Você está na página 1de 324

Ttulo: A maior lista de gentica da histria!

Professor: Andr Braga Turma: AeB


Questo 1 O texto que se segue foi extrado de "Xadrez, truco e outras guerras", de Jos Roberto Torero. Servimos-nos de algumas de suas estruturas para introduzir a(s) questo(es) seguintes. "Os abutres, sbios animais que se alimentavam do mais farto dos pastos, j comeavam a sobrevoar a ala dos estropiados quando o General mandou que acampassem. Naquela tarde assaram trinta bois, quantidade nfima para abastecer os homens que ainda sobravam.... O plano dos comandantes era assaltar fazendas da regio e tomar-lhes o gado... noite a rao foi ainda mais escassa, e, para enganar a fome, fizeram-se fogueiras para assar as ltimas batatas e umas poucas razes colhidas pelo caminho. Como o frio tambm aumentava, surgiu um impasse: quem ficaria perto do fogo: os colricos, que logo morreriam, ou os sos, que precisavam recuperar as foras para a luta?" (TORERO, J. Roberto. "Xadrez, truco e outras guerras") "(...) os colricos, que logo morreriam, ou os sos, que precisavam recuperar as foras para a luta?" Muitas doenas podem provocar a morte. a) A afirmao "os colricos, que logo morreriam" falsa ou verdadeira? Justifique. b) Justifique e exemplifique: Muitas doenas so hereditrias e sua manifestao est na dependncia da ao de genes especficos ou de alteraes cromossmicas. Questo 2 O texto abaixo refere-se s questes: 2 a 3 O experimento clssico de Meselson e Stahl, em 1957, demonstrou que a replicao do DNA era semiconservativa, ou seja, cada fita do DNA serve de molde para sua prpria duplicao, formando molculas de DNA idnticas original. Nesse experimento, os cientistas cultivaram clulas de 'Escherichia coli' inicialmente em presena de fonte de N (istopo de nitrognio leve), trocando, a seguir, por N (istopo pesado), que incorporado s bases nitrogenadas do DNA. Colheram, ento, amostras de DNA aps a primeira e a segunda geraes de clulas crescidas em N e analisaram essas amostras quanto densidade do DNA formado. Considere como PESADO o DNA dupla hlice marcado com N; como LEVE o marcado com N; como INTERMEDIRIO o marcado com N e N. Justifique por que, aps a troca da fonte de nitrognio, a primeira gerao de clulas foi totalmente constituda com DNA dupla hlice do tipo INTERMEDIRIO. Questo 3 Calcule as propores dos trs tipos de DNA dupla hlice LEVE, INTERMEDIRIO E PESADO - formados em clulas da segunda gerao, aps a troca da fonte de nitrognio. Questo 4 "O agronegcio responde por um tero do PIB, 42% das exportaes e 37% dos empregos. Com clima privilegiado, solo frtil, disponibilidade de gua, rica biodiversidade e mo-de-obra qualificada, o Brasil capaz de colher at duas safras anuais de gros. As palavras so do Ministrio da Agricultura e correspondem aos fatos. Essa , no entanto, apenas metade da histria. H uma srie de questes pouco debatidas: Como se distribui a riqueza gerada no campo? Que impactos o agronegcio causa na sociedade, na forma de desemprego, concentrao de renda e poder, xodo rural, contaminao da gua e do solo e destruio de biomas? Quanto tempo essa bonana vai durar, tendo em vista a exausto dos recursos naturais? O descuido socioambiental vai servir de argumento para a criao de barreiras no-tarifrias, como a que vivemos com a China na questo da soja contaminada por agrotxicos?" (Adaptado de Amlia Safatle e Flvia Pardini, Gros na Balana. "Carta Capital", 01/09/2004, p. 42.) A contaminao por agrotxicos tambm mencionada no texto. A aplicao intensiva de agrotxicos a partir da dcada de 1940 aumentou a produtividade na agricultura. Atualmente, so produzidas e cultivadas plantas
1

transgnicas, isto , geneticamente modificadas para serem resistentes ao de insetos. Um exemplo conhecido o milho geneticamente modificado com um gene da bactria 'Bacillus thuringensis' (Bt), o que lhe confere resistncia a ataques de insetos. Contudo, alguns pesquisadores tm observado que diferentes espcies de insetos adquirem resistncia s toxinas bioinseticidas produzidas por essas plantas. a) Explique como os insetos se tornam resistentes. b) Sabe-se que a aplicao intensiva de agrotxicos, como o DDT, pode afetar a cadeia alimentar tanto de ambientes aquticos como de solos. Explique por que isso ocorre. Questo 5 Atualmente, um grande esforo tem sido feito por diversos centros de pesquisa e de tratamento de pessoas queimadas para produzir grandes reas de pele, do prprio indivduo, que possam recobrir imediatamente reas destrudas. Explique a vantagem de se utilizar a pele do prprio indivduo para recobrir as reas destrudas, ao invs de serem utilizados enxertos de pele de outras pessoas. Questo 6 O desenho a seguir mostra a sntese de um polipeptdio a partir da molcula de DNA num certo organismo. Esse organismo um procarioto ou um eucarioto? Por qu?

b) A clonagem de bactrias, comparada clonagem de animais, um processo mais complexo ou mais simples? Justifique. Questo 8 O grfico a seguir demonstra a distribuio citoplasmtica do nmero de ribossomas isolados e polirribossomas, em comparao com o nmero de cadeias polipeptdicas em formao durante um certo perodo de tempo.

1.1.3.2

(Adaptado de ALBERTS, Bruce & outros. "Molecular biology of the cell". New York, Garland Publishing, 1994, p.239) a) Defina a relao existente entre os ribossomas isolados e a formao das cadeias polipeptdicas. Justifique sua resposta. b) Descreva a estrutura das cadeias polipeptdicas e a dos polirribossomas. Questo 9

1.1.1.2 Um certo tipo de macromolcula destinada membrana plasmtica celular, depende de etapas nucleares e citoplasmticas para sua produo, de acordo com os percursos esquematizados a seguir:

Questo 7 Nas bactrias, a cadeia respiratria encontra-se associada membrana plasmtica e os cidos nuclicos esto associados ao citoplasma. a) assim tambm em um protista, em um animal e em um vegetal? Justifique.
2

Questo 12 Ribossomos so formados por RNA e protenas, sintetizados pelos processos de transcrio e traduo, respectivamente. a) Onde esses processos ocorrem na clula eucaritica? b) O que acontecer com os processos de transcrio e traduo, se ocorrer uma inativao na Regio Organizadora do Nuclolo? Justifique. Questo 13 a) Por que essas etapas comeam no ncleo? b) Qual a composio da macromolcula ao final do percurso I? E do percurso II? Esclarea a diferena, baseando-se nas funes das organelas citoplasmticas envolvidas em cada percurso. Questo 10 Uma espcie de lombriga de cavalo possui apenas um par de cromossomos no zigoto (2n=2). Um macho dessa espcie, heterozigtico quanto a dois pares de alelos (Aa Bb) formou, ao final da gametognese, quatro tipos de espermatozides normais com diferentes gentipos quanto a esses genes. a) Qual o nmero de cromossomos e o nmero de molculas de DNA no ncleo de cada espermatozide? b) Quais so os gentipos dos espermatozides formados? c) Por que, a partir das informaes fornecidas, no possvel estimar a proporo em que cada um dos quatro tipos de espermatozides aparece? Explique. Questo 11 Uma mulher com a idade de 40 anos est grvida do primeiro filho. Ela sabe que, devido sua idade, o beb tem maior probabilidade de ser portador de alguma anomalia cromossmica. A cariotipagem pr-natal o exame mais indicado para esclarecer estas dvidas na fase uterina. Pergunta-se: a) Em que consiste este exame? b) Que exemplos de anomalias cromossmicas podem ser detectadas atravs deste exame (cite dois exemplos). Criadores e sitiantes sabem que a mula (exemplar fmea) e o burro (exemplar macho) so hbridos estreis que apresentam grande fora e resistncia. So o produto do acasalamento do jumento ('Equus asinus', 2n = 62 cromossomos) com a gua ('Equus caballus', 2n = 64 cromossomos). a) Quantos cromossomos tm o burro ou a mula? Justifique sua resposta. b) Considerando os eventos da meiose I para a produo de gametas, explique por que o burro e a mula so estreis. Questo 14 Considere as duas fases da meiose, de um organismo com 2n=6 cromossomos, esquematizadas a seguir e responda:

1.1.3.2

1.1.5.2

a) Que fases esto representadas na figura A e na B? Justifique. b) Que tipo de alterao aparece em uma das figuras? Em relao aos cromossomos, como sero as clulas resultantes de um processo de diviso com essa alterao? c) D um exemplo de anomalia que seja causada por este tipo de alterao na espcie humana, cujo nmero normal de cromossomos 2n = 46.

Questo 15 O gato siams um animal de rara beleza pois a pelagem de seu corpo clara com extremidades - orelhas, focinho, ps e cauda - pretas. A presena do pigmento que d a cor negra a essas extremidades o resultado da atividade de uma enzima que fica inativada acima de 34C. Explique por que esses animais tm a pelagem negra nas extremidades do corpo. Questo 16 Desde 1995 alguns estados norte-americanos esto excluindo o ensino da teoria de evoluo biolgica dos seus currculos escolares alegando, entre outras razes, que ningum estava presente quando a vida surgiu na Terra. Alguns cientistas defendem a teoria da evoluo argumentando que, se necessrio "ver para crer", ento no poderemos acreditar na existncia dos tomos, pois estes tambm no podem ser vistos. (Adaptado da "ISTO ", 25/08/1999.) a) Apresente trs evidncias que apiam a teoria da evoluo biolgica. b) A mutao gnica considerada um dos principais fatores evolutivos. Por qu? Questo 17 Dois 'loci' de uma populao, cada um com dois gens alelos, sofrem a ao da seleo natural por muitas geraes, como mostrado nas tabelas abaixo. O coeficiente de seleo (S) indica os valores com que a seleo natural atua contra o gentipo. O valor adaptativo (W) representa os valores com que a seleo natural favorece o gentipo. Note que (W+S)=1. Qual dos gens, A ou B, apresentar a maior freqncia na populao? Explique. Questo 18 No porquinho-da-ndia existe um par de genes autossmicos que determina a cor da pelagem: o alelo dominante B determina a cor preta e o recessivo b, a cor branca. Descreva um experimento que possa evidenciar se um porquinho preto homozigoto ou heterozigoto. Questo 19 Nos porquinhos-da-ndia, a pelagem negra dominante sobre a pelagem branca. Um criador tem um lote de porquinhos-da-ndia negros, com o mesmo gentipo. O que deve fazer para descobrir se esses animais so homozigotos ou heterozigotos? Justifique sua resposta. Questo 20 Uma anomalia gentica autossmica recessiva condicionada por uma alterao na seqncia do DNA. Um homem portador dessa anomalia apresenta a seqncia timina-citosina-timina enquanto sua mulher, que normal, apresenta a seqncia timina-adenina-timina. A anlise do DNA de um filho do casal mostrou que ele portador tanto da seqncia de bases do pai quanto da me. a) O filho ter a doena? Por qu? b) Qual a probabilidade de um outro filho do casal apresentar as duas seqncias iguais da me? Questo 21 Um homem afetado por uma doena gentica muito rara, de herana dominante, casa-se com uma mulher, no consangnea. Imagine que o casal tenha doze descendentes, seis filhos e seis filhas. Responda,
4

1.4.1.6

justificando sua resposta, qual ser a proporo esperada de filhas e filhos afetados pela doena do pai no caso do gene em questo estar localizado. a) em um autossomo; b) no cromossomo X. Questo 22 Em ervilhas o carter semente lisa condicionado por um gene dominante R e semente rugosa pelo seu alelo recessivo r. Quais so as propores genotpica e fenotpica obtidas na autofecundao de uma variedade comprovadamente heterozigota? Questo 23 "Hormnios so protenas cuja funo regular os complicados mecanismos do organismo - como o aumento e reduo do peso do corpo (...) Em outubro, o geneticista Jeffrey Friediman (...) isolou o primeiro hormnio capaz de controlar o peso, chamado leptina. Ele produzido por um gene que, quando funciona mal, o organismo ganha peso (...)". (In: "Superinteressante" - ano 10, n 3, mar., 1996.) Com base no texto, RESPONDA: a) Como se denomina o local que o gene ocupa no cromossomos? b) Considerando de forma simplificada a existncia de dois alelos para o gene da leptina, um normal (L) e outro mutante (L'), quantos gentipos diferentes so possveis em humanos diplides? Quais so eles? c) COMENTE sobre um mecanismo que pode levar mutao gnica. Questo 24 No incio do sculo XX, a transmisso das informaes genticas para os descendentes era explicada por algumas hipteses sobre as leis da hereditariedade, como a mendeliana e a por mistura. Observe os esquemas:

1.5.1.1

Suponha que, em um indivduo de uma populao com reproduo sexuada, aparea, por mutao, um gene raro que confira ao seu portador caractersticas vantajosas. Indique, para cada uma das hipteses representadas, se h ou no possibilidade de aumento da freqncia do gene mutante na descendncia desse indivduo e justifique suas respostas. Questo 25 Leia o texto a seguir. "A Doena de Alzheimer (D.A.) (...) uma afeco neurodegenerativa progressiva e irreversvel, que acarreta perda de memria e diversos distrbios cognitivos. Em geral, a D.A. de acometimento tardio, de incidncia ao redor de 60 anos de idade, ocorre de forma espordica, enquanto que a D.A. de acometimento precoce, de incidncia ao redor de 40 anos, mostra recorrncia familiar. (...) Cerca de um tero dos casos de D.A. apresentam familiaridade e comportam-se de acordo com um padro de herana monognica autossmica dominante. Estes casos, em geral, so de acometimento precoce e famlias extensas tm sido periodicamente estudadas." Smith, M.A.C. (Revista Brasileira de Psiquiatria, 1999) Considerando o texto e o histrico familiar a seguir, responda ao que se pede. Histrico familiar: "Um rapaz cujas duas irms mais velhas, o pai e a av paterna manifestaram Doena de Alzheimer de acometimento precoce."

b) aa x aa c) aa x Aa d) Aa x Aa e) Aa x AA 1.5.1.1 Questo 28 No gado bovino da raa Ayrshire a cor mogno determinada pelo gentipo A A e a cor vermelha pelo gentipo A A, mas o gentipo A A mogno nos machos e vermelho nas fmeas. Com base nessas informaes, qual o sexo de um filhote vermelho, cuja me uma vaca mogno? Justifique a sua resposta. Questo 29 A formao de uma caracterstica fenotpica depende, em alguns casos, apenas de fatores genticos. Em outros casos, prevalece a influncia de fatores ambientais. Na maioria das vezes h uma interao entre fatores genticos e ambientais. Um dos mtodos utilizados para avaliar a importncia relativa dos genes e dos fatores ambientais na formao de uma caracterstica o estudo comparativo entre irmos gmeos monozigticos criados juntos e criados separados. A tabela a seguir, elaborada a partir de um grande nmero de pares de gmeos, indica o grau de concordncia de quatro caractersticas. Uma concordncia significa que quando um irmo possui a caracterstica, o outro tambm a possui.

I. Montar o heredograma para o histrico familiar apresentado. II. Qual a probabilidade de o rapaz em questo tambm ser portador do gene responsvel pela forma de acometimento precoce da doena? III. Quais indivduos do heredograma so seguramente heterozigotos para esse gene? IV. Explicar o padro de herana mencionado no texto. Questo 26 Mendel no acreditava na mistura de caracteres herdados. De acordo com suas concluses, a partir dos cruzamentos realizados com ervilhas do gnero 'Pisum', as caractersticas no se misturam, permanecem separadas e so transmitidas independentemente. HENIG, Robin. "O monge no jardim". Rio de Janeiro: Rocco, 2001. a) Considerando as leis de Mendel para a hereditariedade, no momento da fecundao os cromossomos herdados dos progenitores se juntam, porm os alelos dos seus genes no se misturam. A partir dessa idia, qual fenmeno explicaria a ocorrncia de caractersticas intermedirias na prognie, que parecem ser uma mistura daquelas dos progenitores? b) Posteriormente, estudos de grupos de geneticistas indicaram que pode haver troca de material gentico entre cromossomos homlogos herdados do pai e da me. Em que etapa isso pode ocorrer e como se chama este processo? Questo 27 Determine as probabilidades de aparecerem indivduos afetados (aa), normais (AA) e heterozigotos (Aa), nas proles dos casamentos: a) aa x AA

1.5.1.1

Indique a caracterstica que mais depende de fatores ambientais. Justifique sua resposta.

Questo 30 Um pesquisador teve sucesso na integrao de uma cpia do gene que codifica o hormnio do crescimento de rato (HCR) em um dos cromossomos autossmicos de uma clula-ovo de camundongo. A clula-ovo transgnica se desenvolveu, dando origem a um camundongo macho. Este camundongo transgnico foi cruzado com uma fmea de camundongo normal, isto , no portadora do gene HCR.

1.5.1.1

1.5.1.1

Identifique se o componente gentico ou o componente ambiental que predomina no condicionamento da produtividade dessas plantas. Justifique sua resposta. Questo 32 Um determinado casal normal, mas heterozigoto para o albinismo, solicitou aconselhamento gentico sobre a possibilidade de vir a ter crianas apresentando a condio albina. Qual a probabilidade desse casal ter: a) quatro crianas albinas? b) uma criana albina e do sexo feminino? c) uma criana normal, heterozigota e do sexo masculino? d) Represente o provvel heredograma desse casal, admitindo-se que as suposies feitas nas letras (b) e (c) realmente se concretizem. Questo 33 A mamona ('Ricinus communis') produz inflorescncias contendo somente flores pistiladas (flores femininas), quando o gentipo recessivo, e inflorescncias mistas (flores femininas e flores masculinas), quando o gentipo homozigoto dominante ou heterozigoto. Com base nessas afirmaes, que tipos de inflorescncias sero produzidas nos descendentes dos seguintes cruzamentos: a) NN x Nn? b) Nn x Nn? Questo 34 Recentemente, os meios de comunicao noticiaram o caso de uma mulher norte-americana que, impossibilitada de ter filhos por anomalia no tero, teve seu vulo fertilizado "in vitro", e este foi implantado no tero de sua me. Assim, quem engravidou e deu luz foi a me da referida mulher.
7

Calcule a proporo esperada da prole destes camundongos que ser portadora do gene que codifica o HCR. Justifique sua resposta. Questo 31 Um pesquisador observou que uma certa espcie de planta apresentava uma grande variao de produtividade relacionada altitude onde a planta se desenvolvia. Em grandes altitudes, a produtividade era muito baixa; medida que a altitude se aproximava do nvel do mar, a produtividade aumentava. Ele, ento, realizou um experimento em que sementes dessa espcie, coletadas em diversas altitudes, foram plantadas ao nvel do mar em idnticas condies ambientais. Aps algum tempo, a produtividade dessas plantas foi medida e apresentou os seguintes resultados:

Responda: a) Do ponto de vista gentico, quem a me da criana? Justifique. b) Qual a porcentagem de genes herdados da parturiente que se encontram no patrimnio gentico da criana? Questo 35 Em gatos, as cores marrom e branca dos pelos tm sido descritas como devidas a, pelo menos, um par de genes. Considere o cruzamento de gatos homozigotos brancos e marrons. Qual a proporo fenotpica esperada em F se a) o modo de herana for do tipo dominante? b) o modo de herana for do tipo co-dominante? Questo 36 Suponha que voc tenha em seu jardim exemplares da mesma espcie de ervilha utilizada por Mendel em seus experimentos. Alguns desses exemplares produzem sementes lisas e outros, sementes rugosas. Sabendo que a caracterstica "lisa" das sementes da ervilha determinada por um alelo dominante L, portanto por gentipos LL ou Ll e, sabendo ainda, que as flores so hermafroditas e que sementes produzidas por autofecundao so viveis, a) planeje um cruzamento experimental entre flores de exemplares diferentes que lhe permita determinar se uma planta que produz sementes lisas homozigota ou heterozigota para esse carter. b) No caso de ocorrer autofecundao em uma planta que produz sementes lisas e heterozigota, qual seria a proporo esperada de descendentes com sementes rugosas? Questo 37 Um criador de cabras, depois de muitos anos nesse ramo, observou que alguns dos animais de sua criao apresentavam uma caracterstica incomum nos chifres. Como o criador poderia fazer para determinar se essa variao decorrente de uma mutao gentica ou de uma alterao causada por fatores ambientais? Questo 38 Em experimento feito no incio do sculo, dois pesquisadores retiraram os ovrios de uma cobaia albina e implantaram-lhe um ovrio obtido de uma cobaia preta.

Mais tarde, o animal foi cruzado com um macho albino e deu origem a uma prole toda preta. a) Sabendo-se que o albinismo caracterstica recessiva, como voc explica esse resultado? b) Indique os gentipos da fmea preta e da prole. c) Se fosse possvel implantar os plos da fmea preta na fmea albina, em vez de transplantar o ovrio, o resultado seria o mesmo? Justifique. Questo 39 Em vrias culturas vegetais, os programas de melhoramento utilizam a heterose (vigor do hbrido). Nesses programas so desenvolvidas linhagens homozigotas por meio de sucessivas geraes autofecundadas. Duas linhagens, homozigotas para alelos diferentes, so ento cruzadas e produzem os hbridos, que, em geral, so mais vigorosos e mais produtivos que os parentais. a) Esses indivduos hbridos so geneticamente iguais entre si? Explique. b) Se o agricultor utilizar as sementes produzidas pelo hbrido nos plantios subsequentes, o resultado no ser o mesmo. Por qu? Questo 40 Ao estudar a distribuio de uma espcie de planta da famlia dos girassis em altitudes crescentes na costa oeste dos Estados Unidos, pesquisadores observaram que essas plantas apresentavam um gradiente decrescente de tamanho. Sementes dessas plantas foram coletadas nas vrias altitudes e plantadas em uma mesma regio localizada ao nvel do mar. Aps um determinado tempo de crescimento, as plantas resultantes foram medidas e os dados obtidos no experimento so mostrados no grfico A. a) Explique o resultado obtido, expresso no grfico A. b) Se o resultado do experimento tivesse sido o representado no grfico B, qual seria a interpretao?

1.5.1.1

a) Formule uma hiptese consistente com os resultados obtidos para explicar a herana da forma dos frutos nessa espcie. b) Represente os alelos por letras e indique os gentipos dos indivduos parentais e dos descendentes no cruzamento IV. Questo 43 A talassemia um defeito da hemoglobina em seres humanos. Ela ocorre em duas formas, (a) talassemia menor, na qual os eritrcitos so pequenos (microcitemia) e em grande nmero (policitemia), mas a sade essencialmente normal, e (b) talassemia maior, caracterizada por uma anemia severa, aumento do bao, microcitemia e policitemia, entre outros sintomas. Essa ltima forma geralmente culmina em morte antes de atingir a idade reprodutiva. A partir do heredograma hipottico a seguir onde os smbolos claros representam pessoas normais; os hachurados, a talassemia menor e os pretos a talassemia maior, determine o modo de herana indicando os possveis gentipos dos indivduos envolvidos.

Questo 41 A herana da cor do olho na espcie humana geralmente representada simplificadamente como um par de alelos, A (dominante, determinando cor castanha) e a (recessivo, determinando cor azul). Baseando-se nessa explicao, analise as afirmaes abaixo, proferidas por casais em relao cor dos olhos de seu beb, verificando se elas tm fundamento. Justifique sua resposta. a) Afirmao de um casal de olhos azuis: "nosso beb poder ter olhos castanhos porque as avs tm olhos castanhos". b) Afirmao de um casal de olhos castanhos: "nosso beb poder ter olhos azuis porque o av paterno tem olhos azuis". Questo 42 Em uma espcie de planta a forma dos frutos pode ser alongada, oval ou redonda. Foram realizados quatro tipos de cruzamento entre plantas dessa espcie e obtidos e seguintes resultados:

1.5.1.2

Questo 44 Considere uma certa espcie de planta que pode apresentar flores com trs tipos de cor: azul, azul-claro e branca. Estas cores so determinadas por combinaes de dois alelos de um nico locus. Na expresso fenotpica de tais cores no h relao de dominncia entre os alelos, sendo que a manifestao em homozigose de um dos alelos - aa, cor branca - letal na fase adulta. Sabe-se que: - a flor de cor branca nunca se abre; - em um jardim de plantas com flores de cor azul no nascem plantas com flores de cor azul-claro.
9

1.5.1.2

a) Realizou-se o cruzamento entre as plantas com flores azul-claro e, a partir das sementes obtidas, formou-se um jardim. Determine a cor das flores que tm menor possibilidade de se abrirem neste jardim. Justifique a resposta. b) Realizaram-se os cruzamentos possveis entre as plantas com flores das cores mencionadas, presentes em igual quantidade. A partir das sementes obtidas, formou-se outro jardim. Determine a cor das flores que tm maior possibilidade de se abrirem neste jardim. Justifique a resposta. Questo 45 Em rabanetes, a forma da raiz determinada por um par de genes alelos. Os fentipos formados so trs: arredondado, ovalado ou alongado. Cruzamentos entre plantas de razes alongadas com plantas de razes arredondadas produziram apenas indivduos com razes ovaladas. Em cruzamentos desses indivduos ovalados entre si, foram obtidas quatrocentas sementes que foram plantadas em sementeiras individuais. Antes que as sementes germinassem, as sementeiras foram distribudas a diversas pessoas; voc recebeu uma delas. a) Qual a relao de dominncia entre os caracteres em questo? b) Qual a probabilidade de que, na sua sementeira, venha a se desenvolver um rabanete de raiz ovalada? Justifique a sua resposta. Questo 46 Em gado, a cor da pelagem vermelha, ruo e branca, controlada por genes codominantes, e o cruzamento de animais com chifres versus animais sem chifres, s vezes s origina prole sem chifres, e, em outros cruzamentos, aparecem os dois tipos em igual nmero. Um fazendeiro tem uma grande boiada constituda de animais vermelhos, rues, brancos e sem chifres, os quais, ocasionalmente produzem prole com chifres. Utilizando apenas cruzamentos naturais, ou seja, sem recorrer inseminao artificial, como o fazendeiro dever proceder para estabelecer uma linhagem pura de animais brancos e sem chifres? Por que ele no conseguir resolver o problema dos chifres

rapidamente? Questo 47 O grfico a seguir mostra a mortalidade de mosquitos de uma determinada espcie quando expostos a diferentes concentraes de um inseticida. A resistncia ou susceptibilidade ao inseticida devida a um locus com dois alelos, A e A.

1.5.1.2

a) Qual o gentipo mais resistente? Como voc chegou a essa concluso? b) Observando as trs curvas, que concluso se pode tirar sobre as relaes de dominncia entre os alelos deste locus? Explique. c) Os indivduos de cada um dos gentipos no se comportam da mesma forma quanto resistncia ao inseticida e, por isso, os pontos distribuem-se ao longo da curva. Essas diferenas podem ser atribudas a efeitos pleiotrpicos de outros genes? Justifique sua resposta utilizando o conceito de efeito pleiotrpico. Questo 48 A pseudo-acondroplasia um tipo de nanismo determinado geneticamente pelo alelo D autossmico dominante que interfere no crescimento dos ossos durante o desenvolvimento. A princpio, pensou-se que o fentipo ano seria expresso pelo gentipo D/D ou D/d. Entretanto, foi considerado que a severidade do alelo dominante, quando em dose dupla, produz efeito letal durante o desenvolvimento embrionrio, provocando aborto precocemente. Considere um casal de anes pseudo-acondroplsicos, para responder s seguintes questes:
10

a) Quais so os gentipos de cada indivduo do referido casal? b) Caso a mulher deste casal venha dar luz uma criana, qual a probabilidade dela nascer geneticamente com a pseudo-acondroplasia? c) Como o casal j tem trs crianas com a pseudo-acondroplasia, qual a probabilidade de, em um eventual quarto nascimento, a criana nascer tambm afetada? d) Se o casal tem planos para ter uma menina normal em relao a esta condio gentica, qual a probabilidade que se espera para este evento? e) Em uma outra famlia, com 3 meninas e 2 meninos, todos apresentando a pseudo-acondroplasia, quantas destas crianas so homozigotas no loco correspondente a este tipo de nanismo? Questo 49 Observe os cruzamentos a seguir, onde o alelo (A) condiciona a cor amarela em camundongos e dominante sobre o alelo (a), que condiciona a cor cinza. CRUZAMENTO I (Aa Aa) 240 amarelos 120 cinzas CRUZAMENTO II (Aa aa) 240 amarelos 240 cinzas Analise os resultados destes cruzamentos e responda. a) Qual cruzamento apresenta resultado de acordo com os valores esperados? b) Como voc explicaria o resultado do cruzamento em que os valores observados no esto de acordo com os valores esperados? Questo 50 Em ratos, a cor da pelagem condicionada por gene autossmico, sendo o gene C, dominante, responsvel pela colorao amarela, e seu alelo c recessivo, responsvel pela

colorao cinza. Um geneticista observou que o cruzamento de ratos de pelagem amarela com ratos de pelagem cinza resultou descendentes amarelos e cinzas em igual proporo; porm, o cruzamento de ratos amarelos entre si produziu 2/3 de descendentes de pelagem amarela e 1/3 de descendentes de pelagem cinza. a) A partir de 20 ovos, originados do cruzamento de machos amarelos e fmeas cinzas, quantas fmeas amarelas adultas so esperadas? Justifique. b) A partir de 40 ovos, originados do cruzamento entre ratos amarelos, quantos machos cinzas devero atingir a idade adulta? Justifique. Questo 51 Gatos Manx so heterozigotos para uma mutao que resulta na ausncia de cauda (ou cauda muito curta), presena de pernas traseiras grandes e um andar diferente dos outros. O cruzamento de dois gatos Manx produziu dois gatinhos Manx para cada gatinho normal de cauda longa (2:1), em vez de trs para um (3:1), como seria esperado pela gentica mendeliana. a) Qual a explicao para esse resultado? b) D os gentipos dos parentais e dos descendentes. (Utilize as letras B e b para as suas respostas). Questo 52 O heredograma a seguir representa uma famlia com pessoas afetadas por uma doena hereditria.

1.5.1.4

11

a) A doena tem herana dominante ou recessiva? Por qu? b) A doena tem herana autossmica ou ligada ao cromossomo X? Por qu? Questo 53 Analisando a genealogia adiante, responda:

anomalia?

1.5.1.4

1.5.1.4 Questo 56 A figura a seguir, adaptada da Folha de So Paulo de 17/03/96, mostra a transmisso do albinismo, de gerao, na Famlia de Raimundo e Elelde da Silva, moradores da ilha dos Lenis, situada a oeste de So Lus, onde a freqncia de albinos de 1,5 % e cinqenta vezes maior do que entre o restante da populao do Maranho.

a) Qual a probabilidade de o indivduo 3 ser heterozigoto? b) Qual a probabilidade de o indivduo 5 ser homozigoto recessivo? c) Qual a probabilidade de o indivduo 6 ser homozigoto dominante? Questo 54

1.5.1.4 No heredograma adiante o indivduo 3 afetado pelo albinismo. Sabendo-se que, na populao, a freqncia de heterozigoto para o albinismo de 1/50, qual a probabilidade de que o casal 4 5 tenha uma menina albina? Analise a figura onde se admite que a pigmentao da pele devida a um par de alelos (A,a). Os indivduos I - 1, II - 6, V - 2, V - 3 e V - 5 so albinos. Responda, ento: a) Que nome se d ao aparecimento, numa dada gerao, de uma caracterstica expressa em antepassados remotos? b) O albinismo se deve a alelo dominante ou a alelo recessivo? Explique com base na figura. c) Qual a probabilidade de os indivduos de pigmentao normal da gerao V serem todos heterozigotos? Questo 57 Questo 55 No heredograma a seguir os smbolos cheios representam indivduos portadores de uma anomalia gentica. Qual a probabilidade de o indivduo 9 ser portador dessa Nos Estados Unidos, um grupo de cientistas do "Genetics & IVF Institute" vem testando um novo mtodo que permite a seleo dos espermatozides a partir de sua colorao, de acordo com a presena ou ausncia do
12

1.5.1.4

cromossomo Y ('Microsort'). Tal mtodo, alm de satisfazer os anseios de vrios casais na escolha do sexo do filho, poder ser benfico quando utilizado por famlias portadoras de determinadas anomalias genticas.

Questo 59 O padro de herana de uma doena, que se suspeita ser autossmica recessiva ou ligada ao sexo, foi analisada em trs famlias diferentes (I, II e III), como representado nos heredogramas a seguir:

1.5.1.4 1.5.1.4

Analise os dois heredogramas anteriores, considerando que o carter determinado por um nico par de genes, e responda s seguintes questes: a) Qual o padro de herana envolvido na determinao da caracterstica representada no heredograma 1 e no heredograma 2? Justifique sua resposta. b) Em qual das duas situaes seria mais recomendado o uso da tcnica ('Microsort') para a escolha de um beb do sexo feminino? Por qu? c) Considerando o heredograma n1, calcule a chance de os indivduos III.1 e III.2 gerarem uma criana afetada do sexo masculino. Questo 58 O heredograma a seguir refere-se ao caso de braquidactilia. Identifique e justifique o tipo de herana.

a) Qual o tipo de herana da doena? Justifique sua resposta. b) Suponha que a mulher 3 da famlia I case-se com o homem 4 da famlia III. Qual a probabilidade de nascer uma criana doente? Justifique. Questo 60 Numa aula de gentica, o professor lhe apresenta o heredograma a seguir, que mostra a ocorrncia de uma anomalia causada pela ao de um par de genes (A e a) em vrias geraes de uma famlia. Ao analisar os indivduos afetados por esta anomalia, voc conclui que se trata de uma herana autossmica dominante.

1.5.1.4

1.5.1.4

13

Baseando-se EXCLUSIVAMENTE no heredograma apresentado acima, responda: a) Por que a anomalia NO pode ser recessiva? b) Por que a anomalia NO pode ser ligada ao cromossomo X? c) Qual a probabilidade de nascer uma criana afetada pela anomalia, se a mulher (4) da gerao F3 tiver filhos com um homem que apresente essa anomalia? Questo 61 No heredograma abaixo a cor preta indica indivduos com pelagem negra, fentipo determinado por um gene autossmico dominante A. A cor branca indica pelagem branca determinada por um gene recessivo. Os indivduos 5 e 8 devem ser considerados homozigotos (AA), a menos que haja evidncia contrria. a) Identifique os heredogramas que so compatveis com uma herana autossmica recessiva. Justifique sua resposta para cada famlia. b) Determine se em algum dos casos apresentados existe herana ligada ao cromossomo Y. Justifique. Questo 63 Na genealogia adiante, os indivduos em escuro apresentam uma doena hereditria, enquanto os outros exibem fentipo normal. Os crculos representam as mulheres e os quadrados, os homens. 1.5.1.4 1.5.1.4

1.5.1.4

Qual a probabilidade de que o cruzamento entre o indivduo 9 e o indivduo 10 gere um indivduo de pelagem branca? Questo 62 Os heredogramas A, B e C a seguir representam trs famlias diferentes. Os crculos representam mulheres e os quadrados, homens. Quadrados ou crculos escuros representam indivduos afetados por uma caracterstica comum na populao. Analise esta genealogia e responda. a) Esta doena hereditria condicionada por gene dominante ou recessivo? b) Dos dez indivduos que compem esta genealogia, qual o nico que no pode ter seu gentipo definido? Explique por qu. Questo 64 Analise a genealogia, que apresenta indivduos afetados por uma doena recessiva e indivduos normais.

14

segunda criana desse casal tambm seja afetada por essa mesma doena? Por qu? Justifique suas respostas, mostrando como chegou aos resultados dos itens b) e c). 1.5.1.4 Questo 68 Alguns centros de pesquisa na Inglaterra esto realizando um programa de triagem populacional para detectar a fibrose cstica, uma doena autossmica recessiva grave particularmente comum em caucasianos. a) Quais os indivduos representados na genealogia que so obrigatoriamente heterozigotos? b) Qual a probabilidade de o casal formado pelos indivduos II2 e II3 ter mais dois filhos, sendo ambos do sexo masculino e afetados? Questo 65 Uma determinada caracterstica foi estudada em centenas de pares de gmeos, tanto monozigticos como dizigticos. As diferenas registradas entre os irmos dizigticos foram praticamente da mesma magnitude que as encontradas entre os irmos monozigticos. Discuta a importncia dos fatores genticos na manifestao dessa caracterstica. Questo 66 Se uma abelha operria tem o gene A herdado de seu pai, qual a probabilidade de que uma sua irm tenha esse mesmo gene A? Por qu? Questo 67 Dois irmos (Pedro e Paulo) casam-se com duas irms (Maria e Joana), todos normais. O primeiro casal, Pedro e Maria, tem uma criana afetada por uma doena muito rara de herana autossmica recessiva. a) Desenhe o heredograma representando os dois casais e seus respectivos pais. b) Qual a probabilidade de que uma futura criana de Paulo e Joana venha a ser afetada por essa mesma doena gentica? Considere desprezvel a probabilidade de uma nova mutao. c) Se Paulo e Joana tiverem uma primeira criana afetada pela mesma doena gentica, qual ser o risco de que uma 1.5.2.1 Calcule a probabilidade de que esse casal venha a ter uma criana com fibrose cstica. Justifique sua resposta. Questo 69 Considere a figura a seguir que representa o resultado da primeira diviso meitica de uma clula feminina: Toda pessoa na qual o alelo recessivo detectado recebe orientao a respeito dos riscos de vir a ter um descendente com a anomalia. Um ingls heterozigoto para essa caracterstica casado com uma mulher normal, filha de pais normais, mas cujo irmo morreu na infncia, vtima de fibrose cstica.

a) Indique o gentipo do embrio formado a partir da fecundao do vulo resultante dessa clula por um espermatozide de um macho recessivo para os dois pares de genes considerados. b) Quais os possveis gentipos dos filhos possveis do mesmo casal?

15

Questo 70 Em cobaias, a cor preta condicionada pelo alelo dominante D e a cor marrom, pelo alelo recessivo d. Em um outro cromossomo, localiza-se o gene responsvel pelo padro da colorao: o alelo dominante M determina padro uniforme (uma nica cor) e o alelo recessivo m, o padro malhado (preto / branco ou marrom / branco). O cruzamento de um macho de cor preta uniforme com uma fmea de cor marrom uniforme produz uma ninhada de oito filhotes: 3 de cor preta uniforme, 3 de cor marrom uniforme, 1 preto e branco e 1 marrom e branco. a) Quais os gentipos dos pais? b) Se o filho preto e branco for cruzado com uma fmea cujo gentipo igual ao da me dele, qual a proporo esperada de descendentes iguais a ele? Questo 71 A audio normal depende da presena de pelo menos um dominante de dois pares de genes, D e E que se segregam independentemente. Caso voc examine a prole de um grande nmero de casamentos em que ambos os cnjuges so duplo heterozigotos para esses dois pares de genes, que proporo fenotpica voc espera encontrar? Questo 72 Observe a tabela a seguir, que mostra parte dos resultados dos experimentos de Mendel, realizados com ervilhas.

De acordo com a tabela, responda: a) Por que na gerao F1 no foram encontradas sementes rugosas ou verdes? b) O que so os fatores hereditrios referidos por Mendel e onde esto situados? c) Faa um diagrama de cruzamento para exemplificar as propores fenotpicas encontradas na gerao F2, utilizando qualquer uma das caractersticas apresentadas na tabela. Questo 73 Quatro irmos, filhos legtimos de um mesmo casal, apresentam marcantes diferenas em suas caractersticas fsicas. Descreva trs mecanismos biolgicos potencialmente responsveis por essa variabilidade gentica e explique como atuam. Questo 74 Em uma raa de cachorros, a cor do plo negro determinada por um gene dominante (A) enquanto seu alelo (a) determina a cor branca. O tamanho do plo tambm controlado por um par de genes, sendo o alelo dominante (B) para plo curto e o alelo recessivo (b) para plo longo. A tabela a seguir apresenta os fentipos dos pais e os fentipos das respectivas proles, aps vrios cruzamentos.

1.5.2.1

1.5.2.1

a) Os genes para a cor e tamanho de plo esto no mesmo par de cromossomas? Justifique sua resposta. b) Quais so os gentipos mais provveis dos pais em cada casal? Justifique sua resposta.

16

Questo 75 Um pesquisador est estudando a gentica de uma espcie de moscas, considerando apenas dois locos, cada um com dois genes alelos: loco 1 - gene A (dominante) ou gene a (recessivo); loco 2 - gene B (dominante) ou gene b (recessivo). Cruzando indivduos AABB com indivduos aabb, foram obtidos 100% de indivduos AaBb que, quando cruzados entre si, podem formar indivduos com os gentipos mostrados na Tabela 1. Sem interao entre os dois locos, as propores fenotpicas dependem de os referidos locos estarem ou no no mesmo cromossomo. Na Tabela 2, esto representadas duas propores fenotpicas (casos 1 e 2) que poderiam resultar do cruzamento de dois indivduos AaBb.

1.5.2.1

a) Ao final da segunda diviso meitica dessa clula, quais sero os gentipos das quatro clulas haplides geradas? b) Considerando o conjunto total de espermatozides produzidos por esse animal, quais sero seus gentipos e em que proporo espera-se que eles sejam produzidos? Questo 77 Em uma determinada espcie animal, foram analisadas duas caractersticas com segregao independente e herana co-dominante: cor e textura do plo. Para a cor do plo, os homozigotos podem ser vermelhos ou brancos. Para a textura, os homozigotos tm plo liso ou crespo. Calcule a porcentagem esperada de descendentes fmeas com plo vermelho crespo oriundas do cruzamento de dois animais duplamente heterozigotos. Despreze a parte fracionria de seu resultado, caso exista. Questo 78

1.5.2.1

Identifique qual dos dois casos tem maior probabilidade de representar dois locos no mesmo cromossomo. Justifique sua resposta. Questo 76 A figura mostra a segregao de dois pares de cromossomos homlogos na anfase da primeira diviso meitica de uma clula testicular de um animal heterozigtico quanto a dois genes. As localizaes dos alelos desses genes, identificados pelas letras Aa e Bb, esto indicadas nos cromossomos representados no desenho.

Suponha uma planta superior originada de um zigoto no qual dois dos pares de cromossomos, A e B, tm a constituio AABB. a) Qual ser a constituio cromossmica da planta adulta originada desse zigoto? Justifique. b) Se essa planta se reproduzir por autofecundao, a constituio cromossmica de seus descendentes ser igual da planta me? Justifique. Questo 79 Considere duas linhagens homozigotas de plantas, uma com caule longo e frutos ovais e outra com caule curto e frutos redondos. Os genes para comprimento do caule e forma do fruto segregam-se independentemente. O alelo que determina caule longo dominante, assim como o alelo para fruto redondo.
17

a) De que forma podem ser obtidas plantas com caule curto e frutos ovais a partir das linhagens originais? Explique indicando o(s) cruzamento(s). Utilize as letras A, a para comprimento do caule e B, b para forma dos frutos. b) Em que proporo essas plantas de caule curto e frutos ovais sero obtidas? Questo 80 Considere dois genes e seus respectivos alelos: A e a; B e b. Em termos de localizao cromossmica, explique o que significa dizer que esses dois genes a) segregam-se independentemente na formao dos gametas. b) esto ligados. Questo 81 Do cruzamento de AaBbccDd x aaBbCcDd, qual ser a probabilidade de nascer um indivduo de gentipo aabbCcDD? Questo 82 Idiotia amaurtica infantil uma doena hereditria recessiva (ii) que causa a morte nos primeiros anos de vida. A condio normal (I_) produz um fentipo normal. Admite-se que dedos nas mos anormalmente curtos (braquidactilia) sejam devido a um gentipo heterozigoto para um gene letal embrionrio (BBL), o homozigoto (BB) normal e o outro homozigoto (BLBL) morre prematuramente. Qual a probabilidade de um casal de braquidctilos e heterozigotos para a idiotia amaurtica infantil vir a ter um descendente normal? Questo 83 Nos anos 40, o famoso cineasta Charlie ChapIin foi acusado de ser o pai de uma criana, fato que ele no admitia. Os exames de sangue revelaram que a me era do grupo A, a criana do grupo B e Chaplin do grupo O. Ao final do julgamento, Chaplin foi considerado como sendo um possvel pai da criana. a) O veredicto aceitvel? Por qu? b) Na hiptese de Chaplin ter tido filhos com a referida mulher, de que tipos sangneos eles poderiam ser?

Questo 84 Um tratamento utilizado para certos tipos de doenas do sangue a destruio completa da medula ssea do paciente e implante de clulas medulares sadias provenientes de um doador. Eugnio, cujo grupo sangneo A, recebeu um transplante de medula ssea de seu irmo Valentim, cujo grupo sangneo B, e a operao foi bem sucedida. a) Qual ser o grupo sangneo de Eugnio aps o transplante? Por qu? b) Sabendo-se que a me e a esposa de Eugnio tm sangue do tipo O, qual ser a probabilidade de um futuro filho do casal ter sangue do tipo A? E do tipo B? Questo 85 O pai e a me de um par de gmeos monozigticos tm tipo sangneo A. Uma outra criana desse casal do grupo sangneo O. a) Quais os gentipos do pai e da me? b) Qual a probabilidade de que ambos os gmeos tenham sangue do tipo O? Questo 86 Um homem faleceu por causa de uma transfuso de sangue. Sabendo-se que seus pais pertenciam aos grupos B (homozigoto) e AB, pergunta-se: a) qual o grupo sangneo do homem em questo? b) qual ou quais os possveis grupos sangneos usados erroneamente na transfuso? Questo 87 "Os grupos sangneos so determinados pela presena ou ausncia de antgenos na superfcie das hemcias. No caso do Sistema ABO, os antgenos esto presentes no sangue dos grupos A, B, AB e ausentes no grupo O". ("Reserva estratgica de sangue", de Ricardo Lorzetto. CINCIA HOJE, SBPC, vol. 19/n 113, set. 95, p. 58.) a) O que so antgenos? b) Qual a importncia de se identificar a presena de antgenos eritrocitrios (presentes nas hemcias ou eritrcitos) no sangue humano?

18

Questo 88 O daltonismo, ou cegueira para as cores, determinado por um gene localizado no cromossomo sexual X. O tipo de sangue, grupo ABO, determinado por trs alelos autossmicos: I, I, i. Uma mulher, com sangue tipo A e viso normal, ficou viva e casou pela segunda vez. Um dos maridos, Jos, tinha sangue AB e era daltnico; o outro marido, Paulo, tinha sangue A e viso normal. Com os dois maridos, a mulher teve cinco filhos na seguinte ordem: 1) homem, sangue A, daltnico; 2) homem, sangue O, daltnico; 3) mulher, sangue A, daltnica; 4) mulher, sangue B, viso normal; 5) mulher, sangue A, viso normal. Qual dos homens foi o primeiro marido? Justifique sua resposta. Questo 89 O sangue de Orlando aglutina quando colocado em presena de soro contendo imunoglobulinas ou aglutininas anti-A, e no aglutina quando colocado em presena de imunoglobulinas ou aglutininas anti-B. Orlando casa-se com Leila, que apresenta aglutinaes inversas. O casal tem um filho cujo sangue no aglutina em nenhum dos dois tipos de soro. a) Qual o gentipo dos pais? b) Qual a probabilidade de esse casal ter uma criana cujo sangue aglutine nos dois tipos de soro? Justifique sua resposta. Questo 90 Pode-se usar o sistema ABO para "excluir" um suposto pai em uma investigao de paternidade. Para tal, basta determinar o gentipo e o fentipo do suposto pai e, por comparao com os fentipos e gentipos do filho e da me, verificar se o homem acusado pode ser considerado como um pai impossvel. A tabela a seguir mostra os fentipos do filho e da me em trs casos.

1.5.3.1

Indique os fentipos dos pais que NO poderiam ser os pais biolgicos de cada caso. Questo 91 Nas quatro pessoas relacionadas a seguir, foram encontrados os seguintes tipos sangneos: Joana - AB Cassilda - B Doaldo - O Saildo - A Com base nesta relao, responda: a) Quem do grupo anterior NO possui os aglutinognios em suas hemcias? b) Por que Joana pode receber sangue de outros membros do grupo? c) Que tipo de aglutinina possuem Cassilda e Saildo, respectivamente? Questo 92 Ao descobrir que seu gentipo era homozigoto, o Sr. Lalau (indivduo II-1) elaborou o seguinte heredograma sobre a herana de grupos sangneos do sistema ABO.

1.5.3.1

19

a) Identifique o grupo sangneo do indivduo I-1: b) Qual o gentipo do indivduo II-5? c) O Sr. Lalau poder ser receptor de sangue de seu genro para transfuso? d) O indivduo III-5 NO poder ser de qual grupo sangneo? e) No caso do casal III-3 e III-4 ter uma segunda criana, qual a probabilidade dela ser uma menina e do grupo sangneo "B"? Questo 93 Dois casais suspeitavam da troca de seus bebs no berrio da maternidade. Os casais e os bebs foram submetidos tipagem do sangue quanto ao sistema ABO, cujos resultados obtidos so mostrados na tabela adiante. Analisando-os, pode-se identificar os pais de cada beb. 1.5.3.1

Questo 95 O rei Salomo resolveu uma disputa entre duas mulheres que reclamavam a posse de uma criana. Ao propor dividir a criana ao meio, uma das mulheres desistiu. O rei ento concluiu que aquela que havia desistido era de fato a me verdadeira. Nos tribunais modernos, um juiz pode utilizar a anlise dos grupos sangneos e teste de DNA para ajudar a solucionar questes semelhantes. Analisando uma situao em que uma mulher de sangue A atribua a paternidade de seu filho de sangue O a um homem de sangue B, o juiz no pde chegar a nenhuma deciso conclusiva. a) Explique por qu. b) Qual deveria ser o grupo sangneo do homem para que a deciso pudesse ser conclusiva? c) Com base no teste de DNA, o juiz concluiu que o homem era pai da criana. Por que o teste de DNA permite tirar concluses to precisas em casos como este? Questo 96 Os grupos sangneos humanos podem ser classificados em 4 tipos: A, AB, B e O, pelo sistema ABO e, de acordo com o sistema Rh, como Rh e Rh. a) Explique como o sangue de uma pessoa pode ser identificado em relao aos sistemas ABO e Rh. b) Explique por que uma pessoa com sangue tipo O doadora universal mas s pode receber sangue do tipo O, enquanto uma pessoa com sangue AB receptora universal mas no pode doar para os outros tipos. Questo 97 Um exemplo clssico de alelos mltiplos o sistema de grupos sangneos humano, em que o alelo I, que codifica para o antgeno A, codominante sobre o alelo I, que
20

1.5.3.1

Aps identificar os pais do beb n 2, calcule a probabilidade, em porcentagem, de que um futuro irmo deste beb seja do sexo masculino e venha a ter tipo sangneo diferente do irmo. Despreze a parte fracionria do seu resultado, caso exista. Questo 94 Com base no heredograma a seguir, responda: a) Qual a probabilidade de o casal formado por 5 e 6 ter duas crianas com sangue AB Rh? b) Se o casal em questo j tiver uma criana com sangue AB Rh ,qual a probabilidade de ter outra com os mesmos fentipos sangneos? Obs.: indique os passos que voc seguiu para chegar s respostas, em a e b.

codifica para o antgeno B. Ambos os alelos so dominantes sobre o alelo i, que no codifica para qualquer antgeno. Dois tipos de soros, anti-A e anti-B, so necessrios para a identificao dos quatro grupos sangneos: A, B, AB e O. a) Complete o quadro a seguir com os gentipos e as reaes antignicas (represente com os sinais + e -) dos grupos sangneos indicados.

com o uso do soro anti-Rh (anti-D) como mostra o esquema a seguir.

1.5.3.2

1.5.3.1 Qual das mulheres poderia ser a verdadeira me daquela criana? Justifique sua resposta. Questo 100 Na eritroblastose fetal ocorre destruio das hemcias, o que pode levar recm-nascidos morte. a) Explique como ocorre a eritroblastose fetal. b) Como evitar sua ocorrncia? c) Qual o procedimento usual para salvar a vida do recm-nascido com eritroblastose fetal? Questo 101 Um indivduo pertencente aos grupos sangneos AB e Rh positivo considerado receptor universal ideal. Certo ou errado? Justifique sua resposta. Questo 102 1.5.3.2 Nas transfuses sangneas, o doador deve ter o mesmo tipo de sangue que o receptor com relao ao sistema ABO. Em situaes de emergncia, na falta de sangue do mesmo tipo, podem ser feitas transfuses de pequenos volumes de sangue O para pacientes dos grupos A, B ou AB. Explique o problema que pode ocorrer se forem fornecidos grandes volumes de sangue O para pacientes A, B ou AB. Questo 103 Um casal tem cinco filhos: Alex, Pedro, Mrio, rica e Ana. Dois dos irmos so gmeos univitelinos. rica, um dos gmeos, sofreu um acidente e precisa urgentemente de uma transfuso de sangue, e os nicos doadores disponveis so seus irmos. Na impossibilidade de se fazer um exame dos tipos sangneos, responda:
21

b) Embora 3 alelos distintos determinem os grupos sangneos ABO humanos, por que cada indivduo portador de somente dois alelos? Questo 98 Uma populao humana foi testada quanto ao sistema MN de grupos sanguneos. Os dados obtidos compem a tabela a seguir:

a) Quais as freqncias dos alelos M e N nessa populao? b)Essa populao est em equilbrio de Hardy-Weinberg para esse loco gnico? Questo 99 Duas mulheres disputam a maternidade de uma criana, que, ao nascer, apresentou a doena hemoltica ou eritroblastose fetal. O sangue das duas mulheres foi testado

a) Entre seus irmos, qual seria a pessoa mais indicada para ser o doador? b) Justifique sua resposta. Questo 104 No quadro a seguir, as duas colunas da direita demonstram esquematicamente o aspecto "in vitro" das reaes no sangue dos indivduos de cada grupo sangneo ABO aos anti-A e Anti-B.

forma? c) Qual o gentipo da fmea preta? d) Qual o gentipo da fmea marrom? Questo 106 Em galinhas h quatro tipos de cristas: simples, noz, rosa e ervilha. Na determinao desses tipos de cristas atuam dois pares de genes (Rr e Ee). Assim o gentipo R_E_ determina crista noz, R_ee crista rosa, rrE_ crista ervilha e o gentipo eerr determina crista simples. Um galo de crista noz cruzado com uma galinha de crista rosa produziu a seguinte gerao: 3/8 noz, 3/8 rosa, 1/8 ervilha e 1/8 simples. A partir desses dados responda: a) Quais os gentipos paternos? b) Os genes em questo obedecem a segunda lei de Mendel? Justifique. Questo 107 Em galinhas domsticas o tipo de crista determinado por dois pares de genes com segregao independente. Observe os fentipos e gentipos. Crista Rosa = R_ee Crista Ervilha = rrE_ Crista Noz = R_E_ Crista Simpes = rree Um galo com crista noz foi cruzado com trs galinhas. Com a galinha A de crista noz produziu na gerao 3 noz: 1 rosa, com a galinha B de crista ervilha produziu 3 noz: 1 rosa: 3 ervilha: 1 simples e com a galinha C de crista noz a gerao tinha 100% crista noz. Utilizando a tabela a seguir determine o gentipo do galo e das trs galinhas. Questo 108 As reaes enzimticas a seguir indicam a passagem metablica que sintetiza pigmentos em uma planta.

1.5.3.4

a) Explique o fenmeno que ocorreria com as hemcias de um indivduo do grupo A ao receber sangue de um indivduo do grupo B. b) Sabe-se que o aglutinognio uma protena da membrana das hemcias. Explique por que a aglutinao no ocorreria se o aglutinognio fosse uma protena citoplasmtica. Questo 105 As trs cores de pelagem de ces labradores (preta, marrom e dourada) so condicionadas pela interao de dois genes autossmicos, cada um deles com dois alelos: "Ee" e "Bb". Os ces homozigticos recessivos "ee" no depositam pigmentos nos plos e apresentam, por isso, pelagem dourada. J os ces com gentipos "EE" ou "Ee" apresentam pigmento nos plos, que pode ser preto ou marrom, dependendo do outro gene: os ces homozigticos recessivos "bb" apresentam pelagem marrom, enquanto os com gentipos "BB" ou "Bb" apresentam pelagem preta. Um labrador macho, com pelagem dourada, foi cruzado com uma fmea preta e com uma fmea marrom. Em ambos os cruzamentos, foram produzidos descendentes dourados, pretos e marrons. a) Qual o gentipo do macho dourado, quanto aos dois genes mencionados? b) Que tipos de gameta e em que proporo esse macho

22

1.5.4.1

Considere as seguintes condies: - para as enzimas A e B, os alelos A e B produzem enzimas funcionais, enquanto os alelos a e b produzem enzimas inativas; - uma nica cpia funcional da enzima A ou da enzima B suficiente para catalisar normalmente a sua respectiva reao. Determine a proporo esperada entre as cores das plantas descendentes na primeira gerao do cruzamento AaBbAABb. Questo 109 Analisando a via metablica hipottica, temos que:

O gene A episttico sobre o gene B e, quando em homozigose recessiva (aa), impede a produo dos pigmentos rosa e vermelho, devido no produo de enzima X. O gene B, em homozigose recessiva, impossibilita a converso de pigmento rosa em vermelho. Os genes A e B so dominantes sobre os seus alelos. Responda: a) No cruzamento entre indivduos de gentipos AaBbaabb, qual ser a proporo fenotpica esperada na prognie? b) Quais so os possveis gentipos para os indivduos vermelhos? c) Quais os fentipos esperados e suas respectivas propores em F obtidos a partir de parentais AABB aabb? Questo 110 Em camundongos, o tipo selvagem, encontrado comumente na natureza, apresenta pelagem de colorao acinzentada (aguti). Duas outras coloraes so tambm observadas: preta e albina. Observe os dois pares de genes envolvidos e os fentipos relativos aos tipos de colorao dos camundongos. A _ B _ = Aguti A _ bb = Preto aaB _ e aabb = Albinos

1.5.4.2

Utilizando essas informaes e seus conhecimentos, faa o que se pede. a) Do cruzamento entre camundongos preto e albino obtiveram-se 100% de camundongos aguti. D os gentipos dos camundongos envolvidos no cruzamento. b) Do cruzamento de dois camundongos aguti obtiveram-se descendentes na seguinte proporo: 9 aguti: 3 pretos: 4 albinos. CITE todos os gentipos possveis para os camundongos albinos obtidos e APRESENTE UMA EXPLICAO para a alterao da proporo 9:3:3:1 (esperada em cruzamento de dibridos) para 9:3:4. c) CITE a probabilidade de se obterem camundongos pretos do cruzamento de albinos (duplo homozigotos) com aguti (duplo heterozigotos).

23

Questo 111 Na herana da cor do fruto da moranga, esto envolvidos dois pares de genes A/a e B/b. O gene B produz frutos amarelos, mas, na presena do gene A, ele inibido e produz frutos brancos, como o seu alelo b. O indivduo duplo recessivo produz frutos verdes. Uma planta homozigota, produtora de frutos amarelos, cruzada com outra, produtora de frutos verdes. Uma planta, filha desse cruzamento, que ser chamada de planta I, foi cruzada com outra planta, II, produtora de frutos brancos. O cruzamento entre a planta I e a planta II produziu 4/8 de plantas com frutos brancos, 3/8 de plantas com frutos amarelos e 1/8 de plantas com frutos verdes. Responda: a) Que denominao se d a este tipo de interao entre os genes A e B? b) Quais os gentipos das plantas I e II? Questo 112 Numa dada planta, o gene B condiciona fruto branco e o gene A condiciona fruto amarelo, mas o gene B inibe a ao do gene A. O duplo recessivo condiciona fruto verde. Considerando que tais genes apresentam segregao independentemente um do outro, responda: a) Como se chama esse tipo de interao? b) Qual a proporo fenotpica correta entre os descendentes do cruzamento de plantas heterozigotas para esses dois pares de genes? Questo 113 Existe um gene em cobaias que suprime o efeito do gene que determina a colorao nesses animais. Esse gene est localizado em um cromossomo diferente daquele em que est o gene que determine a cor do animal. Cobaias albinas homozigotas foram cruzadas e todos os descendentes nasceram pretos. Como isto pode ser explicado, considerando-se que no ocorreu mutao? Justifique. Questo 114 O daltonismo tem herana recessiva ligada ao X. Um indivduo anormal, com caritipo 47, XXY, era daltnico. Seus genitores tinham viso normal para cores. a) Qual genitor formou o gameta com 24 cromossomos?

Explique. b) O erro ocorreu na primeira ou na segunda diviso da meiose? Explique. Questo 115 Com relao espcie humana, pergunta-se: a) Por que o pai quem determina o sexo da prole? b) Por que os filhos homens de pai hemoflico nunca herdam essa caracterstica do pai? Questo 116 Um geneticista, adotando o mesmo critrio utilizado para a montagem de caritipo da espcie humana, montou o caritipo de certa espcie animal desconhecida, conseguindo formar dez pares de cromossomos, restando, alm desses, dois cromossomos de tamanhos distintos. Considere o padro de determinao de sexo, nessa espcie desconhecida, igual ao do humano e determine: a) quantos cromossomos existem, respectivamente, nos vulos, nos espermatozides e nas clulas musculares dessa espcie animal; b) o sexo a que pertence o animal da espcie em questo, justificando sua resposta. Questo 117 Esta figura representa uma clula humana na qual uma estrutura est indicada pela seta.

1.5.5.1

24

Com base na figura e em conhecimentos sobre o assunto, a) CITE o nome da clula representada e sua principal funo. b) CITE o nome da estrutura indicada pela seta e JUSTIFIQUE a existncia da estrutura nessa clula. c) Utilizando a letra A para designar um conjunto de autossomos e as letras convencionalmente usadas para representar os cromossomos sexuais, CITE o nmero cromossmico dessa clula caso ela pertena a um indivduo normal e um indivduo cujo sexo no compatvel com a presena da estrutura indicada. d) DENOMINE a sndrome que designa o indivduo cujo sexo compatvel com a presena da estrutura indicada, mas no a possui. Questo 118 Em galinhas domsticas, o sexo feminino heterogamtico. Numa determinada raa, a colorao das penas uma caracterstica condicionada pelo gene C e ligada ao sexo. O alelo que determina a colorao carij dominante sobre o alelo para a cor branca. O cruzamento de uma galinha branca com um galo carij produziu somente aves carijs. Promovendo o intercruzamento destes descendentes, qual seria a proporo fenotpica esperada? Demonstre os cruzamentos. Questo 119 Fazendeiros que criam gado leiteiro podem, atualmente, determinar o sexo dos embries logo aps a fertilizao, usando um "kit" que determina a presena do cromossomo Y. Se o embrio for fmea, reimplantado no tero da vaca. Caso contrrio, ele eliminado ou congelado para uso futuro. a) Para esses fazendeiros, qual a vantagem dessa prvia determinao do sexo dos embries? b) Por que o "kit" pesquisa somente a presena do cromossomo Y? Questo 120 Durante o processo de meiose ocorre a recombinao gnica, isto , a troca de seqncias de ADN entre cromossomos homlogos. Identifique o cromossomo humano que sofre menos recombinao. Justifique sua resposta.

Questo 121 Na espcie humana existe um gene raro que causa a displasia ectodrmica anidrtica, que uma anomalia caracterizada pela ausncia das glndulas sudorparas. Esse gene se localiza no cromossomo sexual X. Algumas mulheres, portadoras desse gene em heterozigose, ficam com a pele toda manchada, formando um mosaico de manchas claras e escuras, quando se passa um corante sobre a pele.

1.5.5.1

a) Explique a formao dessas manchas do ponto de vista gentico. b) Por que esse mosaico no pode aparecer em um homem? Questo 122 Certos tipos de cncer, em especial aqueles ligados s clulas do sangue, so tratados com transplantes de medula ssea. Nesses transplantes, uma parte da medula ssea de um doador sadio introduzida na coluna vertebral de um paciente cujas clulas da medula ssea foram previamente eliminadas com auxlio de drogas ou de radiao. Aps o transplante de medula possvel identificar os cromossomos de clulas de diversos rgos e tecidos. A tabela a seguir mostra os resultados da classificao dos cromossomos de 4 tecidos de um paciente submetido a transplante de medula.

25

Questo 125 Na dcada de 40 descobriu-se que algumas clulas retiradas de mulheres apresentavam no ncleo interfsico, um pequeno corpsculo de cromatina intensamente corado. Este corpsculo conhecido hoje como cromatina sexual ou corpsculo de Barr. a) A que corresponde tal corpsculo e em que tipo de clulas (somticas ou germinativas) ele aparece? b) Qual a sua importncia e por que ele no ocorre nas clulas masculinas? Questo 126 A anlise dos ncleos interfsicos de clulas da mucosa oral de uma mulher, fenotipicamente normal, revelou a existncia de duas cromatinas sexuais em todos eles. Responda: a) Quantos cromossomos X tem esta mulher? b) Se ela se casar com um homem normal, qual a probabilidade de ter uma filha com constituio cromossmica igual sua? Questo 127 Essa lei atingir o objetivo desejado depois de algumas geraes? Justifique sua resposta. Questo 124 Em uma 'Drosophila melanogaster', a determinao do sexo no feita simplesmente pela presena ou ausncia do cromossomo Y, mas por um balano gnico entre genes femininizantes e masculinizantes. Se o cromossomo X de uma fmea com caritipo 2AXX sofrer no-disjuno meitica e o vulo resultante com 2 cromossomos X for fecundado por um espermatozide normal, portador de um cromossomo Y, dando origem a um descendente com caritipo 2AXXY, pergunta-se: a) Qual o sexo do descendente com caritipo 2AXXY? b) Sabendo-se que o sexo da 'Drosophila melanogaster' pode ser definido por um ndice sexual (I.S.), qual a relao que expressa esse ndice? c) Qual o ndice sexual (I.S.) do descendente acima referido? Uma revista publicou uma reportagem com o ttulo "Atleta com anomalia gentica faz operao para definir seu sexo e poder competir na classe feminina de jud". A matria dizia, ainda, que a jovem era um caso de pseudo-hermafroditismo, pois apresentava rgos sexuais internos masculinos e rgos sexuais externos femininos. Os testculos da atleta fora extirpados para que ela pudesse competir na equipe feminina de jud a) Que vantagem a atleta levaria sobre as demais competidoras se tivesse os testculos durante a competio? b) Sabendo-se que ela foi considerada do sexo feminino, que testes citogenticos voc faria para comprovar esta afirmao? Questo 128 Um casal de no hemoflicos tem um filho com hemofilia. a) Qual a probabilidade de que uma filha desse casal apresente a doena? b) Qual a probabilidade de que um outro filho desse casal seja tambm hemoflico? Justifique suas respostas.
26

1.5.5.1

Com base nesses resultados, identifique o sexo do paciente e o sexo do doador. Justifique sua resposta. Questo 123 O governo de uma sociedade totalitria decidiu conter a expanso demogrfica reduzindo a proporo de homens na populao. Com esse objetivo, foi ento promulgada uma lei segundo a qual todas as mulheres que tivessem um filho homem no mais poderiam ter filhos. As demais mulheres poderiam continuar a ter filhos at que tivessem um filho homem.

Questo 129 Uma mulher portadora de um gene letal ligado ao sexo, que causa aborto espontneo. Supondo que quinze de suas gestaes se completem, qual o nmero esperado para crianas do sexo masculino, entre as que nascerem? Justifique sua resposta. Questo 130 Uma mulher clinicamente normal casou-se duas vezes, em ambos os casos com indivduos normais e que no eram seus consangneos. Conforme mostrado na genealogia a seguir, ela teve quatro filhos, dois de cada casamento, todos afetados por uma doena gentica muito rara.

1.5.5.2

a) Qual a probabilidade de que uma segunda criana de II-4 e II-5 seja afetada? b) Qual a probabilidade de II-2 ser portadora do alelo que causa a hemofilia? c) Se o av materno de II-4 era afetado, qual era o fentipo da av materna? Justifique sua resposta.

1.5.5.2

Questo 132 O gene recessivo h est localizado no cromossomo X e responsvel pela hemofilia na espcie humana. Com base nessas informaes e nas contidas na rvore genealgica adiante, responda seguinte pergunta: se a mulher 4 casar com um homem normal e seu primeiro filho for um menino hemoflico, qual a probabilidade de que o prximo filho homem desse casal venha a ser hemoflico?

a) Que padro de herana explica melhor a genealogia? Justifique sua resposta. b) Se os dois maridos da mulher fossem irmos isto poderia alterar sua resposta anterior? Por qu? Questo 131 No heredograma a seguir, ocorrem dois meninos hemoflicos. A hemofilia tem herana recessiva ligada ao cromossomo X.

1.5.5.2

Questo 133 O gene recessivo d est localizado no cromossomo X e responsvel pelo daltonismo na espcie humana. Com base nessas informaes e nas contidas na rvore genealgica adiante, responda seguinte pergunta: se a mulher 5 se casar com um homem daltnico, qual a probabilidade de
27

que o prximo filho homem desse casal venha a ser daltnico?

a) Sabendo que a doena em questo um caso de herana ligada ao sexo, formule a concluso do geneticista quanto possibilidade de o consultante transmitir a doena a seus descendentes diretos. b) Calcule os valores correspondentes probabilidade de que o primo doente do consultante, ao casar com uma mulher normal, gere filhas e filhos afetados pela doena. Questo 136 O daltonismo (cegueira para as cores) se deve a uma mutao recessiva ligada ao sexo, isto , localizada na parte no homloga do cromossomo X. Sendo assim, podemos representar gentipos e fentipos de homens e mulheres como no quadro a seguir. Homens: XDY - Viso normal XdY - Daltnico Mulheres: XDXD - Viso normal XDXd - Viso normal XdXd - Daltnica Na figura a seguir, os smbolos sombreados representam indivduos daltnicos em um dos ramos da famlia Abreu, de Maranguape.

1.5.5.2

Questo 134 Uma mulher portadora de um gene letal ligado ao sexo, que causa aborto espontneo. Supondo que nove de suas gestaes se completem, qual o nmero esperado para crianas do sexo feminino entre as que nascerem? Justifique sua resposta. Questo 135 Um homem pertence a uma famlia na qual, h geraes, diversos membros so afetados por raquitismo resistente ao tratamento com vitamina D. Preocupado com a possibilidade de transmitir essa doena, consultou um geneticista que, aps constatar que a famlia reside em um grande centro urbano, bem como a inexistncia de casamentos consangneos, preparou o heredograma abaixo. Nele, o consultante est indicado por uma seta.

1.5.5.2

1.5.5.2

28

Analisando a figura, tendo em vista as informaes e usando os smbolos dados, no quadro anterior, para representar os genes, responda: a) Quais os gentipos dos indivduos II.1, III.7, IV.2 e IV.9? b) Qual a probabilidade de, nascendo uma criana de III.9 e III.10, ela ser do sexo masculino e daltnico? Justifique sua resposta. c) Quais todos os gentipos provveis para os descendentes (filhos e filhas) de um possvel casamento entre IV.2 e IV.9? Justifique sua resposta. Questo 137 Na espcie humana h algumas condies dominantes ligadas ao cromossomo X, embora sejam raras. A figura a seguir mostra o heredograma de um tipo de diabetes que leva a problemas no metabolismo do fosfato e dos carboidratos.

leis da probabilidade, o seu risco e tambm o de sua famlia de vir a ter uma criana com essa doena. a) Qual a principal caracterstica clnica da hemofilia A? Justifique por que esse sintoma clnico aparece nos afetados. b) Analise a rvore Genealgica de MS e informe: 1- risco de ela vir a ter uma criana hemoflica, considerando o seu casamento com um homem normal (indivduo III). 2- risco de sua prima (indivduo III) vir a ter uma outra criana hemoflica do mesmo casamento com o indivduo III.

1.5.5.2

Questo 139 1.5.5.2 A cor do plo dos gatos depende de um par de genes alelos situados no cromossomo X. Um deles responsvel pela cor preta e o outro pela cor amarela. Existe um terceiro gene autossmico (no localizado nos cromossomos sexuais) que responsvel pela cor branca. Com essas informaes, explique por que o plo de uma gata pode ter trs cores, enquanto o plo de um gato s pode ter duas cores. Questo 140 Uma das primeiras experincias de terapia gentica foi realizada com indivduos hemoflicos cujo gene para o fator VIII de coagulao era defeituoso. Na terapia foram retiradas clulas da pele do paciente. Estas clulas receberam cpias do gene normal para o fator VIII e foram posteriormente reintroduzidas no indivduo. Os resultados mostraram um aumento significativo na produo do fator VIII nos indivduos tratados. Supondo que o indivduo tratado venha a ter filhos com
29

Com base no enunciado e na anlise do heredograma, responda: a) A me do cruzamento I homozigota ou heterozigota? Justifique. b) Quais so os provveis gentipos dos indivduos II-2, III-4 e III-5? Questo 138 MS (indivduo III) est grvida, tem vrios parentes com hemofilia clssica ou hemofilia A. Como no tem recursos para fazer o diagnstico pr-natal dessa doena pelo estudo do DNA fetal, procurou um geneticista. Ela quer obter mais informaes sobre a hemofilia A e conhecer, por meio das

uma mulher cujos genes para o fator VIII sejam defeituosos, existe possibilidade de nascimento de uma criana no hemoflica? Justifique sua resposta. Questo 141 Seguindo a representao a seguir 1.5.5.2

1.5.5.2

e considerando que os indivduos apresentam, simultaneamente, dois caracteres genticos com mecanismos de herana distintos, a) indique os gentipos dos indivduos. b) construa um heredograma no qual trs desses indivduos sejam os filhos biolgicos (legtimos) dos outros dois. c) discuta a possibilidade de uma mulher hemoflica e albina ser filha biolgica dos pais propostos no heredograma que voc construiu. Questo 142 Os heredogramas a seguir representam duas famlias com doenas hereditrias distintas. A doena que acomete a famlia 1 provoca retardamento mental acentuado, enquanto que a da famlia 2 uma doena degenerativa fatal que aparece em torno dos 40 anos de idade.

Aps analisar os heredogramas, atenda s solicitaes a seguir. a) Quais os tipos de herana envolvidos na transmisso das doenas de cada famlia? Justifique sua resposta. b) Considerando que a seleo natural pode eliminar doenas genticas, explique por que a doena da famlia 2 ainda poderia ser encontrada em indivduos da gerao VI (netos da gerao IV). Questo 143 Com o objetivo de reconstruir a histria familiar de um caso de herana de daltonismo, o heredograma a seguir comeou a ser elaborado para que fosse determinado o gentipo e, ou, fentipo dos indivduos. Sabendo-se que o loco do gene para o daltonismo est no cromossomo X, e ausente no Y, responda:

1.5.5.2

30

a) Se os indivduos I - 1 e II - 5 so daltnicos, quantas pessoas A MAIS, neste heredograma, tambm devero apresentar este fentipo? b) O indivduo II - 5 poder ter irmo normal? Justifique. c) Se os indivduos III - 1 e III - 4 vierem a se casar e ter filhos, podero ter uma menina normal homozigota? Justifique. Questo 144 Na espcie humana, o nmero de mulheres afetadas pelo daltonismo baixo quando comparado com o nmero de homens afetados pela anomalia. Supondo-se que a freqncia de homens daltnicos nas populaes seja de 10%, responda: a) Por que o daltonismo raro nas mulheres? b) Quantas vezes os homens daltnicos so mais freqentes nas populaes do que as mulheres daltnicas? Questo 145 A genealogia representada na figura de uma famlia com uma anomalia rara na espcie humana. Os crculos representam as mulheres e os quadrados, os homens. Os smbolos em escuro representam os indivduos com anomalia

Questo 146 Jos uma pessoa muito interessada na criao de gatos. Um de seus gatos apresenta hipoplasia testicular (testculos atrofiados) e totalmente estril. Jos procurou um veterinrio que, ao ver as cores preta e amarela do animal, imediatamente fez o seguinte diagnstico: trata-se de um caso de aneuploidia de cromossomos sexuais. As cores nos gatos domsticos so determinadas por um gene A (cor amarela) e outro gene P (cor preta), ambos ligados ao sexo, e o malhado apresenta os dois genes (A e P). a) O que e qual o tipo de aneuploidia que o gato de Jos apresenta? b) Qual a explicao dada pelo veterinrio relacionando a anomalia com as cores do animal? Questo 147 O daltonismo comumente entendido como a incapacidade de enxergar as cores verde e/ou vermelha. A percepo de cores devida presena de diferentes tipos do pigmento retinol nos cones da retina. Nos indivduos daltnicos, alguns desses pigmentos no esto presentes, alterando a percepo das cores. Os genes que participam da sntese desses pigmentos localizam-se no cromossomo X. O daltonismo um carter recessivo. Um homem daltnico casou-se com uma mulher de viso normal em cuja famlia no havia relatos de casos de daltonismo. Este casal teve dois filhos: Joo e Maria. a) Qual a probabilidade de Joo ter herdado do pai o gene para daltonismo? Qual a probabilidade de Maria ter herdado do pai o gene para daltonismo? b) Por que mais freqente encontrarmos homens daltnicos que mulheres daltnicas? Questo 148

1.5.5.2

Com base nessa genealogia, responda. a) Qual o tipo mais provvel da herana desta anomalia? Justifique. b) Tendo em vista o tipo de herana mais provvel, quais os gentipos dos indivduos II-4 e II-5?

Uma mulher deu luz um menino com hemofilia. Como nenhum de seus parentes prximos era hemoflico, ela sups que o problema teria surgido porque o pai da criana trabalhava em uma usina nuclear e teria ficado exposto a radiaes que alteraram seu material gentico. A mulher tem razo? Justifique.

31

Questo 149 No gnero Drosophila, a cor vermelha ou branca dos olhos determinada por um gene localizado no cromossomo X. Responda as trs questes a seguir considerando o cruzamento de uma mosca fmea de olhos vermelhos de uma linhagem pura para cor de olhos com um macho de olhos brancos, e o cruzamento das moscas F entre si. Represente como B o alelo dominante para olhos vermelhos e como b o alelo recessivo para olhos brancos. a) Qual ser a cor dos olhos dos machos e fmeas na primeira gerao (F)? E na segunda (F)? Justifique. b) Qual ser a proporo de machos e fmeas nas duas geraes? Justifique. Questo 150 A determinao do sexo em peixes segue o sistema XY, como no ser humano. Um alelo de um lcus do cromossomo Y do peixe 'Lebistes' determina a ocorrncia de manchas na nadadeira dorsal. Um peixe macho com manchas na nadadeira foi cruzado com uma fmea sem manchas. a) Quais so os fentipos de F e de F desse cruzamento? b) Como seria o resultado em F e F, se o alelo fosse dominante e estivesse no cromossomo X do macho? Demonstre, atravs de um cruzamento. Questo 151 Um geneticista estudou dois grupos, I e II, portadores de uma doena gentica que se manifestava da seguinte maneira:

O pesquisador concluiu que no se tratava de uma doena com herana dominante ou recessiva ligada ao sexo, porm teve dvida se se tratava de herana autossmica recessiva ou autossmica dominante com penetrncia incompleta. a) O que levou o pesquisador a concluir que no se tratava de herana ligada ao sexo? b) Por que o pesquisador teve dvida quanto ao tipo de herana autossmica? Questo 152 Uma doena humana rara introduzida em uma famlia quando uma mulher normal se casa com um homem afetado. Esse casal tem 5 filhos, 2 mulheres e 3 homens. Todas as filhas mulheres so afetadas por essa doena. Uma das filhas se casa com um homem normal e tem 7 filhos, sendo 4 homens, dos quais 2 so afetados, e 3 mulheres, das quais somente uma normal. O irmo mais velho, afetado pela doena, casa-se com uma mulher normal e tem 2 filhos, uma mulher afetada e um homem normal. A irm mais nova, tambm afetada pela doena, se casa com um homem normal e tem 3 filhos, uma moa normal e 2 homens, um normal e outro afetado. Observando a genealogia, pode-se dizer que o modo de herana mais provvel seja de herana ligada do X dominante. Justifique essa concluso, desenhe o heredograma dessa famlia considerando o gene (A) normal e o gene (a) mutado e apresente os provveis progenes, assim como a probabilidade de filhos afetados para o casamento entre os ltimos primos, a filha afetada do irmo mais velho e o filho afetado da irm mais nova. Para o heredograma, utilize a simbologia: quadrados e crculos brancos para, respectivamente, homens e mulheres normais, quadrados e crculos hachurados para homens e mulheres afetados. Questo 153 Os conhecimentos atuais de biologia celular, biologia molecular e engenharia gentica podem, muitas vezes, estabelecer com segurana o parentesco entre pessoas, mesmo quando elas pertencem a geraes afastadas entre si. O heredograma a seguir mostra os descendentes do casal Joo e Maria.

1.5.5.2

32

a) Quanto aos pares de alelos mencionados, que tipos de gameta esta clula poder formar? b) Que pares de alelos tm segregao independente? 1.5.5.3 Questo 155 Foram realizados cruzamentos entre uma linhagem pura de plantas de ervilha com flores prpuras e gros de plen longos e outra linhagem pura, com flores vermelhas e gros de plen redondos. Todas as plantas produzidas tinham flores prpuras e gros de plen longos. Cruzando-se essas plantas heterozigticas com plantas da linhagem pura de flores vermelhas e gros de plen redondos, foram obtidas 160 plantas: 62 com flores prpuras e gros de plen longos, 66 com flores vermelhas e gros de plen redondos, 17 com flores prpuras e gros de plen redondos, 15 com flores vermelhas e gros de plen longos. Essas freqncias fenotpicas obtidas no esto de acordo com o esperado, considerando-se a Segunda Lei de Mendel (Lei da Segregao Independente). a) De acordo com a Segunda Lei de Mendel, quais so as freqncias esperadas para os fentipos? b) Explique a razo das diferenas entre as freqncias esperadas e as observadas. Questo 156 Trs grupos de alunos realizaram cruzamentos-testes entre plantas de tomate para o estudo de diferentes genes. Os grupos obtiveram os seguintes resultados:

Atualmente, de toda essa famlia, apenas Maria e todos os seus bisnetos esto vivos, e se apresentaram para a identificao de herdeiros do casal citado. Por no haver documentos legais comprobatrios da relao de parentesco, nem ser possvel a coleta de material gentico dos membros falecidos da famlia, foi utilizada, dentre outras, a tcnica de identificao por meio do estudo do DNA extranuclear. Indique o nmero de: a) bisnetos do sexo masculino e do sexo feminino que poderiam ser identificados com aproximadamente 100% de certeza, por tcnicas que determinam a homologia entre amostras de DNA extranuclear, e justifique sua resposta; b) netos e bisnetos de Joo e Maria que possuram ou possuem o cromossomo Y idntico ao de Joo e justifique sua resposta. Questo 154 O esquema a seguir representa, numa clula em diviso meitica, dois pares de cromossomos com trs genes em heterozigose: A/a, B/b e D/d. Nesses cromossomos, ocorreram as permutas indicadas pelas setas 1 e 2.

1.5.6

1.5.6

33

a) Indique o(s) grupo(s) que trabalhou (trabalharam) com genes ligados, Justifique. b) O que significa, em Gentica, o termo ligao? Qual a sua utilidade para a pesquisa cientfica? c) Calcule a distncia, em unidades de mapa gentico, entre os genes pesquisados pelos alunos do grupo G2. Questo 157 Considere que os genes autossmicos, identificados nos cromossomos (I e II), correspondam a aptides para aprender biologia (B), matemtica (M) e tocar guitarra (G). Em um dado loco, um indivduo com gentipo recessivo no apresenta aptido; um indivduo heterozigoto apresenta aptido mediana; e um indivduo homozigoto dominante apresenta maior aptido.

Com base nessas informaes, faa o que se pede: a) Um casal (P1), formado por um indivduo triplo homozigoto dominante e outro triplo homozigoto recessivo, poder esperar descendentes (F1) com qual(is) gentipo(s)? b) Se um descendente (F1) se casar com um indivduo sem aptido para as trs habilidades, qual a probabilidade desse casal ter uma criana com aptido mediana para matemtica? c) Qual o nome do mecanismo gentico, proposto por Thomas Hunt Morgan, que permitiria ao casal do item b ter filhos com aptido mediana para aprender biologia mas sem aptido para tocar guitarra? d) Quais os locos cuja herana no resultar em propores segregantes dentro dos padres da segunda Lei de Mendel? e) Uma me sem aptido para aprender biologia e tocar guitarra, mas com aptido mediana para aprender matemtica, ter 100% dos filhos(as) com aptido no mnimo mediana para as trs caractersticas, ao se casar com um indivduo com gentipo: Questo 158

1.5.6

Os locos gnicos A e B se localizam em um mesmo cromossomo, havendo 10 unidades de recombinao (morgandeos) entre eles. a) Como se denomina a situao mencionada? Supondo o cruzamento AB/ab com ab/ab b) Qual ser a porcentagem de indivduos AaBb na descendncia? c) Qual ser a porcentagem de indivduos Aabb? Questo 159 Numa populao de 100 pessoas, 36 so afetadas por uma doena gentica condicionada por um par de alelos de herana autossmica recessiva. a) Expresse, em fraes decimais, a freqncia dos genes dominantes e recessivos. b) Quantos indivduos so homozigotos? c) Suponha que nessa populao os cruzamentos ocorram ao acaso, deles resultando, em mdia, igual nmero de descendentes. Considere, tambm, que a caracterstica em questo no altera o valor adaptativo dos indivduos. Nessas condies, qual ser a porcentagem esperada de indivduos de fentipo dominante na prxima gerao? Justifique suas respostas mostrando como chegou aos resultados numricos.
34

Questo 160 Um determinado gene de herana autossmica recessiva causa a morte das pessoas homozigticas aa ainda na infncia. As pessoas heterozigticas Aa so resistentes a uma doena infecciosa causada por um protozorio, a qual letal para as pessoas homozigticas AA. Considere regies geogrficas em que a doena infecciosa endmica e regies livres dessa infeco. Espera-se encontrar diferena na freqncia de nascimento de crianas aa entre essas regies? Por qu? Questo 161 Segundo o Teorema de Hardy Weinberg, uma populao ideal deve atingir o equilbrio, ou estado esttico, sem grandes alteraes de seu reservatrio gentico. Em uma das ilhas do arquiplago de Galpagos, uma das condies estabelecidas por Hardy e Weinberg para populaes ideais foi seriamente afetada por uma erupo vulcnica ocorrida h cerca de cem mil anos. Esta erupo teria diminudo drasticamente a populao de jabutis gigantes da ilha. a) Cite duas das condies propostas por Hardy e Weinberg para que o equilbrio possa ser atingido. b) Defina o conceito de evoluo em funo da freqncia dos genes de uma populao e indique de que forma a diminuio da populao afetou a evoluo dos jabutis gigantes. Questo 162 A SOCIOBIOLOGIA procura explicar o comportamento dos indivduos em funo de sua herana gentica. Um dos instrumentos mais utilizados nesses estudos a pesquisa sobre o comportamento de gmeos univitelinos que foram criados em ambientes diferentes. Qual o princpio cientfico dessa abordagem experimental? Questo 163 Pela equao Hardy-Weinberg, p+ 2pq + q= 1, onde p e q so as freqncias de dois alelos. Com essa equao podemos calcular a freqncia de um gentipo sabendo a freqncia de um dos alelos, ou vice-versa, desde que a populao esteja em equilbrio. Numa determinada populao em equilbrio de

Hardy-Weinberg nasceram 10.000 crianas; uma dessas crianas apresentou uma doena, a fenilcetonria, determinada por um gene autossmico recessivo. Calcule a freqncia de indivduos de fentipo normal portadores do gene causador da fenilcetonria nessa populao. Questo 164 Uma populao vegetal que NO est em equilbrio de Hardy-Weinberg, composta por 500 indivduos. Desses, 420 so de flores vermelhas (fentipo dominante) e 80 so de flores brancas (fentipo recessivo). Dos 420 indivduos de flores vermelhas, 380 so homozigticos (VV) e 40 so heterozigticos (Vv). Determine a freqncia dos genes V e a freqncia dos genes v nessa populao. Questo 165 A freqncia gnica de dois alelos em uma populao, numa dada gerao, foi de A= 80% e a=20%. Na gerao seguinte foi observada uma freqncia de A=60% e a=40%. Alguns mecanismos evolutivos que alteram a freqncia dos genes so: 1) Seleo natural; 2) Taxa de mutao gnica; 3) Deriva ao acaso da freqncia gnica, principalmente em populaes pequenas. Qual das trs possibilidades apresentadas NO pode ser aceita para explicar a variao na freqncia dos genes citados? Justifique sua resposta. Questo 166 O grupo sangneo MN determinado por dois alelos codominantes. A freqncia dos gentipos desse grupo sangneo foi amostrada em duas populaes humanas e os resultados so apresentados na tabela a seguir.

35

Questo 169 Em uma populao, um determinado gene apresenta-se em duas formas, a dominante e a recessiva, sendo 36% dos indivduos recessivos. Considerando que tal populao se encontre em equilbrio gentico, podendo-se, portanto, aplicar o Princpio de Hardy-Weimberg, calcule, EM PORCENTAGEM, a freqncia do referido gene na populao. Despreze a parte fracionria de seu resultado, caso exista. Questo 170 Considere duas populaes diferentes, 1 e 2, cada uma com 200 indivduos diplides, portanto, com 400 alelos. A populao 1 apresenta 90 indivduos com gentipo AA, 40 indivduos com gentipo Aa e 70 indivduos com gentipo aa. A populao 2 apresenta 45 indivduos com gentipo AA, 130 indivduos com gentipo Aa e 25 indivduos com gentipo aa. a) Qual a freqncia dos alelos A e a em cada uma das populaes? b) Qual delas tem a maioria dos indivduos homozigotos? Explique. Questo 171 A freqncia do gene i, que determina o grupo sangneo O, de 0,40 (40%) em uma populao em equilbrio. Em uma amostra de 1000 pessoas desta populao, quantas se espera encontrar com sangue do tipo O? Explique as etapas que voc seguiu para chegar resposta. Indique o gentipo das pessoas do grupo sangneo O. Questo 172 Uma caracterstica fenotpica de uma populao, como a cor amarela, determinada por um gene dominante. Esse gene tem um alelo que no produz essa caracterstica. Um estudo dessa populao determinou que a freqncia do fentipo amarelo era de 50% e NO SE SABE se essa populao est em equilbrio de Hardy-Weinberg. Com base nessas informaes, no possvel saber a freqncia do gene para cor amarela. Explique.

1.5.7

Calcule a freqncia do alelo M nas duas populaes e determine se a populao da Europa como um todo uma populao panmtica, isto , uma populao em que os casamentos ocorrem ao acaso. Justifique sua resposta. Questo 167 Numa determinada ilha existia uma populao animal com indivduos possuidores de uma caracterstica normal e indivduos possuidores de uma caracterstica recessiva, numa proporo de 10:1, respectivamente. Mas um desastre ambiental provocou a morte de todos os indivduos com a caracterstica recessiva, alterando de forma brusca a freqncia do gene recessivo na populao da ilha. a) Aps o desastre pode-se afirmar que a freqncia do gene recessivo ser zero? Justifique sua resposta. b) Qual o nome dado a essa alterao brusca na freqncia gnica? Questo 168 Uma das maneiras de verificar se uma determinada espcie est ou no em evoluo fazer um estudo do patrimnio gentico de suas populaes. Usando o teorema de Hardy-Weinberg pode-se determinar as freqncias gnicas de uma populao e demonstrar se a espcie est em equilbrio, isto , em estado de no-evoluo. Entretanto, para que uma populao se mantenha em equilbrio gentico necessrio que ela se enquadre em certas condies. Escreva quatro destas condies:

36

Questo 173 No DNA de um organismo, 18% das bases nitrogenadas so constitudas por citosina. Que outras bases nitrogenadas devem existir neste DNA e em que propores? Justifique sua resposta. Questo 174 Bactrias (Escherichia coli) foram cultivadas durante vrias geraes em um meio de cultura na qual toda a fonte de nitrognio era o istopo pesado N. De uma amostra dessas bactrias (amostra A), extraiu-se o DNA que foi submetido a uma tcnica de centrifugao que permite separar molculas de DNA de acordo com sua densidade. O restante das bactrias foi transferido para um meio de cultura em que todo o nitrognio disponvel era o istopo normal N. Retirou-se uma segunda amostra (amostra B), quando as bactrias completaram uma diviso celular nesse novo meio e uma terceira amostra (amostra C), quando as bactrias completaram duas divises celulares. O DNA das bactrias das amostras B e C foi tambm extrado e centrifugado.

Questo 176 Por que o processo de replicao do DNA chamado semiconservativo? Questo 177 Dada a seqncia de bases nitrogenadas de um segmento de DNA: AAT GGC ATC responda: a) Qual a seqncia de bases da hlice complementar a esse segmento? b) Qual a seqncia de bases do RNA mensageiro transcrito a partir desse segmento? Questo 178 Dada a seqncia de bases nitrogenadas de um segmento de DNA a seguir, responda aos itens adiante. TTT AAT GGG CAT a) Qual a seqncia de bases da hlice complementar a esse segmento? b) Qual a seqncia de bases do RNA mensageiro transcrito a partir desse segmento? Questo 179 Para funcionar como material gentico o cido desoxirribonuclico (DNA) apresenta a capacidade de autoduplicao. Utilizando seus conhecimentos sobre o material gentico, responda: a) Qual a importncia de o DNA autoduplicar-se? b) Por que essa replicao semiconservativa? Questo 180 No DNA de um organismo, 20% das bases nitrogenadas so constitudas por adenina. Que outras bases nitrogenadas devem existir neste DNA e em que propores?

1.5.8.1

A figura mostra o resultado da centrifugao do DNA das trs amostras de bactrias. a) Por que, na amostra B, todo o DNA tem uma densidade intermediria entre o que constitudo apenas por N e o que contm apenas N? b) Considerando que, na amostra C, a quantidade de DNA separada na faixa inferior X, que quantidade de DNA h na faixa superior? Questo 175 Quais so as duas propriedades fundamentais do DNA que permitem a essa substncia desempenhar o papel de material gentico?

37

Questo 181 Mencione duas diferenas de natureza molecular entre o DNA e o RNA. 1.5.8.1 Questo 182 Justifique o termo SEMICONSERVATIVO para caracterizar o processo de replicao do DNA. Questo 183 O que so NUCLEOTDEOS? Quais so as molculas que entram em sua composio qumica? Questo 184 Quais so as diferenas observadas nos nucleotdeos que entram na composio do DNA em relao aos que entram na composio do RNA? Questo 185 O que representa o desenho a seguir? Qual o nome das molculas representadas pelos nmeros 1, 2 e 3, respectivamente, sabendo que se trata da unidade estrutural do cido desoxirribonuclico (DNA)? Questo 187 Uma molcula de DNA contm 15% de guanina. Que outras bases nitrogenadas possui essa molcula e em quais propores? Questo 188 Os cidos nuclicos so macromolculas definidas como polinucleotdeos. a) Represente um nucleotdeo apontando seus trs constituintes moleculares. b) Quais so as diferenas observadas nos nucleotdeos que entram na composio do DNA em relao aos que entram na composio do RNA? Questo 189 1.5.8.1 Para funcionar como material gentico o DNA apresenta duas propriedades fundamentais. So elas: I - AUTODUPLICAO II - TRANSCRIO Explique essas duas propriedades. Questo 186 No desenho a seguir, que representa a estrutura da molcula de DNA, o que representam os nmeros 1, 2 e 3 respectivamente? Questo 190 Sabendo-se que numa molcula de DNA formada por uma dupla hlice h 21% de timina, responda quais so as outras bases dessa molcula e em que propores ocorrem.

38

Questo 191 Considere um segmento de DNA com a seguinte seqncia de bases nitrogenadas: ATT CTA CGC AAA GGC

atravs de observaes de caractersticas morfolgicas e fisiolgicas da clula. Nomeie o processo atravs do qual o DNA capaz de controlar e interferir nas caractersticas morfolgicas e fisiolgicas da clula. Questo 195

a) Quais so as bases da cadeia complementar a esse segmento? b) Se o segmento dado servir de molde para a produo de RNA, qual ser a seqncia de bases desse RNA? Questo 192 Considere a seqncia de bases nitrogenadas de um segmento de DNA: AAA GGC ATT Responda: a) Qual a seqncia de bases da hlice complementar a esse segmento? b) Qual a seqncia de bases do RNA mensageiro transcrito a partir desse segmento? Questo 193 No DNA de um organismo, 32% das bases nitrogenadas so constitudas por citosina. Que outras bases nitrogenadas devem existir neste DNA e em que propores? Questo 194 CLULAS IMORTAIS CONTAM AOS CIENTISTAS HISTRIA DA EVOLUO DA HUMANIDADE Estas clulas formam um livro, conservado em tanques de nitrognio lquido que guarda informaes desconhecidas sobre a humanidade. Os captulos contam diferentes detalhes da saga do homem na terra: suas andanas pelos continentes, casamentos ancestrais e os ataques de doenas. (adaptado de, "O Globo") a) Explique por que o processo de autoduplicao do DNA d significado hereditariedade permitindo revelar a histria da evoluo da humanidade. b) "... suas andanas pelos continentes, casamentos ancestrais e os ataques de doenas" podem ser estudados

Em clulas eucariotas mantidas em cultura, adicionou-se o nucleosdeo uridina marcado radioativamente com H ao meio de cultura. Aps algum tempo, as clulas foram transferidas para um novo meio que no continha o istopo. Amostras destas clulas foram retiradas 3, 15 e 90 minutos aps a transferncia, sendo, ento, colocadas em lmina de vidro, fixadas e submetidas a auto-radiografia. Esse processo marca a posio aproximada do istopo dentro da clula, como representado no esquema a seguir.

1.5.8.1

a) Cite o tipo de molcula qual a uridina se incorporou. Justifique sua resposta. b) Nomeie o compartimento celular que seria marcado, se o nucleosdeo radioativo usado fosse a timidina e justifique sua resposta. Questo 196 Num experimento, foram comparadas as caractersticas genotpicas e fenotpicas de clulas retiradas de um tecido de anfbio, ainda no estgio de girino, com as de clulas de tecido similar do mesmo indivduo aps atingir a idade adulta. Explique por que, entre essas clulas: a) as caractersticas genotpicas so iguais; b) as caractersticas fenotpicas so diferentes.

39

Questo 197 Para desempenhar sua funo como material hereditrio, o DNA possui duas propriedades. Identifique-as e descreva resumidamente cada uma delas. Questo 198 A mutao em um gene humano provoca cegueira. Com a utilizao de tcnicas de gentica clssica e molecular, verificou-se que este gene est localizado no genoma mitocondrial. Sabe-se que todas as mitocndrias dos indivduos afetados pela cegueira no possuem o gene normal, mas sim o gene mutado. a) Informe a percentagem de filhas e filhos cegos de um casal: I) cuja mulher normal e o homem cego; II) cuja mulher cega e o homem normal. b) Justifique as respostas ao item a. Questo 199 O genoma da bactria "Escherichia coli" tem um tamanho de 410 pares de nucleotdeos. J o genoma haplide humano tem 310 pares de nucleotdeos. Para replicar o genoma, antes da diviso celular, existe uma enzima, a DNA polimerase, cuja velocidade de reao equivalente a cerca de 800 nucleotdeos/s. Assim, para replicar todo o genoma de uma bactria, a DNA polimerase consumiria cerca de 83 minutos e, para o genoma humano, aproximadamente 43 dias! Sabemos, no entanto, que o tempo de gerao da "E.coli" de cerca de 20 minutos, e que o tempo mdio de replicao de uma clula eucariota de 12 horas. Assumindo que a DNA polimerase apresenta uma velocidade de reao constante para todas as espcies analisadas, explique essa aparente contradio. Questo 200 O teste de tipagem de DNA revelou que nos seres humanos existe individualidade genmica. Isto significa que cada indivduo possui variaes discretas e caractersticas na

seqncia de seu DNA, ou seja, a seqncia de nucleotdeos do DNA de cada pessoa nica (excetuando-se o caso de gmeos monozigticos). Assim, a tipagem do DNA revela um padro de bandas que estvel (presente no DNA de todos os tecidos) e transmitido aos descendentes seguindo as leis de Mendel. Graas a essas caractersticas possvel atualmente realizar testes de paternidade que comparam os padres de bandas de DNA das pessoas e revelam se um homem de fato o pai biolgico de uma outra pessoa. Suponha agora a seguinte situao: um homem acusado de ser o pai de uma criana tenta burlar o teste de tipagem de DNA; um amigo o aconselha a receber uma transfuso de sangue 2 meses antes do teste (em geral colhe-se o sangue como fonte de clulas nucleadas). a) Qual a influncia da transfuso sugerida no resultado no exame? b) Que precaues podem ser tomadas para desmascarar a tentativa de fraude? Questo 201 A tipagem de DNA uma tcnica desenvolvida recentemente que permite identificar e estabelecer o grau de parentesco entre indivduos. Para se realizar uma anlise patrilnea, isto , a investigao dos ancestrais paternos, usa-se um marcador do cromossomo Y, que no se altera ao longo das geraes (salvo em casos de mutaes). Por outro lado, para uma anlise matrilnea (materna), lana-se mo do DNA mitocondrial. Por que o DNA mitocondrial deve ser usado para a anlise matrilnea? Questo 202 No ADN, a transcrio dos genes no est restrita a somente uma das suas cadeias. Para alguns genes, a seqncia de nucleotdeos transcrita pode estar em uma cadeia, ao passo que a seqncia do outro gene pode estar localizada na cadeia oposta. No entanto, sabe-se que no mesmo trecho nunca ocorre a transcrio simultnea das duas cadeias de uma molcula de ADN. Tal evento inibiria
40

o processo da traduo. Explique por que ocorreria a inibio da traduo se a transcrio de uma cadeia do ADN ocorresse ao mesmo tempo que a transcrio da sua cadeia complementar, no mesmo trecho. Questo 203 Estudos recentes compararam as seqncias completas de DNA mitocondrial de indivduos de vrias regies geogrficas do planeta. Os resultados revelaram que a variabilidade gentica no DNA mitocondrial de indivduos africanos era quase o dobro da observada no DNA mitocondrial de no-africanos. Esses resultados foram importantes para corroborar a idia de que o ancestral comum mais recente do 'Homo sapiens' viveu na frica h cerca de 200.000 anos. Explique por que a maior diversidade do DNA mitocondrial apia a idia da origem africana do 'Homo sapiens'. Questo 204 A soma das porcentagens de guanina e citosina em uma certa molcula de ADN igual a 58% do total de bases presentes. a) Indique as porcentagens das quatro bases, adenina (A), citosina (C), guanina (G) e timina (T), nessa molcula. b) Explique por que impossvel prever a proporo de citosina presente no ARN mensageiro codificado por esse trecho de ADN. Questo 205 Considerando as propriedades de duplicao do DNA, observe o resultado do experimento a seguir. 1 etapa: Em uma cultura com N, obtm-se o crescimento de colnias de bactrias; aps esse crescimento promove-se o desenvolvimento de mais duas geraes, em cultura com N. 2 etapa: Extrai-se o DNA de todas as bactrias e obtm-se o seguinte resultado: Questo 206 A anlise qumica de duas molculas de DNA revelou a seguinte composio de bases: Molcula A 23% de adenina, 23% de timina, 27% de citosina e 27% de guanina; Molcula B 23% de adenina, 23% de timina, 27% de citosina e 27% de guanina. Com base nestes dados: a) O que se pode afirmar a respeito das semelhanas entre estas duas molculas de DNA? b) Justifique sua resposta. - Cultura de crescimento com N: 300 molculas de DNA todas com N. - Cultura de 1 gerao com N: 600 molculas de DNA todas com N e N. - Cultura de 2 gerao com N: 1200 molculas de DNA nas quais 600 com N e 600 com N e N. Explique as porcentagens obtidas em todos os extratos das diferentes culturas no experimento. Justifique sua resposta.

1.5.8.1

41

Questo 207 A anlise qumica em amostras de cinco lminas com cidos nuclicos apresentou os seguintes resultados: 1 lmina: ribose 2 lmina: uracila 3 lmina: dupla-hlice 4 lmina: timina 5 lmina: 15% de guanina e 25% de citosina. a) Entre estas lminas, quais se referem a DNA? b) Justifique o resultado obtido com a 5 lmina. Questo 208 Em 1952, Hershey e Chase cultivaram bactrias em meio de cultura contendo fsforo radioativo (P) e colocaram bacterifagos (vrus) para infectar essas clulas. Os novos bacterifagos formados estavam marcados radioativamente. Estes bacterifagos marcados foram utilizados para infectar outras clulas bacterianas cultivadas sem a presena de fsforo radioativo. A marcao radioativa foi detectada dentro destas bactrias. a) Como se explica que o fsforo radioativo tenha passado para o bacterifago? b) Como se explica que as bactrias cultivadas sem a presena de fsforo radioativo tenham sido marcadas? c) Se, em vez de fsforo, tivesse sido usado enxofre radioativo (S) para marcao de protenas, os resultados seriam os mesmos? Justifique. Questo 209 Em 25 de abril de 1953, um estudo de uma nica pgina na revista inglesa Nature intitulado "A estrutura molecular dos cidos nuclicos", quase ignorado de incio, revolucionou para sempre todas as cincias da vida sejam elas do homem, rato, planta ou bactria. James Watson e Francis Crick descobriram a estrutura do DNA, que permitiu posteriormente decifrar o cdigo gentico determinante para a sntese protica. a) Watson e Crick demonstraram que a estrutura do DNA se assemelha a uma escada retorcida. Explique a que

correspondem os "corrimos" e os "degraus" dessa escada. b) Que relao existe entre DNA, RNA e sntese protica? c) Como podemos diferenciar duas protenas? Questo 210 Cientistas criaram em laboratrio um bacterifago (fago) composto que possui a cpsula protica de um fago T2 e o DNA de um fago T4. Aps esse bacterifago composto infectar uma bactria, os fagos produzidos tero a) a cpsula protica de qual dos fagos? E o DNA, ser de qual deles? b) Justifique sua resposta. Questo 211 No heredograma seguinte, a pessoa A possui uma mutao no DNA de todas as suas mitocndrias, que faz com que a produo de energia para os msculos seja deficiente, ocasionando dificuldades motoras para os portadores do problema. Essa pessoa casou-se com outra, aparentemente normal. O casal (P) teve filhos (F1) e estes, por sua vez, tambm tiveram filhos (F2).

