Título: A maior lista de genética da história!

Professor: André Braga Turma: AeB
Questão 1 O texto que se segue foi extraído de "Xadrez, truco e outras guerras", de José Roberto Torero. Servimos-nos de algumas de suas estruturas para introduzir a(s) questão(ões) seguintes. "Os abutres, sábios animais que se alimentavam do mais farto dos pastos, já começavam a sobrevoar a ala dos estropiados quando o General mandou que acampassem. Naquela tarde assaram trinta bois, quantidade ínfima para abastecer os homens que ainda sobravam.... O plano dos comandantes era assaltar fazendas da região e tomar-lhes o gado... À noite a ração foi ainda mais escassa, e, para enganar a fome, fizeram-se fogueiras para assar as últimas batatas e umas poucas raízes colhidas pelo caminho. Como o frio também aumentava, surgiu um impasse: quem ficaria perto do fogo: os coléricos, que logo morreriam, ou os sãos, que precisavam recuperar as forças para a luta?" (TORERO, J. Roberto. "Xadrez, truco e outras guerras") "(...) os coléricos, que logo morreriam, ou os sãos, que precisavam recuperar as forças para a luta?" Muitas doenças podem provocar a morte. a) A afirmação "os coléricos, que logo morreriam" é falsa ou verdadeira? Justifique. b) Justifique e exemplifique: Muitas doenças são hereditárias e sua manifestação está na dependência da ação de genes específicos ou de alterações cromossômicas. Questão 2 O texto abaixo refere-se às questões: 2 a 3 O experimento clássico de Meselson e Stahl, em 1957, demonstrou que a replicação do DNA era semiconservativa, ou seja, cada fita do DNA serve de molde para sua própria duplicação, formando moléculas de DNA idênticas à original. Nesse experimento, os cientistas cultivaram células de 'Escherichia coli' inicialmente em presença de fonte de ¢¥N (isótopo de nitrogênio leve), trocando, a seguir, por ¢¦N (isótopo pesado), que é incorporado às bases nitrogenadas do DNA. Colheram, então, amostras de DNA após a primeira e a segunda gerações de células crescidas em ¢¦N e analisaram essas amostras quanto à densidade do DNA formado. Considere como PESADO o DNA dupla hélice marcado com ¢¦N; como LEVE o marcado com ¢¥N; como INTERMEDIÁRIO o marcado com ¢¥N e ¢¦N. Justifique por que, após a troca da fonte de nitrogênio, a primeira geração de células foi totalmente constituída com DNA dupla hélice do tipo INTERMEDIÁRIO. Questão 3 Calcule as proporções dos três tipos de DNA dupla hélice LEVE, INTERMEDIÁRIO E PESADO - formados em células da segunda geração, após a troca da fonte de nitrogênio. Questão 4 "O agronegócio responde por um terço do PIB, 42% das exportações e 37% dos empregos. Com clima privilegiado, solo fértil, disponibilidade de água, rica biodiversidade e mão-de-obra qualificada, o Brasil é capaz de colher até duas safras anuais de grãos. As palavras são do Ministério da Agricultura e correspondem aos fatos. Essa é, no entanto, apenas metade da história. Há uma série de questões pouco debatidas: Como se distribui a riqueza gerada no campo? Que impactos o agronegócio causa na sociedade, na forma de desemprego, concentração de renda e poder, êxodo rural, contaminação da água e do solo e destruição de biomas? Quanto tempo essa bonança vai durar, tendo em vista a exaustão dos recursos naturais? O descuido socioambiental vai servir de argumento para a criação de barreiras não-tarifárias, como a que vivemos com a China na questão da soja contaminada por agrotóxicos?" (Adaptado de Amália Safatle e Flávia Pardini, Grãos na Balança. "Carta Capital", 01/09/2004, p. 42.) A contaminação por agrotóxicos também é mencionada no texto. A aplicação intensiva de agrotóxicos a partir da década de 1940 aumentou a produtividade na agricultura. Atualmente, são produzidas e cultivadas plantas
1

transgênicas, isto é, geneticamente modificadas para serem resistentes à ação de insetos. Um exemplo conhecido é o milho geneticamente modificado com um gene da bactéria 'Bacillus thuringensis' (Bt), o que lhe confere resistência a ataques de insetos. Contudo, alguns pesquisadores têm observado que diferentes espécies de insetos adquirem resistência às toxinas bioinseticidas produzidas por essas plantas. a) Explique como os insetos se tornam resistentes. b) Sabe-se que a aplicação intensiva de agrotóxicos, como o DDT, pode afetar a cadeia alimentar tanto de ambientes aquáticos como de solos. Explique por que isso ocorre. Questão 5 Atualmente, um grande esforço tem sido feito por diversos centros de pesquisa e de tratamento de pessoas queimadas para produzir grandes áreas de pele, do próprio indivíduo, que possam recobrir imediatamente áreas destruídas. Explique a vantagem de se utilizar a pele do próprio indivíduo para recobrir as áreas destruídas, ao invés de serem utilizados enxertos de pele de outras pessoas. Questão 6 O desenho a seguir mostra a síntese de um polipeptídio a partir da molécula de DNA num certo organismo. Esse organismo é um procarioto ou um eucarioto? Por quê?

b) A clonagem de bactérias, comparada à clonagem de animais, é um processo mais complexo ou mais simples? Justifique. Questão 8 O gráfico a seguir demonstra a distribuição citoplasmática do número de ribossomas isolados e polirribossomas, em comparação com o número de cadeias polipeptídicas em formação durante um certo período de tempo.

1.1.3.2

(Adaptado de ALBERTS, Bruce & outros. "Molecular biology of the cell". New York, Garland Publishing, 1994, p.239) a) Defina a relação existente entre os ribossomas isolados e a formação das cadeias polipeptídicas. Justifique sua resposta. b) Descreva a estrutura das cadeias polipeptídicas e a dos polirribossomas. Questão 9

1.1.1.2 Um certo tipo de macromolécula destinada à membrana plasmática celular, depende de etapas nucleares e citoplasmáticas para sua produção, de acordo com os percursos esquematizados a seguir:

Questão 7 Nas bactérias, a cadeia respiratória encontra-se associada à membrana plasmática e os ácidos nucléicos estão associados ao citoplasma. a) É assim também em um protista, em um animal e em um vegetal? Justifique.
2

Questão 12 Ribossomos são formados por RNA e proteínas, sintetizados pelos processos de transcrição e tradução, respectivamente. a) Onde esses processos ocorrem na célula eucariótica? b) O que acontecerá com os processos de transcrição e tradução, se ocorrer uma inativação na Região Organizadora do Nucléolo? Justifique. Questão 13 a) Por que essas etapas começam no núcleo? b) Qual é a composição da macromolécula ao final do percurso I? E do percurso II? Esclareça a diferença, baseando-se nas funções das organelas citoplasmáticas envolvidas em cada percurso. Questão 10 Uma espécie de lombriga de cavalo possui apenas um par de cromossomos no zigoto (2n=2). Um macho dessa espécie, heterozigótico quanto a dois pares de alelos (Aa Bb) formou, ao final da gametogênese, quatro tipos de espermatozóides normais com diferentes genótipos quanto a esses genes. a) Qual é o número de cromossomos e o número de moléculas de DNA no núcleo de cada espermatozóide? b) Quais são os genótipos dos espermatozóides formados? c) Por que, a partir das informações fornecidas, não é possível estimar a proporção em que cada um dos quatro tipos de espermatozóides aparece? Explique. Questão 11 Uma mulher com a idade de 40 anos está grávida do primeiro filho. Ela sabe que, devido à sua idade, o bebê tem maior probabilidade de ser portador de alguma anomalia cromossômica. A cariotipagem pré-natal é o exame mais indicado para esclarecer estas dúvidas na fase uterina. Pergunta-se: a) Em que consiste este exame? b) Que exemplos de anomalias cromossômicas podem ser detectadas através deste exame (cite dois exemplos). Criadores e sitiantes sabem que a mula (exemplar fêmea) e o burro (exemplar macho) são híbridos estéreis que apresentam grande força e resistência. São o produto do acasalamento do jumento ('Equus asinus', 2n = 62 cromossomos) com a égua ('Equus caballus', 2n = 64 cromossomos). a) Quantos cromossomos têm o burro ou a mula? Justifique sua resposta. b) Considerando os eventos da meiose I para a produção de gametas, explique por que o burro e a mula são estéreis. Questão 14 Considere as duas fases da meiose, de um organismo com 2n=6 cromossomos, esquematizadas a seguir e responda:

1.1.3.2

1.1.5.2

a) Que fases estão representadas na figura A e na B? Justifique. b) Que tipo de alteração aparece em uma das figuras? Em relação aos cromossomos, como serão as células resultantes de um processo de divisão com essa alteração? c) Dê um exemplo de anomalia que seja causada por este tipo de alteração na espécie humana, cujo número normal de cromossomos é 2n = 46.

3

Questão 15 O gato siamês é um animal de rara beleza pois a pelagem de seu corpo é clara com extremidades - orelhas, focinho, pés e cauda - pretas. A presença do pigmento que dá a cor negra a essas extremidades é o resultado da atividade de uma enzima que fica inativada acima de 34°C. Explique por que esses animais têm a pelagem negra nas extremidades do corpo. Questão 16 Desde 1995 alguns estados norte-americanos estão excluindo o ensino da teoria de evolução biológica dos seus currículos escolares alegando, entre outras razões, que ninguém estava presente quando a vida surgiu na Terra. Alguns cientistas defendem a teoria da evolução argumentando que, se é necessário "ver para crer", então não poderemos acreditar na existência dos átomos, pois estes também não podem ser vistos. (Adaptado da "ISTO É", 25/08/1999.) a) Apresente três evidências que apóiam a teoria da evolução biológica. b) A mutação gênica é considerada um dos principais fatores evolutivos. Por quê? Questão 17 Dois 'loci' de uma população, cada um com dois gens alelos, sofrem a ação da seleção natural por muitas gerações, como é mostrado nas tabelas abaixo. O coeficiente de seleção (S) indica os valores com que a seleção natural atua contra o genótipo. O valor adaptativo (W) representa os valores com que a seleção natural favorece o genótipo. Note que (W+S)=1. Qual dos gens, A‚ ou B‚, apresentará a maior freqüência na população? Explique. Questão 18 No porquinho-da-índia existe um par de genes autossômicos que determina a cor da pelagem: o alelo dominante B determina a cor preta e o recessivo b, a cor branca. Descreva um experimento que possa evidenciar se um porquinho preto é homozigoto ou heterozigoto. Questão 19 Nos porquinhos-da-índia, a pelagem negra é dominante sobre a pelagem branca. Um criador tem um lote de porquinhos-da-índia negros, com o mesmo genótipo. O que deve fazer para descobrir se esses animais são homozigotos ou heterozigotos? Justifique sua resposta. Questão 20 Uma anomalia genética autossômica recessiva é condicionada por uma alteração na seqüência do DNA. Um homem portador dessa anomalia apresenta a seqüência timina-citosina-timina enquanto sua mulher, que é normal, apresenta a seqüência timina-adenina-timina. A análise do DNA de um filho do casal mostrou que ele é portador tanto da seqüência de bases do pai quanto da mãe. a) O filho terá a doença? Por quê? b) Qual a probabilidade de um outro filho do casal apresentar as duas seqüências iguais à da mãe? Questão 21 Um homem afetado por uma doença genética muito rara, de herança dominante, casa-se com uma mulher, não consangüínea. Imagine que o casal tenha doze descendentes, seis filhos e seis filhas. Responda,
4

1.4.1.6

justificando sua resposta, qual será a proporção esperada de filhas e filhos afetados pela doença do pai no caso do gene em questão estar localizado. a) em um autossomo; b) no cromossomo X. Questão 22 Em ervilhas o caráter semente lisa é condicionado por um gene dominante R e semente rugosa pelo seu alelo recessivo r. Quais são as proporções genotípica e fenotípica obtidas na autofecundação de uma variedade comprovadamente heterozigota? Questão 23 "Hormônios são proteínas cuja função é regular os complicados mecanismos do organismo - como o aumento e redução do peso do corpo (...) Em outubro, o geneticista Jeffrey Friediman (...) isolou o primeiro hormônio capaz de controlar o peso, chamado leptina. Ele é produzido por um gene que, quando funciona mal, o organismo ganha peso (...)". (In: "Superinteressante" - ano 10, nŽ 3, mar., 1996.) Com base no texto, RESPONDA: a) Como se denomina o local que o gene ocupa no cromossomos? b) Considerando de forma simplificada a existência de dois alelos para o gene da leptina, um normal (L) e outro mutante (L'), quantos genótipos diferentes são possíveis em humanos diplóides? Quais são eles? c) COMENTE sobre um mecanismo que pode levar à mutação gênica. Questão 24 No início do século XX, a transmissão das informações genéticas para os descendentes era explicada por algumas hipóteses sobre as leis da hereditariedade, como a mendeliana e a por mistura. Observe os esquemas:

1.5.1.1

Suponha que, em um indivíduo de uma população com reprodução sexuada, apareça, por mutação, um gene raro que confira ao seu portador características vantajosas. Indique, para cada uma das hipóteses representadas, se há ou não possibilidade de aumento da freqüência do gene mutante na descendência desse indivíduo e justifique suas respostas. Questão 25 Leia o texto a seguir. "A Doença de Alzheimer (D.A.) (...) é uma afecção neurodegenerativa progressiva e irreversível, que acarreta perda de memória e diversos distúrbios cognitivos. Em geral, a D.A. de acometimento tardio, de incidência ao redor de 60 anos de idade, ocorre de forma esporádica, enquanto que a D.A. de acometimento precoce, de incidência ao redor de 40 anos, mostra recorrência familiar. (...) Cerca de um terço dos casos de D.A. apresentam familiaridade e comportam-se de acordo com um padrão de herança monogênica autossômica dominante. Estes casos, em geral, são de acometimento precoce e famílias extensas têm sido periodicamente estudadas." Smith, M.A.C. (Revista Brasileira de Psiquiatria, 1999) Considerando o texto e o histórico familiar a seguir, responda ao que se pede. Histórico familiar: "Um rapaz cujas duas irmãs mais velhas, o pai e a avó paterna manifestaram Doença de Alzheimer de acometimento precoce."

5

b) aa x aa c) aa x Aa d) Aa x Aa e) Aa x AA 1.5.1.1 Questão 28 No gado bovino da raça Ayrshire a cor mogno é determinada pelo genótipo A A e a cor vermelha pelo genótipo A‚ A‚, mas o genótipo A A‚ é mogno nos machos e vermelho nas fêmeas. Com base nessas informações, qual é o sexo de um filhote vermelho, cuja mãe é uma vaca mogno? Justifique a sua resposta. Questão 29 A formação de uma característica fenotípica depende, em alguns casos, apenas de fatores genéticos. Em outros casos, prevalece a influência de fatores ambientais. Na maioria das vezes há uma interação entre fatores genéticos e ambientais. Um dos métodos utilizados para avaliar a importância relativa dos genes e dos fatores ambientais na formação de uma característica é o estudo comparativo entre irmãos gêmeos monozigóticos criados juntos e criados separados. A tabela a seguir, elaborada a partir de um grande número de pares de gêmeos, indica o grau de concordância de quatro características. Uma concordância significa que quando um irmão possui a característica, o outro também a possui.

I. Montar o heredograma para o histórico familiar apresentado. II. Qual a probabilidade de o rapaz em questão também ser portador do gene responsável pela forma de acometimento precoce da doença? III. Quais indivíduos do heredograma são seguramente heterozigotos para esse gene? IV. Explicar o padrão de herança mencionado no texto. Questão 26 Mendel não acreditava na mistura de caracteres herdados. De acordo com suas conclusões, a partir dos cruzamentos realizados com ervilhas do gênero 'Pisum', as características não se misturam, permanecem separadas e são transmitidas independentemente. HENIG, Robin. "O monge no jardim". Rio de Janeiro: Rocco, 2001. a) Considerando as leis de Mendel para a hereditariedade, no momento da fecundação os cromossomos herdados dos progenitores se juntam, porém os alelos dos seus genes não se misturam. A partir dessa idéia, qual fenômeno explicaria a ocorrência de características intermediárias na progênie, que parecem ser uma mistura daquelas dos progenitores? b) Posteriormente, estudos de grupos de geneticistas indicaram que pode haver troca de material genético entre cromossomos homólogos herdados do pai e da mãe. Em que etapa isso pode ocorrer e como se chama este processo? Questão 27 Determine as probabilidades de aparecerem indivíduos afetados (aa), normais (AA) e heterozigotos (Aa), nas proles dos casamentos: a) aa x AA

1.5.1.1

Indique a característica que mais depende de fatores ambientais. Justifique sua resposta.

6

os meios de comunicação noticiaram o caso de uma mulher norte-americana que. quando o genótipo é homozigoto dominante ou heterozigoto. Ele. a produtividade aumentava.1 Identifique se é o componente genético ou o componente ambiental que predomina no condicionamento da produtividade dessas plantas.Questão 30 Um pesquisador teve sucesso na integração de uma cópia do gene que codifica o hormônio do crescimento de rato (HCR) em um dos cromossomos autossômicos de uma célula-ovo de camundongo. e este foi implantado no útero de sua mãe. não portadora do gene HCR. a produtividade era muito baixa.1. heterozigota e do sexo masculino? d) Represente o provável heredograma desse casal. Assim. realizou um experimento em que sementes dessa espécie. Qual a probabilidade desse casal ter: a) quatro crianças albinas? b) uma criança albina e do sexo feminino? c) uma criança normal. Este camundongo transgênico foi cruzado com uma fêmea de camundongo normal. Questão 33 A mamona ('Ricinus communis') produz inflorescências contendo somente flores pistiladas (flores femininas). então. solicitou aconselhamento genético sobre a possibilidade de vir a ter crianças apresentando a condição albina. Em grandes altitudes.5. quem engravidou e deu à luz foi a mãe da referida mulher. 1. Questão 32 Um determinado casal normal.1.5.1 1. A célula-ovo transgênica se desenvolveu. 7 Calcule a proporção esperada da prole destes camundongos que será portadora do gene que codifica o HCR. Questão 31 Um pesquisador observou que uma certa espécie de planta apresentava uma grande variação de produtividade relacionada à altitude onde a planta se desenvolvia. isto é. Com base nessas afirmações. impossibilitada de ter filhos por anomalia no útero. admitindo-se que as suposições feitas nas letras (b) e (c) realmente se concretizem. Após algum tempo. Justifique sua resposta. Justifique sua resposta. a produtividade dessas plantas foi medida e apresentou os seguintes resultados: . dando origem a um camundongo macho. e inflorescências mistas (flores femininas e flores masculinas). à medida que a altitude se aproximava do nível do mar. foram plantadas ao nível do mar em idênticas condições ambientais. mas heterozigoto para o albinismo. que tipos de inflorescências serão produzidas nos descendentes dos seguintes cruzamentos: a) NN x Nn? b) Nn x Nn? Questão 34 Recentemente. quando o genótipo é recessivo. coletadas em diversas altitudes. teve seu óvulo fertilizado "in vitro".

c) Se fosse possível implantar os pêlos da fêmea preta na fêmea albina. como você explica esse resultado? b) Indique os genótipos da fêmea preta e da prole. Questão 39 Em várias culturas vegetais. sabendo ainda. quem é a mãe da criança? Justifique. a) Sabendo-se que o albinismo é característica recessiva. que as flores são hermafroditas e que sementes produzidas por autofecundação são viáveis. Sementes dessas plantas foram coletadas nas várias altitudes e plantadas em uma mesma região localizada ao nível do mar. o animal foi cruzado com um macho albino e deu origem a uma prole toda preta. a) planeje um cruzamento experimental entre flores de exemplares diferentes que lhe permita determinar se uma planta que produz sementes lisas é homozigota ou heterozigota para esse caráter. a) Explique o resultado obtido. Duas linhagens.Responda: a) Do ponto de vista genético. Após um determinado tempo de crescimento. b) Se o agricultor utilizar as sementes produzidas pelo híbrido nos plantios subsequentes. Nesses programas são desenvolvidas linhagens homozigotas por meio de sucessivas gerações autofecundadas. b) Qual a porcentagem de genes herdados da parturiente que se encontram no patrimônio genético da criança? Questão 35 Em gatos. as cores marrom e branca dos pelos têm sido descritas como devidas a. um par de genes. em vez de transplantar o ovário. homozigotas para alelos diferentes. qual seria a proporção esperada de descendentes com sementes rugosas? Questão 37 Um criador de cabras. os programas de melhoramento utilizam a heterose (vigor do híbrido). que. Por quê? Questão 40 Ao estudar a distribuição de uma espécie de planta da família dos girassóis em altitudes crescentes na costa oeste dos Estados Unidos. expresso no gráfico A. pelo menos. Alguns desses exemplares produzem sementes lisas e outros. são então cruzadas e produzem os híbridos. pesquisadores observaram que essas plantas apresentavam um gradiente decrescente de tamanho. Como o criador poderia fazer para determinar se essa variação é decorrente de uma mutação genética ou de uma alteração causada por fatores ambientais? Questão 38 Em experimento feito no início do século. depois de muitos anos nesse ramo. o resultado seria o mesmo? Justifique. Considere o cruzamento de gatos homozigotos brancos e marrons. Sabendo que a característica "lisa" das sementes da ervilha é determinada por um alelo dominante L. sementes rugosas. são mais vigorosos e mais produtivos que os parentais. Qual a proporção fenotípica esperada em F se a) o modo de herança for do tipo dominante? b) o modo de herança for do tipo co-dominante? Questão 36 Suponha que você tenha em seu jardim exemplares da mesma espécie de ervilha utilizada por Mendel em seus experimentos. qual seria a interpretação? 8 . dois pesquisadores retiraram os ovários de uma cobaia albina e implantaram-lhe um ovário obtido de uma cobaia preta. a) Esses indivíduos híbridos são geneticamente iguais entre si? Explique. o resultado não será o mesmo. b) Se o resultado do experimento tivesse sido o representado no gráfico B. Mais tarde. as plantas resultantes foram medidas e os dados obtidos no experimento são mostrados no gráfico A. portanto por genótipos LL ou Ll e. em geral. b) No caso de ocorrer autofecundação em uma planta que produz sementes lisas e é heterozigota. observou que alguns dos animais de sua criação apresentavam uma característica incomum nos chifres.

a talassemia menor e os pretos a talassemia maior. mas a saúde é essencialmente normal. analise as afirmações abaixo. caracterizada por uma anemia severa.1.2 . verificando se elas têm fundamento. determinando cor azul). Foram realizados quatro tipos de cruzamento entre plantas dessa espécie e obtidos e seguintes resultados: 1.aa. A (dominante. determine o modo de herança indicando os possíveis genótipos dos indivíduos envolvidos. Essa última forma geralmente culmina em morte antes de atingir a idade reprodutiva. aumento do baço. azul-claro e branca. Baseando-se nessa explicação.1 a) Formule uma hipótese consistente com os resultados obtidos para explicar a herança da forma dos frutos nessa espécie.em um jardim de plantas com flores de cor azul não nascem plantas com flores de cor azul-claro. determinando cor castanha) e a (recessivo.2 Questão 44 Considere uma certa espécie de planta que pode apresentar flores com três tipos de cor: azul.1. os hachurados. e (b) talassemia maior. Questão 42 Em uma espécie de planta a forma dos frutos pode ser alongada. a) Afirmação de um casal de olhos azuis: "nosso bebê poderá ter olhos castanhos porque as avós têm olhos castanhos". b) Represente os alelos por letras e indique os genótipos dos indivíduos parentais e dos descendentes no cruzamento IV.1. (a) talassemia menor. proferidas por casais em relação à cor dos olhos de seu bebê. entre outros sintomas.5. na qual os eritrócitos são pequenos (microcitemia) e em grande número (policitemia).é letal na fase adulta.5.1. Estas cores são determinadas por combinações de dois alelos de um único locus. oval ou redonda. sendo que a manifestação em homozigose de um dos alelos . microcitemia e policitemia. b) Afirmação de um casal de olhos castanhos: "nosso bebê poderá ter olhos azuis porque o avô paterno tem olhos azuis". Sabe-se que: .5. Questão 43 A talassemia é um defeito da hemoglobina em seres humanos. Na expressão fenotípica de tais cores não há relação de dominância entre os alelos. . 9 1. cor branca . A partir do heredograma hipotético a seguir onde os símbolos claros representam pessoas normais. Ela ocorre em duas formas. Justifique sua resposta. Questão 41 A herança da cor do olho na espécie humana geralmente é representada simplificadamente como um par de alelos.a flor de cor branca nunca se abre.

Antes que as sementes germinassem. provocando aborto precocemente. como o fazendeiro deverá proceder para estabelecer uma linhagem pura de animais brancos e sem chifres? Por que ele não conseguirá resolver o problema dos chifres rapidamente? Questão 47 O gráfico a seguir mostra a mortalidade de mosquitos de uma determinada espécie quando expostos a diferentes concentrações de um inseticida. venha a se desenvolver um rabanete de raiz ovalada? Justifique a sua resposta.2 a) Qual é o genótipo mais resistente? Como você chegou a essa conclusão? b) Observando as três curvas. e. Questão 46 Em gado. Entretanto. Um fazendeiro tem uma grande boiada constituída de animais vermelhos. aparecem os dois tipos em igual número. formou-se outro jardim. é controlada por genes codominantes. Considere um casal de anões pseudo-acondroplásicos.1. A e A‚. a forma da raiz é determinada por um par de genes alelos. Determine a cor das flores que têm maior possibilidade de se abrirem neste jardim. você recebeu uma delas. sem recorrer à inseminação artificial.5. Questão 45 Em rabanetes. para responder às seguintes questões: 10 .a) Realizou-se o cruzamento entre as plantas com flores azul-claro e. às vezes só origina prole sem chifres. A partir das sementes obtidas. foram obtidas quatrocentas sementes que foram plantadas em sementeiras individuais. A princípio. foi considerado que a severidade do alelo dominante. as sementeiras foram distribuídas a diversas pessoas. ou seja. na sua sementeira. formou-se um jardim. A resistência ou susceptibilidade ao inseticida é devida a um locus com dois alelos. Questão 48 A pseudo-acondroplasia é um tipo de nanismo determinado geneticamente pelo alelo D autossômico dominante que interfere no crescimento dos ossos durante o desenvolvimento. ocasionalmente produzem prole com chifres. os pontos distribuem-se ao longo da curva. ruão e branca. a) Qual a relação de dominância entre os caracteres em questão? b) Qual a probabilidade de que. Os fenótipos formados são três: arredondado. 1. a partir das sementes obtidas. quando em dose dupla. por isso. brancos e sem chifres. os quais. ovalado ou alongado. e o cruzamento de animais com chifres versus animais sem chifres. Determine a cor das flores que têm menor possibilidade de se abrirem neste jardim. produz efeito letal durante o desenvolvimento embrionário. Cruzamentos entre plantas de raízes alongadas com plantas de raízes arredondadas produziram apenas indivíduos com raízes ovaladas. presentes em igual quantidade. ruões. Utilizando apenas cruzamentos naturais. Em cruzamentos desses indivíduos ovalados entre si. que conclusão se pode tirar sobre as relações de dominância entre os alelos deste locus? Explique. c) Os indivíduos de cada um dos genótipos não se comportam da mesma forma quanto à resistência ao inseticida e. pensou-se que o fenótipo anão seria expresso pelo genótipo D/D ou D/d. Justifique a resposta. Essas diferenças podem ser atribuídas a efeitos pleiotrópicos de outros genes? Justifique sua resposta utilizando o conceito de efeito pleiotrópico. b) Realizaram-se os cruzamentos possíveis entre as plantas com flores das cores mencionadas. em outros cruzamentos. a cor da pelagem vermelha. Justifique a resposta.

em vez de três para um (3:1). a) Qual cruzamento apresenta resultado de acordo com os valores esperados? b) Como você explicaria o resultado do cruzamento em que os valores observados não estão de acordo com os valores esperados? Questão 50 Em ratos. o cruzamento de ratos amarelos entre si produziu 2/3 de descendentes de pelagem amarela e 1/3 de descendentes de pelagem cinza. todos apresentando a pseudo-acondroplasia. originados do cruzamento entre ratos amarelos. Questão 51 Gatos Manx são heterozigotos para uma mutação que resulta na ausência de cauda (ou cauda muito curta). presença de pernas traseiras grandes e um andar diferente dos outros. a cor da pelagem é condicionada por gene autossômico.a) Quais são os genótipos de cada indivíduo do referido casal? b) Caso a mulher deste casal venha dar à luz uma criança. quantas destas crianças são homozigotas no loco correspondente a este tipo de nanismo? Questão 49 Observe os cruzamentos a seguir. sendo o gene C. b) A partir de 40 ovos.5. dominante. como seria esperado pela genética mendeliana. qual é a probabilidade dela nascer geneticamente com a pseudo-acondroplasia? c) Como o casal já tem três crianças com a pseudo-acondroplasia. onde o alelo (A) condiciona a cor amarela em camundongos e é dominante sobre o alelo (a).4 11 . (Utilize as letras B e b para as suas respostas). a) Qual a explicação para esse resultado? b) Dê os genótipos dos parentais e dos descendentes.1. a) A partir de 20 ovos. e seu alelo c recessivo. que condiciona a cor cinza. CRUZAMENTO I (Aa × Aa) 240 amarelos 120 cinzas CRUZAMENTO II (Aa × aa) 240 amarelos 240 cinzas Analise os resultados destes cruzamentos e responda. porém. Um geneticista observou que o cruzamento de ratos de pelagem amarela com ratos de pelagem cinza resultou descendentes amarelos e cinzas em igual proporção. responsável pela coloração cinza. O cruzamento de dois gatos Manx produziu dois gatinhos Manx para cada gatinho normal de cauda longa (2:1). Questão 52 O heredograma a seguir representa uma família com pessoas afetadas por uma doença hereditária. responsável pela coloração amarela. a criança nascer também afetada? d) Se o casal tem planos para ter uma menina normal em relação a esta condição genética. em um eventual quarto nascimento. com 3 meninas e 2 meninos. qual é a probabilidade de. 1. originados do cruzamento de machos amarelos e fêmeas cinzas. qual é a probabilidade que se espera para este evento? e) Em uma outra família. quantos machos cinzas deverão atingir a idade adulta? Justifique. quantas fêmeas amarelas adultas são esperadas? Justifique.

qual é a probabilidade de que o casal 4 × 5 tenha uma menina albina? Analise a figura onde se admite que a pigmentação da pele é devida a um par de alelos (A. situada a oeste de São Luís.1.5. Os indivíduos I .1.6.5 são albinos. responda: anomalia? 1.4 1. c) Qual a probabilidade de os indivíduos de pigmentação normal da geração V serem todos heterozigotos? Questão 57 Questão 55 No heredograma a seguir os símbolos cheios representam indivíduos portadores de uma anomalia genética.5. V . Responda.5.4 Questão 56 A figura a seguir. moradores da ilha dos Lençóis. Sabendo-se que. um grupo de cientistas do "Genetics & IVF Institute" vem testando um novo método que permite a seleção dos espermatozóides a partir de sua coloração. onde a freqüência de albinos é de 1. V .1. adaptada da Folha de São Paulo de 17/03/96.3 e V .5 % e cinqüenta vezes maior do que entre o restante da população do Maranhão.4 .1. de uma característica expressa em antepassados remotos? b) O albinismo se deve a alelo dominante ou a alelo recessivo? Explique com base na figura. numa dada geração. de geração.1. a freqüência de heterozigoto para o albinismo é de 1/50.2. na Família de Raimundo e Eleílde da Silva. de acordo com a presença ou ausência do 12 1.a) A doença tem herança dominante ou recessiva? Por quê? b) A doença tem herança autossômica ou ligada ao cromossomo X? Por quê? Questão 53 Analisando a genealogia adiante. então: a) Que nome se dá ao aparecimento.5. a) Qual a probabilidade de o indivíduo 3 ser heterozigoto? b) Qual a probabilidade de o indivíduo 5 ser homozigoto recessivo? c) Qual a probabilidade de o indivíduo 6 ser homozigoto dominante? Questão 54 1. mostra a transmissão do albinismo.4 No heredograma adiante o indivíduo 3 é afetado pelo albinismo. Qual é a probabilidade de o indivíduo 9 ser portador dessa Nos Estados Unidos. na população.a). II .

Questão 59 O padrão de herança de uma doença.1.1. poderá ser benéfico quando utilizado por famílias portadoras de determinadas anomalias genéticas.5.4 1. foi analisada em três famílias diferentes (I. 1. além de satisfazer os anseios de vários casais na escolha do sexo do filho. você conclui que se trata de uma herança autossômica dominante.5. b) Suponha que a mulher 3 da família I case-se com o homem 4 da família III. a) Qual o tipo de herança da doença? Justifique sua resposta. Questão 60 Numa aula de genética. Ao analisar os indivíduos afetados por esta anomalia. Tal método. o professor lhe apresenta o heredograma a seguir. que mostra a ocorrência de uma anomalia causada pela ação de um par de genes (A e a) em várias gerações de uma família.4 13 . II e III).5. Identifique e justifique o tipo de herança.1. Questão 58 O heredograma a seguir refere-se ao caso de braquidactilia. considerando que o caráter é determinado por um único par de genes. como representado nos heredogramas a seguir: 1. b) Em qual das duas situações seria mais recomendado o uso da técnica ('Microsort') para a escolha de um bebê do sexo feminino? Por quê? c) Considerando o heredograma nŽ1.cromossomo Y ('Microsort').4 1. calcule a chance de os indivíduos III.1.2 gerarem uma criança afetada do sexo masculino.5. Qual a probabilidade de nascer uma criança doente? Justifique.1 e III.4 Analise os dois heredogramas anteriores. e responda às seguintes questões: a) Qual o padrão de herança envolvido na determinação da característica representada no heredograma 1 e no heredograma 2? Justifique sua resposta. que se suspeita ser autossômica recessiva ou ligada ao sexo.

Os círculos representam as mulheres e os quadrados. Analise esta genealogia e responda.4 1. A cor branca indica pelagem branca determinada por um gene recessivo.1.1. Quadrados ou círculos escuros representam indivíduos afetados por uma característica comum na população. a) Identifique os heredogramas que são compatíveis com uma herança autossômica recessiva. homens.4 Qual a probabilidade de que o cruzamento entre o indivíduo 9 e o indivíduo 10 gere um indivíduo de pelagem branca? Questão 62 Os heredogramas A. qual o único que não pode ter seu genótipo definido? Explique por quê. que apresenta indivíduos afetados por uma doença recessiva e indivíduos normais.5. Justifique sua resposta para cada família. 1. a menos que haja evidência contrária. a) Esta doença hereditária é condicionada por gene dominante ou recessivo? b) Dos dez indivíduos que compõem esta genealogia.Baseando-se EXCLUSIVAMENTE no heredograma apresentado acima.1.4 1.5.5. Os círculos representam mulheres e os quadrados. b) Determine se em algum dos casos apresentados existe herança ligada ao cromossomo Y. responda: a) Por que a anomalia NÃO pode ser recessiva? b) Por que a anomalia NÃO pode ser ligada ao cromossomo X? c) Qual a probabilidade de nascer uma criança afetada pela anomalia. os homens. enquanto os outros exibem fenótipo normal. Questão 63 Na genealogia adiante. Questão 64 Analise a genealogia. os indivíduos em escuro apresentam uma doença hereditária. B e C a seguir representam três famílias diferentes. Os indivíduos 5 e 8 devem ser considerados homozigotos (AA). 14 . se a mulher (4) da geração F3 tiver filhos com um homem que apresente essa anomalia? Questão 61 No heredograma abaixo a cor preta indica indivíduos com pelagem negra. fenótipo determinado por um gene autossômico dominante A. Justifique.

b) Qual é a probabilidade de que uma futura criança de Paulo e Joana venha a ser afetada por essa mesma doença genética? Considere desprezível a probabilidade de uma nova mutação. vítima de fibrose cística. mas cujo irmão morreu na infância. Discuta a importância dos fatores genéticos na manifestação dessa característica. tanto monozigóticos como dizigóticos.5. a) Indique o genótipo do embrião formado a partir da fecundação do óvulo resultante dessa célula por um espermatozóide de um macho recessivo para os dois pares de genes considerados.5. qual é a probabilidade de que uma sua irmã tenha esse mesmo gene A? Por quê? Questão 67 Dois irmãos (Pedro e Paulo) casam-se com duas irmãs (Maria e Joana). sendo ambos do sexo masculino e afetados? Questão 65 Uma determinada característica foi estudada em centenas de pares de gêmeos. filha de pais normais. c) Se Paulo e Joana tiverem uma primeira criança afetada pela mesma doença genética. Um inglês heterozigoto para essa característica é casado com uma mulher normal. Justifique sua resposta. tem uma criança afetada por uma doença muito rara de herança autossômica recessiva. mostrando como chegou aos resultados dos itens b) e c). Questão 69 Considere a figura a seguir que representa o resultado da primeira divisão meiótica de uma célula feminina: Toda pessoa na qual o alelo recessivo é detectado recebe orientação a respeito dos riscos de vir a ter um descendente com a anomalia. qual será o risco de que uma 1. b) Quais os possíveis genótipos dos filhos possíveis do mesmo casal? 15 . todos normais.1. As diferenças registradas entre os irmãos dizigóticos foram praticamente da mesma magnitude que as encontradas entre os irmãos monozigóticos.2.4 Questão 68 Alguns centros de pesquisa na Inglaterra estão realizando um programa de triagem populacional para detectar a fibrose cística. Questão 66 Se uma abelha operária tem o gene A herdado de seu pai. a) Desenhe o heredograma representando os dois casais e seus respectivos pais. 1. a) Quais os indivíduos representados na genealogia que são obrigatoriamente heterozigotos? b) Qual a probabilidade de o casal formado pelos indivíduos II2 e II3 ter mais dois filhos. uma doença autossômica recessiva grave particularmente comum em caucasianos.1 Calcule a probabilidade de que esse casal venha a ter uma criança com fibrose cística. Pedro e Maria. O primeiro casal.segunda criança desse casal também seja afetada por essa mesma doença? Por quê? Justifique suas respostas.

Questão 70 Em cobaias. A tabela a seguir apresenta os fenótipos dos pais e os fenótipos das respectivas proles. Descreva três mecanismos biológicos potencialmente responsáveis por essa variabilidade genética e explique como atuam.5. Caso você examine a prole de um grande número de casamentos em que ambos os cônjuges são duplo heterozigotos para esses dois pares de genes. filhos legítimos de um mesmo casal. O tamanho do pêlo também é controlado por um par de genes. apresentam marcantes diferenças em suas características físicas. a cor preta é condicionada pelo alelo dominante D e a cor marrom. 16 .2. realizados com ervilhas. 1 preto e branco e 1 marrom e branco. 3 de cor marrom uniforme. utilizando qualquer uma das características apresentadas na tabela. localiza-se o gene responsável pelo padrão da coloração: o alelo dominante M determina padrão uniforme (uma única cor) e o alelo recessivo m. que mostra parte dos resultados dos experimentos de Mendel.5. Questão 73 Quatro irmãos.1 a) Os genes para a cor e tamanho de pêlo estão no mesmo par de cromossomas? Justifique sua resposta. a) Quais os genótipos dos pais? b) Se o filho preto e branco for cruzado com uma fêmea cujo genótipo é igual ao da mãe dele.2. pelo alelo recessivo d. O cruzamento de um macho de cor preta uniforme com uma fêmea de cor marrom uniforme produz uma ninhada de oito filhotes: 3 de cor preta uniforme. b) Quais são os genótipos mais prováveis dos pais em cada casal? Justifique sua resposta. D e E que se segregam independentemente. 1. após vários cruzamentos. sendo o alelo dominante (B) para pêlo curto e o alelo recessivo (b) para pêlo longo. Em um outro cromossomo. o padrão malhado (preto / branco ou marrom / branco).1 1. qual a proporção esperada de descendentes iguais a ele? Questão 71 A audição normal depende da presença de pelo menos um dominante de dois pares de genes. Questão 74 Em uma raça de cachorros. De acordo com a tabela. a cor do pêlo negro é determinada por um gene dominante (A) enquanto seu alelo (a) determina a cor branca. que proporção fenotípica você espera encontrar? Questão 72 Observe a tabela a seguir. responda: a) Por que na geração F1 não foram encontradas sementes rugosas ou verdes? b) O que são os fatores hereditários referidos por Mendel e onde estão situados? c) Faça um diagrama de cruzamento para exemplificar as proporções fenotípicas encontradas na geração F2.

Suponha uma planta superior originada de um zigoto no qual dois dos pares de cromossomos. caso exista.2.Questão 75 Um pesquisador está estudando a genética de uma espécie de moscas. estão indicadas nos cromossomos representados no desenho. a constituição cromossômica de seus descendentes será igual à da planta mãe? Justifique.gene A (dominante) ou gene a (recessivo). Para a textura. têm a constituição AA‚BB‚. os homozigotos podem ser vermelhos ou brancos.gene B (dominante) ou gene b (recessivo). foram obtidos 100% de indivíduos AaBb que. Sem interação entre os dois locos. identificados pelas letras Aa e Bb. A e B. as proporções fenotípicas dependem de os referidos locos estarem ou não no mesmo cromossomo. Calcule a porcentagem esperada de descendentes fêmeas com pêlo vermelho crespo oriundas do cruzamento de dois animais duplamente heterozigotos. foram analisadas duas características com segregação independente e herança co-dominante: cor e textura do pêlo. cada um com dois genes alelos: loco 1 .1 Identifique qual dos dois casos tem maior probabilidade de representar dois locos no mesmo cromossomo. Questão 78 1. quais serão seus genótipos e em que proporção espera-se que eles sejam produzidos? Questão 77 Em uma determinada espécie animal. podem formar indivíduos com os genótipos mostrados na Tabela 1. quais serão os genótipos das quatro células haplóides geradas? b) Considerando o conjunto total de espermatozóides produzidos por esse animal.5. As localizações dos alelos desses genes. Na Tabela 2.1 a) Ao final da segunda divisão meiótica dessa célula. Justifique sua resposta. Os genes para comprimento do caule e forma do fruto segregam-se independentemente. Cruzando indivíduos AABB com indivíduos aabb. Despreze a parte fracionária de seu resultado. estão representadas duas proporções fenotípicas (casos 1 e 2) que poderiam resultar do cruzamento de dois indivíduos AaBb. 1. b) Se essa planta se reproduzir por autofecundação.2. a) Qual será a constituição cromossômica da planta adulta originada desse zigoto? Justifique. os homozigotos têm pêlo liso ou crespo. Para a cor do pêlo. assim como o alelo para fruto redondo. Questão 76 A figura mostra a segregação de dois pares de cromossomos homólogos na anáfase da primeira divisão meiótica de uma célula testicular de um animal heterozigótico quanto a dois genes. loco 2 . quando cruzados entre si.5. considerando apenas dois locos. O alelo que determina caule longo é dominante. uma com caule longo e frutos ovais e outra com caule curto e frutos redondos. 17 . Questão 79 Considere duas linhagens homozigotas de plantas.

CIÊNCIA HOJE. a) Quais os genótipos do pai e da mãe? b) Qual é a probabilidade de que ambos os gêmeos tenham sangue do tipo O? Questão 86 Um homem faleceu por causa de uma transfusão de sangue. explique o que significa dizer que esses dois genes a) segregam-se independentemente na formação dos gametas. b para forma dos frutos. Ao final do julgamento. de Ricardo Lorzetto. 95. ("Reserva estratégica de sangue". SBPC. qual será a probabilidade de nascer um indivíduo de genótipo aabbCcDD? Questão 82 Idiotia amaurótica infantil é uma doença hereditária recessiva (ii) que causa a morte nos primeiros anos de vida. Utilize as letras A. Questão 81 Do cruzamento de AaBbccDd x aaBbCcDd. fato que ele não admitia. b) estão ligados. a criança do grupo B e Chaplin do grupo O. Chaplin foi considerado como sendo um possível pai da criança. os antígenos estão presentes no sangue dos grupos A. Os exames de sangue revelaram que a mãe era do grupo A. 19/nŽ 113.a) De que forma podem ser obtidas plantas com caule curto e frutos ovais a partir das linhagens originais? Explique indicando o(s) cruzamento(s). recebeu um transplante de medula óssea de seu irmão Valentim. a) Qual será o grupo sangüíneo de Eugênio após o transplante? Por quê? b) Sabendo-se que a mãe e a esposa de Eugênio têm sangue do tipo O. set. o famoso cineasta Charlie ChapIin foi acusado de ser o pai de uma criança. pergunta-se: a) qual é o grupo sangüíneo do homem em questão? b) qual ou quais os possíveis grupos sangüíneos usados erroneamente na transfusão? Questão 87 "Os grupos sangüíneos são determinados pela presença ou ausência de antígenos na superfície das hemácias. Admite-se que dedos nas mãos anormalmente curtos (braquidactilia) sejam devido a um genótipo heterozigoto para um gene letal embrionário (BBL). e a operação foi bem sucedida.) a) O que são antígenos? b) Qual a importância de se identificar a presença de antígenos eritrocitários (presentes nas hemácias ou eritrócitos) no sangue humano? 18 . B. 58. de que tipos sangüíneos eles poderiam ser? Questão 84 Um tratamento utilizado para certos tipos de doenças do sangue é a destruição completa da medula óssea do paciente e implante de células medulares sadias provenientes de um doador. a para comprimento do caule e B. Sabendo-se que seus pais pertenciam aos grupos B (homozigoto) e AB. A condição normal (I_) produz um fenótipo normal. B e b. cujo grupo sangüíneo é B. qual será a probabilidade de um futuro filho do casal ter sangue do tipo A? E do tipo B? Questão 85 O pai e a mãe de um par de gêmeos monozigóticos têm tipo sangüíneo A. o homozigoto (BB) é normal e o outro homozigoto (BLBL) morre prematuramente. Qual é a probabilidade de um casal de braquidáctilos e heterozigotos para a idiotia amaurótica infantil vir a ter um descendente normal? Questão 83 Nos anos 40. Em termos de localização cromossômica. cujo grupo sangüíneo é A. AB e ausentes no grupo O". vol. No caso do Sistema ABO. Eugênio. a) O veredicto é aceitável? Por quê? b) Na hipótese de Chaplin ter tido filhos com a referida mulher. p. b) Em que proporção essas plantas de caule curto e frutos ovais serão obtidas? Questão 80 Considere dois genes e seus respectivos alelos: A e a. Uma outra criança desse casal é do grupo sangüíneo O.

por comparação com os fenótipos e genótipos do filho e da mãe. O casal tem um filho cujo sangue não aglutina em nenhum dos dois tipos de soro. e não aglutina quando colocado em presença de imunoglobulinas ou aglutininas anti-B. 1.Questão 88 O daltonismo. Uma mulher. tinha sangue A e visão normal. Qual dos homens foi o primeiro marido? Justifique sua resposta. 1. Para tal. responda: a) Quem do grupo anterior NÃO possui os aglutinogênios em suas hemácias? b) Por que Joana pode receber sangue de outros membros do grupo? c) Que tipo de aglutinina possuem Cassilda e Saildo.3. O tipo de sangue.5. a) Qual o genótipo dos pais? b) Qual a probabilidade de esse casal ter uma criança cujo sangue aglutine nos dois tipos de soro? Justifique sua resposta.O Saildo . Um dos maridos. ou cegueira para as cores. 2) homem. com sangue tipo A e visão normal. basta determinar o genótipo e o fenótipo do suposto pai e. Lalau (indivíduo II-1) elaborou o seguinte heredograma sobre a herança de grupos sangüíneos do sistema ABO. é determinado por um gene localizado no cromossomo sexual X. é determinado por três alelos autossômicos: IÞ. Questão 90 Pode-se usar o sistema ABO para "excluir" um suposto pai em uma investigação de paternidade.5.3. sangue A. sangue A. daltônica. daltônico. Orlando casa-se com Leila. sangue O. verificar se o homem acusado pode ser considerado como um pai impossível. José. visão normal. Iß. 3) mulher. o outro marido. Questão 89 O sangue de Orlando aglutina quando colocado em presença de soro contendo imunoglobulinas ou aglutininas anti-A. grupo ABO. sangue B.1 19 . que apresenta aglutinações inversas. i.AB Cassilda . sangue A. tinha sangue AB e era daltônico. respectivamente? Questão 92 Ao descobrir que seu genótipo era homozigoto. A tabela a seguir mostra os fenótipos do filho e da mãe em três casos. Paulo. a mulher teve cinco filhos na seguinte ordem: 1) homem. 5) mulher.B Doaldo . Com os dois maridos. ficou viúva e casou pela segunda vez. o Sr. Questão 91 Nas quatro pessoas relacionadas a seguir.1 Indique os fenótipos dos pais que NÃO poderiam ser os pais biológicos de cada caso. visão normal. daltônico. 4) mulher. foram encontrados os seguintes tipos sangüíneos: Joana .A Com base nesta relação.

de acordo com o sistema Rh.qual a probabilidade de ter outra com os mesmos fenótipos sangüíneos? Obs. de que um futuro irmão deste bebê seja do sexo masculino e venha a ter tipo sangüíneo diferente do irmão.5.3.1 Questão 95 O rei Salomão resolveu uma disputa entre duas mulheres que reclamavam a posse de uma criança. responda: a) Qual a probabilidade de o casal formado por 5 e 6 ter duas crianças com sangue AB Rh®? b) Se o casal em questão já tiver uma criança com sangue AB Rh ®. caso exista. B e O. Questão 97 Um exemplo clássico de alelos múltiplos é o sistema de grupos sangüíneos humano. Nos tribunais modernos.: indique os passos que você seguiu para chegar às respostas. Despreze a parte fracionária do seu resultado. como Rh® e Rh−. AB. O rei então concluiu que aquela que havia desistido era de fato a mãe verdadeira. Ao propor dividir a criança ao meio.1 Após identificar os pais do bebê nŽ 2.3. b) Explique por que uma pessoa com sangue tipo O é doadora universal mas só pode receber sangue do tipo O. Analisando-os. a) Explique por quê. pelo sistema ABO e. . que codifica para o antígeno A. em a e b.5. 1. Analisando uma situação em que uma mulher de sangue A atribuía a paternidade de seu filho de sangue O a um homem de sangue B. qual é a probabilidade dela ser uma menina e do grupo sangüíneo "B"? Questão 93 Dois casais suspeitavam da troca de seus bebês no berçário da maternidade. cujos resultados obtidos são mostrados na tabela adiante. é codominante sobre o alelo Iß. em porcentagem. um juiz pode utilizar a análise dos grupos sangüíneos e teste de DNA para ajudar a solucionar questões semelhantes. enquanto uma pessoa com sangue AB é receptora universal mas não pode doar para os outros tipos. pode-se identificar os pais de cada bebê. Por que o teste de DNA permite tirar conclusões tão precisas em casos como este? Questão 96 Os grupos sangüíneos humanos podem ser classificados em 4 tipos: A. Os casais e os bebês foram submetidos à tipagem do sangue quanto ao sistema ABO.a) Identifique o grupo sangüíneo do indivíduo I-1: b) Qual o genótipo do indivíduo II-5? c) O Sr. b) Qual deveria ser o grupo sangüíneo do homem para que a decisão pudesse ser conclusiva? c) Com base no teste de DNA. Questão 94 Com base no heredograma a seguir. o juiz concluiu que o homem era pai da criança. a) Explique como o sangue de uma pessoa pode ser identificado em relação aos sistemas ABO e Rh. em que o alelo IÞ. que 20 1. calcule a probabilidade. Lalau poderá ser receptor de sangue de seu genro para transfusão? d) O indivíduo III-5 NÃO poderá ser de qual grupo sangüíneo? e) No caso do casal III-3 e III-4 ter uma segunda criança. uma das mulheres desistiu. o juiz não pôde chegar a nenhuma decisão conclusiva.

3. B ou AB. a) Complete o quadro a seguir com os genótipos e as reações antigênicas (represente com os sinais + e -) dos grupos sangüíneos indicados. com o uso do soro anti-Rh (anti-D) como mostra o esquema a seguir. Questão 103 Um casal tem cinco filhos: Alex.5. 1.3. Érica e Ana. Questão 102 1. por que cada indivíduo é portador de somente dois alelos? Questão 98 Uma população humana foi testada quanto ao sistema MN de grupos sanguíneos. apresentou a doença hemolítica ou eritroblastose fetal. B ou AB. responda: 21 b) Embora 3 alelos distintos determinem os grupos sangüíneos ABO humanos. Certo ou errado? Justifique sua resposta.2 Nas transfusões sangüíneas. Mário. podem ser feitas transfusões de pequenos volumes de sangue O para pacientes dos grupos A.3. o doador deve ter o mesmo tipo de sangue que o receptor com relação ao sistema ABO.codifica para o antígeno B. que. Pedro. Na impossibilidade de se fazer um exame dos tipos sangüíneos.5.2 1. na falta de sangue do mesmo tipo. B. ao nascer. a) Explique como ocorre a eritroblastose fetal. sofreu um acidente e precisa urgentemente de uma transfusão de sangue. são necessários para a identificação dos quatro grupos sangüíneos: A. um dos gêmeos.5. o que pode levar recém-nascidos à morte. b) Como evitar sua ocorrência? c) Qual o procedimento usual para salvar a vida do recém-nascido com eritroblastose fetal? Questão 101 Um indivíduo pertencente aos grupos sangüíneos AB e Rh positivo é considerado receptor universal ideal. Os dados obtidos compõem a tabela a seguir: a) Quais as freqüências dos alelos M e N nessa população? b)Essa população está em equilíbrio de Hardy-Weinberg para esse loco gênico? Questão 99 Duas mulheres disputam a maternidade de uma criança. e os únicos doadores disponíveis são seus irmãos. Érica. Ambos os alelos são dominantes sobre o alelo i.1 Qual das mulheres poderia ser a verdadeira mãe daquela criança? Justifique sua resposta. Explique o problema que pode ocorrer se forem fornecidos grandes volumes de sangue O para pacientes A. Dois tipos de soros. que não codifica para qualquer antígeno. Questão 100 Na eritroblastose fetal ocorre destruição das hemácias. Em situações de emergência. anti-A e anti-B. AB e O. O sangue das duas mulheres foi testado . Dois dos irmãos são gêmeos univitelinos.

foram produzidos descendentes dourados. R_ee crista rosa. a) Qual é o genótipo do macho dourado. Questão 104 No quadro a seguir. forma? c) Qual é o genótipo da fêmea preta? d) Qual é o genótipo da fêmea marrom? Questão 106 Em galinhas há quatro tipos de cristas: simples. pretos e marrons.4 a) Explique o fenômeno que ocorreria com as hemácias de um indivíduo do grupo A ao receber sangue de um indivíduo do grupo B. por isso. Questão 107 Em galinhas domésticas o tipo de crista é determinado por dois pares de genes com segregação independente. Em ambos os cruzamentos. Explique por que a aglutinação não ocorreria se o aglutinogênio fosse uma proteína citoplasmática. 1. 1/8 ervilha e 1/8 simples. qual seria a pessoa mais indicada para ser o doador? b) Justifique sua resposta. rosa e ervilha. foi cruzado com uma fêmea preta e com uma fêmea marrom. A partir desses dados responda: a) Quais os genótipos paternos? b) Os genes em questão obedecem a segunda lei de Mendel? Justifique. Crista Rosa = R_ee Crista Ervilha = rrE_ Crista Noz = R_E_ Crista Simpes = rree Um galo com crista noz foi cruzado com três galinhas. 3/8 rosa. que pode ser preto ou marrom. quanto aos dois genes mencionados? b) Que tipos de gameta e em que proporção esse macho 22 . Já os cães com genótipos "EE" ou "Ee" apresentam pigmento nos pêlos. enquanto os com genótipos "BB" ou "Bb" apresentam pelagem preta. b) Sabe-se que o aglutinogênio é uma proteína da membrana das hemácias. rrE_ crista ervilha e o genótipo eerr determina crista simples. Questão 108 As reações enzimáticas a seguir indicam a passagem metabólica que sintetiza pigmentos em uma planta. Um galo de crista noz cruzado com uma galinha de crista rosa produziu a seguinte geração: 3/8 noz. Observe os fenótipos e genótipos. com pelagem dourada. Na determinação desses tipos de cristas atuam dois pares de genes (Rr e Ee).a) Entre seus irmãos.3. marrom e dourada) são condicionadas pela interação de dois genes autossômicos. Questão 105 As três cores de pelagem de cães labradores (preta. Assim o genótipo R_E_ determina crista noz. dependendo do outro gene: os cães homozigóticos recessivos "bb" apresentam pelagem marrom. as duas colunas da direita demonstram esquematicamente o aspecto "in vitro" das reações no sangue dos indivíduos de cada grupo sangüíneo ABO aos anti-A e Anti-B. Utilizando a tabela a seguir determine o genótipo do galo e das três galinhas.5. cada um deles com dois alelos: "Ee" e "Bb". com a galinha B de crista ervilha produziu 3 noz: 1 rosa: 3 ervilha: 1 simples e com a galinha C de crista noz a geração tinha 100% crista noz. Os cães homozigóticos recessivos "ee" não depositam pigmentos nos pêlos e apresentam. Com a galinha A de crista noz produziu na geração 3 noz: 1 rosa. Um labrador macho. pelagem dourada. noz.

uma única cópia funcional da enzima A ou da enzima B é suficiente para catalisar normalmente a sua respectiva reação. em homozigose recessiva.1.5. encontrado comumente na natureza. apresenta pelagem de coloração acinzentada (aguti). Duas outras colorações são também observadas: preta e albina. quando em homozigose recessiva (aa). os alelos A e B produzem enzimas funcionais. temos que: O gene A é epistático sobre o gene B e. Responda: a) No cruzamento entre indivíduos de genótipos AaBb×aabb. Questão 109 Analisando a via metabólica hipotética.2 Utilizando essas informações e seus conhecimentos. impede a produção dos pigmentos rosa e vermelho. devido à não produção de enzima X. Os genes A e B são dominantes sobre os seus alelos. o tipo selvagem. impossibilita a conversão de pigmento rosa em vermelho. enquanto os alelos a e b produzem enzimas inativas. c) CITE a probabilidade de se obterem camundongos pretos do cruzamento de albinos (duplo homozigotos) com aguti (duplo heterozigotos). 23 .4. b) Do cruzamento de dois camundongos aguti obtiveram-se descendentes na seguinte proporção: 9 aguti: 3 pretos: 4 albinos. A _ B _ = Aguti A _ bb = Preto aaB _ e aabb = Albinos 1. faça o que se pede. qual será a proporção fenotípica esperada na progênie? b) Quais são os possíveis genótipos para os indivíduos vermelhos? c) Quais os fenótipos esperados e suas respectivas proporções em F‚ obtidos a partir de parentais AABB × aabb? Questão 110 Em camundongos. CITE todos os genótipos possíveis para os camundongos albinos obtidos e APRESENTE UMA EXPLICAÇÃO para a alteração da proporção 9:3:3:1 (esperada em cruzamento de diíbridos) para 9:3:4. a) Do cruzamento entre camundongos preto e albino obtiveram-se 100% de camundongos aguti. Determine a proporção esperada entre as cores das plantas descendentes na primeira geração do cruzamento AaBb×AABb.para as enzimas A e B.5. . DÊ os genótipos dos camundongos envolvidos no cruzamento. O gene B. Observe os dois pares de genes envolvidos e os fenótipos relativos aos tipos de coloração dos camundongos.1 Considere as seguintes condições: .4.

estão envolvidos dois pares de genes A/a e B/b. Cobaias albinas homozigotas foram cruzadas e todos os descendentes nasceram pretos. Seus genitores tinham visão normal para cores. igual ao do humano e determine: a) quantos cromossomos existem. ele é inibido e produz frutos brancos. mas. Questão 114 O daltonismo tem herança recessiva ligada ao X. Como isto pode ser explicado. pergunta-se: a) Por que é o pai quem determina o sexo da prole? b) Por que os filhos homens de pai hemofílico nunca herdam essa característica do pai? Questão 116 Um geneticista. considerando-se que não ocorreu mutação? Justifique. O indivíduo duplo recessivo produz frutos verdes. justificando sua resposta. nos espermatozóides e nas células musculares dessa espécie animal. adotando o mesmo critério utilizado para a montagem de cariótipo da espécie humana.Questão 111 Na herança da cor do fruto da moranga. nessa espécie desconhecida. é cruzada com outra. produtora de frutos verdes. como o seu alelo b. mas o gene B inibe a ação do gene A. Questão 117 Esta figura representa uma célula humana na qual uma estrutura está indicada pela seta. a) Qual genitor formou o gameta com 24 cromossomos? Explique. b) O erro ocorreu na primeira ou na segunda divisão da meiose? Explique. II. Uma planta homozigota. além desses. responda: a) Como se chama esse tipo de interação? b) Qual a proporção fenotípica correta entre os descendentes do cruzamento de plantas heterozigotas para esses dois pares de genes? Questão 113 Existe um gene em cobaias que suprime o efeito do gene que determina a coloração nesses animais. Um indivíduo anormal. nos óvulos. respectivamente. Uma planta.1 24 . XXY. Questão 115 Com relação à espécie humana. produtora de frutos brancos. o gene B condiciona fruto branco e o gene A condiciona fruto amarelo. na presença do gene A. Considerando que tais genes apresentam segregação independentemente um do outro.5. filha desse cruzamento. com cariótipo 47. Considere o padrão de determinação de sexo. dois cromossomos de tamanhos distintos. produtora de frutos amarelos. que será chamada de planta I. foi cruzada com outra planta. Responda: a) Que denominação se dá a este tipo de interação entre os genes A e B? b) Quais os genótipos das plantas I e II? Questão 112 Numa dada planta. b) o sexo a que pertence o animal da espécie em questão. era daltônico. 1. montou o cariótipo de certa espécie animal desconhecida. conseguindo formar dez pares de cromossomos. Esse gene está localizado em um cromossomo diferente daquele em que está o gene que determine a cor do animal. O gene B produz frutos amarelos.5. O cruzamento entre a planta I e a planta II produziu 4/8 de plantas com frutos brancos. 3/8 de plantas com frutos amarelos e 1/8 de plantas com frutos verdes. O duplo recessivo condiciona fruto verde. restando.

o sexo feminino é heterogamético. são tratados com transplantes de medula óssea. Questão 118 Em galinhas domésticas. qual a vantagem dessa prévia determinação do sexo dos embriões? b) Por que o "kit" pesquisa somente a presença do cromossomo Y? Questão 120 Durante o processo de meiose ocorre a recombinação gênica. ele é eliminado ou congelado para uso futuro. O alelo que determina a coloração carijó é dominante sobre o alelo para a cor branca. 1.5. mas não a possui. Questão 119 Fazendeiros que criam gado leiteiro podem. b) CITE o nome da estrutura indicada pela seta e JUSTIFIQUE a existência da estrutura nessa célula.Com base na figura e em conhecimentos sobre o assunto. Identifique o cromossomo humano que sofre menos recombinação. em especial aqueles ligados às células do sangue. 25 . Após o transplante de medula é possível identificar os cromossomos de células de diversos órgãos e tecidos. que é uma anomalia caracterizada pela ausência das glândulas sudoríparas. d) DENOMINE a síndrome que designa o indivíduo cujo sexo é compatível com a presença da estrutura indicada. Esse gene se localiza no cromossomo sexual X. Caso contrário. quando se passa um corante sobre a pele. uma parte da medula óssea de um doador sadio é introduzida na coluna vertebral de um paciente cujas células da medula óssea foram previamente eliminadas com auxílio de drogas ou de radiação. Justifique sua resposta. determinar o sexo dos embriões logo após a fertilização.1 a) Explique a formação dessas manchas do ponto de vista genético. A tabela a seguir mostra os resultados da classificação dos cromossomos de 4 tecidos de um paciente submetido a transplante de medula. Nesses transplantes. usando um "kit" que determina a presença do cromossomo Y. ficam com a pele toda manchada. a) CITE o nome da célula representada e sua principal função. a coloração das penas é uma característica condicionada pelo gene C e é ligada ao sexo. CITE o número cromossômico dessa célula caso ela pertença a um indivíduo normal e um indivíduo cujo sexo não é compatível com a presença da estrutura indicada. c) Utilizando a letra A para designar um conjunto de autossomos e as letras convencionalmente usadas para representar os cromossomos sexuais. formando um mosaico de manchas claras e escuras. Questão 121 Na espécie humana existe um gene raro que causa a displasia ectodérmica anidrótica. Se o embrião for fêmea. isto é. b) Por que esse mosaico não pode aparecer em um homem? Questão 122 Certos tipos de câncer. Numa determinada raça. a troca de seqüências de ADN entre cromossomos homólogos. Promovendo o intercruzamento destes descendentes. portadoras desse gene em heterozigose. Algumas mulheres. O cruzamento de uma galinha branca com um galo carijó produziu somente aves carijós. a) Para esses fazendeiros. atualmente. é reimplantado no útero da vaca. qual seria a proporção fenotípica esperada? Demonstre os cruzamentos.5.

1 Com base nesses resultados. A matéria dizia. a) Qual é a probabilidade de que uma filha desse casal apresente a doença? b) Qual é a probabilidade de que um outro filho desse casal seja também hemofílico? Justifique suas respostas. . Questão 123 O governo de uma sociedade totalitária decidiu conter a expansão demográfica reduzindo a proporção de homens na população. um pequeno corpúsculo de cromatina intensamente corado. Se o cromossomo X de uma fêmea com cariótipo 2AXX sofrer não-disjunção meiótica e o óvulo resultante com 2 cromossomos X for fecundado por um espermatozóide normal.S. mas por um balanço gênico entre genes femininizantes e masculinizantes. Questão 124 Em uma 'Drosophila melanogaster'. Os testículos da atleta fora extirpados para que ela pudesse competir na equipe feminina de judô a) Que vantagem a atleta levaria sobre as demais competidoras se tivesse os testículos durante a competição? b) Sabendo-se que ela foi considerada do sexo feminino. a) A que corresponde tal corpúsculo e em que tipo de células (somáticas ou germinativas) ele aparece? b) Qual a sua importância e por que ele não ocorre nas células masculinas? Questão 126 A análise dos núcleos interfásicos de células da mucosa oral de uma mulher. portador de um cromossomo Y.Questão 125 Na década de 40 descobriu-se que algumas células retiradas de mulheres apresentavam no núcleo interfásico. As demais mulheres poderiam continuar a ter filhos até que tivessem um filho homem. Este corpúsculo é conhecido hoje como cromatina sexual ou corpúsculo de Barr. Responda: a) Quantos cromossomos X tem esta mulher? b) Se ela se casar com um homem normal. qual a probabilidade de ter uma filha com constituição cromossômica igual à sua? Questão 127 Essa lei atingirá o objetivo desejado depois de algumas gerações? Justifique sua resposta. Com esse objetivo. qual é a relação que expressa esse índice? c) Qual é o índice sexual (I. pergunta-se: a) Qual é o sexo do descendente com cariótipo 2AXXY? b) Sabendo-se que o sexo da 'Drosophila melanogaster' pode ser definido por um índice sexual (I. identifique o sexo do paciente e o sexo do doador.5.) do descendente acima referido? Uma revista publicou uma reportagem com o título "Atleta com anomalia genética faz operação para definir seu sexo e poder competir na classe feminina de judô". a determinação do sexo não é feita simplesmente pela presença ou ausência do cromossomo Y.5.S. ainda.). revelou a existência de duas cromatinas sexuais em todos eles. pois apresentava órgãos sexuais internos masculinos e órgãos sexuais externos femininos. que testes citogenéticos você faria para comprovar esta afirmação? Questão 128 Um casal de não hemofílicos tem um filho com hemofilia. que a jovem era um caso de pseudo-hermafroditismo. fenotipicamente normal. dando origem a um descendente com cariótipo 2AXXY. foi então promulgada uma lei segundo a qual todas as mulheres que tivessem um filho homem não mais poderiam ter filhos. Justifique sua resposta. 26 1.

dois de cada casamento. Com base nessas informações e nas contidas na árvore genealógica adiante. A hemofilia tem herança recessiva ligada ao cromossomo X.5. Supondo que quinze de suas gestações se completem. 1. 1. ocorrem dois meninos hemofílicos. Questão 130 Uma mulher clinicamente normal casou-se duas vezes. responda à seguinte pergunta: se a mulher 5 se casar com um homem daltônico.5.5. Conforme mostrado na genealogia a seguir. que causa aborto espontâneo.5. responda à seguinte pergunta: se a mulher 4 casar com um homem normal e seu primeiro filho for um menino hemofílico.2 Questão 133 O gene recessivo d está localizado no cromossomo X e é responsável pelo daltonismo na espécie humana. 1. Com base nessas informações e nas contidas na árvore genealógica adiante.5.2 Questão 132 O gene recessivo h está localizado no cromossomo X e é responsável pela hemofilia na espécie humana. qual é a probabilidade de que o próximo filho homem desse casal venha a ser hemofílico? a) Que padrão de herança explica melhor a genealogia? Justifique sua resposta. b) Se os dois maridos da mulher fossem irmãos isto poderia alterar sua resposta anterior? Por quê? Questão 131 No heredograma a seguir. em ambos os casos com indivíduos normais e que não eram seus consangüíneos. entre as que nascerem? Justifique sua resposta. ela teve quatro filhos.Questão 129 Uma mulher é portadora de um gene letal ligado ao sexo. qual era o fenótipo da avó materna? Justifique sua resposta. qual é a probabilidade de 27 .5.2 a) Qual é a probabilidade de que uma segunda criança de II-4 e II-5 seja afetada? b) Qual é a probabilidade de II-2 ser portadora do alelo que causa a hemofilia? c) Se o avô materno de II-4 era afetado. qual o número esperado para crianças do sexo masculino. todos afetados por uma doença genética muito rara.

Daltônico Mulheres: XDXD . podemos representar genótipos e fenótipos de homens e mulheres como no quadro a seguir. qual o número esperado para crianças do sexo feminino entre as que nascerem? Justifique sua resposta.2 1.que o próximo filho homem desse casal venha a ser daltônico? a) Sabendo que a doença em questão é um caso de herança ligada ao sexo.5. Preocupado com a possibilidade de transmitir essa doença.Daltônica Na figura a seguir.2 28 .Visão normal XdY .5.5. que causa aborto espontâneo. consultou um geneticista que. 1. bem como a inexistência de casamentos consangüíneos. ao casar com uma mulher normal.Visão normal XdXd . 1.5.5. de Maranguape. gere filhas e filhos afetados pela doença. formule a conclusão do geneticista quanto à possibilidade de o consultante transmitir a doença a seus descendentes diretos. Questão 135 Um homem pertence a uma família na qual. Questão 136 O daltonismo (cegueira para as cores) se deve a uma mutação recessiva ligada ao sexo.5. há gerações.2 Questão 134 Uma mulher é portadora de um gene letal ligado ao sexo. b) Calcule os valores correspondentes à probabilidade de que o primo doente do consultante. diversos membros são afetados por raquitismo resistente ao tratamento com vitamina D. Homens: XDY .Visão normal XDXd . Nele. os símbolos sombreados representam indivíduos daltônicos em um dos ramos da família Abreu. Sendo assim. após constatar que a família reside em um grande centro urbano. o consultante está indicado por uma seta. localizada na parte não homóloga do cromossomo X. preparou o heredograma abaixo. Supondo que nove de suas gestações se completem. isto é.

procurou um geneticista. IV.7. b) Quais são os prováveis genótipos dos indivíduos II-2. 1. c) Quais todos os genótipos prováveis para os descendentes (filhos e filhas) de um possível casamento entre IV. Supondo que o indivíduo tratado venha a ter filhos com 29 Com base no enunciado e na análise do heredograma. Os resultados mostraram um aumento significativo na produção do fator VIII nos indivíduos tratados. para representar os genes. a) Qual a principal característica clínica da hemofilia A? Justifique por que esse sintoma clínico aparece nos afetados. considerando o seu casamento com um homem normal (indivíduo III‰). leis da probabilidade. responda: a) A mãe do cruzamento I é homozigota ou heterozigota? Justifique. 2. Questão 140 Uma das primeiras experiências de terapia genética foi realizada com indivíduos hemofílicos cujo gene para o fator VIII de coagulação era defeituoso. embora sejam raras.2 A cor do pêlo dos gatos depende de um par de genes alelos situados no cromossomo X. por meio das . A figura a seguir mostra o heredograma de um tipo de diabetes que leva a problemas no metabolismo do fosfato e dos carboidratos.risco de sua prima (indivíduo III„) vir a ter uma outra criança hemofílica do mesmo casamento com o indivíduo III…. no quadro anterior.10. Existe um terceiro gene autossômico (não localizado nos cromossomos sexuais) que é responsável pela cor branca. b) Analise a Árvore Genealógica de MS e informe: 1.risco de ela vir a ter uma criança hemofílica. nascendo uma criança de III.Analisando a figura. Como não tem recursos para fazer o diagnóstico pré-natal dessa doença pelo estudo do DNA fetal. Um deles é responsável pela cor preta e o outro pela cor amarela. explique por que o pêlo de uma gata pode ter três cores.9 e III.2 e IV. Na terapia foram retiradas células da pele do paciente.9? Justifique sua resposta.5.5.5. III. Ela quer obter mais informações sobre a hemofilia A e conhecer. enquanto o pêlo de um gato só pode ter duas cores. tem vários parentes com hemofilia clássica ou hemofilia A.2 e IV. tendo em vista as informações e usando os símbolos dados.5. o seu risco e também o de sua família de vir a ter uma criança com essa doença. ela ser do sexo masculino e daltônico? Justifique sua resposta.2 Questão 139 1.1. Questão 137 Na espécie humana há algumas condições dominantes ligadas ao cromossomo X. Com essas informações.9? b) Qual a probabilidade de. III-4 e III-5? Questão 138 MS (indivíduo IIIˆ) está grávida. responda: a) Quais os genótipos dos indivíduos II. Estas células receberam cópias do gene normal para o fator VIII e foram posteriormente reintroduzidas no indivíduo.

5. enquanto que a da família 2 é uma doença degenerativa fatal que aparece em torno dos 40 anos de idade. e ausente no Y. a) indique os genótipos dos indivíduos. existe possibilidade de nascimento de uma criança não hemofílica? Justifique sua resposta. ou. dois caracteres genéticos com mecanismos de herança distintos. explique por que a doença da família 2 ainda poderia ser encontrada em indivíduos da geração VI (netos da geração IV). responda: 1. a) Quais os tipos de herança envolvidos na transmissão das doenças de cada família? Justifique sua resposta.2 30 . atenda às solicitações a seguir.2 1.5.5. simultaneamente. Após analisar os heredogramas. fenótipo dos indivíduos.5.uma mulher cujos genes para o fator VIII sejam defeituosos. c) discuta a possibilidade de uma mulher hemofílica e albina ser filha biológica dos pais propostos no heredograma que você construiu. o heredograma a seguir começou a ser elaborado para que fosse determinado o genótipo e. b) construa um heredograma no qual três desses indivíduos sejam os filhos biológicos (legítimos) dos outros dois.5. Sabendo-se que o loco do gene para o daltonismo está no cromossomo X. Questão 141 Seguindo a representação a seguir 1. b) Considerando que a seleção natural pode eliminar doenças genéticas. Questão 143 Com o objetivo de reconstruir a história familiar de um caso de herança de daltonismo. A doença que acomete a família 1 provoca retardamento mental acentuado.2 e considerando que os indivíduos apresentam.5. Questão 142 Os heredogramas a seguir representam duas famílias com doenças hereditárias distintas.

a) Se os indivíduos I . Como nenhum de seus parentes próximos era hemofílico. a) Qual a probabilidade de João ter herdado do pai o gene para daltonismo? Qual a probabilidade de Maria ter herdado do pai o gene para daltonismo? b) Por que é mais freqüente encontrarmos homens daltônicos que mulheres daltônicas? Questão 148 1. também deverão apresentar este fenótipo? b) O indivíduo II . alterando a percepção das cores. os homens. Um de seus gatos apresenta hipoplasia testicular (testículos atrofiados) e é totalmente estéril. ambos ligados ao sexo.4 vierem a se casar e ter filhos. responda. neste heredograma. o número de mulheres afetadas pelo daltonismo é baixo quando comparado com o número de homens afetados pela anomalia. Nos indivíduos daltônicos.5.5. alguns desses pigmentos não estão presentes. b) Tendo em vista o tipo de herança mais provável. c) Se os indivíduos III . responda: a) Por que o daltonismo é raro nas mulheres? b) Quantas vezes os homens daltônicos são mais freqüentes nas populações do que as mulheres daltônicas? Questão 145 A genealogia representada na figura é de uma família com uma anomalia rara na espécie humana. Supondo-se que a freqüência de homens daltônicos nas populações seja de 10%. quais os genótipos dos indivíduos II-4 e II-5? Uma mulher deu à luz um menino com hemofilia. a) O que é e qual o tipo de aneuploidia que o gato de José apresenta? b) Qual a explicação dada pelo veterinário relacionando a anomalia com as cores do animal? Questão 147 O daltonismo é comumente entendido como a incapacidade de enxergar as cores verde e/ou vermelha. quantas pessoas A MAIS.1 e II . Questão 144 Na espécie humana. ao ver as cores preta e amarela do animal. A percepção de cores é devida à presença de diferentes tipos do pigmento retinol nos cones da retina. ela supôs que o problema teria surgido porque o pai da criança trabalhava em uma usina nuclear e teria ficado exposto a radiações que alteraram seu material genético.2 Com base nessa genealogia. a) Qual o tipo mais provável da herança desta anomalia? Justifique. Os genes que participam da síntese desses pigmentos localizam-se no cromossomo X.5 são daltônicos. Os círculos representam as mulheres e os quadrados. A mulher tem razão? Justifique. José procurou um veterinário que.1 e III . As cores nos gatos domésticos são determinadas por um gene A (cor amarela) e outro gene P (cor preta). O daltonismo é um caráter recessivo. e o malhado apresenta os dois genes (A e P). 31 .5 poderá ter irmão normal? Justifique. imediatamente fez o seguinte diagnóstico: trata-se de um caso de aneuploidia de cromossomos sexuais. Os símbolos em escuro representam os indivíduos com anomalia Questão 146 José é uma pessoa muito interessada na criação de gatos. Este casal teve dois filhos: João e Maria. poderão ter uma menina normal homozigota? Justifique. Um homem daltônico casou-se com uma mulher de visão normal em cuja família não havia relatos de casos de daltonismo.

se casa com um homem normal e tem 3 filhos.5. a cor vermelha ou branca dos olhos é determinada por um gene localizado no cromossomo X. quadrados e círculos hachurados para homens e mulheres afetados. I e II. dos quais 2 são afetados. homens e mulheres normais. e 3 mulheres. Esse casal tem 5 filhos. uma moça normal e 2 homens. A irmã mais nova. Todas as filhas mulheres são afetadas por essa doença. estabelecer com segurança o parentesco entre pessoas. como no ser humano. assim como a probabilidade de filhos afetados para o casamento entre os últimos primos. O heredograma a seguir mostra os descendentes do casal João e Maria. Um alelo de um lócus do cromossomo Y do peixe 'Lebistes' determina a ocorrência de manchas na nadadeira dorsal. Questão 150 A determinação do sexo em peixes segue o sistema XY.Questão 149 No gênero Drosophila. se o alelo fosse dominante e estivesse no cromossomo X do macho? Demonstre. casa-se com uma mulher normal e tem 2 filhos. das quais somente uma é normal. também afetada pela doença. portadores de uma doença genética que se manifestava da seguinte maneira: O pesquisador concluiu que não se tratava de uma doença com herança dominante ou recessiva ligada ao sexo. a) O que levou o pesquisador a concluir que não se tratava de herança ligada ao sexo? b) Por que o pesquisador teve dúvida quanto ao tipo de herança autossômica? Questão 152 Uma doença humana rara é introduzida em uma família quando uma mulher normal se casa com um homem afetado. a filha afetada do irmão mais velho e o filho afetado da irmã mais nova. Para o heredograma. Responda as três questões a seguir considerando o cruzamento de uma mosca fêmea de olhos vermelhos de uma linhagem pura para cor de olhos com um macho de olhos brancos. Justifique essa conclusão.2 32 .5. Questão 151 Um geneticista estudou dois grupos. utilize a simbologia: quadrados e círculos brancos para. a) Quais são os fenótipos de F e de F‚ desse cruzamento? b) Como seria o resultado em F e F‚. Um peixe macho com manchas na nadadeira foi cruzado com uma fêmea sem manchas. biologia molecular e engenharia genética podem. muitas vezes. através de um cruzamento. 2 mulheres e 3 homens. Questão 153 Os conhecimentos atuais de biologia celular. porém teve dúvida se se tratava de herança autossômica recessiva ou autossômica dominante com penetrância incompleta. pode-se dizer que o modo de herança mais provável seja de herança ligada do X dominante. e o cruzamento das moscas F entre si. a) Qual será a cor dos olhos dos machos e fêmeas na primeira geração (F)? E na segunda (F‚)? Justifique. sendo 4 homens. 1. b) Qual será a proporção de machos e fêmeas nas duas gerações? Justifique. Uma das filhas se casa com um homem normal e tem 7 filhos. mesmo quando elas pertencem a gerações afastadas entre si. Represente como B o alelo dominante para olhos vermelhos e como b o alelo recessivo para olhos brancos. um normal e outro afetado. Observando a genealogia. afetado pela doença. O irmão mais velho. uma mulher afetada e um homem normal. respectivamente. desenhe o heredograma dessa família considerando o gene (A) normal e o gene (a) mutado e apresente os prováveis progenes.

numa célula em divisão meiótica.a) Quanto aos pares de alelos mencionados. 17 com flores púrpuras e grãos de pólen redondos. Questão 154 O esquema a seguir representa. 1. e justifique sua resposta.6 33 . Questão 156 Três grupos de alunos realizaram cruzamentos-testes entre plantas de tomate para o estudo de diferentes genes. considerando-se a Segunda Lei de Mendel (Lei da Segregação Independente). Essas freqüências fenotípicas obtidas não estão de acordo com o esperado. foi utilizada.5. Os grupos obtiveram os seguintes resultados: Atualmente.5. Todas as plantas produzidas tinham flores púrpuras e grãos de pólen longos. foram obtidas 160 plantas: 62 com flores púrpuras e grãos de pólen longos.3 Questão 155 Foram realizados cruzamentos entre uma linhagem pura de plantas de ervilha com flores púrpuras e grãos de pólen longos e outra linhagem pura. 15 com flores vermelhas e grãos de pólen longos. e se apresentaram para a identificação de herdeiros do casal citado. Nesses cromossomos. por técnicas que determinam a homologia entre amostras de DNA extranuclear. que tipos de gameta esta célula poderá formar? b) Que pares de alelos têm segregação independente? 1. b) netos e bisnetos de João e Maria que possuíram ou possuem o cromossomo Y idêntico ao de João e justifique sua resposta. B/b e D/d. Indique o número de: a) bisnetos do sexo masculino e do sexo feminino que poderiam ser identificados com aproximadamente 100% de certeza. a) De acordo com a Segunda Lei de Mendel. 66 com flores vermelhas e grãos de pólen redondos.5. dentre outras. a técnica de identificação por meio do estudo do DNA extranuclear. de toda essa família. nem ser possível a coleta de material genético dos membros falecidos da família. dois pares de cromossomos com três genes em heterozigose: A/a.6 1. Por não haver documentos legais comprobatórios da relação de parentesco.5. Cruzando-se essas plantas heterozigóticas com plantas da linhagem pura de flores vermelhas e grãos de pólen redondos. ocorreram as permutas indicadas pelas setas 1 e 2. quais são as freqüências esperadas para os fenótipos? b) Explique a razão das diferenças entre as freqüências esperadas e as observadas. apenas Maria e todos os seus bisnetos estão vivos. com flores vermelhas e grãos de pólen redondos.

faça o que se pede: a) Um casal (P1). Justifique. entre os genes pesquisados pelos alunos do grupo G2. também. poderá esperar descendentes (F1) com qual(is) genótipo(s)? b) Se um descendente (F1) se casar com um indivíduo sem aptidão para as três habilidades. Nessas condições. em frações decimais. Questão 157 Considere que os genes autossômicos. a freqüência dos genes dominantes e recessivos. Com base nessas informações. a) Como se denomina a situação mencionada? Supondo o cruzamento AB/ab com ab/ab b) Qual será a porcentagem de indivíduos AaBb na descendência? c) Qual será a porcentagem de indivíduos Aabb? Questão 159 Numa população de 100 pessoas. proposto por Thomas Hunt Morgan. e um indivíduo homozigoto dominante apresenta maior aptidão. um indivíduo heterozigoto apresenta aptidão mediana. matemática (M) e tocar guitarra (G). um indivíduo com genótipo recessivo não apresenta aptidão. qual será a porcentagem esperada de indivíduos de fenótipo dominante na próxima geração? Justifique suas respostas mostrando como chegou aos resultados numéricos.a) Indique o(s) grupo(s) que trabalhou (trabalharam) com genes ligados. mas com aptidão mediana para aprender matemática. ao se casar com um indivíduo com genótipo: Questão 158 1. Considere. havendo 10 unidades de recombinação (morganídeos) entre eles. b) O que significa. a) Expresse. 34 . deles resultando. Em um dado loco. que permitiria ao casal do item b ter filhos com aptidão mediana para aprender biologia mas sem aptidão para tocar guitarra? d) Quais os locos cuja herança não resultará em proporções segregantes dentro dos padrões da segunda Lei de Mendel? e) Uma mãe sem aptidão para aprender biologia e tocar guitarra. em unidades de mapa genético. identificados nos cromossomos (I e II). b) Quantos indivíduos são homozigotos? c) Suponha que nessa população os cruzamentos ocorram ao acaso.5. em média.6 Os locos gênicos A e B se localizam em um mesmo cromossomo. 36 são afetadas por uma doença genética condicionada por um par de alelos de herança autossômica recessiva. formado por um indivíduo triplo homozigoto dominante e outro triplo homozigoto recessivo. o termo ligação? Qual é a sua utilidade para a pesquisa científica? c) Calcule a distância. em Genética. terá 100% dos filhos(as) com aptidão no mínimo mediana para as três características. correspondam a aptidões para aprender biologia (B). qual a probabilidade desse casal ter uma criança com aptidão mediana para matemática? c) Qual o nome do mecanismo genético. que a característica em questão não altera o valor adaptativo dos indivíduos. igual número de descendentes.

a qual é letal para as pessoas homozigóticas AA. Esta erupção teria diminuído drasticamente a população de jabutis gigantes da ilha. Desses. onde p e q são as freqüências de dois alelos. determinada por um gene autossômico recessivo. p£+ 2pq + q£= 1. Qual das três possibilidades apresentadas NÃO pode ser aceita para explicar a variação na freqüência dos genes citados? Justifique sua resposta. a fenilcetonúria. ou estado estático. uma dessas crianças apresentou uma doença. uma das condições estabelecidas por Hardy e Weinberg para populações ideais foi seriamente afetada por uma erupção vulcânica ocorrida há cerca de cem mil anos. 3) Deriva ao acaso da freqüência gênica. Alguns mecanismos evolutivos que alteram a freqüência dos genes são: 1) Seleção natural. Questão 164 Uma população vegetal que NÃO está em equilíbrio de Hardy-Weinberg. foi de A= 80% e a=20%. Questão 162 A SOCIOBIOLOGIA procura explicar o comportamento dos indivíduos em função de sua herança genética. Com essa equação podemos calcular a freqüência de um genótipo sabendo a freqüência de um dos alelos. Dos 420 indivíduos de flores vermelhas. Qual o princípio científico dessa abordagem experimental? Questão 163 Pela equação Hardy-Weinberg. Calcule a freqüência de indivíduos de fenótipo normal portadores do gene causador da fenilcetonúria nessa população. a) Cite duas das condições propostas por Hardy e Weinberg para que o equilíbrio possa ser atingido. Em uma das ilhas do arquipélago de Galápagos. A freqüência dos genótipos desse grupo sangüíneo foi amostrada em duas populações humanas e os resultados são apresentados na tabela a seguir.Questão 160 Um determinado gene de herança autossômica recessiva causa a morte das pessoas homozigóticas aa ainda na infância. numa dada geração. principalmente em populações pequenas. Considere regiões geográficas em que a doença infecciosa é endêmica e regiões livres dessa infecção. Questão 166 O grupo sangüíneo MN é determinado por dois alelos codominantes. Na geração seguinte foi observada uma freqüência de A=60% e a=40%. Determine a freqüência dos genes V e a freqüência dos genes v nessa população. desde que a população esteja em equilíbrio.000 crianças. é composta por 500 indivíduos. 380 são homozigóticos (VV) e 40 são heterozigóticos (Vv). Um dos instrumentos mais utilizados nesses estudos é a pesquisa sobre o comportamento de gêmeos univitelinos que foram criados em ambientes diferentes. Numa determinada população em equilíbrio de Hardy-Weinberg nasceram 10. sem grandes alterações de seu reservatório genético. As pessoas heterozigóticas Aa são resistentes a uma doença infecciosa causada por um protozoário. uma população ideal deve atingir o equilíbrio. Questão 165 A freqüência gênica de dois alelos em uma população. ou vice-versa. 35 . b) Defina o conceito de evolução em função da freqüência dos genes de uma população e indique de que forma a diminuição da população afetou a evolução dos jabutis gigantes. 420 são de flores vermelhas (fenótipo dominante) e 80 são de flores brancas (fenótipo recessivo). Espera-se encontrar diferença na freqüência de nascimento de crianças aa entre essas regiões? Por quê? Questão 161 Segundo o Teorema de Hardy Weinberg. 2) Taxa de mutação gênica.

portanto. Indique o genótipo das pessoas do grupo sangüíneo O. caso exista. podendo-se.40 (40%) em uma população em equilíbrio. Despreze a parte fracionária de seu resultado. Com base nessas informações. um determinado gene apresenta-se em duas formas. Esse gene tem um alelo que não produz essa característica. isto é. respectivamente. Explique. para que uma população se mantenha em equilíbrio genético é necessário que ela se enquadre em certas condições. a) Qual a freqüência dos alelos A e a em cada uma das populações? b) Qual delas tem a maioria dos indivíduos homozigotos? Explique. a freqüência do referido gene na população. Considerando que tal população se encontre em equilíbrio genético. Usando o teorema de Hardy-Weinberg pode-se determinar as freqüências gênicas de uma população e demonstrar se a espécie está em equilíbrio. é de 0. alterando de forma brusca a freqüência do gene recessivo na população da ilha. Justifique sua resposta. A população 1 apresenta 90 indivíduos com genótipo AA. não é possível saber a freqüência do gene para cor amarela. b) Qual o nome dado a essa alteração brusca na freqüência gênica? Questão 168 Uma das maneiras de verificar se uma determinada espécie está ou não em evolução é fazer um estudo do patrimônio genético de suas populações. Um estudo dessa população determinou que a freqüência do fenótipo amarelo era de 50% e NÃO SE SABE se essa população está em equilíbrio de Hardy-Weinberg. Escreva quatro destas condições: 36 . 130 indivíduos com genótipo Aa e 25 indivíduos com genótipo aa. que determina o grupo sangüíneo O. Entretanto. Em uma amostra de 1000 pessoas desta população. sendo 36% dos indivíduos recessivos.7 Calcule a freqüência do alelo M nas duas populações e determine se a população da Europa como um todo é uma população panmítica. como a cor amarela. 1 e 2.Questão 169 Em uma população. a dominante e a recessiva. a) Após o desastre pode-se afirmar que a freqüência do gene recessivo será zero? Justifique sua resposta. com 400 alelos. Questão 172 Uma característica fenotípica de uma população. isto é. uma população em que os casamentos ocorrem ao acaso. aplicar o Princípio de Hardy-Weimberg.5. calcule. EM PORCENTAGEM. em estado de não-evolução. Mas um desastre ambiental provocou a morte de todos os indivíduos com a característica recessiva. 1. Questão 170 Considere duas populações diferentes. é determinada por um gene dominante. portanto. quantas se espera encontrar com sangue do tipo O? Explique as etapas que você seguiu para chegar à resposta. 40 indivíduos com genótipo Aa e 70 indivíduos com genótipo aa. A população 2 apresenta 45 indivíduos com genótipo AA. Questão 167 Numa determinada ilha existia uma população animal com indivíduos possuidores de uma característica normal e indivíduos possuidores de uma característica recessiva. numa proporção de 10:1. Questão 171 A freqüência do gene i. cada uma com 200 indivíduos diplóides.

1 A figura mostra o resultado da centrifugação do DNA das três amostras de bactérias.8.5. a quantidade de DNA separada na faixa inferior é X. TTT AAT GGG CAT a) Qual é a seqüência de bases da hélice complementar a esse segmento? b) Qual é a seqüência de bases do RNA mensageiro transcrito a partir desse segmento? Questão 179 Para funcionar como material genético o ácido desoxirribonucléico (DNA) apresenta a capacidade de autoduplicação. Questão 174 Bactérias (Escherichia coli) foram cultivadas durante várias gerações em um meio de cultura na qual toda a fonte de nitrogênio era o isótopo pesado ¢¦N. Utilizando seus conhecimentos sobre o material genético. na amostra C. responda aos itens adiante. Questão 176 Por que o processo de replicação do DNA é chamado semiconservativo? Questão 177 Dada a seqüência de bases nitrogenadas de um segmento de DNA: AAT GGC ATC responda: a) Qual é a seqüência de bases da hélice complementar a esse segmento? b) Qual é a seqüência de bases do RNA mensageiro transcrito a partir desse segmento? Questão 178 Dada a seqüência de bases nitrogenadas de um segmento de DNA a seguir. Que outras bases nitrogenadas devem existir neste DNA e em que proporções? Justifique sua resposta. na amostra B. Que outras bases nitrogenadas devem existir neste DNA e em que proporções? 1. quando as bactérias completaram uma divisão celular nesse novo meio e uma terceira amostra (amostra C). O DNA das bactérias das amostras B e C foi também extraído e centrifugado. extraiu-se o DNA que foi submetido a uma técnica de centrifugação que permite separar moléculas de DNA de acordo com sua densidade. De uma amostra dessas bactérias (amostra A).Questão 173 No DNA de um organismo. a) Por que. 20% das bases nitrogenadas são constituídas por adenina. todo o DNA tem uma densidade intermediária entre o que é constituído apenas por ¢¥N e o que contém apenas ¢¦N? b) Considerando que. 18% das bases nitrogenadas são constituídas por citosina. responda: a) Qual a importância de o DNA autoduplicar-se? b) Por que essa replicação é semiconservativa? Questão 180 No DNA de um organismo. quando as bactérias completaram duas divisões celulares. que quantidade de DNA há na faixa superior? Questão 175 Quais são as duas propriedades fundamentais do DNA que permitem a essa substância desempenhar o papel de material genético? 37 . Retirou-se uma segunda amostra (amostra B). O restante das bactérias foi transferido para um meio de cultura em que todo o nitrogênio disponível era o isótopo normal ¢¥N.

1.AUTODUPLICAÇÃO II . Questão 183 O que são NUCLEOTÍDEOS? Quais são as moléculas que entram em sua composição química? Questão 184 Quais são as diferenças observadas nos nucleotídeos que entram na composição do DNA em relação aos que entram na composição do RNA? Questão 185 O que representa o desenho a seguir? Qual o nome das moléculas representadas pelos números 1. Que outras bases nitrogenadas possui essa molécula e em quais proporções? Questão 188 Os ácidos nucléicos são macromoléculas definidas como polinucleotídeos. a) Represente um nucleotídeo apontando seus três constituintes moleculares. o que representam os números 1.1 Questão 182 Justifique o termo SEMICONSERVATIVO para caracterizar o processo de replicação do DNA. 2 e 3 respectivamente? Questão 190 Sabendo-se que numa molécula de DNA formada por uma dupla hélice há 21% de timina.8. responda quais são as outras bases dessa molécula e em que proporções ocorrem. sabendo que se trata da unidade estrutural do ácido desoxirribonucléico (DNA)? Questão 187 Uma molécula de DNA contém 15% de guanina.TRANSCRIÇÃO Explique essas duas propriedades.5.5. b) Quais são as diferenças observadas nos nucleotídeos que entram na composição do DNA em relação aos que entram na composição do RNA? Questão 189 1. São elas: I . 2 e 3. que representa a estrutura da molécula de DNA. respectivamente.8. Questão 186 No desenho a seguir.Questão 181 Mencione duas diferenças de natureza molecular entre o DNA e o RNA.1 Para funcionar como material genético o DNA apresenta duas propriedades fundamentais. 38 .

foram comparadas as características genotípicas e fenotípicas de células retiradas de um tecido de anfíbio. sendo. com as de células de tecido similar do mesmo indivíduo após atingir a idade adulta. se o nucleosídeo radioativo usado fosse a timidina e justifique sua resposta. Após algum tempo. Os capítulos contam diferentes detalhes da saga do homem na terra: suas andanças pelos continentes. ainda no estágio de girino.. adicionou-se o nucleosídeo uridina marcado radioativamente com H¤ ao meio de cultura. (adaptado de. "O Globo") a) Explique por que o processo de autoduplicação do DNA dá significado à hereditariedade permitindo revelar a história da evolução da humanidade.8. casamentos ancestrais e os ataques de doenças. 15 e 90 minutos após a transferência. 39 . casamentos ancestrais e os ataques de doenças" podem ser estudados Em células eucariotas mantidas em cultura. Justifique sua resposta. Esse processo marca a posição aproximada do isótopo dentro da célula. 32% das bases nitrogenadas são constituídas por citosina. as células foram transferidas para um novo meio que não continha o isótopo. Nomeie o processo através do qual o DNA é capaz de controlar e interferir nas características morfológicas e fisiológicas da célula.5. conservado em tanques de nitrogênio líquido que guarda informações desconhecidas sobre a humanidade. Questão 196 Num experimento. Questão 195 a) Quais são as bases da cadeia complementar a esse segmento? b) Se o segmento dado servir de molde para a produção de RNA. como representado no esquema a seguir. 1. Amostras destas células foram retiradas 3.. colocadas em lâmina de vidro. então. b) as características fenotípicas são diferentes. Explique por que. suas andanças pelos continentes.1 a) Cite o tipo de molécula à qual a uridina se incorporou.Questão 191 Considere um segmento de DNA com a seguinte seqüência de bases nitrogenadas: ATT CTA CGC AAA GGC através de observações de características morfológicas e fisiológicas da célula. b) ". fixadas e submetidas a auto-radiografia. entre essas células: a) as características genotípicas são iguais. Que outras bases nitrogenadas devem existir neste DNA e em que proporções? Questão 194 CÉLULAS IMORTAIS CONTAM AOS CIENTISTAS HISTÓRIA DA EVOLUÇÃO DA HUMANIDADE Estas células formam um livro. qual será a seqüência de bases desse RNA? Questão 192 Considere a seqüência de bases nitrogenadas de um segmento de DNA: AAA GGC ATT Responda: a) Qual é a seqüência de bases da hélice complementar a esse segmento? b) Qual é a seqüência de bases do RNA mensageiro transcrito a partir desse segmento? Questão 193 No DNA de um organismo. b) Nomeie o compartimento celular que seria marcado.

aproximadamente 43 dias! Sabemos. II) cuja mulher é cega e o homem é normal. Assim. lança-se mão do DNA mitocondrial. usa-se um marcador do cromossomo Y. a investigação dos ancestrais paternos.Questão 197 Para desempenhar sua função como material hereditário. Isto significa que cada indivíduo possui variações discretas e características na seqüência de seu DNA. mas sim o gene mutado. para replicar todo o genoma de uma bactéria.coli" é de cerca de 20 minutos. Por que o DNA mitocondrial deve ser usado para a análise matrilínea? Questão 202 No ADN. cuja velocidade de reação é equivalente a cerca de 800 nucleotídeos/s. Por outro lado. Identifique-as e descreva resumidamente cada uma delas. o DNA possui duas propriedades. a seqüência de nucleotídeos transcrita pode estar em uma cadeia. a seqüência de nucleotídeos do DNA de cada pessoa é única (excetuando-se o caso de gêmeos monozigóticos). para o genoma humano. que o tempo de geração da "E. Para se realizar uma análise patrilínea. que não se altera ao longo das gerações (salvo em casos de mutações). a tipagem do DNA revela um padrão de bandas que é estável (presente no DNA de todos os tecidos) e é transmitido aos descendentes seguindo as leis de Mendel. ou seja. Para alguns genes. a DNA polimerase consumiria cerca de 83 minutos e. Questão 200 O teste de tipagem de DNA revelou que nos seres humanos existe individualidade genômica. um amigo o aconselha a receber uma transfusão de sangue 2 meses antes do teste (em geral colhe-se o sangue como fonte de células nucleadas). e que o tempo médio de replicação de uma célula eucariota é de 12 horas. para uma análise matrilínea (materna). Sabe-se que todas as mitocôndrias dos indivíduos afetados pela cegueira não possuem o gene normal. sabe-se que no mesmo trecho nunca ocorre a transcrição simultânea das duas cadeias de uma molécula de ADN. a) Informe a percentagem de filhas e filhos cegos de um casal: I) cuja mulher é normal e o homem é cego. isto é. a transcrição dos genes não está restrita a somente uma das suas cadeias. Graças a essas características é possível atualmente realizar testes de paternidade que comparam os padrões de bandas de DNA das pessoas e revelam se um homem é de fato o pai biológico de uma outra pessoa. Questão 199 O genoma da bactéria "Escherichia coli" tem um tamanho de 4×10§ pares de nucleotídeos. Suponha agora a seguinte situação: um homem acusado de ser o pai de uma criança tenta burlar o teste de tipagem de DNA. Questão 198 A mutação em um gene humano provoca cegueira. explique essa aparente contradição. Tal evento inibiria 40 . Com a utilização de técnicas de genética clássica e molecular. Assim. Já o genoma haplóide humano tem 3×10ª pares de nucleotídeos. a) Qual a influência da transfusão sugerida no resultado no exame? b) Que precauções podem ser tomadas para desmascarar a tentativa de fraude? Questão 201 A tipagem de DNA é uma técnica desenvolvida recentemente que permite identificar e estabelecer o grau de parentesco entre indivíduos. antes da divisão celular. verificou-se que este gene está localizado no genoma mitocondrial. a DNA polimerase. No entanto. Para replicar o genoma. no entanto. ao passo que a seqüência do outro gene pode estar localizada na cadeia oposta. b) Justifique as respostas ao item a. existe uma enzima. Assumindo que a DNA polimerase apresenta uma velocidade de reação constante para todas as espécies analisadas.

citosina (C). Explique as porcentagens obtidas em todos os extratos das diferentes culturas no experimento. no mesmo trecho. 23% de timina. b) Explique por que é impossível prever a proporção de citosina presente no ARN mensageiro codificado por esse trecho de ADN. .000 anos.Cultura de 1 geração com ¢¥N: 600 moléculas de DNA todas com ¢¦N e ¢¥N. obtém-se o crescimento de colônias de bactérias. em cultura com ¢¥N.o processo da tradução. após esse crescimento promove-se o desenvolvimento de mais duas gerações.Cultura de crescimento com ¢¦N: 300 moléculas de DNA todas com ¢¦N. . nessa molécula. Explique por que a maior diversidade do DNA mitocondrial apóia a idéia da origem africana do 'Homo sapiens'. 2 etapa: Extrai-se o DNA de todas as bactérias e obtém-se o seguinte resultado: Questão 206 A análise química de duas moléculas de DNA revelou a seguinte composição de bases: Molécula A 23% de adenina. Esses resultados foram importantes para corroborar a idéia de que o ancestral comum mais recente do 'Homo sapiens' viveu na África há cerca de 200. Questão 205 Considerando as propriedades de duplicação do DNA.1 41 . 27% de citosina e 27% de guanina. Questão 203 Estudos recentes compararam as seqüências completas de DNA mitocondrial de indivíduos de várias regiões geográficas do planeta. Justifique sua resposta. Explique por que ocorreria a inibição da tradução se a transcrição de uma cadeia do ADN ocorresse ao mesmo tempo que a transcrição da sua cadeia complementar. 23% de timina.8. Com base nestes dados: a) O que se pode afirmar a respeito das semelhanças entre estas duas moléculas de DNA? b) Justifique sua resposta. 27% de citosina e 27% de guanina. Molécula B 23% de adenina.5. observe o resultado do experimento a seguir. 1. guanina (G) e timina (T). Questão 204 A soma das porcentagens de guanina e citosina em uma certa molécula de ADN é igual a 58% do total de bases presentes. . 1 etapa: Em uma cultura com ¢¦N. a) Indique as porcentagens das quatro bases.Cultura de 2 geração com ¢¥N: 1200 moléculas de DNA nas quais 600 com ¢¥N e 600 com ¢¦N e ¢¥N. Os resultados revelaram que a variabilidade genética no DNA mitocondrial de indivíduos africanos era quase o dobro da observada no DNA mitocondrial de não-africanos. adenina (A).

b) Que relação existe entre DNA.5. A marcação radioativa foi detectada dentro destas bactérias.Questão 207 A análise química em amostras de cinco lâminas com ácidos nucléicos apresentou os seguintes resultados: 1Ž lâmina: ribose 2Ž lâmina: uracila 3Ž lâmina: dupla-hélice 4Ž lâmina: timina 5Ž lâmina: 15% de guanina e 25% de citosina. planta ou bactéria. Questão 208 Em 1952. 42 . Hershey e Chase cultivaram bactérias em meio de cultura contendo fósforo radioativo (¤£P) e colocaram bacteriófagos (vírus) para infectar essas células. Explique a que correspondem os "corrimãos" e os "degraus" dessa escada. Questão 209 Em 25 de abril de 1953. quais se referem a DNA? b) Justifique o resultado obtido com a 5Ž lâmina. ressaltando a interação entre as duas cadeias do polímero. será de qual deles? b) Justifique sua resposta. Os novos bacteriófagos formados estavam marcados radioativamente.8. 1. guanina e timina. respectivamente. RNA e síntese protéica? c) Como podemos diferenciar duas proteínas? Questão 210 Cientistas criaram em laboratório um bacteriófago (fago) composto que possui a cápsula protéica de um fago T2 e o DNA de um fago T4. G & T representam as bases adenina. a) Watson e Crick demonstraram que a estrutura do DNA se assemelha a uma escada retorcida. Questão 212 A figura a seguir mostra um trecho da estrutura do ácido desoxiribonucléico. um estudo de uma única página na revista inglesa Nature intitulado "A estrutura molecular dos ácidos nucléicos". Após esse bacteriófago composto infectar uma bactéria. que faz com que a produção de energia para os músculos seja deficiente. A. ocasionando dificuldades motoras para os portadores do problema. a) Entre estas lâminas. James Watson e Francis Crick descobriram a estrutura do DNA. C. que permitiu posteriormente decifrar o código genético determinante para a síntese protéica. pintando quais serão as pessoas afetadas pela doença em F1 e em F2 b) Justifique sua resposta. também tiveram filhos (F2). por sua vez. rato. Na figura. Questão 211 No heredograma seguinte. Essa pessoa casou-se com outra. aparentemente normal. a pessoa A possui uma mutação no DNA de todas as suas mitocôndrias. revolucionou para sempre todas as ciências da vida sejam elas do homem. os fagos produzidos terão a) a cápsula protéica de qual dos fagos? E o DNA. citosina. quase ignorado de início.1 a) Copie o heredograma. em vez de fósforo. os resultados seriam os mesmos? Justifique. Estes bacteriófagos marcados foram utilizados para infectar outras células bacterianas cultivadas sem a presença de fósforo radioativo. a) Como se explica que o fósforo radioativo tenha passado para o bacteriófago? b) Como se explica que as bactérias cultivadas sem a presença de fósforo radioativo tenham sido marcadas? c) Se. tivesse sido usado enxofre radioativo (¤¦S) para marcação de proteínas. O casal (P) teve filhos (F1) e estes.

