P. 1
Exercicios de Genética

Exercicios de Genética

|Views: 52.375|Likes:
Publicado porVicthor Sartório
Genetica Biologia Ensino Médio Questões Vestibular
Genetica Biologia Ensino Médio Questões Vestibular

More info:

Categories:Types, School Work
Published by: Victhor Sartório on Apr 23, 2013
Direitos Autorais:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

11/01/2015

pdf

text

original

Título: A maior lista de genética da história!

Professor: André Braga Turma: AeB
Questão 1 O texto que se segue foi extraído de "Xadrez, truco e outras guerras", de José Roberto Torero. Servimos-nos de algumas de suas estruturas para introduzir a(s) questão(ões) seguintes. "Os abutres, sábios animais que se alimentavam do mais farto dos pastos, já começavam a sobrevoar a ala dos estropiados quando o General mandou que acampassem. Naquela tarde assaram trinta bois, quantidade ínfima para abastecer os homens que ainda sobravam.... O plano dos comandantes era assaltar fazendas da região e tomar-lhes o gado... À noite a ração foi ainda mais escassa, e, para enganar a fome, fizeram-se fogueiras para assar as últimas batatas e umas poucas raízes colhidas pelo caminho. Como o frio também aumentava, surgiu um impasse: quem ficaria perto do fogo: os coléricos, que logo morreriam, ou os sãos, que precisavam recuperar as forças para a luta?" (TORERO, J. Roberto. "Xadrez, truco e outras guerras") "(...) os coléricos, que logo morreriam, ou os sãos, que precisavam recuperar as forças para a luta?" Muitas doenças podem provocar a morte. a) A afirmação "os coléricos, que logo morreriam" é falsa ou verdadeira? Justifique. b) Justifique e exemplifique: Muitas doenças são hereditárias e sua manifestação está na dependência da ação de genes específicos ou de alterações cromossômicas. Questão 2 O texto abaixo refere-se às questões: 2 a 3 O experimento clássico de Meselson e Stahl, em 1957, demonstrou que a replicação do DNA era semiconservativa, ou seja, cada fita do DNA serve de molde para sua própria duplicação, formando moléculas de DNA idênticas à original. Nesse experimento, os cientistas cultivaram células de 'Escherichia coli' inicialmente em presença de fonte de ¢¥N (isótopo de nitrogênio leve), trocando, a seguir, por ¢¦N (isótopo pesado), que é incorporado às bases nitrogenadas do DNA. Colheram, então, amostras de DNA após a primeira e a segunda gerações de células crescidas em ¢¦N e analisaram essas amostras quanto à densidade do DNA formado. Considere como PESADO o DNA dupla hélice marcado com ¢¦N; como LEVE o marcado com ¢¥N; como INTERMEDIÁRIO o marcado com ¢¥N e ¢¦N. Justifique por que, após a troca da fonte de nitrogênio, a primeira geração de células foi totalmente constituída com DNA dupla hélice do tipo INTERMEDIÁRIO. Questão 3 Calcule as proporções dos três tipos de DNA dupla hélice LEVE, INTERMEDIÁRIO E PESADO - formados em células da segunda geração, após a troca da fonte de nitrogênio. Questão 4 "O agronegócio responde por um terço do PIB, 42% das exportações e 37% dos empregos. Com clima privilegiado, solo fértil, disponibilidade de água, rica biodiversidade e mão-de-obra qualificada, o Brasil é capaz de colher até duas safras anuais de grãos. As palavras são do Ministério da Agricultura e correspondem aos fatos. Essa é, no entanto, apenas metade da história. Há uma série de questões pouco debatidas: Como se distribui a riqueza gerada no campo? Que impactos o agronegócio causa na sociedade, na forma de desemprego, concentração de renda e poder, êxodo rural, contaminação da água e do solo e destruição de biomas? Quanto tempo essa bonança vai durar, tendo em vista a exaustão dos recursos naturais? O descuido socioambiental vai servir de argumento para a criação de barreiras não-tarifárias, como a que vivemos com a China na questão da soja contaminada por agrotóxicos?" (Adaptado de Amália Safatle e Flávia Pardini, Grãos na Balança. "Carta Capital", 01/09/2004, p. 42.) A contaminação por agrotóxicos também é mencionada no texto. A aplicação intensiva de agrotóxicos a partir da década de 1940 aumentou a produtividade na agricultura. Atualmente, são produzidas e cultivadas plantas
1

transgênicas, isto é, geneticamente modificadas para serem resistentes à ação de insetos. Um exemplo conhecido é o milho geneticamente modificado com um gene da bactéria 'Bacillus thuringensis' (Bt), o que lhe confere resistência a ataques de insetos. Contudo, alguns pesquisadores têm observado que diferentes espécies de insetos adquirem resistência às toxinas bioinseticidas produzidas por essas plantas. a) Explique como os insetos se tornam resistentes. b) Sabe-se que a aplicação intensiva de agrotóxicos, como o DDT, pode afetar a cadeia alimentar tanto de ambientes aquáticos como de solos. Explique por que isso ocorre. Questão 5 Atualmente, um grande esforço tem sido feito por diversos centros de pesquisa e de tratamento de pessoas queimadas para produzir grandes áreas de pele, do próprio indivíduo, que possam recobrir imediatamente áreas destruídas. Explique a vantagem de se utilizar a pele do próprio indivíduo para recobrir as áreas destruídas, ao invés de serem utilizados enxertos de pele de outras pessoas. Questão 6 O desenho a seguir mostra a síntese de um polipeptídio a partir da molécula de DNA num certo organismo. Esse organismo é um procarioto ou um eucarioto? Por quê?

b) A clonagem de bactérias, comparada à clonagem de animais, é um processo mais complexo ou mais simples? Justifique. Questão 8 O gráfico a seguir demonstra a distribuição citoplasmática do número de ribossomas isolados e polirribossomas, em comparação com o número de cadeias polipeptídicas em formação durante um certo período de tempo.

1.1.3.2

(Adaptado de ALBERTS, Bruce & outros. "Molecular biology of the cell". New York, Garland Publishing, 1994, p.239) a) Defina a relação existente entre os ribossomas isolados e a formação das cadeias polipeptídicas. Justifique sua resposta. b) Descreva a estrutura das cadeias polipeptídicas e a dos polirribossomas. Questão 9

1.1.1.2 Um certo tipo de macromolécula destinada à membrana plasmática celular, depende de etapas nucleares e citoplasmáticas para sua produção, de acordo com os percursos esquematizados a seguir:

Questão 7 Nas bactérias, a cadeia respiratória encontra-se associada à membrana plasmática e os ácidos nucléicos estão associados ao citoplasma. a) É assim também em um protista, em um animal e em um vegetal? Justifique.
2

Questão 12 Ribossomos são formados por RNA e proteínas, sintetizados pelos processos de transcrição e tradução, respectivamente. a) Onde esses processos ocorrem na célula eucariótica? b) O que acontecerá com os processos de transcrição e tradução, se ocorrer uma inativação na Região Organizadora do Nucléolo? Justifique. Questão 13 a) Por que essas etapas começam no núcleo? b) Qual é a composição da macromolécula ao final do percurso I? E do percurso II? Esclareça a diferença, baseando-se nas funções das organelas citoplasmáticas envolvidas em cada percurso. Questão 10 Uma espécie de lombriga de cavalo possui apenas um par de cromossomos no zigoto (2n=2). Um macho dessa espécie, heterozigótico quanto a dois pares de alelos (Aa Bb) formou, ao final da gametogênese, quatro tipos de espermatozóides normais com diferentes genótipos quanto a esses genes. a) Qual é o número de cromossomos e o número de moléculas de DNA no núcleo de cada espermatozóide? b) Quais são os genótipos dos espermatozóides formados? c) Por que, a partir das informações fornecidas, não é possível estimar a proporção em que cada um dos quatro tipos de espermatozóides aparece? Explique. Questão 11 Uma mulher com a idade de 40 anos está grávida do primeiro filho. Ela sabe que, devido à sua idade, o bebê tem maior probabilidade de ser portador de alguma anomalia cromossômica. A cariotipagem pré-natal é o exame mais indicado para esclarecer estas dúvidas na fase uterina. Pergunta-se: a) Em que consiste este exame? b) Que exemplos de anomalias cromossômicas podem ser detectadas através deste exame (cite dois exemplos). Criadores e sitiantes sabem que a mula (exemplar fêmea) e o burro (exemplar macho) são híbridos estéreis que apresentam grande força e resistência. São o produto do acasalamento do jumento ('Equus asinus', 2n = 62 cromossomos) com a égua ('Equus caballus', 2n = 64 cromossomos). a) Quantos cromossomos têm o burro ou a mula? Justifique sua resposta. b) Considerando os eventos da meiose I para a produção de gametas, explique por que o burro e a mula são estéreis. Questão 14 Considere as duas fases da meiose, de um organismo com 2n=6 cromossomos, esquematizadas a seguir e responda:

1.1.3.2

1.1.5.2

a) Que fases estão representadas na figura A e na B? Justifique. b) Que tipo de alteração aparece em uma das figuras? Em relação aos cromossomos, como serão as células resultantes de um processo de divisão com essa alteração? c) Dê um exemplo de anomalia que seja causada por este tipo de alteração na espécie humana, cujo número normal de cromossomos é 2n = 46.

3

Questão 15 O gato siamês é um animal de rara beleza pois a pelagem de seu corpo é clara com extremidades - orelhas, focinho, pés e cauda - pretas. A presença do pigmento que dá a cor negra a essas extremidades é o resultado da atividade de uma enzima que fica inativada acima de 34°C. Explique por que esses animais têm a pelagem negra nas extremidades do corpo. Questão 16 Desde 1995 alguns estados norte-americanos estão excluindo o ensino da teoria de evolução biológica dos seus currículos escolares alegando, entre outras razões, que ninguém estava presente quando a vida surgiu na Terra. Alguns cientistas defendem a teoria da evolução argumentando que, se é necessário "ver para crer", então não poderemos acreditar na existência dos átomos, pois estes também não podem ser vistos. (Adaptado da "ISTO É", 25/08/1999.) a) Apresente três evidências que apóiam a teoria da evolução biológica. b) A mutação gênica é considerada um dos principais fatores evolutivos. Por quê? Questão 17 Dois 'loci' de uma população, cada um com dois gens alelos, sofrem a ação da seleção natural por muitas gerações, como é mostrado nas tabelas abaixo. O coeficiente de seleção (S) indica os valores com que a seleção natural atua contra o genótipo. O valor adaptativo (W) representa os valores com que a seleção natural favorece o genótipo. Note que (W+S)=1. Qual dos gens, A‚ ou B‚, apresentará a maior freqüência na população? Explique. Questão 18 No porquinho-da-índia existe um par de genes autossômicos que determina a cor da pelagem: o alelo dominante B determina a cor preta e o recessivo b, a cor branca. Descreva um experimento que possa evidenciar se um porquinho preto é homozigoto ou heterozigoto. Questão 19 Nos porquinhos-da-índia, a pelagem negra é dominante sobre a pelagem branca. Um criador tem um lote de porquinhos-da-índia negros, com o mesmo genótipo. O que deve fazer para descobrir se esses animais são homozigotos ou heterozigotos? Justifique sua resposta. Questão 20 Uma anomalia genética autossômica recessiva é condicionada por uma alteração na seqüência do DNA. Um homem portador dessa anomalia apresenta a seqüência timina-citosina-timina enquanto sua mulher, que é normal, apresenta a seqüência timina-adenina-timina. A análise do DNA de um filho do casal mostrou que ele é portador tanto da seqüência de bases do pai quanto da mãe. a) O filho terá a doença? Por quê? b) Qual a probabilidade de um outro filho do casal apresentar as duas seqüências iguais à da mãe? Questão 21 Um homem afetado por uma doença genética muito rara, de herança dominante, casa-se com uma mulher, não consangüínea. Imagine que o casal tenha doze descendentes, seis filhos e seis filhas. Responda,
4

1.4.1.6

justificando sua resposta, qual será a proporção esperada de filhas e filhos afetados pela doença do pai no caso do gene em questão estar localizado. a) em um autossomo; b) no cromossomo X. Questão 22 Em ervilhas o caráter semente lisa é condicionado por um gene dominante R e semente rugosa pelo seu alelo recessivo r. Quais são as proporções genotípica e fenotípica obtidas na autofecundação de uma variedade comprovadamente heterozigota? Questão 23 "Hormônios são proteínas cuja função é regular os complicados mecanismos do organismo - como o aumento e redução do peso do corpo (...) Em outubro, o geneticista Jeffrey Friediman (...) isolou o primeiro hormônio capaz de controlar o peso, chamado leptina. Ele é produzido por um gene que, quando funciona mal, o organismo ganha peso (...)". (In: "Superinteressante" - ano 10, nŽ 3, mar., 1996.) Com base no texto, RESPONDA: a) Como se denomina o local que o gene ocupa no cromossomos? b) Considerando de forma simplificada a existência de dois alelos para o gene da leptina, um normal (L) e outro mutante (L'), quantos genótipos diferentes são possíveis em humanos diplóides? Quais são eles? c) COMENTE sobre um mecanismo que pode levar à mutação gênica. Questão 24 No início do século XX, a transmissão das informações genéticas para os descendentes era explicada por algumas hipóteses sobre as leis da hereditariedade, como a mendeliana e a por mistura. Observe os esquemas:

1.5.1.1

Suponha que, em um indivíduo de uma população com reprodução sexuada, apareça, por mutação, um gene raro que confira ao seu portador características vantajosas. Indique, para cada uma das hipóteses representadas, se há ou não possibilidade de aumento da freqüência do gene mutante na descendência desse indivíduo e justifique suas respostas. Questão 25 Leia o texto a seguir. "A Doença de Alzheimer (D.A.) (...) é uma afecção neurodegenerativa progressiva e irreversível, que acarreta perda de memória e diversos distúrbios cognitivos. Em geral, a D.A. de acometimento tardio, de incidência ao redor de 60 anos de idade, ocorre de forma esporádica, enquanto que a D.A. de acometimento precoce, de incidência ao redor de 40 anos, mostra recorrência familiar. (...) Cerca de um terço dos casos de D.A. apresentam familiaridade e comportam-se de acordo com um padrão de herança monogênica autossômica dominante. Estes casos, em geral, são de acometimento precoce e famílias extensas têm sido periodicamente estudadas." Smith, M.A.C. (Revista Brasileira de Psiquiatria, 1999) Considerando o texto e o histórico familiar a seguir, responda ao que se pede. Histórico familiar: "Um rapaz cujas duas irmãs mais velhas, o pai e a avó paterna manifestaram Doença de Alzheimer de acometimento precoce."

5

b) aa x aa c) aa x Aa d) Aa x Aa e) Aa x AA 1.5.1.1 Questão 28 No gado bovino da raça Ayrshire a cor mogno é determinada pelo genótipo A A e a cor vermelha pelo genótipo A‚ A‚, mas o genótipo A A‚ é mogno nos machos e vermelho nas fêmeas. Com base nessas informações, qual é o sexo de um filhote vermelho, cuja mãe é uma vaca mogno? Justifique a sua resposta. Questão 29 A formação de uma característica fenotípica depende, em alguns casos, apenas de fatores genéticos. Em outros casos, prevalece a influência de fatores ambientais. Na maioria das vezes há uma interação entre fatores genéticos e ambientais. Um dos métodos utilizados para avaliar a importância relativa dos genes e dos fatores ambientais na formação de uma característica é o estudo comparativo entre irmãos gêmeos monozigóticos criados juntos e criados separados. A tabela a seguir, elaborada a partir de um grande número de pares de gêmeos, indica o grau de concordância de quatro características. Uma concordância significa que quando um irmão possui a característica, o outro também a possui.

I. Montar o heredograma para o histórico familiar apresentado. II. Qual a probabilidade de o rapaz em questão também ser portador do gene responsável pela forma de acometimento precoce da doença? III. Quais indivíduos do heredograma são seguramente heterozigotos para esse gene? IV. Explicar o padrão de herança mencionado no texto. Questão 26 Mendel não acreditava na mistura de caracteres herdados. De acordo com suas conclusões, a partir dos cruzamentos realizados com ervilhas do gênero 'Pisum', as características não se misturam, permanecem separadas e são transmitidas independentemente. HENIG, Robin. "O monge no jardim". Rio de Janeiro: Rocco, 2001. a) Considerando as leis de Mendel para a hereditariedade, no momento da fecundação os cromossomos herdados dos progenitores se juntam, porém os alelos dos seus genes não se misturam. A partir dessa idéia, qual fenômeno explicaria a ocorrência de características intermediárias na progênie, que parecem ser uma mistura daquelas dos progenitores? b) Posteriormente, estudos de grupos de geneticistas indicaram que pode haver troca de material genético entre cromossomos homólogos herdados do pai e da mãe. Em que etapa isso pode ocorrer e como se chama este processo? Questão 27 Determine as probabilidades de aparecerem indivíduos afetados (aa), normais (AA) e heterozigotos (Aa), nas proles dos casamentos: a) aa x AA

1.5.1.1

Indique a característica que mais depende de fatores ambientais. Justifique sua resposta.

6

Justifique sua resposta.5. Este camundongo transgênico foi cruzado com uma fêmea de camundongo normal.1. mas heterozigoto para o albinismo. Após algum tempo. realizou um experimento em que sementes dessa espécie. a produtividade dessas plantas foi medida e apresentou os seguintes resultados: . quem engravidou e deu à luz foi a mãe da referida mulher. impossibilitada de ter filhos por anomalia no útero. à medida que a altitude se aproximava do nível do mar. a produtividade era muito baixa.1. quando o genótipo é recessivo. Ele. então. Assim. Qual a probabilidade desse casal ter: a) quatro crianças albinas? b) uma criança albina e do sexo feminino? c) uma criança normal. A célula-ovo transgênica se desenvolveu. heterozigota e do sexo masculino? d) Represente o provável heredograma desse casal. admitindo-se que as suposições feitas nas letras (b) e (c) realmente se concretizem. foram plantadas ao nível do mar em idênticas condições ambientais. Questão 33 A mamona ('Ricinus communis') produz inflorescências contendo somente flores pistiladas (flores femininas).Questão 30 Um pesquisador teve sucesso na integração de uma cópia do gene que codifica o hormônio do crescimento de rato (HCR) em um dos cromossomos autossômicos de uma célula-ovo de camundongo. os meios de comunicação noticiaram o caso de uma mulher norte-americana que. coletadas em diversas altitudes. que tipos de inflorescências serão produzidas nos descendentes dos seguintes cruzamentos: a) NN x Nn? b) Nn x Nn? Questão 34 Recentemente. Com base nessas afirmações. 1. e este foi implantado no útero de sua mãe. isto é. quando o genótipo é homozigoto dominante ou heterozigoto. solicitou aconselhamento genético sobre a possibilidade de vir a ter crianças apresentando a condição albina. teve seu óvulo fertilizado "in vitro". e inflorescências mistas (flores femininas e flores masculinas). Em grandes altitudes. 7 Calcule a proporção esperada da prole destes camundongos que será portadora do gene que codifica o HCR. Questão 32 Um determinado casal normal. não portadora do gene HCR. a produtividade aumentava.1 Identifique se é o componente genético ou o componente ambiental que predomina no condicionamento da produtividade dessas plantas. dando origem a um camundongo macho.5.1 1. Questão 31 Um pesquisador observou que uma certa espécie de planta apresentava uma grande variação de produtividade relacionada à altitude onde a planta se desenvolvia. Justifique sua resposta.

Considere o cruzamento de gatos homozigotos brancos e marrons. em vez de transplantar o ovário. observou que alguns dos animais de sua criação apresentavam uma característica incomum nos chifres. Sabendo que a característica "lisa" das sementes da ervilha é determinada por um alelo dominante L. que. são então cruzadas e produzem os híbridos. a) planeje um cruzamento experimental entre flores de exemplares diferentes que lhe permita determinar se uma planta que produz sementes lisas é homozigota ou heterozigota para esse caráter. Nesses programas são desenvolvidas linhagens homozigotas por meio de sucessivas gerações autofecundadas. as cores marrom e branca dos pelos têm sido descritas como devidas a. depois de muitos anos nesse ramo. a) Esses indivíduos híbridos são geneticamente iguais entre si? Explique. c) Se fosse possível implantar os pêlos da fêmea preta na fêmea albina. como você explica esse resultado? b) Indique os genótipos da fêmea preta e da prole. sabendo ainda. Questão 39 Em várias culturas vegetais. portanto por genótipos LL ou Ll e. os programas de melhoramento utilizam a heterose (vigor do híbrido). pesquisadores observaram que essas plantas apresentavam um gradiente decrescente de tamanho. o animal foi cruzado com um macho albino e deu origem a uma prole toda preta. Sementes dessas plantas foram coletadas nas várias altitudes e plantadas em uma mesma região localizada ao nível do mar. o resultado não será o mesmo. são mais vigorosos e mais produtivos que os parentais.Responda: a) Do ponto de vista genético. em geral. a) Sabendo-se que o albinismo é característica recessiva. Como o criador poderia fazer para determinar se essa variação é decorrente de uma mutação genética ou de uma alteração causada por fatores ambientais? Questão 38 Em experimento feito no início do século. a) Explique o resultado obtido. um par de genes. o resultado seria o mesmo? Justifique. expresso no gráfico A. homozigotas para alelos diferentes. sementes rugosas. que as flores são hermafroditas e que sementes produzidas por autofecundação são viáveis. quem é a mãe da criança? Justifique. b) Qual a porcentagem de genes herdados da parturiente que se encontram no patrimônio genético da criança? Questão 35 Em gatos. as plantas resultantes foram medidas e os dados obtidos no experimento são mostrados no gráfico A. Qual a proporção fenotípica esperada em F se a) o modo de herança for do tipo dominante? b) o modo de herança for do tipo co-dominante? Questão 36 Suponha que você tenha em seu jardim exemplares da mesma espécie de ervilha utilizada por Mendel em seus experimentos. qual seria a interpretação? 8 . pelo menos. b) Se o resultado do experimento tivesse sido o representado no gráfico B. Alguns desses exemplares produzem sementes lisas e outros. qual seria a proporção esperada de descendentes com sementes rugosas? Questão 37 Um criador de cabras. Duas linhagens. Por quê? Questão 40 Ao estudar a distribuição de uma espécie de planta da família dos girassóis em altitudes crescentes na costa oeste dos Estados Unidos. dois pesquisadores retiraram os ovários de uma cobaia albina e implantaram-lhe um ovário obtido de uma cobaia preta. b) No caso de ocorrer autofecundação em uma planta que produz sementes lisas e é heterozigota. b) Se o agricultor utilizar as sementes produzidas pelo híbrido nos plantios subsequentes. Mais tarde. Após um determinado tempo de crescimento.

Foram realizados quatro tipos de cruzamento entre plantas dessa espécie e obtidos e seguintes resultados: 1. Essa última forma geralmente culmina em morte antes de atingir a idade reprodutiva.1. A (dominante. (a) talassemia menor.5. oval ou redonda.a flor de cor branca nunca se abre.1. Questão 43 A talassemia é um defeito da hemoglobina em seres humanos.1.2 Questão 44 Considere uma certa espécie de planta que pode apresentar flores com três tipos de cor: azul. A partir do heredograma hipotético a seguir onde os símbolos claros representam pessoas normais. sendo que a manifestação em homozigose de um dos alelos . Estas cores são determinadas por combinações de dois alelos de um único locus. entre outros sintomas. azul-claro e branca. verificando se elas têm fundamento. a talassemia menor e os pretos a talassemia maior. 9 1. determine o modo de herança indicando os possíveis genótipos dos indivíduos envolvidos. Na expressão fenotípica de tais cores não há relação de dominância entre os alelos. os hachurados.é letal na fase adulta. Questão 42 Em uma espécie de planta a forma dos frutos pode ser alongada.em um jardim de plantas com flores de cor azul não nascem plantas com flores de cor azul-claro. Justifique sua resposta. Ela ocorre em duas formas. b) Afirmação de um casal de olhos castanhos: "nosso bebê poderá ter olhos azuis porque o avô paterno tem olhos azuis". determinando cor castanha) e a (recessivo. .5. e (b) talassemia maior. determinando cor azul). analise as afirmações abaixo.1.2 .1 a) Formule uma hipótese consistente com os resultados obtidos para explicar a herança da forma dos frutos nessa espécie. proferidas por casais em relação à cor dos olhos de seu bebê. na qual os eritrócitos são pequenos (microcitemia) e em grande número (policitemia). caracterizada por uma anemia severa. a) Afirmação de um casal de olhos azuis: "nosso bebê poderá ter olhos castanhos porque as avós têm olhos castanhos". Baseando-se nessa explicação. microcitemia e policitemia. mas a saúde é essencialmente normal. Questão 41 A herança da cor do olho na espécie humana geralmente é representada simplificadamente como um par de alelos.aa. cor branca . Sabe-se que: . b) Represente os alelos por letras e indique os genótipos dos indivíduos parentais e dos descendentes no cruzamento IV.5. aumento do baço.

às vezes só origina prole sem chifres.5. A e A‚. Questão 45 Em rabanetes. Em cruzamentos desses indivíduos ovalados entre si. c) Os indivíduos de cada um dos genótipos não se comportam da mesma forma quanto à resistência ao inseticida e. Determine a cor das flores que têm maior possibilidade de se abrirem neste jardim. como o fazendeiro deverá proceder para estabelecer uma linhagem pura de animais brancos e sem chifres? Por que ele não conseguirá resolver o problema dos chifres rapidamente? Questão 47 O gráfico a seguir mostra a mortalidade de mosquitos de uma determinada espécie quando expostos a diferentes concentrações de um inseticida. Entretanto. Considere um casal de anões pseudo-acondroplásicos. para responder às seguintes questões: 10 . aparecem os dois tipos em igual número. e o cruzamento de animais com chifres versus animais sem chifres. a partir das sementes obtidas. Questão 46 Em gado. provocando aborto precocemente. A princípio. Antes que as sementes germinassem. a cor da pelagem vermelha. ou seja. 1. A resistência ou susceptibilidade ao inseticida é devida a um locus com dois alelos. na sua sementeira. é controlada por genes codominantes. Determine a cor das flores que têm menor possibilidade de se abrirem neste jardim. foram obtidas quatrocentas sementes que foram plantadas em sementeiras individuais. a forma da raiz é determinada por um par de genes alelos.2 a) Qual é o genótipo mais resistente? Como você chegou a essa conclusão? b) Observando as três curvas. foi considerado que a severidade do alelo dominante. pensou-se que o fenótipo anão seria expresso pelo genótipo D/D ou D/d. Justifique a resposta. ruões. Cruzamentos entre plantas de raízes alongadas com plantas de raízes arredondadas produziram apenas indivíduos com raízes ovaladas. b) Realizaram-se os cruzamentos possíveis entre as plantas com flores das cores mencionadas. sem recorrer à inseminação artificial. e. a) Qual a relação de dominância entre os caracteres em questão? b) Qual a probabilidade de que.1. as sementeiras foram distribuídas a diversas pessoas. ovalado ou alongado. formou-se outro jardim. que conclusão se pode tirar sobre as relações de dominância entre os alelos deste locus? Explique. ruão e branca. venha a se desenvolver um rabanete de raiz ovalada? Justifique a sua resposta. Utilizando apenas cruzamentos naturais. Um fazendeiro tem uma grande boiada constituída de animais vermelhos. Os fenótipos formados são três: arredondado. Questão 48 A pseudo-acondroplasia é um tipo de nanismo determinado geneticamente pelo alelo D autossômico dominante que interfere no crescimento dos ossos durante o desenvolvimento. brancos e sem chifres. você recebeu uma delas.a) Realizou-se o cruzamento entre as plantas com flores azul-claro e. ocasionalmente produzem prole com chifres. os pontos distribuem-se ao longo da curva. A partir das sementes obtidas. produz efeito letal durante o desenvolvimento embrionário. quando em dose dupla. os quais. formou-se um jardim. Justifique a resposta. Essas diferenças podem ser atribuídas a efeitos pleiotrópicos de outros genes? Justifique sua resposta utilizando o conceito de efeito pleiotrópico. por isso. presentes em igual quantidade. em outros cruzamentos.

com 3 meninas e 2 meninos. O cruzamento de dois gatos Manx produziu dois gatinhos Manx para cada gatinho normal de cauda longa (2:1). onde o alelo (A) condiciona a cor amarela em camundongos e é dominante sobre o alelo (a). e seu alelo c recessivo. a) A partir de 20 ovos. Questão 51 Gatos Manx são heterozigotos para uma mutação que resulta na ausência de cauda (ou cauda muito curta). como seria esperado pela genética mendeliana. qual é a probabilidade que se espera para este evento? e) Em uma outra família. a) Qual a explicação para esse resultado? b) Dê os genótipos dos parentais e dos descendentes. (Utilize as letras B e b para as suas respostas). presença de pernas traseiras grandes e um andar diferente dos outros. responsável pela coloração amarela. porém. que condiciona a cor cinza. b) A partir de 40 ovos.5. CRUZAMENTO I (Aa × Aa) 240 amarelos 120 cinzas CRUZAMENTO II (Aa × aa) 240 amarelos 240 cinzas Analise os resultados destes cruzamentos e responda. quantos machos cinzas deverão atingir a idade adulta? Justifique. Um geneticista observou que o cruzamento de ratos de pelagem amarela com ratos de pelagem cinza resultou descendentes amarelos e cinzas em igual proporção.4 11 . quantas fêmeas amarelas adultas são esperadas? Justifique. a cor da pelagem é condicionada por gene autossômico. dominante. originados do cruzamento entre ratos amarelos. em um eventual quarto nascimento. originados do cruzamento de machos amarelos e fêmeas cinzas. o cruzamento de ratos amarelos entre si produziu 2/3 de descendentes de pelagem amarela e 1/3 de descendentes de pelagem cinza. todos apresentando a pseudo-acondroplasia. Questão 52 O heredograma a seguir representa uma família com pessoas afetadas por uma doença hereditária.1.a) Quais são os genótipos de cada indivíduo do referido casal? b) Caso a mulher deste casal venha dar à luz uma criança. 1. sendo o gene C. qual é a probabilidade de. a) Qual cruzamento apresenta resultado de acordo com os valores esperados? b) Como você explicaria o resultado do cruzamento em que os valores observados não estão de acordo com os valores esperados? Questão 50 Em ratos. a criança nascer também afetada? d) Se o casal tem planos para ter uma menina normal em relação a esta condição genética. qual é a probabilidade dela nascer geneticamente com a pseudo-acondroplasia? c) Como o casal já tem três crianças com a pseudo-acondroplasia. responsável pela coloração cinza. em vez de três para um (3:1). quantas destas crianças são homozigotas no loco correspondente a este tipo de nanismo? Questão 49 Observe os cruzamentos a seguir.

4 Questão 56 A figura a seguir.1.4 1.5.5.a) A doença tem herança dominante ou recessiva? Por quê? b) A doença tem herança autossômica ou ligada ao cromossomo X? Por quê? Questão 53 Analisando a genealogia adiante. de uma característica expressa em antepassados remotos? b) O albinismo se deve a alelo dominante ou a alelo recessivo? Explique com base na figura. na Família de Raimundo e Eleílde da Silva.5.1. c) Qual a probabilidade de os indivíduos de pigmentação normal da geração V serem todos heterozigotos? Questão 57 Questão 55 No heredograma a seguir os símbolos cheios representam indivíduos portadores de uma anomalia genética. de geração. de acordo com a presença ou ausência do 12 1. responda: anomalia? 1.2.3 e V . situada a oeste de São Luís.1.6. a) Qual a probabilidade de o indivíduo 3 ser heterozigoto? b) Qual a probabilidade de o indivíduo 5 ser homozigoto recessivo? c) Qual a probabilidade de o indivíduo 6 ser homozigoto dominante? Questão 54 1. adaptada da Folha de São Paulo de 17/03/96. na população.1. mostra a transmissão do albinismo. Sabendo-se que.4 . a freqüência de heterozigoto para o albinismo é de 1/50. um grupo de cientistas do "Genetics & IVF Institute" vem testando um novo método que permite a seleção dos espermatozóides a partir de sua coloração. moradores da ilha dos Lençóis. numa dada geração. V .5 são albinos. Os indivíduos I . II . então: a) Que nome se dá ao aparecimento.1.5 % e cinqüenta vezes maior do que entre o restante da população do Maranhão. Qual é a probabilidade de o indivíduo 9 ser portador dessa Nos Estados Unidos. V .4 No heredograma adiante o indivíduo 3 é afetado pelo albinismo. onde a freqüência de albinos é de 1. Responda. qual é a probabilidade de que o casal 4 × 5 tenha uma menina albina? Analise a figura onde se admite que a pigmentação da pele é devida a um par de alelos (A.a).5.

calcule a chance de os indivíduos III.5.4 Analise os dois heredogramas anteriores. o professor lhe apresenta o heredograma a seguir.2 gerarem uma criança afetada do sexo masculino.cromossomo Y ('Microsort'). II e III). além de satisfazer os anseios de vários casais na escolha do sexo do filho. e responda às seguintes questões: a) Qual o padrão de herança envolvido na determinação da característica representada no heredograma 1 e no heredograma 2? Justifique sua resposta.1. Qual a probabilidade de nascer uma criança doente? Justifique.4 13 . considerando que o caráter é determinado por um único par de genes. que se suspeita ser autossômica recessiva ou ligada ao sexo.5. que mostra a ocorrência de uma anomalia causada pela ação de um par de genes (A e a) em várias gerações de uma família. Tal método. Questão 59 O padrão de herança de uma doença.1. a) Qual o tipo de herança da doença? Justifique sua resposta. b) Suponha que a mulher 3 da família I case-se com o homem 4 da família III. Ao analisar os indivíduos afetados por esta anomalia.4 1. poderá ser benéfico quando utilizado por famílias portadoras de determinadas anomalias genéticas. b) Em qual das duas situações seria mais recomendado o uso da técnica ('Microsort') para a escolha de um bebê do sexo feminino? Por quê? c) Considerando o heredograma nŽ1. foi analisada em três famílias diferentes (I.1 e III. como representado nos heredogramas a seguir: 1. você conclui que se trata de uma herança autossômica dominante. 1. Identifique e justifique o tipo de herança.5.1.1. Questão 60 Numa aula de genética.4 1. Questão 58 O heredograma a seguir refere-se ao caso de braquidactilia.5.

B e C a seguir representam três famílias diferentes. os indivíduos em escuro apresentam uma doença hereditária. 1. qual o único que não pode ter seu genótipo definido? Explique por quê.1. homens. se a mulher (4) da geração F3 tiver filhos com um homem que apresente essa anomalia? Questão 61 No heredograma abaixo a cor preta indica indivíduos com pelagem negra. que apresenta indivíduos afetados por uma doença recessiva e indivíduos normais. fenótipo determinado por um gene autossômico dominante A.4 1. Questão 63 Na genealogia adiante. Os círculos representam as mulheres e os quadrados.1. A cor branca indica pelagem branca determinada por um gene recessivo. Quadrados ou círculos escuros representam indivíduos afetados por uma característica comum na população. Questão 64 Analise a genealogia.1.5. 14 .5.4 Qual a probabilidade de que o cruzamento entre o indivíduo 9 e o indivíduo 10 gere um indivíduo de pelagem branca? Questão 62 Os heredogramas A. a menos que haja evidência contrária. a) Identifique os heredogramas que são compatíveis com uma herança autossômica recessiva.4 1. Os indivíduos 5 e 8 devem ser considerados homozigotos (AA). Justifique sua resposta para cada família. Os círculos representam mulheres e os quadrados. Justifique. os homens. responda: a) Por que a anomalia NÃO pode ser recessiva? b) Por que a anomalia NÃO pode ser ligada ao cromossomo X? c) Qual a probabilidade de nascer uma criança afetada pela anomalia.5. b) Determine se em algum dos casos apresentados existe herança ligada ao cromossomo Y. enquanto os outros exibem fenótipo normal. Analise esta genealogia e responda. a) Esta doença hereditária é condicionada por gene dominante ou recessivo? b) Dos dez indivíduos que compõem esta genealogia.Baseando-se EXCLUSIVAMENTE no heredograma apresentado acima.

Discuta a importância dos fatores genéticos na manifestação dessa característica. filha de pais normais. As diferenças registradas entre os irmãos dizigóticos foram praticamente da mesma magnitude que as encontradas entre os irmãos monozigóticos. tem uma criança afetada por uma doença muito rara de herança autossômica recessiva. tanto monozigóticos como dizigóticos.1.5. 1.segunda criança desse casal também seja afetada por essa mesma doença? Por quê? Justifique suas respostas. mostrando como chegou aos resultados dos itens b) e c). a) Indique o genótipo do embrião formado a partir da fecundação do óvulo resultante dessa célula por um espermatozóide de um macho recessivo para os dois pares de genes considerados. b) Qual é a probabilidade de que uma futura criança de Paulo e Joana venha a ser afetada por essa mesma doença genética? Considere desprezível a probabilidade de uma nova mutação.4 Questão 68 Alguns centros de pesquisa na Inglaterra estão realizando um programa de triagem populacional para detectar a fibrose cística. sendo ambos do sexo masculino e afetados? Questão 65 Uma determinada característica foi estudada em centenas de pares de gêmeos.5. Questão 66 Se uma abelha operária tem o gene A herdado de seu pai. vítima de fibrose cística. mas cujo irmão morreu na infância.2. Pedro e Maria. uma doença autossômica recessiva grave particularmente comum em caucasianos. a) Quais os indivíduos representados na genealogia que são obrigatoriamente heterozigotos? b) Qual a probabilidade de o casal formado pelos indivíduos II2 e II3 ter mais dois filhos. todos normais. Um inglês heterozigoto para essa característica é casado com uma mulher normal.1 Calcule a probabilidade de que esse casal venha a ter uma criança com fibrose cística. O primeiro casal. qual é a probabilidade de que uma sua irmã tenha esse mesmo gene A? Por quê? Questão 67 Dois irmãos (Pedro e Paulo) casam-se com duas irmãs (Maria e Joana). Questão 69 Considere a figura a seguir que representa o resultado da primeira divisão meiótica de uma célula feminina: Toda pessoa na qual o alelo recessivo é detectado recebe orientação a respeito dos riscos de vir a ter um descendente com a anomalia. Justifique sua resposta. c) Se Paulo e Joana tiverem uma primeira criança afetada pela mesma doença genética. b) Quais os possíveis genótipos dos filhos possíveis do mesmo casal? 15 . qual será o risco de que uma 1. a) Desenhe o heredograma representando os dois casais e seus respectivos pais.

Em um outro cromossomo. Caso você examine a prole de um grande número de casamentos em que ambos os cônjuges são duplo heterozigotos para esses dois pares de genes. pelo alelo recessivo d.5. O tamanho do pêlo também é controlado por um par de genes. a cor preta é condicionada pelo alelo dominante D e a cor marrom. Questão 74 Em uma raça de cachorros.1 a) Os genes para a cor e tamanho de pêlo estão no mesmo par de cromossomas? Justifique sua resposta. após vários cruzamentos. Descreva três mecanismos biológicos potencialmente responsáveis por essa variabilidade genética e explique como atuam. D e E que se segregam independentemente. filhos legítimos de um mesmo casal. apresentam marcantes diferenças em suas características físicas.5.1 1. sendo o alelo dominante (B) para pêlo curto e o alelo recessivo (b) para pêlo longo. responda: a) Por que na geração F1 não foram encontradas sementes rugosas ou verdes? b) O que são os fatores hereditários referidos por Mendel e onde estão situados? c) Faça um diagrama de cruzamento para exemplificar as proporções fenotípicas encontradas na geração F2. a cor do pêlo negro é determinada por um gene dominante (A) enquanto seu alelo (a) determina a cor branca.2. a) Quais os genótipos dos pais? b) Se o filho preto e branco for cruzado com uma fêmea cujo genótipo é igual ao da mãe dele. O cruzamento de um macho de cor preta uniforme com uma fêmea de cor marrom uniforme produz uma ninhada de oito filhotes: 3 de cor preta uniforme. 1. qual a proporção esperada de descendentes iguais a ele? Questão 71 A audição normal depende da presença de pelo menos um dominante de dois pares de genes. o padrão malhado (preto / branco ou marrom / branco).Questão 70 Em cobaias. que mostra parte dos resultados dos experimentos de Mendel. utilizando qualquer uma das características apresentadas na tabela. De acordo com a tabela. 16 . b) Quais são os genótipos mais prováveis dos pais em cada casal? Justifique sua resposta. Questão 73 Quatro irmãos. 1 preto e branco e 1 marrom e branco. localiza-se o gene responsável pelo padrão da coloração: o alelo dominante M determina padrão uniforme (uma única cor) e o alelo recessivo m. 3 de cor marrom uniforme.2. realizados com ervilhas. A tabela a seguir apresenta os fenótipos dos pais e os fenótipos das respectivas proles. que proporção fenotípica você espera encontrar? Questão 72 Observe a tabela a seguir.

a constituição cromossômica de seus descendentes será igual à da planta mãe? Justifique.gene A (dominante) ou gene a (recessivo). cada um com dois genes alelos: loco 1 . estão representadas duas proporções fenotípicas (casos 1 e 2) que poderiam resultar do cruzamento de dois indivíduos AaBb. Despreze a parte fracionária de seu resultado. Questão 78 1. Suponha uma planta superior originada de um zigoto no qual dois dos pares de cromossomos. os homozigotos podem ser vermelhos ou brancos. Cruzando indivíduos AABB com indivíduos aabb. assim como o alelo para fruto redondo. caso exista.1 a) Ao final da segunda divisão meiótica dessa célula. Calcule a porcentagem esperada de descendentes fêmeas com pêlo vermelho crespo oriundas do cruzamento de dois animais duplamente heterozigotos. foram obtidos 100% de indivíduos AaBb que. os homozigotos têm pêlo liso ou crespo. 1. 17 . têm a constituição AA‚BB‚.gene B (dominante) ou gene b (recessivo). considerando apenas dois locos. loco 2 .2. Sem interação entre os dois locos. quais serão seus genótipos e em que proporção espera-se que eles sejam produzidos? Questão 77 Em uma determinada espécie animal. Para a cor do pêlo. uma com caule longo e frutos ovais e outra com caule curto e frutos redondos. A e B. a) Qual será a constituição cromossômica da planta adulta originada desse zigoto? Justifique. Os genes para comprimento do caule e forma do fruto segregam-se independentemente. foram analisadas duas características com segregação independente e herança co-dominante: cor e textura do pêlo. estão indicadas nos cromossomos representados no desenho. Questão 76 A figura mostra a segregação de dois pares de cromossomos homólogos na anáfase da primeira divisão meiótica de uma célula testicular de um animal heterozigótico quanto a dois genes. Na Tabela 2.5. podem formar indivíduos com os genótipos mostrados na Tabela 1. Questão 79 Considere duas linhagens homozigotas de plantas.5. quando cruzados entre si.Questão 75 Um pesquisador está estudando a genética de uma espécie de moscas. quais serão os genótipos das quatro células haplóides geradas? b) Considerando o conjunto total de espermatozóides produzidos por esse animal. as proporções fenotípicas dependem de os referidos locos estarem ou não no mesmo cromossomo.2. b) Se essa planta se reproduzir por autofecundação. Justifique sua resposta. identificados pelas letras Aa e Bb. Para a textura. As localizações dos alelos desses genes. O alelo que determina caule longo é dominante.1 Identifique qual dos dois casos tem maior probabilidade de representar dois locos no mesmo cromossomo.

vol. os antígenos estão presentes no sangue dos grupos A. a) Qual será o grupo sangüíneo de Eugênio após o transplante? Por quê? b) Sabendo-se que a mãe e a esposa de Eugênio têm sangue do tipo O. b) Em que proporção essas plantas de caule curto e frutos ovais serão obtidas? Questão 80 Considere dois genes e seus respectivos alelos: A e a. set. cujo grupo sangüíneo é A.) a) O que são antígenos? b) Qual a importância de se identificar a presença de antígenos eritrocitários (presentes nas hemácias ou eritrócitos) no sangue humano? 18 . Utilize as letras A. Os exames de sangue revelaram que a mãe era do grupo A. de que tipos sangüíneos eles poderiam ser? Questão 84 Um tratamento utilizado para certos tipos de doenças do sangue é a destruição completa da medula óssea do paciente e implante de células medulares sadias provenientes de um doador. 95. qual será a probabilidade de nascer um indivíduo de genótipo aabbCcDD? Questão 82 Idiotia amaurótica infantil é uma doença hereditária recessiva (ii) que causa a morte nos primeiros anos de vida. AB e ausentes no grupo O". b para forma dos frutos. CIÊNCIA HOJE. o famoso cineasta Charlie ChapIin foi acusado de ser o pai de uma criança. Eugênio. B e b. explique o que significa dizer que esses dois genes a) segregam-se independentemente na formação dos gametas. p. de Ricardo Lorzetto. recebeu um transplante de medula óssea de seu irmão Valentim. Uma outra criança desse casal é do grupo sangüíneo O. B. ("Reserva estratégica de sangue". o homozigoto (BB) é normal e o outro homozigoto (BLBL) morre prematuramente. cujo grupo sangüíneo é B. fato que ele não admitia. Ao final do julgamento. Admite-se que dedos nas mãos anormalmente curtos (braquidactilia) sejam devido a um genótipo heterozigoto para um gene letal embrionário (BBL). A condição normal (I_) produz um fenótipo normal. pergunta-se: a) qual é o grupo sangüíneo do homem em questão? b) qual ou quais os possíveis grupos sangüíneos usados erroneamente na transfusão? Questão 87 "Os grupos sangüíneos são determinados pela presença ou ausência de antígenos na superfície das hemácias. SBPC. qual será a probabilidade de um futuro filho do casal ter sangue do tipo A? E do tipo B? Questão 85 O pai e a mãe de um par de gêmeos monozigóticos têm tipo sangüíneo A. No caso do Sistema ABO. a) O veredicto é aceitável? Por quê? b) Na hipótese de Chaplin ter tido filhos com a referida mulher. Chaplin foi considerado como sendo um possível pai da criança. Sabendo-se que seus pais pertenciam aos grupos B (homozigoto) e AB. Questão 81 Do cruzamento de AaBbccDd x aaBbCcDd. e a operação foi bem sucedida.a) De que forma podem ser obtidas plantas com caule curto e frutos ovais a partir das linhagens originais? Explique indicando o(s) cruzamento(s). Em termos de localização cromossômica. b) estão ligados. a para comprimento do caule e B. 58. a) Quais os genótipos do pai e da mãe? b) Qual é a probabilidade de que ambos os gêmeos tenham sangue do tipo O? Questão 86 Um homem faleceu por causa de uma transfusão de sangue. a criança do grupo B e Chaplin do grupo O. Qual é a probabilidade de um casal de braquidáctilos e heterozigotos para a idiotia amaurótica infantil vir a ter um descendente normal? Questão 83 Nos anos 40. 19/nŽ 113.

a mulher teve cinco filhos na seguinte ordem: 1) homem. tinha sangue A e visão normal. Questão 91 Nas quatro pessoas relacionadas a seguir. Qual dos homens foi o primeiro marido? Justifique sua resposta.1 Indique os fenótipos dos pais que NÃO poderiam ser os pais biológicos de cada caso. ficou viúva e casou pela segunda vez. Um dos maridos. sangue B.O Saildo .A Com base nesta relação. Questão 89 O sangue de Orlando aglutina quando colocado em presença de soro contendo imunoglobulinas ou aglutininas anti-A. o outro marido. é determinado por três alelos autossômicos: IÞ. 3) mulher. Lalau (indivíduo II-1) elaborou o seguinte heredograma sobre a herança de grupos sangüíneos do sistema ABO. José.AB Cassilda . o Sr. é determinado por um gene localizado no cromossomo sexual X. grupo ABO. visão normal. sangue A. daltônico. daltônica. a) Qual o genótipo dos pais? b) Qual a probabilidade de esse casal ter uma criança cujo sangue aglutine nos dois tipos de soro? Justifique sua resposta. por comparação com os fenótipos e genótipos do filho e da mãe. daltônico. Questão 90 Pode-se usar o sistema ABO para "excluir" um suposto pai em uma investigação de paternidade.5. com sangue tipo A e visão normal. i. 2) homem. visão normal. sangue O. sangue A. Uma mulher. 5) mulher. Paulo. e não aglutina quando colocado em presença de imunoglobulinas ou aglutininas anti-B.1 19 .Questão 88 O daltonismo. Orlando casa-se com Leila. foram encontrados os seguintes tipos sangüíneos: Joana . O tipo de sangue. tinha sangue AB e era daltônico. Para tal. que apresenta aglutinações inversas. verificar se o homem acusado pode ser considerado como um pai impossível. 1.5. Com os dois maridos. A tabela a seguir mostra os fenótipos do filho e da mãe em três casos. Iß. responda: a) Quem do grupo anterior NÃO possui os aglutinogênios em suas hemácias? b) Por que Joana pode receber sangue de outros membros do grupo? c) Que tipo de aglutinina possuem Cassilda e Saildo. sangue A.3.B Doaldo . respectivamente? Questão 92 Ao descobrir que seu genótipo era homozigoto.3. 4) mulher. O casal tem um filho cujo sangue não aglutina em nenhum dos dois tipos de soro. 1. ou cegueira para as cores. basta determinar o genótipo e o fenótipo do suposto pai e.

Ao propor dividir a criança ao meio.1 Após identificar os pais do bebê nŽ 2. Lalau poderá ser receptor de sangue de seu genro para transfusão? d) O indivíduo III-5 NÃO poderá ser de qual grupo sangüíneo? e) No caso do casal III-3 e III-4 ter uma segunda criança. a) Explique por quê. é codominante sobre o alelo Iß. 1. uma das mulheres desistiu. enquanto uma pessoa com sangue AB é receptora universal mas não pode doar para os outros tipos. Os casais e os bebês foram submetidos à tipagem do sangue quanto ao sistema ABO. cujos resultados obtidos são mostrados na tabela adiante. Questão 94 Com base no heredograma a seguir.1 Questão 95 O rei Salomão resolveu uma disputa entre duas mulheres que reclamavam a posse de uma criança.3. O rei então concluiu que aquela que havia desistido era de fato a mãe verdadeira. caso exista. Questão 97 Um exemplo clássico de alelos múltiplos é o sistema de grupos sangüíneos humano.5. como Rh® e Rh−.qual a probabilidade de ter outra com os mesmos fenótipos sangüíneos? Obs. Por que o teste de DNA permite tirar conclusões tão precisas em casos como este? Questão 96 Os grupos sangüíneos humanos podem ser classificados em 4 tipos: A. responda: a) Qual a probabilidade de o casal formado por 5 e 6 ter duas crianças com sangue AB Rh®? b) Se o casal em questão já tiver uma criança com sangue AB Rh ®. b) Qual deveria ser o grupo sangüíneo do homem para que a decisão pudesse ser conclusiva? c) Com base no teste de DNA. em que o alelo IÞ.3. Analisando uma situação em que uma mulher de sangue A atribuía a paternidade de seu filho de sangue O a um homem de sangue B.: indique os passos que você seguiu para chegar às respostas. o juiz concluiu que o homem era pai da criança. que codifica para o antígeno A. a) Explique como o sangue de uma pessoa pode ser identificado em relação aos sistemas ABO e Rh. pelo sistema ABO e. em porcentagem. AB. pode-se identificar os pais de cada bebê. qual é a probabilidade dela ser uma menina e do grupo sangüíneo "B"? Questão 93 Dois casais suspeitavam da troca de seus bebês no berçário da maternidade. calcule a probabilidade. em a e b. que 20 1.5.a) Identifique o grupo sangüíneo do indivíduo I-1: b) Qual o genótipo do indivíduo II-5? c) O Sr. Nos tribunais modernos. b) Explique por que uma pessoa com sangue tipo O é doadora universal mas só pode receber sangue do tipo O. o juiz não pôde chegar a nenhuma decisão conclusiva. Analisando-os. B e O. de acordo com o sistema Rh. um juiz pode utilizar a análise dos grupos sangüíneos e teste de DNA para ajudar a solucionar questões semelhantes. . Despreze a parte fracionária do seu resultado. de que um futuro irmão deste bebê seja do sexo masculino e venha a ter tipo sangüíneo diferente do irmão.

e os únicos doadores disponíveis são seus irmãos. Questão 102 1. B. na falta de sangue do mesmo tipo. Érica. que não codifica para qualquer antígeno.5. sofreu um acidente e precisa urgentemente de uma transfusão de sangue. B ou AB. por que cada indivíduo é portador de somente dois alelos? Questão 98 Uma população humana foi testada quanto ao sistema MN de grupos sanguíneos. b) Como evitar sua ocorrência? c) Qual o procedimento usual para salvar a vida do recém-nascido com eritroblastose fetal? Questão 101 Um indivíduo pertencente aos grupos sangüíneos AB e Rh positivo é considerado receptor universal ideal. um dos gêmeos. Pedro. Dois tipos de soros.1 Qual das mulheres poderia ser a verdadeira mãe daquela criança? Justifique sua resposta. Os dados obtidos compõem a tabela a seguir: a) Quais as freqüências dos alelos M e N nessa população? b)Essa população está em equilíbrio de Hardy-Weinberg para esse loco gênico? Questão 99 Duas mulheres disputam a maternidade de uma criança. B ou AB. Mário. Questão 103 Um casal tem cinco filhos: Alex.2 1. 1. Ambos os alelos são dominantes sobre o alelo i. Certo ou errado? Justifique sua resposta.codifica para o antígeno B. a) Explique como ocorre a eritroblastose fetal. que. são necessários para a identificação dos quatro grupos sangüíneos: A.5. anti-A e anti-B. O sangue das duas mulheres foi testado . AB e O. podem ser feitas transfusões de pequenos volumes de sangue O para pacientes dos grupos A.3. o doador deve ter o mesmo tipo de sangue que o receptor com relação ao sistema ABO. Na impossibilidade de se fazer um exame dos tipos sangüíneos. Dois dos irmãos são gêmeos univitelinos.2 Nas transfusões sangüíneas. Questão 100 Na eritroblastose fetal ocorre destruição das hemácias.5. Em situações de emergência. Explique o problema que pode ocorrer se forem fornecidos grandes volumes de sangue O para pacientes A. o que pode levar recém-nascidos à morte. responda: 21 b) Embora 3 alelos distintos determinem os grupos sangüíneos ABO humanos.3. com o uso do soro anti-Rh (anti-D) como mostra o esquema a seguir. apresentou a doença hemolítica ou eritroblastose fetal. ao nascer.3. a) Complete o quadro a seguir com os genótipos e as reações antigênicas (represente com os sinais + e -) dos grupos sangüíneos indicados. Érica e Ana.

quanto aos dois genes mencionados? b) Que tipos de gameta e em que proporção esse macho 22 . foram produzidos descendentes dourados. com pelagem dourada.3. foi cruzado com uma fêmea preta e com uma fêmea marrom. b) Sabe-se que o aglutinogênio é uma proteína da membrana das hemácias. a) Qual é o genótipo do macho dourado. que pode ser preto ou marrom. R_ee crista rosa. por isso. Os cães homozigóticos recessivos "ee" não depositam pigmentos nos pêlos e apresentam. Utilizando a tabela a seguir determine o genótipo do galo e das três galinhas.5. cada um deles com dois alelos: "Ee" e "Bb". Crista Rosa = R_ee Crista Ervilha = rrE_ Crista Noz = R_E_ Crista Simpes = rree Um galo com crista noz foi cruzado com três galinhas. Um galo de crista noz cruzado com uma galinha de crista rosa produziu a seguinte geração: 3/8 noz. Questão 105 As três cores de pelagem de cães labradores (preta. Um labrador macho. Questão 107 Em galinhas domésticas o tipo de crista é determinado por dois pares de genes com segregação independente. qual seria a pessoa mais indicada para ser o doador? b) Justifique sua resposta. pretos e marrons. Na determinação desses tipos de cristas atuam dois pares de genes (Rr e Ee). Explique por que a aglutinação não ocorreria se o aglutinogênio fosse uma proteína citoplasmática. Em ambos os cruzamentos. 1/8 ervilha e 1/8 simples. pelagem dourada. Já os cães com genótipos "EE" ou "Ee" apresentam pigmento nos pêlos. enquanto os com genótipos "BB" ou "Bb" apresentam pelagem preta. marrom e dourada) são condicionadas pela interação de dois genes autossômicos. rrE_ crista ervilha e o genótipo eerr determina crista simples. forma? c) Qual é o genótipo da fêmea preta? d) Qual é o genótipo da fêmea marrom? Questão 106 Em galinhas há quatro tipos de cristas: simples. Questão 108 As reações enzimáticas a seguir indicam a passagem metabólica que sintetiza pigmentos em uma planta.a) Entre seus irmãos.4 a) Explique o fenômeno que ocorreria com as hemácias de um indivíduo do grupo A ao receber sangue de um indivíduo do grupo B. as duas colunas da direita demonstram esquematicamente o aspecto "in vitro" das reações no sangue dos indivíduos de cada grupo sangüíneo ABO aos anti-A e Anti-B. Observe os fenótipos e genótipos. 1. dependendo do outro gene: os cães homozigóticos recessivos "bb" apresentam pelagem marrom. Questão 104 No quadro a seguir. Com a galinha A de crista noz produziu na geração 3 noz: 1 rosa. A partir desses dados responda: a) Quais os genótipos paternos? b) Os genes em questão obedecem a segunda lei de Mendel? Justifique. 3/8 rosa. rosa e ervilha. noz. com a galinha B de crista ervilha produziu 3 noz: 1 rosa: 3 ervilha: 1 simples e com a galinha C de crista noz a geração tinha 100% crista noz. Assim o genótipo R_E_ determina crista noz.

Questão 109 Analisando a via metabólica hipotética. Determine a proporção esperada entre as cores das plantas descendentes na primeira geração do cruzamento AaBb×AABb. Responda: a) No cruzamento entre indivíduos de genótipos AaBb×aabb. faça o que se pede. Os genes A e B são dominantes sobre os seus alelos.4. os alelos A e B produzem enzimas funcionais. c) CITE a probabilidade de se obterem camundongos pretos do cruzamento de albinos (duplo homozigotos) com aguti (duplo heterozigotos).uma única cópia funcional da enzima A ou da enzima B é suficiente para catalisar normalmente a sua respectiva reação. Observe os dois pares de genes envolvidos e os fenótipos relativos aos tipos de coloração dos camundongos. impossibilita a conversão de pigmento rosa em vermelho. a) Do cruzamento entre camundongos preto e albino obtiveram-se 100% de camundongos aguti. temos que: O gene A é epistático sobre o gene B e. devido à não produção de enzima X.2 Utilizando essas informações e seus conhecimentos.1 Considere as seguintes condições: . . CITE todos os genótipos possíveis para os camundongos albinos obtidos e APRESENTE UMA EXPLICAÇÃO para a alteração da proporção 9:3:3:1 (esperada em cruzamento de diíbridos) para 9:3:4. apresenta pelagem de coloração acinzentada (aguti).4. A _ B _ = Aguti A _ bb = Preto aaB _ e aabb = Albinos 1. Duas outras colorações são também observadas: preta e albina. impede a produção dos pigmentos rosa e vermelho. encontrado comumente na natureza. quando em homozigose recessiva (aa). b) Do cruzamento de dois camundongos aguti obtiveram-se descendentes na seguinte proporção: 9 aguti: 3 pretos: 4 albinos. enquanto os alelos a e b produzem enzimas inativas. 23 .1.5. DÊ os genótipos dos camundongos envolvidos no cruzamento.para as enzimas A e B. qual será a proporção fenotípica esperada na progênie? b) Quais são os possíveis genótipos para os indivíduos vermelhos? c) Quais os fenótipos esperados e suas respectivas proporções em F‚ obtidos a partir de parentais AABB × aabb? Questão 110 Em camundongos.5. em homozigose recessiva. o tipo selvagem. O gene B.

nos óvulos. que será chamada de planta I. restando. considerando-se que não ocorreu mutação? Justifique. foi cruzada com outra planta. filha desse cruzamento. justificando sua resposta. Um indivíduo anormal. a) Qual genitor formou o gameta com 24 cromossomos? Explique. O cruzamento entre a planta I e a planta II produziu 4/8 de plantas com frutos brancos. era daltônico. Uma planta. responda: a) Como se chama esse tipo de interação? b) Qual a proporção fenotípica correta entre os descendentes do cruzamento de plantas heterozigotas para esses dois pares de genes? Questão 113 Existe um gene em cobaias que suprime o efeito do gene que determina a coloração nesses animais. XXY. Considerando que tais genes apresentam segregação independentemente um do outro. 1. adotando o mesmo critério utilizado para a montagem de cariótipo da espécie humana. b) o sexo a que pertence o animal da espécie em questão. produtora de frutos amarelos. o gene B condiciona fruto branco e o gene A condiciona fruto amarelo. pergunta-se: a) Por que é o pai quem determina o sexo da prole? b) Por que os filhos homens de pai hemofílico nunca herdam essa característica do pai? Questão 116 Um geneticista. é cruzada com outra. igual ao do humano e determine: a) quantos cromossomos existem. Seus genitores tinham visão normal para cores. com cariótipo 47. além desses. O duplo recessivo condiciona fruto verde. Responda: a) Que denominação se dá a este tipo de interação entre os genes A e B? b) Quais os genótipos das plantas I e II? Questão 112 Numa dada planta. II. produtora de frutos verdes. nos espermatozóides e nas células musculares dessa espécie animal. Questão 117 Esta figura representa uma célula humana na qual uma estrutura está indicada pela seta. mas o gene B inibe a ação do gene A. dois cromossomos de tamanhos distintos. O gene B produz frutos amarelos. Questão 114 O daltonismo tem herança recessiva ligada ao X.Questão 111 Na herança da cor do fruto da moranga. na presença do gene A. O indivíduo duplo recessivo produz frutos verdes. conseguindo formar dez pares de cromossomos.5. estão envolvidos dois pares de genes A/a e B/b. montou o cariótipo de certa espécie animal desconhecida. b) O erro ocorreu na primeira ou na segunda divisão da meiose? Explique. ele é inibido e produz frutos brancos.1 24 . produtora de frutos brancos. Questão 115 Com relação à espécie humana.5. Cobaias albinas homozigotas foram cruzadas e todos os descendentes nasceram pretos. respectivamente. 3/8 de plantas com frutos amarelos e 1/8 de plantas com frutos verdes. Uma planta homozigota. mas. nessa espécie desconhecida. como o seu alelo b. Como isto pode ser explicado. Esse gene está localizado em um cromossomo diferente daquele em que está o gene que determine a cor do animal. Considere o padrão de determinação de sexo.

b) Por que esse mosaico não pode aparecer em um homem? Questão 122 Certos tipos de câncer. Promovendo o intercruzamento destes descendentes. ele é eliminado ou congelado para uso futuro. 25 . d) DENOMINE a síndrome que designa o indivíduo cujo sexo é compatível com a presença da estrutura indicada. que é uma anomalia caracterizada pela ausência das glândulas sudoríparas. isto é. Esse gene se localiza no cromossomo sexual X. c) Utilizando a letra A para designar um conjunto de autossomos e as letras convencionalmente usadas para representar os cromossomos sexuais. qual seria a proporção fenotípica esperada? Demonstre os cruzamentos. usando um "kit" que determina a presença do cromossomo Y. Nesses transplantes. Questão 118 Em galinhas domésticas. formando um mosaico de manchas claras e escuras. em especial aqueles ligados às células do sangue. é reimplantado no útero da vaca. atualmente. b) CITE o nome da estrutura indicada pela seta e JUSTIFIQUE a existência da estrutura nessa célula. A tabela a seguir mostra os resultados da classificação dos cromossomos de 4 tecidos de um paciente submetido a transplante de medula. O alelo que determina a coloração carijó é dominante sobre o alelo para a cor branca. quando se passa um corante sobre a pele. determinar o sexo dos embriões logo após a fertilização. a coloração das penas é uma característica condicionada pelo gene C e é ligada ao sexo. qual a vantagem dessa prévia determinação do sexo dos embriões? b) Por que o "kit" pesquisa somente a presença do cromossomo Y? Questão 120 Durante o processo de meiose ocorre a recombinação gênica. Numa determinada raça. CITE o número cromossômico dessa célula caso ela pertença a um indivíduo normal e um indivíduo cujo sexo não é compatível com a presença da estrutura indicada. mas não a possui. Justifique sua resposta. uma parte da medula óssea de um doador sadio é introduzida na coluna vertebral de um paciente cujas células da medula óssea foram previamente eliminadas com auxílio de drogas ou de radiação. Questão 121 Na espécie humana existe um gene raro que causa a displasia ectodérmica anidrótica. Caso contrário.Com base na figura e em conhecimentos sobre o assunto. portadoras desse gene em heterozigose. a) Para esses fazendeiros. 1. Se o embrião for fêmea. o sexo feminino é heterogamético.5. Identifique o cromossomo humano que sofre menos recombinação.5. Questão 119 Fazendeiros que criam gado leiteiro podem. ficam com a pele toda manchada. são tratados com transplantes de medula óssea. O cruzamento de uma galinha branca com um galo carijó produziu somente aves carijós. Algumas mulheres. a) CITE o nome da célula representada e sua principal função. Após o transplante de medula é possível identificar os cromossomos de células de diversos órgãos e tecidos.1 a) Explique a formação dessas manchas do ponto de vista genético. a troca de seqüências de ADN entre cromossomos homólogos.

revelou a existência de duas cromatinas sexuais em todos eles.S. que a jovem era um caso de pseudo-hermafroditismo. A matéria dizia. a determinação do sexo não é feita simplesmente pela presença ou ausência do cromossomo Y. Responda: a) Quantos cromossomos X tem esta mulher? b) Se ela se casar com um homem normal.). pois apresentava órgãos sexuais internos masculinos e órgãos sexuais externos femininos. fenotipicamente normal. Questão 123 O governo de uma sociedade totalitária decidiu conter a expansão demográfica reduzindo a proporção de homens na população.Questão 125 Na década de 40 descobriu-se que algumas células retiradas de mulheres apresentavam no núcleo interfásico.1 Com base nesses resultados. Os testículos da atleta fora extirpados para que ela pudesse competir na equipe feminina de judô a) Que vantagem a atleta levaria sobre as demais competidoras se tivesse os testículos durante a competição? b) Sabendo-se que ela foi considerada do sexo feminino.5. 26 1. Justifique sua resposta. As demais mulheres poderiam continuar a ter filhos até que tivessem um filho homem. dando origem a um descendente com cariótipo 2AXXY. qual a probabilidade de ter uma filha com constituição cromossômica igual à sua? Questão 127 Essa lei atingirá o objetivo desejado depois de algumas gerações? Justifique sua resposta. que testes citogenéticos você faria para comprovar esta afirmação? Questão 128 Um casal de não hemofílicos tem um filho com hemofilia. . foi então promulgada uma lei segundo a qual todas as mulheres que tivessem um filho homem não mais poderiam ter filhos. a) Qual é a probabilidade de que uma filha desse casal apresente a doença? b) Qual é a probabilidade de que um outro filho desse casal seja também hemofílico? Justifique suas respostas. qual é a relação que expressa esse índice? c) Qual é o índice sexual (I. a) A que corresponde tal corpúsculo e em que tipo de células (somáticas ou germinativas) ele aparece? b) Qual a sua importância e por que ele não ocorre nas células masculinas? Questão 126 A análise dos núcleos interfásicos de células da mucosa oral de uma mulher. Se o cromossomo X de uma fêmea com cariótipo 2AXX sofrer não-disjunção meiótica e o óvulo resultante com 2 cromossomos X for fecundado por um espermatozóide normal.S. pergunta-se: a) Qual é o sexo do descendente com cariótipo 2AXXY? b) Sabendo-se que o sexo da 'Drosophila melanogaster' pode ser definido por um índice sexual (I. portador de um cromossomo Y. identifique o sexo do paciente e o sexo do doador. Com esse objetivo. mas por um balanço gênico entre genes femininizantes e masculinizantes.5. Este corpúsculo é conhecido hoje como cromatina sexual ou corpúsculo de Barr.) do descendente acima referido? Uma revista publicou uma reportagem com o título "Atleta com anomalia genética faz operação para definir seu sexo e poder competir na classe feminina de judô". um pequeno corpúsculo de cromatina intensamente corado. Questão 124 Em uma 'Drosophila melanogaster'. ainda.

qual é a probabilidade de 27 . b) Se os dois maridos da mulher fossem irmãos isto poderia alterar sua resposta anterior? Por quê? Questão 131 No heredograma a seguir. ocorrem dois meninos hemofílicos. Questão 130 Uma mulher clinicamente normal casou-se duas vezes. dois de cada casamento. qual o número esperado para crianças do sexo masculino. 1. A hemofilia tem herança recessiva ligada ao cromossomo X. ela teve quatro filhos. responda à seguinte pergunta: se a mulher 4 casar com um homem normal e seu primeiro filho for um menino hemofílico. que causa aborto espontâneo.5. Com base nessas informações e nas contidas na árvore genealógica adiante. em ambos os casos com indivíduos normais e que não eram seus consangüíneos.2 Questão 132 O gene recessivo h está localizado no cromossomo X e é responsável pela hemofilia na espécie humana.2 Questão 133 O gene recessivo d está localizado no cromossomo X e é responsável pelo daltonismo na espécie humana. Conforme mostrado na genealogia a seguir. entre as que nascerem? Justifique sua resposta. qual era o fenótipo da avó materna? Justifique sua resposta. qual é a probabilidade de que o próximo filho homem desse casal venha a ser hemofílico? a) Que padrão de herança explica melhor a genealogia? Justifique sua resposta. 1. Supondo que quinze de suas gestações se completem. Com base nessas informações e nas contidas na árvore genealógica adiante.Questão 129 Uma mulher é portadora de um gene letal ligado ao sexo.5. todos afetados por uma doença genética muito rara.5.5. responda à seguinte pergunta: se a mulher 5 se casar com um homem daltônico.2 a) Qual é a probabilidade de que uma segunda criança de II-4 e II-5 seja afetada? b) Qual é a probabilidade de II-2 ser portadora do alelo que causa a hemofilia? c) Se o avô materno de II-4 era afetado.5. 1.5.

5.Visão normal XDXd . o consultante está indicado por uma seta.2 1. consultou um geneticista que.5. isto é.5. Preocupado com a possibilidade de transmitir essa doença. Sendo assim.2 Questão 134 Uma mulher é portadora de um gene letal ligado ao sexo. após constatar que a família reside em um grande centro urbano. Nele. que causa aborto espontâneo. diversos membros são afetados por raquitismo resistente ao tratamento com vitamina D. localizada na parte não homóloga do cromossomo X. 1.5.Daltônico Mulheres: XDXD . Questão 135 Um homem pertence a uma família na qual. Supondo que nove de suas gestações se completem. podemos representar genótipos e fenótipos de homens e mulheres como no quadro a seguir. de Maranguape.que o próximo filho homem desse casal venha a ser daltônico? a) Sabendo que a doença em questão é um caso de herança ligada ao sexo. 1. gere filhas e filhos afetados pela doença. há gerações.2 28 . bem como a inexistência de casamentos consangüíneos.Visão normal XdXd .5. Questão 136 O daltonismo (cegueira para as cores) se deve a uma mutação recessiva ligada ao sexo. ao casar com uma mulher normal. os símbolos sombreados representam indivíduos daltônicos em um dos ramos da família Abreu.Visão normal XdY .Daltônica Na figura a seguir. preparou o heredograma abaixo. qual o número esperado para crianças do sexo feminino entre as que nascerem? Justifique sua resposta.5. Homens: XDY . b) Calcule os valores correspondentes à probabilidade de que o primo doente do consultante. formule a conclusão do geneticista quanto à possibilidade de o consultante transmitir a doença a seus descendentes diretos.

5. tem vários parentes com hemofilia clássica ou hemofilia A. procurou um geneticista. explique por que o pêlo de uma gata pode ter três cores. Como não tem recursos para fazer o diagnóstico pré-natal dessa doença pelo estudo do DNA fetal. no quadro anterior. Existe um terceiro gene autossômico (não localizado nos cromossomos sexuais) que é responsável pela cor branca. o seu risco e também o de sua família de vir a ter uma criança com essa doença.5.9 e III. Supondo que o indivíduo tratado venha a ter filhos com 29 Com base no enunciado e na análise do heredograma.2 A cor do pêlo dos gatos depende de um par de genes alelos situados no cromossomo X. III-4 e III-5? Questão 138 MS (indivíduo IIIˆ) está grávida.risco de ela vir a ter uma criança hemofílica. Questão 140 Uma das primeiras experiências de terapia genética foi realizada com indivíduos hemofílicos cujo gene para o fator VIII de coagulação era defeituoso.7. b) Analise a Árvore Genealógica de MS e informe: 1. Os resultados mostraram um aumento significativo na produção do fator VIII nos indivíduos tratados. leis da probabilidade. responda: a) A mãe do cruzamento I é homozigota ou heterozigota? Justifique. embora sejam raras. Questão 137 Na espécie humana há algumas condições dominantes ligadas ao cromossomo X.9? Justifique sua resposta. Com essas informações. Ela quer obter mais informações sobre a hemofilia A e conhecer.2 Questão 139 1. A figura a seguir mostra o heredograma de um tipo de diabetes que leva a problemas no metabolismo do fosfato e dos carboidratos.2 e IV.5. para representar os genes. responda: a) Quais os genótipos dos indivíduos II.risco de sua prima (indivíduo III„) vir a ter uma outra criança hemofílica do mesmo casamento com o indivíduo III…. III. b) Quais são os prováveis genótipos dos indivíduos II-2. IV. ela ser do sexo masculino e daltônico? Justifique sua resposta. nascendo uma criança de III.5. considerando o seu casamento com um homem normal (indivíduo III‰). c) Quais todos os genótipos prováveis para os descendentes (filhos e filhas) de um possível casamento entre IV.2 e IV. Na terapia foram retiradas células da pele do paciente.Analisando a figura.1. 2. Um deles é responsável pela cor preta e o outro pela cor amarela. tendo em vista as informações e usando os símbolos dados. a) Qual a principal característica clínica da hemofilia A? Justifique por que esse sintoma clínico aparece nos afetados. por meio das . Estas células receberam cópias do gene normal para o fator VIII e foram posteriormente reintroduzidas no indivíduo. 1.10. enquanto o pêlo de um gato só pode ter duas cores.9? b) Qual a probabilidade de.

2 30 . atenda às solicitações a seguir.5. fenótipo dos indivíduos. e ausente no Y. enquanto que a da família 2 é uma doença degenerativa fatal que aparece em torno dos 40 anos de idade.5.uma mulher cujos genes para o fator VIII sejam defeituosos. o heredograma a seguir começou a ser elaborado para que fosse determinado o genótipo e. Após analisar os heredogramas. A doença que acomete a família 1 provoca retardamento mental acentuado.2 e considerando que os indivíduos apresentam. existe possibilidade de nascimento de uma criança não hemofílica? Justifique sua resposta. Sabendo-se que o loco do gene para o daltonismo está no cromossomo X. b) Considerando que a seleção natural pode eliminar doenças genéticas. Questão 142 Os heredogramas a seguir representam duas famílias com doenças hereditárias distintas. Questão 141 Seguindo a representação a seguir 1. b) construa um heredograma no qual três desses indivíduos sejam os filhos biológicos (legítimos) dos outros dois.5.2 1.5. ou. explique por que a doença da família 2 ainda poderia ser encontrada em indivíduos da geração VI (netos da geração IV).5. a) Quais os tipos de herança envolvidos na transmissão das doenças de cada família? Justifique sua resposta. c) discuta a possibilidade de uma mulher hemofílica e albina ser filha biológica dos pais propostos no heredograma que você construiu. dois caracteres genéticos com mecanismos de herança distintos. responda: 1.5. Questão 143 Com o objetivo de reconstruir a história familiar de um caso de herança de daltonismo. a) indique os genótipos dos indivíduos. simultaneamente.

5 poderá ter irmão normal? Justifique. Um de seus gatos apresenta hipoplasia testicular (testículos atrofiados) e é totalmente estéril. os homens. 31 . quantas pessoas A MAIS. o número de mulheres afetadas pelo daltonismo é baixo quando comparado com o número de homens afetados pela anomalia. também deverão apresentar este fenótipo? b) O indivíduo II . ambos ligados ao sexo.1 e III . Este casal teve dois filhos: João e Maria. As cores nos gatos domésticos são determinadas por um gene A (cor amarela) e outro gene P (cor preta).5. alguns desses pigmentos não estão presentes. a) Qual a probabilidade de João ter herdado do pai o gene para daltonismo? Qual a probabilidade de Maria ter herdado do pai o gene para daltonismo? b) Por que é mais freqüente encontrarmos homens daltônicos que mulheres daltônicas? Questão 148 1. c) Se os indivíduos III .5 são daltônicos. neste heredograma. imediatamente fez o seguinte diagnóstico: trata-se de um caso de aneuploidia de cromossomos sexuais. Os símbolos em escuro representam os indivíduos com anomalia Questão 146 José é uma pessoa muito interessada na criação de gatos. responda: a) Por que o daltonismo é raro nas mulheres? b) Quantas vezes os homens daltônicos são mais freqüentes nas populações do que as mulheres daltônicas? Questão 145 A genealogia representada na figura é de uma família com uma anomalia rara na espécie humana. a) Qual o tipo mais provável da herança desta anomalia? Justifique.5. Supondo-se que a freqüência de homens daltônicos nas populações seja de 10%. Nos indivíduos daltônicos. e o malhado apresenta os dois genes (A e P).a) Se os indivíduos I . ela supôs que o problema teria surgido porque o pai da criança trabalhava em uma usina nuclear e teria ficado exposto a radiações que alteraram seu material genético.4 vierem a se casar e ter filhos. responda. b) Tendo em vista o tipo de herança mais provável. quais os genótipos dos indivíduos II-4 e II-5? Uma mulher deu à luz um menino com hemofilia.2 Com base nessa genealogia. A mulher tem razão? Justifique. Como nenhum de seus parentes próximos era hemofílico. O daltonismo é um caráter recessivo. alterando a percepção das cores. poderão ter uma menina normal homozigota? Justifique. Um homem daltônico casou-se com uma mulher de visão normal em cuja família não havia relatos de casos de daltonismo. A percepção de cores é devida à presença de diferentes tipos do pigmento retinol nos cones da retina. Os genes que participam da síntese desses pigmentos localizam-se no cromossomo X. Os círculos representam as mulheres e os quadrados. Questão 144 Na espécie humana. ao ver as cores preta e amarela do animal. a) O que é e qual o tipo de aneuploidia que o gato de José apresenta? b) Qual a explicação dada pelo veterinário relacionando a anomalia com as cores do animal? Questão 147 O daltonismo é comumente entendido como a incapacidade de enxergar as cores verde e/ou vermelha. José procurou um veterinário que.1 e II .

O irmão mais velho. 1. e o cruzamento das moscas F entre si. Questão 150 A determinação do sexo em peixes segue o sistema XY. mesmo quando elas pertencem a gerações afastadas entre si. se o alelo fosse dominante e estivesse no cromossomo X do macho? Demonstre. b) Qual será a proporção de machos e fêmeas nas duas gerações? Justifique. um normal e outro afetado. também afetada pela doença. Esse casal tem 5 filhos. Justifique essa conclusão. I e II. A irmã mais nova. assim como a probabilidade de filhos afetados para o casamento entre os últimos primos. utilize a simbologia: quadrados e círculos brancos para.2 32 . uma mulher afetada e um homem normal. sendo 4 homens. portadores de uma doença genética que se manifestava da seguinte maneira: O pesquisador concluiu que não se tratava de uma doença com herança dominante ou recessiva ligada ao sexo. Um peixe macho com manchas na nadadeira foi cruzado com uma fêmea sem manchas.5. a cor vermelha ou branca dos olhos é determinada por um gene localizado no cromossomo X. Observando a genealogia. Um alelo de um lócus do cromossomo Y do peixe 'Lebistes' determina a ocorrência de manchas na nadadeira dorsal.Questão 149 No gênero Drosophila. biologia molecular e engenharia genética podem. casa-se com uma mulher normal e tem 2 filhos. afetado pela doença. O heredograma a seguir mostra os descendentes do casal João e Maria. a) Qual será a cor dos olhos dos machos e fêmeas na primeira geração (F)? E na segunda (F‚)? Justifique. homens e mulheres normais. pode-se dizer que o modo de herança mais provável seja de herança ligada do X dominante. Represente como B o alelo dominante para olhos vermelhos e como b o alelo recessivo para olhos brancos. dos quais 2 são afetados. se casa com um homem normal e tem 3 filhos.5. respectivamente. Todas as filhas mulheres são afetadas por essa doença. Questão 151 Um geneticista estudou dois grupos. Questão 153 Os conhecimentos atuais de biologia celular. como no ser humano. estabelecer com segurança o parentesco entre pessoas. a filha afetada do irmão mais velho e o filho afetado da irmã mais nova. das quais somente uma é normal. e 3 mulheres. desenhe o heredograma dessa família considerando o gene (A) normal e o gene (a) mutado e apresente os prováveis progenes. uma moça normal e 2 homens. através de um cruzamento. Uma das filhas se casa com um homem normal e tem 7 filhos. a) Quais são os fenótipos de F e de F‚ desse cruzamento? b) Como seria o resultado em F e F‚. 2 mulheres e 3 homens. muitas vezes. Para o heredograma. quadrados e círculos hachurados para homens e mulheres afetados. a) O que levou o pesquisador a concluir que não se tratava de herança ligada ao sexo? b) Por que o pesquisador teve dúvida quanto ao tipo de herança autossômica? Questão 152 Uma doença humana rara é introduzida em uma família quando uma mulher normal se casa com um homem afetado. Responda as três questões a seguir considerando o cruzamento de uma mosca fêmea de olhos vermelhos de uma linhagem pura para cor de olhos com um macho de olhos brancos. porém teve dúvida se se tratava de herança autossômica recessiva ou autossômica dominante com penetrância incompleta.

Questão 156 Três grupos de alunos realizaram cruzamentos-testes entre plantas de tomate para o estudo de diferentes genes. considerando-se a Segunda Lei de Mendel (Lei da Segregação Independente). foi utilizada. Essas freqüências fenotípicas obtidas não estão de acordo com o esperado. Os grupos obtiveram os seguintes resultados: Atualmente.5.6 1.6 33 . dentre outras. Questão 154 O esquema a seguir representa.a) Quanto aos pares de alelos mencionados. a) De acordo com a Segunda Lei de Mendel.5. Todas as plantas produzidas tinham flores púrpuras e grãos de pólen longos. ocorreram as permutas indicadas pelas setas 1 e 2. apenas Maria e todos os seus bisnetos estão vivos. numa célula em divisão meiótica. 15 com flores vermelhas e grãos de pólen longos. 17 com flores púrpuras e grãos de pólen redondos. a técnica de identificação por meio do estudo do DNA extranuclear. nem ser possível a coleta de material genético dos membros falecidos da família. dois pares de cromossomos com três genes em heterozigose: A/a. B/b e D/d. foram obtidas 160 plantas: 62 com flores púrpuras e grãos de pólen longos.5.5. Indique o número de: a) bisnetos do sexo masculino e do sexo feminino que poderiam ser identificados com aproximadamente 100% de certeza. por técnicas que determinam a homologia entre amostras de DNA extranuclear. Por não haver documentos legais comprobatórios da relação de parentesco. Nesses cromossomos. e justifique sua resposta. e se apresentaram para a identificação de herdeiros do casal citado. 66 com flores vermelhas e grãos de pólen redondos.3 Questão 155 Foram realizados cruzamentos entre uma linhagem pura de plantas de ervilha com flores púrpuras e grãos de pólen longos e outra linhagem pura. 1. de toda essa família. com flores vermelhas e grãos de pólen redondos. que tipos de gameta esta célula poderá formar? b) Que pares de alelos têm segregação independente? 1. Cruzando-se essas plantas heterozigóticas com plantas da linhagem pura de flores vermelhas e grãos de pólen redondos. b) netos e bisnetos de João e Maria que possuíram ou possuem o cromossomo Y idêntico ao de João e justifique sua resposta. quais são as freqüências esperadas para os fenótipos? b) Explique a razão das diferenças entre as freqüências esperadas e as observadas.

Justifique. 34 . o termo ligação? Qual é a sua utilidade para a pesquisa científica? c) Calcule a distância. que permitiria ao casal do item b ter filhos com aptidão mediana para aprender biologia mas sem aptidão para tocar guitarra? d) Quais os locos cuja herança não resultará em proporções segregantes dentro dos padrões da segunda Lei de Mendel? e) Uma mãe sem aptidão para aprender biologia e tocar guitarra. que a característica em questão não altera o valor adaptativo dos indivíduos. em unidades de mapa genético. ao se casar com um indivíduo com genótipo: Questão 158 1. Em um dado loco. 36 são afetadas por uma doença genética condicionada por um par de alelos de herança autossômica recessiva. entre os genes pesquisados pelos alunos do grupo G2. a) Expresse. Com base nessas informações. igual número de descendentes. deles resultando. b) O que significa. correspondam a aptidões para aprender biologia (B). proposto por Thomas Hunt Morgan. em frações decimais. e um indivíduo homozigoto dominante apresenta maior aptidão.5. a) Como se denomina a situação mencionada? Supondo o cruzamento AB/ab com ab/ab b) Qual será a porcentagem de indivíduos AaBb na descendência? c) Qual será a porcentagem de indivíduos Aabb? Questão 159 Numa população de 100 pessoas. havendo 10 unidades de recombinação (morganídeos) entre eles. um indivíduo heterozigoto apresenta aptidão mediana. identificados nos cromossomos (I e II). formado por um indivíduo triplo homozigoto dominante e outro triplo homozigoto recessivo. Considere. em média. qual a probabilidade desse casal ter uma criança com aptidão mediana para matemática? c) Qual o nome do mecanismo genético. em Genética. poderá esperar descendentes (F1) com qual(is) genótipo(s)? b) Se um descendente (F1) se casar com um indivíduo sem aptidão para as três habilidades.a) Indique o(s) grupo(s) que trabalhou (trabalharam) com genes ligados. um indivíduo com genótipo recessivo não apresenta aptidão. mas com aptidão mediana para aprender matemática. Questão 157 Considere que os genes autossômicos. matemática (M) e tocar guitarra (G). Nessas condições. b) Quantos indivíduos são homozigotos? c) Suponha que nessa população os cruzamentos ocorram ao acaso. terá 100% dos filhos(as) com aptidão no mínimo mediana para as três características. também. qual será a porcentagem esperada de indivíduos de fenótipo dominante na próxima geração? Justifique suas respostas mostrando como chegou aos resultados numéricos.6 Os locos gênicos A e B se localizam em um mesmo cromossomo. faça o que se pede: a) Um casal (P1). a freqüência dos genes dominantes e recessivos.

420 são de flores vermelhas (fenótipo dominante) e 80 são de flores brancas (fenótipo recessivo). Numa determinada população em equilíbrio de Hardy-Weinberg nasceram 10. uma dessas crianças apresentou uma doença. Questão 164 Uma população vegetal que NÃO está em equilíbrio de Hardy-Weinberg. Qual das três possibilidades apresentadas NÃO pode ser aceita para explicar a variação na freqüência dos genes citados? Justifique sua resposta. As pessoas heterozigóticas Aa são resistentes a uma doença infecciosa causada por um protozoário. foi de A= 80% e a=20%. 35 . uma população ideal deve atingir o equilíbrio. Considere regiões geográficas em que a doença infecciosa é endêmica e regiões livres dessa infecção. a) Cite duas das condições propostas por Hardy e Weinberg para que o equilíbrio possa ser atingido. 380 são homozigóticos (VV) e 40 são heterozigóticos (Vv). desde que a população esteja em equilíbrio. A freqüência dos genótipos desse grupo sangüíneo foi amostrada em duas populações humanas e os resultados são apresentados na tabela a seguir. onde p e q são as freqüências de dois alelos. numa dada geração. Determine a freqüência dos genes V e a freqüência dos genes v nessa população. 2) Taxa de mutação gênica. Desses. Com essa equação podemos calcular a freqüência de um genótipo sabendo a freqüência de um dos alelos. Questão 166 O grupo sangüíneo MN é determinado por dois alelos codominantes. Dos 420 indivíduos de flores vermelhas. Espera-se encontrar diferença na freqüência de nascimento de crianças aa entre essas regiões? Por quê? Questão 161 Segundo o Teorema de Hardy Weinberg. uma das condições estabelecidas por Hardy e Weinberg para populações ideais foi seriamente afetada por uma erupção vulcânica ocorrida há cerca de cem mil anos. ou estado estático. Questão 165 A freqüência gênica de dois alelos em uma população. b) Defina o conceito de evolução em função da freqüência dos genes de uma população e indique de que forma a diminuição da população afetou a evolução dos jabutis gigantes. Um dos instrumentos mais utilizados nesses estudos é a pesquisa sobre o comportamento de gêmeos univitelinos que foram criados em ambientes diferentes.Questão 160 Um determinado gene de herança autossômica recessiva causa a morte das pessoas homozigóticas aa ainda na infância. Calcule a freqüência de indivíduos de fenótipo normal portadores do gene causador da fenilcetonúria nessa população. principalmente em populações pequenas. Esta erupção teria diminuído drasticamente a população de jabutis gigantes da ilha. sem grandes alterações de seu reservatório genético. Em uma das ilhas do arquipélago de Galápagos. determinada por um gene autossômico recessivo. p£+ 2pq + q£= 1.000 crianças. a qual é letal para as pessoas homozigóticas AA. Qual o princípio científico dessa abordagem experimental? Questão 163 Pela equação Hardy-Weinberg. Na geração seguinte foi observada uma freqüência de A=60% e a=40%. ou vice-versa. Alguns mecanismos evolutivos que alteram a freqüência dos genes são: 1) Seleção natural. Questão 162 A SOCIOBIOLOGIA procura explicar o comportamento dos indivíduos em função de sua herança genética. é composta por 500 indivíduos. 3) Deriva ao acaso da freqüência gênica. a fenilcetonúria.

calcule. é de 0. Usando o teorema de Hardy-Weinberg pode-se determinar as freqüências gênicas de uma população e demonstrar se a espécie está em equilíbrio.40 (40%) em uma população em equilíbrio. a) Qual a freqüência dos alelos A e a em cada uma das populações? b) Qual delas tem a maioria dos indivíduos homozigotos? Explique. Questão 171 A freqüência do gene i. com 400 alelos. Despreze a parte fracionária de seu resultado. a) Após o desastre pode-se afirmar que a freqüência do gene recessivo será zero? Justifique sua resposta. Questão 170 Considere duas populações diferentes. isto é. Entretanto. a freqüência do referido gene na população. caso exista. quantas se espera encontrar com sangue do tipo O? Explique as etapas que você seguiu para chegar à resposta. um determinado gene apresenta-se em duas formas. A população 1 apresenta 90 indivíduos com genótipo AA. respectivamente. Explique. 1. portanto. Indique o genótipo das pessoas do grupo sangüíneo O. Considerando que tal população se encontre em equilíbrio genético. A população 2 apresenta 45 indivíduos com genótipo AA. em estado de não-evolução. b) Qual o nome dado a essa alteração brusca na freqüência gênica? Questão 168 Uma das maneiras de verificar se uma determinada espécie está ou não em evolução é fazer um estudo do patrimônio genético de suas populações. isto é. Escreva quatro destas condições: 36 . não é possível saber a freqüência do gene para cor amarela. portanto. Em uma amostra de 1000 pessoas desta população. numa proporção de 10:1. aplicar o Princípio de Hardy-Weimberg. EM PORCENTAGEM. que determina o grupo sangüíneo O. Justifique sua resposta. sendo 36% dos indivíduos recessivos. alterando de forma brusca a freqüência do gene recessivo na população da ilha. Um estudo dessa população determinou que a freqüência do fenótipo amarelo era de 50% e NÃO SE SABE se essa população está em equilíbrio de Hardy-Weinberg. Questão 167 Numa determinada ilha existia uma população animal com indivíduos possuidores de uma característica normal e indivíduos possuidores de uma característica recessiva.5. Esse gene tem um alelo que não produz essa característica. Mas um desastre ambiental provocou a morte de todos os indivíduos com a característica recessiva. 130 indivíduos com genótipo Aa e 25 indivíduos com genótipo aa. 40 indivíduos com genótipo Aa e 70 indivíduos com genótipo aa. cada uma com 200 indivíduos diplóides.Questão 169 Em uma população.7 Calcule a freqüência do alelo M nas duas populações e determine se a população da Europa como um todo é uma população panmítica. Questão 172 Uma característica fenotípica de uma população. 1 e 2. é determinada por um gene dominante. como a cor amarela. podendo-se. Com base nessas informações. a dominante e a recessiva. uma população em que os casamentos ocorrem ao acaso. para que uma população se mantenha em equilíbrio genético é necessário que ela se enquadre em certas condições.

que quantidade de DNA há na faixa superior? Questão 175 Quais são as duas propriedades fundamentais do DNA que permitem a essa substância desempenhar o papel de material genético? 37 . responda: a) Qual a importância de o DNA autoduplicar-se? b) Por que essa replicação é semiconservativa? Questão 180 No DNA de um organismo. TTT AAT GGG CAT a) Qual é a seqüência de bases da hélice complementar a esse segmento? b) Qual é a seqüência de bases do RNA mensageiro transcrito a partir desse segmento? Questão 179 Para funcionar como material genético o ácido desoxirribonucléico (DNA) apresenta a capacidade de autoduplicação. 20% das bases nitrogenadas são constituídas por adenina. Retirou-se uma segunda amostra (amostra B). Que outras bases nitrogenadas devem existir neste DNA e em que proporções? 1. extraiu-se o DNA que foi submetido a uma técnica de centrifugação que permite separar moléculas de DNA de acordo com sua densidade. a) Por que. De uma amostra dessas bactérias (amostra A).Questão 173 No DNA de um organismo. O DNA das bactérias das amostras B e C foi também extraído e centrifugado. quando as bactérias completaram uma divisão celular nesse novo meio e uma terceira amostra (amostra C).1 A figura mostra o resultado da centrifugação do DNA das três amostras de bactérias. quando as bactérias completaram duas divisões celulares. Questão 176 Por que o processo de replicação do DNA é chamado semiconservativo? Questão 177 Dada a seqüência de bases nitrogenadas de um segmento de DNA: AAT GGC ATC responda: a) Qual é a seqüência de bases da hélice complementar a esse segmento? b) Qual é a seqüência de bases do RNA mensageiro transcrito a partir desse segmento? Questão 178 Dada a seqüência de bases nitrogenadas de um segmento de DNA a seguir. 18% das bases nitrogenadas são constituídas por citosina. Utilizando seus conhecimentos sobre o material genético.5. na amostra B. O restante das bactérias foi transferido para um meio de cultura em que todo o nitrogênio disponível era o isótopo normal ¢¥N. todo o DNA tem uma densidade intermediária entre o que é constituído apenas por ¢¥N e o que contém apenas ¢¦N? b) Considerando que.8. Que outras bases nitrogenadas devem existir neste DNA e em que proporções? Justifique sua resposta. na amostra C. Questão 174 Bactérias (Escherichia coli) foram cultivadas durante várias gerações em um meio de cultura na qual toda a fonte de nitrogênio era o isótopo pesado ¢¦N. responda aos itens adiante. a quantidade de DNA separada na faixa inferior é X.