1.5.8.1

a) Copie o heredograma, pintando quais sero as pessoas afetadas pela doena em F1 e em F2 b) Justifique sua resposta. Questo 212 A figura a seguir mostra um trecho da estrutura do cido desoxiribonuclico, ressaltando a interao entre as duas cadeias do polmero. Na figura, A, C, G & T representam as bases adenina, citosina, guanina e timina, respectivamente.

42

Questo 214 Que papis desempenham o RNA mensageiro e do RNA transportador no processo de sntese das protenas? 1.5.8.1 Questo 215 Observe o esquema adiante e responda:

As linhas pontilhadas indicam as pontes de hidrognio que so formadas entre as bases aminadas e que contribuem para manter unidas as duas cadeias do DNA. Essas pontes de hidrognio podem ser rompidas por calor, o que produz a dissociao das cadeias. Esse processo reversvel chama-se de desnaturao. A temperatura necessria para desnaturar o DNA depende de vrios fatores, mas um deles a composio dos nucleotdeos de um determinado DNA. Observe as duas seqncias de DNA a seguir e determine qual delas precisar de uma temperatura de desnaturao maior. Justifique a sua resposta. 1) ACTTTAAAGATATTTACTTAAA TGAAATTTC TATAAATGAATTT 2) GCTAGGCCGATGCGGCGTGGA CGATCCGGCTACGCCGCACCT Questo 213 Considerando o modelo da estrutura molecular do DNA como representado na figura adiante, responda o que representam os componentes 1, 2 e 3, respectivamente.

1.5.8.2

) Quais so as molculas representadas pelos nmeros 1, 2 e 3, respectivamente, sabendo-se que trata-se da unidade estrutural do cido ribonuclico (RNA). b) Qual o nome dessa unidade estrutural? Questo 216 Uma cadeia de RNA tem 200 nucleotdeos. Quantos nucleotdeos tinha o DNA que originou esse RNA? Questo 217 Um segmento de RNA mensageiro apresenta a seqncia de bases nitrogenadas a seguir: AAA UUC GGG GAU. a) Quais so as bases do segmento de DNA que deu origem a esse RNA? b) Quantos nucleotdeos existem no DNA que deu origem a essa molcula de RNA mensageiro? Questo 218 A enzima poligalacturonase, que digere a parede celular de clulas vegetais, a principal responsvel pela maturao de frutos como o tomate. Para retardar o amadurecimento e evitar as perdas durante o armazenamento, utilizou-se uma tcnica na qual o gene que codifica a enzima citada foi inserido, de maneira invertida, no genoma de um tomateiro.
43

1.5.8.1

O esquema adiante mostra os produtos da transcrio do gene normal da enzima e do gene inserido, ambos ativos nesse tomate geneticamente modificado.

Indivduo B CAT AAC TGA GGA ATG CAT TTC (m) GTA TTG ACT CCT TAC GTA AAG Indivduo C CAA TAC TGA GGA ATG CAT TTC (m) GTT ATG ACT CCT TAC GTA AAG

1.5.8.2

1.5.8.3 a) Descreva a interao que ocorre entre os produtos da transcrio dos genes normal e inserido no tomate geneticamente modificado e indique a caracterstica dessas molculas que permite a interao. b) Explique por que haver um aumento no tempo de amadurecimento desse tomate geneticamente modificado. Questo 219 De que maneira o DNA determina a seqncia de aminocidos das molculas de protenas? Questo 220 Uma doena gentica de herana dominante causada por mutaes em um gene localizado em um autossomo. Os indivduos A, B e C tm mutaes em um segmento de DNA desse gene, cuja seqncia normal est representada a seguir. Usando a tabela que relaciona alguns codons aos respectivos aminocidos e considerando que a fita molde a ser transcrita aquela assinalada com a letra m, responda: a) Quais sero os segmentos de protenas produzidos, respectivamente, pelos indivduos A, B e C? b) Como ser o fentipo (normal ou afetado dos indivduos A, B e C? Por qu? Seqncia normal CAA AAC TGA GGA ATG CAT TTC (m) GTT TTG ACT CCT TAC GTA AAG Indivduo A CAA AAC TGA GGA ATT CAT TTC (m) GTT TTG ACT CCT TAA GTA AAG
44

Questo 221 O fumo est relacionado ao aumento de risco para o cncer de pulmo. O hbito de fumar expe os fumantes a substncias com atividade carcinognica. O Benzo[a]pireno, um dos principais agentes carcinognicos presentes na fumaa do cigarro, tem a capacidade de promover mutaes no DNA levando a mudana da base Guanina para Timina. Suponha que um trecho da fita molde de DNA do gene X, representado a seguir, possa ser alterado em presena do Benzo[a]pireno, em um dos dois stios indicados na figura 1. Considere que o RNA mensageiro seja formado a partir das trincas mostradas no esquema da figura 1 a seguir. Indique as alteraes que ocorrero na sntese da protena X quando a mutao for localizada nos diferentes stios, justificando cada resposta com a utilizao do cdigo gentico da figura 2:

Por que sempre encontramos N > P ? Questo 224 1.5.8.3 Com o auxlio da tabela do cdigo gentico representada a seguir, sempre possvel deduzir-se a seqncia de aminocidos de uma protena a partir da seqncia de nucleotdeos do seu gene, ou do RNA-m correspondentes.

Questo 222 As globinas constituem um bom exemplo da importncia da informao gentica na estrutura primria e na funo das protenas. a) Considere o segmento de DNA, cuja seqncia de nucleotdeos 5' - GTG - CAC - CTG - ACT - CCT - GAG - GAG - AAG - 3' e, utilizando-se da tabela do cdigo gentico apresentada a seguir, fornea o produto da sntese protica (polipeptdio parte da cadeia beta prevista para a globina humana).

1.5.8.3

Entretanto, o oposto no verdadeiro, isto , a partir da seqncia de aminocidos de uma protena, no se pode deduzir a seqncia de nucleotdeos do gene. Explique por qu. Questo 225 O DNA dos organismos do planeta Zbohrnya constitudo pelos mesmos 4 tipos de bases dos seres vivos terrestres. J o cdigo gentico desses organismos determinado por cdons de 2 bases. a) As protenas A, B e C, encontradas nos organismos da Terra, apresentam, respectivamente, 13, 16 e 19 tipos diferentes de aminocidos. Explique a possibilidade da ocorrncia dessas trs protenas nos seres de Zbohrnya. b) Sabendo que a vida em Zbohrnya e na Terra existe h 3,5 bilhes de anos, faa uma comparao entre a diversidade dos organismos encontrados nesses dois planetas. c) Se o gene de uma protena respiratria de um organismo zbohrniano for introduzido numa bactria terrestre, a protena produzida pela expresso desse gene ser idntica da espcie zbohrniana? Justifique sua resposta.

1.5.8.3

b) Utilize um exemplo de alterao estrutural da globina humana (cadeia beta) para explicar como uma mutao pontual, do tipo substituio, pode afetar a sade e a qualidade de vida do portador dessa mutao. Questo 223 O ADN um polmero constitudo por vrios nucleotdeos e as protenas so polmeros constitudos por vrios aminocidos. Um gene constitudo por um nmero N de nucleotdeos que codifica uma protena constituda por P aminocidos.

45

Questo 226 Considere a tabela abaixo, contendo cdigos de trincas de bases do DNA com os aminocidos correspondentes, para resolver os itens seguintes:

1.5.8.3

Analise a tabela e faa o que se pede: a) Cite o nome da enzima que catalisa a sntese de RNA mensageiro. b) Cite a seqncia do anticdon correspondente ao cdon de iniciao. c) Qual a seqncia de aminocidos que resultar da traduo da molcula de RNA mensageiro? Ver figura anterior. d) Qual a seqncia de aminocidos que resultar da traduo da mesma molcula de mRNA, aps uma deleo do TERCEIRO nucleotdeo? Questo 228 A seguir est representada a seqncia dos 13 primeiros pares de nucleotdios da regio codificadora de um gene.

a) Determine a seqncia de bases do RNAm que foi utilizado para sintetizar o polipeptdeo esquematizado abaixo da tabela. b) Se ocorresse uma substituio, por uma purina, na 3 base do cdigo correspondente ao 6 aminocido do polipeptdeo, qual seria o aminocido da tabela a ser incorporado? c) Qual anticdon correspondente ao novo aminocido incorporado? Questo 227 A tabela adiante representa uma verso fictcia do cdigo gentico. Entretanto, esse cdigo segue o padro do cdigo gentico universal, no qual trs bases codificam um aminocido.

--- A T G A G T T G G C C T G ----- T A C T C A A C C G G A C --A primeira trinca de pares de bases nitrogenadas esquerda, corresponde ao aminocido metionina. A tabela a seguir mostra alguns cdons do RNA mensageiro e os aminocidos codificados por cada um deles.

1.5.8.4

1.5.8.3

a) Escreva a seqncia de bases nitrogenadas do RNA mensageiro, transcrito a partir desse segmento de DNA. b) Utilizando a tabela de cdigo gentico fornecida, indique a seqncia dos trs aminocidos seguintes metionina, no polipeptdio codificado por esse gene. c) Qual seria a seqncia dos trs primeiros aminocidos de um polipeptdio codificado por um alelo mutante desse gene, originado pela perda do sexto par de nucleotdios (ou seja, a deleo do par de bases T = A)?

46

Questo 229 Sabendo-se que um determinado segmento de DNA apresenta capacidade de transcrever e que apresenta a seqncia de bases TAC TCC GCT TAG e, em sua cadeia complementar, a seqncia ATG AGG CGA ATC, quais so as seqncias de bases de RNAm por ele produzido? Questo 230 Dado um segmento de RNA mensageiro com a seguinte seqncia de bases: AAU GUA GGC pergunta-se: a) Qual a seqncia de bases do DNA que deu origem a esse RNA? b) Quantos aminocidos ter o polipeptdeo traduzido, no ribossomo, a partir desse RNA? Questo 231 Ribossomos so formados por RNA e protenas, sintetizados pelos processos de transcrio e traduo, respectivamente. a) Onde esses processos ocorrem na clula eucaritica? b) O que acontecer com os processos de transcrio e traduo, se ocorrer uma destruio do(s) nuclolo(s) de uma clula?. Questo 232 Sabendo-se que um determinado segmento de DNA apresenta capacidade de transcrever e que apresenta uma seqncia de bases ACTCCGCTT / TGAGGCGAA, quais poderiam ser as seqncias de bases do RNA por ele produzido?

Questo 233 Analisando o genoma de alguns tipos de vrus formados por fita simples de RNA, encontramos aqueles que so RNA (-), como o do resfriado comum, e os que so RNA (+), como o da poliomielite. Observe que: - nos vrus RNA (-), apenas o RNA complementar a seu genoma capaz de funcionar como mensageiro na clula infectada; - nos vrus RNA (+), o genoma viral funciona diretamente como mensageiro; - ambos os vrus necessitam, para sua replicao, da enzima RNA replicase, que sintetiza um RNA complementar a um molde de RNA; - o gene da enzima RNA replicase est presente no genoma dos dois tipos de vrus, mas a enzima s encontrada nas partculas virais RNA (-). a) Explique por que necessrio, para sua replicao, que os vrus RNA (-) j contenham a enzima RNA replicase, enquanto os RNA (+) no precisam armazenar esta enzima. b) Apresente um argumento contrrio hiptese de que os vrus, devido simplicidade de sua estrutura, foram precursores das primeiras clulas. Questo 234 Em um organismo pluricelular com vrios tecidos, como no caso dos seres humanos, todas as clulas possuem um genoma idntico. Analogamente, correto afirmar que os ARN mensageiros (ARNm) dos diferentes tecidos so todos idnticos? Justifique sua resposta Questo 235 Suponha um gene de um eucarioto responsvel pela sntese de uma protena. Nesse gene existem ntrons, ou seja, regies do ADN cujas informaes no esto presentes na protena em questo. As regies do ARN transcrito correspondentes aos ntrons so eliminadas aps o processo de transcrio. A figura a seguir representa o resultado de uma experincia de hibridao do ARN mensageiro com a cadeia de ADN que lhe deu origem.

47

1.5.8.4

a) Faa um esquema simples, formado por palavras e setas, demonstrando como, a partir de uma seqncia de DNA, obtm-se uma protena. b) A partir de uma protena, possvel percorrer o caminho inverso e chegar seqncia de DNA que a gerou? Justifique. Questo 239 Atualmente os genes podem ser desmembrados em trs classes diferentes: os genes que expressam mRNA que codificam polipeptdios diversos; os genes reguladores que codificam protenas que regulam outros genes; e uma terceira classe de genes que no codificam polipeptdios. Qual o produto final da classe de genes que no codificam polipeptdios? Questo 240 O que so cidos nuclicos? Como atuam na sntese de protenas? Questo 241

A figura mostra cinco regies, identificadas por nmeros de 1 a 5. Quais dessas regies correspondem aos ntrons? Justifique sua resposta. Questo 236 Em um segmento da cadeia ativa de DNA, que servir de molde para a fita de RNA mensageiro, h 30 timinas e 20 guaninas. No segmento correspondente da fita complementar do DNA h 12 timinas e 10 guaninas. Levando-se em considerao essas informaes, responda. a) Quantas uracilas e quantas guaninas comporo a fita do RNA mensageiro transcrito do DNA ativado? b) Quantos aminocidos devero compor a cadeia de polipepitdeos que ser formada? Justifique sua resposta. Questo 237 Considere um fragmento de DNA com a seguinte seqncia de bases: GTA GCC TAG e responda: a) Qual ser a seqncia do RNAm transcrito a partir deste DNA? b) O mesmo peptdio ser obtido a partir deste RNAm e do RNAm da fita complementar? Explique. Questo 238 O jornal "Folha de S.Paulo" (23.09.2002) noticiou que um cientista espanhol afirmou ter encontrado protenas no ovo fssil de um dinossauro que poderiam ajud-lo a reconstituir o DNA desses animais.

Certos mutantes nutricionais do fungo Neurospora s conseguem crescer quando aminocidos so adicionados ao meio de cultura. Na tabela a seguir, o sinal (+) significa crescimento, e o sinal (-) significa ausncia de crescimento.

1.5.8.5

48

Sabe-se que as etapas que levam sntese da arginina so: substrato (gene1) ornitina (gene2) citrulina (gene3) arginina Supondo que em cada mutante h apenas um gene alterado, explique o porqu do mutante Z s crescer quando se adiciona arginina ao meio de cultura. Questo 242 Os cdons AGA, CUG, e ACU do RNA mensageiro codificam, respectivamente os aminocidos arginina, leucina e treonina. Escreva esses aminocidos na ordem correspondente seqncia TGA - TCT - GAC de um segmento de DNA. Questo 243 Quais os papis do gene e do ribossomo na sntese das protenas celulares? Questo 244 Para investigar possveis efeitos de uma determinada droga, utilizou-se uma cultura de clulas, qual foram adicionadas quantidades adequadas das seguintes substncias, marcadas com istopos: uridina C, timidina H e leucina N. Aps algum tempo, a droga foi tambm introduzida no meio de cultura. Ao longo do experimento, amostras das clulas foram coletadas a intervalos regulares. A incorporao dos istopos foi medida em uma preparao que contm os cidos nuclicos e as protenas da clula. Os resultados do experimento esto mostrados no grfico a seguir.

a) Considere as etapas de replicao, transcrio e traduo nas clulas analisadas. Indique se a droga interfere em cada uma dessas etapas e justifique suas respostas. b) As protenas, aps sintetizadas, adquirem uma conformao tridimensional. Cite duas ligaes ou interaes que atuam na manuteno da estrutura enovelada das protenas. Questo 245 Diversas tcnicas so utilizadas para determinar, em genes de uma clula eucariota, a seqncia de bases nitrogenadas codificantes, ou seja, aquela que define a estrutura primria da protena a ser sintetizada. A abordagem experimental mais freqente, hoje, consiste em, primeiramente, extrair os RNA-mensageiros da clula, sintetizar os seus DNA-complementares e, ento, proceder ao seqenciamento das bases presentes nesses DNA. Em uma bactria, no entanto, possvel determinar a seqncia codificante diretamente a partir de seu cromossomo. Explique o motivo pelo qual, em organismos eucariotos, prefervel utilizar o RNA-mensageiro para determinar a regio codificante do DNA. Questo 246 Os grficos a seguir representam o efeito inibitrio de dois antibiticos (I e II) sobre a sntese protica em culturas de 'Staphylococcus aureus'. As setas nos grficos indicam o momento em que foram administrados os antibiticos nas culturas.

1.5.8.5

1.5.8.5

Com base nos grficos, explique a atuao dos antibiticos I e II sobre a sntese protica.

49

Questo 247 Na espcie humana h dois tipos de hemoglobinas, conhecidas como hemoglobinas A e S, que diferem apenas em um aminocido: Hemoglobina A: ...valina-histidina-leucina-treonina-prolina-cido glutmico... Hemoglobina S: ...valina-histidina-leucina-treonina-prolina-x... Essa pequena diferena suficiente para determinar que uma pessoa portadora de hemoglobina S sofra de anemia falciforme. Os cdons de RNA-m que codificam esses aminocidos so: valina - GUU, GUG, GUC, GUA histidina - CAU, CAC leucina - UUG, UUA treonina - ACU, ACC, ACG, ACA prolina - CCU, CCC, CCG, CCA cido glutmico - GAG, GAA A mutao pode ocorrer no ADN como mostra o esquema a seguir:

Questo 248 Nos procariotos, o sinal para o incio da sntese das protenas (traduo) geralmente sinalizado no ARNm pelo cdon AUG, que corresponde ao aminocido metionina. No entanto, alm do cdigo AUG, existe uma seqncia curta de nucleotdeos que antecede esse cdon. Essa seqncia, que chamada de Shine-Dalgarno, em homenagem aos pesquisadores que as detectaram, permite que o stio correto de iniciao da traduo seja selecionado. O diagrama a seguir ilustra a localizao dessa seqncia. A seqncia de Shine-Dalgarno est em vermelho e o cdon de iniciao, em azul.

1.5.8.5

Explique a importncia desse duplo controle da iniciao para a traduo correta da mensagem contida no ARNm. Questo 249 Nos anos 50 e 60, quando se iniciavam as pesquisas sobre como o DNA codificava os aminocidos de uma protena, um grupo de pesquisadores desenvolveu o seguinte experimento: 1.5.8.5 - Sintetizaram uma cadeia de DNA com trs nucleotdeos repetidos muitas vezes em uma seqncia conhecida: ...AGCAGCAGCAGCAGCAGCAGCAGC... - Essa cadeia de DNA foi usada em um sistema livre de clulas, porm no qual haviam todos os componentes necessrios sntese protica, incluindo os diferentes aminocidos. - Nesse sistema, essa cadeia de DNA sempre produzia uma protena com um nico tipo de aminocido. Diferentes repeties do experimento demonstraram que at trs protenas diferentes poderiam ser produzidas, cada uma delas com um nico tipo de aminocido: serina ou alanina
50

a) Qual o aminocido que aparece, na hemoglobina S, no lugar do cido glutmico? Justifique sua resposta. b) Todas as clulas, a partir da clula que sofre a mutao, sero anmalas? Justifique sua resposta.

ou glutamina. a) Por que as protenas obtidas possuam apenas um tipo de aminocido? b) Por que foram obtidos 3 tipos de protenas? Questo 250 O metabolismo celular controlado por uma srie de reaes em que esto envolvidas inmeras protenas. Uma mutao gnica pode determinar a alterao ou a ausncia de algumas dessas protenas, levando a mudanas no ciclo de vida da clula. a) Explique a relao que existe entre gene e protena. b) Por que podem ocorrer alteraes nas protenas quando o gene sofre mutao? c) Em que situao uma mutao no altera a molcula protica? Questo 251 Abaixo esto esquematizadas as seqncias de aminocidos de um trecho de uma protena homloga, em quatro espcies prximas. Cada letra representa um aminocido.

Questo 252 O esquema a seguir representa a seqncia de reaes que levam formao do pigmento da pelagem de uma espcie animal. Os genes autossmicos A, B e C so responsveis pela produo das enzimas A, B e C que atuam nesse processo metablico. Mutaes nos genes A, B e C produzem respectivamente os alelos recessivos a, b e c.

1.5.8.5

a) Do ponto de vista gentico, quantos tipos de albinismo podem ocorrer nessa espcie? Por qu? b) Demonstre o fentipo esperado de um cruzamento entre animais de linhagens puras com dois tipos diferentes de albinismo. c) possvel ocorrer uma mutao em um gene sem que se altere a enzima correspondente? Justifique. Questo 253 Uma fita de DNA tem a seguinte seqncia de bases 5'ATGCGT3'. a) Considerando que tenha ocorrido a ao da DNA-polimerase, qual ser a seqncia de bases da fita complementar? b) Se a fita complementar for usada durante a transcrio, qual ser a seqncia de bases do RNA resultante e que nome recebe esse RNA se ele traduzir para sntese de protenas? Questo 254

1.5.8.5

a) Quantos nucleotdeos so necessrios para codificar a seqncia de aminocidos nas espcies 1 e 2? Justifique. b) Pode-se dizer que seqncias idnticas de aminocidos so sempre codificadas por seqncias idnticas de nucleotdeos? Justifique. c) Considerando que as espcies 2, 3 e 4 se originaram da espcie 1, que tipo de mutao originou cada seqncia?

Sabe-se que a bactria 'E.coli' cresce mais rapidamente na presena da glicose (um monossacardeo) do que na presena de lactose (um dissacardeo). Isso se deve a dois fatos: primeiro, a lactose no to facilmente incorporada pelas bactrias; segundo, porque a lactose necessita ser
51

hidrolisada pela enzima -galactosidase em glicose e galactose. O grfico a seguir resultou de experimento em que 'E.coli' foi inoculada num meio contendo uma mistura de glicose e lactose. As curvas no grfico adiante representam a concentrao da enzima -galactosidase, a concentrao de glicose e o nmero de bactrias no meio de cultura em funo do tempo.

Questo 258 Descreva o experimento realizado por Hersey e Chase em 1952, conhecido como "experincia do liquidificador" na qual utilizaram istopos radioativos de enxofre (S) e de fsforo (P) para 'marcar' vrus parasitas de bactrias, bem como suas concluses a partir deste trabalho. Questo 259 A mula um animal oriundo do cruzamento da gua (2n=64) e do burro (2n=62). Em relao a esses trs animais e ao processo de origem da mula, RESPONDA: a) Qual o nmero de cromossomos encontrado nas clulas sexuais normais da gua e do burro? b) Qual o nmero de cromossomos encontrado nas clulas somticas da mula? Como essas clulas se originam? c) Apesar de a mula apresentar uma alta capacidade de realizar trabalho, ela estril. EXPLIQUE os motivos que levam a tal esterilidade. Questo 260 O esquema a seguir mostra, simplificadamente, a formao de um zigoto hbrido, resultante do cruzamento entre duas espcies.

1.5.8.5

Identifique as curvas da figura, correlacione os parmetros concentrao de -galactosidase, concentrao de glicose e nmero de bactrias e explique o comportamento da curva da enzima -galactosidase. Questo 255 Descreva os principais passos seguidos por Griffth em 1928 no experimento que demonstra a "transformao" de bactrias pneumococos sem cpsula, no-patognicas, em pneumococos com cpsula, patognicas. Questo 256 Como os cientistas O. Avery, M. MacLeod e M. McCarthy chegaram concluso, em 1944, de que o "agente transformante" capaz de permitir o desenvolvimento da cpsula em pneumococos no-capsulados era o cido desoxirribonuclico? Questo 257 O que so bacterifagos? Qual sua importncia na identificao do DNA como material gentico?

1.5.9.1

Suponha que os zigotos podem crescer normalmente, dando origem a indivduos adultos. a) possvel a reproduo dos zigotos pela via da reproduo sexuada? Justifique sua resposta. b) E possvel pela via da reproduo assexuada? Justifique sua resposta.

52

Questo 261 Ao analisar o caritipo de clulas obtidas de uma criana com sndrome de Down, observou-se que 70% das clulas apresentavam 47 cromossomos, por exibirem a trissomia do cromossomo 21, e que 30% das clulas apresentavam um caritipo normal, ou seja, 46 cromossomos, sem trissomia do 21. Responda se o fenmeno da no-disjuno do par de cromossomos 21 ocorreu antes ou depois da formao do zigoto. Justifique sua resposta. Questo 262 Tendo um homem ingerido uma substncia que causa erros na diviso meitica da gametognese, observou-se, neste indivduo, a no disjuno do cromossomo X e a gerao de espermatozides defeituosos. Que tipos de anomalias cromossmicas podero ser formadas se esses espermatozides fecundarem ovcitos normais? Justifique. Questo 263 Numa dada espcie, um indivduo trissmico apresenta um caritipo contendo 97 cromossomos. Qual o nmero de cromossomos que deve ser encontrado em um espermatozide normal nessa espcie? Questo 264 A ilustrao adiante mostra o caritipo de um indivduo do sexo masculino com Sndrome de Down.

Adaptado de Amabis, J. M e Martho, G. R. "Biologia das clulas". So Paulo: Moderna. 2002. a) Qual a aneuploidia existente na Sndrome de Down? b) Quais so os mecanismos responsveis pelo aparecimento desta aneuploidia? c) Qual a relao existente entre idade materna e a Sndrome de Down? Questo 265 A Sndrome de Down caracteriza-se pela presena de um cromossomo 21 a mais nas clulas dos indivduos afetados. Esse problema pode ser decorrente da no-disjuno do cromossomo 21 em dois momentos durante a formao dos gametas. Considerando a ocorrncia de tal no-disjuno, responda. a) Em quais momentos ela pode ocorrer? b) Utilize os contornos a seguir para representar uma das duas possibilidades, indicando na lacuna pontilhada qual delas foi escolhida para ser representada.

1.5.9.1

Questo 266 1.5.9.1 Uma alterao no DNA pode modificar o funcionamento de uma clula. Por qu? Questo 267 O quadro a seguir destaca dois conceitos biolgicos: cncer e sistema respiratrio de insetos.

53

2) mutao (modificao da seqncia de nucleotdeos de uma molcula de ADN); e 3) segregao independente (recombinao aleatria de cromossomos dos diferentes pares de homlogos). 1.5.9.3 Identifique qual(is) deste(s) fator(es) pode(m) contribuir para a variabilidade gentica da laranja-da-baa. Justifique sua resposta. Questo 271 a) Faa uma breve descrio de como o nefasto hbito de fumar est associado ao desenvolvimento de cncer de pulmo, garantindo que em seu texto apaream, de forma relacionada, os seguintes conceitos: tumor, mutao, fumo, proliferao celular descontrolada, genes reguladores da diviso celular. b) Descreva o caminho da fumaa de um cigarro desde o meio externo at as clulas do corpo de uma barata. Questo 268 A substituio de uma nica base na molcula de DNA leva necessariamente substituio de um aminocido na protena a ser sintetizada pela clula. Certo ou errado? Justifique. Questo 269 Qualquer alterao no DNA pode modificar o funcionamento de uma clula? Justifique. Questo 270 A laranja-da-baa surgiu em 1810 e, por no possuir sementes, tem sido propagada assexuadamente atravs de mudas e enxertia. Por ser uma variedade triplide (3n) de laranja, sua meiose anormal, no produzindo gametas viveis. Atualmente, milhes de ps de laranja-da-baa esto espalhados em plantaes no Brasil e nos Estados Unidos. Sabe-se que a variabilidade gentica de uma populao depende dos seguintes fatores: 1) permutao cromossmica ou crossing-over (troca de fragmentos entre cromossomos de um mesmo par de homlogos); Aps tratar culturas de bactrias com doses de um agente mutagnico capaz de induzir uma nica mutao pontual (que afeta apenas um nucleotdeo por clula), analisou-se a seqncia de aminocidos de uma determinada protena em diversos mutantes gerados. Verificou-se que um desses mutantes produzia uma dada protena que diferia da original pela ausncia de 35 aminocidos em uma das extremidades da cadeia peptdica. Explique como essa nica mutao pontual pode fazer com que a sntese da protena seja interrompida prematuramente. Questo 272 A anemia falciforme uma doena que resulta da substituio de um aminocido cido glutmico pela valina, na hemoglobina. Examinando a tabela do cdigo gentico a seguir, possvel identificar as alteraes no RNA que formam o cdon da valina na hemoglobina da anemia falciforme.

1.5.9.3

Identifique as duas alteraes nos cdons do RNA que mais provavelmente explicariam a transformao de cido glutmico em valina. Justifique a sua resposta.

54

Questo 273 As seqncias de RNA mensageiro a seguir codificam peptdeos com atividades biolgicas especficas. Suponha que mutaes no DNA tenham causado as seguintes mudanas nas duas molculas de mRNA (1 e 2). A tabela resumida do cdigo gentico mostra alguns cdons e seus aminocidos correspondentes.

agente de natureza biolgica que podem aumentar a taxa de mutaes gnicas, aumentando assim a probabilidade de desenvolvimento de cncer. Questo 275 Em um segmento de DNA que codifica determinada protena, considere duas situaes: a) um nucleotdeo suprimido; b) um nucleotdeo substitudo por outro. A situao "a", geralmente, mais drstica que a situao "b". Explique por qu. Questo 276 Entre os diferentes tipos de processos que criam nova variabilidade gentica, a duplicao gnica muito importante na criao de novidades evolutivas. Nesse tipo de mutao, um determinado gene, alm de replicar-se, tem sua seqncia duplicada e acrescentada ao DNA, de forma que o indivduo passa a apresentar uma ou mais cpias do mesmo gene no mesmo cromossomo. a) Qual a vantagem desse tipo de mutao no aparecimento de novas espcies? b) Se uma mutao gnica ocorre em um dos genes duplicados, fazendo com que o gene no funcione, o indivduo morre? Justifique sua resposta. Questo 277 FIM DA 2 GUERRA MUNDIAL - BOMBA ATMICA SESSENTA ANOS DE TERROR NUCLEAR Destrudas por bombas, Hiroshima e Nagasaki hoje lideram luta contra essas armas Domingo, 31 de julho de 2005 - "O GLOBO" Gilberto Scofield Jr. Enviado especial Hiroshima, Japo "Shizuko Abe tinha 18 anos no dia 6 de agosto de 1945 e, como todos os jovens japoneses durante a Segunda Guerra Mundial, ela havia abandonado os estudos para se dedicar ao esforo de guerra. Era um dia claro e quente de vero e s 8h, Shizuko e seus colegas iniciavam a derrubada de parte das casas de madeira do centro de Hiroshima para tentar criar um cordo de isolamento antiincndio no caso de um bombardeio incendirio areo. quela altura,
55

1.5.9.3

Em qual das mudanas (1 ou 2) h risco de perda ou de diminuio da atividade biolgica? Justifique sua resposta. Questo 274 Analise as seguintes informaes. I. A renovao dos tecidos requer um controle complexo para coordenar o comportamento de clulas individuais e as necessidades do organismo como um todo. As clulas devem dividir-se e conter a diviso, sobreviver e morrer, manter uma especializao caracterstica apropriada e ocupar o lugar apropriado, sempre de acordo com as necessidades do organismo. Sabe-se que essas funes so geneticamente controladas. II. Em 2001 a indstria Shell do Brasil S.A. foi responsabilizada pela contaminao das reas em torno de sua fbrica de agrotxicos em Paulnia, SP, com resduos de Endrin, Diedrin e Aldrin. Um aumento significativo no nmero de casos de cncer na regio tem sido associado exposio dos moradores a essas substncias. a) Que relaes podem ser estabelecidas entre as informaes I e II? Inclua na sua resposta os conceitos de "mutao gnica", "agentes mutagnicos", "descontrole dos mecanismos de diviso celular" e "cncer". b) D exemplos de um agente de natureza fsica e de um

ningum imaginava que Hiroshima seria o laboratrio de outro tipo de bombardeio, muito mais devastador e letal, para o qual os abrigos antiincndio foram inteis". "Hiroshima, Japo. Passear pelas ruas de Hiroshima hoje 60 anos depois da tragdia que matou 140 mil pessoas e deixou cicatrizes eternas em outros 60 mil, numa populao de 400 mil - nunca esquecer o passado. Apesar de rica e moderna com seus 1,1 milho de habitantes circulando em bem cuidadas ruas e avenidas, os monumentos s vtimas do terror atmico esto em todos os lugares". Aps sessenta anos da exploso da bomba atmica sobre as cidades de Hiroshima e Nagasaki, no Japo, as populaes dessas cidades continuam a ser monitoradas. Com base nos efeitos biolgicos das radiaes sobre os seres vivos, aponte dois motivos pelos quais essas populaes humanas devem ser monitoradas ainda hoje. Questo 278 Os recentes testes nucleares e o cinqentenrio da exploso da bomba atmica em Hiroshima e Nagasaki em 1995 provocaram discusses sobre os efeitos da radiao no meio ambiente e nos seres humanos. Dados mostram que a incidncia do cncer nas duas cidades japonesas muito alta. a) Como a radiao est relacionada ao aumento na incidncia de cncer? b) Como se explica que muitos dos efeitos da bomba atmica se manifestem nos descendentes dos sobreviventes? c) Por que algumas pessoas que foram viver nessas cidades tempos depois da exploso tambm foram afetadas? Questo 279 Soros e vacinas fazem parte do arsenal usado no combate s doenas infecciosas (imunidade adquirida). Compare, respectivamente, a ao do soro e da vacina segundo estes tpicos: 1- A natureza da imunizao 2- A ao imediata ou no 3- A durao da imunizao 4- O emprego curativo ou preventivo

Questo 280 As bactrias podem vencer a barreira da pele, por exemplo num ferimento, e entrar em nosso corpo. O sistema imunitrio age para combat-las. a) Nesse combate, uma reao inicial inespecfica efetuada por clulas do sangue. Indique o processo que leva destruio do patgeno bem como as clulas que o realizam. b) Indique a reao de combate que especfica para cada agente infeccioso e as clulas diretamente responsveis por esse tipo de resposta. Questo 281 Explique o que uma vacina e como funciona. Questo 282 Sobre a vacina, responda: a) Para que usada? b) De que feita? c) Como funciona? Questo 283 Um protozorio conhecido como 'Trypanosoma gambiense' provoca no homem a chamada "doena do sono", que transmitida pela picada da mosca ts-ts. O estudo da reao imunitria do organismo humano aos antgenos da superfcie dos parasitas est demonstrado no esquema abaixo.

1.5.10

56

a) Explique por que os parasitas com antgeno A desapareceram na semana 2 e cite o principal tipo celular participante da reao responsvel por esse desaparecimento. b) Justifique o aumento do nmero de parasitas com antgeno B na semana 2. Questo 284 A funo do sistema imunolgico a de defender o organismo contra invasores. Bactrias, vrus, fungos, tecidos ou rgos transplantados, e mesmo simples molculas, podem ser reconhecidos pelo organismo como agentes agressores. a) Os grficos a seguir mostram a variao da concentrao de anticorpos contra um determinado antgeno no sangue de uma pessoa, em funo do tempo, em duas condies: vacinao ou soroterapia.

Questo 285 O termo amamentao designa o ato de amamentar, de aceitar uma criana no prprio peito. Mais do que um simples ato de amor, representa a maneira mais eficiente e prtica de alimentar e nutrir o filho sem os riscos que a alimentao artificial pode oferecer. Escreva a importncia da amamentao PARA A ME E PARA O FILHO. Questo 286 As respostas imunolgicas constituem mecanismos de defesa vitais para os organismos. A esse respeito, a) explique a diferena entre a resposta ativa e a passiva; b) apresente um exemplo de imunizao ativa artificial e um de imunizao passiva natural. Questo 287 Um casal tem quatro filhos: Joo, Maria, Paulo e Luisa. Dois dos filhos do casal so gmeos monozigticos e os outros dois so gmeos dizigticos. Joo, um dos gmeos monozigticos, precisa de um transplante de um rgo. Qual seria a pessoa da famlia mais indicada para ser o doador? Justifique sua resposta. Questo 288 As curvas abaixo mostram a produo de anticorpos especficos de dois indivduos inoculados com antgenos proticos do vrus X no dia 0. Com base nas respostas de cada um deles ao antgeno, suspeitou-se de que um dos indivduos fosse originrio de uma regio onde a infeo pelo vrus X atinge grande nmero de indivduos. Qual dos dois indivduos originrio da regio com alta incidncia do vrus X? Justifique.

1.5.10

Um dos grficos mostrados corresponde variao da concentrao de anticorpo antiofdico no sangue de uma pessoa mordida por uma serpente e tratada com uma dose do soro apropriado. Justifique por que esse tratamento deve ser feito logo aps a picada do animal e, por que, em casos mais graves, deve ser repetido a intervalos de tempo relativamente curtos. b) Na eritroblastose fetal, a me produz anticorpos contra o fator Rh do filho. A doena s se manifesta, porm, a partir da segunda gravidez. Indique a condio que deve estar presente no feto para o desenvolvimento da eritroblastose em filhos de mulheres que no produzem fator Rh. Explique por que, mesmo nessas circunstncias, o primeiro filho nunca afetado.

57

1.5.10

1.5.10

Questo 289 A febre aftosa uma doena virtica que afeta diversos animais de importncia econmica, tais como vacas e ovelhas. Pases que no vacinam seus rebanhos contra febre aftosa restringem a importao de carne de pases onde a vacinao ocorre, dificultando as relaes comerciais internacionais. As restries importao de carne se baseiam no fato de que os testes disponveis utilizam a deteco de anticorpos contra o vrus, e no a deteco do prprio vrus na carne. Estes testes geram resultados semelhantes para animais vacinados e animais que contraram a doena. Determine se os resultados dos testes seriam positivos ou negativos tanto para animais infectados quanto para vacinados. Justifique sua resposta. Questo 290 A resposta imune de seis voluntrios a trs diferentes antgenos (A, B e C) do parasita causador da malria (plasmdio) foi testada em uma pesquisa. A figura a seguir, que mostra o ttulo (quantidade) de anticorpos especficos contra os antgenos A, B e C no soro de cada um dos voluntrios, indica os resultados observados. O voluntrio 6 no recebeu nenhum dos antgenos, mas sim uma substncia incua (placebo) para servir de controle negativo.

Com base nos resultados apresentados, avalie se a estratgia de vacinao com esses antgenos seria eficaz. Justifique sua resposta. Questo 291 No caso de algumas doenas infecciosas, pode-se considerar que toda a populao est protegida se uma alta proporo dos indivduos estiver imunizada. Tal fenmeno denominado imunidade de grupo. a) Explique por que a imunidade de grupo eficiente no controle de doenas como a gripe. b) Explique por que a imunidade de grupo no eficiente no controle de doenas como, por exemplo, o clera e a hepatite. Questo 292 Uma pessoa foi contaminada por uma substncia txica, de origem orgnica. Para trat-la o mdico introduziu em seu organismo uma substncia especfica. Cinco meses depois desse evento, a pessoa foi novamente contaminada e outra vez a substncia especfica foi usada, pelo mdico, como medicamento. O grfico a seguir reproduz os dois momentos em que ocorreram as contaminaes. A linha pontilhada representa a SUBSTNCIA TXICA, enquanto a linha contnua representa a SUBSTNCIA ESPECFICA.

58

1.5.10

1.5.10

A substncia especfica de combate, inoculada no paciente, um soro ou uma vacina? Justifique sua resposta. Questo 293 O grfico a seguir mostra as respostas primria e secundria da produo de anticorpos quando um indivduo submetido a injees de antgenos.

Questo 295 Analise o grfico, que descreve causas de bitos humanos nos Estados Unidos no incio e no final do sculo XX.

1.5.10

1.5.10

Analisando o grfico, responda: a) Qual a funo do antgeno e qual curva corresponde s respostas primria e secundria? b) Explique o que acontece em relao aos anticorpos nas fases das respostas primria e secundria. Questo 294 O grfico representa o resultado de duas aplicaes de um mesmo antgeno, em intervalos diferentes. a) A que tipo de imunizao se referem as aplicaes? b) Analise os resultados apresentados pelo grfico e explique o fato observado com a 2 aplicao do antgeno.

Considerando que esse quadro retrata as condies encontradas em outros pases industrializados, responda. a) Que tendncia pode ser observada quando se comparam as taxas de mortalidade por doenas contagiosas e por doenas degenerativas (tambm chamadas "doenas da velhice") no incio e no final do sculo XX? b) Cite dois fatores que podem explicar as mudanas observadas nas taxas de mortalidade por doenas contagiosas. Questo 296 Leia os seguintes fragmentos de textos: 1. Edward Jenner, um mdico ingls, observou no final do sculo XVIII que um nmero expressivo de pessoas mostrava-se imune varola. Todas eram ordenhadoras e tinham se contaminado com "cowpox", uma doena do gado semelhante varola pela formao de pstulas, mas que no causava a morte dos animais. Aps uma srie de experincias, constatou que estes indivduos mantinham-se
59

refratrios varola, mesmo quando inoculados com o vrus. (www.bio.fiocruz.br) 2. A 6 de julho de 1885, chegava ao laboratrio de Louis Pasteur um menino alsaciano de nove anos, Joseph Meister, que havia sido mordido por um co raivoso. Pasteur, que vinha desenvolvendo pesquisas na atenuao do vrus da raiva, injetou na criana material proveniente de medula de um coelho infectado. Ao todo, foram 13 inoculaes, cada uma com material mais virulento. Meister no chegou a contrair a doena. (www.bio.fiocruz.br) a) Qual dos fragmentos, 1 ou 2, refere-se a processos de imunizao passiva? Justifique sua resposta. b) Que tipos de produtos (medicamentos) puderam ser produzidos a partir das experincias relatadas, respectivamente, nos fragmentos de textos 1 e 2? Que relao existe entre o fenmeno observado no relato 1 e as chamadas clulas de memria? Questo 297 Jararaca, cascavel, coral e urutu so exemplos de cobras venenosas que ocorrem no Brasil. Se picada por uma delas, a vtima deve ser tratada com soro antiofdico. O soro antiofdico poderia ser denominado vacina antiofdica? Explique. Questo 298 Os mdicos verificam se os gnglios linfticos esto inchados e doloridos para avaliar se o paciente apresenta algum processo infeccioso. O sistema imunitrio, que atua no combate a infeces, constitudo por diferentes tipos de glbulos brancos e pelos rgos responsveis pela produo e maturao desses glbulos. a) Explique como macrfagos, linfcitos T e linfcitos B atuam no sistema imunitrio. b) Explique que mecanismos induzem a proliferao de linfcitos nos gnglios linfticos.

Questo 299 Observe atentamente os dois grficos apresentados. Grfico 1: Cobertura da vacinao contra sarampo em menores de um ano no Brasil, de 1980 a 1997. Grfico 2: Taxa da incidncia anual de sarampo em menores de um ano no Brasil, de 1982 a 1997.

1.5.10

(Programa Nacional de Imunizaes, Ministrio da Sade.) a) O grfico 2 indica claramente a ocorrncia de epidemias de sarampo em dois anos distintos no Brasil. Para reduzir rapidamente e de imediato o nmero de doentes durante uma epidemia, mais eficiente o uso do soro ou da vacina? Justifique. b) Considere, nos dois grficos, o ano de 1997. mais correto supor que, ao longo desse ano, os resultados representados no grfico 1 tenham influenciado os resultados representados no grfico 2 ou o inverso? Justifique. Questo 300 Procurando compreender a importncia de determinadas clulas sangneas para o sistema imunolgico, foi feito o seguinte experimento:

60

1.5.10

respectivamente, no contribuem para o acrscimo de massa. O fruto de uma planta de gentipo AABB tem 40 gramas de massa enquanto o de uma planta de gentipo aabb tem 20 gramas. Determine a massa do fruto de uma planta de gentipo AABb. Justifique sua resposta. Questo 303 O peso dos frutos (fentipos) de uma determinada espcie vegetal varia de 150g a 300g. Do cruzamento entre linhagens homozigticas que produzem frutos de 150g, com linhagens homozigticas que produzem frutos de 300g, obteve-se uma gerao F que, autofecundada, originou 7 fentipos diferentes. Sabendo-se que o peso do fruto um caso de herana quantitativa, reponda: a) quantos pares de genes esto envolvidos na determinao do peso dos frutos desta espcie vegetal? b) qual o efeito aditivo de cada gene? c) de acordo com o tringulo de Pascal, qual a proporo de cada classe fenotpica obtida em F? Questo 304 A altura dos espcimes de uma determinada planta encontrada no cerrado varia entre 12cm e 108cm. Os responsveis por essa variao so 3 pares de genes com segregao independente, que interferem igualmente na altura da planta. Determine a altura, em centmetros, esperada para a primeira gerao de um cruzamento entre dois indivduos com os gentipos AABBCC e aabbCC. Questo 305 Em um concurso de ces, duas caractersticas so condicionadas por genes dominantes (A e B). O homozigoto dominante para estas duas caractersticas recebe mais pontos que os heterozigotos e estes, mais pontos que os recessivos, que ganham nota zero. Um criador, desejando participar do concurso, cruzou um macho e uma fmea, ambos heterozigotos para os dois genes, obtendo uma descendncia com todos os gentipos possveis.
61

Com base no exposto, responda s perguntas a seguir. a) Que tipo especfico de clula sangnea foi afetada pela irradiao? b) Que tipo de molcula essa clula do sangue passa a produzir quando estimulada pela protena estranha? c) A introduo de molculas estranhas ao organismo com o objetivo de provocar uma resposta imune um mtodo bastante usado na preveno de determinadas doenas. Qual o nome que se d a esse mtodo profiltico? Questo 301 Atualmente, o Governo Federal vem discutindo a implantao de quotas para negros nas universidades. Considerando a cor da pele de negros e de brancos responda: a) Onde determinada, histolgica e citologicamente a cor da pele? Histologicamente: Citologicamente: b) O que confere a diferena na cor da pele de indivduos negros em relao dos indivduos brancos? c) Evolutivamente, qual a importncia da existncia dessa variabilidade na cor da pele para o ser humano? d) Especifique a forma de herana gentica responsvel pela determinao da cor da pele. Questo 302 A massa de um determinado tipo de fruto depende da ao de dois genes A e B, no alelos, independentes e de ao cumulativa (polimeria). Esses genes contribuem com valores idnticos para o acrscimo de massa. Os genes a e b, alelos de A e B

a) Qual a probabilidade do criador obter um animal com a pontuao mxima? Qual a probabilidade de obter um animal homozigoto recessivo para os dois genes? b) Considerando que todos os descendentes do referido cruzamento participaram do concurso, e que cada gene dominante contribui com 5 pontos na premiao, quantos pontos devem ter obtido os vice-campees e os ces classificados em penltimo lugar? Questo 306 Certas caractersticas fenotpicas so determinadas por poucos genes (herana mendeliana), enquanto outras so determinadas por muitos genes (herana polignica). Qual dos dois mecanismos explica a maior parte das variaes fenotpicas nas populaes? Justifique. Questo 307 Um pesquisador cruzou paineiras de flores "pink" com paineiras de flores brancas. Os descendentes (F) foram cruzados entre si, produzindo sempre as seguintes freqncias fenotpicas na gerao (F):

Questo 309 A cor da pelagem em coelhos determinada por uma srie de alelos mltiplos composta pelos genes C, c, c e c, responsveis pelos fentipos aguti, chinchila, himalaio e albino, respectivamente. A ordem de dominncia existente entre os genes C > c > c > c. Responda: a) Quais as propores fenotpicas e genotpicas esperadas na prognie do cruzamento entre um coelho aguti (Cc) e um coelho chinchila (cc)? b) Como voc explicaria o aparecimento de coelhos albinos a partir de um cruzamento entre coelhos himalaios? Questo 310 As videiras podem produzir uvas de colorao vermelha, vinho, rosa e amarela. O cruzamento entre plantas com esses fentipos produziu as seguintes proles na gerao F1.

1.5.12

1.5.11 Com base nos resultados apresentados, responda ao que se pede: a) Quantos alelos esto envolvidos na determinao do carter cor de fruto e qual a relao de dominncia entre eles? b) Qual a proporo genotpica e fenotpica do cruzamento entre plantas de fruto vinho do cruzamento parental (2) com plantas de fruto vinho do cruzamento parental (4)? c) Quantas plantas com frutos amarelos sero geradas, a partir de 200 sementes oriundas do cruzamento entre plantas de frutos vinho do cruzamento parental (4) com plantas de frutos rosa do cruzamento parental (2)? Questo 311 Uma determinada caracterstica depende de um locus que possui 4 alelos (A1, A2, A3, A4). Outra caracterstica tambm depende de 4 genes (B1, B2 e C1, C2), porm so
62

a) Qual o tipo da herana da cor da flor da paineira? b) Indique as possibilidades de se obter em um cruzamento: I) apenas flores de cor branca; II) apenas flores de rosa mdio. Questo 308 Admitamos que numa certa espcie de animal quatro alelos (A, a, a e a) tem seu locus no cromossomo I e outra srie de trs alelos (D, d e d) tem seu locus no cromossomo II. Em relao a essas duas sries de alelos, quantos gentipos diferentes so, teoricamente, possveis na populao?

dois pares de alelos localizados em pares de cromossomos homlogos diferentes. Um desses dois tipos de determinismo gentico apresenta um nmero maior de gentipos possveis na populao. Identifique esses gentipos. Questo 312 Em abelhas, a cor do olho condicionada por uma srie de alelos mltiplos, constituda por cinco alelos, com a seguinte relao de dominncia: marrom>prola>neve>creme>amarelo. Uma rainha de olho marrom, porm, heterozigota para prola, produziu 600 ovos e foi inseminada artificialmente por espermatozides que portavam, em propores iguais, os cinco alelos. Somente 40% dos ovos dessa rainha foram fertilizados e toda a descendncia teve a mesma oportunidade de sobrevivncia. Em abelhas, existe um processo denominado partenognese. a) O que partenognese? Em abelhas, que descendncia resulta deste processo? b) Na inseminao realizada, qual o nmero esperado de machos e de fmeas na descendncia? Dos machos esperados, quantos tero o olho de cor marrom? Questo 313 Um organismo, homozigoto para os genes A B C D, todos localizados em um mesmo cromossomo, cruzado com outro, que homozigoto recessivo para os mesmos alelos. O retrocruzamento de F1 (com o duplo recessivo) mostra os seguintes resultados: - no ocorreu permuta entre os genes A e C; - ocorreu 20% de permuta entre os genes A e B, 30% entre A e D; - ocorreu 10% de permuta entre os genes B e D. a) Baseando-se nos resultados acima, qual a seqncia mais provvel desses 4 genes no cromossomo, a partir do gene A? b) Justifique sua resposta.

Questo 314 O cruzamento CD/cd x cd/cd produziu 600 descendentes. Quantos devero ser diferentes dos pais, sabendo-se que a freqncia de permutao de 10%? Questo 315 Que tipos de gametas e em que propores produzir um organismo com gentipo Cd/cD, sabendo-se que a freqncia de permutao de 36%? Questo 316 Quais so os gametas produzidos por um indivduo de gentipo Ab/aB? Em que propores sero formados sabendo-se que os genes A e b permutam com uma freqncia de 16%? Questo 317 Considere a existncia de dois locos em um indivduo. Cada loco tem dois alelos "A" e "a" e "B" e "b", sendo que "A" e "B" so dominantes. Um pesquisador cruzou um indivduo "AaBb" com um indivduo "aabb". A prole resultante foi: 40% AaBb 40% aabb 10% Aabb 10% aaBb O pesquisador ficou surpreso, pois esperava obter os quatro gentipos na mesma proporo, 25% para cada um deles. Esses resultados contrariam a segunda lei de Mendel ou lei da segregao independente? Justifique sua resposta. Questo 318 Sabendo que a maioria das mutaes deletria (prejudicial ao organismo), o evolucionista John Maynard-Smith escreveu sobre a meiose, durante a produo de gametas: "A meiose o equivalente a ter dois carros, um com a transmisso quebrada, outro com o motor quebrado e, com eles, produzir um nico carro que funcione". A figura a seguir ilustra um par de cromossomos homlogos duplicados (A e B), bem como as localizaes
63

dos alelos deletrios "M" (presente somente no cromossomo A) e "N" (presente somente no cromossomo B).

1.5.13

vida em um ambiente estril. A causa da doena da menina era um defeito em um gene que codifica a enzima adenosina desaminase (ADA). Os cientistas do National Institute of Health dos Estados Unidos coletaram sangue da menina, separaram os linfcitos (clulas brancas) e usaram um retrovrus para introduzir uma cpia correta do gene nestas clulas. Ento eles reintroduziram os linfcitos na paciente. As clulas alteradas produziram a enzima que faltava e, hoje, a menina mais saudvel do que antes. (Kreuzer, H.; Massey, A. "Engenharia Gentica e Biotecnologia". Porto Alegre. Artmed, 2002.) a) A partir do exemplo apresentado no texto, explique em que consistem, de maneira geral, os tratamentos denominados "terapia gnica". b) Selecione e transcreva o segmento do texto que justifica a afirmao de que a terapia gnica um exemplo de engenharia gentica. Questo 321 Alguns grupos radicalmente contrrios ao uso de organismos geneticamente modificados (transgnicos) na agricultura divulgaram recentemente, no Sul do pas, um folheto populao alertando sobre os perigos da ingesto de transgnicos na alimentao. Entre as advertncias, constava uma que afirmava incorretamente que "para serem criadas plantas transgnicas so usados os vrus da AIDS" e que tais plantas, se ingeridas, poderiam infectar com o vrus da AIDS toda a populao. a) O que so transgnicos ou organismos geneticamente modificados (OGMs)? b) Explique por que o vrus da AIDS no poderia infectar uma planta e por que a ingesto de uma planta transgnica no seria capaz de transmitir o vrus da AIDS. Questo 322 CLULAS-TRONCO PODEM TRATAR LESES CEREBRAIS Empresa usa unidade estrutural de embries para recuperar vtimas de derrame. A tcnica combina o uso de clulas-tronco de embries e terapia gentica. (Adaptado de "O Globo", 08/09/2000) Explique a vantagem da utilizao, no procedimento
64

Um indivduo que possui os cromossomos A e B poder formar gametas que no sejam portadores dos alelos M e N? Justifique sua resposta. Questo 319 Os locos M, N, O, P esto localizados em um mesmo cromossomo. Um indivduo homozigtico para os alelos M, N, O, P foi cruzado com outro, homozigtico para os alelos m, n, o, p. A gerao F foi ento retrocruzada com o homozigtico m, n, o, p. A descendncia desse retrocruzamento apresentou 15% de permuta entre os locos M e N. 25% de permuta entre os locos M e O. 10% de permuta entre os locos N e O. No houve descendentes com permuta entre os locos M e P. Responda. a) Qual a seqncia mais provvel desses locos no cromossomo? Faa um esquema do mapa gentico desse trecho do cromossomo, indicando as distncias entre os locos. b) Por que no houve descendentes recombinantes com permuta entre os locos M e P? Questo 320 O primeiro teste de terapia gnica humana utilizou clulas sangneas, pois estas so de fcil obteno e de fcil reintroduo no corpo. A paciente foi uma menina com a doena da imunodeficincia combinada severa. Esta criana possua um sistema imune extremamente deficiente e no podia defender-se contra infeces. Sua doena era a mesma que a do "menino da bolha", que viveu sua curta

descrito, de clulas-tronco ao invs de clulas j diferenciadas. Questo 323 Dois cientistas realizaram uma experincia com o objetivo de estudar a transmisso das informaes contidas nos genes do ncleo de clulas de diferentes tecidos. Ncleos de vulos de r no-fertilizados foram substitudos por ncleos de clulas somticas, retiradas de uma mesma r. Os cientistas observaram que a grande maioria destas clulas, com seus novos ncleos, resultaram na formao de embries normais. Explique por que: a) esses ncleos transplantados de clulas somticas de diferentes tecidos deram origem a indivduos normais e idnticos; b) o resultado da experincia seria diferente se tivessem sido usados ncleos de clulas germinativas. Questo 324 A figura a seguir (Folha de So Paulo, 6/8/98) baseia-se no livro Remaking Eden (Refazendo o den) de Lee Silver, o qual afirma que cenas como estas no s so possveis, como inevitveis.

Admitindo-se a possibilidade de clonar seres humanos e com base no que tem sido publicado nos principais jornais e revistas do Pas, responda: a) Como o beb da figura acima poderia ter sido gerado? b) Qual seria o sexo do beb gerado por esse processo? Justifique sua resposta. Questo 325 Em uma experincia de reproduo com uma espcie de mamfero adotou-se o seguinte procedimento: fundiu-se uma clula do indivduo 1 com um vulo, previamente anucleado, do indivduo 2. A clula assim formada foi implantada no tero do indivduo 3, desenvolveu-se, e deu origem a um novo ser. Esse novo ser geneticamente idntico ao indivduo 1, ao 2 ou ao 3? Justifique sua resposta. Questo 326 No desenvolvimento de um organismo ocorre a transio de um estgio embrionrio, no qual todas as clulas so inicialmente indiferenciadas, at o estgio adulto, composto por at centenas de diferentes tipos de clulas. Esse processo conhecido como diferenciao celular. Historicamente, havia duas hipteses a respeito da diferenciao celular. Em uma delas, que chamaremos de H1, postulava-se a idia de que ocorria perda de material gentico enquanto a clula se diferenciava. Na segunda, H2, que a diferenciao no implicava perda de DNA. Identifique qual das duas hipteses confirmada pelos processos de clonagem, nos quais o ncleo da clula de um tecido de um indivduo adulto introduzido em um ovcito anucleado que, ao se desenvolver, origina outro organismo. Justifique sua resposta. Questo 327 "CIENTISTAS DA UNIVERSIDADE DO HAVA CLONAM MAMFERO ADULTO DO SEXO MASCULINO A clonagem deixou de ser uma tcnica aplicvel exclusivamente s fmeas. Cientistas da Universidade do
65

1.5.15.1

Hava clonaram o primeiro mamfero adulto do sexo masculino. Trata-se de um camundongo batizado de Fibro, uma brincadeira com a palavra fibroblasto, tipo de clula usada na criao do animal (...) Agora, os pesquisadores Ryuzo Yanagimachi e Teruhiko Wakayama mostram que um macho adulto tambm pode ser replicado, segundo trabalho publicado na revista "Nature Genetics". Em vez de utilizar clulas relacionadas ao sistema reprodutivo feminino para preencher os vulos, como havia sido feito at agora, os cientistas criaram Fibro a partir de um pedao do rabo de um camundongo. Eles colheram 700 vulos, produzidos por ratas, e descartaram seus ncleos. O material foi substitudo por clulas extradas da cauda do doador. Apenas 274 embries resultaram dessa operao e foram implantados em 25 ratinhas que funcionaram como 'mes de aluguel'."

Questo 329 Respondendo a uma questo sobre a possibilidade de se clonarem animais para livr-los de extino, um cientista apresenta duas tcnicas, I e II, que poderiam ser usados e que esto descritas nos quadros. TCNICA I 1 - Uma fmea (animal X) estimulada com hormnios a produzir vrios vulos. 2 - Essa fmea ento inseminada artificialmente. 3 - Aps alguns dias, os zigotos so retirados da fmea e divididos em dois. 4 - Cada metade reimplantada no tero de outra fmea (receptora), da mesma espcie, gerando um novo animal. TCNICA II 1 - Clulas somticas so retiradas do corpo de um animal (animal Y), das quais so retirados os ncleos. 2 - vulos no fecundados so retirados de um segundo animal (animal Z). O ncleo de cada um desses vulos retirado. 3 - O ncleo retirado da clula somtica do animal Y implantado no vulo sem ncleo do animal Z. A nova clula assim formada comea a se dividir formando um embrio. 4 - O embrio reimplantado no tero de um terceiro animal (animal W) dando origem a um novo animal. Pergunta-se: a) Todos os animais produzidos pela tcnica I so genotipicamente iguais ao animal X? Justifique. b) O novo animal formado pela tcnica II pode ser chamado "clone" do animal Y, Z ou W? Justifique. Questo 330 No incio deste ano, pesquisadores anunciaram o nascimento da ovelha Dolly, considerada o primeiro clone de mamfero gerado artificialmente. Um dos objetivos dessa pesquisa a melhoria da pecuria, atravs da formao de rebanhos homogneos. Clones, no entanto, ocorrem naturalmente no cotidiano, lembra o geneticista Ademar Freire Maia em um artigo do Boletim "Germinis" do Conselho Federal de Biologia, de maio/junho de 1997. a) Qual seria a desvantagem biolgica de um rebanho de clones? b) D um exemplo de clone que ocorre naturalmente.
66

1.5.15.1

Adaptado da Revista poca: Ano II, n55, 7/6/99. p.89. Por que os cientistas extraram os ncleos dos vulos antes de inserir as clulas da cauda do doador? Questo 328 No filme "Parque dos Dinossauros", um cientista cria em laboratrio novas geraes de dinossauros, extintos h 65 milhes de anos, por meio do sangue conservado em mosquitos que os teriam picado e que permaneceram fossilizados no mbar. Com o sangue, foi possvel determinar o DNA dos dinossauros, chegando-se assim frmula para recuperar a espcie. Considere a possibilidade de que o DNA obtido pertena a um nico dinossauro e que deste DNA foram recuperados vrios exemplares. a) O que se poderia dizer dos exemplares recuperados, caso um dos animais seja sensvel a uma bactria que cause pneumonia? b) Justifique sua resposta.

Justifique. Questo 331 Um pesquisador construiu um camundongo transgnico que possui uma cpia extra de um gene Z. Em um outro camundongo jovem, realizou uma cirurgia e removeu a hipfise. Em seguida, estudou o crescimento desses camundongos, comparando com o crescimento de um camundongo, no transgnico e com hipfise. Obteve as seguintes curvas de crescimento corporal:

manipulao (Esquema I) , e quatro diferentes partculas virais modificadas (Esquemas II, III, IV e V).

1.5.15.2

1.5.15.2

a) Explique a causa da diferena no crescimento dos camundongos 2 e 3. b) Com base em sua resposta ao item a, elabore uma hiptese para a causa da diferena no crescimento dos camundongos 1 e 2. Questo 332 A terapia gnica, uma promessa da biotecnologia moderna, consiste na cura de defeitos genticos pela introduo de genes normais em celulas de indivduos doentes. Algumas metodologias em estudo utilizam retrovrus modificados como veculo de introduo do gene desejado. Por exemplo, na talassemia, doena caracterizada pela produo de hemoglobina anormal devido a uma deleo no gene que codifica a cadeia da globina, poderia ser usado um retrovrus modificado, contendo a informao para a sntese da -globina. Nesse caso, deveriam ser realizadas trs etapas: 1. coletar clulas da medula ssea do paciente; 2. colocar as clulas coletadas em contato com o retrovrus modificado, para que essas sejam infectadas; 3. reintroduzir as clulas infectadas no paciente. A seguir, esto esquematizadas a partcula viral original, antes da

- X representa o trecho de cido nuclico viral, que codifica as protenas necessrias para a formao de novas partculas virais no interior da clula hospedeira. - Y representa o trecho de cido nuclico introduzido, que contm a informao para a sntese da cadeia da globina. - o smbolo esfrico e negro, indicado em lagumas figuras, indica que a partcula viral contm as enzimas transcriptase reversa e integrase (insere o material gentico de origem viral no genoma da clula). a) Explique por que, no caso do tratamento da talassemia, as clulas retiradas da medula ssea so as indicadas para serem infectadas com as partculas virais adequadamente modificadas. b) Indique qual dos retrovrus modificados, apresentados nos esquemas acima, seria o mais indicado para ser usado nesse tratamento. Justifique sua resposta. Questo 333 As tcnicas modernas de engenharia gentica tornaram possvel a produo de plantas transgnicas que possuem genes introduzidos artificialmente no seu genoma. Entre as vrias estratgias de produo de plantas transgnicas, destacamos duas: 1) Plantas resistentes a certos vrus patognicos que, na ausncia do gene de resistncia, as matariam. 2) Plantas mais resistentes aos efeitos dos defensivos agrcolas (agrotxicos). Essas plantas toleram concentraes maiores de agrotxico sem alterar as propriedades txicas dos defensivos agrcolas.

67

Do ponto de vista ambiental, qual das duas estratgias no recomendvel? Justifique sua resposta. Questo 334 Considere os seguintes seres: I) cabra selecionada artificialmente, por cruzamentos sucessivos, para aumentar a produo leiteira; II) cana-de-acar obtida atravs de mudas; III) soja transgnica clonada para melhoria da qualidade biolgica de suas protenas. Analisando-os quanto variabilidade gnica, explique a) como os trs grupos de seres se diferenciam entre si; b) de que forma os trs grupos poderiam ser afetados, no que se refere perpetuao de sua prpria espcie, em caso de ocorrer uma catstrofe ambiental. Justifique. Questo 335

entre espcies distintas. b) Defina um organismo transgnico. c) Indique um benefcio decorrente da utilizao de organismos transgnicos e um possvel risco para o ambiente ou para a sade humana. Questo 337 Uma mutao no gene que codifica a enzima fenilalanina hidroxilase pode acarretar o acmulo do aminocido fenilalanina no sangue, sendo o excesso transformado em compostos txicos que comprometem o desenvolvimento fsico e mental da criana fenilcetonrica. No entanto, o desenvolvimento de novas metodologias nas reas da bioqumica e da biologia molecular permitiu a implementao de exames diagnsticos, indubitavelmente importantes no caso de doenas tratveis, como a fenilcetonria. a) Explique, do ponto de vista gentico, por que o tratamento iniciado logo aps o nascimento, o qual inclui uma dieta restritiva fenilalanina, pode melhorar a qualidade de vida das crianas afetadas por fenilcetonria. b) Apresente dois testes laboratoriais para a deteco de portadores de fenilcetonria e explique os princpios desses testes. Questo 338 Considere estes dados como hipotticos. Um casal apresenta, em seus cromossomos de nmero 21, pontos de quebra por enzimas especiais, indicados no esquema por setas. Essas resultam em fragmentos de tamanhos diferentes que podem ser utilizados como marcadores genticos. No esquema a seguir, os fragmentos so indicados por Kb (1Kb=1000 pares de bases nitrogenadas). Esse casal tem uma criana com Sndrome de Down devida trissomia do cromossomo 21. Os resultados obtidos com o estudo dos marcadores para o cromossomo 21 do pai, da me e da criana esto indicados na figura 2, onde cada trao indica a posio e o tamanho dos fragmentos num
68

1.5.15.2

Explique o que alimento transgnico e como obtido. Questo 336 Existem mecanismos que normalmente impedem a troca de genes entre espcies distintas. Nos ltimos anos, porm, as fronteiras entre as espcies vm sendo rompidas com a criao de organismos transgnicos. A introduo de soja e de outras plantas transgnicas tem gerado muita polmica, pois, apesar de seus inmeros benefcios, no h ainda como avaliar os riscos que os organismos transgnicos apresentam. a) Cite dois mecanismos que impedem a troca de genes

campo de eletroforese.

econmica? Questo 340 Uma tcnica usada como uma ferramenta da taxonomia emprega a seguinte abordagem: extrai-se o ADN de um organismo e este , ento, marcado com fsforo radioativo. O ADN radioativo ento desnaturado (suas cadeias so separadas por calor) e posto em contato com o ADN de um outro organismo, igualmente desnaturado, porm no radioativo. Aps a hibridao (reassociao formando molculas hbridas), possvel medir quanto ADN radioativo existe num ADN de cadeia dupla. Foi feito um experimento em que o ADN do organismo 1 (ADN radioativo) foi "hibridado" com o ADN no radioativo de trs outros organismos, obtendo-se os seguintes resultados: ADN do organismo 1 + ADN do organismo 1 = 100% de radioatividade no ADN hbrido ADN do organismo 1 + ADN do organismo 2 = 10% de radioatividade no ADN hbrido ADN do organismo 1 + ADN do organismo 3 = 40% de radioatividade no ADN hbrido ADN do organismo 1 + ADN do organismo 4 = 85% de radioatividade no ADN hbrido Qual o organismo que pertence mesma espcie do organismo 1? Justifique sua resposta. Questo 341 Em Junho de 2001, foi publicada a seqncia quase completa do genoma humano. Esse projeto contou com a participao de diversos laboratrios, que individualmente determinaram a seqncia de vrios trechos diferentes do ADN de todos os cromossomos, a partir da amostra de somente um indivduo, que permaneceu annimo. Sabe-se, no entanto, que o ADN era de um indivduo do sexo masculino. Por que foi importante determinar a seqncia do ADN de um homem e no de uma mulher?
69

1.5.15.3

Com base nas informaes apresentadas e em conhecimentos sobre o assunto responda ao que se pede. 1) Identifique o genitor que transmitiu dois cromossomos 21 criana. Justifique sua resposta. 2) Determine o estgio da meiose, I ou II, em que ocorreu o fenmeno de no-separao ou no-disjuno dos cromossomos. Justifique sua resposta. 3) Suponha que a mulher est novamente grvida e que o exame para marcadores do cromossomo 21, como descrito no texto, foi realizado para o feto atravs de puno do lquido amnitico, amniocentese. Analise o resultado obtido na figura 3. Pelos resultados apresentados na figura, pressupe-se que a criana deve ser normal. Entretanto, aps o nascimento, constatou-se que a criana apresentava Sndrome de Down. Com base nessa informao, determine: O genitor onde ocorreu a no-disjuno. A fase da meiose em que o fenmeno ocorreu. Questo 339 No incio do projeto do genoma humano, havia duas estratgias a considerar: I) seqenciar o ADN total dos cromossomos diretamente; II) extrair todos os ARNs mensageiros, produzir ADN a partir desses ARNs mensageiros e seqenciar apenas esse ADN. Nos dois casos, a tcnica de seqenciamento era a mesma. Por que a segunda estratgia mais rpida e, portanto, mais

Questo 342 Considerando situaes hipotticas, Maria manteve relaes sexuais com dois irmos, gmeos dizigticos, nascendo destas relaes Alfredo. Em outra situao, tambm hipottica, Paula engravidou-se ao manter relaes sexuais com dois irmos, gmeos monozigticos, nascendo Renato. Abandonadas, ambas reclamaram na Justia o reconhecimento de paternidade, determinando o Juiz a realizao dos testes de DNA. Aps receber os resultados, a Justia pronunciou-se sobre a paternidade de uma das crianas e ficou impossibilitada de pronunciar-se sobre a paternidade da outra criana. Responda: a) sobre a paternidade de qual criana o juiz pronunciou-se? b) por que no pde o juiz se pronunciar sobre a paternidade da outra criana? Questo 343 Com tcnicas de biologia molecular possvel verificar a presena ou no de certas regies de interesse na fita de DNA. Cada uma dessas regies recebe o nome de marcador, uma vez que pode ser associada com algum fentipo em particular. A presena do marcador no genoma de um indivduo pode ser visualizada como uma banda. Dessa forma, podemos descobrir se um embrio poder apresentar uma determinada caracterstica ou doena gentica pela anlise de seus marcadores. O esquema abaixo representa a anlise de marcadores de DNA de quatro embries humanos (I, II, III e IV). Apenas a presena de duas bandas (A e B) indicativo positivo para o indivduo apresentar uma certa disfuno muscular quando adulto. Detectou-se ainda que esses marcadores ocupam o MESMO loco.

Observe o padro de bandas do DNA de cada embrio e responda: a) Dentre os embries analisados, quais NO devero apresentar a disfuno muscular quando adultos? b) Supondo que os quatros embries sejam irmos, qual o padro de bandas (I, II, III e IV) mais provvel PARA CADA UM de seus pais? c) Qual a probabilidade de um certo casal, formado por indivduos tipo I e III, ter um descendente com essa disfuno muscular? Questo 344 Recentemente, os jornais e a revista cientfica internacional "Nature" publicaram com destaque um grande feito de um grupo de cientistas brasileiros, que identificou o genoma de uma bactria, 'Xylella fastidiosa', que causa uma doena nas laranjeiras, conhecida como amarelinho. O xilema das plantas produtoras de laranja parcialmente bloqueado, reduzindo a produo, pois a maioria das frutas no se desenvolve. a) Explique o que genoma e indique uma possvel conseqncia econmica dos resultados desta pesquisa. b) Se o xilema bloqueado, quais as principais deficincias que a planta sofre? Justifique. Questo 345 O exame de paternidade atravs da comparao de DNA seqenciado vem sendo utilizado para determinar progenitores. possvel determinar o pai de um recm-nascido quando a dvida sobre a paternidade desse recm-nascido est entre gmeos univitelinos? Justifique sua resposta. Questo 346 1.5.15.3 O teste de paternidade usando o DNA tornou-se muito freqente hoje. No entanto, as pessoas tm muitas dvidas a respeito desse tipo de exame. As frases a seguir constam numa lista de "mitos e verdades sobre o teste de DNA" encontrada na internet (http://www.gene.com.br).

70

I. "O exame de DNA s pode ser feito com sangue." II. "Sou primo da me e estou com medo do resultado ser positivo, mesmo que eu no seja o verdadeiro pai." III. "Ele j morreu e no deixou nenhum outro parente vivo. Nunca poderei provar que ele era o pai do meu filho." Justifique por que cada uma das frases constitui um "mito". Questo 347 A virulncia do 'Bacillus anthracis', causador do antraz, est diretamente associada presena conjunta dos componentes toxina e cpsula bacteriana, e atenuada quando um deles est ausente. Os constituintes da toxina so codificados por genes existentes no plasmdeo pX01, e os da cpsula por genes existentes no plasmdeo pX02. O esquema abaixo representa quatro diferentes linhagens de 'Bacillus anthracis'.

indstria ganharam alternativas eficientes para a produo, em grande escala, de determinadas protenas, que antes eram disponveis em quantidades extremamente reduzidas. a) Qual a funo das endonucleases de restrio e a das ligases na aplicao da tecnologia anteriormente citada? b) Explique como a tecnologia do DNA recombinante participa no processo de produo de organismos transgnicos. c) Cite dois produtos, utilizados pelo homem, que foram obtidos a partir da aplicao da tecnologia do DNA recombinante. Questo 349 Na tecnologia do DNA recombinante so utilizadas enzimas bacterianas que tm a propriedade de cortar a molcula de DNA em pontos especficos, o que permite, por exemplo, que genes humanos que codificam protenas de interesse mdico ou comercial sejam extrados, clonados em bactrias ou vrus, e depois sejam transferidos para animais de laboratrio, que passam a produzir sistematicamente tais protenas. Pergunta-se: a) Qual o nome genrico que se d a estas enzimas?

1.5.15.5

a) Explique a utilidade dos plasmdios bacterianos no desenvolvimento de tcnicas de DNA recombinante. b) A cpsula do 'Bacillus anthracis', ao contrrio da toxina, no possui antgenos capazes de provocar reao imunolgica protetora em mamferos. Dentre as linhagens apresentadas, indique a que pode ser utilizada na elaborao de uma vacina composta por bactrias vivas com virulncia atenuada. Justifique sua indicao. Questo 348 A partir da dcada de 70, as molculas de cidos nuclicos da clula passaram a ser exploradas atravs da utilizao de novas metodologias, conhecidas como tecnologia do DNA recombinante. Por meio dessa tecnologia, a medicina e a

b) O que confere a especificidade a estas enzimas? c) Na natureza, qual deve ser o papel desempenhado por elas? d) Como so chamados os organismos que recebem e incorporam genes de outra espcie? Questo 350 CONVERSO CELULAR: Cientistas israelenses induzem clulas hepticas a produzir insulina em laboratrio e propem tcnica para tratar diabetes tipo 1. De acordo com a tcnica esquematizada a seguir, clulas de fgado so cultivadas em laboratrio. Um vrus inserido nas clulas, contendo um gene que, em clulas do pncreas,
71

est ligado produo de insulina. As clulas se diferenciam em cultura, ficando mais parecidas com as que existem no pncreas (clulas beta). Os cientistas acreditam que as clulas transformadas possam futuramente ser usadas no combate ao diabetes tipo 1.

a) Analise as etapas I, II e III. Em quais delas se desenvolvem, respectivamente: a) o pareamento das bases? a) a ao das enzimas de restrio? a) a ao da DNA ligase? b) "Os agricultores americanos, por exemplo, j esto plantando as sementes da terceira safra de milho, algodo e soja transgnicos." (Adaptao do artigo "Revoluo invisvel na mesa", da revista poca, 8 de junho de 1998). Conceitue os organismos transgnicos. Questo 352 A melhor fonte de clulas-tronco so os embries em estgios iniciais de desenvolvimento, pois essas clulas indiferenciadas podem se transformar em qualquer tecido. Por esse motivo, h interesse em us-las para reparar danos de tecidos que normalmente no se regeneram. Atualmente possvel produzir clulas-tronco heterlogas (retiradas diretamente de um embrio qualquer) ou homlogas. O procedimento para o preparo de clulas-tronco embrionrias homlogas est ilustrado de modo simplificado a seguir e envolve as seguintes etapas: 1 - o ncleo de uma clula do paciente transplantado para um ovcito maduro, cujo ncleo foi previamente removido; 2 - o ovcito transplantado induzido a proliferar; 3 - ao atingir o estgio de blstula, as clulas do embrio so separadas umas das outras e injetadas diretamente no paciente, em local prximo leso.

1.5.15.5

Com relao ao procedimento descrito, responda os itens a seguir. a) Cite UMA desvantagem do uso de vrus como vetores de terapia gnica. b) Qual a vantagem da terapia gnica descrita, quando comparada ao tratamento de diabticos com transplante de clulas de pncreas de indivduos mortos? Questo 351 Na engenharia gentica, a tcnica de DNA recombinante vem sendo utilizada na pesquisa e no desenvolvimento, por exemplo, de vacinas e medicamentos. O esquema a seguir apresenta algumas etapas dessa tcnica.

1.5.15.5 1.5.15.6

72

a) Explique por que indivduos transplantados com clulas-tronco embrionrias, tanto homlogas, quanto heterlogas, apresentam duas populaes de mitocndrias diferentes em seus tecidos. b) Explique por que o uso de clulas-tronco embrionrias homlogas reduz potencialmente os problemas ps-tratamento para os pacientes. Questo 353 Leia atentamente o texto adiante e responda as perguntas propostas a seguir: "A gripe uma das doenas que mais matou na histria do homem. Suas epidemias, que ainda ocorrem todo o ano, j assustaram mais do que a AIDS. As epidemias, quase sempre no inverno, ocorrem quando o vrus sofre uma mutao que o torna mais virulento e irreconhecvel pelos sistemas imunolgicos das pessoas infectadas. As mutaes ocorrem numa protena chamada HA, que fica espetada na membrana do vrus. Toda a interao inicial entre vrus e clula do paciente ocorre atravs da HA. ela que os glbulos brancos reconhecem e procuram atacar. A HA se liga superfcie de uma clula, fazendo com que ela acione suas defesas e "engula" o vrus com uma bolsa digestiva. Dentro dessa bolsa, a clula solta cidos para digerir o vrus. No entanto, o aumento da acidez provoca a mudana de forma na HA, que faz com que a membrana do vrus se funda com a membrana da clula. Dessa forma, o contedo do vrus - seu material gentico - liberado no interior da clula, e ele continua sua reproduo sem ser molestado." a) Por que o sistema imunolgico de uma pessoa no reconhece um vrus mutante, mesmo que j tenha tido uma forma da doena? b) Explique como o vrus consegue "enganar" uma clula e infect-la. Questo 354 O grfico a seguir mostra a variao do nmero de um tipo de leuccitos, os linfcitos T CD4, e da quantidade de vrus HIV no sangue de um indivduo ao longo do tempo. Esse indivduo, portador da sndrome de imunodeficincia causada pelo vrus HIV (AIDS/ SIDA), no teve acesso a tratamento algum durante o perodo mostrado.

1.7.1

Note que, somente aps cerca de 60 meses, apareceram, nesse indivduo, infeces oportunistas por fungos, parasitas e bactrias. Foram essas infeces, e no o vrus propriamente dito, que levaram o paciente morte. Por que pacientes infectados com HIV e no tratados sofrem, em geral, de infeces oportunistas? Questo 355 Notcias recentes veiculadas pela imprensa informam que o surto de sarampo no Estado de So Paulo foi devido diminuio do nmero de pessoas vacinadas nos ltimos anos. As autoridades sanitrias tambm atriburam o alto nmero de casos em crianas abaixo de um ano ao fato de muitas mes nunca terem recebido a vacina contra o sarampo. a) Se a me j foi vacinada ou j teve sarampo, o beb fica temporariamente protegido contra essa doena. Por qu? b) Por que uma pessoa que teve sarampo ou foi vacinada fica permanentemente imune doena? De que forma a vacina atua no organismo? Questo 356 A anemia falciforme caracterizada por hemcias em forma de foice, em funo da produo de molculas anormais de hemoglobina, incapazes de transportar o gs oxignio. Indivduos com anemia falciforme so homozigotos (SS) e morrem na infncia. Os heterozigotos (Ss) apresentam forma atenuada da anemia. Na frica, onde a malria endmica, os indivduos heterozigotos para anemia falciforme so resistentes malria. a) Explique o que esperado para a freqncia do gene S em presena da malria. E em ausncia da malria? b) Qual a explicao para o fato dos heterozigotos para anemia serem resistentes malria?
73

Questo 357 As abelhas vivem em colnias constitudas por indivduos de trs castas: a rainha, os zanges e as operrias. Sabendo-se que as fmeas frteis de 'Apis mellifera' tm 32 cromossomos, indique o nmero cromossmico dos indivduos de cada uma das castas e descreva como ocorre a diferenciao em castas nesses insetos. Questo 358 Um menino colocou a mo em um buraco onde havia uma cobra e, apesar de no t-la tocado, foi picado por ela. Seu pai, um bilogo, mesmo sem ver a cobra, deduziu que ela era peonhenta e socorreu o filho, tratando-o com soro antiofdico. a) Que caracterstica desse rptil levou o pai a deduzir que se tratava de cobra peonhenta? Cite outra caracterstica morfolgica facilmente identificada na maioria dessas cobras. b) Qual a substncia imunolgica presente no soro antiofdico responsvel pela inativao do veneno? Como este soro produzido? Questo 359 A indstria de flores movimenta bilhes de dlares por ano e est continuamente buscando criar novas variedades, como uma rosa azul. Pelos mtodos tradicionais, no possvel obter rosas dessa cor, pois a enzima que sintetiza esse pigmento est ausente nas roseiras. As petnias, entretanto, possuem tal enzima. Encontra-se em fase de teste uma tcnica que possibilita inserir em clulas de roseira o gene da petnia responsvel pela codificao da enzima que produz o pigmento azul. a) Cite o tipo de clula indiferenciada de roseira que, com o objetivo de produzir rosas azuis, seria o indicado para receber esse gene e justifique sua resposta. b) Suponha que, em vez de ser introduzido o gene da petnia que define a cor azul, fossem inseridas cpias de seu RNA mensageiro. Indique se h ou no possibilidade de produo de rosas azuis nesse caso e justifique sua resposta.

Questo 360 Uma importante realizao da pesquisa cientfica brasileira foi o seqenciamento do genoma da bactria 'Xylella fastidiosa', causadora da doena chamada amarelinho ou clorose variegada dos citros (CVC). O nome da bactria deriva do fato de que ela se estabelece nos vasos do xilema da planta hospedeira. a) Que processo fisiolgico da planta diretamente prejudicado pela presena da bactria? Justifique. b) No se pode atribuir 'Xylella fastidiosa' a morte das clulas que constituem os vasos do xilema maduro. Por qu? c) Em que consiste o seqenciamento de um genoma? Questo 361 Esforos de cientistas criaram a primeira rosa do mundo com pigmento para cor azul. Anteriormente, rosas de colorao azul j eram produzidas atravs de cruzamento, mas no eram consideradas azuis verdadeiras. Segundo o jornal "The Japan Times on line", de 1.07.2004, a tcnica recentemente utilizada consistiu no seguinte: o gene da enzima que produz o pigmento azul, delfinidina, foi extrado do amor-perfeito e ativado nas rosas. a) Como se chamam as estruturas mais vistosas e atraentes destas flores, que passaram a ter cor azul? Qual o significado biolgico do fato de certas plantas apresentarem flores com cores to vistosas? b) Qual a relao entre esta tcnica recente para a produo de flores azuis e aquela empregada para a produo de alimentos transgnicos? Questo 362 O oxignio um elemento imprescindvel manuteno da vida dos seres aerbicos, pois participa do processo de extrao de energia dos alimentos, como aceptor final de eltrons, conforme exemplificado pela reao abaixo. CHO + 6 O 6 HO + 6 CO Em virtude de sua configurao eletrnica, o oxignio tem
74

forte tendncia a receber um eltron de cada vez, dando origem a molculas intermedirias, denominadas espcies reativas de oxignio, que so fortes agentes oxidantes. Essas molculas, por serem muito reativas, causam alteraes, inclusive no DNA, fato que pode induzir mutaes tanto em clulas somticas quanto em clulas germinativas. a) Considerando o processo de oxidao completa da glicose pela clula eucaritica, indique a etapa responsvel pela formao de espcies reativas de oxignio e o local da clula onde essas reaes ocorrem. b) Uma espcie reativa de oxignio induziu uma mutao no gene de uma clula, acarretando a substituio de uma base guanina por uma adenina, sem alterar, porm, a estrutura primria da protena codificada pelo gene. Justifique por que no houve alterao da estrutura da protena. Questo 363 Em um hospital, um indivduo necessita de um transplante de rim. Dispe ele dos seguintes doadores: tio, amigo, primo em primeiro grau e irmo gmeo dizigtico. Pergunta-se: a) Qual dos parentes voc escolheria como doador do rgo? b) Justifique sua resposta. Questo 364 Uma conquista recente no campo da biotecnologia o uso de bactrias para a produo de protena animal de interesse comercial. Por exemplo, hoje j esto sendo comercializadas insulina e somatotrofina (ou somatropina) humanas produzidas por bactrias. a) Em que locais do corpo humano so produzidas essas protenas e qual a principal funo de cada uma delas no organismo? b) Explique sucintamente o processo por meio do qual se modificam bactrias para que elas passem a produzir protenas humanas. Questo 365 Em uma gravidez gemelar, o par de gmeos do sexo masculino. a) Estes gmeos devem ser monozigticos ou dizigticos?

Por qu? b) Se um dos gmeos herdou o alelo dominante A de sua me heterozigtica Aa, qual a probabilidade de que esse alelo tambm esteja presente no outro gmeo? Questo 366 O esquema a seguir resume a seqncia do desenvolvimento de irmos gmeos:

1.10.9

a) Sob o ponto de vista embriolgico, o que so gmeos? b) Analisando a figura, quais so geneticamente idnticos? Justifique sua resposta. Questo 367 Uma mulher teve uma menina em sua primeira gravidez, ocorrendo o mesmo na sua segunda gestao. Qual o percentual esperado de ocorrncia desse fato? Questo 368 A figura adiante representa o fenmeno biolgico que ocorre com um tipo de clula que sai do vaso sangneo para exercer sua funo no tecido conjuntivo.

1.10.11

75

a) Identifique esta clula e nomeie o fenmeno biolgico apresentado. b) Qual a importncia do fenmeno apresentado para a funo desta clula? Questo 369 A enzima transcriptase reversa encontrada em retrovrus. Muitos pesquisadores, atualmente, procuram descobrir novas substncias que sejam inibidoras especficas dessa enzima. Descreva a funo da transcriptase reversa no mecanismo de replicao do vrus da Aids. Questo 370 O texto abaixo refere-se s questes: ** a ** O cruzamento entre plantas de variedades diferentes de uma mesma espcie muito utilizado para a obteno de cultivares mais produtivos. Dois espcimes de variedades diferentes de uma planta oleaginosa foram cruzados visando obteno de uma variedade mais resistente seca. Considere que duas das caractersticas dessa planta, referentes folha e semente, so definidas por alelos segregados independentemente, conforme a lista a seguir. P - semente com "plos" p - semente lisa C - folha coberta com cera c - folha sem cera Os grficos a seguir mostram a composio dos alelos para essas duas caractersticas nas plantas parentais. O grfico que representa o nmero de alelos encontrados na mitose de uma clula obtida de uma planta resultante do cruzamento entre os parentais :

Questo 371

1.5.2.1

Das combinaes possveis resultantes do cruzamento entre esses mesmos parentais, o fentipo que apresenta o maior nmero de gentipos possveis a) semente com "plos". b) semente lisa. c) folha sem cera. d) folha com cera. Questo 372 O amendoim uma planta originria da Amrica do Sul. Sua importncia econmica est relacionada ao fato das sementes possurem sabor agradvel e serem ricas em leo, protenas, carboidratos, sais minerais e vitaminas. Os cidos graxos insaturados presentes no amendoim, ainda servem de veculo de transporte para a vitamina E, pois a mesma lipossolvel. As plantas de amendoim podem apresentar folhas com pecolo normal ou curto, caracterstica determinada por um gene, com dois alelos. Para determinar qual alelo dominante, foi feito um cruzamento entre duas linhagens puras, uma com pecolo normal e outra com pecolo curto. Espera-se encontrar, em F2, plantas com pecolo normal e com pecolo curto, respectivamente, na proporo de a) 1:1, se os alelos forem codominantes. b) 1:2:1, se o alelo para pecolo curto for recessivo. c) 2:1, se o alelo para pecolo normal for recessivo. d) 3:1, se o alelo para pecolo curto for dominante. e) 3:1, se o alelo para pecolo normal for dominante.

1.1.5.1

76

Uma pequena cidade interiorana do Nordeste brasileiro chamou a ateno de pesquisadores da Universidade de So Paulo pela alta incidncia de uma doena autossmica recessiva neurodegenerativa. As pesquisas realizadas revelaram que tambm alto o nmero de casamentos consangneos na cidade. Outro dado interessante levantado pelos pesquisadores foi que a populao da cidade acredita que a doena seja transmitida de uma gerao a outra atravs do sangue. (Pesquisa FAPESP, julho de 2005.) Pelas informaes fornecidas no texto, podemos afirmar que: a) pais saudveis de filhos que apresentam a doena so necessariamente homozigotos. b) homens e mulheres tm a mesma probabilidade de apresentar a doena. c) em situaes como a descrita, casamentos consangneos no aumentam a probabilidade de transmisso de doenas recessivas. d) pais heterozigotos tm 25% de probabilidade de terem filhos tambm heterozigotos. e) pais heterozigotos tm 50% de probabilidade de terem filhos que iro desenvolver a doena. Questo 374 Em relao crena da populao sobre o processo de transmisso de caractersticas hereditrias, podemos afirmar que: a) no sculo XIX, muitos cientistas tambm acreditavam que as caractersticas genticas eram transmitidas pelo sangue. b) a populao no est to equivocada, pois os genes esto presentes apenas nas clulas sangneas e nas clulas germinativas. c) este um exemplo claro no qual o conhecimento elaborado pelo senso comum coincide com os conhecimentos atuais dos cientistas. d) a crena da populao pode ser explicada pelo fato de o sangue do feto ser fornecido pela me. e) a crena da populao no faz o menor sentido, uma vez que clulas sangneas no apresentam as estruturas bsicas que guardam as informaes genticas.

Questo 375 O texto abaixo refere-se s questes: Notcia de algum jornal do futuro... INICIA A CAMPANHA NACIONAL DE VACINAO CONTRA SARAMPO E TUBERCULOSE. O destaque da campanha de vacinao, neste ano, a utilizao de cerejas coloridas, sem sementes. Segundo a biloga Josefa da Silva, responsvel pela equipe que desenvolveu os novos frutos, tcnicas especiais de cruzamento foram aplicadas em dois tipos de cerejeiras transgnicas, resultando na obteno de plantas triplides (3n = 72), incapazes de produzir sementes. Apesar de passar por todas as etapas do ciclo reprodutivo, no h a formao de endosperma, e o processo cessa nas primeiras divises celulares do zigoto. As novas cores (amarela, verde, roxa e branca) haviam sido obtidas, anteriormente, por mutao no gene responsvel pela produo de pigmento na casca do fruto. As formas mutantes para esse loco, diz a pesquisadora, no interferem na eficincia das plantas transgnicas como produtoras de vacinas. Elas continuam apresentando, nos frutos, as substncias que, depois de liberadas pela digesto, ligam-se membrana plasmtica dos linfcitos e sofrem endocitose, determinando o desenvolvimento da resposta imunolgica. Outra inovao dessas cerejas a resistncia s moscas Anastrepha fraterculus que, nos ltimos anos, estabeleceram-se como pragas importantes do cultivo de cerejas-vacina. Da mesma forma, as plantas apresentam resistncia aos nematides que atacavam a raiz principal do sistema axial desses vegetais. Com o cultivo das novas variedades de cerejas resistentes, espera-se que essas pragas mantenham-se afastadas dos pomares de vacinas, por algum tempo. Se as cerejeiras referidas no texto so transgnicas, ento no .......... das clulas dessas plantas, em algum cromossomo, existe uma .......... que foi introduzida para ser transcrita e originar um .......... que, ao ser traduzido, resulta em produto que determinara o desenvolvimento da resposta imunolgica. Assinale a alternativa que completa as lacunas de modo correto. a) ncleo - protena - RNA mensageiro b) citoplasma - seqncia de aminocidos - RNA transportador
77

** a **

c) ncleo - seqncia de aminocidos - RNA mensageiro d) ncleo - seqncia de nucleotdeos - RNA mensageiro e) citoplasma - protena - RNA transportador Questo 376 A partir das informaes do texto, "(...) mutao no gene responsvel pela produo de pigmento (...)" e "As formas mutantes (obtidas) para esse loco (...)", pode(m)-se afirmar: I - As mutaes responsveis pelas cores da cereja ocorreram em vrios cromossomos. II - O alelo responsvel pela "casca roxa" ser considerado dominante em relao ao alelo que determina a "casca verde", se uma planta heterozigota para esses alelos apresentar frutos com a casca roxa. Ill - Se a colorao branca for recessiva, ser possvel obter plantas com frutos coloridos a partir do cruzamento de plantas com frutos brancos. Esta(o) correta(s) a) apenas I. b) apenas II. c) apenas I e II. d) apenas III. e) apenas II e III. Questo 377 O texto abaixo refere-se s questes: ** a ** Na(s) questo(es) a seguir escreva nos parnteses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. Um pesquisador apresentou a seus alunos o heredograma a seguir, relativo a uma certa doena observada por ele em humanos. Sabendo-se que os indivduos afetados esto representados em negrito e os normais em branco, pode-se afirmar: ( ) a doena causada por um alelo recessivo; ( ) trata-se de um caso de herana parcialmente ligada ao sexo; ( ) a doena causada por um alelo dominante; ( ) trata-se de um caso de herana ligada ao sexo; ( ) um caso de polialelia com epistasia recessiva. Questo 378 As proposies a seguir so relativas ao processo de sntese de protenas nas clulas vivas. ( ) A molcula de DNA transcreve no ncleo uma molcula de RNA mensageiro (RNAm) com vrias seqncias de trs bases - os cdons. ( ) Cada cdon do RNA mensageiro determinar a colocao de um aminocido especfico na cadeia polipeptdica. ( ) No local onde houver um ribossomo, pequenas molculas de RNA transportador (RNAt), ligadas a aminocidos, unem-se ao RNAm por uma seqncia de trs bases - o anticdon. ( ) O processo de sntese de protenas a respeito do citoplasma tambm conhecido como transcrio gentica. ( ) Os diversos aminocidos unem-se atravs de ligaes do tipo ster, dando formao, ao final da leitura do RNAm, a uma protena funcional. Questo 379 Analise os dados apresentados a seguir, que trata dos tipos e percentuais de gametas produzidos por um indivduo de gentipo no divulgado (indivduo parental). AB = 47,4% Ab = 2,6% aB = 2,6% ab = 47,4%
78

1.5.1.4

( ) Trata-se de um caso de genes de segregao independente, determinando uma distribuio 1:1:1:1: ( ) 5,2% dos gametas apresentam combinaes allicas diferentes daquelas existentes nos cromossomos do indivduo parental. ( ) O indivduo parental um heterozigoto AB/ab e, portanto, um heterozigoto "Cis". ( ) O indivduo parental um heterozigoto aB/Ab, ou seja, um heterozigoto "Trans". ( ) Considerando que 5,2% dos gametas so recombinantes, pode-se inferir que ocorreu quiasma entre os locos "A" e "B" em 94,8% das clulas meiticas que originaram estes gametas. Questo 380 O texto abaixo refere-se s questes: ** a ** A seqncia a seguir indica de maneira simplificada os passos seguidos por um grupo de cientistas para a clonagem de uma vaca: I. Retirou-se um vulo da vaca Z. O ncleo foi desprezado, obtendo-se um vulo anucleado. II. Retirou-se uma clula da glndula mamria da vaca W. O ncleo foi isolado e conservado, desprezando-se o resto da clula. III. O ncleo da clula da glndula mamria foi introduzido no vulo anucleado. A clula reconstituda foi estimulada para entrar em diviso. IV. Aps algumas divises, o embrio foi implantado no tero de uma terceira vaca Y, me de aluguel. O embrio se desenvolveu e deu origem ao clone. Considerando-se que os animais Z, W e Y no tm parentesco, pode-se afirmar que o animal resultante da clonagem tem as caractersticas genticas da vaca. a) Z, apenas b) W, apenas c) Y, apenas d) Z e da W, apenas e) Z, W e Y Questo 381 Se a vaca Y, utilizada como "me de aluguel", for a me biolgica da vaca W, a porcentagem de genes da "me de aluguel" presente no clone ser

a) 0 % b) 25 % c) 50 % d) 75 % e) 100 % Questo 382 A histria da maioria dos municpios gachos coincide com a chegada dos primeiros portugueses, alemes, italianos e de outros povos. No entanto, atravs dos vestgios materiais encontrados nas pesquisas arqueolgicas, sabemos que outros povos, anteriores aos citados, protagonizaram a nossa histria. Diante da relevncia do contexto e da vontade de valorizar o nosso povo nativo, "o ndio", foi selecionada a rea temtica CULTURA e as questes foram construdas com base na obra "Os Primeiros Habitantes do Rio Grande do Sul" (Custdio, L. A. B., organizador. Santa Cruz do Sul: EDUNISC; IPHAN, 2004). "Nossos ancestrais, uma mistura de ndios, brancos e negros, deixaram-nos um legado que, muitas vezes, diferencia-nos. Nosso chimarro nos identifica em qualquer parte do mundo. Ainda hoje, convivemos com grupos indgenas, como os Kaingng; ainda hoje, as trs raas se mesclam em nossos descendentes." O DNA presente nas mitocndrias tem composio e estrutura tpicas desse tipo de cido nuclico, portanto formado por I. uma cadeia de nucleotdeos em que as bases nitrogenadas interagem, formando ligaes fosfo-dister. II. duas cadeias polinucleotdicas paralelas e complementares entre si, atravs dos pareamentos de aminocidos. III. nucleotdeos que so compostos por uma base nitrogenada, uma pentose e um radical "fosfato". Est(o) correta(s) a) apenas I. b) apenas II. c) apenas III. d) apenas I e II. e) apenas II e III.