8.1 Questão 215 Observe o esquema adiante e responda: As linhas pontilhadas indicam as pontes de hidrogênio que são formadas entre as bases aminadas e que contribuem para manter unidas as duas cadeias do DNA. 1.1 . responda o que representam os componentes 1.5. o que produz a dissociação das cadeias. utilizou-se uma técnica na qual o gene que codifica a enzima citada foi inserido. é a principal responsável pela maturação de frutos como o tomate. A temperatura necessária para desnaturar o DNA depende de vários fatores. respectivamente. b) Qual é o nome dessa unidade estrutural? Questão 216 Uma cadeia de RNA tem 200 nucleotídeos. Essas pontes de hidrogênio podem ser rompidas por calor.8. Quantos nucleotídeos tinha o DNA que originou esse RNA? Questão 217 Um segmento de RNA mensageiro apresenta a seqüência de bases nitrogenadas a seguir: AAA UUC GGG GAU. 43 1. 2 e 3. no genoma de um tomateiro. de maneira invertida.Questão 214 Que papéis desempenham o RNA mensageiro e do RNA transportador no processo de síntese das proteínas? 1.8. mas um deles é a composição dos nucleotídeos de um determinado DNA. 1) ACTTTAAAGATATTTACTTAAA TGAAATTTC TATAAATGAATTT 2) GCTAGGCCGATGCGGCGTGGA CGATCCGGCTACGCCGCACCT Questão 213 Considerando o modelo da estrutura molecular do DNA como representado na figura adiante. respectivamente.5. a) Quais são as bases do segmento de DNA que deu origem a esse RNA? b) Quantos nucleotídeos existem no DNA que deu origem a essa molécula de RNA mensageiro? Questão 218 A enzima poligalacturonase. que digere a parede celular de células vegetais. Para retardar o amadurecimento e evitar as perdas durante o armazenamento. Justifique a sua resposta. Esse processo reversível chama-se de desnaturação.2 ) Quais são as moléculas representadas pelos números 1.5. Observe as duas seqüências de DNA a seguir e determine qual delas precisará de uma temperatura de desnaturação maior. sabendo-se que trata-se da unidade estrutural do ácido ribonucléico (RNA). 2 e 3.

representado a seguir. B e C? b) Como será o fenótipo (normal ou afetado dos indivíduos A. O hábito de fumar expõe os fumantes a substâncias com atividade carcinogênica.5.5. Indique as alterações que ocorrerão na síntese da proteína X quando a mutação for localizada nos diferentes sítios. Considere que o RNA mensageiro seja formado a partir das trincas mostradas no esquema da figura 1 a seguir. B e C têm mutações em um segmento de DNA desse gene. Usando a tabela que relaciona alguns codons aos respectivos aminoácidos e considerando que a fita molde a ser transcrita é aquela assinalada com a letra m. O Benzo[a]pireno. responda: a) Quais serão os segmentos de proteínas produzidos.3 a) Descreva a interação que ocorre entre os produtos da transcrição dos genes normal e inserido no tomate geneticamente modificado e indique a característica dessas moléculas que permite a interação.8.2 1. ambos ativos nesse tomate geneticamente modificado. B e C? Por quê? Seqüência normal CAA AAC TGA GGA ATG CAT TTC (m) GTT TTG ACT CCT TAC GTA AAG Indivíduo A CAA AAC TGA GGA ATT CAT TTC (m) GTT TTG ACT CCT TAA GTA AAG 44 Questão 221 O fumo está relacionado ao aumento de risco para o câncer de pulmão. possa ser alterado em presença do Benzo[a]pireno. em um dos dois sítios indicados na figura 1. justificando cada resposta com a utilização do código genético da figura 2: . Indivíduo B CAT AAC TGA GGA ATG CAT TTC (m) GTA TTG ACT CCT TAC GTA AAG Indivíduo C CAA TAC TGA GGA ATG CAT TTC (m) GTT ATG ACT CCT TAC GTA AAG 1. pelos indivíduos A. cuja seqüência normal está representada a seguir. Suponha que um trecho da fita molde de DNA do gene X.O esquema adiante mostra os produtos da transcrição do gene normal da enzima e do gene inserido. um dos principais agentes carcinogênicos presentes na fumaça do cigarro. tem a capacidade de promover mutações no DNA levando a mudança da base Guanina para Timina. Questão 219 De que maneira o DNA determina a seqüência de aminoácidos das moléculas de proteínas? Questão 220 Uma doença genética de herança dominante é causada por mutações em um gene localizado em um autossomo.8. b) Explique por que haverá um aumento no tempo de amadurecimento desse tomate geneticamente modificado. respectivamente. Os indivíduos A.

cuja seqüência de nucleotídeos é 5' . é sempre possível deduzir-se a seqüência de aminoácidos de uma proteína a partir da seqüência de nucleotídeos do seu gene. isto é. Questão 225 O DNA dos organismos do planeta Zbohrnya é constituído pelos mesmos 4 tipos de bases dos seres vivos terrestres.5. do tipo substituição. 1. a) As proteínas A. 13.8.GAG .8. 1.5.GTG . utilizando-se da tabela do código genético apresentada a seguir. 45 .CAC . faça uma comparação entre a diversidade dos organismos encontrados nesses dois planetas. b) Sabendo que a vida em Zbohrnya e na Terra existe há 3.Por que sempre encontramos N > P ? Questão 224 1.CCT .3 b) Utilize um exemplo de alteração estrutural da globina humana (cadeia beta) para explicar como uma mutação pontual. Um gene é constituído por um número N de nucleotídeos que codifica uma proteína constituída por P aminoácidos.ACT .3' e. pode afetar a saúde e a qualidade de vida do portador dessa mutação. a proteína produzida pela expressão desse gene será idêntica à da espécie zbohrniana? Justifique sua resposta. o oposto não é verdadeiro. a) Considere o segmento de DNA. Questão 223 O ADN é um polímero constituído por vários nucleotídeos e as proteínas são polímeros constituídos por vários aminoácidos. ou do RNA-m correspondentes. B e C. Explique por quê. 16 e 19 tipos diferentes de aminoácidos.3 Com o auxílio da tabela do código genético representada a seguir. forneça o produto da síntese protéica (polipeptídio parte da cadeia beta prevista para a globina humana). apresentam. Explique a possibilidade da ocorrência dessas três proteínas nos seres de Zbohrnya.3 Entretanto.5. a partir da seqüência de aminoácidos de uma proteína. respectivamente. não se pode deduzir a seqüência de nucleotídeos do gene. Questão 222 As globinas constituem um bom exemplo da importância da informação genética na estrutura primária e na função das proteínas. encontradas nos organismos da Terra.CTG .8.GAG . c) Se o gene de uma proteína respiratória de um organismo zbohrniano for introduzido numa bactéria terrestre. Já o código genético desses organismos é determinado por códons de 2 bases.5 bilhões de anos.AAG .

5. corresponde ao aminoácido metionina. por uma purina. no polipeptídio codificado por esse gene. após uma deleção do TERCEIRO nucleotídeo? Questão 228 A seguir está representada a seqüência dos 13 primeiros pares de nucleotídios da região codificadora de um gene. a deleção do par de bases T = A)? 46 . esse código segue o padrão do código genético universal.8. originado pela perda do sexto par de nucleotídios (ou seja.T A C T C A A C C G G A C --A primeira trinca de pares de bases nitrogenadas à esquerda. a) Determine a seqüência de bases do RNAm que foi utilizado para sintetizar o polipeptídeo esquematizado abaixo da tabela.3 Analise a tabela e faça o que se pede: a) Cite o nome da enzima que catalisa a síntese de RNA mensageiro.3 a) Escreva a seqüência de bases nitrogenadas do RNA mensageiro.A T G A G T T G G C C T G ----. b) Se ocorresse uma substituição. b) Cite a seqüência do anticódon correspondente ao códon de iniciação.8.8. d) Qual a seqüência de aminoácidos que resultará da tradução da mesma molécula de mRNA. contendo códigos de trincas de bases do DNA com os aminoácidos correspondentes. c) Qual seria a seqüência dos três primeiros aminoácidos de um polipeptídio codificado por um alelo mutante desse gene.4 1. transcrito a partir desse segmento de DNA. indique a seqüência dos três aminoácidos seguintes à metionina. c) Qual a seqüência de aminoácidos que resultará da tradução da molécula de RNA mensageiro? Ver figura anterior. 1. Entretanto.Questão 226 Considere a tabela abaixo. b) Utilizando a tabela de código genético fornecida.5. --. no qual três bases codificam um aminoácido. na 3 base do código correspondente ao 6Ž aminoácido do polipeptídeo. para resolver os itens seguintes: 1.5. A tabela a seguir mostra alguns códons do RNA mensageiro e os aminoácidos codificados por cada um deles. qual seria o aminoácido da tabela a ser incorporado? c) Qual é anticódon correspondente ao novo aminoácido incorporado? Questão 227 A tabela adiante representa uma versão fictícia do código genético.

.Questão 229 Sabendo-se que um determinado segmento de DNA apresenta capacidade de transcrever e que apresenta a seqüência de bases TAC TCC GCT TAG e. para sua replicação. e os que são RNA (+). a partir desse RNA? Questão 231 Ribossomos são formados por RNA e proteínas. As regiões do ARN transcrito correspondentes aos íntrons são eliminadas após o processo de transcrição. a) Onde esses processos ocorrem na célula eucariótica? b) O que acontecerá com os processos de transcrição e tradução. se ocorrer uma destruição do(s) nucléolo(s) de uma célula?.nos vírus RNA (+). a) Explique por que é necessário. 47 .nos vírus RNA (-). mas a enzima só é encontrada nas partículas virais RNA (-). no ribossomo. encontramos aqueles que são RNA (-). em sua cadeia complementar. para sua replicação. Nesse gene existem íntrons. .o gene da enzima RNA replicase está presente no genoma dos dois tipos de vírus. da enzima RNA replicase. quais poderiam ser as seqüências de bases do RNA por ele produzido? Questão 233 Analisando o genoma de alguns tipos de vírus formados por fita simples de RNA.ambos os vírus necessitam. respectivamente. A figura a seguir representa o resultado de uma experiência de hibridação do ARN mensageiro com a cadeia de ADN que lhe deu origem. foram precursores das primeiras células. Questão 232 Sabendo-se que um determinado segmento de DNA apresenta capacidade de transcrever e que apresenta uma seqüência de bases ACTCCGCTT / TGAGGCGAA. a seqüência ATG AGG CGA ATC. que os vírus RNA (-) já contenham a enzima RNA replicase. quais são as seqüências de bases de RNAm por ele produzido? Questão 230 Dado um segmento de RNA mensageiro com a seguinte seqüência de bases: AAU GUA GGC pergunta-se: a) Qual a seqüência de bases do DNA que deu origem a esse RNA? b) Quantos aminoácidos terá o polipeptídeo traduzido. todas as células possuem um genoma idêntico. regiões do ADN cujas informações não estão presentes na proteína em questão. como no caso dos seres humanos. apenas o RNA complementar a seu genoma é capaz de funcionar como mensageiro na célula infectada. devido à simplicidade de sua estrutura. que sintetiza um RNA complementar a um molde de RNA. como o do resfriado comum. Questão 234 Em um organismo pluricelular com vários tecidos. enquanto os RNA (+) não precisam armazenar esta enzima. é correto afirmar que os ARN mensageiros (ARNm) dos diferentes tecidos são todos idênticos? Justifique sua resposta Questão 235 Suponha um gene de um eucarioto responsável pela síntese de uma proteína. Observe que: . . ou seja. sintetizados pelos processos de transcrição e tradução. o genoma viral funciona diretamente como mensageiro. como o da poliomielite. Analogamente. b) Apresente um argumento contrário à hipótese de que os vírus.

Levando-se em consideração essas informações. a partir de uma seqüência de DNA. Quais dessas regiões correspondem aos íntrons? Justifique sua resposta. b) A partir de uma proteína.8. Na tabela a seguir. e uma terceira classe de genes que não codificam polipeptídios. que servirá de molde para a fita de RNA mensageiro. Questão 239 Atualmente os genes podem ser desmembrados em três classes diferentes: os genes que expressam mRNA que codificam polipeptídios diversos.09.2002) noticiou que um cientista espanhol afirmou ter encontrado proteínas no ovo fóssil de um dinossauro que poderiam ajudá-lo a reconstituir o DNA desses animais. responda. demonstrando como.8. Qual o produto final da classe de genes que não codificam polipeptídios? Questão 240 O que são ácidos nucléicos? Como atuam na síntese de proteínas? Questão 241 A figura mostra cinco regiões.Paulo" (23.5 48 . Questão 238 O jornal "Folha de S.1. há 30 timinas e 20 guaninas. Questão 236 Em um segmento da cadeia ativa de DNA.5. Questão 237 Considere um fragmento de DNA com a seguinte seqüência de bases: GTA GCC TAG e responda: a) Qual será a seqüência do RNAm transcrito a partir deste DNA? b) O mesmo peptídio será obtido a partir deste RNAm e do RNAm da fita complementar? Explique.5. No segmento correspondente da fita complementar do DNA há 12 timinas e 10 guaninas. formado por palavras e setas. a) Quantas uracilas e quantas guaninas comporão a fita do RNA mensageiro transcrito do DNA ativado? b) Quantos aminoácidos deverão compor a cadeia de polipepitídeos que será formada? Justifique sua resposta. o sinal (+) significa crescimento. obtém-se uma proteína. é possível percorrer o caminho inverso e chegar à seqüência de DNA que a gerou? Justifique.4 a) Faça um esquema simples. os genes reguladores que codificam proteínas que regulam outros genes. e o sinal (-) significa ausência de crescimento. 1. identificadas por números de 1 a 5. Certos mutantes nutricionais do fungo Neurospora só conseguem crescer quando aminoácidos são adicionados ao meio de cultura.

Questão 243 Quais os papéis do gene e do ribossomo na síntese das proteínas celulares? Questão 244 Para investigar possíveis efeitos de uma determinada droga. explique a atuação dos antibióticos I e II sobre a síntese protéica. após sintetizadas.8. a) Considere as etapas de replicação. à qual foram adicionadas quantidades adequadas das seguintes substâncias.5 Com base nos gráficos. Os resultados do experimento estão mostrados no gráfico a seguir.GAC de um segmento de DNA. transcrição e tradução nas células analisadas. As setas nos gráficos indicam o momento em que foram administrados os antibióticos nas culturas. respectivamente os aminoácidos arginina. então. b) As proteínas. leucina e treonina. Questão 245 Diversas técnicas são utilizadas para determinar. em organismos eucariotos. CUG. Questão 246 Os gráficos a seguir representam o efeito inibitório de dois antibióticos (I e II) sobre a síntese protéica em culturas de 'Staphylococcus aureus'. consiste em.8. e ACU do RNA mensageiro codificam. A abordagem experimental mais freqüente. adquirem uma conformação tridimensional. Após algum tempo.5. é preferível utilizar o RNA-mensageiro para determinar a região codificante do DNA. Escreva esses aminoácidos na ordem correspondente à seqüência TGA . Ao longo do experimento. marcadas com isótopos: uridina ¢¥C. Em uma bactéria. explique o porquê do mutante Z só crescer quando se adiciona arginina ao meio de cultura.TCT . no entanto. em genes de uma célula eucariota.Sabe-se que as etapas que levam à síntese da arginina são: substrato ë (gene1) ë ornitina ë (gene2) ë citrulina ë (gene3) ë arginina Supondo que em cada mutante há apenas um gene alterado. primeiramente. ou seja. Questão 242 Os códons AGA. aquela que define a estrutura primária da proteína a ser sintetizada. Explique o motivo pelo qual. timidina ¤H e leucina ¢¦N. hoje. 49 . extrair os RNA-mensageiros da célula.5 1. Cite duas ligações ou interações que atuam na manutenção da estrutura enovelada das proteínas. Indique se a droga interfere em cada uma dessas etapas e justifique suas respostas. amostras das células foram coletadas a intervalos regulares.5. a droga foi também introduzida no meio de cultura. sintetizar os seus DNA-complementares e. é possível determinar a seqüência codificante diretamente a partir de seu cromossomo. proceder ao seqüenciamento das bases presentes nesses DNA. a seqüência de bases nitrogenadas codificantes. 1. utilizou-se uma cultura de células. A incorporação dos isótopos foi medida em uma preparação que contém os ácidos nucléicos e as proteínas da célula.

. quando se iniciavam as pesquisas sobre como o DNA codificava os aminoácidos de uma proteína. além do código AUG. em azul. permite que o sítio correto de iniciação da tradução seja selecionado.Nesse sistema. ACG. . UUA treonina . b) Todas as células. 1.GAG. o sinal para o início da síntese das proteínas (tradução) é geralmente sinalizado no ARNm pelo códon AUG. porém no qual haviam todos os componentes necessários à síntese protéica..5 Explique a importância desse duplo controle da iniciação para a tradução correta da mensagem contida no ARNm.valina-histidina-leucina-treonina-prolina-ácido glutâmico.valina-histidina-leucina-treonina-prolina-x. essa cadeia de DNA sempre produzia uma proteína com um único tipo de aminoácido.8. Os códons de RNA-m que codificam esses aminoácidos são: valina . CCC. A seqüência de Shine-Dalgarno está em vermelho e o códon de iniciação.GUU. CCA ácido glutâmico . GUG.8. em homenagem aos pesquisadores que as detectaram... Essa seqüência. que diferem apenas em um aminoácido: Hemoglobina A: . serão anômalas? Justifique sua resposta. ACC. cada uma delas com um único tipo de aminoácido: serina ou alanina 50 a) Qual é o aminoácido que aparece. a partir da célula que sofre a mutação.... Questão 249 Nos anos 50 e 60.5 .Essa cadeia de DNA foi usada em um sistema livre de células. Hemoglobina S: . . incluindo os diferentes aminoácidos.Sintetizaram uma cadeia de DNA com três nucleotídeos repetidos muitas vezes em uma seqüência conhecida: . CAC leucina . Diferentes repetições do experimento demonstraram que até três proteínas diferentes poderiam ser produzidas. ACA prolina .ACU. que é chamada de Shine-Dalgarno.AGCAGCAGCAGCAGCAGCAGCAGC.CCU. Essa pequena diferença é suficiente para determinar que uma pessoa portadora de hemoglobina S sofra de anemia falciforme. na hemoglobina S. O diagrama a seguir ilustra a localização dessa seqüência.UUG.5. no lugar do ácido glutâmico? Justifique sua resposta. existe uma seqüência curta de nucleotídeos que antecede esse códon.5. GAA A mutação pode ocorrer no ADN como mostra o esquema a seguir: Questão 248 Nos procariotos..Questão 247 Na espécie humana há dois tipos de hemoglobinas.... conhecidas como hemoglobinas A e S.CAU.. CCG. No entanto. que corresponde ao aminoácido metionina. GUC. GUA histidina . . um grupo de pesquisadores desenvolveu o seguinte experimento: 1.

a) Considerando que tenha ocorrido a ação da DNA-polimerase. qual será a seqüência de bases do RNA resultante e que nome recebe esse RNA se ele traduzir para síntese de proteínas? Questão 254 1.5.8. segundo. a lactose não é tão facilmente incorporada pelas bactérias. Questão 252 O esquema a seguir representa a seqüência de reações que levam à formação do pigmento da pelagem de uma espécie animal.5 a) Quantos nucleotídeos são necessários para codificar a seqüência de aminoácidos nas espécies 1 e 2? Justifique. b) Pode-se dizer que seqüências idênticas de aminoácidos são sempre codificadas por seqüências idênticas de nucleotídeos? Justifique. B e C são responsáveis pela produção das enzimas A. Questão 253 Uma fita de DNA tem a seguinte seqüência de bases 5'ATGCGT3'. a) Por que as proteínas obtidas possuíam apenas um tipo de aminoácido? b) Por que foram obtidos 3 tipos de proteínas? Questão 250 O metabolismo celular é controlado por uma série de reações em que estão envolvidas inúmeras proteínas.5 a) Do ponto de vista genético. 1. B e C produzem respectivamente os alelos recessivos a.ou glutamina. em quatro espécies próximas.8. B e C que atuam nesse processo metabólico. Isso se deve a dois fatos: primeiro. 3 e 4 se originaram da espécie 1. quantos tipos de albinismo podem ocorrer nessa espécie? Por quê? b) Demonstre o fenótipo esperado de um cruzamento entre animais de linhagens puras com dois tipos diferentes de albinismo. levando a mudanças no ciclo de vida da célula.5. b) Por que podem ocorrer alterações nas proteínas quando o gene sofre mutação? c) Em que situação uma mutação não altera a molécula protéica? Questão 251 Abaixo estão esquematizadas as seqüências de aminoácidos de um trecho de uma proteína homóloga. porque a lactose necessita ser 51 . Cada letra representa um aminoácido. Uma mutação gênica pode determinar a alteração ou a ausência de algumas dessas proteínas. que tipo de mutação originou cada seqüência? Sabe-se que a bactéria 'E. Os genes autossômicos A. c) É possível ocorrer uma mutação em um gene sem que se altere a enzima correspondente? Justifique. Mutações nos genes A. a) Explique a relação que existe entre gene e proteína. b e c. c) Considerando que as espécies 2.coli' cresce mais rapidamente na presença da glicose (um monossacarídeo) do que na presença de lactose (um dissacarídeo). qual será a seqüência de bases da fita complementar? b) Se a fita complementar for usada durante a transcrição.

O gráfico a seguir resultou de experimento em que 'E. a) É possível a reprodução dos zigotos pela via da reprodução sexuada? Justifique sua resposta. a formação de um zigoto híbrido. conhecido como "experiência do liquidificador" na qual utilizaram isótopos radioativos de enxofre (S¤¦) e de fósforo (P¤£) para 'marcar' vírus parasitas de bactérias. bem como suas conclusões a partir deste trabalho. patogênicas. Questão 260 O esquema a seguir mostra. de que o "agente transformante" capaz de permitir o desenvolvimento da cápsula em pneumococos não-capsulados era o ácido desoxirribonucléico? Questão 257 O que são bacteriófagos? Qual sua importância na identificação do DNA como material genético? 1. simplificadamente. a concentração de glicose e o número de bactérias no meio de cultura em função do tempo.5 Identifique as curvas da figura. concentração de glicose e número de bactérias e explique o comportamento da curva da enzima ’-galactosidase. resultante do cruzamento entre duas espécies. EXPLIQUE os motivos que levam a tal esterilidade. McCarthy chegaram à conclusão. MacLeod e M. 1. As curvas no gráfico adiante representam a concentração da enzima ’-galactosidase. RESPONDA: a) Qual o número de cromossomos encontrado nas células sexuais normais da égua e do burro? b) Qual o número de cromossomos encontrado nas células somáticas da mula? Como essas células se originam? c) Apesar de a mula apresentar uma alta capacidade de realizar trabalho. Avery.9. Questão 258 Descreva o experimento realizado por Hersey e Chase em 1952. ela é estéril. correlacione os parâmetros concentração de ’-galactosidase.1 Suponha que os zigotos podem crescer normalmente. Questão 255 Descreva os principais passos seguidos por Griffth em 1928 no experimento que demonstra a "transformação" de bactérias pneumococos sem cápsula.5. Em relação a esses três animais e ao processo de origem da mula. 52 . dando origem a indivíduos adultos. M.5. b) E é possível pela via da reprodução assexuada? Justifique sua resposta. Questão 256 Como os cientistas O. em pneumococos com cápsula.8. Questão 259 A mula é um animal oriundo do cruzamento da égua (2n=64) e do burro (2n=62). não-patogênicas. em 1944.hidrolisada pela enzima ’-galactosidase em glicose e galactose.coli' foi inoculada num meio contendo uma mistura de glicose e lactose.

J. Responda se o fenômeno da não-disjunção do par de cromossomos 21 ocorreu antes ou depois da formação do zigoto. 46 cromossomos. um indivíduo trissômico apresenta um cariótipo contendo 97 cromossomos. a) Em quais momentos ela pode ocorrer? b) Utilize os contornos a seguir para representar uma das duas possibilidades. 53 .9. responda.5. Justifique sua resposta. neste indivíduo. observou-se. R. a) Qual é a aneuploidia existente na Síndrome de Down? b) Quais são os mecanismos responsáveis pelo aparecimento desta aneuploidia? c) Qual é a relação existente entre idade materna e a Síndrome de Down? Questão 265 A Síndrome de Down caracteriza-se pela presença de um cromossomo 21 a mais nas células dos indivíduos afetados. Questão 262 Tendo um homem ingerido uma substância que causa erros na divisão meiótica da gametogênese. e que 30% das células apresentavam um cariótipo normal.Questão 261 Ao analisar o cariótipo de células obtidas de uma criança com síndrome de Down.1 Questão 266 1. a não disjunção do cromossomo X e a geração de espermatozóides defeituosos. Considerando a ocorrência de tal não-disjunção. indicando na lacuna pontilhada qual delas foi escolhida para ser representada.1 Uma alteração no DNA pode modificar o funcionamento de uma célula. Por quê? Questão 267 O quadro a seguir destaca dois conceitos biológicos: câncer e sistema respiratório de insetos. M e Martho. Adaptado de Amabis. sem trissomia do 21. São Paulo: Moderna. ou seja. por exibirem a trissomia do cromossomo 21. observou-se que 70% das células apresentavam 47 cromossomos. "Biologia das células". Que tipos de anomalias cromossômicas poderão ser formadas se esses espermatozóides fecundarem ovócitos normais? Justifique. Qual o número de cromossomos que deve ser encontrado em um espermatozóide normal nessa espécie? Questão 264 A ilustração adiante mostra o cariótipo de um indivíduo do sexo masculino com Síndrome de Down. Questão 263 Numa dada espécie. G. 2002.9. 1.5. Esse problema pode ser decorrente da não-disjunção do cromossomo 21 em dois momentos durante a formação dos gametas.

não produzindo gametas viáveis. os seguintes conceitos: tumor. 1. analisou-se a seqüência de aminoácidos de uma determinada proteína em diversos mutantes gerados. Certo ou errado? Justifique. Questão 272 A anemia falciforme é uma doença que resulta da substituição de um aminoácido ácido glutâmico pela valina. milhões de pés de laranja-da-baía estão espalhados em plantações no Brasil e nos Estados Unidos. Questão 271 a) Faça uma breve descrição de como o nefasto hábito de fumar está associado ao desenvolvimento de câncer de pulmão. Verificou-se que um desses mutantes produzia uma dada proteína que diferia da original pela ausência de 35 aminoácidos em uma das extremidades da cadeia peptídica. Por ser uma variedade triplóide (3n) de laranja. e 3) segregação independente (recombinação aleatória de cromossomos dos diferentes pares de homólogos). por não possuir sementes.5. b) Descreva o caminho da fumaça de um cigarro desde o meio externo até as células do corpo de uma barata. fumo. de forma relacionada. Atualmente. Questão 269 Qualquer alteração no DNA pode modificar o funcionamento de uma célula? Justifique. sua meiose é anormal. 1. garantindo que em seu texto apareçam. proliferação celular descontrolada. Após tratar culturas de bactérias com doses de um agente mutagênico capaz de induzir uma única mutação pontual (que afeta apenas um nucleotídeo por célula). genes reguladores da divisão celular. Sabe-se que a variabilidade genética de uma população depende dos seguintes fatores: 1) permutação cromossômica ou crossing-over (troca de fragmentos entre cromossomos de um mesmo par de homólogos).9.5. tem sido propagada assexuadamente através de mudas e enxertia.3 Identifique as duas alterações nos códons do RNA que mais provavelmente explicariam a transformação de ácido glutâmico em valina. é possível identificar as alterações no RNA que formam o códon da valina na hemoglobina da anemia falciforme. Justifique sua resposta. Explique como essa única mutação pontual pode fazer com que a síntese da proteína seja interrompida prematuramente. Justifique a sua resposta.3 Identifique qual(is) deste(s) fator(es) pode(m) contribuir para a variabilidade genética da laranja-da-baía.2) mutação (modificação da seqüência de nucleotídeos de uma molécula de ADN). 54 . na hemoglobina.9. Questão 268 A substituição de uma única base na molécula de DNA leva necessariamente à substituição de um aminoácido na proteína a ser sintetizada pela célula. mutação. Questão 270 A laranja-da-baía surgiu em 1810 e. Examinando a tabela do código genético a seguir.

Nesse tipo de mutação. Em 2001 a indústria Shell do Brasil S. I.3 Em qual das mudanças (1 ou 2) há risco de perda ou de diminuição da atividade biológica? Justifique sua resposta. Questão 277 FIM DA 2 GUERRA MUNDIAL . Diedrin e Aldrin. Questão 276 Entre os diferentes tipos de processos que criam nova variabilidade genética. com resíduos de Endrin. Hiroshima e Nagasaki hoje lideram luta contra essas armas Domingo. tem sua seqüência duplicada e acrescentada ao DNA. Suponha que mutações no DNA tenham causado as seguintes mudanças nas duas moléculas de mRNA (1 e 2). A situação "a". aumentando assim a probabilidade de desenvolvimento de câncer. Questão 274 Analise as seguintes informações. sempre de acordo com as necessidades do organismo. Japão "Shizuko Abe tinha 18 anos no dia 6 de agosto de 1945 e.Questão 273 As seqüências de RNA mensageiro a seguir codificam peptídeos com atividades biológicas específicas. Explique por quê. a duplicação gênica é muito importante na criação de novidades evolutivas. é mais drástica que a situação "b".BOMBA ATÔMICA SESSENTA ANOS DE TERROR NUCLEAR Destruídas por bombas. além de replicar-se. A tabela resumida do código genético mostra alguns códons e seus aminoácidos correspondentes."O GLOBO" Gilberto Scofield Jr. "descontrole dos mecanismos de divisão celular" e "câncer". Questão 275 Em um segmento de DNA que codifica determinada proteína. sobreviver e morrer. agente de natureza biológica que podem aumentar a taxa de mutações gênicas. "agentes mutagênicos". Um aumento significativo no número de casos de câncer na região tem sido associado à exposição dos moradores a essas substâncias. fazendo com que o gene não funcione. SP. o indivíduo morre? Justifique sua resposta. Era um dia claro e quente de verão e às 8h. considere duas situações: a) um nucleotídeo é suprimido. b) um nucleotídeo é substituído por outro. II. As células devem dividir-se e conter a divisão. 55 1. A renovação dos tecidos requer um controle complexo para coordenar o comportamento de células individuais e as necessidades do organismo como um todo.A. Enviado especial Hiroshima.9. de forma que o indivíduo passa a apresentar uma ou mais cópias do mesmo gene no mesmo cromossomo.5. geralmente. Sabe-se que essas funções são geneticamente controladas. um determinado gene. ela havia abandonado os estudos para se dedicar ao esforço de guerra. a) Qual a vantagem desse tipo de mutação no aparecimento de novas espécies? b) Se uma mutação gênica ocorre em um dos genes duplicados. Shizuko e seus colegas iniciavam a derrubada de parte das casas de madeira do centro de Hiroshima para tentar criar um cordão de isolamento antiincêndio no caso de um bombardeio incendiário aéreo. manter uma especialização característica apropriada e ocupar o lugar apropriado. a) Que relações podem ser estabelecidas entre as informações I e II? Inclua na sua resposta os conceitos de "mutação gênica". 31 de julho de 2005 . como todos os jovens japoneses durante a Segunda Guerra Mundial. b) Dê exemplos de um agente de natureza física e de um . Àquela altura. foi responsabilizada pela contaminação das áreas em torno de sua fábrica de agrotóxicos em Paulínia.

Com base nos efeitos biológicos das radiações sobre os seres vivos. Indique o processo que leva à destruição do patógeno bem como as células que o realizam. muito mais devastador e letal. numa população de 400 mil . Compare. por exemplo num ferimento. as populações dessas cidades continuam a ser monitoradas. os monumentos às vítimas do terror atômico estão em todos os lugares". Questão 281 Explique o que é uma vacina e como funciona. Questão 282 Sobre a vacina. Questão 278 Os recentes testes nucleares e o cinqüentenário da explosão da bomba atômica em Hiroshima e Nagasaki em 1995 provocaram discussões sobre os efeitos da radiação no meio ambiente e nos seres humanos. Apesar de rica e moderna com seus 1. a) Nesse combate.ninguém imaginava que Hiroshima seria o laboratório de outro tipo de bombardeio. a ação do soro e da vacina segundo estes tópicos: 1.A duração da imunização 4. a) Como a radiação está relacionada ao aumento na incidência de câncer? b) Como se explica que muitos dos efeitos da bomba atômica se manifestem nos descendentes dos sobreviventes? c) Por que algumas pessoas que foram viver nessas cidades tempos depois da explosão também foram afetadas? Questão 279 Soros e vacinas fazem parte do arsenal usado no combate às doenças infecciosas (imunidade adquirida). "Hiroshima. que é transmitida pela picada da mosca tsé-tsé. O sistema imunitário age para combatê-las. para o qual os abrigos antiincêndio foram inúteis".O emprego curativo ou preventivo Questão 280 As bactérias podem vencer a barreira da pele. responda: a) Para que é usada? b) De que é feita? c) Como funciona? Questão 283 Um protozoário conhecido como 'Trypanosoma gambiense' provoca no homem a chamada "doença do sono".é nunca esquecer o passado.5. O estudo da reação imunitária do organismo humano aos antígenos da superfície dos parasitas está demonstrado no esquema abaixo. no Japão.A ação imediata ou não 3. e entrar em nosso corpo.A natureza da imunização 2. aponte dois motivos pelos quais essas populações humanas devem ser monitoradas ainda hoje. 1.10 56 . uma reação inicial inespecífica é efetuada por células do sangue. Japão. Após sessenta anos da explosão da bomba atômica sobre as cidades de Hiroshima e Nagasaki. b) Indique a reação de combate que é específica para cada agente infeccioso e as células diretamente responsáveis por esse tipo de resposta.1 milhão de habitantes circulando em bem cuidadas ruas e avenidas. Passear pelas ruas de Hiroshima hoje 60 anos depois da tragédia que matou 140 mil pessoas e deixou cicatrizes eternas em outros 60 mil. respectivamente. Dados mostram que a incidência do câncer nas duas cidades japonesas é muito alta.

Questão 285 O termo amamentação designa o ato de amamentar. o primeiro filho nunca é afetado. podem ser reconhecidos pelo organismo como agentes agressores. a) Os gráficos a seguir mostram a variação da concentração de anticorpos contra um determinado antígeno no sangue de uma pessoa. precisa de um transplante de um órgão. Qual dos dois indivíduos é originário da região com alta incidência do vírus X? Justifique. b) Na eritroblastose fetal. em duas condições: vacinação ou soroterapia. a partir da segunda gravidez. um dos gêmeos monozigóticos. Bactérias. Dois dos filhos do casal são gêmeos monozigóticos e os outros dois são gêmeos dizigóticos. Questão 286 As respostas imunológicas constituem mecanismos de defesa vitais para os organismos. b) apresente um exemplo de imunização ativa artificial e um de imunização passiva natural. mesmo nessas circunstâncias. b) Justifique o aumento do número de parasitas com antígeno B na semana 2. fungos. porém. a mãe produz anticorpos contra o fator Rh do filho. Questão 287 Um casal tem quatro filhos: João. Mais do que um simples ato de amor. em casos mais graves. vírus. Com base nas respostas de cada um deles ao antígeno. Explique por que. Qual seria a pessoa da família mais indicada para ser o doador? Justifique sua resposta. representa a maneira mais eficiente e prática de alimentar e nutrir o filho sem os riscos que a alimentação artificial pode oferecer. Indique a condição que deve estar presente no feto para o desenvolvimento da eritroblastose em filhos de mulheres que não produzem fator Rh.5. suspeitou-se de que um dos indivíduos fosse originário de uma região onde a infeção pelo vírus X atinge grande número de indivíduos. 57 . em função do tempo. Escreva a importância da amamentação PARA A MÃE E PARA O FILHO. Questão 288 As curvas abaixo mostram a produção de anticorpos específicos de dois indivíduos inoculados com antígenos protéicos do vírus X no dia 0. e mesmo simples moléculas. deve ser repetido a intervalos de tempo relativamente curtos. Questão 284 A função do sistema imunológico é a de defender o organismo contra invasores. 1. A esse respeito.10 Um dos gráficos mostrados corresponde à variação da concentração de anticorpo antiofídico no sangue de uma pessoa mordida por uma serpente e tratada com uma dose do soro apropriado. tecidos ou órgãos transplantados. Justifique por que esse tratamento deve ser feito logo após a picada do animal e. de aceitar uma criança no próprio peito. a) explique a diferença entre a resposta ativa e a passiva. Maria. por que. João.a) Explique por que os parasitas com antígeno A desapareceram na semana 2 e cite o principal tipo celular participante da reação responsável por esse desaparecimento. Paulo e Luisa. A doença só se manifesta.

Questão 290 A resposta imune de seis voluntários a três diferentes antígenos (A. 58 . por exemplo. que mostra o título (quantidade) de anticorpos específicos contra os antígenos A. b) Explique por que a imunidade de grupo não é eficiente no controle de doenças como. Estes testes geram resultados semelhantes para animais vacinados e animais que contraíram a doença. tais como vacas e ovelhas. Justifique sua resposta. a pessoa foi novamente contaminada e outra vez a substância específica foi usada. Justifique sua resposta. como medicamento. Cinco meses depois desse evento. dificultando as relações comerciais internacionais.1. enquanto a linha contínua representa a SUBSTÂNCIA ESPECÍFICA.5. mas sim uma substância inócua (placebo) para servir de controle negativo. Questão 292 Uma pessoa foi contaminada por uma substância tóxica.10 Questão 289 A febre aftosa é uma doença virótica que afeta diversos animais de importância econômica. a) Explique por que a imunidade de grupo é eficiente no controle de doenças como a gripe. e não a detecção do próprio vírus na carne. indica os resultados observados. pelo médico. Questão 291 No caso de algumas doenças infecciosas.10 1. A linha pontilhada representa a SUBSTÂNCIA TÓXICA. de origem orgânica. Com base nos resultados apresentados. O gráfico a seguir reproduz os dois momentos em que ocorreram as contaminações. B e C) do parasita causador da malária (plasmódio) foi testada em uma pesquisa.5. A figura a seguir. Tal fenômeno é denominado imunidade de grupo. O voluntário 6 não recebeu nenhum dos antígenos. As restrições à importação de carne se baseiam no fato de que os testes disponíveis utilizam a detecção de anticorpos contra o vírus. avalie se a estratégia de vacinação com esses antígenos seria eficaz. Países que não vacinam seus rebanhos contra febre aftosa restringem a importação de carne de países onde a vacinação ocorre. pode-se considerar que toda a população está protegida se uma alta proporção dos indivíduos estiver imunizada. B e C no soro de cada um dos voluntários. Para tratá-la o médico introduziu em seu organismo uma substância específica. Determine se os resultados dos testes seriam positivos ou negativos tanto para animais infectados quanto para vacinados. o cólera e a hepatite.

Questão 293 O gráfico a seguir mostra as respostas primária e secundária da produção de anticorpos quando um indivíduo é submetido a injeções de antígenos. Considerando que esse quadro retrata as condições encontradas em outros países industrializados. a) A que tipo de imunização se referem as aplicações? b) Analise os resultados apresentados pelo gráfico e explique o fato observado com a 2 aplicação do antígeno. Questão 295 Analise o gráfico. um médico inglês.10 A substância específica de combate. constatou que estes indivíduos mantinham-se 59 . Questão 296 Leia os seguintes fragmentos de textos: 1. Questão 294 O gráfico representa o resultado de duas aplicações de um mesmo antígeno. responda. uma doença do gado semelhante à varíola pela formação de pústulas.5. Após uma série de experiências.1. Todas eram ordenhadoras e tinham se contaminado com "cowpox". que descreve causas de óbitos humanos nos Estados Unidos no início e no final do século XX.10 1. 1. a) Que tendência pode ser observada quando se comparam as taxas de mortalidade por doenças contagiosas e por doenças degenerativas (também chamadas "doenças da velhice") no início e no final do século XX? b) Cite dois fatores que podem explicar as mudanças observadas nas taxas de mortalidade por doenças contagiosas. Edward Jenner.10 1. inoculada no paciente.5. mas que não causava a morte dos animais. em intervalos diferentes.5.5.10 Analisando o gráfico. responda: a) Qual a função do antígeno e qual curva corresponde às respostas primária e secundária? b) Explique o que acontece em relação aos anticorpos nas fases das respostas primária e secundária. é um soro ou uma vacina? Justifique sua resposta. observou no final do século XVIII que um número expressivo de pessoas mostrava-se imune à varíola.

que atua no combate a infecções. Se picada por uma delas. (www. de 1980 a 1997.br) 2. A 6 de julho de 1885. o ano de 1997. ao longo desse ano. Gráfico 2: Taxa da incidência anual de sarampo em menores de um ano no Brasil.fiocruz. que havia sido mordido por um cão raivoso. Joseph Meister. O sistema imunitário. Ao todo. injetou na criança material proveniente de medula de um coelho infectado. chegava ao laboratório de Louis Pasteur um menino alsaciano de nove anos.refratários à varíola. que vinha desenvolvendo pesquisas na atenuação do vírus da raiva. b) Que tipos de produtos (medicamentos) puderam ser produzidos a partir das experiências relatadas. de 1982 a 1997. coral e urutu são exemplos de cobras venenosas que ocorrem no Brasil. Meister não chegou a contrair a doença.) a) O gráfico 2 indica claramente a ocorrência de epidemias de sarampo em dois anos distintos no Brasil. mesmo quando inoculados com o vírus. Questão 300 Procurando compreender a importância de determinadas células sangüíneas para o sistema imunológico. foi feito o seguinte experimento: 60 .bio. respectivamente. b) Explique que mecanismos induzem a proliferação de linfócitos nos gânglios linfáticos.fiocruz. Questão 298 Os médicos verificam se os gânglios linfáticos estão inchados e doloridos para avaliar se o paciente apresenta algum processo infeccioso. cada uma com material mais virulento. nos fragmentos de textos 1 e 2? Que relação existe entre o fenômeno observado no relato 1 e as chamadas células de memória? Questão 297 Jararaca. (www. é mais eficiente o uso do soro ou da vacina? Justifique. 1. Gráfico 1: Cobertura da vacinação contra sarampo em menores de um ano no Brasil. a vítima deve ser tratada com soro antiofídico. nos dois gráficos. Ministério da Saúde. linfócitos T e linfócitos B atuam no sistema imunitário. Pasteur. é constituído por diferentes tipos de glóbulos brancos e pelos órgãos responsáveis pela produção e maturação desses glóbulos.5. os resultados representados no gráfico 1 tenham influenciado os resultados representados no gráfico 2 ou o inverso? Justifique.10 (Programa Nacional de Imunizações. Para reduzir rapidamente e de imediato o número de doentes durante uma epidemia. Questão 299 Observe atentamente os dois gráficos apresentados.bio.br) a) Qual dos fragmentos. b) Considere. 1 ou 2. É mais correto supor que. foram 13 inoculações. refere-se a processos de imunização passiva? Justifique sua resposta. O soro antiofídico poderia ser denominado vacina antiofídica? Explique. a) Explique como macrófagos. cascavel.

duas características são condicionadas por genes dominantes (A e B). Os responsáveis por essa variação são 3 pares de genes com segregação independente. O fruto de uma planta de genótipo AABB tem 40 gramas de massa enquanto o de uma planta de genótipo aabb tem 20 gramas. O homozigoto dominante para estas duas características recebe mais pontos que os heterozigotos e estes. originou 7 fenótipos diferentes. alelos de A e B . em centímetros.5. responda às perguntas a seguir. Esses genes contribuem com valores idênticos para o acréscimo de massa. Determine a massa do fruto de uma planta de genótipo AABb. mais pontos que os recessivos. Qual o nome que se dá a esse método profilático? Questão 301 Atualmente. a) Que tipo específico de célula sangüínea foi afetada pela irradiação? b) Que tipo de molécula essa célula do sangue passa a produzir quando estimulada pela proteína estranha? c) A introdução de moléculas estranhas ao organismo com o objetivo de provocar uma resposta imune é um método bastante usado na prevenção de determinadas doenças. Um criador. Os genes a e b. Questão 303 O peso dos frutos (fenótipos) de uma determinada espécie vegetal varia de 150g a 300g. que interferem igualmente na altura da planta.1. cruzou um macho e uma fêmea. o Governo Federal vem discutindo a implantação de quotas para negros nas universidades. Justifique sua resposta. não contribuem para o acréscimo de massa. Sabendo-se que o peso do fruto é um caso de herança quantitativa. obtendo uma descendência com todos os genótipos possíveis. esperada para a primeira geração de um cruzamento entre dois indivíduos com os genótipos AABBCC e aabbCC. não alelos. desejando participar do concurso.10 respectivamente. qual a importância da existência dessa variabilidade na cor da pele para o ser humano? d) Especifique a forma de herança genética responsável pela determinação da cor da pele. independentes e de ação cumulativa (polimeria). reponda: a) quantos pares de genes estão envolvidos na determinação do peso dos frutos desta espécie vegetal? b) qual é o efeito aditivo de cada gene? c) de acordo com o triângulo de Pascal. qual é a proporção de cada classe fenotípica obtida em F‚? Questão 304 A altura dos espécimes de uma determinada planta encontrada no cerrado varia entre 12cm e 108cm. com linhagens homozigóticas que produzem frutos de 300g. autofecundada. Do cruzamento entre linhagens homozigóticas que produzem frutos de 150g. 61 Com base no exposto. histológica e citologicamente a cor da pele? Histologicamente: Citologicamente: b) O que confere a diferença na cor da pele de indivíduos negros em relação à dos indivíduos brancos? c) Evolutivamente. que ganham nota zero. Considerando a cor da pele de negros e de brancos responda: a) Onde é determinada. Questão 305 Em um concurso de cães. Determine a altura. obteve-se uma geração F que. Questão 302 A massa de um determinado tipo de fruto depende da ação de dois genes A e B. ambos heterozigotos para os dois genes.

Os descendentes (F) foram cruzados entre si.a) Qual a probabilidade do criador obter um animal com a pontuação máxima? Qual a probabilidade de obter um animal homozigoto recessivo para os dois genes? b) Considerando que todos os descendentes do referido cruzamento participaram do concurso. Questão 307 Um pesquisador cruzou paineiras de flores "pink" com paineiras de flores brancas. a£ e a¤) tem seu locus no cromossomo I e outra série de três alelos (D. responda ao que se pede: a) Quantos alelos estão envolvidos na determinação do caráter cor de fruto e qual a relação de dominância entre eles? b) Qual a proporção genotípica e fenotípica do cruzamento entre plantas de fruto vinho do cruzamento parental (2) com plantas de fruto vinho do cruzamento parental (4)? c) Quantas plantas com frutos amarelos serão geradas. d¢ e d£) tem seu locus no cromossomo II. a partir de 200 sementes oriundas do cruzamento entre plantas de frutos vinho do cruzamento parental (4) com plantas de frutos rosa do cruzamento parental (2)? Questão 311 Uma determinada característica depende de um locus que possui 4 alelos (A1. enquanto outras são determinadas por muitos genes (herança poligênica). vinho. chinchila. e que cada gene dominante contribui com 5 pontos na premiação. II) apenas flores de rosa médio.5.11 Com base nos resultados apresentados. B2 e C1. a¢.5. Outra característica também depende de 4 genes (B1. c¢. Qual dos dois mecanismos explica a maior parte das variações fenotípicas nas populações? Justifique. Questão 308 Admitamos que numa certa espécie de animal quatro alelos (A. A ordem de dominância existente entre os genes é C > c¢ > c£ > c¤. 1. A2. quantos pontos devem ter obtido os vice-campeões e os cães classificados em penúltimo lugar? Questão 306 Certas características fenotípicas são determinadas por poucos genes (herança mendeliana). c£ e c¤. A4). produzindo sempre as seguintes freqüências fenotípicas na geração (F‚): Questão 309 A cor da pelagem em coelhos é determinada por uma série de alelos múltiplos composta pelos genes C. himalaio e albino. quantos genótipos diferentes são. possíveis na população? . respectivamente. responsáveis pelos fenótipos aguti. Em relação a essas duas séries de alelos. O cruzamento entre plantas com esses fenótipos produziu as seguintes proles na geração F1.12 1. porém são 62 a) Qual o tipo da herança da cor da flor da paineira? b) Indique as possibilidades de se obter em um cruzamento: I) apenas flores de cor branca. Responda: a) Quais as proporções fenotípicas e genotípicas esperadas na progênie do cruzamento entre um coelho aguti (Cc¢) e um coelho chinchila (c£c¤)? b) Como você explicaria o aparecimento de coelhos albinos a partir de um cruzamento entre coelhos himalaios? Questão 310 As videiras podem produzir uvas de coloração vermelha. rosa e amarela. A3. teoricamente. C2).

Uma rainha de olho marrom. sendo que "A" e "B" são dominantes. com eles. Cada loco tem dois alelos "A" e "a" e "B" e "b". é cruzado com outro. sabendo-se que a freqüência de permutação é de 10%? Questão 315 Que tipos de gametas e em que proporções produzirá um organismo com genótipo Cd/cD. Questão 318 Sabendo que a maioria das mutações é deletéria (prejudicial ao organismo). outro com o motor quebrado e. qual o número esperado de machos e de fêmeas na descendência? Dos machos esperados. A prole resultante foi: 40% AaBb 40% aabb 10% Aabb 10% aaBb O pesquisador ficou surpreso. um com a transmissão quebrada. a partir do gene A? b) Justifique sua resposta. A figura a seguir ilustra um par de cromossomos homólogos duplicados (A e B). homozigoto para os genes A B C D. que descendência resulta deste processo? b) Na inseminação realizada. constituída por cinco alelos. Questão 312 Em abelhas. a) O que é partenogênese? Em abelhas.não ocorreu permuta entre os genes A e C. Um pesquisador cruzou um indivíduo "AaBb" com um indivíduo "aabb". a cor do olho é condicionada por uma série de alelos múltiplos. existe um processo denominado partenogênese. heterozigota para pérola. Somente 40% dos ovos dessa rainha foram fertilizados e toda a descendência teve a mesma oportunidade de sobrevivência. com a seguinte relação de dominância: marrom>pérola>neve>creme>amarelo. Um desses dois tipos de determinismo genético apresenta um número maior de genótipos possíveis na população. os cinco alelos. durante a produção de gametas: "A meiose é o equivalente a ter dois carros. produziu 600 ovos e foi inseminada artificialmente por espermatozóides que portavam. 30% entre A e D. Questão 314 O cruzamento CD/cd x cd/cd produziu 600 descendentes. quantos terão o olho de cor marrom? Questão 313 Um organismo.ocorreu 10% de permuta entre os genes B e D. Quantos deverão ser diferentes dos pais. o evolucionista John Maynard-Smith escreveu sobre a meiose. em proporções iguais. a) Baseando-se nos resultados acima. pois esperava obter os quatro genótipos na mesma proporção. 25% para cada um deles. . bem como as localizações 63 . Esses resultados contrariam a segunda lei de Mendel ou lei da segregação independente? Justifique sua resposta. sabendo-se que a freqüência de permutação é de 36%? Questão 316 Quais são os gametas produzidos por um indivíduo de genótipo Ab/aB? Em que proporções serão formados sabendo-se que os genes A e b permutam com uma freqüência de 16%? Questão 317 Considere a existência de dois locos em um indivíduo. Identifique esses genótipos.dois pares de alelos localizados em pares de cromossomos homólogos diferentes. produzir um único carro que funcione".ocorreu 20% de permuta entre os genes A e B. porém. que é homozigoto recessivo para os mesmos alelos. . qual é a seqüência mais provável desses 4 genes no cromossomo. O retrocruzamento de F1 (com o duplo recessivo) mostra os seguintes resultados: . Em abelhas. todos localizados em um mesmo cromossomo.

A causa da doença da menina era um defeito em um gene que codifica a enzima adenosina desaminase (ADA). 2002. n. hoje. se ingeridas. N. 08/09/2000) Explique a vantagem da utilização. (Kreuzer. a) Qual a seqüência mais provável desses locos no cromossomo? Faça um esquema do mapa genético desse trecho do cromossomo. homozigótico para os alelos m.5. O. n. O. separaram os linfócitos (células brancas) e usaram um retrovírus para introduzir uma cópia correta do gene nestas células. b) Selecione e transcreva o segmento do texto que justifica a afirmação de que a terapia gênica é um exemplo de engenharia genética. poderiam infectar com o vírus da AIDS toda a população. Questão 319 Os locos M. Esta criança possuía um sistema imune extremamente deficiente e não podia defender-se contra infecções. Entre as advertências. A. A descendência desse retrocruzamento apresentou 15% de permuta entre os locos M e N. 1. N. que viveu sua curta .) a) A partir do exemplo apresentado no texto. A técnica combina o uso de células-tronco de embriões e terapia genética.dos alelos deletérios "M" (presente somente no cromossomo A) e "N" (presente somente no cromossomo B). 25% de permuta entre os locos M e O.13 vida em um ambiente estéril.. o. um folheto à população alertando sobre os perigos da ingestão de transgênicos na alimentação. Não houve descendentes com permuta entre os locos M e P. Artmed. "Engenharia Genética e Biotecnologia". explique em que consistem. os tratamentos denominados "terapia gênica". Sua doença era a mesma que a do "menino da bolha". o. Os cientistas do National Institute of Health dos Estados Unidos coletaram sangue da menina. a) O que são transgênicos ou organismos geneticamente modificados (OGMs)? b) Explique por que o vírus da AIDS não poderia infectar uma planta e por que a ingestão de uma planta transgênica não seria capaz de transmitir o vírus da AIDS. indicando as distâncias entre os locos. A geração F foi então retrocruzada com o homozigótico m. p. H. pois estas são de fácil obtenção e de fácil reintrodução no corpo. constava uma que afirmava incorretamente que "para serem criadas plantas transgênicas são usados os vírus da AIDS" e que tais plantas. P foi cruzado com outro. Questão 322 CÉLULAS-TRONCO PODEM TRATAR LESÕES CEREBRAIS Empresa usa unidade estrutural de embriões para recuperar vítimas de derrame. de maneira geral. Um indivíduo homozigótico para os alelos M. Porto Alegre. As células alteradas produziram a enzima que faltava e. no Sul do país. Massey. 10% de permuta entre os locos N e O. Responda. Então eles reintroduziram os linfócitos na paciente. a menina é mais saudável do que antes. p. b) Por que não houve descendentes recombinantes com permuta entre os locos M e P? Questão 320 O primeiro teste de terapia gênica humana utilizou células sangüíneas. A paciente foi uma menina com a doença da imunodeficiência combinada severa. P estão localizados em um mesmo cromossomo. (Adaptado de "O Globo". Questão 321 Alguns grupos radicalmente contrários ao uso de organismos geneticamente modificados (transgênicos) na agricultura divulgaram recentemente. no procedimento 64 Um indivíduo que possui os cromossomos A e B poderá formar gametas que não sejam portadores dos alelos M e N? Justifique sua resposta.

A célula assim formada foi implantada no útero do indivíduo 3. Justifique sua resposta. Em uma delas. ao se desenvolver. Núcleos de óvulos de rã não-fertilizados foram substituídos por núcleos de células somáticas.descrito. do indivíduo 2. no qual todas as células são inicialmente indiferenciadas. origina outro organismo. ao 2 ou ao 3? Justifique sua resposta. Esse novo ser é geneticamente idêntico ao indivíduo 1. H2. havia duas hipóteses a respeito da diferenciação celular. resultaram na formação de embriões normais. Cientistas da Universidade do 65 1. retiradas de uma mesma rã. que a diferenciação não implicava perda de DNA. Historicamente. Explique por que: a) esses núcleos transplantados de células somáticas de diferentes tecidos deram origem a indivíduos normais e idênticos. como inevitáveis. desenvolveu-se. composto por até centenas de diferentes tipos de células. postulava-se a idéia de que ocorria perda de material genético enquanto a célula se diferenciava.15. b) o resultado da experiência seria diferente se tivessem sido usados núcleos de células germinativas. 6/8/98) baseia-se no livro Remaking Eden (Refazendo o Éden) de Lee Silver. previamente anucleado. Na segunda. Admitindo-se a possibilidade de clonar seres humanos e com base no que tem sido publicado nos principais jornais e revistas do País. de células-tronco ao invés de células já diferenciadas. o qual afirma que cenas como estas não só são possíveis.5. Identifique qual das duas hipóteses é confirmada pelos processos de clonagem. e deu origem a um novo ser.1 . Esse processo é conhecido como diferenciação celular. responda: a) Como o bebê da figura acima poderia ter sido gerado? b) Qual seria o sexo do bebê gerado por esse processo? Justifique sua resposta. Questão 326 No desenvolvimento de um organismo ocorre a transição de um estágio embrionário. Questão 327 "CIENTISTAS DA UNIVERSIDADE DO HAVAÍ CLONAM MAMÍFERO ADULTO DO SEXO MASCULINO A clonagem deixou de ser uma técnica aplicável exclusivamente às fêmeas. Questão 323 Dois cientistas realizaram uma experiência com o objetivo de estudar a transmissão das informações contidas nos genes do núcleo de células de diferentes tecidos. nos quais o núcleo da célula de um tecido de um indivíduo adulto é introduzido em um ovócito anucleado que. com seus novos núcleos. que chamaremos de H1. Questão 324 A figura a seguir (Folha de São Paulo. Questão 325 Em uma experiência de reprodução com uma espécie de mamífero adotou-se o seguinte procedimento: fundiu-se uma célula do indivíduo 1 com um óvulo. até o estágio adulto. Os cientistas observaram que a grande maioria destas células.

Óvulos não fecundados são retirados de um segundo animal (animal Z). Pergunta-se: a) Todos os animais produzidos pela técnica I são genotipicamente iguais ao animal X? Justifique. no entanto. Por que os cientistas extraíram os núcleos dos óvulos antes de inserir as células da cauda do doador? Questão 328 No filme "Parque dos Dinossauros". a) Qual seria a desvantagem biológica de um rebanho de clones? b) Dê um exemplo de clone que ocorre naturalmente. Trata-se de um camundongo batizado de Fibro. por meio do sangue conservado em mosquitos que os teriam picado e que permaneceram fossilizados no âmbar.O núcleo retirado da célula somática do animal Y é implantado no óvulo sem núcleo do animal Z.Havaí clonaram o primeiro mamífero adulto do sexo masculino.5.89. A nova célula assim formada começa a se dividir formando um embrião. TÉCNICA II 1 . 3 . 3 . nŽ55. a) O que se poderia dizer dos exemplares recuperados. O núcleo de cada um desses óvulos é retirado.Cada metade é reimplantada no útero de outra fêmea (receptora). tipo de célula usada na criação do animal (. b) O novo animal formado pela técnica II pode ser chamado "clone" do animal Y. chegando-se assim à fórmula para recuperar a espécie.O embrião é reimplantado no útero de um terceiro animal (animal W) dando origem a um novo animal. 4 . caso um dos animais seja sensível a uma bactéria que cause pneumonia? b) Justifique sua resposta.) Agora. Considere a possibilidade de que o DNA obtido pertença a um único dinossauro e que deste DNA foram recuperados vários exemplares. os cientistas criaram Fibro a partir de um pedaço do rabo de um camundongo. Questão 330 No início deste ano. produzidos por ratas. 2 . O material foi substituído por células extraídas da cauda do doador. Apenas 274 embriões resultaram dessa operação e foram implantados em 25 ratinhas que funcionaram como 'mães de aluguel'. os zigotos são retirados da fêmea e divididos em dois. p.Após alguns dias. Um dos objetivos dessa pesquisa é a melhoria da pecuária. lembra o geneticista Ademar Freire Maia em um artigo do Boletim "Germinis" do Conselho Federal de Biologia. Com o sangue.Células somáticas são retiradas do corpo de um animal (animal Y). Em vez de utilizar células relacionadas ao sistema reprodutivo feminino para preencher os óvulos.. 7/6/99. de maio/junho de 1997. como havia sido feito até agora. pesquisadores anunciaram o nascimento da ovelha Dolly. . Z ou W? Justifique. uma brincadeira com a palavra fibroblasto. 4 . que poderiam ser usados e que estão descritas nos quadros. das quais são retirados os núcleos.Uma fêmea (animal X) é estimulada com hormônios a produzir vários óvulos..15.1 Adaptado da Revista Época: Ano II. 2 ." Questão 329 Respondendo a uma questão sobre a possibilidade de se clonarem animais para livrá-los de extinção. considerada o primeiro clone de mamífero gerado artificialmente. através da formação de rebanhos homogêneos. Eles colheram 700 óvulos. Clones. da mesma espécie. os pesquisadores Ryuzo Yanagimachi e Teruhiko Wakayama mostram que um macho adulto também pode ser replicado. foi possível determinar o DNA dos dinossauros. TÉCNICA I 1 . ocorrem naturalmente no cotidiano. extintos há 65 milhões de anos. um cientista cria em laboratório novas gerações de dinossauros. e descartaram seus núcleos. I e II. 66 1. um cientista apresenta duas técnicas. gerando um novo animal.Essa fêmea é então inseminada artificialmente. segundo trabalho publicado na revista "Nature Genetics".

2 a) Explique a causa da diferença no crescimento dos camundongos 2 e 3. elabore uma hipótese para a causa da diferença no crescimento dos camundongos 1 e 2. coletar células da medula óssea do paciente. contendo a informação para a síntese da ’-globina. na ausência do gene de resistência. . realizou uma cirurgia e removeu a hipófise. 67 . Justifique sua resposta. 3.Justifique. as células retiradas da medula óssea são as indicadas para serem infectadas com as partículas virais adequadamente modificadas. deveriam ser realizadas três etapas: 1. Em seguida. estão esquematizadas a partícula viral original. seria o mais indicado para ser usado nesse tratamento. 2) Plantas mais resistentes aos efeitos dos defensivos agrícolas (agrotóxicos). não transgênico e com hipófise. doença caracterizada pela produção de hemoglobina anormal devido a uma deleção no gene que codifica a cadeia ’ da globina. Questão 333 As técnicas modernas de engenharia genética tornaram possível a produção de plantas transgênicas que possuem genes introduzidos artificialmente no seu genoma. indicado em lagumas figuras. b) Com base em sua resposta ao item a. que contém a informação para a síntese da cadeia ’ da globina.15. Questão 331 Um pesquisador construiu um camundongo transgênico que possui uma cópia extra de um gene Z. as matariam. 1. que codifica as proteínas necessárias para a formação de novas partículas virais no interior da célula hospedeira. Entre as várias estratégias de produção de plantas transgênicas. a) Explique por que. na talassemia. Questão 332 A terapia génica. colocar as células coletadas em contato com o retrovírus modificado. III. Nesse caso. indica que a partícula viral contém as enzimas transcriptase reversa e integrase (insere o material genético de origem viral no genoma da célula). Essas plantas toleram concentrações maiores de agrotóxico sem alterar as propriedades tóxicas dos defensivos agrícolas. comparando com o crescimento de um camundongo. IV e V). e quatro diferentes partículas virais modificadas (Esquemas II. 2. no caso do tratamento da talassemia.15. A seguir. b) Indique qual dos retrovírus modificados.Y representa o trecho de ácido nucléico introduzido. Por exemplo. antes da . estudou o crescimento desses camundongos.X representa o trecho de ácido nucléico viral. apresentados nos esquemas acima. Em um outro camundongo jovem. poderia ser usado um retrovírus modificado. Obteve as seguintes curvas de crescimento corporal: manipulação (Esquema I) . para que essas sejam infectadas. uma promessa da biotecnologia moderna. .o símbolo esférico e negro. consiste na cura de defeitos genéticos pela introdução de genes normais em celulas de indivíduos doentes. Algumas metodologias em estudo utilizam retrovírus modificados como veículo de introdução do gene desejado.5.2 1. destacamos duas: 1) Plantas resistentes a certos vírus patogênicos que.5. reintroduzir as células infectadas no paciente.

2 Explique o que é alimento transgênico e como é obtido. Questão 337 Uma mutação no gene que codifica a enzima fenilalanina hidroxilase pode acarretar o acúmulo do aminoácido fenilalanina no sangue. os fragmentos são indicados por Kb (1Kb=1000 pares de bases nitrogenadas). Um casal apresenta. em caso de ocorrer uma catástrofe ambiental. qual das duas estratégias não é recomendável? Justifique sua resposta. por que o tratamento iniciado logo após o nascimento. b) Defina um organismo transgênico. o desenvolvimento de novas metodologias nas áreas da bioquímica e da biologia molecular permitiu a implementação de exames diagnósticos. da mãe e da criança estão indicados na figura 2. onde cada traço indica a posição e o tamanho dos fragmentos num 68 1. a) Explique. indubitavelmente importantes no caso de doenças tratáveis. indicados no esquema por setas. como a fenilcetonúria. II) cana-de-açúcar obtida através de mudas. Analisando-os quanto à variabilidade gênica. No esquema a seguir. Os resultados obtidos com o estudo dos marcadores para o cromossomo 21 do pai. Essas resultam em fragmentos de tamanhos diferentes que podem ser utilizados como marcadores genéticos. em seus cromossomos de número 21. sendo o excesso transformado em compostos tóxicos que comprometem o desenvolvimento físico e mental da criança fenilcetonúrica.Do ponto de vista ambiental. Questão 335 entre espécies distintas. A introdução de soja e de outras plantas transgênicas tem gerado muita polêmica. III) soja transgênica clonada para melhoria da qualidade biológica de suas proteínas. Questão 338 Considere estes dados como hipotéticos. b) de que forma os três grupos poderiam ser afetados. do ponto de vista genético. a) Cite dois mecanismos que impedem a troca de genes . Nos últimos anos. Questão 336 Existem mecanismos que normalmente impedem a troca de genes entre espécies distintas. Questão 334 Considere os seguintes seres: I) cabra selecionada artificialmente. explique a) como os três grupos de seres se diferenciam entre si. o qual inclui uma dieta restritiva à fenilalanina.5. porém. No entanto. c) Indique um benefício decorrente da utilização de organismos transgênicos e um possível risco para o ambiente ou para a saúde humana. b) Apresente dois testes laboratoriais para a detecção de portadores de fenilcetonúria e explique os princípios desses testes. no que se refere à perpetuação de sua própria espécie. apesar de seus inúmeros benefícios. pois. as fronteiras entre as espécies vêm sendo rompidas com a criação de organismos transgênicos. pode melhorar a qualidade de vida das crianças afetadas por fenilcetonúria. por cruzamentos sucessivos. Justifique. para aumentar a produção leiteira. pontos de quebra por enzimas especiais. não há ainda como avaliar os riscos que os organismos transgênicos apresentam.15. Esse casal tem uma criança com Síndrome de Down devida à trissomia do cromossomo 21.

15. a técnica de seqüenciamento era a mesma. obtendo-se os seguintes resultados: ADN do organismo 1 + ADN do organismo 1 = 100% de radioatividade no ADN híbrido ADN do organismo 1 + ADN do organismo 2 = 10% de radioatividade no ADN híbrido ADN do organismo 1 + ADN do organismo 3 = 40% de radioatividade no ADN híbrido ADN do organismo 1 + ADN do organismo 4 = 85% de radioatividade no ADN híbrido Qual o organismo que pertence à mesma espécie do organismo 1? Justifique sua resposta. determine: O genitor onde ocorreu a não-disjunção. A fase da meiose em que o fenômeno ocorreu. a partir da amostra de somente um indivíduo. em que ocorreu o fenômeno de não-separação ou não-disjunção dos cromossomos. mais . 1) Identifique o genitor que transmitiu dois cromossomos 21 à criança. foi publicada a seqüência quase completa do genoma humano. Pelos resultados apresentados na figura. econômica? Questão 340 Uma técnica usada como uma ferramenta da taxonomia emprega a seguinte abordagem: extrai-se o ADN de um organismo e este é. então. que o ADN era de um indivíduo do sexo masculino. havia duas estratégias a considerar: I) seqüenciar o ADN total dos cromossomos diretamente. pressupõe-se que a criança deve ser normal. Após a hibridação (reassociação formando moléculas híbridas). é possível medir quanto ADN radioativo existe num ADN de cadeia dupla. O ADN radioativo é então desnaturado (suas cadeias são separadas por calor) e posto em contato com o ADN de um outro organismo. Foi feito um experimento em que o ADN do organismo 1 (ADN radioativo) foi "hibridado" com o ADN não radioativo de três outros organismos. II) extrair todos os ARNs mensageiros. Por que foi importante determinar a seqüência do ADN de um homem e não de uma mulher? 69 1. I ou II. após o nascimento.campo de eletroforese. foi realizado para o feto através de punção do líquido amniótico. no entanto. Esse projeto contou com a participação de diversos laboratórios. Entretanto. marcado com fósforo radioativo.5. constatou-se que a criança apresentava Síndrome de Down. Sabe-se. Questão 341 Em Junho de 2001. Nos dois casos. 2) Determine o estágio da meiose. Analise o resultado obtido na figura 3. Justifique sua resposta. Questão 339 No início do projeto do genoma humano. portanto. como descrito no texto. amniocentese. Por que a segunda estratégia é mais rápida e. igualmente desnaturado. que individualmente determinaram a seqüência de vários trechos diferentes do ADN de todos os cromossomos. 3) Suponha que a mulher está novamente grávida e que o exame para marcadores do cromossomo 21. porém não radioativo. Justifique sua resposta. Com base nessa informação.3 Com base nas informações apresentadas e em conhecimentos sobre o assunto responda ao que se pede. produzir ADN a partir desses ARNs mensageiros e seqüenciar apenas esse ADN. que permaneceu anônimo.

ambas reclamaram na Justiça o reconhecimento de paternidade. Paula engravidou-se ao manter relações sexuais com dois irmãos. pois a maioria das frutas não se desenvolve.br). Cada uma dessas regiões recebe o nome de marcador. Questão 345 O exame de paternidade através da comparação de DNA seqüenciado vem sendo utilizado para determinar progenitores. II. que identificou o genoma de uma bactéria.5. Apenas a presença de duas bandas (A e B) é indicativo positivo para o indivíduo apresentar uma certa disfunção muscular quando adulto. Dessa forma. que causa uma doença nas laranjeiras. gêmeos monozigóticos. a) Explique o que é genoma e indique uma possível conseqüência econômica dos resultados desta pesquisa. Questão 346 1. III e IV) mais provável PARA CADA UM de seus pais? c) Qual é a probabilidade de um certo casal. 'Xylella fastidiosa'. Em outra situação. Após receber os resultados. formado por indivíduos tipo I e III. b) Se o xilema é bloqueado. Observe o padrão de bandas do DNA de cada embrião e responda: a) Dentre os embriões analisados. Abandonadas. também hipotética. qual é o padrão de bandas (I. quais NÃO deverão apresentar a disfunção muscular quando adultos? b) Supondo que os quatros embriões sejam irmãos.com. A presença do marcador no genoma de um indivíduo pode ser visualizada como uma banda. gêmeos dizigóticos. No entanto.3 O teste de paternidade usando o DNA tornou-se muito freqüente hoje. II. nascendo destas relações Alfredo. quais as principais deficiências que a planta sofre? Justifique. uma vez que pode ser associada com algum fenótipo em particular. nascendo Renato. os jornais e a revista científica internacional "Nature" publicaram com destaque um grande feito de um grupo de cientistas brasileiros.gene. conhecida como amarelinho. As frases a seguir constam numa lista de "mitos e verdades sobre o teste de DNA" encontrada na internet (http://www. podemos descobrir se um embrião poderá apresentar uma determinada característica ou doença genética pela análise de seus marcadores. O xilema das plantas produtoras de laranja é parcialmente bloqueado. reduzindo a produção. determinando o Juiz a realização dos testes de DNA. as pessoas têm muitas dúvidas a respeito desse tipo de exame.15. É possível determinar o pai de um recém-nascido quando a dúvida sobre a paternidade desse recém-nascido está entre gêmeos univitelinos? Justifique sua resposta. Detectou-se ainda que esses marcadores ocupam o MESMO loco.Questão 342 Considerando situações hipotéticas. Maria manteve relações sexuais com dois irmãos. 70 . ter um descendente com essa disfunção muscular? Questão 344 Recentemente. O esquema abaixo representa a análise de marcadores de DNA de quatro embriões humanos (I. III e IV). Responda: a) sobre a paternidade de qual criança o juiz pronunciou-se? b) por que não pôde o juiz se pronunciar sobre a paternidade da outra criança? Questão 343 Com técnicas de biologia molecular é possível verificar a presença ou não de certas regiões de interesse na fita de DNA. a Justiça pronunciou-se sobre a paternidade de uma das crianças e ficou impossibilitada de pronunciar-se sobre a paternidade da outra criança.

b) A cápsula do 'Bacillus anthracis'. utilizados pelo homem. Pergunta-se: a) Qual é o nome genérico que se dá a estas enzimas? 1.5 a) Explique a utilidade dos plasmídios bacterianos no desenvolvimento de técnicas de DNA recombinante. contendo um gene que. "O exame de DNA só pode ser feito com sangue. e é atenuada quando um deles está ausente. a) Qual é a função das endonucleases de restrição e a das ligases na aplicação da tecnologia anteriormente citada? b) Explique como a tecnologia do DNA recombinante participa no processo de produção de organismos transgênicos. por exemplo. Um vírus é inserido nas células." II. as moléculas de ácidos nucléicos da célula passaram a ser exploradas através da utilização de novas metodologias. "Ele já morreu e não deixou nenhum outro parente vivo. em células do pâncreas. e os da cápsula por genes existentes no plasmídeo pX02. indústria ganharam alternativas eficientes para a produção." III. De acordo com a técnica esquematizada a seguir. conhecidas como tecnologia do DNA recombinante. não possui antígenos capazes de provocar reação imunológica protetora em mamíferos. está diretamente associada à presença conjunta dos componentes toxina e cápsula bacteriana. clonados em bactérias ou vírus. ao contrário da toxina.5. "Sou primo da mãe e estou com medo do resultado ser positivo. 71 . Dentre as linhagens apresentadas. que genes humanos que codificam proteínas de interesse médico ou comercial sejam extraídos. Justifique sua indicação. de determinadas proteínas. o que permite. indique a que pode ser utilizada na elaboração de uma vacina composta por bactérias vivas com virulência atenuada. que foram obtidos a partir da aplicação da tecnologia do DNA recombinante. Os constituintes da toxina são codificados por genes existentes no plasmídeo pX01. que passam a produzir sistematicamente tais proteínas. Questão 348 A partir da década de 70. causador do antraz. e depois sejam transferidos para animais de laboratório." Justifique por que cada uma das frases constitui um "mito". qual deve ser o papel desempenhado por elas? d) Como são chamados os organismos que recebem e incorporam genes de outra espécie? Questão 350 CONVERSÃO CELULAR: Cientistas israelenses induzem células hepáticas a produzir insulina em laboratório e propõem técnica para tratar diabetes tipo 1. mesmo que eu não seja o verdadeiro pai. Questão 347 A virulência do 'Bacillus anthracis'. c) Cite dois produtos. a medicina e a b) O que confere a especificidade a estas enzimas? c) Na natureza.I. Por meio dessa tecnologia. células de fígado são cultivadas em laboratório. em grande escala. Questão 349 Na tecnologia do DNA recombinante são utilizadas enzimas bacterianas que têm a propriedade de cortar a molécula de DNA em pontos específicos. que antes eram disponíveis em quantidades extremamente reduzidas. O esquema abaixo representa quatro diferentes linhagens de 'Bacillus anthracis'. Nunca poderei provar que ele era o pai do meu filho.15.

6 72 .o ovócito transplantado é induzido a proliferar. Por esse motivo. 3 . já estão plantando as sementes da terceira safra de milho.o núcleo de uma célula do paciente é transplantado para um ovócito maduro. b) Qual é a vantagem da terapia gênica descrita. O esquema a seguir apresenta algumas etapas dessa técnica. Conceitue os organismos transgênicos.5 1.15. respectivamente: a) o pareamento das bases? a‚) a ação das enzimas de restrição? aƒ) a ação da DNA ligase? b) "Os agricultores americanos.5. a técnica de DNA recombinante vem sendo utilizada na pesquisa e no desenvolvimento. As células se diferenciam em cultura.5. responda os itens a seguir. algodão e soja transgênicos.5 Com relação ao procedimento descrito. Questão 352 A melhor fonte de células-tronco são os embriões em estágios iniciais de desenvolvimento.ao atingir o estágio de blástula. 1.está ligado à produção de insulina. Os cientistas acreditam que as células transformadas possam futuramente ser usadas no combate ao diabetes tipo 1. Em quais delas se desenvolvem. a) Cite UMA desvantagem do uso de vírus como vetores de terapia gênica. cujo núcleo foi previamente removido. em local próximo à lesão. de vacinas e medicamentos. há interesse em usá-las para reparar danos de tecidos que normalmente não se regeneram. da revista Época. quando comparada ao tratamento de diabéticos com transplante de células de pâncreas de indivíduos mortos? Questão 351 Na engenharia genética. 8 de junho de 1998). por exemplo. 2 .15. a) Analise as etapas I. ficando mais parecidas com as que existem no pâncreas (células beta). as células do embrião são separadas umas das outras e injetadas diretamente no paciente." (Adaptação do artigo "Revolução invisível na mesa".15. II e III. Atualmente é possível produzir células-tronco heterólogas (retiradas diretamente de um embrião qualquer) ou homólogas. O procedimento para o preparo de células-tronco embrionárias homólogas está ilustrado de modo simplificado a seguir e envolve as seguintes etapas: 1 . por exemplo.5. 1. pois essas células indiferenciadas podem se transformar em qualquer tecido.

os linfócitos T CD4.a) Explique por que indivíduos transplantados com células-tronco embrionárias. É ela que os glóbulos brancos reconhecem e procuram atacar. Esse indivíduo. que fica espetada na membrana do vírus.7. A HA se liga à superfície de uma célula. Questão 353 Leia atentamente o texto adiante e responda as perguntas propostas a seguir: "A gripe é uma das doenças que mais matou na história do homem. o conteúdo do vírus . apresentam duas populações de mitocôndrias diferentes em seus tecidos. As autoridades sanitárias também atribuíram o alto número de casos em crianças abaixo de um ano ao fato de muitas mães nunca terem recebido a vacina contra o sarampo. Foram essas infecções. quanto heterólogas. que ainda ocorrem todo o ano. nesse indivíduo. Suas epidemias.é liberado no interior da célula. apareceram. Os heterozigotos (Ss) apresentam forma atenuada da anemia.1 Note que. não teve acesso a tratamento algum durante o período mostrado. Por quê? b) Por que uma pessoa que teve sarampo ou foi vacinada fica permanentemente imune à doença? De que forma a vacina atua no organismo? Questão 356 A anemia falciforme é caracterizada por hemácias em forma de foice. Toda a interação inicial entre vírus e célula do paciente ocorre através da HA. em geral. Dentro dessa bolsa. Por que pacientes infectados com HIV e não tratados sofrem. parasitas e bactérias. a) Se a mãe já foi vacinada ou já teve sarampo. de infecções oportunistas? Questão 355 Notícias recentes veiculadas pela imprensa informam que o surto de sarampo no Estado de São Paulo foi devido à diminuição do número de pessoas vacinadas nos últimos anos. Questão 354 O gráfico a seguir mostra a variação do número de um tipo de leucócitos. tanto homólogas. E em ausência da malária? b) Qual é a explicação para o fato dos heterozigotos para anemia serem resistentes à malária? 73 . Dessa forma. já assustaram mais do que a AIDS. a) Explique o que é esperado para a freqüência do gene S em presença da malária. portador da síndrome de imunodeficiência causada pelo vírus HIV (AIDS/ SIDA). que levaram o paciente à morte. em função da produção de moléculas anormais de hemoglobina. incapazes de transportar o gás oxigênio. e da quantidade de vírus HIV no sangue de um indivíduo ao longo do tempo. As mutações ocorrem numa proteína chamada HA. que faz com que a membrana do vírus se funda com a membrana da célula. o aumento da acidez provoca a mudança de forma na HA. b) Explique por que o uso de células-tronco embrionárias homólogas reduz potencialmente os problemas pós-tratamento para os pacientes. somente após cerca de 60 meses. As epidemias. onde a malária é endêmica. mesmo que já tenha tido uma forma da doença? b) Explique como o vírus consegue "enganar" uma célula e infectá-la. infecções oportunistas por fungos. Indivíduos com anemia falciforme são homozigotos (SS) e morrem na infância.seu material genético ." a) Por que o sistema imunológico de uma pessoa não reconhece um vírus mutante. quase sempre no inverno. a célula solta ácidos para digerir o vírus. No entanto. Na África. e ele continua sua reprodução sem ser molestado. o bebê fica temporariamente protegido contra essa doença. os indivíduos heterozigotos para anemia falciforme são resistentes à malária. ocorrem quando o vírus sofre uma mutação que o torna mais virulento e irreconhecível pelos sistemas imunológicos das pessoas infectadas. fazendo com que ela acione suas defesas e "engula" o vírus com uma bolsa digestiva. e não o vírus propriamente dito. 1.

os zangões e as operárias. a) Como se chamam as estruturas mais vistosas e atraentes destas flores. em vez de ser introduzido o gene da petúnia que define a cor azul. Seu pai. tratando-o com soro antiofídico. o oxigênio tem 74 . possuem tal enzima. apesar de não tê-la tocado. Indique se há ou não possibilidade de produção de rosas azuis nesse caso e justifique sua resposta. mesmo sem ver a cobra.2004. não é possível obter rosas dessa cor. Questão 360 Uma importante realização da pesquisa científica brasileira foi o seqüenciamento do genoma da bactéria 'Xylella fastidiosa'. entretanto. Sabendo-se que as fêmeas férteis de 'Apis mellifera' têm 32 cromossomos. indique o número cromossômico dos indivíduos de cada uma das castas e descreva como ocorre a diferenciação em castas nesses insetos. a) Que processo fisiológico da planta é diretamente prejudicado pela presença da bactéria? Justifique. a) Que característica desse réptil levou o pai a deduzir que se tratava de cobra peçonhenta? Cite outra característica morfológica facilmente identificada na maioria dessas cobras. a técnica recentemente utilizada consistiu no seguinte: o gene da enzima que produz o pigmento azul. com o objetivo de produzir rosas azuis. O nome da bactéria deriva do fato de que ela se estabelece nos vasos do xilema da planta hospedeira. foi picado por ela. Encontra-se em fase de teste uma técnica que possibilita inserir em células de roseira o gene da petúnia responsável pela codificação da enzima que produz o pigmento azul. b) Qual é a substância imunológica presente no soro antiofídico responsável pela inativação do veneno? Como este soro é produzido? Questão 359 A indústria de flores movimenta bilhões de dólares por ano e está continuamente buscando criar novas variedades. pois a enzima que sintetiza esse pigmento está ausente nas roseiras. C†H‚O† + 6 O‚ ë 6 H‚O + 6 CO‚ Em virtude de sua configuração eletrônica. mas não eram consideradas azuis verdadeiras. b) Suponha que. delfinidina. seria o indicado para receber esse gene e justifique sua resposta. b) Não se pode atribuir à 'Xylella fastidiosa' a morte das células que constituem os vasos do xilema maduro. As petúnias. deduziu que ela era peçonhenta e socorreu o filho. pois participa do processo de extração de energia dos alimentos. conforme exemplificado pela reação abaixo. Questão 358 Um menino colocou a mão em um buraco onde havia uma cobra e. um biólogo.07. a) Cite o tipo de célula indiferenciada de roseira que. Pelos métodos tradicionais. de 1Ž. Anteriormente. como aceptor final de elétrons. como uma rosa azul. causadora da doença chamada amarelinho ou clorose variegada dos citros (CVC). Segundo o jornal "The Japan Times on line". Por quê? c) Em que consiste o seqüenciamento de um genoma? Questão 361 Esforços de cientistas criaram a primeira rosa do mundo com pigmento para cor azul. foi extraído do amor-perfeito e ativado nas rosas.Questão 357 As abelhas vivem em colônias constituídas por indivíduos de três castas: a rainha. rosas de coloração azul já eram produzidas através de cruzamento. fossem inseridas cópias de seu RNA mensageiro. que passaram a ter cor azul? Qual o significado biológico do fato de certas plantas apresentarem flores com cores tão vistosas? b) Qual é a relação entre esta técnica recente para a produção de flores azuis e aquela empregada para a produção de alimentos transgênicos? Questão 362 O oxigênio é um elemento imprescindível à manutenção da vida dos seres aeróbicos.

quais são geneticamente idênticos? Justifique sua resposta.10. denominadas espécies reativas de oxigênio. hoje já estão sendo comercializadas insulina e somatotrofina (ou somatropina) humanas produzidas por bactérias. Questão 367 Uma mulher teve uma menina em sua primeira gravidez. indique a etapa responsável pela formação de espécies reativas de oxigênio e o local da célula onde essas reações ocorrem. o que são gêmeos? b) Analisando a figura. qual é a probabilidade de que esse alelo também esteja presente no outro gêmeo? Questão 366 O esquema a seguir resume a seqüência do desenvolvimento de irmãos gêmeos: 1. Questão 364 Uma conquista recente no campo da biotecnologia é o uso de bactérias para a produção de proteína animal de interesse comercial. sem alterar. ocorrendo o mesmo na sua segunda gestação.10. acarretando a substituição de uma base guanina por uma adenina. a estrutura primária da proteína codificada pelo gene. primo em primeiro grau e irmão gêmeo dizigótico. Qual o percentual esperado de ocorrência desse fato? Questão 368 A figura adiante representa o fenômeno biológico que ocorre com um tipo de célula que sai do vaso sangüíneo para exercer sua função no tecido conjuntivo. Por exemplo.9 a) Sob o ponto de vista embriológico. fato que pode induzir mutações tanto em células somáticas quanto em células germinativas. causam alterações. Questão 365 Em uma gravidez gemelar. Essas moléculas.forte tendência a receber um elétron de cada vez. o par de gêmeos é do sexo masculino. Questão 363 Em um hospital. 1. a) Considerando o processo de oxidação completa da glicose pela célula eucariótica. Dispõe ele dos seguintes doadores: tio. por serem muito reativas. que são fortes agentes oxidantes. inclusive no DNA. dando origem a moléculas intermediárias. Pergunta-se: a) Qual dos parentes você escolheria como doador do órgão? b) Justifique sua resposta. a) Estes gêmeos devem ser monozigóticos ou dizigóticos? Por quê? b) Se um dos gêmeos herdou o alelo dominante A de sua mãe heterozigótica Aa. um indivíduo necessita de um transplante de rim. a) Em que locais do corpo humano são produzidas essas proteínas e qual é a principal função de cada uma delas no organismo? b) Explique sucintamente o processo por meio do qual se modificam bactérias para que elas passem a produzir proteínas humanas. b) Uma espécie reativa de oxigênio induziu uma mutação no gene de uma célula. porém. Justifique por que não houve alteração da estrutura da proteína.11 75 . amigo.

e) 3:1. ainda servem de veículo de transporte para a vitamina E. respectivamente. pois a mesma é lipossolúvel.5. Muitos pesquisadores.folha coberta com cera c . As plantas de amendoim podem apresentar folhas com pecíolo normal ou curto. b) Qual a importância do fenômeno apresentado para a função desta célula? Questão 369 A enzima transcriptase reversa é encontrada em retrovírus. sais minerais e vitaminas. se o alelo para pecíolo curto for recessivo. Questão 370 O texto abaixo refere-se às questões: ** a ** O cruzamento entre plantas de variedades diferentes de uma mesma espécie é muito utilizado para a obtenção de cultivares mais produtivos.5. carboidratos. uma com pecíolo normal e outra com pecíolo curto. Para determinar qual alelo é dominante.1. se o alelo para pecíolo normal for dominante. plantas com pecíolo normal e com pecíolo curto.a) Identifique esta célula e nomeie o fenômeno biológico apresentado. Descreva a função da transcriptase reversa no mecanismo de replicação do vírus da Aids. se o alelo para pecíolo curto for dominante. c) folha sem cera. referentes à folha e à semente. d) folha com cera. o fenótipo que apresenta o maior número de genótipos possíveis é a) semente com "pêlos". na proporção de a) 1:1. P . c) 2:1. procuram descobrir novas substâncias que sejam inibidoras específicas dessa enzima. em F2. 1.folha sem cera Os gráficos a seguir mostram a composição dos alelos para essas duas características nas plantas parentais. característica determinada por um gene. Questão 372 O amendoim é uma planta originária da América do Sul. b) semente lisa.2. d) 3:1.semente lisa C . b) 1:2:1. Considere que duas das características dessa planta.1 76 . Espera-se encontrar. se o alelo para pecíolo normal for recessivo. conforme a lista a seguir. com dois alelos. foi feito um cruzamento entre duas linhagens puras. são definidas por alelos segregados independentemente. se os alelos forem codominantes. Dois espécimes de variedades diferentes de uma planta oleaginosa foram cruzados visando à obtenção de uma variedade mais resistente à seca. Os ácidos graxos insaturados presentes no amendoim. proteínas. atualmente. Sua importância econômica está relacionada ao fato das sementes possuírem sabor agradável e serem ricas em óleo. O gráfico que representa o número de alelos encontrados na mitose de uma célula obtida de uma planta resultante do cruzamento entre os parentais é: Questão 371 1.1 Das combinações possíveis resultantes do cruzamento entre esses mesmos parentais.semente com "pêlos" p .

em algum cromossomo. d) a crença da população pode ser explicada pelo fato de o sangue do feto ser fornecido pela mãe. Questão 375 O texto abaixo refere-se às questões: Notícia de algum jornal do futuro. diz a pesquisadora. por mutação no gene responsável pela produção de pigmento na casca do fruto.. b) a população não está tão equivocada.. espera-se que essas pragas mantenham-se afastadas dos pomares de vacinas.Uma pequena cidade interiorana do Nordeste brasileiro chamou a atenção de pesquisadores da Universidade de São Paulo pela alta incidência de uma doença autossômica recessiva neurodegenerativa. não interferem na eficiência das plantas transgênicas como produtoras de vacinas.. as plantas apresentam resistência aos nematóides que atacavam a raiz principal do sistema axial desses vegetais. incapazes de produzir sementes. c) em situações como a descrita. Apesar de passar por todas as etapas do ciclo reprodutivo. então no . Com o cultivo das novas variedades de cerejas resistentes.) Pelas informações fornecidas no texto. as substâncias que. e o processo cessa nas primeiras divisões celulares do zigoto.... b) homens e mulheres têm a mesma probabilidade de apresentar a doença. técnicas especiais de cruzamento foram aplicadas em dois tipos de cerejeiras transgênicas.. resultando na obtenção de plantas triplóides (3n = 72). verde. que foi introduzida para ser transcrita e originar um . roxa e branca) haviam sido obtidas. O destaque da campanha de vacinação. Da mesma forma. determinando o desenvolvimento da resposta imunológica. Questão 374 Em relação à crença da população sobre o processo de transmissão de características hereditárias.. que. existe uma . e) a crença da população não faz o menor sentido. sem sementes. nos frutos... por algum tempo...seqüência de aminoácidos . Outro dado interessante levantado pelos pesquisadores foi que a população da cidade acredita que a doença seja transmitida de uma geração a outra através do sangue. neste ano. podemos afirmar que: a) no século XIX.. julho de 2005.. Segundo a bióloga Josefa da Silva.. podemos afirmar que: a) pais saudáveis de filhos que apresentam a doença são necessariamente homozigotos. INICIA A CAMPANHA NACIONAL DE VACINAÇÃO CONTRA SARAMPO E TUBERCULOSE.. é a utilização de cerejas coloridas. ao ser traduzido. a) núcleo . Outra inovação dessas cerejas é a resistência às moscas Anastrepha fraterculus que. Assinale a alternativa que completa as lacunas de modo correto. resulta em produto que determinara o desenvolvimento da resposta imunológica. nos últimos anos. As formas mutantes para esse loco. estabeleceram-se como pragas importantes do cultivo de cerejas-vacina. depois de liberadas pela digestão.....RNA mensageiro b) citoplasma . anteriormente.. d) pais heterozigotos têm 25% de probabilidade de terem filhos também heterozigotos..proteína . responsável pela equipe que desenvolveu os novos frutos. c) este é um exemplo claro no qual o conhecimento elaborado pelo senso comum coincide com os conhecimentos atuais dos cientistas. As pesquisas realizadas revelaram que é também alto o número de casamentos consangüíneos na cidade. e) pais heterozigotos têm 50% de probabilidade de terem filhos que irão desenvolver a doença. Elas continuam apresentando. (Pesquisa FAPESP.. As novas cores (amarela. Se as cerejeiras referidas no texto são transgênicas. das células dessas plantas. casamentos consangüíneos não aumentam a probabilidade de transmissão de doenças recessivas. pois os genes estão presentes apenas nas células sangüíneas e nas células germinativas... muitos cientistas também acreditavam que as características genéticas eram transmitidas pelo sangue.. não há a formação de endosperma.RNA transportador 77 ** a ** .... ligam-se á membrana plasmática dos linfócitos e sofrem endocitose. uma vez que células sangüíneas não apresentam as estruturas básicas que guardam as informações genéticas.

Questão 379 Analise os dados apresentados a seguir. e) apenas II e III. que trata dos tipos e percentuais de gametas produzidos por um indivíduo de genótipo não divulgado (indivíduo parental).) mutação no gene responsável pela produção de pigmento (.4% Ab = 2. pode-se afirmar: ( ) a doença é causada por um alelo recessivo.seqüência de aminoácidos . ( ) Os diversos aminoácidos unem-se através de ligações do tipo éster.6% aB = 2. pequenas moléculas de RNA transportador (RNAt).o anticódon.)" e "As formas mutantes (obtidas) para esse loco (. unem-se ao RNAm por uma seqüência de três bases . Um pesquisador apresentou a seus alunos o heredograma a seguir. ( ) Cada códon do RNA mensageiro determinará a colocação de um aminoácido específico na cadeia polipeptídica.RNA mensageiro d) núcleo .. Questão 377 O texto abaixo refere-se às questões: ** a ** Na(s) questão(ões) a seguir escreva nos parênteses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa.RNA mensageiro e) citoplasma . ( ) trata-se de um caso de herança parcialmente ligada ao sexo.RNA transportador Questão 376 A partir das informações do texto. ( ) No local onde houver um ribossomo.Se a coloração branca for recessiva.os códons. ligadas a aminoácidos.As mutações responsáveis pelas cores da cereja ocorreram em vários cromossomos. ( ) a doença é causada por um alelo dominante.6% ab = 47. Sabendo-se que os indivíduos afetados estão representados em negrito e os normais em branco.4% 78 1. a uma proteína funcional. II .. d) apenas III.. ( ) trata-se de um caso de herança ligada ao sexo.proteína . Ill . pode(m)-se afirmar: I . "(. será possível obter plantas com frutos coloridos a partir do cruzamento de plantas com frutos brancos. dando formação. relativo a uma certa doença observada por ele em humanos. ao final da leitura do RNAm. ( ) O processo de síntese de proteínas a respeito do citoplasma é também conhecido como transcrição genética. b) apenas II. se uma planta heterozigota para esses alelos apresentar frutos com a casca roxa. ( ) é um caso de polialelia com epistasia recessiva. ( ) A molécula de DNA transcreve no núcleo uma molécula de RNA mensageiro (RNAm) com várias seqüências de três bases .. AB = 47.)".5. Questão 378 As proposições a seguir são relativas ao processo de síntese de proteínas nas células vivas.O alelo responsável pela "casca roxa" será considerado dominante em relação ao alelo que determina a "casca verde". c) apenas I e II..seqüência de nucleotídeos .c) núcleo . Esta(ão) correta(s) a) apenas I.1.4 ..

O embrião se desenvolveu e deu origem ao clone. muitas vezes. através dos pareamentos de aminoácidos. um heterozigoto "Cis". anteriores aos citados. Ainda hoje. uma mistura de índios. Nosso chimarrão nos identifica em qualquer parte do mundo. Está(ão) correta(s) a) apenas I. convivemos com grupos indígenas. Diante da relevância do contexto e da vontade de valorizar o nosso povo nativo. A. brancos e negros. através dos vestígios materiais encontrados nas pesquisas arqueológicas. L. Santa Cruz do Sul: EDUNISC. organizador. A célula reconstituída foi estimulada para entrar em divisão. II. Questão 380 O texto abaixo refere-se às questões: ** a ** A seqüência a seguir indica de maneira simplificada os passos seguidos por um grupo de cientistas para a clonagem de uma vaca: I. portanto. mãe de aluguel.2% dos gametas são recombinantes. ( ) O indivíduo parental é um heterozigoto AB/ab e. "o índio". desprezando-se o resto da célula. for a mãe biológica da vaca W. ( ) O indivíduo parental é um heterozigoto aB/Ab. como os Kaingáng. IV.8% das células meióticas que originaram estes gametas. III.. deixaram-nos um legado que. O núcleo foi isolado e conservado. pode-se inferir que ocorreu quiasma entre os locos "A" e "B" em 94. e) apenas II e III. italianos e de outros povos. utilizada como "mãe de aluguel". uma pentose e um radical "fosfato". III. apenas b) W. obtendo-se um óvulo anucleado. determinando uma distribuição 1:1:1:1: ( ) 5.2% dos gametas apresentam combinações alélicas diferentes daquelas existentes nos cromossomos do indivíduo parental. O núcleo foi desprezado. apenas e) Z. alemães. formando ligações fosfo-diéster. b) apenas II. as três raças se mesclam em nossos descendentes. um heterozigoto "Trans". protagonizaram a nossa história. Retirou-se um óvulo da vaca Z. 79 . d) apenas I e II. apenas d) Z e da W. Após algumas divisões. o embrião foi implantado no útero de uma terceira vaca Y. W e Y Questão 381 Se a vaca Y. II. c) apenas III. foi selecionada a área temática CULTURA e as questões foram construídas com base na obra "Os Primeiros Habitantes do Rio Grande do Sul" (Custódio. duas cadeias polinucleotídicas paralelas e complementares entre si. B. ( ) Considerando que 5. a) Z. sabemos que outros povos.( ) Trata-se de um caso de genes de segregação independente. W e Y não têm parentesco. apenas c) Y. "Nossos ancestrais. diferencia-nos. a porcentagem de genes da "mãe de aluguel" presente no clone será a) 0 % b) 25 % c) 50 % d) 75 % e) 100 % Questão 382 A história da maioria dos municípios gaúchos coincide com a chegada dos primeiros portugueses. No entanto." O DNA presente nas mitocôndrias tem composição e estrutura típicas desse tipo de ácido nucléico. IPHAN. uma cadeia de nucleotídeos em que as bases nitrogenadas interagem. Retirou-se uma célula da glândula mamária da vaca W. nucleotídeos que são compostos por uma base nitrogenada. ainda hoje. 2004). pode-se afirmar que o animal resultante da clonagem tem as características genéticas da vaca. O núcleo da célula da glândula mamária foi introduzido no óvulo anucleado. Considerando-se que os animais Z. portanto é formado por I. ou seja.

vasos e capilares transportando gases. d) Quando a malária for erradicada. c) Pedro. c) inversão de um par de bases no DNA. com alteração do aminoácido codificado e da proteína correspondente. tem um filho O. Um adulto de peso médio tem cerca de 5 litros de sangue em circulação. ser heterozigoto deixará de ser vantagem. circula pelo coração. com tipo sangüíneo O. mas tem dúvidas sobre qual dos três namorados é o pai da criança: João tem tipo sangüíneo A. onde a anemia falciforme não sofra influência de outros fatores e onde novas mutações não estejam ocorrendo. Considere os segmentos de DNA a seguir: rata-se de um caso de mutação por a) perda de um par de bases no DNA. mas não da proteína correspondente. Questão 386 O sangue. Questão 385 O esquema a seguir mostra a seqüência do DNA que leva à formação da hemoglobina normal e a que leva à formação da hemoglobina alterada. haverá mudança na freqüência gênica da população. Questão 384 Verificou-se que em populações de regiões onde a malária é endêmica. e) José ou Pedro. Rh−. É condicionada por um alelo mutante s. Uma mãe.3 A anemia falciforme ou siclemia é uma doença hereditária que leva à formação de hemoglobina anormal e. Nesse caso são verdadeiras as afirmações a seguir. d) inversão de um par de bases no DNA. Questão 387 O texto abaixo refere-se às questões: ** a ** Na(s) questão(ões) a seguir escreva nos parênteses a soma dos itens corretos. Rh−. Supondo populações africanas com incidência endêmica de malária. com alteração do aminoácido codificado. c) O indivíduo Ss leva vantagem em relação ao SS. O indivíduo SS é normal. sem alteração do aminoácido codificado.9. e) s tende a aumentar. b) S tende a diminuir. EXCETO: a) A malária atua como agente seletivo. Ela 80 .Questão 383 O texto abaixo refere-se às questões: ** a ** 1. O geneticista consultado informou que o pai pode ser a) João. os heterozigotos (Ss) são mais resistentes à malária do que os normais (SS). e) inversão de um par de bases no DNA. b) adição de um par de bases no DNA. o Ss apresenta anemia atenuada e o ss geralmente morre. nutrientes etc. d) s permanece constante. Rh®. Doença pode ser definida como um desequilíbrio do organismo ou ausência de bem-estar físico e mental. sem alteração do aminoácido codificado. artérias. d) João ou José. que é constituído por plasma e algumas células especializadas.5. de hemácias que se deformam. José tem tipo AB. Rh®. Rh® e Pedro é A. conseqüentemente. e) Quando a malária for erradicada. a freqüência do gene a) S permanece constante. b) José. c) S tende a aumentar. b) O indivíduo ss leva vantagem em relação ao SS. sem alteração do aminoácido codificado.

Muitas vezes. através do material genético. encontra barreiras de ordem ética. independentemente do sexo. (02) Doenças genéticas são aquelas causadas por alterações do patrimônio genético e podem passar de pais para filhos. (02) O material genético do doador das células e do clone é idêntico. seu clone possuirá. Soma = ( ) Questão 388 Considerando inclusive a possibilidade de permuta genética. No homem. os cientistas provocam modificações nessas espécies em busca de seus benefícios e atuam à semelhança da natureza. (16) Doenças transmissíveis são as transmitidas por patógenos ou por seus produtos. certamente será hemofílica. (08) A B D (16) a B D (32) portador apenas de D. (02) a b D (04) portador apenas de B ou d.pode ter inúmeras causas e variar de intensidade e manifestação. a ciência do melhoramento genético procura encontrar soluções que aumentem a produtividade de certas espécies. (08) Um homem hemofílico teve uma filha normal. filha de um indivíduo hemofílico. nascerá sem o referido membro. casado com uma mulher homozigota normal. sem alelos A e D. Com base nesta informação. (08) Doenças funcionais resultam do mau desempenho ou da perda de um órgão ou sistema. essa anomalia. podendo resultar em fratura de ossos. A probabilidade desta mulher ter uma criança do sexo masculino e hemofílico é igual a 1/4. usando técnicas sofisticadas. terá todos os seus filhos normais. terá 50% de seus filhos afetados. Sobre esse processo é CORRETO afirmar: (01) Os clones são como irmãos gêmeos fraternos do doador das células. casado com uma mulher homozigota normal. Soma ( ) Questão 390 O texto abaixo refere-se às questões: ** a ** Na(s) questão(ões) adiante. Soma ( ) (04) Se o doador das células possuir um defeito genético. 81 . é correto afirmar: (01) Um homem hemofílico. sem alelos B e D. como o albinismo. por esse processo. escreva no espaço apropriado a soma dos itens corretos. Questão 391 Em parte motivada pela necessidade mundial de aumentar a produção de alimentos. (64) A b D Soma ( ) Questão 389 Clones são seres vivos obtidos pelo desenvolvimento de células retiradas de indivíduos já existentes. hemorragias. (32) O mongolismo é um exemplo de doença hereditária. o gene (h) para hemofilia está localizado no cromossoma X e é recessivo em relação ao gene (h+) para coagulação normal do sangue. é CORRETO afirmar: (01) O alcoolismo. também. etc. o organismo originado posteriormente. o tabagismo e a dependência de outras drogas são exemplos de causas que podem resultar em doenças. em humanos. sem alelos A e B. (08) Órgãos transplantados do clone para o doador das células serão sempre rejeitados. Com relação a esse tema. Leia o texto adiante e compare-o com o esquema. (04) Um homem hemofílico. (16) Já existem seres humanos que foram originados e desenvolvidos plenamente por clonagem. (04) Doenças traumáticas são aquelas que se originam de acidentes. um indivíduo portador do genótipo ABD//abD poderá produzir os seguintes gametas: (01) Portador apenas de A ou a. enquanto a eritroblastose fetal é uma doença congênita. A clonagem é um processo que vem sendo desenvolvido rapidamente com vários organismos e. independentemente do sexo. (32) Se o doador de células sofrer a perda de um membro antes de ser realizada a clonagem. (02) Uma mulher.

