DNA. cópia. 1. b) ribossomos. II e III. aminoácidos. Questão 1076 241 .análise do esquema anterior nos permite afirmar que: I . RNA ribossômico." a) ribossomos. II .8. Sabe-se que esses antibióticos são substâncias cuja utilização médica se baseia na inibição das células bacterianas atuando no mecanismo de: a) fagocitose. c) genes. "O controle das características fenotípicas dos seres vivos é feito pelos ___(I)___ através do comando da síntese de ___(II)___.

1.5. b) pentoses da molécula de RNA .5 obre essa síntese foram feitas as afirmações abaixo: I.Questão 1080 A composição química de uma proteína pode ser alterada se a) durante sua síntese houver variação dos tipos de aminoácidos disponíveis no citoplasma. d) uma base púrica substituir uma pirimídica no RNA mensageiro que a codifica. b) apenas I e II estão corretas. d) da produção de RNA e de proteínas. 2 e 3 ficariam corretamente preenchidos por: a) ACA. CAC. A seqüência correta de bases nitrogenadas encontradas na molécula de RNA mensageiro. GUA 242 . Questão 1081 A seqüência de aminoácidos de uma proteína é determinada pela seqüência de a) pentoses da molécula de DNA. GUG. CAU c) TCT. c) apenas II e III estão corretas.8. d) apenas I e III estão corretas. e) O DNA não se duplicar durante a interfase. Questão 1079 A Rifampicina é um dos antibióticos utilizados para o tratamento da tuberculose. c) exclusivamente da produção de RNA.5 s espaços 1.8. Sob ação do antibiótico. respectivamente aos processos de tradução e transcrição. e) todas estão corretas.mensageiro. III. CAT e) TGT. CUC. Para codificar a seqüência dos aminoácidos do trecho da proteína apresentada no esquema são necessários 24 nucleotídeos no RNA mensageiro. e) da produção de DNA e RNA. II. complementar ao segmento da hélice de DNA apresentada é UGGUUUGGCUCA. c) sua síntese ocorrer no retículo endoplasmático liso e não no rugoso. nas células bacterianas haverá comprometimento a) exclusivamente da produção de proteínas. GAG. 1. GAU b) TGT.5. que ocorrem no núcleo das células eucarióticas. GAG. b) durante sua síntese houver variação dos tipos de RNA transportadores. e) bases da molécula de RNA . GTA d) UGU. No esquema. b) exclusivamente da produção de DNA. d) bases da molécula de RNA . c) bases da molécula de DNA. Seu mecanismo de ação consiste na inibição da transcrição nas células de 'Mycobacterium tuberculosis'.transportador. Deve-se concluir que a) apenas II está correta.ribossômico Questão 1082 Considere os seguintes fragmentos de ácidos nucléicos que participam da síntese de uma proteína. os números 1 e 2 correspondem.

b) O RNAm do gene "anti-sense" é capaz de parear com o RNAm da poligalacturonase. Questão 1084 Um mutante perdeu um segmento de DNA contendo todas as cópias dos genes que codificam RNA transportador. Os pesquisadores utilizaram a metodologia "anti-sense" (veja o quadro a seguir) para diminuir os níveis da enzima poligalacturonase. d) o transporte de proteínas. c) Esse ácido nucléico é produzido no núcleo e se dirige ao citoplasma. 243 . A função celular drasticamente afetada por essa mutação será a) a replicação do DNA. os tomates são pulverizados com etileno para acelerar o amadurecimento e torná-los vermelhos.8. Questão 1085 O DNA apresenta importantes funções celulares. b) a síntese de RNA mensageiros. cuja expressão gênica é induzida pelo etileno. cuja função é transportar aminoácidos. a) A substância representada em I é obrigatoriamente ribose.5.5 Considerando o esquema acima. Dessa forma. Antes de chegarem às prateleiras. a) Essa metodologia visa reduzir os níveis de etileno nos frutos evitando seu amadurecimento. Essa enzima promove a hidrólise de componentes da parede celular. que ocorre também em você. Questão 1087 O esquema a seguir é um processo celular vital. impedindo sua expressão. e) o transporte de RNA. 1. o que compromete a firmeza dos frutos. d) A tecnologia "anti-sense" para genes necessários à síntese do etileno poderia ser utilizada para se evitar o amadurecimento de frutos. o tomate pode ser transportado já maduro e apresenta um maior tempo de prateleira. c) O maior tempo de prateleira a que o texto se refere se deve aos baixos níveis da enzima poligalacturonase. o processo de transcrição não ocorrerá.8. Numa síntese de proteína com 185 ligações peptídicas. que representa um fragmento de ácido nucléico.5. e) Se a ação desse ácido for bloqueada. assinale a alternativa INCORRETA. c) a síntese de proteínas.Questão 1083 e) 558 Questão 1086 Tradicionalmente. unindo-se aos aminoácidos. os tomates são colhidos ainda verdes para que sua firmeza seja mantida no transporte. O tomate Flavr Savr foi desenvolvido pela empresa de biotecnologia Calgene para amadurecer no pé mantendo a firmeza de sua pele. Uma delas é a síntese de proteína. o filamento de DNA que proporcionou essa síntese deverá ter o seguinte número total de nucleotídeos: a) 62 b) 93 c) 186 d) 279 1. é denominada anticódon. b) Cada trinca de bases. d) II pode apresentar moléculas de adenina.5 Assinale a alternativa INCORRETA. representada em II.

5. mas não traduzidas. Ao final do experimento.5. Num experimento de laboratório hipotético. observam-se os seguintes eventos: I.5 Nesse processo ocorre produção de. no processo digestivo.8. obteve-se uma proteína a) humana. d) quimérica de homem e ovelha. b) enzimas usadas. o RNA mensageiro combina-se com um complexo de ribossomo. c) moléculas de defesa do corpo. mas não são traduzidas em proteínas) de seis espécies de organismos. 1. d) Seqüências transcritas. d) moléculas utilizadas nos processos de cicatrização. b) Os vertebrados citados apresentam menor percentual de transcrição em relação aos outros animais. o gene (segmento de DNA) é transcrito em RNA mensageiro.8.1. Questão 1088 Os gráficos a seguir revelam o NÚMERO DE GENES e a relação entre RNA CODIFICADOR (que contém as seqüências que podem ser traduzidas em proteínas) e RNA NÃO-CODIFICADOR (seqüências que são transcritas. c) de coelho. por exemplo.5 244 . RNAs transportadores de ovelha e aminoácidos de coelho. II. é correto afirmar. Questão 1090 Responder à questão com base na ilustração e afirmativas a seguir. RNAs transportadores e aminoácidos. III. Analisando os resultados anteriores de acordo com seus conhecimentos sobre o assunto.8.5 1. b) de ovelha. realizou-se uma síntese protéica utilizando-se: DNA de um gene humano. e) híbrida de homem e coelho. EXCETO: a) Não existe uma relação de proporcionalidade direta absoluta entre o número de genes e a complexidade dos organismos relacionados. EXCETO: a) macromoléculas de reserva energética. e nos éxons estão presentes seqüências codificadoras. Questão 1089 Na síntese protéica. poderiam desempenhar alguma função no núcleo celular. c) Os íntrons são exemplos de RNA não-codificador. a proteína é sintetizada.5.

o DNA se duplica. todas as afirmativas corretas encontram-se na alternativa a) I. III e IV c) I e IV d) II e III e) II. Muitos animais desenvolvem-se ao longo de eixos cartesianos. vértebras. Lewis. "De volta ao seqüenciamento. B e C ocorrem no interior do núcleo. denominado replicação. penas e dentes. sendo os padrões especificados independentemente ao longo de cada um. o galardão de química ficou com os inventores de ferramentas para estudar proteínas. em grande parte.) Com base no texto e nos conhecimentos sobre o tema. p. mas talvez não seja pretensioso supor que foi um lapso. d) as proteínas não terem controle sobre o metabolismo celular. é certo afirmar: a) os aminoácidos que estão no citoplasma são selecionados pelo RNAm b) todo o processo da síntese de uma proteína ocorre exclusivamente no núcleo da célula c) o RNAm controla a síntese de uma proteína.. In: MURPHY. (WOLPERT. Durante o processo A. III e IV Questão 1091 (. III. Uma outra característica comum parece ser a geração de estruturas periódicas como segmentos.) (LEITE. M. 74. como em um sistema coordenado. contido no material genético. É verdade que a Fundação Nobel ainda fala no DNA como o diretor de cena a comandar a ação das proteínas. denominado tradução. Todas as interações ocorrem a curta distância . e as células então interpretam esses valores de maneiras diferentes.. que é induzido a se expressar em resposta a fatores extrínsecos. b) O desenvolvimento envolve a expressão diferencial do material genético e independe do micro-ambiente em que a célula está localizada. "O Que é vida? 50 anos depois". Nos eucariotos. c) O desenvolvimento das diferentes regiões de um organismo deve-se à propriedade de interação célula-célula 245 . L.J.A. dá-se a síntese protéica. Essa referência deve-se ao fato de a) não ocorrer uma correlação funcional entre DNA e proteínas no meio celular. células tornando-se diferentes de maneira ordenada [. ocorre a síntese de RNA. Uma maneira de produzir padrões é dar às células informação posicional.. os processos A. Durante o processo C. Questão 1092 Em se tratando do processo de síntese de proteínas.) O autor refere-se às proteínas como ''atores do drama molecular'' e ao DNA como "diretor de cena". IV. os verdadeiros atores do drama molecular da vida. e) o DNA controlar a produção de proteínas e estas controlarem a atividade celular.e a maior parte da formação de padrões acontece localmente. P.raramente ultrapassam mais que 30 diâmetros de célula . II e III b) I. Marcelo. e que o sinal emitido por essas premiações aponta o verdadeiro futuro da pesquisa biológica e médica muito além dos genomas e de seu seqüenciamento (uma simples soletração). de forma que os embriões são logo divididos em regiões que essencialmente se dividem de maneira independente". A importante implicação disto é que não existe relação entre o padrão inicial e o observado. (.) De outro lado. Considerando os processos intracelulares.. que são construídas segundo o modelo básico modificado pela informação posicional. é correto afirmar: a) As células diferenciam-se de acordo com um padrão intrínseco.20/10/2002. denominado transcrição. Paulo . b) o DNA controlar a produção de proteínas etambém atuar como catalisador de reações químicas celulares. 1997. O'NEILL.. mas a síntese dele próprio é controle do DNA d) o RNAt é responsável pela etapa de transcrição no processo de síntese de uma proteína Questão 1093 "Desenvolvimento significa. Durante o processo B. II.." Folha de S. c) o material genético ser constituído por proteínas. São Paulo: UNESP..].

no citoplasma.UAC b) ATG . c) o transporte de aminoácido para o local da síntese é feito pelo mRNA. De acordo com o texto. esta enzima passa para o lisossomo. Sabe-se que X < Y < Z e que esses valores formam uma progressão aritmética.UCG . que serve de modelo para a formação de uma proteína. Y e Z de aminoácidos. a síntese da enzima ocorre nas membranas do mesossomo e depois ela é secretada para o meio de cultura. contendo. o valor de Y equivale a: a) 826 b) 706 c) 586 d) 466 Questão 1095 Considere os seguintes códons: UAC . no meio de cultura líquido. Questão 1098 Na síntese protéica. Em seguida. via vesículas de secreção. onde a tradução é concluída.ACG .ACG . substâncias químicas indispensáveis à vida. d) A síntese da pectinase começa no núcleo e termina nas membranas do retículo endoplasmático liso. assinale a alternativa correta.CGU Questão 1096 Sobre os diferentes papéis dos ácidos nucléicos na síntese de proteínas podemos afirmar corretamente que: a) a seqüência de bases no DNA determina a seqüência de aminoácidos na cadeia polipeptídica. c) A síntese da pectinase começa no citoplasma e termina nas membranas do retículo endoplasmático rugoso.ACT . para o meio de cultura. Admita que todos os demais nucleotídios formam códons que correspondem a aminoácidos encontrados na estrutura primária das proteínas após serem sintetizadas. via vesículas de secreção.GUA .GAU . a) O 'Aspergillus niger' é um organismo que possui mesossomo. está corretamente referida em: a) O DNA transcreve a mensagem genética para o RNA.CUA .CUT . via vesículas de secreção. para o meio de cultura.TAC c) TUG . um processo bastante complexo e fundamental para a sobrevivência das células.CGA .AUG Os anti-códons correspondentes são: a) AUG . respectivamente. depois para o complexo de Golgi e é secretada. do seu RNAm. Portanto. produzida pelo fungo 'Aspergillus niger'. para o meio de cultura. Gustavo não precisa destruir o fungo para obter a enzima. d) A diferenciação caracteriza-se pela manutenção do padrão morfológico e pela alteração do padrão funcional do tecido. Questão 1094 Um RNA-mensageiro bacteriano é formado pela polimerização de 5292 nucleotídios e contém três códons de iniciação de leitura e três de terminação. Em seguida. a participação dos ácidos nucléicos. 246 .e da quantidade de informações que a célula é capaz de processar.GAC e) GCA . b) a posição dos aminoácidos na cadeia polipeptídica depende da seqüência de bases do tRNA. Questão 1097 O pesquisador Gustavo obtém pectinase.TCG .UTC d) AGT . Esse RNA é traduzido em três diferentes proteínas. que é traduzido por ribossomos e depois é ancorado nas membranas do retículo endoplasmático rugoso. d) a seqüência de bases do rRNA é transcrita a partir do código do mRNA. um número X. em que a diferenciação de um tipo celular induz outro tipo a se diferenciar.UGC . desta forma. e) O desenvolvimento ocorre como um dominó. b) O caminho da produção da pectinase começa com a transcrição.CTA . para ser empregada na indústria de sucos. ele simplesmente separa o meio de cultura do microrganismo e isola a enzima deste meio. Em seguida. e) A síntese da pectinase começa no mesossomo e termina nas membranas do retículo endoplasmático rugoso. e) a extremidade livre dos diversos tRNA tem seqüências de bases diferentes. esta enzima passa para o complexo de Golgi e é secretada. esta enzima passa para o complexo de Golgi e é secretada.

2 e 3 substituem. c) O RNA mensageiro contém trincas de nucleotídeos denominadas códons.‘. Analise-a e assinale a alternativa correta. Questão 1102 No esquema. c) Estão corretas apenas I e II. também. b) o mRNA se integrou ao DNA dos ovócitos. c) o gene responsável pela síntese da cadeia polipeptídica ’ aumenta sua atividade a partir do terceiro mês da concepção.5.8. local da síntese protéica. produziam. c) o material injetado nos ovócitos foi capaz de se autoduplicar. os números 1. e) Estão corretas apenas I e III. em que está representada a produção de diferentes tipos de cadeias polipeptídicas . ’. d) O RNA transportador apresenta na sua molécula uma trinca de nucleotídeos denominada anticódon. d) os quatro tipos de cadeias polipeptídicas . proteínas virais. ’.5. comandando a síntese da proteína viral.b) O DNA transcreve a mensagem genética para o RNA solúvel.8. local onde ocorre a transcrição da mensagem genética. Questão 1099 Um pesquisador injetou RNA mensageiro (mRNA) de vírus em ovócitos de anfíbios. – e “ estarão presentes no indivíduo adulto. que se liga ao ribossomo. é INCORRETO afirmar que a) a ativação do gene responsável pela síntese da cadeia polipeptídica “ ocorre dias antes do nascimento. II) A tradução do código genético do RNAm é feita nos ribossomos localizados no retículo endoplasmático rugoso. além de suas próprias proteínas. b) Todas estão corretas. Questão 1100 Analise este gráfico.‘. verificou que esses ovócitos. I) Um RNAt transporta sempre o mesmo aminoácido. a) Apenas II está correta. respectivamente: 1. responsáveis pela transcrição de uma cadeia polipeptídica. Após certo tempo. b) a síntese da cadeia polipeptídica ‘ permanece constante durante a mudança de produção das cadeias – e ’. – e “ determinadas pela ação de diferentes genes e que vão compor as hemoglobinas em várias fases do desenvolvimento humano: om base nas informações contidas nesse gráfico e em outros conhecimentos sobre o assunto. Esses dados sugerem que a) o DNA dos ovócitos foi impedido de se expressar. local de ligação com o aminoácido que ele transporta.5 247 . III) O anticódon corresponde a uma trinca de bases localizada numa determinada região de todos os RNAt. Questão 1101 São feitas as seguintes afirmativas a respeito da síntese protéica.5 1. d) os ovócitos foram capazes de interpretar a informação contida no mRNA viral. e) O RNA ribossômico se une a proteínas formando o ribossomo. d) Apenas III está correta.

5 Um dos processos metabólicos mais importantes. Entre as hipóteses apresentadas naquele texto. c) cada polipeptídeo tem uma seqüência específica de nucleotídeos determinada pelo gene.8. é CORRETO afirmar que: (01) ele ocorre nos ribossomos. repressão. (32) existem códons específicos para concluí-lo. e) Apenas II e III. Questão 1105 1. que ocorre em nível celular. lançando. (04) o RNA transportador tem como função levar as proteínas produzidas no núcleo para o citoplasma. c) Apenas III. assim. Segundo esse dogma. destaca-se o 1. que podem ser de quatro tipos diferentes. Quais estão corretas? a) Apenas I. as bases para a descoberta do código genético. transcrição c) amplificação gênica. b) a transferência de informações genéticas ocorre do DNA para o RNA. o mensageiro e o transportador. a) o código genético é degenerado. (08) o ordenamento dos aminoácidos na proteína formada dá-se em função da seqüência de bases nitrogenadas. no interior do núcleo. tradução. b) Apenas II. diferentes códons sempre especificam diferentes aminoácidos na cadeia polipeptídica. pois um aminoácido pode ser codificado por mais de uma trinca.5 248 . d) cada molécula de DNA é formada pela reunião de nucleotídeos. e) uma molécula de DNA difere de outra pela seqüência de seus nucleotídeos. levando à formação de alguns hormônios: dogma central da Biologia. tradução e) transcrição. replicação. e deste para a proteína.a) repressão gênica. um dos descobridores da estrutura da molécula de DNA. (02) dele participam três moléculas de RNA: o ribossômico. tradução Questão 1103 O esquema a seguir mostra a via metabólica de um aminoácido. presente no RNA mensageiro. tradução d) replicação. é a síntese de proteínas. Com relação a esse processo. replicação b) replicação. II .Um indivíduo com a enzima 1 inibida deixa de produzir as enzimas 2 e 3.5. transcrição. d) Apenas I e II.8. III . Questão 1104 O cientista britânico Francis Crick. apresentando suas hipóteses sobre a estrutura teórica da biologia molecular. transcrição.5. Questão 1106 respeito deste esquema são feitas as seguintes afirmações: I .Um indivíduo com a enzima 1 inibida acumulará grandes quantidades de aminoácido 3.Um indivíduo com a enzima 1 inibida precisa receber os hormônios 1 e 2 de fontes externas. morto em julho de 2004. publicou um manifesto sobre a síntese de proteínas. será lembrado como um dos mais influentes cientistas de todos os tempos. isto é. Em 1958. (16) o código genético é degenerado.

c) transcrição . c) RNAt. e) RNAm.tradução . (0) Ao final da síntese. ribossomo e anticódon.tradução .replicação . que também participa do processo.núcleo d) replicação .5.tradução . III e IV correspondem. b) RNAt. (3) O conjunto representado pode estar localizado no retículo endoplasmático rugoso. São Paulo: Moderna.8. a) transcrição . a: a) ribossomo. RNAt. corretamente. ao processo de ___________ e o número (3) ao processo de ___________. RNAt.8. o número a) 2 representa o RNA mensageiro que contém os códons para a síntese protéica. Nas células eucariotas. 1. todas as proteínas representadas no esquema serão iguais. (4) O número de aminoácidos da proteína dependerá do tamanho do RNA mensageiro. Questão 1109 O diagrama ilustra uma fase da síntese de proteínas. 249 .5. 150. o número (1) corresponde ao processo de ___________. d) 1 representa a mitocôndria onde ocorre o processo de tradução. o número (2). (1) Os ribossomos estão se movendo da parte de baixo para a de cima do esquema.No esquema. Questão 1108 O esquema a seguir representa a síntese protéica. 1. b) 3 representa a proteína carregada pelo RNA mensageiro. códon.transcrição .5.núcleo Questão 1107 1. p.citoplasma e) replicação .5 AVANCINI e FAVARETTO.citoplasma. RNAm. e) 4 representa o RNA mensageiro que está sendo carregado pelo RNA transportador representado pelo número 1. não está representado o RNA transportador. RNAm.Uma abordagem evolutiva e ecológica". ribossomo e códon. ribossomo e códon.replicação . vol.tradução . b) replicação . Na figura. 1. "Biologia . os processos representados pelos números (1) e (2) ocorrem no _________.5 Analise o esquema e julgue os itens a seguir. (2) No esquema.5 s algarismos I. c) 4 representa o RNA transportador que carrega a mensagem. Assinale a alternativa que preenche.transcrição . 1997. ribossomo e anticódon. d) RNAm.transcrição .núcleo. II.8. as lacunas.tradução . respectivamente. RNAm e RNAt.

somente. e) nos genes III e IV. Questão 1111 Considere o diagrama. Nesse extrato o agente transformante era a) o ácido ribonucléico. d) uma enzima. somente. 3 e 4. duplicação e retículo endoplasmático.8. 1. respectivamente. é normal. quantos nucleotídeos em média estão presentes em uma seqüência codificadora de ARN-m. Questão 1114 Em 1928 Griffth descobriu que pneumococos (bactérias) sem cápsula e não-patogênicos. patogênicos e mortos. produzem quatro tipos diferentes de enzimas. III e IV. transcrição e lisossomo.5 m indivíduo tem anomalias na pigmentação do corpo e seu metabolismo é prejudicado pela falta do hormônio da tireóide. duplicação e lisossomo. s processos assinalados como 1 e 2 e a organela representados no diagrama referem-se. os sintomas que o indivíduo apresenta ocorrem devido às alterações a) no gene I. onde quatro genes. responsável pelo sequenciamento dos aminoácidos em um peptídeo com peso molecular de 27000 daltons? a) 810 b) 300 c) 270 d) 81000 e) 2700 Questão 1113 Griffth em 1928 descobriu que pneumococos sem cápsula. não patogênicos. Questão 1112 Supondo que o peso molecular médio de um aminoácido é de 100 daltons. d) uma enzima. transcrição e ribossomo. causavam a morte de cobaias. somente. b) o ácido indolilacético.5 250 . d) transcrição. II. c) duplicação. c) nos genes I e III.8. e) uma proteína. e) tradução. a a) transcrição. que resume as principais etapas da síntese protéica que ocorre numa célula eucarionte. c) o ácido desoxirribonucléico. misturados com um extrato de pneumococos capsulados. b) tradução. d) nos genes II e III.Questão 1110 O esquema representa alguns passos de uma série de reações metabólicas. somente. somente. misturados com um extrato de pneumococos capsulados patogênicos mortos causavam a morte de cobaias.5. c) o ácido desoxirribonucléico. b) o ácido indolilacético. O funcionamento das glândulas supra-renais. transformando o aminoácido fenilalanina em quatro possíveis substâncias. 1. Nesse extrato o agente capaz de transformar bactérias não-patogênicas em patogênicas era a) o ácido ribonucléico.5. 1. b) nos genes I e II. tradução e ribossomo. porém. 2. De acordo com o esquema. e) uma proteína. I.

Questão 1115 Griffth, em 1928 descobriu que bactérias pneumococos sem cápsula e não-patogênicos, misturados com um extrato de pneumococos capsulados, patogênicos e mortos, causavam a morte de cobaias. Em 1944 Avery, McLeod e McCarthy concluíram que o agente capaz de transformar as bactérias era a) o RNA. b) o AIA. c) o DNA. d) uma enzima. e) uma proteína. Questão 1116 A experiência do "liquidificador" realizada por Hersey e Chase demonstrou que a substância que determinava a destruição de bactérias parasitadas pelos vírus bacteriófagos era a) uma proteína viral. b) uma enzima viral. c) o RNA viral. d) o DNA viral. e) um lípide viral. Questão 1117 O experimento do "liquidificador" serviu para demonstrar que o DNA de certos organismos era capaz de causar a destruição de bactérias. Os organismos que podem infectar bactérias são a) fungos. b) vírus. c) algas. d) ácaros. e) protozoários. Questão 1118 Bacteriófagos são a) protozoários de vida livre. b) líquenes parasitas. c) vermes parasitas. d) vírus. e) vermes de vida livre.

Questão 1119 A experiência do "liquidificador" realizada por Hersey e Chase em 1952 demonstrou que a) o material genético é formado por proteínas. b) o material genético é formado de RNA. c) o material genético é formado de lipídios. d) o material genético é formado por açúcares. e) o material genético é formado de DNA. Questão 1120 A bactéria 'Pneumococo pneumoniae' pode possuir uma cápsula que lhe permite a) sofrer mutações. b) desenvolver flagelos. c) resistir às defesas dos hospedeiros. d) ficar imune às defesas dos hospedeiros. e) sobreviver em ambientes sem água. Questão 1121 "O século XX proporcionou uma série de pesquisas na área genética. Em 1928, Griffith realizou um importante experimento que envolvia transformações em bactérias. Esse experimento, retomado por Avery e colaboradores, em 1944, foi a base para a descoberta da molécula formadora do material genético. Nos anos 50, Watson e Crick apresentaram o modela da dupla-hélice dessa molécula, abrindo caminho para que, na década seguinte, se demonstrasse como o gene, através de sua seqüência de bases nitrogenadas, controla a produção de proteínas. Nas duas últimas décadas, o avanço biotecnológico permitiu aos cientistas a manipulação do material genético e a transferência de um gene de uma espécie para outra." Considere os itens abaixo: I. estrutura da molécula do DNA; II. descoberta do código genético; III. DNA como molécula constituinte do gene; IV. obtenção de organismos transgênicos. O texto faz referência a) apenas aos itens I, II e III.
251

b) apenas aos itens I, II e IV. c) apenas aos itens I, III e IV. d) apenas aos itens II, III e IV. e) a todos os itens considerados. 1.5.8.6 Questão 1122 Sabendo que o DNA dos vírus bacteriófagos contém fósforo e que a cápsula protéica contém enxofre, Hersey e Chase, em 1952, cultivaram vírus em meio contendo isótopos de fósforo (¤£P) e de enxofre (¤¦S). Esses pesquisadores observaram, ao introduzir os vírus marcados em meio contendo bactérias, que os isótopos de fósforo (¤£P) apareciam no interior das bactérias e que os isótopos de enxofre (¤¦S) permaneciam fora das células. Observaram também que, após lavarem a superfície das bactérias, retirando o enxofre (¤¦S), continuava ocorrendo a replicação dos vírus. Com esse experimento, eles puderam concluir que a) a informação genética necessária para a síntese de novos vírus está contida no DNA viral. b) as capas protéicas dos vírus contêm parte importante da informação genética necessária à síntese de novos vírus. c) o DNA viral precisa estar associado integralmente às capas protéicas para poder se replicar no interior das bactérias. d) a capa protéica protege o DNA viral da ação de endonucleases no interior do organismo hospedeiro. e) os vírus bacteriófagos contêm DNA como material genético, e essa molécula é muito rica em enxofre. Questão 1123 No início da década de 1950, foi desenvolvido um experimento onde um dos componentes de um tipo de bacteriófago foi marcado radiativamente com enxofre e outro, com fósforo. Esses bacteriófagos foram utilizados para infectar uma cultura de 'Escherichia coli'. Um dos componentes entrou na bactéria, e o outro foi retirado da parede da mesma, por agitação. A cultura foi, então, imediatamente, centrifugada. O resultado obtido encontra-se ilustrado no esquema a seguir.

obre o resultado do experimento, é correto afirmar que a) o DNA do bacteriófago marcado com fósforo encontra-se no depósito bacteriano. b) as proteínas do bacteriófago marcadas com enxofre encontram-se no depósito bacteriano. c) o DNA do bacteriófago marcado com enxofre encontra-se em suspensão. d) as proteínas do bacteriófago marcadas com fósforo encontram-se em suspensão. e) o DNA do bacteriófago marcado com enxofre encontra-se no depósito bacteriano. Questão 1124 Por razões pouco conhecidas, durante a meiose pode ocorrer a não-disjunção de um determinado par de cromossomas, acarretando anomalias cromossomiais. Como exemplo de anomalia cromossomial autossômica temos: a) mongolismo. b) daltonismo. c) hemofilia. d) Síndrome de Turner. e) Síndrome de Klinefelter. Questão 1125 O esquema a seguir representa a formação dos gametas responsáveis pela produção de um indivíduo com alteração do seu número cromossomial.

