Título: A maior lista de genética da história!

Professor: André Braga Turma: AeB
Questão 1 O texto que se segue foi extraído de "Xadrez, truco e outras guerras", de José Roberto Torero. Servimos-nos de algumas de suas estruturas para introduzir a(s) questão(ões) seguintes. "Os abutres, sábios animais que se alimentavam do mais farto dos pastos, já começavam a sobrevoar a ala dos estropiados quando o General mandou que acampassem. Naquela tarde assaram trinta bois, quantidade ínfima para abastecer os homens que ainda sobravam.... O plano dos comandantes era assaltar fazendas da região e tomar-lhes o gado... À noite a ração foi ainda mais escassa, e, para enganar a fome, fizeram-se fogueiras para assar as últimas batatas e umas poucas raízes colhidas pelo caminho. Como o frio também aumentava, surgiu um impasse: quem ficaria perto do fogo: os coléricos, que logo morreriam, ou os sãos, que precisavam recuperar as forças para a luta?" (TORERO, J. Roberto. "Xadrez, truco e outras guerras") "(...) os coléricos, que logo morreriam, ou os sãos, que precisavam recuperar as forças para a luta?" Muitas doenças podem provocar a morte. a) A afirmação "os coléricos, que logo morreriam" é falsa ou verdadeira? Justifique. b) Justifique e exemplifique: Muitas doenças são hereditárias e sua manifestação está na dependência da ação de genes específicos ou de alterações cromossômicas. Questão 2 O texto abaixo refere-se às questões: 2 a 3 O experimento clássico de Meselson e Stahl, em 1957, demonstrou que a replicação do DNA era semiconservativa, ou seja, cada fita do DNA serve de molde para sua própria duplicação, formando moléculas de DNA idênticas à original. Nesse experimento, os cientistas cultivaram células de 'Escherichia coli' inicialmente em presença de fonte de ¢¥N (isótopo de nitrogênio leve), trocando, a seguir, por ¢¦N (isótopo pesado), que é incorporado às bases nitrogenadas do DNA. Colheram, então, amostras de DNA após a primeira e a segunda gerações de células crescidas em ¢¦N e analisaram essas amostras quanto à densidade do DNA formado. Considere como PESADO o DNA dupla hélice marcado com ¢¦N; como LEVE o marcado com ¢¥N; como INTERMEDIÁRIO o marcado com ¢¥N e ¢¦N. Justifique por que, após a troca da fonte de nitrogênio, a primeira geração de células foi totalmente constituída com DNA dupla hélice do tipo INTERMEDIÁRIO. Questão 3 Calcule as proporções dos três tipos de DNA dupla hélice LEVE, INTERMEDIÁRIO E PESADO - formados em células da segunda geração, após a troca da fonte de nitrogênio. Questão 4 "O agronegócio responde por um terço do PIB, 42% das exportações e 37% dos empregos. Com clima privilegiado, solo fértil, disponibilidade de água, rica biodiversidade e mão-de-obra qualificada, o Brasil é capaz de colher até duas safras anuais de grãos. As palavras são do Ministério da Agricultura e correspondem aos fatos. Essa é, no entanto, apenas metade da história. Há uma série de questões pouco debatidas: Como se distribui a riqueza gerada no campo? Que impactos o agronegócio causa na sociedade, na forma de desemprego, concentração de renda e poder, êxodo rural, contaminação da água e do solo e destruição de biomas? Quanto tempo essa bonança vai durar, tendo em vista a exaustão dos recursos naturais? O descuido socioambiental vai servir de argumento para a criação de barreiras não-tarifárias, como a que vivemos com a China na questão da soja contaminada por agrotóxicos?" (Adaptado de Amália Safatle e Flávia Pardini, Grãos na Balança. "Carta Capital", 01/09/2004, p. 42.) A contaminação por agrotóxicos também é mencionada no texto. A aplicação intensiva de agrotóxicos a partir da década de 1940 aumentou a produtividade na agricultura. Atualmente, são produzidas e cultivadas plantas
1

transgênicas, isto é, geneticamente modificadas para serem resistentes à ação de insetos. Um exemplo conhecido é o milho geneticamente modificado com um gene da bactéria 'Bacillus thuringensis' (Bt), o que lhe confere resistência a ataques de insetos. Contudo, alguns pesquisadores têm observado que diferentes espécies de insetos adquirem resistência às toxinas bioinseticidas produzidas por essas plantas. a) Explique como os insetos se tornam resistentes. b) Sabe-se que a aplicação intensiva de agrotóxicos, como o DDT, pode afetar a cadeia alimentar tanto de ambientes aquáticos como de solos. Explique por que isso ocorre. Questão 5 Atualmente, um grande esforço tem sido feito por diversos centros de pesquisa e de tratamento de pessoas queimadas para produzir grandes áreas de pele, do próprio indivíduo, que possam recobrir imediatamente áreas destruídas. Explique a vantagem de se utilizar a pele do próprio indivíduo para recobrir as áreas destruídas, ao invés de serem utilizados enxertos de pele de outras pessoas. Questão 6 O desenho a seguir mostra a síntese de um polipeptídio a partir da molécula de DNA num certo organismo. Esse organismo é um procarioto ou um eucarioto? Por quê?

b) A clonagem de bactérias, comparada à clonagem de animais, é um processo mais complexo ou mais simples? Justifique. Questão 8 O gráfico a seguir demonstra a distribuição citoplasmática do número de ribossomas isolados e polirribossomas, em comparação com o número de cadeias polipeptídicas em formação durante um certo período de tempo.

1.1.3.2

(Adaptado de ALBERTS, Bruce & outros. "Molecular biology of the cell". New York, Garland Publishing, 1994, p.239) a) Defina a relação existente entre os ribossomas isolados e a formação das cadeias polipeptídicas. Justifique sua resposta. b) Descreva a estrutura das cadeias polipeptídicas e a dos polirribossomas. Questão 9

1.1.1.2 Um certo tipo de macromolécula destinada à membrana plasmática celular, depende de etapas nucleares e citoplasmáticas para sua produção, de acordo com os percursos esquematizados a seguir:

Questão 7 Nas bactérias, a cadeia respiratória encontra-se associada à membrana plasmática e os ácidos nucléicos estão associados ao citoplasma. a) É assim também em um protista, em um animal e em um vegetal? Justifique.
2

Questão 12 Ribossomos são formados por RNA e proteínas, sintetizados pelos processos de transcrição e tradução, respectivamente. a) Onde esses processos ocorrem na célula eucariótica? b) O que acontecerá com os processos de transcrição e tradução, se ocorrer uma inativação na Região Organizadora do Nucléolo? Justifique. Questão 13 a) Por que essas etapas começam no núcleo? b) Qual é a composição da macromolécula ao final do percurso I? E do percurso II? Esclareça a diferença, baseando-se nas funções das organelas citoplasmáticas envolvidas em cada percurso. Questão 10 Uma espécie de lombriga de cavalo possui apenas um par de cromossomos no zigoto (2n=2). Um macho dessa espécie, heterozigótico quanto a dois pares de alelos (Aa Bb) formou, ao final da gametogênese, quatro tipos de espermatozóides normais com diferentes genótipos quanto a esses genes. a) Qual é o número de cromossomos e o número de moléculas de DNA no núcleo de cada espermatozóide? b) Quais são os genótipos dos espermatozóides formados? c) Por que, a partir das informações fornecidas, não é possível estimar a proporção em que cada um dos quatro tipos de espermatozóides aparece? Explique. Questão 11 Uma mulher com a idade de 40 anos está grávida do primeiro filho. Ela sabe que, devido à sua idade, o bebê tem maior probabilidade de ser portador de alguma anomalia cromossômica. A cariotipagem pré-natal é o exame mais indicado para esclarecer estas dúvidas na fase uterina. Pergunta-se: a) Em que consiste este exame? b) Que exemplos de anomalias cromossômicas podem ser detectadas através deste exame (cite dois exemplos). Criadores e sitiantes sabem que a mula (exemplar fêmea) e o burro (exemplar macho) são híbridos estéreis que apresentam grande força e resistência. São o produto do acasalamento do jumento ('Equus asinus', 2n = 62 cromossomos) com a égua ('Equus caballus', 2n = 64 cromossomos). a) Quantos cromossomos têm o burro ou a mula? Justifique sua resposta. b) Considerando os eventos da meiose I para a produção de gametas, explique por que o burro e a mula são estéreis. Questão 14 Considere as duas fases da meiose, de um organismo com 2n=6 cromossomos, esquematizadas a seguir e responda:

1.1.3.2

1.1.5.2

a) Que fases estão representadas na figura A e na B? Justifique. b) Que tipo de alteração aparece em uma das figuras? Em relação aos cromossomos, como serão as células resultantes de um processo de divisão com essa alteração? c) Dê um exemplo de anomalia que seja causada por este tipo de alteração na espécie humana, cujo número normal de cromossomos é 2n = 46.

3

Questão 15 O gato siamês é um animal de rara beleza pois a pelagem de seu corpo é clara com extremidades - orelhas, focinho, pés e cauda - pretas. A presença do pigmento que dá a cor negra a essas extremidades é o resultado da atividade de uma enzima que fica inativada acima de 34°C. Explique por que esses animais têm a pelagem negra nas extremidades do corpo. Questão 16 Desde 1995 alguns estados norte-americanos estão excluindo o ensino da teoria de evolução biológica dos seus currículos escolares alegando, entre outras razões, que ninguém estava presente quando a vida surgiu na Terra. Alguns cientistas defendem a teoria da evolução argumentando que, se é necessário "ver para crer", então não poderemos acreditar na existência dos átomos, pois estes também não podem ser vistos. (Adaptado da "ISTO É", 25/08/1999.) a) Apresente três evidências que apóiam a teoria da evolução biológica. b) A mutação gênica é considerada um dos principais fatores evolutivos. Por quê? Questão 17 Dois 'loci' de uma população, cada um com dois gens alelos, sofrem a ação da seleção natural por muitas gerações, como é mostrado nas tabelas abaixo. O coeficiente de seleção (S) indica os valores com que a seleção natural atua contra o genótipo. O valor adaptativo (W) representa os valores com que a seleção natural favorece o genótipo. Note que (W+S)=1. Qual dos gens, A‚ ou B‚, apresentará a maior freqüência na população? Explique. Questão 18 No porquinho-da-índia existe um par de genes autossômicos que determina a cor da pelagem: o alelo dominante B determina a cor preta e o recessivo b, a cor branca. Descreva um experimento que possa evidenciar se um porquinho preto é homozigoto ou heterozigoto. Questão 19 Nos porquinhos-da-índia, a pelagem negra é dominante sobre a pelagem branca. Um criador tem um lote de porquinhos-da-índia negros, com o mesmo genótipo. O que deve fazer para descobrir se esses animais são homozigotos ou heterozigotos? Justifique sua resposta. Questão 20 Uma anomalia genética autossômica recessiva é condicionada por uma alteração na seqüência do DNA. Um homem portador dessa anomalia apresenta a seqüência timina-citosina-timina enquanto sua mulher, que é normal, apresenta a seqüência timina-adenina-timina. A análise do DNA de um filho do casal mostrou que ele é portador tanto da seqüência de bases do pai quanto da mãe. a) O filho terá a doença? Por quê? b) Qual a probabilidade de um outro filho do casal apresentar as duas seqüências iguais à da mãe? Questão 21 Um homem afetado por uma doença genética muito rara, de herança dominante, casa-se com uma mulher, não consangüínea. Imagine que o casal tenha doze descendentes, seis filhos e seis filhas. Responda,
4

1.4.1.6

justificando sua resposta, qual será a proporção esperada de filhas e filhos afetados pela doença do pai no caso do gene em questão estar localizado. a) em um autossomo; b) no cromossomo X. Questão 22 Em ervilhas o caráter semente lisa é condicionado por um gene dominante R e semente rugosa pelo seu alelo recessivo r. Quais são as proporções genotípica e fenotípica obtidas na autofecundação de uma variedade comprovadamente heterozigota? Questão 23 "Hormônios são proteínas cuja função é regular os complicados mecanismos do organismo - como o aumento e redução do peso do corpo (...) Em outubro, o geneticista Jeffrey Friediman (...) isolou o primeiro hormônio capaz de controlar o peso, chamado leptina. Ele é produzido por um gene que, quando funciona mal, o organismo ganha peso (...)". (In: "Superinteressante" - ano 10, nŽ 3, mar., 1996.) Com base no texto, RESPONDA: a) Como se denomina o local que o gene ocupa no cromossomos? b) Considerando de forma simplificada a existência de dois alelos para o gene da leptina, um normal (L) e outro mutante (L'), quantos genótipos diferentes são possíveis em humanos diplóides? Quais são eles? c) COMENTE sobre um mecanismo que pode levar à mutação gênica. Questão 24 No início do século XX, a transmissão das informações genéticas para os descendentes era explicada por algumas hipóteses sobre as leis da hereditariedade, como a mendeliana e a por mistura. Observe os esquemas:

1.5.1.1

Suponha que, em um indivíduo de uma população com reprodução sexuada, apareça, por mutação, um gene raro que confira ao seu portador características vantajosas. Indique, para cada uma das hipóteses representadas, se há ou não possibilidade de aumento da freqüência do gene mutante na descendência desse indivíduo e justifique suas respostas. Questão 25 Leia o texto a seguir. "A Doença de Alzheimer (D.A.) (...) é uma afecção neurodegenerativa progressiva e irreversível, que acarreta perda de memória e diversos distúrbios cognitivos. Em geral, a D.A. de acometimento tardio, de incidência ao redor de 60 anos de idade, ocorre de forma esporádica, enquanto que a D.A. de acometimento precoce, de incidência ao redor de 40 anos, mostra recorrência familiar. (...) Cerca de um terço dos casos de D.A. apresentam familiaridade e comportam-se de acordo com um padrão de herança monogênica autossômica dominante. Estes casos, em geral, são de acometimento precoce e famílias extensas têm sido periodicamente estudadas." Smith, M.A.C. (Revista Brasileira de Psiquiatria, 1999) Considerando o texto e o histórico familiar a seguir, responda ao que se pede. Histórico familiar: "Um rapaz cujas duas irmãs mais velhas, o pai e a avó paterna manifestaram Doença de Alzheimer de acometimento precoce."

5

b) aa x aa c) aa x Aa d) Aa x Aa e) Aa x AA 1.5.1.1 Questão 28 No gado bovino da raça Ayrshire a cor mogno é determinada pelo genótipo A A e a cor vermelha pelo genótipo A‚ A‚, mas o genótipo A A‚ é mogno nos machos e vermelho nas fêmeas. Com base nessas informações, qual é o sexo de um filhote vermelho, cuja mãe é uma vaca mogno? Justifique a sua resposta. Questão 29 A formação de uma característica fenotípica depende, em alguns casos, apenas de fatores genéticos. Em outros casos, prevalece a influência de fatores ambientais. Na maioria das vezes há uma interação entre fatores genéticos e ambientais. Um dos métodos utilizados para avaliar a importância relativa dos genes e dos fatores ambientais na formação de uma característica é o estudo comparativo entre irmãos gêmeos monozigóticos criados juntos e criados separados. A tabela a seguir, elaborada a partir de um grande número de pares de gêmeos, indica o grau de concordância de quatro características. Uma concordância significa que quando um irmão possui a característica, o outro também a possui.

I. Montar o heredograma para o histórico familiar apresentado. II. Qual a probabilidade de o rapaz em questão também ser portador do gene responsável pela forma de acometimento precoce da doença? III. Quais indivíduos do heredograma são seguramente heterozigotos para esse gene? IV. Explicar o padrão de herança mencionado no texto. Questão 26 Mendel não acreditava na mistura de caracteres herdados. De acordo com suas conclusões, a partir dos cruzamentos realizados com ervilhas do gênero 'Pisum', as características não se misturam, permanecem separadas e são transmitidas independentemente. HENIG, Robin. "O monge no jardim". Rio de Janeiro: Rocco, 2001. a) Considerando as leis de Mendel para a hereditariedade, no momento da fecundação os cromossomos herdados dos progenitores se juntam, porém os alelos dos seus genes não se misturam. A partir dessa idéia, qual fenômeno explicaria a ocorrência de características intermediárias na progênie, que parecem ser uma mistura daquelas dos progenitores? b) Posteriormente, estudos de grupos de geneticistas indicaram que pode haver troca de material genético entre cromossomos homólogos herdados do pai e da mãe. Em que etapa isso pode ocorrer e como se chama este processo? Questão 27 Determine as probabilidades de aparecerem indivíduos afetados (aa), normais (AA) e heterozigotos (Aa), nas proles dos casamentos: a) aa x AA

1.5.1.1

Indique a característica que mais depende de fatores ambientais. Justifique sua resposta.

6

quando o genótipo é homozigoto dominante ou heterozigoto. admitindo-se que as suposições feitas nas letras (b) e (c) realmente se concretizem. Com base nessas afirmações. Qual a probabilidade desse casal ter: a) quatro crianças albinas? b) uma criança albina e do sexo feminino? c) uma criança normal. a produtividade era muito baixa. coletadas em diversas altitudes. quem engravidou e deu à luz foi a mãe da referida mulher. quando o genótipo é recessivo. Justifique sua resposta. não portadora do gene HCR. Justifique sua resposta. Questão 33 A mamona ('Ricinus communis') produz inflorescências contendo somente flores pistiladas (flores femininas).1 1. que tipos de inflorescências serão produzidas nos descendentes dos seguintes cruzamentos: a) NN x Nn? b) Nn x Nn? Questão 34 Recentemente. e este foi implantado no útero de sua mãe. foram plantadas ao nível do mar em idênticas condições ambientais. Assim. Este camundongo transgênico foi cruzado com uma fêmea de camundongo normal. a produtividade aumentava. solicitou aconselhamento genético sobre a possibilidade de vir a ter crianças apresentando a condição albina. Questão 32 Um determinado casal normal.1 Identifique se é o componente genético ou o componente ambiental que predomina no condicionamento da produtividade dessas plantas. Em grandes altitudes. Questão 31 Um pesquisador observou que uma certa espécie de planta apresentava uma grande variação de produtividade relacionada à altitude onde a planta se desenvolvia. os meios de comunicação noticiaram o caso de uma mulher norte-americana que. dando origem a um camundongo macho. A célula-ovo transgênica se desenvolveu. 7 Calcule a proporção esperada da prole destes camundongos que será portadora do gene que codifica o HCR.5. então. realizou um experimento em que sementes dessa espécie. isto é. heterozigota e do sexo masculino? d) Represente o provável heredograma desse casal.5. mas heterozigoto para o albinismo. Após algum tempo. teve seu óvulo fertilizado "in vitro".1. a produtividade dessas plantas foi medida e apresentou os seguintes resultados: .1. Ele. 1. à medida que a altitude se aproximava do nível do mar.Questão 30 Um pesquisador teve sucesso na integração de uma cópia do gene que codifica o hormônio do crescimento de rato (HCR) em um dos cromossomos autossômicos de uma célula-ovo de camundongo. impossibilitada de ter filhos por anomalia no útero. e inflorescências mistas (flores femininas e flores masculinas).

b) Qual a porcentagem de genes herdados da parturiente que se encontram no patrimônio genético da criança? Questão 35 Em gatos. dois pesquisadores retiraram os ovários de uma cobaia albina e implantaram-lhe um ovário obtido de uma cobaia preta. a) planeje um cruzamento experimental entre flores de exemplares diferentes que lhe permita determinar se uma planta que produz sementes lisas é homozigota ou heterozigota para esse caráter. em geral. em vez de transplantar o ovário. pelo menos. Como o criador poderia fazer para determinar se essa variação é decorrente de uma mutação genética ou de uma alteração causada por fatores ambientais? Questão 38 Em experimento feito no início do século. as plantas resultantes foram medidas e os dados obtidos no experimento são mostrados no gráfico A. Mais tarde. observou que alguns dos animais de sua criação apresentavam uma característica incomum nos chifres. Por quê? Questão 40 Ao estudar a distribuição de uma espécie de planta da família dos girassóis em altitudes crescentes na costa oeste dos Estados Unidos. b) No caso de ocorrer autofecundação em uma planta que produz sementes lisas e é heterozigota. Nesses programas são desenvolvidas linhagens homozigotas por meio de sucessivas gerações autofecundadas. a) Esses indivíduos híbridos são geneticamente iguais entre si? Explique. b) Se o resultado do experimento tivesse sido o representado no gráfico B. pesquisadores observaram que essas plantas apresentavam um gradiente decrescente de tamanho. Considere o cruzamento de gatos homozigotos brancos e marrons. depois de muitos anos nesse ramo. que.Responda: a) Do ponto de vista genético. Alguns desses exemplares produzem sementes lisas e outros. Duas linhagens. os programas de melhoramento utilizam a heterose (vigor do híbrido). um par de genes. qual seria a interpretação? 8 . o resultado não será o mesmo. que as flores são hermafroditas e que sementes produzidas por autofecundação são viáveis. portanto por genótipos LL ou Ll e. expresso no gráfico A. são mais vigorosos e mais produtivos que os parentais. Questão 39 Em várias culturas vegetais. Qual a proporção fenotípica esperada em F se a) o modo de herança for do tipo dominante? b) o modo de herança for do tipo co-dominante? Questão 36 Suponha que você tenha em seu jardim exemplares da mesma espécie de ervilha utilizada por Mendel em seus experimentos. o animal foi cruzado com um macho albino e deu origem a uma prole toda preta. o resultado seria o mesmo? Justifique. c) Se fosse possível implantar os pêlos da fêmea preta na fêmea albina. a) Explique o resultado obtido. homozigotas para alelos diferentes. sementes rugosas. são então cruzadas e produzem os híbridos. Após um determinado tempo de crescimento. qual seria a proporção esperada de descendentes com sementes rugosas? Questão 37 Um criador de cabras. Sementes dessas plantas foram coletadas nas várias altitudes e plantadas em uma mesma região localizada ao nível do mar. sabendo ainda. as cores marrom e branca dos pelos têm sido descritas como devidas a. quem é a mãe da criança? Justifique. Sabendo que a característica "lisa" das sementes da ervilha é determinada por um alelo dominante L. como você explica esse resultado? b) Indique os genótipos da fêmea preta e da prole. b) Se o agricultor utilizar as sementes produzidas pelo híbrido nos plantios subsequentes. a) Sabendo-se que o albinismo é característica recessiva.

a) Afirmação de um casal de olhos azuis: "nosso bebê poderá ter olhos castanhos porque as avós têm olhos castanhos". aumento do baço.2 Questão 44 Considere uma certa espécie de planta que pode apresentar flores com três tipos de cor: azul. a talassemia menor e os pretos a talassemia maior. sendo que a manifestação em homozigose de um dos alelos .1. entre outros sintomas. Ela ocorre em duas formas.5.1. microcitemia e policitemia. Questão 43 A talassemia é um defeito da hemoglobina em seres humanos. Foram realizados quatro tipos de cruzamento entre plantas dessa espécie e obtidos e seguintes resultados: 1. na qual os eritrócitos são pequenos (microcitemia) e em grande número (policitemia). Questão 42 Em uma espécie de planta a forma dos frutos pode ser alongada. (a) talassemia menor.a flor de cor branca nunca se abre.1.é letal na fase adulta.5. b) Represente os alelos por letras e indique os genótipos dos indivíduos parentais e dos descendentes no cruzamento IV. e (b) talassemia maior. 9 1. Questão 41 A herança da cor do olho na espécie humana geralmente é representada simplificadamente como um par de alelos. verificando se elas têm fundamento. analise as afirmações abaixo. proferidas por casais em relação à cor dos olhos de seu bebê.1. . Essa última forma geralmente culmina em morte antes de atingir a idade reprodutiva. Na expressão fenotípica de tais cores não há relação de dominância entre os alelos.2 . oval ou redonda. cor branca . mas a saúde é essencialmente normal. Justifique sua resposta. b) Afirmação de um casal de olhos castanhos: "nosso bebê poderá ter olhos azuis porque o avô paterno tem olhos azuis". determinando cor castanha) e a (recessivo.em um jardim de plantas com flores de cor azul não nascem plantas com flores de cor azul-claro. Estas cores são determinadas por combinações de dois alelos de um único locus. os hachurados.1 a) Formule uma hipótese consistente com os resultados obtidos para explicar a herança da forma dos frutos nessa espécie. determine o modo de herança indicando os possíveis genótipos dos indivíduos envolvidos. determinando cor azul). azul-claro e branca.5. Baseando-se nessa explicação. A partir do heredograma hipotético a seguir onde os símbolos claros representam pessoas normais. Sabe-se que: . A (dominante.aa. caracterizada por uma anemia severa.

A partir das sementes obtidas. provocando aborto precocemente. A princípio. venha a se desenvolver um rabanete de raiz ovalada? Justifique a sua resposta. Em cruzamentos desses indivíduos ovalados entre si. A resistência ou susceptibilidade ao inseticida é devida a um locus com dois alelos. quando em dose dupla. Um fazendeiro tem uma grande boiada constituída de animais vermelhos. como o fazendeiro deverá proceder para estabelecer uma linhagem pura de animais brancos e sem chifres? Por que ele não conseguirá resolver o problema dos chifres rapidamente? Questão 47 O gráfico a seguir mostra a mortalidade de mosquitos de uma determinada espécie quando expostos a diferentes concentrações de um inseticida. ovalado ou alongado. ou seja. Questão 45 Em rabanetes. Questão 46 Em gado. Justifique a resposta. Determine a cor das flores que têm maior possibilidade de se abrirem neste jardim. A e A‚. b) Realizaram-se os cruzamentos possíveis entre as plantas com flores das cores mencionadas. ruão e branca. formou-se outro jardim. aparecem os dois tipos em igual número.1. você recebeu uma delas. em outros cruzamentos. presentes em igual quantidade. a) Qual a relação de dominância entre os caracteres em questão? b) Qual a probabilidade de que. Antes que as sementes germinassem. os pontos distribuem-se ao longo da curva. Utilizando apenas cruzamentos naturais. c) Os indivíduos de cada um dos genótipos não se comportam da mesma forma quanto à resistência ao inseticida e.5. as sementeiras foram distribuídas a diversas pessoas. é controlada por genes codominantes. Considere um casal de anões pseudo-acondroplásicos. e o cruzamento de animais com chifres versus animais sem chifres. produz efeito letal durante o desenvolvimento embrionário.a) Realizou-se o cruzamento entre as plantas com flores azul-claro e. pensou-se que o fenótipo anão seria expresso pelo genótipo D/D ou D/d. 1. Os fenótipos formados são três: arredondado. a cor da pelagem vermelha. às vezes só origina prole sem chifres. formou-se um jardim.2 a) Qual é o genótipo mais resistente? Como você chegou a essa conclusão? b) Observando as três curvas. ocasionalmente produzem prole com chifres. para responder às seguintes questões: 10 . foi considerado que a severidade do alelo dominante. Determine a cor das flores que têm menor possibilidade de se abrirem neste jardim. foram obtidas quatrocentas sementes que foram plantadas em sementeiras individuais. ruões. Questão 48 A pseudo-acondroplasia é um tipo de nanismo determinado geneticamente pelo alelo D autossômico dominante que interfere no crescimento dos ossos durante o desenvolvimento. Entretanto. os quais. Essas diferenças podem ser atribuídas a efeitos pleiotrópicos de outros genes? Justifique sua resposta utilizando o conceito de efeito pleiotrópico. a partir das sementes obtidas. a forma da raiz é determinada por um par de genes alelos. sem recorrer à inseminação artificial. e. Justifique a resposta. que conclusão se pode tirar sobre as relações de dominância entre os alelos deste locus? Explique. Cruzamentos entre plantas de raízes alongadas com plantas de raízes arredondadas produziram apenas indivíduos com raízes ovaladas. na sua sementeira. brancos e sem chifres. por isso.

responsável pela coloração amarela. qual é a probabilidade de. a) Qual cruzamento apresenta resultado de acordo com os valores esperados? b) Como você explicaria o resultado do cruzamento em que os valores observados não estão de acordo com os valores esperados? Questão 50 Em ratos. como seria esperado pela genética mendeliana. 1. quantas destas crianças são homozigotas no loco correspondente a este tipo de nanismo? Questão 49 Observe os cruzamentos a seguir. b) A partir de 40 ovos. em vez de três para um (3:1). qual é a probabilidade que se espera para este evento? e) Em uma outra família. que condiciona a cor cinza. com 3 meninas e 2 meninos. O cruzamento de dois gatos Manx produziu dois gatinhos Manx para cada gatinho normal de cauda longa (2:1). a cor da pelagem é condicionada por gene autossômico.5. o cruzamento de ratos amarelos entre si produziu 2/3 de descendentes de pelagem amarela e 1/3 de descendentes de pelagem cinza.4 11 . a) Qual a explicação para esse resultado? b) Dê os genótipos dos parentais e dos descendentes. quantas fêmeas amarelas adultas são esperadas? Justifique. a) A partir de 20 ovos. porém. Questão 51 Gatos Manx são heterozigotos para uma mutação que resulta na ausência de cauda (ou cauda muito curta). quantos machos cinzas deverão atingir a idade adulta? Justifique. Questão 52 O heredograma a seguir representa uma família com pessoas afetadas por uma doença hereditária. originados do cruzamento de machos amarelos e fêmeas cinzas.1.a) Quais são os genótipos de cada indivíduo do referido casal? b) Caso a mulher deste casal venha dar à luz uma criança. em um eventual quarto nascimento. qual é a probabilidade dela nascer geneticamente com a pseudo-acondroplasia? c) Como o casal já tem três crianças com a pseudo-acondroplasia. originados do cruzamento entre ratos amarelos. e seu alelo c recessivo. sendo o gene C. presença de pernas traseiras grandes e um andar diferente dos outros. todos apresentando a pseudo-acondroplasia. responsável pela coloração cinza. onde o alelo (A) condiciona a cor amarela em camundongos e é dominante sobre o alelo (a). (Utilize as letras B e b para as suas respostas). dominante. Um geneticista observou que o cruzamento de ratos de pelagem amarela com ratos de pelagem cinza resultou descendentes amarelos e cinzas em igual proporção. a criança nascer também afetada? d) Se o casal tem planos para ter uma menina normal em relação a esta condição genética. CRUZAMENTO I (Aa × Aa) 240 amarelos 120 cinzas CRUZAMENTO II (Aa × aa) 240 amarelos 240 cinzas Analise os resultados destes cruzamentos e responda.

qual é a probabilidade de que o casal 4 × 5 tenha uma menina albina? Analise a figura onde se admite que a pigmentação da pele é devida a um par de alelos (A.1.a). de acordo com a presença ou ausência do 12 1. na população. Os indivíduos I . V . a freqüência de heterozigoto para o albinismo é de 1/50. de geração.4 . um grupo de cientistas do "Genetics & IVF Institute" vem testando um novo método que permite a seleção dos espermatozóides a partir de sua coloração. moradores da ilha dos Lençóis.5.a) A doença tem herança dominante ou recessiva? Por quê? b) A doença tem herança autossômica ou ligada ao cromossomo X? Por quê? Questão 53 Analisando a genealogia adiante.1.2. de uma característica expressa em antepassados remotos? b) O albinismo se deve a alelo dominante ou a alelo recessivo? Explique com base na figura.6. numa dada geração.3 e V .4 1. c) Qual a probabilidade de os indivíduos de pigmentação normal da geração V serem todos heterozigotos? Questão 57 Questão 55 No heredograma a seguir os símbolos cheios representam indivíduos portadores de uma anomalia genética.5 % e cinqüenta vezes maior do que entre o restante da população do Maranhão. II . V . situada a oeste de São Luís.5. responda: anomalia? 1. mostra a transmissão do albinismo. Sabendo-se que.1.1.5 são albinos.4 No heredograma adiante o indivíduo 3 é afetado pelo albinismo.4 Questão 56 A figura a seguir.5. onde a freqüência de albinos é de 1.5. adaptada da Folha de São Paulo de 17/03/96. então: a) Que nome se dá ao aparecimento.1. Responda. a) Qual a probabilidade de o indivíduo 3 ser heterozigoto? b) Qual a probabilidade de o indivíduo 5 ser homozigoto recessivo? c) Qual a probabilidade de o indivíduo 6 ser homozigoto dominante? Questão 54 1. na Família de Raimundo e Eleílde da Silva. Qual é a probabilidade de o indivíduo 9 ser portador dessa Nos Estados Unidos.

4 1. o professor lhe apresenta o heredograma a seguir.1.1. e responda às seguintes questões: a) Qual o padrão de herança envolvido na determinação da característica representada no heredograma 1 e no heredograma 2? Justifique sua resposta.4 1. Questão 60 Numa aula de genética. além de satisfazer os anseios de vários casais na escolha do sexo do filho.5.cromossomo Y ('Microsort').5. 1.4 13 . II e III).1. Qual a probabilidade de nascer uma criança doente? Justifique.2 gerarem uma criança afetada do sexo masculino. como representado nos heredogramas a seguir: 1.1 e III.5. a) Qual o tipo de herança da doença? Justifique sua resposta. calcule a chance de os indivíduos III. Questão 59 O padrão de herança de uma doença.1. foi analisada em três famílias diferentes (I. você conclui que se trata de uma herança autossômica dominante. Questão 58 O heredograma a seguir refere-se ao caso de braquidactilia. que mostra a ocorrência de uma anomalia causada pela ação de um par de genes (A e a) em várias gerações de uma família.4 Analise os dois heredogramas anteriores. que se suspeita ser autossômica recessiva ou ligada ao sexo. b) Suponha que a mulher 3 da família I case-se com o homem 4 da família III.5. Identifique e justifique o tipo de herança. considerando que o caráter é determinado por um único par de genes. poderá ser benéfico quando utilizado por famílias portadoras de determinadas anomalias genéticas. b) Em qual das duas situações seria mais recomendado o uso da técnica ('Microsort') para a escolha de um bebê do sexo feminino? Por quê? c) Considerando o heredograma nŽ1. Ao analisar os indivíduos afetados por esta anomalia. Tal método.

14 . B e C a seguir representam três famílias diferentes.5. a) Identifique os heredogramas que são compatíveis com uma herança autossômica recessiva. Os indivíduos 5 e 8 devem ser considerados homozigotos (AA). Justifique sua resposta para cada família.1. responda: a) Por que a anomalia NÃO pode ser recessiva? b) Por que a anomalia NÃO pode ser ligada ao cromossomo X? c) Qual a probabilidade de nascer uma criança afetada pela anomalia. a) Esta doença hereditária é condicionada por gene dominante ou recessivo? b) Dos dez indivíduos que compõem esta genealogia. que apresenta indivíduos afetados por uma doença recessiva e indivíduos normais. qual o único que não pode ter seu genótipo definido? Explique por quê.1.4 Qual a probabilidade de que o cruzamento entre o indivíduo 9 e o indivíduo 10 gere um indivíduo de pelagem branca? Questão 62 Os heredogramas A. Os círculos representam mulheres e os quadrados. b) Determine se em algum dos casos apresentados existe herança ligada ao cromossomo Y. se a mulher (4) da geração F3 tiver filhos com um homem que apresente essa anomalia? Questão 61 No heredograma abaixo a cor preta indica indivíduos com pelagem negra. homens. Os círculos representam as mulheres e os quadrados.5.4 1. enquanto os outros exibem fenótipo normal.5. os indivíduos em escuro apresentam uma doença hereditária. os homens. Justifique. Analise esta genealogia e responda. Questão 64 Analise a genealogia. a menos que haja evidência contrária. A cor branca indica pelagem branca determinada por um gene recessivo. Questão 63 Na genealogia adiante.4 1.Baseando-se EXCLUSIVAMENTE no heredograma apresentado acima.1. Quadrados ou círculos escuros representam indivíduos afetados por uma característica comum na população. fenótipo determinado por um gene autossômico dominante A. 1.

a) Desenhe o heredograma representando os dois casais e seus respectivos pais. qual é a probabilidade de que uma sua irmã tenha esse mesmo gene A? Por quê? Questão 67 Dois irmãos (Pedro e Paulo) casam-se com duas irmãs (Maria e Joana).5. filha de pais normais. mostrando como chegou aos resultados dos itens b) e c). tem uma criança afetada por uma doença muito rara de herança autossômica recessiva. Questão 69 Considere a figura a seguir que representa o resultado da primeira divisão meiótica de uma célula feminina: Toda pessoa na qual o alelo recessivo é detectado recebe orientação a respeito dos riscos de vir a ter um descendente com a anomalia. todos normais. O primeiro casal.1 Calcule a probabilidade de que esse casal venha a ter uma criança com fibrose cística. mas cujo irmão morreu na infância. 1. uma doença autossômica recessiva grave particularmente comum em caucasianos. Discuta a importância dos fatores genéticos na manifestação dessa característica. vítima de fibrose cística. tanto monozigóticos como dizigóticos.4 Questão 68 Alguns centros de pesquisa na Inglaterra estão realizando um programa de triagem populacional para detectar a fibrose cística.2. Justifique sua resposta. sendo ambos do sexo masculino e afetados? Questão 65 Uma determinada característica foi estudada em centenas de pares de gêmeos.1. a) Quais os indivíduos representados na genealogia que são obrigatoriamente heterozigotos? b) Qual a probabilidade de o casal formado pelos indivíduos II2 e II3 ter mais dois filhos. c) Se Paulo e Joana tiverem uma primeira criança afetada pela mesma doença genética.5. qual será o risco de que uma 1. b) Qual é a probabilidade de que uma futura criança de Paulo e Joana venha a ser afetada por essa mesma doença genética? Considere desprezível a probabilidade de uma nova mutação. Um inglês heterozigoto para essa característica é casado com uma mulher normal.segunda criança desse casal também seja afetada por essa mesma doença? Por quê? Justifique suas respostas. a) Indique o genótipo do embrião formado a partir da fecundação do óvulo resultante dessa célula por um espermatozóide de um macho recessivo para os dois pares de genes considerados. b) Quais os possíveis genótipos dos filhos possíveis do mesmo casal? 15 . Questão 66 Se uma abelha operária tem o gene A herdado de seu pai. As diferenças registradas entre os irmãos dizigóticos foram praticamente da mesma magnitude que as encontradas entre os irmãos monozigóticos. Pedro e Maria.

que mostra parte dos resultados dos experimentos de Mendel. após vários cruzamentos. localiza-se o gene responsável pelo padrão da coloração: o alelo dominante M determina padrão uniforme (uma única cor) e o alelo recessivo m.1 a) Os genes para a cor e tamanho de pêlo estão no mesmo par de cromossomas? Justifique sua resposta. apresentam marcantes diferenças em suas características físicas. o padrão malhado (preto / branco ou marrom / branco). responda: a) Por que na geração F1 não foram encontradas sementes rugosas ou verdes? b) O que são os fatores hereditários referidos por Mendel e onde estão situados? c) Faça um diagrama de cruzamento para exemplificar as proporções fenotípicas encontradas na geração F2. qual a proporção esperada de descendentes iguais a ele? Questão 71 A audição normal depende da presença de pelo menos um dominante de dois pares de genes. Em um outro cromossomo. A tabela a seguir apresenta os fenótipos dos pais e os fenótipos das respectivas proles. 1 preto e branco e 1 marrom e branco.2. D e E que se segregam independentemente. O tamanho do pêlo também é controlado por um par de genes. a cor do pêlo negro é determinada por um gene dominante (A) enquanto seu alelo (a) determina a cor branca. pelo alelo recessivo d. a cor preta é condicionada pelo alelo dominante D e a cor marrom.5. Caso você examine a prole de um grande número de casamentos em que ambos os cônjuges são duplo heterozigotos para esses dois pares de genes.Questão 70 Em cobaias. sendo o alelo dominante (B) para pêlo curto e o alelo recessivo (b) para pêlo longo. realizados com ervilhas. a) Quais os genótipos dos pais? b) Se o filho preto e branco for cruzado com uma fêmea cujo genótipo é igual ao da mãe dele.2. Questão 73 Quatro irmãos. filhos legítimos de um mesmo casal.1 1. 3 de cor marrom uniforme. utilizando qualquer uma das características apresentadas na tabela. Descreva três mecanismos biológicos potencialmente responsáveis por essa variabilidade genética e explique como atuam. que proporção fenotípica você espera encontrar? Questão 72 Observe a tabela a seguir.5. 1. 16 . Questão 74 Em uma raça de cachorros. b) Quais são os genótipos mais prováveis dos pais em cada casal? Justifique sua resposta. O cruzamento de um macho de cor preta uniforme com uma fêmea de cor marrom uniforme produz uma ninhada de oito filhotes: 3 de cor preta uniforme. De acordo com a tabela.

1 Identifique qual dos dois casos tem maior probabilidade de representar dois locos no mesmo cromossomo. Questão 79 Considere duas linhagens homozigotas de plantas. Calcule a porcentagem esperada de descendentes fêmeas com pêlo vermelho crespo oriundas do cruzamento de dois animais duplamente heterozigotos.gene A (dominante) ou gene a (recessivo). quais serão seus genótipos e em que proporção espera-se que eles sejam produzidos? Questão 77 Em uma determinada espécie animal. Cruzando indivíduos AABB com indivíduos aabb. quais serão os genótipos das quatro células haplóides geradas? b) Considerando o conjunto total de espermatozóides produzidos por esse animal. Suponha uma planta superior originada de um zigoto no qual dois dos pares de cromossomos. Despreze a parte fracionária de seu resultado.2. uma com caule longo e frutos ovais e outra com caule curto e frutos redondos. As localizações dos alelos desses genes.5. b) Se essa planta se reproduzir por autofecundação. 17 . Os genes para comprimento do caule e forma do fruto segregam-se independentemente. foram analisadas duas características com segregação independente e herança co-dominante: cor e textura do pêlo. os homozigotos podem ser vermelhos ou brancos. quando cruzados entre si. assim como o alelo para fruto redondo. 1. têm a constituição AA‚BB‚. a) Qual será a constituição cromossômica da planta adulta originada desse zigoto? Justifique. foram obtidos 100% de indivíduos AaBb que. loco 2 . os homozigotos têm pêlo liso ou crespo. A e B. a constituição cromossômica de seus descendentes será igual à da planta mãe? Justifique. as proporções fenotípicas dependem de os referidos locos estarem ou não no mesmo cromossomo. Na Tabela 2. estão indicadas nos cromossomos representados no desenho. considerando apenas dois locos. Para a textura. Questão 78 1. Para a cor do pêlo. estão representadas duas proporções fenotípicas (casos 1 e 2) que poderiam resultar do cruzamento de dois indivíduos AaBb. Sem interação entre os dois locos. Justifique sua resposta.2. O alelo que determina caule longo é dominante.5. Questão 76 A figura mostra a segregação de dois pares de cromossomos homólogos na anáfase da primeira divisão meiótica de uma célula testicular de um animal heterozigótico quanto a dois genes. cada um com dois genes alelos: loco 1 .1 a) Ao final da segunda divisão meiótica dessa célula. identificados pelas letras Aa e Bb.gene B (dominante) ou gene b (recessivo). podem formar indivíduos com os genótipos mostrados na Tabela 1. caso exista.Questão 75 Um pesquisador está estudando a genética de uma espécie de moscas.

A condição normal (I_) produz um fenótipo normal. Admite-se que dedos nas mãos anormalmente curtos (braquidactilia) sejam devido a um genótipo heterozigoto para um gene letal embrionário (BBL). qual será a probabilidade de um futuro filho do casal ter sangue do tipo A? E do tipo B? Questão 85 O pai e a mãe de um par de gêmeos monozigóticos têm tipo sangüíneo A. Ao final do julgamento. 95. a criança do grupo B e Chaplin do grupo O. 58. No caso do Sistema ABO. b) estão ligados. cujo grupo sangüíneo é A. o famoso cineasta Charlie ChapIin foi acusado de ser o pai de uma criança. Em termos de localização cromossômica. a) O veredicto é aceitável? Por quê? b) Na hipótese de Chaplin ter tido filhos com a referida mulher. set.) a) O que são antígenos? b) Qual a importância de se identificar a presença de antígenos eritrocitários (presentes nas hemácias ou eritrócitos) no sangue humano? 18 . os antígenos estão presentes no sangue dos grupos A. vol. cujo grupo sangüíneo é B. pergunta-se: a) qual é o grupo sangüíneo do homem em questão? b) qual ou quais os possíveis grupos sangüíneos usados erroneamente na transfusão? Questão 87 "Os grupos sangüíneos são determinados pela presença ou ausência de antígenos na superfície das hemácias. Chaplin foi considerado como sendo um possível pai da criança. Utilize as letras A. Qual é a probabilidade de um casal de braquidáctilos e heterozigotos para a idiotia amaurótica infantil vir a ter um descendente normal? Questão 83 Nos anos 40. ("Reserva estratégica de sangue". de que tipos sangüíneos eles poderiam ser? Questão 84 Um tratamento utilizado para certos tipos de doenças do sangue é a destruição completa da medula óssea do paciente e implante de células medulares sadias provenientes de um doador. B e b. CIÊNCIA HOJE. Sabendo-se que seus pais pertenciam aos grupos B (homozigoto) e AB. Os exames de sangue revelaram que a mãe era do grupo A.a) De que forma podem ser obtidas plantas com caule curto e frutos ovais a partir das linhagens originais? Explique indicando o(s) cruzamento(s). fato que ele não admitia. B. o homozigoto (BB) é normal e o outro homozigoto (BLBL) morre prematuramente. Eugênio. Uma outra criança desse casal é do grupo sangüíneo O. a) Quais os genótipos do pai e da mãe? b) Qual é a probabilidade de que ambos os gêmeos tenham sangue do tipo O? Questão 86 Um homem faleceu por causa de uma transfusão de sangue. recebeu um transplante de medula óssea de seu irmão Valentim. e a operação foi bem sucedida. 19/nŽ 113. SBPC. a para comprimento do caule e B. explique o que significa dizer que esses dois genes a) segregam-se independentemente na formação dos gametas. AB e ausentes no grupo O". p. qual será a probabilidade de nascer um indivíduo de genótipo aabbCcDD? Questão 82 Idiotia amaurótica infantil é uma doença hereditária recessiva (ii) que causa a morte nos primeiros anos de vida. Questão 81 Do cruzamento de AaBbccDd x aaBbCcDd. b para forma dos frutos. a) Qual será o grupo sangüíneo de Eugênio após o transplante? Por quê? b) Sabendo-se que a mãe e a esposa de Eugênio têm sangue do tipo O. b) Em que proporção essas plantas de caule curto e frutos ovais serão obtidas? Questão 80 Considere dois genes e seus respectivos alelos: A e a. de Ricardo Lorzetto.

Lalau (indivíduo II-1) elaborou o seguinte heredograma sobre a herança de grupos sangüíneos do sistema ABO. responda: a) Quem do grupo anterior NÃO possui os aglutinogênios em suas hemácias? b) Por que Joana pode receber sangue de outros membros do grupo? c) Que tipo de aglutinina possuem Cassilda e Saildo.O Saildo . Questão 90 Pode-se usar o sistema ABO para "excluir" um suposto pai em uma investigação de paternidade. e não aglutina quando colocado em presença de imunoglobulinas ou aglutininas anti-B. sangue B. Com os dois maridos. tinha sangue AB e era daltônico.5. A tabela a seguir mostra os fenótipos do filho e da mãe em três casos. verificar se o homem acusado pode ser considerado como um pai impossível.1 19 . Qual dos homens foi o primeiro marido? Justifique sua resposta. Paulo. Iß. basta determinar o genótipo e o fenótipo do suposto pai e.B Doaldo . O casal tem um filho cujo sangue não aglutina em nenhum dos dois tipos de soro. ficou viúva e casou pela segunda vez. Questão 91 Nas quatro pessoas relacionadas a seguir. tinha sangue A e visão normal. grupo ABO. i. respectivamente? Questão 92 Ao descobrir que seu genótipo era homozigoto.A Com base nesta relação. daltônico. Um dos maridos. sangue O. 5) mulher. daltônica. sangue A. Questão 89 O sangue de Orlando aglutina quando colocado em presença de soro contendo imunoglobulinas ou aglutininas anti-A.1 Indique os fenótipos dos pais que NÃO poderiam ser os pais biológicos de cada caso. com sangue tipo A e visão normal.Questão 88 O daltonismo. 2) homem. daltônico.3. é determinado por um gene localizado no cromossomo sexual X. a) Qual o genótipo dos pais? b) Qual a probabilidade de esse casal ter uma criança cujo sangue aglutine nos dois tipos de soro? Justifique sua resposta. é determinado por três alelos autossômicos: IÞ.3. ou cegueira para as cores. visão normal. José. sangue A. 1. 4) mulher. a mulher teve cinco filhos na seguinte ordem: 1) homem. visão normal. sangue A. que apresenta aglutinações inversas. Para tal. Orlando casa-se com Leila. 3) mulher. por comparação com os fenótipos e genótipos do filho e da mãe.AB Cassilda .5. O tipo de sangue. 1. Uma mulher. foram encontrados os seguintes tipos sangüíneos: Joana . o outro marido. o Sr.

1. um juiz pode utilizar a análise dos grupos sangüíneos e teste de DNA para ajudar a solucionar questões semelhantes. b) Qual deveria ser o grupo sangüíneo do homem para que a decisão pudesse ser conclusiva? c) Com base no teste de DNA. Ao propor dividir a criança ao meio. Analisando-os.a) Identifique o grupo sangüíneo do indivíduo I-1: b) Qual o genótipo do indivíduo II-5? c) O Sr.1 Após identificar os pais do bebê nŽ 2. que 20 1. uma das mulheres desistiu. o juiz não pôde chegar a nenhuma decisão conclusiva. cujos resultados obtidos são mostrados na tabela adiante.qual a probabilidade de ter outra com os mesmos fenótipos sangüíneos? Obs. responda: a) Qual a probabilidade de o casal formado por 5 e 6 ter duas crianças com sangue AB Rh®? b) Se o casal em questão já tiver uma criança com sangue AB Rh ®. pode-se identificar os pais de cada bebê. em que o alelo IÞ.3.: indique os passos que você seguiu para chegar às respostas. B e O.1 Questão 95 O rei Salomão resolveu uma disputa entre duas mulheres que reclamavam a posse de uma criança. como Rh® e Rh−. b) Explique por que uma pessoa com sangue tipo O é doadora universal mas só pode receber sangue do tipo O. Nos tribunais modernos.5. é codominante sobre o alelo Iß. Lalau poderá ser receptor de sangue de seu genro para transfusão? d) O indivíduo III-5 NÃO poderá ser de qual grupo sangüíneo? e) No caso do casal III-3 e III-4 ter uma segunda criança. em a e b. enquanto uma pessoa com sangue AB é receptora universal mas não pode doar para os outros tipos. Analisando uma situação em que uma mulher de sangue A atribuía a paternidade de seu filho de sangue O a um homem de sangue B. a) Explique como o sangue de uma pessoa pode ser identificado em relação aos sistemas ABO e Rh. em porcentagem. de que um futuro irmão deste bebê seja do sexo masculino e venha a ter tipo sangüíneo diferente do irmão. Por que o teste de DNA permite tirar conclusões tão precisas em casos como este? Questão 96 Os grupos sangüíneos humanos podem ser classificados em 4 tipos: A. a) Explique por quê. AB. calcule a probabilidade. Os casais e os bebês foram submetidos à tipagem do sangue quanto ao sistema ABO. O rei então concluiu que aquela que havia desistido era de fato a mãe verdadeira. Questão 94 Com base no heredograma a seguir. pelo sistema ABO e. caso exista.3. qual é a probabilidade dela ser uma menina e do grupo sangüíneo "B"? Questão 93 Dois casais suspeitavam da troca de seus bebês no berçário da maternidade. Questão 97 Um exemplo clássico de alelos múltiplos é o sistema de grupos sangüíneos humano. .5. de acordo com o sistema Rh. o juiz concluiu que o homem era pai da criança. que codifica para o antígeno A. Despreze a parte fracionária do seu resultado.

5. Dois tipos de soros. Pedro. Questão 102 1. são necessários para a identificação dos quatro grupos sangüíneos: A. na falta de sangue do mesmo tipo. Mário. Os dados obtidos compõem a tabela a seguir: a) Quais as freqüências dos alelos M e N nessa população? b)Essa população está em equilíbrio de Hardy-Weinberg para esse loco gênico? Questão 99 Duas mulheres disputam a maternidade de uma criança. podem ser feitas transfusões de pequenos volumes de sangue O para pacientes dos grupos A.codifica para o antígeno B. Dois dos irmãos são gêmeos univitelinos. 1. por que cada indivíduo é portador de somente dois alelos? Questão 98 Uma população humana foi testada quanto ao sistema MN de grupos sanguíneos. com o uso do soro anti-Rh (anti-D) como mostra o esquema a seguir.3. B ou AB. um dos gêmeos. B ou AB. a) Complete o quadro a seguir com os genótipos e as reações antigênicas (represente com os sinais + e -) dos grupos sangüíneos indicados. AB e O. Na impossibilidade de se fazer um exame dos tipos sangüíneos.3. ao nascer. apresentou a doença hemolítica ou eritroblastose fetal.2 Nas transfusões sangüíneas. b) Como evitar sua ocorrência? c) Qual o procedimento usual para salvar a vida do recém-nascido com eritroblastose fetal? Questão 101 Um indivíduo pertencente aos grupos sangüíneos AB e Rh positivo é considerado receptor universal ideal. O sangue das duas mulheres foi testado . a) Explique como ocorre a eritroblastose fetal. sofreu um acidente e precisa urgentemente de uma transfusão de sangue.2 1. B. o que pode levar recém-nascidos à morte. Explique o problema que pode ocorrer se forem fornecidos grandes volumes de sangue O para pacientes A. Érica e Ana. anti-A e anti-B. que não codifica para qualquer antígeno. Questão 103 Um casal tem cinco filhos: Alex.5. Ambos os alelos são dominantes sobre o alelo i. Érica.1 Qual das mulheres poderia ser a verdadeira mãe daquela criança? Justifique sua resposta. Questão 100 Na eritroblastose fetal ocorre destruição das hemácias. o doador deve ter o mesmo tipo de sangue que o receptor com relação ao sistema ABO. que. Em situações de emergência. e os únicos doadores disponíveis são seus irmãos. Certo ou errado? Justifique sua resposta.5.3. responda: 21 b) Embora 3 alelos distintos determinem os grupos sangüíneos ABO humanos.

qual seria a pessoa mais indicada para ser o doador? b) Justifique sua resposta.3. 1/8 ervilha e 1/8 simples. Já os cães com genótipos "EE" ou "Ee" apresentam pigmento nos pêlos. R_ee crista rosa. Assim o genótipo R_E_ determina crista noz. foi cruzado com uma fêmea preta e com uma fêmea marrom. pelagem dourada. Um galo de crista noz cruzado com uma galinha de crista rosa produziu a seguinte geração: 3/8 noz.a) Entre seus irmãos. quanto aos dois genes mencionados? b) Que tipos de gameta e em que proporção esse macho 22 .5. rosa e ervilha. Questão 105 As três cores de pelagem de cães labradores (preta. forma? c) Qual é o genótipo da fêmea preta? d) Qual é o genótipo da fêmea marrom? Questão 106 Em galinhas há quatro tipos de cristas: simples. com pelagem dourada. Questão 104 No quadro a seguir. com a galinha B de crista ervilha produziu 3 noz: 1 rosa: 3 ervilha: 1 simples e com a galinha C de crista noz a geração tinha 100% crista noz. pretos e marrons. as duas colunas da direita demonstram esquematicamente o aspecto "in vitro" das reações no sangue dos indivíduos de cada grupo sangüíneo ABO aos anti-A e Anti-B. 1. Explique por que a aglutinação não ocorreria se o aglutinogênio fosse uma proteína citoplasmática. por isso. A partir desses dados responda: a) Quais os genótipos paternos? b) Os genes em questão obedecem a segunda lei de Mendel? Justifique. Crista Rosa = R_ee Crista Ervilha = rrE_ Crista Noz = R_E_ Crista Simpes = rree Um galo com crista noz foi cruzado com três galinhas. Utilizando a tabela a seguir determine o genótipo do galo e das três galinhas. rrE_ crista ervilha e o genótipo eerr determina crista simples. Em ambos os cruzamentos. Com a galinha A de crista noz produziu na geração 3 noz: 1 rosa. Observe os fenótipos e genótipos. enquanto os com genótipos "BB" ou "Bb" apresentam pelagem preta. Na determinação desses tipos de cristas atuam dois pares de genes (Rr e Ee). marrom e dourada) são condicionadas pela interação de dois genes autossômicos. Os cães homozigóticos recessivos "ee" não depositam pigmentos nos pêlos e apresentam. Questão 108 As reações enzimáticas a seguir indicam a passagem metabólica que sintetiza pigmentos em uma planta. b) Sabe-se que o aglutinogênio é uma proteína da membrana das hemácias. Um labrador macho. a) Qual é o genótipo do macho dourado. Questão 107 Em galinhas domésticas o tipo de crista é determinado por dois pares de genes com segregação independente. noz. que pode ser preto ou marrom.4 a) Explique o fenômeno que ocorreria com as hemácias de um indivíduo do grupo A ao receber sangue de um indivíduo do grupo B. foram produzidos descendentes dourados. 3/8 rosa. cada um deles com dois alelos: "Ee" e "Bb". dependendo do outro gene: os cães homozigóticos recessivos "bb" apresentam pelagem marrom.

impede a produção dos pigmentos rosa e vermelho. b) Do cruzamento de dois camundongos aguti obtiveram-se descendentes na seguinte proporção: 9 aguti: 3 pretos: 4 albinos. Observe os dois pares de genes envolvidos e os fenótipos relativos aos tipos de coloração dos camundongos. O gene B. Responda: a) No cruzamento entre indivíduos de genótipos AaBb×aabb. devido à não produção de enzima X.5. Determine a proporção esperada entre as cores das plantas descendentes na primeira geração do cruzamento AaBb×AABb.1. . CITE todos os genótipos possíveis para os camundongos albinos obtidos e APRESENTE UMA EXPLICAÇÃO para a alteração da proporção 9:3:3:1 (esperada em cruzamento de diíbridos) para 9:3:4. c) CITE a probabilidade de se obterem camundongos pretos do cruzamento de albinos (duplo homozigotos) com aguti (duplo heterozigotos).5.1 Considere as seguintes condições: .uma única cópia funcional da enzima A ou da enzima B é suficiente para catalisar normalmente a sua respectiva reação. encontrado comumente na natureza.4. a) Do cruzamento entre camundongos preto e albino obtiveram-se 100% de camundongos aguti.2 Utilizando essas informações e seus conhecimentos. os alelos A e B produzem enzimas funcionais. impossibilita a conversão de pigmento rosa em vermelho. Os genes A e B são dominantes sobre os seus alelos. em homozigose recessiva. temos que: O gene A é epistático sobre o gene B e.4. quando em homozigose recessiva (aa). enquanto os alelos a e b produzem enzimas inativas. Questão 109 Analisando a via metabólica hipotética. o tipo selvagem. Duas outras colorações são também observadas: preta e albina. faça o que se pede.para as enzimas A e B. 23 . apresenta pelagem de coloração acinzentada (aguti). qual será a proporção fenotípica esperada na progênie? b) Quais são os possíveis genótipos para os indivíduos vermelhos? c) Quais os fenótipos esperados e suas respectivas proporções em F‚ obtidos a partir de parentais AABB × aabb? Questão 110 Em camundongos. DÊ os genótipos dos camundongos envolvidos no cruzamento. A _ B _ = Aguti A _ bb = Preto aaB _ e aabb = Albinos 1.

foi cruzada com outra planta. XXY. 3/8 de plantas com frutos amarelos e 1/8 de plantas com frutos verdes. como o seu alelo b. produtora de frutos amarelos. Um indivíduo anormal. Considere o padrão de determinação de sexo. Cobaias albinas homozigotas foram cruzadas e todos os descendentes nasceram pretos. mas. Questão 117 Esta figura representa uma célula humana na qual uma estrutura está indicada pela seta. responda: a) Como se chama esse tipo de interação? b) Qual a proporção fenotípica correta entre os descendentes do cruzamento de plantas heterozigotas para esses dois pares de genes? Questão 113 Existe um gene em cobaias que suprime o efeito do gene que determina a coloração nesses animais. a) Qual genitor formou o gameta com 24 cromossomos? Explique. adotando o mesmo critério utilizado para a montagem de cariótipo da espécie humana. além desses. II. Seus genitores tinham visão normal para cores. Questão 114 O daltonismo tem herança recessiva ligada ao X. restando. pergunta-se: a) Por que é o pai quem determina o sexo da prole? b) Por que os filhos homens de pai hemofílico nunca herdam essa característica do pai? Questão 116 Um geneticista. ele é inibido e produz frutos brancos.Questão 111 Na herança da cor do fruto da moranga. estão envolvidos dois pares de genes A/a e B/b. considerando-se que não ocorreu mutação? Justifique.5. mas o gene B inibe a ação do gene A. dois cromossomos de tamanhos distintos.5. Esse gene está localizado em um cromossomo diferente daquele em que está o gene que determine a cor do animal. 1.1 24 . conseguindo formar dez pares de cromossomos. produtora de frutos brancos. é cruzada com outra. era daltônico. na presença do gene A. justificando sua resposta. Uma planta. igual ao do humano e determine: a) quantos cromossomos existem. Como isto pode ser explicado. produtora de frutos verdes. o gene B condiciona fruto branco e o gene A condiciona fruto amarelo. O gene B produz frutos amarelos. nessa espécie desconhecida. b) o sexo a que pertence o animal da espécie em questão. com cariótipo 47. Questão 115 Com relação à espécie humana. b) O erro ocorreu na primeira ou na segunda divisão da meiose? Explique. Responda: a) Que denominação se dá a este tipo de interação entre os genes A e B? b) Quais os genótipos das plantas I e II? Questão 112 Numa dada planta. que será chamada de planta I. filha desse cruzamento. respectivamente. nos óvulos. nos espermatozóides e nas células musculares dessa espécie animal. montou o cariótipo de certa espécie animal desconhecida. O duplo recessivo condiciona fruto verde. O indivíduo duplo recessivo produz frutos verdes. Uma planta homozigota. Considerando que tais genes apresentam segregação independentemente um do outro. O cruzamento entre a planta I e a planta II produziu 4/8 de plantas com frutos brancos.

c) Utilizando a letra A para designar um conjunto de autossomos e as letras convencionalmente usadas para representar os cromossomos sexuais. isto é. Algumas mulheres. ficam com a pele toda manchada. A tabela a seguir mostra os resultados da classificação dos cromossomos de 4 tecidos de um paciente submetido a transplante de medula. são tratados com transplantes de medula óssea. Caso contrário. 1. CITE o número cromossômico dessa célula caso ela pertença a um indivíduo normal e um indivíduo cujo sexo não é compatível com a presença da estrutura indicada. Questão 119 Fazendeiros que criam gado leiteiro podem. 25 . uma parte da medula óssea de um doador sadio é introduzida na coluna vertebral de um paciente cujas células da medula óssea foram previamente eliminadas com auxílio de drogas ou de radiação. Promovendo o intercruzamento destes descendentes. que é uma anomalia caracterizada pela ausência das glândulas sudoríparas. Identifique o cromossomo humano que sofre menos recombinação. Após o transplante de medula é possível identificar os cromossomos de células de diversos órgãos e tecidos. é reimplantado no útero da vaca. O alelo que determina a coloração carijó é dominante sobre o alelo para a cor branca. qual a vantagem dessa prévia determinação do sexo dos embriões? b) Por que o "kit" pesquisa somente a presença do cromossomo Y? Questão 120 Durante o processo de meiose ocorre a recombinação gênica. O cruzamento de uma galinha branca com um galo carijó produziu somente aves carijós. Esse gene se localiza no cromossomo sexual X. mas não a possui. Nesses transplantes. o sexo feminino é heterogamético. ele é eliminado ou congelado para uso futuro.5.1 a) Explique a formação dessas manchas do ponto de vista genético. a) CITE o nome da célula representada e sua principal função. a troca de seqüências de ADN entre cromossomos homólogos. a coloração das penas é uma característica condicionada pelo gene C e é ligada ao sexo. qual seria a proporção fenotípica esperada? Demonstre os cruzamentos.5. Questão 121 Na espécie humana existe um gene raro que causa a displasia ectodérmica anidrótica. portadoras desse gene em heterozigose. a) Para esses fazendeiros. b) Por que esse mosaico não pode aparecer em um homem? Questão 122 Certos tipos de câncer. Justifique sua resposta. Se o embrião for fêmea. em especial aqueles ligados às células do sangue. Questão 118 Em galinhas domésticas. quando se passa um corante sobre a pele. b) CITE o nome da estrutura indicada pela seta e JUSTIFIQUE a existência da estrutura nessa célula. usando um "kit" que determina a presença do cromossomo Y. d) DENOMINE a síndrome que designa o indivíduo cujo sexo é compatível com a presença da estrutura indicada. formando um mosaico de manchas claras e escuras. atualmente.Com base na figura e em conhecimentos sobre o assunto. Numa determinada raça. determinar o sexo dos embriões logo após a fertilização.

26 1. portador de um cromossomo Y. Este corpúsculo é conhecido hoje como cromatina sexual ou corpúsculo de Barr. foi então promulgada uma lei segundo a qual todas as mulheres que tivessem um filho homem não mais poderiam ter filhos. fenotipicamente normal.5.). revelou a existência de duas cromatinas sexuais em todos eles. . pois apresentava órgãos sexuais internos masculinos e órgãos sexuais externos femininos.5. Com esse objetivo. Se o cromossomo X de uma fêmea com cariótipo 2AXX sofrer não-disjunção meiótica e o óvulo resultante com 2 cromossomos X for fecundado por um espermatozóide normal. dando origem a um descendente com cariótipo 2AXXY. As demais mulheres poderiam continuar a ter filhos até que tivessem um filho homem. Questão 123 O governo de uma sociedade totalitária decidiu conter a expansão demográfica reduzindo a proporção de homens na população.1 Com base nesses resultados. Responda: a) Quantos cromossomos X tem esta mulher? b) Se ela se casar com um homem normal. Questão 124 Em uma 'Drosophila melanogaster'. um pequeno corpúsculo de cromatina intensamente corado.) do descendente acima referido? Uma revista publicou uma reportagem com o título "Atleta com anomalia genética faz operação para definir seu sexo e poder competir na classe feminina de judô". pergunta-se: a) Qual é o sexo do descendente com cariótipo 2AXXY? b) Sabendo-se que o sexo da 'Drosophila melanogaster' pode ser definido por um índice sexual (I. mas por um balanço gênico entre genes femininizantes e masculinizantes. que testes citogenéticos você faria para comprovar esta afirmação? Questão 128 Um casal de não hemofílicos tem um filho com hemofilia. Os testículos da atleta fora extirpados para que ela pudesse competir na equipe feminina de judô a) Que vantagem a atleta levaria sobre as demais competidoras se tivesse os testículos durante a competição? b) Sabendo-se que ela foi considerada do sexo feminino. a determinação do sexo não é feita simplesmente pela presença ou ausência do cromossomo Y. que a jovem era um caso de pseudo-hermafroditismo.S. identifique o sexo do paciente e o sexo do doador.S. Justifique sua resposta. qual é a relação que expressa esse índice? c) Qual é o índice sexual (I. a) A que corresponde tal corpúsculo e em que tipo de células (somáticas ou germinativas) ele aparece? b) Qual a sua importância e por que ele não ocorre nas células masculinas? Questão 126 A análise dos núcleos interfásicos de células da mucosa oral de uma mulher. A matéria dizia. a) Qual é a probabilidade de que uma filha desse casal apresente a doença? b) Qual é a probabilidade de que um outro filho desse casal seja também hemofílico? Justifique suas respostas. ainda. qual a probabilidade de ter uma filha com constituição cromossômica igual à sua? Questão 127 Essa lei atingirá o objetivo desejado depois de algumas gerações? Justifique sua resposta.Questão 125 Na década de 40 descobriu-se que algumas células retiradas de mulheres apresentavam no núcleo interfásico.

5. 1.2 Questão 133 O gene recessivo d está localizado no cromossomo X e é responsável pelo daltonismo na espécie humana. 1. qual o número esperado para crianças do sexo masculino. Com base nessas informações e nas contidas na árvore genealógica adiante. qual era o fenótipo da avó materna? Justifique sua resposta. qual é a probabilidade de que o próximo filho homem desse casal venha a ser hemofílico? a) Que padrão de herança explica melhor a genealogia? Justifique sua resposta. 1. b) Se os dois maridos da mulher fossem irmãos isto poderia alterar sua resposta anterior? Por quê? Questão 131 No heredograma a seguir.2 Questão 132 O gene recessivo h está localizado no cromossomo X e é responsável pela hemofilia na espécie humana.5. Supondo que quinze de suas gestações se completem. ocorrem dois meninos hemofílicos.Questão 129 Uma mulher é portadora de um gene letal ligado ao sexo.5. responda à seguinte pergunta: se a mulher 4 casar com um homem normal e seu primeiro filho for um menino hemofílico. ela teve quatro filhos.2 a) Qual é a probabilidade de que uma segunda criança de II-4 e II-5 seja afetada? b) Qual é a probabilidade de II-2 ser portadora do alelo que causa a hemofilia? c) Se o avô materno de II-4 era afetado. Questão 130 Uma mulher clinicamente normal casou-se duas vezes. Com base nessas informações e nas contidas na árvore genealógica adiante. que causa aborto espontâneo. Conforme mostrado na genealogia a seguir. dois de cada casamento. A hemofilia tem herança recessiva ligada ao cromossomo X. responda à seguinte pergunta: se a mulher 5 se casar com um homem daltônico.5. em ambos os casos com indivíduos normais e que não eram seus consangüíneos. qual é a probabilidade de 27 .5. todos afetados por uma doença genética muito rara.5. entre as que nascerem? Justifique sua resposta.

diversos membros são afetados por raquitismo resistente ao tratamento com vitamina D. gere filhas e filhos afetados pela doença. ao casar com uma mulher normal. após constatar que a família reside em um grande centro urbano. Homens: XDY .5. os símbolos sombreados representam indivíduos daltônicos em um dos ramos da família Abreu.2 1.5. localizada na parte não homóloga do cromossomo X. que causa aborto espontâneo. isto é. consultou um geneticista que.Visão normal XDXd .2 28 . bem como a inexistência de casamentos consangüíneos. formule a conclusão do geneticista quanto à possibilidade de o consultante transmitir a doença a seus descendentes diretos. preparou o heredograma abaixo. Questão 136 O daltonismo (cegueira para as cores) se deve a uma mutação recessiva ligada ao sexo. b) Calcule os valores correspondentes à probabilidade de que o primo doente do consultante. há gerações. 1.Visão normal XdXd .Visão normal XdY . qual o número esperado para crianças do sexo feminino entre as que nascerem? Justifique sua resposta. Sendo assim.5. podemos representar genótipos e fenótipos de homens e mulheres como no quadro a seguir. o consultante está indicado por uma seta.5. Preocupado com a possibilidade de transmitir essa doença.5. Supondo que nove de suas gestações se completem.Daltônico Mulheres: XDXD .que o próximo filho homem desse casal venha a ser daltônico? a) Sabendo que a doença em questão é um caso de herança ligada ao sexo.2 Questão 134 Uma mulher é portadora de um gene letal ligado ao sexo. 1. de Maranguape.Daltônica Na figura a seguir.5. Nele. Questão 135 Um homem pertence a uma família na qual.

10. b) Quais são os prováveis genótipos dos indivíduos II-2. embora sejam raras. leis da probabilidade.5.risco de ela vir a ter uma criança hemofílica. responda: a) A mãe do cruzamento I é homozigota ou heterozigota? Justifique. para representar os genes.2 e IV. explique por que o pêlo de uma gata pode ter três cores. a) Qual a principal característica clínica da hemofilia A? Justifique por que esse sintoma clínico aparece nos afetados. considerando o seu casamento com um homem normal (indivíduo III‰). 1. Estas células receberam cópias do gene normal para o fator VIII e foram posteriormente reintroduzidas no indivíduo. por meio das . responda: a) Quais os genótipos dos indivíduos II. tendo em vista as informações e usando os símbolos dados.2 Questão 139 1.1. Questão 140 Uma das primeiras experiências de terapia genética foi realizada com indivíduos hemofílicos cujo gene para o fator VIII de coagulação era defeituoso.2 e IV. ela ser do sexo masculino e daltônico? Justifique sua resposta.5. Questão 137 Na espécie humana há algumas condições dominantes ligadas ao cromossomo X. c) Quais todos os genótipos prováveis para os descendentes (filhos e filhas) de um possível casamento entre IV. tem vários parentes com hemofilia clássica ou hemofilia A.9? b) Qual a probabilidade de.5.9 e III. Existe um terceiro gene autossômico (não localizado nos cromossomos sexuais) que é responsável pela cor branca. A figura a seguir mostra o heredograma de um tipo de diabetes que leva a problemas no metabolismo do fosfato e dos carboidratos.5.Analisando a figura. III-4 e III-5? Questão 138 MS (indivíduo IIIˆ) está grávida. Os resultados mostraram um aumento significativo na produção do fator VIII nos indivíduos tratados. Um deles é responsável pela cor preta e o outro pela cor amarela. Na terapia foram retiradas células da pele do paciente.9? Justifique sua resposta. Como não tem recursos para fazer o diagnóstico pré-natal dessa doença pelo estudo do DNA fetal. o seu risco e também o de sua família de vir a ter uma criança com essa doença. Supondo que o indivíduo tratado venha a ter filhos com 29 Com base no enunciado e na análise do heredograma. IV. III. Ela quer obter mais informações sobre a hemofilia A e conhecer. no quadro anterior. nascendo uma criança de III.2 A cor do pêlo dos gatos depende de um par de genes alelos situados no cromossomo X.risco de sua prima (indivíduo III„) vir a ter uma outra criança hemofílica do mesmo casamento com o indivíduo III…. procurou um geneticista.7. 2. b) Analise a Árvore Genealógica de MS e informe: 1. Com essas informações. enquanto o pêlo de um gato só pode ter duas cores.

o heredograma a seguir começou a ser elaborado para que fosse determinado o genótipo e. enquanto que a da família 2 é uma doença degenerativa fatal que aparece em torno dos 40 anos de idade. responda: 1.5. A doença que acomete a família 1 provoca retardamento mental acentuado.2 1. atenda às solicitações a seguir. a) indique os genótipos dos indivíduos. ou.2 e considerando que os indivíduos apresentam. Sabendo-se que o loco do gene para o daltonismo está no cromossomo X. Questão 142 Os heredogramas a seguir representam duas famílias com doenças hereditárias distintas.5. a) Quais os tipos de herança envolvidos na transmissão das doenças de cada família? Justifique sua resposta. b) Considerando que a seleção natural pode eliminar doenças genéticas. Questão 143 Com o objetivo de reconstruir a história familiar de um caso de herança de daltonismo.5.2 30 . simultaneamente. Questão 141 Seguindo a representação a seguir 1. fenótipo dos indivíduos.5. e ausente no Y. b) construa um heredograma no qual três desses indivíduos sejam os filhos biológicos (legítimos) dos outros dois.5. c) discuta a possibilidade de uma mulher hemofílica e albina ser filha biológica dos pais propostos no heredograma que você construiu. dois caracteres genéticos com mecanismos de herança distintos.5. explique por que a doença da família 2 ainda poderia ser encontrada em indivíduos da geração VI (netos da geração IV). existe possibilidade de nascimento de uma criança não hemofílica? Justifique sua resposta. Após analisar os heredogramas.uma mulher cujos genes para o fator VIII sejam defeituosos.

5. ela supôs que o problema teria surgido porque o pai da criança trabalhava em uma usina nuclear e teria ficado exposto a radiações que alteraram seu material genético. poderão ter uma menina normal homozigota? Justifique. o número de mulheres afetadas pelo daltonismo é baixo quando comparado com o número de homens afetados pela anomalia. José procurou um veterinário que. b) Tendo em vista o tipo de herança mais provável.5 são daltônicos. quais os genótipos dos indivíduos II-4 e II-5? Uma mulher deu à luz um menino com hemofilia. Os círculos representam as mulheres e os quadrados. neste heredograma. a) Qual o tipo mais provável da herança desta anomalia? Justifique. os homens. a) O que é e qual o tipo de aneuploidia que o gato de José apresenta? b) Qual a explicação dada pelo veterinário relacionando a anomalia com as cores do animal? Questão 147 O daltonismo é comumente entendido como a incapacidade de enxergar as cores verde e/ou vermelha. a) Qual a probabilidade de João ter herdado do pai o gene para daltonismo? Qual a probabilidade de Maria ter herdado do pai o gene para daltonismo? b) Por que é mais freqüente encontrarmos homens daltônicos que mulheres daltônicas? Questão 148 1. Nos indivíduos daltônicos. A percepção de cores é devida à presença de diferentes tipos do pigmento retinol nos cones da retina. quantas pessoas A MAIS.5. Um homem daltônico casou-se com uma mulher de visão normal em cuja família não havia relatos de casos de daltonismo.1 e III . responda. imediatamente fez o seguinte diagnóstico: trata-se de um caso de aneuploidia de cromossomos sexuais.4 vierem a se casar e ter filhos.a) Se os indivíduos I . alguns desses pigmentos não estão presentes. Supondo-se que a freqüência de homens daltônicos nas populações seja de 10%. ambos ligados ao sexo. responda: a) Por que o daltonismo é raro nas mulheres? b) Quantas vezes os homens daltônicos são mais freqüentes nas populações do que as mulheres daltônicas? Questão 145 A genealogia representada na figura é de uma família com uma anomalia rara na espécie humana. 31 . Este casal teve dois filhos: João e Maria. Como nenhum de seus parentes próximos era hemofílico. c) Se os indivíduos III . alterando a percepção das cores.5 poderá ter irmão normal? Justifique. também deverão apresentar este fenótipo? b) O indivíduo II . Questão 144 Na espécie humana.2 Com base nessa genealogia. ao ver as cores preta e amarela do animal.1 e II . Um de seus gatos apresenta hipoplasia testicular (testículos atrofiados) e é totalmente estéril. O daltonismo é um caráter recessivo. Os genes que participam da síntese desses pigmentos localizam-se no cromossomo X. As cores nos gatos domésticos são determinadas por um gene A (cor amarela) e outro gene P (cor preta). Os símbolos em escuro representam os indivíduos com anomalia Questão 146 José é uma pessoa muito interessada na criação de gatos. A mulher tem razão? Justifique. e o malhado apresenta os dois genes (A e P).

Observando a genealogia. Represente como B o alelo dominante para olhos vermelhos e como b o alelo recessivo para olhos brancos. desenhe o heredograma dessa família considerando o gene (A) normal e o gene (a) mutado e apresente os prováveis progenes. Todas as filhas mulheres são afetadas por essa doença. Um alelo de um lócus do cromossomo Y do peixe 'Lebistes' determina a ocorrência de manchas na nadadeira dorsal. b) Qual será a proporção de machos e fêmeas nas duas gerações? Justifique. Esse casal tem 5 filhos. também afetada pela doença. Responda as três questões a seguir considerando o cruzamento de uma mosca fêmea de olhos vermelhos de uma linhagem pura para cor de olhos com um macho de olhos brancos. muitas vezes.5. um normal e outro afetado. O heredograma a seguir mostra os descendentes do casal João e Maria. uma mulher afetada e um homem normal. portadores de uma doença genética que se manifestava da seguinte maneira: O pesquisador concluiu que não se tratava de uma doença com herança dominante ou recessiva ligada ao sexo. mesmo quando elas pertencem a gerações afastadas entre si. Questão 153 Os conhecimentos atuais de biologia celular. O irmão mais velho. a) Quais são os fenótipos de F e de F‚ desse cruzamento? b) Como seria o resultado em F e F‚. casa-se com uma mulher normal e tem 2 filhos. estabelecer com segurança o parentesco entre pessoas. Justifique essa conclusão. assim como a probabilidade de filhos afetados para o casamento entre os últimos primos. quadrados e círculos hachurados para homens e mulheres afetados. afetado pela doença. a) Qual será a cor dos olhos dos machos e fêmeas na primeira geração (F)? E na segunda (F‚)? Justifique. I e II. a filha afetada do irmão mais velho e o filho afetado da irmã mais nova. 1. 2 mulheres e 3 homens. porém teve dúvida se se tratava de herança autossômica recessiva ou autossômica dominante com penetrância incompleta. utilize a simbologia: quadrados e círculos brancos para. através de um cruzamento. a cor vermelha ou branca dos olhos é determinada por um gene localizado no cromossomo X. como no ser humano. e 3 mulheres. das quais somente uma é normal. Uma das filhas se casa com um homem normal e tem 7 filhos. pode-se dizer que o modo de herança mais provável seja de herança ligada do X dominante. respectivamente.2 32 . Questão 151 Um geneticista estudou dois grupos. Um peixe macho com manchas na nadadeira foi cruzado com uma fêmea sem manchas. homens e mulheres normais. a) O que levou o pesquisador a concluir que não se tratava de herança ligada ao sexo? b) Por que o pesquisador teve dúvida quanto ao tipo de herança autossômica? Questão 152 Uma doença humana rara é introduzida em uma família quando uma mulher normal se casa com um homem afetado. Questão 150 A determinação do sexo em peixes segue o sistema XY.5. se casa com um homem normal e tem 3 filhos.Questão 149 No gênero Drosophila. biologia molecular e engenharia genética podem. Para o heredograma. A irmã mais nova. dos quais 2 são afetados. uma moça normal e 2 homens. e o cruzamento das moscas F entre si. sendo 4 homens. se o alelo fosse dominante e estivesse no cromossomo X do macho? Demonstre.

a) Quanto aos pares de alelos mencionados. a) De acordo com a Segunda Lei de Mendel. ocorreram as permutas indicadas pelas setas 1 e 2. B/b e D/d. considerando-se a Segunda Lei de Mendel (Lei da Segregação Independente). quais são as freqüências esperadas para os fenótipos? b) Explique a razão das diferenças entre as freqüências esperadas e as observadas. foram obtidas 160 plantas: 62 com flores púrpuras e grãos de pólen longos. 1.3 Questão 155 Foram realizados cruzamentos entre uma linhagem pura de plantas de ervilha com flores púrpuras e grãos de pólen longos e outra linhagem pura. e justifique sua resposta. dois pares de cromossomos com três genes em heterozigose: A/a. Questão 156 Três grupos de alunos realizaram cruzamentos-testes entre plantas de tomate para o estudo de diferentes genes. 15 com flores vermelhas e grãos de pólen longos. dentre outras. Questão 154 O esquema a seguir representa. Nesses cromossomos. de toda essa família. b) netos e bisnetos de João e Maria que possuíram ou possuem o cromossomo Y idêntico ao de João e justifique sua resposta. Os grupos obtiveram os seguintes resultados: Atualmente. e se apresentaram para a identificação de herdeiros do casal citado. 66 com flores vermelhas e grãos de pólen redondos.5.6 33 .5. nem ser possível a coleta de material genético dos membros falecidos da família. que tipos de gameta esta célula poderá formar? b) Que pares de alelos têm segregação independente? 1. a técnica de identificação por meio do estudo do DNA extranuclear.5. com flores vermelhas e grãos de pólen redondos. numa célula em divisão meiótica. Todas as plantas produzidas tinham flores púrpuras e grãos de pólen longos. Essas freqüências fenotípicas obtidas não estão de acordo com o esperado. por técnicas que determinam a homologia entre amostras de DNA extranuclear.6 1. Por não haver documentos legais comprobatórios da relação de parentesco. Indique o número de: a) bisnetos do sexo masculino e do sexo feminino que poderiam ser identificados com aproximadamente 100% de certeza. 17 com flores púrpuras e grãos de pólen redondos.5. Cruzando-se essas plantas heterozigóticas com plantas da linhagem pura de flores vermelhas e grãos de pólen redondos. apenas Maria e todos os seus bisnetos estão vivos. foi utilizada.

matemática (M) e tocar guitarra (G). b) O que significa. que a característica em questão não altera o valor adaptativo dos indivíduos. formado por um indivíduo triplo homozigoto dominante e outro triplo homozigoto recessivo. deles resultando. em média. um indivíduo heterozigoto apresenta aptidão mediana. e um indivíduo homozigoto dominante apresenta maior aptidão. ao se casar com um indivíduo com genótipo: Questão 158 1. que permitiria ao casal do item b ter filhos com aptidão mediana para aprender biologia mas sem aptidão para tocar guitarra? d) Quais os locos cuja herança não resultará em proporções segregantes dentro dos padrões da segunda Lei de Mendel? e) Uma mãe sem aptidão para aprender biologia e tocar guitarra. entre os genes pesquisados pelos alunos do grupo G2. poderá esperar descendentes (F1) com qual(is) genótipo(s)? b) Se um descendente (F1) se casar com um indivíduo sem aptidão para as três habilidades. o termo ligação? Qual é a sua utilidade para a pesquisa científica? c) Calcule a distância. Nessas condições. b) Quantos indivíduos são homozigotos? c) Suponha que nessa população os cruzamentos ocorram ao acaso. Considere. qual a probabilidade desse casal ter uma criança com aptidão mediana para matemática? c) Qual o nome do mecanismo genético. mas com aptidão mediana para aprender matemática.5. Justifique. correspondam a aptidões para aprender biologia (B). 36 são afetadas por uma doença genética condicionada por um par de alelos de herança autossômica recessiva. em Genética. igual número de descendentes. a) Expresse. qual será a porcentagem esperada de indivíduos de fenótipo dominante na próxima geração? Justifique suas respostas mostrando como chegou aos resultados numéricos. identificados nos cromossomos (I e II). Com base nessas informações. terá 100% dos filhos(as) com aptidão no mínimo mediana para as três características. havendo 10 unidades de recombinação (morganídeos) entre eles. também. em frações decimais. 34 . a freqüência dos genes dominantes e recessivos. a) Como se denomina a situação mencionada? Supondo o cruzamento AB/ab com ab/ab b) Qual será a porcentagem de indivíduos AaBb na descendência? c) Qual será a porcentagem de indivíduos Aabb? Questão 159 Numa população de 100 pessoas. em unidades de mapa genético.a) Indique o(s) grupo(s) que trabalhou (trabalharam) com genes ligados. faça o que se pede: a) Um casal (P1). um indivíduo com genótipo recessivo não apresenta aptidão.6 Os locos gênicos A e B se localizam em um mesmo cromossomo. proposto por Thomas Hunt Morgan. Em um dado loco. Questão 157 Considere que os genes autossômicos.

Espera-se encontrar diferença na freqüência de nascimento de crianças aa entre essas regiões? Por quê? Questão 161 Segundo o Teorema de Hardy Weinberg. Calcule a freqüência de indivíduos de fenótipo normal portadores do gene causador da fenilcetonúria nessa população. Esta erupção teria diminuído drasticamente a população de jabutis gigantes da ilha. b) Defina o conceito de evolução em função da freqüência dos genes de uma população e indique de que forma a diminuição da população afetou a evolução dos jabutis gigantes. Questão 166 O grupo sangüíneo MN é determinado por dois alelos codominantes. 35 . 2) Taxa de mutação gênica. onde p e q são as freqüências de dois alelos.000 crianças. Considere regiões geográficas em que a doença infecciosa é endêmica e regiões livres dessa infecção. ou estado estático. a) Cite duas das condições propostas por Hardy e Weinberg para que o equilíbrio possa ser atingido. determinada por um gene autossômico recessivo.Questão 160 Um determinado gene de herança autossômica recessiva causa a morte das pessoas homozigóticas aa ainda na infância. Com essa equação podemos calcular a freqüência de um genótipo sabendo a freqüência de um dos alelos. a qual é letal para as pessoas homozigóticas AA. A freqüência dos genótipos desse grupo sangüíneo foi amostrada em duas populações humanas e os resultados são apresentados na tabela a seguir. Questão 162 A SOCIOBIOLOGIA procura explicar o comportamento dos indivíduos em função de sua herança genética. Qual das três possibilidades apresentadas NÃO pode ser aceita para explicar a variação na freqüência dos genes citados? Justifique sua resposta. p£+ 2pq + q£= 1. a fenilcetonúria. foi de A= 80% e a=20%. ou vice-versa. Alguns mecanismos evolutivos que alteram a freqüência dos genes são: 1) Seleção natural. uma das condições estabelecidas por Hardy e Weinberg para populações ideais foi seriamente afetada por uma erupção vulcânica ocorrida há cerca de cem mil anos. Dos 420 indivíduos de flores vermelhas. 380 são homozigóticos (VV) e 40 são heterozigóticos (Vv). Numa determinada população em equilíbrio de Hardy-Weinberg nasceram 10. 420 são de flores vermelhas (fenótipo dominante) e 80 são de flores brancas (fenótipo recessivo). desde que a população esteja em equilíbrio. Questão 165 A freqüência gênica de dois alelos em uma população. principalmente em populações pequenas. As pessoas heterozigóticas Aa são resistentes a uma doença infecciosa causada por um protozoário. é composta por 500 indivíduos. Determine a freqüência dos genes V e a freqüência dos genes v nessa população. uma dessas crianças apresentou uma doença. Na geração seguinte foi observada uma freqüência de A=60% e a=40%. 3) Deriva ao acaso da freqüência gênica. numa dada geração. sem grandes alterações de seu reservatório genético. Qual o princípio científico dessa abordagem experimental? Questão 163 Pela equação Hardy-Weinberg. Questão 164 Uma população vegetal que NÃO está em equilíbrio de Hardy-Weinberg. Um dos instrumentos mais utilizados nesses estudos é a pesquisa sobre o comportamento de gêmeos univitelinos que foram criados em ambientes diferentes. Desses. uma população ideal deve atingir o equilíbrio. Em uma das ilhas do arquipélago de Galápagos.

um determinado gene apresenta-se em duas formas. Explique. para que uma população se mantenha em equilíbrio genético é necessário que ela se enquadre em certas condições. respectivamente. não é possível saber a freqüência do gene para cor amarela. Escreva quatro destas condições: 36 . é de 0. podendo-se. Com base nessas informações. numa proporção de 10:1. A população 2 apresenta 45 indivíduos com genótipo AA. Usando o teorema de Hardy-Weinberg pode-se determinar as freqüências gênicas de uma população e demonstrar se a espécie está em equilíbrio. isto é. Esse gene tem um alelo que não produz essa característica. a) Após o desastre pode-se afirmar que a freqüência do gene recessivo será zero? Justifique sua resposta. Questão 170 Considere duas populações diferentes. como a cor amarela.5. Entretanto. b) Qual o nome dado a essa alteração brusca na freqüência gênica? Questão 168 Uma das maneiras de verificar se uma determinada espécie está ou não em evolução é fazer um estudo do patrimônio genético de suas populações.40 (40%) em uma população em equilíbrio. a freqüência do referido gene na população. alterando de forma brusca a freqüência do gene recessivo na população da ilha. 1 e 2. Mas um desastre ambiental provocou a morte de todos os indivíduos com a característica recessiva. é determinada por um gene dominante. sendo 36% dos indivíduos recessivos. que determina o grupo sangüíneo O. Questão 171 A freqüência do gene i. 130 indivíduos com genótipo Aa e 25 indivíduos com genótipo aa. isto é. quantas se espera encontrar com sangue do tipo O? Explique as etapas que você seguiu para chegar à resposta. A população 1 apresenta 90 indivíduos com genótipo AA. aplicar o Princípio de Hardy-Weimberg. Um estudo dessa população determinou que a freqüência do fenótipo amarelo era de 50% e NÃO SE SABE se essa população está em equilíbrio de Hardy-Weinberg. Despreze a parte fracionária de seu resultado. Considerando que tal população se encontre em equilíbrio genético. Indique o genótipo das pessoas do grupo sangüíneo O. Em uma amostra de 1000 pessoas desta população. Questão 172 Uma característica fenotípica de uma população.7 Calcule a freqüência do alelo M nas duas populações e determine se a população da Europa como um todo é uma população panmítica. portanto.Questão 169 Em uma população. a dominante e a recessiva. Questão 167 Numa determinada ilha existia uma população animal com indivíduos possuidores de uma característica normal e indivíduos possuidores de uma característica recessiva. calcule. em estado de não-evolução. a) Qual a freqüência dos alelos A e a em cada uma das populações? b) Qual delas tem a maioria dos indivíduos homozigotos? Explique. portanto. EM PORCENTAGEM. uma população em que os casamentos ocorrem ao acaso. 1. Justifique sua resposta. caso exista. com 400 alelos. cada uma com 200 indivíduos diplóides. 40 indivíduos com genótipo Aa e 70 indivíduos com genótipo aa.

a quantidade de DNA separada na faixa inferior é X. Que outras bases nitrogenadas devem existir neste DNA e em que proporções? Justifique sua resposta. 20% das bases nitrogenadas são constituídas por adenina. quando as bactérias completaram duas divisões celulares. responda aos itens adiante. Que outras bases nitrogenadas devem existir neste DNA e em que proporções? 1. Questão 176 Por que o processo de replicação do DNA é chamado semiconservativo? Questão 177 Dada a seqüência de bases nitrogenadas de um segmento de DNA: AAT GGC ATC responda: a) Qual é a seqüência de bases da hélice complementar a esse segmento? b) Qual é a seqüência de bases do RNA mensageiro transcrito a partir desse segmento? Questão 178 Dada a seqüência de bases nitrogenadas de um segmento de DNA a seguir. que quantidade de DNA há na faixa superior? Questão 175 Quais são as duas propriedades fundamentais do DNA que permitem a essa substância desempenhar o papel de material genético? 37 . todo o DNA tem uma densidade intermediária entre o que é constituído apenas por ¢¥N e o que contém apenas ¢¦N? b) Considerando que. a) Por que. Utilizando seus conhecimentos sobre o material genético. O restante das bactérias foi transferido para um meio de cultura em que todo o nitrogênio disponível era o isótopo normal ¢¥N. Questão 174 Bactérias (Escherichia coli) foram cultivadas durante várias gerações em um meio de cultura na qual toda a fonte de nitrogênio era o isótopo pesado ¢¦N. responda: a) Qual a importância de o DNA autoduplicar-se? b) Por que essa replicação é semiconservativa? Questão 180 No DNA de um organismo.Questão 173 No DNA de um organismo.1 A figura mostra o resultado da centrifugação do DNA das três amostras de bactérias. O DNA das bactérias das amostras B e C foi também extraído e centrifugado. Retirou-se uma segunda amostra (amostra B). na amostra C. na amostra B. quando as bactérias completaram uma divisão celular nesse novo meio e uma terceira amostra (amostra C). extraiu-se o DNA que foi submetido a uma técnica de centrifugação que permite separar moléculas de DNA de acordo com sua densidade.5. De uma amostra dessas bactérias (amostra A). TTT AAT GGG CAT a) Qual é a seqüência de bases da hélice complementar a esse segmento? b) Qual é a seqüência de bases do RNA mensageiro transcrito a partir desse segmento? Questão 179 Para funcionar como material genético o ácido desoxirribonucléico (DNA) apresenta a capacidade de autoduplicação.8. 18% das bases nitrogenadas são constituídas por citosina.

2 e 3 respectivamente? Questão 190 Sabendo-se que numa molécula de DNA formada por uma dupla hélice há 21% de timina.8.AUTODUPLICAÇÃO II . 1.8. sabendo que se trata da unidade estrutural do ácido desoxirribonucléico (DNA)? Questão 187 Uma molécula de DNA contém 15% de guanina. que representa a estrutura da molécula de DNA. responda quais são as outras bases dessa molécula e em que proporções ocorrem. a) Represente um nucleotídeo apontando seus três constituintes moleculares.1 Questão 182 Justifique o termo SEMICONSERVATIVO para caracterizar o processo de replicação do DNA.TRANSCRIÇÃO Explique essas duas propriedades. Questão 183 O que são NUCLEOTÍDEOS? Quais são as moléculas que entram em sua composição química? Questão 184 Quais são as diferenças observadas nos nucleotídeos que entram na composição do DNA em relação aos que entram na composição do RNA? Questão 185 O que representa o desenho a seguir? Qual o nome das moléculas representadas pelos números 1.5. 2 e 3. Que outras bases nitrogenadas possui essa molécula e em quais proporções? Questão 188 Os ácidos nucléicos são macromoléculas definidas como polinucleotídeos. 38 . Questão 186 No desenho a seguir. o que representam os números 1.Questão 181 Mencione duas diferenças de natureza molecular entre o DNA e o RNA. b) Quais são as diferenças observadas nos nucleotídeos que entram na composição do DNA em relação aos que entram na composição do RNA? Questão 189 1.1 Para funcionar como material genético o DNA apresenta duas propriedades fundamentais. São elas: I . respectivamente.5.

colocadas em lâmina de vidro. Esse processo marca a posição aproximada do isótopo dentro da célula. Os capítulos contam diferentes detalhes da saga do homem na terra: suas andanças pelos continentes. adicionou-se o nucleosídeo uridina marcado radioativamente com H¤ ao meio de cultura. Após algum tempo. 32% das bases nitrogenadas são constituídas por citosina. fixadas e submetidas a auto-radiografia. Que outras bases nitrogenadas devem existir neste DNA e em que proporções? Questão 194 CÉLULAS IMORTAIS CONTAM AOS CIENTISTAS HISTÓRIA DA EVOLUÇÃO DA HUMANIDADE Estas células formam um livro. como representado no esquema a seguir. 39 . "O Globo") a) Explique por que o processo de autoduplicação do DNA dá significado à hereditariedade permitindo revelar a história da evolução da humanidade. Explique por que. Amostras destas células foram retiradas 3.1 a) Cite o tipo de molécula à qual a uridina se incorporou. ainda no estágio de girino. entre essas células: a) as características genotípicas são iguais.. sendo.Questão 191 Considere um segmento de DNA com a seguinte seqüência de bases nitrogenadas: ATT CTA CGC AAA GGC através de observações de características morfológicas e fisiológicas da célula. b) as características fenotípicas são diferentes. qual será a seqüência de bases desse RNA? Questão 192 Considere a seqüência de bases nitrogenadas de um segmento de DNA: AAA GGC ATT Responda: a) Qual é a seqüência de bases da hélice complementar a esse segmento? b) Qual é a seqüência de bases do RNA mensageiro transcrito a partir desse segmento? Questão 193 No DNA de um organismo. com as de células de tecido similar do mesmo indivíduo após atingir a idade adulta. b) ".8. Questão 195 a) Quais são as bases da cadeia complementar a esse segmento? b) Se o segmento dado servir de molde para a produção de RNA.5. suas andanças pelos continentes. 1. Justifique sua resposta. as células foram transferidas para um novo meio que não continha o isótopo. b) Nomeie o compartimento celular que seria marcado. Nomeie o processo através do qual o DNA é capaz de controlar e interferir nas características morfológicas e fisiológicas da célula.. 15 e 90 minutos após a transferência. conservado em tanques de nitrogênio líquido que guarda informações desconhecidas sobre a humanidade. então. foram comparadas as características genotípicas e fenotípicas de células retiradas de um tecido de anfíbio. (adaptado de. Questão 196 Num experimento. casamentos ancestrais e os ataques de doenças" podem ser estudados Em células eucariotas mantidas em cultura. casamentos ancestrais e os ataques de doenças. se o nucleosídeo radioativo usado fosse a timidina e justifique sua resposta.

a) Qual a influência da transfusão sugerida no resultado no exame? b) Que precauções podem ser tomadas para desmascarar a tentativa de fraude? Questão 201 A tipagem de DNA é uma técnica desenvolvida recentemente que permite identificar e estabelecer o grau de parentesco entre indivíduos. isto é. a DNA polimerase. usa-se um marcador do cromossomo Y. Assim. aproximadamente 43 dias! Sabemos. para replicar todo o genoma de uma bactéria. Para se realizar uma análise patrilínea. o DNA possui duas propriedades. Com a utilização de técnicas de genética clássica e molecular. no entanto. a tipagem do DNA revela um padrão de bandas que é estável (presente no DNA de todos os tecidos) e é transmitido aos descendentes seguindo as leis de Mendel. ao passo que a seqüência do outro gene pode estar localizada na cadeia oposta. existe uma enzima. a seqüência de nucleotídeos transcrita pode estar em uma cadeia. a seqüência de nucleotídeos do DNA de cada pessoa é única (excetuando-se o caso de gêmeos monozigóticos). que não se altera ao longo das gerações (salvo em casos de mutações). a DNA polimerase consumiria cerca de 83 minutos e. Para replicar o genoma. para o genoma humano. para uma análise matrilínea (materna). Questão 200 O teste de tipagem de DNA revelou que nos seres humanos existe individualidade genômica. Tal evento inibiria 40 . Suponha agora a seguinte situação: um homem acusado de ser o pai de uma criança tenta burlar o teste de tipagem de DNA. explique essa aparente contradição. Por que o DNA mitocondrial deve ser usado para a análise matrilínea? Questão 202 No ADN.coli" é de cerca de 20 minutos. Já o genoma haplóide humano tem 3×10ª pares de nucleotídeos. verificou-se que este gene está localizado no genoma mitocondrial. um amigo o aconselha a receber uma transfusão de sangue 2 meses antes do teste (em geral colhe-se o sangue como fonte de células nucleadas). antes da divisão celular. Por outro lado. a) Informe a percentagem de filhas e filhos cegos de um casal: I) cuja mulher é normal e o homem é cego. mas sim o gene mutado. Graças a essas características é possível atualmente realizar testes de paternidade que comparam os padrões de bandas de DNA das pessoas e revelam se um homem é de fato o pai biológico de uma outra pessoa. Sabe-se que todas as mitocôndrias dos indivíduos afetados pela cegueira não possuem o gene normal. ou seja. sabe-se que no mesmo trecho nunca ocorre a transcrição simultânea das duas cadeias de uma molécula de ADN. Assumindo que a DNA polimerase apresenta uma velocidade de reação constante para todas as espécies analisadas.Questão 197 Para desempenhar sua função como material hereditário. Isto significa que cada indivíduo possui variações discretas e características na seqüência de seu DNA. b) Justifique as respostas ao item a. Para alguns genes. que o tempo de geração da "E. e que o tempo médio de replicação de uma célula eucariota é de 12 horas. a investigação dos ancestrais paternos. Assim. Questão 199 O genoma da bactéria "Escherichia coli" tem um tamanho de 4×10§ pares de nucleotídeos. Questão 198 A mutação em um gene humano provoca cegueira. a transcrição dos genes não está restrita a somente uma das suas cadeias. II) cuja mulher é cega e o homem é normal. No entanto. lança-se mão do DNA mitocondrial. cuja velocidade de reação é equivalente a cerca de 800 nucleotídeos/s. Identifique-as e descreva resumidamente cada uma delas.

no mesmo trecho.8. Questão 205 Considerando as propriedades de duplicação do DNA. Molécula B 23% de adenina. 2 etapa: Extrai-se o DNA de todas as bactérias e obtém-se o seguinte resultado: Questão 206 A análise química de duas moléculas de DNA revelou a seguinte composição de bases: Molécula A 23% de adenina.000 anos.o processo da tradução. nessa molécula. Explique as porcentagens obtidas em todos os extratos das diferentes culturas no experimento. Com base nestes dados: a) O que se pode afirmar a respeito das semelhanças entre estas duas moléculas de DNA? b) Justifique sua resposta.Cultura de 1 geração com ¢¥N: 600 moléculas de DNA todas com ¢¦N e ¢¥N. após esse crescimento promove-se o desenvolvimento de mais duas gerações. guanina (G) e timina (T). obtém-se o crescimento de colônias de bactérias. Justifique sua resposta. 1. Questão 203 Estudos recentes compararam as seqüências completas de DNA mitocondrial de indivíduos de várias regiões geográficas do planeta. observe o resultado do experimento a seguir. adenina (A). citosina (C). Questão 204 A soma das porcentagens de guanina e citosina em uma certa molécula de ADN é igual a 58% do total de bases presentes. 23% de timina. b) Explique por que é impossível prever a proporção de citosina presente no ARN mensageiro codificado por esse trecho de ADN. . 27% de citosina e 27% de guanina. Esses resultados foram importantes para corroborar a idéia de que o ancestral comum mais recente do 'Homo sapiens' viveu na África há cerca de 200. 23% de timina.Cultura de 2 geração com ¢¥N: 1200 moléculas de DNA nas quais 600 com ¢¥N e 600 com ¢¦N e ¢¥N. .1 41 .Cultura de crescimento com ¢¦N: 300 moléculas de DNA todas com ¢¦N.5. . 27% de citosina e 27% de guanina. em cultura com ¢¥N. Os resultados revelaram que a variabilidade genética no DNA mitocondrial de indivíduos africanos era quase o dobro da observada no DNA mitocondrial de não-africanos. 1 etapa: Em uma cultura com ¢¦N. Explique por que a maior diversidade do DNA mitocondrial apóia a idéia da origem africana do 'Homo sapiens'. Explique por que ocorreria a inibição da tradução se a transcrição de uma cadeia do ADN ocorresse ao mesmo tempo que a transcrição da sua cadeia complementar. a) Indique as porcentagens das quatro bases.