79

Questo 383 O texto abaixo refere-se s questes: ** a ** 1.5.9.3 A anemia falciforme ou siclemia uma doena hereditria que leva formao de hemoglobina anormal e, conseqentemente, de hemcias que se deformam. condicionada por um alelo mutante s. O indivduo SS normal, o Ss apresenta anemia atenuada e o ss geralmente morre. Supondo populaes africanas com incidncia endmica de malria, onde a anemia falciforme no sofra influncia de outros fatores e onde novas mutaes no estejam ocorrendo, a freqncia do gene a) S permanece constante. b) S tende a diminuir. c) S tende a aumentar. d) s permanece constante. e) s tende a aumentar. Questo 384 Verificou-se que em populaes de regies onde a malria endmica, os heterozigotos (Ss) so mais resistentes malria do que os normais (SS). Nesse caso so verdadeiras as afirmaes a seguir, EXCETO: a) A malria atua como agente seletivo. b) O indivduo ss leva vantagem em relao ao SS. c) O indivduo Ss leva vantagem em relao ao SS. d) Quando a malria for erradicada, ser heterozigoto deixar de ser vantagem. e) Quando a malria for erradicada, haver mudana na freqncia gnica da populao. Questo 385 O esquema a seguir mostra a seqncia do DNA que leva formao da hemoglobina normal e a que leva formao da hemoglobina alterada. Considere os segmentos de DNA a seguir:

rata-se de um caso de mutao por a) perda de um par de bases no DNA, sem alterao do aminocido codificado. b) adio de um par de bases no DNA, sem alterao do aminocido codificado. c) inverso de um par de bases no DNA, sem alterao do aminocido codificado. d) inverso de um par de bases no DNA, com alterao do aminocido codificado, mas no da protena correspondente. e) inverso de um par de bases no DNA, com alterao do aminocido codificado e da protena correspondente. Questo 386 O sangue, que constitudo por plasma e algumas clulas especializadas, circula pelo corao, artrias, vasos e capilares transportando gases, nutrientes etc. Um adulto de peso mdio tem cerca de 5 litros de sangue em circulao. Uma me, com tipo sangneo O, Rh, tem um filho O, Rh, mas tem dvidas sobre qual dos trs namorados o pai da criana: Joo tem tipo sangneo A, Rh, Jos tem tipo AB, Rh e Pedro A, Rh. O geneticista consultado informou que o pai pode ser a) Joo. b) Jos. c) Pedro. d) Joo ou Jos. e) Jos ou Pedro. Questo 387 O texto abaixo refere-se s questes: ** a ** Na(s) questo(es) a seguir escreva nos parnteses a soma dos itens corretos. Doena pode ser definida como um desequilbrio do organismo ou ausncia de bem-estar fsico e mental. Ela
80

pode ter inmeras causas e variar de intensidade e manifestao. Com relao a esse tema, CORRETO afirmar: (01) O alcoolismo, o tabagismo e a dependncia de outras drogas so exemplos de causas que podem resultar em doenas. (02) Doenas genticas so aquelas causadas por alteraes do patrimnio gentico e podem passar de pais para filhos, atravs do material gentico. (04) Doenas traumticas so aquelas que se originam de acidentes, podendo resultar em fratura de ossos, hemorragias, etc. (08) Doenas funcionais resultam do mau desempenho ou da perda de um rgo ou sistema. (16) Doenas transmissveis so as transmitidas por patgenos ou por seus produtos. (32) O mongolismo um exemplo de doena hereditria, enquanto a eritroblastose fetal uma doena congnita. Soma ( )

(04) Se o doador das clulas possuir um defeito gentico, como o albinismo, seu clone possuir, tambm, essa anomalia. (08) rgos transplantados do clone para o doador das clulas sero sempre rejeitados. (16) J existem seres humanos que foram originados e desenvolvidos plenamente por clonagem. (32) Se o doador de clulas sofrer a perda de um membro antes de ser realizada a clonagem, o organismo originado posteriormente, por esse processo, nascer sem o referido membro. Soma ( )

Questo 390 O texto abaixo refere-se s questes: ** a ** Na(s) questo(es) adiante, escreva no espao apropriado a soma dos itens corretos. No homem, o gene (h) para hemofilia est localizado no cromossoma X e recessivo em relao ao gene (h+) para coagulao normal do sangue. Com base nesta informao, correto afirmar: (01) Um homem hemoflico, casado com uma mulher homozigota normal, ter 50% de seus filhos afetados, independentemente do sexo. (02) Uma mulher, filha de um indivduo hemoflico, certamente ser hemoflica. (04) Um homem hemoflico, casado com uma mulher homozigota normal, ter todos os seus filhos normais, independentemente do sexo. (08) Um homem hemoflico teve uma filha normal. A probabilidade desta mulher ter uma criana do sexo masculino e hemoflico igual a 1/4. Soma = ( )

Questo 388 Considerando inclusive a possibilidade de permuta gentica, um indivduo portador do gentipo ABD//abD poder produzir os seguintes gametas: (01) Portador apenas de A ou a, sem alelos B e D. (02) a b D (04) portador apenas de B ou d, sem alelos A e D. (08) A B D (16) a B D (32) portador apenas de D, sem alelos A e B. (64) A b D Soma ( )

Questo 389 Clones so seres vivos obtidos pelo desenvolvimento de clulas retiradas de indivduos j existentes. A clonagem um processo que vem sendo desenvolvido rapidamente com vrios organismos e, em humanos, encontra barreiras de ordem tica. Sobre esse processo CORRETO afirmar: (01) Os clones so como irmos gmeos fraternos do doador das clulas. (02) O material gentico do doador das clulas e do clone idntico. Questo 391 Em parte motivada pela necessidade mundial de aumentar a produo de alimentos, a cincia do melhoramento gentico procura encontrar solues que aumentem a produtividade de certas espcies. Muitas vezes, usando tcnicas sofisticadas, os cientistas provocam modificaes nessas espcies em busca de seus benefcios e atuam semelhana da natureza. Leia o texto adiante e compare-o com o esquema.
81

"Nos prximos meses chegam s lavouras dos Estados Unidos e Canad sementes de milho, batata e algodo alteradas geneticamente em laboratrio, para destruir as pragas que atacam essas culturas. Os cientistas alteraram o cdigo gentico dessas sementes e, nos testes experimentais, escolheram e reproduziram aquelas cujas plantas apresentassem a capacidade de produzir uma protena inseticida. Essa protena, quando ingerida com as folhas, matava os insetos que atacavam as plantaes. Livre dos mesmos, a produtividade das lavouras ser bem maior." (Veja, 21/02/1996) Da comparao entre o texto e o esquema, correto afirmar:

Questo 392 Uma criana de aproximadamente 1 ano, com acentuado atraso psicomotor, encaminhada pelo pediatra a um geneticista clnico. Este, aps alguns exames, constata que a criana possui ausncia de enzimas oxidases em uma das organelas celulares. Esse problema pode ser evidenciado no dia-a-dia, ao se colocar HO em ferimentos. No caso dessa criana, a HO "no ferve". O geneticista clnico explica aos pais que a criana tem uma doena de origem gentica, monognica com herana autossmica recessiva. Diz tambm que a doena muito grave, pois a criana no possui, em um tipo de organela de suas clulas, as enzimas que deveriam proteger contra a ao dos radicais livres. Qual o gentipo dos pais da criana descrita no texto e qual a probabilidade de o casal ter outro filho com essa mesma doena? a) AA x aa; 1/8. b) Aa x aa; 1/2. c) Aa x Aa; 1/4. d) Aa x aa; 1/4. e) Aa x Aa; 1/8. Questo 393

1.5.15.2

(01) A afirmativa "Os cientistas alteraram o cdigo gentico dessas sementes" est relacionada somente ao item 1 do esquema. (02) A afirmativa "Os cientistas alteraram o cdigo gentico dessas sementes" est relacionada aos itens 1, 2 e 4 do esquema. (04) A afirmativa "nos testes experimentais, escolheram e reproduziram aquelas cujas plantas apresentassem a capacidade de produzir uma protena inseticida" est relacionada aos itens 3 e 4 do esquema. (08) A afirmativa "nos testes experimentais, escolheram e reproduziram aquelas cujas plantas apresentassem a capacidade de produzir uma protena inseticida" est relacionada aos itens 4 e 5 do esquema. (16) A afirmativa "Livre dos mesmos, a produtividade das lavouras ser bem maior" refere-se ao item 6 do esquema. Soma = ( )

O ciclo celular interrompido entre as fases G/S e G/mitose, e protenas especiais controlam a evoluo do ciclo celular das novas clulas. Entre S/G algumas protenas checam possveis falhas e erros na linha de produo, decidem se o ciclo celular avana ou paralisado iniciando um processo de destruio do material gentico, conhecido como APOPTOSE, ou morte celular espontnea. Portanto, a inativao de qualquer um dos componentes ou operadores do sistema de checagem ou de apoptose poderia provocar a proliferao contnua das clulas e possvel desenvolvimento de tumores cancerosos. Um exemplo observvel das conseqncias de apoptoses o descamar da pele aps sua exposio prolongada a radiao solar intensa. Abaixo est transcrito um pequeno trecho de uma recente entrevista, concedida Revista Galileu pelo cientista Srgio Danilo Pena, da Universidade Federal de Minas Gerais, que liderou uma pesquisa gentica sobre a composio tnica do povo brasileiro. GALILEU: " correta a noo de que a maior parte dos
82

brasileiros tem algum antepassado com pai branco europeu e me negra ou ndia ?" PENA: ". Meu caso exatamente esse. Meu cromossomo Y europeu e meu DNA mitocondrial amerndio." A resposta do geneticista aliada aos seus conhecimentos permite afirmar, EXCETO: a) O DNA do cromossomo Y e das mitocndrias apresenta genes que determinam a cor da pele humana. b) O DNA mitocondrial de origem materna. c) O cromossomo Y apresenta genes exclusivamente paternos. d) Pelo estudo acima, somente o genoma de indivduos do sexo masculino pode ser utilizado para a determinao da ancestralidade paterna. Questo 394 Instrues: Leia atentamente o texto adiante para responder s questes a seguir. MONTEIRO LOBATO (1882-1947) 1. As obras "infantis" de Monteiro Lobato ajudaram muito na formao de milhares de pequenos brasileiros que, quando marmanjos, passariam a citar de boca cheia, e s vezes sem confessar, uma poro de coisas que aprenderam com as personagens do Stio do Picapau Amarelo, inesquecveis companheiras de aventuras por vrios tempos e espaos. Quanto da histria e da mitologia grega no se aprende ao lado da boneca Emlia, que tagarela pedantemente com Pricles ou com Hrcules? Na "Histria do mundo para as crianas", vai-se da origem do universo (sabiamente explicada pela vov Benta como hiptese), passando pelo uso do fogo, pelos hierglifos, pelos assrios e babilnios, pelo imprio romano, pelos tempos da cavalaria, pelas revolues do sculo XVIII, at chamada "era dos milagres", que como Lobato batizou a vida com luz eltrica, telefone, cinema - e com o manejo atmico que deu na tragdia de Hiroshima, eplogo tambm do livro, que termina com esta frase da vov sabida: "O tempo, s o tempo pode curar o grande defeito da humanidade - que ser muito criana ainda". Dona Benta (permito-me eu), o homem continua brincando, e seus brinquedos so cada vez mais fantsticos e perigosos... 2. Sempre foi inteno de Lobato ensinar sem ser chato,

opinar sem ser pretensioso. Se Dona Benta uma velha de culos e muita leitura, Emlia uma abelhuda crtica e irreverente. Em "Emlia no pas da Gramtica", onde no faltam lies de fontica, de formao e de classes de palavras, h esta frase da boneca que muito lingista moderno poderia adotar como lema, fazendo coro com os alunos: "- Que peste a tal Gramtica!". J depois de ler a "Aritmtica da Emlia", o jovem leitor lamentar que Lobato no tenha entrado na lgebra e na Geometria, nas expresses, nas equaes de todos os graus, nas seqncias e nas funes - para que o escritor lhe apresentasse alguns dos "bichos de sete cabeas" da Matemtica com a mesma graa e eficcia com que iniciara os meninotes nas fraes e nos nmeros complexos. Tambm um iniciante na Fsica no pode se queixar, lendo a "Histria das invenes": so sugestivas as explicaes sobre a operao das alavancas (que permitiu ao homem a construo das pirmides), das roldanas, das dragas (com as quais se escavou o Canal do Panam), dos guindastes, dos moinhos... Nesse mesmo livro, qualquer um admirar a facilidade com que se explica a formao e as propriedades do vidro, do carvo, do petrleo... Quanto ao petrleo, no custa lembrar que a campanha nacionalista de Lobato, que inclua a explorao estatal do "ouro negro" (como tambm a do ferro), custou-lhe seis meses de cadeia, em 1941, num perodo especialmente sombrio da histria do nosso pas e trgico da histria universal. Em "O poo do Visconde", jorra o precioso leo em pleno stio, e no falta a chegada do tcnico norte-americano para tentar tomar conta da situao e acabar escorraado pelos indignados habitantes... 3. Em "A reforma da natureza", as experincias realizadas por Emlia e pelo Visconde geram monstros: alteram o funcionamento de "Dona Pituitria" em insetos, que assim adquirem novas formas, propores e propriedades, espantando os vizinhos e provocando em D. Benta uma verdadeira manifestao ecolgica: "- Mas que absurdo, Emlia, reformar a natureza! Quem somos ns para corrigir qualquer coisa que existe? E quando reformamos qualquer coisa, aparecem logo muitas conseqncias que no previmos. Tudo quanto existe levou milhes de anos a formar-se, a adaptar-se; e se est no ponto em que est, existem mil razes para isso." Que diria hoje D. Benta acerca da clonagem e dos transgnicos? 4. As adaptaes que faz Lobato de obras ficcionais ou a recuperao de fatos histricos so tambm notveis: seu "D. Quixote" alegre e comovente, seu "Hans Staden"
83

introduz o leitor num captulo importante de nossa histria colonial, nem falta a apresentao de personagens como Marco Polo, Bolvar e Lincoln, conhecido por suas frases lapidares. O que espanta nessa pluralidade que nada surge como aleatrio, tudo parece fazer parte de uma didtica natural, proveitosa e sempre polemizada pela palpiteira Emlia. 5. O leitor que percorra essa obra notar, em muitos pontos, o quanto ela tem de orgnico. Se num livro o autor se referia, por exemplo mquina a vapor, em outro esse invento vem associado ao carvo-de-pedra que, "mais o ferro, foi o que deu a vitria aos ingleses. Sem isso, a Inglaterra seria um quase nada, como o fora antes da inveno de Watt". 6. Ao instalar suas criaturas numa base rural, dispondo-se a dali falar de tudo e a contar qualquer histria (numa linguagem ao mesmo tempo exata, imaginativa e fluente, sem concesses famigerada "literatura infantil"), Lobato parece ter querido reunir a beleza natural do primitivo ao encantamento pelo enciclopdico. De certa forma, reuniu a seu modo as realidades de um pas ainda arcaico e j moderno, contradio nossa at hoje. Soube admirar tanto a mangueira frondosa quanto a tcnica fecunda; se vivesse nos dias de hoje, provavelmente estaria batalhando pelo desenvolvimento sustentvel. 7. Sempre haver a curiosidade nossa de saber o que Emlia pensaria hoje da globalizao, da difuso de novas seitas, dos conflitos religiosos, das aes terroristas... . Se nada mais sobrasse da obra de Lobato, essa vivssima boneca de pano expressaria sempre um fundamento de malandragem, humor e vivacidade crtica - combinao que, dizem alguns, resume algo de nosso "temperamento", forjado no caldeiro de raas e culturas de que procedemos. (Eurpides de Souza e Passos, indito) Que diria hoje "D. Benta" acerca da "clonagem" e dos "transgnicos"? Atualmente ela teria notcias freqentes sobre tcnicas de manipulao do DNA. Um exemplo delas constitui a matria publicada recentemente em um jornal, segundo a qual cientistas ingleses esto conseguindo transferir certos genes de bactrias para mosquitos anofelinos. Estes genes teriam a capacidade de impedir a instalao de determinadas fases do protozorio 'Plasmodium' no estmago e nas glndulas salivares do mosquito. Esse exemplo refere-se construo de um organismo a) transgnico til para a erradicao da malria. b) transgnico til para a erradicao da esquistossomose.

c) transgnico til para a erradicao da leishmaniose. d) clonado til para a erradicao da malria. e) clonado til para a erradicao da leishmaniose. Questo 395 "Virtualmente, cada aspecto da vida de nossas clulas regulado por seu DNA, incluindo sua prpria morte. As ltimas instrues do DNA, enviadas ao citoplasma, referem-se morte da clula. Logo que essas instrues sejam recebidas e processadas, a clula comea a destruir todo o DNA de seu ncleo, partindo-o em milhares de pedaos que no mais conseguem enviar instrues teis clula. Esta, apesar de poder continuar exercendo determinadas funes durante certo tempo, est fadada a morrer, processo este decididamente irreversvel." (Traduzido e adaptado de: William R. Clark. SEX AND THE ORIGINS OF DEATH. New York: Oxford University Press, 1996. p. 32-5) Considere os seguintes fatos: I. uma clula do miocrdio morta por falta de oxignio durante um ataque cardaco; II. uma clula morta pelas toxinas produzidas por bactrias invasoras; III. uma clula da camada germinativa da epiderme, que morre e sofre queratinizao. A apoptose, ou morte programada das clulas, verificada SOMENTE em a) I b) II c) III d) I e II e) I e III Questo 396 Na(s) questo(es) a seguir escreva no espao apropriado a soma dos itens corretos. Os termos a seguir fazem parte da nomenclatura gentica bsica. Assinale as alternativas que trazem o significado correto de cada um desses termos: (01) GENE sinnimo de molcula de DNA. (02) GENTIPO a constituio gentica de um indivduo. (04) DOMINANTE um dos membros de um par de alelos que se manifesta inibindo a expresso do outro.
84

(08) FENTIPO a expresso do gene em determinado ambiente. (16) GENOMA o conjunto de todos os alelos de um indivduo. Soma ( )

Questo 397 Cultura dos almanaques 1. Como explicar ao meu leitor mais jovem o que (ou o que era) um ALMANAQUE? Vamos ao dicionrio. L est, entre outras acepes, a que vem ao caso: folheto ou livro que, alm do calendrio do ano, traz diversas indicaes teis, poesias, trechos literrios, anedotas, curiosidades etc. O leitor no faz idia do que cabia nesse etc.: charadas, horscopo, palavras cruzadas, enigmas policiais, astcias da matemtica, recordes mundiais, caricaturas, provrbios, dicas de viagem, receitas caseiras... Pense em algo publicvel, e l estava. 2. J ouvi a expresso "cultura de almanaque", dita em tom pejorativo. Acho injusto. Talvez no seja intil conhecer as dimenses das trs pirmides, ou a histria de expresses como "vitria de Pirro", "vim, vi e venci" e "at tu, Brutus?". E me arrepiava a descrio do ataque base naval de Pearl Harbor, da guilhotina francesa, do fracasso de Napoleo em Waterloo, da queda de caro, das angstias de Colombo em alto mar. Sim, misturava povos e sculos com grande facilidade, mas ainda hoje me valho das informaes de almanaque para explicar, por exemplo, a relao que Pitgoras encontrou no apenas entre catetos e hipotenusa, mas - pasme, leitor - entre o sentimento da melancolia e o funcionamento do fgado. Um bom leitor de almanaque explica como uma bela expresso de Manuel Bandeira - "o fogo de constelaes extintas h milnios" - tambm uma constatao da astrofsica. 3. Algum risco sempre havia: no foi boa idia tentar fazer algumas experincias qumicas com produtos caseiros. E alguns professores sempre implicavam quando eu os contestava ou arga, com base no almanaque. Pegadinhas do tipo "quais so os nmeros que tm relaes de parentesco?" ou questes como "por que uma mosca no se esborracha no vidro dentro de um carro em alta velocidade?" no eram bem-vindas, porque despertavam a classe sonolenta. Meu professor de Cincias fechou a cara

quando lhe perguntei se era hbito de Arquimedes tomar banho na banheira brincando com bichinhos que biam, e minha professora de Histria fingiu que no me ouviu quando lhe perguntei de quem era mesmo a frase "E no entanto, move-se!", que eu achei familiar quando a li pintada no pra-choque de um fordinho com chapa 1932 (relquia de um paulista orgulhoso?). 4. Almanaque no se emprestava a ningum: ao contrrio de um bumerangue, nunca voltaria para o dono. Lembro-me de um exemplar que falava com tanta expresso da guerra fria e de espionagem que me proporcionou um prazer equivalente ao das boas pginas de fico. Um outro ensinava a fazer balo e pipa, a manejar um pio, e se nunca os fiz subir ou rodar era porque meu controle motor j no dava inveja a ningum. Em compensao, conhecia todas as propriedades de uma carnaubeira, o curso e o regime do rio So Francisco, fazia prodgios com ms e saberia perfeitamente reconhecer uma vooroca, se viesse a cair dentro de uma. 5. Pouco depois dos almanaques vim a conhecer as SELEES - READER'S DIGEST - uma espcie de almanaque de luxo, de circulao regular e internacional. Tirando Hollywood, as SELEES talvez tenham sido o principal meio de difuso do AMERICAN WAY OF LIFE, a concretizao editorial do SLOGAN famoso: TIME IS MONEY. No tinha o charme dos almanaques: levava-se muito a srio, o humor era bem-comportado, as matrias tinham um tom meio autoritrio e moralista, pelo qual j se entrevia uma Amrica (como os EUA gostam de se chamar) com ares de dona do mundo. No tinha a galhofa, o descompromisso macunamico dos nossos almanaques em papel ordinrio. Eu no trocaria trs exemplares do almanaque de um certo biotnico pela coleo completa das SELEES. 6. Adolescente, aprendi a me especializar nas disciplinas curriculares, a separar as chamadas reas do conhecimento. Deixei de lado os almanaques e entrei no funil apertado das tendncias vocacionais. Com o tempo, descobri este emprego de cronista que me abre, de novo, todas as portas do mundo: posso falar da minha rua ou de Bagdad, da reunio do meu condomnio ou da assemblia da ONU, do meu canteirinho de temperos ou da safra nacional de gros. Agora sou autor do meu prprio almanaque. Se fico sem assunto, entro na Internet, esse almanaque multidisciplinarssimo de ltima gerao. O "buscador" da HOME PAGE uma espcie de orculo de Delfos de efeito
85

quase instantneo. E o ingls, enfim, se globalizou pra valer: meus filhos j aprenderam, na prtica, o sentido de outro SLOGAN prestigiado, NO PAIN, NO GAIN (ou GAME, no caso deles). Se eu fosse um nostlgico, diria que, apesar de todo esse avano, os velhos almanaques me deixaram saudades. Mas no sou, como podeis ver. (Argemiro Fonseca) A produo brasileira de gros ultrapassou 115,2 milhes de toneladas na safra 2002/03, o que significa uma elevao de 19% em comparao colheita anterior, de 96,5 milhes de toneladas. Parte dessa safra refere-se produo da soja. Segundo a "Folha de S.Paulo" de 23/09/03, cerca de 8% da produo nacional da soja biologicamente adulterada. Assinale a alternativa que contm argumentos favorveis produo, no Brasil, de alimentos geneticamente modificados. a) H muitas dvidas sobre eventuais danos sade do consumidor provocados pelas alteraes genticas nos alimentos. b) O mercado europeu resistente a este tipo de alimento, o que representaria uma vantagem comercial ao pas que os probe. c) Pode haver cruzamento entre a cultura convencional e a geneticamente modificada, podendo acarretar o fim da espcie convencional. d) Pode haver efeitos sobre vrias espcies de insetos protetores da flora e de polinizadores. e) O desenvolvimento desta tecnologia poder aumentar a produtividade em relao tradicional. Questo 398 A qualidade da gua pode ser alterada por vrios fatores: - contaminantes biolgicos, que podem transformar as guas em fontes de transmisso de doenas; - compostos orgnicos que, mesmo em baixas concentraes, podem interferir no funcionamento dos seres vivos, como o benzeno, que um agente mutagnico, e os hormnios humanos, que podem ser exemplificados pelos esterides. O benzeno, por ser mutagnico, deve I - aumentar as taxas de mutao em todos os seres vivos, no apenas no homem. II - permitir o surgimento de novos alelos, por alterar a seqncia de nucleotdeos do DNA. III - impedir o funcionamento dos cidos nuclicos,

especialmente durante a transcrio e a traduo. Est(o) correta(s) a) apenas I. b) apenas II. c) apenas III. d) apenas I e II. e) I, II e III. Questo 399 O texto abaixo refere-se s questes: ** a ** Ao distncia, velocidade, comunicao, linha de montagem, triunfo das massas, Holocausto: atravs das metforas e das realidades que marcaram esses cem ltimos anos, aparece a verdadeira doena do progresso... O sculo que chega ao fim o que presenciou o Holocausto, Hiroshima, os regimes dos Grandes Irmos e dos Pequenos Pais, os massacres do Camboja e assim por diante. No um balano tranqilizador. Mas o horror desses acontecimentos no reside apenas na quantidade, que, certamente, assustadora. Nosso sculo o da acelerao tecnolgica e cientfica, que se operou e continua a se operar em ritmos antes inconcebveis. Foram necessrios milhares de anos para passar do barco a remo caravela ou da energia elica ao motor de exploso; e em algumas dcadas se passou do dirigvel ao avio, da hlice ao turborreator e da ao foguete interplanetrio. Em algumas dezenas de anos, assistiu-se ao triunfo das teorias revolucionrias de Einstein e a seu questionamento. O custo dessa acelerao da descoberta a hiperespecializao. Estamos em via de viver a tragdia dos saberes separados: quanto mais os separamos, tanto mais fcil submeter a cincia aos clculos do poder. Esse fenmeno est intimamente ligado ao fato de ter sido neste sculo que os homens colocaram mais diretamente em questo a sobrevivncia do planeta. Um excelente qumico pode imaginar um excelente desodorante, mas no possui mais o saber que lhe permitiria dar-se conta de que seu produto ir provocar um buraco na camada de oznio. O equivalente tecnolgico da separao dos saberes foi a linha de montagem. Nesta, cada um conhece apenas uma fase do trabalho. Privado da satisfao de ver o produto acabado, cada um tambm liberado de qualquer responsabilidade. Poderia produzir venenos sem que o soubesse - e isso ocorre com freqncia. Mas a linha de

86

montagem permite tambm fabricar aspirina em quantidade para o mundo todo. E rpido. Tudo se passa num ritmo acelerado, desconhecido dos sculos anteriores. Sem essa acelerao, o Muro de Berlim poderia ter durado milnios, como a Grande Muralha da China. bom que tudo se tenha resolvido no espao de trinta anos, mas pagamos o preo dessa rapidez. Poderamos destruir o planeta num dia. Nosso sculo foi o da comunicao instantnea, presenciou o triunfo da ao distncia. Hoje, aperta-se um boto e entra-se em comunicao com Pequim. Aperta-se um boto e um pas inteiro explode. Aperta-se um boto e um foguete lanado a Marte. A ao distncia salva numerosas vidas, mas irresponsabiliza o crime. Cincia, tecnologia, comunicao, ao distncia, princpio da linha de montagem: tudo isso tornou possvel o Holocausto. A perseguio racial e o genocdio no foram uma inveno de nosso sculo; herdamos do passado o hbito de brandir a ameaa de um compl judeu para desviar o descontentamento dos explorados. Mas o que torna to terrvel o genocdio nazista que foi rpido, tecnologicamente eficaz e buscou o consenso servindo-se das comunicaes de massa e do prestgio da cincia. Foi fcil fazer passar por cincia uma teoria pseudocientfica porque, num regime de separao dos saberes, o qumico que aplicava os gases asfixiantes no julgava necessrio ter opinies sobre a antropologia fsica. O Holocausto foi possvel porque se podia aceit-lo e justific-lo sem ver seus resultados. Alm de um nmero, afinal restrito, de pessoas responsveis e de executantes diretos (sdicos e loucos), milhes de outros puderam colaborar distncia, realizando cada qual um gesto que nada tinha de aterrador. Assim, este sculo soube fazer do melhor de si o pior de si. Tudo o que aconteceu de terrvel a seguir no foi se no repetio, sem grande inovao. O sculo do triunfo tecnolgico foi tambm o da descoberta da fragilidade. Um moinho de vento podia ser reparado, mas o sistema do computador no tem defesa diante da m inteno de um garoto precoce. O sculo est estressado porque no sabe de quem se deve defender, nem como: somos demasiado poderosos para poder evitar nossos inimigos. Encontramos o meio de eliminar a sujeira, mas no o de eliminar os resduos. Porque a sujeira nascia da indigncia, que podia ser reduzida, ao passo que os resduos (inclusive os radioativos) nascem do bem-estar que ningum quer mais perder. Eis porque nosso sculo foi

o da angstia e da utopia de cur-la. Espao, tempo, informao, crime, castigo, arrependimento, absolvio, indignao, esquecimento, descoberta, crtica, nascimento, vida mais longa, morte... tudo em altssima velocidade. A um ritmo de STRESS. Nosso sculo o do enfarte. (Adaptado de Umberto Eco, Rpida Utopia. VEJA, 25 anos, Reflexes para o futuro. So Paulo, 1993). No texto, o autor menciona que no conseguimos eliminar os resduos radioativos do ambiente. Um exemplo ocorreu em 1987, em Goinia, onde foi abandonada uma cpsula contendo p de Csio-137 e que foi aberta por pessoas desavisadas, que sofreram graves danos em conseqncia desse ato. Para tais conseqncias, deram-se as seguintes explicaes: I - As emisses radioativas introduziram energia nas clulas. II - A energia provocou alteraes nos compostos qumicos das clulas. III - As clulas reagiram e, sob a forma de calor, devolveram essa energia para o ambiente. IV - As clulas humanas esto adaptadas a receber energia com os comprimentos de onda do Csio-137. Dessas explicaes, esto corretas SOMENTE a) I e II b) I e III c) II e IV d) I, II e III e) II, III e IV Questo 400 Apesar da "acelerao tecnolgica e cientfica de nosso sculo" nem todos os problemas puderam ser solucionados, como por exemplo, o fato de certas pessoas, quando picadas por abelhas, apresentarem uma reao alrgica toxina desses animais. Se forem novamente picadas, especialmente por um grande nmero desses insetos, elas podero apresentar uma reao denominada a) hemlise. b) choque anafiltico. c) choque trmico. d) embolia. e) reforo do sistema imunolgico.

87

Questo 401 Jamie Whitaker mal nasceu e j se tornou celebridade. Jamie o que j est sendo chamado de "irmo salvador" pelos tablides (jornais populares) do Reino Unido, uma criana gerada para fornecer tecidos vivos para tentar salvar a vida de outro filho de seus pais. O irmo de Jamie se chama Charlie e sofre de uma forma rara de anemia causada por anomalia gentica... Como foi concebido por tcnicas de fertilizao "in vitro"... Jamie pde ter suas clulas testadas no tero, uma forma de confirmar sua compatibilidade com as de Charlie. (Leite, M. Cincia em Dia. Folha de S. Paulo, MAIS! 29.06.2003.) Em relao ao texto, podemos afirmar que: a) ao fazer referncia tcnica de fertilizao in vitro e de escolha de gentipos de seres humanos, o texto nos coloca diante de situaes concretas de biotecnologia e de biotica. b) o fato relatado, embora envolva questes de biotecnologia, nada tem a ver com aspectos de biotica, pois no envolve escolha de gentipo de seres humanos. c) no se trata de uma questo que envolva biotecnologia e biotica, pois as tcnicas de fertilizao in vitroj so de total domnio e amplamente utilizadas pelos especialistas na rea de reproduo humana. d) o caso relatado no envolve problemas de biotica, uma vez que na concepo de Jamie foram empregadas tcnicas de fertilizao in vitro. e) no se pode associar a fertilizao "in vitro" com biotecnologia ou com biotica, uma vez que o embrio, depois de selecionado, implantado no tero materno, onde, de fato, se d o desenvolvimento do feto. Questo 402 O texto abaixo refere-se s questes: ** a ** Professor Astrogildo combinou com seus alunos visitar uma regio onde ocorria extrao de minrio a cu aberto, com a inteno de mostrar os efeitos ambientais produzidos por aquela atividade. Durante o trajeto, professor Astrogildo ia propondo desafios a partir das situaes do dia-a-dia vivenciadas ao longo do passeio. Algumas das questes propostas por professor Astrogildo esto apresentadas a seguir para que voc responda. "J est na hora de voltar. O motorista est buzinando. Vamos!" A turma entrou muito animada no nibus e

Ariosvaldo percebeu que o motorista era calvo. Ariosvaldo refletiu e perguntou: "Professor, por que no se v mulher careca?" O professor respondeu que a ocorrncia de calvcie em mulheres era muito rara. Isso ocorre porque a) o gene responsvel pela calvcie est no cromossomo Y. b) a expresso do gene depende da presena de hormnios masculinos. c) a calvcie uma caracterstica gentica cuja herana ligada ao sexo. d) a mulher s ser careca se tiver os dois alelos recessivos. Questo 403 Quando a garonete se aproximou, professor Astrogildo perguntou-lhe se seria seu primeiro filho. Ela o informou de que j era sua terceira gestao. Na primeira, o seu filho nasceu normal e, na segunda, a criana teve eritroblastose fetal. Nessa situao, os gentipos do pai das crianas, da me, do primeiro e do segundo filhos seriam: a) Pai - RR; Me - Rr; 1 Filho - Rr; 2 Filho - Rr. b) Pai - Rr; Me - Rr; 1 Filho - rr; 2 Filho - Rr. c) Pai - RR; Me - rr; 1 Filho - Rr; 2 Filho - Rr. d) Pai - Rr; Me - rr; 1 Filho - rr; 2 Filho - Rr. Questo 404 Aproveitando a pergunta de Zeca, o professor esquematizou o processo de sntese protica, em que os nmeros I, II, III e IV representam molculas de cidos nuclicos.

1.5.8.3

88

partir do esquema, correto afirmar que a) I corresponde ao RNA que contm o cdigo gentico determinando a seqncia de aminocidos da protena. b) II corresponde ao RNA que catalisa a unio do I com o III, durante o processo de transcrio. c) III corresponde ao RNA que contm o anticdon complementar ao cdon existente em I. d) IV corresponde ao RNA que catalisa a ligao dos nucleotdeos com a desoxirribose. Questo 405 Zeca perguntou: "Professor, j que as clulas beta do pncreas de um diabtico no so capazes de sintetizar insulina, por que as clulas alfa desse mesmo rgo no assumem esta funo?" A sntese da insulina no ocorre nas clulas alfa porque o(s) a) gene da insulina est defeituoso. b) cromossomos no tm o gene da insulina. c) gene da insulina est inativo. d) cromossomo com o gene da insulina no est presente. Questo 406 O texto abaixo refere-se s questes: ** a ** Em uma espcie de abelha, a cor dos olhos condicionada por uma srie de cinco alelos, entre os quais h a seguinte relao de dominncia: a > a > a > a >a a : marrom a : prola a : neve a : creme a : amarelo Uma rainha de olhos marrons, heterozigtica para prola, foi inseminada por espermatozides provenientes de machos com olhos das cores marrom (20%), prola (20%), neve (20%), creme (20%) e amarelo (20%). Essa rainha produziu, em um dia, 1 250 gametas dos quais 80% foram fecundados. Todos os gametas produzidos resultaram em descendentes. Assinale a alternativa da tabela que indica corretamente o nmero esperado de descendentes dessa rainha. a) 1250 fmeas; (zero) machos b) 1000 fmeas; (zero) machos

c) 1000 fmeas; 250 machos d) 625 fmeas; 625 machos e) 500 fmeas; 500 machos Questo 407 Os descendentes dessa rainha tero olhos a) somente da cor marrom. b) O somente das cores marrom ou prola. c) da cor marrom se forem fmeas; da cor prola, se forem machos. d) da cor marrom ou prola, se forem fmeas, e, nos machos, as cinco cores sero possveis. e) da cor marrom ou prola, se forem machos, e, nas fmeas, as cinco cores sero possveis. Questo 408 O texto abaixo refere-se s questes: ** a ** A alcaptunria uma disfuno extremamente rara do metabolismo humano. Os indivduos afetados apresentam a cor da urina vermelho pardacenta devido a uma alterao no metabolismo normal da fenilalanina. O gene determinante dessa disfuno est localizado no cromossomo 9, onde tambm encontramos os genes que determinam os grupos sangneos ABO ( I; I; i ). O heredograma a seguir foi montado para se estudar a disfuno em uma determinada famlia, para a qual o tipo sangneo de cada um dos membros est indicado.

1.5.6

89

nalisando-se o heredograma, possvel afirmar, EXCETO: a) A alcaptonria um carter determinado por gene autossmico recessivo. b) O indivduo 3 pode ter recebido um gameta recombinante de sua me. c) O indivduo 6 certamente no recebeu um gameta recombinante da sua me ou do seu pai. d) A chance de o indivduo 9 ser heterozigoto para o carter alcaptonria de 2/3. Questo 409

(Darwin, apud DARNELL, p. 2 - traduzido) TEXTO II: Os hbridos, de cada par de caracteres diferenciais, formam sementes das quais a metade novamente desenvolve a forma hbrida, enquanto a outra metade produz plantas que permanecem constantes e recebem os caracteres dominantes e recessivos em partes iguais. (Mendel, apud FREIRE-MAIA, p. 1117) Em relao s idias de Darwin e de Mendel, exemplificadas nos textos, pode-se dizer: (01) As "plantas que permanecem constantes" ao longo das geraes so homozigotas. (02) A herana de um carter determinada pela fuso dos fatores condicionantes na descendncia. (04) A citao de Mendel expressa a proporo genotpica 1:2:1, esperada em F2. (08) A seleo natural pode preservar caractersticas diferentes, em diferentes ambientes. (16) O trabalho de Darwin afirma a constncia gentica do mundo biolgico. (32) Variaes referidas por Darwin transmitem-se descendncia segundo o padro mendeliano de herana. Soma ( )

1.5.6

posio ocupada pelos alelos que determinam grupo sangneo e alcapatonria, no par de cromossomos 9, est representada para o indivduo 7 ao lado do heredograma. A freqncia de recombinao entre os dois loci gnicos de 10%. So freqncias esperadas de descendentes para o cruzamento 6 X 7, EXCETO: a) 22,5% AB normais. b) 45% de A normais. c) 50% de afetados. d) 50% B normais ou afetados. Questo 410 O texto abaixo refere-se s questes: ** a ** Na(s) questo(es) a seguir escreva nos parnteses a soma dos itens corretos. TEXTO I: Como muito mais organismos de cada espcie nascem do que provavelmente sobrevivem e como, conseqentemente, h uma freqente luta pela existncia, segue-se que qualquer organismo que varia de modo proveitoso para si prprio, sob condies de vida complexas e algumas vezes variveis, ter uma melhor oportunidade de sobrevivncia e, assim, de ser "naturalmente selecionado".

Questo 411 A idia da eugenia, que se ocupa do aperfeioamento fsico e mental da espcie humana, perigosamente em alta em pases desenvolvidos da Europa, se sustenta em premissas incorretas, que violam princpios sociais e admitem conceitos biolgicos errneos, como na citao: "Os cromossomos, (...) os determinantes (...) se entrechocam, lutam entre si, selecionam-se, eliminando-se com o glbulo polar os mais fracos, os inferiores, e persistindo nos proncleos resultantes os mais aptos, os mais fortes." (Kehl apud BIZZO, p. 30) Considerando-se os princpios biolgicos que regem a herana, pode-se afirmar: (01) A subordinao aos princpios mendelianos reduz a variabilidade nas espcies que se reproduzem sexuadamente.
90

(02) A segregao dos cromossomos homlogos, na primeira diviso meitica, aleatria. (04) O efeito de um determinado gene depende do ambiente em que ele expresso. (08) Os fatores genticos se misturam e se diluem ao longo das geraes. (16) A aplicao de princpios eugnicos comprometeria a sobrevivncia da espcie humana. (32) Alteraes do fentipo, adquiridas por indivduos de uma gerao, repercutem alm dela, atingindo sua prole. (64) As repercusses da eugenia em populaes humanas descartam sua aplicao para qualquer fim. Soma ( )

o processo evolutivo. Soma ( )

Questo 413 Os radioistopos, apesar de temidos pela populao que os associa a acidentes nucleares e danos ambientais, exercem importante papel na sociedade atual. So hoje praticamente indispensveis medicina, engenharia, indstria, hidrologia, antropologia e pesquisa acadmica em diversas reas do conhecimento, seja por atuarem como traadores radioativos, ou como fontes de radiaes. O temor da populao em relao aos radioistopos relaciona-se capacidade desses elementos produzirem mutaes nos seres vivos. No entanto, as mutaes ocorrem naturalmente e tm uma grande importncia evolutiva porque a) geram a variabilidade sobre a qual a seleo natural pode agir. b) geram as adaptaes, que permitem a sobrevivncia das espcies. c) permitem a origem de novas espcies cada vez melhor adaptadas. d) so responsveis por extines em massa, como a dos trilobitas. e) so o nico processo evolutivo agindo atualmente no homem. Questo 414

Questo 412 Indivduos portadores da doena "xeroderma pigmentosum", condio gentica autossmica recessiva, apresentam, em clulas epidrmicas, extrema sensibilidade luz solar, resultando em alta freqncia de cncer de pele, principalmente na face. Alguns desses pacientes tambm desenvolvem anormalidades neurolgicas, que parecem resultar da morte prematura de clulas nervosas. Estudos genticos em clulas de organismos afetados revelam a existncia de defeitos no sistema enzimtico responsvel pelo reparo de molculas de DNA danificadas pela exposio a agentes mutagnicos. (GARDNER, p. 307-8 - adaptao) Uma anlise da situao apresentada anteriormente permite afirmar: (01) Agentes mutagnicos incluem fatores fsicos que alteram a estrutura da molcula de DNA. (02) A falha em mecanismos celulares que preservam a fidelidade da mensagem gentica predispe ao cncer. (04) A condio gentica dos indivduos com "xeroderma pigmentosum" determinada pela exposio radiao ultravioleta. (08) A morte prematura de clulas nervosas resulta dos efeitos do acmulo de leses na molcula de DNA. (16) Os genes que condicionam o "xeroderma pigmentosum" so caractersticos de clulas epidrmicas. (32) A ocorrncia de alteraes em clulas nervosas e em clulas epidrmicas pode estar relacionada sua origem embriolgica comum. (64) A preciso dos sistemas de reparo do DNA inviabiliza

Na(s) questo(es) a seguir julgue os itens e escreva nos parnteses (V) se for verdadeiro ou (F) se for falso. A elucidao de crimes, como tambm a identificao da paternidade, vm sendo efetuadas com certa facilidade e segurana atravs do uso de tcnicas apropriadas, em que so considerados bsicos alguns conceitos de gentica. Sobre esses conceitos, julgue os itens. ( ) Caritipo o conjunto de informaes sobre os cromossomos de uma determinada espcie. ( ) Genes alelos so genes que ocupam o mesmo "locus" gnico em cromossomos homlogos. ( ) Um dos catalisadores do processo de duplicao do DNA a enzima DNA polimerase. ( ) Na espcie humana distinguem-se 3 tipos sangneos, e os indivduos do grupo sangneo AB so considerados doadores universais.
91

Questo 415 O texto abaixo refere-se s questes: ** a ** Na(s) questo(es) a seguir, escreva no espao apropriado a soma dos itens corretos. Imagine uma espcie animal na qual um gene A determina a formao do olho e seu alelo recessivo determina a ausncia de olhos. Um outro gene B dominante determina a pigmentao clara do olho, enquanto seu alelo recessivo determina a cor escura. Sabe-se que o gene A est em um cromossomo e B em outro. Feito um cruzamento entre dois indivduos duplamente heterozigticos, correto afirmar que: (01) 9/16 dos descendentes desse cruzamento tero olhos normais e com pigmentao escura. (02) 3/16 dos descendentes desse cruzamento tero olhos normais e com pigmentao clara. (04) 4/16 dos descendentes nascero sem olhos. (08) Estes problemas envolvem a Segunda Lei de Mendel, ou seja, "Lei da Segregao Independente dos Caracteres". Soma ( )

Questo 417 Um canil, especializado na criao de dlmatas, escolheu dois irmos de uma ninhada e os cruzou. Desse cruzamento resultaram oito filhotes que, na sua maioria, apresentaram as mesmas caractersticas dos pais. Observou-se, entretanto, que, dos oito cezinhos, dois nasceram cegos. luz dos conhecimentos de gentica, esse fato pode ser explicado porque houve: (01) Heterose, reduzindo o vigor da ninhada. (02) Efeito gentico da consanginidade. (04) Herana ligada ao cromossomo sexual. (08) Segregao monognica dominante. (16) Deriva gentica, fixando aleatoriamente alguns genes. (32) Semiletalidade, ou seja, efeitos nocivos que podem surgir devido a gentipos recessivos produzidos atravs do cruzamento entre indivduos aparentados. soma = ( )

Questo 418 O texto abaixo refere-se s questes: ** a ** Caros candidatos; Vocs esto convidados a fazer um passeio numa rea de Mata Atlntica, onde vero um maravilhoso ecossistema. Nesse passeio, vocs estaro em contato com a natureza, vero de perto a diversidade da fauna e da flora, compreendero como as espcies se inter-relacionam, se reproduzem e como se do alguns fenmenos biolgicos nos seres que vivem ali e at naqueles que visitam esse ambiente. Vocs tero a oportunidade de verificar de que maneira o homem pode interferir nesse meio, alterando-o, e quais as conseqncias disso. Tambm sero convocados a responder a questes bsicas no campo da Biologia. Para tanto, contaro com a companhia de Ribossomildo, um experiente pesquisador, que lhes servir de guia. Ele dispe de material para ilustrar, quando necessrio, essa atividade de campo. Fiquem tranqilos: vocs esto preparados, e o passeio ser muito proveitoso, pois Ribossomildo s lhes dar informaes cientificamente corretas. Vamos l?!!! Como voc j devem ter percebido, grande a variabilidade de espcies, comportamentos, e adaptaes na Mata Atlntica.
92

Questo 416 Com base nos estudos de Gentica, correto afirmar que: (01) Uma planta de sementes brancas, autofecundada, ser heterozigota para o carter se entre os seus descendentes aparecerem alguns com sementes amarelas e outros com sementes brancas. (02) Uma mulher do grupo sangneo A cuja me do grupo O, casando-se com um homem doador-universal, ter filhos apenas do grupo sangneo O. (04) Indivduos heterozigotos para duas caractersticas produzem quatro tipos de gametas. (08) Na interao gnica, ou polimeria, os genes de um par agem combinando-se com outro par (ou outros pares), a fim de condicionar um determinado fentipo. (16) Sendo a hemofilia uma anomalia condicionada por um gene recessivo ligado ao sexo, uma criana hemoflica nascida de pais normais s poder ser do sexo feminino. Soma ( )

Essa variabilidade fenotpica est relacionada constituio gentica do indivduo e pode ser observada at dentro da mesma espcie. Segundo Ribossomildo, etapas da diviso celular como as representadas nas figuras abaixo justificam essa variabilidade.

1.5.8.1

1.5.2.1 ssinale a opo correspondente ao evento representado na figura. a) replicao do DNA b) transcrio de RNA transportador c) traduo de RNA mensageiro d) sntese das protenas arque a opo em que se relaciona adequadamente a figura ao evento biolgico. a) Na figura I, a segregao independente dos cromossomos contribui para o aumento da diversidade dos gametas. b) Na figura II, a formao de quiasma eleva a probabilidade de ocorrncia de mutao dos genes. c) Na figura I, a migrao das cromtides-irms para plos opostos eleva a recombinao gnica. d) Na figura II, a permutao entre cromossomos heterlogos aumenta a variabilidade gentica. Questo 419 Ribossomildo diz: Vejam quantos folhas novas, quantos filhotes de animais! O que deve estar ocorrendo no interior das clulas desses seres, que lhes permite crescer?! Para facilitar a resposta a essa pergunta, ele apresenta a figura abaixo, que ilustra um dos eventos imprescindveis ao processo de crescimento dos organismos. Questo 420 A histria da maioria dos municpios gachos coincide com a chegada dos primeiros portugueses, alemes, italianos e de outros povos. No entanto, atravs dos vestgios materiais encontrados nas pesquisas arqueolgicas, sabemos que outros povos, anteriores aos citados, protagonizaram a nossa histria. Diante da relevncia do contexto e da vontade de valorizar o nosso povo nativo, "o ndio", foi selecionada a rea temtica CULTURA e as questes foram construdas com base na obra "Os Primeiros Habitantes do Rio Grande do Sul" (Custdio, L. A. B., organizador. Santa Cruz do Sul: EDUNISC; IPHAN, 2004). "Da Amaznia vieram os tupis-guaranis, trazendo contribuies nossa cultura, ensinando a plantar diferentes espcies e a usar plantas frutferas e medicinais." Variedades de milho cultivadas pelos indgenas so usadas hoje em cruzamentos, com o objetivo de melhorar a produo de gros. Considere que a caracterstica baixa estatura dominante sobre a caracterstica porte elevado e que apenas um loco gnico est envolvido na determinao da estatura das plantas. O resultado para a F1 de um cruzamento de plantas com baixa estatura X plantas com estatura elevada ser _________________________, se os indivduos cruzados forem homozigotos para esse loco gnico. Assinale a alternativa que completa corretamente a lacuna.
93

a) 100% com estatura elevada b) 100% com estatura baixa c) 1/2 com estatura elevada e 1/2 com estatura baixa d) 1/4 com estatura elevada e) 3/4 com estatura elevada Questo 421 O texto abaixo refere-se s questes: ** a ** O tipo selvagem do fungo Neurospora capaz de crescer em um meio de cultura simples, constitudo de gua, sais minerais, acar e uma vitamina. O fungo utiliza esses elementos como precursores para a sntese de vrios compostos, tal como na via biossinttica representada na figura 1. Os compostos X, Y e Z correspondem citrulina, arginina e ornitina, no necessariamente nessa ordem. Um pesquisador obteve trs diferentes linhagens desse fungo, cada uma delas deficiente em uma das enzimas participantes dessa via biossinttica. O esquema na figura 2 apresenta os resultados obtidos quando essas diferentes linhagens foram colocadas para crescer em diferentes meios de cultura. O sinal + indica que houve crescimento do fungo, o sinal - indica que no houve crescimento. A linhagem D o tipo selvagem, no deficiente em qualquer uma das enzimas.

Questo 422

1.5.8.5

As linhagens A, B e C so deficientes, respectivamente, para as enzimas a) 1, 2 e 3. b) 1, 3 e 2. c) 2, 1 e 3. d) 2, 3 e 1. e) 3, 1 e 2. Questo 423 Quando as clulas do corpo humano se multiplicam, espera-se que aquelas produzidas com defeitos sejam destrudas pelo sistema imunolgico. No entanto, se algumas clulas mutantes se tornam invulnerveis elas podem se multiplicar, alcanando um nmero razovel de clulas e estabelecendo uma rede de vasos sangneos que passa a aliment-las. Aps essa fase vrias dessas clulas podem cair na corrente sangnea e invadir outros rgos, determinado assim uma acentuada queda na sobrevida do indivduo. Considere as seguintes afirmativas: I - O comportamento celular descrito na ltima frase do texto chamado metstase, o qual pode ser determinado pela perda da inibio por contato nas clulas. II - Agentes ambientais, tais como radiaes solares e agrotxicos, podem provocar alteraes genticas nas clulas, tornando-as invulnerveis ao do sistema imunolgico. III - A inativao dos oncogenes uma das condies essenciais para que as clulas citadas no texto se multipliquem desordenadamente. Assinale a opo que contm a(s) afirmativa(s)
94

1.5.8.5

As letras X, Y e Z correspondem, respectivamente, aos compostos a) ornitina, arginina e citrulina. b) ornitina, citrulina e arginina. c) citrulina, ornitina e arginina. d) citrulina, arginina e ornitina. e) arginina, citrulina e ornitina.

verdadeira(s). a) Apenas I e II. b) Apenas I e III. c) Apenas II e III. d) Apenas III. e) I, II, III. Questo 424 A sntese protica envolve um complexo de estruturas celulares que trabalham harmonicamente, como mostra o esquema adiante.

1.1.4

1.1.3.2

Segundo a tirinha, a amiga de Calvin tem DOIS CROMOSSOMOS X. Com base neste dado podemos concluir que: a) a amiga de Calvin mutante, por isso hostil. b) um cromossomo X da amiga de Calvin ativo e o outro chamado de cromatina sexual. c) a heterocromatina ocorre em Calvin, pois ele XY. d) os dois cromossomos X de que Calvin fala da cobra que quer com-lo. e) no h cromatina sexual em meninas. Questo 426

Com base no esquema e em conhecimentos correlatos, julgue os itens a seguir. (0) O esquema mostra a sntese protica em uma clula procaritica. (1) Os tipos de RNA necessrios para a sntese protica em procariotos e eucariotos so essencialmente diferentes. (2) Na expresso de um gene eucaritico, a transcrio e a traduo ocorrem simultaneamente. (3) Uma molcula de RNAm pode ser utilizada para a sntese concomitante de vrias molculas da protena. Questo 425 Leia com ateno a tirinha a seguir:

Qual das alternativas se refere a um cromossomo? a) Um conjunto de molculas de DNA com todas as informaes genticas da espcie. b) Uma nica molcula de DNA com informao gentica para algumas protenas. c) Um segmento de molcula de DNA com informao para uma cadeia polipeptdica. d) Uma nica molcula de RNA com informao para uma cadeia polipeptdica. e) Uma seqncia de trs bases nitrogenadas do RNA mensageiro correspondente a um aminocido na cadeia polipeptdica. Questo 427 Quando afirmamos que o metabolismo da clula controlado pelo ncleo celular, isso significa que a) todas as reaes metablicas so catalisadas por molculas e componentes nucleares. b) o ncleo produz molculas que, no citoplasma, promovem a sntese de enzimas catalisadoras das reaes metablicas. c) o ncleo produz e envia, para todas as partes da clula, molculas que catalisam as reaes metablicas.
95

d) dentro do ncleo, molculas sintetizam enzimas catalisadoras das reaes metablicas. e) o contedo do ncleo passa para o citoplasma e atua diretamente nas funes celulares, catalisando as reaes metablicas. Questo 428 Considere uma espcie de vertebrado cujas clulas embrionrias tm oito cromossomos. Em quantos grupos de ligaes seus genes estaro associados? a) Dois. b) Quatro. c) Oito. d) Dezesseis. e) Nmero varivel. Questo 429 A ilustrao representa o caritipo humano que permite determinar o nmero e a forma dos cromossomos.

Questo 431 Os cromossomos so constitudos principalmente por: a) fosfolipdeos. b) protenas. c) cido ribonuclico. d) enzimas. e) cido desoxirribonuclico. Questo 432 A cromatina sexual compreende: a) o citoplasma de clulas gamticas masculinas que se apresentam mais coradas que as femininas. b) o citoplasma de clulas gamticas femininas que se apresentam mais coradas que as masculinas. c) cromossomo Y condensado em ncleos de hemcias humanas. d) um dos cromossomos X da mulher, que permanece condensado no ncleo das clulas, facilmente visualizado na mucosa oral. e) cromossomos X e Y condensados durante o perodo da interfase. Questo 433 Responder questo com base no caritipo (conjunto de cromossomas) humano representado abaixo.

1.1.4

Analisando-se a figura, correto concluir que se refere a um indivduo portador da sndrome de a) Klinefelter. b) Patau. c) Turner. d) Down. Questo 430 A presena de cromatina sexual predominante em nmero de clulas femininas est relacionada a cromossomos: a) Y inativos b) X inativos c) autossmicos inativos d) autossmicos que no se dividiram e) autossmicos agregados

1.1.4

caritipo de um indivduo do sexo com sndrome de __________. a) feminino - Klinefelter b) masculino - Klinefelter c) masculino - Down d) feminino - Turner e) masculino - Turner

96

Questo 434 Numere a coluna inferior, relacionando-a com a superior. Indivduos: 1 - 45, X 2 - 46, XX 3 - 49, XXXXX 4 - 49, XXXXY 5 - 47, XXX Quantidade de cromatinas sexuais (corpsculos de Barr) ( ) quatro ( ) duas ( ) nenhuma ( ) uma ( ) trs Assinale a opo que apresenta a seqncia correta de numerao. a) 2, 4, 1, 3, 5 b) 3, 5, 1, 2, 4 c) 2, 3, 1, 4, 5 d) 3, 2, 1, 4, 5 e) 2, 1, 3, 4, 5 Questo 435

Analisando o desenho esquemtico que representa o ncleo de uma clula animal qualquer, podemos identificar que o componente responsvel pela sntese de RNA que forma o ribossomo assinalado pelo nmero: a) 1 b) 2 c) 3 d) 4 e) 5 Questo 436 Muitas vezes, durante a realizao de eventos esportivos, realizada a determinao do sexo gentico. Este exame feito pela observao dos cromossomos de clulas epiteliais. Pode-se afirmar que neste exame a) mulheres normais deveriam apresentar uma estrutura chamada corpsculo de Barr, que corresponde a um dos cromossomos X. b) homens normais deveriam apresentar uma estrutura chamada corpsculo de Barr, que corresponde ao cromossomo Y. c) mulheres normais deveriam apresentar duas estruturas chamadas corpsculos de Barr, que correspondem aos dois cromossomos X. d) homens normais deveriam apresentar uma estrutura chamada corpsculo de Barr, correspondente ao cromossomo X. e) mulheres normais na fase adulta no deveriam apresentar corpsculo de Barr. Questo 437

1.1.4

Analise o esquema a seguir, o qual mostra o mecanismo de ao de algumas drogas antimitticas que inibem a progresso a partir dos pontos indicados.

1.1.5.1

97

Assinale a afirmativa INCORRETA. a) A puromicina no tem qualquer efeito sobre o crescimento ou multiplicao celular. b) A mitomicina no permite a ocorrncia da fase 5 do ciclo celular. c) Pelo menos duas das drogas interferem diretamente na sntese protica. d) Nem todos os tipos de nucleotdeos sofrem ao da droga arabinosilcitosdeo. Questo 438 A figura a seguir representa _______________ , que ocorre na _______________ e tem como conseqncia _______________.

1.1.5.2

1.1.5.2

( ) O nmero de gametas AB dever ser idntico ao de gametas ab. ( ) A freqncia de gametas recombinantes dever ser igual a de gametas no-recombinantes. ( ) Trezentos e sessenta gametas no- recombinantes so esperados. ( ) Vinte gametas recombinantes so esperados no caso descrito. ( ) A taxa de recombinao no caso citado de 10%; logo, os locos A e B distam de 10 unidades de mapa. Questo 440 "Devo, finalmente, chamar a ateno para a possibilidade do pareamento dos cromossomos paternos e maternos, e sua subseqente separao durante a diviso reducional, constiturem as bases fsicas das leis de Mendel" (Walter S. Sutton, 1902). O que Sutton achava possvel sabe-se, hoje, ser verdade, isto : I. os genes esto localizados nos cromossomos. II. dois ou mais genes localizados no mesmo cromossomo so herdados, na maioria dos casos, em gametas diferentes. III. dois ou mais genes localizados em cromossomos diferentes segregam de maneira independente. Sobre as afirmativas acima, pode-se dizer que: a) somente III est correta. b) I e II esto corretas. c) II e III esto corretas. d) I e III esto corretas. e) somente II est correta.

A alternativa que preenche correta e respectivamente os espaos anteriores : a) o crossing-over; metfase da mitose; a variabilidade gentica. b) o pareamento de cromtides-irms; anfase I da meiose; a troca de genes alelos. c) o crossing-over; prfase I da meiose; a variabilidade gentica. d) a segregao de cromossomos homlogos; anfase I da meiose; a formao de clulas haplides. e) o pareamento de cromossomos homlogos; metfase da mitose; a formao de gametas. Questo 439 Analise as proposies abaixo, considerando a seguinte situao: Em uma amostra de 100 (cem) espermatognias, de um organismo genotipicamente (AB//ab), ocorreu permutao meitica entre os locos A e B, em 20 (vinte) espermatognias, tendo sido observada uma segregao gamtica como ilustrado na figura abaixo.

98

Questo 441

Questo 443 Quanto aos cromossomos sexuais X e Y, podemos afirmar que: a) como no so completamente homlogos, no se pareiam na meiose. b) como so completamente homlogos, pareiam-se na meiose. c) se pareiam na meiose, pois possuem uma regio homloga. d) no se pareiam na meiose, pois possuem uma regio no homloga. e) os genes que se encontram na regio no homloga do X condicionam um tipo de herana chamado herana restrita ao sexo. Questo 444 As variaes das cargas eltricas das molculas das protenas W, X, Y e Z, em funo do pH do meio, esto representadas no grfico a seguir.

1.1.5.2

AMABIS e MARTHO. "Fundamentos da Biologia Moderna". So Paulo: Moderna, 1997. p. 499. A figura representa a a) mitose e explica a separao dos cromossomos durante a diviso. b) meiose e explica a segregao independente dos genes previstos pela segunda lei de Mendel. c) mitose e explica a segregao dos genes demonstrando a dominncia e a recessividade. d) meiose, que um processo de formao de gametas mas que no tem nenhuma relao com as leis de Mendel. e) mitose, que um processo de diviso celular mas que no tem nenhuma relao com as leis de Mendel. Questo 442 Os gatos possuem 38 cromossomos, com o sistema XX/XY de determinao sexual. No desenvolvimento embrionrio de fmeas, um dos cromossomos X inativado aleatoriamente em todas as clulas do organismo. Em gatos domsticos, a pelagem de cor preta (dominante) e amarela (recessiva) so determinadas por alelos de um gene localizado no cromossomo X. Fmeas heterozigticas para cor da pelagem so manchadas de amarelo e preto. Um geneticista colocou um anncio oferecendo recompensa por gatos machos manchados de amarelo e preto. A constituio cromossmica desses gatos a) 37, YO. b) 37, XO. c) 38, XX. d) 39, XXY. e) 39, XXX.

1.1.7.3

molcula do DNA, em pH fisiolgico, apresenta carga eltrica negativa, devido a sua natureza cida. No ncleo celular, ela est associada a protenas, de carter bsico, denominadas histonas. De acordo com o grfico, a protena que apresenta propriedades compatveis com as de uma histona a representada pela seguinte letra: a) W b) X c) Y d) Z

99

Questo 445 Considere a rota metablica que produz o aminocido arginina na figura adiante.

grupamentos amina e hidroxila. Questo 447 O metabolismo celular depende de uma srie de reaes qumicas controladas por enzimas, isto , protenas que atuam como catalisadores e que podem sofrer mutaes genticas sendo modificadas ou eliminadas. Assinale a alternativa correta, levando em conta os cidos nuclicos, a ocorrncia de mutaes e as conseqentes mudanas do ciclo de vida da clula. a) O DNA constitudo por cdons, que determinam a seqncia de bases do RNA mensageiro, necessria formao dos anticdons, responsveis pela produo das protenas. b) No caso de uma mutao acarretar a transformao de um cdon em outro relacionado ao mesmo aminocido, no haver alterao na molcula protica formada, nem no metabolismo celular. c) A mutao altera a seqncia de aminocidos do DNA, acarretando alteraes na seqncia de bases do RNA mensageiro e, conseqentemente, na produo das protenas. d) As mutaes atuam diretamente sobre as protenas, provocando a desnaturao dessas molculas e, conseqentemente, a inativao delas. e) Quando algumas protenas so alteradas por mutaes, suas funes no metabolismo celular passam a ser realizadas pelos aminocidos. Questo 448 Organelas citoplasmticas que contm DNA: a) mitocndria e ribossomo. b) mitocndria e cloroplasto. c) nuclolo e cloroplasto. d) lisossomo e ribossomo. e) ribossomo e cromossomo. Questo 449 A hiptese de que os cloroplastos e as mitocndrias tenham surgido atravs de uma associao simbitica de um eucarioto primitivo com, respectivamente, bactrias fotossintetizantes e bactrias aerbicas, reforada pelo fato daquelas organelas celulares: a) serem estruturas equivalentes, com grande superfcie interna.
100

1.1.7.3

Em um experimento, trs linhagens de bactrias foram irradiadas com raios X, que causaram mutaes nos genes envolvidos na rota metablica acima representada. Para descobrir quais enzimas da rota metablica foram afetadas, as trs linhagens foram cultivadas em meios suplementados com ornitina, citrulina e arginina, obtendo-se o resultado mostrado na tabela acima: Sobre esse experimento, podemos afirmar que a) o gene que codifica a enzima 1 na linhagem I foi afetado. b) o gene que codifica a enzima 2 na linhagem I foi afetado. c) o gene que codifica a enzima 3 na linhagem II foi afetado. d) o gene que codifica a enzima 1 na linhagem II foi afetado. e) o gene que codifica a enzima 3 na linhagem III foi afetado. Questo 446 Alm de serem as macromolculas mais abundantes nas clulas vivas, as protenas desempenham diversas funes estruturais e fisiolgicas no metabolismo celular. Com relao a essas substncias CORRETO afirmar que: a) so todas constitudas por seqncias monomricas de aminocidos e monossacardeos. b) alm de funo estrutural, so tambm as mais importantes molculas de reserva energtica e de defesa. c) cada indivduo produz as suas protenas, que so codificadas de acordo com o seu material gentico. d) a sua estrutura terciria determinada pela forma, mas no interfere na sua funo ou especificidade. e) so formadas pela unio de nucleotdeos por meio dos

b) apresentarem DNA prprio. c) estarem envolvidas, respectivamente, na produo e consumo de oxignio. d) apresentarem tilacides e cristas como as bactrias. e) serem encontradas tanto em organismos superiores como inferiores. Questo 450 "Captura aminocidos que se encontram dissolvidos no citoplasma e carrega-os ao local da sntese de protenas". Essa funo desempenhada pelo a) RNA mensageiro. b) RNA transportador. c) RNA ribossmico. d) ribossomo. e) DNA. Questo 451 Clulas vegetais, depois de mantidas em meio de cultura contendo uracila marcada, foram fixadas e submetidas autoradiografia, para comprovar os locais que possuam esse material. correto prever que, no citoplasma, encontre-se uracila radioativa SOMENTE nos a) nuclolos. b) ribossomos. c) nuclolos e nas mitocndrias. d) ribossomos e nos cloroplastos. e) ribossomos, nos cloroplastos e nas mitocndrias. Questo 452

A clula muscular cardaca e a esqueltica tm a mesma origem porm so diferentes, tanto do ponto de vista estrutural como funcional. Ao longo do processo de diferenciao das clulas do mesmo organismo ocorre a) duplicao de alguns genes. b) perda dos genes no expressos. c) expresso diferencial dos genes. d) induo de mutaes especficas. e) recombinao entre genes ativados. Questo 453 A seqncia de nucleotdeos ATGCACCT forma um segmento de DNA dupla hlice ao se ligar fita complementar a) AUGCACCU. b) UACGUGGA. c) TACGTGGA. d) TCCACGTA. e) ATGCACCT. Questo 454 Uma bactria, um fungo e uma samambaia apresentam em comum a) produo de glicose atravs da utilizao de energia solar. b) presena de carioteca envolvendo os componentes do ncleo celular. c) utilizao de oxignio no interior de mitocndrias. d) presena de DNA como material gentico. e) produo de ATP no interior de plastos. Questo 455 O gato domstico ('Felis domestica') apresenta 38 cromossomos em suas clulas somticas. No ncleo do vulo normal de uma gata so esperados: a) 19 cromossomos simples e 19 molculas de DNA. b) 19 cromossomos duplicados e 38 molculas de DNA. c) 38 cromossomos simples e 38 molculas de DNA. d) 38 cromossomos simples e 19 molculas de DNA. e) 19 cromossomos duplicados e 19 molculas de DNA. Questo 456 como se em cada quarto de um imenso prdio existisse uma estante contendo os planos do arquiteto para todo o prdio. (...) No homem, os planos do arquiteto montam 46
101

1.1.7.6

volumes. Nessa analogia, proposta por Richard Dawkins no livro "O gene egosta", cada pgina de cada volume contm um texto formado por uma seqncia de: a) fentipos b) aminocidos c) cromossomos d) bases nitrogenadas Questo 457 Analise as afirmativas a seguir, acerca dos elementos constituintes do ncleo celular eucaritico. I. Cada cromossomo possui uma nica molcula de DNA. II. Histonas so protenas relativamente pequenas que se ligam fortemente ao RNA. III. Os nuclolos podem atuar na sntese de carboidratos que migram do ncleo para o citoplasma. Pode-se afirmar, de modo correto, que: a) somente I verdadeira. b) somente II verdadeira. c) somente I e II so verdadeiras. d) somente I e III so verdadeiras. e) somente II e III so verdadeiras. Questo 458 A molcula de RNAm sintetizada no ncleo, transcrevendo a seqncia de bases de uma cadeia de DNA. O RNAm no citoplasma, se liga ao ribossomo, onde se d a produo de cadeias peptdicas. Considerando esse tema, analise a figura e as proposies a seguir.

( ) O aminocido metionina (I) trazido ao ribossomo pelo RNAt cujo anticdon UAC (II), complementar ao cdon AUG do RNAm. ( ) Na etapa seguinte da traduo, um segundo RNAt (III), cujo anticdon complementar ao segundo cdon do RNAm geralmente onde h uma trinca UAA, UAG ou UGA, encaixa-se no stio destinado entrada de aminocidos na cadeia peptdica. ( ) Quando se estabelece uma ligao peptdica entre os dois primeiros aminocidos, o RNAt do primeiro aminocido liberado (IV) no citoplasma. ( ) O final da traduo ocorre quando, na leitura da mensagem gentica, se chega a um cdon de parada (V), a saber, UUG, UUA ou GUA, para os quais no h aminocido correspondente. ( ) 61 cdons correspondem aos aminocidos que compem as protenas. Sabendo-se que os cdons 5 e 6 trazem a informao para um mesmo aminocido, para o qual existe apenas uma trinca de codificao, podemos afirmar que os cdons 5 e 6 codificam, ou para a metionina ou para o triptofano. Questo 459 Cinco amostras com cidos nuclicos foram analisadas quimicamente e apresentaram os seguintes resultados: I - 1 amostra: ribose II - 2 amostra: timina III - 3 amostra: dupla hlice IV- 4 amostra: uracila V - 5 amostra: 20% de guanina e 30% de citosina Entre estas amostras, quais se referem a DNA? a) Apenas I e II. b) Apenas I e III. c) Apenas II e III. d) Apenas II e IV. e) Apenas II e V. Questo 460 Neste ano de 2003, so comemorados os 50 anos da "descoberta" da estrutura tridimensional do DNA. Com relao s caractersticas dessa molcula, ao papel que ela desempenha nos seres vivos e aos processos em que se encontra envolvida CORRETO afirmar que:
102

1.1.7.6

(01) formada por duas fileiras de nucleotdeos torcidas juntas em forma de hlice. (02) Em sua composio possvel encontrar quatro bases nitrogenadas diferentes: a adenina, a citosina, o aminocido e a protena. (04) Ela tem a capacidade de se autoduplicar. (08) Nela est contida a informao gentica necessria para a formao de um organismo. (16) A mensagem nela contida pode ser transcrita para uma outra molcula denominada RNA. (32) Nos organismos procariontes, ela fica estocada dentro do ncleo das clulas. (64) Em alguns organismos primitivos, ela apresenta apenas uma fileira de nucleotdeos. Questo 461 Analise as afirmativas: I. As protenas e os cidos nuclicos so formados por aminocidos. II. DNA e RNA so os cidos nuclicos encontrados tanto em clulas eucariontes como procariontes. III. A informao contida no DNA pode ser copiada em uma fita de RNA, atravs do processo denominado transcrio. IV. A informao presente no RNA pode ser transformada em uma seqncia de aminocidos, atravs do processo denominado traduo. Est(o) correta(s) a) apenas I. b) apenas I e II. c) apenas II e III. d) apenas I, III e IV. e) apenas II, III e IV. Questo 462 Este ano comemorou-se 50 anos da publicao do trabalho de Francis Crick e James Watson, que estabeleceu o modelo da estrutura da molcula de cido desoxirribonuclico (DNA). Dentre as afirmativas abaixo, assinale a alternativa CORRETA: a) Uma cadeia simples de DNA constituda de

nucleotdeos, compostos por uma desoxirribose ligada a um fosfato e a um aminocido. b) A polimerizao de uma fita simples de DNA dita semiconservativa, pois independe da existncia de uma fita molde. c) Os nucleotdeos so polimerizados por meio de ligaes fosfodister entre o fosfato e a base nitrogenada. d) Duas cadeias simples de DNA formam uma dupla-hlice, por meio da formao de pontes de hidrognio entre as bases nitrogenadas. e) As duas cadeias de uma dupla-hlice possuem a mesma orientao, e suas seqncias de bases so complementares. Questo 463 Erros podem ocorrer, embora em baixa freqncia, durante os processos de replicao, transcrio e traduo do DNA. Entretanto, as conseqncias desses erros podem ser mais graves, por serem herdveis, quando ocorrem a) na transcrio, apenas. b) na replicao, apenas. c) na replicao e na transcrio, apenas. d) na transcrio e na traduo, apenas. e) em qualquer um dos trs processos. Questo 464 Em abril de 2003, a finalizao do Projeto Genoma Humano foi noticiada por vrios meios de comunicao como sendo a "decifrao do cdigo gentico humano". A informao, da maneira como foi veiculada, est a) correta, porque agora se sabe toda a seqncia de nucleotdeos dos cromossomos humanos. b) correta, porque agora se sabe toda a seqncia de genes dos cromossomos humanos. c) errada, porque o cdigo gentico diz respeito correspondncia entre os cdons do DNA e os aminocidos nas protenas. d) errada, porque o Projeto decifrou os genes dos cromossomos humanos, no as protenas que eles codificam. e) errada, porque no possvel decifrar todo o cdigo gentico, existem regies cromossmicas com alta taxa de mutao.

103

Questo 465 Ao se injetar o ncleo de uma clula diferenciada de uma r em um ovo de outra r, no fertilizado e cujo ncleo tenha sido removido, ocorrer: a) a morte da clula-ovo, uma vez que o ncleo injetado proveniente da clula diferenciada contm DNA cuja composio de bases nitrogenadas diferente da clula-ovo; b) a morte da clula-ovo, uma vez que o ncleo injetado no contm determinados genes, removidos durante a diferenciao; c) a formao de um clone de clulas no diferenciadas, uma vez que o ncleo injetado no possui alguns genes, removidos durante a diferenciao; d) a formao de um girino normal a partir do ovo, uma vez que o ncleo injetado contm toda a informao (DNA) necessria formao do girino; e) a expulso do ncleo injetado por meio de exocitose realizada pela clula-ovo. Questo 466 CHIMPANZ TAMBM "GENTE", DIZ ESTUDO. Alguns cientistas dos EUA afirmam que os chimpanzs (Pan troglodites) so geneticamente to parecidos com os homens que deveriam ser includos no gnero Homo, que at o momento tem o Homo sapiens como nico representante vivo. A idia surgiu pela primeira vez em 1998 quando a anlise de seqncias de DNA de humanos e de chimpanzs revelou 98,4% de identidade. Mais recentemente, a comparao da seqncia de DNA de 97 genes comuns de humanos e de chimpanzs revelou 99,4% de identidade entre os genes humanos e de chimpanzs. A diferena nos percentuais de identidade dos dois estudos se deve ao fato de que em 1998 foi estudado o DNA no-codificante, que no faz parte das seqncias que podem ser transcritas e traduzidas. Na realidade, biologicamente no somos to diferentes dos chimpanzs como muitos crem. Estudar estes 0,6% de diferenas pode contribuir para entendermos como, nos 6 milhes de anos que separam a evoluo do homem e do chimpanz de um ancestral comum, apenas um deles desenvolve a capacidade de compor msica, de construir prdios e de fazer pesquisa cientfica. (Fonte: "Folha de S.Paulo", em 21/05/2003.)

Tendo em vista o texto apresentado, assinale a afirmativa CORRETA. a) As espcies Homo sapiens e Pan troglodites surgiram h 6 milhes de anos. b) 99,4% dos genes apresentam a mesma seqncia de DNA. c) Seqncias de DNA que podem ser expressas como protenas apresentaram maiores semelhanas que as seqncias no codificadoras. d) Os 97 genes comuns so os responsveis pela diferenas entres seres humanos e chimpanzs. Questo 467 Descobertas recentes na medicina e na sade pblica, se aplicadas consistentemente, tero algum impacto no curso da evoluo humana. Qualquer resistncia s doenas infecciosas (de carter hereditrio), como o sarampo e a difteria, conferiria vantagem seletiva a uma famlia. Assinale a alternativa que mostra, corretamente, os efeitos da imunizao em massa sobre a freqncia da resistncia ou susceptibilidade inata s doenas. a) A freqncia dos alelos que conferem resistncia inata s doenas seria aumentada. b) Os gentipos que produzem pouca ou nenhuma resistncia se tornariam comuns. c) A longo prazo, mais pessoas se tornariam independentes de procedimentos mdicos. d) A longo prazo, haveria adaptao gentica a resistncia a muitas doenas. e) No haveria alterao alguma na freqncia desses alelos. Questo 468 O grfico mostra a variao dos nmeros de indivduos do tipo original e do tipo mutante, ao longo de 100 anos, em uma mesma rea de floresta.

104

Questo 470 A seguir esto representadas trs seqncias de aminocidos de protenas retiradas de diferentes espcies (A, B e C). espcie A: MET - ARG - LEU - LEU - VAL - GLU - HIS - ARG ALA - ARG - LEU - PHE - PRO - LEU espcie B: MET - ARG - LEU - ARG - VAL - GLU - HIS - ALA ARG - ARG - ALA - PHE - PRO - LEU espcie C: MET - ARG - LEU - ARG - VAL - GLU - HIS - ALA ALA - ARG - ALA- PHE - PRO - LEU Admitindo-se um ancestral comum para as trs espcies, a rvore filogentica que melhor expressa o parentesco evolutivo entre as trs :

1.4.1.7

anlise do grfico permite concluir que: a) o tipo original permanece melhor adaptado ao longo do perodo analisado. b) o tipo original e o tipo mutante esto igualmente adaptados mesma rea de floresta. c) a mudana de ambiente provocou alterao nas freqncias gnicas. d) a partir de 50 anos, o tipo mutante passou a parasitar o tipo original. e) aps 50 anos, deixa de existir o efeito de dominncia do alelo para o tipo original sobre aquele para o tipo mutante. Questo 469 Um determinado tipo de protena, presente em praticamente todos os animais, ocorre em trs formas diferentes: a forma P, a forma PX, resultante de mutao no gene que codifica P, e a forma PY, resultante de mutao no gene que codifica PX. A ocorrncia dessas mutaes pde ser localizada nos pontos indicados pelos retngulos escuros na rvore filogentica, com base na forma da protena presente nos grupos de animais I, II, III, IV e V. Indique a alternativa que mostra as protenas encontradas nos grupos de animais I a V.

1.4.1.10

Questo 471 Moscas de asas longas cruzadas entre si fornecem moscas com asas vestigiais. Para determinarmos se uma mosca de asa longa homozigota ou heterozigota quanto ao par de genes que condicionam este carter, o procedimento correto analisar a prole resultante do cruzamento desta mosca com outra de: a) asa vestigial. b) de asa longa. c) gentipo igual ao seu. d) fentipo igual ao seu. e) fentipo dominante.

1.4.1.10

105

Questo 472

1.5.1.1 1.5.1.1

esquema anterior mostra uma experincia com um coelho himalaia. A mudana ocorrida na colorao do plo em funo da queda de temperatura demonstra o efeito da: a) norma de reao. b) mutao gnica. c) expressividade de um gene. d) penetrncia de um gene. e) alterao do gentipo pelo ambiente. Questo 473 Na espcie humana, o albinismo causado por um gene autossmico recessivo. A probabilidade do primeiro filho de um homem albino casado com uma mulher normal, mas heterozigota, ser albino e do sexo masculino : a) nula b) 25 % c) 50 % d) 75 % e) 100 % Questo 474 A incidncia de determinada anomalia foi investigada nos indivduos da espcie humana representados no heredograma a seguir:

Sabendo-se que os smbolos escuros representam portadores da anomalia, possvel afirmar que se trata a) exclusivamente de um caso de herana ligada ao sexo, sendo a anomalia causada por um gene recessivo e de 75% a probabilidade de o casal n. 2 ter um descendente do sexo masculino com a anomalia. b) exclusivamente de um caso de herana autossmica, sendo a anomalia causada por um gene dominante e de 75% a probabilidade de o casal n. 2 ter um descendente com a anomalia. c) de um caso que pode ser tanto de herana ligada ao sexo como de herana autossmica, sendo a anomalia determinada por um gene recessivo e de 50% a probabilidade de o casal n. 2 ter um descendente com a anomalia. d) de um caso que pode ser tanto de herana ligada ao sexo como de herana autossmica, sendo a anomalia determinada por um gene recessivo e impossvel o casal n. 3 ter um descendente com a anomalia. e) de um caso de herana ligada ao cromossomo Y e de 50% a probabilidade de o casal n. 3 ter um descendente com a anomalia. Questo 475 Sabendo-se que o albinismo um carter recessivo, determine a porcentagem de descendentes com o fentipo igual ao do pai, resultantes do casamento de um homem heterozigoto para esse fator, com uma mulher de igual gentipo. a) 0% b) 25% c) 50% d) 75% e) 100%

106

Questo 476 Num homem heterozigoto para determinado carter, a porcentagem provvel de espermatozides que contero o gene recessivo desse carter de: a) 0% b) 25% c) 50% d) 75% e) 100% Questo 477 Algumas variedades de canrios mudam de cor dependendo da alimentao que recebem. Esta mudana indica que o: a) fentipo depende do ambiente. b) gentipo depende do ambiente. c) fentipo depende do gentipo e do meio ambiente. d) gentipo depende do fentipo e do meio ambiente. e) gentipo depende dos genes. Questo 478 Sabe-se que o casamento consangneo, ou seja, entre indivduos que so parentes prximos, resulta numa maior freqncia de indivduos com anomalias genticas. Isso pode ser justificado pelo fato de os filhos apresentarem: a) maior probabilidade de heterozigoses recessivas b) maior probabilidade de homozigozes recessivas c) menor probabilidade de heterozigoses dominantes d) menor probabilidade de homozigoses dominantes e) menor probabilidade de homozigoses recessivas Questo 479 Na gentica, uma expresso bastante conhecida diz que fentipo o gentipo mais o ambiente. Essa expresso significa que a) o ambiente altera o gentipo do indivduo, visando sua adaptao. b) o gentipo do indivduo o resultado da ao do ambiente sobre seu fentipo. c) o fentipo do indivduo o resultado da expresso de seu gentipo em um dado ambiente. d) o gentipo do indivduo pode variar como resultado da expresso de seu fentipo em diferentes ambientes. e) o fentipo do indivduo invarivel e resulta da expresso de seu gentipo, em qualquer que seja o

ambiente. Questo 480 Pedro e seus filhos, Joo e Maria, tm uma doena determinada por um gene dominante. No h outros afetados na famlia. Esse gene: a) est no cromossomo X. b) est no cromossomo Y. c) est num autossomo. d) pode estar no cromossomo X ou no Y. e) pode estar num cromossomo ou num autossomo. Questo 481 Um gato preto (A) foi cruzado com duas gatas (B e C) tambm pretas. O cruzamento do gato A com a gata B produziu 8 filhotes, todos pretos; o cruzamento do gato A com a gata C produziu 6 filhotes pretos e 2 amarelos. A anlise desses resultados permite concluir que: a) a cor preta dominante, A e C so homozigotos. b) a cor preta dominante, A e B so homozigotos. c) a cor preta dominante, A e C so heterozigotos. d) a cor preta recessiva, A e C so homozigotos. e) a cor preta recessiva, B e C so heterozigotos. Questo 482 Dois genes alelos atuam na determinao da cor das sementes de uma planta: (A), dominante, determina a cor prpura e (a), recessivo, determina a cor amarela. A tabela a seguir apresenta resultados de vrios cruzamentos feitos com diversas linhagens dessa planta:

1.5.1.1

107

presentam gentipo (Aa) as linhagens: a) I e III b) II e III c) II e IV d) I e IV e) III e IV I Questo 483 Considere os seguintes cruzamentos para ervilha, sabendo que V representa o gene que determina cor amarela dos cotildones e dominante sobre o alelo v, que determina cor verde. I. VVx vv II. Vv x Vv III. Vv x vv Um p de ervilha, heterozigoto e que, portanto, produz vagens com sementes amarelas e com sementes verdes, pode resultar a) apenas do cruzamento I. b) apenas do cruzamento II. c) apenas do cruzamento III. d) apenas dos cruzamentos II e III. e) dos cruzamentos I, II e III. Questo 484 Dois grupos de mudas obtidas a partir de um mesmo clone de plantas verdes foram colocados em ambientes diferentes: um claro e outro escuro. Depois de alguns dias, as plantas que ficaram no escuro estavam estioladas o que significa que os dois grupos apresentam: a) o mesmo gentipo e fentipos diferentes. b) o mesmo fentipo e gentipos diferentes. c) gentipos e fentipos iguais. d) gentipos e fentipos diferentes. e) gentipos variados em cada grupo. Questo 485 Considere uma ovognia de uma mulher heterozigota para o par de alelos Dd. Entre os possveis gametas formados por essa ovognia, podemos encontrar: a) quatro vulos Dd. b) quatro vulos D e quatro vulos d. c) dois vulos D e dois vulos d.

d) apenas um vulo Dd. e) apenas um vulo D ou um vulo d. Questo 486 Qual a porcentagem de descendentes Aa nascidos de uma me Aa? a) 25% b) 50% c) 75% d) 100% e) depende do pai. Questo 487 De uma populao de 100 camundongos foi retirado ao acaso um indivduo com deficincia da enzima E, carter condicionado por um alelo recessivo a. correto afirmar que a) seus pais podem ser fenotipicamente normais. b) seus pais so certamente heterozigotos. c) a freqncia do alelo a 0,1. d) a freqncia do alelo a 0,2. e) 1% dos indivduos da populao tm deficincia da enzima E. Questo 488 Uma mulher normal, casada com um portador de doena gentica de herana autossmica dominante, est grvida de um par de gmeos. Qual a probabilidade de que pelo menos um dos gmeos venha a ser afetado pela doena no caso de serem, respectivamente, gmeos monozigticos ou dizigticos? a) 25% e 50% b) 25% e 75% c) 50% e 25% d) 50% e 50% e) 50% e 75% Questo 489 Em uma populao de mariposas, 96% dos indivduos tm cor clara e 4%, cor escura. Indivduos escuros cruzados entre si produzem, na maioria das vezes, descendentes claros e escuros. J os cruzamentos entre indivduos claros produzem sempre apenas descendentes de cor clara. Esses resultados sugerem que a cor dessas mariposas
108

condicionada por a) um par de alelos, sendo o alelo para cor clara dominante sobre o que condiciona cor escura. b) um par de alelos, sendo o alelo para cor escura dominante sobre o que condiciona cor clara. c) um par de alelos, que no apresentam dominncia um sobre o outro. d) dois genes ligados com alta taxa de recombinao entre si. e) fatores ambientais, como a colorao dos troncos onde elas pousam. Questo 490 Uma populao experimental contm 200 indivduos AA, 200 aa e 200 Aa. Todos os indivduos AA foram cruzados com indivduos aa e os indivduos Aa foram cruzados entre si. Considerando que cada casal produziu 2 descendentes, espera-se encontrar entre os filhotes: a) AA - 50; Aa - 500; aa - 50 b) AA - 100; Aa - 400; aa - 100 c) AA - 100; Aa - 1000; aa - 100 d) AA - 200; Aa - 200; aa - 200 e) AA - 200; Aa - 800; aa - 100 Questo 491 Em seu trabalho com ervilhas, publicado em 1866, Mendel representou os fatores hereditrios determinantes dos estados amarelo e verde do carter cor da semente pelas letras A e a, respectivamente. O conhecimento atual a respeito da natureza do material hereditrio permite dizer que a letra A usada por Mendel simboliza a) um segmento de DNA com informao para uma cadeia polipeptdica. b) um segmento de DNA com informao para um RNA ribossmico. c) um aminocido em uma protena. d) uma trinca de bases do RNA mensageiro. e) uma trinca de bases do RNA transportador. Questo 492 Em plantas de ervilha ocorre, normalmente, autofecundao. Para estudar os mecanismos de herana, Mendel fez fecundaes cruzadas, removendo as anteras da flor de uma planta homozigtica de alta estatura e

colocando, sobre seu estigma, plen recolhido da flor de uma planta homozigtica de baixa estatura. Com esse procedimento, o pesquisador a) impediu o amadurecimento dos gametas femininos. b) trouxe gametas femininos com alelos para baixa estatura. c) trouxe gametas masculinos com alelos para baixa estatura. d) promoveu o encontro de gametas com os mesmos alelos para estatura. e) impediu o encontro de gametas com alelos diferentes para estatura. Questo 493 Dizemos que um determinado gene recessivo quando sua expresso (fentipo): a) s acontece em heterozigose. b) s ocorre quando em dose dupla. c) independe da presena de seu alelo. d) depende de caractersticas congnitas. e) reproduz uma caracterstica provocada pelo ambiente. Questo 494 Moscas de colorao acinzentada cruzadas entre si fornecem moscas de cor preta. Para determinarmos se uma mosca cinza homozigota ou heterozigota quanto ao par de genes que condicionam esse carter, o procedimento correto analisar a prole resultante do cruzamento dessa mosca com outra de a) cor preta. b) cor cinza. c) gentipo igual ao seu. d) fentipo igual ao seu. e) fentipo dominante. Questo 495 "Cada carter condicionado por um par de fatores que se separam na formao dos gametas". Mendel ao enunciar essa lei j admitia, embora sem conhecer, a existncia das seguintes estruturas e processo de diviso celular, respectivamente: a) cromossomos, mitose. b) ncleos, meiose. c) ncleos, mitose. d) genes, mitose. e) genes, meiose.
109

Questo 496 Em tomates, o estame pode ser de cor prpura ou verde. Cruzando-se plantas de estames de cor prpura com plantas de estames verdes, obteve-se uma gerao F composta apenas de indivduos com estames de cor prpura. Se esses indivduos forem retrocruzados com os parentais de estames verdes, ento a porcentagem de descendentes com estames verdes ser de: a) 25% b) 50% c) 75% d) 0 e) 100% Questo 497 Em porquinhos da ndia, o plo pode ser preto ou marrom. Uma fmea preta foi cruzada com um macho marrom, produzindo uma F composta por indivduos marrons e pretos em igual quantidade. Retrocruzando-se um macho preto de F com a fmea parental, 75% dos filhotes produzidos em F tinham plo preto e 25% apresentavam plo marrom. A partir desses resultados, assinale a alternativa correta. a) 50% dos indivduos pretos de F eram heterozigotos. b) Os indivduos pretos de F eram homozigotos. c) Todos os indivduos pretos de F eram heterozigotos. d) Todos os indivduos marrons eram homozigotos. e) Os indivduos pretos da gerao F eram heterozigotos e a fmea parental era homozigota. Questo 498 Em uma determinada planta, o padro das nervuras foliares pode ser regular ou irregular. Do cruzamento entre duas plantas com nervuras irregulares, originou-se uma F1 composta por plantas com nervuras regulares e outras com nervuras irregulares. A partir desses dados, assinale a alternativa INCORRETA. a) As plantas cruzadas so heterozigotas. b) A proporo fenotpica em F1 de 3/4 de indivduos irregulares e de 1/4 de indivduos regulares. c) Todos os F1 com nervuras irregulares so heterozigotos. d) Se um indivduo F1 com nervuras regulares for cruzado com um indivduo da gerao P, surgiro indivduos regulares e irregulares na proporo 1:1.

e) Os indivduos F1 de nervuras regulares s podem ser homozigotos. Questo 499 Do cruzamento de duas moscas com asas nasceram 120 descendentes com asas e 40 sem asas. Se os 120 descendentes com asas forem cruzados com moscas sem asas e se cada cruzamento originar 100 indivduos, o nmero esperado de indivduos com asas e sem asas ser, respectivamente, a) 6.000 e 3.000 b) 6.000 e 6.000 c) 8.000 e 4.000 d) 9.000 e 3.000 e) 12.000 e 4.000 Questo 500 Em gentica, em alguns casos, um nico par de alelos determina mais de uma caracterstica no organismo. Isso ocorre, por exemplo, com ervilhas, em que um nico par de alelos responsvel por trs caractersticas fenotpicas: cor das flores, cor das sementes, presena ou ausncia de manchas nas axilas foliares. Esse fenmeno conhecido como: a) herana aditiva b) poligenia c) pleiotropia d) codominncia Questo 501 Analise o heredograma para um fentipo recessivo esquematizado a seguir e assinale a afirmativa INCORRETA.

1.5.1.1

110

a) As pessoas afetadas possuem pelo menos um dos pais obrigatoriamente afetado. b) Aproximadamente 1/4 das crianas de pais no-afetados pode ser afetado. c) O fentipo ocorre igualmente em ambos os sexos. d) Se um dos pais heterozigoto, o alelo recessivo pode ser herdado por descendentes fenotipicamente normais. Questo 502 Os bulbos da cebola podem ser brancos, amarelos ou roxos. Nesses vegetais, existe um precursor incolor que, sob a ao de uma enzima, que chamaremos de E1, se transforma em um pigmento amarelo, que a enzima E2 transforma em roxo. As duas enzimas so codificadas por genes alelos dominantes com segregao independente, de acordo com o esquema a seguir.

fenotpica mendeliana 3:1 aparecer na gerao F2, pois os gentipos sero: a) 1/2 AA e 1/2 aa b) 1/4 AA, 1/2 Aa e 1/4 aa c) 1/3 AA e 1/4 aa d) 1/4 Aa, 1/2 AA e 1/4 aa e) impossvel determinar os gentipos utilizando os dados acima. Questo 504 "Casais de pigmentao da pele normal, que apresentam gentipo __(I)__ podem ter filhos albinos. O gene para o albinismo __(II)__ e no se manifesta nos indivduos __(III)__. So albinos apenas os indivduos de gentipo __(IV)__." No trecho acima, as lacunas I, II, III e IV devem ser preenchidas correta e, respectivamente, por: a) AA, dominante, homozigoto e aa. b) AA, recessivo, homozigoto e Aa. c) Aa, dominante, heterozigotos e aa. d) Aa, recessivo, heterozigotos e aa. e) aa, dominante, heterozigotos e AA. Questo 505

1.5.1.1

Analisando as informaes apresentadas de acordo com os seus conhecimentos, INCORRETO afirmar que o cruzamento de plantas de bulbo: a) incolor com planta de bulbo incolor s pode originar fentipo incolor. b) amarelo com planta de bulbo amarelo no produz plantas com bulbo roxo. c) roxo com planta de bulbo roxo pode produzir todos os trs fentipos mencionados. d) amarelo com planta de bulbo incolor no produz plantas com bulbo roxo. Questo 503 Quando duas populaes da espcie vegetal 'Zea mays' (milho), uma homozigota para o alelo dominante (AA) e uma homozigota para um alelo recessivo (aa), so cruzadas, toda a descendncia da primeira gerao (F1) assemelha-se ao tipo parental dominante (Aa), embora seja heterozigota. Porm, quando a gerao F1 se intercruza, a proporo

Em uma certa espcie de mamferos, h um carter mendeliano com co-dominncia e gentipos EE, EC e CC. Sabe-se que animais heterozigticos so mais resistentes a um dado vrus X do que os homozigticos. Animais com os trs gentipos foram introduzidos em duas regies diferentes designadas por I e II, onde h predadores naturais da espcie. Nos dois ambientes, os animais de gentipo CC so mais facilmente capturados pelos predadores. Em I no h registro da presena do vrus X e em II ele transmitido por contato com as presas da espcie. Pode-se prever que a) haver igual chance de adaptao de animais com os trs gentipos nas duas regies. b) haver igual chance de adaptao de animais com os trs gentipos apenas na regio I. c) haver maior nmero de animais com gentipos EE e CC do que com gentipo EC na regio I.
111

d) a seleo natural ser mais favorvel aos animais com gentipo EC na regio II. e) a seleo natural ser mais favorvel aos animais com gentipo EE na regio II. Questo 506 No homem, a acondroplasia uma anomalia determinada por um gene autossmico dominante. Qual a probabilidade de um casal de acondroplsicos, que j tem uma menina normal, vir a ter um menino acondroplsico? a) 1 b) 3/4 c) 3/8 d) 1/4 e) 1/8 Questo 507 Considere que o comprimento da cauda, numa dada espcie, seja condicionado por um par de alelos. Animais com cauda longa foram cruzados repetidas vezes entre si originando sempre descendentes com cauda longa. Os descendentes, quando cruzados entre si, tambm s originaram filhotes de cauda longa. A partir desses dados, s possvel concluir que a) o carter recessivo. b) o carter dominante. c) os animais cruzados eram homozigotos. d) os animais cruzados eram heterozigotos. e) o gentipo dos descendentes difere do dos pais. Questo 508 Em cobaias, a cor preta do plo condicionada por um alelo dominante e a cor branca, pelo alelo recessivo. Um cruzamento-teste de um indivduo de cor preta produziu descendentes brancos e pretos em igual nmero. Se esses descendentes pretos forem cruzados entre si, a proporo fenotpica esperada na prole ser de a) 3 pretos :1 branco b) 2 pretos :1 branco c) 1 preto : 3 brancos d) 1 preto : 2 brancos e) 1 preto :1 branco

Questo 509 Sabe-se que a transmisso hereditria da cor das flores conhecidas como copo-de-leite se d por herana mendeliana simples, com dominncia completa. Em um cruzamento experimental de copos-de-leite vermelhos, obteve-se uma primeira gerao - F - bastante numerosa, numa proporo de 3 descendentes vermelhos para cada branco (3:1). Analisando o gentipo da F, os cientistas constataram que apenas um em cada trs descendentes vermelhos era homozigoto para essa caracterstica. De acordo com tais dados, pode-se afirmar que a produo genotpica da F desse cruzamento experimental foi: a) 4 Aa b) 2 Aa : 2 aa c) 3 AA : 1 Aa d) 1 AA : 2 Aa : 1 aa Questo 510 Numere a segunda coluna de acordo com a primeira, associando os conceitos aos respectivos termos. I - Genoma II - Crossing-over III - Fentipo IV - Alelo V - Gene ( ) troca de fragmentos de cromossomos homlogos na primeira diviso da meiose. ( ) conjunto de genes organizados nos cromossomos. ( ) segmento do DNA capaz de transcrever uma molcula de RNA. ( ) atuam sobre a mesma caracterstica, mas no so obrigatoriamente iguais. ( ) conjunto de caractersticas detectveis de um indivduo. A seqncia correta : a) II, I, V, IV e III b) III, II, I, V e IV c) II, I, III, V e IV d) IV, II, I, III e V e) I, II, V, IV e III

112

Questo 511 Considere as seguintes proposies: 1 - Em nenhuma hiptese a calvcie ocorre na mulher, por se tratar de herana ligada ao sexo. 2 - Um homem calvo (homozigoto) transmite a caracterstica da calvcie a todos os filhos homens nascidos de seu casamento com uma mulher no calva. 3 - A calvcie dominante no sexo masculino 4 - A calvcie pode ser originada por causas ambientais, mas na maioria dos casos claramente hereditria. 5 - Uma mulher ser calva se seus pais forem calvos e se sua me (heterozigota) possuir um de seus genitores calvo. Concluiu-se com relao a estas proposies que: a) Apenas a 2, a 3 e a 4 so corretas. b) Apenas a 1, a 2 e a 3 so corretas. c) Apenas a 1, a 3 e a 4 so corretas. d) Apenas a 1, a 2 , a 3 e a 4 so corretas. e) Apenas a 2, a 3, a 4 e a 5 so corretas. Questo 512 Com o enorme crescimento populacional, h tambm uma necessidade crescente de alimentos, o que estimula a obteno de culturas vegetais com mxima produtividade. Muitas vezes esse melhoramento lana mo do conhecimento da herana gentica de um determinado carcter como, por exemplo, a altura. Supondo-se que duas espcies vegetais - X e Y - poderiam apresentar mudas com alturas diferentes, realizou-se cruzamento entre mudas altas e baixas das duas espcies (P1), obtendo F1 que ao serem fentipos resultantes dos cruzamentos foram representados nos grficos a seguir:

upondo que as plantas altas, tanto da espcie X quanto da espcie Y, sejam mais produtivas, podese afirmar que se obtm na espcie: a) X e na espcie Y, 100% de mudas altas ao cruzar mudas altas em F2; b) X, 50% de mudas altas ao cruzar as mudas altas em F1; c) Y, 100% de mudas altas ao cruzar as mudas mdias em F2; d) Y, 100% de mudas altas ao cruzar mudas altas em P1 com mudas altas em F2; e) Y, 100% de mudas altas ao cruzar mudas altas em P1 com mudas mdias em F2. Questo 513 No que se refere ao desenvolvimento do chamado milho hbrido, sabe-se que o cruzamento de duas linhagens homozigotas selecionadas pode produzir espigas maiores e de melhor qualidade comercial, em conseqncia da alta a) interao de genes recessivos. b) taxa de crossing-over. c) freqncia de genes em heterozigose. d) inativao de alelos codominantes. e) ocorrncia de pleiotropia. Questo 514 Considere as proposies seguintes. I. O enunciado da Primeira Lei de Mendel diz que os alelos de um gene separam-se durante a formao dos gametas. II. O enunciado da Segunda Lei de Mendel diz que quando dois ou mais genes esto envolvidos, cada um atua e segrega independentemente dos demais. III. A fase da meiose, responsvel pela ocorrncia da Segunda Lei de Mendel, a Anfase I. Assinale: a) se somente I e II estiverem corretas. b) se somente I e III estiverem corretas. c) se somente I estiver correta. d) se somente II e III estiverem corretas. e) se I, II e III estiverem corretas.

1.5.1.1

113

Questo 515 A primeira lei de Mendel ou lei da segregao significa: a) um cruzamento onde se considera apenas um gene, representado por dois alelos. b) um cruzamento de dois genitores homozigotos contrastantes. c) um cruzamento de dois genitores heterozigotos. d) a separao de um par de alelos durante a formao dos gametas. e) um carter controlado por dois ou mais genes. Questo 516 A primeira Lei de Mendel refere-se a) ao efeito do ambiente para formar o fentipo. b) segregao do par de alelos durante a formao dos gametas. c) ocorrncia de fentipos diferentes em uma populao. d) ocorrncia de gentipos diferentes em uma populao. e) unio dos gametas para formar o zigoto. Questo 517 Quando Mendel cruzou plantas de ervilha apresentando vagens de colorao verde com plantas de vagens de colorao amarelas, obteve na primeira gerao (F) todos os descendentes de colorao verde. Na segunda gerao (F) obteve 428 verdes e 152 amarelas. Todas as alternativas apresentam concluses a partir desses resultados, EXCETO: a) A expresso do alelo recessivo do gene desaparece apenas em F. b) As plantas com vagens verdes ou amarelas da gerao parental devem ser homozigotas. c) O alelo dominante do gene se expressa em cor verde. d) O carter controlado por um par de genes. e) Os indivduos que apresentam vagens de colorao verde em F so heterozigotos. Questo 518 A colorao das flores de ervilha determinada por herana autossmica. A figura a seguir representa um dos cruzamentos realizados por Mendel entre plantas de ervilhas com flores prpuras e plantas com flores brancas. Se Mendel utilizasse como genitor masculino as plantas de

flores prpuras e como feminino, as plantas de flores brancas, os descendentes obtidos em F1 apresentariam

1.5.1.1

a) 100% de flores brancas. b) 100% de flores prpuras. c) 75% de flores prpuras e 25% de flores brancas. d) 50% de flores prpuras e 50% de flores brancas. e) 100% de flores de colorao rsea. Questo 519 Esta figura representa o cruzamento de drosfilas de asas normais com indivduos de asas enroladas, mutantes, criadas em temperatura de 25C.

1.5.1.1

s moscas de gentipo igual ao do tipo III, quando criadas em temperatura de 16C, apresentam asas normais. O resultado desse fenmeno ilustra a) a adaptao dos mutantes. b) a influncia do ambiente na expresso do gentipo. c) a transmisso dos caracteres adquiridos. d) o processo de seleo natural. Questo 520 Analise esta tabela: MDIA DAS DIFERENAS NAS CARACTERSTICAS ENTRE GMEOS MONOZIGTICOS E DIZIGTICOS
114

1.5.1.1

Com base nas informaes desse grfico e em outros conhecimentos sobre o assunto, INCORRETO afirmar que, a) em torno dos 65 anos, cerca de 85% dos indivduos heterozigotos j manifestaram a doena. b) antes de atingirem a idade de 15 anos, indivduos portadores do alelo mutante podem expressar a doena. c) aos 30 anos, aproximadamente 75% dos indivduos Aa se apresentam sem os sinais clnicos da doena. d) aos 40 anos, filhos de casais Aa aa tm 50% de probabilidade de manifestar a doena. Questo 522 Na espcie humana h um gene que exerce ao simultaneamente sobre a fragilidade ssea, a surdez congnita e a esclertica azulada. Assinale a alternativa que define o caso. a) Ligao gentica b) Penetrncia completa c) Pleiotropia d) Herana quantitativa e) Polialelia Questo 523 A presena de sardas em seres humanos uma caracterstica hereditria determinada por um par de alelos. As sardas aparecem igualmente em homens e em mulheres, podem ser transmitidas de pai para filho, ocorrem em todas as geraes, e s pessoas com sardas podem ter filhos com sardas (veja no heredograma abaixo).

om base nos dados dessa tabela e em outros conhecimentos sobre o assunto, CORRETO afirmar que a) o peso a caracterstica que apresenta maior influncia gentica. b) as diferenas entre gmeos MZ indicam diferenas genticas entre eles. c) a influncia ambiental pode ser avaliada em gmeos MZ. d) o comprimento da cabea apresenta maior influncia ambiental. Questo 521 O mal de Huntington uma doena autossmica dominante caracterizada por deteriorao mental progressiva, convulses e morte. Os indivduos afetados so heterozigotos. Analise este grfico, em que se mostra o percentual de indivduos doentes entre aqueles que possuem gentipo favorvel:

1.5.1.1

1.5.1.1

115

abendo disso, possvel deduzir que a) a presena de sardas se deve a um alelo recessivo ligado ao cromossomo Y. b) a presena de sardas se deve a um alelo recessivo ligado ao cromossomo X. c) a presena de sardas se deve a um alelo dominante ligado ao sexo. d) a presena de sardas se deve a um alelo autossmico recessivo. e) a presena de sardas se deve a um alelo autossmico dominante. Questo 524 Uma ovelha branca ao cruzar com um carneiro branco teve um filhote de cor preta. Quais os gentipos dos pais, se a cor branca dominante? a) Ambos so homozigotos recessivos b) Ambos so brancos heterozigotos c) Ambos so homozigotos dominantes d) A me Bb e o pai BB e) A me bb e o pai Bb Questo 525 A acondroplasia (uma das formas de nanismo) causada por um gene dominante autossmico. Da unio de um homem acondroplsico com uma mulher normal resulta um filho normal. Este se casa com uma mulher normal cujos pais eram normais (conforme heredograma abaixo).

Em relao aos descendentes deste ltimo casamento e ao carter em questo, considerando ausncia de mutao, correto afirmar: (01) O descendente ser obrigatoriamente heterozigoto. (02) A freqncia genotpica na descendncia ser 1:2:1. (04) A probabilidade de acondroplasia na descendncia igual a zero. (08) A probabilidade de heterozigose na descendncia em relao a este locus igual a zero. (16) A freqncia fenotpica numa prole numerosa ser 3:1. (32) Numa prole numerosa, a freqncia fenotpica ser de 1 acondroplsico para 1 normal. Soma ( )

Questo 526 Cheiros e odores corporais fazem parte do aparato de comunicao em vrias espcies de mamferos, influenciando uma variedade de atividades como, por exemplo, reconhecimento da prole, disperso dos filhotes ainda jovens, seleo de parceiros e restries ao endocruzamento. Machos e fmeas sentem-se atrados por odores de linhagens no relacionadas. A respeito desse assunto, correto afirmar: (01) O cruzamento entre indivduos geneticamente diferentes, da mesma espcie, origina descendentes predominantemente heterozigotos. (02) O cruzamento entre indivduos geneticamente diferentes, da mesma espcie, origina descendentes homozigotos. (04) O endocruzamento pode causar uma reduo no valor adaptativo pela maior probabilidade de ocorrncia de gentipos ou combinaes homozigotas de alelos recessivos deletrios. (08) O endocruzamento no interfere no valor adaptativo. (16) Um indivduo hbrido aquele que resulta da unio entre dois indivduos geneticamente diferentes. Soma ( )

1.5.1.1

116

Questo 527 A matria publicada no Jornal O GLOBO, em 02 de julho de 1995, com o ttulo "Teste ajuda a evitar doenas congnitas", foi ilustrada com o esquema a seguir, representando o mecanismo de transmisso da fibrose cstica:

Questo 529 A Primeira Lei de Mendel ou Lei da Segregao dos Genes pode ser relacionada a uma das fases do processo meitico. Assinale a alternativa que apresenta a fase referida. a) Prfase I b) Metfase I c) Anfase I d) Metfase II e) Telfase II Questo 530 Joo e Maria esto pensando em ter um filho. Joo tem um irmo albino e uma irm com pigmentao normal. Seus pais no so albinos, porm Joo tem uma tia paterna albina e um primo, por parte de me, com a mesma caracterstica. J Maria tem um av materno e uma irm albinos e um irmo com pigmentao normal. Os pais de Maria tambm tm pigmentao normal. Que informaes permitem avaliar com maior preciso as chances de Joo e Maria terem um filho albino? a) O fentipo da irm de Joo e o gentipo do av de Maria. b) O gentipo da tia de Joo e o gentipo do irmo de Maria. c) O fentipo do irmo de Joo e o fentipo da irm de Maria. d) O gentipo do primo de Joo e o fentipo da me de Maria. e) O fentipo do pai de Joo e o gentipo do pai de Maria. Questo 531 Em 2005, iniciaram-se as comemoraes do centenrio da utilizao da 'Drosophila' sp. na pesquisa cientfica. Assinale com V (verdadeiro) ou F (falso) as afirmaes a seguir sobre esse inseto, amplamente utilizado em experimentos na rea de gentica e evoluo. ( ( ( ( ( ) Apresenta variantes genticas facilmente observveis. ) Apresenta autofecundao. ) Apresenta ciclo reprodutivo curto e fecundidade alta. ) Apresenta pequeno nmero de cromossomos. ) No apresenta dimorfismo sexual.

1.5.1.1

O esquema publicado apresenta um erro. Assinale a opo que faz referncia a esse erro. a) Os indivduos 3 a 6 so heterozigotos para a fibrose cstica. b) A fibrose cstica causada pela presena de um par de genes recessivos. c) A doena somente se manifesta quando dois indivduos portadores so cruzados. d) O indivduo 8 homozigoto dominante para a fibrose cstica. e) O indivduo 18 afetado pela fibrose cstica e no um portador desta doena. Questo 528 As reaes bioqumicas, em sua maioria, so interligadas e freqentemente interdependentes. Os produtos de uma cadeia de reaes podem ser utilizados em muitas outras vias metablicas. Assim, no surpreendente que a expresso fenotpica de um gene envolva mais do que uma caracterstica. A afirmao acima se refere ao conceito de a) dominncia incompleta. b) heterogeneidade gentica. c) pleiotropia. d) alelismo mltiplo. e) fenocpia.

A seqncia correta de preenchimento dos parnteses, de


117

cima para baixo a) F - V - F - F - V. b) F - F - V - F - V. c) V - V - F - V - F. d) V - F - V - V - F. e) V - F - F - V - V. Questo 532 Conforme correspondncia publicada na revista cientfica "Nature" de agosto de 2005 (p. 776), foi sugerido que a caracterstica de ser ou no bruxo seguiria padro de segregao mendeliana. Rony, Neville e Draco so bruxos, filhos de pais bruxos, provenientes de famlias bruxas tradicionais. Hermione bruxa mas filha de trouxas (no bruxos). Simas bruxo, filho de uma bruxa e de um trouxa. Harry bruxo, filho de bruxos, sendo sua me filha de trouxas. Com base no texto, considere as seguintes afirmaes sobre o carter bruxo em termos genticos. I - Harry menos bruxo que Rony, Neville e Draco. II - Hermione apresenta dois alelos para o carter bruxo. III - Simas heterozigoto para o carter bruxo. Quais esto corretas? a) Apenas I. b) Apenas II. c) Apenas I e III. d) Apenas II e III. e) I, II e III. Questo 533 Assinale a alternativa que preenche corretamente as lacunas do texto a seguir, na ordem em que aparecem. De acordo com a hiptese de segregao de fatores proposta por Mendel, a produo de uma gerao F a partir da autofertilizao da gerao F resultante do cruzamento de ervilhas parentais homozigotas amarelas (AA) e verdes (aa) produziria ............... de ervilhas amarelas e ............... de ervilhas verdes. a) 3/8 - 5/8 b) 4/8 - 4/8

c) 5/8 - 3/8 d) 6/8 - 2/8 e) 7/8 - 1/8 Questo 534 Leandro, preocupado com a possiblidade de vir a ser calvo, consultou um amigo que estava estudando gentica.Contou que, embora seus pais no fossem calvos, sua av materna era. Na famlia do av materno, no havia histrico de calvcie. Seu amigo explicou que a calvcie uma caracterstica influenciada pelo sexo e que se expressa nos homens em homo e heterozigose e nas mulheres, somente em homozigose. Assim concluiu que a chance de Leandro vir a ser calvo era de 50%. Essa concluso baseia-se no fato de a) sua me ser heterozigota. b) seu av paterno ser calvo. c) sua av paterna ser heterozigota. d) seu pai ser heterozigoto. e) sua av materna ser heterozigota. Questo 535 Considere que o carter analisado - cor da pelagem em coelhos - obedece ao proposto pela 1 Lei de Mendel, tendo sido realizados os cruzamentos a seguir:

1.5.1.1

Todos os descendentes pretos de F2 foram cruzados com os F1, resultando em 192 descendentes. Assinale o nmero esperado de descendentes com pelagem branca.