252

1.5.9.1

III IV a) 65 , 65. b) 65 ,130. c) 70 , 60. d) 130 , 65. e) 130 , 130. Questão 1128 Monossomia do cromossomo X, ovários rudimentares, mau desenvolvimento dos caracteres sexuais secundários, baixa estatura são, entre outros, dados que podem ser relacionados com a síndrome: a) de Marfan b) de Klinefelter c) de Down d) de Turner e) de Patau Questão 1129 A constituição genética dos indivíduos com síndrome de Klinefelter é: a) 45A XX b) 44A XYY c) 44A XXY d) 45A XO e) 47A XXY Questão 1130 A síndrome de Down ou mongolismo é uma anomalia causada por: a) uma mutação gênica b) uma deficiência cromossômica c) uma diminuição do número de cromossomos no genoma d) um aumento do número de cromossomos do genoma e) uma inversão cromossômica Questão 1131

ntre as características que este indivíduo passará a apresentar, teremos: a) sexo masculino. b) cariótipo normal. c) estatura elevada. d) caracteres sexuais desenvolvidos. e) ausência de cromatina sexual. Questão 1126 A síndrome de Klinefelter é uma anomalia genética devido à: a) presença de três cromossomos autossômicos nŽ 21. b) ausência de um cromossomo autossômico nŽ 21. c) presença de um cromossomo X e dois cromossomos Y. d) presença de um cromossomo Y e dois cromossomos X. e) ausência de cromossomos sexuais. Questão 1127 Suponha que o seguinte processo ocorre em uma comunidade onde convivem diferentes espécies de gramínea: Qual das alternativas a seguir indica corretamente o valor de 2N dos híbridos III e IV do processo esquematizado?

1.5.9.1

Se na ovulogênese, não houver disjunção do par de cromossomos sexuais, os óvulos correspondentes, sendo fecundados, poderão dar origem a casos de a) síndrome de Turner b) síndrome de Klinefelter c) síndrome de Down d) síndrome de Patau e) a e b são possíveis
253

Questão 1132 Duas espécies de plantas A(2n = 8) e B(2n = 6) foram cruzadas produzindo um híbrido interespecífico que, germinando, produz alguns grãos de pólen que foram utilizados para fecundar óvulos da espécie B. Assinale a opção que relaciona o nível de ploidia e o número de cromossomos da descendência. a) 2n = 7 b) 2n = 10 c) 3n = 7 d) 3n = 10 e) 4n = 14 Questão 1133 Duas espécies de plantas A(2n = 8) e B(2n = 10) foram cruzadas produzindo um híbrido interespecífico que, germinando, produz alguns grãos de pólen que foram utilizados para fecundar óvulos da espécie B. Assinale a opção que relaciona o nível de ploidia e o número de cromossomos da descendência. a) 2n = 7 b) 2n = 14 c) 3n = 14 d) 3n = 10 e) 4n = 14 Questão 1134 A figura a seguir representa uma sinapse (pareamento) anormal observado quando ocorre a mutação cromossômica estrutural denominada:

a) inversão pericêntrica b) translocação c) duplicação d) deleção e) isocromossomos Questão 1135 A figura a seguir representa uma sinapse (pareamento) anormal observado quando ocorre a mutação cromossômica estrutural denominada:

1.5.9.1

a) inversão pericêntrica b) translocação c) duplicação d) deleção e) isocromossomos Questão 1136 Existem algumas pessoas chamadas especiais porque possuem uma série de características diferentes da maioria da população. Entre essas, estão aquelas que possuem a 'Síndrome de Down', também conhecida como Mongolismo. Em relação a essa síndrome, podemos afirmar que: a) é uma anomalia genética, causada pela presença de 3 cromossomos 21 e transmitida sempre pela mãe. b) é uma anomalia congênita, causada pela presença de 3 cromossomos 21 e transmitida sempre pela mãe. c) é uma anomalia genética, causada pela presença de 3 cromossomos 21 e transmitida por qualquer um dos pais. d) é uma anomalia congênita, causada pela ausência de um cromossomo sexual X ou Y. e) é uma anomalia genética, causada pela translocação de um dos cromossomos 21 para um 22.

1.5.9.1

254

Questão 1137 Num dado organismo, foram encontradas células somáticas normais com seis cromossomos (I) e células aberrantes (II e III) cujos cariótipos estão esquematizados a seguir.

Questão 1139 O número de cromossomos de uma espécie é 2n=20. O sistema de determinação do sexo é do tipo ZW. O cariótipo que representa uma euploidia é: a) 20, ZW b) 20, ZZ c) 30, ZWW d) 19, ZO e) 21, ZZW Questão 1140 A figura a seguir ilustra o processo denominado AMNIOCENTESE, utilizado para diagnóstico pré-natal de doenças genéticas. A técnica consiste na remoção de uma pequena quantidade de líquido amniótico (que banha o feto durante o desenvolvimento embrionário) para análise. Nesse líquido são encontradas proteínas e células que se soltam da pele do feto e dos revestimentos das vias gastrointestinais, respiratórias e genito-urinárias. As células imersas no líquido podem ser coletadas por centrifugação e utilizadas para estabelecer culturas de amniócitos. Essas culturas podem ser analisadas citologicamente, ou por análise do DNA.

1.5.9.1

s aberrações cromossômicas dos cariótipos II e III são, respectivamente, do tipo a) monossomia e trissomia. b) monossomia e poliploidia. c) nulissomia e trissomia. d) nulissomia e poliploidia. e) nulissomia e monossomia. Questão 1138 Observe o cariótipo a seguir, obtido a partir de células diplóides de uma pessoa.

1.5.9.1

1.5.9.1

ua análise permite afirmar que ele pode pertencer a uma mulher a) normal, com 47 cromossomos. b) com síndrome de Down. c) com síndrome de Klinefelter. d) com daltonismo. e) com polidactilia.

255

obre o processo acima descrito são feitas várias afirmações. Com base em seus conhecimentos e no texto acima, assinale a alternativa que apresenta um ERRO conceitual ou processual. a) O líquido amniótico funciona como amortecedor de choques mecânicos e propicia um ambiente adequado para o desenvolvimento do feto. b) Células presentes no líquido podem ser utilizadas para a determinação de anomalias cromossômicas. c) O processo pode ser indicado para gestantes com idade avançada, para as quais é maior o risco de terem filhos com Síndrome de Down. d) A cariotipagem pode ainda ser utilizada para a detecção de erros inatos do metabolismo como, por exemplo, a hemofilia. e) A presença de alguns vírus, como o da rubéola, apontam para possibilidade de más formações congênitas na criança. Questão 1141 O daltonismo é um caráter ligado ao sexo na espécie humana. A seguir estão representados os cariótipos de cinco indivíduos que apresentam uma anomalia cromossômica numérica, além de serem todos daltônicos.

odas as afirmações a seguir referentes aos indivíduos representados são verdadeiras, EXCETO: a) O gameta com um cromossomo a mais que deu origem ao indivíduo I foi produzido por não-disjunção na segunda divisão meiótica da gametogênese masculina. b) Ao pai do indivíduo II é obrigatoriamente daltônico, e a não-disjunção que resultou na anomalia pode ter acontecido na gametogênese feminina. c) Se o pai do indivíduo III não for daltônico, a não-disjunção que resultou na anomalia ocorreu na gametogênese feminina. d) Se o pai do indivíduo IV não for daltônico, a não-disjunção que resultou na anomalia ocorreu na gametogênese feminina. e) A mãe do indivíduo V pode ou não ser daltônica. Questão 1142

1.5.9.1

1.5.9.1 Acima, representa-se esquematicamente uma alteração estrutural de um cromossomo que serve de exemplo para o fenômeno denominado a) duplicação. b) deleção. c) translocação. d) transdução. e) inversão. Questão 1143 Uma mulher triplo-X é fértil e produz óvulos normais e óvulos com dois cromossomos X. Sendo casada com um homem cromossomicamente normal, essa mulher terá chance de apresentar a) apenas descendentes cromossomicamente normais. b) apenas descendentes cromossomicamente anormais. c) 50% dos descendentes cromossomicamente normais e 50% cromossomicamente anormais.
256

e) 75% dos descendentes cromossomicamente normais e 25% cromossomicamente anormais.9.d) 25% dos descendentes cromossomicamente normais e 75% cromossomicamente anormais.9. assinale a alternativa que indica a causa mais provável para a infertilidade da F1. b) Durante a meiose ocorrida em F1. em função de alelos incompatíveis. d) existência de um cromossomo X extra. Assinale a alternativa que representa esse cromossomo após um rearranjo do tipo inversão. Questão 1144 Na espécie humana. temos exemplos. III e IV. parte dos cromossomos foi eliminada. Questão 1146 Pela análise dos cromossomas. seguida de reprodução normal na F2: a) O tratamento com colchicina removeu as barreiras químicas existentes nos dois conjuntos de cromossomos. c) existência de um autossomo extra. d) A duplicação do número cromossômico permitiu a formação de 28 pares de cromossomos bivalentes.5. e) falta de um cromossomo X. que florescia. Meristemas desta geração de híbridos (F1) foram submetidos a um tratamento com colchicina.5. também com 2n=28. mas não conseguia produzir sementes. viabilizando a meiose. b) mutação de um gene do cromossomo X. foram cruzadas e criou-se um híbrido.1 Questão 1148 Na figura a seguir. respectivamente. é possível detectar a anomalia que caracteriza a síndrome de Down. ambas com número cromossômico 2n=28. O esquema a seguir apresenta quatro eventos da divisão celular. temos uma célula diplóide 2n = 6 cromossomos. e) A duplicação deu-se apenas com os cromossomos viáveis de cada espécie e o número total foi completado com quebras cromossômicas. pertencentes a gêneros diferentes. c) A primeira geração filial era infértil. que foram seletivamente eliminados em F2. Questão 1145 Duas espécies de gramíneas. 1.1 s eventos possíveis da meiose que levam à síndrome de Down são os de número: a) 1 e 4 b) 1 e 3 c) 2 e 3 d) 2 e 4 Questão 1147 Considere o cromossomo a seguir esquematizado. o que resultou em uma duplicação do número cromossômico. de 257 . que por sua vez produziam sementes normalmente. a anomalia conhecida como síndrome de Down ou mongolismo deve-se à a) mutação de um gene autossômico. De acordo com o texto e os conhecimentos sobre o tema. gerando plantas (F2) com 2n=56. em I. havendo multiplicação apenas do lote haplóide de uma das espécies. Em II. 1.

apresentar alterações. artificialmente. EXCETO a) É resultante do cruzamento de égua com jumento." (ROSA. isto é. vindo de Passa-Tempo. Pessoas com síndrome de Klinefelter possuem 47 cromossomos.Guimarães. inversão paracêntrica. podemos citar o uso da Colchicina. por conseguinte. d) recombinação gênica. b) Tem características morfológicas idênticas às de um dos pais. ( ) nos homens. translocação. 1. miúdo e resignado. também conhecida como trissomia 21: ( ) a causa é a não-disjunção. Assinale nos parênteses V se for verdadeira ou F se a afirmação for falsa. Questão 1152 Muitas aberrações cromossômicas humanas se manifestam como síndromes bem definidas e de fácil constatação pela análise do cariótipo. que induz à a) haploidia. Questão 1150 "Era um burrinho pedrês. b) inversão cromossômica. c) poliploidia. por esse motivo. a produção de espermatozóide ocorre durante todos os anos reprodutivos.1 a) haploidia. e já fora tão bom. J. e) translocação cromossômica.1 Questão 1153 Na Síndrome de Down. d) monossomia.9. Questão 1149 Vegetais maiores. c) monossomia. ocorrem casualmente na natureza. b) haploidia. d) Produz gametas inviáveis. Na tabela a seguir são dados cinco casos cuja veracidade você deverá analisar. translocação. translocação. o fenômeno ocorre quando os cromossomos não se separam durante a primeira divisão meiótica. "Sagarana".5. translocação. mais vantajosos economicamente. inversão paracêntrica. inversão paracêntrica. os cromossomos sexuais são representados por XXY. 1. Conceição do Serro. inversão pericêntrica. e) monossomia.) Todas as alternativas apresentam características biológicas do burrinho referido nesse texto. c) a ocorrência do fenótipo mutante é resultado de um cromossomo extra.9. ou não sei onde no sertão. Como exemplo. Esses vegetais podem ser reproduzidos pelo homem. inversão pericêntrica. como outro não existiu e nem pode haver igual. Com base nessas informações e outros conhecimentos sobre o assunto. entre os quais.Questão 1151 O número de cromossomos da espécie humana pode. é INCORRETO afirmar que a) os pais de um indivíduo Klinefelter têm número normal de cromossomos nas células somáticas. mais vigorosos e. não existindo não-disjunção e. d) a fecundação de um óvulo X por um espermatozóide XY dá origem a um indivíduo Klinefelter. 258 . usando-se técnicas de melhoramento genético.5. c) É um típico exemplo de animal híbrido. não levando à aneuploidia em seus filhos. translocação. às vezes. Chamava-se Sete-de-Ouros. b) a presença de dois cromossomos X impede a manifestação do fenótipo masculino.

comenta em um dos seus artigos: ".. Esta Síndrome pode ser classificada como exemplo de a) Nulissomia. b) substituição. p. e) Triploidia. ( ) os portadores têm uma cópia extra do cromossomo 21. Quanto a esses micronúcleos. Quando bem assistidas.tanto o homem quanto a mulher podem ser portadores de aneuploidias. II . Nélio. d) Euploidia. Questão 1157 Mulheres com Síndrome de Turner caracterizam-se por apresentar baixa estatura. III . preconceito e tautologia em uma única linha. caracteriza-se pela trissomia do cromossomo 21 e decorre do(a) a) erro de disjunção do cromossomo 21 durante a formação dos gametas. b) fecundação de um gameta feminino diplóide por um gameta masculino haplóide. d) I. c) deleção. trabalhar e ter uma vida semelhante à dos demais cidadãos. Questão 1156 Uma pesquisadora analisou células da mucosa bucal de frentistas de postos de gasolina. uma aneuploidia autossômica. Abril 2000: nŽ 159. Pode-se afirmar que a) I e II estão corretas. um exemplo disso é que aproximadamente uma a cada 600 crianças no mundo nasce com síndrome de Down. Rev. podemos supor que se originaram a partir de a) translocação. ( ) o longo período de intervalo entre o início da meiose do tecido ovariano (durante o desenvolvimento fetal) e seu término (na ovulação) é a mais provável razão para a incidência aumentada em mães mais idosas. apresentavam micronúcleos originados em cromossomos defeituosos. 26 Os casos de aneuploidias citados no texto incluíam daltonismo e hemofilia. e) bipartição. c) II e III estão corretas. 259 . d) deslocação.. b) I e III estão corretas. em alguns casos. mas apresenta a doença quando afetado. esterilidade e pescoço alado. "CIÊNCIA HOJE". além do núcleo.daltonismo e hemofilia são alterações gênicas e não cromossômicas. Em função do comentário do professor. e) I está correta. Questão 1158 As anomalias cromossômicas são bastante freqüentes na população humana. d) fato de as células autossômicas dos portadores terem 46 cromossomos.( ) afeta indivíduos que têm um autossoma extra. analise as afirmações abaixo: I . como por exemplo: explique por que o homem não é portador de aneuploidias. podem-se perceber erro conceitual grave. II e III estão corretas. ou um segmento do cromossomo 21. isso se deve à presença de um cromossomo 21 extranumerário. Questão 1154 A Síndrome de Down. c) senilidade dos ovócitos em mulheres com idade a partir dos 35 anos." BIZZO. professor da Faculdade de Educação da USP. Na grande maioria dos casos. pessoas com síndrome de Down alcançam importantes marcos no desenvolvimento e podem estudar. c) Trissomia. b) Monossomia. Questão 1155 FALHAS NO ENSINO DE CIÊNCIAS "ERROS EM LIVROS DIDÁTICOS AINDA PERSISTEM EM ESCOLAS DE MINAS E SÃO PAULO" Nélio Bizzo O autor. translocado para outro cromossomo.o livro confunde herança ligada ao sexo com aneuploidias. Foram encontradas muitas células que.

1. (64) podem acontecer devido a erros na duplicação do DNA.9. julgue os itens abaixo. (2) Os erros na distribuição de cromossomos que levam às aneuploidias são freqüentes no processo de meiose e raros nas mitoses. (32) ocorrem preferencialmente em populações de menor renda. (1) As fibras do fuso acromático têm importância fundamental para as migrações cromossômicas características da anáfase.5. com a indicação do número de cromossomos autossômicos (A) e dos tipos de cromossomos sexuais (X e Y). causadas por não-disjunções cromossômicas. pode-se afirmar que o indivíduo é: a) trissômico. (04) ocorrem somente em filhos e filhas de mulheres de idade avançada. (3) As aberrações cromossômicas numéricas causam grandes alterações no funcionamento celular.1 260 . Questão 1161 1.9. em esquema. os machos normais apresentam complemento cromossômico igual a 2n=6. Entretanto.5. d) haplóide. presentes em cada uma delas. b) poliplóide. (4) As síndromes de Down e de Turner.XY. células de seis indivíduos. (08) estão intimamente ligadas à separação incorreta dos cromossomos na meiose. produzindo doenças graves e até mesmo a morte. é CORRETO afirmar que: (01) podem ocorrer tanto na espermatogênese quanto na ovulogênese.Sobre as anomalias do número de cromossomos. onsiderando-se os dados anteriores. (16) ocorrem ao acaso. devido a um erro na gametogênese. Questão 1160 A figura abaixo esquematiza a não-disjunção cromossômica.1 Os quadrados a seguir representam.5. Questão 1159 Em uma certa espécie de animal selvagem. são exemplo de trissomia e de monossomia. (02) ocorrem mais em meninas do que em meninos.9. numerados de 1 a 6. c) triplóide. com menor escolaridade e pouca assistência médica. e) monossômico.1 A respeito desse tema. um indivíduo anormal foi identificado na população e seu cariótipo foi representado pela seguinte forma: 1.

d) I e III. Está(ão) correta(s) a) I apenas b) II apenas. b) II. apenas. sendo dois X e um Y e 45 cromossomos. Turner e Down. Questão 1166 Analise as afirmativas a seguir a respeito das mutações. e) II e III. respectivamente. c) I e II. a forma e o tamanho dos cromossomos. e) a I. b) Morgan. d) substituição das três primeiras bases nitrogenadas por outras. o chamado ADN lixo Questão 1164 As alterações do número de cromossomos. apenas. o que evita a permuta gênica entre eles d) Aos cromossomos X menos um serem inativados ainda na fase do desenvolvimento embrionário e) Ao cromossomo X ser o cromossomo com maior quantidade de ADN repetitivo. e) Klinefelter. II . O indivíduo 4 pode ser do sexo masculino ou do sexo feminino. Turner e Klinefelter. d) somente a II e a III. Turner e Klinefelter. d) Down. apenas. A célula do indivíduo 2 pode ser igual a de um gameta do indivíduo 1. tais como: presença de um cromossomo 21 a mais. I . 5 e 6 são normais e pertencem à espécie humana. Os indivíduos 3. leia as afirmações a seguir.m relação a estes indivíduos. Questão 1162 A respeito das mutações. 47 cromossomos. tendo apenas um X. a II e a III.Ocorrem para adaptar o indivíduo ao ambiente. e às células representadas.As mutações ocorridas em células somáticas são de grande valor adaptativo para a perpetuação da espécie.Sempre que o ambiente se torna desfavorável. apenas. I . c) III apenas. I. Estão corretas as afirmações: a) I. apenas. c) substituição da quarta base nitrogenada por outra. b) somente a I e a II. c) somente a I e a III. Em relação ao cromossomo sexual X são conhecidos casos de recém-nascidos do sexo feminino com trissomia. Down e Morgan. determinam.Podem alterar o número. o ser vivo reage sofrendo uma mutação gênica. III . II . 261 . III .As mutações transmitidas às gerações futuras são aquelas que ocorrem em células germinativas. c) Turner. Questão 1163 Na espécie humana. b) supressão das três primeiras bases nitrogenadas. II. III. as síndromes de: a) Down.Ocorrem em células sexuais e somáticas. Questão 1165 Considere um segmento de DNA com seqüência de bases indicadas a seguir: TTA TCG GGA CCG ATC ATC GTA A alteração mais drástica que esta molécula pode sofrer é a: a) supressão da segunda base nitrogenada. foram feitas as afirmações seguintes. e) inclusão de mais três bases nitrogenadas no final da molécula. tetrassomia e até pentassomia desse cromossomo. A que se deve esse fato? a) Ao cromossomo X ser um dos menores cromossomos do conjunto haplóide b) Ao cromossomo X ser basicamente formado por heterocromatina com poucos genes estruturais c) Ao cromossomo X não ter uma pequena parte homóloga ao cromossomo Y. é conhecida a trissomia do cromossomo 21 (síndrome de Down). Klinefelter e Turner. A(s) afirmação(ões) correta(s) é(são): a) somente a II. que é um dos menores cromossomos da espécie.

d) excreção.3 onsiderando as moléculas III. "A medusa e a lesma". e) II e III apenas. II. d) uma base púrica substituir uma pirimídica no RNA mensageiro que a codifica. Um par de bases nitrogenadas está identificado. c) o erro ser corrigido pela célula durante a tradução. b) durante sua síntese houver variação dos tipos de RNA transportadores. muitas vezes não resultam em substituição efetiva do aminoácido correspondente ao códon mutado na proteína produzida. b) somente 2.). uma adenina sofreu uma desaminação e transformou-se em hipoxantina (H).5. Nova Fronteira. e) os genes mutados não serem transcritos ou traduzidos. Questão 1170 Diversas doenças estão relacionadas a mutações no material genético. b) reprodução.. com a alteração de apenas uma base nitrogenada. dizemos. b) ocorre exclusivamente pela ação de agentes mutagênicos. 1979). a mutação no par de bases indicado estará presente em a) somente 1. Questão 1171 O esquema a seguir mostra dois ciclos de replicação de moléculas de DNA. 3 e 4. e) origina somente combinações gênicas adaptativas. c) excitabilidade.. e) mutação. c) sua síntese ocorrer no complexo de Golgi e não no retículo endoplasmático rugoso. RJ. de modo que podemos esperar baixa variabilidade na sua população. mutações pontuais. Isto se dá devido ao fato de: a) o código genético ser universal. b) o código genético ser repetitivo ou degenerado. ed.d) I e II apenas. base que normalmente emparelha-se com citosina (C). É ela: a) seleção natural. nos organismos eucariontes a) constitui a principal fonte de variabilidade genética. Após a replicação da molécula I. Questão 1168 A mutação gênica. mas a idéia não nos agrada muito. e a música não existiria (. Esse texto refere-se a uma característica dos seres vivos. Sem esse atributo especial. Questão 1169 "A capacidade de errar ligeiramente é a verdadeira maravilha do DNA. Questão 1172 Leia as afirmativas a seguir: I. Questão 1167 A estrutura química de uma proteína poderá ser modificada se a) durante sua síntese houver variação dos tipos de aminoácidos disponíveis no citoplasma celular. 1. c) origina apenas seres recessivos. seríamos ainda bactéria anaeróbia. d) o código genético não poder sofrer alterações. As cianofíceas reproduzem-se apenas assexuadamente. Errar é humano.9. Mutações podem ocorrer espontaneamente ou serem 262 . e é mais difícil ainda aceitar o fato de que errar é também biológico" (Lewis Thomas. e) o DNA não se duplicar durante a intérfase. d) somente 3 e 4. c) somente 1 e 2. Porém. 2. e) 1. d) ocorre devido a alterações na molécula de DNA.

(Org. II e III. No entanto (.3 erificou-se que certos fungos mutantes só conseguem sintetizar arginina quando a ornitina é acrescentada ao meio de cultura.) A evolução biológica se dá através de uma grande e inexorável seqüência de tentativas e erros .). Esses fungos devem ter sofrido mutação no gene a) X. somente. apresentada por 3% dos pacientes estudados. a sobrevivência dos indivíduos de uma determinada espécie depende da estabilidade genética. Essa alteração na seqüência de DNA e a eliminação do indivíduo são fenômenos que podem ser explicados pela ocorrência. As coisas são assim. A afirmativa está CORRETA em: a) I. capaz de destruir um organismo. respectivamente.. Daniel C. In: BROCKMAN.induzidas. por ter sido transmitida de geração em geração. b) Y. e MATSON K. eles são.5. Questão 1173 Em certo fungo. b) I e II apenas. (. e) II apenas.9.e sem os erros as tentativas não teriam levado a nada. os cientistas afirmaram que a imunidade está relacionada a uma mutação genética. como aquelas provocadas pelos raios X. III. Os cientistas consideraram esse percentual muito elevado. é: a) impedir a multiplicação de determinado vírus no interior das células .. A característica da mutação. que permite que ela ocorra em grande número de indivíduos. J. d) X ou no gene Y.) O processo que se relaciona com o conceito de evolução biológica apresentado pelo autor é: a) reparação das lesões gênicas b) indução de mutações programadas c) geração de organismos transgênicos d) alteração aleatória na estrutura do DNA Questão 1177 As mutações representam um importante mecanismo evolutivo para os organismos. pode ocorrer uma alteração permanente numa seqüência de DNA. de: a) especiação e ortogênese b) mutação e seleção natural c) oscilação genética e epigênese d) variação hereditária e isolamento ecológico Questão 1176 Cometer erros é a chave para o progresso.) os erros não são apenas oportunidades valiosas para aprendermos. c) II e III apenas. somente.pergunte a qualquer cirurgião ou piloto de avião. a única oportunidade para aprendermos algo relativamente novo. Questão 1174 Recentemente cientistas confirmaram suas suspeitas de que existem pessoas imunes à AIDS. c) Z. Uma das conseqüências deste fenômeno está descrita na seguinte alternativa: a) limitação da diversidade biológica 263 1. (Adaptado de DENNETT. Há momentos em que é importante não cometer erro algum . Entretanto. São Paulo: Cia. ocorre a seqüência de reações a seguir esquematizada que leva à síntese do aminoácido arginina.. das Letras. somente. b) evitar a ação de agentes externos sobre os genes c) representar uma vantagem para a sobrevivência d) ocorrer em resposta à necessidade de adaptação Questão 1175 Durante o processo evolutivo. de forma significativa. A partir do estudo de um grupo de 1850 pessoas. Mutações constituem um fator causador de variabilidade. 1997. d) I apenas.. e) X ou no gene Z.

9. c) A seqüência pertence a um DNA e pode codificar um polipeptídeo contendo. b) a elevação do número de indivíduos HH está associada ao aparecimento de indivíduos HÞH infectados. nesse caso. b) aumenta a freqüência de crossing-over. Com base nas informações apresentadas.3 1.3 odas as afirmativas são corretas quanto à seqüência. e) a seleção natural.5. a) Mutação. c) aumenta o número de alelos disponíveis em um locus. o qual é reconhecido pelo anti-códon GCU. Questão 1179 Observe a seqüência de bases nitrogenadas.5. c) Seleção natural. e) Oscilação gênica.b) criação de novas variantes de seres vivos c) extinção de espécies nocivas ao ambiente d) produção exclusiva de alterações benéficas Questão 1178 Indivíduos portadores do genótipo HÞH sofrem uma mutação gênica no cromossomo 11 e expressam anemia falciforme ou siclemia. durante um certo tempo. pode resultar na troca do aminoácido respectivo na proteína. 1. em quaisquer das trincas indicadas. analise a figura a seguir que representa uma população isolada. d) Recombinação gênica. 264 . pelo menos. c) os genótipos HH e HÞH estão igualmente adaptados ao longo do tempo. em uma determinada região africana que possui casos de malária. Questão 1181 Pode-se afirmar que a mutação a) sempre ocorre para adaptar o indivíduo ao ambiente. e) A troca da primeira base. prioriza os indivíduos HH. pode-se concluir que a) o aumento do número de indivíduos HÞH está diretamente associado ao aparecimento de casos de malária. Sabendo-se que o continente africano possui alto índice de malária e que o 'Plasmodium malariae' tem dificuldade de sobreviver nas hemácias de indivíduos portadores do genótipo HÞH. b) A mutação da 3  base na trinca indicada por 9 pode traduzir um aminoácido diferente. EXCETO a) A introdução de uma adenina (A) entre as trincas indicadas por 2 e 3 pode alterar toda a transcrição a partir desse ponto. d) a variação do meio. d) A trinca indicada por 5 pode transcrever um códon CGA. b) Fluxo gênico.9. 27 aminoácidos. em uma população. Questão 1180 Assinale a alternativa que indica o fator que conduz ao surgimento de variabilidade gênica nova. em um período de tempo. d) sempre é dominante e prejudicial ao organismo. desfavorece os indivíduos HÞH.