42 . Estes bacteriófagos marcados foram utilizados para infectar outras células bacterianas cultivadas sem a presença de fósforo radioativo. 1. quais se referem a DNA? b) Justifique o resultado obtido com a 5Ž lâmina.1 a) Copie o heredograma. os resultados seriam os mesmos? Justifique.Questão 207 A análise química em amostras de cinco lâminas com ácidos nucléicos apresentou os seguintes resultados: 1Ž lâmina: ribose 2Ž lâmina: uracila 3Ž lâmina: dupla-hélice 4Ž lâmina: timina 5Ž lâmina: 15% de guanina e 25% de citosina. A. que permitiu posteriormente decifrar o código genético determinante para a síntese protéica. Questão 211 No heredograma seguinte. Os novos bacteriófagos formados estavam marcados radioativamente.5. tivesse sido usado enxofre radioativo (¤¦S) para marcação de proteínas. Na figura. os fagos produzidos terão a) a cápsula protéica de qual dos fagos? E o DNA. em vez de fósforo. será de qual deles? b) Justifique sua resposta. Hershey e Chase cultivaram bactérias em meio de cultura contendo fósforo radioativo (¤£P) e colocaram bacteriófagos (vírus) para infectar essas células. respectivamente. O casal (P) teve filhos (F1) e estes. a) Watson e Crick demonstraram que a estrutura do DNA se assemelha a uma escada retorcida. quase ignorado de início. C. revolucionou para sempre todas as ciências da vida sejam elas do homem. citosina. Após esse bacteriófago composto infectar uma bactéria. Essa pessoa casou-se com outra. ocasionando dificuldades motoras para os portadores do problema. pintando quais serão as pessoas afetadas pela doença em F1 e em F2 b) Justifique sua resposta. também tiveram filhos (F2). a pessoa A possui uma mutação no DNA de todas as suas mitocôndrias. por sua vez. A marcação radioativa foi detectada dentro destas bactérias. um estudo de uma única página na revista inglesa Nature intitulado "A estrutura molecular dos ácidos nucléicos". Questão 209 Em 25 de abril de 1953. Explique a que correspondem os "corrimãos" e os "degraus" dessa escada. a) Como se explica que o fósforo radioativo tenha passado para o bacteriófago? b) Como se explica que as bactérias cultivadas sem a presença de fósforo radioativo tenham sido marcadas? c) Se. Questão 208 Em 1952. ressaltando a interação entre as duas cadeias do polímero. RNA e síntese protéica? c) Como podemos diferenciar duas proteínas? Questão 210 Cientistas criaram em laboratório um bacteriófago (fago) composto que possui a cápsula protéica de um fago T2 e o DNA de um fago T4. guanina e timina. a) Entre estas lâminas. Questão 212 A figura a seguir mostra um trecho da estrutura do ácido desoxiribonucléico. rato. G & T representam as bases adenina. planta ou bactéria. b) Que relação existe entre DNA. que faz com que a produção de energia para os músculos seja deficiente.8. James Watson e Francis Crick descobriram a estrutura do DNA. aparentemente normal.

responda o que representam os componentes 1. Justifique a sua resposta.5. de maneira invertida. Para retardar o amadurecimento e evitar as perdas durante o armazenamento.2 ) Quais são as moléculas representadas pelos números 1. a) Quais são as bases do segmento de DNA que deu origem a esse RNA? b) Quantos nucleotídeos existem no DNA que deu origem a essa molécula de RNA mensageiro? Questão 218 A enzima poligalacturonase. respectivamente. 1) ACTTTAAAGATATTTACTTAAA TGAAATTTC TATAAATGAATTT 2) GCTAGGCCGATGCGGCGTGGA CGATCCGGCTACGCCGCACCT Questão 213 Considerando o modelo da estrutura molecular do DNA como representado na figura adiante.1 Questão 215 Observe o esquema adiante e responda: As linhas pontilhadas indicam as pontes de hidrogênio que são formadas entre as bases aminadas e que contribuem para manter unidas as duas cadeias do DNA.8.5. que digere a parede celular de células vegetais. é a principal responsável pela maturação de frutos como o tomate.8. Observe as duas seqüências de DNA a seguir e determine qual delas precisará de uma temperatura de desnaturação maior. respectivamente. 43 1.5. Quantos nucleotídeos tinha o DNA que originou esse RNA? Questão 217 Um segmento de RNA mensageiro apresenta a seqüência de bases nitrogenadas a seguir: AAA UUC GGG GAU. Essas pontes de hidrogênio podem ser rompidas por calor. no genoma de um tomateiro. Esse processo reversível chama-se de desnaturação. 2 e 3. A temperatura necessária para desnaturar o DNA depende de vários fatores.1 . mas um deles é a composição dos nucleotídeos de um determinado DNA. 1. 2 e 3. utilizou-se uma técnica na qual o gene que codifica a enzima citada foi inserido. b) Qual é o nome dessa unidade estrutural? Questão 216 Uma cadeia de RNA tem 200 nucleotídeos. o que produz a dissociação das cadeias.8.Questão 214 Que papéis desempenham o RNA mensageiro e do RNA transportador no processo de síntese das proteínas? 1. sabendo-se que trata-se da unidade estrutural do ácido ribonucléico (RNA).

8. possa ser alterado em presença do Benzo[a]pireno. pelos indivíduos A. Suponha que um trecho da fita molde de DNA do gene X. B e C têm mutações em um segmento de DNA desse gene.3 a) Descreva a interação que ocorre entre os produtos da transcrição dos genes normal e inserido no tomate geneticamente modificado e indique a característica dessas moléculas que permite a interação. em um dos dois sítios indicados na figura 1. justificando cada resposta com a utilização do código genético da figura 2: . B e C? Por quê? Seqüência normal CAA AAC TGA GGA ATG CAT TTC (m) GTT TTG ACT CCT TAC GTA AAG Indivíduo A CAA AAC TGA GGA ATT CAT TTC (m) GTT TTG ACT CCT TAA GTA AAG 44 Questão 221 O fumo está relacionado ao aumento de risco para o câncer de pulmão. respectivamente. Considere que o RNA mensageiro seja formado a partir das trincas mostradas no esquema da figura 1 a seguir. cuja seqüência normal está representada a seguir. tem a capacidade de promover mutações no DNA levando a mudança da base Guanina para Timina. responda: a) Quais serão os segmentos de proteínas produzidos. B e C? b) Como será o fenótipo (normal ou afetado dos indivíduos A.8.5. Usando a tabela que relaciona alguns codons aos respectivos aminoácidos e considerando que a fita molde a ser transcrita é aquela assinalada com a letra m.O esquema adiante mostra os produtos da transcrição do gene normal da enzima e do gene inserido. Os indivíduos A. um dos principais agentes carcinogênicos presentes na fumaça do cigarro. Indivíduo B CAT AAC TGA GGA ATG CAT TTC (m) GTA TTG ACT CCT TAC GTA AAG Indivíduo C CAA TAC TGA GGA ATG CAT TTC (m) GTT ATG ACT CCT TAC GTA AAG 1. representado a seguir. Indique as alterações que ocorrerão na síntese da proteína X quando a mutação for localizada nos diferentes sítios. Questão 219 De que maneira o DNA determina a seqüência de aminoácidos das moléculas de proteínas? Questão 220 Uma doença genética de herança dominante é causada por mutações em um gene localizado em um autossomo. ambos ativos nesse tomate geneticamente modificado. O hábito de fumar expõe os fumantes a substâncias com atividade carcinogênica.2 1. O Benzo[a]pireno.5. b) Explique por que haverá um aumento no tempo de amadurecimento desse tomate geneticamente modificado.

Por que sempre encontramos N > P ? Questão 224 1.3 Com o auxílio da tabela do código genético representada a seguir.8. c) Se o gene de uma proteína respiratória de um organismo zbohrniano for introduzido numa bactéria terrestre. 1. 16 e 19 tipos diferentes de aminoácidos. Questão 225 O DNA dos organismos do planeta Zbohrnya é constituído pelos mesmos 4 tipos de bases dos seres vivos terrestres.8. a partir da seqüência de aminoácidos de uma proteína.CAC . forneça o produto da síntese protéica (polipeptídio parte da cadeia beta prevista para a globina humana). do tipo substituição. isto é. b) Sabendo que a vida em Zbohrnya e na Terra existe há 3.3 Entretanto. cuja seqüência de nucleotídeos é 5' .AAG . Questão 223 O ADN é um polímero constituído por vários nucleotídeos e as proteínas são polímeros constituídos por vários aminoácidos.GTG . utilizando-se da tabela do código genético apresentada a seguir.8. a) Considere o segmento de DNA. Explique por quê. apresentam.3' e.CTG . pode afetar a saúde e a qualidade de vida do portador dessa mutação. 45 . Explique a possibilidade da ocorrência dessas três proteínas nos seres de Zbohrnya. a) As proteínas A. a proteína produzida pela expressão desse gene será idêntica à da espécie zbohrniana? Justifique sua resposta.5.GAG . não se pode deduzir a seqüência de nucleotídeos do gene. ou do RNA-m correspondentes. Questão 222 As globinas constituem um bom exemplo da importância da informação genética na estrutura primária e na função das proteínas.5 bilhões de anos. encontradas nos organismos da Terra. Já o código genético desses organismos é determinado por códons de 2 bases. B e C. 13. 1.CCT .ACT . o oposto não é verdadeiro.3 b) Utilize um exemplo de alteração estrutural da globina humana (cadeia beta) para explicar como uma mutação pontual. respectivamente. Um gene é constituído por um número N de nucleotídeos que codifica uma proteína constituída por P aminoácidos.GAG .5. é sempre possível deduzir-se a seqüência de aminoácidos de uma proteína a partir da seqüência de nucleotídeos do seu gene. faça uma comparação entre a diversidade dos organismos encontrados nesses dois planetas.5.

originado pela perda do sexto par de nucleotídios (ou seja.A T G A G T T G G C C T G ----. no polipeptídio codificado por esse gene. b) Utilizando a tabela de código genético fornecida. corresponde ao aminoácido metionina. c) Qual a seqüência de aminoácidos que resultará da tradução da molécula de RNA mensageiro? Ver figura anterior. após uma deleção do TERCEIRO nucleotídeo? Questão 228 A seguir está representada a seqüência dos 13 primeiros pares de nucleotídios da região codificadora de um gene. c) Qual seria a seqüência dos três primeiros aminoácidos de um polipeptídio codificado por um alelo mutante desse gene.4 1.5. a) Determine a seqüência de bases do RNAm que foi utilizado para sintetizar o polipeptídeo esquematizado abaixo da tabela. no qual três bases codificam um aminoácido. A tabela a seguir mostra alguns códons do RNA mensageiro e os aminoácidos codificados por cada um deles.5. b) Se ocorresse uma substituição. --. na 3 base do código correspondente ao 6Ž aminoácido do polipeptídeo. esse código segue o padrão do código genético universal. transcrito a partir desse segmento de DNA. Entretanto.T A C T C A A C C G G A C --A primeira trinca de pares de bases nitrogenadas à esquerda. 1. por uma purina.5.Questão 226 Considere a tabela abaixo.8.3 a) Escreva a seqüência de bases nitrogenadas do RNA mensageiro. d) Qual a seqüência de aminoácidos que resultará da tradução da mesma molécula de mRNA.3 Analise a tabela e faça o que se pede: a) Cite o nome da enzima que catalisa a síntese de RNA mensageiro.8. indique a seqüência dos três aminoácidos seguintes à metionina. qual seria o aminoácido da tabela a ser incorporado? c) Qual é anticódon correspondente ao novo aminoácido incorporado? Questão 227 A tabela adiante representa uma versão fictícia do código genético. b) Cite a seqüência do anticódon correspondente ao códon de iniciação.8. contendo códigos de trincas de bases do DNA com os aminoácidos correspondentes. a deleção do par de bases T = A)? 46 . para resolver os itens seguintes: 1.

As regiões do ARN transcrito correspondentes aos íntrons são eliminadas após o processo de transcrição. que os vírus RNA (-) já contenham a enzima RNA replicase. Questão 234 Em um organismo pluricelular com vários tecidos. a seqüência ATG AGG CGA ATC. . para sua replicação. a) Onde esses processos ocorrem na célula eucariótica? b) O que acontecerá com os processos de transcrição e tradução. ou seja.o gene da enzima RNA replicase está presente no genoma dos dois tipos de vírus. enquanto os RNA (+) não precisam armazenar esta enzima. como o da poliomielite. todas as células possuem um genoma idêntico. . quais poderiam ser as seqüências de bases do RNA por ele produzido? Questão 233 Analisando o genoma de alguns tipos de vírus formados por fita simples de RNA.nos vírus RNA (-). o genoma viral funciona diretamente como mensageiro. e os que são RNA (+). para sua replicação.Questão 229 Sabendo-se que um determinado segmento de DNA apresenta capacidade de transcrever e que apresenta a seqüência de bases TAC TCC GCT TAG e. a partir desse RNA? Questão 231 Ribossomos são formados por RNA e proteínas. respectivamente. . Analogamente. da enzima RNA replicase. é correto afirmar que os ARN mensageiros (ARNm) dos diferentes tecidos são todos idênticos? Justifique sua resposta Questão 235 Suponha um gene de um eucarioto responsável pela síntese de uma proteína. que sintetiza um RNA complementar a um molde de RNA. 47 .ambos os vírus necessitam. se ocorrer uma destruição do(s) nucléolo(s) de uma célula?. devido à simplicidade de sua estrutura. Nesse gene existem íntrons. como no caso dos seres humanos. encontramos aqueles que são RNA (-). a) Explique por que é necessário. mas a enzima só é encontrada nas partículas virais RNA (-). apenas o RNA complementar a seu genoma é capaz de funcionar como mensageiro na célula infectada. quais são as seqüências de bases de RNAm por ele produzido? Questão 230 Dado um segmento de RNA mensageiro com a seguinte seqüência de bases: AAU GUA GGC pergunta-se: a) Qual a seqüência de bases do DNA que deu origem a esse RNA? b) Quantos aminoácidos terá o polipeptídeo traduzido. A figura a seguir representa o resultado de uma experiência de hibridação do ARN mensageiro com a cadeia de ADN que lhe deu origem. b) Apresente um argumento contrário à hipótese de que os vírus. foram precursores das primeiras células. no ribossomo.nos vírus RNA (+). regiões do ADN cujas informações não estão presentes na proteína em questão. Questão 232 Sabendo-se que um determinado segmento de DNA apresenta capacidade de transcrever e que apresenta uma seqüência de bases ACTCCGCTT / TGAGGCGAA. Observe que: . em sua cadeia complementar. sintetizados pelos processos de transcrição e tradução. como o do resfriado comum.

No segmento correspondente da fita complementar do DNA há 12 timinas e 10 guaninas. é possível percorrer o caminho inverso e chegar à seqüência de DNA que a gerou? Justifique. identificadas por números de 1 a 5. a) Quantas uracilas e quantas guaninas comporão a fita do RNA mensageiro transcrito do DNA ativado? b) Quantos aminoácidos deverão compor a cadeia de polipepitídeos que será formada? Justifique sua resposta. Questão 239 Atualmente os genes podem ser desmembrados em três classes diferentes: os genes que expressam mRNA que codificam polipeptídios diversos.5. a partir de uma seqüência de DNA. Questão 236 Em um segmento da cadeia ativa de DNA. obtém-se uma proteína. que servirá de molde para a fita de RNA mensageiro. 1. há 30 timinas e 20 guaninas.1. formado por palavras e setas. Qual o produto final da classe de genes que não codificam polipeptídios? Questão 240 O que são ácidos nucléicos? Como atuam na síntese de proteínas? Questão 241 A figura mostra cinco regiões. Questão 237 Considere um fragmento de DNA com a seguinte seqüência de bases: GTA GCC TAG e responda: a) Qual será a seqüência do RNAm transcrito a partir deste DNA? b) O mesmo peptídio será obtido a partir deste RNAm e do RNAm da fita complementar? Explique. b) A partir de uma proteína.4 a) Faça um esquema simples. Questão 238 O jornal "Folha de S. Levando-se em consideração essas informações.09.8. Certos mutantes nutricionais do fungo Neurospora só conseguem crescer quando aminoácidos são adicionados ao meio de cultura. Quais dessas regiões correspondem aos íntrons? Justifique sua resposta. demonstrando como.Paulo" (23.5.2002) noticiou que um cientista espanhol afirmou ter encontrado proteínas no ovo fóssil de um dinossauro que poderiam ajudá-lo a reconstituir o DNA desses animais. os genes reguladores que codificam proteínas que regulam outros genes.8. e o sinal (-) significa ausência de crescimento. responda.5 48 . o sinal (+) significa crescimento. Na tabela a seguir. e uma terceira classe de genes que não codificam polipeptídios.

timidina ¤H e leucina ¢¦N.TCT . é preferível utilizar o RNA-mensageiro para determinar a região codificante do DNA. marcadas com isótopos: uridina ¢¥C. em genes de uma célula eucariota. ou seja. Escreva esses aminoácidos na ordem correspondente à seqüência TGA . A abordagem experimental mais freqüente. transcrição e tradução nas células analisadas. Questão 242 Os códons AGA. Após algum tempo.8. após sintetizadas.5. a seqüência de bases nitrogenadas codificantes. à qual foram adicionadas quantidades adequadas das seguintes substâncias.8. aquela que define a estrutura primária da proteína a ser sintetizada. Indique se a droga interfere em cada uma dessas etapas e justifique suas respostas. Em uma bactéria. extrair os RNA-mensageiros da célula. utilizou-se uma cultura de células. Ao longo do experimento. no entanto.5 1.5 Com base nos gráficos. em organismos eucariotos. hoje. leucina e treonina. Cite duas ligações ou interações que atuam na manutenção da estrutura enovelada das proteínas. Questão 245 Diversas técnicas são utilizadas para determinar. a droga foi também introduzida no meio de cultura. 49 . A incorporação dos isótopos foi medida em uma preparação que contém os ácidos nucléicos e as proteínas da célula. Questão 246 Os gráficos a seguir representam o efeito inibitório de dois antibióticos (I e II) sobre a síntese protéica em culturas de 'Staphylococcus aureus'.GAC de um segmento de DNA. Questão 243 Quais os papéis do gene e do ribossomo na síntese das proteínas celulares? Questão 244 Para investigar possíveis efeitos de uma determinada droga. amostras das células foram coletadas a intervalos regulares. proceder ao seqüenciamento das bases presentes nesses DNA. 1.5. é possível determinar a seqüência codificante diretamente a partir de seu cromossomo. CUG. a) Considere as etapas de replicação. Explique o motivo pelo qual. explique a atuação dos antibióticos I e II sobre a síntese protéica. explique o porquê do mutante Z só crescer quando se adiciona arginina ao meio de cultura. Os resultados do experimento estão mostrados no gráfico a seguir. As setas nos gráficos indicam o momento em que foram administrados os antibióticos nas culturas.Sabe-se que as etapas que levam à síntese da arginina são: substrato ë (gene1) ë ornitina ë (gene2) ë citrulina ë (gene3) ë arginina Supondo que em cada mutante há apenas um gene alterado. primeiramente. sintetizar os seus DNA-complementares e. e ACU do RNA mensageiro codificam. então. b) As proteínas. respectivamente os aminoácidos arginina. adquirem uma conformação tridimensional. consiste em.

. ACG.ACU. GUG. O diagrama a seguir ilustra a localização dessa seqüência.. Essa seqüência. ACA prolina . GAA A mutação pode ocorrer no ADN como mostra o esquema a seguir: Questão 248 Nos procariotos.Essa cadeia de DNA foi usada em um sistema livre de células. ACC. Essa pequena diferença é suficiente para determinar que uma pessoa portadora de hemoglobina S sofra de anemia falciforme..8.5 .GUU. .. No entanto. em homenagem aos pesquisadores que as detectaram. GUA histidina .Nesse sistema.. CCC. A seqüência de Shine-Dalgarno está em vermelho e o códon de iniciação. a partir da célula que sofre a mutação.valina-histidina-leucina-treonina-prolina-ácido glutâmico.. que diferem apenas em um aminoácido: Hemoglobina A: .5 Explique a importância desse duplo controle da iniciação para a tradução correta da mensagem contida no ARNm. cada uma delas com um único tipo de aminoácido: serina ou alanina 50 a) Qual é o aminoácido que aparece.CCU. porém no qual haviam todos os componentes necessários à síntese protéica.Sintetizaram uma cadeia de DNA com três nucleotídeos repetidos muitas vezes em uma seqüência conhecida: . Os códons de RNA-m que codificam esses aminoácidos são: valina . essa cadeia de DNA sempre produzia uma proteína com um único tipo de aminoácido.valina-histidina-leucina-treonina-prolina-x. incluindo os diferentes aminoácidos.CAU. um grupo de pesquisadores desenvolveu o seguinte experimento: 1..AGCAGCAGCAGCAGCAGCAGCAGC. Diferentes repetições do experimento demonstraram que até três proteínas diferentes poderiam ser produzidas. Hemoglobina S: .5.Questão 247 Na espécie humana há dois tipos de hemoglobinas.5.UUG.GAG. Questão 249 Nos anos 50 e 60. serão anômalas? Justifique sua resposta.. o sinal para o início da síntese das proteínas (tradução) é geralmente sinalizado no ARNm pelo códon AUG. que é chamada de Shine-Dalgarno. na hemoglobina S.8. quando se iniciavam as pesquisas sobre como o DNA codificava os aminoácidos de uma proteína.. GUC. b) Todas as células. CCG. . existe uma seqüência curta de nucleotídeos que antecede esse códon. UUA treonina .. CAC leucina . . 1.. no lugar do ácido glutâmico? Justifique sua resposta. além do código AUG.. em azul. permite que o sítio correto de iniciação da tradução seja selecionado. que corresponde ao aminoácido metionina. conhecidas como hemoglobinas A e S. CCA ácido glutâmico .

5 a) Quantos nucleotídeos são necessários para codificar a seqüência de aminoácidos nas espécies 1 e 2? Justifique.5 a) Do ponto de vista genético. Questão 253 Uma fita de DNA tem a seguinte seqüência de bases 5'ATGCGT3'. levando a mudanças no ciclo de vida da célula. b e c. b) Pode-se dizer que seqüências idênticas de aminoácidos são sempre codificadas por seqüências idênticas de nucleotídeos? Justifique. 1.8. porque a lactose necessita ser 51 . qual será a seqüência de bases do RNA resultante e que nome recebe esse RNA se ele traduzir para síntese de proteínas? Questão 254 1. c) Considerando que as espécies 2.5. Uma mutação gênica pode determinar a alteração ou a ausência de algumas dessas proteínas. Questão 252 O esquema a seguir representa a seqüência de reações que levam à formação do pigmento da pelagem de uma espécie animal.ou glutamina. que tipo de mutação originou cada seqüência? Sabe-se que a bactéria 'E. 3 e 4 se originaram da espécie 1. Os genes autossômicos A. B e C que atuam nesse processo metabólico. c) É possível ocorrer uma mutação em um gene sem que se altere a enzima correspondente? Justifique.5. a) Explique a relação que existe entre gene e proteína. quantos tipos de albinismo podem ocorrer nessa espécie? Por quê? b) Demonstre o fenótipo esperado de um cruzamento entre animais de linhagens puras com dois tipos diferentes de albinismo. Mutações nos genes A.coli' cresce mais rapidamente na presença da glicose (um monossacarídeo) do que na presença de lactose (um dissacarídeo). a) Considerando que tenha ocorrido a ação da DNA-polimerase. Isso se deve a dois fatos: primeiro. B e C são responsáveis pela produção das enzimas A.8. segundo. B e C produzem respectivamente os alelos recessivos a. a lactose não é tão facilmente incorporada pelas bactérias. em quatro espécies próximas. qual será a seqüência de bases da fita complementar? b) Se a fita complementar for usada durante a transcrição. a) Por que as proteínas obtidas possuíam apenas um tipo de aminoácido? b) Por que foram obtidos 3 tipos de proteínas? Questão 250 O metabolismo celular é controlado por uma série de reações em que estão envolvidas inúmeras proteínas. b) Por que podem ocorrer alterações nas proteínas quando o gene sofre mutação? c) Em que situação uma mutação não altera a molécula protéica? Questão 251 Abaixo estão esquematizadas as seqüências de aminoácidos de um trecho de uma proteína homóloga. Cada letra representa um aminoácido.

bem como suas conclusões a partir deste trabalho.hidrolisada pela enzima ’-galactosidase em glicose e galactose.8.5. M. O gráfico a seguir resultou de experimento em que 'E. As curvas no gráfico adiante representam a concentração da enzima ’-galactosidase. resultante do cruzamento entre duas espécies. b) E é possível pela via da reprodução assexuada? Justifique sua resposta. simplificadamente. Avery. Questão 259 A mula é um animal oriundo do cruzamento da égua (2n=64) e do burro (2n=62). patogênicas.9. Questão 255 Descreva os principais passos seguidos por Griffth em 1928 no experimento que demonstra a "transformação" de bactérias pneumococos sem cápsula. Em relação a esses três animais e ao processo de origem da mula. McCarthy chegaram à conclusão. de que o "agente transformante" capaz de permitir o desenvolvimento da cápsula em pneumococos não-capsulados era o ácido desoxirribonucléico? Questão 257 O que são bacteriófagos? Qual sua importância na identificação do DNA como material genético? 1. a) É possível a reprodução dos zigotos pela via da reprodução sexuada? Justifique sua resposta. a formação de um zigoto híbrido. Questão 258 Descreva o experimento realizado por Hersey e Chase em 1952. a concentração de glicose e o número de bactérias no meio de cultura em função do tempo. ela é estéril. EXPLIQUE os motivos que levam a tal esterilidade. Questão 256 Como os cientistas O. 1. RESPONDA: a) Qual o número de cromossomos encontrado nas células sexuais normais da égua e do burro? b) Qual o número de cromossomos encontrado nas células somáticas da mula? Como essas células se originam? c) Apesar de a mula apresentar uma alta capacidade de realizar trabalho. concentração de glicose e número de bactérias e explique o comportamento da curva da enzima ’-galactosidase. em 1944.5. MacLeod e M. em pneumococos com cápsula. conhecido como "experiência do liquidificador" na qual utilizaram isótopos radioativos de enxofre (S¤¦) e de fósforo (P¤£) para 'marcar' vírus parasitas de bactérias. Questão 260 O esquema a seguir mostra.1 Suponha que os zigotos podem crescer normalmente.5 Identifique as curvas da figura.coli' foi inoculada num meio contendo uma mistura de glicose e lactose. correlacione os parâmetros concentração de ’-galactosidase. 52 . não-patogênicas. dando origem a indivíduos adultos.

1 Uma alteração no DNA pode modificar o funcionamento de uma célula.9. Por quê? Questão 267 O quadro a seguir destaca dois conceitos biológicos: câncer e sistema respiratório de insetos. 46 cromossomos. e que 30% das células apresentavam um cariótipo normal. sem trissomia do 21.5. São Paulo: Moderna. Responda se o fenômeno da não-disjunção do par de cromossomos 21 ocorreu antes ou depois da formação do zigoto. indicando na lacuna pontilhada qual delas foi escolhida para ser representada. J. 2002. Adaptado de Amabis.Questão 261 Ao analisar o cariótipo de células obtidas de uma criança com síndrome de Down. Esse problema pode ser decorrente da não-disjunção do cromossomo 21 em dois momentos durante a formação dos gametas. a não disjunção do cromossomo X e a geração de espermatozóides defeituosos. Qual o número de cromossomos que deve ser encontrado em um espermatozóide normal nessa espécie? Questão 264 A ilustração adiante mostra o cariótipo de um indivíduo do sexo masculino com Síndrome de Down. observou-se. G. R. Considerando a ocorrência de tal não-disjunção. responda. Que tipos de anomalias cromossômicas poderão ser formadas se esses espermatozóides fecundarem ovócitos normais? Justifique. ou seja. "Biologia das células". Justifique sua resposta.9. 1. neste indivíduo. 53 . Questão 262 Tendo um homem ingerido uma substância que causa erros na divisão meiótica da gametogênese. um indivíduo trissômico apresenta um cariótipo contendo 97 cromossomos. M e Martho. a) Em quais momentos ela pode ocorrer? b) Utilize os contornos a seguir para representar uma das duas possibilidades. por exibirem a trissomia do cromossomo 21.1 Questão 266 1. observou-se que 70% das células apresentavam 47 cromossomos. a) Qual é a aneuploidia existente na Síndrome de Down? b) Quais são os mecanismos responsáveis pelo aparecimento desta aneuploidia? c) Qual é a relação existente entre idade materna e a Síndrome de Down? Questão 265 A Síndrome de Down caracteriza-se pela presença de um cromossomo 21 a mais nas células dos indivíduos afetados.5. Questão 263 Numa dada espécie.

Atualmente. analisou-se a seqüência de aminoácidos de uma determinada proteína em diversos mutantes gerados.3 Identifique as duas alterações nos códons do RNA que mais provavelmente explicariam a transformação de ácido glutâmico em valina. 1. 54 . Verificou-se que um desses mutantes produzia uma dada proteína que diferia da original pela ausência de 35 aminoácidos em uma das extremidades da cadeia peptídica. Certo ou errado? Justifique. Questão 269 Qualquer alteração no DNA pode modificar o funcionamento de uma célula? Justifique. Questão 271 a) Faça uma breve descrição de como o nefasto hábito de fumar está associado ao desenvolvimento de câncer de pulmão. proliferação celular descontrolada. tem sido propagada assexuadamente através de mudas e enxertia. Explique como essa única mutação pontual pode fazer com que a síntese da proteína seja interrompida prematuramente. não produzindo gametas viáveis. Após tratar culturas de bactérias com doses de um agente mutagênico capaz de induzir uma única mutação pontual (que afeta apenas um nucleotídeo por célula).9. Por ser uma variedade triplóide (3n) de laranja. Justifique a sua resposta. de forma relacionada.5. fumo. Questão 270 A laranja-da-baía surgiu em 1810 e. b) Descreva o caminho da fumaça de um cigarro desde o meio externo até as células do corpo de uma barata. Justifique sua resposta.2) mutação (modificação da seqüência de nucleotídeos de uma molécula de ADN). 1. e 3) segregação independente (recombinação aleatória de cromossomos dos diferentes pares de homólogos). por não possuir sementes. é possível identificar as alterações no RNA que formam o códon da valina na hemoglobina da anemia falciforme.5. genes reguladores da divisão celular. os seguintes conceitos: tumor. Sabe-se que a variabilidade genética de uma população depende dos seguintes fatores: 1) permutação cromossômica ou crossing-over (troca de fragmentos entre cromossomos de um mesmo par de homólogos). Questão 268 A substituição de uma única base na molécula de DNA leva necessariamente à substituição de um aminoácido na proteína a ser sintetizada pela célula. mutação. Questão 272 A anemia falciforme é uma doença que resulta da substituição de um aminoácido ácido glutâmico pela valina.3 Identifique qual(is) deste(s) fator(es) pode(m) contribuir para a variabilidade genética da laranja-da-baía. na hemoglobina. garantindo que em seu texto apareçam. sua meiose é anormal. Examinando a tabela do código genético a seguir.9. milhões de pés de laranja-da-baía estão espalhados em plantações no Brasil e nos Estados Unidos.

BOMBA ATÔMICA SESSENTA ANOS DE TERROR NUCLEAR Destruídas por bombas. Explique por quê. As células devem dividir-se e conter a divisão. a) Qual a vantagem desse tipo de mutação no aparecimento de novas espécies? b) Se uma mutação gênica ocorre em um dos genes duplicados. A situação "a". b) um nucleotídeo é substituído por outro. "descontrole dos mecanismos de divisão celular" e "câncer". geralmente. 31 de julho de 2005 . "agentes mutagênicos". Japão "Shizuko Abe tinha 18 anos no dia 6 de agosto de 1945 e. agente de natureza biológica que podem aumentar a taxa de mutações gênicas. a duplicação gênica é muito importante na criação de novidades evolutivas. Enviado especial Hiroshima. foi responsabilizada pela contaminação das áreas em torno de sua fábrica de agrotóxicos em Paulínia. manter uma especialização característica apropriada e ocupar o lugar apropriado. II. Hiroshima e Nagasaki hoje lideram luta contra essas armas Domingo. 55 1.9. Nesse tipo de mutação. Questão 277 FIM DA 2 GUERRA MUNDIAL .A. A renovação dos tecidos requer um controle complexo para coordenar o comportamento de células individuais e as necessidades do organismo como um todo. com resíduos de Endrin. é mais drástica que a situação "b". Um aumento significativo no número de casos de câncer na região tem sido associado à exposição dos moradores a essas substâncias.Questão 273 As seqüências de RNA mensageiro a seguir codificam peptídeos com atividades biológicas específicas. considere duas situações: a) um nucleotídeo é suprimido. SP."O GLOBO" Gilberto Scofield Jr. um determinado gene. Àquela altura. tem sua seqüência duplicada e acrescentada ao DNA.5. ela havia abandonado os estudos para se dedicar ao esforço de guerra. A tabela resumida do código genético mostra alguns códons e seus aminoácidos correspondentes. sempre de acordo com as necessidades do organismo. I. Questão 275 Em um segmento de DNA que codifica determinada proteína. sobreviver e morrer. de forma que o indivíduo passa a apresentar uma ou mais cópias do mesmo gene no mesmo cromossomo. Questão 276 Entre os diferentes tipos de processos que criam nova variabilidade genética. fazendo com que o gene não funcione. b) Dê exemplos de um agente de natureza física e de um . Questão 274 Analise as seguintes informações. Suponha que mutações no DNA tenham causado as seguintes mudanças nas duas moléculas de mRNA (1 e 2). Era um dia claro e quente de verão e às 8h. o indivíduo morre? Justifique sua resposta. Shizuko e seus colegas iniciavam a derrubada de parte das casas de madeira do centro de Hiroshima para tentar criar um cordão de isolamento antiincêndio no caso de um bombardeio incendiário aéreo.3 Em qual das mudanças (1 ou 2) há risco de perda ou de diminuição da atividade biológica? Justifique sua resposta. Em 2001 a indústria Shell do Brasil S. aumentando assim a probabilidade de desenvolvimento de câncer. a) Que relações podem ser estabelecidas entre as informações I e II? Inclua na sua resposta os conceitos de "mutação gênica". Diedrin e Aldrin. como todos os jovens japoneses durante a Segunda Guerra Mundial. Sabe-se que essas funções são geneticamente controladas. além de replicar-se.

5. Compare. uma reação inicial inespecífica é efetuada por células do sangue. a) Como a radiação está relacionada ao aumento na incidência de câncer? b) Como se explica que muitos dos efeitos da bomba atômica se manifestem nos descendentes dos sobreviventes? c) Por que algumas pessoas que foram viver nessas cidades tempos depois da explosão também foram afetadas? Questão 279 Soros e vacinas fazem parte do arsenal usado no combate às doenças infecciosas (imunidade adquirida).10 56 . que é transmitida pela picada da mosca tsé-tsé. Dados mostram que a incidência do câncer nas duas cidades japonesas é muito alta.A natureza da imunização 2. respectivamente.A ação imediata ou não 3. a) Nesse combate.A duração da imunização 4. muito mais devastador e letal. Passear pelas ruas de Hiroshima hoje 60 anos depois da tragédia que matou 140 mil pessoas e deixou cicatrizes eternas em outros 60 mil. por exemplo num ferimento. aponte dois motivos pelos quais essas populações humanas devem ser monitoradas ainda hoje. 1. O sistema imunitário age para combatê-las. Questão 278 Os recentes testes nucleares e o cinqüentenário da explosão da bomba atômica em Hiroshima e Nagasaki em 1995 provocaram discussões sobre os efeitos da radiação no meio ambiente e nos seres humanos. as populações dessas cidades continuam a ser monitoradas. Apesar de rica e moderna com seus 1. b) Indique a reação de combate que é específica para cada agente infeccioso e as células diretamente responsáveis por esse tipo de resposta. no Japão. responda: a) Para que é usada? b) De que é feita? c) Como funciona? Questão 283 Um protozoário conhecido como 'Trypanosoma gambiense' provoca no homem a chamada "doença do sono". Indique o processo que leva à destruição do patógeno bem como as células que o realizam. Após sessenta anos da explosão da bomba atômica sobre as cidades de Hiroshima e Nagasaki.é nunca esquecer o passado.1 milhão de habitantes circulando em bem cuidadas ruas e avenidas.ninguém imaginava que Hiroshima seria o laboratório de outro tipo de bombardeio. "Hiroshima. numa população de 400 mil . e entrar em nosso corpo. Com base nos efeitos biológicos das radiações sobre os seres vivos. O estudo da reação imunitária do organismo humano aos antígenos da superfície dos parasitas está demonstrado no esquema abaixo. a ação do soro e da vacina segundo estes tópicos: 1. Questão 282 Sobre a vacina. Japão.O emprego curativo ou preventivo Questão 280 As bactérias podem vencer a barreira da pele. os monumentos às vítimas do terror atômico estão em todos os lugares". para o qual os abrigos antiincêndio foram inúteis". Questão 281 Explique o que é uma vacina e como funciona.

Qual seria a pessoa da família mais indicada para ser o doador? Justifique sua resposta. Mais do que um simples ato de amor. Dois dos filhos do casal são gêmeos monozigóticos e os outros dois são gêmeos dizigóticos. Questão 285 O termo amamentação designa o ato de amamentar. Questão 287 Um casal tem quatro filhos: João. suspeitou-se de que um dos indivíduos fosse originário de uma região onde a infeção pelo vírus X atinge grande número de indivíduos. porém. mesmo nessas circunstâncias. de aceitar uma criança no próprio peito. Justifique por que esse tratamento deve ser feito logo após a picada do animal e. o primeiro filho nunca é afetado. um dos gêmeos monozigóticos.5. b) apresente um exemplo de imunização ativa artificial e um de imunização passiva natural. Paulo e Luisa. em função do tempo. 1. a mãe produz anticorpos contra o fator Rh do filho. Escreva a importância da amamentação PARA A MÃE E PARA O FILHO. tecidos ou órgãos transplantados. 57 . a) Os gráficos a seguir mostram a variação da concentração de anticorpos contra um determinado antígeno no sangue de uma pessoa. em duas condições: vacinação ou soroterapia. por que. a partir da segunda gravidez. Bactérias. Com base nas respostas de cada um deles ao antígeno.10 Um dos gráficos mostrados corresponde à variação da concentração de anticorpo antiofídico no sangue de uma pessoa mordida por uma serpente e tratada com uma dose do soro apropriado. vírus. em casos mais graves. Indique a condição que deve estar presente no feto para o desenvolvimento da eritroblastose em filhos de mulheres que não produzem fator Rh. deve ser repetido a intervalos de tempo relativamente curtos. e mesmo simples moléculas. a) explique a diferença entre a resposta ativa e a passiva. Questão 288 As curvas abaixo mostram a produção de anticorpos específicos de dois indivíduos inoculados com antígenos protéicos do vírus X no dia 0. representa a maneira mais eficiente e prática de alimentar e nutrir o filho sem os riscos que a alimentação artificial pode oferecer. precisa de um transplante de um órgão. Questão 286 As respostas imunológicas constituem mecanismos de defesa vitais para os organismos. fungos. A doença só se manifesta. Questão 284 A função do sistema imunológico é a de defender o organismo contra invasores. b) Justifique o aumento do número de parasitas com antígeno B na semana 2. Explique por que. podem ser reconhecidos pelo organismo como agentes agressores. Maria. b) Na eritroblastose fetal.a) Explique por que os parasitas com antígeno A desapareceram na semana 2 e cite o principal tipo celular participante da reação responsável por esse desaparecimento. João. Qual dos dois indivíduos é originário da região com alta incidência do vírus X? Justifique. A esse respeito.

Determine se os resultados dos testes seriam positivos ou negativos tanto para animais infectados quanto para vacinados. dificultando as relações comerciais internacionais. pode-se considerar que toda a população está protegida se uma alta proporção dos indivíduos estiver imunizada. e não a detecção do próprio vírus na carne. Cinco meses depois desse evento. avalie se a estratégia de vacinação com esses antígenos seria eficaz. a) Explique por que a imunidade de grupo é eficiente no controle de doenças como a gripe. por exemplo. Justifique sua resposta. A figura a seguir. o cólera e a hepatite. O gráfico a seguir reproduz os dois momentos em que ocorreram as contaminações.10 Questão 289 A febre aftosa é uma doença virótica que afeta diversos animais de importância econômica. Questão 292 Uma pessoa foi contaminada por uma substância tóxica.10 1. A linha pontilhada representa a SUBSTÂNCIA TÓXICA. O voluntário 6 não recebeu nenhum dos antígenos. B e C) do parasita causador da malária (plasmódio) foi testada em uma pesquisa. 58 . Para tratá-la o médico introduziu em seu organismo uma substância específica. B e C no soro de cada um dos voluntários. Com base nos resultados apresentados. enquanto a linha contínua representa a SUBSTÂNCIA ESPECÍFICA. tais como vacas e ovelhas. As restrições à importação de carne se baseiam no fato de que os testes disponíveis utilizam a detecção de anticorpos contra o vírus. b) Explique por que a imunidade de grupo não é eficiente no controle de doenças como. pelo médico. como medicamento.5. a pessoa foi novamente contaminada e outra vez a substância específica foi usada. Tal fenômeno é denominado imunidade de grupo. Estes testes geram resultados semelhantes para animais vacinados e animais que contraíram a doença. Justifique sua resposta. que mostra o título (quantidade) de anticorpos específicos contra os antígenos A.1. mas sim uma substância inócua (placebo) para servir de controle negativo. Questão 290 A resposta imune de seis voluntários a três diferentes antígenos (A. Países que não vacinam seus rebanhos contra febre aftosa restringem a importação de carne de países onde a vacinação ocorre. indica os resultados observados. Questão 291 No caso de algumas doenças infecciosas.5. de origem orgânica.

5. 1. Considerando que esse quadro retrata as condições encontradas em outros países industrializados.10 1.5.10 1. inoculada no paciente.10 A substância específica de combate. Após uma série de experiências. Questão 294 O gráfico representa o resultado de duas aplicações de um mesmo antígeno.1. Questão 296 Leia os seguintes fragmentos de textos: 1. um médico inglês. observou no final do século XVIII que um número expressivo de pessoas mostrava-se imune à varíola. mas que não causava a morte dos animais. que descreve causas de óbitos humanos nos Estados Unidos no início e no final do século XX. constatou que estes indivíduos mantinham-se 59 . é um soro ou uma vacina? Justifique sua resposta.5. a) A que tipo de imunização se referem as aplicações? b) Analise os resultados apresentados pelo gráfico e explique o fato observado com a 2 aplicação do antígeno. a) Que tendência pode ser observada quando se comparam as taxas de mortalidade por doenças contagiosas e por doenças degenerativas (também chamadas "doenças da velhice") no início e no final do século XX? b) Cite dois fatores que podem explicar as mudanças observadas nas taxas de mortalidade por doenças contagiosas. responda.5. em intervalos diferentes. Questão 293 O gráfico a seguir mostra as respostas primária e secundária da produção de anticorpos quando um indivíduo é submetido a injeções de antígenos.10 Analisando o gráfico. responda: a) Qual a função do antígeno e qual curva corresponde às respostas primária e secundária? b) Explique o que acontece em relação aos anticorpos nas fases das respostas primária e secundária. Todas eram ordenhadoras e tinham se contaminado com "cowpox". Questão 295 Analise o gráfico. uma doença do gado semelhante à varíola pela formação de pústulas. Edward Jenner.

refere-se a processos de imunização passiva? Justifique sua resposta. (www. b) Considere. de 1980 a 1997. É mais correto supor que. O sistema imunitário. Se picada por uma delas.fiocruz. A 6 de julho de 1885.bio. cada uma com material mais virulento. nos dois gráficos. injetou na criança material proveniente de medula de um coelho infectado. a) Explique como macrófagos.bio. Questão 300 Procurando compreender a importância de determinadas células sangüíneas para o sistema imunológico. que atua no combate a infecções. b) Explique que mecanismos induzem a proliferação de linfócitos nos gânglios linfáticos. linfócitos T e linfócitos B atuam no sistema imunitário. chegava ao laboratório de Louis Pasteur um menino alsaciano de nove anos. Questão 298 Os médicos verificam se os gânglios linfáticos estão inchados e doloridos para avaliar se o paciente apresenta algum processo infeccioso. Para reduzir rapidamente e de imediato o número de doentes durante uma epidemia. 1 ou 2. (www. respectivamente. ao longo desse ano. o ano de 1997. Ao todo. Joseph Meister. O soro antiofídico poderia ser denominado vacina antiofídica? Explique.) a) O gráfico 2 indica claramente a ocorrência de epidemias de sarampo em dois anos distintos no Brasil. Ministério da Saúde. Pasteur. é constituído por diferentes tipos de glóbulos brancos e pelos órgãos responsáveis pela produção e maturação desses glóbulos. que havia sido mordido por um cão raivoso. 1. Questão 299 Observe atentamente os dois gráficos apresentados. a vítima deve ser tratada com soro antiofídico. Gráfico 1: Cobertura da vacinação contra sarampo em menores de um ano no Brasil.5. nos fragmentos de textos 1 e 2? Que relação existe entre o fenômeno observado no relato 1 e as chamadas células de memória? Questão 297 Jararaca. Meister não chegou a contrair a doença. b) Que tipos de produtos (medicamentos) puderam ser produzidos a partir das experiências relatadas.fiocruz. coral e urutu são exemplos de cobras venenosas que ocorrem no Brasil. de 1982 a 1997. os resultados representados no gráfico 1 tenham influenciado os resultados representados no gráfico 2 ou o inverso? Justifique.br) 2.refratários à varíola.br) a) Qual dos fragmentos. é mais eficiente o uso do soro ou da vacina? Justifique. Gráfico 2: Taxa da incidência anual de sarampo em menores de um ano no Brasil.10 (Programa Nacional de Imunizações. cascavel. que vinha desenvolvendo pesquisas na atenuação do vírus da raiva. foi feito o seguinte experimento: 60 . mesmo quando inoculados com o vírus. foram 13 inoculações.

Os genes a e b. não contribuem para o acréscimo de massa. obteve-se uma geração F que. com linhagens homozigóticas que produzem frutos de 300g. Um criador. Questão 305 Em um concurso de cães. que ganham nota zero. Considerando a cor da pele de negros e de brancos responda: a) Onde é determinada. qual é a proporção de cada classe fenotípica obtida em F‚? Questão 304 A altura dos espécimes de uma determinada planta encontrada no cerrado varia entre 12cm e 108cm.1. esperada para a primeira geração de um cruzamento entre dois indivíduos com os genótipos AABBCC e aabbCC. O fruto de uma planta de genótipo AABB tem 40 gramas de massa enquanto o de uma planta de genótipo aabb tem 20 gramas. Do cruzamento entre linhagens homozigóticas que produzem frutos de 150g. qual a importância da existência dessa variabilidade na cor da pele para o ser humano? d) Especifique a forma de herança genética responsável pela determinação da cor da pele. Questão 302 A massa de um determinado tipo de fruto depende da ação de dois genes A e B. Determine a massa do fruto de uma planta de genótipo AABb. Justifique sua resposta. originou 7 fenótipos diferentes. cruzou um macho e uma fêmea.10 respectivamente. o Governo Federal vem discutindo a implantação de quotas para negros nas universidades. Questão 303 O peso dos frutos (fenótipos) de uma determinada espécie vegetal varia de 150g a 300g. 61 Com base no exposto. Esses genes contribuem com valores idênticos para o acréscimo de massa. reponda: a) quantos pares de genes estão envolvidos na determinação do peso dos frutos desta espécie vegetal? b) qual é o efeito aditivo de cada gene? c) de acordo com o triângulo de Pascal. ambos heterozigotos para os dois genes.5. autofecundada. desejando participar do concurso. O homozigoto dominante para estas duas características recebe mais pontos que os heterozigotos e estes. em centímetros. Qual o nome que se dá a esse método profilático? Questão 301 Atualmente. obtendo uma descendência com todos os genótipos possíveis. responda às perguntas a seguir. mais pontos que os recessivos. a) Que tipo específico de célula sangüínea foi afetada pela irradiação? b) Que tipo de molécula essa célula do sangue passa a produzir quando estimulada pela proteína estranha? c) A introdução de moléculas estranhas ao organismo com o objetivo de provocar uma resposta imune é um método bastante usado na prevenção de determinadas doenças. alelos de A e B . que interferem igualmente na altura da planta. duas características são condicionadas por genes dominantes (A e B). Sabendo-se que o peso do fruto é um caso de herança quantitativa. Os responsáveis por essa variação são 3 pares de genes com segregação independente. histológica e citologicamente a cor da pele? Histologicamente: Citologicamente: b) O que confere a diferença na cor da pele de indivíduos negros em relação à dos indivíduos brancos? c) Evolutivamente. não alelos. independentes e de ação cumulativa (polimeria). Determine a altura.

O cruzamento entre plantas com esses fenótipos produziu as seguintes proles na geração F1. Questão 307 Um pesquisador cruzou paineiras de flores "pink" com paineiras de flores brancas. Os descendentes (F) foram cruzados entre si.5. produzindo sempre as seguintes freqüências fenotípicas na geração (F‚): Questão 309 A cor da pelagem em coelhos é determinada por uma série de alelos múltiplos composta pelos genes C. vinho.12 1. respectivamente. A ordem de dominância existente entre os genes é C > c¢ > c£ > c¤.5. responda ao que se pede: a) Quantos alelos estão envolvidos na determinação do caráter cor de fruto e qual a relação de dominância entre eles? b) Qual a proporção genotípica e fenotípica do cruzamento entre plantas de fruto vinho do cruzamento parental (2) com plantas de fruto vinho do cruzamento parental (4)? c) Quantas plantas com frutos amarelos serão geradas. responsáveis pelos fenótipos aguti. d¢ e d£) tem seu locus no cromossomo II. II) apenas flores de rosa médio. c¢. A4). teoricamente. a¢.11 Com base nos resultados apresentados. C2). 1. Qual dos dois mecanismos explica a maior parte das variações fenotípicas nas populações? Justifique. B2 e C1. Em relação a essas duas séries de alelos. a partir de 200 sementes oriundas do cruzamento entre plantas de frutos vinho do cruzamento parental (4) com plantas de frutos rosa do cruzamento parental (2)? Questão 311 Uma determinada característica depende de um locus que possui 4 alelos (A1. possíveis na população? . c£ e c¤. A2. porém são 62 a) Qual o tipo da herança da cor da flor da paineira? b) Indique as possibilidades de se obter em um cruzamento: I) apenas flores de cor branca. rosa e amarela. a£ e a¤) tem seu locus no cromossomo I e outra série de três alelos (D. e que cada gene dominante contribui com 5 pontos na premiação. quantos genótipos diferentes são. chinchila. enquanto outras são determinadas por muitos genes (herança poligênica). Questão 308 Admitamos que numa certa espécie de animal quatro alelos (A. quantos pontos devem ter obtido os vice-campeões e os cães classificados em penúltimo lugar? Questão 306 Certas características fenotípicas são determinadas por poucos genes (herança mendeliana). Responda: a) Quais as proporções fenotípicas e genotípicas esperadas na progênie do cruzamento entre um coelho aguti (Cc¢) e um coelho chinchila (c£c¤)? b) Como você explicaria o aparecimento de coelhos albinos a partir de um cruzamento entre coelhos himalaios? Questão 310 As videiras podem produzir uvas de coloração vermelha. A3. Outra característica também depende de 4 genes (B1.a) Qual a probabilidade do criador obter um animal com a pontuação máxima? Qual a probabilidade de obter um animal homozigoto recessivo para os dois genes? b) Considerando que todos os descendentes do referido cruzamento participaram do concurso. himalaio e albino.

25% para cada um deles.não ocorreu permuta entre os genes A e C. . Uma rainha de olho marrom. um com a transmissão quebrada.ocorreu 10% de permuta entre os genes B e D. pois esperava obter os quatro genótipos na mesma proporção. sabendo-se que a freqüência de permutação é de 36%? Questão 316 Quais são os gametas produzidos por um indivíduo de genótipo Ab/aB? Em que proporções serão formados sabendo-se que os genes A e b permutam com uma freqüência de 16%? Questão 317 Considere a existência de dois locos em um indivíduo. Questão 314 O cruzamento CD/cd x cd/cd produziu 600 descendentes. todos localizados em um mesmo cromossomo. sendo que "A" e "B" são dominantes. Cada loco tem dois alelos "A" e "a" e "B" e "b". com eles. qual é a seqüência mais provável desses 4 genes no cromossomo. é cruzado com outro. produziu 600 ovos e foi inseminada artificialmente por espermatozóides que portavam. sabendo-se que a freqüência de permutação é de 10%? Questão 315 Que tipos de gametas e em que proporções produzirá um organismo com genótipo Cd/cD. os cinco alelos. . Identifique esses genótipos. bem como as localizações 63 . constituída por cinco alelos. Questão 312 Em abelhas. Quantos deverão ser diferentes dos pais. o evolucionista John Maynard-Smith escreveu sobre a meiose. quantos terão o olho de cor marrom? Questão 313 Um organismo. durante a produção de gametas: "A meiose é o equivalente a ter dois carros. a cor do olho é condicionada por uma série de alelos múltiplos. que é homozigoto recessivo para os mesmos alelos. a partir do gene A? b) Justifique sua resposta.dois pares de alelos localizados em pares de cromossomos homólogos diferentes. produzir um único carro que funcione". Questão 318 Sabendo que a maioria das mutações é deletéria (prejudicial ao organismo). O retrocruzamento de F1 (com o duplo recessivo) mostra os seguintes resultados: . outro com o motor quebrado e. Um pesquisador cruzou um indivíduo "AaBb" com um indivíduo "aabb". a) Baseando-se nos resultados acima.ocorreu 20% de permuta entre os genes A e B. em proporções iguais. qual o número esperado de machos e de fêmeas na descendência? Dos machos esperados. Em abelhas. com a seguinte relação de dominância: marrom>pérola>neve>creme>amarelo. heterozigota para pérola. que descendência resulta deste processo? b) Na inseminação realizada. homozigoto para os genes A B C D. A prole resultante foi: 40% AaBb 40% aabb 10% Aabb 10% aaBb O pesquisador ficou surpreso. existe um processo denominado partenogênese. Somente 40% dos ovos dessa rainha foram fertilizados e toda a descendência teve a mesma oportunidade de sobrevivência. porém. Esses resultados contrariam a segunda lei de Mendel ou lei da segregação independente? Justifique sua resposta. 30% entre A e D. a) O que é partenogênese? Em abelhas. Um desses dois tipos de determinismo genético apresenta um número maior de genótipos possíveis na população. A figura a seguir ilustra um par de cromossomos homólogos duplicados (A e B).

o. A descendência desse retrocruzamento apresentou 15% de permuta entre os locos M e N. O. Artmed. poderiam infectar com o vírus da AIDS toda a população. um folheto à população alertando sobre os perigos da ingestão de transgênicos na alimentação. b) Por que não houve descendentes recombinantes com permuta entre os locos M e P? Questão 320 O primeiro teste de terapia gênica humana utilizou células sangüíneas. a menina é mais saudável do que antes. Porto Alegre. O. p. H. constava uma que afirmava incorretamente que "para serem criadas plantas transgênicas são usados os vírus da AIDS" e que tais plantas.13 vida em um ambiente estéril.. P estão localizados em um mesmo cromossomo. Um indivíduo homozigótico para os alelos M. N. Esta criança possuía um sistema imune extremamente deficiente e não podia defender-se contra infecções. n. p. N. P foi cruzado com outro. Não houve descendentes com permuta entre os locos M e P. 10% de permuta entre os locos N e O. Questão 319 Os locos M.5. A geração F foi então retrocruzada com o homozigótico m. Responda. que viveu sua curta . Sua doença era a mesma que a do "menino da bolha". homozigótico para os alelos m. no Sul do país. (Kreuzer. A paciente foi uma menina com a doença da imunodeficiência combinada severa. explique em que consistem. "Engenharia Genética e Biotecnologia". os tratamentos denominados "terapia gênica".) a) A partir do exemplo apresentado no texto. no procedimento 64 Um indivíduo que possui os cromossomos A e B poderá formar gametas que não sejam portadores dos alelos M e N? Justifique sua resposta. indicando as distâncias entre os locos. se ingeridas. b) Selecione e transcreva o segmento do texto que justifica a afirmação de que a terapia gênica é um exemplo de engenharia genética. Então eles reintroduziram os linfócitos na paciente. Entre as advertências. a) Qual a seqüência mais provável desses locos no cromossomo? Faça um esquema do mapa genético desse trecho do cromossomo. n. pois estas são de fácil obtenção e de fácil reintrodução no corpo. 2002.dos alelos deletérios "M" (presente somente no cromossomo A) e "N" (presente somente no cromossomo B). A causa da doença da menina era um defeito em um gene que codifica a enzima adenosina desaminase (ADA). hoje. Massey. 25% de permuta entre os locos M e O. As células alteradas produziram a enzima que faltava e. o. 08/09/2000) Explique a vantagem da utilização. de maneira geral. A. Os cientistas do National Institute of Health dos Estados Unidos coletaram sangue da menina. Questão 321 Alguns grupos radicalmente contrários ao uso de organismos geneticamente modificados (transgênicos) na agricultura divulgaram recentemente. A técnica combina o uso de células-tronco de embriões e terapia genética. 1. separaram os linfócitos (células brancas) e usaram um retrovírus para introduzir uma cópia correta do gene nestas células. Questão 322 CÉLULAS-TRONCO PODEM TRATAR LESÕES CEREBRAIS Empresa usa unidade estrutural de embriões para recuperar vítimas de derrame. (Adaptado de "O Globo". a) O que são transgênicos ou organismos geneticamente modificados (OGMs)? b) Explique por que o vírus da AIDS não poderia infectar uma planta e por que a ingestão de uma planta transgênica não seria capaz de transmitir o vírus da AIDS.

15. Em uma delas. b) o resultado da experiência seria diferente se tivessem sido usados núcleos de células germinativas. Questão 324 A figura a seguir (Folha de São Paulo. postulava-se a idéia de que ocorria perda de material genético enquanto a célula se diferenciava.1 . previamente anucleado. responda: a) Como o bebê da figura acima poderia ter sido gerado? b) Qual seria o sexo do bebê gerado por esse processo? Justifique sua resposta. A célula assim formada foi implantada no útero do indivíduo 3. até o estágio adulto.5. Questão 326 No desenvolvimento de um organismo ocorre a transição de um estágio embrionário. Questão 323 Dois cientistas realizaram uma experiência com o objetivo de estudar a transmissão das informações contidas nos genes do núcleo de células de diferentes tecidos. Os cientistas observaram que a grande maioria destas células. Questão 325 Em uma experiência de reprodução com uma espécie de mamífero adotou-se o seguinte procedimento: fundiu-se uma célula do indivíduo 1 com um óvulo. Na segunda. o qual afirma que cenas como estas não só são possíveis. origina outro organismo. composto por até centenas de diferentes tipos de células. com seus novos núcleos. resultaram na formação de embriões normais. Identifique qual das duas hipóteses é confirmada pelos processos de clonagem. Justifique sua resposta. ao 2 ou ao 3? Justifique sua resposta. no qual todas as células são inicialmente indiferenciadas. Cientistas da Universidade do 65 1. do indivíduo 2. Esse processo é conhecido como diferenciação celular. Historicamente. Explique por que: a) esses núcleos transplantados de células somáticas de diferentes tecidos deram origem a indivíduos normais e idênticos. como inevitáveis. Questão 327 "CIENTISTAS DA UNIVERSIDADE DO HAVAÍ CLONAM MAMÍFERO ADULTO DO SEXO MASCULINO A clonagem deixou de ser uma técnica aplicável exclusivamente às fêmeas. H2. 6/8/98) baseia-se no livro Remaking Eden (Refazendo o Éden) de Lee Silver. havia duas hipóteses a respeito da diferenciação celular. Esse novo ser é geneticamente idêntico ao indivíduo 1. de células-tronco ao invés de células já diferenciadas. Núcleos de óvulos de rã não-fertilizados foram substituídos por núcleos de células somáticas. ao se desenvolver. nos quais o núcleo da célula de um tecido de um indivíduo adulto é introduzido em um ovócito anucleado que. que a diferenciação não implicava perda de DNA. e deu origem a um novo ser. Admitindo-se a possibilidade de clonar seres humanos e com base no que tem sido publicado nos principais jornais e revistas do País. retiradas de uma mesma rã. desenvolveu-se. que chamaremos de H1.descrito.

O material foi substituído por células extraídas da cauda do doador.Havaí clonaram o primeiro mamífero adulto do sexo masculino." Questão 329 Respondendo a uma questão sobre a possibilidade de se clonarem animais para livrá-los de extinção. os pesquisadores Ryuzo Yanagimachi e Teruhiko Wakayama mostram que um macho adulto também pode ser replicado. TÉCNICA II 1 . caso um dos animais seja sensível a uma bactéria que cause pneumonia? b) Justifique sua resposta. ocorrem naturalmente no cotidiano.1 Adaptado da Revista Época: Ano II. no entanto. 3 . 2 .. como havia sido feito até agora. TÉCNICA I 1 . considerada o primeiro clone de mamífero gerado artificialmente. Trata-se de um camundongo batizado de Fibro. . e descartaram seus núcleos. um cientista cria em laboratório novas gerações de dinossauros. 3 .Uma fêmea (animal X) é estimulada com hormônios a produzir vários óvulos. 66 1. das quais são retirados os núcleos. por meio do sangue conservado em mosquitos que os teriam picado e que permaneceram fossilizados no âmbar. I e II. Considere a possibilidade de que o DNA obtido pertença a um único dinossauro e que deste DNA foram recuperados vários exemplares. lembra o geneticista Ademar Freire Maia em um artigo do Boletim "Germinis" do Conselho Federal de Biologia. tipo de célula usada na criação do animal (. chegando-se assim à fórmula para recuperar a espécie. os zigotos são retirados da fêmea e divididos em dois.89. nŽ55.O núcleo retirado da célula somática do animal Y é implantado no óvulo sem núcleo do animal Z. a) Qual seria a desvantagem biológica de um rebanho de clones? b) Dê um exemplo de clone que ocorre naturalmente.) Agora. Clones.5. Um dos objetivos dessa pesquisa é a melhoria da pecuária. b) O novo animal formado pela técnica II pode ser chamado "clone" do animal Y. Pergunta-se: a) Todos os animais produzidos pela técnica I são genotipicamente iguais ao animal X? Justifique. foi possível determinar o DNA dos dinossauros.O embrião é reimplantado no útero de um terceiro animal (animal W) dando origem a um novo animal.Células somáticas são retiradas do corpo de um animal (animal Y).Após alguns dias. um cientista apresenta duas técnicas. Em vez de utilizar células relacionadas ao sistema reprodutivo feminino para preencher os óvulos. a) O que se poderia dizer dos exemplares recuperados. produzidos por ratas. os cientistas criaram Fibro a partir de um pedaço do rabo de um camundongo. Com o sangue. que poderiam ser usados e que estão descritas nos quadros. através da formação de rebanhos homogêneos. da mesma espécie. pesquisadores anunciaram o nascimento da ovelha Dolly. A nova célula assim formada começa a se dividir formando um embrião. gerando um novo animal. uma brincadeira com a palavra fibroblasto. Apenas 274 embriões resultaram dessa operação e foram implantados em 25 ratinhas que funcionaram como 'mães de aluguel'. O núcleo de cada um desses óvulos é retirado. 4 ..15. Por que os cientistas extraíram os núcleos dos óvulos antes de inserir as células da cauda do doador? Questão 328 No filme "Parque dos Dinossauros".Essa fêmea é então inseminada artificialmente. p. extintos há 65 milhões de anos. Eles colheram 700 óvulos. 7/6/99. 4 . Z ou W? Justifique. de maio/junho de 1997.Óvulos não fecundados são retirados de um segundo animal (animal Z). Questão 330 No início deste ano. 2 .Cada metade é reimplantada no útero de outra fêmea (receptora). segundo trabalho publicado na revista "Nature Genetics".

que codifica as proteínas necessárias para a formação de novas partículas virais no interior da célula hospedeira. Questão 332 A terapia génica. coletar células da medula óssea do paciente. comparando com o crescimento de um camundongo. contendo a informação para a síntese da ’-globina. colocar as células coletadas em contato com o retrovírus modificado. na ausência do gene de resistência.Y representa o trecho de ácido nucléico introduzido. que contém a informação para a síntese da cadeia ’ da globina. as matariam. . poderia ser usado um retrovírus modificado.2 a) Explique a causa da diferença no crescimento dos camundongos 2 e 3. . Por exemplo. indica que a partícula viral contém as enzimas transcriptase reversa e integrase (insere o material genético de origem viral no genoma da célula). b) Indique qual dos retrovírus modificados. Entre as várias estratégias de produção de plantas transgênicas.X representa o trecho de ácido nucléico viral. realizou uma cirurgia e removeu a hipófise. IV e V).15.5. deveriam ser realizadas três etapas: 1. uma promessa da biotecnologia moderna. não transgênico e com hipófise. na talassemia. elabore uma hipótese para a causa da diferença no crescimento dos camundongos 1 e 2. antes da . a) Explique por que. doença caracterizada pela produção de hemoglobina anormal devido a uma deleção no gene que codifica a cadeia ’ da globina. indicado em lagumas figuras. no caso do tratamento da talassemia. Questão 331 Um pesquisador construiu um camundongo transgênico que possui uma cópia extra de um gene Z. 1. Obteve as seguintes curvas de crescimento corporal: manipulação (Esquema I) .2 1. 67 . 3.15. destacamos duas: 1) Plantas resistentes a certos vírus patogênicos que. A seguir. as células retiradas da medula óssea são as indicadas para serem infectadas com as partículas virais adequadamente modificadas. reintroduzir as células infectadas no paciente. Em seguida. seria o mais indicado para ser usado nesse tratamento. Justifique sua resposta. estudou o crescimento desses camundongos. para que essas sejam infectadas. Essas plantas toleram concentrações maiores de agrotóxico sem alterar as propriedades tóxicas dos defensivos agrícolas. estão esquematizadas a partícula viral original. 2) Plantas mais resistentes aos efeitos dos defensivos agrícolas (agrotóxicos). e quatro diferentes partículas virais modificadas (Esquemas II.5.Justifique. b) Com base em sua resposta ao item a. Algumas metodologias em estudo utilizam retrovírus modificados como veículo de introdução do gene desejado. 2. III. Questão 333 As técnicas modernas de engenharia genética tornaram possível a produção de plantas transgênicas que possuem genes introduzidos artificialmente no seu genoma. consiste na cura de defeitos genéticos pela introdução de genes normais em celulas de indivíduos doentes. apresentados nos esquemas acima. Nesse caso. Em um outro camundongo jovem.o símbolo esférico e negro.

onde cada traço indica a posição e o tamanho dos fragmentos num 68 1. no que se refere à perpetuação de sua própria espécie. qual das duas estratégias não é recomendável? Justifique sua resposta. explique a) como os três grupos de seres se diferenciam entre si. para aumentar a produção leiteira. Essas resultam em fragmentos de tamanhos diferentes que podem ser utilizados como marcadores genéticos. indicados no esquema por setas. as fronteiras entre as espécies vêm sendo rompidas com a criação de organismos transgênicos. No entanto. em seus cromossomos de número 21. c) Indique um benefício decorrente da utilização de organismos transgênicos e um possível risco para o ambiente ou para a saúde humana. do ponto de vista genético. A introdução de soja e de outras plantas transgênicas tem gerado muita polêmica. b) Apresente dois testes laboratoriais para a detecção de portadores de fenilcetonúria e explique os princípios desses testes. Analisando-os quanto à variabilidade gênica.Do ponto de vista ambiental. da mãe e da criança estão indicados na figura 2. por que o tratamento iniciado logo após o nascimento. não há ainda como avaliar os riscos que os organismos transgênicos apresentam. Questão 334 Considere os seguintes seres: I) cabra selecionada artificialmente. Questão 338 Considere estes dados como hipotéticos.2 Explique o que é alimento transgênico e como é obtido. o qual inclui uma dieta restritiva à fenilalanina. por cruzamentos sucessivos. b) Defina um organismo transgênico. pois. Um casal apresenta. sendo o excesso transformado em compostos tóxicos que comprometem o desenvolvimento físico e mental da criança fenilcetonúrica. a) Cite dois mecanismos que impedem a troca de genes .15. Justifique. II) cana-de-açúcar obtida através de mudas. a) Explique. No esquema a seguir. Questão 335 entre espécies distintas. pode melhorar a qualidade de vida das crianças afetadas por fenilcetonúria. Questão 337 Uma mutação no gene que codifica a enzima fenilalanina hidroxilase pode acarretar o acúmulo do aminoácido fenilalanina no sangue. pontos de quebra por enzimas especiais. os fragmentos são indicados por Kb (1Kb=1000 pares de bases nitrogenadas). como a fenilcetonúria.5. Questão 336 Existem mecanismos que normalmente impedem a troca de genes entre espécies distintas. o desenvolvimento de novas metodologias nas áreas da bioquímica e da biologia molecular permitiu a implementação de exames diagnósticos. porém. apesar de seus inúmeros benefícios. em caso de ocorrer uma catástrofe ambiental. Os resultados obtidos com o estudo dos marcadores para o cromossomo 21 do pai. Esse casal tem uma criança com Síndrome de Down devida à trissomia do cromossomo 21. b) de que forma os três grupos poderiam ser afetados. Nos últimos anos. indubitavelmente importantes no caso de doenças tratáveis. III) soja transgênica clonada para melhoria da qualidade biológica de suas proteínas.

Justifique sua resposta. O ADN radioativo é então desnaturado (suas cadeias são separadas por calor) e posto em contato com o ADN de um outro organismo. I ou II. que permaneceu anônimo. Justifique sua resposta. Questão 339 No início do projeto do genoma humano. Nos dois casos. Por que a segunda estratégia é mais rápida e. II) extrair todos os ARNs mensageiros. determine: O genitor onde ocorreu a não-disjunção. 3) Suponha que a mulher está novamente grávida e que o exame para marcadores do cromossomo 21. em que ocorreu o fenômeno de não-separação ou não-disjunção dos cromossomos. Pelos resultados apresentados na figura. Após a hibridação (reassociação formando moléculas híbridas). mais . Com base nessa informação. portanto. Analise o resultado obtido na figura 3. após o nascimento. constatou-se que a criança apresentava Síndrome de Down. a partir da amostra de somente um indivíduo. pressupõe-se que a criança deve ser normal. havia duas estratégias a considerar: I) seqüenciar o ADN total dos cromossomos diretamente. 1) Identifique o genitor que transmitiu dois cromossomos 21 à criança. A fase da meiose em que o fenômeno ocorreu. no entanto. marcado com fósforo radioativo. Foi feito um experimento em que o ADN do organismo 1 (ADN radioativo) foi "hibridado" com o ADN não radioativo de três outros organismos. 2) Determine o estágio da meiose. Por que foi importante determinar a seqüência do ADN de um homem e não de uma mulher? 69 1.3 Com base nas informações apresentadas e em conhecimentos sobre o assunto responda ao que se pede. que o ADN era de um indivíduo do sexo masculino. econômica? Questão 340 Uma técnica usada como uma ferramenta da taxonomia emprega a seguinte abordagem: extrai-se o ADN de um organismo e este é. obtendo-se os seguintes resultados: ADN do organismo 1 + ADN do organismo 1 = 100% de radioatividade no ADN híbrido ADN do organismo 1 + ADN do organismo 2 = 10% de radioatividade no ADN híbrido ADN do organismo 1 + ADN do organismo 3 = 40% de radioatividade no ADN híbrido ADN do organismo 1 + ADN do organismo 4 = 85% de radioatividade no ADN híbrido Qual o organismo que pertence à mesma espécie do organismo 1? Justifique sua resposta. então. produzir ADN a partir desses ARNs mensageiros e seqüenciar apenas esse ADN. igualmente desnaturado. que individualmente determinaram a seqüência de vários trechos diferentes do ADN de todos os cromossomos.campo de eletroforese. Questão 341 Em Junho de 2001. Sabe-se. a técnica de seqüenciamento era a mesma. amniocentese. como descrito no texto. porém não radioativo. Entretanto. foi realizado para o feto através de punção do líquido amniótico. Esse projeto contou com a participação de diversos laboratórios. é possível medir quanto ADN radioativo existe num ADN de cadeia dupla.5. foi publicada a seqüência quase completa do genoma humano.15.

Detectou-se ainda que esses marcadores ocupam o MESMO loco. nascendo Renato. 70 . III e IV) mais provável PARA CADA UM de seus pais? c) Qual é a probabilidade de um certo casal. No entanto. b) Se o xilema é bloqueado. a) Explique o que é genoma e indique uma possível conseqüência econômica dos resultados desta pesquisa. Paula engravidou-se ao manter relações sexuais com dois irmãos. qual é o padrão de bandas (I. os jornais e a revista científica internacional "Nature" publicaram com destaque um grande feito de um grupo de cientistas brasileiros.br).com. que causa uma doença nas laranjeiras. formado por indivíduos tipo I e III. determinando o Juiz a realização dos testes de DNA. II. uma vez que pode ser associada com algum fenótipo em particular. a Justiça pronunciou-se sobre a paternidade de uma das crianças e ficou impossibilitada de pronunciar-se sobre a paternidade da outra criança. Cada uma dessas regiões recebe o nome de marcador. As frases a seguir constam numa lista de "mitos e verdades sobre o teste de DNA" encontrada na internet (http://www.Questão 342 Considerando situações hipotéticas. ambas reclamaram na Justiça o reconhecimento de paternidade. pois a maioria das frutas não se desenvolve. Questão 346 1. Dessa forma. quais as principais deficiências que a planta sofre? Justifique. Após receber os resultados. nascendo destas relações Alfredo. O esquema abaixo representa a análise de marcadores de DNA de quatro embriões humanos (I. podemos descobrir se um embrião poderá apresentar uma determinada característica ou doença genética pela análise de seus marcadores. II.3 O teste de paternidade usando o DNA tornou-se muito freqüente hoje. III e IV). quais NÃO deverão apresentar a disfunção muscular quando adultos? b) Supondo que os quatros embriões sejam irmãos. gêmeos dizigóticos. Apenas a presença de duas bandas (A e B) é indicativo positivo para o indivíduo apresentar uma certa disfunção muscular quando adulto. Questão 345 O exame de paternidade através da comparação de DNA seqüenciado vem sendo utilizado para determinar progenitores. Maria manteve relações sexuais com dois irmãos. 'Xylella fastidiosa'. gêmeos monozigóticos. ter um descendente com essa disfunção muscular? Questão 344 Recentemente. Observe o padrão de bandas do DNA de cada embrião e responda: a) Dentre os embriões analisados. conhecida como amarelinho. Em outra situação. também hipotética. A presença do marcador no genoma de um indivíduo pode ser visualizada como uma banda.5. Responda: a) sobre a paternidade de qual criança o juiz pronunciou-se? b) por que não pôde o juiz se pronunciar sobre a paternidade da outra criança? Questão 343 Com técnicas de biologia molecular é possível verificar a presença ou não de certas regiões de interesse na fita de DNA.15. O xilema das plantas produtoras de laranja é parcialmente bloqueado. que identificou o genoma de uma bactéria. É possível determinar o pai de um recém-nascido quando a dúvida sobre a paternidade desse recém-nascido está entre gêmeos univitelinos? Justifique sua resposta.gene. Abandonadas. as pessoas têm muitas dúvidas a respeito desse tipo de exame. reduzindo a produção.

Justifique sua indicação. "O exame de DNA só pode ser feito com sangue." Justifique por que cada uma das frases constitui um "mito". c) Cite dois produtos. b) A cápsula do 'Bacillus anthracis'." III. em grande escala. e os da cápsula por genes existentes no plasmídeo pX02. de determinadas proteínas. que antes eram disponíveis em quantidades extremamente reduzidas. e é atenuada quando um deles está ausente. Questão 347 A virulência do 'Bacillus anthracis'.I. mesmo que eu não seja o verdadeiro pai. Questão 349 Na tecnologia do DNA recombinante são utilizadas enzimas bacterianas que têm a propriedade de cortar a molécula de DNA em pontos específicos. Pergunta-se: a) Qual é o nome genérico que se dá a estas enzimas? 1. conhecidas como tecnologia do DNA recombinante. indústria ganharam alternativas eficientes para a produção. que genes humanos que codificam proteínas de interesse médico ou comercial sejam extraídos. Um vírus é inserido nas células. contendo um gene que. "Ele já morreu e não deixou nenhum outro parente vivo.15. De acordo com a técnica esquematizada a seguir. "Sou primo da mãe e estou com medo do resultado ser positivo." II. 71 . está diretamente associada à presença conjunta dos componentes toxina e cápsula bacteriana. Nunca poderei provar que ele era o pai do meu filho. em células do pâncreas. indique a que pode ser utilizada na elaboração de uma vacina composta por bactérias vivas com virulência atenuada. causador do antraz. a) Qual é a função das endonucleases de restrição e a das ligases na aplicação da tecnologia anteriormente citada? b) Explique como a tecnologia do DNA recombinante participa no processo de produção de organismos transgênicos. e depois sejam transferidos para animais de laboratório. Dentre as linhagens apresentadas. O esquema abaixo representa quatro diferentes linhagens de 'Bacillus anthracis'. clonados em bactérias ou vírus. ao contrário da toxina. que foram obtidos a partir da aplicação da tecnologia do DNA recombinante. qual deve ser o papel desempenhado por elas? d) Como são chamados os organismos que recebem e incorporam genes de outra espécie? Questão 350 CONVERSÃO CELULAR: Cientistas israelenses induzem células hepáticas a produzir insulina em laboratório e propõem técnica para tratar diabetes tipo 1.5. Por meio dessa tecnologia. células de fígado são cultivadas em laboratório. utilizados pelo homem. o que permite. que passam a produzir sistematicamente tais proteínas. Os constituintes da toxina são codificados por genes existentes no plasmídeo pX01. Questão 348 A partir da década de 70. por exemplo. não possui antígenos capazes de provocar reação imunológica protetora em mamíferos. a medicina e a b) O que confere a especificidade a estas enzimas? c) Na natureza. as moléculas de ácidos nucléicos da célula passaram a ser exploradas através da utilização de novas metodologias.5 a) Explique a utilidade dos plasmídios bacterianos no desenvolvimento de técnicas de DNA recombinante.

Por esse motivo.5 1. As células se diferenciam em cultura.o núcleo de uma célula do paciente é transplantado para um ovócito maduro.5 Com relação ao procedimento descrito.15. 8 de junho de 1998).15. em local próximo à lesão. de vacinas e medicamentos. as células do embrião são separadas umas das outras e injetadas diretamente no paciente. b) Qual é a vantagem da terapia gênica descrita. já estão plantando as sementes da terceira safra de milho. ficando mais parecidas com as que existem no pâncreas (células beta). responda os itens a seguir. pois essas células indiferenciadas podem se transformar em qualquer tecido.15. há interesse em usá-las para reparar danos de tecidos que normalmente não se regeneram. 1. Em quais delas se desenvolvem. II e III. respectivamente: a) o pareamento das bases? a‚) a ação das enzimas de restrição? aƒ) a ação da DNA ligase? b) "Os agricultores americanos. 1. O procedimento para o preparo de células-tronco embrionárias homólogas está ilustrado de modo simplificado a seguir e envolve as seguintes etapas: 1 . 2 . Atualmente é possível produzir células-tronco heterólogas (retiradas diretamente de um embrião qualquer) ou homólogas. Questão 352 A melhor fonte de células-tronco são os embriões em estágios iniciais de desenvolvimento. Os cientistas acreditam que as células transformadas possam futuramente ser usadas no combate ao diabetes tipo 1. quando comparada ao tratamento de diabéticos com transplante de células de pâncreas de indivíduos mortos? Questão 351 Na engenharia genética. Conceitue os organismos transgênicos. por exemplo. a) Analise as etapas I. cujo núcleo foi previamente removido. a técnica de DNA recombinante vem sendo utilizada na pesquisa e no desenvolvimento.6 72 .está ligado à produção de insulina.o ovócito transplantado é induzido a proliferar. da revista Época.ao atingir o estágio de blástula. algodão e soja transgênicos." (Adaptação do artigo "Revolução invisível na mesa". O esquema a seguir apresenta algumas etapas dessa técnica.5. a) Cite UMA desvantagem do uso de vírus como vetores de terapia gênica. 3 .5.5. por exemplo.

Dessa forma.1 Note que. parasitas e bactérias. b) Explique por que o uso de células-tronco embrionárias homólogas reduz potencialmente os problemas pós-tratamento para os pacientes. que ainda ocorrem todo o ano. onde a malária é endêmica. Dentro dessa bolsa. o conteúdo do vírus . Indivíduos com anemia falciforme são homozigotos (SS) e morrem na infância. Toda a interação inicial entre vírus e célula do paciente ocorre através da HA. que faz com que a membrana do vírus se funda com a membrana da célula. As autoridades sanitárias também atribuíram o alto número de casos em crianças abaixo de um ano ao fato de muitas mães nunca terem recebido a vacina contra o sarampo. Suas epidemias. No entanto. a célula solta ácidos para digerir o vírus. Foram essas infecções.é liberado no interior da célula. E em ausência da malária? b) Qual é a explicação para o fato dos heterozigotos para anemia serem resistentes à malária? 73 . de infecções oportunistas? Questão 355 Notícias recentes veiculadas pela imprensa informam que o surto de sarampo no Estado de São Paulo foi devido à diminuição do número de pessoas vacinadas nos últimos anos. incapazes de transportar o gás oxigênio. somente após cerca de 60 meses. em função da produção de moléculas anormais de hemoglobina. e da quantidade de vírus HIV no sangue de um indivíduo ao longo do tempo. 1. que fica espetada na membrana do vírus.a) Explique por que indivíduos transplantados com células-tronco embrionárias. quase sempre no inverno. Por que pacientes infectados com HIV e não tratados sofrem.seu material genético . a) Se a mãe já foi vacinada ou já teve sarampo. em geral. É ela que os glóbulos brancos reconhecem e procuram atacar. As mutações ocorrem numa proteína chamada HA. Questão 353 Leia atentamente o texto adiante e responda as perguntas propostas a seguir: "A gripe é uma das doenças que mais matou na história do homem. quanto heterólogas. portador da síndrome de imunodeficiência causada pelo vírus HIV (AIDS/ SIDA). o aumento da acidez provoca a mudança de forma na HA. ocorrem quando o vírus sofre uma mutação que o torna mais virulento e irreconhecível pelos sistemas imunológicos das pessoas infectadas. apareceram. Esse indivíduo. o bebê fica temporariamente protegido contra essa doença." a) Por que o sistema imunológico de uma pessoa não reconhece um vírus mutante. fazendo com que ela acione suas defesas e "engula" o vírus com uma bolsa digestiva. os indivíduos heterozigotos para anemia falciforme são resistentes à malária. As epidemias. Por quê? b) Por que uma pessoa que teve sarampo ou foi vacinada fica permanentemente imune à doença? De que forma a vacina atua no organismo? Questão 356 A anemia falciforme é caracterizada por hemácias em forma de foice. Os heterozigotos (Ss) apresentam forma atenuada da anemia. A HA se liga à superfície de uma célula. apresentam duas populações de mitocôndrias diferentes em seus tecidos. a) Explique o que é esperado para a freqüência do gene S em presença da malária. infecções oportunistas por fungos. já assustaram mais do que a AIDS. tanto homólogas.7. nesse indivíduo. não teve acesso a tratamento algum durante o período mostrado. Questão 354 O gráfico a seguir mostra a variação do número de um tipo de leucócitos. os linfócitos T CD4. que levaram o paciente à morte. e não o vírus propriamente dito. e ele continua sua reprodução sem ser molestado. Na África. mesmo que já tenha tido uma forma da doença? b) Explique como o vírus consegue "enganar" uma célula e infectá-la.

foi picado por ela. a) Como se chamam as estruturas mais vistosas e atraentes destas flores. em vez de ser introduzido o gene da petúnia que define a cor azul. deduziu que ela era peçonhenta e socorreu o filho. de 1Ž. um biólogo. apesar de não tê-la tocado. Segundo o jornal "The Japan Times on line". a) Que processo fisiológico da planta é diretamente prejudicado pela presença da bactéria? Justifique. delfinidina. como uma rosa azul.07. As petúnias. Sabendo-se que as fêmeas férteis de 'Apis mellifera' têm 32 cromossomos. conforme exemplificado pela reação abaixo. b) Qual é a substância imunológica presente no soro antiofídico responsável pela inativação do veneno? Como este soro é produzido? Questão 359 A indústria de flores movimenta bilhões de dólares por ano e está continuamente buscando criar novas variedades. possuem tal enzima. mas não eram consideradas azuis verdadeiras. b) Suponha que. causadora da doença chamada amarelinho ou clorose variegada dos citros (CVC). mesmo sem ver a cobra. O nome da bactéria deriva do fato de que ela se estabelece nos vasos do xilema da planta hospedeira. Anteriormente. pois a enzima que sintetiza esse pigmento está ausente nas roseiras. pois participa do processo de extração de energia dos alimentos. Por quê? c) Em que consiste o seqüenciamento de um genoma? Questão 361 Esforços de cientistas criaram a primeira rosa do mundo com pigmento para cor azul. a) Que característica desse réptil levou o pai a deduzir que se tratava de cobra peçonhenta? Cite outra característica morfológica facilmente identificada na maioria dessas cobras. indique o número cromossômico dos indivíduos de cada uma das castas e descreva como ocorre a diferenciação em castas nesses insetos. Indique se há ou não possibilidade de produção de rosas azuis nesse caso e justifique sua resposta. o oxigênio tem 74 . a) Cite o tipo de célula indiferenciada de roseira que. fossem inseridas cópias de seu RNA mensageiro. Questão 360 Uma importante realização da pesquisa científica brasileira foi o seqüenciamento do genoma da bactéria 'Xylella fastidiosa'. Questão 358 Um menino colocou a mão em um buraco onde havia uma cobra e. foi extraído do amor-perfeito e ativado nas rosas. que passaram a ter cor azul? Qual o significado biológico do fato de certas plantas apresentarem flores com cores tão vistosas? b) Qual é a relação entre esta técnica recente para a produção de flores azuis e aquela empregada para a produção de alimentos transgênicos? Questão 362 O oxigênio é um elemento imprescindível à manutenção da vida dos seres aeróbicos. como aceptor final de elétrons. tratando-o com soro antiofídico. a técnica recentemente utilizada consistiu no seguinte: o gene da enzima que produz o pigmento azul.2004. rosas de coloração azul já eram produzidas através de cruzamento. Seu pai. entretanto. os zangões e as operárias. com o objetivo de produzir rosas azuis.Questão 357 As abelhas vivem em colônias constituídas por indivíduos de três castas: a rainha. C†H‚O† + 6 O‚ ë 6 H‚O + 6 CO‚ Em virtude de sua configuração eletrônica. seria o indicado para receber esse gene e justifique sua resposta. b) Não se pode atribuir à 'Xylella fastidiosa' a morte das células que constituem os vasos do xilema maduro. não é possível obter rosas dessa cor. Encontra-se em fase de teste uma técnica que possibilita inserir em células de roseira o gene da petúnia responsável pela codificação da enzima que produz o pigmento azul. Pelos métodos tradicionais.

9 a) Sob o ponto de vista embriológico. Dispõe ele dos seguintes doadores: tio. 1. b) Uma espécie reativa de oxigênio induziu uma mutação no gene de uma célula. fato que pode induzir mutações tanto em células somáticas quanto em células germinativas. porém.10. Questão 367 Uma mulher teve uma menina em sua primeira gravidez.11 75 . a) Em que locais do corpo humano são produzidas essas proteínas e qual é a principal função de cada uma delas no organismo? b) Explique sucintamente o processo por meio do qual se modificam bactérias para que elas passem a produzir proteínas humanas. amigo. que são fortes agentes oxidantes.forte tendência a receber um elétron de cada vez. Qual o percentual esperado de ocorrência desse fato? Questão 368 A figura adiante representa o fenômeno biológico que ocorre com um tipo de célula que sai do vaso sangüíneo para exercer sua função no tecido conjuntivo. ocorrendo o mesmo na sua segunda gestação. sem alterar. o par de gêmeos é do sexo masculino. Questão 363 Em um hospital. acarretando a substituição de uma base guanina por uma adenina. Essas moléculas. a estrutura primária da proteína codificada pelo gene. primo em primeiro grau e irmão gêmeo dizigótico. hoje já estão sendo comercializadas insulina e somatotrofina (ou somatropina) humanas produzidas por bactérias. Por exemplo. Questão 365 Em uma gravidez gemelar.10. dando origem a moléculas intermediárias. denominadas espécies reativas de oxigênio. qual é a probabilidade de que esse alelo também esteja presente no outro gêmeo? Questão 366 O esquema a seguir resume a seqüência do desenvolvimento de irmãos gêmeos: 1. um indivíduo necessita de um transplante de rim. a) Considerando o processo de oxidação completa da glicose pela célula eucariótica. Justifique por que não houve alteração da estrutura da proteína. quais são geneticamente idênticos? Justifique sua resposta. a) Estes gêmeos devem ser monozigóticos ou dizigóticos? Por quê? b) Se um dos gêmeos herdou o alelo dominante A de sua mãe heterozigótica Aa. Questão 364 Uma conquista recente no campo da biotecnologia é o uso de bactérias para a produção de proteína animal de interesse comercial. Pergunta-se: a) Qual dos parentes você escolheria como doador do órgão? b) Justifique sua resposta. o que são gêmeos? b) Analisando a figura. causam alterações. por serem muito reativas. inclusive no DNA. indique a etapa responsável pela formação de espécies reativas de oxigênio e o local da célula onde essas reações ocorrem.

b) Qual a importância do fenômeno apresentado para a função desta célula? Questão 369 A enzima transcriptase reversa é encontrada em retrovírus. Para determinar qual alelo é dominante.1 Das combinações possíveis resultantes do cruzamento entre esses mesmos parentais. ainda servem de veículo de transporte para a vitamina E. são definidas por alelos segregados independentemente.5.1. se o alelo para pecíolo normal for recessivo. carboidratos.semente lisa C . se o alelo para pecíolo curto for recessivo.a) Identifique esta célula e nomeie o fenômeno biológico apresentado.folha sem cera Os gráficos a seguir mostram a composição dos alelos para essas duas características nas plantas parentais. b) 1:2:1. uma com pecíolo normal e outra com pecíolo curto. se o alelo para pecíolo normal for dominante. conforme a lista a seguir.1 76 . na proporção de a) 1:1.folha coberta com cera c . respectivamente. se os alelos forem codominantes. sais minerais e vitaminas. d) 3:1. o fenótipo que apresenta o maior número de genótipos possíveis é a) semente com "pêlos". Os ácidos graxos insaturados presentes no amendoim. referentes à folha e à semente. c) 2:1. Questão 372 O amendoim é uma planta originária da América do Sul. Descreva a função da transcriptase reversa no mecanismo de replicação do vírus da Aids. característica determinada por um gene.5. Espera-se encontrar. e) 3:1. proteínas. d) folha com cera. Muitos pesquisadores. P . 1. c) folha sem cera. As plantas de amendoim podem apresentar folhas com pecíolo normal ou curto. com dois alelos. Dois espécimes de variedades diferentes de uma planta oleaginosa foram cruzados visando à obtenção de uma variedade mais resistente à seca. em F2. b) semente lisa.2.semente com "pêlos" p . Sua importância econômica está relacionada ao fato das sementes possuírem sabor agradável e serem ricas em óleo. Questão 370 O texto abaixo refere-se às questões: ** a ** O cruzamento entre plantas de variedades diferentes de uma mesma espécie é muito utilizado para a obtenção de cultivares mais produtivos. Considere que duas das características dessa planta. O gráfico que representa o número de alelos encontrados na mitose de uma célula obtida de uma planta resultante do cruzamento entre os parentais é: Questão 371 1. atualmente. plantas com pecíolo normal e com pecíolo curto. pois a mesma é lipossolúvel. foi feito um cruzamento entre duas linhagens puras. procuram descobrir novas substâncias que sejam inibidoras específicas dessa enzima. se o alelo para pecíolo curto for dominante.

então no .. muitos cientistas também acreditavam que as características genéticas eram transmitidas pelo sangue. que foi introduzida para ser transcrita e originar um . existe uma .proteína .. e) a crença da população não faz o menor sentido. d) a crença da população pode ser explicada pelo fato de o sangue do feto ser fornecido pela mãe. neste ano. Segundo a bióloga Josefa da Silva. em algum cromossomo.seqüência de aminoácidos . uma vez que células sangüíneas não apresentam as estruturas básicas que guardam as informações genéticas. casamentos consangüíneos não aumentam a probabilidade de transmissão de doenças recessivas. As novas cores (amarela.. ao ser traduzido. As pesquisas realizadas revelaram que é também alto o número de casamentos consangüíneos na cidade.... resultando na obtenção de plantas triplóides (3n = 72).. é a utilização de cerejas coloridas. Assinale a alternativa que completa as lacunas de modo correto. (Pesquisa FAPESP. por mutação no gene responsável pela produção de pigmento na casca do fruto. O destaque da campanha de vacinação... Se as cerejeiras referidas no texto são transgênicas... a) núcleo . e) pais heterozigotos têm 50% de probabilidade de terem filhos que irão desenvolver a doença. b) homens e mulheres têm a mesma probabilidade de apresentar a doença. as plantas apresentam resistência aos nematóides que atacavam a raiz principal do sistema axial desses vegetais..RNA mensageiro b) citoplasma . roxa e branca) haviam sido obtidas. por algum tempo. c) este é um exemplo claro no qual o conhecimento elaborado pelo senso comum coincide com os conhecimentos atuais dos cientistas. As formas mutantes para esse loco. não interferem na eficiência das plantas transgênicas como produtoras de vacinas. pois os genes estão presentes apenas nas células sangüíneas e nas células germinativas. das células dessas plantas. sem sementes.RNA transportador 77 ** a ** . Questão 375 O texto abaixo refere-se às questões: Notícia de algum jornal do futuro.. nos últimos anos. ligam-se á membrana plasmática dos linfócitos e sofrem endocitose.) Pelas informações fornecidas no texto... Outra inovação dessas cerejas é a resistência às moscas Anastrepha fraterculus que. Questão 374 Em relação à crença da população sobre o processo de transmissão de características hereditárias.. diz a pesquisadora... c) em situações como a descrita.. Com o cultivo das novas variedades de cerejas resistentes. Apesar de passar por todas as etapas do ciclo reprodutivo. estabeleceram-se como pragas importantes do cultivo de cerejas-vacina. depois de liberadas pela digestão.. verde. INICIA A CAMPANHA NACIONAL DE VACINAÇÃO CONTRA SARAMPO E TUBERCULOSE. responsável pela equipe que desenvolveu os novos frutos.. não há a formação de endosperma.. b) a população não está tão equivocada.. Da mesma forma. anteriormente. resulta em produto que determinara o desenvolvimento da resposta imunológica. Outro dado interessante levantado pelos pesquisadores foi que a população da cidade acredita que a doença seja transmitida de uma geração a outra através do sangue. incapazes de produzir sementes... d) pais heterozigotos têm 25% de probabilidade de terem filhos também heterozigotos. que. nos frutos. Elas continuam apresentando... e o processo cessa nas primeiras divisões celulares do zigoto.Uma pequena cidade interiorana do Nordeste brasileiro chamou a atenção de pesquisadores da Universidade de São Paulo pela alta incidência de uma doença autossômica recessiva neurodegenerativa. espera-se que essas pragas mantenham-se afastadas dos pomares de vacinas. julho de 2005... técnicas especiais de cruzamento foram aplicadas em dois tipos de cerejeiras transgênicas. as substâncias que. podemos afirmar que: a) pais saudáveis de filhos que apresentam a doença são necessariamente homozigotos. podemos afirmar que: a) no século XIX. determinando o desenvolvimento da resposta imunológica.

( ) a doença é causada por um alelo dominante. Um pesquisador apresentou a seus alunos o heredograma a seguir. b) apenas II.RNA transportador Questão 376 A partir das informações do texto. d) apenas III.) mutação no gene responsável pela produção de pigmento (. ( ) trata-se de um caso de herança ligada ao sexo. AB = 47..O alelo responsável pela "casca roxa" será considerado dominante em relação ao alelo que determina a "casca verde"...RNA mensageiro e) citoplasma .os códons.4% 78 1. relativo a uma certa doença observada por ele em humanos.4 . ( ) é um caso de polialelia com epistasia recessiva. "(. que trata dos tipos e percentuais de gametas produzidos por um indivíduo de genótipo não divulgado (indivíduo parental).6% aB = 2. Questão 378 As proposições a seguir são relativas ao processo de síntese de proteínas nas células vivas.seqüência de nucleotídeos .4% Ab = 2. Ill . Sabendo-se que os indivíduos afetados estão representados em negrito e os normais em branco. II . ( ) O processo de síntese de proteínas a respeito do citoplasma é também conhecido como transcrição genética..proteína . unem-se ao RNAm por uma seqüência de três bases .)" e "As formas mutantes (obtidas) para esse loco (.seqüência de aminoácidos .5. Questão 377 O texto abaixo refere-se às questões: ** a ** Na(s) questão(ões) a seguir escreva nos parênteses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. ( ) A molécula de DNA transcreve no núcleo uma molécula de RNA mensageiro (RNAm) com várias seqüências de três bases .Se a coloração branca for recessiva. ( ) Cada códon do RNA mensageiro determinará a colocação de um aminoácido específico na cadeia polipeptídica. dando formação.1. a uma proteína funcional. será possível obter plantas com frutos coloridos a partir do cruzamento de plantas com frutos brancos. ao final da leitura do RNAm. ( ) No local onde houver um ribossomo. ( ) Os diversos aminoácidos unem-se através de ligações do tipo éster.. pequenas moléculas de RNA transportador (RNAt). e) apenas II e III.6% ab = 47.c) núcleo . pode-se afirmar: ( ) a doença é causada por um alelo recessivo. ( ) trata-se de um caso de herança parcialmente ligada ao sexo. pode(m)-se afirmar: I .o anticódon. Esta(ão) correta(s) a) apenas I.RNA mensageiro d) núcleo . se uma planta heterozigota para esses alelos apresentar frutos com a casca roxa. ligadas a aminoácidos.)".As mutações responsáveis pelas cores da cereja ocorreram em vários cromossomos.. c) apenas I e II. Questão 379 Analise os dados apresentados a seguir.

mãe de aluguel. B. muitas vezes. portanto é formado por I. apenas c) Y. desprezando-se o resto da célula. III. as três raças se mesclam em nossos descendentes.. uma pentose e um radical "fosfato". O núcleo foi desprezado. anteriores aos citados. "Nossos ancestrais. pode-se afirmar que o animal resultante da clonagem tem as características genéticas da vaca. apenas d) Z e da W. alemães. organizador. ( ) Considerando que 5." O DNA presente nas mitocôndrias tem composição e estrutura típicas desse tipo de ácido nucléico. ( ) O indivíduo parental é um heterozigoto aB/Ab. "o índio". IPHAN. L. deixaram-nos um legado que. apenas e) Z. II. ainda hoje. Após algumas divisões. Diante da relevância do contexto e da vontade de valorizar o nosso povo nativo.( ) Trata-se de um caso de genes de segregação independente. diferencia-nos. IV. Considerando-se que os animais Z. portanto. italianos e de outros povos. A célula reconstituída foi estimulada para entrar em divisão. W e Y não têm parentesco. sabemos que outros povos.2% dos gametas apresentam combinações alélicas diferentes daquelas existentes nos cromossomos do indivíduo parental. b) apenas II. ( ) O indivíduo parental é um heterozigoto AB/ab e. for a mãe biológica da vaca W. II. a porcentagem de genes da "mãe de aluguel" presente no clone será a) 0 % b) 25 % c) 50 % d) 75 % e) 100 % Questão 382 A história da maioria dos municípios gaúchos coincide com a chegada dos primeiros portugueses. W e Y Questão 381 Se a vaca Y. O núcleo da célula da glândula mamária foi introduzido no óvulo anucleado. foi selecionada a área temática CULTURA e as questões foram construídas com base na obra "Os Primeiros Habitantes do Rio Grande do Sul" (Custódio. através dos pareamentos de aminoácidos. um heterozigoto "Trans". O núcleo foi isolado e conservado.2% dos gametas são recombinantes. apenas b) W. Retirou-se uma célula da glândula mamária da vaca W. Nosso chimarrão nos identifica em qualquer parte do mundo. d) apenas I e II. através dos vestígios materiais encontrados nas pesquisas arqueológicas. como os Kaingáng. Ainda hoje. 2004). O embrião se desenvolveu e deu origem ao clone.8% das células meióticas que originaram estes gametas. Questão 380 O texto abaixo refere-se às questões: ** a ** A seqüência a seguir indica de maneira simplificada os passos seguidos por um grupo de cientistas para a clonagem de uma vaca: I. pode-se inferir que ocorreu quiasma entre os locos "A" e "B" em 94. Retirou-se um óvulo da vaca Z. 79 . a) Z. brancos e negros. utilizada como "mãe de aluguel". Santa Cruz do Sul: EDUNISC. o embrião foi implantado no útero de uma terceira vaca Y. determinando uma distribuição 1:1:1:1: ( ) 5. A. convivemos com grupos indígenas. um heterozigoto "Cis". No entanto. III. nucleotídeos que são compostos por uma base nitrogenada. obtendo-se um óvulo anucleado. protagonizaram a nossa história. uma cadeia de nucleotídeos em que as bases nitrogenadas interagem. formando ligações fosfo-diéster. Está(ão) correta(s) a) apenas I. duas cadeias polinucleotídicas paralelas e complementares entre si. c) apenas III. ou seja. e) apenas II e III. uma mistura de índios.

Um adulto de peso médio tem cerca de 5 litros de sangue em circulação. José tem tipo AB. d) João ou José. d) s permanece constante. sem alteração do aminoácido codificado.3 A anemia falciforme ou siclemia é uma doença hereditária que leva à formação de hemoglobina anormal e. Rh®. circula pelo coração. c) S tende a aumentar.Questão 383 O texto abaixo refere-se às questões: ** a ** 1. b) S tende a diminuir. Rh®. e) José ou Pedro. tem um filho O. com alteração do aminoácido codificado e da proteína correspondente. com tipo sangüíneo O. Questão 386 O sangue. de hemácias que se deformam. e) Quando a malária for erradicada. e) inversão de um par de bases no DNA. nutrientes etc. c) Pedro.9. os heterozigotos (Ss) são mais resistentes à malária do que os normais (SS). Rh−. Rh−. É condicionada por um alelo mutante s. Questão 387 O texto abaixo refere-se às questões: ** a ** Na(s) questão(ões) a seguir escreva nos parênteses a soma dos itens corretos. b) José. c) O indivíduo Ss leva vantagem em relação ao SS. Ela 80 . Uma mãe. mas não da proteína correspondente. haverá mudança na freqüência gênica da população. Questão 384 Verificou-se que em populações de regiões onde a malária é endêmica. Doença pode ser definida como um desequilíbrio do organismo ou ausência de bem-estar físico e mental. O geneticista consultado informou que o pai pode ser a) João. a freqüência do gene a) S permanece constante. Questão 385 O esquema a seguir mostra a seqüência do DNA que leva à formação da hemoglobina normal e a que leva à formação da hemoglobina alterada. sem alteração do aminoácido codificado. sem alteração do aminoácido codificado. Considere os segmentos de DNA a seguir: rata-se de um caso de mutação por a) perda de um par de bases no DNA. conseqüentemente. c) inversão de um par de bases no DNA. b) O indivíduo ss leva vantagem em relação ao SS. Nesse caso são verdadeiras as afirmações a seguir. ser heterozigoto deixará de ser vantagem. b) adição de um par de bases no DNA. vasos e capilares transportando gases. O indivíduo SS é normal. d) inversão de um par de bases no DNA. e) s tende a aumentar. Supondo populações africanas com incidência endêmica de malária. o Ss apresenta anemia atenuada e o ss geralmente morre.5. d) Quando a malária for erradicada. que é constituído por plasma e algumas células especializadas. com alteração do aminoácido codificado. EXCETO: a) A malária atua como agente seletivo. onde a anemia falciforme não sofra influência de outros fatores e onde novas mutações não estejam ocorrendo. Rh® e Pedro é A. mas tem dúvidas sobre qual dos três namorados é o pai da criança: João tem tipo sangüíneo A. artérias.

(16) Já existem seres humanos que foram originados e desenvolvidos plenamente por clonagem. encontra barreiras de ordem ética. (08) Órgãos transplantados do clone para o doador das células serão sempre rejeitados. (08) Doenças funcionais resultam do mau desempenho ou da perda de um órgão ou sistema. em humanos. (02) Doenças genéticas são aquelas causadas por alterações do patrimônio genético e podem passar de pais para filhos. A probabilidade desta mulher ter uma criança do sexo masculino e hemofílico é igual a 1/4. (64) A b D Soma ( ) Questão 389 Clones são seres vivos obtidos pelo desenvolvimento de células retiradas de indivíduos já existentes. (08) Um homem hemofílico teve uma filha normal. Muitas vezes. a ciência do melhoramento genético procura encontrar soluções que aumentem a produtividade de certas espécies. filha de um indivíduo hemofílico. terá 50% de seus filhos afetados. Com relação a esse tema. A clonagem é um processo que vem sendo desenvolvido rapidamente com vários organismos e. seu clone possuirá. (32) Se o doador de células sofrer a perda de um membro antes de ser realizada a clonagem. (04) Doenças traumáticas são aquelas que se originam de acidentes. Leia o texto adiante e compare-o com o esquema. Soma ( ) (04) Se o doador das células possuir um defeito genético. também. escreva no espaço apropriado a soma dos itens corretos. podendo resultar em fratura de ossos. etc. 81 . nascerá sem o referido membro. independentemente do sexo. independentemente do sexo. Questão 391 Em parte motivada pela necessidade mundial de aumentar a produção de alimentos. Sobre esse processo é CORRETO afirmar: (01) Os clones são como irmãos gêmeos fraternos do doador das células. é correto afirmar: (01) Um homem hemofílico. sem alelos B e D. é CORRETO afirmar: (01) O alcoolismo. (16) Doenças transmissíveis são as transmitidas por patógenos ou por seus produtos. terá todos os seus filhos normais. certamente será hemofílica. casado com uma mulher homozigota normal. o tabagismo e a dependência de outras drogas são exemplos de causas que podem resultar em doenças. Com base nesta informação. essa anomalia. por esse processo. (08) A B D (16) a B D (32) portador apenas de D. os cientistas provocam modificações nessas espécies em busca de seus benefícios e atuam à semelhança da natureza. o organismo originado posteriormente. (02) Uma mulher. Soma ( ) Questão 390 O texto abaixo refere-se às questões: ** a ** Na(s) questão(ões) adiante. No homem. enquanto a eritroblastose fetal é uma doença congênita. (02) a b D (04) portador apenas de B ou d. o gene (h) para hemofilia está localizado no cromossoma X e é recessivo em relação ao gene (h+) para coagulação normal do sangue. casado com uma mulher homozigota normal. através do material genético. usando técnicas sofisticadas. como o albinismo. Soma = ( ) Questão 388 Considerando inclusive a possibilidade de permuta genética. sem alelos A e B.pode ter inúmeras causas e variar de intensidade e manifestação. hemorragias. (32) O mongolismo é um exemplo de doença hereditária. (02) O material genético do doador das células e do clone é idêntico. (04) Um homem hemofílico. um indivíduo portador do genótipo ABD//abD poderá produzir os seguintes gametas: (01) Portador apenas de A ou a. sem alelos A e D.