118

Questo 536 Em vrios cultivos, o que se deseja a produo de sementes. Para a produo de milho, por exemplo, necessrio que ocorra a polinizao. Se o plen de uma planta heterozigota para um determinado loco gnico fecundar os vulos de uma planta tambm heterozigota para esse loco, espera-se que a F seja a) 100% heterozigota. b) 50% dominante e 50% recessiva. c) 50% heterozigota, 25% homozigota dominante e 25% homozigota recessiva. d) formada por homozigotos para o alelo dominante. e) formada por homozigotos recessivos. Questo 537 Por meio da tcnica do DNA recombinante, uma cpia de um gene humano, responsvel pela sntese do hormnio do crescimento (somatotrofina), foi integrada a um nico cromossomo, na fase G do ciclo celular, de zigoto de camundongo. Este zigoto foi implantado em uma "me de aluguel", gerando um camundongo macho gigante.

de gametas: a) 100% com alelo recessivo. b) 100% com alelo dominante. c) 50% com alelo recessivo e 50% com alelo dominante. d) 75% com alelo dominante e 25% com alelo recessivo. e) 75% com alelo recessivo e 25% com alelo dominante. Questo 539 Os mecanismos da herana apresentam diferentes maneiras pelas quais os genes interagem entre si e com o ambiente para manifestarem seus efeitos no fentipo dos seres vivos. Com relao aos princpios bsicos da hereditariedade, assinale a alternativa CORRETA: a) Os genes codominantes tm menor influncia no fentipo do que os fatores ambientais. b) Na expresso gnica os efeitos do ambiente celular no so considerados. c) Os genes dominantes so independentes dos fatores ambientais para se expressarem. d) Pode ser muito difcil determinar se o fentipo resulta mais do efeito gnico do que o ambiental. e) Na presena de genes recessivos, apenas o efeito ambiental prevalece no fentipo. Questo 540

1.5.1.1

Se o camundongo macho gigante cruzar com uma fmea normal, no portadora do gene do hormnio do crescimento, a frao de descendentes gigantes, provavelmente, ser igual a a) zero. b) 25%. c) 50%. d) 100%. Questo 538 De acordo com a primeira lei de Mendel, um indivduo heterozigoto para um carter regulado por dominncia completa provavelmente produzir a seguinte porcentagem

Suponha que um evento de mutao permitiu ao homem-aranha secretar a seda formadora de teia. Esse nico evento resultou na formao de um alelo (S) autossmico e dominante, mas com expresso influenciada pelo sexo. Desta forma, mulheres-aranha seriam esperadas na populao apenas se tal alelo ocorresse em homozigose (SS). Considerando que o homem-aranha o nico a ter essa mutao, a expectativa quanto aos fentipos de seus futuros descendentes poder ser uma entre as possibilidades abaixo. Assinale a afirmativa CORRETA: a) Ter filhas-aranha se casar com uma prima de primeiro grau. b) Todos os seus meninos devero ter o fentipo "aranha". c) Na gerao F1, 25% poder ser de meninos-aranha. d) Analisando apenas as filhas, 50% delas devero ser normais. e) Quem herdar o cromossomo Y dever ser uma criana-aranha.
119

Questo 541 No Brasil, uma lei determina que os recm-nascidos sejam submetidos ao "teste do pezinho", por meio do qual se identifica a fenilcetonria, doena hereditria que pode levar ao retardamento mental, com prejuzo da fala e dos movimentos. Se detectada a tempo, essa doena pode ser controlada ministrando-se ao recm-nascido uma dieta especial. O heredograma seguinte ilustra uma situao em que h indivduos fenilcetonricos.

b) No, pois tanto o gentipo como o fentipo dos filhos so alterados pela insulina. c) Sim, pois a insulina incorporada nas clulas e ter ao nos filhos. d) Sim, pois a insulina incorporada no sangue fazendo com que os filhos no apresentem o distrbio. e) Depende do tipo de diabete, pois nesses casos o gentipo pode ser alterado evitando a manifestao da doena nos filhos. Questo 543 O gene autossmico, que condiciona plos curtos em cobaias, dominante em relao ao gene que determina plos longos. Do cruzamento de cobaias heterozigotas nasceram 300 cobaias, das quais 240 tinham plos curtos. Entre as cobaias de plos curtos, o nmero esperado de heterozigotos : a) 45. b) 60. c) 90. d) 160. e) 180. Questo 544 Considerando-se que a cor da pelagem de cobaias determinada por um par de alelos, que pode apresentar dominncia ou recessividade, foram realizados cruzamentos entre esses animais, conforme a tabela.

1.5.1.1

Considerando o heredograma, julgue os itens abaixo. (1) O carter fenilcetonrico apresenta herana autossmica dominante. (2) O cruzamento entre os indivduos 10 e 11 ilustra como a consanginidade influencia o aparecimento de doenas hereditrias. (3) Os homens normais representados no heredograma so necessariamente heterozigotos. (4) A probabilidade de que o casal formado pelos indivduos 10 e 11 tenha um descendente do sexo masculino fenilcetonrico igual a 12,5%. (5) A dieta especial a que devem ser submetidos os recm-nascidos fenilcetonricos tende a alterar a freqncia do gene da fenilcetonria na populao. Questo 542 Os vrios tipos de diabete so hereditrios, embora o distrbio possa aparecer em crianas cujos pais so normais. Em algumas dessas formas, os sintomas podem ser evitados por meio de injees dirias de insulina. A administrao de insulina aos diabticos evitar que eles tenham filhos com este distrbio? a) No, pois o gentipo dos filhos no alterado pela insulina.

1.5.1.1

120

anlise da tabela permite concluir que a) no cruzamento I, os pais so heterozigotos. b) no cruzamento II, so observados dois fentipos e trs gentipos entre os descendentes. c) no cruzamento III, os gentipos dos pais podem ser diferentes. d) no cruzamento IV, os pais so heterozigotos. e) no cruzamento V, podem ocorrer trs gentipos diferentes entre os descendentes. Questo 545 Em gatos, existe uma sndrome caracterizada, entre outras manifestaes, por suscetibilidade aumentada a infeces e tendncia a sangramentos. Essa sndrome mais freqente em descendentes de casais aparentados e ocorre em machos e fmeas em proporo relativamente igual. Ao fazer a genealogia de vrios indivduos, observou-se que a sndrome no se manifesta em algumas geraes e pode ocorrer em indivduos que aparentemente tm pais normais. Com base nessas informaes, pode-se dizer que o tipo de herana responsvel por essa sndrome a) autossmica recessiva. b) autossmica dominante. c) ligada ao cromossomo X e dominante. d) ligada ao cromossomo X e recessiva. e) ligada ao cromossomo Y e recessiva. Questo 546 Em um cruzamento de um indivduo AA com outro aa, considerando que o alelo A dominante sobre a, a proporo fenotpica observada em F significa exatamente que: a) 25% da prole expressam o fentipo determinado pelo alelo dominante e 75% no o expressam. b) em 25% da prole, o fentipo recessivo mascarado pelo fentipo dominante. c) 75% da prole expressam o fentipo determinado pelo alelo A e 25% no o expressam. d) em 50% da prole, o fentipo dominante mascarado pelo fentipo recessivo. e) 50% da prole possuem um nico tipo de alelo e 50% possuem outro tipo de alelo.

Questo 547 No cruzamento de plantas verdes, normais, possvel o aparecimento de indivduos albinos. Embora plantas albinas morram antes de produzirem sementes, a caracterstica "albinismo" no desaparece entre elas. Isto se explica porque: a) muitas plantas verdes so heterozigticas. b) plantas normais homozigticas tornam-se albinas na ausncia de luz. c) plantas albinas tornam-se verdes na presena de luz. d) o gene para albinismo ativado no escuro. e) o albinismo impede a sntese de clorofila. Questo 548 Mendel cruzou duas variedades de 'Mirabilis jalapa', uma com flores vermelhas e outra com flores brancas. Na gerao F todas as flores eram rosas. Indique qual ser o resultado do cruzamento da variedade de flores rosas (F). a) 25% brancas : 25% vermelhas : 50% rosas b) 25% brancas : 50% vermelhas : 25% rosas c) 100% rosas d) 50% vermelhas : 50% rosas e) 50% brancas : 25% vermelhas : 25% rosas Questo 549 Do cruzamento entre aves andaluzas de colorao azulada, nasceram 15 filhotes azulados, 7 brancos e 8 pretos. Trata-se de um caso de _____________ e os indivduos parentais so _______________. O preenchimento correto das lacunas , respectivamente: a) herana quantitativa e homozigotos dominantes. b) codominncia e heterozigotos c) linkage e heterozigotos. d) herana ligada ao sexo e homozigotos recessivos. e) epistasia e homozigotos dominantes. Questo 550 As flores da planta maravilha podem ser vermelhas, brancas ou rosas. As flores vermelhas e brancas so homozigotas, enquanto as rosas so heterozigotas. Para se obter 50% de flores brancas, necessrio cruzar: a) duas plantas de flores rosas. b) uma planta de flores brancas com outra de flores rosas. c) uma planta de flores rosas com outra de flores
121

vermelhas. d) uma planta de flores vermelhas com outra de flores brancas. e) duas plantas de flores vermelhas. Questo 551 A maioria das populaes composta por pessoas que manifestam perda progressiva da lactase intestinal aps o desmame. Em conseqncia da falta dessa enzima, essas pessoas perdem a capacidade de digerir o acar do leite, a lactose. (Adaptado de "Cincia Hoje". Agosto de 1999. p. 49) A alergia ao leite pode ser hereditria, causada pela deficincia da enzima lactase. Essa caracterstica autossmica e, nas populaes ocorrem trs fentipos relacionados atividade da enzima: indivduos sem atividade de lactase, indivduos com atividade de lactase e indivduos com atividade parcial da lactase. Essa distribuio caracterstica de um padro de herana a) recessiva. b) dominante. c) episttica. d) co-dominante. e) quantitativa. Questo 552 Valria gostava muito de flores. Observando seu jardim, notou a existncia de plantas de uma mesma espcie que possuam indivduos com flores brancas, rosas e vermelhas. Curiosa para saber como se dava a transmisso desse carter, Valria promoveu uma autofecundao nas plantas de cor rosa e, para sua surpresa, obteve plantas que davam flores brancas, vermelhas e rosas, estas ltimas em quantidade duas vezes maior que as plantas de flor branca e vermelha, obtendo plantas que s davam flores de cor rosa. Valria concluiu CORRETAMENTE que: a) trata-se de dominncia da cor rosa sobre as demais. b) trata-se de um caso de co-dominncia entre os genes alelos que determinam o padro de cor. c) as plantas de flor rosa eram recessivas. d) as plantas de flor vermelha eram dominantes e as de cor branca recessivas. e) trata-se de um caso de gene letal, pois o cruzamento de plantas de flores brancas e vermelhas s originou flores

rosas. Questo 553 Em "Mirabilis jalapa" (maravilha), o carter tonalidade da cor das folhas e ramos transmitido geneticamente atravs do citoplasma dos vulos. Trs fentipos so observados: verde; verde plido; variegadas (pigmentao irregular). A tabela abaixo apresenta o resultado de seis possveis cruzamentos.

1.5.1.2

e acordo com a tabela e com seus conhecimentos, INCORRETO afirmar: a) A propagao vegetativa de uma planta verde deve produzir plantas verdes. b) Genes esto envolvidos na determinao dos fentipos. c) uma herana ligada ao sexo em vegetais. d) O fentipo pode ser influenciado por fatores ambientais. Questo 554 No monoibridismo com co-dominncia ou dominncia intermediria, as propores genotpicas e fenotpicas observadas na segunda gerao dos filhos sero, respectivamente, a) 1 : 3 : 1 e 3 : 1 b) 1 : 2 : 1 e 1 : 2 : 1 c) 1 : 1 : 2 e 1 : 1 : 1 d) 1 : 3 : 1 e 3 : 1 : 3 e) 1 : 1 : 1 e 3 : 1 Questo 555 Em estudo publicado na revista Nature de 25 de junho passado, pesquisadores da Universidade de Toronto, no Canad, afirmam que o gene CYP2A6 est ligado dependncia das pessoas ao cigarro. Este gene, em sua forma normal, codifica a sntese de uma enzima que
122

metaboliza a nicotina, tornando as pessoas dependentes. Eles afirmam, ainda, que h, na espcie humana, trs alelos para este gene: um normal e dois defeituosos. Fumantes portadores de dois alelos normais (homozigoto para o alelo normal) so altamente dependentes do cigarro, enquanto que portadores de dois dos alelos defeituosos, apesar de fumantes, jamais se tornam dependentes. Por outro lado, fumantes heterozigotos, portadores de um alelo normal e outro defeituoso, so moderadamente dependentes, consumindo 20% menos cigarros que os fumantes inteiramente dependentes. Com base no texto anterior, correto afirmar que a dependncia ao cigarro determinada pelo gene CYP2A6 um caso de: a) herana quantitativa, pois o fentipo apresenta uma continuidade entre dependentes e no dependentes. b) pleiotropia, pois o heterozigoto apresenta fentipo diferente de ambos os homozigotos. c) epistasia recessiva, pois qualquer um dos alelos defeituosos inibe, parcialmente, a ao do alelo normal. d) dominncia completa da forma normal do gene CYP2A6 sobre as formas defeituosas. e) dominncia incompleta entre a forma normal e as defeituosas do gene CYP2A6. Questo 556 Observe o esquema.

Com base nesse esquema e em conhecimentos sobre o assunto, CORRETO afirmar que a) o gene HbA dominante sobre o gene HbS. b) os indivduos HbA/HbS e HbS/HbS devem apresentar os mesmos nveis de hemoglobina anormal. c) os indivduos que produzem s hemcias anormais podem ser curados por meio de transfuso sangnea. d) um determinado gentipo pode produzir diferentes fentipos. Questo 557 Analise esta tabela, em que esto relacionadas caractersticas das geraes F1 e F2, resultantes dos cruzamentos de linhagens puras de trs organismos diferentes:

1.5.1.2

1.5.1.2

Considerando-se as informaes contidas nesta tabela e outros conhecimentos sobre o assunto, INCORRETO afirmar que a) os pares de genes que determinam o "tipo" e a "cor" da asa nas moscas esto localizados em cromossomas no-homlogos. b) as caractersticas "tipo de semente" e "cor de plumagem" so determinadas, cada uma delas, por um nico par de gene. c) as plantas da F2 com "sementes rugosas", quando autofecundadas, originam apenas descendentes com sementes rugosas. d) o gene que determina "plumagem azulada" dominante sobre os genes que determinam "plumagem preta" ou "plumagem branca".

123

Questo 558 Um casal de africanos teve trs filhos. O primeiro morreu aos 5 anos de idade, em conseqncia de anemia falciforme; o segundo normal e bastante suscetvel a malria (doena endmica na regio); o ltimo normal, porm pouco suscetvel a malria. Assinale a opo em que se indicam, corretamente, o membro da famlia com seu respectivo gentipo e o padro de herana da anemia falciforme. a) 2 filho homozigoto recessivo; Herana: dominncia completa; b) pai heterozigoto; Herana: epistasia dominante; c) 3 filho heterozigoto; Herana: co-dominncia; d) me homozigoto dominante; Herana: pleiotropia. Questo 559 Um experimentador cruzou duas linhagens puras de uma planta denominada boca-de-leo; uma constituda de plantas com flores brancas e outra com flores vermelhas. A descendncia originada (F) apresentou apenas plantas com flores cor-de-rosa. Da autofecundao das plantas da F, foram obtidas plantas com flores exclusivamente brancas, vermelhas ou cor-de-rosa. Assinale a(s) proposio(es) VERDADEIRA(S), considerando que neste experimento: (01) ocorreu a segregao de trs fentipos: o branco, o vermelho e o cor-de-rosa. (02) a proporo genotpica esperada nas plantas de F : 1 planta com flores cor-de-rosa: 2 plantas brancas: 1 planta vermelha. (04) as linhagens puras, que deram origem ao experimento, certamente apresentam gentipos homozigotos. (08) os indivduos de F eram, certamente, heterozigotos. (16) a F esperada ser constituda de 50% de indivduos homozigotos e 50% de indivduos heterozigotos. Questo 560 A talassemia uma doena hereditria que resulta em anemia. Indivduos homozigotos MM apresentam a forma mais grave, identificada como talassemia maior e os heterozigotos MN, apresentam uma forma mais branda

chamada de talassemia menor. Indivduos homozigotos NN so normais. Sabendo-se que todos os indivduos com talassemia maior morrem antes da maturidade sexual, qual das alternativas a seguir representa a frao de indivduos adultos, descendentes do cruzamento de um homem e uma mulher portadores de talassemia menor, que sero anmicos? a) 1/2 b) 1/4 c) 1/3 d) 2/3 e) 1/8 Questo 561 Considere as seguintes formas de herana: I. Na planta boca-de-leo, h indivduos homozigotos, cujo gentipo (CC) define cor vermelha nas flores. Indivduos homozigotos com gentipos (CC) apresentam flores brancas. Os heterozigotos resultantes do cruzamento entre essas duas linhagens (CC) apresentam flores de cor rosa. II. Em humanos, indivduos com gentipos II ou Ii apresentam tipo sangneo A e os com gentipos II ou Ii apresentam tipo sangneo B. Os alelos Ie I so, portanto, dominantes com relao ao alelo i. Por outro lado, o gentipo II determina tipo sangneo AB. III. A calvcie determinada por um alelo autossmico. Homens com gentipo CC (homozigotos) ou CC (heterozigotos) so calvos, enquanto mulheres CC so calvas e CC so normais. Tanto homens quanto mulheres CC so normais. I, II e III so, respectivamente, exemplos de a) dominncia incompleta, co-dominncia e expresso gnica influenciada pelo sexo. b) dominncia incompleta, pleiotropia e penetrncia incompleta. c) co-dominncia, epistasia e pleiotropia. d) epistasia, co-dominncia e dominncia incompleta. e) herana polignica, dominncia incompleta e expresso gnica influenciada pelo sexo.

124

Questo 562 Em gentica, a dominncia parcial e a codominncia entre alelos definem-se, de forma mais precisa, a) nos gentipos heterozigotos. b) nos gentipos homozigotos. c) nos gentipos dominantes. d) nos gentipos recessivos. e) na ligao gnica. Questo 563 Os grficos I e II representam a freqncia de plantas com flores de diferentes cores em uma plantao de cravos (I) e rosas (II).

c) pleiotrpico. d) hiposttico. e) episttico. Questo 565 Em determinado tipo de camundongo, a pelagem branca condicionada pela presena do gene "A", letal em homozigose. Seu alelo recessivo "a" condiciona pelagem preta. Para os filhotes vivos de um cruzamento de um casal de heterozigotos, esperam-se as seguintes propores de camundongos de pelagem branca e preta, respectivamente: a) 1/2 e 1/2 b) 1/4 e 3/4 c) 2/3 e 1/3 d) 3/4 e 1/4 Questo 566

1.5.1.2

Os padres de distribuio fenotpica so devidos a: a) I: 1 gene com dominncia; II: 1 gene com dominncia incompleta. b) I: 1 gene com dominncia incompleta; II: vrios genes com interao. c) I: 1 gene com dominncia incompleta; II: 1 gene com alelos mltiplos. d) I: 3 genes com dominncia incompleta; II: vrios genes com interao. e) I: 2 genes com interao; II: 2 genes com dominncia incompleta. Questo 564 Em aves, existe uma anomalia que se caracteriza pelo encurtamento das asas. Quando aves anmalas heterozigticas so cruzadas, originam uma descendncia com indivduos anmalos e normais numa proporo de 2 :1, respectivamente. A partir desses dados, possvel deduzir que o alelo que condiciona a anomalia a) letal em homozigose. b) letal recessivo.

Na espcie humana h um tipo de surdez hereditria que determinada por um par de genes. No heredograma a seguir, as pessoas surdas esto representadas por smbolos hachurados: Com base nessa afirmao, assinale a opo correta quanto ao tipo de herana e os gentipos dos indivduos 1, 2, 3 e 4, respectivamente:

1.5.1.4

a) autossmica dominante - ss, Ss, ss e ss. b) autossmica dominante - SS, ss, SS e SS. c) autossmica dominante - Ss, SS, Ss e Ss. d) autossmica recessiva - SS, ss, Ss e SS. e) autossmica recessiva - Ss, ss, Ss e Ss.

125

Questo 567 A fenilcetonria (PKU) uma doena de origem gentica bastante conhecida, causada por uma deficincia da enzima fenilalanina hidroxilase. Pacientes acometidos desse mal, alm de no sintetizarem catecolaminas corretamente, no conseguem metabolizar a fenilalanina e, assim, apresentam uma srie de complicaes como retardo mental, epilepsia, hipopigmentao, entre outras. Considere o heredograma a seguir de uma famlia com membros acometidos (smbolos cheios) e normais (smbolos vazados).

1.5.1.4

1.5.1.4

obre as informaes contidas no heredograma, podemos afirmar que os indivduos heterozigotos so: a) 1, 2, 3, 4 b) 1, 2, 4, 5 c) 1, 2, 6, 8 d) 4, 5, 6, 7 e) 3, 5, 9 Questo 569 No heredograma, os quadrados cheios representam meninos afetados por uma doena gentica. Se a doena for condicionada por um par de alelos recessivos localizados em cromossomos autossmicos, as probabilidades de o pai (A) e de a me (B) do menino (C) serem portadores desse alelo so, respectivamente, (I) e (II). Caso a anomalia seja condicionada por um alelo recessivo ligado ao cromossomo X, num segmento sem homologia com o cromossomo Y, as probabilidades de o pai e de a me serem portadores desse alelo so, respectivamente, (III) e (IV). Assinale a alternativa que mostra as porcentagens que preenchem corretamente os espaos I, II, III e IV.

odemos dizer, quanto presena de alelos mutantes de fenilalanina hidroxilase nos membros da famlia marcados com algarismos romanos, que: a) VIII pode ter um alelo mutado. b) VI possui dois alelos mutados. c) V necessariamente homozigoto. d) III possui apenas um alelo mutado. e) I necessariamente homozigoto. Questo 568 Analise o heredograma a seguir, onde os indivduos masculinos so representados por quadrados e os femininos por crculos.

1.5.1.4

126

Questo 570 O esquema a seguir representa indivduos de trs geraes de uma famlia. Os smbolos escuros indicam os portadores de uma anomalia hereditria.

Questo 572 O tipo de herana gentica apresentada pelos indivduos afetados : a) autossmica dominante. b) autossmica recessiva. c) ligada ao x dominante. d) ligada ao x recessiva. e) ligada ao y.

1.5.1.4

1.5.1.4

nalisando-se a genealogia, conclui-se que a anomalia determinada por gene a) dominante, localizado no cromossomo x. b) dominante, localizado no cromossomo y. c) dominante, localizado em autossomo. d) recessivo, localizado no cromossomo y. e) recessivo, localizado em autossomo. Questo 571 No heredograma a seguir, crculos representam mulheres, quadrados representam homens e smbolos preenchidos representam indivduos portadores de certa caracterstica.

Questo 573 Se os indivduos 7 e 11 se casarem, a probabilidade desse casal ter uma filha com o mesmo fentipo do av materno de: a) 1/2 b) 1/4 c) 1/8 d) 1/3 e) 2/3

1.5.1.4 1.5.1.4

om base na anlise do heredograma, pode-se concluir que a caracterstica em questo condicionada por gene a) dominante, localizado no cromossomo X. b) recessivo, localizado no cromossomo X. c) dominante, localizado em um autossomo. d) recessivo, localizado em um autossomo. e) localizado no cromossomo Y.

Questo 574

127

1.5.1.4

No heredograma acima, se os indivduos marcados so afetados por uma caracterstica gentica, as probabilidades dos casais 78 e 910 terem crianas normais so, respectivamente, de: a) 100% e 50%. b) 0 e 75%. c) 50% e 50%. d) 0 e 25%. e) 100% e 75%. Questo 575 Analise o seguinte heredograma de uma caracterstica transmitida geneticamente:

om base nessa anlise, indique a opo que apresenta a afirmativa correta sobre a herana da caracterstica referida no heredograma. a) do tipo recessiva autossmica porque o gentipo pode estar presente na prole de ambos os sexos sem estar presente nos pais. b) do tipo dominante autossmica porque o gentipo pode estar presente na prole de ambos os sexos sem estar presente nos pais. c) do tipo recessiva autossmica porque o nmero de indivduos afetados menor do que o de no afetados. d) do tipo recessiva ligada ao sexo porque todo progenitor masculino afetado transmite a caracterstica para suas filhas. e) do tipo dominante ligada ao sexo porque todos os filhos homens herdam a caracterstica da me. Questo 576 No heredograma adiante, os indivduos 3 e 5 so afetados por uma anomalia gentica recessiva.

1.5.1.4

1.5.1.4

Considerando-se que a famlia acima representada faz parte de uma populao em equilbrio de Hardy-Weimberg, na qual a freqncia de indivduos afetados de 1%, correto afirmar, EXCETO: a) A segunda gerao pode ser composta apenas por indivduos homozigotos. b) O indivduo 8 apresenta o mesmo fentipo e o mesmo gentipo do av para o carter em questo. c) A probabilidade de o indivduo 7 ser heterozigoto de 18%. d) O carter em estudo pode ser ligado ao sexo.

128

Questo 577 No heredograma, as figuras 6, 10 e 12 representam indivduos que, na fase adulta, desenvolveram a mesma doena hereditria:

1.5.1.4

onsiderando que os indivduos indicados em preto so afetados por uma caracterstica gentica, e os indicados em branco no a apresentam, correto concluir que tal caracterstica a) a calvcie, causada por um gene autossmico influenciado pelo sexo. b) o lbulo da orelha livre, causada por um gene autossmico dominante. c) a hemofilia, causada por um gene recessivo ligado ao sexo. d) a hipertricose, causada por um gene restrito ao sexo. e) a incapacidade de enrolar a lngua, causada por um gene autossmico recessivo. Questo 579 A Doena de Huntington (DH) uma anomalia autossmica com carter dominante cuja manifestao ocorre na fase adulta, com uma progressiva perda do controle motor e problemas psiquitricos como demncia e distrbios afetivos. No heredograma a seguir, os indivduos afetados por DH esto indicados em negro.

xamine as afirmaes: I - uma doena de carter dominante autossmica. II - As pessoas 1 e 2 so heterozigotas. III - A mulher representada pelo nmero 5 tem possibilidade de ser homozigota. IV - Se houver casamento consangneo entre 9 e 11, com certeza, os eventuais filhos nascero afetados. So corretas as afirmaes: a) I, II, III e IV. b) Apenas I, II e III. c) Apenas II e III. d) Apenas II, III e IV. e) Apenas uma das afirmaes. Questo 578 Responder questo com base no heredograma a seguir.

1.5.1.4

1.5.1.4

129

s afirmativas abaixo referem-se aos possveis gentipos dos indivduos indicados no heredograma. Assinale, nos parnteses, V para as verdadeiras e F para as falsas. ( ) Os indivduos I-1, I-2, II-1 e II-3 so homozigotos. ( ) Os indivduos II-1 e II-3 so heterozigotos. ( ) Os indivduos II-2 e II-4 so heterozigotos. ( ) Os indivduos III-1, III-2, III-3 e III-4 so homozigotos. A seqncia correta de preenchimento dos parnteses, de cima para baixo, a) F - V - F - V b) F - V - V - F c) V - F - V - F d) V - F - F - V e) V - F - V - V Questo 580 Qual dos heredogramas a seguir ilustra uma condio biologicamente IMPOSSVEL?

1.5.1.4

essa famlia, os indivduos 1, 2, 3, 4 e 7 so braquidctilos, enquanto os indivduos 5 e 8 apresentam dedos normais. Considerando essas informaes e desprezando a possibilidade de ocorrncia de mutao, pode-se afirmar que o indivduo 6: a) braquidctilo e homozigoto. b) braquidctilo e heterozigoto. c) tem dedos normais e homozigoto. d) tem dedos normais e heterozigoto. e) pode ser ou no braquidctilo e homozigoto. Questo 582 Na genealogia a seguir, as pessoas indicadas pelos nmeros 1, 2, 4, 5 e 7 apresentam uma anomalia condicionada por gene autossmico dominante. J as pessoas indicadas pelos nmeros 3 e 6 tm fentipo normal.

1.5.1.4

1.5.1.4 Questo 581 Analise a genealogia a seguir, onde foi estudado o carter BRAQUIDACTILIA (dedos curtos), que determinado por um par de genes:

130

Aps a anlise da genealogia, pode-se concluir que: a) apenas as pessoas indicadas pelos nmeros 1 e 2 so heterozigticas. b) a pessoa indicada pelo nmero 4 homozigtica. c) a pessoa indicada pelo nmero 3 transmitiu o gene recessivo para seu descendente indicado pelo nmero 7. d) no h possibilidade de a pessoa indicada pelo nmero 5 ser heterozigtica. e) o casal indicado pelos nmeros 6 e 7 no poder ter descendentes com fentipo normal. Questo 583 A calvcie uma caracterstica influenciada pelo sexo e o gene que a condiciona se comporta como recessivo no sexo feminino e dominante no sexo masculino. Observe a genealogia a seguir, relativa a essa caracterstica.

1.5.1.4

esse heredograma NO se pode determinar o gentipo do indivduo a) 1 b) 3 c) 5 d) 6 e) 7 Questo 585

1.5.1.4

No heredograma abaixo, os smbolos escuros representam indivduos que possuem uma anomalia.

1.5.1.4 probabilidade do casal 34 ter o primeiro filho homem e que venha a ser calvo, : a) 1/2 b) 1/4 c) 1/8 d) 1/6 Questo 584 O heredograma a seguir representa a herana de um par de genes entre os quais h dominncia. Os smbolos escuros representam indivduos que exibem a caracterstica recessiva.

131

onsidere as seguintes afirmativas sobre esse heredograma: I. A anomalia condicionada por um alelo dominante. II. Todos os indivduos que apresentam a anomalia so homozigticos. III. O nico indivduo que no pode ter o seu gentipo definido o I-4. correto o que se afirma APENAS em a) I b) II c) III d) I e II e) II e III Questo 586 No heredograma adiante, a criana II-1 tem fibrose cstica, uma doena causada por um alelo recessivo autossmico. As probabilidades de que sua irm (II-2) no afetada seja carreadora ou no carreadora da fibrose cstica so, respectivamente: a) zero, 1/4 b) 1/4, 1/2 c) 1/4, 1/4 d) 1/2, 1/4 e) 1/2, 2/2

1.5.1.4

ps a anlise deste heredograma, podemos afirmar: a) todos os indivduos normais so homozigotos recessivos; b) a anomalia condicionada por um gene recessivo; c) a anomalia ocorre apenas em homozigotos dominantes; d) todos os indivduos normais so homozigotos dominantes; e) todos os indivduos normais so homozigotos dominantes ou heterozigotos. Questo 588 Foi estabelecida uma linhagem de camundongos nocaute esses animais se caracterizam por no expressar um determinado gene. Aps uma infeco em que apenas uma fmea nocaute sobreviveu, a linhagem pde ser reestabelecida por meio do acasalamento descrito a seguir:

1.5.1.4

1.5.1.4

Questo 587 O heredograma mostra a incidncia de uma anomalia gentica em grupo familiar.

132

ode-se afirmar que: a) Por meio do acasalamento do macho 3 com a fmea nocaute, 75% do filhotes nascero normais. b) Em F, 50% dos filhotes so animais com o gentipo heterozigoto. c) O acasalamento do macho 3 com a fmea 5 produzir maior nmero de camundongos nocaute do que o acasalamento desse macho com a fmea 4. d) O cruzamento do macho 2 com uma das fmeas de F originar camundongos dos quais 75% sero heterozigotos. e) A herana do carter nocaute autossmica dominante. Questo 589 Analise o heredograma que representa a herana de um tipo de disfuno dos msculos esqueltico e cardaco em seres humanos.

1.5.1.4

m relao caracterstica representada no heredograma, todas as alternativas so possveis, EXCETO a) A herana pode ser autossmica. b) A herana pode ser ligada ao sexo. c) A herana pode representar uma famlia de hemoflicos. d) I-1 e I-2 podem ser heterozigotos. e) II-2, II-5 e III-1 podem ser homozigotos dominantes. Questo 591

1.5.1.4

Observe este heredograma:

1.5.1.4 Com relao ao heredograma, correto afirmar-se que a) a herana para esse tipo de caracterstica recessiva e ligada ao sexo. b) a ocorrncia da caracterstica nessa famlia se deve aos casamentos consangneos. c) a probabilidade de mulheres descendentes de IV-1 serem afetadas zero. d) as mulheres afetadas apresentam fentipos idnticos aos de suas mes. e) o casamento de III-4 com indivduo de fentipo igual a II-4 tem como resultado esperado 100% de mulheres afetadas. Questo 590 Analise o heredograma.

ps analisar esse heredograma, uma estudante concluiu que a caracterstica transmitida, na famlia representada, autossmica recessiva. Para chegar a tal concluso, essa estudante considerou todas as seguintes hipteses, EXCETO a) O indivduo I.3 tem filha normal, por isso improvvel uma herana dominante ligada ao X. b) O indivduo II.5 tambm seria afetado, se a herana fosse ligada ao Y. c) O indivduo III.2 no possui pais afetados, portanto a herana no deve ser autossmica dominante. d) Os filhos homens de I.2 seriam normais, se a herana fosse recessiva ligada ao X.

133

Questo 592 As pessoas podem detectar a substncia qumica feniltiocarbamida - PTC - como um gosto amargo ou, mesmo, no sentir qualquer sabor. Observe este heredograma para a capacidade de sentir o gosto dessa substncia:

onsiderando-se as informaes desse heredograma e outros conhecimentos sobre o assunto, INCORRETO afirmar que a) os indivduos normais, em todas as geraes, so homozigotos. b) a ocorrncia do tumor uma caracterstica autossmica. c) o prximo filho do casal II.1 x II.2 ser normal. d) a probabilidade de o indivduo III.2 ser heterozigoto de dois teros. Questo 594

1.5.1.4

Um geneticista estabeleceu o heredograma para uma determinada doena hereditria, cujo diagrama, mostrando-os indivduos afetados, representado abaixo.

om base nesse heredograma e em outros conhecimentos sobre o assunto, INCORRETO afirmar que a) o alelo para a capacidade de sentir o gosto do PTC dominante. b) o loco do gene em estudo est situado em um cromossomo autossmico. c) o risco de III.3 nascer incapaz de sentir o gosto do PTC de 50%. d) os indivduos I.1 e II.1 so heterozigotos. Questo 593 Analise este heredograma, que representa uma famlia em que h indivduos afetados por um tipo de tumor de gengiva:

1.5.1.4

Esse diagrama representa: ( ) o modelo de herana recessiva ligada ao cromossomo X. ( ) um modelo de herana idntico ao do albinismo. ( ) um modelo de herana idntico ao da cegueira para cores, conhecida como daltonismo. ( ) a caracterstica passada de gerao a gerao, de pai para filha e me para filha, tpica daquelas no vinculadas aos cromossomos X e Y. ( ) o modelo de herana autossmica recessiva. Questo 595 Renata (III.1), cuja av materna e av paterno eram albinos, preocupada com a possibilidade de transmitir o alelo para o albinismo a seus filhos, deseja saber qual a probabilidade de ela no ser portadora deste alelo. Assinale a alternativa que responde ao questionamento de Renata. a) 0 b) 1/4 c) 3/4
134

1.5.1.4

d) 1/3 e) 1

1.5.1.4 1.5.1.4

Questo 596 O heredograma adiante representa a herana de um fentipo anormal na espcie humana. Analise-o e assinale a alternativa correta.

(01) A anomalia causada por gene provavelmente recessivo. (02) A anomalia causada por gene provavelmente dominante. (04) Trata-se de gene localizado no cromossomo X. (08) Trata-se de gene localizado no cromossomo Y. (16) Trata-se de gene autossmico. (32) Trata-se de Herana Intermediria. (64) Trata-se de Herana Holndrica. Soma ( )

1.5.1.4

Questo 598 Na genealogia a seguir, os indivduos assinalados com preto apresentam uma anomalia determinada por um gene dominante.

a) Os indivduos II-3 e II-4 so homozigotos, pois do origem a indivduos anormais. b) O fentipo anormal recessivo, pois os indivduos II-3 e II-4 tiveram crianas anormais. c) Os indivduos III-1 e III-2 so heterozigotos, pois so afetados pelo fentipo anormal. d) Todos os indivduos afetados so heterozigotos, pois a caracterstica dominante. e) Os indivduos I-1 e I-4 so homozigotos. Questo 597 Considerando o heredograma abaixo, onde os indivduos afetados pela sndrome unha-rtula (deformao nas unhas e nas rtulas) aparecem em preto, correto afirmar:

1.5.1.4

Analisando essa genealogia, correto afirmar: a) Todos os indivduos afetados so homozigotos. b) Todos os indivduos no afetados so heterozigotos. c) Apenas o indivduo I:1 heterozigoto. d) Apenas os indivduos I:1; II:1 e II:5 so heterozigotos. e) Apenas os indivduos I:1 e I:2 so homozigotos.

135

Questo 599 A figura a seguir apresenta uma genealogia hipottica.

1.5.1.4

(01) Na genealogia esto representadas 2 geraes. (02) O padro da herana desta doena autossmico dominante. (04) Os indivduos I - 1, II - 3 e III - 3 podem ser homozigotos. (08) Do casamento consangneo, apresentado na genealogia, existe 33,3% de possibilidade de nascer um descendente com a doena. (16) III - 3 e III - 4 tm 50% de probabilidade de terem um descendente portador da doena. (32) A doena s se manifesta nas mulheres, portanto est ligada ao cromossomo X. Questo 601

Com relao a essa figura CORRETO afirmar que: (01) Os indivduos II - 3 e II - 4 representam, respectivamente, um homem e uma mulher. (02) Os indivduos I - 1 e II - 2, por exemplo, so indivduos afetados pela caracterstica que est sendo estudada, enquanto II - 1 e III - 3 no o so. (04) III - 1 neto(a) de I - 1 e I - 2. (08) III - 2 sobrinho(a) de II - 5. (16) II - 3 no tem nenhuma relao gentica com I - 2. (32) II - 1 mais jovem do que II - 5. (64) Com exceo de II - 3, os demais indivduos da segunda gerao so irmos. Questo 600 Na genealogia a seguir, os indivduos que manifestam uma determinada doena hereditria so mostrados em preto. Com base na anlise da mesma, assinale a(s) proposio(es) CORRETA(S).

1.5.1.4

A anemia falciforme causada pela presena de uma hemoglobina anormal. Essa doena herdada como autossmica recessiva. Considerando o heredograma apresentado inicialmente os indivduos I - 2 e I - 3 forem heterozigotos e os indivduos I - 1 e I - 4 forem homozigotos normais, quem poder ser afetado pela doena? a) Apenas III - 1 e III - 2. b) Apenas II - 1 e II - 3. c) Apenas II - 2 e II - 4. d) II - 1, II - 2, II - 3 e II - 4. e) II - 1, II - 3, III - 1 e III - 2. Questo 602 Os heredogramas a seguir apresentam o padro de herana de um mesmo carter em cinco diferentes famlias, identificadas por 1, 2, 3, 4 e 5. Os crculos representam as mulheres e os quadrados, os homens. Os smbolos cheios indicam que o indivduo portador do carter.

1.5.1.4

136

1.5.1.4

A probabilidade do casal I x II ter uma criana mope a) imprevisvel, porque a mulher tanto pode ser homozigota como heterozigota. b) nula, porque a mulher tem o gene dominante em homozigose. c) 1/2, porque 50% dos gametas da mulher transportam o gene recessivo. d) 1/4, porque o casal j tem trs filhos com viso normal. e) 1/4, porque o gene para a miopia recessivo. Questo 604

upondo que no haja mutao, analise os heredogramas e assinale a alternativa correta. a) A famlia l permite concluir que se trata de um carter dominante ligado ao cromossomo X. b) A famlia 2 permite concluir que se trata de um carter autossmico recessivo. c) A famlia 3 permite concluir que se trata de um carter recessivo, ligado ao cromossomo X. d) A famlia 4 permite concluir que se trata de um carter recessivo, ligado ao cromossomo Y. e) A famlia 5 mostra que o carter no pode ser controlado por gene ligado ao cromossomo X. Questo 603 O esquema mostra a genealogia de uma famlia. Os smbolos escuros representam os indivduos mopes, e os claros os indivduos de viso normal.

O diagrama representa o padro de herana de uma doena gentica que afeta uma determinada espcie de animal silvestre, observado a partir de cruzamentos controlados realizados em cativeiro.

1.5.1.4

A partir da anlise da ocorrncia da doena entre os indivduos nascidos dos diferentes cruzamentos, foram feitas as afirmaes seguintes. I. Trata-se de uma doena autossmica recessiva. II. Os indivduos I-1 e I-3 so obrigatoriamente homozigotos dominantes. III. No h nenhuma possibilidade de que um filhote nascido do cruzamento entre os indivduos II-5 e II-6 apresente a doena. IV. O indivduo III-1 s deve ser cruzado com o indivduo II-5, uma vez que so nulas as possibilidades de que desse cruzamento resulte um filhote que apresente a doena. verdadeiro o que se afirma em a) I, apenas. b) II e III, apenas. c) I, II e III, apenas. d) I e IV, apenas. e) III e IV, apenas.
137

1.5.1.4

Questo 605 Na espcie humana h um tipo de doena hereditria muito rara denominada Aquiropodia, que determinada por um par de genes. No heredograma a seguir, os aquirpodos esto representados por smbolos hachurados.

1.5.1.4

1.5.1.4 ual a probabilidade de o casal II.1 - II.2 vir a ter uma criana com mucoviscidose? a) 1/8 b) 1/4 c) 1/3 d) 1/2 e) 2/3 Questo 607 Para analisar heredogramas de famlias de seres humanos, os principais critrios para a identificao de um gene recessivo autossmico so aqueles em que o nmero de: a) homens afetados diferente do nmero de mulheres afetadas; a caracterstica deve aparecer em todas as geraes; o indivduo afetado tem pelo menos um pai afetado b) homens e mulheres afetados aproximadamente igual; a caracterstica deve aparecer em todas as geraes; o indivduo afetado tem pelo menos um pai afetado c) homens e mulheres afetados aproximadamente igual; os indivduos afetados tm geralmente pais normais; cerca de 25% da prole de pais portadores do gene deve apresentar a caracterstica d) homens e mulheres afetados aproximadamente igual; os indivduos afetados tm geralmente pais normais; cerca de 75% da prole de pais portadores do gene deve apresentar a caracterstica e) homens afetados maior do que o de mulheres afetadas; a caracterstica deixa de aparecer em vrias geraes; o indivduo afetado tem pais afetados Questo 608 O popular "Teste-do-pezinho" feito em recm-nascidos pode detectar a doena fenilcetonria. Tal doena deve-se presena de uma enzima defeituosa que no metaboliza
138

om base na anlise do heredograma, assinale a afirmativa INCORRETA. a) Pode-se dizer que a Aquiropodia condicionada por um alelo recessivo a. b) Pode-se assumir que os indivduos II.1 e II.5 possuem o gentipo AA, j que a condio herdada em anlise muito rara. c) No possvel ter certeza sobre o gentipo de alguns indivduos, como o caso dos indivduos II.3 e III.5. d) Os pais dos aquirpodos so primos. e) O gentipo dos indivduos IV.2 e IV.4 aa. Questo 606 A mucoviscidose uma doena gentica grave que associa problemas digestivos e respiratrios. Os pulmes das pessoas afetadas apresentam um muco espesso que promove infeces bacterianas. Observe e analise o esquema a seguir, que representa a rvore genealgica de uma famlia onde alguns indivduos so afetados pela doena.

corretamente o aminocido fenilalanina, cuja ingesto provoca retardamento mental. Na genealogia a seguir, os indivduos que apresentam fenilcetonria esto em negro. Sabendo-se que a determinao do carter se deve apenas a um par de genes autossmicos, determine o cruzamento que permite diagnosticar a recessividade do gene que condiciona a fenilcetonria e a probabilidade de nascer uma menina afetada a partir do cruzamento 12 X 18. a) C e 50% b) C e 25% c) B e 6,25% d) B e 8,25% e) C e 75%

d) 1/12 e) 2/3 Questo 611 Em drosfilas, o carter asa vestigial recessivo em relao ao carter asa longa. Um macho puro de asa longa cruzado com uma fmea de asa curta. Um indivduo de F1 retrocruzado com a fmea parental e se obtm 480 larvas. Supondo que todas sofram metamorfose, o nmero esperado de indivduos de asa curta de: a) 480. b) 120. c) 180. d) 360. e) 240. Questo 612 Estudos genticos permitiram verificar que um casal tem 1/4 de probabilidade de ter um descendente com uma determinada anomalia. Esse casal tem __________ de probabilidade de ter um descendente do sexo masculino e portador da disfuno gentica mencionada. a) 2/3. b) 3/9. c) 1/8. d) 2/5. e) 1/25. Questo 613 Sabe-se que o albinismo determinado pela ao de um gene recessivo autossmico. Considere um casal normal que teve 6 crianas todas normais. Sabendo-se que o av paterno e a av materna das crianas eram albinos, podemos afirmar com certeza que a probabilidade de um novo filho vir a ser albino (sem considerar o sexo), ser: a) 0% b) 25% c) 50% d) 75% e) 100%

1.5.1.4

Questo 609 A fenilcetonria uma doena com herana autossmica recessiva. Em certa comunidade europia, uma em cada 20 pessoas com fentipo normal heterozigtica quanto ao gene que determina a fenilcetonria. Em 800 casamentos ocorridos entre membros sadios dessa comunidade, qual o nmero esperado de casamentos com risco de gerar crianas fenilcetonricas? a) 2. b) 8. c) 16. d) 40. e) 80. Questo 610 Um casal, em que ambos so polidctilos, tem uma filha tambm polidctila e um filho normal. A probabilidade de o casal vir a ter uma filha normal de: a) 1/4 b) 1/6 c) 1/8

139

Questo 614 Admita que uma determinada doena neurodegenerativa que provoca convulses e leve morte em pouco mais de 10 meses seja determinada por um gene dominante. Essa doena manifesta-se tardiamente como representado no grfico a seguir:

Questo 616 Fenilcetonria uma doena hereditria humana resultante da inabilidade do organismo de processar o aminocido fenilalanina, que est presente nas protenas da dieta humana, e causada por um alelo recessivo por herana Mendeliana simples. Um casal decide ter um filho, mas consulta um geneticista porque o homem tem uma irm com fenilcetonria, e a mulher tem um irmo com esta mesma doena. No h outros casos conhecidos nas famlias. A probabilidade de sua primeira criana ter fenilcetonria de: a) 1/2. b) 1/4. c) 1/9. d) 2/3. e) 4/9. Questo 617 Em determinada planta, flores vermelhas so condicionadas por um gene dominante e flores brancas por seu alelo recessivo; folhas longas so condicionadas por um gene dominante e folhas curtas por seu alelo recessivo. Esses dois pares de alelos localizam-se em cromossomos diferentes. Do cruzamento entre plantas heterozigticas para os dois caracteres resultaram 320 descendentes. Desses, espera-se que o nmero de plantas com flores vermelhas e folhas curtas seja a) 20. b) 60. c) 160. d) 180. e) 320. Questo 618 Na espcie humana, a habilidade para o uso da mo direita condicionada pelo gene dominante E , sendo a habilidade para o uso da mo esquerda devida a seu alelo recessivo e . A sensibilidade feniltiocarbamida (PTC) condicionada pelo gene dominante I, e a insensibilidade a essa substncia devida a seu alelo recessivo i . Esses dois pares de alelos apresentam segregao independente. Um homem canhoto e sensvel ao PTC, cujo pai era insensvel, casa-se com uma mulher destra, sensvel, cuja me era canhota e insensvel.
140

1.5.1.5

e um casal com 35 anos tiver um filho, a chance de a criana vir a manifestar a doena corresponde a a) 0 %. b) 25%. c) 50%. d) 75%. e) 100%. Questo 615 A anemia falciforme uma doena hemoltica grave cujas manifestaes clnicas incluem anemia, ictercia, obstruo vascular e infartos dolorosos em vrios rgos como os ossos, o bao e os pulmes, podendo ser fatal se no tratada no incio da infncia. Devido a sua importncia, a deteco de portadores de anemia falciforme est sendo includa, no Rio Grande do Sul, no teste do pezinho. O seu padro de herana autossmico recessivo. Um casal normal que pretende ter um filho consulta um geneticista, j que cada um dos cnjuges tem um irmo com anemia falciforme. Se voc fosse o geneticista, antes de realizar qualquer exame, qual a resposta correta que daria pergunta sobre a probabilidade de nascimento de uma criana com este tipo de anemia? a) 1/2 b) 1/4 c) 1/8 d) 1/9 e) 1/16

A probabilidade de esse casal vir a ter uma criana canhota e sensvel ao PTC de a) 3/4. b) 3/8. c) 1/4. d) 3/16. e) 1/8. Questo 619 Do casamento entre uma mulher albina com cabelos crespos e um homem normal com cabelos crespos, cuja me albina, nasceram duas crianas, uma com cabelos crespos e outra com cabelos lisos. A probabilidade de que uma terceira criana seja albina com cabelos crespos : a) 75% b) 50% c) 37,5% d) 25% e) 12,5% Questo 620 O cruzamento entre duas linhagens de ervilhas, uma com sementes amarelas e lisas (VvRr) e outra com sementes amarelas e rugosas (Vvrr), originou 800 indivduos. Quantos indivduos devem ser esperados para cada um dos fentipos obtidos? a) amarelas-lisas = 80; amarelas-rugosas = 320; verdes-lisas = 320; verdes-rugosas = 80. b) amarelas-lisas = 100; amarelas-rugosas = 100; verdes-lisas = 300; verdes-rugosas = 300. c) amarelas-lisas = 200; amarelas-rugosas = 200; verdes-lisas = 200; verdes-rugosas = 200. d) amarelas-lisas = 300; amarelas-rugosas = 300; verdes-lisas = 100; verdes-rugosas=100. e) amarelas-lisas = 450; amarelas-rugosas = 150; verdes-lisas = 150; verdes-rugosas=50. Questo 621 Em ervilha, o gene que determina a forma lisa da vagem (C) dominante sobre o gene que determina vagens com constries (c). O gene que determina plantas de altura normal (H) dominante sobre o gene que determina plantas ans (h). Cruzando-se plantas CCHH com plantas CcHh, espera-se obter na descendncia: a) 50% de plantas ans com vagens lisas e 50% de plantas

de altura normal com vagens com constries. b) 100% de plantas ans com vagens com constries. c) 100% de plantas de altura normal com vagens com constries. d) 100% de plantas ans com vagens lisas. e) 100% de plantas de altura normal com vagens lisas. Questo 622 Um homem albino e de olhos claros casa-se com uma mulher de pele normal e de olhos escuros. Deste casal, nasce uma criana albina e de olhos claros. Qual o gentipo dos pais da criana? a) aacc, AaCc, aacc. b) Aacc, AACC, Aacc. c) AaCC, AaCc, AaCC. d) aaCC, aacc, aacc. e) aacc, AaCc, AaCc. Questo 623 Observe o heredograma a seguir:

1.5.2.1

141

Sabendo-se que a miopia e o uso da mo esquerda so condicionados por genes recessivos, considere as seguintes afirmaes: I - Os indivduos 2 e 4 tm o mesmo gentipo. II - Se o indivduo 3 se casar com um homem de viso normal (heterozigoto) e canhoto, tero 25% de chance de ter uma filha canhota e de viso normal. III - O indivduo 5 heterozigoto para o gene do uso da mo esquerda e o indivduo 6 heterozigoto para o gene da miopia. Assinale: a) se todas as afirmativas forem corretas. b) se somente as afirmativas I e III forem corretas. c) se somente as afirmativas II e III forem corretas. d) se somente as afirmativas I e II forem corretas. e) se somente a afirmativa II for correta. Questo 624 Sabendo-se que a miopia e o uso da mo esquerda so condicionados por genes recessivos, analise a genealogia a seguir e responda.

diferentes, ento, a probabilidade do casal ter outra criana normal para as duas caractersticas : a) 1 b) 1/16 c) 3/16 d) 9/16 e) 0 Questo 626 A fenilcetonria e a miopia so doenas decorrentes da ao de genes autossmicos recessivos. Do casamento entre uma mulher normal, filha de me com fenilcetonria e pai mope, com um homem normal para fenilcetonria e mope, nasceu uma criana de viso normal e fenilcetonrica. A probabilidade desse casal ter uma criana normal para as duas caractersticas : a) 1/8 b) 1/2 c) 3/8 d) 7/8 e) 3/4 Questo 627 Em ervilhas, os genes que determinam sementes lisas e amarelas so dominantes em relao aos genes que determinam sementes rugosas e verdes. Considerando uma planta de sementes lisas e amarelas, dibrida, assinale a alternativa que apresenta a porcentagem de gametas produzidos por essa planta com pelo menos um gene dominante. a) zero b) 75% c) 50% d) 12,5% e) 25% Questo 628 Qual a probabilidade de um casal de duplo heterozigotos para dois pares de genes autossmicos com segregao independente vir a ter um descendente com apenas uma caracterstica dominante? a) 15/16 b) 9/16 c) 6/16 d) 3/16
142

1.5.2.1

A probabilidade do casal 4 x 5 ter uma criana dibrida : a) 1/8 b) 3/16 c) 1/16 d) 1/4 e) 1/2 Questo 625 Um casal, ambos polidctilos (com mais de 5 dedos) e de viso normal, tem uma criana normal para polidactilia, mas mope. Considerando-se que ambas as anomalias so autossmicas e os respectivos genes esto em cromossomos

e) 1/16 Questo 629 Considere que em cavalos a colorao do plo resulta da ao de dois pares de genes autossmicos localizados em cromossomos no homlogos. O gene M condiciona cor preta e seu alelo m, cor marrom; o gene B determina colorao uniforme e seu alelo b, manchas brancas em qualquer cor de pelagem. Um macho preto com manchas brancas (I), cujo pai era marrom uniforme (II), cruzado com uma fmea marrom com manchas brancas (III), cuja me era preta uniforme (IV). Assinale, a seguir, a alternativa que contm os gentipos dos indivduos mencionados. a) I - (mmBb), II - (Mmbb), III - (MmBb), IV - (mmbb) b) I - (Mmbb), II - (mmBb), III - (mmBb), IV - (Mmbb) c) I - (MMbb), II - (mmBb), III - (mmbb), IV - (MmBb) d) I - (mmbb), II - (MmBb), III - (Mmbb), IV - (mmBb) e) I - (Mmbb), II - (mmBb), III - (mmbb), IV - (MmBb) Questo 630 Considere que a surdez no homem esteja relacionada a dois pares de genes (Dd - Ee) localizados em cromossomos no homlogos. Os indivduos homozigotos dd ou ee so surdos; os indivduos com audio normal possuem, pelo menos, um gene D e um E. Qual a probabilidade de um casal DdEE ddEe vir a ter uma criana com surdez? a) 0% b) 25% c) 50% d) 75% e) 100% Questo 631 As flores de uma determinada planta podem ser vermelhas ou amarelas. Dois pares de genes (Vv e Aa) determinam essa caracterstica: plantas V_A_ produzem flores vermelhas e plantas V_aa, vvA_ ou vvaa, flores amarelas. Na descendncia do cruzamento VvAa x VvAa espera-se encontrar uma proporo fenotpica de a) 1 vermelha: 1 amarela b) 9 amarelas: 7 vermelhas c) 9 vermelhas: 7 amarelas d) 15 amarelas: 1 vermelha

e) 15 vermelhas: 1 amarela Questo 632 O esquema abaixo representa o ncleo de uma clula de um organismo com 2n=4 cromossomos. Os alelos de cinco genes esto indicados por letras.

1.5.2.1

os pares de alelos abaixo aplica-se a segunda lei de Mendel SOMENTE a a) Aa e Mm b) Aa e Dd c) Aa e Nn d) Bb e Nn e) Dd e Mm Questo 633 Um pesquisador averiguava a transmisso de caracteres em vegetais ao longo de geraes, determinados por genes que se segregavam independentemente. Cruzando dois indivduos homozigotos, sendo um dominante e outro recessivo, ele obteve a primeira linhagem, na qual promoveu autofecundao. Como resultado, obteve quatro tipos de fentipos, na proporo de 9:3:3:1. Quantos caracteres esse pesquisador estudava? a) 1 b) 2 c) 3 d) 4 e) 5 Questo 634 Assinale a alternativa que indica os gentipos dos pais que tm ou podero ter filhos nas seguintes propores ou percentuais:

143

- 25% de filhos canhotos, podendo ter olhos castanhos ou azuis. - 75% de filhos destros, podendo ter olhos castanhos ou azuis. - 25% de filhos com olhos azuis, podendo ser destros ou canhotos. - 75% de filhos com olhos castanhos, podendo ser destros ou canhotos. Dados: gen para olhos castanhos - C gen para olhos azuis - c gen para mo destra - D gen para mo canhota - d a) CCDD e CCDD b) ccdd e ccdd c) CCdd e ccDD d) CcDd e CcDd e) CcDd e ccdd Questo 635 Foram analisadas, em uma famlia, duas caractersticas autossmicas dominantes com segregao independente: BRAQUIDACTILIA (dedos curtos) e PROGNATISMO MANDIBULAR (projeo da mandbula para frente). As pessoas indicadas pelos nmeros 1, 3, 5 e 6 so braquidctilas e prognatas, enquanto 2 e 4 tm dedos e mandbula normais.

Questo 636 Em uma planta com autopolinizao so estudados dois pares de genes - A, a e B, b - com segregao independente. Suponha que um exemplar da planta produza todos os esporos femininos com constituio gentica AB e todos os esporos masculinos com constituio ab. Como, por meio do processo de mitose, os esporos do origem gerao gametoftica, espera-se que a) um dos ncleos gamticos do tubo polnico tenha constituio a e o outro constituio b. b) a oosfera (gameta feminino) tenha constituio AB ou ab. c) o endosperma, sendo triplide, tenha constituio AaB ou Aab. d) o zigoto tenha constituio AB ou ab. e) o embrio tenha constituio AaBb. Questo 637 Em humanos a polidactilia condicionada por um gene dominante, sendo os indivduos homozigotos recessivos portadores de ps e mos normais (com 5 dedos cada). Por sua vez, o albinismo condicionado por um gene recessivo, sendo que o alelo dominante produz em seus portadores pigmentao normal. Ambos os locos citados so autossmicos. Considere este caso: Antnio, um homem com ps e mos normais, porm albino, casa-se com Maria, mulher normal para o albinismo, polidctila a e filha de um homem homozigoto e normal para os dois caracteres e de uma mulher albina e polidctila. A partir das informaes anteriores, assinale a alternativa CORRETA. a) Todos os filhos desse casal devero ser albinos. b) No existe qualqueir chance de nascer um filho polidctilo dessa relao. c) Antnio poder produzir 2 tipos de gametas diferentes para essas caractersticas. d) A me de Maria , obrigatoriamente, homozigota para as duas caractersticas. e) Maria produzir gametas de 4 tipos diferentes para essas caractersticas.
144

1.5.2.1

probabilidade de o casal 5x6 ter um descendente simultaneamente braquidctilo e prognata de a) 1/16 b) 3/16 c) 9/16 d) 3/4 e) 1/4

Questo 638 Do cruzamento entre dois indivduos portadores do gentipo CcDd, a probabilidade de ocorrncia na F de indivduos com o mesmo gentipo dos pais, : a) zero b) 1/2 c) 1/4 d) 1/8 Questo 639 Na genealogia a seguir, est representada a herana de duas caractersticas determinadas por genes autossmicos. uais so os indivduos que seguramente produzem um s tipo de gameta? a) 6, 7, 8, 9, 13 e 14 b) 6, 8, 11, 14 e 16 c) 5, 9, 10, 12 e 15 d) 3, 4, 8, 9 e 15 e) 1, 2, 3, 4 e 13 Questo 641 Em coelhos, o gene P produz pelagem preta e o seu alelo recessivo p, pelagem parda desde que esteja presente o gene A. Os animais aa so sempre albinos. Considerando que ocorra segregao independente entre esses genes, a partir do cruzamento PpAa x ppaa espera-se uma proporo fenotpica de a) 1 preto: 1 pardo: 2 albinos. b) 1 preto: 1 pardo. c) 1 preto: 1 albino. d) 1 preto: 3 albinos. e) 1 pardo: 3 albinos. Questo 642 Numa ave domstica, o gene C condiciona plumagem branca e o seu alelo recessivo, plumagem colorida; o gene P determina patas com plumas e o seu alelo recessivo, patas sem plumas. Esses pares de genes so autossmicos e segregam-se independentemente. Uma ave branca com patas com plumas, homozigota para os dois pares de genes, foi cruzada com uma colorida com patas sem plumas. Se os decendentes obtidos forem cruzados entre si, espera-se que a proporo de aves homozigotas para os dois pares de genes seja de a) 9/16 b) 6/16 c) 4/16
145

1.5.2.1

1.5.2.1

uais so os indivduos obrigatoriamente heterozigotos para as duas caractersticas? a) 6, 7, 13 e 14 b) 5, 8, 9, 12 e 15 c) 1, 2, 3, 4, 7 e 13 d) 6, 9, 10, 11, 14, 15 e 16 e) 1, 2, 3, 4, 7, 9, 13 e 15 Questo 640 Na genealogia a seguir, est representada a herana de duas caractersticas determinadas por genes autossmicos.

d) 3/16 e) 1/16 Questo 643 No homem, a polidactilia um carter dominante e a miopia, uma anomalia recessiva. Os genes responsveis por essas caractersticas situam-se em autossomos e apresentam segregao independente. Uma mulher com polidactilia e miopia, cuja me era normal para as duas caractersticas, casada com um homem normal, cujo pai era mope. A probabilidade deste casal ter uma criana com polidactilia e miopia a) 0% b) 25% c) 50% d) 75% e) 100% Questo 644 No cruzamento entre indivduos heterozigotos para dois pares de genes que se segregam independentemente, espera-se que a proporo de descendentes heterozigotos para apenas um par de genes seja a) 9/16 b) 1/2 c) 1/4 d) 3/16 e) 1/16 Questo 645 Plantas de gentipo AaBb foram intercruzadas. Sabendo-se que os alelos representados por letras maisculas so dominantes e que os no-alelos sofrem segregao independente, os nmeros de gentipos e de fentipos diferentes entre os descendentes desses cruzamentos so, respectivamente, a) 3 e 2 b) 6 e 3 c) 9 e 4 d) 12 e 8 e) 16 e 9

Questo 646 Em ces, latir ou no latir durante a corrida so caractersticas definidas por um par de genes allicos. O mesmo ocorre para os caracteres orelhas eretas ou orelhas cadas. Latir enquanto corre e possuir orelhas eretas so caractersticas dominantes, enquanto no latir durante a corrida e possuir orelhas cadas so recessivas. Considere o cruzamento entre um casal de ces heterozigotos para ambos os pares de alelos. Neste caso, a probabilidade de que nasam filhotes que latem enquanto correm e que possuem orelhas cadas , aproximadamente, de: a) 6,2% b) 18,7% c) 31,2% d) 43,7% Questo 647 Em tomateiros, a cor do hipoctilo prpura condicionada por um alelo dominante e a cor verde, pelo alelo recessivo; a folha recortada determinada por um alelo dominante e a lisa, pelo alelo recessivo. Esses genes esto localizados em cromossomos que se segregam independentemente. Atravs do intercruzamento de plantas duplo-heterozigticas, foram obtidos 480 descendentes. Dentre esses, o nmero esperado de indivduos com hipoctilo prpura e folhas lisas a) 30 b) 90 c) 160 d) 240 e) 270 Questo 648 Numa dada espcie de papagaio, existem quatro variedades: verdes, azuis, amarelos e brancos. Os papagaios verdes so os nicos normalmente encontrados na natureza. Os azuis carecem de pigmento amarelo; os amarelos carecem de grnulos de melanina, e os brancos no tm nem melanina azul nem pigmento amarelo nas penas. Quando se cruzam papagaios verdes silvestres com os de cor branca, geram-se papagaios verdes na primeira gerao (F1). O cruzamento da F1 gera os quatro tipos de cores na F2. Considerando-se que os genes para a melanina e o
146

pigmento amarelo se encontram em cromossomos diferentes, a freqncia esperada de cada um dos tipos de papagaio a) 9 papagaios brancos; 3 verdes; 3 amarelos; 1 azul. b) 4 papagaios amarelos; 2 verdes; 1 azul; 1 branco. c) 9 papagaios verdes; 3 amarelos; 3 azuis; 1 branco. d) 1 papagaio verde; 1 amarelo; 1 azul; 1 branco. e) 9 papagaios azuis; 4 amarelos; 4 brancos; 1 verde. Questo 649 Em bovinos, a pelagem colorida determinada pelo alelo H, enquanto o alelo h determina a pelagem branca. Outro gene determina a pigmentao da pelagem na cor vermelha (b) ou preta (B). O cruzamento entre um touro de pelagem preta (HhBb) com uma vaca de pelagem preta (HhBb) produzir uma prole com: a) 100% de animais com pelagem preta, pois o gene para a cor dominante. b) 100% de animais com pelagem branca, pois o gene para a cor episttico. c) 12 animais com pelagem branca : 1 com pelagem vermelha : 3 com pelagem preta. d) 4 animais com pelagem branca : 3 com pelagem vermelha : 9 com pelagem preta. e) 9 animais com pelagem preta : 7 com pelagem vermelha. Questo 650 Um criador fez cruzamentos entre porquinhos-da-ndia para estudar as caractersticas: cor e tamanho do plo. Observou os seguintes resultados: GERAO P: plo preto curto X plo marrom longo GERAO F: plo preto curto GERAO F: 81 plo preto curto 27 plo preto longo 27 plo marrom curto 09 plo marrom longo Com base nesses resultados, INCORRETO afirmar que

a) as caractersticas plo preto e curto so dominantes. b) as duas caractersticas segregam-se independentemente. c) os indivduos da gerao F1 so homozigotos. d) os indivduos da gerao P formam um s tipo de gameta. Questo 651 A cor preta da pelagem dos ces da raa 'Cocker Spaniel' governada por um alelo dominante V e a cor vermelha, pelo seu recessivo v. O padro uniforme governado pelo alelo dominante que segrega independentemente no locus M, e o padro malhado, por seu alelo recessivo m. Um macho preto foi cruzado com fmeas genotipicamente iguais entre si e fenotipicamente iguais a ele. Entre as vrias ninhadas foram vendidos apenas os filhotes malhados de vermelho, que eram em nmero de cinco. Quantos filhotes do total nascido das vrias ninhadas, se espera que sejam fenotipicamente idnticos ao pai, quanto s caractersticas consideradas? a) 9 b) 16 c) 30 d) 45 e) 80 Questo 652 Quando se estuda uma clula meitica duplo-heterozigota AaBb e se diz que, para esses genes, est ocorrendo segregao independente, INCORRETO afirmar que a) os cromossomos de origem materna e paterna que contm esses genes podem combinar-se livremente. b) pode ocorrer recombinao entre os genes A e B. c) os genes A e B que se situam em diferentes pares de homlogos distribuem-se ao acaso em diferentes gametas. d) os genes A e B esto em grupos de ligao separados. e) os genes A e B no so alelos. Questo 653 Em porcos, a cor dos plos pode ser branca (P_) ou preta (pp), e o tipo de casco determinado por alelos que segregam em outro cromossomo, sendo que F_ condiciona casco indiviso e ff, casco fendido. Se porcos dibridos so cruzados entre si e produzem, entre vrias ninhadas, 64 descendentes, quantos desses apresentaro fentipo diferente dos pais?
147

a) 4. b) 16. c) 28. d) 36. e) 60. Questo 654 O esquema a seguir representa o cruzamento entre duas variedades puras de ervilha-de-cheiro ('Lathyrus odoratus') de flor branca. A F1 resultante apresentou 100% das ervilhas com flores avermelhadas. Aps autofecundao das plantas F1, foram produzidas 371 plantas com flores avermelhadas e 287 com flores brancas, na gerao F2.

estiverem localizados em cromossomos diferentes. III - A lei da segregao independente (2 lei) est relacionada s conseqncias do arranjo, ao acaso, de pares de cromossomos homlogos na placa metafsica, na meiose. Est(o) correta(s): a) somente I. b) somente I e II. c) somente I e III. d) somente II e III. e) I, II e III. Questo 656 A mosca-de-fruta 'Drosophila melanogaster' pode apresentar asas vestigiais ou longas e corpo cinza ou bano. Cruzando-se um macho de corpo cinza e asas vestigiais com uma fmea de corpo bano e asas longas (parentais P) obteve-se F que deu origem a F atravs da autofecundao, como mostra a figura a seguir.

1.5.2.1

nalise este padro de herana e assinale a afirmativa CORRETA: a) Trata-se de um exemplo tpico da primeira Lei de Mendel. b) Pelos resultados, deduz-se que um padro de herana intermediria. c) A proporo fenotpica 9:7 um padro de segregao independente. d) O gene para a cor avermelhada codominante em relao ao alelo. e) O exemplo de interao gnica j que est envolvido apenas um loco. Questo 655 As afirmativas a seguir relacionam a Gentica Mendeliana Diviso Celular. I - As 1 e 2 Leis de Mendel abordam o comportamento dos genes na formao dos gametas, logo esto relacionadas com o comportamento cromossmico na meiose. II - Dois pares de genes se segregam independentemente, se

1.5.2.1

148

Aps a anlise dos resultados dos cruzamentos, foram feitas as afirmativas abaixo. I - A probabilidade de ocorrncia do mesmo gentipo dos indivduos de F em F de 4/16. II - Os genes para cor do corpo e pra tipo de asa esto localizados num mesmo cromossoma. III - Em F, a probabilidade de ocorrncia de homozigose dominante a mesma de homozigose recessiva. IV - O gene para corpo bano s est presente na gerao P e em parte de F. V - Os genes para cor do corpo e forma das asas segregam-se independentemente durante a formao dos gametas. As afirmativas corretas so: a) I, II e IV, apenas. b) I, II e V , apenas. c) I, III e V , apenas. d) II, III e IV , apenas. e) III, IV e V, apenas. Questo 657 Um casal de surdos teve dois filhos com audio normal. Sabendo-se que a surdez determinada por qualquer dos genes recessivos d ou e, em homozigose, espera-se que o gentipo dos filhos seja a) ddee. b) Ddee. c) DDEE. d) DdEe. e) DDee. Questo 658 Uma abelha rainha tem os seguintes pares de genes alelos que segregam independentemente: AaBbDdEe. Sabendo-se que os zanges surgem de vulos que se desenvolvem por partenognese, quantos gentipos diferentes, relativos a esses quatro pares de genes, podem apresentar os zanges filhos dessa rainha? a) Um b) Dois c) Quatro d) Oito e) Dezesseis

Questo 659 Considere um homem heterozigoto para o gene "A", duplo recessivo para o gene "D" e homozigoto dominante para o gene "F". Considere ainda que todos esses genes situam-se em cromossomos diferentes. Entre os gametas que podero se formar encontraremos apenas a(s) combinao(es): a) AdF. b) AADDFF. c) AaddFF. d) AdF e adF. e) ADF e adf. Questo 660 Uma abelha rainha tem os seguintes pares de genes alelos que se segregam independentemente: AaBBccDdEE. Sabendo-se que os zanges surgem de vulos que se desenvolvem por partenognese, quantos gentipos diferentes, relativos a esses cinco pares de genes podem apresentar os zanges filhos dessa rainha? a) Um. b) Dois. c) Quatro. d) Oito. e) Dezesseis. Questo 661 Do cruzamento de dois indivduos com gentipo AaBbCc, a probabilidade de surgir um descendente com gentipo que apresenta, pelo menos, um gene dominante, Obs.: Considere um tipo de herana mendeliana. a) 1/64 b) 63/64 c) 1/32 d) 1/16 e) 1/4 Questo 662 Os dermatglifos so padres tpicos das cristas drmicas nos dedos e palmas das mos, artelhos e solas dos ps. A figura a seguir mostra padres digitais que formam figuras denominadas de arco, ala ou verticilo. Sabe-se que os padres dermatglifos so de herana multifatorial.

149

Questo 665 No milho, a textura da semente pode ser lisa devido ao alelo "Su" e rugosa devido ao alelo "su". A cor da semente pode ser amarela devido ao alelo "Y" e branca devido ao alelo "y". A planta pode ser alta devido ao alelo "Br" e baixa devido ao alelo "br". Uma planta pura, alta, de semente lisa e amarela, foi cruzada com outra planta pura, baixa, de semente rugosa e branca. Na gerao F, observaram-se 100% das plantas altas, de semente lisa e amarela. Se as plantas da gerao F forem intercruzadas, o nmero de gametas produzidos pelas plantas F e a proporo fenotpica esperada na gerao F ser, respectivamente: a) 4 e 3:3:3:1:1:1 b) 8 e 27:9:9:9:3:3:3:1 c) 8 e 9:3:3:1 d) 16 e 9:3:3:1 e) 16 e 27:9:9:9:3:3:3:1 Questo 666 Considere a segunda lei de Mendel ou lei da distribuio independente e indique os gametas produzidos pelo gentipo aaBbccDdEE. a) a; B; b; c; D; d; E. b) aBcDE; aBcdE; abcDE; abcdE. c) aa; Bb; cc; Dd; EE. d) aaBb; ccDd; aaEE; BbDd. e) aB; bc; cD; dE. Questo 667 Um organismo diplide, com o gentipo AaBBCCDDEE, poder produzir quantos tipos geneticamente distintos de gametas? a) 2 b) 4 c) 8 d) 16 e) 32 Questo 668 O desenho abaixo corresponde ao ncleo de uma clula em metfase de uma espcie cujo nmero n de cromossomos 3. Analisando a figura, correto afirmar:
150

1.5.2.2

Sobre esse assunto, INCORRETO afirmar: a) Quanto mais semelhantes forem as mos de gmeos, maior ser a probabilidade de que eles sejam monozigticos. b) Esses padres podem ser teis ao diagnstico de certas sndromes cromossmicas, como a Sndrome de Down. c) A anlise dos padres digitais no se presta para a determinao de paternidade. d) O nmero de cristas drmicas no varia entre indivduos da mesma famlia. Questo 663 A anlise de 4 genes autossmicos, cada um com um par de alelos, permitiu constatar que Janana tem o gentipo AAbbCCDD e Pedro tem o gentipo aaBBccDD. Para estes 4 genes, quantos tipos diferentes de gametas poderia produzir o filho de Janana e Pedro? a) 4 b) 8 c) 16 d) 32 e) 64 Questo 664 Considere quatro pares de genes que segregam de maneira independente. Nessas condies, um indivduo que apresente o gentipo AaBBCcDD produzir gametas ABCD com a freqncia de: a) 75%. b) 50%. c) 25%. d) 12%. e) 6,25%.

1.5.2.2

1.5.2.2

(01) Em relao aos genes em questo, podero ser formados 8 diferentes tipos de gametas. (02) Em relao aos genes em questo, podero ser formados 4 diferentes tipos de gametas. (04) Como resultado de uma autofecundao, podero ser encontrados 9 gentipos diferentes. (08) Como resultado de uma autofecundao, podero ser encontrados 16 gentipos diferentes. (16) Como resultado de uma autofecundao, podero ser encontrados 64 gentipos diferentes. (32) O sistema em questo poliallico, sendo, portanto, impossvel calcular tanto o nmero de gentipos quanto o de fentipos. Soma ( )

o esperados, apresentando a constituio ABC, a) 30 espermatozides. b) 60 espermatozides. c) 90 espermatozides. d) 120 espermatozides. e) 180 espermatozides. Questo 671 Assinale a alternativa correta. Em experimentos envolvendo trs caractersticas independentes (triibridismo), se for realizado um cruzamento entre indivduos AaBbCc, a freqncia de descendentes AABbcc ser igual a a) 8/64 b) 1/16 c) 3/64 d) 1/4 e) 1/32 Questo 672 Se a mitose ocorre em uma clula de gentipo AaBbCc, onde os trs pares de genes esto em pares de cromossomos distintos, os gentipos das clulas resultantes sero: a) ABC, ABc, aBC, AbC, Abc, abC, abc b) ABC, abc c) Aa, Bb, Cc d) AABBCC, aabbcc e) AaBbCc Questo 673 Se a meiose ocorre numa clula de gentipo AaBbCc, onde os trs pares de genes esto em pares de cromossomos separados, quais sero os gentipos das clulas resultantes? a) Aa, Bb e Cc
151

Questo 669 Indivduos com os gentipos AaBb, AaBB, AaBbCc, AaBBcc, AaBbcc podem formar, respectivamente, quantos tipos de gametas diferentes? a) 4 - 4 - 8 - 8 - 8 b) 4 - 2 - 8 - 4 - 4 c) 2 - 4 -16 - 8 - 8 d) 4 - 2 - 8 - 2 - 4 e) 2 - 4 -16 - 4 - 8 Questo 670 Sessenta clulas de um animal, com a constituio representada na figura, sofrem meiose.

b) ABC e abc c) ABC, ABc, aBC, aBc, AbC, Abc, abC e abc d) AaBbCc e) AABBCC e aabbcc Questo 674 Sabendo-se que a miopia e o uso da mo esquerda so condicionados por genes autossmicos recessivos, considere a genealogia a seguir.

Questo 676 No heredograma a seguir, os indivduos marcados apresentam um tipo de cegueira noturna.

1.5.2.3

1.5.2.3 probabilidade do casal 4X5 ter uma criana de sexo feminino e de viso normal de: a) 1/6. b) 1/4. c) 1/8. d) 1/2. e) 1/3. Questo 677 Um indivduo de sangue tipo B, Rh, filho de pai O, Rh, casa-se com uma mulher de sangue tipo A, Rh, que teve eritroblastose fetal ao nascer e filha de pai do tipo O. A probabilidade de esse casal ter uma criana que possa doar sangue para o pai de: a) 1/2. b) 1/4. c) 3/4. d) zero. e) 1. Questo 678 Na espcie humana, a miopia e a habilidade para a mo esquerda so caracteres condicionados por genes recessivos que se segregam de forma independente. Um homem de viso normal e destro, cujo pai tinha miopia e era canhoto, casa-se com uma mulher mope e destra, cuja me era canhota. Qual a probabilidade de esse casal ter uma criana com fentipo igual ao do pai? a) 1/2 b) 1/4 c) 1/8
152

ssinale a alternativa correta. a) O indivduo 2 deve ser heterozigoto para os alelos dessas duas caractersticas. b) O indivduo 3 deve ter herdado os alelos dessas duas caractersticas apenas de sua me. c) A probabilidade de o casal 1 2 ter uma criana destra e de viso normal de 1/4. d) Todos os descendentes de pai mope e canhoto possuem essas caractersticas. e) A probabilidade de o casal 4 5 ter uma criana mope e canhota de 3/8. Questo 675 Um indivduo daltnico e no mope, filho de pai mope, casa-se com uma mulher normal para ambas as caractersticas. O casal j tem uma filha daltnica e mope. Sabendo que o daltonismo condicionado por um gene recessivo ligado ao sexo e que a miopia uma herana autossmica recessiva, a probabilidade de terem uma menina normal para ambas as caractersticas de: a) 3/16 b) 1/4 c) 1/16 d) 1/2 e) 9/16

d) 3/4 e) 3/8 Questo 679 Em determinada raa animal, a cor preta determinada pelo alelo dominante M e a marrom pelo alelo m, o alelo B condiciona padro uniforme e o b, presena de manchas brancas. Esses dois pares de alelos autossmicos segregam-se independentemente. A partir do cruzamento Mmbb mmBb, a probabilidade de nascer um filhote marrom com manchas a) 1/16 b) 3/16 c) 1/4 d) 1/2 e) 3/4 Questo 680 A diversidade biolgica dos seres vivos est relacionada, principalmente, com a reproduo sexuada. O principal evento responsvel por essa diversidade ocorre durante a formao dos gametas. A figura a seguir demonstra a distribuio independente de cromossomos maternos e paternos, que ocorre durante a meiose, em um organismo onde o nmero haplide (n) igual a 3. Nessas condies, podemos observar que o nmero possvel de gametas (w) em uma espcie igual a 2.

Levando-se em considerao que na espcie humana ocorre a permuta gnica, pode-se afirmar que a melhor expresso para o nmero (w) de gametas possveis est representada em: a) w = 2 b) w > 2 c) w < 2 d) w = 2 e) w 2 Questo 681 A cegueira provocada pela catarata e a extrema fragilidade dos ossos so caractersticas que podem aparecer em seres humanos e resultam da ao de dois genes dominantes autossmicos presentes em cromossomos diferentes. Um homem com catarata e ossos normais cujo pai tem olhos normais, casa-se com uma mulher de olhos livres de catarata mas com ossos frgeis. O pai da mulher tem ossos normais. Assim, pode-se afirmar que um descendente do casal tem: (01) 100% de probabilidade de nascer livre de ambas as anomalias. (02) 50% de probabilidade de vir a sofrer de catarata e ter ossos normais. (04) 25% de probabilidade de vir a ter olhos normais e ossos frgeis. (08) 50% de probabilidade de vir a apresentar ambas as anomalias. (16) 50% de probabilidade de vir a apresentar apenas uma das anomalias. Soma ( )

Questo 682 Sendo um homem de sangue tipo O, pergunta-se: I - Se esse homem casar-se com uma mulher de sangue tipo AB, quais os provveis tipos de sangue dos filhos do casal? II - Se casar-se com uma mulher de sangue tipo A, qual a probabilidade do nascimento de uma criana do tipo AB? A alternativa que responde corretamente s perguntas anteriores : a) (I) - A ou B ou O; (II) - zero b) (I) - O ou A ou B; (II) - 50%
153

1.5.2.3

c) (I) - A ou B; (II) - 50% d) (I) - A ou B; (II) - zero e) (I) - A ou B; (II) - 25% Questo 683 Considere os seguintes dados: - menino de tipo sangneo A, Rh; - me de tipo sangneo B, Rh; - pai sem aglutininas do sistema ABO no sangue, mas possuidor do antgeno Rh. A probabilidade de os pais desse menino terem mais um filho com o mesmo fentipo de seu irmo, levando em conta o sexo, o grupo sangneo e o fator Rh de a) 1/16 b) 1/12 c) 1/8 d) 1/4 e) 1/2 Questo 684 Nas hemcias de um indivduo pertencente ao grupo sangneo B: a) existe o aglutingeno B b) existe o aglutingeno A c) existe a aglutinina A d) existe a aglutinina B e) existem o aglutingeno A e a aglutinina B Questo 685 Um homem de gentipo AB casa-se com uma mulher receptora universal. Os tipos de sangue dos filhos so apenas: a) A e AB b) A e B c) A, B, AB d) A, B, O e) A, O Questo 686 Num caso de investigao de paternidade, foram realizados exames para identificao de grupos sangneos e anlise de DNA. A tabela a seguir resume os resultados parciais da

anlise de grupos sangneos (do menino, de sua me e do suposto pai) e de duas seqncias de DNA (do menino e do suposto pai), correspondentes a um segmento localizado num autossomo e outro no cromossomo X. Considerando apenas a tabela adiante, podemos afirmar que:

1.5.3.1

a) os resultados dos grupos sangneos excluem a possibilidade do homem ser o pai da criana; os outros exames foram desnecessrios. b) os resultados dos grupos sangneos no excluem a possibilidade do homem ser o pai da criana, mas a seqncia de DNA do cromossomo X exclui. c) os resultados dos grupos sangneos e de DNA no excluem a possibilidade do homem ser pai da criana. d) os trs resultados foram necessrios para confirmar que o homem mesmo o pai da criana. e) os resultados de DNA contradizem os resultados dos grupos sangneos. Questo 687 Uma mulher de sangue tipo A, casada com um homem de sangue tipo B, teve um filho de sangue tipo O. Se o casal vier a ter outros 5 filhos, a chance deles nascerem todos com sangue do tipo O a) igual chance de nascerem todos com sangue do tipo AB. b) menor que a chance de nascerem todos com sangue do tipo AB. c) maior que a chance de nascerem todos com sangue do tipo AB. d) menor que a chance de nascerem sucessivamente com sangue do tipo AB, A, B, A e B. e) maior que a chance de nascerem sucessivamente com sangue do tipo AB, B, B, A e A.

154

Questo 688 Para se determinar o tipo sangneo de uma pessoa, foram colocadas trs gotas de seu sangue sobre uma lmina de vidro, adicionando-se, a cada uma, soros anti-A, anti-Rh e anti-B, conforme o esquema adiante. Aps alguns segundos, notou-se aglomerao de hemcias apenas no local onde havia soros anti-B e anti-A.

a) heterozigoto - heterozigoto. b) heterozigoto - homozigoto dominante. c) heterozigoto - homozigoto recessivo. d) homozigoto - heterozigoto. e) homozigoto - homozigoto dominante. Questo 690 Utilizando-se trs lminas de microscopia, foi colocada uma gota de sangue humano em cada uma delas. A cada gota foi juntada igual quantidade de soro anti-A na primeira, soro anti-B na segunda e soro anti-Rh na terceira. Aps a mistura do sangue com os respectivos soros, foi observada aglutinao nas duas primeiras lminas. A partir desses dados podemos afirmar que o indivduo, quanto aos grupos sanguneos ABO e fator Rh, : a) B e Rh positivo. b) AB e Rh negativo. c) A e Rh negativo. d) AB e Rh positivo. e) A e Rh positivo. Questo 691 A herana do sistema ABO do tipo: a) com dominncia. b) quantitativa. c) polialelia. d) pleiotropia. e) polignica. Questo 692 Qual das opes a seguir relaciona os grupos sangneos de um doador universal ideal? a) ARh b) ABRh c) ORh d) ABRh e) ORh Questo 693 Considerando os casamentos a seguir, uma criana de tipo sangneo B, Rh+ poder ser filha:

1.5.3.1

om relao a esses resultados, assinale a opo correspondente ao possvel gentipo da pessoa em teste: a) IIRR b) IIrr c) IiRr d) Iirr e) iiRR Questo 689 No heredograma a seguir esto indicados os fentipos dos grupos sangneos ABO e Rh. O indivduo 6 dever ser, em relao aos locos dos sistemas ABO e Rh, respectivamente:

1.5.3.1

155

1.5.3.1

1.5.3.1

a) somente do casal I. b) do casal I ou do casal IV. c) o casal III ou do casal IV. d) somente do casal II e) do casal I ou do casal II ou do casal III. Questo 694 Jorge, que tem tipo sangneo A, Rh e filho de pai tipo A e me tipo B, recebeu transfuso de sangue de sua mulher Tnia, que filha de pai e me do tipo B. Sabendo-se que Tnia teve eritroblastose fetal ao nascer, a probabilidade do casal ter uma criana do tipo A, Rh : a) 100% b) 25% c) 75% d) 50% e) 0 Questo 695 Uma mulher que possui aglutinina anti-B no seu sangue teve um filho do grupo O. Sabendo-se que o marido tem o aglutinognio B, os gentipos do casal so: a) Ii e Ii. b) II e Ii. c) Ii e Ii. d) II e II. e) Ii e II. Questo 696

A respeito do heredograma acima, que considera o sistema sangneo ABO, assinale a alternativa INCORRETA. a) O indivduo 9 pode ser doador universal. b) O indivduo 7 pertence ao grupo sangneo A. c) O indivduo 6 homozigoto. d) O indivduo 1 receptor universal. e) O indivduo 8 heterozigoto. Questo 697

1.5.3.1

Considere o heredograma acima, que mostra a tipagem ABO e Rh dos indivduos. Sabendo que o casal 56 j perdeu uma criana com eritroblastose fetal, a probabilidade de nascer uma menina do tipo O, Rh de: a) 1/6 b) 1/8 c) 1/2 d) 1/4 e) 1/3 Questo 698 O heredograma a seguir mostra os diferentes tipos sangneos existentes em uma famlia.

156

1.5.3.1

ou negativo; b) TIPO SANGNEO: O, somente; FATOR Rh: positivo, somente; c) TIPO SANGNEO: A ou O; FATOR Rh: negativo ou positivo; d) TIPO SANGNEO: A ou O; FATOR Rh: positivo, somente; e) TIPO SANGNEO: O, somente; FATOR Rh: negativo, somente; Questo 702

ssinale a alternativa que contm, respectivamente, o fentipo e o gentipo do indivduo II.2 a) O - ii b) A - Ii c) A - II d) B - Ii e) AB - II Questo 699 Pais cujo grupo sanguneo so AB e O tm cinco filhos com os seguintes fentipos: dois so O, um A, um B e um AB. Quantos filhos biolgicos tem esse casal? a) 5 b) 4 c) 3 d) 2 e) 1 Questo 700 Uma criana tem tipo sangneo do tipo AB. Os tipos sangneos dos pais biolgicos dessa criana so: a) A e A. b) B e B. c) A e O. d) A e B. e) AB e O. Questo 701 Alexsander no sabe qual o seu grupo sangneo e o seu tipo de Rh. Entretanto sabe que seu pai A+, sua me O+ e seu irmo A-. Assinale a opo que contm o(s) grupo(s) sangneo(s) e o(s) tipo(s) de Rh que Alexsander pode ter: a) TIPO SANGNEO: A, somente; FATOR Rh: positivo

No ambulatrio de uma pequena cidade do interior estava D. Josefa, que precisava urgentemente de transfuso sangnea, mas no se sabia o seu grupo sangneo. Como faltavam anti-soros para a determinao dos grupos sangneos no sistema ABO, Dr. Epaminondas, que do grupo A, usou de um outro recurso: retirou um pouco de seu prprio sangue do qual separou o soro, fazendo o mesmo com o sangue de D. Josefa. O teste subseqente revelou que o soro do Dr. Epaminondas provocava aglutinao das hemcias de D. Josefa, mas o soro de D. Josefa no era capaz de aglutinar as hemcias do Dr. Epaminondas. A partir dos resultados, Dr. Epaminondas pode concluir que D. Josefa apresenta sangue do grupo: a) A b) B c) AB d) O Questo 703 O esquema apresenta uma rvore genealgica de alguns primatas e seus possveis grupos sangneos no sistema ABO, de acordo com a seguinte composio gentica: - Indivduos que apresentem apenas alelo dominante I e no apresentem I pertencem ao grupo A. - Indivduos que apresentem apenas alelo dominante I e no apresentem I pertencem ao grupo B. - Indivduos que apresentem os dois alelos dominantes I e I pertencem ao grupo AB. - Indivduos que apresentem apenas alelos recessivos ii pertencem ao grupo O.

157

Questo 705 Suponha que um grupo de pessoas, pertences a uma determinada seita religiosa, imigrou para uma regio h mais de meio sculo. A populao originria desse grupo vive at hoje no mesmo local, totalmente isolada. Nas tabelas a seguir, so mostradas as freqncias aproximadas dos grupos sangneos do sistema ABO da populao original (tabela 1) e da populao atual (tabela 2).

1.5.3.1

De acordo com o esquema, somente humanos podem apresentar os quatro grupos sangneos no sistema ABO. Considerando-se apenas os antgenos do sistema ABO, correto afirmar, EXCETO: a) Apenas dois dos primatas citados podem apresentar indivduos doadores universais no sistema ABO. b) Orangotangos podem apresentar trs grupos sangneos, mas chimpanzs, apenas dois. c) Apenas dois dos primatas da rvore podem apresentar indivduos receptores universais no sistema ABO. d) Alguns gorilas podem receber sangue de alguns orangotangos, mas no de chimpanzs. Questo 704 Os esquemas mostram as possveis transfuses de sangue tradicionais em relao aos sistemas ABO e Rh.

1.5.3.1

1.5.3.1

Pode-se dizer que os tipos sanguneos mais difceis e mais fceis para receber sangue so, respectivamente: a) O Rh e O Rh b) O Rh e AB Rh c) A Rh e OB Rh d) AB Rh e O Rh

Qual das alternativas a seguir apresenta uma explicao possvel para a mudana na freqncia dos grupos sangneos nessa populao? a) O gene O dominante sobre os genes A e B. Assim, os casamentos entre as pessoas O e A e entre pessoas O e B produzem apenas descendentes pertencentes ao grupo O. b) O gene O dominante sobre os genes A e B. Assim, os casamentos entre pessoas O e A e entre pessoas O e B apresentam 50% de chance de produzir descendentes pertencentes ao grupo O. c) O gene O recessivo e, portanto, o casamento entre pessoas pertencentes ao grupo O origina apenas descendentes do grupo O. d) As pessoas pertencentes ao grupo AB so recessivas e, portanto, apresentam pouca chance de existir numa populao. e) As pessoas pertencentes ao grupo AB s recebem sangue de AB. Essa situao leva a uma menor freqncia dessas pessoas na populao. Questo 706 Observe a rvore genealgica a seguir para o grupo sangneo (ABO) em uma famlia:

158

Legenda: Grupo "A": A/A ou A/O Grupo "B": B/B ou B/O Grupo "AB": A/B Grupo "O": O/O

arque a opo correta: a) o indivduo n 5 pode ser de grupo sangneo "AB" b) o indivduo n 1 do grupo sangneo "AB" c) o indivduo n 6 do grupo sangneo "AB" d) o indivduo n 7 no pode ser filho do casal 56 Questo 708 Uma mulher com grupos sangneos B, N, Rh teve trs crianas com pais distintos: 1.5.3.1 CRIANAS I. O, MN, Rh II. AB, N, Rh III. B, N, Rh PAIS a. A, N, Rh b. A, M, Rh c. B, N, Rh Assinale a alternativa que relaciona corretamente cada criana ao seu pai. a) I - a; II - b; III - c b) I - a; II - c; III - b c) I - b; II - a; III - c d) I - b; II - c; III - a e) I - c; II - b; III - a Questo 709 Sabe-se que, numa famlia, dois irmos so do grupo sangneo A, outro do grupo AB e outro do grupo O. Dos pares de gentipos a seguir, o nico que pode ser dos pais desses indivduos a) ii Ii b) Ii II c) Ii Ii d) II II e) II II Questo 710 Os tipos sangneos do sistema ABO de trs casais e trs crianas so mostrados a seguir. CASAIS I. AB AB
159

OBS: 1. O indivduo 2 mulher do grupo sangneo "A" 2. O indivduo 4 homem do grupo sangneo "B" 3. O indivduo 5 mulher do grupo sangneo "O" Sobre a rvore anterior, marque a opo correta: a) o indivduo 3 do grupo sangneo "AB" b) o indivduo 1 pode ser do grupo sangneo "AB" c) o indivduo 1 do grupo sangneo "A" d) o indivduo 1 do grupo sangneo "O" Questo 707 Observe a rvore genealgica a seguir, para o grupo sangneo ABO em uma famlia:

1.5.3.1

II. B B III. A O CRIANAS a. A b. O c. AB Sabendo-se que cada criana filha de um dos casais, alternativa que associa corretamente cada casal a seu filho a) I - a; II - b; III - c b) I - a; II - c; III - b c) I - b; II - a; III - c d) I - c; II - a; III - b e) I - c; II - b; III - a Questo 711 Uma criana necessita urgentemente de uma transfuso de sangue. Seu pai tem sangue do tipo B e sua me, do tipo O. Que outro(s) tipo(s) de sangue, alm do tipo O, poderia(m) ser utilizado(s) na transfuso, mesmo sem a realizao de teste, sabendo-se que o av paterno da criana tem sangue do tipo AB e sua av paterna tem sangue do tipo O? a) Tipo AB. b) Tipo A. c) Tipo B. d) Tipo A e tipo B. e) Nenhum outro tipo. Questo 712 Na herana do sistema sangneo ABO, h trs alelos autossmicos principais: I (para sangue do tipo A), I (para sangue do tipo B) e i (para sangue do tipo O). Sabe-se, ainda, que I e I so codominantes, ambos dominando sobre i. Uma mulher do tipo A, casada com um homem do tipo B, teve uma filha do tipo O. O homem no quis reconhecer a paternidade alegando infidelidade por parte da mulher. Como na poca em que o fato ocorreu no havia o "exame do DNA", o Juiz recorreu a um geneticista que lhe apresentou um parecer sobre o caso. Assinale a alternativa que contm a concluso correta do geneticista. a) O homem tem razo, pois, por se tratar de um caso de herana ligada ao sexo, a filha dos dois teria que ser, obrigatoriamente, do tipo A.

b) O homem tem razo, pois, pais com tipos A e B, quaisquer que sejam seus gentipos, jamais poderiam ter filhos ou filhas do tipo O. c) O homem no tem razo, pois, pais com tipos A e B, dependendo de seus gentipos, podem ter filhos ou filhas com qualquer um dos tipos sangneos (A, B, AB e O). d) O homem no tem razo, pois, por se tratar de herana autossmica, filhos e filhas teriam que ser, obrigatoriamente, do tipo O. e) O homem tem razo, pois, pais com tipos A e B, s podem ter filhos ou filhas do tipo AB, visto que I e I so codominantes. Questo 713 Mulher branca, submetida inseminao artificial, deu luz gmeos de cor negra. O fato causou polmica, j que o pai tambm branco. A grande dvida saber se houve troca de embries ou apenas de um dos gametas. Adaptado do "Jornal do Brasil", 1 de agosto de 2002 Considere o fato relatado e suponha que a me tenha sangue tipo A e seja filha de pai e me com sangue tipo AB. Nesse caso, o tipo sangneo dos gmeos poderia ser: a) A ou O b) A ou AB c) B ou O d) B ou A e) AB ou O Questo 714 necessrio o conhecimento do tipo sangneo em caso de transfuso. Em relao ao sistema ABO, ( ) indivduos do grupo sangneo O podem doar sangue para pessoas do seu prprio tipo sangneo e para os demais . ( ) indivduos do grupo AB podem receber sangue de qualquer tipo. ( ) indivduos portadores de sangue do tipo A possuem aglutinognios A. ( ) indivduos do grupo B possuem aglutinina anti-A.

160

Questo 715 Alm do teste de DNA, h exames mais simples que podem ajudar a esclarecer dvidas sobre paternidade. Por exemplo, o teste de tipagem sangnea do sistema ABO permite determinar quem no pode ser o pai. Assinale a alternativa que apresenta uma situao em que esse exame assegura a excluso da paternidade: a) O filho do tipo O, a me do tipo O e o suposto pai do tipo A. b) O filho do tipo AB, a me do tipo AB e o suposto pai do tipo O. c) O filho do tipo AB, a me do tipo A e o suposto pai do tipo B. d) O filho do tipo B, a me do tipo B e o suposto pai do tipo O. e) O filho do tipo A, a me do tipo A e o suposto pai do tipo B. Questo 716 O heredograma a seguir representa uma famlia na qual foram determinados os grupos sangneos do sistema ABO para alguns dos membros, e do sistema Rh para todos os membros. Com base nas informaes contidas no heredograma e em seus conhecimentos sobre o assunto, INCORRETO afirmar-se que

a) a probabilidade do indivduo I-2 formar gametas iR de 50%. b) a probabilidade de II-4 ter uma criana com eritroblastose fetal de O%. c) os indivduos Rh positivos da gerao II pertencem ao grupo sangneo A, e os Rh negativos, ao grupo O. d) o indivduo I-1 heterozigoto para uma das caractersticas. e) os indivduos II-3 e II-4 podem apresentar os dois tipos de aglutinina do sistema ABO. Questo 717 Nas situaes em que vtimas de acidentes necessitam de transfuso de sangue, sem que se conhea o tipo sangneo de cada uma delas, recomendvel utilizar-se o tipo "O negativo". CORRETO afirmar que, nesse caso, tal tipo sangneo o mais adequado porque, nas hemceas do doador, esto a) presentes os antgenos correspondentes aos anticorpos do receptor. b) ausentes os anticorpos correspondentes aos antgenos do receptor. c) ausentes os antgenos correspondentes aos anticorpos do receptor. d) presentes os anticorpos correspondentes aos antgenos do receptor. Questo 718 Com relao gentica dos grupos sangneos ABO, pode-se afirmar que: a) existem 16 modalidades de cruzamentos de gametas. b) existem 9 possibilidades de acasalamentos. c) indivduo com grupo sangneo O no pode ser filho de acasalamento de indivduos dos grupos O e AB. d) indivduo do grupo sangneo B no pode ser filho de acasalamento de indivduos dos grupos O e AB. e) indivduo com grupo sangneo AB pode ser filho de acasalamento de indivduos dos grupos O e B. Questo 719 A respeito dos grupos sangneos avalie as proposies abaixo. ( ) Grupo sangneo: A
161

1.5.3.1

Antgenos: A Anticorpos: Anti-B Doa: A, AB Recebe: A, O ( ) Grupo sangneo: B Antgenos: B Anticorpos: Anti-A Doa: B, AB Recebe: B, O ) Grupo sangneo: AB Antgenos: A e B Anticorpos: Anti-A e Anti-B Doa: AB Recebe: AB, A , B, O ) Grupo sangneo: O Antgenos: O Anticorpos: No tem Doa: O, A, B, AB Recebe: O ) Grupo sangneo: A Antgenos: A Anticorpos: Anti-A Doa: A, AB Recebe: A, O Questo 720 Na figura a seguir so mostrados os gentipos e fentipos possveis, considerando-se os alelos I, I e i determinantes dos grupos sangneos do sistema ABO no homem. De acordo com a figura, analise as proposies a seguir.

) Todos os descendentes de um casal de gentipo tipo 2 sero do grupo A e apresentaro em suas hemcias o aglutinognio A. 2) Indivduos do grupo sangneo B de gentipo 3 ou 4 apresentam na membrana de suas hemcias aglutinognio B e, no plasma, aglutinina anti-A. 3) Os descendentes de um casal (gentipo 5) do grupo sangneo AB sero fenotipicamente AB e, como tm em seus gentipos os alelos I e I, apresentam, na membrana de suas hemcias, os antgenos A e B. 4) Indivduos do grupo sangneo O de gentipo 6, apresentam aglutinognios A e B no plasma, mas no tm aglutininas anti-A e anti-B na membrana de suas hemcias. Est(o) correta(s) apenas: a) 2 b) 1 e 4 c) 2 e 4 d) 2 e 3 e) 2, 3 e 4 Questo 721 Trs irmos (Joo, Jos e Maria) realizaram um exame de sangue em laboratrio para identificar os seus tipos sangneos, com o objetivo de verificar a possibilidade de doarem sangue ao pai, que necessitaria de uma transfuso aps uma cirurgia. Um deles (Joo) ficou surpreso ao descobrir seu tipo sangneo - O - e achou que no era filho biolgico do casal que o criou. Seu pai e o irmo apresentam sangue do tipo A e sua me e a irm apresentam sangue do tipo B. Todos so RH. Com base no texto e em seus conhecimentos sobre a herana dos tipos sangneos, correto afirmar que a) Joo no pode ser filho biolgico do casal, pois de acordo com a herana gentica possvel do tipo sangneo, os filhos somente poderiam apresentar sangues dos tipos A, B e AB. Dos filhos biolgicos, somente Jos pode doar sangue ao pai, pois as hemcias de seu sangue apresentam aglutinognio A. b) Joo pode ser filho biolgico do casal, desde que pelo menos um dos pais seja heterozigoto e apresente o alelo responsvel pela presena de aglutininas anti-A e anti-B no plasma. O pai no pode receber sangue de Maria, pois seu sangue apresenta aglutinina anti-B. c) Joo no pode ser filho biolgico do casal, assim como seus dois irmos, pois de acordo com a herana gentica
162

1.5.3.1

possvel do tipo sangneo, os filhos somente poderiam apresentar sangues dos tipos AB. O pai pode receber sangue de Joo e Jos, pois o sangue dele apresenta aglutinina anti-A, assim como o de seus filhos. d) Se Maria engravidar de um homem com o mesmo gentipo para o tipo sangneo de seu irmo Joo, existe a probabilidade de 100% de seu filho ter sangue do tipo B. Porm, se ela engravidar de um homem com o mesmo gentipo para o tipo sangneo de seu irmo Jos, existe a probabilidade de 50% de seu filho ter sangue do tipo AB, 25% do tipo A e 25% do tipo B. e) Joo pode ser filho biolgico do casal, desde que ambos os pais sejam heterozigotos e apresentem o alelo responsvel pela ausncia de aglutinognio. Joo pode doar sangue para seu pai, pois as hemcias do seu sangue no apresentam aglutinognios. Questo 722 Jorge, portador de grupo sangneo AB Rh-, e Jlia, que AB Rh+, tm uma filha, Joana, que aos 3 anos de idade necessita de uma transfuso sangnea. Os exames laboratoriais por hemaglutinao do os seguintes resultados:

b) seus eritrcitos no contm anticorpos anti-A e anti-B. c) seu plasma no contm antgenos A e B. d) seus eritrcitos no contm antgenos A e B. e) seu sangue no contm antgenos nem anticorpos. Questo 724 A herana dos tipos sangneos do sistema ABO constitui um exemplo de alelos mltiplos (polialelia) na espcie humana. Com relao ao sistema ABO CORRETO afirmar que: (01) o tipo O muito freqente e, por este motivo, o alelo responsvel por sua expresso dominante sobre os demais. (02) os indivduos classificam-se em um dos quatro gentipos possveis: grupo A, grupo B, grupo AB e grupo O. (04) existem trs alelos: o I, o I e o i. (08) os alelos I e I so codominantes. (16) se um indivduo do grupo A for heterozigoto, ele produzir gametas portadores de I ou de i. (32) os indivduos de tipo sangneo O possuem aglutinognios em suas hemcias, porm no possuem aglutininas no plasma. (64) em alguns cruzamentos, entre indivduos do grupo A com indivduos do grupo B, possvel nascerem indivduos do grupo O. Questo 725 Em relao ao sistema sangneo ABO, um garoto, ao se submeter ao exame sorolgico, revelou ausncia de aglutininas. Seus pais apresentaram grupos sangneos diferentes e cada um apresentou apenas uma aglutinina. Os provveis gentipos dos pais do menino so a) Ii - ii. b) Ii - ii. c) II - Ii. d) II - II. e) Ii - Ii.

1.5.3.1

Em face dos dados apresentados, assinale a alternativa correta. a) Joana no pode ser filha natural de Jlia. b) Joana no pode receber sangue O Rh-. c) Jorge no pode ser o pai natural de Joana. d) Joana pode receber sangue AB Rh-. e) Joana pode ser homozigota para B. Questo 723 Em uma transfuso sangnea, indivduos do grupo O so considerados doadores universais porque a) seu plasma no contm anticorpos anti-A e anti-B.