São elas: I . sabendo que se trata da unidade estrutural do ácido desoxirribonucléico (DNA)? Questão 187 Uma molécula de DNA contém 15% de guanina.AUTODUPLICAÇÃO II . o que representam os números 1. Questão 183 O que são NUCLEOTÍDEOS? Quais são as moléculas que entram em sua composição química? Questão 184 Quais são as diferenças observadas nos nucleotídeos que entram na composição do DNA em relação aos que entram na composição do RNA? Questão 185 O que representa o desenho a seguir? Qual o nome das moléculas representadas pelos números 1. 38 . responda quais são as outras bases dessa molécula e em que proporções ocorrem.TRANSCRIÇÃO Explique essas duas propriedades.5. Questão 186 No desenho a seguir. 2 e 3. b) Quais são as diferenças observadas nos nucleotídeos que entram na composição do DNA em relação aos que entram na composição do RNA? Questão 189 1. 2 e 3 respectivamente? Questão 190 Sabendo-se que numa molécula de DNA formada por uma dupla hélice há 21% de timina.Questão 181 Mencione duas diferenças de natureza molecular entre o DNA e o RNA. Que outras bases nitrogenadas possui essa molécula e em quais proporções? Questão 188 Os ácidos nucléicos são macromoléculas definidas como polinucleotídeos. a) Represente um nucleotídeo apontando seus três constituintes moleculares.8.5.8. que representa a estrutura da molécula de DNA.1 Para funcionar como material genético o DNA apresenta duas propriedades fundamentais. respectivamente. 1.1 Questão 182 Justifique o termo SEMICONSERVATIVO para caracterizar o processo de replicação do DNA.

39 . ainda no estágio de girino. Os capítulos contam diferentes detalhes da saga do homem na terra: suas andanças pelos continentes.5. conservado em tanques de nitrogênio líquido que guarda informações desconhecidas sobre a humanidade. se o nucleosídeo radioativo usado fosse a timidina e justifique sua resposta.Questão 191 Considere um segmento de DNA com a seguinte seqüência de bases nitrogenadas: ATT CTA CGC AAA GGC através de observações de características morfológicas e fisiológicas da célula.. Explique por que. casamentos ancestrais e os ataques de doenças.. b) as características fenotípicas são diferentes. sendo.1 a) Cite o tipo de molécula à qual a uridina se incorporou. Após algum tempo. Questão 196 Num experimento. casamentos ancestrais e os ataques de doenças" podem ser estudados Em células eucariotas mantidas em cultura. Esse processo marca a posição aproximada do isótopo dentro da célula. fixadas e submetidas a auto-radiografia. Amostras destas células foram retiradas 3. qual será a seqüência de bases desse RNA? Questão 192 Considere a seqüência de bases nitrogenadas de um segmento de DNA: AAA GGC ATT Responda: a) Qual é a seqüência de bases da hélice complementar a esse segmento? b) Qual é a seqüência de bases do RNA mensageiro transcrito a partir desse segmento? Questão 193 No DNA de um organismo. 15 e 90 minutos após a transferência. como representado no esquema a seguir.8. 1. colocadas em lâmina de vidro. Nomeie o processo através do qual o DNA é capaz de controlar e interferir nas características morfológicas e fisiológicas da célula. adicionou-se o nucleosídeo uridina marcado radioativamente com H¤ ao meio de cultura. com as de células de tecido similar do mesmo indivíduo após atingir a idade adulta. "O Globo") a) Explique por que o processo de autoduplicação do DNA dá significado à hereditariedade permitindo revelar a história da evolução da humanidade. foram comparadas as características genotípicas e fenotípicas de células retiradas de um tecido de anfíbio. b) ". b) Nomeie o compartimento celular que seria marcado. Que outras bases nitrogenadas devem existir neste DNA e em que proporções? Questão 194 CÉLULAS IMORTAIS CONTAM AOS CIENTISTAS HISTÓRIA DA EVOLUÇÃO DA HUMANIDADE Estas células formam um livro. (adaptado de. então. 32% das bases nitrogenadas são constituídas por citosina. Questão 195 a) Quais são as bases da cadeia complementar a esse segmento? b) Se o segmento dado servir de molde para a produção de RNA. suas andanças pelos continentes. entre essas células: a) as características genotípicas são iguais. as células foram transferidas para um novo meio que não continha o isótopo. Justifique sua resposta.

para replicar todo o genoma de uma bactéria. Tal evento inibiria 40 . b) Justifique as respostas ao item a. Para alguns genes. Por que o DNA mitocondrial deve ser usado para a análise matrilínea? Questão 202 No ADN. existe uma enzima. II) cuja mulher é cega e o homem é normal. cuja velocidade de reação é equivalente a cerca de 800 nucleotídeos/s. Questão 199 O genoma da bactéria "Escherichia coli" tem um tamanho de 4×10§ pares de nucleotídeos. mas sim o gene mutado. para o genoma humano. Assim. a) Qual a influência da transfusão sugerida no resultado no exame? b) Que precauções podem ser tomadas para desmascarar a tentativa de fraude? Questão 201 A tipagem de DNA é uma técnica desenvolvida recentemente que permite identificar e estabelecer o grau de parentesco entre indivíduos. Sabe-se que todas as mitocôndrias dos indivíduos afetados pela cegueira não possuem o gene normal. Questão 198 A mutação em um gene humano provoca cegueira. a seqüência de nucleotídeos transcrita pode estar em uma cadeia. que não se altera ao longo das gerações (salvo em casos de mutações). Assim. que o tempo de geração da "E. a seqüência de nucleotídeos do DNA de cada pessoa é única (excetuando-se o caso de gêmeos monozigóticos). Graças a essas características é possível atualmente realizar testes de paternidade que comparam os padrões de bandas de DNA das pessoas e revelam se um homem é de fato o pai biológico de uma outra pessoa. ao passo que a seqüência do outro gene pode estar localizada na cadeia oposta. Com a utilização de técnicas de genética clássica e molecular. antes da divisão celular. sabe-se que no mesmo trecho nunca ocorre a transcrição simultânea das duas cadeias de uma molécula de ADN. para uma análise matrilínea (materna).Questão 197 Para desempenhar sua função como material hereditário. aproximadamente 43 dias! Sabemos. isto é. e que o tempo médio de replicação de uma célula eucariota é de 12 horas. Para se realizar uma análise patrilínea. a transcrição dos genes não está restrita a somente uma das suas cadeias. verificou-se que este gene está localizado no genoma mitocondrial. Suponha agora a seguinte situação: um homem acusado de ser o pai de uma criança tenta burlar o teste de tipagem de DNA. explique essa aparente contradição. usa-se um marcador do cromossomo Y. No entanto. a tipagem do DNA revela um padrão de bandas que é estável (presente no DNA de todos os tecidos) e é transmitido aos descendentes seguindo as leis de Mendel. Identifique-as e descreva resumidamente cada uma delas. a DNA polimerase. ou seja.coli" é de cerca de 20 minutos. Isto significa que cada indivíduo possui variações discretas e características na seqüência de seu DNA. a) Informe a percentagem de filhas e filhos cegos de um casal: I) cuja mulher é normal e o homem é cego. o DNA possui duas propriedades. um amigo o aconselha a receber uma transfusão de sangue 2 meses antes do teste (em geral colhe-se o sangue como fonte de células nucleadas). Assumindo que a DNA polimerase apresenta uma velocidade de reação constante para todas as espécies analisadas. Por outro lado. Para replicar o genoma. a investigação dos ancestrais paternos. lança-se mão do DNA mitocondrial. no entanto. Questão 200 O teste de tipagem de DNA revelou que nos seres humanos existe individualidade genômica. Já o genoma haplóide humano tem 3×10ª pares de nucleotídeos. a DNA polimerase consumiria cerca de 83 minutos e.

a) Indique as porcentagens das quatro bases.000 anos.o processo da tradução. Com base nestes dados: a) O que se pode afirmar a respeito das semelhanças entre estas duas moléculas de DNA? b) Justifique sua resposta. obtém-se o crescimento de colônias de bactérias. nessa molécula. 27% de citosina e 27% de guanina. Explique por que ocorreria a inibição da tradução se a transcrição de uma cadeia do ADN ocorresse ao mesmo tempo que a transcrição da sua cadeia complementar. Explique por que a maior diversidade do DNA mitocondrial apóia a idéia da origem africana do 'Homo sapiens'. citosina (C). Os resultados revelaram que a variabilidade genética no DNA mitocondrial de indivíduos africanos era quase o dobro da observada no DNA mitocondrial de não-africanos. em cultura com ¢¥N. . observe o resultado do experimento a seguir. 27% de citosina e 27% de guanina. Molécula B 23% de adenina. b) Explique por que é impossível prever a proporção de citosina presente no ARN mensageiro codificado por esse trecho de ADN.Cultura de 1 geração com ¢¥N: 600 moléculas de DNA todas com ¢¦N e ¢¥N. 2 etapa: Extrai-se o DNA de todas as bactérias e obtém-se o seguinte resultado: Questão 206 A análise química de duas moléculas de DNA revelou a seguinte composição de bases: Molécula A 23% de adenina. . adenina (A).1 41 . Questão 204 A soma das porcentagens de guanina e citosina em uma certa molécula de ADN é igual a 58% do total de bases presentes.5. Explique as porcentagens obtidas em todos os extratos das diferentes culturas no experimento. no mesmo trecho.8. 1 etapa: Em uma cultura com ¢¦N. guanina (G) e timina (T).Cultura de crescimento com ¢¦N: 300 moléculas de DNA todas com ¢¦N. 23% de timina. . Questão 205 Considerando as propriedades de duplicação do DNA. Questão 203 Estudos recentes compararam as seqüências completas de DNA mitocondrial de indivíduos de várias regiões geográficas do planeta. após esse crescimento promove-se o desenvolvimento de mais duas gerações. 23% de timina. Justifique sua resposta. Esses resultados foram importantes para corroborar a idéia de que o ancestral comum mais recente do 'Homo sapiens' viveu na África há cerca de 200.Cultura de 2 geração com ¢¥N: 1200 moléculas de DNA nas quais 600 com ¢¥N e 600 com ¢¦N e ¢¥N. 1.

quais se referem a DNA? b) Justifique o resultado obtido com a 5Ž lâmina. os fagos produzidos terão a) a cápsula protéica de qual dos fagos? E o DNA. a) Entre estas lâminas. 42 . Questão 209 Em 25 de abril de 1953. Essa pessoa casou-se com outra. guanina e timina. tivesse sido usado enxofre radioativo (¤¦S) para marcação de proteínas. será de qual deles? b) Justifique sua resposta. Hershey e Chase cultivaram bactérias em meio de cultura contendo fósforo radioativo (¤£P) e colocaram bacteriófagos (vírus) para infectar essas células. b) Que relação existe entre DNA. pintando quais serão as pessoas afetadas pela doença em F1 e em F2 b) Justifique sua resposta. A.5. quase ignorado de início. RNA e síntese protéica? c) Como podemos diferenciar duas proteínas? Questão 210 Cientistas criaram em laboratório um bacteriófago (fago) composto que possui a cápsula protéica de um fago T2 e o DNA de um fago T4. que faz com que a produção de energia para os músculos seja deficiente. Questão 211 No heredograma seguinte. James Watson e Francis Crick descobriram a estrutura do DNA. O casal (P) teve filhos (F1) e estes. revolucionou para sempre todas as ciências da vida sejam elas do homem. por sua vez. ressaltando a interação entre as duas cadeias do polímero. Os novos bacteriófagos formados estavam marcados radioativamente. aparentemente normal. rato. que permitiu posteriormente decifrar o código genético determinante para a síntese protéica.8. em vez de fósforo. respectivamente.Questão 207 A análise química em amostras de cinco lâminas com ácidos nucléicos apresentou os seguintes resultados: 1Ž lâmina: ribose 2Ž lâmina: uracila 3Ž lâmina: dupla-hélice 4Ž lâmina: timina 5Ž lâmina: 15% de guanina e 25% de citosina. a pessoa A possui uma mutação no DNA de todas as suas mitocôndrias. G & T representam as bases adenina. a) Watson e Crick demonstraram que a estrutura do DNA se assemelha a uma escada retorcida. 1. Após esse bacteriófago composto infectar uma bactéria. citosina. Na figura. planta ou bactéria. um estudo de uma única página na revista inglesa Nature intitulado "A estrutura molecular dos ácidos nucléicos". ocasionando dificuldades motoras para os portadores do problema. os resultados seriam os mesmos? Justifique. C. Estes bacteriófagos marcados foram utilizados para infectar outras células bacterianas cultivadas sem a presença de fósforo radioativo.1 a) Copie o heredograma. também tiveram filhos (F2). A marcação radioativa foi detectada dentro destas bactérias. Questão 212 A figura a seguir mostra um trecho da estrutura do ácido desoxiribonucléico. Explique a que correspondem os "corrimãos" e os "degraus" dessa escada. Questão 208 Em 1952. a) Como se explica que o fósforo radioativo tenha passado para o bacteriófago? b) Como se explica que as bactérias cultivadas sem a presença de fósforo radioativo tenham sido marcadas? c) Se.

mas um deles é a composição dos nucleotídeos de um determinado DNA. Essas pontes de hidrogênio podem ser rompidas por calor. que digere a parede celular de células vegetais. 1. a) Quais são as bases do segmento de DNA que deu origem a esse RNA? b) Quantos nucleotídeos existem no DNA que deu origem a essa molécula de RNA mensageiro? Questão 218 A enzima poligalacturonase. respectivamente. respectivamente.8.1 Questão 215 Observe o esquema adiante e responda: As linhas pontilhadas indicam as pontes de hidrogênio que são formadas entre as bases aminadas e que contribuem para manter unidas as duas cadeias do DNA. Esse processo reversível chama-se de desnaturação. 2 e 3.1 . b) Qual é o nome dessa unidade estrutural? Questão 216 Uma cadeia de RNA tem 200 nucleotídeos.5. 2 e 3.8. A temperatura necessária para desnaturar o DNA depende de vários fatores.5. de maneira invertida. Quantos nucleotídeos tinha o DNA que originou esse RNA? Questão 217 Um segmento de RNA mensageiro apresenta a seqüência de bases nitrogenadas a seguir: AAA UUC GGG GAU.5. responda o que representam os componentes 1.Questão 214 Que papéis desempenham o RNA mensageiro e do RNA transportador no processo de síntese das proteínas? 1.2 ) Quais são as moléculas representadas pelos números 1. sabendo-se que trata-se da unidade estrutural do ácido ribonucléico (RNA). é a principal responsável pela maturação de frutos como o tomate. no genoma de um tomateiro. 1) ACTTTAAAGATATTTACTTAAA TGAAATTTC TATAAATGAATTT 2) GCTAGGCCGATGCGGCGTGGA CGATCCGGCTACGCCGCACCT Questão 213 Considerando o modelo da estrutura molecular do DNA como representado na figura adiante.8. Para retardar o amadurecimento e evitar as perdas durante o armazenamento. o que produz a dissociação das cadeias. Justifique a sua resposta. 43 1. utilizou-se uma técnica na qual o gene que codifica a enzima citada foi inserido. Observe as duas seqüências de DNA a seguir e determine qual delas precisará de uma temperatura de desnaturação maior.

5. justificando cada resposta com a utilização do código genético da figura 2: . B e C? Por quê? Seqüência normal CAA AAC TGA GGA ATG CAT TTC (m) GTT TTG ACT CCT TAC GTA AAG Indivíduo A CAA AAC TGA GGA ATT CAT TTC (m) GTT TTG ACT CCT TAA GTA AAG 44 Questão 221 O fumo está relacionado ao aumento de risco para o câncer de pulmão.O esquema adiante mostra os produtos da transcrição do gene normal da enzima e do gene inserido. Usando a tabela que relaciona alguns codons aos respectivos aminoácidos e considerando que a fita molde a ser transcrita é aquela assinalada com a letra m. responda: a) Quais serão os segmentos de proteínas produzidos. pelos indivíduos A. possa ser alterado em presença do Benzo[a]pireno. tem a capacidade de promover mutações no DNA levando a mudança da base Guanina para Timina.8. um dos principais agentes carcinogênicos presentes na fumaça do cigarro.2 1. respectivamente. Suponha que um trecho da fita molde de DNA do gene X. cuja seqüência normal está representada a seguir. Considere que o RNA mensageiro seja formado a partir das trincas mostradas no esquema da figura 1 a seguir. O Benzo[a]pireno. ambos ativos nesse tomate geneticamente modificado. b) Explique por que haverá um aumento no tempo de amadurecimento desse tomate geneticamente modificado. em um dos dois sítios indicados na figura 1. B e C têm mutações em um segmento de DNA desse gene.8. Indique as alterações que ocorrerão na síntese da proteína X quando a mutação for localizada nos diferentes sítios. O hábito de fumar expõe os fumantes a substâncias com atividade carcinogênica. Os indivíduos A. Indivíduo B CAT AAC TGA GGA ATG CAT TTC (m) GTA TTG ACT CCT TAC GTA AAG Indivíduo C CAA TAC TGA GGA ATG CAT TTC (m) GTT ATG ACT CCT TAC GTA AAG 1.3 a) Descreva a interação que ocorre entre os produtos da transcrição dos genes normal e inserido no tomate geneticamente modificado e indique a característica dessas moléculas que permite a interação.5. Questão 219 De que maneira o DNA determina a seqüência de aminoácidos das moléculas de proteínas? Questão 220 Uma doença genética de herança dominante é causada por mutações em um gene localizado em um autossomo. B e C? b) Como será o fenótipo (normal ou afetado dos indivíduos A. representado a seguir.

pode afetar a saúde e a qualidade de vida do portador dessa mutação.GAG .8. é sempre possível deduzir-se a seqüência de aminoácidos de uma proteína a partir da seqüência de nucleotídeos do seu gene. faça uma comparação entre a diversidade dos organismos encontrados nesses dois planetas. a) Considere o segmento de DNA. Questão 222 As globinas constituem um bom exemplo da importância da informação genética na estrutura primária e na função das proteínas.3 Entretanto.5.3 Com o auxílio da tabela do código genético representada a seguir. b) Sabendo que a vida em Zbohrnya e na Terra existe há 3.8.5.Por que sempre encontramos N > P ? Questão 224 1. Questão 225 O DNA dos organismos do planeta Zbohrnya é constituído pelos mesmos 4 tipos de bases dos seres vivos terrestres.GTG . a proteína produzida pela expressão desse gene será idêntica à da espécie zbohrniana? Justifique sua resposta. B e C.GAG . respectivamente. Um gene é constituído por um número N de nucleotídeos que codifica uma proteína constituída por P aminoácidos. c) Se o gene de uma proteína respiratória de um organismo zbohrniano for introduzido numa bactéria terrestre.CTG . a partir da seqüência de aminoácidos de uma proteína.8.CCT . do tipo substituição.CAC . o oposto não é verdadeiro. 13. Questão 223 O ADN é um polímero constituído por vários nucleotídeos e as proteínas são polímeros constituídos por vários aminoácidos. 1. 45 . forneça o produto da síntese protéica (polipeptídio parte da cadeia beta prevista para a globina humana). 1.3' e. Já o código genético desses organismos é determinado por códons de 2 bases. Explique por quê.ACT . encontradas nos organismos da Terra. ou do RNA-m correspondentes. não se pode deduzir a seqüência de nucleotídeos do gene.3 b) Utilize um exemplo de alteração estrutural da globina humana (cadeia beta) para explicar como uma mutação pontual. isto é.5 bilhões de anos. utilizando-se da tabela do código genético apresentada a seguir. cuja seqüência de nucleotídeos é 5' . a) As proteínas A. 16 e 19 tipos diferentes de aminoácidos.AAG .5. Explique a possibilidade da ocorrência dessas três proteínas nos seres de Zbohrnya. apresentam.

5.3 a) Escreva a seqüência de bases nitrogenadas do RNA mensageiro. c) Qual a seqüência de aminoácidos que resultará da tradução da molécula de RNA mensageiro? Ver figura anterior. Entretanto. esse código segue o padrão do código genético universal. --. b) Cite a seqüência do anticódon correspondente ao códon de iniciação.4 1. c) Qual seria a seqüência dos três primeiros aminoácidos de um polipeptídio codificado por um alelo mutante desse gene.8. originado pela perda do sexto par de nucleotídios (ou seja.T A C T C A A C C G G A C --A primeira trinca de pares de bases nitrogenadas à esquerda. d) Qual a seqüência de aminoácidos que resultará da tradução da mesma molécula de mRNA. contendo códigos de trincas de bases do DNA com os aminoácidos correspondentes. qual seria o aminoácido da tabela a ser incorporado? c) Qual é anticódon correspondente ao novo aminoácido incorporado? Questão 227 A tabela adiante representa uma versão fictícia do código genético. a deleção do par de bases T = A)? 46 . transcrito a partir desse segmento de DNA.3 Analise a tabela e faça o que se pede: a) Cite o nome da enzima que catalisa a síntese de RNA mensageiro. indique a seqüência dos três aminoácidos seguintes à metionina.5. b) Se ocorresse uma substituição. no polipeptídio codificado por esse gene.8. b) Utilizando a tabela de código genético fornecida.Questão 226 Considere a tabela abaixo. no qual três bases codificam um aminoácido.A T G A G T T G G C C T G ----. corresponde ao aminoácido metionina.8. por uma purina.5. na 3 base do código correspondente ao 6Ž aminoácido do polipeptídeo. A tabela a seguir mostra alguns códons do RNA mensageiro e os aminoácidos codificados por cada um deles. a) Determine a seqüência de bases do RNAm que foi utilizado para sintetizar o polipeptídeo esquematizado abaixo da tabela. 1. para resolver os itens seguintes: 1. após uma deleção do TERCEIRO nucleotídeo? Questão 228 A seguir está representada a seqüência dos 13 primeiros pares de nucleotídios da região codificadora de um gene.

respectivamente. . apenas o RNA complementar a seu genoma é capaz de funcionar como mensageiro na célula infectada. a) Explique por que é necessário. a partir desse RNA? Questão 231 Ribossomos são formados por RNA e proteínas. que os vírus RNA (-) já contenham a enzima RNA replicase.Questão 229 Sabendo-se que um determinado segmento de DNA apresenta capacidade de transcrever e que apresenta a seqüência de bases TAC TCC GCT TAG e. . no ribossomo. Nesse gene existem íntrons. o genoma viral funciona diretamente como mensageiro.nos vírus RNA (-). .ambos os vírus necessitam. enquanto os RNA (+) não precisam armazenar esta enzima. da enzima RNA replicase. em sua cadeia complementar. e os que são RNA (+). mas a enzima só é encontrada nas partículas virais RNA (-). Observe que: . encontramos aqueles que são RNA (-). Questão 232 Sabendo-se que um determinado segmento de DNA apresenta capacidade de transcrever e que apresenta uma seqüência de bases ACTCCGCTT / TGAGGCGAA. para sua replicação. a seqüência ATG AGG CGA ATC. para sua replicação.o gene da enzima RNA replicase está presente no genoma dos dois tipos de vírus. quais poderiam ser as seqüências de bases do RNA por ele produzido? Questão 233 Analisando o genoma de alguns tipos de vírus formados por fita simples de RNA. como o da poliomielite. b) Apresente um argumento contrário à hipótese de que os vírus. devido à simplicidade de sua estrutura. a) Onde esses processos ocorrem na célula eucariótica? b) O que acontecerá com os processos de transcrição e tradução. que sintetiza um RNA complementar a um molde de RNA. como no caso dos seres humanos. Questão 234 Em um organismo pluricelular com vários tecidos. foram precursores das primeiras células. A figura a seguir representa o resultado de uma experiência de hibridação do ARN mensageiro com a cadeia de ADN que lhe deu origem. 47 . todas as células possuem um genoma idêntico. sintetizados pelos processos de transcrição e tradução. quais são as seqüências de bases de RNAm por ele produzido? Questão 230 Dado um segmento de RNA mensageiro com a seguinte seqüência de bases: AAU GUA GGC pergunta-se: a) Qual a seqüência de bases do DNA que deu origem a esse RNA? b) Quantos aminoácidos terá o polipeptídeo traduzido. ou seja. se ocorrer uma destruição do(s) nucléolo(s) de uma célula?.nos vírus RNA (+). Analogamente. é correto afirmar que os ARN mensageiros (ARNm) dos diferentes tecidos são todos idênticos? Justifique sua resposta Questão 235 Suponha um gene de um eucarioto responsável pela síntese de uma proteína. As regiões do ARN transcrito correspondentes aos íntrons são eliminadas após o processo de transcrição. como o do resfriado comum. regiões do ADN cujas informações não estão presentes na proteína em questão.

Certos mutantes nutricionais do fungo Neurospora só conseguem crescer quando aminoácidos são adicionados ao meio de cultura. a partir de uma seqüência de DNA. que servirá de molde para a fita de RNA mensageiro. e uma terceira classe de genes que não codificam polipeptídios. Qual o produto final da classe de genes que não codificam polipeptídios? Questão 240 O que são ácidos nucléicos? Como atuam na síntese de proteínas? Questão 241 A figura mostra cinco regiões. Questão 239 Atualmente os genes podem ser desmembrados em três classes diferentes: os genes que expressam mRNA que codificam polipeptídios diversos.5. identificadas por números de 1 a 5. formado por palavras e setas. e o sinal (-) significa ausência de crescimento. demonstrando como.1. a) Quantas uracilas e quantas guaninas comporão a fita do RNA mensageiro transcrito do DNA ativado? b) Quantos aminoácidos deverão compor a cadeia de polipepitídeos que será formada? Justifique sua resposta. Na tabela a seguir. Questão 238 O jornal "Folha de S. o sinal (+) significa crescimento.5 48 .4 a) Faça um esquema simples. é possível percorrer o caminho inverso e chegar à seqüência de DNA que a gerou? Justifique.5. há 30 timinas e 20 guaninas.8.8. No segmento correspondente da fita complementar do DNA há 12 timinas e 10 guaninas. Questão 237 Considere um fragmento de DNA com a seguinte seqüência de bases: GTA GCC TAG e responda: a) Qual será a seqüência do RNAm transcrito a partir deste DNA? b) O mesmo peptídio será obtido a partir deste RNAm e do RNAm da fita complementar? Explique. b) A partir de uma proteína. Levando-se em consideração essas informações. Questão 236 Em um segmento da cadeia ativa de DNA. responda. 1.Paulo" (23.09. os genes reguladores que codificam proteínas que regulam outros genes. Quais dessas regiões correspondem aos íntrons? Justifique sua resposta. obtém-se uma proteína.2002) noticiou que um cientista espanhol afirmou ter encontrado proteínas no ovo fóssil de um dinossauro que poderiam ajudá-lo a reconstituir o DNA desses animais.

extrair os RNA-mensageiros da célula. Após algum tempo. a droga foi também introduzida no meio de cultura. Questão 243 Quais os papéis do gene e do ribossomo na síntese das proteínas celulares? Questão 244 Para investigar possíveis efeitos de uma determinada droga. utilizou-se uma cultura de células. Os resultados do experimento estão mostrados no gráfico a seguir. transcrição e tradução nas células analisadas. proceder ao seqüenciamento das bases presentes nesses DNA.5.8. Indique se a droga interfere em cada uma dessas etapas e justifique suas respostas. b) As proteínas.GAC de um segmento de DNA. respectivamente os aminoácidos arginina. Escreva esses aminoácidos na ordem correspondente à seqüência TGA . ou seja. Cite duas ligações ou interações que atuam na manutenção da estrutura enovelada das proteínas.TCT . leucina e treonina. timidina ¤H e leucina ¢¦N. Ao longo do experimento.Sabe-se que as etapas que levam à síntese da arginina são: substrato ë (gene1) ë ornitina ë (gene2) ë citrulina ë (gene3) ë arginina Supondo que em cada mutante há apenas um gene alterado.5 1. Questão 245 Diversas técnicas são utilizadas para determinar. é possível determinar a seqüência codificante diretamente a partir de seu cromossomo. a) Considere as etapas de replicação. então. marcadas com isótopos: uridina ¢¥C. após sintetizadas. As setas nos gráficos indicam o momento em que foram administrados os antibióticos nas culturas.5 Com base nos gráficos. em genes de uma célula eucariota. explique a atuação dos antibióticos I e II sobre a síntese protéica. 1. hoje. à qual foram adicionadas quantidades adequadas das seguintes substâncias. 49 . Em uma bactéria. CUG. A abordagem experimental mais freqüente. Questão 246 Os gráficos a seguir representam o efeito inibitório de dois antibióticos (I e II) sobre a síntese protéica em culturas de 'Staphylococcus aureus'.8. adquirem uma conformação tridimensional. é preferível utilizar o RNA-mensageiro para determinar a região codificante do DNA. a seqüência de bases nitrogenadas codificantes. Questão 242 Os códons AGA. e ACU do RNA mensageiro codificam. consiste em. explique o porquê do mutante Z só crescer quando se adiciona arginina ao meio de cultura. amostras das células foram coletadas a intervalos regulares. aquela que define a estrutura primária da proteína a ser sintetizada.5. sintetizar os seus DNA-complementares e. primeiramente. Explique o motivo pelo qual. A incorporação dos isótopos foi medida em uma preparação que contém os ácidos nucléicos e as proteínas da célula. no entanto. em organismos eucariotos.

valina-histidina-leucina-treonina-prolina-ácido glutâmico...Essa cadeia de DNA foi usada em um sistema livre de células. ACG. conhecidas como hemoglobinas A e S.5. b) Todas as células..Questão 247 Na espécie humana há dois tipos de hemoglobinas.CCU. serão anômalas? Justifique sua resposta. Os códons de RNA-m que codificam esses aminoácidos são: valina .. CAC leucina . CCA ácido glutâmico . A seqüência de Shine-Dalgarno está em vermelho e o códon de iniciação. UUA treonina . O diagrama a seguir ilustra a localização dessa seqüência. essa cadeia de DNA sempre produzia uma proteína com um único tipo de aminoácido. Essa seqüência.Sintetizaram uma cadeia de DNA com três nucleotídeos repetidos muitas vezes em uma seqüência conhecida: . Essa pequena diferença é suficiente para determinar que uma pessoa portadora de hemoglobina S sofra de anemia falciforme. além do código AUG. que diferem apenas em um aminoácido: Hemoglobina A: . Questão 249 Nos anos 50 e 60. em homenagem aos pesquisadores que as detectaram. GUG.GUU. cada uma delas com um único tipo de aminoácido: serina ou alanina 50 a) Qual é o aminoácido que aparece. o sinal para o início da síntese das proteínas (tradução) é geralmente sinalizado no ARNm pelo códon AUG. No entanto.UUG. que corresponde ao aminoácido metionina.5.CAU.GAG. GUA histidina .valina-histidina-leucina-treonina-prolina-x. porém no qual haviam todos os componentes necessários à síntese protéica.. CCC. em azul.. Diferentes repetições do experimento demonstraram que até três proteínas diferentes poderiam ser produzidas. GUC.Nesse sistema... um grupo de pesquisadores desenvolveu o seguinte experimento: 1. permite que o sítio correto de iniciação da tradução seja selecionado. incluindo os diferentes aminoácidos. .. no lugar do ácido glutâmico? Justifique sua resposta.. a partir da célula que sofre a mutação.5 . ACC. 1. .5 Explique a importância desse duplo controle da iniciação para a tradução correta da mensagem contida no ARNm. que é chamada de Shine-Dalgarno.ACU. .8.. CCG. Hemoglobina S: .8.. ACA prolina . na hemoglobina S. existe uma seqüência curta de nucleotídeos que antecede esse códon. quando se iniciavam as pesquisas sobre como o DNA codificava os aminoácidos de uma proteína.AGCAGCAGCAGCAGCAGCAGCAGC. GAA A mutação pode ocorrer no ADN como mostra o esquema a seguir: Questão 248 Nos procariotos.

Os genes autossômicos A. quantos tipos de albinismo podem ocorrer nessa espécie? Por quê? b) Demonstre o fenótipo esperado de um cruzamento entre animais de linhagens puras com dois tipos diferentes de albinismo. segundo.5 a) Quantos nucleotídeos são necessários para codificar a seqüência de aminoácidos nas espécies 1 e 2? Justifique. qual será a seqüência de bases da fita complementar? b) Se a fita complementar for usada durante a transcrição. Questão 253 Uma fita de DNA tem a seguinte seqüência de bases 5'ATGCGT3'. a lactose não é tão facilmente incorporada pelas bactérias. B e C que atuam nesse processo metabólico. Questão 252 O esquema a seguir representa a seqüência de reações que levam à formação do pigmento da pelagem de uma espécie animal.8. qual será a seqüência de bases do RNA resultante e que nome recebe esse RNA se ele traduzir para síntese de proteínas? Questão 254 1. em quatro espécies próximas.5. levando a mudanças no ciclo de vida da célula. a) Considerando que tenha ocorrido a ação da DNA-polimerase. 1.coli' cresce mais rapidamente na presença da glicose (um monossacarídeo) do que na presença de lactose (um dissacarídeo). Uma mutação gênica pode determinar a alteração ou a ausência de algumas dessas proteínas.ou glutamina. b) Por que podem ocorrer alterações nas proteínas quando o gene sofre mutação? c) Em que situação uma mutação não altera a molécula protéica? Questão 251 Abaixo estão esquematizadas as seqüências de aminoácidos de um trecho de uma proteína homóloga.8. c) Considerando que as espécies 2. porque a lactose necessita ser 51 . B e C produzem respectivamente os alelos recessivos a. Mutações nos genes A. Cada letra representa um aminoácido.5 a) Do ponto de vista genético. 3 e 4 se originaram da espécie 1. b) Pode-se dizer que seqüências idênticas de aminoácidos são sempre codificadas por seqüências idênticas de nucleotídeos? Justifique.5. B e C são responsáveis pela produção das enzimas A. Isso se deve a dois fatos: primeiro. a) Explique a relação que existe entre gene e proteína. c) É possível ocorrer uma mutação em um gene sem que se altere a enzima correspondente? Justifique. a) Por que as proteínas obtidas possuíam apenas um tipo de aminoácido? b) Por que foram obtidos 3 tipos de proteínas? Questão 250 O metabolismo celular é controlado por uma série de reações em que estão envolvidas inúmeras proteínas. que tipo de mutação originou cada seqüência? Sabe-se que a bactéria 'E. b e c.

bem como suas conclusões a partir deste trabalho. patogênicas.9. conhecido como "experiência do liquidificador" na qual utilizaram isótopos radioativos de enxofre (S¤¦) e de fósforo (P¤£) para 'marcar' vírus parasitas de bactérias. resultante do cruzamento entre duas espécies. a concentração de glicose e o número de bactérias no meio de cultura em função do tempo. em pneumococos com cápsula. Questão 256 Como os cientistas O. RESPONDA: a) Qual o número de cromossomos encontrado nas células sexuais normais da égua e do burro? b) Qual o número de cromossomos encontrado nas células somáticas da mula? Como essas células se originam? c) Apesar de a mula apresentar uma alta capacidade de realizar trabalho. ela é estéril.5. Questão 260 O esquema a seguir mostra.5. Questão 258 Descreva o experimento realizado por Hersey e Chase em 1952. concentração de glicose e número de bactérias e explique o comportamento da curva da enzima ’-galactosidase. simplificadamente. M. correlacione os parâmetros concentração de ’-galactosidase. Questão 255 Descreva os principais passos seguidos por Griffth em 1928 no experimento que demonstra a "transformação" de bactérias pneumococos sem cápsula. a) É possível a reprodução dos zigotos pela via da reprodução sexuada? Justifique sua resposta. As curvas no gráfico adiante representam a concentração da enzima ’-galactosidase.hidrolisada pela enzima ’-galactosidase em glicose e galactose. MacLeod e M. Questão 259 A mula é um animal oriundo do cruzamento da égua (2n=64) e do burro (2n=62). b) E é possível pela via da reprodução assexuada? Justifique sua resposta. Avery.coli' foi inoculada num meio contendo uma mistura de glicose e lactose.1 Suponha que os zigotos podem crescer normalmente. 1. não-patogênicas. a formação de um zigoto híbrido. McCarthy chegaram à conclusão. Em relação a esses três animais e ao processo de origem da mula. em 1944. dando origem a indivíduos adultos. 52 . O gráfico a seguir resultou de experimento em que 'E.5 Identifique as curvas da figura. EXPLIQUE os motivos que levam a tal esterilidade.8. de que o "agente transformante" capaz de permitir o desenvolvimento da cápsula em pneumococos não-capsulados era o ácido desoxirribonucléico? Questão 257 O que são bacteriófagos? Qual sua importância na identificação do DNA como material genético? 1.

Esse problema pode ser decorrente da não-disjunção do cromossomo 21 em dois momentos durante a formação dos gametas. ou seja. a) Qual é a aneuploidia existente na Síndrome de Down? b) Quais são os mecanismos responsáveis pelo aparecimento desta aneuploidia? c) Qual é a relação existente entre idade materna e a Síndrome de Down? Questão 265 A Síndrome de Down caracteriza-se pela presença de um cromossomo 21 a mais nas células dos indivíduos afetados. J. sem trissomia do 21. Adaptado de Amabis. Qual o número de cromossomos que deve ser encontrado em um espermatozóide normal nessa espécie? Questão 264 A ilustração adiante mostra o cariótipo de um indivíduo do sexo masculino com Síndrome de Down.1 Uma alteração no DNA pode modificar o funcionamento de uma célula. Considerando a ocorrência de tal não-disjunção. Questão 263 Numa dada espécie. 2002. 53 .5. observou-se que 70% das células apresentavam 47 cromossomos. 1. G.Questão 261 Ao analisar o cariótipo de células obtidas de uma criança com síndrome de Down. Questão 262 Tendo um homem ingerido uma substância que causa erros na divisão meiótica da gametogênese.1 Questão 266 1. por exibirem a trissomia do cromossomo 21. 46 cromossomos.9. responda. um indivíduo trissômico apresenta um cariótipo contendo 97 cromossomos. a não disjunção do cromossomo X e a geração de espermatozóides defeituosos. São Paulo: Moderna. M e Martho. "Biologia das células". observou-se. e que 30% das células apresentavam um cariótipo normal. Responda se o fenômeno da não-disjunção do par de cromossomos 21 ocorreu antes ou depois da formação do zigoto. Justifique sua resposta. Que tipos de anomalias cromossômicas poderão ser formadas se esses espermatozóides fecundarem ovócitos normais? Justifique. a) Em quais momentos ela pode ocorrer? b) Utilize os contornos a seguir para representar uma das duas possibilidades. Por quê? Questão 267 O quadro a seguir destaca dois conceitos biológicos: câncer e sistema respiratório de insetos. neste indivíduo. indicando na lacuna pontilhada qual delas foi escolhida para ser representada.5.9. R.

analisou-se a seqüência de aminoácidos de uma determinada proteína em diversos mutantes gerados. Questão 270 A laranja-da-baía surgiu em 1810 e. Examinando a tabela do código genético a seguir. Verificou-se que um desses mutantes produzia uma dada proteína que diferia da original pela ausência de 35 aminoácidos em uma das extremidades da cadeia peptídica. Explique como essa única mutação pontual pode fazer com que a síntese da proteína seja interrompida prematuramente.5. Questão 271 a) Faça uma breve descrição de como o nefasto hábito de fumar está associado ao desenvolvimento de câncer de pulmão. os seguintes conceitos: tumor. tem sido propagada assexuadamente através de mudas e enxertia. Certo ou errado? Justifique.3 Identifique as duas alterações nos códons do RNA que mais provavelmente explicariam a transformação de ácido glutâmico em valina. na hemoglobina. 54 .9. Questão 272 A anemia falciforme é uma doença que resulta da substituição de um aminoácido ácido glutâmico pela valina.9. b) Descreva o caminho da fumaça de um cigarro desde o meio externo até as células do corpo de uma barata. Após tratar culturas de bactérias com doses de um agente mutagênico capaz de induzir uma única mutação pontual (que afeta apenas um nucleotídeo por célula). não produzindo gametas viáveis. fumo. Atualmente. Questão 269 Qualquer alteração no DNA pode modificar o funcionamento de uma célula? Justifique. Justifique a sua resposta. de forma relacionada. garantindo que em seu texto apareçam. milhões de pés de laranja-da-baía estão espalhados em plantações no Brasil e nos Estados Unidos. sua meiose é anormal. Por ser uma variedade triplóide (3n) de laranja.5. 1. Justifique sua resposta.3 Identifique qual(is) deste(s) fator(es) pode(m) contribuir para a variabilidade genética da laranja-da-baía. por não possuir sementes. Questão 268 A substituição de uma única base na molécula de DNA leva necessariamente à substituição de um aminoácido na proteína a ser sintetizada pela célula. mutação. Sabe-se que a variabilidade genética de uma população depende dos seguintes fatores: 1) permutação cromossômica ou crossing-over (troca de fragmentos entre cromossomos de um mesmo par de homólogos). e 3) segregação independente (recombinação aleatória de cromossomos dos diferentes pares de homólogos). genes reguladores da divisão celular.2) mutação (modificação da seqüência de nucleotídeos de uma molécula de ADN). é possível identificar as alterações no RNA que formam o códon da valina na hemoglobina da anemia falciforme. 1. proliferação celular descontrolada.

a) Qual a vantagem desse tipo de mutação no aparecimento de novas espécies? b) Se uma mutação gênica ocorre em um dos genes duplicados. é mais drástica que a situação "b".BOMBA ATÔMICA SESSENTA ANOS DE TERROR NUCLEAR Destruídas por bombas. a) Que relações podem ser estabelecidas entre as informações I e II? Inclua na sua resposta os conceitos de "mutação gênica".5. Enviado especial Hiroshima. Hiroshima e Nagasaki hoje lideram luta contra essas armas Domingo. Questão 277 FIM DA 2 GUERRA MUNDIAL . manter uma especialização característica apropriada e ocupar o lugar apropriado. II. Explique por quê.Questão 273 As seqüências de RNA mensageiro a seguir codificam peptídeos com atividades biológicas específicas. Questão 276 Entre os diferentes tipos de processos que criam nova variabilidade genética. 31 de julho de 2005 . Sabe-se que essas funções são geneticamente controladas. o indivíduo morre? Justifique sua resposta.9. Japão "Shizuko Abe tinha 18 anos no dia 6 de agosto de 1945 e. a duplicação gênica é muito importante na criação de novidades evolutivas. As células devem dividir-se e conter a divisão.A. um determinado gene. I. de forma que o indivíduo passa a apresentar uma ou mais cópias do mesmo gene no mesmo cromossomo. Questão 275 Em um segmento de DNA que codifica determinada proteína. sempre de acordo com as necessidades do organismo. Diedrin e Aldrin.3 Em qual das mudanças (1 ou 2) há risco de perda ou de diminuição da atividade biológica? Justifique sua resposta. A tabela resumida do código genético mostra alguns códons e seus aminoácidos correspondentes. como todos os jovens japoneses durante a Segunda Guerra Mundial. agente de natureza biológica que podem aumentar a taxa de mutações gênicas. com resíduos de Endrin. fazendo com que o gene não funcione. Questão 274 Analise as seguintes informações. aumentando assim a probabilidade de desenvolvimento de câncer."O GLOBO" Gilberto Scofield Jr. geralmente. A situação "a". Nesse tipo de mutação. Um aumento significativo no número de casos de câncer na região tem sido associado à exposição dos moradores a essas substâncias. ela havia abandonado os estudos para se dedicar ao esforço de guerra. Shizuko e seus colegas iniciavam a derrubada de parte das casas de madeira do centro de Hiroshima para tentar criar um cordão de isolamento antiincêndio no caso de um bombardeio incendiário aéreo. Era um dia claro e quente de verão e às 8h. Suponha que mutações no DNA tenham causado as seguintes mudanças nas duas moléculas de mRNA (1 e 2). tem sua seqüência duplicada e acrescentada ao DNA. "agentes mutagênicos". "descontrole dos mecanismos de divisão celular" e "câncer". A renovação dos tecidos requer um controle complexo para coordenar o comportamento de células individuais e as necessidades do organismo como um todo. b) Dê exemplos de um agente de natureza física e de um . além de replicar-se. b) um nucleotídeo é substituído por outro. foi responsabilizada pela contaminação das áreas em torno de sua fábrica de agrotóxicos em Paulínia. Àquela altura. 55 1. Em 2001 a indústria Shell do Brasil S. considere duas situações: a) um nucleotídeo é suprimido. SP. sobreviver e morrer.

Questão 282 Sobre a vacina. as populações dessas cidades continuam a ser monitoradas. O sistema imunitário age para combatê-las.10 56 . "Hiroshima. Com base nos efeitos biológicos das radiações sobre os seres vivos.A ação imediata ou não 3. uma reação inicial inespecífica é efetuada por células do sangue.A duração da imunização 4. os monumentos às vítimas do terror atômico estão em todos os lugares". no Japão. Apesar de rica e moderna com seus 1. por exemplo num ferimento. Japão. Questão 278 Os recentes testes nucleares e o cinqüentenário da explosão da bomba atômica em Hiroshima e Nagasaki em 1995 provocaram discussões sobre os efeitos da radiação no meio ambiente e nos seres humanos.1 milhão de habitantes circulando em bem cuidadas ruas e avenidas. Questão 281 Explique o que é uma vacina e como funciona. aponte dois motivos pelos quais essas populações humanas devem ser monitoradas ainda hoje. Dados mostram que a incidência do câncer nas duas cidades japonesas é muito alta. que é transmitida pela picada da mosca tsé-tsé. a) Como a radiação está relacionada ao aumento na incidência de câncer? b) Como se explica que muitos dos efeitos da bomba atômica se manifestem nos descendentes dos sobreviventes? c) Por que algumas pessoas que foram viver nessas cidades tempos depois da explosão também foram afetadas? Questão 279 Soros e vacinas fazem parte do arsenal usado no combate às doenças infecciosas (imunidade adquirida). para o qual os abrigos antiincêndio foram inúteis". muito mais devastador e letal. 1. e entrar em nosso corpo.ninguém imaginava que Hiroshima seria o laboratório de outro tipo de bombardeio.O emprego curativo ou preventivo Questão 280 As bactérias podem vencer a barreira da pele.A natureza da imunização 2. Após sessenta anos da explosão da bomba atômica sobre as cidades de Hiroshima e Nagasaki. numa população de 400 mil . Compare. respectivamente. a ação do soro e da vacina segundo estes tópicos: 1. Passear pelas ruas de Hiroshima hoje 60 anos depois da tragédia que matou 140 mil pessoas e deixou cicatrizes eternas em outros 60 mil. b) Indique a reação de combate que é específica para cada agente infeccioso e as células diretamente responsáveis por esse tipo de resposta.5. O estudo da reação imunitária do organismo humano aos antígenos da superfície dos parasitas está demonstrado no esquema abaixo. Indique o processo que leva à destruição do patógeno bem como as células que o realizam.é nunca esquecer o passado. responda: a) Para que é usada? b) De que é feita? c) Como funciona? Questão 283 Um protozoário conhecido como 'Trypanosoma gambiense' provoca no homem a chamada "doença do sono". a) Nesse combate.

deve ser repetido a intervalos de tempo relativamente curtos. b) Justifique o aumento do número de parasitas com antígeno B na semana 2. fungos. em casos mais graves. b) Na eritroblastose fetal. suspeitou-se de que um dos indivíduos fosse originário de uma região onde a infeção pelo vírus X atinge grande número de indivíduos. João. Bactérias. podem ser reconhecidos pelo organismo como agentes agressores. Escreva a importância da amamentação PARA A MÃE E PARA O FILHO. a partir da segunda gravidez. precisa de um transplante de um órgão. Dois dos filhos do casal são gêmeos monozigóticos e os outros dois são gêmeos dizigóticos. Questão 284 A função do sistema imunológico é a de defender o organismo contra invasores. Com base nas respostas de cada um deles ao antígeno. o primeiro filho nunca é afetado. porém. de aceitar uma criança no próprio peito. Justifique por que esse tratamento deve ser feito logo após a picada do animal e. A doença só se manifesta. em duas condições: vacinação ou soroterapia. Questão 285 O termo amamentação designa o ato de amamentar.5. Qual seria a pessoa da família mais indicada para ser o doador? Justifique sua resposta. Qual dos dois indivíduos é originário da região com alta incidência do vírus X? Justifique. A esse respeito. representa a maneira mais eficiente e prática de alimentar e nutrir o filho sem os riscos que a alimentação artificial pode oferecer. Questão 288 As curvas abaixo mostram a produção de anticorpos específicos de dois indivíduos inoculados com antígenos protéicos do vírus X no dia 0. Questão 287 Um casal tem quatro filhos: João.a) Explique por que os parasitas com antígeno A desapareceram na semana 2 e cite o principal tipo celular participante da reação responsável por esse desaparecimento. Explique por que. vírus. um dos gêmeos monozigóticos. Maria. a mãe produz anticorpos contra o fator Rh do filho. b) apresente um exemplo de imunização ativa artificial e um de imunização passiva natural. Indique a condição que deve estar presente no feto para o desenvolvimento da eritroblastose em filhos de mulheres que não produzem fator Rh. Questão 286 As respostas imunológicas constituem mecanismos de defesa vitais para os organismos. 57 . Mais do que um simples ato de amor.10 Um dos gráficos mostrados corresponde à variação da concentração de anticorpo antiofídico no sangue de uma pessoa mordida por uma serpente e tratada com uma dose do soro apropriado. e mesmo simples moléculas. a) Os gráficos a seguir mostram a variação da concentração de anticorpos contra um determinado antígeno no sangue de uma pessoa. 1. por que. mesmo nessas circunstâncias. em função do tempo. a) explique a diferença entre a resposta ativa e a passiva. tecidos ou órgãos transplantados. Paulo e Luisa.

Estes testes geram resultados semelhantes para animais vacinados e animais que contraíram a doença. As restrições à importação de carne se baseiam no fato de que os testes disponíveis utilizam a detecção de anticorpos contra o vírus. e não a detecção do próprio vírus na carne. O gráfico a seguir reproduz os dois momentos em que ocorreram as contaminações.10 Questão 289 A febre aftosa é uma doença virótica que afeta diversos animais de importância econômica.1. enquanto a linha contínua representa a SUBSTÂNCIA ESPECÍFICA. A figura a seguir. por exemplo. Para tratá-la o médico introduziu em seu organismo uma substância específica. pelo médico. Determine se os resultados dos testes seriam positivos ou negativos tanto para animais infectados quanto para vacinados. Questão 290 A resposta imune de seis voluntários a três diferentes antígenos (A. Justifique sua resposta. a) Explique por que a imunidade de grupo é eficiente no controle de doenças como a gripe. Com base nos resultados apresentados. dificultando as relações comerciais internacionais. como medicamento. 58 . O voluntário 6 não recebeu nenhum dos antígenos.10 1. de origem orgânica. Questão 292 Uma pessoa foi contaminada por uma substância tóxica. B e C no soro de cada um dos voluntários. Tal fenômeno é denominado imunidade de grupo. Justifique sua resposta.5. mas sim uma substância inócua (placebo) para servir de controle negativo. Cinco meses depois desse evento. Países que não vacinam seus rebanhos contra febre aftosa restringem a importação de carne de países onde a vacinação ocorre. Questão 291 No caso de algumas doenças infecciosas. pode-se considerar que toda a população está protegida se uma alta proporção dos indivíduos estiver imunizada. avalie se a estratégia de vacinação com esses antígenos seria eficaz. que mostra o título (quantidade) de anticorpos específicos contra os antígenos A. a pessoa foi novamente contaminada e outra vez a substância específica foi usada. B e C) do parasita causador da malária (plasmódio) foi testada em uma pesquisa.5. b) Explique por que a imunidade de grupo não é eficiente no controle de doenças como. tais como vacas e ovelhas. o cólera e a hepatite. indica os resultados observados. A linha pontilhada representa a SUBSTÂNCIA TÓXICA.

a) A que tipo de imunização se referem as aplicações? b) Analise os resultados apresentados pelo gráfico e explique o fato observado com a 2 aplicação do antígeno. Questão 293 O gráfico a seguir mostra as respostas primária e secundária da produção de anticorpos quando um indivíduo é submetido a injeções de antígenos. que descreve causas de óbitos humanos nos Estados Unidos no início e no final do século XX. Todas eram ordenhadoras e tinham se contaminado com "cowpox".10 1. Questão 295 Analise o gráfico.5. Edward Jenner. uma doença do gado semelhante à varíola pela formação de pústulas. Questão 296 Leia os seguintes fragmentos de textos: 1. um médico inglês.5.10 A substância específica de combate. Considerando que esse quadro retrata as condições encontradas em outros países industrializados.10 1.5. responda: a) Qual a função do antígeno e qual curva corresponde às respostas primária e secundária? b) Explique o que acontece em relação aos anticorpos nas fases das respostas primária e secundária. 1.1. mas que não causava a morte dos animais. Após uma série de experiências.10 Analisando o gráfico. responda. constatou que estes indivíduos mantinham-se 59 . em intervalos diferentes. é um soro ou uma vacina? Justifique sua resposta. observou no final do século XVIII que um número expressivo de pessoas mostrava-se imune à varíola.5. Questão 294 O gráfico representa o resultado de duas aplicações de um mesmo antígeno. a) Que tendência pode ser observada quando se comparam as taxas de mortalidade por doenças contagiosas e por doenças degenerativas (também chamadas "doenças da velhice") no início e no final do século XX? b) Cite dois fatores que podem explicar as mudanças observadas nas taxas de mortalidade por doenças contagiosas. inoculada no paciente.

5. nos dois gráficos. b) Considere. é constituído por diferentes tipos de glóbulos brancos e pelos órgãos responsáveis pela produção e maturação desses glóbulos. a vítima deve ser tratada com soro antiofídico. que havia sido mordido por um cão raivoso.refratários à varíola. 1 ou 2. Questão 300 Procurando compreender a importância de determinadas células sangüíneas para o sistema imunológico. nos fragmentos de textos 1 e 2? Que relação existe entre o fenômeno observado no relato 1 e as chamadas células de memória? Questão 297 Jararaca. cascavel. refere-se a processos de imunização passiva? Justifique sua resposta.fiocruz. a) Explique como macrófagos.10 (Programa Nacional de Imunizações. mesmo quando inoculados com o vírus. Joseph Meister. O sistema imunitário. Ministério da Saúde. É mais correto supor que. chegava ao laboratório de Louis Pasteur um menino alsaciano de nove anos. A 6 de julho de 1885. foram 13 inoculações. Ao todo. b) Que tipos de produtos (medicamentos) puderam ser produzidos a partir das experiências relatadas.) a) O gráfico 2 indica claramente a ocorrência de epidemias de sarampo em dois anos distintos no Brasil. O soro antiofídico poderia ser denominado vacina antiofídica? Explique. de 1982 a 1997. 1. cada uma com material mais virulento. os resultados representados no gráfico 1 tenham influenciado os resultados representados no gráfico 2 ou o inverso? Justifique. Questão 298 Os médicos verificam se os gânglios linfáticos estão inchados e doloridos para avaliar se o paciente apresenta algum processo infeccioso. que atua no combate a infecções. Meister não chegou a contrair a doença. foi feito o seguinte experimento: 60 . Gráfico 2: Taxa da incidência anual de sarampo em menores de um ano no Brasil. b) Explique que mecanismos induzem a proliferação de linfócitos nos gânglios linfáticos.br) a) Qual dos fragmentos.br) 2. Gráfico 1: Cobertura da vacinação contra sarampo em menores de um ano no Brasil. injetou na criança material proveniente de medula de um coelho infectado. (www.bio. que vinha desenvolvendo pesquisas na atenuação do vírus da raiva. respectivamente. Se picada por uma delas.bio. linfócitos T e linfócitos B atuam no sistema imunitário. Questão 299 Observe atentamente os dois gráficos apresentados. de 1980 a 1997. (www. Pasteur. coral e urutu são exemplos de cobras venenosas que ocorrem no Brasil. o ano de 1997. ao longo desse ano. é mais eficiente o uso do soro ou da vacina? Justifique.fiocruz. Para reduzir rapidamente e de imediato o número de doentes durante uma epidemia.

1. Questão 305 Em um concurso de cães. qual é a proporção de cada classe fenotípica obtida em F‚? Questão 304 A altura dos espécimes de uma determinada planta encontrada no cerrado varia entre 12cm e 108cm. Determine a massa do fruto de uma planta de genótipo AABb. não contribuem para o acréscimo de massa. Sabendo-se que o peso do fruto é um caso de herança quantitativa. mais pontos que os recessivos. independentes e de ação cumulativa (polimeria). Justifique sua resposta. O homozigoto dominante para estas duas características recebe mais pontos que os heterozigotos e estes. obtendo uma descendência com todos os genótipos possíveis. 61 Com base no exposto. que interferem igualmente na altura da planta. Qual o nome que se dá a esse método profilático? Questão 301 Atualmente. reponda: a) quantos pares de genes estão envolvidos na determinação do peso dos frutos desta espécie vegetal? b) qual é o efeito aditivo de cada gene? c) de acordo com o triângulo de Pascal. a) Que tipo específico de célula sangüínea foi afetada pela irradiação? b) Que tipo de molécula essa célula do sangue passa a produzir quando estimulada pela proteína estranha? c) A introdução de moléculas estranhas ao organismo com o objetivo de provocar uma resposta imune é um método bastante usado na prevenção de determinadas doenças. Do cruzamento entre linhagens homozigóticas que produzem frutos de 150g. o Governo Federal vem discutindo a implantação de quotas para negros nas universidades. qual a importância da existência dessa variabilidade na cor da pele para o ser humano? d) Especifique a forma de herança genética responsável pela determinação da cor da pele. desejando participar do concurso. alelos de A e B . autofecundada. originou 7 fenótipos diferentes. cruzou um macho e uma fêmea.5. Questão 303 O peso dos frutos (fenótipos) de uma determinada espécie vegetal varia de 150g a 300g. Determine a altura.10 respectivamente. Um criador. histológica e citologicamente a cor da pele? Histologicamente: Citologicamente: b) O que confere a diferença na cor da pele de indivíduos negros em relação à dos indivíduos brancos? c) Evolutivamente. ambos heterozigotos para os dois genes. Os responsáveis por essa variação são 3 pares de genes com segregação independente. em centímetros. responda às perguntas a seguir. esperada para a primeira geração de um cruzamento entre dois indivíduos com os genótipos AABBCC e aabbCC. duas características são condicionadas por genes dominantes (A e B). não alelos. obteve-se uma geração F que. com linhagens homozigóticas que produzem frutos de 300g. Os genes a e b. O fruto de uma planta de genótipo AABB tem 40 gramas de massa enquanto o de uma planta de genótipo aabb tem 20 gramas. Questão 302 A massa de um determinado tipo de fruto depende da ação de dois genes A e B. que ganham nota zero. Esses genes contribuem com valores idênticos para o acréscimo de massa. Considerando a cor da pele de negros e de brancos responda: a) Onde é determinada.

respectivamente. e que cada gene dominante contribui com 5 pontos na premiação. responda ao que se pede: a) Quantos alelos estão envolvidos na determinação do caráter cor de fruto e qual a relação de dominância entre eles? b) Qual a proporção genotípica e fenotípica do cruzamento entre plantas de fruto vinho do cruzamento parental (2) com plantas de fruto vinho do cruzamento parental (4)? c) Quantas plantas com frutos amarelos serão geradas. Qual dos dois mecanismos explica a maior parte das variações fenotípicas nas populações? Justifique. quantos pontos devem ter obtido os vice-campeões e os cães classificados em penúltimo lugar? Questão 306 Certas características fenotípicas são determinadas por poucos genes (herança mendeliana). possíveis na população? .12 1.5. Questão 308 Admitamos que numa certa espécie de animal quatro alelos (A.a) Qual a probabilidade do criador obter um animal com a pontuação máxima? Qual a probabilidade de obter um animal homozigoto recessivo para os dois genes? b) Considerando que todos os descendentes do referido cruzamento participaram do concurso. II) apenas flores de rosa médio. himalaio e albino.11 Com base nos resultados apresentados. A4). enquanto outras são determinadas por muitos genes (herança poligênica). A2. a partir de 200 sementes oriundas do cruzamento entre plantas de frutos vinho do cruzamento parental (4) com plantas de frutos rosa do cruzamento parental (2)? Questão 311 Uma determinada característica depende de um locus que possui 4 alelos (A1.5. d¢ e d£) tem seu locus no cromossomo II. a¢. Outra característica também depende de 4 genes (B1. Questão 307 Um pesquisador cruzou paineiras de flores "pink" com paineiras de flores brancas. A3. quantos genótipos diferentes são. porém são 62 a) Qual o tipo da herança da cor da flor da paineira? b) Indique as possibilidades de se obter em um cruzamento: I) apenas flores de cor branca. 1. Em relação a essas duas séries de alelos. produzindo sempre as seguintes freqüências fenotípicas na geração (F‚): Questão 309 A cor da pelagem em coelhos é determinada por uma série de alelos múltiplos composta pelos genes C. O cruzamento entre plantas com esses fenótipos produziu as seguintes proles na geração F1. Responda: a) Quais as proporções fenotípicas e genotípicas esperadas na progênie do cruzamento entre um coelho aguti (Cc¢) e um coelho chinchila (c£c¤)? b) Como você explicaria o aparecimento de coelhos albinos a partir de um cruzamento entre coelhos himalaios? Questão 310 As videiras podem produzir uvas de coloração vermelha. a£ e a¤) tem seu locus no cromossomo I e outra série de três alelos (D. A ordem de dominância existente entre os genes é C > c¢ > c£ > c¤. B2 e C1. c¢. responsáveis pelos fenótipos aguti. teoricamente. vinho. C2). chinchila. Os descendentes (F) foram cruzados entre si. c£ e c¤. rosa e amarela.

os cinco alelos. quantos terão o olho de cor marrom? Questão 313 Um organismo. 30% entre A e D. produzir um único carro que funcione". Cada loco tem dois alelos "A" e "a" e "B" e "b". a partir do gene A? b) Justifique sua resposta. . Em abelhas. Questão 314 O cruzamento CD/cd x cd/cd produziu 600 descendentes. porém. Quantos deverão ser diferentes dos pais. O retrocruzamento de F1 (com o duplo recessivo) mostra os seguintes resultados: . é cruzado com outro. sabendo-se que a freqüência de permutação é de 10%? Questão 315 Que tipos de gametas e em que proporções produzirá um organismo com genótipo Cd/cD. com eles. sabendo-se que a freqüência de permutação é de 36%? Questão 316 Quais são os gametas produzidos por um indivíduo de genótipo Ab/aB? Em que proporções serão formados sabendo-se que os genes A e b permutam com uma freqüência de 16%? Questão 317 Considere a existência de dois locos em um indivíduo. qual o número esperado de machos e de fêmeas na descendência? Dos machos esperados. Esses resultados contrariam a segunda lei de Mendel ou lei da segregação independente? Justifique sua resposta. Questão 318 Sabendo que a maioria das mutações é deletéria (prejudicial ao organismo). heterozigota para pérola. outro com o motor quebrado e. . durante a produção de gametas: "A meiose é o equivalente a ter dois carros. 25% para cada um deles. A prole resultante foi: 40% AaBb 40% aabb 10% Aabb 10% aaBb O pesquisador ficou surpreso. Questão 312 Em abelhas. a) Baseando-se nos resultados acima. que descendência resulta deste processo? b) Na inseminação realizada.ocorreu 10% de permuta entre os genes B e D. Um pesquisador cruzou um indivíduo "AaBb" com um indivíduo "aabb". produziu 600 ovos e foi inseminada artificialmente por espermatozóides que portavam. constituída por cinco alelos. qual é a seqüência mais provável desses 4 genes no cromossomo. Identifique esses genótipos. a) O que é partenogênese? Em abelhas. A figura a seguir ilustra um par de cromossomos homólogos duplicados (A e B).ocorreu 20% de permuta entre os genes A e B. Uma rainha de olho marrom. pois esperava obter os quatro genótipos na mesma proporção. Um desses dois tipos de determinismo genético apresenta um número maior de genótipos possíveis na população. um com a transmissão quebrada. o evolucionista John Maynard-Smith escreveu sobre a meiose. sendo que "A" e "B" são dominantes. bem como as localizações 63 . homozigoto para os genes A B C D.dois pares de alelos localizados em pares de cromossomos homólogos diferentes. a cor do olho é condicionada por uma série de alelos múltiplos.não ocorreu permuta entre os genes A e C. que é homozigoto recessivo para os mesmos alelos. Somente 40% dos ovos dessa rainha foram fertilizados e toda a descendência teve a mesma oportunidade de sobrevivência. com a seguinte relação de dominância: marrom>pérola>neve>creme>amarelo. existe um processo denominado partenogênese. em proporções iguais. todos localizados em um mesmo cromossomo.

Um indivíduo homozigótico para os alelos M. no Sul do país. A causa da doença da menina era um defeito em um gene que codifica a enzima adenosina desaminase (ADA). Responda. 08/09/2000) Explique a vantagem da utilização. de maneira geral. hoje. A descendência desse retrocruzamento apresentou 15% de permuta entre os locos M e N. Não houve descendentes com permuta entre os locos M e P. A técnica combina o uso de células-tronco de embriões e terapia genética. que viveu sua curta . Questão 319 Os locos M. se ingeridas. homozigótico para os alelos m. 25% de permuta entre os locos M e O. P foi cruzado com outro. "Engenharia Genética e Biotecnologia". pois estas são de fácil obtenção e de fácil reintrodução no corpo. separaram os linfócitos (células brancas) e usaram um retrovírus para introduzir uma cópia correta do gene nestas células. indicando as distâncias entre os locos. Então eles reintroduziram os linfócitos na paciente. o. Questão 322 CÉLULAS-TRONCO PODEM TRATAR LESÕES CEREBRAIS Empresa usa unidade estrutural de embriões para recuperar vítimas de derrame. p.. explique em que consistem. os tratamentos denominados "terapia gênica".5. Massey. Esta criança possuía um sistema imune extremamente deficiente e não podia defender-se contra infecções. (Adaptado de "O Globo". a) Qual a seqüência mais provável desses locos no cromossomo? Faça um esquema do mapa genético desse trecho do cromossomo. Porto Alegre. p. Questão 321 Alguns grupos radicalmente contrários ao uso de organismos geneticamente modificados (transgênicos) na agricultura divulgaram recentemente. um folheto à população alertando sobre os perigos da ingestão de transgênicos na alimentação.) a) A partir do exemplo apresentado no texto. A paciente foi uma menina com a doença da imunodeficiência combinada severa. a menina é mais saudável do que antes. b) Por que não houve descendentes recombinantes com permuta entre os locos M e P? Questão 320 O primeiro teste de terapia gênica humana utilizou células sangüíneas. b) Selecione e transcreva o segmento do texto que justifica a afirmação de que a terapia gênica é um exemplo de engenharia genética.13 vida em um ambiente estéril. o. n. Sua doença era a mesma que a do "menino da bolha". H. 10% de permuta entre os locos N e O. poderiam infectar com o vírus da AIDS toda a população. A. A geração F foi então retrocruzada com o homozigótico m. n. no procedimento 64 Um indivíduo que possui os cromossomos A e B poderá formar gametas que não sejam portadores dos alelos M e N? Justifique sua resposta. (Kreuzer. a) O que são transgênicos ou organismos geneticamente modificados (OGMs)? b) Explique por que o vírus da AIDS não poderia infectar uma planta e por que a ingestão de uma planta transgênica não seria capaz de transmitir o vírus da AIDS. Entre as advertências. N. Artmed. As células alteradas produziram a enzima que faltava e. constava uma que afirmava incorretamente que "para serem criadas plantas transgênicas são usados os vírus da AIDS" e que tais plantas. Os cientistas do National Institute of Health dos Estados Unidos coletaram sangue da menina. 1. P estão localizados em um mesmo cromossomo. N.dos alelos deletérios "M" (presente somente no cromossomo A) e "N" (presente somente no cromossomo B). 2002. O. O.

no qual todas as células são inicialmente indiferenciadas. origina outro organismo. Em uma delas. Questão 323 Dois cientistas realizaram uma experiência com o objetivo de estudar a transmissão das informações contidas nos genes do núcleo de células de diferentes tecidos. previamente anucleado. postulava-se a idéia de que ocorria perda de material genético enquanto a célula se diferenciava. Admitindo-se a possibilidade de clonar seres humanos e com base no que tem sido publicado nos principais jornais e revistas do País. Questão 324 A figura a seguir (Folha de São Paulo. o qual afirma que cenas como estas não só são possíveis. que a diferenciação não implicava perda de DNA. e deu origem a um novo ser. com seus novos núcleos. nos quais o núcleo da célula de um tecido de um indivíduo adulto é introduzido em um ovócito anucleado que. Esse processo é conhecido como diferenciação celular.1 . havia duas hipóteses a respeito da diferenciação celular. resultaram na formação de embriões normais. ao 2 ou ao 3? Justifique sua resposta. Questão 325 Em uma experiência de reprodução com uma espécie de mamífero adotou-se o seguinte procedimento: fundiu-se uma célula do indivíduo 1 com um óvulo. até o estágio adulto. retiradas de uma mesma rã. Os cientistas observaram que a grande maioria destas células. Justifique sua resposta. Cientistas da Universidade do 65 1. H2. de células-tronco ao invés de células já diferenciadas. Explique por que: a) esses núcleos transplantados de células somáticas de diferentes tecidos deram origem a indivíduos normais e idênticos. Identifique qual das duas hipóteses é confirmada pelos processos de clonagem. composto por até centenas de diferentes tipos de células. Questão 326 No desenvolvimento de um organismo ocorre a transição de um estágio embrionário. Esse novo ser é geneticamente idêntico ao indivíduo 1. Núcleos de óvulos de rã não-fertilizados foram substituídos por núcleos de células somáticas. responda: a) Como o bebê da figura acima poderia ter sido gerado? b) Qual seria o sexo do bebê gerado por esse processo? Justifique sua resposta.5. A célula assim formada foi implantada no útero do indivíduo 3. ao se desenvolver. Historicamente. b) o resultado da experiência seria diferente se tivessem sido usados núcleos de células germinativas. do indivíduo 2. 6/8/98) baseia-se no livro Remaking Eden (Refazendo o Éden) de Lee Silver. Na segunda. que chamaremos de H1.descrito.15. desenvolveu-se. como inevitáveis. Questão 327 "CIENTISTAS DA UNIVERSIDADE DO HAVAÍ CLONAM MAMÍFERO ADULTO DO SEXO MASCULINO A clonagem deixou de ser uma técnica aplicável exclusivamente às fêmeas.

3 . caso um dos animais seja sensível a uma bactéria que cause pneumonia? b) Justifique sua resposta. Considere a possibilidade de que o DNA obtido pertença a um único dinossauro e que deste DNA foram recuperados vários exemplares. Z ou W? Justifique. Questão 330 No início deste ano.89.O embrião é reimplantado no útero de um terceiro animal (animal W) dando origem a um novo animal. chegando-se assim à fórmula para recuperar a espécie. de maio/junho de 1997. O núcleo de cada um desses óvulos é retirado. a) O que se poderia dizer dos exemplares recuperados. através da formação de rebanhos homogêneos. como havia sido feito até agora. I e II. um cientista cria em laboratório novas gerações de dinossauros.Cada metade é reimplantada no útero de outra fêmea (receptora)..Essa fêmea é então inseminada artificialmente. ocorrem naturalmente no cotidiano. os zigotos são retirados da fêmea e divididos em dois. lembra o geneticista Ademar Freire Maia em um artigo do Boletim "Germinis" do Conselho Federal de Biologia.Uma fêmea (animal X) é estimulada com hormônios a produzir vários óvulos.Após alguns dias. foi possível determinar o DNA dos dinossauros. por meio do sangue conservado em mosquitos que os teriam picado e que permaneceram fossilizados no âmbar.) Agora. Trata-se de um camundongo batizado de Fibro. Um dos objetivos dessa pesquisa é a melhoria da pecuária..O núcleo retirado da célula somática do animal Y é implantado no óvulo sem núcleo do animal Z. extintos há 65 milhões de anos. que poderiam ser usados e que estão descritas nos quadros." Questão 329 Respondendo a uma questão sobre a possibilidade de se clonarem animais para livrá-los de extinção. os cientistas criaram Fibro a partir de um pedaço do rabo de um camundongo. da mesma espécie. os pesquisadores Ryuzo Yanagimachi e Teruhiko Wakayama mostram que um macho adulto também pode ser replicado. e descartaram seus núcleos. Clones. Em vez de utilizar células relacionadas ao sistema reprodutivo feminino para preencher os óvulos. O material foi substituído por células extraídas da cauda do doador. Apenas 274 embriões resultaram dessa operação e foram implantados em 25 ratinhas que funcionaram como 'mães de aluguel'. 2 . Por que os cientistas extraíram os núcleos dos óvulos antes de inserir as células da cauda do doador? Questão 328 No filme "Parque dos Dinossauros". 3 . uma brincadeira com a palavra fibroblasto. p. produzidos por ratas. das quais são retirados os núcleos. b) O novo animal formado pela técnica II pode ser chamado "clone" do animal Y. segundo trabalho publicado na revista "Nature Genetics". 4 . A nova célula assim formada começa a se dividir formando um embrião. 2 . TÉCNICA II 1 . considerada o primeiro clone de mamífero gerado artificialmente.1 Adaptado da Revista Época: Ano II. 4 . Eles colheram 700 óvulos.Havaí clonaram o primeiro mamífero adulto do sexo masculino. no entanto.Óvulos não fecundados são retirados de um segundo animal (animal Z). 66 1. tipo de célula usada na criação do animal (. nŽ55. Com o sangue.5. . TÉCNICA I 1 . 7/6/99.Células somáticas são retiradas do corpo de um animal (animal Y). pesquisadores anunciaram o nascimento da ovelha Dolly. um cientista apresenta duas técnicas.15. gerando um novo animal. Pergunta-se: a) Todos os animais produzidos pela técnica I são genotipicamente iguais ao animal X? Justifique. a) Qual seria a desvantagem biológica de um rebanho de clones? b) Dê um exemplo de clone que ocorre naturalmente.

IV e V). no caso do tratamento da talassemia.5. uma promessa da biotecnologia moderna. indicado em lagumas figuras. na talassemia. Em um outro camundongo jovem. A seguir. b) Indique qual dos retrovírus modificados.X representa o trecho de ácido nucléico viral. as matariam. que contém a informação para a síntese da cadeia ’ da globina. seria o mais indicado para ser usado nesse tratamento. Justifique sua resposta. comparando com o crescimento de um camundongo. as células retiradas da medula óssea são as indicadas para serem infectadas com as partículas virais adequadamente modificadas. contendo a informação para a síntese da ’-globina. Questão 332 A terapia génica.Justifique. estão esquematizadas a partícula viral original. Algumas metodologias em estudo utilizam retrovírus modificados como veículo de introdução do gene desejado. III. Por exemplo. elabore uma hipótese para a causa da diferença no crescimento dos camundongos 1 e 2. deveriam ser realizadas três etapas: 1. Questão 331 Um pesquisador construiu um camundongo transgênico que possui uma cópia extra de um gene Z. que codifica as proteínas necessárias para a formação de novas partículas virais no interior da célula hospedeira. b) Com base em sua resposta ao item a. 1. poderia ser usado um retrovírus modificado. Nesse caso. consiste na cura de defeitos genéticos pela introdução de genes normais em celulas de indivíduos doentes. na ausência do gene de resistência. não transgênico e com hipófise. apresentados nos esquemas acima. a) Explique por que. .15. antes da . doença caracterizada pela produção de hemoglobina anormal devido a uma deleção no gene que codifica a cadeia ’ da globina. reintroduzir as células infectadas no paciente. para que essas sejam infectadas. estudou o crescimento desses camundongos.15.2 1. coletar células da medula óssea do paciente.o símbolo esférico e negro.2 a) Explique a causa da diferença no crescimento dos camundongos 2 e 3. Obteve as seguintes curvas de crescimento corporal: manipulação (Esquema I) . realizou uma cirurgia e removeu a hipófise. . Em seguida. Entre as várias estratégias de produção de plantas transgênicas. e quatro diferentes partículas virais modificadas (Esquemas II.Y representa o trecho de ácido nucléico introduzido. destacamos duas: 1) Plantas resistentes a certos vírus patogênicos que. indica que a partícula viral contém as enzimas transcriptase reversa e integrase (insere o material genético de origem viral no genoma da célula). colocar as células coletadas em contato com o retrovírus modificado. 67 . Questão 333 As técnicas modernas de engenharia genética tornaram possível a produção de plantas transgênicas que possuem genes introduzidos artificialmente no seu genoma. 2. 2) Plantas mais resistentes aos efeitos dos defensivos agrícolas (agrotóxicos). 3.5. Essas plantas toleram concentrações maiores de agrotóxico sem alterar as propriedades tóxicas dos defensivos agrícolas.

o qual inclui uma dieta restritiva à fenilalanina.15. Questão 335 entre espécies distintas. Um casal apresenta. pontos de quebra por enzimas especiais. por que o tratamento iniciado logo após o nascimento. c) Indique um benefício decorrente da utilização de organismos transgênicos e um possível risco para o ambiente ou para a saúde humana. da mãe e da criança estão indicados na figura 2. Justifique. Os resultados obtidos com o estudo dos marcadores para o cromossomo 21 do pai. No esquema a seguir. II) cana-de-açúcar obtida através de mudas. por cruzamentos sucessivos. No entanto. indicados no esquema por setas. para aumentar a produção leiteira. em caso de ocorrer uma catástrofe ambiental. a) Explique. Esse casal tem uma criança com Síndrome de Down devida à trissomia do cromossomo 21. explique a) como os três grupos de seres se diferenciam entre si. b) de que forma os três grupos poderiam ser afetados. do ponto de vista genético. pode melhorar a qualidade de vida das crianças afetadas por fenilcetonúria. b) Defina um organismo transgênico. os fragmentos são indicados por Kb (1Kb=1000 pares de bases nitrogenadas). indubitavelmente importantes no caso de doenças tratáveis. apesar de seus inúmeros benefícios. pois. Questão 336 Existem mecanismos que normalmente impedem a troca de genes entre espécies distintas. sendo o excesso transformado em compostos tóxicos que comprometem o desenvolvimento físico e mental da criança fenilcetonúrica. qual das duas estratégias não é recomendável? Justifique sua resposta. não há ainda como avaliar os riscos que os organismos transgênicos apresentam. III) soja transgênica clonada para melhoria da qualidade biológica de suas proteínas. o desenvolvimento de novas metodologias nas áreas da bioquímica e da biologia molecular permitiu a implementação de exames diagnósticos. Questão 338 Considere estes dados como hipotéticos. como a fenilcetonúria. A introdução de soja e de outras plantas transgênicas tem gerado muita polêmica.5.2 Explique o que é alimento transgênico e como é obtido. b) Apresente dois testes laboratoriais para a detecção de portadores de fenilcetonúria e explique os princípios desses testes. Essas resultam em fragmentos de tamanhos diferentes que podem ser utilizados como marcadores genéticos. Nos últimos anos. porém. no que se refere à perpetuação de sua própria espécie. Questão 337 Uma mutação no gene que codifica a enzima fenilalanina hidroxilase pode acarretar o acúmulo do aminoácido fenilalanina no sangue. as fronteiras entre as espécies vêm sendo rompidas com a criação de organismos transgênicos. Questão 334 Considere os seguintes seres: I) cabra selecionada artificialmente. em seus cromossomos de número 21. onde cada traço indica a posição e o tamanho dos fragmentos num 68 1.Do ponto de vista ambiental. a) Cite dois mecanismos que impedem a troca de genes . Analisando-os quanto à variabilidade gênica.

foi publicada a seqüência quase completa do genoma humano. Sabe-se. Justifique sua resposta. porém não radioativo. como descrito no texto. é possível medir quanto ADN radioativo existe num ADN de cadeia dupla. O ADN radioativo é então desnaturado (suas cadeias são separadas por calor) e posto em contato com o ADN de um outro organismo. produzir ADN a partir desses ARNs mensageiros e seqüenciar apenas esse ADN. a técnica de seqüenciamento era a mesma. 1) Identifique o genitor que transmitiu dois cromossomos 21 à criança.5. econômica? Questão 340 Uma técnica usada como uma ferramenta da taxonomia emprega a seguinte abordagem: extrai-se o ADN de um organismo e este é. Esse projeto contou com a participação de diversos laboratórios. a partir da amostra de somente um indivíduo. Nos dois casos. marcado com fósforo radioativo. havia duas estratégias a considerar: I) seqüenciar o ADN total dos cromossomos diretamente. foi realizado para o feto através de punção do líquido amniótico. igualmente desnaturado. Justifique sua resposta. Pelos resultados apresentados na figura. obtendo-se os seguintes resultados: ADN do organismo 1 + ADN do organismo 1 = 100% de radioatividade no ADN híbrido ADN do organismo 1 + ADN do organismo 2 = 10% de radioatividade no ADN híbrido ADN do organismo 1 + ADN do organismo 3 = 40% de radioatividade no ADN híbrido ADN do organismo 1 + ADN do organismo 4 = 85% de radioatividade no ADN híbrido Qual o organismo que pertence à mesma espécie do organismo 1? Justifique sua resposta. Analise o resultado obtido na figura 3. amniocentese. no entanto. Foi feito um experimento em que o ADN do organismo 1 (ADN radioativo) foi "hibridado" com o ADN não radioativo de três outros organismos. portanto. Questão 339 No início do projeto do genoma humano. após o nascimento. constatou-se que a criança apresentava Síndrome de Down. Por que a segunda estratégia é mais rápida e. II) extrair todos os ARNs mensageiros. determine: O genitor onde ocorreu a não-disjunção. 3) Suponha que a mulher está novamente grávida e que o exame para marcadores do cromossomo 21. Por que foi importante determinar a seqüência do ADN de um homem e não de uma mulher? 69 1. que o ADN era de um indivíduo do sexo masculino. I ou II. Após a hibridação (reassociação formando moléculas híbridas). 2) Determine o estágio da meiose. em que ocorreu o fenômeno de não-separação ou não-disjunção dos cromossomos. que individualmente determinaram a seqüência de vários trechos diferentes do ADN de todos os cromossomos. Com base nessa informação. então. Questão 341 Em Junho de 2001. que permaneceu anônimo. A fase da meiose em que o fenômeno ocorreu.15. Entretanto.campo de eletroforese.3 Com base nas informações apresentadas e em conhecimentos sobre o assunto responda ao que se pede. pressupõe-se que a criança deve ser normal. mais .

É possível determinar o pai de um recém-nascido quando a dúvida sobre a paternidade desse recém-nascido está entre gêmeos univitelinos? Justifique sua resposta.gene. As frases a seguir constam numa lista de "mitos e verdades sobre o teste de DNA" encontrada na internet (http://www.3 O teste de paternidade usando o DNA tornou-se muito freqüente hoje. nascendo Renato. também hipotética. ambas reclamaram na Justiça o reconhecimento de paternidade. podemos descobrir se um embrião poderá apresentar uma determinada característica ou doença genética pela análise de seus marcadores. quais NÃO deverão apresentar a disfunção muscular quando adultos? b) Supondo que os quatros embriões sejam irmãos. a) Explique o que é genoma e indique uma possível conseqüência econômica dos resultados desta pesquisa. qual é o padrão de bandas (I. Paula engravidou-se ao manter relações sexuais com dois irmãos. 'Xylella fastidiosa'. b) Se o xilema é bloqueado. a Justiça pronunciou-se sobre a paternidade de uma das crianças e ficou impossibilitada de pronunciar-se sobre a paternidade da outra criança. No entanto. gêmeos monozigóticos. Questão 345 O exame de paternidade através da comparação de DNA seqüenciado vem sendo utilizado para determinar progenitores. determinando o Juiz a realização dos testes de DNA. nascendo destas relações Alfredo. pois a maioria das frutas não se desenvolve.15. que causa uma doença nas laranjeiras. Detectou-se ainda que esses marcadores ocupam o MESMO loco. 70 .Questão 342 Considerando situações hipotéticas. os jornais e a revista científica internacional "Nature" publicaram com destaque um grande feito de um grupo de cientistas brasileiros. Em outra situação. Apenas a presença de duas bandas (A e B) é indicativo positivo para o indivíduo apresentar uma certa disfunção muscular quando adulto. Após receber os resultados. O esquema abaixo representa a análise de marcadores de DNA de quatro embriões humanos (I. III e IV).br). ter um descendente com essa disfunção muscular? Questão 344 Recentemente. que identificou o genoma de uma bactéria.5. Questão 346 1. II. A presença do marcador no genoma de um indivíduo pode ser visualizada como uma banda. Abandonadas. Maria manteve relações sexuais com dois irmãos. III e IV) mais provável PARA CADA UM de seus pais? c) Qual é a probabilidade de um certo casal. formado por indivíduos tipo I e III. gêmeos dizigóticos. reduzindo a produção. Responda: a) sobre a paternidade de qual criança o juiz pronunciou-se? b) por que não pôde o juiz se pronunciar sobre a paternidade da outra criança? Questão 343 Com técnicas de biologia molecular é possível verificar a presença ou não de certas regiões de interesse na fita de DNA. Dessa forma. II.com. O xilema das plantas produtoras de laranja é parcialmente bloqueado. uma vez que pode ser associada com algum fenótipo em particular. as pessoas têm muitas dúvidas a respeito desse tipo de exame. Observe o padrão de bandas do DNA de cada embrião e responda: a) Dentre os embriões analisados. Cada uma dessas regiões recebe o nome de marcador. quais as principais deficiências que a planta sofre? Justifique. conhecida como amarelinho.

de determinadas proteínas. Questão 347 A virulência do 'Bacillus anthracis'. a) Qual é a função das endonucleases de restrição e a das ligases na aplicação da tecnologia anteriormente citada? b) Explique como a tecnologia do DNA recombinante participa no processo de produção de organismos transgênicos." III.I. Questão 349 Na tecnologia do DNA recombinante são utilizadas enzimas bacterianas que têm a propriedade de cortar a molécula de DNA em pontos específicos. que antes eram disponíveis em quantidades extremamente reduzidas. o que permite. está diretamente associada à presença conjunta dos componentes toxina e cápsula bacteriana. Questão 348 A partir da década de 70. "Ele já morreu e não deixou nenhum outro parente vivo.15.5. e depois sejam transferidos para animais de laboratório. "O exame de DNA só pode ser feito com sangue. indique a que pode ser utilizada na elaboração de uma vacina composta por bactérias vivas com virulência atenuada. a medicina e a b) O que confere a especificidade a estas enzimas? c) Na natureza.5 a) Explique a utilidade dos plasmídios bacterianos no desenvolvimento de técnicas de DNA recombinante. em células do pâncreas. Os constituintes da toxina são codificados por genes existentes no plasmídeo pX01. células de fígado são cultivadas em laboratório." Justifique por que cada uma das frases constitui um "mito". indústria ganharam alternativas eficientes para a produção. que foram obtidos a partir da aplicação da tecnologia do DNA recombinante. em grande escala. ao contrário da toxina. que passam a produzir sistematicamente tais proteínas. mesmo que eu não seja o verdadeiro pai. conhecidas como tecnologia do DNA recombinante. as moléculas de ácidos nucléicos da célula passaram a ser exploradas através da utilização de novas metodologias." II. b) A cápsula do 'Bacillus anthracis'. Um vírus é inserido nas células. contendo um gene que. Dentre as linhagens apresentadas. não possui antígenos capazes de provocar reação imunológica protetora em mamíferos. por exemplo. utilizados pelo homem. que genes humanos que codificam proteínas de interesse médico ou comercial sejam extraídos. "Sou primo da mãe e estou com medo do resultado ser positivo. Por meio dessa tecnologia. causador do antraz. e os da cápsula por genes existentes no plasmídeo pX02. O esquema abaixo representa quatro diferentes linhagens de 'Bacillus anthracis'. c) Cite dois produtos. clonados em bactérias ou vírus. Justifique sua indicação. Nunca poderei provar que ele era o pai do meu filho. qual deve ser o papel desempenhado por elas? d) Como são chamados os organismos que recebem e incorporam genes de outra espécie? Questão 350 CONVERSÃO CELULAR: Cientistas israelenses induzem células hepáticas a produzir insulina em laboratório e propõem técnica para tratar diabetes tipo 1. 71 . e é atenuada quando um deles está ausente. Pergunta-se: a) Qual é o nome genérico que se dá a estas enzimas? 1. De acordo com a técnica esquematizada a seguir.

há interesse em usá-las para reparar danos de tecidos que normalmente não se regeneram.5. as células do embrião são separadas umas das outras e injetadas diretamente no paciente." (Adaptação do artigo "Revolução invisível na mesa".5 Com relação ao procedimento descrito. Conceitue os organismos transgênicos. a) Cite UMA desvantagem do uso de vírus como vetores de terapia gênica.15. de vacinas e medicamentos. Em quais delas se desenvolvem. 2 .15. pois essas células indiferenciadas podem se transformar em qualquer tecido. II e III. 3 . As células se diferenciam em cultura.6 72 . O procedimento para o preparo de células-tronco embrionárias homólogas está ilustrado de modo simplificado a seguir e envolve as seguintes etapas: 1 .ao atingir o estágio de blástula. 1. quando comparada ao tratamento de diabéticos com transplante de células de pâncreas de indivíduos mortos? Questão 351 Na engenharia genética. da revista Época. a técnica de DNA recombinante vem sendo utilizada na pesquisa e no desenvolvimento.o núcleo de uma célula do paciente é transplantado para um ovócito maduro. 8 de junho de 1998). ficando mais parecidas com as que existem no pâncreas (células beta). responda os itens a seguir. Questão 352 A melhor fonte de células-tronco são os embriões em estágios iniciais de desenvolvimento. O esquema a seguir apresenta algumas etapas dessa técnica.5. já estão plantando as sementes da terceira safra de milho.5.está ligado à produção de insulina. Os cientistas acreditam que as células transformadas possam futuramente ser usadas no combate ao diabetes tipo 1. algodão e soja transgênicos. 1. em local próximo à lesão.o ovócito transplantado é induzido a proliferar. respectivamente: a) o pareamento das bases? a‚) a ação das enzimas de restrição? aƒ) a ação da DNA ligase? b) "Os agricultores americanos.5 1.15. por exemplo. cujo núcleo foi previamente removido. b) Qual é a vantagem da terapia gênica descrita. Por esse motivo. por exemplo. a) Analise as etapas I. Atualmente é possível produzir células-tronco heterólogas (retiradas diretamente de um embrião qualquer) ou homólogas.

incapazes de transportar o gás oxigênio. de infecções oportunistas? Questão 355 Notícias recentes veiculadas pela imprensa informam que o surto de sarampo no Estado de São Paulo foi devido à diminuição do número de pessoas vacinadas nos últimos anos. onde a malária é endêmica. Questão 353 Leia atentamente o texto adiante e responda as perguntas propostas a seguir: "A gripe é uma das doenças que mais matou na história do homem. os linfócitos T CD4.seu material genético . b) Explique por que o uso de células-tronco embrionárias homólogas reduz potencialmente os problemas pós-tratamento para os pacientes. somente após cerca de 60 meses. o bebê fica temporariamente protegido contra essa doença. Indivíduos com anemia falciforme são homozigotos (SS) e morrem na infância. que fica espetada na membrana do vírus. As epidemias. parasitas e bactérias. fazendo com que ela acione suas defesas e "engula" o vírus com uma bolsa digestiva. 1. a célula solta ácidos para digerir o vírus. Os heterozigotos (Ss) apresentam forma atenuada da anemia.7. No entanto. portador da síndrome de imunodeficiência causada pelo vírus HIV (AIDS/ SIDA).é liberado no interior da célula. que ainda ocorrem todo o ano. As autoridades sanitárias também atribuíram o alto número de casos em crianças abaixo de um ano ao fato de muitas mães nunca terem recebido a vacina contra o sarampo. já assustaram mais do que a AIDS. que faz com que a membrana do vírus se funda com a membrana da célula." a) Por que o sistema imunológico de uma pessoa não reconhece um vírus mutante. o aumento da acidez provoca a mudança de forma na HA. não teve acesso a tratamento algum durante o período mostrado. As mutações ocorrem numa proteína chamada HA.1 Note que. Esse indivíduo. Dentro dessa bolsa. ocorrem quando o vírus sofre uma mutação que o torna mais virulento e irreconhecível pelos sistemas imunológicos das pessoas infectadas. Na África. em geral. Questão 354 O gráfico a seguir mostra a variação do número de um tipo de leucócitos. A HA se liga à superfície de uma célula. em função da produção de moléculas anormais de hemoglobina. Por que pacientes infectados com HIV e não tratados sofrem. e não o vírus propriamente dito. mesmo que já tenha tido uma forma da doença? b) Explique como o vírus consegue "enganar" uma célula e infectá-la. que levaram o paciente à morte. quanto heterólogas. quase sempre no inverno. apareceram. Toda a interação inicial entre vírus e célula do paciente ocorre através da HA. o conteúdo do vírus .a) Explique por que indivíduos transplantados com células-tronco embrionárias. a) Explique o que é esperado para a freqüência do gene S em presença da malária. Foram essas infecções. os indivíduos heterozigotos para anemia falciforme são resistentes à malária. a) Se a mãe já foi vacinada ou já teve sarampo. tanto homólogas. É ela que os glóbulos brancos reconhecem e procuram atacar. e da quantidade de vírus HIV no sangue de um indivíduo ao longo do tempo. nesse indivíduo. Dessa forma. infecções oportunistas por fungos. Por quê? b) Por que uma pessoa que teve sarampo ou foi vacinada fica permanentemente imune à doença? De que forma a vacina atua no organismo? Questão 356 A anemia falciforme é caracterizada por hemácias em forma de foice. apresentam duas populações de mitocôndrias diferentes em seus tecidos. Suas epidemias. E em ausência da malária? b) Qual é a explicação para o fato dos heterozigotos para anemia serem resistentes à malária? 73 . e ele continua sua reprodução sem ser molestado.