5. em uma determinada macieira.LISINA. espera-se que as árvores originadas das sementes dessa maçã produzam frutos a) todos de casca amarela. II.lisina . a fita que será transcrita apresenta a seqüência de nucleotídeos TAA TGT CGA TTC e codifica. Esses aminoácidos possuem mais de um códon de DNA. TAG ou TAT treonina = TGA.3 onsiderando-se que. As mutações podem ocorrer tanto em células somáticas como em células germinativas. e) reprodução sexuada. I.alanina . e) lisina . Assinale a alternativa que contém todas as afirmações corretas. mas apenas causadas por fatores mutagênicos. TGG. III e IV. pode-se prever que a seqüência de A respeito das mutações gênicas. CGC ou CGT lisina = TTT ou TTC Se ocorrer mutação e a nova seqüência de nucleotídeos for TAT TGT CGA TAA. d) alguns de casca amarela e outros de casca vermelha.treonina .treonina. aminoácidos da proteína será a) isoleucina .9.isoleucina.alanina . para a seqüência de aminoácidos. e) alguns de casca amarela. c) lisina . tais como agentes químicos e físicos. CGG. III e V. III. um dos frutos.isoleucina . c) seleção natural. Questão 1183 Em um determinado gene. As mutações são fatores importantes na promoção da variabilidade genética e para a evolução das espécies. o que chamamos de fruto é um pseudofruto. III e V. ou seja. 265 .Questão 1182 A coloração vermelha da casca da maçã é determinada geneticamente. d) II. TGC ou TGT alanina = CGA.isoleucina. b) I.alanina . no qual a parte comestível desenvolve-se a partir do receptáculo da flor. b) isoleucina . independentemente do seu sistema reprodutivo. V. na maçã. d) treonina . Um alelo mutante determina casca de cor amarela. b) recombinação gênica.TREONINA .treonina . foram apresentadas as cinco afirmações seguintes. IV.alanina . Apenas as mutações que atingem as células germinativas da espécie humana podem ser transmitidas aos descendentes. Um produtor de maçãs verificou que.lisina. Questão 1184 Vários são os processos que atuam na evolução. ISOLEUCINA . II e III. d) reprodução assexuada.lisina . a) I. outros de casca vermelha e outros de casca bicolor.treonina. b) todos de casca vermelha. ao invés de apresentar casca vermelha. Somente as mutações ocorridas em células somáticas poderão produzir alterações transmitidas à sua descendência. como representado na figura. apresentava casca com as duas cores. o único que fornece material genético novo a um determinado conjunto gênico preexistente é a: a) mutação gênica. As mutações não podem ser espontâneas.treonina .ALANINA . IV e V. Questão 1185 1. isoleucina = TAA. e) II. Dentre eles. c) todos de casca bicolor. c) I.

o que resultou em pequenos tumores na pele. que resulta sempre de segregação ou recombinação cromossômica. c) só herdará os tumores se for do sexo masculino. apenas b) 1 e 3. apenas 266 . e) tornaram-se estéreis. que era: TAC CTT ATA GAT Ocorreu uma mudança na terceira base. ela a) só herdará os tumores se tiver ocorrido dano em um gene dominante. II e IV. Caso ele venha a ser pai de uma criança. b) II e III. podemos esperar várias reações. d) herdará os tumores. d) tornaram-se albinos. EXCETO: a) produção de um filhote albino. Após o experimento. a) ATC GAA TAT CTA b) ATG GAA TAT CTA c) AUC UAU AAG GUA d) AUC GAA UAU CUA e) AUG G GAA UAU CUA Questão 1187 Uma experiência realizada com coelhos (linhagem pura selvagem) consistiu em submetê-los a uma descarga excessiva de raio-X. os quais. Questão 1189 Um surfista que se expunha muito ao sol sofreu danos em seu DNA em conseqüência de radiações UV. causados por diversos poluentes ambientais. Questão 1188 Atualmente são bem conhecidos os efeitos adversos à saúde humana. e) não herdará os tumores. II . Está(ão) correta(s): a) 1. c) I. b) só herdará os tumores se tiver ocorrido dano em dois genes recessivos. pois houve dano no material genético.Questão 1186 Uma bactéria sofre uma mutação pontual em uma região do seu DNA. especialmente aqueles que possuem potencialidades mutagênicas ou carcinogênicas.Mutações são modificações bruscas do material genético que podem ser transmitidas à prole (descendência ou células filhas). Indique o RNA mensageiro codificado pela seqüência de DNA mutada. químicos ou biológicos com potencial mutagênico. As mutações do tipo substituição de base acarretam a alteração de vários aminoácidos nas proteínas. 2. que passou de citidina a guanina. podem causar mutações e doenças nas gerações futuras. IV . devido à sua interação com mecanismos genéticos. Questão 1190 Analise as proposições: 1. b) produção de filhotes anormais. Assinale as afirmações corretas: I .Mutação é toda alteração do material genético. e) III. Modificações hereditárias que ocorrem num locus específico são chamadas de mutações gênicas.Mutações gênicas podem ser causadas por poluentes ambientais e provocar alterações responsáveis pelo aparecimento de genótipos diferentes numa população. apenas c) 3. apenas d) 1. III . c) morte em conseqüência da dose de radiação. A alternativa que contém as afirmações corretas é: a) I e III. 3. Os principais agentes mutagênicos são as radiações ionizantes e os raios-ultravioleta.A mutação pode ser espontânea ou induzida por agentes físicos. d) IV e III. 2 e 3 e) 2.

800 Angstrons. onde recebem grande quantidade de antígenos. o que reduzirá a mortalidade infantil em pelo menos um terço. retirado de pessoas que já tiveram a doença. O corpo. criados em laboratório. d) não é herdável. como os cavalos. queimaduras. for aplicada uma segunda dose do mesmo antígeno. reconhecidos pelo corpo como antígenos. a serem cumpridas até o ano 2. envelhecimento precoce e câncer de pele. Para que esta meta seja atingida. recentemente. tais como lesões na retina. c) 2.000.V. Questão 1192 O gráfico mostra o espectro de absorção de raios ultravioleta (U. a utilização de câmaras de bronzeamento artificial. d) não consiga reagir a essa segunda dose. com duração de 15 a 30 minutos cada uma. e) o soro obtido através do sangue de animais. Questão 1193 Os meios de comunicação têm noticiado que a Unicef (Fundo das Nações Unidas para a Infância) estabeleceu como uma das metas. e) produza anticorpos mais rapidamente.500 Angstrons. b) um medicamento eficaz no combate à doença já instalada e que produza no corpo uma reação para a fabricação de anticorpos específicos e resistentes. apresentou. porque a mutação resultante é recessiva. d) o plasma. imunizado.9. visando diminuir os riscos dessa prática. e) é herdável.600 Angstrons. para que o corpo produza antígenos e anticorpos específicos. indícios de câncer de pele. porque provoca alteração em células germinativas. o comprimento de onda em que será obtida maior taxa de mutação é a) 2. Se.Questão 1191 A ANVISA (Agência Nacional de Vigilância Sanitária) normalizou. espera-se que o organismo: a) reaja da mesma forma como reagiu à primeira dose. EXCETO: a) pâncreas b) amídalas c) baço d) timo e) gânglios linfáticos Questão 1195 1. porque provoca alteração do DNA.5. c) vírus ou bactérias mortos ou atenuado que. b) 2. que consiste em injetar no organismo: a) vírus ou bactérias vivas para provocar a doença de forma branda. c) é herdável.4 Considerando a ação desses raios na célula.700 Angstrons. e) 2. por estar imunizado. porque a mutação resultante é dominante. d) 2.400 Angstrons. b) não é herdável. a imunização de 90% das crianças. quatro meses depois. c) não produza mais anticorpos. uma vez que as radiações UV danificaram seu DNA. produzirá antígenos específicos. 267 . porque provoca alteração em células somáticas.) por uma proteína e por um ácido nucléico. Uma mulher que se submeteu a dez sessões intercaladas de bronzeamento. Pode-se afirmar que esse tipo de câncer a) é herdável. após algum tempo. é necessária a vacinação. produziu anticorpos específicos. induzam a produção de anticorpos específicos. b) reaja sem utilizar seus anticorpos. como resposta imune. Um organismo recebeu uma primeira dose de um antígeno X e. Questão 1194 Todas as estruturas citadas a seguir podem ser ligadas à defesa do organismo.

porque já contém anticorpos. portanto ela não pode destruir o que a produz e) é que o vírus impede a ação da vacina.10 a) na época do nascimento a criança não está protegida.5. Para a imunização de cada uma das crianças foram utilizados dois procedimentos diferentes: Criança I: aplicação de soro imune Criança II: vacinação. c) vacina. no caso o vírus "A" d) é que a vacina é feita de vírus. c) o recém-nascido não produz anticorpos.Questão 1196 A variação da quantidade de anticorpos específicos foi medida por meio de uma experiência controlada. e) vacina. que são específicos aos seus antígenos. pois produz poucos anticorpos. porque estimula o organismo a produzir anticorpos. você deverá procurar recurso através de a) vacina. pois não produz os próprios anticorpos. b) antes do nascimento o feto nunca produz anticorpos. e) após o nascimento a criança depende dos anticorpos maternos. inibindo a sua atividade de defesa. O gráfico que melhor representa as taxas de variação da quantidade de anticorpos nas crianças I e II é: Existe um erro de fundamento biológico na historinha da tirinha. que é o sistema "chave-fechadura" Questão 1198 Ao ser picado por uma cobra peçonhenta. Questão 1199 1. embora já esteja produzindo os seus. d) soro. porque já contém anticorpos.10 1. d) após o nascimento a criança depende completamente dos anticorpos maternos. os anticorpos. Assinale a alternativa que esclarece o erro: a) é que vírus do tipo "A" não sofre efeito de vacina alguma b) é que a vacina não combate vírus.5. porque contém antígenos específicos. b) soro. 268 .10 Questão 1197 Leia com atenção a tirinha de Frank & Ernest A análise do gráfico permite concluir que 1. somente doenças causadas por bactérias c) é que a vacina não combate vírus. em duas crianças durante um certo período de tempo.5. ela proporciona ao nosso organismo produzir defesas. porque estimula o organismo a produzir anticorpos.

O segundo caso na Vila Antártica. o procedimento mais adequado que deverá ser tomado pelas autoridades da referida cidade será a) promover campanha para localização e eliminação das colônias de morcegos nas áreas urbana e rural. O animal estava caído e se debatendo. recebeu outra dose. Se após certo tempo for aplicada uma segunda injeção da toxina no animal. quando foi visto por estudantes. De acordo com o gráfico. que reagem liberando histaminas. A Secretaria Municipal de Saúde registrou mais um caso de morcego positivo para raiva na cidade de Botucatu. c) produza anticorpos mais lentamente na segunda dose. pois apenas os morcegos hematófagos. Este é o terceiro caso de raiva em morcego registrado este ano em Botucatu. 06. no final do mês de julho.08. 1. e) desconsiderar o ocorrido e informar a população que não tenha receio. espera-se que o organismo a) reaja mais rapidamente na segunda dose. e) são fagocitadas pelos mastócitos e estimulam a fabricação das interleucinas. uma grande proliferação de linfócitos específicos. c) são reconhecidas pelas células de memória. que são reconhecidas por um tipo especial de anticorpo.2006) Para se evitar a contaminação da população humana com o vírus da raiva. d) reaja sem produzir anticorpos. d) ligam-se aos anticorpos e migram para os órgãos imunitários primários onde são destruídas. Questão 1201 DETECTADO FOCO DE MORCEGO COM RAIVA EM BOTUCATU. 269 . d) não produza mais a antitoxina por estar imunizado. espera-se que ele a) não resista a essa segunda dose. nos gânglios linfáticos. representam risco de transmissão da raiva. d) promover campanha para a vacinação anti-rábica da população humana. os alergênicos. b) não consiga reagir a uma segunda dose. SP. Confirmada a presença do vírus causador da raiva em um morcego apreendido em uma praça no centro da cidade. e) produza menor quantidade de antitoxina. após algum tempo. b) medicar com antibióticos específicos os animais domésticos que tenham entrado em contado com os morcegos. Questão 1202 Um coelho recebeu. c) produza a antitoxina mais rapidamente. A reação alérgica ocorre quando as moléculas do alergênico a) ligam-se a moléculas do anticorpo presas à membrana dos mastócitos. b) desencadeiam. O morcego encontrado é da espécie 'Myots sp' e alimenta-se de insetos. e) reaja na segunda vez. (Portal da Prefeitura Municipal de Botucatu. mas não os frugívoros ou insetívoros. pela primeira vez. produzindo menos anticorpos.2006) MAIS UM CASO DE MORCEGO POSITIVO PARA RAIVA NA CIDADE DE BOTUCATU. (Portal "Estadão".06.5. c) antecipar a vacinação anti-rábica de cães e gatos nas regiões onde os morcegos foram encontrados.Questão 1200 Analise o gráfico que se segue. O morcego doente era da espécie que se alimenta de frutas. Questão 1203 A alergia é uma hipersensibilidade desenvolvida em relação a determinadas substâncias. na região central da cidade. que se reproduzem e fabricam grande quantidade de histaminas. 18. a injeção de uma toxina bacteriana e manifestou a resposta imunitária produzindo a antitoxina (anticorpo). pois já está imunizado. b) demore mais tempo para produzir a antitoxina.10 m organismo recebeu uma dose de um antígeno X e. O animal foi encontrado caído em uma praça nas proximidades do centro. O primeiro foi notificado no início do mês de junho.

d) células brancas produzidas por animais. d) Falta de veneno em quantidade suficiente para a obtenção do soro. para a produção de soro no combate à epidemia de peste bubônica. c) soro de indivíduos previamente imunizados contra aquele patógeno. e) certamente deverá estar no mercado dentro de pouco tempo. protegendo o organismo. Questão 1207 "Os cientistas examinaram 11 homens aidéticos. famoso pelo seu serpentário. aos a) trombócitos e fagocitose. que se multiplicam no corpo do indivíduo que recebe a vacina. que estimulam a resposta imunológica do indivíduo. d) neutrófilos e clasmocitose. e) Falta de animais com características adequadas para a produção do soro. b) euritrócitos e pinocitose. c) precisa ser feita contra a forma normal do HIV. Questão 1206 Consideramos uma vacina um material que contém: a) anticorpos contra determinado patógeno. b) anticorpos contra determinado patógeno produzidos por outro animal e que fornecem proteção imunológica. quando aparecem CÉLULAS DE DEFESA que ATRAVESSAM OS CAPILARES e caem no tecido conjuntivo. d) é fácil de ser efetuada. dos quais 5 nunca tinham usado medicamentos anti-HIV e 6 haviam usado. c) leucócitos e diapedese. Das alternativas a seguir. Verificaram que 8 pacientes apresentavam novas mutações do vírus. mas não causar a doença. 1. foi fundado por Vital Brazil. Os termos destacados referem-se. b) O êxodo rural e a maior concentração da população humana em centros urbanos.Questão 1204 Uma lesão na pele pode infeccionar. c) A imunização garantida pela administração do soro. tendo em vista a estabilidade do HIV. resistentes às drogas ministradas e passíveis de serem transmitidas a outras pessoas. capaz de estimular a resposta imunológica. assinale aquela que contém argumento válido e que explica a menor procura por antivenenos no Brasil. Segundo o Instituto "a demanda da produção de antivenenos vem diminuindo gradativamente no Brasil." Pela análise do texto. Hoje é um centro de pesquisa reconhecido mundialmente na área de biomédicas produzindo diversos tipos de soros antitóxicos e antivenenos. pode-se concluir que a fabricação da vacina anti-AIDS a) apresenta os mesmos problemas que a da vacina contra a gripe. Questão 1205 O Instituto Butantã. a) As reações alérgicas e a alta mortalidade provocada pela aplicação do soro. é possível oferecer os seus soros para outros países". em fevereiro de 1901. b) só pode ser feita contra as formas mutantes do HIV. Questão 1208 Observe a figura a seguir. Sendo assim. e) um patógeno vivo enfraquecido ou partes dele. respectivamente.5.10 270 .

O processo envolve a inoculação direta do DNA plasmidial. em intervalos diferentes. foram feitas as seguintes afirmações: I. "Scientific American". Otto. que representa a atividade de células T citotóxicas. A imunidade desenvolvida pela vacina de DNA não é imediata. (Fonte: Desenvolvimento de vacinas gênicas. a) A toxina diftérica funciona para o cavalo como uma vacina. que será expressa e produzida no interior das células do indivíduo. Questão 1211 Em relação à figura a seguir. induzindo a formação de anticorpos. diphtheriae'. pois não determinam imunidade e sim doenças. 1984. que possui o gene codificador da proteína antigênica. assinale a afirmativa INCORRETA. mas é de longa duração. d) O gráfico acima exemplifica ação das vacinas. e) Para o sistema imunológico da cobaia A. Questão 1210 A vacina de DNA é a mais recente forma de apresentação de antígeno que veio revolucionar o campo da vacinologia. para verificar a atividade letal da toxina na ausência do soro. São afirmações CORRETAS: a) I e II b) II e IV c) III e IV d) I e III 1.tapas na preparação do soro terapêutico.) Com base no texto. Patógenos vivos não podem ser usados como vacina. O gráfico a seguir representa o resultado de duas aplicações de mesmo antígeno. pois fornece para o hospedeiro a informação genética necessária para que ele fabrique o antígeno preservando todas as suas características importantes na indução de uma resposta imune eficiente. a antitoxina diftérica é um corpo estranho. O indivíduo geneticamente vacinado passa a produzir tanto os antígenos quanto os anticorpos. MICROBIOLOGIA E IMUNOLOGIA.5. b) A dose de reforço provoca produção maior e mais rápida de anticorpos. EXCETO: a) Doenças diferentes em intervalos menores de tempo provocariam a mesma intensidade de produção de antígenos. II. c) O tipo de imunização explicitado é ativa. III. Assinale-a. Esse tipo de vacina apresenta uma grande vantagem sobre as demais. Fonte: Bier. pode-se fazer todas as afirmações.10 correto afirmar. c) A injeção de antitoxina e de toxina na cobaia A é usada como controle para testar a eficácia da primeira na inativação da segunda. Questão 1209 Os anticorpos são proteínas específicas de defesa do corpo. 1999. EXCETO uma. Isso sem gerar os efeitos colaterais que podem aparecer quando são utilizados patógenos vivos. 271 . Em relação aos procedimentos observados na ilustração anterior. Os antígenos produzidos pelo DNA plasmidial são capazes de combater patógenos que infectem o hospedeiro. d) Um animal imunizado com toxina diftérica está protegido da infecção por 'C. IV. ou os problemas proporcionados pela produção das vacinas de subunidades em microorganismos. b) A injeção de toxina na cobaia B é utilizada como controle.

Aplicada em 36 voluntários saudáveis. e células de memória. Segundo Druilhe e seus colegas. b) Secreções mucosas . b) manter limpos quintais. d) Descamar da epiderme . c) As células T citotóxicas podem atacar algumas células tumorais.5. c) Lágrima . que produzem anticorpos e têm vida longa. d) A degradação ou lise da célula infectada não necessita do reconhecimento e da fixação da célula T citotóxica. a fórmula induziu a produção de anticorpos contra a doença. c) Apesar de muito antiga. d) tomar vacina como mecanismo de prevenção ou usar soro de preferência polivalente em caso de picada acidental. cardiotóxica. c) aparar a grama dos jardins e recolher folhas caídas. Esses venenos podem apresentar ação neurotóxica. d) O ciclo vital desse parasita envolve um curto período na corrente sangüínea. bastando que esta esteja ativada. O controle e prevenção de acidentes com esses animais podem ser feitos tomando-se os seguintes cuidados. contém lisozima. hemolítica. trata-se do "primeiro teste clínico de uma vacina contra a malária a demonstrar claramente sua atividade contra o parasito". b) Se o organismo apresentar imunidade positiva contra o parasita. que realizam o ataque e morrem. uma célula T citotóxica pode separar e atacar outra célula-alvo. Questão 1214 a) Após efetuar um "ataque letal". Em uma pessoa 272 .lubrifica e limpa. b) As células T citotóxicas matam células que apresentam antígenos na superfície por meio da secreção de perforinas e linfotoxinas.1. moscas e outros insetos. necrosante.opõe-se à colonização da pele por alguns patógenos. 09/11/2005) Assinale a afirmativa INCORRETA. (Fonte: "Folha de S. um linfócito ativado produz dois tipos de células-filhas: células efetoras.previnem a entrada de patógenos e substâncias estranhas. os quais se mostraram capazes de atacar o parasito 'Plasmodium falciparum'. Questão 1212 As defesas inatas dos organismos são geralmente mecanismos de proteção que inibem a entrada ou o desenvolvimento de organismos causadores de doenças. EXCETO: VACINA RESISTE A PARASITO DA MALÁRIA Pesquisadores liderados por Pierre Druilhe. Questão 1215 A memória imunológica e imunidade resultam da seleção clonal. a) O objetivo do uso da vacina é ativar o sistema de defesa do organismo contra invasores através da produção de anticorpos. a malária continua sendo um dos principais problemas de saúde pública no mundo. do Instituto Pasteur. Paulo". jardins e terrenos baldios.prendem microorganismos no trato digestivo e respiratório. dizem ter realizado com sucesso a primeira fase de testes clínicos (em humanos) de uma vacina contra a malária. não acumulando entulho e lixo doméstico. pode-se afirmar que a vacina foi eficaz contra todos os parasitos do mesmo filo. Assinale a alternativa que NÃO apresenta a relação correta entre o fator de defesa e sua função. que destrói bactérias. Os pesquisadores ainda precisam realizar mais duas fases de testes clínicos antes de confirmar a eficácia da fórmula. uma fase de invasão e diferenciação nos hepatócitos e uma fase intra-eritrocítica. células de tecidos transplantados e células infectadas por vírus. em Paris. De acordo com a teoria clonal. apresentando o mesmo antígeno. Questão 1213 Aranhas e escorpiões podem apresentar efeito peçonhento ao homem. a) Fagócitos .10 a) colocar lixo em sacos plásticos e mantê-los bem fechados para não atrair baratas.

há uma fase de espera antes de o número de moléculas de anticorpos e células T aumentar. São exemplos destas células. que controlam lentamente o invasor. d) Promoção imediata de resposta imune secundária. 273 . 30/08/2005. responsáveis por 90% dos 20 mil acidentes anuais com cobras no Brasil. é INCORRETO afirmar: a) A imunidade dos gambás sul-americanos ao veneno das jararacas foi naturalmente selecionada. d) circulação linfática. a DM43 e a DM64 parecem especificamente talhadas para neutralizar os principais efeitos do veneno das serpentes da família das viperídeas. c) produção de uréia. repetidas vezes. após um certo espaço de tempo. Questão 1216 "Por décadas os cientistas tiveram de quebrar a cabeça para criar antídotos contra o veneno das cobras. c) macrófagos e linfócitos. e) leucócitos e linfócitos. c) Os linfócitos de gambá reagem a picadas das jararacas produzindo soro antiofídico que pode ser letal para as cobras. a um mesmo tipo de antígeno (ex. enquanto a outra neutraliza as substâncias que matam as células musculares de quem é picado. b) Essa resistência dos gambás ao veneno de serpentes viperídeas é determinada geneticamente." Fonte: Extraído da Reportagem: Sangue de gambá contém soro antiofídico do Jornal "Folha de S. descobriram que uma solução potencialmente melhor foi 'desenvolvida' ao longo de milhões de anos pelos gambás sul-americanos. respectivamente: a) linfócitos e basófilos. d) eritrócitos e macrófagos. que têm função antiofídica. c) Na primeira exposição ao antígeno. uma resposta do organismo.Paulo". A primeira molécula se opõe à ação dos compostos do veneno que causam forte hemorragia na vítima ao impedir a formação de coágulos. com produção de células efetoras e de memória. d) Um dos componentes do veneno da jararaca poderia ser útil na prevenção de tromboses. embora elas mesmas não sejam anticorpos. Analisando o texto e de acordo com seus conhecimentos. Questão 1218 Uma pessoa que tivesse seriamente comprometida a atividade dos plasmócitos teria problemas com a a) produção de anticorpos. São Paulo: Saraiva. b) circulação venosa.1999. Bio. 1. São glicoproteínas que apresentam estrutura parecida com a de substâncias do sistema de defesa do organismo. EXCETO: a) Ativação de resposta imune primária e produção de clones de células efetoras e de memória pelos linfócitos. e) produção de toxinas. entre as quais se incluem as jararacas. b) Maior e mais rápida produção de anticorpos específicos em casos de encontros subseqüentes com o mesmo antígeno. Pesquisadores da Fundação Oswaldo Cruz identificaram no sangue dos gambás duas moléculas. Seja como for.: vírus) provoca.5. DM43 e DM64. b) eosinófilos e eritrócitos. Questão 1219 O gráfico a seguir exemplifica como a exposição de um homem normal.10 onte: LOPES. S.vacinada contra uma possível infecção. podem-se observar os seguintes eventos. que se alimentam de serpentes. Agora. Questão 1217 Compartilhamos o ambiente com uma série de microorganismos que podem causar infecções nos seres humanos. As nossas células de defesa exercem o seu papel por meio da fagocitose e da produção de anticorpos.

que tem como conseqüência: a) o aumento da produção de anticorpos b) a inibição da produção de anticorpos c) o aumento da produção de antígenos d) a inibição da produção de antígenos Questão 1220 A produção de imunoglobulinas por células do sistema imunitário constitui um dos mecanismos de defesa do organismo contra infecções. c) profilaxia. d) quimioterapia. EXCETO a) basófilos. c) os linfócitos B. para pessoas aidéticas sintomáticas.10 s resultados acima permitem chegar à seguinte conclusão em relação a esse soro: a) na época do nascimento há presença de IgG materna b) durante a gestação diminuem os níveis de IgG fetal c) durante a gestação os níveis de IgG independem da produção fetal d) após o nascimento diminuem os níveis de IgG produzida pelo recém-nascido . na maioria das pessoas. Uma série de tipos celulares é responsável pelas reações alérgicas e por outros tipos de hipersensibilidade imune. de modo que a) os macrófagos. c) eosinófilos. denomina-se a) imunoterapia ativa. 1. será desencadeada uma reação. Havendo incompatibilidade entre o doador e o receptor de um órgão ou tecido condicionado pelo MHC. após reconhecerem os antígenos apresentados pelos macrófagos. e) vacinoterapia. O gráfico abaixo demonstra os níveis de imunoglobulina G (IgG) no soro do feto e do recém-nascido.5. mas sem os sintomas da doença. cuja intenção é fortalecer a defesa desses indivíduos. diferenciam-se em plasmócitos. d) linfócitos. participando assim da imunidade celular.10 odemos atribuir esta resposta do organismo ao fenômeno de memória imunológica. Questão 1222 A urtiga é um vegetal que provoca. produzindo assim uma quantidade maior de anticorpos. b) eritrócitos. as primeiras células a serem ativadas. b) imunoterapia passiva. principais responsáveis pela 274 1. e) mastócitos. b) os linfócitos T.Questão 1221 Um novo tipo de tratamento da AIDS começou a ser testado no Brasil e consiste em transmitir anticorpos anti-HIV. multiplicam-se e diferenciam-se. Tal tratamento. uma forte reação alérgica. dando início à imunidade humoral. e o sistema imune do receptor responde.5. d) as interleucinas inibem a proliferação de macrófagos e linfócitos T citotóxicos. contidos no plasma de pessoas contaminadas há muitos anos. ligam-se aos anticorpos e iniciam suas ações fagocitária e secredora. Questão 1223 As principais moléculas responsáveis pela resposta imune aos transplantes de órgãos e tecidos são os antígenos do Complexo Principal de Histocompatibilidade (MHC). estimulados por substâncias produzidas pelos linfócitos T auxiliares.

sarampos. A Guerra Fria foi o resultado óbvio dessas tensões e disputas. campeã do socialismo.rejeição. ( ) são típicas das regiões úmidas e frias e têm como vetores insetos do gênero 'Anopheles' sp. consiste na análise de amostras de sangue e saliva antes e após a injeção de um determinado antígeno. tem o objetivo de estudar até que ponto o sistema imunológico se altera durante vôos espaciais. Traduzido e adaptado de: http:// spaceflight. novas tecnologias para comunicação evidenciam o progresso no século XXI. Questão 1226 As vacinas utilizadas nas campanhas de imunização em massa são constituídas de a) anticorpos que destruirão o agente infeccioso específico. Uma dessas. conclui-se que. ao mesmo tempo em que socialismo e capitalismo disputavam o predomínio na produção e nos mercados. Entretanto. ocorre menor: a) fagocitose do antígeno mediada pelos linfócitos B b) produção de anticorpos pelos linfócitos T citotóxicos c) produção de imunoglobulinas pelos neutrófilos d) produção de anticorpos mediada pelos linfócitos B e) produção de imunoglobulinas pelos macrófagos Questão 1225 "Onde não há cozinhas pratos por lavar vigílias. c) drogas capazes de aumentar a resistência à infecção. iniciou-se um novo período na história da humanidade. clonagem. José Paulo Paes) ". Questão 1224 Com o final da 2 Guerra Mundial. a ser realizada na Terra e no espaço.gov/shuttle/archives/ sts-74/orbit/payloads/lifes/regimmun. novas comodidades. o conhecimento humano não tem fronteiras nem limites: DNA. Vencido o perigo nazista. passou a existir o desejo do bem-estar e do conforto mostrar onde se vivia melhor era fundamental. e) soros obtidos de animais que neutralizarão os antígenos específicos. Ao lado da política e da economia. ao provocar nos indivíduos do sexo masculino o aumento da produção de urina. até mesmo. sem suprimir o sistema imunológico do receptor. e) a ciclosporina age no processo de rejeição. sem deixar o paciente vulnerável a infecções. Mais conforto. um novo século. aparecem na infância. d) microorganismos ou produtos deles derivados que induzirão a formação de anticorpos. Esse desejo fez com que rapidamente se transferissem para o cotidiano dos homens os resultados práticos das inovações de guerra. normalmente." ("Outro retrato". Cai o império soviético. coqueluches. e a URSS.. a revolução tecnológica avançava como conseqüência. alterações nos comportamentos sinalizaram um novo tempo. A experiência. ( ) comprometem os nódulos linfáticos das virilhas. suprimindo os linfócitos B. sarampos" são alterações no bem-estar físico do indivíduo que. 275 . campeões do capitalismo. b) anticorpos que persistirão ativos por toda a vida do receptor.nasa. no mundo globalizado. fraldas sujas coqueluches. A comparação dos resultados obtidos poderá indicar o quanto a resposta imunológica estará afetada.html Se ao final da experiência mencionada for demonstrado que a resposta imunológica humoral diminui durante os vôos espaciais. A corrida espacial foi um dos aspectos dessa concorrência. genoma.. realizada por pesquisadores da NASA. enfrentaram-se as duas forças hegemônicas do pós-guerra: os Estados Unidos da América. nessas condições. ( ) podem ser prevenidas pela aplicação de vacinas na primeira fase da vida ou tratadas com medicamentos adequados. Pesquisas biológicas vêm sendo desenvolvidas com os tripulantes dos vôos espaciais. Estas doenças ( ) são transmitidas por vírus e enquadram-se no grupo das que causam desidratação. Hoje. da concorrência entre esses dois países.