163

Questo 726 Para os grupos sangneos do sistema ABO, existem trs alelos comuns na populao humana. Dois (alelos A e B) so co-dominantes entre si e o outro (alelo O) recessivo em relao aos outros dois. De acordo com essas informaes, pode(m)-se afirmar: I. Se os pais so do grupo sangneo O, os filhos tambm sero do grupo sangneo O. II. Se um dos pais do grupo sangneo A e o outro do grupo sangneo B, todos os filhos sero do grupo sangneo AB. III. Se os pais so do grupo sangneo A, os filhos podero ser do grupo sangneo A ou O. Est(o) correta(s) a) apenas I. b) apenas II. c) apenas III. d) apenas I e III. e) I, II e III. Questo 727 Observe a genealogia.

ara o casal (5 e 6) que pretende ter muitos filhos, foram feitas as quatro afirmaes a seguir. I - O casal s ter filhos AB e Rh positivo. II - Para o sistema ABO, o casal poder ter filhos que no podero doar sangue para qualquer um dos pais. III - O casal poder ter filhos Rh positivo, que tero suas hemcias lisadas por anticorpos anti-Rh produzidos durante a gravidez da me. IV - Se for considerado apenas o sistema Rh, o pai poder doar sangue a qualquer um de seus filhos. So corretas, apenas, as afirmaes a) II e IV b) I, II e IV c) II, III e IV d) I, II e III. e) I e III. Questo 728 Em um acidente de carro, trs jovens sofreram graves ferimentos e foram levados a um hospital, onde foi constatada a necessidade de transfuso de sangue devido a forte hemorragia nos trs acidentados. O hospital possua em seu estoque 1 litro de sangue do tipo AB, 4 litros do tipo B, 6 litros do tipo A e 10 litros do tipo O. Ao se fazer a tipagem sangnea dos jovens, verificou-se que o sangue de Carlos era do tipo O, o de Roberto do tipo AB e o de Marcos do tipo A. Considerando apenas o sistema ABO, os jovens para os quais havia maior e menor disponibilidade de sangue em estoque eram, respectivamente, a) Carlos e Marcos. b) Marcos e Roberto. c) Marcos e Carlos. d) Roberto e Carlos. e) Roberto e Marcos. Questo 729 Considerando o casamento entre um homem tipo sangneo A, cujo pai era O, com uma mulher B cuja me era A, assinale a(s) alternativa(s) correta(s). (01) A probabilidade de nascer 1 filha mulher B 3/16. (02) A probabilidade de nascer 1 filho homem O nula. (04) A probabilidade de nascer 1 filho homem e 1 filha mulher AB 9/1024.
164

1.5.3.1

(08) A probabilidade de nascer filho homem AB 1/16. (16) A probabilidade de nascer 1 filho homem A 1/8. (32) A probabilidade de nascer 2 filhas mulheres A 1/1024. Questo 730 Uma mulher Rh casou-se e teve um filho. Numa segunda gestao a criana apresentou um quadro de eritroblastose fetal. Com estes dados, indique qual a opo que apresenta o fentipo para o fator Rh da me, do pai e da criana, respectivamente. a) Me Rh negativo, Pai Rh positivo e Criana Rh positivo. b) Me Rh positivo, Pai Rh positivo e Criana Rh negativo. c) Me Rh positiva, Pai Rh negativo e Criana Rh negativa. d) Me Rh positivo, Pai Rh negativo e Criana Rh positivo. e) Me Rh negativo, Pai Rh positivo e Criana Rh negativo. Questo 731 A observao do esquema a seguir, que representa a genealogia de uma famlia em relao aos grupos sanguneos MN, nos permite afirmar que:

a) Rh positivo e Rh negativo. b) Rh negativo e Rh positivo. c) Rh positivo e Rh positivo. d) Rh negativo e Rh negativo. e) Rh positivo e Rh neutro. Questo 733 A doena hemoltica do recm-nascido um problema causado pela incompatibilidade sangnea entre me e feto. Assinale a alternativa que contm a famlia na qual possvel a ocorrncia da citada doena. a) Me: Pai: 1 beb: 2 beb: b) Me: Pai: 1 beb: 2 beb: c) Me: Pai: 1 beb: 2 beb: Ii Ii II Ii II II II II ii ii ii ii rh Rh Rh Rh rh rh rh rh

Rh rh rh rh Rh rh rh rh rh rh rh rh Rh Rh Rh Rh rh Rh rh rh rh rh rh rh rh rh rh rh rh rh rh rh

1.5.3.2

d) Me: ii Pai: Ii 1 beb: Ii 2 beb: ii e) Me: Ii Pai: ii 1 beb: Ii 2 beb: ii Questo 734

a) sangue MN caracterstica determinada por gene dominante. b) os indivduos 4 e 5 so heterozigotos. c) o casal 3 e 4 poder ter filhos dos trs tipos de grupos sanguneos. d) se o indivduo 5 casar-se com uma mulher de sangue N, todos os filhos sero heterozigotos. e) um prximo filho do casal 6 e 7 poder ser do grupo N. Questo 732 Quanto ao surgimento da eritroblastose fetal, ou doena hemoltica do recm-nascido, podemos afirmar que ela ocorre quando o pai e a me respectivamente apresentam:

Paula, portadora do aglutinognio B e Rh negativo casou-se com Joo, portador dos aglutinognios A e B e Rh positivo. Sabendo-se que a me de Paula no possui aglutinognios e que Joo teve um irmo com doena hemoltica do recm nascido, conclui-se que a probabilidade de o casal ter um filho Rh positivo e sangue tipo A : a) 9/16
165

b) 3/16 c) 1/4 d) 1/8 e) 1/2 Questo 735 Lcia e Joo so do tipo sangneo Rh positivo e seus irmos, Pedro e Marina, so do tipo Rh negativo. Quais dos quatro irmos podem vir a ter filhos com eritroblastose fetal? a) Marina e Pedro. b) Lcia e Joo. c) Lcia e Marina. d) Pedro e Joo. e) Joo e Marina. Questo 736 A afirmao que uma mulher Rh no deve casar-se com um homem Rh: a) correta, pois todos os filhos desse casal sero abortados. b) correta, pois todos os filhos desse casal tero uma doena grave fetal caracterizada por uma anemia profunda (Eritroblastose fetal). c) incorreta, pois o primeiro filho em geral no tem a anemia, mesmo sendo Rh, bem como todos os filhos Rh no sero atingidos pela doena e esta s atinge uma pequena frao de casos em outras gestaes de filhos Rh. d) incorreta, pois filhos Rh, mesmo no caso de glbulos vermelhos atingirem a circulao materna em sucessivas gestaes, no sero atingidos pela Eritroblastose fetal. e) incorreta, pois no existe influncia do fator Rh positivo ou negativo nos casos de Eritroblastose fetal. Questo 737 Uma criana tem gentipo igual ao pai, que receptor universal e teve eritroblastose fetal. Ento INCORRETO afirmar que: a) a me certamente Rh. b) o pai possui gentipo II. c) a me pode pertencer ao tipo sangneo O. d) essa criana certamente heterozigota para o fator Rh. e) a me pode ter gentipo Ii.

Questo 738 O quadro abaixo mostra os resultados das tipagens ABO e Rh de um casal e de seu filho. O sinal + indica reao positiva e o sinal - indica reao negativa.

1.5.3.2

onsidere as seguintes afirmaes: I - Essa mulher poder dar luz uma criana com eritroblastose fetal. II - Em caso de transfuso sangnea, a criana poder receber sangue, tanto da me quanto do pai. III - O gentipo do pai pode ser IIRR. Assinale: a) se somente III estiver correta. b) se somente II estiver correta. c) se somente I estiver correta. d) se somente I e III estiverem corretas. e) se somente II e III estiverem corretas. Questo 739 Indivduos sem antgeno Rh nas hemcias so considerados recessivos. Carlos, que tem Rh e homozigoto, casou-se com Elaine, que tem Rh. Ambos possuem o mesmo grupo sangneo. Fazendo um exame pr-natal e relatando esse fato ao mdico, o mesmo ficou: a) despreocupado e no fez qualquer recomendao relativa ao fato. b) despreocupado, no fez qualquer recomendao, apenas solicitando ao casal que o procurasse no momento da segunda gestao. c) preocupado, recomendando que, logo aps o parto, a me recebesse soro anti-Rh. Numa segunda gravidez, entretanto, disse que esse procedimento no seria mais necessrio. d) bastante preocupado, inclusive pela informao de
166

compatibilidade de grupo sangneo, recomendando bastante ateno em cada gravidez, de maneira que, aps cada parto, a me receba o soro anti-Rh. e) bastante preocupado, dizendo ao casal que a gravidez era de altssimo risco e eles no poderiam mais ter outro filho. Questo 740 Um casal possui o seguinte gentipo para o fator Rh: Pai = Rr; Me = rr. Considerando apenas o fator Rh, a probabilidade de esse casal vir a ter um filho do sexo masculino, com ocorrncia de eritroblastose fetal, : a) 1 b) 1/2 c) 1/3 d) 1/4 e) 1/8 Questo 741 Interpretando a figura a seguir sobre a Doena Hemoltica do recm-nascido (DHR), assinale a afirmativa INCORRETA.

Questo 742 Uma mulher com sangue do tipo A / Rh / MM casada com um homem com tipo sangneo B / Rh / NN. Qual das alternativas abaixo indica o tipo sangneo de uma criana que NO poderia ter sido gerada por este casal? a) A / Rh / NN b) A / Rh / MN c) AB / Rh / MN d) O / Rh / MN e) O / Rh / MN Questo 743 Uma mulher Rh, cujo pai Rh, casada com um homem Rh, cuja me Rh. A probabilidade desse casal vir a ter uma criana Rh de a) 100% b) 75% c) 50% d) 25% e) 0% Questo 744 Um casal teve uma criana com eritroblastose fetal. Assinale a alternativa do quadro abaixo que identifica corretamente os grupos sangneos dessa famlia. a) ME- Rh; PAI - Rh; CRIANA - Rh b) ME- Rh; PAI - Rh; CRIANA - Rh c) ME- Rh; PAI - Rh; CRIANA - Rh d) ME- Rh; PAI - Rh; CRIANA - Rh e) ME- Rh; PAI - Rh; CRIANA - Rh

1.5.3.2

a) A placenta normalmente funciona como uma barreira que separa as clulas sangneas fetais e maternas. b) Aps a 1 gravidez, os antgenos fetais no sero capazes de induzir a produo de anticorpos anti-Rh pela me. c) Em III, aps o contato com o antgeno Rh, a me produz anticorpos anti-Rh que podem ser transferidos para a corrente sangnea fetal. d) Se, logo aps o parto da 1 gravidez, a me recebesse anticorpos anti-Rh, a DHR poderia ser evitada.

Questo 745 A incompatibilidade materno-fetal ao antgeno Rh pode determinar um doena denominada Eritroblastose Fetal. Se uma mulher foi orientada a usar a vacina anti-Rh logo aps o nascimento do primeiro filho, podemos dizer que seu fator Rh, o do seu marido e o da criana so, respectivamente: a) negativo; negativo; negativo. b) negativo; negativo; positivo. c) negativo; positivo; positivo. d) positivo; negativo; positivo. e) positivo; positivo; negativo.
167

Questo 746 A eritroblastose fetal uma doena hemoltica adquirida apresentada por alguns recm-nascidos, sendo observado, alm da anemia, ictercia e aumento do bao e fgado. Esta condio provocada por incompatibilidade sangnea do fator Rh, exclusivamente: a) quando a me Rh e o filho Rh; b) quando a me Rh e o filho Rh; c) quando a me Rh e o pai Rh; d) quando a me Rh e o pai Rh; e) independente do Rh materno, o filho Rh. Questo 747 No segundo parto de uma mulher, o feto apresentou o quadro de hemlise de hemcias, esse conhecido por doena hemoltica do recm-nascido (DHRN) ou eritroblastose fetal. Considerando o fato de que essa mulher no foi submetida transfuso de sangue em toda a sua vida anterior, e teve seu primeiro filho sem qualquer anormalidade, analise os gentipos descritos, no quadro apresentado, e assinale abaixo a alternativa que indica, respectivamente, os gentipos da me, do primeiro filho e do segundo filho.

1.5.3.2

ela observao dos grficos e considerando que essa mulher teve um filho em cada gestao e nunca recebeu transfuso de sangue, correto concluir que, a) em X, a me transferiu anticorpos anti-Rh para o 1 filho Rh-, o qual teve eritroblastose fetal. b) em X, a me foi sensibilizada com o sangue Rh+ do 2 filho, o qual no teve eritroblastose fetal. c) em Y, a me transferiu anticorpos anti-Rh para o 2 filho Rh+, o qual teve eritroblastose fetal. d) em Y, a me foi sensibilizada com o fator Rh- do 1 filho, o qual no teve eritroblastose fetal. Questo 749 Assinale a alternativa que completa corretamente as lacunas no texto a seguir. Uma mulher do tipo sangneo Rh, homozigota recessiva e seu marido Rh. Se ele for ................., ................. Rh. A me reconhecer os glbulos vermelhos do embrio como estranhos e produzir anticorpos anti-Rh. Isto s acontecer quando houver passagem do sangue do embrio para a circulao materna. a) homozigoto, nenhum dos filhos ser b) heterozigoto, todos os filhos sero c) homozigoto, todos os filhos sero d) heterozigoto, nenhum dos filhos ser e) homozigoto, metade dos filhos ser Questo 750 Aps uma primeira gravidez bem sucedida, uma me abortou trs vezes. Seu caso foi diagnosticado, em consulta mdica, como eritroblastose fetal. Em relao patologia observada nesta famlia, assinale a alternativa CORRETA: a) A me Rh positivo. b) Os abortados certamente eram Rh negativo. c) Este casal jamais poder ter outros filhos.
168

1.5.3.2

Questo 748 Os dois grficos a seguir representam as quantidades de anticorpos anti-Rh presentes no sangue de uma mulher (Rh-) em gestaes distintas.

d) A criana Rh negativo. e) O pai Rh positivo. Questo 751 Uma mulher com tero infantil, Rh homozigota, casa-se com um homem Rh. Impedida de ter filhos, o casal decide ter um "beb de proveta" e contrata uma "me de aluguel" para receber em seu tero o zigoto formado por aquele casal. O que o casal no sabia que a "me de aluguel" tivera trs filhos, sendo que o ltimo apresentara a doena hemoltica do recm-nascido. A probabilidade de o "beb de proveta" nascer com a doena hemoltica do recm-nascido : a) mnima, visto que seu pai Rh. b) mnima, visto que sua me gentica Rh. c) alta, j que o "beb de proveta", com absoluta certeza, ser Rh. d) nula, visto que a doena hemoltica do recm-nascido s ocorre quando a me Rh e o pai Rh. e) alta, pois a "me de aluguel" Rh. Questo 752 Um banco de sangue possui 5 litros de sangue tipo AB, 3 litros de tipo A, 8 litros B e 2 litros O. Para transfuses em indivduos O, A, B e AB esto disponveis, respectivamente: a) 2, 5, 10 e 18 litros. b) 2, 3, 5 e 8 litros. c) 18, 8, 13 e 5 litros. d) 2, 3, 8 e 16 litros. e) 2, 5, 18 e 10 litros. Questo 753 Assinale a alternativa que esquematiza as transfuses que podem ser feitas entre indivduos com diferentes grupos sanguneos do sistema ABO (as setas indicam o sentido das transfuses). 1.5.3.3

Questo 754 Observe o diagrama geral das possveis trocas sangneas por doao e recepo no sistema "ABO":

1.5.3.3

(s) seta(s) cujo sentido (doao recepo) est(o) errado(s) (so): a) 4 e 5 b) 2 c) 1 d) 3 Questo 755 Em um banco de sangue de um hospital, as etiquetas que identificavam os tipos sangneos estavam em cdigo, e, por acidente, o livro onde estavam registrados os cdigos foi perdido. Para que os frascos contendo sangue fossem identificados, foram feitos testes com amostras correspondentes a cada cdigo, e o resultado foi o seguinte:

169

1.5.3.3

necessidade de transfuses sanguneas para um indivduo com sangue tipo AB, Rh, estaro disponveis para ele, do total acima mencionado: a) 4 litros. b) 8 litros. c) 12 litros. d) 13 litros. e) 21 litros. Questo 758

aseados nesse teste, podemos afirmar que a) existem 105 litros de sangue disponveis para um receptor AB Rh b) existem 135 litros de sangue disponveis para um receptor AB Rh c) existem 105 litros de sangue disponveis para um receptor A Rh d) existem 135 litros de sangue disponveis para um receptor O Rh e) existem 25 litros de sangue disponveis para um receptor O Rh Questo 756 A transfuso de sangue tipo AB para uma pessoa com sangue tipo B a) pode ser realizada sem problema, porque as hemcias AB no possuem antgenos que possam interagir com anticorpos anti-A presentes no sangue do receptor. b) pode ser realizada sem problema, porque as hemcias AB no possuem antgenos que possam interagir com anticorpos anti-B presentes no sangue do receptor. c) pode ser realizada sem problema, porque, apesar de as hemcias AB apresentarem antgeno A e antgeno B, o sangue do receptor no possui anticorpos contra eles. d) no deve ser realizada, pois os anticorpos anti-B presentes no sangue do receptor podem reagir com os antgenos B presentes nas hemcias AB. e) no deve ser realizada, pois os anticorpos anti-A presentes no sangue do receptor podem reagir com os antgenos A presentes nas hemcias AB. Questo 757 Um determinado banco de sangue possui 4 litros de sangue tipo AB, 7 litros de sangue tipo A, 1 litro de sangue tipo B e 9 litros de sangue tipo O, todos Rh. Se houver

A transfuso de sangue do tipo B para uma pessoa do grupo A, resultaria em a) reao de anticorpos anti-B do receptor com os glbulos vermelhos do doador. b) reao dos antgenos B do receptor com os anticorpos anti-B do doador. c) formao de anticorpos anti-A e anti-B pelo receptor. d) nenhuma reao, porque A receptor universal. e) reao de anticorpos anti-B do doador com antgenos A do receptor. Questo 759 Um homem sofreu um acidente e precisou de transfuso sangnea. Analisado o seu sangue, verificou-se a presena de anticorpos anti-A e ausncia de anti-B. No banco de sangue do hospital, havia trs bolsas disponveis, sendo que o sangue da bolsa 1 apresentava todos os tipos de antgenos do sistema ABO, o sangue da bolsa 2 possua anticorpos anti-A e anti-B e a bolsa 3 possua sangue com antgenos somente do tipo B. Esse homem pode receber sangue: a) apenas da bolsa 1. b) apenas da bolsa 3. c) da bolsa 2 ou da bolsa 3. d) da bolsa 1 ou da bolsa 2. e) apenas da bolsa 2. Questo 760 O soro sangneo de um indivduo do grupo O foi colocado em quatro tubos de ensaio, I, II, III e IV, aos quais foram adicionadas, separada e respectivamente, hemcias de indivduos dos grupos sangneos AB, A, B e O. Marque, na alternativa a seguir, a opo que corresponde condio de aglutinao (+) ou no aglutinao (-) de hemcias resultante de reao antgeno-anticorpo:
170

a) Tubo I (-), Tubo II (+), Tubo III (-) e Tubo IV (+); b) Tubo I (-), Tubo II (+), Tubo III (+) e Tubo IV (-); c) Tubo I (+), Tubo II (-), Tubo III (-) e Tubo IV (+); d) Tubo I (+), Tubo II (+), Tubo III (+) e Tubo IV (-); e) Tubo I (-), Tubo II (-), Tubo III (-) e Tubo IV (+); Questo 761 Num laboratrio foram realizados, em cinco indivduos, exames de sangue para a determinao da tipagem sangnea dos Sistemas ABO e Rh. Foram obtidas reaes com a aplicao dos reagentes anti-A, anti-B e anti-Rh. Os resultados obtidos foram:

1.5.3.4

bservao: o sinal + significa aglutinao de hemcias; o sinal - significa ausncia de aglutinao. A partir dos resultados observados, podero doar sangue ao referido homem, os indivduos: a) I e II b) I e III c) II e III d) II e IV e) III e IV Questo 763

1.5.3.4

om base no quadro, conclui-se que so classificados, respectivamente, como receptor e doador universal: a) 4 e 2 b) 4 e 3 c) 1 e 5 d) 2 e 4 e) 5 e 1 Questo 762 Em um hospital h um homem necessitando de uma transfuso de emergncia. Sabe-se que ele pertence ao grupo sangneo A e que, no hospital, h quatro indivduos que se ofereceram para doar sangue. Foi realizada a determinao de grupos sangneos do sistema ABO dos quatro indivduos, com a utilizao de duas gotas de sangue de cada um deles, que, colocadas em uma lmina, foram, em seguida, misturadas aos soros anti-A e anti-B. Os resultados so apresentados a seguir:

Um laboratorista realizou exames de sangue em cinco indivduos e analisou as reaes obtidas com os reagentes anti-A, anti-B, anti-Rh, para a determinao da tipagem sangnea dos sistemas ABO e Rh. Os resultados obtidos encontram-se no quadro seguinte.

1.5.3.4

171

Com base nesses resultados, indique quais os indivduos que sero considerados, respectivamente, receptor e doador universal. a) 5 e 2. b) 4 e 3. c) 3 e 4. d) 2 e 5. e) 1 e 4. Questo 764 A tabela a seguir foi elaborada a partir de testes para determinao dos grupos sangneos de seis pessoas de uma academia de ginstica. O sinal positivo (+) significa "aglutina" e o sinal negativo (-) significa "no aglutina". Aps analisar a tabela, assinale a alternativa que indica os grupos sangneos de todas as pessoas quanto aos sistemas ABO e Rh, mantendo a seqncia disposta na tabela.

1.5.4.1

ituaes como essa so conhecidas como: a) polialelia. b) poligens. c) norma de reao. d) interao gnica. e) alelos mltiplos. Questo 766 A surdez pode ser uma doena hereditria ou adquirida. Quando hereditria, depende da homozigose de apenas um dos dois genes recessivos, (d) ou (e). A audio normal depende da presena de pelo menos dois genes dominantes diferentes (D) e (E), simultaneamente. Um homem surdo, casou-se com uma surda. Tiveram 9 filhos, todos de audio normal. Assim, podemos concluir que o gentipo dos filhos : a) ddEE. b) DdEe. c) Ddee. d) DDee. e) DDEE. Questo 767 Na ervilha-de-cheiro existem dois pares de genes que condicionam a cor da flor (Cc e Pp). A presena do gene C ou P ou ausncia de ambos produz flor branca. A presena de ambos simultaneamente produz flor prpura. Cruzando-se duas plantas de flores brancas, obtm-se em F plantas produtoras de flores coloridas, na proporo de 3 brancas: 1 colorida. Os gentipos das plantas cruzadas so, respectivamente: a) CCpp x ccPP b) CCpp x ccPp c) Ccpp x ccPP d) Ccpp x ccPp
172

1.5.3.4

a) O, Rh/ AB, Rh/ B, Rh/ A,Rh/ O,Rh/ A,Rh b) O, Rh/ AB, Rh/ B, Rh/ A, Rh/ O, Rh/ A, Rh c) AB, Rh/ O, Rh/ A, Rh/ B, Rh/ AB, Rh/ B, Rh d) AB, Rh/ O, Rh/ A, Rh/ B, Rh/ AB, Rh/ B, Rh e) AB, Rh/ O, Rh/ B, Rh/ A, Rh/AB, Rh/ A, Rh Questo 765 O esquema a seguir evidencia que a formao de melanina no depende apenas da ao de um gen. No processo ali representado, est ocorrendo a ao conjunta de dois gens.

e) CcPp x CcPp Questo 768 Suponha que, na espcie humana, a pigmentao da pele seja devida a dois pares de genes autossmicos com efeito aditivo. A tabela abaixo indica os fentipos existentes.

Questo 770 Em determinada espcie vegetal, ocorrem flores vermelhas somente se a planta possuir os alelos dominantes A e B. Cruzando-se plantas de flores vermelhas com plantas de flores brancas, obtiveram-se 3 plantas de folhas vermelhas para 5 plantas de flores brancas na gerao F. Os gentipos das plantas com flores vermelhas e brancas da gerao parental so, respectivamente, a) AABB e AaBb b) AaBb e Aabb c) AABb e aabb d) aaBb e Aabb e) aabb e aabb Questo 771

1.5.4.1

expresso desses genes pode ser impedida pela presena de um par de genes autossmicos recessivos. Nesse caso, o indivduo albino. Um casal de mulatos mdios dibridos tem uma criana albina. A probabilidade de nascer uma criana branca no albina de: a) 1/16. b) 1/2. c) 1/5. d) 3/16. e) 3/64. Questo 769 Em gentica, o fenmeno da interao gnica consiste no fato de: a) uma caracterstica provocada pelo ambiente, como surdez por infeco, imitar uma caracterstica gentica, como a surdez hereditria. b) vrios pares de genes no alelos influenciarem na determinao de uma mesma caracterstica. c) um nico gene ter efeito simultneo sobre vrias caractersticas do organismo. d) dois pares de genes estarem no mesmo par de cromossomos homlogos. e) dois cromossomos se unirem para formar um gameta.

Observe a figura.

1.5.4.1

odas as alternativas contm gentipos possveis para os porquinhos vermelhos de F2, EXCETO a) AABB b) AaBB c) Aabb d) AaBb e) AABb Questo 772 Os indivduos albinos no possuem melanina - pigmento responsvel pela cor e proteo da pele - e, por isso, so muito sensveis luz solar. Neste esquema, est representada parte da via biossinttica para a produo desse pigmento:

173

1.5.4.1

om base nesse esquema e em outros conhecimentos sobre o assunto, INCORRETO afirmar que a) a ausncia da Enzima 1 resulta em um aumento da concentrao de tirosina. b) casamentos entre indivduos albinos podem gerar descendentes com melanina. c) diferentes gentipos podem dar origem ao albinismo. d) indivduos AABB formam gametas do tipo AA e BB. Questo 773 Em uma exaustiva anlise de genealogias humanas, com relao surdez congnita na descendncia de pais normais para a audio, cujos progenitores eram surdos, foi observado que a distribuio fenotpica para normais e surdos obedecia a uma proporo de 9:7, respectivamente, como ilustrado no quadro a seguir. Considerando esses dados, analise as proposies com verdadeiro ou falso.

( ) A surdez congnita determinada por alelos mltiplos em um loco autossmico. ( ) Interao gnica entre dois locos justificam esses dados. ( ) Na determinao da caracterstica analisada atuam locos gnicos ligados que distam entre si em 16 unidades de mapa. ( ) A probabilidade do nascimento de uma criana normal para a audio, a partir de um casal genotipicamente igual ao mostrado na F1, de aproximadamente de 0,56. ( ) Cinco distintas classes genotpicas so observadas entre os descendentes surdos citados. Questo 774 Em ces labradores, dois genes, cada um com dois alelos (B/b e E/e), condicionam as trs pelagens tpicas da raa: preta, marrom e dourada. A pelagem dourada condicionada pela presena do alelo recessivo e em homozigose no gentipo. Os ces portadores de pelo menos um alelo dominante E sero pretos, se tiverem pelo menos um alelo dominante B; ou marrons, se forem homozigticos bb. O cruzamento de um macho dourado com uma fmea marrom produziu descendentes pretos, marrons e dourados. O gentipo do macho a) Ee BB. b) Ee Bb. c) ee bb. d) ee BB. e) ee Bb. Questo 775

1.5.4.1

Em galinhas, a cor da plumagem determinada por 2 pares de genes. O gene C condiciona plumagem colorida enquanto seu alelo c determina plumagem branca. O gene I impede a expresso do gene C, enquanto seu alelo i no interfere nessa expresso. Com esses dados, conclui-se que se trata de um caso de: a) epistasia recessiva. b) herana quantitativa. c) pleiotropia. d) codominncia. e) epistasia dominante.

174

Questo 776 Nos camundongos, a pelagem pode ser aguti, preta ou albina. A figura a seguir mostra as reaes bioqumicas envolvidas na sntese de pigmentos.

1.5.4.2

1.5.4.2 om base nos resultados, correto afirmar, EXCETO: a) Trata-se de um carter determinado por interao gnica. b) Os duplos heterozigotos apresentam flores coloridas. c) Os indivduos de F, produzem quatro tipos de gametas para o carter em estudo. d) A fecundao cruzada das plantas com flores brancas de F produzir sempre o mesmo fentipo. Questo 778 Em ces da raa Labrador Retriever, a cor da pelagem determinada por um tipo de interao gnica episttica de acordo com o esquema a seguir.

om base na figura foram feitas as seguintes afirmaes: I - A formao de qualquer pigmento no plo depende da presena do alelo P. II - Quando animais pretos homozigticos so cruzados com certos albinos tambm homozigticos, os descendentes so todos aguti. III - Trata-se de um caso de interao gnica do tipo epistasia recessiva. Pode-se considerar correto o que afirmado em a) I, somente. b) III, somente. c) I e II, somente. d) II e III, somente. e) I, II e III. Questo 777 O esquema abaixo representa o cruzamento artificial (em P) de duas variedades puras de um determinado vegetal, que se reproduz por autopolinizao (em F). O carter em estudo a cor das flores.

1.5.4.2

175

Sabendo que o cruzamento (gerao Parental) entre um macho com fentipo chocolate e uma fmea de fentipo amarela gera apenas filhotes com pelagem preta (gerao F1), um criador fez as seguintes afirmaes: I. Todos os filhotes produzidos nesse cruzamento so heterozigotos, enquanto os pais so homozigotos para os dois pares de genes. II. No cruzamento da fmea parental com qualquer co de pelagem preta, no se espera a produo de descendentes com fentipo chocolate. III. No cruzamento da fmea amarela com um de seus filhotes de F1, espera-se que 50% dos descendentes apresentem pelagem amarela. IV. No cruzamento entre os filhotes de F1, espera-se que 25% dos descendentes apresentem pelagem chocolate. So afirmaes CORRETAS: a) I, II e III apenas. b) II, III e IV apenas. c) I, III e IV apenas. d) I, II, III e IV. Questo 779 Em camundongos, a colorao da pelagem determinada por dois pares de genes, Aa e Cc, com segregao independente. O gene A determina colorao aguti e dominante sobre seu alelo a, que condiciona colorao preta. O gene C determina a produo de pigmentos e dominante sobre seu alelo c, que inibe a formao de pigmentos dando origem a indivduos albinos. Do cruzamento de um camundongo preto com um albino, foram obtidos apenas descendentes agutis. Qual o gentipo desse casal? a) aaCC x aacc b) Aacc x aaCc c) aaCc x AAcc d) AaCc x AaCc e) aaCC x AAcc Questo 780 Em cebolas, dois pares de genes que apresentam segregao independente participam na determinao da cor do bulbo: o alelo dominante I impede a manifestao de cor e o recessivo i permite a expresso; o alelo dominante A determina cor vermelha e o recessivo a, cor amarela.

Uma proporo de 2 incolores: 1 vermelho: 1 amarelo esperada entre os descendentes do cruzamento a) IIAA x IiAa b) IiAA x iiAa c) IIaa x ii aa d) IiAa x IiAa e) IiAa x iiaa Questo 781 Sobre interao gnica, assinale o que for correto. (01) Ocorre poligenia quando dois genes no-alelos colaboram na mesma caracterstica, completando seus efeitos. (02) Dois genes no-alelos colaboram na mesma caracterstica, complementando seus efeitos e produzindo um fentipo igual aos fentipos produzidos por cada gene isoladamente. (04) Ocorre poligenia quando um gene tem efeito simultneo sobre vrias caractersticas do organismo. (08) Ocorre epistasia quando um gene, ao invs de determinar uma caracterstica, impede a manifestao de outro gene, no-alelo. (16) Durante o desenvolvimento do organismo, vrios pares de genes no-alelos influem na determinao de uma caracterstica. Questo 782 Na cebola, a presena de um alelo dominante C determina a produo de bulbo pigmentado; em cebolas cc, a enzima que catalisa a formao de pigmento no produzida (cebolas brancas). Outro gene, herdado de forma independente, apresenta o alelo B, que impede a manifestao de gene C. Homozigotos bb no tm a manifestao da cor do bulbo impedida. Quais as propores fenotpicas esperadas do cruzamento de cebolas homozigotas coloridas com BBcc? a) 9/16 de cebolas brancas e 7/16 de cebolas coloridas. b) 12/16 de cebolas brancas e 4/16 de cebolas coloridas. c) 13/16 de cebolas brancas e 3/16 de cebolas coloridas. d) 15/16 de cebolas brancas e 1/16 de cebolas coloridas. e) 16/16 de cebolas brancas.

176

Questo 783 A cor da pelagem em cavalos depende, dentre outros fatores, da ao de dois pares de genes Bb e Ww. O gene B determina plos pretos e o seu alelo b determina plos marrons. O gene dominante W "inibe" a manifestao da cor, fazendo com que o plo fique branco, enquanto que o alelo recessivo w permite a manifestao da cor. Cruzando-se indivduos heterozigotos para os dois pares de genes obtm-se: a) 3 brancos: 1 preto b) 9 brancos: 3 pretos: 3 mesclados de marrom e preto: 1 branco c) 1 preto: 2 brancos: 1 marrom d) 12 brancos: 3 pretos: 1 marrom e) 3 pretos: 1 branco Questo 784 As diversas substncias ingeridas pelo homem so transformadas em outras, durante os processos metablicos. Essas transformaes so catalisadas por diferentes enzimas. O esquema abaixo representa alguns passos da sntese de melanina.

Questo 785 Epistasia o fenmeno em que um gene (chamado episttico) inibe a ao de outro que no seu alelo (chamado hiposttico). Em ratos, o alelo dominante B determina cor de plo acinzentada, enquanto o gentipo homozigoto bb define cor preta. Em outro cromossomo, um segundo lcus afeta uma etapa inicial na formao dos pigmentos dos plos. O alelo dominante A nesse lcus possibilita o desenvolvimento normal da cor (como definido pelos gentipos B_ ou bb), mas o gentipo aa bloqueia toda a produo de pigmentos e o rato torna-se albino. Considerando os descendentes do cruzamento de dois ratos, ambos com gentipo AaBb, os filhotes de cor preta podero apresentar gentipos: a) Aabbe AAbb. b) Aabbe aabb. c) AAbbe aabb. d) AABBe Aabb. e) aaBB, AaBBe aabb. Questo 786 Em uma espcie animal, cujo 2n = 6, o caritipo de clulas somticas de machos e fmeas se apresenta como mostram os desenhos a seguir:

1.5.4.2 1.5.5.1

Com base no esquema e sabendo que indivduos incapazes de sintetizar a melanina so albinos, julgue os itens seguintes. (1) Na produo de melanina a partir de fenilalanina, atuam trs mRNAs. (2) Indivduos albinos podem apresentar homozigose recessiva bb e cc. (3) Um casal de indivduos albinos pode ter filhos com pigmentao normal. (4) O gene B episttico sobre o gene C.

anlise desses caritipos revela que, nessa espcie, a determinao do sexo feita por um sistema, em que o macho e a fmea so, respectivamente: a) XY e XX b) YO e XX c) XO e XX d) XY e XO e) XO e XY

177

Questo 787 Na espcie humana a determinao sexual feita por um par de cromossomos, X e Y. O indivduo do sexo feminino apresenta dois cromossomos X enquanto que o indivduo de sexo masculino apresenta um cromossomo X e outro cromossomo Y. Com base neste texto INCORRETO afirmar: a) O sexo masculino heterogamtico e sempre o homem quem determina o sexo dos filhos. b) O sexo feminino homogamtico e o gameta feminino normal sempre apresenta um cromossomo X. c) na mulher um cromossomo X est sempre condensado e recebe o nome de cromatina sexual. d) A hipertricose auricular uma caracterstica restrita ao sexo masculino, pois o gene est localizado no cromossomo Y. e) Toda doena hereditria e recessiva ligada ao cromossomo X s afeta as mulheres. Questo 788 Leia o texto a seguir referente Hiptese de Lyon. "A pesquisadora inglesa Mary Lyon props, em 1961, a hiptese de que fmeas de mamferos compensariam a dose dupla de genes do cromossomo X atravs da inativao de um desses cromossomos. Assim, as clulas femininas ficariam iguais s masculinas, que possuem apenas uma cpia funcional dos genes ligados ao cromossomo X. A inativao do cromossomo X ocorre ao acaso, independentemente dos genes que possuem, e nos blastmeros iniciais do desenvolvimento embrionrio. Logo, as mulheres apresentam clulas geneticamente diferentes entre si, pois em algumas esto ativos os genes provenientes do cromossomo X materno e em outras do cromossomo X paterno. Mulheres heterozigotas para os genes ligados aos cromossomos X expressam o alelo dominante em algumas clulas e o alelo recessivo em outras." Assinale a alternativa que confirma o texto anterior. a) Algumas mulheres, heterozigotas para os grupos sangneos, so tipo A e B simultaneamente. b) Algumas mulheres, heterozigotas para a cor do cabelo, so loiras e castanhas, simultaneamente. c) Algumas mulheres, heterozigotas para o daltonismo (XD

Xd), tm viso normal em um dos olhos e daltonismo no outro. d) Algumas mulheres, heterozigotas para a cor da pele, tm manchas brancas e pretas, simultaneamente. e) Algumas mulheres, heterozigotas para a cor dos olhos, tm um olho azul e outro castanho. Questo 789 O mdico confirmou que se tratava de gmeos monozigticos, contudo um deles era menino e o outro menina. A anlise cromossmica dos gmeos indicou que o menino era normal, porm a menina era portadora da sndrome de Turner. Tal fato deve-se perda de a) um cromossomo X na gametognese da me das crianas. b) um cromossomo Y na gametognese do pai das crianas. c) um cromossomo sexual, X ou Y, na gametognese do pai ou da me das crianas. d) um cromossomo X quando da diviso mittica do zigoto. e) um cromossomo Y quando da diviso mittica do zigoto. Questo 790 O esquema a seguir mostra a formao dos gametas responsveis pela produo de um indivduo com alterao do seu nmero cromossomial.

1.5.5.1

ntre as caractersticas que esse indivduo passar a apresentar, teremos: a) sexo masculino. b) caracteres sexuais desenvolvidos. c) caritipo normal. d) ausncia de cromatina sexual. e) estatura elevada.
178

Questo 791 A anlise do caritipo de exemplares de uma dada espcie revelou que o nmero diplide idntico em ambos os sexos e que o sexo heterogamtico o feminino. Com base nesses dados, possvel dizer que o sistema de determinao do sexo nessa espcie do tipo a) XX : XY b) XX : XO c) XX : YO d) ZZ : ZW e) ZZ : ZO Questo 792 O carneiro ('Ovis aries') apresenta 27 cromossomos em seus gametas normais. A partir desse dado, assinale a alternativa INCORRETA com relao ao nmero de cromossomos encontrado em diversas clulas nessa espcie. a) Um neurnio de carneiro deve apresentar 52 autossomos. b) Um linfcito de carneiro deve apresentar 54 cromossomos, incluindo 2 cromossomos sexuais. c) Um vulo de ovelha deve apresentar 26 autossomos. d) Uma clula de carneiro que est na metfase da mitose deve apresentar 54 cromossomos duplicados. e) Uma clula muscular de carneiro deve apresentar 54 autossomos, alm de 2 cromossomos sexuais. Questo 793 Acerca da relao entre os cromossomos de um menino e os de seus avs, fizeram-se as seguintes afirmaes: I. Seu cromossomo Y descendente do Y de seu av paterno. II. Seu cromossomo X descendente de um X de sua av paterna. III. Entre seus autossomos, h descendentes de autossomos de seus avs. Dessas afirmaes, est(o) correta(s) APENAS a) I b) II c) III d) I e III e) II e III

Questo 794 Em galinhas, a cor das penas apresenta herana ligada ao sexo. O alelo dominante determina penas barradas e o recessivo, penas pretas. Considere os seguintes cruzamentos a partir dos quais obtiveram-se as geraes F e F: I. machos homozigticos de penas barradas fmeas de penas pretas II. machos de penas pretas fmeas de penas barradas Assinale a alternativa que indica corretamente as geraes nas quais espera-se encontrar galinhas pretas. a) I - F: galinha barrada; F: galinha barrada II - F: galinha preta; F: galinha barrada b) I - F: galinha barrada; F: galinha preta II - F: galinha preta; F: galinha preta c) I - F: galinha barrada; F: galinha barrada II - F: galinha preta; F: galinha preta d) I - F: galinha preta; F: galinha barrada II - F: galinha barrada; F: galinha preta e) I - F: galinha barrada; F: galinha preta II - F: galinha barrada; F: galinha preta Questo 795 Em uma experincia de fecundao "in vitro", 4 vulos humanos, quando incubados com 4 suspenses de espermatozides, todos igualmente viveis, geraram 4 embries, de acordo com a tabela abaixo.

1.5.5.1

179

onsiderando a experincia descrita, o grfico que indica as probabilidades de os 4 embries serem do sexo masculino o de nmero: a) 1 b) 2 c) 3 d) 4 Questo 796 Considere que um vulo de abelha possui 510 g de DNA. Nesse inseto, embora as fmeas se originem de reproduo sexuada, os machos originam-se de vulos no-fecundados, por partenognese. A quantidade de DNA encontrada em uma clula somtica de zango, no perodo correspondente prfase da mitose , em mg, igual a: a) 1,0 10 b) 2,5 10 c) 5,0 10 d) 5,0 10 Questo 797 As afirmaes a seguir relacionam-se DETERMINAO CROMOSSMICA DO SEXO na espcie humana. ( ) O sexo heterogamtico o masculino. ( ) O genitor do sexo feminino determina o sexo dos descendentes. ( ) O corpsculo de Barr ou cromatina sexual corresponde a um cromossomo X inativo. ( ) A sndrome de Down causada pela presena de um cromossomo X extra no caritipo. ( ) O indivduo hermafrodita formado por clulas XX e XY. Questo 798 Um estudante, ao analisar os cromossomos de 'Drosophila', encontrou a proporo de 1X : 2A (onde a letra A simboliza o conjunto haplide de autossomos). Alm disso, no observou a presena do cromossomo Y. Analisando os dados do estudante, podemos concluir que a mosca a) uma fmea normal. b) uma fmea aneuplide. c) um macho normal. d) um macho estril.

e) um intersexuado. Questo 799 Alguns mtodos em desenvolvimento podero permitir aos pais a escolha do sexo de seus futuros filhos. Dentre eles, alguns se baseiam em executar a fecundao em tubo de ensaio, implantando, a seguir, o ovo fertilizado no tero da me. Dentre as opes abaixo, os gametas que precisam ser necessariamente identificados e separados para uso no processo de fecundao, caso os pais desejem um filho do sexo feminino, so: a) espermatcitos secundrios diplides portando os cromossomos X e Y; b) ocitos primrios diplides portando os cromossomos Y; c) espermatozides derivados de espermtides portando o cromossomo X; d) vulos haplides portando o cromossomo Y; e) oognias portando o cromossomo X e espermatognias portando o cromossomo Y. Questo 800 Observe a figura.

1.5.5.1

180

ssa figura representa a herana do carter mancha negra numa espcie de peixes em que a determinao do sexo segue o padro mais comum nas aves. Com relao ao padro de herana desse carter, correto afirmar-se que a) a probabilidade do casal em F ter um descendente macho e sem mancha negra zero. b) a probabilidade de uma fmea com mancha, cruzada com macho sem mancha, ter descendentes machos sem mancha de 50%. c) as fmeas de F e P sem mancha negra possuem gentipos diferentes, d) o carter mancha negra exclusivo de indivduos homozigotos. e) o sexo heterogamtico nessa espcie de peixes o masculino. Questo 801 A figura a seguir se refere determinao do sexo em algumas espcies de tartarugas e lagartos. Com base nessa figura pode-se afirmar que

Questo 802 A identificao do fator que origina indivduos com sndrome de Down tornou-se possvel pela utilizao da tcnica de a) contagem e identificao dos cromossomos. b) cultura de clulas e tecidos. c) mapeamento do genoma humano. d) produo de DNA recombinante. Questo 803 Nos mamferos, a presena do cromossoma Y determina o fentipo masculino. O gene SRY, presente nesse cromossoma, induz diferenciao dos testculos. Considerando-se essas informaes e outros conhecimentos sobre o assunto, CORRETO afirmar que a) os indivduos 46, XY que, na idade adulta, sofrem mutao nesse gene perdem as caractersticas sexuais. b) os indivduos trissmicos com caritipo 47, XYY apresentam dois testculos a mais. c) os indivduos trissmicos 47, XXY possuem rgos reprodutores masculinos e femininos. d) os testculos esto ausentes nos indivduos 46, XY com deleo do gene SRY. Questo 804 A figura a seguir mostra esquematicamente o tipo de reproduo em abelhas do gnero 'Apis'.

1.5.5.1

a) a determinao do sexo nesses animais independente da localizao dos ovos no ninho e da poca da postura. b) a determinao do sexo, sob controle de temperatura, pode ser til em condies de manejo de espcies em extino. c) indivduos de sexo indeterminado, em tartarugas, so produzidos em temperaturas abaixo de 28C. d) temperaturas maiores que 28C produzem fmeas tanto em tartarugas quanto em lagartos. e) machos so produzidos em baixas temperaturas tanto para tartarugas quanto para lagartos.

1.5.5.1

181

nalise as seguintes afirmativas sobre o esquema da figura. I. A produo de zanges caracteriza o processo de reproduo assexuada denominado partenognese. II. Os zanges podem ser considerados clones perfeitos da abelha rainha, uma vez que no houve a fecundao dos vulos que os originaram. III. As operrias so estreis devido espermatognese nos zanges produzir, atravs da meiose, gametas com um nmero de cromossomos 4 (quatro) vezes menor. Da anlise das afirmativas acima podemos assegurar que: a) apenas I est correta. b) I e II esto corretas. c) II e III esto corretas. d) apenas II est correta. e) I e III esto corretas. Questo 805 Analisando a figura adiante, que representa um caritipo humano, correto afirmar que se trata do caritipo de um indivduo:

Questo 806 No reino Colmia, havia uma rainha que tinha tido apenas filhos do sexo masculino (zanges) e precisava de uma sucessora para o trono. A rainha se casou com um belo zango plebeu, e nasceram filhas operrias, das quais uma seria a escolhida para ser a futura sucessora da rainha. Essa histria mostra que a) os zanges so haplides e produzem os espermatozides por meiose. b) o sexo das abelhas determinado pelos cromossomos sexuais. c) o sexo das abelhas determinado pela ploidia do indivduo. d) a rainha e as operrias so diicas, e os zanges so monicos. Questo 807 Os machos de abelha originam-se de vulos no fecundados e so haplides. As fmeas resultam da fuso entre vulos e espermatozides, e so diplides. Em uma linhagem desses insetos, a cor clara dos olhos condicionada pelo alelo recessivo a de um determinado gene, enquanto a cor escura condicionada pelo alelo dominante A. Uma abelha rainha de olhos escuros, heterozigtica Aa, foi inseminada artificialmente com espermatozides de machos de olhos escuros. Espera-se que a prole dessa rainha tenha a seguinte composio:

1.5.5.1

(01) Do sexo masculino. (02) Do sexo feminino. (04) Com Sndrome de Down. (08) Com Sndrome de Patau. (16) Ccom Sndrome de Edwards. (32) Com caritipo normal. (64) Com uma anomalia numrica de autossomos. Soma ( ) Questo 808 Considere as afirmaes:

1.5.5.1

I. Em humanos, a determinao do sexo cromossmico do zigoto (XX ou XY) depende do gameta masculino que fecunda o vulo.
182

II. Em mamferos, as fmeas possuem apenas um cromossomo X e os machos, dois. III. Em mamferos, nas clulas somticas de fmeas normais, possvel observar o cromossomo X que foi inativado, pois este corresponde ao corpsculo de Barr ou cromatina sexual. Est(o) correta(s) a) apenas I. b) apenas II. c) apenas III. d) apenas I e II. e) apenas I e III. Questo 809 O diagrama a seguir est dividido em 3 segmentos (I, II e III), os quais contm conceitos relacionados aos diferentes sistemas de determinao do sexo.

sexual. c) Dois cromossomos X e blocos de cromatina sexual. d) Trs cromossomos X, sendo que dois deles formam a cromatina sexual. e) Um cromossomo X apenas. Questo 811 Considere as cinco afirmaes seguintes. I. Em mamferos, cromossomos homlogos contm a mesma seqncia linear de genes, sendo exceo a essa regra os cromossomos sexuais X e Y. II. Toda a informao gentica necessria para formar um organismo completo est contida em seqncias de timinas, adeninas, citosinas e guaninas arranjadas em diferentes combinaes. III. A informao gentica pode ser passada de uma gerao para outra, de pais para filhos; porm, no pode ser passada, em um mesmo indivduo, de uma clula a outra. IV. Em uma clula eucaritica animal, todas as molculas de RNA, com exceo do RNA mitocondrial, tm sua origem no ncleo. V. Numa protena com 500 aminocidos, o RNA mensageiro que saiu do ncleo continha 1500 cdons e a seqncia que serviu de molde para a transcrio possua 3000 nucleotdeos. Esto corretas: a) I, II e III. b) I, II e IV. c) II, III e IV. d) II, III e V. e) III, IV e V. Questo 812 A reproduo da maioria dos seres vivos envolve um processo sexual onde se alternam os fenmenos de meiose e fecundao. No homem, a meiose gamtica, e a fecundao reconstitui a diploidia. Qual dos pares de gametas representados a seguir poder originar um zigoto que desenvolver um embrio normal do sexo masculino?

1.5.5.1

Adaptado de: AMABIS, J.M e MARTHO, G.R. "Conceitos de Biologia". So Paulo: Moderna, 2001. Com relao a esses segmentos, pode-se afirmar que: a) I e III esto corretos. b) I e II esto corretos. c) II e III esto corretos. d) Apenas I est correto. Questo 810 Durante as Olimpadas comum fazer-se teste da cromatina sexual ou corpsculo de Barr nas mulheres. Esse teste permite o diagnstico citolgico do sexo feminino. Uma mulher normal apresentar em suas clulas bucais: a) Dois cromossomos X, sendo que um deles a cromatina sexual. b) Trs cromossomos Y, sendo que um deles a cromatina

183

Questo 815

1.5.5.1 1.5.5.2

Questo 813 Em eventos esportivos internacionais como os Jogos Pan-americanos ou as Olimpadas, ocasionalmente, h suspeitas sobre o sexo de certas atletas, cujo desempenho ou mesmo a aparncia sugerem fraude. Para esclarecer tais suspeitas utiliza-se a) a identificao da cromatina sexual. b) a contagem de hemcias cuja quantidade maior nos homens. c) o exame radiolgico dos rgos sexuais. d) a pesquisa de hormnios sexuais femininos atravs de um exame de sangue. e) a anlise radiogrfica da bacia. Questo 814 Em relao aos cromossomos sexuais X e Y, so feitas as seguintes afirmaes: I - quando pareados, so exemplos de cromossomos homlogos; II - caractersticas como a hemofilia, por exemplo, fazem parte do cromossomo X, III - caractersticas como o daltonismo, por exemplo, esto associadas a genes do cromossomo Y. Esto corretas as seguintes afirmaes: a) apenas I b) apenas II c) apenas III d) apenas II e III e) todas. No grfico anterior temos representado um exemplo de doena ligada ao sexo onde apenas o indivduo IV afetado. Feita a anlise desse grfico, podemos afirmar corretamente que: a) a anomalia causada por um gene dominante. b) o indivduo I obrigatoriamente homozigoto. c) o cromossoma Y paterno pode apresentar o gene para a doena. d) o casal apresenta 50% de probabilidade de ter filhas afetadas. e) os indivduos III e V podem ser homozigotos ou heterozigotos. Questo 816 Observe o esquema a seguir:

1.5.5.2

anlise do esquema permite formular as concluses a seguir, EXCETO uma. Indique-a. a) O casal 1/2 nunca formar mulheres hemoflicas. b) O casal 5/6 formar homens hemoflicos. c) O gentipo de 4 ser XHY. d) O gentipo de 6 ser XHXH ou XHXh. e) O indivduo 5 com certeza hemoflico.
184

Questo 817 "Tem sido verificado que aproximadamente 25% dos casos de hemofilia A em meninos so decorrentes de mutaes novas, isto , a doena se manifesta em meninos que no tem histria familiar de hemofilia." (Handin R.I., BLOOD AND PRACTICE OF HEMATOLOGY, 1955) Quando nos debruamos sobre a hemofilia, aprendemos que ela mais comum nos homens porque: a) os homens so mais propensos doena devido influncia do hormnio testosterona. b) sendo uma herana ligada ao sexo, suficiente nos homens apenas um alelo para que a doena se manifeste. c) mulheres hemoflicas precisam de dois alelos dominantes, ao passo que os homens s necessitam de um alelo. d) mulheres hemoflicas morrem nos primeiros sangramentos menstruais. e) causada por um alelo tpico do cromossoma Y, que masculinizante. Questo 818 O daltonismo uma anomalia que apresenta um tipo de herana ligada ao sexo. De acordo com o heredograma, analise as afirmaes de I a IV e assinale a alternativa correta.

I - 100% dos filhos homens do casal 3 e 4 sero daltnicos; II - 50% das filhas do casal 3 e 4 sero normais portadoras e 50% daltnicas; III - No possvel identificar o gentipo de 2; IV - 100% das filhas do casal 3 e 4 sero normais portadoras. a) Todas as afirmaes so verdadeiras. b) Apenas as afirmaes I e II so verdadeiras. c) Apenas as afirmaes I, III e IV so verdadeiras. d) Apenas as afirmaes II e III so verdadeiras. e) Apenas as afirmaes II e IV so verdadeiras. Questo 819 A distrofia muscular de Duchenne devida a um gene recessivo, ligado ao cromossomo X. O heredograma a seguir refere-se a uma famlia com esta anomalia. A probabilidade de A ser portador da anomalia, sabendo-se que a mulher B homozigota de a) 1/8 b) 3/8 c) 1/2 d) 1/4 e) 3/4

1.5.5.2

1.5.5.2

Questo 820 A hemofilia uma doena gentica cuja herana ligada ao sexo. Analise o heredograma adiante e assinale a alternativa correta.

185

Questo 822 Na espcie humana, o gentipo para hemofilia XHY fenotipicamente representa: a) homem normal b) homem hemoflico c) mulher normal d) mulher hemoflica e) homem normal, porm portador Questo 823 a) Os indivduos 1 e 2 so homozigotos normais. b) O indivduo 8 portador do gene para hemofilia. c) O indivduo 9 no pode ser hemoflico. d) Todos os filhos e filhas do indivduo 10 sero hemoflicos. e) O indivduo 14 pode ser homo ou heterozigoto. Questo 821 O daltonismo causado por um gene recessivo localizado no cromossomo X na regio no-homloga ao cromossomo Y. Na genealogia abaixo, os indivduos representados com smbolos escuros so daltnicos e os demais tm viso normal para as cores. Um homem hemoflico casa-se com uma mulher normal e homozigota para este carter. A probabilidade deste casal vir a ter uma filha hemoflica igual a: a) zero b) 50% c) 25% d) 12,5% e) 100% Questo 824 Meio-irmos o termo utilizado para designar os indivduos que so irmos s por parte de pai ou s por parte de me. Joo e Pedro so meio-irmos e ambos so daltnicos e hemoflicos. Seus genitores so normais. Pode-se dizer que, mais provavelmente, Joo e Pedro sejam a) filhos do mesmo pai, do qual herdaram os genes para daltonismo e hemofilia. b) filhos da mesma me, da qual herdaram os genes para daltonismo e hemofilia. c) filhos do mesmo pai, porm herdaram de suas respectivas mes os genes para daltonismo e hemofilia. d) filhos da mesma me, porm herdaram de seus respectivos pais os genes para daltonismo e hemofilia. e) portadores de novas mutaes, ocorridas independentemente da herana materna ou paterna. Questo 825 VTIMAS DE HIROSHIMA NO BRASIL SERO INDENIZADAS. Os trs homens, que pediram para no ser identificados, vo receber US$ 24,7 mil, decidiu um tribunal japons. ("Folha de S.Paulo", 09.02.2006)
186

1.5.5.2

1.5.5.2

correto afirmar que a) a mulher 6 homozigota. b) as mulheres 2 e 4 so, certamente, heterozigotas. c) os homens 1, 3 e 7 so portadores do gene para o daltonismo. d) as filhas do casal 6 e 7 so, certamente, portadoras do gene para o daltonismo. e) se o pai de 2 era afetado pelo daltonismo, certamente a me tinha fentipo normal.

Emlia interessou-se pela notcia. Afinal, acreditava que seu nico filho, Mrio, portador de hemofilia do tipo A, a mais grave delas, era uma vtima indireta da radiao liberada pela bomba. Emlia havia lido que a doena gentica, ligada ao sexo, e muito mais freqente em homens que em mulheres. O sogro de Emlia, Sr. Shiguero, foi um dos sobreviventes da bomba de Hiroshima. Aps a guerra, migrou para o Brasil, onde se casou e teve um filho, Takashi. Anos depois, o Sr. Shiguero faleceu de leucemia. Emlia, que no tem ascendncia oriental, casou-se com Takashi e atribua a doena de seu filho Mrio herana gentica do av Shiguero. Depois da notcia do jornal, Emlia passou a acreditar que seu filho talvez pudesse se beneficiar com alguma indenizao. Sobre suas convices quanto origem da doena de Mrio, pode-se dizer que Emlia est a) correta. Do mesmo modo como a radiao provocou a leucemia do Sr. Shiguero, tambm poderia ter provocado mutaes nas clulas de seu tecido reprodutivo que, transmitidas Takashi, e deste se filho, provocaram a hemofilia de Mrio. b) correta. A hemofilia ocorre mais freqentemente em homens, uma vez que determinada por um alelo no cromossomo Y. Deste modo, Mrio s pode ter herdado esse alelo de seu pai, que, por sua vez, o herdou do Sr. Shiguero. c) apenas parcialmente correta. Como a hemofilia um carter recessivo e s se manifesta nos homozigotos para esse alelo, a doena de seu filho Mrio causada pela presena de um alelo herdado pela via paterna e por outro herdado pela via materna. d) errada. Como a hemofilia um carter dominante, se seu filho Mrio tivesse herdado o alelo do pai, que o teria herdado do Sr. Shiguero, todos seriam hemoflicos. e) errada. mais provvel que a hemofilia de Mrio seja determinada por um alelo herdado por via materna, ou que Mrio seja portador de uma nova mutao sem qualquer relao com a radiao a que o Sr. Shiguero foi submetido. Questo 826 Na genealogia a seguir, os smbolos cheios representam pessoas afetadas por uma doena gentica rara.

1.5.5.2

padro de herana que melhor explica o heredograma a) autossmico dominante, porque a doena afeta os dois sexos. b) autossmico dominante, porque a doena aparece em todas as geraes. c) autossmico dominante, porque aproximadamente 50% da prole afetada. d) dominante ligado ao sexo, porque todas as filhas de homens afetados so afetadas. e) recessivo ligado ao sexo, porque no h transmisso de homem para homem. Questo 827 O daltonismo causado por um alelo recessivo de um gene localizado no cromossomo X. Em uma amostra representativa da populao, entre 1000 homens analisados, 90 so daltnicos. Qual a porcentagem esperada de mulheres daltnicas nessa populao? a) 0,81 %. b) 4,5 %. c) 9 %. d) 16 %. e) 83 %. Questo 828 Acredita-se que a rainha Vitria da Inglaterra tenha sido a introdutora do gene para hemofilia - ligado ao X - na famlia real inglesa. A hemofilia uma doena que prejudica a coagulao do sangue. A princesa Beatriz, filha de Vitria, introduziu o gene na famlia real espanhola. Observe a rvore genealgica:

187

Questo 831 Uma mulher, filha de pai normal e me portadora do gene para o daltonismo, casa-se com um homem daltnico e tem uma criana do sexo masculino e daltnica. correto afirmar que: a) essa mulher daltnica. b) essa mulher poderia ter uma irm daltnica. c) o filho dessa mulher herdou do seu pai o gene para o daltonismo. d) o gentipo dessa mulher igual ao de sua me. e) essa mulher no poder ter uma filha daltnica. Questo 832 Um casal tem uma criana de sexo masculino e hemoflica. correto afirmar, com certeza, que: a) o pai normal. b) o pai normal e a me hemoflica. c) o pai e a me so hemoflicos. d) ela recebeu da me o gene para a hemofilia. e) se ela tiver um irmo, este ser hemoflico tambm. Questo 833 O gene que determina o daltonismo na espcie humana caracteriza o seguinte tipo de herana a) autossmico dominante. b) dominante ligado ao sexo. c) autossmico recessivo. d) recessivo ligado ao sexo. e) interao gnica. Questo 834 Uma criana do sexo feminino, daltnica e canhota possui pai daltnico e destro e me de viso normal e canhota. Sabendo que o uso da mo esquerda uma caracterstica recessiva, ento a probabilidade do segundo filho ser do sexo masculino e com fentipos dominantes : a) 1/2 b) 1/4 c) 1/6 d) 1/8 e) 1

1.5.5.2

probabilidade da princesa Maria vir a ter um menino hemoflico de: a) 100% b) 75% c) 50% d) 25% e) 0% Questo 829 O estudo de linhagens de galinhas em que aparecia uma anomalia hereditria mostrou que fmeas afetadas cruzadas com machos normais davam sempre todos os descendentes machos com a anomalia e as fmeas normais. A anomalia, provavelmente, determinada por gene a) autossmico dominante. b) autossmico recessivo. c) recessivo ligado ao cromossomo X. d) recessivo ligado ao cromossomo Z.. e) dominante ligado ao cromossomo Z.. Questo 830 Um homem de viso normal e com nmero normal de dedos casa-se com uma mulher polidctila e daltnica. Sabendo-se que a polidactilia uma herana autossmica dominante, assinale a alternativa correta. a) Esse casal poder ter uma filha polidctila e daltnica. b) A me dessa mulher ter obrigatoriamente o mesmo gentipo para o daltonismo que ela. c) O pai dessa mulher daltnico. d) A mulher obrigatoriamente filha de pai e me polidctilos. e) Os filhos homens desse casal sero sempre daltnicos e no polidctilos.

188

Questo 835 O raquitismo resistente vitamina D uma doena provocada por um gene dominante ligado ao X. Do casamento entre uma mulher afetada e um homem normal, nasceu uma menina normal. A probabilidade do nascimento de um menino tambm normal : a) 50% b) 75% c) 25% d) 100% e) 0 Questo 836 Em 'Drosophila', a cor dos olhos determinada por um gene localizado no cromossomo X sem o correspondente alelo no cromossomo Y. A cor vermelha determinada pelo gene W+, enquanto a cor branca devida ao gene W. Um macho de olhos brancos foi cruzado com uma fmea heterozigota. Considerando que nesses indivduos o sexo heterogamtico o masculino, a porcentagem de indivduos de olhos brancos em F ser de: a) zero b) 100 % c) 25 % d) 75 % e) 50 % Questo 837 Um homem de audio normal e no hemoflico casa-se com uma mulher com o mesmo fentipo. O primeiro filho desse casal nasceu hemoflico e surdo-mudo. Considerando a surdo-mudez como uma caracterstica autossmica recessiva, a probabilidade desse casal ter uma criana do sexo feminino normal para ambas as caractersticas de: a) 3/8 b) 1/8 c) 1/2 d) 3/4 e) zero Questo 838 A respeito das heranas recessivas ligadas ao sexo (genes situados no cromossomo X), considere as seguintes afirmaes.

I - Os homens s apresentam dois gentipos possveis, enquanto as mulheres apresentam trs gentipos possveis. II - As mulheres heterozigotas tm fentipo normal. III - As filhas de pai normal sero sempre normais. IV - Se a me for afetada, todos os seus filhos do sexo masculino tambm sero afetados. So corretas: a) I, III e IV apenas. b) I e III apenas. c) I, II, III e IV. d) II e IV apenas. e) III e IV apenas. Questo 839 Considere as seguintes afirmaes sobre uma mulher hemoflica: I- seu pai hemoflico. II- sua me possui um gene para a hemofilia. III- sua av paterna NO apresenta o gene para a hemofilia. Sabendo-se que o gene em questo recessivo e ligado ao sexo, e excluindo-se a possibilidade de mutao, possvel considerar que APENAS a) I verdadeira. b) II verdadeira. c) III verdadeira. d) I e II so verdadeiras. e) I e III so verdadeiras. Questo 840 Um homem tem av materna e pai com viso normal, e av materno e me com daltonismo. Assinale a alternativa correta quanto aos gentipos do homem e de seus avs maternos. a) Homem - XdY, Av - XDXd, Av - XdY b) Homem - XDY, Av - XDXd, Av - XdY c) Homem - XdY, Av - XDXd, Av - XDY d) Homem - XDY, Av - XDXd, Av - XDY e) Homem - XdY, Av - XdXd, Av - XdY

189

Questo 841 O heredograma a seguir representa uma famlia em que um dos filhos afetado por doena determinada por um alelo recessivo localizado no cromossomo X.

c) e as filhas de homens daltnicos so sempre heterozigotos. d) de mulheres daltnicas sempre portam alelo para daltonismo. e) de homens daltnicos sempre portam alelo para daltonismo. Questo 844

1.5.5.2

e uma das irms desse indivduo casar-se com um homem sadio, a probabilidade desse casal ter um menino afetado a) 3/4 b) 1/2 c) 1/4 d) 1/8 e) 1/16 Questo 842 Um homem hemoflico e uma mulher daltnica tiveram um filho com sndrome de Klinefelter (47, XXY). Admitindo-se que o gameta anormal tenha sido produzido pela mulher, espera-se que esse filho do casal seja a) normal, quanto hemofilia e ao daltonismo. b) daltnico e hemoflico. c) daltnico ou hemoflico. d) apenas hemoflico. e) apenas daltnico. Questo 843 O cientista John Dalton bastante conhecido por suas contribuies para a Qumica e Fsica. Alm disso, Dalton descreveu uma doena hereditria que o impossibilitava de distinguir a cor verde da vermelha. Essa doena hereditria, causada por um alelo recessivo ligado ao cromossomo X, recebeu o nome de daltonismo. correto afirmar que os filhos a) e as filhas de homens daltnicos so sempre daltnicos. b) e as filhas de mulheres daltnicas so sempre daltnicos.

O daltonismo condicionado por um gene recessivo ligado ao sexo. Um homem normal casou-se com uma mulher daltnica. A probabilidade de terem um filho homem e normal de: a) 0 b) 1/4 c) 1/3 d) 1/2 e) 1 Questo 845 Observe os heredogramas a seguir, que tratam de um caso e hemofilia:

1.5.5.2

abendo que o indivduo 7 do sexo feminino, a probabilidade de apresentar hemofilia : a) 1 b) 1/2 c) 1/4 d) 1/8 e) 1/16 Questo 846 O esquema a seguir representa a ontognese de Joo, que nasceu com SNDROME DE KLINEFELTER e DALTONISMO, embora seus pais no apresentem alteraes cromossmicas numricas em suas clulas
190

somticas.

1.5.5.2

a filha receba dela os alelos dominantes para daltonismo e hemofilia no mesmo cromossomo. c) Algumas clulas somticas de cada filha apresentam o cromossomo X de origem paterna condensado, enquanto a outra parte, o cromossomo X de origem materna condensado, o que permite expressar os dois alelos dominantes. d) A no-expresso dos alelos dominantes recebidos garante que a filha seja normal para os dois caracteres. Questo 848

abendo que o daltonismo uma herana recessiva ligada ao sexo, correto afirmar, EXCETO: a) Se o pai de Joo daltnico, ele obrigatoriamente contribuiu com o gameta responsvel pela sndrome do filho. b) Se foi o pai de Joo quem contribuiu com o gameta contendo um cromossomo a mais, esse pai obrigatoriamente daltnico. c) A me de Joo pode ser daltnica, mas pode no ser ela quem contribuiu com o gameta responsvel pela sndrome do filho. d) Se a me de Joo daltnica, pelo menos um dos avs de Joo tambm daltnico. Questo 847 Em geral, o DNA no-expresso altamente condensado na forma de heterocromatina. Um exemplo disso a inativao completa de um dos dois cromossomos X em fmeas de mamferos, situao que, ao microscpio, vista como uma mancha escura chamada corpsculo de Barr. O DNA ativo no nvel de transcrio, conhecido como eucromatina, menos condensado para permitir acesso da maquinaria de transcrio. Na espcie humana, a hemofilia e o daltonismo so caractersticas recessivas ligadas ao sexo. Sabendo que filhas de pai apenas hemoflico e me apenas daltnica e homozigota para hemofilia so normais para os dois caracteres, assinale a alternativa que traz uma explicao possvel para o fato apresentado. a) A permutao na espermatognese permitiu que o pai tenha dado para a filha gameta contendo o alelo dominante para hemofilia. b) O "crossing-over" na gametognese da me garante que

Os dois heredogramas a seguir foram montados para duas famlias que apresentavam distrbios musculares geneticamente determinados. O carter Distrofia Muscular de Duchenne (DMD) uma herana ligada ao sexo, sendo somente transmitido pelas mes; torna os indivduos afetados incapazes de se reproduzir. A Atrofia Muscular Espinhal (AME) no impede a reproduo e pode ser transmitida pelo pai.

1.5.5.2

nalisando as informaes e os heredogramas acima de acordo com seus conhecimentos, correto afirmar, EXCETO: a) Os dois caracteres DMD e AME acima so recessivos. b) No podem ser gerados descendentes do sexo feminino afetados por DMD. c) A AME pode ser um carter ligado ao sexo. d) Os dois caracteres DMD e AME no podem estar localizados no mesmo par de homlogos. Questo 849 A hemofilia um distrbio gentico humano, que se caracteriza pela falta de um dos fatores de coagulao sangnea. O gene que codifica para a produo desse fator est localizado no cromossomo X em uma regio que no apresenta homologia em Y. O heredograma a seguir indica,
191

na segunda e terceira geraes, trs famlias (A, B e C) que apresentam, em comum, um progenitor afetado por essa anomalia.

constituem o sexo homogamtico (macho ZZ). Os experimentos a seguir foram desenvolvidos para se estudar a herana do carter padro da plumagem de galinceos da raa Langshan Black (fentipo Lisa) cruzados com galinceos da raa Plymouth Rock (fentipo Listrada).

1.5.5.2

1.5.5.2

Analisando-se o heredograma, correto afirmar, EXCETO: a) Na famlia A, pelo menos dois indivduos apresentam o gene causador de hemofilia. b) No existem indivduos portadores do gene da hemofilia na famlia B. c) Na famlia C, pelo menos um indivduo apresenta o gene causador de hemofilia. d) A chance de o casal II-5 II-6 ter uma criana afetada por esse carter de 1/4. Questo 850 Um homem e uma mulher com viso normal tiveram uma filha, Maria, tambm com viso normal para daltonismo. Do casamento de Maria com Manuel nasceu um casal de gmeos, sendo um deles daltnico e outro normal. Sabendo-se que o daltonismo uma caracterstica determinada por gene recessivo ligado ao sexo, INCORRETO afirmar: a) O pai de Maria no portador, mas Maria portadora do gene que causa daltonismo. b) Os dois gmeos podem ter recebido o gene recessivo que determina o daltonismo. c) Se o gmeo afetado for o do sexo masculino, Manuel certamente normal. d) Se o gmeo afetado por daltonismo for do sexo feminino, Manuel certamente daltnico. Questo 851 Em Galinceos a determinao do sexo (sistema ZW) segue um padro inverso ao que se observa em mamferos (sistema XY). Dessa forma as galinhas constituem o sexo heterogamtico (feminino ZW), enquanto os galos

O carter descrito uma herana ligada ao sexo. De acordo com as informaes apresentadas, correto afirmar, EXCETO: a) Os galos com padro de plumagem listrada representados, receberam o alelo dominante de seu progenitor do sexo feminino. b) Nos dois experimentos, os galos listrados de F so heterozigotos quanto aos alelos que determinam esse carter. c) O padro da plumagem das galinhas depende dos alelos que recebem do seu progenitor do sexo masculino. d) O carter plumagem lisa recessivo em relao ao carter plumagem listrada. Questo 852 A Displasia Ectodrmica Anidrtica (DEA) apresenta prevalncia na populao de 1:100.000 nascimentos, sendo uma sndrome hereditria recessiva ligada ao cromossomo X. O fentipo mais marcante dessa sndrome a ausncia de glndulas sudorparas na pele.

192

Questo 854 Robson, Michele e Aline so membros de uma mesma famlia. Para o carter daltonismo, as pessoas citadas apresentam o seguinte gentipo: Robson Michele Aline (Xd) Y (XD) (Xd) (XD) (XD)

1.5.5.2

A figura apresenta duas gmeas univitelnicas, heterozigotas e, portanto, no apresentam a sndrome. No entanto, as manchas que aparecem nessas mulheres so produzidas por um corante especial capaz de revelar reas com poucas ou nenhuma glndula sudorpara. Com base nas informaes dadas e em seus conhecimentos, INCORRETO afirmar: a) As manchas na pele das gmeas representadas podem ser o resultado da ocorrncia de heterocromatina para o cromossomo que carrega o alelo dominante. b) As gmeas podem ter herdado o alelo recessivo tanto de seu pai quando de sua me. c) Metade dos descendentes machos das gmeas devero apresentar a sndrome. d) Um macho com o alelo recessivo pode pass-lo para suas filhas e filhos, que apresentaro o fentipo da sndrome. Questo 853 Analise as afirmaes: I. O daltonismo transmitido por herana gentica. II. A hemofilia uma herana gentica ligada aos cromossomas sexuais. III. O genoma humano de 46 cromossomos. Est correta ou esto corretas: a) Somente I e II. b) I, II e III. c) Somente II e III. d) Somente I e III. e) Nenhuma.

Baseados nos mecanismos genticos, poderamos estabelecer os seguintes graus de parentesco. a) Robson pode ser filho de Aline. b) Robson, Michele e Aline podem ser irmos, mesmo que o pai seja daltnico. c) Michele pode ser me de Robson e de Aline. d) Robson pode ser pai de Aline e de Michele. e) Michele e Robson podem ser filhos de me daltnica e Aline a tia materna. Questo 855

1.5.5.2

fotografia mostra o ltimo czar da Rssia, Nicolau II, sua esposa Alexandra, suas quatro filhas (Olga, Tatiana, Maria, Anastasia) e seu filho Alexis, que sofria de hemofilia. Um irmo da czarina Alexandra tambm era afetado por essa doena. A probabilidade de que Olga, filha do casal, fosse portadora do alelo para hemofilia de a) 1/4 b) 1/64 c) 1/2 d) 1/8 e) 1/32

193

Questo 856

1.5.5.2

a) no ter chance de apresentar descendentes com a doena. b) poder ter apenas descendentes do sexo feminino com a doena. c) poder ter apenas descendentes do sexo masculino com a doena. d) poder ter metade de seus descendentes com a doena. e) ter todos os seus descendentes com a doena. Questo 858 O daltonismo uma doena hereditria e ligada ao sexo na espcie humana. Se um homem daltnico casa-se com uma mulher normal, no portadora do gene para o daltonismo, a probabilidade desse casal ter um filho homem e daltnico : a) 25 % b) 8 % c) 12,5 % d) 0 % Questo 859 Observe a rvore genealgica a seguir, referente a uma famlia com herana para daltonismo (herana ligada ao sexo e deve-se a um gene recessivo).

Na tira de quadrinhos, o homem de etnia amarela apresenta uma caracterstica determinada por um gene recessivo ligado ao sexo. Descendendo de pais com viso normal, pode-se dizer que ele a) homozigoto recessivo para esse gene. b) heterozigoto para essa caracterstica. c) recebeu o gene de sua me, heterozigota para essa caracterstica. d) recebeu o gene de seu pai, heterozigoto para essa caracterstica. e) recebeu o gene de seu pai, uma vez que o loco gnico est no cromossomo Y. Questo 857 Na genealogia a seguir, as pessoas indicadas pelos nmeros 3 e 6 apresentam uma doena rara determinada por um gene dominante localizado no cromossomo X. O casal indicado pelos nmeros 5 e 6

1.5.5.2

1.5.5.2

elativamente aos indivduos anteriores, podemos afirmar: a) somente o indivduo 2 daltnico b) o gentipo do indivduo 4 XdY c) o indivduo 1 normal, porm portador do gene para o daltonismo d) os indivduos 4 e 5 so daltnicos Questo 860 Em drosfilas, a cor amarela do corpo determinada por um gene recessivo localizado no cromossomo X, e a cor cinza pelo alelo dominante. Assinale a descendncia
194

esperada a partir do cruzamento entre uma fmea amarela e um macho cinzento. a) machos: 100% amarelos - fmeas: 100% cinzentas. b) machos: 100% cinzentos - fmeas: 100% amarelas. c) machos: 100% amarelos - fmeas: 50% cinzentas e 50% amarelas. d) machos: 50% cinzentos e 50% amarelos - fmeas: 100% cinzentas. e) machos: 50% cinzentos e 50% amarelos - fmeas: 50% cinzentas e 50% amarelas. Questo 861 O raquitismo resistente vitamina D uma doena determinada por um gene dominante de herana ligada ao sexo. Na prole de um homem afetado casado com uma mulher normal, espera-se que a) tanto os filhos quanto as filhas possam ser normais ou afetados. b) tanto os filhos quanto as filhas sejam sempre afetados. c) tanto os filhos quanto as filhas sejam sempre normais. d) apenas as filhas sejam afetadas. e) apenas os filhos sejam afetados. Questo 862 Considere o heredograma a seguir.

Questo 863 Em seres humanos, uma forma de daltonismo que provoca cegueira para as cores vermelho e verde, determinada pelo gene recessivo d, ligado ao cromossomo X. Ao consultar um mdico, um casal fica sabendo que todos os seus filhos do sexo masculino sero daltnicos; j as meninas sero normais. Qual das opes fenotpicas abaixo corresponde do casal em questo? a) Homem normal e mulher normal. b) Homem normal e mulher daltnica. c) Homem daltnico e mulher daltnica. d) Homem daltnico e mulher normal. e) Homem normal e mulher normal, porm portadora de gene recessivo d. Questo 864 Sobre a hemofilia, anomalia hereditria caracterizada por uma deficincia na coagulao do sangue, assinale o que for correto. (01) restrita ao sexo, ou seja, atinge indivduos de um nico sexo. (02) uma doena mais comum em homens que em mulheres. (04) As mulheres hemoflicas geralmente morrem na menarca, em virtude da no-coagulao do sangue. (08) O mecanismo gentico da hemofilia se deve presena de um gene ligado ao sexo. (16) Se transmite de pai para filho. Questo 865 Considere o heredograma:

1.5.5.2

partir da sua anlise, possvel concluir que a anomalia devida provavelmente a um alelo a) localizado no cromossomo Y. b) dominante, localizado no cromossomo X. c) recessivo, localizado no cromossomo X. d) dominante, situado num autossomo. e) recessivo, situado num autossomo.

1.5.5.2

195

abe-se que o pai, o marido, os cinco irmos homens e um sobrinho de Joana so normais. Entretanto, Joana teve um filho que apresentou sndrome hemorrgica caracterizada por baixo nvel plasmtico do fator VIII da coagulao. A probabilidade gentica de serem portadoras do gene para a hemofilia A, neste caso, : a) 100% para todas as mulheres da famlia b) 100% para Joana, sua me e sua filha c) 100% para Joana e 50% para sua filha d) 100% para Joana e 50% para as outras mulheres da famlia e) 100% para Joana e 25% para sua filha Questo 866 Tendo em vista o heredograma, analise os itens.

c) esta anomalia ser transmitida a todas as filhas. d) esta anomalia ser transmitida metade das filhas. e) esta anomalia no ser transmitida a nenhum descendente. Questo 868 Em bovinos ocorrem 60 cromossomos na clula somtica, sendo 58 autossomos mais dois cromossomos sexuais, XX na fmea, e 58 autosomos mais XY no macho. O gene responsvel pela quantidade de plos no animal est situado no cromossomo X. Esse gene representado por dois alelos, o R, responsvel por animal peludo, e o r, recessivo, responsvel por animal sem plo. A partir do cruzamento XrY XRXr,

1.5.5.2

as propores fenotpicas esperadas na descendncia so: a) Macho peludo: 1/4; Macho sem plo: 1/4; Fmea peluda: 1/4; Fmea sem plo: 1/4 b) Macho peludo: 9/16; Macho sem plo: 3/16; Fmea peluda: 3/16; Fmea sem plo: 1/16 c) Macho peludo: 3/8; Macho sem plo: 1/8; Fmea peluda: 3/8; Fmea sem plo: 1/8 d) Macho peludo: 36/64; Macho sem plo: 9/64; Fmea peluda: 9/64; Fmea sem plo: 10/64 e) Macho peludo: 1/8; Macho sem plo: 3/8; Fmea peluda: 3/8; Fmea sem plo: 1/8 Questo 869 Observe a figura a seguir que apresenta o heredograma de uma famlia na qual alguns membros apresentam hemofilia, grave anomalia relacionada alterao no tempo de coagulao do sangue. Essa figura indica os grupos sangneos do sistema ABO de alguns dos seus membros.

( ) O carter em questo condicionado por um gene recessivo e ligado ao sexo. ( ) Esse pedigree mostra um exemplo de herana passada do av ou da av para o neto por meio da me portadora. ( ) Essa rvore genealgica representa um caso de anomalia hereditria, determinada por um gene presente no cromossomo Y. ( ) Essa genealogia apresenta um tipo de interao gnica, como a cor da pele, influenciada pelo meio ambiente. Questo 867 Um homem possui uma anomalia dominante ligada ao cromossomo X e casado com uma mulher normal. Em relao aos descendentes deste casal CORRETO afirmar que: a) esta anomalia ser transmitida a todos os filhos do sexo masculino. b) esta anomalia ser transmitida metade dos filhos do sexo masculino.

196

Questo 871 Analise o heredograma. 1.5.5.2

1.5.5.2

Com base nas informaes do heredograma e considerando-se que no ocorreu mutao, INCORRETO afirmar-se que a) a probabilidade de II-3 ser portadora do gene da hemofilia de 50%. b) a probabilidade de nascimento de outra criana hemoflica e do grupo B para o casal III-6 e III-7 de 25%. c) o indivduo III-4 pode receber sangue de III-6. d) o indivduo II-5 tem 50% de probabilidade de formar gametas do tipo iXh. e) o indivduo I-1 heterozigoto para o sistema ABO. Questo 870 Ao fazer um exame de vista para tirar carteira de motorista, um rapaz descobriu que era daltnico. Assinale entre as alternativas a seguir aquela que contm o heredograma que NO poderia representar a famlia desse rapaz.

ssinale a alternativa que NO contm um tipo de herana compatvel com a anomalia representada no heredograma. a) Ligada ao X. b) Autossmica recessiva. c) Ligada ao Y. d) Autossmica dominante. Questo 872 A enzima G-6-PD (glicose-6-fosfato desidrogenase) est presente nas hemcias de indivduos normais. A ausncia dessa enzima, em indivduos afetados, torna as hemcias sensveis a certas drogas e nutrientes, provocando sua destruio. O gene que determina a ausncia de G-6-PD recessivo e situa-se no cromossoma X. Observe o heredograma que representa uma famlia com essa caracterstica.

1.5.5.2 1.5.5.2

a) 1 b) 2 c) 3 d) 4

197

om base nesse heredograma, CORRETO afirmar que a) cada um dos indivduos representados tem, pelo menos, um gene para ausncia de G-6-PD. b) essa famlia apresenta dois indivduos heterozigotos para o gene que determina a G-6-PD. c) casais como I.1 x I.2 tm probabilidade maior de ter filhos afetados do que de ter filhas afetadas. d) o indivduo II-3 pode ter recebido o gene da G-6-PD tanto do seu pai quanto de sua me. Questo 873 A distrofia muscular do tipo Duchenne, doena recessiva ligada ao cromossomo X, caracteriza-se por debilidade muscular progressiva e deformidades sseas, inicia-se na infncia e impede a reproduo dos afetados. Considerando-se essas informaes e outros conhecimentos sobre o assunto, INCORRETO afirmar que a) casais com filhos afetados tm 25% de probabilidade de ter outra criana com essa doena. b) indivduos do sexo masculino afetados por essa distrofia muscular so filhos de mes heterozigotas. c) indivduos do sexo masculino que possuem um gene mutante para essa distrofia manifestam a doena. d) mulheres afetadas recebem os cromossomos X materno e paterno com o gene para essa distrofia. Questo 874 Analise este heredograma, em que est representada a herana do daltonismo, condicionada por gene recessivo localizado no cromossoma X:

Considerando-se as informaes contidas nesse heredograma e outros conhecimentos sobre o assunto, CORRETO afirmar que a) o indivduo I.2 apresenta o fentipo normal e portador do gene do daltonismo. b) o indivduo II.4 recebeu o gene do daltonismo de qualquer um de seus genitores. c) os casais como I.1 e I.2 tm maior probabilidade de ter filhos do sexo masculino daltnicos. d) os filhos do sexo masculino de II.2 sero daltnicos, independentemente do gentipo do seu pai. Questo 875 Considerando que o heredograma a seguir o de uma herana dominante, ligada ao X, analise os itens:

1.5.5.2

. A mulher I.2 homozigota 2. A mulher I.2 heterozigota 3. A mulher II.4 homozigota 4. A mulher III.5 heterozigota 5. A mulher III.9 homozigota Est(o) correto(s) apenas: a) 1 b) 2 c) 3 d) 1 e 3 e) 1 e 2 Questo 876 A figura a seguir faz referncia a uma genealogia que ilustra a ocorrncia de uma determinada doena gentica. Analise-a e avalie as proposies dadas.

1.5.5.2

198

1.5.5.2

1.5.5.2

( ) A caracterstica mostrada no heredograma determinada por uma srie poliallica de genes autossmicos. ( ) O loco gnico determinante deste carter deve estar localizado na poro no-homloga do cromossomo X. ( ) Observando-se que a maioria dos machos (I, II, III, III e III) manifestam a caracterstica em considerao, pode-se concluir que se trata da herana de genes localizados no cromossomo Y. ( ) Os descendentes III e III apresentam o mesmo gentipo. ( ) A identidade genotpica tambm observada entre II e II. Questo 877 A hemofilia uma doena hereditria em que h uma falha no sistema de coagulao do sangue. A hemofilia A, um dos tipos mais graves, causada pela deficincia de um dos fatores que agem na coagulao, o fator VIII. Esse fator uma protena cujo gene codificador encontra-se no cromossomo X; o alelo normal (H) produz o fator VIII e condiciona fentipo no hemoflico; o alelo mutante (h) condiciona ausncia do fator VIII, sendo responsvel por este tipo de hemofilia. AMABIS, J.M.; MARTHO, G.R. "Conceitos de Biologia". V3. So Paulo: Ed. Moderna, 2003. Observe o heredograma (fig. 1) de uma famlia em que ocorre a hemofilia A, considerando que os indivduos 2 e 4 so irms.

Com base nos textos e em seus conhecimentos, analise as afirmativas. I. As irms 2 e 4 apresentam, respectivamente, gentipos da figura 2 e a consanginidade, atravs da unio entre primos irmos (indivduos 5 e 6), condicionou a manifestao do alelo deletrio h para hemofilia. II. O indivduo 7 hemoflico, pois herdou o alelo recessivo para ausncia do fator VIII de sua me, e o indivduo 8 pode ou no ser portador deste alelo recessivo. III. Dos primos que se casaram, somente o indivduo 6 portador do alelo recessivo que causa a hemofilia, enquanto que o indivduo 5 no apresenta este alelo, pois herdou da me o alelo normal (H). IV. Se o indivduo 7 tiver filhos com uma mulher que tenha o mesmo gentipo para hemofilia de sua av materna, a probabilidade de terem filhos hemoflicos de 50% e de terem filhas hemoflicas de 0%. Esto corretas apenas as afirmativas a) I e IV. b) III e IV. c) II, III. d) I e II. e) I e III. Questo 878 O diagrama abaixo mostra a surdez em trs geraes de uma famlia. Um crculo preto representa uma mulher surda e um crculo branco representa uma mulher normal. Um quadrado preto representa um homem surdo e um quadrado branco um homem normal.

199

1.5.5.2

(08) Esse gene deve se manifestar apenas nos machos. (16) Machos afetados descendem de machos tambm afetados. (32) Machos afetados descendem de fmeas portadoras ou afetadas. (64) Fmeas afetadas so necessariamente descendentes de fmeas afetadas. Soma ( )

Questo 881 condio de surdez mostrada no heredograma herdada como uma caracterstica: a) autossmica dominante. b) autossmica recessiva. c) dominante ligada ao sexo. d) recessiva ligada ao sexo. e) holndrica. Questo 879 A cegueira da cor verde na espcie humana uma caracterstica recessiva ligada ao sexo. Em uma famlia, a filha possui viso normal, enquanto o filho no enxerga a cor verde. correto afirmar que: a) a me obrigatoriamente apresenta a cegueira da cor verde. b) o pai heterozigoto para a cegueira da cor verde. c) o pai homozigoto para a cegueira da cor verde. d) a me pelo menos heterozigota para a cegueira da cor verde. e) o pai obrigatoriamente apresenta a cegueira da cor verde. Questo 880 Genes situados na poro mpar do cromossomo X so transmitidos segundo um padro definido como Herana Ligada ao Sexo. Considerando um gene recessivo e localizado nessa poro do cromossomo X, correto afirmar: (01) Esse gene deve se manifestar com igual freqncia em machos e fmeas. (02) Esse gene deve se manifestar com maior freqncia nas fmeas. (04) Esse gene deve se manifestar com maior freqncia nos machos. Em camundongos, o fentipo cauda curta e retorcida determinado por um gene dominante denominado "Bent", localizado no cromossomo sexual comum aos dois sexos. Seu alelo recessivo responsvel pelo fentipo cauda normal. Se uma fmea de cauda normal for cruzada com um macho de cauda retorcida, sua descendncia apresentar a seguinte proporo: a) machos e fmeas com cauda curta e retorcida na proporo de 100%. b) machos e fmeas com cauda curta e retorcida na proporo de 2:1. c) machos e fmeas com cauda normal na proporo de 100%. d) todos os machos com cauda curta e retorcida e todas as fmeas com cauda normal. e) todos os machos com cauda normal e todas as fmeas com cauda curta e retorcida. Questo 882 Existe uma doena condicionada por um gene recessivo, localizado na regio no homloga do cromossomo X, que leva a uma debilidade muscular progressiva (distrofia muscular progressiva). - Uma mulher com fentipo normal tem um irmo afetado e um tio materno tambm afetado pela doena; - seus pais no so afetados; - ela est casada com um homem normal. Qual a probabilidade de que um(a) filho(a) deste casal venha a ser afetado pela doena? a) Se a mulher for homozigota, a probabilidade 100%. b) Se a mulher for homozigota, a probabilidade zero. c) Se a mulher for homozigota, a probabilidade 25%. d) Se a mulher for heterozigota, a probabilidade 75%.
200

e) Se a mulher for heterozigota, a probabilidade 100%. Questo 883 Interprete o heredograma abaixo.

Questo 886 Em um caso de disputa da paternidade de um menino hemoflico, esto envolvidos um homem que tem a doena e outro que no a tem. (Hemofilia: herana recessiva ligada ao X) Analise as afirmaes abaixo a esse respeito. I - As bases genticas da hemofilia apoiam a paternidade do homem hemoflico. II - O homem no hemoflico pode ser o pai do menino. III - O homem hemoflico no pode ser o pai do menino. Quais esto corretas? a) Apenas I. b) Apenas II. c) Apenas III. d) Apenas I e II. e) Apenas II e III. Questo 887 Assinale a proposio CORRETA. Em um indivduo daltnico, do sexo masculino, o gene para o daltonismo encontra-se: a) em todas as clulas somticas. b) em todas as clulas gamticas. c) apenas nas clulas do globo ocular. d) apenas nas clulas-me dos gametas. e) apenas nos gametas com cromossomo y. Questo 888 A hemofilia uma doena hereditria em que h um retardo no tempo de coagulao do sangue, e decorre do no funcionamento de um dos fatores bioqumicos de coagulao. Com relao a essa doena, assinale a(s) proposio(es) CORRETA(S). (01) No possvel a existncia de mulheres hemoflicas. (02) condicionada por um gene que se localiza no cromossomo X, em uma regio sem homologia no cromossomo Y. (04) Entre as mulheres, possvel encontrar um mximo de trs fentipos e dois gentipos.
201

1.5.5.2

dentifique o mais provvel padro de herana representado no heredograma. a) autossmica dominante b) ligada ao X dominante c) ligada ao Y dominante d) ligada ao Y recessiva e) ligada ao X recessiva Questo 884 Um homem heterozigoto para um gene autossmico, Aa, e possui um alelo ligado ao X recessivo b. Que proporo dos seus espermatozides espera-se que seja A/X ? a) 0 % b) 25 % c) 50 % d) 75 % e) 100 % Questo 885 Nos gatos domsticos a cor do plo ligada ao cromossomo X. Assim, os machos podem se pretos ou amarelos e as fmeas podem ser pretas amarelas ou malhadas. Quando metade das fmeas de uma ninhada malhada, a outra metade preta, e metade dos machos amarela, de que cores so os pais? a) A me malhada e o pai, preto. b) A me malhada e o pai, amarelo. c) A me amarela e o pai, preto. d) A me preta e o pai, amarelo. e) A me e o pai so pretos.

(08) Entre os homens, possvel ocorrer apenas um gentipo; por isso, h uma maior incidncia dessa doena entre eles. (16) Entre os descendentes de um homem hemoflico e de uma mulher normal, no portadora, espera-se que 50% deles sejam normais e 50% sejam hemoflicos. (32) um exemplo de herana ligada ao sexo, em que os indivduos afetados tm graves hemorragias, mesmo no caso de pequenos ferimentos. Soma ( )

- menina com viso normal para as cores; - menino com viso normal para as cores; - menino com daltonismo. Sabendo-se que o daltonismo uma herana ligada ao X, a possibilidade de esse casal ter uma filha com daltonismo a) zero. b) 1/4. c) 1/2. d) 3/4. e) 1. Questo 892 Na espcie humana, a distrofia muscular de Duchenne uma doena condicionada por um gene recessivo localizado no cromossomo X, que acarreta degenerao e atrofia dos msculos. Os homens afetados comeam a apresentar os sintomas na primeira infncia e no se reproduzem porque morrem antes de atingir o perodo reprodutivo. Analise as afirmativas abaixo. I- A distrofia muscular de Duchenne uma doena que ocorre quase que exclusivamente em meninos. II- Devido inativao ao acaso de um cromossomo X, que ocorre nas clulas das fmeas dos mamferos (hiptese de Lyon), as mulheres heterozigotas para o gene da distrofia muscular de Duchenne podem apresentar graduaes da caracterstica. III- A distrofia muscular de Duchenne uma doena que ocorre exclusivamente no sexo masculino. So corretas as afirmativas a) apenas III. b) I e III. c) II e III. d) I e II. Questo 893 Observe a genealogia abaixo sobre uma famlia que apresenta pessoas afetadas por uma anomalia hereditria.

Questo 889 A hemofilia uma doena recessiva ligada ao sexo, que se caracteriza pela dificuldade de coagulao do sangue. Em um casal em que a mulher heterozigota para a hemofilia e o marido normal, a probabilidade de nascimento de uma criana do sexo masculino e hemoflica a) 1/2. b) 1/3. c) 1/4. d) 1/8. e) 3/4. Questo 890 Em drosfila, o carter cerdas retorcidas determinado por um gene recessivo e ligado ao sexo. O alelo dominante determina cerdas normais (no retorcidas). Uma fmea heterozigota foi cruzada com um macho normal. A descendncia esperada ser de a) 50% de machos e 50% de fmeas normais e 50% de machos e 50% de fmeas com cerdas retorcidas. b) 50% de machos normais, 50% de machos com cerdas retorcidas e 100% de fmeas normais. c) 100% de machos normais, 50% de fmeas com cerdas retorcidas e 50% de fmeas normais. d) 100% de machos com cerdas retorcidas e 100% de fmeas normais. e) 100% de machos normais e 100% de fmeas com cerdas retorcidas. Questo 891 Um casal que possui viso normal para as cores, tem 3 filhos com as seguintes caractersticas:

202

1.5.5.2

1.5.5.2

anomalia em questo transmitida por meio de um gene a) recessivo ligado ao cromossomo X. b) autossmico recessivo. c) dominante ligado ao cromossomo X. d) autossmico dominante. Questo 894 Na espcie humana, a calvcie hereditria uma caracterstica influenciada pelo sexo. O gene que condiciona a calvcie dominante nos homens e recessivo nas mulheres. O daltonismo de herana recessiva ligada ao cromossomo X. Um casal no-calvo e de viso normal tem um filho calvo e daltnico. Considerando os dados apresentados, analise as afirmativas a seguir. I - A mulher dupla heterozigota para os genes em questo. II - possvel que o casal tenha filhas no-calvas, de viso normal em um dos olhos, mas daltnicas do outro. III - 25% das filhas do casal podero ser calvas e daltnicas. Marque a alternativa correta. a) I e II so corretas. b) I e III so corretas. c) II e III so corretas. d) Apenas III est correta. Questo 895 O gene h que determina a hemofilia na espcie humana recessivo e est localizado no cromossomo X. Com base no heredograma a seguir, podemos afirmar corretamente:

a) O gentipo da Sra 5 XHXH. b) O gentipo da Sra 5 XHXh. c) O gentipo da Sra 8 XHXH. d) O gentipo do Sr 9 XHY. e) O gentipo da Sra 8 XhXh. Questo 896 Com relao colorao da pelagem de gatos, observam-se os seguintes fentipos:

1.5.5.2

Utilizando as informaes anteriores, julgue os itens a seguir. (0) O carter cor da pelagem, nos gatos, condicionado por genes ligados ao cromossomo X, no havendo dominncia. (1) As fmeas manchadas so heterozigotas para o carter cor da pelagem. (2) Os descendentes de uma fmea amarela, cruzada com um macho preto, sero manchados. (3) Um gato macho no transmite para seus filhos machos os genes para cor da pelagem.

203

Questo 897 Em moscas de frutas, a cor branca dos olhos devida herana ligada ao sexo. Uma mosca fmea com olhos coloridos, cuja me tinha olhos brancos, cruza-se com macho de olhos brancos. Qual a probabilidade de se obter uma fmea de olhos brancos deste cruzamento? a) 1,00. b) 0,67. c) 0,50. d) 0,25. e) 0,00. Questo 898 Considere o heredograma, que representa uma famlia portadora de carter recessivo condicionado por um gene situado em um dos cromossomos sexuais.

c) 3. d) 4. e) 5. Questo 900 A genealogia abaixo nos mostra uma forma de transmisso do daltonismo.

1.5.5.2

Assinale dentre as alternativas que se seguem, a(s) correta(s). (01) O daltonismo est relacionado com genes localizados em cromossomos autossmicos. (02) O daltonismo determinado por um gene recessivo, sendo que seu alelo dominante condiciona viso normal. (04) O indivduo 1 transmite a todas as suas filhas um cromossomo Xd. (08) O indivduo 8 tem o mesmo fentipo de sua av materna. (16) O casal 1 x 2 pode ter filhos homens daltnicos. (32) O gentipo do indivduo 9 XdY. (64) O gentipo do indivduo 5 XdXd. Questo 901 Um casal no hemoflico teve um filho do sexo masculino com hemofilia. Indique a alternativa com a probabilidade desse casal ter uma filha hemoflica: a) 0% b) 25% c) 50% d) 75% e) 100%

1.5.5.2

respeito desta genealogia, podemos afirmar que a) a mulher 2 homozigota. b) as filhas do casal 3 e 4 so, certamente, portadoras do gene. c) as mulheres 2 e 3 so, certamente, portadoras do gene. d) todas as filhas do casal 1 e 2 so portadoras do gene. e) os homens 1 e 4 so, certamente, portadores do gene. Questo 899 Uma mulher portadora de um gene letal presente no cromossomo X. Este gene provoca aborto espontneo algumas semanas aps a formao do zigoto. Se esta mulher der luz seis crianas normais, em seis partos diferentes, o nmero esperado de crianas do sexo masculino ser a) 1. b) 2.

204

Questo 902 Na espcie humana, a determinao cromossmica do sexo dada pelos cromossomos X e Y. O cromossomo Y apresenta genes holndricos, isto , genes que no possuem homologia com o cromossomo X. As caractersticas condicionadas por tais genes so a) transmitidas da me para 100% das filhas. b) transmitidas do pai para 100% dos filhos homens. c) transmitidas do pai s para as filhas. d) transmitidas do pai para os filhos homens e filhas em 100% dos casos. e) exclusivas das mulheres. Questo 903 A hipertricose auricular uma anomalia gentica condicionada por um gene localizado no cromossomo Y. Um homem com hipertricose casa-se, e todos os seus filhos so homens. Na prxima gerao dessa famlia esse gene se manifestar a) em todas as mulheres. b) em todos os homens. c) em 50% das mulheres e 50% dos homens. d) somente nas mulheres heterozigotas. e) somente nos homens heterozigotos. Questo 904 Como exemplo de caracterstica na espcie humana, determinada por genes localizados no cromossomo Y, ou seja, por genes holndricos, temos: a) a diferenciao dos testculos. b) o aparecimento do corpsculo de Barr. c) a hemofilia. d) o daltonismo. e) o albinismo. Questo 905 O exame citogentico de um indivduo normal revelou que o seu cromossomo Y contm, aproximadamente, 30% a mais de heterocromatina na regio distal, em relao ao padro de cromossomo Y presente na populao. Embora sem nenhuma manifestao fenotpica aparente, ele fez algumas suposies sobre a herana desse cromossomo. Assinale a suposio que est geneticamente coerente: a) Acho que o meu pai herdou essa condio gentica da

me dele. b) Se eu tenho este Y, todos os meus descendentes tambm o tero. c) Se o meu irmo no tiver esse Y, talvez ele no seja meu irmo. d) Entre as minhas filhas, apenas 50% tero esse cromossomo. e) Provavelmente esse Y ficou grande para ser o homlogo do X. Questo 906 A hipertricose auricular (plos na orelha) transmitida apenas pelo homem e somente para os filhos do sexo masculino. Este fenmeno chamado de: a) epistasia. b) codominncia. c) herana holndrica. d) pleiotropia. e) interao gnica. Questo 907 Mendel, nas primeiras experincias sobre hereditariedade, trabalhou com apenas uma caracterstica de cada vez. Posteriormente, ele acompanhou a transmisso de dois caracteres ao mesmo tempo, e os resultados levaram-no a concluir que: "fatores para dois ou mais caracteres so transmitidos para os gametas de modo totalmente independente". Esta observao foi enunciada como "2 Lei de Mendel" ou "Lei da Segregao Independente", a qual no vlida para os genes que esto em ligao gnica ou "linkage", isto , genes que esto localizados nos mesmos cromossomos. Observando as seguintes propores de gametas produzidos pelo dibrido AaBb em trs situaes distintas. I - AB (25%); Ab (25%); aB (25%); ab (25%), II - AB (50%); ab (50%), III - AB (40%); Ab (10%); aB (10%); ab (40%), pode-se afirmar que: a) I e II so situaes nas quais os genes segregam-se independentemente. b) II e III so situaes nas quais ocorre segregao independente e ligao gnica sem "crossing-over", respectivamente,
205

c) I e III so situaes nas quais ocorre segregao independente e ligao gnica com "crossing-over", respectivamente. d) II uma situao na qual ocorre ligao gnica com "crossing-over". e) III uma situao na qual ocorre ligao gnica sem "crossing-over". Questo 908 Considere uma espcie de vertebrado cujas clulas embrionrias tm oito cromossomos. Em quantos grupos de ligaes seus genes estaro associados? a) Dois. b) Quatro. c) Oito. d) Dezesseis. e) Nmero varivel. Questo 909 Considere uma espcie de vertebrado cujas clulas somticas tm 12 cromossomos. Em quantos grupos de ligaes seus genes estaro associados? a) Quatro. b) Seis. c) Trs. d) Oito. e) Dez. Questo 910 O cruzamento de dois indivduos, um com gentipo AaBb e outro com gentipo aabb resultou numa F com as seguintes propores: AaBb = 35% aabb = 35% Aabb = 15% aaBb = 15% Com esses resultados, pode-se concluir que os genes "a" e "b": a) esto em um mesmo brao do cromossomo. b) seguem as leis do diibridismo. c) constituem um caso de interao gnica. d) so pleiotrpicos. e) so epistticos.

Questo 911 Quando dois genes esto em um mesmo cromossomo, existe uma ligao gnica. A taxa de recombinao entre eles depender do quanto estiverem afastados um do outro, no cromossomo. A esse propsito, analise a figura e as afirmaes feitas a seguir.

1.5.6

( ) A freqncia de recombinao entre os locos A e B de 17%. ( ) A probabilidade do aparecimento de um indivduo AB//ab, a partir do cruzamento acima indicado, de aproximadamente 42%. ( ) Se, em 100% das clulas germinativas da fmea, ocorrer permutao entre os locos A e B, cada tipo de gameta recombinante (Ab e aB) aparecer com freqncia de 25%. ( ) Se, em 50% das clulas produtoras de gametas, ocorrer permutao entre os locos A e B, os gametas no recombinantes e os recombinantes surgiro nas propores esperadas de 1:1:1:1. ( ) Considerando o cruzamento ilustrado na figura, pode-se inferir que ocorreu permutao (ou crossing-over), em 8,5% das clulas formadoras de gametas. Questo 912 A freqncia de recombinao entre os locos A e B de 10%. Em que percentual sero esperados descendentes de gentipo AB // ab, a partir de progenitores com os gentipos mostrados na figura?

206

Questo 914 Uma determinada espcie vegetal apresenta variao para cor da flor - roxo e branco -, cor do hipoctilo - roxo e verde - e pilosidade no clice da flor - com (piloso) e sem (glabro). A cor roxa da flor e do hipoctilo e a presena de pilosidade so dominantes. Em todos os cruzamentos realizados entre plantas fenotipicamente diferentes e aps avaliaes em vrias geraes segregantes, foi observado que todas as plantas que apresentavam flores roxas, o hipoctilo era roxo e todas as plantas que apresentavam flores de cor branca, o hipoctilo era verde (situao 1). Entretanto, ao cruzarem um duplo heterozigoto para os caracteres cor da flor e pilosidade no clice da flor com um duplo-recessivo, foi observada na prognie a seguinte proporo (situao 2):

1.5.6

a) 5% b) 90% c) 45% d) 10% e) 20% Questo 913 Dois fentipos de interesse econmico, em milho, so determinados, respectivamente, pelos locos A e B, ambos com dominncia completa. Plantas homozigticas, fenotipicamente (AB), foram cruzadas com plantas de fentipo (ab). A F1, fenotipicamente (AB), foi retrocruzada com o pai duplo-recessivo, obtendo-se uma F2 como mostrado no quadro. Analise as proposies a seguir quanto correo.