Esse problema pode ser evidenciado no dia-a-dia. batata e algodão alteradas geneticamente em laboratório. escolheram e reproduziram aquelas cujas plantas apresentassem a capacidade de produzir uma proteína inseticida" está relacionada aos itens 3 e 4 do esquema. 1/8. pois a criança não possui. é correto afirmar: Questão 392 Uma criança de aproximadamente 1 ano. Questão 393 1. 1/4. b) Aa x aa. escolheram e reproduziram aquelas cujas plantas apresentassem a capacidade de produzir uma proteína inseticida" está relacionada aos itens 4 e 5 do esquema. 21/02/1996) Da comparação entre o texto e o esquema. (16) A afirmativa "Livre dos mesmos. ao se colocar H‚O‚ em ferimentos. 1/8. as enzimas que deveriam proteger contra a ação dos radicais livres. e) Aa x Aa. a produtividade das lavouras será bem maior" refere-se ao item 6 do esquema. é monogênica com herança autossômica recessiva. nos testes experimentais. c) Aa x Aa. para destruir as pragas que atacam essas culturas." (Veja. escolheram e reproduziram aquelas cujas plantas apresentassem a capacidade de produzir uma proteína inseticida. (04) A afirmativa "nos testes experimentais. conhecido como APOPTOSE. No caso dessa criança. d) Aa x aa. que liderou uma pesquisa genética sobre a composição étnica do povo brasileiro.2 (01) A afirmativa "Os cientistas alteraram o código genético dessas sementes" está relacionada somente ao item 1 do esquema. 1/2."Nos próximos meses chegam às lavouras dos Estados Unidos e Canadá sementes de milho. a inativação de qualquer um dos componentes ou operadores do sistema de checagem ou de apoptose poderia provocar a proliferação contínua das células e possível desenvolvimento de tumores cancerosos. Diz também que a doença é muito grave. decidem se o ciclo celular avança ou é paralisado iniciando um processo de destruição do material genético.15. a H‚O‚ "não ferve". Qual é o genótipo dos pais da criança descrita no texto e qual a probabilidade de o casal ter outro filho com essa mesma doença? a) AA x aa. Este. Um exemplo observável das conseqüências de apoptoses é o descamar da pele após sua exposição prolongada a radiação solar intensa. Abaixo está transcrito um pequeno trecho de uma recente entrevista. 2 e 4 do esquema. GALILEU: "É correta a noção de que a maior parte dos 82 . após alguns exames. da Universidade Federal de Minas Gerais. 1/4.5. (02) A afirmativa "Os cientistas alteraram o código genético dessas sementes" está relacionada aos itens 1. constata que a criança possui ausência de enzimas oxidases em uma das organelas celulares. é encaminhada pelo pediatra a um geneticista clínico. com acentuado atraso psicomotor. Os cientistas alteraram o código genético dessas sementes e. Livre dos mesmos. Portanto. em um tipo de organela de suas células. Soma = ( ) O ciclo celular é interrompido entre as fases G/S e G‚/mitose. e proteínas especiais controlam a evolução do ciclo celular das novas células. O geneticista clínico explica aos pais que a criança tem uma doença de origem genética. Essa proteína. (08) A afirmativa "nos testes experimentais. a produtividade das lavouras será bem maior. ou morte celular espontânea. Entre S/G‚ algumas proteínas checam possíveis falhas e erros na linha de produção. concedida à Revista Galileu pelo cientista Sérgio Danilo Pena. quando ingerida com as folhas. matava os insetos que atacavam as plantações.

das roldanas. aparecem logo muitas conseqüências £que não previmos. cinema .Mas que absurdo. pelas revoluções do século XVIII. jorra o precioso óleo em pleno sítio. 2. MONTEIRO LOBATO (1882-1947) 1. passando pelo uso do fogo. das dragas (com as quais se escavou o Canal do Panamá). Emília é uma abelhuda crítica e irreverente.. não custa lembrar que a campanha nacionalista de Lobato. que é como Lobato batizou a vida com luz elétrica. onde não faltam lições de fonética. telefone. nas equações de todos os graus. Tudo quanto existe levou milhões de anos a formar-se. pelos assírios e babilônios. Sempre foi intenção de Lobato ensinar sem ser chato. Nesse mesmo livro. lendo a "História das invenções": são sugestivas as explicações sobre a operação das alavancas (que permitiu ao homem a construção das pirâmides). dos guindastes. Meu caso é exatamente esse. nas seqüências e nas funções . Meu cromossomo Y é europeu e meu DNA mitocondrial é ameríndio.. e seus brinquedos são cada vez mais fantásticos e perigosos. do petróleo. fazendo coro com os alunos: ". até à chamada "era dos milagres". há esta frase da boneca que muito lingüista moderno poderia adotar como lema. Em "Emília no país da Gramática". seu "Hans Staden" 83 .para que o escritor lhe apresentasse alguns dos "bichos de sete cabeças" da Matemática com a mesma graça e eficácia com que iniciara os meninotes nas frações e nos números complexos. inesquecíveis companheiras de aventuras por vários tempos e espaços. Também um iniciante na Física não pode se queixar. a adaptar-se.e com o manejo atômico que deu na tragédia de Hiroshima. só o tempo pode curar o grande defeito da humanidade .. epílogo também do livro. As obras "infantis" de Monteiro Lobato ajudaram muito na formação de milhares de pequenos brasileiros que." A resposta do geneticista aliada aos seus conhecimentos permite afirmar. do carvão. vai-se da origem do universo (sabiamente explicada pela vovó Benta como hipótese). o homem continua brincando. Dona Benta (permito-me eu). Se Dona Benta é uma velha de óculos e muita leitura. passariam a citar de boca cheia. somente o genoma de indivíduos do sexo masculino pode ser utilizado para a determinação da ancestralidade paterna.. Emília. Benta uma verdadeira manifestação ecológica: ". que termina com esta frase da vovó sabida: "O tempo.. Questão 394 Instruções: Leia atentamente o texto adiante para responder às questões a seguir.que é ser muito criança ainda". quando marmanjos. Benta acerca da clonagem e dos transgênicos? 4.. e não falta a chegada do técnico norte-americano para tentar tomar conta da situação e acabar escorraçado pelos indignados habitantes. existem mil razões para isso. de formação e de classes de palavras. EXCETO: a) O DNA do cromossomo Y e das mitocôndrias apresenta genes que determinam a cor da pele humana. reformar a natureza! Quem somos nós para corrigir qualquer coisa que existe? E quando reformamos qualquer coisa. num período especialmente sombrio da história do nosso país e trágico da história universal. Em "O poço do Visconde". Quixote" é alegre e comovente. e às vezes sem confessar. pelos hieróglifos. Em "A reforma da natureza". opinar sem ser pretensioso. uma porção de coisas que aprenderam com as personagens do Sítio do Picapau Amarelo. Quanto ao petróleo. que assim adquirem novas formas. c) O cromossomo Y apresenta genes exclusivamente paternos. custou-lhe seis meses de cadeia. espantando os vizinhos e provocando em D.. as experiências realizadas por Emília e pelo Visconde geram monstros: ¢alteram o funcionamento de "Dona Pituitária" em insetos. As adaptações que faz Lobato de obras ficcionais ou a recuperação de fatos históricos são também notáveis: seu "D. Quanto da história e da mitologia grega não se aprende ao lado da boneca Emília. dos moinhos. d) Pelo estudo acima. pelos tempos da cavalaria.Que peste é a tal Gramática!". proporções e propriedades. pelo império romano. que tagarela pedantemente com Péricles ou com Hércules? Na "História do mundo para as crianças". Já depois de ler a "Aritmética da Emília". nas expressões.brasileiros tem algum antepassado com pai branco europeu e mãe negra ou índia ?" PENA: "É. e se está no ponto em que está.. em 1941. qualquer um admirará a facilidade com que se explica a formação e as propriedades do vidro." Que diria hoje D. b) O DNA mitocondrial é de origem materna. o jovem leitor lamentará que Lobato não tenha entrado na Álgebra e na Geometria. que incluía a exploração estatal do "ouro negro" (como também a do ferro). 3.

Lobato parece ter querido reunir a beleza natural do primitivo ao encantamento pelo enciclopédico. Estes genes teriam a capacidade de impedir a instalação de determinadas fases do protozoário 'Plasmodium' no estômago e nas glândulas salivares do mosquito. incluindo sua própria morte.combinação que. . sem concessões à famigerada "literatura infantil"). Soube admirar tanto a mangueira frondosa quanto a técnica fecunda. provavelmente estaria batalhando pelo desenvolvimento sustentável. 7. Assinale as alternativas que trazem o significado correto de cada um desses termos: (01) GENE é sinônimo de molécula de DNA. d) clonado útil para a erradicação da malária. a célula começa a destruir todo o DNA de seu núcleo. 84 . Esta. contradição nossa até hoje. e) clonado útil para a erradicação da leishmaniose. ou morte programada das células. Logo que essas instruções sejam recebidas e processadas. cada aspecto da vida de nossas células é regulado por seu DNA. Questão 395 "Virtualmente. Sem isso. New York: Oxford University Press.. como o fora antes da invenção de Watt". referem-se à morte da célula. reuniu a seu modo as realidades de um país ainda arcaico e já moderno. (02) GENÓTIPO é a constituição genética de um indivíduo. por exemplo à máquina a vapor. Ao instalar suas criaturas numa base rural. 6. 5. c) transgênico útil para a erradicação da leishmaniose. apesar de poder continuar exercendo determinadas funções durante certo tempo. A apoptose. uma célula da camada germinativa da epiderme. As últimas instruções do DNA. da difusão de novas seitas. o quanto ela tem de orgânico. Se num livro o autor se referia. (04) DOMINANTE é um dos membros de um par de alelos que se manifesta inibindo a expressão do outro. proveitosa e sempre polemizada pela palpiteira Emília. Se nada mais sobrasse da obra de Lobato. (Eurípides de Souza e Passos. foi o que deu a vitória aos ingleses. SEX AND THE ORIGINS OF DEATH. De certa forma. está fadada a morrer.. "mais o ferro. resume algo de nosso "temperamento". é verificada SOMENTE em a) I b) II c) III d) I e II e) I e III Questão 396 Na(s) questão(ões) a seguir escreva no espaço apropriado a soma dos itens corretos. se vivesse nos dias de hoje. Clark. dos conflitos religiosos. Sempre haverá a curiosidade nossa de saber o que Emília pensaria hoje da globalização. Bolívar e Lincoln. 32-5) Considere os seguintes fatos: I. b) transgênico útil para a erradicação da esquistossomose. processo este decididamente irreversível. em muitos pontos.introduz o leitor num capítulo importante de nossa história colonial. tudo parece fazer parte de uma didática natural. O que espanta nessa pluralidade é que nada surge como aleatório. Benta" acerca da "clonagem" e dos "transgênicos"? Atualmente ela teria notícias freqüentes sobre técnicas de manipulação do DNA. humor e vivacidade crítica . forjado no caldeirão de raças e culturas de que procedemos. dizem alguns. p. uma célula morta pelas toxinas produzidas por bactérias invasoras. Um exemplo delas constitui a matéria publicada recentemente em um jornal. II. a Inglaterra seria um quase nada. conhecido por suas frases lapidares. em outro esse invento vem associado ao carvão-de-pedra que. nem falta a apresentação de personagens como Marco Polo. dispondo-se a dali falar de tudo e a contar qualquer história (numa linguagem ao mesmo tempo exata. inédito) Que diria hoje "D. segundo a qual cientistas ingleses estão conseguindo transferir certos genes de bactérias para mosquitos anofelinos. essa vivíssima boneca de pano expressaria sempre um fundamento de malandragem. enviadas ao citoplasma. uma célula do miocárdio morta por falta de oxigênio durante um ataque cardíaco. imaginativa e fluente. O leitor que percorra essa obra notará. III. Esse exemplo refere-se à construção de um organismo a) transgênico útil para a erradicação da malária. partindo-o em milhares de pedaços que não mais conseguem enviar instruções úteis à célula. Os termos a seguir fazem parte da nomenclatura genética básica. das ações terroristas." (Traduzido e adaptado de: William R. 1996. que morre e sofre queratinização.

Deixei de lado os almanaques e entrei no funil apertado das tendências vocacionais. a que vem ao caso: folheto ou livro que. entro na Internet. leitor . da queda de Ícaro. recordes mundiais. mas . esse almanaque multidisciplinaríssimo de última geração. Lembro-me de um exemplar que falava com tanta expressão da guerra fria e de espionagem que me proporcionou um prazer equivalente ao das boas páginas de ficção. Não tinha a galhofa. Adolescente.entre o sentimento da melancolia e o funcionamento do fígado.uma espécie de almanaque de luxo. que eu achei familiar quando a li pintada no pára-choque de um fordinho com chapa 1932 (relíquia de um paulista orgulhoso?). Tirando Hollywood. enigmas policiais. Um bom leitor de almanaque explica como uma bela expressão de Manuel Bandeira . o curso e o regime do rio São Francisco. pelo qual já se entrevia uma América (como os EUA gostam de se chamar) com ares de dona do mundo. Soma ( ) Questão 397 Cultura dos almanaques 1. Brutus?". das angústias de Colombo em alto mar. poesias. 5. Sim. nunca voltaria para o dono. misturava povos e séculos com grande facilidade. a manejar um pião. anedotas. Pegadinhas do tipo "quais são os números que têm relações de parentesco?" ou questões como "por que uma mosca não se esborracha no vidro dentro de um carro em alta velocidade?" não eram bem-vindas. a concretização editorial do SLOGAN famoso: TIME IS MONEY. ou a história de expressões como "vitória de Pirro". trechos literários. (16) GENOMA é o conjunto de todos os alelos de um indivíduo. Pouco depois dos almanaques vim a conhecer as SELEÇÕES . Agora sou autor do meu próprio almanaque. dicas de viagem. porque despertavam a classe sonolenta. o humor era bem-comportado. Já ouvi a expressão "cultura de almanaque". move-se!". caricaturas."o fogo de constelações extintas há milênios" . por exemplo. além do calendário do ano. e minha professora de História fingiu que não me ouviu quando lhe perguntei de quem era mesmo a frase "E no entanto. E alguns professores sempre implicavam quando eu os contestava ou argüía.pasme. E me arrepiava a descrição do ataque à base naval de Pearl Harbor. palavras cruzadas. provérbios. a relação que Pitágoras encontrou não apenas entre catetos e hipotenusa. Um outro ensinava a fazer balão e pipa. as matérias tinham um tom meio autoritário e moralista. Como explicar ao meu leitor mais jovem o que é (ou o que era) um ALMANAQUE? Vamos ao dicionário. Em compensação. 3.READER'S DIGEST . Pense em algo publicável. Algum risco sempre havia: não foi boa idéia tentar fazer algumas experiências químicas com produtos caseiros. "vim. conhecia todas as propriedades de uma carnaubeira. da reunião do meu condomínio ou da assembléia da ONU. O leitor não faz idéia do que cabia nesse etc. entre outras acepções. receitas caseiras. se viesse a cair dentro de uma. O "buscador" da HOME PAGE é uma espécie de oráculo de Delfos de efeito 85 . fazia prodígios com ímãs e saberia perfeitamente reconhecer uma voçoroca. com base no almanaque. Eu não trocaria três exemplares do almanaque de um certo biotônico pela coleção completa das SELEÇÕES. e se nunca os fiz subir ou rodar era porque meu controle motor já não dava inveja a ninguém. curiosidades etc. a separar as chamadas áreas do conhecimento. Almanaque não se emprestava a ninguém: ao contrário de um bumerangue. traz diversas indicações úteis. o descompromisso macunaímico dos nossos almanaques em papel ordinário. do meu canteirinho de temperos ou da safra nacional de grãos. 4. do fracasso de Napoleão em Waterloo. 6. Lá está. e lá estava. de circulação regular e internacional.é também uma constatação da astrofísica. dita em tom pejorativo. vi e venci" e "até tu. horóscopo. Se fico sem assunto. aprendi a me especializar nas disciplinas curriculares. Não tinha o charme dos almanaques: levava-se muito a sério.. Acho injusto. Talvez não seja inútil conhecer as dimensões das três pirâmides. as SELEÇÕES talvez tenham sido o principal meio de difusão do AMERICAN WAY OF LIFE. todas as portas do mundo: posso falar da minha rua ou de Bagdad. Com o tempo. astúcias da matemática.. mas ainda hoje me valho das informações de almanaque para explicar. da guilhotina francesa. Meu professor de Ciências fechou a cara quando lhe perguntei se era hábito de Arquimedes tomar banho na banheira brincando com bichinhos que bóiam. de novo.: charadas. descobri este emprego de cronista que me abre.(08) FENÓTIPO é a expressão do gene em determinado ambiente. 2.

Assinale a alternativa que contém argumentos favoráveis à produção. Mas a linha de 86 . Um excelente químico pode imaginar um excelente desodorante. mas não possui mais o saber que lhe permitiria dar-se conta de que seu produto irá provocar um buraco na camada de ozônio. como podeis ver. é assustadora. como o benzeno. III . O equivalente tecnológico da separação dos saberes foi a linha de montagem.. no Brasil. assistiu-se ao triunfo das teorias revolucionárias de Einstein e a seu questionamento. Questão 399 O texto abaixo refere-se às questões: ** a ** Ação à distância. enfim. por ser mutagênico. comunicação. que podem transformar as águas em fontes de transmissão de doenças. não apenas no homem.compostos orgânicos que. podem interferir no funcionamento dos seres vivos. b) apenas II. triunfo das massas. d) apenas I e II. Não é um balanço tranqüilizador. na prática. e em algumas décadas se passou do dirigível ao avião. mesmo em baixas concentrações.. cerca de 8% da produção nacional da soja é biologicamente adulterada. O benzeno.contaminantes biológicos. e) I. Questão 398 A qualidade da água pode ser alterada por vários fatores: . cada um é também liberado de qualquer responsabilidade.e isso ocorre com freqüência. tanto mais fácil submeter a ciência aos cálculos do poder.Paulo" de 23/09/03. que é um agente mutagênico. O século que chega ao fim é o que presenciou o Holocausto. aparece a verdadeira doença do progresso. os regimes dos Grandes Irmãos e dos Pequenos Pais. Parte dessa safra refere-se à produção da soja. cada um conhece apenas uma fase do trabalho. Estamos em via de viver a tragédia dos saberes separados: quanto mais os separamos. que se operou e continua a se operar em ritmos antes inconcebíveis.aumentar as taxas de mutação em todos os seres vivos. Em algumas dezenas de anos. Poderia produzir venenos sem que o soubesse .2 milhões de toneladas na safra 2002/03. os massacres do Camboja e assim por diante. especialmente durante a transcrição e a tradução. diria que. linha de montagem. o que representaria uma vantagem comercial ao país que os proíbe. E o inglês.quase instantâneo. da hélice ao turborreator e daí ao foguete interplanetário. d) Pode haver efeitos sobre várias espécies de insetos protetores da flora e de polinizadores. Hiroshima. Mas o horror desses acontecimentos não reside apenas na quantidade. NO PAIN. por alterar a seqüência de nucleotídeos do DNA. (Argemiro Fonseca) A produção brasileira de grãos ultrapassou 115. O custo dessa aceleração da descoberta é a hiperespecialização.permitir o surgimento de novos alelos. se globalizou pra valer: meus filhos já aprenderam. Esse fenômeno está intimamente ligado ao fato de ter sido neste século que os homens colocaram mais diretamente em questão a sobrevivência do planeta. podendo acarretar o fim da espécie convencional. que podem ser exemplificados pelos esteróides. Mas não sou. II . no caso deles). de 96. b) O mercado europeu é resistente a este tipo de alimento. c) Pode haver cruzamento entre a cultura convencional e a geneticamente modificada. e os hormônios humanos. velocidade. apesar de todo esse avanço. Nosso século é o da aceleração tecnológica e científica. o que significa uma elevação de 19% em comparação à colheita anterior. o sentido de outro SLOGAN prestigiado. deve I . os velhos almanaques me deixaram saudades.impedir o funcionamento dos ácidos nucléicos. que.5 milhões de toneladas. Foram necessários milhares de anos para passar do barco a remo à caravela ou da energia eólica ao motor de explosão. Nesta. Privado da satisfação de ver o produto acabado. de alimentos geneticamente modificados. Segundo a "Folha de S. NO GAIN (ou GAME. certamente. Holocausto: através das metáforas e das realidades que marcaram esses cem últimos anos. c) apenas III. . Está(ão) correta(s) a) apenas I. e) O desenvolvimento desta tecnologia poderá aumentar a produtividade em relação à tradicional. a) Há muitas dúvidas sobre eventuais danos à saúde do consumidor provocados pelas alterações genéticas nos alimentos. II e III. Se eu fosse um nostálgico.

como por exemplo. sob a forma de calor.. III e IV Questão 400 Apesar da "aceleração tecnológica e científica de nosso século" nem todos os problemas puderam ser solucionados. este século soube fazer do melhor de si o pior de si. Dessas explicações. O século está estressado porque não sabe de quem se deve defender. elas poderão apresentar uma reação denominada a) hemólise. milhões de outros puderam colaborar à distância. tempo. mas pagamos o preço dessa rapidez. Um exemplo ocorreu em 1987. vida mais longa. mas irresponsabiliza o crime. Nosso século foi o da comunicação instantânea. Para tais conseqüências. Além de um número. presenciou o triunfo da ação à distância. II e III e) II. nem como: somos demasiado poderosos para poder evitar nossos inimigos. deram-se as seguintes explicações: I . Reflexões para o futuro. morte. E rápido. O Holocausto foi possível porque se podia aceitá-lo e justificá-lo sem ver seus resultados. Porque a sujeira nascia da indigência. onde foi abandonada uma cápsula contendo pó de Césio-137 e que foi aberta por pessoas desavisadas. princípio da linha de montagem: tudo isso tornou possível o Holocausto.A energia provocou alterações nos compostos químicos das células. No texto. mas o sistema do computador não tem defesa diante da má intenção de um garoto precoce. Mas o que torna tão terrível o genocídio nazista é que foi rápido. Eis porque nosso século foi o da angústia e da utopia de curá-la. ao passo que os resíduos (inclusive os radioativos) nascem do bem-estar que ninguém quer mais perder. de pessoas responsáveis e de executantes diretos (sádicos e loucos).As emissões radioativas introduziram energia nas células. 25 anos. A perseguição racial e o genocídio não foram uma invenção de nosso século. tecnologia. indignação. mas não o de eliminar os resíduos. aperta-se um botão e entra-se em comunicação com Pequim. e) reforço do sistema imunológico. tecnologicamente eficaz e buscou o consenso servindo-se das comunicações de massa e do prestígio da ciência. (Adaptado de Umberto Eco. como a Grande Muralha da China. comunicação.montagem permite também fabricar aspirina em quantidade para o mundo todo. Ciência. O século do triunfo tecnológico foi também o da descoberta da fragilidade. IV . castigo. o químico que aplicava os gases asfixiantes não julgava necessário ter opiniões sobre a antropologia física.. quando picadas por abelhas. em Goiânia. apresentarem uma reação alérgica à toxina desses animais. A ação à distância salva numerosas vidas. desconhecido dos séculos anteriores. sem grande inovação. Sem essa aceleração. Aperta-se um botão e um país inteiro explode. Rápida Utopia. herdamos do passado o hábito de brandir a ameaça de um complô judeu para desviar o descontentamento dos explorados. Assim.As células humanas estão adaptadas a receber energia com os comprimentos de onda do Césio-137. Hoje. o Muro de Berlim poderia ter durado milênios. crime. Encontramos o meio de eliminar a sujeira. absolvição. devolveram essa energia para o ambiente. 1993). especialmente por um grande número desses insetos. ação à distância. É bom que tudo se tenha resolvido no espaço de trinta anos. Tudo se passa num ritmo acelerado. crítica. Espaço. Nosso século é o do enfarte. Se forem novamente picadas. São Paulo. III . que podia ser reduzida. VEJA. 87 . d) embolia. Um moinho de vento podia ser reparado. o fato de certas pessoas. o autor menciona que não conseguimos eliminar os resíduos radioativos do ambiente. Aperta-se um botão e um foguete é lançado a Marte. Poderíamos destruir o planeta num dia. num regime de separação dos saberes. A um ritmo de STRESS. estão corretas SOMENTE a) I e II b) I e III c) II e IV d) I. esquecimento. que sofreram graves danos em conseqüência desse ato. Foi fácil fazer passar por ciência uma teoria pseudocientífica porque. arrependimento.As células reagiram e. b) choque anafilático. Tudo o que aconteceu de terrível a seguir não foi se não repetição. realizando cada qual um gesto que nada tinha de aterrador. c) choque térmico. afinal restrito. tudo em altíssima velocidade. descoberta. II . nascimento. informação.

Rr. os genótipos do pai das crianças. é implantado no útero materno. do primeiro e do segundo filhos seriam: a) Pai . c) a calvície é uma característica genética cuja herança é ligada ao sexo. Folha de S..Rr. depois de selecionado. uma criança gerada para fornecer tecidos vivos para tentar salvar a vida de outro filho de seus pais. onde.8. Ela o informou de que já era sua terceira gestação. na segunda. professor Astrogildo ia propondo desafios a partir das situações do dia-a-dia vivenciadas ao longo do passeio. O motorista está buzinando.Rr. Isso ocorre porque a) o gene responsável pela calvície está no cromossomo Y.06. 2Ž Filho . Ariosvaldo refletiu e perguntou: "Professor.Rr. MAIS! 29. se dá o desenvolvimento do feto. (Leite. c) não se trata de uma questão que envolva biotecnologia e bioética. o seu filho nasceu normal e.Rr. Questão 403 Quando a garçonete se aproximou. e) não se pode associar a fertilização "in vitro" com biotecnologia ou com bioética.Rr. Paulo.. 2Ž Filho . da mãe. Vamos!" A turma entrou muito animada no ônibus e Ariosvaldo percebeu que o motorista era calvo.5. M. "Já está na hora de voltar. III e IV representam moléculas de ácidos nucléicos. d) a mulher só será careca se tiver os dois alelos recessivos. Questão 402 O texto abaixo refere-se às questões: ** a ** Professor Astrogildo combinou com seus alunos visitar uma região onde ocorria extração de minério a céu aberto.rr. uma vez que o embrião. Mãe . 1Ž Filho .. podemos afirmar que: a) ao fazer referência à técnica de fertilização in vitro e de escolha de genótipos de seres humanos. Na primeira. 2Ž Filho .rr. 1Ž Filho . Como foi concebido por técnicas de fertilização "in vitro". pois as técnicas de fertilização in vitrojá são de total domínio e amplamente utilizadas pelos especialistas na área de reprodução humana. embora envolva questões de biotecnologia. por que não se vê mulher careca?" O professor respondeu que a ocorrência de calvície em mulheres era muito rara. Mãe . nada tem a ver com aspectos de bioética.RR. Mãe .rr. Mãe . uma vez que na concepção de Jamie foram empregadas técnicas de fertilização in vitro. d) o caso relatado não envolve problemas de bioética. 2Ž Filho . 1Ž Filho .) Em relação ao texto.3 88 . professor Astrogildo perguntou-lhe se seria seu primeiro filho.. II. b) a expressão do gene depende da presença de hormônios masculinos. 1Ž Filho . a criança teve eritroblastose fetal.Rr.Rr. uma forma de confirmar sua compatibilidade com as de Charlie. pois não envolve escolha de genótipo de seres humanos.rr. em que os números I. 1. Algumas das questões propostas por professor Astrogildo estão apresentadas a seguir para que você responda. o professor esquematizou o processo de síntese protéica.Rr. com a intenção de mostrar os efeitos ambientais produzidos por aquela atividade. b) o fato relatado.2003. o texto nos coloca diante de situações concretas de biotecnologia e de bioética. b) Pai .Rr. O irmão de Jamie se chama Charlie e sofre de uma forma rara de anemia causada por anomalia genética.Questão 401 Jamie Whitaker mal nasceu e já se tornou celebridade. de fato. Nessa situação. d) Pai .RR. c) Pai . Jamie é o que já está sendo chamado de "irmão salvador" pelos tablóides (jornais populares) do Reino Unido. Jamie pôde ter suas células testadas no útero. Questão 404 Aproveitando a pergunta de Zeca. Ciência em Dia. Durante o trajeto.

para a qual o tipo sangüíneo de cada um dos membros está indicado. Iß. pérola (20%). c) III corresponde ao RNA que contém o anticódon complementar ao códon existente em I. nas fêmeas. c) gene da insulina está inativo. se forem fêmeas. d) IV corresponde ao RNA que catalisa a ligação dos nucleotídeos com a desoxirribose. da cor pérola. heterozigótica para pérola.partir do esquema. Questão 406 O texto abaixo refere-se às questões: ** a ** Em uma espécie de abelha. Essa rainha produziu. e. creme (20%) e amarelo (20%). onde também encontramos os genes que determinam os grupos sangüíneos ABO ( IÞ.6 89 . e) da cor marrom ou pérola. se forem machos. por que as células alfa desse mesmo órgão não assumem esta função?" A síntese da insulina não ocorre nas células alfa porque o(s) a) gene da insulina está defeituoso. e. se forem machos. a cor dos olhos é condicionada por uma série de cinco alelos. (zero) machos c) 1000 fêmeas. 500 machos Questão 407 Os descendentes dessa rainha terão olhos a) somente da cor marrom.5. b) II corresponde ao RNA que catalisa a união do I com o III. durante o processo de transcrição. Questão 405 Zeca perguntou: "Professor. 625 machos e) 500 fêmeas. b) cromossomos não têm o gene da insulina. as cinco cores serão possíveis. em um dia. foi inseminada por espermatozóides provenientes de machos com olhos das cores marrom (20%). Questão 408 O texto abaixo refere-se às questões: ** a ** A alcaptunúria é uma disfunção extremamente rara do metabolismo humano. 250 machos d) 625 fêmeas. O gene determinante dessa disfunção está localizado no cromossomo 9. d) cromossomo com o gene da insulina não está presente. c) da cor marrom se forem fêmeas. neve (20%). (zero) machos b) 1000 fêmeas. Os indivíduos afetados apresentam a cor da urina vermelho pardacenta devido a uma alteração no metabolismo normal da fenilalanina. d) da cor marrom ou pérola. i ). 1 250 gametas dos quais 80% foram fecundados. entre os quais há a seguinte relação de dominância: a¢ > a£ > a¤ > a¥ >a a¢ : marrom a£ : pérola a¤ : neve a¥ : creme a : amarelo Uma rainha de olhos marrons. b) O somente das cores marrom ou pérola. já que as células beta do pâncreas de um diabético não são capazes de sintetizar insulina. nos machos. O heredograma a seguir foi montado para se estudar a disfunção em uma determinada família. Todos os gametas produzidos resultaram em descendentes. 1. as cinco cores serão possíveis. a) 1250 fêmeas. é correto afirmar que a) I corresponde ao RNA que contém o código genético determinando a seqüência de aminoácidos da proteína. Assinale a alternativa da tabela que indica corretamente o número esperado de descendentes dessa rainha.

(Mendel. (16) O trabalho de Darwin afirma a constância genética do mundo biológico. esperada em F2. b) O indivíduo 3 pode ter recebido um gameta recombinante de sua mãe. que violam princípios sociais e admitem conceitos biológicos errôneos. assim. apud FREIRE-MAIA. (08) A seleção natural pode preservar características diferentes. TEXTO I: Como muito mais organismos de cada espécie nascem do que provavelmente sobrevivem e como.traduzido) TEXTO II: Os híbridos. 90 . 1117) Em relação às idéias de Darwin e de Mendel.nalisando-se o heredograma. formam sementes das quais a metade novamente desenvolve a forma híbrida. conseqüentemente. Soma ( ) 1. EXCETO: a) 22.) os determinantes (. pode-se dizer: (01) As "plantas que permanecem constantes" ao longo das gerações são homozigotas. lutam entre si. p. perigosamente em alta em países desenvolvidos da Europa. os inferiores.6 posição ocupada pelos alelos que determinam grupo sangüíneo e alcapatonúria. Questão 411 A idéia da eugenia. eliminando-se com o glóbulo polar os mais fracos.5. (02) A herança de um caráter é determinada pela fusão dos fatores condicionantes na descendência. EXCETO: a) A alcaptonúria é um caráter determinado por gene autossômico recessivo. exemplificadas nos textos. p. apud DARNELL. (04) A citação de Mendel expressa a proporção genotípica 1:2:1." (Kehl apud BIZZO. d) A chance de o indivíduo 9 ser heterozigoto para o caráter alcaptonúria é de 2/3. Questão 409 (Darwin. sob condições de vida complexas e algumas vezes variáveis. Questão 410 O texto abaixo refere-se às questões: ** a ** Na(s) questão(ões) a seguir escreva nos parênteses a soma dos itens corretos. se sustenta em premissas incorretas. 30) Considerando-se os princípios biológicos que regem a herança.. (. no par de cromossomos 9. há uma freqüente luta pela existência. terá uma melhor oportunidade de sobrevivência e. enquanto a outra metade produz plantas que permanecem constantes e recebem os caracteres dominantes e recessivos em partes iguais.) se entrechocam. está representada para o indivíduo 7 ao lado do heredograma. (32) Variações referidas por Darwin transmitem-se à descendência segundo o padrão mendeliano de herança. pode-se afirmar: (01) A subordinação aos princípios mendelianos reduz a variabilidade nas espécies que se reproduzem sexuadamente. que se ocupa do aperfeiçoamento físico e mental da espécie humana. d) 50% B normais ou afetados. como na citação: "Os cromossomos.. selecionam-se. de cada par de caracteres diferenciais. b) 45% de A normais. São freqüências esperadas de descendentes para o cruzamento 6 X 7. é possível afirmar. A freqüência de recombinação entre os dois loci gênicos é de 10%. c) O indivíduo 6 certamente não recebeu um gameta recombinante da sua mãe ou do seu pai.5% AB normais. os mais fortes. segue-se que qualquer organismo que varia de modo proveitoso para si próprio. p. 2 . em diferentes ambientes.. de ser "naturalmente selecionado".. e persistindo nos pronúcleos resultantes os mais aptos. c) 50% de afetados.

(02) A segregação dos cromossomos homólogos. (16) A aplicação de princípios eugênicos comprometeria a sobrevivência da espécie humana. repercutem além dela.adaptação) Uma análise da situação apresentada anteriormente permite afirmar: (01) Agentes mutagênicos incluem fatores físicos que alteram a estrutura da molécula de DNA. ( ) Cariótipo é o conjunto de informações sobre os cromossomos de uma determinada espécie. em que são considerados básicos alguns conceitos de genética. apresentam. (64) A precisão dos sistemas de reparo do DNA inviabiliza Na(s) questão(ões) a seguir julgue os itens e escreva nos parênteses (V) se for verdadeiro ou (F) se for falso. julgue os itens. Estudos genéticos em células de organismos afetados revelam a existência de defeitos no sistema enzimático responsável pelo reparo de moléculas de DNA danificadas pela exposição a agentes mutagênicos. Soma ( ) Questão 413 Os radioisótopos. (02) A falha em mecanismos celulares que preservam a fidelidade da mensagem genética predispõe ao câncer. (64) As repercussões da eugenia em populações humanas descartam sua aplicação para qualquer fim. ou como fontes de radiações. na primeira divisão meiótica. 307-8 . em células epidérmicas. No entanto. indústria. apesar de temidos pela população que os associa a acidentes nucleares e danos ambientais. é aleatória. e os indivíduos do grupo sangüíneo AB são considerados doadores universais. A elucidação de crimes. (32) A ocorrência de alterações em células nervosas e em células epidérmicas pode estar relacionada à sua origem embriológica comum. ( ) Na espécie humana distinguem-se 3 tipos sangüíneos. ( ) Um dos catalisadores do processo de duplicação do DNA é a enzima DNA polimerase. que permitem a sobrevivência das espécies. engenharia. que parecem resultar da morte prematura de células nervosas. atingindo sua prole. adquiridas por indivíduos de uma geração. (04) A condição genética dos indivíduos com "xeroderma pigmentosum" é determinada pela exposição à radiação ultravioleta. 91 . Soma ( ) o processo evolutivo. e) são o único processo evolutivo agindo atualmente no homem. Alguns desses pacientes também desenvolvem anormalidades neurológicas. (16) Os genes que condicionam o "xeroderma pigmentosum" são característicos de células epidérmicas. (08) A morte prematura de células nervosas resulta dos efeitos do acúmulo de lesões na molécula de DNA. extrema sensibilidade à luz solar. b) geram as adaptações. antropologia e à pesquisa acadêmica em diversas áreas do conhecimento. hidrologia. seja por atuarem como traçadores radioativos. (08) Os fatores genéticos se misturam e se diluem ao longo das gerações. Questão 414 Questão 412 Indivíduos portadores da doença "xeroderma pigmentosum". exercem importante papel na sociedade atual. principalmente na face. ( ) Genes alelos são genes que ocupam o mesmo "locus" gênico em cromossomos homólogos. resultando em alta freqüência de câncer de pele. O temor da população em relação aos radioisótopos relaciona-se à capacidade desses elementos produzirem mutações nos seres vivos. (GARDNER. como também a identificação da paternidade. condição genética autossômica recessiva. p. (32) Alterações do fenótipo. São hoje praticamente indispensáveis à medicina. d) são responsáveis por extinções em massa. como a dos trilobitas. Sobre esses conceitos. (04) O efeito de um determinado gene depende do ambiente em que ele é expresso. vêm sendo efetuadas com certa facilidade e segurança através do uso de técnicas apropriadas. as mutações ocorrem naturalmente e têm uma grande importância evolutiva porque a) geram a variabilidade sobre a qual a seleção natural pode agir. c) permitem a origem de novas espécies cada vez melhor adaptadas.

Questão 415 O texto abaixo refere-se às questões: ** a ** Na(s) questão(ões) a seguir. Soma ( ) . pois Ribossomildo só lhes dará informações cientificamente corretas. 92 Questão 416 Com base nos estudos de Genética. será heterozigota para o caráter se entre os seus descendentes aparecerem alguns com sementes amarelas e outros com sementes brancas. Desse cruzamento resultaram oito filhotes que. ou seja. terá filhos apenas do grupo sangüíneo O. (02) Uma mulher do grupo sangüíneo A cuja mãe é do grupo O. fixando aleatoriamente alguns genes. Vocês terão a oportunidade de verificar de que maneira o homem pode interferir nesse meio. Ele dispõe de material para ilustrar. uma criança hemofílica nascida de pais normais só poderá ser do sexo feminino. quando necessário. ou seja. Vocês estão convidados a fazer um passeio numa área de Mata Atlântica. esse fato pode ser explicado porque houve: (01) Heterose. comportamentos. (04) Indivíduos heterozigotos para duas características produzem quatro tipos de gametas. especializado na criação de dálmatas. (02) Efeito genético da consangüinidade. é correto afirmar que: (01) Uma planta de sementes brancas. "Lei da Segregação Independente dos Caracteres". que. na sua maioria. efeitos nocivos que podem surgir devido a genótipos recessivos produzidos através do cruzamento entre indivíduos aparentados. (08) Estes problemas envolvem a Segunda Lei de Mendel. compreenderão como as espécies se inter-relacionam. e o passeio será muito proveitoso. enquanto seu alelo recessivo determina a cor escura. (32) Semiletalidade. que lhes servirá de guia. autofecundada. casando-se com um homem doador-universal. Nesse passeio. (08) Segregação monogênica dominante. Observou-se. Feito um cruzamento entre dois indivíduos duplamente heterozigóticos. vocês estarão em contato com a natureza. os genes de um par agem combinando-se com outro par (ou outros pares). entretanto. (02) 3/16 dos descendentes desse cruzamento terão olhos normais e com pigmentação clara. essa atividade de campo. dois nasceram cegos. Um outro gene B dominante determina a pigmentação clara do olho. (04) 4/16 dos descendentes nascerão sem olhos. Soma ( ) Questão 417 Um canil. Para tanto. alterando-o. é grande a variabilidade de espécies. Também serão convocados a responder a questões básicas no campo da Biologia. (08) Na interação gênica. a fim de condicionar um determinado fenótipo. ou polimeria. é correto afirmar que: (01) 9/16 dos descendentes desse cruzamento terão olhos normais e com pigmentação escura. onde verão um maravilhoso ecossistema. Vamos lá?!!! Como você já devem ter percebido. (16) Sendo a hemofilia uma anomalia condicionada por um gene recessivo ligado ao sexo. verão de perto a diversidade da fauna e da flora. e adaptações na Mata Atlântica. escreva no espaço apropriado a soma dos itens corretos. dos oito cãezinhos. soma = ( ) Questão 418 O texto abaixo refere-se às questões: ** a ** Caros candidatos. Fiquem tranqüilos: vocês estão preparados. escolheu dois irmãos de uma ninhada e os cruzou. e quais as conseqüências disso. se reproduzem e como se dão alguns fenômenos biológicos nos seres que vivem ali e até naqueles que visitam esse ambiente. À luz dos conhecimentos de genética. reduzindo o vigor da ninhada. (16) Deriva genética. contarão com a companhia de Ribossomildo. Imagine uma espécie animal na qual um gene A determina a formação do olho e seu alelo recessivo determina a ausência de olhos. (04) Herança ligada ao cromossomo sexual. apresentaram as mesmas características dos pais. um experiente pesquisador. Sabe-se que o gene A está em um cromossomo e B em outro.

a) replicação do DNA b) transcrição de RNA transportador c) tradução de RNA mensageiro d) síntese das proteínas arque a opção em que se relaciona adequadamente a figura ao evento biológico. Questão 419 Ribossomildo diz: Vejam quantos folhas novas. 2004). a formação de quiasma eleva a probabilidade de ocorrência de mutação dos genes. etapas da divisão celular como as representadas nas figuras abaixo justificam essa variabilidade. trazendo contribuições à nossa cultura.. A. a permutação entre cromossomos heterólogos aumenta a variabilidade genética. IPHAN. se os indivíduos cruzados forem homozigotos para esse loco gênico. Assinale a alternativa que completa corretamente a lacuna. Questão 420 A história da maioria dos municípios gaúchos coincide com a chegada dos primeiros portugueses. ensinando a plantar diferentes espécies e a usar plantas frutíferas e medicinais. Considere que a característica baixa estatura é dominante sobre a característica porte elevado e que apenas um loco gênico está envolvido na determinação da estatura das plantas. através dos vestígios materiais encontrados nas pesquisas arqueológicas. protagonizaram a nossa história. a segregação independente dos cromossomos contribui para o aumento da diversidade dos gametas. anteriores aos citados. a migração das cromátides-irmãs para pólos opostos eleva a recombinação gênica. 1. Diante da relevância do contexto e da vontade de valorizar o nosso povo nativo. "Da Amazônia vieram os tupis-guaranis. c) Na figura I." Variedades de milho cultivadas pelos indígenas são usadas hoje em cruzamentos. com o objetivo de melhorar a produção de grãos. No entanto.1 ssinale a opção correspondente ao evento representado na figura. Santa Cruz do Sul: EDUNISC. alemães. O resultado para a F1 de um cruzamento de plantas com baixa estatura X plantas com estatura elevada será _________________________. 93 . quantos filhotes de animais! O que deve estar ocorrendo no interior das células desses seres. sabemos que outros povos. que lhes permite crescer?! Para facilitar a resposta a essa pergunta.5.Essa variabilidade fenotípica está relacionada à constituição genética do indivíduo e pode ser observada até dentro da mesma espécie. b) Na figura II. a) Na figura I. ele apresenta a figura abaixo.5. que ilustra um dos eventos imprescindíveis ao processo de crescimento dos organismos. L.8. organizador. foi selecionada a área temática CULTURA e as questões foram construídas com base na obra "Os Primeiros Habitantes do Rio Grande do Sul" (Custódio.1 1. "o índio". d) Na figura II.2. Segundo Ribossomildo. B. italianos e de outros povos.

Um pesquisador obteve três diferentes linhagens desse fungo. Questão 423 Quando as células do corpo humano se multiplicam. para as enzimas a) 1. 1 e 3. 3 e 1.8. tal como na via biossintética representada na figura 1. d) 2. respectivamente. B e C são deficientes. arginina e ornitina. 2 e 3.5. tais como radiações solares e agrotóxicos.indica que não houve crescimento. b) 1. Y e Z correspondem à citrulina. o qual pode ser determinado pela perda da inibição por contato nas células. se algumas células mutantes se tornam invulneráveis elas podem se multiplicar. alcançando um número razoável de células e estabelecendo uma rede de vasos sangüíneos que passa a alimentá-las.A inativação dos oncogenes é uma das condições essenciais para que as células citadas no texto se multipliquem desordenadamente. aos compostos a) ornitina. O sinal + indica que houve crescimento do fungo. d) citrulina.8.5 As linhagens A. citrulina e arginina. não necessariamente nessa ordem. Os compostos X. constituído de água. O esquema na figura 2 apresenta os resultados obtidos quando essas diferentes linhagens foram colocadas para crescer em diferentes meios de cultura. sais minerais. e) arginina.5. podem provocar alterações genéticas nas células.5 As letras X. o sinal . c) 2.O comportamento celular descrito na última frase do texto é chamado metástase. O fungo utiliza esses elementos como precursores para a síntese de vários compostos. cada uma delas deficiente em uma das enzimas participantes dessa via biossintética.Agentes ambientais. não deficiente em qualquer uma das enzimas. açúcar e uma vitamina. ornitina e arginina. Assinale a opção que contém a(s) afirmativa(s) 94 1. 3 e 2. II . respectivamente. . espera-se que aquelas produzidas com defeitos sejam destruídas pelo sistema imunológico. A linhagem D é o tipo selvagem. No entanto.a) 100% com estatura elevada b) 100% com estatura baixa c) 1/2 com estatura elevada e 1/2 com estatura baixa d) 1/4 com estatura elevada e) 3/4 com estatura elevada Questão 421 O texto abaixo refere-se às questões: ** a ** O tipo selvagem do fungo Neurospora é capaz de crescer em um meio de cultura simples. Considere as seguintes afirmativas: I . 1 e 2. III . determinado assim uma acentuada queda na sobrevida do indivíduo. tornando-as invulneráveis à ação do sistema imunológico. c) citrulina. Após essa fase várias dessas células podem cair na corrente sangüínea e invadir outros órgãos. e) 3. Questão 422 1. Y e Z correspondem. arginina e citrulina. b) ornitina. arginina e ornitina. citrulina e ornitina.

verdadeira(s). a) Apenas I e II. b) Apenas I e III. c) Apenas II e III. d) Apenas III. e) I, II, III. Questão 424 A síntese protéica envolve um complexo de estruturas celulares que trabalham harmonicamente, como mostra o esquema adiante.

1.1.4

1.1.3.2

Segundo a tirinha, a amiga de Calvin tem DOIS CROMOSSOMOS X. Com base neste dado podemos concluir que: a) a amiga de Calvin é mutante, por isso é hostil. b) um cromossomo X da amiga de Calvin é ativo e o outro é chamado de cromatina sexual. c) a heterocromatina ocorre em Calvin, pois ele é XY. d) os dois cromossomos X de que Calvin fala é da cobra que quer comê-lo. e) não há cromatina sexual em meninas. Questão 426

Com base no esquema e em conhecimentos correlatos, julgue os itens a seguir. (0) O esquema mostra a síntese protéica em uma célula procariótica. (1) Os tipos de RNA necessários para a síntese protéica em procariotos e eucariotos são essencialmente diferentes. (2) Na expressão de um gene eucariótico, a transcrição e a tradução ocorrem simultaneamente. (3) Uma molécula de RNAm pode ser utilizada para a síntese concomitante de várias moléculas da proteína. Questão 425 Leia com atenção a tirinha a seguir:

Qual das alternativas se refere a um cromossomo? a) Um conjunto de moléculas de DNA com todas as informações genéticas da espécie. b) Uma única molécula de DNA com informação genética para algumas proteínas. c) Um segmento de molécula de DNA com informação para uma cadeia polipeptídica. d) Uma única molécula de RNA com informação para uma cadeia polipeptídica. e) Uma seqüência de três bases nitrogenadas do RNA mensageiro correspondente a um aminoácido na cadeia polipeptídica. Questão 427 Quando afirmamos que o metabolismo da célula é controlado pelo núcleo celular, isso significa que a) todas as reações metabólicas são catalisadas por moléculas e componentes nucleares. b) o núcleo produz moléculas que, no citoplasma, promovem a síntese de enzimas catalisadoras das reações metabólicas. c) o núcleo produz e envia, para todas as partes da célula, moléculas que catalisam as reações metabólicas.
95

d) dentro do núcleo, moléculas sintetizam enzimas catalisadoras das reações metabólicas. e) o conteúdo do núcleo passa para o citoplasma e atua diretamente nas funções celulares, catalisando as reações metabólicas. Questão 428 Considere uma espécie de vertebrado cujas células embrionárias têm oito cromossomos. Em quantos grupos de ligações seus genes estarão associados? a) Dois. b) Quatro. c) Oito. d) Dezesseis. e) Número variável. Questão 429 A ilustração representa o cariótipo humano que permite determinar o número e a forma dos cromossomos.

Questão 431 Os cromossomos são constituídos principalmente por: a) fosfolipídeos. b) proteínas. c) ácido ribonucléico. d) enzimas. e) ácido desoxirribonucléico. Questão 432 A cromatina sexual compreende: a) o citoplasma de células gaméticas masculinas que se apresentam mais coradas que as femininas. b) o citoplasma de células gaméticas femininas que se apresentam mais coradas que as masculinas. c) cromossomo Y condensado em núcleos de hemácias humanas. d) um dos cromossomos X da mulher, que permanece condensado no núcleo das células, facilmente visualizado na mucosa oral. e) cromossomos X e Y condensados durante o período da interfase. Questão 433 Responder à questão com base no cariótipo (conjunto de cromossomas) humano representado abaixo.

1.1.4

Analisando-se a figura, é correto concluir que se refere a um indivíduo portador da síndrome de a) Klinefelter. b) Patau. c) Turner. d) Down. Questão 430 A presença de cromatina sexual predominante em número de células femininas está relacionada a cromossomos: a) Y inativos b) X inativos c) autossômicos inativos d) autossômicos que não se dividiram e) autossômicos agregados

1.1.4

cariótipo é de um indivíduo do sexo com síndrome de __________. a) feminino - Klinefelter b) masculino - Klinefelter c) masculino - Down d) feminino - Turner e) masculino - Turner

96

Questão 434 Numere a coluna inferior, relacionando-a com a superior. Indivíduos: 1 - 45, X 2 - 46, XX 3 - 49, XXXXX 4 - 49, XXXXY 5 - 47, XXX Quantidade de cromatinas sexuais (corpúsculos de Barr) ( ) quatro ( ) duas ( ) nenhuma ( ) uma ( ) três Assinale a opção que apresenta a seqüência correta de numeração. a) 2, 4, 1, 3, 5 b) 3, 5, 1, 2, 4 c) 2, 3, 1, 4, 5 d) 3, 2, 1, 4, 5 e) 2, 1, 3, 4, 5 Questão 435

Analisando o desenho esquemático que representa o núcleo de uma célula animal qualquer, podemos identificar que o componente responsável pela síntese de RNA que forma o ribossomo é assinalado pelo número: a) 1 b) 2 c) 3 d) 4 e) 5 Questão 436 Muitas vezes, durante a realização de eventos esportivos, é realizada a determinação do sexo genético. Este exame é feito pela observação dos cromossomos de células epiteliais. Pode-se afirmar que neste exame a) mulheres normais deveriam apresentar uma estrutura chamada corpúsculo de Barr, que corresponde a um dos cromossomos X. b) homens normais deveriam apresentar uma estrutura chamada corpúsculo de Barr, que corresponde ao cromossomo Y. c) mulheres normais deveriam apresentar duas estruturas chamadas corpúsculos de Barr, que correspondem aos dois cromossomos X. d) homens normais deveriam apresentar uma estrutura chamada corpúsculo de Barr, correspondente ao cromossomo X. e) mulheres normais na fase adulta não deveriam apresentar corpúsculo de Barr. Questão 437

1.1.4

Analise o esquema a seguir, o qual mostra o mecanismo de ação de algumas drogas antimitóticas que inibem a progressão a partir dos pontos indicados.

1.1.5.1

97

Assinale a afirmativa INCORRETA. a) A puromicina não tem qualquer efeito sobre o crescimento ou multiplicação celular. b) A mitomicina não permite a ocorrência da fase 5 do ciclo celular. c) Pelo menos duas das drogas interferem diretamente na síntese protéica. d) Nem todos os tipos de nucleotídeos sofrem ação da droga arabinosilcitosídeo. Questão 438 A figura a seguir representa _______________ , que ocorre na _______________ e tem como conseqüência _______________.

1.1.5.2

1.1.5.2

( ) O número de gametas AB deverá ser idêntico ao de gametas ab. ( ) A freqüência de gametas recombinantes deverá ser igual a de gametas não-recombinantes. ( ) Trezentos e sessenta gametas não- recombinantes são esperados. ( ) Vinte gametas recombinantes são esperados no caso descrito. ( ) A taxa de recombinação no caso citado é de 10%; logo, os locos A e B distam de 10 unidades de mapa. Questão 440 "Devo, finalmente, chamar a atenção para a possibilidade do pareamento dos cromossomos paternos e maternos, e sua subseqüente separação durante a divisão reducional, constituírem as bases físicas das leis de Mendel" (Walter S. Sutton, 1902). O que Sutton achava possível sabe-se, hoje, ser verdade, isto é: I. os genes estão localizados nos cromossomos. II. dois ou mais genes localizados no mesmo cromossomo são herdados, na maioria dos casos, em gametas diferentes. III. dois ou mais genes localizados em cromossomos diferentes segregam de maneira independente. Sobre as afirmativas acima, pode-se dizer que: a) somente III está correta. b) I e II estão corretas. c) II e III estão corretas. d) I e III estão corretas. e) somente II está correta.

A alternativa que preenche correta e respectivamente os espaços anteriores é: a) o crossing-over; metáfase da mitose; a variabilidade genética. b) o pareamento de cromátides-irmãs; anáfase I da meiose; a troca de genes alelos. c) o crossing-over; prófase I da meiose; a variabilidade genética. d) a segregação de cromossomos homólogos; anáfase I da meiose; a formação de células haplóides. e) o pareamento de cromossomos homólogos; metáfase da mitose; a formação de gametas. Questão 439 Analise as proposições abaixo, considerando a seguinte situação: Em uma amostra de 100 (cem) espermatogônias, de um organismo genotipicamente (AB//ab), ocorreu permutação meiótica entre os locos A e B, em 20 (vinte) espermatogônias, tendo sido observada uma segregação gamética como ilustrado na figura abaixo.

98

Questão 441

Questão 443 Quanto aos cromossomos sexuais X e Y, podemos afirmar que: a) como não são completamente homólogos, não se pareiam na meiose. b) como são completamente homólogos, pareiam-se na meiose. c) se pareiam na meiose, pois possuem uma região homóloga. d) não se pareiam na meiose, pois possuem uma região não homóloga. e) os genes que se encontram na região não homóloga do X condicionam um tipo de herança chamado herança restrita ao sexo. Questão 444 As variações das cargas elétricas das moléculas das proteínas W, X, Y e Z, em função do pH do meio, estão representadas no gráfico a seguir.

1.1.5.2

AMABIS e MARTHO. "Fundamentos da Biologia Moderna". São Paulo: Moderna, 1997. p. 499. A figura representa a a) mitose e explica a separação dos cromossomos durante a divisão. b) meiose e explica a segregação independente dos genes previstos pela segunda lei de Mendel. c) mitose e explica a segregação dos genes demonstrando a dominância e a recessividade. d) meiose, que é um processo de formação de gametas mas que não tem nenhuma relação com as leis de Mendel. e) mitose, que é um processo de divisão celular mas que não tem nenhuma relação com as leis de Mendel. Questão 442 Os gatos possuem 38 cromossomos, com o sistema XX/XY de determinação sexual. No desenvolvimento embrionário de fêmeas, um dos cromossomos X é inativado aleatoriamente em todas as células do organismo. Em gatos domésticos, a pelagem de cor preta (dominante) e amarela (recessiva) são determinadas por alelos de um gene localizado no cromossomo X. Fêmeas heterozigóticas para cor da pelagem são manchadas de amarelo e preto. Um geneticista colocou um anúncio oferecendo recompensa por gatos machos manchados de amarelo e preto. A constituição cromossômica desses gatos é a) 37, YO. b) 37, XO. c) 38, XX. d) 39, XXY. e) 39, XXX.

1.1.7.3

molécula do DNA, em pH fisiológico, apresenta carga elétrica negativa, devido a sua natureza ácida. No núcleo celular, ela está associada a proteínas, de caráter básico, denominadas histonas. De acordo com o gráfico, a proteína que apresenta propriedades compatíveis com as de uma histona é a representada pela seguinte letra: a) W b) X c) Y d) Z

99

Questão 445 Considere a rota metabólica que produz o aminoácido arginina na figura adiante.

grupamentos amina e hidroxila. Questão 447 O metabolismo celular depende de uma série de reações químicas controladas por enzimas, isto é, proteínas que atuam como catalisadores e que podem sofrer mutações genéticas sendo modificadas ou eliminadas. Assinale a alternativa correta, levando em conta os ácidos nucléicos, a ocorrência de mutações e as conseqüentes mudanças do ciclo de vida da célula. a) O DNA é constituído por códons, que determinam a seqüência de bases do RNA mensageiro, necessária à formação dos anticódons, responsáveis pela produção das proteínas. b) No caso de uma mutação acarretar a transformação de um códon em outro relacionado ao mesmo aminoácido, não haverá alteração na molécula protéica formada, nem no metabolismo celular. c) A mutação altera a seqüência de aminoácidos do DNA, acarretando alterações na seqüência de bases do RNA mensageiro e, conseqüentemente, na produção das proteínas. d) As mutações atuam diretamente sobre as proteínas, provocando a desnaturação dessas moléculas e, conseqüentemente, a inativação delas. e) Quando algumas proteínas são alteradas por mutações, suas funções no metabolismo celular passam a ser realizadas pelos aminoácidos. Questão 448 Organelas citoplasmáticas que contêm DNA: a) mitocôndria e ribossomo. b) mitocôndria e cloroplasto. c) nucléolo e cloroplasto. d) lisossomo e ribossomo. e) ribossomo e cromossomo. Questão 449 A hipótese de que os cloroplastos e as mitocôndrias tenham surgido através de uma associação simbiótica de um eucarioto primitivo com, respectivamente, bactérias fotossintetizantes e bactérias aeróbicas, é reforçada pelo fato daquelas organelas celulares: a) serem estruturas equivalentes, com grande superfície interna.
100

1.1.7.3

Em um experimento, três linhagens de bactérias foram irradiadas com raios X, que causaram mutações nos genes envolvidos na rota metabólica acima representada. Para descobrir quais enzimas da rota metabólica foram afetadas, as três linhagens foram cultivadas em meios suplementados com ornitina, citrulina e arginina, obtendo-se o resultado mostrado na tabela acima: Sobre esse experimento, podemos afirmar que a) o gene que codifica a enzima 1 na linhagem I foi afetado. b) o gene que codifica a enzima 2 na linhagem I foi afetado. c) o gene que codifica a enzima 3 na linhagem II foi afetado. d) o gene que codifica a enzima 1 na linhagem II foi afetado. e) o gene que codifica a enzima 3 na linhagem III foi afetado. Questão 446 Além de serem as macromoléculas mais abundantes nas células vivas, as proteínas desempenham diversas funções estruturais e fisiológicas no metabolismo celular. Com relação a essas substâncias é CORRETO afirmar que: a) são todas constituídas por seqüências monoméricas de aminoácidos e monossacarídeos. b) além de função estrutural, são também as mais importantes moléculas de reserva energética e de defesa. c) cada indivíduo produz as suas proteínas, que são codificadas de acordo com o seu material genético. d) a sua estrutura terciária é determinada pela forma, mas não interfere na sua função ou especificidade. e) são formadas pela união de nucleotídeos por meio dos

Questão 455 O gato doméstico ('Felis domestica') apresenta 38 cromossomos em suas células somáticas. d) ribossomos e nos cloroplastos. b) ribossomos. É correto prever que. e) produção de ATP no interior de plastos. b) perda dos genes não expressos. c) nucléolos e nas mitocôndrias. Questão 454 Uma bactéria. e) ribossomos. Questão 456 É como se em cada quarto de um imenso prédio existisse uma estante contendo os planos do arquiteto para todo o prédio. b) RNA transportador. b) 19 cromossomos duplicados e 38 moléculas de DNA. e) serem encontradas tanto em organismos superiores como inferiores. e) 19 cromossomos duplicados e 19 moléculas de DNA. Ao longo do processo de diferenciação das células do mesmo organismo ocorre a) duplicação de alguns genes. Essa função é desempenhada pelo a) RNA mensageiro. d) ribossomo. respectivamente. os planos do arquiteto montam 46 101 1. c) utilização de oxigênio no interior de mitocôndrias. c) RNA ribossômico. c) TACGTGGA. c) estarem envolvidas. c) expressão diferencial dos genes. Questão 450 "Captura aminoácidos que se encontram dissolvidos no citoplasma e carrega-os ao local da síntese de proteínas".1. e) DNA. d) apresentarem tilacóides e cristas como as bactérias. d) indução de mutações específicas. Questão 453 A seqüência de nucleotídeos ATGCACCT forma um segmento de DNA dupla hélice ao se ligar à fita complementar a) AUGCACCU. tanto do ponto de vista estrutural como funcional. encontre-se uracila radioativa SOMENTE nos a) nucléolos. b) presença de carioteca envolvendo os componentes do núcleo celular. e) ATGCACCT. e) recombinação entre genes ativados. Questão 452 A célula muscular cardíaca e a esquelética têm a mesma origem porém são diferentes. b) UACGUGGA. foram fixadas e submetidas à autoradiografia.) No homem. no citoplasma.b) apresentarem DNA próprio. para comprovar os locais que possuíam esse material. Questão 451 Células vegetais. No núcleo do óvulo normal de uma gata são esperados: a) 19 cromossomos simples e 19 moléculas de DNA. na produção e consumo de oxigênio.. d) 38 cromossomos simples e 19 moléculas de DNA.7. c) 38 cromossomos simples e 38 moléculas de DNA. um fungo e uma samambaia apresentam em comum a) produção de glicose através da utilização de energia solar. d) presença de DNA como material genético. depois de mantidas em meio de cultura contendo uracila marcada. d) TCCACGTA.. (. nos cloroplastos e nas mitocôndrias.6 .

um segundo RNAt (III). Nessa analogia. podemos afirmar que os códons 5 e 6 codificam. para os quais não há aminoácido correspondente. ( ) Quando se estabelece uma ligação peptídica entre os dois primeiros aminoácidos. ou para a metionina ou para o triptofano. transcrevendo a seqüência de bases de uma cadeia de DNA.3 amostra: dupla hélice IV. O RNAm no citoplasma. o RNAt do primeiro aminoácido é liberado (IV) no citoplasma. se chega a um códon de parada (V). UAG ou UGA. são comemorados os 50 anos da "descoberta" da estrutura tridimensional do DNA.7. Sabendo-se que os códons 5 e 6 trazem a informação para um mesmo aminoácido. proposta por Richard Dawkins no livro "O gene egoísta". Histonas são proteínas relativamente pequenas que se ligam fortemente ao RNA. II. analise a figura e as proposições a seguir.2 amostra: timina III . Os nucléolos podem atuar na síntese de carboidratos que migram do núcleo para o citoplasma. ( ) 61 códons correspondem aos aminoácidos que compõem as proteínas. ao papel que ela desempenha nos seres vivos e aos processos em que se encontra envolvida é CORRETO afirmar que: 102 1. c) somente I e II são verdadeiras. e) Apenas II e V. encaixa-se no sítio destinado à entrada de aminoácidos na cadeia peptídica. Com relação às características dessa molécula. Questão 460 Neste ano de 2003. ( ) O final da tradução ocorre quando. para o qual existe apenas uma trinca de codificação. cada página de cada volume contém um texto formado por uma seqüência de: a) fenótipos b) aminoácidos c) cromossomos d) bases nitrogenadas Questão 457 Analise as afirmativas a seguir. Cada cromossomo possui uma única molécula de DNA. quais se referem a DNA? a) Apenas I e II. na leitura da mensagem genética. de modo correto. c) Apenas II e III. d) somente I e III são verdadeiras.5 amostra: 20% de guanina e 30% de citosina Entre estas amostras.6 .1 amostra: ribose II . Questão 459 Cinco amostras com ácidos nucléicos foram analisadas quimicamente e apresentaram os seguintes resultados: I . Pode-se afirmar. complementar ao códon AUG do RNAm. Questão 458 A molécula de RNAm é sintetizada no núcleo.1. UUG. UUA ou GUA. a saber. e) somente II e III são verdadeiras. ( ) Na etapa seguinte da tradução. b) somente II é verdadeira. Considerando esse tema. b) Apenas I e III. que: a) somente I é verdadeira. ( ) O aminoácido metionina (I) é trazido ao ribossomo pelo RNAt cujo anticódon é UAC (II). III. onde se dá a produção de cadeias peptídicas. acerca dos elementos constituintes do núcleo celular eucariótico.4 amostra: uracila V . I. se liga ao ribossomo. cujo anticódon é complementar ao segundo códon do RNAm geralmente onde há uma trinca UAA. d) Apenas II e IV.volumes.

e suas seqüências de bases são complementares. ela fica estocada dentro do núcleo das células. b) A polimerização de uma fita simples de DNA é dita semiconservativa. Está(ão) correta(s) a) apenas I. c) apenas II e III. por serem herdáveis. a finalização do Projeto Genoma Humano foi noticiada por vários meios de comunicação como sendo a "decifração do código genético humano". (08) Nela está contida a informação genética necessária para a formação de um organismo. Questão 464 Em abril de 2003. transcrição e tradução do DNA. através do processo denominado transcrição. por meio da formação de pontes de hidrogênio entre as bases nitrogenadas. Questão 463 Erros podem ocorrer. apenas. embora em baixa freqüência. d) na transcrição e na tradução. e) errada. ela apresenta apenas uma fileira de nucleotídeos. d) apenas I. III e IV. e) em qualquer um dos três processos. III e IV. III. não as proteínas que eles codificam. através do processo denominado tradução. Dentre as afirmativas abaixo. apenas. as conseqüências desses erros podem ser mais graves. porque agora se sabe toda a seqüência de nucleotídeos dos cromossomos humanos.(01) É formada por duas fileiras de nucleotídeos torcidas juntas em forma de hélice. c) errada. IV. porque não é possível decifrar todo o código genético. e) As duas cadeias de uma dupla-hélice possuem a mesma orientação. (64) Em alguns organismos primitivos. assinale a alternativa CORRETA: a) Uma cadeia simples de DNA é constituída de nucleotídeos. o aminoácido e a proteína. da maneira como foi veiculada. d) errada. porque o código genético diz respeito à correspondência entre os códons do DNA e os aminoácidos nas proteínas. 103 . (04) Ela tem a capacidade de se autoduplicar. b) correta. compostos por uma desoxirribose ligada a um fosfato e a um aminoácido. está a) correta. apenas. que estabeleceu o modelo da estrutura da molécula de ácido desoxirribonucléico (DNA). quando ocorrem a) na transcrição. DNA e RNA são os ácidos nucléicos encontrados tanto em células eucariontes como procariontes. Questão 462 Este ano comemorou-se 50 anos da publicação do trabalho de Francis Crick e James Watson. porque agora se sabe toda a seqüência de genes dos cromossomos humanos. b) na replicação. A informação presente no RNA pode ser transformada em uma seqüência de aminoácidos. durante os processos de replicação. pois independe da existência de uma fita molde. e) apenas II. A informação. Entretanto. a citosina. existem regiões cromossômicas com alta taxa de mutação. A informação contida no DNA pode ser copiada em uma fita de RNA. b) apenas I e II. II. c) Os nucleotídeos são polimerizados por meio de ligações fosfodiéster entre o fosfato e a base nitrogenada. As proteínas e os ácidos nucléicos são formados por aminoácidos. apenas. (32) Nos organismos procariontes. porque o Projeto decifrou os genes dos cromossomos humanos. Questão 461 Analise as afirmativas: I. (16) A mensagem nela contida pode ser transcrita para uma outra molécula denominada RNA. c) na replicação e na transcrição. d) Duas cadeias simples de DNA formam uma dupla-hélice. (02) Em sua composição é possível encontrar quatro bases nitrogenadas diferentes: a adenina.

6% de diferenças pode contribuir para entendermos como. d) Os 97 genes comuns são os responsáveis pela diferenças entres seres humanos e chimpanzés. uma vez que o núcleo injetado não possui alguns genes. Questão 467 Descobertas recentes na medicina e na saúde pública. Qualquer resistência às doenças infecciosas (de caráter hereditário). nos 6 milhões de anos que separam a evolução do homem e do chimpanzé de um ancestral comum. em uma mesma área de floresta. a comparação da seqüência de DNA de 97 genes comuns de humanos e de chimpanzés revelou 99.4% de identidade entre os genes humanos e de chimpanzés. Mais recentemente. c) a formação de um clone de células não diferenciadas. a) A freqüência dos alelos que conferem resistência inata às doenças seria aumentada. Estudar estes 0. mais pessoas se tornariam independentes de procedimentos médicos.4% dos genes apresentam a mesma seqüência de DNA. de construir prédios e de fazer pesquisa científica. como o sarampo e a difteria. haveria adaptação genética a resistência a muitas doenças. terão algum impacto no curso da evolução humana. b) a morte da célula-ovo. se aplicadas consistentemente. que até o momento tem o Homo sapiens como único representante vivo. (Fonte: "Folha de S. apenas um deles desenvolve a capacidade de compor música. ao longo de 100 anos. b) 99. Questão 466 CHIMPANZÉ TAMBÉM É "GENTE". em 21/05/2003. b) Os genótipos que produzem pouca ou nenhuma resistência se tornariam comuns. removidos durante a diferenciação. não fertilizado e cujo núcleo tenha sido removido. e) a expulsão do núcleo injetado por meio de exocitose realizada pela célula-ovo. conferiria vantagem seletiva a uma família.Paulo". d) A longo prazo. c) Seqüências de DNA que podem ser expressas como proteínas apresentaram maiores semelhanças que as seqüências não codificadoras. 104 . c) A longo prazo. e) Não haveria alteração alguma na freqüência desses alelos. DIZ ESTUDO. a) As espécies Homo sapiens e Pan troglodites surgiram há 6 milhões de anos. Alguns cientistas dos EUA afirmam que os chimpanzés (Pan troglodites) são geneticamente tão parecidos com os homens que deveriam ser incluídos no gênero Homo. ocorrerá: a) a morte da célula-ovo. assinale a afirmativa CORRETA. Na realidade. uma vez que o núcleo injetado proveniente da célula diferenciada contém DNA cuja composição de bases nitrogenadas é diferente da célula-ovo.Questão 465 Ao se injetar o núcleo de uma célula diferenciada de uma rã em um ovo de outra rã. biologicamente não somos tão diferentes dos chimpanzés como muitos crêem. A diferença nos percentuais de identidade dos dois estudos se deve ao fato de que em 1998 foi estudado o DNA não-codificante. corretamente. uma vez que o núcleo injetado contém toda a informação (DNA) necessária à formação do girino.4% de identidade. que não faz parte das seqüências que podem ser transcritas e traduzidas. removidos durante a diferenciação. Assinale a alternativa que mostra.) Tendo em vista o texto apresentado. uma vez que o núcleo injetado não contém determinados genes. os efeitos da imunização em massa sobre a freqüência da resistência ou susceptibilidade inata às doenças. Questão 468 O gráfico mostra a variação dos números de indivíduos do tipo original e do tipo mutante. A idéia surgiu pela primeira vez em 1998 quando a análise de seqüências de DNA de humanos e de chimpanzés revelou 98. d) a formação de um girino normal a partir do ovo.

ALA ALA .ARG . II. e) após 50 anos.HIS . deixa de existir o efeito de dominância do alelo para o tipo original sobre aquele para o tipo mutante.LEU . ocorre em três formas diferentes: a forma P.PHE .GLU .LEU . c) genótipo igual ao seu.PHE .4.ARG ALA . e a forma PY. com base na forma da proteína presente nos grupos de animais I.VAL .LEU . Indique a alternativa que mostra as proteínas encontradas nos grupos de animais I a V.LEU .VAL . Questão 469 Um determinado tipo de proteína.1.ARG .ARG . espécie A: MET .4.10 Questão 471 Moscas de asas longas cruzadas entre si fornecem moscas com asas vestigiais.LEU espécie C: MET .PHE .GLU . Para determinarmos se uma mosca de asa longa é homozigota ou heterozigota quanto ao par de genes que condicionam este caráter. d) a partir de 50 anos.LEU espécie B: MET .PRO . a árvore filogenética que melhor expressa o parentesco evolutivo entre as três é: 1.1.ARG .Questão 470 A seguir estão representadas três seqüências de aminoácidos de proteínas retiradas de diferentes espécies (A. A ocorrência dessas mutações pôde ser localizada nos pontos indicados pelos retângulos escuros na árvore filogenética.VAL . c) a mudança de ambiente provocou alteração nas freqüências gênicas. o procedimento correto é analisar a prole resultante do cruzamento desta mosca com outra de: a) asa vestigial.ARG . b) o tipo original e o tipo mutante estão igualmente adaptados à mesma área de floresta. 1.ARG . b) de asa longa. d) fenótipo igual ao seu.ARG . resultante de mutação no gene que codifica P. a forma PX.10 105 . 1. III.4.ALA.ALA ARG .ARG .GLU . presente em praticamente todos os animais. IV e V.LEU . resultante de mutação no gene que codifica PX.HIS . B e C).PRO .1. o tipo mutante passou a parasitar o tipo original.HIS . e) fenótipo dominante.ALA .LEU Admitindo-se um ancestral comum para as três espécies.PRO .7 análise do gráfico permite concluir que: a) o tipo original permanece melhor adaptado ao longo do período analisado.

sendo a anomalia causada por um gene recessivo e de 75% a probabilidade de o casal n¡. Questão 473 Na espécie humana. b) mutação gênica.5. c) expressividade de um gene. Questão 475 Sabendo-se que o albinismo é um caráter recessivo. c) de um caso que pode ser tanto de herança ligada ao sexo como de herança autossômica. com uma mulher de igual genótipo.5.1 esquema anterior mostra uma experiência com um coelho himalaia. é possível afirmar que se trata a) exclusivamente de um caso de herança ligada ao sexo.Questão 472 1. b) exclusivamente de um caso de herança autossômica. o albinismo é causado por um gene autossômico recessivo. e) de um caso de herança ligada ao cromossomo Y e de 50% a probabilidade de o casal n¡.1. 2 ter um descendente com a anomalia. sendo a anomalia determinada por um gene recessivo e impossível o casal n¡. d) de um caso que pode ser tanto de herança ligada ao sexo como de herança autossômica. 2 ter um descendente do sexo masculino com a anomalia. d) penetrância de um gene. e) alteração do genótipo pelo ambiente. A probabilidade do primeiro filho de um homem albino casado com uma mulher normal. mas heterozigota. determine a porcentagem de descendentes com o fenótipo igual ao do pai.1. 3 ter um descendente com a anomalia. sendo a anomalia determinada por um gene recessivo e de 50% a probabilidade de o casal n¡.1 1. sendo a anomalia causada por um gene dominante e de 75% a probabilidade de o casal n¡. resultantes do casamento de um homem heterozigoto para esse fator. A mudança ocorrida na coloração do pêlo em função da queda de temperatura demonstra o efeito da: a) norma de reação. 3 ter um descendente com a anomalia. 2 ter um descendente com a anomalia. ser albino e do sexo masculino é: a) nula b) 25 % c) 50 % d) 75 % e) 100 % Questão 474 A incidência de determinada anomalia foi investigada nos indivíduos da espécie humana representados no heredograma a seguir: Sabendo-se que os símbolos escuros representam portadores da anomalia. a) 0% b) 25% c) 50% d) 75% e) 100% 106 .

b) está no cromossomo Y. O cruzamento do gato A com a gata B produziu 8 filhotes. b) o genótipo do indivíduo é o resultado da ação do ambiente sobre seu fenótipo. c) está num autossomo. o cruzamento do gato A com a gata C produziu 6 filhotes pretos e 2 amarelos. b) a cor preta é dominante. e) genótipo depende dos genes. d) pode estar no cromossomo X ou no Y. e) a cor preta é recessiva. Questão 480 Pedro e seus filhos. b) genótipo depende do ambiente. têm uma doença determinada por um gene dominante. Essa expressão significa que a) o ambiente altera o genótipo do indivíduo. e) pode estar num cromossomo ou num autossomo. João e Maria. A e C são heterozigotos. dominante. A e C são homozigotos. B e C são heterozigotos.1. Não há outros afetados na família. determina a cor púrpura e (a). determina a cor amarela. d) a cor preta é recessiva. todos pretos. Questão 478 Sabe-se que o casamento consangüíneo. A tabela a seguir apresenta resultados de vários cruzamentos feitos com diversas linhagens dessa planta: 1. d) genótipo depende do fenótipo e do meio ambiente. Questão 482 Dois genes alelos atuam na determinação da cor das sementes de uma planta: (A). em qualquer que seja o ambiente. A e C são homozigotos. Esta mudança indica que o: a) fenótipo depende do ambiente. c) o fenótipo do indivíduo é o resultado da expressão de seu genótipo em um dado ambiente. visando à sua adaptação. Esse gene: a) está no cromossomo X.5. recessivo. c) fenótipo depende do genótipo e do meio ambiente. uma expressão bastante conhecida diz que fenótipo é o genótipo mais o ambiente.Questão 476 Num homem heterozigoto para determinado caráter. A análise desses resultados permite concluir que: a) a cor preta é dominante. Isso pode ser justificado pelo fato de os filhos apresentarem: a) maior probabilidade de heterozigoses recessivas b) maior probabilidade de homozigozes recessivas c) menor probabilidade de heterozigoses dominantes d) menor probabilidade de homozigoses dominantes e) menor probabilidade de homozigoses recessivas Questão 479 Na genética.1 107 . d) o genótipo do indivíduo pode variar como resultado da expressão de seu fenótipo em diferentes ambientes. c) a cor preta é dominante. A e B são homozigotos. ou seja. Questão 481 Um gato preto (A) foi cruzado com duas gatas (B e C) também pretas. a porcentagem provável de espermatozóides que conterão o gene recessivo desse caráter é de: a) 0% b) 25% c) 50% d) 75% e) 100% Questão 477 Algumas variedades de canários mudam de cor dependendo da alimentação que recebem. resulta numa maior freqüência de indivíduos com anomalias genéticas. e) o fenótipo do indivíduo é invariável e resulta da expressão de seu genótipo. entre indivíduos que são parentes próximos.

2. d) a freqüência do alelo a é 0. descendentes claros e escuros. Questão 487 De uma população de 100 camundongos foi retirado ao acaso um indivíduo com deficiência da enzima E. II e III. É correto afirmar que a) seus pais podem ser fenotipicamente normais. portanto. d) apenas um óvulo Dd. Depois de alguns dias. Questão 484 Dois grupos de mudas obtidas a partir de um mesmo clone de plantas verdes foram colocados em ambientes diferentes: um claro e outro escuro. gêmeos monozigóticos ou dizigóticos? a) 25% e 50% b) 25% e 75% c) 50% e 25% d) 50% e 50% e) 50% e 75% Questão 489 Em uma população de mariposas. c) a freqüência do alelo a é 0. c) dois óvulos D e dois óvulos d. produz vagens com sementes amarelas e com sementes verdes. Qual é a probabilidade de que pelo menos um dos gêmeos venha a ser afetado pela doença no caso de serem. Entre os possíveis gametas formados por essa ovogônia. Vv x vv Um pé de ervilha. Já os cruzamentos entre indivíduos claros produzem sempre apenas descendentes de cor clara. heterozigoto e que. b) quatro óvulos D e quatro óvulos d. pode resultar a) apenas do cruzamento I. Vv x Vv III. b) apenas do cruzamento II. na maioria das vezes. cor escura. sabendo que V representa o gene que determina cor amarela dos cotilédones e é dominante sobre o alelo v. 96% dos indivíduos têm cor clara e 4%. casada com um portador de doença genética de herança autossômica dominante. d) apenas dos cruzamentos II e III. d) genótipos e fenótipos diferentes. Esses resultados sugerem que a cor dessas mariposas é 108 .presentam genótipo (Aa) as linhagens: a) I e III b) II e III c) II e IV d) I e IV e) III e IV I Questão 483 Considere os seguintes cruzamentos para ervilha. caráter condicionado por um alelo recessivo a. podemos encontrar: a) quatro óvulos Dd. e) apenas um óvulo D ou um óvulo d. e) dos cruzamentos I. Questão 488 Uma mulher normal. I. b) seus pais são certamente heterozigotos. que determina cor verde. e) 1% dos indivíduos da população têm deficiência da enzima E. c) genótipos e fenótipos iguais. Questão 485 Considere uma ovogônia de uma mulher heterozigota para o par de alelos Dd. está grávida de um par de gêmeos. b) o mesmo fenótipo e genótipos diferentes.1. c) apenas do cruzamento III. VVx vv II. Indivíduos escuros cruzados entre si produzem. Questão 486 Qual a porcentagem de descendentes Aa nascidos de uma mãe Aa? a) 25% b) 50% c) 75% d) 100% e) depende do pai. as plantas que ficaram no escuro estavam estioladas o que significa que os dois grupos apresentam: a) o mesmo genótipo e fenótipos diferentes. e) genótipos variados em cada grupo. respectivamente.

e) genes. c) um aminoácido em uma proteína. como a coloração dos troncos onde elas pousam. b) cor cinza.100.800. Mendel fez fecundações cruzadas. Todos os indivíduos AA foram cruzados com indivíduos aa e os indivíduos Aa foram cruzados entre si. embora sem conhecer. Aa .200. d) depende de características congênitas.500. b) trouxe gametas femininos com alelos para baixa estatura.50. b) um par de alelos. Considerando que cada casal produziu 2 descendentes.condicionada por a) um par de alelos. Para determinarmos se uma mosca cinza é homozigota ou heterozigota quanto ao par de genes que condicionam esse caráter. respectivamente. O conhecimento atual a respeito da natureza do material hereditário permite dizer que a letra A usada por Mendel simboliza a) um segmento de DNA com informação para uma cadeia polipeptídica. d) promoveu o encontro de gametas com os mesmos alelos para estatura. c) genótipo igual ao seu.200. aa .400. d) fenótipo igual ao seu. e) reproduz uma característica provocada pelo ambiente. Questão 494 Moscas de coloração acinzentada cruzadas entre si fornecem moscas de cor preta. e) impediu o encontro de gametas com alelos diferentes para estatura. removendo as anteras da flor de uma planta homozigótica de alta estatura e colocando. d) uma trinca de bases do RNA mensageiro. Aa . Questão 492 Em plantas de ervilha ocorre. b) núcleos. a existência das seguintes estruturas e processo de divisão celular.1000.200. c) trouxe gametas masculinos com alelos para baixa estatura. que não apresentam dominância um sobre o outro. aa . sobre seu estigma.100. meiose.100 Questão 491 Em seu trabalho com ervilhas. aa . espera-se encontrar entre os filhotes: a) AA . Mendel ao enunciar essa lei já admitia. Questão 490 Uma população experimental contém 200 indivíduos AA.100 d) AA .50 b) AA . mitose. Com esse procedimento. meiose. autofecundação. e) fenótipo dominante. mitose. publicado em 1866.100 c) AA . Aa . Questão 493 Dizemos que um determinado gene é recessivo quando sua expressão (fenótipo): a) só acontece em heterozigose. b) um segmento de DNA com informação para um RNA ribossômico. e) fatores ambientais.200 e) AA . b) só ocorre quando em dose dupla. d) dois genes ligados com alta taxa de recombinação entre si. c) núcleos. normalmente. d) genes. aa . 200 aa e 200 Aa. Para estudar os mecanismos de herança. respectivamente: a) cromossomos. o procedimento correto é analisar a prole resultante do cruzamento dessa mosca com outra de a) cor preta. aa . sendo o alelo para cor clara dominante sobre o que condiciona cor escura. 109 . Aa . Aa . Mendel representou os fatores hereditários determinantes dos estados amarelo e verde do caráter cor da semente pelas letras A e a. c) um par de alelos. sendo o alelo para cor escura dominante sobre o que condiciona cor clara. pólen recolhido da flor de uma planta homozigótica de baixa estatura. mitose. Questão 495 "Cada caráter é condicionado por um par de fatores que se separam na formação dos gametas". e) uma trinca de bases do RNA transportador. c) independe da presença de seu alelo. o pesquisador a) impediu o amadurecimento dos gametas femininos.

000 e 4. Cruzando-se plantas de estames de cor púrpura com plantas de estames verdes. 75% dos filhotes produzidos em F‚ tinham pêlo preto e 25% apresentavam pêlo marrom.5. por exemplo. b) Os indivíduos pretos de F eram homozigotos. c) Todos os F1 com nervuras irregulares são heterozigotos. surgirão indivíduos regulares e irregulares na proporção 1:1. Esse fenômeno é conhecido como: a) herança aditiva b) poligenia c) pleiotropia d) codominância Questão 501 Analise o heredograma para um fenótipo recessivo esquematizado a seguir e assinale a afirmativa INCORRETA. Isso ocorre.000 e 3.000 e 6. obteve-se uma geração F composta apenas de indivíduos com estames de cor púrpura. a) As plantas cruzadas são heterozigotas. A partir desses resultados. assinale a alternativa correta. d) Se um indivíduo F1 com nervuras regulares for cruzado com um indivíduo da geração P. Do cruzamento entre duas plantas com nervuras irregulares. então a porcentagem de descendentes com estames verdes será de: a) 25% b) 50% c) 75% d) 0 e) 100% Questão 497 Em porquinhos da Índia. e) Os indivíduos pretos da geração F eram heterozigotos e a fêmea parental era homozigota. presença ou ausência de manchas nas axilas foliares. Se os 120 descendentes com asas forem cruzados com moscas sem asas e se cada cruzamento originar 100 indivíduos. Questão 498 Em uma determinada planta. Questão 499 Do cruzamento de duas moscas com asas nasceram 120 descendentes com asas e 40 sem asas. Uma fêmea preta foi cruzada com um macho marrom. 1. originou-se uma F1 composta por plantas com nervuras regulares e outras com nervuras irregulares. o padrão das nervuras foliares pode ser regular ou irregular.1 110 . produzindo uma F composta por indivíduos marrons e pretos em igual quantidade.Questão 496 Em tomates.000 e 4. A partir desses dados. cor das sementes. e) Os indivíduos F1 de nervuras regulares só podem ser homozigotos.1. Retrocruzando-se um macho preto de F com a fêmea parental.000 Questão 500 Em genética. Se esses indivíduos forem retrocruzados com os parentais de estames verdes. um único par de alelos determina mais de uma característica no organismo. respectivamente. o pêlo pode ser preto ou marrom. a) 50% dos indivíduos pretos de F‚ eram heterozigotos. d) Todos os indivíduos marrons eram homozigotos.000 d) 9. b) A proporção fenotípica em F1 é de 3/4 de indivíduos irregulares e de 1/4 de indivíduos regulares. em que um único par de alelos é responsável por três características fenotípicas: cor das flores.000 b) 6. a) 6.000 c) 8.000 e) 12. c) Todos os indivíduos pretos de F‚ eram heterozigotos. em alguns casos. o número esperado de indivíduos com asas e sem asas será. com ervilhas.000 e 3. o estame pode ser de cor púrpura ou verde. assinale a alternativa INCORRETA.

dominante. Em I não há registro da presença do vírus X e em II ele é transmitido por contato com as presas da espécie. b) amarelo com planta de bulbo amarelo não produz plantas com bulbo roxo. que apresentam genótipo __(I)__ podem ter filhos albinos. Nesses vegetais. EC e CC. que chamaremos de E1. recessivo. 1/2 Aa e 1/4 aa c) 1/3 AA e 1/4 aa d) 1/4 Aa. toda a descendência da primeira geração (F1) assemelha-se ao tipo parental dominante (Aa). c) haverá maior número de animais com genótipos EE e CC do que com genótipo EC na região I. amarelos ou roxos. fenotípica mendeliana 3:1 aparecerá na geração F2. de acordo com o esquema a seguir. são cruzadas. por: a) AA." No trecho acima. pois os genótipos serão: a) 1/2 AA e 1/2 aa b) 1/4 AA. Porém. d) amarelo com planta de bulbo incolor não produz plantas com bulbo roxo.a) As pessoas afetadas possuem pelo menos um dos pais obrigatoriamente afetado. Questão 505 1. São albinos apenas os indivíduos de genótipo __(IV)__. Questão 504 "Casais de pigmentação da pele normal. b) Aproximadamente 1/4 das crianças de pais não-afetados pode ser afetado. a proporção Em uma certa espécie de mamíferos. dominante. c) roxo com planta de bulbo roxo pode produzir todos os três fenótipos mencionados. III e IV devem ser preenchidas correta e. Pode-se prever que a) haverá igual chance de adaptação de animais com os três genótipos nas duas regiões.1. se transforma em um pigmento amarelo. embora seja heterozigota.1 Analisando as informações apresentadas de acordo com os seus conhecimentos. existe um precursor incolor que. c) Aa. respectivamente.5. b) haverá igual chance de adaptação de animais com os três genótipos apenas na região I. Questão 502 Os bulbos da cebola podem ser brancos. Nos dois ambientes. Sabe-se que animais heterozigóticos são mais resistentes a um dado vírus X do que os homozigóticos. 111 . os animais de genótipo CC são mais facilmente capturados pelos predadores. há um caráter mendeliano com co-dominância e genótipos EE. onde há predadores naturais da espécie. Animais com os três genótipos foram introduzidos em duas regiões diferentes designadas por I e II. d) Se um dos pais é heterozigoto. o alelo recessivo pode ser herdado por descendentes fenotipicamente normais. O gene para o albinismo é __(II)__ e não se manifesta nos indivíduos __(III)__. recessivo. as lacunas I. sob a ação de uma enzima. c) O fenótipo ocorre igualmente em ambos os sexos. 1/2 AA e 1/4 aa e) É impossível determinar os genótipos utilizando os dados acima. heterozigotos e aa. é INCORRETO afirmar que o cruzamento de plantas de bulbo: a) incolor com planta de bulbo incolor só pode originar fenótipo incolor. Questão 503 Quando duas populações da espécie vegetal 'Zea mays' (milho). d) Aa. dominante. homozigoto e aa. b) AA. e) aa. As duas enzimas são codificadas por genes alelos dominantes com segregação independente. quando a geração F1 se intercruza. heterozigotos e aa. uma homozigota para o alelo dominante (AA) e uma homozigota para um alelo recessivo (aa). homozigoto e Aa. II. que a enzima E2 transforma em roxo. heterozigotos e AA.

IV e III 112 . com dominância completa. quando cruzados entre si. I . numa dada espécie. só é possível concluir que a) o caráter é recessivo. Analisando o genótipo da F. III. ( ) atuam sobre a mesma característica. mas não são obrigatoriamente iguais. ( ) conjunto de genes organizados nos cromossomos. c) os animais cruzados eram homozigotos. Questão 506 No homem. que já tem uma menina normal.Fenótipo IV . pelo alelo recessivo. I. também só originaram filhotes de cauda longa.Genoma II . II. I.F .Gene ( ) troca de fragmentos de cromossomos homólogos na primeira divisão da meiose. Os descendentes. V e IV c) II. a cor preta do pêlo é condicionada por um alelo dominante e a cor branca. d) os animais cruzados eram heterozigotos. a acondroplasia é uma anomalia determinada por um gene autossômico dominante. I. A partir desses dados. Um cruzamento-teste de um indivíduo de cor preta produziu descendentes brancos e pretos em igual número. a proporção fenotípica esperada na prole será de a) 3 pretos :1 branco b) 2 pretos :1 branco c) 1 preto : 3 brancos d) 1 preto : 2 brancos e) 1 preto :1 branco Questão 509 Sabe-se que a transmissão hereditária da cor das flores conhecidas como copo-de-leite se dá por herança mendeliana simples. numa proporção de 3 descendentes vermelhos para cada branco (3:1). V. V. De acordo com tais dados. V e IV d) IV. b) o caráter é dominante.bastante numerosa. Questão 508 Em cobaias. Se esses descendentes pretos forem cruzados entre si. os cientistas constataram que apenas um em cada três descendentes vermelhos era homozigoto para essa característica. associando os conceitos aos respectivos termos. e) a seleção natural será mais favorável aos animais com genótipo EE na região II. ( ) segmento do DNA capaz de transcrever uma molécula de RNA. ( ) conjunto de características detectáveis de um indivíduo. IV e III b) III. II. e) o genótipo dos descendentes difere do dos pais.Alelo V .d) a seleção natural será mais favorável aos animais com genótipo EC na região II. III e V e) I. Em um cruzamento experimental de copos-de-leite vermelhos. I. A seqüência correta é: a) II. obteve-se uma primeira geração . II. vir a ter um menino acondroplásico? a) 1 b) 3/4 c) 3/8 d) 1/4 e) 1/8 Questão 507 Considere que o comprimento da cauda. pode-se afirmar que a produção genotípica da F desse cruzamento experimental foi: a) 4 Aa b) 2 Aa : 2 aa c) 3 AA : 1 Aa d) 1 AA : 2 Aa : 1 aa Questão 510 Numere a segunda coluna de acordo com a primeira. Animais com cauda longa foram cruzados repetidas vezes entre si originando sempre descendentes com cauda longa. seja condicionado por um par de alelos. Qual é a probabilidade de um casal de acondroplásicos.Crossing-over III .

Concluiu-se com relação a estas proposições que: a) Apenas a 2. Questão 513 No que se refere ao desenvolvimento do chamado milho híbrido. O enunciado da Segunda Lei de Mendel diz que quando dois ou mais genes estão envolvidos. d) se somente II e III estiverem corretas. b) taxa de crossing-over. cada um atua e segrega independentemente dos demais. podese afirmar que se obtém na espécie: a) X e na espécie Y. 5 . tanto da espécie X quanto da espécie Y. 100% de mudas altas ao cruzar mudas altas em P1 com mudas altas em F2. é a Anáfase I. d) inativação de alelos codominantes. o que estimula a obtenção de culturas vegetais com máxima produtividade. e) se I. O enunciado da Primeira Lei de Mendel diz que os alelos de um gene separam-se durante a formação dos gametas. d) Apenas a 1.1. obtendo F1 que ao serem fenótipos resultantes dos cruzamentos foram representados nos gráficos a seguir: upondo que as plantas altas.1 113 . Muitas vezes esse melhoramento lança mão do conhecimento da herança genética de um determinado carácter como.5.Um homem calvo (homozigoto) transmite a característica da calvície a todos os filhos homens nascidos de seu casamento com uma mulher não calva. a 4 e a 5 são corretas. a 3 e a 4 são corretas. por exemplo. II e III estiverem corretas. A fase da meiose. e) Y. c) Apenas a 1. a altura.Em nenhuma hipótese a calvície ocorre na mulher. d) Y. há também uma necessidade crescente de alimentos. mas na maioria dos casos é claramente hereditária. Questão 514 Considere as proposições seguintes. e) Apenas a 2. e) ocorrência de pleiotropia. c) freqüência de genes em heterozigose. 100% de mudas altas ao cruzar mudas altas em P1 com mudas médias em F2. por se tratar de herança ligada ao sexo.A calvície é dominante no sexo masculino 4 . c) se somente I estiver correta. realizou-se cruzamento entre mudas altas e baixas das duas espécies (P1). 1. responsável pela ocorrência da Segunda Lei de Mendel. a 2 e a 3 são corretas. 100% de mudas altas ao cruzar as mudas médias em F2. 50% de mudas altas ao cruzar as mudas altas em F1. a 3.Questão 511 Considere as seguintes proposições: 1 . 3 . b) se somente I e III estiverem corretas. III. sejam mais produtivas. II. b) X. a 2 . 2 . Assinale: a) se somente I e II estiverem corretas.poderiam apresentar mudas com alturas diferentes. sabe-se que o cruzamento de duas linhagens homozigotas selecionadas pode produzir espigas maiores e de melhor qualidade comercial. Questão 512 Com o enorme crescimento populacional. Supondo-se que duas espécies vegetais . 100% de mudas altas ao cruzar mudas altas em F2.Uma mulher será calva se seus pais forem calvos e se sua mãe (heterozigota) possuir um de seus genitores calvo. a 3 e a 4 são corretas. em conseqüência da alta a) interação de genes recessivos.X e Y . I. a 3 e a 4 são corretas.A calvície pode ser originada por causas ambientais. b) Apenas a 1. c) Y.

c) O alelo dominante do gene se expressa em cor verde. e) à união dos gametas para formar o zigoto. 1. d) à ocorrência de genótipos diferentes em uma população. b) um cruzamento de dois genitores homozigotos contrastantes. A figura a seguir representa um dos cruzamentos realizados por Mendel entre plantas de ervilhas com flores púrpuras e plantas com flores brancas. c) a transmissão dos caracteres adquiridos. criadas em temperatura de 25°C.Questão 515 A primeira lei de Mendel ou lei da segregação significa: a) um cruzamento onde se considera apenas um gene.5. Todas as alternativas apresentam conclusões a partir desses resultados. Questão 520 Analise esta tabela: MÉDIA DAS DIFERENÇAS NAS CARACTERÍSTICAS ENTRE GÊMEOS MONOZIGÓTICOS E DIZIGÓTICOS 114 . mutantes. d) o processo de seleção natural.1. EXCETO: a) A expressão do alelo recessivo do gene desaparece apenas em F. obteve na primeira geração (F) todos os descendentes de coloração verde. representado por dois alelos. c) à ocorrência de fenótipos diferentes em uma população.1 s moscas de genótipo igual ao do tipo III. e) Os indivíduos que apresentam vagens de coloração verde em F‚ são heterozigotos.1. Se Mendel utilizasse como genitor masculino as plantas de flores púrpuras e como feminino.1 a) 100% de flores brancas.5. c) 75% de flores púrpuras e 25% de flores brancas. e) um caráter controlado por dois ou mais genes. b) 100% de flores púrpuras. Questão 518 A coloração das flores de ervilha é determinada por herança autossômica. e) 100% de flores de coloração rósea. b) à segregação do par de alelos durante a formação dos gametas. b) As plantas com vagens verdes ou amarelas da geração parental devem ser homozigotas. apresentam asas normais. quando criadas em temperatura de 16°C. Questão 516 A primeira Lei de Mendel refere-se a) ao efeito do ambiente para formar o fenótipo. d) 50% de flores púrpuras e 50% de flores brancas. d) O caráter é controlado por um par de genes. os descendentes obtidos em F1 apresentariam 1. d) a separação de um par de alelos durante a formação dos gametas. Questão 519 Esta figura representa o cruzamento de drosófilas de asas normais com indivíduos de asas enroladas. as plantas de flores brancas. O resultado desse fenômeno ilustra a) a adaptação dos mutantes. b) a influência do ambiente na expressão do genótipo. c) um cruzamento de dois genitores heterozigotos. Na segunda geração (F‚) obteve 428 verdes e 152 amarelas. Questão 517 Quando Mendel cruzou plantas de ervilha apresentando vagens de coloração verde com plantas de vagens de coloração amarelas.

5.1. e só pessoas com sardas podem ter filhos com sardas (veja no heredograma abaixo). convulsões e morte.1 1.1. aproximadamente 75% dos indivíduos Aa se apresentam sem os sinais clínicos da doença. podem ser transmitidas de pai para filho.5. ocorrem em todas as gerações. om base nos dados dessa tabela e em outros conhecimentos sobre o assunto. b) antes de atingirem a idade de 15 anos. Os indivíduos afetados são heterozigotos. Assinale a alternativa que define o caso. filhos de casais Aa × aa têm 50% de probabilidade de manifestar a doença.1 115 . cerca de 85% dos indivíduos heterozigotos já manifestaram a doença.1. As sardas aparecem igualmente em homens e em mulheres. a surdez congênita e a esclerótica azulada. Analise este gráfico. c) a influência ambiental pode ser avaliada em gêmeos MZ. b) as diferenças entre gêmeos MZ indicam diferenças genéticas entre eles. d) o comprimento da cabeça apresenta maior influência ambiental. Questão 522 Na espécie humana há um gene que exerce ação simultaneamente sobre a fragilidade óssea. c) aos 30 anos. a) em torno dos 65 anos. é CORRETO afirmar que a) o peso é a característica que apresenta maior influência genética. indivíduos portadores do alelo mutante podem expressar a doença. d) aos 40 anos. em que se mostra o percentual de indivíduos doentes entre aqueles que possuem genótipo favorável: 1. Questão 521 O mal de Huntington é uma doença autossômica dominante caracterizada por deterioração mental progressiva.1.1 Com base nas informações desse gráfico e em outros conhecimentos sobre o assunto.5. é INCORRETO afirmar que. a) Ligação genética b) Penetrância completa c) Pleiotropia d) Herança quantitativa e) Polialelia Questão 523 A presença de sardas em seres humanos é uma característica hereditária determinada por um par de alelos.

(16) Um indivíduo híbrido é aquele que resulta da união entre dois indivíduos geneticamente diferentes. é correto afirmar: (01) O descendente será obrigatoriamente heterozigoto. se a cor branca é dominante? a) Ambos são homozigotos recessivos b) Ambos são brancos heterozigotos c) Ambos são homozigotos dominantes d) A mãe é Bb e o pai é BB e) A mãe é bb e o pai é Bb Questão 525 A acondroplasia (uma das formas de nanismo) é causada por um gene dominante autossômico. Este se casa com uma mulher normal cujos pais eram normais (conforme heredograma abaixo). Machos e fêmeas sentem-se atraídos por odores de linhagens não relacionadas. Da união de um homem acondroplásico com uma mulher normal resulta um filho normal. A respeito desse assunto. (02) O cruzamento entre indivíduos geneticamente diferentes. da mesma espécie.abendo disso. origina descendentes predominantemente heterozigotos.5. é correto afirmar: (01) O cruzamento entre indivíduos geneticamente diferentes. (08) O endocruzamento não interfere no valor adaptativo. (04) A probabilidade de acondroplasia na descendência é igual a zero. da mesma espécie. e) a presença de sardas se deve a um alelo autossômico dominante. Soma ( ) Questão 526 Cheiros e odores corporais fazem parte do aparato de comunicação em várias espécies de mamíferos. (02) A freqüência genotípica na descendência será 1:2:1. d) a presença de sardas se deve a um alelo autossômico recessivo. reconhecimento da prole. (32) Numa prole numerosa. (04) O endocruzamento pode causar uma redução no valor adaptativo pela maior probabilidade de ocorrência de genótipos ou combinações homozigotas de alelos recessivos deletérios. por exemplo.1 116 . a freqüência fenotípica será de 1 acondroplásico para 1 normal. Questão 524 Uma ovelha branca ao cruzar com um carneiro branco teve um filhote de cor preta. considerando ausência de mutação. é possível deduzir que a) a presença de sardas se deve a um alelo recessivo ligado ao cromossomo Y. Quais os genótipos dos pais. Soma ( ) 1. (08) A probabilidade de heterozigose na descendência em relação a este locus é igual a zero. seleção de parceiros e restrições ao endocruzamento. dispersão dos filhotes ainda jovens. b) a presença de sardas se deve a um alelo recessivo ligado ao cromossomo X. (16) A freqüência fenotípica numa prole numerosa será 3:1.1. origina descendentes homozigotos. c) a presença de sardas se deve a um alelo dominante ligado ao sexo. influenciando uma variedade de atividades como. Em relação aos descendentes deste último casamento e ao caráter em questão.

foi ilustrada com o esquema a seguir. ( ( ( ( ( ) Apresenta variantes genéticas facilmente observáveis. b) heterogeneidade genética. b) A fibrose cística é causada pela presença de um par de genes recessivos. a) Prófase I b) Metáfase I c) Anáfase I d) Metáfase II e) Telófase II Questão 530 João e Maria estão pensando em ter um filho. na pesquisa científica. d) O indivíduo 8 é homozigoto dominante para a fibrose cística.1. em 02 de julho de 1995. Questão 528 As reações bioquímicas. não é surpreendente que a expressão fenotípica de um gene envolva mais do que uma característica. Assinale a opção que faz referência a esse erro. c) O fenótipo do irmão de João e o fenótipo da irmã de Maria. com o título "Teste ajuda a evitar doenças congênitas". 1. Assim.1 O esquema publicado apresenta um erro. Já Maria tem um avô materno e uma irmã albinos e um irmão com pigmentação normal.5. Assinale com V (verdadeiro) ou F (falso) as afirmações a seguir sobre esse inseto. com a mesma característica. b) O genótipo da tia de João e o genótipo do irmão de Maria. iniciaram-se as comemorações do centenário da utilização da 'Drosophila' sp. ) Não apresenta dimorfismo sexual.Questão 527 A matéria publicada no Jornal O GLOBO. d) alelismo múltiplo. Assinale a alternativa que apresenta a fase referida. amplamente utilizado em experimentos na área de genética e evolução. e) O indivíduo 18 é afetado pela fibrose cística e não um portador desta doença. representando o mecanismo de transmissão da fibrose cística: Questão 529 A Primeira Lei de Mendel ou Lei da Segregação dos Genes pode ser relacionada a uma das fases do processo meiótico. d) O genótipo do primo de João e o fenótipo da mãe de Maria. Os pais de Maria também têm pigmentação normal. ) Apresenta autofecundação. ) Apresenta pequeno número de cromossomos. Que informações permitem avaliar com maior precisão as chances de João e Maria terem um filho albino? a) O fenótipo da irmã de João e o genótipo do avô de Maria. Seus pais não são albinos. por parte de mãe. João tem um irmão albino e uma irmã com pigmentação normal. A seqüência correta de preenchimento dos parênteses. porém João tem uma tia paterna albina e um primo. e) O fenótipo do pai de João e o genótipo do pai de Maria. em sua maioria. e) fenocópia. ) Apresenta ciclo reprodutivo curto e fecundidade alta. de 117 . Questão 531 Em 2005. A afirmação acima se refere ao conceito de a) dominância incompleta. Os produtos de uma cadeia de reações podem ser utilizados em muitas outras vias metabólicas. são interligadas e freqüentemente interdependentes. c) pleiotropia. c) A doença somente se manifesta quando dois indivíduos portadores são cruzados. a) Os indivíduos 3 a 6 são heterozigotos para a fibrose cística.