Esse problema pode ser evidenciado no dia-a-dia. Essa proteína. e) Aa x Aa. No caso dessa criança. constata que a criança possui ausência de enzimas oxidases em uma das organelas celulares. escolheram e reproduziram aquelas cujas plantas apresentassem a capacidade de produzir uma proteína inseticida" está relacionada aos itens 3 e 4 do esquema. Abaixo está transcrito um pequeno trecho de uma recente entrevista. nos testes experimentais. Entre S/G‚ algumas proteínas checam possíveis falhas e erros na linha de produção. GALILEU: "É correta a noção de que a maior parte dos 82 . conhecido como APOPTOSE. Diz também que a doença é muito grave. Questão 393 1. Soma = ( ) O ciclo celular é interrompido entre as fases G/S e G‚/mitose. quando ingerida com as folhas. com acentuado atraso psicomotor. em um tipo de organela de suas células. é encaminhada pelo pediatra a um geneticista clínico. (08) A afirmativa "nos testes experimentais. ao se colocar H‚O‚ em ferimentos. c) Aa x Aa. (04) A afirmativa "nos testes experimentais. (02) A afirmativa "Os cientistas alteraram o código genético dessas sementes" está relacionada aos itens 1. O geneticista clínico explica aos pais que a criança tem uma doença de origem genética. a inativação de qualquer um dos componentes ou operadores do sistema de checagem ou de apoptose poderia provocar a proliferação contínua das células e possível desenvolvimento de tumores cancerosos. a produtividade das lavouras será bem maior" refere-se ao item 6 do esquema. Livre dos mesmos. (16) A afirmativa "Livre dos mesmos. ou morte celular espontânea.5. 2 e 4 do esquema. Portanto. as enzimas que deveriam proteger contra a ação dos radicais livres. escolheram e reproduziram aquelas cujas plantas apresentassem a capacidade de produzir uma proteína inseticida.2 (01) A afirmativa "Os cientistas alteraram o código genético dessas sementes" está relacionada somente ao item 1 do esquema. é correto afirmar: Questão 392 Uma criança de aproximadamente 1 ano.15. após alguns exames. é monogênica com herança autossômica recessiva. Os cientistas alteraram o código genético dessas sementes e. 1/2. 1/8. da Universidade Federal de Minas Gerais. batata e algodão alteradas geneticamente em laboratório."Nos próximos meses chegam às lavouras dos Estados Unidos e Canadá sementes de milho. Qual é o genótipo dos pais da criança descrita no texto e qual a probabilidade de o casal ter outro filho com essa mesma doença? a) AA x aa. matava os insetos que atacavam as plantações. concedida à Revista Galileu pelo cientista Sérgio Danilo Pena. Este. decidem se o ciclo celular avança ou é paralisado iniciando um processo de destruição do material genético. 1/4. escolheram e reproduziram aquelas cujas plantas apresentassem a capacidade de produzir uma proteína inseticida" está relacionada aos itens 4 e 5 do esquema. b) Aa x aa. pois a criança não possui. a H‚O‚ "não ferve". Um exemplo observável das conseqüências de apoptoses é o descamar da pele após sua exposição prolongada a radiação solar intensa. a produtividade das lavouras será bem maior. 1/4. d) Aa x aa." (Veja. para destruir as pragas que atacam essas culturas. que liderou uma pesquisa genética sobre a composição étnica do povo brasileiro. 21/02/1996) Da comparação entre o texto e o esquema. e proteínas especiais controlam a evolução do ciclo celular das novas células. 1/8.

inesquecíveis companheiras de aventuras por vários tempos e espaços. seu "Hans Staden" 83 .brasileiros tem algum antepassado com pai branco europeu e mãe negra ou índia ?" PENA: "É. e às vezes sem confessar. As obras "infantis" de Monteiro Lobato ajudaram muito na formação de milhares de pequenos brasileiros que. das dragas (com as quais se escavou o Canal do Panamá). e se está no ponto em que está. EXCETO: a) O DNA do cromossomo Y e das mitocôndrias apresenta genes que determinam a cor da pele humana. b) O DNA mitocondrial é de origem materna. Questão 394 Instruções: Leia atentamente o texto adiante para responder às questões a seguir. só o tempo pode curar o grande defeito da humanidade . cinema . onde não faltam lições de fonética.. não custa lembrar que a campanha nacionalista de Lobato. pelos hieróglifos. custou-lhe seis meses de cadeia. Tudo quanto existe levou milhões de anos a formar-se.. telefone. Nesse mesmo livro. Benta uma verdadeira manifestação ecológica: ". passariam a citar de boca cheia.Mas que absurdo. Quanto ao petróleo. das roldanas. pelas revoluções do século XVIII. qualquer um admirará a facilidade com que se explica a formação e as propriedades do vidro. pelos tempos da cavalaria. as experiências realizadas por Emília e pelo Visconde geram monstros: ¢alteram o funcionamento de "Dona Pituitária" em insetos. do carvão. a adaptar-se. Emília é uma abelhuda crítica e irreverente. 3. fazendo coro com os alunos: ". que assim adquirem novas formas. aparecem logo muitas conseqüências £que não previmos. vai-se da origem do universo (sabiamente explicada pela vovó Benta como hipótese). passando pelo uso do fogo. Quanto da história e da mitologia grega não se aprende ao lado da boneca Emília. Meu caso é exatamente esse. num período especialmente sombrio da história do nosso país e trágico da história universal. de formação e de classes de palavras. até à chamada "era dos milagres". Em "Emília no país da Gramática". Benta acerca da clonagem e dos transgênicos? 4. reformar a natureza! Quem somos nós para corrigir qualquer coisa que existe? E quando reformamos qualquer coisa. Quixote" é alegre e comovente. Dona Benta (permito-me eu). MONTEIRO LOBATO (1882-1947) 1.e com o manejo atômico que deu na tragédia de Hiroshima. que é como Lobato batizou a vida com luz elétrica. proporções e propriedades. e seus brinquedos são cada vez mais fantásticos e perigosos.para que o escritor lhe apresentasse alguns dos "bichos de sete cabeças" da Matemática com a mesma graça e eficácia com que iniciara os meninotes nas frações e nos números complexos. jorra o precioso óleo em pleno sítio.. Já depois de ler a "Aritmética da Emília". pelos assírios e babilônios..que é ser muito criança ainda". uma porção de coisas que aprenderam com as personagens do Sítio do Picapau Amarelo.. o jovem leitor lamentará que Lobato não tenha entrado na Álgebra e na Geometria. Emília. do petróleo.Que peste é a tal Gramática!". Sempre foi intenção de Lobato ensinar sem ser chato. As adaptações que faz Lobato de obras ficcionais ou a recuperação de fatos históricos são também notáveis: seu "D. que tagarela pedantemente com Péricles ou com Hércules? Na "História do mundo para as crianças". que termina com esta frase da vovó sabida: "O tempo.. opinar sem ser pretensioso." A resposta do geneticista aliada aos seus conhecimentos permite afirmar. lendo a "História das invenções": são sugestivas as explicações sobre a operação das alavancas (que permitiu ao homem a construção das pirâmides). Também um iniciante na Física não pode se queixar. dos guindastes. que incluía a exploração estatal do "ouro negro" (como também a do ferro)." Que diria hoje D. pelo império romano. c) O cromossomo Y apresenta genes exclusivamente paternos. nas equações de todos os graus. o homem continua brincando.. Em "A reforma da natureza". dos moinhos. existem mil razões para isso. d) Pelo estudo acima. e não falta a chegada do técnico norte-americano para tentar tomar conta da situação e acabar escorraçado pelos indignados habitantes. somente o genoma de indivíduos do sexo masculino pode ser utilizado para a determinação da ancestralidade paterna. nas expressões. espantando os vizinhos e provocando em D. quando marmanjos. epílogo também do livro. 2. há esta frase da boneca que muito lingüista moderno poderia adotar como lema. nas seqüências e nas funções . Se Dona Benta é uma velha de óculos e muita leitura. em 1941. Meu cromossomo Y é europeu e meu DNA mitocondrial é ameríndio.. Em "O poço do Visconde".

a célula começa a destruir todo o DNA de seu núcleo. o quanto ela tem de orgânico.introduz o leitor num capítulo importante de nossa história colonial. Logo que essas instruções sejam recebidas e processadas. uma célula da camada germinativa da epiderme. como o fora antes da invenção de Watt". Questão 395 "Virtualmente. da difusão de novas seitas. conhecido por suas frases lapidares. essa vivíssima boneca de pano expressaria sempre um fundamento de malandragem. (Eurípides de Souza e Passos. cada aspecto da vida de nossas células é regulado por seu DNA. 1996. (02) GENÓTIPO é a constituição genética de um indivíduo. dizem alguns. Bolívar e Lincoln. As últimas instruções do DNA.combinação que. incluindo sua própria morte. 84 . referem-se à morte da célula. reuniu a seu modo as realidades de um país ainda arcaico e já moderno. Se num livro o autor se referia. 7. segundo a qual cientistas ingleses estão conseguindo transferir certos genes de bactérias para mosquitos anofelinos. humor e vivacidade crítica . resume algo de nosso "temperamento". dispondo-se a dali falar de tudo e a contar qualquer história (numa linguagem ao mesmo tempo exata. Sempre haverá a curiosidade nossa de saber o que Emília pensaria hoje da globalização. Estes genes teriam a capacidade de impedir a instalação de determinadas fases do protozoário 'Plasmodium' no estômago e nas glândulas salivares do mosquito.. b) transgênico útil para a erradicação da esquistossomose. De certa forma. enviadas ao citoplasma. provavelmente estaria batalhando pelo desenvolvimento sustentável. 32-5) Considere os seguintes fatos: I. "mais o ferro. Os termos a seguir fazem parte da nomenclatura genética básica. 5. O leitor que percorra essa obra notará. III. imaginativa e fluente. que morre e sofre queratinização. e) clonado útil para a erradicação da leishmaniose. Clark. forjado no caldeirão de raças e culturas de que procedemos. proveitosa e sempre polemizada pela palpiteira Emília.. uma célula do miocárdio morta por falta de oxigênio durante um ataque cardíaco. Ao instalar suas criaturas numa base rural. Benta" acerca da "clonagem" e dos "transgênicos"? Atualmente ela teria notícias freqüentes sobre técnicas de manipulação do DNA. Um exemplo delas constitui a matéria publicada recentemente em um jornal. (04) DOMINANTE é um dos membros de um par de alelos que se manifesta inibindo a expressão do outro. Esta. nem falta a apresentação de personagens como Marco Polo. ou morte programada das células." (Traduzido e adaptado de: William R. tudo parece fazer parte de uma didática natural. 6. está fadada a morrer. se vivesse nos dias de hoje. c) transgênico útil para a erradicação da leishmaniose. sem concessões à famigerada "literatura infantil"). A apoptose. processo este decididamente irreversível. foi o que deu a vitória aos ingleses. uma célula morta pelas toxinas produzidas por bactérias invasoras. New York: Oxford University Press. II. Sem isso. Esse exemplo refere-se à construção de um organismo a) transgênico útil para a erradicação da malária. em muitos pontos. em outro esse invento vem associado ao carvão-de-pedra que. p. Soube admirar tanto a mangueira frondosa quanto a técnica fecunda. Lobato parece ter querido reunir a beleza natural do primitivo ao encantamento pelo enciclopédico. contradição nossa até hoje. das ações terroristas. d) clonado útil para a erradicação da malária. dos conflitos religiosos. O que espanta nessa pluralidade é que nada surge como aleatório. . Assinale as alternativas que trazem o significado correto de cada um desses termos: (01) GENE é sinônimo de molécula de DNA. inédito) Que diria hoje "D. por exemplo à máquina a vapor. é verificada SOMENTE em a) I b) II c) III d) I e II e) I e III Questão 396 Na(s) questão(ões) a seguir escreva no espaço apropriado a soma dos itens corretos. Se nada mais sobrasse da obra de Lobato. SEX AND THE ORIGINS OF DEATH. partindo-o em milhares de pedaços que não mais conseguem enviar instruções úteis à célula. a Inglaterra seria um quase nada. apesar de poder continuar exercendo determinadas funções durante certo tempo.

do meu canteirinho de temperos ou da safra nacional de grãos. o descompromisso macunaímico dos nossos almanaques em papel ordinário. E me arrepiava a descrição do ataque à base naval de Pearl Harbor. pelo qual já se entrevia uma América (como os EUA gostam de se chamar) com ares de dona do mundo. Com o tempo. Já ouvi a expressão "cultura de almanaque". traz diversas indicações úteis.. por exemplo. E alguns professores sempre implicavam quando eu os contestava ou argüía. vi e venci" e "até tu. Pouco depois dos almanaques vim a conhecer as SELEÇÕES .é também uma constatação da astrofísica. porque despertavam a classe sonolenta. Um bom leitor de almanaque explica como uma bela expressão de Manuel Bandeira . aprendi a me especializar nas disciplinas curriculares. Não tinha o charme dos almanaques: levava-se muito a sério. poesias. horóscopo. e se nunca os fiz subir ou rodar era porque meu controle motor já não dava inveja a ninguém. ou a história de expressões como "vitória de Pirro". se viesse a cair dentro de uma. O "buscador" da HOME PAGE é uma espécie de oráculo de Delfos de efeito 85 . Adolescente. Acho injusto. a separar as chamadas áreas do conhecimento. receitas caseiras. conhecia todas as propriedades de uma carnaubeira. Um outro ensinava a fazer balão e pipa. provérbios. Deixei de lado os almanaques e entrei no funil apertado das tendências vocacionais.: charadas. misturava povos e séculos com grande facilidade. Talvez não seja inútil conhecer as dimensões das três pirâmides. recordes mundiais. Algum risco sempre havia: não foi boa idéia tentar fazer algumas experiências químicas com produtos caseiros. 3. o humor era bem-comportado. palavras cruzadas. caricaturas. O leitor não faz idéia do que cabia nesse etc. move-se!". 5. além do calendário do ano. enigmas policiais. da guilhotina francesa. a que vem ao caso: folheto ou livro que."o fogo de constelações extintas há milênios" . que eu achei familiar quando a li pintada no pára-choque de um fordinho com chapa 1932 (relíquia de um paulista orgulhoso?). esse almanaque multidisciplinaríssimo de última geração. das angústias de Colombo em alto mar.. mas ainda hoje me valho das informações de almanaque para explicar. Pegadinhas do tipo "quais são os números que têm relações de parentesco?" ou questões como "por que uma mosca não se esborracha no vidro dentro de um carro em alta velocidade?" não eram bem-vindas. a manejar um pião. Almanaque não se emprestava a ninguém: ao contrário de um bumerangue.pasme. de novo. Sim. Lembro-me de um exemplar que falava com tanta expressão da guerra fria e de espionagem que me proporcionou um prazer equivalente ao das boas páginas de ficção. Não tinha a galhofa. "vim. Em compensação. Como explicar ao meu leitor mais jovem o que é (ou o que era) um ALMANAQUE? Vamos ao dicionário. as matérias tinham um tom meio autoritário e moralista. astúcias da matemática. anedotas. do fracasso de Napoleão em Waterloo. Brutus?". Meu professor de Ciências fechou a cara quando lhe perguntei se era hábito de Arquimedes tomar banho na banheira brincando com bichinhos que bóiam. as SELEÇÕES talvez tenham sido o principal meio de difusão do AMERICAN WAY OF LIFE. dita em tom pejorativo. Lá está. curiosidades etc. leitor . da reunião do meu condomínio ou da assembléia da ONU. entro na Internet. 2. a concretização editorial do SLOGAN famoso: TIME IS MONEY. 6. 4. dicas de viagem. Tirando Hollywood. Agora sou autor do meu próprio almanaque. mas . descobri este emprego de cronista que me abre. entre outras acepções.(08) FENÓTIPO é a expressão do gene em determinado ambiente. a relação que Pitágoras encontrou não apenas entre catetos e hipotenusa. Eu não trocaria três exemplares do almanaque de um certo biotônico pela coleção completa das SELEÇÕES. Se fico sem assunto. com base no almanaque. trechos literários. o curso e o regime do rio São Francisco. Pense em algo publicável. nunca voltaria para o dono. da queda de Ícaro. Soma ( ) Questão 397 Cultura dos almanaques 1. fazia prodígios com ímãs e saberia perfeitamente reconhecer uma voçoroca. todas as portas do mundo: posso falar da minha rua ou de Bagdad.uma espécie de almanaque de luxo.READER'S DIGEST . de circulação regular e internacional. e minha professora de História fingiu que não me ouviu quando lhe perguntei de quem era mesmo a frase "E no entanto.entre o sentimento da melancolia e o funcionamento do fígado. (16) GENOMA é o conjunto de todos os alelos de um indivíduo. e lá estava.

2 milhões de toneladas na safra 2002/03. Esse fenômeno está intimamente ligado ao fato de ter sido neste século que os homens colocaram mais diretamente em questão a sobrevivência do planeta. Não é um balanço tranqüilizador. diria que. e) I. NO PAIN. no caso deles). Está(ão) correta(s) a) apenas I. d) apenas I e II. Um excelente químico pode imaginar um excelente desodorante. por alterar a seqüência de nucleotídeos do DNA. O benzeno.Paulo" de 23/09/03. O século que chega ao fim é o que presenciou o Holocausto. c) Pode haver cruzamento entre a cultura convencional e a geneticamente modificada. comunicação. como o benzeno. no Brasil. enfim. especialmente durante a transcrição e a tradução. mesmo em baixas concentrações.quase instantâneo. que podem ser exemplificados pelos esteróides. que.e isso ocorre com freqüência. cerca de 8% da produção nacional da soja é biologicamente adulterada. E o inglês. e) O desenvolvimento desta tecnologia poderá aumentar a produtividade em relação à tradicional. Holocausto: através das metáforas e das realidades que marcaram esses cem últimos anos. (Argemiro Fonseca) A produção brasileira de grãos ultrapassou 115. os massacres do Camboja e assim por diante. se globalizou pra valer: meus filhos já aprenderam.contaminantes biológicos. II e III. podem interferir no funcionamento dos seres vivos. O equivalente tecnológico da separação dos saberes foi a linha de montagem. Mas não sou. linha de montagem. o sentido de outro SLOGAN prestigiado. Assinale a alternativa que contém argumentos favoráveis à produção. NO GAIN (ou GAME. que se operou e continua a se operar em ritmos antes inconcebíveis. cada um é também liberado de qualquer responsabilidade. aparece a verdadeira doença do progresso. triunfo das massas. c) apenas III. velocidade. o que significa uma elevação de 19% em comparação à colheita anterior. apesar de todo esse avanço. d) Pode haver efeitos sobre várias espécies de insetos protetores da flora e de polinizadores. por ser mutagênico. o que representaria uma vantagem comercial ao país que os proíbe. da hélice ao turborreator e daí ao foguete interplanetário. Questão 398 A qualidade da água pode ser alterada por vários fatores: .5 milhões de toneladas.permitir o surgimento de novos alelos. de 96. Nesta. Mas o horror desses acontecimentos não reside apenas na quantidade. mas não possui mais o saber que lhe permitiria dar-se conta de que seu produto irá provocar um buraco na camada de ozônio. cada um conhece apenas uma fase do trabalho. b) O mercado europeu é resistente a este tipo de alimento. que é um agente mutagênico. na prática.. b) apenas II. Questão 399 O texto abaixo refere-se às questões: ** a ** Ação à distância. certamente. O custo dessa aceleração da descoberta é a hiperespecialização. Segundo a "Folha de S.. os regimes dos Grandes Irmãos e dos Pequenos Pais. deve I . Estamos em via de viver a tragédia dos saberes separados: quanto mais os separamos. Foram necessários milhares de anos para passar do barco a remo à caravela ou da energia eólica ao motor de explosão. Privado da satisfação de ver o produto acabado. e em algumas décadas se passou do dirigível ao avião. os velhos almanaques me deixaram saudades. Se eu fosse um nostálgico. assistiu-se ao triunfo das teorias revolucionárias de Einstein e a seu questionamento. que podem transformar as águas em fontes de transmissão de doenças. tanto mais fácil submeter a ciência aos cálculos do poder. Poderia produzir venenos sem que o soubesse .compostos orgânicos que.aumentar as taxas de mutação em todos os seres vivos. é assustadora. a) Há muitas dúvidas sobre eventuais danos à saúde do consumidor provocados pelas alterações genéticas nos alimentos. Mas a linha de 86 . Hiroshima. não apenas no homem. II . Nosso século é o da aceleração tecnológica e científica. . podendo acarretar o fim da espécie convencional.impedir o funcionamento dos ácidos nucléicos. Em algumas dezenas de anos. e os hormônios humanos. Parte dessa safra refere-se à produção da soja. III . como podeis ver. de alimentos geneticamente modificados.

princípio da linha de montagem: tudo isso tornou possível o Holocausto. Se forem novamente picadas. c) choque térmico. o fato de certas pessoas. mas não o de eliminar os resíduos. morte. aperta-se um botão e entra-se em comunicação com Pequim. deram-se as seguintes explicações: I . Tudo se passa num ritmo acelerado. III e IV Questão 400 Apesar da "aceleração tecnológica e científica de nosso século" nem todos os problemas puderam ser solucionados. II e III e) II. como a Grande Muralha da China. VEJA. Porque a sujeira nascia da indigência. É bom que tudo se tenha resolvido no espaço de trinta anos. num regime de separação dos saberes. Nosso século foi o da comunicação instantânea. que podia ser reduzida. Além de um número. desconhecido dos séculos anteriores. 25 anos. castigo. presenciou o triunfo da ação à distância. vida mais longa. IV . III .As células reagiram e. O século está estressado porque não sabe de quem se deve defender. A ação à distância salva numerosas vidas. tecnologicamente eficaz e buscou o consenso servindo-se das comunicações de massa e do prestígio da ciência. mas o sistema do computador não tem defesa diante da má intenção de um garoto precoce. o Muro de Berlim poderia ter durado milênios. O século do triunfo tecnológico foi também o da descoberta da fragilidade. arrependimento. sem grande inovação. 1993). Foi fácil fazer passar por ciência uma teoria pseudocientífica porque. (Adaptado de Umberto Eco. afinal restrito. Aperta-se um botão e um país inteiro explode. tempo. Um moinho de vento podia ser reparado. estão corretas SOMENTE a) I e II b) I e III c) II e IV d) I. onde foi abandonada uma cápsula contendo pó de Césio-137 e que foi aberta por pessoas desavisadas. 87 .. Poderíamos destruir o planeta num dia. ao passo que os resíduos (inclusive os radioativos) nascem do bem-estar que ninguém quer mais perder. Assim. No texto. de pessoas responsáveis e de executantes diretos (sádicos e loucos). Tudo o que aconteceu de terrível a seguir não foi se não repetição. Aperta-se um botão e um foguete é lançado a Marte. Eis porque nosso século foi o da angústia e da utopia de curá-la. O Holocausto foi possível porque se podia aceitá-lo e justificá-lo sem ver seus resultados. Sem essa aceleração. Mas o que torna tão terrível o genocídio nazista é que foi rápido. quando picadas por abelhas. nem como: somos demasiado poderosos para poder evitar nossos inimigos. que sofreram graves danos em conseqüência desse ato. este século soube fazer do melhor de si o pior de si. Nosso século é o do enfarte. indignação. Espaço. milhões de outros puderam colaborar à distância. A perseguição racial e o genocídio não foram uma invenção de nosso século. o autor menciona que não conseguimos eliminar os resíduos radioativos do ambiente. tudo em altíssima velocidade. devolveram essa energia para o ambiente.As células humanas estão adaptadas a receber energia com os comprimentos de onda do Césio-137.. comunicação.montagem permite também fabricar aspirina em quantidade para o mundo todo. Hoje. Rápida Utopia. d) embolia. ação à distância. em Goiânia. mas pagamos o preço dessa rapidez. especialmente por um grande número desses insetos. absolvição. Um exemplo ocorreu em 1987. tecnologia. como por exemplo. e) reforço do sistema imunológico.A energia provocou alterações nos compostos químicos das células. elas poderão apresentar uma reação denominada a) hemólise. Ciência. Para tais conseqüências. o químico que aplicava os gases asfixiantes não julgava necessário ter opiniões sobre a antropologia física. Encontramos o meio de eliminar a sujeira. A um ritmo de STRESS. Dessas explicações. realizando cada qual um gesto que nada tinha de aterrador. esquecimento. São Paulo. nascimento. b) choque anafilático. mas irresponsabiliza o crime. crime. Reflexões para o futuro. II . sob a forma de calor.As emissões radioativas introduziram energia nas células. informação. descoberta. apresentarem uma reação alérgica à toxina desses animais. E rápido. herdamos do passado o hábito de brandir a ameaça de um complô judeu para desviar o descontentamento dos explorados. crítica.

c) não se trata de uma questão que envolva biotecnologia e bioética. b) a expressão do gene depende da presença de hormônios masculinos.Rr. Paulo. 1Ž Filho . Ela o informou de que já era sua terceira gestação.Rr.06. Questão 402 O texto abaixo refere-se às questões: ** a ** Professor Astrogildo combinou com seus alunos visitar uma região onde ocorria extração de minério a céu aberto.Rr. uma vez que o embrião.rr. com a intenção de mostrar os efeitos ambientais produzidos por aquela atividade. O irmão de Jamie se chama Charlie e sofre de uma forma rara de anemia causada por anomalia genética. os genótipos do pai das crianças. Ciência em Dia. II. MAIS! 29. da mãe. embora envolva questões de biotecnologia. Questão 403 Quando a garçonete se aproximou. Na primeira. uma criança gerada para fornecer tecidos vivos para tentar salvar a vida de outro filho de seus pais. a criança teve eritroblastose fetal. Como foi concebido por técnicas de fertilização "in vitro". Jamie pôde ter suas células testadas no útero. nada tem a ver com aspectos de bioética. Nessa situação. Mãe .Rr.. III e IV representam moléculas de ácidos nucléicos. Mãe .Questão 401 Jamie Whitaker mal nasceu e já se tornou celebridade. pois as técnicas de fertilização in vitrojá são de total domínio e amplamente utilizadas pelos especialistas na área de reprodução humana. O motorista está buzinando. é implantado no útero materno. uma forma de confirmar sua compatibilidade com as de Charlie. 2Ž Filho . Vamos!" A turma entrou muito animada no ônibus e Ariosvaldo percebeu que o motorista era calvo. b) o fato relatado.RR.Rr.Rr.rr. se dá o desenvolvimento do feto. professor Astrogildo ia propondo desafios a partir das situações do dia-a-dia vivenciadas ao longo do passeio.. Folha de S. em que os números I. 1. 1Ž Filho . Algumas das questões propostas por professor Astrogildo estão apresentadas a seguir para que você responda.Rr. d) a mulher só será careca se tiver os dois alelos recessivos.8. (Leite. professor Astrogildo perguntou-lhe se seria seu primeiro filho.) Em relação ao texto. "Já está na hora de voltar.3 88 .Rr. 1Ž Filho . de fato. 1Ž Filho . Jamie é o que já está sendo chamado de "irmão salvador" pelos tablóides (jornais populares) do Reino Unido. 2Ž Filho . uma vez que na concepção de Jamie foram empregadas técnicas de fertilização in vitro. onde.5. por que não se vê mulher careca?" O professor respondeu que a ocorrência de calvície em mulheres era muito rara.rr.. Mãe .RR. do primeiro e do segundo filhos seriam: a) Pai .Rr. Questão 404 Aproveitando a pergunta de Zeca. M. Ariosvaldo refletiu e perguntou: "Professor.2003. c) Pai .. o professor esquematizou o processo de síntese protéica. 2Ž Filho . na segunda. b) Pai . d) o caso relatado não envolve problemas de bioética. e) não se pode associar a fertilização "in vitro" com biotecnologia ou com bioética. o seu filho nasceu normal e. 2Ž Filho . d) Pai . depois de selecionado. Durante o trajeto. Mãe . c) a calvície é uma característica genética cuja herança é ligada ao sexo. o texto nos coloca diante de situações concretas de biotecnologia e de bioética.Rr.rr. pois não envolve escolha de genótipo de seres humanos. podemos afirmar que: a) ao fazer referência à técnica de fertilização in vitro e de escolha de genótipos de seres humanos. Isso ocorre porque a) o gene responsável pela calvície está no cromossomo Y.

se forem fêmeas. durante o processo de transcrição. Os indivíduos afetados apresentam a cor da urina vermelho pardacenta devido a uma alteração no metabolismo normal da fenilalanina. i ). já que as células beta do pâncreas de um diabético não são capazes de sintetizar insulina. onde também encontramos os genes que determinam os grupos sangüíneos ABO ( IÞ. O heredograma a seguir foi montado para se estudar a disfunção em uma determinada família. em um dia. Assinale a alternativa da tabela que indica corretamente o número esperado de descendentes dessa rainha. Iß. d) IV corresponde ao RNA que catalisa a ligação dos nucleotídeos com a desoxirribose. e.partir do esquema. Questão 408 O texto abaixo refere-se às questões: ** a ** A alcaptunúria é uma disfunção extremamente rara do metabolismo humano. c) III corresponde ao RNA que contém o anticódon complementar ao códon existente em I. c) gene da insulina está inativo. pérola (20%). b) O somente das cores marrom ou pérola. (zero) machos c) 1000 fêmeas. 1. b) II corresponde ao RNA que catalisa a união do I com o III. nas fêmeas. creme (20%) e amarelo (20%). neve (20%). nos machos. se forem machos. para a qual o tipo sangüíneo de cada um dos membros está indicado. (zero) machos b) 1000 fêmeas.6 89 . entre os quais há a seguinte relação de dominância: a¢ > a£ > a¤ > a¥ >a a¢ : marrom a£ : pérola a¤ : neve a¥ : creme a : amarelo Uma rainha de olhos marrons. as cinco cores serão possíveis. por que as células alfa desse mesmo órgão não assumem esta função?" A síntese da insulina não ocorre nas células alfa porque o(s) a) gene da insulina está defeituoso. d) cromossomo com o gene da insulina não está presente. e) da cor marrom ou pérola. Todos os gametas produzidos resultaram em descendentes. c) da cor marrom se forem fêmeas. Essa rainha produziu. b) cromossomos não têm o gene da insulina. é correto afirmar que a) I corresponde ao RNA que contém o código genético determinando a seqüência de aminoácidos da proteína.5. 625 machos e) 500 fêmeas. se forem machos. 1 250 gametas dos quais 80% foram fecundados. a) 1250 fêmeas. e. da cor pérola. Questão 405 Zeca perguntou: "Professor. heterozigótica para pérola. 250 machos d) 625 fêmeas. a cor dos olhos é condicionada por uma série de cinco alelos. 500 machos Questão 407 Os descendentes dessa rainha terão olhos a) somente da cor marrom. O gene determinante dessa disfunção está localizado no cromossomo 9. d) da cor marrom ou pérola. Questão 406 O texto abaixo refere-se às questões: ** a ** Em uma espécie de abelha. foi inseminada por espermatozóides provenientes de machos com olhos das cores marrom (20%). as cinco cores serão possíveis.

(02) A herança de um caráter é determinada pela fusão dos fatores condicionantes na descendência. (Mendel. é possível afirmar. no par de cromossomos 9.. Questão 409 (Darwin. 2 . pode-se dizer: (01) As "plantas que permanecem constantes" ao longo das gerações são homozigotas. esperada em F2. b) 45% de A normais... eliminando-se com o glóbulo polar os mais fracos. os mais fortes. Questão 410 O texto abaixo refere-se às questões: ** a ** Na(s) questão(ões) a seguir escreva nos parênteses a soma dos itens corretos. os inferiores. (08) A seleção natural pode preservar características diferentes. em diferentes ambientes. (04) A citação de Mendel expressa a proporção genotípica 1:2:1.5.5% AB normais. de ser "naturalmente selecionado". Soma ( ) 1. sob condições de vida complexas e algumas vezes variáveis. lutam entre si. que se ocupa do aperfeiçoamento físico e mental da espécie humana. pode-se afirmar: (01) A subordinação aos princípios mendelianos reduz a variabilidade nas espécies que se reproduzem sexuadamente. (. (32) Variações referidas por Darwin transmitem-se à descendência segundo o padrão mendeliano de herança. que violam princípios sociais e admitem conceitos biológicos errôneos. d) 50% B normais ou afetados. formam sementes das quais a metade novamente desenvolve a forma híbrida. Questão 411 A idéia da eugenia. está representada para o indivíduo 7 ao lado do heredograma. 1117) Em relação às idéias de Darwin e de Mendel. exemplificadas nos textos. segue-se que qualquer organismo que varia de modo proveitoso para si próprio.nalisando-se o heredograma.6 posição ocupada pelos alelos que determinam grupo sangüíneo e alcapatonúria.) se entrechocam. se sustenta em premissas incorretas. 90 . selecionam-se. terá uma melhor oportunidade de sobrevivência e. assim. A freqüência de recombinação entre os dois loci gênicos é de 10%. p. (16) O trabalho de Darwin afirma a constância genética do mundo biológico." (Kehl apud BIZZO. c) O indivíduo 6 certamente não recebeu um gameta recombinante da sua mãe ou do seu pai. EXCETO: a) A alcaptonúria é um caráter determinado por gene autossômico recessivo. apud DARNELL.. c) 50% de afetados. TEXTO I: Como muito mais organismos de cada espécie nascem do que provavelmente sobrevivem e como. há uma freqüente luta pela existência. p. São freqüências esperadas de descendentes para o cruzamento 6 X 7. como na citação: "Os cromossomos. e persistindo nos pronúcleos resultantes os mais aptos. 30) Considerando-se os princípios biológicos que regem a herança. enquanto a outra metade produz plantas que permanecem constantes e recebem os caracteres dominantes e recessivos em partes iguais. de cada par de caracteres diferenciais. b) O indivíduo 3 pode ter recebido um gameta recombinante de sua mãe. conseqüentemente.) os determinantes (. EXCETO: a) 22. perigosamente em alta em países desenvolvidos da Europa. p. d) A chance de o indivíduo 9 ser heterozigoto para o caráter alcaptonúria é de 2/3.traduzido) TEXTO II: Os híbridos. apud FREIRE-MAIA.

exercem importante papel na sociedade atual. repercutem além dela. Sobre esses conceitos. é aleatória. apresentam. ( ) Na espécie humana distinguem-se 3 tipos sangüíneos. engenharia. (02) A falha em mecanismos celulares que preservam a fidelidade da mensagem genética predispõe ao câncer. indústria. na primeira divisão meiótica. Questão 414 Questão 412 Indivíduos portadores da doença "xeroderma pigmentosum". No entanto. resultando em alta freqüência de câncer de pele. extrema sensibilidade à luz solar. Soma ( ) o processo evolutivo.(02) A segregação dos cromossomos homólogos. principalmente na face. e) são o único processo evolutivo agindo atualmente no homem. (16) A aplicação de princípios eugênicos comprometeria a sobrevivência da espécie humana. A elucidação de crimes. (64) A precisão dos sistemas de reparo do DNA inviabiliza Na(s) questão(ões) a seguir julgue os itens e escreva nos parênteses (V) se for verdadeiro ou (F) se for falso. d) são responsáveis por extinções em massa. que permitem a sobrevivência das espécies. antropologia e à pesquisa acadêmica em diversas áreas do conhecimento. como também a identificação da paternidade.adaptação) Uma análise da situação apresentada anteriormente permite afirmar: (01) Agentes mutagênicos incluem fatores físicos que alteram a estrutura da molécula de DNA. (16) Os genes que condicionam o "xeroderma pigmentosum" são característicos de células epidérmicas. julgue os itens. São hoje praticamente indispensáveis à medicina. 91 . (64) As repercussões da eugenia em populações humanas descartam sua aplicação para qualquer fim. Soma ( ) Questão 413 Os radioisótopos. hidrologia. ou como fontes de radiações. (08) A morte prematura de células nervosas resulta dos efeitos do acúmulo de lesões na molécula de DNA. O temor da população em relação aos radioisótopos relaciona-se à capacidade desses elementos produzirem mutações nos seres vivos. e os indivíduos do grupo sangüíneo AB são considerados doadores universais. (04) O efeito de um determinado gene depende do ambiente em que ele é expresso. c) permitem a origem de novas espécies cada vez melhor adaptadas. apesar de temidos pela população que os associa a acidentes nucleares e danos ambientais. que parecem resultar da morte prematura de células nervosas. p. adquiridas por indivíduos de uma geração. seja por atuarem como traçadores radioativos. em células epidérmicas. (32) Alterações do fenótipo. condição genética autossômica recessiva. (GARDNER. as mutações ocorrem naturalmente e têm uma grande importância evolutiva porque a) geram a variabilidade sobre a qual a seleção natural pode agir. atingindo sua prole. em que são considerados básicos alguns conceitos de genética. (32) A ocorrência de alterações em células nervosas e em células epidérmicas pode estar relacionada à sua origem embriológica comum. como a dos trilobitas. ( ) Genes alelos são genes que ocupam o mesmo "locus" gênico em cromossomos homólogos. 307-8 . ( ) Cariótipo é o conjunto de informações sobre os cromossomos de uma determinada espécie. (08) Os fatores genéticos se misturam e se diluem ao longo das gerações. Alguns desses pacientes também desenvolvem anormalidades neurológicas. vêm sendo efetuadas com certa facilidade e segurança através do uso de técnicas apropriadas. ( ) Um dos catalisadores do processo de duplicação do DNA é a enzima DNA polimerase. (04) A condição genética dos indivíduos com "xeroderma pigmentosum" é determinada pela exposição à radiação ultravioleta. Estudos genéticos em células de organismos afetados revelam a existência de defeitos no sistema enzimático responsável pelo reparo de moléculas de DNA danificadas pela exposição a agentes mutagênicos. b) geram as adaptações.

é correto afirmar que: (01) 9/16 dos descendentes desse cruzamento terão olhos normais e com pigmentação escura. efeitos nocivos que podem surgir devido a genótipos recessivos produzidos através do cruzamento entre indivíduos aparentados. se reproduzem e como se dão alguns fenômenos biológicos nos seres que vivem ali e até naqueles que visitam esse ambiente. a fim de condicionar um determinado fenótipo. "Lei da Segregação Independente dos Caracteres". e o passeio será muito proveitoso. é grande a variabilidade de espécies. terá filhos apenas do grupo sangüíneo O. Sabe-se que o gene A está em um cromossomo e B em outro. soma = ( ) Questão 418 O texto abaixo refere-se às questões: ** a ** Caros candidatos. alterando-o. Vamos lá?!!! Como você já devem ter percebido. Também serão convocados a responder a questões básicas no campo da Biologia. (08) Na interação gênica. uma criança hemofílica nascida de pais normais só poderá ser do sexo feminino. (02) 3/16 dos descendentes desse cruzamento terão olhos normais e com pigmentação clara. compreenderão como as espécies se inter-relacionam. ou seja. contarão com a companhia de Ribossomildo. comportamentos. casando-se com um homem doador-universal. Soma ( ) Questão 417 Um canil. 92 Questão 416 Com base nos estudos de Genética. (16) Sendo a hemofilia uma anomalia condicionada por um gene recessivo ligado ao sexo. (08) Segregação monogênica dominante. dos oito cãezinhos. (08) Estes problemas envolvem a Segunda Lei de Mendel. é correto afirmar que: (01) Uma planta de sementes brancas. enquanto seu alelo recessivo determina a cor escura. Observou-se. fixando aleatoriamente alguns genes. apresentaram as mesmas características dos pais. vocês estarão em contato com a natureza. Desse cruzamento resultaram oito filhotes que. que lhes servirá de guia. Fiquem tranqüilos: vocês estão preparados. autofecundada. reduzindo o vigor da ninhada. Feito um cruzamento entre dois indivíduos duplamente heterozigóticos. À luz dos conhecimentos de genética. na sua maioria. (04) 4/16 dos descendentes nascerão sem olhos. dois nasceram cegos. Ele dispõe de material para ilustrar. esse fato pode ser explicado porque houve: (01) Heterose. e quais as conseqüências disso. os genes de um par agem combinando-se com outro par (ou outros pares). Vocês estão convidados a fazer um passeio numa área de Mata Atlântica. escreva no espaço apropriado a soma dos itens corretos. Para tanto. quando necessário. Vocês terão a oportunidade de verificar de que maneira o homem pode interferir nesse meio. (32) Semiletalidade. um experiente pesquisador. entretanto. Nesse passeio. escolheu dois irmãos de uma ninhada e os cruzou. (04) Herança ligada ao cromossomo sexual. e adaptações na Mata Atlântica. Imagine uma espécie animal na qual um gene A determina a formação do olho e seu alelo recessivo determina a ausência de olhos. pois Ribossomildo só lhes dará informações cientificamente corretas. especializado na criação de dálmatas. que. (16) Deriva genética. Um outro gene B dominante determina a pigmentação clara do olho.Questão 415 O texto abaixo refere-se às questões: ** a ** Na(s) questão(ões) a seguir. (04) Indivíduos heterozigotos para duas características produzem quatro tipos de gametas. onde verão um maravilhoso ecossistema. será heterozigota para o caráter se entre os seus descendentes aparecerem alguns com sementes amarelas e outros com sementes brancas. (02) Efeito genético da consangüinidade. ou polimeria. ou seja. Soma ( ) . (02) Uma mulher do grupo sangüíneo A cuja mãe é do grupo O. verão de perto a diversidade da fauna e da flora. essa atividade de campo.

B. Santa Cruz do Sul: EDUNISC. a) replicação do DNA b) transcrição de RNA transportador c) tradução de RNA mensageiro d) síntese das proteínas arque a opção em que se relaciona adequadamente a figura ao evento biológico. etapas da divisão celular como as representadas nas figuras abaixo justificam essa variabilidade. ele apresenta a figura abaixo. a formação de quiasma eleva a probabilidade de ocorrência de mutação dos genes. sabemos que outros povos. Questão 420 A história da maioria dos municípios gaúchos coincide com a chegada dos primeiros portugueses. com o objetivo de melhorar a produção de grãos.5. Assinale a alternativa que completa corretamente a lacuna. Considere que a característica baixa estatura é dominante sobre a característica porte elevado e que apenas um loco gênico está envolvido na determinação da estatura das plantas. foi selecionada a área temática CULTURA e as questões foram construídas com base na obra "Os Primeiros Habitantes do Rio Grande do Sul" (Custódio. italianos e de outros povos. Segundo Ribossomildo. "o índio".Essa variabilidade fenotípica está relacionada à constituição genética do indivíduo e pode ser observada até dentro da mesma espécie. 93 . 1. anteriores aos citados. "Da Amazônia vieram os tupis-guaranis. b) Na figura II. d) Na figura II. que ilustra um dos eventos imprescindíveis ao processo de crescimento dos organismos.8.1 1. quantos filhotes de animais! O que deve estar ocorrendo no interior das células desses seres. a migração das cromátides-irmãs para pólos opostos eleva a recombinação gênica. A. O resultado para a F1 de um cruzamento de plantas com baixa estatura X plantas com estatura elevada será _________________________. IPHAN.1 ssinale a opção correspondente ao evento representado na figura. organizador. através dos vestígios materiais encontrados nas pesquisas arqueológicas. No entanto. se os indivíduos cruzados forem homozigotos para esse loco gênico. protagonizaram a nossa história. a) Na figura I.5. Diante da relevância do contexto e da vontade de valorizar o nosso povo nativo.. a permutação entre cromossomos heterólogos aumenta a variabilidade genética." Variedades de milho cultivadas pelos indígenas são usadas hoje em cruzamentos. L. que lhes permite crescer?! Para facilitar a resposta a essa pergunta. a segregação independente dos cromossomos contribui para o aumento da diversidade dos gametas. 2004).2. alemães. c) Na figura I. ensinando a plantar diferentes espécies e a usar plantas frutíferas e medicinais. Questão 419 Ribossomildo diz: Vejam quantos folhas novas. trazendo contribuições à nossa cultura.

arginina e citrulina. aos compostos a) ornitina.5. 1 e 3. . Questão 423 Quando as células do corpo humano se multiplicam. Um pesquisador obteve três diferentes linhagens desse fungo. ornitina e arginina.5 As letras X.8. Assinale a opção que contém a(s) afirmativa(s) 94 1. No entanto. açúcar e uma vitamina. sais minerais. 3 e 2. A linhagem D é o tipo selvagem. tal como na via biossintética representada na figura 1. arginina e ornitina.A inativação dos oncogenes é uma das condições essenciais para que as células citadas no texto se multipliquem desordenadamente. e) 3. b) 1. cada uma delas deficiente em uma das enzimas participantes dessa via biossintética. para as enzimas a) 1. Considere as seguintes afirmativas: I . O fungo utiliza esses elementos como precursores para a síntese de vários compostos. c) 2. arginina e ornitina. d) citrulina. Questão 422 1.O comportamento celular descrito na última frase do texto é chamado metástase.5 As linhagens A. d) 2. citrulina e ornitina.indica que não houve crescimento.8. o qual pode ser determinado pela perda da inibição por contato nas células. constituído de água. B e C são deficientes. O esquema na figura 2 apresenta os resultados obtidos quando essas diferentes linhagens foram colocadas para crescer em diferentes meios de cultura. c) citrulina. Após essa fase várias dessas células podem cair na corrente sangüínea e invadir outros órgãos. b) ornitina. não necessariamente nessa ordem. espera-se que aquelas produzidas com defeitos sejam destruídas pelo sistema imunológico. respectivamente.5. III . Y e Z correspondem à citrulina. citrulina e arginina. o sinal . alcançando um número razoável de células e estabelecendo uma rede de vasos sangüíneos que passa a alimentá-las. respectivamente. e) arginina. 2 e 3. 3 e 1. tais como radiações solares e agrotóxicos. determinado assim uma acentuada queda na sobrevida do indivíduo. podem provocar alterações genéticas nas células. II . tornando-as invulneráveis à ação do sistema imunológico.Agentes ambientais. O sinal + indica que houve crescimento do fungo. se algumas células mutantes se tornam invulneráveis elas podem se multiplicar. Os compostos X.a) 100% com estatura elevada b) 100% com estatura baixa c) 1/2 com estatura elevada e 1/2 com estatura baixa d) 1/4 com estatura elevada e) 3/4 com estatura elevada Questão 421 O texto abaixo refere-se às questões: ** a ** O tipo selvagem do fungo Neurospora é capaz de crescer em um meio de cultura simples. não deficiente em qualquer uma das enzimas. 1 e 2. Y e Z correspondem.

verdadeira(s). a) Apenas I e II. b) Apenas I e III. c) Apenas II e III. d) Apenas III. e) I, II, III. Questão 424 A síntese protéica envolve um complexo de estruturas celulares que trabalham harmonicamente, como mostra o esquema adiante.

1.1.4

1.1.3.2

Segundo a tirinha, a amiga de Calvin tem DOIS CROMOSSOMOS X. Com base neste dado podemos concluir que: a) a amiga de Calvin é mutante, por isso é hostil. b) um cromossomo X da amiga de Calvin é ativo e o outro é chamado de cromatina sexual. c) a heterocromatina ocorre em Calvin, pois ele é XY. d) os dois cromossomos X de que Calvin fala é da cobra que quer comê-lo. e) não há cromatina sexual em meninas. Questão 426

Com base no esquema e em conhecimentos correlatos, julgue os itens a seguir. (0) O esquema mostra a síntese protéica em uma célula procariótica. (1) Os tipos de RNA necessários para a síntese protéica em procariotos e eucariotos são essencialmente diferentes. (2) Na expressão de um gene eucariótico, a transcrição e a tradução ocorrem simultaneamente. (3) Uma molécula de RNAm pode ser utilizada para a síntese concomitante de várias moléculas da proteína. Questão 425 Leia com atenção a tirinha a seguir:

Qual das alternativas se refere a um cromossomo? a) Um conjunto de moléculas de DNA com todas as informações genéticas da espécie. b) Uma única molécula de DNA com informação genética para algumas proteínas. c) Um segmento de molécula de DNA com informação para uma cadeia polipeptídica. d) Uma única molécula de RNA com informação para uma cadeia polipeptídica. e) Uma seqüência de três bases nitrogenadas do RNA mensageiro correspondente a um aminoácido na cadeia polipeptídica. Questão 427 Quando afirmamos que o metabolismo da célula é controlado pelo núcleo celular, isso significa que a) todas as reações metabólicas são catalisadas por moléculas e componentes nucleares. b) o núcleo produz moléculas que, no citoplasma, promovem a síntese de enzimas catalisadoras das reações metabólicas. c) o núcleo produz e envia, para todas as partes da célula, moléculas que catalisam as reações metabólicas.
95

d) dentro do núcleo, moléculas sintetizam enzimas catalisadoras das reações metabólicas. e) o conteúdo do núcleo passa para o citoplasma e atua diretamente nas funções celulares, catalisando as reações metabólicas. Questão 428 Considere uma espécie de vertebrado cujas células embrionárias têm oito cromossomos. Em quantos grupos de ligações seus genes estarão associados? a) Dois. b) Quatro. c) Oito. d) Dezesseis. e) Número variável. Questão 429 A ilustração representa o cariótipo humano que permite determinar o número e a forma dos cromossomos.

Questão 431 Os cromossomos são constituídos principalmente por: a) fosfolipídeos. b) proteínas. c) ácido ribonucléico. d) enzimas. e) ácido desoxirribonucléico. Questão 432 A cromatina sexual compreende: a) o citoplasma de células gaméticas masculinas que se apresentam mais coradas que as femininas. b) o citoplasma de células gaméticas femininas que se apresentam mais coradas que as masculinas. c) cromossomo Y condensado em núcleos de hemácias humanas. d) um dos cromossomos X da mulher, que permanece condensado no núcleo das células, facilmente visualizado na mucosa oral. e) cromossomos X e Y condensados durante o período da interfase. Questão 433 Responder à questão com base no cariótipo (conjunto de cromossomas) humano representado abaixo.

1.1.4

Analisando-se a figura, é correto concluir que se refere a um indivíduo portador da síndrome de a) Klinefelter. b) Patau. c) Turner. d) Down. Questão 430 A presença de cromatina sexual predominante em número de células femininas está relacionada a cromossomos: a) Y inativos b) X inativos c) autossômicos inativos d) autossômicos que não se dividiram e) autossômicos agregados

1.1.4

cariótipo é de um indivíduo do sexo com síndrome de __________. a) feminino - Klinefelter b) masculino - Klinefelter c) masculino - Down d) feminino - Turner e) masculino - Turner

96

Questão 434 Numere a coluna inferior, relacionando-a com a superior. Indivíduos: 1 - 45, X 2 - 46, XX 3 - 49, XXXXX 4 - 49, XXXXY 5 - 47, XXX Quantidade de cromatinas sexuais (corpúsculos de Barr) ( ) quatro ( ) duas ( ) nenhuma ( ) uma ( ) três Assinale a opção que apresenta a seqüência correta de numeração. a) 2, 4, 1, 3, 5 b) 3, 5, 1, 2, 4 c) 2, 3, 1, 4, 5 d) 3, 2, 1, 4, 5 e) 2, 1, 3, 4, 5 Questão 435

Analisando o desenho esquemático que representa o núcleo de uma célula animal qualquer, podemos identificar que o componente responsável pela síntese de RNA que forma o ribossomo é assinalado pelo número: a) 1 b) 2 c) 3 d) 4 e) 5 Questão 436 Muitas vezes, durante a realização de eventos esportivos, é realizada a determinação do sexo genético. Este exame é feito pela observação dos cromossomos de células epiteliais. Pode-se afirmar que neste exame a) mulheres normais deveriam apresentar uma estrutura chamada corpúsculo de Barr, que corresponde a um dos cromossomos X. b) homens normais deveriam apresentar uma estrutura chamada corpúsculo de Barr, que corresponde ao cromossomo Y. c) mulheres normais deveriam apresentar duas estruturas chamadas corpúsculos de Barr, que correspondem aos dois cromossomos X. d) homens normais deveriam apresentar uma estrutura chamada corpúsculo de Barr, correspondente ao cromossomo X. e) mulheres normais na fase adulta não deveriam apresentar corpúsculo de Barr. Questão 437

1.1.4

Analise o esquema a seguir, o qual mostra o mecanismo de ação de algumas drogas antimitóticas que inibem a progressão a partir dos pontos indicados.

1.1.5.1

97

Assinale a afirmativa INCORRETA. a) A puromicina não tem qualquer efeito sobre o crescimento ou multiplicação celular. b) A mitomicina não permite a ocorrência da fase 5 do ciclo celular. c) Pelo menos duas das drogas interferem diretamente na síntese protéica. d) Nem todos os tipos de nucleotídeos sofrem ação da droga arabinosilcitosídeo. Questão 438 A figura a seguir representa _______________ , que ocorre na _______________ e tem como conseqüência _______________.

1.1.5.2

1.1.5.2

( ) O número de gametas AB deverá ser idêntico ao de gametas ab. ( ) A freqüência de gametas recombinantes deverá ser igual a de gametas não-recombinantes. ( ) Trezentos e sessenta gametas não- recombinantes são esperados. ( ) Vinte gametas recombinantes são esperados no caso descrito. ( ) A taxa de recombinação no caso citado é de 10%; logo, os locos A e B distam de 10 unidades de mapa. Questão 440 "Devo, finalmente, chamar a atenção para a possibilidade do pareamento dos cromossomos paternos e maternos, e sua subseqüente separação durante a divisão reducional, constituírem as bases físicas das leis de Mendel" (Walter S. Sutton, 1902). O que Sutton achava possível sabe-se, hoje, ser verdade, isto é: I. os genes estão localizados nos cromossomos. II. dois ou mais genes localizados no mesmo cromossomo são herdados, na maioria dos casos, em gametas diferentes. III. dois ou mais genes localizados em cromossomos diferentes segregam de maneira independente. Sobre as afirmativas acima, pode-se dizer que: a) somente III está correta. b) I e II estão corretas. c) II e III estão corretas. d) I e III estão corretas. e) somente II está correta.

A alternativa que preenche correta e respectivamente os espaços anteriores é: a) o crossing-over; metáfase da mitose; a variabilidade genética. b) o pareamento de cromátides-irmãs; anáfase I da meiose; a troca de genes alelos. c) o crossing-over; prófase I da meiose; a variabilidade genética. d) a segregação de cromossomos homólogos; anáfase I da meiose; a formação de células haplóides. e) o pareamento de cromossomos homólogos; metáfase da mitose; a formação de gametas. Questão 439 Analise as proposições abaixo, considerando a seguinte situação: Em uma amostra de 100 (cem) espermatogônias, de um organismo genotipicamente (AB//ab), ocorreu permutação meiótica entre os locos A e B, em 20 (vinte) espermatogônias, tendo sido observada uma segregação gamética como ilustrado na figura abaixo.

98

Questão 441

Questão 443 Quanto aos cromossomos sexuais X e Y, podemos afirmar que: a) como não são completamente homólogos, não se pareiam na meiose. b) como são completamente homólogos, pareiam-se na meiose. c) se pareiam na meiose, pois possuem uma região homóloga. d) não se pareiam na meiose, pois possuem uma região não homóloga. e) os genes que se encontram na região não homóloga do X condicionam um tipo de herança chamado herança restrita ao sexo. Questão 444 As variações das cargas elétricas das moléculas das proteínas W, X, Y e Z, em função do pH do meio, estão representadas no gráfico a seguir.

1.1.5.2

AMABIS e MARTHO. "Fundamentos da Biologia Moderna". São Paulo: Moderna, 1997. p. 499. A figura representa a a) mitose e explica a separação dos cromossomos durante a divisão. b) meiose e explica a segregação independente dos genes previstos pela segunda lei de Mendel. c) mitose e explica a segregação dos genes demonstrando a dominância e a recessividade. d) meiose, que é um processo de formação de gametas mas que não tem nenhuma relação com as leis de Mendel. e) mitose, que é um processo de divisão celular mas que não tem nenhuma relação com as leis de Mendel. Questão 442 Os gatos possuem 38 cromossomos, com o sistema XX/XY de determinação sexual. No desenvolvimento embrionário de fêmeas, um dos cromossomos X é inativado aleatoriamente em todas as células do organismo. Em gatos domésticos, a pelagem de cor preta (dominante) e amarela (recessiva) são determinadas por alelos de um gene localizado no cromossomo X. Fêmeas heterozigóticas para cor da pelagem são manchadas de amarelo e preto. Um geneticista colocou um anúncio oferecendo recompensa por gatos machos manchados de amarelo e preto. A constituição cromossômica desses gatos é a) 37, YO. b) 37, XO. c) 38, XX. d) 39, XXY. e) 39, XXX.

1.1.7.3

molécula do DNA, em pH fisiológico, apresenta carga elétrica negativa, devido a sua natureza ácida. No núcleo celular, ela está associada a proteínas, de caráter básico, denominadas histonas. De acordo com o gráfico, a proteína que apresenta propriedades compatíveis com as de uma histona é a representada pela seguinte letra: a) W b) X c) Y d) Z

99

Questão 445 Considere a rota metabólica que produz o aminoácido arginina na figura adiante.

grupamentos amina e hidroxila. Questão 447 O metabolismo celular depende de uma série de reações químicas controladas por enzimas, isto é, proteínas que atuam como catalisadores e que podem sofrer mutações genéticas sendo modificadas ou eliminadas. Assinale a alternativa correta, levando em conta os ácidos nucléicos, a ocorrência de mutações e as conseqüentes mudanças do ciclo de vida da célula. a) O DNA é constituído por códons, que determinam a seqüência de bases do RNA mensageiro, necessária à formação dos anticódons, responsáveis pela produção das proteínas. b) No caso de uma mutação acarretar a transformação de um códon em outro relacionado ao mesmo aminoácido, não haverá alteração na molécula protéica formada, nem no metabolismo celular. c) A mutação altera a seqüência de aminoácidos do DNA, acarretando alterações na seqüência de bases do RNA mensageiro e, conseqüentemente, na produção das proteínas. d) As mutações atuam diretamente sobre as proteínas, provocando a desnaturação dessas moléculas e, conseqüentemente, a inativação delas. e) Quando algumas proteínas são alteradas por mutações, suas funções no metabolismo celular passam a ser realizadas pelos aminoácidos. Questão 448 Organelas citoplasmáticas que contêm DNA: a) mitocôndria e ribossomo. b) mitocôndria e cloroplasto. c) nucléolo e cloroplasto. d) lisossomo e ribossomo. e) ribossomo e cromossomo. Questão 449 A hipótese de que os cloroplastos e as mitocôndrias tenham surgido através de uma associação simbiótica de um eucarioto primitivo com, respectivamente, bactérias fotossintetizantes e bactérias aeróbicas, é reforçada pelo fato daquelas organelas celulares: a) serem estruturas equivalentes, com grande superfície interna.
100

1.1.7.3

Em um experimento, três linhagens de bactérias foram irradiadas com raios X, que causaram mutações nos genes envolvidos na rota metabólica acima representada. Para descobrir quais enzimas da rota metabólica foram afetadas, as três linhagens foram cultivadas em meios suplementados com ornitina, citrulina e arginina, obtendo-se o resultado mostrado na tabela acima: Sobre esse experimento, podemos afirmar que a) o gene que codifica a enzima 1 na linhagem I foi afetado. b) o gene que codifica a enzima 2 na linhagem I foi afetado. c) o gene que codifica a enzima 3 na linhagem II foi afetado. d) o gene que codifica a enzima 1 na linhagem II foi afetado. e) o gene que codifica a enzima 3 na linhagem III foi afetado. Questão 446 Além de serem as macromoléculas mais abundantes nas células vivas, as proteínas desempenham diversas funções estruturais e fisiológicas no metabolismo celular. Com relação a essas substâncias é CORRETO afirmar que: a) são todas constituídas por seqüências monoméricas de aminoácidos e monossacarídeos. b) além de função estrutural, são também as mais importantes moléculas de reserva energética e de defesa. c) cada indivíduo produz as suas proteínas, que são codificadas de acordo com o seu material genético. d) a sua estrutura terciária é determinada pela forma, mas não interfere na sua função ou especificidade. e) são formadas pela união de nucleotídeos por meio dos

. d) apresentarem tilacóides e cristas como as bactérias. b) ribossomos. nos cloroplastos e nas mitocôndrias.b) apresentarem DNA próprio.1.6 . Ao longo do processo de diferenciação das células do mesmo organismo ocorre a) duplicação de alguns genes. c) utilização de oxigênio no interior de mitocôndrias. b) RNA transportador. d) ribossomos e nos cloroplastos. c) TACGTGGA. (. c) nucléolos e nas mitocôndrias. Questão 453 A seqüência de nucleotídeos ATGCACCT forma um segmento de DNA dupla hélice ao se ligar à fita complementar a) AUGCACCU. tanto do ponto de vista estrutural como funcional. d) ribossomo. um fungo e uma samambaia apresentam em comum a) produção de glicose através da utilização de energia solar. b) 19 cromossomos duplicados e 38 moléculas de DNA. foram fixadas e submetidas à autoradiografia. encontre-se uracila radioativa SOMENTE nos a) nucléolos. d) indução de mutações específicas. d) 38 cromossomos simples e 19 moléculas de DNA. d) presença de DNA como material genético. Essa função é desempenhada pelo a) RNA mensageiro. É correto prever que. depois de mantidas em meio de cultura contendo uracila marcada. os planos do arquiteto montam 46 101 1. e) recombinação entre genes ativados. e) ribossomos. No núcleo do óvulo normal de uma gata são esperados: a) 19 cromossomos simples e 19 moléculas de DNA. Questão 452 A célula muscular cardíaca e a esquelética têm a mesma origem porém são diferentes. e) DNA. c) 38 cromossomos simples e 38 moléculas de DNA. para comprovar os locais que possuíam esse material. e) ATGCACCT. e) 19 cromossomos duplicados e 19 moléculas de DNA.. Questão 450 "Captura aminoácidos que se encontram dissolvidos no citoplasma e carrega-os ao local da síntese de proteínas". e) produção de ATP no interior de plastos. c) expressão diferencial dos genes. Questão 454 Uma bactéria. b) presença de carioteca envolvendo os componentes do núcleo celular. Questão 455 O gato doméstico ('Felis domestica') apresenta 38 cromossomos em suas células somáticas. no citoplasma. na produção e consumo de oxigênio. c) RNA ribossômico.) No homem.7. c) estarem envolvidas. d) TCCACGTA. Questão 456 É como se em cada quarto de um imenso prédio existisse uma estante contendo os planos do arquiteto para todo o prédio. respectivamente. e) serem encontradas tanto em organismos superiores como inferiores. Questão 451 Células vegetais. b) UACGUGGA. b) perda dos genes não expressos.

complementar ao códon AUG do RNAm.1 amostra: ribose II . cada página de cada volume contém um texto formado por uma seqüência de: a) fenótipos b) aminoácidos c) cromossomos d) bases nitrogenadas Questão 457 Analise as afirmativas a seguir. I. transcrevendo a seqüência de bases de uma cadeia de DNA. ( ) 61 códons correspondem aos aminoácidos que compõem as proteínas. na leitura da mensagem genética. encaixa-se no sítio destinado à entrada de aminoácidos na cadeia peptídica.1.3 amostra: dupla hélice IV.5 amostra: 20% de guanina e 30% de citosina Entre estas amostras. que: a) somente I é verdadeira. para o qual existe apenas uma trinca de codificação. proposta por Richard Dawkins no livro "O gene egoísta". Cada cromossomo possui uma única molécula de DNA. podemos afirmar que os códons 5 e 6 codificam. Nessa analogia.volumes. quais se referem a DNA? a) Apenas I e II. Os nucléolos podem atuar na síntese de carboidratos que migram do núcleo para o citoplasma. de modo correto. II. III. c) Apenas II e III. ( ) O aminoácido metionina (I) é trazido ao ribossomo pelo RNAt cujo anticódon é UAC (II). um segundo RNAt (III). Sabendo-se que os códons 5 e 6 trazem a informação para um mesmo aminoácido. Com relação às características dessa molécula. acerca dos elementos constituintes do núcleo celular eucariótico. analise a figura e as proposições a seguir. Questão 460 Neste ano de 2003. Questão 458 A molécula de RNAm é sintetizada no núcleo.6 . UAG ou UGA. Pode-se afirmar. se liga ao ribossomo. cujo anticódon é complementar ao segundo códon do RNAm geralmente onde há uma trinca UAA. Considerando esse tema.2 amostra: timina III . ( ) Na etapa seguinte da tradução. Questão 459 Cinco amostras com ácidos nucléicos foram analisadas quimicamente e apresentaram os seguintes resultados: I . ( ) Quando se estabelece uma ligação peptídica entre os dois primeiros aminoácidos. UUA ou GUA. são comemorados os 50 anos da "descoberta" da estrutura tridimensional do DNA. d) somente I e III são verdadeiras. a saber. e) Apenas II e V. c) somente I e II são verdadeiras. d) Apenas II e IV.4 amostra: uracila V . ou para a metionina ou para o triptofano. se chega a um códon de parada (V).7. para os quais não há aminoácido correspondente. o RNAt do primeiro aminoácido é liberado (IV) no citoplasma. UUG. e) somente II e III são verdadeiras. ao papel que ela desempenha nos seres vivos e aos processos em que se encontra envolvida é CORRETO afirmar que: 102 1. b) Apenas I e III. ( ) O final da tradução ocorre quando. Histonas são proteínas relativamente pequenas que se ligam fortemente ao RNA. onde se dá a produção de cadeias peptídicas. b) somente II é verdadeira. O RNAm no citoplasma.

A informação. a finalização do Projeto Genoma Humano foi noticiada por vários meios de comunicação como sendo a "decifração do código genético humano". d) na transcrição e na tradução. d) errada. DNA e RNA são os ácidos nucléicos encontrados tanto em células eucariontes como procariontes. transcrição e tradução do DNA. durante os processos de replicação. b) correta. compostos por uma desoxirribose ligada a um fosfato e a um aminoácido. por serem herdáveis. assinale a alternativa CORRETA: a) Uma cadeia simples de DNA é constituída de nucleotídeos. b) na replicação. existem regiões cromossômicas com alta taxa de mutação. está a) correta. pois independe da existência de uma fita molde. b) apenas I e II. apenas. porque o Projeto decifrou os genes dos cromossomos humanos. e suas seqüências de bases são complementares. Questão 464 Em abril de 2003. 103 . b) A polimerização de uma fita simples de DNA é dita semiconservativa. A informação contida no DNA pode ser copiada em uma fita de RNA. II. d) Duas cadeias simples de DNA formam uma dupla-hélice. c) Os nucleotídeos são polimerizados por meio de ligações fosfodiéster entre o fosfato e a base nitrogenada. IV. porque agora se sabe toda a seqüência de nucleotídeos dos cromossomos humanos. porque não é possível decifrar todo o código genético. não as proteínas que eles codificam. porque agora se sabe toda a seqüência de genes dos cromossomos humanos. III e IV. e) errada. III e IV. porque o código genético diz respeito à correspondência entre os códons do DNA e os aminoácidos nas proteínas. por meio da formação de pontes de hidrogênio entre as bases nitrogenadas. através do processo denominado transcrição. o aminoácido e a proteína. Questão 463 Erros podem ocorrer. A informação presente no RNA pode ser transformada em uma seqüência de aminoácidos. (16) A mensagem nela contida pode ser transcrita para uma outra molécula denominada RNA. apenas.(01) É formada por duas fileiras de nucleotídeos torcidas juntas em forma de hélice. d) apenas I. (64) Em alguns organismos primitivos. As proteínas e os ácidos nucléicos são formados por aminoácidos. apenas. Dentre as afirmativas abaixo. as conseqüências desses erros podem ser mais graves. c) errada. ela fica estocada dentro do núcleo das células. c) apenas II e III. (02) Em sua composição é possível encontrar quatro bases nitrogenadas diferentes: a adenina. que estabeleceu o modelo da estrutura da molécula de ácido desoxirribonucléico (DNA). c) na replicação e na transcrição. (08) Nela está contida a informação genética necessária para a formação de um organismo. Questão 461 Analise as afirmativas: I. (04) Ela tem a capacidade de se autoduplicar. através do processo denominado tradução. e) apenas II. a citosina. quando ocorrem a) na transcrição. Questão 462 Este ano comemorou-se 50 anos da publicação do trabalho de Francis Crick e James Watson. Entretanto. Está(ão) correta(s) a) apenas I. ela apresenta apenas uma fileira de nucleotídeos. (32) Nos organismos procariontes. e) em qualquer um dos três processos. e) As duas cadeias de uma dupla-hélice possuem a mesma orientação. apenas. embora em baixa freqüência. III. da maneira como foi veiculada.

e) Não haveria alteração alguma na freqüência desses alelos.6% de diferenças pode contribuir para entendermos como. nos 6 milhões de anos que separam a evolução do homem e do chimpanzé de um ancestral comum. uma vez que o núcleo injetado não possui alguns genes. 104 . corretamente. Alguns cientistas dos EUA afirmam que os chimpanzés (Pan troglodites) são geneticamente tão parecidos com os homens que deveriam ser incluídos no gênero Homo. uma vez que o núcleo injetado proveniente da célula diferenciada contém DNA cuja composição de bases nitrogenadas é diferente da célula-ovo. b) a morte da célula-ovo. que não faz parte das seqüências que podem ser transcritas e traduzidas. a comparação da seqüência de DNA de 97 genes comuns de humanos e de chimpanzés revelou 99. terão algum impacto no curso da evolução humana. mais pessoas se tornariam independentes de procedimentos médicos. Estudar estes 0. c) a formação de um clone de células não diferenciadas.) Tendo em vista o texto apresentado. conferiria vantagem seletiva a uma família. haveria adaptação genética a resistência a muitas doenças. Mais recentemente. se aplicadas consistentemente. Assinale a alternativa que mostra. DIZ ESTUDO. Qualquer resistência às doenças infecciosas (de caráter hereditário). b) Os genótipos que produzem pouca ou nenhuma resistência se tornariam comuns. A diferença nos percentuais de identidade dos dois estudos se deve ao fato de que em 1998 foi estudado o DNA não-codificante. d) Os 97 genes comuns são os responsáveis pela diferenças entres seres humanos e chimpanzés. c) Seqüências de DNA que podem ser expressas como proteínas apresentaram maiores semelhanças que as seqüências não codificadoras. os efeitos da imunização em massa sobre a freqüência da resistência ou susceptibilidade inata às doenças. não fertilizado e cujo núcleo tenha sido removido. em uma mesma área de floresta. ao longo de 100 anos. A idéia surgiu pela primeira vez em 1998 quando a análise de seqüências de DNA de humanos e de chimpanzés revelou 98. d) a formação de um girino normal a partir do ovo.4% dos genes apresentam a mesma seqüência de DNA. a) A freqüência dos alelos que conferem resistência inata às doenças seria aumentada.4% de identidade entre os genes humanos e de chimpanzés. removidos durante a diferenciação. Questão 466 CHIMPANZÉ TAMBÉM É "GENTE". biologicamente não somos tão diferentes dos chimpanzés como muitos crêem.Questão 465 Ao se injetar o núcleo de uma célula diferenciada de uma rã em um ovo de outra rã. removidos durante a diferenciação. apenas um deles desenvolve a capacidade de compor música.Paulo". ocorrerá: a) a morte da célula-ovo. e) a expulsão do núcleo injetado por meio de exocitose realizada pela célula-ovo. (Fonte: "Folha de S. d) A longo prazo. uma vez que o núcleo injetado não contém determinados genes.4% de identidade. uma vez que o núcleo injetado contém toda a informação (DNA) necessária à formação do girino. Questão 468 O gráfico mostra a variação dos números de indivíduos do tipo original e do tipo mutante. como o sarampo e a difteria. b) 99. que até o momento tem o Homo sapiens como único representante vivo. Questão 467 Descobertas recentes na medicina e na saúde pública. c) A longo prazo. assinale a afirmativa CORRETA. em 21/05/2003. a) As espécies Homo sapiens e Pan troglodites surgiram há 6 milhões de anos. de construir prédios e de fazer pesquisa científica. Na realidade.

LEU Admitindo-se um ancestral comum para as três espécies.GLU . II.ARG .Questão 470 A seguir estão representadas três seqüências de aminoácidos de proteínas retiradas de diferentes espécies (A. b) de asa longa. presente em praticamente todos os animais.10 Questão 471 Moscas de asas longas cruzadas entre si fornecem moscas com asas vestigiais.HIS .ALA ALA . B e C).LEU espécie C: MET .ARG .ARG .PRO .VAL .LEU . o procedimento correto é analisar a prole resultante do cruzamento desta mosca com outra de: a) asa vestigial.4.10 105 .LEU . com base na forma da proteína presente nos grupos de animais I.PHE .PHE .ALA .1. A ocorrência dessas mutações pôde ser localizada nos pontos indicados pelos retângulos escuros na árvore filogenética. 1.HIS .PHE .4. Questão 469 Um determinado tipo de proteína.ARG .LEU .ARG ALA . IV e V. a forma PX. b) o tipo original e o tipo mutante estão igualmente adaptados à mesma área de floresta. c) genótipo igual ao seu. e) fenótipo dominante.VAL .LEU . 1. resultante de mutação no gene que codifica PX. deixa de existir o efeito de dominância do alelo para o tipo original sobre aquele para o tipo mutante. d) a partir de 50 anos.ALA.ARG .ALA ARG .HIS .ARG . o tipo mutante passou a parasitar o tipo original.LEU .LEU espécie B: MET . espécie A: MET .PRO .1.4.ARG . c) a mudança de ambiente provocou alteração nas freqüências gênicas. III. Para determinarmos se uma mosca de asa longa é homozigota ou heterozigota quanto ao par de genes que condicionam este caráter.GLU . d) fenótipo igual ao seu. Indique a alternativa que mostra as proteínas encontradas nos grupos de animais I a V. ocorre em três formas diferentes: a forma P.7 análise do gráfico permite concluir que: a) o tipo original permanece melhor adaptado ao longo do período analisado. e) após 50 anos. a árvore filogenética que melhor expressa o parentesco evolutivo entre as três é: 1.VAL .1.GLU .PRO . resultante de mutação no gene que codifica P.ARG . e a forma PY.

d) de um caso que pode ser tanto de herança ligada ao sexo como de herança autossômica. 2 ter um descendente com a anomalia. ser albino e do sexo masculino é: a) nula b) 25 % c) 50 % d) 75 % e) 100 % Questão 474 A incidência de determinada anomalia foi investigada nos indivíduos da espécie humana representados no heredograma a seguir: Sabendo-se que os símbolos escuros representam portadores da anomalia. é possível afirmar que se trata a) exclusivamente de um caso de herança ligada ao sexo. sendo a anomalia determinada por um gene recessivo e impossível o casal n¡.1 esquema anterior mostra uma experiência com um coelho himalaia. resultantes do casamento de um homem heterozigoto para esse fator. b) exclusivamente de um caso de herança autossômica.5.5. b) mutação gênica. 2 ter um descendente do sexo masculino com a anomalia. sendo a anomalia causada por um gene dominante e de 75% a probabilidade de o casal n¡. sendo a anomalia causada por um gene recessivo e de 75% a probabilidade de o casal n¡. d) penetrância de um gene. A mudança ocorrida na coloração do pêlo em função da queda de temperatura demonstra o efeito da: a) norma de reação. sendo a anomalia determinada por um gene recessivo e de 50% a probabilidade de o casal n¡. a) 0% b) 25% c) 50% d) 75% e) 100% 106 . 3 ter um descendente com a anomalia.1. mas heterozigota.Questão 472 1. e) de um caso de herança ligada ao cromossomo Y e de 50% a probabilidade de o casal n¡. c) de um caso que pode ser tanto de herança ligada ao sexo como de herança autossômica. Questão 473 Na espécie humana.1 1. o albinismo é causado por um gene autossômico recessivo. 2 ter um descendente com a anomalia. 3 ter um descendente com a anomalia. e) alteração do genótipo pelo ambiente. c) expressividade de um gene. determine a porcentagem de descendentes com o fenótipo igual ao do pai. com uma mulher de igual genótipo. Questão 475 Sabendo-se que o albinismo é um caráter recessivo.1. A probabilidade do primeiro filho de um homem albino casado com uma mulher normal.

e) a cor preta é recessiva. d) o genótipo do indivíduo pode variar como resultado da expressão de seu fenótipo em diferentes ambientes. c) fenótipo depende do genótipo e do meio ambiente. resulta numa maior freqüência de indivíduos com anomalias genéticas. A e B são homozigotos. b) o genótipo do indivíduo é o resultado da ação do ambiente sobre seu fenótipo. ou seja. A tabela a seguir apresenta resultados de vários cruzamentos feitos com diversas linhagens dessa planta: 1. A e C são homozigotos. O cruzamento do gato A com a gata B produziu 8 filhotes. Esse gene: a) está no cromossomo X. João e Maria. c) a cor preta é dominante.Questão 476 Num homem heterozigoto para determinado caráter.1. e) pode estar num cromossomo ou num autossomo.1 107 . b) genótipo depende do ambiente.5. o cruzamento do gato A com a gata C produziu 6 filhotes pretos e 2 amarelos. uma expressão bastante conhecida diz que fenótipo é o genótipo mais o ambiente. Questão 482 Dois genes alelos atuam na determinação da cor das sementes de uma planta: (A). b) a cor preta é dominante. Questão 480 Pedro e seus filhos. Questão 481 Um gato preto (A) foi cruzado com duas gatas (B e C) também pretas. todos pretos. visando à sua adaptação. Questão 478 Sabe-se que o casamento consangüíneo. B e C são heterozigotos. têm uma doença determinada por um gene dominante. dominante. Não há outros afetados na família. entre indivíduos que são parentes próximos. d) genótipo depende do fenótipo e do meio ambiente. determina a cor amarela. e) genótipo depende dos genes. d) a cor preta é recessiva. a porcentagem provável de espermatozóides que conterão o gene recessivo desse caráter é de: a) 0% b) 25% c) 50% d) 75% e) 100% Questão 477 Algumas variedades de canários mudam de cor dependendo da alimentação que recebem. c) está num autossomo. b) está no cromossomo Y. A análise desses resultados permite concluir que: a) a cor preta é dominante. recessivo. determina a cor púrpura e (a). Isso pode ser justificado pelo fato de os filhos apresentarem: a) maior probabilidade de heterozigoses recessivas b) maior probabilidade de homozigozes recessivas c) menor probabilidade de heterozigoses dominantes d) menor probabilidade de homozigoses dominantes e) menor probabilidade de homozigoses recessivas Questão 479 Na genética. A e C são heterozigotos. d) pode estar no cromossomo X ou no Y. c) o fenótipo do indivíduo é o resultado da expressão de seu genótipo em um dado ambiente. e) o fenótipo do indivíduo é invariável e resulta da expressão de seu genótipo. em qualquer que seja o ambiente. Esta mudança indica que o: a) fenótipo depende do ambiente. Essa expressão significa que a) o ambiente altera o genótipo do indivíduo. A e C são homozigotos.

caráter condicionado por um alelo recessivo a. c) dois óvulos D e dois óvulos d.presentam genótipo (Aa) as linhagens: a) I e III b) II e III c) II e IV d) I e IV e) III e IV I Questão 483 Considere os seguintes cruzamentos para ervilha.2. b) apenas do cruzamento II. portanto. e) apenas um óvulo D ou um óvulo d. heterozigoto e que. e) dos cruzamentos I. sabendo que V representa o gene que determina cor amarela dos cotilédones e é dominante sobre o alelo v. d) apenas dos cruzamentos II e III. Indivíduos escuros cruzados entre si produzem. Questão 487 De uma população de 100 camundongos foi retirado ao acaso um indivíduo com deficiência da enzima E. c) apenas do cruzamento III. I. Já os cruzamentos entre indivíduos claros produzem sempre apenas descendentes de cor clara. Vv x vv Um pé de ervilha.1. descendentes claros e escuros. d) apenas um óvulo Dd. gêmeos monozigóticos ou dizigóticos? a) 25% e 50% b) 25% e 75% c) 50% e 25% d) 50% e 50% e) 50% e 75% Questão 489 Em uma população de mariposas. c) genótipos e fenótipos iguais. casada com um portador de doença genética de herança autossômica dominante. b) quatro óvulos D e quatro óvulos d. e) 1% dos indivíduos da população têm deficiência da enzima E. II e III. d) a freqüência do alelo a é 0. 96% dos indivíduos têm cor clara e 4%. e) genótipos variados em cada grupo. Questão 486 Qual a porcentagem de descendentes Aa nascidos de uma mãe Aa? a) 25% b) 50% c) 75% d) 100% e) depende do pai. b) o mesmo fenótipo e genótipos diferentes. c) a freqüência do alelo a é 0. Questão 488 Uma mulher normal. Entre os possíveis gametas formados por essa ovogônia. Questão 485 Considere uma ovogônia de uma mulher heterozigota para o par de alelos Dd. Depois de alguns dias. está grávida de um par de gêmeos. Questão 484 Dois grupos de mudas obtidas a partir de um mesmo clone de plantas verdes foram colocados em ambientes diferentes: um claro e outro escuro. as plantas que ficaram no escuro estavam estioladas o que significa que os dois grupos apresentam: a) o mesmo genótipo e fenótipos diferentes. na maioria das vezes. Qual é a probabilidade de que pelo menos um dos gêmeos venha a ser afetado pela doença no caso de serem. podemos encontrar: a) quatro óvulos Dd. É correto afirmar que a) seus pais podem ser fenotipicamente normais. pode resultar a) apenas do cruzamento I. que determina cor verde. b) seus pais são certamente heterozigotos. VVx vv II. cor escura. produz vagens com sementes amarelas e com sementes verdes. respectivamente. Vv x Vv III. Esses resultados sugerem que a cor dessas mariposas é 108 . d) genótipos e fenótipos diferentes.

d) uma trinca de bases do RNA mensageiro.200. Questão 490 Uma população experimental contém 200 indivíduos AA. aa . autofecundação. Aa . aa . publicado em 1866. d) dois genes ligados com alta taxa de recombinação entre si. meiose. Aa . d) promoveu o encontro de gametas com os mesmos alelos para estatura. espera-se encontrar entre os filhotes: a) AA . Para determinarmos se uma mosca cinza é homozigota ou heterozigota quanto ao par de genes que condicionam esse caráter. Aa . e) reproduz uma característica provocada pelo ambiente. c) genótipo igual ao seu.100 d) AA .100 Questão 491 Em seu trabalho com ervilhas.100.200. que não apresentam dominância um sobre o outro.50 b) AA . 109 . Questão 495 "Cada caráter é condicionado por um par de fatores que se separam na formação dos gametas". sendo o alelo para cor escura dominante sobre o que condiciona cor clara. Questão 493 Dizemos que um determinado gene é recessivo quando sua expressão (fenótipo): a) só acontece em heterozigose. e) genes. Todos os indivíduos AA foram cruzados com indivíduos aa e os indivíduos Aa foram cruzados entre si. como a coloração dos troncos onde elas pousam.1000. mitose. removendo as anteras da flor de uma planta homozigótica de alta estatura e colocando. Questão 492 Em plantas de ervilha ocorre. c) independe da presença de seu alelo.200 e) AA .400. Aa . o pesquisador a) impediu o amadurecimento dos gametas femininos. a existência das seguintes estruturas e processo de divisão celular.800. pólen recolhido da flor de uma planta homozigótica de baixa estatura. b) um segmento de DNA com informação para um RNA ribossômico. Mendel fez fecundações cruzadas. embora sem conhecer. d) genes. b) só ocorre quando em dose dupla. o procedimento correto é analisar a prole resultante do cruzamento dessa mosca com outra de a) cor preta.200.condicionada por a) um par de alelos. e) fatores ambientais.100.100 c) AA . mitose. respectivamente. O conhecimento atual a respeito da natureza do material hereditário permite dizer que a letra A usada por Mendel simboliza a) um segmento de DNA com informação para uma cadeia polipeptídica. d) depende de características congênitas.500. aa . respectivamente: a) cromossomos. Mendel representou os fatores hereditários determinantes dos estados amarelo e verde do caráter cor da semente pelas letras A e a. e) impediu o encontro de gametas com alelos diferentes para estatura. c) um par de alelos. Mendel ao enunciar essa lei já admitia. b) trouxe gametas femininos com alelos para baixa estatura. c) núcleos. c) trouxe gametas masculinos com alelos para baixa estatura. meiose. Para estudar os mecanismos de herança. d) fenótipo igual ao seu. sendo o alelo para cor clara dominante sobre o que condiciona cor escura. aa . b) cor cinza. normalmente. b) núcleos. e) uma trinca de bases do RNA transportador. mitose. Aa . aa . sobre seu estigma. b) um par de alelos. Com esse procedimento. e) fenótipo dominante. 200 aa e 200 Aa. c) um aminoácido em uma proteína. Questão 494 Moscas de coloração acinzentada cruzadas entre si fornecem moscas de cor preta.50. Considerando que cada casal produziu 2 descendentes.

1 110 . Questão 499 Do cruzamento de duas moscas com asas nasceram 120 descendentes com asas e 40 sem asas. assinale a alternativa INCORRETA. o estame pode ser de cor púrpura ou verde. Esse fenômeno é conhecido como: a) herança aditiva b) poligenia c) pleiotropia d) codominância Questão 501 Analise o heredograma para um fenótipo recessivo esquematizado a seguir e assinale a afirmativa INCORRETA. 75% dos filhotes produzidos em F‚ tinham pêlo preto e 25% apresentavam pêlo marrom.000 e) 12. originou-se uma F1 composta por plantas com nervuras regulares e outras com nervuras irregulares. Questão 498 Em uma determinada planta.000 b) 6.Questão 496 Em tomates. o padrão das nervuras foliares pode ser regular ou irregular. Do cruzamento entre duas plantas com nervuras irregulares. então a porcentagem de descendentes com estames verdes será de: a) 25% b) 50% c) 75% d) 0 e) 100% Questão 497 Em porquinhos da Índia. a) 6. c) Todos os F1 com nervuras irregulares são heterozigotos. d) Todos os indivíduos marrons eram homozigotos. respectivamente. produzindo uma F composta por indivíduos marrons e pretos em igual quantidade. a) As plantas cruzadas são heterozigotas. presença ou ausência de manchas nas axilas foliares. o pêlo pode ser preto ou marrom.000 e 3. e) Os indivíduos pretos da geração F eram heterozigotos e a fêmea parental era homozigota. c) Todos os indivíduos pretos de F‚ eram heterozigotos. em que um único par de alelos é responsável por três características fenotípicas: cor das flores.000 Questão 500 Em genética. um único par de alelos determina mais de uma característica no organismo. cor das sementes. e) Os indivíduos F1 de nervuras regulares só podem ser homozigotos. surgirão indivíduos regulares e irregulares na proporção 1:1.000 e 4. b) Os indivíduos pretos de F eram homozigotos. A partir desses dados. Uma fêmea preta foi cruzada com um macho marrom. 1. em alguns casos. obteve-se uma geração F composta apenas de indivíduos com estames de cor púrpura. Retrocruzando-se um macho preto de F com a fêmea parental. Se os 120 descendentes com asas forem cruzados com moscas sem asas e se cada cruzamento originar 100 indivíduos.000 e 4. Isso ocorre. Se esses indivíduos forem retrocruzados com os parentais de estames verdes. Cruzando-se plantas de estames de cor púrpura com plantas de estames verdes.5. A partir desses resultados. b) A proporção fenotípica em F1 é de 3/4 de indivíduos irregulares e de 1/4 de indivíduos regulares. assinale a alternativa correta.000 e 3.000 c) 8. o número esperado de indivíduos com asas e sem asas será.1.000 d) 9. com ervilhas. por exemplo.000 e 6. a) 50% dos indivíduos pretos de F‚ eram heterozigotos. d) Se um indivíduo F1 com nervuras regulares for cruzado com um indivíduo da geração P.

amarelos ou roxos. fenotípica mendeliana 3:1 aparecerá na geração F2." No trecho acima. recessivo. b) haverá igual chance de adaptação de animais com os três genótipos apenas na região I. homozigoto e aa. por: a) AA. de acordo com o esquema a seguir. as lacunas I.a) As pessoas afetadas possuem pelo menos um dos pais obrigatoriamente afetado. onde há predadores naturais da espécie. toda a descendência da primeira geração (F1) assemelha-se ao tipo parental dominante (Aa). 1/2 AA e 1/4 aa e) É impossível determinar os genótipos utilizando os dados acima. os animais de genótipo CC são mais facilmente capturados pelos predadores. Questão 502 Os bulbos da cebola podem ser brancos. quando a geração F1 se intercruza. e) aa. há um caráter mendeliano com co-dominância e genótipos EE. que chamaremos de E1. dominante. Sabe-se que animais heterozigóticos são mais resistentes a um dado vírus X do que os homozigóticos. d) Aa. uma homozigota para o alelo dominante (AA) e uma homozigota para um alelo recessivo (aa). Nos dois ambientes. homozigoto e Aa. Questão 503 Quando duas populações da espécie vegetal 'Zea mays' (milho). Animais com os três genótipos foram introduzidos em duas regiões diferentes designadas por I e II. b) amarelo com planta de bulbo amarelo não produz plantas com bulbo roxo.1. sob a ação de uma enzima. As duas enzimas são codificadas por genes alelos dominantes com segregação independente. 1/2 Aa e 1/4 aa c) 1/3 AA e 1/4 aa d) 1/4 Aa. Nesses vegetais. que apresentam genótipo __(I)__ podem ter filhos albinos. são cruzadas. que a enzima E2 transforma em roxo. Em I não há registro da presença do vírus X e em II ele é transmitido por contato com as presas da espécie. Questão 505 1. se transforma em um pigmento amarelo. existe um precursor incolor que. c) roxo com planta de bulbo roxo pode produzir todos os três fenótipos mencionados. Pode-se prever que a) haverá igual chance de adaptação de animais com os três genótipos nas duas regiões. Porém. 111 . d) Se um dos pais é heterozigoto. o alelo recessivo pode ser herdado por descendentes fenotipicamente normais.5. Questão 504 "Casais de pigmentação da pele normal. b) Aproximadamente 1/4 das crianças de pais não-afetados pode ser afetado. O gene para o albinismo é __(II)__ e não se manifesta nos indivíduos __(III)__. c) O fenótipo ocorre igualmente em ambos os sexos. embora seja heterozigota. c) Aa. é INCORRETO afirmar que o cruzamento de plantas de bulbo: a) incolor com planta de bulbo incolor só pode originar fenótipo incolor. São albinos apenas os indivíduos de genótipo __(IV)__. EC e CC. heterozigotos e AA. heterozigotos e aa. II. III e IV devem ser preenchidas correta e. recessivo.1 Analisando as informações apresentadas de acordo com os seus conhecimentos. respectivamente. d) amarelo com planta de bulbo incolor não produz plantas com bulbo roxo. b) AA. heterozigotos e aa. dominante. pois os genótipos serão: a) 1/2 AA e 1/2 aa b) 1/4 AA. a proporção Em uma certa espécie de mamíferos. dominante. c) haverá maior número de animais com genótipos EE e CC do que com genótipo EC na região I.

A partir desses dados. I. d) os animais cruzados eram heterozigotos.Crossing-over III . Se esses descendentes pretos forem cruzados entre si. a proporção fenotípica esperada na prole será de a) 3 pretos :1 branco b) 2 pretos :1 branco c) 1 preto : 3 brancos d) 1 preto : 2 brancos e) 1 preto :1 branco Questão 509 Sabe-se que a transmissão hereditária da cor das flores conhecidas como copo-de-leite se dá por herança mendeliana simples. Animais com cauda longa foram cruzados repetidas vezes entre si originando sempre descendentes com cauda longa. I. Os descendentes. IV e III b) III. II. I. a cor preta do pêlo é condicionada por um alelo dominante e a cor branca. IV e III 112 . V e IV d) IV. numa dada espécie. seja condicionado por um par de alelos. Um cruzamento-teste de um indivíduo de cor preta produziu descendentes brancos e pretos em igual número. pelo alelo recessivo. ( ) segmento do DNA capaz de transcrever uma molécula de RNA. III. Qual é a probabilidade de um casal de acondroplásicos. De acordo com tais dados. ( ) atuam sobre a mesma característica. a acondroplasia é uma anomalia determinada por um gene autossômico dominante. vir a ter um menino acondroplásico? a) 1 b) 3/4 c) 3/8 d) 1/4 e) 1/8 Questão 507 Considere que o comprimento da cauda. e) a seleção natural será mais favorável aos animais com genótipo EE na região II. só é possível concluir que a) o caráter é recessivo. III e V e) I. ( ) conjunto de características detectáveis de um indivíduo.Gene ( ) troca de fragmentos de cromossomos homólogos na primeira divisão da meiose. numa proporção de 3 descendentes vermelhos para cada branco (3:1).bastante numerosa. os cientistas constataram que apenas um em cada três descendentes vermelhos era homozigoto para essa característica. I .Genoma II . mas não são obrigatoriamente iguais. V.Alelo V . com dominância completa. Analisando o genótipo da F. II. b) o caráter é dominante. A seqüência correta é: a) II. Questão 508 Em cobaias. também só originaram filhotes de cauda longa. obteve-se uma primeira geração . II. Em um cruzamento experimental de copos-de-leite vermelhos. Questão 506 No homem. associando os conceitos aos respectivos termos. c) os animais cruzados eram homozigotos. I.d) a seleção natural será mais favorável aos animais com genótipo EC na região II. e) o genótipo dos descendentes difere do dos pais.Fenótipo IV . quando cruzados entre si.F . pode-se afirmar que a produção genotípica da F desse cruzamento experimental foi: a) 4 Aa b) 2 Aa : 2 aa c) 3 AA : 1 Aa d) 1 AA : 2 Aa : 1 aa Questão 510 Numere a segunda coluna de acordo com a primeira. ( ) conjunto de genes organizados nos cromossomos. que já tem uma menina normal. V e IV c) II. V.

O enunciado da Primeira Lei de Mendel diz que os alelos de um gene separam-se durante a formação dos gametas. I. O enunciado da Segunda Lei de Mendel diz que quando dois ou mais genes estão envolvidos. e) Y. a 3. cada um atua e segrega independentemente dos demais. Assinale: a) se somente I e II estiverem corretas. 2 .X e Y . Supondo-se que duas espécies vegetais . tanto da espécie X quanto da espécie Y. II e III estiverem corretas. podese afirmar que se obtém na espécie: a) X e na espécie Y. por se tratar de herança ligada ao sexo. o que estimula a obtenção de culturas vegetais com máxima produtividade. d) se somente II e III estiverem corretas. Questão 512 Com o enorme crescimento populacional. sejam mais produtivas. 100% de mudas altas ao cruzar as mudas médias em F2. Concluiu-se com relação a estas proposições que: a) Apenas a 2. b) X. 5 . 100% de mudas altas ao cruzar mudas altas em P1 com mudas altas em F2.Um homem calvo (homozigoto) transmite a característica da calvície a todos os filhos homens nascidos de seu casamento com uma mulher não calva. A fase da meiose. a 3 e a 4 são corretas. a 4 e a 5 são corretas. mas na maioria dos casos é claramente hereditária. a 2 .1.Em nenhuma hipótese a calvície ocorre na mulher. c) se somente I estiver correta. é a Anáfase I. há também uma necessidade crescente de alimentos.Questão 511 Considere as seguintes proposições: 1 . c) Y. III. obtendo F1 que ao serem fenótipos resultantes dos cruzamentos foram representados nos gráficos a seguir: upondo que as plantas altas. sabe-se que o cruzamento de duas linhagens homozigotas selecionadas pode produzir espigas maiores e de melhor qualidade comercial. Muitas vezes esse melhoramento lança mão do conhecimento da herança genética de um determinado carácter como. b) taxa de crossing-over.1 113 . c) Apenas a 1.5. a 3 e a 4 são corretas. e) se I. d) Apenas a 1. 100% de mudas altas ao cruzar mudas altas em F2.poderiam apresentar mudas com alturas diferentes. em conseqüência da alta a) interação de genes recessivos. e) Apenas a 2. II. 1. c) freqüência de genes em heterozigose. responsável pela ocorrência da Segunda Lei de Mendel. a 3 e a 4 são corretas. Questão 514 Considere as proposições seguintes. d) inativação de alelos codominantes. 100% de mudas altas ao cruzar mudas altas em P1 com mudas médias em F2. a altura. Questão 513 No que se refere ao desenvolvimento do chamado milho híbrido. por exemplo. b) se somente I e III estiverem corretas.Uma mulher será calva se seus pais forem calvos e se sua mãe (heterozigota) possuir um de seus genitores calvo.A calvície pode ser originada por causas ambientais. e) ocorrência de pleiotropia. d) Y. b) Apenas a 1.A calvície é dominante no sexo masculino 4 . realizou-se cruzamento entre mudas altas e baixas das duas espécies (P1). 3 . a 2 e a 3 são corretas. 50% de mudas altas ao cruzar as mudas altas em F1.

b) As plantas com vagens verdes ou amarelas da geração parental devem ser homozigotas. mutantes. EXCETO: a) A expressão do alelo recessivo do gene desaparece apenas em F. d) à ocorrência de genótipos diferentes em uma população. representado por dois alelos. Questão 520 Analise esta tabela: MÉDIA DAS DIFERENÇAS NAS CARACTERÍSTICAS ENTRE GÊMEOS MONOZIGÓTICOS E DIZIGÓTICOS 114 .Questão 515 A primeira lei de Mendel ou lei da segregação significa: a) um cruzamento onde se considera apenas um gene. Na segunda geração (F‚) obteve 428 verdes e 152 amarelas. Questão 517 Quando Mendel cruzou plantas de ervilha apresentando vagens de coloração verde com plantas de vagens de coloração amarelas. O resultado desse fenômeno ilustra a) a adaptação dos mutantes. 1. e) à união dos gametas para formar o zigoto. c) a transmissão dos caracteres adquiridos. Questão 516 A primeira Lei de Mendel refere-se a) ao efeito do ambiente para formar o fenótipo.5. e) 100% de flores de coloração rósea. e) Os indivíduos que apresentam vagens de coloração verde em F‚ são heterozigotos. apresentam asas normais.5. c) O alelo dominante do gene se expressa em cor verde. e) um caráter controlado por dois ou mais genes. Todas as alternativas apresentam conclusões a partir desses resultados. b) 100% de flores púrpuras. b) um cruzamento de dois genitores homozigotos contrastantes. Questão 518 A coloração das flores de ervilha é determinada por herança autossômica. d) o processo de seleção natural. d) O caráter é controlado por um par de genes.1 s moscas de genótipo igual ao do tipo III. c) à ocorrência de fenótipos diferentes em uma população. d) a separação de um par de alelos durante a formação dos gametas. c) 75% de flores púrpuras e 25% de flores brancas. b) a influência do ambiente na expressão do genótipo. os descendentes obtidos em F1 apresentariam 1. Questão 519 Esta figura representa o cruzamento de drosófilas de asas normais com indivíduos de asas enroladas. Se Mendel utilizasse como genitor masculino as plantas de flores púrpuras e como feminino. as plantas de flores brancas. criadas em temperatura de 25°C.1 a) 100% de flores brancas. b) à segregação do par de alelos durante a formação dos gametas.1. c) um cruzamento de dois genitores heterozigotos. A figura a seguir representa um dos cruzamentos realizados por Mendel entre plantas de ervilhas com flores púrpuras e plantas com flores brancas. d) 50% de flores púrpuras e 50% de flores brancas. obteve na primeira geração (F) todos os descendentes de coloração verde.1. quando criadas em temperatura de 16°C.

é CORRETO afirmar que a) o peso é a característica que apresenta maior influência genética. e só pessoas com sardas podem ter filhos com sardas (veja no heredograma abaixo). em que se mostra o percentual de indivíduos doentes entre aqueles que possuem genótipo favorável: 1.1. ocorrem em todas as gerações.5. a) em torno dos 65 anos.1 1. b) antes de atingirem a idade de 15 anos. As sardas aparecem igualmente em homens e em mulheres. aproximadamente 75% dos indivíduos Aa se apresentam sem os sinais clínicos da doença. d) aos 40 anos. Questão 522 Na espécie humana há um gene que exerce ação simultaneamente sobre a fragilidade óssea.5. a surdez congênita e a esclerótica azulada. cerca de 85% dos indivíduos heterozigotos já manifestaram a doença.5.1 115 .1. podem ser transmitidas de pai para filho. d) o comprimento da cabeça apresenta maior influência ambiental. indivíduos portadores do alelo mutante podem expressar a doença.1. é INCORRETO afirmar que. a) Ligação genética b) Penetrância completa c) Pleiotropia d) Herança quantitativa e) Polialelia Questão 523 A presença de sardas em seres humanos é uma característica hereditária determinada por um par de alelos. Assinale a alternativa que define o caso. convulsões e morte. c) a influência ambiental pode ser avaliada em gêmeos MZ. Os indivíduos afetados são heterozigotos. filhos de casais Aa × aa têm 50% de probabilidade de manifestar a doença. om base nos dados dessa tabela e em outros conhecimentos sobre o assunto.1 Com base nas informações desse gráfico e em outros conhecimentos sobre o assunto. b) as diferenças entre gêmeos MZ indicam diferenças genéticas entre eles.1. Analise este gráfico. c) aos 30 anos. Questão 521 O mal de Huntington é uma doença autossômica dominante caracterizada por deterioração mental progressiva.

da mesma espécie. a freqüência fenotípica será de 1 acondroplásico para 1 normal.1. Este se casa com uma mulher normal cujos pais eram normais (conforme heredograma abaixo). (32) Numa prole numerosa.1 116 . seleção de parceiros e restrições ao endocruzamento. (08) A probabilidade de heterozigose na descendência em relação a este locus é igual a zero. e) a presença de sardas se deve a um alelo autossômico dominante. d) a presença de sardas se deve a um alelo autossômico recessivo. influenciando uma variedade de atividades como. dispersão dos filhotes ainda jovens. (02) A freqüência genotípica na descendência será 1:2:1. A respeito desse assunto. origina descendentes predominantemente heterozigotos. reconhecimento da prole. (08) O endocruzamento não interfere no valor adaptativo. (16) Um indivíduo híbrido é aquele que resulta da união entre dois indivíduos geneticamente diferentes. (04) O endocruzamento pode causar uma redução no valor adaptativo pela maior probabilidade de ocorrência de genótipos ou combinações homozigotas de alelos recessivos deletérios. (04) A probabilidade de acondroplasia na descendência é igual a zero. por exemplo. considerando ausência de mutação. é correto afirmar: (01) O cruzamento entre indivíduos geneticamente diferentes. (02) O cruzamento entre indivíduos geneticamente diferentes. b) a presença de sardas se deve a um alelo recessivo ligado ao cromossomo X. é possível deduzir que a) a presença de sardas se deve a um alelo recessivo ligado ao cromossomo Y.5. Em relação aos descendentes deste último casamento e ao caráter em questão. Quais os genótipos dos pais. Soma ( ) Questão 526 Cheiros e odores corporais fazem parte do aparato de comunicação em várias espécies de mamíferos. Machos e fêmeas sentem-se atraídos por odores de linhagens não relacionadas. Da união de um homem acondroplásico com uma mulher normal resulta um filho normal. da mesma espécie. é correto afirmar: (01) O descendente será obrigatoriamente heterozigoto.abendo disso. (16) A freqüência fenotípica numa prole numerosa será 3:1. Soma ( ) 1. Questão 524 Uma ovelha branca ao cruzar com um carneiro branco teve um filhote de cor preta. c) a presença de sardas se deve a um alelo dominante ligado ao sexo. origina descendentes homozigotos. se a cor branca é dominante? a) Ambos são homozigotos recessivos b) Ambos são brancos heterozigotos c) Ambos são homozigotos dominantes d) A mãe é Bb e o pai é BB e) A mãe é bb e o pai é Bb Questão 525 A acondroplasia (uma das formas de nanismo) é causada por um gene dominante autossômico.

d) alelismo múltiplo. a) Prófase I b) Metáfase I c) Anáfase I d) Metáfase II e) Telófase II Questão 530 João e Maria estão pensando em ter um filho. d) O indivíduo 8 é homozigoto dominante para a fibrose cística. representando o mecanismo de transmissão da fibrose cística: Questão 529 A Primeira Lei de Mendel ou Lei da Segregação dos Genes pode ser relacionada a uma das fases do processo meiótico. Assinale a opção que faz referência a esse erro. por parte de mãe. b) heterogeneidade genética. João tem um irmão albino e uma irmã com pigmentação normal. a) Os indivíduos 3 a 6 são heterozigotos para a fibrose cística.1 O esquema publicado apresenta um erro. em sua maioria. com o título "Teste ajuda a evitar doenças congênitas". Que informações permitem avaliar com maior precisão as chances de João e Maria terem um filho albino? a) O fenótipo da irmã de João e o genótipo do avô de Maria. c) O fenótipo do irmão de João e o fenótipo da irmã de Maria. ( ( ( ( ( ) Apresenta variantes genéticas facilmente observáveis. amplamente utilizado em experimentos na área de genética e evolução. Questão 531 Em 2005. d) O genótipo do primo de João e o fenótipo da mãe de Maria.5. ) Apresenta autofecundação. Assinale a alternativa que apresenta a fase referida. Assim. A seqüência correta de preenchimento dos parênteses. na pesquisa científica. A afirmação acima se refere ao conceito de a) dominância incompleta.Questão 527 A matéria publicada no Jornal O GLOBO. Assinale com V (verdadeiro) ou F (falso) as afirmações a seguir sobre esse inseto. ) Apresenta ciclo reprodutivo curto e fecundidade alta. e) O indivíduo 18 é afetado pela fibrose cística e não um portador desta doença. Já Maria tem um avô materno e uma irmã albinos e um irmão com pigmentação normal. 1.1. foi ilustrada com o esquema a seguir. b) O genótipo da tia de João e o genótipo do irmão de Maria. ) Apresenta pequeno número de cromossomos. Os produtos de uma cadeia de reações podem ser utilizados em muitas outras vias metabólicas. em 02 de julho de 1995. b) A fibrose cística é causada pela presença de um par de genes recessivos. são interligadas e freqüentemente interdependentes. Os pais de Maria também têm pigmentação normal. ) Não apresenta dimorfismo sexual. iniciaram-se as comemorações do centenário da utilização da 'Drosophila' sp. e) O fenótipo do pai de João e o genótipo do pai de Maria. c) A doença somente se manifesta quando dois indivíduos portadores são cruzados. porém João tem uma tia paterna albina e um primo. com a mesma característica. não é surpreendente que a expressão fenotípica de um gene envolva mais do que uma característica. Questão 528 As reações bioquímicas. Seus pais não são albinos. de 117 . e) fenocópia. c) pleiotropia.