1.5.6

1.5.6

( ) Trata-se de um caso de ligao gnica. A gerao P genotipicamente (AB//AB) x (ab//ab). ( ) Em 60% das clulas formadoras de gametas da F1, ocorreu permutao entre os locos A e B. ( ) A taxa de recombinao no caso mostrado de 30%. ( ) Os locos A e B distam entre si de 35 unidades de mapa. ( ) Em 35% das clulas gamticas da F1 ocorreu recombinao.

Com base no texto e em seus conhecimentos correto afirmar que a) a primeira situao pode representar um caso de pleiotropia e a segunda mostra um caso de ligao gnica. b) a primeira situao pode representar um caso de pleiotropia e a segunda evidencia uma segregao independente dos genes. c) a primeira situao evidencia ligao gnica e a segunda mostra a segregao independente dos genes. d) em ambas as situaes ficou evidenciado o efeito pleiotrpico entre os genes. e) em ambas as situaes ficou evidenciada a ligao gnica, sendo que na segunda, a ligao mais forte do que na primeira, o que mostra uma distncia menor entre os genes.

207

Questo 915 Os seguintes conceitos genticos foram escritos por um aluno que estava com dvidas sobre a matria e que pediu a um professor qualificado que os conferisse: I - Os genes em um mesmo cromossomo tendem a ser herdados juntos e so denominados "genes ligados" II - Quando uma caracterstica particular de um organismo governada por muitos pares de genes, que possuem efeitos similares e aditivos, ns dizemos que esta caracterstica uma caracterstica polignica. III - Quando trs ou mais alelos, para um dado "locus", esto presentes na populao, dizemos que este "locus" possui alelos mltiplos. IV - Um organismo com dois alelos idnticos para um "locus" em particular considerado homozigoto para este "locus", enquanto um organismo com dois alelos diferentes para um mesmo "locus" considerado heterozigoto para este "locus". V - A aparncia de um indivduo com respeito a uma dada caracterstica herdada chamada de fentipo. Quais afirmativas o professor diria que esto corretas? a) Apenas II, III e IV b) Apenas I, II, III e IV c) Apenas I, II, III e V d) Apenas II, III, IV e V e) I, II, III, IV e V Questo 916 Numa determinada populao a capacidade de enrolar a lngua determinada por um gene dominante A. Nessa mesma populao foi observado que 64% das pessoas apresentam esta caracterstica. A freqncia esperada de indivduos heterozigotos ser de: a) 70% b) 48% c) 36% d) 16% e) 10%

Questo 917 A doena de Tay-Sachs resulta da ao de um gene mutante localizado no cromossomo nmero 15, provocando a degenerescncia nervosa mortal. O diagnstico pr-natal possvel, e h tentativas de tratamento com algum sucesso em poucos casos. Em certas comunidades da Europa Central, uma em cada 30 pessoas apresenta fentipo normal e heterozigota quanto ao gene determina a doena de Tay-Sachs. Em 2.700 casamento ocorridos entre membros sadios dessas comunidades, o nmero esperado de casamentos com risco de gerar crianas com degenerescncia nervosa : a) 0,3 b) 3 c) 45 d) 60 e) 90 Questo 918 O grfico a seguir mostra a dinmica das freqncias do gene s, o qual determina a doena chamada siclemia ou anemia falciforme. Os homozigotos siclmicos morrem precocemente devido severa anemia; os heterozigotos sofrem de uma forma branda da anemia mas, por outro lado, so mais resistentes malria que os indivduos normais. O grfico refere-se ao perodo posterior erradicao da malria. Qual a explicao para o comportamento das curvas do grfico?

1.5.7

208

a) Diminuio da freqncia de mutao de S para s. b) Seleo contra os portadores do gene s. c) Aumento da freqncia de mutao de S para s. d) Cruzamentos preferenciais entre pessoas anmicas. e) Cruzamentos preferenciais entre portadores de malria. Questo 919 Considere uma populao em que metade dos indivduos mantm-se heterozigota para um dado gene (Aa), enquanto que a outra metade composta por indivduos duplo-recessivos (aa). Nessa populao a freqncia do alelo A a) impossvel de se determinar. b) 1,00. c) 0,75. d) 0,50. e) 0,25. Questo 920 A freqncia de indivduos afetados por uma anomalia gentica autossmica recessiva, em uma dada populao, era de 0,16. Constatou-se a diminuio dessa freqncia aps a) a morte de 5% da populao total por falta de alimento. b) a imigrao de muitos indivduos homozigotos dominantes. c) o nascimento de 48 indivduos afetados entre 300 nascidos. d) o casamento preferencial de indivduos heterozigotos. e) o crescimento da populao da populao devido a diminuio da predao. Questo 921 A sensibilidade (gosto amargo) do ser humano ao PTC (feniltiocarbamida) se deve a um gene autossmico dominante I e a insensibilidade, ao seu alelo recessivo i. Sabendo-se que, numa populao de 1200 pessoas, as freqncias dos genes I e i so, respectivamente, 0,8 e 0,2, os nmeros esperados de pessoas sensveis e insensveis nessa populao so, respectivamente: a) 960 e 240. b) 768 e 432. c) 1008 e 192. d) 1152 e 48. e) 816 e 384.

Questo 922 Numa populao, a freqncia de um gene autossmico dominante A o triplo da freqncia do seu alelo recessivo a. Essa populao estar em equilbrio gentico, se as propores genotpicas forem: a) AA - 6/16; Aa - 9/16; aa - 1/16; b) AA - 9/16; Aa - 1/16; aa - 6/16; c) AA - 9/16; Aa - 6/16; aa - 1/16; d) AA - 6/16; Aa - 6/16; aa - 4/16; e) AA - 4/16; Aa - 8/16; aa - 4/16; Questo 923 Sabendo-se que uma populao est em equilbrio gentico e que a freqncia de indivduos homozigotos para um carter autossmico e dominante (AA) de 25%, conclumos que a freqncia de indivduos homozigotos recessivos (aa) de: a) 6,25% b) 12,5% c) 25% d) 50% e) 75% Questo 924 Sabendo-se que a freqncia do gene autossmico A igual a 0,8, numa populao constituda de 8.000 indivduos, indique a alternativa que mostra o nmero de indivduos para cada gentipo, se essa populao estiver em equilbrio gentico. a) AA - 6.400; Aa - 1.440; aa - 160. b) AA - 6.400; Aa - 1.280; aa - 320. c) AA - 5.120; Aa - 1.280; aa - 1.600. d) AA - 6.560; Aa - 1.280; aa - 160. e) AA - 5.120; Aa - 2.560; aa - 320. Questo 925 A hemofilia causada por um gene recessivo (h) localizado no cromossomo X. Se, numa determinada populao, um homem em 25.000 hemoflico, a freqncia do gene h nessa populao a) 1/500 b) 1/12.500 c) 1/25.000 d) 1/50.000
209

e) 1/100.000 Questo 926 Em uma populao em equilbrio de Hardy-Weinberg, a freqncia do alelo autossmico (b) de 30%. Se essa populao for formada por 1000 indivduos, espera-se que sejam heterozigotos a) 700 b) 420 c) 90 d) 49 e) 21 Questo 927 Analise o heredograma a seguir no qual os smbolos escuros significam a presena de uma anomalia. 1.5.7

Questo 929 Uma populao em que atuam os princpios postulados por Hardy e Weinberg, as freqncias genotpicas de um determinado par de alelos "a" se distribui de acordo com o grfico destacado: Marque o grfico que representa a freqncia genotpica aps 12 geraes:

1.5.7 1.5.7

abendo-se que a freqncia de heterozigotos na populao 1/20, a probabilidade do casal III.1 x III.2 vir a ter uma criana com a anomalia a) 1/420 b) 1/160 c) 1/120 d) 1/80 e) 1/50 Questo 928 Em drosfilas, o comprimento das asas determinado por um par de genes. O alelo que condiciona asas longas dominante sobre o alelo que condiciona asas vestigiais. Sabendo-se que, em uma populao mantida em laboratrio, 16% apresentavam asas vestigiais, calcularam-se outras freqncias, que esto indicadas na tabela abaixo. Assinale a alternativa correspondente aos clculos corretos.

Questo 930 A calvcie na espcie humana determinada por um gene autossmico C, que tem sua expresso influenciada pelo sexo. Esse carter dominante nos homens e recessivo nas mulheres, como mostra a tabela a seguir:

210

1.5.7

esta populao, as freqncias dos alelos M e N so, respectivamente, a) 0,16 e 0,84. b) 0,24 e 0,48. c) 0,36 e 0,16. d) 0,48 e 0,24. e) 0,60 e 0,40. Questo 932 Numa populao em equilbrio de Hardy-Weinberg, formada por 10.000 indivduos, existem 900 do tipo Rh negativo. Espera-se que o nmero de indivduos Rh positivo homozigoto nessa populao seja de a) 9.100 b) 4.900 c) 4.550 d) 2.100 e) 900 Questo 933 Sabe-se que olhos escuros so dominantes sobre olhos azuis. Sabe-se tambm que, na maioria das populaes da Amrica do Sul predomina o nmero de pessoas de olhos escuros, enquanto em diversas populaes europias acontece o inverso: pessoas de olhos escuros constituem a minoria. Essa diferena deve-se fato de a) a herana da cor dos olhos no obedecer s leis de Mendel. b) a mecanismo de herana da cor dos olhos no ser ainda bem conhecido. c) a dominncia dos genes relacionados com a cor dos olhos modificar-se com o ambiente. d) a freqncia dos alelos para olhos escuros ser maior nas populaes sul-americanas do que nas europias. e) tratar-se de um caso de herana quantitativa, que sempre influenciada por fatores ambientais. Questo 934 Na espcie humana, h certas protenas no sangue que permitem classificar as pessoas como pertencentes ao tipo sangneo M, N ou MN. Essa caracterstica determinada por um par de alelos entre os quais no h dominncia. Se em uma populao em equilbrio de Hardy-Weinberg, a freqncia de indivduos do grupo M 49%, as freqncias esperadas de indivduos dos grupos N e MN so,
211

m uma populao, em equilbrio de Hardy-Weimberg, onde 81% dos homens no apresentam gentipo capaz de torn-los calvos, qual a freqncia esperada de mulheres cujo gentipo pode torn-las calvas? a) 1% b) 8,5% c) 19% d) 42% e) 81% Questo 931 Para responder questo, considere a informao a seguir. Um levantamento nos pronturios mdicos de um importante hospital brasileiro identificou o grupo sangneo MN de 10.000 indivduos revelando os dados apresentados no quadro abaixo. A anlise da populao estudada concluiu que a mesma se encontra em equilbrio de Hardy-Weinberg.

1.5.7

respectivamente, a) 9% e 42% b) 17% e 34% c) 18% e 21% d) 21% e 18% e) 34% e 17% Questo 935 Suponha que uma variedade de determinada planta possua um gene que lhe confere vantagem em relao a uma outra variedade da mesma populao. Com o tempo, a freqncia desse gene tende a aumentar devido a) ao fato de ser recessivo. b) s mutaes que continua a sofrer. c) seleo natural. d) ao seu efeito dominante. e) oscilao gentica. Questo 936 Tamanho ...(I)..., cruzamentos ...(2)... e fatores evolutivos ...(3)... so condies para que, numa populao, as freqncias gnicas e genotpicas se mantenham constantes ao longo das geraes, de acordo com Hardy e Weinberg. Preenchem correta e respectivamente as lacunas (1), (2) e (3): a) Infinitamente grande, ao acaso, atuantes b) Infinitamente grande, direcionados, atuantes c) Infinitamente grande, ao acaso, ausentes d) Pequena, direcionados, ausentes e) Pequena, ao acaso, atuantes Questo 937 Em uma populao composta de 100 mil indivduos, 24 mil apresentam o gentipo AA e 36 mil apresentam o gentipo aa. Com base nesses dados, correto afirmar que a freqncia dos alelos A e a ser respectivamente: a) 0,49 e 0,51 b) 0,44 e 0,56 c) 0,50 e 0,50 d) 0,56 e 0,44 e) 0,34 e 0,66

Questo 938 Uma populao de roedor est sendo estudada quanto ao equilbrio de Hardy-Weinberg para uma caracterstica determinada por um locus autossmico. O alelo dominante A condiciona o fentipo D e ocorre com a freqncia p. O alelo recessivo a responsvel pelo fentipo R e tem freqncia q. Ento, para essa caracterstica, assinale o que for correto. (01) A populao est em equilbrio se estiver ocorrendo seleo natural h, pelo menos, uma gerao. (02) No equilbrio, os gentipos AA, Aa e aa so encontrados com as freqncias p, 2pq e q, respectivamente. (04) Em uma amostra de 1000 indivduos de uma populao em equilbrio, com p=0,6, so esperados 160 indivduos com o fentipo R. (08) Com informaes sobre os valores das freqncias gnicas, p e q, e das freqncias fenotpicas, possvel determinar se a populao est ou no em equilbrio. (16) O conhecimento das freqncias genotpicas suficiente para se determinar a condio da populao quanto ao equilbrio. (32) Quando todas as freqncias genotpicas so iguais, a populao no est em equilbrio. (64) A populao est em equilbrio apenas quando 75% dos indivduos apresentam o fentipo D e 25% apresentam o fentipo R. Questo 939 Na espcie humana, o albinismo determinado por um alelo autossmico recessivo. Se em uma dada populao em equilbrio de Hardy-Weinberg 9% dos indivduos so albinos, a freqncia esperada de heterozigotos normais a) 91 % b) 75% c) 49% d) 42% e) 21% Questo 940 Um par de genes determina resistncia a um fungo que ataca a cana-de-acar e os indivduos suscetveis (aa) apresentam freqncia de 0,25. Em uma populao que est
212

em equilbrio de Hardy-Weinberg, a freqncia de heterozigotos ser: a) 15% b) 25% c) 50% d) 75% e) 100% Questo 941 O grfico mostra as relaes entre as freqncias dos alelos A e a e as freqncias genotpicas AA, Aa e aa numa populao em equilbrio.

Questo 943 Uma populao em equilbrio constituda de 500 indivduos, dos quais 45 apresentam um fentipo determinado por gene recessivo. Com base nesses dados INCORRETO afirmar-se que a) a freqncia de indivduos com fentipo dominante 91% b) cerca de 10% da populao homozigota. c) o gene dominante mais freqente que o recessivo. d) 30% dos gametas produzidos carregam o alelo recessivo. e) os heterozigotos representam 42% da populao. Questo 944 A cor da raiz da cenoura controlada por um par de genes autossmicos. O gene B responsvel pela cor branca e seu alelo recessivo, pela cor amarela. Um agricultor colheu 20.000 sementes de uma populao panmtica, que se cruza ao acaso, das quais 12.800 desenvolveram plantas com razes brancas. A partir dessas informaes pode-se afirmar que a) a freqncia do gene para colorao amarela de 36% nessa populao. b) a freqncia de heterozigotos nessa populao de 24%. c) a freqncia de plantas com razes amarelas ser de 64% se a populao se mantiver em equilbrio. d) a probabilidade de formao de gametas B de 80% nessa populao. e) a probabilidade de ocorrncia de homozigotos nessa populao de 52%. Questo 945 G. H. Hardy e W. Weinberg postularam que, em uma populao, sob condies especiais, as freqncias dos alelos, e de cada gentipo, permanecem constantes, gerao aps gerao. Para que isso ocorra, segundo os referidos autores, necessrio que: ( ) no haja presso de seleo natural, uma vez que esta tende a selecionar determinados alelos em detrimento de outros, que podem desaparecer. ( ) no ocorram fluxos migratrios, os quais acarretam troca de alelos entre populaes diferentes. ( ) os cruzamentos, nas populaes, ocorram ao acaso; ou seja, as populaes sejam panmticas. ( ) os novos alelos, que surjam por mutao, se
213

1.5.7

Numa populao em equilbrio, em que os casamentos ocorrem ao acaso e a freqncia dos genes A e a de 50% para cada um. A probabilidade de se encontrarem indivduos AA, Aa e aa , respectivamente, a) 25%, 50% e 25%. b) 40%, 30% e 30%. c) 50%, 25% e 25%. d) 70%, 15% e 15%. e) 80%, 10% e 10%. Questo 942 Numa populao em equilbrio, a freqncia de indivduos Rh negativos de 16%. A probabilidade de ocorrncia de indivduos heterozigotos nessa populao a) 84%. b) 60%. c) 48%. d) 36%. e) 24%.

incorporem rapidamente ao estoque gnico. ( ) nas populaes demasiadamente pequenas, os cruzamentos sejam ao acaso, a partir de seu estabelecimento. Questo 946 Numa certa populao de africanos, 9% nascem com anemia falciforme. Qual o percentual da populao que possui a vantagem heterozigtica? a) 9% b) 19% c) 42% d) 81% e) 91% Questo 947 Em 1908, os cientistas Hardy e Weinberg formularam um teorema cuja importncia est no fato dele estabelecer um modelo para o comportamento dos genes nas populaes naturais. Se os valores das freqncias gnicas de uma populao, observada ao longo de geraes, forem significativamente diferentes dos valores esperados atravs da aplicao do teorema, pode-se concluir corretamente que: a) a populao estudada infinitamente grande, inviabilizando a aplicao do teorema. b) no houve a atuao dos fatores evolutivos sobre a populao. c) a populao encontra-se em equilbrio gentico. d) a populao est evoluindo, uma vez que as freqncias gnicas foram alteradas. e) os cruzamentos nessa populao ocorrem ao acaso. Questo 948 Em mexilhes, as cores externas das conchas so determinadas por dois alelos de um gene, sendo a cor azulada determinada por um alelo recessivo e a cor castanha, por um dominante. Em uma populao de cem animais, foram encontrados 16 azuis. Com relao a essa populao, considere as seguintes afirmativas: 1. Ela no pode estar em equilbrio de Hardy-Weinberg. 2. Se houver 48 heterozigotos, ela estar em equilbrio de Hardy-Weinberg. 3. Se houver 30 heterozigotos, possvel que a seleo

natural seja a causa do aumento do nmero de heterozigotos. 4. A endogamia pode ser a causa do desvio em relao ao equilbrio de Hardy-Weinberg, se houver 76 animais castanhos. Assinale a alternativa correta. a) Somente a afirmativa 1 verdadeira. b) Somente as afirmativas 1 e 2 so verdadeiras. c) Somente as afirmativas 1 e 3 so verdadeiras. d) Somente as afirmativas 2 e 4 so verdadeiras. e) Somente as afirmativas 3 e 4 so verdadeiras. Questo 949 De acordo com a Teoria de Hardy-Weimberg, em uma populao em equilbrio gentico as freqncias gnicas e genotpicas permanecem constantes ao longo das geraes. Para tanto, necessrio que a) a populao seria infinitamente grande, os cruzamentos ocorram ao acaso e esteja isenta de fatores evolutivos, tais como mutao, seleo natural e migraes. b) o tamanho da populao seja reduzido, os cruzamentos ocorram ao acaso e esteja sujeita a fatores evolutivos, tais como mutao, seleo natural e migraes. c) a populao seria infinitamente grande, os cruzamentos ocorram de modo preferencial e esteja isenta de fatores evolutivos, tais como mutao, seleo natural e migraes. d) a populao seja de tamanho reduzido, os cruzamentos ocorram de modo preferencial e esteja sujeita a fatores evolutivos, tais como mutao, seleo natural e migraes. Questo 950 Numa populao a freqncia do gene dominante W 0,7. A probabilidade de um indivduo desta populao ser heterozigoto Ww igual a: a) 9/100. b) 49/100. c) 3/10. d) 42/100. e) 1/2. Questo 951 No estudo da gentica de populaes, utiliza-se a frmula p + 2pq + q = 1, na qual p indica a freqncia do alelo dominante e q indica a freqncia do alelo recessivo. Em
214

uma populao em equilbrio de Hardy-Weinberg espera-se que a) o gentipo homozigoto dominante tenha freqncia p=0,25, o gentipo heterozigoto tenha freqncia 2pq=0,5 e o gentipo homozigoto recessivo tenha freqncia q=0,25. b) haja manuteno do tamanho da populao ao longo das geraes. c) os alelos que expressam fentipos mais adaptativos sejam favorecidos por seleo natural. d) a somatria da freqncia dos diferentes alelos, ou dos diferentes gentipos, seja igual a 1. e) ocorra manuteno das mesmas freqncias genotpicas ao longo das geraes. Questo 952 Sabendo-se que a freqncia de um gene recessivo a, numa populao, 0,1, as freqncias genotpicas esperadas para essa populao, se estiver em equilbrio, sero: a) AA - 0,9; Aa - 0,09; aa - 0,01 b) AA - 0,81; Aa - 0,18; aa - 0,01 c) AA - 0,81; Aa - 0,09; aa - 0,1 d) AA - 0,72; Aa - 0,18; aa - 0,1 e) AA - 0,25; Aa - 0,50; aa - 0,25 Questo 953 Os grupos sanguneos de uma populao foram estudados no que se refere ao sistema MN dos seus indivduos. Verificou-se que existiam, numa porcentagem de 9%, portadores de sangue do tipo N. Assim, a freqncia dos indivduos do grupo MN dessa populao de: a) 79%. b) 61%. c) 50%. d) 49%. e) 42%. Questo 954 Cientistas conseguiram inserir um grande trecho de ADN estranho ao ADN de cobaias como mostra o desenho a seguir: O resultado esperado para este trabalho que as clulas que receberam o implante: a) morram pela presena de cido nuclico estranho composio do ncleo.

b) morram por ficarem prejudicadas na realizao da sntese protica. c) reproduzam-se, produzindo clulas defeituosas incapazes de sobreviver. d) reproduzam-se, transferindo as caractersticas implantadas para as clulas-filhas. e) cresam, produzindo anticorpos contra as protenas estranhas que sero fabricadas.

1.5.8.1

Questo 955 Joo ficou intrigado com a grande quantidade de notcias envolvendo DNA: clonagem da ovelha Dolly, terapia gnica, testes de paternidade, engenharia gentica, etc. Para conseguir entender as notcias, estudou a estrutura da molcula de DNA e seu funcionamento e analisou os dados do quadro a seguir.

1.5.8.1

215

nalisando-se o DNA de um animal, detectou-se que 40% de suas bases nitrogenadas eram constitudas por Adenina. Relacionando esse valor com o emparelhamento especfico das bases, os valores encontrados para as outras bases nitrogenadas foram: a) T = 40%; C = 20%; G = 40% b) T = 10%; C = 10%; G = 40% c) T = 10%; C = 40%; G = 10% d) T = 40%; C = 10%; G = 10% e) T = 40%; C = 60%; G = 60% Questo 956 Joo ficou intrigado com a grande quantidade de notcias envolvendo DNA: clonagem da ovelha Dolly, terapia gnica, testes de paternidade, engenharia gentica, etc. Para conseguir entender as notcias, estudou a estrutura da molcula de DNA e seu funcionamento e analisou os dados do quadro a seguir.

Questo 957 A identificao da estrutura do DNA foi fundamental para compreender seu papel na continuidade da vida. Na dcada de 1950, um estudo pioneiro determinou a proporo das bases nitrogenadas que compem molculas de DNA de vrias espcies.

1.5.8.1

1.5.8.1

m I est representado o trecho de uma molcula de DNA. Observando o quadro, pode-se concluir que: a) a molcula de DNA formada por 2 cadeias caracterizadas por seqncias de bases nitrogenadas. b) na molcula de DNA, podem existir diferentes tipos de complementao de bases nitrogenadas. c) a quantidade de A presente em uma das cadeias exatamente igual quantidade de A da cadeia complementar. d) na molcula de DNA, podem existir 5 diferentes tipos de bases nitrogenadas. e) no processo de mitose, cada molcula de DNA d origem a 4 molculas de DNA exatamente iguais.

comparao das propores permitiu concluir que ocorre emparelhamento entre as bases nitrogenadas e que elas formam a) pares de mesmo tipo em todas as espcies, evidenciando a universalidade da estrutura do DNA. b) pares diferentes de acordo com a espcie considerada, o que garante a diversidade da vida. c) pares diferentes em diferentes clulas de uma espcie, como resultado da diferenciao celular. d) pares especficos apenas nos gametas, pois essas clulas so responsveis pela perpetuao das espcies. e) pares especficos somente nas bactrias, pois esses organismos so formados por uma nica clula. Questo 958 As tcnicas utilizadas pela Engenharia Gentica permitem que se atue em uma substncia presente em todas as clulas, procariontes e eucariontes, sendo responsvel pelo controle do seu metabolismo. Essa substncia se denomina a) DNA, e formada por cadeias polipeptdicas que apresentam em sua composio os aminocidos adenina, uracila, citosina e guanina. b) DNA, e formada por cadeias polinucleotdicas que apresentam em sua composio as bases nitrogenadas adenina, citosina, guanina e timina. c) RNA, e formada por cadeias polinucleotdicas que apresentam em sua composio as bases nitrogenadas adenina, timina, citosina e guanina.
216

d) polimerase, e formada por aminocidos que apresentam em sua composio a desoxirribose. e) transcriptase, e formada por aminocidos que apresentam em sua composio a ribose. Questo 959 Uma molcula de DNA apresenta uma dupla hlice de cadeias polinucleotdicas. Nela identificamos 20% de adenina. Assinale a alternativa correta em relao porcentagem de guanina. a) 20% b) 30% c) 40% d) 50% e) 60% Questo 960 Depois da descoberta da estrutura da molcula do cido Desoxirribonuclico (DNA ou ADN), novos mtodos de diagnstico foram desenvolvidos e utilizados para inmeros fins (identificao de microrganismos patognicos, testes de paternidade, mapa gentico, medicina forense, entre outros). Assinale a afirmao correta. a) A molcula de DNA constituda por uma fita nica e por vrios nucleotdeos que tm a transcrio como principal funo. b) A molcula de DNA nas bactrias se encontra na carioteca da clula. c) A molcula de DNA no capaz de produzir a molcula de RNA. d) A molcula de DNA tem funo de duplicao e constituda por uma fita dupla, sendo que cada filamento composto por vrios nucleotdeos. e) A molcula de DNA, nos organismos eucariontes, no se encontra no ncleo da clula. Questo 961 A tabela mostra a composio das bases nitrogenadas pricas, adenina e guanina, nos DNAs do homem e do boi. Adenina 30,4% ? Guanina ? 21,0%

As porcentagens que esto faltando para o homem e para o boi so, respectivamente: a) 19,6 e 29,0 b) 21,0 e 30,4 c) 29,0 e 30,4 d) 19,6 e 21,0 e) 30,4 e 21,0 Questo 962 Bactrias foram cultivadas em um meio nutritivo contendo timina radioativa, por centenas de geraes. Dessa cultura, foram isoladas 100 bactrias e transferidas para um meio sem substncias radioativas. Essas bactrias sofreram trs divises no novo meio, produzindo 800 bactrias. A anlise dos cidos nuclicos mostrou que dessas 800 bactrias a) 100 apresentavam o DNA marcado, mas no o RNA. b) 200 apresentavam o DNA marcado, mas no o RNA. c) 400 apresentavam o DNA marcado, mas no o RNA. d) 200 apresentavam o DNA e o RNA marcados. e) todas apresentavam o DNA e o RNA marcados. Questo 963 Em um organismo, clulas musculares e clulas nervosas diferem principalmente por: a) possurem genes diferentes. b) possurem ribossomos diferentes. c) possurem cromossomos diferentes. d) expressarem genes diferentes. e) utilizarem cdigo gentico diferente. Questo 964 Um pesquisador que pretende estudar comparativamente a sntese de DNA e RNA em uma clula deve usar nucleotdios radiativos contendo a) timina e uracila. b) guanina e timina. c) citosina e guanina. d) adenina e timina. e) citosina e uracila.

Homem Boi

217

Questo 965 Importante informao que permitiu o estabelecimento de um modelo para a molcula de DNA foi a verificao de que o nmero de adenina-nucleotdeos era sempre igual ao de timina-nucleotdeos, o mesmo ocorrendo com a guanina e citosina-nucleotdeos. O fato nos permite afirmar que os nucleotdeos a) ocorrem em igual quantidade. b) ocorrem aos pares na molcula de DNA. c) pricos pareiam com outros pricos. d) pirimdicos pareiam com outros pirimdicos. e) ligam-se como se fossem o corrimo de uma escada. Questo 966 Na figura a seguir que representa o modelo da molcula de DNA os nmeros 1, 2 e 3 indicam, respectivamente a) desoxirribose, cido fosfrico e base nitrogenada. b) cido fosfrico, desoxirribose e base nitrogenada. c) ribose, cido fosfrico e base nitrogenada. d) cido fosfrico, ribose e base nitrogenada. e) cido fosfrico, base nitrogenada e desoxirribose.

Questo 968 Comparando as estruturas dos cidos nuclicos desoxirribonuclico (DNA) e ribonuclico (RNA) pode-se afirmar que a) timina uma base nitrogenada exclusiva do RNA. b) uracila uma base nitrogenada exclusiva do DNA. c) ribose um acar que entra na composio qumica do RNA. d) cido fosfrico s entra na composio qumica do DNA. e) timina pareia com adenina no RNA. Questo 969 Molculas de DNA constitudas por duplo filamento helicoidal mantm as cadeias unidas entre si por a) ligaes covalentes. b) ligaes inicas. c) pontes de hidrognio. d) pontes de nitrognio. e) ligao metlica. Questo 970 Sobre o DNA, INCORRETO afirmar que a) possui a base nitrogenada uracila. b) origina o RNA mensageiro c) reproduz-se de modo semiconservativo. d) integrante dos genes e dos cromossomos. e) formado de dupla cadeia com formato helicoidal. Questo 971 Sobre o DNA, CORRETO afirmar que a) possui a base nitrogenada uracila. b) no origina o RNA mensageiro c) no capaz de replicar-se. d) integrante do nuclolo e dos ribossomos. e) formado de dupla cadeia com formato helicoidal. Questo 972 O DNA e o RNA quanto sua estrutura qumica, so classificados como a) polipeptdeos. b) nucleoprotenas. c) polissacardeos.
218

1.5.8.1

Questo 967 Numa molcula de DNA, a quantidade de a) adenina igual a de citosina. b) citosina igual a de timina. c) guanina igual a de citosina. d) citosina igual a de adenina. e) adenina igual a de uracila.

d) fosfatdeos. e) polinucleotdeos. Questo 973 Qual das seguintes bases nitrogenadas NO entra na composio qumica do DNA? a) Timina. b) Citosina. c) Adenina. d) Uracila. e) Guanina. Questo 974 Qual das seguintes molculas NO entra na composio qumica do DNA? a) Ribose. b) Desoxirribose. c) cido fosfrico. d) Adenina. e) Guanina. Questo 975 Se um segmento de DNA possui a seqncia de bases nitrogenadas TTA CCG ATT ATG, pode-se afirmar que a cadeia complementar a esse segmento ter a seqncia a) AAT GGC TAA TAC. b) UUT GGC TUU UAC. c) TTA CCG ATT ATG. d) AAT GGC TAA UAC. e) AAU GGC UAA UAC. Questo 976 Observa-se a presena de DNA nos seguintes organides citoplasmticos a) mitocndria e ribossomo. b) ribossomo e cromossomo. c) nuclolo e cloroplasto. d) lisossomo e ribossomo. e) mitocndria e cloroplasto.

Questo 977 Na molcula de DNA, a quantidade de a) adenina igual a de citosina. b) citosina igual a de timina. c) guanina igual a de adenina. d) citosina igual a de adenina. e) adenina igual a de timina. Questo 978 Comparando as estruturas dos cidos desoxirribonuclico (DNA) e ribonuclico (RNA) NO se pode afirmar que a) timina uma base nitrogenada exclusiva do DNA. b) uracila uma base nitrogenada exclusiva do DNA. c) ribose um acar que entra na composio qumica do RNA. d) cido fosfrico entra na composio qumica do DNA e do RNA. e) timina pareia com adenina no DNA. Questo 979 Assinale a alternativa que relaciona corretamente o nome das molculas representadas pelos nmeros 1, 2 e 3, respectivamente, sabendo-se que a figura adiante representa a unidade estrutural do cido desoxirribonuclico (DNA). a) base nitrogenada, ribose e cido fosfrico. b) cido fosfrico, ribose e base nitrogenada. c) desoxirribose, base nitrogenada e cido fosfrico. d) cido fosfrico, desoxirribose e base nitrogenada. e) base nitrogenada, desoxirribose e cido fosfrico.

1.5.8.1

219

Questo 980 O modelo molecular dos cidos nuclicos (DNA e RNA) foi proposto por J. Watson e F. Crick em 1953. Segundo esse modelo esses cidos so a) micromolculas. b) polipeptdeos. c) polinucleotdeos. d) enzimas. e) lipdios. Questo 981 caracterstica do DNA: a) acar com quatro tomos de carbono. b) presena das bases nitrogenadas uracila, guanina, citosina e adenina. c) ausncia de cido fosfrico. d) ser um polipeptdeo. e) ocorre nos cromossomos. Questo 982 Uma molcula de DNA contm 15% de Guanina. Assinale a alternativa que relaciona corretamente as outras bases nitrogenadas e suas respectivas propores: a) Citosina = 15%, Adenina = 15% e Timina = 15% b) Citosina = 35%, Adenina = 15% e Timina = 15% c) Citosina = 15%, Adenina = 35% e Timina = 15% d) Citosina = 15%, Adenina = 35% e Timina = 35% e) Citosina = 15%, Adenina = 15% e Timina = 35% Questo 983 Uma molcula de DNA contm 16% de Citosina. Assinale a alternativa que relaciona corretamente as outras bases nitrogenadas e suas respectivas propores? a) Guanina = 16%, Timina = 16% e Adenina = 16% b) Guanina = 16%, Timina = 34% e Adenina = 34% c) Guanina = 34%, Timina = 16% e Adenina = 16% d) Guanina = 34%, Timina = 34% e Adenina = 16% e) Guanina = 34%, Timina = 34% e Adenina = 16% Questo 984 Numa molcula de DNA formada por uma dupla-hlice a quantidade de a) adenina igual a de citosina.

b) citosina igual a de timina. c) adenina igual a de uracila. d) citosina igual a de adenina. e) guanina igual a de citosina. Questo 985 Assinale a alternativa que relaciona as estruturas celulares em se observa a presena de DNA: a) membrana plasmtica, centrolos e lisossomos. b) centrolos, cromossomos e complexo de Golgi. c) ribossomos, cromossomos e lisossomos. d) cloroplastos, mitocndrias e cromossomos. e) lisossomos, complexo de Golgi e ribossomos Questo 986 Sabemos que os genes so constitudos de DNA e esto localizados nas seguintes estruturas celulares: a) lisossomos, complexo de Golgi e cromossomos. b) cloroplastos, cromossomos e mitocndrias. c) retculo endoplasmtico, ribossomos e centrolos. d) membrana plasmtica, ribossomos e cromossomos. e) vacolos, centrolos e cromossomos. Questo 987 As evidncias de que o DNA a substncia hereditria que determina as caractersticas dos seres vivos foram primeiramente observadas em a) vrus. b) protozorios. c) caros. d) liquens. e) bactrias. Questo 988 Num dado organismo, o contedo de guanina no seu DNA 30%. Assinale a alternativa que contm a porcentagem correta de cada uma das demais bases nitrogenadas. a) Adenina = 20%, Citosina = 20% e Timina = 30% b) Adenina = 20%, Citosina = 30% e Timina = 20% c) Adenina = 30%, Citosina = 30% e Timina = 30% d) Adenina = 30%, Citosina = 40% e Timina = 40% e) Adenina = 40%, Citosina = 30% e Timina = 40%

220

Questo 989 O esquema a seguir mostra um tipo de ciclo reprodutivo dos bacterifagos.

1. Com Timina 2. Com Uracila Funo a. Transcrio b. Sntese protica So caractersticas do cido desoxirribonuclico (DNA): 1.5.8.1 a) II - 1 - b b) I - 1 - a c) II - 1 - a d) II - 2 - a e) I - 2 - b

e acordo com o esquema, verifica-se que a) ocorre lise da bactria no fim do ciclo. b) o DNA viral se incorpora ao cromossomo bacteriano. c) o DNA viral destrudo pela bactria. d) as bactrias perdem a capacidade de se dividir. e) h grande multiplicao do DNA viral no interior da bactria. Questo 990 Considere as caractersticas do DNA abaixo discriminadas. I. constitudo por uma nica cadeia de nucleotdeos. II. Seu acar a desoxirribose. III. Uma de suas bases nitrogenadas a timina. IV. Possui capacidade de autoduplicao. So corretas a) II e III, somente. b) II e IV, somente. c) I, III e IV, somente. d) II, III e IV, somente. e) I, II, III e IV. Questo 991 Os itens abaixo se referem aos cidos nuclicos: Estrutura I. Cadeia simples II. Dupla hlice Composio

Questo 992 Supondo que ocorra um evento gentico raro em que dois cromossomos no-homlogos, de uma mesma clula, quebram-se e voltam a se soldar, porm com os segmentos trocados, estaramos verificando a ocorrncia de a) crossing-over. b) duplicao. c) translocao. d) inverso. e) deleo. Questo 993 Duas mulheres disputam a maternidade de uma menina. Foi realizada a anlise de um mesmo trecho do DNA, obtido de um dos cromossomos X de cada mulher e da menina. As seqncias de bases do referido trecho gnico esto esquematizadas adiante:

1.5.8.1

221

Os dados obtidos a) so suficientes para excluir a possibilidade de qualquer uma das mulheres ser a me da menina. b) so suficientes para excluir a possibilidade de uma das mulheres ser a me da menina. c) no so suficientes, pois o cromossomo X da menina analisado pode ser o de origem paterna. d) no so suficientes, pois a menina recebe seus dois cromossomos X da me e apenas um deles foi analisado. e) no podem ser considerados, pois uma menina no recebe cromossomo X de sua me. Questo 994 Com relao composio qumica, as molculas de DNA e RNA diferem entre si quanto ao tipo de a) acar, apenas. b) base nitrogenada, apenas. c) base nitrogenada e de acar, apenas. d) base nitrogenada e de fosfato, apenas. e) base nitrogenada, de acar e de fosfato. Questo 995 Em um segmento de cadeia ativa de DNA h 20 adeninas e 15 guaninas; no segmento correspondente da cadeia complementar h 10 adeninas e 30 guaninas. Com base nesses dados, conclui-se que nos segmentos de RNA originrios desse DNA haver a) 30 citosinas. b) 20 timinas. c) 15 guaninas. d) 10 uracilas. e) 10 adeninas. Questo 996 Considere que um cientista esteja, em um laboratrio, tentando reproduzir "in vitro" a sntese de molculas de DNA. Com base nos conhecimentos sobre o tema, assinale a alternativa que indica, corretamente, as molculas imprescindveis que ele deve utilizar para que possa atingir o seu objetivo. a) Quatro diferentes tipos de nucleotdeos, contendo as bases nitrogenadas adenina, timina, citosina e guanina; a enzima DNA polimerase e DNA. b) Os nucleotdeos contendo as bases nitrogenadas timina,

guanina, adenina e citosina; a enzima RNA polimerase; RNA mensageiro e DNA. c) As enzimas RNA e DNA polimerase; os trs tipos de RNA (mensageiro, transportador e ribossmico) e DNA. d) A enzima DNA polimerase; os vinte tipos diferentes de aminocidos, DNA e RNA. e) As enzimas RNA e DNA polimerase; vinte tipos diferentes de aminocidos; DNA e RNA. Questo 997 TESTES GENTICOS: A Cincia se antecipa doena Com o avano no mapeamento de 100 mil genes dos 23 pares de cromossomos do ncleo da clula (projeto Genoma, iniciado em 1990, nos EUA), j possvel detectar por meio de exames de DNA (cido desoxirribonucleico) a probabilidade de uma pessoa desenvolver doenas (...). (O GLOBO, 10/08/97) Sabe-se que o citado mapeamento feito a partir do conhecimento da seqncia de bases do DNA. O esquema abaixo que representa o pareamento tpicos de bases encontradas na molcula de DNA, :

1.5.8.1

Questo 998 Tendo em vista a estrutura e a funo dos cidos nuclicos, correto afirmar que: a) todas as trincas da molcula do mRNA especificam algum aminocido. b) as molculas do cido ribonuclico (RNA) so hlices duplas de polirribonucleotdeos. c) em todos os organismos, s existe um gene para cada molcula de DNA. d) as estruturas espaciais e moleculares do DNA e RNA so
222

diferentes. e) as duas metades da hlice dupla do DNA tm seqncias iguais de bases nitrogenadas. Questo 999 Leia o texto a seguir. O mamfero-smbolo da Idade do Gelo provavelmente tinha dois tipos de pelagem: castanho-escuro e loiro. A inferncia vem diretamente do DNA do mamute-lanoso ('Mammuthus primigenius'), de exemplares mortos h 43 mil anos na Sibria. uma das primeiras vezes em que os genes de um bicho extinto do pistas sobre caractersticas suas em vida. Mamutes podem ter tido plo "loiro", sugere anlise de DNA. "Folha de So Paulo", 07/07/2006. Em relao s caractersticas genticas deste mamfero, possvel afirmar corretamente que: a) seus genes estavam dispostos em cromossomos circulares. b) seu DNA era composto por bases nitrogenadas, ribose e fosfato. c) seus genes estavam organizados nos plasmdeos. d) suas molculas de DNA apresentavam estrutura helicoidal. e) seus genes para o tipo de pelagem localizavam-se no DNA mitocondrial. Questo 1000 Sabe-se que o homem possui em torno de 80.000 genes, que, entre outras funes, codificam protenas. Considerando-se essa informao e conhecimento sobre o assunto, CORRETO afirmar que a) o gentipo das clulas do tecido nervoso diferente do gentipo das clulas do tecido epitelial. b) o nmero total de genes, aps a diferenciao e a especializao das clulas, reduz-se. c) os genes cuja atividade no necessria ao funcionamento de uma clula perdem a capacidade de duplicao. d) os genes responsveis pelo sistema sangneo ABO esto presentes nas clulas epiteliais, mas so incapazes de se expressar.

Questo 1001 Clulas provenientes de um indivduo foram examinadas ao microscpio e revelaram diferenas estruturais, que podem ser observadas nestas representaes esquemticas:

1.5.8.1

odas as alternativas apresentam diferenas entre essas clulas, EXCETO a) Forma ou localizao dos seus ncleos. b) Funes que realizam. c) Genes que possuem. d) Tecidos a que pertencem. Questo 1002 Um laboratrio recebeu trs amostras de DNA para investigar se pertenciam a espcies diferentes. A quantidade e a relao entre as bases das amostras esto apresentadas nesta tabela:

1.5.8.1

223

om base nas informaes dessa tabela e em outros conhecimentos sobre o assunto, INCORRETO afirmar que a) as trs amostras so provenientes de diferentes espcies. b) a amostra 3 possui o mais alto contedo de pares de bases A e T. c) a amostra 2 apresenta DNA de fita simples. d) as amostras 1 e 3 apresentam alta homologia entre seus DNAs. Questo 1003 A composio das bases pricas adenina e guanina do DNA do homem e do co so as seguintes: Homem: Adenina = 30,4 % Guanina = ? Co: Adenina = ? Guanina = 21,0 % As percentagens que esto faltando para o homem e co so, respectivamente: a) 19,6 e 29,0; b) 21,0 e 30,4; c) 29,0 e 30,4; d) 19,6 e21,0; e) 30,4 e 21,0. Questo 1004 Meselson e Stahl, em 1957, cultivaram, inicialmente, 'Escherichia coli' (gerao F0) na presena de N (istopo pesado). Posteriormente, cresceram diversas geraes das bactrias em N (istopo leve) e extraram o DNA das sucessivas geraes (geraes F0; F1 - F2 e F3), mediante precipitao baseada em suas diferentes densidades, conforme esquematizado abaixo.

1.5.8.1

A partir desse experimento pode-se afirmar que: ( ) todas as molculas da gerao F1 tero a densidade intermediria entre a pesada e a leve. ( ) metade das molculas da gerao F2 tero a densidade leve e apenas 12,5% tero a densidade intermediria em F3. ( ) eles concluram, como foi antecipado por Watson e Crick, que as fitas de DNA serviam de modelo para sua prpria replicao. ( ) a tendncia da fita de DNA pesada desaparecer no decorrer das geraes. ( ) A composio do meio de cultura no exerceu influncia no experimento uma vez que a bactria cresceu em todos os meios. Questo 1005 Considerando que na figura a seguir tem-se uma representao plana de um segmento da molcula de DNA, analise as proposies a seguir.

1.5.8.1

224

) Um nucleotdeo formado por um grupo fosfato (I), uma molcula do acar desoxirribose (II) e uma molcula de base nitrogenada. 2) Um nucleotdeo com Timina (T) em uma cadeia pareia com um nucleotdeo com Adenina (A) em outra cadeia. 3) Um nucleotdeo com Guanina (G) em uma cadeia pareia com um nucleotdeo com Citosina (C) em outra cadeia. 4) Pontes de hidrognio se estabelecem entre as bases nitrogenadas T e A e entre as bases nitrogenadas C e G. Est(o) correta(s). a) 1 apenas b) 2 e 3 apenas c) 1, 2 e 3 apenas d) 2, 3 e 4 apenas e) 1, 2, 3 e 4 Questo 1006 Na figura a seguir ilustrado um processo muito importante para a vida. Analise-o e assinale a alternativa que indica corretamente qual este processo.

sendo aplicadas a plantas e animais, resultando em tipos criados que nunca poderiam ter sido produzidos com a gentica clssica. (...) Com a capacidade de mover genes de um organismo para outro, os cientistas produziram plantas que brilham porque expressam os genes de bioluminescncia dos vaga-lumes; plantas que adquirem resistncia ao frio por expressar genes anticongelantes de peixes, e camundongos gigante que expressam os genes do hormnio de crescimento de ratos." (Griffiths, A.J.F. et al. "Introduo Gentica". 6 ed. Rio de Janeiro: Guanabara Koogan. 1998) O texto acima se refere a organismos transgnicos, que so aqueles em cujo genoma foi introduzido um gene de uma outra espcie ou mesmo um gene produzido em laboratrio. Assinale a alternativa que define o que um gene. a) Um gene um cromossomo da clula vegetal ou animal. b) Um gene um segmento do DNA que contm a informao necessria para a produo de uma determinada protena. c) Um gene uma protena que tem funo especfica em uma determinada rota metablica. d) Um gene uma molcula de RNA que atua diretamente na sntese protica. e) Um gene uma cadeia de aminocidos que codifica o cdigo gentico. Questo 1008 Geraes sucessivas de bactrias da espcie 'Escherichia coli' foram cultivadas num meio cuja nica fonte de nitrognio era o istopo N, o qual se incorporou nas molculas de DNA. Posteriormente, essas bactrias foram transferidas para um novo meio, onde existia o N como nica forma de nitrognio. Em relao ao experimento, pode-se prever que, nesse novo meio, a) ao final da 1 gerao, sero formadas molculas de DNA apenas com N e molculas apenas com N. b) ao trmino da 1 gerao, todas as molculas de DNA apresentaro apenas N incorporado. c) ao trmino da 2 gerao, cerca de 1/4 do DNA ser hbrido, sendo o restante no-hbrido. d) ao final da 2 gerao, cada molcula hbrida de DNA formar duas molculas, sendo uma hbrida e outra no.
225

1.5.8.1

a) Produo de protena b) Transcrio do RNA c) Produo de RNAribossmico d) Helicoidizao do DNA e) Replicao do DNA Questo 1007 Um tema que vem despertando grande polmica no Brasil atualmente a liberao, para cultivo, de plantas transgnicas. A obteno dessas plantas se deve biotecnologia. "A biotecnologia de gentica molecular foi inicialmente aplicada a micrbios, mas hoje as mesmas tcnicas esto

Questo 1009 Meselson e Stahl, em 1957, fizeram um experimento sobre a replicao do DNA. Nesse experimento, a bactria 'Escherichia coli' foi cultivada, por muitas geraes, em meio contendo um istopo pesado de nitrognio, N, at todo o seu DNA estar marcado com esse istopo. Depois disso, as bactrias foram transferidas para um meio contendo nitrognio leve, N. As molculas de DNA das bactrias foram ento isoladas e analisadas com relao ao seu contedo de N e de N, sendo observado o seguinte:

I - No cdigo gentico, a cada cdon deve corresponder mais de um aminocido. II - Os genes compartilhados pelos genomas dos diferentes grupos devem ser essenciais. III - Os genes envolvidos na replicao, transcrio e traduo do material gentico devem fazer parte do conjunto mnimo de genes. Quais delas poderiam ter embasado o raciocnio de Koonin? a) Apenas I. b) Apenas II. c) Apenas III. d) Apenas II e III. e) I, II e III. Questo 1011 Numere a 2 coluna de acordo com a 1 COLUNA 1 1- DNA 2- RNA COLUNA 2 ( ) dupla hlice ( ) ribose ( ) fita nica ou simples ( ) desoxirribose ( ) bases nitrogenadas: adenina, guanina, citosina, timina. ( ) bases nitrogenadas: adenina, guanina, citosina, uracila A seqncia correta a) 1 - 2 - 1 - 2 - 2 - 1. b) 2 - 1 - 1 - 2 - 2 - 2. c) 1 - 2 - 2 - 1 - 1 - 2. d) 2 - 1 - 2 - 1 - 1 - 2. e) 1 - 1 - 2 - 2 - 2 - 1. Questo 1012 Desde que Watson e Crick propuseram um modelo para a estrutura do DNA, em 1953, tem-se constatado um progresso fantasticamente acelerado da Biologia Molecular, do que exemplo a recente clonagem de uma ovelha. Julgue os itens a seguir, acerca do referido cido nuclico.

1.5.8.1

Com relao a esses dados, podemos concluir que a) a replicao do DNA semiconservativa. b) a replicao do DNA conservativa. c) a replicao do DNA randmica. d) no ocorreu replicao do DNA mas, sim, uma mutao. e) no ocorreu replicao do DNA mas, sim, transcrio. Questo 1010 Leia o texto abaixo. A entrada na era da genmica possibilitou ao norte-americano Eugene V. Koonin investigar qual seria o nmero mnimo de genes capazes de sustentar o funcionamento de uma clula. Para isso, ele comparou 21 genomas completos de representantes das trs linhagens primrias da vida: as eubactrias, as arqueobactrias e os eucariontes. O resultado da pesquisa mostrou que o nmero de genes deve situar-se em torno de 150. Esse enfoque interessante, pois permite imaginar os primeiros sistemas genticos surgidos por ocasio da origem da vida. Adaptado de SALZANO, F.M. "Cincia Hoje", v. 29, n. 173, jul. 2001. Considere as seguintes afirmaes.

226

(1) Apesar de ser o sexto elemento mais abundante no universo e o mais verstil de todos, o carbono no faz parte da estrutura do DNA. (2) A colorao de cromossomos com vrios matizes uma tcnica atual que se baseia no uso de vrios corantes para os diferentes lipdios que constituem os cromossomos. (3) No processo de recombinao entre cromtides, ocorre a troca de, no mnimo, um segmento de DNA que corresponde a um gene funcional. (4) As mutaes gnicas implicam necessariamente a modificao do fentipo do indivduo. (5) Nos processos de fecundao natural, a me transmite maior quantidade de DNA para o filho do que o pai. Questo 1013 A partir dos anos 1900, uma srie de observaes e experimentos indicaram uma correlao entre o comportamento dos cromossomos na clula em diviso e as leis mendelianas. Analise cada uma das afirmaes seguintes. I. Na meiose I, a segregao dos homlogos de um par cromossmico corresponde, em efeito, 1 lei de Mendel. II. Na meiose I, a segregao dos homlogos dos diferentes pares cromossmicos correspondem, em efeito, 2 lei de Mendel. III. Na meiose I, a segregao de cromossomos homlogos que apresentam os mesmos alelos resulta nas propores da gerao F2 dos experimentos de Mendel. IV. Na meiose II, a segregao das cromtides dos diferentes pares cromossmicos corresponde, em efeito, 2 lei de Mendel. V. Genes localizados em regies prximas de um mesmo cromossomo implicam em distores das propores mendelianas. So afirmaes corretas: a) I, II, III, IV e V. b) I, II, III e V, apenas. c) I, II, IV e V, apenas. d) I, II e IV, apenas. e) II e V, apenas.

Questo 1014 No artigo "Retrato molecular do Brasil" ("Cincia Hoje", 2001), Srgio Penna, pesquisador da Universidade Federal de Minas Gerais, revelou que a contribuio dos europeus na composio gentica do povo brasileiro fez-se basicamente por meio de indivduos do sexo masculino, enquanto a contribuio gentica de povos indgenas e africanos deu-se por meio das mulheres. Tais concluses so possveis com base em estudos moleculares, respectivamente, do DNA do cromossomo a) X e de autossomos. b) Y e de autossomos. c) Y e do cromossomo X. d) Y e mitocondrial. e) X e mitocondrial. Questo 1015 No caracterstica do DNA: a) o acar com cinco tomos de carbono. b) a presena das bases nitrogenadas uracila, guanina, citosina e adenina. c) a presena de cido fosfrico. d) polinucleotdeo. e) ocorre nos cromossomos. Questo 1016 O estudo do mecanismo da sntese de protenas no interior das clulas confirma que: a) a transcrio gnica caracteriza-se pela autoduplicao do DNA b) trs tipos de RNA participam do processo c) os anticdons localizam-se no RNA-m d) os cdons so trincas de bases nitrogenadas do RNA-t e) no h evidncias que permitam aceitar que o cdigo gentico seja considerado degenerado Questo 1017 Uma molcula de RNA mensageiro apresenta a seguinte seqncia de bases nitrogenadas: UUU GUG CCC AAC Assinale a alternativa que contm a seqncia de bases do segmento da molcula de DNA que deu origem a esse
227

RNA. a) AAA CAC GGG TTG b) TTT CAC GGG UUG c) AAA CTC GGG TTG d) TTT GAG GGG TTG e) AAA CAC CCC UUG Questo 1018 Na figura a seguir que representa o modelo da molcula de RNA os nmeros 1, 2 e 3 indicam, respectivamente a) desoxirribose, cido fosfrico e base nitrogenada. b) cido fosfrico, desoxirribose e base nitrogenada. c) ribose, cido fosfrico e base nitrogenada. d) cido fosfrico, ribose e base nitrogenada. e) cido fosfrico, base nitrogenada e desoxirribose.

Questo 1021 Qual das seguintes molculas NO entra na composio qumica do RNA? a) Ribose. b) Desoxirribose. c) cido fosfrico. d) Adenina. e) Guanina. Questo 1022 No modelo molecular do cido ribonuclico (RNA) representado adiante, os nmeros 1, 2 e 3 indicam, respectivamente: a) desoxirribose, cido fosfrico e base nitrogenada. b) cido fosfrico, desoxirribose e base nitrogenada. c) ribose, cido fosfrico e base nitrogenada. d) cido fosfrico, ribose e base nitrogenada. e) cido fosfrico, base nitrogenada e desoxirribose.

1.5.8.2

1.5.8.2

Questo 1019 Sobre o RNA, INCORRETO afirmar que a) possui a base nitrogenada uracila. b) participa da estrutura dos ribossomos. c) reproduz-se de modo semiconservativo. d) traduzido em protenas nos ribossomos. e) formado de simples cadeia com formato helicoidal. Questo 1020 Qual das seguintes bases nitrogenadas NO entra na composio qumica do RNA? a) Timina. b) Citosina. c) Adenina. d) Uracila. e) Guanina. Assinale a alternativa que contm a seqncia de bases do segmento da molcula de DNA que deu origem a esse RNA. a) AAA CAC GGG TTA b) TTT CAC GGG UUT c) AAA CTC GGG TTT d) TTT GAG GGG TTA e) AAA CAC CCC UUA
228

Questo 1023 Uma molcula de RNA mensageiro apresenta a seguinte seqncia de bases nitrogenadas: UUU GUG CCC AAU.

Questo 1024 caracterstica do RNA: a) acar com quatro tomos de carbono. b) presena das bases nitrogenadas uracila, guanina, citosina e adenina. c) ausncia de cido fosfrico. d) ser um polipeptdeo. e) ocorrer nos lisossomos. Questo 1025 Os itens a seguir referem-se estrutura, composio e funo dos cidos nuclicos. - Estrutura: I. dupla hlice II. cadeia simples - Composio: 1. presena de uracila 2. presena de timina - Funo: a. sntese de protenas b. transcrio gnica So caractersticas do cido ribonuclico a) I - 1 - a b) I - 2 - b c) II - 1 - a d) II - 1 - b e) II - 2 - b Questo 1026 Nos ltimos anos, a biologia molecular tem fornecido ferramentas teis para a produo de plantas e animais transgnicos. As informaes armazenadas nas molculas de DNA so traduzidas em protenas por meio de molculas intermedirias denominadas: a) Proteases. b) Plasmdios. c) rRNA. d) tRNA. e) mRNA.

Questo 1027 Um pesquisador, interessado em produzir em tubo de ensaio uma protena, nas mesmas condies em que essa sntese ocorre nas clulas, utilizou ribossomos de clulas de rato, RNA mensageiro de clulas de macaco, RNA transportador de clulas de coelho e aminocidos ativos de clulas de sapo. A protena produzida teria uma seqncia de aminocidos idntica do a) rato. b) sapo. c) coelho. d) macaco. e) macaco e do rato. Questo 1028 A tabela a seguir mostra alguns aminocidos e as trincas de bases no DNA que os identificam:

1.5.8.3

e um RNA mensageiro apresenta a seqncia de bases AUU AGA UGU GUU UUA, a seqncia de aminocidos no polipeptdeo correspondente ser, de acordo com a tabela anterior: a) Cis - Val - Leu - Arg - Ile b) Leu - Val - Cis - Arg - Ile c) Arg - Ile - Val - Leu - Cis d) Ile - Arg - Cis - Val - Leu e) Val - Cis - Arg - Ile - Leu Questo 1029 Sobre o cdigo gentico so feitas as seguintes afirmaes: I - pode existir mais de um cdon para determinar um mesmo aminocido; II - em todos os seres vivos os cdons que codificam um respectivo aminocido so os mesmos;
229

III - a traduo da seqncia de bases do RNA para a protena feita, a nvel citoplasmtico, nos ribossomos. Est(o) correta(s) afirmativa(s): a) II apenas. b) III apenas. c) I e II apenas. d) I, II e III. e) I e III apenas. Questo 1030 A tabela a seguir relaciona trincas de bases do DNA aos aminocidos correspondentes.

Questo 1032 Considere a seguinte tabela que indica seqncias de bases do RNA mensageiro e os aminocidos por elas codificados. Com base na tabela fornecida e considerando um segmento hipottico de DNA, cuja seqncia de bases AAGTTTGGT, qual seria a seqncia de aminocidos codificada?

1.5.8.3

1.5.8.3 a) Aspargina, leucina, valina. b) Aspargina, lisina, prolina. c) Fenilalanina, lisina, prolina. d) Fenilalanina, valina, lisina. e) Valina, lisina, prolina. Assinale a alternativa que apresenta a possvel seqncia de cdons para a formao do seguinte tetrapeptdeo: GLU - GLI - FEN - LEU a) GUU - GGU - UUU - CUC; b) GAA - GGC - TTT - CTC; c) CTT - CCG - AAA - AAC; d) GAA - GGA - UUU - CUC; e) GUU - GGC - UUU - UUG. Questo 1031 Um gene de bactria com 600 pares de bases nitrogenadas produzir uma cadeia polipeptdica com nmero de aminocidos aproximadamente igual a a) 200 b) 300 c) 600 d) 1200 e) 1800 Questo 1033 O cdigo gentico o conjunto de todas as trincas possveis de bases nitrogenadas (cdons). A seqncia de cdons do RNA mensageiro determina a seqncia de aminocidos da protena. correto afirmar que o cdigo gentico a) varia entre os tecidos do corpo de um indivduo. b) o mesmo em todas as clulas de um indivduo, mas varia de indivduo para indivduo. c) o mesmo nos indivduos de uma mesma espcie, mas varia de espcie para espcie. d) permite distinguir procariotos de eucariotos. e) praticamente o mesmo em todas as formas de vida. Questo 1034 Os cdons UGC, UAU, GCC e AGC codificam, respectivamente os aminocidos cistena, tirosina, alanina e serina; o cdon UAG terminal, ou seja, indica a interrupo da traduo. Um fragmento de DNA, que codifica a seqncia serina - cistena - tirosina - alanina, sofreu a perda da 9 base nitrogenada. Assinale a
230

alternativa que descreve o que acontecer com a seqncia de aminocidos. a) O aminocido tirosina ser substitudo por outro aminocido. b) O aminocido tirosina no ser traduzido, resultando numa molcula com 3 aminocidos. c) A seqncia no ser traduzida, pois essa molcula de DNA alterada no capaz de comandar esse processo. d) A traduo ser interrompida no 2 aminocido. e) A seqncia no sofrer prejuzo, pois qualquer modificao na fita de DNA imediatamente corrigida. Questo 1035 Com relao ao cdigo gentico e sntese de protenas, assinale a afirmativa FALSA. a) Na molcula de DNA, encontramos sempre desoxirribose e cinco tipos de bases: adenina, guanina, citosina, timina e uracil. b) Os cidos nuclicos podem aparecer livres na clula ou podem estar associados a protenas, compondo os cromossomos e ribossomos na forma de molculas complexas de nucleoprotenas. c) Duas grandes etapas esto envolvidas na sntese das protenas: a transcrio, que compreende a passagem do cdigo gentico do DNA para o RNA, e a traduo, que compreende o trabalho do RNA de organizao dos aminocidos na seqncia determinada pelo cdigo gentico. d) A mutao constitui uma alterao na seqncia de bases nitrogenadas de um segmento de DNA e pode ser provocada por radiaes, por raios csmicos, por raios-X, ou mesmo por exposio aos raios ultravioleta do sol. e) Todas as clulas do corpo tm a mesma coleo de genes, mas, apesar disso, encontramos clulas com formas e funes diferentes. Este processo chama-se diferenciao celular. Questo 1036 Em 1987, foi oficialmente fundado o Projeto Genoma, que visa decifrar e mapear o cdigo gentico humano. Indique a alternativa ERRADA relativa ao cdigo gentico e sntese de protenas: a) Os genes so formados por cido desoxirribonucleico e controlam a produo de protenas da clula, determinando as caractersticas de um ser vivo.

b) Todas as clulas do corpo tm a mesma coleo de genes, mas, apesar disto, encontramos clulas com formas e funes diferentes. c) A mutao uma alterao do cdigo gentico de um organismo e pode ser provocada por radiaes ou substncias qumicas. d) As mudanas na programao gentica de um organismo no alteram a produo de protenas, nem as suas caractersticas. e) A Engenharia Gentica, que uma tcnica de manipulao dos genes, pode corrigir defeitos no cdigo gentico de um organismo. Questo 1037 O esquema a seguir representa a seqncia de aminocidos de um trecho de uma protena e os respectivos anticdons dos RNA transportadores.

1.5.8.3

ssinale a alternativa que contm a seqncia de cdons do RNA mensageiro que participou dessa traduo. a) UUU CGT TTG UGC GUC b) UUU CGA AAG UGC GUC c) TTT CGT TTC TGC GTC d) TTT CGA AAG TGC GTC e) CCC TAC CCA CAT ACT Questo 1038 O quadro a seguir contm um segmento de DNA, os cdons e os anticdons correspondentes.

231

GLICINA Aps a substituio de uma nica base nitrogenada no segmento de DNA, o polipeptdio sintetizado passou a apresentar duas argininas. A seqncia de trincas no RNA mensageiro que pode ter codificado esse polipeptdio alterado a) CUC - TGC - TGC - CGC - GGU b) TUT - CGT - CGT - TGT - GGU c) CGT - CGT - CAC - TGT - GGA d) UAU - CTU - CAC - CTU - TTA e) UAU - CGU - CAC - CGU - GGA Questo 1041 Organismos so ditos transgnicos quando, por tcnica de engenharia gentica, recebem e incorporam genes de outra espcie, os quais podem ser transmitidos aos seus descendentes. Exemplos desses organismos so as plantas transgnicas, receptoras de um gene de outro organismo (doador) que lhes confere resistncia a certos herbicidas. Para que ocorra a sntese da protena codificada pelo gene inserido no genoma da espcie receptora, diversas condies devem ser observadas. Entretanto, fundamentalmente, essa tcnica possvel porque a) cada organismo apresenta seu prprio cdigo gentico. b) o cdigo gentico comum a todos os seres vivos. c) o cdigo gentico degenerado. d) a tcnica permite trocar o cdigo gentico do organismo doador do gene. e) a tcnica permite trocar o cdigo gentico do organismo receptor do gene. Questo 1042 Considere os seguintes cdons do RNA mensageiro e os aminocidos por eles especificados: ACA = treonina GUU = valina Assinale a alternativa da tabela a seguir que indica corretamente os anticdons do RNAt e os cdons do DNA relacionados com esses aminocidos.

1.5.8.3

ara preench-lo corretamente, os algarismos I, II, III e IV devem ser substitudos, respectivamente, por a) GAC, TAA, AGT e CTG b) GTC, AUU, UCA e GUC c) GTC, ATT, TCA e GUC d) CTG, ATT, TCA e CUG e) CTG, AUU, UCA e CUG Questo 1039 Com relao ao cdigo gentico, foram feitas as seguintes afirmaes: I. Cada trinca de bases nitrogenadas de uma cadeia do DNA corresponde a um aminocido. II. O RNA ribossmico contm as informaes para as protenas que devem ser sintetizadas. III. O RNA mensageiro, de acordo com o anticdon que possui, liga-se a um aminocido especfico. IV. Diversos aminocidos so codificados por mais de uma trinca de nucleotdios. So verdadeiras APENAS as afirmaes a) I e II b) I e IV c) II e III d) II e IV e) I, III e IV Questo 1040 Considere o seguinte segmento de uma cadeia de DNA e o polipeptdio sintetizado a partir dele: ATA - GCA - GTG - ACA - CCT TIROSINA - ARGININA - HISTIDINA - CISTENA -

232

1.5.8.3

1.5.8.3

Questo 1043 Uma molcula de RNAm, composta pelas bases adenina-A e citosina-C, foi sintetizada experimentalmente. Sua estrutura est representada no esquema abaixo: C-A-C-A-C-A-C-A-C-A-C-A-C-A-C-A-C-A Suponha que a sntese de um peptdeo possa ser iniciada a partir de qualquer um dos extremos dessa estrutura de RNAm, sem necessidade de cdigo de iniciao ou de terminao. Nestas condies, o nmero de diferentes tipos de aminocidos encontrados nos peptdeos formados ser: a) 4 b) 3 c) 2 d) 1 Questo 1044 A mutao em um gene, por conseqncia da substituio de uma nica base na estrutura do DNA, pode acarretar modificaes importantes na atividade biolgica da protena codificada por esse gene. Considere que a estrutura normal de um RNA mensageiro de um peptdio e sua estrutura alterada em virtude da troca de uma nica base no gene correspondente so: 5' AUGUGGUUUGCACACAAAUGAUAA 3' (normal) 5' AUGUGGUUUGAACACAAAUGAUAA 3' (alterada) A tabela a seguir identifica alguns codons.

bserve que: - o codon da metionina tambm o do incio da traduo; - os codons de trmino da traduo so UAA, UAG e UGA. O aminocido encontrado no peptdio normal e aquele que o substituiu no peptdio mutante so, respectivamente: a) lisina e cistena b) treonina e triptofano c) alanina e cido glutmico d) fenil alanina e cido asprtico Questo 1045 A determinao da seqncia de aminocidos de todas as protenas da espcie humana e de outros seres vivos de extrema importncia. A partir da seqncia de aminocidos de uma protena, podem-se identificar as possveis seqncias de DNA que a originaram. Considere o quadro:

1.5.8.3

233

om base no quadro apresentado, assinale a opo que indica a seqncia do DNA responsvel pela sntese do peptdeo mostrado a seguir: Met - Asn - Glu - Cys - Tyr - Phe a) ATG - AAT - GAA - TGT - TAC - TTT b) ATG - AAC - GAA - TTC - TAC - TTT c) ATC - AAT - GAA - TGT - TAC - TTT d) ATG - AAT - GCC - TGT - TAC - TTC e) ATC - AAT - GAA - TGT - TAC - TTC Questo 1046 OBSERVE: 1. O cdigo gentico descreve a relao entre a seqncia de bases nitrogenadas e a seqncia de aminocidos, na protena que ele especifica. 2. A seqncia de aminocidos que forma uma cadeia polipeptdica compreende a estrutura secundria de uma protena. 3. Trs bases nitrogenadas adjacentes codificam um aminocido e formam um cdon. Est(o) correta(s): a) 1, apenas b) 1 e 3, apenas c) 3, apenas d) 1, 2 e 3 e) 2, apenas Questo 1047 A unio de vrios aminocidos forma os peptdeos. Estes, aps passarem por diferentes processamentos no Retculo endoplasmtico rugoso e complexo de Golgi, formam as protenas. As protenas exercem inmeras funes no nosso organismo, como por exemplo as funes enzimticas. Para descobrir se determinado organismo produz determinada protena, faz-se a construo de uma fita de RNA mensageiro a partir dela. Isso possvel graas relao existente entre os cdons do RNA mensageiro (cada trs nucleotdeos) e os aminocidos presentes nas protenas. Cada trs nucleotdeos correspondem a um aminocido, portanto, a partir de uma seqncia de aminocidos (peptdeo), possvel obter uma seqncia de nucleotdeos

(RNA mensageiros). O inverso tambm pode ocorrer. A correspondncia entre os cdons do RNA mensageiro e os aminocidos por ele determinados constitui o cdigo gentico, que est representado na tabela a seguir:

1.5.8.3

Phe (fenilalanina), Leu (leucina), Ile (isoleucina), Met (metionina), Val (valina), Ser (serina), Pro (prolina), Thr (treonina), Ala (alanina), Tyr (tirosina), His (histidina), Gln (glutanina), Asn (asparagina), Lys (lisina), Asp (cido asprtico), Glu (cido glutmico), Cys (cistena), Trp (triptofano), Arg (arginina), Gly (glicina), pare (cdon de parada). Com base no texto e em seus conhecimentos, correta a seguinte afirmao: a) O peptdeo Gly-Gly-Gly-His-Arg-Leu-Ile-Gln pode ter sido originado a partir do seguinte RNA mensageiro: GGCGGUGCGCACCGCCUUAUUCAA. b) A partir da seqncia do RNA mensageiro UUUCAUAGUGCUGGGAGCCAC, formado o seguinte peptdeo: Phe-His-Ser-Ala-Gly-Arg-His. c) A partir da seqncia do RNA mensageiro GUGGUUGUCGCUCGUCGGCGG, formado o seguinte peptdeo: Val-Val-Val-Val-Arg-Arg-Arg. d) A partir da seqncia do RNA mensageiro UUAGGGGAGACUCGGCAGGAG, formado o seguinte peptdeo Leu-Gly-Glu-Thr-Arg-Gln-Glu. e) O peptdeo Lys-Phe-Lys-Tyr-Tyr-Thr-Ile pode ter sido originado a partir do seguinte RNA mensageiro: AAAUUUAACUAUUACACAAUA. Questo 1048 Se uma protena possui 100 aminocidos, quantos cdons, que especificam esses aminocidos, devem estar presentes no seu mRNA? a) 100
234

b) 33 c) 99 d) 300 e) 500 Questo 1049 Observe as seqncias de nucleotdeos de um vrus de RNA: 5' GCA UCA CAC CUC AUU GCG UAG 3' Considerando que esse segmento de RNA codifica um determinado peptdeo, correto afirmar: a) Os cdons dessa seqncia sinalizam os mesmos aminocidos em seres humanos. b) A insero de um nucleotdeo entre a 4 e a 5 base no altera o cdigo gentico. c) Os cdons GCA e GCG so degenerados porque codificam aminocidos diferentes. d) Os anticdons do 1 do 2 cdon dessa seqncia so, respectivamente, GCA e UGA. Questo 1050 As unidades hereditrias que contm a informao para especificar um aminocido so denominadas a) ADN. b) cdons. c) nuclolos. d) acrossomos. e) ribossomos. Questo 1051 A tabela apresenta o cdigo gentico, com os cdons e os aminocidos correspondentes.

he = FENILALANINA; leu = LEUCINA; ileu = ISOLEUCINA; met = METIONINA; val = VALINA; ser = SERINA; pro = PROLINA; thr = TREONINA; ala = ALANINA; tyr = TIROSINA; his = HISTIDINA; glu = GLUTAMINA; asn = ASPARAGINA; lys = LISINA; asp = ASPARTATO; cys = CISTENA; trp = TRIPTOFANO; arg = ARGININA; gly = GLICINA LOPES, Snia. Bio Volume nico. So Paulo: Saraiva, 1996. Utilizando a tabela, determine a seqncia de aminocidos que corresponde seqncia de DNA TAC TGA TTG CTA a) metionina - treonina - asparagina - aspartato b) metionina - glutamina - histidina - glicina c) glutamina - treonina - aspartato - arginina d) glutamina - histidina - glicina - arginina e) glicina - cistena - glutamina - treonina Questo 1052 O aminocido leucina pode ser codificado por mais de uma trinca de nucleotdios do DNA (AAT, GAA e outras). Assim sendo, podemos dizer que I - o cdigo gentico degenerado, o que significa que um aminocido pode ser codificado por mais de uma trinca. II - um aminocido pode ser codificado por apenas uma trinca de nucleotdios de DNA. III - assim como a leucina pode ser codificada por diferentes trincas, uma determinada trinca tambm pode codificar diferentes aminocidos. Esto corretas afirmativas: a) apenas III.
235

1.5.8.3

b) apenas II. c) apenas I. d) I e III. e) nenhuma delas. Questo 1053 Um trecho de fita de DNA com a seqncia... TACACCTCTCGT... responsvel pela incorporao respectiva dos seguintes aminocidos: metionina, triptofano, arginina e alanina. Considerando as informaes apresentadas, julgue os itens que se seguem. (1) Os cdons do mRNA, para os aminocidos mencionados, so, respectivamente, UAC ACC UCU CGU. (2) A molcula de DNA referente ao trecho apresentado tem 20% de adenina. (3) A perda de um nucleotdeo do DNA implicar a alterao dos aminocidos da cadeia polipeptdica. (4) A fumaa do cigarro, os raios X e a luz ultravioleta podem produzir mutaes na molcula de DNA. Questo 1054 Um fragmento de DNA de uma espcie de organismo procarionte apresenta a seguinte seqncia de bases: AAT ATT CGA GTC TAA AGA. Indique qual a seqncia de RNAm transcrito a partir deste segmento DNA: a) TTA TAA GCT CAG ATT TCT b) TTA TTA GCT CAG ATT TCT c) UUA UUU GGU CAG AUU UGU d) UUA UAA GCU CAG AUU UCU e) AAT ATT CGA GTC TAA AGA Questo 1055 Uma cadeia de DNA apresenta a seguinte seqncia de bases numa certa regio de sua hlice: ATA CCG TAT; sua cadeia complementar e o tipo de RNAm que poder ser formado a partir das bases da hlice original so, respectivamente: a) TAT GGC ATA; UAU GGC AUA. b) UAU GGC UAU; TAT GGC ATA. c) TAT GGC ATA; TUT GGC UTU.

d) ATA GGC TAT; UTU GGC UTU. e) TAT GGC UTU; TAT GGC ATA. Questo 1056 Existe um nmero muito grande de substncias com funes antibiticas. Essas substncias diferem quanto maneira pela qual interferem no metabolismo celular. Assim, a TETRACICLINA liga-se aos ribossomos e impede a ligao do RNA transportador; a MITOMICINA inibe a ao da polimerase do DNA e a ESTREPTOMICINA causa erros na leitura dos cdons do RNA mensageiro. Essas informaes permitem afirmar que I - a TETRACICLINA impede a transcrio e leva a clula bacteriana morte por falta de RNA mensageiro. II - a MITOMICINA, por inibir a duplicao do DNA, impede a multiplicao da clula bacteriana. III - a ESTREPTOMICINA interfere na traduo e leva a clula bacteriana a produzir protenas defeituosas. Assinale a alternativa que rene as afirmaes corretas. a) apenas I correta. b) apenas I e II so corretas. c) apenas II e III so corretas. d) apenas I e III so corretas. e) I, II e III so corretas. Questo 1057 Dado um segmento de RNA com a seguinte seqncia de bases nitrogenadas: UUA UUU GGC UCC, pode-se dizer que o segmento de DNA que deu origem a esse RNA era a) TTA AAA CCG AGG. b) AAT AAA GGC UCC. c) AAT AAA CCG AGG. d) TTA TTT CCG AGG. e) AAU AAA CCG AGG.

236

Questo 1058 Uma molcula de RNA mensageiro apresenta a seguinte seqncia de bases nitrogenadas: UUU GUG CCC AAA. Assinale a alternativa que contm a seqncia de bases do segmento da molcula de DNA que deu origem a esse RNA. a) AAA CAC GGG TTT b) TTT CAC GGG UUU c) AAA CTC GGG TTT d) TTT GAG GGG TTT e) AAA CAC CCC UUT Questo 1059 O esquema a seguir representa dois processos observados numa clula eucaritica.

Questo 1060 O esquema a seguir representa fragmentos de cidos nuclicos no ncleo de uma clula.

1.5.8.4

bservando o esquema, INCORRETO afirmar que: a) 1 uma molcula de uracila. b) 2 representa nucleotdeos de DNA. c) 3 representa nucleotdeos de RNA. d) a clula encontra-se em metfase. e) trata-se do processo de transcrio. Questo 1061 A molcula de RNA sintetizada ___________ fita de DNA que lhe deu origem e ___________ outra fita de DNA, sendo as _______________ substitudas pelas uracilas. a) idntica - complementar - adeninas b) complementar - complementar - guaninas c) idntica - idntica - citosinas d) complementar - complementar - adeninas e) complementar - idntica - timinas Questo 1062 A mesma molcula - o RNA - que faturou o Nobel de Medicina ou Fisiologia na segunda-feira foi a protagonista do prmio de Qumica entregue ontem. O americano Roger Kornberg, da Universidade Stanford, foi laureado por registrar em imagens o momento em que a informao gentica contida no DNA no ncleo da clula traduzida para ser enviada para fora pelo RNA - o astro da semana. Esse mecanismo de transcrio, atravs do qual o RNA carrega consigo as instrues para a produo de protenas (e por isso ele ganha o nome de RNA mensageiro), j era conhecido pelos cientistas desde a dcada de 50. (Girardi, G. Estudo de RNA rende o segundo Nobel 237

1.5.8.4

ssinale a alternativa correta. a) O processo 1 somente observado no ncleo da clula, sendo inexistente em todas as outras organelas. b) Para interromper o processo 2, necessrio bloquear o funcionamento de todo o retculo endoplasmtico dessa clula. c) O processo 2 ocorre principalmente no perodo S da intrfase. d) Um dos mais importantes locais de ocorrncia do processo 1 o nuclolo. e) As molculas produzidas no processo 2 podero ser utilizadas como catalisadoras, mas nunca sero constituintes de outras organelas.

"O Estado de S. Paulo", 5 out. 2006). A partir da leitura do trecho anterior e de seu conhecimento de biologia molecular, assinale a alternativa incorreta. a) A produo de RNA mensageiro se d por controle do material gentico. b) No ncleo da clula ocorre transcrio do cdigo da molcula de DNA para a de RNA. c) O RNA mensageiro leva do ncleo para o citoplasma instrues transcritas a ele pelo DNA. d) No citoplasma, o RNA mensageiro determina a seqncia de aminocidos apresentada por uma protena. e) Cada molcula de RNA mensageiro uma longa seqncia de nucleotdeos idntica ao DNA. Questo 1063 Os processos de transcrio e traduo gnicas resultam na sntese, respectivamente, de a) protenas e de RNA. b) RNA e de protenas. c) DNA e de protenas. d) RNA e de DNA. e) DNA e de RNA. Questo 1064 O segmento CGATAGACT de uma fita de DNA, aps o processo de transcrio, origina a cadeia a) GUTATUTGA b) GCUAUCUGA c) GCTUTCTGU d) UCTATCTUA e) GCTATCTGA Questo 1065 Abaixo est representado o filamento I de uma molcula de cido nuclico presente no interior do ncleo de uma clula vegetal. Qual seria a seqncia correta encontrada na molcula de RNA mensageiro, transcrita a partir do filamento II? a) G - A - A - G - C - U b) G - U - U - G - C - A c) G - U - U - G - C - U d) C - U - U - C - G - A e) C - A - A - C - G - U

1.5.8.4

Questo 1066 Considere as seguintes etapas da sntese de protenas. I - Transcrio do cdigo gentico do DNA em cdons do RNA mensageiro. II - Ligao dos cdons de RNA mensageiro aos anticdons correspondentes dos RNAs transportadores. III - Fixao do RNA mensageiro aos ribossomos. Qual a seqncia correta dessas etapas durante o processo? a) I - II - III. b) I - III - II. c) II - III - I. d) III - II - I e) III - I - II. Questo 1067 H na mdia uma grande quantidade de notcias envolvendo o DNA: testes de paternidade, engenharia gentica, transgnicos, clonagem teraputica e reprodutiva, terapia gnica, farmacogenmica etc. Para compreender essas notcias, necessrio conhecer a estrutura da molcula de DNA e entender seu funcionamento. Analise os dados dos quadros a seguir, e assinale a(s) proposio(es) CORRETA(S).

238

e) apenas II e III. Questo 1069 1.5.8.4 O esquema resume parcialmente as relaes funcionais dos cidos nucleicos que ocorrem na maioria das clulas vivas.

1.5.8.4 (01) Em I, observa-se que o pareamento das bases nitrogenadas do DNA aleatrio. (02) O quadro I mostra uma molcula de DNA cuja duplicao ocorre de forma semiconservativa, pois cada uma das fitas originais em I serve de molde para uma nova fita, gerando duas novas duplas hlices. (04) Em II, est indicado o processo de transcrio, atravs do qual formam-se molculas que contm as mesmas bases nitrogenadas presentes no DNA. (08) Em III, est indicado o processo de traduo, que resulta na formao de polipeptdios, cuja seqncia de aminocidos est codificada numa molcula de cido nuclico. (16) A deleo de um dos pares de bases na seqncia mostrada em I no alteraria significativamente a seqncia de aminocidos em III. Questo 1068 Analise as afirmativas a seguir. I. Nas clulas eucariontes, a informao gentica transmitida do citoplasma, onde est o DNA, para o ncleo, onde sero produzidas as protenas. II. Nas bactrias, transcrio e traduo ocorrem no mesmo local porque as clulas procariontes no possuem sistema de endomembranas. III. Durante a transcrio, uma fita de DNA serve como molde para a produo do RNA que ter uma seqncia de nucleotdeos complementar fita-molde. Est(o) correta(s) a) apenas I. b) apenas II. c) apenas III. d) apenas I e III.
239

onsiderando-se apenas clulas eucariontes, as etapas que representam, respectivamente, transcrio, duplicao e traduo so: a) I, II e III. b) I, III e II. c) II, I e III. d) III, I e II. e) II, III e I. Questo 1070 Algumas clulas de cultura de tecido foram deixadas em um meio contendo um precursor radioativo de RNA. Posteriormente, essas clulas foram transferidas para um meio sem essa substncia. Aps 3 minutos, algumas clulas foram fixadas e radioautografadas. Esse procedimento se repetiu aps 15 e aps 90 minutos. Os esquemas representam as clulas radioautografadas nos trs momentos, revelando a distribuio do precursor radioativo nas mesmas.

1.5.8.4

1.5.8.5

Esses resultados ocorrem porque a) o RNA transportador leva o istopo at o nuclolo e posteriormente ao ncleo e citoplasma celular. b) a substncia, ao ser deixada em situao de desequilbrio osmtico em relao cultura sem istopo, dirige-se gradativamente para o citoplasma celular, buscando a situao de equilbrio. c) a sntese de RNA, que se intensifica aos 90 minutos, esgota toda a substncia presente no ncleo, restando apenas no citoplasma. d) a produo de RNA, que ocorre inicialmente no ncleo celular, prossegue posteriormente no citoplasma da clula. e) a sntese de RNA ocorre no ncleo, sendo que posteriormente o RNA a produzido migra para o citoplasma celular. Questo 1071 Os cdons AGA, CUG e ACU do RNA mensageiro codificam, respectivamente, os aminocidos arginina, leucina e treonina. A seqncia desses aminocidos na protena correspondente ao segmento do DNA que apresenta a seqncia de nucleotdeos GAC TGA TCT ser, respectivamente, a) treonina, arginina, leucina. b) arginina, leucina, treonina. c) leucina, arginina, treonina. d) treonina, leucina, arginina. e) leucina, treonina, arginina. Questo 1072 Partindo-se do conhecimento do RNAm (CCU GAG), indique, nas opes a seguir, qual a seqncia correta do DNA e do RNA transportador.

Questo 1073 Sobre a sntese de protenas, so feitas as seguintes afirmaes: I - Um RNA-t (RNA transportador) transporta sempre um determinado aminocido. Esse aminocido, porm, pode ser transportado por vrios RNA-t. II - A traduo do cdigo qumico do RNA-m (RNA mensageiro) ocorre nos ribossomas localizados no retculo endoplasmtico rugoso. III - As molculas de RNA-t apresentam numa determinada regio da sua molcula uma trinca de bases denominada anticdon. Assinale a(s) afirmativa(s) correta(s): a) Apenas II. b) Apenas III. c) Apenas I e II. d) Apenas II e III. e) I, II e III. Questo 1074 Ao longo da molcula de DNA, existem quatro tipos de genes que atuam como est demonstrado no esquema a seguir: So esses mecanismos que tornam possvel a: a) diferenciao celular. b) produo de energia. c) duplicao de RNA. d) mutao gnica. e) lise celular.

240

anlise do esquema anterior nos permite afirmar que: I - os ribossomas alinhados nessa molcula de RNA traduziro os mesmos cdons; II - durante o processo a protena formada depende, em ltima anlise, de uma molcula de DNA; III - qualquer protena formada ser conseqncia direta de uma transcrio do RNA. A(s) afirmativa(s) correta(s) (so): a) I apenas. b) I e II apenas. c) I e III apenas. d) II e III apenas. e) I, II e III. Questo 1077 Analise o texto abaixo e assinale a alternativa que contm os termos que preenchem corretamente os espaos (I), (II), (III) e (IV). "O controle das caractersticas fenotpicas dos seres vivos feito pelos ___(I)___ atravs do comando da sntese de ___(II)___. No processo de elaborao de uma protena ocorrem as etapas de transcrio e ___(III)___. A primeira etapa forma a molcula de ___(IV)___ contendo a mensagem gentica e a segunda etapa responsvel pela produo da protena." a) ribossomos, protenas, traduo, RNA transportador. b) ribossomos, aminocidos, duplicao, RNA ribossmico. c) genes, aminocidos, duplicao, RNA mensageiro. d) genes, protenas, traduo, RNA mensageiro. e) genes, aminocidos, cpia, RNA ribossmico. 1.5.8.5 Questo 1078 O esquema a seguir representa a seqncia das etapas da sntese de um trecho de uma protena a partir da molcula de DNA, num certo organismo.

1.5.8.5

Questo 1075 O antibitico Estreptomicina age sobre as bactrias promovendo a leitura errada do RNAm, a Tetraciclina liga-se subunidade ribossmica menor e inibe a ligao do AA-RNAt, o Cloranfenicol inibe a peptidiltransferase na subunidade ribossmica maior e a Rifampicina inibe a RNA polimerase no stio de iniciao. Sabe-se que esses antibiticos so substncias cuja utilizao mdica se baseia na inibio das clulas bacterianas atuando no mecanismo de: a) fagocitose. b) secreo de substncias. c) sntese protica. d) produo de energia. e) reproduo celular. Questo 1076

241

Questo 1080 A composio qumica de uma protena pode ser alterada se a) durante sua sntese houver variao dos tipos de aminocidos disponveis no citoplasma. b) durante sua sntese houver variao dos tipos de RNA transportadores. c) sua sntese ocorrer no retculo endoplasmtico liso e no no rugoso. d) uma base prica substituir uma pirimdica no RNA mensageiro que a codifica. e) O DNA no se duplicar durante a interfase. Questo 1081 A seqncia de aminocidos de uma protena determinada pela seqncia de a) pentoses da molcula de DNA. b) pentoses da molcula de RNA - mensageiro. c) bases da molcula de DNA. d) bases da molcula de RNA - transportador. e) bases da molcula de RNA - ribossmico Questo 1082 Considere os seguintes fragmentos de cidos nuclicos que participam da sntese de uma protena.

1.5.8.5

obre essa sntese foram feitas as afirmaes abaixo: I. No esquema, os nmeros 1 e 2 correspondem, respectivamente aos processos de traduo e transcrio, que ocorrem no ncleo das clulas eucariticas. II. A seqncia correta de bases nitrogenadas encontradas na molcula de RNA mensageiro, complementar ao segmento da hlice de DNA apresentada UGGUUUGGCUCA. III. Para codificar a seqncia dos aminocidos do trecho da protena apresentada no esquema so necessrios 24 nucleotdeos no RNA mensageiro. Deve-se concluir que a) apenas II est correta. b) apenas I e II esto corretas. c) apenas II e III esto corretas. d) apenas I e III esto corretas. e) todas esto corretas. Questo 1079 A Rifampicina um dos antibiticos utilizados para o tratamento da tuberculose. Seu mecanismo de ao consiste na inibio da transcrio nas clulas de 'Mycobacterium tuberculosis'. Sob ao do antibitico, nas clulas bacterianas haver comprometimento a) exclusivamente da produo de protenas. b) exclusivamente da produo de DNA. c) exclusivamente da produo de RNA. d) da produo de RNA e de protenas. e) da produo de DNA e RNA.

1.5.8.5

s espaos 1, 2 e 3 ficariam corretamente preenchidos por: a) ACA; CUC; GAU b) TGT; GAG; CAU c) TCT; GUG; GTA d) UGU; GAG; CAT e) TGT; CAC; GUA

242

Questo 1083

e) 558 Questo 1086 Tradicionalmente, os tomates so colhidos ainda verdes para que sua firmeza seja mantida no transporte. Antes de chegarem s prateleiras, os tomates so pulverizados com etileno para acelerar o amadurecimento e torn-los vermelhos. O tomate Flavr Savr foi desenvolvido pela empresa de biotecnologia Calgene para amadurecer no p mantendo a firmeza de sua pele. Dessa forma, o tomate pode ser transportado j maduro e apresenta um maior tempo de prateleira. Os pesquisadores utilizaram a metodologia "anti-sense" (veja o quadro a seguir) para diminuir os nveis da enzima poligalacturonase, cuja expresso gnica induzida pelo etileno. Essa enzima promove a hidrlise de componentes da parede celular, o que compromete a firmeza dos frutos.

1.5.8.5

Considerando o esquema acima, que representa um fragmento de cido nuclico, cuja funo transportar aminocidos, assinale a alternativa INCORRETA. a) A substncia representada em I obrigatoriamente ribose. b) Cada trinca de bases, representada em II, denominada anticdon. c) Esse cido nuclico produzido no ncleo e se dirige ao citoplasma, unindo-se aos aminocidos. d) II pode apresentar molculas de adenina. e) Se a ao desse cido for bloqueada, o processo de transcrio no ocorrer. Questo 1084 Um mutante perdeu um segmento de DNA contendo todas as cpias dos genes que codificam RNA transportador. A funo celular drasticamente afetada por essa mutao ser a) a replicao do DNA. b) a sntese de RNA mensageiros. c) a sntese de protenas. d) o transporte de protenas. e) o transporte de RNA. Questo 1085 O DNA apresenta importantes funes celulares. Uma delas a sntese de protena. Numa sntese de protena com 185 ligaes peptdicas, o filamento de DNA que proporcionou essa sntese dever ter o seguinte nmero total de nucleotdeos: a) 62 b) 93 c) 186 d) 279

1.5.8.5

Assinale a alternativa INCORRETA. a) Essa metodologia visa reduzir os nveis de etileno nos frutos evitando seu amadurecimento. b) O RNAm do gene "anti-sense" capaz de parear com o RNAm da poligalacturonase, impedindo sua expresso. c) O maior tempo de prateleira a que o texto se refere se deve aos baixos nveis da enzima poligalacturonase. d) A tecnologia "anti-sense" para genes necessrios sntese do etileno poderia ser utilizada para se evitar o amadurecimento de frutos. Questo 1087 O esquema a seguir um processo celular vital, que ocorre tambm em voc.

243

1.5.8.5

Nesse processo ocorre produo de, EXCETO: a) macromolculas de reserva energtica. b) enzimas usadas, por exemplo, no processo digestivo. c) molculas de defesa do corpo. d) molculas utilizadas nos processos de cicatrizao. Questo 1088 Os grficos a seguir revelam o NMERO DE GENES e a relao entre RNA CODIFICADOR (que contm as seqncias que podem ser traduzidas em protenas) e RNA NO-CODIFICADOR (seqncias que so transcritas, mas no so traduzidas em protenas) de seis espcies de organismos.

Analisando os resultados anteriores de acordo com seus conhecimentos sobre o assunto, correto afirmar, EXCETO: a) No existe uma relao de proporcionalidade direta absoluta entre o nmero de genes e a complexidade dos organismos relacionados. b) Os vertebrados citados apresentam menor percentual de transcrio em relao aos outros animais. c) Os ntrons so exemplos de RNA no-codificador, e nos xons esto presentes seqncias codificadoras. d) Seqncias transcritas, mas no traduzidas, poderiam desempenhar alguma funo no ncleo celular. Questo 1089 Na sntese protica, observam-se os seguintes eventos: I. o gene (segmento de DNA) transcrito em RNA mensageiro; II. o RNA mensageiro combina-se com um complexo de ribossomo, RNAs transportadores e aminocidos; III. a protena sintetizada. Num experimento de laboratrio hipottico, realizou-se uma sntese protica utilizando-se: DNA de um gene humano, RNAs transportadores de ovelha e aminocidos de coelho. Ao final do experimento, obteve-se uma protena a) humana. b) de ovelha. c) de coelho. d) quimrica de homem e ovelha. e) hbrida de homem e coelho. Questo 1090 Responder questo com base na ilustrao e afirmativas a seguir.

1.5.8.5

1.5.8.5

244

. Durante o processo A, denominado replicao, o DNA se duplica. II. Durante o processo B, denominado transcrio, ocorre a sntese de RNA. III. Durante o processo C, denominado traduo, d-se a sntese protica. IV. Nos eucariotos, os processos A, B e C ocorrem no interior do ncleo. Considerando os processos intracelulares, todas as afirmativas corretas encontram-se na alternativa a) I, II e III b) I, III e IV c) I e IV d) II e III e) II, III e IV Questo 1091 (...) De outro lado, o galardo de qumica ficou com os inventores de ferramentas para estudar protenas, os verdadeiros atores do drama molecular da vida. verdade que a Fundao Nobel ainda fala no DNA como o diretor de cena a comandar a ao das protenas, mas talvez no seja pretensioso supor que foi um lapso, e que o sinal emitido por essas premiaes aponta o verdadeiro futuro da pesquisa biolgica e mdica muito alm dos genomas e de seu seqenciamento (uma simples soletrao). (...) (LEITE, Marcelo. "De volta ao seqenciamento." Folha de S. Paulo - 20/10/2002.) O autor refere-se s protenas como ''atores do drama molecular'' e ao DNA como "diretor de cena". Essa referncia deve-se ao fato de a) no ocorrer uma correlao funcional entre DNA e protenas no meio celular. b) o DNA controlar a produo de protenas etambm atuar como catalisador de reaes qumicas celulares. c) o material gentico ser constitudo por protenas. d) as protenas no terem controle sobre o metabolismo celular. e) o DNA controlar a produo de protenas e estas controlarem a atividade celular.

Questo 1092 Em se tratando do processo de sntese de protenas, certo afirmar: a) os aminocidos que esto no citoplasma so selecionados pelo RNAm b) todo o processo da sntese de uma protena ocorre exclusivamente no ncleo da clula c) o RNAm controla a sntese de uma protena, mas a sntese dele prprio controle do DNA d) o RNAt responsvel pela etapa de transcrio no processo de sntese de uma protena Questo 1093 "Desenvolvimento significa, em grande parte, clulas tornando-se diferentes de maneira ordenada [...]. Muitos animais desenvolvem-se ao longo de eixos cartesianos, sendo os padres especificados independentemente ao longo de cada um. Uma maneira de produzir padres dar s clulas informao posicional, como em um sistema coordenado, e as clulas ento interpretam esses valores de maneiras diferentes. A importante implicao disto que no existe relao entre o padro inicial e o observado. Uma outra caracterstica comum parece ser a gerao de estruturas peridicas como segmentos, vrtebras, penas e dentes, que so construdas segundo o modelo bsico modificado pela informao posicional. Todas as interaes ocorrem a curta distncia - raramente ultrapassam mais que 30 dimetros de clula - e a maior parte da formao de padres acontece localmente, de forma que os embries so logo divididos em regies que essencialmente se dividem de maneira independente". (WOLPERT, Lewis. In: MURPHY, M. P; O'NEILL, L.A.J. "O Que vida? 50 anos depois". So Paulo: UNESP, 1997. p. 74.) Com base no texto e nos conhecimentos sobre o tema, correto afirmar: a) As clulas diferenciam-se de acordo com um padro intrnseco, contido no material gentico, que induzido a se expressar em resposta a fatores extrnsecos. b) O desenvolvimento envolve a expresso diferencial do material gentico e independe do micro-ambiente em que a clula est localizada. c) O desenvolvimento das diferentes regies de um organismo deve-se propriedade de interao clula-clula
245

e da quantidade de informaes que a clula capaz de processar. d) A diferenciao caracteriza-se pela manuteno do padro morfolgico e pela alterao do padro funcional do tecido. e) O desenvolvimento ocorre como um domin, em que a diferenciao de um tipo celular induz outro tipo a se diferenciar. Questo 1094 Um RNA-mensageiro bacteriano formado pela polimerizao de 5292 nucleotdios e contm trs cdons de iniciao de leitura e trs de terminao. Admita que todos os demais nucleotdios formam cdons que correspondem a aminocidos encontrados na estrutura primria das protenas aps serem sintetizadas. Esse RNA traduzido em trs diferentes protenas, contendo, respectivamente, um nmero X, Y e Z de aminocidos. Sabe-se que X < Y < Z e que esses valores formam uma progresso aritmtica. Portanto, o valor de Y equivale a: a) 826 b) 706 c) 586 d) 466 Questo 1095 Considere os seguintes cdons: UAC - GAU - UGC - AUG Os anti-cdons correspondentes so: a) AUG - CUA - ACG - UAC b) ATG - CTA - ACG - TAC c) TUG - CUT - TCG - UTC d) AGT - CGA - ACT - GAC e) GCA - UCG - GUA - CGU Questo 1096 Sobre os diferentes papis dos cidos nuclicos na sntese de protenas podemos afirmar corretamente que: a) a seqncia de bases no DNA determina a seqncia de aminocidos na cadeia polipeptdica. b) a posio dos aminocidos na cadeia polipeptdica depende da seqncia de bases do tRNA.

c) o transporte de aminocido para o local da sntese feito pelo mRNA. d) a seqncia de bases do rRNA transcrita a partir do cdigo do mRNA. e) a extremidade livre dos diversos tRNA tem seqncias de bases diferentes. Questo 1097 O pesquisador Gustavo obtm pectinase, no meio de cultura lquido, produzida pelo fungo 'Aspergillus niger', para ser empregada na indstria de sucos. Gustavo no precisa destruir o fungo para obter a enzima; ele simplesmente separa o meio de cultura do microrganismo e isola a enzima deste meio. De acordo com o texto, assinale a alternativa correta. a) O 'Aspergillus niger' um organismo que possui mesossomo; desta forma, a sntese da enzima ocorre nas membranas do mesossomo e depois ela secretada para o meio de cultura. b) O caminho da produo da pectinase comea com a transcrio, no citoplasma, do seu RNAm, que traduzido por ribossomos e depois ancorado nas membranas do retculo endoplasmtico rugoso, onde a traduo concluda. c) A sntese da pectinase comea no citoplasma e termina nas membranas do retculo endoplasmtico rugoso. Em seguida, esta enzima passa para o complexo de Golgi e secretada, via vesculas de secreo, para o meio de cultura. d) A sntese da pectinase comea no ncleo e termina nas membranas do retculo endoplasmtico liso. Em seguida, esta enzima passa para o lisossomo, depois para o complexo de Golgi e secretada, via vesculas de secreo, para o meio de cultura. e) A sntese da pectinase comea no mesossomo e termina nas membranas do retculo endoplasmtico rugoso. Em seguida, esta enzima passa para o complexo de Golgi e secretada, via vesculas de secreo, para o meio de cultura. Questo 1098 Na sntese protica, um processo bastante complexo e fundamental para a sobrevivncia das clulas, a participao dos cidos nuclicos, substncias qumicas indispensveis vida, est corretamente referida em: a) O DNA transcreve a mensagem gentica para o RNA, que serve de modelo para a formao de uma protena.
246

b) O DNA transcreve a mensagem gentica para o RNA solvel, que se liga ao ribossomo, local da sntese protica. c) O RNA mensageiro contm trincas de nucleotdeos denominadas cdons, responsveis pela transcrio de uma cadeia polipeptdica. d) O RNA transportador apresenta na sua molcula uma trinca de nucleotdeos denominada anticdon, local de ligao com o aminocido que ele transporta. e) O RNA ribossmico se une a protenas formando o ribossomo, local onde ocorre a transcrio da mensagem gentica. Questo 1099 Um pesquisador injetou RNA mensageiro (mRNA) de vrus em ovcitos de anfbios. Aps certo tempo, verificou que esses ovcitos, alm de suas prprias protenas, produziam, tambm, protenas virais. Esses dados sugerem que a) o DNA dos ovcitos foi impedido de se expressar. b) o mRNA se integrou ao DNA dos ovcitos, comandando a sntese da protena viral. c) o material injetado nos ovcitos foi capaz de se autoduplicar. d) os ovcitos foram capazes de interpretar a informao contida no mRNA viral. Questo 1100 Analise este grfico, em que est representada a produo de diferentes tipos de cadeias polipeptdicas - , , e determinadas pela ao de diferentes genes e que vo compor as hemoglobinas em vrias fases do desenvolvimento humano:

om base nas informaes contidas nesse grfico e em outros conhecimentos sobre o assunto, INCORRETO afirmar que a) a ativao do gene responsvel pela sntese da cadeia polipeptdica ocorre dias antes do nascimento. b) a sntese da cadeia polipeptdica permanece constante durante a mudana de produo das cadeias e . c) o gene responsvel pela sntese da cadeia polipeptdica aumenta sua atividade a partir do terceiro ms da concepo. d) os quatro tipos de cadeias polipeptdicas - , , e estaro presentes no indivduo adulto. Questo 1101 So feitas as seguintes afirmativas a respeito da sntese protica. Analise-a e assinale a alternativa correta. I) Um RNAt transporta sempre o mesmo aminocido. II) A traduo do cdigo gentico do RNAm feita nos ribossomos localizados no retculo endoplasmtico rugoso. III) O anticdon corresponde a uma trinca de bases localizada numa determinada regio de todos os RNAt. a) Apenas II est correta. b) Todas esto corretas. c) Esto corretas apenas I e II. d) Apenas III est correta. e) Esto corretas apenas I e III. Questo 1102 No esquema, os nmeros 1, 2 e 3 substituem, respectivamente:

1.5.8.5

1.5.8.5

247

a) represso gnica, transcrio, replicao b) replicao, traduo, transcrio c) amplificao gnica, represso, traduo d) replicao, transcrio, traduo e) transcrio, replicao, traduo Questo 1103 O esquema a seguir mostra a via metablica de um aminocido, levando formao de alguns hormnios:

dogma central da Biologia. Segundo esse dogma, a) o cdigo gentico degenerado, pois um aminocido pode ser codificado por mais de uma trinca. b) a transferncia de informaes genticas ocorre do DNA para o RNA, e deste para a protena. c) cada polipeptdeo tem uma seqncia especfica de nucleotdeos determinada pelo gene. d) cada molcula de DNA formada pela reunio de nucleotdeos, que podem ser de quatro tipos diferentes. e) uma molcula de DNA difere de outra pela seqncia de seus nucleotdeos. Questo 1105

1.5.8.5

Um dos processos metablicos mais importantes, que ocorre em nvel celular, a sntese de protenas. Com relao a esse processo, CORRETO afirmar que: (01) ele ocorre nos ribossomos, no interior do ncleo. (02) dele participam trs molculas de RNA: o ribossmico, o mensageiro e o transportador. (04) o RNA transportador tem como funo levar as protenas produzidas no ncleo para o citoplasma. (08) o ordenamento dos aminocidos na protena formada d-se em funo da seqncia de bases nitrogenadas, presente no RNA mensageiro. (16) o cdigo gentico degenerado, isto , diferentes cdons sempre especificam diferentes aminocidos na cadeia polipeptdica. (32) existem cdons especficos para conclu-lo. Questo 1106

respeito deste esquema so feitas as seguintes afirmaes: I - Um indivduo com a enzima 1 inibida acumular grandes quantidades de aminocido 3. II - Um indivduo com a enzima 1 inibida deixa de produzir as enzimas 2 e 3. III - Um indivduo com a enzima 1 inibida precisa receber os hormnios 1 e 2 de fontes externas. Quais esto corretas? a) Apenas I. b) Apenas II. c) Apenas III. d) Apenas I e II. e) Apenas II e III. Questo 1104 O cientista britnico Francis Crick, um dos descobridores da estrutura da molcula de DNA, morto em julho de 2004, ser lembrado como um dos mais influentes cientistas de todos os tempos. Em 1958, publicou um manifesto sobre a sntese de protenas, apresentando suas hipteses sobre a estrutura terica da biologia molecular, lanando, assim, as bases para a descoberta do cdigo gentico. Entre as hipteses apresentadas naquele texto, destaca-se o

1.5.8.5

248

No esquema, o nmero (1) corresponde ao processo de ___________; o nmero (2), ao processo de ___________ e o nmero (3) ao processo de ___________. Nas clulas eucariotas, os processos representados pelos nmeros (1) e (2) ocorrem no _________. Assinale a alternativa que preenche, corretamente, as lacunas. a) transcrio - replicao - traduo - ncleo. b) replicao - traduo - transcrio - citoplasma. c) transcrio - traduo - replicao - ncleo d) replicao - transcrio - traduo - citoplasma e) replicao - transcrio - traduo - ncleo Questo 1107

1.5.8.5

Analise o esquema e julgue os itens a seguir. (0) Ao final da sntese, todas as protenas representadas no esquema sero iguais. (1) Os ribossomos esto se movendo da parte de baixo para a de cima do esquema. (2) No esquema, no est representado o RNA transportador, que tambm participa do processo. (3) O conjunto representado pode estar localizado no retculo endoplasmtico rugoso. (4) O nmero de aminocidos da protena depender do tamanho do RNA mensageiro. Questo 1109 O diagrama ilustra uma fase da sntese de protenas.