.V ... c) V .F. a) 3/8 .5.V .V .Harry é menos bruxo que Rony. II e III.. filhos de pais bruxos.cima para baixo é a) F . considere as seguintes afirmações sobre o caráter bruxo em termos genéticos.. preocupado com a possiblidade de vir a ser calvo.. na ordem em que aparecem.5/8 b) 4/8 . b) seu avô paterno ser calvo. consultou um amigo que estava estudando genética...Simas é heterozigoto para o caráter bruxo. Questão 535 Considere que o caráter analisado .F . somente em homozigose. resultando em 192 descendentes.F . a produção de uma geração Fƒ a partir da autofertilização da geração F‚ resultante do cruzamento de ervilhas parentais homozigotas amarelas (AA) e verdes (aa) produziria .1 Todos os descendentes pretos de F2 foram cruzados com os F1.F .... d) V .V . I .1. Neville e Draco são bruxos.Contou que. Hermione é bruxa mas filha de trouxas (não bruxos). Quais estão corretas? a) Apenas I. Na família do avô materno. Assinale o número esperado de descendentes com pelagem branca... Assim concluiu que a chance de Leandro vir a ser calvo era de 50%. sua avó materna era.F . Seu amigo explicou que a calvície é uma característica influenciada pelo sexo e que se expressa nos homens em homo e heterozigose e nas mulheres.cor da pelagem em coelhos .F .F . filho de uma bruxa e de um trouxa. d) Apenas II e III.Hermione apresenta dois alelos para o caráter bruxo. de ervilhas verdes.4/8 c) 5/8 ..3/8 d) 6/8 ..V . não havia histórico de calvície.2/8 e) 7/8 . provenientes de famílias bruxas tradicionais.V. b) F .. Rony. De acordo com a hipótese de segregação de fatores proposta por Mendel.V . foi sugerido que a característica de ser ou não bruxo seguiria padrão de segregação mendeliana. c) Apenas I e III. de ervilhas amarelas e ..F .F... III . Simas é bruxo.. e) I.. d) seu pai ser heterozigoto. Harry é bruxo. 118 .. filho de bruxos.V. sendo sua mãe filha de trouxas. e) sua avó materna ser heterozigota...1/8 Questão 534 Leandro.V. Neville e Draco. Essa conclusão baseia-se no fato de a) sua mãe ser heterozigota.V . e) V . Questão 532 Conforme correspondência publicada na revista científica "Nature" de agosto de 2005 (p.. Questão 533 Assinale a alternativa que preenche corretamente as lacunas do texto a seguir. 776).. b) Apenas II..F . Com base no texto. c) sua avó paterna ser heterozigota..obedece ao proposto pela 1 Lei de Mendel. II . embora seus pais não fossem calvos. tendo sido realizados os cruzamentos a seguir: 1.

b) 50% dominante e 50% recessiva. c) 50%. d) 75% com alelo dominante e 25% com alelo recessivo. uma cópia de um gene humano. b) Na expressão gênica os efeitos do ambiente celular não são considerados. Considerando que o homem-aranha é o único a ter essa mutação. Com relação aos princípios básicos da hereditariedade. Questão 538 De acordo com a primeira lei de Mendel. Questão 539 Os mecanismos da herança apresentam diferentes maneiras pelas quais os genes interagem entre si e com o ambiente para manifestarem seus efeitos no fenótipo dos seres vivos. 119 . d) Pode ser muito difícil determinar se o fenótipo resulta mais do efeito gênico do que o ambiental. a fração de descendentes gigantes. espera-se que a F seja a) 100% heterozigota. b) 25%. assinale a alternativa CORRETA: a) Os genes codominantes têm menor influência no fenótipo do que os fatores ambientais. b) Todos os seus meninos deverão ter o fenótipo "aranha". mas com expressão influenciada pelo sexo.1 Se o camundongo macho gigante cruzar com uma fêmea normal. é necessário que ocorra a polinização. responsável pela síntese do hormônio do crescimento (somatotrofina). b) 100% com alelo dominante. c) 50% com alelo recessivo e 50% com alelo dominante. provavelmente. c) Na geração F1. de gametas: a) 100% com alelo recessivo. será igual a a) zero. e) formada por homozigotos recessivos. e) 75% com alelo recessivo e 25% com alelo dominante. gerando um camundongo macho gigante. Este zigoto foi implantado em uma "mãe de aluguel". Para a produção de milho. Se o pólen de uma planta heterozigota para um determinado loco gênico fecundar os óvulos de uma planta também heterozigota para esse loco. Esse único evento resultou na formação de um alelo (S) autossômico e dominante. Assinale a afirmativa CORRETA: a) Terá filhas-aranha se casar com uma prima de primeiro grau. Questão 537 Por meio da técnica do DNA recombinante. mulheres-aranha seriam esperadas na população apenas se tal alelo ocorresse em homozigose (SS). Questão 540 1. foi integrada a um único cromossomo. e) Na presença de genes recessivos. 50% delas deverão ser normais.5. c) 50% heterozigota. 25% homozigota dominante e 25% homozigota recessiva. apenas o efeito ambiental prevalece no fenótipo. d) Analisando apenas as filhas. a expectativa quanto aos fenótipos de seus futuros descendentes poderá ser uma entre as possibilidades abaixo. e) Quem herdar o cromossomo Y deverá ser uma criança-aranha. um indivíduo heterozigoto para um caráter regulado por dominância completa provavelmente produzirá a seguinte porcentagem Suponha que um evento de mutação permitiu ao homem-aranha secretar a seda formadora de teia. c) Os genes dominantes são independentes dos fatores ambientais para se expressarem.Questão 536 Em vários cultivos. por exemplo. de zigoto de camundongo. d) 100%.1. na fase G do ciclo celular. Desta forma. não portadora do gene do hormônio do crescimento. 25% poderá ser de meninos-aranha. o que se deseja é a produção de sementes. d) formada por homozigotos para o alelo dominante.

foram realizados cruzamentos entre esses animais. (5) A dieta especial a que devem ser submetidos os recém-nascidos fenilcetonúricos tende a alterar a freqüência do gene da fenilcetonúria na população. que pode apresentar dominância ou recessividade.1. A administração de insulina aos diabéticos evitará que eles tenham filhos com este distúrbio? a) Não. Em algumas dessas formas.5. (4) A probabilidade de que o casal formado pelos indivíduos 10 e 11 tenha um descendente do sexo masculino fenilcetonúrico é igual a 12. e) Depende do tipo de diabete. c) 90. Questão 544 Considerando-se que a cor da pelagem de cobaias é determinada por um par de alelos. conforme a tabela. 1. que condiciona pêlos curtos em cobaias. d) Sim. e) 180.1 120 . por meio do qual se identifica a fenilcetonúria. c) Sim. (3) Os homens normais representados no heredograma são necessariamente heterozigotos.1. essa doença pode ser controlada ministrando-se ao recém-nascido uma dieta especial. pois tanto o genótipo como o fenótipo dos filhos são alterados pela insulina. julgue os itens abaixo.1 Considerando o heredograma. das quais 240 tinham pêlos curtos. (1) O caráter fenilcetonúrico apresenta herança autossômica dominante. é dominante em relação ao gene que determina pêlos longos. d) 160. Questão 543 O gene autossômico. o número esperado de heterozigotos é: a) 45. uma lei determina que os recém-nascidos sejam submetidos ao "teste do pezinho". b) 60. b) Não. doença hereditária que pode levar ao retardamento mental. (2) O cruzamento entre os indivíduos 10 e 11 ilustra como a consangüinidade influencia o aparecimento de doenças hereditárias. Questão 542 Os vários tipos de diabete são hereditários. Do cruzamento de cobaias heterozigotas nasceram 300 cobaias. 1. pois o genótipo dos filhos não é alterado pela insulina. Se detectada a tempo. embora o distúrbio possa aparecer em crianças cujos pais são normais. O heredograma seguinte ilustra uma situação em que há indivíduos fenilcetonúricos.5%. pois nesses casos o genótipo pode ser alterado evitando a manifestação da doença nos filhos. pois a insulina é incorporada no sangue fazendo com que os filhos não apresentem o distúrbio.5.Questão 541 No Brasil. com prejuízo da fala e dos movimentos. pois a insulina é incorporada nas células e terá ação nos filhos. os sintomas podem ser evitados por meio de injeções diárias de insulina. Entre as cobaias de pêlos curtos.

existe uma síndrome caracterizada. d) o gene para albinismo é ativado no escuro. Ao fazer a genealogia de vários indivíduos. Trata-se de um caso de _____________ e os indivíduos parentais são _______________. Com base nessas informações. por suscetibilidade aumentada a infecções e tendência a sangramentos. são observados dois fenótipos e três genótipos entre os descendentes. d) ligada ao cromossomo X e recessiva.análise da tabela permite concluir que a) no cruzamento I. e) no cruzamento V. os genótipos dos pais podem ser diferentes. os pais são heterozigotos. e) 50% da prole possuem um único tipo de alelo e 50% possuem outro tipo de alelo. c) uma planta de flores rosas com outra de flores 121 . enquanto as rosas são heterozigotas. b) uma planta de flores brancas com outra de flores rosas. b) autossômica dominante. c) plantas albinas tornam-se verdes na presença de luz. Questão 546 Em um cruzamento de um indivíduo AA com outro aa. é possível o aparecimento de indivíduos albinos. b) em 25% da prole. e) ligada ao cromossomo Y e recessiva. pode-se dizer que o tipo de herança responsável por essa síndrome é a) autossômica recessiva. Para se obter 50% de flores brancas. c) 75% da prole expressam o fenótipo determinado pelo alelo A e 25% não o expressam. Embora plantas albinas morram antes de produzirem sementes. 7 brancos e 8 pretos. uma com flores vermelhas e outra com flores brancas. normais. a) 25% brancas : 25% vermelhas : 50% rosas b) 25% brancas : 50% vermelhas : 25% rosas c) 100% rosas d) 50% vermelhas : 50% rosas e) 50% brancas : 25% vermelhas : 25% rosas Questão 549 Do cruzamento entre aves andaluzas de coloração azulada. Na geração F todas as flores eram rosas. observou-se que a síndrome não se manifesta em algumas gerações e pode ocorrer em indivíduos que aparentemente têm pais normais. Questão 545 Em gatos. Questão 547 No cruzamento de plantas verdes. e) o albinismo impede a síntese de clorofila. c) no cruzamento III. podem ocorrer três genótipos diferentes entre os descendentes. Isto se explica porque: a) muitas plantas verdes são heterozigóticas. As flores vermelhas e brancas são homozigotas. c) ligada ao cromossomo X e dominante. nasceram 15 filhotes azulados. a proporção fenotípica observada em F‚ significa exatamente que: a) 25% da prole expressam o fenótipo determinado pelo alelo dominante e 75% não o expressam. O preenchimento correto das lacunas é. respectivamente: a) herança quantitativa e homozigotos dominantes. Questão 548 Mendel cruzou duas variedades de 'Mirabilis jalapa'. Indique qual será o resultado do cruzamento da variedade de flores rosas (F‚). b) plantas normais homozigóticas tornam-se albinas na ausência de luz. b) no cruzamento II. a característica "albinismo" não desaparece entre elas. d) herança ligada ao sexo e homozigotos recessivos. o fenótipo dominante é mascarado pelo fenótipo recessivo. e) epistasia e homozigotos dominantes. os pais são heterozigotos. d) no cruzamento IV. o fenótipo recessivo é mascarado pelo fenótipo dominante. Essa síndrome é mais freqüente em descendentes de casais aparentados e ocorre em machos e fêmeas em proporção relativamente igual. d) em 50% da prole. brancas ou rosas. b) codominância e heterozigotos c) linkage e heterozigotos. Questão 550 As flores da planta maravilha podem ser vermelhas. é necessário cruzar: a) duas plantas de flores rosas. entre outras manifestações. considerando que o alelo Aé dominante sobre a.

as proporções genotípicas e fenotípicas observadas na segunda geração dos filhos serão. verde pálido. c) É uma herança ligada ao sexo em vegetais. Este gene. o caráter tonalidade da cor das folhas e ramos é transmitido geneticamente através do citoplasma dos óvulos. (Adaptado de "Ciência Hoje". obteve plantas que davam flores brancas. Agosto de 1999.1. Questão 552 Valéria gostava muito de flores. é INCORRETO afirmar: a) A propagação vegetativa de uma planta verde deve produzir plantas verdes. Observando seu jardim. pois o cruzamento de plantas de flores brancas e vermelhas só originou flores rosas. d) co-dominante. 49) A alergia ao leite pode ser hereditária. A tabela abaixo apresenta o resultado de seis possíveis cruzamentos. indivíduos com atividade de lactase e indivíduos com atividade parcial da lactase. e) duas plantas de flores vermelhas. nas populações ocorrem três fenótipos relacionados à atividade da enzima: indivíduos sem atividade de lactase. no Canadá. c) epistática.5. respectivamente. a) 1 : 3 : 1 e 3 : 1 b) 1 : 2 : 1 e 1 : 2 : 1 c) 1 : 1 : 2 e 1 : 1 : 1 d) 1 : 3 : 1 e 3 : 1 : 3 e) 1 : 1 : 1 e 3 : 1 Questão 555 Em estudo publicado na revista Nature de 25 de junho passado. Questão 551 A maioria das populações é composta por pessoas que manifestam perda progressiva da lactase intestinal após o desmame. Curiosa para saber como se dava a transmissão desse caráter. pesquisadores da Universidade de Toronto. rosas e vermelhas. essas pessoas perdem a capacidade de digerir o açúcar do leite. Valéria promoveu uma autofecundação nas plantas de cor rosa e. vermelhas e rosas. Essa distribuição é característica de um padrão de herança a) recessiva. p. d) O fenótipo pode ser influenciado por fatores ambientais. e) quantitativa. d) as plantas de flor vermelha eram dominantes e as de cor branca recessivas. causada pela deficiência da enzima lactase. notou a existência de plantas de uma mesma espécie que possuíam indivíduos com flores brancas. b) trata-se de um caso de co-dominância entre os genes alelos que determinam o padrão de cor. Questão 554 No monoibridismo com co-dominância ou dominância intermediária. para sua surpresa. afirmam que o gene CYP2A6 está ligado à dependência das pessoas ao cigarro. e) trata-se de um caso de gene letal. b) dominante. Três fenótipos são observados: verde.2 e acordo com a tabela e com seus conhecimentos. Valéria concluiu CORRETAMENTE que: a) trata-se de dominância da cor rosa sobre as demais. a lactose. estas últimas em quantidade duas vezes maior que as plantas de flor branca e vermelha. codifica a síntese de uma enzima que 122 .vermelhas. b) Genes estão envolvidos na determinação dos fenótipos. d) uma planta de flores vermelhas com outra de flores brancas. Questão 553 Em "Mirabilis jalapa" (maravilha). variegadas (pigmentação irregular). 1. em sua forma normal. c) as plantas de flor rosa eram recessivas. obtendo plantas que só davam flores de cor rosa. Essa característica é autossômica e. Em conseqüência da falta dessa enzima.

Questão 556 Observe o esquema.1. Por outro lado. ainda. c) epistasia recessiva. pois qualquer um dos alelos defeituosos inibe. e) dominância incompleta entre a forma normal e as defeituosas do gene CYP2A6. é INCORRETO afirmar que a) os pares de genes que determinam o "tipo" e a "cor" da asa nas moscas estão localizados em cromossomas não-homólogos.metaboliza a nicotina. três alelos para este gene: um normal e dois defeituosos. Fumantes portadores de dois alelos normais (homozigoto para o alelo normal) são altamente dependentes do cigarro.2 1.1. d) o gene que determina "plumagem azulada" é dominante sobre os genes que determinam "plumagem preta" ou "plumagem branca". é CORRETO afirmar que a) o gene HbA é dominante sobre o gene HbS. b) pleiotropia. em que estão relacionadas características das gerações F1 e F2. na espécie humana. b) os indivíduos HbA/HbS e HbS/HbS devem apresentar os mesmos níveis de hemoglobina anormal. jamais se tornam dependentes. pois o fenótipo apresenta uma continuidade entre dependentes e não dependentes. b) as características "tipo de semente" e "cor de plumagem" são determinadas. tornando as pessoas dependentes. é correto afirmar que a dependência ao cigarro determinada pelo gene CYP2A6 é um caso de: a) herança quantitativa. resultantes dos cruzamentos de linhagens puras de três organismos diferentes: 1. enquanto que portadores de dois dos alelos defeituosos. são moderadamente dependentes. a ação do alelo normal. quando autofecundadas. Com base no texto anterior. d) dominância completa da forma normal do gene CYP2A6 sobre as formas defeituosas. por um único par de gene. Questão 557 Analise esta tabela.5. Com base nesse esquema e em conhecimentos sobre o assunto. que há. consumindo 20% menos cigarros que os fumantes inteiramente dependentes. portadores de um alelo normal e outro defeituoso. originam apenas descendentes com sementes rugosas. Eles afirmam. cada uma delas. 123 .2 Considerando-se as informações contidas nesta tabela e outros conhecimentos sobre o assunto. parcialmente. c) os indivíduos que produzem só hemácias anormais podem ser curados por meio de transfusão sangüínea.5. fumantes heterozigotos. pois o heterozigoto apresenta fenótipo diferente de ambos os homozigotos. d) um determinado genótipo pode produzir diferentes fenótipos. c) as plantas da F2 com "sementes rugosas". apesar de fumantes.

A calvície é determinada por um alelo autossômico. certamente apresentam genótipos homozigotos. exemplos de a) dominância incompleta. heterozigotos. identificada como talassemia maior e os heterozigotos MN. d) epistasia. I. Sabendo-se que todos os indivíduos com talassemia maior morrem antes da maturidade sexual. uma constituída de plantas com flores brancas e outra com flores vermelhas. Tanto homens quanto mulheres C£C£ são normais. Questão 559 Um experimentador cruzou duas linhagens puras de uma planta denominada boca-de-leão. Herança: epistasia dominante. III. Indivíduos homozigotos com genótipos (CßCß) apresentam flores brancas. II. dominantes com relação ao alelo i. Herança: dominância completa. 124 . apresentam uma forma mais branda chamada de talassemia menor. Herança: pleiotropia. (02) a proporção genotípica esperada nas plantas de F‚ é: 1 planta com flores cor-de-rosa: 2 plantas brancas: 1 planta vermelha. considerando que neste experimento: (01) ocorreu a segregação de três fenótipos: o branco. co-dominância e expressão gênica influenciada pelo sexo. respectivamente. co-dominância e dominância incompleta. Os heterozigotos resultantes do cruzamento entre essas duas linhagens (CÑCß) apresentam flores de cor rosa. Homens com genótipo C¢C¢ (homozigotos) ou C¢C£ (heterozigotos) são calvos. foram obtidas plantas com flores exclusivamente brancas. Assinale a opção em que se indicam. O primeiro morreu aos 5 anos de idade. Da autofecundação das plantas da F. o último é normal.Questão 558 Um casal de africanos teve três filhos. o vermelho e o cor-de-rosa. c) 3Ž filho ë heterozigoto. Indivíduos homozigotos NN são normais. (04) as linhagens puras. certamente. que deram origem ao experimento. porém pouco suscetível a malária. c) co-dominância. e) herança poligênica. a) 2Ž filho ë homozigoto recessivo. Herança: co-dominância. corretamente. b) dominância incompleta. em conseqüência de anemia falciforme. (08) os indivíduos de F eram. Na planta boca-de-leão. o segundo é normal e bastante suscetível a malária (doença endêmica na região). II e III são. indivíduos com genótipos IÞIÞ ou IÞi apresentam tipo sangüíneo A e os com genótipos IßIß ou Ißi apresentam tipo sangüíneo B. enquanto mulheres C¢C¢ são calvas e C¢C£ são normais. Questão 560 A talassemia é uma doença hereditária que resulta em anemia. descendentes do cruzamento de um homem e uma mulher portadores de talassemia menor. b) pai ë heterozigoto. portanto. Os alelos IÞe Iß são. (16) a F‚ esperada será constituída de 50% de indivíduos homozigotos e 50% de indivíduos heterozigotos. o membro da família com seu respectivo genótipo e o padrão de herança da anemia falciforme. epistasia e pleiotropia. há indivíduos homozigotos. o genótipo IÞIß determina tipo sangüíneo AB. Em humanos. d) mãe ë homozigoto dominante. pleiotropia e penetrância incompleta. cujo genótipo (CÑCÑ) define cor vermelha nas flores. dominância incompleta e expressão gênica influenciada pelo sexo. que serão anêmicos? a) 1/2 b) 1/4 c) 1/3 d) 2/3 e) 1/8 Questão 561 Considere as seguintes formas de herança: I. qual das alternativas a seguir representa a fração de indivíduos adultos. A descendência originada (F) apresentou apenas plantas com flores cor-de-rosa. Por outro lado. vermelhas ou cor-de-rosa. Indivíduos homozigotos MM apresentam a forma mais grave. Assinale a(s) proposição(ões) VERDADEIRA(S).

respectivamente: a) 1/2 e 1/2 b) 1/4 e 3/4 c) 2/3 e 1/3 d) 3/4 e 1/4 Questão 566 1.ss. a dominância parcial e a codominância entre alelos definem-se. a) nos genótipos heterozigotos. II: 1 gene com dominância incompleta. II: vários genes com interação. No heredograma a seguir. é possível deduzir que o alelo que condiciona a anomalia é a) letal em homozigose. esperam-se as seguintes proporções de camundongos de pelagem branca e preta. Ss e Ss. SS. 125 . ss e ss. e) autossômica recessiva .SS. Ss. a pelagem branca é condicionada pela presença do gene "A". c) I: 1 gene com dominância incompleta. letal em homozigose. existe uma anomalia que se caracteriza pelo encurtamento das asas. Quando aves anômalas heterozigóticas são cruzadas. SS e SS. Seu alelo recessivo "a" condiciona pelagem preta. Na espécie humana há um tipo de surdez hereditária que é determinada por um par de genes.1. b) nos genótipos homozigotos.4 a) autossômica dominante . 3 e 4. de forma mais precisa. II: 1 gene com alelos múltiplos. originam uma descendência com indivíduos anômalos e normais numa proporção de 2 :1.5. assinale a opção correta quanto ao tipo de herança e os genótipos dos indivíduos 1. Ss e Ss. c) nos genótipos dominantes. e) epistático. Questão 565 Em determinado tipo de camundongo. c) pleiotrópico.2 Os padrões de distribuição fenotípica são devidos a: a) I: 1 gene com dominância. c) autossômica dominante .Questão 562 Em genética. Para os filhotes vivos de um cruzamento de um casal de heterozigotos. d) I: 3 genes com dominância incompleta. b) autossômica dominante . respectivamente: 1. Questão 563 Os gráficos I e II representam a freqüência de plantas com flores de diferentes cores em uma plantação de cravos (I) e rosas (II). b) letal recessivo. respectivamente.Ss. as pessoas surdas estão representadas por símbolos hachurados: Com base nessa afirmação. Ss e SS. 2. ss. d) nos genótipos recessivos. ss.SS.5.1.Ss. II: 2 genes com dominância incompleta. e) na ligação gênica. II: vários genes com interação. d) autossômica recessiva . e) I: 2 genes com interação. Questão 564 Em aves. b) I: 1 gene com dominância incompleta. A partir desses dados. ss. d) hipostático.

d) III possui apenas um alelo mutado. hipopigmentação. 4 b) 1. odemos dizer. respectivamente. (I) e (II). (III) e (IV). 5. as probabilidades de o pai e de a mãe serem portadores desse alelo são. apresentam uma série de complicações como retardo mental. 8 d) 4. 2. Assinale a alternativa que mostra as porcentagens que preenchem corretamente os espaços I. os quadrados cheios representam meninos afetados por uma doença genética. as probabilidades de o pai (A) e de a mãe (B) do menino (C) serem portadores desse alelo são. 6. III e IV. assim. Questão 568 Analise o heredograma a seguir. causada por uma deficiência da enzima fenilalanina hidroxilase. 6. Pacientes acometidos desse mal.4 1. respectivamente. não conseguem metabolizar a fenilalanina e. que: a) VIII pode ter um alelo mutado. onde os indivíduos masculinos são representados por quadrados e os femininos por círculos. 5 c) 1. Caso a anomalia seja condicionada por um alelo recessivo ligado ao cromossomo X.4 126 . além de não sintetizarem catecolaminas corretamente. quanto à presença de alelos mutantes de fenilalanina hidroxilase nos membros da família marcados com algarismos romanos. c) V é necessariamente homozigoto.Questão 567 A fenilcetonúria (PKU) é uma doença de origem genética bastante conhecida. 4. b) VI possui dois alelos mutados. 2.4 obre as informações contidas no heredograma. 2.5. podemos afirmar que os indivíduos heterozigotos são: a) 1.1. 7 e) 3. 3. 1. entre outras. II. 5. epilepsia.1. Considere o heredograma a seguir de uma família com membros acometidos (símbolos cheios) e normais (símbolos vazados). e) I é necessariamente homozigoto.1. num segmento sem homologia com o cromossomo Y. 1. 9 Questão 569 No heredograma.5.5. Se a doença for condicionada por um par de alelos recessivos localizados em cromossomos autossômicos.

Os símbolos escuros indicam os portadores de uma anomalia hereditária.5. d) recessivo. c) ligada ao x dominante. localizado em um autossomo. b) dominante. quadrados representam homens e símbolos preenchidos representam indivíduos portadores de certa característica.1.4 1. localizado em autossomo. c) dominante. c) dominante. Questão 574 127 . Questão 573 Se os indivíduos 7 e 11 se casarem. Questão 572 O tipo de herança genética apresentada pelos indivíduos afetados é: a) autossômica dominante. e) localizado no cromossomo Y. círculos representam mulheres. 1.1.1. pode-se concluir que a característica em questão é condicionada por gene a) dominante. a probabilidade desse casal ter uma filha com o mesmo fenótipo do avô materno é de: a) 1/2 b) 1/4 c) 1/8 d) 1/3 e) 2/3 1.5. localizado no cromossomo x.5. conclui-se que a anomalia é determinada por gene a) dominante. Questão 571 No heredograma a seguir. localizado em autossomo.4 1. d) recessivo.Questão 570 O esquema a seguir representa indivíduos de três gerações de uma família. localizado no cromossomo y. localizado no cromossomo X. d) ligada ao x recessiva. e) ligada ao y.5.4 nalisando-se a genealogia.4 om base na análise do heredograma. b) recessivo. localizado no cromossomo y. b) autossômica recessiva.1. localizado em um autossomo. localizado no cromossomo X. e) recessivo.

c) 50% e 50%.5. e) É do tipo dominante ligada ao sexo porque todos os filhos homens herdam a característica da mãe. as probabilidades dos casais 7×8 e 9×10 terem crianças normais são.5.5.4 No heredograma acima.1. se os indivíduos marcados são afetados por uma característica genética. d) É do tipo recessiva ligada ao sexo porque todo progenitor masculino afetado transmite a característica para suas filhas.4 Considerando-se que a família acima representada faz parte de uma população em equilíbrio de Hardy-Weimberg. b) É do tipo dominante autossômica porque o genótipo pode estar presente na prole de ambos os sexos sem estar presente nos pais.1. Questão 576 No heredograma adiante. é correto afirmar. respectivamente. 128 . b) 0 e 75%. os indivíduos 3 e 5 são afetados por uma anomalia genética recessiva. a) É do tipo recessiva autossômica porque o genótipo pode estar presente na prole de ambos os sexos sem estar presente nos pais.1. Questão 575 Analise o seguinte heredograma de uma característica transmitida geneticamente: om base nessa análise. indique a opção que apresenta a afirmativa correta sobre a herança da característica referida no heredograma. na qual a freqüência de indivíduos afetados é de 1%. b) O indivíduo 8 apresenta o mesmo fenótipo e o mesmo genótipo do avô para o caráter em questão. 1. e) 100% e 75%. c) É do tipo recessiva autossômica porque o número de indivíduos afetados é menor do que o de não afetados. d) O caráter em estudo pode ser ligado ao sexo. de: a) 100% e 50%.1. EXCETO: a) A segunda geração pode ser composta apenas por indivíduos homozigotos. d) 0 e 25%. c) A probabilidade de o indivíduo 7 ser heterozigoto é de 18%.4 1.

as figuras 6. os eventuais filhos nascerão afetados.A mulher representada pelo número 5 tem possibilidade de ser homozigota. com uma progressiva perda do controle motor e problemas psiquiátricos como demência e distúrbios afetivos.5. causada por um gene autossômico influenciado pelo sexo.4 onsiderando que os indivíduos indicados em preto são afetados por uma característica genética.1. e) a incapacidade de enrolar a língua. b) Apenas I.5. b) o lóbulo da orelha livre. II.5. 1. São corretas as afirmações: a) I.1. c) Apenas II e III. d) a hipertricose.Questão 577 No heredograma. causada por um gene autossômico recessivo. desenvolveram a mesma doença hereditária: 1. III e IV. causada por um gene restrito ao sexo. 10 e 12 representam indivíduos que. IV . e os indicados em branco não a apresentam.1. Questão 578 Responder à questão com base no heredograma a seguir.4 1.É uma doença de caráter dominante autossômica. na fase adulta.4 129 . com certeza. e) Apenas uma das afirmações. II . os indivíduos afetados por DH estão indicados em negro. Questão 579 A Doença de Huntington (DH) é uma anomalia autossômica com caráter dominante cuja manifestação ocorre na fase adulta. causada por um gene recessivo ligado ao sexo. xamine as afirmações: I . III e IV. c) a hemofilia.As pessoas 1 e 2 são heterozigotas. No heredograma a seguir. II e III. d) Apenas II.Se houver casamento consangüíneo entre 9 e 11. III . é correto concluir que tal característica é a) a calvície. causada por um gene autossômico dominante.

d) tem dedos normais e é heterozigoto.V . de cima para baixo. e) pode ser ou não braquidáctilo e é homozigoto. b) é braquidáctilo e heterozigoto.V .5. ( ) Os indivíduos II-2 e II-4 são heterozigotos.V . que é determinado por um par de genes: 130 .V e) V .V . 4.1. I-2.4 1.1. Já as pessoas indicadas pelos números 3 e 6 têm fenótipo normal. Questão 582 Na genealogia a seguir. os indivíduos 1.F . A seqüência correta de preenchimento dos parênteses.F . c) tem dedos normais e é homozigoto. ( ) Os indivíduos III-1. pode-se afirmar que o indivíduo 6: a) é braquidáctilo e homozigoto.1. ( ) Os indivíduos II-1 e II-3 são heterozigotos. III-2. 3. 1.4 Questão 581 Analise a genealogia a seguir. ( ) Os indivíduos I-1.V .F .V b) F . 5 e 7 apresentam uma anomalia condicionada por gene autossômico dominante.4 essa família.s afirmativas abaixo referem-se aos possíveis genótipos dos indivíduos indicados no heredograma.V Questão 580 Qual dos heredogramas a seguir ilustra uma condição biologicamente IMPOSSÍVEL? 1. V para as verdadeiras e F para as falsas. é a) F . 4 e 7 são braquidáctilos. Assinale.5.F . Considerando essas informações e desprezando a possibilidade de ocorrência de mutação.F c) V . onde foi estudado o caráter BRAQUIDACTILIA (dedos curtos).5. enquanto os indivíduos 5 e 8 apresentam dedos normais. nos parênteses. 2. III-3 e III-4 são homozigotos.F d) V .F . as pessoas indicadas pelos números 1. II-1 e II-3 são homozigotos. 2.

5. 1.1.4 probabilidade do casal 3×4 ter o primeiro filho homem e que venha a ser calvo. c) a pessoa indicada pelo número 3 transmitiu o gene recessivo para seu descendente indicado pelo número 7.4 esse heredograma NÃO se pode determinar o genótipo do indivíduo a) 1 b) 3 c) 5 d) 6 e) 7 Questão 585 1. d) não há possibilidade de a pessoa indicada pelo número 5 ser heterozigótica. e) o casal indicado pelos números 6 e 7 não poderá ter descendentes com fenótipo normal.Após a análise da genealogia.4 No heredograma abaixo.5. Questão 583 A calvície é uma característica influenciada pelo sexo e o gene que a condiciona se comporta como recessivo no sexo feminino e dominante no sexo masculino. é: a) 1/2 b) 1/4 c) 1/8 d) 1/6 Questão 584 O heredograma a seguir representa a herança de um par de genes entre os quais há dominância. b) a pessoa indicada pelo número 4 é homozigótica. 131 . pode-se concluir que: a) apenas as pessoas indicadas pelos números 1 e 2 são heterozigóticas.1. os símbolos escuros representam indivíduos que possuem uma anomalia. Observe a genealogia a seguir. 1.1.5. relativa a essa característica. Os símbolos escuros representam indivíduos que exibem a característica recessiva.

Todos os indivíduos que apresentam a anomalia são homozigóticos.1. a criança II-1 tem fibrose cística. b) a anomalia é condicionada por um gene recessivo.5.1. A anomalia é condicionada por um alelo dominante. e) todos os indivíduos normais são homozigotos dominantes ou heterozigotos.4 Questão 587 O heredograma mostra a incidência de uma anomalia genética em grupo familiar. podemos afirmar: a) todos os indivíduos normais são homozigotos recessivos. d) todos os indivíduos normais são homozigotos dominantes. 132 . a linhagem pôde ser reestabelecida por meio do acasalamento descrito a seguir: 1. 1/4 e) 1/2.4 1. uma doença causada por um alelo recessivo autossômico. Questão 588 Foi estabelecida uma linhagem de camundongos nocaute esses animais se caracterizam por não expressar um determinado gene.1. 1/4 b) 1/4. É correto o que se afirma APENAS em a) I b) II c) III d) I e II e) II e III Questão 586 No heredograma adiante.5. Após uma infecção em que apenas uma fêmea nocaute sobreviveu.onsidere as seguintes afirmativas sobre esse heredograma: I. respectivamente: a) zero.4 pós a análise deste heredograma. 1/2 c) 1/4.5. II. As probabilidades de que sua irmã (II-2) não afetada seja carreadora ou não carreadora da fibrose cística são. III. 1/4 d) 1/2. 2/2 1. c) a anomalia ocorre apenas em homozigotos dominantes. O único indivíduo que não pode ter o seu genótipo definido é o I-4.

II-5 e III-1 podem ser homozigotos dominantes.4 m relação à característica representada no heredograma. d) Os filhos homens de I. Para chegar a tal conclusão. 133 . d) as mulheres afetadas apresentam fenótipos idênticos aos de suas mães. b) a ocorrência da característica nessa família se deve aos casamentos consangüíneos.2 seriam normais. se a herança fosse recessiva ligada ao X.1. d) I-1 e I-2 podem ser heterozigotos. se a herança fosse ligada ao Y.3 tem filha normal.2 não possui pais afetados. e) A herança do caráter nocaute é autossômica dominante. c) O acasalamento do macho 3 com a fêmea 5 produzirá maior número de camundongos nocaute do que o acasalamento desse macho com a fêmea 4. na família representada. b) A herança pode ser ligada ao sexo. Questão 589 Analise o heredograma que representa a herança de um tipo de disfunção dos músculos esquelético e cardíaco em seres humanos.5. EXCETO a) O indivíduo I.5 também seria afetado. c) a probabilidade de mulheres descendentes de IV-1 serem afetadas é zero. portanto a herança não deve ser autossômica dominante. d) O cruzamento do macho 2 com uma das fêmeas de F originará camundongos dos quais 75% serão heterozigotos. EXCETO a) A herança pode ser autossômica. é correto afirmar-se que a) a herança para esse tipo de característica é recessiva e ligada ao sexo.5. todas as alternativas são possíveis. Questão 591 1. e) o casamento de III-4 com indivíduo de fenótipo igual a II-4 tem como resultado esperado 100% de mulheres afetadas.ode-se afirmar que: a) Por meio do acasalamento do macho 3 com a fêmea nocaute. c) O indivíduo III.5. essa estudante considerou todas as seguintes hipóteses. b) Em F‚. 75% do filhotes nascerão normais.4 Com relação ao heredograma.1. b) O indivíduo II. 1. e) II-2. c) A herança pode representar uma família de hemofílicos.4 Observe este heredograma: 1. pós analisar esse heredograma. Questão 590 Analise o heredograma.1. 50% dos filhotes são animais com o genótipo heterozigoto. uma estudante concluiu que a característica transmitida. é autossômica recessiva. por isso é improvável uma herança dominante ligada ao X.

cuja avó materna e avô paterno eram albinos.3 nascer incapaz de sentir o gosto do PTC é de 50%.4 Um geneticista estabeleceu o heredograma para uma determinada doença hereditária. ( ) um modelo de herança idêntico ao da cegueira para cores. d) os indivíduos I. em todas as gerações.5. não sentir qualquer sabor. om base nesse heredograma e em outros conhecimentos sobre o assunto.1 x II.1. b) a ocorrência do tumor é uma característica autossômica. mesmo. são homozigotos.1).4 Esse diagrama representa: ( ) o modelo de herança recessiva ligada ao cromossomo X. de pai para filha e mãe para filha. que representa uma família em que há indivíduos afetados por um tipo de tumor de gengiva: 1. é representado abaixo. conhecida como daltonismo. Observe este heredograma para a capacidade de sentir o gosto dessa substância: onsiderando-se as informações desse heredograma e outros conhecimentos sobre o assunto.Questão 592 As pessoas podem detectar a substância química feniltiocarbamida . típica daquelas não vinculadas aos cromossomos X e Y. d) a probabilidade de o indivíduo III. ( ) o modelo de herança autossômica recessiva. mostrando-os indivíduos afetados.PTC . c) o próximo filho do casal II. cujo diagrama. Questão 595 Renata (III. c) o risco de III. deseja saber qual a probabilidade de ela não ser portadora deste alelo. é INCORRETO afirmar que a) os indivíduos normais. b) o loco do gene em estudo está situado em um cromossomo autossômico.1. ( ) a característica passada de geração a geração. ( ) um modelo de herança idêntico ao do albinismo.1 e II. preocupada com a possibilidade de transmitir o alelo para o albinismo a seus filhos.5.5.2 ser heterozigoto é de dois terços.4 .2 será normal.1 são heterozigotos. a) 0 b) 1/4 c) 3/4 134 1.como um gosto amargo ou. Questão 594 1. é INCORRETO afirmar que a) o alelo para a capacidade de sentir o gosto do PTC é dominante. Questão 593 Analise este heredograma. Assinale a alternativa que responde ao questionamento de Renata.1.

(04) Trata-se de gene localizado no cromossomo X.1.5. pois a característica é dominante. c) Os indivíduos III-1 e III-2 são heterozigotos.d) 1/3 e) 1 1. (16) Trata-se de gene autossômico.4 1. pois os indivíduos II-3 e II-4 tiveram crianças anormais. Analise-o e assinale a alternativa correta. II:1 e II:5 são heterozigotos.5. b) Todos os indivíduos não afetados são heterozigotos.4 Analisando essa genealogia. Questão 597 Considerando o heredograma abaixo.1. b) O fenótipo anormal é recessivo. (64) Trata-se de Herança Holândrica.5. pois dão origem a indivíduos anormais. a) Os indivíduos II-3 e II-4 são homozigotos.1. d) Apenas os indivíduos I:1. pois são afetados pelo fenótipo anormal.1. d) Todos os indivíduos afetados são heterozigotos. 135 . (01) A anomalia é causada por gene provavelmente recessivo. e) Apenas os indivíduos I:1 e I:2 são homozigotos. onde os indivíduos afetados pela síndrome unha-rótula (deformação nas unhas e nas rótulas) aparecem em preto. Soma ( ) 1.4 Questão 596 O heredograma adiante representa a herança de um fenótipo anormal na espécie humana. (32) Trata-se de Herança Intermediária.5. os indivíduos assinalados com preto apresentam uma anomalia determinada por um gene dominante. (02) A anomalia é causada por gene provavelmente dominante. (08) Trata-se de gene localizado no cromossomo Y. é correto afirmar: a) Todos os indivíduos afetados são homozigotos.4 Questão 598 Na genealogia a seguir. c) Apenas o indivíduo I:1 é heterozigoto. é correto afirmar: 1. e) Os indivíduos I-1 e I-4 são homozigotos.

5. Questão 600 Na genealogia a seguir. II .1.1.1 e III . quem poderá ser afetado pela doença? a) Apenas III .4 forem homozigotos normais.5. (32) II .4. II .4.3 podem ser homozigotos. Considerando o heredograma apresentado inicialmente os indivíduos I . os indivíduos que manifestam uma determinada doença hereditária são mostrados em preto. são indivíduos afetados pela característica que está sendo estudada.2 e I .3.3.1 e II . 4 e 5.1 e II .1 é neto(a) de I . enquanto II . II .1 é mais jovem do que II .1. Com base na análise da mesma.3 não o são. c) Apenas II .Questão 599 A figura a seguir apresenta uma genealogia hipotética. d) II . (32) A doença só se manifesta nas mulheres. 3. um homem e uma mulher. II . e) II . Questão 601 Com relação a essa figura é CORRETO afirmar que: (01) Os indivíduos II . 1. b) Apenas II . Questão 602 Os heredogramas a seguir apresentam o padrão de herança de um mesmo caráter em cinco diferentes famílias.4 136 . III .4 A anemia falciforme é causada pela presença de uma hemoglobina anormal. respectivamente. 1. (08) Do casamento consangüíneo.3 e II .3.2. por exemplo.1 e I .1 e I .3 não tem nenhuma relação genética com I . Os símbolos cheios indicam que o indivíduo é portador do caráter.5. (64) Com exceção de II . (08) III . os homens.3 e II .5.5.2.2 é sobrinho(a) de II .2. os demais indivíduos da segunda geração são irmãos. Essa doença é herdada como autossômica recessiva.2.4 representam. 2. (16) II .1.1.2. apresentado na genealogia.3 e III .2.1 e III .3% de possibilidade de nascer um descendente com a doença. identificadas por 1. assinale a(s) proposição(ões) CORRETA(S). (04) Os indivíduos I .1 e III . (02) Os indivíduos I . existe 33.3 e III . Os círculos representam as mulheres e os quadrados.4 têm 50% de probabilidade de terem um descendente portador da doença.3 forem heterozigotos e os indivíduos I . (16) III . (02) O padrão da herança desta doença é autossômico dominante.4 (01) Na genealogia estão representadas 2 gerações. 1.2 e II . portanto está ligada ao cromossomo X. (04) III .1.

5.4 A partir da análise da ocorrência da doença entre os indivíduos nascidos dos diferentes cruzamentos. II e III. Trata-se de uma doença autossômica recessiva. Não há nenhuma possibilidade de que um filhote nascido do cruzamento entre os indivíduos II-5 e II-6 apresente a doença. Os indivíduos I-1 e I-3 são obrigatoriamente homozigotos dominantes. d) I e IV. c) I. d) A família 4 permite concluir que se trata de um caráter recessivo.1. 137 1. porque o casal já tem três filhos com visão normal. ligado ao cromossomo X.5. porque a mulher tanto pode ser homozigota como heterozigota. 1. III. e) A família 5 mostra que o caráter não pode ser controlado por gene ligado ao cromossomo X. apenas. porque a mulher tem o gene dominante em homozigose. Questão 604 upondo que não haja mutação. c) A família 3 permite concluir que se trata de um caráter recessivo. porque o gene para a miopia é recessivo. O indivíduo III-1 só deve ser cruzado com o indivíduo II-5. apenas. observado a partir de cruzamentos controlados realizados em cativeiro.4 A probabilidade do casal I x II ter uma criança míope é a) imprevisível. c) 1/2. b) A família 2 permite concluir que se trata de um caráter autossômico recessivo. Questão 603 O esquema mostra a genealogia de uma família. apenas. e os claros os indivíduos de visão normal. apenas.5. e) 1/4. I. Os símbolos escuros representam os indivíduos míopes.1. apenas. IV. e) III e IV. b) II e III.1. porque 50% dos gametas da mulher transportam o gene recessivo.1. b) nula. analise os heredogramas e assinale a alternativa correta. foram feitas as afirmações seguintes. ligado ao cromossomo Y. a) A família l permite concluir que se trata de um caráter dominante ligado ao cromossomo X. II. O diagrama representa o padrão de herança de uma doença genética que afeta uma determinada espécie de animal silvestre.4 . d) 1/4. uma vez que são nulas as possibilidades de que desse cruzamento resulte um filhote que apresente a doença. É verdadeiro o que se afirma em a) I.

4 é aa. o indivíduo afetado tem pelo menos um pai afetado b) homens e mulheres afetados é aproximadamente igual. a característica deixa de aparecer em várias gerações. os principais critérios para a identificação de um gene recessivo autossômico são aqueles em que o número de: a) homens afetados é diferente do número de mulheres afetadas. os aquirópodos estão representados por símbolos hachurados.Questão 605 Na espécie humana há um tipo de doença hereditária muito rara denominada Aquiropodia.5. assinale a afirmativa INCORRETA.II.2 vir a ter uma criança com mucoviscidose? a) 1/8 b) 1/4 c) 1/3 d) 1/2 e) 2/3 Questão 607 Para analisar heredogramas de famílias de seres humanos. No heredograma a seguir. b) Pode-se assumir que os indivíduos II. Os pulmões das pessoas afetadas apresentam um muco espesso que promove infecções bacterianas.1 . como é o caso dos indivíduos II.1 e II. o indivíduo afetado tem pais afetados Questão 608 O popular "Teste-do-pezinho" feito em recém-nascidos pode detectar a doença fenilcetonúria. e) O genótipo dos indivíduos IV.5. a característica deve aparecer em todas as gerações. cerca de 25% da prole de pais portadores do gene deve apresentar a característica d) homens e mulheres afetados é aproximadamente igual.4 1. já que a condição herdada em análise é muito rara.1. 1. que representa a árvore genealógica de uma família onde alguns indivíduos são afetados pela doença. Observe e analise o esquema a seguir.1. cerca de 75% da prole de pais portadores do gene deve apresentar a característica e) homens afetados é maior do que o de mulheres afetadas.3 e III. c) Não é possível ter certeza sobre o genótipo de alguns indivíduos.2 e IV. d) Os pais dos aquirópodos são primos. .5 possuem o genótipo AA. os indivíduos afetados têm geralmente pais normais.5. Questão 606 A mucoviscidose é uma doença genética grave que associa problemas digestivos e respiratórios. que é determinada por um par de genes. a característica deve aparecer em todas as gerações. os indivíduos afetados têm geralmente pais normais.4 ual a probabilidade de o casal II. Tal doença deve-se à presença de uma enzima defeituosa que não metaboliza 138 om base na análise do heredograma. o indivíduo afetado tem pelo menos um pai afetado c) homens e mulheres afetados é aproximadamente igual. a) Pode-se dizer que a Aquiropodia é condicionada por um alelo recessivo a.

25% d) B e 8. Supondo que todas sofram metamorfose. c) 180. determine o cruzamento que permite diagnosticar a recessividade do gene que condiciona a fenilcetonúria e a probabilidade de nascer uma menina afetada a partir do cruzamento 12 X 18. Questão 610 Um casal. Considere um casal normal que teve 6 crianças todas normais. podemos afirmar com certeza que a probabilidade de um novo filho vir a ser albino (sem considerar o sexo). tem uma filha também polidáctila e um filho normal. os indivíduos que apresentam fenilcetonúria estão em negro. Em certa comunidade européia. d) 2/5. a) C e 50% b) C e 25% c) B e 6. qual o número esperado de casamentos com risco de gerar crianças fenilcetonúricas? a) 2. Esse casal tem __________ de probabilidade de ter um descendente do sexo masculino e portador da disfunção genética mencionada. c) 16. o número esperado de indivíduos de asa curta é de: a) 480. Sabendo-se que o avô paterno e a avó materna das crianças eram albinos. o caráter asa vestigial é recessivo em relação ao caráter asa longa. Questão 612 Estudos genéticos permitiram verificar que um casal tem 1/4 de probabilidade de ter um descendente com uma determinada anomalia. d) 40. Um macho puro de asa longa é cruzado com uma fêmea de asa curta.4 Questão 609 A fenilcetonúria é uma doença com herança autossômica recessiva. cuja ingestão provoca retardamento mental. a) 2/3. será: a) 0% b) 25% c) 50% d) 75% e) 100% 1.25% e) C e 75% d) 1/12 e) 2/3 Questão 611 Em drosófilas. c) 1/8. e) 80. uma em cada 20 pessoas com fenótipo normal é heterozigótica quanto ao gene que determina a fenilcetonúria.corretamente o aminoácido fenilalanina. b) 8. A probabilidade de o casal vir a ter uma filha normal é de: a) 1/4 b) 1/6 c) 1/8 139 . d) 360.1. Questão 613 Sabe-se que o albinismo é determinado pela ação de um gene recessivo autossômico. Um indivíduo de F1 é retrocruzado com a fêmea parental e se obtém 480 larvas. Sabendo-se que a determinação do caráter se deve apenas a um par de genes autossômicos. e) 240. Na genealogia a seguir. b) 3/9.5. b) 120. e) 1/25. em que ambos são polidáctilos. Em 800 casamentos ocorridos entre membros sadios dessa comunidade.

Questão 615 A anemia falciforme é uma doença hemolítica grave cujas manifestações clínicas incluem anemia. a detecção de portadores de anemia falciforme está sendo incluída.Questão 614 Admita que uma determinada doença neurodegenerativa que provoca convulsões e leve à morte em pouco mais de 10 meses seja determinada por um gene dominante. obstrução vascular e infartos dolorosos em vários órgãos como os ossos. Um homem canhoto e sensível ao PTC. mas consulta um geneticista porque o homem tem uma irmã com fenilcetonúria. flores vermelhas são condicionadas por um gene dominante e flores brancas por seu alelo recessivo. a habilidade para o uso da mão direita é condicionada pelo gene dominante E . e a mulher tem um irmão com esta mesma doença. já que cada um dos cônjuges tem um irmão com anemia falciforme. Um casal normal que pretende ter um filho consulta um geneticista. e a insensibilidade a essa substância é devida a seu alelo recessivo i . Questão 618 Na espécie humana. casa-se com uma mulher destra. b) 25%.5 e um casal com 35 anos tiver um filho. cujo pai era insensível. podendo ser fatal se não tratada no início da infância. antes de realizar qualquer exame. qual a resposta correta que daria à pergunta sobre a probabilidade de nascimento de uma criança com este tipo de anemia? a) 1/2 b) 1/4 c) 1/8 d) 1/9 e) 1/16 . e) 100%. e) 4/9. 140 1. d) 75%. sendo a habilidade para o uso da mão esquerda devida a seu alelo recessivo e . Um casal decide ter um filho. Se você fosse o geneticista. d) 180. Esses dois pares de alelos localizam-se em cromossomos diferentes. c) 1/9. O seu padrão de herança é autossômico recessivo. e é causada por um alelo recessivo por herança Mendeliana simples. Desses. d) 2/3. A sensibilidade à feniltiocarbamida (PTC) é condicionada pelo gene dominante I. espera-se que o número de plantas com flores vermelhas e folhas curtas seja a) 20.5. que está presente nas proteínas da dieta humana. Devido a sua importância. Não há outros casos conhecidos nas famílias. icterícia. c) 160. b) 60. o baço e os pulmões.1. sensível. cuja mãe era canhota e insensível. no teste do pezinho. A probabilidade de sua primeira criança ter fenilcetonúria é de: a) 1/2. e) 320. Esses dois pares de alelos apresentam segregação independente. Essa doença manifesta-se tardiamente como representado no gráfico a seguir: Questão 616 Fenilcetonúria é uma doença hereditária humana resultante da inabilidade do organismo de processar o aminoácido fenilalanina. folhas longas são condicionadas por um gene dominante e folhas curtas por seu alelo recessivo. a chance de a criança vir a manifestar a doença corresponde a a) 0 %. no Rio Grande do Sul. Do cruzamento entre plantas heterozigóticas para os dois caracteres resultaram 320 descendentes. b) 1/4. Questão 617 Em determinada planta. c) 50%.

c) 1/4. verdes-rugosas = 300. d) amarelas-lisas = 300. O gene que determina plantas de altura normal (H) é dominante sobre o gene que determina plantas anãs (h).5% d) 25% e) 12. aacc. nasceram duas crianças. verdes-rugosas=100. verdes-rugosas=50. b) 3/8. AaCc. verdes-lisas = 320. Qual o genótipo dos pais da criança? a) aacc.A probabilidade de esse casal vir a ter uma criança canhota e sensível ao PTC é de a) 3/4. cuja mãe é albina. b) amarelas-lisas = 100. aacc. verdes-lisas = 200. d) aaCC. d) 100% de plantas anãs com vagens lisas. espera-se obter na descendência: a) 50% de plantas anãs com vagens lisas e 50% de plantas de altura normal com vagens com constrições. AaCc. amarelas-rugosas = 150. amarelas-rugosas = 300. e) aacc. verdes-lisas = 150. Questão 623 Observe o heredograma a seguir: 1. AaCc. AaCc. d) 3/16. Questão 621 Em ervilha. b) Aacc. Questão 619 Do casamento entre uma mulher albina com cabelos crespos e um homem normal com cabelos crespos. amarelas-rugosas = 320. verdes-rugosas = 200. e) amarelas-lisas = 450. aacc. uma com cabelos crespos e outra com cabelos lisos. amarelas-rugosas = 100. c) AaCC. c) 100% de plantas de altura normal com vagens com constrições. b) 100% de plantas anãs com vagens com constrições. verdes-rugosas = 80.2. Questão 622 Um homem albino e de olhos claros casa-se com uma mulher de pele normal e de olhos escuros. verdes-lisas = 100.5. A probabilidade de que uma terceira criança seja albina com cabelos crespos é: a) 75% b) 50% c) 37. Aacc.5% Questão 620 O cruzamento entre duas linhagens de ervilhas. amarelas-rugosas = 200. Cruzando-se plantas CCHH com plantas CcHh. uma com sementes amarelas e lisas (VvRr) e outra com sementes amarelas e rugosas (Vvrr). e) 1/8. nasce uma criança albina e de olhos claros. Deste casal. originou 800 indivíduos. verdes-lisas = 300.1 141 . o gene que determina a forma lisa da vagem (C) é dominante sobre o gene que determina vagens com constrições (c). e) 100% de plantas de altura normal com vagens lisas. AACC. AaCC. c) amarelas-lisas = 200. Quantos indivíduos devem ser esperados para cada um dos fenótipos obtidos? a) amarelas-lisas = 80.

a) zero b) 75% c) 50% d) 12. tem uma criança normal para polidactilia. Considerando-se que ambas as anomalias são autossômicas e os respectivos genes estão em cromossomos . b) se somente as afirmativas I e III forem corretas.Os indivíduos 2 e 4 têm o mesmo genótipo. Assinale: a) se todas as afirmativas forem corretas. analise a genealogia a seguir e responda. ambos polidáctilos (com mais de 5 dedos) e de visão normal.5. II . a probabilidade do casal ter outra criança normal para as duas características é: a) 1 b) 1/16 c) 3/16 d) 9/16 e) 0 Questão 626 A fenilcetonúria e a miopia são doenças decorrentes da ação de genes autossômicos recessivos. nasceu uma criança de visão normal e fenilcetonúrica. Considerando uma planta de sementes lisas e amarelas. com um homem normal para fenilcetonúria e míope. diíbrida.1 A probabilidade do casal 4 x 5 ter uma criança diíbrida é: a) 1/8 b) 3/16 c) 1/16 d) 1/4 e) 1/2 Questão 625 Um casal. os genes que determinam sementes lisas e amarelas são dominantes em relação aos genes que determinam sementes rugosas e verdes. assinale a alternativa que apresenta a porcentagem de gametas produzidos por essa planta com pelo menos um gene dominante. III . então. considere as seguintes afirmações: I . terão 25% de chance de ter uma filha canhota e de visão normal. Questão 624 Sabendo-se que a miopia e o uso da mão esquerda são condicionados por genes recessivos. c) se somente as afirmativas II e III forem corretas. Do casamento entre uma mulher normal.2.O indivíduo 5 é heterozigoto para o gene do uso da mão esquerda e o indivíduo 6 é heterozigoto para o gene da miopia. A probabilidade desse casal ter uma criança normal para as duas características é: a) 1/8 b) 1/2 c) 3/8 d) 7/8 e) 3/4 Questão 627 Em ervilhas.5% e) 25% Questão 628 Qual é a probabilidade de um casal de duplo heterozigotos para dois pares de genes autossômicos com segregação independente vir a ter um descendente com apenas uma característica dominante? a) 15/16 b) 9/16 c) 6/16 d) 3/16 142 1.Sabendo-se que a miopia e o uso da mão esquerda são condicionados por genes recessivos. d) se somente as afirmativas I e II forem corretas. e) se somente a afirmativa II for correta. diferentes.Se o indivíduo 3 se casar com um homem de visão normal (heterozigoto) e canhoto. mas míope. filha de mãe com fenilcetonúria e pai míope.

Os indivíduos homozigotos dd ou ee são surdos.(mmBb). II . um gene D e um E. os indivíduos com audição normal possuem.(Mmbb). II .e) 1/16 Questão 629 Considere que em cavalos a coloração do pêlo resulta da ação de dois pares de genes autossômicos localizados em cromossomos não homólogos.(mmBb).(MmBb) Questão 630 Considere que a surdez no homem esteja relacionada a dois pares de genes (Dd . III . a alternativa que contém os genótipos dos indivíduos mencionados. na proporção de 9:3:3:1. é cruzado com uma fêmea marrom com manchas brancas (III). Um macho preto com manchas brancas (I).(mmbb). II . na qual promoveu autofecundação.(Mmbb). III . III . III .(mmBb) e) I . O gene M condiciona cor preta e seu alelo m.(Mmbb) c) I . determinados por genes que se segregavam independentemente. Cruzando dois indivíduos homozigotos. IV .Ee) localizados em cromossomos não homólogos. Dois pares de genes (Vv e Aa) determinam essa característica: plantas V_A_ produzem flores vermelhas e plantas V_aa.(mmbb). cujo pai era marrom uniforme (II).(MmBb).(mmbb). a seguir. Na descendência do cruzamento VvAa x VvAa espera-se encontrar uma proporção fenotípica de a) 1 vermelha: 1 amarela b) 9 amarelas: 7 vermelhas c) 9 vermelhas: 7 amarelas d) 15 amarelas: 1 vermelha e) 15 vermelhas: 1 amarela Questão 632 O esquema abaixo representa o núcleo de uma célula de um organismo com 2n=4 cromossomos.2. Quantos caracteres esse pesquisador estudava? a) 1 b) 2 c) 3 d) 4 e) 5 Questão 634 Assinale a alternativa que indica os genótipos dos pais que têm ou poderão ter filhos nas seguintes proporções ou percentuais: 143 .(Mmbb).5.(Mmbb).(mmBb). ele obteve a primeira linhagem. Assinale.(MmBb) d) I . vvA_ ou vvaa. sendo um dominante e outro recessivo.(mmBb). III .(MMbb). Os alelos de cinco genes estão indicados por letras. IV . II . manchas brancas em qualquer cor de pelagem. cuja mãe era preta uniforme (IV). IV . IV .1 os pares de alelos abaixo aplica-se a segunda lei de Mendel SOMENTE a a) Aa e Mm b) Aa e Dd c) Aa e Nn d) Bb e Nn e) Dd e Mm Questão 633 Um pesquisador averiguava a transmissão de caracteres em vegetais ao longo de gerações. Qual é a probabilidade de um casal DdEE × ddEe vir a ter uma criança com surdez? a) 0% b) 25% c) 50% d) 75% e) 100% Questão 631 As flores de uma determinada planta podem ser vermelhas ou amarelas.(MmBb). obteve quatro tipos de fenótipos. cor marrom. o gene B determina coloração uniforme e seu alelo b. IV . 1. pelo menos.(mmBb). II . a) I .(mmbb) b) I . flores amarelas. Como resultado.

144 1. e) Maria produzirá gametas de 4 tipos diferentes para essas características.25% de filhos canhotos.1 probabilidade de o casal 5x6 ter um descendente simultaneamente braquidáctilo e prognata é de a) 1/16 b) 3/16 c) 9/16 d) 3/4 e) 1/4 .25% de filhos com olhos azuis. d) o zigoto tenha constituição AB ou ab. c) o endosperma.A. obrigatoriamente. podendo ser destros ou canhotos. enquanto 2 e 4 têm dedos e mandíbula normais. a e B.C gen para olhos azuis . d) A mãe de Maria é.. . Considere este caso: Antônio. b) Não existe qualqueir chance de nascer um filho polidáctilo dessa relação. c) Antônio poderá produzir 2 tipos de gametas diferentes para essas características.5. Questão 637 Em humanos a polidactilia é condicionada por um gene dominante. Suponha que um exemplar da planta produza todos os esporos femininos com constituição genética AB e todos os esporos masculinos com constituição ab. espera-se que a) um dos núcleos gaméticos do tubo polínico tenha constituição a e o outro constituição b. o albinismo é condicionado por um gene recessivo. porém albino. . a) Todos os filhos desse casal deverão ser albinos. um homem com pés e mãos normais.D gen para mão canhota . . 5 e 6 são braquidáctilas e prognatas. A partir das informações anteriores. b) a oosfera (gameta feminino) tenha constituição AB ou ab. Dados: gen para olhos castanhos . assinale a alternativa CORRETA. polidáctila a e filha de um homem homozigoto e normal para os dois caracteres e de uma mulher albina e polidáctila. Ambos os locos citados são autossômicos. mulher normal para o albinismo.com segregação independente.c gen para mão destra . sendo triplóide.d a) CCDD e CCDD b) ccdd e ccdd c) CCdd e ccDD d) CcDd e CcDd e) CcDd e ccdd Questão 635 Foram analisadas. sendo que o alelo dominante produz em seus portadores pigmentação normal. 3. e) o embrião tenha constituição AaBb. podendo ter olhos castanhos ou azuis. As pessoas indicadas pelos números 1.2. Por sua vez. tenha constituição AaB ou Aab. podendo ter olhos castanhos ou azuis. duas características autossômicas dominantes com segregação independente: BRAQUIDACTILIA (dedos curtos) e PROGNATISMO MANDIBULAR (projeção da mandíbula para frente). Como. homozigota para as duas características. podendo ser destros ou canhotos.75% de filhos destros. os esporos dão origem à geração gametofítica. Questão 636 Em uma planta com autopolinização são estudados dois pares de genes .75% de filhos com olhos castanhos. por meio do processo de mitose. b . em uma família. sendo os indivíduos homozigotos recessivos portadores de pés e mãos normais (com 5 dedos cada). casa-se com Maria.

está representada a herança de duas características determinadas por genes autossômicos. 8. a probabilidade de ocorrência na F de indivíduos com o mesmo genótipo dos pais.5. 2. Uma ave branca com patas com plumas. 9 e 15 e) 1. espera-se que a proporção de aves homozigotas para os dois pares de genes seja de a) 9/16 b) 6/16 c) 4/16 145 1. 4 e 13 Questão 641 Em coelhos. foi cruzada com uma colorida com patas sem plumas. 12 e 15 d) 3. d) 1 preto: 3 albinos. 9. 2. é: a) zero b) 1/2 c) 1/4 d) 1/8 Questão 639 Na genealogia a seguir. Esses pares de genes são autossômicos e segregam-se independentemente. 13 e 14 b) 5. 4. 9. 14 e 16 c) 5. 3. 2. 8. Os animais aa são sempre albinos.2.1 uais são os indivíduos obrigatoriamente heterozigotos para as duas características? a) 6. o gene P produz pelagem preta e o seu alelo recessivo p. 10. e) 1 pardo: 3 albinos. uais são os indivíduos que seguramente produzem um só tipo de gameta? a) 6.2. patas sem plumas. Se os decendentes obtidos forem cruzados entre si. 4. 15 e 16 e) 1. Considerando que ocorra segregação independente entre esses genes. . 7. 12 e 15 c) 1. pelagem parda desde que esteja presente o gene A. o gene P determina patas com plumas e o seu alelo recessivo. 8. 9. 11. c) 1 preto: 1 albino. homozigota para os dois pares de genes. 9.Questão 638 Do cruzamento entre dois indivíduos portadores do genótipo CcDd. Questão 642 Numa ave doméstica. 9.1 1.5. 10. 13 e 15 Questão 640 Na genealogia a seguir. plumagem colorida. o gene C condiciona plumagem branca e o seu alelo recessivo. b) 1 preto: 1 pardo. 11. 8. está representada a herança de duas características determinadas por genes autossômicos. 3. 7. 14. 7. a partir do cruzamento PpAa x ppaa espera-se uma proporção fenotípica de a) 1 preto: 1 pardo: 2 albinos. 13 e 14 b) 6. 4. 3. 7 e 13 d) 6.

2% b) 18. O mesmo ocorre para os caracteres orelhas eretas ou orelhas caídas. Os azuis carecem de pigmento amarelo. pelo alelo recessivo.7% Questão 647 Em tomateiros. Considere o cruzamento entre um casal de cães heterozigotos para ambos os pares de alelos. cujo pai era míope. enquanto não latir durante a corrida e possuir orelhas caídas são recessivas.d) 3/16 e) 1/16 Questão 643 No homem. respectivamente. aproximadamente. Esses genes estão localizados em cromossomos que se segregam independentemente. A probabilidade deste casal ter uma criança com polidactilia e miopia é a) 0% b) 25% c) 50% d) 75% e) 100% Questão 644 No cruzamento entre indivíduos heterozigotos para dois pares de genes que se segregam independentemente. existem quatro variedades: verdes. geram-se papagaios verdes na primeira geração (F1). uma anomalia recessiva. Uma mulher com polidactilia e miopia. espera-se que a proporção de descendentes heterozigotos para apenas um par de genes seja a) 9/16 b) 1/2 c) 1/4 d) 3/16 e) 1/16 Questão 645 Plantas de genótipo AaBb foram intercruzadas. foram obtidos 480 descendentes. Sabendo-se que os alelos representados por letras maiúsculas são dominantes e que os não-alelos sofrem segregação independente. Os papagaios verdes são os únicos normalmente encontrados na natureza. os números de genótipos e de fenótipos diferentes entre os descendentes desses cruzamentos são. Considerando-se que os genes para a melanina e o 146 . azuis.2% d) 43. e os brancos não têm nem melanina azul nem pigmento amarelo nas penas.7% c) 31. pelo alelo recessivo. O cruzamento da F1 gera os quatro tipos de cores na F2. os amarelos carecem de grânulos de melanina. a) 3 e 2 b) 6 e 3 c) 9 e 4 d) 12 e 8 e) 16 e 9 Questão 646 Em cães. a polidactilia é um caráter dominante e a miopia. amarelos e brancos. a probabilidade de que nasçam filhotes que latem enquanto correm e que possuem orelhas caídas é. Dentre esses. Através do intercruzamento de plantas duplo-heterozigóticas. é casada com um homem normal. Os genes responsáveis por essas características situam-se em autossomos e apresentam segregação independente. cuja mãe era normal para as duas características. Neste caso. a folha recortada é determinada por um alelo dominante e a lisa. o número esperado de indivíduos com hipocótilo púrpura e folhas lisas é a) 30 b) 90 c) 160 d) 240 e) 270 Questão 648 Numa dada espécie de papagaio. Latir enquanto corre e possuir orelhas eretas são características dominantes. Quando se cruzam papagaios verdes silvestres com os de cor branca. de: a) 6. latir ou não latir durante a corrida são características definidas por um par de genes alélicos. a cor do hipocótilo púrpura é condicionada por um alelo dominante e a cor verde.

1 azul. e) os genes A e B não são alelos. Um macho preto foi cruzado com fêmeas genotipicamente iguais entre si e fenotipicamente iguais a ele. 1 branco. c) 9 papagaios verdes. entre várias ninhadas. quanto às características consideradas? a) 9 b) 16 c) 30 d) 45 e) 80 Questão 652 Quando se estuda uma célula meiótica duplo-heterozigota AaBb e se diz que. 1 azul. 1 verde. 3 verdes. 2 verdes. é INCORRETO afirmar que a) as características pêlo preto e curto são dominantes. 3 azuis. 3 amarelos. e) 9 animais com pelagem preta : 7 com pelagem vermelha. Questão 650 Um criador fez cruzamentos entre porquinhos-da-índia para estudar as características: cor e tamanho do pêlo. d) os genes A e B estão em grupos de ligação separados. d) os indivíduos da geração P formam um só tipo de gameta. a cor dos pêlos pode ser branca (P_) ou preta (pp). 4 amarelos. 1 branco. b) 100% de animais com pelagem branca. b) as duas características segregam-se independentemente. d) 1 papagaio verde.pigmento amarelo se encontram em cromossomos diferentes. 64 descendentes. O cruzamento entre um touro de pelagem preta (HhBb) com uma vaca de pelagem preta (HhBb) produzirá uma prole com: a) 100% de animais com pelagem preta. O padrão uniforme é governado pelo alelo dominante que segrega independentemente no locus M. 1 branco. Questão 649 Em bovinos. por seu alelo recessivo m. c) 12 animais com pelagem branca : 1 com pelagem vermelha : 3 com pelagem preta. Questão 651 A cor preta da pelagem dos cães da raça 'Cocker Spaniel' é governada por um alelo dominante V e a cor vermelha. pois o gene para a cor é dominante. Entre as várias ninhadas foram vendidos apenas os filhotes malhados de vermelho. b) pode ocorrer recombinação entre os genes A e B. 3 amarelos. e o padrão malhado. Se porcos diíbridos são cruzados entre si e produzem. está ocorrendo segregação independente. 1 azul. quantos desses apresentarão fenótipo diferente dos pais? 147 . b) 4 papagaios amarelos. pelo seu recessivo v. c) os genes A e B que se situam em diferentes pares de homólogos distribuem-se ao acaso em diferentes gametas. e) 9 papagaios azuis. sendo que F_ condiciona casco indiviso e ff. enquanto o alelo h determina a pelagem branca. Questão 653 Em porcos. se espera que sejam fenotipicamente idênticos ao pai. Outro gene determina a pigmentação da pelagem na cor vermelha (b) ou preta (B). 4 brancos. e o tipo de casco é determinado por alelos que segregam em outro cromossomo. Quantos filhotes do total nascido das várias ninhadas. 1 amarelo. Observou os seguintes resultados: GERAÇÃO P: pêlo preto curto X pêlo marrom longo GERAÇÃO F: pêlo preto curto GERAÇÃO F‚: 81 pêlo preto curto 27 pêlo preto longo 27 pêlo marrom curto 09 pêlo marrom longo Com base nesses resultados. a freqüência esperada de cada um dos tipos de papagaio é a) 9 papagaios brancos. que eram em número de cinco. casco fendido. a pelagem colorida é determinada pelo alelo H. d) 4 animais com pelagem branca : 3 com pelagem vermelha : 9 com pelagem preta. c) os indivíduos da geração F1 são homozigotos. pois o gene para a cor é epistático. para esses genes. é INCORRETO afirmar que a) os cromossomos de origem materna e paterna que contêm esses genes podem combinar-se livremente.

na geração F2.1 148 . e) I. c) 28. II e III. c) somente I e III. foram produzidas 371 plantas com flores avermelhadas e 287 com flores brancas. d) O gene para a cor avermelhada é codominante em relação ao alelo.2. logo estão relacionadas com o comportamento cromossômico na meiose. Questão 655 As afirmativas a seguir relacionam a Genética Mendeliana à Divisão Celular. Após autofecundação das plantas F1. ao acaso.A lei da segregação independente (2 lei) está relacionada às conseqüências do arranjo. I .a) 4. se 1. deduz-se que é um padrão de herança intermediária.5. Questão 654 O esquema a seguir representa o cruzamento entre duas variedades puras de ervilha-de-cheiro ('Lathyrus odoratus') de flor branca. e) 60. Cruzando-se um macho de corpo cinza e asas vestigiais com uma fêmea de corpo ébano e asas longas (parentais P) obteve-se F que deu origem a F‚ através da autofecundação.2. c) A proporção fenotípica 9:7 é um padrão de segregação independente. d) 36. na meiose.Dois pares de genes se segregam independentemente. d) somente II e III.As 1 e 2 Leis de Mendel abordam o comportamento dos genes na formação dos gametas. b) 16. Está(ão) correta(s): a) somente I. Questão 656 A mosca-de-fruta 'Drosophila melanogaster' pode apresentar asas vestigiais ou longas e corpo cinza ou ébano. III . b) Pelos resultados.1 nalise este padrão de herança e assinale a afirmativa CORRETA: a) Trata-se de um exemplo típico da primeira Lei de Mendel. e) O exemplo é de interação gênica já que está envolvido apenas um loco. estiverem localizados em cromossomos diferentes.5. II . 1. A F1 resultante apresentou 100% das ervilhas com flores avermelhadas. b) somente I e II. de pares de cromossomos homólogos na placa metafásica. como mostra a figura a seguir.

foram feitas as afirmativas abaixo. III e IV . apenas. d) DdEe. II e IV.O gene para corpo ébano só está presente na geração P e em parte de F‚. Questão 657 Um casal de surdos teve dois filhos com audição normal. A figura a seguir mostra padrões digitais que formam figuras denominadas de arco. pelo menos. em homozigose. b) Ddee. IV e V. b) I. c) I. d) AdF e adF. Considere ainda que todos esses genes situam-se em cromossomos diferentes. e) III. a probabilidade de surgir um descendente com genótipo que apresenta. d) II.Os genes para cor do corpo e pra tipo de asa estão localizados num mesmo cromossoma. espera-se que o genótipo dos filhos seja a) ddee. relativos a esses quatro pares de genes. podem apresentar os zangões filhos dessa rainha? a) Um b) Dois c) Quatro d) Oito e) Dezesseis Questão 659 Considere um homem heterozigoto para o gene "A".: Considere um tipo de herança mendeliana. e) ADF e adf. 149 . Entre os gametas que poderão se formar encontraremos apenas a(s) combinação(ões): a) AdF. apenas. c) AaddFF. Questão 658 Uma abelha rainha tem os seguintes pares de genes alelos que segregam independentemente: AaBbDdEe. a) 1/64 b) 63/64 c) 1/32 d) 1/16 e) 1/4 Questão 662 Os dermatóglifos são padrões típicos das cristas dérmicas nos dedos e palmas das mãos. e) Dezesseis. quantos genótipos diferentes. duplo recessivo para o gene "D" e homozigoto dominante para o gene "F". e) DDee. III . apenas.Após a análise dos resultados dos cruzamentos. Sabendo-se que os zangões surgem de óvulos que se desenvolvem por partenogênese. apenas. Sabendo-se que os zangões surgem de óvulos que se desenvolvem por partenogênese. quantos genótipos diferentes.Em F‚. II . b) AADDFF. é Obs.Os genes para cor do corpo e forma das asas segregam-se independentemente durante a formação dos gametas. III e V . V . d) Oito.A probabilidade de ocorrência do mesmo genótipo dos indivíduos de F em F‚ é de 4/16. As afirmativas corretas são: a) I. I . relativos a esses cinco pares de genes podem apresentar os zangões filhos dessa rainha? a) Um. a probabilidade de ocorrência de homozigose dominante é a mesma de homozigose recessiva. b) Dois. artelhos e solas dos pés. Sabe-se que os padrões dermatóglifos são de herança multifatorial. c) Quatro. apenas. um gene dominante. alça ou verticilo. IV . II e V . c) DDEE. Questão 661 Do cruzamento de dois indivíduos com genótipo AaBbCc. Questão 660 Uma abelha rainha tem os seguintes pares de genes alelos que se segregam independentemente: AaBBccDdEE. Sabendo-se que a surdez é determinada por qualquer dos genes recessivos d ou e.

Questão 663 A análise de 4 genes autossômicos. alta. observaram-se 100% das plantas altas. A planta pode ser alta devido ao alelo "Br" e baixa devido ao alelo "br". B. abcdE. maior será a probabilidade de que eles sejam monozigóticos. respectivamente: a) 4 e 3:3:3:1:1:1 b) 8 e 27:9:9:9:3:3:3:1 c) 8 e 9:3:3:1 d) 16 e 9:3:3:1 e) 16 e 27:9:9:9:3:3:3:1 Questão 666 Considere a segunda lei de Mendel ou lei da distribuição independente e indique os gametas produzidos pelo genótipo aaBbccDdEE. c) 25%. cc. Analisando a figura. de semente rugosa e branca. Dd. um indivíduo que apresente o genótipo AaBBCcDD produzirá gametas ABCD com a freqüência de: a) 75%. ccDd. dE. foi cruzada com outra planta pura. Se as plantas da geração F forem intercruzadas. aBcdE. d. d) aaBb.2 Sobre esse assunto. aaEE. o número de gametas produzidos pelas plantas F e a proporção fenotípica esperada na geração F‚ será.5. bc. com o genótipo AaBBCCDDEE. e) aB. a textura da semente pode ser lisa devido ao alelo "Su" e rugosa devido ao alelo "su". E. cD. Para estes 4 genes. Questão 667 Um organismo diplóide. de semente lisa e amarela. e) 6. é correto afirmar: 150 1. .Questão 665 No milho. quantos tipos diferentes de gametas poderia produzir o filho de Janaína e Pedro? a) 4 b) 8 c) 16 d) 32 e) 64 Questão 664 Considere quatro pares de genes que segregam de maneira independente. c. b) aBcDE. Na geração F. é INCORRETO afirmar: a) Quanto mais semelhantes forem as mãos de gêmeos. b) Esses padrões podem ser úteis ao diagnóstico de certas síndromes cromossômicas. Bb. c) aa. d) 12%. D.25%. permitiu constatar que Janaína tem o genótipo AAbbCCDD e Pedro tem o genótipo aaBBccDD. baixa. A cor da semente pode ser amarela devido ao alelo "Y" e branca devido ao alelo "y". abcDE. c) A análise dos padrões digitais não se presta para a determinação de paternidade. poderá produzir quantos tipos geneticamente distintos de gametas? a) 2 b) 4 c) 8 d) 16 e) 32 Questão 668 O desenho abaixo corresponde ao núcleo de uma célula em metáfase de uma espécie cujo número n de cromossomos é 3. Uma planta pura.2. como a Síndrome de Down. b) 50%. cada um com um par de alelos. Nessas condições. a) a. de semente lisa e amarela. BbDd. b. EE. d) O número de cristas dérmicas não varia entre indivíduos da mesma família.

(04) Como resultado de uma autofecundação.8 .8 b) 4 .8 d) 4 . sendo. Cc d) AABBCC.4 e) 2 . poderão ser encontrados 64 genótipos diferentes.2 (01) Em relação aos genes em questão. quantos tipos de gametas diferentes? a) 4 . abc b) ABC. aBC. (32) O sistema em questão é polialélico.4 c) 2 .2 . poderão ser formados 8 diferentes tipos de gametas. (16) Como resultado de uma autofecundação. d) 120 espermatozóides. AaBbCc.8 . Abc. Em experimentos envolvendo três características independentes (triibridismo). onde os três pares de genes estão em pares de cromossomos separados. AbC. com a constituição representada na figura. poderão ser encontrados 16 genótipos diferentes.1. e) 180 espermatozóides. (08) Como resultado de uma autofecundação.8 . Questão 671 Assinale a alternativa correta. abc c) Aa. Bb e Cc 151 Questão 669 Indivíduos com os genótipos AaBb. c) 90 espermatozóides. AaBBcc.5. ABc. impossível calcular tanto o número de genótipos quanto o de fenótipos.2 .4 -16 .4 .2. onde os três pares de genes estão em pares de cromossomos distintos. a) 30 espermatozóides.5.8 Questão 670 Sessenta células de um animal. Soma ( ) ão esperados.4 . Bb. os genótipos das células resultantes serão: a) ABC. aabbcc e) AaBbCc Questão 673 Se a meiose ocorre numa célula de genótipo AaBbCc.4 . b) 60 espermatozóides. a freqüência de descendentes AABbcc será igual a a) 8/64 b) 1/16 c) 3/64 d) 1/4 e) 1/32 Questão 672 Se a mitose ocorre em uma célula de genótipo AaBbCc. poderão ser encontrados 9 genótipos diferentes. se for realizado um cruzamento entre indivíduos AaBbCc. . abC. portanto.8 .8 .2. poderão ser formados 4 diferentes tipos de gametas. apresentando a constituição ABC. (02) Em relação aos genes em questão. AaBB. respectivamente.2 . sofrem meiose.4 -16 .2 1. quais serão os genótipos das células resultantes? a) Aa. AaBbcc podem formar.

5. d) Todos os descendentes de pai míope e canhoto possuem essas características. Questão 675 Um indivíduo daltônico e não míope. 1. aBc. filho de pai O. b) 1/4. os indivíduos marcados apresentam um tipo de cegueira noturna. c) 1/8. b) 1/4. ABc. b) O indivíduo 3 deve ter herdado os alelos dessas duas características apenas de sua mãe. Abc. cuja mãe era canhota.5. Um homem de visão normal e destro. a probabilidade de terem uma menina normal para ambas as características é de: a) 3/16 b) 1/4 c) 1/16 d) 1/2 e) 9/16 . c) 3/4. AbC. d) 1/2. cujo pai tinha miopia e era canhoto.2. aBC. a miopia e a habilidade para a mão esquerda são caracteres condicionados por genes recessivos que se segregam de forma independente.3 1. Questão 676 No heredograma a seguir. e) A probabilidade de o casal 4 × 5 ter uma criança míope e canhota é de 3/8. que teve eritroblastose fetal ao nascer e é filha de pai do tipo O.2.3 probabilidade do casal 4X5 ter uma criança de sexo feminino e de visão normal é de: a) 1/6. A probabilidade de esse casal ter uma criança que possa doar sangue para o pai é de: a) 1/2. considere a genealogia a seguir. e) 1. Questão 678 Na espécie humana. casa-se com uma mulher normal para ambas as características. filho de pai míope. Rh−. a) O indivíduo 2 deve ser heterozigoto para os alelos dessas duas características. d) zero. casa-se com uma mulher de sangue tipo A. Sabendo que o daltonismo é condicionado por um gene recessivo ligado ao sexo e que a miopia é uma herança autossômica recessiva. Questão 677 Um indivíduo de sangue tipo B. c) A probabilidade de o casal 1 × 2 ter uma criança destra e de visão normal é de 1/4. e) 1/3. O casal já tem uma filha daltônica e míope. Qual a probabilidade de esse casal ter uma criança com fenótipo igual ao do pai? a) 1/2 b) 1/4 c) 1/8 152 ssinale a alternativa correta. Rh®.b) ABC e abc c) ABC. casa-se com uma mulher míope e destra. Rh®. abC e abc d) AaBbCc e) AABBCC e aabbcc Questão 674 Sabendo-se que a miopia e o uso da mão esquerda são condicionados por genes autossômicos recessivos.

qual a probabilidade do nascimento de uma criança do tipo AB? A alternativa que responde corretamente às perguntas anteriores é: a) (I) . O principal evento responsável por essa diversidade ocorre durante a formação dos gametas.Se casar-se com uma mulher de sangue tipo A. (II) .2. A figura a seguir demonstra a distribuição independente de cromossomos maternos e paternos. (02) 50% de probabilidade de vir a sofrer de catarata e ter ossos normais. com a reprodução sexuada.5. quais os prováveis tipos de sangue dos filhos do casal? II .3 . a probabilidade de nascer um filhote marrom com manchas é a) 1/16 b) 3/16 c) 1/4 d) 1/2 e) 3/4 Questão 680 A diversidade biológica dos seres vivos está relacionada. Esses dois pares de alelos autossômicos segregam-se independentemente. em um organismo onde o número haplóide (n) é igual a 3. que ocorre durante a meiose. pergunta-se: I . A partir do cruzamento Mmbb × mmBb. (16) 50% de probabilidade de vir a apresentar apenas uma das anomalias. pode-se afirmar que a melhor expressão para o número (w) de gametas possíveis está representada em: a) w = 2£¤ b) w > 2£¤ c) w < 2£¤ d) w = 2¢¤ e) w¤ 2¢¤ Questão 681 A cegueira provocada pela catarata e a extrema fragilidade dos ossos são características que podem aparecer em seres humanos e resultam da ação de dois genes dominantes autossômicos presentes em cromossomos diferentes.50% 153 1. pode-se afirmar que um descendente do casal tem: (01) 100% de probabilidade de nascer livre de ambas as anomalias. (04) 25% de probabilidade de vir a ter olhos normais e ossos frágeis. Assim. o alelo B condiciona padrão uniforme e o b. a cor preta é determinada pelo alelo dominante M e a marrom pelo alelo m. podemos observar que o número possível de gametas (w) em uma espécie é igual a 2¾. presença de manchas brancas. principalmente. Soma ( ) Questão 682 Sendo um homem de sangue tipo O. Nessas condições. (II) . Um homem com catarata e ossos normais cujo pai tem olhos normais. (08) 50% de probabilidade de vir a apresentar ambas as anomalias.d) 3/4 e) 3/8 Questão 679 Em determinada raça animal. O pai da mulher tem ossos normais.zero b) (I) .A ou B ou O. casa-se com uma mulher de olhos livres de catarata mas com ossos frágeis.O ou A ou B. Levando-se em consideração que na espécie humana ocorre a permuta gênica.Se esse homem casar-se com uma mulher de sangue tipo AB.

o grupo sangüíneo e o fator Rh é de a) 1/16 b) 1/12 c) 1/8 d) 1/4 e) 1/2 Questão 684 Nas hemácias de um indivíduo pertencente ao grupo sangüíneo B: a) existe o aglutinógeno B b) existe o aglutinógeno A c) existe a aglutinina A d) existe a aglutinina B e) existem o aglutinógeno A e a aglutinina B Questão 685 Um homem de genótipo AB casa-se com uma mulher receptora universal.A ou B.1 a) os resultados dos grupos sangüíneos excluem a possibilidade do homem ser o pai da criança.50% d) (I) . de sua mãe e do suposto pai) e de duas seqüências de DNA (do menino e do suposto pai). d) menor que a chance de nascerem sucessivamente com sangue do tipo AB.25% Questão 683 Considere os seguintes dados: . 154 . Questão 687 Uma mulher de sangue tipo A.pai sem aglutininas do sistema ABO no sangue. B. (II) . B. foram realizados exames para identificação de grupos sangüíneos e análise de DNA. (II) . Rh−. B. d) os três resultados foram necessários para confirmar que o homem é mesmo o pai da criança. A probabilidade de os pais desse menino terem mais um filho com o mesmo fenótipo de seu irmão. B. A tabela a seguir resume os resultados parciais da análise de grupos sangüíneos (do menino. A e A.zero e) (I) . correspondentes a um segmento localizado num autossomo e outro no cromossomo X. A e B. b) menor que a chance de nascerem todos com sangue do tipo AB. os outros exames foram desnecessários. O e) A. e) maior que a chance de nascerem sucessivamente com sangue do tipo AB. c) maior que a chance de nascerem todos com sangue do tipo AB. . casada com um homem de sangue tipo B. Rh−. .A ou B. Considerando apenas a tabela adiante. AB d) A. mas a seqüência de DNA do cromossomo X exclui.c) (I) . Os tipos de sangue dos filhos são apenas: a) A e AB b) A e B c) A. c) os resultados dos grupos sangüíneos e de DNA não excluem a possibilidade do homem ser pai da criança. levando em conta o sexo.A ou B. O Questão 686 Num caso de investigação de paternidade. A. B. Se o casal vier a ter outros 5 filhos. a chance deles nascerem todos com sangue do tipo O é a) igual à chance de nascerem todos com sangue do tipo AB.5.menino de tipo sangüíneo A. mas possuidor do antígeno Rh. e) os resultados de DNA contradizem os resultados dos grupos sangüíneos. teve um filho de sangue tipo O.mãe de tipo sangüíneo B. b) os resultados dos grupos sangüíneos não excluem a possibilidade do homem ser o pai da criança. (II) .3. podemos afirmar que: 1.

respectivamente: 1.1 om relação a esses resultados.5. soros anti-A.heterozigoto. b) quantitativa. Após alguns segundos. assinale a opção correspondente ao possível genótipo da pessoa em teste: a) IÞIÞRR b) IÞIßrr c) IßiRr d) IÞirr e) iiRR Questão 689 No heredograma a seguir estão indicados os fenótipos dos grupos sangüíneos ABO e Rh. é: a) B e Rh positivo. c) A e Rh negativo. c) heterozigoto . foram colocadas três gotas de seu sangue sobre uma lâmina de vidro. d) AB e Rh positivo. d) homozigoto . e) homozigoto . d) pleiotropia. b) heterozigoto . anti-Rh e anti-B. a) heterozigoto .3. notou-se aglomeração de hemácias apenas no local onde havia soros anti-B e anti-A.1 155 .homozigoto dominante. Questão 692 Qual das opções a seguir relaciona os grupos sangüíneos de um doador universal ideal? a) ARh− b) ABRh® c) ORh® d) ABRh− e) ORh− Questão 693 Considerando os casamentos a seguir. A cada gota foi juntada igual quantidade de soro anti-A na primeira. foi colocada uma gota de sangue humano em cada uma delas. conforme o esquema adiante. e) poligênica. adicionando-se. quanto aos grupos sanguíneos ABO e fator Rh. c) polialelia. A partir desses dados podemos afirmar que o indivíduo.3. b) AB e Rh negativo. uma criança de tipo sangüíneo B. e) A e Rh positivo. Questão 690 Utilizando-se três lâminas de microscopia.heterozigoto.5. O indivíduo 6 deverá ser. foi observada aglutinação nas duas primeiras lâminas. Após a mistura do sangue com os respectivos soros. Rh+ poderá ser filha: 1.homozigoto recessivo. em relação aos locos dos sistemas ABO e Rh.Questão 688 Para se determinar o tipo sangüíneo de uma pessoa. Questão 691 A herança do sistema ABO é do tipo: a) com dominância. soro anti-B na segunda e soro anti-Rh na terceira. a cada uma.homozigoto dominante.

Questão 694 Jorge. que é filha de pai e mãe do tipo B. Rh− e é filho de pai tipo A e mãe tipo B. que tem tipo sangüíneo A. d) IÞIß e IÞIÞ. b) IÞIÞ e Ißi. os genótipos do casal são: a) IÞi e IÞi.5.1 a) somente do casal I.3. Rh® é: a) 100% b) 25% c) 75% d) 50% e) 0 Questão 695 Uma mulher que possui aglutinina anti-B no seu sangue teve um filho do grupo O.5. e) IÞi e IßIß. c) o casal III ou do casal IV. Sabendo-se que o marido tem o aglutinogênio B.1. 156 .1 1. que considera o sistema sangüíneo ABO. Questão 697 1. assinale a alternativa INCORRETA.1 Considere o heredograma acima. Questão 696 A respeito do heredograma acima. Rh® é de: a) 1/6 b) 1/8 c) 1/2 d) 1/4 e) 1/3 Questão 698 O heredograma a seguir mostra os diferentes tipos sangüíneos existentes em uma família. e) O indivíduo 8 é heterozigoto. recebeu transfusão de sangue de sua mulher Tânia. Sabendo-se que Tânia teve eritroblastose fetal ao nascer. Sabendo que o casal 5×6 já perdeu uma criança com eritroblastose fetal. a probabilidade de nascer uma menina do tipo O. b) do casal I ou do casal IV. c) IÞi e Ißi.5. a probabilidade do casal ter uma criança do tipo A. c) O indivíduo 6 é homozigoto.3. que mostra a tipagem ABO e Rh dos indivíduos. b) O indivíduo 7 pertence ao grupo sangüíneo A. d) somente do casal II e) do casal I ou do casal II ou do casal III. d) O indivíduo 1 é receptor universal.3. a) O indivíduo 9 pode ser doador universal.

mas não se sabia o seu grupo sangüíneo. c) A e O. Questão 702 ssinale a alternativa que contém. um B e um AB. Epaminondas pode concluir que D. Os tipos sangüíneos dos pais biológicos dessa criança são: a) A e A.IÞIÞ d) B . Dr.1. fazendo o mesmo com o sangue de D. 157 . e) TIPO SANGÜÍNEO: O. Questão 701 Alexsander não sabe qual é o seu grupo sangüíneo e o seu tipo de Rh. somente. Como faltavam anti-soros para a determinação dos grupos sangüíneos no sistema ABO. Josefa. somente. FATOR Rh: positivo.Indivíduos que apresentem apenas alelos recessivos ii pertencem ao grupo O. um A. Josefa apresenta sangue do grupo: a) A b) B c) AB d) O Questão 703 O esquema apresenta uma árvore genealógica de alguns primatas e seus possíveis grupos sangüíneos no sistema ABO. d) A e B. FATOR Rh: negativo. sua mãe O+ e seu irmão é A-. Josefa não era capaz de aglutinar as hemácias do Dr.Indivíduos que apresentem os dois alelos dominantes IÞ e Iß pertencem ao grupo AB. b) TIPO SANGÜÍNEO: O. Assinale a opção que contém o(s) grupo(s) sangüíneo(s) e o(s) tipo(s) de Rh que Alexsander pode ter: a) TIPO SANGÜÍNEO: A. respectivamente.Indivíduos que apresentem apenas alelo dominante Iß e não apresentem IÞ pertencem ao grupo B.1 ou negativo. Epaminondas provocava aglutinação das hemácias de D.Indivíduos que apresentem apenas alelo dominante IÞ e não apresentem Iß pertencem ao grupo A. FATOR Rh: positivo. usou de um outro recurso: retirou um pouco de seu próprio sangue do qual separou o soro. somente. Epaminondas. que precisava urgentemente de transfusão sangüínea. Epaminondas.2 a) O .5. o fenótipo e o genótipo do indivíduo II. . de acordo com a seguinte composição genética: . e) AB e O. . Josefa. b) B e B. A partir dos resultados. somente. Entretanto sabe que seu pai é A+.IÞIß Questão 699 Pais cujo grupo sanguíneo são AB e O têm cinco filhos com os seguintes fenótipos: dois são O. FATOR Rh: positivo No ambulatório de uma pequena cidade do interior estava D. c) TIPO SANGÜÍNEO: A ou O. O teste subseqüente revelou que o soro do Dr. d) TIPO SANGÜÍNEO: A ou O.IÞi c) A . somente. Josefa. Dr. que é do grupo A.ii b) A . somente. FATOR Rh: negativo ou positivo.Ißi e) AB . . Quantos filhos biológicos tem esse casal? a) 5 b) 4 c) 3 d) 2 e) 1 Questão 700 Uma criança tem tipo sangüíneo do tipo AB.3. mas o soro de D.

c) Apenas dois dos primatas da árvore podem apresentar indivíduos receptores universais no sistema ABO. imigrou para uma região há mais de meio século.Questão 705 Suponha que um grupo de pessoas. pertences a uma determinada seita religiosa. somente humanos podem apresentar os quatro grupos sangüíneos no sistema ABO. mas chimpanzés.3. Questão 704 Os esquemas mostram as possíveis transfusões de sangue tradicionais em relação aos sistemas ABO e Rh. d) As pessoas pertencentes ao grupo AB são recessivas e. totalmente isolada. são mostradas as freqüências aproximadas dos grupos sangüíneos do sistema ABO da população original (tabela 1) e da população atual (tabela 2).5. b) O gene O é dominante sobre os genes A e B. Nas tabelas a seguir. apenas dois. Assim. e) As pessoas pertencentes ao grupo AB só recebem sangue de AB. apresentam pouca chance de existir numa população.1 1. 1. respectivamente: a) O Rh® e O Rh− b) O Rh− e AB Rh® c) A Rh− e OB Rh® d) AB Rh® e O Rh− Qual das alternativas a seguir apresenta uma explicação possível para a mudança na freqüência dos grupos sangüíneos nessa população? a) O gene O é dominante sobre os genes A e B. 1. c) O gene O é recessivo e. Considerando-se apenas os antígenos do sistema ABO. d) Alguns gorilas podem receber sangue de alguns orangotangos.5. Assim.5.3. o casamento entre pessoas pertencentes ao grupo O origina apenas descendentes do grupo O. Questão 706 Observe a árvore genealógica a seguir para o grupo sangüíneo (ABO) em uma família: 158 . os casamentos entre pessoas O e A e entre pessoas O e B apresentam 50% de chance de produzir descendentes pertencentes ao grupo O. Essa situação leva a uma menor freqüência dessas pessoas na população.1 De acordo com o esquema. A população originária desse grupo vive até hoje no mesmo local. é correto afirmar. EXCETO: a) Apenas dois dos primatas citados podem apresentar indivíduos doadores universais no sistema ABO. portanto. os casamentos entre as pessoas O e A e entre pessoas O e B produzem apenas descendentes pertencentes ao grupo O. portanto.3. b) Orangotangos podem apresentar três grupos sangüíneos. mas não de chimpanzés.1 Pode-se dizer que os tipos sanguíneos mais difíceis e mais fáceis para receber sangue são.

b. Rh® teve três crianças com pais distintos: 1.a. N. Rh− b. III . III .a. numa família. II . Rh− II. III .c b) I .c.5. II . Rh− c.5. O indivíduo 4 é homem do grupo sangüíneo "B" 3. marque a opção correta: a) o indivíduo 3 é do grupo sangüíneo "AB" b) o indivíduo 1 pode ser do grupo sangüíneo "AB" c) o indivíduo 1 é do grupo sangüíneo "A" d) o indivíduo 1 é do grupo sangüíneo "O" Questão 707 Observe a árvore genealógica a seguir. dois irmãos são do grupo sangüíneo A. O indivíduo 2 é mulher do grupo sangüíneo "A" 2.a e) I .c. II .a. o único que pode ser dos pais desses indivíduos é a) ii × Ißi b) IÞi × IÞIß c) IÞi × Ißi d) IÞIÞ × IÞIß e) IÞIÞ × IßIß Questão 710 Os tipos sangüíneos do sistema ABO de três casais e três crianças são mostrados a seguir. Rh− PAIS a. M.3.Legenda: Grupo "A": A/A ou A/O Grupo "B": B/B ou B/O Grupo "AB": A/B Grupo "O": O/O arque a opção correta: a) o indivíduo nŽ 5 pode ser de grupo sangüíneo "AB" b) o indivíduo nŽ 1 é do grupo sangüíneo "AB" c) o indivíduo nŽ 6 é do grupo sangüíneo "AB" d) o indivíduo nŽ 7 não pode ser filho do casal 5×6 Questão 708 Uma mulher com grupos sangüíneos B. AB × AB 159 OBS: 1.b c) I . CASAIS I.b. O indivíduo 5 é mulher do grupo sangüíneo "O" Sobre a árvore anterior. A. para o grupo sangüíneo ABO em uma família: 1. MN. Rh® III. outro é do grupo AB e outro do grupo O.1 .c. O. N. N. a) I .c d) I .b.b.3. Rh® Assinale a alternativa que relaciona corretamente cada criança ao seu pai. III . Dos pares de genótipos a seguir. II . II . AB. N.1 CRIANÇAS I. B. A. B.a Questão 709 Sabe-se que. N. III .

II. B × B III. A × O CRIANÇAS a. A b. O c. AB Sabendo-se que cada criança é filha de um dos casais, alternativa que associa corretamente cada casal a seu filho é a) I - a; II - b; III - c b) I - a; II - c; III - b c) I - b; II - a; III - c d) I - c; II - a; III - b e) I - c; II - b; III - a Questão 711 Uma criança necessita urgentemente de uma transfusão de sangue. Seu pai tem sangue do tipo B e sua mãe, do tipo O. Que outro(s) tipo(s) de sangue, além do tipo O, poderia(m) ser utilizado(s) na transfusão, mesmo sem a realização de teste, sabendo-se que o avô paterno da criança tem sangue do tipo AB e sua avó paterna tem sangue do tipo O? a) Tipo AB. b) Tipo A. c) Tipo B. d) Tipo A e tipo B. e) Nenhum outro tipo. Questão 712 Na herança do sistema sangüíneo ABO, há três alelos autossômicos principais: IÞ (para sangue do tipo A), Iß (para sangue do tipo B) e i (para sangue do tipo O). Sabe-se, ainda, que IÞ e Iß são codominantes, ambos dominando sobre i. Uma mulher do tipo A, casada com um homem do tipo B, teve uma filha do tipo O. O homem não quis reconhecer a paternidade alegando infidelidade por parte da mulher. Como na época em que o fato ocorreu não havia o "exame do DNA", o Juiz recorreu a um geneticista que lhe apresentou um parecer sobre o caso. Assinale a alternativa que contém a conclusão correta do geneticista. a) O homem tem razão, pois, por se tratar de um caso de herança ligada ao sexo, a filha dos dois teria que ser, obrigatoriamente, do tipo A.

b) O homem tem razão, pois, pais com tipos A e B, quaisquer que sejam seus genótipos, jamais poderiam ter filhos ou filhas do tipo O. c) O homem não tem razão, pois, pais com tipos A e B, dependendo de seus genótipos, podem ter filhos ou filhas com qualquer um dos tipos sangüíneos (A, B, AB e O). d) O homem não tem razão, pois, por se tratar de herança autossômica, filhos e filhas teriam que ser, obrigatoriamente, do tipo O. e) O homem tem razão, pois, pais com tipos A e B, só podem ter filhos ou filhas do tipo AB, visto que IÞ e Iß são codominantes. Questão 713 Mulher branca, submetida à inseminação artificial, deu à luz gêmeos de cor negra. O fato causou polêmica, já que o pai também é branco. A grande dúvida é saber se houve troca de embriões ou apenas de um dos gametas. Adaptado do "Jornal do Brasil", 1Ž de agosto de 2002 Considere o fato relatado e suponha que a mãe tenha sangue tipo A e seja filha de pai e mãe com sangue tipo AB. Nesse caso, o tipo sangüíneo dos gêmeos poderia ser: a) A ou O b) A ou AB c) B ou O d) B ou A e) AB ou O Questão 714 É necessário o conhecimento do tipo sangüíneo em caso de transfusão. Em relação ao sistema ABO, ( ) indivíduos do grupo sangüíneo O podem doar sangue para pessoas do seu próprio tipo sangüíneo e para os demais . ( ) indivíduos do grupo AB podem receber sangue de qualquer tipo. ( ) indivíduos portadores de sangue do tipo A possuem aglutinogênios A. ( ) indivíduos do grupo B possuem aglutinina anti-A.

160

Questão 715 Além do teste de DNA, há exames mais simples que podem ajudar a esclarecer dúvidas sobre paternidade. Por exemplo, o teste de tipagem sangüínea do sistema ABO permite determinar quem não pode ser o pai. Assinale a alternativa que apresenta uma situação em que esse exame assegura a exclusão da paternidade: a) O filho é do tipo O, a mãe do tipo O e o suposto pai do tipo A. b) O filho é do tipo AB, a mãe do tipo AB e o suposto pai do tipo O. c) O filho é do tipo AB, a mãe do tipo A e o suposto pai do tipo B. d) O filho é do tipo B, a mãe do tipo B e o suposto pai do tipo O. e) O filho é do tipo A, a mãe do tipo A e o suposto pai do tipo B. Questão 716 O heredograma a seguir representa uma família na qual foram determinados os grupos sangüíneos do sistema ABO para alguns dos membros, e do sistema Rh para todos os membros. Com base nas informações contidas no heredograma e em seus conhecimentos sobre o assunto, é INCORRETO afirmar-se que

a) a probabilidade do indivíduo I-2 formar gametas iR é de 50%. b) a probabilidade de II-4 ter uma criança com eritroblastose fetal é de O%. c) os indivíduos Rh positivos da geração II pertencem ao grupo sangüíneo A, e os Rh negativos, ao grupo O. d) o indivíduo I-1 é heterozigoto para uma das características. e) os indivíduos II-3 e II-4 podem apresentar os dois tipos de aglutinina do sistema ABO. Questão 717 Nas situações em que vítimas de acidentes necessitam de transfusão de sangue, sem que se conheça o tipo sangüíneo de cada uma delas, é recomendável utilizar-se o tipo "O negativo". É CORRETO afirmar que, nesse caso, tal tipo sangüíneo é o mais adequado porque, nas hemáceas do doador, estão a) presentes os antígenos correspondentes aos anticorpos do receptor. b) ausentes os anticorpos correspondentes aos antígenos do receptor. c) ausentes os antígenos correspondentes aos anticorpos do receptor. d) presentes os anticorpos correspondentes aos antígenos do receptor. Questão 718 Com relação à genética dos grupos sangüíneos ABO, pode-se afirmar que: a) existem 16 modalidades de cruzamentos de gametas. b) existem 9 possibilidades de acasalamentos. c) indivíduo com grupo sangüíneo O não pode ser filho de acasalamento de indivíduos dos grupos O e AB. d) indivíduo do grupo sangüíneo B não pode ser filho de acasalamento de indivíduos dos grupos O e AB. e) indivíduo com grupo sangüíneo AB pode ser filho de acasalamento de indivíduos dos grupos O e B. Questão 719 A respeito dos grupos sangüíneos avalie as proposições abaixo. ( ) Grupo sangüíneo: A
161

1.5.3.1

Antígenos: A Anticorpos: Anti-B Doa: A, AB Recebe: A, O ( ) Grupo sangüíneo: B Antígenos: B Anticorpos: Anti-A Doa: B, AB Recebe: B, O ) Grupo sangüíneo: AB Antígenos: A e B Anticorpos: Anti-A e Anti-B Doa: AB Recebe: AB, A , B, O ) Grupo sangüíneo: O Antígenos: O Anticorpos: Não tem Doa: O, A, B, AB Recebe: O ) Grupo sangüíneo: A Antígenos: A Anticorpos: Anti-A Doa: A, AB Recebe: A, O Questão 720 Na figura a seguir são mostrados os genótipos e fenótipos possíveis, considerando-se os alelos IÞ, Iß e i determinantes dos grupos sangüíneos do sistema ABO no homem. De acordo com a figura, analise as proposições a seguir.

(

) Todos os descendentes de um casal de genótipo tipo 2 serão do grupo A e apresentarão em suas hemácias o aglutinogênio A. 2) Indivíduos do grupo sangüíneo B de genótipo 3 ou 4 apresentam na membrana de suas hemácias aglutinogênio B e, no plasma, aglutinina anti-A. 3) Os descendentes de um casal (genótipo 5) do grupo sangüíneo AB serão fenotipicamente AB e, como têm em seus genótipos os alelos IÞ e Iß, apresentam, na membrana de suas hemácias, os antígenos A e B. 4) Indivíduos do grupo sangüíneo O de genótipo 6, apresentam aglutinogênios A e B no plasma, mas não têm aglutininas anti-A e anti-B na membrana de suas hemácias. Está(ão) correta(s) apenas: a) 2 b) 1 e 4 c) 2 e 4 d) 2 e 3 e) 2, 3 e 4 Questão 721 Três irmãos (João, José e Maria) realizaram um exame de sangue em laboratório para identificar os seus tipos sangüíneos, com o objetivo de verificar a possibilidade de doarem sangue ao pai, que necessitaria de uma transfusão após uma cirurgia. Um deles (João) ficou surpreso ao descobrir seu tipo sangüíneo - O - e achou que não era filho biológico do casal que o criou. Seu pai e o irmão apresentam sangue do tipo A e sua mãe e a irmã apresentam sangue do tipo B. Todos são RH®. Com base no texto e em seus conhecimentos sobre a herança dos tipos sangüíneos, é correto afirmar que a) João não pode ser filho biológico do casal, pois de acordo com a herança genética possível do tipo sangüíneo, os filhos somente poderiam apresentar sangues dos tipos A, B e AB. Dos filhos biológicos, somente José pode doar sangue ao pai, pois as hemácias de seu sangue apresentam aglutinogênio A. b) João pode ser filho biológico do casal, desde que pelo menos um dos pais seja heterozigoto e apresente o alelo responsável pela presença de aglutininas anti-A e anti-B no plasma. O pai não pode receber sangue de Maria, pois seu sangue apresenta aglutinina anti-B. c) João não pode ser filho biológico do casal, assim como seus dois irmãos, pois de acordo com a herança genética
162

(

(

1.5.3.1

possível do tipo sangüíneo, os filhos somente poderiam apresentar sangues dos tipos AB. O pai pode receber sangue de João e José, pois o sangue dele apresenta aglutinina anti-A, assim como o de seus filhos. d) Se Maria engravidar de um homem com o mesmo genótipo para o tipo sangüíneo de seu irmão João, existe a probabilidade de 100% de seu filho ter sangue do tipo B. Porém, se ela engravidar de um homem com o mesmo genótipo para o tipo sangüíneo de seu irmão José, existe a probabilidade de 50% de seu filho ter sangue do tipo AB, 25% do tipo A e 25% do tipo B. e) João pode ser filho biológico do casal, desde que ambos os pais sejam heterozigotos e apresentem o alelo responsável pela ausência de aglutinogênio. João pode doar sangue para seu pai, pois as hemácias do seu sangue não apresentam aglutinogênios. Questão 722 Jorge, portador de grupo sangüíneo AB Rh-, e Júlia, que é AB Rh+, têm uma filha, Joana, que aos 3 anos de idade necessita de uma transfusão sangüínea. Os exames laboratoriais por hemaglutinação dão os seguintes resultados:

b) seus eritrócitos não contêm anticorpos anti-A e anti-B. c) seu plasma não contém antígenos A e B. d) seus eritrócitos não contêm antígenos A e B. e) seu sangue não contém antígenos nem anticorpos. Questão 724 A herança dos tipos sangüíneos do sistema ABO constitui um exemplo de alelos múltiplos (polialelia) na espécie humana. Com relação ao sistema ABO é CORRETO afirmar que: (01) o tipo O é muito freqüente e, por este motivo, o alelo responsável por sua expressão é dominante sobre os demais. (02) os indivíduos classificam-se em um dos quatro genótipos possíveis: grupo A, grupo B, grupo AB e grupo O. (04) existem três alelos: o IÞ, o Iß e o i. (08) os alelos IÞ e Iß são codominantes. (16) se um indivíduo do grupo A for heterozigoto, ele produzirá gametas portadores de IÞ ou de i. (32) os indivíduos de tipo sangüíneo O possuem aglutinogênios em suas hemácias, porém não possuem aglutininas no plasma. (64) em alguns cruzamentos, entre indivíduos do grupo A com indivíduos do grupo B, é possível nascerem indivíduos do grupo O. Questão 725 Em relação ao sistema sangüíneo ABO, um garoto, ao se submeter ao exame sorológico, revelou ausência de aglutininas. Seus pais apresentaram grupos sangüíneos diferentes e cada um apresentou apenas uma aglutinina. Os prováveis genótipos dos pais do menino são a) Ißi - ii. b) IÞi - ii. c) IÞIß - IÞi. d) IÞIß - IÞIÞ. e) IÞi - Ißi.