F .. c) Apenas I e III.Hermione apresenta dois alelos para o caráter bruxo.1.4/8 c) 5/8 . embora seus pais não fossem calvos. filho de bruxos. Essa conclusão baseia-se no fato de a) sua mãe ser heterozigota. Neville e Draco. III .obedece ao proposto pela 1 Lei de Mendel. filho de uma bruxa e de um trouxa. b) Apenas II. e) sua avó materna ser heterozigota.V . d) seu pai ser heterozigoto.V .. I .. Questão 532 Conforme correspondência publicada na revista científica "Nature" de agosto de 2005 (p. II .. somente em homozigose.2/8 e) 7/8 .. consultou um amigo que estava estudando genética.. resultando em 192 descendentes. Simas é bruxo. d) V ...V..cor da pelagem em coelhos . sendo sua mãe filha de trouxas..F .F . na ordem em que aparecem.1/8 Questão 534 Leandro.F.. filhos de pais bruxos.F .. 776). Seu amigo explicou que a calvície é uma característica influenciada pelo sexo e que se expressa nos homens em homo e heterozigose e nas mulheres.. sua avó materna era. Na família do avô materno. de ervilhas verdes.cima para baixo é a) F .. Quais estão corretas? a) Apenas I..Contou que. d) Apenas II e III. a) 3/8 .V ..F .V ..V . foi sugerido que a característica de ser ou não bruxo seguiria padrão de segregação mendeliana.. tendo sido realizados os cruzamentos a seguir: 1.Simas é heterozigoto para o caráter bruxo. e) V . de ervilhas amarelas e .V . provenientes de famílias bruxas tradicionais. II e III. b) seu avô paterno ser calvo. c) V .V.V.1 Todos os descendentes pretos de F2 foram cruzados com os F1. a produção de uma geração Fƒ a partir da autofertilização da geração F‚ resultante do cruzamento de ervilhas parentais homozigotas amarelas (AA) e verdes (aa) produziria . preocupado com a possiblidade de vir a ser calvo.V .5/8 b) 4/8 .5. Neville e Draco são bruxos. c) sua avó paterna ser heterozigota.. De acordo com a hipótese de segregação de fatores proposta por Mendel... Assim concluiu que a chance de Leandro vir a ser calvo era de 50%.F . não havia histórico de calvície.Harry é menos bruxo que Rony.F ..F .. b) F . Rony.. Questão 533 Assinale a alternativa que preenche corretamente as lacunas do texto a seguir. Questão 535 Considere que o caráter analisado . e) I...3/8 d) 6/8 .. Com base no texto. Hermione é bruxa mas filha de trouxas (não bruxos). considere as seguintes afirmações sobre o caráter bruxo em termos genéticos.F.. Assinale o número esperado de descendentes com pelagem branca. Harry é bruxo. 118 .

a fração de descendentes gigantes. um indivíduo heterozigoto para um caráter regulado por dominância completa provavelmente produzirá a seguinte porcentagem Suponha que um evento de mutação permitiu ao homem-aranha secretar a seda formadora de teia. 25% homozigota dominante e 25% homozigota recessiva. c) Na geração F1. apenas o efeito ambiental prevalece no fenótipo. de gametas: a) 100% com alelo recessivo. c) Os genes dominantes são independentes dos fatores ambientais para se expressarem. e) Na presença de genes recessivos. assinale a alternativa CORRETA: a) Os genes codominantes têm menor influência no fenótipo do que os fatores ambientais. o que se deseja é a produção de sementes. d) 100%. Se o pólen de uma planta heterozigota para um determinado loco gênico fecundar os óvulos de uma planta também heterozigota para esse loco. e) Quem herdar o cromossomo Y deverá ser uma criança-aranha. Considerando que o homem-aranha é o único a ter essa mutação. de zigoto de camundongo. Questão 537 Por meio da técnica do DNA recombinante. Desta forma.5. na fase G do ciclo celular. Questão 540 1. Com relação aos princípios básicos da hereditariedade. c) 50% com alelo recessivo e 50% com alelo dominante. b) 25%.1. uma cópia de um gene humano.Questão 536 Em vários cultivos. será igual a a) zero. Questão 539 Os mecanismos da herança apresentam diferentes maneiras pelas quais os genes interagem entre si e com o ambiente para manifestarem seus efeitos no fenótipo dos seres vivos. d) Analisando apenas as filhas. d) formada por homozigotos para o alelo dominante. b) Todos os seus meninos deverão ter o fenótipo "aranha". mas com expressão influenciada pelo sexo. b) Na expressão gênica os efeitos do ambiente celular não são considerados. responsável pela síntese do hormônio do crescimento (somatotrofina). e) formada por homozigotos recessivos. por exemplo. foi integrada a um único cromossomo. Assinale a afirmativa CORRETA: a) Terá filhas-aranha se casar com uma prima de primeiro grau. e) 75% com alelo recessivo e 25% com alelo dominante. b) 100% com alelo dominante. Questão 538 De acordo com a primeira lei de Mendel. não portadora do gene do hormônio do crescimento. gerando um camundongo macho gigante. d) 75% com alelo dominante e 25% com alelo recessivo. provavelmente. Esse único evento resultou na formação de um alelo (S) autossômico e dominante. c) 50%. 25% poderá ser de meninos-aranha. 50% delas deverão ser normais. c) 50% heterozigota. Para a produção de milho. a expectativa quanto aos fenótipos de seus futuros descendentes poderá ser uma entre as possibilidades abaixo. espera-se que a F seja a) 100% heterozigota. d) Pode ser muito difícil determinar se o fenótipo resulta mais do efeito gênico do que o ambiental. 119 . mulheres-aranha seriam esperadas na população apenas se tal alelo ocorresse em homozigose (SS). Este zigoto foi implantado em uma "mãe de aluguel". é necessário que ocorra a polinização.1 Se o camundongo macho gigante cruzar com uma fêmea normal. b) 50% dominante e 50% recessiva.

que pode apresentar dominância ou recessividade. e) Depende do tipo de diabete. foram realizados cruzamentos entre esses animais.5%.5. Entre as cobaias de pêlos curtos.5. pois nesses casos o genótipo pode ser alterado evitando a manifestação da doença nos filhos. c) Sim. 1. com prejuízo da fala e dos movimentos. b) Não. pois o genótipo dos filhos não é alterado pela insulina. pois a insulina é incorporada nas células e terá ação nos filhos. d) 160. das quais 240 tinham pêlos curtos. (1) O caráter fenilcetonúrico apresenta herança autossômica dominante. (2) O cruzamento entre os indivíduos 10 e 11 ilustra como a consangüinidade influencia o aparecimento de doenças hereditárias. d) Sim. (4) A probabilidade de que o casal formado pelos indivíduos 10 e 11 tenha um descendente do sexo masculino fenilcetonúrico é igual a 12. e) 180. Questão 543 O gene autossômico.1 120 .1. julgue os itens abaixo. Questão 542 Os vários tipos de diabete são hereditários. A administração de insulina aos diabéticos evitará que eles tenham filhos com este distúrbio? a) Não. (5) A dieta especial a que devem ser submetidos os recém-nascidos fenilcetonúricos tende a alterar a freqüência do gene da fenilcetonúria na população. os sintomas podem ser evitados por meio de injeções diárias de insulina. Questão 544 Considerando-se que a cor da pelagem de cobaias é determinada por um par de alelos. conforme a tabela. 1. c) 90. doença hereditária que pode levar ao retardamento mental. Se detectada a tempo. Do cruzamento de cobaias heterozigotas nasceram 300 cobaias. o número esperado de heterozigotos é: a) 45. O heredograma seguinte ilustra uma situação em que há indivíduos fenilcetonúricos. (3) Os homens normais representados no heredograma são necessariamente heterozigotos.Questão 541 No Brasil. b) 60. pois tanto o genótipo como o fenótipo dos filhos são alterados pela insulina. que condiciona pêlos curtos em cobaias.1 Considerando o heredograma. essa doença pode ser controlada ministrando-se ao recém-nascido uma dieta especial.1. uma lei determina que os recém-nascidos sejam submetidos ao "teste do pezinho". é dominante em relação ao gene que determina pêlos longos. pois a insulina é incorporada no sangue fazendo com que os filhos não apresentem o distúrbio. Em algumas dessas formas. por meio do qual se identifica a fenilcetonúria. embora o distúrbio possa aparecer em crianças cujos pais são normais.

é necessário cruzar: a) duas plantas de flores rosas.análise da tabela permite concluir que a) no cruzamento I. Com base nessas informações. a proporção fenotípica observada em F‚ significa exatamente que: a) 25% da prole expressam o fenótipo determinado pelo alelo dominante e 75% não o expressam. b) no cruzamento II. b) autossômica dominante. 7 brancos e 8 pretos. por suscetibilidade aumentada a infecções e tendência a sangramentos. entre outras manifestações. c) uma planta de flores rosas com outra de flores 121 . d) no cruzamento IV. nasceram 15 filhotes azulados. é possível o aparecimento de indivíduos albinos. d) o gene para albinismo é ativado no escuro. observou-se que a síndrome não se manifesta em algumas gerações e pode ocorrer em indivíduos que aparentemente têm pais normais. Embora plantas albinas morram antes de produzirem sementes. Isto se explica porque: a) muitas plantas verdes são heterozigóticas. Questão 548 Mendel cruzou duas variedades de 'Mirabilis jalapa'. pode-se dizer que o tipo de herança responsável por essa síndrome é a) autossômica recessiva. e) 50% da prole possuem um único tipo de alelo e 50% possuem outro tipo de alelo. Na geração F todas as flores eram rosas. Essa síndrome é mais freqüente em descendentes de casais aparentados e ocorre em machos e fêmeas em proporção relativamente igual. são observados dois fenótipos e três genótipos entre os descendentes. enquanto as rosas são heterozigotas. b) uma planta de flores brancas com outra de flores rosas. e) o albinismo impede a síntese de clorofila. Questão 545 Em gatos. existe uma síndrome caracterizada. Questão 546 Em um cruzamento de um indivíduo AA com outro aa. Trata-se de um caso de _____________ e os indivíduos parentais são _______________. os pais são heterozigotos. c) 75% da prole expressam o fenótipo determinado pelo alelo A e 25% não o expressam. o fenótipo recessivo é mascarado pelo fenótipo dominante. respectivamente: a) herança quantitativa e homozigotos dominantes. uma com flores vermelhas e outra com flores brancas. normais. Questão 550 As flores da planta maravilha podem ser vermelhas. As flores vermelhas e brancas são homozigotas. c) no cruzamento III. c) plantas albinas tornam-se verdes na presença de luz. a característica "albinismo" não desaparece entre elas. Questão 547 No cruzamento de plantas verdes. O preenchimento correto das lacunas é. d) ligada ao cromossomo X e recessiva. a) 25% brancas : 25% vermelhas : 50% rosas b) 25% brancas : 50% vermelhas : 25% rosas c) 100% rosas d) 50% vermelhas : 50% rosas e) 50% brancas : 25% vermelhas : 25% rosas Questão 549 Do cruzamento entre aves andaluzas de coloração azulada. b) em 25% da prole. os pais são heterozigotos. Para se obter 50% de flores brancas. e) ligada ao cromossomo Y e recessiva. b) plantas normais homozigóticas tornam-se albinas na ausência de luz. d) herança ligada ao sexo e homozigotos recessivos. os genótipos dos pais podem ser diferentes. considerando que o alelo Aé dominante sobre a. o fenótipo dominante é mascarado pelo fenótipo recessivo. b) codominância e heterozigotos c) linkage e heterozigotos. brancas ou rosas. e) epistasia e homozigotos dominantes. e) no cruzamento V. d) em 50% da prole. c) ligada ao cromossomo X e dominante. Ao fazer a genealogia de vários indivíduos. podem ocorrer três genótipos diferentes entre os descendentes. Indique qual será o resultado do cruzamento da variedade de flores rosas (F‚).

afirmam que o gene CYP2A6 está ligado à dependência das pessoas ao cigarro. obteve plantas que davam flores brancas. (Adaptado de "Ciência Hoje". nas populações ocorrem três fenótipos relacionados à atividade da enzima: indivíduos sem atividade de lactase.2 e acordo com a tabela e com seus conhecimentos. c) as plantas de flor rosa eram recessivas. Este gene. c) É uma herança ligada ao sexo em vegetais. indivíduos com atividade de lactase e indivíduos com atividade parcial da lactase. o caráter tonalidade da cor das folhas e ramos é transmitido geneticamente através do citoplasma dos óvulos. as proporções genotípicas e fenotípicas observadas na segunda geração dos filhos serão. Agosto de 1999. notou a existência de plantas de uma mesma espécie que possuíam indivíduos com flores brancas. Questão 553 Em "Mirabilis jalapa" (maravilha).1. Valéria promoveu uma autofecundação nas plantas de cor rosa e. e) trata-se de um caso de gene letal. Em conseqüência da falta dessa enzima. e) quantitativa. essas pessoas perdem a capacidade de digerir o açúcar do leite. d) O fenótipo pode ser influenciado por fatores ambientais. a lactose. d) co-dominante. Observando seu jardim. a) 1 : 3 : 1 e 3 : 1 b) 1 : 2 : 1 e 1 : 2 : 1 c) 1 : 1 : 2 e 1 : 1 : 1 d) 1 : 3 : 1 e 3 : 1 : 3 e) 1 : 1 : 1 e 3 : 1 Questão 555 Em estudo publicado na revista Nature de 25 de junho passado. p. no Canadá.vermelhas. respectivamente. c) epistática. b) trata-se de um caso de co-dominância entre os genes alelos que determinam o padrão de cor. para sua surpresa. b) Genes estão envolvidos na determinação dos fenótipos. codifica a síntese de uma enzima que 122 . Essa característica é autossômica e. pois o cruzamento de plantas de flores brancas e vermelhas só originou flores rosas. Três fenótipos são observados: verde. A tabela abaixo apresenta o resultado de seis possíveis cruzamentos. rosas e vermelhas. causada pela deficiência da enzima lactase. 49) A alergia ao leite pode ser hereditária. Valéria concluiu CORRETAMENTE que: a) trata-se de dominância da cor rosa sobre as demais. obtendo plantas que só davam flores de cor rosa. em sua forma normal. d) as plantas de flor vermelha eram dominantes e as de cor branca recessivas. estas últimas em quantidade duas vezes maior que as plantas de flor branca e vermelha. b) dominante. Curiosa para saber como se dava a transmissão desse caráter. variegadas (pigmentação irregular). é INCORRETO afirmar: a) A propagação vegetativa de uma planta verde deve produzir plantas verdes. pesquisadores da Universidade de Toronto. d) uma planta de flores vermelhas com outra de flores brancas.5. verde pálido. e) duas plantas de flores vermelhas. Essa distribuição é característica de um padrão de herança a) recessiva. Questão 552 Valéria gostava muito de flores. Questão 551 A maioria das populações é composta por pessoas que manifestam perda progressiva da lactase intestinal após o desmame. Questão 554 No monoibridismo com co-dominância ou dominância intermediária. 1. vermelhas e rosas.

Com base no texto anterior. a ação do alelo normal. Questão 556 Observe o esquema. é CORRETO afirmar que a) o gene HbA é dominante sobre o gene HbS. na espécie humana. quando autofecundadas. é correto afirmar que a dependência ao cigarro determinada pelo gene CYP2A6 é um caso de: a) herança quantitativa. tornando as pessoas dependentes. b) os indivíduos HbA/HbS e HbS/HbS devem apresentar os mesmos níveis de hemoglobina anormal. d) um determinado genótipo pode produzir diferentes fenótipos. originam apenas descendentes com sementes rugosas. é INCORRETO afirmar que a) os pares de genes que determinam o "tipo" e a "cor" da asa nas moscas estão localizados em cromossomas não-homólogos. Questão 557 Analise esta tabela. cada uma delas.1. jamais se tornam dependentes. e) dominância incompleta entre a forma normal e as defeituosas do gene CYP2A6. d) o gene que determina "plumagem azulada" é dominante sobre os genes que determinam "plumagem preta" ou "plumagem branca". Fumantes portadores de dois alelos normais (homozigoto para o alelo normal) são altamente dependentes do cigarro. pois o fenótipo apresenta uma continuidade entre dependentes e não dependentes. d) dominância completa da forma normal do gene CYP2A6 sobre as formas defeituosas. b) pleiotropia. c) epistasia recessiva. ainda. c) as plantas da F2 com "sementes rugosas". enquanto que portadores de dois dos alelos defeituosos.2 Considerando-se as informações contidas nesta tabela e outros conhecimentos sobre o assunto. c) os indivíduos que produzem só hemácias anormais podem ser curados por meio de transfusão sangüínea. que há. pois o heterozigoto apresenta fenótipo diferente de ambos os homozigotos. por um único par de gene. três alelos para este gene: um normal e dois defeituosos. Eles afirmam. são moderadamente dependentes.5. 123 . portadores de um alelo normal e outro defeituoso. apesar de fumantes. consumindo 20% menos cigarros que os fumantes inteiramente dependentes. Por outro lado.1. parcialmente. Com base nesse esquema e em conhecimentos sobre o assunto. resultantes dos cruzamentos de linhagens puras de três organismos diferentes: 1. pois qualquer um dos alelos defeituosos inibe.5.metaboliza a nicotina. fumantes heterozigotos.2 1. em que estão relacionadas características das gerações F1 e F2. b) as características "tipo de semente" e "cor de plumagem" são determinadas.

124 . c) 3Ž filho ë heterozigoto. enquanto mulheres C¢C¢ são calvas e C¢C£ são normais. dominantes com relação ao alelo i. dominância incompleta e expressão gênica influenciada pelo sexo. certamente. corretamente. d) mãe ë homozigoto dominante. o segundo é normal e bastante suscetível a malária (doença endêmica na região). Herança: pleiotropia. Indivíduos homozigotos NN são normais. exemplos de a) dominância incompleta. Homens com genótipo C¢C¢ (homozigotos) ou C¢C£ (heterozigotos) são calvos. II. Herança: dominância completa. Os alelos IÞe Iß são. descendentes do cruzamento de um homem e uma mulher portadores de talassemia menor. Da autofecundação das plantas da F. Por outro lado. pleiotropia e penetrância incompleta. Herança: co-dominância. I. b) dominância incompleta. e) herança poligênica. cujo genótipo (CÑCÑ) define cor vermelha nas flores. Na planta boca-de-leão. o último é normal. uma constituída de plantas com flores brancas e outra com flores vermelhas. Sabendo-se que todos os indivíduos com talassemia maior morrem antes da maturidade sexual. III. heterozigotos. d) epistasia. há indivíduos homozigotos. Tanto homens quanto mulheres C£C£ são normais. o vermelho e o cor-de-rosa. respectivamente. co-dominância e expressão gênica influenciada pelo sexo. qual das alternativas a seguir representa a fração de indivíduos adultos. certamente apresentam genótipos homozigotos. considerando que neste experimento: (01) ocorreu a segregação de três fenótipos: o branco. Indivíduos homozigotos com genótipos (CßCß) apresentam flores brancas. a) 2Ž filho ë homozigoto recessivo. indivíduos com genótipos IÞIÞ ou IÞi apresentam tipo sangüíneo A e os com genótipos IßIß ou Ißi apresentam tipo sangüíneo B. Questão 560 A talassemia é uma doença hereditária que resulta em anemia. Assinale a opção em que se indicam. que serão anêmicos? a) 1/2 b) 1/4 c) 1/3 d) 2/3 e) 1/8 Questão 561 Considere as seguintes formas de herança: I. apresentam uma forma mais branda chamada de talassemia menor. o genótipo IÞIß determina tipo sangüíneo AB. portanto. O primeiro morreu aos 5 anos de idade. Questão 559 Um experimentador cruzou duas linhagens puras de uma planta denominada boca-de-leão.Questão 558 Um casal de africanos teve três filhos. II e III são. Assinale a(s) proposição(ões) VERDADEIRA(S). foram obtidas plantas com flores exclusivamente brancas. Herança: epistasia dominante. vermelhas ou cor-de-rosa. b) pai ë heterozigoto. c) co-dominância. porém pouco suscetível a malária. (02) a proporção genotípica esperada nas plantas de F‚ é: 1 planta com flores cor-de-rosa: 2 plantas brancas: 1 planta vermelha. o membro da família com seu respectivo genótipo e o padrão de herança da anemia falciforme. co-dominância e dominância incompleta. Indivíduos homozigotos MM apresentam a forma mais grave. epistasia e pleiotropia. (08) os indivíduos de F eram. identificada como talassemia maior e os heterozigotos MN. em conseqüência de anemia falciforme. A descendência originada (F) apresentou apenas plantas com flores cor-de-rosa. A calvície é determinada por um alelo autossômico. (16) a F‚ esperada será constituída de 50% de indivíduos homozigotos e 50% de indivíduos heterozigotos. (04) as linhagens puras. que deram origem ao experimento. Os heterozigotos resultantes do cruzamento entre essas duas linhagens (CÑCß) apresentam flores de cor rosa. Em humanos.

Seu alelo recessivo "a" condiciona pelagem preta. esperam-se as seguintes proporções de camundongos de pelagem branca e preta. c) I: 1 gene com dominância incompleta. Ss. SS e SS. Questão 564 Em aves. II: vários genes com interação. SS.Questão 562 Em genética. ss e ss. d) hipostático. Ss e SS. II: 1 gene com dominância incompleta.Ss. e) I: 2 genes com interação. existe uma anomalia que se caracteriza pelo encurtamento das asas. e) epistático. II: vários genes com interação. Quando aves anômalas heterozigóticas são cruzadas. ss.4 a) autossômica dominante . a dominância parcial e a codominância entre alelos definem-se. respectivamente.1.2 Os padrões de distribuição fenotípica são devidos a: a) I: 1 gene com dominância.1. Para os filhotes vivos de um cruzamento de um casal de heterozigotos. Questão 563 Os gráficos I e II representam a freqüência de plantas com flores de diferentes cores em uma plantação de cravos (I) e rosas (II).Ss. ss. b) letal recessivo. originam uma descendência com indivíduos anômalos e normais numa proporção de 2 :1. e) na ligação gênica. 2. II: 1 gene com alelos múltiplos. d) nos genótipos recessivos.5. Na espécie humana há um tipo de surdez hereditária que é determinada por um par de genes. respectivamente: a) 1/2 e 1/2 b) 1/4 e 3/4 c) 2/3 e 1/3 d) 3/4 e 1/4 Questão 566 1.SS. de forma mais precisa. 125 . b) autossômica dominante . b) I: 1 gene com dominância incompleta. II: 2 genes com dominância incompleta. a) nos genótipos heterozigotos. assinale a opção correta quanto ao tipo de herança e os genótipos dos indivíduos 1. b) nos genótipos homozigotos.ss. A partir desses dados. respectivamente: 1. c) pleiotrópico. a pelagem branca é condicionada pela presença do gene "A".SS. c) autossômica dominante . No heredograma a seguir. 3 e 4. d) autossômica recessiva . d) I: 3 genes com dominância incompleta. ss. é possível deduzir que o alelo que condiciona a anomalia é a) letal em homozigose.5. Ss e Ss. e) autossômica recessiva . as pessoas surdas estão representadas por símbolos hachurados: Com base nessa afirmação. Questão 565 Em determinado tipo de camundongo. c) nos genótipos dominantes. Ss e Ss. letal em homozigose.

Considere o heredograma a seguir de uma família com membros acometidos (símbolos cheios) e normais (símbolos vazados). b) VI possui dois alelos mutados. as probabilidades de o pai e de a mãe serem portadores desse alelo são. Questão 568 Analise o heredograma a seguir. 4 b) 1. onde os indivíduos masculinos são representados por quadrados e os femininos por círculos. 6.1. as probabilidades de o pai (A) e de a mãe (B) do menino (C) serem portadores desse alelo são. 2. e) I é necessariamente homozigoto. 8 d) 4. hipopigmentação. entre outras.5.Questão 567 A fenilcetonúria (PKU) é uma doença de origem genética bastante conhecida. odemos dizer. 3. num segmento sem homologia com o cromossomo Y. quanto à presença de alelos mutantes de fenilalanina hidroxilase nos membros da família marcados com algarismos romanos. (I) e (II). não conseguem metabolizar a fenilalanina e. (III) e (IV).4 126 .5. III e IV. II. 6.1. respectivamente. causada por uma deficiência da enzima fenilalanina hidroxilase. 5. respectivamente. além de não sintetizarem catecolaminas corretamente.1. 5 c) 1. 9 Questão 569 No heredograma. Pacientes acometidos desse mal. Caso a anomalia seja condicionada por um alelo recessivo ligado ao cromossomo X. 5. podemos afirmar que os indivíduos heterozigotos são: a) 1. 2. assim. c) V é necessariamente homozigoto. Se a doença for condicionada por um par de alelos recessivos localizados em cromossomos autossômicos.4 obre as informações contidas no heredograma. 1. Assinale a alternativa que mostra as porcentagens que preenchem corretamente os espaços I. epilepsia.4 1. que: a) VIII pode ter um alelo mutado. apresentam uma série de complicações como retardo mental.5. 2. 7 e) 3. 1. d) III possui apenas um alelo mutado. 4. os quadrados cheios representam meninos afetados por uma doença genética.

4 1.1.1. c) dominante. b) recessivo.5.5. Questão 571 No heredograma a seguir. conclui-se que a anomalia é determinada por gene a) dominante. quadrados representam homens e símbolos preenchidos representam indivíduos portadores de certa característica. c) dominante. Questão 573 Se os indivíduos 7 e 11 se casarem. Questão 572 O tipo de herança genética apresentada pelos indivíduos afetados é: a) autossômica dominante. d) recessivo. pode-se concluir que a característica em questão é condicionada por gene a) dominante. a probabilidade desse casal ter uma filha com o mesmo fenótipo do avô materno é de: a) 1/2 b) 1/4 c) 1/8 d) 1/3 e) 2/3 1. localizado em um autossomo. localizado no cromossomo X. b) dominante. b) autossômica recessiva. localizado em autossomo. círculos representam mulheres. localizado em um autossomo.4 om base na análise do heredograma. c) ligada ao x dominante.5. localizado no cromossomo y. d) ligada ao x recessiva. e) ligada ao y. Questão 574 127 . e) localizado no cromossomo Y.1. localizado em autossomo.4 nalisando-se a genealogia.4 1. e) recessivo.5. localizado no cromossomo y. localizado no cromossomo X. d) recessivo. Os símbolos escuros indicam os portadores de uma anomalia hereditária.Questão 570 O esquema a seguir representa indivíduos de três gerações de uma família. 1.1. localizado no cromossomo x.

Questão 575 Analise o seguinte heredograma de uma característica transmitida geneticamente: om base nessa análise. e) 100% e 75%. indique a opção que apresenta a afirmativa correta sobre a herança da característica referida no heredograma. d) É do tipo recessiva ligada ao sexo porque todo progenitor masculino afetado transmite a característica para suas filhas. d) 0 e 25%. c) A probabilidade de o indivíduo 7 ser heterozigoto é de 18%. 128 .1. b) É do tipo dominante autossômica porque o genótipo pode estar presente na prole de ambos os sexos sem estar presente nos pais. se os indivíduos marcados são afetados por uma característica genética. é correto afirmar. na qual a freqüência de indivíduos afetados é de 1%. b) O indivíduo 8 apresenta o mesmo fenótipo e o mesmo genótipo do avô para o caráter em questão.1. 1.5. respectivamente. os indivíduos 3 e 5 são afetados por uma anomalia genética recessiva.4 1.1.4 No heredograma acima.4 Considerando-se que a família acima representada faz parte de uma população em equilíbrio de Hardy-Weimberg. EXCETO: a) A segunda geração pode ser composta apenas por indivíduos homozigotos. Questão 576 No heredograma adiante.5. e) É do tipo dominante ligada ao sexo porque todos os filhos homens herdam a característica da mãe. as probabilidades dos casais 7×8 e 9×10 terem crianças normais são. b) 0 e 75%. c) 50% e 50%. c) É do tipo recessiva autossômica porque o número de indivíduos afetados é menor do que o de não afetados. a) É do tipo recessiva autossômica porque o genótipo pode estar presente na prole de ambos os sexos sem estar presente nos pais.5. de: a) 100% e 50%. d) O caráter em estudo pode ser ligado ao sexo.1.

III e IV. na fase adulta. os indivíduos afetados por DH estão indicados em negro. b) Apenas I.Questão 577 No heredograma. São corretas as afirmações: a) I. com uma progressiva perda do controle motor e problemas psiquiátricos como demência e distúrbios afetivos. Questão 579 A Doença de Huntington (DH) é uma anomalia autossômica com caráter dominante cuja manifestação ocorre na fase adulta. No heredograma a seguir.5.Se houver casamento consangüíneo entre 9 e 11. III . II .4 onsiderando que os indivíduos indicados em preto são afetados por uma característica genética. desenvolveram a mesma doença hereditária: 1.As pessoas 1 e 2 são heterozigotas. Questão 578 Responder à questão com base no heredograma a seguir. 1. III e IV. e os indicados em branco não a apresentam. causada por um gene autossômico influenciado pelo sexo. d) Apenas II.4 129 .5. 10 e 12 representam indivíduos que. II e III. e) Apenas uma das afirmações.1. as figuras 6. é correto concluir que tal característica é a) a calvície. causada por um gene recessivo ligado ao sexo. causada por um gene autossômico dominante. causada por um gene restrito ao sexo. os eventuais filhos nascerão afetados.1. com certeza.4 1. c) a hemofilia. b) o lóbulo da orelha livre. e) a incapacidade de enrolar a língua. d) a hipertricose.1. xamine as afirmações: I . II.É uma doença de caráter dominante autossômica. causada por um gene autossômico recessivo. c) Apenas II e III.A mulher representada pelo número 5 tem possibilidade de ser homozigota.5. IV .

nos parênteses.V Questão 580 Qual dos heredogramas a seguir ilustra uma condição biologicamente IMPOSSÍVEL? 1.F .V . Considerando essas informações e desprezando a possibilidade de ocorrência de mutação. onde foi estudado o caráter BRAQUIDACTILIA (dedos curtos). de cima para baixo. os indivíduos 1.4 1.5. 5 e 7 apresentam uma anomalia condicionada por gene autossômico dominante. III-3 e III-4 são homozigotos. 2.F . 1.V .F . III-2. 4. V para as verdadeiras e F para as falsas. 4 e 7 são braquidáctilos. A seqüência correta de preenchimento dos parênteses. b) é braquidáctilo e heterozigoto. Questão 582 Na genealogia a seguir.F .F c) V .V .1.s afirmativas abaixo referem-se aos possíveis genótipos dos indivíduos indicados no heredograma. I-2. d) tem dedos normais e é heterozigoto. 3. ( ) Os indivíduos II-2 e II-4 são heterozigotos. é a) F .1.4 essa família.4 Questão 581 Analise a genealogia a seguir. e) pode ser ou não braquidáctilo e é homozigoto. ( ) Os indivíduos I-1.V . ( ) Os indivíduos II-1 e II-3 são heterozigotos.V e) V . ( ) Os indivíduos III-1. Assinale.1.V b) F .5.5.V .F . que é determinado por um par de genes: 130 . pode-se afirmar que o indivíduo 6: a) é braquidáctilo e homozigoto. enquanto os indivíduos 5 e 8 apresentam dedos normais. 2. Já as pessoas indicadas pelos números 3 e 6 têm fenótipo normal. II-1 e II-3 são homozigotos.F d) V . c) tem dedos normais e é homozigoto. as pessoas indicadas pelos números 1.

e) o casal indicado pelos números 6 e 7 não poderá ter descendentes com fenótipo normal.1. é: a) 1/2 b) 1/4 c) 1/8 d) 1/6 Questão 584 O heredograma a seguir representa a herança de um par de genes entre os quais há dominância. Observe a genealogia a seguir. 1. 1. os símbolos escuros representam indivíduos que possuem uma anomalia. 131 .4 probabilidade do casal 3×4 ter o primeiro filho homem e que venha a ser calvo.Após a análise da genealogia. c) a pessoa indicada pelo número 3 transmitiu o gene recessivo para seu descendente indicado pelo número 7.4 No heredograma abaixo. relativa a essa característica.1.5.5. b) a pessoa indicada pelo número 4 é homozigótica.5. d) não há possibilidade de a pessoa indicada pelo número 5 ser heterozigótica.1. Questão 583 A calvície é uma característica influenciada pelo sexo e o gene que a condiciona se comporta como recessivo no sexo feminino e dominante no sexo masculino.4 esse heredograma NÃO se pode determinar o genótipo do indivíduo a) 1 b) 3 c) 5 d) 6 e) 7 Questão 585 1. Os símbolos escuros representam indivíduos que exibem a característica recessiva. pode-se concluir que: a) apenas as pessoas indicadas pelos números 1 e 2 são heterozigóticas.

a linhagem pôde ser reestabelecida por meio do acasalamento descrito a seguir: 1.5. É correto o que se afirma APENAS em a) I b) II c) III d) I e II e) II e III Questão 586 No heredograma adiante.1. d) todos os indivíduos normais são homozigotos dominantes.4 Questão 587 O heredograma mostra a incidência de uma anomalia genética em grupo familiar. Todos os indivíduos que apresentam a anomalia são homozigóticos. 1/4 d) 1/2.4 pós a análise deste heredograma. Questão 588 Foi estabelecida uma linhagem de camundongos nocaute esses animais se caracterizam por não expressar um determinado gene. 1/2 c) 1/4. uma doença causada por um alelo recessivo autossômico.onsidere as seguintes afirmativas sobre esse heredograma: I. 1/4 e) 1/2. 132 . b) a anomalia é condicionada por um gene recessivo. respectivamente: a) zero.5. As probabilidades de que sua irmã (II-2) não afetada seja carreadora ou não carreadora da fibrose cística são. e) todos os indivíduos normais são homozigotos dominantes ou heterozigotos. O único indivíduo que não pode ter o seu genótipo definido é o I-4. podemos afirmar: a) todos os indivíduos normais são homozigotos recessivos. II.4 1. c) a anomalia ocorre apenas em homozigotos dominantes. 1/4 b) 1/4. a criança II-1 tem fibrose cística. 2/2 1.5. III.1.1. Após uma infecção em que apenas uma fêmea nocaute sobreviveu. A anomalia é condicionada por um alelo dominante.

uma estudante concluiu que a característica transmitida. pós analisar esse heredograma.2 seriam normais.2 não possui pais afetados.5 também seria afetado. na família representada. Para chegar a tal conclusão. todas as alternativas são possíveis.1. se a herança fosse recessiva ligada ao X. e) II-2. b) Em F‚. c) A herança pode representar uma família de hemofílicos. c) O indivíduo III. e) o casamento de III-4 com indivíduo de fenótipo igual a II-4 tem como resultado esperado 100% de mulheres afetadas. se a herança fosse ligada ao Y.3 tem filha normal.4 Com relação ao heredograma.1.5. c) a probabilidade de mulheres descendentes de IV-1 serem afetadas é zero. 1. d) O cruzamento do macho 2 com uma das fêmeas de F originará camundongos dos quais 75% serão heterozigotos. II-5 e III-1 podem ser homozigotos dominantes. essa estudante considerou todas as seguintes hipóteses. 133 . b) A herança pode ser ligada ao sexo. d) as mulheres afetadas apresentam fenótipos idênticos aos de suas mães.4 m relação à característica representada no heredograma. c) O acasalamento do macho 3 com a fêmea 5 produzirá maior número de camundongos nocaute do que o acasalamento desse macho com a fêmea 4. por isso é improvável uma herança dominante ligada ao X.4 Observe este heredograma: 1. Questão 590 Analise o heredograma. é autossômica recessiva. e) A herança do caráter nocaute é autossômica dominante. Questão 589 Analise o heredograma que representa a herança de um tipo de disfunção dos músculos esquelético e cardíaco em seres humanos. é correto afirmar-se que a) a herança para esse tipo de característica é recessiva e ligada ao sexo. b) a ocorrência da característica nessa família se deve aos casamentos consangüíneos.1. EXCETO a) A herança pode ser autossômica.5.ode-se afirmar que: a) Por meio do acasalamento do macho 3 com a fêmea nocaute. 50% dos filhotes são animais com o genótipo heterozigoto. EXCETO a) O indivíduo I. d) I-1 e I-2 podem ser heterozigotos. Questão 591 1. d) Os filhos homens de I.5. b) O indivíduo II. 75% do filhotes nascerão normais. portanto a herança não deve ser autossômica dominante.

( ) o modelo de herança autossômica recessiva.1. é INCORRETO afirmar que a) os indivíduos normais. om base nesse heredograma e em outros conhecimentos sobre o assunto. cuja avó materna e avô paterno eram albinos.como um gosto amargo ou. é representado abaixo. c) o risco de III.1). não sentir qualquer sabor. cujo diagrama.1 são heterozigotos.4 Um geneticista estabeleceu o heredograma para uma determinada doença hereditária. em todas as gerações. ( ) um modelo de herança idêntico ao do albinismo. a) 0 b) 1/4 c) 3/4 134 1.1 e II.5.4 Esse diagrama representa: ( ) o modelo de herança recessiva ligada ao cromossomo X. b) a ocorrência do tumor é uma característica autossômica. típica daquelas não vinculadas aos cromossomos X e Y.5. preocupada com a possibilidade de transmitir o alelo para o albinismo a seus filhos.1. d) a probabilidade de o indivíduo III. de pai para filha e mãe para filha.5.PTC . Assinale a alternativa que responde ao questionamento de Renata. deseja saber qual a probabilidade de ela não ser portadora deste alelo. Questão 593 Analise este heredograma.4 .1.2 será normal. mesmo.1 x II. que representa uma família em que há indivíduos afetados por um tipo de tumor de gengiva: 1. conhecida como daltonismo. ( ) a característica passada de geração a geração. b) o loco do gene em estudo está situado em um cromossomo autossômico. é INCORRETO afirmar que a) o alelo para a capacidade de sentir o gosto do PTC é dominante. mostrando-os indivíduos afetados. são homozigotos. c) o próximo filho do casal II.2 ser heterozigoto é de dois terços. Questão 595 Renata (III. Questão 594 1. d) os indivíduos I.Questão 592 As pessoas podem detectar a substância química feniltiocarbamida . Observe este heredograma para a capacidade de sentir o gosto dessa substância: onsiderando-se as informações desse heredograma e outros conhecimentos sobre o assunto.3 nascer incapaz de sentir o gosto do PTC é de 50%. ( ) um modelo de herança idêntico ao da cegueira para cores.

4 Analisando essa genealogia.1.1. pois os indivíduos II-3 e II-4 tiveram crianças anormais.4 Questão 596 O heredograma adiante representa a herança de um fenótipo anormal na espécie humana. pois a característica é dominante. d) Apenas os indivíduos I:1. os indivíduos assinalados com preto apresentam uma anomalia determinada por um gene dominante. (32) Trata-se de Herança Intermediária.5. b) Todos os indivíduos não afetados são heterozigotos. (02) A anomalia é causada por gene provavelmente dominante. 135 . (01) A anomalia é causada por gene provavelmente recessivo.1.5. Analise-o e assinale a alternativa correta. c) Apenas o indivíduo I:1 é heterozigoto. Questão 597 Considerando o heredograma abaixo. d) Todos os indivíduos afetados são heterozigotos. b) O fenótipo anormal é recessivo. II:1 e II:5 são heterozigotos. é correto afirmar: 1.5. e) Apenas os indivíduos I:1 e I:2 são homozigotos.5. (08) Trata-se de gene localizado no cromossomo Y. onde os indivíduos afetados pela síndrome unha-rótula (deformação nas unhas e nas rótulas) aparecem em preto. a) Os indivíduos II-3 e II-4 são homozigotos.4 Questão 598 Na genealogia a seguir.4 1. (04) Trata-se de gene localizado no cromossomo X. Soma ( ) 1.1. c) Os indivíduos III-1 e III-2 são heterozigotos. (16) Trata-se de gene autossômico. e) Os indivíduos I-1 e I-4 são homozigotos. é correto afirmar: a) Todos os indivíduos afetados são homozigotos. pois são afetados pelo fenótipo anormal. pois dão origem a indivíduos anormais. (64) Trata-se de Herança Holândrica.d) 1/3 e) 1 1.

3 e III .1 e III . III . respectivamente. c) Apenas II .1. II . assinale a(s) proposição(ões) CORRETA(S). 1. os demais indivíduos da segunda geração são irmãos. (08) Do casamento consangüíneo. (64) Com exceção de II .2.3 não tem nenhuma relação genética com I .2 e I . são indivíduos afetados pela característica que está sendo estudada. (02) O padrão da herança desta doença é autossômico dominante.4.Questão 599 A figura a seguir apresenta uma genealogia hipotética. II .4 (01) Na genealogia estão representadas 2 gerações. Considerando o heredograma apresentado inicialmente os indivíduos I .1 e III . (16) III .1 e II .3. portanto está ligada ao cromossomo X.1 é neto(a) de I .2 é sobrinho(a) de II . Com base na análise da mesma. 1.4 têm 50% de probabilidade de terem um descendente portador da doença. Questão 600 Na genealogia a seguir.4.3 forem heterozigotos e os indivíduos I .1. apresentado na genealogia. (04) Os indivíduos I . e) II . 3.5. II . (02) Os indivíduos I . existe 33.3. quem poderá ser afetado pela doença? a) Apenas III . identificadas por 1.4 136 . um homem e uma mulher. d) II .3 não o são.4 forem homozigotos normais. II .2.1 e III . (32) II . enquanto II . (08) III . (32) A doença só se manifesta nas mulheres.5.1.1 é mais jovem do que II . b) Apenas II .2.1.1 e I .1. 2.3 e II .4 representam. (16) II .2.3% de possibilidade de nascer um descendente com a doença. 1. por exemplo. (04) III .2.1.3 podem ser homozigotos. 4 e 5.5.2 e II .4 A anemia falciforme é causada pela presença de uma hemoglobina anormal. os homens.5.1 e I .1 e II .3. Os símbolos cheios indicam que o indivíduo é portador do caráter.3 e III .5.2. os indivíduos que manifestam uma determinada doença hereditária são mostrados em preto. Os círculos representam as mulheres e os quadrados.3 e II . Questão 601 Com relação a essa figura é CORRETO afirmar que: (01) Os indivíduos II . Questão 602 Os heredogramas a seguir apresentam o padrão de herança de um mesmo caráter em cinco diferentes famílias. Essa doença é herdada como autossômica recessiva.

d) 1/4. d) I e IV. e os claros os indivíduos de visão normal. III. foram feitas as afirmações seguintes. II e III. porque 50% dos gametas da mulher transportam o gene recessivo.1. analise os heredogramas e assinale a alternativa correta. Questão 604 upondo que não haja mutação. apenas. e) III e IV. 137 1. Questão 603 O esquema mostra a genealogia de uma família.5. observado a partir de cruzamentos controlados realizados em cativeiro. porque o casal já tem três filhos com visão normal. apenas.5. d) A família 4 permite concluir que se trata de um caráter recessivo.4 A partir da análise da ocorrência da doença entre os indivíduos nascidos dos diferentes cruzamentos. porque a mulher tanto pode ser homozigota como heterozigota. 1. c) A família 3 permite concluir que se trata de um caráter recessivo. c) 1/2. Não há nenhuma possibilidade de que um filhote nascido do cruzamento entre os indivíduos II-5 e II-6 apresente a doença. uma vez que são nulas as possibilidades de que desse cruzamento resulte um filhote que apresente a doença. Os símbolos escuros representam os indivíduos míopes. I.1. ligado ao cromossomo X. e) A família 5 mostra que o caráter não pode ser controlado por gene ligado ao cromossomo X.1. apenas. b) II e III. II. porque o gene para a miopia é recessivo. O indivíduo III-1 só deve ser cruzado com o indivíduo II-5. É verdadeiro o que se afirma em a) I. apenas. porque a mulher tem o gene dominante em homozigose. Trata-se de uma doença autossômica recessiva. e) 1/4. O diagrama representa o padrão de herança de uma doença genética que afeta uma determinada espécie de animal silvestre. b) nula. a) A família l permite concluir que se trata de um caráter dominante ligado ao cromossomo X. b) A família 2 permite concluir que se trata de um caráter autossômico recessivo.4 A probabilidade do casal I x II ter uma criança míope é a) imprevisível.4 . apenas. ligado ao cromossomo Y.1. c) I. IV. Os indivíduos I-1 e I-3 são obrigatoriamente homozigotos dominantes.5.

b) Pode-se assumir que os indivíduos II.4 1. .2 vir a ter uma criança com mucoviscidose? a) 1/8 b) 1/4 c) 1/3 d) 1/2 e) 2/3 Questão 607 Para analisar heredogramas de famílias de seres humanos.Questão 605 Na espécie humana há um tipo de doença hereditária muito rara denominada Aquiropodia.5.4 ual a probabilidade de o casal II. 1. os principais critérios para a identificação de um gene recessivo autossômico são aqueles em que o número de: a) homens afetados é diferente do número de mulheres afetadas. que é determinada por um par de genes.3 e III. já que a condição herdada em análise é muito rara. a característica deve aparecer em todas as gerações. cerca de 25% da prole de pais portadores do gene deve apresentar a característica d) homens e mulheres afetados é aproximadamente igual.1 e II. Questão 606 A mucoviscidose é uma doença genética grave que associa problemas digestivos e respiratórios. o indivíduo afetado tem pelo menos um pai afetado b) homens e mulheres afetados é aproximadamente igual.4 é aa. c) Não é possível ter certeza sobre o genótipo de alguns indivíduos. que representa a árvore genealógica de uma família onde alguns indivíduos são afetados pela doença. o indivíduo afetado tem pelo menos um pai afetado c) homens e mulheres afetados é aproximadamente igual. os aquirópodos estão representados por símbolos hachurados.1. os indivíduos afetados têm geralmente pais normais. Tal doença deve-se à presença de uma enzima defeituosa que não metaboliza 138 om base na análise do heredograma.5.5. No heredograma a seguir. Os pulmões das pessoas afetadas apresentam um muco espesso que promove infecções bacterianas. Observe e analise o esquema a seguir. a) Pode-se dizer que a Aquiropodia é condicionada por um alelo recessivo a. os indivíduos afetados têm geralmente pais normais.1 . a característica deixa de aparecer em várias gerações. como é o caso dos indivíduos II.II. o indivíduo afetado tem pais afetados Questão 608 O popular "Teste-do-pezinho" feito em recém-nascidos pode detectar a doença fenilcetonúria.5 possuem o genótipo AA. a característica deve aparecer em todas as gerações.2 e IV. e) O genótipo dos indivíduos IV.1. assinale a afirmativa INCORRETA. cerca de 75% da prole de pais portadores do gene deve apresentar a característica e) homens afetados é maior do que o de mulheres afetadas. d) Os pais dos aquirópodos são primos.

d) 2/5. cuja ingestão provoca retardamento mental. Questão 612 Estudos genéticos permitiram verificar que um casal tem 1/4 de probabilidade de ter um descendente com uma determinada anomalia. tem uma filha também polidáctila e um filho normal.25% d) B e 8. d) 360. Supondo que todas sofram metamorfose. A probabilidade de o casal vir a ter uma filha normal é de: a) 1/4 b) 1/6 c) 1/8 139 . em que ambos são polidáctilos. os indivíduos que apresentam fenilcetonúria estão em negro. Um macho puro de asa longa é cruzado com uma fêmea de asa curta. b) 120. c) 180. e) 80. Questão 610 Um casal. b) 3/9. e) 1/25. o caráter asa vestigial é recessivo em relação ao caráter asa longa. será: a) 0% b) 25% c) 50% d) 75% e) 100% 1. e) 240. c) 1/8.4 Questão 609 A fenilcetonúria é uma doença com herança autossômica recessiva. Sabendo-se que a determinação do caráter se deve apenas a um par de genes autossômicos.1. uma em cada 20 pessoas com fenótipo normal é heterozigótica quanto ao gene que determina a fenilcetonúria. o número esperado de indivíduos de asa curta é de: a) 480.25% e) C e 75% d) 1/12 e) 2/3 Questão 611 Em drosófilas. qual o número esperado de casamentos com risco de gerar crianças fenilcetonúricas? a) 2. a) 2/3. Sabendo-se que o avô paterno e a avó materna das crianças eram albinos.corretamente o aminoácido fenilalanina. Um indivíduo de F1 é retrocruzado com a fêmea parental e se obtém 480 larvas. c) 16. Em 800 casamentos ocorridos entre membros sadios dessa comunidade. Na genealogia a seguir. Esse casal tem __________ de probabilidade de ter um descendente do sexo masculino e portador da disfunção genética mencionada. Considere um casal normal que teve 6 crianças todas normais. podemos afirmar com certeza que a probabilidade de um novo filho vir a ser albino (sem considerar o sexo).5. d) 40. determine o cruzamento que permite diagnosticar a recessividade do gene que condiciona a fenilcetonúria e a probabilidade de nascer uma menina afetada a partir do cruzamento 12 X 18. a) C e 50% b) C e 25% c) B e 6. Questão 613 Sabe-se que o albinismo é determinado pela ação de um gene recessivo autossômico. b) 8. Em certa comunidade européia.

e a mulher tem um irmão com esta mesma doença. b) 60. flores vermelhas são condicionadas por um gene dominante e flores brancas por seu alelo recessivo. c) 50%.5. qual a resposta correta que daria à pergunta sobre a probabilidade de nascimento de uma criança com este tipo de anemia? a) 1/2 b) 1/4 c) 1/8 d) 1/9 e) 1/16 . icterícia. espera-se que o número de plantas com flores vermelhas e folhas curtas seja a) 20. Esses dois pares de alelos localizam-se em cromossomos diferentes. no teste do pezinho. a detecção de portadores de anemia falciforme está sendo incluída. A probabilidade de sua primeira criança ter fenilcetonúria é de: a) 1/2. folhas longas são condicionadas por um gene dominante e folhas curtas por seu alelo recessivo. cuja mãe era canhota e insensível. Desses. e) 320. d) 180. b) 1/4. c) 1/9.5 e um casal com 35 anos tiver um filho. antes de realizar qualquer exame. podendo ser fatal se não tratada no início da infância. Essa doença manifesta-se tardiamente como representado no gráfico a seguir: Questão 616 Fenilcetonúria é uma doença hereditária humana resultante da inabilidade do organismo de processar o aminoácido fenilalanina. Questão 618 Na espécie humana. a chance de a criança vir a manifestar a doença corresponde a a) 0 %. Um homem canhoto e sensível ao PTC. casa-se com uma mulher destra. Esses dois pares de alelos apresentam segregação independente. Questão 617 Em determinada planta. a habilidade para o uso da mão direita é condicionada pelo gene dominante E . Questão 615 A anemia falciforme é uma doença hemolítica grave cujas manifestações clínicas incluem anemia. O seu padrão de herança é autossômico recessivo. b) 25%. e a insensibilidade a essa substância é devida a seu alelo recessivo i . o baço e os pulmões. já que cada um dos cônjuges tem um irmão com anemia falciforme. no Rio Grande do Sul. c) 160. d) 75%. Um casal normal que pretende ter um filho consulta um geneticista. Um casal decide ter um filho.1. A sensibilidade à feniltiocarbamida (PTC) é condicionada pelo gene dominante I. Se você fosse o geneticista. e) 100%. d) 2/3. e é causada por um alelo recessivo por herança Mendeliana simples. obstrução vascular e infartos dolorosos em vários órgãos como os ossos. sendo a habilidade para o uso da mão esquerda devida a seu alelo recessivo e . cujo pai era insensível. Não há outros casos conhecidos nas famílias. Do cruzamento entre plantas heterozigóticas para os dois caracteres resultaram 320 descendentes. Devido a sua importância. sensível. mas consulta um geneticista porque o homem tem uma irmã com fenilcetonúria. que está presente nas proteínas da dieta humana. e) 4/9.Questão 614 Admita que uma determinada doença neurodegenerativa que provoca convulsões e leve à morte em pouco mais de 10 meses seja determinada por um gene dominante. 140 1.

AaCc. A probabilidade de que uma terceira criança seja albina com cabelos crespos é: a) 75% b) 50% c) 37. verdes-rugosas=50. uma com cabelos crespos e outra com cabelos lisos. amarelas-rugosas = 200. aacc. verdes-lisas = 300. Quantos indivíduos devem ser esperados para cada um dos fenótipos obtidos? a) amarelas-lisas = 80. verdes-lisas = 150. cuja mãe é albina. amarelas-rugosas = 300. e) 100% de plantas de altura normal com vagens lisas. Questão 619 Do casamento entre uma mulher albina com cabelos crespos e um homem normal com cabelos crespos. b) 100% de plantas anãs com vagens com constrições. espera-se obter na descendência: a) 50% de plantas anãs com vagens lisas e 50% de plantas de altura normal com vagens com constrições. c) amarelas-lisas = 200. nasce uma criança albina e de olhos claros. verdes-rugosas = 200. AaCc. AaCc. Questão 623 Observe o heredograma a seguir: 1. c) 1/4. amarelas-rugosas = 320. Questão 621 Em ervilha. c) AaCC. Cruzando-se plantas CCHH com plantas CcHh. e) 1/8. d) aaCC. AaCC. Deste casal. verdes-lisas = 100. uma com sementes amarelas e lisas (VvRr) e outra com sementes amarelas e rugosas (Vvrr). AaCc. b) Aacc.1 141 . verdes-rugosas=100. verdes-rugosas = 80. nasceram duas crianças. o gene que determina a forma lisa da vagem (C) é dominante sobre o gene que determina vagens com constrições (c). Aacc. amarelas-rugosas = 100. d) 100% de plantas anãs com vagens lisas. b) amarelas-lisas = 100. verdes-lisas = 320. aacc.2. b) 3/8. e) amarelas-lisas = 450. amarelas-rugosas = 150. verdes-lisas = 200.A probabilidade de esse casal vir a ter uma criança canhota e sensível ao PTC é de a) 3/4. e) aacc. aacc. AACC. Questão 622 Um homem albino e de olhos claros casa-se com uma mulher de pele normal e de olhos escuros. originou 800 indivíduos.5% d) 25% e) 12. c) 100% de plantas de altura normal com vagens com constrições. d) amarelas-lisas = 300. d) 3/16.5% Questão 620 O cruzamento entre duas linhagens de ervilhas.5. O gene que determina plantas de altura normal (H) é dominante sobre o gene que determina plantas anãs (h). Qual o genótipo dos pais da criança? a) aacc. verdes-rugosas = 300.

b) se somente as afirmativas I e III forem corretas. A probabilidade desse casal ter uma criança normal para as duas características é: a) 1/8 b) 1/2 c) 3/8 d) 7/8 e) 3/4 Questão 627 Em ervilhas.O indivíduo 5 é heterozigoto para o gene do uso da mão esquerda e o indivíduo 6 é heterozigoto para o gene da miopia. Assinale: a) se todas as afirmativas forem corretas. considere as seguintes afirmações: I . Considerando-se que ambas as anomalias são autossômicas e os respectivos genes estão em cromossomos . analise a genealogia a seguir e responda. d) se somente as afirmativas I e II forem corretas.Os indivíduos 2 e 4 têm o mesmo genótipo. c) se somente as afirmativas II e III forem corretas. com um homem normal para fenilcetonúria e míope. nasceu uma criança de visão normal e fenilcetonúrica. a) zero b) 75% c) 50% d) 12. Considerando uma planta de sementes lisas e amarelas.2. terão 25% de chance de ter uma filha canhota e de visão normal. mas míope. Do casamento entre uma mulher normal. a probabilidade do casal ter outra criança normal para as duas características é: a) 1 b) 1/16 c) 3/16 d) 9/16 e) 0 Questão 626 A fenilcetonúria e a miopia são doenças decorrentes da ação de genes autossômicos recessivos.Se o indivíduo 3 se casar com um homem de visão normal (heterozigoto) e canhoto.5. os genes que determinam sementes lisas e amarelas são dominantes em relação aos genes que determinam sementes rugosas e verdes. Questão 624 Sabendo-se que a miopia e o uso da mão esquerda são condicionados por genes recessivos. assinale a alternativa que apresenta a porcentagem de gametas produzidos por essa planta com pelo menos um gene dominante.Sabendo-se que a miopia e o uso da mão esquerda são condicionados por genes recessivos.5% e) 25% Questão 628 Qual é a probabilidade de um casal de duplo heterozigotos para dois pares de genes autossômicos com segregação independente vir a ter um descendente com apenas uma característica dominante? a) 15/16 b) 9/16 c) 6/16 d) 3/16 142 1. diíbrida. diferentes.1 A probabilidade do casal 4 x 5 ter uma criança diíbrida é: a) 1/8 b) 3/16 c) 1/16 d) 1/4 e) 1/2 Questão 625 Um casal. ambos polidáctilos (com mais de 5 dedos) e de visão normal. filha de mãe com fenilcetonúria e pai míope. então. e) se somente a afirmativa II for correta. II . III . tem uma criança normal para polidactilia.

IV . Os indivíduos homozigotos dd ou ee são surdos. III .(mmbb).2. vvA_ ou vvaa. Qual é a probabilidade de um casal DdEE × ddEe vir a ter uma criança com surdez? a) 0% b) 25% c) 50% d) 75% e) 100% Questão 631 As flores de uma determinada planta podem ser vermelhas ou amarelas. pelo menos. 1. Na descendência do cruzamento VvAa x VvAa espera-se encontrar uma proporção fenotípica de a) 1 vermelha: 1 amarela b) 9 amarelas: 7 vermelhas c) 9 vermelhas: 7 amarelas d) 15 amarelas: 1 vermelha e) 15 vermelhas: 1 amarela Questão 632 O esquema abaixo representa o núcleo de uma célula de um organismo com 2n=4 cromossomos. Dois pares de genes (Vv e Aa) determinam essa característica: plantas V_A_ produzem flores vermelhas e plantas V_aa. obteve quatro tipos de fenótipos. a) I . na proporção de 9:3:3:1. O gene M condiciona cor preta e seu alelo m.(MmBb) Questão 630 Considere que a surdez no homem esteja relacionada a dois pares de genes (Dd . II .(Mmbb).(mmBb). Como resultado. os indivíduos com audição normal possuem. III . Quantos caracteres esse pesquisador estudava? a) 1 b) 2 c) 3 d) 4 e) 5 Questão 634 Assinale a alternativa que indica os genótipos dos pais que têm ou poderão ter filhos nas seguintes proporções ou percentuais: 143 . Assinale.(Mmbb). II .e) 1/16 Questão 629 Considere que em cavalos a coloração do pêlo resulta da ação de dois pares de genes autossômicos localizados em cromossomos não homólogos. IV . ele obteve a primeira linhagem. IV .(MmBb) d) I . Os alelos de cinco genes estão indicados por letras.1 os pares de alelos abaixo aplica-se a segunda lei de Mendel SOMENTE a a) Aa e Mm b) Aa e Dd c) Aa e Nn d) Bb e Nn e) Dd e Mm Questão 633 Um pesquisador averiguava a transmissão de caracteres em vegetais ao longo de gerações. flores amarelas. cor marrom. cujo pai era marrom uniforme (II). IV . Cruzando dois indivíduos homozigotos.5. um gene D e um E.(mmBb) e) I .(mmBb).(mmBb).(Mmbb). manchas brancas em qualquer cor de pelagem.(MMbb). III . III .(mmbb) b) I . determinados por genes que se segregavam independentemente. II . IV . a alternativa que contém os genótipos dos indivíduos mencionados. II .(MmBb).(mmbb).(mmbb). cuja mãe era preta uniforme (IV). III .(Mmbb).(Mmbb) c) I . Um macho preto com manchas brancas (I). na qual promoveu autofecundação.(mmBb). o gene B determina coloração uniforme e seu alelo b. é cruzado com uma fêmea marrom com manchas brancas (III).(MmBb). a seguir. II .(mmBb).Ee) localizados em cromossomos não homólogos. sendo um dominante e outro recessivo.

Questão 636 Em uma planta com autopolinização são estudados dois pares de genes .25% de filhos com olhos azuis. b) a oosfera (gameta feminino) tenha constituição AB ou ab.D gen para mão canhota . Como. enquanto 2 e 4 têm dedos e mandíbula normais. 5 e 6 são braquidáctilas e prognatas. b) Não existe qualqueir chance de nascer um filho polidáctilo dessa relação. polidáctila a e filha de um homem homozigoto e normal para os dois caracteres e de uma mulher albina e polidáctila. 3. d) o zigoto tenha constituição AB ou ab. os esporos dão origem à geração gametofítica. sendo que o alelo dominante produz em seus portadores pigmentação normal. a) Todos os filhos desse casal deverão ser albinos.c gen para mão destra .. sendo triplóide. espera-se que a) um dos núcleos gaméticos do tubo polínico tenha constituição a e o outro constituição b. porém albino. Suponha que um exemplar da planta produza todos os esporos femininos com constituição genética AB e todos os esporos masculinos com constituição ab. um homem com pés e mãos normais.2. b . Dados: gen para olhos castanhos . assinale a alternativa CORRETA. As pessoas indicadas pelos números 1.A. 144 1. podendo ser destros ou canhotos. d) A mãe de Maria é.75% de filhos destros. tenha constituição AaB ou Aab.25% de filhos canhotos.5.com segregação independente.75% de filhos com olhos castanhos. . sendo os indivíduos homozigotos recessivos portadores de pés e mãos normais (com 5 dedos cada). c) o endosperma. e) Maria produzirá gametas de 4 tipos diferentes para essas características. podendo ter olhos castanhos ou azuis. Por sua vez. o albinismo é condicionado por um gene recessivo. . casa-se com Maria. duas características autossômicas dominantes com segregação independente: BRAQUIDACTILIA (dedos curtos) e PROGNATISMO MANDIBULAR (projeção da mandíbula para frente). por meio do processo de mitose. e) o embrião tenha constituição AaBb. Considere este caso: Antônio. mulher normal para o albinismo. a e B.d a) CCDD e CCDD b) ccdd e ccdd c) CCdd e ccDD d) CcDd e CcDd e) CcDd e ccdd Questão 635 Foram analisadas.C gen para olhos azuis . podendo ser destros ou canhotos. c) Antônio poderá produzir 2 tipos de gametas diferentes para essas características. Questão 637 Em humanos a polidactilia é condicionada por um gene dominante. homozigota para as duas características. A partir das informações anteriores. obrigatoriamente. podendo ter olhos castanhos ou azuis. . Ambos os locos citados são autossômicos. em uma família.1 probabilidade de o casal 5x6 ter um descendente simultaneamente braquidáctilo e prognata é de a) 1/16 b) 3/16 c) 9/16 d) 3/4 e) 1/4 .

12 e 15 d) 3. 14. 2. 9. 4 e 13 Questão 641 Em coelhos. patas sem plumas. 4. 9. 12 e 15 c) 1. 11. está representada a herança de duas características determinadas por genes autossômicos. 3. 4. o gene P determina patas com plumas e o seu alelo recessivo. 8.1 uais são os indivíduos obrigatoriamente heterozigotos para as duas características? a) 6. 7. o gene C condiciona plumagem branca e o seu alelo recessivo. plumagem colorida. d) 1 preto: 3 albinos. a partir do cruzamento PpAa x ppaa espera-se uma proporção fenotípica de a) 1 preto: 1 pardo: 2 albinos. 7. Esses pares de genes são autossômicos e segregam-se independentemente. Considerando que ocorra segregação independente entre esses genes. 13 e 14 b) 6. 8. Uma ave branca com patas com plumas. foi cruzada com uma colorida com patas sem plumas. 3. 2.2. 7 e 13 d) 6. 13 e 14 b) 5. homozigota para os dois pares de genes. 7. 2. c) 1 preto: 1 albino. 15 e 16 e) 1. . 14 e 16 c) 5. 8. é: a) zero b) 1/2 c) 1/4 d) 1/8 Questão 639 Na genealogia a seguir. 10. Se os decendentes obtidos forem cruzados entre si. Os animais aa são sempre albinos. Questão 642 Numa ave doméstica. 3.Questão 638 Do cruzamento entre dois indivíduos portadores do genótipo CcDd. está representada a herança de duas características determinadas por genes autossômicos. o gene P produz pelagem preta e o seu alelo recessivo p. espera-se que a proporção de aves homozigotas para os dois pares de genes seja de a) 9/16 b) 6/16 c) 4/16 145 1. 10. 13 e 15 Questão 640 Na genealogia a seguir. 9. 9.5. 9 e 15 e) 1.2. 8. e) 1 pardo: 3 albinos. b) 1 preto: 1 pardo. pelagem parda desde que esteja presente o gene A. a probabilidade de ocorrência na F de indivíduos com o mesmo genótipo dos pais.1 1. 11. uais são os indivíduos que seguramente produzem um só tipo de gameta? a) 6. 4. 9.5.

d) 3/16 e) 1/16 Questão 643 No homem. Uma mulher com polidactilia e miopia. Sabendo-se que os alelos representados por letras maiúsculas são dominantes e que os não-alelos sofrem segregação independente. foram obtidos 480 descendentes. cujo pai era míope. Os genes responsáveis por essas características situam-se em autossomos e apresentam segregação independente. amarelos e brancos. Dentre esses. a polidactilia é um caráter dominante e a miopia. a folha recortada é determinada por um alelo dominante e a lisa. Os azuis carecem de pigmento amarelo. Quando se cruzam papagaios verdes silvestres com os de cor branca. espera-se que a proporção de descendentes heterozigotos para apenas um par de genes seja a) 9/16 b) 1/2 c) 1/4 d) 3/16 e) 1/16 Questão 645 Plantas de genótipo AaBb foram intercruzadas. a probabilidade de que nasçam filhotes que latem enquanto correm e que possuem orelhas caídas é.7% Questão 647 Em tomateiros. Latir enquanto corre e possuir orelhas eretas são características dominantes. pelo alelo recessivo. os números de genótipos e de fenótipos diferentes entre os descendentes desses cruzamentos são. é casada com um homem normal. a) 3 e 2 b) 6 e 3 c) 9 e 4 d) 12 e 8 e) 16 e 9 Questão 646 Em cães. aproximadamente. latir ou não latir durante a corrida são características definidas por um par de genes alélicos.7% c) 31. de: a) 6. azuis. Esses genes estão localizados em cromossomos que se segregam independentemente. O cruzamento da F1 gera os quatro tipos de cores na F2. a cor do hipocótilo púrpura é condicionada por um alelo dominante e a cor verde. Neste caso. e os brancos não têm nem melanina azul nem pigmento amarelo nas penas.2% d) 43. uma anomalia recessiva. A probabilidade deste casal ter uma criança com polidactilia e miopia é a) 0% b) 25% c) 50% d) 75% e) 100% Questão 644 No cruzamento entre indivíduos heterozigotos para dois pares de genes que se segregam independentemente. Considere o cruzamento entre um casal de cães heterozigotos para ambos os pares de alelos. pelo alelo recessivo. existem quatro variedades: verdes. Através do intercruzamento de plantas duplo-heterozigóticas. os amarelos carecem de grânulos de melanina. respectivamente. O mesmo ocorre para os caracteres orelhas eretas ou orelhas caídas. Os papagaios verdes são os únicos normalmente encontrados na natureza. geram-se papagaios verdes na primeira geração (F1). cuja mãe era normal para as duas características.2% b) 18. o número esperado de indivíduos com hipocótilo púrpura e folhas lisas é a) 30 b) 90 c) 160 d) 240 e) 270 Questão 648 Numa dada espécie de papagaio. enquanto não latir durante a corrida e possuir orelhas caídas são recessivas. Considerando-se que os genes para a melanina e o 146 .

64 descendentes. a pelagem colorida é determinada pelo alelo H. Se porcos diíbridos são cruzados entre si e produzem. a freqüência esperada de cada um dos tipos de papagaio é a) 9 papagaios brancos. 3 amarelos. d) 1 papagaio verde. quantos desses apresentarão fenótipo diferente dos pais? 147 . c) os genes A e B que se situam em diferentes pares de homólogos distribuem-se ao acaso em diferentes gametas. sendo que F_ condiciona casco indiviso e ff. se espera que sejam fenotipicamente idênticos ao pai. b) 4 papagaios amarelos. e o padrão malhado. 1 amarelo. 1 branco. a cor dos pêlos pode ser branca (P_) ou preta (pp). d) os indivíduos da geração P formam um só tipo de gameta. d) os genes A e B estão em grupos de ligação separados. d) 4 animais com pelagem branca : 3 com pelagem vermelha : 9 com pelagem preta. enquanto o alelo h determina a pelagem branca. e) os genes A e B não são alelos. está ocorrendo segregação independente. Questão 649 Em bovinos. c) 12 animais com pelagem branca : 1 com pelagem vermelha : 3 com pelagem preta. 1 azul. 1 azul. b) as duas características segregam-se independentemente. Quantos filhotes do total nascido das várias ninhadas. e) 9 animais com pelagem preta : 7 com pelagem vermelha. Um macho preto foi cruzado com fêmeas genotipicamente iguais entre si e fenotipicamente iguais a ele. 4 brancos. e o tipo de casco é determinado por alelos que segregam em outro cromossomo. 1 azul. 3 verdes. pois o gene para a cor é dominante. O cruzamento entre um touro de pelagem preta (HhBb) com uma vaca de pelagem preta (HhBb) produzirá uma prole com: a) 100% de animais com pelagem preta. 2 verdes. por seu alelo recessivo m. quanto às características consideradas? a) 9 b) 16 c) 30 d) 45 e) 80 Questão 652 Quando se estuda uma célula meiótica duplo-heterozigota AaBb e se diz que. 1 branco. é INCORRETO afirmar que a) as características pêlo preto e curto são dominantes. pelo seu recessivo v. c) 9 papagaios verdes. 1 verde. 1 branco. casco fendido. O padrão uniforme é governado pelo alelo dominante que segrega independentemente no locus M. Outro gene determina a pigmentação da pelagem na cor vermelha (b) ou preta (B). entre várias ninhadas. b) pode ocorrer recombinação entre os genes A e B. pois o gene para a cor é epistático. 3 amarelos. c) os indivíduos da geração F1 são homozigotos. Entre as várias ninhadas foram vendidos apenas os filhotes malhados de vermelho. para esses genes. Questão 650 Um criador fez cruzamentos entre porquinhos-da-índia para estudar as características: cor e tamanho do pêlo. 4 amarelos. é INCORRETO afirmar que a) os cromossomos de origem materna e paterna que contêm esses genes podem combinar-se livremente.pigmento amarelo se encontram em cromossomos diferentes. e) 9 papagaios azuis. 3 azuis. Questão 651 A cor preta da pelagem dos cães da raça 'Cocker Spaniel' é governada por um alelo dominante V e a cor vermelha. Observou os seguintes resultados: GERAÇÃO P: pêlo preto curto X pêlo marrom longo GERAÇÃO F: pêlo preto curto GERAÇÃO F‚: 81 pêlo preto curto 27 pêlo preto longo 27 pêlo marrom curto 09 pêlo marrom longo Com base nesses resultados. Questão 653 Em porcos. b) 100% de animais com pelagem branca. que eram em número de cinco.

e) 60.2. logo estão relacionadas com o comportamento cromossômico na meiose.a) 4. b) somente I e II. deduz-se que é um padrão de herança intermediária. Questão 654 O esquema a seguir representa o cruzamento entre duas variedades puras de ervilha-de-cheiro ('Lathyrus odoratus') de flor branca. Cruzando-se um macho de corpo cinza e asas vestigiais com uma fêmea de corpo ébano e asas longas (parentais P) obteve-se F que deu origem a F‚ através da autofecundação. Questão 656 A mosca-de-fruta 'Drosophila melanogaster' pode apresentar asas vestigiais ou longas e corpo cinza ou ébano.1 148 .A lei da segregação independente (2 lei) está relacionada às conseqüências do arranjo.Dois pares de genes se segregam independentemente. b) Pelos resultados. ao acaso. I . na geração F2. d) somente II e III. 1. c) A proporção fenotípica 9:7 é um padrão de segregação independente. como mostra a figura a seguir. d) 36. c) 28.5. se 1.1 nalise este padrão de herança e assinale a afirmativa CORRETA: a) Trata-se de um exemplo típico da primeira Lei de Mendel. estiverem localizados em cromossomos diferentes. c) somente I e III. Após autofecundação das plantas F1. II . II e III. de pares de cromossomos homólogos na placa metafásica. Questão 655 As afirmativas a seguir relacionam a Genética Mendeliana à Divisão Celular. Está(ão) correta(s): a) somente I. na meiose. e) O exemplo é de interação gênica já que está envolvido apenas um loco. d) O gene para a cor avermelhada é codominante em relação ao alelo. foram produzidas 371 plantas com flores avermelhadas e 287 com flores brancas. A F1 resultante apresentou 100% das ervilhas com flores avermelhadas.2. e) I. III . b) 16.As 1 e 2 Leis de Mendel abordam o comportamento dos genes na formação dos gametas.5.

e) DDee. 149 . A figura a seguir mostra padrões digitais que formam figuras denominadas de arco. c) DDEE. apenas. Questão 657 Um casal de surdos teve dois filhos com audição normal. As afirmativas corretas são: a) I. d) DdEe. e) Dezesseis.Os genes para cor do corpo e pra tipo de asa estão localizados num mesmo cromossoma. artelhos e solas dos pés. c) I. II e V . relativos a esses cinco pares de genes podem apresentar os zangões filhos dessa rainha? a) Um. alça ou verticilo. Sabe-se que os padrões dermatóglifos são de herança multifatorial. espera-se que o genótipo dos filhos seja a) ddee. e) ADF e adf. IV e V. V . pelo menos. Entre os gametas que poderão se formar encontraremos apenas a(s) combinação(ões): a) AdF.Em F‚. III . Questão 661 Do cruzamento de dois indivíduos com genótipo AaBbCc. c) Quatro. foram feitas as afirmativas abaixo. em homozigose.Os genes para cor do corpo e forma das asas segregam-se independentemente durante a formação dos gametas. apenas. a probabilidade de ocorrência de homozigose dominante é a mesma de homozigose recessiva. IV . b) Dois. e) III. quantos genótipos diferentes. b) AADDFF. I . Sabendo-se que os zangões surgem de óvulos que se desenvolvem por partenogênese. Considere ainda que todos esses genes situam-se em cromossomos diferentes. apenas. quantos genótipos diferentes. II .Após a análise dos resultados dos cruzamentos. d) II. Questão 658 Uma abelha rainha tem os seguintes pares de genes alelos que segregam independentemente: AaBbDdEe. duplo recessivo para o gene "D" e homozigoto dominante para o gene "F". II e IV. Questão 660 Uma abelha rainha tem os seguintes pares de genes alelos que se segregam independentemente: AaBBccDdEE.O gene para corpo ébano só está presente na geração P e em parte de F‚. III e V . d) AdF e adF. d) Oito. Sabendo-se que a surdez é determinada por qualquer dos genes recessivos d ou e. podem apresentar os zangões filhos dessa rainha? a) Um b) Dois c) Quatro d) Oito e) Dezesseis Questão 659 Considere um homem heterozigoto para o gene "A". apenas. apenas. III e IV . b) I. c) AaddFF. Sabendo-se que os zangões surgem de óvulos que se desenvolvem por partenogênese.: Considere um tipo de herança mendeliana. a) 1/64 b) 63/64 c) 1/32 d) 1/16 e) 1/4 Questão 662 Os dermatóglifos são padrões típicos das cristas dérmicas nos dedos e palmas das mãos. relativos a esses quatro pares de genes. b) Ddee. a probabilidade de surgir um descendente com genótipo que apresenta. um gene dominante.A probabilidade de ocorrência do mesmo genótipo dos indivíduos de F em F‚ é de 4/16. é Obs.

é INCORRETO afirmar: a) Quanto mais semelhantes forem as mãos de gêmeos. de semente lisa e amarela. A cor da semente pode ser amarela devido ao alelo "Y" e branca devido ao alelo "y". b) aBcDE. EE. é correto afirmar: 150 1. bc. abcDE. . c. Uma planta pura. b. E. d) 12%. de semente rugosa e branca. maior será a probabilidade de que eles sejam monozigóticos. BbDd. Questão 667 Um organismo diplóide. e) 6. Nessas condições. c) 25%. Se as plantas da geração F forem intercruzadas. Na geração F. baixa.25%. a) a. D. Bb. cc. como a Síndrome de Down. d. c) aa. com o genótipo AaBBCCDDEE. b) 50%. poderá produzir quantos tipos geneticamente distintos de gametas? a) 2 b) 4 c) 8 d) 16 e) 32 Questão 668 O desenho abaixo corresponde ao núcleo de uma célula em metáfase de uma espécie cujo número n de cromossomos é 3. Questão 663 A análise de 4 genes autossômicos. a textura da semente pode ser lisa devido ao alelo "Su" e rugosa devido ao alelo "su". b) Esses padrões podem ser úteis ao diagnóstico de certas síndromes cromossômicas. aaEE.2.5. cD. abcdE. d) aaBb. o número de gametas produzidos pelas plantas F e a proporção fenotípica esperada na geração F‚ será. permitiu constatar que Janaína tem o genótipo AAbbCCDD e Pedro tem o genótipo aaBBccDD. respectivamente: a) 4 e 3:3:3:1:1:1 b) 8 e 27:9:9:9:3:3:3:1 c) 8 e 9:3:3:1 d) 16 e 9:3:3:1 e) 16 e 27:9:9:9:3:3:3:1 Questão 666 Considere a segunda lei de Mendel ou lei da distribuição independente e indique os gametas produzidos pelo genótipo aaBbccDdEE. B.2 Sobre esse assunto. quantos tipos diferentes de gametas poderia produzir o filho de Janaína e Pedro? a) 4 b) 8 c) 16 d) 32 e) 64 Questão 664 Considere quatro pares de genes que segregam de maneira independente. e) aB. um indivíduo que apresente o genótipo AaBBCcDD produzirá gametas ABCD com a freqüência de: a) 75%. d) O número de cristas dérmicas não varia entre indivíduos da mesma família. ccDd. A planta pode ser alta devido ao alelo "Br" e baixa devido ao alelo "br". de semente lisa e amarela. c) A análise dos padrões digitais não se presta para a determinação de paternidade. aBcdE. Dd. Analisando a figura. observaram-se 100% das plantas altas. dE. foi cruzada com outra planta pura. alta. Para estes 4 genes.Questão 665 No milho. cada um com um par de alelos.

sendo. Soma ( ) ão esperados. abc b) ABC.2 1. . AaBbCc.5. onde os três pares de genes estão em pares de cromossomos separados. AaBBcc. (02) Em relação aos genes em questão.8 b) 4 . portanto. Cc d) AABBCC. apresentando a constituição ABC.4 . aBC. e) 180 espermatozóides. Questão 671 Assinale a alternativa correta.2 .4 e) 2 . onde os três pares de genes estão em pares de cromossomos distintos.5.4 -16 .8 . poderão ser formados 4 diferentes tipos de gametas. (08) Como resultado de uma autofecundação.8 . Bb. impossível calcular tanto o número de genótipos quanto o de fenótipos. Abc. AaBB.2.8 . aabbcc e) AaBbCc Questão 673 Se a meiose ocorre numa célula de genótipo AaBbCc.1. poderão ser encontrados 64 genótipos diferentes. respectivamente.2 (01) Em relação aos genes em questão.4 -16 .2 .8 Questão 670 Sessenta células de um animal. poderão ser encontrados 9 genótipos diferentes. d) 120 espermatozóides. quais serão os genótipos das células resultantes? a) Aa.4 . (16) Como resultado de uma autofecundação. AbC. (32) O sistema em questão é polialélico. (04) Como resultado de uma autofecundação.8 . abC.2 . a) 30 espermatozóides. AaBbcc podem formar. quantos tipos de gametas diferentes? a) 4 . se for realizado um cruzamento entre indivíduos AaBbCc. poderão ser formados 8 diferentes tipos de gametas.4 c) 2 . sofrem meiose. c) 90 espermatozóides. Em experimentos envolvendo três características independentes (triibridismo). a freqüência de descendentes AABbcc será igual a a) 8/64 b) 1/16 c) 3/64 d) 1/4 e) 1/32 Questão 672 Se a mitose ocorre em uma célula de genótipo AaBbCc.8 . Bb e Cc 151 Questão 669 Indivíduos com os genótipos AaBb. ABc. poderão ser encontrados 16 genótipos diferentes.2. com a constituição representada na figura.8 d) 4 .4 . os genótipos das células resultantes serão: a) ABC. b) 60 espermatozóides. abc c) Aa.

Questão 677 Um indivíduo de sangue tipo B. casa-se com uma mulher míope e destra. Questão 675 Um indivíduo daltônico e não míope. O casal já tem uma filha daltônica e míope. d) zero. casa-se com uma mulher de sangue tipo A.2. cujo pai tinha miopia e era canhoto. cuja mãe era canhota. AbC. Rh−. e) A probabilidade de o casal 4 × 5 ter uma criança míope e canhota é de 3/8. aBc. e) 1/3. a) O indivíduo 2 deve ser heterozigoto para os alelos dessas duas características. Um homem de visão normal e destro. d) Todos os descendentes de pai míope e canhoto possuem essas características.3 probabilidade do casal 4X5 ter uma criança de sexo feminino e de visão normal é de: a) 1/6. os indivíduos marcados apresentam um tipo de cegueira noturna. considere a genealogia a seguir. b) 1/4. filho de pai O. A probabilidade de esse casal ter uma criança que possa doar sangue para o pai é de: a) 1/2. casa-se com uma mulher normal para ambas as características. Questão 678 Na espécie humana.2.5. Sabendo que o daltonismo é condicionado por um gene recessivo ligado ao sexo e que a miopia é uma herança autossômica recessiva. Qual a probabilidade de esse casal ter uma criança com fenótipo igual ao do pai? a) 1/2 b) 1/4 c) 1/8 152 ssinale a alternativa correta. c) A probabilidade de o casal 1 × 2 ter uma criança destra e de visão normal é de 1/4.3 1. b) O indivíduo 3 deve ter herdado os alelos dessas duas características apenas de sua mãe. aBC.5. d) 1/2. filho de pai míope. c) 3/4.b) ABC e abc c) ABC. a probabilidade de terem uma menina normal para ambas as características é de: a) 3/16 b) 1/4 c) 1/16 d) 1/2 e) 9/16 . 1. abC e abc d) AaBbCc e) AABBCC e aabbcc Questão 674 Sabendo-se que a miopia e o uso da mão esquerda são condicionados por genes autossômicos recessivos. Questão 676 No heredograma a seguir. c) 1/8. a miopia e a habilidade para a mão esquerda são caracteres condicionados por genes recessivos que se segregam de forma independente. ABc. Rh®. e) 1. Rh®. b) 1/4. que teve eritroblastose fetal ao nascer e é filha de pai do tipo O. Abc.

2. (16) 50% de probabilidade de vir a apresentar apenas uma das anomalias. com a reprodução sexuada. principalmente. O pai da mulher tem ossos normais. (II) .zero b) (I) . Nessas condições. o alelo B condiciona padrão uniforme e o b. (04) 25% de probabilidade de vir a ter olhos normais e ossos frágeis. presença de manchas brancas. (02) 50% de probabilidade de vir a sofrer de catarata e ter ossos normais. A partir do cruzamento Mmbb × mmBb. pergunta-se: I . em um organismo onde o número haplóide (n) é igual a 3.Se esse homem casar-se com uma mulher de sangue tipo AB.A ou B ou O. Um homem com catarata e ossos normais cujo pai tem olhos normais. casa-se com uma mulher de olhos livres de catarata mas com ossos frágeis. quais os prováveis tipos de sangue dos filhos do casal? II . Esses dois pares de alelos autossômicos segregam-se independentemente. O principal evento responsável por essa diversidade ocorre durante a formação dos gametas. pode-se afirmar que a melhor expressão para o número (w) de gametas possíveis está representada em: a) w = 2£¤ b) w > 2£¤ c) w < 2£¤ d) w = 2¢¤ e) w¤ 2¢¤ Questão 681 A cegueira provocada pela catarata e a extrema fragilidade dos ossos são características que podem aparecer em seres humanos e resultam da ação de dois genes dominantes autossômicos presentes em cromossomos diferentes. (08) 50% de probabilidade de vir a apresentar ambas as anomalias. (II) . Soma ( ) Questão 682 Sendo um homem de sangue tipo O. a cor preta é determinada pelo alelo dominante M e a marrom pelo alelo m.50% 153 1. que ocorre durante a meiose. podemos observar que o número possível de gametas (w) em uma espécie é igual a 2¾. A figura a seguir demonstra a distribuição independente de cromossomos maternos e paternos. qual a probabilidade do nascimento de uma criança do tipo AB? A alternativa que responde corretamente às perguntas anteriores é: a) (I) .Se casar-se com uma mulher de sangue tipo A. a probabilidade de nascer um filhote marrom com manchas é a) 1/16 b) 3/16 c) 1/4 d) 1/2 e) 3/4 Questão 680 A diversidade biológica dos seres vivos está relacionada.O ou A ou B.5. Assim.3 .d) 3/4 e) 3/8 Questão 679 Em determinada raça animal. pode-se afirmar que um descendente do casal tem: (01) 100% de probabilidade de nascer livre de ambas as anomalias. Levando-se em consideração que na espécie humana ocorre a permuta gênica.

.pai sem aglutininas do sistema ABO no sangue. teve um filho de sangue tipo O. Rh−.1 a) os resultados dos grupos sangüíneos excluem a possibilidade do homem ser o pai da criança. Os tipos de sangue dos filhos são apenas: a) A e AB b) A e B c) A.3. casada com um homem de sangue tipo B. foram realizados exames para identificação de grupos sangüíneos e análise de DNA. d) menor que a chance de nascerem sucessivamente com sangue do tipo AB.50% d) (I) . A tabela a seguir resume os resultados parciais da análise de grupos sangüíneos (do menino. A probabilidade de os pais desse menino terem mais um filho com o mesmo fenótipo de seu irmão. O e) A.zero e) (I) . c) maior que a chance de nascerem todos com sangue do tipo AB. levando em conta o sexo. os outros exames foram desnecessários. B. A e A. b) os resultados dos grupos sangüíneos não excluem a possibilidade do homem ser o pai da criança.A ou B. 154 . (II) . Se o casal vier a ter outros 5 filhos.A ou B. podemos afirmar que: 1.c) (I) .A ou B. mas a seqüência de DNA do cromossomo X exclui. Considerando apenas a tabela adiante. b) menor que a chance de nascerem todos com sangue do tipo AB.25% Questão 683 Considere os seguintes dados: . A e B. o grupo sangüíneo e o fator Rh é de a) 1/16 b) 1/12 c) 1/8 d) 1/4 e) 1/2 Questão 684 Nas hemácias de um indivíduo pertencente ao grupo sangüíneo B: a) existe o aglutinógeno B b) existe o aglutinógeno A c) existe a aglutinina A d) existe a aglutinina B e) existem o aglutinógeno A e a aglutinina B Questão 685 Um homem de genótipo AB casa-se com uma mulher receptora universal. B. e) os resultados de DNA contradizem os resultados dos grupos sangüíneos. correspondentes a um segmento localizado num autossomo e outro no cromossomo X. e) maior que a chance de nascerem sucessivamente com sangue do tipo AB. de sua mãe e do suposto pai) e de duas seqüências de DNA (do menino e do suposto pai). B. O Questão 686 Num caso de investigação de paternidade.mãe de tipo sangüíneo B. a chance deles nascerem todos com sangue do tipo O é a) igual à chance de nascerem todos com sangue do tipo AB. Rh−.5.menino de tipo sangüíneo A. B. (II) . AB d) A. (II) . A. d) os três resultados foram necessários para confirmar que o homem é mesmo o pai da criança. Questão 687 Uma mulher de sangue tipo A. c) os resultados dos grupos sangüíneos e de DNA não excluem a possibilidade do homem ser pai da criança. . mas possuidor do antígeno Rh. B.

é: a) B e Rh positivo.heterozigoto. respectivamente: 1. b) quantitativa. Questão 690 Utilizando-se três lâminas de microscopia.5. A partir desses dados podemos afirmar que o indivíduo.1 om relação a esses resultados. d) AB e Rh positivo. A cada gota foi juntada igual quantidade de soro anti-A na primeira. e) A e Rh positivo. c) heterozigoto . O indivíduo 6 deverá ser. d) homozigoto . adicionando-se.Questão 688 Para se determinar o tipo sangüíneo de uma pessoa. a) heterozigoto .1 155 . quanto aos grupos sanguíneos ABO e fator Rh. Rh+ poderá ser filha: 1. foi observada aglutinação nas duas primeiras lâminas. foram colocadas três gotas de seu sangue sobre uma lâmina de vidro. soros anti-A.homozigoto dominante. foi colocada uma gota de sangue humano em cada uma delas. c) polialelia. notou-se aglomeração de hemácias apenas no local onde havia soros anti-B e anti-A. Após a mistura do sangue com os respectivos soros. em relação aos locos dos sistemas ABO e Rh. soro anti-B na segunda e soro anti-Rh na terceira. c) A e Rh negativo. a cada uma. assinale a opção correspondente ao possível genótipo da pessoa em teste: a) IÞIÞRR b) IÞIßrr c) IßiRr d) IÞirr e) iiRR Questão 689 No heredograma a seguir estão indicados os fenótipos dos grupos sangüíneos ABO e Rh.3.3. e) poligênica.5. d) pleiotropia.heterozigoto. Questão 692 Qual das opções a seguir relaciona os grupos sangüíneos de um doador universal ideal? a) ARh− b) ABRh® c) ORh® d) ABRh− e) ORh− Questão 693 Considerando os casamentos a seguir. Questão 691 A herança do sistema ABO é do tipo: a) com dominância. b) AB e Rh negativo. anti-Rh e anti-B. e) homozigoto . Após alguns segundos.homozigoto recessivo. uma criança de tipo sangüíneo B. b) heterozigoto .homozigoto dominante. conforme o esquema adiante.

Questão 694 Jorge. b) O indivíduo 7 pertence ao grupo sangüíneo A. b) IÞIÞ e Ißi. recebeu transfusão de sangue de sua mulher Tânia. a probabilidade do casal ter uma criança do tipo A. Sabendo que o casal 5×6 já perdeu uma criança com eritroblastose fetal.1 1. a probabilidade de nascer uma menina do tipo O. c) o casal III ou do casal IV.1 Considere o heredograma acima. Questão 696 A respeito do heredograma acima. Sabendo-se que Tânia teve eritroblastose fetal ao nascer. a) O indivíduo 9 pode ser doador universal. os genótipos do casal são: a) IÞi e IÞi.5. e) IÞi e IßIß.5. que é filha de pai e mãe do tipo B. c) O indivíduo 6 é homozigoto. Sabendo-se que o marido tem o aglutinogênio B. Rh− e é filho de pai tipo A e mãe tipo B. c) IÞi e Ißi. que mostra a tipagem ABO e Rh dos indivíduos.1 a) somente do casal I. d) O indivíduo 1 é receptor universal. Rh® é: a) 100% b) 25% c) 75% d) 50% e) 0 Questão 695 Uma mulher que possui aglutinina anti-B no seu sangue teve um filho do grupo O. 156 .5.3. b) do casal I ou do casal IV. que considera o sistema sangüíneo ABO. e) O indivíduo 8 é heterozigoto. que tem tipo sangüíneo A.1. Questão 697 1.3. d) somente do casal II e) do casal I ou do casal II ou do casal III. assinale a alternativa INCORRETA. d) IÞIß e IÞIÞ.3. Rh® é de: a) 1/6 b) 1/8 c) 1/2 d) 1/4 e) 1/3 Questão 698 O heredograma a seguir mostra os diferentes tipos sangüíneos existentes em uma família.

respectivamente. .3. FATOR Rh: positivo. c) TIPO SANGÜÍNEO: A ou O. . A partir dos resultados. Epaminondas provocava aglutinação das hemácias de D. um A.Indivíduos que apresentem apenas alelos recessivos ii pertencem ao grupo O.Ißi e) AB . o fenótipo e o genótipo do indivíduo II. Questão 701 Alexsander não sabe qual é o seu grupo sangüíneo e o seu tipo de Rh. b) TIPO SANGÜÍNEO: O.IÞi c) A . Josefa.IÞIÞ d) B . e) AB e O.Indivíduos que apresentem os dois alelos dominantes IÞ e Iß pertencem ao grupo AB. que precisava urgentemente de transfusão sangüínea. Os tipos sangüíneos dos pais biológicos dessa criança são: a) A e A. somente. e) TIPO SANGÜÍNEO: O. O teste subseqüente revelou que o soro do Dr. Quantos filhos biológicos tem esse casal? a) 5 b) 4 c) 3 d) 2 e) 1 Questão 700 Uma criança tem tipo sangüíneo do tipo AB. somente. b) B e B. Epaminondas. Questão 702 ssinale a alternativa que contém. Como faltavam anti-soros para a determinação dos grupos sangüíneos no sistema ABO. mas não se sabia o seu grupo sangüíneo. d) TIPO SANGÜÍNEO: A ou O. Epaminondas pode concluir que D. FATOR Rh: positivo No ambulatório de uma pequena cidade do interior estava D. fazendo o mesmo com o sangue de D. c) A e O. d) A e B.ii b) A .2 a) O . FATOR Rh: negativo ou positivo. Assinale a opção que contém o(s) grupo(s) sangüíneo(s) e o(s) tipo(s) de Rh que Alexsander pode ter: a) TIPO SANGÜÍNEO: A. Dr. . de acordo com a seguinte composição genética: . Dr.IÞIß Questão 699 Pais cujo grupo sanguíneo são AB e O têm cinco filhos com os seguintes fenótipos: dois são O. sua mãe O+ e seu irmão é A-. mas o soro de D. Josefa apresenta sangue do grupo: a) A b) B c) AB d) O Questão 703 O esquema apresenta uma árvore genealógica de alguns primatas e seus possíveis grupos sangüíneos no sistema ABO. Josefa não era capaz de aglutinar as hemácias do Dr. somente. usou de um outro recurso: retirou um pouco de seu próprio sangue do qual separou o soro.Indivíduos que apresentem apenas alelo dominante Iß e não apresentem IÞ pertencem ao grupo B. FATOR Rh: positivo. Josefa. somente. somente.Indivíduos que apresentem apenas alelo dominante IÞ e não apresentem Iß pertencem ao grupo A. FATOR Rh: negativo.5.1. um B e um AB. Josefa. somente. Epaminondas. 157 . que é do grupo A. Entretanto sabe que seu pai é A+.1 ou negativo.

mas chimpanzés.3. Questão 706 Observe a árvore genealógica a seguir para o grupo sangüíneo (ABO) em uma família: 158 . b) O gene O é dominante sobre os genes A e B. c) O gene O é recessivo e. d) Alguns gorilas podem receber sangue de alguns orangotangos. respectivamente: a) O Rh® e O Rh− b) O Rh− e AB Rh® c) A Rh− e OB Rh® d) AB Rh® e O Rh− Qual das alternativas a seguir apresenta uma explicação possível para a mudança na freqüência dos grupos sangüíneos nessa população? a) O gene O é dominante sobre os genes A e B. apresentam pouca chance de existir numa população. c) Apenas dois dos primatas da árvore podem apresentar indivíduos receptores universais no sistema ABO. os casamentos entre pessoas O e A e entre pessoas O e B apresentam 50% de chance de produzir descendentes pertencentes ao grupo O. e) As pessoas pertencentes ao grupo AB só recebem sangue de AB. d) As pessoas pertencentes ao grupo AB são recessivas e. 1.1 Pode-se dizer que os tipos sanguíneos mais difíceis e mais fáceis para receber sangue são.3. são mostradas as freqüências aproximadas dos grupos sangüíneos do sistema ABO da população original (tabela 1) e da população atual (tabela 2).1 De acordo com o esquema. imigrou para uma região há mais de meio século. Essa situação leva a uma menor freqüência dessas pessoas na população. é correto afirmar. EXCETO: a) Apenas dois dos primatas citados podem apresentar indivíduos doadores universais no sistema ABO. Questão 704 Os esquemas mostram as possíveis transfusões de sangue tradicionais em relação aos sistemas ABO e Rh.5.1 1.5. o casamento entre pessoas pertencentes ao grupo O origina apenas descendentes do grupo O. Nas tabelas a seguir. b) Orangotangos podem apresentar três grupos sangüíneos. portanto. somente humanos podem apresentar os quatro grupos sangüíneos no sistema ABO.3.Questão 705 Suponha que um grupo de pessoas. Assim. Assim. apenas dois. os casamentos entre as pessoas O e A e entre pessoas O e B produzem apenas descendentes pertencentes ao grupo O. pertences a uma determinada seita religiosa. totalmente isolada.5. A população originária desse grupo vive até hoje no mesmo local. mas não de chimpanzés. 1. portanto. Considerando-se apenas os antígenos do sistema ABO.

O.3. N. para o grupo sangüíneo ABO em uma família: 1.a e) I .a Questão 709 Sabe-se que.5. O indivíduo 4 é homem do grupo sangüíneo "B" 3. B. III . II .Legenda: Grupo "A": A/A ou A/O Grupo "B": B/B ou B/O Grupo "AB": A/B Grupo "O": O/O arque a opção correta: a) o indivíduo nŽ 5 pode ser de grupo sangüíneo "AB" b) o indivíduo nŽ 1 é do grupo sangüíneo "AB" c) o indivíduo nŽ 6 é do grupo sangüíneo "AB" d) o indivíduo nŽ 7 não pode ser filho do casal 5×6 Questão 708 Uma mulher com grupos sangüíneos B. Rh− b. II . N. AB × AB 159 OBS: 1. Rh− PAIS a. III .b.c.a. a) I .b. N. dois irmãos são do grupo sangüíneo A. N.b.1 CRIANÇAS I. Rh® Assinale a alternativa que relaciona corretamente cada criança ao seu pai. Rh− c. AB. Rh® teve três crianças com pais distintos: 1. B.b. II .3. CASAIS I. O indivíduo 5 é mulher do grupo sangüíneo "O" Sobre a árvore anterior.c.c b) I . III . MN. M. II . O indivíduo 2 é mulher do grupo sangüíneo "A" 2.a.5. A. o único que pode ser dos pais desses indivíduos é a) ii × Ißi b) IÞi × IÞIß c) IÞi × Ißi d) IÞIÞ × IÞIß e) IÞIÞ × IßIß Questão 710 Os tipos sangüíneos do sistema ABO de três casais e três crianças são mostrados a seguir.a. outro é do grupo AB e outro do grupo O. III . III . Dos pares de genótipos a seguir. Rh® III. A. numa família.b c) I . N.1 . II .c.c d) I . marque a opção correta: a) o indivíduo 3 é do grupo sangüíneo "AB" b) o indivíduo 1 pode ser do grupo sangüíneo "AB" c) o indivíduo 1 é do grupo sangüíneo "A" d) o indivíduo 1 é do grupo sangüíneo "O" Questão 707 Observe a árvore genealógica a seguir. Rh− II.

II. B × B III. A × O CRIANÇAS a. A b. O c. AB Sabendo-se que cada criança é filha de um dos casais, alternativa que associa corretamente cada casal a seu filho é a) I - a; II - b; III - c b) I - a; II - c; III - b c) I - b; II - a; III - c d) I - c; II - a; III - b e) I - c; II - b; III - a Questão 711 Uma criança necessita urgentemente de uma transfusão de sangue. Seu pai tem sangue do tipo B e sua mãe, do tipo O. Que outro(s) tipo(s) de sangue, além do tipo O, poderia(m) ser utilizado(s) na transfusão, mesmo sem a realização de teste, sabendo-se que o avô paterno da criança tem sangue do tipo AB e sua avó paterna tem sangue do tipo O? a) Tipo AB. b) Tipo A. c) Tipo B. d) Tipo A e tipo B. e) Nenhum outro tipo. Questão 712 Na herança do sistema sangüíneo ABO, há três alelos autossômicos principais: IÞ (para sangue do tipo A), Iß (para sangue do tipo B) e i (para sangue do tipo O). Sabe-se, ainda, que IÞ e Iß são codominantes, ambos dominando sobre i. Uma mulher do tipo A, casada com um homem do tipo B, teve uma filha do tipo O. O homem não quis reconhecer a paternidade alegando infidelidade por parte da mulher. Como na época em que o fato ocorreu não havia o "exame do DNA", o Juiz recorreu a um geneticista que lhe apresentou um parecer sobre o caso. Assinale a alternativa que contém a conclusão correta do geneticista. a) O homem tem razão, pois, por se tratar de um caso de herança ligada ao sexo, a filha dos dois teria que ser, obrigatoriamente, do tipo A.

b) O homem tem razão, pois, pais com tipos A e B, quaisquer que sejam seus genótipos, jamais poderiam ter filhos ou filhas do tipo O. c) O homem não tem razão, pois, pais com tipos A e B, dependendo de seus genótipos, podem ter filhos ou filhas com qualquer um dos tipos sangüíneos (A, B, AB e O). d) O homem não tem razão, pois, por se tratar de herança autossômica, filhos e filhas teriam que ser, obrigatoriamente, do tipo O. e) O homem tem razão, pois, pais com tipos A e B, só podem ter filhos ou filhas do tipo AB, visto que IÞ e Iß são codominantes. Questão 713 Mulher branca, submetida à inseminação artificial, deu à luz gêmeos de cor negra. O fato causou polêmica, já que o pai também é branco. A grande dúvida é saber se houve troca de embriões ou apenas de um dos gametas. Adaptado do "Jornal do Brasil", 1Ž de agosto de 2002 Considere o fato relatado e suponha que a mãe tenha sangue tipo A e seja filha de pai e mãe com sangue tipo AB. Nesse caso, o tipo sangüíneo dos gêmeos poderia ser: a) A ou O b) A ou AB c) B ou O d) B ou A e) AB ou O Questão 714 É necessário o conhecimento do tipo sangüíneo em caso de transfusão. Em relação ao sistema ABO, ( ) indivíduos do grupo sangüíneo O podem doar sangue para pessoas do seu próprio tipo sangüíneo e para os demais . ( ) indivíduos do grupo AB podem receber sangue de qualquer tipo. ( ) indivíduos portadores de sangue do tipo A possuem aglutinogênios A. ( ) indivíduos do grupo B possuem aglutinina anti-A.

160

Questão 715 Além do teste de DNA, há exames mais simples que podem ajudar a esclarecer dúvidas sobre paternidade. Por exemplo, o teste de tipagem sangüínea do sistema ABO permite determinar quem não pode ser o pai. Assinale a alternativa que apresenta uma situação em que esse exame assegura a exclusão da paternidade: a) O filho é do tipo O, a mãe do tipo O e o suposto pai do tipo A. b) O filho é do tipo AB, a mãe do tipo AB e o suposto pai do tipo O. c) O filho é do tipo AB, a mãe do tipo A e o suposto pai do tipo B. d) O filho é do tipo B, a mãe do tipo B e o suposto pai do tipo O. e) O filho é do tipo A, a mãe do tipo A e o suposto pai do tipo B. Questão 716 O heredograma a seguir representa uma família na qual foram determinados os grupos sangüíneos do sistema ABO para alguns dos membros, e do sistema Rh para todos os membros. Com base nas informações contidas no heredograma e em seus conhecimentos sobre o assunto, é INCORRETO afirmar-se que

a) a probabilidade do indivíduo I-2 formar gametas iR é de 50%. b) a probabilidade de II-4 ter uma criança com eritroblastose fetal é de O%. c) os indivíduos Rh positivos da geração II pertencem ao grupo sangüíneo A, e os Rh negativos, ao grupo O. d) o indivíduo I-1 é heterozigoto para uma das características. e) os indivíduos II-3 e II-4 podem apresentar os dois tipos de aglutinina do sistema ABO. Questão 717 Nas situações em que vítimas de acidentes necessitam de transfusão de sangue, sem que se conheça o tipo sangüíneo de cada uma delas, é recomendável utilizar-se o tipo "O negativo". É CORRETO afirmar que, nesse caso, tal tipo sangüíneo é o mais adequado porque, nas hemáceas do doador, estão a) presentes os antígenos correspondentes aos anticorpos do receptor. b) ausentes os anticorpos correspondentes aos antígenos do receptor. c) ausentes os antígenos correspondentes aos anticorpos do receptor. d) presentes os anticorpos correspondentes aos antígenos do receptor. Questão 718 Com relação à genética dos grupos sangüíneos ABO, pode-se afirmar que: a) existem 16 modalidades de cruzamentos de gametas. b) existem 9 possibilidades de acasalamentos. c) indivíduo com grupo sangüíneo O não pode ser filho de acasalamento de indivíduos dos grupos O e AB. d) indivíduo do grupo sangüíneo B não pode ser filho de acasalamento de indivíduos dos grupos O e AB. e) indivíduo com grupo sangüíneo AB pode ser filho de acasalamento de indivíduos dos grupos O e B. Questão 719 A respeito dos grupos sangüíneos avalie as proposições abaixo. ( ) Grupo sangüíneo: A
161

1.5.3.1

Antígenos: A Anticorpos: Anti-B Doa: A, AB Recebe: A, O ( ) Grupo sangüíneo: B Antígenos: B Anticorpos: Anti-A Doa: B, AB Recebe: B, O ) Grupo sangüíneo: AB Antígenos: A e B Anticorpos: Anti-A e Anti-B Doa: AB Recebe: AB, A , B, O ) Grupo sangüíneo: O Antígenos: O Anticorpos: Não tem Doa: O, A, B, AB Recebe: O ) Grupo sangüíneo: A Antígenos: A Anticorpos: Anti-A Doa: A, AB Recebe: A, O Questão 720 Na figura a seguir são mostrados os genótipos e fenótipos possíveis, considerando-se os alelos IÞ, Iß e i determinantes dos grupos sangüíneos do sistema ABO no homem. De acordo com a figura, analise as proposições a seguir.

(

) Todos os descendentes de um casal de genótipo tipo 2 serão do grupo A e apresentarão em suas hemácias o aglutinogênio A. 2) Indivíduos do grupo sangüíneo B de genótipo 3 ou 4 apresentam na membrana de suas hemácias aglutinogênio B e, no plasma, aglutinina anti-A. 3) Os descendentes de um casal (genótipo 5) do grupo sangüíneo AB serão fenotipicamente AB e, como têm em seus genótipos os alelos IÞ e Iß, apresentam, na membrana de suas hemácias, os antígenos A e B. 4) Indivíduos do grupo sangüíneo O de genótipo 6, apresentam aglutinogênios A e B no plasma, mas não têm aglutininas anti-A e anti-B na membrana de suas hemácias. Está(ão) correta(s) apenas: a) 2 b) 1 e 4 c) 2 e 4 d) 2 e 3 e) 2, 3 e 4 Questão 721 Três irmãos (João, José e Maria) realizaram um exame de sangue em laboratório para identificar os seus tipos sangüíneos, com o objetivo de verificar a possibilidade de doarem sangue ao pai, que necessitaria de uma transfusão após uma cirurgia. Um deles (João) ficou surpreso ao descobrir seu tipo sangüíneo - O - e achou que não era filho biológico do casal que o criou. Seu pai e o irmão apresentam sangue do tipo A e sua mãe e a irmã apresentam sangue do tipo B. Todos são RH®. Com base no texto e em seus conhecimentos sobre a herança dos tipos sangüíneos, é correto afirmar que a) João não pode ser filho biológico do casal, pois de acordo com a herança genética possível do tipo sangüíneo, os filhos somente poderiam apresentar sangues dos tipos A, B e AB. Dos filhos biológicos, somente José pode doar sangue ao pai, pois as hemácias de seu sangue apresentam aglutinogênio A. b) João pode ser filho biológico do casal, desde que pelo menos um dos pais seja heterozigoto e apresente o alelo responsável pela presença de aglutininas anti-A e anti-B no plasma. O pai não pode receber sangue de Maria, pois seu sangue apresenta aglutinina anti-B. c) João não pode ser filho biológico do casal, assim como seus dois irmãos, pois de acordo com a herança genética
162

(

(

1.5.3.1

possível do tipo sangüíneo, os filhos somente poderiam apresentar sangues dos tipos AB. O pai pode receber sangue de João e José, pois o sangue dele apresenta aglutinina anti-A, assim como o de seus filhos. d) Se Maria engravidar de um homem com o mesmo genótipo para o tipo sangüíneo de seu irmão João, existe a probabilidade de 100% de seu filho ter sangue do tipo B. Porém, se ela engravidar de um homem com o mesmo genótipo para o tipo sangüíneo de seu irmão José, existe a probabilidade de 50% de seu filho ter sangue do tipo AB, 25% do tipo A e 25% do tipo B. e) João pode ser filho biológico do casal, desde que ambos os pais sejam heterozigotos e apresentem o alelo responsável pela ausência de aglutinogênio. João pode doar sangue para seu pai, pois as hemácias do seu sangue não apresentam aglutinogênios. Questão 722 Jorge, portador de grupo sangüíneo AB Rh-, e Júlia, que é AB Rh+, têm uma filha, Joana, que aos 3 anos de idade necessita de uma transfusão sangüínea. Os exames laboratoriais por hemaglutinação dão os seguintes resultados:

b) seus eritrócitos não contêm anticorpos anti-A e anti-B. c) seu plasma não contém antígenos A e B. d) seus eritrócitos não contêm antígenos A e B. e) seu sangue não contém antígenos nem anticorpos. Questão 724 A herança dos tipos sangüíneos do sistema ABO constitui um exemplo de alelos múltiplos (polialelia) na espécie humana. Com relação ao sistema ABO é CORRETO afirmar que: (01) o tipo O é muito freqüente e, por este motivo, o alelo responsável por sua expressão é dominante sobre os demais. (02) os indivíduos classificam-se em um dos quatro genótipos possíveis: grupo A, grupo B, grupo AB e grupo O. (04) existem três alelos: o IÞ, o Iß e o i. (08) os alelos IÞ e Iß são codominantes. (16) se um indivíduo do grupo A for heterozigoto, ele produzirá gametas portadores de IÞ ou de i. (32) os indivíduos de tipo sangüíneo O possuem aglutinogênios em suas hemácias, porém não possuem aglutininas no plasma. (64) em alguns cruzamentos, entre indivíduos do grupo A com indivíduos do grupo B, é possível nascerem indivíduos do grupo O. Questão 725 Em relação ao sistema sangüíneo ABO, um garoto, ao se submeter ao exame sorológico, revelou ausência de aglutininas. Seus pais apresentaram grupos sangüíneos diferentes e cada um apresentou apenas uma aglutinina. Os prováveis genótipos dos pais do menino são a) Ißi - ii. b) IÞi - ii. c) IÞIß - IÞi. d) IÞIß - IÞIÞ. e) IÞi - Ißi.