Seu pai. rosas de coloração azul já eram produzidas através de cruzamento. a) Que característica desse réptil levou o pai a deduzir que se tratava de cobra peçonhenta? Cite outra característica morfológica facilmente identificada na maioria dessas cobras. conforme exemplificado pela reação abaixo. Por quê? c) Em que consiste o seqüenciamento de um genoma? Questão 361 Esforços de cientistas criaram a primeira rosa do mundo com pigmento para cor azul. Pelos métodos tradicionais. Questão 358 Um menino colocou a mão em um buraco onde havia uma cobra e. fossem inseridas cópias de seu RNA mensageiro. a) Como se chamam as estruturas mais vistosas e atraentes destas flores. mas não eram consideradas azuis verdadeiras. foi extraído do amor-perfeito e ativado nas rosas. seria o indicado para receber esse gene e justifique sua resposta. com o objetivo de produzir rosas azuis.Questão 357 As abelhas vivem em colônias constituídas por indivíduos de três castas: a rainha. que passaram a ter cor azul? Qual o significado biológico do fato de certas plantas apresentarem flores com cores tão vistosas? b) Qual é a relação entre esta técnica recente para a produção de flores azuis e aquela empregada para a produção de alimentos transgênicos? Questão 362 O oxigênio é um elemento imprescindível à manutenção da vida dos seres aeróbicos. pois participa do processo de extração de energia dos alimentos. de 1Ž. As petúnias. delfinidina. Sabendo-se que as fêmeas férteis de 'Apis mellifera' têm 32 cromossomos. pois a enzima que sintetiza esse pigmento está ausente nas roseiras. causadora da doença chamada amarelinho ou clorose variegada dos citros (CVC). b) Suponha que. não é possível obter rosas dessa cor. Indique se há ou não possibilidade de produção de rosas azuis nesse caso e justifique sua resposta. Encontra-se em fase de teste uma técnica que possibilita inserir em células de roseira o gene da petúnia responsável pela codificação da enzima que produz o pigmento azul. deduziu que ela era peçonhenta e socorreu o filho. a) Que processo fisiológico da planta é diretamente prejudicado pela presença da bactéria? Justifique. como uma rosa azul. os zangões e as operárias. a técnica recentemente utilizada consistiu no seguinte: o gene da enzima que produz o pigmento azul. Anteriormente.07. b) Qual é a substância imunológica presente no soro antiofídico responsável pela inativação do veneno? Como este soro é produzido? Questão 359 A indústria de flores movimenta bilhões de dólares por ano e está continuamente buscando criar novas variedades. como aceptor final de elétrons. tratando-o com soro antiofídico.2004. um biólogo. mesmo sem ver a cobra. foi picado por ela. Segundo o jornal "The Japan Times on line". C†H‚O† + 6 O‚ ë 6 H‚O + 6 CO‚ Em virtude de sua configuração eletrônica. a) Cite o tipo de célula indiferenciada de roseira que. entretanto. O nome da bactéria deriva do fato de que ela se estabelece nos vasos do xilema da planta hospedeira. Questão 360 Uma importante realização da pesquisa científica brasileira foi o seqüenciamento do genoma da bactéria 'Xylella fastidiosa'. apesar de não tê-la tocado. indique o número cromossômico dos indivíduos de cada uma das castas e descreva como ocorre a diferenciação em castas nesses insetos. em vez de ser introduzido o gene da petúnia que define a cor azul. possuem tal enzima. o oxigênio tem 74 . b) Não se pode atribuir à 'Xylella fastidiosa' a morte das células que constituem os vasos do xilema maduro.

qual é a probabilidade de que esse alelo também esteja presente no outro gêmeo? Questão 366 O esquema a seguir resume a seqüência do desenvolvimento de irmãos gêmeos: 1. Pergunta-se: a) Qual dos parentes você escolheria como doador do órgão? b) Justifique sua resposta. Qual o percentual esperado de ocorrência desse fato? Questão 368 A figura adiante representa o fenômeno biológico que ocorre com um tipo de célula que sai do vaso sangüíneo para exercer sua função no tecido conjuntivo. um indivíduo necessita de um transplante de rim. sem alterar. inclusive no DNA. Questão 367 Uma mulher teve uma menina em sua primeira gravidez. indique a etapa responsável pela formação de espécies reativas de oxigênio e o local da célula onde essas reações ocorrem. a) Em que locais do corpo humano são produzidas essas proteínas e qual é a principal função de cada uma delas no organismo? b) Explique sucintamente o processo por meio do qual se modificam bactérias para que elas passem a produzir proteínas humanas. o que são gêmeos? b) Analisando a figura. Questão 363 Em um hospital. primo em primeiro grau e irmão gêmeo dizigótico.10. acarretando a substituição de uma base guanina por uma adenina. Essas moléculas. a) Considerando o processo de oxidação completa da glicose pela célula eucariótica. Por exemplo. 1. amigo. quais são geneticamente idênticos? Justifique sua resposta. dando origem a moléculas intermediárias. hoje já estão sendo comercializadas insulina e somatotrofina (ou somatropina) humanas produzidas por bactérias.9 a) Sob o ponto de vista embriológico.11 75 .forte tendência a receber um elétron de cada vez. a) Estes gêmeos devem ser monozigóticos ou dizigóticos? Por quê? b) Se um dos gêmeos herdou o alelo dominante A de sua mãe heterozigótica Aa. porém. Dispõe ele dos seguintes doadores: tio. denominadas espécies reativas de oxigênio. Questão 365 Em uma gravidez gemelar. causam alterações. por serem muito reativas. b) Uma espécie reativa de oxigênio induziu uma mutação no gene de uma célula. ocorrendo o mesmo na sua segunda gestação. que são fortes agentes oxidantes. o par de gêmeos é do sexo masculino.10. Justifique por que não houve alteração da estrutura da proteína. Questão 364 Uma conquista recente no campo da biotecnologia é o uso de bactérias para a produção de proteína animal de interesse comercial. fato que pode induzir mutações tanto em células somáticas quanto em células germinativas. a estrutura primária da proteína codificada pelo gene.

pois a mesma é lipossolúvel. As plantas de amendoim podem apresentar folhas com pecíolo normal ou curto. respectivamente.folha coberta com cera c . Dois espécimes de variedades diferentes de uma planta oleaginosa foram cruzados visando à obtenção de uma variedade mais resistente à seca. b) semente lisa. Considere que duas das características dessa planta. atualmente. c) folha sem cera. uma com pecíolo normal e outra com pecíolo curto. conforme a lista a seguir. carboidratos.2. proteínas.semente lisa C . se o alelo para pecíolo normal for recessivo. c) 2:1. ainda servem de veículo de transporte para a vitamina E. d) 3:1. em F2. d) folha com cera.folha sem cera Os gráficos a seguir mostram a composição dos alelos para essas duas características nas plantas parentais. O gráfico que representa o número de alelos encontrados na mitose de uma célula obtida de uma planta resultante do cruzamento entre os parentais é: Questão 371 1. Questão 370 O texto abaixo refere-se às questões: ** a ** O cruzamento entre plantas de variedades diferentes de uma mesma espécie é muito utilizado para a obtenção de cultivares mais produtivos. referentes à folha e à semente. Muitos pesquisadores. Questão 372 O amendoim é uma planta originária da América do Sul.1 76 .1 Das combinações possíveis resultantes do cruzamento entre esses mesmos parentais. se o alelo para pecíolo curto for dominante. se o alelo para pecíolo curto for recessivo.a) Identifique esta célula e nomeie o fenômeno biológico apresentado. Para determinar qual alelo é dominante. sais minerais e vitaminas. Os ácidos graxos insaturados presentes no amendoim. o fenótipo que apresenta o maior número de genótipos possíveis é a) semente com "pêlos". se o alelo para pecíolo normal for dominante.1. e) 3:1.5.5. b) Qual a importância do fenômeno apresentado para a função desta célula? Questão 369 A enzima transcriptase reversa é encontrada em retrovírus. Descreva a função da transcriptase reversa no mecanismo de replicação do vírus da Aids. 1. na proporção de a) 1:1. procuram descobrir novas substâncias que sejam inibidoras específicas dessa enzima. se os alelos forem codominantes. plantas com pecíolo normal e com pecíolo curto. P . Sua importância econômica está relacionada ao fato das sementes possuírem sabor agradável e serem ricas em óleo. com dois alelos.semente com "pêlos" p . são definidas por alelos segregados independentemente. foi feito um cruzamento entre duas linhagens puras. b) 1:2:1. Espera-se encontrar. característica determinada por um gene.

. técnicas especiais de cruzamento foram aplicadas em dois tipos de cerejeiras transgênicas.seqüência de aminoácidos .... Elas continuam apresentando. verde. b) homens e mulheres têm a mesma probabilidade de apresentar a doença. c) em situações como a descrita. por algum tempo. Apesar de passar por todas as etapas do ciclo reprodutivo. roxa e branca) haviam sido obtidas. incapazes de produzir sementes. em algum cromossomo. Questão 375 O texto abaixo refere-se às questões: Notícia de algum jornal do futuro.. ligam-se á membrana plasmática dos linfócitos e sofrem endocitose. d) a crença da população pode ser explicada pelo fato de o sangue do feto ser fornecido pela mãe. ao ser traduzido.. resultando na obtenção de plantas triplóides (3n = 72). Outro dado interessante levantado pelos pesquisadores foi que a população da cidade acredita que a doença seja transmitida de uma geração a outra através do sangue. anteriormente. das células dessas plantas. as substâncias que. depois de liberadas pela digestão. a) núcleo . Questão 374 Em relação à crença da população sobre o processo de transmissão de características hereditárias.. resulta em produto que determinara o desenvolvimento da resposta imunológica.. Se as cerejeiras referidas no texto são transgênicas. diz a pesquisadora. d) pais heterozigotos têm 25% de probabilidade de terem filhos também heterozigotos... então no . responsável pela equipe que desenvolveu os novos frutos. b) a população não está tão equivocada. por mutação no gene responsável pela produção de pigmento na casca do fruto. existe uma .. Com o cultivo das novas variedades de cerejas resistentes. que.RNA transportador 77 ** a ** . não há a formação de endosperma.. espera-se que essas pragas mantenham-se afastadas dos pomares de vacinas. determinando o desenvolvimento da resposta imunológica. e) pais heterozigotos têm 50% de probabilidade de terem filhos que irão desenvolver a doença.. O destaque da campanha de vacinação. (Pesquisa FAPESP.Uma pequena cidade interiorana do Nordeste brasileiro chamou a atenção de pesquisadores da Universidade de São Paulo pela alta incidência de uma doença autossômica recessiva neurodegenerativa. as plantas apresentam resistência aos nematóides que atacavam a raiz principal do sistema axial desses vegetais. casamentos consangüíneos não aumentam a probabilidade de transmissão de doenças recessivas.. estabeleceram-se como pragas importantes do cultivo de cerejas-vacina. muitos cientistas também acreditavam que as características genéticas eram transmitidas pelo sangue. Outra inovação dessas cerejas é a resistência às moscas Anastrepha fraterculus que. sem sementes.RNA mensageiro b) citoplasma . neste ano.. As novas cores (amarela.. não interferem na eficiência das plantas transgênicas como produtoras de vacinas... c) este é um exemplo claro no qual o conhecimento elaborado pelo senso comum coincide com os conhecimentos atuais dos cientistas.. Segundo a bióloga Josefa da Silva.. podemos afirmar que: a) pais saudáveis de filhos que apresentam a doença são necessariamente homozigotos. nos frutos. As formas mutantes para esse loco. Assinale a alternativa que completa as lacunas de modo correto. Da mesma forma. é a utilização de cerejas coloridas.. As pesquisas realizadas revelaram que é também alto o número de casamentos consangüíneos na cidade. uma vez que células sangüíneas não apresentam as estruturas básicas que guardam as informações genéticas. pois os genes estão presentes apenas nas células sangüíneas e nas células germinativas. nos últimos anos. INICIA A CAMPANHA NACIONAL DE VACINAÇÃO CONTRA SARAMPO E TUBERCULOSE....) Pelas informações fornecidas no texto.. que foi introduzida para ser transcrita e originar um . julho de 2005..proteína .. podemos afirmar que: a) no século XIX. e) a crença da população não faz o menor sentido... e o processo cessa nas primeiras divisões celulares do zigoto.

Questão 377 O texto abaixo refere-se às questões: ** a ** Na(s) questão(ões) a seguir escreva nos parênteses a letra (V) se a afirmativa for verdadeira ou (F) se for falsa. Ill . unem-se ao RNAm por uma seqüência de três bases .4% 78 1. ( ) No local onde houver um ribossomo.seqüência de nucleotídeos .. dando formação.. AB = 47.Se a coloração branca for recessiva.os códons.. c) apenas I e II.seqüência de aminoácidos . "(.As mutações responsáveis pelas cores da cereja ocorreram em vários cromossomos.) mutação no gene responsável pela produção de pigmento (.. e) apenas II e III. ( ) a doença é causada por um alelo dominante. será possível obter plantas com frutos coloridos a partir do cruzamento de plantas com frutos brancos. pode-se afirmar: ( ) a doença é causada por um alelo recessivo.1.6% ab = 47. ( ) A molécula de DNA transcreve no núcleo uma molécula de RNA mensageiro (RNAm) com várias seqüências de três bases .. ( ) é um caso de polialelia com epistasia recessiva.o anticódon. pode(m)-se afirmar: I .6% aB = 2. d) apenas III. relativo a uma certa doença observada por ele em humanos. ( ) Os diversos aminoácidos unem-se através de ligações do tipo éster. que trata dos tipos e percentuais de gametas produzidos por um indivíduo de genótipo não divulgado (indivíduo parental). ( ) trata-se de um caso de herança ligada ao sexo. ao final da leitura do RNAm.RNA mensageiro e) citoplasma .RNA mensageiro d) núcleo . pequenas moléculas de RNA transportador (RNAt).c) núcleo . Sabendo-se que os indivíduos afetados estão representados em negrito e os normais em branco. II .)" e "As formas mutantes (obtidas) para esse loco (. ligadas a aminoácidos.O alelo responsável pela "casca roxa" será considerado dominante em relação ao alelo que determina a "casca verde".5.proteína . se uma planta heterozigota para esses alelos apresentar frutos com a casca roxa. ( ) Cada códon do RNA mensageiro determinará a colocação de um aminoácido específico na cadeia polipeptídica..RNA transportador Questão 376 A partir das informações do texto. Um pesquisador apresentou a seus alunos o heredograma a seguir. b) apenas II.)". ( ) trata-se de um caso de herança parcialmente ligada ao sexo.4% Ab = 2. a uma proteína funcional.4 . Esta(ão) correta(s) a) apenas I. ( ) O processo de síntese de proteínas a respeito do citoplasma é também conhecido como transcrição genética. Questão 379 Analise os dados apresentados a seguir. Questão 378 As proposições a seguir são relativas ao processo de síntese de proteínas nas células vivas.

Ainda hoje. b) apenas II. sabemos que outros povos. protagonizaram a nossa história. alemães.8% das células meióticas que originaram estes gametas. uma cadeia de nucleotídeos em que as bases nitrogenadas interagem. organizador. duas cadeias polinucleotídicas paralelas e complementares entre si. através dos pareamentos de aminoácidos. Considerando-se que os animais Z. Está(ão) correta(s) a) apenas I. O núcleo foi isolado e conservado. W e Y Questão 381 Se a vaca Y.2% dos gametas são recombinantes. portanto é formado por I. O embrião se desenvolveu e deu origem ao clone. 2004). nucleotídeos que são compostos por uma base nitrogenada. Após algumas divisões. O núcleo da célula da glândula mamária foi introduzido no óvulo anucleado.2% dos gametas apresentam combinações alélicas diferentes daquelas existentes nos cromossomos do indivíduo parental. II. Santa Cruz do Sul: EDUNISC. ou seja. a) Z. muitas vezes. for a mãe biológica da vaca W. apenas b) W. uma mistura de índios. anteriores aos citados. pode-se afirmar que o animal resultante da clonagem tem as características genéticas da vaca. formando ligações fosfo-diéster. Retirou-se uma célula da glândula mamária da vaca W. mãe de aluguel. foi selecionada a área temática CULTURA e as questões foram construídas com base na obra "Os Primeiros Habitantes do Rio Grande do Sul" (Custódio. "Nossos ancestrais. IV.. uma pentose e um radical "fosfato". c) apenas III. III. pode-se inferir que ocorreu quiasma entre os locos "A" e "B" em 94. um heterozigoto "Trans". brancos e negros. A. d) apenas I e II. o embrião foi implantado no útero de uma terceira vaca Y. ainda hoje. portanto. as três raças se mesclam em nossos descendentes. deixaram-nos um legado que. L. Nosso chimarrão nos identifica em qualquer parte do mundo. ( ) O indivíduo parental é um heterozigoto AB/ab e. convivemos com grupos indígenas. 79 . B. através dos vestígios materiais encontrados nas pesquisas arqueológicas. diferencia-nos. A célula reconstituída foi estimulada para entrar em divisão. utilizada como "mãe de aluguel". apenas d) Z e da W. IPHAN. III. ( ) O indivíduo parental é um heterozigoto aB/Ab. a porcentagem de genes da "mãe de aluguel" presente no clone será a) 0 % b) 25 % c) 50 % d) 75 % e) 100 % Questão 382 A história da maioria dos municípios gaúchos coincide com a chegada dos primeiros portugueses. italianos e de outros povos. Diante da relevância do contexto e da vontade de valorizar o nosso povo nativo. desprezando-se o resto da célula. apenas e) Z. como os Kaingáng. Questão 380 O texto abaixo refere-se às questões: ** a ** A seqüência a seguir indica de maneira simplificada os passos seguidos por um grupo de cientistas para a clonagem de uma vaca: I. W e Y não têm parentesco. II. O núcleo foi desprezado. e) apenas II e III. No entanto. ( ) Considerando que 5." O DNA presente nas mitocôndrias tem composição e estrutura típicas desse tipo de ácido nucléico. determinando uma distribuição 1:1:1:1: ( ) 5.( ) Trata-se de um caso de genes de segregação independente. obtendo-se um óvulo anucleado. Retirou-se um óvulo da vaca Z. "o índio". apenas c) Y. um heterozigoto "Cis".

mas não da proteína correspondente. Uma mãe. haverá mudança na freqüência gênica da população. Rh−. vasos e capilares transportando gases. c) S tende a aumentar. a freqüência do gene a) S permanece constante. sem alteração do aminoácido codificado. Rh−.3 A anemia falciforme ou siclemia é uma doença hereditária que leva à formação de hemoglobina anormal e. os heterozigotos (Ss) são mais resistentes à malária do que os normais (SS). sem alteração do aminoácido codificado. tem um filho O. sem alteração do aminoácido codificado. b) S tende a diminuir. onde a anemia falciforme não sofra influência de outros fatores e onde novas mutações não estejam ocorrendo. e) José ou Pedro. Considere os segmentos de DNA a seguir: rata-se de um caso de mutação por a) perda de um par de bases no DNA. É condicionada por um alelo mutante s.5. O geneticista consultado informou que o pai pode ser a) João. Nesse caso são verdadeiras as afirmações a seguir. de hemácias que se deformam. c) inversão de um par de bases no DNA. Questão 384 Verificou-se que em populações de regiões onde a malária é endêmica. d) s permanece constante. com tipo sangüíneo O. Ela 80 . que é constituído por plasma e algumas células especializadas. nutrientes etc. o Ss apresenta anemia atenuada e o ss geralmente morre. EXCETO: a) A malária atua como agente seletivo. mas tem dúvidas sobre qual dos três namorados é o pai da criança: João tem tipo sangüíneo A. b) O indivíduo ss leva vantagem em relação ao SS. Um adulto de peso médio tem cerca de 5 litros de sangue em circulação. circula pelo coração. d) Quando a malária for erradicada. d) inversão de um par de bases no DNA. c) Pedro. e) inversão de um par de bases no DNA. artérias. Rh®. Rh® e Pedro é A. com alteração do aminoácido codificado. e) Quando a malária for erradicada. com alteração do aminoácido codificado e da proteína correspondente.Questão 383 O texto abaixo refere-se às questões: ** a ** 1. O indivíduo SS é normal. c) O indivíduo Ss leva vantagem em relação ao SS. ser heterozigoto deixará de ser vantagem. b) José.9. Questão 387 O texto abaixo refere-se às questões: ** a ** Na(s) questão(ões) a seguir escreva nos parênteses a soma dos itens corretos. e) s tende a aumentar. Supondo populações africanas com incidência endêmica de malária. conseqüentemente. Doença pode ser definida como um desequilíbrio do organismo ou ausência de bem-estar físico e mental. Questão 386 O sangue. José tem tipo AB. Questão 385 O esquema a seguir mostra a seqüência do DNA que leva à formação da hemoglobina normal e a que leva à formação da hemoglobina alterada. d) João ou José. b) adição de um par de bases no DNA. Rh®.

(64) A b D Soma ( ) Questão 389 Clones são seres vivos obtidos pelo desenvolvimento de células retiradas de indivíduos já existentes. essa anomalia. casado com uma mulher homozigota normal. Soma ( ) Questão 390 O texto abaixo refere-se às questões: ** a ** Na(s) questão(ões) adiante.pode ter inúmeras causas e variar de intensidade e manifestação. (16) Doenças transmissíveis são as transmitidas por patógenos ou por seus produtos. sem alelos A e D. (04) Um homem hemofílico. A probabilidade desta mulher ter uma criança do sexo masculino e hemofílico é igual a 1/4. sem alelos B e D. (32) Se o doador de células sofrer a perda de um membro antes de ser realizada a clonagem. é correto afirmar: (01) Um homem hemofílico. (32) O mongolismo é um exemplo de doença hereditária. (04) Doenças traumáticas são aquelas que se originam de acidentes. o organismo originado posteriormente. No homem. o gene (h) para hemofilia está localizado no cromossoma X e é recessivo em relação ao gene (h+) para coagulação normal do sangue. 81 . Muitas vezes. encontra barreiras de ordem ética. (02) Uma mulher. filha de um indivíduo hemofílico. nascerá sem o referido membro. a ciência do melhoramento genético procura encontrar soluções que aumentem a produtividade de certas espécies. (16) Já existem seres humanos que foram originados e desenvolvidos plenamente por clonagem. certamente será hemofílica. o tabagismo e a dependência de outras drogas são exemplos de causas que podem resultar em doenças. os cientistas provocam modificações nessas espécies em busca de seus benefícios e atuam à semelhança da natureza. como o albinismo. Soma = ( ) Questão 388 Considerando inclusive a possibilidade de permuta genética. é CORRETO afirmar: (01) O alcoolismo. escreva no espaço apropriado a soma dos itens corretos. (02) Doenças genéticas são aquelas causadas por alterações do patrimônio genético e podem passar de pais para filhos. Leia o texto adiante e compare-o com o esquema. seu clone possuirá. usando técnicas sofisticadas. através do material genético. (08) A B D (16) a B D (32) portador apenas de D. terá 50% de seus filhos afetados. A clonagem é um processo que vem sendo desenvolvido rapidamente com vários organismos e. Questão 391 Em parte motivada pela necessidade mundial de aumentar a produção de alimentos. um indivíduo portador do genótipo ABD//abD poderá produzir os seguintes gametas: (01) Portador apenas de A ou a. Sobre esse processo é CORRETO afirmar: (01) Os clones são como irmãos gêmeos fraternos do doador das células. independentemente do sexo. podendo resultar em fratura de ossos. em humanos. (08) Doenças funcionais resultam do mau desempenho ou da perda de um órgão ou sistema. sem alelos A e B. enquanto a eritroblastose fetal é uma doença congênita. por esse processo. (02) O material genético do doador das células e do clone é idêntico. hemorragias. independentemente do sexo. (08) Órgãos transplantados do clone para o doador das células serão sempre rejeitados. etc. terá todos os seus filhos normais. (02) a b D (04) portador apenas de B ou d. também. Com base nesta informação. (08) Um homem hemofílico teve uma filha normal. casado com uma mulher homozigota normal. Soma ( ) (04) Se o doador das células possuir um defeito genético. Com relação a esse tema.

1/2. após alguns exames.2 (01) A afirmativa "Os cientistas alteraram o código genético dessas sementes" está relacionada somente ao item 1 do esquema." (Veja. a produtividade das lavouras será bem maior" refere-se ao item 6 do esquema. escolheram e reproduziram aquelas cujas plantas apresentassem a capacidade de produzir uma proteína inseticida" está relacionada aos itens 3 e 4 do esquema. para destruir as pragas que atacam essas culturas. batata e algodão alteradas geneticamente em laboratório. 1/4. 1/4. matava os insetos que atacavam as plantações. Um exemplo observável das conseqüências de apoptoses é o descamar da pele após sua exposição prolongada a radiação solar intensa. quando ingerida com as folhas. decidem se o ciclo celular avança ou é paralisado iniciando um processo de destruição do material genético. c) Aa x Aa. 1/8. (02) A afirmativa "Os cientistas alteraram o código genético dessas sementes" está relacionada aos itens 1. é correto afirmar: Questão 392 Uma criança de aproximadamente 1 ano. concedida à Revista Galileu pelo cientista Sérgio Danilo Pena. a inativação de qualquer um dos componentes ou operadores do sistema de checagem ou de apoptose poderia provocar a proliferação contínua das células e possível desenvolvimento de tumores cancerosos. Questão 393 1. No caso dessa criança. com acentuado atraso psicomotor. pois a criança não possui. é monogênica com herança autossômica recessiva. Essa proteína. conhecido como APOPTOSE. que liderou uma pesquisa genética sobre a composição étnica do povo brasileiro. em um tipo de organela de suas células.15. Livre dos mesmos. d) Aa x aa. 2 e 4 do esquema. escolheram e reproduziram aquelas cujas plantas apresentassem a capacidade de produzir uma proteína inseticida" está relacionada aos itens 4 e 5 do esquema. e proteínas especiais controlam a evolução do ciclo celular das novas células. ao se colocar H‚O‚ em ferimentos. (04) A afirmativa "nos testes experimentais. a H‚O‚ "não ferve". constata que a criança possui ausência de enzimas oxidases em uma das organelas celulares. GALILEU: "É correta a noção de que a maior parte dos 82 . Este. Portanto. as enzimas que deveriam proteger contra a ação dos radicais livres. Esse problema pode ser evidenciado no dia-a-dia. nos testes experimentais. é encaminhada pelo pediatra a um geneticista clínico. da Universidade Federal de Minas Gerais. 1/8. (16) A afirmativa "Livre dos mesmos. Os cientistas alteraram o código genético dessas sementes e. Qual é o genótipo dos pais da criança descrita no texto e qual a probabilidade de o casal ter outro filho com essa mesma doença? a) AA x aa. Soma = ( ) O ciclo celular é interrompido entre as fases G/S e G‚/mitose. e) Aa x Aa. b) Aa x aa.5. O geneticista clínico explica aos pais que a criança tem uma doença de origem genética. 21/02/1996) Da comparação entre o texto e o esquema. Entre S/G‚ algumas proteínas checam possíveis falhas e erros na linha de produção. Abaixo está transcrito um pequeno trecho de uma recente entrevista. a produtividade das lavouras será bem maior."Nos próximos meses chegam às lavouras dos Estados Unidos e Canadá sementes de milho. Diz também que a doença é muito grave. ou morte celular espontânea. (08) A afirmativa "nos testes experimentais. escolheram e reproduziram aquelas cujas plantas apresentassem a capacidade de produzir uma proteína inseticida.

há esta frase da boneca que muito lingüista moderno poderia adotar como lema.brasileiros tem algum antepassado com pai branco europeu e mãe negra ou índia ?" PENA: "É.. EXCETO: a) O DNA do cromossomo Y e das mitocôndrias apresenta genes que determinam a cor da pele humana. nas equações de todos os graus. aparecem logo muitas conseqüências £que não previmos. não custa lembrar que a campanha nacionalista de Lobato. Emília é uma abelhuda crítica e irreverente. reformar a natureza! Quem somos nós para corrigir qualquer coisa que existe? E quando reformamos qualquer coisa. só o tempo pode curar o grande defeito da humanidade . Benta acerca da clonagem e dos transgênicos? 4. dos guindastes.. das dragas (com as quais se escavou o Canal do Panamá). das roldanas. Emília. do carvão. que termina com esta frase da vovó sabida: "O tempo. Quixote" é alegre e comovente. Dona Benta (permito-me eu). Quanto da história e da mitologia grega não se aprende ao lado da boneca Emília. e se está no ponto em que está. onde não faltam lições de fonética. pelos assírios e babilônios. passando pelo uso do fogo. d) Pelo estudo acima. epílogo também do livro. dos moinhos. num período especialmente sombrio da história do nosso país e trágico da história universal. passariam a citar de boca cheia. somente o genoma de indivíduos do sexo masculino pode ser utilizado para a determinação da ancestralidade paterna. que incluía a exploração estatal do "ouro negro" (como também a do ferro). custou-lhe seis meses de cadeia. do petróleo. telefone. que tagarela pedantemente com Péricles ou com Hércules? Na "História do mundo para as crianças". nas seqüências e nas funções . Em "Emília no país da Gramática". proporções e propriedades..que é ser muito criança ainda". que assim adquirem novas formas. cinema . Questão 394 Instruções: Leia atentamente o texto adiante para responder às questões a seguir. b) O DNA mitocondrial é de origem materna.. Benta uma verdadeira manifestação ecológica: ". opinar sem ser pretensioso. Em "O poço do Visconde". espantando os vizinhos e provocando em D.. e seus brinquedos são cada vez mais fantásticos e perigosos.. até à chamada "era dos milagres".Mas que absurdo. Em "A reforma da natureza". de formação e de classes de palavras. nas expressões. MONTEIRO LOBATO (1882-1947) 1. pelos hieróglifos. pelo império romano. quando marmanjos. Tudo quanto existe levou milhões de anos a formar-se. o jovem leitor lamentará que Lobato não tenha entrado na Álgebra e na Geometria. Já depois de ler a "Aritmética da Emília". jorra o precioso óleo em pleno sítio. inesquecíveis companheiras de aventuras por vários tempos e espaços.. existem mil razões para isso. Nesse mesmo livro. Quanto ao petróleo. a adaptar-se. e às vezes sem confessar. pelos tempos da cavalaria. que é como Lobato batizou a vida com luz elétrica. em 1941.. c) O cromossomo Y apresenta genes exclusivamente paternos.e com o manejo atômico que deu na tragédia de Hiroshima. uma porção de coisas que aprenderam com as personagens do Sítio do Picapau Amarelo. Sempre foi intenção de Lobato ensinar sem ser chato. lendo a "História das invenções": são sugestivas as explicações sobre a operação das alavancas (que permitiu ao homem a construção das pirâmides). o homem continua brincando. seu "Hans Staden" 83 . qualquer um admirará a facilidade com que se explica a formação e as propriedades do vidro. Também um iniciante na Física não pode se queixar." Que diria hoje D.para que o escritor lhe apresentasse alguns dos "bichos de sete cabeças" da Matemática com a mesma graça e eficácia com que iniciara os meninotes nas frações e nos números complexos. fazendo coro com os alunos: ". Meu caso é exatamente esse. e não falta a chegada do técnico norte-americano para tentar tomar conta da situação e acabar escorraçado pelos indignados habitantes. 2. pelas revoluções do século XVIII. Se Dona Benta é uma velha de óculos e muita leitura.Que peste é a tal Gramática!". vai-se da origem do universo (sabiamente explicada pela vovó Benta como hipótese). 3." A resposta do geneticista aliada aos seus conhecimentos permite afirmar. Meu cromossomo Y é europeu e meu DNA mitocondrial é ameríndio. as experiências realizadas por Emília e pelo Visconde geram monstros: ¢alteram o funcionamento de "Dona Pituitária" em insetos. As adaptações que faz Lobato de obras ficcionais ou a recuperação de fatos históricos são também notáveis: seu "D. As obras "infantis" de Monteiro Lobato ajudaram muito na formação de milhares de pequenos brasileiros que.

6. imaginativa e fluente. O que espanta nessa pluralidade é que nada surge como aleatório. Clark. uma célula morta pelas toxinas produzidas por bactérias invasoras. Sempre haverá a curiosidade nossa de saber o que Emília pensaria hoje da globalização. Esta. Os termos a seguir fazem parte da nomenclatura genética básica. em muitos pontos. se vivesse nos dias de hoje. referem-se à morte da célula. New York: Oxford University Press. uma célula da camada germinativa da epiderme. sem concessões à famigerada "literatura infantil")..combinação que. da difusão de novas seitas. está fadada a morrer. As últimas instruções do DNA. forjado no caldeirão de raças e culturas de que procedemos. e) clonado útil para a erradicação da leishmaniose. c) transgênico útil para a erradicação da leishmaniose. Questão 395 "Virtualmente. 7. inédito) Que diria hoje "D. Se nada mais sobrasse da obra de Lobato. 32-5) Considere os seguintes fatos: I. De certa forma. das ações terroristas. foi o que deu a vitória aos ingleses. apesar de poder continuar exercendo determinadas funções durante certo tempo. tudo parece fazer parte de uma didática natural. a Inglaterra seria um quase nada. partindo-o em milhares de pedaços que não mais conseguem enviar instruções úteis à célula. SEX AND THE ORIGINS OF DEATH. A apoptose. Soube admirar tanto a mangueira frondosa quanto a técnica fecunda. dispondo-se a dali falar de tudo e a contar qualquer história (numa linguagem ao mesmo tempo exata. que morre e sofre queratinização. uma célula do miocárdio morta por falta de oxigênio durante um ataque cardíaco. resume algo de nosso "temperamento". III. II. (Eurípides de Souza e Passos. cada aspecto da vida de nossas células é regulado por seu DNA. contradição nossa até hoje. 84 . 1996. Benta" acerca da "clonagem" e dos "transgênicos"? Atualmente ela teria notícias freqüentes sobre técnicas de manipulação do DNA. "mais o ferro. incluindo sua própria morte. Lobato parece ter querido reunir a beleza natural do primitivo ao encantamento pelo enciclopédico. a célula começa a destruir todo o DNA de seu núcleo. ou morte programada das células. nem falta a apresentação de personagens como Marco Polo. (04) DOMINANTE é um dos membros de um par de alelos que se manifesta inibindo a expressão do outro. em outro esse invento vem associado ao carvão-de-pedra que. humor e vivacidade crítica . Logo que essas instruções sejam recebidas e processadas. conhecido por suas frases lapidares.. . reuniu a seu modo as realidades de um país ainda arcaico e já moderno." (Traduzido e adaptado de: William R. enviadas ao citoplasma. Esse exemplo refere-se à construção de um organismo a) transgênico útil para a erradicação da malária. Se num livro o autor se referia. segundo a qual cientistas ingleses estão conseguindo transferir certos genes de bactérias para mosquitos anofelinos. b) transgênico útil para a erradicação da esquistossomose. Assinale as alternativas que trazem o significado correto de cada um desses termos: (01) GENE é sinônimo de molécula de DNA. processo este decididamente irreversível. 5. O leitor que percorra essa obra notará. dizem alguns. dos conflitos religiosos.introduz o leitor num capítulo importante de nossa história colonial. p. Sem isso. d) clonado útil para a erradicação da malária. o quanto ela tem de orgânico. por exemplo à máquina a vapor. é verificada SOMENTE em a) I b) II c) III d) I e II e) I e III Questão 396 Na(s) questão(ões) a seguir escreva no espaço apropriado a soma dos itens corretos. como o fora antes da invenção de Watt". (02) GENÓTIPO é a constituição genética de um indivíduo. proveitosa e sempre polemizada pela palpiteira Emília. Um exemplo delas constitui a matéria publicada recentemente em um jornal. Estes genes teriam a capacidade de impedir a instalação de determinadas fases do protozoário 'Plasmodium' no estômago e nas glândulas salivares do mosquito. provavelmente estaria batalhando pelo desenvolvimento sustentável. essa vivíssima boneca de pano expressaria sempre um fundamento de malandragem. Ao instalar suas criaturas numa base rural. Bolívar e Lincoln.

entro na Internet. conhecia todas as propriedades de uma carnaubeira. Já ouvi a expressão "cultura de almanaque". da queda de Ícaro. poesias. 4. Pense em algo publicável. leitor . Como explicar ao meu leitor mais jovem o que é (ou o que era) um ALMANAQUE? Vamos ao dicionário. Não tinha o charme dos almanaques: levava-se muito a sério. receitas caseiras. que eu achei familiar quando a li pintada no pára-choque de um fordinho com chapa 1932 (relíquia de um paulista orgulhoso?). o curso e o regime do rio São Francisco. anedotas.. a concretização editorial do SLOGAN famoso: TIME IS MONEY. dita em tom pejorativo. Um outro ensinava a fazer balão e pipa. pelo qual já se entrevia uma América (como os EUA gostam de se chamar) com ares de dona do mundo.(08) FENÓTIPO é a expressão do gene em determinado ambiente. O leitor não faz idéia do que cabia nesse etc. palavras cruzadas. o humor era bem-comportado. Pegadinhas do tipo "quais são os números que têm relações de parentesco?" ou questões como "por que uma mosca não se esborracha no vidro dentro de um carro em alta velocidade?" não eram bem-vindas. Sim. (16) GENOMA é o conjunto de todos os alelos de um indivíduo. Tirando Hollywood. o descompromisso macunaímico dos nossos almanaques em papel ordinário. e lá estava. da guilhotina francesa. Agora sou autor do meu próprio almanaque. horóscopo. Deixei de lado os almanaques e entrei no funil apertado das tendências vocacionais. descobri este emprego de cronista que me abre.: charadas. e se nunca os fiz subir ou rodar era porque meu controle motor já não dava inveja a ninguém. a que vem ao caso: folheto ou livro que. curiosidades etc. 3. O "buscador" da HOME PAGE é uma espécie de oráculo de Delfos de efeito 85 . Eu não trocaria três exemplares do almanaque de um certo biotônico pela coleção completa das SELEÇÕES. "vim. recordes mundiais. Em compensação. Pouco depois dos almanaques vim a conhecer as SELEÇÕES . Com o tempo. se viesse a cair dentro de uma.. por exemplo. 2. Acho injusto. E me arrepiava a descrição do ataque à base naval de Pearl Harbor. Não tinha a galhofa. nunca voltaria para o dono. Soma ( ) Questão 397 Cultura dos almanaques 1. Adolescente. Almanaque não se emprestava a ninguém: ao contrário de um bumerangue.é também uma constatação da astrofísica. Brutus?".READER'S DIGEST . 5. a manejar um pião. enigmas policiais. trechos literários. 6. de circulação regular e internacional. de novo. a separar as chamadas áreas do conhecimento. fazia prodígios com ímãs e saberia perfeitamente reconhecer uma voçoroca. misturava povos e séculos com grande facilidade. dicas de viagem. caricaturas. mas . além do calendário do ano. astúcias da matemática. as matérias tinham um tom meio autoritário e moralista. esse almanaque multidisciplinaríssimo de última geração. Lembro-me de um exemplar que falava com tanta expressão da guerra fria e de espionagem que me proporcionou um prazer equivalente ao das boas páginas de ficção. do meu canteirinho de temperos ou da safra nacional de grãos. Talvez não seja inútil conhecer as dimensões das três pirâmides. do fracasso de Napoleão em Waterloo. move-se!". aprendi a me especializar nas disciplinas curriculares. Meu professor de Ciências fechou a cara quando lhe perguntei se era hábito de Arquimedes tomar banho na banheira brincando com bichinhos que bóiam."o fogo de constelações extintas há milênios" . a relação que Pitágoras encontrou não apenas entre catetos e hipotenusa. provérbios.uma espécie de almanaque de luxo. com base no almanaque. traz diversas indicações úteis.pasme. todas as portas do mundo: posso falar da minha rua ou de Bagdad. ou a história de expressões como "vitória de Pirro". e minha professora de História fingiu que não me ouviu quando lhe perguntei de quem era mesmo a frase "E no entanto. Um bom leitor de almanaque explica como uma bela expressão de Manuel Bandeira . E alguns professores sempre implicavam quando eu os contestava ou argüía. as SELEÇÕES talvez tenham sido o principal meio de difusão do AMERICAN WAY OF LIFE. entre outras acepções.entre o sentimento da melancolia e o funcionamento do fígado. porque despertavam a classe sonolenta. mas ainda hoje me valho das informações de almanaque para explicar. vi e venci" e "até tu. Lá está. Se fico sem assunto. da reunião do meu condomínio ou da assembléia da ONU. Algum risco sempre havia: não foi boa idéia tentar fazer algumas experiências químicas com produtos caseiros. das angústias de Colombo em alto mar.

certamente. enfim. Está(ão) correta(s) a) apenas I. Um excelente químico pode imaginar um excelente desodorante. cada um é também liberado de qualquer responsabilidade. que podem ser exemplificados pelos esteróides. e os hormônios humanos.. especialmente durante a transcrição e a tradução.aumentar as taxas de mutação em todos os seres vivos. triunfo das massas. assistiu-se ao triunfo das teorias revolucionárias de Einstein e a seu questionamento. cerca de 8% da produção nacional da soja é biologicamente adulterada. por ser mutagênico. d) Pode haver efeitos sobre várias espécies de insetos protetores da flora e de polinizadores.. Em algumas dezenas de anos. deve I . c) Pode haver cruzamento entre a cultura convencional e a geneticamente modificada. NO PAIN. o que representaria uma vantagem comercial ao país que os proíbe. Estamos em via de viver a tragédia dos saberes separados: quanto mais os separamos. O custo dessa aceleração da descoberta é a hiperespecialização. não apenas no homem.permitir o surgimento de novos alelos.5 milhões de toneladas. tanto mais fácil submeter a ciência aos cálculos do poder.contaminantes biológicos. Parte dessa safra refere-se à produção da soja. na prática. os massacres do Camboja e assim por diante.e isso ocorre com freqüência. como podeis ver. Holocausto: através das metáforas e das realidades que marcaram esses cem últimos anos. c) apenas III. Mas não sou. que podem transformar as águas em fontes de transmissão de doenças. os velhos almanaques me deixaram saudades. Se eu fosse um nostálgico. no caso deles). mas não possui mais o saber que lhe permitiria dar-se conta de que seu produto irá provocar um buraco na camada de ozônio. podendo acarretar o fim da espécie convencional. e em algumas décadas se passou do dirigível ao avião.quase instantâneo. O século que chega ao fim é o que presenciou o Holocausto. da hélice ao turborreator e daí ao foguete interplanetário. que. O benzeno. e) I. . se globalizou pra valer: meus filhos já aprenderam. mesmo em baixas concentrações. NO GAIN (ou GAME. Assinale a alternativa que contém argumentos favoráveis à produção. que é um agente mutagênico. (Argemiro Fonseca) A produção brasileira de grãos ultrapassou 115.impedir o funcionamento dos ácidos nucléicos. aparece a verdadeira doença do progresso. por alterar a seqüência de nucleotídeos do DNA. e) O desenvolvimento desta tecnologia poderá aumentar a produtividade em relação à tradicional. E o inglês. Nosso século é o da aceleração tecnológica e científica. de alimentos geneticamente modificados. III . Privado da satisfação de ver o produto acabado. d) apenas I e II. Não é um balanço tranqüilizador.compostos orgânicos que. Hiroshima. II . diria que. b) O mercado europeu é resistente a este tipo de alimento. no Brasil. cada um conhece apenas uma fase do trabalho. velocidade. linha de montagem. Foram necessários milhares de anos para passar do barco a remo à caravela ou da energia eólica ao motor de explosão. o sentido de outro SLOGAN prestigiado. de 96. II e III. b) apenas II. Segundo a "Folha de S. Questão 398 A qualidade da água pode ser alterada por vários fatores: . o que significa uma elevação de 19% em comparação à colheita anterior. Poderia produzir venenos sem que o soubesse . comunicação. O equivalente tecnológico da separação dos saberes foi a linha de montagem.2 milhões de toneladas na safra 2002/03. é assustadora. que se operou e continua a se operar em ritmos antes inconcebíveis. apesar de todo esse avanço. Mas a linha de 86 . como o benzeno. Esse fenômeno está intimamente ligado ao fato de ter sido neste século que os homens colocaram mais diretamente em questão a sobrevivência do planeta. os regimes dos Grandes Irmãos e dos Pequenos Pais. Nesta. Questão 399 O texto abaixo refere-se às questões: ** a ** Ação à distância. Mas o horror desses acontecimentos não reside apenas na quantidade. podem interferir no funcionamento dos seres vivos. a) Há muitas dúvidas sobre eventuais danos à saúde do consumidor provocados pelas alterações genéticas nos alimentos.Paulo" de 23/09/03.

informação. aperta-se um botão e entra-se em comunicação com Pequim. O século do triunfo tecnológico foi também o da descoberta da fragilidade. absolvição. b) choque anafilático. Sem essa aceleração. O Holocausto foi possível porque se podia aceitá-lo e justificá-lo sem ver seus resultados. Hoje. mas o sistema do computador não tem defesa diante da má intenção de um garoto precoce. Um exemplo ocorreu em 1987. II e III e) II. afinal restrito. vida mais longa.As emissões radioativas introduziram energia nas células. num regime de separação dos saberes. como a Grande Muralha da China. devolveram essa energia para o ambiente. 25 anos. comunicação. Assim. herdamos do passado o hábito de brandir a ameaça de um complô judeu para desviar o descontentamento dos explorados. O século está estressado porque não sabe de quem se deve defender. Foi fácil fazer passar por ciência uma teoria pseudocientífica porque. (Adaptado de Umberto Eco. tempo. IV . castigo. Tudo o que aconteceu de terrível a seguir não foi se não repetição. A ação à distância salva numerosas vidas. 1993). ação à distância. sob a forma de calor. tecnologicamente eficaz e buscou o consenso servindo-se das comunicações de massa e do prestígio da ciência.A energia provocou alterações nos compostos químicos das células. Dessas explicações. É bom que tudo se tenha resolvido no espaço de trinta anos. VEJA. morte. onde foi abandonada uma cápsula contendo pó de Césio-137 e que foi aberta por pessoas desavisadas. ao passo que os resíduos (inclusive os radioativos) nascem do bem-estar que ninguém quer mais perder. Nosso século é o do enfarte. Mas o que torna tão terrível o genocídio nazista é que foi rápido. desconhecido dos séculos anteriores. elas poderão apresentar uma reação denominada a) hemólise. III . o químico que aplicava os gases asfixiantes não julgava necessário ter opiniões sobre a antropologia física. e) reforço do sistema imunológico. Nosso século foi o da comunicação instantânea. A um ritmo de STRESS. tecnologia. Encontramos o meio de eliminar a sujeira. Além de um número. quando picadas por abelhas. mas irresponsabiliza o crime. São Paulo. Eis porque nosso século foi o da angústia e da utopia de curá-la. Se forem novamente picadas. Reflexões para o futuro. nascimento. 87 . deram-se as seguintes explicações: I . o fato de certas pessoas. Rápida Utopia. Tudo se passa num ritmo acelerado. Aperta-se um botão e um foguete é lançado a Marte. de pessoas responsáveis e de executantes diretos (sádicos e loucos). presenciou o triunfo da ação à distância. que podia ser reduzida. este século soube fazer do melhor de si o pior de si. II . como por exemplo. milhões de outros puderam colaborar à distância. c) choque térmico.As células humanas estão adaptadas a receber energia com os comprimentos de onda do Césio-137. Espaço. nem como: somos demasiado poderosos para poder evitar nossos inimigos. Ciência. apresentarem uma reação alérgica à toxina desses animais. descoberta. arrependimento. A perseguição racial e o genocídio não foram uma invenção de nosso século.As células reagiram e. Poderíamos destruir o planeta num dia. crítica. indignação. sem grande inovação. o autor menciona que não conseguimos eliminar os resíduos radioativos do ambiente. princípio da linha de montagem: tudo isso tornou possível o Holocausto.montagem permite também fabricar aspirina em quantidade para o mundo todo. mas pagamos o preço dessa rapidez. III e IV Questão 400 Apesar da "aceleração tecnológica e científica de nosso século" nem todos os problemas puderam ser solucionados. o Muro de Berlim poderia ter durado milênios.. que sofreram graves danos em conseqüência desse ato. esquecimento.. crime. Para tais conseqüências. d) embolia. E rápido. tudo em altíssima velocidade. em Goiânia. Um moinho de vento podia ser reparado. realizando cada qual um gesto que nada tinha de aterrador. mas não o de eliminar os resíduos. especialmente por um grande número desses insetos. Porque a sujeira nascia da indigência. Aperta-se um botão e um país inteiro explode. estão corretas SOMENTE a) I e II b) I e III c) II e IV d) I. No texto.

b) a expressão do gene depende da presença de hormônios masculinos. Ela o informou de que já era sua terceira gestação.Rr. III e IV representam moléculas de ácidos nucléicos.rr.2003. d) Pai . professor Astrogildo ia propondo desafios a partir das situações do dia-a-dia vivenciadas ao longo do passeio. uma vez que na concepção de Jamie foram empregadas técnicas de fertilização in vitro. a criança teve eritroblastose fetal.. d) a mulher só será careca se tiver os dois alelos recessivos. 2Ž Filho . é implantado no útero materno. 2Ž Filho .RR. o texto nos coloca diante de situações concretas de biotecnologia e de bioética. Nessa situação. (Leite. Algumas das questões propostas por professor Astrogildo estão apresentadas a seguir para que você responda.) Em relação ao texto. uma forma de confirmar sua compatibilidade com as de Charlie.Rr. embora envolva questões de biotecnologia.Rr. MAIS! 29. Folha de S.Questão 401 Jamie Whitaker mal nasceu e já se tornou celebridade. Mãe . O motorista está buzinando. II. na segunda. M. professor Astrogildo perguntou-lhe se seria seu primeiro filho. do primeiro e do segundo filhos seriam: a) Pai . Ariosvaldo refletiu e perguntou: "Professor. Jamie é o que já está sendo chamado de "irmão salvador" pelos tablóides (jornais populares) do Reino Unido. Ciência em Dia.Rr.06.. Mãe . e) não se pode associar a fertilização "in vitro" com biotecnologia ou com bioética. Jamie pôde ter suas células testadas no útero. pois não envolve escolha de genótipo de seres humanos. Na primeira. Mãe . O irmão de Jamie se chama Charlie e sofre de uma forma rara de anemia causada por anomalia genética. Mãe . 1Ž Filho .Rr.. uma vez que o embrião. os genótipos do pai das crianças. Questão 402 O texto abaixo refere-se às questões: ** a ** Professor Astrogildo combinou com seus alunos visitar uma região onde ocorria extração de minério a céu aberto. 1Ž Filho . pois as técnicas de fertilização in vitrojá são de total domínio e amplamente utilizadas pelos especialistas na área de reprodução humana. Isso ocorre porque a) o gene responsável pela calvície está no cromossomo Y. Paulo. por que não se vê mulher careca?" O professor respondeu que a ocorrência de calvície em mulheres era muito rara. b) o fato relatado. Questão 404 Aproveitando a pergunta de Zeca. Questão 403 Quando a garçonete se aproximou.rr. 2Ž Filho . 2Ž Filho . o seu filho nasceu normal e. da mãe.3 88 . podemos afirmar que: a) ao fazer referência à técnica de fertilização in vitro e de escolha de genótipos de seres humanos. Vamos!" A turma entrou muito animada no ônibus e Ariosvaldo percebeu que o motorista era calvo.Rr..rr. d) o caso relatado não envolve problemas de bioética.RR. nada tem a ver com aspectos de bioética. em que os números I. com a intenção de mostrar os efeitos ambientais produzidos por aquela atividade.Rr. onde. uma criança gerada para fornecer tecidos vivos para tentar salvar a vida de outro filho de seus pais. Durante o trajeto. depois de selecionado. c) a calvície é uma característica genética cuja herança é ligada ao sexo. Como foi concebido por técnicas de fertilização "in vitro". se dá o desenvolvimento do feto. "Já está na hora de voltar.Rr.rr. b) Pai . 1. 1Ž Filho .Rr.5.Rr. c) não se trata de uma questão que envolva biotecnologia e bioética. 1Ž Filho . de fato.8. c) Pai . o professor esquematizou o processo de síntese protéica.

é correto afirmar que a) I corresponde ao RNA que contém o código genético determinando a seqüência de aminoácidos da proteína. 1 250 gametas dos quais 80% foram fecundados. nos machos. c) III corresponde ao RNA que contém o anticódon complementar ao códon existente em I. b) cromossomos não têm o gene da insulina.partir do esquema. i ). Questão 408 O texto abaixo refere-se às questões: ** a ** A alcaptunúria é uma disfunção extremamente rara do metabolismo humano.5. se forem fêmeas. onde também encontramos os genes que determinam os grupos sangüíneos ABO ( IÞ. 500 machos Questão 407 Os descendentes dessa rainha terão olhos a) somente da cor marrom. em um dia. as cinco cores serão possíveis. foi inseminada por espermatozóides provenientes de machos com olhos das cores marrom (20%). Os indivíduos afetados apresentam a cor da urina vermelho pardacenta devido a uma alteração no metabolismo normal da fenilalanina. entre os quais há a seguinte relação de dominância: a¢ > a£ > a¤ > a¥ >a a¢ : marrom a£ : pérola a¤ : neve a¥ : creme a : amarelo Uma rainha de olhos marrons. d) cromossomo com o gene da insulina não está presente. Assinale a alternativa da tabela que indica corretamente o número esperado de descendentes dessa rainha. nas fêmeas. creme (20%) e amarelo (20%). se forem machos. (zero) machos b) 1000 fêmeas. pérola (20%). b) O somente das cores marrom ou pérola. se forem machos. 625 machos e) 500 fêmeas. durante o processo de transcrição. Iß. (zero) machos c) 1000 fêmeas. as cinco cores serão possíveis. 250 machos d) 625 fêmeas. 1. Questão 405 Zeca perguntou: "Professor. e. heterozigótica para pérola. e) da cor marrom ou pérola. Todos os gametas produzidos resultaram em descendentes. d) da cor marrom ou pérola. O heredograma a seguir foi montado para se estudar a disfunção em uma determinada família. por que as células alfa desse mesmo órgão não assumem esta função?" A síntese da insulina não ocorre nas células alfa porque o(s) a) gene da insulina está defeituoso. a) 1250 fêmeas. Essa rainha produziu. Questão 406 O texto abaixo refere-se às questões: ** a ** Em uma espécie de abelha. c) gene da insulina está inativo. e. c) da cor marrom se forem fêmeas. neve (20%). para a qual o tipo sangüíneo de cada um dos membros está indicado. b) II corresponde ao RNA que catalisa a união do I com o III. a cor dos olhos é condicionada por uma série de cinco alelos. O gene determinante dessa disfunção está localizado no cromossomo 9.6 89 . já que as células beta do pâncreas de um diabético não são capazes de sintetizar insulina. da cor pérola. d) IV corresponde ao RNA que catalisa a ligação dos nucleotídeos com a desoxirribose.

os mais fortes. (08) A seleção natural pode preservar características diferentes. esperada em F2. (16) O trabalho de Darwin afirma a constância genética do mundo biológico. Questão 409 (Darwin. enquanto a outra metade produz plantas que permanecem constantes e recebem os caracteres dominantes e recessivos em partes iguais. 90 . se sustenta em premissas incorretas. conseqüentemente. segue-se que qualquer organismo que varia de modo proveitoso para si próprio. c) O indivíduo 6 certamente não recebeu um gameta recombinante da sua mãe ou do seu pai. formam sementes das quais a metade novamente desenvolve a forma híbrida. apud DARNELL.) os determinantes (. que se ocupa do aperfeiçoamento físico e mental da espécie humana. está representada para o indivíduo 7 ao lado do heredograma.6 posição ocupada pelos alelos que determinam grupo sangüíneo e alcapatonúria. e persistindo nos pronúcleos resultantes os mais aptos. São freqüências esperadas de descendentes para o cruzamento 6 X 7.5% AB normais. (. que violam princípios sociais e admitem conceitos biológicos errôneos. c) 50% de afetados. em diferentes ambientes. b) 45% de A normais. TEXTO I: Como muito mais organismos de cada espécie nascem do que provavelmente sobrevivem e como. p. no par de cromossomos 9.. 2 . lutam entre si. sob condições de vida complexas e algumas vezes variáveis. é possível afirmar. EXCETO: a) A alcaptonúria é um caráter determinado por gene autossômico recessivo. assim. de cada par de caracteres diferenciais. exemplificadas nos textos. 1117) Em relação às idéias de Darwin e de Mendel. pode-se dizer: (01) As "plantas que permanecem constantes" ao longo das gerações são homozigotas." (Kehl apud BIZZO. Soma ( ) 1.traduzido) TEXTO II: Os híbridos. d) A chance de o indivíduo 9 ser heterozigoto para o caráter alcaptonúria é de 2/3. como na citação: "Os cromossomos. (02) A herança de um caráter é determinada pela fusão dos fatores condicionantes na descendência. (04) A citação de Mendel expressa a proporção genotípica 1:2:1.nalisando-se o heredograma. Questão 410 O texto abaixo refere-se às questões: ** a ** Na(s) questão(ões) a seguir escreva nos parênteses a soma dos itens corretos. os inferiores.5. eliminando-se com o glóbulo polar os mais fracos. há uma freqüente luta pela existência.) se entrechocam. de ser "naturalmente selecionado".. (Mendel. pode-se afirmar: (01) A subordinação aos princípios mendelianos reduz a variabilidade nas espécies que se reproduzem sexuadamente. A freqüência de recombinação entre os dois loci gênicos é de 10%. Questão 411 A idéia da eugenia. d) 50% B normais ou afetados. p. perigosamente em alta em países desenvolvidos da Europa. EXCETO: a) 22. p. (32) Variações referidas por Darwin transmitem-se à descendência segundo o padrão mendeliano de herança. apud FREIRE-MAIA.. terá uma melhor oportunidade de sobrevivência e.. 30) Considerando-se os princípios biológicos que regem a herança. b) O indivíduo 3 pode ter recebido um gameta recombinante de sua mãe. selecionam-se.

São hoje praticamente indispensáveis à medicina. Questão 414 Questão 412 Indivíduos portadores da doença "xeroderma pigmentosum". vêm sendo efetuadas com certa facilidade e segurança através do uso de técnicas apropriadas. (08) Os fatores genéticos se misturam e se diluem ao longo das gerações. (16) A aplicação de princípios eugênicos comprometeria a sobrevivência da espécie humana. (08) A morte prematura de células nervosas resulta dos efeitos do acúmulo de lesões na molécula de DNA. que parecem resultar da morte prematura de células nervosas. engenharia. (32) A ocorrência de alterações em células nervosas e em células epidérmicas pode estar relacionada à sua origem embriológica comum. Estudos genéticos em células de organismos afetados revelam a existência de defeitos no sistema enzimático responsável pelo reparo de moléculas de DNA danificadas pela exposição a agentes mutagênicos. exercem importante papel na sociedade atual. como também a identificação da paternidade. (04) A condição genética dos indivíduos com "xeroderma pigmentosum" é determinada pela exposição à radiação ultravioleta. apresentam. Soma ( ) Questão 413 Os radioisótopos. ou como fontes de radiações. (64) As repercussões da eugenia em populações humanas descartam sua aplicação para qualquer fim. atingindo sua prole. extrema sensibilidade à luz solar. No entanto. em que são considerados básicos alguns conceitos de genética. d) são responsáveis por extinções em massa. é aleatória. ( ) Na espécie humana distinguem-se 3 tipos sangüíneos. apesar de temidos pela população que os associa a acidentes nucleares e danos ambientais. indústria. ( ) Um dos catalisadores do processo de duplicação do DNA é a enzima DNA polimerase. p. 91 . as mutações ocorrem naturalmente e têm uma grande importância evolutiva porque a) geram a variabilidade sobre a qual a seleção natural pode agir. ( ) Genes alelos são genes que ocupam o mesmo "locus" gênico em cromossomos homólogos. Soma ( ) o processo evolutivo.(02) A segregação dos cromossomos homólogos. adquiridas por indivíduos de uma geração. Sobre esses conceitos. A elucidação de crimes. 307-8 . (32) Alterações do fenótipo. (64) A precisão dos sistemas de reparo do DNA inviabiliza Na(s) questão(ões) a seguir julgue os itens e escreva nos parênteses (V) se for verdadeiro ou (F) se for falso. seja por atuarem como traçadores radioativos. ( ) Cariótipo é o conjunto de informações sobre os cromossomos de uma determinada espécie. (04) O efeito de um determinado gene depende do ambiente em que ele é expresso. (GARDNER. Alguns desses pacientes também desenvolvem anormalidades neurológicas.adaptação) Uma análise da situação apresentada anteriormente permite afirmar: (01) Agentes mutagênicos incluem fatores físicos que alteram a estrutura da molécula de DNA. hidrologia. e os indivíduos do grupo sangüíneo AB são considerados doadores universais. antropologia e à pesquisa acadêmica em diversas áreas do conhecimento. c) permitem a origem de novas espécies cada vez melhor adaptadas. condição genética autossômica recessiva. resultando em alta freqüência de câncer de pele. julgue os itens. como a dos trilobitas. na primeira divisão meiótica. b) geram as adaptações. principalmente na face. (02) A falha em mecanismos celulares que preservam a fidelidade da mensagem genética predispõe ao câncer. que permitem a sobrevivência das espécies. O temor da população em relação aos radioisótopos relaciona-se à capacidade desses elementos produzirem mutações nos seres vivos. (16) Os genes que condicionam o "xeroderma pigmentosum" são característicos de células epidérmicas. repercutem além dela. em células epidérmicas. e) são o único processo evolutivo agindo atualmente no homem.

92 Questão 416 Com base nos estudos de Genética. Nesse passeio. soma = ( ) Questão 418 O texto abaixo refere-se às questões: ** a ** Caros candidatos. (04) Indivíduos heterozigotos para duas características produzem quatro tipos de gametas. autofecundada. entretanto. Sabe-se que o gene A está em um cromossomo e B em outro. Observou-se. onde verão um maravilhoso ecossistema. Feito um cruzamento entre dois indivíduos duplamente heterozigóticos. casando-se com um homem doador-universal. (02) Efeito genético da consangüinidade. alterando-o. que lhes servirá de guia. será heterozigota para o caráter se entre os seus descendentes aparecerem alguns com sementes amarelas e outros com sementes brancas. é correto afirmar que: (01) 9/16 dos descendentes desse cruzamento terão olhos normais e com pigmentação escura. essa atividade de campo. Desse cruzamento resultaram oito filhotes que. compreenderão como as espécies se inter-relacionam. Imagine uma espécie animal na qual um gene A determina a formação do olho e seu alelo recessivo determina a ausência de olhos. Para tanto. (08) Segregação monogênica dominante. é correto afirmar que: (01) Uma planta de sementes brancas. a fim de condicionar um determinado fenótipo. terá filhos apenas do grupo sangüíneo O. e o passeio será muito proveitoso. Soma ( ) Questão 417 Um canil. reduzindo o vigor da ninhada. dois nasceram cegos. vocês estarão em contato com a natureza. um experiente pesquisador. Um outro gene B dominante determina a pigmentação clara do olho. Soma ( ) . escreva no espaço apropriado a soma dos itens corretos. que. (02) Uma mulher do grupo sangüíneo A cuja mãe é do grupo O. (16) Sendo a hemofilia uma anomalia condicionada por um gene recessivo ligado ao sexo. ou seja. fixando aleatoriamente alguns genes. especializado na criação de dálmatas. Vocês estão convidados a fazer um passeio numa área de Mata Atlântica. e adaptações na Mata Atlântica. Fiquem tranqüilos: vocês estão preparados. (32) Semiletalidade. ou seja. (02) 3/16 dos descendentes desse cruzamento terão olhos normais e com pigmentação clara. quando necessário. enquanto seu alelo recessivo determina a cor escura. esse fato pode ser explicado porque houve: (01) Heterose. Vamos lá?!!! Como você já devem ter percebido. (04) 4/16 dos descendentes nascerão sem olhos. apresentaram as mesmas características dos pais. os genes de um par agem combinando-se com outro par (ou outros pares). efeitos nocivos que podem surgir devido a genótipos recessivos produzidos através do cruzamento entre indivíduos aparentados. "Lei da Segregação Independente dos Caracteres". Ele dispõe de material para ilustrar. (16) Deriva genética. se reproduzem e como se dão alguns fenômenos biológicos nos seres que vivem ali e até naqueles que visitam esse ambiente. na sua maioria. comportamentos. À luz dos conhecimentos de genética. (08) Na interação gênica. pois Ribossomildo só lhes dará informações cientificamente corretas. ou polimeria. Também serão convocados a responder a questões básicas no campo da Biologia. verão de perto a diversidade da fauna e da flora. dos oito cãezinhos. contarão com a companhia de Ribossomildo. escolheu dois irmãos de uma ninhada e os cruzou. (04) Herança ligada ao cromossomo sexual. Vocês terão a oportunidade de verificar de que maneira o homem pode interferir nesse meio. e quais as conseqüências disso. uma criança hemofílica nascida de pais normais só poderá ser do sexo feminino.Questão 415 O texto abaixo refere-se às questões: ** a ** Na(s) questão(ões) a seguir. (08) Estes problemas envolvem a Segunda Lei de Mendel. é grande a variabilidade de espécies.

sabemos que outros povos. c) Na figura I. Questão 419 Ribossomildo diz: Vejam quantos folhas novas. Santa Cruz do Sul: EDUNISC. a permutação entre cromossomos heterólogos aumenta a variabilidade genética. a) replicação do DNA b) transcrição de RNA transportador c) tradução de RNA mensageiro d) síntese das proteínas arque a opção em que se relaciona adequadamente a figura ao evento biológico. 93 . a migração das cromátides-irmãs para pólos opostos eleva a recombinação gênica. 2004). IPHAN. etapas da divisão celular como as representadas nas figuras abaixo justificam essa variabilidade. L. alemães. protagonizaram a nossa história. com o objetivo de melhorar a produção de grãos. trazendo contribuições à nossa cultura. a) Na figura I. b) Na figura II. italianos e de outros povos.. No entanto. O resultado para a F1 de um cruzamento de plantas com baixa estatura X plantas com estatura elevada será _________________________. Assinale a alternativa que completa corretamente a lacuna. foi selecionada a área temática CULTURA e as questões foram construídas com base na obra "Os Primeiros Habitantes do Rio Grande do Sul" (Custódio.8. Diante da relevância do contexto e da vontade de valorizar o nosso povo nativo. B. d) Na figura II. anteriores aos citados. A.Essa variabilidade fenotípica está relacionada à constituição genética do indivíduo e pode ser observada até dentro da mesma espécie.1 ssinale a opção correspondente ao evento representado na figura." Variedades de milho cultivadas pelos indígenas são usadas hoje em cruzamentos. "Da Amazônia vieram os tupis-guaranis. 1. a segregação independente dos cromossomos contribui para o aumento da diversidade dos gametas. Questão 420 A história da maioria dos municípios gaúchos coincide com a chegada dos primeiros portugueses. que ilustra um dos eventos imprescindíveis ao processo de crescimento dos organismos.5.1 1.2. Considere que a característica baixa estatura é dominante sobre a característica porte elevado e que apenas um loco gênico está envolvido na determinação da estatura das plantas. organizador. quantos filhotes de animais! O que deve estar ocorrendo no interior das células desses seres. "o índio". a formação de quiasma eleva a probabilidade de ocorrência de mutação dos genes. ele apresenta a figura abaixo. se os indivíduos cruzados forem homozigotos para esse loco gênico.5. através dos vestígios materiais encontrados nas pesquisas arqueológicas. ensinando a plantar diferentes espécies e a usar plantas frutíferas e medicinais. que lhes permite crescer?! Para facilitar a resposta a essa pergunta. Segundo Ribossomildo.

3 e 2. d) citrulina. Y e Z correspondem.5.O comportamento celular descrito na última frase do texto é chamado metástase. respectivamente. não necessariamente nessa ordem. Considere as seguintes afirmativas: I . O sinal + indica que houve crescimento do fungo. II . constituído de água. arginina e citrulina. O fungo utiliza esses elementos como precursores para a síntese de vários compostos. aos compostos a) ornitina. não deficiente em qualquer uma das enzimas.Agentes ambientais. c) 2.8. tal como na via biossintética representada na figura 1.8. Após essa fase várias dessas células podem cair na corrente sangüínea e invadir outros órgãos.a) 100% com estatura elevada b) 100% com estatura baixa c) 1/2 com estatura elevada e 1/2 com estatura baixa d) 1/4 com estatura elevada e) 3/4 com estatura elevada Questão 421 O texto abaixo refere-se às questões: ** a ** O tipo selvagem do fungo Neurospora é capaz de crescer em um meio de cultura simples. arginina e ornitina. Os compostos X.A inativação dos oncogenes é uma das condições essenciais para que as células citadas no texto se multipliquem desordenadamente.5 As linhagens A. citrulina e arginina.indica que não houve crescimento. d) 2. III . alcançando um número razoável de células e estabelecendo uma rede de vasos sangüíneos que passa a alimentá-las. b) ornitina. 3 e 1. tornando-as invulneráveis à ação do sistema imunológico. tais como radiações solares e agrotóxicos. Assinale a opção que contém a(s) afirmativa(s) 94 1. para as enzimas a) 1. 2 e 3. O esquema na figura 2 apresenta os resultados obtidos quando essas diferentes linhagens foram colocadas para crescer em diferentes meios de cultura.5. c) citrulina. sais minerais. açúcar e uma vitamina. podem provocar alterações genéticas nas células. A linhagem D é o tipo selvagem. 1 e 3. . o qual pode ser determinado pela perda da inibição por contato nas células. Um pesquisador obteve três diferentes linhagens desse fungo. e) 3. o sinal . No entanto. respectivamente. arginina e ornitina.5 As letras X. ornitina e arginina. Y e Z correspondem à citrulina. e) arginina. 1 e 2. Questão 422 1. citrulina e ornitina. Questão 423 Quando as células do corpo humano se multiplicam. B e C são deficientes. b) 1. determinado assim uma acentuada queda na sobrevida do indivíduo. se algumas células mutantes se tornam invulneráveis elas podem se multiplicar. cada uma delas deficiente em uma das enzimas participantes dessa via biossintética. espera-se que aquelas produzidas com defeitos sejam destruídas pelo sistema imunológico.

verdadeira(s). a) Apenas I e II. b) Apenas I e III. c) Apenas II e III. d) Apenas III. e) I, II, III. Questão 424 A síntese protéica envolve um complexo de estruturas celulares que trabalham harmonicamente, como mostra o esquema adiante.

1.1.4

1.1.3.2

Segundo a tirinha, a amiga de Calvin tem DOIS CROMOSSOMOS X. Com base neste dado podemos concluir que: a) a amiga de Calvin é mutante, por isso é hostil. b) um cromossomo X da amiga de Calvin é ativo e o outro é chamado de cromatina sexual. c) a heterocromatina ocorre em Calvin, pois ele é XY. d) os dois cromossomos X de que Calvin fala é da cobra que quer comê-lo. e) não há cromatina sexual em meninas. Questão 426

Com base no esquema e em conhecimentos correlatos, julgue os itens a seguir. (0) O esquema mostra a síntese protéica em uma célula procariótica. (1) Os tipos de RNA necessários para a síntese protéica em procariotos e eucariotos são essencialmente diferentes. (2) Na expressão de um gene eucariótico, a transcrição e a tradução ocorrem simultaneamente. (3) Uma molécula de RNAm pode ser utilizada para a síntese concomitante de várias moléculas da proteína. Questão 425 Leia com atenção a tirinha a seguir:

Qual das alternativas se refere a um cromossomo? a) Um conjunto de moléculas de DNA com todas as informações genéticas da espécie. b) Uma única molécula de DNA com informação genética para algumas proteínas. c) Um segmento de molécula de DNA com informação para uma cadeia polipeptídica. d) Uma única molécula de RNA com informação para uma cadeia polipeptídica. e) Uma seqüência de três bases nitrogenadas do RNA mensageiro correspondente a um aminoácido na cadeia polipeptídica. Questão 427 Quando afirmamos que o metabolismo da célula é controlado pelo núcleo celular, isso significa que a) todas as reações metabólicas são catalisadas por moléculas e componentes nucleares. b) o núcleo produz moléculas que, no citoplasma, promovem a síntese de enzimas catalisadoras das reações metabólicas. c) o núcleo produz e envia, para todas as partes da célula, moléculas que catalisam as reações metabólicas.
95

d) dentro do núcleo, moléculas sintetizam enzimas catalisadoras das reações metabólicas. e) o conteúdo do núcleo passa para o citoplasma e atua diretamente nas funções celulares, catalisando as reações metabólicas. Questão 428 Considere uma espécie de vertebrado cujas células embrionárias têm oito cromossomos. Em quantos grupos de ligações seus genes estarão associados? a) Dois. b) Quatro. c) Oito. d) Dezesseis. e) Número variável. Questão 429 A ilustração representa o cariótipo humano que permite determinar o número e a forma dos cromossomos.

Questão 431 Os cromossomos são constituídos principalmente por: a) fosfolipídeos. b) proteínas. c) ácido ribonucléico. d) enzimas. e) ácido desoxirribonucléico. Questão 432 A cromatina sexual compreende: a) o citoplasma de células gaméticas masculinas que se apresentam mais coradas que as femininas. b) o citoplasma de células gaméticas femininas que se apresentam mais coradas que as masculinas. c) cromossomo Y condensado em núcleos de hemácias humanas. d) um dos cromossomos X da mulher, que permanece condensado no núcleo das células, facilmente visualizado na mucosa oral. e) cromossomos X e Y condensados durante o período da interfase. Questão 433 Responder à questão com base no cariótipo (conjunto de cromossomas) humano representado abaixo.

1.1.4

Analisando-se a figura, é correto concluir que se refere a um indivíduo portador da síndrome de a) Klinefelter. b) Patau. c) Turner. d) Down. Questão 430 A presença de cromatina sexual predominante em número de células femininas está relacionada a cromossomos: a) Y inativos b) X inativos c) autossômicos inativos d) autossômicos que não se dividiram e) autossômicos agregados

1.1.4

cariótipo é de um indivíduo do sexo com síndrome de __________. a) feminino - Klinefelter b) masculino - Klinefelter c) masculino - Down d) feminino - Turner e) masculino - Turner

96

Questão 434 Numere a coluna inferior, relacionando-a com a superior. Indivíduos: 1 - 45, X 2 - 46, XX 3 - 49, XXXXX 4 - 49, XXXXY 5 - 47, XXX Quantidade de cromatinas sexuais (corpúsculos de Barr) ( ) quatro ( ) duas ( ) nenhuma ( ) uma ( ) três Assinale a opção que apresenta a seqüência correta de numeração. a) 2, 4, 1, 3, 5 b) 3, 5, 1, 2, 4 c) 2, 3, 1, 4, 5 d) 3, 2, 1, 4, 5 e) 2, 1, 3, 4, 5 Questão 435

Analisando o desenho esquemático que representa o núcleo de uma célula animal qualquer, podemos identificar que o componente responsável pela síntese de RNA que forma o ribossomo é assinalado pelo número: a) 1 b) 2 c) 3 d) 4 e) 5 Questão 436 Muitas vezes, durante a realização de eventos esportivos, é realizada a determinação do sexo genético. Este exame é feito pela observação dos cromossomos de células epiteliais. Pode-se afirmar que neste exame a) mulheres normais deveriam apresentar uma estrutura chamada corpúsculo de Barr, que corresponde a um dos cromossomos X. b) homens normais deveriam apresentar uma estrutura chamada corpúsculo de Barr, que corresponde ao cromossomo Y. c) mulheres normais deveriam apresentar duas estruturas chamadas corpúsculos de Barr, que correspondem aos dois cromossomos X. d) homens normais deveriam apresentar uma estrutura chamada corpúsculo de Barr, correspondente ao cromossomo X. e) mulheres normais na fase adulta não deveriam apresentar corpúsculo de Barr. Questão 437

1.1.4

Analise o esquema a seguir, o qual mostra o mecanismo de ação de algumas drogas antimitóticas que inibem a progressão a partir dos pontos indicados.

1.1.5.1

97

Assinale a afirmativa INCORRETA. a) A puromicina não tem qualquer efeito sobre o crescimento ou multiplicação celular. b) A mitomicina não permite a ocorrência da fase 5 do ciclo celular. c) Pelo menos duas das drogas interferem diretamente na síntese protéica. d) Nem todos os tipos de nucleotídeos sofrem ação da droga arabinosilcitosídeo. Questão 438 A figura a seguir representa _______________ , que ocorre na _______________ e tem como conseqüência _______________.

1.1.5.2

1.1.5.2

( ) O número de gametas AB deverá ser idêntico ao de gametas ab. ( ) A freqüência de gametas recombinantes deverá ser igual a de gametas não-recombinantes. ( ) Trezentos e sessenta gametas não- recombinantes são esperados. ( ) Vinte gametas recombinantes são esperados no caso descrito. ( ) A taxa de recombinação no caso citado é de 10%; logo, os locos A e B distam de 10 unidades de mapa. Questão 440 "Devo, finalmente, chamar a atenção para a possibilidade do pareamento dos cromossomos paternos e maternos, e sua subseqüente separação durante a divisão reducional, constituírem as bases físicas das leis de Mendel" (Walter S. Sutton, 1902). O que Sutton achava possível sabe-se, hoje, ser verdade, isto é: I. os genes estão localizados nos cromossomos. II. dois ou mais genes localizados no mesmo cromossomo são herdados, na maioria dos casos, em gametas diferentes. III. dois ou mais genes localizados em cromossomos diferentes segregam de maneira independente. Sobre as afirmativas acima, pode-se dizer que: a) somente III está correta. b) I e II estão corretas. c) II e III estão corretas. d) I e III estão corretas. e) somente II está correta.

A alternativa que preenche correta e respectivamente os espaços anteriores é: a) o crossing-over; metáfase da mitose; a variabilidade genética. b) o pareamento de cromátides-irmãs; anáfase I da meiose; a troca de genes alelos. c) o crossing-over; prófase I da meiose; a variabilidade genética. d) a segregação de cromossomos homólogos; anáfase I da meiose; a formação de células haplóides. e) o pareamento de cromossomos homólogos; metáfase da mitose; a formação de gametas. Questão 439 Analise as proposições abaixo, considerando a seguinte situação: Em uma amostra de 100 (cem) espermatogônias, de um organismo genotipicamente (AB//ab), ocorreu permutação meiótica entre os locos A e B, em 20 (vinte) espermatogônias, tendo sido observada uma segregação gamética como ilustrado na figura abaixo.

98

Questão 441

Questão 443 Quanto aos cromossomos sexuais X e Y, podemos afirmar que: a) como não são completamente homólogos, não se pareiam na meiose. b) como são completamente homólogos, pareiam-se na meiose. c) se pareiam na meiose, pois possuem uma região homóloga. d) não se pareiam na meiose, pois possuem uma região não homóloga. e) os genes que se encontram na região não homóloga do X condicionam um tipo de herança chamado herança restrita ao sexo. Questão 444 As variações das cargas elétricas das moléculas das proteínas W, X, Y e Z, em função do pH do meio, estão representadas no gráfico a seguir.

1.1.5.2

AMABIS e MARTHO. "Fundamentos da Biologia Moderna". São Paulo: Moderna, 1997. p. 499. A figura representa a a) mitose e explica a separação dos cromossomos durante a divisão. b) meiose e explica a segregação independente dos genes previstos pela segunda lei de Mendel. c) mitose e explica a segregação dos genes demonstrando a dominância e a recessividade. d) meiose, que é um processo de formação de gametas mas que não tem nenhuma relação com as leis de Mendel. e) mitose, que é um processo de divisão celular mas que não tem nenhuma relação com as leis de Mendel. Questão 442 Os gatos possuem 38 cromossomos, com o sistema XX/XY de determinação sexual. No desenvolvimento embrionário de fêmeas, um dos cromossomos X é inativado aleatoriamente em todas as células do organismo. Em gatos domésticos, a pelagem de cor preta (dominante) e amarela (recessiva) são determinadas por alelos de um gene localizado no cromossomo X. Fêmeas heterozigóticas para cor da pelagem são manchadas de amarelo e preto. Um geneticista colocou um anúncio oferecendo recompensa por gatos machos manchados de amarelo e preto. A constituição cromossômica desses gatos é a) 37, YO. b) 37, XO. c) 38, XX. d) 39, XXY. e) 39, XXX.

1.1.7.3

molécula do DNA, em pH fisiológico, apresenta carga elétrica negativa, devido a sua natureza ácida. No núcleo celular, ela está associada a proteínas, de caráter básico, denominadas histonas. De acordo com o gráfico, a proteína que apresenta propriedades compatíveis com as de uma histona é a representada pela seguinte letra: a) W b) X c) Y d) Z

99

Questão 445 Considere a rota metabólica que produz o aminoácido arginina na figura adiante.

grupamentos amina e hidroxila. Questão 447 O metabolismo celular depende de uma série de reações químicas controladas por enzimas, isto é, proteínas que atuam como catalisadores e que podem sofrer mutações genéticas sendo modificadas ou eliminadas. Assinale a alternativa correta, levando em conta os ácidos nucléicos, a ocorrência de mutações e as conseqüentes mudanças do ciclo de vida da célula. a) O DNA é constituído por códons, que determinam a seqüência de bases do RNA mensageiro, necessária à formação dos anticódons, responsáveis pela produção das proteínas. b) No caso de uma mutação acarretar a transformação de um códon em outro relacionado ao mesmo aminoácido, não haverá alteração na molécula protéica formada, nem no metabolismo celular. c) A mutação altera a seqüência de aminoácidos do DNA, acarretando alterações na seqüência de bases do RNA mensageiro e, conseqüentemente, na produção das proteínas. d) As mutações atuam diretamente sobre as proteínas, provocando a desnaturação dessas moléculas e, conseqüentemente, a inativação delas. e) Quando algumas proteínas são alteradas por mutações, suas funções no metabolismo celular passam a ser realizadas pelos aminoácidos. Questão 448 Organelas citoplasmáticas que contêm DNA: a) mitocôndria e ribossomo. b) mitocôndria e cloroplasto. c) nucléolo e cloroplasto. d) lisossomo e ribossomo. e) ribossomo e cromossomo. Questão 449 A hipótese de que os cloroplastos e as mitocôndrias tenham surgido através de uma associação simbiótica de um eucarioto primitivo com, respectivamente, bactérias fotossintetizantes e bactérias aeróbicas, é reforçada pelo fato daquelas organelas celulares: a) serem estruturas equivalentes, com grande superfície interna.
100

1.1.7.3

Em um experimento, três linhagens de bactérias foram irradiadas com raios X, que causaram mutações nos genes envolvidos na rota metabólica acima representada. Para descobrir quais enzimas da rota metabólica foram afetadas, as três linhagens foram cultivadas em meios suplementados com ornitina, citrulina e arginina, obtendo-se o resultado mostrado na tabela acima: Sobre esse experimento, podemos afirmar que a) o gene que codifica a enzima 1 na linhagem I foi afetado. b) o gene que codifica a enzima 2 na linhagem I foi afetado. c) o gene que codifica a enzima 3 na linhagem II foi afetado. d) o gene que codifica a enzima 1 na linhagem II foi afetado. e) o gene que codifica a enzima 3 na linhagem III foi afetado. Questão 446 Além de serem as macromoléculas mais abundantes nas células vivas, as proteínas desempenham diversas funções estruturais e fisiológicas no metabolismo celular. Com relação a essas substâncias é CORRETO afirmar que: a) são todas constituídas por seqüências monoméricas de aminoácidos e monossacarídeos. b) além de função estrutural, são também as mais importantes moléculas de reserva energética e de defesa. c) cada indivíduo produz as suas proteínas, que são codificadas de acordo com o seu material genético. d) a sua estrutura terciária é determinada pela forma, mas não interfere na sua função ou especificidade. e) são formadas pela união de nucleotídeos por meio dos

d) ribossomos e nos cloroplastos. encontre-se uracila radioativa SOMENTE nos a) nucléolos. e) produção de ATP no interior de plastos. c) nucléolos e nas mitocôndrias. c) estarem envolvidas. e) ATGCACCT. depois de mantidas em meio de cultura contendo uracila marcada. b) UACGUGGA. Questão 452 A célula muscular cardíaca e a esquelética têm a mesma origem porém são diferentes. d) TCCACGTA. tanto do ponto de vista estrutural como funcional. e) recombinação entre genes ativados. na produção e consumo de oxigênio. b) presença de carioteca envolvendo os componentes do núcleo celular. c) expressão diferencial dos genes. Ao longo do processo de diferenciação das células do mesmo organismo ocorre a) duplicação de alguns genes. No núcleo do óvulo normal de uma gata são esperados: a) 19 cromossomos simples e 19 moléculas de DNA. Questão 454 Uma bactéria. c) TACGTGGA. d) ribossomo. foram fixadas e submetidas à autoradiografia. e) ribossomos. e) DNA. c) utilização de oxigênio no interior de mitocôndrias. d) presença de DNA como material genético. Questão 456 É como se em cada quarto de um imenso prédio existisse uma estante contendo os planos do arquiteto para todo o prédio.. b) RNA transportador. um fungo e uma samambaia apresentam em comum a) produção de glicose através da utilização de energia solar. Questão 455 O gato doméstico ('Felis domestica') apresenta 38 cromossomos em suas células somáticas. b) 19 cromossomos duplicados e 38 moléculas de DNA. (. respectivamente. para comprovar os locais que possuíam esse material. Questão 450 "Captura aminoácidos que se encontram dissolvidos no citoplasma e carrega-os ao local da síntese de proteínas". É correto prever que. Essa função é desempenhada pelo a) RNA mensageiro.. d) apresentarem tilacóides e cristas como as bactérias. no citoplasma. e) 19 cromossomos duplicados e 19 moléculas de DNA. d) 38 cromossomos simples e 19 moléculas de DNA. os planos do arquiteto montam 46 101 1.1. d) indução de mutações específicas. nos cloroplastos e nas mitocôndrias. c) RNA ribossômico. Questão 453 A seqüência de nucleotídeos ATGCACCT forma um segmento de DNA dupla hélice ao se ligar à fita complementar a) AUGCACCU. b) ribossomos. c) 38 cromossomos simples e 38 moléculas de DNA.) No homem. e) serem encontradas tanto em organismos superiores como inferiores.7. Questão 451 Células vegetais.b) apresentarem DNA próprio.6 . b) perda dos genes não expressos.

e) Apenas II e V. na leitura da mensagem genética.1. que: a) somente I é verdadeira. UUG. Com relação às características dessa molécula. III. d) Apenas II e IV. ( ) O final da tradução ocorre quando. Questão 460 Neste ano de 2003. cujo anticódon é complementar ao segundo códon do RNAm geralmente onde há uma trinca UAA. ( ) O aminoácido metionina (I) é trazido ao ribossomo pelo RNAt cujo anticódon é UAC (II).volumes. se liga ao ribossomo. transcrevendo a seqüência de bases de uma cadeia de DNA. c) Apenas II e III. para os quais não há aminoácido correspondente.6 . acerca dos elementos constituintes do núcleo celular eucariótico. o RNAt do primeiro aminoácido é liberado (IV) no citoplasma.1 amostra: ribose II . de modo correto. para o qual existe apenas uma trinca de codificação.5 amostra: 20% de guanina e 30% de citosina Entre estas amostras. podemos afirmar que os códons 5 e 6 codificam. Considerando esse tema. um segundo RNAt (III). ( ) Na etapa seguinte da tradução. II. encaixa-se no sítio destinado à entrada de aminoácidos na cadeia peptídica. Sabendo-se que os códons 5 e 6 trazem a informação para um mesmo aminoácido.7. quais se referem a DNA? a) Apenas I e II. Os nucléolos podem atuar na síntese de carboidratos que migram do núcleo para o citoplasma. proposta por Richard Dawkins no livro "O gene egoísta". Nessa analogia. b) Apenas I e III. d) somente I e III são verdadeiras. complementar ao códon AUG do RNAm. e) somente II e III são verdadeiras. c) somente I e II são verdadeiras. analise a figura e as proposições a seguir. Cada cromossomo possui uma única molécula de DNA. O RNAm no citoplasma. ou para a metionina ou para o triptofano. se chega a um códon de parada (V).2 amostra: timina III . UAG ou UGA. I. b) somente II é verdadeira. cada página de cada volume contém um texto formado por uma seqüência de: a) fenótipos b) aminoácidos c) cromossomos d) bases nitrogenadas Questão 457 Analise as afirmativas a seguir. Pode-se afirmar. Questão 459 Cinco amostras com ácidos nucléicos foram analisadas quimicamente e apresentaram os seguintes resultados: I . ( ) Quando se estabelece uma ligação peptídica entre os dois primeiros aminoácidos. UUA ou GUA. são comemorados os 50 anos da "descoberta" da estrutura tridimensional do DNA. Questão 458 A molécula de RNAm é sintetizada no núcleo. onde se dá a produção de cadeias peptídicas.4 amostra: uracila V . Histonas são proteínas relativamente pequenas que se ligam fortemente ao RNA. ( ) 61 códons correspondem aos aminoácidos que compõem as proteínas. a saber. ao papel que ela desempenha nos seres vivos e aos processos em que se encontra envolvida é CORRETO afirmar que: 102 1.3 amostra: dupla hélice IV.

A informação. ela apresenta apenas uma fileira de nucleotídeos. pois independe da existência de uma fita molde. c) Os nucleotídeos são polimerizados por meio de ligações fosfodiéster entre o fosfato e a base nitrogenada. d) na transcrição e na tradução. c) apenas II e III. ela fica estocada dentro do núcleo das células. por serem herdáveis. porque agora se sabe toda a seqüência de genes dos cromossomos humanos. as conseqüências desses erros podem ser mais graves. (32) Nos organismos procariontes. b) correta. (64) Em alguns organismos primitivos. III. b) apenas I e II. Dentre as afirmativas abaixo. d) apenas I. não as proteínas que eles codificam. b) na replicação. apenas. Questão 464 Em abril de 2003. está a) correta. DNA e RNA são os ácidos nucléicos encontrados tanto em células eucariontes como procariontes. através do processo denominado transcrição. c) errada. d) Duas cadeias simples de DNA formam uma dupla-hélice. e) As duas cadeias de uma dupla-hélice possuem a mesma orientação. Questão 463 Erros podem ocorrer. e) em qualquer um dos três processos. apenas. da maneira como foi veiculada. 103 . A informação presente no RNA pode ser transformada em uma seqüência de aminoácidos. (02) Em sua composição é possível encontrar quatro bases nitrogenadas diferentes: a adenina. As proteínas e os ácidos nucléicos são formados por aminoácidos. Questão 462 Este ano comemorou-se 50 anos da publicação do trabalho de Francis Crick e James Watson. Questão 461 Analise as afirmativas: I. III e IV. porque o código genético diz respeito à correspondência entre os códons do DNA e os aminoácidos nas proteínas. IV. (04) Ela tem a capacidade de se autoduplicar. (16) A mensagem nela contida pode ser transcrita para uma outra molécula denominada RNA. III e IV. e) errada. quando ocorrem a) na transcrição. porque agora se sabe toda a seqüência de nucleotídeos dos cromossomos humanos. apenas. a citosina. existem regiões cromossômicas com alta taxa de mutação. c) na replicação e na transcrição. através do processo denominado tradução. durante os processos de replicação. d) errada. porque o Projeto decifrou os genes dos cromossomos humanos. embora em baixa freqüência. transcrição e tradução do DNA. e) apenas II. assinale a alternativa CORRETA: a) Uma cadeia simples de DNA é constituída de nucleotídeos.(01) É formada por duas fileiras de nucleotídeos torcidas juntas em forma de hélice. a finalização do Projeto Genoma Humano foi noticiada por vários meios de comunicação como sendo a "decifração do código genético humano". e suas seqüências de bases são complementares. que estabeleceu o modelo da estrutura da molécula de ácido desoxirribonucléico (DNA). Está(ão) correta(s) a) apenas I. apenas. Entretanto. por meio da formação de pontes de hidrogênio entre as bases nitrogenadas. compostos por uma desoxirribose ligada a um fosfato e a um aminoácido. II. porque não é possível decifrar todo o código genético. o aminoácido e a proteína. b) A polimerização de uma fita simples de DNA é dita semiconservativa. (08) Nela está contida a informação genética necessária para a formação de um organismo. A informação contida no DNA pode ser copiada em uma fita de RNA.

uma vez que o núcleo injetado não contém determinados genes.Questão 465 Ao se injetar o núcleo de uma célula diferenciada de uma rã em um ovo de outra rã. A idéia surgiu pela primeira vez em 1998 quando a análise de seqüências de DNA de humanos e de chimpanzés revelou 98.4% dos genes apresentam a mesma seqüência de DNA. a) As espécies Homo sapiens e Pan troglodites surgiram há 6 milhões de anos. (Fonte: "Folha de S. Questão 468 O gráfico mostra a variação dos números de indivíduos do tipo original e do tipo mutante. não fertilizado e cujo núcleo tenha sido removido.4% de identidade entre os genes humanos e de chimpanzés. Questão 467 Descobertas recentes na medicina e na saúde pública. removidos durante a diferenciação. Questão 466 CHIMPANZÉ TAMBÉM É "GENTE". apenas um deles desenvolve a capacidade de compor música. d) a formação de um girino normal a partir do ovo. de construir prédios e de fazer pesquisa científica. Mais recentemente. A diferença nos percentuais de identidade dos dois estudos se deve ao fato de que em 1998 foi estudado o DNA não-codificante. uma vez que o núcleo injetado contém toda a informação (DNA) necessária à formação do girino. e) Não haveria alteração alguma na freqüência desses alelos.Paulo". c) A longo prazo.4% de identidade. se aplicadas consistentemente. c) a formação de um clone de células não diferenciadas. 104 . Qualquer resistência às doenças infecciosas (de caráter hereditário). d) Os 97 genes comuns são os responsáveis pela diferenças entres seres humanos e chimpanzés. haveria adaptação genética a resistência a muitas doenças. em uma mesma área de floresta. ocorrerá: a) a morte da célula-ovo. que não faz parte das seqüências que podem ser transcritas e traduzidas. a) A freqüência dos alelos que conferem resistência inata às doenças seria aumentada. uma vez que o núcleo injetado proveniente da célula diferenciada contém DNA cuja composição de bases nitrogenadas é diferente da célula-ovo. mais pessoas se tornariam independentes de procedimentos médicos. assinale a afirmativa CORRETA. Alguns cientistas dos EUA afirmam que os chimpanzés (Pan troglodites) são geneticamente tão parecidos com os homens que deveriam ser incluídos no gênero Homo. DIZ ESTUDO. Assinale a alternativa que mostra. c) Seqüências de DNA que podem ser expressas como proteínas apresentaram maiores semelhanças que as seqüências não codificadoras. os efeitos da imunização em massa sobre a freqüência da resistência ou susceptibilidade inata às doenças.) Tendo em vista o texto apresentado. Estudar estes 0. Na realidade. em 21/05/2003. e) a expulsão do núcleo injetado por meio de exocitose realizada pela célula-ovo. uma vez que o núcleo injetado não possui alguns genes. nos 6 milhões de anos que separam a evolução do homem e do chimpanzé de um ancestral comum. biologicamente não somos tão diferentes dos chimpanzés como muitos crêem.6% de diferenças pode contribuir para entendermos como. b) Os genótipos que produzem pouca ou nenhuma resistência se tornariam comuns. ao longo de 100 anos. corretamente. que até o momento tem o Homo sapiens como único representante vivo. terão algum impacto no curso da evolução humana. conferiria vantagem seletiva a uma família. removidos durante a diferenciação. a comparação da seqüência de DNA de 97 genes comuns de humanos e de chimpanzés revelou 99. d) A longo prazo. como o sarampo e a difteria. b) 99. b) a morte da célula-ovo.

A ocorrência dessas mutações pôde ser localizada nos pontos indicados pelos retângulos escuros na árvore filogenética.ALA ALA .ARG .1. 1. b) de asa longa.LEU espécie C: MET .ALA ARG . IV e V. espécie A: MET .ARG .7 análise do gráfico permite concluir que: a) o tipo original permanece melhor adaptado ao longo do período analisado.PHE .VAL . e a forma PY. Para determinarmos se uma mosca de asa longa é homozigota ou heterozigota quanto ao par de genes que condicionam este caráter.ALA . b) o tipo original e o tipo mutante estão igualmente adaptados à mesma área de floresta.HIS .ARG .LEU .ARG .LEU . c) genótipo igual ao seu. II.ARG .10 Questão 471 Moscas de asas longas cruzadas entre si fornecem moscas com asas vestigiais. B e C).1. c) a mudança de ambiente provocou alteração nas freqüências gênicas.LEU .LEU Admitindo-se um ancestral comum para as três espécies.LEU . deixa de existir o efeito de dominância do alelo para o tipo original sobre aquele para o tipo mutante. ocorre em três formas diferentes: a forma P.PRO .LEU espécie B: MET . e) após 50 anos.PRO .PHE .HIS . a árvore filogenética que melhor expressa o parentesco evolutivo entre as três é: 1.ALA.GLU . com base na forma da proteína presente nos grupos de animais I.HIS .4.PHE . o procedimento correto é analisar a prole resultante do cruzamento desta mosca com outra de: a) asa vestigial.GLU . III.VAL . o tipo mutante passou a parasitar o tipo original.GLU .ARG .VAL .10 105 .LEU .4. Indique a alternativa que mostra as proteínas encontradas nos grupos de animais I a V. a forma PX. d) a partir de 50 anos. resultante de mutação no gene que codifica PX. 1. presente em praticamente todos os animais.Questão 470 A seguir estão representadas três seqüências de aminoácidos de proteínas retiradas de diferentes espécies (A.4.ARG . resultante de mutação no gene que codifica P.ARG . e) fenótipo dominante. d) fenótipo igual ao seu.PRO .1. Questão 469 Um determinado tipo de proteína.ARG ALA .