( ) os linfócitos B transformam-se em plasmócitos. que atua no combate a infecções. por exemplo (Y).10 ( ) Ao primeiro contato com um vírus X (1) .5. estes estimulam os linfócitos B a produzirem interferons. Questão 1228 A Campanha Nacional de Vacinação do Idoso. b) contêm anticorpos específicos. imediatamente. ( ) Em (2) ilustra-se a resposta imunológica do organismo a uma infecção bacteriana. Questão 1230 Há um número muito grande de organismos causadores de infecções. Com relação ao sistema imunológico humano.10 especificamente a determinados antígenos. Em relação a esse sistema. os macrófagos. diz-se que ele adquiriu imunidade humoral. ( ) Em (1) ilustra-se a resposta primária do organismo após um primeiro contato com um vírus X. são produzidas células apresentadoras de antígenos. d) impedem mutações dos patógenos. o organismo humano dispõe de diferentes mecanismos de defesa. c) induzem resposta imunológica. se o organismo continuar a produzir anticorpos em quantidades elevadas. os postos de saúde estão aplicando. ( ) Após um primeiro contato com um vírus X (2). um organismo infectado por uma bactéria X produzirá mais antígenos em (2) do que em (1). a vacina contra pneumonia pneumocócica. ( ) Devido à elevada especificidade da reação antígeno-anticorpo. b) o código genético do patógeno é igual ao do camundongo.Questão 1227 Analise estas figuras: 1. É CORRETO afirmar que essas vacinas protegem porque a) são constituídas de moléculas recombinantes. Além da vacina contra a gripe. também. instituída pelo Ministério da Saúde do Brasil. Com relação a este tema. o organismo reage e produz. c) o antígeno do patógeno é produzido pelo camundongo em I. perduram no organismo e podem desencadear a resposta imune com mais rapidez. anticorpos em nível neutralizador suficiente para inativar o vírus. podemos afirmar que: ( ) nos nódulos linfáticos e no baço. vem-se revelando uma das mais abrangentes dirigidas à população dessa faixa etária. ( ) contra patógenos extracelulares. Questão 1231 O sistema imunitário. contra as quais o homem dispõe de um vigilante exército para a sua defesa. ( ) as chamadas "células de memória" surgem da diferenciação de linfócitos T e B.5. como a maioria das bactérias. enquanto em (1) mostra-se o efeito da pós infecção viral. d) o mRNA do antígeno do patógeno é traduzido em II. ( ) linfócitos T podem adquirir ação citotóxica e destruir células infectadas por vírus. ou ainda células como as cancerosas. o organismo ativa seus linfócitos T citotóxicos. muito ativos no combate a patógenos externos. é constituído por diferentes tipos de glóbulos brancos e pelos órgãos responsáveis pela produção e maturação desses glóbulos. células produtoras de anticorpos. Questão 1229 Para o controle das infecções. é INCORRETO afirmar que a) os anticorpos são produzidos tanto em I quanto em II. podemos afirmar que: 276 . proteínas que se ligam 1. é correto afirmar que: onsiderando-se os processos de imunização representados.

porque é composto por antígenos específicos. que induzirá a formação de anticorpos. a) imunoglobulinas .. Indique o que deve ser aplicado em cada criança. porque contém anticorpos prontos. Uma possível explicação é que o brasileiro . na vida intra-uterina.. enquanto as . ( ) Os macrófagos são responsáveis pela secreção de histamina. (04) São produzidos somente pela vacinação. são proteínas sintetizadas para combater agentes externos (bactérias e vírus. ( ) Os linfócitos B... estimulando os linfócitosT... ( ) Os linfócitos T e B originam-se no timo e depois migram para a medula óssea. a) Uma partícula b) Um organismo c) Uma molécula d) Uma célula e) Um patógeno Questão 1233 Os anticorpos.. a outra. O que o relatório mostra é que. 28 jul. Adaptado de: "Veja".. especialmente nos macrófagos.... Em relação às características dos anticorpos. Soma ( ) Questão 1234 Duas crianças foram levadas a um posto de saúde: uma delas. fixando-se temporariamente no ducto toráxico. onde podem se multiplicar ao detectarem elemento estranhos ao organismo. para eliminar quimicamente o veneno. b) soro. O relatório da Polícia Federal sobre a Operação Vampiro traz uma informação no mínimo irônica sobre o sangue dos brasileiros.. (02) São capazes de neutralizar os vírus. em virtude de uma picada de serpente peçonhenta. as dos brasileiros situam-se na faixa de 5.. a) vacina (porque contém antígenos) e soro (porque contém anticorpos) b) soro (porque contém antígenos) e vacina (porque contém anticorpos) c) vacina (porque contém anticorpos) e soro (porque contém antígenos) d) soro (porque contém anticorpos) e vacina (porque contém antígenos) Questão 1235 Quando uma pessoa é picada por um animal peçonhento.( ) Os macrófagos fagocitam elementos estranhos e imobilizam resíduos na membrana. e) vacina. d) vacina.... estimulam os linfócitos B a produzirem anticorpos e eliminam células anormais. quando estimulados. porque fornecerá ao organismo elementos de defesa. Questão 1232 Assinale a alternativa que melhor descreve um anticorpo. e permanecem na corrente sangüínea prontos para nos proteger da ação de patógenos. (16) São dotados de memória imunológica. é correto afirmar: (01) São capazes de neutralizar toxinas bacterianas.. causando vermelhidão e edema nos processos inflamatórios. extraídas do plasma de europeus ficam na faixa de 3 gramas por litro. por exemplo) ou seus produtos. RESPECTIVAMENTE. para se prevenir contra poliomielite. se diferenciam em plasmócitos que produzem anticorpos e participam da memória imunológica. Questão 1236 Assinale a alternativa que preenche corretamente as lacunas do texto a seguir. na ordem em que ocorrem. 2004.. componentes do nosso sistema de defesa.se alimenta de nutrientes ricos em ferro 277 . produzem interleucinas. (32) São capazes de imobilizar os microorganismos. . Os anticorpos também são capazes de proteger o embrião humano. (08) Podem atravessar a barreira placentária. Sabe-se que a produção de certos hemoderivados se vale de material retirado do plasma.está exposto a uma maior variedade de organismos patogênicos b) hemácias . deve procurar socorro através de a) soro. muitas vezes por períodos bastante longos. c) soro. para atendimento...se alimenta de nutrientes ricos em ferro c) albuminas .. a qual provoca vasodilatação.2 gramas por litro.. ( ) Linfócitos T reconhecem antígenos nas membranas de outras células.

na tentativa de destruir agentes invasores. Vacinar consiste em injetar no organismo: a) microrganismos vivos para provocar a doença de forma branda.tende a apresentar o baço com tamanho aumentado. d) Apenas I é correta. criados em laboratório.10 Analise as afirmativas a seguir: I . que tem efeito terapêutico. Questão 1241 A revista "Veja" (28.Alguns tipos de leucócitos (glóbulos brancos) atravessam as paredes dos capilares por diapedese e deslocam-se pelo tecido. já prontos. c) Apenas II e III são corretas. Marque a alternativa correta. II e III são corretas. induzam a produção de anticorpos específicos. c) aplicação do soro. retirado de convalescentes. reconhecidos pelo corpo como antígenos. c) microrganismos mortos ou atenuados que.2004) noticiou que a quantidade de imunoglobulina extraída do sangue dos europeus é. e) possui antígenos específicos. b) I. fagocitando os microorganismos patogênicos.A inflamação é uma resposta imune do corpo. Questão 1239 Os meios de comunicação têm convocado dentistas e outros profissionais da saúde para a vacinação contra a hepatite B. III . 278 1. que é a imunidade adquirida de ação menos duradoura que o soro e de emprego terapêutico. e) o soro obtido através do sangue de animais. Questão 1238 O soro antiofídico é ministrado em pessoas picadas por cobra peçonhenta porque: a) induz a formação de anticorpos. a) Apenas I e II são corretas.O tecido lesado libera sinais químicos (histamina e prostaglandinas) que promovem a dilatação dos vasos na área lesada. . pois as pessoas desenvolvem anticorpos contra os antígenos atenuados.d) albuminas . II . submetendo-se as pessoas à a) aplicação do soro. para que o corpo produza então os antígenos específicos. b) aplicação do soro. quando o agente infeccioso provoca uma doença de evolução muito rápida e não há tempo para a imunização ativa. b) contém anticorpos. b) uma substância que combata a doença já instalada e que produza no corpo uma reação para a fabricação de anticorpos resistentes. que é um processo ativo de imunização preventiva e duradoura. Questão 1237 As ilustrações a seguir (a.07. como os cavalos. A incidência de doenças causadas por estes agentes infecciosos poderá ser reduzida. em média. e) vacinação.2 gramas por litro. d) provoca imunização. b e c) representam o que pode acontecer quando uma lesão na pele permite a entrada de bactérias que causam infecção. c) é um antibiótico. d) vacinação. produzidos pelo organismo de um animal. Questão 1240 Os agentes infecciosos penetram no corpo das pessoas através dos ferimentos e das mucosas. O corpo imunizado produzirá antígenos específicos.tende a apresentar o baço com tamanho aumentado e) imunoglobulinas .5. onde recebem grande quantidade de antígenos. de 3 gramas por litro. resultado da ativação dos mecanismos naturais de defesa do organismo. d) o plasma. enquanto a extraída do sangue dos brasileiros é de 5. ocasião em que o indivíduo recebe anticorpos.

Assinale a hipótese que pode explicar corretamente a causa de tal diferença. a) Os europeus tomam maior quantidade de vacinas ao longo de sua vida. b) Os brasileiros estão expostos a uma maior variedade de doenças. c) Os antígenos presentes no sangue do europeu são mais resistentes. d) Os anticorpos presentes no sangue do brasileiro são menos eficientes. e) Os europeus são mais resistentes às doenças que os brasileiros. Questão 1242 A partir do recente surto de sarampo na cidade do Rio de Janeiro, o governo decidiu iniciar uma campanha de imunização das crianças. A imunização contra diversos tipos de doenças é atingida através de vacinação, que consiste em injetar no organismo: a) o soro obtido através do sangue de animais criados em laboratório, como macacos, onde recebem grande quantidade de antígenos e anticorpos específicos. b) o plasma retirado de pessoas que já tiveram a doença, para que o organismo produza antígenos e anticorpos específicos. c) um agente químico eficaz no combate a doença já instalada e que produza no corpo uma reação para a fabricação de anticorpos específicos. d) vírus ou bactérias mortos ou atenuados que, reconhecidos pelo organismo como antígenos, induzem a produção de anticorpos específicos. e) vírus ou bactérias vivos, em quantidade pequena, para provocar a doença de forma branda, pois o corpo imunizado produzirá anticorpos específicos. Questão 1243 Nosso corpo está sempre sendo ameaçado de invasão por substâncias estranhas e por uma variedade enorme de microorganismos. Toda vez que isso acontece, além dos nossos mecanismos gerais de defesa, acionamos nosso sistema imune constituído por diferentes tipos de glóbulos brancos e por órgãos imunitários que, primariamente, são: a) fígado e baço. b) fígado e gânglios linfáticos.

c) tonsilas e pâncreas. d) pâncreas e medula óssea. e) medula óssea e timo. Questão 1244 A pigmentação da pele humana é condicionada por pares de genes com ausência da dominância. Suponhamos que apenas dois pares de genes estivessem envolvidos na cor de pele: o negro seria SSTT e o branco, sstt. Um homem mulato, heterozigoto nos dois pares, tem 6 filhos com uma mulher mulata de genótipo igual ao seu. Sobre os filhos do casal, pode-se afirmar que: a) todos são mulatos como os pais. b) cada um deles tem uma tonalidade de pele diferente da outro. c) um ou mais deles podem ser brancos. d) a probabilidade de serem negros é maior do que a de serem brancos. e) 50% apresentam pele branca e 50%, pele negra. Questão 1245 O gráfico a seguir representa um tipo de herança onde os caracteres variam de forma gradativa. As opções a seguir são exemplos deste tipo de herança no homem, EXCETO uma. Assinale-a.

1.5.11

a) Estatura. b) Inteligência. c) Obesidade. d) Fator RH. e) Cor da pele.

279

Questão 1246

1.5.11

dois indivíduos que produzem frutos com 15cm, espera-se uma proporção de plantas com frutos de 17,5cm igual a a) 9/16 b) 1/2 c) 3/16 d) 1/4 e) 1/8 Questão 1249 Em um caso de herança quantitativa, estão envolvidos três pares de genes, "a", "b" e "c". Cruzando-se dois indivíduos triplo heterozigotos, a proporção de homozigotos esperada é de: a) 1/2 b) 1/8 c) 1/16 d) 1/32 e) 1/64 Questão 1250 Imagine que, em um determinado animal, a retenção de água no corpo seja controlada pela interação quantitativa de dois pares de genes, existindo cinco fenótipos (da retenção baixa até a retenção máxima de água). Animais com genótipo aabb retêm baixa quantidade de água, enquanto animais com genótipo AABB apresentam retenção máxima de água. Os animais que apresentam dois genes "maiúsculos" e dois genes "minúsculos" no genótipo retêm uma quantidade intermediária de água. Na genealogia abaixo, são dados os genótipos dos animais indicados pelos números 1, 2, 3 e 6. Considerando que os genes em questão se segregam independentemente, qual a probabilidade de os indivíduos 7 e 8 apresentarem simultaneamente retenção intermediária de água? a) 1/2 b) 1/3 c) 1/4 d) 1/8 e) 1/16

A cor dos grãos de trigo é condicionada por dois pares de genes de efeito aditivo. A tabela acima mostra o número de genes dominantes e as cores determinadas por eles. Do cruzamento entre um indivíduo AaBb e um Aabb, a proporção esperada de indivíduos com grãos vermelhos é de: a) 3/8 b) 1/8 c) 3/16 d) 6/8 e) 5/8 Questão 1247 Admita que a diferença de comprimento das orelhas nos coelhos seja um caso de herança quantitativa envolvendo dois pares de genes com segregação independente. Animais sem nenhum gene dominante possuem orelhas com 4,0cm. Cada gene dominante aumenta em 1,0cm o comprimento das orelhas. O cruzamento que produzirá na descendência uma maior porcentagem de coelhos com orelhas de no mínimo 7,0cm é o a) AaBb x AaBb b) AaBb x aaBB c) AAbb x aaBB d) Aabb x AABB e) AABB x aabb Questão 1248 Para uma determinada planta, suponha que a diferença entre um fruto de 10cm de comprimento e um de 20cm de comprimento seja devida a dois genes, cada um com dois alelos, que têm efeito aditivo e que se segregam independentemente. Na descendência do cruzamento entre

280

1.5.11

de altura e cada alelo p e r determina 10cm. Assim, os indivíduos PPRR têm 80cm e os indivíduos pprr, 40cm. O gráfico a seguir representa a distribuição das classes fenotípicas observada nos descendentes dos cruzamento entre heterozigotos PpRr.

1.5.11

Questão 1251 Supondo que na aboboreira existam 3 pares de genes que influem no peso do fruto, uma planta aabbcc origina frutos com aproximadamente 1.500 gramas e uma planta AABBCC, frutos ao redor de 3.000 gramas. Se essas duas plantas forem cruzadas, o peso aproximado dos frutos produzidos pelas plantas F será de a) 3 000 gramas. b) 2 500 gramas. c) 2 250 gramas. d) 2 000 gramas. e) 1 500 gramas. Questão 1252 A tabela a seguir classifica características hereditárias da espécie humana. Assinale a alternativa que corresponde à classificação correta.

esse gráfico, os indivíduos PPRr e Pprr estão incluídos, respectivamente, em a) IV e V b) IV e II c) III e II d) III e I e) I e V Questão 1254 Um estudante de 23 anos, doador de sangue tipo universal, é moreno, tem estatura mediana e pesa 85 kg. Todas as alternativas apresentam características hereditárias desse estudante que são influenciadas pelo ambiente, EXCETO a) Altura b) Grupo sangüíneo c) Cor da pele d) Peso Questão 1255 Em um dos modelos propostos para a determinação da cor dos olhos na espécie humana (herança quantitativa), são considerados cinco diferentes fenótipos. Na descendência de pais heterozigóticos para os locos determinantes desta característica, foram observados os dados apresentados no quadro abaixo. Analise-os, juntamente com o gráfico, e identifique a correção das proposições a seguir.

1.5.11

Questão 1253 Em certa espécie vegetal, a altura dos indivíduos determinada é por dois pares de alelos de efeito aditivo e segregação independente: cada alelo P e R determina 20cm

281

1.5.11

( ) Três pares de alelos justificam os resultados apresentados. ( ) Nos indivíduos de olhos castanho-claros, os locos em questão podem estar em homozigose ou em heterozigose. ( ) Indivíduos de olhos verdes apresentam homozigose em apenas um dos locos em questão. ( ) A probabilidade do nascimento de duas crianças de olhos azuis, a partir de um casal genotipicamente igual ao do exemplo dado, é de aproximadamente 0,004. ( ) A probabilidade do casal indicado no item anterior de ter duas crianças, sendo uma de olhos castanho-claros e uma de olhos verdes é de 3/16. Questão 1256 A cor da pele humana é conseqüência do efeito cumulativo de mais de um gene, de modo que cada gene contribui igualmente para o fenótipo. O gráfico que representa a proporção fenotípica nesse tipo de herança é

são fenotipicamente homogêneas: apresentam as mesmas características quanto à altura da planta e tamanho da espiga, ao tamanho e número de grãos por espiga, e a outras características de interesse do agricultor. Porém, quando o agricultor realiza um novo plantio com sementes produzidas pelas plantas C, não obtém os resultados desejados: as novas plantas são fenotipicamente heterogêneas e não apresentam as características da planta C; têm tamanhos variados e as espigas diferem quanto a tamanho, número e qualidade dos grãos. Para as características consideradas, os genótipos das plantas A, B e C são, respectivamente, a) heterozigoto, heterozigoto e homozigoto. b) heterozigoto, homozigoto e heterozigoto. c) homozigoto, heterozigoto e heterozigoto. d) homozigoto, homozigoto e heterozigoto. e) homozigoto, homozigoto e homozigoto. Questão 1258 A altura de uma planta depende de dois pares de genes, A e B. O gráfico adiante mostra a variação da altura dos descendentes de dois indivíduos diíbridos.

1.5.11

1.5.11 Com relação ao gráfico, julgue os itens que se seguem. (1) Os efeitos quantitativos dos alelos A e B são, respectivamente, 40 e 30cm. (2) A freqüência de descendentes heterozigotos, para os dois genes, é de 50%. (3) Estão ilustrados cinco genótipos. (4) A herança apresentada é poligênica.

Questão 1257 Uma empresa agropecuária desenvolveu duas variedades de milho, A e B, que, quando entrecruzadas, produzem sementes que são vendidas aos agricultores. Essas sementes, quando plantadas, resultam nas plantas C, que

282

Questão 1259 A altura de uma certa espécie de planta é determinada por dois pares de genes A e B e seus respectivos alelos a e b. Os alelos A e B apresentam efeito aditivo e, quando presentes, cada alelo acrescenta à planta 0,15m. Verificou-se que plantas desta espécie variam de 1,00m a 1,60m de altura. Cruzando-se plantas AaBB com aabb pode-se prever que, entre os descendentes, a) 100% terão 1,30m de altura. b) 75% terão 1,30m e 25% terão 1,45m de altura. c) 25% terão 1,00m e 75% terão 1,60m de altura. d) 50% terão 1,15m e 50% terão 1,30m de altura. e) 25% terão 1,15m, 25% 1,30m, 25% 1,45m e 25% 1,60m de altura. Questão 1260 Políticas de inclusão que consideram cotas para negros ou afrodescendentes nas universidades públicas foram colocadas em prática pela primeira vez na Universidade Estadual do Rio de Janeiro (UERJ), em 2001. Propostas como essas geram polêmicas e dividem opiniões. Há vários argumentos contra e a favor. Os biólogos têm participado desse debate, contribuindo com os conhecimentos biológicos referentes à raça e à herança da cor da pele humana, entre outros. Assinale a afirmação considerada correta do ponto de vista da biologia. a) Os critérios para se definirem duas populações como raças diferentes são científica e consensualmente determinados. b) Não encontramos, na história da biologia, dúvidas sobre a existência de raças na espécie humana. c) A cor da pele humana é um exemplo de herança quantitativa ou poligênica, o que significa que vários genes atuam na sua definição. d) O fato de a cor da pele não ser influenciada por fatores ambientais reforça a hipótese da existência de raças na espécie humana. e) A determinação da cor da pele humana segue os padrões do tipo de herança qualitativa e é um exemplo de co-dominância.

Questão 1261 As diferenças hereditárias entre os indivíduos de uma população podem ser classificadas em qualitativas e quantitativas. A esse respeito, assinale a opção correta. a) Na herança de caracteres quantitativos, existe um grande contraste entre as características que um dado traço fenotípico pode apresentar. b) Na herança de caracteres qualitativos, um dado traço de fenótipo apresenta-se sob grande variedade de formas, em geral com pequenas diferenças entre si. c) Altura, peso e cor da pele são exemplos de algumas características quantitativas do homem. d) Os caracteres qualitativos, em sua maioria, sofrem grande influência do meio. e) A altura não é uma característica hereditária, já que um indivíduo cresce menos se não receber a alimentação adequada na infância. Questão 1262 Determinada característica quantitativa depende da ação de cinco pares de genes. Do cruzamento entre dois indivíduos com genótipo AaBbCcDdEe resultam a) 5 classes fenotípicas. b) 9 classes fenotípicas. c) 10 classes fenotípicas. d) 11 classes fenotípicas. e) 15 classes fenotípicas. Questão 1263 A cor dos pêlos nas cobaias é condicionada por uma série de alelos múltiplos com a seguinte escala de dominância: C (preta) > C (marrom) > C‚ (creme) > c (albino). Uma fêmea marrom teve 3 ninhadas, cada uma com um macho diferente. A tabela a seguir mostra a constituição de cada ninhada.

283

1.5.12

1.5.12

A partir desses dados é possível afirmar que o macho responsável pela ninhada: a) 1 era marrom homozigoto. b) 1 era preto homozigoto. c) 2 era albino heterozigoto. d) 2 era creme heterozigoto. e) 3 era marrom homozigoto. Questão 1264 O controle genético de determinado caráter é feito por uma série de quatro alelos de um só locus. O alelo A é dominante sobre os alelos A‚, Aƒ e A„; o alelo A‚ é dominante sobre os alelos Aƒ e A„ e o alelo Aƒ é dominante sobre A„. Do cruzamento AA‚ x AƒA„ devem ser obtidas: a) quatro classes genotípicas e quatro classes fenotípicas. b) quatro classes genotípicas e duas classes fenotípicas. c) quatro classes genotípicas e três classes fenotípicas. d) três classes genotípicas e três classes fenotípicas. e) três classes genotípicas e duas classes fenotípicas. Questão 1265 Em uma população de organismos diplóides, foram encontrados quatro alelos diferentes para um determinado locus gênico, denominados S¢, S£, S¤ e S¥. A figura a seguir mostra, à esquerda, as diferenças na seqüência de DNA que caracterizam cada um desses alelos e, à direita, o par de cromossomos homólogos (metafásicos) onde esse gene é encontrado. Diante dessas informações, se um único indivíduo desta população for escolhido ao acaso, qual combinação alelo/posição cromossômica poderia ser encontrada no par de cromossomos metafásicos deste indivíduo?

Questão 1266 Se um caráter tem três alelos possíveis, podendo haver seis genótipos, e um segundo caráter apresenta oito genótipos possíveis, quando ambos forem estudados simultaneamente, podem ocorrer a) 7 genótipos. b) 12 genótipos. c) 24 genótipos. d) 48 genótipos. e) 96 genótipos. Questão 1267 Coelhos podem ter quatro tipos de pelagem: chinchila, himalaia, aguti e albina, resultantes das combinações de quatro diferentes alelos de um mesmo loco. Num experimento, animais com diferentes fenótipos foram cruzados várias vezes. Os resultados, expressos em número de descendentes, constam na tabela a seguir.

1.5.12

284

Questão 1268 Suponha que em uma certa espécie diplóide exista um caráter relacionado com uma série de quatro alelos (alelos múltiplos).13 a) 1 aguti: 1 chinchila. podemos afirmar que: a) todos os gametas formados conterão as combinações resultantes do "crossing". aqui denominados "alfa".e o animal progenitor aguti do cruzamento 1 for utilizado para a obtenção de filhotes com o progenitor chinchila do cruzamento 4. (04) quatro fenótipos. Tal gene deve determinar: (01) três fenótipos. e) 10. d) as proporções entre os tipos de gametas seriam iguais às que ocorrem quando os genes estão em cromossomos diferentes. e) não é possível calcular essas proporções. c) a ocorrência do "crossing" não altera a seqüência dos genes nos cromossomos.5. (16) quatro fenótipos. (02) três fenótipos. Questão 1270 No órgão reprodutor de um animal há 1000 (mil) células. Na meiose de um indivíduo duplo-heterozigoto AB/ab ocorre permutação entre esses locos em 80% das células. correspondentes a quatro genótipos. Questão 1269 Considere um gene que apresenta 3 alelos. b) 1 aguti: 1 himalaia. "beta" e "gama". c) 6. os locos dos genes A e B situam-se no mesmo cromossomo. A porcentagem esperada de gametas Ab que o indivíduo formará é a) 10% b) 20% c) 30% d) 40% e) 80% Questão 1272 O cruzamento CD/cd x cd/cd produziu 300 descendentes. o número máximo de alelos representados relacionados ao caráter em questão será igual a a) 2. cada um correspondente a um genótipo. porque os gametas recebem cromossomos ao acaso. Questão 1271 Em determinada espécie. porque só as cromátides irmãs são envolvidas. d) 2 aguti: 1 chinchila: 1 himalaia. b) a proporção de gametas com as formas não "crossing" seria maior do que a de gametas com as formas "crossing". d) 8. e se cada uma originar 4 (quatro) gametas. Considere que os alelos "alf" e "beta" são co-dominantes e gama é recessivo em relação a ambos. Em um determinado indivíduo da espécie referida. c) 9 aguti: 3 himalaia: 3 chinchila: 1 albino. cada um correspondente a dois genótipos. correspondentes a cinco genótipos. correspondentes a seis genótipos. e) 3 aguti: 1 chinchila. que proporção de descendentes poderemos prever? 1. sabendo-se que a freqüência de permutação é de 10% a) 30 b) 15 c) 270 285 . como mostra o desenho a seguir: Se em todas as células ocorrer "crossing-over" entre os genes A e B. em cujos núcleos estão os cromossomos. Quantos deverão ser diferentes dos pais. b) 4. (08) seis fenótipos.

b) 97 morganídeos.48.1. sabendo-se que a freqüência de permutação é de 20% a) 30 b) 90 c) 430 d) 360 e) 45 Questão 1274 Analisando-se dois pares de genes em ligamento fatorial ("linkage") representados pelo híbrido BR/br. c) 1. Questão 1275 Em um caso de "linkage". 40% e 10% b) 30%. c) da existência do fenômeno da pleiotropia. 10%.5% Br .1.R. é de se esperar lhe a freqüência de permutação entre dois genes esteja na dependência. 40%. aB e ab produzidos por esse indivíduo deve ser. e) 50 morganídeos. distam entre só 20 U. 10% e 10% 286 . autossômicos. Considere o seguinte cruzamento: 1. a) da distância entre eles. d) do tipo de polimeria existente. Ab. 20% e 20% d) 40%. distam entre si 20 UR. (unidades de recombinação).13 esse cruzamento.5. b) do comprimento da zona centromérica. pode-se concluir que a distância entre os genes B e R é de: a) 48.d) 290 e) 45 Questão 1273 O cruzamento AB/ab x ab/ab produziu 450 descendentes. Considere o seguinte cruzamento: Fêmea (Ab/aB) X Macho (ab/ab) Qual é a freqüência esperada de machos com o genótipo AB/ab? a) 100% b) 50% c) 25% d) 10% e) 5% Questão 1276 Na espécie humana os genes que determinam a distrofia muscular Duchnne e a hemofilia. 20% e 30% c) 30%.5 morganídeos.5 morganídeo.5% bR . 20%. a freqüência esperada de machos afetados pelos dois caracteres é de: a) 0 % b) 5 % c) 10 % d) 20 % e) 40 % Questão 1277 Pelo que se conhece da disposição dos genes dos cromossomos. ocorre "crossing-over" entre esses genes em 40% das células.5% Pela análise dos resultados.5% br . 30%. 10% e 40% e) 40%.48. e) da ausência de nucleotídeos covalentes. a) 10%. respectivamente. uma certa espécie apresentou a seguinte proporção de gametas: BR . Quantos deverão ser diferentes dos pais. heranças recessivas ligadas ao sexo. A freqüência de gametas AB. 40%. dois genes A e B. Questão 1278 Na meiose de um indivíduo AB/ab. d) 3 morganídeos.

ea = 25. Ea = 30. eA = 20. ea = 10. 150 indivíduos que produziam sementes brancas e rugosas. durante a meiose. podemos concluir que o genótipo do indivíduo parental colorido liso e a distância entre os genes B e R são a) BR/br. e) troca cromossomos entre genes homólogos. grãos brancos e rugosos. o alelo dominante E condiciona pêlos normais e o alelo recessivo e. Ea = 20. eA = 40.R. No cruzamento entre um indivíduo colorido liso com um branco rugoso. 1. eA = 25. eA = 30. podemos afirmar que o mesmo a) diminui a variabilidade genética. c) Br/bR. b) EA = 20. respectivamente.5 U.5. 62.R. a partir de um determinado cruzamento espera-se obter os seguintes descendentes: + + 10 + d 40 c + 40 c d 10 Esse cruzamento poderia ser a) ++/++ x cd/cd b) ++/cd x cd/cd c) +d/+d x c+/c+ d) +d/c+ x cd/cd e) +d/cd x c+/cd Questão 1280 Em camundongos. Ea = 40. ea = 40. b) separa cromátides homólogas. 250 indivíduos que produziam sementes coloridas e rugosas e 250 indivíduos que produziam sementes brancas e lisas. ea = 30. eA = 10. c) EA = 25. albina. surgiu uma F. A partir desses resultados.5 U. e) BR/br. pêlos encrespados.R.5 U. O alelo dominante A determina pelagem selvagem e o alelo recessivo a. a) EA = 10. Questão 1283 O esquema a seguir refere-se a uma célula diplóide que. d) Br/bR. originaram os seguintes descendentes: 160 com pêlos normais e albinos 160 com pêlos encrespados e selvagens 40 com pêlos normais e selvagens 40 com pêlos encrespados e albinos Assinale a alternativa que contém as porcentagens corretas de cada tipo de gameta produzido pelos indivíduos F. Questão 1282 Com relação ao processo conhecido como crossing-over.Questão 1279 Se a distância entre dois locos gênicos é de 20 unidades. sofrerá permutação entre os genes A e B.75 U. Ea = 25. Ea = 10. b) BR/br. ea = 20. d) EA = 30.R. Os indivíduos F. 37. 37. o grão colorido é condicionado por um gene dominante B e o grão liso por um gene dominante R. Os alelos recessivos b e r condicionam.5 U.13 287 . com os seguintes descendentes: 150 indivíduos que produziam sementes coloridas e lisas. 62. obtidos a partir de cruzamentos EEAA×eeaa. 18. c) corrige a recombinação gênica. e) EA = 40. Questão 1281 Numa certa espécie de milho. d) aumenta a variabilidade genética. ao serem cruzados com animais duplo-recessivos.R.