1.5.3.1

Em face dos dados apresentados, assinale a alternativa correta. a) Joana não pode ser filha natural de Júlia. b) Joana não pode receber sangue O Rh-. c) Jorge não pode ser o pai natural de Joana. d) Joana pode receber sangue AB Rh-. e) Joana pode ser homozigota para B. Questão 723 Em uma transfusão sangüínea, indivíduos do grupo O são considerados doadores universais porque a) seu plasma não contém anticorpos anti-A e anti-B.

163

Questão 726 Para os grupos sangüíneos do sistema ABO, existem três alelos comuns na população humana. Dois (alelos A e B) são co-dominantes entre si e o outro (alelo O) é recessivo em relação aos outros dois. De acordo com essas informações, pode(m)-se afirmar: I. Se os pais são do grupo sangüíneo O, os filhos também serão do grupo sangüíneo O. II. Se um dos pais é do grupo sangüíneo A e o outro é do grupo sangüíneo B, todos os filhos serão do grupo sangüíneo AB. III. Se os pais são do grupo sangüíneo A, os filhos poderão ser do grupo sangüíneo A ou O. Está(ão) correta(s) a) apenas I. b) apenas II. c) apenas III. d) apenas I e III. e) I, II e III. Questão 727 Observe a genealogia.

ara o casal (5 e 6) que pretende ter muitos filhos, foram feitas as quatro afirmações a seguir. I - O casal só terá filhos AB e Rh positivo. II - Para o sistema ABO, o casal poderá ter filhos que não poderão doar sangue para qualquer um dos pais. III - O casal poderá ter filhos Rh positivo, que terão suas hemácias lisadas por anticorpos anti-Rh produzidos durante a gravidez da mãe. IV - Se for considerado apenas o sistema Rh, o pai poderá doar sangue a qualquer um de seus filhos. São corretas, apenas, as afirmações a) II e IV b) I, II e IV c) II, III e IV d) I, II e III. e) I e III. Questão 728 Em um acidente de carro, três jovens sofreram graves ferimentos e foram levados a um hospital, onde foi constatada a necessidade de transfusão de sangue devido a forte hemorragia nos três acidentados. O hospital possuía em seu estoque 1 litro de sangue do tipo AB, 4 litros do tipo B, 6 litros do tipo A e 10 litros do tipo O. Ao se fazer a tipagem sangüínea dos jovens, verificou-se que o sangue de Carlos era do tipo O, o de Roberto do tipo AB e o de Marcos do tipo A. Considerando apenas o sistema ABO, os jovens para os quais havia maior e menor disponibilidade de sangue em estoque eram, respectivamente, a) Carlos e Marcos. b) Marcos e Roberto. c) Marcos e Carlos. d) Roberto e Carlos. e) Roberto e Marcos. Questão 729 Considerando o casamento entre um homem tipo sangüíneo A®, cujo pai era O−, com uma mulher B® cuja mãe era A−, assinale a(s) alternativa(s) correta(s). (01) A probabilidade de nascer 1 filha mulher B® é 3/16. (02) A probabilidade de nascer 1 filho homem O− é nula. (04) A probabilidade de nascer 1 filho homem e 1 filha mulher AB é 9/1024.
164

1.5.3.1

(08) A probabilidade de nascer filho homem AB− é 1/16. (16) A probabilidade de nascer 1 filho homem A® é 1/8. (32) A probabilidade de nascer 2 filhas mulheres A− é 1/1024. Questão 730 Uma mulher Rh− casou-se e teve um filho. Numa segunda gestação a criança apresentou um quadro de eritroblastose fetal. Com estes dados, indique qual a opção que apresenta o fenótipo para o fator Rh da mãe, do pai e da criança, respectivamente. a) Mãe Rh negativo, Pai Rh positivo e Criança Rh positivo. b) Mãe Rh positivo, Pai Rh positivo e Criança Rh negativo. c) Mãe Rh positiva, Pai Rh negativo e Criança Rh negativa. d) Mãe Rh positivo, Pai Rh negativo e Criança Rh positivo. e) Mãe Rh negativo, Pai Rh positivo e Criança Rh negativo. Questão 731 A observação do esquema a seguir, que representa a genealogia de uma família em relação aos grupos sanguíneos MN, nos permite afirmar que:

a) Rh positivo e Rh negativo. b) Rh negativo e Rh positivo. c) Rh positivo e Rh positivo. d) Rh negativo e Rh negativo. e) Rh positivo e Rh neutro. Questão 733 A doença hemolítica do recém-nascido é um problema causado pela incompatibilidade sangüínea entre mãe e feto. Assinale a alternativa que contém a família na qual é possível a ocorrência da citada doença. a) Mãe: Pai: 1Ž bebê: 2Ž bebê: b) Mãe: Pai: 1Ž bebê: 2Ž bebê: c) Mãe: Pai: 1Ž bebê: 2Ž bebê: IÞi Ißi IÞIß Ißi IÞIÞ IßIß IÞIß IÞIß ii ii ii ii rh Rh Rh Rh rh rh rh rh

Rh rh rh rh Rh rh rh rh rh rh rh rh Rh Rh Rh Rh rh Rh rh rh rh rh rh rh rh rh rh rh rh rh rh rh

1.5.3.2

d) Mãe: ii Pai: Ißi 1Ž bebê: Ißi 2Ž bebê: ii e) Mãe: IÞi Pai: ii 1Ž bebê: IÞi 2Ž bebê: ii Questão 734

a) sangue MN é característica determinada por gene dominante. b) os indivíduos 4 e 5 são heterozigotos. c) o casal 3 e 4 poderá ter filhos dos três tipos de grupos sanguíneos. d) se o indivíduo 5 casar-se com uma mulher de sangue N, todos os filhos serão heterozigotos. e) um próximo filho do casal 6 e 7 poderá ser do grupo N. Questão 732 Quanto ao surgimento da eritroblastose fetal, ou doença hemolítica do recém-nascido, podemos afirmar que ela ocorre quando o pai e a mãe respectivamente apresentam:

Paula, portadora do aglutinogênio B e Rh negativo casou-se com João, portador dos aglutinogênios A e B e Rh positivo. Sabendo-se que a mãe de Paula não possui aglutinogênios e que João teve um irmão com doença hemolítica do recém nascido, conclui-se que a probabilidade de o casal ter um filho Rh positivo e sangue tipo A é: a) 9/16
165

d) Pedro e João. III . b) despreocupado. o mesmo ficou: a) despreocupado e não fez qualquer recomendação relativa ao fato. b) o pai possui genótipo IÞIß. inclusive pela informação de 166 .Essa mulher poderá dar à luz uma criança com eritroblastose fetal. não fez qualquer recomendação. 1. tanto da mãe quanto do pai. Ambos possuem o mesmo grupo sangüíneo. que tem Rh−. bem como todos os filhos Rh− não serão atingidos pela doença e esta só atinge uma pequena fração de casos em outras gestações de filhos Rh®. não serão atingidos pela Eritroblastose fetal. recomendando que. Questão 738 O quadro abaixo mostra os resultados das tipagens ABO e Rh de um casal e de seu filho. c) é incorreta. pois o primeiro filho em geral não tem a anemia. Questão 737 Uma criança tem genótipo igual ao pai. d) se somente I e III estiverem corretas. disse que esse procedimento não seria mais necessário.3. pois todos os filhos desse casal serão abortados. c) a mãe pode pertencer ao tipo sangüíneo O. O sinal + indica reação positiva e o sinal . II . Quais dos quatro irmãos podem vir a ter filhos com eritroblastose fetal? a) Marina e Pedro.b) 3/16 c) 1/4 d) 1/8 e) 1/2 Questão 735 Lúcia e João são do tipo sangüíneo Rh positivo e seus irmãos. Numa segunda gravidez.indica reação negativa. Fazendo um exame pré-natal e relatando esse fato ao médico. e) João e Marina.5. Pedro e Marina. que é receptor universal e teve eritroblastose fetal. b) se somente II estiver correta. d) essa criança é certamente heterozigota para o fator Rh.O genótipo do pai pode ser IÞIÞRR. mesmo no caso de glóbulos vermelhos atingirem a circulação materna em sucessivas gestações. Então é INCORRETO afirmar que: a) a mãe é certamente Rh−. d) bastante preocupado. Carlos.Em caso de transfusão sangüínea. c) se somente I estiver correta.2 onsidere as seguintes afirmações: I . Questão 736 A afirmação que uma mulher Rh− não deve casar-se com um homem Rh®: a) é correta. e) a mãe pode ter genótipo IÞi. a mãe recebesse soro anti-Rh. pois não existe influência do fator Rh positivo ou negativo nos casos de Eritroblastose fetal. mesmo sendo Rh®. Assinale: a) se somente III estiver correta. c) preocupado. c) Lúcia e Marina. e) é incorreta. a criança poderá receber sangue. são do tipo Rh negativo. d) é incorreta. logo após o parto. casou-se com Elaine. pois todos os filhos desse casal terão uma doença grave fetal caracterizada por uma anemia profunda (Eritroblastose fetal). Questão 739 Indivíduos sem antígeno Rh nas hemácias são considerados recessivos. e) se somente II e III estiverem corretas. que tem Rh® e é homozigoto. b) é correta. apenas solicitando ao casal que o procurasse no momento da segunda gestação. pois filhos Rh®. entretanto. b) Lúcia e João.

b) Após a 1 gravidez. dizendo ao casal que a gravidez era de altíssimo risco e eles não poderiam mais ter outro filho.Rh−. PAI . após o contato com o antígeno Rh®. com ocorrência de eritroblastose fetal. logo após o parto da 1 gravidez.Rh− c) MÃE. PAI . b) negativo. PAI . Questão 742 Uma mulher com sangue do tipo A / Rh® / MM é casada com um homem com tipo sangüíneo B / Rh® / NN.5. positivo. Assinale a alternativa do quadro abaixo que identifica corretamente os grupos sangüíneos dessa família. respectivamente: a) negativo. positivo.Rh® b) MÃE. de maneira que. e) positivo. a) MÃE. os antígenos fetais não serão capazes de induzir a produção de anticorpos anti-Rh pela mãe. d) positivo. cuja mãe é Rh−. a DHR poderia ser evitada. a mãe recebesse anticorpos anti-Rh.2 a) A placenta normalmente funciona como uma barreira que separa as células sangüíneas fetais e maternas. assinale a afirmativa INCORRETA. A probabilidade desse casal vir a ter uma criança Rh− é de a) 100% b) 75% c) 50% d) 25% e) 0% Questão 744 Um casal teve uma criança com eritroblastose fetal. é: a) 1 b) 1/2 c) 1/3 d) 1/4 e) 1/8 Questão 741 Interpretando a figura a seguir sobre a Doença Hemolítica do recém-nascido (DHR).Rh−. a mãe produz anticorpos anti-Rh que podem ser transferidos para a corrente sangüínea fetal.Rh®. recomendando bastante atenção em cada gravidez.Rh−. CRIANÇA . CRIANÇA . é casada com um homem Rh®. Considerando apenas o fator Rh. CRIANÇA .Rh−. a mãe receba o soro anti-Rh. negativo.Rh−.Rh®. negativo. c) negativo.Rh®. o do seu marido e o da criança são. podemos dizer que seu fator Rh. positivo. d) Se.Rh® d) MÃE. PAI . PAI .Rh®.Rh® 1. cujo pai é Rh−. negativo. c) Em III. Questão 745 A incompatibilidade materno-fetal ao antígeno Rh pode determinar um doença denominada Eritroblastose Fetal. após cada parto. e) bastante preocupado.Rh−.compatibilidade de grupo sangüíneo. CRIANÇA .Rh− e) MÃE. Se uma mulher foi orientada a usar a vacina anti-Rh logo após o nascimento do primeiro filho. 167 . positivo. positivo. CRIANÇA . a probabilidade de esse casal vir a ter um filho do sexo masculino. negativo. Qual das alternativas abaixo indica o tipo sangüíneo de uma criança que NÃO poderia ter sido gerada por este casal? a) A / Rh® / NN b) A / Rh− / MN c) AB / Rh− / MN d) O / Rh® / MN e) O / Rh− / MN Questão 743 Uma mulher Rh®.3. Questão 740 Um casal possui o seguinte genótipo para o fator Rh: Pai = Rr. negativo. Mãe = rr.

nenhum dos filhos será b) heterozigoto.. b) em X.. Questão 749 Assinale a alternativa que completa corretamente as lacunas no texto a seguir. assinale a alternativa CORRETA: a) A mãe é Rh positivo.. analise os genótipos descritos. homozigota recessiva e seu marido é Rh®. e assinale abaixo a alternativa que indica.5.do 1Ž filho. o qual teve eritroblastose fetal.3.. é correto concluir que..2 ela observação dos gráficos e considerando que essa mulher teve um filho em cada gestação e nunca recebeu transfusão de sangue... a mãe transferiu anticorpos anti-Rh para o 2Ž filho Rh+.. respectivamente.2 Questão 748 Os dois gráficos a seguir representam as quantidades de anticorpos anti-Rh presentes no sangue de uma mulher (Rh-) em gestações distintas.Questão 746 A eritroblastose fetal é uma doença hemolítica adquirida apresentada por alguns recém-nascidos. metade dos filhos será Questão 750 Após uma primeira gravidez bem sucedida. a) homozigoto. o filho é Rh−.. sendo observado. exclusivamente: a) quando a mãe é Rh® e o filho Rh−. e) independente do Rh materno. o feto apresentou o quadro de hemólise de hemácias. d) quando a mãe é Rh® e o pai Rh−. 1. Questão 747 No segundo parto de uma mulher. a mãe foi sensibilizada com o fator Rh. .3.. a mãe transferiu anticorpos anti-Rh para o 1Ž filho Rh-.. nenhum dos filhos será e) homozigoto. Se ele for . .. esse conhecido por doença hemolítica do recém-nascido (DHRN) ou eritroblastose fetal.. c) quando a mãe é Rh− e o pai Rh®.. 168 1.. a) em X. em consulta médica. c) em Y. todos os filhos serão d) heterozigoto.. b) Os abortados certamente eram Rh negativo.. o qual não teve eritroblastose fetal.... uma mãe abortou três vezes. Isto só acontecerá quando houver passagem do sangue do embrião para a circulação materna.. a mãe foi sensibilizada com o sangue Rh+ do 2Ž filho. d) em Y. Uma mulher é do tipo sangüíneo Rh−.. o qual não teve eritroblastose fetal. Rh®. icterícia e aumento do baço e fígado. e teve seu primeiro filho sem qualquer anormalidade.. c) Este casal jamais poderá ter outros filhos... Considerando o fato de que essa mulher não foi submetida à transfusão de sangue em toda a sua vida anterior. como eritroblastose fetal.. b) quando a mãe é Rh− e o filho Rh®. Esta condição é provocada por incompatibilidade sangüínea do fator Rh. além da anemia. Em relação à patologia observada nesta família. o qual teve eritroblastose fetal... A mãe reconhecerá os glóbulos vermelhos do embrião como estranhos e produzirá anticorpos anti-Rh... Seu caso foi diagnosticado. do primeiro filho e do segundo filho. no quadro apresentado... os genótipos da mãe.5. todos os filhos serão c) homozigoto..

o casal decide ter um "bebê de proveta" e contrata uma "mãe de aluguel" para receber em seu útero o zigoto formado por aquele casal.5. pois a "mãe de aluguel" é Rh®. 13 e 5 litros. e) alta. 5. com absoluta certeza. casa-se com um homem Rh−. 8 e 16 litros.3 (s) seta(s) cujo sentido (doação ë recepção) está(ão) errado(s) é(são): a) 4 e 5 b) 2 c) 1 d) 3 Questão 755 Em um banco de sangue de um hospital. 8. A probabilidade de o "bebê de proveta" nascer com a doença hemolítica do recém-nascido é: a) mínima. já que o "bebê de proveta". 5 e 8 litros. e o resultado foi o seguinte: 169 . b) mínima. será Rh®.3. 3.3 Questão 754 Observe o diagrama geral das possíveis trocas sangüíneas por doação e recepção no sistema "ABO": 1. respectivamente: a) 2. b) 2. e) 2. e) O pai é Rh positivo. O que o casal não sabia é que a "mãe de aluguel" tivera três filhos. d) 2.3.d) A criança é Rh negativo. 10 e 18 litros. c) 18. c) alta. 5. e. Impedida de ter filhos. visto que a doença hemolítica do recém-nascido só ocorre quando a mãe é Rh− e o pai Rh®. o livro onde estavam registrados os códigos foi perdido. 3 litros de tipo A. Para que os frascos contendo sangue fossem identificados. 1. por acidente. Rh® homozigota. sendo que o último apresentara a doença hemolítica do recém-nascido. A. visto que seu pai é Rh−. Para transfusões em indivíduos O.5. 18 e 10 litros. Questão 752 Um banco de sangue possui 5 litros de sangue tipo AB. as etiquetas que identificavam os tipos sangüíneos estavam em código. d) nula. foram feitos testes com amostras correspondentes a cada código. 8 litros B e 2 litros O. visto que sua mãe genética é Rh®. B e AB estão disponíveis. Questão 753 Assinale a alternativa que esquematiza as transfusões que podem ser feitas entre indivíduos com diferentes grupos sanguíneos do sistema ABO (as setas indicam o sentido das transfusões). Questão 751 Uma mulher com útero infantil. 3.

I. porque as hemácias AB não possuem antígenos que possam interagir com anticorpos anti-A presentes no sangue do receptor. III e IV. o sangue do receptor não possui anticorpos contra eles. separada e respectivamente. d) 13 litros. No banco de sangue do hospital. do total acima mencionado: a) 4 litros. pois os anticorpos anti-B presentes no sangue do receptor podem reagir com os antígenos B presentes nas hemácias AB. Questão 758 aseados nesse teste. Questão 760 O soro sangüíneo de um indivíduo do grupo O foi colocado em quatro tubos de ensaio. Se houver A transfusão de sangue do tipo B para uma pessoa do grupo A. c) 12 litros. hemácias de indivíduos dos grupos sangüíneos AB. d) não deve ser realizada. d) nenhuma reação. Questão 759 Um homem sofreu um acidente e precisou de transfusão sangüínea. c) formação de anticorpos anti-A e anti-B pelo receptor. verificou-se a presença de anticorpos anti-A e ausência de anti-B. Analisado o seu sangue. e) reação de anticorpos anti-B do doador com antígenos A do receptor. estarão disponíveis para ele. podemos afirmar que a) existem 105 litros de sangue disponíveis para um receptor AB Rh® b) existem 135 litros de sangue disponíveis para um receptor AB Rh− c) existem 105 litros de sangue disponíveis para um receptor A Rh® d) existem 135 litros de sangue disponíveis para um receptor O Rh® e) existem 25 litros de sangue disponíveis para um receptor O Rh− Questão 756 A transfusão de sangue tipo AB para uma pessoa com sangue tipo B a) pode ser realizada sem problema. 7 litros de sangue tipo A. pois os anticorpos anti-A presentes no sangue do receptor podem reagir com os antígenos A presentes nas hemácias AB. apesar de as hemácias AB apresentarem antígeno A e antígeno B. Questão 757 Um determinado banco de sangue possui 4 litros de sangue tipo AB. e) apenas da bolsa 2. Rh®. b) pode ser realizada sem problema. a opção que corresponde à condição de aglutinação (+) ou não aglutinação (-) de hemácias resultante de reação antígeno-anticorpo: 170 . todos Rh®.5. B e O. b) apenas da bolsa 3. c) pode ser realizada sem problema. Marque. Esse homem pode receber sangue: a) apenas da bolsa 1. e) 21 litros. na alternativa a seguir. 1 litro de sangue tipo B e 9 litros de sangue tipo O. b) reação dos antígenos B do receptor com os anticorpos anti-B do doador. resultaria em a) reação de anticorpos anti-B do receptor com os glóbulos vermelhos do doador. e) não deve ser realizada.3. b) 8 litros. havia três bolsas disponíveis. sendo que o sangue da bolsa 1 apresentava todos os tipos de antígenos do sistema ABO. o sangue da bolsa 2 possuía anticorpos anti-A e anti-B e a bolsa 3 possuía sangue com antígenos somente do tipo B. d) da bolsa 1 ou da bolsa 2.1. porque. II. aos quais foram adicionadas. porque A é receptor universal.3 necessidade de transfusões sanguíneas para um indivíduo com sangue tipo AB. c) da bolsa 2 ou da bolsa 3. porque as hemácias AB não possuem antígenos que possam interagir com anticorpos anti-B presentes no sangue do receptor. A.

A partir dos resultados observados. em seguida. Tubo II (+).3. para a determinação da tipagem sangüínea dos sistemas ABO e Rh. o sinal . há quatro indivíduos que se ofereceram para doar sangue. respectivamente. Foram obtidas reações com a aplicação dos reagentes anti-A. Os resultados obtidos foram: 1. Tubo II (+).4 om base no quadro. poderão doar sangue ao referido homem. Sabe-se que ele pertence ao grupo sangüíneo A e que.5. exames de sangue para a determinação da tipagem sangüínea dos Sistemas ABO e Rh. conclui-se que são classificados.a) Tubo I (-).5. Tubo III (-) e Tubo IV (+). e) Tubo I (-). Tubo III (-) e Tubo IV (+).3. os indivíduos: a) I e II b) I e III c) II e III d) II e IV e) III e IV Questão 763 1. em cinco indivíduos. c) Tubo I (+). Tubo II (+). como receptor e doador universal: a) 4 e 2 b) 4 e 3 c) 1 e 5 d) 2 e 4 e) 5 e 1 Questão 762 Em um hospital há um homem necessitando de uma transfusão de emergência. Os resultados são apresentados a seguir: Um laboratorista realizou exames de sangue em cinco indivíduos e analisou as reações obtidas com os reagentes anti-A. 1. Tubo II (-). Tubo III (+) e Tubo IV (-). Questão 761 Num laboratório foram realizados. Tubo II (-). anti-B. misturadas aos soros anti-A e anti-B. Tubo III (-) e Tubo IV (+). que. anti-B e anti-Rh. b) Tubo I (-).4 bservação: o sinal + significa aglutinação de hemácias. anti-Rh.3.4 171 . no hospital. foram. Foi realizada a determinação de grupos sangüíneos do sistema ABO dos quatro indivíduos. Tubo III (+) e Tubo IV (-).5. Os resultados obtidos encontram-se no quadro seguinte.significa ausência de aglutinação. com a utilização de duas gotas de sangue de cada um deles. d) Tubo I (+). colocadas em uma lâmina.

b) poligens. Rh®/ B. d) 2 e 5. Rh−/ A. Rh−/ O. Os genótipos das plantas cruzadas são. 1. d) interação gênica. Rh®/ AB. Rh®/ A. Rh−/AB. A presença de ambos simultaneamente produz flor púrpura.Com base nesses resultados. c) Ddee. mantendo a seqüência disposta na tabela. Rh® Questão 765 O esquema a seguir evidencia que a formação de melanina não depende apenas da ação de um gen. c) norma de reação. Um homem surdo. Rh®/ B. c) 3 e 4. Rh−/ AB. Rh−/ B. e) DDEE. b) DdEe. assinale a alternativa que indica os grupos sangüíneos de todas as pessoas quanto aos sistemas ABO e Rh.Rh®/ A. e) 1 e 4. depende da homozigose de apenas um dos dois genes recessivos. e) alelos múltiplos.5. Rh− d) AB.Rh®/ O.Rh− b) O. No processo ali representado. Rh−/ B. a) 5 e 2. todos de audição normal. Rh®/ A. na proporção de 3 brancas: 1 colorida. Rh® c) AB. A presença do gene C ou P ou ausência de ambos produz flor branca. Rh−/ AB. casou-se com uma surda. Tiveram 9 filhos. Rh−/ B. simultaneamente. . Rh®/ O. Rh®/ AB. receptor e doador universal. Após analisar a tabela. Rh−/ A. O sinal positivo (+) significa "aglutina" e o sinal negativo (-) significa "não aglutina".1 ituações como essa são conhecidas como: a) polialelia. respectivamente: a) CCpp x ccPP b) CCpp x ccPp c) Ccpp x ccPP d) Ccpp x ccPp 172 1.4. Rh®/ O. podemos concluir que o genótipo dos filhos é: a) ddEE. d) DDee. Questão 766 A surdez pode ser uma doença hereditária ou adquirida. Rh−/ B. está ocorrendo a ação conjunta de dois gens. Assim. Questão 767 Na ervilha-de-cheiro existem dois pares de genes que condicionam a cor da flor (Cc e Pp). Cruzando-se duas plantas de flores brancas. Quando hereditária. Rh®/ B. Questão 764 A tabela a seguir foi elaborada a partir de testes para determinação dos grupos sangüíneos de seis pessoas de uma academia de ginástica.3. Rh−/ A. Rh® e) AB. obtém-se em F plantas produtoras de flores coloridas. b) 4 e 3. (d) ou (e). A audição normal depende da presença de pelo menos dois genes dominantes diferentes (D) e (E).4 a) O. indique quais os indivíduos que serão considerados.5. respectivamente. Rh−/ O. Rh®/ A. Rh−/ A.

EXCETO a) AABB b) AaBB c) Aabb d) AaBb e) AABb Questão 772 Os indivíduos albinos não possuem melanina . ocorrem flores vermelhas somente se a planta possuir os alelos dominantes A e B.5. b) 1/2.5.4. na espécie humana. são muito sensíveis à luz solar. Cruzando-se plantas de flores vermelhas com plantas de flores brancas. como a surdez hereditária. A tabela abaixo indica os fenótipos existentes. respectivamente. está representada parte da via biossintética para a produção desse pigmento: 173 .e. Os genótipos das plantas com flores vermelhas e brancas da geração parental são. obtiveram-se 3 plantas de folhas vermelhas para 5 plantas de flores brancas na geração F. o fenômeno da interação gênica consiste no fato de: a) uma característica provocada pelo ambiente. d) dois pares de genes estarem no mesmo par de cromossomos homólogos. d) 3/16. como surdez por infecção.4. a) AABB e AaBb b) AaBb e Aabb c) AABb e aabb d) aaBb e Aabb e) aabb e aabb Questão 771 1. imitar uma característica genética. Questão 769 Em genética. Questão 770 Em determinada espécie vegetal. Neste esquema. a pigmentação da pele seja devida a dois pares de genes autossômicos com efeito aditivo. b) vários pares de genes não alelos influenciarem na determinação de uma mesma característica. Nesse caso. c) um único gene ter efeito simultâneo sobre várias características do organismo. 1.1 odas as alternativas contêm genótipos possíveis para os porquinhos vermelhos de F2.pigmento responsável pela cor e proteção da pele . Um casal de mulatos médios diíbridos tem uma criança albina. c) 1/5.e) CcPp x CcPp Questão 768 Suponha que. por isso.1 expressão desses genes pode ser impedida pela presença de um par de genes autossômicos recessivos. A probabilidade de nascer uma criança branca não albina é de: a) 1/16. Observe a figura. e) dois cromossomos se unirem para formar um gameta. o indivíduo é albino. e) 3/64.

a partir de um casal genotipicamente igual ao mostrado na F1. a cor da plumagem é determinada por 2 pares de genes. b) herança quantitativa. Questão 773 Em uma exaustiva análise de genealogias humanas. c) ee bb. Questão 775 1.56. dois genes. ( ) Cinco distintas classes genotípicas são observadas entre os descendentes surdos citados. e) epistasia dominante. cujos progenitores eram surdos. Com esses dados. 174 . é de aproximadamente de 0. marrons e dourados. b) Ee Bb. enquanto seu alelo i não interfere nessa expressão. analise as proposições com verdadeiro ou falso. d) indivíduos AABB formam gametas do tipo AA e BB.5. ( ) A probabilidade do nascimento de uma criança normal para a audição. condicionam as três pelagens típicas da raça: preta. foi observado que a distribuição fenotípica para normais e surdos obedecia a uma proporção de 9:7. e) ee Bb. ( ) A surdez congênita é determinada por alelos múltiplos em um loco autossômico. respectivamente. O gene I impede a expressão do gene C. O cruzamento de um macho dourado com uma fêmea marrom produziu descendentes pretos. O genótipo do macho é a) Ee BB. é INCORRETO afirmar que a) a ausência da Enzima 1 resulta em um aumento da concentração de tirosina. marrom e dourada.1 om base nesse esquema e em outros conhecimentos sobre o assunto.5. A pelagem dourada é condicionada pela presença do alelo recessivo e em homozigose no genótipo. O gene C condiciona plumagem colorida enquanto seu alelo c determina plumagem branca. se forem homozigóticos bb. com relação à surdez congênita na descendência de pais normais para a audição. cada um com dois alelos (B/b e E/e). c) diferentes genótipos podem dar origem ao albinismo.1 Em galinhas. b) casamentos entre indivíduos albinos podem gerar descendentes com melanina.4. como ilustrado no quadro a seguir.1. Considerando esses dados. c) pleiotropia. conclui-se que se trata de um caso de: a) epistasia recessiva. ou marrons. ( ) Interação gênica entre dois locos justificam esses dados.4. d) ee BB. Os cães portadores de pelo menos um alelo dominante E serão pretos. se tiverem pelo menos um alelo dominante B. ( ) Na determinação da característica analisada atuam locos gênicos ligados que distam entre si em 16 unidades de mapa. Questão 774 Em cães labradores. d) codominância.

1.4.2 om base nos resultados. produzem quatro tipos de gametas para o caráter em estudo. preta ou albina. 1. d) A fecundação cruzada das plantas com flores brancas de F‚ produzirá sempre o mesmo fenótipo. que se reproduz por autopolinização (em F).5. somente. os descendentes são todos aguti. c) I e II.2 175 .Quando animais pretos homozigóticos são cruzados com certos albinos também homozigóticos.5. O caráter em estudo é a cor das flores.Questão 776 Nos camundongos. somente.2 1.5. somente. om base na figura foram feitas as seguintes afirmações: I . II e III. a cor da pelagem é determinada por um tipo de interação gênica epistática de acordo com o esquema a seguir. d) II e III.4. III . Pode-se considerar correto o que é afirmado em a) I. é correto afirmar. b) III.4. II . Questão 777 O esquema abaixo representa o cruzamento artificial (em P) de duas variedades puras de um determinado vegetal.A formação de qualquer pigmento no pêlo depende da presença do alelo P. somente.Trata-se de um caso de interação gênica do tipo epistasia recessiva. Questão 778 Em cães da raça Labrador Retriever. c) Os indivíduos de F. EXCETO: a) Trata-se de um caráter determinado por interação gênica. b) Os duplos heterozigotos apresentam flores coloridas. a pelagem pode ser aguti. A figura a seguir mostra as reações bioquímicas envolvidas na síntese de pigmentos. e) I.

Questão 779 Em camundongos. espera-se que 25% dos descendentes apresentem pelagem chocolate. III e IV apenas. o alelo dominante A determina cor vermelha e o recessivo a. Do cruzamento de um camundongo preto com um albino. vários pares de genes não-alelos influem na determinação de uma característica.Sabendo que o cruzamento (geração Parental) entre um macho com fenótipo chocolate e uma fêmea de fenótipo amarela gera apenas filhotes com pelagem preta (geração F1). em cebolas cc. apresenta o alelo B. III. O gene A determina coloração aguti e é dominante sobre seu alelo a. ao invés de determinar uma característica. (16) Durante o desenvolvimento do organismo. IV. No cruzamento entre os filhotes de F1. não se espera a produção de descendentes com fenótipo chocolate. d) I. que condiciona coloração preta. São afirmações CORRETAS: a) I. herdado de forma independente. espera-se que 50% dos descendentes apresentem pelagem amarela. II e III apenas. Outro gene. II. e) 16/16 de cebolas brancas. a coloração da pelagem é determinada por dois pares de genes. que impede a manifestação de gene C. Aa e Cc. c) 13/16 de cebolas brancas e 3/16 de cebolas coloridas. impede a manifestação de outro gene. com segregação independente. a presença de um alelo dominante C determina a produção de bulbo pigmentado. completando seus efeitos. d) 15/16 de cebolas brancas e 1/16 de cebolas coloridas. III e IV apenas. II. b) 12/16 de cebolas brancas e 4/16 de cebolas coloridas. No cruzamento da fêmea parental com qualquer cão de pelagem preta. Questão 782 Na cebola. a enzima que catalisa a formação de pigmento não é produzida (cebolas brancas). cor amarela. (01) Ocorre poligenia quando dois genes não-alelos colaboram na mesma característica. foram obtidos apenas descendentes agutis. Quais as proporções fenotípicas esperadas do cruzamento de cebolas homozigotas coloridas com BBcc? a) 9/16 de cebolas brancas e 7/16 de cebolas coloridas. Uma proporção de 2 incolores: 1 vermelho: 1 amarelo é esperada entre os descendentes do cruzamento a) IIAA x IiAa b) IiAA x iiAa c) IIaa x ii aa d) IiAa x IiAa e) IiAa x iiaa Questão 781 Sobre interação gênica. b) II. enquanto os pais são homozigotos para os dois pares de genes. um criador fez as seguintes afirmações: I. complementando seus efeitos e produzindo um fenótipo igual aos fenótipos produzidos por cada gene isoladamente. (04) Ocorre poligenia quando um gene tem efeito simultâneo sobre várias características do organismo. dois pares de genes que apresentam segregação independente participam na determinação da cor do bulbo: o alelo dominante I impede a manifestação de cor e o recessivo i permite a expressão. Qual é o genótipo desse casal? a) aaCC x aacc b) Aacc x aaCc c) aaCc x AAcc d) AaCc x AaCc e) aaCC x AAcc Questão 780 Em cebolas. que inibe a formação de pigmentos dando origem a indivíduos albinos. não-alelo. III e IV. 176 . c) I. (08) Ocorre epistasia quando um gene. (02) Dois genes não-alelos colaboram na mesma característica. Homozigotos bb não têm a manifestação da cor do bulbo impedida. No cruzamento da fêmea amarela com um de seus filhotes de F1. Todos os filhotes produzidos nesse cruzamento são heterozigotos. assinale o que for correto. O gene C determina a produção de pigmentos e é dominante sobre seu alelo c.

um segundo lócus afeta uma etapa inicial na formação dos pigmentos dos pêlos.4. Essas transformações são catalisadas por diferentes enzimas.Questão 783 A cor da pelagem em cavalos depende. fazendo com que o pêlo fique branco. Questão 786 Em uma espécie animal. (3) Um casal de indivíduos albinos pode ter filhos com pigmentação normal. análise desses cariótipos revela que. e) aaBB. ambos com genótipo AaBb. b) Aabbe aabb. O gene dominante W "inibe" a manifestação da cor. dentre outros fatores. (2) Indivíduos albinos podem apresentar homozigose recessiva bb e cc. d) AABBe Aabb. atuam três mRNAs. Considerando os descendentes do cruzamento de dois ratos.5. respectivamente: a) XY e XX b) YO e XX c) XO e XX d) XY e XO e) XO e XY 177 . enquanto que o alelo recessivo w permite a manifestação da cor. cujo 2n = 6. a determinação do sexo é feita por um sistema. c) AAbbe aabb. (1) Na produção de melanina a partir de fenilalanina. mas o genótipo aa bloqueia toda a produção de pigmentos e o rato torna-se albino. nessa espécie. AaBBe aabb. Questão 785 Epistasia é o fenômeno em que um gene (chamado epistático) inibe a ação de outro que não é seu alelo (chamado hipostático). enquanto o genótipo homozigoto bb define cor preta. (4) O gene B é epistático sobre o gene C. o alelo dominante B determina cor de pêlo acinzentada.1 Com base no esquema e sabendo que indivíduos incapazes de sintetizar a melanina são albinos. durante os processos metabólicos. Cruzando-se indivíduos heterozigotos para os dois pares de genes obtém-se: a) 3 brancos: 1 preto b) 9 brancos: 3 pretos: 3 mesclados de marrom e preto: 1 branco c) 1 preto: 2 brancos: 1 marrom d) 12 brancos: 3 pretos: 1 marrom e) 3 pretos: 1 branco Questão 784 As diversas substâncias ingeridas pelo homem são transformadas em outras. da ação de dois pares de genes Bb e Ww. julgue os itens seguintes.5. O esquema abaixo representa alguns passos da síntese de melanina. O gene B determina pêlos pretos e o seu alelo b determina pêlos marrons. Em ratos. os filhotes de cor preta poderão apresentar genótipos: a) Aabbe AAbb. Em outro cromossomo.5.2 1. O alelo dominante A nesse lócus possibilita o desenvolvimento normal da cor (como definido pelos genótipos B_ ou bb). o cariótipo de células somáticas de machos e fêmeas se apresenta como mostram os desenhos a seguir: 1. em que o macho e a fêmea são.

c) um cromossomo sexual. A análise cromossômica dos gêmeos indicou que o menino era normal. e) Algumas mulheres. 1. heterozigotas para a cor dos olhos. porém a menina era portadora da síndrome de Turner. 178 . b) O sexo feminino é homogamético e o gameta feminino normal sempre apresenta um cromossomo X. simultaneamente. Com base neste texto é INCORRETO afirmar: a) O sexo masculino é heterogamético e é sempre o homem quem determina o sexo dos filhos. em 1961. c) na mulher um cromossomo X está sempre condensado e recebe o nome de cromatina sexual. têm um olho azul e outro castanho. teremos: a) sexo masculino. d) A hipertricose auricular é uma característica restrita ao sexo masculino. Questão 789 O médico confirmou que se tratava de gêmeos monozigóticos. b) um cromossomo Y na gametogênese do pai das crianças.Questão 787 Na espécie humana a determinação sexual é feita por um par de cromossomos. simultaneamente." Assinale a alternativa que confirma o texto anterior. a) Algumas mulheres. d) um cromossomo X quando da divisão mitótica do zigoto. e) Toda doença hereditária e recessiva ligada ao cromossomo X só afeta as mulheres. Logo. independentemente dos genes que possuem. as células femininas ficariam iguais às masculinas. X e Y. b) caracteres sexuais desenvolvidos. "A pesquisadora inglesa Mary Lyon propôs. contudo um deles era menino e o outro menina. Mulheres heterozigotas para os genes ligados aos cromossomos X expressam o alelo dominante em algumas células e o alelo recessivo em outras. heterozigotas para o daltonismo (XD Xd).5. Tal fato deve-se à perda de a) um cromossomo X na gametogênese da mãe das crianças. são tipo A e B simultaneamente. na gametogênese do pai ou da mãe das crianças. as mulheres apresentam células geneticamente diferentes entre si.1 ntre as características que esse indivíduo passará a apresentar. pois em algumas estão ativos os genes provenientes do cromossomo X materno e em outras do cromossomo X paterno. heterozigotas para a cor do cabelo. Assim. heterozigotas para a cor da pele. a hipótese de que fêmeas de mamíferos compensariam a dose dupla de genes do cromossomo X através da inativação de um desses cromossomos. d) Algumas mulheres. c) Algumas mulheres. A inativação do cromossomo X ocorre ao acaso. b) Algumas mulheres.5. Questão 788 Leia o texto a seguir referente à Hipótese de Lyon. pois o gene está localizado no cromossomo Y. heterozigotas para os grupos sangüíneos. e) estatura elevada. têm visão normal em um dos olhos e daltonismo no outro. têm manchas brancas e pretas. d) ausência de cromatina sexual. e nos blastômeros iniciais do desenvolvimento embrionário. Questão 790 O esquema a seguir mostra a formação dos gametas responsáveis pela produção de um indivíduo com alteração do seu número cromossomial. que possuem apenas uma cópia funcional dos genes ligados ao cromossomo X. c) cariótipo normal. são loiras e castanhas. X ou Y. O indivíduo do sexo feminino apresenta dois cromossomos X enquanto que o indivíduo de sexo masculino apresenta um cromossomo X e outro cromossomo Y. e) um cromossomo Y quando da divisão mitótica do zigoto.

4 óvulos humanos. Dessas afirmações. 1. machos homozigóticos de penas barradas × fêmeas de penas pretas II.Questão 791 A análise do cariótipo de exemplares de uma dada espécie revelou que o número diplóide é idêntico em ambos os sexos e que o sexo heterogamético é o feminino.5. c) Um óvulo de ovelha deve apresentar 26 autossomos. Entre seus autossomos. Seu cromossomo Y é descendente do Y de seu avô paterno.5.F: galinha barrada. F‚: galinha preta c) I . é possível dizer que o sistema de determinação do sexo nessa espécie é do tipo a) XX : XY b) XX : XO c) XX : YO d) ZZ : ZW e) ZZ : ZO Questão 792 O carneiro ('Ovis aries') apresenta 27 cromossomos em seus gametas normais.F: galinha barrada. a) I . e) Uma célula muscular de carneiro deve apresentar 54 autossomos. b) Um linfócito de carneiro deve apresentar 54 cromossomos. a cor das penas apresenta herança ligada ao sexo. A partir desse dado.F: galinha preta. III.F: galinha barrada.F: galinha barrada. F‚: galinha preta II . geraram 4 embriões. O alelo dominante determina penas barradas e o recessivo. machos de penas pretas × fêmeas de penas barradas Assinale a alternativa que indica corretamente as gerações nas quais espera-se encontrar galinhas pretas. incluindo 2 cromossomos sexuais. está(ão) correta(s) APENAS a) I b) II c) III d) I e III e) II e III Questão 794 Em galinhas. F‚: galinha barrada II . todos igualmente viáveis.F: galinha barrada. Com base nesses dados. a) Um neurônio de carneiro deve apresentar 52 autossomos. F‚: galinha preta d) I . há descendentes de autossomos de seus avós.F: galinha barrada. F‚: galinha barrada II .1 179 . F‚: galinha barrada II . F‚: galinha barrada b) I . Seu cromossomo X é descendente de um X de sua avó paterna. Considere os seguintes cruzamentos a partir dos quais obtiveram-se as gerações F e F‚: I. II. Questão 793 Acerca da relação entre os cromossomos de um menino e os de seus avós. quando incubados com 4 suspensões de espermatozóides. penas pretas. de acordo com a tabela abaixo. d) Uma célula de carneiro que está na metáfase da mitose deve apresentar 54 cromossomos duplicados. assinale a alternativa INCORRETA com relação ao número de cromossomos encontrado em diversas células nessa espécie.F: galinha preta.F: galinha preta. além de 2 cromossomos sexuais. F‚: galinha preta II .F: galinha preta. F‚: galinha preta e) I . F‚: galinha preta Questão 795 Em uma experiência de fecundação "in vitro". fizeram-se as seguintes afirmações: I.

( ) O indivíduo hermafrodita é formado por células XX e XY. no período correspondente à prófase da mitose é. embora as fêmeas se originem de reprodução sexuada. Questão 800 Observe a figura.onsiderando a experiência descrita. Além disso. alguns se baseiam em executar a fecundação em tubo de ensaio. podemos concluir que a mosca é a) uma fêmea normal.1 180 . são: a) espermatócitos secundários diplóides portando os cromossomos X e Y. Dentre as opções abaixo. o gráfico que indica as probabilidades de os 4 embriões serem do sexo masculino é o de número: a) 1 b) 2 c) 3 d) 4 Questão 796 Considere que um óvulo de abelha possui 5×10−¢¥ g de DNA. os machos originam-se de óvulos não-fecundados. Questão 799 Alguns métodos em desenvolvimento poderão permitir aos pais a escolha do sexo de seus futuros filhos. ( ) A síndrome de Down é causada pela presença de um cromossomo X extra no cariótipo. os gametas que precisam ser necessariamente identificados e separados para uso no processo de fecundação. o ovo fertilizado no útero da mãe. d) um macho estéril. d) óvulos haplóides portando o cromossomo Y. ( ) O sexo heterogamético é o masculino. Analisando os dados do estudante. e) um intersexuado. por partenogênese.0 × 10−¢¢ d) 5. caso os pais desejem um filho do sexo feminino. ao analisar os cromossomos de 'Drosophila'. ( ) O corpúsculo de Barr ou cromatina sexual corresponde a um cromossomo X inativo.0 × 10−¢¨ Questão 797 As afirmações a seguir relacionam-se à DETERMINAÇÃO CROMOSSÔMICA DO SEXO na espécie humana.5. em mg.5 × 10−ª c) 5. encontrou a proporção de 1X : 2A (onde a letra A simboliza o conjunto haplóide de autossomos). igual a: a) 1. Nesse inseto.0 × 10−¢¡ b) 2. Questão 798 Um estudante. não observou a presença do cromossomo Y. 1. a seguir. c) espermatozóides derivados de espermátides portando o cromossomo X. b) uma fêmea aneuplóide. c) um macho normal. A quantidade de DNA encontrada em uma célula somática de zangão. Dentre eles. implantando.5. b) oócitos primários diplóides portando os cromossomos Y. ( ) O genitor do sexo feminino determina o sexo dos descendentes. e) oogônias portando o cromossomo X e espermatogônias portando o cromossomo Y.

é correto afirmar-se que a) a probabilidade do casal em F ter um descendente macho e sem mancha negra é zero.5. XYY apresentam dois testículos a mais. pode ser útil em condições de manejo de espécies em extinção. Com relação ao padrão de herança desse caráter. XXY possuem órgãos reprodutores masculinos e femininos. b) cultura de células e tecidos. d) temperaturas maiores que 28°C produzem fêmeas tanto em tartarugas quanto em lagartos.1 181 . Considerando-se essas informações e outros conhecimentos sobre o assunto. Com base nessa figura pode-se afirmar que Questão 802 A identificação do fator que origina indivíduos com síndrome de Down tornou-se possível pela utilização da técnica de a) contagem e identificação dos cromossomos. XY que. O gene SRY. 1. b) a probabilidade de uma fêmea com mancha. d) os testículos estão ausentes nos indivíduos 46. Questão 803 Nos mamíferos. e) o sexo heterogamético nessa espécie de peixes é o masculino. c) indivíduos de sexo indeterminado. é CORRETO afirmar que a) os indivíduos 46. Questão 804 A figura a seguir mostra esquematicamente o tipo de reprodução em abelhas do gênero 'Apis'. em tartarugas. ter descendentes machos sem mancha é de 50%. e) machos são produzidos em baixas temperaturas tanto para tartarugas quanto para lagartos. d) produção de DNA recombinante. na idade adulta.5.5. c) mapeamento do genoma humano. XY com deleção do gene SRY.5. a presença do cromossoma Y determina o fenótipo masculino. 1. cruzada com macho sem mancha. sofrem mutação nesse gene perdem as características sexuais. c) as fêmeas de F‚ e P sem mancha negra possuem genótipos diferentes. são produzidos em temperaturas abaixo de 28°C. sob controle de temperatura. d) o caráter mancha negra é exclusivo de indivíduos homozigotos.1 a) a determinação do sexo nesses animais é independente da localização dos ovos no ninho e da época da postura. c) os indivíduos trissômicos 47. b) os indivíduos trissômicos com cariótipo 47. induz à diferenciação dos testículos. b) a determinação do sexo.ssa figura representa a herança do caráter mancha negra numa espécie de peixes em que a determinação do sexo segue o padrão mais comum nas aves. presente nesse cromossoma. Questão 801 A figura a seguir se refere à determinação do sexo em algumas espécies de tartarugas e lagartos.

e) I e III estão corretas. a cor clara dos olhos é condicionada pelo alelo recessivo a de um determinado gene. d) a rainha e as operárias são dióicas. Essa história mostra que a) os zangões são haplóides e produzem os espermatozóides por meiose. As operárias são estéreis devido à espermatogênese nos zangões produzir. III. heterozigótica Aa. e nasceram filhas operárias.5. Questão 805 Analisando a figura adiante. b) o sexo das abelhas é determinado pelos cromossomos sexuais. uma vez que não houve a fecundação dos óvulos que os originaram. Da análise das afirmativas acima podemos assegurar que: a) apenas I está correta. é correto afirmar que se trata do cariótipo de um indivíduo: Questão 806 No reino Colméia. c) II e III estão corretas. foi inseminada artificialmente com espermatozóides de machos de olhos escuros. (64) Com uma anomalia numérica de autossomos. (02) Do sexo feminino. c) o sexo das abelhas é determinado pela ploidia do indivíduo. enquanto a cor escura é condicionada pelo alelo dominante A. 182 . As fêmeas resultam da fusão entre óvulos e espermatozóides. (32) Com cariótipo normal. b) I e II estão corretas. das quais uma seria a escolhida para ser a futura sucessora da rainha. (04) Com Síndrome de Down. Questão 807 Os machos de abelha originam-se de óvulos não fecundados e são haplóides. que representa um cariótipo humano. A rainha se casou com um belo zangão plebeu. Espera-se que a prole dessa rainha tenha a seguinte composição: 1. A produção de zangões caracteriza o processo de reprodução assexuada denominado partenogênese. havia uma rainha que tinha tido apenas filhos do sexo masculino (zangões) e precisava de uma sucessora para o trono. gametas com um número de cromossomos 4 (quatro) vezes menor. Em humanos. Soma ( ) Questão 808 Considere as afirmações: 1.5. d) apenas II está correta. e os zangões são monóicos. através da meiose. a determinação do sexo cromossômico do zigoto (XX ou XY) depende do gameta masculino que fecunda o óvulo. Os zangões podem ser considerados clones perfeitos da abelha rainha.1 I. II.1 (01) Do sexo masculino. I. Uma abelha rainha de olhos escuros.5. e são diplóides. (16) Ccom Síndrome de Edwards.5.nalise as seguintes afirmativas sobre o esquema da figura. (08) Com Síndrome de Patau. Em uma linhagem desses insetos.

c) Dois cromossomos X e blocos de cromatina sexual. Em uma célula eucariótica animal. sexual. e) Um cromossomo X apenas.5. todas as moléculas de RNA. nas células somáticas de fêmeas normais. cromossomos homólogos contêm a mesma seqüência linear de genes. Em mamíferos. d) II. de pais para filhos. 2001. é possível observar o cromossomo X que foi inativado. Qual dos pares de gametas representados a seguir poderá originar um zigoto que desenvolverá um embrião normal do sexo masculino? 1. c) II e III estão corretos. sendo exceção a essa regra os cromossomos sexuais X e Y.R. Em mamíferos. b) Três cromossomos Y. sendo que um deles é a cromatina 183 . Uma mulher normal apresentará em suas células bucais: a) Dois cromossomos X. têm sua origem no núcleo. São Paulo: Moderna. b) I. de uma célula a outra. Questão 812 A reprodução da maioria dos seres vivos envolve um processo sexual onde se alternam os fenômenos de meiose e fecundação. d) apenas I e II. e a fecundação reconstitui a diploidia. as fêmeas possuem apenas um cromossomo X e os machos. citosinas e guaninas arranjadas em diferentes combinações. e) III. II e III). e) apenas I e III.M e MARTHO. pode-se afirmar que: a) I e III estão corretos.II. II e III. d) Apenas I está correto. Toda a informação genética necessária para formar um organismo completo está contida em seqüências de timinas. Em mamíferos. IV e V.1 Adaptado de: AMABIS. pois este corresponde ao corpúsculo de Barr ou cromatina sexual. sendo que dois deles formam a cromatina sexual.5. c) apenas III. III. b) I e II estão corretos. Esse teste permite o diagnóstico citológico do sexo feminino. com exceção do RNA mitocondrial. adeninas. d) Três cromossomos X. Questão 810 Durante as Olimpíadas é comum fazer-se teste da cromatina sexual ou corpúsculo de Barr nas mulheres. Estão corretas: a) I. No homem. I. II. "Conceitos de Biologia". Questão 809 O diagrama a seguir está dividido em 3 segmentos (I. J. Questão 811 Considere as cinco afirmações seguintes. IV. sendo que um deles é a cromatina sexual. a meiose é gamética. c) II. Com relação a esses segmentos. III e IV. os quais contêm conceitos relacionados aos diferentes sistemas de determinação do sexo. III e V. em um mesmo indivíduo. dois. V. o RNA mensageiro que saiu do núcleo continha 1500 códons e a seqüência que serviu de molde para a transcrição possuía 3000 nucleotídeos. não pode ser passada. Está(ão) correta(s) a) apenas I. porém. b) apenas II. II e IV. Numa proteína com 500 aminoácidos. G. A informação genética pode ser passada de uma geração para outra. III.

184 . e) a análise radiográfica da bacia. b) o indivíduo I é obrigatoriamente homozigoto. são feitas as seguintes afirmações: I . b) O casal 5/6 formará homens hemofílicos. Feita a análise desse gráfico. ocasionalmente.características como a hemofilia. b) a contagem de hemácias cuja quantidade é maior nos homens. II .características como o daltonismo. e) O indivíduo 5 com certeza é hemofílico. por exemplo.5.5. são exemplos de cromossomos homólogos.5. c) O genótipo de 4 será XHY. Questão 814 Em relação aos cromossomos sexuais X e Y. Questão 816 Observe o esquema a seguir: 1. c) o exame radiológico dos órgãos sexuais. estão associadas a genes do cromossomo Y.2 análise do esquema permite formular as conclusões a seguir. Indique-a. III .Questão 815 1. cujo desempenho ou mesmo a aparência sugerem fraude. a) O casal 1/2 nunca formará mulheres hemofílicas.5. fazem parte do cromossomo X. há suspeitas sobre o sexo de certas atletas. por exemplo.1 1. No gráfico anterior temos representado um exemplo de doença ligada ao sexo onde apenas o indivíduo IV é afetado.5. e) os indivíduos III e V podem ser homozigotos ou heterozigotos.quando pareados.5. d) a pesquisa de hormônios sexuais femininos através de um exame de sangue. d) O genótipo de 6 será XHXH ou XHXh. d) o casal apresenta 50% de probabilidade de ter filhas afetadas.2 Questão 813 Em eventos esportivos internacionais como os Jogos Pan-americanos ou as Olimpíadas. c) o cromossoma Y paterno pode apresentar o gene para a doença. EXCETO uma. Para esclarecer tais suspeitas utiliza-se a) a identificação da cromatina sexual. podemos afirmar corretamente que: a) a anomalia é causada por um gene dominante. Estão corretas as seguintes afirmações: a) apenas I b) apenas II c) apenas III d) apenas II e III e) todas.

De acordo com o heredograma. isto é. c) Apenas as afirmações I. I . b) sendo uma herança ligada ao sexo. IV .. que é masculinizante. BLOOD AND PRACTICE OF HEMATOLOGY. e) é causada por um alelo típico do cromossoma Y.Não é possível identificar o genótipo de 2. sabendo-se que a mulher B é homozigota é de a) 1/8 b) 3/8 c) 1/2 d) 1/4 e) 3/4 1. III . Questão 818 O daltonismo é uma anomalia que apresenta um tipo de herança ligada ao sexo. d) mulheres hemofílicas morrem nos primeiros sangramentos menstruais." (Handin R. O heredograma a seguir refere-se a uma família com esta anomalia. analise as afirmações de I a IV e assinale a alternativa correta. a doença se manifesta em meninos que não tem história familiar de hemofilia. 185 .2 Questão 820 A hemofilia é uma doença genética cuja herança é ligada ao sexo.5.100% das filhas do casal 3 e 4 serão normais portadoras. e) Apenas as afirmações II e IV são verdadeiras. é suficiente nos homens apenas um alelo para que a doença se manifeste. 1955) Quando nos debruçamos sobre a hemofilia. ao passo que os homens só necessitam de um alelo.Questão 817 "Tem sido verificado que aproximadamente 25% dos casos de hemofilia A em meninos são decorrentes de mutações novas.5.2 1. Questão 819 A distrofia muscular de Duchenne é devida a um gene recessivo. II .100% dos filhos homens do casal 3 e 4 serão daltônicos.5. ligado ao cromossomo X. III e IV são verdadeiras. c) mulheres hemofílicas precisam de dois alelos dominantes. aprendemos que ela é mais comum nos homens porque: a) os homens são mais propensos à doença devido à influência do hormônio testosterona.5. a) Todas as afirmações são verdadeiras.50% das filhas do casal 3 e 4 serão normais portadoras e 50% daltônicas. d) Apenas as afirmações II e III são verdadeiras. Analise o heredograma adiante e assinale a alternativa correta. b) Apenas as afirmações I e II são verdadeiras.I. A probabilidade de A ser portador da anomalia.

João e Pedro são meio-irmãos e ambos são daltônicos e hemofílicos. portadoras do gene para o daltonismo.Paulo".2 correto afirmar que a) a mulher 6 é homozigota. . ocorridas independentemente da herança materna ou paterna. João e Pedro sejam a) filhos do mesmo pai.02. o genótipo para hemofilia XHY fenotipicamente representa: a) homem normal b) homem hemofílico c) mulher normal d) mulher hemofílica e) homem normal. Os três homens.5. A probabilidade deste casal vir a ter uma filha hemofílica é igual a: a) zero b) 50% c) 25% d) 12. c) O indivíduo 9 não pode ser hemofílico. certamente.Questão 822 Na espécie humana. decidiu um tribunal japonês. porém herdaram de suas respectivas mães os genes para daltonismo e hemofilia. e) portadores de novas mutações. b) filhos da mesma mãe. ("Folha de S. que pediram para não ser identificados. porém portador Questão 823 a) Os indivíduos 1 e 2 são homozigotos normais. mais provavelmente. d) Todos os filhos e filhas do indivíduo 10 serão hemofílicos. c) os homens 1. os indivíduos representados com símbolos escuros são daltônicos e os demais têm visão normal para as cores. e) O indivíduo 14 pode ser homo ou heterozigoto. da qual herdaram os genes para daltonismo e hemofilia.2006) 186 1. d) filhos da mesma mãe. Pode-se dizer que. c) filhos do mesmo pai. heterozigotas. certamente a mãe tinha fenótipo normal. 09. d) as filhas do casal 6 e 7 são. 3 e 7 são portadores do gene para o daltonismo.5. do qual herdaram os genes para daltonismo e hemofilia. b) as mulheres 2 e 4 são. e) se o pai de 2 era afetado pelo daltonismo.5. vão receber US$ 24. Um homem hemofílico casa-se com uma mulher normal e homozigota para este caráter.7 mil.5.2 1.5% e) 100% Questão 824 Meio-irmãos é o termo utilizado para designar os indivíduos que são irmãos só por parte de pai ou só por parte de mãe. Seus genitores são normais. certamente. Questão 825 VÍTIMAS DE HIROSHIMA NO BRASIL SERÃO INDENIZADAS. b) O indivíduo 8 é portador do gene para hemofilia. Na genealogia abaixo. porém herdaram de seus respectivos pais os genes para daltonismo e hemofilia. Questão 821 O daltonismo é causado por um gene recessivo localizado no cromossomo X na região não-homóloga ao cromossomo Y.

b) 4. os símbolos cheios representam pessoas afetadas por uma doença genética rara. Shiguero. Sr. Como a hemofilia é um caráter dominante.5. era uma vítima indireta da radiação liberada pela bomba.Emília interessou-se pela notícia. também poderia ter provocado mutações nas células de seu tecido reprodutivo que. Depois da notícia do jornal. Mário só pode ter herdado esse alelo de seu pai. porque a doença aparece em todas as gerações. Anos depois. Qual é a porcentagem esperada de mulheres daltônicas nessa população? a) 0. A hemofilia é uma doença que prejudica a coagulação do sangue. b) correta. Questão 827 O daltonismo é causado por um alelo recessivo de um gene localizado no cromossomo X. Mário. Shiguero.81 %. Após a guerra. todos seriam hemofílicos. Emília passou a acreditar que seu filho talvez pudesse se beneficiar com alguma indenização. Em uma amostra representativa da população. a mais grave delas.na família real inglesa. e) errada. porque não há transmissão de homem para homem. É mais provável que a hemofilia de Mário seja determinada por um alelo herdado por via materna. e muito mais freqüente em homens que em mulheres. entre 1000 homens analisados. ligada ao sexo. Deste modo. porque todas as filhas de homens afetados são afetadas. se seu filho Mário tivesse herdado o alelo do pai.5. pode-se dizer que Emília está a) correta. por sua vez. A hemofilia ocorre mais freqüentemente em homens.ligado ao X . d) dominante ligado ao sexo. A princesa Beatriz. filha de Vitória. a doença de seu filho Mário é causada pela presença de um alelo herdado pela via paterna e por outro herdado pela via materna. Shiguero foi submetido.2 padrão de herança que melhor explica o heredograma é a) autossômico dominante. d) 16 %. Como a hemofilia é um caráter recessivo e só se manifesta nos homozigotos para esse alelo. foi um dos sobreviventes da bomba de Hiroshima. provocaram a hemofilia de Mário. e) 83 %. portador de hemofilia do tipo A.5 %. Observe a árvore genealógica: 187 . c) apenas parcialmente correta. 90 são daltônicos. Shiguero. d) errada. Afinal. acreditava que seu único filho. O sogro de Emília. ou que Mário seja portador de uma nova mutação sem qualquer relação com a radiação a que o Sr. Shiguero. onde se casou e teve um filho. Takashi. Emília havia lido que a doença é genética. casou-se com Takashi e atribuía a doença de seu filho Mário à herança genética do avô Shiguero. c) autossômico dominante. o Sr. porque a doença afeta os dois sexos. Questão 828 Acredita-se que a rainha Vitória da Inglaterra tenha sido a introdutora do gene para hemofilia . Do mesmo modo como a radiação provocou a leucemia do Sr. Questão 826 Na genealogia a seguir. migrou para o Brasil. transmitidas à Takashi. porque aproximadamente 50% da prole é afetada. Emília. introduziu o gene na família real espanhola. b) autossômico dominante. que o teria herdado do Sr. c) 9 %. e) recessivo ligado ao sexo. e deste à se filho. uma vez que é determinada por um alelo no cromossomo Y. 1. o herdou do Sr. Shiguero faleceu de leucemia. que. que não tem ascendência oriental. Sobre suas convicções quanto à origem da doença de Mário.

A anomalia.5. este será hemofílico também. daltônica e canhota possui pai daltônico e destro e mãe de visão normal e canhota.5. d) o genótipo dessa mulher é igual ao de sua mãe. b) autossômico recessivo. c) o pai e a mãe são hemofílicos. filha de pai normal e mãe portadora do gene para o daltonismo. e) Os filhos homens desse casal serão sempre daltônicos e não polidáctilos. b) A mãe dessa mulher terá obrigatoriamente o mesmo genótipo para o daltonismo que ela. c) o filho dessa mulher herdou do seu pai o gene para o daltonismo. é determinada por gene a) autossômico dominante.. d) ela recebeu da mãe o gene para a hemofilia. e) essa mulher não poderá ter uma filha daltônica. assinale a alternativa correta.2 probabilidade da princesa Maria vir a ter um menino hemofílico é de: a) 100% b) 75% c) 50% d) 25% e) 0% Questão 829 O estudo de linhagens de galinhas em que aparecia uma anomalia hereditária mostrou que fêmeas afetadas cruzadas com machos normais davam sempre todos os descendentes machos com a anomalia e as fêmeas normais. d) recessivo ligado ao sexo. provavelmente. c) autossômico recessivo. c) O pai dessa mulher é daltônico.Questão 831 Uma mulher. casa-se com um homem daltônico e tem uma criança do sexo masculino e daltônica. Questão 830 Um homem de visão normal e com número normal de dedos casa-se com uma mulher polidáctila e daltônica. b) dominante ligado ao sexo. Questão 832 Um casal tem uma criança de sexo masculino e hemofílica. É correto afirmar. b) essa mulher poderia ter uma irmã daltônica. e) se ela tiver um irmão.. d) recessivo ligado ao cromossomo Z. É correto afirmar que: a) essa mulher é daltônica. 188 . c) recessivo ligado ao cromossomo X. Sabendo-se que a polidactilia é uma herança autossômica dominante. Questão 834 Uma criança do sexo feminino. b) o pai é normal e a mãe é hemofílica. a) Esse casal poderá ter uma filha polidáctila e daltônica. com certeza. e) dominante ligado ao cromossomo Z. então a probabilidade do segundo filho ser do sexo masculino e com fenótipos dominantes é: a) 1/2 b) 1/4 c) 1/6 d) 1/8 e) 1 1. Questão 833 O gene que determina o daltonismo na espécie humana caracteriza o seguinte tipo de herança a) autossômico dominante. d) A mulher é obrigatoriamente filha de pai e mãe polidáctilos. Sabendo que o uso da mão esquerda é uma característica recessiva. que: a) o pai é normal. e) interação gênica.

O primeiro filho desse casal nasceu hemofílico e surdo-mudo. IV . São corretas: a) I. Avô .XdY 189 .XDXd.XdY. c) I. e) III e IV apenas. a) Homem .Os homens só apresentam dois genótipos possíveis. II .XdY.XdY. considere as seguintes afirmações.XDY d) Homem . Avó . b) I e III apenas. d) I e II são verdadeiras. e avô materno e mãe com daltonismo. todos os seus filhos do sexo masculino também serão afetados. Avó .XdY b) Homem .seu pai é hemofílico. Avô . Avó .XDXd.XdXd. II. Um macho de olhos brancos foi cruzado com uma fêmea heterozigota. e) I e III são verdadeiras. nasceu uma menina normal. a porcentagem de indivíduos de olhos brancos em F será de: a) zero b) 100 % c) 25 % d) 75 % e) 50 % Questão 837 Um homem de audição normal e não hemofílico casa-se com uma mulher com o mesmo fenótipo. III. III e IV apenas. enquanto a cor branca é devida ao gene W. c) III é verdadeira.As filhas de pai normal serão sempre normais. a probabilidade desse casal ter uma criança do sexo feminino normal para ambas as características é de: a) 3/8 b) 1/8 c) 1/2 d) 3/4 e) zero Questão 838 A respeito das heranças recessivas ligadas ao sexo (genes situados no cromossomo X). Avô . a cor dos olhos é determinada por um gene localizado no cromossomo X sem o correspondente alelo no cromossomo Y. I .sua mãe possui um gene para a hemofilia. A cor vermelha é determinada pelo gene W+.As mulheres heterozigotas têm fenótipo normal. Avó . Do casamento entre uma mulher afetada e um homem normal. b) II é verdadeira.sua avó paterna NÃO apresenta o gene para a hemofilia.XDY. d) II e IV apenas. Assinale a alternativa correta quanto aos genótipos do homem e de seus avós maternos. Considerando que nesses indivíduos o sexo heterogamético é o masculino.XdY c) Homem . A probabilidade do nascimento de um menino também normal é: a) 50% b) 75% c) 25% d) 100% e) 0 Questão 836 Em 'Drosophila'. III e IV. Questão 840 Um homem tem avó materna e pai com visão normal. Avô .Se a mãe for afetada. II. Avô .XDXd. Sabendo-se que o gene em questão é recessivo e ligado ao sexo. enquanto as mulheres apresentam três genótipos possíveis. III .XDY. Questão 839 Considere as seguintes afirmações sobre uma mulher hemofílica: I.XDY e) Homem . e excluindo-se a possibilidade de mutação.Questão 835 O raquitismo resistente à vitamina D é uma doença provocada por um gene dominante ligado ao X. Avó . é possível considerar que APENAS a) I é verdadeira. Considerando a surdo-mudez como uma característica autossômica recessiva.XDXd.

É correto afirmar que os filhos a) e as filhas de homens daltônicos são sempre daltônicos. d) apenas hemofílico. A probabilidade de terem um filho homem e normal é de: a) 0 b) 1/4 c) 1/3 d) 1/2 e) 1 Questão 845 Observe os heredogramas a seguir. O daltonismo é condicionado por um gene recessivo ligado ao sexo. XXY). e) de homens daltônicos sempre portam alelo para daltonismo.5. Admitindo-se que o gameta anormal tenha sido produzido pela mulher. que tratam de um caso e hemofilia: 1.2 abendo que o indivíduo 7 é do sexo feminino. a probabilidade desse casal ter um menino afetado é a) 3/4 b) 1/2 c) 1/4 d) 1/8 e) 1/16 Questão 842 Um homem hemofílico e uma mulher daltônica tiveram um filho com síndrome de Klinefelter (47. recebeu o nome de daltonismo. Dalton descreveu uma doença hereditária que o impossibilitava de distinguir a cor verde da vermelha.2 e uma das irmãs desse indivíduo casar-se com um homem sadio. Questão 843 O cientista John Dalton é bastante conhecido por suas contribuições para a Química e Física. c) e as filhas de homens daltônicos são sempre heterozigotos. e) apenas daltônico. Um homem normal casou-se com uma mulher daltônica. Além disso.5. causada por um alelo recessivo ligado ao cromossomo X. que nasceu com SÍNDROME DE KLINEFELTER e DALTONISMO.Questão 841 O heredograma a seguir representa uma família em que um dos filhos é afetado por doença determinada por um alelo recessivo localizado no cromossomo X.5. embora seus pais não apresentem alterações cromossômicas numéricas em suas células 190 . espera-se que esse filho do casal seja a) normal. a probabilidade de apresentar hemofilia é: a) 1 b) 1/2 c) 1/4 d) 1/8 e) 1/16 Questão 846 O esquema a seguir representa a ontogênese de João.5. Questão 844 1. Essa doença hereditária. b) e as filhas de mulheres daltônicas são sempre daltônicos. quanto à hemofilia e ao daltonismo. c) daltônico ou hemofílico. d) de mulheres daltônicas sempre portam alelo para daltonismo. b) daltônico e hemofílico.

Questão 848 abendo que o daltonismo é uma herança recessiva ligada ao sexo. ao microscópio. mas pode não ser ela quem contribuiu com o gameta responsável pela síndrome do filho. torna os indivíduos afetados incapazes de se reproduzir. Na espécie humana. Sabendo que filhas de pai apenas hemofílico e mãe apenas daltônica e homozigota para hemofilia são normais para os dois caracteres.5. Questão 847 Em geral. 191 . c) Algumas células somáticas de cada filha apresentam o cromossomo X de origem paterna condensado. 1. O gene que codifica para a produção desse fator está localizado no cromossomo X em uma região que não apresenta homologia em Y. enquanto a outra parte. c) A AME pode ser um caráter ligado ao sexo.5. A Atrofia Muscular Espinhal (AME) não impede a reprodução e pode ser transmitida pelo pai. conhecido como eucromatina. é menos condensado para permitir acesso da maquinaria de transcrição. a hemofilia e o daltonismo são características recessivas ligadas ao sexo. é vista como uma mancha escura chamada corpúsculo de Barr. Questão 849 A hemofilia é um distúrbio genético humano. Um exemplo disso é a inativação completa de um dos dois cromossomos X em fêmeas de mamíferos. O caráter Distrofia Muscular de Duchenne (DMD) é uma herança ligada ao sexo. a) A permutação na espermatogênese permitiu que o pai tenha dado para a filha gameta contendo o alelo dominante para hemofilia. ele obrigatoriamente contribuiu com o gameta responsável pela síndrome do filho. b) Se foi o pai de João quem contribuiu com o gameta contendo um cromossomo a mais. d) Se a mãe de João é daltônica. b) O "crossing-over" na gametogênese da mãe garante que Os dois heredogramas a seguir foram montados para duas famílias que apresentavam distúrbios musculares geneticamente determinados. o DNA não-expresso é altamente condensado na forma de heterocromatina. c) A mãe de João pode ser daltônica. situação que. EXCETO: a) Se o pai de João é daltônico. b) Não podem ser gerados descendentes do sexo feminino afetados por DMD. sendo somente transmitido pelas mães. 1.2 nalisando as informações e os heredogramas acima de acordo com seus conhecimentos. o cromossomo X de origem materna condensado. EXCETO: a) Os dois caracteres DMD e AME acima são recessivos. esse pai é obrigatoriamente daltônico.2 a filha receba dela os alelos dominantes para daltonismo e hemofilia no mesmo cromossomo. assinale a alternativa que traz uma explicação possível para o fato apresentado.5. d) A não-expressão dos alelos dominantes recebidos garante que a filha seja normal para os dois caracteres. d) Os dois caracteres DMD e AME não podem estar localizados no mesmo par de homólogos. o que permite expressar os dois alelos dominantes. pelo menos um dos avós de João também é daltônico. que se caracteriza pela falta de um dos fatores de coagulação sangüínea. é correto afirmar.5. O DNA ativo no nível de transcrição. O heredograma a seguir indica. é correto afirmar.somáticas.

mas Maria é portadora do gene que causa daltonismo. Manuel é certamente daltônico. é INCORRETO afirmar: a) O pai de Maria não é portador. Questão 851 Em Galináceos a determinação do sexo (sistema ZW) segue um padrão inverso ao que se observa em mamíferos (sistema XY). Dessa forma as galinhas constituem o sexo heterogamético (feminino ZW). Manuel certamente é normal.2 1.na segunda e terceira gerações. EXCETO: a) Os galos com padrão de plumagem listrada representados. b) Nos dois experimentos. d) A chance de o casal II-5 × II-6 ter uma criança afetada por esse caráter é de 1/4. também com visão normal para daltonismo. Do casamento de Maria com Manuel nasceu um casal de gêmeos. é correto afirmar. B e C) que apresentam. O fenótipo mais marcante dessa síndrome é a ausência de glândulas sudoríparas na pele.5. De acordo com as informações apresentadas. em comum. c) Se o gêmeo afetado for o do sexo masculino. é correto afirmar. os galos listrados de F são heterozigotos quanto aos alelos que determinam esse caráter.5. sendo um deles daltônico e outro normal. sendo uma síndrome hereditária recessiva ligada ao cromossomo X. 1. Sabendo-se que o daltonismo é uma característica determinada por gene recessivo ligado ao sexo. um progenitor afetado por essa anomalia. constituem o sexo homogamético (macho ZZ). b) Não existem indivíduos portadores do gene da hemofilia na família B. EXCETO: a) Na família A. c) O padrão da plumagem das galinhas depende dos alelos que recebem do seu progenitor do sexo masculino.2 Analisando-se o heredograma. 192 . Questão 850 Um homem e uma mulher com visão normal tiveram uma filha. Questão 852 A Displasia Ectodérmica Anidrótica (DEA) apresenta prevalência na população de 1:100. três famílias (A. Os experimentos a seguir foram desenvolvidos para se estudar a herança do caráter padrão da plumagem de galináceos da raça Langshan Black (fenótipo Lisa) cruzados com galináceos da raça Plymouth Rock (fenótipo Listrada). Maria. pelo menos um indivíduo apresenta o gene causador de hemofilia. b) Os dois gêmeos podem ter recebido o gene recessivo que determina o daltonismo. enquanto os galos O caráter descrito é uma herança ligada ao sexo. d) O caráter plumagem lisa é recessivo em relação ao caráter plumagem listrada. pelo menos dois indivíduos apresentam o gene causador de hemofilia.000 nascimentos.5. d) Se o gêmeo afetado por daltonismo for do sexo feminino. receberam o alelo dominante de seu progenitor do sexo feminino. c) Na família C.5.

5. c) Metade dos descendentes machos das gêmeas deverão apresentar a síndrome. c) Somente II e III. b) As gêmeas podem ter herdado o alelo recessivo tanto de seu pai quando de sua mãe. No entanto.Questão 854 Robson. Está correta ou estão corretas: a) Somente I e II. que apresentarão o fenótipo da síndrome. O genoma humano é de 46 cromossomos. portanto. b) Robson. e) Nenhuma. Baseados nos mecanismos genéticos. b) I. é INCORRETO afirmar: a) As manchas na pele das gêmeas representadas podem ser o resultado da ocorrência de heterocromatina para o cromossomo que carrega o alelo dominante. que sofria de hemofilia. as pessoas citadas apresentam o seguinte genótipo: Robson Michele Aline (Xd) Y (XD) (Xd) (XD) (XD) 1. filha do casal.2 A figura apresenta duas gêmeas univitelínicas. O daltonismo é transmitido por herança genética. a) Robson pode ser filho de Aline. Michele e Aline podem ser irmãos. mesmo que o pai seja daltônico. suas quatro filhas (Olga. II e III. II. Questão 853 Analise as afirmações: I. Questão 855 1. A probabilidade de que Olga.5. Um irmão da czarina Alexandra também era afetado por essa doença. Nicolau II. Michele e Aline são membros de uma mesma família. A hemofilia é uma herança genética ligada aos cromossomas sexuais. Para o caráter daltonismo. Anastasia) e seu filho Alexis. e) Michele e Robson podem ser filhos de mãe daltônica e Aline a tia materna. heterozigotas e. Maria. não apresentam a síndrome. sua esposa Alexandra. d) Um macho com o alelo recessivo pode passá-lo para suas filhas e filhos. III. fosse portadora do alelo para hemofilia é de a) 1/4 b) 1/64 c) 1/2 d) 1/8 e) 1/32 193 .2 fotografia mostra o último czar da Rússia. d) Robson pode ser pai de Aline e de Michele. Com base nas informações dadas e em seus conhecimentos. poderíamos estabelecer os seguintes graus de parentesco.5. d) Somente I e III. as manchas que aparecem nessas mulheres são produzidas por um corante especial capaz de revelar áreas com poucas ou nenhuma glândula sudorípara.5. Tatiana. c) Michele pode ser mãe de Robson e de Aline.

referente a uma família com herança para daltonismo (herança ligada ao sexo e deve-se a um gene recessivo).2 1. e) recebeu o gene de seu pai.5.5.5. e a cor cinza pelo alelo dominante.2 elativamente aos indivíduos anteriores. e) terá todos os seus descendentes com a doença.5. O casal indicado pelos números 5 e 6 1. Assinale a descendência 194 . o homem de etnia amarela apresenta uma característica determinada por um gene recessivo ligado ao sexo. uma vez que o loco gênico está no cromossomo Y. a probabilidade desse casal ter um filho homem e daltônico é: a) 25 % b) 8 % c) 12. b) é heterozigoto para essa característica. c) recebeu o gene de sua mãe. as pessoas indicadas pelos números 3 e 6 apresentam uma doença rara determinada por um gene dominante localizado no cromossomo X. Se um homem daltônico casa-se com uma mulher normal. não portadora do gene para o daltonismo. Questão 857 Na genealogia a seguir.Questão 856 1. Na tira de quadrinhos. a cor amarela do corpo é determinada por um gene recessivo localizado no cromossomo X.2 a) não terá chance de apresentar descendentes com a doença. d) poderá ter metade de seus descendentes com a doença. heterozigota para essa característica. porém portador do gene para o daltonismo d) os indivíduos 4 e 5 são daltônicos Questão 860 Em drosófilas. b) poderá ter apenas descendentes do sexo feminino com a doença. heterozigoto para essa característica.5. d) recebeu o gene de seu pai. Questão 858 O daltonismo é uma doença hereditária e ligada ao sexo na espécie humana. podemos afirmar: a) somente o indivíduo 2 é daltônico b) o genótipo do indivíduo 4 é XdY c) o indivíduo 1 é normal. pode-se dizer que ele a) é homozigoto recessivo para esse gene.5. c) poderá ter apenas descendentes do sexo masculino com a doença.5 % d) 0 % Questão 859 Observe a árvore genealógica a seguir. Descendendo de pais com visão normal.

b) tanto os filhos quanto as filhas sejam sempre afetados. d) Homem daltônico e mulher normal. já as meninas serão normais. em virtude da não-coagulação do sangue. ligado ao cromossomo X. d) dominante. (16) Se transmite de pai para filho. c) recessivo. localizado no cromossomo X. e) machos: 50% cinzentos e 50% amarelos .esperada a partir do cruzamento entre uma fêmea amarela e um macho cinzento. ou seja. Qual das opções fenotípicas abaixo corresponde à do casal em questão? a) Homem normal e mulher normal. Questão 865 Considere o heredograma: 1. e) Homem normal e mulher normal. b) dominante. uma forma de daltonismo que provoca cegueira para as cores vermelho e verde. um casal fica sabendo que todos os seus filhos do sexo masculino serão daltônicos. b) Homem normal e mulher daltônica. Questão 861 O raquitismo resistente à vitamina D é uma doença determinada por um gene dominante de herança ligada ao sexo. porém portadora de gene recessivo d. Ao consultar um médico.5. d) machos: 50% cinzentos e 50% amarelos .fêmeas: 100% amarelas. c) tanto os filhos quanto as filhas sejam sempre normais. Questão 862 Considere o heredograma a seguir. é possível concluir que a anomalia é devida provavelmente a um alelo a) localizado no cromossomo Y.5. Na prole de um homem afetado casado com uma mulher normal. (02) É uma doença mais comum em homens que em mulheres. b) machos: 100% cinzentos .fêmeas: 50% cinzentas e 50% amarelas.fêmeas: 100% cinzentas.2 195 . 1. anomalia hereditária caracterizada por uma deficiência na coagulação do sangue. espera-se que a) tanto os filhos quanto as filhas possam ser normais ou afetados. (01) É restrita ao sexo. d) apenas as filhas sejam afetadas.5.5. (08) O mecanismo genético da hemofilia se deve à presença de um gene ligado ao sexo. é determinada pelo gene recessivo d. situado num autossomo. a) machos: 100% amarelos .fêmeas: 50% cinzentas e 50% amarelas. e) apenas os filhos sejam afetados. c) Homem daltônico e mulher daltônica. localizado no cromossomo X.fêmeas: 100% cinzentas. situado num autossomo. (04) As mulheres hemofílicas geralmente morrem na menarca. atinge indivíduos de um único sexo. Questão 864 Sobre a hemofilia. assinale o que for correto. c) machos: 100% amarelos .2 partir da sua análise. Questão 863 Em seres humanos. e) recessivo.

A partir do cruzamento XrY × XRXr. sendo 58 autossomos mais dois cromossomos sexuais. Joana teve um filho que apresentou síndrome hemorrágica caracterizada por baixo nível plasmático do fator VIII da coagulação. Fêmea peluda: 3/8. c) esta anomalia será transmitida a todas as filhas. ( ) Essa árvore genealógica representa um caso de anomalia hereditária.5. b) esta anomalia será transmitida à metade dos filhos do sexo masculino. é: a) 100% para todas as mulheres da família b) 100% para Joana. Fêmea sem pêlo: 10/64 e) Macho peludo: 1/8. XX na fêmea.abe-se que o pai. A probabilidade genética de serem portadoras do gene para a hemofilia A. Esse gene é representado por dois alelos. Macho sem pêlo: 1/4. os cinco irmãos homens e um sobrinho de Joana são normais. analise os itens. e 58 autosomos mais XY no macho. como a cor da pele. o R. Fêmea sem pêlo: 1/16 c) Macho peludo: 3/8. Macho sem pêlo: 3/16. sua mãe e sua filha c) 100% para Joana e 50% para sua filha d) 100% para Joana e 50% para as outras mulheres da família e) 100% para Joana e 25% para sua filha Questão 866 Tendo em vista o heredograma. Macho sem pêlo: 9/64. responsável por animal peludo. Essa figura indica os grupos sangüíneos do sistema ABO de alguns dos seus membros. Fêmea sem pêlo: 1/4 b) Macho peludo: 9/16.2 as proporções fenotípicas esperadas na descendência são: a) Macho peludo: 1/4. Entretanto. Fêmea sem pêlo: 1/8 d) Macho peludo: 36/64. 196 . grave anomalia relacionada à alteração no tempo de coagulação do sangue. d) esta anomalia será transmitida à metade das filhas. e o r. Fêmea peluda: 9/64. Questão 867 Um homem possui uma anomalia dominante ligada ao cromossomo X e é casado com uma mulher normal. responsável por animal sem pêlo.5. O gene responsável pela quantidade de pêlos no animal está situado no cromossomo X. Em relação aos descendentes deste casal é CORRETO afirmar que: a) esta anomalia será transmitida a todos os filhos do sexo masculino. Macho sem pêlo: 1/8. ( ) O caráter em questão é condicionado por um gene recessivo e ligado ao sexo. o marido. determinada por um gene presente no cromossomo Y. e) esta anomalia não será transmitida a nenhum descendente. Macho sem pêlo: 3/8. Fêmea peluda: 3/16. neste caso. Questão 868 Em bovinos ocorrem 60 cromossomos na célula somática. ( ) Essa genealogia apresenta um tipo de interação gênica. Fêmea sem pêlo: 1/8 Questão 869 Observe a figura a seguir que apresenta o heredograma de uma família na qual alguns membros apresentam hemofilia. influenciada pelo meio ambiente. recessivo. 1. Fêmea peluda: 1/4. ( ) Esse pedigree mostra um exemplo de herança passada do avô ou da avó para o neto por meio da mãe portadora. Fêmea peluda: 3/8.

2 1. Questão 872 A enzima G-6-PD (glicose-6-fosfato desidrogenase) está presente nas hemácias de indivíduos normais. d) o indivíduo II-5 tem 50% de probabilidade de formar gametas do tipo iXh.2 Com base nas informações do heredograma e considerando-se que não ocorreu mutação.5. em indivíduos afetados. Assinale entre as alternativas a seguir aquela que contém o heredograma que NÃO poderia representar a família desse rapaz.2 a) 1 b) 2 c) 3 d) 4 197 . Questão 870 Ao fazer um exame de vista para tirar carteira de motorista. provocando sua destruição. torna as hemácias sensíveis a certas drogas e nutrientes. Observe o heredograma que representa uma família com essa característica. a) Ligada ao X.5.Questão 871 Analise o heredograma. d) Autossômica dominante. é INCORRETO afirmar-se que a) a probabilidade de II-3 ser portadora do gene da hemofilia é de 50%. c) o indivíduo III-4 pode receber sangue de III-6.5. 1.5. c) Ligada ao Y. b) Autossômica recessiva. A ausência dessa enzima. 1.2 1. e) o indivíduo I-1 é heterozigoto para o sistema ABO.5. O gene que determina a ausência de G-6-PD é recessivo e situa-se no cromossoma X. b) a probabilidade de nascimento de outra criança hemofílica e do grupo B para o casal III-6 e III-7 é de 25%. um rapaz descobriu que era daltônico.5.5. ssinale a alternativa que NÃO contém um tipo de herança compatível com a anomalia representada no heredograma.5.

2 serão daltônicos.2 198 .4 recebeu o gene do daltonismo de qualquer um de seus genitores.om base nesse heredograma. Questão 873 A distrofia muscular do tipo Duchenne.4 é homozigota 4. A mulher I. Questão 874 Analise este heredograma.2 apresenta o fenótipo normal e é portador do gene do daltonismo.2 têm probabilidade maior de ter filhos afetados do que de ter filhas afetadas. ligada ao X. Considerando-se essas informações e outros conhecimentos sobre o assunto.5. A mulher II. d) mulheres afetadas recebem os cromossomos X materno e paterno com o gene para essa distrofia. A mulher I. doença recessiva ligada ao cromossomo X.2 . um gene para ausência de G-6-PD. d) o indivíduo II-3 pode ter recebido o gene da G-6-PD tanto do seu pai quanto de sua mãe. c) indivíduos do sexo masculino que possuem um gene mutante para essa distrofia manifestam a doença. A mulher III. pelo menos. d) os filhos do sexo masculino de II.5. b) o indivíduo II. condicionada por gene recessivo localizado no cromossoma X: Considerando-se as informações contidas nesse heredograma e outros conhecimentos sobre o assunto. b) essa família apresenta dois indivíduos heterozigotos para o gene que determina a G-6-PD. inicia-se na infância e impede a reprodução dos afetados. Analise-a e avalie as proposições dadas. A mulher III.2 é homozigota 2. é CORRETO afirmar que a) o indivíduo I. caracteriza-se por debilidade muscular progressiva e deformidades ósseas. c) casais como I.1 x I. é CORRETO afirmar que a) cada um dos indivíduos representados tem.5 é heterozigota 5. analise os itens: 1.2 é heterozigota 3.1 e I. em que está representada a herança do daltonismo.9 é homozigota Está(ão) correto(s) apenas: a) 1 b) 2 c) 3 d) 1 e 3 e) 1 e 2 Questão 876 A figura a seguir faz referência a uma genealogia que ilustra a ocorrência de uma determinada doença genética.5. c) os casais como I. é INCORRETO afirmar que a) casais com filhos afetados têm 25% de probabilidade de ter outra criança com essa doença.2 têm maior probabilidade de ter filhos do sexo masculino daltônicos. independentemente do genótipo do seu pai.5. Questão 875 Considerando que o heredograma a seguir é o de uma herança dominante. b) indivíduos do sexo masculino afetados por essa distrofia muscular são filhos de mães heterozigotas. 1.

o alelo mutante (h) condiciona ausência do fator VIII. A hemofilia A. respectivamente. Moderna. ( ) Observando-se que a maioria dos machos (I.5. São Paulo: Ed.5. III‚. II„. pode-se concluir que se trata da herança de genes localizados no cromossomo Y. Estão corretas apenas as afirmativas a) I e IV. Questão 878 O diagrama abaixo mostra a surdez em três gerações de uma família.2 ( ) A característica mostrada no heredograma é determinada por uma série polialélica de genes autossômicos.. I. As irmãs 2 e 4 apresentam.5. Se o indivíduo 7 tiver filhos com uma mulher que tenha o mesmo genótipo para hemofilia de sua avó materna. Esse fator é uma proteína cujo gene codificador encontra-se no cromossomo X. sendo responsável por este tipo de hemofilia. O indivíduo 7 é hemofílico. "Conceitos de Biologia". analise as afirmativas. Dos primos que se casaram. 199 .M. pois herdou da mãe o alelo normal (H). é causada pela deficiência de um dos fatores que agem na coagulação. G. V3. um dos tipos mais graves. genótipos da figura 2 e a consangüinidade. Com base nos textos e em seus conhecimentos. através da união entre primos irmãos (indivíduos 5 e 6). enquanto que o indivíduo 5 não apresenta este alelo.5. condicionou a manifestação do alelo deletério h para hemofilia. IV. ( ) O loco gênico determinante deste caráter deve estar localizado na porção não-homóloga do cromossomo X. Questão 877 A hemofilia é uma doença hereditária em que há uma falha no sistema de coagulação do sangue. II. III. AMABIS. ( ) Os descendentes III„ e III… apresentam o mesmo genótipo. e) I e III. pois herdou o alelo recessivo para ausência do fator VIII de sua mãe. 2003. J. MARTHO. III„ e III…) manifestam a característica em consideração. b) III e IV. o fator VIII. c) II.1. 1) de uma família em que ocorre a hemofilia A. ( ) A identidade genotípica é também observada entre II e IIƒ.R. Um círculo preto representa uma mulher surda e um círculo branco representa uma mulher normal. e o indivíduo 8 pode ou não ser portador deste alelo recessivo. Um quadrado preto representa um homem surdo e um quadrado branco um homem normal. o alelo normal (H) produz o fator VIII e condiciona fenótipo não hemofílico. Observe o heredograma (fig. considerando que os indivíduos 2 e 4 são irmãs.2 1. somente o indivíduo 6 é portador do alelo recessivo que causa a hemofilia. III. a probabilidade de terem filhos hemofílicos é de 50% e de terem filhas hemofílicas é de 0%. d) I e II.

e) o pai obrigatoriamente apresenta a cegueira da cor verde. b) o pai é heterozigoto para a cegueira da cor verde. (32) Machos afetados descendem de fêmeas portadoras ou afetadas. Seu alelo recessivo é responsável pelo fenótipo cauda normal. a probabilidade é zero. Questão 880 Genes situados na porção ímpar do cromossomo X são transmitidos segundo um padrão definido como Herança Ligada ao Sexo. d) Se a mulher for heterozigota. c) Se a mulher for homozigota. (04) Esse gene deve se manifestar com maior freqüência nos machos. b) machos e fêmeas com cauda curta e retorcida na proporção de 2:1.ela está casada com um homem normal. (02) Esse gene deve se manifestar com maior freqüência nas fêmeas. d) todos os machos com cauda curta e retorcida e todas as fêmeas com cauda normal. localizado no cromossomo sexual comum aos dois sexos. d) recessiva ligada ao sexo.5. É correto afirmar que: a) a mãe obrigatoriamente apresenta a cegueira da cor verde. a probabilidade é 25%. c) o pai é homozigoto para a cegueira da cor verde.1. e) holândrica. 200 . localizado na região não homóloga do cromossomo X. Qual a probabilidade de que um(a) filho(a) deste casal venha a ser afetado pela doença? a) Se a mulher for homozigota. Considerando um gene recessivo e localizado nessa porção do cromossomo X. a probabilidade é 100%.Uma mulher com fenótipo normal tem um irmão afetado e um tio materno também afetado pela doença. o fenótipo cauda curta e retorcida é determinado por um gene dominante denominado "Bent". Em uma família. . . a probabilidade é 75%.5. enquanto o filho não enxerga a cor verde. Soma ( ) Questão 881 condição de surdez mostrada no heredograma é herdada como uma característica: a) autossômica dominante. Em camundongos. Se uma fêmea de cauda normal for cruzada com um macho de cauda retorcida. (64) Fêmeas afetadas são necessariamente descendentes de fêmeas afetadas. d) a mãe é pelo menos heterozigota para a cegueira da cor verde. a filha possui visão normal.seus pais não são afetados. (16) Machos afetados descendem de machos também afetados. é correto afirmar: (01) Esse gene deve se manifestar com igual freqüência em machos e fêmeas. . que leva a uma debilidade muscular progressiva (distrofia muscular progressiva). c) machos e fêmeas com cauda normal na proporção de 100%. b) Se a mulher for homozigota. e) todos os machos com cauda normal e todas as fêmeas com cauda curta e retorcida.2 (08) Esse gene deve se manifestar apenas nos machos. sua descendência apresentará a seguinte proporção: a) machos e fêmeas com cauda curta e retorcida na proporção de 100%. Questão 882 Existe uma doença condicionada por um gene recessivo. Questão 879 A cegueira da cor verde na espécie humana é uma característica recessiva ligada ao sexo. c) dominante ligada ao sexo. b) autossômica recessiva.

Questão 887 Assinale a proposição CORRETA. b) em todas as células gaméticas. c) A mãe é amarela e o pai. Quais estão corretas? a) Apenas I.5. d) apenas nas células-mãe dos gametas. Que proporção dos seus espermatozóides espera-se que seja A/Xö ? a) 0 % b) 25 % c) 50 % d) 75 % e) 100 % Questão 885 Nos gatos domésticos a cor do pêlo é ligada ao cromossomo X. os machos podem se pretos ou amarelos e as fêmeas podem ser pretas amarelas ou malhadas. c) Apenas III. preto. em uma região sem homologia no cromossomo Y. b) A mãe é malhada e o pai. a) autossômica dominante b) ligada ao X dominante c) ligada ao Y dominante d) ligada ao Y recessiva e) ligada ao X recessiva Questão 884 Um homem é heterozigoto para um gene autossômico.e) Se a mulher for heterozigota. do sexo masculino. (01) Não é possível a existência de mulheres hemofílicas. Com relação a essa doença. e metade dos machos é amarela. Questão 883 Interprete o heredograma abaixo. o gene para o daltonismo encontra-se: a) em todas as células somáticas. Questão 886 Em um caso de disputa da paternidade de um menino hemofílico. preto. c) apenas nas células do globo ocular. a outra metade é preta. e) Apenas II e III. estão envolvidos um homem que tem a doença e outro que não a tem. d) A mãe é preta e o pai. 201 1. (Hemofilia: herança recessiva ligada ao X) Analise as afirmações abaixo a esse respeito. e) A mãe e o pai são pretos. Quando metade das fêmeas de uma ninhada é malhada.O homem não hemofílico pode ser o pai do menino. d) Apenas I e II.As bases genéticas da hemofilia apoiam a paternidade do homem hemofílico. amarelo. Questão 888 A hemofilia é uma doença hereditária em que há um retardo no tempo de coagulação do sangue. b) Apenas II. . (02) É condicionada por um gene que se localiza no cromossomo X. III .O homem hemofílico não pode ser o pai do menino. a probabilidade é 100%. é possível encontrar um máximo de três fenótipos e dois genótipos. Em um indivíduo daltônico. e possui um alelo ligado ao X recessivo b. e decorre do não funcionamento de um dos fatores bioquímicos de coagulação. assinale a(s) proposição(ões) CORRETA(S).2 dentifique o mais provável padrão de herança representado no heredograma. Aa. (04) Entre as mulheres. e) apenas nos gametas com cromossomo y. de que cores são os pais? a) A mãe é malhada e o pai. II .5. I . Assim. amarelo.

(08) Entre os homens. b) 1/3. 50% de fêmeas com cerdas retorcidas e 50% de fêmeas normais. c) II e III. tem 3 filhos com as seguintes características: 202 .Devido à inativação ao acaso de um cromossomo X. por isso. d) 100% de machos com cerdas retorcidas e 100% de fêmeas normais. . b) 50% de machos normais. em que os indivíduos afetados têm graves hemorragias. Questão 893 Observe a genealogia abaixo sobre uma família que apresenta pessoas afetadas por uma anomalia hereditária. A descendência esperada será de a) 50% de machos e 50% de fêmeas normais e 50% de machos e 50% de fêmeas com cerdas retorcidas. (32) É um exemplo de herança ligada ao sexo. c) 1/2.menina com visão normal para as cores. d) I e II. Os homens afetados começam a apresentar os sintomas na primeira infância e não se reproduzem porque morrem antes de atingir o período reprodutivo. é possível ocorrer apenas um genótipo. há uma maior incidência dessa doença entre eles. d) 1/8. espera-se que 50% deles sejam normais e 50% sejam hemofílicos. que acarreta degeneração e atrofia dos músculos. III. as mulheres heterozigotas para o gene da distrofia muscular de Duchenne podem apresentar graduações da característica.menino com visão normal para as cores. Analise as afirmativas abaixo. Questão 891 Um casal que possui visão normal para as cores. Soma ( ) . b) I e III. c) 100% de machos normais. Sabendo-se que o daltonismo é uma herança ligada ao X.menino com daltonismo. a distrofia muscular de Duchenne é uma doença condicionada por um gene recessivo localizado no cromossomo X. Questão 890 Em drosófila. c) 1/4. II. a possibilidade de esse casal ter uma filha com daltonismo é a) zero. e) 3/4. que se caracteriza pela dificuldade de coagulação do sangue. que ocorre nas células das fêmeas dos mamíferos (hipótese de Lyon). I.A distrofia muscular de Duchenne é uma doença que ocorre quase que exclusivamente em meninos. b) 1/4. Uma fêmea heterozigota foi cruzada com um macho normal. e) 100% de machos normais e 100% de fêmeas com cerdas retorcidas. a probabilidade de nascimento de uma criança do sexo masculino e hemofílica é a) 1/2. São corretas as afirmativas a) apenas III. mesmo no caso de pequenos ferimentos. Questão 892 Na espécie humana. (16) Entre os descendentes de um homem hemofílico e de uma mulher normal. 50% de machos com cerdas retorcidas e 100% de fêmeas normais. O alelo dominante determina cerdas normais (não retorcidas). Questão 889 A hemofilia é uma doença recessiva ligada ao sexo. não portadora. Em um casal em que a mulher é heterozigota para a hemofilia e o marido é normal. . o caráter cerdas retorcidas é determinado por um gene recessivo e ligado ao sexo. e) 1.A distrofia muscular de Duchenne é uma doença que ocorre exclusivamente no sexo masculino. d) 3/4.

(2) Os descendentes de uma fêmea amarela. Questão 895 O gene h que determina a hemofilia na espécie humana é recessivo e está localizado no cromossomo X. Considerando os dados apresentados. e) O genótipo da Sra 8 é XhXh. é condicionado por genes ligados ao cromossomo X.5.2 anomalia em questão é transmitida por meio de um gene a) recessivo ligado ao cromossomo X. (1) As fêmeas manchadas são heterozigotas para o caráter cor da pelagem. mas daltônicas do outro. nos gatos. c) O genótipo da Sra 8 é XHXH. I . Questão 894 Na espécie humana.A mulher é dupla heterozigota para os genes em questão.25% das filhas do casal poderão ser calvas e daltônicas. O daltonismo é de herança recessiva ligada ao cromossomo X.É possível que o casal tenha filhas não-calvas. Um casal não-calvo e de visão normal tem um filho calvo e daltônico.5. Marque a alternativa correta.5.5. analise as afirmativas a seguir. cruzada com um macho preto. d) O genótipo do Sr 9 é XHY. b) O genótipo da Sra 5 é XHXh. (3) Um gato macho não transmite para seus filhos machos os genes para cor da pelagem. observam-se os seguintes fenótipos: 1. III . d) autossômico dominante. O gene que condiciona a calvície é dominante nos homens e recessivo nas mulheres. c) II e III são corretas. c) dominante ligado ao cromossomo X. não havendo dominância. II .5. julgue os itens a seguir. Questão 896 Com relação à coloração da pelagem de gatos.2 Utilizando as informações anteriores. a calvície hereditária é uma característica influenciada pelo sexo. de visão normal em um dos olhos. b) autossômico recessivo. Com base no heredograma a seguir. d) Apenas III está correta.2 1. 203 .1. b) I e III são corretas. serão manchados. (0) O caráter cor da pelagem.5. podemos afirmar corretamente: a) O genótipo da Sra 5 é XHXH. a) I e II são corretas.

em seis partos diferentes.2 respeito desta genealogia. b) 2. (16) O casal 1 x 2 pode ter filhos homens daltônicos. Indique a alternativa com a probabilidade desse casal ter uma filha hemofílica: a) 0% b) 25% c) 50% d) 75% e) 100% 1. Questão 898 Considere o heredograma. (04) O indivíduo 1 transmite a todas as suas filhas um cromossomo Xd. sendo que seu alelo dominante condiciona visão normal. cuja mãe tinha olhos brancos.50. certamente. c) as mulheres 2 e 3 são.67. b) as filhas do casal 3 e 4 são. a(s) correta(s). e) 0. Se esta mulher der à luz seis crianças normais.5. portadores do gene. e) 5. a cor branca dos olhos é devida à herança ligada ao sexo. Questão 901 Um casal não hemofílico teve um filho do sexo masculino com hemofilia. d) 4. 204 . d) todas as filhas do casal 1 e 2 são portadoras do gene. (32) O genótipo do indivíduo 9 é XdY. o número esperado de crianças do sexo masculino será a) 1. b) 0. e) os homens 1 e 4 são.5. que representa uma família portadora de caráter recessivo condicionado por um gene situado em um dos cromossomos sexuais. podemos afirmar que a) a mulher 2 é homozigota. certamente.5.00. cruza-se com macho de olhos brancos. portadoras do gene.00. d) 0. (08) O indivíduo 8 tem o mesmo fenótipo de sua avó materna. (64) O genótipo do indivíduo 5 é XdXd.5. Uma mosca fêmea com olhos coloridos. 1. Qual é a probabilidade de se obter uma fêmea de olhos brancos deste cruzamento? a) 1. Questão 899 Uma mulher é portadora de um gene letal presente no cromossomo X. portadoras do gene. c) 0. Este gene provoca aborto espontâneo algumas semanas após a formação do zigoto. certamente.Questão 897 Em moscas de frutas. Questão 900 A genealogia abaixo nos mostra uma forma de transmissão do daltonismo. c) 3.25. (01) O daltonismo está relacionado com genes localizados em cromossomos autossômicos.2 Assinale dentre as alternativas que se seguem. (02) O daltonismo é determinado por um gene recessivo.

Questão 902 Na espécie humana. respectivamente. b) em todos os homens. e) somente nos homens heterozigotos. Um homem com hipertricose casa-se. c) transmitidas do pai só para as filhas. isto é. aB (10%). e todos os seus filhos são homens. b) II e III são situações nas quais ocorre segregação independente e ligação gênica sem "crossing-over". c) a hemofilia. ab (50%). d) o daltonismo. e) Provavelmente esse Y ficou grande para ser o homólogo do X. d) Entre as minhas filhas. ab (40%). Na próxima geração dessa família esse gene se manifestará a) em todas as mulheres.AB (25%). aproximadamente. e) o albinismo. trabalhou com apenas uma característica de cada vez. Questão 907 Mendel. Questão 906 A hipertricose auricular (pêlos na orelha) é transmitida apenas pelo homem e somente para os filhos do sexo masculino. 30% a mais de heterocromatina na região distal. todos os meus descendentes também o terão. isto é. Questão 904 Como exemplo de característica na espécie humana. d) transmitidas do pai para os filhos homens e filhas em 100% dos casos. Posteriormente. apenas 50% terão esse cromossomo. Questão 905 O exame citogenético de um indivíduo normal revelou que o seu cromossomo Y contém. ele acompanhou a transmissão de dois caracteres ao mesmo tempo. nas primeiras experiências sobre hereditariedade. talvez ele não seja meu irmão. e os resultados levaram-no a concluir que: "fatores para dois ou mais caracteres são transmitidos para os gametas de modo totalmente independente". II . 205 . III . a qual não é válida para os genes que estão em ligação gênica ou "linkage".AB (50%). c) herança holândrica. Embora sem nenhuma manifestação fenotípica aparente.AB (40%). ele fez algumas suposições sobre a herança desse cromossomo. ab (25%). d) somente nas mulheres heterozigotas. Este fenômeno é chamado de: a) epistasia. temos: a) a diferenciação dos testículos. genes que estão localizados nos mesmos cromossomos. Observando as seguintes proporções de gametas produzidos pelo diíbrido AaBb em três situações distintas. Questão 903 A hipertricose auricular é uma anomalia genética condicionada por um gene localizado no cromossomo Y. b) Se eu tenho este Y. genes que não possuem homologia com o cromossomo X. determinada por genes localizados no cromossomo Y. Esta observação foi enunciada como "2 Lei de Mendel" ou "Lei da Segregação Independente". b) codominância. e) interação gênica. O cromossomo Y apresenta genes holândricos. c) Se o meu irmão não tiver esse Y. ou seja. em relação ao padrão de cromossomo Y presente na população. aB (25%). Ab (25%). I . As características condicionadas por tais genes são a) transmitidas da mãe para 100% das filhas. e) exclusivas das mulheres. b) o aparecimento do corpúsculo de Barr. por genes holândricos. a determinação cromossômica do sexo é dada pelos cromossomos X e Y. c) em 50% das mulheres e 50% dos homens. d) pleiotropia. Assinale a suposição que está geneticamente coerente: a) Acho que o meu pai herdou essa condição genética da mãe dele. Ab (10%). pode-se afirmar que: a) I e II são situações nas quais os genes segregam-se independentemente. b) transmitidas do pai para 100% dos filhos homens.

analise a figura e as afirmações feitas a seguir. pode-se inferir que ocorreu permutação (ou crossing-over). Em quantos grupos de ligações seus genes estarão associados? a) Quatro. ocorrer permutação entre os locos A e B.6 ( ) A freqüência de recombinação entre os locos A e B é de 17%. d) são pleiotrópicos. b) Seis. d) Dezesseis. pode-se concluir que os genes "a" e "b": a) estão em um mesmo braço do cromossomo. b) seguem as leis do diibridismo. e) Número variável.5% das células formadoras de gametas. Questão 911 Quando dois genes estão em um mesmo cromossomo. no cromossomo. em 8. ( ) Se. ( ) Se. d) Oito. Questão 908 Considere uma espécie de vertebrado cujas células embrionárias têm oito cromossomos. ( ) Considerando o cruzamento ilustrado na figura.5. Em quantos grupos de ligações seus genes estarão associados? a) Dois. Questão 912 A freqüência de recombinação entre os locos A e B é de 10%. A esse propósito. os gametas não recombinantes e os recombinantes surgirão nas proporções esperadas de 1:1:1:1. é de aproximadamente 42%. c) constituem um caso de interação gênica. e) Dez. ( ) A probabilidade do aparecimento de um indivíduo AB//ab. cada tipo de gameta recombinante (Ab e aB) aparecerá com freqüência de 25%. e) são epistáticos. respectivamente. existe uma ligação gênica.c) I e III são situações nas quais ocorre segregação independente e ligação gênica com "crossing-over". A taxa de recombinação entre eles dependerá do quanto estiverem afastados um do outro. 1. Em que percentual serão esperados descendentes de genótipo AB // ab. a partir de progenitores com os genótipos mostrados na figura? 206 . um com genótipo AaBb e outro com genótipo aabb resultou numa F com as seguintes proporções: AaBb = 35% aabb = 35% Aabb = 15% aaBb = 15% Com esses resultados. c) Três. a partir do cruzamento acima indicado. d) II é uma situação na qual ocorre ligação gênica com "crossing-over". em 100% das células germinativas da fêmea. c) Oito. ocorrer permutação entre os locos A e B. em 50% das células produtoras de gametas. e) III é uma situação na qual ocorre ligação gênica sem "crossing-over". Questão 910 O cruzamento de dois indivíduos. Questão 909 Considere uma espécie de vertebrado cujas células somáticas têm 12 cromossomos. b) Quatro.