1.5.8.5

AVANCINI e FAVARETTO, "Biologia - Uma abordagem evolutiva e ecolgica". vol. 1. So Paulo: Moderna, 1997. p. 150. Na figura, o nmero a) 2 representa o RNA mensageiro que contm os cdons para a sntese protica. b) 3 representa a protena carregada pelo RNA mensageiro. c) 4 representa o RNA transportador que carrega a mensagem. d) 1 representa a mitocndria onde ocorre o processo de traduo. e) 4 representa o RNA mensageiro que est sendo carregado pelo RNA transportador representado pelo nmero 1. Questo 1108 O esquema a seguir representa a sntese protica. 1.5.8.5

s algarismos I, II, III e IV correspondem, respectivamente, a: a) ribossomo, cdon, RNAm e RNAt. b) RNAt, RNAm, ribossomo e cdon. c) RNAt, RNAm, ribossomo e anticdon. d) RNAm, RNAt, ribossomo e cdon. e) RNAm, RNAt, ribossomo e anticdon.

249

Questo 1110 O esquema representa alguns passos de uma srie de reaes metablicas, onde quatro genes, I, II, III e IV, produzem quatro tipos diferentes de enzimas, 1, 2, 3 e 4, transformando o aminocido fenilalanina em quatro possveis substncias.

s processos assinalados como 1 e 2 e a organela representados no diagrama referem-se, respectivamente, a a) transcrio, traduo e ribossomo. b) traduo, transcrio e lisossomo. c) duplicao, transcrio e ribossomo. d) transcrio, duplicao e lisossomo. e) traduo, duplicao e retculo endoplasmtico. Questo 1112 Supondo que o peso molecular mdio de um aminocido de 100 daltons, quantos nucleotdeos em mdia esto presentes em uma seqncia codificadora de ARN-m, responsvel pelo sequenciamento dos aminocidos em um peptdeo com peso molecular de 27000 daltons? a) 810 b) 300 c) 270 d) 81000 e) 2700 Questo 1113 Griffth em 1928 descobriu que pneumococos sem cpsula, no patognicos, misturados com um extrato de pneumococos capsulados patognicos mortos causavam a morte de cobaias. Nesse extrato o agente transformante era a) o cido ribonuclico. b) o cido indolilactico. c) o cido desoxirribonuclico. d) uma enzima. e) uma protena. Questo 1114 Em 1928 Griffth descobriu que pneumococos (bactrias) sem cpsula e no-patognicos, misturados com um extrato de pneumococos capsulados, patognicos e mortos, causavam a morte de cobaias. Nesse extrato o agente capaz de transformar bactrias no-patognicas em patognicas era a) o cido ribonuclico. b) o cido indolilactico. c) o cido desoxirribonuclico. d) uma enzima. e) uma protena.

1.5.8.5

m indivduo tem anomalias na pigmentao do corpo e seu metabolismo prejudicado pela falta do hormnio da tireide. O funcionamento das glndulas supra-renais, porm, normal. De acordo com o esquema, os sintomas que o indivduo apresenta ocorrem devido s alteraes a) no gene I, somente. b) nos genes I e II, somente. c) nos genes I e III, somente. d) nos genes II e III, somente. e) nos genes III e IV, somente. Questo 1111 Considere o diagrama, que resume as principais etapas da sntese protica que ocorre numa clula eucarionte.

1.5.8.5

250

Questo 1115 Griffth, em 1928 descobriu que bactrias pneumococos sem cpsula e no-patognicos, misturados com um extrato de pneumococos capsulados, patognicos e mortos, causavam a morte de cobaias. Em 1944 Avery, McLeod e McCarthy concluram que o agente capaz de transformar as bactrias era a) o RNA. b) o AIA. c) o DNA. d) uma enzima. e) uma protena. Questo 1116 A experincia do "liquidificador" realizada por Hersey e Chase demonstrou que a substncia que determinava a destruio de bactrias parasitadas pelos vrus bacterifagos era a) uma protena viral. b) uma enzima viral. c) o RNA viral. d) o DNA viral. e) um lpide viral. Questo 1117 O experimento do "liquidificador" serviu para demonstrar que o DNA de certos organismos era capaz de causar a destruio de bactrias. Os organismos que podem infectar bactrias so a) fungos. b) vrus. c) algas. d) caros. e) protozorios. Questo 1118 Bacterifagos so a) protozorios de vida livre. b) lquenes parasitas. c) vermes parasitas. d) vrus. e) vermes de vida livre.

Questo 1119 A experincia do "liquidificador" realizada por Hersey e Chase em 1952 demonstrou que a) o material gentico formado por protenas. b) o material gentico formado de RNA. c) o material gentico formado de lipdios. d) o material gentico formado por acares. e) o material gentico formado de DNA. Questo 1120 A bactria 'Pneumococo pneumoniae' pode possuir uma cpsula que lhe permite a) sofrer mutaes. b) desenvolver flagelos. c) resistir s defesas dos hospedeiros. d) ficar imune s defesas dos hospedeiros. e) sobreviver em ambientes sem gua. Questo 1121 "O sculo XX proporcionou uma srie de pesquisas na rea gentica. Em 1928, Griffith realizou um importante experimento que envolvia transformaes em bactrias. Esse experimento, retomado por Avery e colaboradores, em 1944, foi a base para a descoberta da molcula formadora do material gentico. Nos anos 50, Watson e Crick apresentaram o modela da dupla-hlice dessa molcula, abrindo caminho para que, na dcada seguinte, se demonstrasse como o gene, atravs de sua seqncia de bases nitrogenadas, controla a produo de protenas. Nas duas ltimas dcadas, o avano biotecnolgico permitiu aos cientistas a manipulao do material gentico e a transferncia de um gene de uma espcie para outra." Considere os itens abaixo: I. estrutura da molcula do DNA; II. descoberta do cdigo gentico; III. DNA como molcula constituinte do gene; IV. obteno de organismos transgnicos. O texto faz referncia a) apenas aos itens I, II e III.
251

b) apenas aos itens I, II e IV. c) apenas aos itens I, III e IV. d) apenas aos itens II, III e IV. e) a todos os itens considerados. 1.5.8.6 Questo 1122 Sabendo que o DNA dos vrus bacterifagos contm fsforo e que a cpsula protica contm enxofre, Hersey e Chase, em 1952, cultivaram vrus em meio contendo istopos de fsforo (P) e de enxofre (S). Esses pesquisadores observaram, ao introduzir os vrus marcados em meio contendo bactrias, que os istopos de fsforo (P) apareciam no interior das bactrias e que os istopos de enxofre (S) permaneciam fora das clulas. Observaram tambm que, aps lavarem a superfcie das bactrias, retirando o enxofre (S), continuava ocorrendo a replicao dos vrus. Com esse experimento, eles puderam concluir que a) a informao gentica necessria para a sntese de novos vrus est contida no DNA viral. b) as capas proticas dos vrus contm parte importante da informao gentica necessria sntese de novos vrus. c) o DNA viral precisa estar associado integralmente s capas proticas para poder se replicar no interior das bactrias. d) a capa protica protege o DNA viral da ao de endonucleases no interior do organismo hospedeiro. e) os vrus bacterifagos contm DNA como material gentico, e essa molcula muito rica em enxofre. Questo 1123 No incio da dcada de 1950, foi desenvolvido um experimento onde um dos componentes de um tipo de bacterifago foi marcado radiativamente com enxofre e outro, com fsforo. Esses bacterifagos foram utilizados para infectar uma cultura de 'Escherichia coli'. Um dos componentes entrou na bactria, e o outro foi retirado da parede da mesma, por agitao. A cultura foi, ento, imediatamente, centrifugada. O resultado obtido encontra-se ilustrado no esquema a seguir.

obre o resultado do experimento, correto afirmar que a) o DNA do bacterifago marcado com fsforo encontra-se no depsito bacteriano. b) as protenas do bacterifago marcadas com enxofre encontram-se no depsito bacteriano. c) o DNA do bacterifago marcado com enxofre encontra-se em suspenso. d) as protenas do bacterifago marcadas com fsforo encontram-se em suspenso. e) o DNA do bacterifago marcado com enxofre encontra-se no depsito bacteriano. Questo 1124 Por razes pouco conhecidas, durante a meiose pode ocorrer a no-disjuno de um determinado par de cromossomas, acarretando anomalias cromossomiais. Como exemplo de anomalia cromossomial autossmica temos: a) mongolismo. b) daltonismo. c) hemofilia. d) Sndrome de Turner. e) Sndrome de Klinefelter. Questo 1125 O esquema a seguir representa a formao dos gametas responsveis pela produo de um indivduo com alterao do seu nmero cromossomial.

252

1.5.9.1

III IV a) 65 , 65. b) 65 ,130. c) 70 , 60. d) 130 , 65. e) 130 , 130. Questo 1128 Monossomia do cromossomo X, ovrios rudimentares, mau desenvolvimento dos caracteres sexuais secundrios, baixa estatura so, entre outros, dados que podem ser relacionados com a sndrome: a) de Marfan b) de Klinefelter c) de Down d) de Turner e) de Patau Questo 1129 A constituio gentica dos indivduos com sndrome de Klinefelter : a) 45A XX b) 44A XYY c) 44A XXY d) 45A XO e) 47A XXY Questo 1130 A sndrome de Down ou mongolismo uma anomalia causada por: a) uma mutao gnica b) uma deficincia cromossmica c) uma diminuio do nmero de cromossomos no genoma d) um aumento do nmero de cromossomos do genoma e) uma inverso cromossmica Questo 1131

ntre as caractersticas que este indivduo passar a apresentar, teremos: a) sexo masculino. b) caritipo normal. c) estatura elevada. d) caracteres sexuais desenvolvidos. e) ausncia de cromatina sexual. Questo 1126 A sndrome de Klinefelter uma anomalia gentica devido : a) presena de trs cromossomos autossmicos n 21. b) ausncia de um cromossomo autossmico n 21. c) presena de um cromossomo X e dois cromossomos Y. d) presena de um cromossomo Y e dois cromossomos X. e) ausncia de cromossomos sexuais. Questo 1127 Suponha que o seguinte processo ocorre em uma comunidade onde convivem diferentes espcies de gramnea: Qual das alternativas a seguir indica corretamente o valor de 2N dos hbridos III e IV do processo esquematizado?

1.5.9.1

Se na ovulognese, no houver disjuno do par de cromossomos sexuais, os vulos correspondentes, sendo fecundados, podero dar origem a casos de a) sndrome de Turner b) sndrome de Klinefelter c) sndrome de Down d) sndrome de Patau e) a e b so possveis
253

Questo 1132 Duas espcies de plantas A(2n = 8) e B(2n = 6) foram cruzadas produzindo um hbrido interespecfico que, germinando, produz alguns gros de plen que foram utilizados para fecundar vulos da espcie B. Assinale a opo que relaciona o nvel de ploidia e o nmero de cromossomos da descendncia. a) 2n = 7 b) 2n = 10 c) 3n = 7 d) 3n = 10 e) 4n = 14 Questo 1133 Duas espcies de plantas A(2n = 8) e B(2n = 10) foram cruzadas produzindo um hbrido interespecfico que, germinando, produz alguns gros de plen que foram utilizados para fecundar vulos da espcie B. Assinale a opo que relaciona o nvel de ploidia e o nmero de cromossomos da descendncia. a) 2n = 7 b) 2n = 14 c) 3n = 14 d) 3n = 10 e) 4n = 14 Questo 1134 A figura a seguir representa uma sinapse (pareamento) anormal observado quando ocorre a mutao cromossmica estrutural denominada:

a) inverso pericntrica b) translocao c) duplicao d) deleo e) isocromossomos Questo 1135 A figura a seguir representa uma sinapse (pareamento) anormal observado quando ocorre a mutao cromossmica estrutural denominada:

1.5.9.1

a) inverso pericntrica b) translocao c) duplicao d) deleo e) isocromossomos Questo 1136 Existem algumas pessoas chamadas especiais porque possuem uma srie de caractersticas diferentes da maioria da populao. Entre essas, esto aquelas que possuem a 'Sndrome de Down', tambm conhecida como Mongolismo. Em relao a essa sndrome, podemos afirmar que: a) uma anomalia gentica, causada pela presena de 3 cromossomos 21 e transmitida sempre pela me. b) uma anomalia congnita, causada pela presena de 3 cromossomos 21 e transmitida sempre pela me. c) uma anomalia gentica, causada pela presena de 3 cromossomos 21 e transmitida por qualquer um dos pais. d) uma anomalia congnita, causada pela ausncia de um cromossomo sexual X ou Y. e) uma anomalia gentica, causada pela translocao de um dos cromossomos 21 para um 22.

1.5.9.1

254

Questo 1137 Num dado organismo, foram encontradas clulas somticas normais com seis cromossomos (I) e clulas aberrantes (II e III) cujos caritipos esto esquematizados a seguir.

Questo 1139 O nmero de cromossomos de uma espcie 2n=20. O sistema de determinao do sexo do tipo ZW. O caritipo que representa uma euploidia : a) 20, ZW b) 20, ZZ c) 30, ZWW d) 19, ZO e) 21, ZZW Questo 1140 A figura a seguir ilustra o processo denominado AMNIOCENTESE, utilizado para diagnstico pr-natal de doenas genticas. A tcnica consiste na remoo de uma pequena quantidade de lquido amnitico (que banha o feto durante o desenvolvimento embrionrio) para anlise. Nesse lquido so encontradas protenas e clulas que se soltam da pele do feto e dos revestimentos das vias gastrointestinais, respiratrias e genito-urinrias. As clulas imersas no lquido podem ser coletadas por centrifugao e utilizadas para estabelecer culturas de amnicitos. Essas culturas podem ser analisadas citologicamente, ou por anlise do DNA.

1.5.9.1

s aberraes cromossmicas dos caritipos II e III so, respectivamente, do tipo a) monossomia e trissomia. b) monossomia e poliploidia. c) nulissomia e trissomia. d) nulissomia e poliploidia. e) nulissomia e monossomia. Questo 1138 Observe o caritipo a seguir, obtido a partir de clulas diplides de uma pessoa.

1.5.9.1

1.5.9.1

ua anlise permite afirmar que ele pode pertencer a uma mulher a) normal, com 47 cromossomos. b) com sndrome de Down. c) com sndrome de Klinefelter. d) com daltonismo. e) com polidactilia.

255

obre o processo acima descrito so feitas vrias afirmaes. Com base em seus conhecimentos e no texto acima, assinale a alternativa que apresenta um ERRO conceitual ou processual. a) O lquido amnitico funciona como amortecedor de choques mecnicos e propicia um ambiente adequado para o desenvolvimento do feto. b) Clulas presentes no lquido podem ser utilizadas para a determinao de anomalias cromossmicas. c) O processo pode ser indicado para gestantes com idade avanada, para as quais maior o risco de terem filhos com Sndrome de Down. d) A cariotipagem pode ainda ser utilizada para a deteco de erros inatos do metabolismo como, por exemplo, a hemofilia. e) A presena de alguns vrus, como o da rubola, apontam para possibilidade de ms formaes congnitas na criana. Questo 1141 O daltonismo um carter ligado ao sexo na espcie humana. A seguir esto representados os caritipos de cinco indivduos que apresentam uma anomalia cromossmica numrica, alm de serem todos daltnicos.

odas as afirmaes a seguir referentes aos indivduos representados so verdadeiras, EXCETO: a) O gameta com um cromossomo a mais que deu origem ao indivduo I foi produzido por no-disjuno na segunda diviso meitica da gametognese masculina. b) Ao pai do indivduo II obrigatoriamente daltnico, e a no-disjuno que resultou na anomalia pode ter acontecido na gametognese feminina. c) Se o pai do indivduo III no for daltnico, a no-disjuno que resultou na anomalia ocorreu na gametognese feminina. d) Se o pai do indivduo IV no for daltnico, a no-disjuno que resultou na anomalia ocorreu na gametognese feminina. e) A me do indivduo V pode ou no ser daltnica. Questo 1142

1.5.9.1

1.5.9.1 Acima, representa-se esquematicamente uma alterao estrutural de um cromossomo que serve de exemplo para o fenmeno denominado a) duplicao. b) deleo. c) translocao. d) transduo. e) inverso. Questo 1143 Uma mulher triplo-X frtil e produz vulos normais e vulos com dois cromossomos X. Sendo casada com um homem cromossomicamente normal, essa mulher ter chance de apresentar a) apenas descendentes cromossomicamente normais. b) apenas descendentes cromossomicamente anormais. c) 50% dos descendentes cromossomicamente normais e 50% cromossomicamente anormais.
256

d) 25% dos descendentes cromossomicamente normais e 75% cromossomicamente anormais. e) 75% dos descendentes cromossomicamente normais e 25% cromossomicamente anormais. Questo 1144 Na espcie humana, a anomalia conhecida como sndrome de Down ou mongolismo deve-se a) mutao de um gene autossmico. b) mutao de um gene do cromossomo X. c) existncia de um autossomo extra. d) existncia de um cromossomo X extra. e) falta de um cromossomo X. Questo 1145 Duas espcies de gramneas, pertencentes a gneros diferentes, ambas com nmero cromossmico 2n=28, foram cruzadas e criou-se um hbrido, tambm com 2n=28, que florescia, mas no conseguia produzir sementes. Meristemas desta gerao de hbridos (F1) foram submetidos a um tratamento com colchicina, o que resultou em uma duplicao do nmero cromossmico, gerando plantas (F2) com 2n=56, que por sua vez produziam sementes normalmente. De acordo com o texto e os conhecimentos sobre o tema, assinale a alternativa que indica a causa mais provvel para a infertilidade da F1, seguida de reproduo normal na F2: a) O tratamento com colchicina removeu as barreiras qumicas existentes nos dois conjuntos de cromossomos. b) Durante a meiose ocorrida em F1, parte dos cromossomos foi eliminada, havendo multiplicao apenas do lote haplide de uma das espcies. c) A primeira gerao filial era infrtil, em funo de alelos incompatveis, que foram seletivamente eliminados em F2. d) A duplicao do nmero cromossmico permitiu a formao de 28 pares de cromossomos bivalentes, viabilizando a meiose. e) A duplicao deu-se apenas com os cromossomos viveis de cada espcie e o nmero total foi completado com quebras cromossmicas.

Questo 1146 Pela anlise dos cromossomas, possvel detectar a anomalia que caracteriza a sndrome de Down. O esquema a seguir apresenta quatro eventos da diviso celular.

1.5.9.1

s eventos possveis da meiose que levam sndrome de Down so os de nmero: a) 1 e 4 b) 1 e 3 c) 2 e 3 d) 2 e 4 Questo 1147 Considere o cromossomo a seguir esquematizado. Assinale a alternativa que representa esse cromossomo aps um rearranjo do tipo inverso.

1.5.9.1

Questo 1148 Na figura a seguir, em I, temos uma clula diplide 2n = 6 cromossomos. Em II, III e IV, temos exemplos, respectivamente, de

257

Questo 1151 O nmero de cromossomos da espcie humana pode, s vezes, apresentar alteraes. Pessoas com sndrome de Klinefelter possuem 47 cromossomos, entre os quais, os cromossomos sexuais so representados por XXY. Com base nessas informaes e outros conhecimentos sobre o assunto, INCORRETO afirmar que a) os pais de um indivduo Klinefelter tm nmero normal de cromossomos nas clulas somticas. b) a presena de dois cromossomos X impede a manifestao do fentipo masculino. c) a ocorrncia do fentipo mutante resultado de um cromossomo extra. d) a fecundao de um vulo X por um espermatozide XY d origem a um indivduo Klinefelter. Questo 1152 Muitas aberraes cromossmicas humanas se manifestam como sndromes bem definidas e de fcil constatao pela anlise do caritipo. Na tabela a seguir so dados cinco casos cuja veracidade voc dever analisar. Assinale nos parnteses V se for verdadeira ou F se a afirmao for falsa.

1.5.9.1

a) haploidia; translocao; inverso paracntrica. b) haploidia; inverso pericntrica; translocao. c) monossomia; translocao; inverso pericntrica. d) monossomia; translocao; inverso paracntrica. e) monossomia; inverso paracntrica; translocao. Questo 1149 Vegetais maiores, mais vigorosos e, por esse motivo, mais vantajosos economicamente, ocorrem casualmente na natureza. Esses vegetais podem ser reproduzidos pelo homem, artificialmente, usando-se tcnicas de melhoramento gentico. Como exemplo, podemos citar o uso da Colchicina, que induz a) haploidia. b) inverso cromossmica. c) poliploidia. d) recombinao gnica. e) translocao cromossmica. Questo 1150 "Era um burrinho pedrs, mido e resignado, vindo de Passa-Tempo, Conceio do Serro, ou no sei onde no serto. Chamava-se Sete-de-Ouros, e j fora to bom, como outro no existiu e nem pode haver igual." (ROSA, J.Guimares. "Sagarana".) Todas as alternativas apresentam caractersticas biolgicas do burrinho referido nesse texto, EXCETO a) resultante do cruzamento de gua com jumento. b) Tem caractersticas morfolgicas idnticas s de um dos pais. c) um tpico exemplo de animal hbrido. d) Produz gametas inviveis.

1.5.9.1

Questo 1153 Na Sndrome de Down, tambm conhecida como trissomia 21: ( ) a causa a no-disjuno, isto , o fenmeno ocorre quando os cromossomos no se separam durante a primeira diviso meitica. ( ) nos homens, a produo de espermatozide ocorre durante todos os anos reprodutivos, no existindo no-disjuno e, por conseguinte, no levando aneuploidia em seus filhos.
258

( ) afeta indivduos que tm um autossoma extra. ( ) o longo perodo de intervalo entre o incio da meiose do tecido ovariano (durante o desenvolvimento fetal) e seu trmino (na ovulao) a mais provvel razo para a incidncia aumentada em mes mais idosas. ( ) os portadores tm uma cpia extra do cromossomo 21, ou um segmento do cromossomo 21, translocado para outro cromossomo. Questo 1154 A Sndrome de Down, uma aneuploidia autossmica, caracteriza-se pela trissomia do cromossomo 21 e decorre do(a) a) erro de disjuno do cromossomo 21 durante a formao dos gametas. b) fecundao de um gameta feminino diplide por um gameta masculino haplide. c) senilidade dos ovcitos em mulheres com idade a partir dos 35 anos. d) fato de as clulas autossmicas dos portadores terem 46 cromossomos. Questo 1155 FALHAS NO ENSINO DE CINCIAS "ERROS EM LIVROS DIDTICOS AINDA PERSISTEM EM ESCOLAS DE MINAS E SO PAULO" Nlio Bizzo O autor, professor da Faculdade de Educao da USP, comenta em um dos seus artigos: "... em alguns casos, podem-se perceber erro conceitual grave, preconceito e tautologia em uma nica linha, como por exemplo: explique por que o homem no portador de aneuploidias, mas apresenta a doena quando afetado." BIZZO, Nlio. Rev. "CINCIA HOJE". Abril 2000: n 159. p. 26 Os casos de aneuploidias citados no texto incluam daltonismo e hemofilia. Em funo do comentrio do professor, analise as afirmaes abaixo: I - daltonismo e hemofilia so alteraes gnicas e no cromossmicas.

II - tanto o homem quanto a mulher podem ser portadores de aneuploidias. III - o livro confunde herana ligada ao sexo com aneuploidias. Pode-se afirmar que a) I e II esto corretas. b) I e III esto corretas. c) II e III esto corretas. d) I, II e III esto corretas. e) I est correta. Questo 1156 Uma pesquisadora analisou clulas da mucosa bucal de frentistas de postos de gasolina. Foram encontradas muitas clulas que, alm do ncleo, apresentavam microncleos originados em cromossomos defeituosos. Quanto a esses microncleos, podemos supor que se originaram a partir de a) translocao. b) substituio. c) deleo. d) deslocao. e) bipartio. Questo 1157 Mulheres com Sndrome de Turner caracterizam-se por apresentar baixa estatura, esterilidade e pescoo alado. Esta Sndrome pode ser classificada como exemplo de a) Nulissomia. b) Monossomia. c) Trissomia. d) Euploidia. e) Triploidia. Questo 1158 As anomalias cromossmicas so bastante freqentes na populao humana; um exemplo disso que aproximadamente uma a cada 600 crianas no mundo nasce com sndrome de Down. Na grande maioria dos casos, isso se deve presena de um cromossomo 21 extranumerrio. Quando bem assistidas, pessoas com sndrome de Down alcanam importantes marcos no desenvolvimento e podem estudar, trabalhar e ter uma vida semelhante dos demais cidados.
259

Sobre as anomalias do nmero de cromossomos, CORRETO afirmar que: (01) podem ocorrer tanto na espermatognese quanto na ovulognese. (02) ocorrem mais em meninas do que em meninos. (04) ocorrem somente em filhos e filhas de mulheres de idade avanada. (08) esto intimamente ligadas separao incorreta dos cromossomos na meiose. (16) ocorrem ao acaso, devido a um erro na gametognese. (32) ocorrem preferencialmente em populaes de menor renda, com menor escolaridade e pouca assistncia mdica. (64) podem acontecer devido a erros na duplicao do DNA. Questo 1159 Em uma certa espcie de animal selvagem, os machos normais apresentam complemento cromossmico igual a 2n=6,XY. Entretanto, um indivduo anormal foi identificado na populao e seu caritipo foi representado pela seguinte forma:

1.5.9.1

A respeito desse tema, julgue os itens abaixo. (1) As fibras do fuso acromtico tm importncia fundamental para as migraes cromossmicas caractersticas da anfase. (2) Os erros na distribuio de cromossomos que levam s aneuploidias so freqentes no processo de meiose e raros nas mitoses. (3) As aberraes cromossmicas numricas causam grandes alteraes no funcionamento celular, produzindo doenas graves e at mesmo a morte. (4) As sndromes de Down e de Turner, causadas por no-disjunes cromossmicas, so exemplo de trissomia e de monossomia. Questo 1161

1.5.9.1

Os quadrados a seguir representam, em esquema, clulas de seis indivduos, numerados de 1 a 6, com a indicao do nmero de cromossomos autossmicos (A) e dos tipos de cromossomos sexuais (X e Y), presentes em cada uma delas.

onsiderando-se os dados anteriores, pode-se afirmar que o indivduo : a) trissmico. b) poliplide. c) triplide. d) haplide. e) monossmico. Questo 1160 A figura abaixo esquematiza a no-disjuno cromossmica.

1.5.9.1

260

m relao a estes indivduos, e s clulas representadas, foram feitas as afirmaes seguintes. I. Os indivduos 3, 5 e 6 so normais e pertencem espcie humana. II. A clula do indivduo 2 pode ser igual a de um gameta do indivduo 1. III. O indivduo 4 pode ser do sexo masculino ou do sexo feminino. Esto corretas as afirmaes: a) I, apenas. b) II, apenas. c) I e II, apenas. d) I e III, apenas. e) II e III, apenas. Questo 1162 A respeito das mutaes, leia as afirmaes a seguir. I - Ocorrem para adaptar o indivduo ao ambiente. II - Ocorrem em clulas sexuais e somticas. III - Podem alterar o nmero, a forma e o tamanho dos cromossomos. A(s) afirmao(es) correta(s) (so): a) somente a II. b) somente a I e a II. c) somente a I e a III. d) somente a II e a III. e) a I, a II e a III. Questo 1163 Na espcie humana, conhecida a trissomia do cromossomo 21 (sndrome de Down), que um dos menores cromossomos da espcie. Em relao ao cromossomo sexual X so conhecidos casos de recm-nascidos do sexo feminino com trissomia, tetrassomia e at pentassomia desse cromossomo. A que se deve esse fato? a) Ao cromossomo X ser um dos menores cromossomos do conjunto haplide b) Ao cromossomo X ser basicamente formado por heterocromatina com poucos genes estruturais c) Ao cromossomo X no ter uma pequena parte homloga ao cromossomo Y, o que evita a permuta gnica entre eles

d) Aos cromossomos X menos um serem inativados ainda na fase do desenvolvimento embrionrio e) Ao cromossomo X ser o cromossomo com maior quantidade de ADN repetitivo, o chamado ADN lixo Questo 1164 As alteraes do nmero de cromossomos, tais como: presena de um cromossomo 21 a mais; 47 cromossomos, sendo dois X e um Y e 45 cromossomos, tendo apenas um X, determinam, respectivamente, as sndromes de: a) Down, Klinefelter e Turner. b) Morgan, Turner e Klinefelter. c) Turner, Down e Morgan. d) Down, Turner e Klinefelter. e) Klinefelter, Turner e Down. Questo 1165 Considere um segmento de DNA com seqncia de bases indicadas a seguir: TTA TCG GGA CCG ATC ATC GTA A alterao mais drstica que esta molcula pode sofrer a: a) supresso da segunda base nitrogenada. b) supresso das trs primeiras bases nitrogenadas. c) substituio da quarta base nitrogenada por outra. d) substituio das trs primeiras bases nitrogenadas por outras. e) incluso de mais trs bases nitrogenadas no final da molcula. Questo 1166 Analise as afirmativas a seguir a respeito das mutaes. I - Sempre que o ambiente se torna desfavorvel, o ser vivo reage sofrendo uma mutao gnica. II - As mutaes transmitidas s geraes futuras so aquelas que ocorrem em clulas germinativas. III - As mutaes ocorridas em clulas somticas so de grande valor adaptativo para a perpetuao da espcie. Est(o) correta(s) a) I apenas b) II apenas. c) III apenas.
261

d) I e II apenas. e) II e III apenas. Questo 1167 A estrutura qumica de uma protena poder ser modificada se a) durante sua sntese houver variao dos tipos de aminocidos disponveis no citoplasma celular. b) durante sua sntese houver variao dos tipos de RNA transportadores. c) sua sntese ocorrer no complexo de Golgi e no no retculo endoplasmtico rugoso. d) uma base prica substituir uma pirimdica no RNA mensageiro que a codifica. e) o DNA no se duplicar durante a intrfase. Questo 1168 A mutao gnica, nos organismos eucariontes a) constitui a principal fonte de variabilidade gentica. b) ocorre exclusivamente pela ao de agentes mutagnicos. c) origina apenas seres recessivos. d) ocorre devido a alteraes na molcula de DNA. e) origina somente combinaes gnicas adaptativas. Questo 1169 "A capacidade de errar ligeiramente a verdadeira maravilha do DNA. Sem esse atributo especial, seramos ainda bactria anaerbia, e a msica no existiria (...). Errar humano, dizemos, mas a idia no nos agrada muito, e mais difcil ainda aceitar o fato de que errar tambm biolgico" (Lewis Thomas. "A medusa e a lesma", ed. Nova Fronteira, RJ, 1979). Esse texto refere-se a uma caracterstica dos seres vivos. ela: a) seleo natural. b) reproduo. c) excitabilidade. d) excreo. e) mutao.

Questo 1170 Diversas doenas esto relacionadas a mutaes no material gentico. Porm, mutaes pontuais, com a alterao de apenas uma base nitrogenada, muitas vezes no resultam em substituio efetiva do aminocido correspondente ao cdon mutado na protena produzida. Isto se d devido ao fato de: a) o cdigo gentico ser universal. b) o cdigo gentico ser repetitivo ou degenerado. c) o erro ser corrigido pela clula durante a traduo. d) o cdigo gentico no poder sofrer alteraes. e) os genes mutados no serem transcritos ou traduzidos. Questo 1171 O esquema a seguir mostra dois ciclos de replicao de molculas de DNA. Um par de bases nitrogenadas est identificado. Aps a replicao da molcula I, uma adenina sofreu uma desaminao e transformou-se em hipoxantina (H), base que normalmente emparelha-se com citosina (C).

1.5.9.3

onsiderando as molculas III, a mutao no par de bases indicado estar presente em a) somente 1. b) somente 2. c) somente 1 e 2. d) somente 3 e 4. e) 1, 2, 3 e 4. Questo 1172 Leia as afirmativas a seguir: I. As cianofceas reproduzem-se apenas assexuadamente, de modo que podemos esperar baixa variabilidade na sua populao. II. Mutaes podem ocorrer espontaneamente ou serem
262

induzidas, como aquelas provocadas pelos raios X. III. Mutaes constituem um fator causador de variabilidade. A afirmativa est CORRETA em: a) I, II e III. b) I e II apenas. c) II e III apenas. d) I apenas. e) II apenas. Questo 1173 Em certo fungo, ocorre a seqncia de reaes a seguir esquematizada que leva sntese do aminocido arginina.

b) evitar a ao de agentes externos sobre os genes c) representar uma vantagem para a sobrevivncia d) ocorrer em resposta necessidade de adaptao Questo 1175 Durante o processo evolutivo, a sobrevivncia dos indivduos de uma determinada espcie depende da estabilidade gentica. Entretanto, pode ocorrer uma alterao permanente numa seqncia de DNA, capaz de destruir um organismo. Essa alterao na seqncia de DNA e a eliminao do indivduo so fenmenos que podem ser explicados pela ocorrncia, respectivamente, de: a) especiao e ortognese b) mutao e seleo natural c) oscilao gentica e epignese d) variao hereditria e isolamento ecolgico Questo 1176 Cometer erros a chave para o progresso. H momentos em que importante no cometer erro algum - pergunte a qualquer cirurgio ou piloto de avio. No entanto (...) os erros no so apenas oportunidades valiosas para aprendermos; eles so, de forma significativa, a nica oportunidade para aprendermos algo relativamente novo. (...) A evoluo biolgica se d atravs de uma grande e inexorvel seqncia de tentativas e erros - e sem os erros as tentativas no teriam levado a nada. (Adaptado de DENNETT, Daniel C. In: BROCKMAN, J. e MATSON K. (Org.). As coisas so assim. So Paulo: Cia. das Letras, 1997.) O processo que se relaciona com o conceito de evoluo biolgica apresentado pelo autor : a) reparao das leses gnicas b) induo de mutaes programadas c) gerao de organismos transgnicos d) alterao aleatria na estrutura do DNA Questo 1177 As mutaes representam um importante mecanismo evolutivo para os organismos. Uma das conseqncias deste fenmeno est descrita na seguinte alternativa: a) limitao da diversidade biolgica
263

1.5.9.3

erificou-se que certos fungos mutantes s conseguem sintetizar arginina quando a ornitina acrescentada ao meio de cultura. Esses fungos devem ter sofrido mutao no gene a) X, somente. b) Y, somente. c) Z, somente. d) X ou no gene Y. e) X ou no gene Z. Questo 1174 Recentemente cientistas confirmaram suas suspeitas de que existem pessoas imunes AIDS. A partir do estudo de um grupo de 1850 pessoas, os cientistas afirmaram que a imunidade est relacionada a uma mutao gentica, apresentada por 3% dos pacientes estudados. Os cientistas consideraram esse percentual muito elevado. A caracterstica da mutao, que permite que ela ocorra em grande nmero de indivduos, por ter sido transmitida de gerao em gerao, : a) impedir a multiplicao de determinado vrus no interior das clulas

b) criao de novas variantes de seres vivos c) extino de espcies nocivas ao ambiente d) produo exclusiva de alteraes benficas Questo 1178 Indivduos portadores do gentipo HH sofrem uma mutao gnica no cromossomo 11 e expressam anemia falciforme ou siclemia. Sabendo-se que o continente africano possui alto ndice de malria e que o 'Plasmodium malariae' tem dificuldade de sobreviver nas hemcias de indivduos portadores do gentipo HH, analise a figura a seguir que representa uma populao isolada, em um perodo de tempo, em uma determinada regio africana que possui casos de malria. 1.5.9.3

1.5.9.3

odas as afirmativas so corretas quanto seqncia, EXCETO a) A introduo de uma adenina (A) entre as trincas indicadas por 2 e 3 pode alterar toda a transcrio a partir desse ponto. b) A mutao da 3 base na trinca indicada por 9 pode traduzir um aminocido diferente. c) A seqncia pertence a um DNA e pode codificar um polipeptdeo contendo, pelo menos, 27 aminocidos. d) A trinca indicada por 5 pode transcrever um cdon CGA, o qual reconhecido pelo anti-cdon GCU. e) A troca da primeira base, em quaisquer das trincas indicadas, pode resultar na troca do aminocido respectivo na protena. Questo 1180 Assinale a alternativa que indica o fator que conduz ao surgimento de variabilidade gnica nova, em uma populao. a) Mutao. b) Fluxo gnico. c) Seleo natural. d) Recombinao gnica. e) Oscilao gnica. Questo 1181 Pode-se afirmar que a mutao a) sempre ocorre para adaptar o indivduo ao ambiente. b) aumenta a freqncia de crossing-over. c) aumenta o nmero de alelos disponveis em um locus. d) sempre dominante e prejudicial ao organismo.

Com base nas informaes apresentadas, pode-se concluir que a) o aumento do nmero de indivduos HH est diretamente associado ao aparecimento de casos de malria. b) a elevao do nmero de indivduos HH est associada ao aparecimento de indivduos HH infectados. c) os gentipos HH e HH esto igualmente adaptados ao longo do tempo. d) a variao do meio, durante um certo tempo, desfavorece os indivduos HH. e) a seleo natural, nesse caso, prioriza os indivduos HH. Questo 1179 Observe a seqncia de bases nitrogenadas.

264

Questo 1182 A colorao vermelha da casca da ma determinada geneticamente. Um alelo mutante determina casca de cor amarela. Um produtor de mas verificou que, em uma determinada macieira, um dos frutos, ao invs de apresentar casca vermelha, apresentava casca com as duas cores, como representado na figura.

aminocidos da protena ser a) isoleucina - treonina - alanina - lisina. b) isoleucina - treonina - alanina - isoleucina. c) lisina - treonina - lisina - isoleucina. d) treonina - alanina - lisina - treonina. e) lisina - alanina - isoleucina - treonina. Questo 1184 Vrios so os processos que atuam na evoluo. Dentre eles, o nico que fornece material gentico novo a um determinado conjunto gnico preexistente a: a) mutao gnica. b) recombinao gnica. c) seleo natural. d) reproduo assexuada. e) reproduo sexuada. Questo 1185

1.5.9.3

onsiderando-se que, na ma, o que chamamos de fruto um pseudofruto, no qual a parte comestvel desenvolve-se a partir do receptculo da flor, espera-se que as rvores originadas das sementes dessa ma produzam frutos a) todos de casca amarela. b) todos de casca vermelha. c) todos de casca bicolor. d) alguns de casca amarela e outros de casca vermelha. e) alguns de casca amarela, outros de casca vermelha e outros de casca bicolor. Questo 1183 Em um determinado gene, a fita que ser transcrita apresenta a seqncia de nucleotdeos TAA TGT CGA TTC e codifica, para a seqncia de aminocidos, ISOLEUCINA - TREONINA - ALANINA - LISINA. Esses aminocidos possuem mais de um cdon de DNA, ou seja, isoleucina = TAA, TAG ou TAT treonina = TGA, TGG, TGC ou TGT alanina = CGA, CGG, CGC ou CGT lisina = TTT ou TTC Se ocorrer mutao e a nova seqncia de nucleotdeos for TAT TGT CGA TAA, pode-se prever que a seqncia de

A respeito das mutaes gnicas, foram apresentadas as cinco afirmaes seguintes. I. As mutaes podem ocorrer tanto em clulas somticas como em clulas germinativas. II. Somente as mutaes ocorridas em clulas somticas podero produzir alteraes transmitidas sua descendncia, independentemente do seu sistema reprodutivo. III. Apenas as mutaes que atingem as clulas germinativas da espcie humana podem ser transmitidas aos descendentes. IV. As mutaes no podem ser espontneas, mas apenas causadas por fatores mutagnicos, tais como agentes qumicos e fsicos. V. As mutaes so fatores importantes na promoo da variabilidade gentica e para a evoluo das espcies. Assinale a alternativa que contm todas as afirmaes corretas. a) I, II e III. b) I, III e V. c) I, IV e V. d) II, III e IV. e) II, III e V.

265

Questo 1186 Uma bactria sofre uma mutao pontual em uma regio do seu DNA, que era: TAC CTT ATA GAT Ocorreu uma mudana na terceira base, que passou de citidina a guanina. Indique o RNA mensageiro codificado pela seqncia de DNA mutada. a) ATC GAA TAT CTA b) ATG GAA TAT CTA c) AUC UAU AAG GUA d) AUC GAA UAU CUA e) AUG G GAA UAU CUA Questo 1187 Uma experincia realizada com coelhos (linhagem pura selvagem) consistiu em submet-los a uma descarga excessiva de raio-X. Aps o experimento, podemos esperar vrias reaes, EXCETO: a) produo de um filhote albino. b) produo de filhotes anormais. c) morte em conseqncia da dose de radiao. d) tornaram-se albinos. e) tornaram-se estreis. Questo 1188 Atualmente so bem conhecidos os efeitos adversos sade humana, causados por diversos poluentes ambientais, especialmente aqueles que possuem potencialidades mutagnicas ou carcinognicas, os quais, devido sua interao com mecanismos genticos, podem causar mutaes e doenas nas geraes futuras. Assinale as afirmaes corretas: I - Mutaes so modificaes bruscas do material gentico que podem ser transmitidas prole (descendncia ou clulas filhas). II - A mutao pode ser espontnea ou induzida por agentes fsicos, qumicos ou biolgicos com potencial mutagnico. III - Mutao toda alterao do material gentico, que resulta sempre de segregao ou recombinao cromossmica.

IV - Mutaes gnicas podem ser causadas por poluentes ambientais e provocar alteraes responsveis pelo aparecimento de gentipos diferentes numa populao. A alternativa que contm as afirmaes corretas : a) I e III. b) II e III. c) I, II e IV. d) IV e III. e) III. Questo 1189 Um surfista que se expunha muito ao sol sofreu danos em seu DNA em conseqncia de radiaes UV, o que resultou em pequenos tumores na pele. Caso ele venha a ser pai de uma criana, ela a) s herdar os tumores se tiver ocorrido dano em um gene dominante. b) s herdar os tumores se tiver ocorrido dano em dois genes recessivos. c) s herdar os tumores se for do sexo masculino. d) herdar os tumores, pois houve dano no material gentico. e) no herdar os tumores. Questo 1190 Analise as proposies: 1. Modificaes hereditrias que ocorrem num locus especfico so chamadas de mutaes gnicas. 2. Os principais agentes mutagnicos so as radiaes ionizantes e os raios-ultravioleta. 3. As mutaes do tipo substituio de base acarretam a alterao de vrios aminocidos nas protenas. Est(o) correta(s): a) 1, apenas b) 1 e 3, apenas c) 3, apenas d) 1, 2 e 3 e) 2, apenas

266

Questo 1191 A ANVISA (Agncia Nacional de Vigilncia Sanitria) normalizou, recentemente, a utilizao de cmaras de bronzeamento artificial, visando diminuir os riscos dessa prtica, tais como leses na retina, queimaduras, envelhecimento precoce e cncer de pele. Uma mulher que se submeteu a dez sesses intercaladas de bronzeamento, com durao de 15 a 30 minutos cada uma, apresentou, quatro meses depois, indcios de cncer de pele, uma vez que as radiaes UV danificaram seu DNA. Pode-se afirmar que esse tipo de cncer a) herdvel, porque provoca alterao do DNA. b) no herdvel, porque a mutao resultante recessiva. c) herdvel, porque a mutao resultante dominante. d) no herdvel, porque provoca alterao em clulas somticas. e) herdvel, porque provoca alterao em clulas germinativas. Questo 1192 O grfico mostra o espectro de absoro de raios ultravioleta (U.V.) por uma protena e por um cido nuclico.

Questo 1193 Os meios de comunicao tm noticiado que a Unicef (Fundo das Naes Unidas para a Infncia) estabeleceu como uma das metas, a serem cumpridas at o ano 2.000, a imunizao de 90% das crianas, o que reduzir a mortalidade infantil em pelo menos um tero. Para que esta meta seja atingida, necessria a vacinao, que consiste em injetar no organismo: a) vrus ou bactrias vivas para provocar a doena de forma branda. O corpo, imunizado, produzir antgenos especficos. b) um medicamento eficaz no combate doena j instalada e que produza no corpo uma reao para a fabricao de anticorpos especficos e resistentes. c) vrus ou bactrias mortos ou atenuado que, reconhecidos pelo corpo como antgenos, induzam a produo de anticorpos especficos. d) o plasma, retirado de pessoas que j tiveram a doena, para que o corpo produza antgenos e anticorpos especficos. e) o soro obtido atravs do sangue de animais, como os cavalos, criados em laboratrio, onde recebem grande quantidade de antgenos. Questo 1194 Todas as estruturas citadas a seguir podem ser ligadas defesa do organismo, EXCETO: a) pncreas b) amdalas c) bao d) timo e) gnglios linfticos Questo 1195

1.5.9.4

Considerando a ao desses raios na clula, o comprimento de onda em que ser obtida maior taxa de mutao a) 2.400 Angstrons. b) 2.500 Angstrons. c) 2.600 Angstrons. d) 2.700 Angstrons. e) 2.800 Angstrons.

Um organismo recebeu uma primeira dose de um antgeno X e, como resposta imune, produziu anticorpos especficos. Se, aps algum tempo, for aplicada uma segunda dose do mesmo antgeno, espera-se que o organismo: a) reaja da mesma forma como reagiu primeira dose. b) reaja sem utilizar seus anticorpos. c) no produza mais anticorpos, por estar imunizado. d) no consiga reagir a essa segunda dose. e) produza anticorpos mais rapidamente.

267

Questo 1196 A variao da quantidade de anticorpos especficos foi medida por meio de uma experincia controlada, em duas crianas durante um certo perodo de tempo. Para a imunizao de cada uma das crianas foram utilizados dois procedimentos diferentes: Criana I: aplicao de soro imune Criana II: vacinao. O grfico que melhor representa as taxas de variao da quantidade de anticorpos nas crianas I e II :

Existe um erro de fundamento biolgico na historinha da tirinha. Assinale a alternativa que esclarece o erro: a) que vrus do tipo "A" no sofre efeito de vacina alguma b) que a vacina no combate vrus, somente doenas causadas por bactrias c) que a vacina no combate vrus, ela proporciona ao nosso organismo produzir defesas, os anticorpos, que so especficos aos seus antgenos, no caso o vrus "A" d) que a vacina feita de vrus, portanto ela no pode destruir o que a produz e) que o vrus impede a ao da vacina, inibindo a sua atividade de defesa, que o sistema "chave-fechadura" Questo 1198 Ao ser picado por uma cobra peonhenta, voc dever procurar recurso atravs de a) vacina, porque contm antgenos especficos. b) soro, porque estimula o organismo a produzir anticorpos. c) vacina, porque j contm anticorpos. d) soro, porque j contm anticorpos. e) vacina, porque estimula o organismo a produzir anticorpos. Questo 1199

1.5.10

Questo 1197 Leia com ateno a tirinha de Frank & Ernest

A anlise do grfico permite concluir que

1.5.10 1.5.10

a) na poca do nascimento a criana no est protegida, pois produz poucos anticorpos. b) antes do nascimento o feto nunca produz anticorpos. c) o recm-nascido no produz anticorpos. d) aps o nascimento a criana depende completamente dos anticorpos maternos, pois no produz os prprios anticorpos. e) aps o nascimento a criana depende dos anticorpos maternos, embora j esteja produzindo os seus.
268

Questo 1200 Analise o grfico que se segue.

1.5.10

m organismo recebeu uma dose de um antgeno X e, aps algum tempo, recebeu outra dose. De acordo com o grfico, espera-se que o organismo a) reaja mais rapidamente na segunda dose. b) no consiga reagir a uma segunda dose. c) produza anticorpos mais lentamente na segunda dose. d) reaja sem produzir anticorpos, pois j est imunizado. e) reaja na segunda vez, produzindo menos anticorpos. Questo 1201 DETECTADO FOCO DE MORCEGO COM RAIVA EM BOTUCATU, SP. Confirmada a presena do vrus causador da raiva em um morcego apreendido em uma praa no centro da cidade. O animal estava cado e se debatendo, quando foi visto por estudantes. O morcego doente era da espcie que se alimenta de frutas. (Portal "Estado", 06.06.2006) MAIS UM CASO DE MORCEGO POSITIVO PARA RAIVA NA CIDADE DE BOTUCATU. A Secretaria Municipal de Sade registrou mais um caso de morcego positivo para raiva na cidade de Botucatu. O animal foi encontrado cado em uma praa nas proximidades do centro. Este o terceiro caso de raiva em morcego registrado este ano em Botucatu. O primeiro foi notificado no incio do ms de junho, na regio central da cidade. O segundo caso na Vila Antrtica, no final do ms de julho. O morcego encontrado da espcie 'Myots sp' e alimenta-se de insetos. (Portal da Prefeitura Municipal de Botucatu, 18.08.2006)

Para se evitar a contaminao da populao humana com o vrus da raiva, o procedimento mais adequado que dever ser tomado pelas autoridades da referida cidade ser a) promover campanha para localizao e eliminao das colnias de morcegos nas reas urbana e rural. b) medicar com antibiticos especficos os animais domsticos que tenham entrado em contado com os morcegos. c) antecipar a vacinao anti-rbica de ces e gatos nas regies onde os morcegos foram encontrados. d) promover campanha para a vacinao anti-rbica da populao humana. e) desconsiderar o ocorrido e informar a populao que no tenha receio, pois apenas os morcegos hematfagos, mas no os frugvoros ou insetvoros, representam risco de transmisso da raiva. Questo 1202 Um coelho recebeu, pela primeira vez, a injeo de uma toxina bacteriana e manifestou a resposta imunitria produzindo a antitoxina (anticorpo). Se aps certo tempo for aplicada uma segunda injeo da toxina no animal, espera-se que ele a) no resista a essa segunda dose. b) demore mais tempo para produzir a antitoxina. c) produza a antitoxina mais rapidamente. d) no produza mais a antitoxina por estar imunizado. e) produza menor quantidade de antitoxina. Questo 1203 A alergia uma hipersensibilidade desenvolvida em relao a determinadas substncias, os alergnicos, que so reconhecidas por um tipo especial de anticorpo. A reao alrgica ocorre quando as molculas do alergnico a) ligam-se a molculas do anticorpo presas membrana dos mastcitos, que reagem liberando histaminas. b) desencadeiam, nos gnglios linfticos, uma grande proliferao de linfcitos especficos. c) so reconhecidas pelas clulas de memria, que se reproduzem e fabricam grande quantidade de histaminas. d) ligam-se aos anticorpos e migram para os rgos imunitrios primrios onde so destrudas. e) so fagocitadas pelos mastcitos e estimulam a fabricao das interleucinas.
269

Questo 1204 Uma leso na pele pode infeccionar, quando aparecem CLULAS DE DEFESA que ATRAVESSAM OS CAPILARES e caem no tecido conjuntivo, protegendo o organismo. Os termos destacados referem-se, respectivamente, aos a) trombcitos e fagocitose. b) euritrcitos e pinocitose. c) leuccitos e diapedese. d) neutrfilos e clasmocitose. Questo 1205 O Instituto Butant, famoso pelo seu serpentrio, foi fundado por Vital Brazil, em fevereiro de 1901, para a produo de soro no combate epidemia de peste bubnica. Hoje um centro de pesquisa reconhecido mundialmente na rea de biomdicas produzindo diversos tipos de soros antitxicos e antivenenos. Segundo o Instituto "a demanda da produo de antivenenos vem diminuindo gradativamente no Brasil. Sendo assim, possvel oferecer os seus soros para outros pases". Das alternativas a seguir, assinale aquela que contm argumento vlido e que explica a menor procura por antivenenos no Brasil. a) As reaes alrgicas e a alta mortalidade provocada pela aplicao do soro. b) O xodo rural e a maior concentrao da populao humana em centros urbanos. c) A imunizao garantida pela administrao do soro. d) Falta de veneno em quantidade suficiente para a obteno do soro. e) Falta de animais com caractersticas adequadas para a produo do soro. Questo 1206 Consideramos uma vacina um material que contm: a) anticorpos contra determinado patgeno, que estimulam a resposta imunolgica do indivduo. b) anticorpos contra determinado patgeno produzidos por outro animal e que fornecem proteo imunolgica. c) soro de indivduos previamente imunizados contra

aquele patgeno. d) clulas brancas produzidas por animais, que se multiplicam no corpo do indivduo que recebe a vacina. e) um patgeno vivo enfraquecido ou partes dele, capaz de estimular a resposta imunolgica, mas no causar a doena. Questo 1207 "Os cientistas examinaram 11 homens aidticos, dos quais 5 nunca tinham usado medicamentos anti-HIV e 6 haviam usado. Verificaram que 8 pacientes apresentavam novas mutaes do vrus, resistentes s drogas ministradas e passveis de serem transmitidas a outras pessoas." Pela anlise do texto, pode-se concluir que a fabricao da vacina anti-AIDS a) apresenta os mesmos problemas que a da vacina contra a gripe. b) s pode ser feita contra as formas mutantes do HIV. c) precisa ser feita contra a forma normal do HIV. d) fcil de ser efetuada, tendo em vista a estabilidade do HIV. e) certamente dever estar no mercado dentro de pouco tempo. Questo 1208 Observe a figura a seguir.

1.5.10

270

tapas na preparao do soro teraputico. Fonte: Bier, Otto. MICROBIOLOGIA E IMUNOLOGIA, 1984. Em relao aos procedimentos observados na ilustrao anterior, pode-se fazer todas as afirmaes, EXCETO uma. Assinale-a. a) A toxina diftrica funciona para o cavalo como uma vacina, induzindo a formao de anticorpos. b) A injeo de toxina na cobaia B utilizada como controle, para verificar a atividade letal da toxina na ausncia do soro. c) A injeo de antitoxina e de toxina na cobaia A usada como controle para testar a eficcia da primeira na inativao da segunda. d) Um animal imunizado com toxina diftrica est protegido da infeco por 'C. diphtheriae'. e) Para o sistema imunolgico da cobaia A, a antitoxina diftrica um corpo estranho. Questo 1209 Os anticorpos so protenas especficas de defesa do corpo. O grfico a seguir representa o resultado de duas aplicaes de mesmo antgeno, em intervalos diferentes.

Questo 1210 A vacina de DNA a mais recente forma de apresentao de antgeno que veio revolucionar o campo da vacinologia. O processo envolve a inoculao direta do DNA plasmidial, que possui o gene codificador da protena antignica, que ser expressa e produzida no interior das clulas do indivduo. Esse tipo de vacina apresenta uma grande vantagem sobre as demais, pois fornece para o hospedeiro a informao gentica necessria para que ele fabrique o antgeno preservando todas as suas caractersticas importantes na induo de uma resposta imune eficiente. Isso sem gerar os efeitos colaterais que podem aparecer quando so utilizados patgenos vivos, ou os problemas proporcionados pela produo das vacinas de subunidades em microorganismos. (Fonte: Desenvolvimento de vacinas gnicas. "Scientific American", 1999.) Com base no texto, foram feitas as seguintes afirmaes: I. A imunidade desenvolvida pela vacina de DNA no imediata, mas de longa durao. II. O indivduo geneticamente vacinado passa a produzir tanto os antgenos quanto os anticorpos. III. Patgenos vivos no podem ser usados como vacina, pois no determinam imunidade e sim doenas. IV. Os antgenos produzidos pelo DNA plasmidial so capazes de combater patgenos que infectem o hospedeiro. So afirmaes CORRETAS: a) I e II b) II e IV c) III e IV d) I e III

1.5.10

correto afirmar, EXCETO: a) Doenas diferentes em intervalos menores de tempo provocariam a mesma intensidade de produo de antgenos. b) A dose de reforo provoca produo maior e mais rpida de anticorpos. c) O tipo de imunizao explicitado ativa. d) O grfico acima exemplifica ao das vacinas.

Questo 1211 Em relao figura a seguir, que representa a atividade de clulas T citotxicas, assinale a afirmativa INCORRETA.

271

1.5.10

a) colocar lixo em sacos plsticos e mant-los bem fechados para no atrair baratas, moscas e outros insetos. b) manter limpos quintais, jardins e terrenos baldios, no acumulando entulho e lixo domstico. c) aparar a grama dos jardins e recolher folhas cadas. d) tomar vacina como mecanismo de preveno ou usar soro de preferncia polivalente em caso de picada acidental. Questo 1214

a) Aps efetuar um "ataque letal", uma clula T citotxica pode separar e atacar outra clula-alvo, apresentando o mesmo antgeno. b) As clulas T citotxicas matam clulas que apresentam antgenos na superfcie por meio da secreo de perforinas e linfotoxinas. c) As clulas T citotxicas podem atacar algumas clulas tumorais, clulas de tecidos transplantados e clulas infectadas por vrus. d) A degradao ou lise da clula infectada no necessita do reconhecimento e da fixao da clula T citotxica, bastando que esta esteja ativada. Questo 1212 As defesas inatas dos organismos so geralmente mecanismos de proteo que inibem a entrada ou o desenvolvimento de organismos causadores de doenas. Assinale a alternativa que NO apresenta a relao correta entre o fator de defesa e sua funo. a) Fagcitos - previnem a entrada de patgenos e substncias estranhas. b) Secrees mucosas - prendem microorganismos no trato digestivo e respiratrio. c) Lgrima - lubrifica e limpa, contm lisozima, que destri bactrias. d) Descamar da epiderme - ope-se colonizao da pele por alguns patgenos. Questo 1213 Aranhas e escorpies podem apresentar efeito peonhento ao homem. Esses venenos podem apresentar ao neurotxica, cardiotxica, necrosante, hemoltica. O controle e preveno de acidentes com esses animais podem ser feitos tomando-se os seguintes cuidados, EXCETO:

VACINA RESISTE A PARASITO DA MALRIA Pesquisadores liderados por Pierre Druilhe, do Instituto Pasteur, em Paris, dizem ter realizado com sucesso a primeira fase de testes clnicos (em humanos) de uma vacina contra a malria. Aplicada em 36 voluntrios saudveis, a frmula induziu a produo de anticorpos contra a doena, os quais se mostraram capazes de atacar o parasito 'Plasmodium falciparum'. Segundo Druilhe e seus colegas, trata-se do "primeiro teste clnico de uma vacina contra a malria a demonstrar claramente sua atividade contra o parasito". Os pesquisadores ainda precisam realizar mais duas fases de testes clnicos antes de confirmar a eficcia da frmula. (Fonte: "Folha de S. Paulo", 09/11/2005) Assinale a afirmativa INCORRETA. a) O objetivo do uso da vacina ativar o sistema de defesa do organismo contra invasores atravs da produo de anticorpos. b) Se o organismo apresentar imunidade positiva contra o parasita, pode-se afirmar que a vacina foi eficaz contra todos os parasitos do mesmo filo. c) Apesar de muito antiga, a malria continua sendo um dos principais problemas de sade pblica no mundo. d) O ciclo vital desse parasita envolve um curto perodo na corrente sangnea, uma fase de invaso e diferenciao nos hepatcitos e uma fase intra-eritroctica. Questo 1215 A memria imunolgica e imunidade resultam da seleo clonal. De acordo com a teoria clonal, um linfcito ativado produz dois tipos de clulas-filhas: clulas efetoras, que realizam o ataque e morrem, e clulas de memria, que produzem anticorpos e tm vida longa. Em uma pessoa
272

vacinada contra uma possvel infeco, podem-se observar os seguintes eventos, EXCETO: a) Ativao de resposta imune primria e produo de clones de clulas efetoras e de memria pelos linfcitos. b) Maior e mais rpida produo de anticorpos especficos em casos de encontros subseqentes com o mesmo antgeno. c) Na primeira exposio ao antgeno, h uma fase de espera antes de o nmero de molculas de anticorpos e clulas T aumentar. d) Promoo imediata de resposta imune secundria, com produo de clulas efetoras e de memria, que controlam lentamente o invasor. Questo 1216 "Por dcadas os cientistas tiveram de quebrar a cabea para criar antdotos contra o veneno das cobras. Agora, descobriram que uma soluo potencialmente melhor foi 'desenvolvida' ao longo de milhes de anos pelos gambs sul-americanos, que se alimentam de serpentes. Pesquisadores da Fundao Oswaldo Cruz identificaram no sangue dos gambs duas molculas, DM43 e DM64, que tm funo antiofdica. So glicoprotenas que apresentam estrutura parecida com a de substncias do sistema de defesa do organismo, embora elas mesmas no sejam anticorpos. Seja como for, a DM43 e a DM64 parecem especificamente talhadas para neutralizar os principais efeitos do veneno das serpentes da famlia das viperdeas, entre as quais se incluem as jararacas, responsveis por 90% dos 20 mil acidentes anuais com cobras no Brasil. A primeira molcula se ope ao dos compostos do veneno que causam forte hemorragia na vtima ao impedir a formao de cogulos, enquanto a outra neutraliza as substncias que matam as clulas musculares de quem picado." Fonte: Extrado da Reportagem: Sangue de gamb contm soro antiofdico do Jornal "Folha de S.Paulo", 30/08/2005. Analisando o texto e de acordo com seus conhecimentos, INCORRETO afirmar: a) A imunidade dos gambs sul-americanos ao veneno das jararacas foi naturalmente selecionada. b) Essa resistncia dos gambs ao veneno de serpentes viperdeas determinada geneticamente.

c) Os linfcitos de gamb reagem a picadas das jararacas produzindo soro antiofdico que pode ser letal para as cobras. d) Um dos componentes do veneno da jararaca poderia ser til na preveno de tromboses. Questo 1217 Compartilhamos o ambiente com uma srie de microorganismos que podem causar infeces nos seres humanos. As nossas clulas de defesa exercem o seu papel por meio da fagocitose e da produo de anticorpos.

1.5.10

onte: LOPES, S. Bio. So Paulo: Saraiva,1999. So exemplos destas clulas, respectivamente: a) linfcitos e basfilos. b) eosinfilos e eritrcitos. c) macrfagos e linfcitos. d) eritrcitos e macrfagos. e) leuccitos e linfcitos. Questo 1218 Uma pessoa que tivesse seriamente comprometida a atividade dos plasmcitos teria problemas com a a) produo de anticorpos. b) circulao venosa. c) produo de uria. d) circulao linftica. e) produo de toxinas. Questo 1219 O grfico a seguir exemplifica como a exposio de um homem normal, repetidas vezes, a um mesmo tipo de antgeno (ex.: vrus) provoca, aps um certo espao de tempo, uma resposta do organismo.
273

Questo 1221 Um novo tipo de tratamento da AIDS comeou a ser testado no Brasil e consiste em transmitir anticorpos anti-HIV, contidos no plasma de pessoas contaminadas h muitos anos, mas sem os sintomas da doena, para pessoas aidticas sintomticas. Tal tratamento, cuja inteno fortalecer a defesa desses indivduos, denomina-se a) imunoterapia ativa. b) imunoterapia passiva. c) profilaxia. d) quimioterapia. e) vacinoterapia. Questo 1222 A urtiga um vegetal que provoca, na maioria das pessoas, uma forte reao alrgica. Uma srie de tipos celulares responsvel pelas reaes alrgicas e por outros tipos de hipersensibilidade imune, EXCETO a) basfilos. b) eritrcitos. c) eosinfilos. d) linfcitos. e) mastcitos. Questo 1223 As principais molculas responsveis pela resposta imune aos transplantes de rgos e tecidos so os antgenos do Complexo Principal de Histocompatibilidade (MHC). Havendo incompatibilidade entre o doador e o receptor de um rgo ou tecido condicionado pelo MHC, ser desencadeada uma reao, e o sistema imune do receptor responde, de modo que a) os macrfagos, as primeiras clulas a serem ativadas, ligam-se aos anticorpos e iniciam suas aes fagocitria e secredora, participando assim da imunidade celular. b) os linfcitos T, aps reconhecerem os antgenos apresentados pelos macrfagos, diferenciam-se em plasmcitos, dando incio imunidade humoral. c) os linfcitos B, estimulados por substncias produzidas pelos linfcitos T auxiliares, multiplicam-se e diferenciam-se, produzindo assim uma quantidade maior de anticorpos. d) as interleucinas inibem a proliferao de macrfagos e linfcitos T citotxicos, principais responsveis pela
274

1.5.10

odemos atribuir esta resposta do organismo ao fenmeno de memria imunolgica, que tem como conseqncia: a) o aumento da produo de anticorpos b) a inibio da produo de anticorpos c) o aumento da produo de antgenos d) a inibio da produo de antgenos Questo 1220 A produo de imunoglobulinas por clulas do sistema imunitrio constitui um dos mecanismos de defesa do organismo contra infeces. O grfico abaixo demonstra os nveis de imunoglobulina G (IgG) no soro do feto e do recm-nascido.

1.5.10

s resultados acima permitem chegar seguinte concluso em relao a esse soro: a) na poca do nascimento h presena de IgG materna b) durante a gestao diminuem os nveis de IgG fetal c) durante a gestao os nveis de IgG independem da produo fetal d) aps o nascimento diminuem os nveis de IgG produzida pelo recm-nascido

rejeio, sem suprimir o sistema imunolgico do receptor. e) a ciclosporina age no processo de rejeio, suprimindo os linfcitos B, sem deixar o paciente vulnervel a infeces. Questo 1224 Com o final da 2 Guerra Mundial, iniciou-se um novo perodo na histria da humanidade. Vencido o perigo nazista, enfrentaram-se as duas foras hegemnicas do ps-guerra: os Estados Unidos da Amrica, campees do capitalismo, e a URSS, campe do socialismo. A Guerra Fria foi o resultado bvio dessas tenses e disputas. Entretanto, ao mesmo tempo em que socialismo e capitalismo disputavam o predomnio na produo e nos mercados, a revoluo tecnolgica avanava como conseqncia, at mesmo, da concorrncia entre esses dois pases. A corrida espacial foi um dos aspectos dessa concorrncia. Ao lado da poltica e da economia, passou a existir o desejo do bem-estar e do conforto mostrar onde se vivia melhor era fundamental. Esse desejo fez com que rapidamente se transferissem para o cotidiano dos homens os resultados prticos das inovaes de guerra. Mais conforto, novas comodidades, alteraes nos comportamentos sinalizaram um novo tempo, um novo sculo. Cai o imprio sovitico. Hoje, no mundo globalizado, o conhecimento humano no tem fronteiras nem limites: DNA, genoma, clonagem, novas tecnologias para comunicao evidenciam o progresso no sculo XXI. Pesquisas biolgicas vm sendo desenvolvidas com os tripulantes dos vos espaciais. Uma dessas, realizada por pesquisadores da NASA, tem o objetivo de estudar at que ponto o sistema imunolgico se altera durante vos espaciais. A experincia, a ser realizada na Terra e no espao, consiste na anlise de amostras de sangue e saliva antes e aps a injeo de um determinado antgeno. A comparao dos resultados obtidos poder indicar o quanto a resposta imunolgica estar afetada. Traduzido e adaptado de: http:// spaceflight.nasa.gov/shuttle/archives/ sts-74/orbit/payloads/lifes/regimmun.html Se ao final da experincia mencionada for demonstrado que

a resposta imunolgica humoral diminui durante os vos espaciais, conclui-se que, nessas condies, ocorre menor: a) fagocitose do antgeno mediada pelos linfcitos B b) produo de anticorpos pelos linfcitos T citotxicos c) produo de imunoglobulinas pelos neutrfilos d) produo de anticorpos mediada pelos linfcitos B e) produo de imunoglobulinas pelos macrfagos Questo 1225 "Onde no h cozinhas pratos por lavar viglias, fraldas sujas coqueluches, sarampos." ("Outro retrato", Jos Paulo Paes) "... coqueluches, sarampos" so alteraes no bem-estar fsico do indivduo que, normalmente, aparecem na infncia. Estas doenas ( ) so transmitidas por vrus e enquadram-se no grupo das que causam desidratao. ( ) comprometem os ndulos linfticos das virilhas, ao provocar nos indivduos do sexo masculino o aumento da produo de urina. ( ) so tpicas das regies midas e frias e tm como vetores insetos do gnero 'Anopheles' sp. ( ) podem ser prevenidas pela aplicao de vacinas na primeira fase da vida ou tratadas com medicamentos adequados. Questo 1226 As vacinas utilizadas nas campanhas de imunizao em massa so constitudas de a) anticorpos que destruiro o agente infeccioso especfico. b) anticorpos que persistiro ativos por toda a vida do receptor. c) drogas capazes de aumentar a resistncia infeco. d) microorganismos ou produtos deles derivados que induziro a formao de anticorpos. e) soros obtidos de animais que neutralizaro os antgenos especficos.

275

Questo 1227 Analise estas figuras:

1.5.10

especificamente a determinados antgenos. ( ) contra patgenos extracelulares, como a maioria das bactrias, o organismo ativa seus linfcitos T citotxicos. ( ) as chamadas "clulas de memria" surgem da diferenciao de linfcitos T e B; perduram no organismo e podem desencadear a resposta imune com mais rapidez. ( ) linfcitos T podem adquirir ao citotxica e destruir clulas infectadas por vrus, ou ainda clulas como as cancerosas, por exemplo (Y). Questo 1230 H um nmero muito grande de organismos causadores de infeces, contra as quais o homem dispe de um vigilante exrcito para a sua defesa. Com relao ao sistema imunolgico humano, correto afirmar que:

onsiderando-se os processos de imunizao representados, INCORRETO afirmar que a) os anticorpos so produzidos tanto em I quanto em II. b) o cdigo gentico do patgeno igual ao do camundongo. c) o antgeno do patgeno produzido pelo camundongo em I. d) o mRNA do antgeno do patgeno traduzido em II. Questo 1228 A Campanha Nacional de Vacinao do Idoso, instituda pelo Ministrio da Sade do Brasil, vem-se revelando uma das mais abrangentes dirigidas populao dessa faixa etria. Alm da vacina contra a gripe, os postos de sade esto aplicando, tambm, a vacina contra pneumonia pneumoccica. CORRETO afirmar que essas vacinas protegem porque a) so constitudas de molculas recombinantes. b) contm anticorpos especficos. c) induzem resposta imunolgica. d) impedem mutaes dos patgenos. Questo 1229 Para o controle das infeces, o organismo humano dispe de diferentes mecanismos de defesa. Com relao a este tema, podemos afirmar que: ( ) nos ndulos linfticos e no bao, so produzidas clulas apresentadoras de antgenos, os macrfagos; estes estimulam os linfcitos B a produzirem interferons, muito ativos no combate a patgenos externos. ( ) os linfcitos B transformam-se em plasmcitos, clulas produtoras de anticorpos, protenas que se ligam

1.5.10

( ) Ao primeiro contato com um vrus X (1) , o organismo reage e produz, imediatamente, anticorpos em nvel neutralizador suficiente para inativar o vrus. ( ) Aps um primeiro contato com um vrus X (2), se o organismo continuar a produzir anticorpos em quantidades elevadas, diz-se que ele adquiriu imunidade humoral. ( ) Em (1) ilustra-se a resposta primria do organismo aps um primeiro contato com um vrus X. ( ) Em (2) ilustra-se a resposta imunolgica do organismo a uma infeco bacteriana, enquanto em (1) mostra-se o efeito da ps infeco viral. ( ) Devido elevada especificidade da reao antgeno-anticorpo, um organismo infectado por uma bactria X produzir mais antgenos em (2) do que em (1). Questo 1231 O sistema imunitrio, que atua no combate a infeces, constitudo por diferentes tipos de glbulos brancos e pelos rgos responsveis pela produo e maturao desses glbulos. Em relao a esse sistema, podemos afirmar que:
276

( ) Os macrfagos fagocitam elementos estranhos e imobilizam resduos na membrana, estimulando os linfcitosT. ( ) Linfcitos T reconhecem antgenos nas membranas de outras clulas, especialmente nos macrfagos, produzem interleucinas, estimulam os linfcitos B a produzirem anticorpos e eliminam clulas anormais. ( ) Os linfcitos B, quando estimulados, se diferenciam em plasmcitos que produzem anticorpos e participam da memria imunolgica. ( ) Os macrfagos so responsveis pela secreo de histamina, a qual provoca vasodilatao, causando vermelhido e edema nos processos inflamatrios. ( ) Os linfcitos T e B originam-se no timo e depois migram para a medula ssea, fixando-se temporariamente no ducto torxico, onde podem se multiplicar ao detectarem elemento estranhos ao organismo. Questo 1232 Assinale a alternativa que melhor descreve um anticorpo. a) Uma partcula b) Um organismo c) Uma molcula d) Uma clula e) Um patgeno Questo 1233 Os anticorpos, componentes do nosso sistema de defesa, so protenas sintetizadas para combater agentes externos (bactrias e vrus, por exemplo) ou seus produtos, e permanecem na corrente sangnea prontos para nos proteger da ao de patgenos, muitas vezes por perodos bastante longos. Os anticorpos tambm so capazes de proteger o embrio humano, na vida intra-uterina. Em relao s caractersticas dos anticorpos, correto afirmar: (01) So capazes de neutralizar toxinas bacterianas. (02) So capazes de neutralizar os vrus. (04) So produzidos somente pela vacinao. (08) Podem atravessar a barreira placentria. (16) So dotados de memria imunolgica. (32) So capazes de imobilizar os microorganismos. Soma ( )

Questo 1234 Duas crianas foram levadas a um posto de sade: uma delas, para se prevenir contra poliomielite; a outra, para atendimento, em virtude de uma picada de serpente peonhenta. Indique o que deve ser aplicado em cada criana, RESPECTIVAMENTE. a) vacina (porque contm antgenos) e soro (porque contm anticorpos) b) soro (porque contm antgenos) e vacina (porque contm anticorpos) c) vacina (porque contm anticorpos) e soro (porque contm antgenos) d) soro (porque contm anticorpos) e vacina (porque contm antgenos) Questo 1235 Quando uma pessoa picada por um animal peonhento, deve procurar socorro atravs de a) soro, que induzir a formao de anticorpos. b) soro, porque composto por antgenos especficos. c) soro, porque contm anticorpos prontos. d) vacina, porque fornecer ao organismo elementos de defesa. e) vacina, para eliminar quimicamente o veneno. Questo 1236 Assinale a alternativa que preenche corretamente as lacunas do texto a seguir, na ordem em que ocorrem. O relatrio da Polcia Federal sobre a Operao Vampiro traz uma informao no mnimo irnica sobre o sangue dos brasileiros. Sabe-se que a produo de certos hemoderivados se vale de material retirado do plasma. O que o relatrio mostra que, enquanto as ........... extradas do plasma de europeus ficam na faixa de 3 gramas por litro, as dos brasileiros situam-se na faixa de 5,2 gramas por litro. Uma possvel explicao que o brasileiro ............. . Adaptado de: "Veja", 28 jul. 2004. a) imunoglobulinas - est exposto a uma maior variedade de organismos patognicos b) hemcias - se alimenta de nutrientes ricos em ferro c) albuminas - se alimenta de nutrientes ricos em ferro
277

d) albuminas - tende a apresentar o bao com tamanho aumentado e) imunoglobulinas - tende a apresentar o bao com tamanho aumentado. Questo 1237 As ilustraes a seguir (a, b e c) representam o que pode acontecer quando uma leso na pele permite a entrada de bactrias que causam infeco.

Questo 1239 Os meios de comunicao tm convocado dentistas e outros profissionais da sade para a vacinao contra a hepatite B. Vacinar consiste em injetar no organismo: a) microrganismos vivos para provocar a doena de forma branda. O corpo imunizado produzir antgenos especficos. b) uma substncia que combata a doena j instalada e que produza no corpo uma reao para a fabricao de anticorpos resistentes. c) microrganismos mortos ou atenuados que, reconhecidos pelo corpo como antgenos, induzam a produo de anticorpos especficos. d) o plasma, retirado de convalescentes, para que o corpo produza ento os antgenos especficos. e) o soro obtido atravs do sangue de animais, como os cavalos, criados em laboratrio, onde recebem grande quantidade de antgenos. Questo 1240 Os agentes infecciosos penetram no corpo das pessoas atravs dos ferimentos e das mucosas. A incidncia de doenas causadas por estes agentes infecciosos poder ser reduzida, submetendo-se as pessoas a) aplicao do soro, que um processo ativo de imunizao preventiva e duradoura. b) aplicao do soro, quando o agente infeccioso provoca uma doena de evoluo muito rpida e no h tempo para a imunizao ativa. c) aplicao do soro, pois as pessoas desenvolvem anticorpos contra os antgenos atenuados. d) vacinao, que a imunidade adquirida de ao menos duradoura que o soro e de emprego teraputico, resultado da ativao dos mecanismos naturais de defesa do organismo. e) vacinao, que tem efeito teraputico, ocasio em que o indivduo recebe anticorpos, j prontos, produzidos pelo organismo de um animal. Questo 1241 A revista "Veja" (28.07.2004) noticiou que a quantidade de imunoglobulina extrada do sangue dos europeus , em mdia, de 3 gramas por litro, enquanto a extrada do sangue dos brasileiros de 5,2 gramas por litro.
278

1.5.10

Analise as afirmativas a seguir: I - A inflamao uma resposta imune do corpo, na tentativa de destruir agentes invasores. II - O tecido lesado libera sinais qumicos (histamina e prostaglandinas) que promovem a dilatao dos vasos na rea lesada. III - Alguns tipos de leuccitos (glbulos brancos) atravessam as paredes dos capilares por diapedese e deslocam-se pelo tecido, fagocitando os microorganismos patognicos. Marque a alternativa correta. a) Apenas I e II so corretas. b) I, II e III so corretas. c) Apenas II e III so corretas. d) Apenas I correta. Questo 1238 O soro antiofdico ministrado em pessoas picadas por cobra peonhenta porque: a) induz a formao de anticorpos. b) contm anticorpos. c) um antibitico. d) provoca imunizao. e) possui antgenos especficos.

Assinale a hiptese que pode explicar corretamente a causa de tal diferena. a) Os europeus tomam maior quantidade de vacinas ao longo de sua vida. b) Os brasileiros esto expostos a uma maior variedade de doenas. c) Os antgenos presentes no sangue do europeu so mais resistentes. d) Os anticorpos presentes no sangue do brasileiro so menos eficientes. e) Os europeus so mais resistentes s doenas que os brasileiros. Questo 1242 A partir do recente surto de sarampo na cidade do Rio de Janeiro, o governo decidiu iniciar uma campanha de imunizao das crianas. A imunizao contra diversos tipos de doenas atingida atravs de vacinao, que consiste em injetar no organismo: a) o soro obtido atravs do sangue de animais criados em laboratrio, como macacos, onde recebem grande quantidade de antgenos e anticorpos especficos. b) o plasma retirado de pessoas que j tiveram a doena, para que o organismo produza antgenos e anticorpos especficos. c) um agente qumico eficaz no combate a doena j instalada e que produza no corpo uma reao para a fabricao de anticorpos especficos. d) vrus ou bactrias mortos ou atenuados que, reconhecidos pelo organismo como antgenos, induzem a produo de anticorpos especficos. e) vrus ou bactrias vivos, em quantidade pequena, para provocar a doena de forma branda, pois o corpo imunizado produzir anticorpos especficos. Questo 1243 Nosso corpo est sempre sendo ameaado de invaso por substncias estranhas e por uma variedade enorme de microorganismos. Toda vez que isso acontece, alm dos nossos mecanismos gerais de defesa, acionamos nosso sistema imune constitudo por diferentes tipos de glbulos brancos e por rgos imunitrios que, primariamente, so: a) fgado e bao. b) fgado e gnglios linfticos.

c) tonsilas e pncreas. d) pncreas e medula ssea. e) medula ssea e timo. Questo 1244 A pigmentao da pele humana condicionada por pares de genes com ausncia da dominncia. Suponhamos que apenas dois pares de genes estivessem envolvidos na cor de pele: o negro seria SSTT e o branco, sstt. Um homem mulato, heterozigoto nos dois pares, tem 6 filhos com uma mulher mulata de gentipo igual ao seu. Sobre os filhos do casal, pode-se afirmar que: a) todos so mulatos como os pais. b) cada um deles tem uma tonalidade de pele diferente da outro. c) um ou mais deles podem ser brancos. d) a probabilidade de serem negros maior do que a de serem brancos. e) 50% apresentam pele branca e 50%, pele negra. Questo 1245 O grfico a seguir representa um tipo de herana onde os caracteres variam de forma gradativa. As opes a seguir so exemplos deste tipo de herana no homem, EXCETO uma. Assinale-a.

1.5.11

a) Estatura. b) Inteligncia. c) Obesidade. d) Fator RH. e) Cor da pele.

279

Questo 1246

1.5.11

dois indivduos que produzem frutos com 15cm, espera-se uma proporo de plantas com frutos de 17,5cm igual a a) 9/16 b) 1/2 c) 3/16 d) 1/4 e) 1/8 Questo 1249 Em um caso de herana quantitativa, esto envolvidos trs pares de genes, "a", "b" e "c". Cruzando-se dois indivduos triplo heterozigotos, a proporo de homozigotos esperada de: a) 1/2 b) 1/8 c) 1/16 d) 1/32 e) 1/64 Questo 1250 Imagine que, em um determinado animal, a reteno de gua no corpo seja controlada pela interao quantitativa de dois pares de genes, existindo cinco fentipos (da reteno baixa at a reteno mxima de gua). Animais com gentipo aabb retm baixa quantidade de gua, enquanto animais com gentipo AABB apresentam reteno mxima de gua. Os animais que apresentam dois genes "maisculos" e dois genes "minsculos" no gentipo retm uma quantidade intermediria de gua. Na genealogia abaixo, so dados os gentipos dos animais indicados pelos nmeros 1, 2, 3 e 6. Considerando que os genes em questo se segregam independentemente, qual a probabilidade de os indivduos 7 e 8 apresentarem simultaneamente reteno intermediria de gua? a) 1/2 b) 1/3 c) 1/4 d) 1/8 e) 1/16

A cor dos gros de trigo condicionada por dois pares de genes de efeito aditivo. A tabela acima mostra o nmero de genes dominantes e as cores determinadas por eles. Do cruzamento entre um indivduo AaBb e um Aabb, a proporo esperada de indivduos com gros vermelhos de: a) 3/8 b) 1/8 c) 3/16 d) 6/8 e) 5/8 Questo 1247 Admita que a diferena de comprimento das orelhas nos coelhos seja um caso de herana quantitativa envolvendo dois pares de genes com segregao independente. Animais sem nenhum gene dominante possuem orelhas com 4,0cm. Cada gene dominante aumenta em 1,0cm o comprimento das orelhas. O cruzamento que produzir na descendncia uma maior porcentagem de coelhos com orelhas de no mnimo 7,0cm o a) AaBb x AaBb b) AaBb x aaBB c) AAbb x aaBB d) Aabb x AABB e) AABB x aabb Questo 1248 Para uma determinada planta, suponha que a diferena entre um fruto de 10cm de comprimento e um de 20cm de comprimento seja devida a dois genes, cada um com dois alelos, que tm efeito aditivo e que se segregam independentemente. Na descendncia do cruzamento entre

280

1.5.11

de altura e cada alelo p e r determina 10cm. Assim, os indivduos PPRR tm 80cm e os indivduos pprr, 40cm. O grfico a seguir representa a distribuio das classes fenotpicas observada nos descendentes dos cruzamento entre heterozigotos PpRr.

1.5.11

Questo 1251 Supondo que na aboboreira existam 3 pares de genes que influem no peso do fruto, uma planta aabbcc origina frutos com aproximadamente 1.500 gramas e uma planta AABBCC, frutos ao redor de 3.000 gramas. Se essas duas plantas forem cruzadas, o peso aproximado dos frutos produzidos pelas plantas F ser de a) 3 000 gramas. b) 2 500 gramas. c) 2 250 gramas. d) 2 000 gramas. e) 1 500 gramas. Questo 1252 A tabela a seguir classifica caractersticas hereditrias da espcie humana. Assinale a alternativa que corresponde classificao correta.

esse grfico, os indivduos PPRr e Pprr esto includos, respectivamente, em a) IV e V b) IV e II c) III e II d) III e I e) I e V Questo 1254 Um estudante de 23 anos, doador de sangue tipo universal, moreno, tem estatura mediana e pesa 85 kg. Todas as alternativas apresentam caractersticas hereditrias desse estudante que so influenciadas pelo ambiente, EXCETO a) Altura b) Grupo sangneo c) Cor da pele d) Peso Questo 1255 Em um dos modelos propostos para a determinao da cor dos olhos na espcie humana (herana quantitativa), so considerados cinco diferentes fentipos. Na descendncia de pais heterozigticos para os locos determinantes desta caracterstica, foram observados os dados apresentados no quadro abaixo. Analise-os, juntamente com o grfico, e identifique a correo das proposies a seguir.

1.5.11

Questo 1253 Em certa espcie vegetal, a altura dos indivduos determinada por dois pares de alelos de efeito aditivo e segregao independente: cada alelo P e R determina 20cm

281

1.5.11

( ) Trs pares de alelos justificam os resultados apresentados. ( ) Nos indivduos de olhos castanho-claros, os locos em questo podem estar em homozigose ou em heterozigose. ( ) Indivduos de olhos verdes apresentam homozigose em apenas um dos locos em questo. ( ) A probabilidade do nascimento de duas crianas de olhos azuis, a partir de um casal genotipicamente igual ao do exemplo dado, de aproximadamente 0,004. ( ) A probabilidade do casal indicado no item anterior de ter duas crianas, sendo uma de olhos castanho-claros e uma de olhos verdes de 3/16. Questo 1256 A cor da pele humana conseqncia do efeito cumulativo de mais de um gene, de modo que cada gene contribui igualmente para o fentipo. O grfico que representa a proporo fenotpica nesse tipo de herana

so fenotipicamente homogneas: apresentam as mesmas caractersticas quanto altura da planta e tamanho da espiga, ao tamanho e nmero de gros por espiga, e a outras caractersticas de interesse do agricultor. Porm, quando o agricultor realiza um novo plantio com sementes produzidas pelas plantas C, no obtm os resultados desejados: as novas plantas so fenotipicamente heterogneas e no apresentam as caractersticas da planta C; tm tamanhos variados e as espigas diferem quanto a tamanho, nmero e qualidade dos gros. Para as caractersticas consideradas, os gentipos das plantas A, B e C so, respectivamente, a) heterozigoto, heterozigoto e homozigoto. b) heterozigoto, homozigoto e heterozigoto. c) homozigoto, heterozigoto e heterozigoto. d) homozigoto, homozigoto e heterozigoto. e) homozigoto, homozigoto e homozigoto. Questo 1258 A altura de uma planta depende de dois pares de genes, A e B. O grfico adiante mostra a variao da altura dos descendentes de dois indivduos dibridos.

1.5.11

1.5.11 Com relao ao grfico, julgue os itens que se seguem. (1) Os efeitos quantitativos dos alelos A e B so, respectivamente, 40 e 30cm. (2) A freqncia de descendentes heterozigotos, para os dois genes, de 50%. (3) Esto ilustrados cinco gentipos. (4) A herana apresentada polignica.

Questo 1257 Uma empresa agropecuria desenvolveu duas variedades de milho, A e B, que, quando entrecruzadas, produzem sementes que so vendidas aos agricultores. Essas sementes, quando plantadas, resultam nas plantas C, que

282

Questo 1259 A altura de uma certa espcie de planta determinada por dois pares de genes A e B e seus respectivos alelos a e b. Os alelos A e B apresentam efeito aditivo e, quando presentes, cada alelo acrescenta planta 0,15m. Verificou-se que plantas desta espcie variam de 1,00m a 1,60m de altura. Cruzando-se plantas AaBB com aabb pode-se prever que, entre os descendentes, a) 100% tero 1,30m de altura. b) 75% tero 1,30m e 25% tero 1,45m de altura. c) 25% tero 1,00m e 75% tero 1,60m de altura. d) 50% tero 1,15m e 50% tero 1,30m de altura. e) 25% tero 1,15m, 25% 1,30m, 25% 1,45m e 25% 1,60m de altura. Questo 1260 Polticas de incluso que consideram cotas para negros ou afrodescendentes nas universidades pblicas foram colocadas em prtica pela primeira vez na Universidade Estadual do Rio de Janeiro (UERJ), em 2001. Propostas como essas geram polmicas e dividem opinies. H vrios argumentos contra e a favor. Os bilogos tm participado desse debate, contribuindo com os conhecimentos biolgicos referentes raa e herana da cor da pele humana, entre outros. Assinale a afirmao considerada correta do ponto de vista da biologia. a) Os critrios para se definirem duas populaes como raas diferentes so cientfica e consensualmente determinados. b) No encontramos, na histria da biologia, dvidas sobre a existncia de raas na espcie humana. c) A cor da pele humana um exemplo de herana quantitativa ou polignica, o que significa que vrios genes atuam na sua definio. d) O fato de a cor da pele no ser influenciada por fatores ambientais refora a hiptese da existncia de raas na espcie humana. e) A determinao da cor da pele humana segue os padres do tipo de herana qualitativa e um exemplo de co-dominncia.

Questo 1261 As diferenas hereditrias entre os indivduos de uma populao podem ser classificadas em qualitativas e quantitativas. A esse respeito, assinale a opo correta. a) Na herana de caracteres quantitativos, existe um grande contraste entre as caractersticas que um dado trao fenotpico pode apresentar. b) Na herana de caracteres qualitativos, um dado trao de fentipo apresenta-se sob grande variedade de formas, em geral com pequenas diferenas entre si. c) Altura, peso e cor da pele so exemplos de algumas caractersticas quantitativas do homem. d) Os caracteres qualitativos, em sua maioria, sofrem grande influncia do meio. e) A altura no uma caracterstica hereditria, j que um indivduo cresce menos se no receber a alimentao adequada na infncia. Questo 1262 Determinada caracterstica quantitativa depende da ao de cinco pares de genes. Do cruzamento entre dois indivduos com gentipo AaBbCcDdEe resultam a) 5 classes fenotpicas. b) 9 classes fenotpicas. c) 10 classes fenotpicas. d) 11 classes fenotpicas. e) 15 classes fenotpicas. Questo 1263 A cor dos plos nas cobaias condicionada por uma srie de alelos mltiplos com a seguinte escala de dominncia: C (preta) > C (marrom) > C (creme) > c (albino). Uma fmea marrom teve 3 ninhadas, cada uma com um macho diferente. A tabela a seguir mostra a constituio de cada ninhada.

283

1.5.12

1.5.12

A partir desses dados possvel afirmar que o macho responsvel pela ninhada: a) 1 era marrom homozigoto. b) 1 era preto homozigoto. c) 2 era albino heterozigoto. d) 2 era creme heterozigoto. e) 3 era marrom homozigoto. Questo 1264 O controle gentico de determinado carter feito por uma srie de quatro alelos de um s locus. O alelo A dominante sobre os alelos A, A e A; o alelo A dominante sobre os alelos A e A e o alelo A dominante sobre A. Do cruzamento AA x AA devem ser obtidas: a) quatro classes genotpicas e quatro classes fenotpicas. b) quatro classes genotpicas e duas classes fenotpicas. c) quatro classes genotpicas e trs classes fenotpicas. d) trs classes genotpicas e trs classes fenotpicas. e) trs classes genotpicas e duas classes fenotpicas. Questo 1265 Em uma populao de organismos diplides, foram encontrados quatro alelos diferentes para um determinado locus gnico, denominados S, S, S e S. A figura a seguir mostra, esquerda, as diferenas na seqncia de DNA que caracterizam cada um desses alelos e, direita, o par de cromossomos homlogos (metafsicos) onde esse gene encontrado. Diante dessas informaes, se um nico indivduo desta populao for escolhido ao acaso, qual combinao alelo/posio cromossmica poderia ser encontrada no par de cromossomos metafsicos deste indivduo?

Questo 1266 Se um carter tem trs alelos possveis, podendo haver seis gentipos, e um segundo carter apresenta oito gentipos possveis, quando ambos forem estudados simultaneamente, podem ocorrer a) 7 gentipos. b) 12 gentipos. c) 24 gentipos. d) 48 gentipos. e) 96 gentipos. Questo 1267 Coelhos podem ter quatro tipos de pelagem: chinchila, himalaia, aguti e albina, resultantes das combinaes de quatro diferentes alelos de um mesmo loco. Num experimento, animais com diferentes fentipos foram cruzados vrias vezes. Os resultados, expressos em nmero de descendentes, constam na tabela a seguir.

1.5.12

284

e o animal progenitor aguti do cruzamento 1 for utilizado para a obteno de filhotes com o progenitor chinchila do cruzamento 4, que proporo de descendentes poderemos prever? 1.5.13 a) 1 aguti: 1 chinchila. b) 1 aguti: 1 himalaia. c) 9 aguti: 3 himalaia: 3 chinchila: 1 albino. d) 2 aguti: 1 chinchila: 1 himalaia. e) 3 aguti: 1 chinchila. Questo 1268 Suponha que em uma certa espcie diplide exista um carter relacionado com uma srie de quatro alelos (alelos mltiplos). Em um determinado indivduo da espcie referida, o nmero mximo de alelos representados relacionados ao carter em questo ser igual a a) 2. b) 4. c) 6. d) 8. e) 10. Questo 1269 Considere um gene que apresenta 3 alelos, aqui denominados "alfa", "beta" e "gama". Considere que os alelos "alf" e "beta" so co-dominantes e gama recessivo em relao a ambos. Tal gene deve determinar: (01) trs fentipos, correspondentes a cinco gentipos. (02) trs fentipos, cada um correspondente a um gentipo. (04) quatro fentipos, cada um correspondente a dois gentipos. (08) seis fentipos, correspondentes a quatro gentipos. (16) quatro fentipos, correspondentes a seis gentipos. Questo 1270 No rgo reprodutor de um animal h 1000 (mil) clulas, em cujos ncleos esto os cromossomos, como mostra o desenho a seguir: Se em todas as clulas ocorrer "crossing-over" entre os genes A e B, e se cada uma originar 4 (quatro) gametas, podemos afirmar que: a) todos os gametas formados contero as combinaes resultantes do "crossing". b) a proporo de gametas com as formas no "crossing" seria maior do que a de gametas com as formas "crossing". c) a ocorrncia do "crossing" no altera a seqncia dos genes nos cromossomos, porque s as cromtides irms so envolvidas. d) as propores entre os tipos de gametas seriam iguais s que ocorrem quando os genes esto em cromossomos diferentes. e) no possvel calcular essas propores, porque os gametas recebem cromossomos ao acaso. Questo 1271 Em determinada espcie, os locos dos genes A e B situam-se no mesmo cromossomo. Na meiose de um indivduo duplo-heterozigoto AB/ab ocorre permutao entre esses locos em 80% das clulas. A porcentagem esperada de gametas Ab que o indivduo formar a) 10% b) 20% c) 30% d) 40% e) 80% Questo 1272 O cruzamento CD/cd x cd/cd produziu 300 descendentes. Quantos devero ser diferentes dos pais, sabendo-se que a freqncia de permutao de 10% a) 30 b) 15 c) 270
285

d) 290 e) 45 Questo 1273 O cruzamento AB/ab x ab/ab produziu 450 descendentes. Quantos devero ser diferentes dos pais, sabendo-se que a freqncia de permutao de 20% a) 30 b) 90 c) 430 d) 360 e) 45 Questo 1274 Analisando-se dois pares de genes em ligamento fatorial ("linkage") representados pelo hbrido BR/br, uma certa espcie apresentou a seguinte proporo de gametas: BR - 48,5% br - 48,5% Br - 1,5% bR - 1,5% Pela anlise dos resultados, pode-se concluir que a distncia entre os genes B e R de: a) 48,5 morgandeos. b) 97 morgandeos. c) 1,5 morgandeo. d) 3 morgandeos. e) 50 morgandeos. Questo 1275 Em um caso de "linkage", dois genes A e B, autossmicos, distam entre si 20 UR. Considere o seguinte cruzamento: Fmea (Ab/aB) X Macho (ab/ab) Qual a freqncia esperada de machos com o gentipo AB/ab? a) 100% b) 50% c) 25% d) 10% e) 5%

Questo 1276 Na espcie humana os genes que determinam a distrofia muscular Duchnne e a hemofilia, heranas recessivas ligadas ao sexo, distam entre s 20 U.R. (unidades de recombinao). Considere o seguinte cruzamento:

1.5.13

esse cruzamento, a freqncia esperada de machos afetados pelos dois caracteres de: a) 0 % b) 5 % c) 10 % d) 20 % e) 40 % Questo 1277 Pelo que se conhece da disposio dos genes dos cromossomos, de se esperar lhe a freqncia de permutao entre dois genes esteja na dependncia. a) da distncia entre eles. b) do comprimento da zona centromrica. c) da existncia do fenmeno da pleiotropia. d) do tipo de polimeria existente. e) da ausncia de nucleotdeos covalentes. Questo 1278 Na meiose de um indivduo AB/ab, ocorre "crossing-over" entre esses genes em 40% das clulas. A freqncia de gametas AB, Ab, aB e ab produzidos por esse indivduo deve ser, respectivamente, a) 10%, 40%, 40% e 10% b) 30%, 20%, 20% e 30% c) 30%, 30%, 20% e 20% d) 40%, 10%, 10% e 40% e) 40%, 40%, 10% e 10%
286

Questo 1279 Se a distncia entre dois locos gnicos de 20 unidades, a partir de um determinado cruzamento espera-se obter os seguintes descendentes: + + 10 + d 40 c + 40 c d 10 Esse cruzamento poderia ser a) ++/++ x cd/cd b) ++/cd x cd/cd c) +d/+d x c+/c+ d) +d/c+ x cd/cd e) +d/cd x c+/cd Questo 1280 Em camundongos, o alelo dominante E condiciona plos normais e o alelo recessivo e, plos encrespados. O alelo dominante A determina pelagem selvagem e o alelo recessivo a, albina. Os indivduos F, obtidos a partir de cruzamentos EEAAeeaa, ao serem cruzados com animais duplo-recessivos, originaram os seguintes descendentes: 160 com plos normais e albinos 160 com plos encrespados e selvagens 40 com plos normais e selvagens 40 com plos encrespados e albinos Assinale a alternativa que contm as porcentagens corretas de cada tipo de gameta produzido pelos indivduos F. a) EA = 10; Ea = 40; eA = 40; ea = 10. b) EA = 20; Ea = 30; eA = 30; ea = 20. c) EA = 25; Ea = 25; eA = 25; ea = 25. d) EA = 30; Ea = 20; eA = 20; ea = 30. e) EA = 40; Ea = 10; eA = 10; ea = 40. Questo 1281 Numa certa espcie de milho, o gro colorido condicionado por um gene dominante B e o gro liso por um gene dominante R. Os alelos recessivos b e r condicionam, respectivamente, gros brancos e rugosos. No cruzamento entre um indivduo colorido liso com um

branco rugoso, surgiu uma F, com os seguintes descendentes: 150 indivduos que produziam sementes coloridas e lisas, 150 indivduos que produziam sementes brancas e rugosas, 250 indivduos que produziam sementes coloridas e rugosas e 250 indivduos que produziam sementes brancas e lisas. A partir desses resultados, podemos concluir que o gentipo do indivduo parental colorido liso e a distncia entre os genes B e R so a) BR/br; 62,5 U.R. b) BR/br; 37,5 U.R. c) Br/bR; 62,5 U.R. d) Br/bR; 37,5 U.R. e) BR/br; 18,75 U.R. Questo 1282 Com relao ao processo conhecido como crossing-over, podemos afirmar que o mesmo a) diminui a variabilidade gentica. b) separa cromtides homlogas. c) corrige a recombinao gnica. d) aumenta a variabilidade gentica. e) troca cromossomos entre genes homlogos. Questo 1283 O esquema a seguir refere-se a uma clula diplide que, durante a meiose, sofrer permutao entre os genes A e B.

1.5.13

287

Assinale a alternativa que apresenta todos os tipos de gametas normais que podem ser formados por essa clula. a) AbCe; abCe; aBCe; ABCe b) AbC; e; aBC; e c) AbCe; ABCe d) AbCe; aBCe e) AabCe; AaBCe; AbCe; aBCe Questo 1284 Com relao ao processo denominado permutao, ou crossing over, correto afirmar: (01) a troca de gametas que ocorre durante o cruzamento de dois indivduos da mesma espcie. (02) a troca de microncleos entre indivduos unicelulares para renovar o seu material gentico. (04) o processo que origina novos arranjos gnicos resultantes de trocas de fragmentos de cromtides homlogas. (08) o pareamento de cromossomos homlogos de modo a se tornarem bivalentes. (16) o processo de duplicao dos cromossomos para garantir a manuteno da espcie. (32) um processo que ocorre necessariamente durante a mitose. (64) o processo responsvel pela variabilidade gentica entre organismos de uma mesma espcie. Questo 1285 Um cruzamento entre dois indivduos, com os gentipos DdEe x ddee, originou 42 descendentes com gentipo DdEe, 160 Ddee, 168 ddEe e 40 ddee. Sobre os genes D e E podemos concluir que: a) esto ligados e h permuta entre eles. b) esto ligados e no h permuta entre eles. c) segregam-se independentemente e h permuta entre eles. d) segregam-se independentemente e no h permuta entre eles. e) no esto ligados, logo segregam-se independentemente. Questo 1286 Suponha que 100 clulas germinativas entram em meiose e que essas clulas tenham o seguinte gentipo:

1.5.13

uantos gametas recombinantes sero formados se 20 das 100 clulas apresentarem permutao na meiose? a) 10 b) 20 c) 40 d) 80 e) 160 Questo 1287 Considerando os genes X, Y e Z de um cromossomo, sabe-se que h 15% de recombinao entre os genes X e Y, entre Y e Z h 30% e entre os genes Z e X ocorre 45%. Qual a posio relativa desses trs genes no cromossomo? a) ZXY b) XYZ c) YZX d) XZY e) YXZ Questo 1288 Sabendo-se que as freqncias de permutao entre os genes A e C de 20% e entre os genes B e C de 10%, ento a distncia entre os genes A e B ser a) 10 morgandeos. b) 30 morgandeos. c) 10 ou 30 morgandeos. d) 20 morgandeos. e) 20 ou 10 morgandeos. Questo 1289 Sabendo-se que as freqncias de permutao entre os genes A e C de 40% e entre os genes B e C de 15%, ento a distncia entre os genes A e B ser a) 45 morgandeos.
288

b) 25 morgandeos. c) 40 morgandeos. d) 25 ou 15 morgandeos. e) 40 ou 15 morgandeos. 1.5.14 Questo 1290 Supondo-se que a distncia entre locos gnicos seja de 16 morgandios, a taxa de recombinao entre eles de a) 8% b) 16% c) 32% d) 42% e) 84% Questo 1291 Quatro genes, A, B, C e D, localizados no mesmo cromossomo, apresentam as seguintes freqncias de recombinao: A-B = 32% A-C = 45% A-D = 12% B-C = 13% B-D = 20% C-D = 33% A seqncia mais provvel desses genes no cromossomo a) ABCD b) ABDC c) ACDB d) ADBC e) ADCB Questo 1292 Na elaborao de mapas genticos, utiliza-se o teste dos trs pontos. Para isso, so avaliadas as freqncias das classes fenotpicas na descendncia de cruzamento entre indivduos heterozigticos (ABC//abc), para trs locos ligados, e indivduos homozigticos recessivos (abc//abc), para os mesmos locos (cruzamento teste). Tomando por base os dados fornecidos no quadro a seguir, analise as proposies seguintes.

( ) Os fentipos 3 e 4 resultaram de recombinao gentica entre os locos A e B. ( ) A recombinao entre os locos B e C, embora em diferentes freqncias, ocorreu nos gentipos 5, 6, 7 e 8. ( ) Os fentipos 7 e 8 resultaram de recombinao gentica apenas entre os locos C e B. ( ) A seqncia dos alelos no cromossomo em questo A -------B-------C. ( ) No mapa gentico, a distncia entre os locos A e B maior que a distncia entre os locos B e C. Questo 1293 Os transgnicos, organismos geneticamente modificados (OGM), esto merecendo uma ateno especial no mundo todo, o que indica um avano biotecnolgico nesta rea. Os produtos transgnicos apresentam algumas vantagens. Das afirmativas, considere as corretas: I. Resistem a certas doenas e pragas (insetos, caros, nematides etc) diminuindo a necessidade do uso de pesticidas. II. Aumentam a produtividade (caso da soja, por exemplo). III. O arroz transgnico apresenta variedades que contm altos teores de beta-caroteno (precursor da Vitamina A) e que acumulam maior teor de ferro, desenvolvidas em pases asiticos. Est correta ou esto corretas: a) apenas I e II b) apenas II e III c) apenas I e III d) todas e) apenas uma das trs vantagens.

289

Questo 1294 As mangueiras, ao contrrio do esperado, continuaram com baixa produo aps a poda. Investigando o problema, o pesquisador descobriu que o ambiente favorecia o desenvolvimento de um nematide parasita de mangueira, cujo controle era muito difcil. O pesquisador sugeriu desenvolver uma linhagem transgnica dessa mangueira, pela insero de um gene que codifica uma toxina capaz de matar o nematide. Para criar a mangueira transgnica, deve-se seguir um conjunto de etapas que comea pela construo de uma seqncia iniciadora ('primer'). A seqncia correta das etapas seguintes construo do 'primer' , resumidamente,

reprodutor da ovelha "Scottish Blackface". Dele se formou um embrio que deu origem Dolly.