A probabilidade do primeiro filho de um homem albino casado com uma mulher normal.Questão 472 1. resultantes do casamento de um homem heterozigoto para esse fator. 3 ter um descendente com a anomalia. c) expressividade de um gene.1 1. mas heterozigota. e) de um caso de herança ligada ao cromossomo Y e de 50% a probabilidade de o casal n¡. Questão 473 Na espécie humana. A mudança ocorrida na coloração do pêlo em função da queda de temperatura demonstra o efeito da: a) norma de reação. sendo a anomalia causada por um gene recessivo e de 75% a probabilidade de o casal n¡.1. com uma mulher de igual genótipo. d) penetrância de um gene. b) mutação gênica. 2 ter um descendente do sexo masculino com a anomalia. b) exclusivamente de um caso de herança autossômica.5. e) alteração do genótipo pelo ambiente. 2 ter um descendente com a anomalia.5. ser albino e do sexo masculino é: a) nula b) 25 % c) 50 % d) 75 % e) 100 % Questão 474 A incidência de determinada anomalia foi investigada nos indivíduos da espécie humana representados no heredograma a seguir: Sabendo-se que os símbolos escuros representam portadores da anomalia. o albinismo é causado por um gene autossômico recessivo. determine a porcentagem de descendentes com o fenótipo igual ao do pai. 2 ter um descendente com a anomalia.1. sendo a anomalia determinada por um gene recessivo e de 50% a probabilidade de o casal n¡. c) de um caso que pode ser tanto de herança ligada ao sexo como de herança autossômica. d) de um caso que pode ser tanto de herança ligada ao sexo como de herança autossômica. sendo a anomalia causada por um gene dominante e de 75% a probabilidade de o casal n¡. é possível afirmar que se trata a) exclusivamente de um caso de herança ligada ao sexo. 3 ter um descendente com a anomalia.1 esquema anterior mostra uma experiência com um coelho himalaia. Questão 475 Sabendo-se que o albinismo é um caráter recessivo. a) 0% b) 25% c) 50% d) 75% e) 100% 106 . sendo a anomalia determinada por um gene recessivo e impossível o casal n¡.

Questão 478 Sabe-se que o casamento consangüíneo. em qualquer que seja o ambiente. B e C são heterozigotos. c) o fenótipo do indivíduo é o resultado da expressão de seu genótipo em um dado ambiente. c) fenótipo depende do genótipo e do meio ambiente. determina a cor amarela. Questão 481 Um gato preto (A) foi cruzado com duas gatas (B e C) também pretas. determina a cor púrpura e (a). O cruzamento do gato A com a gata B produziu 8 filhotes. e) o fenótipo do indivíduo é invariável e resulta da expressão de seu genótipo. ou seja. d) o genótipo do indivíduo pode variar como resultado da expressão de seu fenótipo em diferentes ambientes. João e Maria. todos pretos. b) genótipo depende do ambiente. e) genótipo depende dos genes. têm uma doença determinada por um gene dominante.Questão 476 Num homem heterozigoto para determinado caráter.1 107 . A e C são homozigotos. b) a cor preta é dominante. dominante. Questão 482 Dois genes alelos atuam na determinação da cor das sementes de uma planta: (A). d) genótipo depende do fenótipo e do meio ambiente. visando à sua adaptação. a porcentagem provável de espermatozóides que conterão o gene recessivo desse caráter é de: a) 0% b) 25% c) 50% d) 75% e) 100% Questão 477 Algumas variedades de canários mudam de cor dependendo da alimentação que recebem. Questão 480 Pedro e seus filhos. Esse gene: a) está no cromossomo X. e) a cor preta é recessiva. d) a cor preta é recessiva.1. entre indivíduos que são parentes próximos. Não há outros afetados na família. e) pode estar num cromossomo ou num autossomo. Esta mudança indica que o: a) fenótipo depende do ambiente. Isso pode ser justificado pelo fato de os filhos apresentarem: a) maior probabilidade de heterozigoses recessivas b) maior probabilidade de homozigozes recessivas c) menor probabilidade de heterozigoses dominantes d) menor probabilidade de homozigoses dominantes e) menor probabilidade de homozigoses recessivas Questão 479 Na genética. b) está no cromossomo Y. resulta numa maior freqüência de indivíduos com anomalias genéticas. recessivo. c) está num autossomo. d) pode estar no cromossomo X ou no Y. A e C são homozigotos. o cruzamento do gato A com a gata C produziu 6 filhotes pretos e 2 amarelos. uma expressão bastante conhecida diz que fenótipo é o genótipo mais o ambiente. A e C são heterozigotos.5. Essa expressão significa que a) o ambiente altera o genótipo do indivíduo. A e B são homozigotos. b) o genótipo do indivíduo é o resultado da ação do ambiente sobre seu fenótipo. A tabela a seguir apresenta resultados de vários cruzamentos feitos com diversas linhagens dessa planta: 1. A análise desses resultados permite concluir que: a) a cor preta é dominante. c) a cor preta é dominante.

Questão 485 Considere uma ovogônia de uma mulher heterozigota para o par de alelos Dd. e) apenas um óvulo D ou um óvulo d. Esses resultados sugerem que a cor dessas mariposas é 108 . Entre os possíveis gametas formados por essa ovogônia. Vv x vv Um pé de ervilha. d) a freqüência do alelo a é 0. portanto. sabendo que V representa o gene que determina cor amarela dos cotilédones e é dominante sobre o alelo v. na maioria das vezes. Questão 486 Qual a porcentagem de descendentes Aa nascidos de uma mãe Aa? a) 25% b) 50% c) 75% d) 100% e) depende do pai. VVx vv II. I. É correto afirmar que a) seus pais podem ser fenotipicamente normais. e) dos cruzamentos I. caráter condicionado por um alelo recessivo a. está grávida de um par de gêmeos. b) apenas do cruzamento II. c) a freqüência do alelo a é 0. e) 1% dos indivíduos da população têm deficiência da enzima E. Indivíduos escuros cruzados entre si produzem. casada com um portador de doença genética de herança autossômica dominante. que determina cor verde. II e III. Depois de alguns dias. d) apenas um óvulo Dd.1. produz vagens com sementes amarelas e com sementes verdes.2. Qual é a probabilidade de que pelo menos um dos gêmeos venha a ser afetado pela doença no caso de serem. e) genótipos variados em cada grupo. Questão 488 Uma mulher normal. 96% dos indivíduos têm cor clara e 4%. d) genótipos e fenótipos diferentes. gêmeos monozigóticos ou dizigóticos? a) 25% e 50% b) 25% e 75% c) 50% e 25% d) 50% e 50% e) 50% e 75% Questão 489 Em uma população de mariposas. Vv x Vv III. descendentes claros e escuros. d) apenas dos cruzamentos II e III. b) o mesmo fenótipo e genótipos diferentes. podemos encontrar: a) quatro óvulos Dd. c) apenas do cruzamento III. b) quatro óvulos D e quatro óvulos d. Questão 484 Dois grupos de mudas obtidas a partir de um mesmo clone de plantas verdes foram colocados em ambientes diferentes: um claro e outro escuro. c) dois óvulos D e dois óvulos d. cor escura. c) genótipos e fenótipos iguais. b) seus pais são certamente heterozigotos.presentam genótipo (Aa) as linhagens: a) I e III b) II e III c) II e IV d) I e IV e) III e IV I Questão 483 Considere os seguintes cruzamentos para ervilha. heterozigoto e que. Já os cruzamentos entre indivíduos claros produzem sempre apenas descendentes de cor clara. Questão 487 De uma população de 100 camundongos foi retirado ao acaso um indivíduo com deficiência da enzima E. as plantas que ficaram no escuro estavam estioladas o que significa que os dois grupos apresentam: a) o mesmo genótipo e fenótipos diferentes. pode resultar a) apenas do cruzamento I. respectivamente.

sobre seu estigma.100. o procedimento correto é analisar a prole resultante do cruzamento dessa mosca com outra de a) cor preta.400. Todos os indivíduos AA foram cruzados com indivíduos aa e os indivíduos Aa foram cruzados entre si.50. removendo as anteras da flor de uma planta homozigótica de alta estatura e colocando. respectivamente: a) cromossomos. Mendel fez fecundações cruzadas. respectivamente.500. e) uma trinca de bases do RNA transportador. embora sem conhecer.800. aa .50 b) AA . Considerando que cada casal produziu 2 descendentes.condicionada por a) um par de alelos. b) núcleos. publicado em 1866. Questão 494 Moscas de coloração acinzentada cruzadas entre si fornecem moscas de cor preta. Questão 493 Dizemos que um determinado gene é recessivo quando sua expressão (fenótipo): a) só acontece em heterozigose. mitose.200 e) AA . c) núcleos. O conhecimento atual a respeito da natureza do material hereditário permite dizer que a letra A usada por Mendel simboliza a) um segmento de DNA com informação para uma cadeia polipeptídica. Para determinarmos se uma mosca cinza é homozigota ou heterozigota quanto ao par de genes que condicionam esse caráter. aa .100 c) AA . Mendel ao enunciar essa lei já admitia.200. sendo o alelo para cor escura dominante sobre o que condiciona cor clara. d) genes. mitose. Para estudar os mecanismos de herança. e) reproduz uma característica provocada pelo ambiente. meiose. Aa . meiose. aa . b) um segmento de DNA com informação para um RNA ribossômico.1000. c) trouxe gametas masculinos com alelos para baixa estatura. b) um par de alelos. Com esse procedimento. Aa . c) um par de alelos. d) uma trinca de bases do RNA mensageiro. b) trouxe gametas femininos com alelos para baixa estatura. espera-se encontrar entre os filhotes: a) AA . Questão 492 Em plantas de ervilha ocorre. d) dois genes ligados com alta taxa de recombinação entre si. pólen recolhido da flor de uma planta homozigótica de baixa estatura. Questão 490 Uma população experimental contém 200 indivíduos AA. b) só ocorre quando em dose dupla. c) independe da presença de seu alelo.200. d) fenótipo igual ao seu.100 d) AA . como a coloração dos troncos onde elas pousam. 200 aa e 200 Aa. que não apresentam dominância um sobre o outro. d) promoveu o encontro de gametas com os mesmos alelos para estatura. b) cor cinza. Questão 495 "Cada caráter é condicionado por um par de fatores que se separam na formação dos gametas".100 Questão 491 Em seu trabalho com ervilhas. a existência das seguintes estruturas e processo de divisão celular. d) depende de características congênitas. aa . Aa . normalmente.200.100. autofecundação. e) genes. e) impediu o encontro de gametas com alelos diferentes para estatura. aa . c) um aminoácido em uma proteína. Mendel representou os fatores hereditários determinantes dos estados amarelo e verde do caráter cor da semente pelas letras A e a. Aa . sendo o alelo para cor clara dominante sobre o que condiciona cor escura. e) fenótipo dominante. 109 . o pesquisador a) impediu o amadurecimento dos gametas femininos. c) genótipo igual ao seu. mitose. Aa . e) fatores ambientais.

cor das sementes. presença ou ausência de manchas nas axilas foliares. b) Os indivíduos pretos de F eram homozigotos. o estame pode ser de cor púrpura ou verde. Questão 499 Do cruzamento de duas moscas com asas nasceram 120 descendentes com asas e 40 sem asas.000 e) 12. o padrão das nervuras foliares pode ser regular ou irregular. assinale a alternativa INCORRETA. Esse fenômeno é conhecido como: a) herança aditiva b) poligenia c) pleiotropia d) codominância Questão 501 Analise o heredograma para um fenótipo recessivo esquematizado a seguir e assinale a afirmativa INCORRETA. d) Se um indivíduo F1 com nervuras regulares for cruzado com um indivíduo da geração P. e) Os indivíduos F1 de nervuras regulares só podem ser homozigotos. b) A proporção fenotípica em F1 é de 3/4 de indivíduos irregulares e de 1/4 de indivíduos regulares.000 e 3.1 110 . Uma fêmea preta foi cruzada com um macho marrom. surgirão indivíduos regulares e irregulares na proporção 1:1.5. 1. Do cruzamento entre duas plantas com nervuras irregulares. a) As plantas cruzadas são heterozigotas.000 e 6. Se esses indivíduos forem retrocruzados com os parentais de estames verdes.000 b) 6.Questão 496 Em tomates. em alguns casos. com ervilhas. o número esperado de indivíduos com asas e sem asas será. um único par de alelos determina mais de uma característica no organismo. Cruzando-se plantas de estames de cor púrpura com plantas de estames verdes. assinale a alternativa correta. respectivamente. c) Todos os F1 com nervuras irregulares são heterozigotos. Isso ocorre. c) Todos os indivíduos pretos de F‚ eram heterozigotos. produzindo uma F composta por indivíduos marrons e pretos em igual quantidade. Se os 120 descendentes com asas forem cruzados com moscas sem asas e se cada cruzamento originar 100 indivíduos. A partir desses dados.000 e 3. a) 50% dos indivíduos pretos de F‚ eram heterozigotos. por exemplo.1. Retrocruzando-se um macho preto de F com a fêmea parental.000 e 4.000 e 4. obteve-se uma geração F composta apenas de indivíduos com estames de cor púrpura.000 d) 9. em que um único par de alelos é responsável por três características fenotípicas: cor das flores. Questão 498 Em uma determinada planta. a) 6.000 Questão 500 Em genética. e) Os indivíduos pretos da geração F eram heterozigotos e a fêmea parental era homozigota. então a porcentagem de descendentes com estames verdes será de: a) 25% b) 50% c) 75% d) 0 e) 100% Questão 497 Em porquinhos da Índia. originou-se uma F1 composta por plantas com nervuras regulares e outras com nervuras irregulares. A partir desses resultados. 75% dos filhotes produzidos em F‚ tinham pêlo preto e 25% apresentavam pêlo marrom. o pêlo pode ser preto ou marrom.000 c) 8. d) Todos os indivíduos marrons eram homozigotos.

Questão 502 Os bulbos da cebola podem ser brancos. as lacunas I. c) roxo com planta de bulbo roxo pode produzir todos os três fenótipos mencionados. d) Aa. dominante. heterozigotos e aa. II. O gene para o albinismo é __(II)__ e não se manifesta nos indivíduos __(III)__. a proporção Em uma certa espécie de mamíferos. há um caráter mendeliano com co-dominância e genótipos EE." No trecho acima. homozigoto e Aa. c) haverá maior número de animais com genótipos EE e CC do que com genótipo EC na região I. As duas enzimas são codificadas por genes alelos dominantes com segregação independente. heterozigotos e AA. 1/2 Aa e 1/4 aa c) 1/3 AA e 1/4 aa d) 1/4 Aa. por: a) AA. respectivamente. heterozigotos e aa. o alelo recessivo pode ser herdado por descendentes fenotipicamente normais. b) AA.5. Nesses vegetais. pois os genótipos serão: a) 1/2 AA e 1/2 aa b) 1/4 AA. c) Aa. homozigoto e aa. c) O fenótipo ocorre igualmente em ambos os sexos. onde há predadores naturais da espécie. que chamaremos de E1. existe um precursor incolor que. Em I não há registro da presença do vírus X e em II ele é transmitido por contato com as presas da espécie. é INCORRETO afirmar que o cruzamento de plantas de bulbo: a) incolor com planta de bulbo incolor só pode originar fenótipo incolor. Questão 504 "Casais de pigmentação da pele normal. fenotípica mendeliana 3:1 aparecerá na geração F2. são cruzadas. recessivo. uma homozigota para o alelo dominante (AA) e uma homozigota para um alelo recessivo (aa). os animais de genótipo CC são mais facilmente capturados pelos predadores. e) aa. 111 . Questão 503 Quando duas populações da espécie vegetal 'Zea mays' (milho). EC e CC. Questão 505 1. recessivo. sob a ação de uma enzima. III e IV devem ser preenchidas correta e. Sabe-se que animais heterozigóticos são mais resistentes a um dado vírus X do que os homozigóticos. b) amarelo com planta de bulbo amarelo não produz plantas com bulbo roxo. amarelos ou roxos. de acordo com o esquema a seguir. quando a geração F1 se intercruza.1 Analisando as informações apresentadas de acordo com os seus conhecimentos. Animais com os três genótipos foram introduzidos em duas regiões diferentes designadas por I e II. que a enzima E2 transforma em roxo.a) As pessoas afetadas possuem pelo menos um dos pais obrigatoriamente afetado. b) haverá igual chance de adaptação de animais com os três genótipos apenas na região I. São albinos apenas os indivíduos de genótipo __(IV)__. d) Se um dos pais é heterozigoto. Porém. Pode-se prever que a) haverá igual chance de adaptação de animais com os três genótipos nas duas regiões. dominante.1. Nos dois ambientes. b) Aproximadamente 1/4 das crianças de pais não-afetados pode ser afetado. dominante. que apresentam genótipo __(I)__ podem ter filhos albinos. se transforma em um pigmento amarelo. 1/2 AA e 1/4 aa e) É impossível determinar os genótipos utilizando os dados acima. embora seja heterozigota. toda a descendência da primeira geração (F1) assemelha-se ao tipo parental dominante (Aa). d) amarelo com planta de bulbo incolor não produz plantas com bulbo roxo.

Crossing-over III . ( ) conjunto de características detectáveis de um indivíduo. Um cruzamento-teste de um indivíduo de cor preta produziu descendentes brancos e pretos em igual número. Qual é a probabilidade de um casal de acondroplásicos. II. IV e III 112 . II. numa dada espécie. a proporção fenotípica esperada na prole será de a) 3 pretos :1 branco b) 2 pretos :1 branco c) 1 preto : 3 brancos d) 1 preto : 2 brancos e) 1 preto :1 branco Questão 509 Sabe-se que a transmissão hereditária da cor das flores conhecidas como copo-de-leite se dá por herança mendeliana simples. IV e III b) III. d) os animais cruzados eram heterozigotos. seja condicionado por um par de alelos.Genoma II . Em um cruzamento experimental de copos-de-leite vermelhos. I.d) a seleção natural será mais favorável aos animais com genótipo EC na região II. V. I . V. os cientistas constataram que apenas um em cada três descendentes vermelhos era homozigoto para essa característica. com dominância completa.Alelo V .Fenótipo IV . pode-se afirmar que a produção genotípica da F desse cruzamento experimental foi: a) 4 Aa b) 2 Aa : 2 aa c) 3 AA : 1 Aa d) 1 AA : 2 Aa : 1 aa Questão 510 Numere a segunda coluna de acordo com a primeira.Gene ( ) troca de fragmentos de cromossomos homólogos na primeira divisão da meiose. Questão 506 No homem. ( ) conjunto de genes organizados nos cromossomos. A partir desses dados. Questão 508 Em cobaias. só é possível concluir que a) o caráter é recessivo.bastante numerosa. e) a seleção natural será mais favorável aos animais com genótipo EE na região II. quando cruzados entre si. vir a ter um menino acondroplásico? a) 1 b) 3/4 c) 3/8 d) 1/4 e) 1/8 Questão 507 Considere que o comprimento da cauda. De acordo com tais dados. a acondroplasia é uma anomalia determinada por um gene autossômico dominante. que já tem uma menina normal. ( ) segmento do DNA capaz de transcrever uma molécula de RNA. I. numa proporção de 3 descendentes vermelhos para cada branco (3:1). obteve-se uma primeira geração . mas não são obrigatoriamente iguais. Animais com cauda longa foram cruzados repetidas vezes entre si originando sempre descendentes com cauda longa. I. e) o genótipo dos descendentes difere do dos pais. pelo alelo recessivo. a cor preta do pêlo é condicionada por um alelo dominante e a cor branca. V e IV c) II. III e V e) I. III. V e IV d) IV. Analisando o genótipo da F. Os descendentes. A seqüência correta é: a) II. associando os conceitos aos respectivos termos. I. b) o caráter é dominante. Se esses descendentes pretos forem cruzados entre si. também só originaram filhotes de cauda longa.F . ( ) atuam sobre a mesma característica. II. c) os animais cruzados eram homozigotos.

responsável pela ocorrência da Segunda Lei de Mendel. tanto da espécie X quanto da espécie Y. e) se I.X e Y . Assinale: a) se somente I e II estiverem corretas. II e III estiverem corretas.Questão 511 Considere as seguintes proposições: 1 . a 4 e a 5 são corretas. a 3 e a 4 são corretas. é a Anáfase I. 2 . b) taxa de crossing-over. a altura. d) se somente II e III estiverem corretas. e) ocorrência de pleiotropia. 3 . 1. mas na maioria dos casos é claramente hereditária.A calvície pode ser originada por causas ambientais. c) Apenas a 1. Questão 514 Considere as proposições seguintes.Em nenhuma hipótese a calvície ocorre na mulher.Um homem calvo (homozigoto) transmite a característica da calvície a todos os filhos homens nascidos de seu casamento com uma mulher não calva. 100% de mudas altas ao cruzar mudas altas em F2. Concluiu-se com relação a estas proposições que: a) Apenas a 2. 100% de mudas altas ao cruzar mudas altas em P1 com mudas altas em F2. O enunciado da Primeira Lei de Mendel diz que os alelos de um gene separam-se durante a formação dos gametas. há também uma necessidade crescente de alimentos. III. e) Y. b) Apenas a 1. c) se somente I estiver correta. sabe-se que o cruzamento de duas linhagens homozigotas selecionadas pode produzir espigas maiores e de melhor qualidade comercial. realizou-se cruzamento entre mudas altas e baixas das duas espécies (P1). I. c) freqüência de genes em heterozigose.1 113 .5. e) Apenas a 2. d) Apenas a 1.Uma mulher será calva se seus pais forem calvos e se sua mãe (heterozigota) possuir um de seus genitores calvo. d) Y. obtendo F1 que ao serem fenótipos resultantes dos cruzamentos foram representados nos gráficos a seguir: upondo que as plantas altas. a 3.poderiam apresentar mudas com alturas diferentes. a 2 . d) inativação de alelos codominantes. c) Y. II. por se tratar de herança ligada ao sexo. a 3 e a 4 são corretas. 100% de mudas altas ao cruzar mudas altas em P1 com mudas médias em F2. Supondo-se que duas espécies vegetais . b) se somente I e III estiverem corretas. em conseqüência da alta a) interação de genes recessivos. 50% de mudas altas ao cruzar as mudas altas em F1. a 3 e a 4 são corretas. 5 . A fase da meiose. por exemplo.A calvície é dominante no sexo masculino 4 .1. a 2 e a 3 são corretas. 100% de mudas altas ao cruzar as mudas médias em F2. cada um atua e segrega independentemente dos demais. b) X. podese afirmar que se obtém na espécie: a) X e na espécie Y. Questão 512 Com o enorme crescimento populacional. Questão 513 No que se refere ao desenvolvimento do chamado milho híbrido. O enunciado da Segunda Lei de Mendel diz que quando dois ou mais genes estão envolvidos. Muitas vezes esse melhoramento lança mão do conhecimento da herança genética de um determinado carácter como. sejam mais produtivas. o que estimula a obtenção de culturas vegetais com máxima produtividade.

os descendentes obtidos em F1 apresentariam 1. apresentam asas normais. d) O caráter é controlado por um par de genes. Todas as alternativas apresentam conclusões a partir desses resultados. b) à segregação do par de alelos durante a formação dos gametas. b) um cruzamento de dois genitores homozigotos contrastantes. b) 100% de flores púrpuras. d) a separação de um par de alelos durante a formação dos gametas. b) a influência do ambiente na expressão do genótipo. c) à ocorrência de fenótipos diferentes em uma população. c) O alelo dominante do gene se expressa em cor verde. Questão 520 Analise esta tabela: MÉDIA DAS DIFERENÇAS NAS CARACTERÍSTICAS ENTRE GÊMEOS MONOZIGÓTICOS E DIZIGÓTICOS 114 . d) o processo de seleção natural. Questão 517 Quando Mendel cruzou plantas de ervilha apresentando vagens de coloração verde com plantas de vagens de coloração amarelas. d) 50% de flores púrpuras e 50% de flores brancas. e) à união dos gametas para formar o zigoto. c) a transmissão dos caracteres adquiridos. criadas em temperatura de 25°C.5. obteve na primeira geração (F) todos os descendentes de coloração verde.1 s moscas de genótipo igual ao do tipo III.1. EXCETO: a) A expressão do alelo recessivo do gene desaparece apenas em F. O resultado desse fenômeno ilustra a) a adaptação dos mutantes. e) Os indivíduos que apresentam vagens de coloração verde em F‚ são heterozigotos.1. as plantas de flores brancas. quando criadas em temperatura de 16°C. d) à ocorrência de genótipos diferentes em uma população.1 a) 100% de flores brancas. Questão 518 A coloração das flores de ervilha é determinada por herança autossômica. Questão 516 A primeira Lei de Mendel refere-se a) ao efeito do ambiente para formar o fenótipo.Questão 515 A primeira lei de Mendel ou lei da segregação significa: a) um cruzamento onde se considera apenas um gene. A figura a seguir representa um dos cruzamentos realizados por Mendel entre plantas de ervilhas com flores púrpuras e plantas com flores brancas. Se Mendel utilizasse como genitor masculino as plantas de flores púrpuras e como feminino. b) As plantas com vagens verdes ou amarelas da geração parental devem ser homozigotas. e) 100% de flores de coloração rósea. Questão 519 Esta figura representa o cruzamento de drosófilas de asas normais com indivíduos de asas enroladas.5. 1. representado por dois alelos. c) um cruzamento de dois genitores heterozigotos. mutantes. e) um caráter controlado por dois ou mais genes. c) 75% de flores púrpuras e 25% de flores brancas. Na segunda geração (F‚) obteve 428 verdes e 152 amarelas.

5. e só pessoas com sardas podem ter filhos com sardas (veja no heredograma abaixo). d) aos 40 anos. convulsões e morte. om base nos dados dessa tabela e em outros conhecimentos sobre o assunto. As sardas aparecem igualmente em homens e em mulheres. podem ser transmitidas de pai para filho.5.1. a surdez congênita e a esclerótica azulada. Questão 522 Na espécie humana há um gene que exerce ação simultaneamente sobre a fragilidade óssea.1 Com base nas informações desse gráfico e em outros conhecimentos sobre o assunto. cerca de 85% dos indivíduos heterozigotos já manifestaram a doença. é CORRETO afirmar que a) o peso é a característica que apresenta maior influência genética. Assinale a alternativa que define o caso.1 115 .1. Questão 521 O mal de Huntington é uma doença autossômica dominante caracterizada por deterioração mental progressiva. a) em torno dos 65 anos. ocorrem em todas as gerações.1. c) a influência ambiental pode ser avaliada em gêmeos MZ. c) aos 30 anos.5. aproximadamente 75% dos indivíduos Aa se apresentam sem os sinais clínicos da doença. filhos de casais Aa × aa têm 50% de probabilidade de manifestar a doença.1 1. em que se mostra o percentual de indivíduos doentes entre aqueles que possuem genótipo favorável: 1. d) o comprimento da cabeça apresenta maior influência ambiental. Os indivíduos afetados são heterozigotos. b) as diferenças entre gêmeos MZ indicam diferenças genéticas entre eles.1. é INCORRETO afirmar que. b) antes de atingirem a idade de 15 anos. indivíduos portadores do alelo mutante podem expressar a doença. a) Ligação genética b) Penetrância completa c) Pleiotropia d) Herança quantitativa e) Polialelia Questão 523 A presença de sardas em seres humanos é uma característica hereditária determinada por um par de alelos. Analise este gráfico.

Soma ( ) 1. (16) A freqüência fenotípica numa prole numerosa será 3:1. seleção de parceiros e restrições ao endocruzamento. é correto afirmar: (01) O descendente será obrigatoriamente heterozigoto. Da união de um homem acondroplásico com uma mulher normal resulta um filho normal. considerando ausência de mutação. b) a presença de sardas se deve a um alelo recessivo ligado ao cromossomo X. dispersão dos filhotes ainda jovens. a freqüência fenotípica será de 1 acondroplásico para 1 normal. d) a presença de sardas se deve a um alelo autossômico recessivo. c) a presença de sardas se deve a um alelo dominante ligado ao sexo. (08) O endocruzamento não interfere no valor adaptativo. da mesma espécie. Quais os genótipos dos pais. Este se casa com uma mulher normal cujos pais eram normais (conforme heredograma abaixo).5. origina descendentes predominantemente heterozigotos. Soma ( ) Questão 526 Cheiros e odores corporais fazem parte do aparato de comunicação em várias espécies de mamíferos.1 116 . é possível deduzir que a) a presença de sardas se deve a um alelo recessivo ligado ao cromossomo Y. por exemplo. (32) Numa prole numerosa. (02) A freqüência genotípica na descendência será 1:2:1. (04) A probabilidade de acondroplasia na descendência é igual a zero. e) a presença de sardas se deve a um alelo autossômico dominante. Questão 524 Uma ovelha branca ao cruzar com um carneiro branco teve um filhote de cor preta. influenciando uma variedade de atividades como. é correto afirmar: (01) O cruzamento entre indivíduos geneticamente diferentes.1. reconhecimento da prole. se a cor branca é dominante? a) Ambos são homozigotos recessivos b) Ambos são brancos heterozigotos c) Ambos são homozigotos dominantes d) A mãe é Bb e o pai é BB e) A mãe é bb e o pai é Bb Questão 525 A acondroplasia (uma das formas de nanismo) é causada por um gene dominante autossômico. (02) O cruzamento entre indivíduos geneticamente diferentes. (08) A probabilidade de heterozigose na descendência em relação a este locus é igual a zero. Machos e fêmeas sentem-se atraídos por odores de linhagens não relacionadas. origina descendentes homozigotos. A respeito desse assunto. (16) Um indivíduo híbrido é aquele que resulta da união entre dois indivíduos geneticamente diferentes.abendo disso. da mesma espécie. (04) O endocruzamento pode causar uma redução no valor adaptativo pela maior probabilidade de ocorrência de genótipos ou combinações homozigotas de alelos recessivos deletérios. Em relação aos descendentes deste último casamento e ao caráter em questão.

na pesquisa científica. ) Apresenta autofecundação. em sua maioria. Que informações permitem avaliar com maior precisão as chances de João e Maria terem um filho albino? a) O fenótipo da irmã de João e o genótipo do avô de Maria. representando o mecanismo de transmissão da fibrose cística: Questão 529 A Primeira Lei de Mendel ou Lei da Segregação dos Genes pode ser relacionada a uma das fases do processo meiótico.Questão 527 A matéria publicada no Jornal O GLOBO. Assim.5. Os produtos de uma cadeia de reações podem ser utilizados em muitas outras vias metabólicas. Questão 531 Em 2005. A afirmação acima se refere ao conceito de a) dominância incompleta. d) alelismo múltiplo. c) O fenótipo do irmão de João e o fenótipo da irmã de Maria. e) O fenótipo do pai de João e o genótipo do pai de Maria. b) heterogeneidade genética. b) A fibrose cística é causada pela presença de um par de genes recessivos. Os pais de Maria também têm pigmentação normal. foi ilustrada com o esquema a seguir. por parte de mãe. iniciaram-se as comemorações do centenário da utilização da 'Drosophila' sp. Assinale a alternativa que apresenta a fase referida. b) O genótipo da tia de João e o genótipo do irmão de Maria. a) Prófase I b) Metáfase I c) Anáfase I d) Metáfase II e) Telófase II Questão 530 João e Maria estão pensando em ter um filho. d) O genótipo do primo de João e o fenótipo da mãe de Maria. com o título "Teste ajuda a evitar doenças congênitas". não é surpreendente que a expressão fenotípica de um gene envolva mais do que uma característica. c) A doença somente se manifesta quando dois indivíduos portadores são cruzados. amplamente utilizado em experimentos na área de genética e evolução. ) Não apresenta dimorfismo sexual. em 02 de julho de 1995. Assinale com V (verdadeiro) ou F (falso) as afirmações a seguir sobre esse inseto. Seus pais não são albinos. A seqüência correta de preenchimento dos parênteses. Já Maria tem um avô materno e uma irmã albinos e um irmão com pigmentação normal.1 O esquema publicado apresenta um erro. e) O indivíduo 18 é afetado pela fibrose cística e não um portador desta doença. com a mesma característica. d) O indivíduo 8 é homozigoto dominante para a fibrose cística. são interligadas e freqüentemente interdependentes. João tem um irmão albino e uma irmã com pigmentação normal. Questão 528 As reações bioquímicas. 1. ) Apresenta pequeno número de cromossomos. ( ( ( ( ( ) Apresenta variantes genéticas facilmente observáveis.1. e) fenocópia. de 117 . c) pleiotropia. porém João tem uma tia paterna albina e um primo. Assinale a opção que faz referência a esse erro. a) Os indivíduos 3 a 6 são heterozigotos para a fibrose cística. ) Apresenta ciclo reprodutivo curto e fecundidade alta.

V. 118 . Neville e Draco..V . consultou um amigo que estava estudando genética.F . b) seu avô paterno ser calvo...V...Contou que. d) Apenas II e III.cor da pelagem em coelhos . Rony... Na família do avô materno.. e) V .F . e) I..F . I . a) 3/8 ..5. embora seus pais não fossem calvos... sendo sua mãe filha de trouxas. Simas é bruxo. de ervilhas amarelas e .Hermione apresenta dois alelos para o caráter bruxo. Essa conclusão baseia-se no fato de a) sua mãe ser heterozigota.1/8 Questão 534 Leandro. resultando em 192 descendentes... Harry é bruxo. filho de bruxos.. c) sua avó paterna ser heterozigota.. foi sugerido que a característica de ser ou não bruxo seguiria padrão de segregação mendeliana. na ordem em que aparecem. Seu amigo explicou que a calvície é uma característica influenciada pelo sexo e que se expressa nos homens em homo e heterozigose e nas mulheres.....cima para baixo é a) F .F ..3/8 d) 6/8 .F. somente em homozigose. Questão 533 Assinale a alternativa que preenche corretamente as lacunas do texto a seguir.obedece ao proposto pela 1 Lei de Mendel.F . 776). a produção de uma geração Fƒ a partir da autofertilização da geração F‚ resultante do cruzamento de ervilhas parentais homozigotas amarelas (AA) e verdes (aa) produziria .. Hermione é bruxa mas filha de trouxas (não bruxos).F . tendo sido realizados os cruzamentos a seguir: 1.F .V . Questão 535 Considere que o caráter analisado .Simas é heterozigoto para o caráter bruxo. filhos de pais bruxos.V ..4/8 c) 5/8 . De acordo com a hipótese de segregação de fatores proposta por Mendel. Questão 532 Conforme correspondência publicada na revista científica "Nature" de agosto de 2005 (p.. de ervilhas verdes. Neville e Draco são bruxos. Assim concluiu que a chance de Leandro vir a ser calvo era de 50%.V . sua avó materna era. III . não havia histórico de calvície.V . c) V .F.. d) seu pai ser heterozigoto. II e III.. e) sua avó materna ser heterozigota. II .1 Todos os descendentes pretos de F2 foram cruzados com os F1. filho de uma bruxa e de um trouxa.2/8 e) 7/8 .V . d) V . c) Apenas I e III.V. b) Apenas II. preocupado com a possiblidade de vir a ser calvo. considere as seguintes afirmações sobre o caráter bruxo em termos genéticos. b) F . provenientes de famílias bruxas tradicionais.5/8 b) 4/8 .. Com base no texto.V .F . Quais estão corretas? a) Apenas I.Harry é menos bruxo que Rony. Assinale o número esperado de descendentes com pelagem branca.1..

mulheres-aranha seriam esperadas na população apenas se tal alelo ocorresse em homozigose (SS). o que se deseja é a produção de sementes. c) 50% heterozigota. d) formada por homozigotos para o alelo dominante. um indivíduo heterozigoto para um caráter regulado por dominância completa provavelmente produzirá a seguinte porcentagem Suponha que um evento de mutação permitiu ao homem-aranha secretar a seda formadora de teia. Para a produção de milho. Considerando que o homem-aranha é o único a ter essa mutação. b) 50% dominante e 50% recessiva. d) 100%.Questão 536 Em vários cultivos. foi integrada a um único cromossomo. Questão 538 De acordo com a primeira lei de Mendel. não portadora do gene do hormônio do crescimento. por exemplo. e) formada por homozigotos recessivos. a expectativa quanto aos fenótipos de seus futuros descendentes poderá ser uma entre as possibilidades abaixo. gerando um camundongo macho gigante. a fração de descendentes gigantes. espera-se que a F seja a) 100% heterozigota. b) Todos os seus meninos deverão ter o fenótipo "aranha". Questão 537 Por meio da técnica do DNA recombinante. 50% delas deverão ser normais. e) Na presença de genes recessivos. assinale a alternativa CORRETA: a) Os genes codominantes têm menor influência no fenótipo do que os fatores ambientais. 25% poderá ser de meninos-aranha. Este zigoto foi implantado em uma "mãe de aluguel". Assinale a afirmativa CORRETA: a) Terá filhas-aranha se casar com uma prima de primeiro grau. c) Os genes dominantes são independentes dos fatores ambientais para se expressarem. d) Pode ser muito difícil determinar se o fenótipo resulta mais do efeito gênico do que o ambiental.1. e) 75% com alelo recessivo e 25% com alelo dominante. 25% homozigota dominante e 25% homozigota recessiva. Esse único evento resultou na formação de um alelo (S) autossômico e dominante.5. é necessário que ocorra a polinização. Desta forma. Com relação aos princípios básicos da hereditariedade. apenas o efeito ambiental prevalece no fenótipo. b) Na expressão gênica os efeitos do ambiente celular não são considerados. provavelmente. de zigoto de camundongo. responsável pela síntese do hormônio do crescimento (somatotrofina). Se o pólen de uma planta heterozigota para um determinado loco gênico fecundar os óvulos de uma planta também heterozigota para esse loco. c) Na geração F1. d) 75% com alelo dominante e 25% com alelo recessivo. na fase G do ciclo celular. uma cópia de um gene humano. e) Quem herdar o cromossomo Y deverá ser uma criança-aranha. b) 100% com alelo dominante. c) 50% com alelo recessivo e 50% com alelo dominante. de gametas: a) 100% com alelo recessivo. será igual a a) zero.1 Se o camundongo macho gigante cruzar com uma fêmea normal. 119 . Questão 539 Os mecanismos da herança apresentam diferentes maneiras pelas quais os genes interagem entre si e com o ambiente para manifestarem seus efeitos no fenótipo dos seres vivos. Questão 540 1. b) 25%. mas com expressão influenciada pelo sexo. d) Analisando apenas as filhas. c) 50%.

o número esperado de heterozigotos é: a) 45. Questão 544 Considerando-se que a cor da pelagem de cobaias é determinada por um par de alelos. c) Sim.5. Entre as cobaias de pêlos curtos. (3) Os homens normais representados no heredograma são necessariamente heterozigotos. e) 180. Questão 543 O gene autossômico. b) Não. O heredograma seguinte ilustra uma situação em que há indivíduos fenilcetonúricos. (5) A dieta especial a que devem ser submetidos os recém-nascidos fenilcetonúricos tende a alterar a freqüência do gene da fenilcetonúria na população. e) Depende do tipo de diabete. das quais 240 tinham pêlos curtos. pois o genótipo dos filhos não é alterado pela insulina.Questão 541 No Brasil. com prejuízo da fala e dos movimentos. 1. que pode apresentar dominância ou recessividade. A administração de insulina aos diabéticos evitará que eles tenham filhos com este distúrbio? a) Não. que condiciona pêlos curtos em cobaias. (4) A probabilidade de que o casal formado pelos indivíduos 10 e 11 tenha um descendente do sexo masculino fenilcetonúrico é igual a 12. embora o distúrbio possa aparecer em crianças cujos pais são normais. d) 160. foram realizados cruzamentos entre esses animais. julgue os itens abaixo. é dominante em relação ao gene que determina pêlos longos. Em algumas dessas formas. Questão 542 Os vários tipos de diabete são hereditários.1. conforme a tabela. Se detectada a tempo. 1. pois a insulina é incorporada no sangue fazendo com que os filhos não apresentem o distúrbio.5.1 120 .1 Considerando o heredograma. essa doença pode ser controlada ministrando-se ao recém-nascido uma dieta especial. pois nesses casos o genótipo pode ser alterado evitando a manifestação da doença nos filhos. c) 90. d) Sim. (2) O cruzamento entre os indivíduos 10 e 11 ilustra como a consangüinidade influencia o aparecimento de doenças hereditárias. uma lei determina que os recém-nascidos sejam submetidos ao "teste do pezinho". doença hereditária que pode levar ao retardamento mental. os sintomas podem ser evitados por meio de injeções diárias de insulina. (1) O caráter fenilcetonúrico apresenta herança autossômica dominante.5%.1. pois a insulina é incorporada nas células e terá ação nos filhos. b) 60. pois tanto o genótipo como o fenótipo dos filhos são alterados pela insulina. por meio do qual se identifica a fenilcetonúria. Do cruzamento de cobaias heterozigotas nasceram 300 cobaias.

e) o albinismo impede a síntese de clorofila. c) no cruzamento III. entre outras manifestações. Questão 547 No cruzamento de plantas verdes. e) epistasia e homozigotos dominantes. Indique qual será o resultado do cruzamento da variedade de flores rosas (F‚). d) o gene para albinismo é ativado no escuro. As flores vermelhas e brancas são homozigotas. c) ligada ao cromossomo X e dominante. Essa síndrome é mais freqüente em descendentes de casais aparentados e ocorre em machos e fêmeas em proporção relativamente igual. Na geração F todas as flores eram rosas. e) no cruzamento V. normais. e) ligada ao cromossomo Y e recessiva. é possível o aparecimento de indivíduos albinos. b) autossômica dominante. os genótipos dos pais podem ser diferentes. b) em 25% da prole. c) uma planta de flores rosas com outra de flores 121 . observou-se que a síndrome não se manifesta em algumas gerações e pode ocorrer em indivíduos que aparentemente têm pais normais. Questão 550 As flores da planta maravilha podem ser vermelhas. os pais são heterozigotos. respectivamente: a) herança quantitativa e homozigotos dominantes. os pais são heterozigotos. Trata-se de um caso de _____________ e os indivíduos parentais são _______________. b) codominância e heterozigotos c) linkage e heterozigotos. b) no cruzamento II. por suscetibilidade aumentada a infecções e tendência a sangramentos. b) plantas normais homozigóticas tornam-se albinas na ausência de luz. a proporção fenotípica observada em F‚ significa exatamente que: a) 25% da prole expressam o fenótipo determinado pelo alelo dominante e 75% não o expressam. O preenchimento correto das lacunas é. existe uma síndrome caracterizada. d) no cruzamento IV. são observados dois fenótipos e três genótipos entre os descendentes. Ao fazer a genealogia de vários indivíduos. brancas ou rosas. pode-se dizer que o tipo de herança responsável por essa síndrome é a) autossômica recessiva. d) herança ligada ao sexo e homozigotos recessivos. Questão 545 Em gatos. 7 brancos e 8 pretos. uma com flores vermelhas e outra com flores brancas. Com base nessas informações. c) 75% da prole expressam o fenótipo determinado pelo alelo A e 25% não o expressam. Para se obter 50% de flores brancas. a) 25% brancas : 25% vermelhas : 50% rosas b) 25% brancas : 50% vermelhas : 25% rosas c) 100% rosas d) 50% vermelhas : 50% rosas e) 50% brancas : 25% vermelhas : 25% rosas Questão 549 Do cruzamento entre aves andaluzas de coloração azulada. podem ocorrer três genótipos diferentes entre os descendentes. d) em 50% da prole. e) 50% da prole possuem um único tipo de alelo e 50% possuem outro tipo de alelo. a característica "albinismo" não desaparece entre elas. nasceram 15 filhotes azulados. considerando que o alelo Aé dominante sobre a. d) ligada ao cromossomo X e recessiva. c) plantas albinas tornam-se verdes na presença de luz. b) uma planta de flores brancas com outra de flores rosas. enquanto as rosas são heterozigotas. Questão 548 Mendel cruzou duas variedades de 'Mirabilis jalapa'.análise da tabela permite concluir que a) no cruzamento I. o fenótipo dominante é mascarado pelo fenótipo recessivo. Isto se explica porque: a) muitas plantas verdes são heterozigóticas. o fenótipo recessivo é mascarado pelo fenótipo dominante. Embora plantas albinas morram antes de produzirem sementes. Questão 546 Em um cruzamento de um indivíduo AA com outro aa. é necessário cruzar: a) duas plantas de flores rosas.

Questão 552 Valéria gostava muito de flores.1. c) as plantas de flor rosa eram recessivas. obteve plantas que davam flores brancas. b) trata-se de um caso de co-dominância entre os genes alelos que determinam o padrão de cor. pois o cruzamento de plantas de flores brancas e vermelhas só originou flores rosas. Questão 551 A maioria das populações é composta por pessoas que manifestam perda progressiva da lactase intestinal após o desmame. estas últimas em quantidade duas vezes maior que as plantas de flor branca e vermelha. b) dominante. Observando seu jardim. b) Genes estão envolvidos na determinação dos fenótipos. e) trata-se de um caso de gene letal. e) duas plantas de flores vermelhas. Valéria promoveu uma autofecundação nas plantas de cor rosa e. Questão 554 No monoibridismo com co-dominância ou dominância intermediária. Curiosa para saber como se dava a transmissão desse caráter. d) as plantas de flor vermelha eram dominantes e as de cor branca recessivas. a lactose. (Adaptado de "Ciência Hoje". para sua surpresa. nas populações ocorrem três fenótipos relacionados à atividade da enzima: indivíduos sem atividade de lactase. 1. pesquisadores da Universidade de Toronto. o caráter tonalidade da cor das folhas e ramos é transmitido geneticamente através do citoplasma dos óvulos. Em conseqüência da falta dessa enzima. Essa distribuição é característica de um padrão de herança a) recessiva.vermelhas. a) 1 : 3 : 1 e 3 : 1 b) 1 : 2 : 1 e 1 : 2 : 1 c) 1 : 1 : 2 e 1 : 1 : 1 d) 1 : 3 : 1 e 3 : 1 : 3 e) 1 : 1 : 1 e 3 : 1 Questão 555 Em estudo publicado na revista Nature de 25 de junho passado. c) epistática. d) O fenótipo pode ser influenciado por fatores ambientais. Agosto de 1999. Questão 553 Em "Mirabilis jalapa" (maravilha). indivíduos com atividade de lactase e indivíduos com atividade parcial da lactase. as proporções genotípicas e fenotípicas observadas na segunda geração dos filhos serão. afirmam que o gene CYP2A6 está ligado à dependência das pessoas ao cigarro. codifica a síntese de uma enzima que 122 . notou a existência de plantas de uma mesma espécie que possuíam indivíduos com flores brancas.5. p. respectivamente. Valéria concluiu CORRETAMENTE que: a) trata-se de dominância da cor rosa sobre as demais. no Canadá. c) É uma herança ligada ao sexo em vegetais. verde pálido. causada pela deficiência da enzima lactase. d) co-dominante. Essa característica é autossômica e. vermelhas e rosas. d) uma planta de flores vermelhas com outra de flores brancas. e) quantitativa. variegadas (pigmentação irregular). Este gene. rosas e vermelhas. A tabela abaixo apresenta o resultado de seis possíveis cruzamentos.2 e acordo com a tabela e com seus conhecimentos. obtendo plantas que só davam flores de cor rosa. em sua forma normal. essas pessoas perdem a capacidade de digerir o açúcar do leite. 49) A alergia ao leite pode ser hereditária. Três fenótipos são observados: verde. é INCORRETO afirmar: a) A propagação vegetativa de uma planta verde deve produzir plantas verdes.

três alelos para este gene: um normal e dois defeituosos. c) epistasia recessiva. originam apenas descendentes com sementes rugosas. 123 . b) pleiotropia. em que estão relacionadas características das gerações F1 e F2. a ação do alelo normal. apesar de fumantes. jamais se tornam dependentes. pois o heterozigoto apresenta fenótipo diferente de ambos os homozigotos. enquanto que portadores de dois dos alelos defeituosos. d) dominância completa da forma normal do gene CYP2A6 sobre as formas defeituosas.metaboliza a nicotina. Por outro lado. b) os indivíduos HbA/HbS e HbS/HbS devem apresentar os mesmos níveis de hemoglobina anormal. Questão 557 Analise esta tabela. pois qualquer um dos alelos defeituosos inibe. Com base nesse esquema e em conhecimentos sobre o assunto. ainda. c) os indivíduos que produzem só hemácias anormais podem ser curados por meio de transfusão sangüínea. quando autofecundadas.2 Considerando-se as informações contidas nesta tabela e outros conhecimentos sobre o assunto. por um único par de gene. cada uma delas. que há. Com base no texto anterior. resultantes dos cruzamentos de linhagens puras de três organismos diferentes: 1. e) dominância incompleta entre a forma normal e as defeituosas do gene CYP2A6. na espécie humana. fumantes heterozigotos. c) as plantas da F2 com "sementes rugosas". Eles afirmam.5. é INCORRETO afirmar que a) os pares de genes que determinam o "tipo" e a "cor" da asa nas moscas estão localizados em cromossomas não-homólogos. é CORRETO afirmar que a) o gene HbA é dominante sobre o gene HbS. Questão 556 Observe o esquema. consumindo 20% menos cigarros que os fumantes inteiramente dependentes. portadores de um alelo normal e outro defeituoso. d) um determinado genótipo pode produzir diferentes fenótipos. d) o gene que determina "plumagem azulada" é dominante sobre os genes que determinam "plumagem preta" ou "plumagem branca".1. parcialmente. Fumantes portadores de dois alelos normais (homozigoto para o alelo normal) são altamente dependentes do cigarro.1.5. tornando as pessoas dependentes.2 1. pois o fenótipo apresenta uma continuidade entre dependentes e não dependentes. são moderadamente dependentes. b) as características "tipo de semente" e "cor de plumagem" são determinadas. é correto afirmar que a dependência ao cigarro determinada pelo gene CYP2A6 é um caso de: a) herança quantitativa.

pleiotropia e penetrância incompleta. epistasia e pleiotropia. Indivíduos homozigotos NN são normais. descendentes do cruzamento de um homem e uma mulher portadores de talassemia menor. II e III são. foram obtidas plantas com flores exclusivamente brancas. b) pai ë heterozigoto. indivíduos com genótipos IÞIÞ ou IÞi apresentam tipo sangüíneo A e os com genótipos IßIß ou Ißi apresentam tipo sangüíneo B. Indivíduos homozigotos MM apresentam a forma mais grave. b) dominância incompleta. c) 3Ž filho ë heterozigoto. d) epistasia. Questão 559 Um experimentador cruzou duas linhagens puras de uma planta denominada boca-de-leão. Herança: epistasia dominante. Tanto homens quanto mulheres C£C£ são normais. que serão anêmicos? a) 1/2 b) 1/4 c) 1/3 d) 2/3 e) 1/8 Questão 561 Considere as seguintes formas de herança: I. co-dominância e dominância incompleta. Os alelos IÞe Iß são. portanto. (04) as linhagens puras. Na planta boca-de-leão. Indivíduos homozigotos com genótipos (CßCß) apresentam flores brancas. co-dominância e expressão gênica influenciada pelo sexo. Da autofecundação das plantas da F. o último é normal. exemplos de a) dominância incompleta. uma constituída de plantas com flores brancas e outra com flores vermelhas. Herança: co-dominância. certamente. Os heterozigotos resultantes do cruzamento entre essas duas linhagens (CÑCß) apresentam flores de cor rosa. que deram origem ao experimento. Por outro lado. I. c) co-dominância. a) 2Ž filho ë homozigoto recessivo. respectivamente. Sabendo-se que todos os indivíduos com talassemia maior morrem antes da maturidade sexual. dominância incompleta e expressão gênica influenciada pelo sexo. o membro da família com seu respectivo genótipo e o padrão de herança da anemia falciforme.Questão 558 Um casal de africanos teve três filhos. qual das alternativas a seguir representa a fração de indivíduos adultos. Questão 560 A talassemia é uma doença hereditária que resulta em anemia. (02) a proporção genotípica esperada nas plantas de F‚ é: 1 planta com flores cor-de-rosa: 2 plantas brancas: 1 planta vermelha. enquanto mulheres C¢C¢ são calvas e C¢C£ são normais. apresentam uma forma mais branda chamada de talassemia menor. em conseqüência de anemia falciforme. Em humanos. Assinale a opção em que se indicam. A calvície é determinada por um alelo autossômico. (16) a F‚ esperada será constituída de 50% de indivíduos homozigotos e 50% de indivíduos heterozigotos. dominantes com relação ao alelo i. vermelhas ou cor-de-rosa. Herança: dominância completa. Assinale a(s) proposição(ões) VERDADEIRA(S). cujo genótipo (CÑCÑ) define cor vermelha nas flores. considerando que neste experimento: (01) ocorreu a segregação de três fenótipos: o branco. porém pouco suscetível a malária. d) mãe ë homozigoto dominante. 124 . II. certamente apresentam genótipos homozigotos. (08) os indivíduos de F eram. A descendência originada (F) apresentou apenas plantas com flores cor-de-rosa. heterozigotos. O primeiro morreu aos 5 anos de idade. identificada como talassemia maior e os heterozigotos MN. o genótipo IÞIß determina tipo sangüíneo AB. o segundo é normal e bastante suscetível a malária (doença endêmica na região). Homens com genótipo C¢C¢ (homozigotos) ou C¢C£ (heterozigotos) são calvos. III. corretamente. Herança: pleiotropia. o vermelho e o cor-de-rosa. e) herança poligênica. há indivíduos homozigotos.

existe uma anomalia que se caracteriza pelo encurtamento das asas. II: vários genes com interação. Ss e SS. e) autossômica recessiva .5. Ss e Ss. assinale a opção correta quanto ao tipo de herança e os genótipos dos indivíduos 1. respectivamente: 1. Ss e Ss. Questão 565 Em determinado tipo de camundongo. SS e SS. e) epistático. Questão 563 Os gráficos I e II representam a freqüência de plantas com flores de diferentes cores em uma plantação de cravos (I) e rosas (II). c) I: 1 gene com dominância incompleta. Questão 564 Em aves.ss. Quando aves anômalas heterozigóticas são cruzadas. 2. Na espécie humana há um tipo de surdez hereditária que é determinada por um par de genes.SS. 125 .5. SS. ss e ss. a) nos genótipos heterozigotos. c) autossômica dominante .Ss. e) na ligação gênica.4 a) autossômica dominante . respectivamente. ss. d) I: 3 genes com dominância incompleta. c) pleiotrópico.Ss. A partir desses dados.1. II: 1 gene com alelos múltiplos. No heredograma a seguir. Ss. originam uma descendência com indivíduos anômalos e normais numa proporção de 2 :1.1. d) autossômica recessiva . b) nos genótipos homozigotos. Para os filhotes vivos de um cruzamento de um casal de heterozigotos. II: 2 genes com dominância incompleta. a pelagem branca é condicionada pela presença do gene "A". d) nos genótipos recessivos.2 Os padrões de distribuição fenotípica são devidos a: a) I: 1 gene com dominância. b) letal recessivo.Questão 562 Em genética. c) nos genótipos dominantes. d) hipostático. a dominância parcial e a codominância entre alelos definem-se. II: vários genes com interação.SS. esperam-se as seguintes proporções de camundongos de pelagem branca e preta. as pessoas surdas estão representadas por símbolos hachurados: Com base nessa afirmação. b) I: 1 gene com dominância incompleta. ss. 3 e 4. letal em homozigose. e) I: 2 genes com interação. ss. b) autossômica dominante . respectivamente: a) 1/2 e 1/2 b) 1/4 e 3/4 c) 2/3 e 1/3 d) 3/4 e 1/4 Questão 566 1. é possível deduzir que o alelo que condiciona a anomalia é a) letal em homozigose. Seu alelo recessivo "a" condiciona pelagem preta. de forma mais precisa. II: 1 gene com dominância incompleta.

II. não conseguem metabolizar a fenilalanina e. podemos afirmar que os indivíduos heterozigotos são: a) 1. respectivamente.Questão 567 A fenilcetonúria (PKU) é uma doença de origem genética bastante conhecida.5.4 1.5.4 obre as informações contidas no heredograma. 6.1. 2. 5. Questão 568 Analise o heredograma a seguir. Caso a anomalia seja condicionada por um alelo recessivo ligado ao cromossomo X. b) VI possui dois alelos mutados. (I) e (II). 4 b) 1. epilepsia. hipopigmentação. (III) e (IV). entre outras. 2. 8 d) 4. assim. c) V é necessariamente homozigoto. d) III possui apenas um alelo mutado. os quadrados cheios representam meninos afetados por uma doença genética. as probabilidades de o pai (A) e de a mãe (B) do menino (C) serem portadores desse alelo são. Se a doença for condicionada por um par de alelos recessivos localizados em cromossomos autossômicos. respectivamente. 7 e) 3. 3. Assinale a alternativa que mostra as porcentagens que preenchem corretamente os espaços I. III e IV.5.4 126 . 5 c) 1. quanto à presença de alelos mutantes de fenilalanina hidroxilase nos membros da família marcados com algarismos romanos. e) I é necessariamente homozigoto. 2. 4. odemos dizer. apresentam uma série de complicações como retardo mental. onde os indivíduos masculinos são representados por quadrados e os femininos por círculos.1. 5. 1. num segmento sem homologia com o cromossomo Y. além de não sintetizarem catecolaminas corretamente. causada por uma deficiência da enzima fenilalanina hidroxilase. que: a) VIII pode ter um alelo mutado. Considere o heredograma a seguir de uma família com membros acometidos (símbolos cheios) e normais (símbolos vazados). 1.1. 6. 9 Questão 569 No heredograma. as probabilidades de o pai e de a mãe serem portadores desse alelo são. Pacientes acometidos desse mal.

localizado em autossomo.4 1. Os símbolos escuros indicam os portadores de uma anomalia hereditária. b) autossômica recessiva. localizado no cromossomo y. 1.4 nalisando-se a genealogia. localizado no cromossomo y.5.1. e) localizado no cromossomo Y. pode-se concluir que a característica em questão é condicionada por gene a) dominante. Questão 571 No heredograma a seguir.1. c) ligada ao x dominante. localizado no cromossomo x.4 om base na análise do heredograma.5. localizado no cromossomo X. Questão 572 O tipo de herança genética apresentada pelos indivíduos afetados é: a) autossômica dominante. b) dominante.4 1. localizado em um autossomo.5. c) dominante. e) recessivo. d) ligada ao x recessiva. e) ligada ao y.1.Questão 570 O esquema a seguir representa indivíduos de três gerações de uma família.1. localizado em autossomo. d) recessivo. conclui-se que a anomalia é determinada por gene a) dominante. quadrados representam homens e símbolos preenchidos representam indivíduos portadores de certa característica. Questão 573 Se os indivíduos 7 e 11 se casarem. Questão 574 127 . localizado em um autossomo.5. círculos representam mulheres. localizado no cromossomo X. b) recessivo. d) recessivo. a probabilidade desse casal ter uma filha com o mesmo fenótipo do avô materno é de: a) 1/2 b) 1/4 c) 1/8 d) 1/3 e) 2/3 1. c) dominante.

d) O caráter em estudo pode ser ligado ao sexo.5. na qual a freqüência de indivíduos afetados é de 1%. d) 0 e 25%.1. os indivíduos 3 e 5 são afetados por uma anomalia genética recessiva. Questão 575 Analise o seguinte heredograma de uma característica transmitida geneticamente: om base nessa análise.4 No heredograma acima.1. de: a) 100% e 50%. 128 .4 1. respectivamente. é correto afirmar.1.5.4 Considerando-se que a família acima representada faz parte de uma população em equilíbrio de Hardy-Weimberg. d) É do tipo recessiva ligada ao sexo porque todo progenitor masculino afetado transmite a característica para suas filhas. indique a opção que apresenta a afirmativa correta sobre a herança da característica referida no heredograma. se os indivíduos marcados são afetados por uma característica genética. EXCETO: a) A segunda geração pode ser composta apenas por indivíduos homozigotos. 1.1. a) É do tipo recessiva autossômica porque o genótipo pode estar presente na prole de ambos os sexos sem estar presente nos pais. b) 0 e 75%. b) É do tipo dominante autossômica porque o genótipo pode estar presente na prole de ambos os sexos sem estar presente nos pais. c) A probabilidade de o indivíduo 7 ser heterozigoto é de 18%.5. e) 100% e 75%. as probabilidades dos casais 7×8 e 9×10 terem crianças normais são. b) O indivíduo 8 apresenta o mesmo fenótipo e o mesmo genótipo do avô para o caráter em questão. e) É do tipo dominante ligada ao sexo porque todos os filhos homens herdam a característica da mãe. c) É do tipo recessiva autossômica porque o número de indivíduos afetados é menor do que o de não afetados. c) 50% e 50%. Questão 576 No heredograma adiante.

5. as figuras 6. b) Apenas I. os eventuais filhos nascerão afetados. xamine as afirmações: I . b) o lóbulo da orelha livre. 10 e 12 representam indivíduos que.5. com uma progressiva perda do controle motor e problemas psiquiátricos como demência e distúrbios afetivos. os indivíduos afetados por DH estão indicados em negro. c) Apenas II e III. São corretas as afirmações: a) I. d) Apenas II. IV . causada por um gene recessivo ligado ao sexo. II . desenvolveram a mesma doença hereditária: 1. e os indicados em branco não a apresentam. 1.1. na fase adulta.Questão 577 No heredograma. com certeza.5. II e III. III e IV. é correto concluir que tal característica é a) a calvície.Se houver casamento consangüíneo entre 9 e 11. II. e) a incapacidade de enrolar a língua. Questão 579 A Doença de Huntington (DH) é uma anomalia autossômica com caráter dominante cuja manifestação ocorre na fase adulta. No heredograma a seguir.As pessoas 1 e 2 são heterozigotas.A mulher representada pelo número 5 tem possibilidade de ser homozigota. c) a hemofilia.4 129 . III e IV. causada por um gene restrito ao sexo. III . e) Apenas uma das afirmações.1. causada por um gene autossômico influenciado pelo sexo.É uma doença de caráter dominante autossômica. causada por um gene autossômico dominante. causada por um gene autossômico recessivo.4 onsiderando que os indivíduos indicados em preto são afetados por uma característica genética.1. d) a hipertricose. Questão 578 Responder à questão com base no heredograma a seguir.4 1.

2.F . 3. Já as pessoas indicadas pelos números 3 e 6 têm fenótipo normal.5. 5 e 7 apresentam uma anomalia condicionada por gene autossômico dominante.V . 1.F .V . onde foi estudado o caráter BRAQUIDACTILIA (dedos curtos). pode-se afirmar que o indivíduo 6: a) é braquidáctilo e homozigoto. é a) F . ( ) Os indivíduos III-1.V .s afirmativas abaixo referem-se aos possíveis genótipos dos indivíduos indicados no heredograma. 4 e 7 são braquidáctilos.5. c) tem dedos normais e é homozigoto.4 1. enquanto os indivíduos 5 e 8 apresentam dedos normais.F .V b) F .V e) V . 4. I-2. Assinale.1. 2.4 essa família. que é determinado por um par de genes: 130 . III-2.F c) V . III-3 e III-4 são homozigotos. ( ) Os indivíduos II-2 e II-4 são heterozigotos.F d) V . nos parênteses. Questão 582 Na genealogia a seguir.V .F . os indivíduos 1. d) tem dedos normais e é heterozigoto. V para as verdadeiras e F para as falsas. II-1 e II-3 são homozigotos.1.V Questão 580 Qual dos heredogramas a seguir ilustra uma condição biologicamente IMPOSSÍVEL? 1.4 Questão 581 Analise a genealogia a seguir. A seqüência correta de preenchimento dos parênteses. ( ) Os indivíduos II-1 e II-3 são heterozigotos. ( ) Os indivíduos I-1.V . de cima para baixo. b) é braquidáctilo e heterozigoto. Considerando essas informações e desprezando a possibilidade de ocorrência de mutação.1.F . as pessoas indicadas pelos números 1. e) pode ser ou não braquidáctilo e é homozigoto.5.

Os símbolos escuros representam indivíduos que exibem a característica recessiva. 1.1.5. 1. c) a pessoa indicada pelo número 3 transmitiu o gene recessivo para seu descendente indicado pelo número 7. e) o casal indicado pelos números 6 e 7 não poderá ter descendentes com fenótipo normal.5. relativa a essa característica.1. Observe a genealogia a seguir.Após a análise da genealogia.5.4 probabilidade do casal 3×4 ter o primeiro filho homem e que venha a ser calvo. b) a pessoa indicada pelo número 4 é homozigótica.4 No heredograma abaixo. os símbolos escuros representam indivíduos que possuem uma anomalia. Questão 583 A calvície é uma característica influenciada pelo sexo e o gene que a condiciona se comporta como recessivo no sexo feminino e dominante no sexo masculino.1. 131 . d) não há possibilidade de a pessoa indicada pelo número 5 ser heterozigótica. pode-se concluir que: a) apenas as pessoas indicadas pelos números 1 e 2 são heterozigóticas. é: a) 1/2 b) 1/4 c) 1/8 d) 1/6 Questão 584 O heredograma a seguir representa a herança de um par de genes entre os quais há dominância.4 esse heredograma NÃO se pode determinar o genótipo do indivíduo a) 1 b) 3 c) 5 d) 6 e) 7 Questão 585 1.

e) todos os indivíduos normais são homozigotos dominantes ou heterozigotos. uma doença causada por um alelo recessivo autossômico. 1/4 e) 1/2. O único indivíduo que não pode ter o seu genótipo definido é o I-4. a criança II-1 tem fibrose cística. 1/2 c) 1/4.5.4 Questão 587 O heredograma mostra a incidência de uma anomalia genética em grupo familiar. É correto o que se afirma APENAS em a) I b) II c) III d) I e II e) II e III Questão 586 No heredograma adiante. II.onsidere as seguintes afirmativas sobre esse heredograma: I. Todos os indivíduos que apresentam a anomalia são homozigóticos. podemos afirmar: a) todos os indivíduos normais são homozigotos recessivos. III. 132 . b) a anomalia é condicionada por um gene recessivo.1. As probabilidades de que sua irmã (II-2) não afetada seja carreadora ou não carreadora da fibrose cística são.1.5. a linhagem pôde ser reestabelecida por meio do acasalamento descrito a seguir: 1.4 1. c) a anomalia ocorre apenas em homozigotos dominantes. 2/2 1. 1/4 b) 1/4. Após uma infecção em que apenas uma fêmea nocaute sobreviveu. A anomalia é condicionada por um alelo dominante. Questão 588 Foi estabelecida uma linhagem de camundongos nocaute esses animais se caracterizam por não expressar um determinado gene.4 pós a análise deste heredograma. 1/4 d) 1/2.1.5. d) todos os indivíduos normais são homozigotos dominantes. respectivamente: a) zero.

75% do filhotes nascerão normais.3 tem filha normal. é correto afirmar-se que a) a herança para esse tipo de característica é recessiva e ligada ao sexo. por isso é improvável uma herança dominante ligada ao X. pós analisar esse heredograma.ode-se afirmar que: a) Por meio do acasalamento do macho 3 com a fêmea nocaute. se a herança fosse recessiva ligada ao X. portanto a herança não deve ser autossômica dominante.4 Com relação ao heredograma. d) Os filhos homens de I. b) O indivíduo II. b) a ocorrência da característica nessa família se deve aos casamentos consangüíneos.5. 50% dos filhotes são animais com o genótipo heterozigoto. c) A herança pode representar uma família de hemofílicos.1. c) a probabilidade de mulheres descendentes de IV-1 serem afetadas é zero.2 não possui pais afetados. Questão 589 Analise o heredograma que representa a herança de um tipo de disfunção dos músculos esquelético e cardíaco em seres humanos.1. b) A herança pode ser ligada ao sexo. é autossômica recessiva. na família representada.1. c) O indivíduo III. e) II-2. II-5 e III-1 podem ser homozigotos dominantes. Questão 590 Analise o heredograma. Questão 591 1. EXCETO a) O indivíduo I. todas as alternativas são possíveis.4 Observe este heredograma: 1.5. 1. d) O cruzamento do macho 2 com uma das fêmeas de F originará camundongos dos quais 75% serão heterozigotos.2 seriam normais. uma estudante concluiu que a característica transmitida. se a herança fosse ligada ao Y. c) O acasalamento do macho 3 com a fêmea 5 produzirá maior número de camundongos nocaute do que o acasalamento desse macho com a fêmea 4. b) Em F‚. Para chegar a tal conclusão. 133 . e) o casamento de III-4 com indivíduo de fenótipo igual a II-4 tem como resultado esperado 100% de mulheres afetadas.5 também seria afetado. d) as mulheres afetadas apresentam fenótipos idênticos aos de suas mães. essa estudante considerou todas as seguintes hipóteses. EXCETO a) A herança pode ser autossômica.5. d) I-1 e I-2 podem ser heterozigotos. e) A herança do caráter nocaute é autossômica dominante.4 m relação à característica representada no heredograma.

1. típica daquelas não vinculadas aos cromossomos X e Y. não sentir qualquer sabor.como um gosto amargo ou.1. mesmo. é representado abaixo.5.2 ser heterozigoto é de dois terços.1 x II. é INCORRETO afirmar que a) o alelo para a capacidade de sentir o gosto do PTC é dominante. b) o loco do gene em estudo está situado em um cromossomo autossômico.4 Um geneticista estabeleceu o heredograma para uma determinada doença hereditária. são homozigotos. de pai para filha e mãe para filha.1.4 . Questão 594 1. a) 0 b) 1/4 c) 3/4 134 1.2 será normal. Questão 595 Renata (III. ( ) o modelo de herança autossômica recessiva. ( ) um modelo de herança idêntico ao da cegueira para cores. ( ) um modelo de herança idêntico ao do albinismo. mostrando-os indivíduos afetados. c) o risco de III.3 nascer incapaz de sentir o gosto do PTC é de 50%. em todas as gerações.1 e II. b) a ocorrência do tumor é uma característica autossômica. conhecida como daltonismo.1). que representa uma família em que há indivíduos afetados por um tipo de tumor de gengiva: 1.5. cuja avó materna e avô paterno eram albinos. Observe este heredograma para a capacidade de sentir o gosto dessa substância: onsiderando-se as informações desse heredograma e outros conhecimentos sobre o assunto. d) a probabilidade de o indivíduo III. é INCORRETO afirmar que a) os indivíduos normais. Assinale a alternativa que responde ao questionamento de Renata.PTC . om base nesse heredograma e em outros conhecimentos sobre o assunto.4 Esse diagrama representa: ( ) o modelo de herança recessiva ligada ao cromossomo X.5. preocupada com a possibilidade de transmitir o alelo para o albinismo a seus filhos. cujo diagrama. c) o próximo filho do casal II.1 são heterozigotos. ( ) a característica passada de geração a geração. Questão 593 Analise este heredograma. d) os indivíduos I.Questão 592 As pessoas podem detectar a substância química feniltiocarbamida . deseja saber qual a probabilidade de ela não ser portadora deste alelo.

e) Apenas os indivíduos I:1 e I:2 são homozigotos. a) Os indivíduos II-3 e II-4 são homozigotos. Questão 597 Considerando o heredograma abaixo.5. (64) Trata-se de Herança Holândrica.4 Questão 598 Na genealogia a seguir. b) O fenótipo anormal é recessivo.1.d) 1/3 e) 1 1.4 Analisando essa genealogia. Analise-o e assinale a alternativa correta. b) Todos os indivíduos não afetados são heterozigotos.5.4 Questão 596 O heredograma adiante representa a herança de um fenótipo anormal na espécie humana. d) Apenas os indivíduos I:1.5.4 1.1. onde os indivíduos afetados pela síndrome unha-rótula (deformação nas unhas e nas rótulas) aparecem em preto. (01) A anomalia é causada por gene provavelmente recessivo. é correto afirmar: a) Todos os indivíduos afetados são homozigotos. c) Apenas o indivíduo I:1 é heterozigoto. pois os indivíduos II-3 e II-4 tiveram crianças anormais. c) Os indivíduos III-1 e III-2 são heterozigotos.5. II:1 e II:5 são heterozigotos. (32) Trata-se de Herança Intermediária.1. pois a característica é dominante. 135 . os indivíduos assinalados com preto apresentam uma anomalia determinada por um gene dominante. (08) Trata-se de gene localizado no cromossomo Y. d) Todos os indivíduos afetados são heterozigotos. e) Os indivíduos I-1 e I-4 são homozigotos. (02) A anomalia é causada por gene provavelmente dominante.1. pois são afetados pelo fenótipo anormal. (04) Trata-se de gene localizado no cromossomo X. (16) Trata-se de gene autossômico. é correto afirmar: 1. pois dão origem a indivíduos anormais. Soma ( ) 1.

3 não tem nenhuma relação genética com I . portanto está ligada ao cromossomo X.2.3 não o são. (04) III .1 é mais jovem do que II . Essa doença é herdada como autossômica recessiva. Com base na análise da mesma.4 têm 50% de probabilidade de terem um descendente portador da doença. (32) A doença só se manifesta nas mulheres.2.2 e II . Os círculos representam as mulheres e os quadrados. enquanto II .Questão 599 A figura a seguir apresenta uma genealogia hipotética. c) Apenas II .1 e I . assinale a(s) proposição(ões) CORRETA(S). um homem e uma mulher.1 e II . Questão 602 Os heredogramas a seguir apresentam o padrão de herança de um mesmo caráter em cinco diferentes famílias. identificadas por 1. Questão 600 Na genealogia a seguir. (32) II .1.1.5. os indivíduos que manifestam uma determinada doença hereditária são mostrados em preto.5.2. (04) Os indivíduos I . (02) Os indivíduos I . por exemplo. b) Apenas II . d) II .4 representam. III .1 e III .3 podem ser homozigotos.5.1.3.1 e III .3% de possibilidade de nascer um descendente com a doença.2.1. (08) III .4 A anemia falciforme é causada pela presença de uma hemoglobina anormal. (02) O padrão da herança desta doença é autossômico dominante. 1. respectivamente.2 e I . 2. (64) Com exceção de II .4 (01) Na genealogia estão representadas 2 gerações.1 é neto(a) de I .2 é sobrinho(a) de II . (16) II . os homens. Os símbolos cheios indicam que o indivíduo é portador do caráter.4 136 . e) II .3 e II .5. II .4. II .3.3.3 e II .3 e III .4.1 e I .2. são indivíduos afetados pela característica que está sendo estudada. (16) III . os demais indivíduos da segunda geração são irmãos. quem poderá ser afetado pela doença? a) Apenas III .5. apresentado na genealogia. 1. existe 33. Questão 601 Com relação a essa figura é CORRETO afirmar que: (01) Os indivíduos II .1. 4 e 5. Considerando o heredograma apresentado inicialmente os indivíduos I .2.1 e III . 1. (08) Do casamento consangüíneo.1.1 e II .4 forem homozigotos normais. II .3 e III . II .3 forem heterozigotos e os indivíduos I . 3.

e os claros os indivíduos de visão normal. O diagrama representa o padrão de herança de uma doença genética que afeta uma determinada espécie de animal silvestre.4 A probabilidade do casal I x II ter uma criança míope é a) imprevisível. Questão 603 O esquema mostra a genealogia de uma família. b) A família 2 permite concluir que se trata de um caráter autossômico recessivo. c) 1/2. Trata-se de uma doença autossômica recessiva. apenas. d) 1/4.4 . e) 1/4. apenas.1. a) A família l permite concluir que se trata de um caráter dominante ligado ao cromossomo X. É verdadeiro o que se afirma em a) I. porque 50% dos gametas da mulher transportam o gene recessivo.1. b) II e III. apenas. porque a mulher tanto pode ser homozigota como heterozigota. porque o gene para a miopia é recessivo. ligado ao cromossomo Y.5. O indivíduo III-1 só deve ser cruzado com o indivíduo II-5. analise os heredogramas e assinale a alternativa correta. observado a partir de cruzamentos controlados realizados em cativeiro. Não há nenhuma possibilidade de que um filhote nascido do cruzamento entre os indivíduos II-5 e II-6 apresente a doença.5. e) A família 5 mostra que o caráter não pode ser controlado por gene ligado ao cromossomo X.4 A partir da análise da ocorrência da doença entre os indivíduos nascidos dos diferentes cruzamentos. IV. b) nula. d) A família 4 permite concluir que se trata de um caráter recessivo. d) I e IV. Os símbolos escuros representam os indivíduos míopes.1. porque a mulher tem o gene dominante em homozigose. foram feitas as afirmações seguintes. c) I. e) III e IV. Questão 604 upondo que não haja mutação. uma vez que são nulas as possibilidades de que desse cruzamento resulte um filhote que apresente a doença. II.1. 137 1. c) A família 3 permite concluir que se trata de um caráter recessivo. ligado ao cromossomo X. apenas. porque o casal já tem três filhos com visão normal. III. apenas. Os indivíduos I-1 e I-3 são obrigatoriamente homozigotos dominantes. II e III. 1. I.5.

e) O genótipo dos indivíduos IV.5. os principais critérios para a identificação de um gene recessivo autossômico são aqueles em que o número de: a) homens afetados é diferente do número de mulheres afetadas.5 possuem o genótipo AA.1. cerca de 75% da prole de pais portadores do gene deve apresentar a característica e) homens afetados é maior do que o de mulheres afetadas. d) Os pais dos aquirópodos são primos. a característica deve aparecer em todas as gerações. Os pulmões das pessoas afetadas apresentam um muco espesso que promove infecções bacterianas.2 e IV. a característica deixa de aparecer em várias gerações.II.5. c) Não é possível ter certeza sobre o genótipo de alguns indivíduos.1 e II.1.Questão 605 Na espécie humana há um tipo de doença hereditária muito rara denominada Aquiropodia.4 é aa. cerca de 25% da prole de pais portadores do gene deve apresentar a característica d) homens e mulheres afetados é aproximadamente igual. Questão 606 A mucoviscidose é uma doença genética grave que associa problemas digestivos e respiratórios.4 1. como é o caso dos indivíduos II. Tal doença deve-se à presença de uma enzima defeituosa que não metaboliza 138 om base na análise do heredograma. assinale a afirmativa INCORRETA. No heredograma a seguir. o indivíduo afetado tem pelo menos um pai afetado b) homens e mulheres afetados é aproximadamente igual. a) Pode-se dizer que a Aquiropodia é condicionada por um alelo recessivo a. os indivíduos afetados têm geralmente pais normais.4 ual a probabilidade de o casal II. b) Pode-se assumir que os indivíduos II. o indivíduo afetado tem pais afetados Questão 608 O popular "Teste-do-pezinho" feito em recém-nascidos pode detectar a doença fenilcetonúria. .5. que representa a árvore genealógica de uma família onde alguns indivíduos são afetados pela doença.1 .3 e III. que é determinada por um par de genes. 1. os indivíduos afetados têm geralmente pais normais. a característica deve aparecer em todas as gerações. já que a condição herdada em análise é muito rara. os aquirópodos estão representados por símbolos hachurados. Observe e analise o esquema a seguir.2 vir a ter uma criança com mucoviscidose? a) 1/8 b) 1/4 c) 1/3 d) 1/2 e) 2/3 Questão 607 Para analisar heredogramas de famílias de seres humanos. o indivíduo afetado tem pelo menos um pai afetado c) homens e mulheres afetados é aproximadamente igual.

tem uma filha também polidáctila e um filho normal.corretamente o aminoácido fenilalanina. Sabendo-se que a determinação do caráter se deve apenas a um par de genes autossômicos.5. d) 2/5. b) 120.25% d) B e 8. os indivíduos que apresentam fenilcetonúria estão em negro. A probabilidade de o casal vir a ter uma filha normal é de: a) 1/4 b) 1/6 c) 1/8 139 . d) 40. b) 3/9. qual o número esperado de casamentos com risco de gerar crianças fenilcetonúricas? a) 2. c) 180. Supondo que todas sofram metamorfose. será: a) 0% b) 25% c) 50% d) 75% e) 100% 1. d) 360. c) 16. b) 8. Um indivíduo de F1 é retrocruzado com a fêmea parental e se obtém 480 larvas. Questão 610 Um casal. e) 240. a) 2/3. Em certa comunidade européia.25% e) C e 75% d) 1/12 e) 2/3 Questão 611 Em drosófilas. Esse casal tem __________ de probabilidade de ter um descendente do sexo masculino e portador da disfunção genética mencionada. em que ambos são polidáctilos. Questão 612 Estudos genéticos permitiram verificar que um casal tem 1/4 de probabilidade de ter um descendente com uma determinada anomalia. Questão 613 Sabe-se que o albinismo é determinado pela ação de um gene recessivo autossômico. Em 800 casamentos ocorridos entre membros sadios dessa comunidade. podemos afirmar com certeza que a probabilidade de um novo filho vir a ser albino (sem considerar o sexo). c) 1/8. Sabendo-se que o avô paterno e a avó materna das crianças eram albinos. Um macho puro de asa longa é cruzado com uma fêmea de asa curta. uma em cada 20 pessoas com fenótipo normal é heterozigótica quanto ao gene que determina a fenilcetonúria. Considere um casal normal que teve 6 crianças todas normais. a) C e 50% b) C e 25% c) B e 6. Na genealogia a seguir.1.4 Questão 609 A fenilcetonúria é uma doença com herança autossômica recessiva. o número esperado de indivíduos de asa curta é de: a) 480. e) 80. e) 1/25. o caráter asa vestigial é recessivo em relação ao caráter asa longa. determine o cruzamento que permite diagnosticar a recessividade do gene que condiciona a fenilcetonúria e a probabilidade de nascer uma menina afetada a partir do cruzamento 12 X 18. cuja ingestão provoca retardamento mental.

Questão 615 A anemia falciforme é uma doença hemolítica grave cujas manifestações clínicas incluem anemia. Um casal decide ter um filho. Desses. e é causada por um alelo recessivo por herança Mendeliana simples. Um homem canhoto e sensível ao PTC. Essa doença manifesta-se tardiamente como representado no gráfico a seguir: Questão 616 Fenilcetonúria é uma doença hereditária humana resultante da inabilidade do organismo de processar o aminoácido fenilalanina. cuja mãe era canhota e insensível. no Rio Grande do Sul. no teste do pezinho. Do cruzamento entre plantas heterozigóticas para os dois caracteres resultaram 320 descendentes. A sensibilidade à feniltiocarbamida (PTC) é condicionada pelo gene dominante I. já que cada um dos cônjuges tem um irmão com anemia falciforme.1. d) 75%. a detecção de portadores de anemia falciforme está sendo incluída. b) 25%. e a mulher tem um irmão com esta mesma doença. podendo ser fatal se não tratada no início da infância. O seu padrão de herança é autossômico recessivo. c) 160. flores vermelhas são condicionadas por um gene dominante e flores brancas por seu alelo recessivo. obstrução vascular e infartos dolorosos em vários órgãos como os ossos. Esses dois pares de alelos apresentam segregação independente.5. A probabilidade de sua primeira criança ter fenilcetonúria é de: a) 1/2. antes de realizar qualquer exame. b) 60. c) 50%. folhas longas são condicionadas por um gene dominante e folhas curtas por seu alelo recessivo. e a insensibilidade a essa substância é devida a seu alelo recessivo i . que está presente nas proteínas da dieta humana. a chance de a criança vir a manifestar a doença corresponde a a) 0 %. b) 1/4. Esses dois pares de alelos localizam-se em cromossomos diferentes. Um casal normal que pretende ter um filho consulta um geneticista. sensível. o baço e os pulmões. d) 2/3. espera-se que o número de plantas com flores vermelhas e folhas curtas seja a) 20. 140 1. Se você fosse o geneticista. Questão 618 Na espécie humana. qual a resposta correta que daria à pergunta sobre a probabilidade de nascimento de uma criança com este tipo de anemia? a) 1/2 b) 1/4 c) 1/8 d) 1/9 e) 1/16 . a habilidade para o uso da mão direita é condicionada pelo gene dominante E . mas consulta um geneticista porque o homem tem uma irmã com fenilcetonúria. sendo a habilidade para o uso da mão esquerda devida a seu alelo recessivo e . e) 100%. icterícia.Questão 614 Admita que uma determinada doença neurodegenerativa que provoca convulsões e leve à morte em pouco mais de 10 meses seja determinada por um gene dominante. casa-se com uma mulher destra. Questão 617 Em determinada planta. d) 180. cujo pai era insensível. e) 4/9.5 e um casal com 35 anos tiver um filho. c) 1/9. Não há outros casos conhecidos nas famílias. Devido a sua importância. e) 320.

verdes-lisas = 150. AaCC. verdes-rugosas=50. Cruzando-se plantas CCHH com plantas CcHh. uma com sementes amarelas e lisas (VvRr) e outra com sementes amarelas e rugosas (Vvrr). verdes-lisas = 300. AaCc. d) amarelas-lisas = 300.A probabilidade de esse casal vir a ter uma criança canhota e sensível ao PTC é de a) 3/4.5% d) 25% e) 12. c) 1/4. aacc. Questão 623 Observe o heredograma a seguir: 1. O gene que determina plantas de altura normal (H) é dominante sobre o gene que determina plantas anãs (h). b) 3/8. o gene que determina a forma lisa da vagem (C) é dominante sobre o gene que determina vagens com constrições (c). espera-se obter na descendência: a) 50% de plantas anãs com vagens lisas e 50% de plantas de altura normal com vagens com constrições. amarelas-rugosas = 320. AaCc. cuja mãe é albina. verdes-lisas = 200. e) 1/8. amarelas-rugosas = 100. Aacc. c) 100% de plantas de altura normal com vagens com constrições. e) 100% de plantas de altura normal com vagens lisas. d) aaCC. verdes-rugosas = 80. nasce uma criança albina e de olhos claros. e) amarelas-lisas = 450. b) Aacc. verdes-rugosas = 200.2. verdes-lisas = 320. amarelas-rugosas = 300. AACC. amarelas-rugosas = 200. c) AaCC.5% Questão 620 O cruzamento entre duas linhagens de ervilhas. AaCc.1 141 . Deste casal. verdes-lisas = 100. Questão 619 Do casamento entre uma mulher albina com cabelos crespos e um homem normal com cabelos crespos. b) 100% de plantas anãs com vagens com constrições. originou 800 indivíduos. aacc. Questão 621 Em ervilha. e) aacc. Qual o genótipo dos pais da criança? a) aacc. verdes-rugosas=100. c) amarelas-lisas = 200. d) 100% de plantas anãs com vagens lisas. d) 3/16. uma com cabelos crespos e outra com cabelos lisos. aacc.5. Quantos indivíduos devem ser esperados para cada um dos fenótipos obtidos? a) amarelas-lisas = 80. AaCc. Questão 622 Um homem albino e de olhos claros casa-se com uma mulher de pele normal e de olhos escuros. nasceram duas crianças. amarelas-rugosas = 150. verdes-rugosas = 300. A probabilidade de que uma terceira criança seja albina com cabelos crespos é: a) 75% b) 50% c) 37. b) amarelas-lisas = 100.

b) se somente as afirmativas I e III forem corretas.1 A probabilidade do casal 4 x 5 ter uma criança diíbrida é: a) 1/8 b) 3/16 c) 1/16 d) 1/4 e) 1/2 Questão 625 Um casal. Considerando-se que ambas as anomalias são autossômicas e os respectivos genes estão em cromossomos .Os indivíduos 2 e 4 têm o mesmo genótipo. com um homem normal para fenilcetonúria e míope. a probabilidade do casal ter outra criança normal para as duas características é: a) 1 b) 1/16 c) 3/16 d) 9/16 e) 0 Questão 626 A fenilcetonúria e a miopia são doenças decorrentes da ação de genes autossômicos recessivos. e) se somente a afirmativa II for correta. considere as seguintes afirmações: I . diíbrida.5% e) 25% Questão 628 Qual é a probabilidade de um casal de duplo heterozigotos para dois pares de genes autossômicos com segregação independente vir a ter um descendente com apenas uma característica dominante? a) 15/16 b) 9/16 c) 6/16 d) 3/16 142 1. Questão 624 Sabendo-se que a miopia e o uso da mão esquerda são condicionados por genes recessivos. nasceu uma criança de visão normal e fenilcetonúrica. os genes que determinam sementes lisas e amarelas são dominantes em relação aos genes que determinam sementes rugosas e verdes.Se o indivíduo 3 se casar com um homem de visão normal (heterozigoto) e canhoto. a) zero b) 75% c) 50% d) 12. assinale a alternativa que apresenta a porcentagem de gametas produzidos por essa planta com pelo menos um gene dominante. A probabilidade desse casal ter uma criança normal para as duas características é: a) 1/8 b) 1/2 c) 3/8 d) 7/8 e) 3/4 Questão 627 Em ervilhas. d) se somente as afirmativas I e II forem corretas. então. analise a genealogia a seguir e responda.5. tem uma criança normal para polidactilia. Do casamento entre uma mulher normal. Assinale: a) se todas as afirmativas forem corretas. Considerando uma planta de sementes lisas e amarelas.O indivíduo 5 é heterozigoto para o gene do uso da mão esquerda e o indivíduo 6 é heterozigoto para o gene da miopia. II . diferentes.2. III . ambos polidáctilos (com mais de 5 dedos) e de visão normal. c) se somente as afirmativas II e III forem corretas.Sabendo-se que a miopia e o uso da mão esquerda são condicionados por genes recessivos. filha de mãe com fenilcetonúria e pai míope. mas míope. terão 25% de chance de ter uma filha canhota e de visão normal.

IV . II .(mmbb).(mmBb). Qual é a probabilidade de um casal DdEE × ddEe vir a ter uma criança com surdez? a) 0% b) 25% c) 50% d) 75% e) 100% Questão 631 As flores de uma determinada planta podem ser vermelhas ou amarelas. III . a) I .(mmbb). manchas brancas em qualquer cor de pelagem. III . flores amarelas.(mmbb) b) I .(MmBb). Os indivíduos homozigotos dd ou ee são surdos. um gene D e um E. II .e) 1/16 Questão 629 Considere que em cavalos a coloração do pêlo resulta da ação de dois pares de genes autossômicos localizados em cromossomos não homólogos. IV .(Mmbb) c) I . Dois pares de genes (Vv e Aa) determinam essa característica: plantas V_A_ produzem flores vermelhas e plantas V_aa. a seguir. sendo um dominante e outro recessivo. Como resultado.(MmBb) Questão 630 Considere que a surdez no homem esteja relacionada a dois pares de genes (Dd .(Mmbb).(mmbb). a alternativa que contém os genótipos dos indivíduos mencionados. II . IV . cuja mãe era preta uniforme (IV). Cruzando dois indivíduos homozigotos. Na descendência do cruzamento VvAa x VvAa espera-se encontrar uma proporção fenotípica de a) 1 vermelha: 1 amarela b) 9 amarelas: 7 vermelhas c) 9 vermelhas: 7 amarelas d) 15 amarelas: 1 vermelha e) 15 vermelhas: 1 amarela Questão 632 O esquema abaixo representa o núcleo de uma célula de um organismo com 2n=4 cromossomos. O gene M condiciona cor preta e seu alelo m. cor marrom.(MMbb).Ee) localizados em cromossomos não homólogos.(mmBb). é cruzado com uma fêmea marrom com manchas brancas (III).(mmBb). Assinale. vvA_ ou vvaa. determinados por genes que se segregavam independentemente. IV . II . obteve quatro tipos de fenótipos. na proporção de 9:3:3:1.2.(mmBb).(mmBb) e) I . os indivíduos com audição normal possuem. Os alelos de cinco genes estão indicados por letras.(MmBb). III . ele obteve a primeira linhagem.(mmBb). o gene B determina coloração uniforme e seu alelo b. III . pelo menos. II . na qual promoveu autofecundação. cujo pai era marrom uniforme (II).(Mmbb).(Mmbb).1 os pares de alelos abaixo aplica-se a segunda lei de Mendel SOMENTE a a) Aa e Mm b) Aa e Dd c) Aa e Nn d) Bb e Nn e) Dd e Mm Questão 633 Um pesquisador averiguava a transmissão de caracteres em vegetais ao longo de gerações.5. Um macho preto com manchas brancas (I). IV . III . Quantos caracteres esse pesquisador estudava? a) 1 b) 2 c) 3 d) 4 e) 5 Questão 634 Assinale a alternativa que indica os genótipos dos pais que têm ou poderão ter filhos nas seguintes proporções ou percentuais: 143 . 1.(MmBb) d) I .(Mmbb).

2.75% de filhos destros. Como. a e B. podendo ter olhos castanhos ou azuis. um homem com pés e mãos normais. porém albino.d a) CCDD e CCDD b) ccdd e ccdd c) CCdd e ccDD d) CcDd e CcDd e) CcDd e ccdd Questão 635 Foram analisadas. podendo ser destros ou canhotos. 3. Considere este caso: Antônio. espera-se que a) um dos núcleos gaméticos do tubo polínico tenha constituição a e o outro constituição b.. e) Maria produzirá gametas de 4 tipos diferentes para essas características. obrigatoriamente. os esporos dão origem à geração gametofítica. mulher normal para o albinismo. Por sua vez. As pessoas indicadas pelos números 1. o albinismo é condicionado por um gene recessivo. sendo os indivíduos homozigotos recessivos portadores de pés e mãos normais (com 5 dedos cada). podendo ser destros ou canhotos. duas características autossômicas dominantes com segregação independente: BRAQUIDACTILIA (dedos curtos) e PROGNATISMO MANDIBULAR (projeção da mandíbula para frente).com segregação independente. e) o embrião tenha constituição AaBb. podendo ter olhos castanhos ou azuis. a) Todos os filhos desse casal deverão ser albinos. A partir das informações anteriores.c gen para mão destra .5.C gen para olhos azuis . Suponha que um exemplar da planta produza todos os esporos femininos com constituição genética AB e todos os esporos masculinos com constituição ab.1 probabilidade de o casal 5x6 ter um descendente simultaneamente braquidáctilo e prognata é de a) 1/16 b) 3/16 c) 9/16 d) 3/4 e) 1/4 . polidáctila a e filha de um homem homozigoto e normal para os dois caracteres e de uma mulher albina e polidáctila. tenha constituição AaB ou Aab. d) A mãe de Maria é. .75% de filhos com olhos castanhos. 5 e 6 são braquidáctilas e prognatas. . 144 1. c) Antônio poderá produzir 2 tipos de gametas diferentes para essas características. Dados: gen para olhos castanhos .25% de filhos canhotos. Questão 636 Em uma planta com autopolinização são estudados dois pares de genes . b) a oosfera (gameta feminino) tenha constituição AB ou ab. casa-se com Maria. sendo triplóide. . b) Não existe qualqueir chance de nascer um filho polidáctilo dessa relação. em uma família. Questão 637 Em humanos a polidactilia é condicionada por um gene dominante.D gen para mão canhota . c) o endosperma. b . sendo que o alelo dominante produz em seus portadores pigmentação normal.25% de filhos com olhos azuis. Ambos os locos citados são autossômicos. homozigota para as duas características. assinale a alternativa CORRETA. por meio do processo de mitose.A. enquanto 2 e 4 têm dedos e mandíbula normais. d) o zigoto tenha constituição AB ou ab.