( ) Em 35% das células gaméticas da F1 ocorreu recombinação.e pilosidade no cálice da flor . c) a primeira situação evidencia ligação gênica e a segunda mostra a segregação independente dos genes. foi observado que todas as plantas que apresentavam flores roxas. sendo que na segunda. Em todos os cruzamentos realizados entre plantas fenotipicamente diferentes e após avaliações em várias gerações segregantes. fenotipicamente (AB). b) a primeira situação pode representar um caso de pleiotropia e a segunda evidencia uma segregação independente dos genes. ( ) Os locos A e B distam entre si de 35 unidades de mapa. em milho. Plantas homozigóticas.6 a) 5% b) 90% c) 45% d) 10% e) 20% Questão 913 Dois fenótipos de interesse econômico. respectivamente. ambos com dominância completa.roxo e branco -. 207 .5.Questão 914 Uma determinada espécie vegetal apresenta variação para cor da flor . cor do hipocótilo . o que mostra uma distância menor entre os genes. A geração P é genotipicamente (AB//AB) x (ab//ab). fenotipicamente (AB). d) em ambas as situações ficou evidenciado o efeito pleiotrópico entre os genes. a ligação é mais forte do que na primeira.5. A F1. A cor roxa da flor e do hipocótilo e a presença de pilosidade são dominantes.6 1. ao cruzarem um duplo heterozigoto para os caracteres cor da flor e pilosidade no cálice da flor com um duplo-recessivo. são determinados. ( ) Em 60% das células formadoras de gametas da F1.roxo e verde . Analise as proposições a seguir quanto à correção. ( ) A taxa de recombinação no caso mostrado é de 30%. e) em ambas as situações ficou evidenciada a ligação gênica. Com base no texto e em seus conhecimentos é correto afirmar que a) a primeira situação pode representar um caso de pleiotropia e a segunda mostra um caso de ligação gênica. foi retrocruzada com o pai duplo-recessivo. ocorreu permutação entre os locos A e B. pelos locos A e B. obtendo-se uma F2 como mostrado no quadro.5.com (piloso) e sem (glabro). o hipocótilo era verde (situação 1). foram cruzadas com plantas de fenótipo (ab). 1.6 ( ) Trata-se de um caso de ligação gênica. Entretanto. foi observada na progênie a seguinte proporção (situação 2): 1. o hipocótilo era roxo e todas as plantas que apresentavam flores de cor branca.

V . O gráfico refere-se ao período posterior à erradicação da malária. uma em cada 30 pessoas apresenta fenótipo normal e é heterozigota quanto ao gene determina a doença de Tay-Sachs. II.A aparência de um indivíduo com respeito a uma dada característica herdada é chamada de fenótipo. por outro lado. II. para um dado "locus". nós dizemos que esta característica é uma característica poligênica. III.Quando três ou mais alelos.3 b) 3 c) 45 d) 60 e) 90 Questão 918 O gráfico a seguir mostra a dinâmica das freqüências do gene s. que possuem efeitos similares e aditivos. Em certas comunidades da Europa Central. provocando a degenerescência nervosa mortal. e há tentativas de tratamento com algum sucesso em poucos casos. enquanto um organismo com dois alelos diferentes para um mesmo "locus" é considerado heterozigoto para este "locus". IV e V e) I. estão presentes na população.Os genes em um mesmo cromossomo tendem a ser herdados juntos e são denominados "genes ligados" II . Em 2. III e IV b) Apenas I. III.5. Os homozigotos siclêmicos morrem precocemente devido à severa anemia. o qual determina a doença chamada siclemia ou anemia falciforme. Quais afirmativas o professor diria que estão corretas? a) Apenas II.7 208 . III .700 casamento ocorridos entre membros sadios dessas comunidades. III e IV c) Apenas I. O diagnóstico pré-natal é possível.Questão 915 Os seguintes conceitos genéticos foram escritos por um aluno que estava com dúvidas sobre a matéria e que pediu a um professor qualificado que os conferisse: I . Qual a explicação para o comportamento das curvas do gráfico? 1. o número esperado de casamentos com risco de gerar crianças com degenerescência nervosa é: a) 0.Quando uma característica particular de um organismo é governada por muitos pares de genes.Um organismo com dois alelos idênticos para um "locus" em particular é considerado homozigoto para este "locus". III e V d) Apenas II. são mais resistentes à malária que os indivíduos normais. IV e V Questão 916 Numa determinada população a capacidade de enrolar a língua é determinada por um gene dominante A. Nessa mesma população foi observado que 64% das pessoas apresentam esta característica. A freqüência esperada de indivíduos heterozigotos será de: a) 70% b) 48% c) 36% d) 16% e) 10% Questão 917 A doença de Tay-Sachs resulta da ação de um gene mutante localizado no cromossomo número 15. dizemos que este "locus" possui alelos múltiplos. IV . os heterozigotos sofrem de uma forma branda da anemia mas. II.

8 e 0.000 é hemofílico. Aa .560.400. Aa . Se. as freqüências dos genes I e i são. Aa . d) 1152 e 48.5. Aa .600. em uma dada população.6.120. b) Seleção contra os portadores do gene s. indique a alternativa que mostra o número de indivíduos para cada genótipo.4/16.9/16. b) AA . c) AA .1.25% b) 12. concluímos que a freqüência de indivíduos homozigotos recessivos (aa) é de: a) 6.000 209 .1/16.5. ao seu alelo recessivo i.400. Questão 922 Numa população. Essa população estará em equilíbrio genético. era de 0. c) AA . b) 1.120. numa população de 1200 pessoas. aa . aa . Aa . um homem em 25.9/16. respectivamente: a) 960 e 240. a) AA . Questão 923 Sabendo-se que uma população está em equilíbrio genético e que a freqüência de indivíduos homozigotos para um caráter autossômico e dominante (AA) é de 25%. 0. aa .1.160.1. os números esperados de pessoas sensíveis e insensíveis nessa população são. b) AA . Nessa população a freqüência do alelo A é a) impossível de se determinar.25.5% c) 25% d) 50% e) 75% Questão 924 Sabendo-se que a freqüência do gene autossômico A é igual a 0.8.000 d) 1/50. Aa .4/16. b) a imigração de muitos indivíduos homozigotos dominantes. se essa população estiver em equilíbrio genético. aa . e) AA .320.16. aa . e) 816 e 384. e) AA .320. d) 0. Constatou-se a diminuição dessa freqüência após a) a morte de 5% da população total por falta de alimento. aa . c) Aumento da freqüência de mutação de S para s. a freqüência de um gene autossômico dominante A é o triplo da freqüência do seu alelo recessivo a. aa . Questão 920 A freqüência de indivíduos afetados por uma anomalia genética autossômica recessiva.1/16. enquanto que a outra metade é composta por indivíduos duplo-recessivos (aa).280.4/16. c) 0. d) o casamento preferencial de indivíduos heterozigotos. Aa . aa .6. b) 768 e 432.2. Questão 921 A sensibilidade (gosto amargo) do ser humano ao PTC (feniltiocarbamida) se deve a um gene autossômico dominante I e a insensibilidade. Sabendo-se que. Aa .560.6/16.1. aa .500 c) 1/25. c) 1008 e 192. c) o nascimento de 48 indivíduos afetados entre 300 nascidos. numa população constituída de 8. Aa .75.1. Questão 925 A hemofilia é causada por um gene recessivo (h) localizado no cromossomo X. a freqüência do gene h nessa população é a) 1/500 b) 1/12.2.6.1/16. d) AA . aa . Aa . e) Cruzamentos preferenciais entre portadores de malária. Questão 919 Considere uma população em que metade dos indivíduos mantém-se heterozigota para um dado gene (Aa).000 indivíduos.a) Diminuição da freqüência de mutação de S para s.8/16.160. numa determinada população.00. respectivamente.6/16. e) 0.280.50.6/16.9/16. e) o crescimento da população da população devido a diminuição da predação.6/16. se as proporções genotípicas forem: a) AA .6/16. d) AA . d) Cruzamentos preferenciais entre pessoas anêmicas.440.280.

16% apresentavam asas vestigiais. Sabendo-se que.5. O alelo que condiciona asas longas é dominante sobre o alelo que condiciona asas vestigiais. que tem sua expressão influenciada pelo sexo.7 1. Questão 930 A calvície na espécie humana é determinada por um gene autossômico C.000 Questão 926 Em uma população em equilíbrio de Hardy-Weinberg. em uma população mantida em laboratório. espera-se que sejam heterozigotos a) 700 b) 420 c) 90 d) 49 e) 21 Questão 927 Analise o heredograma a seguir no qual os símbolos escuros significam a presença de uma anomalia.5. calcularam-se outras freqüências.7 Questão 929 Uma população em que atuam os princípios postulados por Hardy e Weinberg. a freqüência do alelo autossômico (b) é de 30%. o comprimento das asas é determinado por um par de genes. que estão indicadas na tabela abaixo. Assinale a alternativa correspondente aos cálculos corretos. a probabilidade do casal III.1 x III.5. Esse caráter é dominante nos homens e recessivo nas mulheres. como mostra a tabela a seguir: 210 .7 abendo-se que a freqüência de heterozigotos na população é 1/20.2 vir a ter uma criança com a anomalia é a) 1/420 b) 1/160 c) 1/120 d) 1/80 e) 1/50 Questão 928 Em drosófilas.e) 1/100. as freqüências genotípicas de um determinado par de alelos "a" se distribui de acordo com o gráfico destacado: Marque o gráfico que representa a freqüência genotípica após 12 gerações: 1. 1. Se essa população for formada por 1000 indivíduos.

60 e 0. que sempre é influenciada por fatores ambientais.100 e) 900 Questão 933 Sabe-se que olhos escuros são dominantes sobre olhos azuis.550 d) 2. c) a dominância dos genes relacionados com a cor dos olhos modificar-se com o ambiente. qual a freqüência esperada de mulheres cujo genótipo pode torná-las calvas? a) 1% b) 8. Sabe-se também que. Um levantamento nos prontuários médicos de um importante hospital brasileiro identificou o grupo sangüíneo MN de 10.16 e 0. e) tratar-se de um caso de herança quantitativa.900 c) 4. N ou MN. 211 m uma população.7 esta população. em equilíbrio de Hardy-Weimberg.48. a freqüência de indivíduos do grupo M é 49%. há certas proteínas no sangue que permitem classificar as pessoas como pertencentes ao tipo sangüíneo M. A análise da população estudada concluiu que a mesma se encontra em equilíbrio de Hardy-Weinberg.24. considere a informação a seguir. a) 0. Essa característica é determinada por um par de alelos entre os quais não há dominância. as freqüências esperadas de indivíduos dos grupos N e MN são. existem 900 do tipo Rh negativo. enquanto em diversas populações européias acontece o inverso: pessoas de olhos escuros constituem a minoria.1.5.7 . b) a mecanismo de herança da cor dos olhos não ser ainda bem conhecido.24 e 0. b) 0.5% c) 19% d) 42% e) 81% Questão 931 Para responder à questão. Essa diferença deve-se fato de a) a herança da cor dos olhos não obedecer às leis de Mendel. as freqüências dos alelos M e N são.48 e 0.36 e 0. d) a freqüência dos alelos para olhos escuros ser maior nas populações sul-americanas do que nas européias.5. Questão 932 Numa população em equilíbrio de Hardy-Weinberg. respectivamente. na maioria das populações da América do Sul predomina o número de pessoas de olhos escuros.84. onde 81% dos homens não apresentam genótipo capaz de torná-los calvos. Espera-se que o número de indivíduos Rh positivo homozigoto nessa população seja de a) 9.000 indivíduos revelando os dados apresentados no quadro abaixo. e) 0. Questão 934 Na espécie humana. c) 0.16.000 indivíduos. Se em uma população em equilíbrio de Hardy-Weinberg.40.100 b) 4. formada por 10. 1. d) 0.

c) à seleção natural. ausentes e) Pequena. os genótipos AA.56 c) 0.(I). pelo menos. atuantes Questão 937 Em uma população composta de 100 mil indivíduos. uma geração. (08) Com informações sobre os valores das freqüências gênicas. O alelo dominante A condiciona o fenótipo D e ocorre com a freqüência p. Com base nesses dados. ao acaso. Com o tempo.44 e 0. ausentes d) Pequena. numa população. Questão 936 Tamanho . (32) Quando todas as freqüências genotípicas são iguais. Preenchem correta e respectivamente as lacunas (1). Se em uma dada população em equilíbrio de Hardy-Weinberg 9% dos indivíduos são albinos.25.(2). (2) e (3): a) Infinitamente grande. a) 9% e 42% b) 17% e 34% c) 18% e 21% d) 21% e 18% e) 34% e 17% Questão 935 Suponha que uma variedade de determinada planta possua um gene que lhe confere vantagem em relação a uma outra variedade da mesma população. atuantes b) Infinitamente grande.. (02) No equilíbrio.. respectivamente.. p e q.... atuantes c) Infinitamente grande.6. é correto afirmar que a freqüência dos alelos A e a será respectivamente: a) 0... são esperados 160 indivíduos com o fenótipo R. a freqüência esperada de heterozigotos normais é a) 91 % b) 75% c) 49% d) 42% e) 21% Questão 940 Um par de genes determina resistência a um fungo que ataca a cana-de-açúcar e os indivíduos suscetíveis (aa) apresentam freqüência de 0. com p=0. e fatores evolutivos . d) ao seu efeito dominante. e) à oscilação genética.. ao acaso. (16) O conhecimento das freqüências genotípicas é suficiente para se determinar a condição da população quanto ao equilíbrio. são condições para que.50 e 0. 2pq e q£. 24 mil apresentam o genótipo AA e 36 mil apresentam o genótipo aa. assinale o que for correto.50 d) 0. (64) A população está em equilíbrio apenas quando 75% dos indivíduos apresentam o fenótipo D e 25% apresentam o fenótipo R. é possível determinar se a população está ou não em equilíbrio. para essa característica. a população não está em equilíbrio.34 e 0.56 e 0. Aa e aa são encontrados com as freqüências p£.. (01) A população está em equilíbrio se estiver ocorrendo seleção natural há. Questão 939 Na espécie humana.. direcionados. Em uma população que está 212 . cruzamentos .66 Questão 938 Uma população de roedor está sendo estudada quanto ao equilíbrio de Hardy-Weinberg para uma característica determinada por um locus autossômico. direcionados.respectivamente.. de acordo com Hardy e Weinberg. O alelo recessivo a é responsável pelo fenótipo R e tem freqüência q. e das freqüências fenotípicas.44 e) 0.49 e 0. o albinismo é determinado por um alelo autossômico recessivo. b) às mutações que continua a sofrer.. (04) Em uma amostra de 1000 indivíduos de uma população em equilíbrio.(3). Então. a freqüência desse gene tende a aumentar devido a) ao fato de ser recessivo. as freqüências gênicas e genotípicas se mantenham constantes ao longo das gerações. ao acaso.51 b) 0.

dos quais 45 apresentam um fenótipo determinado por gene recessivo.em equilíbrio de Hardy-Weinberg. a) 25%. Questão 942 Numa população em equilíbrio. que se cruza ao acaso. permanecem constantes. nas populações. A probabilidade de ocorrência de indivíduos heterozigotos nessa população é a) 84%. as populações sejam panmíticas. respectivamente. e) a probabilidade de ocorrência de homozigotos nessa população é de 52%. 15% e 15%. b) 40%. Questão 943 Uma população em equilíbrio é constituída de 500 indivíduos. Aa e aa numa população em equilíbrio. e) 24%. Questão 944 A cor da raiz da cenoura é controlada por um par de genes autossômicos. em uma população. O gene B é responsável pela cor branca e seu alelo recessivo. geração após geração. c) o gene dominante é mais freqüente que o recessivo. que podem desaparecer. das quais 12. é necessário que: ( ) não haja pressão de seleção natural. Questão 945 G. ocorram ao acaso. e de cada genótipo. H. 10% e 10%. ( ) não ocorram fluxos migratórios. Aa e aa é. segundo os referidos autores. b) a freqüência de heterozigotos nessa população é de 24%. a freqüência de heterozigotos será: a) 15% b) 25% c) 50% d) 75% e) 100% Questão 941 O gráfico mostra as relações entre as freqüências dos alelos A e a e as freqüências genotípicas AA. A partir dessas informações pode-se afirmar que a) a freqüência do gene para coloração amarela é de 36% nessa população.800 desenvolveram plantas com raízes brancas. c) 50%. b) 60%. d) 36%. que surjam por mutação. Weinberg postularam que. 50% e 25%. c) 48%. Com base nesses dados é INCORRETO afirmar-se que a) a freqüência de indivíduos com fenótipo dominante é 91% b) cerca de 10% da população é homozigota. e) os heterozigotos representam 42% da população. . A probabilidade de se encontrarem indivíduos AA. d) 70%. Hardy e W. Para que isso ocorra. ( ) os novos alelos.000 sementes de uma população panmítica. d) a probabilidade de formação de gametas B é de 80% nessa população. 30% e 30%. ou seja. os quais acarretam troca de alelos entre populações diferentes. sob condições especiais. d) 30% dos gametas produzidos carregam o alelo recessivo. uma vez que esta tende a selecionar determinados alelos em detrimento de outros.7 Numa população em equilíbrio. se 213 1. em que os casamentos ocorrem ao acaso e a freqüência dos genes A e a é de 50% para cada um. a freqüência de indivíduos Rh negativos é de 16%. Um agricultor colheu 20. 25% e 25%. e) 80%. pela cor amarela.5. as freqüências dos alelos. c) a freqüência de plantas com raízes amarelas será de 64% se a população se mantiver em equilíbrio. ( ) os cruzamentos.

Em uma população de cem animais. é necessário que a) a população seria infinitamente grande. seleção natural e migrações. observada ao longo de gerações. b) Somente as afirmativas 1 e 2 são verdadeiras. Se houver 48 heterozigotos. b) não houve a atuação dos fatores evolutivos sobre a população. c) a população encontra-se em equilíbrio genético. 3. tais como mutação. utiliza-se a fórmula p£ + 2pq + q£ = 1. seleção natural e migrações. c) 3/10. ( ) nas populações demasiadamente pequenas. tais como mutação. os cruzamentos ocorram de modo preferencial e esteja sujeita a fatores evolutivos.7. na qual p indica a freqüência do alelo dominante e q indica a freqüência do alelo recessivo. c) Somente as afirmativas 1 e 3 são verdadeiras. os cruzamentos ocorram de modo preferencial e esteja isenta de fatores evolutivos. b) o tamanho da população seja reduzido. 2. Se houver 30 heterozigotos. d) a população seja de tamanho reduzido. tais como mutação. Com relação a essa população. inviabilizando a aplicação do teorema. Questão 950 Numa população a freqüência do gene dominante W é 0. Assinale a alternativa correta. A probabilidade de um indivíduo desta população ser heterozigoto Ww é igual a: a) 9/100. é possível que a seleção natural seja a causa do aumento do número de heterozigotos. tais como mutação.incorporem rapidamente ao estoque gênico. Questão 949 De acordo com a Teoria de Hardy-Weimberg. Em 214 . sendo a cor azulada determinada por um alelo recessivo e a cor castanha. Qual o percentual da população que possui a vantagem heterozigótica? a) 9% b) 19% c) 42% d) 81% e) 91% Questão 947 Em 1908. e) 1/2. seleção natural e migrações. a partir de seu estabelecimento. por um dominante. os cruzamentos ocorram ao acaso e esteja sujeita a fatores evolutivos. Se os valores das freqüências gênicas de uma população. e) os cruzamentos nessa população ocorrem ao acaso. A endogamia pode ser a causa do desvio em relação ao equilíbrio de Hardy-Weinberg. a) Somente a afirmativa 1 é verdadeira. pode-se concluir corretamente que: a) a população estudada é infinitamente grande. Questão 951 No estudo da genética de populações. Ela não pode estar em equilíbrio de Hardy-Weinberg. em uma população em equilíbrio genético as freqüências gênicas e genotípicas permanecem constantes ao longo das gerações. os cruzamentos ocorram ao acaso e esteja isenta de fatores evolutivos. d) a população está evoluindo. d) 42/100. b) 49/100. seleção natural e migrações. foram encontrados 16 azuis. Questão 946 Numa certa população de africanos. forem significativamente diferentes dos valores esperados através da aplicação do teorema. c) a população seria infinitamente grande. as cores externas das conchas são determinadas por dois alelos de um gene. e) Somente as afirmativas 3 e 4 são verdadeiras. os cruzamentos sejam ao acaso. 9% nascem com anemia falciforme. considere as seguintes afirmativas: 1. 4. Para tanto. se houver 76 animais castanhos. ela estará em equilíbrio de Hardy-Weinberg. uma vez que as freqüências gênicas foram alteradas. os cientistas Hardy e Weinberg formularam um teorema cuja importância está no fato dele estabelecer um modelo para o comportamento dos genes nas populações naturais. d) Somente as afirmativas 2 e 4 são verdadeiras. Questão 948 Em mexilhões.

c) reproduzam-se.0. Questão 952 Sabendo-se que a freqüência de um gene recessivo a. Aa . Questão 954 Cientistas conseguiram inserir um grande trecho de ADN estranho ao ADN de cobaias como mostra o desenho a seguir: O resultado esperado para este trabalho é que as células que receberam o implante: a) morram pela presença de ácido nucléico estranho à composição do núcleo.25.1 d) AA . testes de paternidade.5. ou dos diferentes genótipos.72. se estiver em equilíbrio. aa .81. 1. produzindo células defeituosas incapazes de sobreviver.1 215 .0.5.0.0. numa porcentagem de 9%.5 e o genótipo homozigoto recessivo tenha freqüência q£=0.0. Aa . b) 61%.0. c) 50%. b) haja manutenção do tamanho da população ao longo das gerações.0. serão: a) AA . as freqüências genotípicas esperadas para essa população.9.8.25.0. numa população. terapia gênica. d) reproduzam-se. Verificou-se que existiam. Assim. etc. e) cresçam.0.1.50. o genótipo heterozigoto tenha freqüência 2pq=0.18. estudou a estrutura da molécula de DNA e seu funcionamento e analisou os dados do quadro a seguir.0. engenharia genética. Aa .0. seja igual a 1. b) morram por ficarem prejudicadas na realização da síntese protéica. aa . e) 42%.09.01 b) AA .1 e) AA . d) a somatória da freqüência dos diferentes alelos.uma população em equilíbrio de Hardy-Weinberg espera-se que a) o genótipo homozigoto dominante tenha freqüência p£=0.0. Aa .0. c) os alelos que expressam fenótipos mais adaptativos sejam favorecidos por seleção natural. portadores de sangue do tipo N.25. e) ocorra manutenção das mesmas freqüências genotípicas ao longo das gerações. d) 49%.81.0.1 Questão 955 João ficou intrigado com a grande quantidade de notícias envolvendo DNA: clonagem da ovelha Dolly. produzindo anticorpos contra as proteínas estranhas que serão fabricadas. é 0. transferindo as características implantadas para as células-filhas. aa . 1.0. Aa .18. a freqüência dos indivíduos do grupo MN dessa população é de: a) 79%. aa . Para conseguir entender as notícias.09.25 Questão 953 Os grupos sanguíneos de uma população foram estudados no que se refere ao sistema MN dos seus indivíduos. aa .01 c) AA .8.

Para conseguir entender as notícias.8. pois esses organismos são formados por uma única célula.1 m I está representado o trecho de uma molécula de DNA. evidenciando a universalidade da estrutura do DNA. uracila. podem existir 5 diferentes tipos de bases nitrogenadas. Questão 957 A identificação da estrutura do DNA foi fundamental para compreender seu papel na continuidade da vida. c) pares diferentes em diferentes células de uma espécie. Relacionando esse valor com o emparelhamento específico das bases. b) DNA. cada molécula de DNA dá origem a 4 moléculas de DNA exatamente iguais. b) na molécula de DNA. c) a quantidade de A presente em uma das cadeias é exatamente igual à quantidade de A da cadeia complementar. G = 10% d) T = 40%.1 1. testes de paternidade. o que garante a diversidade da vida. e) pares específicos somente nas bactérias. d) na molécula de DNA. 1. Essa substância se denomina a) DNA. c) RNA. C = 10%. timina. e é formada por cadeias polinucleotídicas que apresentam em sua composição as bases nitrogenadas adenina. C = 10%. citosina e guanina. detectou-se que 40% de suas bases nitrogenadas eram constituídas por Adenina. como resultado da diferenciação celular. b) pares diferentes de acordo com a espécie considerada. 216 . e) no processo de mitose. um estudo pioneiro determinou a proporção das bases nitrogenadas que compõem moléculas de DNA de várias espécies. e é formada por cadeias polinucleotídicas que apresentam em sua composição as bases nitrogenadas adenina. citosina e guanina. os valores encontrados para as outras bases nitrogenadas foram: a) T = 40%. sendo responsável pelo controle do seu metabolismo. guanina e timina. Questão 958 As técnicas utilizadas pela Engenharia Genética permitem que se atue em uma substância presente em todas as células. C = 40%. Na década de 1950. citosina.nalisando-se o DNA de um animal. d) pares específicos apenas nos gametas. pode-se concluir que: a) a molécula de DNA é formada por 2 cadeias caracterizadas por seqüências de bases nitrogenadas. Observando o quadro. etc. estudou a estrutura da molécula de DNA e seu funcionamento e analisou os dados do quadro a seguir. podem existir diferentes tipos de complementação de bases nitrogenadas. terapia gênica. G = 10% e) T = 40%. G = 60% Questão 956 João ficou intrigado com a grande quantidade de notícias envolvendo DNA: clonagem da ovelha Dolly.5. G = 40% b) T = 10%.5. pois essas células são responsáveis pela perpetuação das espécies. e é formada por cadeias polipeptídicas que apresentam em sua composição os aminoácidos adenina. C = 20%.8. engenharia genética. C = 60%. comparação das proporções permitiu concluir que ocorre emparelhamento entre as bases nitrogenadas e que elas formam a) pares de mesmo tipo em todas as espécies. procariontes e eucariontes. G = 40% c) T = 10%.

por centenas de gerações. Assinale a alternativa correta em relação à porcentagem de guanina. novos métodos de diagnóstico foram desenvolvidos e utilizados para inúmeros fins (identificação de microrganismos patogênicos. d) expressarem genes diferentes.4% ? Guanina ? 21. entre outros). Homem Boi 217 . e é formada por aminoácidos que apresentam em sua composição a ribose. Questão 963 Em um organismo. Questão 959 Uma molécula de DNA apresenta uma dupla hélice de cadeias polinucleotídicas.0 e) 30. Assinale a afirmação correta. medicina forense. mas não o RNA. d) 200 apresentavam o DNA e o RNA marcados. Questão 964 Um pesquisador que pretende estudar comparativamente a síntese de DNA e RNA em uma célula deve usar nucleotídios radiativos contendo a) timina e uracila.6 e 21. não se encontra no núcleo da célula. Nela identificamos 20% de adenina. a) 20% b) 30% c) 40% d) 50% e) 60% Questão 960 Depois da descoberta da estrutura da molécula do Ácido Desoxirribonucléico (DNA ou ADN). a) A molécula de DNA é constituída por uma fita única e por vários nucleotídeos que têm a transcrição como principal função. produzindo 800 bactérias. b) 200 apresentavam o DNA marcado. testes de paternidade. células musculares e células nervosas diferem principalmente por: a) possuírem genes diferentes. respectivamente: a) 19. Adenina 30.0 Questão 962 Bactérias foram cultivadas em um meio nutritivo contendo timina radioativa. nos DNAs do homem e do boi. mas não o RNA.4 c) 29.0 e 30.6 e 29. d) A molécula de DNA tem função de duplicação e é constituída por uma fita dupla. c) citosina e guanina. foram isoladas 100 bactérias e transferidas para um meio sem substâncias radioativas. e) utilizarem código genético diferente. nos organismos eucariontes. b) possuírem ribossomos diferentes. b) guanina e timina. e é formada por aminoácidos que apresentam em sua composição a desoxirribose. mas não o RNA. c) possuírem cromossomos diferentes. e) todas apresentavam o DNA e o RNA marcados.0 e 30. Essas bactérias sofreram três divisões no novo meio. d) adenina e timina. e) citosina e uracila. adenina e guanina.4 e 21.4 d) 19. A análise dos ácidos nucléicos mostrou que dessas 800 bactérias a) 100 apresentavam o DNA marcado.d) polimerase. e) transcriptase. sendo que cada filamento é composto por vários nucleotídeos.0% As porcentagens que estão faltando para o homem e para o boi são.0 b) 21. e) A molécula de DNA. c) 400 apresentavam o DNA marcado. Questão 961 A tabela mostra a composição das bases nitrogenadas púricas. b) A molécula de DNA nas bactérias se encontra na carioteca da célula. c) A molécula de DNA não é capaz de produzir a molécula de RNA. mapa genético. Dessa cultura.

d) ácido fosfórico. b) citosina é igual a de timina. b) origina o RNA mensageiro c) reproduz-se de modo semiconservativo.8. é CORRETO afirmar que a) possui a base nitrogenada uracila. b) uracila é uma base nitrogenada exclusiva do DNA. Questão 969 Moléculas de DNA constituídas por duplo filamento helicoidal mantêm as cadeias unidas entre si por a) ligações covalentes. d) é integrante dos genes e dos cromossomos. base nitrogenada e desoxirribose.5. d) citosina é igual a de adenina. respectivamente a) desoxirribose. d) é integrante do nucléolo e dos ribossomos. ribose e base nitrogenada. Questão 972 O DNA e o RNA quanto à sua estrutura química. O fato nos permite afirmar que os nucleotídeos a) ocorrem em igual quantidade. Questão 966 Na figura a seguir que representa o modelo da molécula de DNA os números 1. Questão 971 Sobre o DNA. d) ácido fosfórico só entra na composição química do DNA. Questão 968 Comparando as estruturas dos ácidos nucléicos desoxirribonucléico (DNA) e ribonucléico (RNA) pode-se afirmar que a) timina é uma base nitrogenada exclusiva do RNA. e) ácido fosfórico. a quantidade de a) adenina é igual a de citosina. ácido fosfórico e base nitrogenada.1 Questão 967 Numa molécula de DNA. c) guanina é igual a de citosina. c) pontes de hidrogênio. e) ligam-se como se fossem o corrimão de uma escada. ácido fosfórico e base nitrogenada. o mesmo ocorrendo com a guanina e citosina-nucleotídeos. desoxirribose e base nitrogenada. é INCORRETO afirmar que a) possui a base nitrogenada uracila. e) timina pareia com adenina no RNA. Questão 970 Sobre o DNA. . d) pontes de nitrogênio. b) nucleoproteínas. e) é formado de dupla cadeia com formato helicoidal. e) ligação metálica. b) ligações iônicas. b) ocorrem aos pares na molécula de DNA. são classificados como a) polipeptídeos. 218 1. c) púricos pareiam com outros púricos. c) ribose. b) não origina o RNA mensageiro c) não é capaz de replicar-se. e) adenina é igual a de uracila. 2 e 3 indicam. e) é formado de dupla cadeia com formato helicoidal. c) ribose é um açúcar que entra na composição química do RNA.Questão 965 Importante informação que permitiu o estabelecimento de um modelo para a molécula de DNA foi a verificação de que o número de adenina-nucleotídeos era sempre igual ao de timina-nucleotídeos. d) pirimídicos pareiam com outros pirimídicos. b) ácido fosfórico. c) polissacarídeos.

Questão 977 Na molécula de DNA. ribose e ácido fosfórico. Questão 974 Qual das seguintes moléculas NÃO entra na composição química do DNA? a) Ribose. Questão 978 Comparando as estruturas dos ácidos desoxirribonucléico (DNA) e ribonucléico (RNA) NÃO se pode afirmar que a) timina é uma base nitrogenada exclusiva do DNA. 1. respectivamente. ribose e base nitrogenada. desoxirribose e base nitrogenada. b) uracila é uma base nitrogenada exclusiva do DNA. 2 e 3. b) Citosina. base nitrogenada e ácido fosfórico. b) ácido fosfórico. d) Adenina. c) nucléolo e cloroplasto. Questão 975 Se um segmento de DNA possui a seqüência de bases nitrogenadas TTA CCG ATT ATG. c) ribose é um açúcar que entra na composição química do RNA.8. c) desoxirribose. d) lisossomo e ribossomo. b) citosina é igual a de timina. e) mitocôndria e cloroplasto. sabendo-se que a figura adiante representa a unidade estrutural do ácido desoxirribonucléico (DNA). Questão 979 Assinale a alternativa que relaciona corretamente o nome das moléculas representadas pelos números 1. e) timina pareia com adenina no DNA. d) citosina é igual a de adenina.d) fosfatídeos. e) base nitrogenada. d) ácido fosfórico. c) Adenina. b) UUT GGC TUU UAC. d) Uracila. e) Guanina. c) TTA CCG ATT ATG. desoxirribose e ácido fosfórico. a quantidade de a) adenina é igual a de citosina. Questão 973 Qual das seguintes bases nitrogenadas NÃO entra na composição química do DNA? a) Timina. pode-se afirmar que a cadeia complementar a esse segmento terá a seqüência a) AAT GGC TAA TAC. e) adenina é igual a de timina. d) ácido fosfórico entra na composição química do DNA e do RNA. b) ribossomo e cromossomo.1 219 . a) base nitrogenada. e) AAU GGC UAA UAC. e) polinucleotídeos. c) Ácido fosfórico.5. d) AAT GGC TAA UAC. Questão 976 Observa-se a presença de DNA nos seguintes organóides citoplasmáticos a) mitocôndria e ribossomo. c) guanina é igual a de adenina. e) Guanina. b) Desoxirribose.

centríolos e cromossomos. Questão 988 Num dado organismo. Citosina = 20% e Timina = 30% b) Adenina = 20%. Timina = 34% e Adenina = 16% Questão 984 Numa molécula de DNA formada por uma dupla-hélice a quantidade de a) adenina é igual a de citosina. b) protozoários. Adenina = 35% e Timina = 15% d) Citosina = 15%. cromossomos e complexo de Golgi. d) enzimas. e) ocorre nos cromossomos. c) ausência de ácido fosfórico. Assinale a alternativa que relaciona corretamente as outras bases nitrogenadas e suas respectivas proporções: a) Citosina = 15%. Questão 985 Assinale a alternativa que relaciona as estruturas celulares em se observa a presença de DNA: a) membrana plasmática. e) lipídios. e) bactérias. Questão 981 É característica do DNA: a) açúcar com quatro átomos de carbono. e) vacúolos. b) centríolos. c) polinucleotídeos. a) Adenina = 20%. Timina = 16% e Adenina = 16% d) Guanina = 34%. c) adenina é igual a de uracila. ribossomos e centríolos. ribossomos e cromossomos. centríolos e lisossomos. e) lisossomos. Citosina = 40% e Timina = 40% e) Adenina = 40%. d) citosina é igual a de adenina. Adenina = 15% e Timina = 35% Questão 983 Uma molécula de DNA contém 16% de Citosina. Timina = 34% e Adenina = 16% e) Guanina = 34%. d) ser um polipeptídeo. mitocôndrias e cromossomos. Watson e F. complexo de Golgi e cromossomos. Questão 982 Uma molécula de DNA contém 15% de Guanina. b) cloroplastos. b) presença das bases nitrogenadas uracila. Assinale a alternativa que contém a porcentagem correta de cada uma das demais bases nitrogenadas.Questão 980 O modelo molecular dos ácidos nucléicos (DNA e RNA) foi proposto por J. complexo de Golgi e ribossomos Questão 986 Sabemos que os genes são constituídos de DNA e estão localizados nas seguintes estruturas celulares: a) lisossomos. c) retículo endoplasmático. d) membrana plasmática. c) ribossomos. Adenina = 15% e Timina = 15% c) Citosina = 15%. Segundo esse modelo esses ácidos são a) micromoléculas. b) polipeptídeos. Citosina = 30% e Timina = 40% 220 . o conteúdo de guanina no seu DNA é 30%. cromossomos e mitocôndrias. Timina = 16% e Adenina = 16% b) Guanina = 16%. Assinale a alternativa que relaciona corretamente as outras bases nitrogenadas e suas respectivas proporções? a) Guanina = 16%. e) guanina é igual a de citosina. Citosina = 30% e Timina = 20% c) Adenina = 30%. Crick em 1953. Timina = 34% e Adenina = 34% c) Guanina = 34%. citosina e adenina. Citosina = 30% e Timina = 30% d) Adenina = 30%. Adenina = 15% e Timina = 15% b) Citosina = 35%. d) cloroplastos. cromossomos e lisossomos. Questão 987 As evidências de que o DNA é a substância hereditária que determina as características dos seres vivos foram primeiramente observadas em a) vírus. Adenina = 35% e Timina = 35% e) Citosina = 15%. guanina. d) liquens. c) ácaros. b) citosina é igual a de timina.

Seu açúcar é a desoxirribose. somente. obtido de um dos cromossomos X de cada mulher e da menina. c) o DNA viral é destruído pela bactéria. Uma de suas bases nitrogenadas é a timina. IV.8.b b) I . As seqüências de bases do referido trecho gênico estão esquematizadas adiante: 1. É constituído por uma única cadeia de nucleotídeos.1 221 . I. e) I. somente. b) o DNA viral se incorpora ao cromossomo bacteriano.2 .a d) II . III e IV. II. c) translocação. Com Timina 2. porém com os segmentos trocados. Possui capacidade de autoduplicação.8. 1.1 a) II . b) duplicação. Transcrição b. Foi realizada a análise de um mesmo trecho do DNA. d) II. e) deleção. Dupla hélice Composição Questão 992 Supondo que ocorra um evento genético raro em que dois cromossomos não-homólogos. e) há grande multiplicação do DNA viral no interior da bactéria. somente. estaríamos verificando a ocorrência de a) crossing-over. II.1 . Síntese protéica São características do ácido desoxirribonucléico (DNA): 1.5.2 . somente.Questão 989 O esquema a seguir mostra um tipo de ciclo reprodutivo dos bacteriófagos. c) I. de uma mesma célula.5. d) inversão. Questão 993 Duas mulheres disputam a maternidade de uma menina. Com Uracila Função a. São corretas a) II e III.1 . Questão 991 Os itens abaixo se referem aos ácidos nucléicos: Estrutura I.b e acordo com o esquema.a c) II . verifica-se que a) ocorre lise da bactéria no fim do ciclo. III e IV.1 . b) II e IV. III e IV.a e) I . Questão 990 Considere as características do DNA abaixo discriminadas. d) as bactérias perdem a capacidade de se dividir. III. quebram-se e voltam a se soldar. Cadeia simples II.

e) As enzimas RNA e DNA polimerase.5. os vinte tipos diferentes de aminoácidos.. DNA e RNA. já é possível detectar por meio de exames de DNA (ácido desoxirribonucleico) a probabilidade de uma pessoa desenvolver doenças (. e) base nitrogenada. tentando reproduzir "in vitro" a síntese de moléculas de DNA.Os dados obtidos a) são suficientes para excluir a possibilidade de qualquer uma das mulheres ser a mãe da menina. no segmento correspondente da cadeia complementar há 10 adeninas e 30 guaninas.). d) base nitrogenada e de fosfato. c) 15 guaninas. assinale a alternativa que indica. b) 20 timinas. timina. c) base nitrogenada e de açúcar. apenas. Questão 996 Considere que um cientista esteja. d) 10 uracilas. é: 1. d) A enzima DNA polimerase. apenas. só existe um gene para cada molécula de DNA. contendo as bases nitrogenadas adenina.8. d) não são suficientes. c) em todos os organismos. a) Quatro diferentes tipos de nucleotídeos. e) não podem ser considerados. DNA e RNA. transportador e ribossômico) e DNA. os três tipos de RNA (mensageiro. citosina e guanina. 10/08/97) Sabe-se que o citado mapeamento é feito a partir do conhecimento da seqüência de bases do DNA. b) são suficientes para excluir a possibilidade de uma das mulheres ser a mãe da menina. d) as estruturas espaciais e moleculares do DNA e RNA são 222 . Questão 997 TESTES GENÉTICOS: A Ciência se antecipa à doença Com o avanço no mapeamento de 100 mil genes dos 23 pares de cromossomos do núcleo da célula (projeto Genoma. as moléculas imprescindíveis que ele deve utilizar para que possa atingir o seu objetivo. (O GLOBO. iniciado em 1990. a enzima DNA polimerase e DNA. vinte tipos diferentes de aminoácidos. guanina. Com base nos conhecimentos sobre o tema. e) 10 adeninas. b) base nitrogenada. a enzima RNA polimerase. Questão 994 Com relação à composição química. apenas.. b) Os nucleotídeos contendo as bases nitrogenadas timina. conclui-se que nos segmentos de RNA originários desse DNA haverá a) 30 citosinas. é correto afirmar que: a) todas as trincas da molécula do mRNA especificam algum aminoácido. pois a menina recebe seus dois cromossomos X da mãe e apenas um deles foi analisado. O esquema abaixo que representa o pareamento típicos de bases encontradas na molécula de DNA. pois uma menina não recebe cromossomo X de sua mãe. Questão 995 Em um segmento de cadeia ativa de DNA há 20 adeninas e 15 guaninas. as moléculas de DNA e RNA diferem entre si quanto ao tipo de a) açúcar. corretamente. adenina e citosina. pois o cromossomo X da menina analisado pode ser o de origem paterna.1 Questão 998 Tendo em vista a estrutura e a função dos ácidos nucléicos. em um laboratório. de açúcar e de fosfato. b) as moléculas do ácido ribonucléico (RNA) são hélices duplas de polirribonucleotídeos. c) não são suficientes. RNA mensageiro e DNA. nos EUA). apenas. Com base nesses dados. c) As enzimas RNA e DNA polimerase.

após a diferenciação e a especialização das células. mas são incapazes de se expressar. e) as duas metades da hélice dupla do DNA têm seqüências iguais de bases nitrogenadas. sugere análise de DNA. b) seu DNA era composto por bases nitrogenadas. e) seus genes para o tipo de pelagem localizavam-se no DNA mitocondrial. Considerando-se essa informação e conhecimento sobre o assunto.5. "Folha de São Paulo". c) Genes que possuem. Questão 999 Leia o texto a seguir. d) suas moléculas de DNA apresentavam estrutura helicoidal. que podem ser observadas nestas representações esquemáticas: 1.5. 07/07/2006. EXCETO a) Forma ou localização dos seus núcleos. Questão 1002 Um laboratório recebeu três amostras de DNA para investigar se pertenciam a espécies diferentes. Mamutes podem ter tido pêlo "loiro".8. d) os genes responsáveis pelo sistema sangüíneo ABO estão presentes nas células epiteliais. reduz-se. É uma das primeiras vezes em que os genes de um bicho extinto dão pistas sobre características suas em vida. b) o número total de genes. c) os genes cuja atividade não é necessária ao funcionamento de uma célula perdem a capacidade de duplicação. é possível afirmar corretamente que: a) seus genes estavam dispostos em cromossomos circulares. A quantidade e a relação entre as bases das amostras estão apresentadas nesta tabela: 1.diferentes. Questão 1001 Células provenientes de um indivíduo foram examinadas ao microscópio e revelaram diferenças estruturais.8. Em relação às características genéticas deste mamífero. de exemplares mortos há 43 mil anos na Sibéria. que. c) seus genes estavam organizados nos plasmídeos.1 223 . ribose e fosfato. O mamífero-símbolo da Idade do Gelo provavelmente tinha dois tipos de pelagem: castanho-escuro e loiro. A inferência vem diretamente do DNA do mamute-lanoso ('Mammuthus primigenius').000 genes. codificam proteínas. b) Funções que realizam. Questão 1000 Sabe-se que o homem possui em torno de 80.1 odas as alternativas apresentam diferenças entre essas células. d) Tecidos a que pertencem. entre outras funções. é CORRETO afirmar que a) o genótipo das células do tecido nervoso é diferente do genótipo das células do tecido epitelial.

inicialmente. cresceram diversas gerações das bactérias em N¢¥ (isótopo leve) e extraíram o DNA das sucessivas gerações (gerações F0. d) as amostras 1 e 3 apresentam alta homologia entre seus DNAs.0. Questão 1005 Considerando que na figura a seguir tem-se uma representação plana de um segmento da molécula de DNA.1 A partir desse experimento pode-se afirmar que: ( ) todas as moléculas da geração F1 terão a densidade intermediária entre a pesada e a leve.5% terão a densidade intermediária em F3.4. respectivamente: a) 19. mediante precipitação baseada em suas diferentes densidades.5.0.8.0. b) 21. ( ) A composição do meio de cultura não exerceu influência no experimento uma vez que a bactéria cresceu em todos os meios.4 e 21.4 % Guanina = ? Cão: Adenina = ? Guanina = 21.6 e 29. c) a amostra 2 apresenta DNA de fita simples. e) 30.om base nas informações dessa tabela e em outros conhecimentos sobre o assunto. c) 29. 1. Questão 1003 A composição das bases púricas adenina e guanina do DNA do homem e do cão são as seguintes: Homem: Adenina = 30. 'Escherichia coli' (geração F0) na presença de N¢¦ (isótopo pesado).0 % As percentagens que estão faltando para o homem e cão são.5. é INCORRETO afirmar que a) as três amostras são provenientes de diferentes espécies. cultivaram. conforme esquematizado abaixo. que as fitas de DNA serviam de modelo para sua própria replicação. em 1957. como foi antecipado por Watson e Crick. ( ) eles concluíram. Posteriormente. analise as proposições a seguir. b) a amostra 3 possui o mais alto conteúdo de pares de bases A e T. ( ) a tendência da fita de DNA pesada é desaparecer no decorrer das gerações.1 224 . F1 . Questão 1004 Meselson e Stahl.4. 1. ( ) metade das moléculas da geração F2 terão a densidade leve e apenas 12.0 e 30.6 e21. d) 19.0 e 30.8.F2 e F3).

2) Um nucleotídeo com Timina (T) em uma cadeia pareia com um nucleotídeo com Adenina (A) em outra cadeia." (Griffiths. onde existia o ¢¥N como única forma de nitrogênio. sendo o restante não-híbrido. essas bactérias foram transferidas para um novo meio. o qual se incorporou nas moléculas de DNA.8. sendo aplicadas a plantas e animais. sendo uma híbrida e outra não.5. Rio de Janeiro: Guanabara Koogan. Assinale a alternativa que define o que é um gene.F.. 3 e 4 Questão 1006 Na figura a seguir é ilustrado um processo muito importante para a vida. uma molécula do açúcar desoxirribose (II) e uma molécula de base nitrogenada. de plantas transgênicas. c) ao término da 2 geração. a) ao final da 1 geração. a) Um gene é um cromossomo da célula vegetal ou animal. mas hoje as mesmas técnicas estão . d) ao final da 2 geração. (. Questão 1008 Gerações sucessivas de bactérias da espécie 'Escherichia coli' foram cultivadas num meio cuja única fonte de nitrogênio era o isótopo ¢¦N. et al.1 a) Produção de proteína b) Transcrição do RNA c) Produção de RNAribossômico d) Helicoidização do DNA e) Replicação do DNA Questão 1007 Um tema que vem despertando grande polêmica no Brasil atualmente é a liberação. Analise-o e assinale a alternativa que indica corretamente qual é este processo.) Um nucleotídeo é formado por um grupo fosfato (I). os cientistas produziram plantas que brilham porque expressam os genes de bioluminescência dos vaga-lumes. cada molécula híbrida de DNA formará duas moléculas. Em relação ao experimento. que são aqueles em cujo genoma foi introduzido um gene de uma outra espécie ou mesmo um gene produzido em laboratório. A. nesse novo meio. c) Um gene é uma proteína que tem função específica em uma determinada rota metabólica. "Introdução à Genética". 3) Um nucleotídeo com Guanina (G) em uma cadeia pareia com um nucleotídeo com Citosina (C) em outra cadeia. 225 1. 4) Pontes de hidrogênio se estabelecem entre as bases nitrogenadas T e A e entre as bases nitrogenadas C e G. A obtenção dessas plantas se deve à biotecnologia. Posteriormente. "A biotecnologia de genética molecular foi inicialmente aplicada a micróbios. Está(ão) correta(s). 3 e 4 apenas e) 1. b) Um gene é um segmento do DNA que contém a informação necessária para a produção de uma determinada proteína. 2.. 2 e 3 apenas d) 2. e) Um gene é uma cadeia de aminoácidos que codifica o código genético. pode-se prever que. 1998) O texto acima se refere a organismos transgênicos.) Com a capacidade de mover genes de um organismo para outro. a) 1 apenas b) 2 e 3 apenas c) 1. para cultivo. resultando em tipos criados que nunca poderiam ter sido produzidos com a genética clássica. serão formadas moléculas de DNA apenas com ¢¦N e moléculas apenas com ¢¥N. 6 ed. todas as moléculas de DNA apresentarão apenas ¢¥N incorporado. b) ao término da 1 geração. cerca de 1/4 do DNA será híbrido. d) Um gene é uma molécula de RNA que atua diretamente na síntese protéica.J. e camundongos gigante que expressam os genes do hormônio de crescimento de ratos. plantas que adquirem resistência ao frio por expressar genes anticongelantes de peixes.

1 . 2001.1 .Os genes compartilhados pelos genomas dos diferentes grupos devem ser essenciais. jul.2 .RNA COLUNA 2 ( ) dupla hélice ( ) ribose ( ) fita única ou simples ( ) desoxirribose ( ) bases nitrogenadas: adenina. a cada códon deve corresponder mais de um aminoácido. As moléculas de DNA das bactérias foram então isoladas e analisadas com relação ao seu conteúdo de ¢¦N e de ¢¥N. ele comparou 21 genomas completos de representantes das três linhagens primárias da vida: as eubactérias. guanina. timina.2 . Depois disso.No código genético. as bactérias foram transferidas para um meio contendo nitrogênio leve.1 . d) não ocorreu replicação do DNA mas.2 . transcrição.2 .2. Koonin investigar qual seria o número mínimo de genes capazes de sustentar o funcionamento de uma célula. 1. em 1953. a bactéria 'Escherichia coli' foi cultivada. citosina. Adaptado de SALZANO.DNA 2.8.2 .2 . citosina. e) I.2. Quais delas poderiam ter embasado o raciocínio de Koonin? a) Apenas I.Os genes envolvidos na replicação. Para isso. Questão 1011 Numere a 2 coluna de acordo com a 1 COLUNA 1 1. c) a replicação do DNA é randômica. III . ¢¥N.1 . sim. 173. d) Apenas II e III. II . Questão 1012 Desde que Watson e Crick propuseram um modelo para a estrutura do DNA. podemos concluir que a) a replicação do DNA é semiconservativa. 29.Questão 1009 Meselson e Stahl. Nesse experimento.5. uracila A seqüência correta é a) 1 . Considere as seguintes afirmações. guanina. por muitas gerações. Questão 1010 Leia o texto abaixo.1 Com relação a esses dados. ¢¦N. em meio contendo um isótopo pesado de nitrogênio. b) 2 . O resultado da pesquisa mostrou que o número de genes deve situar-se em torno de 150.2. b) Apenas II.2 .1 . do que é exemplo a recente clonagem de uma ovelha. até todo o seu DNA estar marcado com esse isótopo.2 . transcrição e tradução do material genético devem fazer parte do conjunto mínimo de genes.2 . v. Esse enfoque é interessante.1 .1 . 226 . em 1957. acerca do referido ácido nucléico. e) 1 . e) não ocorreu replicação do DNA mas. sendo observado o seguinte: I . tem-se constatado um progresso fantasticamente acelerado da Biologia Molecular. II e III. c) Apenas III. sim. uma mutação.1 . b) a replicação do DNA é conservativa.2 .2 . d) 2 . F. A entrada na era da genômica possibilitou ao norte-americano Eugene V. fizeram um experimento sobre a replicação do DNA. "Ciência Hoje". as arqueobactérias e os eucariontes. ( ) bases nitrogenadas: adenina. c) 1 .1. n. pois permite imaginar os primeiros sistemas genéticos surgidos por ocasião da origem da vida. Julgue os itens a seguir.M.1 .1.

e) X e mitocondrial. IV. Na meiose II. pesquisador da Universidade Federal de Minas Gerais. à 2 lei de Mendel. do DNA do cromossomo a) X e de autossomos. o carbono não faz parte da estrutura do DNA. b) a presença das bases nitrogenadas uracila. d) Y e mitocondrial. em efeito. no mínimo. apenas. a segregação dos homólogos de um par cromossômico corresponde. c) Y e do cromossomo X. ocorre a troca de. a segregação dos homólogos dos diferentes pares cromossômicos correspondem. em efeito. à 2 lei de Mendel. II. IV e V. citosina e adenina. a mãe transmite maior quantidade de DNA para o filho do que o pai. à 1 lei de Mendel. II. d) I. e) ocorre nos cromossomos. Na meiose I. Analise cada uma das afirmações seguintes. d) é polinucleotídeo. Genes localizados em regiões próximas de um mesmo cromossomo implicam em distorções das proporções mendelianas. b) I. respectivamente. Tais conclusões são possíveis com base em estudos moleculares. 2001). Sérgio Penna. um segmento de DNA que corresponde a um gene funcional. a segregação de cromossomos homólogos que apresentam os mesmos alelos resulta nas proporções da geração F2 dos experimentos de Mendel. e) II e V. II e IV. enquanto a contribuição genética de povos indígenas e africanos deu-se por meio das mulheres. (2) A coloração de cromossomos com vários matizes é uma técnica atual que se baseia no uso de vários corantes para os diferentes lipídios que constituem os cromossomos. apenas. uma série de observações e experimentos indicaram uma correlação entre o comportamento dos cromossomos na célula em divisão e as leis mendelianas. revelou que a contribuição dos europeus na composição genética do povo brasileiro fez-se basicamente por meio de indivíduos do sexo masculino. III. (4) As mutações gênicas implicam necessariamente a modificação do fenótipo do indivíduo. São afirmações corretas: a) I. Questão 1013 A partir dos anos 1900. guanina. Na meiose I. (3) No processo de recombinação entre cromátides. (5) Nos processos de fecundação natural. I. II. a segregação das cromátides dos diferentes pares cromossômicos corresponde. apenas. apenas.(1) Apesar de ser o sexto elemento mais abundante no universo e o mais versátil de todos. II. Questão 1014 No artigo "Retrato molecular do Brasil" ("Ciência Hoje". c) I. IV e V. Na meiose I. III. V. Questão 1016 O estudo do mecanismo da síntese de proteínas no interior das células confirma que: a) a transcrição gênica caracteriza-se pela autoduplicação do DNA b) três tipos de RNA participam do processo c) os anticódons localizam-se no RNA-m d) os códons são trincas de bases nitrogenadas do RNA-t e) não há evidências que permitam aceitar que o código genético seja considerado degenerado Questão 1017 Uma molécula de RNA mensageiro apresenta a seguinte seqüência de bases nitrogenadas: UUU GUG CCC AAC Assinale a alternativa que contém a seqüência de bases do segmento da molécula de DNA que deu origem a esse 227 . III e V. em efeito. b) Y e de autossomos. c) a presença de ácido fosfórico. Questão 1015 Não é característica do DNA: a) o açúcar com cinco átomos de carbono.

d) Uracila. 2 e 3 indicam.RNA. c) reproduz-se de modo semiconservativo.2 Questão 1019 Sobre o RNA. ácido fosfórico e base nitrogenada. . d) Adenina. desoxirribose e base nitrogenada. c) ribose. respectivamente a) desoxirribose. b) Citosina. b) participa da estrutura dos ribossomos.8. desoxirribose e base nitrogenada. ácido fosfórico e base nitrogenada. Questão 1022 No modelo molecular do ácido ribonucléico (RNA) representado adiante. base nitrogenada e desoxirribose. d) ácido fosfórico.5. c) Adenina. Assinale a alternativa que contém a seqüência de bases do segmento da molécula de DNA que deu origem a esse RNA. 1. ribose e base nitrogenada. respectivamente: a) desoxirribose. os números 1.5. e) ácido fosfórico. e) é formado de simples cadeia com formato helicoidal. b) Desoxirribose. c) ribose. b) ácido fosfórico. Questão 1021 Qual das seguintes moléculas NÃO entra na composição química do RNA? a) Ribose. e) Guanina. e) Guanina. a) AAA CAC GGG TTA b) TTT CAC GGG UUT c) AAA CTC GGG TTT d) TTT GAG GGG TTA e) AAA CAC CCC UUA 228 Questão 1023 Uma molécula de RNA mensageiro apresenta a seguinte seqüência de bases nitrogenadas: UUU GUG CCC AAU. ribose e base nitrogenada. e) ácido fosfórico. Questão 1020 Qual das seguintes bases nitrogenadas NÃO entra na composição química do RNA? a) Timina. d) é traduzido em proteínas nos ribossomos. d) ácido fosfórico. ácido fosfórico e base nitrogenada. c) Ácido fosfórico. b) ácido fosfórico. é INCORRETO afirmar que a) possui a base nitrogenada uracila.8. 2 e 3 indicam. base nitrogenada e desoxirribose. a) AAA CAC GGG TTG b) TTT CAC GGG UUG c) AAA CTC GGG TTG d) TTT GAG GGG TTG e) AAA CAC CCC UUG Questão 1018 Na figura a seguir que representa o modelo da molécula de RNA os números 1.2 1. ácido fosfórico e base nitrogenada.

Leu .Arg .Cis d) Ile . c) coelho.a b) I . presença de timina .Val . de acordo com a tabela anterior: a) Cis . d) macaco. cadeia simples .Função: a.1 .Arg .Leu e) Val . c) ausência de ácido fosfórico.Questão 1024 É característica do RNA: a) açúcar com quatro átomos de carbono. Questão 1025 Os itens a seguir referem-se à estrutura. a biologia molecular tem fornecido ferramentas úteis para a produção de plantas e animais transgênicos. nas mesmas condições em que essa síntese ocorre nas células.pode existir mais de um códon para determinar um mesmo aminoácido. utilizou ribossomos de células de rato.8.Cis .Ile . d) ser um polipeptídeo.2 .Estrutura: I.Arg .Val . a seqüência de aminoácidos no polipeptídeo correspondente será.Val . Questão 1027 Um pesquisador.Cis . II .Ile b) Leu .Val . composição e função dos ácidos nucléicos.Ile .Cis .em todos os seres vivos os códons que codificam um respectivo aminoácido são os mesmos. . síntese de proteínas b. e) ocorrer nos lisossomos.Leu .1 .b Questão 1026 Nos últimos anos. citosina e adenina. A proteína produzida teria uma seqüência de aminoácidos idêntica à do a) rato. RNA mensageiro de células de macaco. interessado em produzir em tubo de ensaio uma proteína. transcrição gênica São características do ácido ribonucléico a) I . b) sapo.2 . 229 . dupla hélice II. b) presença das bases nitrogenadas uracila.b e) II .Arg . d) tRNA. Questão 1028 A tabela a seguir mostra alguns aminoácidos e as trincas de bases no DNA que os identificam: 1. e) macaco e do rato.b c) II . c) rRNA. b) Plasmídios. presença de uracila 2.Leu Questão 1029 Sobre o código genético são feitas as seguintes afirmações: I .1 .5. e) mRNA.3 e um RNA mensageiro apresenta a seqüência de bases AUU AGA UGU GUU UUA. RNA transportador de células de coelho e aminoácidos ativos de células de sapo.a d) II .Composição: 1. guanina. As informações armazenadas nas moléculas de DNA são traduzidas em proteínas por meio de moléculas intermediárias denominadas: a) Proteases.Ile c) Arg .

ou seja. d) permite distinguir procariotos de eucariotos.GLI . prolina.UUU . prolina. b) Aspargina. prolina. mas varia de espécie para espécie. b) é o mesmo em todas as células de um indivíduo. lisina. mas varia de indivíduo para indivíduo.FEN . tirosina. Assinale a 230 .CUC.3 a) Aspargina.5. Questão 1031 Um gene de bactéria com 600 pares de bases nitrogenadas produzirá uma cadeia polipeptídica com número de aminoácidos aproximadamente igual a a) 200 b) 300 c) 600 d) 1200 e) 1800 Questão 1033 O código genético é o conjunto de todas as trincas possíveis de bases nitrogenadas (códons). c) é o mesmo nos indivíduos de uma mesma espécie.a tradução da seqüência de bases do RNA para a proteína é feita. e) GUU .III . cuja seqüência de bases é AAGTTTGGT. valina. e) I e III apenas. o códon UAG é terminal. c) I e II apenas. GCC e AGC codificam.CCG .LEU a) GUU .UUU . c) Fenilalanina.CUC.tirosina . É correto afirmar que o código genético a) varia entre os tecidos do corpo de um indivíduo.5. Questão 1034 Os códons UGC. A seqüência de códons do RNA mensageiro determina a seqüência de aminoácidos da proteína.AAA . lisina. Questão 1030 A tabela a seguir relaciona trincas de bases do DNA aos aminoácidos correspondentes. d) Fenilalanina. d) I. e) é praticamente o mesmo em todas as formas de vida.UUG. sofreu a perda da 9 base nitrogenada.AAC. d) GAA .8.GGC . nos ribossomos. indica a interrupção da tradução. lisina.GGC . lisina.GGU . Questão 1032 Considere a seguinte tabela que indica seqüências de bases do RNA mensageiro e os aminoácidos por elas codificados. Um fragmento de DNA.alanina. II e III. qual seria a seqüência de aminoácidos codificada? 1. Assinale a alternativa que apresenta a possível seqüência de códons para a formação do seguinte tetrapeptídeo: GLU . b) III apenas. respectivamente os aminoácidos cisteína.cisteína . leucina. alanina e serina. b) GAA .GGA . UAU. que codifica a seqüência serina .CTC. a nível citoplasmático.3 1.UUU . Com base na tabela fornecida e considerando um segmento hipotético de DNA. valina.TTT . c) CTT . e) Valina.8. Está(ão) correta(s) afirmativa(s): a) II apenas.

e) A seqüência não sofrerá prejuízo. Indique a alternativa ERRADA relativa ao código genético e à síntese de proteínas: a) Os genes são formados por ácido desoxirribonucleico e controlam a produção de proteínas da célula. que compreende o trabalho do RNA de organização dos aminoácidos na seqüência determinada pelo código genético. b) O aminoácido tirosina não será traduzido. por raios-X. pois qualquer modificação na fita de DNA é imediatamente corrigida. b) Todas as células do corpo têm a mesma coleção de genes. mas. que visa decifrar e mapear o código genético humano. apesar disso. b) Os ácidos nucléicos podem aparecer livres na célula ou podem estar associados a proteínas. ou mesmo por exposição aos raios ultravioleta do sol.5. e a tradução. 1. apesar disto. a) Na molécula de DNA. pois essa molécula de DNA alterada não é capaz de comandar esse processo. encontramos sempre desoxirribose e cinco tipos de bases: adenina.8. Este processo chama-se diferenciação celular. mas. determinando as características de um ser vivo. e) A Engenharia Genética. citosina. a) UUU CGT TTG UGC GUC b) UUU CGA AAG UGC GUC c) TTT CGT TTC TGC GTC d) TTT CGA AAG TGC GTC e) CCC TAC CCA CAT ACT Questão 1038 O quadro a seguir contém um segmento de DNA. guanina. Questão 1037 O esquema a seguir representa a seqüência de aminoácidos de um trecho de uma proteína e os respectivos anticódons dos RNA transportadores. os códons e os anticódons correspondentes. que compreende a passagem do código genético do DNA para o RNA. d) A tradução será interrompida no 2Ž aminoácido. 231 . Questão 1035 Com relação ao código genético e à síntese de proteínas. assinale a afirmativa FALSA. d) As mudanças na programação genética de um organismo não alteram a produção de proteínas. Questão 1036 Em 1987.3 ssinale a alternativa que contém a seqüência de códons do RNA mensageiro que participou dessa tradução. c) A mutação é uma alteração do código genético de um organismo e pode ser provocada por radiações ou substâncias químicas. resultando numa molécula com 3 aminoácidos. d) A mutação constitui uma alteração na seqüência de bases nitrogenadas de um segmento de DNA e pode ser provocada por radiações. encontramos células com formas e funções diferentes. encontramos células com formas e funções diferentes. compondo os cromossomos e ribossomos na forma de moléculas complexas de nucleoproteínas. a) O aminoácido tirosina será substituído por outro aminoácido.alternativa que descreve o que acontecerá com a seqüência de aminoácidos. c) A seqüência não será traduzida. pode corrigir defeitos no código genético de um organismo. nem as suas características. que é uma técnica de manipulação dos genes. timina e uracil. e) Todas as células do corpo têm a mesma coleção de genes. foi oficialmente fundado o Projeto Genoma. por raios cósmicos. c) Duas grandes etapas estão envolvidas na síntese das proteínas: a transcrição.

CTU . O RNA ribossômico contém as informações para as proteínas que devem ser sintetizadas.CISTEÍNA - 232 . diversas condições devem ser observadas. TCA e CUG e) CTG. Questão 1042 Considere os seguintes códons do RNA mensageiro e os aminoácidos por eles especificados: ACA = treonina GUU = valina Assinale a alternativa da tabela a seguir que indica corretamente os anticódons do RNAt e os códons do DNA relacionados com esses aminoácidos. III e IV Questão 1040 Considere o seguinte segmento de uma cadeia de DNA e o polipeptídio sintetizado a partir dele: ATA .TGC .TGC . Para que ocorra a síntese da proteína codificada pelo gene inserido no genoma da espécie receptora. Exemplos desses organismos são as plantas transgênicas. c) o código genético é degenerado.GGU c) CGT .TGT .GGA Questão 1041 Organismos são ditos transgênicos quando.CAC . TAA. d) a técnica permite trocar o código genético do organismo doador do gene.CGT .HISTIDINA . AGT e CTG b) GTC.TTA e) UAU .GCA . o polipeptídio sintetizado passou a apresentar duas argininas.ACA . respectivamente. IV. por técnica de engenharia genética. os quais podem ser transmitidos aos seus descendentes. A seqüência de trincas no RNA mensageiro que pode ter codificado esse polipeptídio alterado é a) CUC . receptoras de um gene de outro organismo (doador) que lhes confere resistência a certos herbicidas.CCT TIROSINA . UCA e GUC c) GTC. foram feitas as seguintes afirmações: I. ATT.CAC . fundamentalmente. III.GTG .GLICINA Após a substituição de uma única base nitrogenada no segmento de DNA.CAC . ATT.TGT .CGU .CGT . II. 1. Entretanto. Cada trinca de bases nitrogenadas de uma cadeia do DNA corresponde a um aminoácido. São verdadeiras APENAS as afirmações a) I e II b) I e IV c) II e III d) II e IV e) I.3 ara preenchê-lo corretamente. III e IV devem ser substituídos.GGA d) UAU . TCA e GUC d) CTG. os algarismos I.CGC .ARGININA . Diversos aminoácidos são codificados por mais de uma trinca de nucleotídios. recebem e incorporam genes de outra espécie.CGT . por a) GAC.8. UCA e CUG Questão 1039 Com relação ao código genético.5. essa técnica é possível porque a) cada organismo apresenta seu próprio código genético. II.GGU b) TUT . e) a técnica permite trocar o código genético do organismo receptor do gene.CGU . b) o código genético é comum a todos os seres vivos. liga-se a um aminoácido específico. O RNA mensageiro. AUU.CTU . AUU. de acordo com o anticódon que possui.

. Considere que a estrutura normal de um RNA mensageiro de um peptídio e sua estrutura alterada em virtude da troca de uma única base no gene correspondente são: 5' AUGUGGUUUGCACACAAAUGAUAA 3' (normal) 5' AUGUGGUUUGAACACAAAUGAUAA 3' (alterada) A tabela a seguir identifica alguns codons. sem necessidade de código de iniciação ou de terminação. pode acarretar modificações importantes na atividade biológica da proteína codificada por esse gene.5. UAG e UGA.3 233 .8. Sua estrutura está representada no esquema abaixo: C-A-C-A-C-A-C-A-C-A-C-A-C-A-C-A-C-A Suponha que a síntese de um peptídeo possa ser iniciada a partir de qualquer um dos extremos dessa estrutura de RNAm. composta pelas bases adenina-A e citosina-C.3 Questão 1043 Uma molécula de RNAm. Nestas condições.8. O aminoácido encontrado no peptídio normal e aquele que o substituiu no peptídio mutante são. podem-se identificar as possíveis seqüências de DNA que a originaram. A partir da seqüência de aminoácidos de uma proteína. o número de diferentes tipos de aminoácidos encontrados nos peptídeos formados será: a) 4 b) 3 c) 2 d) 1 Questão 1044 A mutação em um gene.5. foi sintetizada experimentalmente.5. Considere o quadro: 1.o codon da metionina é também o do início da tradução.os codons de término da tradução são UAA.1. respectivamente: a) lisina e cisteína b) treonina e triptofano c) alanina e ácido glutâmico d) fenil alanina e ácido aspártico Questão 1045 A determinação da seqüência de aminoácidos de todas as proteínas da espécie humana e de outros seres vivos é de extrema importância.3 1.8. bserve que: . por conseqüência da substituição de uma única base na estrutura do DNA.

O código genético descreve a relação entre a seqüência de bases nitrogenadas e a seqüência de aminoácidos. Questão 1048 Se uma proteína possui 100 aminoácidos. Estes.TAC . Met (metionina).Glu . apenas b) 1 e 3. apenas d) 1. 3.AAC .GAA .Cys .TTT b) ATG .TTC e) ATC . portanto. 2 e 3 e) 2.TTC Questão 1046 OBSERVE: 1.TTT c) ATC . a partir de uma seqüência de aminoácidos (peptídeo). Pro (prolina). é possível obter uma seqüência de nucleotídeos (RNA mensageiros). Isso é possível graças à relação existente entre os códons do RNA mensageiro (cada três nucleotídeos) e os aminoácidos presentes nas proteínas.TAC . Ala (alanina). Ser (serina). Asp (ácido aspártico).AAT .om base no quadro apresentado.TGT . A correspondência entre os códons do RNA mensageiro e os aminoácidos por ele determinados constitui o código genético.AAT . faz-se a construção de uma fita de RNA mensageiro a partir dela. 2. Glu (ácido glutâmico). O inverso também pode ocorrer. Para descobrir se determinado organismo produz determinada proteína. Asn (asparagina). Arg (arginina).TAC .AAT .TGT .GAA .GAA . Trp (triptofano). que está representado na tabela a seguir: 1.Asn . quantos códons. Ile (isoleucina). é correta a seguinte afirmação: a) O peptídeo Gly-Gly-Gly-His-Arg-Leu-Ile-Gln pode ter sido originado a partir do seguinte RNA mensageiro: GGCGGUGCGCACCGCCUUAUUCAA.TGT . pare (códon de parada). devem estar presentes no seu mRNA? a) 100 234 . é formado o seguinte peptídeo Leu-Gly-Glu-Thr-Arg-Gln-Glu. A seqüência de aminoácidos que forma uma cadeia polipeptídica compreende a estrutura secundária de uma proteína.Phe a) ATG . como por exemplo as funções enzimáticas. Três bases nitrogenadas adjacentes codificam um aminoácido e formam um códon.8.Tyr .GCC . assinale a opção que indica a seqüência do DNA responsável pela síntese do peptídeo mostrado a seguir: Met . apenas c) 3. é formado o seguinte peptídeo: Val-Val-Val-Val-Arg-Arg-Arg. e) O peptídeo Lys-Phe-Lys-Tyr-Tyr-Thr-Ile pode ter sido originado a partir do seguinte RNA mensageiro: AAAUUUAACUAUUACACAAUA. Thr (treonina).3 Phe (fenilalanina). Tyr (tirosina). Lys (lisina). Com base no texto e em seus conhecimentos. Está(ão) correta(s): a) 1.TAC . As proteínas exercem inúmeras funções no nosso organismo. Gln (glutanina). formam as proteínas. Gly (glicina). que especificam esses aminoácidos.TTC . após passarem por diferentes processamentos no Retículo endoplasmático rugoso e complexo de Golgi.AAT .TGT . Leu (leucina).GAA . d) A partir da seqüência do RNA mensageiro UUAGGGGAGACUCGGCAGGAG. é formado o seguinte peptídeo: Phe-His-Ser-Ala-Gly-Arg-His. c) A partir da seqüência do RNA mensageiro GUGGUUGUCGCUCGUCGGCGG. na proteína que ele especifica. Cys (cisteína). His (histidina).TTT d) ATG . Cada três nucleotídeos correspondem a um aminoácido. Val (valina). b) A partir da seqüência do RNA mensageiro UUUCAUAGUGCUGGGAGCCAC.5. apenas Questão 1047 A união de vários aminoácidos forma os peptídeos.TAC .

assim como a leucina pode ser codificada por diferentes trincas.5.treonina . ala = ALANINA. thr = TREONINA.aspartato . ileu = ISOLEUCINA. glu = GLUTAMINA. gly = GLICINA LOPES. ser = SERINA.glicina c) glutamina . com os códons e os aminoácidos correspondentes. o que significa que um aminoácido pode ser codificado por mais de uma trinca. uma determinada trinca também pode codificar diferentes aminoácidos. asp = ASPARTATO. é correto afirmar: a) Os códons dessa seqüência sinalizam os mesmos aminoácidos em seres humanos. Sônia.glicina . his = HISTIDINA. III .arginina d) glutamina . 1996. met = METIONINA. lys = LISINA. 235 1.glutamina . Utilizando a tabela. Estão corretas afirmativas: a) apenas III. b) códons. GCA e UGA. podemos dizer que I . GAA e outras). c) nucléolos. trp = TRIPTOFANO.treonina Questão 1052 O aminoácido leucina pode ser codificado por mais de uma trinca de nucleotídios do DNA (AAT. leu = LEUCINA.aspartato b) metionina . II . pro = PROLINA.um aminoácido pode ser codificado por apenas uma trinca de nucleotídios de DNA. Assim sendo.treonina .glutamina . tyr = TIROSINA. arg = ARGININA. cys = CISTEÍNA.histidina .o código genético é degenerado. val = VALINA. b) A inserção de um nucleotídeo entre a 4 e a 5 base não altera o código genético.cisteína .asparagina . e) ribossomos. determine a seqüência de aminoácidos que corresponde à seqüência de DNA TAC TGA TTG CTA a) metionina . respectivamente. São Paulo: Saraiva. d) Os anticódons do 1Ž do 2Ž códon dessa seqüência são.histidina .8. c) Os códons GCA e GCG são degenerados porque codificam aminoácidos diferentes.b) 33 c) 99 d) 300 e) 500 Questão 1049 Observe as seqüências de nucleotídeos de um vírus de RNA: 5' GCA UCA CAC CUC AUU GCG UAG 3' Considerando que esse segmento de RNA codifica um determinado peptídeo. d) acrossomos.3 . Bio Volume Único.arginina e) glicina . Questão 1050 As unidades hereditárias que contêm a informação para especificar um aminoácido são denominadas a) ADN. Questão 1051 A tabela apresenta o código genético. asn = ASPARAGINA. he = FENILALANINA.

TAT GGC ATA. e) TAT GGC UTU.. (4) A fumaça do cigarro. II e III são corretas. a TETRACICLINA liga-se aos ribossomos e impede a ligação do RNA transportador. b) apenas I e II são corretas. c) apenas II e III são corretas. d) apenas I e III são corretas. é responsável pela incorporação respectiva dos seguintes aminoácidos: metionina. Indique qual a seqüência de RNAm é transcrito a partir deste segmento DNA: a) TTA TAA GCT CAG ATT TCT b) TTA TTA GCT CAG ATT TCT c) UUA UUU GGU CAG AUU UGU d) UUA UAA GCU CAG AUU UCU e) AAT ATT CGA GTC TAA AGA Questão 1055 Uma cadeia de DNA apresenta a seguinte seqüência de bases numa certa região de sua hélice: ATA CCG TAT. os raios X e a luz ultravioleta podem produzir mutações na molécula de DNA. c) TAT GGC ATA. e) I. respectivamente: a) TAT GGC ATA. c) apenas I. III . (1) Os códons do mRNA. pode-se dizer que o segmento de DNA que deu origem a esse RNA era a) TTA AAA CCG AGG. (2) A molécula de DNA referente ao trecho apresentado tem 20% de adenina. Assinale a alternativa que reúne as afirmações corretas.a TETRACICLINA impede a transcrição e leva a célula bacteriana à morte por falta de RNA mensageiro.a MITOMICINA. TUT GGC UTU. Questão 1054 Um fragmento de DNA de uma espécie de organismo procarionte apresenta a seguinte seqüência de bases: AAT ATT CGA GTC TAA AGA.b) apenas II. d) ATA GGC TAT. Essas substâncias diferem quanto à maneira pela qual interferem no metabolismo celular. e) AAU AAA CCG AGG. e) nenhuma delas. julgue os itens que se seguem. Questão 1056 Existe um número muito grande de substâncias com funções antibióticas. Considerando as informações apresentadas. a MITOMICINA inibe a ação da polimerase do DNA e a ESTREPTOMICINA causa erros na leitura dos códons do RNA mensageiro. Questão 1057 Dado um segmento de RNA com a seguinte seqüência de bases nitrogenadas: UUA UUU GGC UCC. Assim. d) I e III.a ESTREPTOMICINA interfere na tradução e leva a célula bacteriana a produzir proteínas defeituosas. por inibir a duplicação do DNA. II . triptofano. arginina e alanina. TAT GGC ATA.. a) apenas I é correta. UAC ACC UCU CGU. UAU GGC AUA. b) AAT AAA GGC UCC. (3) A perda de um nucleotídeo do DNA implicará a alteração dos aminoácidos da cadeia polipeptídica.. TACACCTCTCGT. respectivamente.. impede a multiplicação da célula bacteriana. UTU GGC UTU. são. para os aminoácidos mencionados. b) UAU GGC UAU. sua cadeia complementar e o tipo de RNAm que poderá ser formado a partir das bases da hélice original são. 236 . c) AAT AAA CCG AGG. Questão 1053 Um trecho de fita de DNA com a seqüência. Essas informações permitem afirmar que I . d) TTA TTT CCG AGG.

foi laureado por registrar em imagens o momento em que a informação genética contida no DNA no núcleo da célula é traduzida para ser enviada para fora pelo RNA . e) trata-se do processo de transcrição. d) a célula encontra-se em metáfase.complementar . sendo as _______________ substituídas pelas uracilas. 1. Questão 1061 A molécula de RNA sintetizada é ___________ à fita de DNA que lhe deu origem e ___________ à outra fita de DNA.adeninas b) complementar .que faturou o Nobel de Medicina ou Fisiologia na segunda-feira foi a protagonista do prêmio de Química entregue ontem. Questão 1060 O esquema a seguir representa fragmentos de ácidos nucléicos no núcleo de uma célula.citosinas d) complementar . a) O processo 1 somente é observado no núcleo da célula.4 bservando o esquema.8.o RNA . b) 2 representa nucleotídeos de DNA.o astro da semana. é INCORRETO afirmar que: a) 1 é uma molécula de uracila. c) O processo 2 ocorre principalmente no período S da intérfase.5.complementar . c) 3 representa nucleotídeos de RNA.Questão 1058 Uma molécula de RNA mensageiro apresenta a seguinte seqüência de bases nitrogenadas: UUU GUG CCC AAA. é necessário bloquear o funcionamento de todo o retículo endoplasmático dessa célula.8.idêntica .4 ssinale a alternativa correta.complementar . (Girardi. a) AAA CAC GGG TTT b) TTT CAC GGG UUU c) AAA CTC GGG TTT d) TTT GAG GGG TTT e) AAA CAC CCC UUT Questão 1059 O esquema a seguir representa dois processos observados numa célula eucariótica. O americano Roger Kornberg.guaninas c) idêntica . .timinas Questão 1062 A mesma molécula . da Universidade Stanford. d) Um dos mais importantes locais de ocorrência do processo 1 é o nucléolo. e) As moléculas produzidas no processo 2 poderão ser utilizadas como catalisadoras. Esse mecanismo de transcrição. mas nunca serão constituintes de outras organelas. através do qual o RNA carrega consigo as instruções para a produção de proteínas (e por isso ele ganha o nome de RNA mensageiro). já era conhecido pelos cientistas desde a década de 50. sendo inexistente em todas as outras organelas. G. b) Para interromper o processo 2.adeninas e) complementar . a) idêntica . Assinale a alternativa que contém a seqüência de bases do segmento da molécula de DNA que deu origem a esse RNA. Estudo de RNA rende o segundo Nobel 237 1.5.idêntica .

2006). Qual a seqüência correta dessas etapas durante o processo? a) I .G . Paulo". Analise os dados dos quadros a seguir.C .G .G .III.A e) C .A .4 Questão 1066 Considere as seguintes etapas da síntese de proteínas.C . 238 . d) RNA e de DNA. Para compreender essas notícias.A . d) No citoplasma. II .A . origina a cadeia a) GUTATUTGA b) GCUAUCUGA c) GCTUTCTGU d) UCTATCTUA e) GCTATCTGA Questão 1065 Abaixo está representado o filamento I de uma molécula de ácido nucléico presente no interior do núcleo de uma célula vegetal. a) A produção de RNA mensageiro se dá por controle do material genético. b) RNA e de proteínas. respectivamente.5. c) O RNA mensageiro leva do núcleo para o citoplasma instruções transcritas a ele pelo DNA. d) III . c) II .U .A .I .I.8.C .C .U d) C .C .II . farmacogenômica etc. de a) proteínas e de RNA. III . engenharia genética.I e) III .G . é necessário conhecer a estrutura da molécula de DNA e entender seu funcionamento.III . b) I .U b) G . o RNA mensageiro determina a seqüência de aminoácidos apresentada por uma proteína. clonagem terapêutica e reprodutiva. terapia gênica.Transcrição do código genético do DNA em códons do RNA mensageiro.Fixação do RNA mensageiro aos ribossomos.G . transcrita a partir do filamento II? a) G .II.U . Questão 1067 Há na mídia uma grande quantidade de notícias envolvendo o DNA: testes de paternidade. transgênicos. assinale a alternativa incorreta.U . A partir da leitura do trecho anterior e de seu conhecimento de biologia molecular. e) DNA e de RNA. I . Questão 1063 Os processos de transcrição e tradução gênicas resultam na síntese. e assinale a(s) proposição(ões) CORRETA(S).U . b) No núcleo da célula ocorre transcrição do código da molécula de DNA para a de RNA."O Estado de S.II .U .III .U 1. Qual seria a seqüência correta encontrada na molécula de RNA mensageiro.U . Questão 1064 O segmento CGATAGACT de uma fita de DNA.II.Ligação dos códons de RNA mensageiro aos anticódons correspondentes dos RNAs transportadores. c) DNA e de proteínas. 5 out. após o processo de transcrição.A c) G . e) Cada molécula de RNA mensageiro é uma longa seqüência de nucleotídeos idêntica ao DNA.

8. I. b) I. Está(ão) correta(s) a) apenas I. . revelando a distribuição do precursor radioativo nas mesmas. d) III. (08) Em III. d) apenas I e III. respectivamente.e) apenas II e III. Questão 1070 Algumas células de cultura de tecido foram deixadas em um meio contendo um precursor radioativo de RNA. observa-se que o pareamento das bases nitrogenadas do DNA é aleatório. está indicado o processo de tradução. transcrição e tradução ocorrem no mesmo local porque as células procariontes não possuem sistema de endomembranas. para o núcleo. I e III. III e II. I e II. (02) O quadro I mostra uma molécula de DNA cuja duplicação ocorre de forma semiconservativa. está indicado o processo de transcrição. através do qual formam-se moléculas que contêm as mesmas bases nitrogenadas presentes no DNA.5. Nas células eucariontes.4 (01) Em I. gerando duas novas duplas hélices. b) apenas II. pois cada uma das fitas originais em I serve de molde para uma nova fita. (16) A deleção de um dos pares de bases na seqüência mostrada em I não alteraria significativamente a seqüência de aminoácidos em III. c) apenas III. Posteriormente. II.8. Questão 1068 Analise as afirmativas a seguir. Questão 1069 1. c) II. transcrição. duplicação e tradução são: a) I. as etapas que representam. e) II. Durante a transcrição. cuja seqüência de aminoácidos está codificada numa molécula de ácido nucléico. (04) Em II.4 O esquema resume parcialmente as relações funcionais dos ácidos nucleicos que ocorrem na maioria das células vivas. algumas células foram fixadas e radioautografadas. uma fita de DNA serve como molde para a produção do RNA que terá uma seqüência de nucleotídeos complementar à fita-molde. Após 3 minutos. que resulta na formação de polipeptídios. onde está o DNA. III. a informação genética é transmitida do citoplasma.5. Esse procedimento se repetiu após 15 e após 90 minutos. Os esquemas representam as células radioautografadas nos três momentos. 1. essas células foram transferidas para um meio sem essa substância. Nas bactérias. onde serão produzidas as proteínas. III e I. II e III. 239 onsiderando-se apenas células eucariontes.

ao ser deixada em situação de desequilíbrio osmótico em relação à cultura sem isótopo. restando apenas no citoplasma. Esse aminoácido. sendo que posteriormente o RNA aí produzido migra para o citoplasma celular. A seqüência desses aminoácidos na proteína correspondente ao segmento do DNA que apresenta a seqüência de nucleotídeos GAC TGA TCT será. treonina. pode ser transportado por vários RNA-t. b) a substância.5 Esses resultados ocorrem porque a) o RNA transportador leva o isótopo até o nucléolo e posteriormente ao núcleo e citoplasma celular. c) duplicação de RNA. arginina.4 1. d) treonina. c) Apenas I e II. leucina. porém. Questão 1072 Partindo-se do conhecimento do RNAm (CCU GAG). arginina. c) leucina.5. Questão 1071 Os códons AGA.8. indique. arginina. buscando a situação de equilíbrio. Questão 1074 Ao longo da molécula de DNA. respectivamente. leucina e treonina. treonina. b) arginina. treonina. arginina.As moléculas de RNA-t apresentam numa determinada região da sua molécula uma trinca de bases denominada anticódon. são feitas as seguintes afirmações: I . II e III. leucina. esgota toda a substância presente no núcleo. leucina. Assinale a(s) afirmativa(s) correta(s): a) Apenas II. qual a seqüência correta do DNA e do RNA transportador.Um RNA-t (RNA transportador) transporta sempre um determinado aminoácido. os aminoácidos arginina. e) leucina. prossegue posteriormente no citoplasma da célula. CUG e ACU do RNA mensageiro codificam. que ocorre inicialmente no núcleo celular. e) I. dirige-se gradativamente para o citoplasma celular. b) Apenas III. II . III . e) a síntese de RNA ocorre no núcleo. que se intensifica aos 90 minutos. nas opções a seguir. c) a síntese de RNA. b) produção de energia. 240 . e) lise celular. d) mutação gênica. a) treonina. respectivamente.8.1. d) Apenas II e III. d) a produção de RNA.5.A tradução do código químico do RNA-m (RNA mensageiro) ocorre nos ribossomas localizados no retículo endoplasmático rugoso. existem quatro tipos de genes que atuam como está demonstrado no esquema a seguir: São esses mecanismos que tornam possível a: a) diferenciação celular. Questão 1073 Sobre a síntese de proteínas.

proteínas. b) secreção de substâncias.5. aminoácidos. aminoácidos. RNA transportador. III . cópia.8. b) ribossomos. A primeira etapa forma a molécula de ___(IV)___ contendo a mensagem genética e a segunda etapa é responsável pela produção da proteína. e) reprodução celular. A(s) afirmativa(s) correta(s) é(são): a) I apenas.durante o processo a proteína formada depende. e) genes. proteínas. o Cloranfenicol inibe a peptidiltransferase na subunidade ribossômica maior e a Rifampicina inibe a RNA polimerase no sítio de iniciação. duplicação. d) produção de energia. No processo de elaboração de uma proteína ocorrem as etapas de transcrição e ___(III)___. d) II e III apenas.8. e) I. num certo organismo. "O controle das características fenotípicas dos seres vivos é feito pelos ___(I)___ através do comando da síntese de ___(II)___. c) I e III apenas.5 Questão 1075 O antibiótico Estreptomicina age sobre as bactérias promovendo a leitura errada do RNAm. duplicação. (II). Questão 1077 Analise o texto abaixo e assinale a alternativa que contém os termos que preenchem corretamente os espaços (I). tradução. de uma molécula de DNA.5. c) síntese protéica. 1. aminoácidos. RNA mensageiro.qualquer proteína formada será conseqüência direta de uma transcrição do RNA. c) genes." a) ribossomos. d) genes. RNA ribossômico.análise do esquema anterior nos permite afirmar que: I .os ribossomas alinhados nessa molécula de RNA traduzirão os mesmos códons. (III) e (IV). tradução. 1. em última análise. II . Sabe-se que esses antibióticos são substâncias cuja utilização médica se baseia na inibição das células bacterianas atuando no mecanismo de: a) fagocitose.5 Questão 1078 O esquema a seguir representa a seqüência das etapas da síntese de um trecho de uma proteína a partir da molécula de DNA. b) I e II apenas. a Tetraciclina liga-se à subunidade ribossômica menor e inibe a ligação do AA-RNAt. RNA ribossômico. Questão 1076 241 . RNA mensageiro. II e III.

Questão 1081 A seqüência de aminoácidos de uma proteína é determinada pela seqüência de a) pentoses da molécula de DNA. e) todas estão corretas.5. CUC. II. A seqüência correta de bases nitrogenadas encontradas na molécula de RNA mensageiro. c) exclusivamente da produção de RNA.5. e) O DNA não se duplicar durante a interfase. que ocorrem no núcleo das células eucarióticas.8. c) sua síntese ocorrer no retículo endoplasmático liso e não no rugoso. complementar ao segmento da hélice de DNA apresentada é UGGUUUGGCUCA. d) da produção de RNA e de proteínas. nas células bacterianas haverá comprometimento a) exclusivamente da produção de proteínas. Deve-se concluir que a) apenas II está correta. CAU c) TCT. GUG. c) bases da molécula de DNA.ribossômico Questão 1082 Considere os seguintes fragmentos de ácidos nucléicos que participam da síntese de uma proteína. d) bases da molécula de RNA . 1.Questão 1080 A composição química de uma proteína pode ser alterada se a) durante sua síntese houver variação dos tipos de aminoácidos disponíveis no citoplasma. CAC. b) pentoses da molécula de RNA . respectivamente aos processos de tradução e transcrição. No esquema. Sob ação do antibiótico.5 obre essa síntese foram feitas as afirmações abaixo: I. GTA d) UGU. e) da produção de DNA e RNA. b) apenas I e II estão corretas. c) apenas II e III estão corretas.5 s espaços 1. GUA 242 . 2 e 3 ficariam corretamente preenchidos por: a) ACA.transportador.8. III. Para codificar a seqüência dos aminoácidos do trecho da proteína apresentada no esquema são necessários 24 nucleotídeos no RNA mensageiro. Seu mecanismo de ação consiste na inibição da transcrição nas células de 'Mycobacterium tuberculosis'. 1. e) bases da molécula de RNA . Questão 1079 A Rifampicina é um dos antibióticos utilizados para o tratamento da tuberculose. GAG. GAG. b) exclusivamente da produção de DNA. b) durante sua síntese houver variação dos tipos de RNA transportadores. os números 1 e 2 correspondem.mensageiro. GAU b) TGT. CAT e) TGT. d) apenas I e III estão corretas. d) uma base púrica substituir uma pirimídica no RNA mensageiro que a codifica.

Questão 1084 Um mutante perdeu um segmento de DNA contendo todas as cópias dos genes que codificam RNA transportador. c) Esse ácido nucléico é produzido no núcleo e se dirige ao citoplasma. d) II pode apresentar moléculas de adenina. unindo-se aos aminoácidos. cuja função é transportar aminoácidos. c) O maior tempo de prateleira a que o texto se refere se deve aos baixos níveis da enzima poligalacturonase.5. Questão 1087 O esquema a seguir é um processo celular vital. Dessa forma. Questão 1085 O DNA apresenta importantes funções celulares. que ocorre também em você. Os pesquisadores utilizaram a metodologia "anti-sense" (veja o quadro a seguir) para diminuir os níveis da enzima poligalacturonase. d) o transporte de proteínas. representada em II. que representa um fragmento de ácido nucléico.8.8. cuja expressão gênica é induzida pelo etileno. os tomates são pulverizados com etileno para acelerar o amadurecimento e torná-los vermelhos.5. é denominada anticódon. Essa enzima promove a hidrólise de componentes da parede celular. Uma delas é a síntese de proteína. d) A tecnologia "anti-sense" para genes necessários à síntese do etileno poderia ser utilizada para se evitar o amadurecimento de frutos. c) a síntese de proteínas. a) Essa metodologia visa reduzir os níveis de etileno nos frutos evitando seu amadurecimento. b) Cada trinca de bases.Questão 1083 e) 558 Questão 1086 Tradicionalmente. o processo de transcrição não ocorrerá. a) A substância representada em I é obrigatoriamente ribose. 1. 243 . O tomate Flavr Savr foi desenvolvido pela empresa de biotecnologia Calgene para amadurecer no pé mantendo a firmeza de sua pele. e) o transporte de RNA. os tomates são colhidos ainda verdes para que sua firmeza seja mantida no transporte.5 Considerando o esquema acima. Antes de chegarem às prateleiras. A função celular drasticamente afetada por essa mutação será a) a replicação do DNA. impedindo sua expressão. b) a síntese de RNA mensageiros. o filamento de DNA que proporcionou essa síntese deverá ter o seguinte número total de nucleotídeos: a) 62 b) 93 c) 186 d) 279 1. o que compromete a firmeza dos frutos. e) Se a ação desse ácido for bloqueada. assinale a alternativa INCORRETA.5 Assinale a alternativa INCORRETA. b) O RNAm do gene "anti-sense" é capaz de parear com o RNAm da poligalacturonase. o tomate pode ser transportado já maduro e apresenta um maior tempo de prateleira. Numa síntese de proteína com 185 ligações peptídicas.

d) moléculas utilizadas nos processos de cicatrização. e nos éxons estão presentes seqüências codificadoras. Questão 1089 Na síntese protéica. b) enzimas usadas. poderiam desempenhar alguma função no núcleo celular. RNAs transportadores de ovelha e aminoácidos de coelho.5 244 .5. EXCETO: a) Não existe uma relação de proporcionalidade direta absoluta entre o número de genes e a complexidade dos organismos relacionados. por exemplo.1.5.5. Questão 1088 Os gráficos a seguir revelam o NÚMERO DE GENES e a relação entre RNA CODIFICADOR (que contém as seqüências que podem ser traduzidas em proteínas) e RNA NÃO-CODIFICADOR (seqüências que são transcritas. obteve-se uma proteína a) humana. o RNA mensageiro combina-se com um complexo de ribossomo. EXCETO: a) macromoléculas de reserva energética.5 1. realizou-se uma síntese protéica utilizando-se: DNA de um gene humano. RNAs transportadores e aminoácidos. e) híbrida de homem e coelho. observam-se os seguintes eventos: I. b) de ovelha. mas não traduzidas. no processo digestivo. III. o gene (segmento de DNA) é transcrito em RNA mensageiro. é correto afirmar. II. Analisando os resultados anteriores de acordo com seus conhecimentos sobre o assunto. d) Seqüências transcritas.8. b) Os vertebrados citados apresentam menor percentual de transcrição em relação aos outros animais. Questão 1090 Responder à questão com base na ilustração e afirmativas a seguir. c) de coelho. mas não são traduzidas em proteínas) de seis espécies de organismos. Num experimento de laboratório hipotético. c) moléculas de defesa do corpo. Ao final do experimento.5 Nesse processo ocorre produção de. d) quimérica de homem e ovelha. a proteína é sintetizada. c) Os íntrons são exemplos de RNA não-codificador.8. 1.8.

contido no material genético. Questão 1092 Em se tratando do processo de síntese de proteínas.. e que o sinal emitido por essas premiações aponta o verdadeiro futuro da pesquisa biológica e médica muito além dos genomas e de seu seqüenciamento (uma simples soletração)... Nos eucariotos.) O autor refere-se às proteínas como ''atores do drama molecular'' e ao DNA como "diretor de cena"." Folha de S. d) as proteínas não terem controle sobre o metabolismo celular. III e IV c) I e IV d) II e III e) II. é certo afirmar: a) os aminoácidos que estão no citoplasma são selecionados pelo RNAm b) todo o processo da síntese de uma proteína ocorre exclusivamente no núcleo da célula c) o RNAm controla a síntese de uma proteína.. b) o DNA controlar a produção de proteínas etambém atuar como catalisador de reações químicas celulares. (. p. "O Que é vida? 50 anos depois". denominado tradução. B e C ocorrem no interior do núcleo. Essa referência deve-se ao fato de a) não ocorrer uma correlação funcional entre DNA e proteínas no meio celular. que é induzido a se expressar em resposta a fatores extrínsecos.].A. O'NEILL. L. que são construídas segundo o modelo básico modificado pela informação posicional. e) o DNA controlar a produção de proteínas e estas controlarem a atividade celular. Considerando os processos intracelulares. dá-se a síntese protéica. todas as afirmativas corretas encontram-se na alternativa a) I. os verdadeiros atores do drama molecular da vida. c) o material genético ser constituído por proteínas. células tornando-se diferentes de maneira ordenada [.. vértebras. de forma que os embriões são logo divididos em regiões que essencialmente se dividem de maneira independente". É verdade que a Fundação Nobel ainda fala no DNA como o diretor de cena a comandar a ação das proteínas.. Todas as interações ocorrem a curta distância . como em um sistema coordenado. b) O desenvolvimento envolve a expressão diferencial do material genético e independe do micro-ambiente em que a célula está localizada.) (LEITE. Marcelo. Uma maneira de produzir padrões é dar às células informação posicional. Durante o processo C. Durante o processo A. c) O desenvolvimento das diferentes regiões de um organismo deve-se à propriedade de interação célula-célula 245 . P. mas a síntese dele próprio é controle do DNA d) o RNAt é responsável pela etapa de transcrição no processo de síntese de uma proteína Questão 1093 "Desenvolvimento significa. Paulo . penas e dentes. (WOLPERT. M. IV. II e III b) I. 74.20/10/2002. o galardão de química ficou com os inventores de ferramentas para estudar proteínas. 1997.J. sendo os padrões especificados independentemente ao longo de cada um. "De volta ao seqüenciamento. é correto afirmar: a) As células diferenciam-se de acordo com um padrão intrínseco.. III. II. Uma outra característica comum parece ser a geração de estruturas periódicas como segmentos.) Com base no texto e nos conhecimentos sobre o tema. In: MURPHY. Lewis. em grande parte. Muitos animais desenvolvem-se ao longo de eixos cartesianos.raramente ultrapassam mais que 30 diâmetros de célula . III e IV Questão 1091 (. os processos A.) De outro lado. mas talvez não seja pretensioso supor que foi um lapso.e a maior parte da formação de padrões acontece localmente. Durante o processo B. São Paulo: UNESP. A importante implicação disto é que não existe relação entre o padrão inicial e o observado. o DNA se duplica. e as células então interpretam esses valores de maneiras diferentes. denominado transcrição. denominado replicação. ocorre a síntese de RNA.

em que a diferenciação de um tipo celular induz outro tipo a se diferenciar. desta forma.CGU Questão 1096 Sobre os diferentes papéis dos ácidos nucléicos na síntese de proteínas podemos afirmar corretamente que: a) a seqüência de bases no DNA determina a seqüência de aminoácidos na cadeia polipeptídica. d) A diferenciação caracteriza-se pela manutenção do padrão morfológico e pela alteração do padrão funcional do tecido.TCG . esta enzima passa para o lisossomo. ele simplesmente separa o meio de cultura do microrganismo e isola a enzima deste meio. do seu RNAm. produzida pelo fungo 'Aspergillus niger'. Portanto.TAC c) TUG . para o meio de cultura. De acordo com o texto. Em seguida. via vesículas de secreção. onde a tradução é concluída. 246 .UAC b) ATG . respectivamente. b) O caminho da produção da pectinase começa com a transcrição. Em seguida.UCG . via vesículas de secreção. d) A síntese da pectinase começa no núcleo e termina nas membranas do retículo endoplasmático liso.e da quantidade de informações que a célula é capaz de processar. substâncias químicas indispensáveis à vida. que é traduzido por ribossomos e depois é ancorado nas membranas do retículo endoplasmático rugoso. no meio de cultura líquido.CUT . Questão 1094 Um RNA-mensageiro bacteriano é formado pela polimerização de 5292 nucleotídios e contém três códons de iniciação de leitura e três de terminação. c) o transporte de aminoácido para o local da síntese é feito pelo mRNA. para o meio de cultura.CUA .GAC e) GCA . no citoplasma.CTA . está corretamente referida em: a) O DNA transcreve a mensagem genética para o RNA.AUG Os anti-códons correspondentes são: a) AUG . Em seguida.UGC . para o meio de cultura. Sabe-se que X < Y < Z e que esses valores formam uma progressão aritmética. c) A síntese da pectinase começa no citoplasma e termina nas membranas do retículo endoplasmático rugoso.ACG .GAU . b) a posição dos aminoácidos na cadeia polipeptídica depende da seqüência de bases do tRNA. um processo bastante complexo e fundamental para a sobrevivência das células. via vesículas de secreção. esta enzima passa para o complexo de Golgi e é secretada. depois para o complexo de Golgi e é secretada. a participação dos ácidos nucléicos. Questão 1098 Na síntese protéica.ACT .CGA . contendo. e) a extremidade livre dos diversos tRNA tem seqüências de bases diferentes.ACG . para ser empregada na indústria de sucos. Admita que todos os demais nucleotídios formam códons que correspondem a aminoácidos encontrados na estrutura primária das proteínas após serem sintetizadas. Gustavo não precisa destruir o fungo para obter a enzima. Y e Z de aminoácidos. d) a seqüência de bases do rRNA é transcrita a partir do código do mRNA.UTC d) AGT . um número X. a síntese da enzima ocorre nas membranas do mesossomo e depois ela é secretada para o meio de cultura. esta enzima passa para o complexo de Golgi e é secretada. e) A síntese da pectinase começa no mesossomo e termina nas membranas do retículo endoplasmático rugoso. a) O 'Aspergillus niger' é um organismo que possui mesossomo. que serve de modelo para a formação de uma proteína. Questão 1097 O pesquisador Gustavo obtém pectinase. o valor de Y equivale a: a) 826 b) 706 c) 586 d) 466 Questão 1095 Considere os seguintes códons: UAC . Esse RNA é traduzido em três diferentes proteínas. assinale a alternativa correta.GUA . e) O desenvolvimento ocorre como um dominó.

8. local onde ocorre a transcrição da mensagem genética. comandando a síntese da proteína viral. Após certo tempo. Questão 1101 São feitas as seguintes afirmativas a respeito da síntese protéica. c) o gene responsável pela síntese da cadeia polipeptídica ’ aumenta sua atividade a partir do terceiro mês da concepção. verificou que esses ovócitos. também. Questão 1102 No esquema. responsáveis pela transcrição de uma cadeia polipeptídica. c) o material injetado nos ovócitos foi capaz de se autoduplicar. I) Um RNAt transporta sempre o mesmo aminoácido. é INCORRETO afirmar que a) a ativação do gene responsável pela síntese da cadeia polipeptídica “ ocorre dias antes do nascimento. – e “ estarão presentes no indivíduo adulto. em que está representada a produção de diferentes tipos de cadeias polipeptídicas .‘. Analise-a e assinale a alternativa correta. II) A tradução do código genético do RNAm é feita nos ribossomos localizados no retículo endoplasmático rugoso. Esses dados sugerem que a) o DNA dos ovócitos foi impedido de se expressar. ’. Questão 1100 Analise este gráfico. III) O anticódon corresponde a uma trinca de bases localizada numa determinada região de todos os RNAt. ’. c) Estão corretas apenas I e II.5. c) O RNA mensageiro contém trincas de nucleotídeos denominadas códons.5 247 . além de suas próprias proteínas. d) O RNA transportador apresenta na sua molécula uma trinca de nucleotídeos denominada anticódon. Questão 1099 Um pesquisador injetou RNA mensageiro (mRNA) de vírus em ovócitos de anfíbios. e) O RNA ribossômico se une a proteínas formando o ribossomo.8. local da síntese protéica. d) Apenas III está correta. respectivamente: 1. os números 1. que se liga ao ribossomo. b) o mRNA se integrou ao DNA dos ovócitos. e) Estão corretas apenas I e III. local de ligação com o aminoácido que ele transporta. a) Apenas II está correta. b) Todas estão corretas. proteínas virais.‘.5 1. 2 e 3 substituem.b) O DNA transcreve a mensagem genética para o RNA solúvel. – e “ determinadas pela ação de diferentes genes e que vão compor as hemoglobinas em várias fases do desenvolvimento humano: om base nas informações contidas nesse gráfico e em outros conhecimentos sobre o assunto.5. d) os quatro tipos de cadeias polipeptídicas . d) os ovócitos foram capazes de interpretar a informação contida no mRNA viral. produziam. b) a síntese da cadeia polipeptídica ‘ permanece constante durante a mudança de produção das cadeias – e ’.

um dos descobridores da estrutura da molécula de DNA. Questão 1106 respeito deste esquema são feitas as seguintes afirmações: I . transcrição c) amplificação gênica. assim.8.Um indivíduo com a enzima 1 inibida precisa receber os hormônios 1 e 2 de fontes externas. diferentes códons sempre especificam diferentes aminoácidos na cadeia polipeptídica. as bases para a descoberta do código genético. tradução Questão 1103 O esquema a seguir mostra a via metabólica de um aminoácido. transcrição. repressão.8. d) cada molécula de DNA é formada pela reunião de nucleotídeos. levando à formação de alguns hormônios: dogma central da Biologia. será lembrado como um dos mais influentes cientistas de todos os tempos. II . (08) o ordenamento dos aminoácidos na proteína formada dá-se em função da seqüência de bases nitrogenadas. lançando. tradução e) transcrição.5. (32) existem códons específicos para concluí-lo. Com relação a esse processo. morto em julho de 2004. replicação b) replicação.5 248 . apresentando suas hipóteses sobre a estrutura teórica da biologia molecular. e deste para a proteína. b) Apenas II.a) repressão gênica. a) o código genético é degenerado. publicou um manifesto sobre a síntese de proteínas. e) Apenas II e III.Um indivíduo com a enzima 1 inibida deixa de produzir as enzimas 2 e 3. (16) o código genético é degenerado. transcrição. no interior do núcleo. isto é. replicação. Segundo esse dogma. Em 1958. e) uma molécula de DNA difere de outra pela seqüência de seus nucleotídeos. d) Apenas I e II. III . tradução. Questão 1104 O cientista britânico Francis Crick. que podem ser de quatro tipos diferentes. c) cada polipeptídeo tem uma seqüência específica de nucleotídeos determinada pelo gene. pois um aminoácido pode ser codificado por mais de uma trinca.5 Um dos processos metabólicos mais importantes. Quais estão corretas? a) Apenas I.5. presente no RNA mensageiro. o mensageiro e o transportador. que ocorre em nível celular. (04) o RNA transportador tem como função levar as proteínas produzidas no núcleo para o citoplasma. é a síntese de proteínas. (02) dele participam três moléculas de RNA: o ribossômico.Um indivíduo com a enzima 1 inibida acumulará grandes quantidades de aminoácido 3. é CORRETO afirmar que: (01) ele ocorre nos ribossomos. c) Apenas III. b) a transferência de informações genéticas ocorre do DNA para o RNA. Questão 1105 1. tradução d) replicação. Entre as hipóteses apresentadas naquele texto. destaca-se o 1.