ABCe b) AbC. Sobre os genes D e E podemos concluir que: a) estão ligados e há permuta entre eles. é correto afirmar: (01) É a troca de gametas que ocorre durante o cruzamento de dois indivíduos da mesma espécie. abCe. 288 . (02) É a troca de micronúcleos entre indivíduos unicelulares para renovar o seu material genético. sabe-se que há 15% de recombinação entre os genes X e Y. AaBCe. aBC. d) 20 morganídeos. a) AbCe. b) estão ligados e não há permuta entre eles. ou crossing over. (04) É o processo que origina novos arranjos gênicos resultantes de trocas de fragmentos de cromátides homólogas. e c) AbCe. 160 Ddee. aBCe e) AabCe. e) não estão ligados. Y e Z de um cromossomo. ABCe d) AbCe. então a distância entre os genes A e B será a) 10 morganídeos. 168 ddEe e 40 ddee.5. Questão 1289 Sabendo-se que as freqüências de permutação entre os genes A e C é de 40% e entre os genes B e C é de 15%. aBCe. e.Assinale a alternativa que apresenta todos os tipos de gametas normais que podem ser formados por essa célula. então a distância entre os genes A e B será a) 45 morganídeos. com os genótipos DdEe x ddee. d) segregam-se independentemente e não há permuta entre eles. (08) É o pareamento de cromossomos homólogos de modo a se tornarem bivalentes. (16) É o processo de duplicação dos cromossomos para garantir a manutenção da espécie. Questão 1286 Suponha que 100 células germinativas entram em meiose e que essas células tenham o seguinte genótipo: 1. (32) É um processo que ocorre necessariamente durante a mitose. e) 20 ou 10 morganídeos.13 uantos gametas recombinantes serão formados se 20 das 100 células apresentarem permutação na meiose? a) 10 b) 20 c) 40 d) 80 e) 160 Questão 1287 Considerando os genes X. originou 42 descendentes com genótipo DdEe. AbCe. b) 30 morganídeos. aBCe Questão 1284 Com relação ao processo denominado permutação. logo segregam-se independentemente. c) 10 ou 30 morganídeos. Questão 1285 Um cruzamento entre dois indivíduos. (64) É o processo responsável pela variabilidade genética entre organismos de uma mesma espécie. Qual a posição relativa desses três genes no cromossomo? a) ZXY b) XYZ c) YZX d) XZY e) YXZ Questão 1288 Sabendo-se que as freqüências de permutação entre os genes A e C é de 20% e entre os genes B e C é de 10%. c) segregam-se independentemente e há permuta entre eles. entre Y e Z há 30% e entre os genes Z e X ocorre 45%.

b) 25 morganídeos. O arroz transgênico apresenta variedades que contêm altos teores de beta-caroteno (precursor da Vitamina A) e que acumulam maior teor de ferro. Aumentam a produtividade (caso da soja.14 Questão 1290 Supondo-se que a distância entre locos gênicos seja de 16 morganídios. 6. embora em diferentes freqüências. A. considere as corretas: I.5. B. e indivíduos homozigóticos recessivos (abc//abc). 1. Tomando por base os dados fornecidos no quadro a seguir. ( ) Os fenótipos 3 e 4 resultaram de recombinação genética entre os locos A e B. para os mesmos locos (cruzamento teste). III. utiliza-se o teste dos três pontos. organismos geneticamente modificados (OGM). Para isso. são avaliadas as freqüências das classes fenotípicas na descendência de cruzamento entre indivíduos heterozigóticos (ABC//abc). ocorreu nos genótipos 5. o que indica um avanço biotecnológico nesta área. 7 e 8. ( ) No mapa genético. analise as proposições seguintes. a taxa de recombinação entre eles é de a) 8% b) 16% c) 32% d) 42% e) 84% Questão 1291 Quatro genes. Resistem a certas doenças e pragas (insetos. ( ) A seqüência dos alelos no cromossomo em questão é A -------B-------C. nematóides etc) diminuindo a necessidade do uso de pesticidas. Está correta ou estão corretas: a) apenas I e II b) apenas II e III c) apenas I e III d) todas e) apenas uma das três vantagens. estão merecendo uma atenção especial no mundo todo. d) 25 ou 15 morganídeos. Das afirmativas. Questão 1293 Os transgênicos. e) 40 ou 15 morganídeos. ácaros. para três locos ligados. por exemplo). ( ) A recombinação entre os locos B e C. localizados no mesmo cromossomo. a distância entre os locos A e B é maior que a distância entre os locos B e C. desenvolvidas em países asiáticos. II. 289 . apresentam as seguintes freqüências de recombinação: A-B = 32% A-C = 45% A-D = 12% B-C = 13% B-D = 20% C-D = 33% A seqüência mais provável desses genes no cromossomo é a) ABCD b) ABDC c) ACDB d) ADBC e) ADCB Questão 1292 Na elaboração de mapas genéticos. Os produtos transgênicos apresentam algumas vantagens. c) 40 morganídeos. ( ) Os fenótipos 7 e 8 resultaram de recombinação genética apenas entre os locos C e B. C e D.

e) o DNA nuclear é igual ao da ovelha A. pela inserção de um gene que codifica uma toxina capaz de matar o nematóide. pois a genitora é a ovelha da raça "Scottish Blackface". Delas são retirados os mitocondrial é igual ao da ovelha C. pois núcleo de b) inserção do gene num vetor ë transfecção do gene ë célula de glândula mamária não pode influir nas amplificação do gene. o pesquisador descobriu que o ambiente favorecia o desenvolvimento de um nematóide parasita de mangueira. mas o DNA Foram retiradas as células das glândulas mamárias de uma ovelha adulta da raça "Finn Dorset". células. O aglomerado celular foi transferido para o aparelho 290 . inserção do gene num vetor. núcleos. Os ingredientes foram Questão 1297 colocados numa solução química para "hibernar" e esperar um tempo para serem encaixados nos óvulos anucleados. d) A clonagem está correta. núcleo de uma célula somática de uma ovelha adulta A para um óvulo de uma outra ovelha B do qual foi previamente Questão 1295 eliminado o núcleo. que consistem em: ele começou a se dividir. Tomando por base o texto. "Scottish Blackface". resumidamente. podemos afirmar que: a) A clonagem está correta mas não revela a tecnologia necessária para as células "hibernarem" e acertarem o tempo. características da "Dolly". b) "Dolly" não tem pai mas é. A receita propõe os seguintes passos: c) o DNA nuclear e o mitocondrial são iguais aos da ovelha Os cientistas retiraram óvulos de uma ovelha adulta da raça C. e) Há uma falha técnica no experimento. reprodutor da ovelha "Scottish Blackface". dentro do óvulo de uma fêmea de uma espécie. uma vez que "Dolly" veio de seu a) transfecção do gene ë amplificação do gene ë óvulo. B. O pesquisador sugeriu desenvolver uma linhagem transgênica dessa mangueira. que cedeu o óvulo anucleado. Para criar a mangueira transgênica. clonagem para "fazer" a ovelha "Dolly" da raça "Finn b) o DNA nuclear e o mitocondrial são iguais aos da ovelha Dorset". A comunidade científica demonstrou ser possível a Os cientistas transferiram o núcleo da célula mamária para reprodução de seres vivos através de sofisticadas técnicas o óvulo da ovelha "Scottish Blackface" Passado um tempo. mitocondrial é igual ao da ovelha B. uma vez que no seu genótipo há cromossomos de seu avô. deve-se seguir um conjunto de etapas que começa pela construção de uma seqüência iniciadora ('primer'). pois o pai é a ovelha da raça "Finn Dorset". onde origina um novo Clone é um população de seres geneticamente idênticos. Recentemente os jornais publicaram uma receita de a) o DNA nuclear e o mitocondrial são iguais aos da ovelha A. certamente. formando um aglomerado de a) injetar. filha da ovelha da raça "Scottish Blackface". d) amplificação do gene ë inserção do gene num vetor Uma maneira de se obter um clone de ovelha é transferir o ë transfecção do gene. para a transferência do núcleo para o óvulo anucleado. que são guardados. cujo controle era muito difícil. c) amplificação do gene ë transfecção do gene ë Questão 1296 inserção do gene num vetor. A seqüência correta das etapas seguintes à construção do 'primer' é. Investigando o problema. Acerca do material genético desse novo originados pela multiplicação assexuada de um único indivíduo. ao contrário do esperado. Dele se formou um embrião que deu origem à Dolly. um espermatozóide de um macho da mesma espécie. Deles removeram os núcleos e d) o DNA nuclear é igual ao da ovelha A. O embrião resultante é implantado no útero de uma terceira ovelha C. indivíduo. c) A clonagem está errada. continuaram com baixa produção após a poda. também necessário.Questão 1294 As mangueiras. pode-se afirmar que genitor ou por manipulação citogenética. de clonagem. mas o DNA guardaram o resto.

e os cromossomos sexuais são iguais aos da ovelha B. que consistem em: a) injetar. neste óvulo anucleado. d) constituição cromossômica da ovelha A e DNA mitocondrial da ovelha C. c) injetar. e) constituição cromossômica e DNA mitocondrial correspondente a uma mistura das três ovelhas. Esses pesquisadores retiraram o núcleo da célula de uma ovelha (A) e o implantaram num óvulo colhido de uma outra ovelha (B). c) retirar e descartar o núcleo de uma célula somática de uma espécie e injetar. o núcleo de uma célula somática de um indivíduo da mesma espécie. dentro do óvulo da fêmea de uma espécie. nesta célula anucleada. d) retirar e descartar o núcleo de uma célula somática de uma espécie e injetar. meiose Na formação de clones de organismos pluricelulares ocorrem. o núcleo de uma célula somática de um indivíduo da mesma espécie. É CORRETO concluir que: a) todos os cromossomos do clone são iguais aos da ovelha A. A partir dos dados envolvidos no experimento realizado pelos pesquisadores. pode-se prever que Dolly apresente a) constituição cromossômica da ovelha A e DNA mitocondrial da ovelha B. necessariamente. obtido por meio da técnica de clonagem. dentro do óvulo de uma fêmea. o núcleo de uma célula-ovo da mesma espécie. do qual o núcleo fora previamente removido. b) constituição cromossômica e DNA mitocondrial da ovelha A. nas células reprodutoras de uma espécie. o mundo foi abalado pela notícia da produção do clone de uma ovelha. c) constituição cromossômica e DNA mitocondrial da ovelha B. produção de indivíduos geneticamente idênticos IV. um grupo de pesquisadores divulgou ao mundo a ovelha Dolly. e) existem cromossomos no clone que são diferentes de A e de B. reprodução sexuada III. e) introduzir. Nessa clonagem. Questão 1298 Recentemente. o núcleo de um outro óvulo da mesma fêmea. d) retirar e descartar o núcleo do óvulo da fêmea de uma espécie e injetar neste óvulo anucleado. d) os autossomos do clone são iguais aos da ovelha B. Questão 1300 Em fevereiro deste ano. reprodução assexuada II. b) os autossomos do clone são iguais aos da ovelha A. e os cromossomos sexuais são iguais aos da ovelha A. e) injetar. o núcleo de uma célula ovo da mesma espécie.b) retirar e descartar o núcleo do óvulo de uma fêmea de uma espécie e injetar. um espermatozóide de um macho da mesma espécie. alguns genes de outra espécie. c) todos os cromossomos do clone são iguais aos da ovelha B. b) introduzir. nas células germinativas de uma espécie. o núcleo de um outro óvulo da mesma espécie. dentro do óvulo de uma fêmea. Questão 1299 Os pesquisadores da área de Genética demonstraram ser possível a reprodução de seres vivos por meio de aprimoradas técnicas de clonagem. originando Dolly. utilizou-se o núcleo de uma célula da mama de uma ovelha (A) e o citoplasma de um óvulo de outra ovelha (B). alguns genes de outra espécie. APENAS a) I e II b) I e III c) I e IV d) II e III e) III e IV Questão 1302 Se retirarmos o núcleo de uma célula-ovo de rã e o substituirmos por outro núcleo diplóide de uma célula de tecido muscular de rã adulta. Esse óvulo fora posteriormente implantado no útero de uma terceira ovelha (C). Questão 1301 Considere os processos adiante: I. e os cromossomos sexuais são iguais aos da ovelha A. nesta célula anucleada. a nova célula-ovo assim 291 .

que recebeu ampla divulgação na imprensa internacional. I. Querem usar a clonagem para salvar pandas em extinção. d) Expressou-se como na célula germinativa. neste caso. V. o que ocorre. b) os embriões resultantes da clonagem em vegetais são mais resistentes às modificações ambientais. Alguns manifestantes. c) Foi integralmente mantida ativa. b) Foi parcialmente inativada. podemos relacionar alguns fatos que marcaram época pela sua importância científica. I. uma vez que o governo britânico divulgou ontem o anúncio. V. II. em relação à seqüência funcional do DNA da célula diplóide doadora. de locais das novas plantações. pela Internet. corretamente. Assinale a alternativa que explica. b) II. VI. porque a) os mecanismos de regulação gênica nos vegetais são mais simples. II. III. como forma de protesto. d) a regulação hormonal da reprodução nos vegetais é mais facilmente controlada pelos cientistas. foi considerado concluído. IV. Questão 1306 Desde que a criação da ovelha "Dolly " foi anunciada há dois anos. Identificação da localização cromossômica dos genes. Numa breve história da genética. ("Veja". um marco no estudo da biologia. a) II. II. considere as seguintes afirmativas: 292 . VI. a capacidade de propagação vegetativa.) Tendo em vista as vantagens e limitações das técnicas comentadas nos textos acima. III. Assinale a alternativa que correlaciona os fatos mencionados anteriormente em ordem cronológica crescente. Surgimento da técnica de identificação das pessoas pelo exame do DNA. Dentre as alternativas a seguir. a) Foi integralmente inativada. d) V." 17/8/99. ("O Estado de São Paulo. IV. V. II. c) V. e) os vegetais produzem maior número de embriões por indivíduo. VI.formada será capaz de produzir uma outra rã. V. depois de dez anos de trabalho. que teme pelos danos ao meio ambiente e à saúde. o "Projeto Genoma Humano". III. em relação à seqüência funcional do DNA da célula diplóide doadora. a nova célula-ovo assim formada será capaz de produzir outra rã normal. estão destruindo as plantações de transgênicos do país. IV. I. VI. Questão 1305 Os conhecimentos científicos envolvendo a "clonagem" têm proporcionado à humanidade grandes avanços e sua utilização em vegetais tem sido mais fácil e menos controversa que em animais. III. III. I. devido ao seu menor grau de complexidade. O uso da técnica tem criado receio entre a população. criar animais com órgãos humanos e produzir bichos que funcionem como farmácias ambulantes. e) IV. Questão 1303 Se retirarmos o núcleo de uma célula-ovo de rã e o substituirmos por outro núcleo diplóide de uma célula de tecido epitelial normal de rã já adulta. VI. como segue. IV. 4/8/99) Agricultores britânicos que produzem alimentos transgênicos prevêem novos conflitos com ambientalistas. o que diminui a perda em caso de rejeição. a que apresenta a melhor explicação sobre o que ocorre neste caso. Transformação genética de bactérias para a produção de insulina humana. Observação da estrutura espiralada do DNA. o que facilita a continuidade do processo. III. cientistas de todo o planeta prometem empreender uma verdadeira reforma genética na natureza. IV. em sua maioria. Estabelecimento das leis da hereditariedade. I. VI. Clonagem do primeiro mamífero a partir de uma célula de um animal adulto. e) Expressou-se como na célula muscular. c) os vegetais apresentam. é: a) foi integralmente inativada b) foi integralmente mantida ativa c) expressou-se como na célula epitelial d) expressou-se como na célula germinativa Questão 1304 No fim de junho de 2000. I.

b) apenas I. o material genético (DNA. d) embrionárias são capazes de se diferenciar em outros tipos de células.1 om base nas informações desse esquema e em outros conhecimentos sobre o assunto. é INCORRETO afirmar que células-tronco a) retiradas de embriões congelados eliminam as questões éticas e religiosas associadas à obtenção de órgãos para transplantes. II e IV. ( ) Os plasmídios não contêm genes essenciais à vida das bactérias. III . "Ciência Hoje". esses cromossomos devem estar em metáfase. d) apenas III e IV. Essa nova célula. de um organismo introduzido em uma bactéria.15.Os cientistas ainda precisam compreender melhor os mecanismos de controle de diferenciação celular. é transferida para um útero para que se desenvolva e forme um embrião.I . II e III. o núcleo de uma célula somática de um tenista é retirado. desde que cultivadas sob condições adequadas. Em 1997. 2003 [adapt. II. ainda não totalmente avaliado. e o adulto (5) terá praticamente as mesmas características fenotípicas do indivíduo que doou o núcleo. (3). Questão 1307 Analise este esquema relativo à obtenção de células-tronco: Questão 1308 Considerando o processo de clonagem do DNA. analise as proposições abaixo. O embrião se desenvolverá. III e IV. c) de adulto são capazes de se diferenciar em outro tipo de célula. Nos cortes são utilizadas as enzimas transcriptases reversas. porém.A introdução de um material genético exógeno (transgene) em organismo vivos pode determinar um risco ecológico. sendo descrita como uma estrutura membranosa que está envolvida no processo de regulação de cálcio. que foi denominada de retículo nucleoplasmático. II . e) I. o núcleo foi considerado uma organela que apresentava as seguintes estruturas: um envoltório.A clonagem poderá auxiliar no esclarecimento dos mecanismos de envelhecimento e morte celular. São corretas a) apenas I. Questão 1309 O esquema a seguir mostra uma clonagem reprodutiva humana. ( ) Um DNA recombinante pode ser obtido a partir da união de um segmento de DNA bacteriano com um segmento de DNA de um outro organismo. uma vez que o fenótipo é resultado do genótipo (DNA) mais as influências do ambiente. c) apenas II. eles podem ser utilizados como vetores genéticos. ( ) Com uma única transcriptase é possível cortar o DNA de uma célula em pontos da molécula onde existem diferentes seqüências de nucleotídeos. o nucléolo e enzimas. Nesse processo.] 1. IV . é possível obter-se um grande número de cópias do mesmo. ( ) A partir de um segmento de DNA. eliminando o risco de rejeição imunológica. (1). cientistas britânicos descobriram uma nova estrutura nuclear. Por muito tempo. 293 . para um maior aproveitamento dessas técnicas.5. b) de um paciente podem ser usadas para regenerar seus tecidos ou órgãos lesados. ( ) Para cortar o DNA dos cromossomos. é removido o núcleo de um ovócito. (2) e finalmente é introduzido o núcleo da célula do atleta no ovócito enucleado. III e IV. (4).Os estudos de clonagem podem ser proveitosos para o estabelecimento de relações filogenéticas entre os organismos fósseis e os atuais. independentemente do seu tecido de origem. nŽ 195. RNA).

Questão 1310 Os morangos de excelente qualidade que se encontram atualmente nos supermercados são produto principalmente de técnicas de propagação vegetativa "in vitro". sendo que cada uma delas é composta por duas camadas de lipídios com proteínas inseridas. este . pois as células podem ser manipuladas geneticamente e. e) o envoltório nuclear é formado por duas membranas. (1) As plantas obtidas de uma mesma cultura de tecidos são geneticamente iguais. Questão 1312 Considere as cinco situações seguintes. a eliminação de infecções virais presentes na planta-mãe e que. Essas técnica permite. b) o nucléolo é responsável pela síntese do RNA ribossômico.15. por exemplo. que é uma organela citoplasmática. enquanto estas se encontram na fase de a) mórula. I. entre elas as envolvidas nos processos de transcrição e replicação. principalmente para a obtenção de células-tronco. Questão 1311 Um dos caminhos escolhidos pelos cientistas que trabalham com clonagens é desenvolver em humanos a clonagem terapêutica. O gameta feminino (óvulo) de certos animais se desenvolve formando um novo indivíduo. c) I. II. apenas. podemos dizer que são processos de clonagem: a) I. faz-se uma cultura de tecidos e. com o núcleo de uma célula somática retirada de um animal que se deseja copiar. (3) A cultura de tecidos vegetais facilita o melhoramento . c) nêurula. IV. é INCORRETO afirmar que a) o núcleo é uma organela exclusiva das células eucarióticas. A partir de células de um morangueiro. e) formação da notocorda.5. (4) Uma vez obtida uma variedade de morangueiro com as características ideais. (4). sem que tenha sido fecundado. muito menos produtivas. as células-tronco podem ser comparadas às células dos embriões. originando zigotos igualmente distintos. c) a função do retículo nucleoplasmático é semelhante à do retículo endoplasmático. do qual se retirou o núcleo celular. apenas. IV e V. III. que são células indiferenciadas que podem dar origem a qualquer tipo de tecido. apenas. III e IV. apenas. b) gástrula. d) formação do celoma. obtêm-se plantas adultas. V. podem-se obter indivíduos adultos com características alteradas. será a célula doadora do núcleo. Concepção de um organismo a partir da fusão de um óvulo não fecundado. Uma muda de violeta formada a partir de uma única folha que tenha sido destacada de outra planta e plantada em solo úmido e bem adubado. pelo procedimento tradicional. No seu interior. não se justifica preservar as variedades silvestres. Tomando-se como referência a definição genética de clone e considerando as situações descritas. d) todo o DNA da nova célula formada na clonagem citada no texto. estão presentes várias enzimas. 294 Com base no texto e em seus conhecimentos. II.forma os ribossomos. Com base nessa informação. estruturas importantes no processo de tradução. Óvulos distintos são fecundados por espermatozóides também distintos.juntamente com proteínas . d) I. b) I e II. Formação de vários embriões a partir de um único zigoto. (2) Uma vantagem dessa técnica é que as plantas produzidas não são suscetíveis ao ataque de pragas.1. julgue os itens adiante. seriam passadas para as plantas-filhas. a partir desta. Quanto a este aspecto.1 genético de plantas. a partir delas.

Esses descendentes são submetidos a doses de herbicida três vezes superiores às aplicadas nas lavouras convencionais. a existência de clones apenas aumenta o número de representantes de um determinado nível trófico. a crítica recai sobre o fato de que não se sabe se os genes introduzidos irão se expressar exatamente como no organismo doador ou se irão ativar também alguns genes inativos do genoma do organismo receptor. criar um clone transgênico. Estão corretas: a) I e II. IV e V. e) Obter células do embrião em fase de blástula. até o momento. Questão 1313 Sobre a clonagem de seres e a criação de organismos geneticamente modificados (transgênicos). II. quando as células já estão mais diferenciadas. Aponte a alternativa que relaciona o procedimento e a justificativa corretos para que tal pesquisador tenha sucesso. Um grande inconveniente entre a clonagem e a produção de transgênicos é que ambas não permitem sobreposição. em uma cadeia alimentar. c) I e IV. Questão 1315 No filme "Jurassic Park". b) Trabalhar apenas com embriões em vez de organismos adultos. III. Questão 1314 Um pesquisador precisa obter células-tronco para iniciar experimentos em terapia gênica. b) a composição química do DNA dos dinossauros é diferente das encontradas em espécies atuais. já que no cordão a diferenciação é menor e o número de células. A reconstituição dessas moléculas teria sido feita através da inserção de fragmentos de DNA de rã. cientistas retiraram do intestino de insetos hematófagos fósseis moléculas de DNA de dinossauros. A clonagem de organismos tem se voltado mais para os animais porque. No caso dos transgênicos. Uma linhagem de soja transgênica requer a produção inicial de 200 plantas resistentes ao herbicida e destas são selecionadas as dez mais "estáveis". ou seja. d) o DNA coletado sofre mutações durante o período em que ficou fossilizado. de Steven Spielberg. d) Optar pela obtenção das células do cordão umbilical de recém-nascidos em vez de obtê-las da fase de gástrula. com maior capacidade de gerar descendentes também resistentes.e) I. processo que exige cerca de três anos. Tanto nos clones quanto nos transgênicos. ali. pode haver também alteração de posições e de elementos na cadeia. e) III e IV. já que ela não tem possibilidade de cruzamento com outras plantas e o perigo de polinização 295 . considere as quatro afirmações seguintes. IV. quando ainda não é possível conseguir células tão indiferenciadas. não foi possível. e) não existem técnicas para a inserção de fragmentos de DNA de uma espécie em outra. maior. ela já é conhecida e utilizada há certo tempo. d) II e III. uma vez que em adultos não existem células-tronco. II. Em seguida. Apesar da eficiência proposta no filme. c) Conseguir células germinativas do ovário de uma fêmea adulta pois. inclusive na agricultura. c) as características do organismo se devem à estrutura primária das proteínas e não do DNA. com relação às plantas. as cinco melhores são separadas e apenas uma delas é levada a testes de segurança. I. III. A planta está passando por testes de segurança nutricional e ambiental. Ecologicamente. em vez de obtê-las da gástrula ou do cordão umbilical. Questão 1316 A Embrapa possui uma linhagem de soja transgênica resistente ao herbicida IMAZAPIR. a) Obter células-tronco de embriões em fase de gástrula em vez de obtê-las da blástula. elas estão menos diferenciadas do que as células germinativas nos testículos de um macho adulto. Os riscos ambientais da soja transgênica são pequenos. quando a indiferenciação é maior. na prática esse procedimento é extremamente improvável porque: a) seria necessário encontrar um genoma completo e conhecer sua ordem nos cromossomas. b) I e III.