Questão 638 Do cruzamento entre dois indivíduos portadores do genótipo CcDd. uais são os indivíduos que seguramente produzem um só tipo de gameta? a) 6. 2. b) 1 preto: 1 pardo. 8. 13 e 14 b) 6. 9. Uma ave branca com patas com plumas. 7. 12 e 15 d) 3. patas sem plumas.5. 9. foi cruzada com uma colorida com patas sem plumas. 4 e 13 Questão 641 Em coelhos. 9. o gene C condiciona plumagem branca e o seu alelo recessivo. 9. Os animais aa são sempre albinos. 4. 2. 9 e 15 e) 1. 8. 11. 7. . está representada a herança de duas características determinadas por genes autossômicos. 7 e 13 d) 6. 2.1 uais são os indivíduos obrigatoriamente heterozigotos para as duas características? a) 6. espera-se que a proporção de aves homozigotas para os dois pares de genes seja de a) 9/16 b) 6/16 c) 4/16 145 1. Se os decendentes obtidos forem cruzados entre si. é: a) zero b) 1/2 c) 1/4 d) 1/8 Questão 639 Na genealogia a seguir. 13 e 15 Questão 640 Na genealogia a seguir. 15 e 16 e) 1. 12 e 15 c) 1. e) 1 pardo: 3 albinos. 8. c) 1 preto: 1 albino. a partir do cruzamento PpAa x ppaa espera-se uma proporção fenotípica de a) 1 preto: 1 pardo: 2 albinos. 10. o gene P determina patas com plumas e o seu alelo recessivo. a probabilidade de ocorrência na F de indivíduos com o mesmo genótipo dos pais. 10.2.2. o gene P produz pelagem preta e o seu alelo recessivo p. 4. está representada a herança de duas características determinadas por genes autossômicos. homozigota para os dois pares de genes. plumagem colorida. 7. Considerando que ocorra segregação independente entre esses genes. 13 e 14 b) 5. Questão 642 Numa ave doméstica. pelagem parda desde que esteja presente o gene A. 11.5. 9. d) 1 preto: 3 albinos. 3. 4. 3.1 1. 14. 8. 14 e 16 c) 5. 3. Esses pares de genes são autossômicos e segregam-se independentemente.

geram-se papagaios verdes na primeira geração (F1). Neste caso. amarelos e brancos. azuis. latir ou não latir durante a corrida são características definidas por um par de genes alélicos. Uma mulher com polidactilia e miopia. cujo pai era míope. espera-se que a proporção de descendentes heterozigotos para apenas um par de genes seja a) 9/16 b) 1/2 c) 1/4 d) 3/16 e) 1/16 Questão 645 Plantas de genótipo AaBb foram intercruzadas. existem quatro variedades: verdes. O mesmo ocorre para os caracteres orelhas eretas ou orelhas caídas. aproximadamente.2% d) 43. pelo alelo recessivo. Os genes responsáveis por essas características situam-se em autossomos e apresentam segregação independente.7% Questão 647 Em tomateiros. pelo alelo recessivo. a) 3 e 2 b) 6 e 3 c) 9 e 4 d) 12 e 8 e) 16 e 9 Questão 646 Em cães. foram obtidos 480 descendentes. é casada com um homem normal. Os papagaios verdes são os únicos normalmente encontrados na natureza. Latir enquanto corre e possuir orelhas eretas são características dominantes. de: a) 6. cuja mãe era normal para as duas características. Esses genes estão localizados em cromossomos que se segregam independentemente.2% b) 18. a polidactilia é um caráter dominante e a miopia. Dentre esses. Através do intercruzamento de plantas duplo-heterozigóticas. os números de genótipos e de fenótipos diferentes entre os descendentes desses cruzamentos são. A probabilidade deste casal ter uma criança com polidactilia e miopia é a) 0% b) 25% c) 50% d) 75% e) 100% Questão 644 No cruzamento entre indivíduos heterozigotos para dois pares de genes que se segregam independentemente. Considerando-se que os genes para a melanina e o 146 . o número esperado de indivíduos com hipocótilo púrpura e folhas lisas é a) 30 b) 90 c) 160 d) 240 e) 270 Questão 648 Numa dada espécie de papagaio.7% c) 31. enquanto não latir durante a corrida e possuir orelhas caídas são recessivas.d) 3/16 e) 1/16 Questão 643 No homem. Quando se cruzam papagaios verdes silvestres com os de cor branca. O cruzamento da F1 gera os quatro tipos de cores na F2. a probabilidade de que nasçam filhotes que latem enquanto correm e que possuem orelhas caídas é. Os azuis carecem de pigmento amarelo. Considere o cruzamento entre um casal de cães heterozigotos para ambos os pares de alelos. e os brancos não têm nem melanina azul nem pigmento amarelo nas penas. a cor do hipocótilo púrpura é condicionada por um alelo dominante e a cor verde. Sabendo-se que os alelos representados por letras maiúsculas são dominantes e que os não-alelos sofrem segregação independente. respectivamente. uma anomalia recessiva. os amarelos carecem de grânulos de melanina. a folha recortada é determinada por um alelo dominante e a lisa.

3 verdes. que eram em número de cinco. é INCORRETO afirmar que a) as características pêlo preto e curto são dominantes. 1 branco. Se porcos diíbridos são cruzados entre si e produzem. a cor dos pêlos pode ser branca (P_) ou preta (pp). c) os genes A e B que se situam em diferentes pares de homólogos distribuem-se ao acaso em diferentes gametas. quanto às características consideradas? a) 9 b) 16 c) 30 d) 45 e) 80 Questão 652 Quando se estuda uma célula meiótica duplo-heterozigota AaBb e se diz que. está ocorrendo segregação independente. enquanto o alelo h determina a pelagem branca. para esses genes. e) os genes A e B não são alelos. e o tipo de casco é determinado por alelos que segregam em outro cromossomo. casco fendido. b) 100% de animais com pelagem branca. pois o gene para a cor é epistático. pois o gene para a cor é dominante. e) 9 papagaios azuis. c) os indivíduos da geração F1 são homozigotos. Questão 653 Em porcos. O cruzamento entre um touro de pelagem preta (HhBb) com uma vaca de pelagem preta (HhBb) produzirá uma prole com: a) 100% de animais com pelagem preta. 1 verde. se espera que sejam fenotipicamente idênticos ao pai. c) 12 animais com pelagem branca : 1 com pelagem vermelha : 3 com pelagem preta. a freqüência esperada de cada um dos tipos de papagaio é a) 9 papagaios brancos. e o padrão malhado. 4 brancos. b) 4 papagaios amarelos. entre várias ninhadas. b) as duas características segregam-se independentemente. O padrão uniforme é governado pelo alelo dominante que segrega independentemente no locus M. Quantos filhotes do total nascido das várias ninhadas. 2 verdes. Outro gene determina a pigmentação da pelagem na cor vermelha (b) ou preta (B). Entre as várias ninhadas foram vendidos apenas os filhotes malhados de vermelho. sendo que F_ condiciona casco indiviso e ff. c) 9 papagaios verdes. d) os genes A e B estão em grupos de ligação separados. por seu alelo recessivo m. 1 branco. d) os indivíduos da geração P formam um só tipo de gameta. pelo seu recessivo v. e) 9 animais com pelagem preta : 7 com pelagem vermelha. 4 amarelos. 3 amarelos. Questão 650 Um criador fez cruzamentos entre porquinhos-da-índia para estudar as características: cor e tamanho do pêlo. quantos desses apresentarão fenótipo diferente dos pais? 147 . 64 descendentes. a pelagem colorida é determinada pelo alelo H. 1 amarelo. Questão 651 A cor preta da pelagem dos cães da raça 'Cocker Spaniel' é governada por um alelo dominante V e a cor vermelha. Questão 649 Em bovinos. 1 branco. Observou os seguintes resultados: GERAÇÃO P: pêlo preto curto X pêlo marrom longo GERAÇÃO F: pêlo preto curto GERAÇÃO F‚: 81 pêlo preto curto 27 pêlo preto longo 27 pêlo marrom curto 09 pêlo marrom longo Com base nesses resultados. d) 1 papagaio verde. b) pode ocorrer recombinação entre os genes A e B. é INCORRETO afirmar que a) os cromossomos de origem materna e paterna que contêm esses genes podem combinar-se livremente. 1 azul. 3 azuis. Um macho preto foi cruzado com fêmeas genotipicamente iguais entre si e fenotipicamente iguais a ele.pigmento amarelo se encontram em cromossomos diferentes. 1 azul. 1 azul. 3 amarelos. d) 4 animais com pelagem branca : 3 com pelagem vermelha : 9 com pelagem preta.

b) 16. e) O exemplo é de interação gênica já que está envolvido apenas um loco.Dois pares de genes se segregam independentemente.As 1 e 2 Leis de Mendel abordam o comportamento dos genes na formação dos gametas. na geração F2. estiverem localizados em cromossomos diferentes. Após autofecundação das plantas F1. na meiose. foram produzidas 371 plantas com flores avermelhadas e 287 com flores brancas.a) 4. b) somente I e II. e) I.2.5. d) 36. 1. II e III.A lei da segregação independente (2 lei) está relacionada às conseqüências do arranjo. I . Questão 655 As afirmativas a seguir relacionam a Genética Mendeliana à Divisão Celular. e) 60. se 1.5. c) somente I e III. d) O gene para a cor avermelhada é codominante em relação ao alelo. Questão 656 A mosca-de-fruta 'Drosophila melanogaster' pode apresentar asas vestigiais ou longas e corpo cinza ou ébano. Questão 654 O esquema a seguir representa o cruzamento entre duas variedades puras de ervilha-de-cheiro ('Lathyrus odoratus') de flor branca. II .2. b) Pelos resultados. c) A proporção fenotípica 9:7 é um padrão de segregação independente. de pares de cromossomos homólogos na placa metafásica. como mostra a figura a seguir. deduz-se que é um padrão de herança intermediária. Está(ão) correta(s): a) somente I.1 nalise este padrão de herança e assinale a afirmativa CORRETA: a) Trata-se de um exemplo típico da primeira Lei de Mendel. c) 28. A F1 resultante apresentou 100% das ervilhas com flores avermelhadas. III . d) somente II e III. ao acaso. Cruzando-se um macho de corpo cinza e asas vestigiais com uma fêmea de corpo ébano e asas longas (parentais P) obteve-se F que deu origem a F‚ através da autofecundação.1 148 . logo estão relacionadas com o comportamento cromossômico na meiose.

a probabilidade de surgir um descendente com genótipo que apresenta. III . artelhos e solas dos pés. espera-se que o genótipo dos filhos seja a) ddee. Sabendo-se que a surdez é determinada por qualquer dos genes recessivos d ou e.Os genes para cor do corpo e pra tipo de asa estão localizados num mesmo cromossoma. d) DdEe. b) I. a probabilidade de ocorrência de homozigose dominante é a mesma de homozigose recessiva. alça ou verticilo. A figura a seguir mostra padrões digitais que formam figuras denominadas de arco. a) 1/64 b) 63/64 c) 1/32 d) 1/16 e) 1/4 Questão 662 Os dermatóglifos são padrões típicos das cristas dérmicas nos dedos e palmas das mãos. é Obs.O gene para corpo ébano só está presente na geração P e em parte de F‚. III e V .Os genes para cor do corpo e forma das asas segregam-se independentemente durante a formação dos gametas. Questão 657 Um casal de surdos teve dois filhos com audição normal. Questão 660 Uma abelha rainha tem os seguintes pares de genes alelos que se segregam independentemente: AaBBccDdEE. b) Dois. um gene dominante. quantos genótipos diferentes. podem apresentar os zangões filhos dessa rainha? a) Um b) Dois c) Quatro d) Oito e) Dezesseis Questão 659 Considere um homem heterozigoto para o gene "A". IV . V . em homozigose. II . relativos a esses cinco pares de genes podem apresentar os zangões filhos dessa rainha? a) Um. Sabe-se que os padrões dermatóglifos são de herança multifatorial. e) Dezesseis. As afirmativas corretas são: a) I. III e IV . apenas. Questão 661 Do cruzamento de dois indivíduos com genótipo AaBbCc. pelo menos. Sabendo-se que os zangões surgem de óvulos que se desenvolvem por partenogênese. apenas.Em F‚. IV e V. c) I. b) AADDFF. e) III.A probabilidade de ocorrência do mesmo genótipo dos indivíduos de F em F‚ é de 4/16. Entre os gametas que poderão se formar encontraremos apenas a(s) combinação(ões): a) AdF. d) Oito.Após a análise dos resultados dos cruzamentos. c) DDEE.: Considere um tipo de herança mendeliana. Sabendo-se que os zangões surgem de óvulos que se desenvolvem por partenogênese. Questão 658 Uma abelha rainha tem os seguintes pares de genes alelos que segregam independentemente: AaBbDdEe. duplo recessivo para o gene "D" e homozigoto dominante para o gene "F". II e IV. d) AdF e adF. apenas. c) AaddFF. apenas. II e V . quantos genótipos diferentes. e) ADF e adf. foram feitas as afirmativas abaixo. b) Ddee. apenas. I . c) Quatro. Considere ainda que todos esses genes situam-se em cromossomos diferentes. 149 . e) DDee. relativos a esses quatro pares de genes. d) II.

BbDd. Dd. c. respectivamente: a) 4 e 3:3:3:1:1:1 b) 8 e 27:9:9:9:3:3:3:1 c) 8 e 9:3:3:1 d) 16 e 9:3:3:1 e) 16 e 27:9:9:9:3:3:3:1 Questão 666 Considere a segunda lei de Mendel ou lei da distribuição independente e indique os gametas produzidos pelo genótipo aaBbccDdEE.2 Sobre esse assunto. é correto afirmar: 150 1. bc. de semente lisa e amarela. b) aBcDE. E.25%. e) 6. observaram-se 100% das plantas altas. abcdE. baixa. Para estes 4 genes. EE.Questão 665 No milho. d. e) aB. b) 50%. Questão 667 Um organismo diplóide. d) O número de cristas dérmicas não varia entre indivíduos da mesma família. d) aaBb. b. aBcdE. Nessas condições. c) aa. é INCORRETO afirmar: a) Quanto mais semelhantes forem as mãos de gêmeos. com o genótipo AaBBCCDDEE. c) 25%. maior será a probabilidade de que eles sejam monozigóticos. quantos tipos diferentes de gametas poderia produzir o filho de Janaína e Pedro? a) 4 b) 8 c) 16 d) 32 e) 64 Questão 664 Considere quatro pares de genes que segregam de maneira independente. cada um com um par de alelos. a) a. Se as plantas da geração F forem intercruzadas. como a Síndrome de Down. permitiu constatar que Janaína tem o genótipo AAbbCCDD e Pedro tem o genótipo aaBBccDD. de semente lisa e amarela. cc. Analisando a figura. cD. d) 12%. poderá produzir quantos tipos geneticamente distintos de gametas? a) 2 b) 4 c) 8 d) 16 e) 32 Questão 668 O desenho abaixo corresponde ao núcleo de uma célula em metáfase de uma espécie cujo número n de cromossomos é 3. Uma planta pura. b) Esses padrões podem ser úteis ao diagnóstico de certas síndromes cromossômicas. A planta pode ser alta devido ao alelo "Br" e baixa devido ao alelo "br". D. o número de gametas produzidos pelas plantas F e a proporção fenotípica esperada na geração F‚ será. foi cruzada com outra planta pura. B. Na geração F. dE. um indivíduo que apresente o genótipo AaBBCcDD produzirá gametas ABCD com a freqüência de: a) 75%. Bb. de semente rugosa e branca. alta.2. abcDE. aaEE. A cor da semente pode ser amarela devido ao alelo "Y" e branca devido ao alelo "y". c) A análise dos padrões digitais não se presta para a determinação de paternidade. ccDd. . a textura da semente pode ser lisa devido ao alelo "Su" e rugosa devido ao alelo "su". Questão 663 A análise de 4 genes autossômicos.5.

AbC.1.8 b) 4 . abc b) ABC.2. a) 30 espermatozóides.4 . (02) Em relação aos genes em questão. poderão ser encontrados 64 genótipos diferentes.8 d) 4 . AaBB. AaBBcc. Abc. aBC. Em experimentos envolvendo três características independentes (triibridismo). onde os três pares de genes estão em pares de cromossomos separados. a freqüência de descendentes AABbcc será igual a a) 8/64 b) 1/16 c) 3/64 d) 1/4 e) 1/32 Questão 672 Se a mitose ocorre em uma célula de genótipo AaBbCc.4 .8 .4 c) 2 .2 1.8 . Cc d) AABBCC.4 -16 . ABc. poderão ser formados 4 diferentes tipos de gametas. onde os três pares de genes estão em pares de cromossomos distintos.8 .2 (01) Em relação aos genes em questão. quais serão os genótipos das células resultantes? a) Aa. abc c) Aa.8 Questão 670 Sessenta células de um animal.4 . Questão 671 Assinale a alternativa correta. b) 60 espermatozóides. e) 180 espermatozóides. AaBbcc podem formar. aabbcc e) AaBbCc Questão 673 Se a meiose ocorre numa célula de genótipo AaBbCc. Bb e Cc 151 Questão 669 Indivíduos com os genótipos AaBb. os genótipos das células resultantes serão: a) ABC. AaBbCc. sofrem meiose.2 . c) 90 espermatozóides. Bb. com a constituição representada na figura. poderão ser formados 8 diferentes tipos de gametas.5. poderão ser encontrados 9 genótipos diferentes. poderão ser encontrados 16 genótipos diferentes. (08) Como resultado de uma autofecundação. impossível calcular tanto o número de genótipos quanto o de fenótipos.8 . . (04) Como resultado de uma autofecundação.2 .2 . portanto.4 -16 .8 . apresentando a constituição ABC.4 e) 2 . abC. (32) O sistema em questão é polialélico.2. sendo. (16) Como resultado de uma autofecundação. d) 120 espermatozóides. se for realizado um cruzamento entre indivíduos AaBbCc. quantos tipos de gametas diferentes? a) 4 .5. respectivamente. Soma ( ) ão esperados.

e) 1/3. d) 1/2.2. cuja mãe era canhota. AbC. Rh−. O casal já tem uma filha daltônica e míope. a) O indivíduo 2 deve ser heterozigoto para os alelos dessas duas características.3 probabilidade do casal 4X5 ter uma criança de sexo feminino e de visão normal é de: a) 1/6. casa-se com uma mulher normal para ambas as características. Questão 677 Um indivíduo de sangue tipo B. Questão 676 No heredograma a seguir.5.5. aBC. filho de pai míope. a miopia e a habilidade para a mão esquerda são caracteres condicionados por genes recessivos que se segregam de forma independente. Qual a probabilidade de esse casal ter uma criança com fenótipo igual ao do pai? a) 1/2 b) 1/4 c) 1/8 152 ssinale a alternativa correta. a probabilidade de terem uma menina normal para ambas as características é de: a) 3/16 b) 1/4 c) 1/16 d) 1/2 e) 9/16 . que teve eritroblastose fetal ao nascer e é filha de pai do tipo O. e) A probabilidade de o casal 4 × 5 ter uma criança míope e canhota é de 3/8. Rh®. considere a genealogia a seguir. c) 3/4. A probabilidade de esse casal ter uma criança que possa doar sangue para o pai é de: a) 1/2. ABc. Questão 675 Um indivíduo daltônico e não míope. Questão 678 Na espécie humana. e) 1. Rh®. Um homem de visão normal e destro. d) zero.b) ABC e abc c) ABC. Abc. c) A probabilidade de o casal 1 × 2 ter uma criança destra e de visão normal é de 1/4. casa-se com uma mulher de sangue tipo A. b) 1/4. abC e abc d) AaBbCc e) AABBCC e aabbcc Questão 674 Sabendo-se que a miopia e o uso da mão esquerda são condicionados por genes autossômicos recessivos.2. filho de pai O. os indivíduos marcados apresentam um tipo de cegueira noturna. b) O indivíduo 3 deve ter herdado os alelos dessas duas características apenas de sua mãe. d) Todos os descendentes de pai míope e canhoto possuem essas características. Sabendo que o daltonismo é condicionado por um gene recessivo ligado ao sexo e que a miopia é uma herança autossômica recessiva. cujo pai tinha miopia e era canhoto. 1. b) 1/4.3 1. aBc. casa-se com uma mulher míope e destra. c) 1/8.

a cor preta é determinada pelo alelo dominante M e a marrom pelo alelo m.A ou B ou O.3 . Esses dois pares de alelos autossômicos segregam-se independentemente. principalmente. pergunta-se: I . (II) . que ocorre durante a meiose. podemos observar que o número possível de gametas (w) em uma espécie é igual a 2¾. (08) 50% de probabilidade de vir a apresentar ambas as anomalias. A figura a seguir demonstra a distribuição independente de cromossomos maternos e paternos.d) 3/4 e) 3/8 Questão 679 Em determinada raça animal. pode-se afirmar que um descendente do casal tem: (01) 100% de probabilidade de nascer livre de ambas as anomalias. a probabilidade de nascer um filhote marrom com manchas é a) 1/16 b) 3/16 c) 1/4 d) 1/2 e) 3/4 Questão 680 A diversidade biológica dos seres vivos está relacionada. (II) . pode-se afirmar que a melhor expressão para o número (w) de gametas possíveis está representada em: a) w = 2£¤ b) w > 2£¤ c) w < 2£¤ d) w = 2¢¤ e) w¤ 2¢¤ Questão 681 A cegueira provocada pela catarata e a extrema fragilidade dos ossos são características que podem aparecer em seres humanos e resultam da ação de dois genes dominantes autossômicos presentes em cromossomos diferentes. (04) 25% de probabilidade de vir a ter olhos normais e ossos frágeis. Assim. em um organismo onde o número haplóide (n) é igual a 3. com a reprodução sexuada. presença de manchas brancas. O principal evento responsável por essa diversidade ocorre durante a formação dos gametas. Nessas condições.5. Soma ( ) Questão 682 Sendo um homem de sangue tipo O.Se esse homem casar-se com uma mulher de sangue tipo AB. qual a probabilidade do nascimento de uma criança do tipo AB? A alternativa que responde corretamente às perguntas anteriores é: a) (I) .O ou A ou B.2.zero b) (I) . o alelo B condiciona padrão uniforme e o b. Um homem com catarata e ossos normais cujo pai tem olhos normais. (02) 50% de probabilidade de vir a sofrer de catarata e ter ossos normais. quais os prováveis tipos de sangue dos filhos do casal? II . O pai da mulher tem ossos normais. A partir do cruzamento Mmbb × mmBb.Se casar-se com uma mulher de sangue tipo A.50% 153 1. casa-se com uma mulher de olhos livres de catarata mas com ossos frágeis. Levando-se em consideração que na espécie humana ocorre a permuta gênica. (16) 50% de probabilidade de vir a apresentar apenas uma das anomalias.

B. AB d) A.pai sem aglutininas do sistema ABO no sangue. Rh−. Se o casal vier a ter outros 5 filhos.50% d) (I) . d) menor que a chance de nascerem sucessivamente com sangue do tipo AB.zero e) (I) .25% Questão 683 Considere os seguintes dados: . e) maior que a chance de nascerem sucessivamente com sangue do tipo AB. B. . (II) . O Questão 686 Num caso de investigação de paternidade. c) maior que a chance de nascerem todos com sangue do tipo AB. d) os três resultados foram necessários para confirmar que o homem é mesmo o pai da criança. B. e) os resultados de DNA contradizem os resultados dos grupos sangüíneos. Rh−.mãe de tipo sangüíneo B. (II) . . podemos afirmar que: 1. O e) A. o grupo sangüíneo e o fator Rh é de a) 1/16 b) 1/12 c) 1/8 d) 1/4 e) 1/2 Questão 684 Nas hemácias de um indivíduo pertencente ao grupo sangüíneo B: a) existe o aglutinógeno B b) existe o aglutinógeno A c) existe a aglutinina A d) existe a aglutinina B e) existem o aglutinógeno A e a aglutinina B Questão 685 Um homem de genótipo AB casa-se com uma mulher receptora universal. A e B. a chance deles nascerem todos com sangue do tipo O é a) igual à chance de nascerem todos com sangue do tipo AB. A tabela a seguir resume os resultados parciais da análise de grupos sangüíneos (do menino. B. Os tipos de sangue dos filhos são apenas: a) A e AB b) A e B c) A. A probabilidade de os pais desse menino terem mais um filho com o mesmo fenótipo de seu irmão.1 a) os resultados dos grupos sangüíneos excluem a possibilidade do homem ser o pai da criança. B.A ou B. de sua mãe e do suposto pai) e de duas seqüências de DNA (do menino e do suposto pai). foram realizados exames para identificação de grupos sangüíneos e análise de DNA. levando em conta o sexo. (II) .menino de tipo sangüíneo A.A ou B. teve um filho de sangue tipo O.A ou B. A. 154 . c) os resultados dos grupos sangüíneos e de DNA não excluem a possibilidade do homem ser pai da criança. os outros exames foram desnecessários. casada com um homem de sangue tipo B. Considerando apenas a tabela adiante. b) os resultados dos grupos sangüíneos não excluem a possibilidade do homem ser o pai da criança. correspondentes a um segmento localizado num autossomo e outro no cromossomo X.5.3. mas a seqüência de DNA do cromossomo X exclui. b) menor que a chance de nascerem todos com sangue do tipo AB. A e A. Questão 687 Uma mulher de sangue tipo A. mas possuidor do antígeno Rh.c) (I) .

O indivíduo 6 deverá ser. e) homozigoto .homozigoto dominante. b) quantitativa.1 om relação a esses resultados. foi observada aglutinação nas duas primeiras lâminas. Questão 690 Utilizando-se três lâminas de microscopia.1 155 . c) A e Rh negativo. d) homozigoto . Questão 691 A herança do sistema ABO é do tipo: a) com dominância. d) pleiotropia. e) A e Rh positivo. c) heterozigoto . soro anti-B na segunda e soro anti-Rh na terceira. b) AB e Rh negativo.heterozigoto. a cada uma. soros anti-A. b) heterozigoto .homozigoto recessivo. conforme o esquema adiante. foram colocadas três gotas de seu sangue sobre uma lâmina de vidro. Após a mistura do sangue com os respectivos soros. é: a) B e Rh positivo.5. Rh+ poderá ser filha: 1. a) heterozigoto . em relação aos locos dos sistemas ABO e Rh. Após alguns segundos. foi colocada uma gota de sangue humano em cada uma delas. d) AB e Rh positivo. A partir desses dados podemos afirmar que o indivíduo.5. adicionando-se. assinale a opção correspondente ao possível genótipo da pessoa em teste: a) IÞIÞRR b) IÞIßrr c) IßiRr d) IÞirr e) iiRR Questão 689 No heredograma a seguir estão indicados os fenótipos dos grupos sangüíneos ABO e Rh. e) poligênica.heterozigoto.homozigoto dominante. notou-se aglomeração de hemácias apenas no local onde havia soros anti-B e anti-A. A cada gota foi juntada igual quantidade de soro anti-A na primeira. Questão 692 Qual das opções a seguir relaciona os grupos sangüíneos de um doador universal ideal? a) ARh− b) ABRh® c) ORh® d) ABRh− e) ORh− Questão 693 Considerando os casamentos a seguir.3. c) polialelia. quanto aos grupos sanguíneos ABO e fator Rh. respectivamente: 1.3. anti-Rh e anti-B. uma criança de tipo sangüíneo B.Questão 688 Para se determinar o tipo sangüíneo de uma pessoa.

recebeu transfusão de sangue de sua mulher Tânia.1 a) somente do casal I.5.3. a probabilidade de nascer uma menina do tipo O. b) O indivíduo 7 pertence ao grupo sangüíneo A.1 Considere o heredograma acima. a probabilidade do casal ter uma criança do tipo A. d) IÞIß e IÞIÞ. que mostra a tipagem ABO e Rh dos indivíduos.5. d) O indivíduo 1 é receptor universal.3. e) IÞi e IßIß. c) O indivíduo 6 é homozigoto. 156 .5. Rh− e é filho de pai tipo A e mãe tipo B.1 1. Rh® é: a) 100% b) 25% c) 75% d) 50% e) 0 Questão 695 Uma mulher que possui aglutinina anti-B no seu sangue teve um filho do grupo O. d) somente do casal II e) do casal I ou do casal II ou do casal III. Sabendo-se que o marido tem o aglutinogênio B.3. os genótipos do casal são: a) IÞi e IÞi. Questão 697 1. Sabendo-se que Tânia teve eritroblastose fetal ao nascer. e) O indivíduo 8 é heterozigoto. assinale a alternativa INCORRETA. Questão 694 Jorge. Sabendo que o casal 5×6 já perdeu uma criança com eritroblastose fetal.1. a) O indivíduo 9 pode ser doador universal. Rh® é de: a) 1/6 b) 1/8 c) 1/2 d) 1/4 e) 1/3 Questão 698 O heredograma a seguir mostra os diferentes tipos sangüíneos existentes em uma família. b) do casal I ou do casal IV. c) IÞi e Ißi. Questão 696 A respeito do heredograma acima. b) IÞIÞ e Ißi. que é filha de pai e mãe do tipo B. c) o casal III ou do casal IV. que tem tipo sangüíneo A. que considera o sistema sangüíneo ABO.

somente.Indivíduos que apresentem apenas alelo dominante Iß e não apresentem IÞ pertencem ao grupo B. fazendo o mesmo com o sangue de D. e) AB e O. Como faltavam anti-soros para a determinação dos grupos sangüíneos no sistema ABO.Indivíduos que apresentem apenas alelos recessivos ii pertencem ao grupo O.3. . Dr. Epaminondas provocava aglutinação das hemácias de D. que precisava urgentemente de transfusão sangüínea. mas não se sabia o seu grupo sangüíneo. b) TIPO SANGÜÍNEO: O. FATOR Rh: positivo. somente. d) TIPO SANGÜÍNEO: A ou O. e) TIPO SANGÜÍNEO: O.1.5.IÞIß Questão 699 Pais cujo grupo sanguíneo são AB e O têm cinco filhos com os seguintes fenótipos: dois são O. um B e um AB. Josefa apresenta sangue do grupo: a) A b) B c) AB d) O Questão 703 O esquema apresenta uma árvore genealógica de alguns primatas e seus possíveis grupos sangüíneos no sistema ABO. que é do grupo A. .Ißi e) AB . um A.Indivíduos que apresentem apenas alelo dominante IÞ e não apresentem Iß pertencem ao grupo A.ii b) A . Entretanto sabe que seu pai é A+. Epaminondas pode concluir que D. b) B e B. FATOR Rh: negativo ou positivo. somente. Os tipos sangüíneos dos pais biológicos dessa criança são: a) A e A. . 157 .IÞIÞ d) B . FATOR Rh: positivo. Questão 702 ssinale a alternativa que contém. Josefa não era capaz de aglutinar as hemácias do Dr. usou de um outro recurso: retirou um pouco de seu próprio sangue do qual separou o soro. FATOR Rh: positivo No ambulatório de uma pequena cidade do interior estava D. Epaminondas. Josefa. somente. Epaminondas. c) A e O.IÞi c) A . Josefa. sua mãe O+ e seu irmão é A-. FATOR Rh: negativo. somente. c) TIPO SANGÜÍNEO: A ou O.Indivíduos que apresentem os dois alelos dominantes IÞ e Iß pertencem ao grupo AB. de acordo com a seguinte composição genética: . o fenótipo e o genótipo do indivíduo II. A partir dos resultados. Questão 701 Alexsander não sabe qual é o seu grupo sangüíneo e o seu tipo de Rh. mas o soro de D.1 ou negativo. O teste subseqüente revelou que o soro do Dr. somente. Quantos filhos biológicos tem esse casal? a) 5 b) 4 c) 3 d) 2 e) 1 Questão 700 Uma criança tem tipo sangüíneo do tipo AB. Josefa. Dr. respectivamente. Assinale a opção que contém o(s) grupo(s) sangüíneo(s) e o(s) tipo(s) de Rh que Alexsander pode ter: a) TIPO SANGÜÍNEO: A.2 a) O . d) A e B.

A população originária desse grupo vive até hoje no mesmo local. portanto. d) Alguns gorilas podem receber sangue de alguns orangotangos. é correto afirmar.1 Pode-se dizer que os tipos sanguíneos mais difíceis e mais fáceis para receber sangue são.5. e) As pessoas pertencentes ao grupo AB só recebem sangue de AB.1 1.Questão 705 Suponha que um grupo de pessoas. Assim. Considerando-se apenas os antígenos do sistema ABO. totalmente isolada. b) O gene O é dominante sobre os genes A e B. Nas tabelas a seguir. mas não de chimpanzés. Assim. somente humanos podem apresentar os quatro grupos sangüíneos no sistema ABO. os casamentos entre pessoas O e A e entre pessoas O e B apresentam 50% de chance de produzir descendentes pertencentes ao grupo O. pertences a uma determinada seita religiosa. os casamentos entre as pessoas O e A e entre pessoas O e B produzem apenas descendentes pertencentes ao grupo O. 1. portanto. EXCETO: a) Apenas dois dos primatas citados podem apresentar indivíduos doadores universais no sistema ABO. c) Apenas dois dos primatas da árvore podem apresentar indivíduos receptores universais no sistema ABO.3. apresentam pouca chance de existir numa população. Questão 704 Os esquemas mostram as possíveis transfusões de sangue tradicionais em relação aos sistemas ABO e Rh.1 De acordo com o esquema.5. apenas dois.5. o casamento entre pessoas pertencentes ao grupo O origina apenas descendentes do grupo O. c) O gene O é recessivo e. b) Orangotangos podem apresentar três grupos sangüíneos. mas chimpanzés. Essa situação leva a uma menor freqüência dessas pessoas na população. respectivamente: a) O Rh® e O Rh− b) O Rh− e AB Rh® c) A Rh− e OB Rh® d) AB Rh® e O Rh− Qual das alternativas a seguir apresenta uma explicação possível para a mudança na freqüência dos grupos sangüíneos nessa população? a) O gene O é dominante sobre os genes A e B. Questão 706 Observe a árvore genealógica a seguir para o grupo sangüíneo (ABO) em uma família: 158 .3. 1. imigrou para uma região há mais de meio século.3. d) As pessoas pertencentes ao grupo AB são recessivas e. são mostradas as freqüências aproximadas dos grupos sangüíneos do sistema ABO da população original (tabela 1) e da população atual (tabela 2).

Rh® Assinale a alternativa que relaciona corretamente cada criança ao seu pai. III . III . N. AB × AB 159 OBS: 1. numa família. Rh− c.5.a. A.Legenda: Grupo "A": A/A ou A/O Grupo "B": B/B ou B/O Grupo "AB": A/B Grupo "O": O/O arque a opção correta: a) o indivíduo nŽ 5 pode ser de grupo sangüíneo "AB" b) o indivíduo nŽ 1 é do grupo sangüíneo "AB" c) o indivíduo nŽ 6 é do grupo sangüíneo "AB" d) o indivíduo nŽ 7 não pode ser filho do casal 5×6 Questão 708 Uma mulher com grupos sangüíneos B.c.3. II . O indivíduo 4 é homem do grupo sangüíneo "B" 3. N.b.b.1 CRIANÇAS I. para o grupo sangüíneo ABO em uma família: 1. Rh® III. marque a opção correta: a) o indivíduo 3 é do grupo sangüíneo "AB" b) o indivíduo 1 pode ser do grupo sangüíneo "AB" c) o indivíduo 1 é do grupo sangüíneo "A" d) o indivíduo 1 é do grupo sangüíneo "O" Questão 707 Observe a árvore genealógica a seguir. III .a. O indivíduo 5 é mulher do grupo sangüíneo "O" Sobre a árvore anterior.b.3. B. Rh® teve três crianças com pais distintos: 1.5.c d) I . N.1 . O indivíduo 2 é mulher do grupo sangüíneo "A" 2.c. II . III . dois irmãos são do grupo sangüíneo A.a. O. M. N. outro é do grupo AB e outro do grupo O. II . N.b c) I . II .c b) I . A.c. Rh− II. Rh− PAIS a. Dos pares de genótipos a seguir. Rh− b.a Questão 709 Sabe-se que. CASAIS I. B. o único que pode ser dos pais desses indivíduos é a) ii × Ißi b) IÞi × IÞIß c) IÞi × Ißi d) IÞIÞ × IÞIß e) IÞIÞ × IßIß Questão 710 Os tipos sangüíneos do sistema ABO de três casais e três crianças são mostrados a seguir. III .b. MN.a e) I . a) I . II . AB.

II. B × B III. A × O CRIANÇAS a. A b. O c. AB Sabendo-se que cada criança é filha de um dos casais, alternativa que associa corretamente cada casal a seu filho é a) I - a; II - b; III - c b) I - a; II - c; III - b c) I - b; II - a; III - c d) I - c; II - a; III - b e) I - c; II - b; III - a Questão 711 Uma criança necessita urgentemente de uma transfusão de sangue. Seu pai tem sangue do tipo B e sua mãe, do tipo O. Que outro(s) tipo(s) de sangue, além do tipo O, poderia(m) ser utilizado(s) na transfusão, mesmo sem a realização de teste, sabendo-se que o avô paterno da criança tem sangue do tipo AB e sua avó paterna tem sangue do tipo O? a) Tipo AB. b) Tipo A. c) Tipo B. d) Tipo A e tipo B. e) Nenhum outro tipo. Questão 712 Na herança do sistema sangüíneo ABO, há três alelos autossômicos principais: IÞ (para sangue do tipo A), Iß (para sangue do tipo B) e i (para sangue do tipo O). Sabe-se, ainda, que IÞ e Iß são codominantes, ambos dominando sobre i. Uma mulher do tipo A, casada com um homem do tipo B, teve uma filha do tipo O. O homem não quis reconhecer a paternidade alegando infidelidade por parte da mulher. Como na época em que o fato ocorreu não havia o "exame do DNA", o Juiz recorreu a um geneticista que lhe apresentou um parecer sobre o caso. Assinale a alternativa que contém a conclusão correta do geneticista. a) O homem tem razão, pois, por se tratar de um caso de herança ligada ao sexo, a filha dos dois teria que ser, obrigatoriamente, do tipo A.

b) O homem tem razão, pois, pais com tipos A e B, quaisquer que sejam seus genótipos, jamais poderiam ter filhos ou filhas do tipo O. c) O homem não tem razão, pois, pais com tipos A e B, dependendo de seus genótipos, podem ter filhos ou filhas com qualquer um dos tipos sangüíneos (A, B, AB e O). d) O homem não tem razão, pois, por se tratar de herança autossômica, filhos e filhas teriam que ser, obrigatoriamente, do tipo O. e) O homem tem razão, pois, pais com tipos A e B, só podem ter filhos ou filhas do tipo AB, visto que IÞ e Iß são codominantes. Questão 713 Mulher branca, submetida à inseminação artificial, deu à luz gêmeos de cor negra. O fato causou polêmica, já que o pai também é branco. A grande dúvida é saber se houve troca de embriões ou apenas de um dos gametas. Adaptado do "Jornal do Brasil", 1Ž de agosto de 2002 Considere o fato relatado e suponha que a mãe tenha sangue tipo A e seja filha de pai e mãe com sangue tipo AB. Nesse caso, o tipo sangüíneo dos gêmeos poderia ser: a) A ou O b) A ou AB c) B ou O d) B ou A e) AB ou O Questão 714 É necessário o conhecimento do tipo sangüíneo em caso de transfusão. Em relação ao sistema ABO, ( ) indivíduos do grupo sangüíneo O podem doar sangue para pessoas do seu próprio tipo sangüíneo e para os demais . ( ) indivíduos do grupo AB podem receber sangue de qualquer tipo. ( ) indivíduos portadores de sangue do tipo A possuem aglutinogênios A. ( ) indivíduos do grupo B possuem aglutinina anti-A.

160

Questão 715 Além do teste de DNA, há exames mais simples que podem ajudar a esclarecer dúvidas sobre paternidade. Por exemplo, o teste de tipagem sangüínea do sistema ABO permite determinar quem não pode ser o pai. Assinale a alternativa que apresenta uma situação em que esse exame assegura a exclusão da paternidade: a) O filho é do tipo O, a mãe do tipo O e o suposto pai do tipo A. b) O filho é do tipo AB, a mãe do tipo AB e o suposto pai do tipo O. c) O filho é do tipo AB, a mãe do tipo A e o suposto pai do tipo B. d) O filho é do tipo B, a mãe do tipo B e o suposto pai do tipo O. e) O filho é do tipo A, a mãe do tipo A e o suposto pai do tipo B. Questão 716 O heredograma a seguir representa uma família na qual foram determinados os grupos sangüíneos do sistema ABO para alguns dos membros, e do sistema Rh para todos os membros. Com base nas informações contidas no heredograma e em seus conhecimentos sobre o assunto, é INCORRETO afirmar-se que

a) a probabilidade do indivíduo I-2 formar gametas iR é de 50%. b) a probabilidade de II-4 ter uma criança com eritroblastose fetal é de O%. c) os indivíduos Rh positivos da geração II pertencem ao grupo sangüíneo A, e os Rh negativos, ao grupo O. d) o indivíduo I-1 é heterozigoto para uma das características. e) os indivíduos II-3 e II-4 podem apresentar os dois tipos de aglutinina do sistema ABO. Questão 717 Nas situações em que vítimas de acidentes necessitam de transfusão de sangue, sem que se conheça o tipo sangüíneo de cada uma delas, é recomendável utilizar-se o tipo "O negativo". É CORRETO afirmar que, nesse caso, tal tipo sangüíneo é o mais adequado porque, nas hemáceas do doador, estão a) presentes os antígenos correspondentes aos anticorpos do receptor. b) ausentes os anticorpos correspondentes aos antígenos do receptor. c) ausentes os antígenos correspondentes aos anticorpos do receptor. d) presentes os anticorpos correspondentes aos antígenos do receptor. Questão 718 Com relação à genética dos grupos sangüíneos ABO, pode-se afirmar que: a) existem 16 modalidades de cruzamentos de gametas. b) existem 9 possibilidades de acasalamentos. c) indivíduo com grupo sangüíneo O não pode ser filho de acasalamento de indivíduos dos grupos O e AB. d) indivíduo do grupo sangüíneo B não pode ser filho de acasalamento de indivíduos dos grupos O e AB. e) indivíduo com grupo sangüíneo AB pode ser filho de acasalamento de indivíduos dos grupos O e B. Questão 719 A respeito dos grupos sangüíneos avalie as proposições abaixo. ( ) Grupo sangüíneo: A
161

1.5.3.1

Antígenos: A Anticorpos: Anti-B Doa: A, AB Recebe: A, O ( ) Grupo sangüíneo: B Antígenos: B Anticorpos: Anti-A Doa: B, AB Recebe: B, O ) Grupo sangüíneo: AB Antígenos: A e B Anticorpos: Anti-A e Anti-B Doa: AB Recebe: AB, A , B, O ) Grupo sangüíneo: O Antígenos: O Anticorpos: Não tem Doa: O, A, B, AB Recebe: O ) Grupo sangüíneo: A Antígenos: A Anticorpos: Anti-A Doa: A, AB Recebe: A, O Questão 720 Na figura a seguir são mostrados os genótipos e fenótipos possíveis, considerando-se os alelos IÞ, Iß e i determinantes dos grupos sangüíneos do sistema ABO no homem. De acordo com a figura, analise as proposições a seguir.

(

) Todos os descendentes de um casal de genótipo tipo 2 serão do grupo A e apresentarão em suas hemácias o aglutinogênio A. 2) Indivíduos do grupo sangüíneo B de genótipo 3 ou 4 apresentam na membrana de suas hemácias aglutinogênio B e, no plasma, aglutinina anti-A. 3) Os descendentes de um casal (genótipo 5) do grupo sangüíneo AB serão fenotipicamente AB e, como têm em seus genótipos os alelos IÞ e Iß, apresentam, na membrana de suas hemácias, os antígenos A e B. 4) Indivíduos do grupo sangüíneo O de genótipo 6, apresentam aglutinogênios A e B no plasma, mas não têm aglutininas anti-A e anti-B na membrana de suas hemácias. Está(ão) correta(s) apenas: a) 2 b) 1 e 4 c) 2 e 4 d) 2 e 3 e) 2, 3 e 4 Questão 721 Três irmãos (João, José e Maria) realizaram um exame de sangue em laboratório para identificar os seus tipos sangüíneos, com o objetivo de verificar a possibilidade de doarem sangue ao pai, que necessitaria de uma transfusão após uma cirurgia. Um deles (João) ficou surpreso ao descobrir seu tipo sangüíneo - O - e achou que não era filho biológico do casal que o criou. Seu pai e o irmão apresentam sangue do tipo A e sua mãe e a irmã apresentam sangue do tipo B. Todos são RH®. Com base no texto e em seus conhecimentos sobre a herança dos tipos sangüíneos, é correto afirmar que a) João não pode ser filho biológico do casal, pois de acordo com a herança genética possível do tipo sangüíneo, os filhos somente poderiam apresentar sangues dos tipos A, B e AB. Dos filhos biológicos, somente José pode doar sangue ao pai, pois as hemácias de seu sangue apresentam aglutinogênio A. b) João pode ser filho biológico do casal, desde que pelo menos um dos pais seja heterozigoto e apresente o alelo responsável pela presença de aglutininas anti-A e anti-B no plasma. O pai não pode receber sangue de Maria, pois seu sangue apresenta aglutinina anti-B. c) João não pode ser filho biológico do casal, assim como seus dois irmãos, pois de acordo com a herança genética
162

(

(

1.5.3.1

possível do tipo sangüíneo, os filhos somente poderiam apresentar sangues dos tipos AB. O pai pode receber sangue de João e José, pois o sangue dele apresenta aglutinina anti-A, assim como o de seus filhos. d) Se Maria engravidar de um homem com o mesmo genótipo para o tipo sangüíneo de seu irmão João, existe a probabilidade de 100% de seu filho ter sangue do tipo B. Porém, se ela engravidar de um homem com o mesmo genótipo para o tipo sangüíneo de seu irmão José, existe a probabilidade de 50% de seu filho ter sangue do tipo AB, 25% do tipo A e 25% do tipo B. e) João pode ser filho biológico do casal, desde que ambos os pais sejam heterozigotos e apresentem o alelo responsável pela ausência de aglutinogênio. João pode doar sangue para seu pai, pois as hemácias do seu sangue não apresentam aglutinogênios. Questão 722 Jorge, portador de grupo sangüíneo AB Rh-, e Júlia, que é AB Rh+, têm uma filha, Joana, que aos 3 anos de idade necessita de uma transfusão sangüínea. Os exames laboratoriais por hemaglutinação dão os seguintes resultados:

b) seus eritrócitos não contêm anticorpos anti-A e anti-B. c) seu plasma não contém antígenos A e B. d) seus eritrócitos não contêm antígenos A e B. e) seu sangue não contém antígenos nem anticorpos. Questão 724 A herança dos tipos sangüíneos do sistema ABO constitui um exemplo de alelos múltiplos (polialelia) na espécie humana. Com relação ao sistema ABO é CORRETO afirmar que: (01) o tipo O é muito freqüente e, por este motivo, o alelo responsável por sua expressão é dominante sobre os demais. (02) os indivíduos classificam-se em um dos quatro genótipos possíveis: grupo A, grupo B, grupo AB e grupo O. (04) existem três alelos: o IÞ, o Iß e o i. (08) os alelos IÞ e Iß são codominantes. (16) se um indivíduo do grupo A for heterozigoto, ele produzirá gametas portadores de IÞ ou de i. (32) os indivíduos de tipo sangüíneo O possuem aglutinogênios em suas hemácias, porém não possuem aglutininas no plasma. (64) em alguns cruzamentos, entre indivíduos do grupo A com indivíduos do grupo B, é possível nascerem indivíduos do grupo O. Questão 725 Em relação ao sistema sangüíneo ABO, um garoto, ao se submeter ao exame sorológico, revelou ausência de aglutininas. Seus pais apresentaram grupos sangüíneos diferentes e cada um apresentou apenas uma aglutinina. Os prováveis genótipos dos pais do menino são a) Ißi - ii. b) IÞi - ii. c) IÞIß - IÞi. d) IÞIß - IÞIÞ. e) IÞi - Ißi.

1.5.3.1

Em face dos dados apresentados, assinale a alternativa correta. a) Joana não pode ser filha natural de Júlia. b) Joana não pode receber sangue O Rh-. c) Jorge não pode ser o pai natural de Joana. d) Joana pode receber sangue AB Rh-. e) Joana pode ser homozigota para B. Questão 723 Em uma transfusão sangüínea, indivíduos do grupo O são considerados doadores universais porque a) seu plasma não contém anticorpos anti-A e anti-B.

163

Questão 726 Para os grupos sangüíneos do sistema ABO, existem três alelos comuns na população humana. Dois (alelos A e B) são co-dominantes entre si e o outro (alelo O) é recessivo em relação aos outros dois. De acordo com essas informações, pode(m)-se afirmar: I. Se os pais são do grupo sangüíneo O, os filhos também serão do grupo sangüíneo O. II. Se um dos pais é do grupo sangüíneo A e o outro é do grupo sangüíneo B, todos os filhos serão do grupo sangüíneo AB. III. Se os pais são do grupo sangüíneo A, os filhos poderão ser do grupo sangüíneo A ou O. Está(ão) correta(s) a) apenas I. b) apenas II. c) apenas III. d) apenas I e III. e) I, II e III. Questão 727 Observe a genealogia.

ara o casal (5 e 6) que pretende ter muitos filhos, foram feitas as quatro afirmações a seguir. I - O casal só terá filhos AB e Rh positivo. II - Para o sistema ABO, o casal poderá ter filhos que não poderão doar sangue para qualquer um dos pais. III - O casal poderá ter filhos Rh positivo, que terão suas hemácias lisadas por anticorpos anti-Rh produzidos durante a gravidez da mãe. IV - Se for considerado apenas o sistema Rh, o pai poderá doar sangue a qualquer um de seus filhos. São corretas, apenas, as afirmações a) II e IV b) I, II e IV c) II, III e IV d) I, II e III. e) I e III. Questão 728 Em um acidente de carro, três jovens sofreram graves ferimentos e foram levados a um hospital, onde foi constatada a necessidade de transfusão de sangue devido a forte hemorragia nos três acidentados. O hospital possuía em seu estoque 1 litro de sangue do tipo AB, 4 litros do tipo B, 6 litros do tipo A e 10 litros do tipo O. Ao se fazer a tipagem sangüínea dos jovens, verificou-se que o sangue de Carlos era do tipo O, o de Roberto do tipo AB e o de Marcos do tipo A. Considerando apenas o sistema ABO, os jovens para os quais havia maior e menor disponibilidade de sangue em estoque eram, respectivamente, a) Carlos e Marcos. b) Marcos e Roberto. c) Marcos e Carlos. d) Roberto e Carlos. e) Roberto e Marcos. Questão 729 Considerando o casamento entre um homem tipo sangüíneo A®, cujo pai era O−, com uma mulher B® cuja mãe era A−, assinale a(s) alternativa(s) correta(s). (01) A probabilidade de nascer 1 filha mulher B® é 3/16. (02) A probabilidade de nascer 1 filho homem O− é nula. (04) A probabilidade de nascer 1 filho homem e 1 filha mulher AB é 9/1024.
164

1.5.3.1

(08) A probabilidade de nascer filho homem AB− é 1/16. (16) A probabilidade de nascer 1 filho homem A® é 1/8. (32) A probabilidade de nascer 2 filhas mulheres A− é 1/1024. Questão 730 Uma mulher Rh− casou-se e teve um filho. Numa segunda gestação a criança apresentou um quadro de eritroblastose fetal. Com estes dados, indique qual a opção que apresenta o fenótipo para o fator Rh da mãe, do pai e da criança, respectivamente. a) Mãe Rh negativo, Pai Rh positivo e Criança Rh positivo. b) Mãe Rh positivo, Pai Rh positivo e Criança Rh negativo. c) Mãe Rh positiva, Pai Rh negativo e Criança Rh negativa. d) Mãe Rh positivo, Pai Rh negativo e Criança Rh positivo. e) Mãe Rh negativo, Pai Rh positivo e Criança Rh negativo. Questão 731 A observação do esquema a seguir, que representa a genealogia de uma família em relação aos grupos sanguíneos MN, nos permite afirmar que:

a) Rh positivo e Rh negativo. b) Rh negativo e Rh positivo. c) Rh positivo e Rh positivo. d) Rh negativo e Rh negativo. e) Rh positivo e Rh neutro. Questão 733 A doença hemolítica do recém-nascido é um problema causado pela incompatibilidade sangüínea entre mãe e feto. Assinale a alternativa que contém a família na qual é possível a ocorrência da citada doença. a) Mãe: Pai: 1Ž bebê: 2Ž bebê: b) Mãe: Pai: 1Ž bebê: 2Ž bebê: c) Mãe: Pai: 1Ž bebê: 2Ž bebê: IÞi Ißi IÞIß Ißi IÞIÞ IßIß IÞIß IÞIß ii ii ii ii rh Rh Rh Rh rh rh rh rh

Rh rh rh rh Rh rh rh rh rh rh rh rh Rh Rh Rh Rh rh Rh rh rh rh rh rh rh rh rh rh rh rh rh rh rh

1.5.3.2

d) Mãe: ii Pai: Ißi 1Ž bebê: Ißi 2Ž bebê: ii e) Mãe: IÞi Pai: ii 1Ž bebê: IÞi 2Ž bebê: ii Questão 734

a) sangue MN é característica determinada por gene dominante. b) os indivíduos 4 e 5 são heterozigotos. c) o casal 3 e 4 poderá ter filhos dos três tipos de grupos sanguíneos. d) se o indivíduo 5 casar-se com uma mulher de sangue N, todos os filhos serão heterozigotos. e) um próximo filho do casal 6 e 7 poderá ser do grupo N. Questão 732 Quanto ao surgimento da eritroblastose fetal, ou doença hemolítica do recém-nascido, podemos afirmar que ela ocorre quando o pai e a mãe respectivamente apresentam:

Paula, portadora do aglutinogênio B e Rh negativo casou-se com João, portador dos aglutinogênios A e B e Rh positivo. Sabendo-se que a mãe de Paula não possui aglutinogênios e que João teve um irmão com doença hemolítica do recém nascido, conclui-se que a probabilidade de o casal ter um filho Rh positivo e sangue tipo A é: a) 9/16
165

Fazendo um exame pré-natal e relatando esse fato ao médico.5. tanto da mãe quanto do pai.2 onsidere as seguintes afirmações: I . pois não existe influência do fator Rh positivo ou negativo nos casos de Eritroblastose fetal. Quais dos quatro irmãos podem vir a ter filhos com eritroblastose fetal? a) Marina e Pedro. b) Lúcia e João. Carlos. d) bastante preocupado. apenas solicitando ao casal que o procurasse no momento da segunda gestação. disse que esse procedimento não seria mais necessário. d) Pedro e João. II . e) se somente II e III estiverem corretas. pois todos os filhos desse casal serão abortados. b) é correta. logo após o parto.indica reação negativa. que é receptor universal e teve eritroblastose fetal. casou-se com Elaine. c) a mãe pode pertencer ao tipo sangüíneo O. bem como todos os filhos Rh− não serão atingidos pela doença e esta só atinge uma pequena fração de casos em outras gestações de filhos Rh®.b) 3/16 c) 1/4 d) 1/8 e) 1/2 Questão 735 Lúcia e João são do tipo sangüíneo Rh positivo e seus irmãos. Então é INCORRETO afirmar que: a) a mãe é certamente Rh−. recomendando que. e) João e Marina. Questão 736 A afirmação que uma mulher Rh− não deve casar-se com um homem Rh®: a) é correta. O sinal + indica reação positiva e o sinal . Assinale: a) se somente III estiver correta. são do tipo Rh negativo. d) se somente I e III estiverem corretas. pois o primeiro filho em geral não tem a anemia. Numa segunda gravidez.Em caso de transfusão sangüínea. 1. a mãe recebesse soro anti-Rh. pois todos os filhos desse casal terão uma doença grave fetal caracterizada por uma anemia profunda (Eritroblastose fetal). e) é incorreta. b) se somente II estiver correta. o mesmo ficou: a) despreocupado e não fez qualquer recomendação relativa ao fato. b) o pai possui genótipo IÞIß. c) preocupado. a criança poderá receber sangue. mesmo sendo Rh®. c) se somente I estiver correta. que tem Rh® e é homozigoto.O genótipo do pai pode ser IÞIÞRR. entretanto. pois filhos Rh®. Questão 739 Indivíduos sem antígeno Rh nas hemácias são considerados recessivos. Pedro e Marina. não serão atingidos pela Eritroblastose fetal. b) despreocupado. e) a mãe pode ter genótipo IÞi. d) é incorreta. III . c) Lúcia e Marina. inclusive pela informação de 166 . Questão 737 Uma criança tem genótipo igual ao pai. mesmo no caso de glóbulos vermelhos atingirem a circulação materna em sucessivas gestações. c) é incorreta. Questão 738 O quadro abaixo mostra os resultados das tipagens ABO e Rh de um casal e de seu filho. que tem Rh−.3. Ambos possuem o mesmo grupo sangüíneo. d) essa criança é certamente heterozigota para o fator Rh.Essa mulher poderá dar à luz uma criança com eritroblastose fetal. não fez qualquer recomendação.

após cada parto. Qual das alternativas abaixo indica o tipo sangüíneo de uma criança que NÃO poderia ter sido gerada por este casal? a) A / Rh® / NN b) A / Rh− / MN c) AB / Rh− / MN d) O / Rh® / MN e) O / Rh− / MN Questão 743 Uma mulher Rh®. positivo. a DHR poderia ser evitada. PAI .2 a) A placenta normalmente funciona como uma barreira que separa as células sangüíneas fetais e maternas. é casada com um homem Rh®.Rh− c) MÃE.Rh−. b) negativo. após o contato com o antígeno Rh®. PAI .Rh®. é: a) 1 b) 1/2 c) 1/3 d) 1/4 e) 1/8 Questão 741 Interpretando a figura a seguir sobre a Doença Hemolítica do recém-nascido (DHR). a mãe receba o soro anti-Rh. 167 .Rh−. CRIANÇA . com ocorrência de eritroblastose fetal. negativo. positivo. dizendo ao casal que a gravidez era de altíssimo risco e eles não poderiam mais ter outro filho.5.Rh−. cujo pai é Rh−. recomendando bastante atenção em cada gravidez. positivo.Rh®.Rh− e) MÃE.compatibilidade de grupo sangüíneo. assinale a afirmativa INCORRETA. podemos dizer que seu fator Rh.Rh®. CRIANÇA .Rh® d) MÃE. d) positivo. e) bastante preocupado. d) Se. Questão 740 Um casal possui o seguinte genótipo para o fator Rh: Pai = Rr. negativo. Considerando apenas o fator Rh. PAI . c) negativo. c) Em III. os antígenos fetais não serão capazes de induzir a produção de anticorpos anti-Rh pela mãe. CRIANÇA .Rh® 1. b) Após a 1 gravidez. a) MÃE. PAI . logo após o parto da 1 gravidez. CRIANÇA . negativo. Se uma mulher foi orientada a usar a vacina anti-Rh logo após o nascimento do primeiro filho. CRIANÇA . a probabilidade de esse casal vir a ter um filho do sexo masculino. cuja mãe é Rh−. e) positivo. Assinale a alternativa do quadro abaixo que identifica corretamente os grupos sangüíneos dessa família. negativo. Mãe = rr.3. positivo. a mãe produz anticorpos anti-Rh que podem ser transferidos para a corrente sangüínea fetal. Questão 745 A incompatibilidade materno-fetal ao antígeno Rh pode determinar um doença denominada Eritroblastose Fetal. A probabilidade desse casal vir a ter uma criança Rh− é de a) 100% b) 75% c) 50% d) 25% e) 0% Questão 744 Um casal teve uma criança com eritroblastose fetal.Rh−. Questão 742 Uma mulher com sangue do tipo A / Rh® / MM é casada com um homem com tipo sangüíneo B / Rh® / NN.Rh® b) MÃE. o do seu marido e o da criança são. de maneira que. respectivamente: a) negativo. PAI . negativo. positivo.Rh®.Rh−. a mãe recebesse anticorpos anti-Rh.Rh−.

exclusivamente: a) quando a mãe é Rh® e o filho Rh−. todos os filhos serão d) heterozigoto. nenhum dos filhos será e) homozigoto.. analise os genótipos descritos. no quadro apresentado. 1... o feto apresentou o quadro de hemólise de hemácias. b) em X.. o qual não teve eritroblastose fetal.. Questão 749 Assinale a alternativa que completa corretamente as lacunas no texto a seguir...3. uma mãe abortou três vezes.. homozigota recessiva e seu marido é Rh®.. o qual não teve eritroblastose fetal.. Questão 747 No segundo parto de uma mulher. o filho é Rh−. Esta condição é provocada por incompatibilidade sangüínea do fator Rh. todos os filhos serão c) homozigoto. .... e teve seu primeiro filho sem qualquer anormalidade. respectivamente. do primeiro filho e do segundo filho.2 ela observação dos gráficos e considerando que essa mulher teve um filho em cada gestação e nunca recebeu transfusão de sangue. a mãe foi sensibilizada com o sangue Rh+ do 2Ž filho.. A mãe reconhecerá os glóbulos vermelhos do embrião como estranhos e produzirá anticorpos anti-Rh..... sendo observado.5. metade dos filhos será Questão 750 Após uma primeira gravidez bem sucedida.. a mãe foi sensibilizada com o fator Rh.. b) Os abortados certamente eram Rh negativo. c) em Y. b) quando a mãe é Rh− e o filho Rh®. a) em X.3. d) em Y. Em relação à patologia observada nesta família.. Isto só acontecerá quando houver passagem do sangue do embrião para a circulação materna.Questão 746 A eritroblastose fetal é uma doença hemolítica adquirida apresentada por alguns recém-nascidos.. o qual teve eritroblastose fetal. nenhum dos filhos será b) heterozigoto. Seu caso foi diagnosticado... a mãe transferiu anticorpos anti-Rh para o 1Ž filho Rh-.do 1Ž filho.. esse conhecido por doença hemolítica do recém-nascido (DHRN) ou eritroblastose fetal. em consulta médica. Uma mulher é do tipo sangüíneo Rh−.. icterícia e aumento do baço e fígado.. c) Este casal jamais poderá ter outros filhos. assinale a alternativa CORRETA: a) A mãe é Rh positivo. é correto concluir que. Se ele for . a) homozigoto. e assinale abaixo a alternativa que indica.. os genótipos da mãe. .5. 168 1. c) quando a mãe é Rh− e o pai Rh®. como eritroblastose fetal. d) quando a mãe é Rh® e o pai Rh−... e) independente do Rh materno. o qual teve eritroblastose fetal... além da anemia. Considerando o fato de que essa mulher não foi submetida à transfusão de sangue em toda a sua vida anterior.. Rh®.2 Questão 748 Os dois gráficos a seguir representam as quantidades de anticorpos anti-Rh presentes no sangue de uma mulher (Rh-) em gestações distintas. a mãe transferiu anticorpos anti-Rh para o 2Ž filho Rh+.

por acidente. 8 litros B e 2 litros O. visto que a doença hemolítica do recém-nascido só ocorre quando a mãe é Rh− e o pai Rh®. o livro onde estavam registrados os códigos foi perdido. Para que os frascos contendo sangue fossem identificados. b) mínima. e) alta. visto que seu pai é Rh−. B e AB estão disponíveis. as etiquetas que identificavam os tipos sangüíneos estavam em código. pois a "mãe de aluguel" é Rh®. e) O pai é Rh positivo.5. será Rh®. 5 e 8 litros.3 Questão 754 Observe o diagrama geral das possíveis trocas sangüíneas por doação e recepção no sistema "ABO": 1. 8. casa-se com um homem Rh−.3 (s) seta(s) cujo sentido (doação ë recepção) está(ão) errado(s) é(são): a) 4 e 5 b) 2 c) 1 d) 3 Questão 755 Em um banco de sangue de um hospital. e o resultado foi o seguinte: 169 . 5.3. com absoluta certeza. Questão 752 Um banco de sangue possui 5 litros de sangue tipo AB. A. o casal decide ter um "bebê de proveta" e contrata uma "mãe de aluguel" para receber em seu útero o zigoto formado por aquele casal. visto que sua mãe genética é Rh®. 8 e 16 litros. 5. b) 2.3. e) 2. 3 litros de tipo A.d) A criança é Rh negativo. Impedida de ter filhos. 10 e 18 litros. 3. d) 2. e. O que o casal não sabia é que a "mãe de aluguel" tivera três filhos. Rh® homozigota. sendo que o último apresentara a doença hemolítica do recém-nascido. respectivamente: a) 2. c) alta. d) nula. Questão 751 Uma mulher com útero infantil.5. 18 e 10 litros. já que o "bebê de proveta". A probabilidade de o "bebê de proveta" nascer com a doença hemolítica do recém-nascido é: a) mínima. Questão 753 Assinale a alternativa que esquematiza as transfusões que podem ser feitas entre indivíduos com diferentes grupos sanguíneos do sistema ABO (as setas indicam o sentido das transfusões). foram feitos testes com amostras correspondentes a cada código. Para transfusões em indivíduos O. 13 e 5 litros. c) 18. 1. 3.

o sangue do receptor não possui anticorpos contra eles. pois os anticorpos anti-B presentes no sangue do receptor podem reagir com os antígenos B presentes nas hemácias AB. e) 21 litros. d) 13 litros. do total acima mencionado: a) 4 litros. porque A é receptor universal. verificou-se a presença de anticorpos anti-A e ausência de anti-B. Questão 759 Um homem sofreu um acidente e precisou de transfusão sangüínea. Se houver A transfusão de sangue do tipo B para uma pessoa do grupo A. Rh®. c) pode ser realizada sem problema. pois os anticorpos anti-A presentes no sangue do receptor podem reagir com os antígenos A presentes nas hemácias AB. No banco de sangue do hospital. III e IV. Esse homem pode receber sangue: a) apenas da bolsa 1. d) não deve ser realizada. d) nenhuma reação. sendo que o sangue da bolsa 1 apresentava todos os tipos de antígenos do sistema ABO. 1 litro de sangue tipo B e 9 litros de sangue tipo O. Questão 758 aseados nesse teste. podemos afirmar que a) existem 105 litros de sangue disponíveis para um receptor AB Rh® b) existem 135 litros de sangue disponíveis para um receptor AB Rh− c) existem 105 litros de sangue disponíveis para um receptor A Rh® d) existem 135 litros de sangue disponíveis para um receptor O Rh® e) existem 25 litros de sangue disponíveis para um receptor O Rh− Questão 756 A transfusão de sangue tipo AB para uma pessoa com sangue tipo B a) pode ser realizada sem problema. I. c) da bolsa 2 ou da bolsa 3. b) apenas da bolsa 3. estarão disponíveis para ele. b) reação dos antígenos B do receptor com os anticorpos anti-B do doador. e) não deve ser realizada. A. c) formação de anticorpos anti-A e anti-B pelo receptor. Questão 760 O soro sangüíneo de um indivíduo do grupo O foi colocado em quatro tubos de ensaio. apesar de as hemácias AB apresentarem antígeno A e antígeno B. Questão 757 Um determinado banco de sangue possui 4 litros de sangue tipo AB. separada e respectivamente. todos Rh®. e) reação de anticorpos anti-B do doador com antígenos A do receptor. 7 litros de sangue tipo A. o sangue da bolsa 2 possuía anticorpos anti-A e anti-B e a bolsa 3 possuía sangue com antígenos somente do tipo B. porque as hemácias AB não possuem antígenos que possam interagir com anticorpos anti-B presentes no sangue do receptor. c) 12 litros. e) apenas da bolsa 2. b) pode ser realizada sem problema. II. a opção que corresponde à condição de aglutinação (+) ou não aglutinação (-) de hemácias resultante de reação antígeno-anticorpo: 170 .3 necessidade de transfusões sanguíneas para um indivíduo com sangue tipo AB. Analisado o seu sangue. B e O. Marque.5. porque.3. havia três bolsas disponíveis. na alternativa a seguir. b) 8 litros. aos quais foram adicionadas. d) da bolsa 1 ou da bolsa 2. hemácias de indivíduos dos grupos sangüíneos AB. resultaria em a) reação de anticorpos anti-B do receptor com os glóbulos vermelhos do doador.1. porque as hemácias AB não possuem antígenos que possam interagir com anticorpos anti-A presentes no sangue do receptor.

5. b) Tubo I (-). Tubo II (+). anti-Rh.3. conclui-se que são classificados. Os resultados obtidos encontram-se no quadro seguinte. respectivamente. Foram obtidas reações com a aplicação dos reagentes anti-A. para a determinação da tipagem sangüínea dos sistemas ABO e Rh.4 bservação: o sinal + significa aglutinação de hemácias. misturadas aos soros anti-A e anti-B. Questão 761 Num laboratório foram realizados. Tubo II (-). Os resultados obtidos foram: 1.3. Tubo III (+) e Tubo IV (-). Foi realizada a determinação de grupos sangüíneos do sistema ABO dos quatro indivíduos. Sabe-se que ele pertence ao grupo sangüíneo A e que.significa ausência de aglutinação. como receptor e doador universal: a) 4 e 2 b) 4 e 3 c) 1 e 5 d) 2 e 4 e) 5 e 1 Questão 762 Em um hospital há um homem necessitando de uma transfusão de emergência. há quatro indivíduos que se ofereceram para doar sangue. colocadas em uma lâmina.3.5. exames de sangue para a determinação da tipagem sangüínea dos Sistemas ABO e Rh.a) Tubo I (-). no hospital. Tubo III (+) e Tubo IV (-). Tubo III (-) e Tubo IV (+). d) Tubo I (+). Tubo III (-) e Tubo IV (+). anti-B.5.4 om base no quadro. Os resultados são apresentados a seguir: Um laboratorista realizou exames de sangue em cinco indivíduos e analisou as reações obtidas com os reagentes anti-A. Tubo II (+). os indivíduos: a) I e II b) I e III c) II e III d) II e IV e) III e IV Questão 763 1. em cinco indivíduos. 1. o sinal . anti-B e anti-Rh.4 171 . que. e) Tubo I (-). em seguida. poderão doar sangue ao referido homem. Tubo II (-). Tubo III (-) e Tubo IV (+). A partir dos resultados observados. Tubo II (+). c) Tubo I (+). foram. com a utilização de duas gotas de sangue de cada um deles.

Após analisar a tabela. e) DDEE. Rh® e) AB. Rh−/ B. c) Ddee. No processo ali representado. Rh®/ O. Um homem surdo. b) poligens. b) 4 e 3. Tiveram 9 filhos. d) DDee. a) 5 e 2. c) 3 e 4. A presença de ambos simultaneamente produz flor púrpura.5. Os genótipos das plantas cruzadas são. Rh® c) AB. Questão 766 A surdez pode ser uma doença hereditária ou adquirida. Questão 764 A tabela a seguir foi elaborada a partir de testes para determinação dos grupos sangüíneos de seis pessoas de uma academia de ginástica. c) norma de reação. todos de audição normal. d) 2 e 5. Rh−/ A.3. Rh−/ O. Rh®/ A.Rh− b) O. Rh−/ A. Rh®/ AB. Quando hereditária. d) interação gênica. podemos concluir que o genótipo dos filhos é: a) ddEE. Rh®/ B. Rh−/ A. respectivamente: a) CCpp x ccPP b) CCpp x ccPp c) Ccpp x ccPP d) Ccpp x ccPp 172 1. mantendo a seqüência disposta na tabela. O sinal positivo (+) significa "aglutina" e o sinal negativo (-) significa "não aglutina". simultaneamente. A presença do gene C ou P ou ausência de ambos produz flor branca. Rh−/ B. Questão 767 Na ervilha-de-cheiro existem dois pares de genes que condicionam a cor da flor (Cc e Pp). Rh®/ AB.Rh®/ A. indique quais os indivíduos que serão considerados. Rh−/ B.4 a) O. e) 1 e 4. . b) DdEe. Rh−/ O. e) alelos múltiplos. Rh®/ B. A audição normal depende da presença de pelo menos dois genes dominantes diferentes (D) e (E). está ocorrendo a ação conjunta de dois gens.Rh®/ O. casou-se com uma surda. 1. assinale a alternativa que indica os grupos sangüíneos de todas as pessoas quanto aos sistemas ABO e Rh. Rh®/ B. Rh−/ AB. Rh®/ A. Rh®/ A.1 ituações como essa são conhecidas como: a) polialelia. Rh®/ O.Com base nesses resultados. na proporção de 3 brancas: 1 colorida.5. receptor e doador universal. Rh−/ AB. (d) ou (e). respectivamente. Rh−/ B. Rh− d) AB. obtém-se em F plantas produtoras de flores coloridas. depende da homozigose de apenas um dos dois genes recessivos. Rh® Questão 765 O esquema a seguir evidencia que a formação de melanina não depende apenas da ação de um gen. Assim. Cruzando-se duas plantas de flores brancas. Rh−/AB. Rh−/ A.4.

d) 3/16. respectivamente. o fenômeno da interação gênica consiste no fato de: a) uma característica provocada pelo ambiente. e) dois cromossomos se unirem para formar um gameta. o indivíduo é albino. c) 1/5. d) dois pares de genes estarem no mesmo par de cromossomos homólogos.e. b) vários pares de genes não alelos influenciarem na determinação de uma mesma característica. imitar uma característica genética. na espécie humana. Questão 769 Em genética. obtiveram-se 3 plantas de folhas vermelhas para 5 plantas de flores brancas na geração F. Os genótipos das plantas com flores vermelhas e brancas da geração parental são. a) AABB e AaBb b) AaBb e Aabb c) AABb e aabb d) aaBb e Aabb e) aabb e aabb Questão 771 1. são muito sensíveis à luz solar. 1. Nesse caso. a pigmentação da pele seja devida a dois pares de genes autossômicos com efeito aditivo. e) 3/64. A probabilidade de nascer uma criança branca não albina é de: a) 1/16. está representada parte da via biossintética para a produção desse pigmento: 173 . como a surdez hereditária. Cruzando-se plantas de flores vermelhas com plantas de flores brancas. por isso. ocorrem flores vermelhas somente se a planta possuir os alelos dominantes A e B.5. b) 1/2. Neste esquema. como surdez por infecção.1 odas as alternativas contêm genótipos possíveis para os porquinhos vermelhos de F2. EXCETO a) AABB b) AaBB c) Aabb d) AaBb e) AABb Questão 772 Os indivíduos albinos não possuem melanina . A tabela abaixo indica os fenótipos existentes.e) CcPp x CcPp Questão 768 Suponha que.1 expressão desses genes pode ser impedida pela presença de um par de genes autossômicos recessivos.5. Um casal de mulatos médios diíbridos tem uma criança albina.4. c) um único gene ter efeito simultâneo sobre várias características do organismo. Questão 770 Em determinada espécie vegetal.pigmento responsável pela cor e proteção da pele . Observe a figura.4.

Questão 775 1. O cruzamento de um macho dourado com uma fêmea marrom produziu descendentes pretos. d) codominância. respectivamente. se forem homozigóticos bb. cada um com dois alelos (B/b e E/e). analise as proposições com verdadeiro ou falso. e) ee Bb. é INCORRETO afirmar que a) a ausência da Enzima 1 resulta em um aumento da concentração de tirosina.1 om base nesse esquema e em outros conhecimentos sobre o assunto. marrons e dourados. d) indivíduos AABB formam gametas do tipo AA e BB. d) ee BB. ( ) Cinco distintas classes genotípicas são observadas entre os descendentes surdos citados. foi observado que a distribuição fenotípica para normais e surdos obedecia a uma proporção de 9:7. ( ) Interação gênica entre dois locos justificam esses dados. b) Ee Bb.5. é de aproximadamente de 0.56.4. se tiverem pelo menos um alelo dominante B. c) pleiotropia. c) diferentes genótipos podem dar origem ao albinismo. a cor da plumagem é determinada por 2 pares de genes. dois genes.1. enquanto seu alelo i não interfere nessa expressão. ( ) A probabilidade do nascimento de uma criança normal para a audição. ( ) A surdez congênita é determinada por alelos múltiplos em um loco autossômico. cujos progenitores eram surdos.5. conclui-se que se trata de um caso de: a) epistasia recessiva. 174 . ( ) Na determinação da característica analisada atuam locos gênicos ligados que distam entre si em 16 unidades de mapa. ou marrons. como ilustrado no quadro a seguir. Questão 774 Em cães labradores. Os cães portadores de pelo menos um alelo dominante E serão pretos. O gene C condiciona plumagem colorida enquanto seu alelo c determina plumagem branca. b) casamentos entre indivíduos albinos podem gerar descendentes com melanina. b) herança quantitativa. condicionam as três pelagens típicas da raça: preta.4. O gene I impede a expressão do gene C. a partir de um casal genotipicamente igual ao mostrado na F1. e) epistasia dominante. marrom e dourada. com relação à surdez congênita na descendência de pais normais para a audição.1 Em galinhas. Questão 773 Em uma exaustiva análise de genealogias humanas. c) ee bb. O genótipo do macho é a) Ee BB. A pelagem dourada é condicionada pela presença do alelo recessivo e em homozigose no genótipo. Com esses dados. Considerando esses dados.

Trata-se de um caso de interação gênica do tipo epistasia recessiva.4. b) Os duplos heterozigotos apresentam flores coloridas. d) A fecundação cruzada das plantas com flores brancas de F‚ produzirá sempre o mesmo fenótipo.4.2 1.Questão 776 Nos camundongos. b) III. II e III. A figura a seguir mostra as reações bioquímicas envolvidas na síntese de pigmentos. somente. preta ou albina. e) I. somente.5. O caráter em estudo é a cor das flores. Pode-se considerar correto o que é afirmado em a) I. os descendentes são todos aguti.5. III . Questão 778 Em cães da raça Labrador Retriever. somente.5.2 175 . 1.4. é correto afirmar. d) II e III. somente. a cor da pelagem é determinada por um tipo de interação gênica epistática de acordo com o esquema a seguir. c) I e II.2 om base nos resultados. 1.A formação de qualquer pigmento no pêlo depende da presença do alelo P. Questão 777 O esquema abaixo representa o cruzamento artificial (em P) de duas variedades puras de um determinado vegetal. c) Os indivíduos de F.Quando animais pretos homozigóticos são cruzados com certos albinos também homozigóticos. a pelagem pode ser aguti. EXCETO: a) Trata-se de um caráter determinado por interação gênica. que se reproduz por autopolinização (em F). om base na figura foram feitas as seguintes afirmações: I . II . produzem quatro tipos de gametas para o caráter em estudo.

apresenta o alelo B. Homozigotos bb não têm a manifestação da cor do bulbo impedida. espera-se que 25% dos descendentes apresentem pelagem chocolate. que inibe a formação de pigmentos dando origem a indivíduos albinos. não-alelo. III e IV apenas. No cruzamento da fêmea parental com qualquer cão de pelagem preta. enquanto os pais são homozigotos para os dois pares de genes. com segregação independente. Outro gene. complementando seus efeitos e produzindo um fenótipo igual aos fenótipos produzidos por cada gene isoladamente. Aa e Cc. O gene C determina a produção de pigmentos e é dominante sobre seu alelo c. herdado de forma independente. Quais as proporções fenotípicas esperadas do cruzamento de cebolas homozigotas coloridas com BBcc? a) 9/16 de cebolas brancas e 7/16 de cebolas coloridas. (04) Ocorre poligenia quando um gene tem efeito simultâneo sobre várias características do organismo. No cruzamento da fêmea amarela com um de seus filhotes de F1. o alelo dominante A determina cor vermelha e o recessivo a. Questão 779 Em camundongos. b) II. em cebolas cc. Do cruzamento de um camundongo preto com um albino. que impede a manifestação de gene C. IV. II e III apenas. III e IV. 176 . III e IV apenas. c) 13/16 de cebolas brancas e 3/16 de cebolas coloridas. São afirmações CORRETAS: a) I. No cruzamento entre os filhotes de F1. foram obtidos apenas descendentes agutis. (01) Ocorre poligenia quando dois genes não-alelos colaboram na mesma característica. (02) Dois genes não-alelos colaboram na mesma característica. d) I. um criador fez as seguintes afirmações: I. ao invés de determinar uma característica. Questão 782 Na cebola. não se espera a produção de descendentes com fenótipo chocolate. e) 16/16 de cebolas brancas. a presença de um alelo dominante C determina a produção de bulbo pigmentado. Qual é o genótipo desse casal? a) aaCC x aacc b) Aacc x aaCc c) aaCc x AAcc d) AaCc x AaCc e) aaCC x AAcc Questão 780 Em cebolas. d) 15/16 de cebolas brancas e 1/16 de cebolas coloridas. a coloração da pelagem é determinada por dois pares de genes. cor amarela.Sabendo que o cruzamento (geração Parental) entre um macho com fenótipo chocolate e uma fêmea de fenótipo amarela gera apenas filhotes com pelagem preta (geração F1). (16) Durante o desenvolvimento do organismo. espera-se que 50% dos descendentes apresentem pelagem amarela. b) 12/16 de cebolas brancas e 4/16 de cebolas coloridas. Uma proporção de 2 incolores: 1 vermelho: 1 amarelo é esperada entre os descendentes do cruzamento a) IIAA x IiAa b) IiAA x iiAa c) IIaa x ii aa d) IiAa x IiAa e) IiAa x iiaa Questão 781 Sobre interação gênica. dois pares de genes que apresentam segregação independente participam na determinação da cor do bulbo: o alelo dominante I impede a manifestação de cor e o recessivo i permite a expressão. Todos os filhotes produzidos nesse cruzamento são heterozigotos. vários pares de genes não-alelos influem na determinação de uma característica. III. O gene A determina coloração aguti e é dominante sobre seu alelo a. completando seus efeitos. assinale o que for correto. II. impede a manifestação de outro gene. que condiciona coloração preta. c) I. II. (08) Ocorre epistasia quando um gene. a enzima que catalisa a formação de pigmento não é produzida (cebolas brancas).

(1) Na produção de melanina a partir de fenilalanina. julgue os itens seguintes. Em ratos.Questão 783 A cor da pelagem em cavalos depende. AaBBe aabb. Considerando os descendentes do cruzamento de dois ratos. um segundo lócus afeta uma etapa inicial na formação dos pigmentos dos pêlos.5.2 1. Essas transformações são catalisadas por diferentes enzimas. respectivamente: a) XY e XX b) YO e XX c) XO e XX d) XY e XO e) XO e XY 177 . ambos com genótipo AaBb. Questão 786 Em uma espécie animal. o alelo dominante B determina cor de pêlo acinzentada. (3) Um casal de indivíduos albinos pode ter filhos com pigmentação normal. os filhotes de cor preta poderão apresentar genótipos: a) Aabbe AAbb. fazendo com que o pêlo fique branco. em que o macho e a fêmea são. enquanto o genótipo homozigoto bb define cor preta. O esquema abaixo representa alguns passos da síntese de melanina. atuam três mRNAs. e) aaBB. d) AABBe Aabb. nessa espécie. Cruzando-se indivíduos heterozigotos para os dois pares de genes obtém-se: a) 3 brancos: 1 preto b) 9 brancos: 3 pretos: 3 mesclados de marrom e preto: 1 branco c) 1 preto: 2 brancos: 1 marrom d) 12 brancos: 3 pretos: 1 marrom e) 3 pretos: 1 branco Questão 784 As diversas substâncias ingeridas pelo homem são transformadas em outras. durante os processos metabólicos. (4) O gene B é epistático sobre o gene C. O gene dominante W "inibe" a manifestação da cor. enquanto que o alelo recessivo w permite a manifestação da cor. c) AAbbe aabb. dentre outros fatores. Questão 785 Epistasia é o fenômeno em que um gene (chamado epistático) inibe a ação de outro que não é seu alelo (chamado hipostático). da ação de dois pares de genes Bb e Ww. análise desses cariótipos revela que. O alelo dominante A nesse lócus possibilita o desenvolvimento normal da cor (como definido pelos genótipos B_ ou bb). o cariótipo de células somáticas de machos e fêmeas se apresenta como mostram os desenhos a seguir: 1. cujo 2n = 6.5.4.5.1 Com base no esquema e sabendo que indivíduos incapazes de sintetizar a melanina são albinos. Em outro cromossomo. b) Aabbe aabb. (2) Indivíduos albinos podem apresentar homozigose recessiva bb e cc. mas o genótipo aa bloqueia toda a produção de pigmentos e o rato torna-se albino. O gene B determina pêlos pretos e o seu alelo b determina pêlos marrons. a determinação do sexo é feita por um sistema.

teremos: a) sexo masculino. têm um olho azul e outro castanho. c) Algumas mulheres. contudo um deles era menino e o outro menina. têm manchas brancas e pretas. Questão 790 O esquema a seguir mostra a formação dos gametas responsáveis pela produção de um indivíduo com alteração do seu número cromossomial.5. simultaneamente. heterozigotas para os grupos sangüíneos. pois em algumas estão ativos os genes provenientes do cromossomo X materno e em outras do cromossomo X paterno. c) um cromossomo sexual. simultaneamente. Logo. d) A hipertricose auricular é uma característica restrita ao sexo masculino. e nos blastômeros iniciais do desenvolvimento embrionário. são loiras e castanhas. b) Algumas mulheres. heterozigotas para a cor da pele. pois o gene está localizado no cromossomo Y. d) ausência de cromatina sexual. Tal fato deve-se à perda de a) um cromossomo X na gametogênese da mãe das crianças. independentemente dos genes que possuem. a hipótese de que fêmeas de mamíferos compensariam a dose dupla de genes do cromossomo X através da inativação de um desses cromossomos. Assim. têm visão normal em um dos olhos e daltonismo no outro. c) cariótipo normal. heterozigotas para a cor dos olhos. Mulheres heterozigotas para os genes ligados aos cromossomos X expressam o alelo dominante em algumas células e o alelo recessivo em outras. c) na mulher um cromossomo X está sempre condensado e recebe o nome de cromatina sexual. d) Algumas mulheres. e) estatura elevada. heterozigotas para a cor do cabelo. X ou Y. e) Algumas mulheres. b) O sexo feminino é homogamético e o gameta feminino normal sempre apresenta um cromossomo X. e) Toda doença hereditária e recessiva ligada ao cromossomo X só afeta as mulheres. a) Algumas mulheres. as células femininas ficariam iguais às masculinas. são tipo A e B simultaneamente.1 ntre as características que esse indivíduo passará a apresentar. porém a menina era portadora da síndrome de Turner. b) um cromossomo Y na gametogênese do pai das crianças. as mulheres apresentam células geneticamente diferentes entre si. na gametogênese do pai ou da mãe das crianças. 1.Questão 787 Na espécie humana a determinação sexual é feita por um par de cromossomos. A análise cromossômica dos gêmeos indicou que o menino era normal. Questão 788 Leia o texto a seguir referente à Hipótese de Lyon. que possuem apenas uma cópia funcional dos genes ligados ao cromossomo X." Assinale a alternativa que confirma o texto anterior. b) caracteres sexuais desenvolvidos. A inativação do cromossomo X ocorre ao acaso. em 1961.5. X e Y. Com base neste texto é INCORRETO afirmar: a) O sexo masculino é heterogamético e é sempre o homem quem determina o sexo dos filhos. heterozigotas para o daltonismo (XD Xd). 178 . O indivíduo do sexo feminino apresenta dois cromossomos X enquanto que o indivíduo de sexo masculino apresenta um cromossomo X e outro cromossomo Y. Questão 789 O médico confirmou que se tratava de gêmeos monozigóticos. "A pesquisadora inglesa Mary Lyon propôs. d) um cromossomo X quando da divisão mitótica do zigoto. e) um cromossomo Y quando da divisão mitótica do zigoto.

está(ão) correta(s) APENAS a) I b) II c) III d) I e III e) II e III Questão 794 Em galinhas. além de 2 cromossomos sexuais. Questão 793 Acerca da relação entre os cromossomos de um menino e os de seus avós. há descendentes de autossomos de seus avós. II. Considere os seguintes cruzamentos a partir dos quais obtiveram-se as gerações F e F‚: I. a cor das penas apresenta herança ligada ao sexo. F‚: galinha preta e) I . F‚: galinha barrada II . Dessas afirmações. F‚: galinha preta d) I .F: galinha preta. Entre seus autossomos.F: galinha barrada. F‚: galinha barrada b) I .Questão 791 A análise do cariótipo de exemplares de uma dada espécie revelou que o número diplóide é idêntico em ambos os sexos e que o sexo heterogamético é o feminino. d) Uma célula de carneiro que está na metáfase da mitose deve apresentar 54 cromossomos duplicados.F: galinha barrada. F‚: galinha preta II . F‚: galinha preta II .F: galinha preta. machos de penas pretas × fêmeas de penas barradas Assinale a alternativa que indica corretamente as gerações nas quais espera-se encontrar galinhas pretas.F: galinha barrada. a) I . F‚: galinha barrada II . geraram 4 embriões. III. Seu cromossomo Y é descendente do Y de seu avô paterno.F: galinha preta. penas pretas. 4 óvulos humanos. Seu cromossomo X é descendente de um X de sua avó paterna. b) Um linfócito de carneiro deve apresentar 54 cromossomos. e) Uma célula muscular de carneiro deve apresentar 54 autossomos. c) Um óvulo de ovelha deve apresentar 26 autossomos.F: galinha barrada. A partir desse dado.5.F: galinha preta.1 179 . Com base nesses dados. F‚: galinha preta Questão 795 Em uma experiência de fecundação "in vitro".5. quando incubados com 4 suspensões de espermatozóides. incluindo 2 cromossomos sexuais.F: galinha barrada. machos homozigóticos de penas barradas × fêmeas de penas pretas II. fizeram-se as seguintes afirmações: I. de acordo com a tabela abaixo. F‚: galinha barrada II . a) Um neurônio de carneiro deve apresentar 52 autossomos. assinale a alternativa INCORRETA com relação ao número de cromossomos encontrado em diversas células nessa espécie.F: galinha barrada. F‚: galinha preta c) I . é possível dizer que o sistema de determinação do sexo nessa espécie é do tipo a) XX : XY b) XX : XO c) XX : YO d) ZZ : ZW e) ZZ : ZO Questão 792 O carneiro ('Ovis aries') apresenta 27 cromossomos em seus gametas normais. todos igualmente viáveis. 1. O alelo dominante determina penas barradas e o recessivo.

Dentre as opções abaixo. o gráfico que indica as probabilidades de os 4 embriões serem do sexo masculino é o de número: a) 1 b) 2 c) 3 d) 4 Questão 796 Considere que um óvulo de abelha possui 5×10−¢¥ g de DNA. Analisando os dados do estudante. ( ) O corpúsculo de Barr ou cromatina sexual corresponde a um cromossomo X inativo. Questão 799 Alguns métodos em desenvolvimento poderão permitir aos pais a escolha do sexo de seus futuros filhos. Além disso. d) óvulos haplóides portando o cromossomo Y. ( ) A síndrome de Down é causada pela presença de um cromossomo X extra no cariótipo. os machos originam-se de óvulos não-fecundados. caso os pais desejem um filho do sexo feminino. o ovo fertilizado no útero da mãe. não observou a presença do cromossomo Y.0 × 10−¢¢ d) 5. d) um macho estéril. Dentre eles. embora as fêmeas se originem de reprodução sexuada. Questão 798 Um estudante. por partenogênese. 1. no período correspondente à prófase da mitose é. ( ) O indivíduo hermafrodita é formado por células XX e XY.5. Nesse inseto. podemos concluir que a mosca é a) uma fêmea normal.onsiderando a experiência descrita. c) espermatozóides derivados de espermátides portando o cromossomo X. são: a) espermatócitos secundários diplóides portando os cromossomos X e Y.5. b) oócitos primários diplóides portando os cromossomos Y. implantando.5 × 10−ª c) 5. A quantidade de DNA encontrada em uma célula somática de zangão. c) um macho normal. alguns se baseiam em executar a fecundação em tubo de ensaio. ( ) O genitor do sexo feminino determina o sexo dos descendentes. em mg. encontrou a proporção de 1X : 2A (onde a letra A simboliza o conjunto haplóide de autossomos). igual a: a) 1.0 × 10−¢¨ Questão 797 As afirmações a seguir relacionam-se à DETERMINAÇÃO CROMOSSÔMICA DO SEXO na espécie humana. Questão 800 Observe a figura.0 × 10−¢¡ b) 2. e) oogônias portando o cromossomo X e espermatogônias portando o cromossomo Y. os gametas que precisam ser necessariamente identificados e separados para uso no processo de fecundação. ao analisar os cromossomos de 'Drosophila'. e) um intersexuado.1 180 . ( ) O sexo heterogamético é o masculino. a seguir. b) uma fêmea aneuplóide.

a presença do cromossoma Y determina o fenótipo masculino. XY com deleção do gene SRY. b) a probabilidade de uma fêmea com mancha. c) os indivíduos trissômicos 47. Com base nessa figura pode-se afirmar que Questão 802 A identificação do fator que origina indivíduos com síndrome de Down tornou-se possível pela utilização da técnica de a) contagem e identificação dos cromossomos. induz à diferenciação dos testículos.ssa figura representa a herança do caráter mancha negra numa espécie de peixes em que a determinação do sexo segue o padrão mais comum nas aves.5. pode ser útil em condições de manejo de espécies em extinção. Questão 801 A figura a seguir se refere à determinação do sexo em algumas espécies de tartarugas e lagartos.5. XY que. Questão 804 A figura a seguir mostra esquematicamente o tipo de reprodução em abelhas do gênero 'Apis'. na idade adulta.5. O gene SRY. XYY apresentam dois testículos a mais. Com relação ao padrão de herança desse caráter. e) machos são produzidos em baixas temperaturas tanto para tartarugas quanto para lagartos. e) o sexo heterogamético nessa espécie de peixes é o masculino.5. ter descendentes machos sem mancha é de 50%. sofrem mutação nesse gene perdem as características sexuais. 1. presente nesse cromossoma. d) temperaturas maiores que 28°C produzem fêmeas tanto em tartarugas quanto em lagartos. c) mapeamento do genoma humano. d) produção de DNA recombinante. XXY possuem órgãos reprodutores masculinos e femininos. sob controle de temperatura. 1. em tartarugas. Considerando-se essas informações e outros conhecimentos sobre o assunto. c) indivíduos de sexo indeterminado. é correto afirmar-se que a) a probabilidade do casal em F ter um descendente macho e sem mancha negra é zero. b) a determinação do sexo. são produzidos em temperaturas abaixo de 28°C. cruzada com macho sem mancha. d) os testículos estão ausentes nos indivíduos 46.1 a) a determinação do sexo nesses animais é independente da localização dos ovos no ninho e da época da postura. b) os indivíduos trissômicos com cariótipo 47. c) as fêmeas de F‚ e P sem mancha negra possuem genótipos diferentes.1 181 . é CORRETO afirmar que a) os indivíduos 46. d) o caráter mancha negra é exclusivo de indivíduos homozigotos. b) cultura de células e tecidos. Questão 803 Nos mamíferos.