249 . Na figura. São Paulo: Moderna.tradução . "Biologia . RNAm. vol.tradução .citoplasma. a) transcrição .replicação . d) RNAm.transcrição . os processos representados pelos números (1) e (2) ocorrem no _________.5. (2) No esquema.núcleo d) replicação . c) RNAt. RNAm. p. Nas células eucariotas. (3) O conjunto representado pode estar localizado no retículo endoplasmático rugoso.8.Uma abordagem evolutiva e ecológica". o número (1) corresponde ao processo de ___________. o número a) 2 representa o RNA mensageiro que contém os códons para a síntese protéica. 1. d) 1 representa a mitocôndria onde ocorre o processo de tradução.5 AVANCINI e FAVARETTO. e) RNAm. 1997. (1) Os ribossomos estão se movendo da parte de baixo para a de cima do esquema. RNAt.8. RNAt. 1. ribossomo e anticódon. b) RNAt.8. 150. 1. as lacunas.5. (0) Ao final da síntese. ao processo de ___________ e o número (3) ao processo de ___________. o número (2).tradução . Questão 1109 O diagrama ilustra uma fase da síntese de proteínas.5.tradução .tradução .replicação . Questão 1108 O esquema a seguir representa a síntese protéica.citoplasma e) replicação . que também participa do processo.5 s algarismos I. ribossomo e códon. a: a) ribossomo. (4) O número de aminoácidos da proteína dependerá do tamanho do RNA mensageiro.transcrição . e) 4 representa o RNA mensageiro que está sendo carregado pelo RNA transportador representado pelo número 1. III e IV correspondem.transcrição .núcleo.No esquema.5 Analise o esquema e julgue os itens a seguir. b) 3 representa a proteína carregada pelo RNA mensageiro. todas as proteínas representadas no esquema serão iguais. RNAm e RNAt. não está representado o RNA transportador. corretamente. Assinale a alternativa que preenche. b) replicação .núcleo Questão 1107 1. ribossomo e códon. respectivamente. c) transcrição . II. códon. ribossomo e anticódon. c) 4 representa o RNA transportador que carrega a mensagem.

1. somente. onde quatro genes. 3 e 4. transcrição e lisossomo. tradução e ribossomo. não patogênicos. b) tradução. somente. d) uma enzima. c) nos genes I e III.5 250 .5 m indivíduo tem anomalias na pigmentação do corpo e seu metabolismo é prejudicado pela falta do hormônio da tireóide. somente. que resume as principais etapas da síntese protéica que ocorre numa célula eucarionte. d) nos genes II e III. b) o ácido indolilacético. é normal. c) duplicação. O funcionamento das glândulas supra-renais. quantos nucleotídeos em média estão presentes em uma seqüência codificadora de ARN-m. somente. somente. a a) transcrição. De acordo com o esquema. misturados com um extrato de pneumococos capsulados.5. responsável pelo sequenciamento dos aminoácidos em um peptídeo com peso molecular de 27000 daltons? a) 810 b) 300 c) 270 d) 81000 e) 2700 Questão 1113 Griffth em 1928 descobriu que pneumococos sem cápsula. 1. s processos assinalados como 1 e 2 e a organela representados no diagrama referem-se. misturados com um extrato de pneumococos capsulados patogênicos mortos causavam a morte de cobaias. b) o ácido indolilacético. III e IV. b) nos genes I e II. 1. respectivamente. e) uma proteína. II. Questão 1112 Supondo que o peso molecular médio de um aminoácido é de 100 daltons. 2. d) transcrição. c) o ácido desoxirribonucléico. e) nos genes III e IV. porém. Questão 1111 Considere o diagrama. patogênicos e mortos. duplicação e retículo endoplasmático. Nesse extrato o agente transformante era a) o ácido ribonucléico. os sintomas que o indivíduo apresenta ocorrem devido às alterações a) no gene I. Questão 1114 Em 1928 Griffth descobriu que pneumococos (bactérias) sem cápsula e não-patogênicos. d) uma enzima. I. transcrição e ribossomo. transformando o aminoácido fenilalanina em quatro possíveis substâncias. duplicação e lisossomo.8. e) tradução.8.5. causavam a morte de cobaias. produzem quatro tipos diferentes de enzimas. e) uma proteína. Nesse extrato o agente capaz de transformar bactérias não-patogênicas em patogênicas era a) o ácido ribonucléico.Questão 1110 O esquema representa alguns passos de uma série de reações metabólicas. c) o ácido desoxirribonucléico.

Questão 1115 Griffth, em 1928 descobriu que bactérias pneumococos sem cápsula e não-patogênicos, misturados com um extrato de pneumococos capsulados, patogênicos e mortos, causavam a morte de cobaias. Em 1944 Avery, McLeod e McCarthy concluíram que o agente capaz de transformar as bactérias era a) o RNA. b) o AIA. c) o DNA. d) uma enzima. e) uma proteína. Questão 1116 A experiência do "liquidificador" realizada por Hersey e Chase demonstrou que a substância que determinava a destruição de bactérias parasitadas pelos vírus bacteriófagos era a) uma proteína viral. b) uma enzima viral. c) o RNA viral. d) o DNA viral. e) um lípide viral. Questão 1117 O experimento do "liquidificador" serviu para demonstrar que o DNA de certos organismos era capaz de causar a destruição de bactérias. Os organismos que podem infectar bactérias são a) fungos. b) vírus. c) algas. d) ácaros. e) protozoários. Questão 1118 Bacteriófagos são a) protozoários de vida livre. b) líquenes parasitas. c) vermes parasitas. d) vírus. e) vermes de vida livre.

Questão 1119 A experiência do "liquidificador" realizada por Hersey e Chase em 1952 demonstrou que a) o material genético é formado por proteínas. b) o material genético é formado de RNA. c) o material genético é formado de lipídios. d) o material genético é formado por açúcares. e) o material genético é formado de DNA. Questão 1120 A bactéria 'Pneumococo pneumoniae' pode possuir uma cápsula que lhe permite a) sofrer mutações. b) desenvolver flagelos. c) resistir às defesas dos hospedeiros. d) ficar imune às defesas dos hospedeiros. e) sobreviver em ambientes sem água. Questão 1121 "O século XX proporcionou uma série de pesquisas na área genética. Em 1928, Griffith realizou um importante experimento que envolvia transformações em bactérias. Esse experimento, retomado por Avery e colaboradores, em 1944, foi a base para a descoberta da molécula formadora do material genético. Nos anos 50, Watson e Crick apresentaram o modela da dupla-hélice dessa molécula, abrindo caminho para que, na década seguinte, se demonstrasse como o gene, através de sua seqüência de bases nitrogenadas, controla a produção de proteínas. Nas duas últimas décadas, o avanço biotecnológico permitiu aos cientistas a manipulação do material genético e a transferência de um gene de uma espécie para outra." Considere os itens abaixo: I. estrutura da molécula do DNA; II. descoberta do código genético; III. DNA como molécula constituinte do gene; IV. obtenção de organismos transgênicos. O texto faz referência a) apenas aos itens I, II e III.
251

b) apenas aos itens I, II e IV. c) apenas aos itens I, III e IV. d) apenas aos itens II, III e IV. e) a todos os itens considerados. 1.5.8.6 Questão 1122 Sabendo que o DNA dos vírus bacteriófagos contém fósforo e que a cápsula protéica contém enxofre, Hersey e Chase, em 1952, cultivaram vírus em meio contendo isótopos de fósforo (¤£P) e de enxofre (¤¦S). Esses pesquisadores observaram, ao introduzir os vírus marcados em meio contendo bactérias, que os isótopos de fósforo (¤£P) apareciam no interior das bactérias e que os isótopos de enxofre (¤¦S) permaneciam fora das células. Observaram também que, após lavarem a superfície das bactérias, retirando o enxofre (¤¦S), continuava ocorrendo a replicação dos vírus. Com esse experimento, eles puderam concluir que a) a informação genética necessária para a síntese de novos vírus está contida no DNA viral. b) as capas protéicas dos vírus contêm parte importante da informação genética necessária à síntese de novos vírus. c) o DNA viral precisa estar associado integralmente às capas protéicas para poder se replicar no interior das bactérias. d) a capa protéica protege o DNA viral da ação de endonucleases no interior do organismo hospedeiro. e) os vírus bacteriófagos contêm DNA como material genético, e essa molécula é muito rica em enxofre. Questão 1123 No início da década de 1950, foi desenvolvido um experimento onde um dos componentes de um tipo de bacteriófago foi marcado radiativamente com enxofre e outro, com fósforo. Esses bacteriófagos foram utilizados para infectar uma cultura de 'Escherichia coli'. Um dos componentes entrou na bactéria, e o outro foi retirado da parede da mesma, por agitação. A cultura foi, então, imediatamente, centrifugada. O resultado obtido encontra-se ilustrado no esquema a seguir.

obre o resultado do experimento, é correto afirmar que a) o DNA do bacteriófago marcado com fósforo encontra-se no depósito bacteriano. b) as proteínas do bacteriófago marcadas com enxofre encontram-se no depósito bacteriano. c) o DNA do bacteriófago marcado com enxofre encontra-se em suspensão. d) as proteínas do bacteriófago marcadas com fósforo encontram-se em suspensão. e) o DNA do bacteriófago marcado com enxofre encontra-se no depósito bacteriano. Questão 1124 Por razões pouco conhecidas, durante a meiose pode ocorrer a não-disjunção de um determinado par de cromossomas, acarretando anomalias cromossomiais. Como exemplo de anomalia cromossomial autossômica temos: a) mongolismo. b) daltonismo. c) hemofilia. d) Síndrome de Turner. e) Síndrome de Klinefelter. Questão 1125 O esquema a seguir representa a formação dos gametas responsáveis pela produção de um indivíduo com alteração do seu número cromossomial.

252

1.5.9.1

III IV a) 65 , 65. b) 65 ,130. c) 70 , 60. d) 130 , 65. e) 130 , 130. Questão 1128 Monossomia do cromossomo X, ovários rudimentares, mau desenvolvimento dos caracteres sexuais secundários, baixa estatura são, entre outros, dados que podem ser relacionados com a síndrome: a) de Marfan b) de Klinefelter c) de Down d) de Turner e) de Patau Questão 1129 A constituição genética dos indivíduos com síndrome de Klinefelter é: a) 45A XX b) 44A XYY c) 44A XXY d) 45A XO e) 47A XXY Questão 1130 A síndrome de Down ou mongolismo é uma anomalia causada por: a) uma mutação gênica b) uma deficiência cromossômica c) uma diminuição do número de cromossomos no genoma d) um aumento do número de cromossomos do genoma e) uma inversão cromossômica Questão 1131

ntre as características que este indivíduo passará a apresentar, teremos: a) sexo masculino. b) cariótipo normal. c) estatura elevada. d) caracteres sexuais desenvolvidos. e) ausência de cromatina sexual. Questão 1126 A síndrome de Klinefelter é uma anomalia genética devido à: a) presença de três cromossomos autossômicos nŽ 21. b) ausência de um cromossomo autossômico nŽ 21. c) presença de um cromossomo X e dois cromossomos Y. d) presença de um cromossomo Y e dois cromossomos X. e) ausência de cromossomos sexuais. Questão 1127 Suponha que o seguinte processo ocorre em uma comunidade onde convivem diferentes espécies de gramínea: Qual das alternativas a seguir indica corretamente o valor de 2N dos híbridos III e IV do processo esquematizado?

1.5.9.1

Se na ovulogênese, não houver disjunção do par de cromossomos sexuais, os óvulos correspondentes, sendo fecundados, poderão dar origem a casos de a) síndrome de Turner b) síndrome de Klinefelter c) síndrome de Down d) síndrome de Patau e) a e b são possíveis
253

Questão 1132 Duas espécies de plantas A(2n = 8) e B(2n = 6) foram cruzadas produzindo um híbrido interespecífico que, germinando, produz alguns grãos de pólen que foram utilizados para fecundar óvulos da espécie B. Assinale a opção que relaciona o nível de ploidia e o número de cromossomos da descendência. a) 2n = 7 b) 2n = 10 c) 3n = 7 d) 3n = 10 e) 4n = 14 Questão 1133 Duas espécies de plantas A(2n = 8) e B(2n = 10) foram cruzadas produzindo um híbrido interespecífico que, germinando, produz alguns grãos de pólen que foram utilizados para fecundar óvulos da espécie B. Assinale a opção que relaciona o nível de ploidia e o número de cromossomos da descendência. a) 2n = 7 b) 2n = 14 c) 3n = 14 d) 3n = 10 e) 4n = 14 Questão 1134 A figura a seguir representa uma sinapse (pareamento) anormal observado quando ocorre a mutação cromossômica estrutural denominada:

a) inversão pericêntrica b) translocação c) duplicação d) deleção e) isocromossomos Questão 1135 A figura a seguir representa uma sinapse (pareamento) anormal observado quando ocorre a mutação cromossômica estrutural denominada:

1.5.9.1

a) inversão pericêntrica b) translocação c) duplicação d) deleção e) isocromossomos Questão 1136 Existem algumas pessoas chamadas especiais porque possuem uma série de características diferentes da maioria da população. Entre essas, estão aquelas que possuem a 'Síndrome de Down', também conhecida como Mongolismo. Em relação a essa síndrome, podemos afirmar que: a) é uma anomalia genética, causada pela presença de 3 cromossomos 21 e transmitida sempre pela mãe. b) é uma anomalia congênita, causada pela presença de 3 cromossomos 21 e transmitida sempre pela mãe. c) é uma anomalia genética, causada pela presença de 3 cromossomos 21 e transmitida por qualquer um dos pais. d) é uma anomalia congênita, causada pela ausência de um cromossomo sexual X ou Y. e) é uma anomalia genética, causada pela translocação de um dos cromossomos 21 para um 22.

1.5.9.1

254

Questão 1137 Num dado organismo, foram encontradas células somáticas normais com seis cromossomos (I) e células aberrantes (II e III) cujos cariótipos estão esquematizados a seguir.

Questão 1139 O número de cromossomos de uma espécie é 2n=20. O sistema de determinação do sexo é do tipo ZW. O cariótipo que representa uma euploidia é: a) 20, ZW b) 20, ZZ c) 30, ZWW d) 19, ZO e) 21, ZZW Questão 1140 A figura a seguir ilustra o processo denominado AMNIOCENTESE, utilizado para diagnóstico pré-natal de doenças genéticas. A técnica consiste na remoção de uma pequena quantidade de líquido amniótico (que banha o feto durante o desenvolvimento embrionário) para análise. Nesse líquido são encontradas proteínas e células que se soltam da pele do feto e dos revestimentos das vias gastrointestinais, respiratórias e genito-urinárias. As células imersas no líquido podem ser coletadas por centrifugação e utilizadas para estabelecer culturas de amniócitos. Essas culturas podem ser analisadas citologicamente, ou por análise do DNA.

1.5.9.1

s aberrações cromossômicas dos cariótipos II e III são, respectivamente, do tipo a) monossomia e trissomia. b) monossomia e poliploidia. c) nulissomia e trissomia. d) nulissomia e poliploidia. e) nulissomia e monossomia. Questão 1138 Observe o cariótipo a seguir, obtido a partir de células diplóides de uma pessoa.

1.5.9.1

1.5.9.1

ua análise permite afirmar que ele pode pertencer a uma mulher a) normal, com 47 cromossomos. b) com síndrome de Down. c) com síndrome de Klinefelter. d) com daltonismo. e) com polidactilia.

255

obre o processo acima descrito são feitas várias afirmações. Com base em seus conhecimentos e no texto acima, assinale a alternativa que apresenta um ERRO conceitual ou processual. a) O líquido amniótico funciona como amortecedor de choques mecânicos e propicia um ambiente adequado para o desenvolvimento do feto. b) Células presentes no líquido podem ser utilizadas para a determinação de anomalias cromossômicas. c) O processo pode ser indicado para gestantes com idade avançada, para as quais é maior o risco de terem filhos com Síndrome de Down. d) A cariotipagem pode ainda ser utilizada para a detecção de erros inatos do metabolismo como, por exemplo, a hemofilia. e) A presença de alguns vírus, como o da rubéola, apontam para possibilidade de más formações congênitas na criança. Questão 1141 O daltonismo é um caráter ligado ao sexo na espécie humana. A seguir estão representados os cariótipos de cinco indivíduos que apresentam uma anomalia cromossômica numérica, além de serem todos daltônicos.

odas as afirmações a seguir referentes aos indivíduos representados são verdadeiras, EXCETO: a) O gameta com um cromossomo a mais que deu origem ao indivíduo I foi produzido por não-disjunção na segunda divisão meiótica da gametogênese masculina. b) Ao pai do indivíduo II é obrigatoriamente daltônico, e a não-disjunção que resultou na anomalia pode ter acontecido na gametogênese feminina. c) Se o pai do indivíduo III não for daltônico, a não-disjunção que resultou na anomalia ocorreu na gametogênese feminina. d) Se o pai do indivíduo IV não for daltônico, a não-disjunção que resultou na anomalia ocorreu na gametogênese feminina. e) A mãe do indivíduo V pode ou não ser daltônica. Questão 1142

1.5.9.1

1.5.9.1 Acima, representa-se esquematicamente uma alteração estrutural de um cromossomo que serve de exemplo para o fenômeno denominado a) duplicação. b) deleção. c) translocação. d) transdução. e) inversão. Questão 1143 Uma mulher triplo-X é fértil e produz óvulos normais e óvulos com dois cromossomos X. Sendo casada com um homem cromossomicamente normal, essa mulher terá chance de apresentar a) apenas descendentes cromossomicamente normais. b) apenas descendentes cromossomicamente anormais. c) 50% dos descendentes cromossomicamente normais e 50% cromossomicamente anormais.
256

que florescia. e) 75% dos descendentes cromossomicamente normais e 25% cromossomicamente anormais. 1. de 257 . foram cruzadas e criou-se um híbrido. b) mutação de um gene do cromossomo X.d) 25% dos descendentes cromossomicamente normais e 75% cromossomicamente anormais. Questão 1144 Na espécie humana. III e IV. Questão 1145 Duas espécies de gramíneas. b) Durante a meiose ocorrida em F1. c) A primeira geração filial era infértil. seguida de reprodução normal na F2: a) O tratamento com colchicina removeu as barreiras químicas existentes nos dois conjuntos de cromossomos. Meristemas desta geração de híbridos (F1) foram submetidos a um tratamento com colchicina. também com 2n=28.5. Questão 1146 Pela análise dos cromossomas.1 s eventos possíveis da meiose que levam à síndrome de Down são os de número: a) 1 e 4 b) 1 e 3 c) 2 e 3 d) 2 e 4 Questão 1147 Considere o cromossomo a seguir esquematizado. temos uma célula diplóide 2n = 6 cromossomos.9. ambas com número cromossômico 2n=28. 1. gerando plantas (F2) com 2n=56. Assinale a alternativa que representa esse cromossomo após um rearranjo do tipo inversão. respectivamente. temos exemplos.5. viabilizando a meiose. que foram seletivamente eliminados em F2.9. e) A duplicação deu-se apenas com os cromossomos viáveis de cada espécie e o número total foi completado com quebras cromossômicas. d) existência de um cromossomo X extra. mas não conseguia produzir sementes. em função de alelos incompatíveis. c) existência de um autossomo extra. e) falta de um cromossomo X. parte dos cromossomos foi eliminada. d) A duplicação do número cromossômico permitiu a formação de 28 pares de cromossomos bivalentes. assinale a alternativa que indica a causa mais provável para a infertilidade da F1. O esquema a seguir apresenta quatro eventos da divisão celular. que por sua vez produziam sementes normalmente. De acordo com o texto e os conhecimentos sobre o tema. é possível detectar a anomalia que caracteriza a síndrome de Down. o que resultou em uma duplicação do número cromossômico. pertencentes a gêneros diferentes. Em II. em I. a anomalia conhecida como síndrome de Down ou mongolismo deve-se à a) mutação de um gene autossômico. havendo multiplicação apenas do lote haplóide de uma das espécies.1 Questão 1148 Na figura a seguir.

c) a ocorrência do fenótipo mutante é resultado de um cromossomo extra. d) monossomia. mais vigorosos e. inversão pericêntrica. Como exemplo. usando-se técnicas de melhoramento genético. b) inversão cromossômica. 1. inversão pericêntrica. Esses vegetais podem ser reproduzidos pelo homem. ocorrem casualmente na natureza. também conhecida como trissomia 21: ( ) a causa é a não-disjunção. inversão paracêntrica. o fenômeno ocorre quando os cromossomos não se separam durante a primeira divisão meiótica. Na tabela a seguir são dados cinco casos cuja veracidade você deverá analisar. c) É um típico exemplo de animal híbrido. d) Produz gametas inviáveis. e) translocação cromossômica. c) poliploidia. Chamava-se Sete-de-Ouros.Guimarães. d) recombinação gênica. e) monossomia. "Sagarana". ( ) nos homens.5. miúdo e resignado.Questão 1151 O número de cromossomos da espécie humana pode. é INCORRETO afirmar que a) os pais de um indivíduo Klinefelter têm número normal de cromossomos nas células somáticas. como outro não existiu e nem pode haver igual. mais vantajosos economicamente. isto é. não levando à aneuploidia em seus filhos. não existindo não-disjunção e. inversão paracêntrica. e já fora tão bom." (ROSA. b) Tem características morfológicas idênticas às de um dos pais. translocação. Assinale nos parênteses V se for verdadeira ou F se a afirmação for falsa. b) haploidia. 1.) Todas as alternativas apresentam características biológicas do burrinho referido nesse texto. às vezes.5. artificialmente.1 a) haploidia. Pessoas com síndrome de Klinefelter possuem 47 cromossomos. Questão 1149 Vegetais maiores. podemos citar o uso da Colchicina. vindo de Passa-Tempo. Com base nessas informações e outros conhecimentos sobre o assunto. EXCETO a) É resultante do cruzamento de égua com jumento. Questão 1152 Muitas aberrações cromossômicas humanas se manifestam como síndromes bem definidas e de fácil constatação pela análise do cariótipo. ou não sei onde no sertão. translocação. entre os quais. translocação. por esse motivo. Conceição do Serro.1 Questão 1153 Na Síndrome de Down. os cromossomos sexuais são representados por XXY. que induz à a) haploidia. translocação.9. apresentar alterações. 258 . Questão 1150 "Era um burrinho pedrês. d) a fecundação de um óvulo X por um espermatozóide XY dá origem a um indivíduo Klinefelter. a produção de espermatozóide ocorre durante todos os anos reprodutivos. inversão paracêntrica. J. b) a presença de dois cromossomos X impede a manifestação do fenótipo masculino. translocação.9. por conseguinte. c) monossomia.

b) fecundação de um gameta feminino diplóide por um gameta masculino haplóide. Quanto a esses micronúcleos. c) senilidade dos ovócitos em mulheres com idade a partir dos 35 anos. d) fato de as células autossômicas dos portadores terem 46 cromossomos. III . Em função do comentário do professor. p. Questão 1156 Uma pesquisadora analisou células da mucosa bucal de frentistas de postos de gasolina. Questão 1155 FALHAS NO ENSINO DE CIÊNCIAS "ERROS EM LIVROS DIDÁTICOS AINDA PERSISTEM EM ESCOLAS DE MINAS E SÃO PAULO" Nélio Bizzo O autor. trabalhar e ter uma vida semelhante à dos demais cidadãos. podemos supor que se originaram a partir de a) translocação. d) I. "CIÊNCIA HOJE". c) II e III estão corretas. como por exemplo: explique por que o homem não é portador de aneuploidias. c) Trissomia.. 26 Os casos de aneuploidias citados no texto incluíam daltonismo e hemofilia. d) Euploidia. Questão 1154 A Síndrome de Down. em alguns casos.o livro confunde herança ligada ao sexo com aneuploidias. Questão 1158 As anomalias cromossômicas são bastante freqüentes na população humana. analise as afirmações abaixo: I . além do núcleo. Rev. b) substituição. b) I e III estão corretas. Na grande maioria dos casos. caracteriza-se pela trissomia do cromossomo 21 e decorre do(a) a) erro de disjunção do cromossomo 21 durante a formação dos gametas. preconceito e tautologia em uma única linha.. c) deleção." BIZZO. pessoas com síndrome de Down alcançam importantes marcos no desenvolvimento e podem estudar. professor da Faculdade de Educação da USP. Esta Síndrome pode ser classificada como exemplo de a) Nulissomia.tanto o homem quanto a mulher podem ser portadores de aneuploidias. ( ) o longo período de intervalo entre o início da meiose do tecido ovariano (durante o desenvolvimento fetal) e seu término (na ovulação) é a mais provável razão para a incidência aumentada em mães mais idosas. um exemplo disso é que aproximadamente uma a cada 600 crianças no mundo nasce com síndrome de Down. Questão 1157 Mulheres com Síndrome de Turner caracterizam-se por apresentar baixa estatura. apresentavam micronúcleos originados em cromossomos defeituosos.( ) afeta indivíduos que têm um autossoma extra. Quando bem assistidas. mas apresenta a doença quando afetado. uma aneuploidia autossômica. d) deslocação. esterilidade e pescoço alado.daltonismo e hemofilia são alterações gênicas e não cromossômicas. isso se deve à presença de um cromossomo 21 extranumerário. Pode-se afirmar que a) I e II estão corretas. e) bipartição. Abril 2000: nŽ 159. b) Monossomia. ou um segmento do cromossomo 21. Foram encontradas muitas células que. II . translocado para outro cromossomo. e) I está correta. II e III estão corretas. comenta em um dos seus artigos: ". Nélio. 259 . e) Triploidia. ( ) os portadores têm uma cópia extra do cromossomo 21. podem-se perceber erro conceitual grave.

9. os machos normais apresentam complemento cromossômico igual a 2n=6.Sobre as anomalias do número de cromossomos. (02) ocorrem mais em meninas do que em meninos.5. d) haplóide. são exemplo de trissomia e de monossomia. numerados de 1 a 6.9.1 A respeito desse tema.1 260 .5. onsiderando-se os dados anteriores.XY.5. um indivíduo anormal foi identificado na população e seu cariótipo foi representado pela seguinte forma: 1.9. presentes em cada uma delas. pode-se afirmar que o indivíduo é: a) trissômico. é CORRETO afirmar que: (01) podem ocorrer tanto na espermatogênese quanto na ovulogênese. Entretanto. e) monossômico. (4) As síndromes de Down e de Turner. com a indicação do número de cromossomos autossômicos (A) e dos tipos de cromossomos sexuais (X e Y). (64) podem acontecer devido a erros na duplicação do DNA. 1. b) poliplóide. (3) As aberrações cromossômicas numéricas causam grandes alterações no funcionamento celular. devido a um erro na gametogênese. Questão 1160 A figura abaixo esquematiza a não-disjunção cromossômica. produzindo doenças graves e até mesmo a morte. em esquema. (2) Os erros na distribuição de cromossomos que levam às aneuploidias são freqüentes no processo de meiose e raros nas mitoses. c) triplóide. Questão 1159 Em uma certa espécie de animal selvagem. julgue os itens abaixo. (04) ocorrem somente em filhos e filhas de mulheres de idade avançada. (08) estão intimamente ligadas à separação incorreta dos cromossomos na meiose. (1) As fibras do fuso acromático têm importância fundamental para as migrações cromossômicas características da anáfase. (16) ocorrem ao acaso. com menor escolaridade e pouca assistência médica. células de seis indivíduos. (32) ocorrem preferencialmente em populações de menor renda. causadas por não-disjunções cromossômicas.1 Os quadrados a seguir representam. Questão 1161 1.

I. III . II . é conhecida a trissomia do cromossomo 21 (síndrome de Down).As mutações ocorridas em células somáticas são de grande valor adaptativo para a perpetuação da espécie. tendo apenas um X. apenas. I . 47 cromossomos. d) I e III. e às células representadas. e) inclusão de mais três bases nitrogenadas no final da molécula. c) Turner. Os indivíduos 3. apenas. apenas. leia as afirmações a seguir. d) Down. Turner e Down. apenas. o chamado ADN lixo Questão 1164 As alterações do número de cromossomos. d) substituição das três primeiras bases nitrogenadas por outras. respectivamente. c) somente a I e a III. a II e a III. as síndromes de: a) Down. Turner e Klinefelter. b) Morgan. Klinefelter e Turner.Sempre que o ambiente se torna desfavorável. determinam. II. O indivíduo 4 pode ser do sexo masculino ou do sexo feminino. 261 . o ser vivo reage sofrendo uma mutação gênica.As mutações transmitidas às gerações futuras são aquelas que ocorrem em células germinativas. b) supressão das três primeiras bases nitrogenadas.Podem alterar o número. Em relação ao cromossomo sexual X são conhecidos casos de recém-nascidos do sexo feminino com trissomia. apenas. I . b) somente a I e a II. tais como: presença de um cromossomo 21 a mais. e) II e III. A célula do indivíduo 2 pode ser igual a de um gameta do indivíduo 1.Ocorrem para adaptar o indivíduo ao ambiente.Ocorrem em células sexuais e somáticas. III.m relação a estes indivíduos. A(s) afirmação(ões) correta(s) é(são): a) somente a II. Turner e Klinefelter. c) I e II. d) somente a II e a III. o que evita a permuta gênica entre eles d) Aos cromossomos X menos um serem inativados ainda na fase do desenvolvimento embrionário e) Ao cromossomo X ser o cromossomo com maior quantidade de ADN repetitivo. 5 e 6 são normais e pertencem à espécie humana. c) III apenas. A que se deve esse fato? a) Ao cromossomo X ser um dos menores cromossomos do conjunto haplóide b) Ao cromossomo X ser basicamente formado por heterocromatina com poucos genes estruturais c) Ao cromossomo X não ter uma pequena parte homóloga ao cromossomo Y. que é um dos menores cromossomos da espécie. foram feitas as afirmações seguintes. Questão 1165 Considere um segmento de DNA com seqüência de bases indicadas a seguir: TTA TCG GGA CCG ATC ATC GTA A alteração mais drástica que esta molécula pode sofrer é a: a) supressão da segunda base nitrogenada. tetrassomia e até pentassomia desse cromossomo. Questão 1162 A respeito das mutações. sendo dois X e um Y e 45 cromossomos. Down e Morgan. c) substituição da quarta base nitrogenada por outra. e) a I. a forma e o tamanho dos cromossomos. b) II. III . II . e) Klinefelter. Está(ão) correta(s) a) I apenas b) II apenas. Questão 1166 Analise as afirmativas a seguir a respeito das mutações. Questão 1163 Na espécie humana. Estão corretas as afirmações: a) I.

1. d) o código genético não poder sofrer alterações. mas a idéia não nos agrada muito. c) somente 1 e 2. Nova Fronteira. d) uma base púrica substituir uma pirimídica no RNA mensageiro que a codifica. seríamos ainda bactéria anaeróbia. e a música não existiria (.3 onsiderando as moléculas III. e é mais difícil ainda aceitar o fato de que errar é também biológico" (Lewis Thomas. d) ocorre devido a alterações na molécula de DNA. uma adenina sofreu uma desaminação e transformou-se em hipoxantina (H). Isto se dá devido ao fato de: a) o código genético ser universal. c) excitabilidade. d) excreção. Mutações podem ocorrer espontaneamente ou serem 262 . 2. b) somente 2. c) o erro ser corrigido pela célula durante a tradução. Questão 1167 A estrutura química de uma proteína poderá ser modificada se a) durante sua síntese houver variação dos tipos de aminoácidos disponíveis no citoplasma celular. muitas vezes não resultam em substituição efetiva do aminoácido correspondente ao códon mutado na proteína produzida.). b) o código genético ser repetitivo ou degenerado. ed. Sem esse atributo especial. b) durante sua síntese houver variação dos tipos de RNA transportadores. Um par de bases nitrogenadas está identificado. d) somente 3 e 4. "A medusa e a lesma". 1979). c) origina apenas seres recessivos. base que normalmente emparelha-se com citosina (C).9. b) reprodução. É ela: a) seleção natural. II. Questão 1170 Diversas doenças estão relacionadas a mutações no material genético.. mutações pontuais. nos organismos eucariontes a) constitui a principal fonte de variabilidade genética. RJ. Questão 1172 Leia as afirmativas a seguir: I. dizemos. Esse texto refere-se a uma característica dos seres vivos. Questão 1171 O esquema a seguir mostra dois ciclos de replicação de moléculas de DNA. Após a replicação da molécula I. Porém. e) origina somente combinações gênicas adaptativas. e) II e III apenas. 3 e 4. a mutação no par de bases indicado estará presente em a) somente 1. de modo que podemos esperar baixa variabilidade na sua população. e) 1. e) o DNA não se duplicar durante a intérfase. e) mutação..5. Errar é humano. c) sua síntese ocorrer no complexo de Golgi e não no retículo endoplasmático rugoso.d) I e II apenas. b) ocorre exclusivamente pela ação de agentes mutagênicos. Questão 1168 A mutação gênica. e) os genes mutados não serem transcritos ou traduzidos. com a alteração de apenas uma base nitrogenada. Questão 1169 "A capacidade de errar ligeiramente é a verdadeira maravilha do DNA. As cianofíceas reproduzem-se apenas assexuadamente.

respectivamente. ocorre a seqüência de reações a seguir esquematizada que leva à síntese do aminoácido arginina.e sem os erros as tentativas não teriam levado a nada. de forma significativa. b) I e II apenas. 1997. In: BROCKMAN.3 erificou-se que certos fungos mutantes só conseguem sintetizar arginina quando a ornitina é acrescentada ao meio de cultura. A partir do estudo de um grupo de 1850 pessoas. somente. No entanto (.. os cientistas afirmaram que a imunidade está relacionada a uma mutação genética. a sobrevivência dos indivíduos de uma determinada espécie depende da estabilidade genética.9. por ter sido transmitida de geração em geração. c) II e III apenas.). III. é: a) impedir a multiplicação de determinado vírus no interior das células . Esses fungos devem ter sofrido mutação no gene a) X. Mutações constituem um fator causador de variabilidade.) A evolução biológica se dá através de uma grande e inexorável seqüência de tentativas e erros .. (Adaptado de DENNETT. Uma das conseqüências deste fenômeno está descrita na seguinte alternativa: a) limitação da diversidade biológica 263 1. b) evitar a ação de agentes externos sobre os genes c) representar uma vantagem para a sobrevivência d) ocorrer em resposta à necessidade de adaptação Questão 1175 Durante o processo evolutivo. de: a) especiação e ortogênese b) mutação e seleção natural c) oscilação genética e epigênese d) variação hereditária e isolamento ecológico Questão 1176 Cometer erros é a chave para o progresso. A característica da mutação. somente. A afirmativa está CORRETA em: a) I. Entretanto.induzidas.. que permite que ela ocorra em grande número de indivíduos. das Letras. pode ocorrer uma alteração permanente numa seqüência de DNA. (.pergunte a qualquer cirurgião ou piloto de avião. c) Z. e) II apenas.) os erros não são apenas oportunidades valiosas para aprendermos. J. As coisas são assim. como aquelas provocadas pelos raios X. e MATSON K. II e III. Daniel C. apresentada por 3% dos pacientes estudados.5. d) X ou no gene Y. Questão 1174 Recentemente cientistas confirmaram suas suspeitas de que existem pessoas imunes à AIDS. eles são. São Paulo: Cia. Há momentos em que é importante não cometer erro algum . e) X ou no gene Z. a única oportunidade para aprendermos algo relativamente novo. somente. Os cientistas consideraram esse percentual muito elevado. Essa alteração na seqüência de DNA e a eliminação do indivíduo são fenômenos que podem ser explicados pela ocorrência. b) Y. (Org..) O processo que se relaciona com o conceito de evolução biológica apresentado pelo autor é: a) reparação das lesões gênicas b) indução de mutações programadas c) geração de organismos transgênicos d) alteração aleatória na estrutura do DNA Questão 1177 As mutações representam um importante mecanismo evolutivo para os organismos. d) I apenas. capaz de destruir um organismo. Questão 1173 Em certo fungo.

3 1. em uma população. durante um certo tempo. em uma determinada região africana que possui casos de malária. e) A troca da primeira base. prioriza os indivíduos HH. c) os genótipos HH e HÞH estão igualmente adaptados ao longo do tempo.5. 1. Questão 1180 Assinale a alternativa que indica o fator que conduz ao surgimento de variabilidade gênica nova. c) A seqüência pertence a um DNA e pode codificar um polipeptídeo contendo. pode-se concluir que a) o aumento do número de indivíduos HÞH está diretamente associado ao aparecimento de casos de malária. d) Recombinação gênica. pode resultar na troca do aminoácido respectivo na proteína. b) Fluxo gênico. o qual é reconhecido pelo anti-códon GCU. Sabendo-se que o continente africano possui alto índice de malária e que o 'Plasmodium malariae' tem dificuldade de sobreviver nas hemácias de indivíduos portadores do genótipo HÞH.9. desfavorece os indivíduos HÞH. e) Oscilação gênica. b) a elevação do número de indivíduos HH está associada ao aparecimento de indivíduos HÞH infectados. 27 aminoácidos. EXCETO a) A introdução de uma adenina (A) entre as trincas indicadas por 2 e 3 pode alterar toda a transcrição a partir desse ponto.b) criação de novas variantes de seres vivos c) extinção de espécies nocivas ao ambiente d) produção exclusiva de alterações benéficas Questão 1178 Indivíduos portadores do genótipo HÞH sofrem uma mutação gênica no cromossomo 11 e expressam anemia falciforme ou siclemia. analise a figura a seguir que representa uma população isolada. d) a variação do meio. a) Mutação.3 odas as afirmativas são corretas quanto à seqüência. e) a seleção natural. pelo menos. em um período de tempo. d) sempre é dominante e prejudicial ao organismo. c) aumenta o número de alelos disponíveis em um locus. Com base nas informações apresentadas. d) A trinca indicada por 5 pode transcrever um códon CGA. c) Seleção natural. nesse caso. em quaisquer das trincas indicadas. Questão 1181 Pode-se afirmar que a mutação a) sempre ocorre para adaptar o indivíduo ao ambiente. Questão 1179 Observe a seqüência de bases nitrogenadas. b) A mutação da 3  base na trinca indicada por 9 pode traduzir um aminoácido diferente.5.9. 264 . b) aumenta a freqüência de crossing-over.

d) reprodução assexuada. tais como agentes químicos e físicos. para a seqüência de aminoácidos. como representado na figura. d) treonina .LISINA. IV. b) I. As mutações não podem ser espontâneas.lisina.treonina . outros de casca vermelha e outros de casca bicolor. um dos frutos.isoleucina .isoleucina. independentemente do seu sistema reprodutivo. As mutações são fatores importantes na promoção da variabilidade genética e para a evolução das espécies. ISOLEUCINA . e) reprodução sexuada. c) I. d) II. III e IV. c) seleção natural.treonina. ao invés de apresentar casca vermelha. d) alguns de casca amarela e outros de casca vermelha.alanina . I. e) alguns de casca amarela. e) lisina .lisina . a fita que será transcrita apresenta a seqüência de nucleotídeos TAA TGT CGA TTC e codifica. o único que fornece material genético novo a um determinado conjunto gênico preexistente é a: a) mutação gênica. Questão 1184 Vários são os processos que atuam na evolução. V. As mutações podem ocorrer tanto em células somáticas como em células germinativas. pode-se prever que a seqüência de A respeito das mutações gênicas. Esses aminoácidos possuem mais de um códon de DNA. o que chamamos de fruto é um pseudofruto. b) recombinação gênica. CGC ou CGT lisina = TTT ou TTC Se ocorrer mutação e a nova seqüência de nucleotídeos for TAT TGT CGA TAA. Um produtor de maçãs verificou que. II e III.treonina. CGG. TGC ou TGT alanina = CGA. na maçã. Questão 1185 1.3 onsiderando-se que.Questão 1182 A coloração vermelha da casca da maçã é determinada geneticamente. Dentre eles. b) isoleucina .ALANINA . isoleucina = TAA. b) todos de casca vermelha. II. III e V.isoleucina. 265 . TGG.alanina .alanina .alanina . IV e V.5.treonina . ou seja.TREONINA . Assinale a alternativa que contém todas as afirmações corretas. espera-se que as árvores originadas das sementes dessa maçã produzam frutos a) todos de casca amarela. Apenas as mutações que atingem as células germinativas da espécie humana podem ser transmitidas aos descendentes. a) I. no qual a parte comestível desenvolve-se a partir do receptáculo da flor. Um alelo mutante determina casca de cor amarela. TAG ou TAT treonina = TGA. III.9. Questão 1183 Em um determinado gene.lisina . aminoácidos da proteína será a) isoleucina . e) II. c) lisina . em uma determinada macieira. apresentava casca com as duas cores. III e V. foram apresentadas as cinco afirmações seguintes. c) todos de casca bicolor. Somente as mutações ocorridas em células somáticas poderão produzir alterações transmitidas à sua descendência. mas apenas causadas por fatores mutagênicos.treonina .

IV . Questão 1189 Um surfista que se expunha muito ao sol sofreu danos em seu DNA em conseqüência de radiações UV. Questão 1188 Atualmente são bem conhecidos os efeitos adversos à saúde humana. apenas c) 3. d) herdará os tumores. c) I.Mutações são modificações bruscas do material genético que podem ser transmitidas à prole (descendência ou células filhas).Mutações gênicas podem ser causadas por poluentes ambientais e provocar alterações responsáveis pelo aparecimento de genótipos diferentes numa população. ela a) só herdará os tumores se tiver ocorrido dano em um gene dominante. pois houve dano no material genético. II . o que resultou em pequenos tumores na pele.A mutação pode ser espontânea ou induzida por agentes físicos. Após o experimento. químicos ou biológicos com potencial mutagênico. Questão 1190 Analise as proposições: 1. Modificações hereditárias que ocorrem num locus específico são chamadas de mutações gênicas. que era: TAC CTT ATA GAT Ocorreu uma mudança na terceira base. A alternativa que contém as afirmações corretas é: a) I e III. II e IV. e) III. b) só herdará os tumores se tiver ocorrido dano em dois genes recessivos. III . e) não herdará os tumores. b) II e III. d) tornaram-se albinos. Indique o RNA mensageiro codificado pela seqüência de DNA mutada. 2 e 3 e) 2. devido à sua interação com mecanismos genéticos. Assinale as afirmações corretas: I . EXCETO: a) produção de um filhote albino. e) tornaram-se estéreis. c) morte em conseqüência da dose de radiação. especialmente aqueles que possuem potencialidades mutagênicas ou carcinogênicas. 3. d) IV e III. apenas d) 1. c) só herdará os tumores se for do sexo masculino. Está(ão) correta(s): a) 1. que resulta sempre de segregação ou recombinação cromossômica. b) produção de filhotes anormais.Mutação é toda alteração do material genético. apenas b) 1 e 3. podemos esperar várias reações.Questão 1186 Uma bactéria sofre uma mutação pontual em uma região do seu DNA. apenas 266 . a) ATC GAA TAT CTA b) ATG GAA TAT CTA c) AUC UAU AAG GUA d) AUC GAA UAU CUA e) AUG G GAA UAU CUA Questão 1187 Uma experiência realizada com coelhos (linhagem pura selvagem) consistiu em submetê-los a uma descarga excessiva de raio-X. que passou de citidina a guanina. As mutações do tipo substituição de base acarretam a alteração de vários aminoácidos nas proteínas. causados por diversos poluentes ambientais. 2. Os principais agentes mutagênicos são as radiações ionizantes e os raios-ultravioleta. Caso ele venha a ser pai de uma criança. podem causar mutações e doenças nas gerações futuras. os quais.

como resposta imune. Uma mulher que se submeteu a dez sessões intercaladas de bronzeamento. quatro meses depois. Um organismo recebeu uma primeira dose de um antígeno X e. onde recebem grande quantidade de antígenos. é necessária a vacinação. a serem cumpridas até o ano 2. a utilização de câmaras de bronzeamento artificial. após algum tempo. por estar imunizado. recentemente. c) não produza mais anticorpos. espera-se que o organismo: a) reaja da mesma forma como reagiu à primeira dose. c) é herdável. produzirá antígenos específicos. c) 2. imunizado. d) 2.800 Angstrons. d) o plasma. b) reaja sem utilizar seus anticorpos. e) 2. produziu anticorpos específicos. queimaduras.V. criados em laboratório. o comprimento de onda em que será obtida maior taxa de mutação é a) 2. Questão 1192 O gráfico mostra o espectro de absorção de raios ultravioleta (U. Pode-se afirmar que esse tipo de câncer a) é herdável. porque a mutação resultante é dominante. e) produza anticorpos mais rapidamente.9. reconhecidos pelo corpo como antígenos. b) não é herdável. o que reduzirá a mortalidade infantil em pelo menos um terço. porque provoca alteração em células germinativas. e) é herdável.400 Angstrons. O corpo. indícios de câncer de pele.000.600 Angstrons. Questão 1193 Os meios de comunicação têm noticiado que a Unicef (Fundo das Nações Unidas para a Infância) estabeleceu como uma das metas. for aplicada uma segunda dose do mesmo antígeno.) por uma proteína e por um ácido nucléico. a imunização de 90% das crianças.Questão 1191 A ANVISA (Agência Nacional de Vigilância Sanitária) normalizou. para que o corpo produza antígenos e anticorpos específicos.4 Considerando a ação desses raios na célula. EXCETO: a) pâncreas b) amídalas c) baço d) timo e) gânglios linfáticos Questão 1195 1. c) vírus ou bactérias mortos ou atenuado que. Para que esta meta seja atingida.500 Angstrons. tais como lesões na retina.5. Se. d) não consiga reagir a essa segunda dose. uma vez que as radiações UV danificaram seu DNA. porque a mutação resultante é recessiva. e) o soro obtido através do sangue de animais. d) não é herdável. Questão 1194 Todas as estruturas citadas a seguir podem ser ligadas à defesa do organismo. apresentou. com duração de 15 a 30 minutos cada uma. que consiste em injetar no organismo: a) vírus ou bactérias vivas para provocar a doença de forma branda. induzam a produção de anticorpos específicos. envelhecimento precoce e câncer de pele. b) um medicamento eficaz no combate à doença já instalada e que produza no corpo uma reação para a fabricação de anticorpos específicos e resistentes. porque provoca alteração do DNA. visando diminuir os riscos dessa prática. como os cavalos. 267 . retirado de pessoas que já tiveram a doença. porque provoca alteração em células somáticas.700 Angstrons. b) 2.

c) o recém-nascido não produz anticorpos. Para a imunização de cada uma das crianças foram utilizados dois procedimentos diferentes: Criança I: aplicação de soro imune Criança II: vacinação. somente doenças causadas por bactérias c) é que a vacina não combate vírus. porque estimula o organismo a produzir anticorpos. e) após o nascimento a criança depende dos anticorpos maternos. Assinale a alternativa que esclarece o erro: a) é que vírus do tipo "A" não sofre efeito de vacina alguma b) é que a vacina não combate vírus. 268 . O gráfico que melhor representa as taxas de variação da quantidade de anticorpos nas crianças I e II é: Existe um erro de fundamento biológico na historinha da tirinha.5. c) vacina. embora já esteja produzindo os seus. porque contém antígenos específicos. você deverá procurar recurso através de a) vacina. que são específicos aos seus antígenos. pois produz poucos anticorpos. em duas crianças durante um certo período de tempo.5. b) soro.10 a) na época do nascimento a criança não está protegida. d) soro. portanto ela não pode destruir o que a produz e) é que o vírus impede a ação da vacina. ela proporciona ao nosso organismo produzir defesas. que é o sistema "chave-fechadura" Questão 1198 Ao ser picado por uma cobra peçonhenta. e) vacina. porque estimula o organismo a produzir anticorpos. b) antes do nascimento o feto nunca produz anticorpos. Questão 1199 1.10 1. inibindo a sua atividade de defesa.Questão 1196 A variação da quantidade de anticorpos específicos foi medida por meio de uma experiência controlada. pois não produz os próprios anticorpos. porque já contém anticorpos. d) após o nascimento a criança depende completamente dos anticorpos maternos.10 Questão 1197 Leia com atenção a tirinha de Frank & Ernest A análise do gráfico permite concluir que 1. os anticorpos. porque já contém anticorpos. no caso o vírus "A" d) é que a vacina é feita de vírus.5.

O animal estava caído e se debatendo. Este é o terceiro caso de raiva em morcego registrado este ano em Botucatu. O morcego encontrado é da espécie 'Myots sp' e alimenta-se de insetos. (Portal da Prefeitura Municipal de Botucatu. a injeção de uma toxina bacteriana e manifestou a resposta imunitária produzindo a antitoxina (anticorpo). A Secretaria Municipal de Saúde registrou mais um caso de morcego positivo para raiva na cidade de Botucatu. Confirmada a presença do vírus causador da raiva em um morcego apreendido em uma praça no centro da cidade. c) antecipar a vacinação anti-rábica de cães e gatos nas regiões onde os morcegos foram encontrados. 269 .2006) MAIS UM CASO DE MORCEGO POSITIVO PARA RAIVA NA CIDADE DE BOTUCATU.2006) Para se evitar a contaminação da população humana com o vírus da raiva. Se após certo tempo for aplicada uma segunda injeção da toxina no animal. b) desencadeiam. SP. espera-se que ele a) não resista a essa segunda dose. O primeiro foi notificado no início do mês de junho. (Portal "Estadão". e) desconsiderar o ocorrido e informar a população que não tenha receio.06. d) reaja sem produzir anticorpos. pela primeira vez. os alergênicos. 18. pois já está imunizado. e) são fagocitadas pelos mastócitos e estimulam a fabricação das interleucinas. o procedimento mais adequado que deverá ser tomado pelas autoridades da referida cidade será a) promover campanha para localização e eliminação das colônias de morcegos nas áreas urbana e rural.Questão 1200 Analise o gráfico que se segue. A reação alérgica ocorre quando as moléculas do alergênico a) ligam-se a moléculas do anticorpo presas à membrana dos mastócitos. De acordo com o gráfico. Questão 1201 DETECTADO FOCO DE MORCEGO COM RAIVA EM BOTUCATU. b) demore mais tempo para produzir a antitoxina. mas não os frugívoros ou insetívoros. representam risco de transmissão da raiva. O segundo caso na Vila Antártica. que são reconhecidas por um tipo especial de anticorpo. que reagem liberando histaminas. b) não consiga reagir a uma segunda dose.08. e) reaja na segunda vez. pois apenas os morcegos hematófagos. 1.10 m organismo recebeu uma dose de um antígeno X e. espera-se que o organismo a) reaja mais rapidamente na segunda dose. O morcego doente era da espécie que se alimenta de frutas. O animal foi encontrado caído em uma praça nas proximidades do centro. que se reproduzem e fabricam grande quantidade de histaminas. d) não produza mais a antitoxina por estar imunizado. e) produza menor quantidade de antitoxina.5. recebeu outra dose. uma grande proliferação de linfócitos específicos. após algum tempo. d) ligam-se aos anticorpos e migram para os órgãos imunitários primários onde são destruídas. nos gânglios linfáticos. c) produza a antitoxina mais rapidamente. no final do mês de julho. quando foi visto por estudantes. Questão 1202 Um coelho recebeu. 06. b) medicar com antibióticos específicos os animais domésticos que tenham entrado em contado com os morcegos. Questão 1203 A alergia é uma hipersensibilidade desenvolvida em relação a determinadas substâncias. na região central da cidade. d) promover campanha para a vacinação anti-rábica da população humana. c) produza anticorpos mais lentamente na segunda dose. c) são reconhecidas pelas células de memória. produzindo menos anticorpos.

tendo em vista a estabilidade do HIV. Sendo assim. mas não causar a doença. protegendo o organismo. d) neutrófilos e clasmocitose. d) células brancas produzidas por animais. d) Falta de veneno em quantidade suficiente para a obtenção do soro. Questão 1208 Observe a figura a seguir. é possível oferecer os seus soros para outros países". b) euritrócitos e pinocitose. assinale aquela que contém argumento válido e que explica a menor procura por antivenenos no Brasil. Questão 1207 "Os cientistas examinaram 11 homens aidéticos. Os termos destacados referem-se. respectivamente. que estimulam a resposta imunológica do indivíduo. Questão 1205 O Instituto Butantã. que se multiplicam no corpo do indivíduo que recebe a vacina.5.10 270 . para a produção de soro no combate à epidemia de peste bubônica. resistentes às drogas ministradas e passíveis de serem transmitidas a outras pessoas. d) é fácil de ser efetuada. c) A imunização garantida pela administração do soro. aos a) trombócitos e fagocitose. quando aparecem CÉLULAS DE DEFESA que ATRAVESSAM OS CAPILARES e caem no tecido conjuntivo. a) As reações alérgicas e a alta mortalidade provocada pela aplicação do soro. Questão 1206 Consideramos uma vacina um material que contém: a) anticorpos contra determinado patógeno. b) anticorpos contra determinado patógeno produzidos por outro animal e que fornecem proteção imunológica. Hoje é um centro de pesquisa reconhecido mundialmente na área de biomédicas produzindo diversos tipos de soros antitóxicos e antivenenos. famoso pelo seu serpentário. e) um patógeno vivo enfraquecido ou partes dele. capaz de estimular a resposta imunológica. c) precisa ser feita contra a forma normal do HIV. pode-se concluir que a fabricação da vacina anti-AIDS a) apresenta os mesmos problemas que a da vacina contra a gripe. c) leucócitos e diapedese. em fevereiro de 1901. dos quais 5 nunca tinham usado medicamentos anti-HIV e 6 haviam usado. c) soro de indivíduos previamente imunizados contra aquele patógeno. Das alternativas a seguir. b) só pode ser feita contra as formas mutantes do HIV. Verificaram que 8 pacientes apresentavam novas mutações do vírus. foi fundado por Vital Brazil. e) Falta de animais com características adequadas para a produção do soro. e) certamente deverá estar no mercado dentro de pouco tempo.Questão 1204 Uma lesão na pele pode infeccionar. Segundo o Instituto "a demanda da produção de antivenenos vem diminuindo gradativamente no Brasil. b) O êxodo rural e a maior concentração da população humana em centros urbanos. 1." Pela análise do texto.

induzindo a formação de anticorpos. (Fonte: Desenvolvimento de vacinas gênicas. IV. b) A dose de reforço provoca produção maior e mais rápida de anticorpos. O processo envolve a inoculação direta do DNA plasmidial. 1999.) Com base no texto.10 correto afirmar. pode-se fazer todas as afirmações. 1984. que possui o gene codificador da proteína antigênica. Assinale-a. O indivíduo geneticamente vacinado passa a produzir tanto os antígenos quanto os anticorpos. Questão 1209 Os anticorpos são proteínas específicas de defesa do corpo. mas é de longa duração. assinale a afirmativa INCORRETA. ou os problemas proporcionados pela produção das vacinas de subunidades em microorganismos. diphtheriae'.5. São afirmações CORRETAS: a) I e II b) II e IV c) III e IV d) I e III 1. Isso sem gerar os efeitos colaterais que podem aparecer quando são utilizados patógenos vivos. III. d) O gráfico acima exemplifica ação das vacinas. Patógenos vivos não podem ser usados como vacina. Questão 1211 Em relação à figura a seguir. O gráfico a seguir representa o resultado de duas aplicações de mesmo antígeno. b) A injeção de toxina na cobaia B é utilizada como controle. MICROBIOLOGIA E IMUNOLOGIA. que será expressa e produzida no interior das células do indivíduo. EXCETO: a) Doenças diferentes em intervalos menores de tempo provocariam a mesma intensidade de produção de antígenos. II. Otto. pois não determinam imunidade e sim doenças. EXCETO uma. A imunidade desenvolvida pela vacina de DNA não é imediata. c) A injeção de antitoxina e de toxina na cobaia A é usada como controle para testar a eficácia da primeira na inativação da segunda. Esse tipo de vacina apresenta uma grande vantagem sobre as demais. c) O tipo de imunização explicitado é ativa. Em relação aos procedimentos observados na ilustração anterior. pois fornece para o hospedeiro a informação genética necessária para que ele fabrique o antígeno preservando todas as suas características importantes na indução de uma resposta imune eficiente. e) Para o sistema imunológico da cobaia A. Questão 1210 A vacina de DNA é a mais recente forma de apresentação de antígeno que veio revolucionar o campo da vacinologia. em intervalos diferentes. Os antígenos produzidos pelo DNA plasmidial são capazes de combater patógenos que infectem o hospedeiro. 271 . que representa a atividade de células T citotóxicas. d) Um animal imunizado com toxina diftérica está protegido da infecção por 'C. a antitoxina diftérica é um corpo estranho. foram feitas as seguintes afirmações: I. a) A toxina diftérica funciona para o cavalo como uma vacina. para verificar a atividade letal da toxina na ausência do soro.tapas na preparação do soro terapêutico. Fonte: Bier. "Scientific American".

um linfócito ativado produz dois tipos de células-filhas: células efetoras. a fórmula induziu a produção de anticorpos contra a doença. pode-se afirmar que a vacina foi eficaz contra todos os parasitos do mesmo filo.1. c) As células T citotóxicas podem atacar algumas células tumorais. a) Fagócitos . uma fase de invasão e diferenciação nos hepatócitos e uma fase intra-eritrocítica. do Instituto Pasteur. b) As células T citotóxicas matam células que apresentam antígenos na superfície por meio da secreção de perforinas e linfotoxinas. trata-se do "primeiro teste clínico de uma vacina contra a malária a demonstrar claramente sua atividade contra o parasito". 09/11/2005) Assinale a afirmativa INCORRETA. b) Se o organismo apresentar imunidade positiva contra o parasita. necrosante. bastando que esta esteja ativada. que realizam o ataque e morrem.5. dizem ter realizado com sucesso a primeira fase de testes clínicos (em humanos) de uma vacina contra a malária. jardins e terrenos baldios. (Fonte: "Folha de S. De acordo com a teoria clonal. a malária continua sendo um dos principais problemas de saúde pública no mundo. a) O objetivo do uso da vacina é ativar o sistema de defesa do organismo contra invasores através da produção de anticorpos. em Paris. apresentando o mesmo antígeno. e células de memória. Questão 1215 A memória imunológica e imunidade resultam da seleção clonal. hemolítica.prendem microorganismos no trato digestivo e respiratório. d) Descamar da epiderme . d) A degradação ou lise da célula infectada não necessita do reconhecimento e da fixação da célula T citotóxica. Questão 1212 As defesas inatas dos organismos são geralmente mecanismos de proteção que inibem a entrada ou o desenvolvimento de organismos causadores de doenças.opõe-se à colonização da pele por alguns patógenos. Em uma pessoa 272 .lubrifica e limpa. moscas e outros insetos. os quais se mostraram capazes de atacar o parasito 'Plasmodium falciparum'. Questão 1214 a) Após efetuar um "ataque letal". d) O ciclo vital desse parasita envolve um curto período na corrente sangüínea. d) tomar vacina como mecanismo de prevenção ou usar soro de preferência polivalente em caso de picada acidental. contém lisozima. Paulo". b) Secreções mucosas . Aplicada em 36 voluntários saudáveis. que produzem anticorpos e têm vida longa. Esses venenos podem apresentar ação neurotóxica. c) Lágrima .10 a) colocar lixo em sacos plásticos e mantê-los bem fechados para não atrair baratas. cardiotóxica. uma célula T citotóxica pode separar e atacar outra célula-alvo. Assinale a alternativa que NÃO apresenta a relação correta entre o fator de defesa e sua função. EXCETO: VACINA RESISTE A PARASITO DA MALÁRIA Pesquisadores liderados por Pierre Druilhe. Os pesquisadores ainda precisam realizar mais duas fases de testes clínicos antes de confirmar a eficácia da fórmula. b) manter limpos quintais. células de tecidos transplantados e células infectadas por vírus. Questão 1213 Aranhas e escorpiões podem apresentar efeito peçonhento ao homem. não acumulando entulho e lixo doméstico. que destrói bactérias. O controle e prevenção de acidentes com esses animais podem ser feitos tomando-se os seguintes cuidados.previnem a entrada de patógenos e substâncias estranhas. Segundo Druilhe e seus colegas. c) Apesar de muito antiga. c) aparar a grama dos jardins e recolher folhas caídas.

DM43 e DM64. podem-se observar os seguintes eventos. Analisando o texto e de acordo com seus conhecimentos.: vírus) provoca. Bio. enquanto a outra neutraliza as substâncias que matam as células musculares de quem é picado. 30/08/2005. b) eosinófilos e eritrócitos. e) leucócitos e linfócitos. é INCORRETO afirmar: a) A imunidade dos gambás sul-americanos ao veneno das jararacas foi naturalmente selecionada. Agora. EXCETO: a) Ativação de resposta imune primária e produção de clones de células efetoras e de memória pelos linfócitos. e) produção de toxinas. embora elas mesmas não sejam anticorpos. que se alimentam de serpentes. São exemplos destas células. São Paulo: Saraiva.5. que têm função antiofídica. São glicoproteínas que apresentam estrutura parecida com a de substâncias do sistema de defesa do organismo. 273 . b) Maior e mais rápida produção de anticorpos específicos em casos de encontros subseqüentes com o mesmo antígeno. uma resposta do organismo. repetidas vezes. Questão 1217 Compartilhamos o ambiente com uma série de microorganismos que podem causar infecções nos seres humanos. após um certo espaço de tempo. c) Na primeira exposição ao antígeno. Questão 1218 Uma pessoa que tivesse seriamente comprometida a atividade dos plasmócitos teria problemas com a a) produção de anticorpos. d) eritrócitos e macrófagos. responsáveis por 90% dos 20 mil acidentes anuais com cobras no Brasil. Pesquisadores da Fundação Oswaldo Cruz identificaram no sangue dos gambás duas moléculas. c) macrófagos e linfócitos. descobriram que uma solução potencialmente melhor foi 'desenvolvida' ao longo de milhões de anos pelos gambás sul-americanos. d) Promoção imediata de resposta imune secundária. As nossas células de defesa exercem o seu papel por meio da fagocitose e da produção de anticorpos. Seja como for. S. b) Essa resistência dos gambás ao veneno de serpentes viperídeas é determinada geneticamente. c) produção de uréia. d) circulação linfática. que controlam lentamente o invasor.1999. d) Um dos componentes do veneno da jararaca poderia ser útil na prevenção de tromboses. Questão 1219 O gráfico a seguir exemplifica como a exposição de um homem normal. a um mesmo tipo de antígeno (ex. Questão 1216 "Por décadas os cientistas tiveram de quebrar a cabeça para criar antídotos contra o veneno das cobras. há uma fase de espera antes de o número de moléculas de anticorpos e células T aumentar. entre as quais se incluem as jararacas. com produção de células efetoras e de memória.Paulo". A primeira molécula se opõe à ação dos compostos do veneno que causam forte hemorragia na vítima ao impedir a formação de coágulos.10 onte: LOPES. b) circulação venosa." Fonte: Extraído da Reportagem: Sangue de gambá contém soro antiofídico do Jornal "Folha de S. a DM43 e a DM64 parecem especificamente talhadas para neutralizar os principais efeitos do veneno das serpentes da família das viperídeas. 1. c) Os linfócitos de gambá reagem a picadas das jararacas produzindo soro antiofídico que pode ser letal para as cobras.vacinada contra uma possível infecção. respectivamente: a) linfócitos e basófilos.

5. b) os linfócitos T. denomina-se a) imunoterapia ativa. diferenciam-se em plasmócitos.10 s resultados acima permitem chegar à seguinte conclusão em relação a esse soro: a) na época do nascimento há presença de IgG materna b) durante a gestação diminuem os níveis de IgG fetal c) durante a gestação os níveis de IgG independem da produção fetal d) após o nascimento diminuem os níveis de IgG produzida pelo recém-nascido . Questão 1222 A urtiga é um vegetal que provoca. c) eosinófilos. Questão 1223 As principais moléculas responsáveis pela resposta imune aos transplantes de órgãos e tecidos são os antígenos do Complexo Principal de Histocompatibilidade (MHC). uma forte reação alérgica. participando assim da imunidade celular. c) profilaxia.10 odemos atribuir esta resposta do organismo ao fenômeno de memória imunológica. c) os linfócitos B. b) eritrócitos. estimulados por substâncias produzidas pelos linfócitos T auxiliares. multiplicam-se e diferenciam-se. O gráfico abaixo demonstra os níveis de imunoglobulina G (IgG) no soro do feto e do recém-nascido. mas sem os sintomas da doença. e) mastócitos. e o sistema imune do receptor responde. após reconhecerem os antígenos apresentados pelos macrófagos. Havendo incompatibilidade entre o doador e o receptor de um órgão ou tecido condicionado pelo MHC. 1.Questão 1221 Um novo tipo de tratamento da AIDS começou a ser testado no Brasil e consiste em transmitir anticorpos anti-HIV. principais responsáveis pela 274 1. cuja intenção é fortalecer a defesa desses indivíduos. as primeiras células a serem ativadas. Tal tratamento. produzindo assim uma quantidade maior de anticorpos. na maioria das pessoas. dando início à imunidade humoral. ligam-se aos anticorpos e iniciam suas ações fagocitária e secredora. para pessoas aidéticas sintomáticas. d) as interleucinas inibem a proliferação de macrófagos e linfócitos T citotóxicos. e) vacinoterapia. que tem como conseqüência: a) o aumento da produção de anticorpos b) a inibição da produção de anticorpos c) o aumento da produção de antígenos d) a inibição da produção de antígenos Questão 1220 A produção de imunoglobulinas por células do sistema imunitário constitui um dos mecanismos de defesa do organismo contra infecções. contidos no plasma de pessoas contaminadas há muitos anos. EXCETO a) basófilos. de modo que a) os macrófagos. b) imunoterapia passiva. d) linfócitos.5. d) quimioterapia. Uma série de tipos celulares é responsável pelas reações alérgicas e por outros tipos de hipersensibilidade imune. será desencadeada uma reação.

iniciou-se um novo período na história da humanidade. aparecem na infância. a revolução tecnológica avançava como conseqüência. enfrentaram-se as duas forças hegemônicas do pós-guerra: os Estados Unidos da América. suprimindo os linfócitos B. ao provocar nos indivíduos do sexo masculino o aumento da produção de urina. A corrida espacial foi um dos aspectos dessa concorrência. campeã do socialismo. ( ) são típicas das regiões úmidas e frias e têm como vetores insetos do gênero 'Anopheles' sp. realizada por pesquisadores da NASA. ( ) comprometem os nódulos linfáticos das virilhas. alterações nos comportamentos sinalizaram um novo tempo. da concorrência entre esses dois países.. Uma dessas." ("Outro retrato". A experiência.gov/shuttle/archives/ sts-74/orbit/payloads/lifes/regimmun. nessas condições. Traduzido e adaptado de: http:// spaceflight. Entretanto. sarampos.rejeição. e a URSS. Cai o império soviético. e) soros obtidos de animais que neutralizarão os antígenos específicos. novas tecnologias para comunicação evidenciam o progresso no século XXI. sem suprimir o sistema imunológico do receptor. um novo século. Esse desejo fez com que rapidamente se transferissem para o cotidiano dos homens os resultados práticos das inovações de guerra. ocorre menor: a) fagocitose do antígeno mediada pelos linfócitos B b) produção de anticorpos pelos linfócitos T citotóxicos c) produção de imunoglobulinas pelos neutrófilos d) produção de anticorpos mediada pelos linfócitos B e) produção de imunoglobulinas pelos macrófagos Questão 1225 "Onde não há cozinhas pratos por lavar vigílias. e) a ciclosporina age no processo de rejeição.html Se ao final da experiência mencionada for demonstrado que a resposta imunológica humoral diminui durante os vôos espaciais. até mesmo. Pesquisas biológicas vêm sendo desenvolvidas com os tripulantes dos vôos espaciais. sem deixar o paciente vulnerável a infecções. fraldas sujas coqueluches.. novas comodidades. c) drogas capazes de aumentar a resistência à infecção. Ao lado da política e da economia. conclui-se que. sarampos" são alterações no bem-estar físico do indivíduo que. o conhecimento humano não tem fronteiras nem limites: DNA. b) anticorpos que persistirão ativos por toda a vida do receptor. clonagem. genoma. Questão 1226 As vacinas utilizadas nas campanhas de imunização em massa são constituídas de a) anticorpos que destruirão o agente infeccioso específico. coqueluches. A Guerra Fria foi o resultado óbvio dessas tensões e disputas. José Paulo Paes) ". ( ) podem ser prevenidas pela aplicação de vacinas na primeira fase da vida ou tratadas com medicamentos adequados. 275 . ao mesmo tempo em que socialismo e capitalismo disputavam o predomínio na produção e nos mercados. no mundo globalizado. Estas doenças ( ) são transmitidas por vírus e enquadram-se no grupo das que causam desidratação. Vencido o perigo nazista. Hoje. campeões do capitalismo.nasa. Questão 1224 Com o final da 2 Guerra Mundial. A comparação dos resultados obtidos poderá indicar o quanto a resposta imunológica estará afetada. consiste na análise de amostras de sangue e saliva antes e após a injeção de um determinado antígeno. tem o objetivo de estudar até que ponto o sistema imunológico se altera durante vôos espaciais. normalmente. Mais conforto. a ser realizada na Terra e no espaço. passou a existir o desejo do bem-estar e do conforto mostrar onde se vivia melhor era fundamental. d) microorganismos ou produtos deles derivados que induzirão a formação de anticorpos.

o organismo humano dispõe de diferentes mecanismos de defesa. por exemplo (Y). Questão 1231 O sistema imunitário.10 especificamente a determinados antígenos. ( ) os linfócitos B transformam-se em plasmócitos. Questão 1230 Há um número muito grande de organismos causadores de infecções. que atua no combate a infecções. ( ) contra patógenos extracelulares. imediatamente. o organismo reage e produz. ( ) linfócitos T podem adquirir ação citotóxica e destruir células infectadas por vírus. estes estimulam os linfócitos B a produzirem interferons. é INCORRETO afirmar que a) os anticorpos são produzidos tanto em I quanto em II. d) o mRNA do antígeno do patógeno é traduzido em II.5. um organismo infectado por uma bactéria X produzirá mais antígenos em (2) do que em (1). Com relação ao sistema imunológico humano. são produzidas células apresentadoras de antígenos.Questão 1227 Analise estas figuras: 1. ou ainda células como as cancerosas. ( ) Em (1) ilustra-se a resposta primária do organismo após um primeiro contato com um vírus X. vem-se revelando uma das mais abrangentes dirigidas à população dessa faixa etária. ( ) Devido à elevada especificidade da reação antígeno-anticorpo. enquanto em (1) mostra-se o efeito da pós infecção viral. a vacina contra pneumonia pneumocócica. como a maioria das bactérias. d) impedem mutações dos patógenos. Com relação a este tema. muito ativos no combate a patógenos externos. ( ) Após um primeiro contato com um vírus X (2). o organismo ativa seus linfócitos T citotóxicos. podemos afirmar que: 276 .5. Em relação a esse sistema. perduram no organismo e podem desencadear a resposta imune com mais rapidez. também. c) o antígeno do patógeno é produzido pelo camundongo em I. diz-se que ele adquiriu imunidade humoral. podemos afirmar que: ( ) nos nódulos linfáticos e no baço. b) o código genético do patógeno é igual ao do camundongo. b) contêm anticorpos específicos. instituída pelo Ministério da Saúde do Brasil.10 ( ) Ao primeiro contato com um vírus X (1) . Questão 1229 Para o controle das infecções. c) induzem resposta imunológica. É CORRETO afirmar que essas vacinas protegem porque a) são constituídas de moléculas recombinantes. células produtoras de anticorpos. é constituído por diferentes tipos de glóbulos brancos e pelos órgãos responsáveis pela produção e maturação desses glóbulos. anticorpos em nível neutralizador suficiente para inativar o vírus. é correto afirmar que: onsiderando-se os processos de imunização representados. os macrófagos. proteínas que se ligam 1. os postos de saúde estão aplicando. ( ) Em (2) ilustra-se a resposta imunológica do organismo a uma infecção bacteriana. Questão 1228 A Campanha Nacional de Vacinação do Idoso. contra as quais o homem dispõe de um vigilante exército para a sua defesa. ( ) as chamadas "células de memória" surgem da diferenciação de linfócitos T e B. se o organismo continuar a produzir anticorpos em quantidades elevadas. Além da vacina contra a gripe.

. causando vermelhidão e edema nos processos inflamatórios. Soma ( ) Questão 1234 Duas crianças foram levadas a um posto de saúde: uma delas.2 gramas por litro. são proteínas sintetizadas para combater agentes externos (bactérias e vírus. para atendimento. ( ) Os linfócitos T e B originam-se no timo e depois migram para a medula óssea.... c) soro.. Indique o que deve ser aplicado em cada criança..( ) Os macrófagos fagocitam elementos estranhos e imobilizam resíduos na membrana. d) vacina. ( ) Os macrófagos são responsáveis pela secreção de histamina. ( ) Linfócitos T reconhecem antígenos nas membranas de outras células. as dos brasileiros situam-se na faixa de 5.. Questão 1236 Assinale a alternativa que preenche corretamente as lacunas do texto a seguir. se diferenciam em plasmócitos que produzem anticorpos e participam da memória imunológica. . em virtude de uma picada de serpente peçonhenta... (04) São produzidos somente pela vacinação. Sabe-se que a produção de certos hemoderivados se vale de material retirado do plasma.se alimenta de nutrientes ricos em ferro c) albuminas .. é correto afirmar: (01) São capazes de neutralizar toxinas bacterianas. para se prevenir contra poliomielite. (08) Podem atravessar a barreira placentária. ( ) Os linfócitos B. estimulando os linfócitosT. porque contém anticorpos prontos.. na vida intra-uterina. componentes do nosso sistema de defesa. estimulam os linfócitos B a produzirem anticorpos e eliminam células anormais... especialmente nos macrófagos. fixando-se temporariamente no ducto toráxico. Uma possível explicação é que o brasileiro .. quando estimulados. e permanecem na corrente sangüínea prontos para nos proteger da ação de patógenos.. extraídas do plasma de europeus ficam na faixa de 3 gramas por litro.. e) vacina... (16) São dotados de memória imunológica. 28 jul. b) soro. na ordem em que ocorrem. Os anticorpos também são capazes de proteger o embrião humano. deve procurar socorro através de a) soro. a qual provoca vasodilatação. Em relação às características dos anticorpos. a) imunoglobulinas . muitas vezes por períodos bastante longos. 2004. Adaptado de: "Veja". onde podem se multiplicar ao detectarem elemento estranhos ao organismo. O relatório da Polícia Federal sobre a Operação Vampiro traz uma informação no mínimo irônica sobre o sangue dos brasileiros. a) vacina (porque contém antígenos) e soro (porque contém anticorpos) b) soro (porque contém antígenos) e vacina (porque contém anticorpos) c) vacina (porque contém anticorpos) e soro (porque contém antígenos) d) soro (porque contém anticorpos) e vacina (porque contém antígenos) Questão 1235 Quando uma pessoa é picada por um animal peçonhento. RESPECTIVAMENTE.. (02) São capazes de neutralizar os vírus. O que o relatório mostra é que. para eliminar quimicamente o veneno. a) Uma partícula b) Um organismo c) Uma molécula d) Uma célula e) Um patógeno Questão 1233 Os anticorpos. produzem interleucinas. porque fornecerá ao organismo elementos de defesa. (32) São capazes de imobilizar os microorganismos.. por exemplo) ou seus produtos. a outra.se alimenta de nutrientes ricos em ferro 277 .. que induzirá a formação de anticorpos. Questão 1232 Assinale a alternativa que melhor descreve um anticorpo.. porque é composto por antígenos específicos. enquanto as .está exposto a uma maior variedade de organismos patogênicos b) hemácias .

III .tende a apresentar o baço com tamanho aumentado. Vacinar consiste em injetar no organismo: a) microrganismos vivos para provocar a doença de forma branda.5. II . d) vacinação. onde recebem grande quantidade de antígenos. retirado de convalescentes. resultado da ativação dos mecanismos naturais de defesa do organismo. II e III são corretas. b e c) representam o que pode acontecer quando uma lesão na pele permite a entrada de bactérias que causam infecção. e) possui antígenos específicos.10 Analise as afirmativas a seguir: I .d) albuminas . Questão 1237 As ilustrações a seguir (a. . b) I. e) o soro obtido através do sangue de animais. Questão 1240 Os agentes infecciosos penetram no corpo das pessoas através dos ferimentos e das mucosas. reconhecidos pelo corpo como antígenos. Questão 1241 A revista "Veja" (28.tende a apresentar o baço com tamanho aumentado e) imunoglobulinas . na tentativa de destruir agentes invasores. b) aplicação do soro. d) Apenas I é correta. Questão 1239 Os meios de comunicação têm convocado dentistas e outros profissionais da saúde para a vacinação contra a hepatite B. a) Apenas I e II são corretas. c) Apenas II e III são corretas. b) contém anticorpos.07. criados em laboratório. de 3 gramas por litro.Alguns tipos de leucócitos (glóbulos brancos) atravessam as paredes dos capilares por diapedese e deslocam-se pelo tecido. em média. enquanto a extraída do sangue dos brasileiros é de 5.2004) noticiou que a quantidade de imunoglobulina extraída do sangue dos europeus é. induzam a produção de anticorpos específicos. b) uma substância que combata a doença já instalada e que produza no corpo uma reação para a fabricação de anticorpos resistentes. para que o corpo produza então os antígenos específicos. Questão 1238 O soro antiofídico é ministrado em pessoas picadas por cobra peçonhenta porque: a) induz a formação de anticorpos.2 gramas por litro. A incidência de doenças causadas por estes agentes infecciosos poderá ser reduzida. já prontos. Marque a alternativa correta. quando o agente infeccioso provoca uma doença de evolução muito rápida e não há tempo para a imunização ativa.O tecido lesado libera sinais químicos (histamina e prostaglandinas) que promovem a dilatação dos vasos na área lesada. ocasião em que o indivíduo recebe anticorpos. O corpo imunizado produzirá antígenos específicos. 278 1. produzidos pelo organismo de um animal. que tem efeito terapêutico. como os cavalos. e) vacinação. c) microrganismos mortos ou atenuados que. que é um processo ativo de imunização preventiva e duradoura. c) aplicação do soro. pois as pessoas desenvolvem anticorpos contra os antígenos atenuados. que é a imunidade adquirida de ação menos duradoura que o soro e de emprego terapêutico. c) é um antibiótico. submetendo-se as pessoas à a) aplicação do soro. fagocitando os microorganismos patogênicos. d) provoca imunização.A inflamação é uma resposta imune do corpo. d) o plasma.

Assinale a hipótese que pode explicar corretamente a causa de tal diferença. a) Os europeus tomam maior quantidade de vacinas ao longo de sua vida. b) Os brasileiros estão expostos a uma maior variedade de doenças. c) Os antígenos presentes no sangue do europeu são mais resistentes. d) Os anticorpos presentes no sangue do brasileiro são menos eficientes. e) Os europeus são mais resistentes às doenças que os brasileiros. Questão 1242 A partir do recente surto de sarampo na cidade do Rio de Janeiro, o governo decidiu iniciar uma campanha de imunização das crianças. A imunização contra diversos tipos de doenças é atingida através de vacinação, que consiste em injetar no organismo: a) o soro obtido através do sangue de animais criados em laboratório, como macacos, onde recebem grande quantidade de antígenos e anticorpos específicos. b) o plasma retirado de pessoas que já tiveram a doença, para que o organismo produza antígenos e anticorpos específicos. c) um agente químico eficaz no combate a doença já instalada e que produza no corpo uma reação para a fabricação de anticorpos específicos. d) vírus ou bactérias mortos ou atenuados que, reconhecidos pelo organismo como antígenos, induzem a produção de anticorpos específicos. e) vírus ou bactérias vivos, em quantidade pequena, para provocar a doença de forma branda, pois o corpo imunizado produzirá anticorpos específicos. Questão 1243 Nosso corpo está sempre sendo ameaçado de invasão por substâncias estranhas e por uma variedade enorme de microorganismos. Toda vez que isso acontece, além dos nossos mecanismos gerais de defesa, acionamos nosso sistema imune constituído por diferentes tipos de glóbulos brancos e por órgãos imunitários que, primariamente, são: a) fígado e baço. b) fígado e gânglios linfáticos.

c) tonsilas e pâncreas. d) pâncreas e medula óssea. e) medula óssea e timo. Questão 1244 A pigmentação da pele humana é condicionada por pares de genes com ausência da dominância. Suponhamos que apenas dois pares de genes estivessem envolvidos na cor de pele: o negro seria SSTT e o branco, sstt. Um homem mulato, heterozigoto nos dois pares, tem 6 filhos com uma mulher mulata de genótipo igual ao seu. Sobre os filhos do casal, pode-se afirmar que: a) todos são mulatos como os pais. b) cada um deles tem uma tonalidade de pele diferente da outro. c) um ou mais deles podem ser brancos. d) a probabilidade de serem negros é maior do que a de serem brancos. e) 50% apresentam pele branca e 50%, pele negra. Questão 1245 O gráfico a seguir representa um tipo de herança onde os caracteres variam de forma gradativa. As opções a seguir são exemplos deste tipo de herança no homem, EXCETO uma. Assinale-a.

1.5.11

a) Estatura. b) Inteligência. c) Obesidade. d) Fator RH. e) Cor da pele.

279

Questão 1246

1.5.11

dois indivíduos que produzem frutos com 15cm, espera-se uma proporção de plantas com frutos de 17,5cm igual a a) 9/16 b) 1/2 c) 3/16 d) 1/4 e) 1/8 Questão 1249 Em um caso de herança quantitativa, estão envolvidos três pares de genes, "a", "b" e "c". Cruzando-se dois indivíduos triplo heterozigotos, a proporção de homozigotos esperada é de: a) 1/2 b) 1/8 c) 1/16 d) 1/32 e) 1/64 Questão 1250 Imagine que, em um determinado animal, a retenção de água no corpo seja controlada pela interação quantitativa de dois pares de genes, existindo cinco fenótipos (da retenção baixa até a retenção máxima de água). Animais com genótipo aabb retêm baixa quantidade de água, enquanto animais com genótipo AABB apresentam retenção máxima de água. Os animais que apresentam dois genes "maiúsculos" e dois genes "minúsculos" no genótipo retêm uma quantidade intermediária de água. Na genealogia abaixo, são dados os genótipos dos animais indicados pelos números 1, 2, 3 e 6. Considerando que os genes em questão se segregam independentemente, qual a probabilidade de os indivíduos 7 e 8 apresentarem simultaneamente retenção intermediária de água? a) 1/2 b) 1/3 c) 1/4 d) 1/8 e) 1/16

A cor dos grãos de trigo é condicionada por dois pares de genes de efeito aditivo. A tabela acima mostra o número de genes dominantes e as cores determinadas por eles. Do cruzamento entre um indivíduo AaBb e um Aabb, a proporção esperada de indivíduos com grãos vermelhos é de: a) 3/8 b) 1/8 c) 3/16 d) 6/8 e) 5/8 Questão 1247 Admita que a diferença de comprimento das orelhas nos coelhos seja um caso de herança quantitativa envolvendo dois pares de genes com segregação independente. Animais sem nenhum gene dominante possuem orelhas com 4,0cm. Cada gene dominante aumenta em 1,0cm o comprimento das orelhas. O cruzamento que produzirá na descendência uma maior porcentagem de coelhos com orelhas de no mínimo 7,0cm é o a) AaBb x AaBb b) AaBb x aaBB c) AAbb x aaBB d) Aabb x AABB e) AABB x aabb Questão 1248 Para uma determinada planta, suponha que a diferença entre um fruto de 10cm de comprimento e um de 20cm de comprimento seja devida a dois genes, cada um com dois alelos, que têm efeito aditivo e que se segregam independentemente. Na descendência do cruzamento entre

280

1.5.11

de altura e cada alelo p e r determina 10cm. Assim, os indivíduos PPRR têm 80cm e os indivíduos pprr, 40cm. O gráfico a seguir representa a distribuição das classes fenotípicas observada nos descendentes dos cruzamento entre heterozigotos PpRr.

1.5.11

Questão 1251 Supondo que na aboboreira existam 3 pares de genes que influem no peso do fruto, uma planta aabbcc origina frutos com aproximadamente 1.500 gramas e uma planta AABBCC, frutos ao redor de 3.000 gramas. Se essas duas plantas forem cruzadas, o peso aproximado dos frutos produzidos pelas plantas F será de a) 3 000 gramas. b) 2 500 gramas. c) 2 250 gramas. d) 2 000 gramas. e) 1 500 gramas. Questão 1252 A tabela a seguir classifica características hereditárias da espécie humana. Assinale a alternativa que corresponde à classificação correta.

esse gráfico, os indivíduos PPRr e Pprr estão incluídos, respectivamente, em a) IV e V b) IV e II c) III e II d) III e I e) I e V Questão 1254 Um estudante de 23 anos, doador de sangue tipo universal, é moreno, tem estatura mediana e pesa 85 kg. Todas as alternativas apresentam características hereditárias desse estudante que são influenciadas pelo ambiente, EXCETO a) Altura b) Grupo sangüíneo c) Cor da pele d) Peso Questão 1255 Em um dos modelos propostos para a determinação da cor dos olhos na espécie humana (herança quantitativa), são considerados cinco diferentes fenótipos. Na descendência de pais heterozigóticos para os locos determinantes desta característica, foram observados os dados apresentados no quadro abaixo. Analise-os, juntamente com o gráfico, e identifique a correção das proposições a seguir.

1.5.11

Questão 1253 Em certa espécie vegetal, a altura dos indivíduos determinada é por dois pares de alelos de efeito aditivo e segregação independente: cada alelo P e R determina 20cm

281

1.5.11

( ) Três pares de alelos justificam os resultados apresentados. ( ) Nos indivíduos de olhos castanho-claros, os locos em questão podem estar em homozigose ou em heterozigose. ( ) Indivíduos de olhos verdes apresentam homozigose em apenas um dos locos em questão. ( ) A probabilidade do nascimento de duas crianças de olhos azuis, a partir de um casal genotipicamente igual ao do exemplo dado, é de aproximadamente 0,004. ( ) A probabilidade do casal indicado no item anterior de ter duas crianças, sendo uma de olhos castanho-claros e uma de olhos verdes é de 3/16. Questão 1256 A cor da pele humana é conseqüência do efeito cumulativo de mais de um gene, de modo que cada gene contribui igualmente para o fenótipo. O gráfico que representa a proporção fenotípica nesse tipo de herança é

são fenotipicamente homogêneas: apresentam as mesmas características quanto à altura da planta e tamanho da espiga, ao tamanho e número de grãos por espiga, e a outras características de interesse do agricultor. Porém, quando o agricultor realiza um novo plantio com sementes produzidas pelas plantas C, não obtém os resultados desejados: as novas plantas são fenotipicamente heterogêneas e não apresentam as características da planta C; têm tamanhos variados e as espigas diferem quanto a tamanho, número e qualidade dos grãos. Para as características consideradas, os genótipos das plantas A, B e C são, respectivamente, a) heterozigoto, heterozigoto e homozigoto. b) heterozigoto, homozigoto e heterozigoto. c) homozigoto, heterozigoto e heterozigoto. d) homozigoto, homozigoto e heterozigoto. e) homozigoto, homozigoto e homozigoto. Questão 1258 A altura de uma planta depende de dois pares de genes, A e B. O gráfico adiante mostra a variação da altura dos descendentes de dois indivíduos diíbridos.

1.5.11

1.5.11 Com relação ao gráfico, julgue os itens que se seguem. (1) Os efeitos quantitativos dos alelos A e B são, respectivamente, 40 e 30cm. (2) A freqüência de descendentes heterozigotos, para os dois genes, é de 50%. (3) Estão ilustrados cinco genótipos. (4) A herança apresentada é poligênica.

Questão 1257 Uma empresa agropecuária desenvolveu duas variedades de milho, A e B, que, quando entrecruzadas, produzem sementes que são vendidas aos agricultores. Essas sementes, quando plantadas, resultam nas plantas C, que

282

Questão 1259 A altura de uma certa espécie de planta é determinada por dois pares de genes A e B e seus respectivos alelos a e b. Os alelos A e B apresentam efeito aditivo e, quando presentes, cada alelo acrescenta à planta 0,15m. Verificou-se que plantas desta espécie variam de 1,00m a 1,60m de altura. Cruzando-se plantas AaBB com aabb pode-se prever que, entre os descendentes, a) 100% terão 1,30m de altura. b) 75% terão 1,30m e 25% terão 1,45m de altura. c) 25% terão 1,00m e 75% terão 1,60m de altura. d) 50% terão 1,15m e 50% terão 1,30m de altura. e) 25% terão 1,15m, 25% 1,30m, 25% 1,45m e 25% 1,60m de altura. Questão 1260 Políticas de inclusão que consideram cotas para negros ou afrodescendentes nas universidades públicas foram colocadas em prática pela primeira vez na Universidade Estadual do Rio de Janeiro (UERJ), em 2001. Propostas como essas geram polêmicas e dividem opiniões. Há vários argumentos contra e a favor. Os biólogos têm participado desse debate, contribuindo com os conhecimentos biológicos referentes à raça e à herança da cor da pele humana, entre outros. Assinale a afirmação considerada correta do ponto de vista da biologia. a) Os critérios para se definirem duas populações como raças diferentes são científica e consensualmente determinados. b) Não encontramos, na história da biologia, dúvidas sobre a existência de raças na espécie humana. c) A cor da pele humana é um exemplo de herança quantitativa ou poligênica, o que significa que vários genes atuam na sua definição. d) O fato de a cor da pele não ser influenciada por fatores ambientais reforça a hipótese da existência de raças na espécie humana. e) A determinação da cor da pele humana segue os padrões do tipo de herança qualitativa e é um exemplo de co-dominância.

Questão 1261 As diferenças hereditárias entre os indivíduos de uma população podem ser classificadas em qualitativas e quantitativas. A esse respeito, assinale a opção correta. a) Na herança de caracteres quantitativos, existe um grande contraste entre as características que um dado traço fenotípico pode apresentar. b) Na herança de caracteres qualitativos, um dado traço de fenótipo apresenta-se sob grande variedade de formas, em geral com pequenas diferenças entre si. c) Altura, peso e cor da pele são exemplos de algumas características quantitativas do homem. d) Os caracteres qualitativos, em sua maioria, sofrem grande influência do meio. e) A altura não é uma característica hereditária, já que um indivíduo cresce menos se não receber a alimentação adequada na infância. Questão 1262 Determinada característica quantitativa depende da ação de cinco pares de genes. Do cruzamento entre dois indivíduos com genótipo AaBbCcDdEe resultam a) 5 classes fenotípicas. b) 9 classes fenotípicas. c) 10 classes fenotípicas. d) 11 classes fenotípicas. e) 15 classes fenotípicas. Questão 1263 A cor dos pêlos nas cobaias é condicionada por uma série de alelos múltiplos com a seguinte escala de dominância: C (preta) > C (marrom) > C‚ (creme) > c (albino). Uma fêmea marrom teve 3 ninhadas, cada uma com um macho diferente. A tabela a seguir mostra a constituição de cada ninhada.

283

1.5.12

1.5.12

A partir desses dados é possível afirmar que o macho responsável pela ninhada: a) 1 era marrom homozigoto. b) 1 era preto homozigoto. c) 2 era albino heterozigoto. d) 2 era creme heterozigoto. e) 3 era marrom homozigoto. Questão 1264 O controle genético de determinado caráter é feito por uma série de quatro alelos de um só locus. O alelo A é dominante sobre os alelos A‚, Aƒ e A„; o alelo A‚ é dominante sobre os alelos Aƒ e A„ e o alelo Aƒ é dominante sobre A„. Do cruzamento AA‚ x AƒA„ devem ser obtidas: a) quatro classes genotípicas e quatro classes fenotípicas. b) quatro classes genotípicas e duas classes fenotípicas. c) quatro classes genotípicas e três classes fenotípicas. d) três classes genotípicas e três classes fenotípicas. e) três classes genotípicas e duas classes fenotípicas. Questão 1265 Em uma população de organismos diplóides, foram encontrados quatro alelos diferentes para um determinado locus gênico, denominados S¢, S£, S¤ e S¥. A figura a seguir mostra, à esquerda, as diferenças na seqüência de DNA que caracterizam cada um desses alelos e, à direita, o par de cromossomos homólogos (metafásicos) onde esse gene é encontrado. Diante dessas informações, se um único indivíduo desta população for escolhido ao acaso, qual combinação alelo/posição cromossômica poderia ser encontrada no par de cromossomos metafásicos deste indivíduo?

Questão 1266 Se um caráter tem três alelos possíveis, podendo haver seis genótipos, e um segundo caráter apresenta oito genótipos possíveis, quando ambos forem estudados simultaneamente, podem ocorrer a) 7 genótipos. b) 12 genótipos. c) 24 genótipos. d) 48 genótipos. e) 96 genótipos. Questão 1267 Coelhos podem ter quatro tipos de pelagem: chinchila, himalaia, aguti e albina, resultantes das combinações de quatro diferentes alelos de um mesmo loco. Num experimento, animais com diferentes fenótipos foram cruzados várias vezes. Os resultados, expressos em número de descendentes, constam na tabela a seguir.

1.5.12

284

d) 8. Questão 1268 Suponha que em uma certa espécie diplóide exista um caráter relacionado com uma série de quatro alelos (alelos múltiplos). b) 4. c) 6. d) 2 aguti: 1 chinchila: 1 himalaia. Tal gene deve determinar: (01) três fenótipos. em cujos núcleos estão os cromossomos. sabendo-se que a freqüência de permutação é de 10% a) 30 b) 15 c) 270 285 . A porcentagem esperada de gametas Ab que o indivíduo formará é a) 10% b) 20% c) 30% d) 40% e) 80% Questão 1272 O cruzamento CD/cd x cd/cd produziu 300 descendentes. Considere que os alelos "alf" e "beta" são co-dominantes e gama é recessivo em relação a ambos. b) 1 aguti: 1 himalaia. e) não é possível calcular essas proporções. porque os gametas recebem cromossomos ao acaso. Na meiose de um indivíduo duplo-heterozigoto AB/ab ocorre permutação entre esses locos em 80% das células. cada um correspondente a um genótipo. e se cada uma originar 4 (quatro) gametas. cada um correspondente a dois genótipos.5. (16) quatro fenótipos. d) as proporções entre os tipos de gametas seriam iguais às que ocorrem quando os genes estão em cromossomos diferentes. Questão 1269 Considere um gene que apresenta 3 alelos. Em um determinado indivíduo da espécie referida. b) a proporção de gametas com as formas não "crossing" seria maior do que a de gametas com as formas "crossing". Questão 1270 No órgão reprodutor de um animal há 1000 (mil) células. (04) quatro fenótipos. correspondentes a cinco genótipos. c) 9 aguti: 3 himalaia: 3 chinchila: 1 albino. Questão 1271 Em determinada espécie. "beta" e "gama". como mostra o desenho a seguir: Se em todas as células ocorrer "crossing-over" entre os genes A e B. que proporção de descendentes poderemos prever? 1. os locos dos genes A e B situam-se no mesmo cromossomo. correspondentes a seis genótipos. e) 3 aguti: 1 chinchila.e o animal progenitor aguti do cruzamento 1 for utilizado para a obtenção de filhotes com o progenitor chinchila do cruzamento 4. correspondentes a quatro genótipos. (02) três fenótipos. porque só as cromátides irmãs são envolvidas. c) a ocorrência do "crossing" não altera a seqüência dos genes nos cromossomos. podemos afirmar que: a) todos os gametas formados conterão as combinações resultantes do "crossing". Quantos deverão ser diferentes dos pais. (08) seis fenótipos. o número máximo de alelos representados relacionados ao caráter em questão será igual a a) 2. aqui denominados "alfa". e) 10.13 a) 1 aguti: 1 chinchila.

40% e 10% b) 30%. ocorre "crossing-over" entre esses genes em 40% das células. a) 10%.5 morganídeos. b) do comprimento da zona centromérica.5. 40%.5% bR . Questão 1275 Em um caso de "linkage".5 morganídeo. 20% e 30% c) 30%. 10%.13 esse cruzamento. sabendo-se que a freqüência de permutação é de 20% a) 30 b) 90 c) 430 d) 360 e) 45 Questão 1274 Analisando-se dois pares de genes em ligamento fatorial ("linkage") representados pelo híbrido BR/br. dois genes A e B. a) da distância entre eles. 40%. a freqüência esperada de machos afetados pelos dois caracteres é de: a) 0 % b) 5 % c) 10 % d) 20 % e) 40 % Questão 1277 Pelo que se conhece da disposição dos genes dos cromossomos. 10% e 40% e) 40%. Ab. Questão 1278 Na meiose de um indivíduo AB/ab. 20% e 20% d) 40%.5% Pela análise dos resultados. 30%. c) da existência do fenômeno da pleiotropia. Quantos deverão ser diferentes dos pais.R. e) 50 morganídeos.d) 290 e) 45 Questão 1273 O cruzamento AB/ab x ab/ab produziu 450 descendentes.48. autossômicos. Considere o seguinte cruzamento: 1.5% br . é de se esperar lhe a freqüência de permutação entre dois genes esteja na dependência. distam entre só 20 U. distam entre si 20 UR. c) 1. pode-se concluir que a distância entre os genes B e R é de: a) 48.5% Br . b) 97 morganídeos. A freqüência de gametas AB. d) do tipo de polimeria existente. e) da ausência de nucleotídeos covalentes.1.1. uma certa espécie apresentou a seguinte proporção de gametas: BR . d) 3 morganídeos. Considere o seguinte cruzamento: Fêmea (Ab/aB) X Macho (ab/ab) Qual é a freqüência esperada de machos com o genótipo AB/ab? a) 100% b) 50% c) 25% d) 10% e) 5% Questão 1276 Na espécie humana os genes que determinam a distrofia muscular Duchnne e a hemofilia. aB e ab produzidos por esse indivíduo deve ser. (unidades de recombinação).48. heranças recessivas ligadas ao sexo. 10% e 10% 286 . respectivamente. 20%.

Questão 1281 Numa certa espécie de milho. ea = 30. o grão colorido é condicionado por um gene dominante B e o grão liso por um gene dominante R. d) EA = 30.5. 37. 62. Questão 1283 O esquema a seguir refere-se a uma célula diplóide que. Questão 1282 Com relação ao processo conhecido como crossing-over. c) corrige a recombinação gênica.R. podemos afirmar que o mesmo a) diminui a variabilidade genética. grãos brancos e rugosos. Ea = 10. b) BR/br. e) EA = 40. ao serem cruzados com animais duplo-recessivos. Os alelos recessivos b e r condicionam. Ea = 40. albina. ea = 40. eA = 30. surgiu uma F. Os indivíduos F. com os seguintes descendentes: 150 indivíduos que produziam sementes coloridas e lisas. durante a meiose. A partir desses resultados. No cruzamento entre um indivíduo colorido liso com um branco rugoso. o alelo dominante E condiciona pêlos normais e o alelo recessivo e. c) EA = 25. b) separa cromátides homólogas. obtidos a partir de cruzamentos EEAA×eeaa.5 U. 1. e) BR/br. d) Br/bR. originaram os seguintes descendentes: 160 com pêlos normais e albinos 160 com pêlos encrespados e selvagens 40 com pêlos normais e selvagens 40 com pêlos encrespados e albinos Assinale a alternativa que contém as porcentagens corretas de cada tipo de gameta produzido pelos indivíduos F.R. Ea = 30. 150 indivíduos que produziam sementes brancas e rugosas.13 287 .R.R. 18.75 U. Ea = 25. 62. sofrerá permutação entre os genes A e B. podemos concluir que o genótipo do indivíduo parental colorido liso e a distância entre os genes B e R são a) BR/br. ea = 25. d) aumenta a variabilidade genética. ea = 10. 37.R. pêlos encrespados. a) EA = 10. 250 indivíduos que produziam sementes coloridas e rugosas e 250 indivíduos que produziam sementes brancas e lisas.5 U. respectivamente.Questão 1279 Se a distância entre dois locos gênicos é de 20 unidades. e) troca cromossomos entre genes homólogos. ea = 20. b) EA = 20. c) Br/bR.5 U. eA = 40. eA = 20. Ea = 20. eA = 25.5 U. eA = 10. a partir de um determinado cruzamento espera-se obter os seguintes descendentes: + + 10 + d 40 c + 40 c d 10 Esse cruzamento poderia ser a) ++/++ x cd/cd b) ++/cd x cd/cd c) +d/+d x c+/c+ d) +d/c+ x cd/cd e) +d/cd x c+/cd Questão 1280 Em camundongos. O alelo dominante A determina pelagem selvagem e o alelo recessivo a.

5. b) estão ligados e não há permuta entre eles. a) AbCe. b) 30 morganídeos. ABCe d) AbCe. c) 10 ou 30 morganídeos. c) segregam-se independentemente e há permuta entre eles. entre Y e Z há 30% e entre os genes Z e X ocorre 45%. Qual a posição relativa desses três genes no cromossomo? a) ZXY b) XYZ c) YZX d) XZY e) YXZ Questão 1288 Sabendo-se que as freqüências de permutação entre os genes A e C é de 20% e entre os genes B e C é de 10%. (08) É o pareamento de cromossomos homólogos de modo a se tornarem bivalentes. (16) É o processo de duplicação dos cromossomos para garantir a manutenção da espécie. então a distância entre os genes A e B será a) 10 morganídeos. ABCe b) AbC. aBCe. AbCe. (64) É o processo responsável pela variabilidade genética entre organismos de uma mesma espécie. ou crossing over. então a distância entre os genes A e B será a) 45 morganídeos. aBCe e) AabCe. abCe. d) 20 morganídeos. 288 . e) 20 ou 10 morganídeos. 160 Ddee. Questão 1285 Um cruzamento entre dois indivíduos. 168 ddEe e 40 ddee. Questão 1286 Suponha que 100 células germinativas entram em meiose e que essas células tenham o seguinte genótipo: 1. sabe-se que há 15% de recombinação entre os genes X e Y.13 uantos gametas recombinantes serão formados se 20 das 100 células apresentarem permutação na meiose? a) 10 b) 20 c) 40 d) 80 e) 160 Questão 1287 Considerando os genes X. Sobre os genes D e E podemos concluir que: a) estão ligados e há permuta entre eles. e. e) não estão ligados. (02) É a troca de micronúcleos entre indivíduos unicelulares para renovar o seu material genético. Y e Z de um cromossomo. AaBCe. e c) AbCe. aBC. originou 42 descendentes com genótipo DdEe. (32) É um processo que ocorre necessariamente durante a mitose. aBCe Questão 1284 Com relação ao processo denominado permutação. d) segregam-se independentemente e não há permuta entre eles. (04) É o processo que origina novos arranjos gênicos resultantes de trocas de fragmentos de cromátides homólogas. logo segregam-se independentemente.Assinale a alternativa que apresenta todos os tipos de gametas normais que podem ser formados por essa célula. é correto afirmar: (01) É a troca de gametas que ocorre durante o cruzamento de dois indivíduos da mesma espécie. Questão 1289 Sabendo-se que as freqüências de permutação entre os genes A e C é de 40% e entre os genes B e C é de 15%. com os genótipos DdEe x ddee.

desenvolvidas em países asiáticos. c) 40 morganídeos. localizados no mesmo cromossomo. 6.5. utiliza-se o teste dos três pontos. estão merecendo uma atenção especial no mundo todo. analise as proposições seguintes. embora em diferentes freqüências. Tomando por base os dados fornecidos no quadro a seguir. ( ) Os fenótipos 3 e 4 resultaram de recombinação genética entre os locos A e B. Resistem a certas doenças e pragas (insetos. a distância entre os locos A e B é maior que a distância entre os locos B e C.14 Questão 1290 Supondo-se que a distância entre locos gênicos seja de 16 morganídios. Das afirmativas. Para isso. nematóides etc) diminuindo a necessidade do uso de pesticidas. C e D. A. ( ) Os fenótipos 7 e 8 resultaram de recombinação genética apenas entre os locos C e B. o que indica um avanço biotecnológico nesta área. são avaliadas as freqüências das classes fenotípicas na descendência de cruzamento entre indivíduos heterozigóticos (ABC//abc). ácaros. e indivíduos homozigóticos recessivos (abc//abc). II. III. ( ) A recombinação entre os locos B e C. Os produtos transgênicos apresentam algumas vantagens. 289 . considere as corretas: I. apresentam as seguintes freqüências de recombinação: A-B = 32% A-C = 45% A-D = 12% B-C = 13% B-D = 20% C-D = 33% A seqüência mais provável desses genes no cromossomo é a) ABCD b) ABDC c) ACDB d) ADBC e) ADCB Questão 1292 Na elaboração de mapas genéticos. ocorreu nos genótipos 5. Questão 1293 Os transgênicos. por exemplo). Aumentam a produtividade (caso da soja. 1. B. para três locos ligados. organismos geneticamente modificados (OGM). 7 e 8. O arroz transgênico apresenta variedades que contêm altos teores de beta-caroteno (precursor da Vitamina A) e que acumulam maior teor de ferro. a taxa de recombinação entre eles é de a) 8% b) 16% c) 32% d) 42% e) 84% Questão 1291 Quatro genes.b) 25 morganídeos. Está correta ou estão corretas: a) apenas I e II b) apenas II e III c) apenas I e III d) todas e) apenas uma das três vantagens. ( ) No mapa genético. para os mesmos locos (cruzamento teste). e) 40 ou 15 morganídeos. ( ) A seqüência dos alelos no cromossomo em questão é A -------B-------C. d) 25 ou 15 morganídeos.