15. II e III. b) mutante e técnica de clonagem. c) a capacidade da linhagem de cruzar com espécies selvagens é inexistente. algodão colorido e cabras que produzem fatores de coagulação sangüínea humana.2 Questão 1318 "Tracy é uma ovelha transgênica. Questão 1317 Os transgênicos vêm ocupando parte da imprensa com opiniões ora favoráveis ora desfavoráveis. b) I. Pense na batata (ou qualquer outra planta) como uma fábrica que produz a mesma substância (proteína. c) mutante e técnica do DNA-recombinante. III.). b) as doses de herbicida aplicadas nas plantas são 3 vezes superiores às usuais. d) a linhagem passou por testes nutricionais e após três anos foi aprovada. II e IV. Estão corretas apenas as afirmativas: a) II e III. segundo o texto. e) transgênica e técnica de clonagem. ou seja. amido. O catálogo com a receita para a produção dessas substâncias está no genoma. no seu patrimônio genético. A planta de fumo e a técnica utilizada para obtê-la são denominadas. III e IV. Questão 1320 Analise as informações abaixo: I. apresenta baixo risco ambiental porque a) a resistência ao herbicida não é estável e assim não passa para as plantas-filhas. capaz de produzir uma proteína humana cuja deficiência causa problema hepático e pulmonar". A soja transgênica. referentes à técnica utilizada para obtenção da Tracy. Caso você fosse escolher uma ilustração para um artigo sobre os transgênicos. Animal transgênico é aquele que recebe e incorpora genes de outra espécie. um dos pintores surrealistas mais importantes. Analise as afirmativas a seguir. Assim. ou modificado da mesma espécie. estaria mais de acordo com esse tema tão polêmico? I.cruzada com outro tipo de soja é de apenas 1%. Um organismo ao receber material genético de outra espécie. qual das obras de Magritte. por exemplo. Quando essa planta foi regada com a substância que o vaga-lume usa para produzir luz. e) a linhagem obtida foi testada rigorosamente em relação a sua segurança. II.5. já temos bactérias fabricando hormônios humanos. d) I. a seguir. Para a ligação do DNA transplantado ao DNA hospedeiro a célula utiliza a ENZIMA LIGASE. Uma saída é consultar os catálogos de outras espécies. a) mutante e técnica de miscigenação. c) I. A bactéria 'Bacillus thuringiensis' (Bt) contém um gene que leva à produção de uma enzima capaz de digerir o 296 1. III e IV. II. passa a apresentar novas características. e) II. ela começou a brilhar. d) transgênica e técnica do DNA-recombinante. deixou obras enigmáticas. Suponha que você queira tomar a fábrica inexpugnável aos ataques de insetos. . A técnica do DNA recombinante foi utilizada para obtenção de Tracy. As substâncias utilizadas para isolar o gene a ser transplantado são denominados ENZIMAS TRANSGÊNICAS. respectivamente. O belga René Magritte (1896-1967). mas o catálogo não possui a receita para isso. etc. IV. Questão 1319 Uma planta de fumo foi produzida a partir de uma célula de fumo que havia recebido o gene responsável pela bioluminescência dos vaga-lumes.

Paulo" de 03/07/1999. O besouro ou a lagarta que se alimentar dela morrerá. incluir o gene no genoma da batata. c) Estudar a dinâmica de crescimento e de regeneração natural das florestas tropicais. d) 75 %. d) transgênicas. Questão 1323 As questões ambientais têm sido motivo de preocupação sobretudo para as últimas gerações. Questão 1322 A engenharia genética possibilitou a introdução do gene humano para a produção da insulina em bactérias. e) Imobilizar o gás carbônico tanto pelo processo de fotossíntese como por meio da fabricação de móveis. que porcentagem de descendentes portadores do gene humano espera-se obter? a) Zero. constituindo. As alternativas a seguir apresentam algumas atividades sugeridas para a melhoria da qualidade de vida humana e da saúde ambiental. Quando uma célula meristemática for geneticamente modificada. Segundo os biotecnólogos. ao tipo de população e às suas riquezas naturais. o que lhe conferiu resistência ao ataque de predadores. IV. Agora. pois a toxina digere o intestino desses animais. d) Introduzir nas células de uma planta. A qualidade do ar e a importância da preservação da biodiversidade constam da pauta das discussões da humanidade há muito tempo. a toxina Bt é inofensiva aos seres humanos. e) Podemos confiar na palavra dos biotecnólogos quando afirmam "A toxina Bt é inofensiva aos seres humanos". uma nova espécie. c) 50 %. é preciso transferir esse gene para o genoma da batata. V. III. genes de uma outra espécie. d) A batata passou a ser uma alimento geneticamente modificado. Para que isso fosse possível. b) A batata passou a ser um alimento transgênico porque foi cruzada com gametas oriundos da bactéria. e com certeza não haverá ser humano sensível à ação biodigestora da toxina. A engenharia genética tem ferramentas bioquímicas para tirar cópias dessas páginas do genoma. A planta inteira ficará impregnada com a toxina. Essas bactérias são consideradas a) puras. b) Cultivar espécies com crescimento rápido e utilizar esses conhecimentos para planejar plantações economicamente viáveis. pois sabemos que o genoma humano é homogêneo. Após a análise das informações acima. a) A batata geneticamente modificada é um alimento transgênico porque recebeu um genoma completo da bactéria. ela poderá de transformar numa planta adulta que produzirá a toxina Bt. a) Associar o desenvolvimento socioeconômico de cada região às suas características de relevo. tiradas do jornal de "Folha de S. b) 25 %. assinale a alternativa correta. cujos intestinos não oferecem condições para ela se manifestar. Questão 1324 Recentemente foi noticiada a criação de uma planta transgênica. A biotecnologia já encontrou bactérias ou vírus capazes de fazer essa transferência. isto é. a partir do cruzamento com a bactéria.intestinos dos insetos. c) A batata geneticamente modificada é um alimento transgênico porque recebeu parte do genoma de uma outra espécie. Se essa ovelha for cruzada com um macho não-transgênico. VI. Questão 1321 A introdução de uma cópia de um gene humano no genoma do pronúcleo masculino de um zigoto originou uma ovelha transgênica. essa planta recebeu: a) os anticódons que determinam a seqüência de 297 . Assinale aquela que contém conceitos e informações científicas só disponíveis aos jovens. b) clones. capaz de produzir hemoglobina. na última década do século XX. o que lhe conferiu resistência ao ataque de predadores. c) mutantes. fazendo com que os novos genes sejam incorporados a seus cromossomos. e) 100 %.

c) não se conhecem os efeitos que os transgênicos podem ter na saúde das pessoas. c) Modificar um organismo geneticamente significa cruzar espécies diferentes. b) I. científico e filosófico. para se obter uma espécie nova que não ocorre naturalmente. apenas. gerando novas combinações genéticas. b) todos os países passarão a produzir soja. A transferência de genes bacterianos para o genoma de uma planta amplamente cultivada e usada na alimentação animal e humana vem gerando. Atualmente. diversos produtos biotecnológicos estão sendo comercializados. Estão corretas: a) I. milho resistente a insetos IV. permitiram a criação do primeiro produto transgênico de grande impacto na agricultura: a soja resistente a um potente herbicida. Questão 1328 A engenharia genética causou uma revolução na biotecnologia. A esse respeito.aminoácidos nessa proteína. II . d) I e III. eliminando todos os competidores do homem e dos animais que ele cria. beneficiando o meio ambiente. b) A aplicação da engenharia genética nos alimentos teve origem em países do terceiro mundo. c) o fragmento de DNA. aumentando a produtividade e minimizando. o "round-up". questionamentos de cunho político.Trata-se de alimentos fabricados com produtos geneticamente modificados. utilizadas para a obtenção de seres transgênicos. II e IV. d) O RNAm que carrega os aminoácidos usados na síntese de hemoglobina. que apresentam uma grande incidência de pragas na agricultura. considere as seguintes afirmações. Questão 1327 As técnicas de manipulação genética. d) A modificação genética dos alimentos consiste na transferência de material hereditário de um organismo para outro receptor. e) somente os aminoácidos usados nessa proteína. destaque a afirmação correta: a) O objetivo dos cientistas é criar novas espécies. prejudicando os atuais exportadores. e) os transgênicos simplificarão muitas cadeias alimentares. III e IV. o uso de herbicidas. apenas. poucos assuntos geram tanta controvérsia como os produtos transgênicos. Esta interferência do homem na natureza se dá por meio da engenharia genética. b) os ribossomos utilizados na produção dessa proteína. Questão 1325 Atualmente. batata resistente a viroses II. IV . porém. III . Considere os quatro exemplos abaixo: I.Os ecologistas temem que as plantas transgênicas possam afetar o equilíbrio ecológico. não trazendo perigos para a humanidade. III e IV. apenas. Questão 1326 Atualmente. insulina humana para uso de diabéticos III. muitas cadeias alimentares desaparecerão.Pode-se gerar um animal transgênico que tenha a capacidade de produzir maior quantidade de leite com menor taxa de gordura. Com o uso dessa variedade. derivam exclusivamente de engenharia 298 . apenas. e) Os ambientalistas defendem o uso da engenharia genética pois os seus efeitos são totalmente previstos e controlados. Esses questionamentos justificam-se porque a) o custo dos transgênicos será certamente maior do que o dos produtos convencionais. cuja seqüência de nucleotídeos determina a seqüência de aminoácidos da hemoglobina. as técnicas de controle de pragas nas culturas de soja sofreram mudanças e os custos de produção diminuíram. d) eliminando-se as pragas da lavoura. por conseqüência.Não se sabe quais serão as possíveis conseqüências da ingestão desses alimentos. c) II e III. Sobre este tema. juntamente com produtos obtidos por meios tradicionais. os alimentos transgênicos representam um tema de grande discussão. II. I . soja tolerante a herbicidas Desses produtos. e) II.

II. É possível que haja polinização entre uma planta transgênica com outras de uma mesma espécie. p. Está correto o que se afirma em a) I somente. II. a insetos e a vírus. ano 36. tomateiros cujos frutos passam mais tempo amadurecendo no pé. e) I. Um transgênico possui em seu genoma um ou mais genes provenientes de outra espécie. interferência na composição da diversidade local de insetos ocorre SOMENTE com a) I b) II c) III d) I e II e) I e III Questão 1330 Sementes transgênicas podem levar à produção de plantas resistentes a inseticidas. II. III e IV e) II. c) I e II somente. entretanto. 100) Foram feitas as seguintes afirmações sobre organismos geneticamente modificados: I. outras conseqüências que o seu cultivo pode acarretar entre as quais estão: I. ou então com melhores qualidades nutritivas. maionese. Há desvantagens SOMENTE em a) I b) II c) III d) I e II e) II e III Questão 1331 Os alimentos geneticamente modificados são uma realidade cotidiana. d) II e III somente. ed. favorecendo a população mundial. óleo de soja. Há grãos transgênicos usados no preparo de bolachas. mostarda e papinhas para crianças. III e IV Questão 1329 Obtiveram-se plantas transgênicas com as seguintes características: I. III. 1886. a possibilidade de transmitir seus genes de resistência a plantas de espécies aparentadas. a necessidade de uso mais intenso de agrotóxicos. o que aumenta e barateia a produção. II e III d) I.15.5. pés de milho cujas sementes produzem hormônios de crescimento humano. 43. não transgênicas. pães. III. algodoeiros cujas folhas se tornaram impalatáveis para a herbivoria. porém. Há. b) II somente. Questão 1332 A charge a seguir foi produzida num momento em que no Brasil se discutem as possíveis vantagens e desvantagens da liberação do plantio e comercialização de plantas transgênicas.genética SOMENTE a) I e II b) III e IV c) I. ("Veja". 1. II e III.2 299 . massas. a possibilidade de afetar insetos e outros animais do ecossistema. cereais. III. Toda essas plantas são úteis para a espécie humana. São Paulo: Abril. tornando-se mais saborosos. O processo de inserção de genes de uma espécie em outra é realizado com a ajuda de enzimas de restrição. n.

em 10 de outubro de 2003. tornar os alimentos mais nutritivos e saudáveis e criar novos tipos de terapias e medicamentos. oportunizando melhores condições ambientais e sociais. de animais e do homem. é CORRETO afirmar: a) O que não faz mal para o homem não fará mal para os insetos.Edição 515. o aumento do uso de agrotóxicos e a perda da fertilidade natural do solo. plásticos e combustíveis. c) DNA do coelho injetado no ovo foi transcrito para o RNA ribossômico que conduziu a síntese de proteínas nessa célula. e) DNA do coelho injetado no ovo se incorporou a um cromossomo e passou a conduzir a síntese de proteínas nessa célula. d) Se os insetos experimentarem. além de mais nutritivos. implicações e incertezas. porque: a) RNA mensageiro do coelho injetado no ovo passou a conduzir a síntese de proteínas nessa célula. O problema está em algumas de suas aplicações. leite e ovos. porque suas implicações são muito sérias. as torna resistentes a certos tipos de insetos. a saúde humana e a economia. pois a ingestão da planta não lhe fará mal. Nenhum cientista deixa de reconhecer o poder da tecnologia do DNA. de plantas." ("Revista Galileu".) Analisando-se a charge de acordo com os atuais conhecimentos biológicos. d) Vários tipos de alimentos. b) retornar uma célula diferenciada ao estágio de indiferenciada. produtos químicos. 300 . Mas. e) A poluição genética. o homem poderá experimentar. podem ser usados para produzir remédios. são os principais riscos ambientais. A transferência do gene Bt para as variedades de milho. Questão 1333 "Muito se tem falado sobre os transgênicos e praticamente todo mundo tem alguma opinião sobre o assunto. podendo misturar o DNA de microorganismos. Questão 1334 O primeiro organismo transgênico foi obtido por volta de 1981. são constantes e cada vez mais freqüentes os noticiários sobre o uso de tecnologia transgênica com fim de obter proteínas de ação farmacológica ou mesmo proteínas terapêuticas humanas. Nov/2003) Sobre os OGM (organismos geneticamente modificados). b) As plantas transgênicas são perigosas para a saúde animal. é correto afirmar: a) OGM são produtos obtidos pela transferência de gene entre espécies similares ou diferentes. redução do uso de agrotóxicos. d) RNA mensageiro do coelho injetado no ovo se incorporou a um cromossomo e foi transmitido de célula a célula através de mitoses. fumo. b) DNA do coelho injetado no ovo se incorporou a um cromossomo e foi transmitido de célula a célula através de mitoses. o surgimento de ervas daninhas resistentes a herbicidas. batata e soja. porém o uso dos OGM tornaria os pequenos agricultores independentes em relação às empresas fornecedoras de sementes. algodão. c) O que não é bom para os insetos pode não ser bom para os homens. quando genes de coelhos foram injetados em ovos de camundongos que se desenvolveram no útero de fêmeas dessa espécie. b) Os defensores dos OGM enumeram a capacidade de aumento da produtividade agrícola. Questão 1335 Em revistas e em jornais. Os camundongos que nascidos desses ovos apresentaram hemoglobina de coelho em suas hemácias. c) A bactéria 'Bacillus thuringiensis' (Bt) é um agente de controle biológico encontrado no solo. que gera um novo organismo por multiplicação. regulamentados pelas normas de biossegurança. favorecendo toda população mundial. este tema não pode progredir na base do ser contra ou a favor. que produz uma toxina contra lagartas.(Jornal da "Ciência" . além de servirem para a alimentação. Isto envolve a natureza. como grãos. alterando assim o código genético do organismo. a perda de biodiversidade. A técnica de obtenção de organismos transgênicos produtores de proteínas humanas consiste em: a) remover artificialmente alguns nucleotídeos de uma molécula de DNA.

Questão 1337 No vaga-lume há um gene que determina produção de luciferase. a partir desta.2 Se esse tipo de experimento realmente fosse concretizado. da genética atual.2 través da técnica. d) introdução de um ou mais genes interessantes de uma espécie em célula hospedeira. Com relação a esse experimento. d) o gene do vaga-lume controlou a produção de RNA e de proteína no interior das células do elefante. c) clonado.c) induzir célula somática. Desses ovos. seria possível produzir um rato a) sintético. e) uma seqüência de DNA do elefante sofreu mutação devido à introdução do gene do vaga-lume em células daquele mamífero. levando à produção de luz. esse gene foi transferido para uma célula vegetal e. NÃO é correto afirmar que a) os genes da hidra se expressaram na planária.5. e) métodos biotecnológicos de cruzamentos seletivos para obtenção de novas espécies. representada na ilustração. e) transgênico. c) uma seqüência de RNA do vagalume foi transferida para células do elefante. 1. b) apenas o vaga-lume é um organismo transgênico. a partir do qual as células da planta produziram RNA e luciferase. O resultado desse experimento indica que a planta a) incorporou um segmento de RNA do vaga-lume. Questão 1338 Em um experimento. poder-se-ia afirmar que a) o elefante e o vaga-lume são organismos transgênicos. b) incorporou um segmento de RNA do vaga-lume.5. foram introduzidos certos genes da hidra em ovos de planária. c) os genes da hidra apresentaram transcrição no organismo da planária.15. d) incorporou um segmento de DNA do vaga-lume. a partir do qual as células da planta produziram DNA e luciferase. b) segmentos de DNA da hidra apresentaram capacidade de replicação durante a embriogênese da planária. c) incorporou um segmento de DNA do vaga-lume. foram isoladas moléculas de RNA e de proteína da hidra. b) híbrido. Após ser regada com solução de luciferina. d) transplantado. a reativar os seus genes e gerar um novo ser. obteve-se uma planta inteira. desenvolveram-se vermes portadores de tentáculos e de cnidoblastos com filamento urticante.15. Questão 1336 Responder à questão a seguir com base na ilustração. Através da engenharia genética. A tira de quadrinhos a seguir faz referência à manipulação de genes em laboratório. que possibilitou às células da planta a produção de luciferase. Questão 1339 1. e) a hidra e a planária nele utilizadas são organismos transgênicos. 301 . de maneira a integrar o material genético. d) ocorreu tradução do código genético da hidra no organismo da planária. que porta a totalidade do genoma. que não possibilitou a produção de RNA e nem de luciferase. a referida planta começou a emitir luz. enzima responsável pela oxidação da substância luciferina. Das células de vermes adultos. e) não expressou o gene do vaga-lume.

apresentaram o mesmo valor. após introduzidas em plasmídios. foram constatados casos de transporte de pólen de espécies de canola transgênica para plantas silvestres (ervas daninhas). As cópias. alto poder de resistência a herbicidas. por exemplo. amido e proteínas em suas sementes ou melhorar a resistência das plantas a pestes e vírus ou ainda aumentar a sobrevivência destes organismos em ambientes adversos. produtos que sofreram 302 . Essas cópias de DNA são sintetizadas em laboratório com o auxílio de uma preparação da enzima denominada de: a) RNA replicase b) RNA polimerase c) desoxirribonuclease d) transcriptase reversa Questão 1343 A enzima EPSP-sintase. Estas passaram a apresentar a característica da canola transgênica. ou seja. presente em praticamente todos os vegetais. b) o pólen da canola transgênica transportou material genético para plantas silvestres. na ausência do inibidor. para gerar uma nova planta com novas características. foi medida. Sobre esse fato.5. Estas novas plantas são exemplos de organismos criados por engenharia genética e são genericamente conhecidos como: a) reversos b) recessivos c) dominantes d) transgênicos Questão 1342 Para a clonagem em bactérias do hormônio do crescimento humano a partir de seu RNA mensageiro. mas evita o crescimento de outros vegetais indesejáveis. em crescimento no meio apropriado. d) o RNA da canola transgênica foi transferido e incorporado ao genoma das ervas daninhas. é INCORRETO afirmar que a) as espécies de canola são transgênicas pois expressam genes que incorporaram de outras espécies. o tratamento com esse herbicida não prejudica o desenvolvimento de culturas de soja transgênica. Questão 1341 As técnicas modernas de biologia molecular têm permitido a inserção de segmentos novos de DNA em células vegetais. As atividades da enzima nesses extratos.Questão 1340 Recentemente. é inicialmente necessário que sejam sintetizadas em laboratório cópias em DNA desse RNA. Observe o gráfico: 1. tornando-as resistentes a agentes químicos. a atividade da EPSP-sintase em extratos de folhas de diferentes tipos desse vegetal. Assim. Estes novos segmentos de DNA introduzidos podem. Num estudo para a identificação da variedade transgênica de soja. serão expressas em culturas de bactérias contendo os plasmídios modificados. tornando-a resistente à inibição pelo herbicida glifosato. em presença ou ausência de glifosato.2 A curva que corresponde à razão entre as atividades de uma enzima da variedade transgênica e as atividades dessa mesma enzima da soja comum é a indicada pela seguinte letra: a) W b) X c) Y d) Z Questão 1344 Considere o texto a seguir: "Os alimentos transgênicos. é modificada na soja transgênica. c) as espécies silvestres incorporaram e expressaram material genético da canola transgênica. nas mesmas condições experimentais. e) as ervas daninhas passaram a produzir proteínas da canola transgênica. gerar novas plantas com reservas modificadas de lipídios.15.

e) todas as plantas transgênicas são estéreis a partir da segunda geração mutante. já ocupam prateleiras dos supermercados nos Estados Unidos e Canadá.].alteração genética com o objetivo de melhorar a qualidade. c) manipulações genéticas podem alterar o funcionamento dos genes naturais de um organismo. mas o consumidor não sabe disso: não há lei que obrigue os fabricantes a informar que o produto sofreu alteração genética. d) as técnicas de transferência de genes por engenharia genética são altamente seguras. podem esconder riscos ainda não esclarecidos [. pois os resultados das experiências podem ser imprevisíveis. c) Antes de se obter a planta produtora de GH é necessária a produção do DNA recombinante. quando introduzido na célula vegetal é transcrito em DNA na presença da enzima transcriptase vegetal.. recentemente. em geral. corretamente.2 303 . b) a utilização de células vegetais diminui a possibilidade de contaminação humana por vírus animais. relacionado ao GH. a multinacional Monsanto está tentando conseguir autorização do Ministério da Ciência e Tecnologia para produzir soja transgênica no país. d) O RNA mensageiro.15. Pela leitura do texto anterior. 1. que: a) toda planta transgênica produz substâncias altamente tóxicas ao ser humano. Eduardo Kac. presente naturalmente em medusas e que pode ser detectada sob luz ultravioleta. (FOLHA DE SÃO PAULO. Questão 1345 Pesquisadores de alguns centros de pesquisa brasileiros. Os benefícios [advindos de plantas transgênicas].5.. utilizando técnicas de engenharia genética. Considere estas informações e assinale a opção incorreta: a) O gene para a produção de GH é. Estas plantas são chamadas transgênicas. entre as quais o hormônio do crescimento (GH). batizou de Alba a coelha transgênica que tem uma propriedade peculiar: seus olhos rosados e seus pêlos brancos ficam fluorescentes quando expostos à luz ultravioleta. introduzido no plasmídeo antes de sua introdução na célula vegetal. obtiveram. 6 de agosto de 1998). os pesquisadores criaram um coelho que produz em todas as suas células a proteína GFP (proteína verde fluorescente. onde também não há obrigação de alertar o consumidor. No Brasil. o resultado mais trágico do uso de produtos transgênicos surgiu no Japão em 1989: 5000 pessoas ficaram doentes. na sigla em inglês). porém. plantas que produzem proteínas humanas. e) O DNA relacionado à síntese do GH pode ser obtido a partir do RNA mensageiro. pode-se concluir. Criador e artista já disputam a posse da "transcoelha". Para conferir essa característica particular. artista plástico brasileiro e professor de arte e tecnologia em Chicago. Até o momento. 1500 se tornaram permanentemente inválidas e 37 morreram". b) plantas transgênicas são aquelas cujos fenótipos se devem mais ao ambiente do que aos genes. Questão 1346 Os cientistas franceses que criaram animal transgênico e o artista brasileiro que fez a encomenda entram em conflito.

em indivíduos sedentários. e) Ainda não é possível produzir plantas com genes ativos de insetos. o homem tem desenvolvido grandes projetos. são vetores do DNA recombinante. IV) A coelha transgênica foi produzida a partir da introdução de um núcleo extraído de uma célula de medusa em um óvulo de coelha cujo núcleo tenha sido anteriormente removido.br/educacao/isaacelias/coelha. somente estão corretas: a) I e II b) I e III c) I e IV d) II e III e) III e IV Questão 1347 Recentes descobertas têm provocado grande discussão por poderem alterar o futuro do esporte. 08/2004) Analise os procedimentos a seguir e aponte aquele que poderia promover o desenvolvimento mais duradouro da massa muscular. Assim sendo.terra. b) Organismos que recebem e manifestam genes de outra espécie são denominados transgênicos. Nessas pesquisas. c) evita o aparecimento do bocio. a partir de DNA viral. se executado uma única vez. c) Introduzir nas células musculares nova cópia do gene do fator IGF-1. II) Apenas as células somáticas tiveram o gene que codifica a proteína GFP inserido em seu genoma. A partir desse conhecimento é possível modular o crescimento muscular por meio de vários procedimentos. O crescimento muscular é estimulado pelo fator IGF-1 e limitado pela miostatina. Sobre este assunto.geneticamente modificado . tal como a insulina. Questão 1349 Através de técnicas da biologia celular. c) As enzimas de restrição agem em seqüências inespecíficas de DNA. e CORRETO afirmar que o uso desse grão na alimentação humana resulta em benefício para a saúde porque ele a) previne alguns tipos de cegueira. para que estas produzam substâncias que normalmente não seriam produzidas. como o de transformar células de bactérias. assinale a alternativa correta.htm Considerando a tecnologia para obtenção de transgênicos. d) diminui a formacao de coagulos. III) As células fluorescentes da coelha produzem RNA mensageiro. que no processo de tradução origina a proteína GFP.daptado de: http://paginas. b) aumenta o peristaltismo. Dentre as afirmativas acima. 304 . referentes a diferentes questões de Genética. sem deixar vestígios detectáveis em exames de sangue ou urina. ("Scientific American Brasil". a) As enzimas de restrição hoje conhecidas são produzidas por diversas indústrias multinacionais. foi mostrada a existência de duas proteínas que atuam regulando o crescimento das células musculares: o fator de crescimento IGF-1 e a miostatina.produz ’-caroteno (vitamina A). Questão 1350 Analise as proposições a seguir.com. e) Injetar anticorpos produzidos contra o fator IGF-1. b) Injetar anticorpos produzidos contra a proteína miostatina. Questão 1348 O arroz dourado . chamados de bacteriófagos. d) Cromossomos circulares presentes no citoplasma de bactérias. a) Introduzir nas células musculares novas cópias de RNA mensageiro que codifica o fator IGF-1. utilizando técnicas aplicadas em terapia gênica. são feitas as seguintes afirmativas: I) A coelha Alba é considerada transgênica pois possui em seu genoma um segmento de DNA de medusa. d) Injetar a proteína miostatina mutada que bloqueia a ação da miostatina normal por competir pelo seu receptor.

( ) No homem. Esses alimentos (. A probabilidade de uma mulher (AaBb). Desenvolver variedades de plantas resistentes a geadas. a chamada comida GM. acidez do solo e escassez de água. por exemplo.. Desenvolver variedades de plantas resistentes a herbicidas ou a insetos.. em uma única gestação.afirmativas a seguir. de 'Escherichia coli'. milho. Da análise das afirmativas acima podemos assegurar que: a) apenas I está correta b) apenas II está correta c) apenas I e II estão corretas d) apenas II e III estão corretas e) I. II. No caso ilustrado no esquema (figura 1). preocupação de longo prazo têm os ingleses. é de 1/16.) Vegetais modificados geneticamente são considerados transgênicos. e essa mutação determinar a produção de enzima não-funcional. 16/06/99. Questão 1351 Em todo o mundo. cinco classes fenotípicas podem ser observadas na população. apresentará fenilcetonúria. Se ocorrer uma mutação em um determinado loco. Nos últimos anos.2 ( ) Certos microorganismos podem ser manipulados em laboratório para incorporarem. Sua obtenção se dá com a) o cruzamento de duas espécies distintas. c) a seleção de DNA mais adaptado existente numa determinada espécie. é necessário que uma molécula produzida por um gene regulador (x) não reprima o gene operador (1). ( ) Por meios biotecnológicos. b) a incorporação de RNAm na célula zigoto das espécies. casada com um homem (aabb). Questão 1353 Escolha a alternativa que apresenta um exemplo de transgenia. batata. cada um determinando a produção de uma enzima. O DNA recombinante então obtido pode ser clonado e utilizado. o país vem consumindo cada vez mais alimentos geneticamente modificados. tomate e muitas outras. diferentes genes participam do metabolismo dos aminoácidos fenilalanina e tirosina. já ocupam cerca de 40 milhões de hectares. ilustrado no esquema (figura 2).53. em testes laboratoriais para a detecção de gravidez em estágios muito precoces. ( ) Se dois pares de genes aditivos determinam a cor da pele no homem. na produção de hormônios para a espécie humana. Considere as . 305 1. 3 e 4 (estruturais). reconhecidos como altamente específicos. e) a adição de DNA exógero manipulado.5. plantas transgênicas. como soja. a) Incorporação e expressão de gene humano que codifica insulina por bactérias. um de fenótipo mulato-médio e o outro de fenótipo branco. Tais anticorpos podem ser empregados. para ocorrer a transcrição das enzimas codificadas nos genes 2. por exemplo. que mostram os objetivos da manipulação genética das plantas cultivadas. da mesma espécie ou de outra espécie no genoma da espécie em estudo.15." (Adaptado da revista VEJA. dois filhos.) têm seu código genético alterado para ficarem mais viçosos ou resistentes a herbicidas e pragas. a Argentina e o Canadá. segmentos do DNA de outro organismo. d) a introdução de DNA em genomas das células dos vegetais já formados. podem ser produzidos anticorpos monoclonais. algodão. ter. Desenvolver variedades de plantas que produzam frutos com melhor textura e de amadurecimento lento III. p. sendo os principais produtores os Estados Unidos. II e III estão corretas Questão 1352 "A reforma da natureza Em termos de cardápio diário. ( ) Considerando o operon da lactose. a pessoa expressará uma anomalia metabólica. I. em seu material genético.