5. II. Em humanos.5. Questão 805 Analisando a figura adiante. (64) Com uma anomalia numérica de autossomos. c) o sexo das abelhas é determinado pela ploidia do indivíduo. a cor clara dos olhos é condicionada pelo alelo recessivo a de um determinado gene. e) I e III estão corretas. (08) Com Síndrome de Patau.1 (01) Do sexo masculino.nalise as seguintes afirmativas sobre o esquema da figura. c) II e III estão corretas. (16) Ccom Síndrome de Edwards.5. I. e são diplóides.1 I. a determinação do sexo cromossômico do zigoto (XX ou XY) depende do gameta masculino que fecunda o óvulo. Em uma linhagem desses insetos. uma vez que não houve a fecundação dos óvulos que os originaram. havia uma rainha que tinha tido apenas filhos do sexo masculino (zangões) e precisava de uma sucessora para o trono. III. e nasceram filhas operárias. Questão 807 Os machos de abelha originam-se de óvulos não fecundados e são haplóides. gametas com um número de cromossomos 4 (quatro) vezes menor. As operárias são estéreis devido à espermatogênese nos zangões produzir. (32) Com cariótipo normal. b) I e II estão corretas. d) apenas II está correta. A rainha se casou com um belo zangão plebeu. Da análise das afirmativas acima podemos assegurar que: a) apenas I está correta. A produção de zangões caracteriza o processo de reprodução assexuada denominado partenogênese. é correto afirmar que se trata do cariótipo de um indivíduo: Questão 806 No reino Colméia. As fêmeas resultam da fusão entre óvulos e espermatozóides. que representa um cariótipo humano. 182 . Essa história mostra que a) os zangões são haplóides e produzem os espermatozóides por meiose. (02) Do sexo feminino.5. através da meiose. b) o sexo das abelhas é determinado pelos cromossomos sexuais. Espera-se que a prole dessa rainha tenha a seguinte composição: 1. das quais uma seria a escolhida para ser a futura sucessora da rainha. Uma abelha rainha de olhos escuros. d) a rainha e as operárias são dióicas. heterozigótica Aa. (04) Com Síndrome de Down. foi inseminada artificialmente com espermatozóides de machos de olhos escuros. Os zangões podem ser considerados clones perfeitos da abelha rainha. enquanto a cor escura é condicionada pelo alelo dominante A. e os zangões são monóicos. Soma ( ) Questão 808 Considere as afirmações: 1.

c) Dois cromossomos X e blocos de cromatina sexual. b) apenas II. Em uma célula eucariótica animal. II e III. I. Em mamíferos.M e MARTHO. de uma célula a outra. IV e V. citosinas e guaninas arranjadas em diferentes combinações. d) II. "Conceitos de Biologia". Questão 810 Durante as Olimpíadas é comum fazer-se teste da cromatina sexual ou corpúsculo de Barr nas mulheres. Esse teste permite o diagnóstico citológico do sexo feminino. Questão 811 Considere as cinco afirmações seguintes. c) apenas III. Está(ão) correta(s) a) apenas I. em um mesmo indivíduo. sendo que um deles é a cromatina sexual. cromossomos homólogos contêm a mesma seqüência linear de genes. V. Questão 812 A reprodução da maioria dos seres vivos envolve um processo sexual onde se alternam os fenômenos de meiose e fecundação. as fêmeas possuem apenas um cromossomo X e os machos. e) III. Com relação a esses segmentos.5. Em mamíferos. o RNA mensageiro que saiu do núcleo continha 1500 códons e a seqüência que serviu de molde para a transcrição possuía 3000 nucleotídeos. II e IV. b) I e II estão corretos. nas células somáticas de fêmeas normais.5. adeninas. No homem. d) Três cromossomos X. Estão corretas: a) I. b) Três cromossomos Y. de pais para filhos. Toda a informação genética necessária para formar um organismo completo está contida em seqüências de timinas. III. III e IV. Em mamíferos. IV. têm sua origem no núcleo. dois. J. todas as moléculas de RNA. é possível observar o cromossomo X que foi inativado. b) I. e a fecundação reconstitui a diploidia.1 Adaptado de: AMABIS. d) apenas I e II. Questão 809 O diagrama a seguir está dividido em 3 segmentos (I. os quais contêm conceitos relacionados aos diferentes sistemas de determinação do sexo. G. sexual. d) Apenas I está correto. São Paulo: Moderna. 2001. sendo que dois deles formam a cromatina sexual.II. II e III). pois este corresponde ao corpúsculo de Barr ou cromatina sexual. pode-se afirmar que: a) I e III estão corretos.R. e) apenas I e III. não pode ser passada. Numa proteína com 500 aminoácidos. sendo exceção a essa regra os cromossomos sexuais X e Y. III e V. c) II. Qual dos pares de gametas representados a seguir poderá originar um zigoto que desenvolverá um embrião normal do sexo masculino? 1. e) Um cromossomo X apenas. II. Uma mulher normal apresentará em suas células bucais: a) Dois cromossomos X. sendo que um deles é a cromatina 183 . a meiose é gamética. com exceção do RNA mitocondrial. c) II e III estão corretos. porém. A informação genética pode ser passada de uma geração para outra. III.

e) a análise radiográfica da bacia.5.5. d) O genótipo de 6 será XHXH ou XHXh. são feitas as seguintes afirmações: I .características como a hemofilia.quando pareados.5. d) a pesquisa de hormônios sexuais femininos através de um exame de sangue.5.2 análise do esquema permite formular as conclusões a seguir.5. estão associadas a genes do cromossomo Y. II . por exemplo.características como o daltonismo. c) o cromossoma Y paterno pode apresentar o gene para a doença. d) o casal apresenta 50% de probabilidade de ter filhas afetadas. III . cujo desempenho ou mesmo a aparência sugerem fraude. Questão 814 Em relação aos cromossomos sexuais X e Y. b) O casal 5/6 formará homens hemofílicos. b) a contagem de hemácias cuja quantidade é maior nos homens. 184 . Para esclarecer tais suspeitas utiliza-se a) a identificação da cromatina sexual.Questão 815 1. e) os indivíduos III e V podem ser homozigotos ou heterozigotos. podemos afirmar corretamente que: a) a anomalia é causada por um gene dominante. Indique-a. são exemplos de cromossomos homólogos.2 Questão 813 Em eventos esportivos internacionais como os Jogos Pan-americanos ou as Olimpíadas. fazem parte do cromossomo X. Estão corretas as seguintes afirmações: a) apenas I b) apenas II c) apenas III d) apenas II e III e) todas. há suspeitas sobre o sexo de certas atletas. c) O genótipo de 4 será XHY. b) o indivíduo I é obrigatoriamente homozigoto. c) o exame radiológico dos órgãos sexuais. Questão 816 Observe o esquema a seguir: 1.5.1 1. EXCETO uma. No gráfico anterior temos representado um exemplo de doença ligada ao sexo onde apenas o indivíduo IV é afetado. e) O indivíduo 5 com certeza é hemofílico. a) O casal 1/2 nunca formará mulheres hemofílicas. Feita a análise desse gráfico. por exemplo. ocasionalmente.

Questão 817 "Tem sido verificado que aproximadamente 25% dos casos de hemofilia A em meninos são decorrentes de mutações novas. d) mulheres hemofílicas morrem nos primeiros sangramentos menstruais.5. d) Apenas as afirmações II e III são verdadeiras. III . II .5. De acordo com o heredograma. IV . analise as afirmações de I a IV e assinale a alternativa correta. Analise o heredograma adiante e assinale a alternativa correta.. BLOOD AND PRACTICE OF HEMATOLOGY. 185 .2 1.I. sabendo-se que a mulher B é homozigota é de a) 1/8 b) 3/8 c) 1/2 d) 1/4 e) 3/4 1. c) mulheres hemofílicas precisam de dois alelos dominantes. e) Apenas as afirmações II e IV são verdadeiras. a) Todas as afirmações são verdadeiras.50% das filhas do casal 3 e 4 serão normais portadoras e 50% daltônicas.5. Questão 818 O daltonismo é uma anomalia que apresenta um tipo de herança ligada ao sexo. a doença se manifesta em meninos que não tem história familiar de hemofilia.100% dos filhos homens do casal 3 e 4 serão daltônicos. e) é causada por um alelo típico do cromossoma Y. b) Apenas as afirmações I e II são verdadeiras.5.2 Questão 820 A hemofilia é uma doença genética cuja herança é ligada ao sexo. isto é. b) sendo uma herança ligada ao sexo. ao passo que os homens só necessitam de um alelo. c) Apenas as afirmações I. A probabilidade de A ser portador da anomalia. aprendemos que ela é mais comum nos homens porque: a) os homens são mais propensos à doença devido à influência do hormônio testosterona." (Handin R. I .Não é possível identificar o genótipo de 2. III e IV são verdadeiras. ligado ao cromossomo X.100% das filhas do casal 3 e 4 serão normais portadoras. que é masculinizante. 1955) Quando nos debruçamos sobre a hemofilia. Questão 819 A distrofia muscular de Duchenne é devida a um gene recessivo. O heredograma a seguir refere-se a uma família com esta anomalia. é suficiente nos homens apenas um alelo para que a doença se manifeste.

5% e) 100% Questão 824 Meio-irmãos é o termo utilizado para designar os indivíduos que são irmãos só por parte de pai ou só por parte de mãe. da qual herdaram os genes para daltonismo e hemofilia. 3 e 7 são portadores do gene para o daltonismo. ("Folha de S. João e Pedro são meio-irmãos e ambos são daltônicos e hemofílicos. João e Pedro sejam a) filhos do mesmo pai. certamente a mãe tinha fenótipo normal.5.2 1. 09. decidiu um tribunal japonês. porém herdaram de seus respectivos pais os genes para daltonismo e hemofilia. Questão 821 O daltonismo é causado por um gene recessivo localizado no cromossomo X na região não-homóloga ao cromossomo Y.Paulo". certamente. Um homem hemofílico casa-se com uma mulher normal e homozigota para este caráter. c) os homens 1.2006) 186 1. certamente.2 correto afirmar que a) a mulher 6 é homozigota. porém portador Questão 823 a) Os indivíduos 1 e 2 são homozigotos normais. do qual herdaram os genes para daltonismo e hemofilia. ocorridas independentemente da herança materna ou paterna. Pode-se dizer que. e) O indivíduo 14 pode ser homo ou heterozigoto. d) Todos os filhos e filhas do indivíduo 10 serão hemofílicos. c) O indivíduo 9 não pode ser hemofílico. b) O indivíduo 8 é portador do gene para hemofilia. heterozigotas. Questão 825 VÍTIMAS DE HIROSHIMA NO BRASIL SERÃO INDENIZADAS. d) as filhas do casal 6 e 7 são. c) filhos do mesmo pai. Seus genitores são normais. Os três homens. Na genealogia abaixo.5.5. porém herdaram de suas respectivas mães os genes para daltonismo e hemofilia. e) portadores de novas mutações. e) se o pai de 2 era afetado pelo daltonismo. b) filhos da mesma mãe. mais provavelmente. portadoras do gene para o daltonismo. A probabilidade deste casal vir a ter uma filha hemofílica é igual a: a) zero b) 50% c) 25% d) 12. d) filhos da mesma mãe.7 mil. b) as mulheres 2 e 4 são. o genótipo para hemofilia XHY fenotipicamente representa: a) homem normal b) homem hemofílico c) mulher normal d) mulher hemofílica e) homem normal. .Questão 822 Na espécie humana. vão receber US$ 24. os indivíduos representados com símbolos escuros são daltônicos e os demais têm visão normal para as cores. que pediram para não ser identificados.5.02.

entre 1000 homens analisados. que não tem ascendência oriental. Shiguero. Mário só pode ter herdado esse alelo de seu pai. d) dominante ligado ao sexo. se seu filho Mário tivesse herdado o alelo do pai. Questão 827 O daltonismo é causado por um alelo recessivo de um gene localizado no cromossomo X.Emília interessou-se pela notícia. e) recessivo ligado ao sexo. era uma vítima indireta da radiação liberada pela bomba. d) errada. Anos depois. Qual é a porcentagem esperada de mulheres daltônicas nessa população? a) 0. também poderia ter provocado mutações nas células de seu tecido reprodutivo que. casou-se com Takashi e atribuía a doença de seu filho Mário à herança genética do avô Shiguero. Afinal. Em uma amostra representativa da população. e deste à se filho. o herdou do Sr.5 %. e muito mais freqüente em homens que em mulheres. Depois da notícia do jornal. foi um dos sobreviventes da bomba de Hiroshima. e) 83 %. A hemofilia ocorre mais freqüentemente em homens. Do mesmo modo como a radiação provocou a leucemia do Sr. Emília havia lido que a doença é genética. Como a hemofilia é um caráter dominante. ou que Mário seja portador de uma nova mutação sem qualquer relação com a radiação a que o Sr. portador de hemofilia do tipo A. acreditava que seu único filho. d) 16 %. Emília passou a acreditar que seu filho talvez pudesse se beneficiar com alguma indenização. b) correta.2 padrão de herança que melhor explica o heredograma é a) autossômico dominante. A hemofilia é uma doença que prejudica a coagulação do sangue. É mais provável que a hemofilia de Mário seja determinada por um alelo herdado por via materna. Observe a árvore genealógica: 187 . por sua vez. c) 9 %.5. porque a doença afeta os dois sexos. Shiguero. c) autossômico dominante.na família real inglesa. filha de Vitória. provocaram a hemofilia de Mário. O sogro de Emília. onde se casou e teve um filho. c) apenas parcialmente correta.ligado ao X . os símbolos cheios representam pessoas afetadas por uma doença genética rara. 90 são daltônicos. uma vez que é determinada por um alelo no cromossomo Y. transmitidas à Takashi. Emília. A princesa Beatriz. que. Mário. ligada ao sexo. Shiguero. pode-se dizer que Emília está a) correta. Shiguero. Shiguero faleceu de leucemia. a doença de seu filho Mário é causada pela presença de um alelo herdado pela via paterna e por outro herdado pela via materna. Sobre suas convicções quanto à origem da doença de Mário. a mais grave delas. porque não há transmissão de homem para homem. porque aproximadamente 50% da prole é afetada.81 %. porque a doença aparece em todas as gerações. introduziu o gene na família real espanhola. b) 4. todos seriam hemofílicos. Após a guerra. Deste modo. porque todas as filhas de homens afetados são afetadas. Questão 828 Acredita-se que a rainha Vitória da Inglaterra tenha sido a introdutora do gene para hemofilia . o Sr.5. e) errada. Takashi. 1. Shiguero foi submetido. migrou para o Brasil. Como a hemofilia é um caráter recessivo e só se manifesta nos homozigotos para esse alelo. b) autossômico dominante. que o teria herdado do Sr. Sr. Questão 826 Na genealogia a seguir.

e) dominante ligado ao cromossomo Z. e) se ela tiver um irmão. com certeza. daltônica e canhota possui pai daltônico e destro e mãe de visão normal e canhota. filha de pai normal e mãe portadora do gene para o daltonismo. c) recessivo ligado ao cromossomo X. Sabendo que o uso da mão esquerda é uma característica recessiva. a) Esse casal poderá ter uma filha polidáctila e daltônica.. este será hemofílico também. 188 . que: a) o pai é normal. b) autossômico recessivo. e) Os filhos homens desse casal serão sempre daltônicos e não polidáctilos.Questão 831 Uma mulher. b) essa mulher poderia ter uma irmã daltônica. provavelmente. e) interação gênica. A anomalia. c) o pai e a mãe são hemofílicos. assinale a alternativa correta. d) recessivo ligado ao sexo. b) o pai é normal e a mãe é hemofílica. d) A mulher é obrigatoriamente filha de pai e mãe polidáctilos. b) dominante ligado ao sexo. então a probabilidade do segundo filho ser do sexo masculino e com fenótipos dominantes é: a) 1/2 b) 1/4 c) 1/6 d) 1/8 e) 1 1. É correto afirmar que: a) essa mulher é daltônica. c) o filho dessa mulher herdou do seu pai o gene para o daltonismo.. e) essa mulher não poderá ter uma filha daltônica. casa-se com um homem daltônico e tem uma criança do sexo masculino e daltônica. d) ela recebeu da mãe o gene para a hemofilia. Questão 833 O gene que determina o daltonismo na espécie humana caracteriza o seguinte tipo de herança a) autossômico dominante. Questão 830 Um homem de visão normal e com número normal de dedos casa-se com uma mulher polidáctila e daltônica. c) autossômico recessivo. c) O pai dessa mulher é daltônico.5.2 probabilidade da princesa Maria vir a ter um menino hemofílico é de: a) 100% b) 75% c) 50% d) 25% e) 0% Questão 829 O estudo de linhagens de galinhas em que aparecia uma anomalia hereditária mostrou que fêmeas afetadas cruzadas com machos normais davam sempre todos os descendentes machos com a anomalia e as fêmeas normais. Questão 834 Uma criança do sexo feminino. d) o genótipo dessa mulher é igual ao de sua mãe. Questão 832 Um casal tem uma criança de sexo masculino e hemofílica. É correto afirmar. Sabendo-se que a polidactilia é uma herança autossômica dominante. é determinada por gene a) autossômico dominante. b) A mãe dessa mulher terá obrigatoriamente o mesmo genótipo para o daltonismo que ela.5. d) recessivo ligado ao cromossomo Z.

Do casamento entre uma mulher afetada e um homem normal. c) I. Avó . enquanto a cor branca é devida ao gene W.As mulheres heterozigotas têm fenótipo normal. e) I e III são verdadeiras. Avô .sua mãe possui um gene para a hemofilia.XDXd. Avó .XDY d) Homem .As filhas de pai normal serão sempre normais.XDY. III e IV.XDXd. A probabilidade do nascimento de um menino também normal é: a) 50% b) 75% c) 25% d) 100% e) 0 Questão 836 Em 'Drosophila'. é possível considerar que APENAS a) I é verdadeira. Avó . b) II é verdadeira. a probabilidade desse casal ter uma criança do sexo feminino normal para ambas as características é de: a) 3/8 b) 1/8 c) 1/2 d) 3/4 e) zero Questão 838 A respeito das heranças recessivas ligadas ao sexo (genes situados no cromossomo X). III e IV apenas. I . nasceu uma menina normal. a porcentagem de indivíduos de olhos brancos em F será de: a) zero b) 100 % c) 25 % d) 75 % e) 50 % Questão 837 Um homem de audição normal e não hemofílico casa-se com uma mulher com o mesmo fenótipo. Avó .XDY e) Homem . II. b) I e III apenas.Se a mãe for afetada. Avó . II. a cor dos olhos é determinada por um gene localizado no cromossomo X sem o correspondente alelo no cromossomo Y. III .XdY b) Homem .XdY. II . Considerando a surdo-mudez como uma característica autossômica recessiva. Questão 840 Um homem tem avó materna e pai com visão normal. e avô materno e mãe com daltonismo. Considerando que nesses indivíduos o sexo heterogamético é o masculino. Avô . e) III e IV apenas.XdXd. Avô .XdY 189 . Sabendo-se que o gene em questão é recessivo e ligado ao sexo. Assinale a alternativa correta quanto aos genótipos do homem e de seus avós maternos.Os homens só apresentam dois genótipos possíveis. Questão 839 Considere as seguintes afirmações sobre uma mulher hemofílica: I. O primeiro filho desse casal nasceu hemofílico e surdo-mudo. São corretas: a) I. III.seu pai é hemofílico. enquanto as mulheres apresentam três genótipos possíveis. d) II e IV apenas.XdY c) Homem . e excluindo-se a possibilidade de mutação. c) III é verdadeira. Avô . a) Homem . considere as seguintes afirmações.XDY.XDXd. IV . d) I e II são verdadeiras. A cor vermelha é determinada pelo gene W+. Avô .XDXd.XdY.Questão 835 O raquitismo resistente à vitamina D é uma doença provocada por um gene dominante ligado ao X. Um macho de olhos brancos foi cruzado com uma fêmea heterozigota. todos os seus filhos do sexo masculino também serão afetados.sua avó paterna NÃO apresenta o gene para a hemofilia.XdY.

Questão 841 O heredograma a seguir representa uma família em que um dos filhos é afetado por doença determinada por um alelo recessivo localizado no cromossomo X. d) apenas hemofílico. a probabilidade de apresentar hemofilia é: a) 1 b) 1/2 c) 1/4 d) 1/8 e) 1/16 Questão 846 O esquema a seguir representa a ontogênese de João. quanto à hemofilia e ao daltonismo. embora seus pais não apresentem alterações cromossômicas numéricas em suas células 190 . espera-se que esse filho do casal seja a) normal. Um homem normal casou-se com uma mulher daltônica. que tratam de um caso e hemofilia: 1. a probabilidade desse casal ter um menino afetado é a) 3/4 b) 1/2 c) 1/4 d) 1/8 e) 1/16 Questão 842 Um homem hemofílico e uma mulher daltônica tiveram um filho com síndrome de Klinefelter (47. b) e as filhas de mulheres daltônicas são sempre daltônicos. Questão 843 O cientista John Dalton é bastante conhecido por suas contribuições para a Química e Física. Admitindo-se que o gameta anormal tenha sido produzido pela mulher. recebeu o nome de daltonismo. É correto afirmar que os filhos a) e as filhas de homens daltônicos são sempre daltônicos. O daltonismo é condicionado por um gene recessivo ligado ao sexo. causada por um alelo recessivo ligado ao cromossomo X.2 abendo que o indivíduo 7 é do sexo feminino.5. XXY). que nasceu com SÍNDROME DE KLINEFELTER e DALTONISMO. Além disso.2 e uma das irmãs desse indivíduo casar-se com um homem sadio.5. c) daltônico ou hemofílico.5. e) de homens daltônicos sempre portam alelo para daltonismo. e) apenas daltônico. d) de mulheres daltônicas sempre portam alelo para daltonismo. Questão 844 1. A probabilidade de terem um filho homem e normal é de: a) 0 b) 1/4 c) 1/3 d) 1/2 e) 1 Questão 845 Observe os heredogramas a seguir.5. Essa doença hereditária. c) e as filhas de homens daltônicos são sempre heterozigotos. b) daltônico e hemofílico. Dalton descreveu uma doença hereditária que o impossibilitava de distinguir a cor verde da vermelha.

5. Na espécie humana. sendo somente transmitido pelas mães. esse pai é obrigatoriamente daltônico. pelo menos um dos avós de João também é daltônico. b) Não podem ser gerados descendentes do sexo feminino afetados por DMD. Questão 849 A hemofilia é um distúrbio genético humano. EXCETO: a) Se o pai de João é daltônico. EXCETO: a) Os dois caracteres DMD e AME acima são recessivos.2 nalisando as informações e os heredogramas acima de acordo com seus conhecimentos. a) A permutação na espermatogênese permitiu que o pai tenha dado para a filha gameta contendo o alelo dominante para hemofilia. d) Os dois caracteres DMD e AME não podem estar localizados no mesmo par de homólogos. 191 .somáticas. Questão 847 Em geral. o cromossomo X de origem materna condensado. o que permite expressar os dois alelos dominantes. O gene que codifica para a produção desse fator está localizado no cromossomo X em uma região que não apresenta homologia em Y. O heredograma a seguir indica. enquanto a outra parte. A Atrofia Muscular Espinhal (AME) não impede a reprodução e pode ser transmitida pelo pai. Sabendo que filhas de pai apenas hemofílico e mãe apenas daltônica e homozigota para hemofilia são normais para os dois caracteres. ele obrigatoriamente contribuiu com o gameta responsável pela síndrome do filho. que se caracteriza pela falta de um dos fatores de coagulação sangüínea. o DNA não-expresso é altamente condensado na forma de heterocromatina.5. Um exemplo disso é a inativação completa de um dos dois cromossomos X em fêmeas de mamíferos. é menos condensado para permitir acesso da maquinaria de transcrição. é correto afirmar.5. d) A não-expressão dos alelos dominantes recebidos garante que a filha seja normal para os dois caracteres. O DNA ativo no nível de transcrição. é vista como uma mancha escura chamada corpúsculo de Barr.5. c) Algumas células somáticas de cada filha apresentam o cromossomo X de origem paterna condensado. 1. 1. torna os indivíduos afetados incapazes de se reproduzir.2 a filha receba dela os alelos dominantes para daltonismo e hemofilia no mesmo cromossomo. ao microscópio. a hemofilia e o daltonismo são características recessivas ligadas ao sexo. é correto afirmar. situação que. Questão 848 abendo que o daltonismo é uma herança recessiva ligada ao sexo. b) Se foi o pai de João quem contribuiu com o gameta contendo um cromossomo a mais. O caráter Distrofia Muscular de Duchenne (DMD) é uma herança ligada ao sexo. assinale a alternativa que traz uma explicação possível para o fato apresentado. c) A AME pode ser um caráter ligado ao sexo. b) O "crossing-over" na gametogênese da mãe garante que Os dois heredogramas a seguir foram montados para duas famílias que apresentavam distúrbios musculares geneticamente determinados. mas pode não ser ela quem contribuiu com o gameta responsável pela síndrome do filho. c) A mãe de João pode ser daltônica. d) Se a mãe de João é daltônica. conhecido como eucromatina.

5. é correto afirmar. Os experimentos a seguir foram desenvolvidos para se estudar a herança do caráter padrão da plumagem de galináceos da raça Langshan Black (fenótipo Lisa) cruzados com galináceos da raça Plymouth Rock (fenótipo Listrada). é correto afirmar. Sabendo-se que o daltonismo é uma característica determinada por gene recessivo ligado ao sexo.na segunda e terceira gerações. pelo menos um indivíduo apresenta o gene causador de hemofilia. mas Maria é portadora do gene que causa daltonismo. um progenitor afetado por essa anomalia.5. c) Se o gêmeo afetado for o do sexo masculino. d) O caráter plumagem lisa é recessivo em relação ao caráter plumagem listrada. B e C) que apresentam. Maria.000 nascimentos. EXCETO: a) Os galos com padrão de plumagem listrada representados. é INCORRETO afirmar: a) O pai de Maria não é portador. enquanto os galos O caráter descrito é uma herança ligada ao sexo. três famílias (A. pelo menos dois indivíduos apresentam o gene causador de hemofilia. Manuel é certamente daltônico. Manuel certamente é normal. b) Não existem indivíduos portadores do gene da hemofilia na família B. c) Na família C. 1. c) O padrão da plumagem das galinhas depende dos alelos que recebem do seu progenitor do sexo masculino. sendo uma síndrome hereditária recessiva ligada ao cromossomo X.5. sendo um deles daltônico e outro normal. b) Nos dois experimentos. De acordo com as informações apresentadas. Questão 850 Um homem e uma mulher com visão normal tiveram uma filha. EXCETO: a) Na família A. também com visão normal para daltonismo. constituem o sexo homogamético (macho ZZ). Questão 852 A Displasia Ectodérmica Anidrótica (DEA) apresenta prevalência na população de 1:100. em comum. 192 .5. Do casamento de Maria com Manuel nasceu um casal de gêmeos. O fenótipo mais marcante dessa síndrome é a ausência de glândulas sudoríparas na pele. b) Os dois gêmeos podem ter recebido o gene recessivo que determina o daltonismo.2 1. os galos listrados de F são heterozigotos quanto aos alelos que determinam esse caráter. Questão 851 Em Galináceos a determinação do sexo (sistema ZW) segue um padrão inverso ao que se observa em mamíferos (sistema XY). receberam o alelo dominante de seu progenitor do sexo feminino. d) A chance de o casal II-5 × II-6 ter uma criança afetada por esse caráter é de 1/4.2 Analisando-se o heredograma. d) Se o gêmeo afetado por daltonismo for do sexo feminino. Dessa forma as galinhas constituem o sexo heterogamético (feminino ZW).

d) Somente I e III. b) I. III.2 A figura apresenta duas gêmeas univitelínicas. heterozigotas e. e) Nenhuma. d) Um macho com o alelo recessivo pode passá-lo para suas filhas e filhos. Está correta ou estão corretas: a) Somente I e II. as manchas que aparecem nessas mulheres são produzidas por um corante especial capaz de revelar áreas com poucas ou nenhuma glândula sudorípara. suas quatro filhas (Olga.Questão 854 Robson. Com base nas informações dadas e em seus conhecimentos. A hemofilia é uma herança genética ligada aos cromossomas sexuais. filha do casal. II. Maria. Questão 853 Analise as afirmações: I. Tatiana.2 fotografia mostra o último czar da Rússia. Baseados nos mecanismos genéticos. que sofria de hemofilia. II e III. Nicolau II. e) Michele e Robson podem ser filhos de mãe daltônica e Aline a tia materna. c) Somente II e III. Michele e Aline são membros de uma mesma família. sua esposa Alexandra. c) Metade dos descendentes machos das gêmeas deverão apresentar a síndrome. a) Robson pode ser filho de Aline. b) Robson. Questão 855 1. não apresentam a síndrome.5. que apresentarão o fenótipo da síndrome. O daltonismo é transmitido por herança genética. c) Michele pode ser mãe de Robson e de Aline.5. poderíamos estabelecer os seguintes graus de parentesco. Um irmão da czarina Alexandra também era afetado por essa doença.5. mesmo que o pai seja daltônico. Michele e Aline podem ser irmãos. No entanto. d) Robson pode ser pai de Aline e de Michele. fosse portadora do alelo para hemofilia é de a) 1/4 b) 1/64 c) 1/2 d) 1/8 e) 1/32 193 . O genoma humano é de 46 cromossomos. A probabilidade de que Olga. Para o caráter daltonismo. Anastasia) e seu filho Alexis. as pessoas citadas apresentam o seguinte genótipo: Robson Michele Aline (Xd) Y (XD) (Xd) (XD) (XD) 1.5. é INCORRETO afirmar: a) As manchas na pele das gêmeas representadas podem ser o resultado da ocorrência de heterocromatina para o cromossomo que carrega o alelo dominante. b) As gêmeas podem ter herdado o alelo recessivo tanto de seu pai quando de sua mãe. portanto.

2 1. Se um homem daltônico casa-se com uma mulher normal.5.5 % d) 0 % Questão 859 Observe a árvore genealógica a seguir. Questão 857 Na genealogia a seguir. referente a uma família com herança para daltonismo (herança ligada ao sexo e deve-se a um gene recessivo). Assinale a descendência 194 . as pessoas indicadas pelos números 3 e 6 apresentam uma doença rara determinada por um gene dominante localizado no cromossomo X. e) terá todos os seus descendentes com a doença. porém portador do gene para o daltonismo d) os indivíduos 4 e 5 são daltônicos Questão 860 Em drosófilas. b) é heterozigoto para essa característica. d) recebeu o gene de seu pai. c) recebeu o gene de sua mãe. pode-se dizer que ele a) é homozigoto recessivo para esse gene.5. heterozigota para essa característica. Descendendo de pais com visão normal.Questão 856 1. c) poderá ter apenas descendentes do sexo masculino com a doença.5. a cor amarela do corpo é determinada por um gene recessivo localizado no cromossomo X. e a cor cinza pelo alelo dominante. b) poderá ter apenas descendentes do sexo feminino com a doença. e) recebeu o gene de seu pai. podemos afirmar: a) somente o indivíduo 2 é daltônico b) o genótipo do indivíduo 4 é XdY c) o indivíduo 1 é normal. d) poderá ter metade de seus descendentes com a doença. Na tira de quadrinhos. uma vez que o loco gênico está no cromossomo Y. não portadora do gene para o daltonismo. o homem de etnia amarela apresenta uma característica determinada por um gene recessivo ligado ao sexo. heterozigoto para essa característica.2 elativamente aos indivíduos anteriores.5. O casal indicado pelos números 5 e 6 1. Questão 858 O daltonismo é uma doença hereditária e ligada ao sexo na espécie humana. a probabilidade desse casal ter um filho homem e daltônico é: a) 25 % b) 8 % c) 12.5.2 a) não terá chance de apresentar descendentes com a doença.5.

fêmeas: 50% cinzentas e 50% amarelas.fêmeas: 100% cinzentas. d) Homem daltônico e mulher normal.fêmeas: 50% cinzentas e 50% amarelas. ou seja. já as meninas serão normais.2 partir da sua análise. situado num autossomo. uma forma de daltonismo que provoca cegueira para as cores vermelho e verde. e) apenas os filhos sejam afetados.fêmeas: 100% amarelas. e) Homem normal e mulher normal. Ao consultar um médico. Questão 862 Considere o heredograma a seguir. c) tanto os filhos quanto as filhas sejam sempre normais.2 195 .5. d) dominante. (02) É uma doença mais comum em homens que em mulheres. (04) As mulheres hemofílicas geralmente morrem na menarca. (16) Se transmite de pai para filho. localizado no cromossomo X. atinge indivíduos de um único sexo. b) machos: 100% cinzentos . b) Homem normal e mulher daltônica. é possível concluir que a anomalia é devida provavelmente a um alelo a) localizado no cromossomo Y. é determinada pelo gene recessivo d. Qual das opções fenotípicas abaixo corresponde à do casal em questão? a) Homem normal e mulher normal. Questão 865 Considere o heredograma: 1. assinale o que for correto. (08) O mecanismo genético da hemofilia se deve à presença de um gene ligado ao sexo. Questão 863 Em seres humanos.5. c) recessivo. ligado ao cromossomo X. Na prole de um homem afetado casado com uma mulher normal. situado num autossomo. porém portadora de gene recessivo d. Questão 864 Sobre a hemofilia.5.5. e) recessivo. um casal fica sabendo que todos os seus filhos do sexo masculino serão daltônicos.esperada a partir do cruzamento entre uma fêmea amarela e um macho cinzento. d) apenas as filhas sejam afetadas. anomalia hereditária caracterizada por uma deficiência na coagulação do sangue. b) tanto os filhos quanto as filhas sejam sempre afetados. em virtude da não-coagulação do sangue. localizado no cromossomo X. (01) É restrita ao sexo. c) machos: 100% amarelos . d) machos: 50% cinzentos e 50% amarelos . espera-se que a) tanto os filhos quanto as filhas possam ser normais ou afetados. 1. b) dominante. Questão 861 O raquitismo resistente à vitamina D é uma doença determinada por um gene dominante de herança ligada ao sexo. a) machos: 100% amarelos . c) Homem daltônico e mulher daltônica. e) machos: 50% cinzentos e 50% amarelos .fêmeas: 100% cinzentas.

Joana teve um filho que apresentou síndrome hemorrágica caracterizada por baixo nível plasmático do fator VIII da coagulação. A partir do cruzamento XrY × XRXr. Em relação aos descendentes deste casal é CORRETO afirmar que: a) esta anomalia será transmitida a todos os filhos do sexo masculino. Fêmea peluda: 9/64. Fêmea sem pêlo: 1/8 Questão 869 Observe a figura a seguir que apresenta o heredograma de uma família na qual alguns membros apresentam hemofilia. Macho sem pêlo: 3/16. d) esta anomalia será transmitida à metade das filhas. sua mãe e sua filha c) 100% para Joana e 50% para sua filha d) 100% para Joana e 50% para as outras mulheres da família e) 100% para Joana e 25% para sua filha Questão 866 Tendo em vista o heredograma.abe-se que o pai. o marido. recessivo. Macho sem pêlo: 3/8. o R. Fêmea sem pêlo: 1/4 b) Macho peludo: 9/16. neste caso. e o r. os cinco irmãos homens e um sobrinho de Joana são normais.5. ( ) Essa genealogia apresenta um tipo de interação gênica. c) esta anomalia será transmitida a todas as filhas. Essa figura indica os grupos sangüíneos do sistema ABO de alguns dos seus membros. Esse gene é representado por dois alelos. Macho sem pêlo: 1/8. ( ) Essa árvore genealógica representa um caso de anomalia hereditária. 1. Macho sem pêlo: 1/4. Fêmea peluda: 3/8. sendo 58 autossomos mais dois cromossomos sexuais. Fêmea peluda: 3/16. O gene responsável pela quantidade de pêlos no animal está situado no cromossomo X. como a cor da pele. Fêmea peluda: 1/4. Fêmea sem pêlo: 10/64 e) Macho peludo: 1/8. b) esta anomalia será transmitida à metade dos filhos do sexo masculino.5. Fêmea sem pêlo: 1/16 c) Macho peludo: 3/8. XX na fêmea. Fêmea peluda: 3/8.2 as proporções fenotípicas esperadas na descendência são: a) Macho peludo: 1/4. responsável por animal sem pêlo. e) esta anomalia não será transmitida a nenhum descendente. responsável por animal peludo. analise os itens. Questão 868 Em bovinos ocorrem 60 cromossomos na célula somática. Entretanto. Fêmea sem pêlo: 1/8 d) Macho peludo: 36/64. determinada por um gene presente no cromossomo Y. Questão 867 Um homem possui uma anomalia dominante ligada ao cromossomo X e é casado com uma mulher normal. é: a) 100% para todas as mulheres da família b) 100% para Joana. ( ) O caráter em questão é condicionado por um gene recessivo e ligado ao sexo. Macho sem pêlo: 9/64. 196 . e 58 autosomos mais XY no macho. influenciada pelo meio ambiente. grave anomalia relacionada à alteração no tempo de coagulação do sangue. A probabilidade genética de serem portadoras do gene para a hemofilia A. ( ) Esse pedigree mostra um exemplo de herança passada do avô ou da avó para o neto por meio da mãe portadora.

5. 1.5. em indivíduos afetados. Questão 872 A enzima G-6-PD (glicose-6-fosfato desidrogenase) está presente nas hemácias de indivíduos normais.2 Com base nas informações do heredograma e considerando-se que não ocorreu mutação.5. c) o indivíduo III-4 pode receber sangue de III-6.2 a) 1 b) 2 c) 3 d) 4 197 .5. 1.5. torna as hemácias sensíveis a certas drogas e nutrientes. Questão 870 Ao fazer um exame de vista para tirar carteira de motorista.Questão 871 Analise o heredograma.5. e) o indivíduo I-1 é heterozigoto para o sistema ABO. ssinale a alternativa que NÃO contém um tipo de herança compatível com a anomalia representada no heredograma.2 1. Observe o heredograma que representa uma família com essa característica.2 1. d) Autossômica dominante. Assinale entre as alternativas a seguir aquela que contém o heredograma que NÃO poderia representar a família desse rapaz. provocando sua destruição. a) Ligada ao X. A ausência dessa enzima. d) o indivíduo II-5 tem 50% de probabilidade de formar gametas do tipo iXh.5. um rapaz descobriu que era daltônico.5. b) Autossômica recessiva. é INCORRETO afirmar-se que a) a probabilidade de II-3 ser portadora do gene da hemofilia é de 50%. O gene que determina a ausência de G-6-PD é recessivo e situa-se no cromossoma X. c) Ligada ao Y. b) a probabilidade de nascimento de outra criança hemofílica e do grupo B para o casal III-6 e III-7 é de 25%.

analise os itens: 1. c) casais como I. independentemente do genótipo do seu pai.1 x I.2 têm maior probabilidade de ter filhos do sexo masculino daltônicos. d) mulheres afetadas recebem os cromossomos X materno e paterno com o gene para essa distrofia. um gene para ausência de G-6-PD. é CORRETO afirmar que a) cada um dos indivíduos representados tem. em que está representada a herança do daltonismo.5. b) indivíduos do sexo masculino afetados por essa distrofia muscular são filhos de mães heterozigotas. Considerando-se essas informações e outros conhecimentos sobre o assunto. inicia-se na infância e impede a reprodução dos afetados. b) essa família apresenta dois indivíduos heterozigotos para o gene que determina a G-6-PD.2 apresenta o fenótipo normal e é portador do gene do daltonismo. A mulher III. d) os filhos do sexo masculino de II. A mulher I. Questão 874 Analise este heredograma.2 198 .9 é homozigota Está(ão) correto(s) apenas: a) 1 b) 2 c) 3 d) 1 e 3 e) 1 e 2 Questão 876 A figura a seguir faz referência a uma genealogia que ilustra a ocorrência de uma determinada doença genética.5. A mulher I.5.2 têm probabilidade maior de ter filhos afetados do que de ter filhas afetadas. caracteriza-se por debilidade muscular progressiva e deformidades ósseas. d) o indivíduo II-3 pode ter recebido o gene da G-6-PD tanto do seu pai quanto de sua mãe. A mulher II. Analise-a e avalie as proposições dadas.2 . doença recessiva ligada ao cromossomo X. Questão 875 Considerando que o heredograma a seguir é o de uma herança dominante. ligada ao X. c) os casais como I. b) o indivíduo II.2 serão daltônicos. é CORRETO afirmar que a) o indivíduo I. pelo menos.2 é heterozigota 3.4 recebeu o gene do daltonismo de qualquer um de seus genitores.5. Questão 873 A distrofia muscular do tipo Duchenne. condicionada por gene recessivo localizado no cromossoma X: Considerando-se as informações contidas nesse heredograma e outros conhecimentos sobre o assunto. é INCORRETO afirmar que a) casais com filhos afetados têm 25% de probabilidade de ter outra criança com essa doença.om base nesse heredograma. A mulher III. 1.4 é homozigota 4.5 é heterozigota 5. c) indivíduos do sexo masculino que possuem um gene mutante para essa distrofia manifestam a doença.1 e I.2 é homozigota 2.

sendo responsável por este tipo de hemofilia. As irmãs 2 e 4 apresentam. III‚. III. 2003. Um círculo preto representa uma mulher surda e um círculo branco representa uma mulher normal. o alelo mutante (h) condiciona ausência do fator VIII. I. ( ) Observando-se que a maioria dos machos (I. e) I e III. pois herdou da mãe o alelo normal (H). b) III e IV. ( ) O loco gênico determinante deste caráter deve estar localizado na porção não-homóloga do cromossomo X. III„ e III…) manifestam a característica em consideração. Questão 878 O diagrama abaixo mostra a surdez em três gerações de uma família. São Paulo: Ed. respectivamente. Esse fator é uma proteína cujo gene codificador encontra-se no cromossomo X. 199 . J. A hemofilia A. Dos primos que se casaram. ( ) Os descendentes III„ e III… apresentam o mesmo genótipo. Moderna. Um quadrado preto representa um homem surdo e um quadrado branco um homem normal. IV. a probabilidade de terem filhos hemofílicos é de 50% e de terem filhas hemofílicas é de 0%. c) II. pode-se concluir que se trata da herança de genes localizados no cromossomo Y.5. Questão 877 A hemofilia é uma doença hereditária em que há uma falha no sistema de coagulação do sangue. G. III. é causada pela deficiência de um dos fatores que agem na coagulação.M. condicionou a manifestação do alelo deletério h para hemofilia. pois herdou o alelo recessivo para ausência do fator VIII de sua mãe. e o indivíduo 8 pode ou não ser portador deste alelo recessivo. AMABIS.. um dos tipos mais graves. genótipos da figura 2 e a consangüinidade. analise as afirmativas.5.5. O indivíduo 7 é hemofílico. II. considerando que os indivíduos 2 e 4 são irmãs.R.5. d) I e II. Com base nos textos e em seus conhecimentos.1. V3. enquanto que o indivíduo 5 não apresenta este alelo. "Conceitos de Biologia". somente o indivíduo 6 é portador do alelo recessivo que causa a hemofilia. Se o indivíduo 7 tiver filhos com uma mulher que tenha o mesmo genótipo para hemofilia de sua avó materna.2 1. o fator VIII. o alelo normal (H) produz o fator VIII e condiciona fenótipo não hemofílico. Estão corretas apenas as afirmativas a) I e IV. 1) de uma família em que ocorre a hemofilia A. II„. Observe o heredograma (fig. ( ) A identidade genotípica é também observada entre II e IIƒ. MARTHO. através da união entre primos irmãos (indivíduos 5 e 6).2 ( ) A característica mostrada no heredograma é determinada por uma série polialélica de genes autossômicos.

(04) Esse gene deve se manifestar com maior freqüência nos machos. É correto afirmar que: a) a mãe obrigatoriamente apresenta a cegueira da cor verde. c) Se a mulher for homozigota. b) autossômica recessiva. 200 . b) machos e fêmeas com cauda curta e retorcida na proporção de 2:1. (32) Machos afetados descendem de fêmeas portadoras ou afetadas. e) o pai obrigatoriamente apresenta a cegueira da cor verde. localizado na região não homóloga do cromossomo X. Questão 880 Genes situados na porção ímpar do cromossomo X são transmitidos segundo um padrão definido como Herança Ligada ao Sexo. que leva a uma debilidade muscular progressiva (distrofia muscular progressiva). . (02) Esse gene deve se manifestar com maior freqüência nas fêmeas. a probabilidade é 100%. a probabilidade é zero. Em camundongos. Questão 882 Existe uma doença condicionada por um gene recessivo. Questão 879 A cegueira da cor verde na espécie humana é uma característica recessiva ligada ao sexo. localizado no cromossomo sexual comum aos dois sexos. d) Se a mulher for heterozigota.2 (08) Esse gene deve se manifestar apenas nos machos.ela está casada com um homem normal.5.seus pais não são afetados. . é correto afirmar: (01) Esse gene deve se manifestar com igual freqüência em machos e fêmeas. Se uma fêmea de cauda normal for cruzada com um macho de cauda retorcida. c) dominante ligada ao sexo.1. a filha possui visão normal.Uma mulher com fenótipo normal tem um irmão afetado e um tio materno também afetado pela doença. c) machos e fêmeas com cauda normal na proporção de 100%. sua descendência apresentará a seguinte proporção: a) machos e fêmeas com cauda curta e retorcida na proporção de 100%. Considerando um gene recessivo e localizado nessa porção do cromossomo X. d) todos os machos com cauda curta e retorcida e todas as fêmeas com cauda normal. Em uma família. b) o pai é heterozigoto para a cegueira da cor verde. (16) Machos afetados descendem de machos também afetados. (64) Fêmeas afetadas são necessariamente descendentes de fêmeas afetadas. e) holândrica. . e) todos os machos com cauda normal e todas as fêmeas com cauda curta e retorcida.5. d) recessiva ligada ao sexo. a probabilidade é 25%. d) a mãe é pelo menos heterozigota para a cegueira da cor verde. c) o pai é homozigoto para a cegueira da cor verde. o fenótipo cauda curta e retorcida é determinado por um gene dominante denominado "Bent". Soma ( ) Questão 881 condição de surdez mostrada no heredograma é herdada como uma característica: a) autossômica dominante. a probabilidade é 75%. b) Se a mulher for homozigota. Seu alelo recessivo é responsável pelo fenótipo cauda normal. enquanto o filho não enxerga a cor verde. Qual a probabilidade de que um(a) filho(a) deste casal venha a ser afetado pela doença? a) Se a mulher for homozigota.

a) autossômica dominante b) ligada ao X dominante c) ligada ao Y dominante d) ligada ao Y recessiva e) ligada ao X recessiva Questão 884 Um homem é heterozigoto para um gene autossômico.2 dentifique o mais provável padrão de herança representado no heredograma. e) A mãe e o pai são pretos. Que proporção dos seus espermatozóides espera-se que seja A/Xö ? a) 0 % b) 25 % c) 50 % d) 75 % e) 100 % Questão 885 Nos gatos domésticos a cor do pêlo é ligada ao cromossomo X. o gene para o daltonismo encontra-se: a) em todas as células somáticas. d) Apenas I e II. Questão 886 Em um caso de disputa da paternidade de um menino hemofílico. e) Apenas II e III.O homem hemofílico não pode ser o pai do menino.e) Se a mulher for heterozigota. amarelo. em uma região sem homologia no cromossomo Y. de que cores são os pais? a) A mãe é malhada e o pai. I . II . (01) Não é possível a existência de mulheres hemofílicas.5. d) apenas nas células-mãe dos gametas. Quando metade das fêmeas de uma ninhada é malhada. b) A mãe é malhada e o pai. (02) É condicionada por um gene que se localiza no cromossomo X. d) A mãe é preta e o pai. c) Apenas III. b) Apenas II. Em um indivíduo daltônico. os machos podem se pretos ou amarelos e as fêmeas podem ser pretas amarelas ou malhadas. III . preto. assinale a(s) proposição(ões) CORRETA(S).O homem não hemofílico pode ser o pai do menino. c) apenas nas células do globo ocular. Com relação a essa doença. preto. é possível encontrar um máximo de três fenótipos e dois genótipos. . amarelo. e possui um alelo ligado ao X recessivo b. e) apenas nos gametas com cromossomo y. Questão 887 Assinale a proposição CORRETA. b) em todas as células gaméticas. a probabilidade é 100%. Quais estão corretas? a) Apenas I. e decorre do não funcionamento de um dos fatores bioquímicos de coagulação. Assim. (Hemofilia: herança recessiva ligada ao X) Analise as afirmações abaixo a esse respeito. 201 1. e metade dos machos é amarela. Questão 883 Interprete o heredograma abaixo. Aa.As bases genéticas da hemofilia apoiam a paternidade do homem hemofílico. estão envolvidos um homem que tem a doença e outro que não a tem. (04) Entre as mulheres. a outra metade é preta. c) A mãe é amarela e o pai.5. do sexo masculino. Questão 888 A hemofilia é uma doença hereditária em que há um retardo no tempo de coagulação do sangue.

que se caracteriza pela dificuldade de coagulação do sangue. d) 100% de machos com cerdas retorcidas e 100% de fêmeas normais. Questão 890 Em drosófila.menina com visão normal para as cores. é possível ocorrer apenas um genótipo. a distrofia muscular de Duchenne é uma doença condicionada por um gene recessivo localizado no cromossomo X. Questão 893 Observe a genealogia abaixo sobre uma família que apresenta pessoas afetadas por uma anomalia hereditária.Devido à inativação ao acaso de um cromossomo X. Questão 891 Um casal que possui visão normal para as cores. b) 1/3. Questão 892 Na espécie humana. as mulheres heterozigotas para o gene da distrofia muscular de Duchenne podem apresentar graduações da característica. III. II. b) I e III. São corretas as afirmativas a) apenas III. d) 3/4.(08) Entre os homens. e) 100% de machos normais e 100% de fêmeas com cerdas retorcidas. mesmo no caso de pequenos ferimentos. d) 1/8. Os homens afetados começam a apresentar os sintomas na primeira infância e não se reproduzem porque morrem antes de atingir o período reprodutivo. Sabendo-se que o daltonismo é uma herança ligada ao X. a possibilidade de esse casal ter uma filha com daltonismo é a) zero. o caráter cerdas retorcidas é determinado por um gene recessivo e ligado ao sexo. d) I e II. Uma fêmea heterozigota foi cruzada com um macho normal. Soma ( ) . não portadora.menino com visão normal para as cores. e) 3/4. c) 100% de machos normais. Questão 889 A hemofilia é uma doença recessiva ligada ao sexo. c) 1/4. .menino com daltonismo. c) II e III.A distrofia muscular de Duchenne é uma doença que ocorre exclusivamente no sexo masculino. que ocorre nas células das fêmeas dos mamíferos (hipótese de Lyon). 50% de fêmeas com cerdas retorcidas e 50% de fêmeas normais. . O alelo dominante determina cerdas normais (não retorcidas). espera-se que 50% deles sejam normais e 50% sejam hemofílicos. a probabilidade de nascimento de uma criança do sexo masculino e hemofílica é a) 1/2. (32) É um exemplo de herança ligada ao sexo. há uma maior incidência dessa doença entre eles. (16) Entre os descendentes de um homem hemofílico e de uma mulher normal. 50% de machos com cerdas retorcidas e 100% de fêmeas normais. Em um casal em que a mulher é heterozigota para a hemofilia e o marido é normal. A descendência esperada será de a) 50% de machos e 50% de fêmeas normais e 50% de machos e 50% de fêmeas com cerdas retorcidas. tem 3 filhos com as seguintes características: 202 . por isso. b) 1/4. I. b) 50% de machos normais. em que os indivíduos afetados têm graves hemorragias. e) 1. que acarreta degeneração e atrofia dos músculos. Analise as afirmativas abaixo.A distrofia muscular de Duchenne é uma doença que ocorre quase que exclusivamente em meninos. c) 1/2.

b) O genótipo da Sra 5 é XHXh. O gene que condiciona a calvície é dominante nos homens e recessivo nas mulheres. analise as afirmativas a seguir. e) O genótipo da Sra 8 é XhXh.25% das filhas do casal poderão ser calvas e daltônicas. O daltonismo é de herança recessiva ligada ao cromossomo X. mas daltônicas do outro. é condicionado por genes ligados ao cromossomo X. II . nos gatos.5. d) O genótipo do Sr 9 é XHY. III .É possível que o casal tenha filhas não-calvas. (3) Um gato macho não transmite para seus filhos machos os genes para cor da pelagem. de visão normal em um dos olhos. Com base no heredograma a seguir. c) II e III são corretas. d) Apenas III está correta. (0) O caráter cor da pelagem.5.5. (2) Os descendentes de uma fêmea amarela. (1) As fêmeas manchadas são heterozigotas para o caráter cor da pelagem.A mulher é dupla heterozigota para os genes em questão. Marque a alternativa correta. c) O genótipo da Sra 8 é XHXH. observam-se os seguintes fenótipos: 1. Um casal não-calvo e de visão normal tem um filho calvo e daltônico. d) autossômico dominante.5. b) autossômico recessivo.2 Utilizando as informações anteriores.1. I . a) I e II são corretas. Questão 894 Na espécie humana. julgue os itens a seguir. Questão 895 O gene h que determina a hemofilia na espécie humana é recessivo e está localizado no cromossomo X. Questão 896 Com relação à coloração da pelagem de gatos. serão manchados. 203 . não havendo dominância. a calvície hereditária é uma característica influenciada pelo sexo. cruzada com um macho preto. c) dominante ligado ao cromossomo X. Considerando os dados apresentados. b) I e III são corretas.2 anomalia em questão é transmitida por meio de um gene a) recessivo ligado ao cromossomo X. podemos afirmar corretamente: a) O genótipo da Sra 5 é XHXH.5.2 1.5.

b) 2. portadoras do gene. e) os homens 1 e 4 são. Questão 900 A genealogia abaixo nos mostra uma forma de transmissão do daltonismo. em seis partos diferentes. Questão 898 Considere o heredograma. Questão 901 Um casal não hemofílico teve um filho do sexo masculino com hemofilia. e) 5.5. certamente.5.25. certamente. (32) O genótipo do indivíduo 9 é XdY. podemos afirmar que a) a mulher 2 é homozigota. b) as filhas do casal 3 e 4 são.2 Assinale dentre as alternativas que se seguem.5. Indique a alternativa com a probabilidade desse casal ter uma filha hemofílica: a) 0% b) 25% c) 50% d) 75% e) 100% 1. Questão 899 Uma mulher é portadora de um gene letal presente no cromossomo X. Este gene provoca aborto espontâneo algumas semanas após a formação do zigoto. c) as mulheres 2 e 3 são. 204 . cuja mãe tinha olhos brancos.5. d) 0. (02) O daltonismo é determinado por um gene recessivo. c) 3. (64) O genótipo do indivíduo 5 é XdXd. e) 0. (16) O casal 1 x 2 pode ter filhos homens daltônicos. que representa uma família portadora de caráter recessivo condicionado por um gene situado em um dos cromossomos sexuais. c) 0. portadoras do gene. b) 0. o número esperado de crianças do sexo masculino será a) 1. Se esta mulher der à luz seis crianças normais. d) todas as filhas do casal 1 e 2 são portadoras do gene. (01) O daltonismo está relacionado com genes localizados em cromossomos autossômicos. Qual é a probabilidade de se obter uma fêmea de olhos brancos deste cruzamento? a) 1. (08) O indivíduo 8 tem o mesmo fenótipo de sua avó materna. 1.Questão 897 Em moscas de frutas. cruza-se com macho de olhos brancos.50. a(s) correta(s). d) 4.00.00. a cor branca dos olhos é devida à herança ligada ao sexo.67. certamente. Uma mosca fêmea com olhos coloridos. portadores do gene.2 respeito desta genealogia. (04) O indivíduo 1 transmite a todas as suas filhas um cromossomo Xd. sendo que seu alelo dominante condiciona visão normal.

c) Se o meu irmão não tiver esse Y. I . nas primeiras experiências sobre hereditariedade. isto é. em relação ao padrão de cromossomo Y presente na população. b) codominância. e) interação gênica. Questão 904 Como exemplo de característica na espécie humana. genes que não possuem homologia com o cromossomo X. ele fez algumas suposições sobre a herança desse cromossomo. por genes holândricos. a determinação cromossômica do sexo é dada pelos cromossomos X e Y. d) Entre as minhas filhas. aB (25%).AB (40%). Este fenômeno é chamado de: a) epistasia. a qual não é válida para os genes que estão em ligação gênica ou "linkage". Ab (10%). Questão 906 A hipertricose auricular (pêlos na orelha) é transmitida apenas pelo homem e somente para os filhos do sexo masculino. c) herança holândrica. b) o aparecimento do corpúsculo de Barr. Embora sem nenhuma manifestação fenotípica aparente. d) o daltonismo. 205 . Posteriormente.Questão 902 Na espécie humana. talvez ele não seja meu irmão. ab (25%). pode-se afirmar que: a) I e II são situações nas quais os genes segregam-se independentemente. genes que estão localizados nos mesmos cromossomos. b) II e III são situações nas quais ocorre segregação independente e ligação gênica sem "crossing-over". b) Se eu tenho este Y. III . e) exclusivas das mulheres. ele acompanhou a transmissão de dois caracteres ao mesmo tempo. As características condicionadas por tais genes são a) transmitidas da mãe para 100% das filhas. e) o albinismo. 30% a mais de heterocromatina na região distal. apenas 50% terão esse cromossomo. ab (50%). Ab (25%). II . aproximadamente. e os resultados levaram-no a concluir que: "fatores para dois ou mais caracteres são transmitidos para os gametas de modo totalmente independente". ab (40%). d) pleiotropia. trabalhou com apenas uma característica de cada vez. O cromossomo Y apresenta genes holândricos. isto é.AB (50%). Esta observação foi enunciada como "2 Lei de Mendel" ou "Lei da Segregação Independente". Observando as seguintes proporções de gametas produzidos pelo diíbrido AaBb em três situações distintas. Questão 903 A hipertricose auricular é uma anomalia genética condicionada por um gene localizado no cromossomo Y. b) em todos os homens. c) em 50% das mulheres e 50% dos homens. Na próxima geração dessa família esse gene se manifestará a) em todas as mulheres. d) transmitidas do pai para os filhos homens e filhas em 100% dos casos. Assinale a suposição que está geneticamente coerente: a) Acho que o meu pai herdou essa condição genética da mãe dele. c) transmitidas do pai só para as filhas. todos os meus descendentes também o terão. b) transmitidas do pai para 100% dos filhos homens. aB (10%). respectivamente. Um homem com hipertricose casa-se. Questão 907 Mendel. e todos os seus filhos são homens. determinada por genes localizados no cromossomo Y. Questão 905 O exame citogenético de um indivíduo normal revelou que o seu cromossomo Y contém. e) somente nos homens heterozigotos. ou seja. temos: a) a diferenciação dos testículos. c) a hemofilia.AB (25%). d) somente nas mulheres heterozigotas. e) Provavelmente esse Y ficou grande para ser o homólogo do X.

b) seguem as leis do diibridismo. e) são epistáticos. ( ) Se. os gametas não recombinantes e os recombinantes surgirão nas proporções esperadas de 1:1:1:1. Em que percentual serão esperados descendentes de genótipo AB // ab. ( ) A probabilidade do aparecimento de um indivíduo AB//ab. Questão 909 Considere uma espécie de vertebrado cujas células somáticas têm 12 cromossomos. c) constituem um caso de interação gênica.c) I e III são situações nas quais ocorre segregação independente e ligação gênica com "crossing-over". em 100% das células germinativas da fêmea. ocorrer permutação entre os locos A e B. d) Dezesseis. a partir do cruzamento acima indicado. existe uma ligação gênica. Questão 908 Considere uma espécie de vertebrado cujas células embrionárias têm oito cromossomos. ( ) Considerando o cruzamento ilustrado na figura. b) Seis. a partir de progenitores com os genótipos mostrados na figura? 206 . A esse propósito. analise a figura e as afirmações feitas a seguir. Em quantos grupos de ligações seus genes estarão associados? a) Dois. em 50% das células produtoras de gametas. no cromossomo. cada tipo de gameta recombinante (Ab e aB) aparecerá com freqüência de 25%. pode-se inferir que ocorreu permutação (ou crossing-over). d) são pleiotrópicos. Em quantos grupos de ligações seus genes estarão associados? a) Quatro. respectivamente. é de aproximadamente 42%. Questão 912 A freqüência de recombinação entre os locos A e B é de 10%. e) Dez.5. em 8. pode-se concluir que os genes "a" e "b": a) estão em um mesmo braço do cromossomo. d) Oito. ( ) Se. c) Oito. um com genótipo AaBb e outro com genótipo aabb resultou numa F com as seguintes proporções: AaBb = 35% aabb = 35% Aabb = 15% aaBb = 15% Com esses resultados.5% das células formadoras de gametas. c) Três. e) Número variável. Questão 911 Quando dois genes estão em um mesmo cromossomo. b) Quatro. A taxa de recombinação entre eles dependerá do quanto estiverem afastados um do outro. ocorrer permutação entre os locos A e B. 1. d) II é uma situação na qual ocorre ligação gênica com "crossing-over".6 ( ) A freqüência de recombinação entre os locos A e B é de 17%. Questão 910 O cruzamento de dois indivíduos. e) III é uma situação na qual ocorre ligação gênica sem "crossing-over".

Questão 914 Uma determinada espécie vegetal apresenta variação para cor da flor . 207 . foi retrocruzada com o pai duplo-recessivo. foram cruzadas com plantas de fenótipo (ab). ambos com dominância completa. 1. Plantas homozigóticas. ocorreu permutação entre os locos A e B. cor do hipocótilo . Analise as proposições a seguir quanto à correção. A geração P é genotipicamente (AB//AB) x (ab//ab). foi observada na progênie a seguinte proporção (situação 2): 1. ( ) A taxa de recombinação no caso mostrado é de 30%. ao cruzarem um duplo heterozigoto para os caracteres cor da flor e pilosidade no cálice da flor com um duplo-recessivo. pelos locos A e B. b) a primeira situação pode representar um caso de pleiotropia e a segunda evidencia uma segregação independente dos genes.6 ( ) Trata-se de um caso de ligação gênica. fenotipicamente (AB).roxo e branco -. sendo que na segunda. o hipocótilo era roxo e todas as plantas que apresentavam flores de cor branca. em milho.5. fenotipicamente (AB).5.com (piloso) e sem (glabro). A F1. obtendo-se uma F2 como mostrado no quadro. foi observado que todas as plantas que apresentavam flores roxas. são determinados. a ligação é mais forte do que na primeira.5. d) em ambas as situações ficou evidenciado o efeito pleiotrópico entre os genes. ( ) Os locos A e B distam entre si de 35 unidades de mapa. ( ) Em 60% das células formadoras de gametas da F1. Em todos os cruzamentos realizados entre plantas fenotipicamente diferentes e após avaliações em várias gerações segregantes. c) a primeira situação evidencia ligação gênica e a segunda mostra a segregação independente dos genes. A cor roxa da flor e do hipocótilo e a presença de pilosidade são dominantes. ( ) Em 35% das células gaméticas da F1 ocorreu recombinação. e) em ambas as situações ficou evidenciada a ligação gênica.e pilosidade no cálice da flor . o hipocótilo era verde (situação 1). respectivamente. o que mostra uma distância menor entre os genes.6 a) 5% b) 90% c) 45% d) 10% e) 20% Questão 913 Dois fenótipos de interesse econômico.6 1.roxo e verde . Com base no texto e em seus conhecimentos é correto afirmar que a) a primeira situação pode representar um caso de pleiotropia e a segunda mostra um caso de ligação gênica. Entretanto.

e há tentativas de tratamento com algum sucesso em poucos casos. enquanto um organismo com dois alelos diferentes para um mesmo "locus" é considerado heterozigoto para este "locus". III e IV c) Apenas I. estão presentes na população.A aparência de um indivíduo com respeito a uma dada característica herdada é chamada de fenótipo. o qual determina a doença chamada siclemia ou anemia falciforme. III. III e IV b) Apenas I. nós dizemos que esta característica é uma característica poligênica.Quando uma característica particular de um organismo é governada por muitos pares de genes. Em 2. Quais afirmativas o professor diria que estão corretas? a) Apenas II. III e V d) Apenas II. IV e V e) I. Os homozigotos siclêmicos morrem precocemente devido à severa anemia. II. II. O diagnóstico pré-natal é possível. são mais resistentes à malária que os indivíduos normais. Qual a explicação para o comportamento das curvas do gráfico? 1. provocando a degenerescência nervosa mortal. Nessa mesma população foi observado que 64% das pessoas apresentam esta característica. III.7 208 . por outro lado.Os genes em um mesmo cromossomo tendem a ser herdados juntos e são denominados "genes ligados" II .Questão 915 Os seguintes conceitos genéticos foram escritos por um aluno que estava com dúvidas sobre a matéria e que pediu a um professor qualificado que os conferisse: I . dizemos que este "locus" possui alelos múltiplos. IV e V Questão 916 Numa determinada população a capacidade de enrolar a língua é determinada por um gene dominante A. II. Em certas comunidades da Europa Central.Quando três ou mais alelos. o número esperado de casamentos com risco de gerar crianças com degenerescência nervosa é: a) 0.700 casamento ocorridos entre membros sadios dessas comunidades. IV .5. III .3 b) 3 c) 45 d) 60 e) 90 Questão 918 O gráfico a seguir mostra a dinâmica das freqüências do gene s. O gráfico refere-se ao período posterior à erradicação da malária. os heterozigotos sofrem de uma forma branda da anemia mas.Um organismo com dois alelos idênticos para um "locus" em particular é considerado homozigoto para este "locus". para um dado "locus". V . uma em cada 30 pessoas apresenta fenótipo normal e é heterozigota quanto ao gene determina a doença de Tay-Sachs. A freqüência esperada de indivíduos heterozigotos será de: a) 70% b) 48% c) 36% d) 16% e) 10% Questão 917 A doença de Tay-Sachs resulta da ação de um gene mutante localizado no cromossomo número 15. que possuem efeitos similares e aditivos.

Questão 925 A hemofilia é causada por um gene recessivo (h) localizado no cromossomo X. ao seu alelo recessivo i. c) AA . os números esperados de pessoas sensíveis e insensíveis nessa população são.25% b) 12.1.a) Diminuição da freqüência de mutação de S para s.00. e) Cruzamentos preferenciais entre portadores de malária. aa . Aa . c) Aumento da freqüência de mutação de S para s. Questão 920 A freqüência de indivíduos afetados por uma anomalia genética autossômica recessiva.8 e 0.440. Aa . aa .25. d) AA .280.1. b) a imigração de muitos indivíduos homozigotos dominantes. aa .160. b) AA .280.6/16. aa .000 209 . Aa . Nessa população a freqüência do alelo A é a) impossível de se determinar. d) AA .5. Questão 923 Sabendo-se que uma população está em equilíbrio genético e que a freqüência de indivíduos homozigotos para um caráter autossômico e dominante (AA) é de 25%. e) o crescimento da população da população devido a diminuição da predação. as freqüências dos genes I e i são. e) AA .6.280. c) o nascimento de 48 indivíduos afetados entre 300 nascidos. respectivamente. b) 768 e 432. Aa . Aa .9/16. Essa população estará em equilíbrio genético. Questão 921 A sensibilidade (gosto amargo) do ser humano ao PTC (feniltiocarbamida) se deve a um gene autossômico dominante I e a insensibilidade. se as proporções genotípicas forem: a) AA .560. em uma dada população.000 é hemofílico.000 indivíduos. b) 1. d) Cruzamentos preferenciais entre pessoas anêmicas. aa .600.2.1/16. Constatou-se a diminuição dessa freqüência após a) a morte de 5% da população total por falta de alimento.6. numa determinada população. Aa . Sabendo-se que. Aa .320. Aa .560. e) AA . Aa . c) 0.1. a) AA . e) 816 e 384. c) AA .400. Questão 919 Considere uma população em que metade dos indivíduos mantém-se heterozigota para um dado gene (Aa). 0. concluímos que a freqüência de indivíduos homozigotos recessivos (aa) é de: a) 6. b) Seleção contra os portadores do gene s.9/16. d) o casamento preferencial de indivíduos heterozigotos.500 c) 1/25.120.1.400.4/16. aa .160. Se.120. numa população de 1200 pessoas.6/16.75. a freqüência do gene h nessa população é a) 1/500 b) 1/12.5% c) 25% d) 50% e) 75% Questão 924 Sabendo-se que a freqüência do gene autossômico A é igual a 0. numa população constituída de 8.1/16. a freqüência de um gene autossômico dominante A é o triplo da freqüência do seu alelo recessivo a.4/16. d) 1152 e 48. Questão 922 Numa população. indique a alternativa que mostra o número de indivíduos para cada genótipo.6/16. aa . e) 0. enquanto que a outra metade é composta por indivíduos duplo-recessivos (aa).9/16.320. aa .1.6/16.8.6/16. aa .16. era de 0. d) 0. aa .8/16.000 d) 1/50.4/16. um homem em 25. Aa .2. c) 1008 e 192.5.50. b) AA . respectivamente: a) 960 e 240. se essa população estiver em equilíbrio genético.1/16.6.

7 Questão 929 Uma população em que atuam os princípios postulados por Hardy e Weinberg. calcularam-se outras freqüências. espera-se que sejam heterozigotos a) 700 b) 420 c) 90 d) 49 e) 21 Questão 927 Analise o heredograma a seguir no qual os símbolos escuros significam a presença de uma anomalia.1 x III. como mostra a tabela a seguir: 210 . o comprimento das asas é determinado por um par de genes. 1. as freqüências genotípicas de um determinado par de alelos "a" se distribui de acordo com o gráfico destacado: Marque o gráfico que representa a freqüência genotípica após 12 gerações: 1. Assinale a alternativa correspondente aos cálculos corretos.2 vir a ter uma criança com a anomalia é a) 1/420 b) 1/160 c) 1/120 d) 1/80 e) 1/50 Questão 928 Em drosófilas.000 Questão 926 Em uma população em equilíbrio de Hardy-Weinberg. Esse caráter é dominante nos homens e recessivo nas mulheres. Se essa população for formada por 1000 indivíduos.7 abendo-se que a freqüência de heterozigotos na população é 1/20. Sabendo-se que. a freqüência do alelo autossômico (b) é de 30%. que tem sua expressão influenciada pelo sexo. em uma população mantida em laboratório.5. Questão 930 A calvície na espécie humana é determinada por um gene autossômico C. O alelo que condiciona asas longas é dominante sobre o alelo que condiciona asas vestigiais.5. 16% apresentavam asas vestigiais.7 1. que estão indicadas na tabela abaixo.e) 1/100.5. a probabilidade do casal III.

há certas proteínas no sangue que permitem classificar as pessoas como pertencentes ao tipo sangüíneo M. b) a mecanismo de herança da cor dos olhos não ser ainda bem conhecido. Sabe-se também que.84. Questão 934 Na espécie humana. que sempre é influenciada por fatores ambientais.7 esta população. Espera-se que o número de indivíduos Rh positivo homozigoto nessa população seja de a) 9.000 indivíduos. a) 0. Se em uma população em equilíbrio de Hardy-Weinberg. 211 m uma população. as freqüências esperadas de indivíduos dos grupos N e MN são.48 e 0. Essa característica é determinada por um par de alelos entre os quais não há dominância.48.5% c) 19% d) 42% e) 81% Questão 931 Para responder à questão.100 e) 900 Questão 933 Sabe-se que olhos escuros são dominantes sobre olhos azuis. 1.5. qual a freqüência esperada de mulheres cujo genótipo pode torná-las calvas? a) 1% b) 8. na maioria das populações da América do Sul predomina o número de pessoas de olhos escuros. Um levantamento nos prontuários médicos de um importante hospital brasileiro identificou o grupo sangüíneo MN de 10.36 e 0.000 indivíduos revelando os dados apresentados no quadro abaixo. formada por 10. e) tratar-se de um caso de herança quantitativa. c) a dominância dos genes relacionados com a cor dos olhos modificar-se com o ambiente.900 c) 4. e) 0.100 b) 4.60 e 0. as freqüências dos alelos M e N são.5. a freqüência de indivíduos do grupo M é 49%. Questão 932 Numa população em equilíbrio de Hardy-Weinberg. considere a informação a seguir.40.24. enquanto em diversas populações européias acontece o inverso: pessoas de olhos escuros constituem a minoria. d) 0. A análise da população estudada concluiu que a mesma se encontra em equilíbrio de Hardy-Weinberg. em equilíbrio de Hardy-Weimberg. existem 900 do tipo Rh negativo. N ou MN.7 .550 d) 2.16 e 0. respectivamente. Essa diferença deve-se fato de a) a herança da cor dos olhos não obedecer às leis de Mendel.16.1. onde 81% dos homens não apresentam genótipo capaz de torná-los calvos.24 e 0. d) a freqüência dos alelos para olhos escuros ser maior nas populações sul-americanas do que nas européias. b) 0. c) 0.

p e q. Com base nesses dados. as freqüências gênicas e genotípicas se mantenham constantes ao longo das gerações.. a freqüência esperada de heterozigotos normais é a) 91 % b) 75% c) 49% d) 42% e) 21% Questão 940 Um par de genes determina resistência a um fungo que ataca a cana-de-açúcar e os indivíduos suscetíveis (aa) apresentam freqüência de 0. ausentes e) Pequena. (08) Com informações sobre os valores das freqüências gênicas. é correto afirmar que a freqüência dos alelos A e a será respectivamente: a) 0. (04) Em uma amostra de 1000 indivíduos de uma população em equilíbrio. são esperados 160 indivíduos com o fenótipo R. são condições para que. (2) e (3): a) Infinitamente grande.. os genótipos AA. para essa característica.44 e 0. Aa e aa são encontrados com as freqüências p£. assinale o que for correto.66 Questão 938 Uma população de roedor está sendo estudada quanto ao equilíbrio de Hardy-Weinberg para uma característica determinada por um locus autossômico. e) à oscilação genética. d) ao seu efeito dominante.44 e) 0.56 e 0.respectivamente.50 e 0..... Se em uma dada população em equilíbrio de Hardy-Weinberg 9% dos indivíduos são albinos. O alelo dominante A condiciona o fenótipo D e ocorre com a freqüência p.(3). atuantes c) Infinitamente grande. cruzamentos . o albinismo é determinado por um alelo autossômico recessivo.. Preenchem correta e respectivamente as lacunas (1).34 e 0... Questão 936 Tamanho . a população não está em equilíbrio. e das freqüências fenotípicas. a freqüência desse gene tende a aumentar devido a) ao fato de ser recessivo.(2). uma geração. (16) O conhecimento das freqüências genotípicas é suficiente para se determinar a condição da população quanto ao equilíbrio. O alelo recessivo a é responsável pelo fenótipo R e tem freqüência q. 24 mil apresentam o genótipo AA e 36 mil apresentam o genótipo aa. b) às mutações que continua a sofrer. atuantes b) Infinitamente grande. atuantes Questão 937 Em uma população composta de 100 mil indivíduos. com p=0..51 b) 0.(I). (02) No equilíbrio. respectivamente. e fatores evolutivos . de acordo com Hardy e Weinberg. Com o tempo.50 d) 0.. ao acaso. (64) A população está em equilíbrio apenas quando 75% dos indivíduos apresentam o fenótipo D e 25% apresentam o fenótipo R. direcionados. 2pq e q£.. a) 9% e 42% b) 17% e 34% c) 18% e 21% d) 21% e 18% e) 34% e 17% Questão 935 Suponha que uma variedade de determinada planta possua um gene que lhe confere vantagem em relação a uma outra variedade da mesma população. ausentes d) Pequena. (01) A população está em equilíbrio se estiver ocorrendo seleção natural há. direcionados. é possível determinar se a população está ou não em equilíbrio.56 c) 0. numa população. Em uma população que está 212 . Então.49 e 0. (32) Quando todas as freqüências genotípicas são iguais. pelo menos.25. Questão 939 Na espécie humana.. ao acaso. c) à seleção natural.6. ao acaso.

( ) os cruzamentos. ( ) não ocorram fluxos migratórios. em uma população. c) o gene dominante é mais freqüente que o recessivo. d) 30% dos gametas produzidos carregam o alelo recessivo. d) 36%. d) a probabilidade de formação de gametas B é de 80% nessa população. as populações sejam panmíticas. a freqüência de indivíduos Rh negativos é de 16%. que se cruza ao acaso. ou seja. as freqüências dos alelos. respectivamente. e) a probabilidade de ocorrência de homozigotos nessa população é de 52%. Aa e aa é. Questão 943 Uma população em equilíbrio é constituída de 500 indivíduos. que surjam por mutação.000 sementes de uma população panmítica. das quais 12. dos quais 45 apresentam um fenótipo determinado por gene recessivo. Weinberg postularam que. b) 40%. 15% e 15%. Com base nesses dados é INCORRETO afirmar-se que a) a freqüência de indivíduos com fenótipo dominante é 91% b) cerca de 10% da população é homozigota. sob condições especiais. e de cada genótipo. é necessário que: ( ) não haja pressão de seleção natural. Aa e aa numa população em equilíbrio.5. O gene B é responsável pela cor branca e seu alelo recessivo. ( ) os novos alelos. Um agricultor colheu 20. e) 24%. b) a freqüência de heterozigotos nessa população é de 24%. e) 80%. a freqüência de heterozigotos será: a) 15% b) 25% c) 50% d) 75% e) 100% Questão 941 O gráfico mostra as relações entre as freqüências dos alelos A e a e as freqüências genotípicas AA. A partir dessas informações pode-se afirmar que a) a freqüência do gene para coloração amarela é de 36% nessa população. Questão 945 G. ocorram ao acaso. e) os heterozigotos representam 42% da população. A probabilidade de ocorrência de indivíduos heterozigotos nessa população é a) 84%. se 213 1. pela cor amarela. os quais acarretam troca de alelos entre populações diferentes. a) 25%. . c) 48%.7 Numa população em equilíbrio. nas populações. b) 60%. 30% e 30%. permanecem constantes. em que os casamentos ocorrem ao acaso e a freqüência dos genes A e a é de 50% para cada um. geração após geração. H. A probabilidade de se encontrarem indivíduos AA. c) 50%. Para que isso ocorra. 25% e 25%. c) a freqüência de plantas com raízes amarelas será de 64% se a população se mantiver em equilíbrio.em equilíbrio de Hardy-Weinberg. uma vez que esta tende a selecionar determinados alelos em detrimento de outros.800 desenvolveram plantas com raízes brancas. Questão 942 Numa população em equilíbrio. 10% e 10%. que podem desaparecer. Hardy e W. segundo os referidos autores. Questão 944 A cor da raiz da cenoura é controlada por um par de genes autossômicos. d) 70%. 50% e 25%.

9% nascem com anemia falciforme. é possível que a seleção natural seja a causa do aumento do número de heterozigotos.7. pode-se concluir corretamente que: a) a população estudada é infinitamente grande. uma vez que as freqüências gênicas foram alteradas. c) 3/10. Se houver 48 heterozigotos. os cruzamentos ocorram de modo preferencial e esteja sujeita a fatores evolutivos. b) o tamanho da população seja reduzido. a partir de seu estabelecimento.incorporem rapidamente ao estoque gênico. por um dominante. Questão 950 Numa população a freqüência do gene dominante W é 0. 4. d) 42/100. tais como mutação. Questão 951 No estudo da genética de populações. ela estará em equilíbrio de Hardy-Weinberg. a) Somente a afirmativa 1 é verdadeira. b) Somente as afirmativas 1 e 2 são verdadeiras. as cores externas das conchas são determinadas por dois alelos de um gene. seleção natural e migrações. os cruzamentos sejam ao acaso. os cruzamentos ocorram ao acaso e esteja sujeita a fatores evolutivos. em uma população em equilíbrio genético as freqüências gênicas e genotípicas permanecem constantes ao longo das gerações. sendo a cor azulada determinada por um alelo recessivo e a cor castanha. e) Somente as afirmativas 3 e 4 são verdadeiras. foram encontrados 16 azuis. Se os valores das freqüências gênicas de uma população. os cruzamentos ocorram de modo preferencial e esteja isenta de fatores evolutivos. os cientistas Hardy e Weinberg formularam um teorema cuja importância está no fato dele estabelecer um modelo para o comportamento dos genes nas populações naturais. Em 214 . d) a população seja de tamanho reduzido. Com relação a essa população. 3. na qual p indica a freqüência do alelo dominante e q indica a freqüência do alelo recessivo. tais como mutação. c) a população seria infinitamente grande. A probabilidade de um indivíduo desta população ser heterozigoto Ww é igual a: a) 9/100. d) a população está evoluindo. tais como mutação. b) 49/100. Questão 949 De acordo com a Teoria de Hardy-Weimberg. Assinale a alternativa correta. é necessário que a) a população seria infinitamente grande. Em uma população de cem animais. e) 1/2. ( ) nas populações demasiadamente pequenas. Para tanto. d) Somente as afirmativas 2 e 4 são verdadeiras. tais como mutação. 2. inviabilizando a aplicação do teorema. Questão 946 Numa certa população de africanos. observada ao longo de gerações. seleção natural e migrações. e) os cruzamentos nessa população ocorrem ao acaso. Ela não pode estar em equilíbrio de Hardy-Weinberg. seleção natural e migrações. c) Somente as afirmativas 1 e 3 são verdadeiras. os cruzamentos ocorram ao acaso e esteja isenta de fatores evolutivos. considere as seguintes afirmativas: 1. utiliza-se a fórmula p£ + 2pq + q£ = 1. c) a população encontra-se em equilíbrio genético. b) não houve a atuação dos fatores evolutivos sobre a população. A endogamia pode ser a causa do desvio em relação ao equilíbrio de Hardy-Weinberg. Questão 948 Em mexilhões. Qual o percentual da população que possui a vantagem heterozigótica? a) 9% b) 19% c) 42% d) 81% e) 91% Questão 947 Em 1908. seleção natural e migrações. Se houver 30 heterozigotos. forem significativamente diferentes dos valores esperados através da aplicação do teorema. se houver 76 animais castanhos.

72.18.0.81.1 e) AA . Questão 952 Sabendo-se que a freqüência de um gene recessivo a.9.0. é 0.0. aa .0. b) 61%. d) reproduzam-se. Aa . o genótipo heterozigoto tenha freqüência 2pq=0. aa .0.25. c) reproduzam-se. b) haja manutenção do tamanho da população ao longo das gerações.0.0. Aa .0.09. 1.0.50.0. c) os alelos que expressam fenótipos mais adaptativos sejam favorecidos por seleção natural. aa .25. d) a somatória da freqüência dos diferentes alelos. b) morram por ficarem prejudicadas na realização da síntese protéica.25. testes de paternidade.1 d) AA . etc.5 e o genótipo homozigoto recessivo tenha freqüência q£=0. ou dos diferentes genótipos.18. d) 49%. se estiver em equilíbrio. estudou a estrutura da molécula de DNA e seu funcionamento e analisou os dados do quadro a seguir. transferindo as características implantadas para as células-filhas. Aa . Verificou-se que existiam. Assim. 1. numa porcentagem de 9%.0. produzindo células defeituosas incapazes de sobreviver. a freqüência dos indivíduos do grupo MN dessa população é de: a) 79%.81.09.8. e) cresçam. aa .0. aa . produzindo anticorpos contra as proteínas estranhas que serão fabricadas. Aa . serão: a) AA .uma população em equilíbrio de Hardy-Weinberg espera-se que a) o genótipo homozigoto dominante tenha freqüência p£=0.1. numa população. seja igual a 1.0. Aa .5. c) 50%. engenharia genética.0. portadores de sangue do tipo N.1 215 .1 Questão 955 João ficou intrigado com a grande quantidade de notícias envolvendo DNA: clonagem da ovelha Dolly. e) ocorra manutenção das mesmas freqüências genotípicas ao longo das gerações. terapia gênica.0.5. Para conseguir entender as notícias.01 b) AA . e) 42%.01 c) AA .25 Questão 953 Os grupos sanguíneos de uma população foram estudados no que se refere ao sistema MN dos seus indivíduos. as freqüências genotípicas esperadas para essa população. Questão 954 Cientistas conseguiram inserir um grande trecho de ADN estranho ao ADN de cobaias como mostra o desenho a seguir: O resultado esperado para este trabalho é que as células que receberam o implante: a) morram pela presença de ácido nucléico estranho à composição do núcleo.8.

G = 10% e) T = 40%. C = 10%. engenharia genética. C = 60%. G = 10% d) T = 40%. como resultado da diferenciação celular.1 m I está representado o trecho de uma molécula de DNA. Observando o quadro. G = 60% Questão 956 João ficou intrigado com a grande quantidade de notícias envolvendo DNA: clonagem da ovelha Dolly. Questão 958 As técnicas utilizadas pela Engenharia Genética permitem que se atue em uma substância presente em todas as células. d) pares específicos apenas nos gametas. citosina e guanina.1 1. e é formada por cadeias polipeptídicas que apresentam em sua composição os aminoácidos adenina. citosina e guanina. timina.nalisando-se o DNA de um animal. uracila.8. cada molécula de DNA dá origem a 4 moléculas de DNA exatamente iguais. testes de paternidade. C = 10%. d) na molécula de DNA. 216 . o que garante a diversidade da vida. e é formada por cadeias polinucleotídicas que apresentam em sua composição as bases nitrogenadas adenina. 1. podem existir 5 diferentes tipos de bases nitrogenadas. b) DNA. procariontes e eucariontes. C = 20%. comparação das proporções permitiu concluir que ocorre emparelhamento entre as bases nitrogenadas e que elas formam a) pares de mesmo tipo em todas as espécies. G = 40% b) T = 10%. c) pares diferentes em diferentes células de uma espécie. c) RNA. os valores encontrados para as outras bases nitrogenadas foram: a) T = 40%. pois essas células são responsáveis pela perpetuação das espécies. e é formada por cadeias polinucleotídicas que apresentam em sua composição as bases nitrogenadas adenina. G = 40% c) T = 10%. sendo responsável pelo controle do seu metabolismo. citosina. detectou-se que 40% de suas bases nitrogenadas eram constituídas por Adenina. Para conseguir entender as notícias. um estudo pioneiro determinou a proporção das bases nitrogenadas que compõem moléculas de DNA de várias espécies.5. pois esses organismos são formados por uma única célula. evidenciando a universalidade da estrutura do DNA. Questão 957 A identificação da estrutura do DNA foi fundamental para compreender seu papel na continuidade da vida. podem existir diferentes tipos de complementação de bases nitrogenadas. guanina e timina. Na década de 1950. etc.5. Essa substância se denomina a) DNA. e) no processo de mitose.8. b) na molécula de DNA. e) pares específicos somente nas bactérias. estudou a estrutura da molécula de DNA e seu funcionamento e analisou os dados do quadro a seguir. C = 40%. pode-se concluir que: a) a molécula de DNA é formada por 2 cadeias caracterizadas por seqüências de bases nitrogenadas. terapia gênica. b) pares diferentes de acordo com a espécie considerada. c) a quantidade de A presente em uma das cadeias é exatamente igual à quantidade de A da cadeia complementar. Relacionando esse valor com o emparelhamento específico das bases.

Dessa cultura. entre outros). Questão 961 A tabela mostra a composição das bases nitrogenadas púricas. d) 200 apresentavam o DNA e o RNA marcados. por centenas de gerações.0 Questão 962 Bactérias foram cultivadas em um meio nutritivo contendo timina radioativa. A análise dos ácidos nucléicos mostrou que dessas 800 bactérias a) 100 apresentavam o DNA marcado. e) todas apresentavam o DNA e o RNA marcados.4 e 21. b) guanina e timina. c) citosina e guanina. Assinale a alternativa correta em relação à porcentagem de guanina. b) 200 apresentavam o DNA marcado.0 e) 30. testes de paternidade. não se encontra no núcleo da célula. e) transcriptase. e é formada por aminoácidos que apresentam em sua composição a ribose. mas não o RNA.6 e 21. mas não o RNA. e) citosina e uracila. e) A molécula de DNA.4 c) 29. Essas bactérias sofreram três divisões no novo meio. a) A molécula de DNA é constituída por uma fita única e por vários nucleotídeos que têm a transcrição como principal função. nos DNAs do homem e do boi. nos organismos eucariontes. mapa genético. produzindo 800 bactérias. c) A molécula de DNA não é capaz de produzir a molécula de RNA. células musculares e células nervosas diferem principalmente por: a) possuírem genes diferentes.0 e 30. b) possuírem ribossomos diferentes. Nela identificamos 20% de adenina.d) polimerase. d) expressarem genes diferentes.0 e 30. Questão 963 Em um organismo. e é formada por aminoácidos que apresentam em sua composição a desoxirribose. d) A molécula de DNA tem função de duplicação e é constituída por uma fita dupla. Assinale a afirmação correta. Questão 964 Um pesquisador que pretende estudar comparativamente a síntese de DNA e RNA em uma célula deve usar nucleotídios radiativos contendo a) timina e uracila.0 b) 21. Adenina 30. sendo que cada filamento é composto por vários nucleotídeos.4% ? Guanina ? 21. novos métodos de diagnóstico foram desenvolvidos e utilizados para inúmeros fins (identificação de microrganismos patogênicos. b) A molécula de DNA nas bactérias se encontra na carioteca da célula. respectivamente: a) 19. adenina e guanina. c) 400 apresentavam o DNA marcado. c) possuírem cromossomos diferentes. medicina forense. Questão 959 Uma molécula de DNA apresenta uma dupla hélice de cadeias polinucleotídicas. a) 20% b) 30% c) 40% d) 50% e) 60% Questão 960 Depois da descoberta da estrutura da molécula do Ácido Desoxirribonucléico (DNA ou ADN). foram isoladas 100 bactérias e transferidas para um meio sem substâncias radioativas. Homem Boi 217 . mas não o RNA.6 e 29.0% As porcentagens que estão faltando para o homem e para o boi são.4 d) 19. d) adenina e timina. e) utilizarem código genético diferente.

d) é integrante do nucléolo e dos ribossomos. d) ácido fosfórico só entra na composição química do DNA. Questão 966 Na figura a seguir que representa o modelo da molécula de DNA os números 1. Questão 972 O DNA e o RNA quanto à sua estrutura química. d) citosina é igual a de adenina. c) polissacarídeos. b) citosina é igual a de timina. c) pontes de hidrogênio. ácido fosfórico e base nitrogenada.Questão 965 Importante informação que permitiu o estabelecimento de um modelo para a molécula de DNA foi a verificação de que o número de adenina-nucleotídeos era sempre igual ao de timina-nucleotídeos. Questão 970 Sobre o DNA. base nitrogenada e desoxirribose. é INCORRETO afirmar que a) possui a base nitrogenada uracila. Questão 969 Moléculas de DNA constituídas por duplo filamento helicoidal mantêm as cadeias unidas entre si por a) ligações covalentes.5. e) timina pareia com adenina no RNA. o mesmo ocorrendo com a guanina e citosina-nucleotídeos.8. Questão 971 Sobre o DNA. b) ligações iônicas. ácido fosfórico e base nitrogenada. b) nucleoproteínas. c) ribose. a quantidade de a) adenina é igual a de citosina. b) origina o RNA mensageiro c) reproduz-se de modo semiconservativo. e) é formado de dupla cadeia com formato helicoidal. b) ácido fosfórico. são classificados como a) polipeptídeos. ribose e base nitrogenada. é CORRETO afirmar que a) possui a base nitrogenada uracila. Questão 968 Comparando as estruturas dos ácidos nucléicos desoxirribonucléico (DNA) e ribonucléico (RNA) pode-se afirmar que a) timina é uma base nitrogenada exclusiva do RNA. b) não origina o RNA mensageiro c) não é capaz de replicar-se. respectivamente a) desoxirribose. O fato nos permite afirmar que os nucleotídeos a) ocorrem em igual quantidade. d) é integrante dos genes e dos cromossomos. e) ácido fosfórico. c) guanina é igual a de citosina. c) ribose é um açúcar que entra na composição química do RNA. desoxirribose e base nitrogenada. d) pirimídicos pareiam com outros pirimídicos. 2 e 3 indicam. d) ácido fosfórico. d) pontes de nitrogênio. c) púricos pareiam com outros púricos. e) ligam-se como se fossem o corrimão de uma escada. e) é formado de dupla cadeia com formato helicoidal.1 Questão 967 Numa molécula de DNA. e) ligação metálica. b) uracila é uma base nitrogenada exclusiva do DNA. b) ocorrem aos pares na molécula de DNA. 218 1. e) adenina é igual a de uracila. .

pode-se afirmar que a cadeia complementar a esse segmento terá a seqüência a) AAT GGC TAA TAC.1 219 . Questão 973 Qual das seguintes bases nitrogenadas NÃO entra na composição química do DNA? a) Timina. b) UUT GGC TUU UAC. base nitrogenada e ácido fosfórico. b) Desoxirribose. desoxirribose e base nitrogenada. c) TTA CCG ATT ATG. e) Guanina. e) timina pareia com adenina no DNA. ribose e ácido fosfórico. Questão 978 Comparando as estruturas dos ácidos desoxirribonucléico (DNA) e ribonucléico (RNA) NÃO se pode afirmar que a) timina é uma base nitrogenada exclusiva do DNA. b) ácido fosfórico. e) AAU GGC UAA UAC. d) Uracila. b) Citosina. 1. 2 e 3. d) ácido fosfórico entra na composição química do DNA e do RNA. d) ácido fosfórico. e) polinucleotídeos. sabendo-se que a figura adiante representa a unidade estrutural do ácido desoxirribonucléico (DNA). c) nucléolo e cloroplasto. respectivamente. d) citosina é igual a de adenina. e) base nitrogenada. Questão 976 Observa-se a presença de DNA nos seguintes organóides citoplasmáticos a) mitocôndria e ribossomo.5. Questão 974 Qual das seguintes moléculas NÃO entra na composição química do DNA? a) Ribose. d) lisossomo e ribossomo. e) mitocôndria e cloroplasto. Questão 975 Se um segmento de DNA possui a seqüência de bases nitrogenadas TTA CCG ATT ATG. c) desoxirribose. desoxirribose e ácido fosfórico. ribose e base nitrogenada. b) citosina é igual a de timina. d) Adenina. e) adenina é igual a de timina. c) guanina é igual a de adenina. b) uracila é uma base nitrogenada exclusiva do DNA. a) base nitrogenada. c) Ácido fosfórico. a quantidade de a) adenina é igual a de citosina. c) Adenina. Questão 979 Assinale a alternativa que relaciona corretamente o nome das moléculas representadas pelos números 1. c) ribose é um açúcar que entra na composição química do RNA. e) Guanina. b) ribossomo e cromossomo. d) AAT GGC TAA UAC. Questão 977 Na molécula de DNA.8.d) fosfatídeos.

d) citosina é igual a de adenina. Assinale a alternativa que contém a porcentagem correta de cada uma das demais bases nitrogenadas. mitocôndrias e cromossomos. c) ácaros. b) centríolos. ribossomos e centríolos. Timina = 16% e Adenina = 16% d) Guanina = 34%. Citosina = 30% e Timina = 30% d) Adenina = 30%. e) guanina é igual a de citosina. cromossomos e complexo de Golgi. b) citosina é igual a de timina. Citosina = 20% e Timina = 30% b) Adenina = 20%. cromossomos e lisossomos. Timina = 16% e Adenina = 16% b) Guanina = 16%. d) ser um polipeptídeo. centríolos e lisossomos. citosina e adenina. Timina = 34% e Adenina = 34% c) Guanina = 34%. e) lisossomos. Assinale a alternativa que relaciona corretamente as outras bases nitrogenadas e suas respectivas proporções: a) Citosina = 15%. b) presença das bases nitrogenadas uracila. Adenina = 15% e Timina = 15% b) Citosina = 35%. c) ribossomos. c) retículo endoplasmático. c) ausência de ácido fosfórico. c) polinucleotídeos. a) Adenina = 20%. d) enzimas. d) liquens. Questão 987 As evidências de que o DNA é a substância hereditária que determina as características dos seres vivos foram primeiramente observadas em a) vírus. Citosina = 40% e Timina = 40% e) Adenina = 40%. d) cloroplastos. guanina. o conteúdo de guanina no seu DNA é 30%. ribossomos e cromossomos. Adenina = 15% e Timina = 15% c) Citosina = 15%. Timina = 34% e Adenina = 16% Questão 984 Numa molécula de DNA formada por uma dupla-hélice a quantidade de a) adenina é igual a de citosina. e) vacúolos. Questão 985 Assinale a alternativa que relaciona as estruturas celulares em se observa a presença de DNA: a) membrana plasmática. Adenina = 35% e Timina = 35% e) Citosina = 15%. complexo de Golgi e cromossomos. Adenina = 15% e Timina = 35% Questão 983 Uma molécula de DNA contém 16% de Citosina. Adenina = 35% e Timina = 15% d) Citosina = 15%. e) bactérias. c) adenina é igual a de uracila. e) lipídios. Segundo esse modelo esses ácidos são a) micromoléculas. centríolos e cromossomos. Citosina = 30% e Timina = 40% 220 . Citosina = 30% e Timina = 20% c) Adenina = 30%. Crick em 1953. b) cloroplastos. Assinale a alternativa que relaciona corretamente as outras bases nitrogenadas e suas respectivas proporções? a) Guanina = 16%. cromossomos e mitocôndrias. Questão 981 É característica do DNA: a) açúcar com quatro átomos de carbono. Timina = 34% e Adenina = 16% e) Guanina = 34%. e) ocorre nos cromossomos. b) polipeptídeos. Questão 988 Num dado organismo. Questão 982 Uma molécula de DNA contém 15% de Guanina. d) membrana plasmática. b) protozoários. Watson e F.Questão 980 O modelo molecular dos ácidos nucléicos (DNA e RNA) foi proposto por J. complexo de Golgi e ribossomos Questão 986 Sabemos que os genes são constituídos de DNA e estão localizados nas seguintes estruturas celulares: a) lisossomos.

e) há grande multiplicação do DNA viral no interior da bactéria. III e IV. c) translocação. Foi realizada a análise de um mesmo trecho do DNA.1 . Questão 993 Duas mulheres disputam a maternidade de uma menina. Seu açúcar é a desoxirribose. Possui capacidade de autoduplicação. É constituído por uma única cadeia de nucleotídeos.Questão 989 O esquema a seguir mostra um tipo de ciclo reprodutivo dos bacteriófagos. 1.b e acordo com o esquema. Questão 990 Considere as características do DNA abaixo discriminadas. e) I.1 .b b) I . c) I. IV. b) II e IV.a c) II . b) o DNA viral se incorpora ao cromossomo bacteriano. Com Timina 2. d) inversão. obtido de um dos cromossomos X de cada mulher e da menina. III e IV.8. Questão 991 Os itens abaixo se referem aos ácidos nucléicos: Estrutura I. b) duplicação. III. somente. d) as bactérias perdem a capacidade de se dividir.1 221 .5.2 . Transcrição b. São corretas a) II e III. Dupla hélice Composição Questão 992 Supondo que ocorra um evento genético raro em que dois cromossomos não-homólogos. quebram-se e voltam a se soldar.a d) II . Cadeia simples II. de uma mesma célula. As seqüências de bases do referido trecho gênico estão esquematizadas adiante: 1. somente.a e) I . I.2 .1 . d) II.1 a) II . Síntese protéica São características do ácido desoxirribonucléico (DNA): 1. somente. somente. II. porém com os segmentos trocados. II.8. Uma de suas bases nitrogenadas é a timina. estaríamos verificando a ocorrência de a) crossing-over. III e IV. Com Uracila Função a. verifica-se que a) ocorre lise da bactéria no fim do ciclo. c) o DNA viral é destruído pela bactéria. e) deleção.5.

b) 20 timinas. já é possível detectar por meio de exames de DNA (ácido desoxirribonucleico) a probabilidade de uma pessoa desenvolver doenças (. e) As enzimas RNA e DNA polimerase. 10/08/97) Sabe-se que o citado mapeamento é feito a partir do conhecimento da seqüência de bases do DNA. c) As enzimas RNA e DNA polimerase. d) base nitrogenada e de fosfato. c) base nitrogenada e de açúcar. contendo as bases nitrogenadas adenina.5. c) em todos os organismos. Com base nos conhecimentos sobre o tema. pois a menina recebe seus dois cromossomos X da mãe e apenas um deles foi analisado. é correto afirmar que: a) todas as trincas da molécula do mRNA especificam algum aminoácido.. d) não são suficientes. d) A enzima DNA polimerase. apenas. apenas.8. os três tipos de RNA (mensageiro. os vinte tipos diferentes de aminoácidos. citosina e guanina. de açúcar e de fosfato. a) Quatro diferentes tipos de nucleotídeos. transportador e ribossômico) e DNA. apenas. pois o cromossomo X da menina analisado pode ser o de origem paterna. corretamente. DNA e RNA. e) não podem ser considerados. as moléculas imprescindíveis que ele deve utilizar para que possa atingir o seu objetivo. vinte tipos diferentes de aminoácidos. adenina e citosina. d) as estruturas espaciais e moleculares do DNA e RNA são 222 . Com base nesses dados. RNA mensageiro e DNA. timina. apenas. a enzima DNA polimerase e DNA. só existe um gene para cada molécula de DNA. no segmento correspondente da cadeia complementar há 10 adeninas e 30 guaninas. (O GLOBO. Questão 996 Considere que um cientista esteja. guanina. é: 1. tentando reproduzir "in vitro" a síntese de moléculas de DNA. b) são suficientes para excluir a possibilidade de uma das mulheres ser a mãe da menina. a enzima RNA polimerase.. b) Os nucleotídeos contendo as bases nitrogenadas timina. pois uma menina não recebe cromossomo X de sua mãe. em um laboratório. Questão 994 Com relação à composição química.1 Questão 998 Tendo em vista a estrutura e a função dos ácidos nucléicos. b) base nitrogenada. assinale a alternativa que indica. Questão 997 TESTES GENÉTICOS: A Ciência se antecipa à doença Com o avanço no mapeamento de 100 mil genes dos 23 pares de cromossomos do núcleo da célula (projeto Genoma. c) não são suficientes. conclui-se que nos segmentos de RNA originários desse DNA haverá a) 30 citosinas. Questão 995 Em um segmento de cadeia ativa de DNA há 20 adeninas e 15 guaninas. c) 15 guaninas. e) 10 adeninas. iniciado em 1990.Os dados obtidos a) são suficientes para excluir a possibilidade de qualquer uma das mulheres ser a mãe da menina. O esquema abaixo que representa o pareamento típicos de bases encontradas na molécula de DNA. d) 10 uracilas.). as moléculas de DNA e RNA diferem entre si quanto ao tipo de a) açúcar. DNA e RNA. nos EUA). e) base nitrogenada. b) as moléculas do ácido ribonucléico (RNA) são hélices duplas de polirribonucleotídeos.