Dele se formou um embrião que deu origem à Dolly. A receita propõe os seguintes passos: c) o DNA nuclear e o mitocondrial são iguais aos da ovelha Os cientistas retiraram óvulos de uma ovelha adulta da raça C. Deles removeram os núcleos e d) o DNA nuclear é igual ao da ovelha A. d) A clonagem está correta. também necessário. Para criar a mangueira transgênica. filha da ovelha da raça "Scottish Blackface". onde origina um novo Clone é um população de seres geneticamente idênticos. que consistem em: ele começou a se dividir. que cedeu o óvulo anucleado. ao contrário do esperado. Delas são retirados os mitocondrial é igual ao da ovelha C. pois a genitora é a ovelha da raça "Scottish Blackface". formando um aglomerado de a) injetar. mitocondrial é igual ao da ovelha B. B. pois o pai é a ovelha da raça "Finn Dorset". para a transferência do núcleo para o óvulo anucleado. núcleos. "Scottish Blackface". pois núcleo de b) inserção do gene num vetor ë transfecção do gene ë célula de glândula mamária não pode influir nas amplificação do gene. O embrião resultante é implantado no útero de uma terceira ovelha C. Recentemente os jornais publicaram uma receita de a) o DNA nuclear e o mitocondrial são iguais aos da ovelha A. clonagem para "fazer" a ovelha "Dolly" da raça "Finn b) o DNA nuclear e o mitocondrial são iguais aos da ovelha Dorset". A comunidade científica demonstrou ser possível a Os cientistas transferiram o núcleo da célula mamária para reprodução de seres vivos através de sofisticadas técnicas o óvulo da ovelha "Scottish Blackface" Passado um tempo. características da "Dolly". uma vez que "Dolly" veio de seu a) transfecção do gene ë amplificação do gene ë óvulo. células. Acerca do material genético desse novo originados pela multiplicação assexuada de um único indivíduo. Investigando o problema. deve-se seguir um conjunto de etapas que começa pela construção de uma seqüência iniciadora ('primer'). mas o DNA guardaram o resto. O pesquisador sugeriu desenvolver uma linhagem transgênica dessa mangueira. e) o DNA nuclear é igual ao da ovelha A. de clonagem.Questão 1294 As mangueiras. pode-se afirmar que genitor ou por manipulação citogenética. podemos afirmar que: a) A clonagem está correta mas não revela a tecnologia necessária para as células "hibernarem" e acertarem o tempo. mas o DNA Foram retiradas as células das glândulas mamárias de uma ovelha adulta da raça "Finn Dorset". continuaram com baixa produção após a poda. d) amplificação do gene ë inserção do gene num vetor Uma maneira de se obter um clone de ovelha é transferir o ë transfecção do gene. A seqüência correta das etapas seguintes à construção do 'primer' é. c) amplificação do gene ë transfecção do gene ë Questão 1296 inserção do gene num vetor. o pesquisador descobriu que o ambiente favorecia o desenvolvimento de um nematóide parasita de mangueira. Os ingredientes foram Questão 1297 colocados numa solução química para "hibernar" e esperar um tempo para serem encaixados nos óvulos anucleados. resumidamente. b) "Dolly" não tem pai mas é. e) Há uma falha técnica no experimento. reprodutor da ovelha "Scottish Blackface". O aglomerado celular foi transferido para o aparelho 290 . inserção do gene num vetor. núcleo de uma célula somática de uma ovelha adulta A para um óvulo de uma outra ovelha B do qual foi previamente Questão 1295 eliminado o núcleo. cujo controle era muito difícil. Tomando por base o texto. que são guardados. c) A clonagem está errada. um espermatozóide de um macho da mesma espécie. dentro do óvulo de uma fêmea de uma espécie. indivíduo. pela inserção de um gene que codifica uma toxina capaz de matar o nematóide. uma vez que no seu genótipo há cromossomos de seu avô. certamente.

o núcleo de um outro óvulo da mesma fêmea. e) existem cromossomos no clone que são diferentes de A e de B. do qual o núcleo fora previamente removido. A partir dos dados envolvidos no experimento realizado pelos pesquisadores. meiose Na formação de clones de organismos pluricelulares ocorrem. nesta célula anucleada. alguns genes de outra espécie. neste óvulo anucleado. Questão 1300 Em fevereiro deste ano. alguns genes de outra espécie. o núcleo de uma célula somática de um indivíduo da mesma espécie. o mundo foi abalado pela notícia da produção do clone de uma ovelha. e os cromossomos sexuais são iguais aos da ovelha A. d) retirar e descartar o núcleo de uma célula somática de uma espécie e injetar. d) constituição cromossômica da ovelha A e DNA mitocondrial da ovelha C. o núcleo de uma célula somática de um indivíduo da mesma espécie. originando Dolly. nas células germinativas de uma espécie. b) os autossomos do clone são iguais aos da ovelha A.b) retirar e descartar o núcleo do óvulo de uma fêmea de uma espécie e injetar. nesta célula anucleada. d) os autossomos do clone são iguais aos da ovelha B. Esses pesquisadores retiraram o núcleo da célula de uma ovelha (A) e o implantaram num óvulo colhido de uma outra ovelha (B). reprodução assexuada II. c) todos os cromossomos do clone são iguais aos da ovelha B. d) retirar e descartar o núcleo do óvulo da fêmea de uma espécie e injetar neste óvulo anucleado. pode-se prever que Dolly apresente a) constituição cromossômica da ovelha A e DNA mitocondrial da ovelha B. um grupo de pesquisadores divulgou ao mundo a ovelha Dolly. c) constituição cromossômica e DNA mitocondrial da ovelha B. b) introduzir. obtido por meio da técnica de clonagem. É CORRETO concluir que: a) todos os cromossomos do clone são iguais aos da ovelha A. reprodução sexuada III. que consistem em: a) injetar. Questão 1301 Considere os processos adiante: I. utilizou-se o núcleo de uma célula da mama de uma ovelha (A) e o citoplasma de um óvulo de outra ovelha (B). e os cromossomos sexuais são iguais aos da ovelha A. dentro do óvulo da fêmea de uma espécie. b) constituição cromossômica e DNA mitocondrial da ovelha A. dentro do óvulo de uma fêmea. Nessa clonagem. um espermatozóide de um macho da mesma espécie. c) retirar e descartar o núcleo de uma célula somática de uma espécie e injetar. e os cromossomos sexuais são iguais aos da ovelha B. necessariamente. e) constituição cromossômica e DNA mitocondrial correspondente a uma mistura das três ovelhas. Questão 1299 Os pesquisadores da área de Genética demonstraram ser possível a reprodução de seres vivos por meio de aprimoradas técnicas de clonagem. e) injetar. a nova célula-ovo assim 291 . o núcleo de um outro óvulo da mesma espécie. produção de indivíduos geneticamente idênticos IV. Esse óvulo fora posteriormente implantado no útero de uma terceira ovelha (C). o núcleo de uma célula ovo da mesma espécie. e) introduzir. APENAS a) I e II b) I e III c) I e IV d) II e III e) III e IV Questão 1302 Se retirarmos o núcleo de uma célula-ovo de rã e o substituirmos por outro núcleo diplóide de uma célula de tecido muscular de rã adulta. o núcleo de uma célula-ovo da mesma espécie. dentro do óvulo de uma fêmea. nas células reprodutoras de uma espécie. Questão 1298 Recentemente. c) injetar.

em relação à seqüência funcional do DNA da célula diplóide doadora. V. a) Foi integralmente inativada. um marco no estudo da biologia. o "Projeto Genoma Humano". criar animais com órgãos humanos e produzir bichos que funcionem como farmácias ambulantes. Querem usar a clonagem para salvar pandas em extinção. IV. b) Foi parcialmente inativada. Identificação da localização cromossômica dos genes. cientistas de todo o planeta prometem empreender uma verdadeira reforma genética na natureza. II. V. podemos relacionar alguns fatos que marcaram época pela sua importância científica. II. O uso da técnica tem criado receio entre a população. b) os embriões resultantes da clonagem em vegetais são mais resistentes às modificações ambientais. e) os vegetais produzem maior número de embriões por indivíduo. c) Foi integralmente mantida ativa. Estabelecimento das leis da hereditariedade. neste caso. devido ao seu menor grau de complexidade. c) V. III. I. a capacidade de propagação vegetativa. foi considerado concluído. Questão 1303 Se retirarmos o núcleo de uma célula-ovo de rã e o substituirmos por outro núcleo diplóide de uma célula de tecido epitelial normal de rã já adulta. ("Veja". III. III. d) a regulação hormonal da reprodução nos vegetais é mais facilmente controlada pelos cientistas. e) Expressou-se como na célula muscular. Clonagem do primeiro mamífero a partir de uma célula de um animal adulto. Numa breve história da genética. III. de locais das novas plantações. VI. corretamente. II. porque a) os mecanismos de regulação gênica nos vegetais são mais simples." 17/8/99. VI. VI. ("O Estado de São Paulo. e) IV. d) Expressou-se como na célula germinativa. a) II. IV. V. IV. uma vez que o governo britânico divulgou ontem o anúncio. em relação à seqüência funcional do DNA da célula diplóide doadora. Alguns manifestantes. IV. b) II. que recebeu ampla divulgação na imprensa internacional. como segue. Assinale a alternativa que correlaciona os fatos mencionados anteriormente em ordem cronológica crescente. que teme pelos danos ao meio ambiente e à saúde. Observação da estrutura espiralada do DNA. Questão 1305 Os conhecimentos científicos envolvendo a "clonagem" têm proporcionado à humanidade grandes avanços e sua utilização em vegetais tem sido mais fácil e menos controversa que em animais. III. pela Internet. o que facilita a continuidade do processo. Assinale a alternativa que explica. Transformação genética de bactérias para a produção de insulina humana. II. a que apresenta a melhor explicação sobre o que ocorre neste caso. Questão 1306 Desde que a criação da ovelha "Dolly " foi anunciada há dois anos. V. I. estão destruindo as plantações de transgênicos do país. I. é: a) foi integralmente inativada b) foi integralmente mantida ativa c) expressou-se como na célula epitelial d) expressou-se como na célula germinativa Questão 1304 No fim de junho de 2000. Surgimento da técnica de identificação das pessoas pelo exame do DNA. I. I. VI. c) os vegetais apresentam. a nova célula-ovo assim formada será capaz de produzir outra rã normal. o que diminui a perda em caso de rejeição. III. IV. VI. VI.) Tendo em vista as vantagens e limitações das técnicas comentadas nos textos acima.formada será capaz de produzir uma outra rã. considere as seguintes afirmativas: 292 . em sua maioria. Dentre as alternativas a seguir. o que ocorre. como forma de protesto. 4/8/99) Agricultores britânicos que produzem alimentos transgênicos prevêem novos conflitos com ambientalistas. I. depois de dez anos de trabalho. d) V.

d) embrionárias são capazes de se diferenciar em outros tipos de células. II . ainda não totalmente avaliado.A clonagem poderá auxiliar no esclarecimento dos mecanismos de envelhecimento e morte celular.A introdução de um material genético exógeno (transgene) em organismo vivos pode determinar um risco ecológico. nŽ 195. RNA). IV .Os estudos de clonagem podem ser proveitosos para o estabelecimento de relações filogenéticas entre os organismos fósseis e os atuais. e o adulto (5) terá praticamente as mesmas características fenotípicas do indivíduo que doou o núcleo. Questão 1307 Analise este esquema relativo à obtenção de células-tronco: Questão 1308 Considerando o processo de clonagem do DNA. que foi denominada de retículo nucleoplasmático. (1). ( ) Um DNA recombinante pode ser obtido a partir da união de um segmento de DNA bacteriano com um segmento de DNA de um outro organismo. e) I.5. o núcleo foi considerado uma organela que apresentava as seguintes estruturas: um envoltório. Questão 1309 O esquema a seguir mostra uma clonagem reprodutiva humana. II. é removido o núcleo de um ovócito. Em 1997. é INCORRETO afirmar que células-tronco a) retiradas de embriões congelados eliminam as questões éticas e religiosas associadas à obtenção de órgãos para transplantes.I . independentemente do seu tecido de origem. b) de um paciente podem ser usadas para regenerar seus tecidos ou órgãos lesados. uma vez que o fenótipo é resultado do genótipo (DNA) mais as influências do ambiente. 2003 [adapt. cientistas britânicos descobriram uma nova estrutura nuclear.Os cientistas ainda precisam compreender melhor os mecanismos de controle de diferenciação celular. III . sendo descrita como uma estrutura membranosa que está envolvida no processo de regulação de cálcio.] 1. Por muito tempo. II e IV. São corretas a) apenas I. porém. ( ) Para cortar o DNA dos cromossomos. b) apenas I. o nucléolo e enzimas. ( ) Os plasmídios não contêm genes essenciais à vida das bactérias.1 om base nas informações desse esquema e em outros conhecimentos sobre o assunto. é transferida para um útero para que se desenvolva e forme um embrião. (2) e finalmente é introduzido o núcleo da célula do atleta no ovócito enucleado. (3). o núcleo de uma célula somática de um tenista é retirado. Nos cortes são utilizadas as enzimas transcriptases reversas. "Ciência Hoje".15. Nesse processo. Essa nova célula. desde que cultivadas sob condições adequadas. c) apenas II. ( ) Com uma única transcriptase é possível cortar o DNA de uma célula em pontos da molécula onde existem diferentes seqüências de nucleotídeos. ( ) A partir de um segmento de DNA. III e IV. analise as proposições abaixo. II e III. eliminando o risco de rejeição imunológica. c) de adulto são capazes de se diferenciar em outro tipo de célula. d) apenas III e IV. o material genético (DNA. 293 . esses cromossomos devem estar em metáfase. eles podem ser utilizados como vetores genéticos. é possível obter-se um grande número de cópias do mesmo. para um maior aproveitamento dessas técnicas. de um organismo introduzido em uma bactéria. O embrião se desenvolverá. (4). III e IV.

seriam passadas para as plantas-filhas. V. este . c) I. as células-tronco podem ser comparadas às células dos embriões. Tomando-se como referência a definição genética de clone e considerando as situações descritas. Concepção de um organismo a partir da fusão de um óvulo não fecundado. Com base nessa informação. apenas. c) nêurula. Essas técnica permite. julgue os itens adiante. e) o envoltório nuclear é formado por duas membranas. II.15.5. originando zigotos igualmente distintos. faz-se uma cultura de tecidos e. não se justifica preservar as variedades silvestres. Questão 1310 Os morangos de excelente qualidade que se encontram atualmente nos supermercados são produto principalmente de técnicas de propagação vegetativa "in vitro". c) a função do retículo nucleoplasmático é semelhante à do retículo endoplasmático. b) I e II. que são células indiferenciadas que podem dar origem a qualquer tipo de tecido. sendo que cada uma delas é composta por duas camadas de lipídios com proteínas inseridas. podem-se obter indivíduos adultos com características alteradas. II. (4) Uma vez obtida uma variedade de morangueiro com as características ideais. estão presentes várias enzimas.1 genético de plantas. Uma muda de violeta formada a partir de uma única folha que tenha sido destacada de outra planta e plantada em solo úmido e bem adubado. III. III e IV. a eliminação de infecções virais presentes na planta-mãe e que. d) formação do celoma. pelo procedimento tradicional. será a célula doadora do núcleo. apenas. e) formação da notocorda. (1) As plantas obtidas de uma mesma cultura de tecidos são geneticamente iguais. principalmente para a obtenção de células-tronco. com o núcleo de uma célula somática retirada de um animal que se deseja copiar. IV e V. Questão 1312 Considere as cinco situações seguintes. a partir delas. (2) Uma vantagem dessa técnica é que as plantas produzidas não são suscetíveis ao ataque de pragas. que é uma organela citoplasmática. (3) A cultura de tecidos vegetais facilita o melhoramento . b) gástrula.forma os ribossomos. entre elas as envolvidas nos processos de transcrição e replicação. IV. Óvulos distintos são fecundados por espermatozóides também distintos. Questão 1311 Um dos caminhos escolhidos pelos cientistas que trabalham com clonagens é desenvolver em humanos a clonagem terapêutica.1. d) I. por exemplo. 294 Com base no texto e em seus conhecimentos. é INCORRETO afirmar que a) o núcleo é uma organela exclusiva das células eucarióticas. muito menos produtivas.juntamente com proteínas . d) todo o DNA da nova célula formada na clonagem citada no texto. podemos dizer que são processos de clonagem: a) I. do qual se retirou o núcleo celular. sem que tenha sido fecundado. Quanto a este aspecto. apenas. pois as células podem ser manipuladas geneticamente e. A partir de células de um morangueiro. obtêm-se plantas adultas. estruturas importantes no processo de tradução. O gameta feminino (óvulo) de certos animais se desenvolve formando um novo indivíduo. b) o nucléolo é responsável pela síntese do RNA ribossômico. (4). enquanto estas se encontram na fase de a) mórula. Formação de vários embriões a partir de um único zigoto. a partir desta. apenas. No seu interior. I.

quando as células já estão mais diferenciadas. Questão 1316 A Embrapa possui uma linhagem de soja transgênica resistente ao herbicida IMAZAPIR. ou seja. a existência de clones apenas aumenta o número de representantes de um determinado nível trófico. b) I e III. e) não existem técnicas para a inserção de fragmentos de DNA de uma espécie em outra. já que ela não tem possibilidade de cruzamento com outras plantas e o perigo de polinização 295 . Aponte a alternativa que relaciona o procedimento e a justificativa corretos para que tal pesquisador tenha sucesso. a) Obter células-tronco de embriões em fase de gástrula em vez de obtê-las da blástula. Estão corretas: a) I e II. A clonagem de organismos tem se voltado mais para os animais porque. a crítica recai sobre o fato de que não se sabe se os genes introduzidos irão se expressar exatamente como no organismo doador ou se irão ativar também alguns genes inativos do genoma do organismo receptor. II. b) Trabalhar apenas com embriões em vez de organismos adultos. as cinco melhores são separadas e apenas uma delas é levada a testes de segurança. Apesar da eficiência proposta no filme. não foi possível. em vez de obtê-las da gástrula ou do cordão umbilical. cientistas retiraram do intestino de insetos hematófagos fósseis moléculas de DNA de dinossauros. c) Conseguir células germinativas do ovário de uma fêmea adulta pois. d) II e III. A planta está passando por testes de segurança nutricional e ambiental. III. I. d) Optar pela obtenção das células do cordão umbilical de recém-nascidos em vez de obtê-las da fase de gástrula. Questão 1314 Um pesquisador precisa obter células-tronco para iniciar experimentos em terapia gênica. III. Ecologicamente. e) III e IV. elas estão menos diferenciadas do que as células germinativas nos testículos de um macho adulto. com maior capacidade de gerar descendentes também resistentes.e) I. inclusive na agricultura. Um grande inconveniente entre a clonagem e a produção de transgênicos é que ambas não permitem sobreposição. A reconstituição dessas moléculas teria sido feita através da inserção de fragmentos de DNA de rã. Os riscos ambientais da soja transgênica são pequenos. considere as quatro afirmações seguintes. até o momento. Questão 1315 No filme "Jurassic Park". e) Obter células do embrião em fase de blástula. criar um clone transgênico. quando ainda não é possível conseguir células tão indiferenciadas. Questão 1313 Sobre a clonagem de seres e a criação de organismos geneticamente modificados (transgênicos). na prática esse procedimento é extremamente improvável porque: a) seria necessário encontrar um genoma completo e conhecer sua ordem nos cromossomas. No caso dos transgênicos. já que no cordão a diferenciação é menor e o número de células. de Steven Spielberg. Em seguida. Uma linhagem de soja transgênica requer a produção inicial de 200 plantas resistentes ao herbicida e destas são selecionadas as dez mais "estáveis". Esses descendentes são submetidos a doses de herbicida três vezes superiores às aplicadas nas lavouras convencionais. d) o DNA coletado sofre mutações durante o período em que ficou fossilizado. uma vez que em adultos não existem células-tronco. IV. quando a indiferenciação é maior. IV e V. c) I e IV. ela já é conhecida e utilizada há certo tempo. pode haver também alteração de posições e de elementos na cadeia. processo que exige cerca de três anos. em uma cadeia alimentar. b) a composição química do DNA dos dinossauros é diferente das encontradas em espécies atuais. com relação às plantas. Tanto nos clones quanto nos transgênicos. c) as características do organismo se devem à estrutura primária das proteínas e não do DNA. ali. II. maior.

no seu patrimônio genético. ou seja. apresenta baixo risco ambiental porque a) a resistência ao herbicida não é estável e assim não passa para as plantas-filhas. algodão colorido e cabras que produzem fatores de coagulação sangüínea humana. Caso você fosse escolher uma ilustração para um artigo sobre os transgênicos. b) as doses de herbicida aplicadas nas plantas são 3 vezes superiores às usuais. Questão 1319 Uma planta de fumo foi produzida a partir de uma célula de fumo que havia recebido o gene responsável pela bioluminescência dos vaga-lumes. II. II. Assim. um dos pintores surrealistas mais importantes. ou modificado da mesma espécie. Analise as afirmativas a seguir.15. Um organismo ao receber material genético de outra espécie. A soja transgênica. passa a apresentar novas características.cruzada com outro tipo de soja é de apenas 1%. A planta de fumo e a técnica utilizada para obtê-la são denominadas. O catálogo com a receita para a produção dessas substâncias está no genoma. As substâncias utilizadas para isolar o gene a ser transplantado são denominados ENZIMAS TRANSGÊNICAS.2 Questão 1318 "Tracy é uma ovelha transgênica. qual das obras de Magritte. e) transgênica e técnica de clonagem. b) mutante e técnica de clonagem. b) I. Questão 1317 Os transgênicos vêm ocupando parte da imprensa com opiniões ora favoráveis ora desfavoráveis. e) a linhagem obtida foi testada rigorosamente em relação a sua segurança. Uma saída é consultar os catálogos de outras espécies. etc. referentes à técnica utilizada para obtenção da Tracy. c) I. a) mutante e técnica de miscigenação. IV. O belga René Magritte (1896-1967). c) mutante e técnica do DNA-recombinante. ela começou a brilhar. d) I. Questão 1320 Analise as informações abaixo: I.5. já temos bactérias fabricando hormônios humanos. d) transgênica e técnica do DNA-recombinante. II e IV. c) a capacidade da linhagem de cruzar com espécies selvagens é inexistente. deixou obras enigmáticas. respectivamente. amido. III e IV. a seguir. II e III. Pense na batata (ou qualquer outra planta) como uma fábrica que produz a mesma substância (proteína. e) II. d) a linhagem passou por testes nutricionais e após três anos foi aprovada. Estão corretas apenas as afirmativas: a) II e III. por exemplo. Animal transgênico é aquele que recebe e incorpora genes de outra espécie.). mas o catálogo não possui a receita para isso. Suponha que você queira tomar a fábrica inexpugnável aos ataques de insetos. A técnica do DNA recombinante foi utilizada para obtenção de Tracy. Quando essa planta foi regada com a substância que o vaga-lume usa para produzir luz. estaria mais de acordo com esse tema tão polêmico? I. segundo o texto. A bactéria 'Bacillus thuringiensis' (Bt) contém um gene que leva à produção de uma enzima capaz de digerir o 296 1. . Para a ligação do DNA transplantado ao DNA hospedeiro a célula utiliza a ENZIMA LIGASE. III. capaz de produzir uma proteína humana cuja deficiência causa problema hepático e pulmonar". III e IV.

Agora. capaz de produzir hemoglobina. IV. isto é.intestinos dos insetos. uma nova espécie. b) clones. b) 25 %. d) transgênicas. a toxina Bt é inofensiva aos seres humanos. genes de uma outra espécie. a) Associar o desenvolvimento socioeconômico de cada região às suas características de relevo. III. Questão 1323 As questões ambientais têm sido motivo de preocupação sobretudo para as últimas gerações. As alternativas a seguir apresentam algumas atividades sugeridas para a melhoria da qualidade de vida humana e da saúde ambiental. Segundo os biotecnólogos. assinale a alternativa correta. e) Podemos confiar na palavra dos biotecnólogos quando afirmam "A toxina Bt é inofensiva aos seres humanos". incluir o gene no genoma da batata. e com certeza não haverá ser humano sensível à ação biodigestora da toxina. b) Cultivar espécies com crescimento rápido e utilizar esses conhecimentos para planejar plantações economicamente viáveis. cujos intestinos não oferecem condições para ela se manifestar. d) Introduzir nas células de uma planta. Quando uma célula meristemática for geneticamente modificada. fazendo com que os novos genes sejam incorporados a seus cromossomos. A qualidade do ar e a importância da preservação da biodiversidade constam da pauta das discussões da humanidade há muito tempo. o que lhe conferiu resistência ao ataque de predadores. d) A batata passou a ser uma alimento geneticamente modificado. Após a análise das informações acima. a partir do cruzamento com a bactéria. Se essa ovelha for cruzada com um macho não-transgênico. O besouro ou a lagarta que se alimentar dela morrerá. b) A batata passou a ser um alimento transgênico porque foi cruzada com gametas oriundos da bactéria. Essas bactérias são consideradas a) puras. e) 100 %. pois sabemos que o genoma humano é homogêneo. é preciso transferir esse gene para o genoma da batata. c) A batata geneticamente modificada é um alimento transgênico porque recebeu parte do genoma de uma outra espécie. V. e) Imobilizar o gás carbônico tanto pelo processo de fotossíntese como por meio da fabricação de móveis. constituindo. essa planta recebeu: a) os anticódons que determinam a seqüência de 297 . c) 50 %. A planta inteira ficará impregnada com a toxina. A biotecnologia já encontrou bactérias ou vírus capazes de fazer essa transferência. A engenharia genética tem ferramentas bioquímicas para tirar cópias dessas páginas do genoma. Paulo" de 03/07/1999. Assinale aquela que contém conceitos e informações científicas só disponíveis aos jovens. Para que isso fosse possível. d) 75 %. c) mutantes. Questão 1321 A introdução de uma cópia de um gene humano no genoma do pronúcleo masculino de um zigoto originou uma ovelha transgênica. Questão 1322 A engenharia genética possibilitou a introdução do gene humano para a produção da insulina em bactérias. ao tipo de população e às suas riquezas naturais. VI. a) A batata geneticamente modificada é um alimento transgênico porque recebeu um genoma completo da bactéria. o que lhe conferiu resistência ao ataque de predadores. na última década do século XX. tiradas do jornal de "Folha de S. Questão 1324 Recentemente foi noticiada a criação de uma planta transgênica. que porcentagem de descendentes portadores do gene humano espera-se obter? a) Zero. ela poderá de transformar numa planta adulta que produzirá a toxina Bt. c) Estudar a dinâmica de crescimento e de regeneração natural das florestas tropicais. pois a toxina digere o intestino desses animais.

para se obter uma espécie nova que não ocorre naturalmente.Trata-se de alimentos fabricados com produtos geneticamente modificados. A transferência de genes bacterianos para o genoma de uma planta amplamente cultivada e usada na alimentação animal e humana vem gerando. d) eliminando-se as pragas da lavoura. IV . II e IV. questionamentos de cunho político. II. por conseqüência. poucos assuntos geram tanta controvérsia como os produtos transgênicos. eliminando todos os competidores do homem e dos animais que ele cria. I . derivam exclusivamente de engenharia 298 . gerando novas combinações genéticas. Sobre este tema. Atualmente. e) os transgênicos simplificarão muitas cadeias alimentares. Questão 1325 Atualmente. não trazendo perigos para a humanidade.Não se sabe quais serão as possíveis conseqüências da ingestão desses alimentos. utilizadas para a obtenção de seres transgênicos. apenas. e) Os ambientalistas defendem o uso da engenharia genética pois os seus efeitos são totalmente previstos e controlados. porém.Os ecologistas temem que as plantas transgênicas possam afetar o equilíbrio ecológico. apenas. milho resistente a insetos IV. as técnicas de controle de pragas nas culturas de soja sofreram mudanças e os custos de produção diminuíram. Questão 1328 A engenharia genética causou uma revolução na biotecnologia. d) O RNAm que carrega os aminoácidos usados na síntese de hemoglobina. que apresentam uma grande incidência de pragas na agricultura. prejudicando os atuais exportadores. b) todos os países passarão a produzir soja.aminoácidos nessa proteína. apenas. soja tolerante a herbicidas Desses produtos. apenas. beneficiando o meio ambiente. científico e filosófico. os alimentos transgênicos representam um tema de grande discussão. permitiram a criação do primeiro produto transgênico de grande impacto na agricultura: a soja resistente a um potente herbicida. III . d) I e III. II . c) não se conhecem os efeitos que os transgênicos podem ter na saúde das pessoas. Esta interferência do homem na natureza se dá por meio da engenharia genética. c) o fragmento de DNA. Estão corretas: a) I. Esses questionamentos justificam-se porque a) o custo dos transgênicos será certamente maior do que o dos produtos convencionais. e) somente os aminoácidos usados nessa proteína. destaque a afirmação correta: a) O objetivo dos cientistas é criar novas espécies. Questão 1327 As técnicas de manipulação genética. b) os ribossomos utilizados na produção dessa proteína. insulina humana para uso de diabéticos III. III e IV. b) I. e) II.Pode-se gerar um animal transgênico que tenha a capacidade de produzir maior quantidade de leite com menor taxa de gordura. o "round-up". cuja seqüência de nucleotídeos determina a seqüência de aminoácidos da hemoglobina. d) A modificação genética dos alimentos consiste na transferência de material hereditário de um organismo para outro receptor. c) Modificar um organismo geneticamente significa cruzar espécies diferentes. juntamente com produtos obtidos por meios tradicionais. o uso de herbicidas. Questão 1326 Atualmente. b) A aplicação da engenharia genética nos alimentos teve origem em países do terceiro mundo. Considere os quatro exemplos abaixo: I. diversos produtos biotecnológicos estão sendo comercializados. c) II e III. batata resistente a viroses II. considere as seguintes afirmações. A esse respeito. muitas cadeias alimentares desaparecerão. III e IV. Com o uso dessa variedade. aumentando a produtividade e minimizando.

II. III. mostarda e papinhas para crianças. II e III d) I. ou então com melhores qualidades nutritivas. outras conseqüências que o seu cultivo pode acarretar entre as quais estão: I. ed. Há grãos transgênicos usados no preparo de bolachas. tomateiros cujos frutos passam mais tempo amadurecendo no pé. cereais. a possibilidade de transmitir seus genes de resistência a plantas de espécies aparentadas.15. ano 36. p. maionese. d) II e III somente. pés de milho cujas sementes produzem hormônios de crescimento humano.genética SOMENTE a) I e II b) III e IV c) I. favorecendo a população mundial. Um transgênico possui em seu genoma um ou mais genes provenientes de outra espécie. Está correto o que se afirma em a) I somente. 43. algodoeiros cujas folhas se tornaram impalatáveis para a herbivoria. II. 100) Foram feitas as seguintes afirmações sobre organismos geneticamente modificados: I. n. a insetos e a vírus. massas. c) I e II somente. pães. b) II somente. tornando-se mais saborosos.2 299 . entretanto. Há. III e IV e) II. e) I. III. II e III. Questão 1332 A charge a seguir foi produzida num momento em que no Brasil se discutem as possíveis vantagens e desvantagens da liberação do plantio e comercialização de plantas transgênicas. Toda essas plantas são úteis para a espécie humana. interferência na composição da diversidade local de insetos ocorre SOMENTE com a) I b) II c) III d) I e II e) I e III Questão 1330 Sementes transgênicas podem levar à produção de plantas resistentes a inseticidas. III. É possível que haja polinização entre uma planta transgênica com outras de uma mesma espécie. 1886. o que aumenta e barateia a produção.5. porém. São Paulo: Abril. Há desvantagens SOMENTE em a) I b) II c) III d) I e II e) II e III Questão 1331 Os alimentos geneticamente modificados são uma realidade cotidiana. II. não transgênicas. III e IV Questão 1329 Obtiveram-se plantas transgênicas com as seguintes características: I. 1. O processo de inserção de genes de uma espécie em outra é realizado com a ajuda de enzimas de restrição. ("Veja". a possibilidade de afetar insetos e outros animais do ecossistema. a necessidade de uso mais intenso de agrotóxicos. óleo de soja.

A transferência do gene Bt para as variedades de milho. podem ser usados para produzir remédios. c) A bactéria 'Bacillus thuringiensis' (Bt) é um agente de controle biológico encontrado no solo. quando genes de coelhos foram injetados em ovos de camundongos que se desenvolveram no útero de fêmeas dessa espécie. é CORRETO afirmar: a) O que não faz mal para o homem não fará mal para os insetos. implicações e incertezas. b) Os defensores dos OGM enumeram a capacidade de aumento da produtividade agrícola. batata e soja. produtos químicos. de animais e do homem. c) O que não é bom para os insetos pode não ser bom para os homens. Os camundongos que nascidos desses ovos apresentaram hemoglobina de coelho em suas hemácias. 300 . além de servirem para a alimentação. o surgimento de ervas daninhas resistentes a herbicidas. são os principais riscos ambientais. favorecendo toda população mundial.) Analisando-se a charge de acordo com os atuais conhecimentos biológicos. porém o uso dos OGM tornaria os pequenos agricultores independentes em relação às empresas fornecedoras de sementes. leite e ovos. oportunizando melhores condições ambientais e sociais. de plantas. regulamentados pelas normas de biossegurança. alterando assim o código genético do organismo.(Jornal da "Ciência" . d) Vários tipos de alimentos." ("Revista Galileu". porque suas implicações são muito sérias. as torna resistentes a certos tipos de insetos. é correto afirmar: a) OGM são produtos obtidos pela transferência de gene entre espécies similares ou diferentes. o aumento do uso de agrotóxicos e a perda da fertilidade natural do solo. c) DNA do coelho injetado no ovo foi transcrito para o RNA ribossômico que conduziu a síntese de proteínas nessa célula. algodão. e) A poluição genética. em 10 de outubro de 2003. Nov/2003) Sobre os OGM (organismos geneticamente modificados). Questão 1334 O primeiro organismo transgênico foi obtido por volta de 1981. redução do uso de agrotóxicos. porque: a) RNA mensageiro do coelho injetado no ovo passou a conduzir a síntese de proteínas nessa célula. b) DNA do coelho injetado no ovo se incorporou a um cromossomo e foi transmitido de célula a célula através de mitoses. a perda de biodiversidade. como grãos. A técnica de obtenção de organismos transgênicos produtores de proteínas humanas consiste em: a) remover artificialmente alguns nucleotídeos de uma molécula de DNA. Nenhum cientista deixa de reconhecer o poder da tecnologia do DNA. tornar os alimentos mais nutritivos e saudáveis e criar novos tipos de terapias e medicamentos. b) As plantas transgênicas são perigosas para a saúde animal. são constantes e cada vez mais freqüentes os noticiários sobre o uso de tecnologia transgênica com fim de obter proteínas de ação farmacológica ou mesmo proteínas terapêuticas humanas. que produz uma toxina contra lagartas. Mas. pois a ingestão da planta não lhe fará mal. e) DNA do coelho injetado no ovo se incorporou a um cromossomo e passou a conduzir a síntese de proteínas nessa célula. O problema está em algumas de suas aplicações. d) Se os insetos experimentarem. podendo misturar o DNA de microorganismos. Questão 1333 "Muito se tem falado sobre os transgênicos e praticamente todo mundo tem alguma opinião sobre o assunto. plásticos e combustíveis. o homem poderá experimentar. a saúde humana e a economia. fumo. além de mais nutritivos.Edição 515. que gera um novo organismo por multiplicação. Isto envolve a natureza. Questão 1335 Em revistas e em jornais. d) RNA mensageiro do coelho injetado no ovo se incorporou a um cromossomo e foi transmitido de célula a célula através de mitoses. este tema não pode progredir na base do ser contra ou a favor. b) retornar uma célula diferenciada ao estágio de indiferenciada.

NÃO é correto afirmar que a) os genes da hidra se expressaram na planária. Após ser regada com solução de luciferina. 1. A tira de quadrinhos a seguir faz referência à manipulação de genes em laboratório. a partir do qual as células da planta produziram DNA e luciferase. Das células de vermes adultos. da genética atual. b) incorporou um segmento de RNA do vaga-lume. a reativar os seus genes e gerar um novo ser. e) métodos biotecnológicos de cruzamentos seletivos para obtenção de novas espécies. 301 . O resultado desse experimento indica que a planta a) incorporou um segmento de RNA do vaga-lume.15. esse gene foi transferido para uma célula vegetal e. d) incorporou um segmento de DNA do vaga-lume. d) ocorreu tradução do código genético da hidra no organismo da planária. que porta a totalidade do genoma. d) transplantado. enzima responsável pela oxidação da substância luciferina. d) o gene do vaga-lume controlou a produção de RNA e de proteína no interior das células do elefante.15. representada na ilustração. b) segmentos de DNA da hidra apresentaram capacidade de replicação durante a embriogênese da planária.c) induzir célula somática. levando à produção de luz. poder-se-ia afirmar que a) o elefante e o vaga-lume são organismos transgênicos. de maneira a integrar o material genético. b) apenas o vaga-lume é um organismo transgênico. desenvolveram-se vermes portadores de tentáculos e de cnidoblastos com filamento urticante. c) uma seqüência de RNA do vagalume foi transferida para células do elefante. seria possível produzir um rato a) sintético. Através da engenharia genética. e) não expressou o gene do vaga-lume.5. c) clonado. Questão 1337 No vaga-lume há um gene que determina produção de luciferase. foram isoladas moléculas de RNA e de proteína da hidra. foram introduzidos certos genes da hidra em ovos de planária. a partir do qual as células da planta produziram RNA e luciferase. e) uma seqüência de DNA do elefante sofreu mutação devido à introdução do gene do vaga-lume em células daquele mamífero. c) os genes da hidra apresentaram transcrição no organismo da planária.5. d) introdução de um ou mais genes interessantes de uma espécie em célula hospedeira. que possibilitou às células da planta a produção de luciferase.2 través da técnica. Questão 1339 1. e) transgênico. obteve-se uma planta inteira. que não possibilitou a produção de RNA e nem de luciferase.2 Se esse tipo de experimento realmente fosse concretizado. Desses ovos. e) a hidra e a planária nele utilizadas são organismos transgênicos. Com relação a esse experimento. c) incorporou um segmento de DNA do vaga-lume. a referida planta começou a emitir luz. Questão 1338 Em um experimento. Questão 1336 Responder à questão a seguir com base na ilustração. a partir desta. b) híbrido.

e) as ervas daninhas passaram a produzir proteínas da canola transgênica. c) as espécies silvestres incorporaram e expressaram material genético da canola transgênica. foi medida. nas mesmas condições experimentais. o tratamento com esse herbicida não prejudica o desenvolvimento de culturas de soja transgênica. é modificada na soja transgênica. a atividade da EPSP-sintase em extratos de folhas de diferentes tipos desse vegetal. após introduzidas em plasmídios. Sobre esse fato. Estas novas plantas são exemplos de organismos criados por engenharia genética e são genericamente conhecidos como: a) reversos b) recessivos c) dominantes d) transgênicos Questão 1342 Para a clonagem em bactérias do hormônio do crescimento humano a partir de seu RNA mensageiro. para gerar uma nova planta com novas características. Assim.5. apresentaram o mesmo valor. tornando-as resistentes a agentes químicos.Questão 1340 Recentemente. é inicialmente necessário que sejam sintetizadas em laboratório cópias em DNA desse RNA. tornando-a resistente à inibição pelo herbicida glifosato. mas evita o crescimento de outros vegetais indesejáveis. amido e proteínas em suas sementes ou melhorar a resistência das plantas a pestes e vírus ou ainda aumentar a sobrevivência destes organismos em ambientes adversos. gerar novas plantas com reservas modificadas de lipídios. alto poder de resistência a herbicidas. Estes novos segmentos de DNA introduzidos podem. em presença ou ausência de glifosato. na ausência do inibidor. Essas cópias de DNA são sintetizadas em laboratório com o auxílio de uma preparação da enzima denominada de: a) RNA replicase b) RNA polimerase c) desoxirribonuclease d) transcriptase reversa Questão 1343 A enzima EPSP-sintase. presente em praticamente todos os vegetais. é INCORRETO afirmar que a) as espécies de canola são transgênicas pois expressam genes que incorporaram de outras espécies. Estas passaram a apresentar a característica da canola transgênica. produtos que sofreram 302 .15. em crescimento no meio apropriado. Num estudo para a identificação da variedade transgênica de soja. ou seja. b) o pólen da canola transgênica transportou material genético para plantas silvestres.2 A curva que corresponde à razão entre as atividades de uma enzima da variedade transgênica e as atividades dessa mesma enzima da soja comum é a indicada pela seguinte letra: a) W b) X c) Y d) Z Questão 1344 Considere o texto a seguir: "Os alimentos transgênicos. Observe o gráfico: 1. d) o RNA da canola transgênica foi transferido e incorporado ao genoma das ervas daninhas. As atividades da enzima nesses extratos. por exemplo. Questão 1341 As técnicas modernas de biologia molecular têm permitido a inserção de segmentos novos de DNA em células vegetais. As cópias. serão expressas em culturas de bactérias contendo os plasmídios modificados. foram constatados casos de transporte de pólen de espécies de canola transgênica para plantas silvestres (ervas daninhas).

15. b) a utilização de células vegetais diminui a possibilidade de contaminação humana por vírus animais. Estas plantas são chamadas transgênicas.2 303 . Até o momento. corretamente. presente naturalmente em medusas e que pode ser detectada sob luz ultravioleta.. pois os resultados das experiências podem ser imprevisíveis. em geral. Eduardo Kac. d) O RNA mensageiro. o resultado mais trágico do uso de produtos transgênicos surgiu no Japão em 1989: 5000 pessoas ficaram doentes. recentemente.alteração genética com o objetivo de melhorar a qualidade. na sigla em inglês). Para conferir essa característica particular. onde também não há obrigação de alertar o consumidor. obtiveram. que: a) toda planta transgênica produz substâncias altamente tóxicas ao ser humano. 1500 se tornaram permanentemente inválidas e 37 morreram". c) manipulações genéticas podem alterar o funcionamento dos genes naturais de um organismo. podem esconder riscos ainda não esclarecidos [.. já ocupam prateleiras dos supermercados nos Estados Unidos e Canadá. introduzido no plasmídeo antes de sua introdução na célula vegetal. batizou de Alba a coelha transgênica que tem uma propriedade peculiar: seus olhos rosados e seus pêlos brancos ficam fluorescentes quando expostos à luz ultravioleta. mas o consumidor não sabe disso: não há lei que obrigue os fabricantes a informar que o produto sofreu alteração genética. No Brasil. Questão 1346 Os cientistas franceses que criaram animal transgênico e o artista brasileiro que fez a encomenda entram em conflito. relacionado ao GH. e) O DNA relacionado à síntese do GH pode ser obtido a partir do RNA mensageiro. Questão 1345 Pesquisadores de alguns centros de pesquisa brasileiros. a multinacional Monsanto está tentando conseguir autorização do Ministério da Ciência e Tecnologia para produzir soja transgênica no país. Os benefícios [advindos de plantas transgênicas]. utilizando técnicas de engenharia genética. Criador e artista já disputam a posse da "transcoelha". pode-se concluir. porém.]. os pesquisadores criaram um coelho que produz em todas as suas células a proteína GFP (proteína verde fluorescente. (FOLHA DE SÃO PAULO. 6 de agosto de 1998). quando introduzido na célula vegetal é transcrito em DNA na presença da enzima transcriptase vegetal. plantas que produzem proteínas humanas. e) todas as plantas transgênicas são estéreis a partir da segunda geração mutante. Considere estas informações e assinale a opção incorreta: a) O gene para a produção de GH é. Pela leitura do texto anterior. d) as técnicas de transferência de genes por engenharia genética são altamente seguras. artista plástico brasileiro e professor de arte e tecnologia em Chicago. entre as quais o hormônio do crescimento (GH).5. b) plantas transgênicas são aquelas cujos fenótipos se devem mais ao ambiente do que aos genes. c) Antes de se obter a planta produtora de GH é necessária a produção do DNA recombinante. 1.

Questão 1349 Através de técnicas da biologia celular. A partir desse conhecimento é possível modular o crescimento muscular por meio de vários procedimentos. assinale a alternativa correta.produz ’-caroteno (vitamina A). e CORRETO afirmar que o uso desse grão na alimentação humana resulta em benefício para a saúde porque ele a) previne alguns tipos de cegueira. para que estas produzam substâncias que normalmente não seriam produzidas. somente estão corretas: a) I e II b) I e III c) I e IV d) II e III e) III e IV Questão 1347 Recentes descobertas têm provocado grande discussão por poderem alterar o futuro do esporte.terra. se executado uma única vez. III) As células fluorescentes da coelha produzem RNA mensageiro. a partir de DNA viral. d) diminui a formacao de coagulos.htm Considerando a tecnologia para obtenção de transgênicos. b) Organismos que recebem e manifestam genes de outra espécie são denominados transgênicos. e) Ainda não é possível produzir plantas com genes ativos de insetos. e) Injetar anticorpos produzidos contra o fator IGF-1. 08/2004) Analise os procedimentos a seguir e aponte aquele que poderia promover o desenvolvimento mais duradouro da massa muscular. Questão 1348 O arroz dourado . o homem tem desenvolvido grandes projetos. utilizando técnicas aplicadas em terapia gênica. referentes a diferentes questões de Genética. são vetores do DNA recombinante. c) As enzimas de restrição agem em seqüências inespecíficas de DNA. são feitas as seguintes afirmativas: I) A coelha Alba é considerada transgênica pois possui em seu genoma um segmento de DNA de medusa. Sobre este assunto. b) Injetar anticorpos produzidos contra a proteína miostatina. II) Apenas as células somáticas tiveram o gene que codifica a proteína GFP inserido em seu genoma. c) evita o aparecimento do bocio. 304 . a) As enzimas de restrição hoje conhecidas são produzidas por diversas indústrias multinacionais. c) Introduzir nas células musculares nova cópia do gene do fator IGF-1. O crescimento muscular é estimulado pelo fator IGF-1 e limitado pela miostatina. tal como a insulina.br/educacao/isaacelias/coelha. em indivíduos sedentários. foi mostrada a existência de duas proteínas que atuam regulando o crescimento das células musculares: o fator de crescimento IGF-1 e a miostatina. b) aumenta o peristaltismo. chamados de bacteriófagos. IV) A coelha transgênica foi produzida a partir da introdução de um núcleo extraído de uma célula de medusa em um óvulo de coelha cujo núcleo tenha sido anteriormente removido.com. Nessas pesquisas. que no processo de tradução origina a proteína GFP. d) Cromossomos circulares presentes no citoplasma de bactérias. Dentre as afirmativas acima. Questão 1350 Analise as proposições a seguir. sem deixar vestígios detectáveis em exames de sangue ou urina. como o de transformar células de bactérias. Assim sendo. ("Scientific American Brasil". d) Injetar a proteína miostatina mutada que bloqueia a ação da miostatina normal por competir pelo seu receptor.geneticamente modificado . a) Introduzir nas células musculares novas cópias de RNA mensageiro que codifica o fator IGF-1.daptado de: http://paginas.

Desenvolver variedades de plantas que produzam frutos com melhor textura e de amadurecimento lento III. Desenvolver variedades de plantas resistentes a geadas. p. por exemplo. tomate e muitas outras.) Vegetais modificados geneticamente são considerados transgênicos. I.5. sendo os principais produtores os Estados Unidos. O DNA recombinante então obtido pode ser clonado e utilizado. acidez do solo e escassez de água.afirmativas a seguir. Questão 1351 Em todo o mundo. milho. é necessário que uma molécula produzida por um gene regulador (x) não reprima o gene operador (1). a Argentina e o Canadá. A probabilidade de uma mulher (AaBb). é de 1/16. diferentes genes participam do metabolismo dos aminoácidos fenilalanina e tirosina. preocupação de longo prazo têm os ingleses. apresentará fenilcetonúria. Questão 1353 Escolha a alternativa que apresenta um exemplo de transgenia. a pessoa expressará uma anomalia metabólica. ( ) Se dois pares de genes aditivos determinam a cor da pele no homem. Nos últimos anos. c) a seleção de DNA mais adaptado existente numa determinada espécie. segmentos do DNA de outro organismo. Da análise das afirmativas acima podemos assegurar que: a) apenas I está correta b) apenas II está correta c) apenas I e II estão corretas d) apenas II e III estão corretas e) I.53. cada um determinando a produção de uma enzima. a chamada comida GM. um de fenótipo mulato-médio e o outro de fenótipo branco.. em seu material genético. ilustrado no esquema (figura 2). batata. como soja. em testes laboratoriais para a detecção de gravidez em estágios muito precoces. Tais anticorpos podem ser empregados. 305 1. Esses alimentos (. No caso ilustrado no esquema (figura 1). algodão. ( ) No homem. 16/06/99. que mostram os objetivos da manipulação genética das plantas cultivadas. casada com um homem (aabb).15. Sua obtenção se dá com a) o cruzamento de duas espécies distintas. reconhecidos como altamente específicos.2 ( ) Certos microorganismos podem ser manipulados em laboratório para incorporarem.) têm seu código genético alterado para ficarem mais viçosos ou resistentes a herbicidas e pragas. ter. II e III estão corretas Questão 1352 "A reforma da natureza Em termos de cardápio diário. podem ser produzidos anticorpos monoclonais. a) Incorporação e expressão de gene humano que codifica insulina por bactérias. ( ) Por meios biotecnológicos. II. e essa mutação determinar a produção de enzima não-funcional. plantas transgênicas. b) a incorporação de RNAm na célula zigoto das espécies." (Adaptado da revista VEJA. em uma única gestação. por exemplo. dois filhos. para ocorrer a transcrição das enzimas codificadas nos genes 2. ( ) Considerando o operon da lactose. Considere as . da mesma espécie ou de outra espécie no genoma da espécie em estudo. o país vem consumindo cada vez mais alimentos geneticamente modificados. d) a introdução de DNA em genomas das células dos vegetais já formados. Se ocorrer uma mutação em um determinado loco. já ocupam cerca de 40 milhões de hectares. cinco classes fenotípicas podem ser observadas na população.. de 'Escherichia coli'. 3 e 4 (estruturais). na produção de hormônios para a espécie humana. Desenvolver variedades de plantas resistentes a herbicidas ou a insetos. e) a adição de DNA exógero manipulado.

Assinale verdadeira (V) ou falsa (F) nas afirmativas a seguir. p. antes de chegarem ao homem. c) Organismo que apresenta tanto estruturas reprodutoras masculinas quanto femininas. ou agir como inseticidas. cientistas desenvolvem ovelhas "auto-tosquiáveis". alterando geneticamente animais e plantas. 306 .F. à obrigatoriedade da apresentação. (16) Os organismos transgênicos são aqueles que recebem segmentos de DNA da mesma espécie. plantas e animais. a produzir esse hormônio.F . resultante do cruzamento de duas variedades puras distintas. na embalagem de alimentos produzidos com técnicas da biotecnologia. que permite a inclusão de genes de organismos de espécies diferentes no genoma de bactérias. podem ser consideradas exemplos de biotecnologia aplicada à fabricação de organismos transgênicos.b) Desenvolvimento de um organismo completo a partir de uma célula somática. b) V . e) F . como a poliploidização. 4. Questão 1354 Porcos têm sido criados transgenicamente para que seus órgãos possam ser transplantados em homens. (1) Transgênicos são organismos produzidos com a tecnologia do DNA recombinante. deixando os vegetarianos confusos com a perspectiva de cruzar animais com plantas. e) Organismo mais vigoroso. Questão 1356 Acerca dos organismos transgênicos.V. julgue os itens a seguir. (04) Os alimentos transgênicos não representam nenhuma ameaça à saúde humana..) A citação anterior mostra avanços da Engenharia Genética. pois atuam como enzimas. (2) Organismos geneticamente modificados podem ser resistentes a produtos químicos como herbicidas. com muitos genes em heterozigose.. de informação relativa à natureza transgênica do produto. e por isso não necessitam ser testados em outras espécies de animais. ( ) As vitaminas são necessárias em grandes quantidades. c) V . (4) As técnicas de melhoramento genético tradicionais. A seqüência correta é a) V . que passam. a partir de transferência de genes humanos para bactérias.F. gens de galinha são introduzidos em batatas. a lã cai sozinha no devido tempo.V . d) Gene que sofreu mutações. isto é.V.V . como a cenoura. (02) Os genes alienígenas permitem ao organismo receptor produzir substâncias que nunca produziriam em condições naturais.F . para que as manipulações genéticas não resultem em impactos ambientais irreversíveis. é uma das experiências bem sucedidas da transgenia. Assinale a(s) proposição(ões) VERDADEIRA(S) sobre a transgenia e suas implicações com relação à saúde e ao meio ambiente. (01) Cientistas interferem na evolução natural das espécies. por isso o grão transgênico é mais nutritivo. 1999.14. (32) É fundamental o estabelecimento de limites. (3) Os debates atuais a respeito dos transgênicos resumem-se à questão da rotulagem. tanto por parte dos cientistas como dos governantes. originando múltiplos alelos para um mesmo locus. Questão 1355 Foi transferido para plantas de arroz um gene que permite a produção e o acúmulo de vitamina A no grão das plantas transgênicas. ( ) A vitamina A foi introduzida no núcleo das células. (08) a produção de insulina. ("CICLO VITAL". isto é. d) F . ( ) Uma importante fonte natural de vitamina A são os vegetais com pigmentos amarelos.F. vol.F . incontinentimente.

continua-se considerando que homens e chimpanzés são espécies diferentes. a semelhança estrutural existente entre as moléculas de DNA é tomada por base para a identificação da paternidade. b) o DNA injetado nos camundongos poderia passar aos seus descendentes somente se fosse incorporado às células somáticas das fêmeas dos camundongos. Esse tipo de teste é particularmente indicado para bebês e crianças pequenas. para obtenção de camundongos transgênicos. levando à produção de ratos gigantes. As diferenças no DNA de humanos e chimpanzés são de apenas 4% dos quase 3 bilhões de bases (letras químicas A. e) o RNAm foi incorporado ao zigoto dos embriões em formação. resultando camundongos com hemoglobina de coelho em suas hemácias. a duplicação de um conjunto de letras qualquer ou a deleção de outro. em ratos. Paulo" (07. Essa diferença consiste na(o): a) seqüência de bases nitrogenadas.2001) afirmou: "O que torna a técnica tão atrativa e produtora de ansiedade é que qualquer gene de qualquer espécie pode ser transferido para qualquer outra espécie". independentemente de sua classificação. c) infectados. Quando se olha para os genes em si . 01. Essa afirmação a) não é válida. identificar a paternidade de uma pessoa sem a necessidade de coleta de sangue. os trechos de DNA que se traduzem em alguma função. se as espécies forem de classes diferentes. que apresentam características diferentes. desde que as espécies sejam da mesma ordem." (O GLOBO.10.2005) A despeito da similaridade genética. Questão 1360 "EXAME DE PATERNIDADE. Gurdon e F. d) tipo de pentose existente. e) é válida para todas as espécies. T. Ruddle. d) mutantes. JÁ PODE SER FEITO COM SALIVA" "Novo teste pode. d) os camundongos transgênicos. c) é válida. mas não foi incorporado aos seus genomas. injetando genes da hemoglobina de coelho em zigotos de camundongos. se as espécies forem de filos diferentes. o caderno Mais! do jornal "Folha de S. c) número de fosfatos contidos. ao se reproduzirem. e) tipo de desoxirriboses presentes. pela análise do DNA das células. transmitiram os genes do coelho aos seus descendentes. pode-se dizer que a maior contribuição para a diferença fenotípica entre essas espécies seja devida à 307 .Paulo". por J. Desse modo. ("Folha de S. Questão 1359 Com relação à técnica de criação de organismos geneticamente modificados (transgênicos). pode-se deduzir que a) o DNA injetado foi incorporado apenas às hemácias dos camundongos. do gene humano para produção do hormônio de crescimento.isto é.Questão 1357 A engenharia genética permitiu a introdução. b) não é válida. E boa parte dessas modificações se deu de maneira trivial ao longo dos cerca de 6 milhões de anos transcorridos desde o ancestral comum de ambos. nós e esses grandes macacos africanos somos 99% iguais. mas não poderiam transmitir essa característica aos seus descendentes. desde que as espécies sejam do mesmo reino. b) aspecto da dupla hélice presente. em função das informações do texto. c) os camundongos receptores dos genes do coelho tiveram suas hemácias modificadas.H. d) é válida. A partir destas informações.W. com a mera troca de uma letra num gene. C e G) que compõem ambos os genomas. Estes ratos são considerados a) isogênicos. e) clones. Questão 1361 CONSÓRCIO DECIFRA GENOMA DO CHIMPANZÉ. Questão 1358 O primeiro transplante de genes bem sucedido foi realizado em 1981.09. NO BRASIL. b) transgênicos. 20/08/98) Nesse tipo de teste. como a síntese de proteínas -.

27/6/2000. Tony Blair.5. inclusive permitiu o estabelecimento de comparações genômicas com o intuito de analisar quais genes são típicos de um organismo e quais foram perdidos no processo evolutivo. d) expressão diferenciada dos genes. São Paulo . V. empenham-se no momento em descobrir a) a interação dos genes. com o intuito de verificar se todos esses genes eram essenciais para a sobrevivência dessa espécie. a ausência de crescimento significa que o gene B é essencial. 308 . d) descobrir novos genes com funções ainda desconhecidas. e) como ocorrem a duplicação e as mutações dos nucleotídeos. o seqüenciamento do DNA revolucionou a ciência e gerou novos conhecimentos sobre seres procariotos e eucariotos. e) o número correto de cromossomos da espécie humana. que estão sendo desenvolvidos em centros de pesquisas de vários países. Quando um transposon é inserido aleatoriamente dentro de um gene. b) quantidade de DNA presente no núcleo das células desses organismos. Questão 1362 O anúncio do seqüenciamento do genoma humano. b) a expressão dos genes. o crescimento demonstra que o gene A não é essencial. IV e V. 1. d) quais nucleotídeos servem de molde para a síntese de RNAm. c) II. Questão 1366 "O genoma humano foi mapeado e sua seqüência estabelecida pela primeira vez na história da humanidade. II.15. IV e V apenas. Questão 1364 Pelo Projeto Genoma Humano. o primeiro ministro britânico. I. como eles agem. Questão 1365 Nos últimos dez anos. o genoma mínimo essencial pode ser determinado. genitalium' sobrevive sem utilizar alguns de seus genes. d) I e III apenas. No experimento I. d) a seqüência de aminoácidos de todas as proteínas humanas. IV e V apenas. b) compreender mecanismos que tornam uma célula imortal. II. III. c) garantir a cura de todas as patologias humanas.a) seqüência de bases nitrogenadas no DNA. c) a seqüência de aminoácidos do DNA humano. c) a seqüência exata de nucleotídeos de cada gene. em 21 de junho de 2000. III. A bactéria 'M. IV. foram feitas algumas afirmações. II. Em um laboratório. c) quantidade de lócus gênicos. e) seqüência de aminoácidos das proteínas. São afirmações CORRETAS: a) I. Se cada gene pode ser inativado por mutação. No experimento II. Questão 1363 Os projetos genomas. significa que os cientistas determinaram a) a seqüência de nucleotídeos dos cromossomos humanos. b) todos os tipos de proteína codificados pelos genes humanos. o consórcio público internacional Projeto Genoma Humano (PGH) e a empresa norte-americana Celera. que possui apenas 470 genes. EXCETO: a) selecionar embriões com características desejáveis. a humanidade viverá uma nova era. Pelas pesquisas realizadas até hoje no Projeto Genoma Humano. isto é. a era da genética. Bill Clinton. e os representantes dos grupos rivais. é capaz de inativá-lo.3 Sobre esse experimento. anunciaram ontem o presidente norte-americano. realizou-se um experimento com a bactéria 'Mycoplasma genitalium'. b) I." "Folha Ciência". é possível.

vacinas. ( ) O teste de paternidade com base no DNA deve ser realizado exclusivamente em indivíduos sem doenças sangüíneas. Uma das formas possíveis de identificar os despojos dos filhos dessa senhora consiste em verificar se existe homologia do: a) DNA mitocondrial da senhora com o DNA mitocondrial das vítimas b) DNA mitocondrial da senhora com o DNA nuclear das vítimas c) DNA nuclear do marido e do ex-marido da senhora com o DNA mitocondrial das vítimas d) DNA mitocondrial do marido e do ex-marido da senhora com o DNA mitocondrial das vítimas e) DNA nuclear da senhora com o DNA mitocondrial das vítimas Questão 1368 Os avanços da Engenharia Genética têm permitido o conhecimento mais amplo dos cromossomos. o método de produção do hormônio do crescimento envolve diretamente a) o seqüenciamento de DNA. d) a hibridização de DNA. amostras de DNA nuclear e mitocondrial de todos os mortos. algumas questões de cunho ético têm sido levantadas. como a hemofilia. Questão 1370 "A nova tecnologia do DNA recombinante está permitindo que cientistas dos países do primeiro mundo desenvolvam um projeto denominado GENOMA. c) o DNA recombinante. e) a sonda de DNA. II e IV. como o das bactérias ('Xylela fastidiosa'). IV . possibilitando a melhor compreensão dos diferentes fenótipos. b) a clonagem de células. Considerando as proposições anteriores. III . o procedimento que pode afetar diretamente o equilíbrio genético de populações humanas é a) a detecção de indivíduos superdotados intelectualmente por meio de procedimentos laboratoriais. todas as quebras provocadas pela radiação solar. b) apenas II e III. Sobre este tema. Na fase laboratorial. ( ) O Projeto Genoma visa a localizar. especialmente no que se refere à produção de antibióticos. d) apenas I." ("Ciência Hoje". embora os corpos das vítimas fatais fiquem queimados e irreconhecíveis. março/93) Em relação a esse projeto.O seqüenciamento do genoma humano possibilitará a identificação dos genes envolvidos em doenças e a criação de novas abordagens preventivas ou de tratamentos mais rápidos e eficazes. cada um de um casamento diferente. ( ) O mapeamento gênico de um indivíduo permite informar se ele é portador ou não de genes causadores de doenças. c) apenas I.O seqüenciamento do genoma de outras espécies. Faleceram no acidente dois filhos de uma senhora. foi possível preparar. a partir de fragmentos de tecidos. Questão 1369 Os avanços na área da biotecnologia permitiram melhores condições de assistência à saúde humana e animal. Questão 1367 Em um acidente. nos cromossomos humanos. analise os itens abaixo. III e IV.Leia as proposições a seguir sobre o Projeto Genoma Humano. que tem por objetivo seqüenciar os cerca de 3 bilhões de bases nitrogenadas que compõem os cromossomos de um ser humano. Ao lado dos inúmeros benefícios desse projeto. I . ( ) O gene para produção de insulina no homem pode ser clonado em bactérias que passam a produzir este hormônio. é de grande auxílio para o Projeto Genoma Humano. pode-se afirmar que estão CORRETAS a) apenas I e II.O genoma humano pode ser seqüenciado a partir de qualquer célula do corpo. e) todas as proposições. com exceção das hemácias. 309 . II .O seqüenciamento do genoma humano determinou a posição exata e a função de cada gene. dos camundongos e ratos. hormônios e outros insumos terapêuticos.

b) o aumento de seleção genética ou gamética artificial. muitas crianças foram seqüestradas com seus pais ou nasceram em centros clandestinos de detenção. pois. para se hibridizarem.ar) A comparação entre os DNAs mitocondriais de possíveis netos e avós tem sido um dos testes utilizados nesses processos de identificação de parentesco. aproximadamente. a) A criança não é filha de nenhum dos supostos pais. b) A criança é filha de Pedro. e) de o DNA mitocondrial. 310 . c) A criança é filha de João. Essas crianças foram adotadas. através de uma mistura dos genes do pai e da mãe. através das mitocôndrias existentes no citoplasma do ovócito da mãe. empregando para isso testes de identificação genética. por ser herdado das duas avós. Questão 1371 Alguns projetos de seqüenciamento genômico vêm sendo desenvolvidos por pesquisadores brasileiros. Para solucionar esse impasse. pois deveríamos ter hibridizado o DNA do pai com o da mãe. pois todos os resultados foram menores que 85%. mesmo na ausência dos pais. a família de Maria resolveu fazer um teste de paternidade. b) de o DNA mitocondrial. os DNAs devem ser diferentes. ou de João (primo de Pedro). EXCETO a) Aumento da produtividade na agricultura b) Compreensão mais ampla das doenças genéticas c) Determinação da posição de proteínas nos cromossomos d) Diagnóstico precoce de doenças hereditárias Questão 1372 Na Argentina. c) o emprego de testes genéticos como um novo critério para admissão a empregos. envolveu a bactéria causadora da "praga do amarelinho". e o resultado foi o seguinte.15. 50% dos genes são herdados da mãe e 50%. d) o registro de patentes de seqüências do genoma humano para especulação mercadológica.5. através das mitocôndrias existentes no citoplasma do ovócito da mãe. por ser herdado da avó paterna. garantir um registro familiar que se mantém de geração a geração. através das mitocôndrias existentes no citoplasma do espermatozóide do pai. por ser herdado da avó materna. c) de o DNA mitocondrial. d) de o DNA mitocondrial. pois. d) O teste não foi conclusivo. do pai. permitir identificar a filiação com segurança. e) o uso de testes pró-sintomáticos para a realização de seguros de vida. por ser herdado do avô materno. Questão 1373 Maria teve um filho e Pedro. durante a ditadura militar iniciada em 1976. por ser herdado do avô paterno. na verdade. alegando que o filho pode ser de Paulo (irmão de Pedro). o seqüenciamento completo do genoma humano foi anunciado pela comunidade científica internacional. permitir traçar árvores familiares confiáveis. permitir traçar árvores familiares confiáveis. vendidas ou abandonadas em orfanatos. seu ex-namorado. que são possíveis. por exemplo. através das mitocôndrias existentes no citoplasma do ovócito da mãe. 1. Antônio. atualmente. permitir traçar árvores familiares confiáveis. ou ainda de um vizinho. irmãos adotivos. Paralelamente. A Associação Civil "Avós da Praça de Maio" tem buscado localizar essas crianças com a finalidade de restituí-las a suas famílias legítimas. A escolha desse teste está relacionada com o fato a) de o DNA mitocondrial. nega a paternidade da criança.com.3 Assinale a alternativa que interpreta corretamente os resultados do teste. que atinge plantas cítricas. Um deles. Todas as alternativas apresentam benefícios de projetos que envolvem o seqüenciamento de genomas. (Fonte: abuelasatournet. e) Pedro e Paulo são.

O genoma humano tem organização diferente da organização do genoma da bactéria 'Xyllela fastidiosa'. C e D quando o seqüenciamento é realizado a partir de RNA mensageiro. no futuro. e) I. Com relação a esse assunto. Georges Barsky desenvolveu a técnica de hibridização somática.. II . bem como pela sua habilidade em produzir as proteínas humanas hipotéticas A. (16) um dos resultados possíveis dessa descoberta será a cura. o pregão eletrônico das empresas de alta tecnologia.).. (.. (02) a molécula sequenciada é o DNA. b) Apenas II. I . .são possíveis de serem encontradas nesse mapeamento.5.. III . Questão 1375 O que se imaginava impossível acabou acontecendo antes do prazo previsto: após a elucidação da seqüência de DNA de vários organismos. II e III. Duas células de origem diferente podem se fundir em uma única célula híbrida.A expressão dos genes humanos depende da presença. Com relação à organização genômica.O genoma humano contém uma grande percentagem de seqüências de DNA que não codificam genes. c) Apenas I e II. (04) apenas quatro bases nitrogenadas .3 m relação à tabela é correto afirmar que a) o gene correspondente à proteína A está no cromossomo 1. de cada gene no DNA de células diferenciadas. no ano 2000. de algumas doenças genéticas. que contém cromossomos das duas espécies. "A revanche veio na quinta-feira [06/4] passada. ou ausência. a Citosina. 311 . é CORRETO afirmar que: (01) o referido genoma está contido nos cromossomos. 123.. através da terapia gênica. c) o gene correspondente à proteína C está no cromossomo 6. a Nasdaq. A tabela abaixo contém uma grade hipotética de dados usados para mapear genes em seus cromossomos humanos apropriados. B. 10/04/2000.15.a Adenina.Questão 1374 Na década de 1960. Três linhagens somáticas híbridas designadas I. recentemente seqüenciado no Brasil.. voltou a respirar." Trecho extraído do artigo: GENOMA: O PRIMEIRO ESBOÇO DO MAPA DA VIDA. Quais estão corretas? a) Apenas I. Questão 1376 1. Depois do susto provocado no começo da semana pelos percalços jurídicos da Microsoft. d) Apenas II e III.. d) o gene correspondente à proteína D está no cromossomo 4. foi anunciado o seqüenciamento do genoma humano. causadora da praga do amarelinho nos laranjais. p. Por isso. considere as seguintes afirmações. O oxigênio foi dado pelo anúncio de que cientistas americanos tinham chegado ao fim do rastreamento de um dos sonhos da medicina nesta virada de século: o mapeamento do genoma humano. que se constitui em um grande passo no mapeamento de genes humanos. b) o gene correspondente à proteína B está no cromossomo 3. publicado na "Revista Época". (08) esse mapeamento já permitiu aos cientistas saberem a localização de todos os genes humanos. identifica-se mais facilmente um gene. II e III foram registradas para a presença ou ausência dos cromossomos humanos 1 até 8. e) a linhagem III contém o cromossomo 8. a Guanina e a Uracila .

O conhecimento dessa seqüência permitirá determinar a) o número de cromossomos presentes nas células humanas. (02) o melhor material biológico para um teste de DNA é aquele extraído de núcleos de glóbulos brancos do sangue.Questão 1377 A revista "Época". Sobre a utilização dos testes de DNA. aproximadamente. do genoma do parasita". "Superinteressante". "Trabalhando sem parar desde o final de 1997. anunciou em sua capa: "O DNA não falha". foi anunciada a conclusão da fase do Projeto Genoma Humano em que se determinou a seqüência de.. o teste de DNA surge como uma das grandes descobertas do mundo ocidental. eles (os pesquisadores) já decifraram 75% do código genético dessa bactéria.] a técnica só traz benefícios. A idéia é descobrir. mas outros tecidos. no ano de 1999. resultados com exatidão total. b) o número de proteínas que compõem os genes humanos. em 30/07/2001. Soma ( ) Questão 1378 Em junho de 2000. vem gerando grande polêmica. é CORRETO afirmar que: (01) os testes de DNA podem ser empregados para finalidades de investigação de paternidade e também para identificação de supostos criminosos. é um dos fatores que dificulta sua utilização em larga escala pelos segmentos populacionais menos favorecidos economicamente. contém padrões dessas marcas de uma determinada família. ainda muito elevado no Brasil. oferecem. e as implicações dessa prática para os indivíduos e a sociedade em geral. Questão 1380 O exame de paternidade tem sido muito utilizado na medicina forense. 1999. e) o número total de genes humanos e quais as proteínas codificadas por esses genes. em países como a Inglaterra. não sendo necessário obter informações do(a) filho(a) e de sua mãe. O resultado do teste. 3 bilhões de nucleotídeos do genoma humano.. como pele e ossos. d) cadeia de DNA por cadeia de RNA. Outros acreditam que reflexos da descoberta vão alterar o universo das relações familiares. (08) os exames de investigação de paternidade. não restando qualquer questionamento ou dúvida sobre os diagnósticos apresentados. para torná-lo mais preciso. O título referiu-se a uma reportagem da qual foi extraído o trecho a seguir: Depois da pílula anticoncepcional. da fertilização "in vitro" e da barriga de aluguel. é a substituição de a) seqüência de substâncias por seqüência de nucleotídeos. como em casos de estupros e assassinatos. ou seja.. do pai e dos filhos. e) seqüência de substâncias por seqüência de aminoácidos. representado a seguir. c) quantas moléculas de DNA estão presentes nos cromossomos humanos. 13(1):63. c) código genético por conjunto total de proteínas. a seqüência de substâncias que constituem os cerca de 2000 genes da cadeia de DNA. Esse teste baseia-se na identificação de marcas genéticas específicas que podem ser encontradas no DNA da mãe. uma vez que podem ser entendidos como uma violação da privacidade biológica dos indivíduos. b) código genético por seqüência de aminoácidos. até abril. com a identificação genética de criminosos e suspeitos. (04) para uma investigação de paternidade. d) o número de doenças que podem afligir a humanidade. 312 . coletam-se amostras biológicas do suposto pai. Questão 1379 O texto a seguir apresenta os resultados do projeto de estudo do genoma da 'Xylella fastidiosa'. Jan. também podem ser utilizados. a partir de testes de DNA. (adaptado) Uma modificação que poderia ser feita nesse texto. (32) a criação de bancos de dados. (16) o custo do exame de DNA. que transferiu para as mulheres o controle da fertilidade. atualmente. Para muitos especialistas [. métodos que permitem a gravidez sem sexo. a partir de testes de DNA.

é obtido a) das hemácias e dos leucócitos. pelo qual se pretende seqüenciar totalmente o DNA humano. julgue os itens a seguir. julgue os itens que se seguem. b) das hemácias. foi publicada a seqüência do DNA da bactéria 'Escherichia coli.impressionam: são cerca de 4. e) dos leucócitos e das globulinas. d) dos leucócitos. c) das hemácias. c) V não pode ser filho biológico deste casal. assinale a alternativa INCORRETA: a) I é filho biológico do casal. principais células de defesa do sangue.2 milhões de moléculas de fosfato. por exemplo. e os genes que codificam proteínas são 4. mas não das hemácias. sendo apenas um passo no conhecimento de nosso genoma. 38% desses genes ainda não têm uma função conhecida. (1) O DNA da bactéria 'Escherichia coli' tem cerca de 9. não se sabe a seqüência de amionoácidos da proteína.3 Com o auxílio do texto. ou seja.576 RNAs mensageiros diferentes. nos últimos 2 anos chegaram ao fim vários seqüenciamentos do genoma de bactérias. (4) A 'Escherichia coli' pode produzir 8. o principal componente do sangue.' Os números .5. b) II não é filho deste pai. Questão 1385 Uma loja de animais mantinha para venda 4 exemplares de 'Ara ararauna' (arara azul-e-amarela) e alegava aos fiscais que os exemplares haviam nascido em cativeiro. Questão 1381 Está em andamento o projeto GENOMA. (2) A seqüência de todos os cromossomos será do mesmo tamanho. Em setembro de 1997. b) é a condição necessária para se saber o número de moléculas de RNA existentes em nosso organismo. que só foi descoberto depois da conclusão do projeto Genoma Humano em 2003. a partir de 313 om base neste resultado. e) III é irmão biológico de I. Questão 1382 Enquanto o projeto que visa seqüenciar completamente o genoma humano segue seu curso. a discriminação de pessoas. A esse respeito.6 milhões de pares de bases. c) é o que nos permitiria conhecer qual a real proporção de proteínas em relação às moléculas de DNA que possuímos. (3) Pode-se fazer estudos da evolução das bactérias. (0) Uma vez obtida a seqüência de um gene. Questão 1383 Nos exames para teste de paternidade. como.15. (1) As seqüências obtidas corresponderão exatamente ao DNA de qualquer pessoa. e) significa decifrar o código genético.288. obter a seqüência de bases nitrogenadas do DNA de todos os cromossomos de uma pessoa. Para surpresa de muitos. d) IV pode ser filho adotivo do casal. (3) O projeto GENOMA tem levantado questões éticas. quando extraído do sangue. será possível conhecer a seqüência de aminoácidos da proteína correspondente. o DNA. dos leucócitos e do plasma. comparando-se a seqüência de DNA de diferentes espécies. (2) Para 38% dos genes. (4) Todos os genes terão a mesma proporção de adenina e guanina. d) é o que foi conseguido pelos pesquisadores há alguns anos. Questão 1384 O mapeamento de toda a seqüência de nucleotídeos existente nos 23 pares de cromossomos humanos a) é o que ainda falta fazer após a conclusão do projeto Genoma Humano em 2003. 1. mas não do plasma. pelo eventual uso inadequado que se possa fazer do conhecimento obtido.

4 Os resultados obtidos indicam que podem ser filhos do casal. originando fragmentos dessa molécula. mantido pelo criador. sendo exclusivamente produtos da indústria química. c) cada uma pode originar fragmentos de DNA com tamanhos diferentes. A migração diferencial dos fragmentos forma bandas (faixas) de DNA no gel. são utilizadas enzimas de restrição na engenharia genética. Enquanto a cura de diabetes está sendo pesquisada através da engenharia genética. por exemplo).5. como a diabetes.um casal mantido em um criatório autorizado pelo IBAMA. colheu-se uma amostra de sangue de cada um dos animais e fez-se um teste para determinação de paternidade pelo método do DNA-Fingerprint. e) modificar seqüências de bases do DNA. que serão manipuladas. Questão 1386 As enzimas de restrição são as principais ferramentas bioquímicas empregadas em Engenharia Genética.15. os fiscais do IBAMA suspeitaram se esses exemplares teriam nascido em cativeiro ou se teriam sido capturados na natureza. colocado sobre um gel suporte e submetido à corrente elétrica. a) os 4 exemplares. c) apenas os exemplares fêmeas. b) apenas os exemplares machos. Questão 1388 Por sua capacidade de cortar o DNA em pontos específicos. fragmentado com enzimas específicas. d) cortar DNA onde ocorrem seqüências específicas de bases. Contudo. cortando o DNA em locais determinados. b) removem os fosfatos e as pentoses. d) são utilizadas nos atuais testes de DNA. por exemplo. no futuro. pode-se isolar um único gene de um cromossomo. Para esclarecer a questão. Questão 1387 Enzimas de restrição são fundamentais à Engenharia Genética porque permitem a) a passagem de DNA através da membrana celular. testes de laboratório utilizando a melatonina indicaram bons resultados para controlar o mal de Alzheimer. raios X. O DNA foi extraído das células por processos químicos. d) apenas os exemplares 1 e 4. Essa técnica tem por objetivo "corrigir o efeito da mutação" a) induzindo mutações nos genes responsáveis pela doença. Com relação a essas substâncias é correto afirmar que a) são altamente específicas. Fragmentos menores migram mais rapidamente em direção a um dos pólos da corrente. b) inibir a síntese de RNA a partir de DNA. ou "impressão digital de DNA". Sobre essas enzimas é INCORRETO afirmar que: a) reconhecem seqüências específicas de bases nitrogenadas. A identificação de genes responsáveis por diversas doenças. b) não existem em seres vivos. que podem ser visualizadas por tratamentos específicos (coloração. A ilustração apresenta o resultado do teste bacteriano. pode possibilitar. e) fazendo-se uso delas. o uso da terapia gênica. c) inibir a síntese de DNA a partir de RNA. b) inserindo cópias extras do alelo mutado. e) impedem a clonagem de moléculas de DNA recombinante. d) permitem somente a ligação de pedaços de DNA de um mesmo tipo celular. e) apenas os exemplares 2 e 3. 314 1. c) atuam como agentes de ligação entre DNA viral e . deixando somente as bases nitrogenadas. O padrão de bandas é exclusivo de cada indivíduo. Questão 1389 Duas doenças não infecciosas que preocupam o homem moderno são a diabetes e o mal de Alzheimer.

Questão 1392 Todas as alternativas apresentam aplicações da tecnologia do DNA recombinante nas duas últimas décadas. Os conhecimentos da área são aplicados com sucesso na produção industrial da insulina e do hormônio de crescimento. Questão 1393 A tecnologia do DNA recombinante permitiu a inserção e a expressão. e) Fragmentos de genes exógenos são inseridos no genoma das células hospedeiras por meio de plastídeos nucleares. c) auxiliar no processo de duplicação do DNA. provavelmente: a) proteger as bactérias contra os vírus bacteriófagos. c) Produção. que representa um determinado experimento. Questão 1391 As principais ferramentas empregadas na tecnologia do DNA recombinante são as enzimas de restrição.5 315 . 1.c) substituindo o alelo mutado ou adicionando uma cópia correta do alelo. em bactérias. d) O DNA endógeno é transferido para genomas hospedeiros por meio de plasmídeos mitocondriais. que têm a propriedade de cortar o DNA em pontos específicos. Questão 1390 A biotecnologia tornou possível a transferência de material genético entre os mais diversos organismos. EXCETO a) Produção de parasitas das pragas b) Extração de inseticidas naturais c) Criação de comensais das pragas d) Produção de machos estéreis das pragas Questão 1395 Analise a figura a seguir. Todas as alternativas apresentam resultados esperados do êxito dessa técnica. b) Recuperação de espécies extintas.15. b) O genoma exógeno é inserido no núcleo hospedeiro por meio de vetores protéicos conhecidos como plasmídeos. do gene humano responsável pela síntese da insulina. em bactérias. d) produzindo proteínas funcionais em organismos de outra espécie. EXCETO a) Investigação de paternidade e criminalística. e) inibindo a expressão do gene mutado nas células secretoras da proteína. b) reparar o DNA bacteriano que sofreu mutação deletéria.5. estão sendo implantadas "biofábricas" de controle de pragas no Nordeste do Brasil. d) auxiliar no processo de transcrição do mRNA. que são administrados a pacientes de todo o planeta. O papel biológico dessas enzimas bacterianas na natureza é. d) Terapia gênica de algumas doenças hereditárias. de proteínas humanas de interesse médico. Essas "biofábricas" podem adotar todas as seguintes tecnologias. e) auxiliar no processo de tradução do DNA. Sobre a produção de organismos geneticamente modificados. é correto afirmar: a) Fragmentos de DNA exógeno são inseridos no genoma de células hospedeiras por meio de plasmídeos. c) O DNA gênico endógeno é inserido no núcleo de células hospedeiras por meio de plastídeos funcionais. EXCETO a) Independência de pâncreas de animais para produção de insulina b) Obtenção de uma nova espécie de bactéria produtora de insulina humana c) Possibilidade de expressão em bactérias de outros genes de interesse médico d) Possibilidade de tratamento para pacientes com intolerância à insulina animal Questão 1394 Para minimizar o uso de inseticidas sintéticos na fruticultura e atender às normas de segurança alimentar da FAO ("Food and Agriculture Organization").

Questão 1396 A manipulação genética de microorganismos. c) DNA recombinante. a forma de atuação dessas enzimas. separando-o sempre em nucleotídeos individuais. ( ) se duas diferentes moléculas de DNA forem cortadas por uma mesma enzima de restrição serão produzidos iguais conjuntos de fragmentos. ( ) promove-se o corte de moléculas de DNA com o uso de enzimas que reconhecem seqüências nucleotídicas específicas no DNA. a extração e o rompimento de (2). plasmídio e enzima ligase. como as enzimas bacterianas.) Produção de DNA recombinante (plasmídio de uma bactéria/ gene do vaga-lume) 2) Introdução do DNA em célula de tabaco 3) Multiplicação da célula de tabaco com o gene do vaga-lume 4) Desenvolvimento de uma planta de tabaco com o gene do vaga-lume (planta que fluoresce) O experimento ilustrado é: a) produção de transgênicos. ( ) a tecnologia do DNA recombinante (ou Engenharia Genética) fundamenta-se na fusão de "trechos" de DNA de diferentes organismos para a construção de DNA híbrido. e) amniocentese. através de cortes com exonucleases. b) hibridação intraespecífica. dispersas no citoplasma bacteriano e que têm replicação independente do cromossomo. RNA plasmidial e enzima transcriptase reversa. 316 . Com relação a esse tema. c) aconselhamento genético. diferentes etapas são cumpridas em laboratório. b) enzima transcriptase reversa.5. d) eletroforese. Questão 1398 O Projeto genoma humano tem como objetivo determinar a seqüência de bases de todos os genes de nossa espécie. com genes de interesse. d) A utilização de enzimas de restrição permite cortar o DNA nos locais onde reconhecem o ácido fosfórico. e) enzima de restrição. d) enzima transcriptase reversa. plasmídio e enzima de restrição. 2 e 3 indicam. como a transcriptase reversa. respectivamente: 1. Questão 1399 Pedro estava doente e perdeu uma semana de aulas. RNA plasmidial e enzima exonuclease. Cada colega lembrou um aspecto das aulas. Isto pode ser feito graças ao instrumental bioquímico da engenharia genética disponível nos dias de hoje. conhecidas como enzimas de restrição. a) As enzimas de restrição cortam o DNA apenas nos locais onde existem certas seqüências de bases nitrogenadas.15. Os números 1. e) As enzimas de restrição quebram o DNA.5 a) enzima de restrição. Assinale a alternativa que apresenta. entre as quais: a utilização de enzima do tipo (1). para o corte e a separação do segmento de DNA a ser estudado. e a inclusão em (2) do segmento obtido (gene isolado) com o auxílio de enzimas do tipo (3). já possibilitou a obtenção de resultados benéficos para a medicina e para outras áreas do conhecimento. c) A utilização das enzimas de restrição permite separar moléculas de DNA de acordo com seu tamanho e carga elétrica. Questão 1397 Para um pesquisador transferir um gene de interesse. principalmente a manipulação de bactérias. soube pelos colegas que o assunto trabalhado fora Biotecnologia. b) As enzimas de restrição cortam o DNA nos locais onde reconhecem o açúcar desoxirribose. cromossomo circular e enzima de restrição. Preocupado com os conteúdos da disciplina de Biologia. corretamente. ( ) são obtidos segmentos de DNA. é verdadeiro afirmar que: ( ) são utilizadas pequenas porções circulares de DNA.

Ao voltar à escola. ... Indivíduos submetidos a hemodiálises são injetados com essa proteína e apresentam sua . em 1988. reduzida.15. atuando sobre a medula óssea vermelha..... 2.. DNA recombinante e organismo transgênico. . julgue os itens abaixo. b) DNA recombinante.. d) apenas as afirmações de Rafael e Joana. . Questão 1400 Assinale a alternativa que preenche corretamente as lacunas do parágrafo a seguir.. está a produção de . as enzimas de restrição são aquelas que podem cortar o DNA em pontos determinados...De acordo com MARIANA. b) apenas as afirmações de Mariana. um dos mais significativos produtos do avanço científico nacional na área da engenharia genética. deu início aos trabalhos.. . 1. estimula a divisão de células-tronco. Ao grupo da UnB coube a parte de Biologia Molecular. plasmídeos são utilizados como vetores para a clonagem de genes. vetor.5 om relação ao processo de clonagem gênica esquematizado acima. DNA recombinante.. vetor.. plasmídio e transgene...EDUARDO lembrou que a identidade genética individual pode ser estabelecida pela técnica DNA 'fingerprint'. que utiliza DNA codificante.RAFAEL definiu proteoma como o conjunto de proteínas expressas pelo genoma.7(com adaptações).. c) DNA.. clone e vetor.. a) eritropoietina . Informe PADCT/Ministério da Ciência e Tecnologia. c) apenas as afirmações de Eduardo e Joana. p.. inicia em 1999 a comercialização do produto.diabetes c) plasmina . Entre os importantes avanços conquistados pela tecnologia do DNA recombinante..anemia b) insulina .. os números 1.JOANA relatou que vacinas genéticas são usadas para inocular nas pessoas microorganismos vivos transgênicos ou atenuados. uma das quatro empresas em todo o mundo e a única no hemisfério sul a deter a tecnologia de produção desta insulina.. ou impressão digital genética. Esta conquista tecnológica permitirá o desenvolvimento de outros medicamentos. .coagulação d) fator VIII . respectivamente. vetor e plasmídio. está prestes a chegar ao mercado com o nome de Biohulin: a empresa BIOBRÁS. o interferon e a calcitonina.. desenvolvendo clones de bactérias produtoras de insulina.5. Questão 1402 CHEGA AO MERCADO UM NOVO FÁRMACO INTEIRAMENTE DESENVOLVIDO NO PAÍS A insulina humana recombinante (IH-r). a) DNA recombinante.. Com o auxílio do texto. como o hormônio de crescimento. d) DNA transgênico.leucocitose e) hormônio de crescimento . Uma parceria entre a BIOBRÁS e a Universidade de Brasília (UnB). e) as afirmações de todos os colegas.. em um plasmídio de bactéria..Segundo LAURA.. para fins terapêuticos. que. plasmídio.esterilidade Questão 1401 A figura a seguir representa de forma esquemática o processo de clonagem de genes do "Mycobacterium tuberculosis". Os rins produzem esse hormônio. 3 e 4 representam. Laura e Rafael. jan/99.. (1) As técnicas de engenharia genética permitem a 317 . na ordem em que aparecem. Pedro conversou com a professora e constatou que estavam corretas a) apenas as afirmações de Eduardo. Mariana e Laura.

as células-tronco terão necessariamente que alterar a) o número de cromossomos. o "autotransplante".htm) Enquanto as demais células do organismo só podem fazer parte de um tecido específico. e) a estrutura de genes específicos por mutações. ela deve receber altas doses dessa proteína. c) a quantidade de genes mitocondriais. d) o padrão de atividade dos genes. Assinale a alternativa que aponta uma limitação do uso de célula-tronco para "possível e futura" cura de doenças genéticas.recombinação de genes entre organismos totalmente diferentes. que mostra a diferenciação de células-tronco humanas nos elementos figurados indicados. b) As células-filhas geradas são cromossomicamente e geneticamente iguais à célula-mãe inclusive no caso de haver gene "defeituoso". Questão 1406 Observe o esquema. Por essa razão seu uso para a cura de doenças é bastante promissor. portanto. Questão 1403 A expectativa em torno da utilização das células-tronco decorre do fato de estas células a) incorporarem o genoma do tecido hospedeiro. segundo a Comissão Técnica Nacional de Biotecnologia (CTNBio).com. d) fundirem-se com o tecido hospedeiro.6 318 . provoca mutações e malformações. Para que ocorra tal diferenciação. Por reprodução ela gera células. pode ser obtido o hormônio de crescimento. prática que. a) As células-filhas geradas por ela são cromossomicamente e geneticamente diferentes da célula-mãe originando. b) eliminarem os genes causadores da doença no tecido hospedeiro. Questão 1404 Células-tronco são células indiferenciadas que têm a capacidade de se diferenciar em diversos tipos celulares. qualquer que seja a sua origem. eliminando as possibilidades de rejeição imunológica. a "célula-tronco" tem a capacidade especial de se diferenciar e constituir diferentes tecidos no organismo. sugere uma melhora aparente do quadro clínico em pacientes com insuficiência cardíaca. d) A célula-tronco só pode ser obtida por clonagem terapêutica. cromossomicamente e geneticamente. a não ser nas doenças genéticas. e) O Brasil não tem cientistas especializados para a realização desse tipo de pesquisa. (3) O Biohulin será um medicamento destinado ao tratamento de diabéticos. Questão 1405 Segundo a doutora Mayana Zats (USP) um estudo recente com células-tronco retiradas da medula e injetadas no coração da própria pessoa. tecidos diferentes daquele que se deseja.5. idênticas a si mesma.br/educando/noticias/2004/mai/10/ 69. c) alterarem a constituição genética do tecido hospedeiro. (2) Para que uma bactéria passe a produzir insulina humana.estadao. c) No Brasil não há permissão para o desenvolvimento de pesquisas com célula-tronco. (adaptado de http://www. e) sofrerem diferenciação que as torna parte integrante e funcional do tecido hospedeiro. 1. (4) A partir da insulina produzida por bactérias. b) a quantidade de genes nucleares.15.

com os epitélios intestinais e especialmente com o sangue. d) Apenas 2 das células diferenciadas apresentam núcleo. considere as afirmativas a seguir. Existe um aumento gradual da capacidade de auto-renovação das células durante este processo. à medida que se diferenciam. Isso acontece com a pele. d) são pouco especializadas. Questão 1408 A pesquisa com células tronco tem-se tornado de grande importância para recuperação de órgãos lesionados que não têm capacidade de regeneração de suas células. assinale a afirmativa INCORRETA.15. c) têm algo grau de especialização. que tem suas células destruídas e renovadas constantemente. I. c) Plaquetas e hemáceas não apresentam capacidade de proliferação mitótica.Assinale a afirmativa INCORRETA. e) não se reproduzem com facilidade. II. b) A capacidade de diferenciação das células precursoras se deve à alteração na expressão gênica específica. As células-tronco podem ser retiradas. existem células-tronco capazes de dar origem a células diferenciadas de todos os tecidos humanos. III. b) Pelo menos 3 tipos de células diferenciadas no esquema dado são encontradas no sangue. vão reduzindo sua potencialidade. d) Na medula óssea de um adulto. Questão 1409 Alguns tecidos do organismo humano adulto se regeneram constantemente por meio de um processo complexo e finamente regulado. Fonte: "O Estado de São Paulo". Baseado nas informações anteriores e nos conhecimentos sobre o tema. IV Questão 1410 Experimentos recentes indicam que células-tronco retiradas da medula óssea de um indivíduo adulto. As células tronco têm grande poder de regeneração porque: a) têm todos os seus genes funcionando. b) todos os seus genes estão desligados. As diferentes linhagens hematopoéticas geradas no sistema apresentam altas taxas de proliferação. de embriões em sua fase 319 . também.6 Um jovem biólogo de São Paulo descobriu porque as células-tronco do cordão umbilical são mais eficientes em transplantes do que as da medula óssea. A hematopoese resulta da diferenciação e da proliferação simultânea de células tronco que. Questão 1407 BIÓLOGO MAPEIA GENES DO CORDÃO UMBILICAL. portador de lesão no miocárdio.5. Ele deseja descobrir maneiras de manipular os genes para obter melhores resultados terapêuticos ou estimular a formação artificial de tecidos. puderam formar tecido normal quando implantadas na região lesada do coração. e III e) II. III. Células tronco hematopoéticas apresentam potencial para diferenciar-se em qualquer célula do sangue e também gerar outras células tronco. Ele encontrou um grupo de genes que seguem um mesmo mecanismo e são mais ativos em células do cordão. 14/02/2006 Sobre esse assunto. como mostra o esquema a seguir: 1. a) A célula-tronco é pluripotente com capacidade de se diferenciar em diversos tipos celulares. IV. em cordões umbilicais e também em diversos tecidos no indivíduo adulto. a) Células-tronco são células capazes de se diferenciar dando origem a diversos tipos de células. A alternativa que contém todas as afirmativas corretas é: a) I e II b) I e IV c) III e IV d) I. c) Células-tronco podem ser encontradas em embriões. II.

da raça Afgham.6 Considerando o uso terapêutico das células-tronco. isto é. Sobre essas células.adulta b) adulta . II e III. eram os idosos que apresentavam uma expressiva redução na taxa de hemoglobina. a alternativa que indica o tipo de célula que possui a característica mais vantajosa para as variáveis I. I .A clonagem de células-tronco embrionárias pode ser utilizada com fins terapêuticos ou reprodutivos.uma célula-tronco deve ter o poder de se renovar indefinidamente pela divisão celular. e) I. casos incomuns de anemia começaram a chamar a atenção dos pesquisadores.adulta . Paulo". II . ("Folha de S. b) II. considere as seguintes afirmações. III. podemos afirmar corretamente que: a) é possível obter células-tronco embrionárias usando-se células diferenciadas de um adulto. Considerando hipóteses plausíveis.embrionária . Quais estão corretas? a) Apenas I.) A partir do texto e do que se conhece sobre clonagem. Questão 1412 Há vinte anos. II e III. A tabela a seguir informa as características de algumas variáveis analisadas em células-tronco embrionárias e adultas. e) I. Questão 1413 Cientistas sul-coreanos clonam pela primeira vez um cachorro. apenas.inicial de desenvolvimento. O animal clonado. II.adulta . A origem do problema estava na produção de glóbulos vermelhos a partir de células-tronco da medula óssea.embrionária . Mais intrigante: a anemia dos idosos não cedia ao tratamento convencional. e nasceu 60 dias após. estão corretas: a) I. d) Apenas II e III. como habitualmente. 03. c) Apenas I e II. I. 320 1. da raça Labrador. apenas.As células-tronco retêm o potencial de dar origem a células-filhas mais especializadas. . d) I e II. apenas. respectivamente.embrionária d) embrionária .08. A origem do problema estava na produção de glóbulos vermelhos pela medula espinhal. é possível obter um outro clone que seja fêmea. foi promulgada a Lei de Biossegurança. c) o clone gerado terá o genótipo Afgham e o fenótipo Labrador e será do sexo masculino. Ao invés de adultos jovens. b) usando o mesmo pai genético. II e III.5.15.2005. utilizando uma célula obtida da orelha do pai genético. apenas. III .embrionária Questão 1411 Em março de 2005. aquelas possíveis de serem aceitas pela comunidade científica. A origem do problema estava relacionada à degeneração do baço.adulta c) embrionária . c) III. Os cientistas tiraram material genético da célula e o colocaram em um óvulo esvaziado do seu núcleo. que autoriza a pesquisa com células-tronco obtidas a partir de embriões humanos remanescentes de tratamentos de infertilidade armazenados por pelo menos três anos. é : a) embrionária . que nesses idosos deixou de produzir glóbulos vermelhos. b) Apenas II. Analise as hipóteses apresentadas pelos cientistas para tentar explicar esses casos incomuns. recebeu o nome de Snuppy . posteriormente estimulado para que se dividisse e virasse um embrião dentro da mãe adotiva.

Com o tratamento. pesquisadores brasileiros da FIOCRUZ foram pioneiros em utilizar células-tronco da medula óssea de um paciente que apresentava insuficiência cardíaca devido a uma doença parasitária. usados como fonte na síntese 321 . vitaminas e sais minerais. considere as proposições: 1 . podendo haver gangrena.d) o núcleo do óvulo inserido em uma célula de orelha anucleada origina uma fêmea Labrador. gorduras. d) Lavar. 3 e 4 Questão 1417 Uma planta feminina de angiosperma com genótipo PP foi cruzada com uma masculina pp. bife e salada" está sendo substituído por comidas industrializadas e com alto teor calórico. a) PP e pp b) Pp e Pp c) Pp e PPP d) Pp e PPp e) PP e Ppp Questão 1418 Os meios de comunicação têm noticiado. A ingestão de proteínas é importante. 2 e 4 c) 3 e 4 d) 1 e 4 e) 2. Dentre estes um dos mais temíveis e agressivos do gênero é a cobra surucucu. Os órgãos envolvidos com a saúde pública têm mostrado preocupação constante com a dieta do povo brasileiro. como proteínas. pois elas serão degradadas em aminoácidos. As proposições que estão corretas são as indicadas por: a) 2 e 3 b) 1. carboidratos. b) Lavar as mãos com sabão antes das refeições e ao deixar o sanitário. I. arroz. as lesões coronarianas reduziram-se a um nível mínimo. pois o tradicional prato de "feijão. Questão 1414 A cólera é uma doença infecciosa causada por uma bactéria descoberta em 1884. especialmente no caso de se utilizar torniquetes. Recentemente. frutas. Com relação à surucucu.O princípio ativo do seu veneno provoca intensa dor no local da inoculação. e) o ambiente celular do Labrador alterou a expressão genotípica do núcleo transplantado. assinale aquela que NÃO é medida de prevenção desta doença. Estima-se que o consumo de feijão e de arroz caiu em torno de 30% nos últimos anos. legumes e verduras antes de comê-los. 2 . a) Beber somente água filtrada ou fervida. d) doença de Chagas. A doença parasitária a que esse texto se refere é a a) amebíase. Essa bactéria ataca o intestino humano fazendo com que o organismo elimine grande quantidade de água e sais minerais. e) Evitar comer alimentos crus. O prato tradicionalmente consumido pelo brasileiro apresenta elementos essenciais ao metabolismo. considere as afirmativas a seguir. muito bem. Questão 1415 Células-tronco vêm sendo utilizadas com sucesso para amenizar os sintomas de pacientes com insuficiência cardíaca devida a infarto do miocárdio.Pertence ao gênero Crotalus e seu veneno tem ação neurotóxica e homolítica. 3 . c) doença do sono. e) febre amarela. que posteriormente recebeu o nome de 'Vibrio cholerae'. causando desidratação. As sementes resultantes devem apresentar embrião e endosperma. freqüentemente. 4 .Pertence ao gênero Bothrops e seu veneno tem potente ação neurotóxica e coagulante. Questão 1416 Um sério risco a que está exposto o trabalhador rural em nosso país é o de acidentes com animais peçonhentos. respectivamente. e com água limpa.Seu veneno tem ação proteolítica e coagulante e o antiofídico específico é o soro antibotrópico. II. principalmente verduras e peixes. Com base no texto e nos conhecimentos sobre o tema. c) Tomar vacina tríplice periodicamente. b) malária. Dentre as alternativas a seguir. que o Brasil está se tornando um país de obesos.

III . Questão 1422 A hemofilia se caracteriza por ser uma doença: a) adquirida. que ficou tetraplégico em 1995 ao cair de um cavalo.A utilização do colar cervical não evita lesões no sistema nervoso periférico. Questão 1421 Em outubro de 2004 faleceu o ator cinematográfico Christopher Reeve. d) congênita. Os carboidratos e lipídios da dieta são fonte importante de energia para os organismos. b) I e IV. de onde são retiradas células da massa celular interna (células tronco) que têm capacidade de regenerar órgãos lesados. já que foram diferenciadas em outra pessoa. c) infecciosa. boa parte da energia gasta para a sua síntese. que causa problemas de coagulação sanguínea. II e III. e) II. IV. e) podem dar origem a todos os diferentes tipos de células sangüíneas. III e IV. 322 . que causa problemas de coagulação sanguínea. porque no interior da coluna vertebral está a medula óssea vermelha. a) I e II são corretas. ingerem os leucócitos em excesso. b) hereditária. d) o pâncreas. d) Apenas III e correta. Questão 1419 Após um traumatismo. II . b) I e III são corretas. Recuperou-se e passou a viver normalmente. após um acidente. d) podem dar origem a linfócitos T que. apenas no sistema nervoso central. c) a hipófise. era um ativista a favor das pesquisas com clonagem terapêutica para obtenção de células tronco. o acidentado deve ser imobilizado na horizontal e utilizar um colar cervical para ser transportado até um hospital. na forma de energia química. b) não serão afetadas pela doença. que causa má formação dos ossos. d) I. se houver comprometimento no sistema nervoso central. A parte retirada era a) o fígado. Tal procedimento fundamenta-se no fato de que essas células-tronco a) podem ser usadas para a clonagem de células sadias do paciente. O sistema nervoso periférico poderá ficar inativo. e) o baço.A clonagem terapêutica por transferência nuclear permite a obtenção de blastocistos. c) secretam substâncias que inibem o crescimento celular. e) contagiosa. c) II e IV. Com relação ao assunto abordado. analise as afirmativas a seguir. cujo sintoma é o excesso de açúcar no sangue e a falta de insulina. b) o diafragma.Após um acidente como o ocorrido com Reeve. Estão corretas apenas as afirmativas: a) I e III. c) II e III são corretas. Reeve. razão pela qual questiona-se o consumo de alimentos transgênicos. Os ácidos nucléicos ingeridos são incorporados ao DNA do organismo. se houver suspeita de lesão na coluna vertebral. pois essas moléculas preservam. Marque a alternativa correta. um paciente teve que se submeter a uma cirurgia que removeu uma parte do seu corpo. causada por um vírus e transmitida por mosquitos. I . III. Questão 1420 O tratamento da leucemia por meio dos transplantes de medula óssea tem por princípio a transferência de células-tronco da medula de um indivíduo sadio para o indivíduo afetado. cuja lesão pode levar à paralisia. que ficou famoso por interpretar o "Super-Homem". por sua vez.das proteínas codificadas pelo organismo.

d) consumo de energia e renovação contínua da matéria. comprovou-se que a determinação do sexo decorre de uma constituição cromossômica específica. Questão 1424 Embora a continuidade da vida na Terra dependa substancialmente de todo o elenco de características que definem os sistemas viventes. c) O tecido conjuntivo. d) O embrião XX desenvolverá testículos e o embrião XY desenvolverá ovários. processo que engloba bactérias invasoras. b) Os cromossomos autossômicos são os responsáveis pela determinação do sexo genético do indivíduo. pois envolve um grupo de células especializadas. a) Os neutrófilos são glóbulos brancos capazes de atravessar as paredes dos capilares sangüíneos. após a meiose. d) Os glóbulos brancos que saem dos capilares podem realizar fagocitose. Essa escolha é importante para estes casais uma vez que a constatação de um feto do sexo feminino pode provocar a decisão de um aborto não-natural. Questão 1425 Desde a época de Aristóteles. como ocorre na China. A partir dos estudos sobre herança mendeliana. especula-se sobre os mecanismos envolvidos na determinação do sexo dos humanos. b) A destruição de bactérias que invadem o tecido conjuntivo depende de moléculas enzimáticas produzidas pelos glóbulos vermelhos. ( ) O exame de urina da mãe é uma técnica usada na identificação do sexo do futuro bebê. a de defesa contra microrganismos é realmente notável. de forma esquemática. porque detecta as células fetais existentes no líquido amniótico e na placenta. A figura a seguir mostra. ( ) Na espécie humana o sexo da prole é determinado pelo pai. e) capacidade de reprodução e hereditariedade.10. pode apresentar um quadro inflamatório. Questão 1426 Atualmente muitos casais têm-se interessado em escolher o sexo do futuro filho. Com base nos conhecimentos sobre o tema. invadido por células sangüíneas e bactérias. que determinam uma maior longevidade para o indivíduo. c) manutenção da homeostase e alto nível de individualidade. b) elevado grau de organização e execução das funções vitais. que apresenta os cromossomos sexuais X e Y no núcleo de suas células germinativas. divisão celular e comportamento dos cromossomos na meiose. e) O sexo genético é determinado pelo número de cromossomos X presentes no embrião. estes são distribuídos entre os espermatozóides. duas dessas características assumem maior importância para a preservação da vida no planeta. Acreditava-se que o sexo do embrião era definido por fatores como a nutrição materna. . é correto afirmar: a) O sexo genético é determinado na fecundação. São elas: a) composição química complexa e estado coloidal. onde os pais muitas vezes optam pelo nascimento de um único filho do sexo masculino. Nesse sentido.11 ssinale a afirmativa INCORRETA. um modo como essas células do sangue podem realizar seu papel de defesa. analise as afirmativas adiante: ( ) A opção por indivíduos do sexo masculino pode ser justificada por sua menor suscetibilidade a doenças genéticas e por apresentarem um par de genes localizados nos cromossomos X e Y. c) A probabilidade de o genitor masculino produzir gametas do tipo Y é maior que a do tipo X. identificando a presença do cromossomo sexual por meio da análise do citoplasma.Questão 1423 O sangue pode realizar várias funções no nosso corpo. Dentre elas. ( ) A tentativa de aborto por meio da ingestão de poções 323 1. quando ocorre a fusão dos núcleos masculino e feminino.

v. d) do teste do DNA. são as do gênero 'Saccharomyces'. na fabricação tanto de pães quanto de vinhos. no 195.vegetais ou de outras drogas abortivas pode não eliminar o feto. Em todos esses casos o 'trabalho' é feito por uma levedura (um tipo de fungo). As leveduras mais usadas hoje. b) de células-tronco. Esta vacina consiste do antígeno de superfície do vírus da hepatite B produzido em células de levedura.62) Atualmente as leveduras têm sido usadas para produzir vacinas. como contra a hepatite B. mas promover a má-formação do corpo do bebê e comprometer a saúde da mãe. c) do DNA recombinante. Isto só é possível graças à tecnologia a) de clonagem de organismos. (Adaptado de Anita D. p. em um processo usado há milênios pela humanidade para obter alimento e prazer. 324 . e) do RNA in vitro. Um suco de uva transforma-se em vinho e um repelente mingau de cevada e centeio torna-se uísque ou cerveja. Panek. Ciência Hoje.33. Questão 1427 A levedação do pão e a fermentação alcoólica são as primeiras tecnologias de que se têm notícia. julho de 2003.

Sign up to vote on this title
UsefulNot useful