(2) Organismos geneticamente modificados podem ser resistentes a produtos químicos como herbicidas. (16) Os organismos transgênicos são aqueles que recebem segmentos de DNA da mesma espécie. ( ) As vitaminas são necessárias em grandes quantidades. (4) As técnicas de melhoramento genético tradicionais. plantas e animais.) A citação anterior mostra avanços da Engenharia Genética. ( ) Uma importante fonte natural de vitamina A são os vegetais com pigmentos amarelos. (1) Transgênicos são organismos produzidos com a tecnologia do DNA recombinante.14. Questão 1356 Acerca dos organismos transgênicos. b) V .V. 306 . é uma das experiências bem sucedidas da transgenia.. (32) É fundamental o estabelecimento de limites. ( ) A vitamina A foi introduzida no núcleo das células. julgue os itens a seguir. alterando geneticamente animais e plantas. à obrigatoriedade da apresentação. deixando os vegetarianos confusos com a perspectiva de cruzar animais com plantas.b) Desenvolvimento de um organismo completo a partir de uma célula somática. ou agir como inseticidas. p. vol. ("CICLO VITAL". por isso o grão transgênico é mais nutritivo. a partir de transferência de genes humanos para bactérias. c) Organismo que apresenta tanto estruturas reprodutoras masculinas quanto femininas. isto é.V . (04) Os alimentos transgênicos não representam nenhuma ameaça à saúde humana. com muitos genes em heterozigose.F. na embalagem de alimentos produzidos com técnicas da biotecnologia.F. de informação relativa à natureza transgênica do produto. c) V . (3) Os debates atuais a respeito dos transgênicos resumem-se à questão da rotulagem. resultante do cruzamento de duas variedades puras distintas. (02) Os genes alienígenas permitem ao organismo receptor produzir substâncias que nunca produziriam em condições naturais.F. e) Organismo mais vigoroso.F .F . e) F . isto é. 1999. incontinentimente. d) F . gens de galinha são introduzidos em batatas. Questão 1354 Porcos têm sido criados transgenicamente para que seus órgãos possam ser transplantados em homens. Assinale verdadeira (V) ou falsa (F) nas afirmativas a seguir. que permite a inclusão de genes de organismos de espécies diferentes no genoma de bactérias. originando múltiplos alelos para um mesmo locus. pois atuam como enzimas.V . 4. e por isso não necessitam ser testados em outras espécies de animais. Assinale a(s) proposição(ões) VERDADEIRA(S) sobre a transgenia e suas implicações com relação à saúde e ao meio ambiente. como a poliploidização. para que as manipulações genéticas não resultem em impactos ambientais irreversíveis.. (01) Cientistas interferem na evolução natural das espécies. antes de chegarem ao homem. A seqüência correta é a) V . (08) a produção de insulina. podem ser consideradas exemplos de biotecnologia aplicada à fabricação de organismos transgênicos. Questão 1355 Foi transferido para plantas de arroz um gene que permite a produção e o acúmulo de vitamina A no grão das plantas transgênicas. tanto por parte dos cientistas como dos governantes.V. que passam. d) Gene que sofreu mutações. como a cenoura. cientistas desenvolvem ovelhas "auto-tosquiáveis". a lã cai sozinha no devido tempo.F . a produzir esse hormônio.

Essa diferença consiste na(o): a) seqüência de bases nitrogenadas.2001) afirmou: "O que torna a técnica tão atrativa e produtora de ansiedade é que qualquer gene de qualquer espécie pode ser transferido para qualquer outra espécie". transmitiram os genes do coelho aos seus descendentes. d) mutantes. continua-se considerando que homens e chimpanzés são espécies diferentes. se as espécies forem de filos diferentes. em função das informações do texto. os trechos de DNA que se traduzem em alguma função. d) os camundongos transgênicos. pode-se dizer que a maior contribuição para a diferença fenotípica entre essas espécies seja devida à 307 . Ruddle. d) é válida. por J. pela análise do DNA das células. mas não foi incorporado aos seus genomas. levando à produção de ratos gigantes.Paulo". Paulo" (07. 01. Questão 1361 CONSÓRCIO DECIFRA GENOMA DO CHIMPANZÉ. com a mera troca de uma letra num gene.10. T. A partir destas informações. d) tipo de pentose existente. Essa afirmação a) não é válida. Gurdon e F. Questão 1358 O primeiro transplante de genes bem sucedido foi realizado em 1981. Questão 1359 Com relação à técnica de criação de organismos geneticamente modificados (transgênicos).09. independentemente de sua classificação. b) não é válida. b) aspecto da dupla hélice presente. nós e esses grandes macacos africanos somos 99% iguais. a duplicação de um conjunto de letras qualquer ou a deleção de outro. NO BRASIL. o caderno Mais! do jornal "Folha de S. identificar a paternidade de uma pessoa sem a necessidade de coleta de sangue. c) infectados. desde que as espécies sejam da mesma ordem. Estes ratos são considerados a) isogênicos. Esse tipo de teste é particularmente indicado para bebês e crianças pequenas. ("Folha de S.Questão 1357 A engenharia genética permitiu a introdução. injetando genes da hemoglobina de coelho em zigotos de camundongos. As diferenças no DNA de humanos e chimpanzés são de apenas 4% dos quase 3 bilhões de bases (letras químicas A. C e G) que compõem ambos os genomas. c) número de fosfatos contidos. pode-se deduzir que a) o DNA injetado foi incorporado apenas às hemácias dos camundongos. e) o RNAm foi incorporado ao zigoto dos embriões em formação. desde que as espécies sejam do mesmo reino. resultando camundongos com hemoglobina de coelho em suas hemácias. Desse modo. Questão 1360 "EXAME DE PATERNIDADE. JÁ PODE SER FEITO COM SALIVA" "Novo teste pode. Quando se olha para os genes em si . b) transgênicos. ao se reproduzirem. b) o DNA injetado nos camundongos poderia passar aos seus descendentes somente se fosse incorporado às células somáticas das fêmeas dos camundongos. c) é válida. E boa parte dessas modificações se deu de maneira trivial ao longo dos cerca de 6 milhões de anos transcorridos desde o ancestral comum de ambos. como a síntese de proteínas -. para obtenção de camundongos transgênicos. que apresentam características diferentes.2005) A despeito da similaridade genética. e) clones.W. do gene humano para produção do hormônio de crescimento.H." (O GLOBO. e) tipo de desoxirriboses presentes. mas não poderiam transmitir essa característica aos seus descendentes. c) os camundongos receptores dos genes do coelho tiveram suas hemácias modificadas. se as espécies forem de classes diferentes.isto é. e) é válida para todas as espécies. 20/08/98) Nesse tipo de teste. em ratos. a semelhança estrutural existente entre as moléculas de DNA é tomada por base para a identificação da paternidade.

15. Bill Clinton. a humanidade viverá uma nova era. b) todos os tipos de proteína codificados pelos genes humanos. II. foram feitas algumas afirmações. IV. d) I e III apenas. Questão 1362 O anúncio do seqüenciamento do genoma humano." "Folha Ciência". I. c) a seqüência exata de nucleotídeos de cada gene.3 Sobre esse experimento. Tony Blair. IV e V apenas. que possui apenas 470 genes. o primeiro ministro britânico. o seqüenciamento do DNA revolucionou a ciência e gerou novos conhecimentos sobre seres procariotos e eucariotos. é capaz de inativá-lo. II. o consórcio público internacional Projeto Genoma Humano (PGH) e a empresa norte-americana Celera. d) descobrir novos genes com funções ainda desconhecidas. significa que os cientistas determinaram a) a seqüência de nucleotídeos dos cromossomos humanos. São Paulo . b) a expressão dos genes. e os representantes dos grupos rivais. São afirmações CORRETAS: a) I. Pelas pesquisas realizadas até hoje no Projeto Genoma Humano. Questão 1363 Os projetos genomas. empenham-se no momento em descobrir a) a interação dos genes. Questão 1364 Pelo Projeto Genoma Humano. como eles agem.5. realizou-se um experimento com a bactéria 'Mycoplasma genitalium'. d) a seqüência de aminoácidos de todas as proteínas humanas. EXCETO: a) selecionar embriões com características desejáveis. Quando um transposon é inserido aleatoriamente dentro de um gene. IV e V. c) garantir a cura de todas as patologias humanas. III. e) o número correto de cromossomos da espécie humana. anunciaram ontem o presidente norte-americano. A bactéria 'M. e) como ocorrem a duplicação e as mutações dos nucleotídeos. Questão 1365 Nos últimos dez anos. a era da genética.27/6/2000. Questão 1366 "O genoma humano foi mapeado e sua seqüência estabelecida pela primeira vez na história da humanidade. com o intuito de verificar se todos esses genes eram essenciais para a sobrevivência dessa espécie. c) II. Em um laboratório. o genoma mínimo essencial pode ser determinado.a) seqüência de bases nitrogenadas no DNA. 308 . é possível. e) seqüência de aminoácidos das proteínas. No experimento II. d) quais nucleotídeos servem de molde para a síntese de RNAm. a ausência de crescimento significa que o gene B é essencial. 1. o crescimento demonstra que o gene A não é essencial. V. IV e V apenas. genitalium' sobrevive sem utilizar alguns de seus genes. Se cada gene pode ser inativado por mutação. que estão sendo desenvolvidos em centros de pesquisas de vários países. inclusive permitiu o estabelecimento de comparações genômicas com o intuito de analisar quais genes são típicos de um organismo e quais foram perdidos no processo evolutivo. c) a seqüência de aminoácidos do DNA humano. c) quantidade de lócus gênicos. II. isto é. b) compreender mecanismos que tornam uma célula imortal. em 21 de junho de 2000. d) expressão diferenciada dos genes. III. b) I. No experimento I. b) quantidade de DNA presente no núcleo das células desses organismos.

Na fase laboratorial. Uma das formas possíveis de identificar os despojos dos filhos dessa senhora consiste em verificar se existe homologia do: a) DNA mitocondrial da senhora com o DNA mitocondrial das vítimas b) DNA mitocondrial da senhora com o DNA nuclear das vítimas c) DNA nuclear do marido e do ex-marido da senhora com o DNA mitocondrial das vítimas d) DNA mitocondrial do marido e do ex-marido da senhora com o DNA mitocondrial das vítimas e) DNA nuclear da senhora com o DNA mitocondrial das vítimas Questão 1368 Os avanços da Engenharia Genética têm permitido o conhecimento mais amplo dos cromossomos. o método de produção do hormônio do crescimento envolve diretamente a) o seqüenciamento de DNA. Questão 1367 Em um acidente. embora os corpos das vítimas fatais fiquem queimados e irreconhecíveis. d) a hibridização de DNA. c) o DNA recombinante. e) todas as proposições. pode-se afirmar que estão CORRETAS a) apenas I e II. cada um de um casamento diferente." ("Ciência Hoje". como a hemofilia. algumas questões de cunho ético têm sido levantadas. Faleceram no acidente dois filhos de uma senhora.O seqüenciamento do genoma humano possibilitará a identificação dos genes envolvidos em doenças e a criação de novas abordagens preventivas ou de tratamentos mais rápidos e eficazes. Questão 1369 Os avanços na área da biotecnologia permitiram melhores condições de assistência à saúde humana e animal.O genoma humano pode ser seqüenciado a partir de qualquer célula do corpo. analise os itens abaixo. todas as quebras provocadas pela radiação solar. Considerando as proposições anteriores. vacinas. e) a sonda de DNA. ( ) O mapeamento gênico de um indivíduo permite informar se ele é portador ou não de genes causadores de doenças. especialmente no que se refere à produção de antibióticos. c) apenas I. III . amostras de DNA nuclear e mitocondrial de todos os mortos. ( ) O teste de paternidade com base no DNA deve ser realizado exclusivamente em indivíduos sem doenças sangüíneas. é de grande auxílio para o Projeto Genoma Humano. nos cromossomos humanos. ( ) O gene para produção de insulina no homem pode ser clonado em bactérias que passam a produzir este hormônio. foi possível preparar. como o das bactérias ('Xylela fastidiosa').Leia as proposições a seguir sobre o Projeto Genoma Humano. que tem por objetivo seqüenciar os cerca de 3 bilhões de bases nitrogenadas que compõem os cromossomos de um ser humano. dos camundongos e ratos. Sobre este tema. Ao lado dos inúmeros benefícios desse projeto.O seqüenciamento do genoma de outras espécies. I . b) apenas II e III. b) a clonagem de células. a partir de fragmentos de tecidos. III e IV. possibilitando a melhor compreensão dos diferentes fenótipos.O seqüenciamento do genoma humano determinou a posição exata e a função de cada gene. hormônios e outros insumos terapêuticos. com exceção das hemácias. março/93) Em relação a esse projeto. 309 . d) apenas I. o procedimento que pode afetar diretamente o equilíbrio genético de populações humanas é a) a detecção de indivíduos superdotados intelectualmente por meio de procedimentos laboratoriais. IV . II e IV. Questão 1370 "A nova tecnologia do DNA recombinante está permitindo que cientistas dos países do primeiro mundo desenvolvam um projeto denominado GENOMA. II . ( ) O Projeto Genoma visa a localizar.

A Associação Civil "Avós da Praça de Maio" tem buscado localizar essas crianças com a finalidade de restituí-las a suas famílias legítimas. através das mitocôndrias existentes no citoplasma do ovócito da mãe. o seqüenciamento completo do genoma humano foi anunciado pela comunidade científica internacional.com. c) de o DNA mitocondrial. c) A criança é filha de João. através de uma mistura dos genes do pai e da mãe.3 Assinale a alternativa que interpreta corretamente os resultados do teste. através das mitocôndrias existentes no citoplasma do espermatozóide do pai. b) A criança é filha de Pedro. A escolha desse teste está relacionada com o fato a) de o DNA mitocondrial. Essas crianças foram adotadas. e) de o DNA mitocondrial. que são possíveis. por exemplo. envolveu a bactéria causadora da "praga do amarelinho". permitir traçar árvores familiares confiáveis. (Fonte: abuelasatournet. 310 . garantir um registro familiar que se mantém de geração a geração. pois todos os resultados foram menores que 85%. a) A criança não é filha de nenhum dos supostos pais. pois. e o resultado foi o seguinte. e) Pedro e Paulo são. d) de o DNA mitocondrial.15. EXCETO a) Aumento da produtividade na agricultura b) Compreensão mais ampla das doenças genéticas c) Determinação da posição de proteínas nos cromossomos d) Diagnóstico precoce de doenças hereditárias Questão 1372 Na Argentina. pois. a família de Maria resolveu fazer um teste de paternidade. por ser herdado da avó paterna. e) o uso de testes pró-sintomáticos para a realização de seguros de vida. seu ex-namorado. vendidas ou abandonadas em orfanatos. pois deveríamos ter hibridizado o DNA do pai com o da mãe. 1. permitir traçar árvores familiares confiáveis. Paralelamente. Para solucionar esse impasse. aproximadamente. b) de o DNA mitocondrial. por ser herdado do avô materno. através das mitocôndrias existentes no citoplasma do ovócito da mãe. por ser herdado da avó materna.b) o aumento de seleção genética ou gamética artificial. permitir identificar a filiação com segurança. 50% dos genes são herdados da mãe e 50%. alegando que o filho pode ser de Paulo (irmão de Pedro). para se hibridizarem.ar) A comparação entre os DNAs mitocondriais de possíveis netos e avós tem sido um dos testes utilizados nesses processos de identificação de parentesco. que atinge plantas cítricas. por ser herdado das duas avós. ou de João (primo de Pedro). irmãos adotivos. na verdade. nega a paternidade da criança. permitir traçar árvores familiares confiáveis. muitas crianças foram seqüestradas com seus pais ou nasceram em centros clandestinos de detenção. mesmo na ausência dos pais. empregando para isso testes de identificação genética. c) o emprego de testes genéticos como um novo critério para admissão a empregos. Todas as alternativas apresentam benefícios de projetos que envolvem o seqüenciamento de genomas. durante a ditadura militar iniciada em 1976. d) O teste não foi conclusivo. atualmente.5. por ser herdado do avô paterno. do pai. Questão 1371 Alguns projetos de seqüenciamento genômico vêm sendo desenvolvidos por pesquisadores brasileiros. os DNAs devem ser diferentes. d) o registro de patentes de seqüências do genoma humano para especulação mercadológica. Questão 1373 Maria teve um filho e Pedro. ou ainda de um vizinho. Antônio. Um deles. através das mitocôndrias existentes no citoplasma do ovócito da mãe.

O oxigênio foi dado pelo anúncio de que cientistas americanos tinham chegado ao fim do rastreamento de um dos sonhos da medicina nesta virada de século: o mapeamento do genoma humano. que contém cromossomos das duas espécies. a Guanina e a Uracila . 311 .. Quais estão corretas? a) Apenas I.).. . a Nasdaq. II e III.A expressão dos genes humanos depende da presença. Duas células de origem diferente podem se fundir em uma única célula híbrida. recentemente seqüenciado no Brasil. B.. d) o gene correspondente à proteína D está no cromossomo 4.O genoma humano contém uma grande percentagem de seqüências de DNA que não codificam genes. (02) a molécula sequenciada é o DNA. Questão 1376 1. (16) um dos resultados possíveis dessa descoberta será a cura. no futuro. C e D quando o seqüenciamento é realizado a partir de RNA mensageiro. através da terapia gênica. Questão 1375 O que se imaginava impossível acabou acontecendo antes do prazo previsto: após a elucidação da seqüência de DNA de vários organismos. de algumas doenças genéticas. publicado na "Revista Época".são possíveis de serem encontradas nesse mapeamento. I .15. e) I.. p. Por isso.Questão 1374 Na década de 1960. considere as seguintes afirmações. ou ausência. (.. b) Apenas II. o pregão eletrônico das empresas de alta tecnologia. "A revanche veio na quinta-feira [06/4] passada. foi anunciado o seqüenciamento do genoma humano. 10/04/2000. II e III foram registradas para a presença ou ausência dos cromossomos humanos 1 até 8. (08) esse mapeamento já permitiu aos cientistas saberem a localização de todos os genes humanos. Depois do susto provocado no começo da semana pelos percalços jurídicos da Microsoft. d) Apenas II e III. A tabela abaixo contém uma grade hipotética de dados usados para mapear genes em seus cromossomos humanos apropriados. c) o gene correspondente à proteína C está no cromossomo 6. Três linhagens somáticas híbridas designadas I. (04) apenas quatro bases nitrogenadas . II .5. b) o gene correspondente à proteína B está no cromossomo 3. é CORRETO afirmar que: (01) o referido genoma está contido nos cromossomos. que se constitui em um grande passo no mapeamento de genes humanos. 123.3 m relação à tabela é correto afirmar que a) o gene correspondente à proteína A está no cromossomo 1. e) a linhagem III contém o cromossomo 8. causadora da praga do amarelinho nos laranjais. Com relação à organização genômica..a Adenina. de cada gene no DNA de células diferenciadas. identifica-se mais facilmente um gene.. c) Apenas I e II. a Citosina. no ano 2000. III ." Trecho extraído do artigo: GENOMA: O PRIMEIRO ESBOÇO DO MAPA DA VIDA. Com relação a esse assunto. voltou a respirar.O genoma humano tem organização diferente da organização do genoma da bactéria 'Xyllela fastidiosa'. Georges Barsky desenvolveu a técnica de hibridização somática. bem como pela sua habilidade em produzir as proteínas humanas hipotéticas A.

coletam-se amostras biológicas do suposto pai. ou seja. O conhecimento dessa seqüência permitirá determinar a) o número de cromossomos presentes nas células humanas. Jan. (adaptado) Uma modificação que poderia ser feita nesse texto. é um dos fatores que dificulta sua utilização em larga escala pelos segmentos populacionais menos favorecidos economicamente.. d) o número de doenças que podem afligir a humanidade. Questão 1380 O exame de paternidade tem sido muito utilizado na medicina forense. mas outros tecidos. b) código genético por seqüência de aminoácidos. O título referiu-se a uma reportagem da qual foi extraído o trecho a seguir: Depois da pílula anticoncepcional. "Trabalhando sem parar desde o final de 1997. em 30/07/2001. oferecem. do genoma do parasita". (16) o custo do exame de DNA. é a substituição de a) seqüência de substâncias por seqüência de nucleotídeos. ainda muito elevado no Brasil. 312 .. Para muitos especialistas [.Questão 1377 A revista "Época". não sendo necessário obter informações do(a) filho(a) e de sua mãe. (04) para uma investigação de paternidade. Sobre a utilização dos testes de DNA. A idéia é descobrir. uma vez que podem ser entendidos como uma violação da privacidade biológica dos indivíduos. não restando qualquer questionamento ou dúvida sobre os diagnósticos apresentados. do pai e dos filhos. "Superinteressante". resultados com exatidão total. e) seqüência de substâncias por seqüência de aminoácidos. também podem ser utilizados. O resultado do teste. o teste de DNA surge como uma das grandes descobertas do mundo ocidental. c) código genético por conjunto total de proteínas. representado a seguir. aproximadamente. Soma ( ) Questão 1378 Em junho de 2000. (32) a criação de bancos de dados. 1999. no ano de 1999. para torná-lo mais preciso. Outros acreditam que reflexos da descoberta vão alterar o universo das relações familiares. (02) o melhor material biológico para um teste de DNA é aquele extraído de núcleos de glóbulos brancos do sangue. contém padrões dessas marcas de uma determinada família. como pele e ossos. métodos que permitem a gravidez sem sexo. a partir de testes de DNA. e) o número total de genes humanos e quais as proteínas codificadas por esses genes. com a identificação genética de criminosos e suspeitos. Esse teste baseia-se na identificação de marcas genéticas específicas que podem ser encontradas no DNA da mãe. vem gerando grande polêmica. a partir de testes de DNA. que transferiu para as mulheres o controle da fertilidade. atualmente. foi anunciada a conclusão da fase do Projeto Genoma Humano em que se determinou a seqüência de. (08) os exames de investigação de paternidade. em países como a Inglaterra. 3 bilhões de nucleotídeos do genoma humano. é CORRETO afirmar que: (01) os testes de DNA podem ser empregados para finalidades de investigação de paternidade e também para identificação de supostos criminosos. a seqüência de substâncias que constituem os cerca de 2000 genes da cadeia de DNA..] a técnica só traz benefícios. c) quantas moléculas de DNA estão presentes nos cromossomos humanos. anunciou em sua capa: "O DNA não falha". e as implicações dessa prática para os indivíduos e a sociedade em geral. d) cadeia de DNA por cadeia de RNA. b) o número de proteínas que compõem os genes humanos. 13(1):63. eles (os pesquisadores) já decifraram 75% do código genético dessa bactéria. até abril. da fertilização "in vitro" e da barriga de aluguel. como em casos de estupros e assassinatos. Questão 1379 O texto a seguir apresenta os resultados do projeto de estudo do genoma da 'Xylella fastidiosa'.

e os genes que codificam proteínas são 4. (2) Para 38% dos genes. (3) Pode-se fazer estudos da evolução das bactérias. quando extraído do sangue. que só foi descoberto depois da conclusão do projeto Genoma Humano em 2003. Em setembro de 1997. b) das hemácias. Questão 1381 Está em andamento o projeto GENOMA. Questão 1385 Uma loja de animais mantinha para venda 4 exemplares de 'Ara ararauna' (arara azul-e-amarela) e alegava aos fiscais que os exemplares haviam nascido em cativeiro. Questão 1383 Nos exames para teste de paternidade. dos leucócitos e do plasma. c) é o que nos permitiria conhecer qual a real proporção de proteínas em relação às moléculas de DNA que possuímos. comparando-se a seqüência de DNA de diferentes espécies. a discriminação de pessoas. (4) Todos os genes terão a mesma proporção de adenina e guanina. 38% desses genes ainda não têm uma função conhecida. d) IV pode ser filho adotivo do casal. e) III é irmão biológico de I. pelo eventual uso inadequado que se possa fazer do conhecimento obtido. nos últimos 2 anos chegaram ao fim vários seqüenciamentos do genoma de bactérias. c) V não pode ser filho biológico deste casal. e) dos leucócitos e das globulinas. não se sabe a seqüência de amionoácidos da proteína. mas não das hemácias.5. b) é a condição necessária para se saber o número de moléculas de RNA existentes em nosso organismo. foi publicada a seqüência do DNA da bactéria 'Escherichia coli. pelo qual se pretende seqüenciar totalmente o DNA humano. Para surpresa de muitos. obter a seqüência de bases nitrogenadas do DNA de todos os cromossomos de uma pessoa.15.576 RNAs mensageiros diferentes. 1. assinale a alternativa INCORRETA: a) I é filho biológico do casal.2 milhões de moléculas de fosfato. b) II não é filho deste pai. c) das hemácias. é obtido a) das hemácias e dos leucócitos. (4) A 'Escherichia coli' pode produzir 8. julgue os itens que se seguem. d) dos leucócitos.3 Com o auxílio do texto. principais células de defesa do sangue.288. será possível conhecer a seqüência de aminoácidos da proteína correspondente. A esse respeito. como. (0) Uma vez obtida a seqüência de um gene.6 milhões de pares de bases. mas não do plasma. (3) O projeto GENOMA tem levantado questões éticas. por exemplo. (1) O DNA da bactéria 'Escherichia coli' tem cerca de 9. Questão 1384 O mapeamento de toda a seqüência de nucleotídeos existente nos 23 pares de cromossomos humanos a) é o que ainda falta fazer após a conclusão do projeto Genoma Humano em 2003. o principal componente do sangue.' Os números . (2) A seqüência de todos os cromossomos será do mesmo tamanho. a partir de 313 om base neste resultado. (1) As seqüências obtidas corresponderão exatamente ao DNA de qualquer pessoa. sendo apenas um passo no conhecimento de nosso genoma. julgue os itens a seguir. e) significa decifrar o código genético. Questão 1382 Enquanto o projeto que visa seqüenciar completamente o genoma humano segue seu curso. ou seja. o DNA. d) é o que foi conseguido pelos pesquisadores há alguns anos.impressionam: são cerca de 4.

d) apenas os exemplares 1 e 4. Fragmentos menores migram mais rapidamente em direção a um dos pólos da corrente. Sobre essas enzimas é INCORRETO afirmar que: a) reconhecem seqüências específicas de bases nitrogenadas. b) apenas os exemplares machos. Para esclarecer a questão. c) cada uma pode originar fragmentos de DNA com tamanhos diferentes. fragmentado com enzimas específicas. d) cortar DNA onde ocorrem seqüências específicas de bases. pode-se isolar um único gene de um cromossomo. pode possibilitar. b) inibir a síntese de RNA a partir de DNA. no futuro.5. por exemplo. Com relação a essas substâncias é correto afirmar que a) são altamente específicas.4 Os resultados obtidos indicam que podem ser filhos do casal. A migração diferencial dos fragmentos forma bandas (faixas) de DNA no gel. Questão 1386 As enzimas de restrição são as principais ferramentas bioquímicas empregadas em Engenharia Genética. Questão 1388 Por sua capacidade de cortar o DNA em pontos específicos.15. cortando o DNA em locais determinados. os fiscais do IBAMA suspeitaram se esses exemplares teriam nascido em cativeiro ou se teriam sido capturados na natureza. d) são utilizadas nos atuais testes de DNA. e) apenas os exemplares 2 e 3. deixando somente as bases nitrogenadas. b) não existem em seres vivos. que podem ser visualizadas por tratamentos específicos (coloração. d) permitem somente a ligação de pedaços de DNA de um mesmo tipo celular. que serão manipuladas. mantido pelo criador. a) os 4 exemplares. A ilustração apresenta o resultado do teste bacteriano. como a diabetes. Questão 1387 Enzimas de restrição são fundamentais à Engenharia Genética porque permitem a) a passagem de DNA através da membrana celular. A identificação de genes responsáveis por diversas doenças. b) inserindo cópias extras do alelo mutado.um casal mantido em um criatório autorizado pelo IBAMA. O DNA foi extraído das células por processos químicos. b) removem os fosfatos e as pentoses. e) modificar seqüências de bases do DNA. c) inibir a síntese de DNA a partir de RNA. Essa técnica tem por objetivo "corrigir o efeito da mutação" a) induzindo mutações nos genes responsáveis pela doença. 314 1. por exemplo). Contudo. raios X. sendo exclusivamente produtos da indústria química. O padrão de bandas é exclusivo de cada indivíduo. ou "impressão digital de DNA". o uso da terapia gênica. colheu-se uma amostra de sangue de cada um dos animais e fez-se um teste para determinação de paternidade pelo método do DNA-Fingerprint. Enquanto a cura de diabetes está sendo pesquisada através da engenharia genética. colocado sobre um gel suporte e submetido à corrente elétrica. originando fragmentos dessa molécula. e) fazendo-se uso delas. Questão 1389 Duas doenças não infecciosas que preocupam o homem moderno são a diabetes e o mal de Alzheimer. c) atuam como agentes de ligação entre DNA viral e . c) apenas os exemplares fêmeas. testes de laboratório utilizando a melatonina indicaram bons resultados para controlar o mal de Alzheimer. e) impedem a clonagem de moléculas de DNA recombinante. são utilizadas enzimas de restrição na engenharia genética.

e) Fragmentos de genes exógenos são inseridos no genoma das células hospedeiras por meio de plastídeos nucleares. 1. Questão 1390 A biotecnologia tornou possível a transferência de material genético entre os mais diversos organismos. Os conhecimentos da área são aplicados com sucesso na produção industrial da insulina e do hormônio de crescimento. que têm a propriedade de cortar o DNA em pontos específicos. Questão 1392 Todas as alternativas apresentam aplicações da tecnologia do DNA recombinante nas duas últimas décadas. em bactérias.15. c) O DNA gênico endógeno é inserido no núcleo de células hospedeiras por meio de plastídeos funcionais. Questão 1391 As principais ferramentas empregadas na tecnologia do DNA recombinante são as enzimas de restrição. b) O genoma exógeno é inserido no núcleo hospedeiro por meio de vetores protéicos conhecidos como plasmídeos. estão sendo implantadas "biofábricas" de controle de pragas no Nordeste do Brasil. e) auxiliar no processo de tradução do DNA. b) Recuperação de espécies extintas. d) O DNA endógeno é transferido para genomas hospedeiros por meio de plasmídeos mitocondriais. que representa um determinado experimento. c) auxiliar no processo de duplicação do DNA. EXCETO a) Independência de pâncreas de animais para produção de insulina b) Obtenção de uma nova espécie de bactéria produtora de insulina humana c) Possibilidade de expressão em bactérias de outros genes de interesse médico d) Possibilidade de tratamento para pacientes com intolerância à insulina animal Questão 1394 Para minimizar o uso de inseticidas sintéticos na fruticultura e atender às normas de segurança alimentar da FAO ("Food and Agriculture Organization"). d) produzindo proteínas funcionais em organismos de outra espécie. Todas as alternativas apresentam resultados esperados do êxito dessa técnica. d) Terapia gênica de algumas doenças hereditárias. b) reparar o DNA bacteriano que sofreu mutação deletéria. Questão 1393 A tecnologia do DNA recombinante permitiu a inserção e a expressão. provavelmente: a) proteger as bactérias contra os vírus bacteriófagos. Sobre a produção de organismos geneticamente modificados.c) substituindo o alelo mutado ou adicionando uma cópia correta do alelo.5.5 315 . O papel biológico dessas enzimas bacterianas na natureza é. e) inibindo a expressão do gene mutado nas células secretoras da proteína. c) Produção. é correto afirmar: a) Fragmentos de DNA exógeno são inseridos no genoma de células hospedeiras por meio de plasmídeos. que são administrados a pacientes de todo o planeta. de proteínas humanas de interesse médico. d) auxiliar no processo de transcrição do mRNA. em bactérias. do gene humano responsável pela síntese da insulina. EXCETO a) Produção de parasitas das pragas b) Extração de inseticidas naturais c) Criação de comensais das pragas d) Produção de machos estéreis das pragas Questão 1395 Analise a figura a seguir. EXCETO a) Investigação de paternidade e criminalística. Essas "biofábricas" podem adotar todas as seguintes tecnologias.