"Folha de São Paulo". A inferência vem diretamente do DNA do mamute-lanoso ('Mammuthus primigenius'). Questão 1002 Um laboratório recebeu três amostras de DNA para investigar se pertenciam a espécies diferentes.5. c) Genes que possuem. A quantidade e a relação entre as bases das amostras estão apresentadas nesta tabela: 1. Questão 999 Leia o texto a seguir. b) seu DNA era composto por bases nitrogenadas.000 genes. sugere análise de DNA. que podem ser observadas nestas representações esquemáticas: 1.5. Em relação às características genéticas deste mamífero.8. Mamutes podem ter tido pêlo "loiro". c) os genes cuja atividade não é necessária ao funcionamento de uma célula perdem a capacidade de duplicação. É uma das primeiras vezes em que os genes de um bicho extinto dão pistas sobre características suas em vida.1 odas as alternativas apresentam diferenças entre essas células. Questão 1001 Células provenientes de um indivíduo foram examinadas ao microscópio e revelaram diferenças estruturais. b) Funções que realizam. é CORRETO afirmar que a) o genótipo das células do tecido nervoso é diferente do genótipo das células do tecido epitelial. ribose e fosfato. codificam proteínas. b) o número total de genes.8. d) Tecidos a que pertencem. e) as duas metades da hélice dupla do DNA têm seqüências iguais de bases nitrogenadas. de exemplares mortos há 43 mil anos na Sibéria. d) os genes responsáveis pelo sistema sangüíneo ABO estão presentes nas células epiteliais. d) suas moléculas de DNA apresentavam estrutura helicoidal. mas são incapazes de se expressar. O mamífero-símbolo da Idade do Gelo provavelmente tinha dois tipos de pelagem: castanho-escuro e loiro.1 223 . Considerando-se essa informação e conhecimento sobre o assunto. e) seus genes para o tipo de pelagem localizavam-se no DNA mitocondrial. Questão 1000 Sabe-se que o homem possui em torno de 80. c) seus genes estavam organizados nos plasmídeos. entre outras funções. após a diferenciação e a especialização das células. EXCETO a) Forma ou localização dos seus núcleos. reduz-se. 07/07/2006. que.diferentes. é possível afirmar corretamente que: a) seus genes estavam dispostos em cromossomos circulares.

e) 30. c) 29.4 % Guanina = ? Cão: Adenina = ? Guanina = 21. Posteriormente. ( ) metade das moléculas da geração F2 terão a densidade leve e apenas 12.8. ( ) A composição do meio de cultura não exerceu influência no experimento uma vez que a bactéria cresceu em todos os meios.5. 1.0.F2 e F3).5% terão a densidade intermediária em F3. cultivaram.0 % As percentagens que estão faltando para o homem e cão são.4. que as fitas de DNA serviam de modelo para sua própria replicação. b) a amostra 3 possui o mais alto conteúdo de pares de bases A e T.5.6 e21. ( ) eles concluíram. c) a amostra 2 apresenta DNA de fita simples. analise as proposições a seguir. 'Escherichia coli' (geração F0) na presença de N¢¦ (isótopo pesado). b) 21.6 e 29. mediante precipitação baseada em suas diferentes densidades. ( ) a tendência da fita de DNA pesada é desaparecer no decorrer das gerações.1 A partir desse experimento pode-se afirmar que: ( ) todas as moléculas da geração F1 terão a densidade intermediária entre a pesada e a leve. respectivamente: a) 19. Questão 1004 Meselson e Stahl. Questão 1005 Considerando que na figura a seguir tem-se uma representação plana de um segmento da molécula de DNA.8.om base nas informações dessa tabela e em outros conhecimentos sobre o assunto. cresceram diversas gerações das bactérias em N¢¥ (isótopo leve) e extraíram o DNA das sucessivas gerações (gerações F0. F1 .4 e 21. conforme esquematizado abaixo.4.0 e 30. em 1957. 1. como foi antecipado por Watson e Crick.1 224 .0. é INCORRETO afirmar que a) as três amostras são provenientes de diferentes espécies. inicialmente. Questão 1003 A composição das bases púricas adenina e guanina do DNA do homem e do cão são as seguintes: Homem: Adenina = 30. d) 19.0 e 30. d) as amostras 1 e 3 apresentam alta homologia entre seus DNAs.0.

onde existia o ¢¥N como única forma de nitrogênio. a) 1 apenas b) 2 e 3 apenas c) 1.) Um nucleotídeo é formado por um grupo fosfato (I).. A obtenção dessas plantas se deve à biotecnologia.8. 225 1. os cientistas produziram plantas que brilham porque expressam os genes de bioluminescência dos vaga-lumes. d) Um gene é uma molécula de RNA que atua diretamente na síntese protéica. A. 4) Pontes de hidrogênio se estabelecem entre as bases nitrogenadas T e A e entre as bases nitrogenadas C e G." (Griffiths. e camundongos gigante que expressam os genes do hormônio de crescimento de ratos. b) Um gene é um segmento do DNA que contém a informação necessária para a produção de uma determinada proteína. 3 e 4 apenas e) 1. nesse novo meio. essas bactérias foram transferidas para um novo meio. a) Um gene é um cromossomo da célula vegetal ou animal. a) ao final da 1 geração. sendo o restante não-híbrido. d) ao final da 2 geração. 3 e 4 Questão 1006 Na figura a seguir é ilustrado um processo muito importante para a vida. o qual se incorporou nas moléculas de DNA. 1998) O texto acima se refere a organismos transgênicos. 2) Um nucleotídeo com Timina (T) em uma cadeia pareia com um nucleotídeo com Adenina (A) em outra cadeia. e) Um gene é uma cadeia de aminoácidos que codifica o código genético. et al. Está(ão) correta(s). Assinale a alternativa que define o que é um gene. Posteriormente. 2.. "A biotecnologia de genética molecular foi inicialmente aplicada a micróbios. cada molécula híbrida de DNA formará duas moléculas. Em relação ao experimento. de plantas transgênicas. Analise-o e assinale a alternativa que indica corretamente qual é este processo. sendo uma híbrida e outra não.5. uma molécula do açúcar desoxirribose (II) e uma molécula de base nitrogenada. 2 e 3 apenas d) 2. 3) Um nucleotídeo com Guanina (G) em uma cadeia pareia com um nucleotídeo com Citosina (C) em outra cadeia. c) ao término da 2 geração. "Introdução à Genética". 6 ed. que são aqueles em cujo genoma foi introduzido um gene de uma outra espécie ou mesmo um gene produzido em laboratório. todas as moléculas de DNA apresentarão apenas ¢¥N incorporado. b) ao término da 1 geração.1 a) Produção de proteína b) Transcrição do RNA c) Produção de RNAribossômico d) Helicoidização do DNA e) Replicação do DNA Questão 1007 Um tema que vem despertando grande polêmica no Brasil atualmente é a liberação. resultando em tipos criados que nunca poderiam ter sido produzidos com a genética clássica. (.) Com a capacidade de mover genes de um organismo para outro. plantas que adquirem resistência ao frio por expressar genes anticongelantes de peixes. pode-se prever que.J.F. mas hoje as mesmas técnicas estão . c) Um gene é uma proteína que tem função específica em uma determinada rota metabólica. serão formadas moléculas de DNA apenas com ¢¦N e moléculas apenas com ¢¥N. Rio de Janeiro: Guanabara Koogan. para cultivo. Questão 1008 Gerações sucessivas de bactérias da espécie 'Escherichia coli' foram cultivadas num meio cuja única fonte de nitrogênio era o isótopo ¢¦N. cerca de 1/4 do DNA será híbrido. sendo aplicadas a plantas e animais.

a bactéria 'Escherichia coli' foi cultivada.2 .1 Com relação a esses dados. Esse enfoque é interessante. podemos concluir que a) a replicação do DNA é semiconservativa. "Ciência Hoje".2 . 29. Adaptado de SALZANO. ele comparou 21 genomas completos de representantes das três linhagens primárias da vida: as eubactérias. O resultado da pesquisa mostrou que o número de genes deve situar-se em torno de 150. e) não ocorreu replicação do DNA mas.2 . Julgue os itens a seguir. c) a replicação do DNA é randômica.Questão 1009 Meselson e Stahl.No código genético. e) I. d) não ocorreu replicação do DNA mas.2.2 . ( ) bases nitrogenadas: adenina.2 . 173. do que é exemplo a recente clonagem de uma ovelha.1 . b) Apenas II.1 . citosina. tem-se constatado um progresso fantasticamente acelerado da Biologia Molecular. b) a replicação do DNA é conservativa. em meio contendo um isótopo pesado de nitrogênio.Os genes envolvidos na replicação. b) 2 . d) Apenas II e III. Questão 1010 Leia o texto abaixo. v. sim.2 . guanina. Questão 1012 Desde que Watson e Crick propuseram um modelo para a estrutura do DNA. F. d) 2 . por muitas gerações.2.M.1. sim. uracila A seqüência correta é a) 1 . e) 1 .1 .2. c) 1 .Os genes compartilhados pelos genomas dos diferentes grupos devem ser essenciais. As moléculas de DNA das bactérias foram então isoladas e analisadas com relação ao seu conteúdo de ¢¦N e de ¢¥N. em 1957. 1. jul. Para isso. II e III. c) Apenas III. Nesse experimento. Considere as seguintes afirmações. em 1953.2 . guanina. transcrição. 226 . acerca do referido ácido nucléico. transcrição e tradução do material genético devem fazer parte do conjunto mínimo de genes.1. pois permite imaginar os primeiros sistemas genéticos surgidos por ocasião da origem da vida. citosina.2 . Quais delas poderiam ter embasado o raciocínio de Koonin? a) Apenas I. sendo observado o seguinte: I . as arqueobactérias e os eucariontes.2 .DNA 2. ¢¦N.2 . a cada códon deve corresponder mais de um aminoácido. n.1 . Depois disso.RNA COLUNA 2 ( ) dupla hélice ( ) ribose ( ) fita única ou simples ( ) desoxirribose ( ) bases nitrogenadas: adenina. as bactérias foram transferidas para um meio contendo nitrogênio leve. 2001. ¢¥N. II .1 . Koonin investigar qual seria o número mínimo de genes capazes de sustentar o funcionamento de uma célula.1 . uma mutação.8.1 . fizeram um experimento sobre a replicação do DNA.5.1 . timina.2 . até todo o seu DNA estar marcado com esse isótopo. Questão 1011 Numere a 2 coluna de acordo com a 1 COLUNA 1 1.1 . A entrada na era da genômica possibilitou ao norte-americano Eugene V. III .

à 2 lei de Mendel. IV. d) é polinucleotídeo. III e V. I. II. Na meiose I. citosina e adenina. apenas. IV e V. Questão 1013 A partir dos anos 1900. d) Y e mitocondrial. b) a presença das bases nitrogenadas uracila. Sérgio Penna. (4) As mutações gênicas implicam necessariamente a modificação do fenótipo do indivíduo. a segregação de cromossomos homólogos que apresentam os mesmos alelos resulta nas proporções da geração F2 dos experimentos de Mendel. b) I. Na meiose II. (2) A coloração de cromossomos com vários matizes é uma técnica atual que se baseia no uso de vários corantes para os diferentes lipídios que constituem os cromossomos. e) X e mitocondrial. e) ocorre nos cromossomos. a segregação das cromátides dos diferentes pares cromossômicos corresponde. revelou que a contribuição dos europeus na composição genética do povo brasileiro fez-se basicamente por meio de indivíduos do sexo masculino. apenas. Genes localizados em regiões próximas de um mesmo cromossomo implicam em distorções das proporções mendelianas. c) Y e do cromossomo X. e) II e V. IV e V. II. (5) Nos processos de fecundação natural. em efeito. Analise cada uma das afirmações seguintes. II. apenas. pesquisador da Universidade Federal de Minas Gerais. II. à 1 lei de Mendel. Na meiose I. Questão 1014 No artigo "Retrato molecular do Brasil" ("Ciência Hoje". a mãe transmite maior quantidade de DNA para o filho do que o pai. (3) No processo de recombinação entre cromátides. d) I. em efeito. São afirmações corretas: a) I. respectivamente. uma série de observações e experimentos indicaram uma correlação entre o comportamento dos cromossomos na célula em divisão e as leis mendelianas. o carbono não faz parte da estrutura do DNA. a segregação dos homólogos dos diferentes pares cromossômicos correspondem. no mínimo. à 2 lei de Mendel. III. Questão 1016 O estudo do mecanismo da síntese de proteínas no interior das células confirma que: a) a transcrição gênica caracteriza-se pela autoduplicação do DNA b) três tipos de RNA participam do processo c) os anticódons localizam-se no RNA-m d) os códons são trincas de bases nitrogenadas do RNA-t e) não há evidências que permitam aceitar que o código genético seja considerado degenerado Questão 1017 Uma molécula de RNA mensageiro apresenta a seguinte seqüência de bases nitrogenadas: UUU GUG CCC AAC Assinale a alternativa que contém a seqüência de bases do segmento da molécula de DNA que deu origem a esse 227 . III. b) Y e de autossomos. II e IV. um segmento de DNA que corresponde a um gene funcional. do DNA do cromossomo a) X e de autossomos. c) a presença de ácido fosfórico. c) I. 2001). V. Na meiose I. a segregação dos homólogos de um par cromossômico corresponde. ocorre a troca de. em efeito. Tais conclusões são possíveis com base em estudos moleculares. apenas. guanina.(1) Apesar de ser o sexto elemento mais abundante no universo e o mais versátil de todos. enquanto a contribuição genética de povos indígenas e africanos deu-se por meio das mulheres. Questão 1015 Não é característica do DNA: a) o açúcar com cinco átomos de carbono.

RNA. ácido fosfórico e base nitrogenada. e) Guanina. base nitrogenada e desoxirribose. d) ácido fosfórico. Questão 1021 Qual das seguintes moléculas NÃO entra na composição química do RNA? a) Ribose. ácido fosfórico e base nitrogenada. d) Uracila. Questão 1020 Qual das seguintes bases nitrogenadas NÃO entra na composição química do RNA? a) Timina. 2 e 3 indicam.2 Questão 1019 Sobre o RNA. Assinale a alternativa que contém a seqüência de bases do segmento da molécula de DNA que deu origem a esse RNA. respectivamente a) desoxirribose. b) participa da estrutura dos ribossomos. a) AAA CAC GGG TTG b) TTT CAC GGG UUG c) AAA CTC GGG TTG d) TTT GAG GGG TTG e) AAA CAC CCC UUG Questão 1018 Na figura a seguir que representa o modelo da molécula de RNA os números 1. d) é traduzido em proteínas nos ribossomos. desoxirribose e base nitrogenada. a) AAA CAC GGG TTA b) TTT CAC GGG UUT c) AAA CTC GGG TTT d) TTT GAG GGG TTA e) AAA CAC CCC UUA 228 Questão 1023 Uma molécula de RNA mensageiro apresenta a seguinte seqüência de bases nitrogenadas: UUU GUG CCC AAU. e) ácido fosfórico.5. 2 e 3 indicam. c) reproduz-se de modo semiconservativo.2 1. ácido fosfórico e base nitrogenada. e) Guanina. é INCORRETO afirmar que a) possui a base nitrogenada uracila.5. c) Ácido fosfórico. os números 1.8. b) ácido fosfórico. d) Adenina.8. d) ácido fosfórico. b) ácido fosfórico. respectivamente: a) desoxirribose. ácido fosfórico e base nitrogenada. ribose e base nitrogenada. . c) ribose. 1. e) é formado de simples cadeia com formato helicoidal. base nitrogenada e desoxirribose. b) Desoxirribose. c) Adenina. Questão 1022 No modelo molecular do ácido ribonucléico (RNA) representado adiante. ribose e base nitrogenada. desoxirribose e base nitrogenada. c) ribose. e) ácido fosfórico. b) Citosina.

Arg . a seqüência de aminoácidos no polipeptídeo correspondente será.Ile b) Leu .Estrutura: I.1 . a biologia molecular tem fornecido ferramentas úteis para a produção de plantas e animais transgênicos. interessado em produzir em tubo de ensaio uma proteína.1 .Arg .2 .Val .b Questão 1026 Nos últimos anos.Ile c) Arg .2 . Questão 1028 A tabela a seguir mostra alguns aminoácidos e as trincas de bases no DNA que os identificam: 1.pode existir mais de um códon para determinar um mesmo aminoácido. Questão 1027 Um pesquisador.Questão 1024 É característica do RNA: a) açúcar com quatro átomos de carbono. c) ausência de ácido fosfórico.Cis . b) sapo. c) coelho. utilizou ribossomos de células de rato.Cis d) Ile .1 . b) Plasmídios. II . dupla hélice II. guanina.Função: a. presença de uracila 2. de acordo com a tabela anterior: a) Cis . nas mesmas condições em que essa síntese ocorre nas células.Cis . Questão 1025 Os itens a seguir referem-se à estrutura. A proteína produzida teria uma seqüência de aminoácidos idêntica à do a) rato. cadeia simples . e) macaco e do rato. d) macaco. RNA mensageiro de células de macaco. composição e função dos ácidos nucléicos. 229 .3 e um RNA mensageiro apresenta a seqüência de bases AUU AGA UGU GUU UUA. síntese de proteínas b.Cis .Leu Questão 1029 Sobre o código genético são feitas as seguintes afirmações: I .a d) II .Leu .5.Arg .b c) II . e) mRNA.Leu . citosina e adenina. e) ocorrer nos lisossomos.Val .Val .8. presença de timina . transcrição gênica São características do ácido ribonucléico a) I . . As informações armazenadas nas moléculas de DNA são traduzidas em proteínas por meio de moléculas intermediárias denominadas: a) Proteases. c) rRNA. RNA transportador de células de coelho e aminoácidos ativos de células de sapo.a b) I .Val .Leu e) Val .b e) II .Composição: 1. d) ser um polipeptídeo.em todos os seres vivos os códons que codificam um respectivo aminoácido são os mesmos.Ile .Ile . b) presença das bases nitrogenadas uracila.Arg . d) tRNA.

A seqüência de códons do RNA mensageiro determina a seqüência de aminoácidos da proteína. alanina e serina. c) é o mesmo nos indivíduos de uma mesma espécie.CCG .AAC. Um fragmento de DNA. c) Fenilalanina.GGU .GGA . que codifica a seqüência serina .5. mas varia de espécie para espécie.CUC.TTT . sofreu a perda da 9 base nitrogenada. c) CTT .FEN .UUG. valina.3 1. e) é praticamente o mesmo em todas as formas de vida.CUC. lisina.cisteína . tirosina. prolina.a tradução da seqüência de bases do RNA para a proteína é feita.UUU . b) Aspargina. leucina. Assinale a alternativa que apresenta a possível seqüência de códons para a formação do seguinte tetrapeptídeo: GLU . Questão 1034 Os códons UGC. lisina. prolina. Questão 1030 A tabela a seguir relaciona trincas de bases do DNA aos aminoácidos correspondentes. lisina. qual seria a seqüência de aminoácidos codificada? 1.UUU .CTC. GCC e AGC codificam. c) I e II apenas. e) GUU . d) I. e) Valina. Assinale a 230 . É correto afirmar que o código genético a) varia entre os tecidos do corpo de um indivíduo. lisina.LEU a) GUU . prolina.GLI . valina.5.8.tirosina . II e III. nos ribossomos. b) é o mesmo em todas as células de um indivíduo. b) GAA . ou seja.8.GGC .GGC .UUU . mas varia de indivíduo para indivíduo. respectivamente os aminoácidos cisteína. UAU. b) III apenas. d) GAA . Questão 1031 Um gene de bactéria com 600 pares de bases nitrogenadas produzirá uma cadeia polipeptídica com número de aminoácidos aproximadamente igual a a) 200 b) 300 c) 600 d) 1200 e) 1800 Questão 1033 O código genético é o conjunto de todas as trincas possíveis de bases nitrogenadas (códons).alanina.AAA . Questão 1032 Considere a seguinte tabela que indica seqüências de bases do RNA mensageiro e os aminoácidos por elas codificados. Está(ão) correta(s) afirmativa(s): a) II apenas.3 a) Aspargina. Com base na tabela fornecida e considerando um segmento hipotético de DNA.III . e) I e III apenas. o códon UAG é terminal. d) Fenilalanina. indica a interrupção da tradução. a nível citoplasmático. d) permite distinguir procariotos de eucariotos. cuja seqüência de bases é AAGTTTGGT.

d) As mudanças na programação genética de um organismo não alteram a produção de proteínas. ou mesmo por exposição aos raios ultravioleta do sol. c) A mutação é uma alteração do código genético de um organismo e pode ser provocada por radiações ou substâncias químicas. que é uma técnica de manipulação dos genes. Questão 1036 Em 1987. nem as suas características. guanina.alternativa que descreve o que acontecerá com a seqüência de aminoácidos. a) O aminoácido tirosina será substituído por outro aminoácido. d) A mutação constitui uma alteração na seqüência de bases nitrogenadas de um segmento de DNA e pode ser provocada por radiações. b) Todas as células do corpo têm a mesma coleção de genes. que compreende o trabalho do RNA de organização dos aminoácidos na seqüência determinada pelo código genético. resultando numa molécula com 3 aminoácidos. por raios-X.3 ssinale a alternativa que contém a seqüência de códons do RNA mensageiro que participou dessa tradução. c) A seqüência não será traduzida. citosina. determinando as características de um ser vivo. encontramos células com formas e funções diferentes. pode corrigir defeitos no código genético de um organismo. timina e uracil. mas. d) A tradução será interrompida no 2Ž aminoácido. b) O aminoácido tirosina não será traduzido. pois qualquer modificação na fita de DNA é imediatamente corrigida. que compreende a passagem do código genético do DNA para o RNA.5. c) Duas grandes etapas estão envolvidas na síntese das proteínas: a transcrição. b) Os ácidos nucléicos podem aparecer livres na célula ou podem estar associados a proteínas. 231 . a) Na molécula de DNA. por raios cósmicos. e) A seqüência não sofrerá prejuízo. Este processo chama-se diferenciação celular. compondo os cromossomos e ribossomos na forma de moléculas complexas de nucleoproteínas. encontramos células com formas e funções diferentes. pois essa molécula de DNA alterada não é capaz de comandar esse processo. Indique a alternativa ERRADA relativa ao código genético e à síntese de proteínas: a) Os genes são formados por ácido desoxirribonucleico e controlam a produção de proteínas da célula.8. assinale a afirmativa FALSA. e) Todas as células do corpo têm a mesma coleção de genes. apesar disto. e) A Engenharia Genética. apesar disso. 1. encontramos sempre desoxirribose e cinco tipos de bases: adenina. mas. os códons e os anticódons correspondentes. a) UUU CGT TTG UGC GUC b) UUU CGA AAG UGC GUC c) TTT CGT TTC TGC GTC d) TTT CGA AAG TGC GTC e) CCC TAC CCA CAT ACT Questão 1038 O quadro a seguir contém um segmento de DNA. foi oficialmente fundado o Projeto Genoma. Questão 1037 O esquema a seguir representa a seqüência de aminoácidos de um trecho de uma proteína e os respectivos anticódons dos RNA transportadores. e a tradução. que visa decifrar e mapear o código genético humano. Questão 1035 Com relação ao código genético e à síntese de proteínas.

IV.CGC .GGU b) TUT .TGC . Entretanto.CCT TIROSINA . III.GGA d) UAU . Diversos aminoácidos são codificados por mais de uma trinca de nucleotídios.CGT .5. os quais podem ser transmitidos aos seus descendentes. por técnica de engenharia genética. Exemplos desses organismos são as plantas transgênicas. diversas condições devem ser observadas. e) a técnica permite trocar o código genético do organismo receptor do gene.CGU . b) o código genético é comum a todos os seres vivos. essa técnica é possível porque a) cada organismo apresenta seu próprio código genético.TGC . II. 1.TTA e) UAU .HISTIDINA .CTU . Questão 1042 Considere os seguintes códons do RNA mensageiro e os aminoácidos por eles especificados: ACA = treonina GUU = valina Assinale a alternativa da tabela a seguir que indica corretamente os anticódons do RNAt e os códons do DNA relacionados com esses aminoácidos.GGU c) CGT .GLICINA Após a substituição de uma única base nitrogenada no segmento de DNA. por a) GAC.ACA . liga-se a um aminoácido específico. A seqüência de trincas no RNA mensageiro que pode ter codificado esse polipeptídio alterado é a) CUC . II. ATT. III e IV devem ser substituídos. III e IV Questão 1040 Considere o seguinte segmento de uma cadeia de DNA e o polipeptídio sintetizado a partir dele: ATA . ATT.CGT . fundamentalmente. receptoras de um gene de outro organismo (doador) que lhes confere resistência a certos herbicidas. de acordo com o anticódon que possui.CAC . UCA e GUC c) GTC.8. foram feitas as seguintes afirmações: I. o polipeptídio sintetizado passou a apresentar duas argininas. UCA e CUG Questão 1039 Com relação ao código genético. respectivamente. Para que ocorra a síntese da proteína codificada pelo gene inserido no genoma da espécie receptora. TAA.ARGININA . O RNA ribossômico contém as informações para as proteínas que devem ser sintetizadas. os algarismos I. São verdadeiras APENAS as afirmações a) I e II b) I e IV c) II e III d) II e IV e) I.CAC . TCA e GUC d) CTG.CAC .CTU .3 ara preenchê-lo corretamente.CISTEÍNA - 232 .TGT .CGT . d) a técnica permite trocar o código genético do organismo doador do gene. recebem e incorporam genes de outra espécie. O RNA mensageiro. AUU.GCA . Cada trinca de bases nitrogenadas de uma cadeia do DNA corresponde a um aminoácido.GTG . TCA e CUG e) CTG. AUU.GGA Questão 1041 Organismos são ditos transgênicos quando.TGT . AGT e CTG b) GTC. c) o código genético é degenerado.CGU .

3 Questão 1043 Uma molécula de RNAm. O aminoácido encontrado no peptídio normal e aquele que o substituiu no peptídio mutante são. .o codon da metionina é também o do início da tradução. A partir da seqüência de aminoácidos de uma proteína.5. sem necessidade de código de iniciação ou de terminação. podem-se identificar as possíveis seqüências de DNA que a originaram. bserve que: . Considere o quadro: 1.5. foi sintetizada experimentalmente. composta pelas bases adenina-A e citosina-C. Considere que a estrutura normal de um RNA mensageiro de um peptídio e sua estrutura alterada em virtude da troca de uma única base no gene correspondente são: 5' AUGUGGUUUGCACACAAAUGAUAA 3' (normal) 5' AUGUGGUUUGAACACAAAUGAUAA 3' (alterada) A tabela a seguir identifica alguns codons. por conseqüência da substituição de uma única base na estrutura do DNA. pode acarretar modificações importantes na atividade biológica da proteína codificada por esse gene. respectivamente: a) lisina e cisteína b) treonina e triptofano c) alanina e ácido glutâmico d) fenil alanina e ácido aspártico Questão 1045 A determinação da seqüência de aminoácidos de todas as proteínas da espécie humana e de outros seres vivos é de extrema importância. o número de diferentes tipos de aminoácidos encontrados nos peptídeos formados será: a) 4 b) 3 c) 2 d) 1 Questão 1044 A mutação em um gene.3 233 .8.os codons de término da tradução são UAA.5.8. Nestas condições.8.1.3 1. UAG e UGA. Sua estrutura está representada no esquema abaixo: C-A-C-A-C-A-C-A-C-A-C-A-C-A-C-A-C-A Suponha que a síntese de um peptídeo possa ser iniciada a partir de qualquer um dos extremos dessa estrutura de RNAm.

b) A partir da seqüência do RNA mensageiro UUUCAUAGUGCUGGGAGCCAC. é formado o seguinte peptídeo: Val-Val-Val-Val-Arg-Arg-Arg. faz-se a construção de uma fita de RNA mensageiro a partir dela.GAA .GCC . A correspondência entre os códons do RNA mensageiro e os aminoácidos por ele determinados constitui o código genético.TTT b) ATG . Para descobrir se determinado organismo produz determinada proteína.Glu .TGT . 2.5.TGT .AAT . Estes. na proteína que ele especifica.TGT . Questão 1048 Se uma proteína possui 100 aminoácidos. é formado o seguinte peptídeo: Phe-His-Ser-Ala-Gly-Arg-His. Trp (triptofano).AAC . Asn (asparagina). Com base no texto e em seus conhecimentos. devem estar presentes no seu mRNA? a) 100 234 . Arg (arginina).TTC .TTC Questão 1046 OBSERVE: 1.AAT . Asp (ácido aspártico). O código genético descreve a relação entre a seqüência de bases nitrogenadas e a seqüência de aminoácidos.3 Phe (fenilalanina). formam as proteínas. que está representado na tabela a seguir: 1. quantos códons. Ser (serina). apenas b) 1 e 3.TAC .TGT . Ala (alanina).om base no quadro apresentado. Tyr (tirosina). é correta a seguinte afirmação: a) O peptídeo Gly-Gly-Gly-His-Arg-Leu-Ile-Gln pode ter sido originado a partir do seguinte RNA mensageiro: GGCGGUGCGCACCGCCUUAUUCAA. Thr (treonina). é formado o seguinte peptídeo Leu-Gly-Glu-Thr-Arg-Gln-Glu. apenas d) 1. é possível obter uma seqüência de nucleotídeos (RNA mensageiros).TAC . 2 e 3 e) 2. Glu (ácido glutâmico). e) O peptídeo Lys-Phe-Lys-Tyr-Tyr-Thr-Ile pode ter sido originado a partir do seguinte RNA mensageiro: AAAUUUAACUAUUACACAAUA.Asn .GAA . após passarem por diferentes processamentos no Retículo endoplasmático rugoso e complexo de Golgi.TAC .TAC . Val (valina). Pro (prolina). a partir de uma seqüência de aminoácidos (peptídeo).Tyr . His (histidina). como por exemplo as funções enzimáticas. Três bases nitrogenadas adjacentes codificam um aminoácido e formam um códon.TTT d) ATG . assinale a opção que indica a seqüência do DNA responsável pela síntese do peptídeo mostrado a seguir: Met . c) A partir da seqüência do RNA mensageiro GUGGUUGUCGCUCGUCGGCGG.Cys . A seqüência de aminoácidos que forma uma cadeia polipeptídica compreende a estrutura secundária de uma proteína. portanto. Cada três nucleotídeos correspondem a um aminoácido. Ile (isoleucina). O inverso também pode ocorrer.TTT c) ATC . Está(ão) correta(s): a) 1.GAA . apenas Questão 1047 A união de vários aminoácidos forma os peptídeos.TAC . Gly (glicina). Gln (glutanina).GAA . Lys (lisina). Isso é possível graças à relação existente entre os códons do RNA mensageiro (cada três nucleotídeos) e os aminoácidos presentes nas proteínas.8. Met (metionina). que especificam esses aminoácidos. Cys (cisteína).TTC e) ATC .Phe a) ATG . d) A partir da seqüência do RNA mensageiro UUAGGGGAGACUCGGCAGGAG. As proteínas exercem inúmeras funções no nosso organismo. Leu (leucina). pare (códon de parada). 3.AAT .AAT . apenas c) 3.

Estão corretas afirmativas: a) apenas III.arginina d) glutamina . ileu = ISOLEUCINA. asp = ASPARTATO. val = VALINA. glu = GLUTAMINA.treonina .5.8.arginina e) glicina . com os códons e os aminoácidos correspondentes. 235 1.glicina c) glutamina . determine a seqüência de aminoácidos que corresponde à seqüência de DNA TAC TGA TTG CTA a) metionina .aspartato . 1996. gly = GLICINA LOPES. ala = ALANINA. cys = CISTEÍNA. III . uma determinada trinca também pode codificar diferentes aminoácidos. d) Os anticódons do 1Ž do 2Ž códon dessa seqüência são. e) ribossomos. Utilizando a tabela.histidina . podemos dizer que I . b) códons. São Paulo: Saraiva. met = METIONINA.histidina . II . Questão 1050 As unidades hereditárias que contêm a informação para especificar um aminoácido são denominadas a) ADN. ser = SERINA.aspartato b) metionina . o que significa que um aminoácido pode ser codificado por mais de uma trinca. respectivamente.glutamina .um aminoácido pode ser codificado por apenas uma trinca de nucleotídios de DNA.treonina Questão 1052 O aminoácido leucina pode ser codificado por mais de uma trinca de nucleotídios do DNA (AAT. Bio Volume Único. c) nucléolos.3 . pro = PROLINA. Sônia. asn = ASPARAGINA. d) acrossomos. lys = LISINA. GAA e outras). c) Os códons GCA e GCG são degenerados porque codificam aminoácidos diferentes. he = FENILALANINA.asparagina . thr = TREONINA.cisteína . his = HISTIDINA. GCA e UGA. arg = ARGININA.assim como a leucina pode ser codificada por diferentes trincas.treonina .b) 33 c) 99 d) 300 e) 500 Questão 1049 Observe as seqüências de nucleotídeos de um vírus de RNA: 5' GCA UCA CAC CUC AUU GCG UAG 3' Considerando que esse segmento de RNA codifica um determinado peptídeo. Assim sendo. é correto afirmar: a) Os códons dessa seqüência sinalizam os mesmos aminoácidos em seres humanos. leu = LEUCINA.glicina . b) A inserção de um nucleotídeo entre a 4 e a 5 base não altera o código genético. trp = TRIPTOFANO.glutamina . Questão 1051 A tabela apresenta o código genético. tyr = TIROSINA.o código genético é degenerado.

Assinale a alternativa que reúne as afirmações corretas. Questão 1053 Um trecho de fita de DNA com a seqüência. Questão 1057 Dado um segmento de RNA com a seguinte seqüência de bases nitrogenadas: UUA UUU GGC UCC. UTU GGC UTU. a MITOMICINA inibe a ação da polimerase do DNA e a ESTREPTOMICINA causa erros na leitura dos códons do RNA mensageiro. respectivamente: a) TAT GGC ATA. (2) A molécula de DNA referente ao trecho apresentado tem 20% de adenina. b) apenas I e II são corretas. c) AAT AAA CCG AGG. II . julgue os itens que se seguem. d) ATA GGC TAT.. TAT GGC ATA. Essas informações permitem afirmar que I . é responsável pela incorporação respectiva dos seguintes aminoácidos: metionina..a TETRACICLINA impede a transcrição e leva a célula bacteriana à morte por falta de RNA mensageiro. sua cadeia complementar e o tipo de RNAm que poderá ser formado a partir das bases da hélice original são. II e III são corretas. UAU GGC AUA. arginina e alanina. b) AAT AAA GGC UCC. Indique qual a seqüência de RNAm é transcrito a partir deste segmento DNA: a) TTA TAA GCT CAG ATT TCT b) TTA TTA GCT CAG ATT TCT c) UUA UUU GGU CAG AUU UGU d) UUA UAA GCU CAG AUU UCU e) AAT ATT CGA GTC TAA AGA Questão 1055 Uma cadeia de DNA apresenta a seguinte seqüência de bases numa certa região de sua hélice: ATA CCG TAT. para os aminoácidos mencionados. c) apenas I. a) apenas I é correta. e) TAT GGC UTU. e) AAU AAA CCG AGG. d) I e III. TUT GGC UTU. (1) Os códons do mRNA. Assim. respectivamente.a MITOMICINA. UAC ACC UCU CGU. Considerando as informações apresentadas. e) I. por inibir a duplicação do DNA. b) UAU GGC UAU. Essas substâncias diferem quanto à maneira pela qual interferem no metabolismo celular. III . TACACCTCTCGT.b) apenas II. triptofano. os raios X e a luz ultravioleta podem produzir mutações na molécula de DNA. d) TTA TTT CCG AGG. 236 . (3) A perda de um nucleotídeo do DNA implicará a alteração dos aminoácidos da cadeia polipeptídica. impede a multiplicação da célula bacteriana. c) TAT GGC ATA. (4) A fumaça do cigarro.. pode-se dizer que o segmento de DNA que deu origem a esse RNA era a) TTA AAA CCG AGG. c) apenas II e III são corretas.. Questão 1054 Um fragmento de DNA de uma espécie de organismo procarionte apresenta a seguinte seqüência de bases: AAT ATT CGA GTC TAA AGA. e) nenhuma delas.a ESTREPTOMICINA interfere na tradução e leva a célula bacteriana a produzir proteínas defeituosas. a TETRACICLINA liga-se aos ribossomos e impede a ligação do RNA transportador. TAT GGC ATA. são. Questão 1056 Existe um número muito grande de substâncias com funções antibióticas. d) apenas I e III são corretas.

adeninas e) complementar . é necessário bloquear o funcionamento de todo o retículo endoplasmático dessa célula. d) a célula encontra-se em metáfase. através do qual o RNA carrega consigo as instruções para a produção de proteínas (e por isso ele ganha o nome de RNA mensageiro).idêntica .guaninas c) idêntica . e) trata-se do processo de transcrição. c) 3 representa nucleotídeos de RNA. sendo inexistente em todas as outras organelas. . G. da Universidade Stanford.5.Questão 1058 Uma molécula de RNA mensageiro apresenta a seguinte seqüência de bases nitrogenadas: UUU GUG CCC AAA. sendo as _______________ substituídas pelas uracilas. c) O processo 2 ocorre principalmente no período S da intérfase.8. Esse mecanismo de transcrição. mas nunca serão constituintes de outras organelas. b) Para interromper o processo 2.8. Questão 1060 O esquema a seguir representa fragmentos de ácidos nucléicos no núcleo de uma célula. a) idêntica .4 bservando o esquema. O americano Roger Kornberg.timinas Questão 1062 A mesma molécula .idêntica . é INCORRETO afirmar que: a) 1 é uma molécula de uracila. 1.4 ssinale a alternativa correta. e) As moléculas produzidas no processo 2 poderão ser utilizadas como catalisadoras.o astro da semana.o RNA . Assinale a alternativa que contém a seqüência de bases do segmento da molécula de DNA que deu origem a esse RNA. a) AAA CAC GGG TTT b) TTT CAC GGG UUU c) AAA CTC GGG TTT d) TTT GAG GGG TTT e) AAA CAC CCC UUT Questão 1059 O esquema a seguir representa dois processos observados numa célula eucariótica.complementar . d) Um dos mais importantes locais de ocorrência do processo 1 é o nucléolo.adeninas b) complementar . já era conhecido pelos cientistas desde a década de 50.5. a) O processo 1 somente é observado no núcleo da célula. foi laureado por registrar em imagens o momento em que a informação genética contida no DNA no núcleo da célula é traduzida para ser enviada para fora pelo RNA .complementar . Estudo de RNA rende o segundo Nobel 237 1. Questão 1061 A molécula de RNA sintetizada é ___________ à fita de DNA que lhe deu origem e ___________ à outra fita de DNA. b) 2 representa nucleotídeos de DNA.que faturou o Nobel de Medicina ou Fisiologia na segunda-feira foi a protagonista do prêmio de Química entregue ontem.citosinas d) complementar . (Girardi.complementar .

II . d) RNA e de DNA. d) No citoplasma. engenharia genética.I.II.A . c) II .C . Questão 1064 O segmento CGATAGACT de uma fita de DNA.Fixação do RNA mensageiro aos ribossomos.G . 2006). a) A produção de RNA mensageiro se dá por controle do material genético.U .II.Transcrição do código genético do DNA em códons do RNA mensageiro. Questão 1063 Os processos de transcrição e tradução gênicas resultam na síntese. farmacogenômica etc. o RNA mensageiro determina a seqüência de aminoácidos apresentada por uma proteína. e) Cada molécula de RNA mensageiro é uma longa seqüência de nucleotídeos idêntica ao DNA.A . transgênicos. 238 . II .U . após o processo de transcrição. b) No núcleo da célula ocorre transcrição do código da molécula de DNA para a de RNA.U .I ."O Estado de S. Questão 1067 Há na mídia uma grande quantidade de notícias envolvendo o DNA: testes de paternidade. d) III . Analise os dados dos quadros a seguir.C .U b) G .I e) III . c) DNA e de proteínas.U .U .C . terapia gênica. origina a cadeia a) GUTATUTGA b) GCUAUCUGA c) GCTUTCTGU d) UCTATCTUA e) GCTATCTGA Questão 1065 Abaixo está representado o filamento I de uma molécula de ácido nucléico presente no interior do núcleo de uma célula vegetal.III .U .A e) C .C .Ligação dos códons de RNA mensageiro aos anticódons correspondentes dos RNAs transportadores.III . III .4 Questão 1066 Considere as seguintes etapas da síntese de proteínas. e assinale a(s) proposição(ões) CORRETA(S). de a) proteínas e de RNA.C . assinale a alternativa incorreta. clonagem terapêutica e reprodutiva. Para compreender essas notícias. A partir da leitura do trecho anterior e de seu conhecimento de biologia molecular.G . Paulo". é necessário conhecer a estrutura da molécula de DNA e entender seu funcionamento.III. b) RNA e de proteínas. 5 out.II .A c) G .G . e) DNA e de RNA. I .A .U 1. Qual seria a seqüência correta encontrada na molécula de RNA mensageiro.G . Qual a seqüência correta dessas etapas durante o processo? a) I . transcrita a partir do filamento II? a) G . c) O RNA mensageiro leva do núcleo para o citoplasma instruções transcritas a ele pelo DNA.8.G . respectivamente.U d) C .5. b) I .A .

. c) II. duplicação e tradução são: a) I. c) apenas III. 239 onsiderando-se apenas células eucariontes. Questão 1069 1. respectivamente. uma fita de DNA serve como molde para a produção do RNA que terá uma seqüência de nucleotídeos complementar à fita-molde. b) I. I e II. transcrição e tradução ocorrem no mesmo local porque as células procariontes não possuem sistema de endomembranas. Após 3 minutos.4 O esquema resume parcialmente as relações funcionais dos ácidos nucleicos que ocorrem na maioria das células vivas.e) apenas II e III. Nas células eucariontes.5. está indicado o processo de transcrição. Questão 1070 Algumas células de cultura de tecido foram deixadas em um meio contendo um precursor radioativo de RNA. gerando duas novas duplas hélices. Questão 1068 Analise as afirmativas a seguir. I. II e III. (04) Em II. as etapas que representam. (08) Em III. que resulta na formação de polipeptídios. d) apenas I e III. e) II. transcrição. a informação genética é transmitida do citoplasma. (02) O quadro I mostra uma molécula de DNA cuja duplicação ocorre de forma semiconservativa.8. d) III. Durante a transcrição. Nas bactérias. observa-se que o pareamento das bases nitrogenadas do DNA é aleatório. II. Posteriormente. essas células foram transferidas para um meio sem essa substância. revelando a distribuição do precursor radioativo nas mesmas. onde serão produzidas as proteínas. Os esquemas representam as células radioautografadas nos três momentos. Esse procedimento se repetiu após 15 e após 90 minutos. onde está o DNA. III e II. pois cada uma das fitas originais em I serve de molde para uma nova fita.8. 1. cuja seqüência de aminoácidos está codificada numa molécula de ácido nucléico. I e III. algumas células foram fixadas e radioautografadas. III. Está(ão) correta(s) a) apenas I.4 (01) Em I. (16) A deleção de um dos pares de bases na seqüência mostrada em I não alteraria significativamente a seqüência de aminoácidos em III. III e I. através do qual formam-se moléculas que contêm as mesmas bases nitrogenadas presentes no DNA.5. está indicado o processo de tradução. b) apenas II. para o núcleo.

A seqüência desses aminoácidos na proteína correspondente ao segmento do DNA que apresenta a seqüência de nucleotídeos GAC TGA TCT será. d) Apenas II e III. d) a produção de RNA. que ocorre inicialmente no núcleo celular. b) arginina. prossegue posteriormente no citoplasma da célula. dirige-se gradativamente para o citoplasma celular. leucina. Questão 1071 Os códons AGA.5.Um RNA-t (RNA transportador) transporta sempre um determinado aminoácido. e) lise celular. buscando a situação de equilíbrio. nas opções a seguir. b) Apenas III. b) a substância. os aminoácidos arginina. arginina. e) I. Questão 1073 Sobre a síntese de proteínas. arginina. d) mutação gênica. arginina. c) Apenas I e II. existem quatro tipos de genes que atuam como está demonstrado no esquema a seguir: São esses mecanismos que tornam possível a: a) diferenciação celular. treonina. d) treonina. indique.8. esgota toda a substância presente no núcleo. são feitas as seguintes afirmações: I . 240 . c) a síntese de RNA. Questão 1072 Partindo-se do conhecimento do RNAm (CCU GAG). leucina e treonina. II e III. sendo que posteriormente o RNA aí produzido migra para o citoplasma celular. a) treonina. treonina. pode ser transportado por vários RNA-t. arginina. CUG e ACU do RNA mensageiro codificam. c) duplicação de RNA. Questão 1074 Ao longo da molécula de DNA. III . c) leucina. b) produção de energia. restando apenas no citoplasma.5 Esses resultados ocorrem porque a) o RNA transportador leva o isótopo até o nucléolo e posteriormente ao núcleo e citoplasma celular.8. Esse aminoácido. respectivamente.As moléculas de RNA-t apresentam numa determinada região da sua molécula uma trinca de bases denominada anticódon. e) leucina. porém. II . treonina.4 1. e) a síntese de RNA ocorre no núcleo. qual a seqüência correta do DNA e do RNA transportador.1. que se intensifica aos 90 minutos.5. leucina. leucina. Assinale a(s) afirmativa(s) correta(s): a) Apenas II. ao ser deixada em situação de desequilíbrio osmótico em relação à cultura sem isótopo.A tradução do código químico do RNA-m (RNA mensageiro) ocorre nos ribossomas localizados no retículo endoplasmático rugoso. respectivamente.

b) secreção de substâncias. b) ribossomos. Questão 1077 Analise o texto abaixo e assinale a alternativa que contém os termos que preenchem corretamente os espaços (I). num certo organismo. d) produção de energia. proteínas. duplicação. e) genes. d) II e III apenas.durante o processo a proteína formada depende. (III) e (IV). duplicação.8.qualquer proteína formada será conseqüência direta de uma transcrição do RNA. aminoácidos.5 Questão 1078 O esquema a seguir representa a seqüência das etapas da síntese de um trecho de uma proteína a partir da molécula de DNA. d) genes. 1.5. (II).os ribossomas alinhados nessa molécula de RNA traduzirão os mesmos códons. Sabe-se que esses antibióticos são substâncias cuja utilização médica se baseia na inibição das células bacterianas atuando no mecanismo de: a) fagocitose. II . aminoácidos.5 Questão 1075 O antibiótico Estreptomicina age sobre as bactérias promovendo a leitura errada do RNAm. c) I e III apenas. II e III. o Cloranfenicol inibe a peptidiltransferase na subunidade ribossômica maior e a Rifampicina inibe a RNA polimerase no sítio de iniciação. c) síntese protéica. b) I e II apenas. e) I. No processo de elaboração de uma proteína ocorrem as etapas de transcrição e ___(III)___. III ." a) ribossomos. Questão 1076 241 . A primeira etapa forma a molécula de ___(IV)___ contendo a mensagem genética e a segunda etapa é responsável pela produção da proteína. de uma molécula de DNA. RNA transportador. 1. cópia. A(s) afirmativa(s) correta(s) é(são): a) I apenas.análise do esquema anterior nos permite afirmar que: I .8. tradução. c) genes. aminoácidos. RNA ribossômico. tradução. e) reprodução celular.5. a Tetraciclina liga-se à subunidade ribossômica menor e inibe a ligação do AA-RNAt. RNA mensageiro. em última análise. RNA ribossômico. RNA mensageiro. "O controle das características fenotípicas dos seres vivos é feito pelos ___(I)___ através do comando da síntese de ___(II)___. proteínas.

d) uma base púrica substituir uma pirimídica no RNA mensageiro que a codifica. GAG. CAU c) TCT. b) durante sua síntese houver variação dos tipos de RNA transportadores. c) exclusivamente da produção de RNA. e) bases da molécula de RNA . complementar ao segmento da hélice de DNA apresentada é UGGUUUGGCUCA. GUA 242 . d) da produção de RNA e de proteínas. Seu mecanismo de ação consiste na inibição da transcrição nas células de 'Mycobacterium tuberculosis'. b) apenas I e II estão corretas. GAU b) TGT. GTA d) UGU. d) apenas I e III estão corretas. b) pentoses da molécula de RNA .5. nas células bacterianas haverá comprometimento a) exclusivamente da produção de proteínas. Questão 1081 A seqüência de aminoácidos de uma proteína é determinada pela seqüência de a) pentoses da molécula de DNA. No esquema. c) apenas II e III estão corretas.5 obre essa síntese foram feitas as afirmações abaixo: I. CAT e) TGT. Para codificar a seqüência dos aminoácidos do trecho da proteína apresentada no esquema são necessários 24 nucleotídeos no RNA mensageiro. c) bases da molécula de DNA. e) da produção de DNA e RNA. que ocorrem no núcleo das células eucarióticas.8.ribossômico Questão 1082 Considere os seguintes fragmentos de ácidos nucléicos que participam da síntese de uma proteína. II. CUC. 2 e 3 ficariam corretamente preenchidos por: a) ACA.8. GUG. Questão 1079 A Rifampicina é um dos antibióticos utilizados para o tratamento da tuberculose.transportador. respectivamente aos processos de tradução e transcrição. os números 1 e 2 correspondem. 1. Deve-se concluir que a) apenas II está correta. III. e) O DNA não se duplicar durante a interfase. b) exclusivamente da produção de DNA.Questão 1080 A composição química de uma proteína pode ser alterada se a) durante sua síntese houver variação dos tipos de aminoácidos disponíveis no citoplasma.5 s espaços 1. c) sua síntese ocorrer no retículo endoplasmático liso e não no rugoso.5. 1.mensageiro. e) todas estão corretas. CAC. d) bases da molécula de RNA . A seqüência correta de bases nitrogenadas encontradas na molécula de RNA mensageiro. GAG. Sob ação do antibiótico.

d) II pode apresentar moléculas de adenina.Questão 1083 e) 558 Questão 1086 Tradicionalmente. impedindo sua expressão. Antes de chegarem às prateleiras. o processo de transcrição não ocorrerá. c) Esse ácido nucléico é produzido no núcleo e se dirige ao citoplasma. c) O maior tempo de prateleira a que o texto se refere se deve aos baixos níveis da enzima poligalacturonase. Os pesquisadores utilizaram a metodologia "anti-sense" (veja o quadro a seguir) para diminuir os níveis da enzima poligalacturonase. A função celular drasticamente afetada por essa mutação será a) a replicação do DNA. Questão 1085 O DNA apresenta importantes funções celulares. o tomate pode ser transportado já maduro e apresenta um maior tempo de prateleira. b) Cada trinca de bases. Numa síntese de proteína com 185 ligações peptídicas. o que compromete a firmeza dos frutos. O tomate Flavr Savr foi desenvolvido pela empresa de biotecnologia Calgene para amadurecer no pé mantendo a firmeza de sua pele. é denominada anticódon. e) o transporte de RNA. 1. que representa um fragmento de ácido nucléico. b) O RNAm do gene "anti-sense" é capaz de parear com o RNAm da poligalacturonase. b) a síntese de RNA mensageiros. cuja expressão gênica é induzida pelo etileno. e) Se a ação desse ácido for bloqueada.5 Considerando o esquema acima. os tomates são colhidos ainda verdes para que sua firmeza seja mantida no transporte. unindo-se aos aminoácidos. assinale a alternativa INCORRETA. representada em II.8. Questão 1084 Um mutante perdeu um segmento de DNA contendo todas as cópias dos genes que codificam RNA transportador. a) A substância representada em I é obrigatoriamente ribose.5.5 Assinale a alternativa INCORRETA. o filamento de DNA que proporcionou essa síntese deverá ter o seguinte número total de nucleotídeos: a) 62 b) 93 c) 186 d) 279 1. 243 . c) a síntese de proteínas. d) A tecnologia "anti-sense" para genes necessários à síntese do etileno poderia ser utilizada para se evitar o amadurecimento de frutos. Questão 1087 O esquema a seguir é um processo celular vital. cuja função é transportar aminoácidos. que ocorre também em você.5. os tomates são pulverizados com etileno para acelerar o amadurecimento e torná-los vermelhos. a) Essa metodologia visa reduzir os níveis de etileno nos frutos evitando seu amadurecimento.8. d) o transporte de proteínas. Uma delas é a síntese de proteína. Dessa forma. Essa enzima promove a hidrólise de componentes da parede celular.

EXCETO: a) macromoléculas de reserva energética.8. b) enzimas usadas. d) moléculas utilizadas nos processos de cicatrização. III. a proteína é sintetizada. realizou-se uma síntese protéica utilizando-se: DNA de um gene humano. Questão 1088 Os gráficos a seguir revelam o NÚMERO DE GENES e a relação entre RNA CODIFICADOR (que contém as seqüências que podem ser traduzidas em proteínas) e RNA NÃO-CODIFICADOR (seqüências que são transcritas. é correto afirmar.5 244 . c) de coelho. EXCETO: a) Não existe uma relação de proporcionalidade direta absoluta entre o número de genes e a complexidade dos organismos relacionados. d) quimérica de homem e ovelha. b) Os vertebrados citados apresentam menor percentual de transcrição em relação aos outros animais. mas não traduzidas. d) Seqüências transcritas. II. b) de ovelha. Ao final do experimento. 1. e) híbrida de homem e coelho.5 Nesse processo ocorre produção de.5. o gene (segmento de DNA) é transcrito em RNA mensageiro.8.5 1. mas não são traduzidas em proteínas) de seis espécies de organismos. e nos éxons estão presentes seqüências codificadoras. obteve-se uma proteína a) humana.5. Num experimento de laboratório hipotético. RNAs transportadores e aminoácidos. por exemplo. c) Os íntrons são exemplos de RNA não-codificador. poderiam desempenhar alguma função no núcleo celular. c) moléculas de defesa do corpo. RNAs transportadores de ovelha e aminoácidos de coelho. o RNA mensageiro combina-se com um complexo de ribossomo.8. Analisando os resultados anteriores de acordo com seus conhecimentos sobre o assunto.1. observam-se os seguintes eventos: I. Questão 1089 Na síntese protéica. Questão 1090 Responder à questão com base na ilustração e afirmativas a seguir. no processo digestivo.5.

O'NEILL. denominado replicação. Durante o processo C. d) as proteínas não terem controle sobre o metabolismo celular.) (LEITE. mas a síntese dele próprio é controle do DNA d) o RNAt é responsável pela etapa de transcrição no processo de síntese de uma proteína Questão 1093 "Desenvolvimento significa. Muitos animais desenvolvem-se ao longo de eixos cartesianos. p. "O Que é vida? 50 anos depois". P. (WOLPERT. todas as afirmativas corretas encontram-se na alternativa a) I. é correto afirmar: a) As células diferenciam-se de acordo com um padrão intrínseco. o DNA se duplica. São Paulo: UNESP. denominado tradução. os processos A. In: MURPHY. Durante o processo B. II e III b) I.raramente ultrapassam mais que 30 diâmetros de célula . "De volta ao seqüenciamento. mas talvez não seja pretensioso supor que foi um lapso.J. de forma que os embriões são logo divididos em regiões que essencialmente se dividem de maneira independente".) O autor refere-se às proteínas como ''atores do drama molecular'' e ao DNA como "diretor de cena". Lewis." Folha de S. b) O desenvolvimento envolve a expressão diferencial do material genético e independe do micro-ambiente em que a célula está localizada. B e C ocorrem no interior do núcleo.) De outro lado. A importante implicação disto é que não existe relação entre o padrão inicial e o observado. É verdade que a Fundação Nobel ainda fala no DNA como o diretor de cena a comandar a ação das proteínas. ocorre a síntese de RNA. dá-se a síntese protéica. Uma maneira de produzir padrões é dar às células informação posicional. 1997. Todas as interações ocorrem a curta distância . o galardão de química ficou com os inventores de ferramentas para estudar proteínas. e as células então interpretam esses valores de maneiras diferentes. como em um sistema coordenado. III e IV c) I e IV d) II e III e) II. que são construídas segundo o modelo básico modificado pela informação posicional. c) o material genético ser constituído por proteínas.. Questão 1092 Em se tratando do processo de síntese de proteínas. contido no material genético... Nos eucariotos. é certo afirmar: a) os aminoácidos que estão no citoplasma são selecionados pelo RNAm b) todo o processo da síntese de uma proteína ocorre exclusivamente no núcleo da célula c) o RNAm controla a síntese de uma proteína.20/10/2002. os verdadeiros atores do drama molecular da vida.].A. Uma outra característica comum parece ser a geração de estruturas periódicas como segmentos.. Paulo .) Com base no texto e nos conhecimentos sobre o tema.e a maior parte da formação de padrões acontece localmente.. M. que é induzido a se expressar em resposta a fatores extrínsecos. e que o sinal emitido por essas premiações aponta o verdadeiro futuro da pesquisa biológica e médica muito além dos genomas e de seu seqüenciamento (uma simples soletração). vértebras. penas e dentes. e) o DNA controlar a produção de proteínas e estas controlarem a atividade celular. L. Durante o processo A. denominado transcrição. III. Essa referência deve-se ao fato de a) não ocorrer uma correlação funcional entre DNA e proteínas no meio celular. IV. c) O desenvolvimento das diferentes regiões de um organismo deve-se à propriedade de interação célula-célula 245 . II. sendo os padrões especificados independentemente ao longo de cada um. Marcelo. (. Considerando os processos intracelulares. b) o DNA controlar a produção de proteínas etambém atuar como catalisador de reações químicas celulares. células tornando-se diferentes de maneira ordenada [.. 74. III e IV Questão 1091 (. em grande parte..

AUG Os anti-códons correspondentes são: a) AUG . a participação dos ácidos nucléicos. 246 . via vesículas de secreção.GAU . Esse RNA é traduzido em três diferentes proteínas. em que a diferenciação de um tipo celular induz outro tipo a se diferenciar.UAC b) ATG . d) A diferenciação caracteriza-se pela manutenção do padrão morfológico e pela alteração do padrão funcional do tecido. depois para o complexo de Golgi e é secretada. De acordo com o texto. para o meio de cultura. no meio de cultura líquido.UGC .GAC e) GCA .TCG . substâncias químicas indispensáveis à vida. esta enzima passa para o complexo de Golgi e é secretada. desta forma. Gustavo não precisa destruir o fungo para obter a enzima. Sabe-se que X < Y < Z e que esses valores formam uma progressão aritmética. a) O 'Aspergillus niger' é um organismo que possui mesossomo. e) A síntese da pectinase começa no mesossomo e termina nas membranas do retículo endoplasmático rugoso.CGU Questão 1096 Sobre os diferentes papéis dos ácidos nucléicos na síntese de proteínas podemos afirmar corretamente que: a) a seqüência de bases no DNA determina a seqüência de aminoácidos na cadeia polipeptídica. esta enzima passa para o complexo de Golgi e é secretada.CTA . um número X. respectivamente.ACT . para ser empregada na indústria de sucos. Questão 1097 O pesquisador Gustavo obtém pectinase.GUA . Y e Z de aminoácidos.CUT . que serve de modelo para a formação de uma proteína.ACG . e) a extremidade livre dos diversos tRNA tem seqüências de bases diferentes. Em seguida. Em seguida.ACG . contendo. do seu RNAm. b) a posição dos aminoácidos na cadeia polipeptídica depende da seqüência de bases do tRNA. está corretamente referida em: a) O DNA transcreve a mensagem genética para o RNA. d) A síntese da pectinase começa no núcleo e termina nas membranas do retículo endoplasmático liso. c) o transporte de aminoácido para o local da síntese é feito pelo mRNA.TAC c) TUG . Portanto. assinale a alternativa correta. via vesículas de secreção. Admita que todos os demais nucleotídios formam códons que correspondem a aminoácidos encontrados na estrutura primária das proteínas após serem sintetizadas. b) O caminho da produção da pectinase começa com a transcrição. Questão 1098 Na síntese protéica. ele simplesmente separa o meio de cultura do microrganismo e isola a enzima deste meio.e da quantidade de informações que a célula é capaz de processar. que é traduzido por ribossomos e depois é ancorado nas membranas do retículo endoplasmático rugoso.UCG . esta enzima passa para o lisossomo.CGA . no citoplasma. um processo bastante complexo e fundamental para a sobrevivência das células. para o meio de cultura. Questão 1094 Um RNA-mensageiro bacteriano é formado pela polimerização de 5292 nucleotídios e contém três códons de iniciação de leitura e três de terminação. o valor de Y equivale a: a) 826 b) 706 c) 586 d) 466 Questão 1095 Considere os seguintes códons: UAC . a síntese da enzima ocorre nas membranas do mesossomo e depois ela é secretada para o meio de cultura. d) a seqüência de bases do rRNA é transcrita a partir do código do mRNA. Em seguida. c) A síntese da pectinase começa no citoplasma e termina nas membranas do retículo endoplasmático rugoso. onde a tradução é concluída.UTC d) AGT . via vesículas de secreção. para o meio de cultura.CUA . produzida pelo fungo 'Aspergillus niger'. e) O desenvolvimento ocorre como um dominó.

comandando a síntese da proteína viral.‘. local de ligação com o aminoácido que ele transporta. os números 1. Após certo tempo. – e “ determinadas pela ação de diferentes genes e que vão compor as hemoglobinas em várias fases do desenvolvimento humano: om base nas informações contidas nesse gráfico e em outros conhecimentos sobre o assunto. b) o mRNA se integrou ao DNA dos ovócitos. ’.5 247 . responsáveis pela transcrição de uma cadeia polipeptídica. Questão 1099 Um pesquisador injetou RNA mensageiro (mRNA) de vírus em ovócitos de anfíbios.b) O DNA transcreve a mensagem genética para o RNA solúvel. – e “ estarão presentes no indivíduo adulto. c) O RNA mensageiro contém trincas de nucleotídeos denominadas códons. Questão 1101 São feitas as seguintes afirmativas a respeito da síntese protéica.5. verificou que esses ovócitos. Analise-a e assinale a alternativa correta. I) Um RNAt transporta sempre o mesmo aminoácido. d) O RNA transportador apresenta na sua molécula uma trinca de nucleotídeos denominada anticódon.5. é INCORRETO afirmar que a) a ativação do gene responsável pela síntese da cadeia polipeptídica “ ocorre dias antes do nascimento. Questão 1102 No esquema. respectivamente: 1. 2 e 3 substituem.8.‘. d) os quatro tipos de cadeias polipeptídicas . d) Apenas III está correta. que se liga ao ribossomo. local onde ocorre a transcrição da mensagem genética. proteínas virais. local da síntese protéica. ’. e) Estão corretas apenas I e III. também. c) o gene responsável pela síntese da cadeia polipeptídica ’ aumenta sua atividade a partir do terceiro mês da concepção. b) Todas estão corretas. c) Estão corretas apenas I e II. e) O RNA ribossômico se une a proteínas formando o ribossomo. produziam. em que está representada a produção de diferentes tipos de cadeias polipeptídicas . b) a síntese da cadeia polipeptídica ‘ permanece constante durante a mudança de produção das cadeias – e ’.5 1. Esses dados sugerem que a) o DNA dos ovócitos foi impedido de se expressar. além de suas próprias proteínas. II) A tradução do código genético do RNAm é feita nos ribossomos localizados no retículo endoplasmático rugoso.8. c) o material injetado nos ovócitos foi capaz de se autoduplicar. a) Apenas II está correta. III) O anticódon corresponde a uma trinca de bases localizada numa determinada região de todos os RNAt. d) os ovócitos foram capazes de interpretar a informação contida no mRNA viral. Questão 1100 Analise este gráfico.

tradução Questão 1103 O esquema a seguir mostra a via metabólica de um aminoácido. presente no RNA mensageiro. apresentando suas hipóteses sobre a estrutura teórica da biologia molecular. e) uma molécula de DNA difere de outra pela seqüência de seus nucleotídeos. (16) o código genético é degenerado. será lembrado como um dos mais influentes cientistas de todos os tempos. (04) o RNA transportador tem como função levar as proteínas produzidas no núcleo para o citoplasma.5. a) o código genético é degenerado. (32) existem códons específicos para concluí-lo. c) Apenas III. (02) dele participam três moléculas de RNA: o ribossômico. morto em julho de 2004. repressão. b) a transferência de informações genéticas ocorre do DNA para o RNA. que ocorre em nível celular. um dos descobridores da estrutura da molécula de DNA. transcrição. Em 1958. Questão 1105 1. é a síntese de proteínas.Um indivíduo com a enzima 1 inibida deixa de produzir as enzimas 2 e 3. Com relação a esse processo. assim. isto é. II . e) Apenas II e III. d) cada molécula de DNA é formada pela reunião de nucleotídeos. levando à formação de alguns hormônios: dogma central da Biologia. transcrição.8. transcrição c) amplificação gênica.Um indivíduo com a enzima 1 inibida precisa receber os hormônios 1 e 2 de fontes externas. o mensageiro e o transportador. Entre as hipóteses apresentadas naquele texto.5 248 . tradução e) transcrição. tradução d) replicação. pois um aminoácido pode ser codificado por mais de uma trinca. c) cada polipeptídeo tem uma seqüência específica de nucleotídeos determinada pelo gene. publicou um manifesto sobre a síntese de proteínas. e deste para a proteína. (08) o ordenamento dos aminoácidos na proteína formada dá-se em função da seqüência de bases nitrogenadas.Um indivíduo com a enzima 1 inibida acumulará grandes quantidades de aminoácido 3. tradução. lançando.a) repressão gênica. Segundo esse dogma. diferentes códons sempre especificam diferentes aminoácidos na cadeia polipeptídica. III . d) Apenas I e II. b) Apenas II.5 Um dos processos metabólicos mais importantes. as bases para a descoberta do código genético. é CORRETO afirmar que: (01) ele ocorre nos ribossomos. Questão 1106 respeito deste esquema são feitas as seguintes afirmações: I . Quais estão corretas? a) Apenas I. que podem ser de quatro tipos diferentes. Questão 1104 O cientista britânico Francis Crick. destaca-se o 1.8. replicação.5. no interior do núcleo. replicação b) replicação.

ribossomo e códon. o número (2). as lacunas. Nas células eucariotas.8.núcleo d) replicação .tradução . (1) Os ribossomos estão se movendo da parte de baixo para a de cima do esquema. b) 3 representa a proteína carregada pelo RNA mensageiro. os processos representados pelos números (1) e (2) ocorrem no _________. e) RNAm. (2) No esquema. 1.8. Questão 1109 O diagrama ilustra uma fase da síntese de proteínas. e) 4 representa o RNA mensageiro que está sendo carregado pelo RNA transportador representado pelo número 1. "Biologia .replicação . o número (1) corresponde ao processo de ___________. ribossomo e anticódon. p.replicação . ao processo de ___________ e o número (3) ao processo de ___________. d) 1 representa a mitocôndria onde ocorre o processo de tradução.5 s algarismos I.tradução .transcrição . ribossomo e anticódon. vol.Uma abordagem evolutiva e ecológica".No esquema. (4) O número de aminoácidos da proteína dependerá do tamanho do RNA mensageiro.núcleo Questão 1107 1. II. 1997.tradução . c) RNAt.citoplasma. Na figura.transcrição . 150. d) RNAm. Assinale a alternativa que preenche.5. RNAt. RNAm. corretamente. RNAt. São Paulo: Moderna.núcleo. RNAm. respectivamente. Questão 1108 O esquema a seguir representa a síntese protéica.tradução . códon.8. o número a) 2 representa o RNA mensageiro que contém os códons para a síntese protéica. (3) O conjunto representado pode estar localizado no retículo endoplasmático rugoso.citoplasma e) replicação . a) transcrição . c) transcrição .5. não está representado o RNA transportador.5 AVANCINI e FAVARETTO. 249 .transcrição . 1. a: a) ribossomo. 1.5.5 Analise o esquema e julgue os itens a seguir. que também participa do processo. III e IV correspondem. todas as proteínas representadas no esquema serão iguais.tradução . c) 4 representa o RNA transportador que carrega a mensagem. (0) Ao final da síntese. b) replicação . b) RNAt. RNAm e RNAt. ribossomo e códon.

Nesse extrato o agente transformante era a) o ácido ribonucléico. duplicação e lisossomo. causavam a morte de cobaias. Questão 1111 Considere o diagrama. porém. c) nos genes I e III. é normal. I. e) tradução. produzem quatro tipos diferentes de enzimas. transcrição e ribossomo. não patogênicos. tradução e ribossomo.5 250 . a a) transcrição. transformando o aminoácido fenilalanina em quatro possíveis substâncias. e) uma proteína.8. onde quatro genes. d) nos genes II e III. Nesse extrato o agente capaz de transformar bactérias não-patogênicas em patogênicas era a) o ácido ribonucléico.5. d) uma enzima. duplicação e retículo endoplasmático. b) nos genes I e II. somente. responsável pelo sequenciamento dos aminoácidos em um peptídeo com peso molecular de 27000 daltons? a) 810 b) 300 c) 270 d) 81000 e) 2700 Questão 1113 Griffth em 1928 descobriu que pneumococos sem cápsula.5. misturados com um extrato de pneumococos capsulados patogênicos mortos causavam a morte de cobaias. e) nos genes III e IV.Questão 1110 O esquema representa alguns passos de uma série de reações metabólicas. 1. 3 e 4. somente. somente. somente. c) o ácido desoxirribonucléico. Questão 1114 Em 1928 Griffth descobriu que pneumococos (bactérias) sem cápsula e não-patogênicos. c) o ácido desoxirribonucléico. que resume as principais etapas da síntese protéica que ocorre numa célula eucarionte.8. b) o ácido indolilacético. b) tradução. somente. respectivamente. O funcionamento das glândulas supra-renais. quantos nucleotídeos em média estão presentes em uma seqüência codificadora de ARN-m. s processos assinalados como 1 e 2 e a organela representados no diagrama referem-se. II. 1. III e IV. Questão 1112 Supondo que o peso molecular médio de um aminoácido é de 100 daltons.5 m indivíduo tem anomalias na pigmentação do corpo e seu metabolismo é prejudicado pela falta do hormônio da tireóide. os sintomas que o indivíduo apresenta ocorrem devido às alterações a) no gene I. c) duplicação. e) uma proteína. transcrição e lisossomo. patogênicos e mortos. b) o ácido indolilacético. 2. d) transcrição. De acordo com o esquema. misturados com um extrato de pneumococos capsulados. 1. d) uma enzima.

Questão 1115 Griffth, em 1928 descobriu que bactérias pneumococos sem cápsula e não-patogênicos, misturados com um extrato de pneumococos capsulados, patogênicos e mortos, causavam a morte de cobaias. Em 1944 Avery, McLeod e McCarthy concluíram que o agente capaz de transformar as bactérias era a) o RNA. b) o AIA. c) o DNA. d) uma enzima. e) uma proteína. Questão 1116 A experiência do "liquidificador" realizada por Hersey e Chase demonstrou que a substância que determinava a destruição de bactérias parasitadas pelos vírus bacteriófagos era a) uma proteína viral. b) uma enzima viral. c) o RNA viral. d) o DNA viral. e) um lípide viral. Questão 1117 O experimento do "liquidificador" serviu para demonstrar que o DNA de certos organismos era capaz de causar a destruição de bactérias. Os organismos que podem infectar bactérias são a) fungos. b) vírus. c) algas. d) ácaros. e) protozoários. Questão 1118 Bacteriófagos são a) protozoários de vida livre. b) líquenes parasitas. c) vermes parasitas. d) vírus. e) vermes de vida livre.

Questão 1119 A experiência do "liquidificador" realizada por Hersey e Chase em 1952 demonstrou que a) o material genético é formado por proteínas. b) o material genético é formado de RNA. c) o material genético é formado de lipídios. d) o material genético é formado por açúcares. e) o material genético é formado de DNA. Questão 1120 A bactéria 'Pneumococo pneumoniae' pode possuir uma cápsula que lhe permite a) sofrer mutações. b) desenvolver flagelos. c) resistir às defesas dos hospedeiros. d) ficar imune às defesas dos hospedeiros. e) sobreviver em ambientes sem água. Questão 1121 "O século XX proporcionou uma série de pesquisas na área genética. Em 1928, Griffith realizou um importante experimento que envolvia transformações em bactérias. Esse experimento, retomado por Avery e colaboradores, em 1944, foi a base para a descoberta da molécula formadora do material genético. Nos anos 50, Watson e Crick apresentaram o modela da dupla-hélice dessa molécula, abrindo caminho para que, na década seguinte, se demonstrasse como o gene, através de sua seqüência de bases nitrogenadas, controla a produção de proteínas. Nas duas últimas décadas, o avanço biotecnológico permitiu aos cientistas a manipulação do material genético e a transferência de um gene de uma espécie para outra." Considere os itens abaixo: I. estrutura da molécula do DNA; II. descoberta do código genético; III. DNA como molécula constituinte do gene; IV. obtenção de organismos transgênicos. O texto faz referência a) apenas aos itens I, II e III.
251

b) apenas aos itens I, II e IV. c) apenas aos itens I, III e IV. d) apenas aos itens II, III e IV. e) a todos os itens considerados. 1.5.8.6 Questão 1122 Sabendo que o DNA dos vírus bacteriófagos contém fósforo e que a cápsula protéica contém enxofre, Hersey e Chase, em 1952, cultivaram vírus em meio contendo isótopos de fósforo (¤£P) e de enxofre (¤¦S). Esses pesquisadores observaram, ao introduzir os vírus marcados em meio contendo bactérias, que os isótopos de fósforo (¤£P) apareciam no interior das bactérias e que os isótopos de enxofre (¤¦S) permaneciam fora das células. Observaram também que, após lavarem a superfície das bactérias, retirando o enxofre (¤¦S), continuava ocorrendo a replicação dos vírus. Com esse experimento, eles puderam concluir que a) a informação genética necessária para a síntese de novos vírus está contida no DNA viral. b) as capas protéicas dos vírus contêm parte importante da informação genética necessária à síntese de novos vírus. c) o DNA viral precisa estar associado integralmente às capas protéicas para poder se replicar no interior das bactérias. d) a capa protéica protege o DNA viral da ação de endonucleases no interior do organismo hospedeiro. e) os vírus bacteriófagos contêm DNA como material genético, e essa molécula é muito rica em enxofre. Questão 1123 No início da década de 1950, foi desenvolvido um experimento onde um dos componentes de um tipo de bacteriófago foi marcado radiativamente com enxofre e outro, com fósforo. Esses bacteriófagos foram utilizados para infectar uma cultura de 'Escherichia coli'. Um dos componentes entrou na bactéria, e o outro foi retirado da parede da mesma, por agitação. A cultura foi, então, imediatamente, centrifugada. O resultado obtido encontra-se ilustrado no esquema a seguir.

obre o resultado do experimento, é correto afirmar que a) o DNA do bacteriófago marcado com fósforo encontra-se no depósito bacteriano. b) as proteínas do bacteriófago marcadas com enxofre encontram-se no depósito bacteriano. c) o DNA do bacteriófago marcado com enxofre encontra-se em suspensão. d) as proteínas do bacteriófago marcadas com fósforo encontram-se em suspensão. e) o DNA do bacteriófago marcado com enxofre encontra-se no depósito bacteriano. Questão 1124 Por razões pouco conhecidas, durante a meiose pode ocorrer a não-disjunção de um determinado par de cromossomas, acarretando anomalias cromossomiais. Como exemplo de anomalia cromossomial autossômica temos: a) mongolismo. b) daltonismo. c) hemofilia. d) Síndrome de Turner. e) Síndrome de Klinefelter. Questão 1125 O esquema a seguir representa a formação dos gametas responsáveis pela produção de um indivíduo com alteração do seu número cromossomial.

252

1.5.9.1

III IV a) 65 , 65. b) 65 ,130. c) 70 , 60. d) 130 , 65. e) 130 , 130. Questão 1128 Monossomia do cromossomo X, ovários rudimentares, mau desenvolvimento dos caracteres sexuais secundários, baixa estatura são, entre outros, dados que podem ser relacionados com a síndrome: a) de Marfan b) de Klinefelter c) de Down d) de Turner e) de Patau Questão 1129 A constituição genética dos indivíduos com síndrome de Klinefelter é: a) 45A XX b) 44A XYY c) 44A XXY d) 45A XO e) 47A XXY Questão 1130 A síndrome de Down ou mongolismo é uma anomalia causada por: a) uma mutação gênica b) uma deficiência cromossômica c) uma diminuição do número de cromossomos no genoma d) um aumento do número de cromossomos do genoma e) uma inversão cromossômica Questão 1131

ntre as características que este indivíduo passará a apresentar, teremos: a) sexo masculino. b) cariótipo normal. c) estatura elevada. d) caracteres sexuais desenvolvidos. e) ausência de cromatina sexual. Questão 1126 A síndrome de Klinefelter é uma anomalia genética devido à: a) presença de três cromossomos autossômicos nŽ 21. b) ausência de um cromossomo autossômico nŽ 21. c) presença de um cromossomo X e dois cromossomos Y. d) presença de um cromossomo Y e dois cromossomos X. e) ausência de cromossomos sexuais. Questão 1127 Suponha que o seguinte processo ocorre em uma comunidade onde convivem diferentes espécies de gramínea: Qual das alternativas a seguir indica corretamente o valor de 2N dos híbridos III e IV do processo esquematizado?

1.5.9.1

Se na ovulogênese, não houver disjunção do par de cromossomos sexuais, os óvulos correspondentes, sendo fecundados, poderão dar origem a casos de a) síndrome de Turner b) síndrome de Klinefelter c) síndrome de Down d) síndrome de Patau e) a e b são possíveis
253

Questão 1132 Duas espécies de plantas A(2n = 8) e B(2n = 6) foram cruzadas produzindo um híbrido interespecífico que, germinando, produz alguns grãos de pólen que foram utilizados para fecundar óvulos da espécie B. Assinale a opção que relaciona o nível de ploidia e o número de cromossomos da descendência. a) 2n = 7 b) 2n = 10 c) 3n = 7 d) 3n = 10 e) 4n = 14 Questão 1133 Duas espécies de plantas A(2n = 8) e B(2n = 10) foram cruzadas produzindo um híbrido interespecífico que, germinando, produz alguns grãos de pólen que foram utilizados para fecundar óvulos da espécie B. Assinale a opção que relaciona o nível de ploidia e o número de cromossomos da descendência. a) 2n = 7 b) 2n = 14 c) 3n = 14 d) 3n = 10 e) 4n = 14 Questão 1134 A figura a seguir representa uma sinapse (pareamento) anormal observado quando ocorre a mutação cromossômica estrutural denominada:

a) inversão pericêntrica b) translocação c) duplicação d) deleção e) isocromossomos Questão 1135 A figura a seguir representa uma sinapse (pareamento) anormal observado quando ocorre a mutação cromossômica estrutural denominada:

1.5.9.1

a) inversão pericêntrica b) translocação c) duplicação d) deleção e) isocromossomos Questão 1136 Existem algumas pessoas chamadas especiais porque possuem uma série de características diferentes da maioria da população. Entre essas, estão aquelas que possuem a 'Síndrome de Down', também conhecida como Mongolismo. Em relação a essa síndrome, podemos afirmar que: a) é uma anomalia genética, causada pela presença de 3 cromossomos 21 e transmitida sempre pela mãe. b) é uma anomalia congênita, causada pela presença de 3 cromossomos 21 e transmitida sempre pela mãe. c) é uma anomalia genética, causada pela presença de 3 cromossomos 21 e transmitida por qualquer um dos pais. d) é uma anomalia congênita, causada pela ausência de um cromossomo sexual X ou Y. e) é uma anomalia genética, causada pela translocação de um dos cromossomos 21 para um 22.

1.5.9.1

254

Questão 1137 Num dado organismo, foram encontradas células somáticas normais com seis cromossomos (I) e células aberrantes (II e III) cujos cariótipos estão esquematizados a seguir.

Questão 1139 O número de cromossomos de uma espécie é 2n=20. O sistema de determinação do sexo é do tipo ZW. O cariótipo que representa uma euploidia é: a) 20, ZW b) 20, ZZ c) 30, ZWW d) 19, ZO e) 21, ZZW Questão 1140 A figura a seguir ilustra o processo denominado AMNIOCENTESE, utilizado para diagnóstico pré-natal de doenças genéticas. A técnica consiste na remoção de uma pequena quantidade de líquido amniótico (que banha o feto durante o desenvolvimento embrionário) para análise. Nesse líquido são encontradas proteínas e células que se soltam da pele do feto e dos revestimentos das vias gastrointestinais, respiratórias e genito-urinárias. As células imersas no líquido podem ser coletadas por centrifugação e utilizadas para estabelecer culturas de amniócitos. Essas culturas podem ser analisadas citologicamente, ou por análise do DNA.

1.5.9.1

s aberrações cromossômicas dos cariótipos II e III são, respectivamente, do tipo a) monossomia e trissomia. b) monossomia e poliploidia. c) nulissomia e trissomia. d) nulissomia e poliploidia. e) nulissomia e monossomia. Questão 1138 Observe o cariótipo a seguir, obtido a partir de células diplóides de uma pessoa.

1.5.9.1

1.5.9.1

ua análise permite afirmar que ele pode pertencer a uma mulher a) normal, com 47 cromossomos. b) com síndrome de Down. c) com síndrome de Klinefelter. d) com daltonismo. e) com polidactilia.

255

obre o processo acima descrito são feitas várias afirmações. Com base em seus conhecimentos e no texto acima, assinale a alternativa que apresenta um ERRO conceitual ou processual. a) O líquido amniótico funciona como amortecedor de choques mecânicos e propicia um ambiente adequado para o desenvolvimento do feto. b) Células presentes no líquido podem ser utilizadas para a determinação de anomalias cromossômicas. c) O processo pode ser indicado para gestantes com idade avançada, para as quais é maior o risco de terem filhos com Síndrome de Down. d) A cariotipagem pode ainda ser utilizada para a detecção de erros inatos do metabolismo como, por exemplo, a hemofilia. e) A presença de alguns vírus, como o da rubéola, apontam para possibilidade de más formações congênitas na criança. Questão 1141 O daltonismo é um caráter ligado ao sexo na espécie humana. A seguir estão representados os cariótipos de cinco indivíduos que apresentam uma anomalia cromossômica numérica, além de serem todos daltônicos.

odas as afirmações a seguir referentes aos indivíduos representados são verdadeiras, EXCETO: a) O gameta com um cromossomo a mais que deu origem ao indivíduo I foi produzido por não-disjunção na segunda divisão meiótica da gametogênese masculina. b) Ao pai do indivíduo II é obrigatoriamente daltônico, e a não-disjunção que resultou na anomalia pode ter acontecido na gametogênese feminina. c) Se o pai do indivíduo III não for daltônico, a não-disjunção que resultou na anomalia ocorreu na gametogênese feminina. d) Se o pai do indivíduo IV não for daltônico, a não-disjunção que resultou na anomalia ocorreu na gametogênese feminina. e) A mãe do indivíduo V pode ou não ser daltônica. Questão 1142

1.5.9.1

1.5.9.1 Acima, representa-se esquematicamente uma alteração estrutural de um cromossomo que serve de exemplo para o fenômeno denominado a) duplicação. b) deleção. c) translocação. d) transdução. e) inversão. Questão 1143 Uma mulher triplo-X é fértil e produz óvulos normais e óvulos com dois cromossomos X. Sendo casada com um homem cromossomicamente normal, essa mulher terá chance de apresentar a) apenas descendentes cromossomicamente normais. b) apenas descendentes cromossomicamente anormais. c) 50% dos descendentes cromossomicamente normais e 50% cromossomicamente anormais.
256

é possível detectar a anomalia que caracteriza a síndrome de Down. Questão 1145 Duas espécies de gramíneas. em função de alelos incompatíveis.1 Questão 1148 Na figura a seguir. Assinale a alternativa que representa esse cromossomo após um rearranjo do tipo inversão. b) mutação de um gene do cromossomo X. 1. De acordo com o texto e os conhecimentos sobre o tema. que por sua vez produziam sementes normalmente. b) Durante a meiose ocorrida em F1. e) falta de um cromossomo X.1 s eventos possíveis da meiose que levam à síndrome de Down são os de número: a) 1 e 4 b) 1 e 3 c) 2 e 3 d) 2 e 4 Questão 1147 Considere o cromossomo a seguir esquematizado.5. o que resultou em uma duplicação do número cromossômico. e) A duplicação deu-se apenas com os cromossomos viáveis de cada espécie e o número total foi completado com quebras cromossômicas. mas não conseguia produzir sementes. que florescia. III e IV. temos uma célula diplóide 2n = 6 cromossomos. Meristemas desta geração de híbridos (F1) foram submetidos a um tratamento com colchicina. viabilizando a meiose. de 257 . que foram seletivamente eliminados em F2. d) existência de um cromossomo X extra. respectivamente. pertencentes a gêneros diferentes. d) A duplicação do número cromossômico permitiu a formação de 28 pares de cromossomos bivalentes.d) 25% dos descendentes cromossomicamente normais e 75% cromossomicamente anormais. parte dos cromossomos foi eliminada.9. 1. foram cruzadas e criou-se um híbrido. havendo multiplicação apenas do lote haplóide de uma das espécies. também com 2n=28.5. gerando plantas (F2) com 2n=56. seguida de reprodução normal na F2: a) O tratamento com colchicina removeu as barreiras químicas existentes nos dois conjuntos de cromossomos. e) 75% dos descendentes cromossomicamente normais e 25% cromossomicamente anormais. Questão 1144 Na espécie humana. Em II. a anomalia conhecida como síndrome de Down ou mongolismo deve-se à a) mutação de um gene autossômico. ambas com número cromossômico 2n=28. em I.9. c) existência de um autossomo extra. c) A primeira geração filial era infértil. assinale a alternativa que indica a causa mais provável para a infertilidade da F1. temos exemplos. O esquema a seguir apresenta quatro eventos da divisão celular. Questão 1146 Pela análise dos cromossomas.