1.5.3.1

Em face dos dados apresentados, assinale a alternativa correta. a) Joana não pode ser filha natural de Júlia. b) Joana não pode receber sangue O Rh-. c) Jorge não pode ser o pai natural de Joana. d) Joana pode receber sangue AB Rh-. e) Joana pode ser homozigota para B. Questão 723 Em uma transfusão sangüínea, indivíduos do grupo O são considerados doadores universais porque a) seu plasma não contém anticorpos anti-A e anti-B.

163

Questão 726 Para os grupos sangüíneos do sistema ABO, existem três alelos comuns na população humana. Dois (alelos A e B) são co-dominantes entre si e o outro (alelo O) é recessivo em relação aos outros dois. De acordo com essas informações, pode(m)-se afirmar: I. Se os pais são do grupo sangüíneo O, os filhos também serão do grupo sangüíneo O. II. Se um dos pais é do grupo sangüíneo A e o outro é do grupo sangüíneo B, todos os filhos serão do grupo sangüíneo AB. III. Se os pais são do grupo sangüíneo A, os filhos poderão ser do grupo sangüíneo A ou O. Está(ão) correta(s) a) apenas I. b) apenas II. c) apenas III. d) apenas I e III. e) I, II e III. Questão 727 Observe a genealogia.

ara o casal (5 e 6) que pretende ter muitos filhos, foram feitas as quatro afirmações a seguir. I - O casal só terá filhos AB e Rh positivo. II - Para o sistema ABO, o casal poderá ter filhos que não poderão doar sangue para qualquer um dos pais. III - O casal poderá ter filhos Rh positivo, que terão suas hemácias lisadas por anticorpos anti-Rh produzidos durante a gravidez da mãe. IV - Se for considerado apenas o sistema Rh, o pai poderá doar sangue a qualquer um de seus filhos. São corretas, apenas, as afirmações a) II e IV b) I, II e IV c) II, III e IV d) I, II e III. e) I e III. Questão 728 Em um acidente de carro, três jovens sofreram graves ferimentos e foram levados a um hospital, onde foi constatada a necessidade de transfusão de sangue devido a forte hemorragia nos três acidentados. O hospital possuía em seu estoque 1 litro de sangue do tipo AB, 4 litros do tipo B, 6 litros do tipo A e 10 litros do tipo O. Ao se fazer a tipagem sangüínea dos jovens, verificou-se que o sangue de Carlos era do tipo O, o de Roberto do tipo AB e o de Marcos do tipo A. Considerando apenas o sistema ABO, os jovens para os quais havia maior e menor disponibilidade de sangue em estoque eram, respectivamente, a) Carlos e Marcos. b) Marcos e Roberto. c) Marcos e Carlos. d) Roberto e Carlos. e) Roberto e Marcos. Questão 729 Considerando o casamento entre um homem tipo sangüíneo A®, cujo pai era O−, com uma mulher B® cuja mãe era A−, assinale a(s) alternativa(s) correta(s). (01) A probabilidade de nascer 1 filha mulher B® é 3/16. (02) A probabilidade de nascer 1 filho homem O− é nula. (04) A probabilidade de nascer 1 filho homem e 1 filha mulher AB é 9/1024.
164

1.5.3.1

(08) A probabilidade de nascer filho homem AB− é 1/16. (16) A probabilidade de nascer 1 filho homem A® é 1/8. (32) A probabilidade de nascer 2 filhas mulheres A− é 1/1024. Questão 730 Uma mulher Rh− casou-se e teve um filho. Numa segunda gestação a criança apresentou um quadro de eritroblastose fetal. Com estes dados, indique qual a opção que apresenta o fenótipo para o fator Rh da mãe, do pai e da criança, respectivamente. a) Mãe Rh negativo, Pai Rh positivo e Criança Rh positivo. b) Mãe Rh positivo, Pai Rh positivo e Criança Rh negativo. c) Mãe Rh positiva, Pai Rh negativo e Criança Rh negativa. d) Mãe Rh positivo, Pai Rh negativo e Criança Rh positivo. e) Mãe Rh negativo, Pai Rh positivo e Criança Rh negativo. Questão 731 A observação do esquema a seguir, que representa a genealogia de uma família em relação aos grupos sanguíneos MN, nos permite afirmar que:

a) Rh positivo e Rh negativo. b) Rh negativo e Rh positivo. c) Rh positivo e Rh positivo. d) Rh negativo e Rh negativo. e) Rh positivo e Rh neutro. Questão 733 A doença hemolítica do recém-nascido é um problema causado pela incompatibilidade sangüínea entre mãe e feto. Assinale a alternativa que contém a família na qual é possível a ocorrência da citada doença. a) Mãe: Pai: 1Ž bebê: 2Ž bebê: b) Mãe: Pai: 1Ž bebê: 2Ž bebê: c) Mãe: Pai: 1Ž bebê: 2Ž bebê: IÞi Ißi IÞIß Ißi IÞIÞ IßIß IÞIß IÞIß ii ii ii ii rh Rh Rh Rh rh rh rh rh

Rh rh rh rh Rh rh rh rh rh rh rh rh Rh Rh Rh Rh rh Rh rh rh rh rh rh rh rh rh rh rh rh rh rh rh

1.5.3.2

d) Mãe: ii Pai: Ißi 1Ž bebê: Ißi 2Ž bebê: ii e) Mãe: IÞi Pai: ii 1Ž bebê: IÞi 2Ž bebê: ii Questão 734

a) sangue MN é característica determinada por gene dominante. b) os indivíduos 4 e 5 são heterozigotos. c) o casal 3 e 4 poderá ter filhos dos três tipos de grupos sanguíneos. d) se o indivíduo 5 casar-se com uma mulher de sangue N, todos os filhos serão heterozigotos. e) um próximo filho do casal 6 e 7 poderá ser do grupo N. Questão 732 Quanto ao surgimento da eritroblastose fetal, ou doença hemolítica do recém-nascido, podemos afirmar que ela ocorre quando o pai e a mãe respectivamente apresentam:

Paula, portadora do aglutinogênio B e Rh negativo casou-se com João, portador dos aglutinogênios A e B e Rh positivo. Sabendo-se que a mãe de Paula não possui aglutinogênios e que João teve um irmão com doença hemolítica do recém nascido, conclui-se que a probabilidade de o casal ter um filho Rh positivo e sangue tipo A é: a) 9/16
165

2 onsidere as seguintes afirmações: I . c) Lúcia e Marina. pois filhos Rh®. que tem Rh−. pois todos os filhos desse casal terão uma doença grave fetal caracterizada por uma anemia profunda (Eritroblastose fetal). c) a mãe pode pertencer ao tipo sangüíneo O. c) se somente I estiver correta.3.indica reação negativa. b) Lúcia e João. II .5. d) Pedro e João. b) se somente II estiver correta.b) 3/16 c) 1/4 d) 1/8 e) 1/2 Questão 735 Lúcia e João são do tipo sangüíneo Rh positivo e seus irmãos. Questão 739 Indivíduos sem antígeno Rh nas hemácias são considerados recessivos.Em caso de transfusão sangüínea. 1. O sinal + indica reação positiva e o sinal . Questão 736 A afirmação que uma mulher Rh− não deve casar-se com um homem Rh®: a) é correta. entretanto. III . pois todos os filhos desse casal serão abortados. Numa segunda gravidez. d) essa criança é certamente heterozigota para o fator Rh. Pedro e Marina. d) se somente I e III estiverem corretas. a mãe recebesse soro anti-Rh. c) é incorreta. pois o primeiro filho em geral não tem a anemia. b) o pai possui genótipo IÞIß. mesmo no caso de glóbulos vermelhos atingirem a circulação materna em sucessivas gestações. a criança poderá receber sangue. e) a mãe pode ter genótipo IÞi. casou-se com Elaine. d) bastante preocupado. logo após o parto. mesmo sendo Rh®. e) é incorreta. Fazendo um exame pré-natal e relatando esse fato ao médico. e) João e Marina. Então é INCORRETO afirmar que: a) a mãe é certamente Rh−. não fez qualquer recomendação. e) se somente II e III estiverem corretas. o mesmo ficou: a) despreocupado e não fez qualquer recomendação relativa ao fato. d) é incorreta. tanto da mãe quanto do pai. b) é correta. Ambos possuem o mesmo grupo sangüíneo. Carlos. Assinale: a) se somente III estiver correta. Quais dos quatro irmãos podem vir a ter filhos com eritroblastose fetal? a) Marina e Pedro. Questão 737 Uma criança tem genótipo igual ao pai. não serão atingidos pela Eritroblastose fetal. que é receptor universal e teve eritroblastose fetal. b) despreocupado. disse que esse procedimento não seria mais necessário. inclusive pela informação de 166 . c) preocupado. que tem Rh® e é homozigoto. apenas solicitando ao casal que o procurasse no momento da segunda gestação. são do tipo Rh negativo. Questão 738 O quadro abaixo mostra os resultados das tipagens ABO e Rh de um casal e de seu filho.Essa mulher poderá dar à luz uma criança com eritroblastose fetal. pois não existe influência do fator Rh positivo ou negativo nos casos de Eritroblastose fetal.O genótipo do pai pode ser IÞIÞRR. bem como todos os filhos Rh− não serão atingidos pela doença e esta só atinge uma pequena fração de casos em outras gestações de filhos Rh®. recomendando que.

a DHR poderia ser evitada. CRIANÇA . CRIANÇA . negativo. com ocorrência de eritroblastose fetal. e) positivo. Questão 745 A incompatibilidade materno-fetal ao antígeno Rh pode determinar um doença denominada Eritroblastose Fetal. CRIANÇA . cuja mãe é Rh−.Rh−. positivo. cujo pai é Rh−. negativo. c) Em III. a mãe recebesse anticorpos anti-Rh. b) Após a 1 gravidez. PAI . positivo. e) bastante preocupado. após o contato com o antígeno Rh®. após cada parto. Qual das alternativas abaixo indica o tipo sangüíneo de uma criança que NÃO poderia ter sido gerada por este casal? a) A / Rh® / NN b) A / Rh− / MN c) AB / Rh− / MN d) O / Rh® / MN e) O / Rh− / MN Questão 743 Uma mulher Rh®. A probabilidade desse casal vir a ter uma criança Rh− é de a) 100% b) 75% c) 50% d) 25% e) 0% Questão 744 Um casal teve uma criança com eritroblastose fetal. positivo. é: a) 1 b) 1/2 c) 1/3 d) 1/4 e) 1/8 Questão 741 Interpretando a figura a seguir sobre a Doença Hemolítica do recém-nascido (DHR).Rh®. Se uma mulher foi orientada a usar a vacina anti-Rh logo após o nascimento do primeiro filho. a) MÃE. assinale a afirmativa INCORRETA.Rh− e) MÃE.5. Assinale a alternativa do quadro abaixo que identifica corretamente os grupos sangüíneos dessa família.Rh−. recomendando bastante atenção em cada gravidez.Rh®. PAI . Questão 740 Um casal possui o seguinte genótipo para o fator Rh: Pai = Rr. positivo. a probabilidade de esse casal vir a ter um filho do sexo masculino. a mãe produz anticorpos anti-Rh que podem ser transferidos para a corrente sangüínea fetal.Rh−. PAI . positivo.3. dizendo ao casal que a gravidez era de altíssimo risco e eles não poderiam mais ter outro filho.Rh− c) MÃE. CRIANÇA .2 a) A placenta normalmente funciona como uma barreira que separa as células sangüíneas fetais e maternas.compatibilidade de grupo sangüíneo. d) positivo. negativo.Rh−. d) Se. PAI . PAI . é casada com um homem Rh®.Rh® d) MÃE. b) negativo. CRIANÇA .Rh® 1.Rh®. de maneira que.Rh−. a mãe receba o soro anti-Rh. negativo.Rh−. podemos dizer que seu fator Rh. Considerando apenas o fator Rh. logo após o parto da 1 gravidez. c) negativo. respectivamente: a) negativo.Rh®. negativo. os antígenos fetais não serão capazes de induzir a produção de anticorpos anti-Rh pela mãe. 167 . o do seu marido e o da criança são. Mãe = rr. Questão 742 Uma mulher com sangue do tipo A / Rh® / MM é casada com um homem com tipo sangüíneo B / Rh® / NN.Rh® b) MÃE.

3. Seu caso foi diagnosticado. nenhum dos filhos será b) heterozigoto... o qual teve eritroblastose fetal. Isto só acontecerá quando houver passagem do sangue do embrião para a circulação materna. do primeiro filho e do segundo filho. a mãe foi sensibilizada com o fator Rh..Questão 746 A eritroblastose fetal é uma doença hemolítica adquirida apresentada por alguns recém-nascidos. analise os genótipos descritos. assinale a alternativa CORRETA: a) A mãe é Rh positivo. b) Os abortados certamente eram Rh negativo... Questão 749 Assinale a alternativa que completa corretamente as lacunas no texto a seguir.2 ela observação dos gráficos e considerando que essa mulher teve um filho em cada gestação e nunca recebeu transfusão de sangue. é correto concluir que.5.. d) em Y.. Esta condição é provocada por incompatibilidade sangüínea do fator Rh.. b) em X.. respectivamente..do 1Ž filho. como eritroblastose fetal. a mãe transferiu anticorpos anti-Rh para o 2Ž filho Rh+. o feto apresentou o quadro de hemólise de hemácias. todos os filhos serão d) heterozigoto.. metade dos filhos será Questão 750 Após uma primeira gravidez bem sucedida.. exclusivamente: a) quando a mãe é Rh® e o filho Rh−. e) independente do Rh materno. o qual teve eritroblastose fetal. c) em Y. e teve seu primeiro filho sem qualquer anormalidade. 1. a mãe transferiu anticorpos anti-Rh para o 1Ž filho Rh-. Questão 747 No segundo parto de uma mulher. uma mãe abortou três vezes....3. o qual não teve eritroblastose fetal. nenhum dos filhos será e) homozigoto. d) quando a mãe é Rh® e o pai Rh−.. b) quando a mãe é Rh− e o filho Rh®.. homozigota recessiva e seu marido é Rh®. a) homozigoto. Em relação à patologia observada nesta família.... a) em X. Uma mulher é do tipo sangüíneo Rh−... A mãe reconhecerá os glóbulos vermelhos do embrião como estranhos e produzirá anticorpos anti-Rh. Rh®. Considerando o fato de que essa mulher não foi submetida à transfusão de sangue em toda a sua vida anterior. .. o qual não teve eritroblastose fetal. a mãe foi sensibilizada com o sangue Rh+ do 2Ž filho.. Se ele for . todos os filhos serão c) homozigoto. sendo observado. e assinale abaixo a alternativa que indica... c) Este casal jamais poderá ter outros filhos.. c) quando a mãe é Rh− e o pai Rh®. além da anemia.. esse conhecido por doença hemolítica do recém-nascido (DHRN) ou eritroblastose fetal.2 Questão 748 Os dois gráficos a seguir representam as quantidades de anticorpos anti-Rh presentes no sangue de uma mulher (Rh-) em gestações distintas.. .. os genótipos da mãe.5.. icterícia e aumento do baço e fígado.. no quadro apresentado.. 168 1. em consulta médica. o filho é Rh−.

c) alta. A. d) nula. 3. 8. 5 e 8 litros. 1.3 Questão 754 Observe o diagrama geral das possíveis trocas sangüíneas por doação e recepção no sistema "ABO": 1. Rh® homozigota. visto que seu pai é Rh−. c) 18. O que o casal não sabia é que a "mãe de aluguel" tivera três filhos. 5. com absoluta certeza. b) 2. e. Questão 751 Uma mulher com útero infantil.5.3. Questão 753 Assinale a alternativa que esquematiza as transfusões que podem ser feitas entre indivíduos com diferentes grupos sanguíneos do sistema ABO (as setas indicam o sentido das transfusões). 10 e 18 litros. 5. 8 e 16 litros.3. 8 litros B e 2 litros O. 3. visto que sua mãe genética é Rh®. 3 litros de tipo A. casa-se com um homem Rh−. e) O pai é Rh positivo. pois a "mãe de aluguel" é Rh®. d) 2. Para transfusões em indivíduos O. A probabilidade de o "bebê de proveta" nascer com a doença hemolítica do recém-nascido é: a) mínima. Questão 752 Um banco de sangue possui 5 litros de sangue tipo AB. o casal decide ter um "bebê de proveta" e contrata uma "mãe de aluguel" para receber em seu útero o zigoto formado por aquele casal. sendo que o último apresentara a doença hemolítica do recém-nascido.d) A criança é Rh negativo.5. b) mínima. o livro onde estavam registrados os códigos foi perdido. Para que os frascos contendo sangue fossem identificados. respectivamente: a) 2. 18 e 10 litros. será Rh®. visto que a doença hemolítica do recém-nascido só ocorre quando a mãe é Rh− e o pai Rh®. 13 e 5 litros. B e AB estão disponíveis.3 (s) seta(s) cujo sentido (doação ë recepção) está(ão) errado(s) é(são): a) 4 e 5 b) 2 c) 1 d) 3 Questão 755 Em um banco de sangue de um hospital. e) alta. as etiquetas que identificavam os tipos sangüíneos estavam em código. e) 2. e o resultado foi o seguinte: 169 . foram feitos testes com amostras correspondentes a cada código. Impedida de ter filhos. por acidente. já que o "bebê de proveta".

verificou-se a presença de anticorpos anti-A e ausência de anti-B. havia três bolsas disponíveis. d) 13 litros. Esse homem pode receber sangue: a) apenas da bolsa 1. Rh®. podemos afirmar que a) existem 105 litros de sangue disponíveis para um receptor AB Rh® b) existem 135 litros de sangue disponíveis para um receptor AB Rh− c) existem 105 litros de sangue disponíveis para um receptor A Rh® d) existem 135 litros de sangue disponíveis para um receptor O Rh® e) existem 25 litros de sangue disponíveis para um receptor O Rh− Questão 756 A transfusão de sangue tipo AB para uma pessoa com sangue tipo B a) pode ser realizada sem problema. a opção que corresponde à condição de aglutinação (+) ou não aglutinação (-) de hemácias resultante de reação antígeno-anticorpo: 170 . e) reação de anticorpos anti-B do doador com antígenos A do receptor. d) nenhuma reação. Questão 758 aseados nesse teste. e) apenas da bolsa 2. Se houver A transfusão de sangue do tipo B para uma pessoa do grupo A. resultaria em a) reação de anticorpos anti-B do receptor com os glóbulos vermelhos do doador. 7 litros de sangue tipo A. c) da bolsa 2 ou da bolsa 3.5. b) apenas da bolsa 3. porque A é receptor universal. c) formação de anticorpos anti-A e anti-B pelo receptor. pois os anticorpos anti-A presentes no sangue do receptor podem reagir com os antígenos A presentes nas hemácias AB. Questão 757 Um determinado banco de sangue possui 4 litros de sangue tipo AB. porque. porque as hemácias AB não possuem antígenos que possam interagir com anticorpos anti-A presentes no sangue do receptor. sendo que o sangue da bolsa 1 apresentava todos os tipos de antígenos do sistema ABO. pois os anticorpos anti-B presentes no sangue do receptor podem reagir com os antígenos B presentes nas hemácias AB. I. Questão 759 Um homem sofreu um acidente e precisou de transfusão sangüínea. estarão disponíveis para ele. o sangue do receptor não possui anticorpos contra eles. 1 litro de sangue tipo B e 9 litros de sangue tipo O. apesar de as hemácias AB apresentarem antígeno A e antígeno B. c) 12 litros.3. III e IV. Marque. todos Rh®. e) não deve ser realizada. porque as hemácias AB não possuem antígenos que possam interagir com anticorpos anti-B presentes no sangue do receptor. o sangue da bolsa 2 possuía anticorpos anti-A e anti-B e a bolsa 3 possuía sangue com antígenos somente do tipo B. hemácias de indivíduos dos grupos sangüíneos AB. b) 8 litros. b) reação dos antígenos B do receptor com os anticorpos anti-B do doador. do total acima mencionado: a) 4 litros. Questão 760 O soro sangüíneo de um indivíduo do grupo O foi colocado em quatro tubos de ensaio. No banco de sangue do hospital. II. na alternativa a seguir.3 necessidade de transfusões sanguíneas para um indivíduo com sangue tipo AB.1. separada e respectivamente. b) pode ser realizada sem problema. d) não deve ser realizada. Analisado o seu sangue. aos quais foram adicionadas. A. d) da bolsa 1 ou da bolsa 2. B e O. c) pode ser realizada sem problema. e) 21 litros.

5.5. há quatro indivíduos que se ofereceram para doar sangue.3. colocadas em uma lâmina. misturadas aos soros anti-A e anti-B. b) Tubo I (-). Questão 761 Num laboratório foram realizados. e) Tubo I (-). o sinal . em seguida. anti-Rh. Tubo II (+). anti-B e anti-Rh.significa ausência de aglutinação. Foi realizada a determinação de grupos sangüíneos do sistema ABO dos quatro indivíduos. A partir dos resultados observados. os indivíduos: a) I e II b) I e III c) II e III d) II e IV e) III e IV Questão 763 1.a) Tubo I (-).4 om base no quadro. Tubo III (-) e Tubo IV (+). Os resultados obtidos foram: 1. Tubo III (-) e Tubo IV (+).3. com a utilização de duas gotas de sangue de cada um deles. Tubo II (+).4 171 . para a determinação da tipagem sangüínea dos sistemas ABO e Rh. d) Tubo I (+). Os resultados obtidos encontram-se no quadro seguinte. Os resultados são apresentados a seguir: Um laboratorista realizou exames de sangue em cinco indivíduos e analisou as reações obtidas com os reagentes anti-A. que. Tubo III (+) e Tubo IV (-). poderão doar sangue ao referido homem. Tubo III (+) e Tubo IV (-). 1. Tubo II (-). conclui-se que são classificados. no hospital. como receptor e doador universal: a) 4 e 2 b) 4 e 3 c) 1 e 5 d) 2 e 4 e) 5 e 1 Questão 762 Em um hospital há um homem necessitando de uma transfusão de emergência. exames de sangue para a determinação da tipagem sangüínea dos Sistemas ABO e Rh. em cinco indivíduos. foram. c) Tubo I (+). respectivamente. Foram obtidas reações com a aplicação dos reagentes anti-A. Sabe-se que ele pertence ao grupo sangüíneo A e que. Tubo II (-).4 bservação: o sinal + significa aglutinação de hemácias. Tubo II (+).5.3. anti-B. Tubo III (-) e Tubo IV (+).

mantendo a seqüência disposta na tabela. Rh−/ A. indique quais os indivíduos que serão considerados. Rh−/AB. Rh−/ B.3. Rh−/ B. Assim. simultaneamente. Rh®/ B.Rh− b) O.Rh®/ O.4. Rh®/ AB. Questão 766 A surdez pode ser uma doença hereditária ou adquirida. No processo ali representado. Os genótipos das plantas cruzadas são. Rh®/ O. Um homem surdo. Rh®/ B. Rh® e) AB. A presença de ambos simultaneamente produz flor púrpura. Questão 767 Na ervilha-de-cheiro existem dois pares de genes que condicionam a cor da flor (Cc e Pp). c) 3 e 4. receptor e doador universal. a) 5 e 2. 1. Rh−/ O. d) DDee. e) DDEE. Rh®/ AB. c) Ddee. Rh® Questão 765 O esquema a seguir evidencia que a formação de melanina não depende apenas da ação de um gen. Após analisar a tabela. Cruzando-se duas plantas de flores brancas. depende da homozigose de apenas um dos dois genes recessivos. Rh−/ A. A audição normal depende da presença de pelo menos dois genes dominantes diferentes (D) e (E). está ocorrendo a ação conjunta de dois gens. b) 4 e 3. Rh−/ B. (d) ou (e). Rh−/ AB.4 a) O. d) interação gênica. Rh−/ A. Questão 764 A tabela a seguir foi elaborada a partir de testes para determinação dos grupos sangüíneos de seis pessoas de uma academia de ginástica. respectivamente: a) CCpp x ccPP b) CCpp x ccPp c) Ccpp x ccPP d) Ccpp x ccPp 172 1. podemos concluir que o genótipo dos filhos é: a) ddEE. b) poligens. obtém-se em F plantas produtoras de flores coloridas.5. Rh®/ A. Rh® c) AB.1 ituações como essa são conhecidas como: a) polialelia. Rh−/ O. Rh®/ B. todos de audição normal. Rh®/ O. Rh−/ B. na proporção de 3 brancas: 1 colorida. Quando hereditária. c) norma de reação. Tiveram 9 filhos. Rh®/ A. b) DdEe.Com base nesses resultados. assinale a alternativa que indica os grupos sangüíneos de todas as pessoas quanto aos sistemas ABO e Rh. casou-se com uma surda. Rh−/ A. d) 2 e 5. A presença do gene C ou P ou ausência de ambos produz flor branca. respectivamente. Rh− d) AB. e) 1 e 4. e) alelos múltiplos. Rh®/ A.5. O sinal positivo (+) significa "aglutina" e o sinal negativo (-) significa "não aglutina". Rh−/ AB. .Rh®/ A.

na espécie humana. A probabilidade de nascer uma criança branca não albina é de: a) 1/16. Um casal de mulatos médios diíbridos tem uma criança albina. e) dois cromossomos se unirem para formar um gameta. Os genótipos das plantas com flores vermelhas e brancas da geração parental são. ocorrem flores vermelhas somente se a planta possuir os alelos dominantes A e B. d) dois pares de genes estarem no mesmo par de cromossomos homólogos. d) 3/16. Observe a figura.4.1 expressão desses genes pode ser impedida pela presença de um par de genes autossômicos recessivos. a) AABB e AaBb b) AaBb e Aabb c) AABb e aabb d) aaBb e Aabb e) aabb e aabb Questão 771 1. como a surdez hereditária. Nesse caso. o indivíduo é albino. Neste esquema. por isso. 1. c) 1/5. Questão 769 Em genética. c) um único gene ter efeito simultâneo sobre várias características do organismo.4. o fenômeno da interação gênica consiste no fato de: a) uma característica provocada pelo ambiente. Questão 770 Em determinada espécie vegetal. b) vários pares de genes não alelos influenciarem na determinação de uma mesma característica. obtiveram-se 3 plantas de folhas vermelhas para 5 plantas de flores brancas na geração F.1 odas as alternativas contêm genótipos possíveis para os porquinhos vermelhos de F2.e) CcPp x CcPp Questão 768 Suponha que. respectivamente. Cruzando-se plantas de flores vermelhas com plantas de flores brancas. e) 3/64. A tabela abaixo indica os fenótipos existentes. são muito sensíveis à luz solar. EXCETO a) AABB b) AaBB c) Aabb d) AaBb e) AABb Questão 772 Os indivíduos albinos não possuem melanina .5. como surdez por infecção.5.e. está representada parte da via biossintética para a produção desse pigmento: 173 . a pigmentação da pele seja devida a dois pares de genes autossômicos com efeito aditivo.pigmento responsável pela cor e proteção da pele . b) 1/2. imitar uma característica genética.

e) ee Bb. d) ee BB.4.56. O cruzamento de um macho dourado com uma fêmea marrom produziu descendentes pretos. c) ee bb. com relação à surdez congênita na descendência de pais normais para a audição. analise as proposições com verdadeiro ou falso.1 om base nesse esquema e em outros conhecimentos sobre o assunto. dois genes. e) epistasia dominante. condicionam as três pelagens típicas da raça: preta. marrons e dourados. Os cães portadores de pelo menos um alelo dominante E serão pretos. Com esses dados. b) casamentos entre indivíduos albinos podem gerar descendentes com melanina. c) pleiotropia. ( ) A probabilidade do nascimento de uma criança normal para a audição. 174 . b) herança quantitativa. ( ) A surdez congênita é determinada por alelos múltiplos em um loco autossômico. cujos progenitores eram surdos. a cor da plumagem é determinada por 2 pares de genes.1. d) codominância.1 Em galinhas. d) indivíduos AABB formam gametas do tipo AA e BB. como ilustrado no quadro a seguir. c) diferentes genótipos podem dar origem ao albinismo. ( ) Cinco distintas classes genotípicas são observadas entre os descendentes surdos citados. O genótipo do macho é a) Ee BB. se forem homozigóticos bb. cada um com dois alelos (B/b e E/e). marrom e dourada. Questão 773 Em uma exaustiva análise de genealogias humanas. respectivamente. ( ) Na determinação da característica analisada atuam locos gênicos ligados que distam entre si em 16 unidades de mapa. A pelagem dourada é condicionada pela presença do alelo recessivo e em homozigose no genótipo. enquanto seu alelo i não interfere nessa expressão. b) Ee Bb. conclui-se que se trata de um caso de: a) epistasia recessiva.5. Questão 775 1. Questão 774 Em cães labradores. é de aproximadamente de 0. O gene I impede a expressão do gene C. a partir de um casal genotipicamente igual ao mostrado na F1. ou marrons. foi observado que a distribuição fenotípica para normais e surdos obedecia a uma proporção de 9:7. é INCORRETO afirmar que a) a ausência da Enzima 1 resulta em um aumento da concentração de tirosina. Considerando esses dados.5.4. se tiverem pelo menos um alelo dominante B. ( ) Interação gênica entre dois locos justificam esses dados. O gene C condiciona plumagem colorida enquanto seu alelo c determina plumagem branca.

A figura a seguir mostra as reações bioquímicas envolvidas na síntese de pigmentos.4. que se reproduz por autopolinização (em F). c) Os indivíduos de F. b) Os duplos heterozigotos apresentam flores coloridas. II e III. II . b) III. preta ou albina.A formação de qualquer pigmento no pêlo depende da presença do alelo P.Trata-se de um caso de interação gênica do tipo epistasia recessiva. produzem quatro tipos de gametas para o caráter em estudo.5. EXCETO: a) Trata-se de um caráter determinado por interação gênica.5. 1.Quando animais pretos homozigóticos são cruzados com certos albinos também homozigóticos. O caráter em estudo é a cor das flores. 1. Questão 778 Em cães da raça Labrador Retriever.4. III . om base na figura foram feitas as seguintes afirmações: I . d) II e III.2 175 . c) I e II. somente.Questão 776 Nos camundongos. somente. Questão 777 O esquema abaixo representa o cruzamento artificial (em P) de duas variedades puras de um determinado vegetal. e) I. d) A fecundação cruzada das plantas com flores brancas de F‚ produzirá sempre o mesmo fenótipo. somente. somente.4. os descendentes são todos aguti.5. é correto afirmar.2 om base nos resultados. Pode-se considerar correto o que é afirmado em a) I. a pelagem pode ser aguti.2 1. a cor da pelagem é determinada por um tipo de interação gênica epistática de acordo com o esquema a seguir.

não se espera a produção de descendentes com fenótipo chocolate. Qual é o genótipo desse casal? a) aaCC x aacc b) Aacc x aaCc c) aaCc x AAcc d) AaCc x AaCc e) aaCC x AAcc Questão 780 Em cebolas. (04) Ocorre poligenia quando um gene tem efeito simultâneo sobre várias características do organismo. II. d) 15/16 de cebolas brancas e 1/16 de cebolas coloridas. II. e) 16/16 de cebolas brancas. a enzima que catalisa a formação de pigmento não é produzida (cebolas brancas). dois pares de genes que apresentam segregação independente participam na determinação da cor do bulbo: o alelo dominante I impede a manifestação de cor e o recessivo i permite a expressão. completando seus efeitos. impede a manifestação de outro gene. III e IV. ao invés de determinar uma característica. complementando seus efeitos e produzindo um fenótipo igual aos fenótipos produzidos por cada gene isoladamente. a presença de um alelo dominante C determina a produção de bulbo pigmentado. espera-se que 50% dos descendentes apresentem pelagem amarela. que inibe a formação de pigmentos dando origem a indivíduos albinos. (01) Ocorre poligenia quando dois genes não-alelos colaboram na mesma característica. O gene A determina coloração aguti e é dominante sobre seu alelo a. III. Questão 779 Em camundongos. O gene C determina a produção de pigmentos e é dominante sobre seu alelo c. com segregação independente. Do cruzamento de um camundongo preto com um albino. em cebolas cc. o alelo dominante A determina cor vermelha e o recessivo a. No cruzamento entre os filhotes de F1. b) 12/16 de cebolas brancas e 4/16 de cebolas coloridas. IV. Homozigotos bb não têm a manifestação da cor do bulbo impedida. Todos os filhotes produzidos nesse cruzamento são heterozigotos. cor amarela. não-alelo. d) I. (16) Durante o desenvolvimento do organismo. assinale o que for correto. vários pares de genes não-alelos influem na determinação de uma característica. b) II. que impede a manifestação de gene C. herdado de forma independente. III e IV apenas. 176 . um criador fez as seguintes afirmações: I. c) 13/16 de cebolas brancas e 3/16 de cebolas coloridas. III e IV apenas. foram obtidos apenas descendentes agutis. a coloração da pelagem é determinada por dois pares de genes. espera-se que 25% dos descendentes apresentem pelagem chocolate. Questão 782 Na cebola. c) I. No cruzamento da fêmea parental com qualquer cão de pelagem preta.Sabendo que o cruzamento (geração Parental) entre um macho com fenótipo chocolate e uma fêmea de fenótipo amarela gera apenas filhotes com pelagem preta (geração F1). apresenta o alelo B. Uma proporção de 2 incolores: 1 vermelho: 1 amarelo é esperada entre os descendentes do cruzamento a) IIAA x IiAa b) IiAA x iiAa c) IIaa x ii aa d) IiAa x IiAa e) IiAa x iiaa Questão 781 Sobre interação gênica. No cruzamento da fêmea amarela com um de seus filhotes de F1. São afirmações CORRETAS: a) I. Outro gene. II e III apenas. (02) Dois genes não-alelos colaboram na mesma característica. Aa e Cc. (08) Ocorre epistasia quando um gene. Quais as proporções fenotípicas esperadas do cruzamento de cebolas homozigotas coloridas com BBcc? a) 9/16 de cebolas brancas e 7/16 de cebolas coloridas. que condiciona coloração preta. enquanto os pais são homozigotos para os dois pares de genes.

(2) Indivíduos albinos podem apresentar homozigose recessiva bb e cc. c) AAbbe aabb. análise desses cariótipos revela que.1 Com base no esquema e sabendo que indivíduos incapazes de sintetizar a melanina são albinos. enquanto o genótipo homozigoto bb define cor preta. b) Aabbe aabb. d) AABBe Aabb. mas o genótipo aa bloqueia toda a produção de pigmentos e o rato torna-se albino. O alelo dominante A nesse lócus possibilita o desenvolvimento normal da cor (como definido pelos genótipos B_ ou bb). Em outro cromossomo. O gene dominante W "inibe" a manifestação da cor. (3) Um casal de indivíduos albinos pode ter filhos com pigmentação normal. respectivamente: a) XY e XX b) YO e XX c) XO e XX d) XY e XO e) XO e XY 177 . Questão 785 Epistasia é o fenômeno em que um gene (chamado epistático) inibe a ação de outro que não é seu alelo (chamado hipostático). (4) O gene B é epistático sobre o gene C. Essas transformações são catalisadas por diferentes enzimas. em que o macho e a fêmea são. cujo 2n = 6.5.2 1.Questão 783 A cor da pelagem em cavalos depende. AaBBe aabb. julgue os itens seguintes. Cruzando-se indivíduos heterozigotos para os dois pares de genes obtém-se: a) 3 brancos: 1 preto b) 9 brancos: 3 pretos: 3 mesclados de marrom e preto: 1 branco c) 1 preto: 2 brancos: 1 marrom d) 12 brancos: 3 pretos: 1 marrom e) 3 pretos: 1 branco Questão 784 As diversas substâncias ingeridas pelo homem são transformadas em outras. os filhotes de cor preta poderão apresentar genótipos: a) Aabbe AAbb. atuam três mRNAs. Questão 786 Em uma espécie animal. O esquema abaixo representa alguns passos da síntese de melanina. enquanto que o alelo recessivo w permite a manifestação da cor. nessa espécie. fazendo com que o pêlo fique branco. (1) Na produção de melanina a partir de fenilalanina. da ação de dois pares de genes Bb e Ww. ambos com genótipo AaBb. o alelo dominante B determina cor de pêlo acinzentada. a determinação do sexo é feita por um sistema. dentre outros fatores. durante os processos metabólicos. um segundo lócus afeta uma etapa inicial na formação dos pigmentos dos pêlos. O gene B determina pêlos pretos e o seu alelo b determina pêlos marrons.5. Considerando os descendentes do cruzamento de dois ratos.4.5. Em ratos. e) aaBB. o cariótipo de células somáticas de machos e fêmeas se apresenta como mostram os desenhos a seguir: 1.

são tipo A e B simultaneamente. simultaneamente. e) estatura elevada. as mulheres apresentam células geneticamente diferentes entre si." Assinale a alternativa que confirma o texto anterior. b) Algumas mulheres. têm manchas brancas e pretas. X e Y. d) A hipertricose auricular é uma característica restrita ao sexo masculino. Com base neste texto é INCORRETO afirmar: a) O sexo masculino é heterogamético e é sempre o homem quem determina o sexo dos filhos. pois o gene está localizado no cromossomo Y. heterozigotas para a cor da pele. e nos blastômeros iniciais do desenvolvimento embrionário. Assim. pois em algumas estão ativos os genes provenientes do cromossomo X materno e em outras do cromossomo X paterno. heterozigotas para a cor do cabelo. contudo um deles era menino e o outro menina. c) um cromossomo sexual. simultaneamente. e) Algumas mulheres. 178 . têm um olho azul e outro castanho. a) Algumas mulheres. e) Toda doença hereditária e recessiva ligada ao cromossomo X só afeta as mulheres. teremos: a) sexo masculino. as células femininas ficariam iguais às masculinas. a hipótese de que fêmeas de mamíferos compensariam a dose dupla de genes do cromossomo X através da inativação de um desses cromossomos. Questão 789 O médico confirmou que se tratava de gêmeos monozigóticos.1 ntre as características que esse indivíduo passará a apresentar. c) Algumas mulheres. d) um cromossomo X quando da divisão mitótica do zigoto. porém a menina era portadora da síndrome de Turner. X ou Y. b) caracteres sexuais desenvolvidos. Logo. heterozigotas para o daltonismo (XD Xd). O indivíduo do sexo feminino apresenta dois cromossomos X enquanto que o indivíduo de sexo masculino apresenta um cromossomo X e outro cromossomo Y. "A pesquisadora inglesa Mary Lyon propôs. c) na mulher um cromossomo X está sempre condensado e recebe o nome de cromatina sexual.5. d) ausência de cromatina sexual. d) Algumas mulheres. que possuem apenas uma cópia funcional dos genes ligados ao cromossomo X. Questão 788 Leia o texto a seguir referente à Hipótese de Lyon. heterozigotas para os grupos sangüíneos. na gametogênese do pai ou da mãe das crianças. Mulheres heterozigotas para os genes ligados aos cromossomos X expressam o alelo dominante em algumas células e o alelo recessivo em outras. A análise cromossômica dos gêmeos indicou que o menino era normal. A inativação do cromossomo X ocorre ao acaso. e) um cromossomo Y quando da divisão mitótica do zigoto.Questão 787 Na espécie humana a determinação sexual é feita por um par de cromossomos. em 1961. têm visão normal em um dos olhos e daltonismo no outro.5. independentemente dos genes que possuem. b) O sexo feminino é homogamético e o gameta feminino normal sempre apresenta um cromossomo X. são loiras e castanhas. b) um cromossomo Y na gametogênese do pai das crianças. c) cariótipo normal. heterozigotas para a cor dos olhos. 1. Tal fato deve-se à perda de a) um cromossomo X na gametogênese da mãe das crianças. Questão 790 O esquema a seguir mostra a formação dos gametas responsáveis pela produção de um indivíduo com alteração do seu número cromossomial.

machos de penas pretas × fêmeas de penas barradas Assinale a alternativa que indica corretamente as gerações nas quais espera-se encontrar galinhas pretas.F: galinha preta. Seu cromossomo Y é descendente do Y de seu avô paterno. além de 2 cromossomos sexuais. b) Um linfócito de carneiro deve apresentar 54 cromossomos. quando incubados com 4 suspensões de espermatozóides. F‚: galinha preta II .Questão 791 A análise do cariótipo de exemplares de uma dada espécie revelou que o número diplóide é idêntico em ambos os sexos e que o sexo heterogamético é o feminino. de acordo com a tabela abaixo. A partir desse dado. 4 óvulos humanos. F‚: galinha barrada II .F: galinha barrada. machos homozigóticos de penas barradas × fêmeas de penas pretas II. F‚: galinha preta II . III. O alelo dominante determina penas barradas e o recessivo.F: galinha barrada. incluindo 2 cromossomos sexuais. F‚: galinha barrada II .F: galinha preta. a cor das penas apresenta herança ligada ao sexo.5. fizeram-se as seguintes afirmações: I. todos igualmente viáveis. assinale a alternativa INCORRETA com relação ao número de cromossomos encontrado em diversas células nessa espécie. está(ão) correta(s) APENAS a) I b) II c) III d) I e III e) II e III Questão 794 Em galinhas. e) Uma célula muscular de carneiro deve apresentar 54 autossomos. penas pretas. Entre seus autossomos.F: galinha barrada. geraram 4 embriões. II.1 179 . a) Um neurônio de carneiro deve apresentar 52 autossomos. 1.F: galinha preta.F: galinha barrada.F: galinha barrada. F‚: galinha barrada b) I . a) I . d) Uma célula de carneiro que está na metáfase da mitose deve apresentar 54 cromossomos duplicados.5. Com base nesses dados.F: galinha barrada. c) Um óvulo de ovelha deve apresentar 26 autossomos. Questão 793 Acerca da relação entre os cromossomos de um menino e os de seus avós. F‚: galinha barrada II . Dessas afirmações. F‚: galinha preta e) I . F‚: galinha preta Questão 795 Em uma experiência de fecundação "in vitro". há descendentes de autossomos de seus avós. Considere os seguintes cruzamentos a partir dos quais obtiveram-se as gerações F e F‚: I. Seu cromossomo X é descendente de um X de sua avó paterna.F: galinha preta. F‚: galinha preta c) I . é possível dizer que o sistema de determinação do sexo nessa espécie é do tipo a) XX : XY b) XX : XO c) XX : YO d) ZZ : ZW e) ZZ : ZO Questão 792 O carneiro ('Ovis aries') apresenta 27 cromossomos em seus gametas normais. F‚: galinha preta d) I .

embora as fêmeas se originem de reprodução sexuada.0 × 10−¢¡ b) 2. Questão 799 Alguns métodos em desenvolvimento poderão permitir aos pais a escolha do sexo de seus futuros filhos. c) um macho normal. e) um intersexuado. igual a: a) 1. podemos concluir que a mosca é a) uma fêmea normal.onsiderando a experiência descrita. são: a) espermatócitos secundários diplóides portando os cromossomos X e Y. ( ) O indivíduo hermafrodita é formado por células XX e XY. implantando. os gametas que precisam ser necessariamente identificados e separados para uso no processo de fecundação. Além disso. Questão 800 Observe a figura. Questão 798 Um estudante. b) uma fêmea aneuplóide. Nesse inseto. a seguir. o gráfico que indica as probabilidades de os 4 embriões serem do sexo masculino é o de número: a) 1 b) 2 c) 3 d) 4 Questão 796 Considere que um óvulo de abelha possui 5×10−¢¥ g de DNA. A quantidade de DNA encontrada em uma célula somática de zangão. não observou a presença do cromossomo Y. b) oócitos primários diplóides portando os cromossomos Y.0 × 10−¢¨ Questão 797 As afirmações a seguir relacionam-se à DETERMINAÇÃO CROMOSSÔMICA DO SEXO na espécie humana.0 × 10−¢¢ d) 5. no período correspondente à prófase da mitose é. ( ) O genitor do sexo feminino determina o sexo dos descendentes. c) espermatozóides derivados de espermátides portando o cromossomo X. por partenogênese. ao analisar os cromossomos de 'Drosophila'. caso os pais desejem um filho do sexo feminino.5. em mg.5. Dentre as opções abaixo. ( ) O sexo heterogamético é o masculino. Dentre eles. os machos originam-se de óvulos não-fecundados. encontrou a proporção de 1X : 2A (onde a letra A simboliza o conjunto haplóide de autossomos).1 180 . ( ) O corpúsculo de Barr ou cromatina sexual corresponde a um cromossomo X inativo.5 × 10−ª c) 5. Analisando os dados do estudante. d) um macho estéril. o ovo fertilizado no útero da mãe. alguns se baseiam em executar a fecundação em tubo de ensaio. d) óvulos haplóides portando o cromossomo Y. ( ) A síndrome de Down é causada pela presença de um cromossomo X extra no cariótipo. e) oogônias portando o cromossomo X e espermatogônias portando o cromossomo Y. 1.

c) mapeamento do genoma humano. a presença do cromossoma Y determina o fenótipo masculino. Questão 803 Nos mamíferos.5. b) cultura de células e tecidos.1 181 . pode ser útil em condições de manejo de espécies em extinção. XY que.5. d) os testículos estão ausentes nos indivíduos 46. é correto afirmar-se que a) a probabilidade do casal em F ter um descendente macho e sem mancha negra é zero. sofrem mutação nesse gene perdem as características sexuais. O gene SRY. b) os indivíduos trissômicos com cariótipo 47. e) o sexo heterogamético nessa espécie de peixes é o masculino. b) a determinação do sexo. em tartarugas. c) indivíduos de sexo indeterminado. d) temperaturas maiores que 28°C produzem fêmeas tanto em tartarugas quanto em lagartos. XYY apresentam dois testículos a mais. c) as fêmeas de F‚ e P sem mancha negra possuem genótipos diferentes. induz à diferenciação dos testículos. é CORRETO afirmar que a) os indivíduos 46. Considerando-se essas informações e outros conhecimentos sobre o assunto. 1.5.ssa figura representa a herança do caráter mancha negra numa espécie de peixes em que a determinação do sexo segue o padrão mais comum nas aves. b) a probabilidade de uma fêmea com mancha.1 a) a determinação do sexo nesses animais é independente da localização dos ovos no ninho e da época da postura. 1. c) os indivíduos trissômicos 47. na idade adulta. e) machos são produzidos em baixas temperaturas tanto para tartarugas quanto para lagartos. sob controle de temperatura. d) o caráter mancha negra é exclusivo de indivíduos homozigotos. XY com deleção do gene SRY.5. d) produção de DNA recombinante. Questão 801 A figura a seguir se refere à determinação do sexo em algumas espécies de tartarugas e lagartos. Com relação ao padrão de herança desse caráter. ter descendentes machos sem mancha é de 50%. Questão 804 A figura a seguir mostra esquematicamente o tipo de reprodução em abelhas do gênero 'Apis'. cruzada com macho sem mancha. XXY possuem órgãos reprodutores masculinos e femininos. são produzidos em temperaturas abaixo de 28°C. Com base nessa figura pode-se afirmar que Questão 802 A identificação do fator que origina indivíduos com síndrome de Down tornou-se possível pela utilização da técnica de a) contagem e identificação dos cromossomos. presente nesse cromossoma.

que representa um cariótipo humano. (32) Com cariótipo normal. b) I e II estão corretas.5.5.5. (16) Ccom Síndrome de Edwards. enquanto a cor escura é condicionada pelo alelo dominante A. c) II e III estão corretas. A produção de zangões caracteriza o processo de reprodução assexuada denominado partenogênese. a cor clara dos olhos é condicionada pelo alelo recessivo a de um determinado gene. (02) Do sexo feminino. e) I e III estão corretas. (64) Com uma anomalia numérica de autossomos. Em uma linhagem desses insetos. As operárias são estéreis devido à espermatogênese nos zangões produzir. Essa história mostra que a) os zangões são haplóides e produzem os espermatozóides por meiose. (04) Com Síndrome de Down.1 (01) Do sexo masculino. das quais uma seria a escolhida para ser a futura sucessora da rainha. Espera-se que a prole dessa rainha tenha a seguinte composição: 1.5. c) o sexo das abelhas é determinado pela ploidia do indivíduo. Questão 805 Analisando a figura adiante. Da análise das afirmativas acima podemos assegurar que: a) apenas I está correta.1 I. é correto afirmar que se trata do cariótipo de um indivíduo: Questão 806 No reino Colméia. e nasceram filhas operárias. foi inseminada artificialmente com espermatozóides de machos de olhos escuros. Uma abelha rainha de olhos escuros. A rainha se casou com um belo zangão plebeu. I.nalise as seguintes afirmativas sobre o esquema da figura. gametas com um número de cromossomos 4 (quatro) vezes menor. II. e os zangões são monóicos. uma vez que não houve a fecundação dos óvulos que os originaram. através da meiose. havia uma rainha que tinha tido apenas filhos do sexo masculino (zangões) e precisava de uma sucessora para o trono. d) apenas II está correta. Soma ( ) Questão 808 Considere as afirmações: 1. 182 . Os zangões podem ser considerados clones perfeitos da abelha rainha. (08) Com Síndrome de Patau. Em humanos. a determinação do sexo cromossômico do zigoto (XX ou XY) depende do gameta masculino que fecunda o óvulo. e são diplóides. b) o sexo das abelhas é determinado pelos cromossomos sexuais. Questão 807 Os machos de abelha originam-se de óvulos não fecundados e são haplóides. heterozigótica Aa. III. d) a rainha e as operárias são dióicas. As fêmeas resultam da fusão entre óvulos e espermatozóides.

com exceção do RNA mitocondrial. sendo que um deles é a cromatina 183 .5. IV. d) apenas I e II. Questão 810 Durante as Olimpíadas é comum fazer-se teste da cromatina sexual ou corpúsculo de Barr nas mulheres. todas as moléculas de RNA. Toda a informação genética necessária para formar um organismo completo está contida em seqüências de timinas. I. d) Apenas I está correto. A informação genética pode ser passada de uma geração para outra. pode-se afirmar que: a) I e III estão corretos. nas células somáticas de fêmeas normais. o RNA mensageiro que saiu do núcleo continha 1500 códons e a seqüência que serviu de molde para a transcrição possuía 3000 nucleotídeos. II e III. III e V. sendo exceção a essa regra os cromossomos sexuais X e Y. porém. adeninas. de uma célula a outra.5.R. III.1 Adaptado de: AMABIS. Estão corretas: a) I. b) Três cromossomos Y. de pais para filhos. Em mamíferos. II e IV. c) II e III estão corretos. Em mamíferos. Questão 809 O diagrama a seguir está dividido em 3 segmentos (I. III. sendo que um deles é a cromatina sexual. e) apenas I e III. Questão 811 Considere as cinco afirmações seguintes. c) Dois cromossomos X e blocos de cromatina sexual. c) apenas III. sexual. Uma mulher normal apresentará em suas células bucais: a) Dois cromossomos X. é possível observar o cromossomo X que foi inativado. em um mesmo indivíduo. II. Com relação a esses segmentos. 2001. e a fecundação reconstitui a diploidia. b) apenas II. G. Questão 812 A reprodução da maioria dos seres vivos envolve um processo sexual onde se alternam os fenômenos de meiose e fecundação. "Conceitos de Biologia". d) II. V. sendo que dois deles formam a cromatina sexual. J. São Paulo: Moderna. os quais contêm conceitos relacionados aos diferentes sistemas de determinação do sexo. d) Três cromossomos X. IV e V.M e MARTHO. b) I e II estão corretos. citosinas e guaninas arranjadas em diferentes combinações. c) II. Em uma célula eucariótica animal. II e III). pois este corresponde ao corpúsculo de Barr ou cromatina sexual. a meiose é gamética. No homem. e) Um cromossomo X apenas. e) III. Está(ão) correta(s) a) apenas I. Qual dos pares de gametas representados a seguir poderá originar um zigoto que desenvolverá um embrião normal do sexo masculino? 1. dois. Em mamíferos. cromossomos homólogos contêm a mesma seqüência linear de genes. b) I. Esse teste permite o diagnóstico citológico do sexo feminino.II. as fêmeas possuem apenas um cromossomo X e os machos. têm sua origem no núcleo. Numa proteína com 500 aminoácidos. III e IV. não pode ser passada.

quando pareados. d) o casal apresenta 50% de probabilidade de ter filhas afetadas.5. d) a pesquisa de hormônios sexuais femininos através de um exame de sangue. ocasionalmente.2 análise do esquema permite formular as conclusões a seguir. b) O casal 5/6 formará homens hemofílicos. cujo desempenho ou mesmo a aparência sugerem fraude. c) o cromossoma Y paterno pode apresentar o gene para a doença. a) O casal 1/2 nunca formará mulheres hemofílicas. b) o indivíduo I é obrigatoriamente homozigoto. EXCETO uma. c) o exame radiológico dos órgãos sexuais.1 1. são exemplos de cromossomos homólogos.5.5. podemos afirmar corretamente que: a) a anomalia é causada por um gene dominante. por exemplo. Feita a análise desse gráfico. II . III . por exemplo. Questão 816 Observe o esquema a seguir: 1. e) os indivíduos III e V podem ser homozigotos ou heterozigotos. 184 . são feitas as seguintes afirmações: I . Indique-a. Questão 814 Em relação aos cromossomos sexuais X e Y. Estão corretas as seguintes afirmações: a) apenas I b) apenas II c) apenas III d) apenas II e III e) todas. No gráfico anterior temos representado um exemplo de doença ligada ao sexo onde apenas o indivíduo IV é afetado. fazem parte do cromossomo X. c) O genótipo de 4 será XHY.5. d) O genótipo de 6 será XHXH ou XHXh. b) a contagem de hemácias cuja quantidade é maior nos homens. há suspeitas sobre o sexo de certas atletas.2 Questão 813 Em eventos esportivos internacionais como os Jogos Pan-americanos ou as Olimpíadas. e) a análise radiográfica da bacia. e) O indivíduo 5 com certeza é hemofílico.Questão 815 1.5. Para esclarecer tais suspeitas utiliza-se a) a identificação da cromatina sexual.características como o daltonismo. estão associadas a genes do cromossomo Y.5.características como a hemofilia.

aprendemos que ela é mais comum nos homens porque: a) os homens são mais propensos à doença devido à influência do hormônio testosterona.2 Questão 820 A hemofilia é uma doença genética cuja herança é ligada ao sexo. I .I." (Handin R. é suficiente nos homens apenas um alelo para que a doença se manifeste. A probabilidade de A ser portador da anomalia. O heredograma a seguir refere-se a uma família com esta anomalia. isto é. d) Apenas as afirmações II e III são verdadeiras. a) Todas as afirmações são verdadeiras.Não é possível identificar o genótipo de 2. e) é causada por um alelo típico do cromossoma Y. b) Apenas as afirmações I e II são verdadeiras.5. ao passo que os homens só necessitam de um alelo.5.100% dos filhos homens do casal 3 e 4 serão daltônicos. sabendo-se que a mulher B é homozigota é de a) 1/8 b) 3/8 c) 1/2 d) 1/4 e) 3/4 1. 185 . que é masculinizante. 1955) Quando nos debruçamos sobre a hemofilia. III .Questão 817 "Tem sido verificado que aproximadamente 25% dos casos de hemofilia A em meninos são decorrentes de mutações novas. a doença se manifesta em meninos que não tem história familiar de hemofilia. De acordo com o heredograma. c) Apenas as afirmações I. Questão 819 A distrofia muscular de Duchenne é devida a um gene recessivo.5. e) Apenas as afirmações II e IV são verdadeiras. c) mulheres hemofílicas precisam de dois alelos dominantes. IV . analise as afirmações de I a IV e assinale a alternativa correta.100% das filhas do casal 3 e 4 serão normais portadoras. Analise o heredograma adiante e assinale a alternativa correta.5.50% das filhas do casal 3 e 4 serão normais portadoras e 50% daltônicas. ligado ao cromossomo X. BLOOD AND PRACTICE OF HEMATOLOGY. Questão 818 O daltonismo é uma anomalia que apresenta um tipo de herança ligada ao sexo. d) mulheres hemofílicas morrem nos primeiros sangramentos menstruais. III e IV são verdadeiras. II . b) sendo uma herança ligada ao sexo..2 1.

5% e) 100% Questão 824 Meio-irmãos é o termo utilizado para designar os indivíduos que são irmãos só por parte de pai ou só por parte de mãe. b) filhos da mesma mãe. certamente. vão receber US$ 24. e) se o pai de 2 era afetado pelo daltonismo. e) portadores de novas mutações. mais provavelmente. .7 mil.5. os indivíduos representados com símbolos escuros são daltônicos e os demais têm visão normal para as cores. que pediram para não ser identificados.02. certamente a mãe tinha fenótipo normal. ocorridas independentemente da herança materna ou paterna. Questão 825 VÍTIMAS DE HIROSHIMA NO BRASIL SERÃO INDENIZADAS. Um homem hemofílico casa-se com uma mulher normal e homozigota para este caráter. o genótipo para hemofilia XHY fenotipicamente representa: a) homem normal b) homem hemofílico c) mulher normal d) mulher hemofílica e) homem normal. porém herdaram de suas respectivas mães os genes para daltonismo e hemofilia. da qual herdaram os genes para daltonismo e hemofilia. Na genealogia abaixo.5. portadoras do gene para o daltonismo. b) as mulheres 2 e 4 são. d) filhos da mesma mãe. b) O indivíduo 8 é portador do gene para hemofilia. c) filhos do mesmo pai. A probabilidade deste casal vir a ter uma filha hemofílica é igual a: a) zero b) 50% c) 25% d) 12. Questão 821 O daltonismo é causado por um gene recessivo localizado no cromossomo X na região não-homóloga ao cromossomo Y. c) os homens 1. decidiu um tribunal japonês. e) O indivíduo 14 pode ser homo ou heterozigoto. porém portador Questão 823 a) Os indivíduos 1 e 2 são homozigotos normais. João e Pedro sejam a) filhos do mesmo pai. porém herdaram de seus respectivos pais os genes para daltonismo e hemofilia. Seus genitores são normais. do qual herdaram os genes para daltonismo e hemofilia. 09. 3 e 7 são portadores do gene para o daltonismo.2006) 186 1. d) Todos os filhos e filhas do indivíduo 10 serão hemofílicos. certamente.5. Os três homens.2 1. ("Folha de S.5.Paulo". d) as filhas do casal 6 e 7 são.2 correto afirmar que a) a mulher 6 é homozigota. João e Pedro são meio-irmãos e ambos são daltônicos e hemofílicos. c) O indivíduo 9 não pode ser hemofílico. heterozigotas.Questão 822 Na espécie humana. Pode-se dizer que.

pode-se dizer que Emília está a) correta. Shiguero. Observe a árvore genealógica: 187 . d) errada. É mais provável que a hemofilia de Mário seja determinada por um alelo herdado por via materna.na família real inglesa. e) 83 %. Emília. transmitidas à Takashi. que não tem ascendência oriental. acreditava que seu único filho. o herdou do Sr. e deste à se filho.Emília interessou-se pela notícia. b) correta. Depois da notícia do jornal. Emília havia lido que a doença é genética. Emília passou a acreditar que seu filho talvez pudesse se beneficiar com alguma indenização. Do mesmo modo como a radiação provocou a leucemia do Sr.ligado ao X . também poderia ter provocado mutações nas células de seu tecido reprodutivo que. Shiguero. A princesa Beatriz. Afinal. 90 são daltônicos. ou que Mário seja portador de uma nova mutação sem qualquer relação com a radiação a que o Sr. Takashi. Shiguero foi submetido.5. e muito mais freqüente em homens que em mulheres. Como a hemofilia é um caráter recessivo e só se manifesta nos homozigotos para esse alelo. por sua vez. b) 4. Shiguero. todos seriam hemofílicos. os símbolos cheios representam pessoas afetadas por uma doença genética rara. porque aproximadamente 50% da prole é afetada. Shiguero. Questão 828 Acredita-se que a rainha Vitória da Inglaterra tenha sido a introdutora do gene para hemofilia . e) errada. Sobre suas convicções quanto à origem da doença de Mário. porque a doença aparece em todas as gerações. O sogro de Emília. e) recessivo ligado ao sexo. Anos depois. Sr. Após a guerra. que o teria herdado do Sr.5. uma vez que é determinada por um alelo no cromossomo Y. A hemofilia é uma doença que prejudica a coagulação do sangue.2 padrão de herança que melhor explica o heredograma é a) autossômico dominante. introduziu o gene na família real espanhola. migrou para o Brasil. Qual é a porcentagem esperada de mulheres daltônicas nessa população? a) 0. onde se casou e teve um filho. Como a hemofilia é um caráter dominante. ligada ao sexo. foi um dos sobreviventes da bomba de Hiroshima. c) 9 %. A hemofilia ocorre mais freqüentemente em homens. se seu filho Mário tivesse herdado o alelo do pai. Deste modo.81 %. o Sr. Mário. b) autossômico dominante. c) autossômico dominante. portador de hemofilia do tipo A. filha de Vitória. d) dominante ligado ao sexo. c) apenas parcialmente correta. que. a mais grave delas. Shiguero faleceu de leucemia. Questão 826 Na genealogia a seguir. 1. provocaram a hemofilia de Mário. porque todas as filhas de homens afetados são afetadas. d) 16 %. entre 1000 homens analisados. casou-se com Takashi e atribuía a doença de seu filho Mário à herança genética do avô Shiguero. Em uma amostra representativa da população.5 %. porque não há transmissão de homem para homem. Questão 827 O daltonismo é causado por um alelo recessivo de um gene localizado no cromossomo X. Mário só pode ter herdado esse alelo de seu pai. era uma vítima indireta da radiação liberada pela bomba. a doença de seu filho Mário é causada pela presença de um alelo herdado pela via paterna e por outro herdado pela via materna. porque a doença afeta os dois sexos.

b) dominante ligado ao sexo. casa-se com um homem daltônico e tem uma criança do sexo masculino e daltônica. c) autossômico recessivo.5. este será hemofílico também. daltônica e canhota possui pai daltônico e destro e mãe de visão normal e canhota. b) o pai é normal e a mãe é hemofílica. b) essa mulher poderia ter uma irmã daltônica. 188 . Questão 833 O gene que determina o daltonismo na espécie humana caracteriza o seguinte tipo de herança a) autossômico dominante. Questão 832 Um casal tem uma criança de sexo masculino e hemofílica. e) dominante ligado ao cromossomo Z. c) o pai e a mãe são hemofílicos. provavelmente. filha de pai normal e mãe portadora do gene para o daltonismo. e) interação gênica.. d) A mulher é obrigatoriamente filha de pai e mãe polidáctilos. Questão 830 Um homem de visão normal e com número normal de dedos casa-se com uma mulher polidáctila e daltônica. c) recessivo ligado ao cromossomo X. c) o filho dessa mulher herdou do seu pai o gene para o daltonismo. Questão 834 Uma criança do sexo feminino. e) Os filhos homens desse casal serão sempre daltônicos e não polidáctilos. que: a) o pai é normal. A anomalia. d) ela recebeu da mãe o gene para a hemofilia. d) recessivo ligado ao cromossomo Z. c) O pai dessa mulher é daltônico. é determinada por gene a) autossômico dominante. e) se ela tiver um irmão. É correto afirmar que: a) essa mulher é daltônica. com certeza. d) o genótipo dessa mulher é igual ao de sua mãe. assinale a alternativa correta. É correto afirmar. a) Esse casal poderá ter uma filha polidáctila e daltônica. Sabendo-se que a polidactilia é uma herança autossômica dominante..Questão 831 Uma mulher. b) A mãe dessa mulher terá obrigatoriamente o mesmo genótipo para o daltonismo que ela. e) essa mulher não poderá ter uma filha daltônica.2 probabilidade da princesa Maria vir a ter um menino hemofílico é de: a) 100% b) 75% c) 50% d) 25% e) 0% Questão 829 O estudo de linhagens de galinhas em que aparecia uma anomalia hereditária mostrou que fêmeas afetadas cruzadas com machos normais davam sempre todos os descendentes machos com a anomalia e as fêmeas normais. b) autossômico recessivo. d) recessivo ligado ao sexo. Sabendo que o uso da mão esquerda é uma característica recessiva.5. então a probabilidade do segundo filho ser do sexo masculino e com fenótipos dominantes é: a) 1/2 b) 1/4 c) 1/6 d) 1/8 e) 1 1.

XDXd. Um macho de olhos brancos foi cruzado com uma fêmea heterozigota. e excluindo-se a possibilidade de mutação.Questão 835 O raquitismo resistente à vitamina D é uma doença provocada por um gene dominante ligado ao X.Se a mãe for afetada. Do casamento entre uma mulher afetada e um homem normal. Avô . A probabilidade do nascimento de um menino também normal é: a) 50% b) 75% c) 25% d) 100% e) 0 Questão 836 Em 'Drosophila'. III . III.As filhas de pai normal serão sempre normais. b) I e III apenas. a probabilidade desse casal ter uma criança do sexo feminino normal para ambas as características é de: a) 3/8 b) 1/8 c) 1/2 d) 3/4 e) zero Questão 838 A respeito das heranças recessivas ligadas ao sexo (genes situados no cromossomo X). a porcentagem de indivíduos de olhos brancos em F será de: a) zero b) 100 % c) 25 % d) 75 % e) 50 % Questão 837 Um homem de audição normal e não hemofílico casa-se com uma mulher com o mesmo fenótipo. IV .XdY. e) I e III são verdadeiras.XdY 189 . b) II é verdadeira. II.XdY. O primeiro filho desse casal nasceu hemofílico e surdo-mudo. Avó .XDY d) Homem .sua avó paterna NÃO apresenta o gene para a hemofilia. Considerando que nesses indivíduos o sexo heterogamético é o masculino.XDXd. d) II e IV apenas.XDY e) Homem .XDXd. c) I. a) Homem . A cor vermelha é determinada pelo gene W+. nasceu uma menina normal. e avô materno e mãe com daltonismo. Avô . Avô . considere as seguintes afirmações.XDY. III e IV. Avó . Considerando a surdo-mudez como uma característica autossômica recessiva. Assinale a alternativa correta quanto aos genótipos do homem e de seus avós maternos.XdXd. enquanto as mulheres apresentam três genótipos possíveis.seu pai é hemofílico.XdY c) Homem .XDXd. c) III é verdadeira. Questão 839 Considere as seguintes afirmações sobre uma mulher hemofílica: I.XdY b) Homem . II. d) I e II são verdadeiras.XDY.XdY. Avô . Avô . e) III e IV apenas. Avó . São corretas: a) I. Sabendo-se que o gene em questão é recessivo e ligado ao sexo. a cor dos olhos é determinada por um gene localizado no cromossomo X sem o correspondente alelo no cromossomo Y.Os homens só apresentam dois genótipos possíveis. II . Avó . todos os seus filhos do sexo masculino também serão afetados. I . é possível considerar que APENAS a) I é verdadeira.As mulheres heterozigotas têm fenótipo normal.sua mãe possui um gene para a hemofilia. enquanto a cor branca é devida ao gene W. Avó . Questão 840 Um homem tem avó materna e pai com visão normal. III e IV apenas.

Além disso. XXY). Admitindo-se que o gameta anormal tenha sido produzido pela mulher.5. c) daltônico ou hemofílico. espera-se que esse filho do casal seja a) normal. É correto afirmar que os filhos a) e as filhas de homens daltônicos são sempre daltônicos. que tratam de um caso e hemofilia: 1.5. d) apenas hemofílico. que nasceu com SÍNDROME DE KLINEFELTER e DALTONISMO.Questão 841 O heredograma a seguir representa uma família em que um dos filhos é afetado por doença determinada por um alelo recessivo localizado no cromossomo X. quanto à hemofilia e ao daltonismo. e) apenas daltônico. Dalton descreveu uma doença hereditária que o impossibilitava de distinguir a cor verde da vermelha. c) e as filhas de homens daltônicos são sempre heterozigotos.2 e uma das irmãs desse indivíduo casar-se com um homem sadio. Um homem normal casou-se com uma mulher daltônica. a probabilidade de apresentar hemofilia é: a) 1 b) 1/2 c) 1/4 d) 1/8 e) 1/16 Questão 846 O esquema a seguir representa a ontogênese de João. Questão 843 O cientista John Dalton é bastante conhecido por suas contribuições para a Química e Física. a probabilidade desse casal ter um menino afetado é a) 3/4 b) 1/2 c) 1/4 d) 1/8 e) 1/16 Questão 842 Um homem hemofílico e uma mulher daltônica tiveram um filho com síndrome de Klinefelter (47. b) e as filhas de mulheres daltônicas são sempre daltônicos.5.2 abendo que o indivíduo 7 é do sexo feminino. Essa doença hereditária. O daltonismo é condicionado por um gene recessivo ligado ao sexo. recebeu o nome de daltonismo. b) daltônico e hemofílico.5. causada por um alelo recessivo ligado ao cromossomo X. Questão 844 1. embora seus pais não apresentem alterações cromossômicas numéricas em suas células 190 . d) de mulheres daltônicas sempre portam alelo para daltonismo. A probabilidade de terem um filho homem e normal é de: a) 0 b) 1/4 c) 1/3 d) 1/2 e) 1 Questão 845 Observe os heredogramas a seguir. e) de homens daltônicos sempre portam alelo para daltonismo.

b) Se foi o pai de João quem contribuiu com o gameta contendo um cromossomo a mais. c) Algumas células somáticas de cada filha apresentam o cromossomo X de origem paterna condensado. sendo somente transmitido pelas mães. a hemofilia e o daltonismo são características recessivas ligadas ao sexo. é menos condensado para permitir acesso da maquinaria de transcrição. Questão 849 A hemofilia é um distúrbio genético humano. O gene que codifica para a produção desse fator está localizado no cromossomo X em uma região que não apresenta homologia em Y. Questão 848 abendo que o daltonismo é uma herança recessiva ligada ao sexo. Um exemplo disso é a inativação completa de um dos dois cromossomos X em fêmeas de mamíferos. b) O "crossing-over" na gametogênese da mãe garante que Os dois heredogramas a seguir foram montados para duas famílias que apresentavam distúrbios musculares geneticamente determinados. ele obrigatoriamente contribuiu com o gameta responsável pela síndrome do filho.5. EXCETO: a) Se o pai de João é daltônico. é vista como uma mancha escura chamada corpúsculo de Barr. é correto afirmar. c) A mãe de João pode ser daltônica. A Atrofia Muscular Espinhal (AME) não impede a reprodução e pode ser transmitida pelo pai. o que permite expressar os dois alelos dominantes.5. que se caracteriza pela falta de um dos fatores de coagulação sangüínea. assinale a alternativa que traz uma explicação possível para o fato apresentado. Na espécie humana.somáticas.2 nalisando as informações e os heredogramas acima de acordo com seus conhecimentos. torna os indivíduos afetados incapazes de se reproduzir. Questão 847 Em geral. é correto afirmar. o cromossomo X de origem materna condensado. 1. d) Os dois caracteres DMD e AME não podem estar localizados no mesmo par de homólogos. esse pai é obrigatoriamente daltônico. situação que. mas pode não ser ela quem contribuiu com o gameta responsável pela síndrome do filho. O caráter Distrofia Muscular de Duchenne (DMD) é uma herança ligada ao sexo.5. enquanto a outra parte. 191 . 1. b) Não podem ser gerados descendentes do sexo feminino afetados por DMD. o DNA não-expresso é altamente condensado na forma de heterocromatina. pelo menos um dos avós de João também é daltônico. d) A não-expressão dos alelos dominantes recebidos garante que a filha seja normal para os dois caracteres. c) A AME pode ser um caráter ligado ao sexo. O DNA ativo no nível de transcrição. conhecido como eucromatina.5. d) Se a mãe de João é daltônica. O heredograma a seguir indica. EXCETO: a) Os dois caracteres DMD e AME acima são recessivos. ao microscópio. a) A permutação na espermatogênese permitiu que o pai tenha dado para a filha gameta contendo o alelo dominante para hemofilia.2 a filha receba dela os alelos dominantes para daltonismo e hemofilia no mesmo cromossomo. Sabendo que filhas de pai apenas hemofílico e mãe apenas daltônica e homozigota para hemofilia são normais para os dois caracteres.

000 nascimentos. B e C) que apresentam. em comum. os galos listrados de F são heterozigotos quanto aos alelos que determinam esse caráter. Manuel é certamente daltônico. d) A chance de o casal II-5 × II-6 ter uma criança afetada por esse caráter é de 1/4. Manuel certamente é normal. pelo menos dois indivíduos apresentam o gene causador de hemofilia.5.5. é INCORRETO afirmar: a) O pai de Maria não é portador. c) Se o gêmeo afetado for o do sexo masculino. EXCETO: a) Os galos com padrão de plumagem listrada representados.5.2 1. também com visão normal para daltonismo. 192 . c) O padrão da plumagem das galinhas depende dos alelos que recebem do seu progenitor do sexo masculino. receberam o alelo dominante de seu progenitor do sexo feminino. Questão 852 A Displasia Ectodérmica Anidrótica (DEA) apresenta prevalência na população de 1:100. Do casamento de Maria com Manuel nasceu um casal de gêmeos. enquanto os galos O caráter descrito é uma herança ligada ao sexo. é correto afirmar. três famílias (A. b) Nos dois experimentos. O fenótipo mais marcante dessa síndrome é a ausência de glândulas sudoríparas na pele. constituem o sexo homogamético (macho ZZ). é correto afirmar. 1. mas Maria é portadora do gene que causa daltonismo. b) Os dois gêmeos podem ter recebido o gene recessivo que determina o daltonismo. um progenitor afetado por essa anomalia. sendo um deles daltônico e outro normal. Questão 850 Um homem e uma mulher com visão normal tiveram uma filha.na segunda e terceira gerações. sendo uma síndrome hereditária recessiva ligada ao cromossomo X. d) Se o gêmeo afetado por daltonismo for do sexo feminino. d) O caráter plumagem lisa é recessivo em relação ao caráter plumagem listrada. Os experimentos a seguir foram desenvolvidos para se estudar a herança do caráter padrão da plumagem de galináceos da raça Langshan Black (fenótipo Lisa) cruzados com galináceos da raça Plymouth Rock (fenótipo Listrada). b) Não existem indivíduos portadores do gene da hemofilia na família B. Dessa forma as galinhas constituem o sexo heterogamético (feminino ZW). Sabendo-se que o daltonismo é uma característica determinada por gene recessivo ligado ao sexo. c) Na família C. pelo menos um indivíduo apresenta o gene causador de hemofilia. EXCETO: a) Na família A. Questão 851 Em Galináceos a determinação do sexo (sistema ZW) segue um padrão inverso ao que se observa em mamíferos (sistema XY). Maria.5. De acordo com as informações apresentadas.2 Analisando-se o heredograma.

b) I. não apresentam a síndrome. é INCORRETO afirmar: a) As manchas na pele das gêmeas representadas podem ser o resultado da ocorrência de heterocromatina para o cromossomo que carrega o alelo dominante. b) As gêmeas podem ter herdado o alelo recessivo tanto de seu pai quando de sua mãe. c) Metade dos descendentes machos das gêmeas deverão apresentar a síndrome. d) Um macho com o alelo recessivo pode passá-lo para suas filhas e filhos. Michele e Aline são membros de uma mesma família. O genoma humano é de 46 cromossomos. Nicolau II. Com base nas informações dadas e em seus conhecimentos. d) Somente I e III.5. fosse portadora do alelo para hemofilia é de a) 1/4 b) 1/64 c) 1/2 d) 1/8 e) 1/32 193 . que apresentarão o fenótipo da síndrome. b) Robson. Questão 855 1.5. as manchas que aparecem nessas mulheres são produzidas por um corante especial capaz de revelar áreas com poucas ou nenhuma glândula sudorípara. c) Somente II e III. A hemofilia é uma herança genética ligada aos cromossomas sexuais. Michele e Aline podem ser irmãos.2 fotografia mostra o último czar da Rússia. c) Michele pode ser mãe de Robson e de Aline. mesmo que o pai seja daltônico. que sofria de hemofilia.5. III.Questão 854 Robson. a) Robson pode ser filho de Aline. Está correta ou estão corretas: a) Somente I e II. heterozigotas e. Um irmão da czarina Alexandra também era afetado por essa doença. II. d) Robson pode ser pai de Aline e de Michele. Baseados nos mecanismos genéticos. sua esposa Alexandra. e) Nenhuma. II e III. filha do casal. poderíamos estabelecer os seguintes graus de parentesco. suas quatro filhas (Olga. e) Michele e Robson podem ser filhos de mãe daltônica e Aline a tia materna. Anastasia) e seu filho Alexis. as pessoas citadas apresentam o seguinte genótipo: Robson Michele Aline (Xd) Y (XD) (Xd) (XD) (XD) 1. Tatiana. A probabilidade de que Olga. portanto. No entanto. Questão 853 Analise as afirmações: I.5. Maria.2 A figura apresenta duas gêmeas univitelínicas. Para o caráter daltonismo. O daltonismo é transmitido por herança genética.

uma vez que o loco gênico está no cromossomo Y. o homem de etnia amarela apresenta uma característica determinada por um gene recessivo ligado ao sexo. Se um homem daltônico casa-se com uma mulher normal.2 elativamente aos indivíduos anteriores.5. Assinale a descendência 194 . O casal indicado pelos números 5 e 6 1.2 1. b) é heterozigoto para essa característica. não portadora do gene para o daltonismo.5.5. b) poderá ter apenas descendentes do sexo feminino com a doença. porém portador do gene para o daltonismo d) os indivíduos 4 e 5 são daltônicos Questão 860 Em drosófilas.5.5 % d) 0 % Questão 859 Observe a árvore genealógica a seguir. Descendendo de pais com visão normal. heterozigoto para essa característica.Questão 856 1. Questão 857 Na genealogia a seguir. a probabilidade desse casal ter um filho homem e daltônico é: a) 25 % b) 8 % c) 12. d) poderá ter metade de seus descendentes com a doença. as pessoas indicadas pelos números 3 e 6 apresentam uma doença rara determinada por um gene dominante localizado no cromossomo X. referente a uma família com herança para daltonismo (herança ligada ao sexo e deve-se a um gene recessivo). c) poderá ter apenas descendentes do sexo masculino com a doença. e) recebeu o gene de seu pai. d) recebeu o gene de seu pai.5. e a cor cinza pelo alelo dominante. heterozigota para essa característica. e) terá todos os seus descendentes com a doença. pode-se dizer que ele a) é homozigoto recessivo para esse gene. Na tira de quadrinhos.2 a) não terá chance de apresentar descendentes com a doença. Questão 858 O daltonismo é uma doença hereditária e ligada ao sexo na espécie humana. a cor amarela do corpo é determinada por um gene recessivo localizado no cromossomo X.5. podemos afirmar: a) somente o indivíduo 2 é daltônico b) o genótipo do indivíduo 4 é XdY c) o indivíduo 1 é normal. c) recebeu o gene de sua mãe.

(02) É uma doença mais comum em homens que em mulheres. d) Homem daltônico e mulher normal. c) Homem daltônico e mulher daltônica. Na prole de um homem afetado casado com uma mulher normal.5. b) Homem normal e mulher daltônica.2 195 . atinge indivíduos de um único sexo. 1. ligado ao cromossomo X.fêmeas: 100% cinzentas. Qual das opções fenotípicas abaixo corresponde à do casal em questão? a) Homem normal e mulher normal. a) machos: 100% amarelos .fêmeas: 100% amarelas. (04) As mulheres hemofílicas geralmente morrem na menarca.5. e) recessivo. (08) O mecanismo genético da hemofilia se deve à presença de um gene ligado ao sexo. localizado no cromossomo X. assinale o que for correto. d) machos: 50% cinzentos e 50% amarelos . b) dominante.fêmeas: 50% cinzentas e 50% amarelas. uma forma de daltonismo que provoca cegueira para as cores vermelho e verde. e) Homem normal e mulher normal. é determinada pelo gene recessivo d. c) tanto os filhos quanto as filhas sejam sempre normais. (01) É restrita ao sexo. Questão 863 Em seres humanos. Questão 865 Considere o heredograma: 1.esperada a partir do cruzamento entre uma fêmea amarela e um macho cinzento. Questão 862 Considere o heredograma a seguir. é possível concluir que a anomalia é devida provavelmente a um alelo a) localizado no cromossomo Y. e) machos: 50% cinzentos e 50% amarelos . já as meninas serão normais. b) machos: 100% cinzentos . anomalia hereditária caracterizada por uma deficiência na coagulação do sangue. e) apenas os filhos sejam afetados. c) recessivo. d) dominante. b) tanto os filhos quanto as filhas sejam sempre afetados. situado num autossomo. ou seja. localizado no cromossomo X. espera-se que a) tanto os filhos quanto as filhas possam ser normais ou afetados.2 partir da sua análise.5.fêmeas: 100% cinzentas. (16) Se transmite de pai para filho. situado num autossomo. d) apenas as filhas sejam afetadas.fêmeas: 50% cinzentas e 50% amarelas. Questão 864 Sobre a hemofilia. porém portadora de gene recessivo d. em virtude da não-coagulação do sangue. um casal fica sabendo que todos os seus filhos do sexo masculino serão daltônicos. Ao consultar um médico.5. c) machos: 100% amarelos . Questão 861 O raquitismo resistente à vitamina D é uma doença determinada por um gene dominante de herança ligada ao sexo.

grave anomalia relacionada à alteração no tempo de coagulação do sangue. c) esta anomalia será transmitida a todas as filhas. neste caso. e) esta anomalia não será transmitida a nenhum descendente. Macho sem pêlo: 1/8. ( ) Essa genealogia apresenta um tipo de interação gênica. sendo 58 autossomos mais dois cromossomos sexuais. como a cor da pele. Fêmea peluda: 3/8. Macho sem pêlo: 9/64.5. Questão 867 Um homem possui uma anomalia dominante ligada ao cromossomo X e é casado com uma mulher normal. influenciada pelo meio ambiente. Esse gene é representado por dois alelos. ( ) Essa árvore genealógica representa um caso de anomalia hereditária. Fêmea peluda: 9/64. ( ) Esse pedigree mostra um exemplo de herança passada do avô ou da avó para o neto por meio da mãe portadora. analise os itens. XX na fêmea. os cinco irmãos homens e um sobrinho de Joana são normais. Entretanto. Macho sem pêlo: 1/4. A partir do cruzamento XrY × XRXr. Fêmea peluda: 3/16. Questão 868 Em bovinos ocorrem 60 cromossomos na célula somática. o R. o marido. Fêmea sem pêlo: 1/16 c) Macho peludo: 3/8.5. responsável por animal sem pêlo. e o r. O gene responsável pela quantidade de pêlos no animal está situado no cromossomo X. Fêmea sem pêlo: 1/8 Questão 869 Observe a figura a seguir que apresenta o heredograma de uma família na qual alguns membros apresentam hemofilia. 196 . Fêmea peluda: 3/8. Em relação aos descendentes deste casal é CORRETO afirmar que: a) esta anomalia será transmitida a todos os filhos do sexo masculino. recessivo. é: a) 100% para todas as mulheres da família b) 100% para Joana. Essa figura indica os grupos sangüíneos do sistema ABO de alguns dos seus membros. Fêmea sem pêlo: 10/64 e) Macho peludo: 1/8. responsável por animal peludo. Macho sem pêlo: 3/8. d) esta anomalia será transmitida à metade das filhas. sua mãe e sua filha c) 100% para Joana e 50% para sua filha d) 100% para Joana e 50% para as outras mulheres da família e) 100% para Joana e 25% para sua filha Questão 866 Tendo em vista o heredograma. Fêmea sem pêlo: 1/8 d) Macho peludo: 36/64. e 58 autosomos mais XY no macho. determinada por um gene presente no cromossomo Y.2 as proporções fenotípicas esperadas na descendência são: a) Macho peludo: 1/4. Fêmea sem pêlo: 1/4 b) Macho peludo: 9/16. b) esta anomalia será transmitida à metade dos filhos do sexo masculino. 1. ( ) O caráter em questão é condicionado por um gene recessivo e ligado ao sexo. Fêmea peluda: 1/4.abe-se que o pai. Joana teve um filho que apresentou síndrome hemorrágica caracterizada por baixo nível plasmático do fator VIII da coagulação. A probabilidade genética de serem portadoras do gene para a hemofilia A. Macho sem pêlo: 3/16.

a) Ligada ao X. um rapaz descobriu que era daltônico.2 1. Questão 870 Ao fazer um exame de vista para tirar carteira de motorista.5. O gene que determina a ausência de G-6-PD é recessivo e situa-se no cromossoma X. b) a probabilidade de nascimento de outra criança hemofílica e do grupo B para o casal III-6 e III-7 é de 25%.5. 1.5.5. c) Ligada ao Y.5. A ausência dessa enzima.5. provocando sua destruição. b) Autossômica recessiva. Assinale entre as alternativas a seguir aquela que contém o heredograma que NÃO poderia representar a família desse rapaz.5. d) o indivíduo II-5 tem 50% de probabilidade de formar gametas do tipo iXh.2 Com base nas informações do heredograma e considerando-se que não ocorreu mutação.2 a) 1 b) 2 c) 3 d) 4 197 .2 1. em indivíduos afetados. 1. é INCORRETO afirmar-se que a) a probabilidade de II-3 ser portadora do gene da hemofilia é de 50%. Observe o heredograma que representa uma família com essa característica. e) o indivíduo I-1 é heterozigoto para o sistema ABO. Questão 872 A enzima G-6-PD (glicose-6-fosfato desidrogenase) está presente nas hemácias de indivíduos normais. torna as hemácias sensíveis a certas drogas e nutrientes. ssinale a alternativa que NÃO contém um tipo de herança compatível com a anomalia representada no heredograma.Questão 871 Analise o heredograma. d) Autossômica dominante.5. c) o indivíduo III-4 pode receber sangue de III-6.

é CORRETO afirmar que a) cada um dos indivíduos representados tem. c) casais como I. analise os itens: 1.2 têm probabilidade maior de ter filhos afetados do que de ter filhas afetadas. b) o indivíduo II.4 é homozigota 4. Questão 874 Analise este heredograma.5. A mulher I. é CORRETO afirmar que a) o indivíduo I.2 198 . inicia-se na infância e impede a reprodução dos afetados. em que está representada a herança do daltonismo. d) o indivíduo II-3 pode ter recebido o gene da G-6-PD tanto do seu pai quanto de sua mãe.2 têm maior probabilidade de ter filhos do sexo masculino daltônicos.2 .9 é homozigota Está(ão) correto(s) apenas: a) 1 b) 2 c) 3 d) 1 e 3 e) 1 e 2 Questão 876 A figura a seguir faz referência a uma genealogia que ilustra a ocorrência de uma determinada doença genética. A mulher III.2 serão daltônicos. b) indivíduos do sexo masculino afetados por essa distrofia muscular são filhos de mães heterozigotas. doença recessiva ligada ao cromossomo X.5 é heterozigota 5. A mulher I. 1. pelo menos. Questão 875 Considerando que o heredograma a seguir é o de uma herança dominante.2 é heterozigota 3. d) os filhos do sexo masculino de II.2 é homozigota 2.5. A mulher III. condicionada por gene recessivo localizado no cromossoma X: Considerando-se as informações contidas nesse heredograma e outros conhecimentos sobre o assunto. b) essa família apresenta dois indivíduos heterozigotos para o gene que determina a G-6-PD. é INCORRETO afirmar que a) casais com filhos afetados têm 25% de probabilidade de ter outra criança com essa doença. c) os casais como I. caracteriza-se por debilidade muscular progressiva e deformidades ósseas. Questão 873 A distrofia muscular do tipo Duchenne.om base nesse heredograma. d) mulheres afetadas recebem os cromossomos X materno e paterno com o gene para essa distrofia. c) indivíduos do sexo masculino que possuem um gene mutante para essa distrofia manifestam a doença. independentemente do genótipo do seu pai.1 e I. um gene para ausência de G-6-PD.4 recebeu o gene do daltonismo de qualquer um de seus genitores. Analise-a e avalie as proposições dadas.2 apresenta o fenótipo normal e é portador do gene do daltonismo.5.1 x I.5. Considerando-se essas informações e outros conhecimentos sobre o assunto. ligada ao X. A mulher II.

2 ( ) A característica mostrada no heredograma é determinada por uma série polialélica de genes autossômicos. analise as afirmativas. MARTHO. Com base nos textos e em seus conhecimentos. 199 . sendo responsável por este tipo de hemofilia. Estão corretas apenas as afirmativas a) I e IV. São Paulo: Ed. Moderna. enquanto que o indivíduo 5 não apresenta este alelo.5. somente o indivíduo 6 é portador do alelo recessivo que causa a hemofilia. J. III. IV. e o indivíduo 8 pode ou não ser portador deste alelo recessivo. ( ) Observando-se que a maioria dos machos (I. ( ) O loco gênico determinante deste caráter deve estar localizado na porção não-homóloga do cromossomo X. um dos tipos mais graves. é causada pela deficiência de um dos fatores que agem na coagulação. A hemofilia A. III. o fator VIII. considerando que os indivíduos 2 e 4 são irmãs. III„ e III…) manifestam a característica em consideração. a probabilidade de terem filhos hemofílicos é de 50% e de terem filhas hemofílicas é de 0%. c) II. Um círculo preto representa uma mulher surda e um círculo branco representa uma mulher normal. III‚. pode-se concluir que se trata da herança de genes localizados no cromossomo Y.. 1) de uma família em que ocorre a hemofilia A. o alelo mutante (h) condiciona ausência do fator VIII. genótipos da figura 2 e a consangüinidade. ( ) Os descendentes III„ e III… apresentam o mesmo genótipo.M.5.5. d) I e II. Dos primos que se casaram. Esse fator é uma proteína cujo gene codificador encontra-se no cromossomo X. pois herdou da mãe o alelo normal (H). o alelo normal (H) produz o fator VIII e condiciona fenótipo não hemofílico. G.R. condicionou a manifestação do alelo deletério h para hemofilia.2 1. respectivamente.5. Observe o heredograma (fig. ( ) A identidade genotípica é também observada entre II e IIƒ. I. pois herdou o alelo recessivo para ausência do fator VIII de sua mãe. AMABIS. através da união entre primos irmãos (indivíduos 5 e 6). Questão 878 O diagrama abaixo mostra a surdez em três gerações de uma família. "Conceitos de Biologia". Um quadrado preto representa um homem surdo e um quadrado branco um homem normal. II„. 2003. b) III e IV. II. V3. Se o indivíduo 7 tiver filhos com uma mulher que tenha o mesmo genótipo para hemofilia de sua avó materna. As irmãs 2 e 4 apresentam. O indivíduo 7 é hemofílico. Questão 877 A hemofilia é uma doença hereditária em que há uma falha no sistema de coagulação do sangue.1. e) I e III.

a probabilidade é 75%. que leva a uma debilidade muscular progressiva (distrofia muscular progressiva). Em uma família. (16) Machos afetados descendem de machos também afetados. .2 (08) Esse gene deve se manifestar apenas nos machos. e) o pai obrigatoriamente apresenta a cegueira da cor verde. a probabilidade é 100%. b) o pai é heterozigoto para a cegueira da cor verde. É correto afirmar que: a) a mãe obrigatoriamente apresenta a cegueira da cor verde. d) a mãe é pelo menos heterozigota para a cegueira da cor verde. a filha possui visão normal.5.1. Seu alelo recessivo é responsável pelo fenótipo cauda normal. b) machos e fêmeas com cauda curta e retorcida na proporção de 2:1. localizado no cromossomo sexual comum aos dois sexos. (04) Esse gene deve se manifestar com maior freqüência nos machos. o fenótipo cauda curta e retorcida é determinado por um gene dominante denominado "Bent". b) autossômica recessiva. c) Se a mulher for homozigota. c) dominante ligada ao sexo. c) o pai é homozigoto para a cegueira da cor verde. .5. (32) Machos afetados descendem de fêmeas portadoras ou afetadas. Em camundongos. (02) Esse gene deve se manifestar com maior freqüência nas fêmeas. Questão 880 Genes situados na porção ímpar do cromossomo X são transmitidos segundo um padrão definido como Herança Ligada ao Sexo. e) holândrica. sua descendência apresentará a seguinte proporção: a) machos e fêmeas com cauda curta e retorcida na proporção de 100%. d) Se a mulher for heterozigota. .seus pais não são afetados. Considerando um gene recessivo e localizado nessa porção do cromossomo X.Uma mulher com fenótipo normal tem um irmão afetado e um tio materno também afetado pela doença. a probabilidade é zero. b) Se a mulher for homozigota. Questão 879 A cegueira da cor verde na espécie humana é uma característica recessiva ligada ao sexo. localizado na região não homóloga do cromossomo X. e) todos os machos com cauda normal e todas as fêmeas com cauda curta e retorcida. Questão 882 Existe uma doença condicionada por um gene recessivo. Se uma fêmea de cauda normal for cruzada com um macho de cauda retorcida. a probabilidade é 25%. enquanto o filho não enxerga a cor verde. d) recessiva ligada ao sexo. é correto afirmar: (01) Esse gene deve se manifestar com igual freqüência em machos e fêmeas. d) todos os machos com cauda curta e retorcida e todas as fêmeas com cauda normal. (64) Fêmeas afetadas são necessariamente descendentes de fêmeas afetadas. Qual a probabilidade de que um(a) filho(a) deste casal venha a ser afetado pela doença? a) Se a mulher for homozigota. c) machos e fêmeas com cauda normal na proporção de 100%.ela está casada com um homem normal. Soma ( ) Questão 881 condição de surdez mostrada no heredograma é herdada como uma característica: a) autossômica dominante. 200 .

em uma região sem homologia no cromossomo Y. Aa. Questão 883 Interprete o heredograma abaixo. é possível encontrar um máximo de três fenótipos e dois genótipos.5.5.O homem não hemofílico pode ser o pai do menino. d) Apenas I e II. c) Apenas III. (04) Entre as mulheres. preto. e possui um alelo ligado ao X recessivo b. do sexo masculino. preto. (01) Não é possível a existência de mulheres hemofílicas. b) A mãe é malhada e o pai. amarelo. d) A mãe é preta e o pai. Questão 888 A hemofilia é uma doença hereditária em que há um retardo no tempo de coagulação do sangue. Quando metade das fêmeas de uma ninhada é malhada. o gene para o daltonismo encontra-se: a) em todas as células somáticas. d) apenas nas células-mãe dos gametas. b) Apenas II. b) em todas as células gaméticas. II . Quais estão corretas? a) Apenas I. e) A mãe e o pai são pretos. Assim. Com relação a essa doença. assinale a(s) proposição(ões) CORRETA(S). e) apenas nos gametas com cromossomo y. estão envolvidos um homem que tem a doença e outro que não a tem.2 dentifique o mais provável padrão de herança representado no heredograma.O homem hemofílico não pode ser o pai do menino. . Que proporção dos seus espermatozóides espera-se que seja A/Xö ? a) 0 % b) 25 % c) 50 % d) 75 % e) 100 % Questão 885 Nos gatos domésticos a cor do pêlo é ligada ao cromossomo X. e metade dos machos é amarela. Questão 887 Assinale a proposição CORRETA.As bases genéticas da hemofilia apoiam a paternidade do homem hemofílico. a outra metade é preta.e) Se a mulher for heterozigota. a) autossômica dominante b) ligada ao X dominante c) ligada ao Y dominante d) ligada ao Y recessiva e) ligada ao X recessiva Questão 884 Um homem é heterozigoto para um gene autossômico. Questão 886 Em um caso de disputa da paternidade de um menino hemofílico. a probabilidade é 100%. e) Apenas II e III. os machos podem se pretos ou amarelos e as fêmeas podem ser pretas amarelas ou malhadas. e decorre do não funcionamento de um dos fatores bioquímicos de coagulação. Em um indivíduo daltônico. I . III . 201 1. (02) É condicionada por um gene que se localiza no cromossomo X. c) A mãe é amarela e o pai. c) apenas nas células do globo ocular. (Hemofilia: herança recessiva ligada ao X) Analise as afirmações abaixo a esse respeito. de que cores são os pais? a) A mãe é malhada e o pai. amarelo.

d) 1/8. 50% de machos com cerdas retorcidas e 100% de fêmeas normais. não portadora. Analise as afirmativas abaixo. por isso.menino com daltonismo. b) 50% de machos normais. que acarreta degeneração e atrofia dos músculos. 50% de fêmeas com cerdas retorcidas e 50% de fêmeas normais. (32) É um exemplo de herança ligada ao sexo. III. . as mulheres heterozigotas para o gene da distrofia muscular de Duchenne podem apresentar graduações da característica.Devido à inativação ao acaso de um cromossomo X. d) 3/4. há uma maior incidência dessa doença entre eles. a probabilidade de nascimento de uma criança do sexo masculino e hemofílica é a) 1/2. espera-se que 50% deles sejam normais e 50% sejam hemofílicos. e) 3/4. o caráter cerdas retorcidas é determinado por um gene recessivo e ligado ao sexo. A descendência esperada será de a) 50% de machos e 50% de fêmeas normais e 50% de machos e 50% de fêmeas com cerdas retorcidas. e) 100% de machos normais e 100% de fêmeas com cerdas retorcidas. a distrofia muscular de Duchenne é uma doença condicionada por um gene recessivo localizado no cromossomo X. b) I e III. Questão 889 A hemofilia é uma doença recessiva ligada ao sexo. mesmo no caso de pequenos ferimentos. São corretas as afirmativas a) apenas III. (16) Entre os descendentes de um homem hemofílico e de uma mulher normal. d) I e II.A distrofia muscular de Duchenne é uma doença que ocorre quase que exclusivamente em meninos. Questão 892 Na espécie humana. a possibilidade de esse casal ter uma filha com daltonismo é a) zero. Questão 891 Um casal que possui visão normal para as cores. é possível ocorrer apenas um genótipo.menino com visão normal para as cores. Os homens afetados começam a apresentar os sintomas na primeira infância e não se reproduzem porque morrem antes de atingir o período reprodutivo. c) 1/2. II. Em um casal em que a mulher é heterozigota para a hemofilia e o marido é normal. Uma fêmea heterozigota foi cruzada com um macho normal. b) 1/4. Soma ( ) . em que os indivíduos afetados têm graves hemorragias. I. Sabendo-se que o daltonismo é uma herança ligada ao X. c) 100% de machos normais. O alelo dominante determina cerdas normais (não retorcidas). c) 1/4. e) 1. b) 1/3.(08) Entre os homens. d) 100% de machos com cerdas retorcidas e 100% de fêmeas normais. tem 3 filhos com as seguintes características: 202 .menina com visão normal para as cores. que se caracteriza pela dificuldade de coagulação do sangue.A distrofia muscular de Duchenne é uma doença que ocorre exclusivamente no sexo masculino. . Questão 890 Em drosófila. c) II e III. Questão 893 Observe a genealogia abaixo sobre uma família que apresenta pessoas afetadas por uma anomalia hereditária. que ocorre nas células das fêmeas dos mamíferos (hipótese de Lyon).

cruzada com um macho preto. Com base no heredograma a seguir. Questão 896 Com relação à coloração da pelagem de gatos.5. Um casal não-calvo e de visão normal tem um filho calvo e daltônico. 203 . Marque a alternativa correta. Considerando os dados apresentados. c) O genótipo da Sra 8 é XHXH. (3) Um gato macho não transmite para seus filhos machos os genes para cor da pelagem. serão manchados.2 anomalia em questão é transmitida por meio de um gene a) recessivo ligado ao cromossomo X. (2) Os descendentes de uma fêmea amarela. I . d) Apenas III está correta.5. b) autossômico recessivo. c) II e III são corretas. analise as afirmativas a seguir.5.25% das filhas do casal poderão ser calvas e daltônicas. III . O gene que condiciona a calvície é dominante nos homens e recessivo nas mulheres. Questão 895 O gene h que determina a hemofilia na espécie humana é recessivo e está localizado no cromossomo X. é condicionado por genes ligados ao cromossomo X. de visão normal em um dos olhos.2 Utilizando as informações anteriores.5. (1) As fêmeas manchadas são heterozigotas para o caráter cor da pelagem. b) O genótipo da Sra 5 é XHXh. observam-se os seguintes fenótipos: 1. podemos afirmar corretamente: a) O genótipo da Sra 5 é XHXH. (0) O caráter cor da pelagem. não havendo dominância. O daltonismo é de herança recessiva ligada ao cromossomo X. b) I e III são corretas. a calvície hereditária é uma característica influenciada pelo sexo. e) O genótipo da Sra 8 é XhXh. c) dominante ligado ao cromossomo X.5. Questão 894 Na espécie humana. a) I e II são corretas. d) autossômico dominante. d) O genótipo do Sr 9 é XHY. nos gatos. julgue os itens a seguir.5.2 1.A mulher é dupla heterozigota para os genes em questão.1. mas daltônicas do outro. II .É possível que o casal tenha filhas não-calvas.

sendo que seu alelo dominante condiciona visão normal. Questão 898 Considere o heredograma. b) 0. Uma mosca fêmea com olhos coloridos. cuja mãe tinha olhos brancos.00. (01) O daltonismo está relacionado com genes localizados em cromossomos autossômicos. (32) O genótipo do indivíduo 9 é XdY. Indique a alternativa com a probabilidade desse casal ter uma filha hemofílica: a) 0% b) 25% c) 50% d) 75% e) 100% 1. portadoras do gene.5. Questão 901 Um casal não hemofílico teve um filho do sexo masculino com hemofilia. c) 3. Questão 899 Uma mulher é portadora de um gene letal presente no cromossomo X. Qual é a probabilidade de se obter uma fêmea de olhos brancos deste cruzamento? a) 1.67. Este gene provoca aborto espontâneo algumas semanas após a formação do zigoto. a(s) correta(s). certamente. certamente. d) 4. podemos afirmar que a) a mulher 2 é homozigota. cruza-se com macho de olhos brancos. que representa uma família portadora de caráter recessivo condicionado por um gene situado em um dos cromossomos sexuais. d) 0.5.2 Assinale dentre as alternativas que se seguem.50. e) 5. (64) O genótipo do indivíduo 5 é XdXd. Se esta mulher der à luz seis crianças normais. d) todas as filhas do casal 1 e 2 são portadoras do gene. b) 2. (04) O indivíduo 1 transmite a todas as suas filhas um cromossomo Xd. (08) O indivíduo 8 tem o mesmo fenótipo de sua avó materna.2 respeito desta genealogia.00. 204 . e) 0. 1. c) as mulheres 2 e 3 são. (16) O casal 1 x 2 pode ter filhos homens daltônicos.Questão 897 Em moscas de frutas.5. certamente.5. a cor branca dos olhos é devida à herança ligada ao sexo. portadoras do gene. e) os homens 1 e 4 são. o número esperado de crianças do sexo masculino será a) 1. b) as filhas do casal 3 e 4 são. em seis partos diferentes.25. c) 0. Questão 900 A genealogia abaixo nos mostra uma forma de transmissão do daltonismo. (02) O daltonismo é determinado por um gene recessivo. portadores do gene.

pode-se afirmar que: a) I e II são situações nas quais os genes segregam-se independentemente. isto é. e) o albinismo. e todos os seus filhos são homens. b) em todos os homens. d) transmitidas do pai para os filhos homens e filhas em 100% dos casos. e) exclusivas das mulheres. c) herança holândrica.AB (50%). d) Entre as minhas filhas. trabalhou com apenas uma característica de cada vez. todos os meus descendentes também o terão. Este fenômeno é chamado de: a) epistasia.Questão 902 Na espécie humana. b) o aparecimento do corpúsculo de Barr. Questão 907 Mendel. Ab (10%). a determinação cromossômica do sexo é dada pelos cromossomos X e Y. Na próxima geração dessa família esse gene se manifestará a) em todas as mulheres. Posteriormente. I . c) Se o meu irmão não tiver esse Y. d) o daltonismo. respectivamente. ab (50%). apenas 50% terão esse cromossomo. e) somente nos homens heterozigotos. aproximadamente. Assinale a suposição que está geneticamente coerente: a) Acho que o meu pai herdou essa condição genética da mãe dele. Um homem com hipertricose casa-se. talvez ele não seja meu irmão. Observando as seguintes proporções de gametas produzidos pelo diíbrido AaBb em três situações distintas. e) interação gênica. d) pleiotropia. Questão 903 A hipertricose auricular é uma anomalia genética condicionada por um gene localizado no cromossomo Y. b) II e III são situações nas quais ocorre segregação independente e ligação gênica sem "crossing-over". ou seja. ele acompanhou a transmissão de dois caracteres ao mesmo tempo. b) codominância. determinada por genes localizados no cromossomo Y. Ab (25%). Esta observação foi enunciada como "2 Lei de Mendel" ou "Lei da Segregação Independente". c) transmitidas do pai só para as filhas. III . Questão 906 A hipertricose auricular (pêlos na orelha) é transmitida apenas pelo homem e somente para os filhos do sexo masculino. Embora sem nenhuma manifestação fenotípica aparente. e) Provavelmente esse Y ficou grande para ser o homólogo do X. ab (40%). O cromossomo Y apresenta genes holândricos. II . genes que não possuem homologia com o cromossomo X. isto é.AB (25%). ele fez algumas suposições sobre a herança desse cromossomo. ab (25%). em relação ao padrão de cromossomo Y presente na população. As características condicionadas por tais genes são a) transmitidas da mãe para 100% das filhas. aB (25%). 30% a mais de heterocromatina na região distal. b) Se eu tenho este Y. nas primeiras experiências sobre hereditariedade. 205 . por genes holândricos. Questão 904 Como exemplo de característica na espécie humana. b) transmitidas do pai para 100% dos filhos homens. Questão 905 O exame citogenético de um indivíduo normal revelou que o seu cromossomo Y contém. c) a hemofilia. a qual não é válida para os genes que estão em ligação gênica ou "linkage".AB (40%). d) somente nas mulheres heterozigotas. temos: a) a diferenciação dos testículos. aB (10%). e os resultados levaram-no a concluir que: "fatores para dois ou mais caracteres são transmitidos para os gametas de modo totalmente independente". c) em 50% das mulheres e 50% dos homens. genes que estão localizados nos mesmos cromossomos.

e) Dez. b) Quatro. ocorrer permutação entre os locos A e B. pode-se inferir que ocorreu permutação (ou crossing-over). c) Oito. Questão 912 A freqüência de recombinação entre os locos A e B é de 10%. 1. Em quantos grupos de ligações seus genes estarão associados? a) Quatro. ( ) Se.c) I e III são situações nas quais ocorre segregação independente e ligação gênica com "crossing-over". em 50% das células produtoras de gametas. Questão 908 Considere uma espécie de vertebrado cujas células embrionárias têm oito cromossomos. respectivamente. a partir do cruzamento acima indicado. ( ) Considerando o cruzamento ilustrado na figura. ( ) A probabilidade do aparecimento de um indivíduo AB//ab. Questão 911 Quando dois genes estão em um mesmo cromossomo. Em que percentual serão esperados descendentes de genótipo AB // ab. c) constituem um caso de interação gênica. existe uma ligação gênica. e) III é uma situação na qual ocorre ligação gênica sem "crossing-over". A esse propósito. um com genótipo AaBb e outro com genótipo aabb resultou numa F com as seguintes proporções: AaBb = 35% aabb = 35% Aabb = 15% aaBb = 15% Com esses resultados. Questão 910 O cruzamento de dois indivíduos. pode-se concluir que os genes "a" e "b": a) estão em um mesmo braço do cromossomo. cada tipo de gameta recombinante (Ab e aB) aparecerá com freqüência de 25%.5. em 8. os gametas não recombinantes e os recombinantes surgirão nas proporções esperadas de 1:1:1:1. d) Oito. d) II é uma situação na qual ocorre ligação gênica com "crossing-over". no cromossomo. Em quantos grupos de ligações seus genes estarão associados? a) Dois. Questão 909 Considere uma espécie de vertebrado cujas células somáticas têm 12 cromossomos.5% das células formadoras de gametas. b) seguem as leis do diibridismo. ocorrer permutação entre os locos A e B. e) são epistáticos. d) são pleiotrópicos.6 ( ) A freqüência de recombinação entre os locos A e B é de 17%. e) Número variável. é de aproximadamente 42%. a partir de progenitores com os genótipos mostrados na figura? 206 . ( ) Se. c) Três. analise a figura e as afirmações feitas a seguir. A taxa de recombinação entre eles dependerá do quanto estiverem afastados um do outro. d) Dezesseis. b) Seis. em 100% das células germinativas da fêmea.

e pilosidade no cálice da flor . foram cruzadas com plantas de fenótipo (ab). obtendo-se uma F2 como mostrado no quadro. foi observado que todas as plantas que apresentavam flores roxas.5. d) em ambas as situações ficou evidenciado o efeito pleiotrópico entre os genes.6 ( ) Trata-se de um caso de ligação gênica. c) a primeira situação evidencia ligação gênica e a segunda mostra a segregação independente dos genes. 1. a ligação é mais forte do que na primeira. são determinados. e) em ambas as situações ficou evidenciada a ligação gênica. ambos com dominância completa. fenotipicamente (AB). ocorreu permutação entre os locos A e B.roxo e branco -.com (piloso) e sem (glabro). A geração P é genotipicamente (AB//AB) x (ab//ab). respectivamente. Entretanto. foi retrocruzada com o pai duplo-recessivo. foi observada na progênie a seguinte proporção (situação 2): 1. pelos locos A e B.5.Questão 914 Uma determinada espécie vegetal apresenta variação para cor da flor . 207 . Analise as proposições a seguir quanto à correção. Com base no texto e em seus conhecimentos é correto afirmar que a) a primeira situação pode representar um caso de pleiotropia e a segunda mostra um caso de ligação gênica. o que mostra uma distância menor entre os genes. A F1. o hipocótilo era verde (situação 1). Em todos os cruzamentos realizados entre plantas fenotipicamente diferentes e após avaliações em várias gerações segregantes. fenotipicamente (AB). o hipocótilo era roxo e todas as plantas que apresentavam flores de cor branca.roxo e verde .6 a) 5% b) 90% c) 45% d) 10% e) 20% Questão 913 Dois fenótipos de interesse econômico. ( ) Em 35% das células gaméticas da F1 ocorreu recombinação.6 1. b) a primeira situação pode representar um caso de pleiotropia e a segunda evidencia uma segregação independente dos genes. ( ) Os locos A e B distam entre si de 35 unidades de mapa. Plantas homozigóticas. ( ) Em 60% das células formadoras de gametas da F1. A cor roxa da flor e do hipocótilo e a presença de pilosidade são dominantes. ao cruzarem um duplo heterozigoto para os caracteres cor da flor e pilosidade no cálice da flor com um duplo-recessivo. ( ) A taxa de recombinação no caso mostrado é de 30%. sendo que na segunda.5. em milho. cor do hipocótilo .