Tomando por base o texto, podemos afirmar que: a) A clonagem est correta mas no revela a tecnologia necessria para as clulas "hibernarem" e acertarem o tempo, tambm necessrio, para a transferncia do ncleo para o vulo anucleado. b) "Dolly" no tem pai mas , certamente, filha da ovelha da raa "Scottish Blackface", que cedeu o vulo anucleado. c) A clonagem est errada, pois o pai a ovelha da raa "Finn Dorset", uma vez que no seu gentipo h cromossomos de seu av. d) A clonagem est correta, pois a genitora a ovelha da raa "Scottish Blackface", uma vez que "Dolly" veio de seu a) transfeco do gene amplificao do gene vulo. insero do gene num vetor. e) H uma falha tcnica no experimento, pois ncleo de b) insero do gene num vetor transfeco do gene clula de glndula mamria no pode influir nas amplificao do gene. caractersticas da "Dolly". c) amplificao do gene transfeco do gene Questo 1296 insero do gene num vetor. d) amplificao do gene insero do gene num vetor Uma maneira de se obter um clone de ovelha transferir o transfeco do gene. ncleo de uma clula somtica de uma ovelha adulta A para um vulo de uma outra ovelha B do qual foi previamente Questo 1295 eliminado o ncleo. O embrio resultante implantado no tero de uma terceira ovelha C, onde origina um novo Clone um populao de seres geneticamente idnticos, indivduo. Acerca do material gentico desse novo originados pela multiplicao assexuada de um nico indivduo, pode-se afirmar que genitor ou por manipulao citogentica. Recentemente os jornais publicaram uma receita de a) o DNA nuclear e o mitocondrial so iguais aos da ovelha A. clonagem para "fazer" a ovelha "Dolly" da raa "Finn b) o DNA nuclear e o mitocondrial so iguais aos da ovelha Dorset". B. A receita prope os seguintes passos: c) o DNA nuclear e o mitocondrial so iguais aos da ovelha Os cientistas retiraram vulos de uma ovelha adulta da raa C. "Scottish Blackface". Deles removeram os ncleos e d) o DNA nuclear igual ao da ovelha A, mas o DNA guardaram o resto. mitocondrial igual ao da ovelha B. e) o DNA nuclear igual ao da ovelha A, mas o DNA Foram retiradas as clulas das glndulas mamrias de uma ovelha adulta da raa "Finn Dorset". Delas so retirados os mitocondrial igual ao da ovelha C. ncleos, que so guardados. Os ingredientes foram Questo 1297 colocados numa soluo qumica para "hibernar" e esperar um tempo para serem encaixados nos vulos anucleados. A comunidade cientfica demonstrou ser possvel a Os cientistas transferiram o ncleo da clula mamria para reproduo de seres vivos atravs de sofisticadas tcnicas o vulo da ovelha "Scottish Blackface" Passado um tempo, de clonagem, que consistem em: ele comeou a se dividir, formando um aglomerado de a) injetar, dentro do vulo de uma fmea de uma espcie, clulas. um espermatozide de um macho da mesma espcie. O aglomerado celular foi transferido para o aparelho
290

b) retirar e descartar o ncleo do vulo de uma fmea de uma espcie e injetar, neste vulo anucleado, o ncleo de uma clula somtica de um indivduo da mesma espcie. c) injetar, dentro do vulo de uma fmea, o ncleo de um outro vulo da mesma fmea. d) retirar e descartar o ncleo de uma clula somtica de uma espcie e injetar, nesta clula anucleada, o ncleo de uma clula ovo da mesma espcie. e) introduzir, nas clulas reprodutoras de uma espcie, alguns genes de outra espcie. Questo 1298 Recentemente, o mundo foi abalado pela notcia da produo do clone de uma ovelha. Nessa clonagem, utilizou-se o ncleo de uma clula da mama de uma ovelha (A) e o citoplasma de um vulo de outra ovelha (B). CORRETO concluir que: a) todos os cromossomos do clone so iguais aos da ovelha A. b) os autossomos do clone so iguais aos da ovelha A, e os cromossomos sexuais so iguais aos da ovelha B. c) todos os cromossomos do clone so iguais aos da ovelha B, e os cromossomos sexuais so iguais aos da ovelha A. d) os autossomos do clone so iguais aos da ovelha B, e os cromossomos sexuais so iguais aos da ovelha A. e) existem cromossomos no clone que so diferentes de A e de B. Questo 1299 Os pesquisadores da rea de Gentica demonstraram ser possvel a reproduo de seres vivos por meio de aprimoradas tcnicas de clonagem, que consistem em: a) injetar, dentro do vulo da fmea de uma espcie, um espermatozide de um macho da mesma espcie. b) introduzir, nas clulas germinativas de uma espcie, alguns genes de outra espcie. c) retirar e descartar o ncleo de uma clula somtica de uma espcie e injetar, nesta clula anucleada, o ncleo de uma clula-ovo da mesma espcie. d) retirar e descartar o ncleo do vulo da fmea de uma espcie e injetar neste vulo anucleado, o ncleo de uma clula somtica de um indivduo da mesma espcie. e) injetar, dentro do vulo de uma fmea, o ncleo de um outro vulo da mesma espcie.

Questo 1300 Em fevereiro deste ano, um grupo de pesquisadores divulgou ao mundo a ovelha Dolly, obtido por meio da tcnica de clonagem. Esses pesquisadores retiraram o ncleo da clula de uma ovelha (A) e o implantaram num vulo colhido de uma outra ovelha (B), do qual o ncleo fora previamente removido. Esse vulo fora posteriormente implantado no tero de uma terceira ovelha (C), originando Dolly. A partir dos dados envolvidos no experimento realizado pelos pesquisadores, pode-se prever que Dolly apresente a) constituio cromossmica da ovelha A e DNA mitocondrial da ovelha B. b) constituio cromossmica e DNA mitocondrial da ovelha A. c) constituio cromossmica e DNA mitocondrial da ovelha B. d) constituio cromossmica da ovelha A e DNA mitocondrial da ovelha C. e) constituio cromossmica e DNA mitocondrial correspondente a uma mistura das trs ovelhas. Questo 1301 Considere os processos adiante: I. reproduo assexuada II. reproduo sexuada III. produo de indivduos geneticamente idnticos IV. meiose Na formao de clones de organismos pluricelulares ocorrem, necessariamente, APENAS a) I e II b) I e III c) I e IV d) II e III e) III e IV Questo 1302 Se retirarmos o ncleo de uma clula-ovo de r e o substituirmos por outro ncleo diplide de uma clula de tecido muscular de r adulta, a nova clula-ovo assim
291

formada ser capaz de produzir uma outra r. Assinale a alternativa que explica, corretamente, o que ocorre, neste caso, em relao seqncia funcional do DNA da clula diplide doadora. a) Foi integralmente inativada. b) Foi parcialmente inativada. c) Foi integralmente mantida ativa. d) Expressou-se como na clula germinativa. e) Expressou-se como na clula muscular. Questo 1303 Se retirarmos o ncleo de uma clula-ovo de r e o substituirmos por outro ncleo diplide de uma clula de tecido epitelial normal de r j adulta, a nova clula-ovo assim formada ser capaz de produzir outra r normal. Dentre as alternativas a seguir, a que apresenta a melhor explicao sobre o que ocorre neste caso, em relao seqncia funcional do DNA da clula diplide doadora, : a) foi integralmente inativada b) foi integralmente mantida ativa c) expressou-se como na clula epitelial d) expressou-se como na clula germinativa Questo 1304 No fim de junho de 2000, foi considerado concludo, depois de dez anos de trabalho, o "Projeto Genoma Humano", um marco no estudo da biologia, que recebeu ampla divulgao na imprensa internacional. Numa breve histria da gentica, podemos relacionar alguns fatos que marcaram poca pela sua importncia cientfica, como segue. I. Observao da estrutura espiralada do DNA. II. Estabelecimento das leis da hereditariedade. III. Surgimento da tcnica de identificao das pessoas pelo exame do DNA. IV. Clonagem do primeiro mamfero a partir de uma clula de um animal adulto. V. Identificao da localizao cromossmica dos genes. VI. Transformao gentica de bactrias para a produo de insulina humana. Assinale a alternativa que correlaciona os fatos mencionados anteriormente em ordem cronolgica crescente. a) II, V, I, VI, III, IV.

b) II, V, III, I, VI, IV. c) V, II, IV, I, VI, III. d) V, II, I, IV, III, VI. e) IV, III, VI, I, V, II. Questo 1305 Os conhecimentos cientficos envolvendo a "clonagem" tm proporcionado humanidade grandes avanos e sua utilizao em vegetais tem sido mais fcil e menos controversa que em animais, porque a) os mecanismos de regulao gnica nos vegetais so mais simples, devido ao seu menor grau de complexidade. b) os embries resultantes da clonagem em vegetais so mais resistentes s modificaes ambientais. c) os vegetais apresentam, em sua maioria, a capacidade de propagao vegetativa, o que facilita a continuidade do processo. d) a regulao hormonal da reproduo nos vegetais mais facilmente controlada pelos cientistas. e) os vegetais produzem maior nmero de embries por indivduo, o que diminui a perda em caso de rejeio. Questo 1306 Desde que a criao da ovelha "Dolly " foi anunciada h dois anos, cientistas de todo o planeta prometem empreender uma verdadeira reforma gentica na natureza. Querem usar a clonagem para salvar pandas em extino, criar animais com rgos humanos e produzir bichos que funcionem como farmcias ambulantes. ("Veja", 4/8/99) Agricultores britnicos que produzem alimentos transgnicos prevem novos conflitos com ambientalistas, uma vez que o governo britnico divulgou ontem o anncio, pela Internet, de locais das novas plantaes. O uso da tcnica tem criado receio entre a populao, que teme pelos danos ao meio ambiente e sade. Alguns manifestantes, como forma de protesto, esto destruindo as plantaes de transgnicos do pas. ("O Estado de So Paulo," 17/8/99.) Tendo em vista as vantagens e limitaes das tcnicas comentadas nos textos acima, considere as seguintes afirmativas:

292

I - Os cientistas ainda precisam compreender melhor os mecanismos de controle de diferenciao celular, para um maior aproveitamento dessas tcnicas. II - Os estudos de clonagem podem ser proveitosos para o estabelecimento de relaes filogenticas entre os organismos fsseis e os atuais. III - A introduo de um material gentico exgeno (transgene) em organismo vivos pode determinar um risco ecolgico, ainda no totalmente avaliado. IV - A clonagem poder auxiliar no esclarecimento dos mecanismos de envelhecimento e morte celular. So corretas a) apenas I, II e III. b) apenas I, II e IV. c) apenas II, III e IV. d) apenas III e IV. e) I, II, III e IV. Questo 1307 Analise este esquema relativo obteno de clulas-tronco:

Questo 1308 Considerando o processo de clonagem do DNA, analise as proposies abaixo. ( ) Para cortar o DNA dos cromossomos, esses cromossomos devem estar em metfase. Nos cortes so utilizadas as enzimas transcriptases reversas. ( ) Com uma nica transcriptase possvel cortar o DNA de uma clula em pontos da molcula onde existem diferentes seqncias de nucleotdeos. ( ) A partir de um segmento de DNA, de um organismo introduzido em uma bactria, possvel obter-se um grande nmero de cpias do mesmo. ( ) Os plasmdios no contm genes essenciais vida das bactrias; eles podem ser utilizados como vetores genticos. ( ) Um DNA recombinante pode ser obtido a partir da unio de um segmento de DNA bacteriano com um segmento de DNA de um outro organismo. Questo 1309 O esquema a seguir mostra uma clonagem reprodutiva humana. Nesse processo, o ncleo de uma clula somtica de um tenista retirado, (1), removido o ncleo de um ovcito, (2) e finalmente introduzido o ncleo da clula do atleta no ovcito enucleado, (3). Essa nova clula, (4), transferida para um tero para que se desenvolva e forme um embrio. O embrio se desenvolver, e o adulto (5) ter praticamente as mesmas caractersticas fenotpicas do indivduo que doou o ncleo, uma vez que o fentipo resultado do gentipo (DNA) mais as influncias do ambiente. Por muito tempo, o ncleo foi considerado uma organela que apresentava as seguintes estruturas: um envoltrio, o material gentico (DNA, RNA), o nuclolo e enzimas. Em 1997, porm, cientistas britnicos descobriram uma nova estrutura nuclear, que foi denominada de retculo nucleoplasmtico, sendo descrita como uma estrutura membranosa que est envolvida no processo de regulao de clcio. "Cincia Hoje", n 195, 2003 [adapt.]

1.5.15.1

om base nas informaes desse esquema e em outros conhecimentos sobre o assunto, INCORRETO afirmar que clulas-tronco a) retiradas de embries congelados eliminam as questes ticas e religiosas associadas obteno de rgos para transplantes. b) de um paciente podem ser usadas para regenerar seus tecidos ou rgos lesados, eliminando o risco de rejeio imunolgica. c) de adulto so capazes de se diferenciar em outro tipo de clula, independentemente do seu tecido de origem. d) embrionrias so capazes de se diferenciar em outros tipos de clulas, desde que cultivadas sob condies adequadas.

293

1.5.15.1

gentico de plantas, pois as clulas podem ser manipuladas geneticamente e, a partir delas, podem-se obter indivduos adultos com caractersticas alteradas. (4) Uma vez obtida uma variedade de morangueiro com as caractersticas ideais, no se justifica preservar as variedades silvestres, muito menos produtivas. Questo 1311 Um dos caminhos escolhidos pelos cientistas que trabalham com clonagens desenvolver em humanos a clonagem teraputica, principalmente para a obteno de clulas-tronco, que so clulas indiferenciadas que podem dar origem a qualquer tipo de tecido. Quanto a este aspecto, as clulas-tronco podem ser comparadas s clulas dos embries, enquanto estas se encontram na fase de a) mrula. b) gstrula. c) nurula. d) formao do celoma. e) formao da notocorda. Questo 1312 Considere as cinco situaes seguintes. I. Formao de vrios embries a partir de um nico zigoto. II. O gameta feminino (vulo) de certos animais se desenvolve formando um novo indivduo, sem que tenha sido fecundado. III. vulos distintos so fecundados por espermatozides tambm distintos, originando zigotos igualmente distintos. IV. Concepo de um organismo a partir da fuso de um vulo no fecundado, do qual se retirou o ncleo celular, com o ncleo de uma clula somtica retirada de um animal que se deseja copiar. V. Uma muda de violeta formada a partir de uma nica folha que tenha sido destacada de outra planta e plantada em solo mido e bem adubado. Tomando-se como referncia a definio gentica de clone e considerando as situaes descritas, podemos dizer que so processos de clonagem: a) I, apenas. b) I e II, apenas. c) I, IV e V, apenas. d) I, II, III e IV, apenas.
294

Com base no texto e em seus conhecimentos, INCORRETO afirmar que a) o ncleo uma organela exclusiva das clulas eucariticas. No seu interior, esto presentes vrias enzimas, entre elas as envolvidas nos processos de transcrio e replicao. b) o nuclolo responsvel pela sntese do RNA ribossmico; este - juntamente com protenas - forma os ribossomos, estruturas importantes no processo de traduo. c) a funo do retculo nucleoplasmtico semelhante do retculo endoplasmtico, que uma organela citoplasmtica. d) todo o DNA da nova clula formada na clonagem citada no texto, (4), ser a clula doadora do ncleo. e) o envoltrio nuclear formado por duas membranas, sendo que cada uma delas composta por duas camadas de lipdios com protenas inseridas. Questo 1310 Os morangos de excelente qualidade que se encontram atualmente nos supermercados so produto principalmente de tcnicas de propagao vegetativa "in vitro". A partir de clulas de um morangueiro, faz-se uma cultura de tecidos e, a partir desta, obtm-se plantas adultas. Essas tcnica permite, por exemplo, a eliminao de infeces virais presentes na planta-me e que, pelo procedimento tradicional, seriam passadas para as plantas-filhas. Com base nessa informao, julgue os itens adiante. (1) As plantas obtidas de uma mesma cultura de tecidos so geneticamente iguais. (2) Uma vantagem dessa tcnica que as plantas produzidas no so suscetveis ao ataque de pragas. (3) A cultura de tecidos vegetais facilita o melhoramento

e) I, II, III, IV e V. Questo 1313 Sobre a clonagem de seres e a criao de organismos geneticamente modificados (transgnicos), considere as quatro afirmaes seguintes. I. A clonagem de organismos tem se voltado mais para os animais porque, com relao s plantas, ela j conhecida e utilizada h certo tempo, inclusive na agricultura. II. Tanto nos clones quanto nos transgnicos, a crtica recai sobre o fato de que no se sabe se os genes introduzidos iro se expressar exatamente como no organismo doador ou se iro ativar tambm alguns genes inativos do genoma do organismo receptor. III. Ecologicamente, em uma cadeia alimentar, a existncia de clones apenas aumenta o nmero de representantes de um determinado nvel trfico. No caso dos transgnicos, pode haver tambm alterao de posies e de elementos na cadeia. IV. Um grande inconveniente entre a clonagem e a produo de transgnicos que ambas no permitem sobreposio, ou seja, no foi possvel, at o momento, criar um clone transgnico. Esto corretas: a) I e II. b) I e III. c) I e IV. d) II e III. e) III e IV. Questo 1314 Um pesquisador precisa obter clulas-tronco para iniciar experimentos em terapia gnica. Aponte a alternativa que relaciona o procedimento e a justificativa corretos para que tal pesquisador tenha sucesso. a) Obter clulas-tronco de embries em fase de gstrula em vez de obt-las da blstula, quando ainda no possvel conseguir clulas to indiferenciadas. b) Trabalhar apenas com embries em vez de organismos adultos, uma vez que em adultos no existem clulas-tronco. c) Conseguir clulas germinativas do ovrio de uma fmea

adulta pois, ali, elas esto menos diferenciadas do que as clulas germinativas nos testculos de um macho adulto. d) Optar pela obteno das clulas do cordo umbilical de recm-nascidos em vez de obt-las da fase de gstrula, j que no cordo a diferenciao menor e o nmero de clulas, maior. e) Obter clulas do embrio em fase de blstula, quando a indiferenciao maior, em vez de obt-las da gstrula ou do cordo umbilical, quando as clulas j esto mais diferenciadas. Questo 1315 No filme "Jurassic Park", de Steven Spielberg, cientistas retiraram do intestino de insetos hematfagos fsseis molculas de DNA de dinossauros. A reconstituio dessas molculas teria sido feita atravs da insero de fragmentos de DNA de r. Apesar da eficincia proposta no filme, na prtica esse procedimento extremamente improvvel porque: a) seria necessrio encontrar um genoma completo e conhecer sua ordem nos cromossomas. b) a composio qumica do DNA dos dinossauros diferente das encontradas em espcies atuais. c) as caractersticas do organismo se devem estrutura primria das protenas e no do DNA. d) o DNA coletado sofre mutaes durante o perodo em que ficou fossilizado. e) no existem tcnicas para a insero de fragmentos de DNA de uma espcie em outra. Questo 1316 A Embrapa possui uma linhagem de soja transgnica resistente ao herbicida IMAZAPIR. A planta est passando por testes de segurana nutricional e ambiental, processo que exige cerca de trs anos. Uma linhagem de soja transgnica requer a produo inicial de 200 plantas resistentes ao herbicida e destas so selecionadas as dez mais "estveis", com maior capacidade de gerar descendentes tambm resistentes. Esses descendentes so submetidos a doses de herbicida trs vezes superiores s aplicadas nas lavouras convencionais. Em seguida, as cinco melhores so separadas e apenas uma delas levada a testes de segurana. Os riscos ambientais da soja transgnica so pequenos, j que ela no tem possibilidade de cruzamento com outras plantas e o perigo de polinizao
295

cruzada com outro tipo de soja de apenas 1%. A soja transgnica, segundo o texto, apresenta baixo risco ambiental porque a) a resistncia ao herbicida no estvel e assim no passa para as plantas-filhas. b) as doses de herbicida aplicadas nas plantas so 3 vezes superiores s usuais. c) a capacidade da linhagem de cruzar com espcies selvagens inexistente. d) a linhagem passou por testes nutricionais e aps trs anos foi aprovada. e) a linhagem obtida foi testada rigorosamente em relao a sua segurana. Questo 1317 Os transgnicos vm ocupando parte da imprensa com opinies ora favorveis ora desfavorveis. Um organismo ao receber material gentico de outra espcie, ou modificado da mesma espcie, passa a apresentar novas caractersticas. Assim, por exemplo, j temos bactrias fabricando hormnios humanos, algodo colorido e cabras que produzem fatores de coagulao sangnea humana. O belga Ren Magritte (1896-1967), um dos pintores surrealistas mais importantes, deixou obras enigmticas. Caso voc fosse escolher uma ilustrao para um artigo sobre os transgnicos, qual das obras de Magritte, a seguir, estaria mais de acordo com esse tema to polmico?

I. Animal transgnico aquele que recebe e incorpora genes de outra espcie. II. As substncias utilizadas para isolar o gene a ser transplantado so denominados ENZIMAS TRANSGNICAS. III. Para a ligao do DNA transplantado ao DNA hospedeiro a clula utiliza a ENZIMA LIGASE. IV. A tcnica do DNA recombinante foi utilizada para obteno de Tracy. Esto corretas apenas as afirmativas: a) II e III. b) I, II e III. c) I, II e IV. d) I, III e IV. e) II, III e IV. Questo 1319 Uma planta de fumo foi produzida a partir de uma clula de fumo que havia recebido o gene responsvel pela bioluminescncia dos vaga-lumes. Quando essa planta foi regada com a substncia que o vaga-lume usa para produzir luz, ela comeou a brilhar. A planta de fumo e a tcnica utilizada para obt-la so denominadas, respectivamente, a) mutante e tcnica de miscigenao. b) mutante e tcnica de clonagem. c) mutante e tcnica do DNA-recombinante. d) transgnica e tcnica do DNA-recombinante. e) transgnica e tcnica de clonagem. Questo 1320 Analise as informaes abaixo: I. Pense na batata (ou qualquer outra planta) como uma fbrica que produz a mesma substncia (protena, amido, etc.). O catlogo com a receita para a produo dessas substncias est no genoma, ou seja, no seu patrimnio gentico. II. Suponha que voc queira tomar a fbrica inexpugnvel aos ataques de insetos, mas o catlogo no possui a receita para isso. Uma sada consultar os catlogos de outras espcies. A bactria 'Bacillus thuringiensis' (Bt) contm um gene que leva produo de uma enzima capaz de digerir o
296

1.5.15.2

Questo 1318 "Tracy uma ovelha transgnica, capaz de produzir uma protena humana cuja deficincia causa problema heptico e pulmonar". Analise as afirmativas a seguir, referentes tcnica utilizada para obteno da Tracy.

intestinos dos insetos. A engenharia gentica tem ferramentas bioqumicas para tirar cpias dessas pginas do genoma. III. Agora, preciso transferir esse gene para o genoma da batata. A biotecnologia j encontrou bactrias ou vrus capazes de fazer essa transferncia, isto , incluir o gene no genoma da batata. IV. Quando uma clula meristemtica for geneticamente modificada, ela poder de transformar numa planta adulta que produzir a toxina Bt. V. A planta inteira ficar impregnada com a toxina. O besouro ou a lagarta que se alimentar dela morrer, pois a toxina digere o intestino desses animais. VI. Segundo os biotecnlogos, a toxina Bt inofensiva aos seres humanos, cujos intestinos no oferecem condies para ela se manifestar. Aps a anlise das informaes acima, tiradas do jornal de "Folha de S. Paulo" de 03/07/1999, assinale a alternativa correta. a) A batata geneticamente modificada um alimento transgnico porque recebeu um genoma completo da bactria, o que lhe conferiu resistncia ao ataque de predadores. b) A batata passou a ser um alimento transgnico porque foi cruzada com gametas oriundos da bactria. c) A batata geneticamente modificada um alimento transgnico porque recebeu parte do genoma de uma outra espcie, o que lhe conferiu resistncia ao ataque de predadores. d) A batata passou a ser uma alimento geneticamente modificado, constituindo, a partir do cruzamento com a bactria, uma nova espcie. e) Podemos confiar na palavra dos biotecnlogos quando afirmam "A toxina Bt inofensiva aos seres humanos", pois sabemos que o genoma humano homogneo, e com certeza no haver ser humano sensvel ao biodigestora da toxina. Questo 1321 A introduo de uma cpia de um gene humano no genoma do proncleo masculino de um zigoto originou uma ovelha transgnica. Se essa ovelha for cruzada com um macho no-transgnico, que porcentagem de descendentes portadores do gene humano espera-se obter? a) Zero.

b) 25 %. c) 50 %. d) 75 %. e) 100 %. Questo 1322 A engenharia gentica possibilitou a introduo do gene humano para a produo da insulina em bactrias. Essas bactrias so consideradas a) puras. b) clones. c) mutantes. d) transgnicas. Questo 1323 As questes ambientais tm sido motivo de preocupao sobretudo para as ltimas geraes. A qualidade do ar e a importncia da preservao da biodiversidade constam da pauta das discusses da humanidade h muito tempo. As alternativas a seguir apresentam algumas atividades sugeridas para a melhoria da qualidade de vida humana e da sade ambiental. Assinale aquela que contm conceitos e informaes cientficas s disponveis aos jovens, na ltima dcada do sculo XX. a) Associar o desenvolvimento socioeconmico de cada regio s suas caractersticas de relevo, ao tipo de populao e s suas riquezas naturais. b) Cultivar espcies com crescimento rpido e utilizar esses conhecimentos para planejar plantaes economicamente viveis. c) Estudar a dinmica de crescimento e de regenerao natural das florestas tropicais. d) Introduzir nas clulas de uma planta, genes de uma outra espcie, fazendo com que os novos genes sejam incorporados a seus cromossomos. e) Imobilizar o gs carbnico tanto pelo processo de fotossntese como por meio da fabricao de mveis. Questo 1324 Recentemente foi noticiada a criao de uma planta transgnica, capaz de produzir hemoglobina. Para que isso fosse possvel, essa planta recebeu: a) os anticdons que determinam a seqncia de
297

aminocidos nessa protena. b) os ribossomos utilizados na produo dessa protena. c) o fragmento de DNA, cuja seqncia de nucleotdeos determina a seqncia de aminocidos da hemoglobina. d) O RNAm que carrega os aminocidos usados na sntese de hemoglobina. e) somente os aminocidos usados nessa protena. Questo 1325 Atualmente, os alimentos transgnicos representam um tema de grande discusso. A esse respeito, considere as seguintes afirmaes. I - Trata-se de alimentos fabricados com produtos geneticamente modificados. II - Pode-se gerar um animal transgnico que tenha a capacidade de produzir maior quantidade de leite com menor taxa de gordura. III - No se sabe quais sero as possveis conseqncias da ingesto desses alimentos. IV - Os ecologistas temem que as plantas transgnicas possam afetar o equilbrio ecolgico. Esto corretas: a) I, II, III e IV. b) I, II e IV, apenas. c) II e III, apenas. d) I e III, apenas. e) II, III e IV, apenas. Questo 1326 Atualmente, poucos assuntos geram tanta controvrsia como os produtos transgnicos. Esta interferncia do homem na natureza se d por meio da engenharia gentica. Sobre este tema, destaque a afirmao correta: a) O objetivo dos cientistas criar novas espcies, aumentando a produtividade e minimizando, por conseqncia, o uso de herbicidas. b) A aplicao da engenharia gentica nos alimentos teve origem em pases do terceiro mundo, que apresentam uma grande incidncia de pragas na agricultura. c) Modificar um organismo geneticamente significa cruzar espcies diferentes, para se obter uma espcie nova que no ocorre naturalmente. d) A modificao gentica dos alimentos consiste na

transferncia de material hereditrio de um organismo para outro receptor, gerando novas combinaes genticas. e) Os ambientalistas defendem o uso da engenharia gentica pois os seus efeitos so totalmente previstos e controlados, no trazendo perigos para a humanidade. Questo 1327 As tcnicas de manipulao gentica, utilizadas para a obteno de seres transgnicos, permitiram a criao do primeiro produto transgnico de grande impacto na agricultura: a soja resistente a um potente herbicida, o "round-up". Com o uso dessa variedade, as tcnicas de controle de pragas nas culturas de soja sofreram mudanas e os custos de produo diminuram. A transferncia de genes bacterianos para o genoma de uma planta amplamente cultivada e usada na alimentao animal e humana vem gerando, porm, questionamentos de cunho poltico, cientfico e filosfico. Esses questionamentos justificam-se porque a) o custo dos transgnicos ser certamente maior do que o dos produtos convencionais. b) todos os pases passaro a produzir soja, prejudicando os atuais exportadores. c) no se conhecem os efeitos que os transgnicos podem ter na sade das pessoas. d) eliminando-se as pragas da lavoura, muitas cadeias alimentares desaparecero, beneficiando o meio ambiente. e) os transgnicos simplificaro muitas cadeias alimentares, eliminando todos os competidores do homem e dos animais que ele cria. Questo 1328 A engenharia gentica causou uma revoluo na biotecnologia. Atualmente, diversos produtos biotecnolgicos esto sendo comercializados, juntamente com produtos obtidos por meios tradicionais. Considere os quatro exemplos abaixo: I. batata resistente a viroses II. insulina humana para uso de diabticos III. milho resistente a insetos IV. soja tolerante a herbicidas Desses produtos, derivam exclusivamente de engenharia
298

gentica SOMENTE a) I e II b) III e IV c) I, II e III d) I, III e IV e) II, III e IV Questo 1329 Obtiveram-se plantas transgnicas com as seguintes caractersticas: I. tomateiros cujos frutos passam mais tempo amadurecendo no p, tornando-se mais saborosos; II. algodoeiros cujas folhas se tornaram impalatveis para a herbivoria; III. ps de milho cujas sementes produzem hormnios de crescimento humano. Toda essas plantas so teis para a espcie humana, entretanto, interferncia na composio da diversidade local de insetos ocorre SOMENTE com a) I b) II c) III d) I e II e) I e III Questo 1330 Sementes transgnicas podem levar produo de plantas resistentes a inseticidas, a insetos e a vrus, ou ento com melhores qualidades nutritivas, o que aumenta e barateia a produo, favorecendo a populao mundial. H, porm, outras conseqncias que o seu cultivo pode acarretar entre as quais esto: I. a possibilidade de transmitir seus genes de resistncia a plantas de espcies aparentadas. II. a possibilidade de afetar insetos e outros animais do ecossistema. III. a necessidade de uso mais intenso de agrotxicos. H desvantagens SOMENTE em a) I b) II c) III

d) I e II e) II e III Questo 1331 Os alimentos geneticamente modificados so uma realidade cotidiana. H gros transgnicos usados no preparo de bolachas, cereais, leo de soja, pes, massas, maionese, mostarda e papinhas para crianas. ("Veja", ed. 1886, ano 36. n. 43. So Paulo: Abril. p. 100) Foram feitas as seguintes afirmaes sobre organismos geneticamente modificados: I. Um transgnico possui em seu genoma um ou mais genes provenientes de outra espcie. II. possvel que haja polinizao entre uma planta transgnica com outras de uma mesma espcie, no transgnicas. III. O processo de insero de genes de uma espcie em outra realizado com a ajuda de enzimas de restrio. Est correto o que se afirma em a) I somente. b) II somente. c) I e II somente. d) II e III somente. e) I, II e III. Questo 1332 A charge a seguir foi produzida num momento em que no Brasil se discutem as possveis vantagens e desvantagens da liberao do plantio e comercializao de plantas transgnicas.

1.5.15.2

299

(Jornal da "Cincia" - Edio 515, em 10 de outubro de 2003.) Analisando-se a charge de acordo com os atuais conhecimentos biolgicos, CORRETO afirmar: a) O que no faz mal para o homem no far mal para os insetos. b) As plantas transgnicas so perigosas para a sade animal. c) O que no bom para os insetos pode no ser bom para os homens. d) Se os insetos experimentarem, o homem poder experimentar, pois a ingesto da planta no lhe far mal. Questo 1333 "Muito se tem falado sobre os transgnicos e praticamente todo mundo tem alguma opinio sobre o assunto. Mas, este tema no pode progredir na base do ser contra ou a favor, porque suas implicaes so muito srias. Nenhum cientista deixa de reconhecer o poder da tecnologia do DNA. O problema est em algumas de suas aplicaes, implicaes e incertezas. Isto envolve a natureza, a sade humana e a economia." ("Revista Galileu", Nov/2003) Sobre os OGM (organismos geneticamente modificados), correto afirmar: a) OGM so produtos obtidos pela transferncia de gene entre espcies similares ou diferentes, podendo misturar o DNA de microorganismos, de plantas, de animais e do homem. b) Os defensores dos OGM enumeram a capacidade de aumento da produtividade agrcola, reduo do uso de agrotxicos, tornar os alimentos mais nutritivos e saudveis e criar novos tipos de terapias e medicamentos, favorecendo toda populao mundial. c) A bactria 'Bacillus thuringiensis' (Bt) um agente de controle biolgico encontrado no solo, que produz uma toxina contra lagartas. A transferncia do gene Bt para as variedades de milho, algodo, fumo, batata e soja, as torna resistentes a certos tipos de insetos, alm de mais nutritivos. d) Vrios tipos de alimentos, como gros, leite e ovos, alm de servirem para a alimentao, podem ser usados para produzir remdios, produtos qumicos, plsticos e combustveis, oportunizando melhores condies ambientais e sociais, regulamentados pelas normas de biossegurana.

e) A poluio gentica, a perda de biodiversidade, o surgimento de ervas daninhas resistentes a herbicidas, o aumento do uso de agrotxicos e a perda da fertilidade natural do solo, so os principais riscos ambientais, porm o uso dos OGM tornaria os pequenos agricultores independentes em relao s empresas fornecedoras de sementes. Questo 1334 O primeiro organismo transgnico foi obtido por volta de 1981, quando genes de coelhos foram injetados em ovos de camundongos que se desenvolveram no tero de fmeas dessa espcie. Os camundongos que nascidos desses ovos apresentaram hemoglobina de coelho em suas hemcias, porque: a) RNA mensageiro do coelho injetado no ovo passou a conduzir a sntese de protenas nessa clula. b) DNA do coelho injetado no ovo se incorporou a um cromossomo e foi transmitido de clula a clula atravs de mitoses. c) DNA do coelho injetado no ovo foi transcrito para o RNA ribossmico que conduziu a sntese de protenas nessa clula. d) RNA mensageiro do coelho injetado no ovo se incorporou a um cromossomo e foi transmitido de clula a clula atravs de mitoses. e) DNA do coelho injetado no ovo se incorporou a um cromossomo e passou a conduzir a sntese de protenas nessa clula. Questo 1335 Em revistas e em jornais, so constantes e cada vez mais freqentes os noticirios sobre o uso de tecnologia transgnica com fim de obter protenas de ao farmacolgica ou mesmo protenas teraputicas humanas. A tcnica de obteno de organismos transgnicos produtores de protenas humanas consiste em: a) remover artificialmente alguns nucleotdeos de uma molcula de DNA, alterando assim o cdigo gentico do organismo. b) retornar uma clula diferenciada ao estgio de indiferenciada, que gera um novo organismo por multiplicao.
300

c) induzir clula somtica, que porta a totalidade do genoma, a reativar os seus genes e gerar um novo ser. d) introduo de um ou mais genes interessantes de uma espcie em clula hospedeira, de maneira a integrar o material gentico. e) mtodos biotecnolgicos de cruzamentos seletivos para obteno de novas espcies. Questo 1336 Responder questo a seguir com base na ilustrao.

e) no expressou o gene do vaga-lume. Questo 1338 Em um experimento, foram introduzidos certos genes da hidra em ovos de planria. Desses ovos, desenvolveram-se vermes portadores de tentculos e de cnidoblastos com filamento urticante. Das clulas de vermes adultos, foram isoladas molculas de RNA e de protena da hidra. Com relao a esse experimento, NO correto afirmar que a) os genes da hidra se expressaram na planria. b) segmentos de DNA da hidra apresentaram capacidade de replicao durante a embriognese da planria. c) os genes da hidra apresentaram transcrio no organismo da planria. d) ocorreu traduo do cdigo gentico da hidra no organismo da planria. e) a hidra e a planria nele utilizadas so organismos transgnicos. Questo 1339

1.5.15.2

travs da tcnica, da gentica atual, representada na ilustrao, seria possvel produzir um rato a) sinttico. b) hbrido. c) clonado. d) transplantado. e) transgnico. Questo 1337 No vaga-lume h um gene que determina produo de luciferase, enzima responsvel pela oxidao da substncia luciferina, levando produo de luz. Atravs da engenharia gentica, esse gene foi transferido para uma clula vegetal e, a partir desta, obteve-se uma planta inteira. Aps ser regada com soluo de luciferina, a referida planta comeou a emitir luz. O resultado desse experimento indica que a planta a) incorporou um segmento de RNA do vaga-lume, a partir do qual as clulas da planta produziram RNA e luciferase. b) incorporou um segmento de RNA do vaga-lume, a partir do qual as clulas da planta produziram DNA e luciferase. c) incorporou um segmento de DNA do vaga-lume, que possibilitou s clulas da planta a produo de luciferase. d) incorporou um segmento de DNA do vaga-lume, que no possibilitou a produo de RNA e nem de luciferase.

A tira de quadrinhos a seguir faz referncia manipulao de genes em laboratrio.

1.5.15.2

Se esse tipo de experimento realmente fosse concretizado, poder-se-ia afirmar que a) o elefante e o vaga-lume so organismos transgnicos. b) apenas o vaga-lume um organismo transgnico. c) uma seqncia de RNA do vagalume foi transferida para clulas do elefante. d) o gene do vaga-lume controlou a produo de RNA e de protena no interior das clulas do elefante. e) uma seqncia de DNA do elefante sofreu mutao devido introduo do gene do vaga-lume em clulas daquele mamfero.
301

Questo 1340 Recentemente, foram constatados casos de transporte de plen de espcies de canola transgnica para plantas silvestres (ervas daninhas). Estas passaram a apresentar a caracterstica da canola transgnica, ou seja, alto poder de resistncia a herbicidas. Sobre esse fato, INCORRETO afirmar que a) as espcies de canola so transgnicas pois expressam genes que incorporaram de outras espcies. b) o plen da canola transgnica transportou material gentico para plantas silvestres. c) as espcies silvestres incorporaram e expressaram material gentico da canola transgnica. d) o RNA da canola transgnica foi transferido e incorporado ao genoma das ervas daninhas, tornando-as resistentes a agentes qumicos. e) as ervas daninhas passaram a produzir protenas da canola transgnica. Questo 1341 As tcnicas modernas de biologia molecular tm permitido a insero de segmentos novos de DNA em clulas vegetais, em crescimento no meio apropriado, para gerar uma nova planta com novas caractersticas. Estes novos segmentos de DNA introduzidos podem, por exemplo, gerar novas plantas com reservas modificadas de lipdios, amido e protenas em suas sementes ou melhorar a resistncia das plantas a pestes e vrus ou ainda aumentar a sobrevivncia destes organismos em ambientes adversos. Estas novas plantas so exemplos de organismos criados por engenharia gentica e so genericamente conhecidos como: a) reversos b) recessivos c) dominantes d) transgnicos Questo 1342 Para a clonagem em bactrias do hormnio do crescimento humano a partir de seu RNA mensageiro, inicialmente necessrio que sejam sintetizadas em laboratrio cpias em DNA desse RNA. As cpias, aps introduzidas em plasmdios, sero expressas em culturas de bactrias

contendo os plasmdios modificados. Essas cpias de DNA so sintetizadas em laboratrio com o auxlio de uma preparao da enzima denominada de: a) RNA replicase b) RNA polimerase c) desoxirribonuclease d) transcriptase reversa Questo 1343 A enzima EPSP-sintase, presente em praticamente todos os vegetais, modificada na soja transgnica, tornando-a resistente inibio pelo herbicida glifosato. Assim, o tratamento com esse herbicida no prejudica o desenvolvimento de culturas de soja transgnica, mas evita o crescimento de outros vegetais indesejveis. Num estudo para a identificao da variedade transgnica de soja, foi medida, nas mesmas condies experimentais, a atividade da EPSP-sintase em extratos de folhas de diferentes tipos desse vegetal, em presena ou ausncia de glifosato. As atividades da enzima nesses extratos, na ausncia do inibidor, apresentaram o mesmo valor. Observe o grfico:

1.5.15.2

A curva que corresponde razo entre as atividades de uma enzima da variedade transgnica e as atividades dessa mesma enzima da soja comum a indicada pela seguinte letra: a) W b) X c) Y d) Z Questo 1344 Considere o texto a seguir: "Os alimentos transgnicos, produtos que sofreram
302

alterao gentica com o objetivo de melhorar a qualidade, j ocupam prateleiras dos supermercados nos Estados Unidos e Canad, mas o consumidor no sabe disso: no h lei que obrigue os fabricantes a informar que o produto sofreu alterao gentica. No Brasil, onde tambm no h obrigao de alertar o consumidor, a multinacional Monsanto est tentando conseguir autorizao do Ministrio da Cincia e Tecnologia para produzir soja transgnica no pas. Os benefcios [advindos de plantas transgnicas], porm, podem esconder riscos ainda no esclarecidos [...], pois os resultados das experincias podem ser imprevisveis. At o momento, o resultado mais trgico do uso de produtos transgnicos surgiu no Japo em 1989: 5000 pessoas ficaram doentes, 1500 se tornaram permanentemente invlidas e 37 morreram". (FOLHA DE SO PAULO, 6 de agosto de 1998). Pela leitura do texto anterior, pode-se concluir, corretamente, que: a) toda planta transgnica produz substncias altamente txicas ao ser humano. b) plantas transgnicas so aquelas cujos fentipos se devem mais ao ambiente do que aos genes. c) manipulaes genticas podem alterar o funcionamento dos genes naturais de um organismo. d) as tcnicas de transferncia de genes por engenharia gentica so altamente seguras. e) todas as plantas transgnicas so estreis a partir da segunda gerao mutante. Questo 1345 Pesquisadores de alguns centros de pesquisa brasileiros, utilizando tcnicas de engenharia gentica, obtiveram, recentemente, plantas que produzem protenas humanas, entre as quais o hormnio do crescimento (GH). Estas plantas so chamadas transgnicas. Considere estas informaes e assinale a opo incorreta: a) O gene para a produo de GH , em geral, introduzido no plasmdeo antes de sua introduo na clula vegetal. b) a utilizao de clulas vegetais diminui a possibilidade de contaminao humana por vrus animais. c) Antes de se obter a planta produtora de GH necessria a produo do DNA recombinante. d) O RNA mensageiro, relacionado ao GH, quando introduzido na clula vegetal transcrito em DNA na presena da enzima transcriptase vegetal.

e) O DNA relacionado sntese do GH pode ser obtido a partir do RNA mensageiro. Questo 1346 Os cientistas franceses que criaram animal transgnico e o artista brasileiro que fez a encomenda entram em conflito. Criador e artista j disputam a posse da "transcoelha". Eduardo Kac, artista plstico brasileiro e professor de arte e tecnologia em Chicago, batizou de Alba a coelha transgnica que tem uma propriedade peculiar: seus olhos rosados e seus plos brancos ficam fluorescentes quando expostos luz ultravioleta. Para conferir essa caracterstica particular, os pesquisadores criaram um coelho que produz em todas as suas clulas a protena GFP (protena verde fluorescente, na sigla em ingls), presente naturalmente em medusas e que pode ser detectada sob luz ultravioleta.

1.5.15.2

303

daptado de: http://paginas.terra.com.br/educacao/isaacelias/coelha.htm Considerando a tecnologia para obteno de transgnicos, so feitas as seguintes afirmativas: I) A coelha Alba considerada transgnica pois possui em seu genoma um segmento de DNA de medusa. II) Apenas as clulas somticas tiveram o gene que codifica a protena GFP inserido em seu genoma. III) As clulas fluorescentes da coelha produzem RNA mensageiro, que no processo de traduo origina a protena GFP. IV) A coelha transgnica foi produzida a partir da introduo de um ncleo extrado de uma clula de medusa em um vulo de coelha cujo ncleo tenha sido anteriormente removido. Dentre as afirmativas acima, somente esto corretas: a) I e II b) I e III c) I e IV d) II e III e) III e IV Questo 1347 Recentes descobertas tm provocado grande discusso por poderem alterar o futuro do esporte. Nessas pesquisas, foi mostrada a existncia de duas protenas que atuam regulando o crescimento das clulas musculares: o fator de crescimento IGF-1 e a miostatina. O crescimento muscular estimulado pelo fator IGF-1 e limitado pela miostatina. A partir desse conhecimento possvel modular o crescimento muscular por meio de vrios procedimentos. ("Scientific American Brasil", 08/2004) Analise os procedimentos a seguir e aponte aquele que poderia promover o desenvolvimento mais duradouro da massa muscular, em indivduos sedentrios, se executado uma nica vez, sem deixar vestgios detectveis em exames de sangue ou urina. a) Introduzir nas clulas musculares novas cpias de RNA mensageiro que codifica o fator IGF-1. b) Injetar anticorpos produzidos contra a protena miostatina. c) Introduzir nas clulas musculares nova cpia do gene do fator IGF-1, utilizando tcnicas aplicadas em terapia

gnica. d) Injetar a protena miostatina mutada que bloqueia a ao da miostatina normal por competir pelo seu receptor. e) Injetar anticorpos produzidos contra o fator IGF-1. Questo 1348 O arroz dourado - geneticamente modificado - produz -caroteno (vitamina A). Assim sendo, e CORRETO afirmar que o uso desse gro na alimentao humana resulta em benefcio para a sade porque ele a) previne alguns tipos de cegueira. b) aumenta o peristaltismo. c) evita o aparecimento do bocio. d) diminui a formacao de coagulos. Questo 1349 Atravs de tcnicas da biologia celular, o homem tem desenvolvido grandes projetos, como o de transformar clulas de bactrias, para que estas produzam substncias que normalmente no seriam produzidas, tal como a insulina. Sobre este assunto, assinale a alternativa correta. a) As enzimas de restrio hoje conhecidas so produzidas por diversas indstrias multinacionais, a partir de DNA viral. b) Organismos que recebem e manifestam genes de outra espcie so denominados transgnicos. c) As enzimas de restrio agem em seqncias inespecficas de DNA. d) Cromossomos circulares presentes no citoplasma de bactrias, chamados de bacterifagos, so vetores do DNA recombinante. e) Ainda no possvel produzir plantas com genes ativos de insetos. Questo 1350 Analise as proposies a seguir, referentes a diferentes questes de Gentica.

304

afirmativas a seguir, que mostram os objetivos da manipulao gentica das plantas cultivadas. I. Desenvolver variedades de plantas resistentes a herbicidas ou a insetos. II. Desenvolver variedades de plantas que produzam frutos com melhor textura e de amadurecimento lento III. Desenvolver variedades de plantas resistentes a geadas, acidez do solo e escassez de gua. Da anlise das afirmativas acima podemos assegurar que: a) apenas I est correta b) apenas II est correta c) apenas I e II esto corretas d) apenas II e III esto corretas e) I, II e III esto corretas Questo 1352 "A reforma da natureza Em termos de cardpio dirio, preocupao de longo prazo tm os ingleses. Nos ltimos anos, o pas vem consumindo cada vez mais alimentos geneticamente modificados, a chamada comida GM. Esses alimentos (...) tm seu cdigo gentico alterado para ficarem mais viosos ou resistentes a herbicidas e pragas." (Adaptado da revista VEJA, 16/06/99, p.53.) Vegetais modificados geneticamente so considerados transgnicos. Sua obteno se d com a) o cruzamento de duas espcies distintas. b) a incorporao de RNAm na clula zigoto das espcies. c) a seleo de DNA mais adaptado existente numa determinada espcie. d) a introduo de DNA em genomas das clulas dos vegetais j formados. e) a adio de DNA exgero manipulado, da mesma espcie ou de outra espcie no genoma da espcie em estudo. Questo 1353 Escolha a alternativa que apresenta um exemplo de transgenia. a) Incorporao e expresso de gene humano que codifica insulina por bactrias.
305

1.5.15.2

( ) Certos microorganismos podem ser manipulados em laboratrio para incorporarem, em seu material gentico, segmentos do DNA de outro organismo. O DNA recombinante ento obtido pode ser clonado e utilizado, por exemplo, na produo de hormnios para a espcie humana. ( ) No homem, diferentes genes participam do metabolismo dos aminocidos fenilalanina e tirosina, cada um determinando a produo de uma enzima. Se ocorrer uma mutao em um determinado loco, e essa mutao determinar a produo de enzima no-funcional, a pessoa expressar uma anomalia metablica. No caso ilustrado no esquema (figura 1), apresentar fenilcetonria. ( ) Por meios biotecnolgicos, podem ser produzidos anticorpos monoclonais, reconhecidos como altamente especficos. Tais anticorpos podem ser empregados, por exemplo, em testes laboratoriais para a deteco de gravidez em estgios muito precoces. ( ) Se dois pares de genes aditivos determinam a cor da pele no homem, cinco classes fenotpicas podem ser observadas na populao. A probabilidade de uma mulher (AaBb), casada com um homem (aabb), ter, em uma nica gestao, dois filhos, um de fentipo mulato-mdio e o outro de fentipo branco, de 1/16. ( ) Considerando o operon da lactose, de 'Escherichia coli', ilustrado no esquema (figura 2), para ocorrer a transcrio das enzimas codificadas nos genes 2, 3 e 4 (estruturais), necessrio que uma molcula produzida por um gene regulador (x) no reprima o gene operador (1). Questo 1351 Em todo o mundo, plantas transgnicas, como soja, milho, algodo, batata, tomate e muitas outras, j ocupam cerca de 40 milhes de hectares, sendo os principais produtores os Estados Unidos, a Argentina e o Canad. Considere as

b) Desenvolvimento de um organismo completo a partir de uma clula somtica. c) Organismo que apresenta tanto estruturas reprodutoras masculinas quanto femininas. d) Gene que sofreu mutaes, originando mltiplos alelos para um mesmo locus. e) Organismo mais vigoroso, com muitos genes em heterozigose, resultante do cruzamento de duas variedades puras distintas. Questo 1354 Porcos tm sido criados transgenicamente para que seus rgos possam ser transplantados em homens; cientistas desenvolvem ovelhas "auto-tosquiveis", isto , a l cai sozinha no devido tempo; gens de galinha so introduzidos em batatas, deixando os vegetarianos confusos com a perspectiva de cruzar animais com plantas... ("CICLO VITAL", vol. 4, 1999, p.14.) A citao anterior mostra avanos da Engenharia Gentica. Assinale a(s) proposio(es) VERDADEIRA(S) sobre a transgenia e suas implicaes com relao sade e ao meio ambiente. (01) Cientistas interferem na evoluo natural das espcies, alterando geneticamente animais e plantas. (02) Os genes aliengenas permitem ao organismo receptor produzir substncias que nunca produziriam em condies naturais. (04) Os alimentos transgnicos no representam nenhuma ameaa sade humana, e por isso no necessitam ser testados em outras espcies de animais, antes de chegarem ao homem. (08) a produo de insulina, a partir de transferncia de genes humanos para bactrias, que passam, incontinentimente, a produzir esse hormnio, uma das experincias bem sucedidas da transgenia. (16) Os organismos transgnicos so aqueles que recebem segmentos de DNA da mesma espcie. (32) fundamental o estabelecimento de limites, tanto por parte dos cientistas como dos governantes, para que as manipulaes genticas no resultem em impactos ambientais irreversveis.

Questo 1355 Foi transferido para plantas de arroz um gene que permite a produo e o acmulo de vitamina A no gro das plantas transgnicas. Assinale verdadeira (V) ou falsa (F) nas afirmativas a seguir. ( ) As vitaminas so necessrias em grandes quantidades, pois atuam como enzimas. ( ) A vitamina A foi introduzida no ncleo das clulas, por isso o gro transgnico mais nutritivo. ( ) Uma importante fonte natural de vitamina A so os vegetais com pigmentos amarelos, como a cenoura. A seqncia correta a) V - F - V. b) V - V - F. c) V - F - F. d) F - F - V. e) F - V - F. Questo 1356 Acerca dos organismos transgnicos, julgue os itens a seguir. (1) Transgnicos so organismos produzidos com a tecnologia do DNA recombinante, que permite a incluso de genes de organismos de espcies diferentes no genoma de bactrias, plantas e animais. (2) Organismos geneticamente modificados podem ser resistentes a produtos qumicos como herbicidas, ou agir como inseticidas. (3) Os debates atuais a respeito dos transgnicos resumem-se questo da rotulagem, isto , obrigatoriedade da apresentao, na embalagem de alimentos produzidos com tcnicas da biotecnologia, de informao relativa natureza transgnica do produto. (4) As tcnicas de melhoramento gentico tradicionais, como a poliploidizao, podem ser consideradas exemplos de biotecnologia aplicada fabricao de organismos transgnicos.

306

Questo 1357 A engenharia gentica permitiu a introduo, em ratos, do gene humano para produo do hormnio de crescimento, levando produo de ratos gigantes. Estes ratos so considerados a) isognicos. b) transgnicos. c) infectados. d) mutantes. e) clones. Questo 1358 O primeiro transplante de genes bem sucedido foi realizado em 1981, por J.W. Gurdon e F.H. Ruddle, para obteno de camundongos transgnicos, injetando genes da hemoglobina de coelho em zigotos de camundongos, resultando camundongos com hemoglobina de coelho em suas hemcias. A partir destas informaes, pode-se deduzir que a) o DNA injetado foi incorporado apenas s hemcias dos camundongos, mas no foi incorporado aos seus genomas. b) o DNA injetado nos camundongos poderia passar aos seus descendentes somente se fosse incorporado s clulas somticas das fmeas dos camundongos. c) os camundongos receptores dos genes do coelho tiveram suas hemcias modificadas, mas no poderiam transmitir essa caracterstica aos seus descendentes. d) os camundongos transgnicos, ao se reproduzirem, transmitiram os genes do coelho aos seus descendentes. e) o RNAm foi incorporado ao zigoto dos embries em formao. Questo 1359 Com relao tcnica de criao de organismos geneticamente modificados (transgnicos), o caderno Mais! do jornal "Folha de S. Paulo" (07.10.2001) afirmou: "O que torna a tcnica to atrativa e produtora de ansiedade que qualquer gene de qualquer espcie pode ser transferido para qualquer outra espcie". Essa afirmao a) no vlida, se as espcies forem de filos diferentes. b) no vlida, se as espcies forem de classes diferentes.

c) vlida, desde que as espcies sejam do mesmo reino. d) vlida, desde que as espcies sejam da mesma ordem. e) vlida para todas as espcies, independentemente de sua classificao. Questo 1360 "EXAME DE PATERNIDADE, NO BRASIL, J PODE SER FEITO COM SALIVA" "Novo teste pode, pela anlise do DNA das clulas, identificar a paternidade de uma pessoa sem a necessidade de coleta de sangue. Esse tipo de teste particularmente indicado para bebs e crianas pequenas." (O GLOBO, 20/08/98) Nesse tipo de teste, a semelhana estrutural existente entre as molculas de DNA tomada por base para a identificao da paternidade. Essa diferena consiste na(o): a) seqncia de bases nitrogenadas. b) aspecto da dupla hlice presente. c) nmero de fosfatos contidos. d) tipo de pentose existente. e) tipo de desoxirriboses presentes. Questo 1361 CONSRCIO DECIFRA GENOMA DO CHIMPANZ. As diferenas no DNA de humanos e chimpanzs so de apenas 4% dos quase 3 bilhes de bases (letras qumicas A, T, C e G) que compem ambos os genomas. E boa parte dessas modificaes se deu de maneira trivial ao longo dos cerca de 6 milhes de anos transcorridos desde o ancestral comum de ambos, com a mera troca de uma letra num gene, a duplicao de um conjunto de letras qualquer ou a deleo de outro. Quando se olha para os genes em si - isto , os trechos de DNA que se traduzem em alguma funo, como a sntese de protenas -, ns e esses grandes macacos africanos somos 99% iguais. ("Folha de S.Paulo", 01.09.2005) A despeito da similaridade gentica, continua-se considerando que homens e chimpanzs so espcies diferentes, que apresentam caractersticas diferentes. Desse modo, em funo das informaes do texto, pode-se dizer que a maior contribuio para a diferena fenotpica entre essas espcies seja devida
307

a) seqncia de bases nitrogenadas no DNA. b) quantidade de DNA presente no ncleo das clulas desses organismos. c) quantidade de lcus gnicos. d) expresso diferenciada dos genes. e) seqncia de aminocidos das protenas. Questo 1362 O anncio do seqenciamento do genoma humano, em 21 de junho de 2000, significa que os cientistas determinaram a) a seqncia de nucleotdeos dos cromossomos humanos. b) todos os tipos de protena codificados pelos genes humanos. c) a seqncia de aminocidos do DNA humano. d) a seqncia de aminocidos de todas as protenas humanas. e) o nmero correto de cromossomos da espcie humana. Questo 1363 Os projetos genomas, que esto sendo desenvolvidos em centros de pesquisas de vrios pases, empenham-se no momento em descobrir a) a interao dos genes. b) a expresso dos genes, isto , como eles agem. c) a seqncia exata de nucleotdeos de cada gene. d) quais nucleotdeos servem de molde para a sntese de RNAm. e) como ocorrem a duplicao e as mutaes dos nucleotdeos. Questo 1364 Pelo Projeto Genoma Humano, a humanidade viver uma nova era, a era da gentica. Pelas pesquisas realizadas at hoje no Projeto Genoma Humano, possvel, EXCETO: a) selecionar embries com caractersticas desejveis. b) compreender mecanismos que tornam uma clula imortal. c) garantir a cura de todas as patologias humanas. d) descobrir novos genes com funes ainda desconhecidas. Questo 1365 Nos ltimos dez anos, o seqenciamento do DNA revolucionou a cincia e gerou novos conhecimentos sobre seres procariotos e eucariotos, inclusive permitiu o

estabelecimento de comparaes genmicas com o intuito de analisar quais genes so tpicos de um organismo e quais foram perdidos no processo evolutivo. Em um laboratrio, realizou-se um experimento com a bactria 'Mycoplasma genitalium', que possui apenas 470 genes, com o intuito de verificar se todos esses genes eram essenciais para a sobrevivncia dessa espcie.

1.5.15.3

Sobre esse experimento, foram feitas algumas afirmaes. I. Quando um transposon inserido aleatoriamente dentro de um gene, capaz de inativ-lo. II. No experimento I, o crescimento demonstra que o gene A no essencial. III. No experimento II, a ausncia de crescimento significa que o gene B essencial. IV. Se cada gene pode ser inativado por mutao, o genoma mnimo essencial pode ser determinado. V. A bactria 'M. genitalium' sobrevive sem utilizar alguns de seus genes. So afirmaes CORRETAS: a) I, II, III, IV e V. b) I, II, IV e V apenas. c) II, IV e V apenas. d) I e III apenas. Questo 1366 "O genoma humano foi mapeado e sua seqncia estabelecida pela primeira vez na histria da humanidade, anunciaram ontem o presidente norte-americano, Bill Clinton, o primeiro ministro britnico, Tony Blair, e os representantes dos grupos rivais, o consrcio pblico internacional Projeto Genoma Humano (PGH) e a empresa norte-americana Celera." "Folha Cincia", So Paulo - 27/6/2000.
308

Leia as proposies a seguir sobre o Projeto Genoma Humano. I - O seqenciamento do genoma humano possibilitar a identificao dos genes envolvidos em doenas e a criao de novas abordagens preventivas ou de tratamentos mais rpidos e eficazes. II - O genoma humano pode ser seqenciado a partir de qualquer clula do corpo, com exceo das hemcias. III - O seqenciamento do genoma humano determinou a posio exata e a funo de cada gene, possibilitando a melhor compreenso dos diferentes fentipos. IV - O seqenciamento do genoma de outras espcies, como o das bactrias ('Xylela fastidiosa'), dos camundongos e ratos, de grande auxlio para o Projeto Genoma Humano. Considerando as proposies anteriores, pode-se afirmar que esto CORRETAS a) apenas I e II. b) apenas II e III. c) apenas I, III e IV. d) apenas I, II e IV. e) todas as proposies. Questo 1367 Em um acidente, embora os corpos das vtimas fatais fiquem queimados e irreconhecveis, foi possvel preparar, a partir de fragmentos de tecidos, amostras de DNA nuclear e mitocondrial de todos os mortos. Faleceram no acidente dois filhos de uma senhora, cada um de um casamento diferente. Uma das formas possveis de identificar os despojos dos filhos dessa senhora consiste em verificar se existe homologia do: a) DNA mitocondrial da senhora com o DNA mitocondrial das vtimas b) DNA mitocondrial da senhora com o DNA nuclear das vtimas c) DNA nuclear do marido e do ex-marido da senhora com o DNA mitocondrial das vtimas d) DNA mitocondrial do marido e do ex-marido da senhora com o DNA mitocondrial das vtimas e) DNA nuclear da senhora com o DNA mitocondrial das vtimas

Questo 1368 Os avanos da Engenharia Gentica tm permitido o conhecimento mais amplo dos cromossomos. Sobre este tema, analise os itens abaixo. ( ) O mapeamento gnico de um indivduo permite informar se ele portador ou no de genes causadores de doenas. ( ) O teste de paternidade com base no DNA deve ser realizado exclusivamente em indivduos sem doenas sangneas, como a hemofilia. ( ) O Projeto Genoma visa a localizar, nos cromossomos humanos, todas as quebras provocadas pela radiao solar. ( ) O gene para produo de insulina no homem pode ser clonado em bactrias que passam a produzir este hormnio. Questo 1369 Os avanos na rea da biotecnologia permitiram melhores condies de assistncia sade humana e animal, especialmente no que se refere produo de antibiticos, vacinas, hormnios e outros insumos teraputicos. Na fase laboratorial, o mtodo de produo do hormnio do crescimento envolve diretamente a) o seqenciamento de DNA. b) a clonagem de clulas. c) o DNA recombinante. d) a hibridizao de DNA. e) a sonda de DNA. Questo 1370 "A nova tecnologia do DNA recombinante est permitindo que cientistas dos pases do primeiro mundo desenvolvam um projeto denominado GENOMA, que tem por objetivo seqenciar os cerca de 3 bilhes de bases nitrogenadas que compem os cromossomos de um ser humano. Ao lado dos inmeros benefcios desse projeto, algumas questes de cunho tico tm sido levantadas." ("Cincia Hoje", maro/93) Em relao a esse projeto, o procedimento que pode afetar diretamente o equilbrio gentico de populaes humanas a) a deteco de indivduos superdotados intelectualmente por meio de procedimentos laboratoriais.
309

b) o aumento de seleo gentica ou gamtica artificial. c) o emprego de testes genticos como um novo critrio para admisso a empregos. d) o registro de patentes de seqncias do genoma humano para especulao mercadolgica. e) o uso de testes pr-sintomticos para a realizao de seguros de vida. Questo 1371 Alguns projetos de seqenciamento genmico vm sendo desenvolvidos por pesquisadores brasileiros. Um deles, por exemplo, envolveu a bactria causadora da "praga do amarelinho", que atinge plantas ctricas. Paralelamente, o seqenciamento completo do genoma humano foi anunciado pela comunidade cientfica internacional. Todas as alternativas apresentam benefcios de projetos que envolvem o seqenciamento de genomas, EXCETO a) Aumento da produtividade na agricultura b) Compreenso mais ampla das doenas genticas c) Determinao da posio de protenas nos cromossomos d) Diagnstico precoce de doenas hereditrias Questo 1372 Na Argentina, durante a ditadura militar iniciada em 1976, muitas crianas foram seqestradas com seus pais ou nasceram em centros clandestinos de deteno. Essas crianas foram adotadas, vendidas ou abandonadas em orfanatos. A Associao Civil "Avs da Praa de Maio" tem buscado localizar essas crianas com a finalidade de restitu-las a suas famlias legtimas, empregando para isso testes de identificao gentica, que so possveis, atualmente, mesmo na ausncia dos pais. (Fonte: abuelasatournet.com.ar) A comparao entre os DNAs mitocondriais de possveis netos e avs tem sido um dos testes utilizados nesses processos de identificao de parentesco. A escolha desse teste est relacionada com o fato a) de o DNA mitocondrial, por ser herdado da av materna, atravs das mitocndrias existentes no citoplasma do ovcito da me, permitir traar rvores familiares confiveis. b) de o DNA mitocondrial, por ser herdado das duas avs, atravs de uma mistura dos genes do pai e da me, garantir

um registro familiar que se mantm de gerao a gerao. c) de o DNA mitocondrial, por ser herdado da av paterna, atravs das mitocndrias existentes no citoplasma do ovcito da me, permitir traar rvores familiares confiveis. d) de o DNA mitocondrial, por ser herdado do av materno, atravs das mitocndrias existentes no citoplasma do ovcito da me, permitir traar rvores familiares confiveis. e) de o DNA mitocondrial, por ser herdado do av paterno, atravs das mitocndrias existentes no citoplasma do espermatozide do pai, permitir identificar a filiao com segurana. Questo 1373 Maria teve um filho e Pedro, seu ex-namorado, nega a paternidade da criana, alegando que o filho pode ser de Paulo (irmo de Pedro), ou de Joo (primo de Pedro), ou ainda de um vizinho, Antnio. Para solucionar esse impasse, a famlia de Maria resolveu fazer um teste de paternidade, e o resultado foi o seguinte.

1.5.15.3

Assinale a alternativa que interpreta corretamente os resultados do teste. a) A criana no filha de nenhum dos supostos pais, pois todos os resultados foram menores que 85%. b) A criana filha de Pedro, pois, aproximadamente, 50% dos genes so herdados da me e 50%, do pai. c) A criana filha de Joo, pois, para se hibridizarem, os DNAs devem ser diferentes. d) O teste no foi conclusivo, pois deveramos ter hibridizado o DNA do pai com o da me. e) Pedro e Paulo so, na verdade, irmos adotivos.

310

Questo 1374 Na dcada de 1960, Georges Barsky desenvolveu a tcnica de hibridizao somtica, que se constitui em um grande passo no mapeamento de genes humanos. Duas clulas de origem diferente podem se fundir em uma nica clula hbrida, que contm cromossomos das duas espcies. A tabela abaixo contm uma grade hipottica de dados usados para mapear genes em seus cromossomos humanos apropriados. Trs linhagens somticas hbridas designadas I, II e III foram registradas para a presena ou ausncia dos cromossomos humanos 1 at 8, bem como pela sua habilidade em produzir as protenas humanas hipotticas A, B, C e D

quando o seqenciamento realizado a partir de RNA mensageiro, identifica-se mais facilmente um gene. II - O genoma humano tem organizao diferente da organizao do genoma da bactria 'Xyllela fastidiosa', causadora da praga do amarelinho nos laranjais, recentemente seqenciado no Brasil. III - A expresso dos genes humanos depende da presena, ou ausncia, de cada gene no DNA de clulas diferenciadas. Quais esto corretas? a) Apenas I. b) Apenas II. c) Apenas I e II. d) Apenas II e III. e) I, II e III. Questo 1376

1.5.15.3

m relao tabela correto afirmar que a) o gene correspondente protena A est no cromossomo 1. b) o gene correspondente protena B est no cromossomo 3. c) o gene correspondente protena C est no cromossomo 6. d) o gene correspondente protena D est no cromossomo 4. e) a linhagem III contm o cromossomo 8. Questo 1375 O que se imaginava impossvel acabou acontecendo antes do prazo previsto: aps a elucidao da seqncia de DNA de vrios organismos, no ano 2000, foi anunciado o seqenciamento do genoma humano. Com relao organizao genmica, considere as seguintes afirmaes. I - O genoma humano contm uma grande percentagem de seqncias de DNA que no codificam genes. Por isso,

"A revanche veio na quinta-feira [06/4] passada. Depois do susto provocado no comeo da semana pelos percalos jurdicos da Microsoft..., a Nasdaq, o prego eletrnico das empresas de alta tecnologia, voltou a respirar, (...). O oxignio foi dado pelo anncio de que cientistas americanos tinham chegado ao fim do rastreamento de um dos sonhos da medicina nesta virada de sculo: o mapeamento do genoma humano, ..." Trecho extrado do artigo: GENOMA: O PRIMEIRO ESBOO DO MAPA DA VIDA, publicado na "Revista poca", 10/04/2000. p. 123. Com relao a esse assunto, CORRETO afirmar que: (01) o referido genoma est contido nos cromossomos. (02) a molcula sequenciada o DNA. (04) apenas quatro bases nitrogenadas - a Adenina, a Citosina, a Guanina e a Uracila - so possveis de serem encontradas nesse mapeamento. (08) esse mapeamento j permitiu aos cientistas saberem a localizao de todos os genes humanos. (16) um dos resultados possveis dessa descoberta ser a cura, no futuro, de algumas doenas genticas, atravs da terapia gnica.

311

Questo 1377 A revista "poca", em 30/07/2001, anunciou em sua capa: "O DNA no falha". O ttulo referiu-se a uma reportagem da qual foi extrado o trecho a seguir: Depois da plula anticoncepcional, que transferiu para as mulheres o controle da fertilidade, da fertilizao "in vitro" e da barriga de aluguel, mtodos que permitem a gravidez sem sexo, o teste de DNA surge como uma das grandes descobertas do mundo ocidental. Para muitos especialistas [...] a tcnica s traz benefcios. Outros acreditam que reflexos da descoberta vo alterar o universo das relaes familiares. Sobre a utilizao dos testes de DNA, e as implicaes dessa prtica para os indivduos e a sociedade em geral, CORRETO afirmar que: (01) os testes de DNA podem ser empregados para finalidades de investigao de paternidade e tambm para identificao de supostos criminosos, como em casos de estupros e assassinatos. (02) o melhor material biolgico para um teste de DNA aquele extrado de ncleos de glbulos brancos do sangue, mas outros tecidos, como pele e ossos, tambm podem ser utilizados. (04) para uma investigao de paternidade, a partir de testes de DNA, coletam-se amostras biolgicas do suposto pai, no sendo necessrio obter informaes do(a) filho(a) e de sua me. (08) os exames de investigao de paternidade, a partir de testes de DNA, oferecem, atualmente, resultados com exatido total, no restando qualquer questionamento ou dvida sobre os diagnsticos apresentados. (16) o custo do exame de DNA, ainda muito elevado no Brasil, um dos fatores que dificulta sua utilizao em larga escala pelos segmentos populacionais menos favorecidos economicamente. (32) a criao de bancos de dados, com a identificao gentica de criminosos e suspeitos, em pases como a Inglaterra, vem gerando grande polmica, uma vez que podem ser entendidos como uma violao da privacidade biolgica dos indivduos. Soma ( )

Questo 1378 Em junho de 2000, foi anunciada a concluso da fase do Projeto Genoma Humano em que se determinou a seqncia de, aproximadamente, 3 bilhes de nucleotdeos do genoma humano. O conhecimento dessa seqncia permitir determinar a) o nmero de cromossomos presentes nas clulas humanas. b) o nmero de protenas que compem os genes humanos. c) quantas molculas de DNA esto presentes nos cromossomos humanos. d) o nmero de doenas que podem afligir a humanidade. e) o nmero total de genes humanos e quais as protenas codificadas por esses genes. Questo 1379 O texto a seguir apresenta os resultados do projeto de estudo do genoma da 'Xylella fastidiosa', no ano de 1999. "Trabalhando sem parar desde o final de 1997, eles (os pesquisadores) j decifraram 75% do cdigo gentico dessa bactria. A idia descobrir, at abril, a seqncia de substncias que constituem os cerca de 2000 genes da cadeia de DNA, ou seja, do genoma do parasita". "Superinteressante", 13(1):63. Jan., 1999. (adaptado) Uma modificao que poderia ser feita nesse texto, para torn-lo mais preciso, a substituio de a) seqncia de substncias por seqncia de nucleotdeos. b) cdigo gentico por seqncia de aminocidos. c) cdigo gentico por conjunto total de protenas. d) cadeia de DNA por cadeia de RNA. e) seqncia de substncias por seqncia de aminocidos. Questo 1380 O exame de paternidade tem sido muito utilizado na medicina forense. Esse teste baseia-se na identificao de marcas genticas especficas que podem ser encontradas no DNA da me, do pai e dos filhos. O resultado do teste, representado a seguir, contm padres dessas marcas de uma determinada famlia.

312

impressionam: so cerca de 4,6 milhes de pares de bases, e os genes que codificam protenas so 4.288. Para surpresa de muitos, 38% desses genes ainda no tm uma funo conhecida. 1.5.15.3 Com o auxlio do texto, julgue os itens a seguir. (1) O DNA da bactria 'Escherichia coli' tem cerca de 9,2 milhes de molculas de fosfato. (2) Para 38% dos genes, no se sabe a seqncia de amionocidos da protena. (3) Pode-se fazer estudos da evoluo das bactrias, comparando-se a seqncia de DNA de diferentes espcies. (4) A 'Escherichia coli' pode produzir 8.576 RNAs mensageiros diferentes. Questo 1383 Nos exames para teste de paternidade, o DNA, quando extrado do sangue, obtido a) das hemcias e dos leuccitos, mas no do plasma. b) das hemcias, dos leuccitos e do plasma. c) das hemcias, o principal componente do sangue. d) dos leuccitos, principais clulas de defesa do sangue. e) dos leuccitos e das globulinas, mas no das hemcias. Questo 1384 O mapeamento de toda a seqncia de nucleotdeos existente nos 23 pares de cromossomos humanos a) o que ainda falta fazer aps a concluso do projeto Genoma Humano em 2003. b) a condio necessria para se saber o nmero de molculas de RNA existentes em nosso organismo. c) o que nos permitiria conhecer qual a real proporo de protenas em relao s molculas de DNA que possumos. d) o que foi conseguido pelos pesquisadores h alguns anos, sendo apenas um passo no conhecimento de nosso genoma. e) significa decifrar o cdigo gentico, que s foi descoberto depois da concluso do projeto Genoma Humano em 2003. Questo 1385 Uma loja de animais mantinha para venda 4 exemplares de 'Ara ararauna' (arara azul-e-amarela) e alegava aos fiscais que os exemplares haviam nascido em cativeiro, a partir de
313

om base neste resultado, assinale a alternativa INCORRETA: a) I filho biolgico do casal. b) II no filho deste pai. c) V no pode ser filho biolgico deste casal. d) IV pode ser filho adotivo do casal. e) III irmo biolgico de I. Questo 1381 Est em andamento o projeto GENOMA, pelo qual se pretende seqenciar totalmente o DNA humano, ou seja, obter a seqncia de bases nitrogenadas do DNA de todos os cromossomos de uma pessoa. A esse respeito, julgue os itens que se seguem. (0) Uma vez obtida a seqncia de um gene, ser possvel conhecer a seqncia de aminocidos da protena correspondente. (1) As seqncias obtidas correspondero exatamente ao DNA de qualquer pessoa. (2) A seqncia de todos os cromossomos ser do mesmo tamanho. (3) O projeto GENOMA tem levantado questes ticas, pelo eventual uso inadequado que se possa fazer do conhecimento obtido, como, por exemplo, a discriminao de pessoas. (4) Todos os genes tero a mesma proporo de adenina e guanina. Questo 1382 Enquanto o projeto que visa seqenciar completamente o genoma humano segue seu curso, nos ltimos 2 anos chegaram ao fim vrios seqenciamentos do genoma de bactrias. Em setembro de 1997, foi publicada a seqncia do DNA da bactria 'Escherichia coli.' Os nmeros

um casal mantido em um criatrio autorizado pelo IBAMA. Contudo, os fiscais do IBAMA suspeitaram se esses exemplares teriam nascido em cativeiro ou se teriam sido capturados na natureza. Para esclarecer a questo, colheu-se uma amostra de sangue de cada um dos animais e fez-se um teste para determinao de paternidade pelo mtodo do DNA-Fingerprint, ou "impresso digital de DNA". O DNA foi extrado das clulas por processos qumicos, fragmentado com enzimas especficas, colocado sobre um gel suporte e submetido corrente eltrica. Fragmentos menores migram mais rapidamente em direo a um dos plos da corrente. A migrao diferencial dos fragmentos forma bandas (faixas) de DNA no gel, que podem ser visualizadas por tratamentos especficos (colorao, raios X, por exemplo). O padro de bandas exclusivo de cada indivduo. A ilustrao apresenta o resultado do teste

bacteriano. d) permitem somente a ligao de pedaos de DNA de um mesmo tipo celular. e) impedem a clonagem de molculas de DNA recombinante. Questo 1387 Enzimas de restrio so fundamentais Engenharia Gentica porque permitem a) a passagem de DNA atravs da membrana celular. b) inibir a sntese de RNA a partir de DNA. c) inibir a sntese de DNA a partir de RNA. d) cortar DNA onde ocorrem seqncias especficas de bases. e) modificar seqncias de bases do DNA. Questo 1388 Por sua capacidade de cortar o DNA em pontos especficos, so utilizadas enzimas de restrio na engenharia gentica, originando fragmentos dessa molcula. Sobre essas enzimas INCORRETO afirmar que: a) reconhecem seqncias especficas de bases nitrogenadas. b) removem os fosfatos e as pentoses, deixando somente as bases nitrogenadas, que sero manipuladas. c) cada uma pode originar fragmentos de DNA com tamanhos diferentes. d) so utilizadas nos atuais testes de DNA. e) fazendo-se uso delas, pode-se isolar um nico gene de um cromossomo. Questo 1389 Duas doenas no infecciosas que preocupam o homem moderno so a diabetes e o mal de Alzheimer. Enquanto a cura de diabetes est sendo pesquisada atravs da engenharia gentica, testes de laboratrio utilizando a melatonina indicaram bons resultados para controlar o mal de Alzheimer. A identificao de genes responsveis por diversas doenas, como a diabetes, por exemplo, pode possibilitar, no futuro, o uso da terapia gnica. Essa tcnica tem por objetivo "corrigir o efeito da mutao" a) induzindo mutaes nos genes responsveis pela doena. b) inserindo cpias extras do alelo mutado.
314

1.5.15.4

Os resultados obtidos indicam que podem ser filhos do casal, mantido pelo criador, a) os 4 exemplares. b) apenas os exemplares machos. c) apenas os exemplares fmeas. d) apenas os exemplares 1 e 4. e) apenas os exemplares 2 e 3. Questo 1386 As enzimas de restrio so as principais ferramentas bioqumicas empregadas em Engenharia Gentica. Com relao a essas substncias correto afirmar que a) so altamente especficas, cortando o DNA em locais determinados. b) no existem em seres vivos, sendo exclusivamente produtos da indstria qumica. c) atuam como agentes de ligao entre DNA viral e

c) substituindo o alelo mutado ou adicionando uma cpia correta do alelo. d) produzindo protenas funcionais em organismos de outra espcie. e) inibindo a expresso do gene mutado nas clulas secretoras da protena. Questo 1390 A biotecnologia tornou possvel a transferncia de material gentico entre os mais diversos organismos. Os conhecimentos da rea so aplicados com sucesso na produo industrial da insulina e do hormnio de crescimento, que so administrados a pacientes de todo o planeta. Sobre a produo de organismos geneticamente modificados, correto afirmar: a) Fragmentos de DNA exgeno so inseridos no genoma de clulas hospedeiras por meio de plasmdeos. b) O genoma exgeno inserido no ncleo hospedeiro por meio de vetores proticos conhecidos como plasmdeos. c) O DNA gnico endgeno inserido no ncleo de clulas hospedeiras por meio de plastdeos funcionais. d) O DNA endgeno transferido para genomas hospedeiros por meio de plasmdeos mitocondriais. e) Fragmentos de genes exgenos so inseridos no genoma das clulas hospedeiras por meio de plastdeos nucleares. Questo 1391 As principais ferramentas empregadas na tecnologia do DNA recombinante so as enzimas de restrio, que tm a propriedade de cortar o DNA em pontos especficos. O papel biolgico dessas enzimas bacterianas na natureza , provavelmente: a) proteger as bactrias contra os vrus bacterifagos. b) reparar o DNA bacteriano que sofreu mutao deletria. c) auxiliar no processo de duplicao do DNA. d) auxiliar no processo de transcrio do mRNA. e) auxiliar no processo de traduo do DNA. Questo 1392 Todas as alternativas apresentam aplicaes da tecnologia do DNA recombinante nas duas ltimas dcadas, EXCETO a) Investigao de paternidade e criminalstica. b) Recuperao de espcies extintas. c) Produo, em bactrias, de protenas humanas de interesse mdico.

d) Terapia gnica de algumas doenas hereditrias. Questo 1393 A tecnologia do DNA recombinante permitiu a insero e a expresso, em bactrias, do gene humano responsvel pela sntese da insulina. Todas as alternativas apresentam resultados esperados do xito dessa tcnica, EXCETO a) Independncia de pncreas de animais para produo de insulina b) Obteno de uma nova espcie de bactria produtora de insulina humana c) Possibilidade de expresso em bactrias de outros genes de interesse mdico d) Possibilidade de tratamento para pacientes com intolerncia insulina animal Questo 1394 Para minimizar o uso de inseticidas sintticos na fruticultura e atender s normas de segurana alimentar da FAO ("Food and Agriculture Organization"), esto sendo implantadas "biofbricas" de controle de pragas no Nordeste do Brasil. Essas "biofbricas" podem adotar todas as seguintes tecnologias, EXCETO a) Produo de parasitas das pragas b) Extrao de inseticidas naturais c) Criao de comensais das pragas d) Produo de machos estreis das pragas Questo 1395 Analise a figura a seguir, que representa um determinado experimento.

1.5.15.5

315

) Produo de DNA recombinante (plasmdio de uma bactria/ gene do vaga-lume) 2) Introduo do DNA em clula de tabaco 3) Multiplicao da clula de tabaco com o gene do vaga-lume 4) Desenvolvimento de uma planta de tabaco com o gene do vaga-lume (planta que fluoresce) O experimento ilustrado : a) produo de transgnicos. b) hibridao intraespecfica. c) aconselhamento gentico. d) eletroforese. e) amniocentese. Questo 1396 A manipulao gentica de microorganismos, principalmente a manipulao de bactrias, j possibilitou a obteno de resultados benficos para a medicina e para outras reas do conhecimento. Com relao a esse tema, verdadeiro afirmar que: ( ) so utilizadas pequenas pores circulares de DNA, dispersas no citoplasma bacteriano e que tm replicao independente do cromossomo. ( ) so obtidos segmentos de DNA, com genes de interesse, atravs de cortes com exonucleases, como a transcriptase reversa. ( ) promove-se o corte de molculas de DNA com o uso de enzimas que reconhecem seqncias nucleotdicas especficas no DNA. ( ) se duas diferentes molculas de DNA forem cortadas por uma mesma enzima de restrio sero produzidos iguais conjuntos de fragmentos. ( ) a tecnologia do DNA recombinante (ou Engenharia Gentica) fundamenta-se na fuso de "trechos" de DNA de diferentes organismos para a construo de DNA hbrido. Questo 1397 Para um pesquisador transferir um gene de interesse, diferentes etapas so cumpridas em laboratrio, entre as quais: a utilizao de enzima do tipo (1), para o corte e a separao do segmento de DNA a ser estudado; a extrao e o rompimento de (2), e a incluso em (2) do segmento obtido (gene isolado) com o auxlio de enzimas do tipo (3). Os nmeros 1, 2 e 3 indicam, respectivamente:

1.5.15.5

a) enzima de restrio, plasmdio e enzima ligase. b) enzima transcriptase reversa, cromossomo circular e enzima de restrio. c) DNA recombinante, RNA plasmidial e enzima exonuclease. d) enzima transcriptase reversa, plasmdio e enzima de restrio. e) enzima de restrio, RNA plasmidial e enzima transcriptase reversa. Questo 1398 O Projeto genoma humano tem como objetivo determinar a seqncia de bases de todos os genes de nossa espcie. Isto pode ser feito graas ao instrumental bioqumico da engenharia gentica disponvel nos dias de hoje, como as enzimas bacterianas, conhecidas como enzimas de restrio. Assinale a alternativa que apresenta, corretamente, a forma de atuao dessas enzimas. a) As enzimas de restrio cortam o DNA apenas nos locais onde existem certas seqncias de bases nitrogenadas. b) As enzimas de restrio cortam o DNA nos locais onde reconhecem o acar desoxirribose. c) A utilizao das enzimas de restrio permite separar molculas de DNA de acordo com seu tamanho e carga eltrica. d) A utilizao de enzimas de restrio permite cortar o DNA nos locais onde reconhecem o cido fosfrico. e) As enzimas de restrio quebram o DNA, separando-o sempre em nucleotdeos individuais. Questo 1399 Pedro estava doente e perdeu uma semana de aulas. Preocupado com os contedos da disciplina de Biologia, soube pelos colegas que o assunto trabalhado fora Biotecnologia. Cada colega lembrou um aspecto das aulas.
316

- EDUARDO lembrou que a identidade gentica individual pode ser estabelecida pela tcnica DNA 'fingerprint', ou impresso digital gentica, que utiliza DNA codificante. - De acordo com MARIANA, as enzimas de restrio so aquelas que podem cortar o DNA em pontos determinados. - Segundo LAURA, plasmdeos so utilizados como vetores para a clonagem de genes. - RAFAEL definiu proteoma como o conjunto de protenas expressas pelo genoma. - JOANA relatou que vacinas genticas so usadas para inocular nas pessoas microorganismos vivos transgnicos ou atenuados. Ao voltar escola, Pedro conversou com a professora e constatou que estavam corretas a) apenas as afirmaes de Eduardo, Mariana e Laura. b) apenas as afirmaes de Mariana, Laura e Rafael. c) apenas as afirmaes de Eduardo e Joana. d) apenas as afirmaes de Rafael e Joana. e) as afirmaes de todos os colegas. Questo 1400 Assinale a alternativa que preenche corretamente as lacunas do pargrafo a seguir, na ordem em que aparecem. Entre os importantes avanos conquistados pela tecnologia do DNA recombinante, est a produo de ............... . Os rins produzem esse hormnio, que, atuando sobre a medula ssea vermelha, estimula a diviso de clulas-tronco. Indivduos submetidos a hemodilises so injetados com essa protena e apresentam sua ............... reduzida. a) eritropoietina - anemia b) insulina - diabetes c) plasmina - coagulao d) fator VIII - leucocitose e) hormnio de crescimento - esterilidade Questo 1401 A figura a seguir representa de forma esquemtica o processo de clonagem de genes do "Mycobacterium tuberculosis", em um plasmdio de bactria, para fins teraputicos.

1.5.15.5

om relao ao processo de clonagem gnica esquematizado acima, os nmeros 1, 2, 3 e 4 representam, respectivamente, a) DNA recombinante, plasmdio, clone e vetor. b) DNA recombinante, vetor, plasmdio e transgene. c) DNA, vetor, DNA recombinante e organismo transgnico. d) DNA transgnico, DNA recombinante, vetor e plasmdio. Questo 1402 CHEGA AO MERCADO UM NOVO FRMACO INTEIRAMENTE DESENVOLVIDO NO PAS A insulina humana recombinante (IH-r), um dos mais significativos produtos do avano cientfico nacional na rea da engenharia gentica, est prestes a chegar ao mercado com o nome de Biohulin: a empresa BIOBRS, uma das quatro empresas em todo o mundo e a nica no hemisfrio sul a deter a tecnologia de produo desta insulina, inicia em 1999 a comercializao do produto. Uma parceria entre a BIOBRS e a Universidade de Braslia (UnB), em 1988, deu incio aos trabalhos. Ao grupo da UnB coube a parte de Biologia Molecular, desenvolvendo clones de bactrias produtoras de insulina. Esta conquista tecnolgica permitir o desenvolvimento de outros medicamentos, como o hormnio de crescimento, o interferon e a calcitonina. Informe PADCT/Ministrio da Cincia e Tecnologia, jan/99, p.7(com adaptaes). Com o auxlio do texto, julgue os itens abaixo. (1) As tcnicas de engenharia gentica permitem a
317

recombinao de genes entre organismos totalmente diferentes. (2) Para que uma bactria passe a produzir insulina humana, ela deve receber altas doses dessa protena. (3) O Biohulin ser um medicamento destinado ao tratamento de diabticos. (4) A partir da insulina produzida por bactrias, pode ser obtido o hormnio de crescimento. Questo 1403 A expectativa em torno da utilizao das clulas-tronco decorre do fato de estas clulas a) incorporarem o genoma do tecido hospedeiro. b) eliminarem os genes causadores da doena no tecido hospedeiro. c) alterarem a constituio gentica do tecido hospedeiro. d) fundirem-se com o tecido hospedeiro, eliminando as possibilidades de rejeio imunolgica. e) sofrerem diferenciao que as torna parte integrante e funcional do tecido hospedeiro. Questo 1404 Clulas-tronco so clulas indiferenciadas que tm a capacidade de se diferenciar em diversos tipos celulares. Para que ocorra tal diferenciao, as clulas-tronco tero necessariamente que alterar a) o nmero de cromossomos. b) a quantidade de genes nucleares. c) a quantidade de genes mitocondriais. d) o padro de atividade dos genes. e) a estrutura de genes especficos por mutaes. Questo 1405 Segundo a doutora Mayana Zats (USP) um estudo recente com clulas-tronco retiradas da medula e injetadas no corao da prpria pessoa, o "autotransplante", sugere uma melhora aparente do quadro clnico em pacientes com insuficincia cardaca. (adaptado de http://www.estadao.com.br/educando/noticias/2004/mai/10/ 69.htm) Enquanto as demais clulas do organismo s podem fazer parte de um tecido especfico, a "clula-tronco" tem a capacidade especial de se diferenciar e constituir diferentes

tecidos no organismo. Por reproduo ela gera clulas, cromossomicamente e geneticamente, idnticas a si mesma. Por essa razo seu uso para a cura de doenas bastante promissor, a no ser nas doenas genticas. Assinale a alternativa que aponta uma limitao do uso de clula-tronco para "possvel e futura" cura de doenas genticas. a) As clulas-filhas geradas por ela so cromossomicamente e geneticamente diferentes da clula-me originando, portanto, tecidos diferentes daquele que se deseja. b) As clulas-filhas geradas so cromossomicamente e geneticamente iguais clula-me inclusive no caso de haver gene "defeituoso". c) No Brasil no h permisso para o desenvolvimento de pesquisas com clula-tronco, qualquer que seja a sua origem. d) A clula-tronco s pode ser obtida por clonagem teraputica, prtica que, segundo a Comisso Tcnica Nacional de Biotecnologia (CTNBio), provoca mutaes e malformaes. e) O Brasil no tem cientistas especializados para a realizao desse tipo de pesquisa. Questo 1406 Observe o esquema, que mostra a diferenciao de clulas-tronco humanas nos elementos figurados indicados.

1.5.15.6

318

Assinale a afirmativa INCORRETA. a) A clula-tronco pluripotente com capacidade de se diferenciar em diversos tipos celulares. b) Pelo menos 3 tipos de clulas diferenciadas no esquema dado so encontradas no sangue. c) Plaquetas e hemceas no apresentam capacidade de proliferao mittica. d) Apenas 2 das clulas diferenciadas apresentam ncleo. Questo 1407 BILOGO MAPEIA GENES DO CORDO UMBILICAL.

Questo 1409 Alguns tecidos do organismo humano adulto se regeneram constantemente por meio de um processo complexo e finamente regulado. Isso acontece com a pele, com os epitlios intestinais e especialmente com o sangue, que tem suas clulas destrudas e renovadas constantemente, como mostra o esquema a seguir:

1.5.15.6 Um jovem bilogo de So Paulo descobriu porque as clulas-tronco do cordo umbilical so mais eficientes em transplantes do que as da medula ssea. Ele encontrou um grupo de genes que seguem um mesmo mecanismo e so mais ativos em clulas do cordo. Ele deseja descobrir maneiras de manipular os genes para obter melhores resultados teraputicos ou estimular a formao artificial de tecidos. Fonte: "O Estado de So Paulo", 14/02/2006 Sobre esse assunto, assinale a afirmativa INCORRETA. a) Clulas-tronco so clulas capazes de se diferenciar dando origem a diversos tipos de clulas. b) A capacidade de diferenciao das clulas precursoras se deve alterao na expresso gnica especfica. c) Clulas-tronco podem ser encontradas em embries, em cordes umbilicais e tambm em diversos tecidos no indivduo adulto. d) Na medula ssea de um adulto, existem clulas-tronco capazes de dar origem a clulas diferenciadas de todos os tecidos humanos. Questo 1408 A pesquisa com clulas tronco tem-se tornado de grande importncia para recuperao de rgos lesionados que no tm capacidade de regenerao de suas clulas. As clulas tronco tm grande poder de regenerao porque: a) tm todos os seus genes funcionando. b) todos os seus genes esto desligados. c) tm algo grau de especializao. d) so pouco especializadas. e) no se reproduzem com facilidade.

Baseado nas informaes anteriores e nos conhecimentos sobre o tema, considere as afirmativas a seguir. I. Clulas tronco hematopoticas apresentam potencial para diferenciar-se em qualquer clula do sangue e tambm gerar outras clulas tronco. II. A hematopoese resulta da diferenciao e da proliferao simultnea de clulas tronco que, medida que se diferenciam, vo reduzindo sua potencialidade. III. As diferentes linhagens hematopoticas geradas no sistema apresentam altas taxas de proliferao. IV. Existe um aumento gradual da capacidade de auto-renovao das clulas durante este processo. A alternativa que contm todas as afirmativas corretas : a) I e II b) I e IV c) III e IV d) I, II, e III e) II, III, IV Questo 1410 Experimentos recentes indicam que clulas-tronco retiradas da medula ssea de um indivduo adulto, portador de leso no miocrdio, puderam formar tecido normal quando implantadas na regio lesada do corao. As clulas-tronco podem ser retiradas, tambm, de embries em sua fase
319

inicial de desenvolvimento. A tabela a seguir informa as caractersticas de algumas variveis analisadas em clulas-tronco embrionrias e adultas.

Questo 1412 H vinte anos, casos incomuns de anemia comearam a chamar a ateno dos pesquisadores. Ao invs de adultos jovens, como habitualmente, eram os idosos que apresentavam uma expressiva reduo na taxa de hemoglobina. Mais intrigante: a anemia dos idosos no cedia ao tratamento convencional. Analise as hipteses apresentadas pelos cientistas para tentar explicar esses casos incomuns. I. A origem do problema estava relacionada degenerao do bao, que nesses idosos deixou de produzir glbulos vermelhos. II. A origem do problema estava na produo de glbulos vermelhos a partir de clulas-tronco da medula ssea. III. A origem do problema estava na produo de glbulos vermelhos pela medula espinhal. Considerando hipteses plausveis, isto , aquelas possveis de serem aceitas pela comunidade cientfica, esto corretas: a) I, apenas. b) II, apenas. c) III, apenas. d) I e II, apenas. e) I, II e III. Questo 1413 Cientistas sul-coreanos clonam pela primeira vez um cachorro, utilizando uma clula obtida da orelha do pai gentico. Os cientistas tiraram material gentico da clula e o colocaram em um vulo esvaziado do seu ncleo, posteriormente estimulado para que se dividisse e virasse um embrio dentro da me adotiva, da raa Labrador. O animal clonado, da raa Afgham, recebeu o nome de Snuppy , e nasceu 60 dias aps. ("Folha de S. Paulo", 03.08.2005.) A partir do texto e do que se conhece sobre clonagem, podemos afirmar corretamente que: a) possvel obter clulas-tronco embrionrias usando-se clulas diferenciadas de um adulto. b) usando o mesmo pai gentico, possvel obter um outro clone que seja fmea. c) o clone gerado ter o gentipo Afgham e o fentipo Labrador e ser do sexo masculino.
320

1.5.15.6

Considerando o uso teraputico das clulas-tronco, a alternativa que indica o tipo de clula que possui a caracterstica mais vantajosa para as variveis I, II e III, respectivamente, : a) embrionria - adulta - adulta b) adulta - embrionria - adulta c) embrionria - adulta - embrionria d) embrionria - embrionria - embrionria Questo 1411 Em maro de 2005, foi promulgada a Lei de Biossegurana, que autoriza a pesquisa com clulas-tronco obtidas a partir de embries humanos remanescentes de tratamentos de infertilidade armazenados por pelo menos trs anos. Sobre essas clulas, considere as seguintes afirmaes. I - A clonagem de clulas-tronco embrionrias pode ser utilizada com fins teraputicos ou reprodutivos. II - uma clula-tronco deve ter o poder de se renovar indefinidamente pela diviso celular. III - As clulas-tronco retm o potencial de dar origem a clulas-filhas mais especializadas. Quais esto corretas? a) Apenas I. b) Apenas II. c) Apenas I e II. d) Apenas II e III. e) I, II e III.

d) o ncleo do vulo inserido em uma clula de orelha anucleada origina uma fmea Labrador. e) o ambiente celular do Labrador alterou a expresso genotpica do ncleo transplantado. Questo 1414 A clera uma doena infecciosa causada por uma bactria descoberta em 1884, que posteriormente recebeu o nome de 'Vibrio cholerae'. Essa bactria ataca o intestino humano fazendo com que o organismo elimine grande quantidade de gua e sais minerais, causando desidratao. Dentre as alternativas a seguir, assinale aquela que NO medida de preveno desta doena. a) Beber somente gua filtrada ou fervida. b) Lavar as mos com sabo antes das refeies e ao deixar o sanitrio. c) Tomar vacina trplice periodicamente. d) Lavar, muito bem, e com gua limpa, frutas, legumes e verduras antes de com-los. e) Evitar comer alimentos crus, principalmente verduras e peixes. Questo 1415 Clulas-tronco vm sendo utilizadas com sucesso para amenizar os sintomas de pacientes com insuficincia cardaca devida a infarto do miocrdio. Recentemente, pesquisadores brasileiros da FIOCRUZ foram pioneiros em utilizar clulas-tronco da medula ssea de um paciente que apresentava insuficincia cardaca devido a uma doena parasitria. Com o tratamento, as leses coronarianas reduziram-se a um nvel mnimo. A doena parasitria a que esse texto se refere a a) amebase. b) malria. c) doena do sono. d) doena de Chagas. e) febre amarela. Questo 1416 Um srio risco a que est exposto o trabalhador rural em nosso pas o de acidentes com animais peonhentos. Dentre estes um dos mais temveis e agressivos do gnero a cobra surucucu. Com relao surucucu, considere as proposies:

1 - Pertence ao gnero Bothrops e seu veneno tem potente ao neurotxica e coagulante. 2 - Pertence ao gnero Crotalus e seu veneno tem ao neurotxica e homoltica. 3 - Seu veneno tem ao proteoltica e coagulante e o antiofdico especfico o soro antibotrpico. 4 - O princpio ativo do seu veneno provoca intensa dor no local da inoculao, podendo haver gangrena, especialmente no caso de se utilizar torniquetes. As proposies que esto corretas so as indicadas por: a) 2 e 3 b) 1, 2 e 4 c) 3 e 4 d) 1 e 4 e) 2, 3 e 4 Questo 1417 Uma planta feminina de angiosperma com gentipo PP foi cruzada com uma masculina pp. As sementes resultantes devem apresentar embrio e endosperma, respectivamente, a) PP e pp b) Pp e Pp c) Pp e PPP d) Pp e PPp e) PP e Ppp Questo 1418 Os meios de comunicao tm noticiado, freqentemente, que o Brasil est se tornando um pas de obesos. Os rgos envolvidos com a sade pblica tm mostrado preocupao constante com a dieta do povo brasileiro, pois o tradicional prato de "feijo, arroz, bife e salada" est sendo substitudo por comidas industrializadas e com alto teor calrico. Estima-se que o consumo de feijo e de arroz caiu em torno de 30% nos ltimos anos. Com base no texto e nos conhecimentos sobre o tema, considere as afirmativas a seguir. I. O prato tradicionalmente consumido pelo brasileiro apresenta elementos essenciais ao metabolismo, como protenas, carboidratos, gorduras, vitaminas e sais minerais. II. A ingesto de protenas importante, pois elas sero degradadas em aminocidos, usados como fonte na sntese
321

das protenas codificadas pelo organismo. III. Os carboidratos e lipdios da dieta so fonte importante de energia para os organismos, pois essas molculas preservam, na forma de energia qumica, boa parte da energia gasta para a sua sntese. IV. Os cidos nuclicos ingeridos so incorporados ao DNA do organismo, razo pela qual questiona-se o consumo de alimentos transgnicos. Esto corretas apenas as afirmativas: a) I e III. b) I e IV. c) II e IV. d) I, II e III. e) II, III e IV. Questo 1419 Aps um traumatismo, um paciente teve que se submeter a uma cirurgia que removeu uma parte do seu corpo. Recuperou-se e passou a viver normalmente. A parte retirada era a) o fgado. b) o diafragma. c) a hipfise. d) o pncreas. e) o bao. Questo 1420 O tratamento da leucemia por meio dos transplantes de medula ssea tem por princpio a transferncia de clulas-tronco da medula de um indivduo sadio para o indivduo afetado. Tal procedimento fundamenta-se no fato de que essas clulas-tronco a) podem ser usadas para a clonagem de clulas sadias do paciente. b) no sero afetadas pela doena, j que foram diferenciadas em outra pessoa. c) secretam substncias que inibem o crescimento celular. d) podem dar origem a linfcitos T que, por sua vez, ingerem os leuccitos em excesso. e) podem dar origem a todos os diferentes tipos de clulas sangneas.

Questo 1421 Em outubro de 2004 faleceu o ator cinematogrfico Christopher Reeve, que ficou famoso por interpretar o "Super-Homem". Reeve, que ficou tetraplgico em 1995 ao cair de um cavalo, era um ativista a favor das pesquisas com clonagem teraputica para obteno de clulas tronco. Com relao ao assunto abordado, analise as afirmativas a seguir. I - Aps um acidente como o ocorrido com Reeve, se houver suspeita de leso na coluna vertebral, o acidentado deve ser imobilizado na horizontal e utilizar um colar cervical para ser transportado at um hospital, porque no interior da coluna vertebral est a medula ssea vermelha, cuja leso pode levar paralisia. II - A utilizao do colar cervical no evita leses no sistema nervoso perifrico, apenas no sistema nervoso central. O sistema nervoso perifrico poder ficar inativo, aps um acidente, se houver comprometimento no sistema nervoso central. III - A clonagem teraputica por transferncia nuclear permite a obteno de blastocistos, de onde so retiradas clulas da massa celular interna (clulas tronco) que tm capacidade de regenerar rgos lesados. Marque a alternativa correta. a) I e II so corretas. b) I e III so corretas. c) II e III so corretas. d) Apenas III e correta. Questo 1422 A hemofilia se caracteriza por ser uma doena: a) adquirida, cujo sintoma o excesso de acar no sangue e a falta de insulina. b) hereditria, que causa problemas de coagulao sangunea. c) infecciosa, que causa problemas de coagulao sangunea. d) congnita, que causa m formao dos ossos. e) contagiosa, causada por um vrus e transmitida por mosquitos.

322

Questo 1423 O sangue pode realizar vrias funes no nosso corpo. Dentre elas, a de defesa contra microrganismos realmente notvel, pois envolve um grupo de clulas especializadas. A figura a seguir mostra, de forma esquemtica, um modo como essas clulas do sangue podem realizar seu papel de defesa.

Questo 1425 Desde a poca de Aristteles, especula-se sobre os mecanismos envolvidos na determinao do sexo dos humanos. Acreditava-se que o sexo do embrio era definido por fatores como a nutrio materna. A partir dos estudos sobre herana mendeliana, diviso celular e comportamento dos cromossomos na meiose, comprovou-se que a determinao do sexo decorre de uma constituio cromossmica especfica. Com base nos conhecimentos sobre o tema, correto afirmar: a) O sexo gentico determinado na fecundao, quando ocorre a fuso dos ncleos masculino e feminino. b) Os cromossomos autossmicos so os responsveis pela determinao do sexo gentico do indivduo. c) A probabilidade de o genitor masculino produzir gametas do tipo Y maior que a do tipo X. d) O embrio XX desenvolver testculos e o embrio XY desenvolver ovrios. e) O sexo gentico determinado pelo nmero de cromossomos X presentes no embrio. Questo 1426 Atualmente muitos casais tm-se interessado em escolher o sexo do futuro filho, como ocorre na China, onde os pais muitas vezes optam pelo nascimento de um nico filho do sexo masculino. Essa escolha importante para estes casais uma vez que a constatao de um feto do sexo feminino pode provocar a deciso de um aborto no-natural. Nesse sentido, analise as afirmativas adiante: ( ) A opo por indivduos do sexo masculino pode ser justificada por sua menor suscetibilidade a doenas genticas e por apresentarem um par de genes localizados nos cromossomos X e Y, que determinam uma maior longevidade para o indivduo. ( ) O exame de urina da me uma tcnica usada na identificao do sexo do futuro beb, porque detecta as clulas fetais existentes no lquido amnitico e na placenta, identificando a presena do cromossomo sexual por meio da anlise do citoplasma. ( ) Na espcie humana o sexo da prole determinado pelo pai, que apresenta os cromossomos sexuais X e Y no ncleo de suas clulas germinativas; aps a meiose, estes so distribudos entre os espermatozides. ( ) A tentativa de aborto por meio da ingesto de poes
323

1.10.11

ssinale a afirmativa INCORRETA. a) Os neutrfilos so glbulos brancos capazes de atravessar as paredes dos capilares sangneos. b) A destruio de bactrias que invadem o tecido conjuntivo depende de molculas enzimticas produzidas pelos glbulos vermelhos. c) O tecido conjuntivo, invadido por clulas sangneas e bactrias, pode apresentar um quadro inflamatrio. d) Os glbulos brancos que saem dos capilares podem realizar fagocitose, processo que engloba bactrias invasoras. Questo 1424 Embora a continuidade da vida na Terra dependa substancialmente de todo o elenco de caractersticas que definem os sistemas viventes, duas dessas caractersticas assumem maior importncia para a preservao da vida no planeta. So elas: a) composio qumica complexa e estado coloidal. b) elevado grau de organizao e execuo das funes vitais. c) manuteno da homeostase e alto nvel de individualidade. d) consumo de energia e renovao contnua da matria. e) capacidade de reproduo e hereditariedade.

vegetais ou de outras drogas abortivas pode no eliminar o feto, mas promover a m-formao do corpo do beb e comprometer a sade da me. Questo 1427 A levedao do po e a fermentao alcolica so as primeiras tecnologias de que se tm notcia. Um suco de uva transforma-se em vinho e um repelente mingau de cevada e centeio torna-se usque ou cerveja. Em todos esses casos o 'trabalho' feito por uma levedura (um tipo de fungo), em um processo usado h milnios pela humanidade para obter alimento e prazer. As leveduras mais usadas hoje, na fabricao tanto de pes quanto de vinhos, so as do gnero 'Saccharomyces'. (Adaptado de Anita D. Panek. Cincia Hoje. v.33, no 195, julho de 2003, p.62) Atualmente as leveduras tm sido usadas para produzir vacinas, como contra a hepatite B. Esta vacina consiste do antgeno de superfcie do vrus da hepatite B produzido em clulas de levedura. Isto s possvel graas tecnologi