Preocupado com os conteúdos da disciplina de Biologia. 316 . plasmídio e enzima ligase. soube pelos colegas que o assunto trabalhado fora Biotecnologia. Questão 1396 A manipulação genética de microorganismos.) Produção de DNA recombinante (plasmídio de uma bactéria/ gene do vaga-lume) 2) Introdução do DNA em célula de tabaco 3) Multiplicação da célula de tabaco com o gene do vaga-lume 4) Desenvolvimento de uma planta de tabaco com o gene do vaga-lume (planta que fluoresce) O experimento ilustrado é: a) produção de transgênicos. plasmídio e enzima de restrição. Isto pode ser feito graças ao instrumental bioquímico da engenharia genética disponível nos dias de hoje. para o corte e a separação do segmento de DNA a ser estudado. e a inclusão em (2) do segmento obtido (gene isolado) com o auxílio de enzimas do tipo (3). a extração e o rompimento de (2). d) A utilização de enzimas de restrição permite cortar o DNA nos locais onde reconhecem o ácido fosfórico. e) amniocentese. como a transcriptase reversa.5. b) enzima transcriptase reversa. ( ) são obtidos segmentos de DNA.5 a) enzima de restrição. cromossomo circular e enzima de restrição. Os números 1. entre as quais: a utilização de enzima do tipo (1). a) As enzimas de restrição cortam o DNA apenas nos locais onde existem certas seqüências de bases nitrogenadas. Assinale a alternativa que apresenta. é verdadeiro afirmar que: ( ) são utilizadas pequenas porções circulares de DNA. e) As enzimas de restrição quebram o DNA. RNA plasmidial e enzima transcriptase reversa. c) A utilização das enzimas de restrição permite separar moléculas de DNA de acordo com seu tamanho e carga elétrica. diferentes etapas são cumpridas em laboratório. Cada colega lembrou um aspecto das aulas. Questão 1398 O Projeto genoma humano tem como objetivo determinar a seqüência de bases de todos os genes de nossa espécie. principalmente a manipulação de bactérias. e) enzima de restrição. dispersas no citoplasma bacteriano e que têm replicação independente do cromossomo. Questão 1397 Para um pesquisador transferir um gene de interesse. corretamente. 2 e 3 indicam. c) DNA recombinante. d) eletroforese. ( ) promove-se o corte de moléculas de DNA com o uso de enzimas que reconhecem seqüências nucleotídicas específicas no DNA. como as enzimas bacterianas. b) As enzimas de restrição cortam o DNA nos locais onde reconhecem o açúcar desoxirribose. conhecidas como enzimas de restrição. ( ) a tecnologia do DNA recombinante (ou Engenharia Genética) fundamenta-se na fusão de "trechos" de DNA de diferentes organismos para a construção de DNA híbrido. b) hibridação intraespecífica. respectivamente: 1.15. ( ) se duas diferentes moléculas de DNA forem cortadas por uma mesma enzima de restrição serão produzidos iguais conjuntos de fragmentos. c) aconselhamento genético. separando-o sempre em nucleotídeos individuais. através de cortes com exonucleases. d) enzima transcriptase reversa. a forma de atuação dessas enzimas. com genes de interesse. já possibilitou a obtenção de resultados benéficos para a medicina e para outras áreas do conhecimento. Questão 1399 Pedro estava doente e perdeu uma semana de aulas. Com relação a esse tema. RNA plasmidial e enzima exonuclease.

para fins terapêuticos.. julgue os itens abaixo.Segundo LAURA.5.5 om relação ao processo de clonagem gênica esquematizado acima. Entre os importantes avanços conquistados pela tecnologia do DNA recombinante.JOANA relatou que vacinas genéticas são usadas para inocular nas pessoas microorganismos vivos transgênicos ou atenuados... Indivíduos submetidos a hemodiálises são injetados com essa proteína e apresentam sua .. um dos mais significativos produtos do avanço científico nacional na área da engenharia genética.....diabetes c) plasmina . b) DNA recombinante. em 1988.. Informe PADCT/Ministério da Ciência e Tecnologia. Os rins produzem esse hormônio. b) apenas as afirmações de Mariana. c) apenas as afirmações de Eduardo e Joana.leucocitose e) hormônio de crescimento . reduzida. Mariana e Laura. os números 1. Laura e Rafael. plasmídio e transgene.. vetor. .. DNA recombinante e organismo transgênico. Questão 1402 CHEGA AO MERCADO UM NOVO FÁRMACO INTEIRAMENTE DESENVOLVIDO NO PAÍS A insulina humana recombinante (IH-r).. está a produção de .15. as enzimas de restrição são aquelas que podem cortar o DNA em pontos determinados. o interferon e a calcitonina. como o hormônio de crescimento. (1) As técnicas de engenharia genética permitem a 317 . Questão 1400 Assinale a alternativa que preenche corretamente as lacunas do parágrafo a seguir... p.De acordo com MARIANA. vetor e plasmídio. Ao voltar à escola. 3 e 4 representam. plasmídio. a) eritropoietina ..coagulação d) fator VIII . Uma parceria entre a BIOBRÁS e a Universidade de Brasília (UnB). que utiliza DNA codificante... 2. estimula a divisão de células-tronco..7(com adaptações). ou impressão digital genética. vetor. uma das quatro empresas em todo o mundo e a única no hemisfério sul a deter a tecnologia de produção desta insulina. em um plasmídio de bactéria. Com o auxílio do texto. c) DNA. . plasmídeos são utilizados como vetores para a clonagem de genes. a) DNA recombinante.. .. que.anemia b) insulina .esterilidade Questão 1401 A figura a seguir representa de forma esquemática o processo de clonagem de genes do "Mycobacterium tuberculosis". clone e vetor. d) DNA transgênico. Esta conquista tecnológica permitirá o desenvolvimento de outros medicamentos.EDUARDO lembrou que a identidade genética individual pode ser estabelecida pela técnica DNA 'fingerprint'. respectivamente... inicia em 1999 a comercialização do produto. jan/99. Pedro conversou com a professora e constatou que estavam corretas a) apenas as afirmações de Eduardo. na ordem em que aparecem... atuando sobre a medula óssea vermelha. está prestes a chegar ao mercado com o nome de Biohulin: a empresa BIOBRÁS. d) apenas as afirmações de Rafael e Joana... 1. Ao grupo da UnB coube a parte de Biologia Molecular.RAFAEL definiu proteoma como o conjunto de proteínas expressas pelo genoma. .. desenvolvendo clones de bactérias produtoras de insulina.. . e) as afirmações de todos os colegas. deu início aos trabalhos.. DNA recombinante.

Questão 1406 Observe o esquema. cromossomicamente e geneticamente. tecidos diferentes daquele que se deseja. d) fundirem-se com o tecido hospedeiro.com. Por reprodução ela gera células. c) a quantidade de genes mitocondriais. portanto. e) a estrutura de genes específicos por mutações. c) No Brasil não há permissão para o desenvolvimento de pesquisas com célula-tronco. o "autotransplante". a "célula-tronco" tem a capacidade especial de se diferenciar e constituir diferentes tecidos no organismo. ela deve receber altas doses dessa proteína. pode ser obtido o hormônio de crescimento. provoca mutações e malformações. 1. segundo a Comissão Técnica Nacional de Biotecnologia (CTNBio). (2) Para que uma bactéria passe a produzir insulina humana. (3) O Biohulin será um medicamento destinado ao tratamento de diabéticos. c) alterarem a constituição genética do tecido hospedeiro. prática que. a) As células-filhas geradas por ela são cromossomicamente e geneticamente diferentes da célula-mãe originando. (adaptado de http://www. idênticas a si mesma.15. Questão 1404 Células-tronco são células indiferenciadas que têm a capacidade de se diferenciar em diversos tipos celulares. qualquer que seja a sua origem. b) As células-filhas geradas são cromossomicamente e geneticamente iguais à célula-mãe inclusive no caso de haver gene "defeituoso". e) sofrerem diferenciação que as torna parte integrante e funcional do tecido hospedeiro. Questão 1405 Segundo a doutora Mayana Zats (USP) um estudo recente com células-tronco retiradas da medula e injetadas no coração da própria pessoa. (4) A partir da insulina produzida por bactérias.br/educando/noticias/2004/mai/10/ 69. Questão 1403 A expectativa em torno da utilização das células-tronco decorre do fato de estas células a) incorporarem o genoma do tecido hospedeiro.htm) Enquanto as demais células do organismo só podem fazer parte de um tecido específico.5. Por essa razão seu uso para a cura de doenças é bastante promissor. eliminando as possibilidades de rejeição imunológica. que mostra a diferenciação de células-tronco humanas nos elementos figurados indicados. Assinale a alternativa que aponta uma limitação do uso de célula-tronco para "possível e futura" cura de doenças genéticas.estadao. b) a quantidade de genes nucleares. as células-tronco terão necessariamente que alterar a) o número de cromossomos. d) A célula-tronco só pode ser obtida por clonagem terapêutica. d) o padrão de atividade dos genes. e) O Brasil não tem cientistas especializados para a realização desse tipo de pesquisa.recombinação de genes entre organismos totalmente diferentes. sugere uma melhora aparente do quadro clínico em pacientes com insuficiência cardíaca. b) eliminarem os genes causadores da doença no tecido hospedeiro. a não ser nas doenças genéticas. Para que ocorra tal diferenciação.6 318 .

5. b) Pelo menos 3 tipos de células diferenciadas no esquema dado são encontradas no sangue. em cordões umbilicais e também em diversos tecidos no indivíduo adulto. portador de lesão no miocárdio. a) A célula-tronco é pluripotente com capacidade de se diferenciar em diversos tipos celulares. assinale a afirmativa INCORRETA. existem células-tronco capazes de dar origem a células diferenciadas de todos os tecidos humanos. III. III. 14/02/2006 Sobre esse assunto. e III e) II. IV. d) Apenas 2 das células diferenciadas apresentam núcleo. c) Plaquetas e hemáceas não apresentam capacidade de proliferação mitótica. I. e) não se reproduzem com facilidade.Assinale a afirmativa INCORRETA. c) Células-tronco podem ser encontradas em embriões. à medida que se diferenciam. vão reduzindo sua potencialidade. Questão 1408 A pesquisa com células tronco tem-se tornado de grande importância para recuperação de órgãos lesionados que não têm capacidade de regeneração de suas células. b) A capacidade de diferenciação das células precursoras se deve à alteração na expressão gênica específica. Questão 1409 Alguns tecidos do organismo humano adulto se regeneram constantemente por meio de um processo complexo e finamente regulado. IV Questão 1410 Experimentos recentes indicam que células-tronco retiradas da medula óssea de um indivíduo adulto.6 Um jovem biólogo de São Paulo descobriu porque as células-tronco do cordão umbilical são mais eficientes em transplantes do que as da medula óssea. Existe um aumento gradual da capacidade de auto-renovação das células durante este processo. II. A alternativa que contém todas as afirmativas corretas é: a) I e II b) I e IV c) III e IV d) I. de embriões em sua fase 319 . como mostra o esquema a seguir: 1. Questão 1407 BIÓLOGO MAPEIA GENES DO CORDÃO UMBILICAL. com os epitélios intestinais e especialmente com o sangue. Células tronco hematopoéticas apresentam potencial para diferenciar-se em qualquer célula do sangue e também gerar outras células tronco. Ele deseja descobrir maneiras de manipular os genes para obter melhores resultados terapêuticos ou estimular a formação artificial de tecidos. As células tronco têm grande poder de regeneração porque: a) têm todos os seus genes funcionando.15. Ele encontrou um grupo de genes que seguem um mesmo mecanismo e são mais ativos em células do cordão. II. Baseado nas informações anteriores e nos conhecimentos sobre o tema. A hematopoese resulta da diferenciação e da proliferação simultânea de células tronco que. também. que tem suas células destruídas e renovadas constantemente. a) Células-tronco são células capazes de se diferenciar dando origem a diversos tipos de células. considere as afirmativas a seguir. As células-tronco podem ser retiradas. d) Na medula óssea de um adulto. Fonte: "O Estado de São Paulo". As diferentes linhagens hematopoéticas geradas no sistema apresentam altas taxas de proliferação. d) são pouco especializadas. puderam formar tecido normal quando implantadas na região lesada do coração. c) têm algo grau de especialização. Isso acontece com a pele. b) todos os seus genes estão desligados.

como habitualmente. posteriormente estimulado para que se dividisse e virasse um embrião dentro da mãe adotiva. Ao invés de adultos jovens. da raça Afgham. II e III. b) II. ("Folha de S. Quais estão corretas? a) Apenas I. Considerando hipóteses plausíveis. da raça Labrador. e nasceu 60 dias após. c) o clone gerado terá o genótipo Afgham e o fenótipo Labrador e será do sexo masculino.adulta . utilizando uma célula obtida da orelha do pai genético. II e III.6 Considerando o uso terapêutico das células-tronco. aquelas possíveis de serem aceitas pela comunidade científica. apenas. que autoriza a pesquisa com células-tronco obtidas a partir de embriões humanos remanescentes de tratamentos de infertilidade armazenados por pelo menos três anos. foi promulgada a Lei de Biossegurança.uma célula-tronco deve ter o poder de se renovar indefinidamente pela divisão celular. O animal clonado. apenas. III . isto é. 320 1. b) Apenas II. apenas. c) Apenas I e II. b) usando o mesmo pai genético.adulta b) adulta . casos incomuns de anemia começaram a chamar a atenção dos pesquisadores. d) Apenas II e III. A origem do problema estava na produção de glóbulos vermelhos pela medula espinhal. considere as seguintes afirmações. apenas.15.adulta .08.embrionária Questão 1411 Em março de 2005. Questão 1413 Cientistas sul-coreanos clonam pela primeira vez um cachorro.5. Paulo". eram os idosos que apresentavam uma expressiva redução na taxa de hemoglobina. estão corretas: a) I. A origem do problema estava relacionada à degeneração do baço. .embrionária .) A partir do texto e do que se conhece sobre clonagem. Analise as hipóteses apresentadas pelos cientistas para tentar explicar esses casos incomuns.inicial de desenvolvimento. A origem do problema estava na produção de glóbulos vermelhos a partir de células-tronco da medula óssea. I . A tabela a seguir informa as características de algumas variáveis analisadas em células-tronco embrionárias e adultas. II. II e III. é possível obter um outro clone que seja fêmea. podemos afirmar corretamente que: a) é possível obter células-tronco embrionárias usando-se células diferenciadas de um adulto. c) III. e) I.As células-tronco retêm o potencial de dar origem a células-filhas mais especializadas. Mais intrigante: a anemia dos idosos não cedia ao tratamento convencional.embrionária d) embrionária .A clonagem de células-tronco embrionárias pode ser utilizada com fins terapêuticos ou reprodutivos. Os cientistas tiraram material genético da célula e o colocaram em um óvulo esvaziado do seu núcleo. Sobre essas células. III.embrionária . recebeu o nome de Snuppy .2005. a alternativa que indica o tipo de célula que possui a característica mais vantajosa para as variáveis I. respectivamente. d) I e II. e) I. 03. que nesses idosos deixou de produzir glóbulos vermelhos. I. II . Questão 1412 Há vinte anos.adulta c) embrionária . é : a) embrionária .

e) o ambiente celular do Labrador alterou a expressão genotípica do núcleo transplantado.Seu veneno tem ação proteolítica e coagulante e o antiofídico específico é o soro antibotrópico.d) o núcleo do óvulo inserido em uma célula de orelha anucleada origina uma fêmea Labrador. freqüentemente. Recentemente. as lesões coronarianas reduziram-se a um nível mínimo.O princípio ativo do seu veneno provoca intensa dor no local da inoculação.Pertence ao gênero Bothrops e seu veneno tem potente ação neurotóxica e coagulante. Com relação à surucucu. c) Tomar vacina tríplice periodicamente. pois o tradicional prato de "feijão. A ingestão de proteínas é importante. bife e salada" está sendo substituído por comidas industrializadas e com alto teor calórico. II. Essa bactéria ataca o intestino humano fazendo com que o organismo elimine grande quantidade de água e sais minerais. especialmente no caso de se utilizar torniquetes. Estima-se que o consumo de feijão e de arroz caiu em torno de 30% nos últimos anos. gorduras. Dentre estes um dos mais temíveis e agressivos do gênero é a cobra surucucu. d) doença de Chagas. Questão 1416 Um sério risco a que está exposto o trabalhador rural em nosso país é o de acidentes com animais peçonhentos. assinale aquela que NÃO é medida de prevenção desta doença. respectivamente. pois elas serão degradadas em aminoácidos. 2 e 4 c) 3 e 4 d) 1 e 4 e) 2. Os órgãos envolvidos com a saúde pública têm mostrado preocupação constante com a dieta do povo brasileiro. 3 . b) malária. que posteriormente recebeu o nome de 'Vibrio cholerae'. causando desidratação. que o Brasil está se tornando um país de obesos. considere as proposições: 1 . e com água limpa. vitaminas e sais minerais. Questão 1414 A cólera é uma doença infecciosa causada por uma bactéria descoberta em 1884. e) febre amarela. e) Evitar comer alimentos crus. 2 . Com base no texto e nos conhecimentos sobre o tema. podendo haver gangrena. considere as afirmativas a seguir. Com o tratamento. a) Beber somente água filtrada ou fervida.Pertence ao gênero Crotalus e seu veneno tem ação neurotóxica e homolítica. 4 . como proteínas. O prato tradicionalmente consumido pelo brasileiro apresenta elementos essenciais ao metabolismo. A doença parasitária a que esse texto se refere é a a) amebíase. As proposições que estão corretas são as indicadas por: a) 2 e 3 b) 1. pesquisadores brasileiros da FIOCRUZ foram pioneiros em utilizar células-tronco da medula óssea de um paciente que apresentava insuficiência cardíaca devido a uma doença parasitária. 3 e 4 Questão 1417 Uma planta feminina de angiosperma com genótipo PP foi cruzada com uma masculina pp. Dentre as alternativas a seguir. muito bem. As sementes resultantes devem apresentar embrião e endosperma. carboidratos. usados como fonte na síntese 321 . a) PP e pp b) Pp e Pp c) Pp e PPP d) Pp e PPp e) PP e Ppp Questão 1418 Os meios de comunicação têm noticiado. arroz. legumes e verduras antes de comê-los. c) doença do sono. principalmente verduras e peixes. b) Lavar as mãos com sabão antes das refeições e ao deixar o sanitário. frutas. I. Questão 1415 Células-tronco vêm sendo utilizadas com sucesso para amenizar os sintomas de pacientes com insuficiência cardíaca devida a infarto do miocárdio. d) Lavar.

razão pela qual questiona-se o consumo de alimentos transgênicos. d) Apenas III e correta. b) hereditária. ingerem os leucócitos em excesso. IV. um paciente teve que se submeter a uma cirurgia que removeu uma parte do seu corpo. já que foram diferenciadas em outra pessoa. de onde são retiradas células da massa celular interna (células tronco) que têm capacidade de regenerar órgãos lesados. analise as afirmativas a seguir. se houver comprometimento no sistema nervoso central. que ficou famoso por interpretar o "Super-Homem". cuja lesão pode levar à paralisia. que ficou tetraplégico em 1995 ao cair de um cavalo. boa parte da energia gasta para a sua síntese. e) podem dar origem a todos os diferentes tipos de células sangüíneas. na forma de energia química. c) infecciosa. apenas no sistema nervoso central. Tal procedimento fundamenta-se no fato de que essas células-tronco a) podem ser usadas para a clonagem de células sadias do paciente. Estão corretas apenas as afirmativas: a) I e III. Questão 1420 O tratamento da leucemia por meio dos transplantes de medula óssea tem por princípio a transferência de células-tronco da medula de um indivíduo sadio para o indivíduo afetado. III. II e III. Questão 1419 Após um traumatismo. c) secretam substâncias que inibem o crescimento celular. II . d) congênita. Reeve. Os ácidos nucléicos ingeridos são incorporados ao DNA do organismo. causada por um vírus e transmitida por mosquitos.A clonagem terapêutica por transferência nuclear permite a obtenção de blastocistos. se houver suspeita de lesão na coluna vertebral. cujo sintoma é o excesso de açúcar no sangue e a falta de insulina. o acidentado deve ser imobilizado na horizontal e utilizar um colar cervical para ser transportado até um hospital.das proteínas codificadas pelo organismo. e) contagiosa. Os carboidratos e lipídios da dieta são fonte importante de energia para os organismos. que causa problemas de coagulação sanguínea. e) o baço. b) o diafragma.A utilização do colar cervical não evita lesões no sistema nervoso periférico. que causa problemas de coagulação sanguínea. b) I e IV. era um ativista a favor das pesquisas com clonagem terapêutica para obtenção de células tronco. a) I e II são corretas. c) II e III são corretas. Marque a alternativa correta. por sua vez. d) I. Questão 1421 Em outubro de 2004 faleceu o ator cinematográfico Christopher Reeve. Recuperou-se e passou a viver normalmente. I . porque no interior da coluna vertebral está a medula óssea vermelha. e) II.Após um acidente como o ocorrido com Reeve. O sistema nervoso periférico poderá ficar inativo. d) podem dar origem a linfócitos T que. Questão 1422 A hemofilia se caracteriza por ser uma doença: a) adquirida. c) a hipófise. Com relação ao assunto abordado. pois essas moléculas preservam. após um acidente. A parte retirada era a) o fígado. c) II e IV. que causa má formação dos ossos. b) I e III são corretas. b) não serão afetadas pela doença. 322 . III e IV. d) o pâncreas. III .

especula-se sobre os mecanismos envolvidos na determinação do sexo dos humanos. após a meiose. duas dessas características assumem maior importância para a preservação da vida no planeta. Essa escolha é importante para estes casais uma vez que a constatação de um feto do sexo feminino pode provocar a decisão de um aborto não-natural. b) elevado grau de organização e execução das funções vitais. divisão celular e comportamento dos cromossomos na meiose.Questão 1423 O sangue pode realizar várias funções no nosso corpo. . como ocorre na China. d) Os glóbulos brancos que saem dos capilares podem realizar fagocitose. c) manutenção da homeostase e alto nível de individualidade. analise as afirmativas adiante: ( ) A opção por indivíduos do sexo masculino pode ser justificada por sua menor suscetibilidade a doenças genéticas e por apresentarem um par de genes localizados nos cromossomos X e Y. pois envolve um grupo de células especializadas. processo que engloba bactérias invasoras. Questão 1425 Desde a época de Aristóteles. comprovou-se que a determinação do sexo decorre de uma constituição cromossômica específica. A figura a seguir mostra. invadido por células sangüíneas e bactérias. é correto afirmar: a) O sexo genético é determinado na fecundação. Acreditava-se que o sexo do embrião era definido por fatores como a nutrição materna. pode apresentar um quadro inflamatório. d) consumo de energia e renovação contínua da matéria. b) Os cromossomos autossômicos são os responsáveis pela determinação do sexo genético do indivíduo.11 ssinale a afirmativa INCORRETA. São elas: a) composição química complexa e estado coloidal. estes são distribuídos entre os espermatozóides. onde os pais muitas vezes optam pelo nascimento de um único filho do sexo masculino. de forma esquemática. a de defesa contra microrganismos é realmente notável. d) O embrião XX desenvolverá testículos e o embrião XY desenvolverá ovários. e) O sexo genético é determinado pelo número de cromossomos X presentes no embrião. quando ocorre a fusão dos núcleos masculino e feminino. ( ) A tentativa de aborto por meio da ingestão de poções 323 1. identificando a presença do cromossomo sexual por meio da análise do citoplasma. que determinam uma maior longevidade para o indivíduo. ( ) O exame de urina da mãe é uma técnica usada na identificação do sexo do futuro bebê. Nesse sentido. Com base nos conhecimentos sobre o tema. um modo como essas células do sangue podem realizar seu papel de defesa. c) A probabilidade de o genitor masculino produzir gametas do tipo Y é maior que a do tipo X. porque detecta as células fetais existentes no líquido amniótico e na placenta. Questão 1424 Embora a continuidade da vida na Terra dependa substancialmente de todo o elenco de características que definem os sistemas viventes. a) Os neutrófilos são glóbulos brancos capazes de atravessar as paredes dos capilares sangüíneos. Questão 1426 Atualmente muitos casais têm-se interessado em escolher o sexo do futuro filho. ( ) Na espécie humana o sexo da prole é determinado pelo pai. c) O tecido conjuntivo. b) A destruição de bactérias que invadem o tecido conjuntivo depende de moléculas enzimáticas produzidas pelos glóbulos vermelhos. que apresenta os cromossomos sexuais X e Y no núcleo de suas células germinativas. Dentre elas.10. e) capacidade de reprodução e hereditariedade. A partir dos estudos sobre herança mendeliana.

324 . são as do gênero 'Saccharomyces'. Isto só é possível graças à tecnologia a) de clonagem de organismos. na fabricação tanto de pães quanto de vinhos. Em todos esses casos o 'trabalho' é feito por uma levedura (um tipo de fungo). como contra a hepatite B. p.vegetais ou de outras drogas abortivas pode não eliminar o feto. b) de células-tronco.62) Atualmente as leveduras têm sido usadas para produzir vacinas. v.33. Panek. mas promover a má-formação do corpo do bebê e comprometer a saúde da mãe. d) do teste do DNA. As leveduras mais usadas hoje. Esta vacina consiste do antígeno de superfície do vírus da hepatite B produzido em células de levedura. e) do RNA in vitro. em um processo usado há milênios pela humanidade para obter alimento e prazer. julho de 2003. (Adaptado de Anita D. c) do DNA recombinante. Um suco de uva transforma-se em vinho e um repelente mingau de cevada e centeio torna-se uísque ou cerveja. Questão 1427 A levedação do pão e a fermentação alcoólica são as primeiras tecnologias de que se têm notícia. Ciência Hoje. no 195.

Sign up to vote on this title
UsefulNot useful