A freqüência esperada de indivíduos heterozigotos será de: a) 70% b) 48% c) 36% d) 16% e) 10% Questão 917 A doença de Tay-Sachs resulta da ação de um gene mutante localizado no cromossomo número 15. II. Nessa mesma população foi observado que 64% das pessoas apresentam esta característica. V . Em 2. III e IV c) Apenas I. o qual determina a doença chamada siclemia ou anemia falciforme. IV .Quando uma característica particular de um organismo é governada por muitos pares de genes. IV e V e) I. O diagnóstico pré-natal é possível. os heterozigotos sofrem de uma forma branda da anemia mas.5. III e V d) Apenas II. IV e V Questão 916 Numa determinada população a capacidade de enrolar a língua é determinada por um gene dominante A. estão presentes na população. enquanto um organismo com dois alelos diferentes para um mesmo "locus" é considerado heterozigoto para este "locus". Em certas comunidades da Europa Central. III e IV b) Apenas I. para um dado "locus". Os homozigotos siclêmicos morrem precocemente devido à severa anemia.Os genes em um mesmo cromossomo tendem a ser herdados juntos e são denominados "genes ligados" II . e há tentativas de tratamento com algum sucesso em poucos casos. Quais afirmativas o professor diria que estão corretas? a) Apenas II. que possuem efeitos similares e aditivos. III . uma em cada 30 pessoas apresenta fenótipo normal e é heterozigota quanto ao gene determina a doença de Tay-Sachs. nós dizemos que esta característica é uma característica poligênica. II. o número esperado de casamentos com risco de gerar crianças com degenerescência nervosa é: a) 0. O gráfico refere-se ao período posterior à erradicação da malária. são mais resistentes à malária que os indivíduos normais. Qual a explicação para o comportamento das curvas do gráfico? 1. II.700 casamento ocorridos entre membros sadios dessas comunidades.Quando três ou mais alelos. III.Questão 915 Os seguintes conceitos genéticos foram escritos por um aluno que estava com dúvidas sobre a matéria e que pediu a um professor qualificado que os conferisse: I .A aparência de um indivíduo com respeito a uma dada característica herdada é chamada de fenótipo.Um organismo com dois alelos idênticos para um "locus" em particular é considerado homozigoto para este "locus". dizemos que este "locus" possui alelos múltiplos. III.7 208 . por outro lado. provocando a degenerescência nervosa mortal.3 b) 3 c) 45 d) 60 e) 90 Questão 918 O gráfico a seguir mostra a dinâmica das freqüências do gene s.

c) 1008 e 192. c) o nascimento de 48 indivíduos afetados entre 300 nascidos. aa . d) AA . aa .280.4/16. d) 1152 e 48.8 e 0. ao seu alelo recessivo i.1/16. d) Cruzamentos preferenciais entre pessoas anêmicas.400. Aa .440. Questão 920 A freqüência de indivíduos afetados por uma anomalia genética autossômica recessiva. Aa . Sabendo-se que.8/16.4/16. se as proporções genotípicas forem: a) AA .320. c) Aumento da freqüência de mutação de S para s. b) 1. c) 0. os números esperados de pessoas sensíveis e insensíveis nessa população são. enquanto que a outra metade é composta por indivíduos duplo-recessivos (aa). Constatou-se a diminuição dessa freqüência após a) a morte de 5% da população total por falta de alimento.4/16.6. e) 0. aa . Se.6.000 d) 1/50. b) AA . e) 816 e 384. respectivamente. e) AA . Aa .6/16.120. em uma dada população. e) o crescimento da população da população devido a diminuição da predação.00. concluímos que a freqüência de indivíduos homozigotos recessivos (aa) é de: a) 6.1. Questão 925 A hemofilia é causada por um gene recessivo (h) localizado no cromossomo X.160. numa população constituída de 8.8. numa determinada população. Nessa população a freqüência do alelo A é a) impossível de se determinar. Aa .560. a) AA . aa .500 c) 1/25.6/16.000 indivíduos. respectivamente: a) 960 e 240.280. Questão 921 A sensibilidade (gosto amargo) do ser humano ao PTC (feniltiocarbamida) se deve a um gene autossômico dominante I e a insensibilidade.75. um homem em 25.50. Essa população estará em equilíbrio genético.1.16.9/16. aa . aa .560. Aa .160. e) AA . Questão 919 Considere uma população em que metade dos indivíduos mantém-se heterozigota para um dado gene (Aa). b) Seleção contra os portadores do gene s. e) Cruzamentos preferenciais entre portadores de malária. aa . Aa . d) AA .000 é hemofílico.1/16. Aa . d) o casamento preferencial de indivíduos heterozigotos.400.a) Diminuição da freqüência de mutação de S para s. Aa .9/16.1/16.9/16.1.600.25% b) 12.25. as freqüências dos genes I e i são. d) 0. Questão 923 Sabendo-se que uma população está em equilíbrio genético e que a freqüência de indivíduos homozigotos para um caráter autossômico e dominante (AA) é de 25%.6/16.120. numa população de 1200 pessoas.6/16.2.280.320. Questão 922 Numa população. aa . 0. se essa população estiver em equilíbrio genético. c) AA .1.5.000 209 . era de 0. Aa .5% c) 25% d) 50% e) 75% Questão 924 Sabendo-se que a freqüência do gene autossômico A é igual a 0. b) AA . aa . Aa . aa .2. indique a alternativa que mostra o número de indivíduos para cada genótipo.6/16. b) 768 e 432. b) a imigração de muitos indivíduos homozigotos dominantes. a freqüência de um gene autossômico dominante A é o triplo da freqüência do seu alelo recessivo a.1.6. c) AA .5. a freqüência do gene h nessa população é a) 1/500 b) 1/12.

7 1.1 x III. 16% apresentavam asas vestigiais. que tem sua expressão influenciada pelo sexo. Questão 930 A calvície na espécie humana é determinada por um gene autossômico C.7 Questão 929 Uma população em que atuam os princípios postulados por Hardy e Weinberg.e) 1/100.7 abendo-se que a freqüência de heterozigotos na população é 1/20.5. as freqüências genotípicas de um determinado par de alelos "a" se distribui de acordo com o gráfico destacado: Marque o gráfico que representa a freqüência genotípica após 12 gerações: 1. 1. Esse caráter é dominante nos homens e recessivo nas mulheres. calcularam-se outras freqüências. Assinale a alternativa correspondente aos cálculos corretos.5. a probabilidade do casal III.2 vir a ter uma criança com a anomalia é a) 1/420 b) 1/160 c) 1/120 d) 1/80 e) 1/50 Questão 928 Em drosófilas. espera-se que sejam heterozigotos a) 700 b) 420 c) 90 d) 49 e) 21 Questão 927 Analise o heredograma a seguir no qual os símbolos escuros significam a presença de uma anomalia. o comprimento das asas é determinado por um par de genes. em uma população mantida em laboratório.000 Questão 926 Em uma população em equilíbrio de Hardy-Weinberg.5. que estão indicadas na tabela abaixo. Se essa população for formada por 1000 indivíduos. a freqüência do alelo autossômico (b) é de 30%. como mostra a tabela a seguir: 210 . O alelo que condiciona asas longas é dominante sobre o alelo que condiciona asas vestigiais. Sabendo-se que.

a freqüência de indivíduos do grupo M é 49%.60 e 0. 1. formada por 10.000 indivíduos revelando os dados apresentados no quadro abaixo.24 e 0.1. existem 900 do tipo Rh negativo. as freqüências esperadas de indivíduos dos grupos N e MN são. respectivamente. Essa característica é determinada por um par de alelos entre os quais não há dominância.48 e 0. 211 m uma população. que sempre é influenciada por fatores ambientais. e) 0. a) 0.16.7 esta população.40.000 indivíduos. d) a freqüência dos alelos para olhos escuros ser maior nas populações sul-americanas do que nas européias. b) 0. Espera-se que o número de indivíduos Rh positivo homozigoto nessa população seja de a) 9. enquanto em diversas populações européias acontece o inverso: pessoas de olhos escuros constituem a minoria. onde 81% dos homens não apresentam genótipo capaz de torná-los calvos. Essa diferença deve-se fato de a) a herança da cor dos olhos não obedecer às leis de Mendel. A análise da população estudada concluiu que a mesma se encontra em equilíbrio de Hardy-Weinberg.24.16 e 0. Se em uma população em equilíbrio de Hardy-Weinberg.7 .100 e) 900 Questão 933 Sabe-se que olhos escuros são dominantes sobre olhos azuis. N ou MN. Um levantamento nos prontuários médicos de um importante hospital brasileiro identificou o grupo sangüíneo MN de 10. c) a dominância dos genes relacionados com a cor dos olhos modificar-se com o ambiente. as freqüências dos alelos M e N são.48.36 e 0. d) 0. e) tratar-se de um caso de herança quantitativa.5% c) 19% d) 42% e) 81% Questão 931 Para responder à questão. em equilíbrio de Hardy-Weimberg.100 b) 4.900 c) 4.5. Questão 934 Na espécie humana. qual a freqüência esperada de mulheres cujo genótipo pode torná-las calvas? a) 1% b) 8. na maioria das populações da América do Sul predomina o número de pessoas de olhos escuros. Questão 932 Numa população em equilíbrio de Hardy-Weinberg. c) 0. b) a mecanismo de herança da cor dos olhos não ser ainda bem conhecido. Sabe-se também que. considere a informação a seguir. há certas proteínas no sangue que permitem classificar as pessoas como pertencentes ao tipo sangüíneo M.5.84.550 d) 2.

a população não está em equilíbrio. (01) A população está em equilíbrio se estiver ocorrendo seleção natural há.. e fatores evolutivos ..(3).34 e 0. atuantes b) Infinitamente grande.. (32) Quando todas as freqüências genotípicas são iguais. Em uma população que está 212 . ausentes d) Pequena.44 e 0. com p=0. (64) A população está em equilíbrio apenas quando 75% dos indivíduos apresentam o fenótipo D e 25% apresentam o fenótipo R. ausentes e) Pequena. direcionados. 2pq e q£.49 e 0.. d) ao seu efeito dominante. atuantes Questão 937 Em uma população composta de 100 mil indivíduos.6. Se em uma dada população em equilíbrio de Hardy-Weinberg 9% dos indivíduos são albinos. para essa característica. Com o tempo. cruzamentos ..50 d) 0. uma geração.50 e 0.(2). assinale o que for correto. respectivamente. a) 9% e 42% b) 17% e 34% c) 18% e 21% d) 21% e 18% e) 34% e 17% Questão 935 Suponha que uma variedade de determinada planta possua um gene que lhe confere vantagem em relação a uma outra variedade da mesma população.. atuantes c) Infinitamente grande. ao acaso.. (04) Em uma amostra de 1000 indivíduos de uma população em equilíbrio. b) às mutações que continua a sofrer. pelo menos.respectivamente.. as freqüências gênicas e genotípicas se mantenham constantes ao longo das gerações. Questão 939 Na espécie humana.44 e) 0. Então. Aa e aa são encontrados com as freqüências p£. a freqüência esperada de heterozigotos normais é a) 91 % b) 75% c) 49% d) 42% e) 21% Questão 940 Um par de genes determina resistência a um fungo que ataca a cana-de-açúcar e os indivíduos suscetíveis (aa) apresentam freqüência de 0. (16) O conhecimento das freqüências genotípicas é suficiente para se determinar a condição da população quanto ao equilíbrio.51 b) 0. 24 mil apresentam o genótipo AA e 36 mil apresentam o genótipo aa.66 Questão 938 Uma população de roedor está sendo estudada quanto ao equilíbrio de Hardy-Weinberg para uma característica determinada por um locus autossômico. p e q. ao acaso. e das freqüências fenotípicas.. (02) No equilíbrio. O alelo dominante A condiciona o fenótipo D e ocorre com a freqüência p. e) à oscilação genética. ao acaso.56 c) 0. os genótipos AA.56 e 0. (08) Com informações sobre os valores das freqüências gênicas. o albinismo é determinado por um alelo autossômico recessivo. c) à seleção natural. Questão 936 Tamanho .25. Com base nesses dados. são condições para que. (2) e (3): a) Infinitamente grande.. O alelo recessivo a é responsável pelo fenótipo R e tem freqüência q.. direcionados. são esperados 160 indivíduos com o fenótipo R.. Preenchem correta e respectivamente as lacunas (1). numa população..(I). é possível determinar se a população está ou não em equilíbrio. é correto afirmar que a freqüência dos alelos A e a será respectivamente: a) 0. de acordo com Hardy e Weinberg. a freqüência desse gene tende a aumentar devido a) ao fato de ser recessivo.

d) a probabilidade de formação de gametas B é de 80% nessa população. Questão 942 Numa população em equilíbrio. Questão 943 Uma população em equilíbrio é constituída de 500 indivíduos. b) 40%. ( ) os novos alelos. d) 36%. ou seja. as freqüências dos alelos. b) 60%. ( ) os cruzamentos. geração após geração. c) 48%. que podem desaparecer. A probabilidade de se encontrarem indivíduos AA. uma vez que esta tende a selecionar determinados alelos em detrimento de outros. respectivamente. Weinberg postularam que. c) a freqüência de plantas com raízes amarelas será de 64% se a população se mantiver em equilíbrio. se 213 1. 15% e 15%.em equilíbrio de Hardy-Weinberg. d) 30% dos gametas produzidos carregam o alelo recessivo. e) a probabilidade de ocorrência de homozigotos nessa população é de 52%. Aa e aa numa população em equilíbrio. a freqüência de heterozigotos será: a) 15% b) 25% c) 50% d) 75% e) 100% Questão 941 O gráfico mostra as relações entre as freqüências dos alelos A e a e as freqüências genotípicas AA. . Hardy e W. é necessário que: ( ) não haja pressão de seleção natural. as populações sejam panmíticas. 30% e 30%. Questão 945 G. c) o gene dominante é mais freqüente que o recessivo. dos quais 45 apresentam um fenótipo determinado por gene recessivo. nas populações. a freqüência de indivíduos Rh negativos é de 16%. e) 80%. H. sob condições especiais. Questão 944 A cor da raiz da cenoura é controlada por um par de genes autossômicos. que surjam por mutação. permanecem constantes.7 Numa população em equilíbrio.5. c) 50%. A partir dessas informações pode-se afirmar que a) a freqüência do gene para coloração amarela é de 36% nessa população. ( ) não ocorram fluxos migratórios. Com base nesses dados é INCORRETO afirmar-se que a) a freqüência de indivíduos com fenótipo dominante é 91% b) cerca de 10% da população é homozigota. A probabilidade de ocorrência de indivíduos heterozigotos nessa população é a) 84%. e) os heterozigotos representam 42% da população. 25% e 25%. Aa e aa é. Para que isso ocorra. O gene B é responsável pela cor branca e seu alelo recessivo. a) 25%. das quais 12. em que os casamentos ocorrem ao acaso e a freqüência dos genes A e a é de 50% para cada um. que se cruza ao acaso. e) 24%. Um agricultor colheu 20. b) a freqüência de heterozigotos nessa população é de 24%. e de cada genótipo. os quais acarretam troca de alelos entre populações diferentes. d) 70%. ocorram ao acaso. segundo os referidos autores.800 desenvolveram plantas com raízes brancas. 10% e 10%. pela cor amarela.000 sementes de uma população panmítica. em uma população. 50% e 25%.

A endogamia pode ser a causa do desvio em relação ao equilíbrio de Hardy-Weinberg. uma vez que as freqüências gênicas foram alteradas. foram encontrados 16 azuis. d) a população está evoluindo. Questão 950 Numa população a freqüência do gene dominante W é 0. Questão 946 Numa certa população de africanos. c) 3/10. Para tanto. Questão 951 No estudo da genética de populações. em uma população em equilíbrio genético as freqüências gênicas e genotípicas permanecem constantes ao longo das gerações. os cruzamentos sejam ao acaso. seleção natural e migrações. e) Somente as afirmativas 3 e 4 são verdadeiras. os cientistas Hardy e Weinberg formularam um teorema cuja importância está no fato dele estabelecer um modelo para o comportamento dos genes nas populações naturais. d) a população seja de tamanho reduzido. Qual o percentual da população que possui a vantagem heterozigótica? a) 9% b) 19% c) 42% d) 81% e) 91% Questão 947 Em 1908. b) 49/100. Questão 948 Em mexilhões. b) o tamanho da população seja reduzido.7. tais como mutação. ( ) nas populações demasiadamente pequenas. e) os cruzamentos nessa população ocorrem ao acaso. se houver 76 animais castanhos. forem significativamente diferentes dos valores esperados através da aplicação do teorema. é possível que a seleção natural seja a causa do aumento do número de heterozigotos. sendo a cor azulada determinada por um alelo recessivo e a cor castanha. 2. os cruzamentos ocorram de modo preferencial e esteja sujeita a fatores evolutivos. d) 42/100. tais como mutação. seleção natural e migrações. tais como mutação. Se houver 30 heterozigotos. 9% nascem com anemia falciforme.incorporem rapidamente ao estoque gênico. Se os valores das freqüências gênicas de uma população. b) Somente as afirmativas 1 e 2 são verdadeiras. a) Somente a afirmativa 1 é verdadeira. utiliza-se a fórmula p£ + 2pq + q£ = 1. Em 214 . os cruzamentos ocorram de modo preferencial e esteja isenta de fatores evolutivos. Com relação a essa população. 4. é necessário que a) a população seria infinitamente grande. inviabilizando a aplicação do teorema. tais como mutação. pode-se concluir corretamente que: a) a população estudada é infinitamente grande. e) 1/2. Assinale a alternativa correta. b) não houve a atuação dos fatores evolutivos sobre a população. as cores externas das conchas são determinadas por dois alelos de um gene. na qual p indica a freqüência do alelo dominante e q indica a freqüência do alelo recessivo. Ela não pode estar em equilíbrio de Hardy-Weinberg. A probabilidade de um indivíduo desta população ser heterozigoto Ww é igual a: a) 9/100. seleção natural e migrações. Questão 949 De acordo com a Teoria de Hardy-Weimberg. ela estará em equilíbrio de Hardy-Weinberg. a partir de seu estabelecimento. 3. c) Somente as afirmativas 1 e 3 são verdadeiras. observada ao longo de gerações. c) a população encontra-se em equilíbrio genético. considere as seguintes afirmativas: 1. Se houver 48 heterozigotos. c) a população seria infinitamente grande. Em uma população de cem animais. os cruzamentos ocorram ao acaso e esteja sujeita a fatores evolutivos. os cruzamentos ocorram ao acaso e esteja isenta de fatores evolutivos. seleção natural e migrações. por um dominante. d) Somente as afirmativas 2 e 4 são verdadeiras.

seja igual a 1. e) cresçam. engenharia genética. d) a somatória da freqüência dos diferentes alelos. Verificou-se que existiam.1 Questão 955 João ficou intrigado com a grande quantidade de notícias envolvendo DNA: clonagem da ovelha Dolly. d) reproduzam-se.1 e) AA . d) 49%.0. Aa . Para conseguir entender as notícias.9.0.0. portadores de sangue do tipo N. transferindo as características implantadas para as células-filhas.18.0.25 Questão 953 Os grupos sanguíneos de uma população foram estudados no que se refere ao sistema MN dos seus indivíduos. 1. aa .uma população em equilíbrio de Hardy-Weinberg espera-se que a) o genótipo homozigoto dominante tenha freqüência p£=0. aa .0.0. estudou a estrutura da molécula de DNA e seu funcionamento e analisou os dados do quadro a seguir. produzindo células defeituosas incapazes de sobreviver.25.50.81. Aa . aa . Questão 954 Cientistas conseguiram inserir um grande trecho de ADN estranho ao ADN de cobaias como mostra o desenho a seguir: O resultado esperado para este trabalho é que as células que receberam o implante: a) morram pela presença de ácido nucléico estranho à composição do núcleo. aa .09. Aa . aa . se estiver em equilíbrio. c) 50%. o genótipo heterozigoto tenha freqüência 2pq=0. c) reproduzam-se. numa porcentagem de 9%. Assim. testes de paternidade.5. Questão 952 Sabendo-se que a freqüência de um gene recessivo a.5. e) ocorra manutenção das mesmas freqüências genotípicas ao longo das gerações. 1. terapia gênica. ou dos diferentes genótipos. b) morram por ficarem prejudicadas na realização da síntese protéica.0. etc.5 e o genótipo homozigoto recessivo tenha freqüência q£=0. é 0. e) 42%. Aa . c) os alelos que expressam fenótipos mais adaptativos sejam favorecidos por seleção natural.01 b) AA . serão: a) AA . b) haja manutenção do tamanho da população ao longo das gerações. produzindo anticorpos contra as proteínas estranhas que serão fabricadas.0.8.0.72.25. b) 61%.18. Aa . as freqüências genotípicas esperadas para essa população.0.1.0.0. a freqüência dos indivíduos do grupo MN dessa população é de: a) 79%.0.25.1 215 . numa população.0.81.1 d) AA .09.8.0.01 c) AA .

b) na molécula de DNA. citosina. Essa substância se denomina a) DNA. b) pares diferentes de acordo com a espécie considerada. b) DNA. c) RNA. citosina e guanina. c) pares diferentes em diferentes células de uma espécie.8. G = 40% b) T = 10%. terapia gênica. e é formada por cadeias polipeptídicas que apresentam em sua composição os aminoácidos adenina.1 m I está representado o trecho de uma molécula de DNA. engenharia genética. comparação das proporções permitiu concluir que ocorre emparelhamento entre as bases nitrogenadas e que elas formam a) pares de mesmo tipo em todas as espécies.5. como resultado da diferenciação celular. evidenciando a universalidade da estrutura do DNA.8. testes de paternidade. cada molécula de DNA dá origem a 4 moléculas de DNA exatamente iguais. Questão 958 As técnicas utilizadas pela Engenharia Genética permitem que se atue em uma substância presente em todas as células. timina. G = 60% Questão 956 João ficou intrigado com a grande quantidade de notícias envolvendo DNA: clonagem da ovelha Dolly. procariontes e eucariontes. etc. e) no processo de mitose. podem existir 5 diferentes tipos de bases nitrogenadas. uracila. C = 60%. Na década de 1950.nalisando-se o DNA de um animal.5. Para conseguir entender as notícias. e é formada por cadeias polinucleotídicas que apresentam em sua composição as bases nitrogenadas adenina. C = 10%. G = 40% c) T = 10%. pode-se concluir que: a) a molécula de DNA é formada por 2 cadeias caracterizadas por seqüências de bases nitrogenadas. pois essas células são responsáveis pela perpetuação das espécies. podem existir diferentes tipos de complementação de bases nitrogenadas. guanina e timina. d) pares específicos apenas nos gametas. o que garante a diversidade da vida. citosina e guanina. e é formada por cadeias polinucleotídicas que apresentam em sua composição as bases nitrogenadas adenina. d) na molécula de DNA. G = 10% d) T = 40%. 1. Questão 957 A identificação da estrutura do DNA foi fundamental para compreender seu papel na continuidade da vida. pois esses organismos são formados por uma única célula. estudou a estrutura da molécula de DNA e seu funcionamento e analisou os dados do quadro a seguir. 216 . Observando o quadro. sendo responsável pelo controle do seu metabolismo. c) a quantidade de A presente em uma das cadeias é exatamente igual à quantidade de A da cadeia complementar. os valores encontrados para as outras bases nitrogenadas foram: a) T = 40%. C = 10%. Relacionando esse valor com o emparelhamento específico das bases. um estudo pioneiro determinou a proporção das bases nitrogenadas que compõem moléculas de DNA de várias espécies. e) pares específicos somente nas bactérias.1 1. detectou-se que 40% de suas bases nitrogenadas eram constituídas por Adenina. C = 20%. G = 10% e) T = 40%. C = 40%.

Questão 961 A tabela mostra a composição das bases nitrogenadas púricas. respectivamente: a) 19. Dessa cultura. não se encontra no núcleo da célula.0 e) 30. entre outros). Assinale a afirmação correta. foram isoladas 100 bactérias e transferidas para um meio sem substâncias radioativas.0 b) 21. b) 200 apresentavam o DNA marcado. Questão 963 Em um organismo.0 e 30. e) utilizarem código genético diferente. d) adenina e timina.4% ? Guanina ? 21. mas não o RNA. mas não o RNA. mas não o RNA. Nela identificamos 20% de adenina. adenina e guanina. c) possuírem cromossomos diferentes. por centenas de gerações. e é formada por aminoácidos que apresentam em sua composição a ribose. Questão 959 Uma molécula de DNA apresenta uma dupla hélice de cadeias polinucleotídicas. novos métodos de diagnóstico foram desenvolvidos e utilizados para inúmeros fins (identificação de microrganismos patogênicos. e é formada por aminoácidos que apresentam em sua composição a desoxirribose. A análise dos ácidos nucléicos mostrou que dessas 800 bactérias a) 100 apresentavam o DNA marcado.0 e 30.4 d) 19. d) 200 apresentavam o DNA e o RNA marcados. d) A molécula de DNA tem função de duplicação e é constituída por uma fita dupla. Essas bactérias sofreram três divisões no novo meio. e) A molécula de DNA.0% As porcentagens que estão faltando para o homem e para o boi são. b) A molécula de DNA nas bactérias se encontra na carioteca da célula.6 e 21. Adenina 30.4 c) 29. células musculares e células nervosas diferem principalmente por: a) possuírem genes diferentes. mapa genético. b) possuírem ribossomos diferentes.6 e 29. a) A molécula de DNA é constituída por uma fita única e por vários nucleotídeos que têm a transcrição como principal função.4 e 21. e) citosina e uracila. medicina forense. d) expressarem genes diferentes. produzindo 800 bactérias. Homem Boi 217 . c) citosina e guanina. a) 20% b) 30% c) 40% d) 50% e) 60% Questão 960 Depois da descoberta da estrutura da molécula do Ácido Desoxirribonucléico (DNA ou ADN). b) guanina e timina. e) todas apresentavam o DNA e o RNA marcados. e) transcriptase. c) 400 apresentavam o DNA marcado. nos organismos eucariontes. nos DNAs do homem e do boi.d) polimerase. sendo que cada filamento é composto por vários nucleotídeos.0 Questão 962 Bactérias foram cultivadas em um meio nutritivo contendo timina radioativa. Assinale a alternativa correta em relação à porcentagem de guanina. Questão 964 Um pesquisador que pretende estudar comparativamente a síntese de DNA e RNA em uma célula deve usar nucleotídios radiativos contendo a) timina e uracila. c) A molécula de DNA não é capaz de produzir a molécula de RNA. testes de paternidade.

c) polissacarídeos. 2 e 3 indicam. Questão 969 Moléculas de DNA constituídas por duplo filamento helicoidal mantêm as cadeias unidas entre si por a) ligações covalentes. d) pontes de nitrogênio.5. O fato nos permite afirmar que os nucleotídeos a) ocorrem em igual quantidade. b) citosina é igual a de timina. b) ligações iônicas. c) ribose. c) púricos pareiam com outros púricos. é CORRETO afirmar que a) possui a base nitrogenada uracila. .Questão 965 Importante informação que permitiu o estabelecimento de um modelo para a molécula de DNA foi a verificação de que o número de adenina-nucleotídeos era sempre igual ao de timina-nucleotídeos.1 Questão 967 Numa molécula de DNA. d) ácido fosfórico só entra na composição química do DNA. e) é formado de dupla cadeia com formato helicoidal. e) timina pareia com adenina no RNA. d) é integrante do nucléolo e dos ribossomos. o mesmo ocorrendo com a guanina e citosina-nucleotídeos. ácido fosfórico e base nitrogenada. b) ácido fosfórico. b) uracila é uma base nitrogenada exclusiva do DNA. e) ligam-se como se fossem o corrimão de uma escada. e) ligação metálica. c) guanina é igual a de citosina.8. b) nucleoproteínas. e) é formado de dupla cadeia com formato helicoidal. 218 1. desoxirribose e base nitrogenada. ribose e base nitrogenada. c) pontes de hidrogênio. Questão 968 Comparando as estruturas dos ácidos nucléicos desoxirribonucléico (DNA) e ribonucléico (RNA) pode-se afirmar que a) timina é uma base nitrogenada exclusiva do RNA. b) ocorrem aos pares na molécula de DNA. c) ribose é um açúcar que entra na composição química do RNA. d) pirimídicos pareiam com outros pirimídicos. ácido fosfórico e base nitrogenada. e) adenina é igual a de uracila. Questão 966 Na figura a seguir que representa o modelo da molécula de DNA os números 1. d) ácido fosfórico. b) não origina o RNA mensageiro c) não é capaz de replicar-se. Questão 971 Sobre o DNA. são classificados como a) polipeptídeos. base nitrogenada e desoxirribose. respectivamente a) desoxirribose. Questão 970 Sobre o DNA. Questão 972 O DNA e o RNA quanto à sua estrutura química. a quantidade de a) adenina é igual a de citosina. é INCORRETO afirmar que a) possui a base nitrogenada uracila. e) ácido fosfórico. d) é integrante dos genes e dos cromossomos. d) citosina é igual a de adenina. b) origina o RNA mensageiro c) reproduz-se de modo semiconservativo.

d) lisossomo e ribossomo. desoxirribose e base nitrogenada. d) citosina é igual a de adenina. 2 e 3. c) guanina é igual a de adenina. d) Adenina. d) AAT GGC TAA UAC. c) desoxirribose. b) UUT GGC TUU UAC. Questão 978 Comparando as estruturas dos ácidos desoxirribonucléico (DNA) e ribonucléico (RNA) NÃO se pode afirmar que a) timina é uma base nitrogenada exclusiva do DNA. d) ácido fosfórico entra na composição química do DNA e do RNA. desoxirribose e ácido fosfórico. Questão 977 Na molécula de DNA. c) Adenina. c) nucléolo e cloroplasto. e) Guanina. c) ribose é um açúcar que entra na composição química do RNA. sabendo-se que a figura adiante representa a unidade estrutural do ácido desoxirribonucléico (DNA). Questão 975 Se um segmento de DNA possui a seqüência de bases nitrogenadas TTA CCG ATT ATG.d) fosfatídeos. a) base nitrogenada. b) uracila é uma base nitrogenada exclusiva do DNA.1 219 . e) adenina é igual a de timina. a quantidade de a) adenina é igual a de citosina. c) TTA CCG ATT ATG. Questão 974 Qual das seguintes moléculas NÃO entra na composição química do DNA? a) Ribose. 1. e) AAU GGC UAA UAC.8. base nitrogenada e ácido fosfórico. b) citosina é igual a de timina. b) ácido fosfórico. e) Guanina. e) timina pareia com adenina no DNA. Questão 979 Assinale a alternativa que relaciona corretamente o nome das moléculas representadas pelos números 1. d) Uracila. e) mitocôndria e cloroplasto.5. Questão 973 Qual das seguintes bases nitrogenadas NÃO entra na composição química do DNA? a) Timina. e) base nitrogenada. pode-se afirmar que a cadeia complementar a esse segmento terá a seqüência a) AAT GGC TAA TAC. b) Desoxirribose. ribose e base nitrogenada. b) Citosina. e) polinucleotídeos. b) ribossomo e cromossomo. Questão 976 Observa-se a presença de DNA nos seguintes organóides citoplasmáticos a) mitocôndria e ribossomo. d) ácido fosfórico. respectivamente. ribose e ácido fosfórico. c) Ácido fosfórico.

Timina = 34% e Adenina = 16% Questão 984 Numa molécula de DNA formada por uma dupla-hélice a quantidade de a) adenina é igual a de citosina. Adenina = 15% e Timina = 15% b) Citosina = 35%. c) ácaros. d) liquens. Citosina = 30% e Timina = 30% d) Adenina = 30%. Timina = 16% e Adenina = 16% b) Guanina = 16%. Adenina = 35% e Timina = 35% e) Citosina = 15%. Citosina = 30% e Timina = 40% 220 . e) lipídios. e) bactérias. b) cloroplastos. d) membrana plasmática. Timina = 34% e Adenina = 16% e) Guanina = 34%. c) polinucleotídeos. Watson e F. c) retículo endoplasmático. a) Adenina = 20%. centríolos e cromossomos. e) ocorre nos cromossomos. e) lisossomos. cromossomos e lisossomos. d) ser um polipeptídeo. b) citosina é igual a de timina. b) polipeptídeos. c) adenina é igual a de uracila. d) enzimas. e) guanina é igual a de citosina. Adenina = 15% e Timina = 15% c) Citosina = 15%. d) citosina é igual a de adenina. Adenina = 35% e Timina = 15% d) Citosina = 15%. ribossomos e centríolos. b) protozoários. c) ribossomos. centríolos e lisossomos. cromossomos e complexo de Golgi. Questão 982 Uma molécula de DNA contém 15% de Guanina. complexo de Golgi e cromossomos. Timina = 34% e Adenina = 34% c) Guanina = 34%. Crick em 1953. Assinale a alternativa que contém a porcentagem correta de cada uma das demais bases nitrogenadas. guanina. d) cloroplastos. Assinale a alternativa que relaciona corretamente as outras bases nitrogenadas e suas respectivas proporções: a) Citosina = 15%.Questão 980 O modelo molecular dos ácidos nucléicos (DNA e RNA) foi proposto por J. citosina e adenina. Citosina = 40% e Timina = 40% e) Adenina = 40%. complexo de Golgi e ribossomos Questão 986 Sabemos que os genes são constituídos de DNA e estão localizados nas seguintes estruturas celulares: a) lisossomos. ribossomos e cromossomos. Questão 987 As evidências de que o DNA é a substância hereditária que determina as características dos seres vivos foram primeiramente observadas em a) vírus. e) vacúolos. Adenina = 15% e Timina = 35% Questão 983 Uma molécula de DNA contém 16% de Citosina. mitocôndrias e cromossomos. Assinale a alternativa que relaciona corretamente as outras bases nitrogenadas e suas respectivas proporções? a) Guanina = 16%. Citosina = 20% e Timina = 30% b) Adenina = 20%. Segundo esse modelo esses ácidos são a) micromoléculas. b) centríolos. Questão 985 Assinale a alternativa que relaciona as estruturas celulares em se observa a presença de DNA: a) membrana plasmática. Timina = 16% e Adenina = 16% d) Guanina = 34%. cromossomos e mitocôndrias. Citosina = 30% e Timina = 20% c) Adenina = 30%. b) presença das bases nitrogenadas uracila. c) ausência de ácido fosfórico. o conteúdo de guanina no seu DNA é 30%. Questão 988 Num dado organismo. Questão 981 É característica do DNA: a) açúcar com quatro átomos de carbono.

1. IV. d) inversão. II.b b) I .a d) II . verifica-se que a) ocorre lise da bactéria no fim do ciclo.a c) II .1 221 . Possui capacidade de autoduplicação.1 a) II . obtido de um dos cromossomos X de cada mulher e da menina. Questão 993 Duas mulheres disputam a maternidade de uma menina. Questão 990 Considere as características do DNA abaixo discriminadas. Síntese protéica São características do ácido desoxirribonucléico (DNA): 1. somente. Uma de suas bases nitrogenadas é a timina. b) duplicação.5. São corretas a) II e III. somente. I. III e IV. Seu açúcar é a desoxirribose. e) deleção. Transcrição b.5. d) II.8. Cadeia simples II.2 . b) o DNA viral se incorpora ao cromossomo bacteriano.1 . III e IV. c) translocação. II. d) as bactérias perdem a capacidade de se dividir. Dupla hélice Composição Questão 992 Supondo que ocorra um evento genético raro em que dois cromossomos não-homólogos. e) há grande multiplicação do DNA viral no interior da bactéria. III e IV.Questão 989 O esquema a seguir mostra um tipo de ciclo reprodutivo dos bacteriófagos. As seqüências de bases do referido trecho gênico estão esquematizadas adiante: 1. somente.a e) I . e) I. c) I. de uma mesma célula.1 . estaríamos verificando a ocorrência de a) crossing-over. c) o DNA viral é destruído pela bactéria. Com Uracila Função a. quebram-se e voltam a se soldar.2 . É constituído por uma única cadeia de nucleotídeos. b) II e IV.b e acordo com o esquema.1 .8. somente. Questão 991 Os itens abaixo se referem aos ácidos nucléicos: Estrutura I. III. Com Timina 2. porém com os segmentos trocados. Foi realizada a análise de um mesmo trecho do DNA.

10/08/97) Sabe-se que o citado mapeamento é feito a partir do conhecimento da seqüência de bases do DNA. d) base nitrogenada e de fosfato..5.8. as moléculas imprescindíveis que ele deve utilizar para que possa atingir o seu objetivo. Com base nesses dados. os três tipos de RNA (mensageiro. b) 20 timinas. vinte tipos diferentes de aminoácidos. de açúcar e de fosfato. iniciado em 1990. tentando reproduzir "in vitro" a síntese de moléculas de DNA. b) as moléculas do ácido ribonucléico (RNA) são hélices duplas de polirribonucleotídeos. RNA mensageiro e DNA. a) Quatro diferentes tipos de nucleotídeos. b) base nitrogenada. guanina. Com base nos conhecimentos sobre o tema. pois a menina recebe seus dois cromossomos X da mãe e apenas um deles foi analisado. c) em todos os organismos. d) A enzima DNA polimerase. a enzima DNA polimerase e DNA. d) não são suficientes. contendo as bases nitrogenadas adenina. b) são suficientes para excluir a possibilidade de uma das mulheres ser a mãe da menina. Questão 996 Considere que um cientista esteja. (O GLOBO. no segmento correspondente da cadeia complementar há 10 adeninas e 30 guaninas. conclui-se que nos segmentos de RNA originários desse DNA haverá a) 30 citosinas. apenas. c) não são suficientes. apenas.). DNA e RNA. citosina e guanina. transportador e ribossômico) e DNA. já é possível detectar por meio de exames de DNA (ácido desoxirribonucleico) a probabilidade de uma pessoa desenvolver doenças (. c) 15 guaninas. os vinte tipos diferentes de aminoácidos. c) As enzimas RNA e DNA polimerase. e) 10 adeninas. d) as estruturas espaciais e moleculares do DNA e RNA são 222 . é correto afirmar que: a) todas as trincas da molécula do mRNA especificam algum aminoácido. a enzima RNA polimerase. Questão 995 Em um segmento de cadeia ativa de DNA há 20 adeninas e 15 guaninas. d) 10 uracilas. é: 1. apenas. DNA e RNA. c) base nitrogenada e de açúcar. pois o cromossomo X da menina analisado pode ser o de origem paterna. pois uma menina não recebe cromossomo X de sua mãe. b) Os nucleotídeos contendo as bases nitrogenadas timina. as moléculas de DNA e RNA diferem entre si quanto ao tipo de a) açúcar. Questão 997 TESTES GENÉTICOS: A Ciência se antecipa à doença Com o avanço no mapeamento de 100 mil genes dos 23 pares de cromossomos do núcleo da célula (projeto Genoma.Os dados obtidos a) são suficientes para excluir a possibilidade de qualquer uma das mulheres ser a mãe da menina. Questão 994 Com relação à composição química. apenas. O esquema abaixo que representa o pareamento típicos de bases encontradas na molécula de DNA. e) As enzimas RNA e DNA polimerase. nos EUA). e) base nitrogenada. assinale a alternativa que indica. e) não podem ser considerados. timina. adenina e citosina. só existe um gene para cada molécula de DNA.1 Questão 998 Tendo em vista a estrutura e a função dos ácidos nucléicos. corretamente. em um laboratório..

e) seus genes para o tipo de pelagem localizavam-se no DNA mitocondrial. 07/07/2006. que podem ser observadas nestas representações esquemáticas: 1. b) seu DNA era composto por bases nitrogenadas. Questão 1002 Um laboratório recebeu três amostras de DNA para investigar se pertenciam a espécies diferentes. c) os genes cuja atividade não é necessária ao funcionamento de uma célula perdem a capacidade de duplicação. após a diferenciação e a especialização das células. A inferência vem diretamente do DNA do mamute-lanoso ('Mammuthus primigenius'). EXCETO a) Forma ou localização dos seus núcleos. Mamutes podem ter tido pêlo "loiro". Questão 1001 Células provenientes de um indivíduo foram examinadas ao microscópio e revelaram diferenças estruturais.8. é CORRETO afirmar que a) o genótipo das células do tecido nervoso é diferente do genótipo das células do tecido epitelial. O mamífero-símbolo da Idade do Gelo provavelmente tinha dois tipos de pelagem: castanho-escuro e loiro. c) seus genes estavam organizados nos plasmídeos. Questão 999 Leia o texto a seguir.1 odas as alternativas apresentam diferenças entre essas células. Em relação às características genéticas deste mamífero. sugere análise de DNA.8.5. d) Tecidos a que pertencem. Questão 1000 Sabe-se que o homem possui em torno de 80. "Folha de São Paulo". que.5. é possível afirmar corretamente que: a) seus genes estavam dispostos em cromossomos circulares. codificam proteínas. entre outras funções.1 223 . b) o número total de genes. de exemplares mortos há 43 mil anos na Sibéria. A quantidade e a relação entre as bases das amostras estão apresentadas nesta tabela: 1. b) Funções que realizam. ribose e fosfato. c) Genes que possuem. d) suas moléculas de DNA apresentavam estrutura helicoidal.diferentes.000 genes. mas são incapazes de se expressar. É uma das primeiras vezes em que os genes de um bicho extinto dão pistas sobre características suas em vida. d) os genes responsáveis pelo sistema sangüíneo ABO estão presentes nas células epiteliais. Considerando-se essa informação e conhecimento sobre o assunto. e) as duas metades da hélice dupla do DNA têm seqüências iguais de bases nitrogenadas. reduz-se.

cultivaram.0 e 30. ( ) metade das moléculas da geração F2 terão a densidade leve e apenas 12.0. d) 19. mediante precipitação baseada em suas diferentes densidades. ( ) eles concluíram. c) 29.om base nas informações dessa tabela e em outros conhecimentos sobre o assunto.0. 1.1 224 .4.4 % Guanina = ? Cão: Adenina = ? Guanina = 21.6 e21. cresceram diversas gerações das bactérias em N¢¥ (isótopo leve) e extraíram o DNA das sucessivas gerações (gerações F0. respectivamente: a) 19. inicialmente. d) as amostras 1 e 3 apresentam alta homologia entre seus DNAs.1 A partir desse experimento pode-se afirmar que: ( ) todas as moléculas da geração F1 terão a densidade intermediária entre a pesada e a leve. 1. ( ) a tendência da fita de DNA pesada é desaparecer no decorrer das gerações. conforme esquematizado abaixo. c) a amostra 2 apresenta DNA de fita simples. Questão 1005 Considerando que na figura a seguir tem-se uma representação plana de um segmento da molécula de DNA.6 e 29.0.5% terão a densidade intermediária em F3. b) 21.5. como foi antecipado por Watson e Crick. que as fitas de DNA serviam de modelo para sua própria replicação. Questão 1003 A composição das bases púricas adenina e guanina do DNA do homem e do cão são as seguintes: Homem: Adenina = 30. b) a amostra 3 possui o mais alto conteúdo de pares de bases A e T.F2 e F3).8.0 e 30.4 e 21. 'Escherichia coli' (geração F0) na presença de N¢¦ (isótopo pesado).0 % As percentagens que estão faltando para o homem e cão são. analise as proposições a seguir.8. F1 .4. em 1957.5. é INCORRETO afirmar que a) as três amostras são provenientes de diferentes espécies. Posteriormente. ( ) A composição do meio de cultura não exerceu influência no experimento uma vez que a bactéria cresceu em todos os meios. e) 30. Questão 1004 Meselson e Stahl.

Rio de Janeiro: Guanabara Koogan.) Um nucleotídeo é formado por um grupo fosfato (I).) Com a capacidade de mover genes de um organismo para outro. para cultivo. c) Um gene é uma proteína que tem função específica em uma determinada rota metabólica. nesse novo meio. Posteriormente. d) ao final da 2 geração. a) ao final da 1 geração. A. 6 ed.5. 1998) O texto acima se refere a organismos transgênicos. plantas que adquirem resistência ao frio por expressar genes anticongelantes de peixes. 4) Pontes de hidrogênio se estabelecem entre as bases nitrogenadas T e A e entre as bases nitrogenadas C e G.J. sendo uma híbrida e outra não. cada molécula híbrida de DNA formará duas moléculas. d) Um gene é uma molécula de RNA que atua diretamente na síntese protéica. os cientistas produziram plantas que brilham porque expressam os genes de bioluminescência dos vaga-lumes. sendo aplicadas a plantas e animais. Questão 1008 Gerações sucessivas de bactérias da espécie 'Escherichia coli' foram cultivadas num meio cuja única fonte de nitrogênio era o isótopo ¢¦N. pode-se prever que. de plantas transgênicas.8. mas hoje as mesmas técnicas estão .1 a) Produção de proteína b) Transcrição do RNA c) Produção de RNAribossômico d) Helicoidização do DNA e) Replicação do DNA Questão 1007 Um tema que vem despertando grande polêmica no Brasil atualmente é a liberação.. et al. a) 1 apenas b) 2 e 3 apenas c) 1. b) Um gene é um segmento do DNA que contém a informação necessária para a produção de uma determinada proteína. uma molécula do açúcar desoxirribose (II) e uma molécula de base nitrogenada. "A biotecnologia de genética molecular foi inicialmente aplicada a micróbios. todas as moléculas de DNA apresentarão apenas ¢¥N incorporado. onde existia o ¢¥N como única forma de nitrogênio. A obtenção dessas plantas se deve à biotecnologia. 225 1. o qual se incorporou nas moléculas de DNA. Em relação ao experimento. serão formadas moléculas de DNA apenas com ¢¦N e moléculas apenas com ¢¥N. 3) Um nucleotídeo com Guanina (G) em uma cadeia pareia com um nucleotídeo com Citosina (C) em outra cadeia. 2. c) ao término da 2 geração. Está(ão) correta(s). b) ao término da 1 geração. que são aqueles em cujo genoma foi introduzido um gene de uma outra espécie ou mesmo um gene produzido em laboratório. 3 e 4 apenas e) 1. 2 e 3 apenas d) 2." (Griffiths. Assinale a alternativa que define o que é um gene. cerca de 1/4 do DNA será híbrido. essas bactérias foram transferidas para um novo meio.F. 2) Um nucleotídeo com Timina (T) em uma cadeia pareia com um nucleotídeo com Adenina (A) em outra cadeia. (. e camundongos gigante que expressam os genes do hormônio de crescimento de ratos. a) Um gene é um cromossomo da célula vegetal ou animal. e) Um gene é uma cadeia de aminoácidos que codifica o código genético. 3 e 4 Questão 1006 Na figura a seguir é ilustrado um processo muito importante para a vida.. sendo o restante não-híbrido. resultando em tipos criados que nunca poderiam ter sido produzidos com a genética clássica. "Introdução à Genética". Analise-o e assinale a alternativa que indica corretamente qual é este processo.

Considere as seguintes afirmações. timina.1 . Questão 1010 Leia o texto abaixo. d) 2 .1 . 29.1 . jul. fizeram um experimento sobre a replicação do DNA.2 . Questão 1011 Numere a 2 coluna de acordo com a 1 COLUNA 1 1.M. e) não ocorreu replicação do DNA mas.1 Com relação a esses dados. ( ) bases nitrogenadas: adenina.1. ¢¥N.1. 226 . podemos concluir que a) a replicação do DNA é semiconservativa. b) 2 .8. III . Adaptado de SALZANO.1 . "Ciência Hoje". guanina. tem-se constatado um progresso fantasticamente acelerado da Biologia Molecular. b) Apenas II.2. em meio contendo um isótopo pesado de nitrogênio. por muitas gerações.1 .2 . F.2 .5. e) I. c) Apenas III. transcrição e tradução do material genético devem fazer parte do conjunto mínimo de genes. 1. Depois disso. ele comparou 21 genomas completos de representantes das três linhagens primárias da vida: as eubactérias. pois permite imaginar os primeiros sistemas genéticos surgidos por ocasião da origem da vida.2 . d) não ocorreu replicação do DNA mas. II e III. v.2 . As moléculas de DNA das bactérias foram então isoladas e analisadas com relação ao seu conteúdo de ¢¦N e de ¢¥N. A entrada na era da genômica possibilitou ao norte-americano Eugene V. c) a replicação do DNA é randômica. d) Apenas II e III. uma mutação. até todo o seu DNA estar marcado com esse isótopo. guanina.2 . uracila A seqüência correta é a) 1 . as arqueobactérias e os eucariontes. Quais delas poderiam ter embasado o raciocínio de Koonin? a) Apenas I. sim. a bactéria 'Escherichia coli' foi cultivada. citosina.1 . sim.Questão 1009 Meselson e Stahl. em 1953. b) a replicação do DNA é conservativa. Julgue os itens a seguir. Koonin investigar qual seria o número mínimo de genes capazes de sustentar o funcionamento de uma célula. Questão 1012 Desde que Watson e Crick propuseram um modelo para a estrutura do DNA. n. transcrição.1 . citosina.2 .DNA 2.2. 173.2. sendo observado o seguinte: I .Os genes envolvidos na replicação.RNA COLUNA 2 ( ) dupla hélice ( ) ribose ( ) fita única ou simples ( ) desoxirribose ( ) bases nitrogenadas: adenina. e) 1 . acerca do referido ácido nucléico.2 .1 . em 1957. Nesse experimento.2 .2 .Os genes compartilhados pelos genomas dos diferentes grupos devem ser essenciais.2 . O resultado da pesquisa mostrou que o número de genes deve situar-se em torno de 150. II . Para isso.1 . do que é exemplo a recente clonagem de uma ovelha. ¢¦N. c) 1 .No código genético. Esse enfoque é interessante. as bactérias foram transferidas para um meio contendo nitrogênio leve. 2001. a cada códon deve corresponder mais de um aminoácido.

b) Y e de autossomos. Questão 1014 No artigo "Retrato molecular do Brasil" ("Ciência Hoje". c) Y e do cromossomo X. à 1 lei de Mendel. a mãe transmite maior quantidade de DNA para o filho do que o pai. c) I. à 2 lei de Mendel. b) I. guanina. apenas. a segregação dos homólogos de um par cromossômico corresponde. (5) Nos processos de fecundação natural. a segregação dos homólogos dos diferentes pares cromossômicos correspondem. pesquisador da Universidade Federal de Minas Gerais. d) I. (2) A coloração de cromossomos com vários matizes é uma técnica atual que se baseia no uso de vários corantes para os diferentes lipídios que constituem os cromossomos. d) é polinucleotídeo. II. IV. ocorre a troca de. enquanto a contribuição genética de povos indígenas e africanos deu-se por meio das mulheres. (3) No processo de recombinação entre cromátides. Na meiose II. Na meiose I. respectivamente. citosina e adenina. d) Y e mitocondrial. II. o carbono não faz parte da estrutura do DNA. (4) As mutações gênicas implicam necessariamente a modificação do fenótipo do indivíduo. e) ocorre nos cromossomos. a segregação das cromátides dos diferentes pares cromossômicos corresponde. Na meiose I. c) a presença de ácido fosfórico. Questão 1015 Não é característica do DNA: a) o açúcar com cinco átomos de carbono. Na meiose I. apenas. a segregação de cromossomos homólogos que apresentam os mesmos alelos resulta nas proporções da geração F2 dos experimentos de Mendel. b) a presença das bases nitrogenadas uracila. I. uma série de observações e experimentos indicaram uma correlação entre o comportamento dos cromossomos na célula em divisão e as leis mendelianas. II. São afirmações corretas: a) I. V. Genes localizados em regiões próximas de um mesmo cromossomo implicam em distorções das proporções mendelianas. em efeito. e) II e V. em efeito. revelou que a contribuição dos europeus na composição genética do povo brasileiro fez-se basicamente por meio de indivíduos do sexo masculino. III. II. e) X e mitocondrial. apenas. Questão 1013 A partir dos anos 1900. Analise cada uma das afirmações seguintes. II e IV. Sérgio Penna. III e V. um segmento de DNA que corresponde a um gene funcional. apenas. III.(1) Apesar de ser o sexto elemento mais abundante no universo e o mais versátil de todos. à 2 lei de Mendel. do DNA do cromossomo a) X e de autossomos. Tais conclusões são possíveis com base em estudos moleculares. IV e V. 2001). Questão 1016 O estudo do mecanismo da síntese de proteínas no interior das células confirma que: a) a transcrição gênica caracteriza-se pela autoduplicação do DNA b) três tipos de RNA participam do processo c) os anticódons localizam-se no RNA-m d) os códons são trincas de bases nitrogenadas do RNA-t e) não há evidências que permitam aceitar que o código genético seja considerado degenerado Questão 1017 Uma molécula de RNA mensageiro apresenta a seguinte seqüência de bases nitrogenadas: UUU GUG CCC AAC Assinale a alternativa que contém a seqüência de bases do segmento da molécula de DNA que deu origem a esse 227 . em efeito. no mínimo. IV e V.

Questão 1021 Qual das seguintes moléculas NÃO entra na composição química do RNA? a) Ribose.RNA. Assinale a alternativa que contém a seqüência de bases do segmento da molécula de DNA que deu origem a esse RNA. ácido fosfórico e base nitrogenada.5. e) ácido fosfórico. a) AAA CAC GGG TTA b) TTT CAC GGG UUT c) AAA CTC GGG TTT d) TTT GAG GGG TTA e) AAA CAC CCC UUA 228 Questão 1023 Uma molécula de RNA mensageiro apresenta a seguinte seqüência de bases nitrogenadas: UUU GUG CCC AAU. 1. c) ribose. ribose e base nitrogenada. c) Adenina. b) participa da estrutura dos ribossomos.2 1. d) Adenina. d) é traduzido em proteínas nos ribossomos. e) Guanina. . c) reproduz-se de modo semiconservativo.8.5. Questão 1020 Qual das seguintes bases nitrogenadas NÃO entra na composição química do RNA? a) Timina. desoxirribose e base nitrogenada. c) Ácido fosfórico. d) ácido fosfórico. os números 1. a) AAA CAC GGG TTG b) TTT CAC GGG UUG c) AAA CTC GGG TTG d) TTT GAG GGG TTG e) AAA CAC CCC UUG Questão 1018 Na figura a seguir que representa o modelo da molécula de RNA os números 1. base nitrogenada e desoxirribose. e) Guanina. e) é formado de simples cadeia com formato helicoidal. b) Citosina. base nitrogenada e desoxirribose. ácido fosfórico e base nitrogenada. d) ácido fosfórico. ribose e base nitrogenada. é INCORRETO afirmar que a) possui a base nitrogenada uracila. b) ácido fosfórico. c) ribose. ácido fosfórico e base nitrogenada. b) Desoxirribose.8.2 Questão 1019 Sobre o RNA. d) Uracila. respectivamente a) desoxirribose. desoxirribose e base nitrogenada. Questão 1022 No modelo molecular do ácido ribonucléico (RNA) representado adiante. e) ácido fosfórico. b) ácido fosfórico. ácido fosfórico e base nitrogenada. 2 e 3 indicam. 2 e 3 indicam. respectivamente: a) desoxirribose.

RNA transportador de células de coelho e aminoácidos ativos de células de sapo.a d) II . guanina. b) presença das bases nitrogenadas uracila. .8.Estrutura: I. Questão 1028 A tabela a seguir mostra alguns aminoácidos e as trincas de bases no DNA que os identificam: 1.3 e um RNA mensageiro apresenta a seqüência de bases AUU AGA UGU GUU UUA.Val . nas mesmas condições em que essa síntese ocorre nas células.b Questão 1026 Nos últimos anos.em todos os seres vivos os códons que codificam um respectivo aminoácido são os mesmos. e) macaco e do rato. presença de timina . a biologia molecular tem fornecido ferramentas úteis para a produção de plantas e animais transgênicos. d) tRNA.Leu Questão 1029 Sobre o código genético são feitas as seguintes afirmações: I .1 . Questão 1027 Um pesquisador. RNA mensageiro de células de macaco.a b) I .Arg .Questão 1024 É característica do RNA: a) açúcar com quatro átomos de carbono.Cis . e) mRNA. b) sapo.Arg . presença de uracila 2. c) rRNA. b) Plasmídios. As informações armazenadas nas moléculas de DNA são traduzidas em proteínas por meio de moléculas intermediárias denominadas: a) Proteases. Questão 1025 Os itens a seguir referem-se à estrutura.Função: a.2 . transcrição gênica São características do ácido ribonucléico a) I . cadeia simples . e) ocorrer nos lisossomos.Cis . a seqüência de aminoácidos no polipeptídeo correspondente será. c) ausência de ácido fosfórico. II . de acordo com a tabela anterior: a) Cis .Val . d) macaco. síntese de proteínas b.Cis d) Ile .Val . utilizou ribossomos de células de rato. d) ser um polipeptídeo.pode existir mais de um códon para determinar um mesmo aminoácido.2 .5. c) coelho.Composição: 1.Leu .Ile b) Leu .Val . A proteína produzida teria uma seqüência de aminoácidos idêntica à do a) rato.Leu e) Val .Ile c) Arg .b c) II .Cis . interessado em produzir em tubo de ensaio uma proteína.Leu . composição e função dos ácidos nucléicos.Ile .Arg .b e) II .1 . 229 .Arg . citosina e adenina.Ile . dupla hélice II.1 .

É correto afirmar que o código genético a) varia entre os tecidos do corpo de um indivíduo. Está(ão) correta(s) afirmativa(s): a) II apenas. respectivamente os aminoácidos cisteína. que codifica a seqüência serina .III . b) III apenas. sofreu a perda da 9 base nitrogenada.UUU . indica a interrupção da tradução. mas varia de indivíduo para indivíduo. lisina.alanina. b) Aspargina.GGA . valina.LEU a) GUU .3 1.GGC .cisteína .UUU . lisina. Questão 1032 Considere a seguinte tabela que indica seqüências de bases do RNA mensageiro e os aminoácidos por elas codificados.UUG.GGC .UUU . ou seja.FEN .GGU . prolina. leucina. e) GUU .8.a tradução da seqüência de bases do RNA para a proteína é feita. b) é o mesmo em todas as células de um indivíduo. prolina. Questão 1031 Um gene de bactéria com 600 pares de bases nitrogenadas produzirá uma cadeia polipeptídica com número de aminoácidos aproximadamente igual a a) 200 b) 300 c) 600 d) 1200 e) 1800 Questão 1033 O código genético é o conjunto de todas as trincas possíveis de bases nitrogenadas (códons). UAU. d) GAA . c) CTT . e) Valina. Assinale a alternativa que apresenta a possível seqüência de códons para a formação do seguinte tetrapeptídeo: GLU .8. nos ribossomos. e) I e III apenas. Um fragmento de DNA. II e III. a nível citoplasmático. tirosina. e) é praticamente o mesmo em todas as formas de vida. qual seria a seqüência de aminoácidos codificada? 1. Assinale a 230 . d) permite distinguir procariotos de eucariotos.AAC. lisina. Com base na tabela fornecida e considerando um segmento hipotético de DNA.5. cuja seqüência de bases é AAGTTTGGT. lisina. c) é o mesmo nos indivíduos de uma mesma espécie. A seqüência de códons do RNA mensageiro determina a seqüência de aminoácidos da proteína. d) Fenilalanina. c) Fenilalanina. prolina.tirosina . mas varia de espécie para espécie. Questão 1034 Os códons UGC.GLI . valina.TTT . Questão 1030 A tabela a seguir relaciona trincas de bases do DNA aos aminoácidos correspondentes.CCG .CUC. c) I e II apenas. d) I.3 a) Aspargina. alanina e serina. o códon UAG é terminal.CTC.AAA .5. b) GAA . GCC e AGC codificam.CUC.

encontramos células com formas e funções diferentes. pode corrigir defeitos no código genético de um organismo. e) A seqüência não sofrerá prejuízo. Este processo chama-se diferenciação celular. Indique a alternativa ERRADA relativa ao código genético e à síntese de proteínas: a) Os genes são formados por ácido desoxirribonucleico e controlam a produção de proteínas da célula. por raios-X. mas. pois essa molécula de DNA alterada não é capaz de comandar esse processo. compondo os cromossomos e ribossomos na forma de moléculas complexas de nucleoproteínas. ou mesmo por exposição aos raios ultravioleta do sol. apesar disto. b) Todas as células do corpo têm a mesma coleção de genes. por raios cósmicos. guanina.alternativa que descreve o que acontecerá com a seqüência de aminoácidos. resultando numa molécula com 3 aminoácidos. 231 . a) Na molécula de DNA. d) A mutação constitui uma alteração na seqüência de bases nitrogenadas de um segmento de DNA e pode ser provocada por radiações. pois qualquer modificação na fita de DNA é imediatamente corrigida. que compreende a passagem do código genético do DNA para o RNA. determinando as características de um ser vivo. mas. Questão 1037 O esquema a seguir representa a seqüência de aminoácidos de um trecho de uma proteína e os respectivos anticódons dos RNA transportadores. d) As mudanças na programação genética de um organismo não alteram a produção de proteínas. os códons e os anticódons correspondentes. encontramos sempre desoxirribose e cinco tipos de bases: adenina. que compreende o trabalho do RNA de organização dos aminoácidos na seqüência determinada pelo código genético. citosina. c) A seqüência não será traduzida. encontramos células com formas e funções diferentes.8. e) A Engenharia Genética. a) UUU CGT TTG UGC GUC b) UUU CGA AAG UGC GUC c) TTT CGT TTC TGC GTC d) TTT CGA AAG TGC GTC e) CCC TAC CCA CAT ACT Questão 1038 O quadro a seguir contém um segmento de DNA. 1. Questão 1035 Com relação ao código genético e à síntese de proteínas. e a tradução. foi oficialmente fundado o Projeto Genoma. a) O aminoácido tirosina será substituído por outro aminoácido. c) A mutação é uma alteração do código genético de um organismo e pode ser provocada por radiações ou substâncias químicas.5. nem as suas características. assinale a afirmativa FALSA. c) Duas grandes etapas estão envolvidas na síntese das proteínas: a transcrição. que visa decifrar e mapear o código genético humano. apesar disso. timina e uracil. d) A tradução será interrompida no 2Ž aminoácido. Questão 1036 Em 1987. b) Os ácidos nucléicos podem aparecer livres na célula ou podem estar associados a proteínas. b) O aminoácido tirosina não será traduzido.3 ssinale a alternativa que contém a seqüência de códons do RNA mensageiro que participou dessa tradução. e) Todas as células do corpo têm a mesma coleção de genes. que é uma técnica de manipulação dos genes.

CCT TIROSINA .GGA Questão 1041 Organismos são ditos transgênicos quando.CAC . e) a técnica permite trocar o código genético do organismo receptor do gene. TCA e CUG e) CTG.TGC .5. de acordo com o anticódon que possui. III. diversas condições devem ser observadas.CGU . UCA e GUC c) GTC. O RNA mensageiro. III e IV devem ser substituídos.3 ara preenchê-lo corretamente. Diversos aminoácidos são codificados por mais de uma trinca de nucleotídios. respectivamente. Para que ocorra a síntese da proteína codificada pelo gene inserido no genoma da espécie receptora. b) o código genético é comum a todos os seres vivos. 1.CGU . ATT. Cada trinca de bases nitrogenadas de uma cadeia do DNA corresponde a um aminoácido. TAA. II. II. ATT.TGT . liga-se a um aminoácido específico.TGC . os quais podem ser transmitidos aos seus descendentes.CGT .TTA e) UAU . essa técnica é possível porque a) cada organismo apresenta seu próprio código genético.8. São verdadeiras APENAS as afirmações a) I e II b) I e IV c) II e III d) II e IV e) I.CISTEÍNA - 232 . A seqüência de trincas no RNA mensageiro que pode ter codificado esse polipeptídio alterado é a) CUC .CGT .CGC . Entretanto. o polipeptídio sintetizado passou a apresentar duas argininas. Exemplos desses organismos são as plantas transgênicas.CAC . TCA e GUC d) CTG. AUU. c) o código genético é degenerado. III e IV Questão 1040 Considere o seguinte segmento de uma cadeia de DNA e o polipeptídio sintetizado a partir dele: ATA .HISTIDINA . Questão 1042 Considere os seguintes códons do RNA mensageiro e os aminoácidos por eles especificados: ACA = treonina GUU = valina Assinale a alternativa da tabela a seguir que indica corretamente os anticódons do RNAt e os códons do DNA relacionados com esses aminoácidos.ACA . por técnica de engenharia genética. AGT e CTG b) GTC.CGT . os algarismos I.CAC . receptoras de um gene de outro organismo (doador) que lhes confere resistência a certos herbicidas.GLICINA Após a substituição de uma única base nitrogenada no segmento de DNA.GGU c) CGT .GGA d) UAU .GCA .CTU .ARGININA . O RNA ribossômico contém as informações para as proteínas que devem ser sintetizadas. AUU. fundamentalmente. por a) GAC.TGT . d) a técnica permite trocar o código genético do organismo doador do gene. foram feitas as seguintes afirmações: I. recebem e incorporam genes de outra espécie.CTU . UCA e CUG Questão 1039 Com relação ao código genético.GTG .GGU b) TUT . IV.

Considere que a estrutura normal de um RNA mensageiro de um peptídio e sua estrutura alterada em virtude da troca de uma única base no gene correspondente são: 5' AUGUGGUUUGCACACAAAUGAUAA 3' (normal) 5' AUGUGGUUUGAACACAAAUGAUAA 3' (alterada) A tabela a seguir identifica alguns codons. Sua estrutura está representada no esquema abaixo: C-A-C-A-C-A-C-A-C-A-C-A-C-A-C-A-C-A Suponha que a síntese de um peptídeo possa ser iniciada a partir de qualquer um dos extremos dessa estrutura de RNAm.8.5. Nestas condições.o codon da metionina é também o do início da tradução. por conseqüência da substituição de uma única base na estrutura do DNA. pode acarretar modificações importantes na atividade biológica da proteína codificada por esse gene.os codons de término da tradução são UAA. O aminoácido encontrado no peptídio normal e aquele que o substituiu no peptídio mutante são. Considere o quadro: 1.5.1. composta pelas bases adenina-A e citosina-C. UAG e UGA. foi sintetizada experimentalmente.5.3 1.3 233 .3 Questão 1043 Uma molécula de RNAm.8. respectivamente: a) lisina e cisteína b) treonina e triptofano c) alanina e ácido glutâmico d) fenil alanina e ácido aspártico Questão 1045 A determinação da seqüência de aminoácidos de todas as proteínas da espécie humana e de outros seres vivos é de extrema importância. podem-se identificar as possíveis seqüências de DNA que a originaram. sem necessidade de código de iniciação ou de terminação. o número de diferentes tipos de aminoácidos encontrados nos peptídeos formados será: a) 4 b) 3 c) 2 d) 1 Questão 1044 A mutação em um gene. .8. bserve que: . A partir da seqüência de aminoácidos de uma proteína.

Isso é possível graças à relação existente entre os códons do RNA mensageiro (cada três nucleotídeos) e os aminoácidos presentes nas proteínas. 2. O inverso também pode ocorrer.8.Glu . Thr (treonina). apenas Questão 1047 A união de vários aminoácidos forma os peptídeos. b) A partir da seqüência do RNA mensageiro UUUCAUAGUGCUGGGAGCCAC. Três bases nitrogenadas adjacentes codificam um aminoácido e formam um códon. c) A partir da seqüência do RNA mensageiro GUGGUUGUCGCUCGUCGGCGG. 3.GAA .TTT b) ATG .AAT . devem estar presentes no seu mRNA? a) 100 234 . Tyr (tirosina). Leu (leucina).TTC .TAC . quantos códons.3 Phe (fenilalanina).Asn . Val (valina). assinale a opção que indica a seqüência do DNA responsável pela síntese do peptídeo mostrado a seguir: Met . e) O peptídeo Lys-Phe-Lys-Tyr-Tyr-Thr-Ile pode ter sido originado a partir do seguinte RNA mensageiro: AAAUUUAACUAUUACACAAUA. His (histidina). Trp (triptofano). Met (metionina). O código genético descreve a relação entre a seqüência de bases nitrogenadas e a seqüência de aminoácidos. Cys (cisteína). Glu (ácido glutâmico). Lys (lisina). Cada três nucleotídeos correspondem a um aminoácido. na proteína que ele especifica. apenas b) 1 e 3. Está(ão) correta(s): a) 1. Estes. A seqüência de aminoácidos que forma uma cadeia polipeptídica compreende a estrutura secundária de uma proteína.TGT . 2 e 3 e) 2. A correspondência entre os códons do RNA mensageiro e os aminoácidos por ele determinados constitui o código genético.GCC .om base no quadro apresentado.AAT . é formado o seguinte peptídeo: Phe-His-Ser-Ala-Gly-Arg-His. Questão 1048 Se uma proteína possui 100 aminoácidos. Ala (alanina).TAC . formam as proteínas.AAT .TGT . Asn (asparagina). a partir de uma seqüência de aminoácidos (peptídeo).GAA . Gly (glicina).TTT c) ATC . Pro (prolina). faz-se a construção de uma fita de RNA mensageiro a partir dela. como por exemplo as funções enzimáticas.Tyr . apenas d) 1. é formado o seguinte peptídeo Leu-Gly-Glu-Thr-Arg-Gln-Glu. Ser (serina).AAC . Arg (arginina). Ile (isoleucina).TTT d) ATG .TAC . Gln (glutanina).TGT . após passarem por diferentes processamentos no Retículo endoplasmático rugoso e complexo de Golgi.TTC e) ATC . d) A partir da seqüência do RNA mensageiro UUAGGGGAGACUCGGCAGGAG. Com base no texto e em seus conhecimentos. apenas c) 3.5. As proteínas exercem inúmeras funções no nosso organismo.TAC . portanto. é correta a seguinte afirmação: a) O peptídeo Gly-Gly-Gly-His-Arg-Leu-Ile-Gln pode ter sido originado a partir do seguinte RNA mensageiro: GGCGGUGCGCACCGCCUUAUUCAA. que especificam esses aminoácidos. Para descobrir se determinado organismo produz determinada proteína.GAA .TTC Questão 1046 OBSERVE: 1.GAA .Phe a) ATG . pare (códon de parada).TAC . que está representado na tabela a seguir: 1. Asp (ácido aspártico). é possível obter uma seqüência de nucleotídeos (RNA mensageiros). é formado o seguinte peptídeo: Val-Val-Val-Val-Arg-Arg-Arg.Cys .AAT .TGT .

ala = ALANINA.glutamina . d) Os anticódons do 1Ž do 2Ž códon dessa seqüência são.b) 33 c) 99 d) 300 e) 500 Questão 1049 Observe as seqüências de nucleotídeos de um vírus de RNA: 5' GCA UCA CAC CUC AUU GCG UAG 3' Considerando que esse segmento de RNA codifica um determinado peptídeo.cisteína .histidina . his = HISTIDINA.aspartato b) metionina . 235 1. Questão 1050 As unidades hereditárias que contêm a informação para especificar um aminoácido são denominadas a) ADN.glutamina . o que significa que um aminoácido pode ser codificado por mais de uma trinca.aspartato . lys = LISINA. gly = GLICINA LOPES.treonina .treonina .glicina c) glutamina . met = METIONINA.o código genético é degenerado. II . Questão 1051 A tabela apresenta o código genético. Assim sendo.um aminoácido pode ser codificado por apenas uma trinca de nucleotídios de DNA. c) Os códons GCA e GCG são degenerados porque codificam aminoácidos diferentes. val = VALINA. trp = TRIPTOFANO.arginina d) glutamina . cys = CISTEÍNA. leu = LEUCINA. Utilizando a tabela. tyr = TIROSINA. com os códons e os aminoácidos correspondentes. determine a seqüência de aminoácidos que corresponde à seqüência de DNA TAC TGA TTG CTA a) metionina . c) nucléolos.asparagina .arginina e) glicina . é correto afirmar: a) Os códons dessa seqüência sinalizam os mesmos aminoácidos em seres humanos. ileu = ISOLEUCINA.treonina Questão 1052 O aminoácido leucina pode ser codificado por mais de uma trinca de nucleotídios do DNA (AAT. d) acrossomos. Sônia. arg = ARGININA. b) A inserção de um nucleotídeo entre a 4 e a 5 base não altera o código genético. Bio Volume Único.5. GAA e outras). glu = GLUTAMINA. asp = ASPARTATO. thr = TREONINA. 1996. GCA e UGA.histidina . respectivamente. asn = ASPARAGINA.glicina . ser = SERINA. b) códons.3 . uma determinada trinca também pode codificar diferentes aminoácidos. he = FENILALANINA.8. III . pro = PROLINA. São Paulo: Saraiva. podemos dizer que I .assim como a leucina pode ser codificada por diferentes trincas. e) ribossomos. Estão corretas afirmativas: a) apenas III.

a ESTREPTOMICINA interfere na tradução e leva a célula bacteriana a produzir proteínas defeituosas. UAC ACC UCU CGU.. e) nenhuma delas. e) I. TAT GGC ATA. respectivamente: a) TAT GGC ATA. é responsável pela incorporação respectiva dos seguintes aminoácidos: metionina.a TETRACICLINA impede a transcrição e leva a célula bacteriana à morte por falta de RNA mensageiro. e) AAU AAA CCG AGG. c) apenas I. Considerando as informações apresentadas.. c) AAT AAA CCG AGG. são.. c) TAT GGC ATA. a MITOMICINA inibe a ação da polimerase do DNA e a ESTREPTOMICINA causa erros na leitura dos códons do RNA mensageiro. (2) A molécula de DNA referente ao trecho apresentado tem 20% de adenina. e) TAT GGC UTU. a) apenas I é correta. Essas informações permitem afirmar que I . (1) Os códons do mRNA. II . b) apenas I e II são corretas. TUT GGC UTU. Assim.b) apenas II. 236 .. sua cadeia complementar e o tipo de RNAm que poderá ser formado a partir das bases da hélice original são. II e III são corretas. c) apenas II e III são corretas. d) TTA TTT CCG AGG. Essas substâncias diferem quanto à maneira pela qual interferem no metabolismo celular. pode-se dizer que o segmento de DNA que deu origem a esse RNA era a) TTA AAA CCG AGG. UTU GGC UTU.a MITOMICINA. TACACCTCTCGT. arginina e alanina. d) I e III. Questão 1056 Existe um número muito grande de substâncias com funções antibióticas. para os aminoácidos mencionados. (3) A perda de um nucleotídeo do DNA implicará a alteração dos aminoácidos da cadeia polipeptídica. d) ATA GGC TAT. b) AAT AAA GGC UCC. por inibir a duplicação do DNA. triptofano. UAU GGC AUA. julgue os itens que se seguem. d) apenas I e III são corretas. impede a multiplicação da célula bacteriana. b) UAU GGC UAU. TAT GGC ATA. a TETRACICLINA liga-se aos ribossomos e impede a ligação do RNA transportador. Indique qual a seqüência de RNAm é transcrito a partir deste segmento DNA: a) TTA TAA GCT CAG ATT TCT b) TTA TTA GCT CAG ATT TCT c) UUA UUU GGU CAG AUU UGU d) UUA UAA GCU CAG AUU UCU e) AAT ATT CGA GTC TAA AGA Questão 1055 Uma cadeia de DNA apresenta a seguinte seqüência de bases numa certa região de sua hélice: ATA CCG TAT. Questão 1057 Dado um segmento de RNA com a seguinte seqüência de bases nitrogenadas: UUA UUU GGC UCC. III . Questão 1054 Um fragmento de DNA de uma espécie de organismo procarionte apresenta a seguinte seqüência de bases: AAT ATT CGA GTC TAA AGA. (4) A fumaça do cigarro. Questão 1053 Um trecho de fita de DNA com a seqüência. os raios X e a luz ultravioleta podem produzir mutações na molécula de DNA. Assinale a alternativa que reúne as afirmações corretas. respectivamente.

é necessário bloquear o funcionamento de todo o retículo endoplasmático dessa célula. 1.o astro da semana. G. d) Um dos mais importantes locais de ocorrência do processo 1 é o nucléolo. .4 ssinale a alternativa correta.adeninas e) complementar .5. a) O processo 1 somente é observado no núcleo da célula.timinas Questão 1062 A mesma molécula . a) AAA CAC GGG TTT b) TTT CAC GGG UUU c) AAA CTC GGG TTT d) TTT GAG GGG TTT e) AAA CAC CCC UUT Questão 1059 O esquema a seguir representa dois processos observados numa célula eucariótica. foi laureado por registrar em imagens o momento em que a informação genética contida no DNA no núcleo da célula é traduzida para ser enviada para fora pelo RNA .idêntica . b) 2 representa nucleotídeos de DNA. já era conhecido pelos cientistas desde a década de 50. sendo inexistente em todas as outras organelas. Assinale a alternativa que contém a seqüência de bases do segmento da molécula de DNA que deu origem a esse RNA. Questão 1061 A molécula de RNA sintetizada é ___________ à fita de DNA que lhe deu origem e ___________ à outra fita de DNA. (Girardi. é INCORRETO afirmar que: a) 1 é uma molécula de uracila.8. da Universidade Stanford.citosinas d) complementar .8.idêntica .complementar .guaninas c) idêntica . mas nunca serão constituintes de outras organelas. a) idêntica . c) 3 representa nucleotídeos de RNA. c) O processo 2 ocorre principalmente no período S da intérfase. e) As moléculas produzidas no processo 2 poderão ser utilizadas como catalisadoras. Estudo de RNA rende o segundo Nobel 237 1. sendo as _______________ substituídas pelas uracilas.Questão 1058 Uma molécula de RNA mensageiro apresenta a seguinte seqüência de bases nitrogenadas: UUU GUG CCC AAA.complementar .adeninas b) complementar .que faturou o Nobel de Medicina ou Fisiologia na segunda-feira foi a protagonista do prêmio de Química entregue ontem. através do qual o RNA carrega consigo as instruções para a produção de proteínas (e por isso ele ganha o nome de RNA mensageiro). Questão 1060 O esquema a seguir representa fragmentos de ácidos nucléicos no núcleo de uma célula.4 bservando o esquema. O americano Roger Kornberg. d) a célula encontra-se em metáfase. e) trata-se do processo de transcrição.o RNA .5. Esse mecanismo de transcrição. b) Para interromper o processo 2.complementar .

A . Qual a seqüência correta dessas etapas durante o processo? a) I .A .I e) III . assinale a alternativa incorreta. b) RNA e de proteínas.A e) C . farmacogenômica etc. Para compreender essas notícias. origina a cadeia a) GUTATUTGA b) GCUAUCUGA c) GCTUTCTGU d) UCTATCTUA e) GCTATCTGA Questão 1065 Abaixo está representado o filamento I de uma molécula de ácido nucléico presente no interior do núcleo de uma célula vegetal. I . respectivamente.II . e) Cada molécula de RNA mensageiro é uma longa seqüência de nucleotídeos idêntica ao DNA.C . b) No núcleo da célula ocorre transcrição do código da molécula de DNA para a de RNA.U .4 Questão 1066 Considere as seguintes etapas da síntese de proteínas. clonagem terapêutica e reprodutiva.G .G .II. d) RNA e de DNA.I . b) I . é necessário conhecer a estrutura da molécula de DNA e entender seu funcionamento.A .Fixação do RNA mensageiro aos ribossomos. d) III . 5 out. o RNA mensageiro determina a seqüência de aminoácidos apresentada por uma proteína.U .III .U .A c) G .U b) G . e assinale a(s) proposição(ões) CORRETA(S).G .C .I. Paulo". 238 . de a) proteínas e de RNA. transgênicos.C .II. a) A produção de RNA mensageiro se dá por controle do material genético.C . c) II . transcrita a partir do filamento II? a) G .C . Analise os dados dos quadros a seguir. 2006).G .III .U . II .5. c) O RNA mensageiro leva do núcleo para o citoplasma instruções transcritas a ele pelo DNA. III . c) DNA e de proteínas.Transcrição do código genético do DNA em códons do RNA mensageiro. Questão 1063 Os processos de transcrição e tradução gênicas resultam na síntese. d) No citoplasma. e) DNA e de RNA.U .U 1."O Estado de S.A .III. Questão 1067 Há na mídia uma grande quantidade de notícias envolvendo o DNA: testes de paternidade.Ligação dos códons de RNA mensageiro aos anticódons correspondentes dos RNAs transportadores.G .U d) C .II . A partir da leitura do trecho anterior e de seu conhecimento de biologia molecular. terapia gênica.U . Questão 1064 O segmento CGATAGACT de uma fita de DNA. após o processo de transcrição.8. Qual seria a seqüência correta encontrada na molécula de RNA mensageiro. engenharia genética.

Questão 1070 Algumas células de cultura de tecido foram deixadas em um meio contendo um precursor radioativo de RNA.5. e) II. I.e) apenas II e III. II e III. I e III. Esse procedimento se repetiu após 15 e após 90 minutos. (02) O quadro I mostra uma molécula de DNA cuja duplicação ocorre de forma semiconservativa. transcrição e tradução ocorrem no mesmo local porque as células procariontes não possuem sistema de endomembranas. Após 3 minutos. b) apenas II.5. através do qual formam-se moléculas que contêm as mesmas bases nitrogenadas presentes no DNA. observa-se que o pareamento das bases nitrogenadas do DNA é aleatório. Os esquemas representam as células radioautografadas nos três momentos. cuja seqüência de aminoácidos está codificada numa molécula de ácido nucléico. (16) A deleção de um dos pares de bases na seqüência mostrada em I não alteraria significativamente a seqüência de aminoácidos em III. (04) Em II. c) II. as etapas que representam. . que resulta na formação de polipeptídios. respectivamente. duplicação e tradução são: a) I. 1. II. d) apenas I e III. Nas bactérias.8. Está(ão) correta(s) a) apenas I. Nas células eucariontes. c) apenas III. a informação genética é transmitida do citoplasma. está indicado o processo de transcrição. Questão 1068 Analise as afirmativas a seguir. III e I. Questão 1069 1. III.4 O esquema resume parcialmente as relações funcionais dos ácidos nucleicos que ocorrem na maioria das células vivas. para o núcleo. onde está o DNA. gerando duas novas duplas hélices.8. 239 onsiderando-se apenas células eucariontes. essas células foram transferidas para um meio sem essa substância. transcrição. Posteriormente.4 (01) Em I. d) III. b) I. onde serão produzidas as proteínas. revelando a distribuição do precursor radioativo nas mesmas. III e II. uma fita de DNA serve como molde para a produção do RNA que terá uma seqüência de nucleotídeos complementar à fita-molde. pois cada uma das fitas originais em I serve de molde para uma nova fita. está indicado o processo de tradução. (08) Em III. Durante a transcrição. I e II. algumas células foram fixadas e radioautografadas.

b) Apenas III. porém. leucina. e) leucina. e) lise celular. indique. treonina. que ocorre inicialmente no núcleo celular. c) leucina. Assinale a(s) afirmativa(s) correta(s): a) Apenas II.Um RNA-t (RNA transportador) transporta sempre um determinado aminoácido. respectivamente. e) I. Questão 1072 Partindo-se do conhecimento do RNAm (CCU GAG).A tradução do código químico do RNA-m (RNA mensageiro) ocorre nos ribossomas localizados no retículo endoplasmático rugoso. arginina. Questão 1073 Sobre a síntese de proteínas. leucina. 240 . d) treonina. os aminoácidos arginina. pode ser transportado por vários RNA-t. arginina. arginina. CUG e ACU do RNA mensageiro codificam. c) a síntese de RNA. que se intensifica aos 90 minutos. arginina. Questão 1071 Os códons AGA. a) treonina. leucina e treonina. e) a síntese de RNA ocorre no núcleo. são feitas as seguintes afirmações: I . d) Apenas II e III.5 Esses resultados ocorrem porque a) o RNA transportador leva o isótopo até o nucléolo e posteriormente ao núcleo e citoplasma celular. d) mutação gênica. qual a seqüência correta do DNA e do RNA transportador. existem quatro tipos de genes que atuam como está demonstrado no esquema a seguir: São esses mecanismos que tornam possível a: a) diferenciação celular.As moléculas de RNA-t apresentam numa determinada região da sua molécula uma trinca de bases denominada anticódon. treonina. Questão 1074 Ao longo da molécula de DNA. esgota toda a substância presente no núcleo. b) arginina. III . nas opções a seguir. c) duplicação de RNA. prossegue posteriormente no citoplasma da célula.4 1. respectivamente. A seqüência desses aminoácidos na proteína correspondente ao segmento do DNA que apresenta a seqüência de nucleotídeos GAC TGA TCT será. d) a produção de RNA. b) a substância. treonina.8.5.1. Esse aminoácido. buscando a situação de equilíbrio. c) Apenas I e II. restando apenas no citoplasma. leucina. II . II e III. ao ser deixada em situação de desequilíbrio osmótico em relação à cultura sem isótopo.5. dirige-se gradativamente para o citoplasma celular. sendo que posteriormente o RNA aí produzido migra para o citoplasma celular.8. b) produção de energia.

8. e) reprodução celular. (III) e (IV). A(s) afirmativa(s) correta(s) é(são): a) I apenas.os ribossomas alinhados nessa molécula de RNA traduzirão os mesmos códons. "O controle das características fenotípicas dos seres vivos é feito pelos ___(I)___ através do comando da síntese de ___(II)___. tradução. b) ribossomos. Questão 1077 Analise o texto abaixo e assinale a alternativa que contém os termos que preenchem corretamente os espaços (I). RNA transportador. d) II e III apenas. c) síntese protéica. e) I. III . RNA mensageiro. o Cloranfenicol inibe a peptidiltransferase na subunidade ribossômica maior e a Rifampicina inibe a RNA polimerase no sítio de iniciação.8.5 Questão 1078 O esquema a seguir representa a seqüência das etapas da síntese de um trecho de uma proteína a partir da molécula de DNA. de uma molécula de DNA.5. proteínas. d) produção de energia. aminoácidos. tradução. num certo organismo. II e III." a) ribossomos. Sabe-se que esses antibióticos são substâncias cuja utilização médica se baseia na inibição das células bacterianas atuando no mecanismo de: a) fagocitose. Questão 1076 241 .5 Questão 1075 O antibiótico Estreptomicina age sobre as bactérias promovendo a leitura errada do RNAm. cópia. A primeira etapa forma a molécula de ___(IV)___ contendo a mensagem genética e a segunda etapa é responsável pela produção da proteína. aminoácidos. c) I e III apenas. RNA ribossômico. b) secreção de substâncias. (II). a Tetraciclina liga-se à subunidade ribossômica menor e inibe a ligação do AA-RNAt. aminoácidos. c) genes. duplicação.durante o processo a proteína formada depende. d) genes. proteínas. RNA ribossômico. e) genes.qualquer proteína formada será conseqüência direta de uma transcrição do RNA. duplicação. b) I e II apenas.5. 1. RNA mensageiro.análise do esquema anterior nos permite afirmar que: I . 1. No processo de elaboração de uma proteína ocorrem as etapas de transcrição e ___(III)___. em última análise. II .

b) durante sua síntese houver variação dos tipos de RNA transportadores. e) bases da molécula de RNA . b) exclusivamente da produção de DNA. nas células bacterianas haverá comprometimento a) exclusivamente da produção de proteínas. que ocorrem no núcleo das células eucarióticas. c) sua síntese ocorrer no retículo endoplasmático liso e não no rugoso. complementar ao segmento da hélice de DNA apresentada é UGGUUUGGCUCA. CUC. CAC. e) O DNA não se duplicar durante a interfase. A seqüência correta de bases nitrogenadas encontradas na molécula de RNA mensageiro. e) da produção de DNA e RNA. respectivamente aos processos de tradução e transcrição. Questão 1081 A seqüência de aminoácidos de uma proteína é determinada pela seqüência de a) pentoses da molécula de DNA. III. GUA 242 .ribossômico Questão 1082 Considere os seguintes fragmentos de ácidos nucléicos que participam da síntese de uma proteína. CAU c) TCT. Seu mecanismo de ação consiste na inibição da transcrição nas células de 'Mycobacterium tuberculosis'. GTA d) UGU. Questão 1079 A Rifampicina é um dos antibióticos utilizados para o tratamento da tuberculose.Questão 1080 A composição química de uma proteína pode ser alterada se a) durante sua síntese houver variação dos tipos de aminoácidos disponíveis no citoplasma.8.8. 1. GAG. c) apenas II e III estão corretas. d) uma base púrica substituir uma pirimídica no RNA mensageiro que a codifica.5. Deve-se concluir que a) apenas II está correta.mensageiro. Sob ação do antibiótico. d) da produção de RNA e de proteínas. d) bases da molécula de RNA . CAT e) TGT.5 s espaços 1. No esquema. GAG.5 obre essa síntese foram feitas as afirmações abaixo: I. 2 e 3 ficariam corretamente preenchidos por: a) ACA. b) apenas I e II estão corretas.transportador. e) todas estão corretas. GAU b) TGT. c) exclusivamente da produção de RNA. c) bases da molécula de DNA. d) apenas I e III estão corretas. Para codificar a seqüência dos aminoácidos do trecho da proteína apresentada no esquema são necessários 24 nucleotídeos no RNA mensageiro. b) pentoses da molécula de RNA . os números 1 e 2 correspondem. GUG. 1. II.5.

b) O RNAm do gene "anti-sense" é capaz de parear com o RNAm da poligalacturonase. Numa síntese de proteína com 185 ligações peptídicas. c) O maior tempo de prateleira a que o texto se refere se deve aos baixos níveis da enzima poligalacturonase. 1. cuja função é transportar aminoácidos.8. impedindo sua expressão.8. Questão 1085 O DNA apresenta importantes funções celulares. que representa um fragmento de ácido nucléico. c) a síntese de proteínas. b) a síntese de RNA mensageiros. a) Essa metodologia visa reduzir os níveis de etileno nos frutos evitando seu amadurecimento. unindo-se aos aminoácidos. Dessa forma. e) o transporte de RNA. os tomates são colhidos ainda verdes para que sua firmeza seja mantida no transporte. c) Esse ácido nucléico é produzido no núcleo e se dirige ao citoplasma. Essa enzima promove a hidrólise de componentes da parede celular. o que compromete a firmeza dos frutos. d) A tecnologia "anti-sense" para genes necessários à síntese do etileno poderia ser utilizada para se evitar o amadurecimento de frutos. Questão 1087 O esquema a seguir é um processo celular vital. cuja expressão gênica é induzida pelo etileno. d) II pode apresentar moléculas de adenina.5 Considerando o esquema acima. que ocorre também em você.Questão 1083 e) 558 Questão 1086 Tradicionalmente. e) Se a ação desse ácido for bloqueada. Antes de chegarem às prateleiras. Questão 1084 Um mutante perdeu um segmento de DNA contendo todas as cópias dos genes que codificam RNA transportador. é denominada anticódon. a) A substância representada em I é obrigatoriamente ribose. b) Cada trinca de bases. o filamento de DNA que proporcionou essa síntese deverá ter o seguinte número total de nucleotídeos: a) 62 b) 93 c) 186 d) 279 1. Uma delas é a síntese de proteína. assinale a alternativa INCORRETA. o processo de transcrição não ocorrerá. A função celular drasticamente afetada por essa mutação será a) a replicação do DNA. d) o transporte de proteínas.5. O tomate Flavr Savr foi desenvolvido pela empresa de biotecnologia Calgene para amadurecer no pé mantendo a firmeza de sua pele. os tomates são pulverizados com etileno para acelerar o amadurecimento e torná-los vermelhos. representada em II.5 Assinale a alternativa INCORRETA. o tomate pode ser transportado já maduro e apresenta um maior tempo de prateleira. 243 . Os pesquisadores utilizaram a metodologia "anti-sense" (veja o quadro a seguir) para diminuir os níveis da enzima poligalacturonase.5.

5 244 . b) enzimas usadas. obteve-se uma proteína a) humana. III. no processo digestivo. RNAs transportadores e aminoácidos. 1. Questão 1088 Os gráficos a seguir revelam o NÚMERO DE GENES e a relação entre RNA CODIFICADOR (que contém as seqüências que podem ser traduzidas em proteínas) e RNA NÃO-CODIFICADOR (seqüências que são transcritas.5.5 Nesse processo ocorre produção de. o gene (segmento de DNA) é transcrito em RNA mensageiro. b) Os vertebrados citados apresentam menor percentual de transcrição em relação aos outros animais.8. c) Os íntrons são exemplos de RNA não-codificador. Questão 1089 Na síntese protéica. mas não são traduzidas em proteínas) de seis espécies de organismos. II. realizou-se uma síntese protéica utilizando-se: DNA de um gene humano. por exemplo. RNAs transportadores de ovelha e aminoácidos de coelho. observam-se os seguintes eventos: I. Analisando os resultados anteriores de acordo com seus conhecimentos sobre o assunto. Num experimento de laboratório hipotético. Ao final do experimento.8. o RNA mensageiro combina-se com um complexo de ribossomo.5. d) moléculas utilizadas nos processos de cicatrização. EXCETO: a) macromoléculas de reserva energética. EXCETO: a) Não existe uma relação de proporcionalidade direta absoluta entre o número de genes e a complexidade dos organismos relacionados. d) Seqüências transcritas. c) moléculas de defesa do corpo. poderiam desempenhar alguma função no núcleo celular. d) quimérica de homem e ovelha. é correto afirmar.1. Questão 1090 Responder à questão com base na ilustração e afirmativas a seguir.5. e nos éxons estão presentes seqüências codificadoras. e) híbrida de homem e coelho.8. c) de coelho.5 1. mas não traduzidas. b) de ovelha. a proteína é sintetizada.

c) o material genético ser constituído por proteínas.J. 1997. "O Que é vida? 50 anos depois". Uma outra característica comum parece ser a geração de estruturas periódicas como segmentos.) Com base no texto e nos conhecimentos sobre o tema. os processos A.. O'NEILL. contido no material genético. In: MURPHY. que é induzido a se expressar em resposta a fatores extrínsecos.. (WOLPERT. Lewis. penas e dentes." Folha de S. o DNA se duplica. é certo afirmar: a) os aminoácidos que estão no citoplasma são selecionados pelo RNAm b) todo o processo da síntese de uma proteína ocorre exclusivamente no núcleo da célula c) o RNAm controla a síntese de uma proteína. denominado transcrição.. sendo os padrões especificados independentemente ao longo de cada um.e a maior parte da formação de padrões acontece localmente. Muitos animais desenvolvem-se ao longo de eixos cartesianos.20/10/2002. II. de forma que os embriões são logo divididos em regiões que essencialmente se dividem de maneira independente". mas talvez não seja pretensioso supor que foi um lapso. Todas as interações ocorrem a curta distância .) De outro lado. e) o DNA controlar a produção de proteínas e estas controlarem a atividade celular... Durante o processo C. p. Questão 1092 Em se tratando do processo de síntese de proteínas. A importante implicação disto é que não existe relação entre o padrão inicial e o observado. 74. É verdade que a Fundação Nobel ainda fala no DNA como o diretor de cena a comandar a ação das proteínas. III e IV Questão 1091 (. IV. ocorre a síntese de RNA. Paulo . Uma maneira de produzir padrões é dar às células informação posicional. é correto afirmar: a) As células diferenciam-se de acordo com um padrão intrínseco. os verdadeiros atores do drama molecular da vida.) (LEITE. mas a síntese dele próprio é controle do DNA d) o RNAt é responsável pela etapa de transcrição no processo de síntese de uma proteína Questão 1093 "Desenvolvimento significa. vértebras. III e IV c) I e IV d) II e III e) II. B e C ocorrem no interior do núcleo. e que o sinal emitido por essas premiações aponta o verdadeiro futuro da pesquisa biológica e médica muito além dos genomas e de seu seqüenciamento (uma simples soletração). todas as afirmativas corretas encontram-se na alternativa a) I. o galardão de química ficou com os inventores de ferramentas para estudar proteínas. Essa referência deve-se ao fato de a) não ocorrer uma correlação funcional entre DNA e proteínas no meio celular. denominado replicação. e as células então interpretam esses valores de maneiras diferentes.]. células tornando-se diferentes de maneira ordenada [.) O autor refere-se às proteínas como ''atores do drama molecular'' e ao DNA como "diretor de cena".. L. como em um sistema coordenado.. II e III b) I. P. denominado tradução. d) as proteínas não terem controle sobre o metabolismo celular. Marcelo. b) O desenvolvimento envolve a expressão diferencial do material genético e independe do micro-ambiente em que a célula está localizada. Nos eucariotos. "De volta ao seqüenciamento. que são construídas segundo o modelo básico modificado pela informação posicional.A. Durante o processo A. Durante o processo B. em grande parte. dá-se a síntese protéica. São Paulo: UNESP. b) o DNA controlar a produção de proteínas etambém atuar como catalisador de reações químicas celulares. (. c) O desenvolvimento das diferentes regiões de um organismo deve-se à propriedade de interação célula-célula 245 .raramente ultrapassam mais que 30 diâmetros de célula . III. Considerando os processos intracelulares. M.

246 .UAC b) ATG .GAC e) GCA .CGA . para o meio de cultura. está corretamente referida em: a) O DNA transcreve a mensagem genética para o RNA.CTA . no citoplasma. e) a extremidade livre dos diversos tRNA tem seqüências de bases diferentes. o valor de Y equivale a: a) 826 b) 706 c) 586 d) 466 Questão 1095 Considere os seguintes códons: UAC . via vesículas de secreção. esta enzima passa para o complexo de Golgi e é secretada. b) a posição dos aminoácidos na cadeia polipeptídica depende da seqüência de bases do tRNA. do seu RNAm. produzida pelo fungo 'Aspergillus niger'.AUG Os anti-códons correspondentes são: a) AUG . d) A diferenciação caracteriza-se pela manutenção do padrão morfológico e pela alteração do padrão funcional do tecido. a participação dos ácidos nucléicos. Sabe-se que X < Y < Z e que esses valores formam uma progressão aritmética. Portanto. um processo bastante complexo e fundamental para a sobrevivência das células.GUA . depois para o complexo de Golgi e é secretada. via vesículas de secreção. Y e Z de aminoácidos. para ser empregada na indústria de sucos.e da quantidade de informações que a célula é capaz de processar. onde a tradução é concluída. Admita que todos os demais nucleotídios formam códons que correspondem a aminoácidos encontrados na estrutura primária das proteínas após serem sintetizadas.ACG .CUT . e) A síntese da pectinase começa no mesossomo e termina nas membranas do retículo endoplasmático rugoso. assinale a alternativa correta. para o meio de cultura.ACT . desta forma. Questão 1094 Um RNA-mensageiro bacteriano é formado pela polimerização de 5292 nucleotídios e contém três códons de iniciação de leitura e três de terminação. d) a seqüência de bases do rRNA é transcrita a partir do código do mRNA. a síntese da enzima ocorre nas membranas do mesossomo e depois ela é secretada para o meio de cultura. c) o transporte de aminoácido para o local da síntese é feito pelo mRNA. que é traduzido por ribossomos e depois é ancorado nas membranas do retículo endoplasmático rugoso. esta enzima passa para o complexo de Golgi e é secretada. no meio de cultura líquido. d) A síntese da pectinase começa no núcleo e termina nas membranas do retículo endoplasmático liso. em que a diferenciação de um tipo celular induz outro tipo a se diferenciar. De acordo com o texto.GAU . via vesículas de secreção. Questão 1097 O pesquisador Gustavo obtém pectinase. c) A síntese da pectinase começa no citoplasma e termina nas membranas do retículo endoplasmático rugoso. esta enzima passa para o lisossomo. Em seguida.UGC . que serve de modelo para a formação de uma proteína. e) O desenvolvimento ocorre como um dominó. Em seguida.TCG . b) O caminho da produção da pectinase começa com a transcrição. ele simplesmente separa o meio de cultura do microrganismo e isola a enzima deste meio. para o meio de cultura.ACG . a) O 'Aspergillus niger' é um organismo que possui mesossomo.CUA . contendo.CGU Questão 1096 Sobre os diferentes papéis dos ácidos nucléicos na síntese de proteínas podemos afirmar corretamente que: a) a seqüência de bases no DNA determina a seqüência de aminoácidos na cadeia polipeptídica.UCG .UTC d) AGT . substâncias químicas indispensáveis à vida. Gustavo não precisa destruir o fungo para obter a enzima.TAC c) TUG . respectivamente. Questão 1098 Na síntese protéica. um número X. Esse RNA é traduzido em três diferentes proteínas. Em seguida.

em que está representada a produção de diferentes tipos de cadeias polipeptídicas . proteínas virais. Questão 1099 Um pesquisador injetou RNA mensageiro (mRNA) de vírus em ovócitos de anfíbios. ’. é INCORRETO afirmar que a) a ativação do gene responsável pela síntese da cadeia polipeptídica “ ocorre dias antes do nascimento. c) o material injetado nos ovócitos foi capaz de se autoduplicar. c) O RNA mensageiro contém trincas de nucleotídeos denominadas códons. 2 e 3 substituem.8. além de suas próprias proteínas. a) Apenas II está correta.‘.5 1. Analise-a e assinale a alternativa correta. Após certo tempo. respectivamente: 1. verificou que esses ovócitos.8. produziam. b) Todas estão corretas. Questão 1102 No esquema.5. II) A tradução do código genético do RNAm é feita nos ribossomos localizados no retículo endoplasmático rugoso.5 247 . Questão 1101 São feitas as seguintes afirmativas a respeito da síntese protéica.b) O DNA transcreve a mensagem genética para o RNA solúvel. c) Estão corretas apenas I e II. também. e) Estão corretas apenas I e III. – e “ determinadas pela ação de diferentes genes e que vão compor as hemoglobinas em várias fases do desenvolvimento humano: om base nas informações contidas nesse gráfico e em outros conhecimentos sobre o assunto. c) o gene responsável pela síntese da cadeia polipeptídica ’ aumenta sua atividade a partir do terceiro mês da concepção. Esses dados sugerem que a) o DNA dos ovócitos foi impedido de se expressar. local onde ocorre a transcrição da mensagem genética. b) o mRNA se integrou ao DNA dos ovócitos. III) O anticódon corresponde a uma trinca de bases localizada numa determinada região de todos os RNAt. ’. b) a síntese da cadeia polipeptídica ‘ permanece constante durante a mudança de produção das cadeias – e ’. – e “ estarão presentes no indivíduo adulto. local da síntese protéica. que se liga ao ribossomo. e) O RNA ribossômico se une a proteínas formando o ribossomo. d) os quatro tipos de cadeias polipeptídicas . d) Apenas III está correta. os números 1.5.‘. comandando a síntese da proteína viral. d) O RNA transportador apresenta na sua molécula uma trinca de nucleotídeos denominada anticódon. Questão 1100 Analise este gráfico. d) os ovócitos foram capazes de interpretar a informação contida no mRNA viral. responsáveis pela transcrição de uma cadeia polipeptídica. I) Um RNAt transporta sempre o mesmo aminoácido. local de ligação com o aminoácido que ele transporta.

destaca-se o 1. levando à formação de alguns hormônios: dogma central da Biologia. (08) o ordenamento dos aminoácidos na proteína formada dá-se em função da seqüência de bases nitrogenadas. replicação b) replicação. transcrição. (02) dele participam três moléculas de RNA: o ribossômico. II . (16) o código genético é degenerado. e) Apenas II e III. III .5 248 . b) Apenas II. um dos descobridores da estrutura da molécula de DNA. transcrição c) amplificação gênica. isto é. o mensageiro e o transportador. presente no RNA mensageiro.Um indivíduo com a enzima 1 inibida deixa de produzir as enzimas 2 e 3. Questão 1105 1.Um indivíduo com a enzima 1 inibida precisa receber os hormônios 1 e 2 de fontes externas. Questão 1104 O cientista britânico Francis Crick. d) cada molécula de DNA é formada pela reunião de nucleotídeos. Segundo esse dogma.5. publicou um manifesto sobre a síntese de proteínas. (04) o RNA transportador tem como função levar as proteínas produzidas no núcleo para o citoplasma.5 Um dos processos metabólicos mais importantes. Questão 1106 respeito deste esquema são feitas as seguintes afirmações: I . Entre as hipóteses apresentadas naquele texto. b) a transferência de informações genéticas ocorre do DNA para o RNA. pois um aminoácido pode ser codificado por mais de uma trinca. c) Apenas III. transcrição.5. d) Apenas I e II. a) o código genético é degenerado. as bases para a descoberta do código genético. lançando. Em 1958. replicação. e) uma molécula de DNA difere de outra pela seqüência de seus nucleotídeos. tradução e) transcrição. tradução. é CORRETO afirmar que: (01) ele ocorre nos ribossomos. no interior do núcleo. diferentes códons sempre especificam diferentes aminoácidos na cadeia polipeptídica. assim. será lembrado como um dos mais influentes cientistas de todos os tempos.Um indivíduo com a enzima 1 inibida acumulará grandes quantidades de aminoácido 3. Quais estão corretas? a) Apenas I. c) cada polipeptídeo tem uma seqüência específica de nucleotídeos determinada pelo gene. tradução Questão 1103 O esquema a seguir mostra a via metabólica de um aminoácido. que podem ser de quatro tipos diferentes. apresentando suas hipóteses sobre a estrutura teórica da biologia molecular.8. repressão. é a síntese de proteínas.8. que ocorre em nível celular.a) repressão gênica. tradução d) replicação. (32) existem códons específicos para concluí-lo. e deste para a proteína. morto em julho de 2004. Com relação a esse processo.

ribossomo e códon. os processos representados pelos números (1) e (2) ocorrem no _________.tradução . ao processo de ___________ e o número (3) ao processo de ___________. RNAm. Nas células eucariotas. Questão 1108 O esquema a seguir representa a síntese protéica.5 AVANCINI e FAVARETTO.8. d) 1 representa a mitocôndria onde ocorre o processo de tradução. (1) Os ribossomos estão se movendo da parte de baixo para a de cima do esquema.tradução .transcrição .5 Analise o esquema e julgue os itens a seguir. (4) O número de aminoácidos da proteína dependerá do tamanho do RNA mensageiro. 1. II.Uma abordagem evolutiva e ecológica".8. RNAm.núcleo.5.citoplasma e) replicação .tradução . b) RNAt.tradução . 1.5.citoplasma.No esquema. b) 3 representa a proteína carregada pelo RNA mensageiro. a) transcrição . ribossomo e anticódon. o número a) 2 representa o RNA mensageiro que contém os códons para a síntese protéica. e) RNAm. códon.núcleo Questão 1107 1. RNAt.replicação .transcrição . "Biologia .núcleo d) replicação . não está representado o RNA transportador. Na figura. as lacunas.5. a: a) ribossomo. São Paulo: Moderna. todas as proteínas representadas no esquema serão iguais. 1. respectivamente. Assinale a alternativa que preenche.5 s algarismos I. RNAt. p. o número (2). Questão 1109 O diagrama ilustra uma fase da síntese de proteínas. III e IV correspondem. (2) No esquema. 1997. c) RNAt. d) RNAm.tradução . 150. (0) Ao final da síntese. (3) O conjunto representado pode estar localizado no retículo endoplasmático rugoso. 249 . c) transcrição . RNAm e RNAt. que também participa do processo. e) 4 representa o RNA mensageiro que está sendo carregado pelo RNA transportador representado pelo número 1. c) 4 representa o RNA transportador que carrega a mensagem. o número (1) corresponde ao processo de ___________. vol.replicação .transcrição . ribossomo e anticódon.8. corretamente. b) replicação . ribossomo e códon.

e) uma proteína.5 250 . b) nos genes I e II. 3 e 4. Nesse extrato o agente capaz de transformar bactérias não-patogênicas em patogênicas era a) o ácido ribonucléico. misturados com um extrato de pneumococos capsulados patogênicos mortos causavam a morte de cobaias. e) uma proteína. não patogênicos. c) o ácido desoxirribonucléico. b) o ácido indolilacético. que resume as principais etapas da síntese protéica que ocorre numa célula eucarionte. somente.5. misturados com um extrato de pneumococos capsulados. responsável pelo sequenciamento dos aminoácidos em um peptídeo com peso molecular de 27000 daltons? a) 810 b) 300 c) 270 d) 81000 e) 2700 Questão 1113 Griffth em 1928 descobriu que pneumococos sem cápsula. 1. causavam a morte de cobaias. quantos nucleotídeos em média estão presentes em uma seqüência codificadora de ARN-m.8. II.8.5. somente. onde quatro genes. De acordo com o esquema. d) uma enzima. Questão 1112 Supondo que o peso molecular médio de um aminoácido é de 100 daltons. e) nos genes III e IV. d) uma enzima. somente. os sintomas que o indivíduo apresenta ocorrem devido às alterações a) no gene I. s processos assinalados como 1 e 2 e a organela representados no diagrama referem-se. d) nos genes II e III. 1. c) duplicação. e) tradução. produzem quatro tipos diferentes de enzimas. 2. transcrição e lisossomo. Questão 1114 Em 1928 Griffth descobriu que pneumococos (bactérias) sem cápsula e não-patogênicos.5 m indivíduo tem anomalias na pigmentação do corpo e seu metabolismo é prejudicado pela falta do hormônio da tireóide. I. III e IV. somente. duplicação e retículo endoplasmático. b) tradução. respectivamente. d) transcrição. é normal. transformando o aminoácido fenilalanina em quatro possíveis substâncias. Questão 1111 Considere o diagrama. O funcionamento das glândulas supra-renais. b) o ácido indolilacético. patogênicos e mortos. duplicação e lisossomo. transcrição e ribossomo. a a) transcrição. c) o ácido desoxirribonucléico. somente. Nesse extrato o agente transformante era a) o ácido ribonucléico.Questão 1110 O esquema representa alguns passos de uma série de reações metabólicas. porém. c) nos genes I e III. tradução e ribossomo. 1.

Questão 1115 Griffth, em 1928 descobriu que bactérias pneumococos sem cápsula e não-patogênicos, misturados com um extrato de pneumococos capsulados, patogênicos e mortos, causavam a morte de cobaias. Em 1944 Avery, McLeod e McCarthy concluíram que o agente capaz de transformar as bactérias era a) o RNA. b) o AIA. c) o DNA. d) uma enzima. e) uma proteína. Questão 1116 A experiência do "liquidificador" realizada por Hersey e Chase demonstrou que a substância que determinava a destruição de bactérias parasitadas pelos vírus bacteriófagos era a) uma proteína viral. b) uma enzima viral. c) o RNA viral. d) o DNA viral. e) um lípide viral. Questão 1117 O experimento do "liquidificador" serviu para demonstrar que o DNA de certos organismos era capaz de causar a destruição de bactérias. Os organismos que podem infectar bactérias são a) fungos. b) vírus. c) algas. d) ácaros. e) protozoários. Questão 1118 Bacteriófagos são a) protozoários de vida livre. b) líquenes parasitas. c) vermes parasitas. d) vírus. e) vermes de vida livre.

Questão 1119 A experiência do "liquidificador" realizada por Hersey e Chase em 1952 demonstrou que a) o material genético é formado por proteínas. b) o material genético é formado de RNA. c) o material genético é formado de lipídios. d) o material genético é formado por açúcares. e) o material genético é formado de DNA. Questão 1120 A bactéria 'Pneumococo pneumoniae' pode possuir uma cápsula que lhe permite a) sofrer mutações. b) desenvolver flagelos. c) resistir às defesas dos hospedeiros. d) ficar imune às defesas dos hospedeiros. e) sobreviver em ambientes sem água. Questão 1121 "O século XX proporcionou uma série de pesquisas na área genética. Em 1928, Griffith realizou um importante experimento que envolvia transformações em bactérias. Esse experimento, retomado por Avery e colaboradores, em 1944, foi a base para a descoberta da molécula formadora do material genético. Nos anos 50, Watson e Crick apresentaram o modela da dupla-hélice dessa molécula, abrindo caminho para que, na década seguinte, se demonstrasse como o gene, através de sua seqüência de bases nitrogenadas, controla a produção de proteínas. Nas duas últimas décadas, o avanço biotecnológico permitiu aos cientistas a manipulação do material genético e a transferência de um gene de uma espécie para outra." Considere os itens abaixo: I. estrutura da molécula do DNA; II. descoberta do código genético; III. DNA como molécula constituinte do gene; IV. obtenção de organismos transgênicos. O texto faz referência a) apenas aos itens I, II e III.
251

b) apenas aos itens I, II e IV. c) apenas aos itens I, III e IV. d) apenas aos itens II, III e IV. e) a todos os itens considerados. 1.5.8.6 Questão 1122 Sabendo que o DNA dos vírus bacteriófagos contém fósforo e que a cápsula protéica contém enxofre, Hersey e Chase, em 1952, cultivaram vírus em meio contendo isótopos de fósforo (¤£P) e de enxofre (¤¦S). Esses pesquisadores observaram, ao introduzir os vírus marcados em meio contendo bactérias, que os isótopos de fósforo (¤£P) apareciam no interior das bactérias e que os isótopos de enxofre (¤¦S) permaneciam fora das células. Observaram também que, após lavarem a superfície das bactérias, retirando o enxofre (¤¦S), continuava ocorrendo a replicação dos vírus. Com esse experimento, eles puderam concluir que a) a informação genética necessária para a síntese de novos vírus está contida no DNA viral. b) as capas protéicas dos vírus contêm parte importante da informação genética necessária à síntese de novos vírus. c) o DNA viral precisa estar associado integralmente às capas protéicas para poder se replicar no interior das bactérias. d) a capa protéica protege o DNA viral da ação de endonucleases no interior do organismo hospedeiro. e) os vírus bacteriófagos contêm DNA como material genético, e essa molécula é muito rica em enxofre. Questão 1123 No início da década de 1950, foi desenvolvido um experimento onde um dos componentes de um tipo de bacteriófago foi marcado radiativamente com enxofre e outro, com fósforo. Esses bacteriófagos foram utilizados para infectar uma cultura de 'Escherichia coli'. Um dos componentes entrou na bactéria, e o outro foi retirado da parede da mesma, por agitação. A cultura foi, então, imediatamente, centrifugada. O resultado obtido encontra-se ilustrado no esquema a seguir.

obre o resultado do experimento, é correto afirmar que a) o DNA do bacteriófago marcado com fósforo encontra-se no depósito bacteriano. b) as proteínas do bacteriófago marcadas com enxofre encontram-se no depósito bacteriano. c) o DNA do bacteriófago marcado com enxofre encontra-se em suspensão. d) as proteínas do bacteriófago marcadas com fósforo encontram-se em suspensão. e) o DNA do bacteriófago marcado com enxofre encontra-se no depósito bacteriano. Questão 1124 Por razões pouco conhecidas, durante a meiose pode ocorrer a não-disjunção de um determinado par de cromossomas, acarretando anomalias cromossomiais. Como exemplo de anomalia cromossomial autossômica temos: a) mongolismo. b) daltonismo. c) hemofilia. d) Síndrome de Turner. e) Síndrome de Klinefelter. Questão 1125 O esquema a seguir representa a formação dos gametas responsáveis pela produção de um indivíduo com alteração do seu número cromossomial.

252

1.5.9.1

III IV a) 65 , 65. b) 65 ,130. c) 70 , 60. d) 130 , 65. e) 130 , 130. Questão 1128 Monossomia do cromossomo X, ovários rudimentares, mau desenvolvimento dos caracteres sexuais secundários, baixa estatura são, entre outros, dados que podem ser relacionados com a síndrome: a) de Marfan b) de Klinefelter c) de Down d) de Turner e) de Patau Questão 1129 A constituição genética dos indivíduos com síndrome de Klinefelter é: a) 45A XX b) 44A XYY c) 44A XXY d) 45A XO e) 47A XXY Questão 1130 A síndrome de Down ou mongolismo é uma anomalia causada por: a) uma mutação gênica b) uma deficiência cromossômica c) uma diminuição do número de cromossomos no genoma d) um aumento do número de cromossomos do genoma e) uma inversão cromossômica Questão 1131

ntre as características que este indivíduo passará a apresentar, teremos: a) sexo masculino. b) cariótipo normal. c) estatura elevada. d) caracteres sexuais desenvolvidos. e) ausência de cromatina sexual. Questão 1126 A síndrome de Klinefelter é uma anomalia genética devido à: a) presença de três cromossomos autossômicos nŽ 21. b) ausência de um cromossomo autossômico nŽ 21. c) presença de um cromossomo X e dois cromossomos Y. d) presença de um cromossomo Y e dois cromossomos X. e) ausência de cromossomos sexuais. Questão 1127 Suponha que o seguinte processo ocorre em uma comunidade onde convivem diferentes espécies de gramínea: Qual das alternativas a seguir indica corretamente o valor de 2N dos híbridos III e IV do processo esquematizado?

1.5.9.1

Se na ovulogênese, não houver disjunção do par de cromossomos sexuais, os óvulos correspondentes, sendo fecundados, poderão dar origem a casos de a) síndrome de Turner b) síndrome de Klinefelter c) síndrome de Down d) síndrome de Patau e) a e b são possíveis
253

Questão 1132 Duas espécies de plantas A(2n = 8) e B(2n = 6) foram cruzadas produzindo um híbrido interespecífico que, germinando, produz alguns grãos de pólen que foram utilizados para fecundar óvulos da espécie B. Assinale a opção que relaciona o nível de ploidia e o número de cromossomos da descendência. a) 2n = 7 b) 2n = 10 c) 3n = 7 d) 3n = 10 e) 4n = 14 Questão 1133 Duas espécies de plantas A(2n = 8) e B(2n = 10) foram cruzadas produzindo um híbrido interespecífico que, germinando, produz alguns grãos de pólen que foram utilizados para fecundar óvulos da espécie B. Assinale a opção que relaciona o nível de ploidia e o número de cromossomos da descendência. a) 2n = 7 b) 2n = 14 c) 3n = 14 d) 3n = 10 e) 4n = 14 Questão 1134 A figura a seguir representa uma sinapse (pareamento) anormal observado quando ocorre a mutação cromossômica estrutural denominada:

a) inversão pericêntrica b) translocação c) duplicação d) deleção e) isocromossomos Questão 1135 A figura a seguir representa uma sinapse (pareamento) anormal observado quando ocorre a mutação cromossômica estrutural denominada:

1.5.9.1

a) inversão pericêntrica b) translocação c) duplicação d) deleção e) isocromossomos Questão 1136 Existem algumas pessoas chamadas especiais porque possuem uma série de características diferentes da maioria da população. Entre essas, estão aquelas que possuem a 'Síndrome de Down', também conhecida como Mongolismo. Em relação a essa síndrome, podemos afirmar que: a) é uma anomalia genética, causada pela presença de 3 cromossomos 21 e transmitida sempre pela mãe. b) é uma anomalia congênita, causada pela presença de 3 cromossomos 21 e transmitida sempre pela mãe. c) é uma anomalia genética, causada pela presença de 3 cromossomos 21 e transmitida por qualquer um dos pais. d) é uma anomalia congênita, causada pela ausência de um cromossomo sexual X ou Y. e) é uma anomalia genética, causada pela translocação de um dos cromossomos 21 para um 22.

1.5.9.1

254

Questão 1137 Num dado organismo, foram encontradas células somáticas normais com seis cromossomos (I) e células aberrantes (II e III) cujos cariótipos estão esquematizados a seguir.

Questão 1139 O número de cromossomos de uma espécie é 2n=20. O sistema de determinação do sexo é do tipo ZW. O cariótipo que representa uma euploidia é: a) 20, ZW b) 20, ZZ c) 30, ZWW d) 19, ZO e) 21, ZZW Questão 1140 A figura a seguir ilustra o processo denominado AMNIOCENTESE, utilizado para diagnóstico pré-natal de doenças genéticas. A técnica consiste na remoção de uma pequena quantidade de líquido amniótico (que banha o feto durante o desenvolvimento embrionário) para análise. Nesse líquido são encontradas proteínas e células que se soltam da pele do feto e dos revestimentos das vias gastrointestinais, respiratórias e genito-urinárias. As células imersas no líquido podem ser coletadas por centrifugação e utilizadas para estabelecer culturas de amniócitos. Essas culturas podem ser analisadas citologicamente, ou por análise do DNA.

1.5.9.1

s aberrações cromossômicas dos cariótipos II e III são, respectivamente, do tipo a) monossomia e trissomia. b) monossomia e poliploidia. c) nulissomia e trissomia. d) nulissomia e poliploidia. e) nulissomia e monossomia. Questão 1138 Observe o cariótipo a seguir, obtido a partir de células diplóides de uma pessoa.

1.5.9.1

1.5.9.1

ua análise permite afirmar que ele pode pertencer a uma mulher a) normal, com 47 cromossomos. b) com síndrome de Down. c) com síndrome de Klinefelter. d) com daltonismo. e) com polidactilia.

255

obre o processo acima descrito são feitas várias afirmações. Com base em seus conhecimentos e no texto acima, assinale a alternativa que apresenta um ERRO conceitual ou processual. a) O líquido amniótico funciona como amortecedor de choques mecânicos e propicia um ambiente adequado para o desenvolvimento do feto. b) Células presentes no líquido podem ser utilizadas para a determinação de anomalias cromossômicas. c) O processo pode ser indicado para gestantes com idade avançada, para as quais é maior o risco de terem filhos com Síndrome de Down. d) A cariotipagem pode ainda ser utilizada para a detecção de erros inatos do metabolismo como, por exemplo, a hemofilia. e) A presença de alguns vírus, como o da rubéola, apontam para possibilidade de más formações congênitas na criança. Questão 1141 O daltonismo é um caráter ligado ao sexo na espécie humana. A seguir estão representados os cariótipos de cinco indivíduos que apresentam uma anomalia cromossômica numérica, além de serem todos daltônicos.

odas as afirmações a seguir referentes aos indivíduos representados são verdadeiras, EXCETO: a) O gameta com um cromossomo a mais que deu origem ao indivíduo I foi produzido por não-disjunção na segunda divisão meiótica da gametogênese masculina. b) Ao pai do indivíduo II é obrigatoriamente daltônico, e a não-disjunção que resultou na anomalia pode ter acontecido na gametogênese feminina. c) Se o pai do indivíduo III não for daltônico, a não-disjunção que resultou na anomalia ocorreu na gametogênese feminina. d) Se o pai do indivíduo IV não for daltônico, a não-disjunção que resultou na anomalia ocorreu na gametogênese feminina. e) A mãe do indivíduo V pode ou não ser daltônica. Questão 1142

1.5.9.1

1.5.9.1 Acima, representa-se esquematicamente uma alteração estrutural de um cromossomo que serve de exemplo para o fenômeno denominado a) duplicação. b) deleção. c) translocação. d) transdução. e) inversão. Questão 1143 Uma mulher triplo-X é fértil e produz óvulos normais e óvulos com dois cromossomos X. Sendo casada com um homem cromossomicamente normal, essa mulher terá chance de apresentar a) apenas descendentes cromossomicamente normais. b) apenas descendentes cromossomicamente anormais. c) 50% dos descendentes cromossomicamente normais e 50% cromossomicamente anormais.
256

De acordo com o texto e os conhecimentos sobre o tema. Meristemas desta geração de híbridos (F1) foram submetidos a um tratamento com colchicina. d) A duplicação do número cromossômico permitiu a formação de 28 pares de cromossomos bivalentes.9. é possível detectar a anomalia que caracteriza a síndrome de Down. Assinale a alternativa que representa esse cromossomo após um rearranjo do tipo inversão. que florescia. c) existência de um autossomo extra. que foram seletivamente eliminados em F2. e) 75% dos descendentes cromossomicamente normais e 25% cromossomicamente anormais. 1. havendo multiplicação apenas do lote haplóide de uma das espécies. Em II. respectivamente. assinale a alternativa que indica a causa mais provável para a infertilidade da F1. 1. de 257 . em I. temos uma célula diplóide 2n = 6 cromossomos. mas não conseguia produzir sementes. III e IV. e) A duplicação deu-se apenas com os cromossomos viáveis de cada espécie e o número total foi completado com quebras cromossômicas. também com 2n=28. pertencentes a gêneros diferentes. c) A primeira geração filial era infértil. b) Durante a meiose ocorrida em F1. Questão 1144 Na espécie humana. Questão 1145 Duas espécies de gramíneas.9. temos exemplos. a anomalia conhecida como síndrome de Down ou mongolismo deve-se à a) mutação de um gene autossômico. seguida de reprodução normal na F2: a) O tratamento com colchicina removeu as barreiras químicas existentes nos dois conjuntos de cromossomos.1 Questão 1148 Na figura a seguir. foram cruzadas e criou-se um híbrido.5. que por sua vez produziam sementes normalmente.1 s eventos possíveis da meiose que levam à síndrome de Down são os de número: a) 1 e 4 b) 1 e 3 c) 2 e 3 d) 2 e 4 Questão 1147 Considere o cromossomo a seguir esquematizado. gerando plantas (F2) com 2n=56. d) existência de um cromossomo X extra. ambas com número cromossômico 2n=28. Questão 1146 Pela análise dos cromossomas. em função de alelos incompatíveis. parte dos cromossomos foi eliminada. viabilizando a meiose.5. o que resultou em uma duplicação do número cromossômico. b) mutação de um gene do cromossomo X. O esquema a seguir apresenta quatro eventos da divisão celular.d) 25% dos descendentes cromossomicamente normais e 75% cromossomicamente anormais. e) falta de um cromossomo X.

translocação. d) recombinação gênica. usando-se técnicas de melhoramento genético. inversão pericêntrica. Chamava-se Sete-de-Ouros. entre os quais. e já fora tão bom. como outro não existiu e nem pode haver igual. apresentar alterações. b) a presença de dois cromossomos X impede a manifestação do fenótipo masculino. c) monossomia.1 Questão 1153 Na Síndrome de Down. Questão 1150 "Era um burrinho pedrês.Guimarães. Esses vegetais podem ser reproduzidos pelo homem. mais vantajosos economicamente. e) translocação cromossômica. que induz à a) haploidia. d) monossomia." (ROSA. miúdo e resignado. 1. "Sagarana". translocação. ( ) nos homens. b) inversão cromossômica. 258 . d) a fecundação de um óvulo X por um espermatozóide XY dá origem a um indivíduo Klinefelter. 1. translocação. Com base nessas informações e outros conhecimentos sobre o assunto. é INCORRETO afirmar que a) os pais de um indivíduo Klinefelter têm número normal de cromossomos nas células somáticas. Questão 1149 Vegetais maiores. artificialmente. c) a ocorrência do fenótipo mutante é resultado de um cromossomo extra. translocação. por conseguinte.1 a) haploidia. inversão paracêntrica. podemos citar o uso da Colchicina.5. ocorrem casualmente na natureza. translocação. mais vigorosos e.9. não levando à aneuploidia em seus filhos. inversão paracêntrica.) Todas as alternativas apresentam características biológicas do burrinho referido nesse texto. Assinale nos parênteses V se for verdadeira ou F se a afirmação for falsa. d) Produz gametas inviáveis. Questão 1152 Muitas aberrações cromossômicas humanas se manifestam como síndromes bem definidas e de fácil constatação pela análise do cariótipo. não existindo não-disjunção e. também conhecida como trissomia 21: ( ) a causa é a não-disjunção. Como exemplo. ou não sei onde no sertão. c) É um típico exemplo de animal híbrido. EXCETO a) É resultante do cruzamento de égua com jumento. a produção de espermatozóide ocorre durante todos os anos reprodutivos. e) monossomia. o fenômeno ocorre quando os cromossomos não se separam durante a primeira divisão meiótica. c) poliploidia.Questão 1151 O número de cromossomos da espécie humana pode.9. Na tabela a seguir são dados cinco casos cuja veracidade você deverá analisar.5. Conceição do Serro. Pessoas com síndrome de Klinefelter possuem 47 cromossomos. inversão pericêntrica. inversão paracêntrica. b) haploidia. J. por esse motivo. os cromossomos sexuais são representados por XXY. vindo de Passa-Tempo. isto é. às vezes. b) Tem características morfológicas idênticas às de um dos pais.

podem-se perceber erro conceitual grave. c) Trissomia. Quando bem assistidas. II e III estão corretas. Na grande maioria dos casos. comenta em um dos seus artigos: ". translocado para outro cromossomo. Questão 1154 A Síndrome de Down. pessoas com síndrome de Down alcançam importantes marcos no desenvolvimento e podem estudar. Quanto a esses micronúcleos. Abril 2000: nŽ 159. esterilidade e pescoço alado. d) deslocação. b) substituição. 26 Os casos de aneuploidias citados no texto incluíam daltonismo e hemofilia. além do núcleo. Esta Síndrome pode ser classificada como exemplo de a) Nulissomia. Nélio. e) Triploidia. Em função do comentário do professor. 259 . trabalhar e ter uma vida semelhante à dos demais cidadãos. Questão 1158 As anomalias cromossômicas são bastante freqüentes na população humana. um exemplo disso é que aproximadamente uma a cada 600 crianças no mundo nasce com síndrome de Down. d) Euploidia.( ) afeta indivíduos que têm um autossoma extra. b) I e III estão corretas. b) Monossomia. III . Questão 1157 Mulheres com Síndrome de Turner caracterizam-se por apresentar baixa estatura. isso se deve à presença de um cromossomo 21 extranumerário. b) fecundação de um gameta feminino diplóide por um gameta masculino haplóide.o livro confunde herança ligada ao sexo com aneuploidias. e) bipartição. como por exemplo: explique por que o homem não é portador de aneuploidias. uma aneuploidia autossômica. preconceito e tautologia em uma única linha. e) I está correta. professor da Faculdade de Educação da USP. c) II e III estão corretas." BIZZO. d) fato de as células autossômicas dos portadores terem 46 cromossomos. p. caracteriza-se pela trissomia do cromossomo 21 e decorre do(a) a) erro de disjunção do cromossomo 21 durante a formação dos gametas. c) deleção. Questão 1156 Uma pesquisadora analisou células da mucosa bucal de frentistas de postos de gasolina. ( ) o longo período de intervalo entre o início da meiose do tecido ovariano (durante o desenvolvimento fetal) e seu término (na ovulação) é a mais provável razão para a incidência aumentada em mães mais idosas. "CIÊNCIA HOJE"..tanto o homem quanto a mulher podem ser portadores de aneuploidias. mas apresenta a doença quando afetado. podemos supor que se originaram a partir de a) translocação.daltonismo e hemofilia são alterações gênicas e não cromossômicas. apresentavam micronúcleos originados em cromossomos defeituosos. Questão 1155 FALHAS NO ENSINO DE CIÊNCIAS "ERROS EM LIVROS DIDÁTICOS AINDA PERSISTEM EM ESCOLAS DE MINAS E SÃO PAULO" Nélio Bizzo O autor. Foram encontradas muitas células que. em alguns casos. II .. ou um segmento do cromossomo 21. Pode-se afirmar que a) I e II estão corretas. Rev. c) senilidade dos ovócitos em mulheres com idade a partir dos 35 anos. analise as afirmações abaixo: I . d) I. ( ) os portadores têm uma cópia extra do cromossomo 21.

Questão 1159 Em uma certa espécie de animal selvagem.9. (32) ocorrem preferencialmente em populações de menor renda. julgue os itens abaixo. b) poliplóide.1 260 . são exemplo de trissomia e de monossomia. d) haplóide. (2) Os erros na distribuição de cromossomos que levam às aneuploidias são freqüentes no processo de meiose e raros nas mitoses. (4) As síndromes de Down e de Turner. Questão 1160 A figura abaixo esquematiza a não-disjunção cromossômica.5. e) monossômico. (08) estão intimamente ligadas à separação incorreta dos cromossomos na meiose.9. células de seis indivíduos. 1.5. é CORRETO afirmar que: (01) podem ocorrer tanto na espermatogênese quanto na ovulogênese. Entretanto. com a indicação do número de cromossomos autossômicos (A) e dos tipos de cromossomos sexuais (X e Y). numerados de 1 a 6. presentes em cada uma delas. com menor escolaridade e pouca assistência médica. em esquema. pode-se afirmar que o indivíduo é: a) trissômico. Questão 1161 1. (16) ocorrem ao acaso. onsiderando-se os dados anteriores.5. produzindo doenças graves e até mesmo a morte.1 Os quadrados a seguir representam.9.XY. (02) ocorrem mais em meninas do que em meninos. os machos normais apresentam complemento cromossômico igual a 2n=6. (64) podem acontecer devido a erros na duplicação do DNA. c) triplóide. (04) ocorrem somente em filhos e filhas de mulheres de idade avançada. um indivíduo anormal foi identificado na população e seu cariótipo foi representado pela seguinte forma: 1.1 A respeito desse tema. (3) As aberrações cromossômicas numéricas causam grandes alterações no funcionamento celular. causadas por não-disjunções cromossômicas. devido a um erro na gametogênese.Sobre as anomalias do número de cromossomos. (1) As fibras do fuso acromático têm importância fundamental para as migrações cromossômicas características da anáfase.

respectivamente. tetrassomia e até pentassomia desse cromossomo.Sempre que o ambiente se torna desfavorável. que é um dos menores cromossomos da espécie. o ser vivo reage sofrendo uma mutação gênica. 261 . Questão 1163 Na espécie humana. tais como: presença de um cromossomo 21 a mais. A célula do indivíduo 2 pode ser igual a de um gameta do indivíduo 1. Down e Morgan. foram feitas as afirmações seguintes. III. apenas. II .As mutações ocorridas em células somáticas são de grande valor adaptativo para a perpetuação da espécie. tendo apenas um X. d) somente a II e a III. A(s) afirmação(ões) correta(s) é(são): a) somente a II. e) a I. determinam. O indivíduo 4 pode ser do sexo masculino ou do sexo feminino. e às células representadas. b) Morgan. sendo dois X e um Y e 45 cromossomos. apenas. 47 cromossomos. é conhecida a trissomia do cromossomo 21 (síndrome de Down). Questão 1165 Considere um segmento de DNA com seqüência de bases indicadas a seguir: TTA TCG GGA CCG ATC ATC GTA A alteração mais drástica que esta molécula pode sofrer é a: a) supressão da segunda base nitrogenada. Turner e Klinefelter.Ocorrem em células sexuais e somáticas. c) substituição da quarta base nitrogenada por outra. Questão 1166 Analise as afirmativas a seguir a respeito das mutações. Turner e Klinefelter. I. as síndromes de: a) Down. a II e a III.Ocorrem para adaptar o indivíduo ao ambiente. Em relação ao cromossomo sexual X são conhecidos casos de recém-nascidos do sexo feminino com trissomia. A que se deve esse fato? a) Ao cromossomo X ser um dos menores cromossomos do conjunto haplóide b) Ao cromossomo X ser basicamente formado por heterocromatina com poucos genes estruturais c) Ao cromossomo X não ter uma pequena parte homóloga ao cromossomo Y. c) Turner. II . d) I e III. leia as afirmações a seguir. c) III apenas. c) somente a I e a III. c) I e II. 5 e 6 são normais e pertencem à espécie humana. d) Down. e) Klinefelter. b) II. Estão corretas as afirmações: a) I.As mutações transmitidas às gerações futuras são aquelas que ocorrem em células germinativas. II. III . o que evita a permuta gênica entre eles d) Aos cromossomos X menos um serem inativados ainda na fase do desenvolvimento embrionário e) Ao cromossomo X ser o cromossomo com maior quantidade de ADN repetitivo. a forma e o tamanho dos cromossomos. e) inclusão de mais três bases nitrogenadas no final da molécula. b) supressão das três primeiras bases nitrogenadas. apenas. apenas. I . b) somente a I e a II. d) substituição das três primeiras bases nitrogenadas por outras. Turner e Down. e) II e III. apenas. Os indivíduos 3.Podem alterar o número. III . Klinefelter e Turner. o chamado ADN lixo Questão 1164 As alterações do número de cromossomos. Questão 1162 A respeito das mutações. I .m relação a estes indivíduos. Está(ão) correta(s) a) I apenas b) II apenas.

c) origina apenas seres recessivos. d) somente 3 e 4. b) ocorre exclusivamente pela ação de agentes mutagênicos. Questão 1167 A estrutura química de uma proteína poderá ser modificada se a) durante sua síntese houver variação dos tipos de aminoácidos disponíveis no citoplasma celular. 1979). dizemos. 2. com a alteração de apenas uma base nitrogenada. muitas vezes não resultam em substituição efetiva do aminoácido correspondente ao códon mutado na proteína produzida. Errar é humano. d) uma base púrica substituir uma pirimídica no RNA mensageiro que a codifica. Isto se dá devido ao fato de: a) o código genético ser universal.9. Questão 1170 Diversas doenças estão relacionadas a mutações no material genético. d) excreção. mutações pontuais. c) excitabilidade.. uma adenina sofreu uma desaminação e transformou-se em hipoxantina (H). c) sua síntese ocorrer no complexo de Golgi e não no retículo endoplasmático rugoso. Sem esse atributo especial.3 onsiderando as moléculas III. Após a replicação da molécula I. Questão 1171 O esquema a seguir mostra dois ciclos de replicação de moléculas de DNA. Questão 1169 "A capacidade de errar ligeiramente é a verdadeira maravilha do DNA. b) durante sua síntese houver variação dos tipos de RNA transportadores. Um par de bases nitrogenadas está identificado. b) reprodução. e a música não existiria (. b) o código genético ser repetitivo ou degenerado. Porém. e) origina somente combinações gênicas adaptativas. Questão 1168 A mutação gênica. Questão 1172 Leia as afirmativas a seguir: I. ed. c) o erro ser corrigido pela célula durante a tradução.). mas a idéia não nos agrada muito. As cianofíceas reproduzem-se apenas assexuadamente. e) o DNA não se duplicar durante a intérfase. É ela: a) seleção natural.5. II. de modo que podemos esperar baixa variabilidade na sua população. d) ocorre devido a alterações na molécula de DNA. a mutação no par de bases indicado estará presente em a) somente 1. d) o código genético não poder sofrer alterações. base que normalmente emparelha-se com citosina (C). Mutações podem ocorrer espontaneamente ou serem 262 . c) somente 1 e 2.d) I e II apenas. e) os genes mutados não serem transcritos ou traduzidos. 1. b) somente 2. RJ. e) 1. Esse texto refere-se a uma característica dos seres vivos. e) II e III apenas. e) mutação. seríamos ainda bactéria anaeróbia. nos organismos eucariontes a) constitui a principal fonte de variabilidade genética. 3 e 4. "A medusa e a lesma". e é mais difícil ainda aceitar o fato de que errar é também biológico" (Lewis Thomas.. Nova Fronteira.

os cientistas afirmaram que a imunidade está relacionada a uma mutação genética. somente. por ter sido transmitida de geração em geração. e MATSON K. de forma significativa. b) Y. Mutações constituem um fator causador de variabilidade.. Os cientistas consideraram esse percentual muito elevado. Essa alteração na seqüência de DNA e a eliminação do indivíduo são fenômenos que podem ser explicados pela ocorrência. somente.. somente. a única oportunidade para aprendermos algo relativamente novo. d) I apenas. (Adaptado de DENNETT. III. e) X ou no gene Z. que permite que ela ocorra em grande número de indivíduos. Questão 1173 Em certo fungo. b) evitar a ação de agentes externos sobre os genes c) representar uma vantagem para a sobrevivência d) ocorrer em resposta à necessidade de adaptação Questão 1175 Durante o processo evolutivo.9. Há momentos em que é importante não cometer erro algum . 1997. (Org. II e III. A partir do estudo de um grupo de 1850 pessoas. Esses fungos devem ter sofrido mutação no gene a) X. São Paulo: Cia.). capaz de destruir um organismo.e sem os erros as tentativas não teriam levado a nada. c) Z. Entretanto. apresentada por 3% dos pacientes estudados. ocorre a seqüência de reações a seguir esquematizada que leva à síntese do aminoácido arginina. respectivamente. é: a) impedir a multiplicação de determinado vírus no interior das células .. No entanto (. das Letras.) A evolução biológica se dá através de uma grande e inexorável seqüência de tentativas e erros .induzidas. Questão 1174 Recentemente cientistas confirmaram suas suspeitas de que existem pessoas imunes à AIDS. eles são. Uma das conseqüências deste fenômeno está descrita na seguinte alternativa: a) limitação da diversidade biológica 263 1. como aquelas provocadas pelos raios X. In: BROCKMAN.pergunte a qualquer cirurgião ou piloto de avião.) os erros não são apenas oportunidades valiosas para aprendermos. J. pode ocorrer uma alteração permanente numa seqüência de DNA.3 erificou-se que certos fungos mutantes só conseguem sintetizar arginina quando a ornitina é acrescentada ao meio de cultura. de: a) especiação e ortogênese b) mutação e seleção natural c) oscilação genética e epigênese d) variação hereditária e isolamento ecológico Questão 1176 Cometer erros é a chave para o progresso.) O processo que se relaciona com o conceito de evolução biológica apresentado pelo autor é: a) reparação das lesões gênicas b) indução de mutações programadas c) geração de organismos transgênicos d) alteração aleatória na estrutura do DNA Questão 1177 As mutações representam um importante mecanismo evolutivo para os organismos.. c) II e III apenas. As coisas são assim. b) I e II apenas. e) II apenas. A afirmativa está CORRETA em: a) I. Daniel C.5. a sobrevivência dos indivíduos de uma determinada espécie depende da estabilidade genética. (. d) X ou no gene Y. A característica da mutação.

b) aumenta a freqüência de crossing-over. em um período de tempo. b) Fluxo gênico. o qual é reconhecido pelo anti-códon GCU. d) sempre é dominante e prejudicial ao organismo. d) A trinca indicada por 5 pode transcrever um códon CGA. c) Seleção natural.3 odas as afirmativas são corretas quanto à seqüência. e) A troca da primeira base. pelo menos.5. c) A seqüência pertence a um DNA e pode codificar um polipeptídeo contendo. Questão 1180 Assinale a alternativa que indica o fator que conduz ao surgimento de variabilidade gênica nova. em uma determinada região africana que possui casos de malária. nesse caso. em uma população. e) Oscilação gênica. c) os genótipos HH e HÞH estão igualmente adaptados ao longo do tempo.9.5. c) aumenta o número de alelos disponíveis em um locus. 264 . d) a variação do meio. Com base nas informações apresentadas. b) A mutação da 3  base na trinca indicada por 9 pode traduzir um aminoácido diferente. durante um certo tempo. prioriza os indivíduos HH.b) criação de novas variantes de seres vivos c) extinção de espécies nocivas ao ambiente d) produção exclusiva de alterações benéficas Questão 1178 Indivíduos portadores do genótipo HÞH sofrem uma mutação gênica no cromossomo 11 e expressam anemia falciforme ou siclemia. em quaisquer das trincas indicadas. b) a elevação do número de indivíduos HH está associada ao aparecimento de indivíduos HÞH infectados. e) a seleção natural. analise a figura a seguir que representa uma população isolada. Questão 1179 Observe a seqüência de bases nitrogenadas. pode resultar na troca do aminoácido respectivo na proteína. Questão 1181 Pode-se afirmar que a mutação a) sempre ocorre para adaptar o indivíduo ao ambiente. Sabendo-se que o continente africano possui alto índice de malária e que o 'Plasmodium malariae' tem dificuldade de sobreviver nas hemácias de indivíduos portadores do genótipo HÞH. 1. d) Recombinação gênica. desfavorece os indivíduos HÞH. a) Mutação. pode-se concluir que a) o aumento do número de indivíduos HÞH está diretamente associado ao aparecimento de casos de malária. 27 aminoácidos. EXCETO a) A introdução de uma adenina (A) entre as trincas indicadas por 2 e 3 pode alterar toda a transcrição a partir desse ponto.9.3 1.

no qual a parte comestível desenvolve-se a partir do receptáculo da flor. b) todos de casca vermelha. Assinale a alternativa que contém todas as afirmações corretas. o único que fornece material genético novo a um determinado conjunto gênico preexistente é a: a) mutação gênica.isoleucina . CGG. c) lisina . IV. aminoácidos da proteína será a) isoleucina . e) alguns de casca amarela. tais como agentes químicos e físicos. c) todos de casca bicolor. V.treonina. foram apresentadas as cinco afirmações seguintes. como representado na figura.Questão 1182 A coloração vermelha da casca da maçã é determinada geneticamente. um dos frutos. CGC ou CGT lisina = TTT ou TTC Se ocorrer mutação e a nova seqüência de nucleotídeos for TAT TGT CGA TAA. o que chamamos de fruto é um pseudofruto.LISINA. espera-se que as árvores originadas das sementes dessa maçã produzam frutos a) todos de casca amarela.TREONINA .alanina . apresentava casca com as duas cores. d) treonina . e) II. e) reprodução sexuada.treonina . III e V. As mutações podem ocorrer tanto em células somáticas como em células germinativas.5. b) I. b) isoleucina .alanina . a) I. b) recombinação gênica. TAG ou TAT treonina = TGA. Apenas as mutações que atingem as células germinativas da espécie humana podem ser transmitidas aos descendentes.isoleucina. e) lisina . III.lisina. As mutações não podem ser espontâneas. na maçã. independentemente do seu sistema reprodutivo. em uma determinada macieira. a fita que será transcrita apresenta a seqüência de nucleotídeos TAA TGT CGA TTC e codifica. para a seqüência de aminoácidos. isoleucina = TAA. III e V. 265 . III e IV.alanina .lisina . ou seja. II e III. c) seleção natural.isoleucina. II. Questão 1183 Em um determinado gene. Questão 1185 1. d) alguns de casca amarela e outros de casca vermelha.treonina.9.lisina . I.alanina . As mutações são fatores importantes na promoção da variabilidade genética e para a evolução das espécies. Somente as mutações ocorridas em células somáticas poderão produzir alterações transmitidas à sua descendência. c) I.treonina . Questão 1184 Vários são os processos que atuam na evolução. Esses aminoácidos possuem mais de um códon de DNA. ao invés de apresentar casca vermelha. TGC ou TGT alanina = CGA. d) reprodução assexuada. outros de casca vermelha e outros de casca bicolor.ALANINA .treonina . d) II. TGG. Um alelo mutante determina casca de cor amarela. pode-se prever que a seqüência de A respeito das mutações gênicas. Dentre eles. ISOLEUCINA . IV e V.3 onsiderando-se que. Um produtor de maçãs verificou que. mas apenas causadas por fatores mutagênicos.

Questão 1186 Uma bactéria sofre uma mutação pontual em uma região do seu DNA. e) não herdará os tumores. b) produção de filhotes anormais. que era: TAC CTT ATA GAT Ocorreu uma mudança na terceira base. Questão 1189 Um surfista que se expunha muito ao sol sofreu danos em seu DNA em conseqüência de radiações UV. causados por diversos poluentes ambientais. IV .Mutações são modificações bruscas do material genético que podem ser transmitidas à prole (descendência ou células filhas). apenas b) 1 e 3.A mutação pode ser espontânea ou induzida por agentes físicos. Após o experimento. e) tornaram-se estéreis. 3. Questão 1188 Atualmente são bem conhecidos os efeitos adversos à saúde humana. apenas d) 1. e) III. d) IV e III. 2 e 3 e) 2. Questão 1190 Analise as proposições: 1. apenas 266 . pois houve dano no material genético. químicos ou biológicos com potencial mutagênico. a) ATC GAA TAT CTA b) ATG GAA TAT CTA c) AUC UAU AAG GUA d) AUC GAA UAU CUA e) AUG G GAA UAU CUA Questão 1187 Uma experiência realizada com coelhos (linhagem pura selvagem) consistiu em submetê-los a uma descarga excessiva de raio-X. Está(ão) correta(s): a) 1. II e IV.Mutação é toda alteração do material genético. Caso ele venha a ser pai de uma criança. EXCETO: a) produção de um filhote albino. 2.Mutações gênicas podem ser causadas por poluentes ambientais e provocar alterações responsáveis pelo aparecimento de genótipos diferentes numa população. apenas c) 3. devido à sua interação com mecanismos genéticos. c) I. d) herdará os tumores. c) só herdará os tumores se for do sexo masculino. que passou de citidina a guanina. Assinale as afirmações corretas: I . A alternativa que contém as afirmações corretas é: a) I e III. III . c) morte em conseqüência da dose de radiação. d) tornaram-se albinos. que resulta sempre de segregação ou recombinação cromossômica. os quais. ela a) só herdará os tumores se tiver ocorrido dano em um gene dominante. o que resultou em pequenos tumores na pele. b) só herdará os tumores se tiver ocorrido dano em dois genes recessivos. Os principais agentes mutagênicos são as radiações ionizantes e os raios-ultravioleta. especialmente aqueles que possuem potencialidades mutagênicas ou carcinogênicas. b) II e III. As mutações do tipo substituição de base acarretam a alteração de vários aminoácidos nas proteínas. Indique o RNA mensageiro codificado pela seqüência de DNA mutada. II . Modificações hereditárias que ocorrem num locus específico são chamadas de mutações gênicas. podem causar mutações e doenças nas gerações futuras. podemos esperar várias reações.

b) reaja sem utilizar seus anticorpos.400 Angstrons. Para que esta meta seja atingida. O corpo. apresentou.V. c) é herdável. uma vez que as radiações UV danificaram seu DNA. e) produza anticorpos mais rapidamente. a serem cumpridas até o ano 2. o comprimento de onda em que será obtida maior taxa de mutação é a) 2. porque provoca alteração em células germinativas.600 Angstrons. é necessária a vacinação. o que reduzirá a mortalidade infantil em pelo menos um terço. imunizado. onde recebem grande quantidade de antígenos. que consiste em injetar no organismo: a) vírus ou bactérias vivas para provocar a doença de forma branda. b) 2. a utilização de câmaras de bronzeamento artificial.000. produzirá antígenos específicos. recentemente. porque a mutação resultante é dominante. d) não é herdável. e) 2. queimaduras. por estar imunizado.) por uma proteína e por um ácido nucléico. porque provoca alteração do DNA. reconhecidos pelo corpo como antígenos. for aplicada uma segunda dose do mesmo antígeno. espera-se que o organismo: a) reaja da mesma forma como reagiu à primeira dose. tais como lesões na retina. com duração de 15 a 30 minutos cada uma. Pode-se afirmar que esse tipo de câncer a) é herdável. d) o plasma. criados em laboratório. envelhecimento precoce e câncer de pele. Questão 1192 O gráfico mostra o espectro de absorção de raios ultravioleta (U. quatro meses depois. visando diminuir os riscos dessa prática. b) não é herdável. após algum tempo.800 Angstrons. c) 2. b) um medicamento eficaz no combate à doença já instalada e que produza no corpo uma reação para a fabricação de anticorpos específicos e resistentes. para que o corpo produza antígenos e anticorpos específicos.700 Angstrons. produziu anticorpos específicos.4 Considerando a ação desses raios na célula. Questão 1194 Todas as estruturas citadas a seguir podem ser ligadas à defesa do organismo.Questão 1191 A ANVISA (Agência Nacional de Vigilância Sanitária) normalizou. Um organismo recebeu uma primeira dose de um antígeno X e.5. porque a mutação resultante é recessiva. d) não consiga reagir a essa segunda dose. c) não produza mais anticorpos. retirado de pessoas que já tiveram a doença. Uma mulher que se submeteu a dez sessões intercaladas de bronzeamento. c) vírus ou bactérias mortos ou atenuado que. como resposta imune. e) é herdável. a imunização de 90% das crianças. porque provoca alteração em células somáticas. e) o soro obtido através do sangue de animais. d) 2.9. indícios de câncer de pele. Se. Questão 1193 Os meios de comunicação têm noticiado que a Unicef (Fundo das Nações Unidas para a Infância) estabeleceu como uma das metas. induzam a produção de anticorpos específicos. 267 . EXCETO: a) pâncreas b) amídalas c) baço d) timo e) gânglios linfáticos Questão 1195 1.500 Angstrons. como os cavalos.

Assinale a alternativa que esclarece o erro: a) é que vírus do tipo "A" não sofre efeito de vacina alguma b) é que a vacina não combate vírus. embora já esteja produzindo os seus. c) o recém-nascido não produz anticorpos. em duas crianças durante um certo período de tempo. Questão 1199 1. d) soro.Questão 1196 A variação da quantidade de anticorpos específicos foi medida por meio de uma experiência controlada. Para a imunização de cada uma das crianças foram utilizados dois procedimentos diferentes: Criança I: aplicação de soro imune Criança II: vacinação.10 1. e) vacina. O gráfico que melhor representa as taxas de variação da quantidade de anticorpos nas crianças I e II é: Existe um erro de fundamento biológico na historinha da tirinha. porque estimula o organismo a produzir anticorpos. ela proporciona ao nosso organismo produzir defesas. que são específicos aos seus antígenos.5. pois não produz os próprios anticorpos. inibindo a sua atividade de defesa.5. pois produz poucos anticorpos.10 Questão 1197 Leia com atenção a tirinha de Frank & Ernest A análise do gráfico permite concluir que 1. no caso o vírus "A" d) é que a vacina é feita de vírus. 268 . b) soro. porque já contém anticorpos. d) após o nascimento a criança depende completamente dos anticorpos maternos. que é o sistema "chave-fechadura" Questão 1198 Ao ser picado por uma cobra peçonhenta. porque já contém anticorpos. porque estimula o organismo a produzir anticorpos. você deverá procurar recurso através de a) vacina. os anticorpos. c) vacina. b) antes do nascimento o feto nunca produz anticorpos. porque contém antígenos específicos. e) após o nascimento a criança depende dos anticorpos maternos. somente doenças causadas por bactérias c) é que a vacina não combate vírus. portanto ela não pode destruir o que a produz e) é que o vírus impede a ação da vacina.5.10 a) na época do nascimento a criança não está protegida.

c) antecipar a vacinação anti-rábica de cães e gatos nas regiões onde os morcegos foram encontrados. A Secretaria Municipal de Saúde registrou mais um caso de morcego positivo para raiva na cidade de Botucatu.Questão 1200 Analise o gráfico que se segue.08. quando foi visto por estudantes. que se reproduzem e fabricam grande quantidade de histaminas. uma grande proliferação de linfócitos específicos. pois já está imunizado. que reagem liberando histaminas. após algum tempo. 06. d) não produza mais a antitoxina por estar imunizado. 18.5. O primeiro foi notificado no início do mês de junho. b) desencadeiam. na região central da cidade.2006) MAIS UM CASO DE MORCEGO POSITIVO PARA RAIVA NA CIDADE DE BOTUCATU. Questão 1201 DETECTADO FOCO DE MORCEGO COM RAIVA EM BOTUCATU. c) produza a antitoxina mais rapidamente. e) produza menor quantidade de antitoxina. os alergênicos. representam risco de transmissão da raiva. Este é o terceiro caso de raiva em morcego registrado este ano em Botucatu. o procedimento mais adequado que deverá ser tomado pelas autoridades da referida cidade será a) promover campanha para localização e eliminação das colônias de morcegos nas áreas urbana e rural. e) são fagocitadas pelos mastócitos e estimulam a fabricação das interleucinas. d) promover campanha para a vacinação anti-rábica da população humana. 269 . (Portal "Estadão". espera-se que o organismo a) reaja mais rapidamente na segunda dose. espera-se que ele a) não resista a essa segunda dose. pois apenas os morcegos hematófagos. mas não os frugívoros ou insetívoros. Questão 1202 Um coelho recebeu.10 m organismo recebeu uma dose de um antígeno X e. a injeção de uma toxina bacteriana e manifestou a resposta imunitária produzindo a antitoxina (anticorpo). e) reaja na segunda vez. no final do mês de julho. produzindo menos anticorpos. b) demore mais tempo para produzir a antitoxina. O segundo caso na Vila Antártica. De acordo com o gráfico. O morcego encontrado é da espécie 'Myots sp' e alimenta-se de insetos. recebeu outra dose. Confirmada a presença do vírus causador da raiva em um morcego apreendido em uma praça no centro da cidade. que são reconhecidas por um tipo especial de anticorpo. SP. A reação alérgica ocorre quando as moléculas do alergênico a) ligam-se a moléculas do anticorpo presas à membrana dos mastócitos.06. 1. O animal estava caído e se debatendo. c) são reconhecidas pelas células de memória. d) ligam-se aos anticorpos e migram para os órgãos imunitários primários onde são destruídas. nos gânglios linfáticos. O animal foi encontrado caído em uma praça nas proximidades do centro. Se após certo tempo for aplicada uma segunda injeção da toxina no animal.2006) Para se evitar a contaminação da população humana com o vírus da raiva. e) desconsiderar o ocorrido e informar a população que não tenha receio. (Portal da Prefeitura Municipal de Botucatu. b) medicar com antibióticos específicos os animais domésticos que tenham entrado em contado com os morcegos. O morcego doente era da espécie que se alimenta de frutas. c) produza anticorpos mais lentamente na segunda dose. d) reaja sem produzir anticorpos. Questão 1203 A alergia é uma hipersensibilidade desenvolvida em relação a determinadas substâncias. b) não consiga reagir a uma segunda dose. pela primeira vez.

b) anticorpos contra determinado patógeno produzidos por outro animal e que fornecem proteção imunológica. 1. d) células brancas produzidas por animais. e) um patógeno vivo enfraquecido ou partes dele. b) só pode ser feita contra as formas mutantes do HIV. assinale aquela que contém argumento válido e que explica a menor procura por antivenenos no Brasil. e) certamente deverá estar no mercado dentro de pouco tempo. é possível oferecer os seus soros para outros países". d) Falta de veneno em quantidade suficiente para a obtenção do soro. d) neutrófilos e clasmocitose. que se multiplicam no corpo do indivíduo que recebe a vacina. em fevereiro de 1901. c) precisa ser feita contra a forma normal do HIV. Questão 1208 Observe a figura a seguir. mas não causar a doença. tendo em vista a estabilidade do HIV.5. c) A imunização garantida pela administração do soro. capaz de estimular a resposta imunológica.Questão 1204 Uma lesão na pele pode infeccionar. respectivamente.10 270 . Questão 1206 Consideramos uma vacina um material que contém: a) anticorpos contra determinado patógeno. protegendo o organismo. Segundo o Instituto "a demanda da produção de antivenenos vem diminuindo gradativamente no Brasil. Hoje é um centro de pesquisa reconhecido mundialmente na área de biomédicas produzindo diversos tipos de soros antitóxicos e antivenenos. resistentes às drogas ministradas e passíveis de serem transmitidas a outras pessoas. pode-se concluir que a fabricação da vacina anti-AIDS a) apresenta os mesmos problemas que a da vacina contra a gripe. e) Falta de animais com características adequadas para a produção do soro. Das alternativas a seguir. que estimulam a resposta imunológica do indivíduo. foi fundado por Vital Brazil." Pela análise do texto. c) soro de indivíduos previamente imunizados contra aquele patógeno. b) O êxodo rural e a maior concentração da população humana em centros urbanos. a) As reações alérgicas e a alta mortalidade provocada pela aplicação do soro. quando aparecem CÉLULAS DE DEFESA que ATRAVESSAM OS CAPILARES e caem no tecido conjuntivo. Sendo assim. Questão 1205 O Instituto Butantã. Questão 1207 "Os cientistas examinaram 11 homens aidéticos. dos quais 5 nunca tinham usado medicamentos anti-HIV e 6 haviam usado. Verificaram que 8 pacientes apresentavam novas mutações do vírus. famoso pelo seu serpentário. c) leucócitos e diapedese. d) é fácil de ser efetuada. Os termos destacados referem-se. b) euritrócitos e pinocitose. aos a) trombócitos e fagocitose. para a produção de soro no combate à epidemia de peste bubônica.

que será expressa e produzida no interior das células do indivíduo. foram feitas as seguintes afirmações: I. O gráfico a seguir representa o resultado de duas aplicações de mesmo antígeno. pode-se fazer todas as afirmações. induzindo a formação de anticorpos. b) A dose de reforço provoca produção maior e mais rápida de anticorpos.5. Otto. pois fornece para o hospedeiro a informação genética necessária para que ele fabrique o antígeno preservando todas as suas características importantes na indução de uma resposta imune eficiente. diphtheriae'. a) A toxina diftérica funciona para o cavalo como uma vacina. 1999. a antitoxina diftérica é um corpo estranho.tapas na preparação do soro terapêutico. mas é de longa duração. Isso sem gerar os efeitos colaterais que podem aparecer quando são utilizados patógenos vivos. "Scientific American". b) A injeção de toxina na cobaia B é utilizada como controle. IV. A imunidade desenvolvida pela vacina de DNA não é imediata. que possui o gene codificador da proteína antigênica. Patógenos vivos não podem ser usados como vacina. c) A injeção de antitoxina e de toxina na cobaia A é usada como controle para testar a eficácia da primeira na inativação da segunda. para verificar a atividade letal da toxina na ausência do soro. Esse tipo de vacina apresenta uma grande vantagem sobre as demais.10 correto afirmar. ou os problemas proporcionados pela produção das vacinas de subunidades em microorganismos. d) Um animal imunizado com toxina diftérica está protegido da infecção por 'C. e) Para o sistema imunológico da cobaia A. Questão 1209 Os anticorpos são proteínas específicas de defesa do corpo. Questão 1210 A vacina de DNA é a mais recente forma de apresentação de antígeno que veio revolucionar o campo da vacinologia. pois não determinam imunidade e sim doenças. 271 . (Fonte: Desenvolvimento de vacinas gênicas. Em relação aos procedimentos observados na ilustração anterior. Os antígenos produzidos pelo DNA plasmidial são capazes de combater patógenos que infectem o hospedeiro. Assinale-a. Fonte: Bier. c) O tipo de imunização explicitado é ativa. São afirmações CORRETAS: a) I e II b) II e IV c) III e IV d) I e III 1. em intervalos diferentes. 1984. que representa a atividade de células T citotóxicas. MICROBIOLOGIA E IMUNOLOGIA. O processo envolve a inoculação direta do DNA plasmidial. EXCETO uma. III.) Com base no texto. II. Questão 1211 Em relação à figura a seguir. assinale a afirmativa INCORRETA. O indivíduo geneticamente vacinado passa a produzir tanto os antígenos quanto os anticorpos. d) O gráfico acima exemplifica ação das vacinas. EXCETO: a) Doenças diferentes em intervalos menores de tempo provocariam a mesma intensidade de produção de antígenos.

Questão 1214 a) Após efetuar um "ataque letal". d) tomar vacina como mecanismo de prevenção ou usar soro de preferência polivalente em caso de picada acidental. uma fase de invasão e diferenciação nos hepatócitos e uma fase intra-eritrocítica. O controle e prevenção de acidentes com esses animais podem ser feitos tomando-se os seguintes cuidados. e células de memória.previnem a entrada de patógenos e substâncias estranhas.10 a) colocar lixo em sacos plásticos e mantê-los bem fechados para não atrair baratas. cardiotóxica. a fórmula induziu a produção de anticorpos contra a doença. a malária continua sendo um dos principais problemas de saúde pública no mundo. Os pesquisadores ainda precisam realizar mais duas fases de testes clínicos antes de confirmar a eficácia da fórmula.prendem microorganismos no trato digestivo e respiratório.1. EXCETO: VACINA RESISTE A PARASITO DA MALÁRIA Pesquisadores liderados por Pierre Druilhe. um linfócito ativado produz dois tipos de células-filhas: células efetoras. uma célula T citotóxica pode separar e atacar outra célula-alvo. b) manter limpos quintais. Paulo". Em uma pessoa 272 . em Paris. a) Fagócitos . (Fonte: "Folha de S. jardins e terrenos baldios. a) O objetivo do uso da vacina é ativar o sistema de defesa do organismo contra invasores através da produção de anticorpos. bastando que esta esteja ativada. Assinale a alternativa que NÃO apresenta a relação correta entre o fator de defesa e sua função. que produzem anticorpos e têm vida longa. b) Se o organismo apresentar imunidade positiva contra o parasita. Questão 1213 Aranhas e escorpiões podem apresentar efeito peçonhento ao homem. Segundo Druilhe e seus colegas. c) aparar a grama dos jardins e recolher folhas caídas. Esses venenos podem apresentar ação neurotóxica. c) Lágrima . Aplicada em 36 voluntários saudáveis. 09/11/2005) Assinale a afirmativa INCORRETA. que destrói bactérias. dizem ter realizado com sucesso a primeira fase de testes clínicos (em humanos) de uma vacina contra a malária. pode-se afirmar que a vacina foi eficaz contra todos os parasitos do mesmo filo. do Instituto Pasteur. necrosante. não acumulando entulho e lixo doméstico. b) Secreções mucosas . c) As células T citotóxicas podem atacar algumas células tumorais. d) A degradação ou lise da célula infectada não necessita do reconhecimento e da fixação da célula T citotóxica. trata-se do "primeiro teste clínico de uma vacina contra a malária a demonstrar claramente sua atividade contra o parasito". apresentando o mesmo antígeno. c) Apesar de muito antiga. Questão 1212 As defesas inatas dos organismos são geralmente mecanismos de proteção que inibem a entrada ou o desenvolvimento de organismos causadores de doenças. De acordo com a teoria clonal.opõe-se à colonização da pele por alguns patógenos. células de tecidos transplantados e células infectadas por vírus. d) Descamar da epiderme . que realizam o ataque e morrem.5.lubrifica e limpa. moscas e outros insetos. os quais se mostraram capazes de atacar o parasito 'Plasmodium falciparum'. hemolítica. Questão 1215 A memória imunológica e imunidade resultam da seleção clonal. contém lisozima. b) As células T citotóxicas matam células que apresentam antígenos na superfície por meio da secreção de perforinas e linfotoxinas. d) O ciclo vital desse parasita envolve um curto período na corrente sangüínea.

b) circulação venosa. d) circulação linfática. Agora. podem-se observar os seguintes eventos. repetidas vezes. c) Na primeira exposição ao antígeno. e) produção de toxinas.5. após um certo espaço de tempo. que controlam lentamente o invasor. que têm função antiofídica." Fonte: Extraído da Reportagem: Sangue de gambá contém soro antiofídico do Jornal "Folha de S. é INCORRETO afirmar: a) A imunidade dos gambás sul-americanos ao veneno das jararacas foi naturalmente selecionada. As nossas células de defesa exercem o seu papel por meio da fagocitose e da produção de anticorpos. entre as quais se incluem as jararacas. Pesquisadores da Fundação Oswaldo Cruz identificaram no sangue dos gambás duas moléculas. São glicoproteínas que apresentam estrutura parecida com a de substâncias do sistema de defesa do organismo.Paulo". b) Essa resistência dos gambás ao veneno de serpentes viperídeas é determinada geneticamente. d) Um dos componentes do veneno da jararaca poderia ser útil na prevenção de tromboses. c) produção de uréia. enquanto a outra neutraliza as substâncias que matam as células musculares de quem é picado. responsáveis por 90% dos 20 mil acidentes anuais com cobras no Brasil. com produção de células efetoras e de memória. a DM43 e a DM64 parecem especificamente talhadas para neutralizar os principais efeitos do veneno das serpentes da família das viperídeas. EXCETO: a) Ativação de resposta imune primária e produção de clones de células efetoras e de memória pelos linfócitos. Seja como for. A primeira molécula se opõe à ação dos compostos do veneno que causam forte hemorragia na vítima ao impedir a formação de coágulos. respectivamente: a) linfócitos e basófilos. 1.vacinada contra uma possível infecção. embora elas mesmas não sejam anticorpos. São Paulo: Saraiva.: vírus) provoca. que se alimentam de serpentes. Questão 1216 "Por décadas os cientistas tiveram de quebrar a cabeça para criar antídotos contra o veneno das cobras. 273 . c) macrófagos e linfócitos. uma resposta do organismo. Bio. 30/08/2005. b) Maior e mais rápida produção de anticorpos específicos em casos de encontros subseqüentes com o mesmo antígeno. d) eritrócitos e macrófagos. descobriram que uma solução potencialmente melhor foi 'desenvolvida' ao longo de milhões de anos pelos gambás sul-americanos. e) leucócitos e linfócitos. a um mesmo tipo de antígeno (ex. Questão 1218 Uma pessoa que tivesse seriamente comprometida a atividade dos plasmócitos teria problemas com a a) produção de anticorpos. São exemplos destas células. Questão 1217 Compartilhamos o ambiente com uma série de microorganismos que podem causar infecções nos seres humanos. DM43 e DM64. S. b) eosinófilos e eritrócitos. há uma fase de espera antes de o número de moléculas de anticorpos e células T aumentar. Analisando o texto e de acordo com seus conhecimentos. c) Os linfócitos de gambá reagem a picadas das jararacas produzindo soro antiofídico que pode ser letal para as cobras. d) Promoção imediata de resposta imune secundária.10 onte: LOPES. Questão 1219 O gráfico a seguir exemplifica como a exposição de um homem normal.1999.

5. Tal tratamento. d) as interleucinas inibem a proliferação de macrófagos e linfócitos T citotóxicos. será desencadeada uma reação. na maioria das pessoas. b) imunoterapia passiva. cuja intenção é fortalecer a defesa desses indivíduos. Uma série de tipos celulares é responsável pelas reações alérgicas e por outros tipos de hipersensibilidade imune. EXCETO a) basófilos. c) profilaxia. 1. participando assim da imunidade celular. que tem como conseqüência: a) o aumento da produção de anticorpos b) a inibição da produção de anticorpos c) o aumento da produção de antígenos d) a inibição da produção de antígenos Questão 1220 A produção de imunoglobulinas por células do sistema imunitário constitui um dos mecanismos de defesa do organismo contra infecções. dando início à imunidade humoral.Questão 1221 Um novo tipo de tratamento da AIDS começou a ser testado no Brasil e consiste em transmitir anticorpos anti-HIV. ligam-se aos anticorpos e iniciam suas ações fagocitária e secredora. estimulados por substâncias produzidas pelos linfócitos T auxiliares. principais responsáveis pela 274 1. as primeiras células a serem ativadas. d) linfócitos. Questão 1222 A urtiga é um vegetal que provoca. Havendo incompatibilidade entre o doador e o receptor de um órgão ou tecido condicionado pelo MHC. O gráfico abaixo demonstra os níveis de imunoglobulina G (IgG) no soro do feto e do recém-nascido. e) vacinoterapia.10 odemos atribuir esta resposta do organismo ao fenômeno de memória imunológica.10 s resultados acima permitem chegar à seguinte conclusão em relação a esse soro: a) na época do nascimento há presença de IgG materna b) durante a gestação diminuem os níveis de IgG fetal c) durante a gestação os níveis de IgG independem da produção fetal d) após o nascimento diminuem os níveis de IgG produzida pelo recém-nascido . uma forte reação alérgica. e o sistema imune do receptor responde. diferenciam-se em plasmócitos. para pessoas aidéticas sintomáticas. Questão 1223 As principais moléculas responsáveis pela resposta imune aos transplantes de órgãos e tecidos são os antígenos do Complexo Principal de Histocompatibilidade (MHC). produzindo assim uma quantidade maior de anticorpos. mas sem os sintomas da doença. de modo que a) os macrófagos. após reconhecerem os antígenos apresentados pelos macrófagos.5. contidos no plasma de pessoas contaminadas há muitos anos. b) os linfócitos T. c) eosinófilos. multiplicam-se e diferenciam-se. denomina-se a) imunoterapia ativa. e) mastócitos. d) quimioterapia. b) eritrócitos. c) os linfócitos B.

A comparação dos resultados obtidos poderá indicar o quanto a resposta imunológica estará afetada. Entretanto. novas tecnologias para comunicação evidenciam o progresso no século XXI.html Se ao final da experiência mencionada for demonstrado que a resposta imunológica humoral diminui durante os vôos espaciais. genoma. coqueluches. suprimindo os linfócitos B. no mundo globalizado. Ao lado da política e da economia. José Paulo Paes) "." ("Outro retrato". da concorrência entre esses dois países. campeões do capitalismo. Cai o império soviético. normalmente. consiste na análise de amostras de sangue e saliva antes e após a injeção de um determinado antígeno. alterações nos comportamentos sinalizaram um novo tempo. Pesquisas biológicas vêm sendo desenvolvidas com os tripulantes dos vôos espaciais. d) microorganismos ou produtos deles derivados que induzirão a formação de anticorpos.. 275 . Uma dessas.gov/shuttle/archives/ sts-74/orbit/payloads/lifes/regimmun. Questão 1226 As vacinas utilizadas nas campanhas de imunização em massa são constituídas de a) anticorpos que destruirão o agente infeccioso específico. Traduzido e adaptado de: http:// spaceflight. e) soros obtidos de animais que neutralizarão os antígenos específicos. e a URSS. campeã do socialismo. tem o objetivo de estudar até que ponto o sistema imunológico se altera durante vôos espaciais. ao provocar nos indivíduos do sexo masculino o aumento da produção de urina. clonagem. Questão 1224 Com o final da 2 Guerra Mundial. Estas doenças ( ) são transmitidas por vírus e enquadram-se no grupo das que causam desidratação. até mesmo. o conhecimento humano não tem fronteiras nem limites: DNA..nasa. conclui-se que. sarampos" são alterações no bem-estar físico do indivíduo que. A Guerra Fria foi o resultado óbvio dessas tensões e disputas. fraldas sujas coqueluches. nessas condições. enfrentaram-se as duas forças hegemônicas do pós-guerra: os Estados Unidos da América. c) drogas capazes de aumentar a resistência à infecção. iniciou-se um novo período na história da humanidade. sem deixar o paciente vulnerável a infecções. Hoje. aparecem na infância. ( ) podem ser prevenidas pela aplicação de vacinas na primeira fase da vida ou tratadas com medicamentos adequados. Mais conforto. ( ) comprometem os nódulos linfáticos das virilhas. realizada por pesquisadores da NASA. sem suprimir o sistema imunológico do receptor. ao mesmo tempo em que socialismo e capitalismo disputavam o predomínio na produção e nos mercados. A corrida espacial foi um dos aspectos dessa concorrência. a ser realizada na Terra e no espaço. novas comodidades. Esse desejo fez com que rapidamente se transferissem para o cotidiano dos homens os resultados práticos das inovações de guerra. ( ) são típicas das regiões úmidas e frias e têm como vetores insetos do gênero 'Anopheles' sp. a revolução tecnológica avançava como conseqüência. Vencido o perigo nazista. A experiência. b) anticorpos que persistirão ativos por toda a vida do receptor. um novo século. ocorre menor: a) fagocitose do antígeno mediada pelos linfócitos B b) produção de anticorpos pelos linfócitos T citotóxicos c) produção de imunoglobulinas pelos neutrófilos d) produção de anticorpos mediada pelos linfócitos B e) produção de imunoglobulinas pelos macrófagos Questão 1225 "Onde não há cozinhas pratos por lavar vigílias. sarampos.rejeição. e) a ciclosporina age no processo de rejeição. passou a existir o desejo do bem-estar e do conforto mostrar onde se vivia melhor era fundamental.

imediatamente. é INCORRETO afirmar que a) os anticorpos são produzidos tanto em I quanto em II. d) o mRNA do antígeno do patógeno é traduzido em II. Questão 1228 A Campanha Nacional de Vacinação do Idoso. estes estimulam os linfócitos B a produzirem interferons. c) o antígeno do patógeno é produzido pelo camundongo em I. o organismo ativa seus linfócitos T citotóxicos. um organismo infectado por uma bactéria X produzirá mais antígenos em (2) do que em (1). ( ) Devido à elevada especificidade da reação antígeno-anticorpo. Além da vacina contra a gripe. ( ) as chamadas "células de memória" surgem da diferenciação de linfócitos T e B. ( ) Em (1) ilustra-se a resposta primária do organismo após um primeiro contato com um vírus X. podemos afirmar que: ( ) nos nódulos linfáticos e no baço. instituída pelo Ministério da Saúde do Brasil.Questão 1227 Analise estas figuras: 1. se o organismo continuar a produzir anticorpos em quantidades elevadas. c) induzem resposta imunológica. contra as quais o homem dispõe de um vigilante exército para a sua defesa. vem-se revelando uma das mais abrangentes dirigidas à população dessa faixa etária. a vacina contra pneumonia pneumocócica. ( ) Em (2) ilustra-se a resposta imunológica do organismo a uma infecção bacteriana.10 ( ) Ao primeiro contato com um vírus X (1) . por exemplo (Y). como a maioria das bactérias. diz-se que ele adquiriu imunidade humoral. Em relação a esse sistema. ( ) os linfócitos B transformam-se em plasmócitos. b) o código genético do patógeno é igual ao do camundongo. que atua no combate a infecções. anticorpos em nível neutralizador suficiente para inativar o vírus. muito ativos no combate a patógenos externos. proteínas que se ligam 1. células produtoras de anticorpos. Questão 1231 O sistema imunitário. ou ainda células como as cancerosas.10 especificamente a determinados antígenos. podemos afirmar que: 276 . Questão 1229 Para o controle das infecções. Com relação ao sistema imunológico humano. Questão 1230 Há um número muito grande de organismos causadores de infecções. o organismo humano dispõe de diferentes mecanismos de defesa.5. também. os macrófagos. são produzidas células apresentadoras de antígenos. é constituído por diferentes tipos de glóbulos brancos e pelos órgãos responsáveis pela produção e maturação desses glóbulos. o organismo reage e produz. os postos de saúde estão aplicando. É CORRETO afirmar que essas vacinas protegem porque a) são constituídas de moléculas recombinantes. Com relação a este tema. ( ) Após um primeiro contato com um vírus X (2). d) impedem mutações dos patógenos. é correto afirmar que: onsiderando-se os processos de imunização representados.5. ( ) linfócitos T podem adquirir ação citotóxica e destruir células infectadas por vírus. perduram no organismo e podem desencadear a resposta imune com mais rapidez. ( ) contra patógenos extracelulares. enquanto em (1) mostra-se o efeito da pós infecção viral. b) contêm anticorpos específicos.

. muitas vezes por períodos bastante longos. na vida intra-uterina. 2004.se alimenta de nutrientes ricos em ferro c) albuminas . a outra. são proteínas sintetizadas para combater agentes externos (bactérias e vírus.. Questão 1232 Assinale a alternativa que melhor descreve um anticorpo.. (32) São capazes de imobilizar os microorganismos. a qual provoca vasodilatação. a) Uma partícula b) Um organismo c) Uma molécula d) Uma célula e) Um patógeno Questão 1233 Os anticorpos. estimulam os linfócitos B a produzirem anticorpos e eliminam células anormais.. Os anticorpos também são capazes de proteger o embrião humano. Indique o que deve ser aplicado em cada criança. causando vermelhidão e edema nos processos inflamatórios.. em virtude de uma picada de serpente peçonhenta...está exposto a uma maior variedade de organismos patogênicos b) hemácias ... e) vacina.. a) vacina (porque contém antígenos) e soro (porque contém anticorpos) b) soro (porque contém antígenos) e vacina (porque contém anticorpos) c) vacina (porque contém anticorpos) e soro (porque contém antígenos) d) soro (porque contém anticorpos) e vacina (porque contém antígenos) Questão 1235 Quando uma pessoa é picada por um animal peçonhento. porque fornecerá ao organismo elementos de defesa. quando estimulados.. Questão 1236 Assinale a alternativa que preenche corretamente as lacunas do texto a seguir. (16) São dotados de memória imunológica. por exemplo) ou seus produtos. componentes do nosso sistema de defesa. ( ) Linfócitos T reconhecem antígenos nas membranas de outras células. deve procurar socorro através de a) soro. Em relação às características dos anticorpos. O que o relatório mostra é que. produzem interleucinas. onde podem se multiplicar ao detectarem elemento estranhos ao organismo. (04) São produzidos somente pela vacinação. extraídas do plasma de europeus ficam na faixa de 3 gramas por litro. porque é composto por antígenos específicos. b) soro. Adaptado de: "Veja".. (08) Podem atravessar a barreira placentária. e permanecem na corrente sangüínea prontos para nos proteger da ação de patógenos... que induzirá a formação de anticorpos..2 gramas por litro.... fixando-se temporariamente no ducto toráxico. (02) São capazes de neutralizar os vírus. RESPECTIVAMENTE.. se diferenciam em plasmócitos que produzem anticorpos e participam da memória imunológica. enquanto as .. as dos brasileiros situam-se na faixa de 5.. ( ) Os linfócitos T e B originam-se no timo e depois migram para a medula óssea. especialmente nos macrófagos.se alimenta de nutrientes ricos em ferro 277 . Sabe-se que a produção de certos hemoderivados se vale de material retirado do plasma. ( ) Os macrófagos são responsáveis pela secreção de histamina. 28 jul.. a) imunoglobulinas . Uma possível explicação é que o brasileiro . para atendimento. porque contém anticorpos prontos. d) vacina. para se prevenir contra poliomielite. ( ) Os linfócitos B. na ordem em que ocorrem.( ) Os macrófagos fagocitam elementos estranhos e imobilizam resíduos na membrana. é correto afirmar: (01) São capazes de neutralizar toxinas bacterianas. Soma ( ) Questão 1234 Duas crianças foram levadas a um posto de saúde: uma delas. O relatório da Polícia Federal sobre a Operação Vampiro traz uma informação no mínimo irônica sobre o sangue dos brasileiros.. para eliminar quimicamente o veneno. c) soro. estimulando os linfócitosT.

criados em laboratório.07. b) uma substância que combata a doença já instalada e que produza no corpo uma reação para a fabricação de anticorpos resistentes.Alguns tipos de leucócitos (glóbulos brancos) atravessam as paredes dos capilares por diapedese e deslocam-se pelo tecido. Questão 1238 O soro antiofídico é ministrado em pessoas picadas por cobra peçonhenta porque: a) induz a formação de anticorpos. c) Apenas II e III são corretas. b) aplicação do soro. que tem efeito terapêutico. . retirado de convalescentes. Vacinar consiste em injetar no organismo: a) microrganismos vivos para provocar a doença de forma branda. d) o plasma. e) o soro obtido através do sangue de animais. ocasião em que o indivíduo recebe anticorpos. e) vacinação. d) vacinação. pois as pessoas desenvolvem anticorpos contra os antígenos atenuados.tende a apresentar o baço com tamanho aumentado e) imunoglobulinas . submetendo-se as pessoas à a) aplicação do soro. c) é um antibiótico. b) I. de 3 gramas por litro. a) Apenas I e II são corretas. d) Apenas I é correta.tende a apresentar o baço com tamanho aumentado. fagocitando os microorganismos patogênicos.2 gramas por litro. b e c) representam o que pode acontecer quando uma lesão na pele permite a entrada de bactérias que causam infecção. b) contém anticorpos. produzidos pelo organismo de um animal. II e III são corretas. como os cavalos.A inflamação é uma resposta imune do corpo. que é a imunidade adquirida de ação menos duradoura que o soro e de emprego terapêutico. O corpo imunizado produzirá antígenos específicos.10 Analise as afirmativas a seguir: I . c) microrganismos mortos ou atenuados que.2004) noticiou que a quantidade de imunoglobulina extraída do sangue dos europeus é. reconhecidos pelo corpo como antígenos. quando o agente infeccioso provoca uma doença de evolução muito rápida e não há tempo para a imunização ativa. II . Questão 1241 A revista "Veja" (28. para que o corpo produza então os antígenos específicos. induzam a produção de anticorpos específicos. em média. Questão 1237 As ilustrações a seguir (a. resultado da ativação dos mecanismos naturais de defesa do organismo. na tentativa de destruir agentes invasores. onde recebem grande quantidade de antígenos. III . d) provoca imunização. c) aplicação do soro. enquanto a extraída do sangue dos brasileiros é de 5. e) possui antígenos específicos. Questão 1239 Os meios de comunicação têm convocado dentistas e outros profissionais da saúde para a vacinação contra a hepatite B.O tecido lesado libera sinais químicos (histamina e prostaglandinas) que promovem a dilatação dos vasos na área lesada.5. Marque a alternativa correta. Questão 1240 Os agentes infecciosos penetram no corpo das pessoas através dos ferimentos e das mucosas. A incidência de doenças causadas por estes agentes infecciosos poderá ser reduzida. 278 1.d) albuminas . que é um processo ativo de imunização preventiva e duradoura. já prontos.

Assinale a hipótese que pode explicar corretamente a causa de tal diferença. a) Os europeus tomam maior quantidade de vacinas ao longo de sua vida. b) Os brasileiros estão expostos a uma maior variedade de doenças. c) Os antígenos presentes no sangue do europeu são mais resistentes. d) Os anticorpos presentes no sangue do brasileiro são menos eficientes. e) Os europeus são mais resistentes às doenças que os brasileiros. Questão 1242 A partir do recente surto de sarampo na cidade do Rio de Janeiro, o governo decidiu iniciar uma campanha de imunização das crianças. A imunização contra diversos tipos de doenças é atingida através de vacinação, que consiste em injetar no organismo: a) o soro obtido através do sangue de animais criados em laboratório, como macacos, onde recebem grande quantidade de antígenos e anticorpos específicos. b) o plasma retirado de pessoas que já tiveram a doença, para que o organismo produza antígenos e anticorpos específicos. c) um agente químico eficaz no combate a doença já instalada e que produza no corpo uma reação para a fabricação de anticorpos específicos. d) vírus ou bactérias mortos ou atenuados que, reconhecidos pelo organismo como antígenos, induzem a produção de anticorpos específicos. e) vírus ou bactérias vivos, em quantidade pequena, para provocar a doença de forma branda, pois o corpo imunizado produzirá anticorpos específicos. Questão 1243 Nosso corpo está sempre sendo ameaçado de invasão por substâncias estranhas e por uma variedade enorme de microorganismos. Toda vez que isso acontece, além dos nossos mecanismos gerais de defesa, acionamos nosso sistema imune constituído por diferentes tipos de glóbulos brancos e por órgãos imunitários que, primariamente, são: a) fígado e baço. b) fígado e gânglios linfáticos.

c) tonsilas e pâncreas. d) pâncreas e medula óssea. e) medula óssea e timo. Questão 1244 A pigmentação da pele humana é condicionada por pares de genes com ausência da dominância. Suponhamos que apenas dois pares de genes estivessem envolvidos na cor de pele: o negro seria SSTT e o branco, sstt. Um homem mulato, heterozigoto nos dois pares, tem 6 filhos com uma mulher mulata de genótipo igual ao seu. Sobre os filhos do casal, pode-se afirmar que: a) todos são mulatos como os pais. b) cada um deles tem uma tonalidade de pele diferente da outro. c) um ou mais deles podem ser brancos. d) a probabilidade de serem negros é maior do que a de serem brancos. e) 50% apresentam pele branca e 50%, pele negra. Questão 1245 O gráfico a seguir representa um tipo de herança onde os caracteres variam de forma gradativa. As opções a seguir são exemplos deste tipo de herança no homem, EXCETO uma. Assinale-a.

1.5.11

a) Estatura. b) Inteligência. c) Obesidade. d) Fator RH. e) Cor da pele.

279

Questão 1246

1.5.11

dois indivíduos que produzem frutos com 15cm, espera-se uma proporção de plantas com frutos de 17,5cm igual a a) 9/16 b) 1/2 c) 3/16 d) 1/4 e) 1/8 Questão 1249 Em um caso de herança quantitativa, estão envolvidos três pares de genes, "a", "b" e "c". Cruzando-se dois indivíduos triplo heterozigotos, a proporção de homozigotos esperada é de: a) 1/2 b) 1/8 c) 1/16 d) 1/32 e) 1/64 Questão 1250 Imagine que, em um determinado animal, a retenção de água no corpo seja controlada pela interação quantitativa de dois pares de genes, existindo cinco fenótipos (da retenção baixa até a retenção máxima de água). Animais com genótipo aabb retêm baixa quantidade de água, enquanto animais com genótipo AABB apresentam retenção máxima de água. Os animais que apresentam dois genes "maiúsculos" e dois genes "minúsculos" no genótipo retêm uma quantidade intermediária de água. Na genealogia abaixo, são dados os genótipos dos animais indicados pelos números 1, 2, 3 e 6. Considerando que os genes em questão se segregam independentemente, qual a probabilidade de os indivíduos 7 e 8 apresentarem simultaneamente retenção intermediária de água? a) 1/2 b) 1/3 c) 1/4 d) 1/8 e) 1/16

A cor dos grãos de trigo é condicionada por dois pares de genes de efeito aditivo. A tabela acima mostra o número de genes dominantes e as cores determinadas por eles. Do cruzamento entre um indivíduo AaBb e um Aabb, a proporção esperada de indivíduos com grãos vermelhos é de: a) 3/8 b) 1/8 c) 3/16 d) 6/8 e) 5/8 Questão 1247 Admita que a diferença de comprimento das orelhas nos coelhos seja um caso de herança quantitativa envolvendo dois pares de genes com segregação independente. Animais sem nenhum gene dominante possuem orelhas com 4,0cm. Cada gene dominante aumenta em 1,0cm o comprimento das orelhas. O cruzamento que produzirá na descendência uma maior porcentagem de coelhos com orelhas de no mínimo 7,0cm é o a) AaBb x AaBb b) AaBb x aaBB c) AAbb x aaBB d) Aabb x AABB e) AABB x aabb Questão 1248 Para uma determinada planta, suponha que a diferença entre um fruto de 10cm de comprimento e um de 20cm de comprimento seja devida a dois genes, cada um com dois alelos, que têm efeito aditivo e que se segregam independentemente. Na descendência do cruzamento entre

280

1.5.11

de altura e cada alelo p e r determina 10cm. Assim, os indivíduos PPRR têm 80cm e os indivíduos pprr, 40cm. O gráfico a seguir representa a distribuição das classes fenotípicas observada nos descendentes dos cruzamento entre heterozigotos PpRr.

1.5.11

Questão 1251 Supondo que na aboboreira existam 3 pares de genes que influem no peso do fruto, uma planta aabbcc origina frutos com aproximadamente 1.500 gramas e uma planta AABBCC, frutos ao redor de 3.000 gramas. Se essas duas plantas forem cruzadas, o peso aproximado dos frutos produzidos pelas plantas F será de a) 3 000 gramas. b) 2 500 gramas. c) 2 250 gramas. d) 2 000 gramas. e) 1 500 gramas. Questão 1252 A tabela a seguir classifica características hereditárias da espécie humana. Assinale a alternativa que corresponde à classificação correta.

esse gráfico, os indivíduos PPRr e Pprr estão incluídos, respectivamente, em a) IV e V b) IV e II c) III e II d) III e I e) I e V Questão 1254 Um estudante de 23 anos, doador de sangue tipo universal, é moreno, tem estatura mediana e pesa 85 kg. Todas as alternativas apresentam características hereditárias desse estudante que são influenciadas pelo ambiente, EXCETO a) Altura b) Grupo sangüíneo c) Cor da pele d) Peso Questão 1255 Em um dos modelos propostos para a determinação da cor dos olhos na espécie humana (herança quantitativa), são considerados cinco diferentes fenótipos. Na descendência de pais heterozigóticos para os locos determinantes desta característica, foram observados os dados apresentados no quadro abaixo. Analise-os, juntamente com o gráfico, e identifique a correção das proposições a seguir.

1.5.11

Questão 1253 Em certa espécie vegetal, a altura dos indivíduos determinada é por dois pares de alelos de efeito aditivo e segregação independente: cada alelo P e R determina 20cm

281

1.5.11

( ) Três pares de alelos justificam os resultados apresentados. ( ) Nos indivíduos de olhos castanho-claros, os locos em questão podem estar em homozigose ou em heterozigose. ( ) Indivíduos de olhos verdes apresentam homozigose em apenas um dos locos em questão. ( ) A probabilidade do nascimento de duas crianças de olhos azuis, a partir de um casal genotipicamente igual ao do exemplo dado, é de aproximadamente 0,004. ( ) A probabilidade do casal indicado no item anterior de ter duas crianças, sendo uma de olhos castanho-claros e uma de olhos verdes é de 3/16. Questão 1256 A cor da pele humana é conseqüência do efeito cumulativo de mais de um gene, de modo que cada gene contribui igualmente para o fenótipo. O gráfico que representa a proporção fenotípica nesse tipo de herança é

são fenotipicamente homogêneas: apresentam as mesmas características quanto à altura da planta e tamanho da espiga, ao tamanho e número de grãos por espiga, e a outras características de interesse do agricultor. Porém, quando o agricultor realiza um novo plantio com sementes produzidas pelas plantas C, não obtém os resultados desejados: as novas plantas são fenotipicamente heterogêneas e não apresentam as características da planta C; têm tamanhos variados e as espigas diferem quanto a tamanho, número e qualidade dos grãos. Para as características consideradas, os genótipos das plantas A, B e C são, respectivamente, a) heterozigoto, heterozigoto e homozigoto. b) heterozigoto, homozigoto e heterozigoto. c) homozigoto, heterozigoto e heterozigoto. d) homozigoto, homozigoto e heterozigoto. e) homozigoto, homozigoto e homozigoto. Questão 1258 A altura de uma planta depende de dois pares de genes, A e B. O gráfico adiante mostra a variação da altura dos descendentes de dois indivíduos diíbridos.

1.5.11

1.5.11 Com relação ao gráfico, julgue os itens que se seguem. (1) Os efeitos quantitativos dos alelos A e B são, respectivamente, 40 e 30cm. (2) A freqüência de descendentes heterozigotos, para os dois genes, é de 50%. (3) Estão ilustrados cinco genótipos. (4) A herança apresentada é poligênica.

Questão 1257 Uma empresa agropecuária desenvolveu duas variedades de milho, A e B, que, quando entrecruzadas, produzem sementes que são vendidas aos agricultores. Essas sementes, quando plantadas, resultam nas plantas C, que

282

Questão 1259 A altura de uma certa espécie de planta é determinada por dois pares de genes A e B e seus respectivos alelos a e b. Os alelos A e B apresentam efeito aditivo e, quando presentes, cada alelo acrescenta à planta 0,15m. Verificou-se que plantas desta espécie variam de 1,00m a 1,60m de altura. Cruzando-se plantas AaBB com aabb pode-se prever que, entre os descendentes, a) 100% terão 1,30m de altura. b) 75% terão 1,30m e 25% terão 1,45m de altura. c) 25% terão 1,00m e 75% terão 1,60m de altura. d) 50% terão 1,15m e 50% terão 1,30m de altura. e) 25% terão 1,15m, 25% 1,30m, 25% 1,45m e 25% 1,60m de altura. Questão 1260 Políticas de inclusão que consideram cotas para negros ou afrodescendentes nas universidades públicas foram colocadas em prática pela primeira vez na Universidade Estadual do Rio de Janeiro (UERJ), em 2001. Propostas como essas geram polêmicas e dividem opiniões. Há vários argumentos contra e a favor. Os biólogos têm participado desse debate, contribuindo com os conhecimentos biológicos referentes à raça e à herança da cor da pele humana, entre outros. Assinale a afirmação considerada correta do ponto de vista da biologia. a) Os critérios para se definirem duas populações como raças diferentes são científica e consensualmente determinados. b) Não encontramos, na história da biologia, dúvidas sobre a existência de raças na espécie humana. c) A cor da pele humana é um exemplo de herança quantitativa ou poligênica, o que significa que vários genes atuam na sua definição. d) O fato de a cor da pele não ser influenciada por fatores ambientais reforça a hipótese da existência de raças na espécie humana. e) A determinação da cor da pele humana segue os padrões do tipo de herança qualitativa e é um exemplo de co-dominância.

Questão 1261 As diferenças hereditárias entre os indivíduos de uma população podem ser classificadas em qualitativas e quantitativas. A esse respeito, assinale a opção correta. a) Na herança de caracteres quantitativos, existe um grande contraste entre as características que um dado traço fenotípico pode apresentar. b) Na herança de caracteres qualitativos, um dado traço de fenótipo apresenta-se sob grande variedade de formas, em geral com pequenas diferenças entre si. c) Altura, peso e cor da pele são exemplos de algumas características quantitativas do homem. d) Os caracteres qualitativos, em sua maioria, sofrem grande influência do meio. e) A altura não é uma característica hereditária, já que um indivíduo cresce menos se não receber a alimentação adequada na infância. Questão 1262 Determinada característica quantitativa depende da ação de cinco pares de genes. Do cruzamento entre dois indivíduos com genótipo AaBbCcDdEe resultam a) 5 classes fenotípicas. b) 9 classes fenotípicas. c) 10 classes fenotípicas. d) 11 classes fenotípicas. e) 15 classes fenotípicas. Questão 1263 A cor dos pêlos nas cobaias é condicionada por uma série de alelos múltiplos com a seguinte escala de dominância: C (preta) > C (marrom) > C‚ (creme) > c (albino). Uma fêmea marrom teve 3 ninhadas, cada uma com um macho diferente. A tabela a seguir mostra a constituição de cada ninhada.

283

1.5.12

1.5.12

A partir desses dados é possível afirmar que o macho responsável pela ninhada: a) 1 era marrom homozigoto. b) 1 era preto homozigoto. c) 2 era albino heterozigoto. d) 2 era creme heterozigoto. e) 3 era marrom homozigoto. Questão 1264 O controle genético de determinado caráter é feito por uma série de quatro alelos de um só locus. O alelo A é dominante sobre os alelos A‚, Aƒ e A„; o alelo A‚ é dominante sobre os alelos Aƒ e A„ e o alelo Aƒ é dominante sobre A„. Do cruzamento AA‚ x AƒA„ devem ser obtidas: a) quatro classes genotípicas e quatro classes fenotípicas. b) quatro classes genotípicas e duas classes fenotípicas. c) quatro classes genotípicas e três classes fenotípicas. d) três classes genotípicas e três classes fenotípicas. e) três classes genotípicas e duas classes fenotípicas. Questão 1265 Em uma população de organismos diplóides, foram encontrados quatro alelos diferentes para um determinado locus gênico, denominados S¢, S£, S¤ e S¥. A figura a seguir mostra, à esquerda, as diferenças na seqüência de DNA que caracterizam cada um desses alelos e, à direita, o par de cromossomos homólogos (metafásicos) onde esse gene é encontrado. Diante dessas informações, se um único indivíduo desta população for escolhido ao acaso, qual combinação alelo/posição cromossômica poderia ser encontrada no par de cromossomos metafásicos deste indivíduo?

Questão 1266 Se um caráter tem três alelos possíveis, podendo haver seis genótipos, e um segundo caráter apresenta oito genótipos possíveis, quando ambos forem estudados simultaneamente, podem ocorrer a) 7 genótipos. b) 12 genótipos. c) 24 genótipos. d) 48 genótipos. e) 96 genótipos. Questão 1267 Coelhos podem ter quatro tipos de pelagem: chinchila, himalaia, aguti e albina, resultantes das combinações de quatro diferentes alelos de um mesmo loco. Num experimento, animais com diferentes fenótipos foram cruzados várias vezes. Os resultados, expressos em número de descendentes, constam na tabela a seguir.

1.5.12

284

Considere que os alelos "alf" e "beta" são co-dominantes e gama é recessivo em relação a ambos. (08) seis fenótipos. correspondentes a seis genótipos. b) 1 aguti: 1 himalaia. c) a ocorrência do "crossing" não altera a seqüência dos genes nos cromossomos. Questão 1271 Em determinada espécie. e) 10. cada um correspondente a dois genótipos. b) 4. os locos dos genes A e B situam-se no mesmo cromossomo. Quantos deverão ser diferentes dos pais. sabendo-se que a freqüência de permutação é de 10% a) 30 b) 15 c) 270 285 . A porcentagem esperada de gametas Ab que o indivíduo formará é a) 10% b) 20% c) 30% d) 40% e) 80% Questão 1272 O cruzamento CD/cd x cd/cd produziu 300 descendentes. "beta" e "gama". como mostra o desenho a seguir: Se em todas as células ocorrer "crossing-over" entre os genes A e B. d) as proporções entre os tipos de gametas seriam iguais às que ocorrem quando os genes estão em cromossomos diferentes.5. (04) quatro fenótipos. em cujos núcleos estão os cromossomos. e se cada uma originar 4 (quatro) gametas. Questão 1270 No órgão reprodutor de um animal há 1000 (mil) células. porque os gametas recebem cromossomos ao acaso.e o animal progenitor aguti do cruzamento 1 for utilizado para a obtenção de filhotes com o progenitor chinchila do cruzamento 4. Tal gene deve determinar: (01) três fenótipos. o número máximo de alelos representados relacionados ao caráter em questão será igual a a) 2. cada um correspondente a um genótipo. d) 8. Questão 1269 Considere um gene que apresenta 3 alelos. e) 3 aguti: 1 chinchila. aqui denominados "alfa". (16) quatro fenótipos. Na meiose de um indivíduo duplo-heterozigoto AB/ab ocorre permutação entre esses locos em 80% das células. b) a proporção de gametas com as formas não "crossing" seria maior do que a de gametas com as formas "crossing". c) 9 aguti: 3 himalaia: 3 chinchila: 1 albino.13 a) 1 aguti: 1 chinchila. correspondentes a cinco genótipos. c) 6. (02) três fenótipos. correspondentes a quatro genótipos. d) 2 aguti: 1 chinchila: 1 himalaia. que proporção de descendentes poderemos prever? 1. e) não é possível calcular essas proporções. podemos afirmar que: a) todos os gametas formados conterão as combinações resultantes do "crossing". Questão 1268 Suponha que em uma certa espécie diplóide exista um caráter relacionado com uma série de quatro alelos (alelos múltiplos). Em um determinado indivíduo da espécie referida. porque só as cromátides irmãs são envolvidas.

20%. autossômicos.1. é de se esperar lhe a freqüência de permutação entre dois genes esteja na dependência. distam entre só 20 U. Quantos deverão ser diferentes dos pais.1.5. uma certa espécie apresentou a seguinte proporção de gametas: BR . A freqüência de gametas AB. distam entre si 20 UR.d) 290 e) 45 Questão 1273 O cruzamento AB/ab x ab/ab produziu 450 descendentes. c) 1.13 esse cruzamento. Considere o seguinte cruzamento: Fêmea (Ab/aB) X Macho (ab/ab) Qual é a freqüência esperada de machos com o genótipo AB/ab? a) 100% b) 50% c) 25% d) 10% e) 5% Questão 1276 Na espécie humana os genes que determinam a distrofia muscular Duchnne e a hemofilia. aB e ab produzidos por esse indivíduo deve ser. Questão 1275 Em um caso de "linkage". 40%.48.5% br . a) da distância entre eles. 30%. pode-se concluir que a distância entre os genes B e R é de: a) 48.5 morganídeos.5% Pela análise dos resultados. b) do comprimento da zona centromérica. 40% e 10% b) 30%. respectivamente. ocorre "crossing-over" entre esses genes em 40% das células. d) do tipo de polimeria existente. a) 10%. heranças recessivas ligadas ao sexo. Ab. e) 50 morganídeos. sabendo-se que a freqüência de permutação é de 20% a) 30 b) 90 c) 430 d) 360 e) 45 Questão 1274 Analisando-se dois pares de genes em ligamento fatorial ("linkage") representados pelo híbrido BR/br. 10% e 40% e) 40%. Questão 1278 Na meiose de um indivíduo AB/ab. 10% e 10% 286 . b) 97 morganídeos. c) da existência do fenômeno da pleiotropia.5% Br .48. 10%. d) 3 morganídeos. 20% e 20% d) 40%. (unidades de recombinação). Considere o seguinte cruzamento: 1.5% bR . e) da ausência de nucleotídeos covalentes. dois genes A e B. a freqüência esperada de machos afetados pelos dois caracteres é de: a) 0 % b) 5 % c) 10 % d) 20 % e) 40 % Questão 1277 Pelo que se conhece da disposição dos genes dos cromossomos. 40%.R.5 morganídeo. 20% e 30% c) 30%.

e) BR/br. grãos brancos e rugosos. eA = 30. 62. 150 indivíduos que produziam sementes brancas e rugosas. e) EA = 40. 250 indivíduos que produziam sementes coloridas e rugosas e 250 indivíduos que produziam sementes brancas e lisas. eA = 20. d) aumenta a variabilidade genética. d) EA = 30. ea = 10. Questão 1282 Com relação ao processo conhecido como crossing-over. obtidos a partir de cruzamentos EEAA×eeaa. Ea = 40. ao serem cruzados com animais duplo-recessivos.75 U.5 U. c) corrige a recombinação gênica. originaram os seguintes descendentes: 160 com pêlos normais e albinos 160 com pêlos encrespados e selvagens 40 com pêlos normais e selvagens 40 com pêlos encrespados e albinos Assinale a alternativa que contém as porcentagens corretas de cada tipo de gameta produzido pelos indivíduos F.5 U. b) separa cromátides homólogas. Ea = 20.R. A partir desses resultados. d) Br/bR. Ea = 10.Questão 1279 Se a distância entre dois locos gênicos é de 20 unidades. 37.R. ea = 20. respectivamente. albina. o grão colorido é condicionado por um gene dominante B e o grão liso por um gene dominante R. sofrerá permutação entre os genes A e B.R. podemos concluir que o genótipo do indivíduo parental colorido liso e a distância entre os genes B e R são a) BR/br. Questão 1283 O esquema a seguir refere-se a uma célula diplóide que. 37.R. Ea = 25. eA = 40. b) EA = 20. a) EA = 10. 62. c) Br/bR. Ea = 30. b) BR/br. com os seguintes descendentes: 150 indivíduos que produziam sementes coloridas e lisas. podemos afirmar que o mesmo a) diminui a variabilidade genética. c) EA = 25.5 U. a partir de um determinado cruzamento espera-se obter os seguintes descendentes: + + 10 + d 40 c + 40 c d 10 Esse cruzamento poderia ser a) ++/++ x cd/cd b) ++/cd x cd/cd c) +d/+d x c+/c+ d) +d/c+ x cd/cd e) +d/cd x c+/cd Questão 1280 Em camundongos. durante a meiose.5. surgiu uma F.13 287 . eA = 25. Os indivíduos F. 1. No cruzamento entre um indivíduo colorido liso com um branco rugoso. Os alelos recessivos b e r condicionam.R.5 U. ea = 25. O alelo dominante A determina pelagem selvagem e o alelo recessivo a. ea = 40. o alelo dominante E condiciona pêlos normais e o alelo recessivo e. 18. ea = 30. pêlos encrespados. e) troca cromossomos entre genes homólogos. eA = 10. Questão 1281 Numa certa espécie de milho.

(32) É um processo que ocorre necessariamente durante a mitose. AbCe. b) estão ligados e não há permuta entre eles. é correto afirmar: (01) É a troca de gametas que ocorre durante o cruzamento de dois indivíduos da mesma espécie. (08) É o pareamento de cromossomos homólogos de modo a se tornarem bivalentes. ABCe d) AbCe. (04) É o processo que origina novos arranjos gênicos resultantes de trocas de fragmentos de cromátides homólogas. b) 30 morganídeos. ou crossing over. 288 . Sobre os genes D e E podemos concluir que: a) estão ligados e há permuta entre eles. ABCe b) AbC. a) AbCe. com os genótipos DdEe x ddee.5. (02) É a troca de micronúcleos entre indivíduos unicelulares para renovar o seu material genético. então a distância entre os genes A e B será a) 45 morganídeos. (16) É o processo de duplicação dos cromossomos para garantir a manutenção da espécie.13 uantos gametas recombinantes serão formados se 20 das 100 células apresentarem permutação na meiose? a) 10 b) 20 c) 40 d) 80 e) 160 Questão 1287 Considerando os genes X. d) 20 morganídeos. Questão 1285 Um cruzamento entre dois indivíduos.Assinale a alternativa que apresenta todos os tipos de gametas normais que podem ser formados por essa célula. e c) AbCe. AaBCe. Qual a posição relativa desses três genes no cromossomo? a) ZXY b) XYZ c) YZX d) XZY e) YXZ Questão 1288 Sabendo-se que as freqüências de permutação entre os genes A e C é de 20% e entre os genes B e C é de 10%. Questão 1289 Sabendo-se que as freqüências de permutação entre os genes A e C é de 40% e entre os genes B e C é de 15%. sabe-se que há 15% de recombinação entre os genes X e Y. aBCe e) AabCe. logo segregam-se independentemente. c) segregam-se independentemente e há permuta entre eles. (64) É o processo responsável pela variabilidade genética entre organismos de uma mesma espécie. e) 20 ou 10 morganídeos. então a distância entre os genes A e B será a) 10 morganídeos. aBCe Questão 1284 Com relação ao processo denominado permutação. originou 42 descendentes com genótipo DdEe. e) não estão ligados. c) 10 ou 30 morganídeos. abCe. entre Y e Z há 30% e entre os genes Z e X ocorre 45%. 160 Ddee. d) segregam-se independentemente e não há permuta entre eles. aBCe. Questão 1286 Suponha que 100 células germinativas entram em meiose e que essas células tenham o seguinte genótipo: 1. e. 168 ddEe e 40 ddee. Y e Z de um cromossomo. aBC.

Aumentam a produtividade (caso da soja. a taxa de recombinação entre eles é de a) 8% b) 16% c) 32% d) 42% e) 84% Questão 1291 Quatro genes. para os mesmos locos (cruzamento teste). 1. localizados no mesmo cromossomo. Das afirmativas. Está correta ou estão corretas: a) apenas I e II b) apenas II e III c) apenas I e III d) todas e) apenas uma das três vantagens. para três locos ligados. Tomando por base os dados fornecidos no quadro a seguir. A. c) 40 morganídeos. 7 e 8. o que indica um avanço biotecnológico nesta área. são avaliadas as freqüências das classes fenotípicas na descendência de cruzamento entre indivíduos heterozigóticos (ABC//abc). d) 25 ou 15 morganídeos. desenvolvidas em países asiáticos. embora em diferentes freqüências. ocorreu nos genótipos 5. estão merecendo uma atenção especial no mundo todo. O arroz transgênico apresenta variedades que contêm altos teores de beta-caroteno (precursor da Vitamina A) e que acumulam maior teor de ferro. ácaros. 289 . a distância entre os locos A e B é maior que a distância entre os locos B e C.b) 25 morganídeos. Resistem a certas doenças e pragas (insetos. analise as proposições seguintes. ( ) No mapa genético. por exemplo). Para isso. nematóides etc) diminuindo a necessidade do uso de pesticidas. Os produtos transgênicos apresentam algumas vantagens. II. organismos geneticamente modificados (OGM). Questão 1293 Os transgênicos. ( ) Os fenótipos 3 e 4 resultaram de recombinação genética entre os locos A e B. B. e indivíduos homozigóticos recessivos (abc//abc).5. ( ) A recombinação entre os locos B e C. III. apresentam as seguintes freqüências de recombinação: A-B = 32% A-C = 45% A-D = 12% B-C = 13% B-D = 20% C-D = 33% A seqüência mais provável desses genes no cromossomo é a) ABCD b) ABDC c) ACDB d) ADBC e) ADCB Questão 1292 Na elaboração de mapas genéticos. ( ) A seqüência dos alelos no cromossomo em questão é A -------B-------C. C e D. 6. ( ) Os fenótipos 7 e 8 resultaram de recombinação genética apenas entre os locos C e B. considere as corretas: I.14 Questão 1290 Supondo-se que a distância entre locos gênicos seja de 16 morganídios. e) 40 ou 15 morganídeos. utiliza-se o teste dos três pontos.

Os ingredientes foram Questão 1297 colocados numa solução química para "hibernar" e esperar um tempo para serem encaixados nos óvulos anucleados. d) A clonagem está correta. "Scottish Blackface". onde origina um novo Clone é um população de seres geneticamente idênticos. pode-se afirmar que genitor ou por manipulação citogenética. A receita propõe os seguintes passos: c) o DNA nuclear e o mitocondrial são iguais aos da ovelha Os cientistas retiraram óvulos de uma ovelha adulta da raça C. clonagem para "fazer" a ovelha "Dolly" da raça "Finn b) o DNA nuclear e o mitocondrial são iguais aos da ovelha Dorset". que são guardados. também necessário. uma vez que "Dolly" veio de seu a) transfecção do gene ë amplificação do gene ë óvulo. Investigando o problema. pois o pai é a ovelha da raça "Finn Dorset". o pesquisador descobriu que o ambiente favorecia o desenvolvimento de um nematóide parasita de mangueira. para a transferência do núcleo para o óvulo anucleado. um espermatozóide de um macho da mesma espécie. características da "Dolly". c) amplificação do gene ë transfecção do gene ë Questão 1296 inserção do gene num vetor. Tomando por base o texto. mitocondrial é igual ao da ovelha B. ao contrário do esperado. continuaram com baixa produção após a poda. Deles removeram os núcleos e d) o DNA nuclear é igual ao da ovelha A. B. mas o DNA guardaram o resto. O pesquisador sugeriu desenvolver uma linhagem transgênica dessa mangueira. deve-se seguir um conjunto de etapas que começa pela construção de uma seqüência iniciadora ('primer'). b) "Dolly" não tem pai mas é. células. c) A clonagem está errada. e) o DNA nuclear é igual ao da ovelha A. reprodutor da ovelha "Scottish Blackface". filha da ovelha da raça "Scottish Blackface". que consistem em: ele começou a se dividir. inserção do gene num vetor. O embrião resultante é implantado no útero de uma terceira ovelha C. Acerca do material genético desse novo originados pela multiplicação assexuada de um único indivíduo. formando um aglomerado de a) injetar. uma vez que no seu genótipo há cromossomos de seu avô. resumidamente. cujo controle era muito difícil. certamente. pela inserção de um gene que codifica uma toxina capaz de matar o nematóide. núcleo de uma célula somática de uma ovelha adulta A para um óvulo de uma outra ovelha B do qual foi previamente Questão 1295 eliminado o núcleo. e) Há uma falha técnica no experimento. pois a genitora é a ovelha da raça "Scottish Blackface". Recentemente os jornais publicaram uma receita de a) o DNA nuclear e o mitocondrial são iguais aos da ovelha A. Para criar a mangueira transgênica. Delas são retirados os mitocondrial é igual ao da ovelha C. A seqüência correta das etapas seguintes à construção do 'primer' é. mas o DNA Foram retiradas as células das glândulas mamárias de uma ovelha adulta da raça "Finn Dorset". podemos afirmar que: a) A clonagem está correta mas não revela a tecnologia necessária para as células "hibernarem" e acertarem o tempo.Questão 1294 As mangueiras. núcleos. Dele se formou um embrião que deu origem à Dolly. indivíduo. d) amplificação do gene ë inserção do gene num vetor Uma maneira de se obter um clone de ovelha é transferir o ë transfecção do gene. O aglomerado celular foi transferido para o aparelho 290 . A comunidade científica demonstrou ser possível a Os cientistas transferiram o núcleo da célula mamária para reprodução de seres vivos através de sofisticadas técnicas o óvulo da ovelha "Scottish Blackface" Passado um tempo. pois núcleo de b) inserção do gene num vetor ë transfecção do gene ë célula de glândula mamária não pode influir nas amplificação do gene. que cedeu o óvulo anucleado. dentro do óvulo de uma fêmea de uma espécie. de clonagem.

o núcleo de uma célula somática de um indivíduo da mesma espécie. a nova célula-ovo assim 291 . dentro do óvulo de uma fêmea.b) retirar e descartar o núcleo do óvulo de uma fêmea de uma espécie e injetar. e) introduzir. nesta célula anucleada. o mundo foi abalado pela notícia da produção do clone de uma ovelha. c) injetar. É CORRETO concluir que: a) todos os cromossomos do clone são iguais aos da ovelha A. um espermatozóide de um macho da mesma espécie. nesta célula anucleada. e os cromossomos sexuais são iguais aos da ovelha A. b) constituição cromossômica e DNA mitocondrial da ovelha A. produção de indivíduos geneticamente idênticos IV. um grupo de pesquisadores divulgou ao mundo a ovelha Dolly. A partir dos dados envolvidos no experimento realizado pelos pesquisadores. Questão 1299 Os pesquisadores da área de Genética demonstraram ser possível a reprodução de seres vivos por meio de aprimoradas técnicas de clonagem. necessariamente. alguns genes de outra espécie. meiose Na formação de clones de organismos pluricelulares ocorrem. neste óvulo anucleado. Questão 1301 Considere os processos adiante: I. o núcleo de uma célula ovo da mesma espécie. e) existem cromossomos no clone que são diferentes de A e de B. que consistem em: a) injetar. dentro do óvulo da fêmea de uma espécie. o núcleo de um outro óvulo da mesma fêmea. b) introduzir. dentro do óvulo de uma fêmea. utilizou-se o núcleo de uma célula da mama de uma ovelha (A) e o citoplasma de um óvulo de outra ovelha (B). obtido por meio da técnica de clonagem. reprodução assexuada II. e os cromossomos sexuais são iguais aos da ovelha B. c) constituição cromossômica e DNA mitocondrial da ovelha B. Questão 1298 Recentemente. nas células germinativas de uma espécie. e) injetar. APENAS a) I e II b) I e III c) I e IV d) II e III e) III e IV Questão 1302 Se retirarmos o núcleo de uma célula-ovo de rã e o substituirmos por outro núcleo diplóide de uma célula de tecido muscular de rã adulta. Esses pesquisadores retiraram o núcleo da célula de uma ovelha (A) e o implantaram num óvulo colhido de uma outra ovelha (B). d) constituição cromossômica da ovelha A e DNA mitocondrial da ovelha C. o núcleo de uma célula somática de um indivíduo da mesma espécie. alguns genes de outra espécie. nas células reprodutoras de uma espécie. c) retirar e descartar o núcleo de uma célula somática de uma espécie e injetar. Questão 1300 Em fevereiro deste ano. e) constituição cromossômica e DNA mitocondrial correspondente a uma mistura das três ovelhas. e os cromossomos sexuais são iguais aos da ovelha A. d) os autossomos do clone são iguais aos da ovelha B. reprodução sexuada III. pode-se prever que Dolly apresente a) constituição cromossômica da ovelha A e DNA mitocondrial da ovelha B. d) retirar e descartar o núcleo do óvulo da fêmea de uma espécie e injetar neste óvulo anucleado. c) todos os cromossomos do clone são iguais aos da ovelha B. do qual o núcleo fora previamente removido. originando Dolly. Nessa clonagem. o núcleo de uma célula-ovo da mesma espécie. d) retirar e descartar o núcleo de uma célula somática de uma espécie e injetar. b) os autossomos do clone são iguais aos da ovelha A. Esse óvulo fora posteriormente implantado no útero de uma terceira ovelha (C). o núcleo de um outro óvulo da mesma espécie.

neste caso. Identificação da localização cromossômica dos genes. Assinale a alternativa que explica. c) os vegetais apresentam. o que facilita a continuidade do processo. em sua maioria. ("O Estado de São Paulo. devido ao seu menor grau de complexidade. como forma de protesto. o que diminui a perda em caso de rejeição. c) V. III. depois de dez anos de trabalho. que teme pelos danos ao meio ambiente e à saúde. b) os embriões resultantes da clonagem em vegetais são mais resistentes às modificações ambientais. V. a que apresenta a melhor explicação sobre o que ocorre neste caso. Questão 1306 Desde que a criação da ovelha "Dolly " foi anunciada há dois anos. corretamente. II. pela Internet. a nova célula-ovo assim formada será capaz de produzir outra rã normal. V. de locais das novas plantações. Assinale a alternativa que correlaciona os fatos mencionados anteriormente em ordem cronológica crescente. o "Projeto Genoma Humano". Dentre as alternativas a seguir. em relação à seqüência funcional do DNA da célula diplóide doadora. Estabelecimento das leis da hereditariedade. V. d) V. c) Foi integralmente mantida ativa. ("Veja". IV. III. I. Transformação genética de bactérias para a produção de insulina humana. I. b) Foi parcialmente inativada. um marco no estudo da biologia. em relação à seqüência funcional do DNA da célula diplóide doadora. como segue. foi considerado concluído. IV. d) Expressou-se como na célula germinativa. 4/8/99) Agricultores britânicos que produzem alimentos transgênicos prevêem novos conflitos com ambientalistas. I. VI. II. V. Surgimento da técnica de identificação das pessoas pelo exame do DNA. e) IV. IV. Observação da estrutura espiralada do DNA. uma vez que o governo britânico divulgou ontem o anúncio. cientistas de todo o planeta prometem empreender uma verdadeira reforma genética na natureza. Questão 1303 Se retirarmos o núcleo de uma célula-ovo de rã e o substituirmos por outro núcleo diplóide de uma célula de tecido epitelial normal de rã já adulta. Questão 1305 Os conhecimentos científicos envolvendo a "clonagem" têm proporcionado à humanidade grandes avanços e sua utilização em vegetais tem sido mais fácil e menos controversa que em animais. b) II. II. a) Foi integralmente inativada. podemos relacionar alguns fatos que marcaram época pela sua importância científica. O uso da técnica tem criado receio entre a população. I. é: a) foi integralmente inativada b) foi integralmente mantida ativa c) expressou-se como na célula epitelial d) expressou-se como na célula germinativa Questão 1304 No fim de junho de 2000.formada será capaz de produzir uma outra rã." 17/8/99. IV. d) a regulação hormonal da reprodução nos vegetais é mais facilmente controlada pelos cientistas. III. VI. estão destruindo as plantações de transgênicos do país. VI. VI. VI. II. criar animais com órgãos humanos e produzir bichos que funcionem como farmácias ambulantes. a) II. III. considere as seguintes afirmativas: 292 . o que ocorre. porque a) os mecanismos de regulação gênica nos vegetais são mais simples. que recebeu ampla divulgação na imprensa internacional. e) os vegetais produzem maior número de embriões por indivíduo. e) Expressou-se como na célula muscular. Querem usar a clonagem para salvar pandas em extinção. Numa breve história da genética. VI. Alguns manifestantes. Clonagem do primeiro mamífero a partir de uma célula de um animal adulto. III. I. a capacidade de propagação vegetativa. III. I.) Tendo em vista as vantagens e limitações das técnicas comentadas nos textos acima. IV.

d) apenas III e IV. o material genético (DNA. III e IV. o nucléolo e enzimas. (4). ( ) A partir de um segmento de DNA. II . é INCORRETO afirmar que células-tronco a) retiradas de embriões congelados eliminam as questões éticas e religiosas associadas à obtenção de órgãos para transplantes. 2003 [adapt. Por muito tempo. independentemente do seu tecido de origem. nŽ 195. ( ) Um DNA recombinante pode ser obtido a partir da união de um segmento de DNA bacteriano com um segmento de DNA de um outro organismo.Os estudos de clonagem podem ser proveitosos para o estabelecimento de relações filogenéticas entre os organismos fósseis e os atuais. ainda não totalmente avaliado. b) de um paciente podem ser usadas para regenerar seus tecidos ou órgãos lesados. II e IV. RNA). analise as proposições abaixo. porém. Nesse processo.A clonagem poderá auxiliar no esclarecimento dos mecanismos de envelhecimento e morte celular. d) embrionárias são capazes de se diferenciar em outros tipos de células.I . c) de adulto são capazes de se diferenciar em outro tipo de célula. Questão 1309 O esquema a seguir mostra uma clonagem reprodutiva humana. Questão 1307 Analise este esquema relativo à obtenção de células-tronco: Questão 1308 Considerando o processo de clonagem do DNA. O embrião se desenvolverá. eliminando o risco de rejeição imunológica. e o adulto (5) terá praticamente as mesmas características fenotípicas do indivíduo que doou o núcleo. b) apenas I.] 1. ( ) Para cortar o DNA dos cromossomos. (3). Em 1997. o núcleo foi considerado uma organela que apresentava as seguintes estruturas: um envoltório. Essa nova célula.Os cientistas ainda precisam compreender melhor os mecanismos de controle de diferenciação celular. ( ) Os plasmídios não contêm genes essenciais à vida das bactérias. II e III. eles podem ser utilizados como vetores genéticos. (1). e) I. é transferida para um útero para que se desenvolva e forme um embrião. II. (2) e finalmente é introduzido o núcleo da célula do atleta no ovócito enucleado. IV .1 om base nas informações desse esquema e em outros conhecimentos sobre o assunto. ( ) Com uma única transcriptase é possível cortar o DNA de uma célula em pontos da molécula onde existem diferentes seqüências de nucleotídeos. é possível obter-se um grande número de cópias do mesmo. uma vez que o fenótipo é resultado do genótipo (DNA) mais as influências do ambiente. III . "Ciência Hoje". 293 .15. desde que cultivadas sob condições adequadas. c) apenas II. o núcleo de uma célula somática de um tenista é retirado. é removido o núcleo de um ovócito. III e IV.5. Nos cortes são utilizadas as enzimas transcriptases reversas. sendo descrita como uma estrutura membranosa que está envolvida no processo de regulação de cálcio. que foi denominada de retículo nucleoplasmático. de um organismo introduzido em uma bactéria. esses cromossomos devem estar em metáfase.A introdução de um material genético exógeno (transgene) em organismo vivos pode determinar um risco ecológico. para um maior aproveitamento dessas técnicas. cientistas britânicos descobriram uma nova estrutura nuclear. São corretas a) apenas I.

(4) Uma vez obtida uma variedade de morangueiro com as características ideais. II. enquanto estas se encontram na fase de a) mórula. b) o nucléolo é responsável pela síntese do RNA ribossômico. Quanto a este aspecto. b) I e II. c) I. estruturas importantes no processo de tradução. c) a função do retículo nucleoplasmático é semelhante à do retículo endoplasmático. e) o envoltório nuclear é formado por duas membranas. pelo procedimento tradicional. (3) A cultura de tecidos vegetais facilita o melhoramento . originando zigotos igualmente distintos. pois as células podem ser manipuladas geneticamente e.1. b) gástrula. obtêm-se plantas adultas.5. que são células indiferenciadas que podem dar origem a qualquer tipo de tecido. sem que tenha sido fecundado. a partir desta. julgue os itens adiante. apenas.juntamente com proteínas . seriam passadas para as plantas-filhas. Concepção de um organismo a partir da fusão de um óvulo não fecundado. do qual se retirou o núcleo celular. entre elas as envolvidas nos processos de transcrição e replicação.15. Formação de vários embriões a partir de um único zigoto. Com base nessa informação. e) formação da notocorda. por exemplo. c) nêurula. II. Óvulos distintos são fecundados por espermatozóides também distintos.forma os ribossomos. d) formação do celoma. (4). a eliminação de infecções virais presentes na planta-mãe e que. d) todo o DNA da nova célula formada na clonagem citada no texto. as células-tronco podem ser comparadas às células dos embriões. Questão 1312 Considere as cinco situações seguintes. podemos dizer que são processos de clonagem: a) I. este . apenas. III. podem-se obter indivíduos adultos com características alteradas. Questão 1310 Os morangos de excelente qualidade que se encontram atualmente nos supermercados são produto principalmente de técnicas de propagação vegetativa "in vitro". Essas técnica permite. será a célula doadora do núcleo. com o núcleo de uma célula somática retirada de um animal que se deseja copiar. IV e V.1 genético de plantas. estão presentes várias enzimas. sendo que cada uma delas é composta por duas camadas de lipídios com proteínas inseridas. O gameta feminino (óvulo) de certos animais se desenvolve formando um novo indivíduo. Questão 1311 Um dos caminhos escolhidos pelos cientistas que trabalham com clonagens é desenvolver em humanos a clonagem terapêutica. não se justifica preservar as variedades silvestres. d) I. (2) Uma vantagem dessa técnica é que as plantas produzidas não são suscetíveis ao ataque de pragas. Tomando-se como referência a definição genética de clone e considerando as situações descritas. A partir de células de um morangueiro. a partir delas. faz-se uma cultura de tecidos e. muito menos produtivas. Uma muda de violeta formada a partir de uma única folha que tenha sido destacada de outra planta e plantada em solo úmido e bem adubado. é INCORRETO afirmar que a) o núcleo é uma organela exclusiva das células eucarióticas. No seu interior. IV. I. apenas. apenas. (1) As plantas obtidas de uma mesma cultura de tecidos são geneticamente iguais. V. principalmente para a obtenção de células-tronco. que é uma organela citoplasmática. 294 Com base no texto e em seus conhecimentos. III e IV.

IV. Questão 1315 No filme "Jurassic Park". b) I e III. processo que exige cerca de três anos. quando ainda não é possível conseguir células tão indiferenciadas. II. II. No caso dos transgênicos. até o momento. Questão 1314 Um pesquisador precisa obter células-tronco para iniciar experimentos em terapia gênica. com relação às plantas. com maior capacidade de gerar descendentes também resistentes. b) Trabalhar apenas com embriões em vez de organismos adultos. I. as cinco melhores são separadas e apenas uma delas é levada a testes de segurança. a crítica recai sobre o fato de que não se sabe se os genes introduzidos irão se expressar exatamente como no organismo doador ou se irão ativar também alguns genes inativos do genoma do organismo receptor. Questão 1316 A Embrapa possui uma linhagem de soja transgênica resistente ao herbicida IMAZAPIR. criar um clone transgênico. em uma cadeia alimentar. em vez de obtê-las da gástrula ou do cordão umbilical. Questão 1313 Sobre a clonagem de seres e a criação de organismos geneticamente modificados (transgênicos). a) Obter células-tronco de embriões em fase de gástrula em vez de obtê-las da blástula. na prática esse procedimento é extremamente improvável porque: a) seria necessário encontrar um genoma completo e conhecer sua ordem nos cromossomas. A clonagem de organismos tem se voltado mais para os animais porque. quando a indiferenciação é maior. de Steven Spielberg. cientistas retiraram do intestino de insetos hematófagos fósseis moléculas de DNA de dinossauros. ou seja. ali. Uma linhagem de soja transgênica requer a produção inicial de 200 plantas resistentes ao herbicida e destas são selecionadas as dez mais "estáveis". quando as células já estão mais diferenciadas. Esses descendentes são submetidos a doses de herbicida três vezes superiores às aplicadas nas lavouras convencionais. d) Optar pela obtenção das células do cordão umbilical de recém-nascidos em vez de obtê-las da fase de gástrula. uma vez que em adultos não existem células-tronco. d) o DNA coletado sofre mutações durante o período em que ficou fossilizado. já que no cordão a diferenciação é menor e o número de células. e) III e IV. A planta está passando por testes de segurança nutricional e ambiental. b) a composição química do DNA dos dinossauros é diferente das encontradas em espécies atuais. c) Conseguir células germinativas do ovário de uma fêmea adulta pois. Apesar da eficiência proposta no filme. Estão corretas: a) I e II. não foi possível. c) as características do organismo se devem à estrutura primária das proteínas e não do DNA.e) I. IV e V. c) I e IV. Tanto nos clones quanto nos transgênicos. Ecologicamente. d) II e III. A reconstituição dessas moléculas teria sido feita através da inserção de fragmentos de DNA de rã. maior. III. já que ela não tem possibilidade de cruzamento com outras plantas e o perigo de polinização 295 . ela já é conhecida e utilizada há certo tempo. III. e) não existem técnicas para a inserção de fragmentos de DNA de uma espécie em outra. a existência de clones apenas aumenta o número de representantes de um determinado nível trófico. Um grande inconveniente entre a clonagem e a produção de transgênicos é que ambas não permitem sobreposição. elas estão menos diferenciadas do que as células germinativas nos testículos de um macho adulto. Os riscos ambientais da soja transgênica são pequenos. inclusive na agricultura. e) Obter células do embrião em fase de blástula. considere as quatro afirmações seguintes. pode haver também alteração de posições e de elementos na cadeia. Em seguida. Aponte a alternativa que relaciona o procedimento e a justificativa corretos para que tal pesquisador tenha sucesso.

II e III. A técnica do DNA recombinante foi utilizada para obtenção de Tracy. um dos pintores surrealistas mais importantes. referentes à técnica utilizada para obtenção da Tracy. Uma saída é consultar os catálogos de outras espécies. c) mutante e técnica do DNA-recombinante. Quando essa planta foi regada com a substância que o vaga-lume usa para produzir luz. no seu patrimônio genético. A soja transgênica. Questão 1319 Uma planta de fumo foi produzida a partir de uma célula de fumo que havia recebido o gene responsável pela bioluminescência dos vaga-lumes. Para a ligação do DNA transplantado ao DNA hospedeiro a célula utiliza a ENZIMA LIGASE. algodão colorido e cabras que produzem fatores de coagulação sangüínea humana. O catálogo com a receita para a produção dessas substâncias está no genoma. d) transgênica e técnica do DNA-recombinante. e) transgênica e técnica de clonagem. qual das obras de Magritte. Caso você fosse escolher uma ilustração para um artigo sobre os transgênicos.cruzada com outro tipo de soja é de apenas 1%. a) mutante e técnica de miscigenação. c) I. Assim. d) I. Animal transgênico é aquele que recebe e incorpora genes de outra espécie. b) I. Questão 1320 Analise as informações abaixo: I. d) a linhagem passou por testes nutricionais e após três anos foi aprovada. II. Questão 1317 Os transgênicos vêm ocupando parte da imprensa com opiniões ora favoráveis ora desfavoráveis. Estão corretas apenas as afirmativas: a) II e III. segundo o texto. ela começou a brilhar. e) a linhagem obtida foi testada rigorosamente em relação a sua segurança. apresenta baixo risco ambiental porque a) a resistência ao herbicida não é estável e assim não passa para as plantas-filhas. Pense na batata (ou qualquer outra planta) como uma fábrica que produz a mesma substância (proteína. etc.15. capaz de produzir uma proteína humana cuja deficiência causa problema hepático e pulmonar". III e IV. deixou obras enigmáticas. estaria mais de acordo com esse tema tão polêmico? I.2 Questão 1318 "Tracy é uma ovelha transgênica. Suponha que você queira tomar a fábrica inexpugnável aos ataques de insetos. ou seja. II. A planta de fumo e a técnica utilizada para obtê-la são denominadas. amido. ou modificado da mesma espécie.). II e IV. a seguir. O belga René Magritte (1896-1967). III e IV. As substâncias utilizadas para isolar o gene a ser transplantado são denominados ENZIMAS TRANSGÊNICAS. Um organismo ao receber material genético de outra espécie. respectivamente. b) as doses de herbicida aplicadas nas plantas são 3 vezes superiores às usuais.5. b) mutante e técnica de clonagem. já temos bactérias fabricando hormônios humanos. e) II. mas o catálogo não possui a receita para isso. passa a apresentar novas características. por exemplo. A bactéria 'Bacillus thuringiensis' (Bt) contém um gene que leva à produção de uma enzima capaz de digerir o 296 1. Analise as afirmativas a seguir. IV. . c) a capacidade da linhagem de cruzar com espécies selvagens é inexistente. III.

V. incluir o gene no genoma da batata. b) 25 %. III. e) 100 %. o que lhe conferiu resistência ao ataque de predadores. a) Associar o desenvolvimento socioeconômico de cada região às suas características de relevo. Assinale aquela que contém conceitos e informações científicas só disponíveis aos jovens. pois sabemos que o genoma humano é homogêneo. a toxina Bt é inofensiva aos seres humanos. As alternativas a seguir apresentam algumas atividades sugeridas para a melhoria da qualidade de vida humana e da saúde ambiental. b) clones. genes de uma outra espécie. b) Cultivar espécies com crescimento rápido e utilizar esses conhecimentos para planejar plantações economicamente viáveis. b) A batata passou a ser um alimento transgênico porque foi cruzada com gametas oriundos da bactéria. ao tipo de população e às suas riquezas naturais. d) Introduzir nas células de uma planta. ela poderá de transformar numa planta adulta que produzirá a toxina Bt. Questão 1322 A engenharia genética possibilitou a introdução do gene humano para a produção da insulina em bactérias. A biotecnologia já encontrou bactérias ou vírus capazes de fazer essa transferência. uma nova espécie. Questão 1324 Recentemente foi noticiada a criação de uma planta transgênica. fazendo com que os novos genes sejam incorporados a seus cromossomos. essa planta recebeu: a) os anticódons que determinam a seqüência de 297 . e com certeza não haverá ser humano sensível à ação biodigestora da toxina. Paulo" de 03/07/1999. isto é. Quando uma célula meristemática for geneticamente modificada. assinale a alternativa correta. Se essa ovelha for cruzada com um macho não-transgênico. tiradas do jornal de "Folha de S. que porcentagem de descendentes portadores do gene humano espera-se obter? a) Zero. VI. c) mutantes. Agora. e) Podemos confiar na palavra dos biotecnólogos quando afirmam "A toxina Bt é inofensiva aos seres humanos". Após a análise das informações acima. A qualidade do ar e a importância da preservação da biodiversidade constam da pauta das discussões da humanidade há muito tempo. na última década do século XX. d) A batata passou a ser uma alimento geneticamente modificado. A engenharia genética tem ferramentas bioquímicas para tirar cópias dessas páginas do genoma. d) 75 %.intestinos dos insetos. capaz de produzir hemoglobina. c) Estudar a dinâmica de crescimento e de regeneração natural das florestas tropicais. pois a toxina digere o intestino desses animais. IV. c) A batata geneticamente modificada é um alimento transgênico porque recebeu parte do genoma de uma outra espécie. Para que isso fosse possível. d) transgênicas. A planta inteira ficará impregnada com a toxina. Essas bactérias são consideradas a) puras. constituindo. O besouro ou a lagarta que se alimentar dela morrerá. o que lhe conferiu resistência ao ataque de predadores. Questão 1323 As questões ambientais têm sido motivo de preocupação sobretudo para as últimas gerações. a partir do cruzamento com a bactéria. Questão 1321 A introdução de uma cópia de um gene humano no genoma do pronúcleo masculino de um zigoto originou uma ovelha transgênica. cujos intestinos não oferecem condições para ela se manifestar. a) A batata geneticamente modificada é um alimento transgênico porque recebeu um genoma completo da bactéria. e) Imobilizar o gás carbônico tanto pelo processo de fotossíntese como por meio da fabricação de móveis. Segundo os biotecnólogos. c) 50 %. é preciso transferir esse gene para o genoma da batata.

III . Sobre este tema. batata resistente a viroses II. utilizadas para a obtenção de seres transgênicos. II. o uso de herbicidas. não trazendo perigos para a humanidade. soja tolerante a herbicidas Desses produtos. e) somente os aminoácidos usados nessa proteína. Esta interferência do homem na natureza se dá por meio da engenharia genética. e) os transgênicos simplificarão muitas cadeias alimentares. prejudicando os atuais exportadores. c) Modificar um organismo geneticamente significa cruzar espécies diferentes. A esse respeito. que apresentam uma grande incidência de pragas na agricultura. poucos assuntos geram tanta controvérsia como os produtos transgênicos. Questão 1328 A engenharia genética causou uma revolução na biotecnologia. b) todos os países passarão a produzir soja. apenas. d) A modificação genética dos alimentos consiste na transferência de material hereditário de um organismo para outro receptor. eliminando todos os competidores do homem e dos animais que ele cria. juntamente com produtos obtidos por meios tradicionais. por conseqüência. c) o fragmento de DNA. II e IV. apenas. as técnicas de controle de pragas nas culturas de soja sofreram mudanças e os custos de produção diminuíram. III e IV. científico e filosófico. muitas cadeias alimentares desaparecerão. I . Considere os quatro exemplos abaixo: I. derivam exclusivamente de engenharia 298 . beneficiando o meio ambiente. c) não se conhecem os efeitos que os transgênicos podem ter na saúde das pessoas. Esses questionamentos justificam-se porque a) o custo dos transgênicos será certamente maior do que o dos produtos convencionais. milho resistente a insetos IV.Os ecologistas temem que as plantas transgênicas possam afetar o equilíbrio ecológico. os alimentos transgênicos representam um tema de grande discussão. A transferência de genes bacterianos para o genoma de uma planta amplamente cultivada e usada na alimentação animal e humana vem gerando. e) II. Questão 1327 As técnicas de manipulação genética. Atualmente. apenas. Com o uso dessa variedade. IV . d) O RNAm que carrega os aminoácidos usados na síntese de hemoglobina.Trata-se de alimentos fabricados com produtos geneticamente modificados. questionamentos de cunho político. o "round-up". II . gerando novas combinações genéticas. b) os ribossomos utilizados na produção dessa proteína. d) eliminando-se as pragas da lavoura. c) II e III. b) I. aumentando a produtividade e minimizando. d) I e III. Questão 1326 Atualmente. considere as seguintes afirmações. Questão 1325 Atualmente. para se obter uma espécie nova que não ocorre naturalmente. e) Os ambientalistas defendem o uso da engenharia genética pois os seus efeitos são totalmente previstos e controlados. cuja seqüência de nucleotídeos determina a seqüência de aminoácidos da hemoglobina. permitiram a criação do primeiro produto transgênico de grande impacto na agricultura: a soja resistente a um potente herbicida. Estão corretas: a) I. insulina humana para uso de diabéticos III. apenas. b) A aplicação da engenharia genética nos alimentos teve origem em países do terceiro mundo. destaque a afirmação correta: a) O objetivo dos cientistas é criar novas espécies. III e IV. diversos produtos biotecnológicos estão sendo comercializados. porém.aminoácidos nessa proteína.Pode-se gerar um animal transgênico que tenha a capacidade de produzir maior quantidade de leite com menor taxa de gordura.Não se sabe quais serão as possíveis conseqüências da ingestão desses alimentos.

ed. a possibilidade de afetar insetos e outros animais do ecossistema. porém. 100) Foram feitas as seguintes afirmações sobre organismos geneticamente modificados: I. III e IV Questão 1329 Obtiveram-se plantas transgênicas com as seguintes características: I. II e III d) I. a possibilidade de transmitir seus genes de resistência a plantas de espécies aparentadas. p. o que aumenta e barateia a produção. Questão 1332 A charge a seguir foi produzida num momento em que no Brasil se discutem as possíveis vantagens e desvantagens da liberação do plantio e comercialização de plantas transgênicas. 1886. III e IV e) II. Há. II. favorecendo a população mundial. Um transgênico possui em seu genoma um ou mais genes provenientes de outra espécie. interferência na composição da diversidade local de insetos ocorre SOMENTE com a) I b) II c) III d) I e II e) I e III Questão 1330 Sementes transgênicas podem levar à produção de plantas resistentes a inseticidas. Está correto o que se afirma em a) I somente. ou então com melhores qualidades nutritivas. Toda essas plantas são úteis para a espécie humana. mostarda e papinhas para crianças. II. d) II e III somente. a insetos e a vírus. n. entretanto.genética SOMENTE a) I e II b) III e IV c) I. tornando-se mais saborosos. óleo de soja. a necessidade de uso mais intenso de agrotóxicos. II e III. 43. tomateiros cujos frutos passam mais tempo amadurecendo no pé. São Paulo: Abril. III. b) II somente. É possível que haja polinização entre uma planta transgênica com outras de uma mesma espécie. c) I e II somente. II. ("Veja". massas.2 299 . e) I.15. maionese.5. não transgênicas. III. ano 36. pés de milho cujas sementes produzem hormônios de crescimento humano. algodoeiros cujas folhas se tornaram impalatáveis para a herbivoria. outras conseqüências que o seu cultivo pode acarretar entre as quais estão: I. Há grãos transgênicos usados no preparo de bolachas. Há desvantagens SOMENTE em a) I b) II c) III d) I e II e) II e III Questão 1331 Os alimentos geneticamente modificados são uma realidade cotidiana. cereais. III. pães. 1. O processo de inserção de genes de uma espécie em outra é realizado com a ajuda de enzimas de restrição.

implicações e incertezas. as torna resistentes a certos tipos de insetos. A técnica de obtenção de organismos transgênicos produtores de proteínas humanas consiste em: a) remover artificialmente alguns nucleotídeos de uma molécula de DNA. e) DNA do coelho injetado no ovo se incorporou a um cromossomo e passou a conduzir a síntese de proteínas nessa célula. são os principais riscos ambientais. é CORRETO afirmar: a) O que não faz mal para o homem não fará mal para os insetos. a perda de biodiversidade. 300 . c) A bactéria 'Bacillus thuringiensis' (Bt) é um agente de controle biológico encontrado no solo. Nenhum cientista deixa de reconhecer o poder da tecnologia do DNA. d) Se os insetos experimentarem. A transferência do gene Bt para as variedades de milho. redução do uso de agrotóxicos. porque: a) RNA mensageiro do coelho injetado no ovo passou a conduzir a síntese de proteínas nessa célula. b) Os defensores dos OGM enumeram a capacidade de aumento da produtividade agrícola. quando genes de coelhos foram injetados em ovos de camundongos que se desenvolveram no útero de fêmeas dessa espécie. são constantes e cada vez mais freqüentes os noticiários sobre o uso de tecnologia transgênica com fim de obter proteínas de ação farmacológica ou mesmo proteínas terapêuticas humanas. de plantas. como grãos. além de mais nutritivos. podendo misturar o DNA de microorganismos. Nov/2003) Sobre os OGM (organismos geneticamente modificados). é correto afirmar: a) OGM são produtos obtidos pela transferência de gene entre espécies similares ou diferentes. porque suas implicações são muito sérias. d) RNA mensageiro do coelho injetado no ovo se incorporou a um cromossomo e foi transmitido de célula a célula através de mitoses. de animais e do homem. b) retornar uma célula diferenciada ao estágio de indiferenciada. Questão 1334 O primeiro organismo transgênico foi obtido por volta de 1981. podem ser usados para produzir remédios. Os camundongos que nascidos desses ovos apresentaram hemoglobina de coelho em suas hemácias. b) As plantas transgênicas são perigosas para a saúde animal. o homem poderá experimentar. b) DNA do coelho injetado no ovo se incorporou a um cromossomo e foi transmitido de célula a célula através de mitoses. batata e soja. regulamentados pelas normas de biossegurança. este tema não pode progredir na base do ser contra ou a favor. pois a ingestão da planta não lhe fará mal. alterando assim o código genético do organismo. c) DNA do coelho injetado no ovo foi transcrito para o RNA ribossômico que conduziu a síntese de proteínas nessa célula. Questão 1333 "Muito se tem falado sobre os transgênicos e praticamente todo mundo tem alguma opinião sobre o assunto. algodão.(Jornal da "Ciência" . c) O que não é bom para os insetos pode não ser bom para os homens. d) Vários tipos de alimentos. Isto envolve a natureza. em 10 de outubro de 2003. que produz uma toxina contra lagartas. oportunizando melhores condições ambientais e sociais. O problema está em algumas de suas aplicações. favorecendo toda população mundial. Mas." ("Revista Galileu". Questão 1335 Em revistas e em jornais. a saúde humana e a economia. o surgimento de ervas daninhas resistentes a herbicidas.) Analisando-se a charge de acordo com os atuais conhecimentos biológicos. tornar os alimentos mais nutritivos e saudáveis e criar novos tipos de terapias e medicamentos. leite e ovos. porém o uso dos OGM tornaria os pequenos agricultores independentes em relação às empresas fornecedoras de sementes. produtos químicos. que gera um novo organismo por multiplicação. e) A poluição genética.Edição 515. plásticos e combustíveis. além de servirem para a alimentação. o aumento do uso de agrotóxicos e a perda da fertilidade natural do solo. fumo.

15. foram introduzidos certos genes da hidra em ovos de planária. c) os genes da hidra apresentaram transcrição no organismo da planária. b) segmentos de DNA da hidra apresentaram capacidade de replicação durante a embriogênese da planária. 1. 301 . a reativar os seus genes e gerar um novo ser. de maneira a integrar o material genético. que não possibilitou a produção de RNA e nem de luciferase. A tira de quadrinhos a seguir faz referência à manipulação de genes em laboratório. enzima responsável pela oxidação da substância luciferina. foram isoladas moléculas de RNA e de proteína da hidra. Desses ovos. d) transplantado. a partir do qual as células da planta produziram RNA e luciferase. obteve-se uma planta inteira. seria possível produzir um rato a) sintético. que possibilitou às células da planta a produção de luciferase. Das células de vermes adultos. a partir desta. a partir do qual as células da planta produziram DNA e luciferase.15. Através da engenharia genética. e) métodos biotecnológicos de cruzamentos seletivos para obtenção de novas espécies. Questão 1339 1. e) uma seqüência de DNA do elefante sofreu mutação devido à introdução do gene do vaga-lume em células daquele mamífero.c) induzir célula somática.2 través da técnica. desenvolveram-se vermes portadores de tentáculos e de cnidoblastos com filamento urticante. Com relação a esse experimento. Questão 1336 Responder à questão a seguir com base na ilustração. Questão 1338 Em um experimento. c) uma seqüência de RNA do vagalume foi transferida para células do elefante. e) a hidra e a planária nele utilizadas são organismos transgênicos. representada na ilustração. c) incorporou um segmento de DNA do vaga-lume. c) clonado. d) introdução de um ou mais genes interessantes de uma espécie em célula hospedeira.2 Se esse tipo de experimento realmente fosse concretizado. Questão 1337 No vaga-lume há um gene que determina produção de luciferase. que porta a totalidade do genoma. e) transgênico. levando à produção de luz. esse gene foi transferido para uma célula vegetal e. d) ocorreu tradução do código genético da hidra no organismo da planária. d) o gene do vaga-lume controlou a produção de RNA e de proteína no interior das células do elefante. a referida planta começou a emitir luz. b) incorporou um segmento de RNA do vaga-lume. NÃO é correto afirmar que a) os genes da hidra se expressaram na planária. poder-se-ia afirmar que a) o elefante e o vaga-lume são organismos transgênicos. d) incorporou um segmento de DNA do vaga-lume.5. b) híbrido. Após ser regada com solução de luciferina.5. e) não expressou o gene do vaga-lume. b) apenas o vaga-lume é um organismo transgênico. O resultado desse experimento indica que a planta a) incorporou um segmento de RNA do vaga-lume. da genética atual.

Estes novos segmentos de DNA introduzidos podem. c) as espécies silvestres incorporaram e expressaram material genético da canola transgênica. amido e proteínas em suas sementes ou melhorar a resistência das plantas a pestes e vírus ou ainda aumentar a sobrevivência destes organismos em ambientes adversos. Estas passaram a apresentar a característica da canola transgênica. na ausência do inibidor.Questão 1340 Recentemente. Questão 1341 As técnicas modernas de biologia molecular têm permitido a inserção de segmentos novos de DNA em células vegetais. é modificada na soja transgênica. a atividade da EPSP-sintase em extratos de folhas de diferentes tipos desse vegetal. Num estudo para a identificação da variedade transgênica de soja. foram constatados casos de transporte de pólen de espécies de canola transgênica para plantas silvestres (ervas daninhas). mas evita o crescimento de outros vegetais indesejáveis. ou seja.2 A curva que corresponde à razão entre as atividades de uma enzima da variedade transgênica e as atividades dessa mesma enzima da soja comum é a indicada pela seguinte letra: a) W b) X c) Y d) Z Questão 1344 Considere o texto a seguir: "Os alimentos transgênicos. foi medida. Sobre esse fato. é inicialmente necessário que sejam sintetizadas em laboratório cópias em DNA desse RNA. após introduzidas em plasmídios. é INCORRETO afirmar que a) as espécies de canola são transgênicas pois expressam genes que incorporaram de outras espécies. alto poder de resistência a herbicidas. nas mesmas condições experimentais.5. por exemplo. em presença ou ausência de glifosato. gerar novas plantas com reservas modificadas de lipídios. o tratamento com esse herbicida não prejudica o desenvolvimento de culturas de soja transgênica.15. b) o pólen da canola transgênica transportou material genético para plantas silvestres. Observe o gráfico: 1. e) as ervas daninhas passaram a produzir proteínas da canola transgênica. Estas novas plantas são exemplos de organismos criados por engenharia genética e são genericamente conhecidos como: a) reversos b) recessivos c) dominantes d) transgênicos Questão 1342 Para a clonagem em bactérias do hormônio do crescimento humano a partir de seu RNA mensageiro. tornando-a resistente à inibição pelo herbicida glifosato. para gerar uma nova planta com novas características. apresentaram o mesmo valor. Assim. As cópias. serão expressas em culturas de bactérias contendo os plasmídios modificados. As atividades da enzima nesses extratos. em crescimento no meio apropriado. tornando-as resistentes a agentes químicos. d) o RNA da canola transgênica foi transferido e incorporado ao genoma das ervas daninhas. produtos que sofreram 302 . presente em praticamente todos os vegetais. Essas cópias de DNA são sintetizadas em laboratório com o auxílio de uma preparação da enzima denominada de: a) RNA replicase b) RNA polimerase c) desoxirribonuclease d) transcriptase reversa Questão 1343 A enzima EPSP-sintase.

5. Questão 1346 Os cientistas franceses que criaram animal transgênico e o artista brasileiro que fez a encomenda entram em conflito. b) a utilização de células vegetais diminui a possibilidade de contaminação humana por vírus animais. a multinacional Monsanto está tentando conseguir autorização do Ministério da Ciência e Tecnologia para produzir soja transgênica no país. corretamente. pois os resultados das experiências podem ser imprevisíveis. Os benefícios [advindos de plantas transgênicas]. pode-se concluir. o resultado mais trágico do uso de produtos transgênicos surgiu no Japão em 1989: 5000 pessoas ficaram doentes. Eduardo Kac. na sigla em inglês). (FOLHA DE SÃO PAULO.]. Questão 1345 Pesquisadores de alguns centros de pesquisa brasileiros. 6 de agosto de 1998). já ocupam prateleiras dos supermercados nos Estados Unidos e Canadá. 1. entre as quais o hormônio do crescimento (GH). introduzido no plasmídeo antes de sua introdução na célula vegetal. utilizando técnicas de engenharia genética.2 303 .alteração genética com o objetivo de melhorar a qualidade. que: a) toda planta transgênica produz substâncias altamente tóxicas ao ser humano. b) plantas transgênicas são aquelas cujos fenótipos se devem mais ao ambiente do que aos genes. No Brasil. obtiveram. c) Antes de se obter a planta produtora de GH é necessária a produção do DNA recombinante. Pela leitura do texto anterior. c) manipulações genéticas podem alterar o funcionamento dos genes naturais de um organismo. plantas que produzem proteínas humanas. porém. onde também não há obrigação de alertar o consumidor. mas o consumidor não sabe disso: não há lei que obrigue os fabricantes a informar que o produto sofreu alteração genética. batizou de Alba a coelha transgênica que tem uma propriedade peculiar: seus olhos rosados e seus pêlos brancos ficam fluorescentes quando expostos à luz ultravioleta. Estas plantas são chamadas transgênicas. os pesquisadores criaram um coelho que produz em todas as suas células a proteína GFP (proteína verde fluorescente.. recentemente. e) O DNA relacionado à síntese do GH pode ser obtido a partir do RNA mensageiro. d) as técnicas de transferência de genes por engenharia genética são altamente seguras. Até o momento. Considere estas informações e assinale a opção incorreta: a) O gene para a produção de GH é. podem esconder riscos ainda não esclarecidos [. Para conferir essa característica particular. relacionado ao GH. e) todas as plantas transgênicas são estéreis a partir da segunda geração mutante. 1500 se tornaram permanentemente inválidas e 37 morreram".15. presente naturalmente em medusas e que pode ser detectada sob luz ultravioleta. artista plástico brasileiro e professor de arte e tecnologia em Chicago.. Criador e artista já disputam a posse da "transcoelha". em geral. quando introduzido na célula vegetal é transcrito em DNA na presença da enzima transcriptase vegetal. d) O RNA mensageiro.

c) evita o aparecimento do bocio. b) Organismos que recebem e manifestam genes de outra espécie são denominados transgênicos. e) Ainda não é possível produzir plantas com genes ativos de insetos. 08/2004) Analise os procedimentos a seguir e aponte aquele que poderia promover o desenvolvimento mais duradouro da massa muscular. c) Introduzir nas células musculares nova cópia do gene do fator IGF-1. III) As células fluorescentes da coelha produzem RNA mensageiro. a partir de DNA viral. sem deixar vestígios detectáveis em exames de sangue ou urina. tal como a insulina. b) aumenta o peristaltismo. em indivíduos sedentários.br/educacao/isaacelias/coelha. e CORRETO afirmar que o uso desse grão na alimentação humana resulta em benefício para a saúde porque ele a) previne alguns tipos de cegueira. utilizando técnicas aplicadas em terapia gênica. O crescimento muscular é estimulado pelo fator IGF-1 e limitado pela miostatina. se executado uma única vez. 304 .produz ’-caroteno (vitamina A). Questão 1350 Analise as proposições a seguir. b) Injetar anticorpos produzidos contra a proteína miostatina.com. IV) A coelha transgênica foi produzida a partir da introdução de um núcleo extraído de uma célula de medusa em um óvulo de coelha cujo núcleo tenha sido anteriormente removido. a) Introduzir nas células musculares novas cópias de RNA mensageiro que codifica o fator IGF-1. Assim sendo.daptado de: http://paginas. d) Cromossomos circulares presentes no citoplasma de bactérias.geneticamente modificado . Dentre as afirmativas acima. II) Apenas as células somáticas tiveram o gene que codifica a proteína GFP inserido em seu genoma. d) diminui a formacao de coagulos. foi mostrada a existência de duas proteínas que atuam regulando o crescimento das células musculares: o fator de crescimento IGF-1 e a miostatina. o homem tem desenvolvido grandes projetos. são feitas as seguintes afirmativas: I) A coelha Alba é considerada transgênica pois possui em seu genoma um segmento de DNA de medusa.terra. que no processo de tradução origina a proteína GFP. como o de transformar células de bactérias. Nessas pesquisas. para que estas produzam substâncias que normalmente não seriam produzidas. c) As enzimas de restrição agem em seqüências inespecíficas de DNA.htm Considerando a tecnologia para obtenção de transgênicos. ("Scientific American Brasil". e) Injetar anticorpos produzidos contra o fator IGF-1. Sobre este assunto. A partir desse conhecimento é possível modular o crescimento muscular por meio de vários procedimentos. somente estão corretas: a) I e II b) I e III c) I e IV d) II e III e) III e IV Questão 1347 Recentes descobertas têm provocado grande discussão por poderem alterar o futuro do esporte. Questão 1349 Através de técnicas da biologia celular. assinale a alternativa correta. a) As enzimas de restrição hoje conhecidas são produzidas por diversas indústrias multinacionais. d) Injetar a proteína miostatina mutada que bloqueia a ação da miostatina normal por competir pelo seu receptor. são vetores do DNA recombinante. Questão 1348 O arroz dourado . referentes a diferentes questões de Genética. chamados de bacteriófagos.

afirmativas a seguir. na produção de hormônios para a espécie humana. ( ) Por meios biotecnológicos.) Vegetais modificados geneticamente são considerados transgênicos. c) a seleção de DNA mais adaptado existente numa determinada espécie. a chamada comida GM. por exemplo. que mostram os objetivos da manipulação genética das plantas cultivadas. ( ) No homem. sendo os principais produtores os Estados Unidos. Se ocorrer uma mutação em um determinado loco.. 305 1. e) a adição de DNA exógero manipulado. dois filhos. segmentos do DNA de outro organismo. No caso ilustrado no esquema (figura 1). acidez do solo e escassez de água. ( ) Considerando o operon da lactose. já ocupam cerca de 40 milhões de hectares. preocupação de longo prazo têm os ingleses." (Adaptado da revista VEJA. algodão. da mesma espécie ou de outra espécie no genoma da espécie em estudo. o país vem consumindo cada vez mais alimentos geneticamente modificados. II. em seu material genético. milho. plantas transgênicas.53. Desenvolver variedades de plantas que produzam frutos com melhor textura e de amadurecimento lento III. Da análise das afirmativas acima podemos assegurar que: a) apenas I está correta b) apenas II está correta c) apenas I e II estão corretas d) apenas II e III estão corretas e) I.. 3 e 4 (estruturais). ter. cinco classes fenotípicas podem ser observadas na população. para ocorrer a transcrição das enzimas codificadas nos genes 2. apresentará fenilcetonúria. p. II e III estão corretas Questão 1352 "A reforma da natureza Em termos de cardápio diário. d) a introdução de DNA em genomas das células dos vegetais já formados. é necessário que uma molécula produzida por um gene regulador (x) não reprima o gene operador (1). Questão 1353 Escolha a alternativa que apresenta um exemplo de transgenia. como soja. por exemplo. 16/06/99.2 ( ) Certos microorganismos podem ser manipulados em laboratório para incorporarem. e essa mutação determinar a produção de enzima não-funcional. cada um determinando a produção de uma enzima. A probabilidade de uma mulher (AaBb). Questão 1351 Em todo o mundo. Sua obtenção se dá com a) o cruzamento de duas espécies distintas. Considere as . em uma única gestação. Nos últimos anos. Desenvolver variedades de plantas resistentes a geadas. é de 1/16. Desenvolver variedades de plantas resistentes a herbicidas ou a insetos. podem ser produzidos anticorpos monoclonais. diferentes genes participam do metabolismo dos aminoácidos fenilalanina e tirosina. a) Incorporação e expressão de gene humano que codifica insulina por bactérias. O DNA recombinante então obtido pode ser clonado e utilizado. a pessoa expressará uma anomalia metabólica.5. Esses alimentos (. de 'Escherichia coli'. I. ( ) Se dois pares de genes aditivos determinam a cor da pele no homem. um de fenótipo mulato-médio e o outro de fenótipo branco. ilustrado no esquema (figura 2). a Argentina e o Canadá. reconhecidos como altamente específicos. casada com um homem (aabb).) têm seu código genético alterado para ficarem mais viçosos ou resistentes a herbicidas e pragas. tomate e muitas outras.15. em testes laboratoriais para a detecção de gravidez em estágios muito precoces. b) a incorporação de RNAm na célula zigoto das espécies. Tais anticorpos podem ser empregados. batata.

como a poliploidização. b) V . Questão 1355 Foi transferido para plantas de arroz um gene que permite a produção e o acúmulo de vitamina A no grão das plantas transgênicas. e) Organismo mais vigoroso.V .F . ( ) Uma importante fonte natural de vitamina A são os vegetais com pigmentos amarelos. Questão 1356 Acerca dos organismos transgênicos. Assinale verdadeira (V) ou falsa (F) nas afirmativas a seguir. a produzir esse hormônio. podem ser consideradas exemplos de biotecnologia aplicada à fabricação de organismos transgênicos. Assinale a(s) proposição(ões) VERDADEIRA(S) sobre a transgenia e suas implicações com relação à saúde e ao meio ambiente. plantas e animais.F. ( ) As vitaminas são necessárias em grandes quantidades. (2) Organismos geneticamente modificados podem ser resistentes a produtos químicos como herbicidas. 306 .b) Desenvolvimento de um organismo completo a partir de uma célula somática. que passam. 1999. a partir de transferência de genes humanos para bactérias. tanto por parte dos cientistas como dos governantes. A seqüência correta é a) V . de informação relativa à natureza transgênica do produto. p. é uma das experiências bem sucedidas da transgenia. (4) As técnicas de melhoramento genético tradicionais. pois atuam como enzimas. para que as manipulações genéticas não resultem em impactos ambientais irreversíveis. que permite a inclusão de genes de organismos de espécies diferentes no genoma de bactérias. na embalagem de alimentos produzidos com técnicas da biotecnologia. gens de galinha são introduzidos em batatas. (16) Os organismos transgênicos são aqueles que recebem segmentos de DNA da mesma espécie. incontinentimente. d) F . cientistas desenvolvem ovelhas "auto-tosquiáveis". antes de chegarem ao homem. e) F . isto é. com muitos genes em heterozigose. c) V . Questão 1354 Porcos têm sido criados transgenicamente para que seus órgãos possam ser transplantados em homens. a lã cai sozinha no devido tempo. resultante do cruzamento de duas variedades puras distintas.F. (3) Os debates atuais a respeito dos transgênicos resumem-se à questão da rotulagem. alterando geneticamente animais e plantas. julgue os itens a seguir. vol. ( ) A vitamina A foi introduzida no núcleo das células. (02) Os genes alienígenas permitem ao organismo receptor produzir substâncias que nunca produziriam em condições naturais. à obrigatoriedade da apresentação.F. ("CICLO VITAL".V. isto é. (01) Cientistas interferem na evolução natural das espécies. (08) a produção de insulina. d) Gene que sofreu mutações..F . (04) Os alimentos transgênicos não representam nenhuma ameaça à saúde humana. (32) É fundamental o estabelecimento de limites.V. originando múltiplos alelos para um mesmo locus.V . (1) Transgênicos são organismos produzidos com a tecnologia do DNA recombinante..14. ou agir como inseticidas. 4.) A citação anterior mostra avanços da Engenharia Genética. e por isso não necessitam ser testados em outras espécies de animais. como a cenoura.F . deixando os vegetarianos confusos com a perspectiva de cruzar animais com plantas. por isso o grão transgênico é mais nutritivo. c) Organismo que apresenta tanto estruturas reprodutoras masculinas quanto femininas.

As diferenças no DNA de humanos e chimpanzés são de apenas 4% dos quase 3 bilhões de bases (letras químicas A. 20/08/98) Nesse tipo de teste.10.W. para obtenção de camundongos transgênicos. com a mera troca de uma letra num gene. c) os camundongos receptores dos genes do coelho tiveram suas hemácias modificadas. c) número de fosfatos contidos. identificar a paternidade de uma pessoa sem a necessidade de coleta de sangue. o caderno Mais! do jornal "Folha de S. desde que as espécies sejam da mesma ordem. independentemente de sua classificação. JÁ PODE SER FEITO COM SALIVA" "Novo teste pode. Gurdon e F. que apresentam características diferentes. e) clones. transmitiram os genes do coelho aos seus descendentes. como a síntese de proteínas -. pode-se dizer que a maior contribuição para a diferença fenotípica entre essas espécies seja devida à 307 . 01.2001) afirmou: "O que torna a técnica tão atrativa e produtora de ansiedade é que qualquer gene de qualquer espécie pode ser transferido para qualquer outra espécie". d) os camundongos transgênicos. d) tipo de pentose existente. continua-se considerando que homens e chimpanzés são espécies diferentes." (O GLOBO. d) mutantes. c) é válida. b) não é válida. a semelhança estrutural existente entre as moléculas de DNA é tomada por base para a identificação da paternidade. mas não poderiam transmitir essa característica aos seus descendentes. a duplicação de um conjunto de letras qualquer ou a deleção de outro. Questão 1358 O primeiro transplante de genes bem sucedido foi realizado em 1981. por J. Questão 1359 Com relação à técnica de criação de organismos geneticamente modificados (transgênicos). pode-se deduzir que a) o DNA injetado foi incorporado apenas às hemácias dos camundongos. Ruddle. Quando se olha para os genes em si . C e G) que compõem ambos os genomas.H.2005) A despeito da similaridade genética. pela análise do DNA das células. Questão 1360 "EXAME DE PATERNIDADE. Essa diferença consiste na(o): a) seqüência de bases nitrogenadas. mas não foi incorporado aos seus genomas. e) tipo de desoxirriboses presentes. injetando genes da hemoglobina de coelho em zigotos de camundongos. d) é válida. NO BRASIL. os trechos de DNA que se traduzem em alguma função. c) infectados. T. se as espécies forem de filos diferentes.Questão 1357 A engenharia genética permitiu a introdução. levando à produção de ratos gigantes. se as espécies forem de classes diferentes. Desse modo. nós e esses grandes macacos africanos somos 99% iguais.isto é. e) é válida para todas as espécies. Esse tipo de teste é particularmente indicado para bebês e crianças pequenas. do gene humano para produção do hormônio de crescimento.09. em função das informações do texto. em ratos. Questão 1361 CONSÓRCIO DECIFRA GENOMA DO CHIMPANZÉ. e) o RNAm foi incorporado ao zigoto dos embriões em formação. b) transgênicos. ao se reproduzirem. desde que as espécies sejam do mesmo reino. b) o DNA injetado nos camundongos poderia passar aos seus descendentes somente se fosse incorporado às células somáticas das fêmeas dos camundongos. Essa afirmação a) não é válida. ("Folha de S. resultando camundongos com hemoglobina de coelho em suas hemácias. E boa parte dessas modificações se deu de maneira trivial ao longo dos cerca de 6 milhões de anos transcorridos desde o ancestral comum de ambos. Paulo" (07. A partir destas informações.Paulo". Estes ratos são considerados a) isogênicos. b) aspecto da dupla hélice presente.

d) quais nucleotídeos servem de molde para a síntese de RNAm. II. c) a seqüência exata de nucleotídeos de cada gene. com o intuito de verificar se todos esses genes eram essenciais para a sobrevivência dessa espécie. IV e V apenas. IV. II. isto é. c) a seqüência de aminoácidos do DNA humano. Pelas pesquisas realizadas até hoje no Projeto Genoma Humano. Se cada gene pode ser inativado por mutação. Em um laboratório. d) a seqüência de aminoácidos de todas as proteínas humanas. foram feitas algumas afirmações. em 21 de junho de 2000.27/6/2000. genitalium' sobrevive sem utilizar alguns de seus genes. empenham-se no momento em descobrir a) a interação dos genes. o primeiro ministro britânico.5. 308 . c) garantir a cura de todas as patologias humanas.a) seqüência de bases nitrogenadas no DNA. São Paulo . o genoma mínimo essencial pode ser determinado. V. b) todos os tipos de proteína codificados pelos genes humanos. III. b) a expressão dos genes. Questão 1364 Pelo Projeto Genoma Humano.15. d) descobrir novos genes com funções ainda desconhecidas. Questão 1363 Os projetos genomas. e) o número correto de cromossomos da espécie humana. No experimento II. 1. b) I. No experimento I. IV e V apenas. e) seqüência de aminoácidos das proteínas. que possui apenas 470 genes. c) II. São afirmações CORRETAS: a) I. Quando um transposon é inserido aleatoriamente dentro de um gene. Bill Clinton. Questão 1365 Nos últimos dez anos. o seqüenciamento do DNA revolucionou a ciência e gerou novos conhecimentos sobre seres procariotos e eucariotos. b) quantidade de DNA presente no núcleo das células desses organismos. Questão 1362 O anúncio do seqüenciamento do genoma humano. como eles agem." "Folha Ciência". a ausência de crescimento significa que o gene B é essencial. e os representantes dos grupos rivais. A bactéria 'M. Questão 1366 "O genoma humano foi mapeado e sua seqüência estabelecida pela primeira vez na história da humanidade. inclusive permitiu o estabelecimento de comparações genômicas com o intuito de analisar quais genes são típicos de um organismo e quais foram perdidos no processo evolutivo. II. a era da genética. IV e V. III. EXCETO: a) selecionar embriões com características desejáveis. é capaz de inativá-lo. c) quantidade de lócus gênicos. significa que os cientistas determinaram a) a seqüência de nucleotídeos dos cromossomos humanos. Tony Blair. é possível. o consórcio público internacional Projeto Genoma Humano (PGH) e a empresa norte-americana Celera. d) expressão diferenciada dos genes. a humanidade viverá uma nova era. realizou-se um experimento com a bactéria 'Mycoplasma genitalium'. que estão sendo desenvolvidos em centros de pesquisas de vários países. o crescimento demonstra que o gene A não é essencial. e) como ocorrem a duplicação e as mutações dos nucleotídeos. I.3 Sobre esse experimento. d) I e III apenas. anunciaram ontem o presidente norte-americano. b) compreender mecanismos que tornam uma célula imortal.

c) o DNA recombinante. Considerando as proposições anteriores. ( ) O mapeamento gênico de um indivíduo permite informar se ele é portador ou não de genes causadores de doenças. é de grande auxílio para o Projeto Genoma Humano. que tem por objetivo seqüenciar os cerca de 3 bilhões de bases nitrogenadas que compõem os cromossomos de um ser humano." ("Ciência Hoje". vacinas. todas as quebras provocadas pela radiação solar. cada um de um casamento diferente. II . Sobre este tema. amostras de DNA nuclear e mitocondrial de todos os mortos. Questão 1369 Os avanços na área da biotecnologia permitiram melhores condições de assistência à saúde humana e animal. b) apenas II e III.Leia as proposições a seguir sobre o Projeto Genoma Humano. IV . o procedimento que pode afetar diretamente o equilíbrio genético de populações humanas é a) a detecção de indivíduos superdotados intelectualmente por meio de procedimentos laboratoriais. março/93) Em relação a esse projeto. possibilitando a melhor compreensão dos diferentes fenótipos. analise os itens abaixo. foi possível preparar. e) todas as proposições. nos cromossomos humanos. d) apenas I. Faleceram no acidente dois filhos de uma senhora. ( ) O teste de paternidade com base no DNA deve ser realizado exclusivamente em indivíduos sem doenças sangüíneas. I . como a hemofilia. ( ) O Projeto Genoma visa a localizar. Ao lado dos inúmeros benefícios desse projeto. como o das bactérias ('Xylela fastidiosa'). III e IV. e) a sonda de DNA. Na fase laboratorial. especialmente no que se refere à produção de antibióticos. Questão 1370 "A nova tecnologia do DNA recombinante está permitindo que cientistas dos países do primeiro mundo desenvolvam um projeto denominado GENOMA. 309 . b) a clonagem de células. Questão 1367 Em um acidente. Uma das formas possíveis de identificar os despojos dos filhos dessa senhora consiste em verificar se existe homologia do: a) DNA mitocondrial da senhora com o DNA mitocondrial das vítimas b) DNA mitocondrial da senhora com o DNA nuclear das vítimas c) DNA nuclear do marido e do ex-marido da senhora com o DNA mitocondrial das vítimas d) DNA mitocondrial do marido e do ex-marido da senhora com o DNA mitocondrial das vítimas e) DNA nuclear da senhora com o DNA mitocondrial das vítimas Questão 1368 Os avanços da Engenharia Genética têm permitido o conhecimento mais amplo dos cromossomos.O seqüenciamento do genoma de outras espécies. pode-se afirmar que estão CORRETAS a) apenas I e II.O seqüenciamento do genoma humano possibilitará a identificação dos genes envolvidos em doenças e a criação de novas abordagens preventivas ou de tratamentos mais rápidos e eficazes. algumas questões de cunho ético têm sido levantadas. d) a hibridização de DNA. dos camundongos e ratos. o método de produção do hormônio do crescimento envolve diretamente a) o seqüenciamento de DNA.O genoma humano pode ser seqüenciado a partir de qualquer célula do corpo. c) apenas I. a partir de fragmentos de tecidos. III . embora os corpos das vítimas fatais fiquem queimados e irreconhecíveis. com exceção das hemácias.O seqüenciamento do genoma humano determinou a posição exata e a função de cada gene. II e IV. ( ) O gene para produção de insulina no homem pode ser clonado em bactérias que passam a produzir este hormônio. hormônios e outros insumos terapêuticos.

50% dos genes são herdados da mãe e 50%. c) o emprego de testes genéticos como um novo critério para admissão a empregos. Paralelamente. empregando para isso testes de identificação genética. Antônio. por ser herdado das duas avós. através das mitocôndrias existentes no citoplasma do espermatozóide do pai. que atinge plantas cítricas. atualmente. envolveu a bactéria causadora da "praga do amarelinho". Essas crianças foram adotadas. vendidas ou abandonadas em orfanatos. Todas as alternativas apresentam benefícios de projetos que envolvem o seqüenciamento de genomas. aproximadamente. os DNAs devem ser diferentes. do pai. a) A criança não é filha de nenhum dos supostos pais. A escolha desse teste está relacionada com o fato a) de o DNA mitocondrial. Para solucionar esse impasse.15. d) o registro de patentes de seqüências do genoma humano para especulação mercadológica. permitir identificar a filiação com segurança. a família de Maria resolveu fazer um teste de paternidade. na verdade.b) o aumento de seleção genética ou gamética artificial. através de uma mistura dos genes do pai e da mãe. mesmo na ausência dos pais. permitir traçar árvores familiares confiáveis. que são possíveis. pois todos os resultados foram menores que 85%. 310 . c) A criança é filha de João. b) de o DNA mitocondrial.ar) A comparação entre os DNAs mitocondriais de possíveis netos e avós tem sido um dos testes utilizados nesses processos de identificação de parentesco. pois deveríamos ter hibridizado o DNA do pai com o da mãe. através das mitocôndrias existentes no citoplasma do ovócito da mãe. permitir traçar árvores familiares confiáveis. A Associação Civil "Avós da Praça de Maio" tem buscado localizar essas crianças com a finalidade de restituí-las a suas famílias legítimas. irmãos adotivos.3 Assinale a alternativa que interpreta corretamente os resultados do teste. o seqüenciamento completo do genoma humano foi anunciado pela comunidade científica internacional. para se hibridizarem. por ser herdado do avô paterno. e) o uso de testes pró-sintomáticos para a realização de seguros de vida. pois. 1. EXCETO a) Aumento da produtividade na agricultura b) Compreensão mais ampla das doenças genéticas c) Determinação da posição de proteínas nos cromossomos d) Diagnóstico precoce de doenças hereditárias Questão 1372 Na Argentina. ou ainda de um vizinho. alegando que o filho pode ser de Paulo (irmão de Pedro). c) de o DNA mitocondrial. e o resultado foi o seguinte. ou de João (primo de Pedro). (Fonte: abuelasatournet. por ser herdado da avó materna. por ser herdado da avó paterna. Questão 1371 Alguns projetos de seqüenciamento genômico vêm sendo desenvolvidos por pesquisadores brasileiros. seu ex-namorado. por exemplo.com. Um deles. Questão 1373 Maria teve um filho e Pedro. nega a paternidade da criança. permitir traçar árvores familiares confiáveis. muitas crianças foram seqüestradas com seus pais ou nasceram em centros clandestinos de detenção. e) de o DNA mitocondrial.5. através das mitocôndrias existentes no citoplasma do ovócito da mãe. b) A criança é filha de Pedro. durante a ditadura militar iniciada em 1976. através das mitocôndrias existentes no citoplasma do ovócito da mãe. garantir um registro familiar que se mantém de geração a geração. e) Pedro e Paulo são. d) de o DNA mitocondrial. pois. d) O teste não foi conclusivo. por ser herdado do avô materno.

b) Apenas II. Questão 1376 1..3 m relação à tabela é correto afirmar que a) o gene correspondente à proteína A está no cromossomo 1. d) Apenas II e III. 123. Duas células de origem diferente podem se fundir em uma única célula híbrida. e) I. B. recentemente seqüenciado no Brasil.O genoma humano tem organização diferente da organização do genoma da bactéria 'Xyllela fastidiosa'. Com relação a esse assunto.. a Guanina e a Uracila . ou ausência. Com relação à organização genômica. de algumas doenças genéticas." Trecho extraído do artigo: GENOMA: O PRIMEIRO ESBOÇO DO MAPA DA VIDA. bem como pela sua habilidade em produzir as proteínas humanas hipotéticas A. I . é CORRETO afirmar que: (01) o referido genoma está contido nos cromossomos. no futuro. Questão 1375 O que se imaginava impossível acabou acontecendo antes do prazo previsto: após a elucidação da seqüência de DNA de vários organismos. Quais estão corretas? a) Apenas I. Depois do susto provocado no começo da semana pelos percalços jurídicos da Microsoft.15. Três linhagens somáticas híbridas designadas I. . e) a linhagem III contém o cromossomo 8. (02) a molécula sequenciada é o DNA.são possíveis de serem encontradas nesse mapeamento. a Citosina. C e D quando o seqüenciamento é realizado a partir de RNA mensageiro. (. causadora da praga do amarelinho nos laranjais. considere as seguintes afirmações.5. p. d) o gene correspondente à proteína D está no cromossomo 4. que contém cromossomos das duas espécies. de cada gene no DNA de células diferenciadas.O genoma humano contém uma grande percentagem de seqüências de DNA que não codificam genes. "A revanche veio na quinta-feira [06/4] passada. O oxigênio foi dado pelo anúncio de que cientistas americanos tinham chegado ao fim do rastreamento de um dos sonhos da medicina nesta virada de século: o mapeamento do genoma humano...A expressão dos genes humanos depende da presença. publicado na "Revista Época". Georges Barsky desenvolveu a técnica de hibridização somática. b) o gene correspondente à proteína B está no cromossomo 3. (04) apenas quatro bases nitrogenadas . III . c) o gene correspondente à proteína C está no cromossomo 6. que se constitui em um grande passo no mapeamento de genes humanos. (16) um dos resultados possíveis dessa descoberta será a cura. a Nasdaq.). através da terapia gênica. Por isso. II ..a Adenina. o pregão eletrônico das empresas de alta tecnologia. II e III foram registradas para a presença ou ausência dos cromossomos humanos 1 até 8.Questão 1374 Na década de 1960. 10/04/2000. II e III.. identifica-se mais facilmente um gene.. foi anunciado o seqüenciamento do genoma humano. (08) esse mapeamento já permitiu aos cientistas saberem a localização de todos os genes humanos. no ano 2000. voltou a respirar. 311 . c) Apenas I e II. A tabela abaixo contém uma grade hipotética de dados usados para mapear genes em seus cromossomos humanos apropriados.

c) quantas moléculas de DNA estão presentes nos cromossomos humanos. e) o número total de genes humanos e quais as proteínas codificadas por esses genes. a partir de testes de DNA. O título referiu-se a uma reportagem da qual foi extraído o trecho a seguir: Depois da pílula anticoncepcional. (02) o melhor material biológico para um teste de DNA é aquele extraído de núcleos de glóbulos brancos do sangue. c) código genético por conjunto total de proteínas. foi anunciada a conclusão da fase do Projeto Genoma Humano em que se determinou a seqüência de. anunciou em sua capa: "O DNA não falha". do genoma do parasita". O conhecimento dessa seqüência permitirá determinar a) o número de cromossomos presentes nas células humanas. coletam-se amostras biológicas do suposto pai. (16) o custo do exame de DNA. é a substituição de a) seqüência de substâncias por seqüência de nucleotídeos. com a identificação genética de criminosos e suspeitos. (adaptado) Uma modificação que poderia ser feita nesse texto. em 30/07/2001.. 13(1):63. é um dos fatores que dificulta sua utilização em larga escala pelos segmentos populacionais menos favorecidos economicamente. Questão 1380 O exame de paternidade tem sido muito utilizado na medicina forense. A idéia é descobrir. ainda muito elevado no Brasil. "Trabalhando sem parar desde o final de 1997. (32) a criação de bancos de dados. eles (os pesquisadores) já decifraram 75% do código genético dessa bactéria. d) o número de doenças que podem afligir a humanidade. e as implicações dessa prática para os indivíduos e a sociedade em geral.Questão 1377 A revista "Época". até abril. O resultado do teste. Sobre a utilização dos testes de DNA. a partir de testes de DNA. 3 bilhões de nucleotídeos do genoma humano. (04) para uma investigação de paternidade. do pai e dos filhos.. b) código genético por seqüência de aminoácidos. em países como a Inglaterra. contém padrões dessas marcas de uma determinada família. mas outros tecidos. para torná-lo mais preciso. é CORRETO afirmar que: (01) os testes de DNA podem ser empregados para finalidades de investigação de paternidade e também para identificação de supostos criminosos. Jan. vem gerando grande polêmica. aproximadamente. não sendo necessário obter informações do(a) filho(a) e de sua mãe. como pele e ossos. (08) os exames de investigação de paternidade. também podem ser utilizados. métodos que permitem a gravidez sem sexo. b) o número de proteínas que compõem os genes humanos. a seqüência de substâncias que constituem os cerca de 2000 genes da cadeia de DNA. 1999. "Superinteressante". no ano de 1999. d) cadeia de DNA por cadeia de RNA. o teste de DNA surge como uma das grandes descobertas do mundo ocidental. 312 . da fertilização "in vitro" e da barriga de aluguel. atualmente. resultados com exatidão total.. ou seja. Questão 1379 O texto a seguir apresenta os resultados do projeto de estudo do genoma da 'Xylella fastidiosa'.] a técnica só traz benefícios. Outros acreditam que reflexos da descoberta vão alterar o universo das relações familiares. não restando qualquer questionamento ou dúvida sobre os diagnósticos apresentados. representado a seguir. e) seqüência de substâncias por seqüência de aminoácidos. uma vez que podem ser entendidos como uma violação da privacidade biológica dos indivíduos. que transferiu para as mulheres o controle da fertilidade. Esse teste baseia-se na identificação de marcas genéticas específicas que podem ser encontradas no DNA da mãe. como em casos de estupros e assassinatos. oferecem. Para muitos especialistas [. Soma ( ) Questão 1378 Em junho de 2000.

e) III é irmão biológico de I. julgue os itens a seguir. nos últimos 2 anos chegaram ao fim vários seqüenciamentos do genoma de bactérias. e) dos leucócitos e das globulinas. comparando-se a seqüência de DNA de diferentes espécies. Questão 1385 Uma loja de animais mantinha para venda 4 exemplares de 'Ara ararauna' (arara azul-e-amarela) e alegava aos fiscais que os exemplares haviam nascido em cativeiro. A esse respeito. Questão 1381 Está em andamento o projeto GENOMA. foi publicada a seqüência do DNA da bactéria 'Escherichia coli. será possível conhecer a seqüência de aminoácidos da proteína correspondente. mas não das hemácias. (3) Pode-se fazer estudos da evolução das bactérias. sendo apenas um passo no conhecimento de nosso genoma. pelo qual se pretende seqüenciar totalmente o DNA humano.6 milhões de pares de bases. dos leucócitos e do plasma. (0) Uma vez obtida a seqüência de um gene. d) é o que foi conseguido pelos pesquisadores há alguns anos. a discriminação de pessoas.288. d) IV pode ser filho adotivo do casal. Em setembro de 1997. quando extraído do sangue. 38% desses genes ainda não têm uma função conhecida. por exemplo. (4) A 'Escherichia coli' pode produzir 8.15.3 Com o auxílio do texto. o DNA.' Os números . pelo eventual uso inadequado que se possa fazer do conhecimento obtido.2 milhões de moléculas de fosfato. (2) Para 38% dos genes. Para surpresa de muitos. obter a seqüência de bases nitrogenadas do DNA de todos os cromossomos de uma pessoa. julgue os itens que se seguem. c) das hemácias.5. c) é o que nos permitiria conhecer qual a real proporção de proteínas em relação às moléculas de DNA que possuímos. d) dos leucócitos. b) II não é filho deste pai. não se sabe a seqüência de amionoácidos da proteína. Questão 1383 Nos exames para teste de paternidade. assinale a alternativa INCORRETA: a) I é filho biológico do casal. que só foi descoberto depois da conclusão do projeto Genoma Humano em 2003. principais células de defesa do sangue. 1. (2) A seqüência de todos os cromossomos será do mesmo tamanho. (3) O projeto GENOMA tem levantado questões éticas. b) das hemácias. Questão 1382 Enquanto o projeto que visa seqüenciar completamente o genoma humano segue seu curso. (1) As seqüências obtidas corresponderão exatamente ao DNA de qualquer pessoa.impressionam: são cerca de 4. c) V não pode ser filho biológico deste casal.576 RNAs mensageiros diferentes. mas não do plasma. ou seja. é obtido a) das hemácias e dos leucócitos. e os genes que codificam proteínas são 4. como. (4) Todos os genes terão a mesma proporção de adenina e guanina. Questão 1384 O mapeamento de toda a seqüência de nucleotídeos existente nos 23 pares de cromossomos humanos a) é o que ainda falta fazer após a conclusão do projeto Genoma Humano em 2003. a partir de 313 om base neste resultado. o principal componente do sangue. b) é a condição necessária para se saber o número de moléculas de RNA existentes em nosso organismo. (1) O DNA da bactéria 'Escherichia coli' tem cerca de 9. e) significa decifrar o código genético.

c) inibir a síntese de DNA a partir de RNA. c) cada uma pode originar fragmentos de DNA com tamanhos diferentes. b) apenas os exemplares machos. por exemplo). Questão 1387 Enzimas de restrição são fundamentais à Engenharia Genética porque permitem a) a passagem de DNA através da membrana celular. e) modificar seqüências de bases do DNA. Essa técnica tem por objetivo "corrigir o efeito da mutação" a) induzindo mutações nos genes responsáveis pela doença. Enquanto a cura de diabetes está sendo pesquisada através da engenharia genética.5. O DNA foi extraído das células por processos químicos. no futuro. Questão 1389 Duas doenças não infecciosas que preocupam o homem moderno são a diabetes e o mal de Alzheimer. por exemplo. mantido pelo criador. A migração diferencial dos fragmentos forma bandas (faixas) de DNA no gel. colheu-se uma amostra de sangue de cada um dos animais e fez-se um teste para determinação de paternidade pelo método do DNA-Fingerprint. colocado sobre um gel suporte e submetido à corrente elétrica. e) fazendo-se uso delas. Fragmentos menores migram mais rapidamente em direção a um dos pólos da corrente. a) os 4 exemplares. raios X. Com relação a essas substâncias é correto afirmar que a) são altamente específicas. como a diabetes. A identificação de genes responsáveis por diversas doenças. d) cortar DNA onde ocorrem seqüências específicas de bases. pode possibilitar. Sobre essas enzimas é INCORRETO afirmar que: a) reconhecem seqüências específicas de bases nitrogenadas. e) impedem a clonagem de moléculas de DNA recombinante. fragmentado com enzimas específicas. ou "impressão digital de DNA". que podem ser visualizadas por tratamentos específicos (coloração. d) são utilizadas nos atuais testes de DNA. cortando o DNA em locais determinados. d) permitem somente a ligação de pedaços de DNA de um mesmo tipo celular. os fiscais do IBAMA suspeitaram se esses exemplares teriam nascido em cativeiro ou se teriam sido capturados na natureza.15. pode-se isolar um único gene de um cromossomo.um casal mantido em um criatório autorizado pelo IBAMA. o uso da terapia gênica. originando fragmentos dessa molécula.4 Os resultados obtidos indicam que podem ser filhos do casal. b) não existem em seres vivos. testes de laboratório utilizando a melatonina indicaram bons resultados para controlar o mal de Alzheimer. A ilustração apresenta o resultado do teste bacteriano. b) removem os fosfatos e as pentoses. c) apenas os exemplares fêmeas. Questão 1388 Por sua capacidade de cortar o DNA em pontos específicos. 314 1. sendo exclusivamente produtos da indústria química. que serão manipuladas. d) apenas os exemplares 1 e 4. b) inibir a síntese de RNA a partir de DNA. b) inserindo cópias extras do alelo mutado. e) apenas os exemplares 2 e 3. O padrão de bandas é exclusivo de cada indivíduo. c) atuam como agentes de ligação entre DNA viral e . Questão 1386 As enzimas de restrição são as principais ferramentas bioquímicas empregadas em Engenharia Genética. são utilizadas enzimas de restrição na engenharia genética. Contudo. Para esclarecer a questão. deixando somente as bases nitrogenadas.

Questão 1390 A biotecnologia tornou possível a transferência de material genético entre os mais diversos organismos. e) Fragmentos de genes exógenos são inseridos no genoma das células hospedeiras por meio de plastídeos nucleares. d) O DNA endógeno é transferido para genomas hospedeiros por meio de plasmídeos mitocondriais. Questão 1391 As principais ferramentas empregadas na tecnologia do DNA recombinante são as enzimas de restrição. EXCETO a) Independência de pâncreas de animais para produção de insulina b) Obtenção de uma nova espécie de bactéria produtora de insulina humana c) Possibilidade de expressão em bactérias de outros genes de interesse médico d) Possibilidade de tratamento para pacientes com intolerância à insulina animal Questão 1394 Para minimizar o uso de inseticidas sintéticos na fruticultura e atender às normas de segurança alimentar da FAO ("Food and Agriculture Organization"). O papel biológico dessas enzimas bacterianas na natureza é. Sobre a produção de organismos geneticamente modificados. c) Produção. Questão 1392 Todas as alternativas apresentam aplicações da tecnologia do DNA recombinante nas duas últimas décadas. do gene humano responsável pela síntese da insulina.15.5. em bactérias. que representa um determinado experimento. Todas as alternativas apresentam resultados esperados do êxito dessa técnica. provavelmente: a) proteger as bactérias contra os vírus bacteriófagos. que têm a propriedade de cortar o DNA em pontos específicos. c) auxiliar no processo de duplicação do DNA. d) Terapia gênica de algumas doenças hereditárias. d) auxiliar no processo de transcrição do mRNA. b) O genoma exógeno é inserido no núcleo hospedeiro por meio de vetores protéicos conhecidos como plasmídeos. estão sendo implantadas "biofábricas" de controle de pragas no Nordeste do Brasil. Essas "biofábricas" podem adotar todas as seguintes tecnologias. Os conhecimentos da área são aplicados com sucesso na produção industrial da insulina e do hormônio de crescimento. e) auxiliar no processo de tradução do DNA.c) substituindo o alelo mutado ou adicionando uma cópia correta do alelo. b) Recuperação de espécies extintas. b) reparar o DNA bacteriano que sofreu mutação deletéria. e) inibindo a expressão do gene mutado nas células secretoras da proteína. c) O DNA gênico endógeno é inserido no núcleo de células hospedeiras por meio de plastídeos funcionais. Questão 1393 A tecnologia do DNA recombinante permitiu a inserção e a expressão. d) produzindo proteínas funcionais em organismos de outra espécie. 1.5 315 . em bactérias. é correto afirmar: a) Fragmentos de DNA exógeno são inseridos no genoma de células hospedeiras por meio de plasmídeos. EXCETO a) Investigação de paternidade e criminalística. EXCETO a) Produção de parasitas das pragas b) Extração de inseticidas naturais c) Criação de comensais das pragas d) Produção de machos estéreis das pragas Questão 1395 Analise a figura a seguir. de proteínas humanas de interesse médico. que são administrados a pacientes de todo o planeta.

e) amniocentese.15.5 a) enzima de restrição. Preocupado com os conteúdos da disciplina de Biologia. Cada colega lembrou um aspecto das aulas. já possibilitou a obtenção de resultados benéficos para a medicina e para outras áreas do conhecimento. para o corte e a separação do segmento de DNA a ser estudado. dispersas no citoplasma bacteriano e que têm replicação independente do cromossomo. 2 e 3 indicam. Questão 1398 O Projeto genoma humano tem como objetivo determinar a seqüência de bases de todos os genes de nossa espécie. ( ) promove-se o corte de moléculas de DNA com o uso de enzimas que reconhecem seqüências nucleotídicas específicas no DNA. conhecidas como enzimas de restrição. RNA plasmidial e enzima exonuclease. Assinale a alternativa que apresenta. Com relação a esse tema. separando-o sempre em nucleotídeos individuais. c) DNA recombinante. como as enzimas bacterianas. Questão 1396 A manipulação genética de microorganismos. Questão 1397 Para um pesquisador transferir um gene de interesse. cromossomo circular e enzima de restrição. plasmídio e enzima de restrição. corretamente. d) enzima transcriptase reversa. c) aconselhamento genético. Isto pode ser feito graças ao instrumental bioquímico da engenharia genética disponível nos dias de hoje. ( ) se duas diferentes moléculas de DNA forem cortadas por uma mesma enzima de restrição serão produzidos iguais conjuntos de fragmentos. plasmídio e enzima ligase. d) A utilização de enzimas de restrição permite cortar o DNA nos locais onde reconhecem o ácido fosfórico. a forma de atuação dessas enzimas. respectivamente: 1. 316 . e) enzima de restrição. diferentes etapas são cumpridas em laboratório.5. através de cortes com exonucleases. d) eletroforese. c) A utilização das enzimas de restrição permite separar moléculas de DNA de acordo com seu tamanho e carga elétrica. com genes de interesse. como a transcriptase reversa. b) As enzimas de restrição cortam o DNA nos locais onde reconhecem o açúcar desoxirribose. Os números 1. b) enzima transcriptase reversa. e a inclusão em (2) do segmento obtido (gene isolado) com o auxílio de enzimas do tipo (3). e) As enzimas de restrição quebram o DNA. ( ) são obtidos segmentos de DNA. é verdadeiro afirmar que: ( ) são utilizadas pequenas porções circulares de DNA. Questão 1399 Pedro estava doente e perdeu uma semana de aulas.) Produção de DNA recombinante (plasmídio de uma bactéria/ gene do vaga-lume) 2) Introdução do DNA em célula de tabaco 3) Multiplicação da célula de tabaco com o gene do vaga-lume 4) Desenvolvimento de uma planta de tabaco com o gene do vaga-lume (planta que fluoresce) O experimento ilustrado é: a) produção de transgênicos. RNA plasmidial e enzima transcriptase reversa. b) hibridação intraespecífica. ( ) a tecnologia do DNA recombinante (ou Engenharia Genética) fundamenta-se na fusão de "trechos" de DNA de diferentes organismos para a construção de DNA híbrido. principalmente a manipulação de bactérias. soube pelos colegas que o assunto trabalhado fora Biotecnologia. a) As enzimas de restrição cortam o DNA apenas nos locais onde existem certas seqüências de bases nitrogenadas. a extração e o rompimento de (2). entre as quais: a utilização de enzima do tipo (1).

coagulação d) fator VIII .. 1. em 1988. clone e vetor. está a produção de .. vetor. (1) As técnicas de engenharia genética permitem a 317 .. Os rins produzem esse hormônio..De acordo com MARIANA. a) DNA recombinante. c) DNA. em um plasmídio de bactéria. Com o auxílio do texto. inicia em 1999 a comercialização do produto. Uma parceria entre a BIOBRÁS e a Universidade de Brasília (UnB)... .. Questão 1400 Assinale a alternativa que preenche corretamente as lacunas do parágrafo a seguir. Ao voltar à escola. um dos mais significativos produtos do avanço científico nacional na área da engenharia genética. os números 1. na ordem em que aparecem. está prestes a chegar ao mercado com o nome de Biohulin: a empresa BIOBRÁS. julgue os itens abaixo.diabetes c) plasmina . reduzida.. as enzimas de restrição são aquelas que podem cortar o DNA em pontos determinados.5. jan/99..7(com adaptações). . e) as afirmações de todos os colegas. p.. DNA recombinante e organismo transgênico.. Esta conquista tecnológica permitirá o desenvolvimento de outros medicamentos.. d) DNA transgênico. Informe PADCT/Ministério da Ciência e Tecnologia. Laura e Rafael. DNA recombinante. respectivamente. estimula a divisão de células-tronco.. b) DNA recombinante. Pedro conversou com a professora e constatou que estavam corretas a) apenas as afirmações de Eduardo. vetor e plasmídio...anemia b) insulina .... o interferon e a calcitonina. 2...15. Mariana e Laura. a) eritropoietina . c) apenas as afirmações de Eduardo e Joana..RAFAEL definiu proteoma como o conjunto de proteínas expressas pelo genoma. deu início aos trabalhos.Segundo LAURA.JOANA relatou que vacinas genéticas são usadas para inocular nas pessoas microorganismos vivos transgênicos ou atenuados. . uma das quatro empresas em todo o mundo e a única no hemisfério sul a deter a tecnologia de produção desta insulina. atuando sobre a medula óssea vermelha. ou impressão digital genética. plasmídio. .leucocitose e) hormônio de crescimento . para fins terapêuticos.5 om relação ao processo de clonagem gênica esquematizado acima..esterilidade Questão 1401 A figura a seguir representa de forma esquemática o processo de clonagem de genes do "Mycobacterium tuberculosis". plasmídio e transgene.. como o hormônio de crescimento. vetor.. Entre os importantes avanços conquistados pela tecnologia do DNA recombinante.EDUARDO lembrou que a identidade genética individual pode ser estabelecida pela técnica DNA 'fingerprint'.. b) apenas as afirmações de Mariana... Questão 1402 CHEGA AO MERCADO UM NOVO FÁRMACO INTEIRAMENTE DESENVOLVIDO NO PAÍS A insulina humana recombinante (IH-r). d) apenas as afirmações de Rafael e Joana... que. 3 e 4 representam. plasmídeos são utilizados como vetores para a clonagem de genes. . Ao grupo da UnB coube a parte de Biologia Molecular. desenvolvendo clones de bactérias produtoras de insulina. Indivíduos submetidos a hemodiálises são injetados com essa proteína e apresentam sua . que utiliza DNA codificante.

cromossomicamente e geneticamente. a "célula-tronco" tem a capacidade especial de se diferenciar e constituir diferentes tecidos no organismo. Por essa razão seu uso para a cura de doenças é bastante promissor. e) O Brasil não tem cientistas especializados para a realização desse tipo de pesquisa. sugere uma melhora aparente do quadro clínico em pacientes com insuficiência cardíaca.br/educando/noticias/2004/mai/10/ 69.estadao. qualquer que seja a sua origem. 1. c) a quantidade de genes mitocondriais. segundo a Comissão Técnica Nacional de Biotecnologia (CTNBio). c) No Brasil não há permissão para o desenvolvimento de pesquisas com célula-tronco. c) alterarem a constituição genética do tecido hospedeiro. Por reprodução ela gera células. d) o padrão de atividade dos genes. idênticas a si mesma. as células-tronco terão necessariamente que alterar a) o número de cromossomos. a não ser nas doenças genéticas. que mostra a diferenciação de células-tronco humanas nos elementos figurados indicados. d) fundirem-se com o tecido hospedeiro. ela deve receber altas doses dessa proteína.recombinação de genes entre organismos totalmente diferentes. Questão 1403 A expectativa em torno da utilização das células-tronco decorre do fato de estas células a) incorporarem o genoma do tecido hospedeiro. pode ser obtido o hormônio de crescimento. (adaptado de http://www. (2) Para que uma bactéria passe a produzir insulina humana. portanto.com.5. prática que.15.htm) Enquanto as demais células do organismo só podem fazer parte de um tecido específico. b) As células-filhas geradas são cromossomicamente e geneticamente iguais à célula-mãe inclusive no caso de haver gene "defeituoso". (4) A partir da insulina produzida por bactérias. d) A célula-tronco só pode ser obtida por clonagem terapêutica. Questão 1404 Células-tronco são células indiferenciadas que têm a capacidade de se diferenciar em diversos tipos celulares. e) sofrerem diferenciação que as torna parte integrante e funcional do tecido hospedeiro. Questão 1406 Observe o esquema. (3) O Biohulin será um medicamento destinado ao tratamento de diabéticos. a) As células-filhas geradas por ela são cromossomicamente e geneticamente diferentes da célula-mãe originando. Assinale a alternativa que aponta uma limitação do uso de célula-tronco para "possível e futura" cura de doenças genéticas. e) a estrutura de genes específicos por mutações.6 318 . b) a quantidade de genes nucleares. eliminando as possibilidades de rejeição imunológica. provoca mutações e malformações. tecidos diferentes daquele que se deseja. Para que ocorra tal diferenciação. b) eliminarem os genes causadores da doença no tecido hospedeiro. o "autotransplante". Questão 1405 Segundo a doutora Mayana Zats (USP) um estudo recente com células-tronco retiradas da medula e injetadas no coração da própria pessoa.

A alternativa que contém todas as afirmativas corretas é: a) I e II b) I e IV c) III e IV d) I. Questão 1409 Alguns tecidos do organismo humano adulto se regeneram constantemente por meio de um processo complexo e finamente regulado. II. Ele deseja descobrir maneiras de manipular os genes para obter melhores resultados terapêuticos ou estimular a formação artificial de tecidos. Questão 1407 BIÓLOGO MAPEIA GENES DO CORDÃO UMBILICAL. b) todos os seus genes estão desligados. c) têm algo grau de especialização. em cordões umbilicais e também em diversos tecidos no indivíduo adulto. vão reduzindo sua potencialidade.15. existem células-tronco capazes de dar origem a células diferenciadas de todos os tecidos humanos. puderam formar tecido normal quando implantadas na região lesada do coração. Isso acontece com a pele. e III e) II. Células tronco hematopoéticas apresentam potencial para diferenciar-se em qualquer célula do sangue e também gerar outras células tronco. Existe um aumento gradual da capacidade de auto-renovação das células durante este processo. As células tronco têm grande poder de regeneração porque: a) têm todos os seus genes funcionando. como mostra o esquema a seguir: 1. assinale a afirmativa INCORRETA.5. portador de lesão no miocárdio. também. I. b) Pelo menos 3 tipos de células diferenciadas no esquema dado são encontradas no sangue. com os epitélios intestinais e especialmente com o sangue. Baseado nas informações anteriores e nos conhecimentos sobre o tema. a) Células-tronco são células capazes de se diferenciar dando origem a diversos tipos de células. d) são pouco especializadas.Assinale a afirmativa INCORRETA. IV Questão 1410 Experimentos recentes indicam que células-tronco retiradas da medula óssea de um indivíduo adulto. b) A capacidade de diferenciação das células precursoras se deve à alteração na expressão gênica específica. A hematopoese resulta da diferenciação e da proliferação simultânea de células tronco que. Ele encontrou um grupo de genes que seguem um mesmo mecanismo e são mais ativos em células do cordão. c) Células-tronco podem ser encontradas em embriões. c) Plaquetas e hemáceas não apresentam capacidade de proliferação mitótica. II. Questão 1408 A pesquisa com células tronco tem-se tornado de grande importância para recuperação de órgãos lesionados que não têm capacidade de regeneração de suas células. As células-tronco podem ser retiradas. considere as afirmativas a seguir. à medida que se diferenciam. IV. a) A célula-tronco é pluripotente com capacidade de se diferenciar em diversos tipos celulares. que tem suas células destruídas e renovadas constantemente. de embriões em sua fase 319 . III.6 Um jovem biólogo de São Paulo descobriu porque as células-tronco do cordão umbilical são mais eficientes em transplantes do que as da medula óssea. 14/02/2006 Sobre esse assunto. d) Na medula óssea de um adulto. As diferentes linhagens hematopoéticas geradas no sistema apresentam altas taxas de proliferação. d) Apenas 2 das células diferenciadas apresentam núcleo. Fonte: "O Estado de São Paulo". e) não se reproduzem com facilidade. III.

6 Considerando o uso terapêutico das células-tronco. I . e) I. da raça Afgham.5. A origem do problema estava na produção de glóbulos vermelhos pela medula espinhal.adulta .08.As células-tronco retêm o potencial de dar origem a células-filhas mais especializadas. foi promulgada a Lei de Biossegurança. considere as seguintes afirmações. da raça Labrador. é possível obter um outro clone que seja fêmea. II e III. O animal clonado. II e III. Ao invés de adultos jovens. II. I. 320 1. recebeu o nome de Snuppy . e nasceu 60 dias após. c) o clone gerado terá o genótipo Afgham e o fenótipo Labrador e será do sexo masculino. c) Apenas I e II. apenas. Paulo".embrionária Questão 1411 Em março de 2005. respectivamente. Analise as hipóteses apresentadas pelos cientistas para tentar explicar esses casos incomuns. A tabela a seguir informa as características de algumas variáveis analisadas em células-tronco embrionárias e adultas.inicial de desenvolvimento. Sobre essas células.embrionária d) embrionária . e) I. isto é. Mais intrigante: a anemia dos idosos não cedia ao tratamento convencional. Questão 1413 Cientistas sul-coreanos clonam pela primeira vez um cachorro. d) I e II. posteriormente estimulado para que se dividisse e virasse um embrião dentro da mãe adotiva. que autoriza a pesquisa com células-tronco obtidas a partir de embriões humanos remanescentes de tratamentos de infertilidade armazenados por pelo menos três anos. é : a) embrionária . c) III. ("Folha de S.) A partir do texto e do que se conhece sobre clonagem. III. Questão 1412 Há vinte anos. como habitualmente. 03.adulta b) adulta . a alternativa que indica o tipo de célula que possui a característica mais vantajosa para as variáveis I. Considerando hipóteses plausíveis. .uma célula-tronco deve ter o poder de se renovar indefinidamente pela divisão celular. apenas. apenas. A origem do problema estava relacionada à degeneração do baço. Os cientistas tiraram material genético da célula e o colocaram em um óvulo esvaziado do seu núcleo. A origem do problema estava na produção de glóbulos vermelhos a partir de células-tronco da medula óssea. III . aquelas possíveis de serem aceitas pela comunidade científica. II .adulta c) embrionária . II e III. eram os idosos que apresentavam uma expressiva redução na taxa de hemoglobina. que nesses idosos deixou de produzir glóbulos vermelhos.A clonagem de células-tronco embrionárias pode ser utilizada com fins terapêuticos ou reprodutivos.adulta . podemos afirmar corretamente que: a) é possível obter células-tronco embrionárias usando-se células diferenciadas de um adulto. casos incomuns de anemia começaram a chamar a atenção dos pesquisadores. b) II. utilizando uma célula obtida da orelha do pai genético.2005.15. Quais estão corretas? a) Apenas I. b) usando o mesmo pai genético.embrionária .embrionária . apenas. estão corretas: a) I. b) Apenas II. d) Apenas II e III.

Com relação à surucucu. considere as afirmativas a seguir. Com o tratamento. c) doença do sono.d) o núcleo do óvulo inserido em uma célula de orelha anucleada origina uma fêmea Labrador. A doença parasitária a que esse texto se refere é a a) amebíase. arroz. que posteriormente recebeu o nome de 'Vibrio cholerae'. Questão 1415 Células-tronco vêm sendo utilizadas com sucesso para amenizar os sintomas de pacientes com insuficiência cardíaca devida a infarto do miocárdio. Recentemente. gorduras. usados como fonte na síntese 321 . Dentre as alternativas a seguir. Os órgãos envolvidos com a saúde pública têm mostrado preocupação constante com a dieta do povo brasileiro. pois elas serão degradadas em aminoácidos. legumes e verduras antes de comê-los. Dentre estes um dos mais temíveis e agressivos do gênero é a cobra surucucu. d) Lavar. podendo haver gangrena. As sementes resultantes devem apresentar embrião e endosperma. considere as proposições: 1 . assinale aquela que NÃO é medida de prevenção desta doença. 3 e 4 Questão 1417 Uma planta feminina de angiosperma com genótipo PP foi cruzada com uma masculina pp. 4 . II. e) o ambiente celular do Labrador alterou a expressão genotípica do núcleo transplantado. que o Brasil está se tornando um país de obesos. a) Beber somente água filtrada ou fervida. como proteínas. I. d) doença de Chagas. O prato tradicionalmente consumido pelo brasileiro apresenta elementos essenciais ao metabolismo. Questão 1414 A cólera é uma doença infecciosa causada por uma bactéria descoberta em 1884. pois o tradicional prato de "feijão. a) PP e pp b) Pp e Pp c) Pp e PPP d) Pp e PPp e) PP e Ppp Questão 1418 Os meios de comunicação têm noticiado. e) febre amarela. respectivamente. pesquisadores brasileiros da FIOCRUZ foram pioneiros em utilizar células-tronco da medula óssea de um paciente que apresentava insuficiência cardíaca devido a uma doença parasitária. Essa bactéria ataca o intestino humano fazendo com que o organismo elimine grande quantidade de água e sais minerais. especialmente no caso de se utilizar torniquetes. As proposições que estão corretas são as indicadas por: a) 2 e 3 b) 1. Estima-se que o consumo de feijão e de arroz caiu em torno de 30% nos últimos anos. muito bem. frutas. 3 .O princípio ativo do seu veneno provoca intensa dor no local da inoculação. causando desidratação. freqüentemente. as lesões coronarianas reduziram-se a um nível mínimo. carboidratos. c) Tomar vacina tríplice periodicamente.Seu veneno tem ação proteolítica e coagulante e o antiofídico específico é o soro antibotrópico. bife e salada" está sendo substituído por comidas industrializadas e com alto teor calórico.Pertence ao gênero Bothrops e seu veneno tem potente ação neurotóxica e coagulante. 2 e 4 c) 3 e 4 d) 1 e 4 e) 2. 2 . principalmente verduras e peixes. e com água limpa. b) Lavar as mãos com sabão antes das refeições e ao deixar o sanitário. A ingestão de proteínas é importante. Com base no texto e nos conhecimentos sobre o tema. Questão 1416 Um sério risco a que está exposto o trabalhador rural em nosso país é o de acidentes com animais peçonhentos. vitaminas e sais minerais. e) Evitar comer alimentos crus.Pertence ao gênero Crotalus e seu veneno tem ação neurotóxica e homolítica. b) malária.

cuja lesão pode levar à paralisia. ingerem os leucócitos em excesso. II . pois essas moléculas preservam. c) secretam substâncias que inibem o crescimento celular. Questão 1420 O tratamento da leucemia por meio dos transplantes de medula óssea tem por princípio a transferência de células-tronco da medula de um indivíduo sadio para o indivíduo afetado. era um ativista a favor das pesquisas com clonagem terapêutica para obtenção de células tronco. d) congênita. O sistema nervoso periférico poderá ficar inativo.A clonagem terapêutica por transferência nuclear permite a obtenção de blastocistos. Marque a alternativa correta. b) não serão afetadas pela doença. Questão 1422 A hemofilia se caracteriza por ser uma doença: a) adquirida. Tal procedimento fundamenta-se no fato de que essas células-tronco a) podem ser usadas para a clonagem de células sadias do paciente. c) II e III são corretas. d) I. III. na forma de energia química. e) o baço. analise as afirmativas a seguir. por sua vez. apenas no sistema nervoso central. d) Apenas III e correta. d) podem dar origem a linfócitos T que. 322 . Os ácidos nucléicos ingeridos são incorporados ao DNA do organismo. Estão corretas apenas as afirmativas: a) I e III. c) II e IV. Os carboidratos e lipídios da dieta são fonte importante de energia para os organismos. após um acidente. causada por um vírus e transmitida por mosquitos. e) podem dar origem a todos os diferentes tipos de células sangüíneas.das proteínas codificadas pelo organismo. Reeve. c) a hipófise. Questão 1421 Em outubro de 2004 faleceu o ator cinematográfico Christopher Reeve. a) I e II são corretas. d) o pâncreas. um paciente teve que se submeter a uma cirurgia que removeu uma parte do seu corpo. b) o diafragma. b) I e III são corretas. Recuperou-se e passou a viver normalmente. que causa má formação dos ossos. I . razão pela qual questiona-se o consumo de alimentos transgênicos. III e IV. que causa problemas de coagulação sanguínea. Com relação ao assunto abordado. se houver comprometimento no sistema nervoso central. de onde são retiradas células da massa celular interna (células tronco) que têm capacidade de regenerar órgãos lesados. o acidentado deve ser imobilizado na horizontal e utilizar um colar cervical para ser transportado até um hospital. II e III. c) infecciosa. que causa problemas de coagulação sanguínea. que ficou famoso por interpretar o "Super-Homem". A parte retirada era a) o fígado. se houver suspeita de lesão na coluna vertebral. cujo sintoma é o excesso de açúcar no sangue e a falta de insulina. Questão 1419 Após um traumatismo.Após um acidente como o ocorrido com Reeve. porque no interior da coluna vertebral está a medula óssea vermelha. já que foram diferenciadas em outra pessoa. b) I e IV.A utilização do colar cervical não evita lesões no sistema nervoso periférico. e) II. IV. boa parte da energia gasta para a sua síntese. que ficou tetraplégico em 1995 ao cair de um cavalo. b) hereditária. III . e) contagiosa.

de forma esquemática.Questão 1423 O sangue pode realizar várias funções no nosso corpo. São elas: a) composição química complexa e estado coloidal. especula-se sobre os mecanismos envolvidos na determinação do sexo dos humanos. Dentre elas. b) A destruição de bactérias que invadem o tecido conjuntivo depende de moléculas enzimáticas produzidas pelos glóbulos vermelhos. Nesse sentido. estes são distribuídos entre os espermatozóides.10. b) elevado grau de organização e execução das funções vitais. comprovou-se que a determinação do sexo decorre de uma constituição cromossômica específica. onde os pais muitas vezes optam pelo nascimento de um único filho do sexo masculino. que determinam uma maior longevidade para o indivíduo. Com base nos conhecimentos sobre o tema. c) O tecido conjuntivo.11 ssinale a afirmativa INCORRETA. divisão celular e comportamento dos cromossomos na meiose. c) A probabilidade de o genitor masculino produzir gametas do tipo Y é maior que a do tipo X. invadido por células sangüíneas e bactérias. e) capacidade de reprodução e hereditariedade. duas dessas características assumem maior importância para a preservação da vida no planeta. quando ocorre a fusão dos núcleos masculino e feminino. b) Os cromossomos autossômicos são os responsáveis pela determinação do sexo genético do indivíduo. d) O embrião XX desenvolverá testículos e o embrião XY desenvolverá ovários. Questão 1425 Desde a época de Aristóteles. pois envolve um grupo de células especializadas. Acreditava-se que o sexo do embrião era definido por fatores como a nutrição materna. Questão 1424 Embora a continuidade da vida na Terra dependa substancialmente de todo o elenco de características que definem os sistemas viventes. ( ) O exame de urina da mãe é uma técnica usada na identificação do sexo do futuro bebê. ( ) Na espécie humana o sexo da prole é determinado pelo pai. como ocorre na China. pode apresentar um quadro inflamatório. Essa escolha é importante para estes casais uma vez que a constatação de um feto do sexo feminino pode provocar a decisão de um aborto não-natural. que apresenta os cromossomos sexuais X e Y no núcleo de suas células germinativas. a de defesa contra microrganismos é realmente notável. após a meiose. d) Os glóbulos brancos que saem dos capilares podem realizar fagocitose. um modo como essas células do sangue podem realizar seu papel de defesa. ( ) A tentativa de aborto por meio da ingestão de poções 323 1. c) manutenção da homeostase e alto nível de individualidade. porque detecta as células fetais existentes no líquido amniótico e na placenta. . é correto afirmar: a) O sexo genético é determinado na fecundação. d) consumo de energia e renovação contínua da matéria. a) Os neutrófilos são glóbulos brancos capazes de atravessar as paredes dos capilares sangüíneos. A figura a seguir mostra. e) O sexo genético é determinado pelo número de cromossomos X presentes no embrião. analise as afirmativas adiante: ( ) A opção por indivíduos do sexo masculino pode ser justificada por sua menor suscetibilidade a doenças genéticas e por apresentarem um par de genes localizados nos cromossomos X e Y. identificando a presença do cromossomo sexual por meio da análise do citoplasma. Questão 1426 Atualmente muitos casais têm-se interessado em escolher o sexo do futuro filho. processo que engloba bactérias invasoras. A partir dos estudos sobre herança mendeliana.

33. e) do RNA in vitro. Esta vacina consiste do antígeno de superfície do vírus da hepatite B produzido em células de levedura. (Adaptado de Anita D. Isto só é possível graças à tecnologia a) de clonagem de organismos. p. 324 . Panek. v. como contra a hepatite B. são as do gênero 'Saccharomyces'. Questão 1427 A levedação do pão e a fermentação alcoólica são as primeiras tecnologias de que se têm notícia. b) de células-tronco. Um suco de uva transforma-se em vinho e um repelente mingau de cevada e centeio torna-se uísque ou cerveja.vegetais ou de outras drogas abortivas pode não eliminar o feto. em um processo usado há milênios pela humanidade para obter alimento e prazer. Em todos esses casos o 'trabalho' é feito por uma levedura (um tipo de fungo). As leveduras mais usadas hoje. c) do DNA recombinante. mas promover a má-formação do corpo do bebê e comprometer a saúde da mãe. d) do teste do DNA. no 195.62) Atualmente as leveduras têm sido usadas para produzir vacinas. julho de 2003. na fabricação tanto de pães quanto de vinhos. Ciência Hoje.

Sign up to vote on this title
UsefulNot useful