Com base nessas informações e outros conhecimentos sobre o assunto. entre os quais. inversão pericêntrica. por conseguinte. que induz à a) haploidia. b) inversão cromossômica. e) monossomia. apresentar alterações. inversão paracêntrica. Chamava-se Sete-de-Ouros. Como exemplo. vindo de Passa-Tempo. b) a presença de dois cromossomos X impede a manifestação do fenótipo masculino. translocação. "Sagarana". c) É um típico exemplo de animal híbrido. translocação. d) Produz gametas inviáveis.Questão 1151 O número de cromossomos da espécie humana pode.1 a) haploidia. podemos citar o uso da Colchicina.) Todas as alternativas apresentam características biológicas do burrinho referido nesse texto. inversão paracêntrica. mais vantajosos economicamente. translocação. Questão 1149 Vegetais maiores. Conceição do Serro. b) haploidia. ou não sei onde no sertão. EXCETO a) É resultante do cruzamento de égua com jumento. usando-se técnicas de melhoramento genético. translocação. Pessoas com síndrome de Klinefelter possuem 47 cromossomos. J." (ROSA. d) a fecundação de um óvulo X por um espermatozóide XY dá origem a um indivíduo Klinefelter. c) a ocorrência do fenótipo mutante é resultado de um cromossomo extra. os cromossomos sexuais são representados por XXY.9.5. não existindo não-disjunção e. 1. 1. b) Tem características morfológicas idênticas às de um dos pais. miúdo e resignado. Na tabela a seguir são dados cinco casos cuja veracidade você deverá analisar.1 Questão 1153 Na Síndrome de Down. mais vigorosos e. às vezes. é INCORRETO afirmar que a) os pais de um indivíduo Klinefelter têm número normal de cromossomos nas células somáticas. e já fora tão bom. d) monossomia. Questão 1152 Muitas aberrações cromossômicas humanas se manifestam como síndromes bem definidas e de fácil constatação pela análise do cariótipo. Esses vegetais podem ser reproduzidos pelo homem. Questão 1150 "Era um burrinho pedrês. e) translocação cromossômica. d) recombinação gênica. também conhecida como trissomia 21: ( ) a causa é a não-disjunção. artificialmente. como outro não existiu e nem pode haver igual. c) poliploidia. translocação.5. inversão paracêntrica.9. inversão pericêntrica. o fenômeno ocorre quando os cromossomos não se separam durante a primeira divisão meiótica. a produção de espermatozóide ocorre durante todos os anos reprodutivos.Guimarães. 258 . c) monossomia. ( ) nos homens. não levando à aneuploidia em seus filhos. por esse motivo. isto é. ocorrem casualmente na natureza. Assinale nos parênteses V se for verdadeira ou F se a afirmação for falsa.

pessoas com síndrome de Down alcançam importantes marcos no desenvolvimento e podem estudar.( ) afeta indivíduos que têm um autossoma extra.o livro confunde herança ligada ao sexo com aneuploidias. d) fato de as células autossômicas dos portadores terem 46 cromossomos. Questão 1156 Uma pesquisadora analisou células da mucosa bucal de frentistas de postos de gasolina. Quanto a esses micronúcleos. caracteriza-se pela trissomia do cromossomo 21 e decorre do(a) a) erro de disjunção do cromossomo 21 durante a formação dos gametas. podemos supor que se originaram a partir de a) translocação. d) I. 259 . d) deslocação. b) fecundação de um gameta feminino diplóide por um gameta masculino haplóide. Em função do comentário do professor. além do núcleo. "CIÊNCIA HOJE". translocado para outro cromossomo. professor da Faculdade de Educação da USP. ( ) o longo período de intervalo entre o início da meiose do tecido ovariano (durante o desenvolvimento fetal) e seu término (na ovulação) é a mais provável razão para a incidência aumentada em mães mais idosas. e) I está correta. Nélio. Quando bem assistidas. Rev. b) substituição. mas apresenta a doença quando afetado. c) senilidade dos ovócitos em mulheres com idade a partir dos 35 anos. preconceito e tautologia em uma única linha. 26 Os casos de aneuploidias citados no texto incluíam daltonismo e hemofilia. Pode-se afirmar que a) I e II estão corretas. um exemplo disso é que aproximadamente uma a cada 600 crianças no mundo nasce com síndrome de Down. Questão 1154 A Síndrome de Down. ( ) os portadores têm uma cópia extra do cromossomo 21. apresentavam micronúcleos originados em cromossomos defeituosos. e) bipartição. Na grande maioria dos casos. podem-se perceber erro conceitual grave. Esta Síndrome pode ser classificada como exemplo de a) Nulissomia. analise as afirmações abaixo: I . e) Triploidia. Questão 1155 FALHAS NO ENSINO DE CIÊNCIAS "ERROS EM LIVROS DIDÁTICOS AINDA PERSISTEM EM ESCOLAS DE MINAS E SÃO PAULO" Nélio Bizzo O autor. trabalhar e ter uma vida semelhante à dos demais cidadãos. como por exemplo: explique por que o homem não é portador de aneuploidias. em alguns casos. II e III estão corretas. III . c) deleção. Questão 1158 As anomalias cromossômicas são bastante freqüentes na população humana. c) Trissomia. uma aneuploidia autossômica. c) II e III estão corretas. isso se deve à presença de um cromossomo 21 extranumerário.tanto o homem quanto a mulher podem ser portadores de aneuploidias. Foram encontradas muitas células que. II . Abril 2000: nŽ 159. d) Euploidia. Questão 1157 Mulheres com Síndrome de Turner caracterizam-se por apresentar baixa estatura. b) Monossomia. b) I e III estão corretas. p." BIZZO. comenta em um dos seus artigos: ". ou um segmento do cromossomo 21.daltonismo e hemofilia são alterações gênicas e não cromossômicas. esterilidade e pescoço alado...

numerados de 1 a 6. 1. pode-se afirmar que o indivíduo é: a) trissômico. (04) ocorrem somente em filhos e filhas de mulheres de idade avançada. Questão 1159 Em uma certa espécie de animal selvagem. b) poliplóide. Questão 1161 1.1 260 . d) haplóide. e) monossômico. onsiderando-se os dados anteriores. Entretanto.1 Os quadrados a seguir representam. (16) ocorrem ao acaso. (64) podem acontecer devido a erros na duplicação do DNA. (1) As fibras do fuso acromático têm importância fundamental para as migrações cromossômicas características da anáfase. produzindo doenças graves e até mesmo a morte. células de seis indivíduos. um indivíduo anormal foi identificado na população e seu cariótipo foi representado pela seguinte forma: 1. Questão 1160 A figura abaixo esquematiza a não-disjunção cromossômica.5. com a indicação do número de cromossomos autossômicos (A) e dos tipos de cromossomos sexuais (X e Y).Sobre as anomalias do número de cromossomos.9.5. em esquema. é CORRETO afirmar que: (01) podem ocorrer tanto na espermatogênese quanto na ovulogênese.9. são exemplo de trissomia e de monossomia.5.1 A respeito desse tema.XY. julgue os itens abaixo. (4) As síndromes de Down e de Turner. (08) estão intimamente ligadas à separação incorreta dos cromossomos na meiose. com menor escolaridade e pouca assistência médica. os machos normais apresentam complemento cromossômico igual a 2n=6. (32) ocorrem preferencialmente em populações de menor renda. (3) As aberrações cromossômicas numéricas causam grandes alterações no funcionamento celular. causadas por não-disjunções cromossômicas.9. (02) ocorrem mais em meninas do que em meninos. c) triplóide. (2) Os erros na distribuição de cromossomos que levam às aneuploidias são freqüentes no processo de meiose e raros nas mitoses. presentes em cada uma delas. devido a um erro na gametogênese.

tendo apenas um X. apenas. Turner e Klinefelter. e) Klinefelter. d) somente a II e a III. III . tais como: presença de um cromossomo 21 a mais. A(s) afirmação(ões) correta(s) é(são): a) somente a II. determinam. c) Turner. b) somente a I e a II. apenas. Klinefelter e Turner. d) substituição das três primeiras bases nitrogenadas por outras. b) II. A que se deve esse fato? a) Ao cromossomo X ser um dos menores cromossomos do conjunto haplóide b) Ao cromossomo X ser basicamente formado por heterocromatina com poucos genes estruturais c) Ao cromossomo X não ter uma pequena parte homóloga ao cromossomo Y. é conhecida a trissomia do cromossomo 21 (síndrome de Down). I .Podem alterar o número. a II e a III. Turner e Down. tetrassomia e até pentassomia desse cromossomo. d) I e III. c) somente a I e a III. O indivíduo 4 pode ser do sexo masculino ou do sexo feminino. o ser vivo reage sofrendo uma mutação gênica. e) a I. apenas. e às células representadas. 47 cromossomos.Ocorrem para adaptar o indivíduo ao ambiente. Em relação ao cromossomo sexual X são conhecidos casos de recém-nascidos do sexo feminino com trissomia. o chamado ADN lixo Questão 1164 As alterações do número de cromossomos. Questão 1166 Analise as afirmativas a seguir a respeito das mutações. respectivamente. sendo dois X e um Y e 45 cromossomos. c) I e II. 261 .Ocorrem em células sexuais e somáticas. III . Turner e Klinefelter. b) Morgan. Questão 1163 Na espécie humana. e) inclusão de mais três bases nitrogenadas no final da molécula. Estão corretas as afirmações: a) I. I . Os indivíduos 3. e) II e III. c) III apenas.m relação a estes indivíduos. apenas. o que evita a permuta gênica entre eles d) Aos cromossomos X menos um serem inativados ainda na fase do desenvolvimento embrionário e) Ao cromossomo X ser o cromossomo com maior quantidade de ADN repetitivo. II. Questão 1165 Considere um segmento de DNA com seqüência de bases indicadas a seguir: TTA TCG GGA CCG ATC ATC GTA A alteração mais drástica que esta molécula pode sofrer é a: a) supressão da segunda base nitrogenada. III. Questão 1162 A respeito das mutações. b) supressão das três primeiras bases nitrogenadas.As mutações ocorridas em células somáticas são de grande valor adaptativo para a perpetuação da espécie. 5 e 6 são normais e pertencem à espécie humana. leia as afirmações a seguir. a forma e o tamanho dos cromossomos. A célula do indivíduo 2 pode ser igual a de um gameta do indivíduo 1. d) Down.As mutações transmitidas às gerações futuras são aquelas que ocorrem em células germinativas. I. as síndromes de: a) Down. que é um dos menores cromossomos da espécie. II . II . Down e Morgan. apenas. foram feitas as afirmações seguintes. Está(ão) correta(s) a) I apenas b) II apenas.Sempre que o ambiente se torna desfavorável. c) substituição da quarta base nitrogenada por outra.

Errar é humano. b) somente 2. b) o código genético ser repetitivo ou degenerado. É ela: a) seleção natural.. c) o erro ser corrigido pela célula durante a tradução. Questão 1171 O esquema a seguir mostra dois ciclos de replicação de moléculas de DNA. c) sua síntese ocorrer no complexo de Golgi e não no retículo endoplasmático rugoso. base que normalmente emparelha-se com citosina (C). e) mutação. Mutações podem ocorrer espontaneamente ou serem 262 .d) I e II apenas. e) II e III apenas. d) o código genético não poder sofrer alterações.9. a mutação no par de bases indicado estará presente em a) somente 1. Nova Fronteira. e) o DNA não se duplicar durante a intérfase. seríamos ainda bactéria anaeróbia. 3 e 4. b) durante sua síntese houver variação dos tipos de RNA transportadores. 1979).5. c) excitabilidade. Questão 1169 "A capacidade de errar ligeiramente é a verdadeira maravilha do DNA. mutações pontuais. e) origina somente combinações gênicas adaptativas. b) reprodução. Questão 1172 Leia as afirmativas a seguir: I. 1. "A medusa e a lesma". Isto se dá devido ao fato de: a) o código genético ser universal. uma adenina sofreu uma desaminação e transformou-se em hipoxantina (H). muitas vezes não resultam em substituição efetiva do aminoácido correspondente ao códon mutado na proteína produzida. dizemos. RJ. nos organismos eucariontes a) constitui a principal fonte de variabilidade genética. Porém. ed. d) uma base púrica substituir uma pirimídica no RNA mensageiro que a codifica. e é mais difícil ainda aceitar o fato de que errar é também biológico" (Lewis Thomas. 2. Sem esse atributo especial. c) somente 1 e 2. d) ocorre devido a alterações na molécula de DNA. d) somente 3 e 4. Esse texto refere-se a uma característica dos seres vivos. Após a replicação da molécula I. d) excreção.3 onsiderando as moléculas III. de modo que podemos esperar baixa variabilidade na sua população. e) os genes mutados não serem transcritos ou traduzidos. As cianofíceas reproduzem-se apenas assexuadamente. e a música não existiria (. II. Questão 1170 Diversas doenças estão relacionadas a mutações no material genético. Questão 1168 A mutação gênica. c) origina apenas seres recessivos. Um par de bases nitrogenadas está identificado. e) 1. b) ocorre exclusivamente pela ação de agentes mutagênicos. Questão 1167 A estrutura química de uma proteína poderá ser modificada se a) durante sua síntese houver variação dos tipos de aminoácidos disponíveis no citoplasma celular.). com a alteração de apenas uma base nitrogenada. mas a idéia não nos agrada muito..

Os cientistas consideraram esse percentual muito elevado. e) X ou no gene Z. somente. por ter sido transmitida de geração em geração.). como aquelas provocadas pelos raios X. que permite que ela ocorra em grande número de indivíduos. eles são. de forma significativa. e MATSON K. II e III. apresentada por 3% dos pacientes estudados. No entanto (. São Paulo: Cia. capaz de destruir um organismo. (Adaptado de DENNETT.9. somente. Há momentos em que é importante não cometer erro algum . Questão 1173 Em certo fungo. Entretanto. a única oportunidade para aprendermos algo relativamente novo. de: a) especiação e ortogênese b) mutação e seleção natural c) oscilação genética e epigênese d) variação hereditária e isolamento ecológico Questão 1176 Cometer erros é a chave para o progresso. respectivamente. das Letras. d) I apenas.. somente. b) evitar a ação de agentes externos sobre os genes c) representar uma vantagem para a sobrevivência d) ocorrer em resposta à necessidade de adaptação Questão 1175 Durante o processo evolutivo. c) Z. In: BROCKMAN.induzidas.) A evolução biológica se dá através de uma grande e inexorável seqüência de tentativas e erros . Essa alteração na seqüência de DNA e a eliminação do indivíduo são fenômenos que podem ser explicados pela ocorrência. J. A característica da mutação. b) Y.. a sobrevivência dos indivíduos de uma determinada espécie depende da estabilidade genética. d) X ou no gene Y. b) I e II apenas.5.e sem os erros as tentativas não teriam levado a nada.) O processo que se relaciona com o conceito de evolução biológica apresentado pelo autor é: a) reparação das lesões gênicas b) indução de mutações programadas c) geração de organismos transgênicos d) alteração aleatória na estrutura do DNA Questão 1177 As mutações representam um importante mecanismo evolutivo para os organismos.) os erros não são apenas oportunidades valiosas para aprendermos. Mutações constituem um fator causador de variabilidade. ocorre a seqüência de reações a seguir esquematizada que leva à síntese do aminoácido arginina. A partir do estudo de um grupo de 1850 pessoas.pergunte a qualquer cirurgião ou piloto de avião. e) II apenas. III. Esses fungos devem ter sofrido mutação no gene a) X. Uma das conseqüências deste fenômeno está descrita na seguinte alternativa: a) limitação da diversidade biológica 263 1. Questão 1174 Recentemente cientistas confirmaram suas suspeitas de que existem pessoas imunes à AIDS... (Org.3 erificou-se que certos fungos mutantes só conseguem sintetizar arginina quando a ornitina é acrescentada ao meio de cultura. (. Daniel C. é: a) impedir a multiplicação de determinado vírus no interior das células . A afirmativa está CORRETA em: a) I. 1997. As coisas são assim. pode ocorrer uma alteração permanente numa seqüência de DNA. c) II e III apenas. os cientistas afirmaram que a imunidade está relacionada a uma mutação genética.

9. pode resultar na troca do aminoácido respectivo na proteína. em uma determinada região africana que possui casos de malária. 27 aminoácidos. c) aumenta o número de alelos disponíveis em um locus. pode-se concluir que a) o aumento do número de indivíduos HÞH está diretamente associado ao aparecimento de casos de malária. desfavorece os indivíduos HÞH.5. b) A mutação da 3  base na trinca indicada por 9 pode traduzir um aminoácido diferente.5. d) A trinca indicada por 5 pode transcrever um códon CGA. Sabendo-se que o continente africano possui alto índice de malária e que o 'Plasmodium malariae' tem dificuldade de sobreviver nas hemácias de indivíduos portadores do genótipo HÞH. em quaisquer das trincas indicadas. e) A troca da primeira base. Com base nas informações apresentadas. nesse caso. analise a figura a seguir que representa uma população isolada. o qual é reconhecido pelo anti-códon GCU. d) a variação do meio. pelo menos. Questão 1179 Observe a seqüência de bases nitrogenadas. em um período de tempo.3 odas as afirmativas são corretas quanto à seqüência. d) Recombinação gênica. c) os genótipos HH e HÞH estão igualmente adaptados ao longo do tempo. b) aumenta a freqüência de crossing-over. prioriza os indivíduos HH. b) a elevação do número de indivíduos HH está associada ao aparecimento de indivíduos HÞH infectados. b) Fluxo gênico. Questão 1181 Pode-se afirmar que a mutação a) sempre ocorre para adaptar o indivíduo ao ambiente. em uma população. 1. e) a seleção natural. 264 . c) Seleção natural.9. d) sempre é dominante e prejudicial ao organismo. c) A seqüência pertence a um DNA e pode codificar um polipeptídeo contendo.b) criação de novas variantes de seres vivos c) extinção de espécies nocivas ao ambiente d) produção exclusiva de alterações benéficas Questão 1178 Indivíduos portadores do genótipo HÞH sofrem uma mutação gênica no cromossomo 11 e expressam anemia falciforme ou siclemia. Questão 1180 Assinale a alternativa que indica o fator que conduz ao surgimento de variabilidade gênica nova. a) Mutação. e) Oscilação gênica. durante um certo tempo.3 1. EXCETO a) A introdução de uma adenina (A) entre as trincas indicadas por 2 e 3 pode alterar toda a transcrição a partir desse ponto.

TREONINA . d) reprodução assexuada. espera-se que as árvores originadas das sementes dessa maçã produzam frutos a) todos de casca amarela. TAG ou TAT treonina = TGA. TGG. no qual a parte comestível desenvolve-se a partir do receptáculo da flor. III e IV. c) seleção natural. d) II.lisina . Um alelo mutante determina casca de cor amarela.treonina . Assinale a alternativa que contém todas as afirmações corretas. As mutações podem ocorrer tanto em células somáticas como em células germinativas. b) isoleucina . V. o que chamamos de fruto é um pseudofruto.treonina. b) todos de casca vermelha.3 onsiderando-se que.isoleucina. As mutações são fatores importantes na promoção da variabilidade genética e para a evolução das espécies. Questão 1184 Vários são os processos que atuam na evolução. a fita que será transcrita apresenta a seqüência de nucleotídeos TAA TGT CGA TTC e codifica.LISINA. III e V. ao invés de apresentar casca vermelha.alanina .9. foram apresentadas as cinco afirmações seguintes. mas apenas causadas por fatores mutagênicos. e) II. ISOLEUCINA . d) treonina . Dentre eles. I. d) alguns de casca amarela e outros de casca vermelha.alanina . III.treonina . a) I. Apenas as mutações que atingem as células germinativas da espécie humana podem ser transmitidas aos descendentes. como representado na figura. isoleucina = TAA. outros de casca vermelha e outros de casca bicolor. Questão 1185 1.treonina. b) I.alanina .Questão 1182 A coloração vermelha da casca da maçã é determinada geneticamente. III e V.lisina. 265 . ou seja. c) lisina . um dos frutos. e) reprodução sexuada.ALANINA . independentemente do seu sistema reprodutivo. c) I. c) todos de casca bicolor. e) alguns de casca amarela.isoleucina. Somente as mutações ocorridas em células somáticas poderão produzir alterações transmitidas à sua descendência. apresentava casca com as duas cores. para a seqüência de aminoácidos. em uma determinada macieira. CGC ou CGT lisina = TTT ou TTC Se ocorrer mutação e a nova seqüência de nucleotídeos for TAT TGT CGA TAA.isoleucina . Questão 1183 Em um determinado gene. tais como agentes químicos e físicos. IV. As mutações não podem ser espontâneas.alanina . o único que fornece material genético novo a um determinado conjunto gênico preexistente é a: a) mutação gênica. CGG. aminoácidos da proteína será a) isoleucina .treonina . TGC ou TGT alanina = CGA. Um produtor de maçãs verificou que.lisina . IV e V. e) lisina .5. II. II e III. pode-se prever que a seqüência de A respeito das mutações gênicas. Esses aminoácidos possuem mais de um códon de DNA. na maçã. b) recombinação gênica.

pois houve dano no material genético. Está(ão) correta(s): a) 1. ela a) só herdará os tumores se tiver ocorrido dano em um gene dominante. que passou de citidina a guanina. c) I.Questão 1186 Uma bactéria sofre uma mutação pontual em uma região do seu DNA. Indique o RNA mensageiro codificado pela seqüência de DNA mutada. apenas 266 . 2. e) III. c) só herdará os tumores se for do sexo masculino. Questão 1189 Um surfista que se expunha muito ao sol sofreu danos em seu DNA em conseqüência de radiações UV. 3. o que resultou em pequenos tumores na pele. e) tornaram-se estéreis. apenas b) 1 e 3. II . podemos esperar várias reações. b) produção de filhotes anormais. os quais.A mutação pode ser espontânea ou induzida por agentes físicos. b) só herdará os tumores se tiver ocorrido dano em dois genes recessivos. que resulta sempre de segregação ou recombinação cromossômica. químicos ou biológicos com potencial mutagênico.Mutações são modificações bruscas do material genético que podem ser transmitidas à prole (descendência ou células filhas).Mutações gênicas podem ser causadas por poluentes ambientais e provocar alterações responsáveis pelo aparecimento de genótipos diferentes numa população. c) morte em conseqüência da dose de radiação. Questão 1188 Atualmente são bem conhecidos os efeitos adversos à saúde humana. III . e) não herdará os tumores. Os principais agentes mutagênicos são as radiações ionizantes e os raios-ultravioleta. A alternativa que contém as afirmações corretas é: a) I e III. d) IV e III. Assinale as afirmações corretas: I . II e IV. b) II e III. devido à sua interação com mecanismos genéticos. 2 e 3 e) 2.Mutação é toda alteração do material genético. podem causar mutações e doenças nas gerações futuras. As mutações do tipo substituição de base acarretam a alteração de vários aminoácidos nas proteínas. especialmente aqueles que possuem potencialidades mutagênicas ou carcinogênicas. d) herdará os tumores. Modificações hereditárias que ocorrem num locus específico são chamadas de mutações gênicas. Questão 1190 Analise as proposições: 1. d) tornaram-se albinos. a) ATC GAA TAT CTA b) ATG GAA TAT CTA c) AUC UAU AAG GUA d) AUC GAA UAU CUA e) AUG G GAA UAU CUA Questão 1187 Uma experiência realizada com coelhos (linhagem pura selvagem) consistiu em submetê-los a uma descarga excessiva de raio-X. EXCETO: a) produção de um filhote albino. apenas d) 1. Caso ele venha a ser pai de uma criança. causados por diversos poluentes ambientais. que era: TAC CTT ATA GAT Ocorreu uma mudança na terceira base. Após o experimento. IV . apenas c) 3.

d) não é herdável. e) 2. c) é herdável. Uma mulher que se submeteu a dez sessões intercaladas de bronzeamento. Se. criados em laboratório. para que o corpo produza antígenos e anticorpos específicos. for aplicada uma segunda dose do mesmo antígeno. b) não é herdável. d) 2. Questão 1194 Todas as estruturas citadas a seguir podem ser ligadas à defesa do organismo. queimaduras. produziu anticorpos específicos.400 Angstrons. porque provoca alteração em células somáticas. O corpo. b) um medicamento eficaz no combate à doença já instalada e que produza no corpo uma reação para a fabricação de anticorpos específicos e resistentes.700 Angstrons. que consiste em injetar no organismo: a) vírus ou bactérias vivas para provocar a doença de forma branda.500 Angstrons. porque provoca alteração em células germinativas. c) vírus ou bactérias mortos ou atenuado que.9. porque a mutação resultante é dominante. EXCETO: a) pâncreas b) amídalas c) baço d) timo e) gânglios linfáticos Questão 1195 1. Questão 1192 O gráfico mostra o espectro de absorção de raios ultravioleta (U. reconhecidos pelo corpo como antígenos. 267 . uma vez que as radiações UV danificaram seu DNA. Para que esta meta seja atingida.000. o que reduzirá a mortalidade infantil em pelo menos um terço. visando diminuir os riscos dessa prática. tais como lesões na retina. porque provoca alteração do DNA.Questão 1191 A ANVISA (Agência Nacional de Vigilância Sanitária) normalizou. imunizado. recentemente.4 Considerando a ação desses raios na célula.600 Angstrons. Um organismo recebeu uma primeira dose de um antígeno X e. a serem cumpridas até o ano 2.V. após algum tempo. como os cavalos. onde recebem grande quantidade de antígenos. e) é herdável. quatro meses depois. por estar imunizado. Questão 1193 Os meios de comunicação têm noticiado que a Unicef (Fundo das Nações Unidas para a Infância) estabeleceu como uma das metas. é necessária a vacinação. d) não consiga reagir a essa segunda dose. como resposta imune. produzirá antígenos específicos. b) 2. o comprimento de onda em que será obtida maior taxa de mutação é a) 2. Pode-se afirmar que esse tipo de câncer a) é herdável. retirado de pessoas que já tiveram a doença. b) reaja sem utilizar seus anticorpos. envelhecimento precoce e câncer de pele. c) 2.) por uma proteína e por um ácido nucléico. induzam a produção de anticorpos específicos. a utilização de câmaras de bronzeamento artificial. a imunização de 90% das crianças.800 Angstrons. e) o soro obtido através do sangue de animais. e) produza anticorpos mais rapidamente. com duração de 15 a 30 minutos cada uma. porque a mutação resultante é recessiva. apresentou. indícios de câncer de pele. c) não produza mais anticorpos. d) o plasma.5. espera-se que o organismo: a) reaja da mesma forma como reagiu à primeira dose.

embora já esteja produzindo os seus. d) soro. porque já contém anticorpos. O gráfico que melhor representa as taxas de variação da quantidade de anticorpos nas crianças I e II é: Existe um erro de fundamento biológico na historinha da tirinha. no caso o vírus "A" d) é que a vacina é feita de vírus. você deverá procurar recurso através de a) vacina. porque já contém anticorpos. pois produz poucos anticorpos. que são específicos aos seus antígenos.10 Questão 1197 Leia com atenção a tirinha de Frank & Ernest A análise do gráfico permite concluir que 1.10 a) na época do nascimento a criança não está protegida. somente doenças causadas por bactérias c) é que a vacina não combate vírus. d) após o nascimento a criança depende completamente dos anticorpos maternos. Para a imunização de cada uma das crianças foram utilizados dois procedimentos diferentes: Criança I: aplicação de soro imune Criança II: vacinação.5.5. ela proporciona ao nosso organismo produzir defesas.Questão 1196 A variação da quantidade de anticorpos específicos foi medida por meio de uma experiência controlada. Questão 1199 1. e) vacina. porque estimula o organismo a produzir anticorpos. c) vacina. os anticorpos. pois não produz os próprios anticorpos. porque estimula o organismo a produzir anticorpos. c) o recém-nascido não produz anticorpos. inibindo a sua atividade de defesa. porque contém antígenos específicos. b) soro. 268 . e) após o nascimento a criança depende dos anticorpos maternos. portanto ela não pode destruir o que a produz e) é que o vírus impede a ação da vacina. Assinale a alternativa que esclarece o erro: a) é que vírus do tipo "A" não sofre efeito de vacina alguma b) é que a vacina não combate vírus. que é o sistema "chave-fechadura" Questão 1198 Ao ser picado por uma cobra peçonhenta. b) antes do nascimento o feto nunca produz anticorpos.5.10 1. em duas crianças durante um certo período de tempo.

d) reaja sem produzir anticorpos. (Portal da Prefeitura Municipal de Botucatu. nos gânglios linfáticos. 1. O animal foi encontrado caído em uma praça nas proximidades do centro. Questão 1203 A alergia é uma hipersensibilidade desenvolvida em relação a determinadas substâncias.08. após algum tempo. O morcego doente era da espécie que se alimenta de frutas. 269 . que se reproduzem e fabricam grande quantidade de histaminas. produzindo menos anticorpos. espera-se que ele a) não resista a essa segunda dose. os alergênicos. A reação alérgica ocorre quando as moléculas do alergênico a) ligam-se a moléculas do anticorpo presas à membrana dos mastócitos. SP. De acordo com o gráfico. representam risco de transmissão da raiva. 18. quando foi visto por estudantes. O primeiro foi notificado no início do mês de junho. A Secretaria Municipal de Saúde registrou mais um caso de morcego positivo para raiva na cidade de Botucatu. O animal estava caído e se debatendo. c) produza a antitoxina mais rapidamente. b) medicar com antibióticos específicos os animais domésticos que tenham entrado em contado com os morcegos. c) são reconhecidas pelas células de memória. e) produza menor quantidade de antitoxina. c) produza anticorpos mais lentamente na segunda dose. (Portal "Estadão". pois já está imunizado.10 m organismo recebeu uma dose de um antígeno X e.06. e) são fagocitadas pelos mastócitos e estimulam a fabricação das interleucinas. que reagem liberando histaminas. d) promover campanha para a vacinação anti-rábica da população humana.2006) Para se evitar a contaminação da população humana com o vírus da raiva.Questão 1200 Analise o gráfico que se segue. espera-se que o organismo a) reaja mais rapidamente na segunda dose. recebeu outra dose. O segundo caso na Vila Antártica. na região central da cidade. Este é o terceiro caso de raiva em morcego registrado este ano em Botucatu. b) demore mais tempo para produzir a antitoxina. pela primeira vez.5. c) antecipar a vacinação anti-rábica de cães e gatos nas regiões onde os morcegos foram encontrados. O morcego encontrado é da espécie 'Myots sp' e alimenta-se de insetos. d) ligam-se aos anticorpos e migram para os órgãos imunitários primários onde são destruídas. uma grande proliferação de linfócitos específicos. Se após certo tempo for aplicada uma segunda injeção da toxina no animal. e) reaja na segunda vez. d) não produza mais a antitoxina por estar imunizado. 06.2006) MAIS UM CASO DE MORCEGO POSITIVO PARA RAIVA NA CIDADE DE BOTUCATU. o procedimento mais adequado que deverá ser tomado pelas autoridades da referida cidade será a) promover campanha para localização e eliminação das colônias de morcegos nas áreas urbana e rural. b) desencadeiam. pois apenas os morcegos hematófagos. Questão 1201 DETECTADO FOCO DE MORCEGO COM RAIVA EM BOTUCATU. no final do mês de julho. que são reconhecidas por um tipo especial de anticorpo. a injeção de uma toxina bacteriana e manifestou a resposta imunitária produzindo a antitoxina (anticorpo). e) desconsiderar o ocorrido e informar a população que não tenha receio. mas não os frugívoros ou insetívoros. Confirmada a presença do vírus causador da raiva em um morcego apreendido em uma praça no centro da cidade. b) não consiga reagir a uma segunda dose. Questão 1202 Um coelho recebeu.

e) um patógeno vivo enfraquecido ou partes dele. resistentes às drogas ministradas e passíveis de serem transmitidas a outras pessoas. a) As reações alérgicas e a alta mortalidade provocada pela aplicação do soro. c) A imunização garantida pela administração do soro. Verificaram que 8 pacientes apresentavam novas mutações do vírus. capaz de estimular a resposta imunológica. d) é fácil de ser efetuada. Questão 1208 Observe a figura a seguir. c) precisa ser feita contra a forma normal do HIV. e) certamente deverá estar no mercado dentro de pouco tempo. respectivamente. é possível oferecer os seus soros para outros países". aos a) trombócitos e fagocitose.10 270 . c) leucócitos e diapedese. Segundo o Instituto "a demanda da produção de antivenenos vem diminuindo gradativamente no Brasil. Questão 1206 Consideramos uma vacina um material que contém: a) anticorpos contra determinado patógeno. d) Falta de veneno em quantidade suficiente para a obtenção do soro. famoso pelo seu serpentário. e) Falta de animais com características adequadas para a produção do soro. c) soro de indivíduos previamente imunizados contra aquele patógeno.Questão 1204 Uma lesão na pele pode infeccionar. Das alternativas a seguir. Questão 1207 "Os cientistas examinaram 11 homens aidéticos. b) O êxodo rural e a maior concentração da população humana em centros urbanos. que se multiplicam no corpo do indivíduo que recebe a vacina. b) euritrócitos e pinocitose. tendo em vista a estabilidade do HIV. dos quais 5 nunca tinham usado medicamentos anti-HIV e 6 haviam usado. b) anticorpos contra determinado patógeno produzidos por outro animal e que fornecem proteção imunológica. em fevereiro de 1901. d) células brancas produzidas por animais. Os termos destacados referem-se. b) só pode ser feita contra as formas mutantes do HIV.5. assinale aquela que contém argumento válido e que explica a menor procura por antivenenos no Brasil. foi fundado por Vital Brazil. que estimulam a resposta imunológica do indivíduo. Questão 1205 O Instituto Butantã. quando aparecem CÉLULAS DE DEFESA que ATRAVESSAM OS CAPILARES e caem no tecido conjuntivo." Pela análise do texto. Sendo assim. Hoje é um centro de pesquisa reconhecido mundialmente na área de biomédicas produzindo diversos tipos de soros antitóxicos e antivenenos. pode-se concluir que a fabricação da vacina anti-AIDS a) apresenta os mesmos problemas que a da vacina contra a gripe. protegendo o organismo. para a produção de soro no combate à epidemia de peste bubônica. mas não causar a doença. 1. d) neutrófilos e clasmocitose.

Assinale-a. b) A injeção de toxina na cobaia B é utilizada como controle. assinale a afirmativa INCORRETA. Questão 1210 A vacina de DNA é a mais recente forma de apresentação de antígeno que veio revolucionar o campo da vacinologia. pois fornece para o hospedeiro a informação genética necessária para que ele fabrique o antígeno preservando todas as suas características importantes na indução de uma resposta imune eficiente. Questão 1209 Os anticorpos são proteínas específicas de defesa do corpo. A imunidade desenvolvida pela vacina de DNA não é imediata.tapas na preparação do soro terapêutico. Questão 1211 Em relação à figura a seguir. induzindo a formação de anticorpos. e) Para o sistema imunológico da cobaia A. EXCETO uma. d) O gráfico acima exemplifica ação das vacinas. Em relação aos procedimentos observados na ilustração anterior. diphtheriae'.5.10 correto afirmar. pode-se fazer todas as afirmações. mas é de longa duração. Os antígenos produzidos pelo DNA plasmidial são capazes de combater patógenos que infectem o hospedeiro. Fonte: Bier. (Fonte: Desenvolvimento de vacinas gênicas. O gráfico a seguir representa o resultado de duas aplicações de mesmo antígeno. 1984. EXCETO: a) Doenças diferentes em intervalos menores de tempo provocariam a mesma intensidade de produção de antígenos. "Scientific American". Patógenos vivos não podem ser usados como vacina. c) A injeção de antitoxina e de toxina na cobaia A é usada como controle para testar a eficácia da primeira na inativação da segunda. que representa a atividade de células T citotóxicas. ou os problemas proporcionados pela produção das vacinas de subunidades em microorganismos. III. 1999. a antitoxina diftérica é um corpo estranho. IV. para verificar a atividade letal da toxina na ausência do soro. Otto. O indivíduo geneticamente vacinado passa a produzir tanto os antígenos quanto os anticorpos. II. d) Um animal imunizado com toxina diftérica está protegido da infecção por 'C. São afirmações CORRETAS: a) I e II b) II e IV c) III e IV d) I e III 1.) Com base no texto. Isso sem gerar os efeitos colaterais que podem aparecer quando são utilizados patógenos vivos. pois não determinam imunidade e sim doenças. 271 . que possui o gene codificador da proteína antigênica. foram feitas as seguintes afirmações: I. MICROBIOLOGIA E IMUNOLOGIA. O processo envolve a inoculação direta do DNA plasmidial. que será expressa e produzida no interior das células do indivíduo. b) A dose de reforço provoca produção maior e mais rápida de anticorpos. Esse tipo de vacina apresenta uma grande vantagem sobre as demais. a) A toxina diftérica funciona para o cavalo como uma vacina. c) O tipo de imunização explicitado é ativa. em intervalos diferentes.

De acordo com a teoria clonal. a) Fagócitos . a) O objetivo do uso da vacina é ativar o sistema de defesa do organismo contra invasores através da produção de anticorpos. d) A degradação ou lise da célula infectada não necessita do reconhecimento e da fixação da célula T citotóxica. Aplicada em 36 voluntários saudáveis. O controle e prevenção de acidentes com esses animais podem ser feitos tomando-se os seguintes cuidados. b) Secreções mucosas . a malária continua sendo um dos principais problemas de saúde pública no mundo. pode-se afirmar que a vacina foi eficaz contra todos os parasitos do mesmo filo. Os pesquisadores ainda precisam realizar mais duas fases de testes clínicos antes de confirmar a eficácia da fórmula. que destrói bactérias. hemolítica. d) O ciclo vital desse parasita envolve um curto período na corrente sangüínea. Em uma pessoa 272 . apresentando o mesmo antígeno.5. c) Apesar de muito antiga. Questão 1212 As defesas inatas dos organismos são geralmente mecanismos de proteção que inibem a entrada ou o desenvolvimento de organismos causadores de doenças. Assinale a alternativa que NÃO apresenta a relação correta entre o fator de defesa e sua função. (Fonte: "Folha de S. Questão 1215 A memória imunológica e imunidade resultam da seleção clonal. 09/11/2005) Assinale a afirmativa INCORRETA. Questão 1214 a) Após efetuar um "ataque letal". d) tomar vacina como mecanismo de prevenção ou usar soro de preferência polivalente em caso de picada acidental. os quais se mostraram capazes de atacar o parasito 'Plasmodium falciparum'.opõe-se à colonização da pele por alguns patógenos.previnem a entrada de patógenos e substâncias estranhas. jardins e terrenos baldios. b) As células T citotóxicas matam células que apresentam antígenos na superfície por meio da secreção de perforinas e linfotoxinas. c) As células T citotóxicas podem atacar algumas células tumorais. do Instituto Pasteur.lubrifica e limpa. uma célula T citotóxica pode separar e atacar outra célula-alvo. que produzem anticorpos e têm vida longa. Paulo".prendem microorganismos no trato digestivo e respiratório. em Paris. e células de memória. c) Lágrima . que realizam o ataque e morrem. Questão 1213 Aranhas e escorpiões podem apresentar efeito peçonhento ao homem. Segundo Druilhe e seus colegas. necrosante. EXCETO: VACINA RESISTE A PARASITO DA MALÁRIA Pesquisadores liderados por Pierre Druilhe.1. c) aparar a grama dos jardins e recolher folhas caídas. trata-se do "primeiro teste clínico de uma vacina contra a malária a demonstrar claramente sua atividade contra o parasito". d) Descamar da epiderme . moscas e outros insetos. bastando que esta esteja ativada. células de tecidos transplantados e células infectadas por vírus. a fórmula induziu a produção de anticorpos contra a doença. b) Se o organismo apresentar imunidade positiva contra o parasita. dizem ter realizado com sucesso a primeira fase de testes clínicos (em humanos) de uma vacina contra a malária.10 a) colocar lixo em sacos plásticos e mantê-los bem fechados para não atrair baratas. um linfócito ativado produz dois tipos de células-filhas: células efetoras. uma fase de invasão e diferenciação nos hepatócitos e uma fase intra-eritrocítica. não acumulando entulho e lixo doméstico. cardiotóxica. contém lisozima. Esses venenos podem apresentar ação neurotóxica. b) manter limpos quintais.

DM43 e DM64. a um mesmo tipo de antígeno (ex. é INCORRETO afirmar: a) A imunidade dos gambás sul-americanos ao veneno das jararacas foi naturalmente selecionada. São Paulo: Saraiva. a DM43 e a DM64 parecem especificamente talhadas para neutralizar os principais efeitos do veneno das serpentes da família das viperídeas. d) Um dos componentes do veneno da jararaca poderia ser útil na prevenção de tromboses. c) Na primeira exposição ao antígeno. S.: vírus) provoca. c) produção de uréia. b) eosinófilos e eritrócitos. Questão 1217 Compartilhamos o ambiente com uma série de microorganismos que podem causar infecções nos seres humanos. EXCETO: a) Ativação de resposta imune primária e produção de clones de células efetoras e de memória pelos linfócitos. c) macrófagos e linfócitos. As nossas células de defesa exercem o seu papel por meio da fagocitose e da produção de anticorpos. d) circulação linfática. d) Promoção imediata de resposta imune secundária.Paulo". descobriram que uma solução potencialmente melhor foi 'desenvolvida' ao longo de milhões de anos pelos gambás sul-americanos. Questão 1219 O gráfico a seguir exemplifica como a exposição de um homem normal. após um certo espaço de tempo. embora elas mesmas não sejam anticorpos. que se alimentam de serpentes. d) eritrócitos e macrófagos. Questão 1218 Uma pessoa que tivesse seriamente comprometida a atividade dos plasmócitos teria problemas com a a) produção de anticorpos. São glicoproteínas que apresentam estrutura parecida com a de substâncias do sistema de defesa do organismo. e) produção de toxinas. enquanto a outra neutraliza as substâncias que matam as células musculares de quem é picado. A primeira molécula se opõe à ação dos compostos do veneno que causam forte hemorragia na vítima ao impedir a formação de coágulos. Seja como for.5. 1.vacinada contra uma possível infecção. b) Essa resistência dos gambás ao veneno de serpentes viperídeas é determinada geneticamente. Bio. c) Os linfócitos de gambá reagem a picadas das jararacas produzindo soro antiofídico que pode ser letal para as cobras. respectivamente: a) linfócitos e basófilos. b) Maior e mais rápida produção de anticorpos específicos em casos de encontros subseqüentes com o mesmo antígeno. podem-se observar os seguintes eventos. São exemplos destas células." Fonte: Extraído da Reportagem: Sangue de gambá contém soro antiofídico do Jornal "Folha de S. que têm função antiofídica. Questão 1216 "Por décadas os cientistas tiveram de quebrar a cabeça para criar antídotos contra o veneno das cobras.1999. entre as quais se incluem as jararacas. Analisando o texto e de acordo com seus conhecimentos. e) leucócitos e linfócitos. 30/08/2005.10 onte: LOPES. há uma fase de espera antes de o número de moléculas de anticorpos e células T aumentar. com produção de células efetoras e de memória. uma resposta do organismo. que controlam lentamente o invasor. 273 . responsáveis por 90% dos 20 mil acidentes anuais com cobras no Brasil. Agora. b) circulação venosa. Pesquisadores da Fundação Oswaldo Cruz identificaram no sangue dos gambás duas moléculas. repetidas vezes.

para pessoas aidéticas sintomáticas. d) quimioterapia. multiplicam-se e diferenciam-se. b) imunoterapia passiva. dando início à imunidade humoral. d) linfócitos.Questão 1221 Um novo tipo de tratamento da AIDS começou a ser testado no Brasil e consiste em transmitir anticorpos anti-HIV. denomina-se a) imunoterapia ativa. Havendo incompatibilidade entre o doador e o receptor de um órgão ou tecido condicionado pelo MHC. O gráfico abaixo demonstra os níveis de imunoglobulina G (IgG) no soro do feto e do recém-nascido. b) os linfócitos T. que tem como conseqüência: a) o aumento da produção de anticorpos b) a inibição da produção de anticorpos c) o aumento da produção de antígenos d) a inibição da produção de antígenos Questão 1220 A produção de imunoglobulinas por células do sistema imunitário constitui um dos mecanismos de defesa do organismo contra infecções. EXCETO a) basófilos. diferenciam-se em plasmócitos. Questão 1223 As principais moléculas responsáveis pela resposta imune aos transplantes de órgãos e tecidos são os antígenos do Complexo Principal de Histocompatibilidade (MHC). as primeiras células a serem ativadas. d) as interleucinas inibem a proliferação de macrófagos e linfócitos T citotóxicos. e) mastócitos. 1. c) profilaxia. estimulados por substâncias produzidas pelos linfócitos T auxiliares. b) eritrócitos. na maioria das pessoas. c) eosinófilos. Uma série de tipos celulares é responsável pelas reações alérgicas e por outros tipos de hipersensibilidade imune. e o sistema imune do receptor responde. cuja intenção é fortalecer a defesa desses indivíduos. Tal tratamento. e) vacinoterapia. ligam-se aos anticorpos e iniciam suas ações fagocitária e secredora. participando assim da imunidade celular. após reconhecerem os antígenos apresentados pelos macrófagos. mas sem os sintomas da doença.5. principais responsáveis pela 274 1. de modo que a) os macrófagos. contidos no plasma de pessoas contaminadas há muitos anos.10 s resultados acima permitem chegar à seguinte conclusão em relação a esse soro: a) na época do nascimento há presença de IgG materna b) durante a gestação diminuem os níveis de IgG fetal c) durante a gestação os níveis de IgG independem da produção fetal d) após o nascimento diminuem os níveis de IgG produzida pelo recém-nascido . produzindo assim uma quantidade maior de anticorpos.5.10 odemos atribuir esta resposta do organismo ao fenômeno de memória imunológica. uma forte reação alérgica. c) os linfócitos B. será desencadeada uma reação. Questão 1222 A urtiga é um vegetal que provoca.

suprimindo os linfócitos B. ( ) podem ser prevenidas pela aplicação de vacinas na primeira fase da vida ou tratadas com medicamentos adequados. Pesquisas biológicas vêm sendo desenvolvidas com os tripulantes dos vôos espaciais. Questão 1224 Com o final da 2 Guerra Mundial. A Guerra Fria foi o resultado óbvio dessas tensões e disputas. A corrida espacial foi um dos aspectos dessa concorrência. ( ) comprometem os nódulos linfáticos das virilhas.html Se ao final da experiência mencionada for demonstrado que a resposta imunológica humoral diminui durante os vôos espaciais. b) anticorpos que persistirão ativos por toda a vida do receptor. consiste na análise de amostras de sangue e saliva antes e após a injeção de um determinado antígeno. c) drogas capazes de aumentar a resistência à infecção.nasa. até mesmo. campeões do capitalismo. tem o objetivo de estudar até que ponto o sistema imunológico se altera durante vôos espaciais. José Paulo Paes) ". a revolução tecnológica avançava como conseqüência. Vencido o perigo nazista. sarampos" são alterações no bem-estar físico do indivíduo que.gov/shuttle/archives/ sts-74/orbit/payloads/lifes/regimmun. fraldas sujas coqueluches. 275 . normalmente. Uma dessas. Entretanto. sarampos. genoma. passou a existir o desejo do bem-estar e do conforto mostrar onde se vivia melhor era fundamental. Estas doenças ( ) são transmitidas por vírus e enquadram-se no grupo das que causam desidratação. iniciou-se um novo período na história da humanidade. Hoje. enfrentaram-se as duas forças hegemônicas do pós-guerra: os Estados Unidos da América. A experiência. aparecem na infância. conclui-se que. novas tecnologias para comunicação evidenciam o progresso no século XXI. o conhecimento humano não tem fronteiras nem limites: DNA. Cai o império soviético. Ao lado da política e da economia. coqueluches. campeã do socialismo. ( ) são típicas das regiões úmidas e frias e têm como vetores insetos do gênero 'Anopheles' sp. Mais conforto. sem suprimir o sistema imunológico do receptor. sem deixar o paciente vulnerável a infecções. clonagem. Esse desejo fez com que rapidamente se transferissem para o cotidiano dos homens os resultados práticos das inovações de guerra. alterações nos comportamentos sinalizaram um novo tempo. nessas condições. no mundo globalizado. a ser realizada na Terra e no espaço. ocorre menor: a) fagocitose do antígeno mediada pelos linfócitos B b) produção de anticorpos pelos linfócitos T citotóxicos c) produção de imunoglobulinas pelos neutrófilos d) produção de anticorpos mediada pelos linfócitos B e) produção de imunoglobulinas pelos macrófagos Questão 1225 "Onde não há cozinhas pratos por lavar vigílias. ao provocar nos indivíduos do sexo masculino o aumento da produção de urina. A comparação dos resultados obtidos poderá indicar o quanto a resposta imunológica estará afetada. Questão 1226 As vacinas utilizadas nas campanhas de imunização em massa são constituídas de a) anticorpos que destruirão o agente infeccioso específico. realizada por pesquisadores da NASA. e a URSS." ("Outro retrato". Traduzido e adaptado de: http:// spaceflight.rejeição.. um novo século. da concorrência entre esses dois países. d) microorganismos ou produtos deles derivados que induzirão a formação de anticorpos. e) a ciclosporina age no processo de rejeição. e) soros obtidos de animais que neutralizarão os antígenos específicos. ao mesmo tempo em que socialismo e capitalismo disputavam o predomínio na produção e nos mercados.. novas comodidades.

proteínas que se ligam 1. contra as quais o homem dispõe de um vigilante exército para a sua defesa. que atua no combate a infecções. estes estimulam os linfócitos B a produzirem interferons. anticorpos em nível neutralizador suficiente para inativar o vírus. d) impedem mutações dos patógenos. c) o antígeno do patógeno é produzido pelo camundongo em I. por exemplo (Y).5. b) contêm anticorpos específicos. vem-se revelando uma das mais abrangentes dirigidas à população dessa faixa etária. podemos afirmar que: 276 . ( ) Em (1) ilustra-se a resposta primária do organismo após um primeiro contato com um vírus X. diz-se que ele adquiriu imunidade humoral. ( ) Devido à elevada especificidade da reação antígeno-anticorpo. Em relação a esse sistema. é INCORRETO afirmar que a) os anticorpos são produzidos tanto em I quanto em II. imediatamente. ( ) contra patógenos extracelulares. podemos afirmar que: ( ) nos nódulos linfáticos e no baço. Questão 1231 O sistema imunitário. ( ) Em (2) ilustra-se a resposta imunológica do organismo a uma infecção bacteriana. ( ) as chamadas "células de memória" surgem da diferenciação de linfócitos T e B. um organismo infectado por uma bactéria X produzirá mais antígenos em (2) do que em (1). Além da vacina contra a gripe. muito ativos no combate a patógenos externos. Questão 1229 Para o controle das infecções.10 ( ) Ao primeiro contato com um vírus X (1) . c) induzem resposta imunológica. Com relação ao sistema imunológico humano. também. os macrófagos. ( ) linfócitos T podem adquirir ação citotóxica e destruir células infectadas por vírus. é constituído por diferentes tipos de glóbulos brancos e pelos órgãos responsáveis pela produção e maturação desses glóbulos. instituída pelo Ministério da Saúde do Brasil. como a maioria das bactérias. o organismo reage e produz.10 especificamente a determinados antígenos. Questão 1230 Há um número muito grande de organismos causadores de infecções. d) o mRNA do antígeno do patógeno é traduzido em II. células produtoras de anticorpos.Questão 1227 Analise estas figuras: 1.5. b) o código genético do patógeno é igual ao do camundongo. o organismo ativa seus linfócitos T citotóxicos. é correto afirmar que: onsiderando-se os processos de imunização representados. o organismo humano dispõe de diferentes mecanismos de defesa. perduram no organismo e podem desencadear a resposta imune com mais rapidez. ou ainda células como as cancerosas. são produzidas células apresentadoras de antígenos. enquanto em (1) mostra-se o efeito da pós infecção viral. ( ) os linfócitos B transformam-se em plasmócitos. Questão 1228 A Campanha Nacional de Vacinação do Idoso. se o organismo continuar a produzir anticorpos em quantidades elevadas. É CORRETO afirmar que essas vacinas protegem porque a) são constituídas de moléculas recombinantes. ( ) Após um primeiro contato com um vírus X (2). os postos de saúde estão aplicando. Com relação a este tema. a vacina contra pneumonia pneumocócica.

está exposto a uma maior variedade de organismos patogênicos b) hemácias . Questão 1236 Assinale a alternativa que preenche corretamente as lacunas do texto a seguir. extraídas do plasma de europeus ficam na faixa de 3 gramas por litro. na vida intra-uterina. (02) São capazes de neutralizar os vírus. Indique o que deve ser aplicado em cada criança. ( ) Os linfócitos B. . quando estimulados.. (16) São dotados de memória imunológica. Sabe-se que a produção de certos hemoderivados se vale de material retirado do plasma... porque é composto por antígenos específicos. para se prevenir contra poliomielite. por exemplo) ou seus produtos....( ) Os macrófagos fagocitam elementos estranhos e imobilizam resíduos na membrana. produzem interleucinas. na ordem em que ocorrem. causando vermelhidão e edema nos processos inflamatórios. O que o relatório mostra é que. as dos brasileiros situam-se na faixa de 5. para eliminar quimicamente o veneno.. é correto afirmar: (01) São capazes de neutralizar toxinas bacterianas. e permanecem na corrente sangüínea prontos para nos proteger da ação de patógenos. (32) São capazes de imobilizar os microorganismos. ( ) Linfócitos T reconhecem antígenos nas membranas de outras células.. Uma possível explicação é que o brasileiro .. b) soro. Soma ( ) Questão 1234 Duas crianças foram levadas a um posto de saúde: uma delas. se diferenciam em plasmócitos que produzem anticorpos e participam da memória imunológica. Em relação às características dos anticorpos.2 gramas por litro. Questão 1232 Assinale a alternativa que melhor descreve um anticorpo. Adaptado de: "Veja". fixando-se temporariamente no ducto toráxico.... O relatório da Polícia Federal sobre a Operação Vampiro traz uma informação no mínimo irônica sobre o sangue dos brasileiros. RESPECTIVAMENTE. porque contém anticorpos prontos. estimulam os linfócitos B a produzirem anticorpos e eliminam células anormais. 28 jul. componentes do nosso sistema de defesa.se alimenta de nutrientes ricos em ferro c) albuminas . Os anticorpos também são capazes de proteger o embrião humano.. e) vacina. porque fornecerá ao organismo elementos de defesa.. a) imunoglobulinas . para atendimento. em virtude de uma picada de serpente peçonhenta. 2004. ( ) Os macrófagos são responsáveis pela secreção de histamina... a qual provoca vasodilatação. especialmente nos macrófagos. estimulando os linfócitosT.. d) vacina.se alimenta de nutrientes ricos em ferro 277 . (04) São produzidos somente pela vacinação. enquanto as . que induzirá a formação de anticorpos. c) soro. muitas vezes por períodos bastante longos. a) vacina (porque contém antígenos) e soro (porque contém anticorpos) b) soro (porque contém antígenos) e vacina (porque contém anticorpos) c) vacina (porque contém anticorpos) e soro (porque contém antígenos) d) soro (porque contém anticorpos) e vacina (porque contém antígenos) Questão 1235 Quando uma pessoa é picada por um animal peçonhento. a) Uma partícula b) Um organismo c) Uma molécula d) Uma célula e) Um patógeno Questão 1233 Os anticorpos. onde podem se multiplicar ao detectarem elemento estranhos ao organismo. ( ) Os linfócitos T e B originam-se no timo e depois migram para a medula óssea. (08) Podem atravessar a barreira placentária.... deve procurar socorro através de a) soro. a outra. são proteínas sintetizadas para combater agentes externos (bactérias e vírus...

tende a apresentar o baço com tamanho aumentado e) imunoglobulinas .O tecido lesado libera sinais químicos (histamina e prostaglandinas) que promovem a dilatação dos vasos na área lesada. e) o soro obtido através do sangue de animais. d) Apenas I é correta. reconhecidos pelo corpo como antígenos. Marque a alternativa correta. II e III são corretas. de 3 gramas por litro. submetendo-se as pessoas à a) aplicação do soro.tende a apresentar o baço com tamanho aumentado. pois as pessoas desenvolvem anticorpos contra os antígenos atenuados.A inflamação é uma resposta imune do corpo. III . . em média. como os cavalos. Questão 1239 Os meios de comunicação têm convocado dentistas e outros profissionais da saúde para a vacinação contra a hepatite B. b) I. e) vacinação.10 Analise as afirmativas a seguir: I . d) vacinação. e) possui antígenos específicos. a) Apenas I e II são corretas. b) contém anticorpos. c) é um antibiótico. para que o corpo produza então os antígenos específicos.07. quando o agente infeccioso provoca uma doença de evolução muito rápida e não há tempo para a imunização ativa. II . Vacinar consiste em injetar no organismo: a) microrganismos vivos para provocar a doença de forma branda.2 gramas por litro. que tem efeito terapêutico. na tentativa de destruir agentes invasores. b) aplicação do soro. resultado da ativação dos mecanismos naturais de defesa do organismo. Questão 1240 Os agentes infecciosos penetram no corpo das pessoas através dos ferimentos e das mucosas. já prontos.2004) noticiou que a quantidade de imunoglobulina extraída do sangue dos europeus é. Questão 1238 O soro antiofídico é ministrado em pessoas picadas por cobra peçonhenta porque: a) induz a formação de anticorpos. fagocitando os microorganismos patogênicos. enquanto a extraída do sangue dos brasileiros é de 5. que é a imunidade adquirida de ação menos duradoura que o soro e de emprego terapêutico. b) uma substância que combata a doença já instalada e que produza no corpo uma reação para a fabricação de anticorpos resistentes. O corpo imunizado produzirá antígenos específicos.5. d) o plasma. b e c) representam o que pode acontecer quando uma lesão na pele permite a entrada de bactérias que causam infecção. Questão 1241 A revista "Veja" (28. ocasião em que o indivíduo recebe anticorpos. criados em laboratório. c) microrganismos mortos ou atenuados que. A incidência de doenças causadas por estes agentes infecciosos poderá ser reduzida. onde recebem grande quantidade de antígenos. d) provoca imunização. c) aplicação do soro. produzidos pelo organismo de um animal.Alguns tipos de leucócitos (glóbulos brancos) atravessam as paredes dos capilares por diapedese e deslocam-se pelo tecido. induzam a produção de anticorpos específicos. que é um processo ativo de imunização preventiva e duradoura. Questão 1237 As ilustrações a seguir (a. retirado de convalescentes.d) albuminas . c) Apenas II e III são corretas. 278 1.

Assinale a hipótese que pode explicar corretamente a causa de tal diferença. a) Os europeus tomam maior quantidade de vacinas ao longo de sua vida. b) Os brasileiros estão expostos a uma maior variedade de doenças. c) Os antígenos presentes no sangue do europeu são mais resistentes. d) Os anticorpos presentes no sangue do brasileiro são menos eficientes. e) Os europeus são mais resistentes às doenças que os brasileiros. Questão 1242 A partir do recente surto de sarampo na cidade do Rio de Janeiro, o governo decidiu iniciar uma campanha de imunização das crianças. A imunização contra diversos tipos de doenças é atingida através de vacinação, que consiste em injetar no organismo: a) o soro obtido através do sangue de animais criados em laboratório, como macacos, onde recebem grande quantidade de antígenos e anticorpos específicos. b) o plasma retirado de pessoas que já tiveram a doença, para que o organismo produza antígenos e anticorpos específicos. c) um agente químico eficaz no combate a doença já instalada e que produza no corpo uma reação para a fabricação de anticorpos específicos. d) vírus ou bactérias mortos ou atenuados que, reconhecidos pelo organismo como antígenos, induzem a produção de anticorpos específicos. e) vírus ou bactérias vivos, em quantidade pequena, para provocar a doença de forma branda, pois o corpo imunizado produzirá anticorpos específicos. Questão 1243 Nosso corpo está sempre sendo ameaçado de invasão por substâncias estranhas e por uma variedade enorme de microorganismos. Toda vez que isso acontece, além dos nossos mecanismos gerais de defesa, acionamos nosso sistema imune constituído por diferentes tipos de glóbulos brancos e por órgãos imunitários que, primariamente, são: a) fígado e baço. b) fígado e gânglios linfáticos.

c) tonsilas e pâncreas. d) pâncreas e medula óssea. e) medula óssea e timo. Questão 1244 A pigmentação da pele humana é condicionada por pares de genes com ausência da dominância. Suponhamos que apenas dois pares de genes estivessem envolvidos na cor de pele: o negro seria SSTT e o branco, sstt. Um homem mulato, heterozigoto nos dois pares, tem 6 filhos com uma mulher mulata de genótipo igual ao seu. Sobre os filhos do casal, pode-se afirmar que: a) todos são mulatos como os pais. b) cada um deles tem uma tonalidade de pele diferente da outro. c) um ou mais deles podem ser brancos. d) a probabilidade de serem negros é maior do que a de serem brancos. e) 50% apresentam pele branca e 50%, pele negra. Questão 1245 O gráfico a seguir representa um tipo de herança onde os caracteres variam de forma gradativa. As opções a seguir são exemplos deste tipo de herança no homem, EXCETO uma. Assinale-a.

1.5.11

a) Estatura. b) Inteligência. c) Obesidade. d) Fator RH. e) Cor da pele.

279

Questão 1246

1.5.11

dois indivíduos que produzem frutos com 15cm, espera-se uma proporção de plantas com frutos de 17,5cm igual a a) 9/16 b) 1/2 c) 3/16 d) 1/4 e) 1/8 Questão 1249 Em um caso de herança quantitativa, estão envolvidos três pares de genes, "a", "b" e "c". Cruzando-se dois indivíduos triplo heterozigotos, a proporção de homozigotos esperada é de: a) 1/2 b) 1/8 c) 1/16 d) 1/32 e) 1/64 Questão 1250 Imagine que, em um determinado animal, a retenção de água no corpo seja controlada pela interação quantitativa de dois pares de genes, existindo cinco fenótipos (da retenção baixa até a retenção máxima de água). Animais com genótipo aabb retêm baixa quantidade de água, enquanto animais com genótipo AABB apresentam retenção máxima de água. Os animais que apresentam dois genes "maiúsculos" e dois genes "minúsculos" no genótipo retêm uma quantidade intermediária de água. Na genealogia abaixo, são dados os genótipos dos animais indicados pelos números 1, 2, 3 e 6. Considerando que os genes em questão se segregam independentemente, qual a probabilidade de os indivíduos 7 e 8 apresentarem simultaneamente retenção intermediária de água? a) 1/2 b) 1/3 c) 1/4 d) 1/8 e) 1/16

A cor dos grãos de trigo é condicionada por dois pares de genes de efeito aditivo. A tabela acima mostra o número de genes dominantes e as cores determinadas por eles. Do cruzamento entre um indivíduo AaBb e um Aabb, a proporção esperada de indivíduos com grãos vermelhos é de: a) 3/8 b) 1/8 c) 3/16 d) 6/8 e) 5/8 Questão 1247 Admita que a diferença de comprimento das orelhas nos coelhos seja um caso de herança quantitativa envolvendo dois pares de genes com segregação independente. Animais sem nenhum gene dominante possuem orelhas com 4,0cm. Cada gene dominante aumenta em 1,0cm o comprimento das orelhas. O cruzamento que produzirá na descendência uma maior porcentagem de coelhos com orelhas de no mínimo 7,0cm é o a) AaBb x AaBb b) AaBb x aaBB c) AAbb x aaBB d) Aabb x AABB e) AABB x aabb Questão 1248 Para uma determinada planta, suponha que a diferença entre um fruto de 10cm de comprimento e um de 20cm de comprimento seja devida a dois genes, cada um com dois alelos, que têm efeito aditivo e que se segregam independentemente. Na descendência do cruzamento entre

280

1.5.11

de altura e cada alelo p e r determina 10cm. Assim, os indivíduos PPRR têm 80cm e os indivíduos pprr, 40cm. O gráfico a seguir representa a distribuição das classes fenotípicas observada nos descendentes dos cruzamento entre heterozigotos PpRr.

1.5.11

Questão 1251 Supondo que na aboboreira existam 3 pares de genes que influem no peso do fruto, uma planta aabbcc origina frutos com aproximadamente 1.500 gramas e uma planta AABBCC, frutos ao redor de 3.000 gramas. Se essas duas plantas forem cruzadas, o peso aproximado dos frutos produzidos pelas plantas F será de a) 3 000 gramas. b) 2 500 gramas. c) 2 250 gramas. d) 2 000 gramas. e) 1 500 gramas. Questão 1252 A tabela a seguir classifica características hereditárias da espécie humana. Assinale a alternativa que corresponde à classificação correta.

esse gráfico, os indivíduos PPRr e Pprr estão incluídos, respectivamente, em a) IV e V b) IV e II c) III e II d) III e I e) I e V Questão 1254 Um estudante de 23 anos, doador de sangue tipo universal, é moreno, tem estatura mediana e pesa 85 kg. Todas as alternativas apresentam características hereditárias desse estudante que são influenciadas pelo ambiente, EXCETO a) Altura b) Grupo sangüíneo c) Cor da pele d) Peso Questão 1255 Em um dos modelos propostos para a determinação da cor dos olhos na espécie humana (herança quantitativa), são considerados cinco diferentes fenótipos. Na descendência de pais heterozigóticos para os locos determinantes desta característica, foram observados os dados apresentados no quadro abaixo. Analise-os, juntamente com o gráfico, e identifique a correção das proposições a seguir.

1.5.11

Questão 1253 Em certa espécie vegetal, a altura dos indivíduos determinada é por dois pares de alelos de efeito aditivo e segregação independente: cada alelo P e R determina 20cm

281

1.5.11

( ) Três pares de alelos justificam os resultados apresentados. ( ) Nos indivíduos de olhos castanho-claros, os locos em questão podem estar em homozigose ou em heterozigose. ( ) Indivíduos de olhos verdes apresentam homozigose em apenas um dos locos em questão. ( ) A probabilidade do nascimento de duas crianças de olhos azuis, a partir de um casal genotipicamente igual ao do exemplo dado, é de aproximadamente 0,004. ( ) A probabilidade do casal indicado no item anterior de ter duas crianças, sendo uma de olhos castanho-claros e uma de olhos verdes é de 3/16. Questão 1256 A cor da pele humana é conseqüência do efeito cumulativo de mais de um gene, de modo que cada gene contribui igualmente para o fenótipo. O gráfico que representa a proporção fenotípica nesse tipo de herança é

são fenotipicamente homogêneas: apresentam as mesmas características quanto à altura da planta e tamanho da espiga, ao tamanho e número de grãos por espiga, e a outras características de interesse do agricultor. Porém, quando o agricultor realiza um novo plantio com sementes produzidas pelas plantas C, não obtém os resultados desejados: as novas plantas são fenotipicamente heterogêneas e não apresentam as características da planta C; têm tamanhos variados e as espigas diferem quanto a tamanho, número e qualidade dos grãos. Para as características consideradas, os genótipos das plantas A, B e C são, respectivamente, a) heterozigoto, heterozigoto e homozigoto. b) heterozigoto, homozigoto e heterozigoto. c) homozigoto, heterozigoto e heterozigoto. d) homozigoto, homozigoto e heterozigoto. e) homozigoto, homozigoto e homozigoto. Questão 1258 A altura de uma planta depende de dois pares de genes, A e B. O gráfico adiante mostra a variação da altura dos descendentes de dois indivíduos diíbridos.

1.5.11

1.5.11 Com relação ao gráfico, julgue os itens que se seguem. (1) Os efeitos quantitativos dos alelos A e B são, respectivamente, 40 e 30cm. (2) A freqüência de descendentes heterozigotos, para os dois genes, é de 50%. (3) Estão ilustrados cinco genótipos. (4) A herança apresentada é poligênica.

Questão 1257 Uma empresa agropecuária desenvolveu duas variedades de milho, A e B, que, quando entrecruzadas, produzem sementes que são vendidas aos agricultores. Essas sementes, quando plantadas, resultam nas plantas C, que

282

Questão 1259 A altura de uma certa espécie de planta é determinada por dois pares de genes A e B e seus respectivos alelos a e b. Os alelos A e B apresentam efeito aditivo e, quando presentes, cada alelo acrescenta à planta 0,15m. Verificou-se que plantas desta espécie variam de 1,00m a 1,60m de altura. Cruzando-se plantas AaBB com aabb pode-se prever que, entre os descendentes, a) 100% terão 1,30m de altura. b) 75% terão 1,30m e 25% terão 1,45m de altura. c) 25% terão 1,00m e 75% terão 1,60m de altura. d) 50% terão 1,15m e 50% terão 1,30m de altura. e) 25% terão 1,15m, 25% 1,30m, 25% 1,45m e 25% 1,60m de altura. Questão 1260 Políticas de inclusão que consideram cotas para negros ou afrodescendentes nas universidades públicas foram colocadas em prática pela primeira vez na Universidade Estadual do Rio de Janeiro (UERJ), em 2001. Propostas como essas geram polêmicas e dividem opiniões. Há vários argumentos contra e a favor. Os biólogos têm participado desse debate, contribuindo com os conhecimentos biológicos referentes à raça e à herança da cor da pele humana, entre outros. Assinale a afirmação considerada correta do ponto de vista da biologia. a) Os critérios para se definirem duas populações como raças diferentes são científica e consensualmente determinados. b) Não encontramos, na história da biologia, dúvidas sobre a existência de raças na espécie humana. c) A cor da pele humana é um exemplo de herança quantitativa ou poligênica, o que significa que vários genes atuam na sua definição. d) O fato de a cor da pele não ser influenciada por fatores ambientais reforça a hipótese da existência de raças na espécie humana. e) A determinação da cor da pele humana segue os padrões do tipo de herança qualitativa e é um exemplo de co-dominância.

Questão 1261 As diferenças hereditárias entre os indivíduos de uma população podem ser classificadas em qualitativas e quantitativas. A esse respeito, assinale a opção correta. a) Na herança de caracteres quantitativos, existe um grande contraste entre as características que um dado traço fenotípico pode apresentar. b) Na herança de caracteres qualitativos, um dado traço de fenótipo apresenta-se sob grande variedade de formas, em geral com pequenas diferenças entre si. c) Altura, peso e cor da pele são exemplos de algumas características quantitativas do homem. d) Os caracteres qualitativos, em sua maioria, sofrem grande influência do meio. e) A altura não é uma característica hereditária, já que um indivíduo cresce menos se não receber a alimentação adequada na infância. Questão 1262 Determinada característica quantitativa depende da ação de cinco pares de genes. Do cruzamento entre dois indivíduos com genótipo AaBbCcDdEe resultam a) 5 classes fenotípicas. b) 9 classes fenotípicas. c) 10 classes fenotípicas. d) 11 classes fenotípicas. e) 15 classes fenotípicas. Questão 1263 A cor dos pêlos nas cobaias é condicionada por uma série de alelos múltiplos com a seguinte escala de dominância: C (preta) > C (marrom) > C‚ (creme) > c (albino). Uma fêmea marrom teve 3 ninhadas, cada uma com um macho diferente. A tabela a seguir mostra a constituição de cada ninhada.

283

1.5.12

1.5.12

A partir desses dados é possível afirmar que o macho responsável pela ninhada: a) 1 era marrom homozigoto. b) 1 era preto homozigoto. c) 2 era albino heterozigoto. d) 2 era creme heterozigoto. e) 3 era marrom homozigoto. Questão 1264 O controle genético de determinado caráter é feito por uma série de quatro alelos de um só locus. O alelo A é dominante sobre os alelos A‚, Aƒ e A„; o alelo A‚ é dominante sobre os alelos Aƒ e A„ e o alelo Aƒ é dominante sobre A„. Do cruzamento AA‚ x AƒA„ devem ser obtidas: a) quatro classes genotípicas e quatro classes fenotípicas. b) quatro classes genotípicas e duas classes fenotípicas. c) quatro classes genotípicas e três classes fenotípicas. d) três classes genotípicas e três classes fenotípicas. e) três classes genotípicas e duas classes fenotípicas. Questão 1265 Em uma população de organismos diplóides, foram encontrados quatro alelos diferentes para um determinado locus gênico, denominados S¢, S£, S¤ e S¥. A figura a seguir mostra, à esquerda, as diferenças na seqüência de DNA que caracterizam cada um desses alelos e, à direita, o par de cromossomos homólogos (metafásicos) onde esse gene é encontrado. Diante dessas informações, se um único indivíduo desta população for escolhido ao acaso, qual combinação alelo/posição cromossômica poderia ser encontrada no par de cromossomos metafásicos deste indivíduo?

Questão 1266 Se um caráter tem três alelos possíveis, podendo haver seis genótipos, e um segundo caráter apresenta oito genótipos possíveis, quando ambos forem estudados simultaneamente, podem ocorrer a) 7 genótipos. b) 12 genótipos. c) 24 genótipos. d) 48 genótipos. e) 96 genótipos. Questão 1267 Coelhos podem ter quatro tipos de pelagem: chinchila, himalaia, aguti e albina, resultantes das combinações de quatro diferentes alelos de um mesmo loco. Num experimento, animais com diferentes fenótipos foram cruzados várias vezes. Os resultados, expressos em número de descendentes, constam na tabela a seguir.

1.5.12

284

aqui denominados "alfa". em cujos núcleos estão os cromossomos. c) 9 aguti: 3 himalaia: 3 chinchila: 1 albino. A porcentagem esperada de gametas Ab que o indivíduo formará é a) 10% b) 20% c) 30% d) 40% e) 80% Questão 1272 O cruzamento CD/cd x cd/cd produziu 300 descendentes. sabendo-se que a freqüência de permutação é de 10% a) 30 b) 15 c) 270 285 . cada um correspondente a um genótipo. Tal gene deve determinar: (01) três fenótipos. (02) três fenótipos.5. c) a ocorrência do "crossing" não altera a seqüência dos genes nos cromossomos. Quantos deverão ser diferentes dos pais. cada um correspondente a dois genótipos. (08) seis fenótipos. como mostra o desenho a seguir: Se em todas as células ocorrer "crossing-over" entre os genes A e B. e) 10. e) não é possível calcular essas proporções. porque os gametas recebem cromossomos ao acaso. porque só as cromátides irmãs são envolvidas. Em um determinado indivíduo da espécie referida. d) as proporções entre os tipos de gametas seriam iguais às que ocorrem quando os genes estão em cromossomos diferentes. b) a proporção de gametas com as formas não "crossing" seria maior do que a de gametas com as formas "crossing". (04) quatro fenótipos. Questão 1268 Suponha que em uma certa espécie diplóide exista um caráter relacionado com uma série de quatro alelos (alelos múltiplos). os locos dos genes A e B situam-se no mesmo cromossomo. o número máximo de alelos representados relacionados ao caráter em questão será igual a a) 2. correspondentes a cinco genótipos. correspondentes a quatro genótipos. que proporção de descendentes poderemos prever? 1.13 a) 1 aguti: 1 chinchila. d) 2 aguti: 1 chinchila: 1 himalaia. correspondentes a seis genótipos. c) 6.e o animal progenitor aguti do cruzamento 1 for utilizado para a obtenção de filhotes com o progenitor chinchila do cruzamento 4. Questão 1271 Em determinada espécie. (16) quatro fenótipos. Considere que os alelos "alf" e "beta" são co-dominantes e gama é recessivo em relação a ambos. b) 1 aguti: 1 himalaia. b) 4. Na meiose de um indivíduo duplo-heterozigoto AB/ab ocorre permutação entre esses locos em 80% das células. e) 3 aguti: 1 chinchila. d) 8. Questão 1270 No órgão reprodutor de um animal há 1000 (mil) células. podemos afirmar que: a) todos os gametas formados conterão as combinações resultantes do "crossing". "beta" e "gama". Questão 1269 Considere um gene que apresenta 3 alelos. e se cada uma originar 4 (quatro) gametas.

48. ocorre "crossing-over" entre esses genes em 40% das células. e) da ausência de nucleotídeos covalentes.d) 290 e) 45 Questão 1273 O cruzamento AB/ab x ab/ab produziu 450 descendentes.5 morganídeos.R. Considere o seguinte cruzamento: Fêmea (Ab/aB) X Macho (ab/ab) Qual é a freqüência esperada de machos com o genótipo AB/ab? a) 100% b) 50% c) 25% d) 10% e) 5% Questão 1276 Na espécie humana os genes que determinam a distrofia muscular Duchnne e a hemofilia. Considere o seguinte cruzamento: 1.5% Br . é de se esperar lhe a freqüência de permutação entre dois genes esteja na dependência. 30%. distam entre si 20 UR. (unidades de recombinação). A freqüência de gametas AB. Questão 1278 Na meiose de um indivíduo AB/ab. aB e ab produzidos por esse indivíduo deve ser. 10% e 10% 286 . heranças recessivas ligadas ao sexo. e) 50 morganídeos. 10% e 40% e) 40%.48. sabendo-se que a freqüência de permutação é de 20% a) 30 b) 90 c) 430 d) 360 e) 45 Questão 1274 Analisando-se dois pares de genes em ligamento fatorial ("linkage") representados pelo híbrido BR/br. Ab. 20% e 30% c) 30%. distam entre só 20 U. a) 10%. dois genes A e B. Questão 1275 Em um caso de "linkage". 40% e 10% b) 30%.5. uma certa espécie apresentou a seguinte proporção de gametas: BR . 40%.13 esse cruzamento. a freqüência esperada de machos afetados pelos dois caracteres é de: a) 0 % b) 5 % c) 10 % d) 20 % e) 40 % Questão 1277 Pelo que se conhece da disposição dos genes dos cromossomos. c) 1.5% br . Quantos deverão ser diferentes dos pais. d) do tipo de polimeria existente.1. 10%. b) 97 morganídeos. 40%. autossômicos. 20% e 20% d) 40%. b) do comprimento da zona centromérica. pode-se concluir que a distância entre os genes B e R é de: a) 48. d) 3 morganídeos.5% bR . c) da existência do fenômeno da pleiotropia.5% Pela análise dos resultados.1. 20%. respectivamente. a) da distância entre eles.5 morganídeo.

37. grãos brancos e rugosos. o grão colorido é condicionado por um gene dominante B e o grão liso por um gene dominante R. albina. d) Br/bR. com os seguintes descendentes: 150 indivíduos que produziam sementes coloridas e lisas.R. podemos concluir que o genótipo do indivíduo parental colorido liso e a distância entre os genes B e R são a) BR/br.R. eA = 40. ao serem cruzados com animais duplo-recessivos. 250 indivíduos que produziam sementes coloridas e rugosas e 250 indivíduos que produziam sementes brancas e lisas. e) troca cromossomos entre genes homólogos.5 U. e) BR/br. b) separa cromátides homólogas.5 U. Questão 1282 Com relação ao processo conhecido como crossing-over. ea = 10. d) EA = 30.5 U. eA = 30.R. eA = 25. Ea = 40. originaram os seguintes descendentes: 160 com pêlos normais e albinos 160 com pêlos encrespados e selvagens 40 com pêlos normais e selvagens 40 com pêlos encrespados e albinos Assinale a alternativa que contém as porcentagens corretas de cada tipo de gameta produzido pelos indivíduos F. a) EA = 10. Ea = 20. ea = 30. 1. A partir desses resultados.5. Questão 1283 O esquema a seguir refere-se a uma célula diplóide que. sofrerá permutação entre os genes A e B. Ea = 25.R. 62. Os indivíduos F. ea = 25. d) aumenta a variabilidade genética. c) corrige a recombinação gênica. 37. pêlos encrespados. No cruzamento entre um indivíduo colorido liso com um branco rugoso. ea = 40. obtidos a partir de cruzamentos EEAA×eeaa. O alelo dominante A determina pelagem selvagem e o alelo recessivo a. c) Br/bR. 62. podemos afirmar que o mesmo a) diminui a variabilidade genética.75 U. Ea = 10. b) EA = 20. 18. Questão 1281 Numa certa espécie de milho. o alelo dominante E condiciona pêlos normais e o alelo recessivo e. a partir de um determinado cruzamento espera-se obter os seguintes descendentes: + + 10 + d 40 c + 40 c d 10 Esse cruzamento poderia ser a) ++/++ x cd/cd b) ++/cd x cd/cd c) +d/+d x c+/c+ d) +d/c+ x cd/cd e) +d/cd x c+/cd Questão 1280 Em camundongos. Os alelos recessivos b e r condicionam. eA = 10. ea = 20. surgiu uma F. durante a meiose.5 U. eA = 20. Ea = 30.13 287 . respectivamente. e) EA = 40. b) BR/br.Questão 1279 Se a distância entre dois locos gênicos é de 20 unidades. c) EA = 25.R. 150 indivíduos que produziam sementes brancas e rugosas.

(04) É o processo que origina novos arranjos gênicos resultantes de trocas de fragmentos de cromátides homólogas.Assinale a alternativa que apresenta todos os tipos de gametas normais que podem ser formados por essa célula. a) AbCe. 160 Ddee. então a distância entre os genes A e B será a) 10 morganídeos. Y e Z de um cromossomo. e) 20 ou 10 morganídeos. d) 20 morganídeos. entre Y e Z há 30% e entre os genes Z e X ocorre 45%. AaBCe. originou 42 descendentes com genótipo DdEe. sabe-se que há 15% de recombinação entre os genes X e Y. c) 10 ou 30 morganídeos. ou crossing over. aBCe Questão 1284 Com relação ao processo denominado permutação. e.5.13 uantos gametas recombinantes serão formados se 20 das 100 células apresentarem permutação na meiose? a) 10 b) 20 c) 40 d) 80 e) 160 Questão 1287 Considerando os genes X. (16) É o processo de duplicação dos cromossomos para garantir a manutenção da espécie. Qual a posição relativa desses três genes no cromossomo? a) ZXY b) XYZ c) YZX d) XZY e) YXZ Questão 1288 Sabendo-se que as freqüências de permutação entre os genes A e C é de 20% e entre os genes B e C é de 10%. b) estão ligados e não há permuta entre eles. Sobre os genes D e E podemos concluir que: a) estão ligados e há permuta entre eles. Questão 1289 Sabendo-se que as freqüências de permutação entre os genes A e C é de 40% e entre os genes B e C é de 15%. aBCe e) AabCe. (32) É um processo que ocorre necessariamente durante a mitose. logo segregam-se independentemente. d) segregam-se independentemente e não há permuta entre eles. AbCe. então a distância entre os genes A e B será a) 45 morganídeos. Questão 1286 Suponha que 100 células germinativas entram em meiose e que essas células tenham o seguinte genótipo: 1. ABCe b) AbC. 288 . (08) É o pareamento de cromossomos homólogos de modo a se tornarem bivalentes. aBC. b) 30 morganídeos. c) segregam-se independentemente e há permuta entre eles. e) não estão ligados. e c) AbCe. aBCe. é correto afirmar: (01) É a troca de gametas que ocorre durante o cruzamento de dois indivíduos da mesma espécie. ABCe d) AbCe. Questão 1285 Um cruzamento entre dois indivíduos. abCe. 168 ddEe e 40 ddee. (02) É a troca de micronúcleos entre indivíduos unicelulares para renovar o seu material genético. (64) É o processo responsável pela variabilidade genética entre organismos de uma mesma espécie. com os genótipos DdEe x ddee.

( ) No mapa genético. B. ( ) A seqüência dos alelos no cromossomo em questão é A -------B-------C. Resistem a certas doenças e pragas (insetos. Tomando por base os dados fornecidos no quadro a seguir. e) 40 ou 15 morganídeos. C e D. II. A. Os produtos transgênicos apresentam algumas vantagens. considere as corretas: I. a taxa de recombinação entre eles é de a) 8% b) 16% c) 32% d) 42% e) 84% Questão 1291 Quatro genes. 1. estão merecendo uma atenção especial no mundo todo. ocorreu nos genótipos 5. analise as proposições seguintes. desenvolvidas em países asiáticos. 6. organismos geneticamente modificados (OGM). utiliza-se o teste dos três pontos. 289 . III. c) 40 morganídeos. o que indica um avanço biotecnológico nesta área. apresentam as seguintes freqüências de recombinação: A-B = 32% A-C = 45% A-D = 12% B-C = 13% B-D = 20% C-D = 33% A seqüência mais provável desses genes no cromossomo é a) ABCD b) ABDC c) ACDB d) ADBC e) ADCB Questão 1292 Na elaboração de mapas genéticos. Das afirmativas. ácaros. são avaliadas as freqüências das classes fenotípicas na descendência de cruzamento entre indivíduos heterozigóticos (ABC//abc). Para isso. para os mesmos locos (cruzamento teste). Questão 1293 Os transgênicos.5. d) 25 ou 15 morganídeos. 7 e 8. O arroz transgênico apresenta variedades que contêm altos teores de beta-caroteno (precursor da Vitamina A) e que acumulam maior teor de ferro. Aumentam a produtividade (caso da soja.14 Questão 1290 Supondo-se que a distância entre locos gênicos seja de 16 morganídios. para três locos ligados. ( ) Os fenótipos 7 e 8 resultaram de recombinação genética apenas entre os locos C e B. ( ) A recombinação entre os locos B e C. e indivíduos homozigóticos recessivos (abc//abc). a distância entre os locos A e B é maior que a distância entre os locos B e C. Está correta ou estão corretas: a) apenas I e II b) apenas II e III c) apenas I e III d) todas e) apenas uma das três vantagens. nematóides etc) diminuindo a necessidade do uso de pesticidas. embora em diferentes freqüências. ( ) Os fenótipos 3 e 4 resultaram de recombinação genética entre os locos A e B.b) 25 morganídeos. por exemplo). localizados no mesmo cromossomo.

resumidamente. deve-se seguir um conjunto de etapas que começa pela construção de uma seqüência iniciadora ('primer'). formando um aglomerado de a) injetar. que são guardados. Para criar a mangueira transgênica. pois o pai é a ovelha da raça "Finn Dorset". A seqüência correta das etapas seguintes à construção do 'primer' é. clonagem para "fazer" a ovelha "Dolly" da raça "Finn b) o DNA nuclear e o mitocondrial são iguais aos da ovelha Dorset". Recentemente os jornais publicaram uma receita de a) o DNA nuclear e o mitocondrial são iguais aos da ovelha A. podemos afirmar que: a) A clonagem está correta mas não revela a tecnologia necessária para as células "hibernarem" e acertarem o tempo. indivíduo. e) Há uma falha técnica no experimento. mas o DNA guardaram o resto. pois a genitora é a ovelha da raça "Scottish Blackface". células. também necessário. "Scottish Blackface". d) A clonagem está correta. um espermatozóide de um macho da mesma espécie. o pesquisador descobriu que o ambiente favorecia o desenvolvimento de um nematóide parasita de mangueira. B. núcleos. pode-se afirmar que genitor ou por manipulação citogenética. continuaram com baixa produção após a poda. Deles removeram os núcleos e d) o DNA nuclear é igual ao da ovelha A. Delas são retirados os mitocondrial é igual ao da ovelha C. c) amplificação do gene ë transfecção do gene ë Questão 1296 inserção do gene num vetor. que consistem em: ele começou a se dividir.Questão 1294 As mangueiras. A receita propõe os seguintes passos: c) o DNA nuclear e o mitocondrial são iguais aos da ovelha Os cientistas retiraram óvulos de uma ovelha adulta da raça C. certamente. O pesquisador sugeriu desenvolver uma linhagem transgênica dessa mangueira. de clonagem. inserção do gene num vetor. mitocondrial é igual ao da ovelha B. Investigando o problema. dentro do óvulo de uma fêmea de uma espécie. uma vez que no seu genótipo há cromossomos de seu avô. c) A clonagem está errada. pela inserção de um gene que codifica uma toxina capaz de matar o nematóide. filha da ovelha da raça "Scottish Blackface". para a transferência do núcleo para o óvulo anucleado. ao contrário do esperado. O embrião resultante é implantado no útero de uma terceira ovelha C. Tomando por base o texto. mas o DNA Foram retiradas as células das glândulas mamárias de uma ovelha adulta da raça "Finn Dorset". b) "Dolly" não tem pai mas é. Os ingredientes foram Questão 1297 colocados numa solução química para "hibernar" e esperar um tempo para serem encaixados nos óvulos anucleados. núcleo de uma célula somática de uma ovelha adulta A para um óvulo de uma outra ovelha B do qual foi previamente Questão 1295 eliminado o núcleo. uma vez que "Dolly" veio de seu a) transfecção do gene ë amplificação do gene ë óvulo. O aglomerado celular foi transferido para o aparelho 290 . que cedeu o óvulo anucleado. cujo controle era muito difícil. d) amplificação do gene ë inserção do gene num vetor Uma maneira de se obter um clone de ovelha é transferir o ë transfecção do gene. onde origina um novo Clone é um população de seres geneticamente idênticos. e) o DNA nuclear é igual ao da ovelha A. Acerca do material genético desse novo originados pela multiplicação assexuada de um único indivíduo. A comunidade científica demonstrou ser possível a Os cientistas transferiram o núcleo da célula mamária para reprodução de seres vivos através de sofisticadas técnicas o óvulo da ovelha "Scottish Blackface" Passado um tempo. características da "Dolly". pois núcleo de b) inserção do gene num vetor ë transfecção do gene ë célula de glândula mamária não pode influir nas amplificação do gene. reprodutor da ovelha "Scottish Blackface". Dele se formou um embrião que deu origem à Dolly.

alguns genes de outra espécie. b) constituição cromossômica e DNA mitocondrial da ovelha A. reprodução assexuada II. É CORRETO concluir que: a) todos os cromossomos do clone são iguais aos da ovelha A. o núcleo de uma célula ovo da mesma espécie. Questão 1299 Os pesquisadores da área de Genética demonstraram ser possível a reprodução de seres vivos por meio de aprimoradas técnicas de clonagem. pode-se prever que Dolly apresente a) constituição cromossômica da ovelha A e DNA mitocondrial da ovelha B. d) constituição cromossômica da ovelha A e DNA mitocondrial da ovelha C. b) os autossomos do clone são iguais aos da ovelha A. neste óvulo anucleado. um grupo de pesquisadores divulgou ao mundo a ovelha Dolly. nas células reprodutoras de uma espécie. c) todos os cromossomos do clone são iguais aos da ovelha B. meiose Na formação de clones de organismos pluricelulares ocorrem. Questão 1301 Considere os processos adiante: I. nas células germinativas de uma espécie. Nessa clonagem. produção de indivíduos geneticamente idênticos IV. dentro do óvulo de uma fêmea. b) introduzir. c) injetar. e) introduzir. d) retirar e descartar o núcleo do óvulo da fêmea de uma espécie e injetar neste óvulo anucleado. o núcleo de uma célula somática de um indivíduo da mesma espécie. dentro do óvulo de uma fêmea. obtido por meio da técnica de clonagem. e) injetar. Esses pesquisadores retiraram o núcleo da célula de uma ovelha (A) e o implantaram num óvulo colhido de uma outra ovelha (B). d) os autossomos do clone são iguais aos da ovelha B. dentro do óvulo da fêmea de uma espécie. o núcleo de uma célula-ovo da mesma espécie. e) constituição cromossômica e DNA mitocondrial correspondente a uma mistura das três ovelhas. reprodução sexuada III. que consistem em: a) injetar. e os cromossomos sexuais são iguais aos da ovelha B. Questão 1298 Recentemente. o núcleo de uma célula somática de um indivíduo da mesma espécie. e) existem cromossomos no clone que são diferentes de A e de B. c) constituição cromossômica e DNA mitocondrial da ovelha B. o núcleo de um outro óvulo da mesma espécie. a nova célula-ovo assim 291 . o mundo foi abalado pela notícia da produção do clone de uma ovelha. um espermatozóide de um macho da mesma espécie.b) retirar e descartar o núcleo do óvulo de uma fêmea de uma espécie e injetar. Esse óvulo fora posteriormente implantado no útero de uma terceira ovelha (C). originando Dolly. e os cromossomos sexuais são iguais aos da ovelha A. nesta célula anucleada. c) retirar e descartar o núcleo de uma célula somática de uma espécie e injetar. d) retirar e descartar o núcleo de uma célula somática de uma espécie e injetar. A partir dos dados envolvidos no experimento realizado pelos pesquisadores. utilizou-se o núcleo de uma célula da mama de uma ovelha (A) e o citoplasma de um óvulo de outra ovelha (B). Questão 1300 Em fevereiro deste ano. necessariamente. APENAS a) I e II b) I e III c) I e IV d) II e III e) III e IV Questão 1302 Se retirarmos o núcleo de uma célula-ovo de rã e o substituirmos por outro núcleo diplóide de uma célula de tecido muscular de rã adulta. o núcleo de um outro óvulo da mesma fêmea. e os cromossomos sexuais são iguais aos da ovelha A. do qual o núcleo fora previamente removido. nesta célula anucleada. alguns genes de outra espécie.

em relação à seqüência funcional do DNA da célula diplóide doadora. II. I. o que diminui a perda em caso de rejeição. cientistas de todo o planeta prometem empreender uma verdadeira reforma genética na natureza. ("Veja". I. de locais das novas plantações. em sua maioria. Assinale a alternativa que correlaciona os fatos mencionados anteriormente em ordem cronológica crescente. e) os vegetais produzem maior número de embriões por indivíduo. e) Expressou-se como na célula muscular. I. Questão 1306 Desde que a criação da ovelha "Dolly " foi anunciada há dois anos. é: a) foi integralmente inativada b) foi integralmente mantida ativa c) expressou-se como na célula epitelial d) expressou-se como na célula germinativa Questão 1304 No fim de junho de 2000. VI. III. III. V. devido ao seu menor grau de complexidade. II. ("O Estado de São Paulo. 4/8/99) Agricultores britânicos que produzem alimentos transgênicos prevêem novos conflitos com ambientalistas. Clonagem do primeiro mamífero a partir de uma célula de um animal adulto. IV. III. V. como forma de protesto. Surgimento da técnica de identificação das pessoas pelo exame do DNA. VI. IV. que teme pelos danos ao meio ambiente e à saúde. III. I. Querem usar a clonagem para salvar pandas em extinção. Dentre as alternativas a seguir. Transformação genética de bactérias para a produção de insulina humana. d) V. V. o que facilita a continuidade do processo. VI. depois de dez anos de trabalho. Identificação da localização cromossômica dos genes. um marco no estudo da biologia. que recebeu ampla divulgação na imprensa internacional. d) a regulação hormonal da reprodução nos vegetais é mais facilmente controlada pelos cientistas. o "Projeto Genoma Humano". podemos relacionar alguns fatos que marcaram época pela sua importância científica. a que apresenta a melhor explicação sobre o que ocorre neste caso. uma vez que o governo britânico divulgou ontem o anúncio. c) Foi integralmente mantida ativa. Alguns manifestantes. Questão 1303 Se retirarmos o núcleo de uma célula-ovo de rã e o substituirmos por outro núcleo diplóide de uma célula de tecido epitelial normal de rã já adulta. Questão 1305 Os conhecimentos científicos envolvendo a "clonagem" têm proporcionado à humanidade grandes avanços e sua utilização em vegetais tem sido mais fácil e menos controversa que em animais. em relação à seqüência funcional do DNA da célula diplóide doadora. estão destruindo as plantações de transgênicos do país. a) II. d) Expressou-se como na célula germinativa. considere as seguintes afirmativas: 292 . Observação da estrutura espiralada do DNA. b) os embriões resultantes da clonagem em vegetais são mais resistentes às modificações ambientais. VI. b) Foi parcialmente inativada. III. IV. porque a) os mecanismos de regulação gênica nos vegetais são mais simples. II. IV. VI. c) os vegetais apresentam. Assinale a alternativa que explica. IV. o que ocorre. Estabelecimento das leis da hereditariedade.formada será capaz de produzir uma outra rã. a) Foi integralmente inativada. como segue. II. I. pela Internet. a capacidade de propagação vegetativa. Numa breve história da genética. III. corretamente. foi considerado concluído. I. e) IV. b) II. a nova célula-ovo assim formada será capaz de produzir outra rã normal." 17/8/99.) Tendo em vista as vantagens e limitações das técnicas comentadas nos textos acima. O uso da técnica tem criado receio entre a população. criar animais com órgãos humanos e produzir bichos que funcionem como farmácias ambulantes. VI. c) V. neste caso. V.

I . porém.A introdução de um material genético exógeno (transgene) em organismo vivos pode determinar um risco ecológico. (4). que foi denominada de retículo nucleoplasmático. sendo descrita como uma estrutura membranosa que está envolvida no processo de regulação de cálcio. Essa nova célula. b) apenas I. ( ) Com uma única transcriptase é possível cortar o DNA de uma célula em pontos da molécula onde existem diferentes seqüências de nucleotídeos. III e IV.Os cientistas ainda precisam compreender melhor os mecanismos de controle de diferenciação celular. Nesse processo. é removido o núcleo de um ovócito. III . Nos cortes são utilizadas as enzimas transcriptases reversas. o núcleo de uma célula somática de um tenista é retirado. e o adulto (5) terá praticamente as mesmas características fenotípicas do indivíduo que doou o núcleo. II .A clonagem poderá auxiliar no esclarecimento dos mecanismos de envelhecimento e morte celular. analise as proposições abaixo. independentemente do seu tecido de origem. Questão 1309 O esquema a seguir mostra uma clonagem reprodutiva humana. (3). é transferida para um útero para que se desenvolva e forme um embrião. ( ) Para cortar o DNA dos cromossomos. esses cromossomos devem estar em metáfase. ( ) Os plasmídios não contêm genes essenciais à vida das bactérias. o material genético (DNA. São corretas a) apenas I. d) embrionárias são capazes de se diferenciar em outros tipos de células. o nucléolo e enzimas. ainda não totalmente avaliado. é possível obter-se um grande número de cópias do mesmo. 293 . b) de um paciente podem ser usadas para regenerar seus tecidos ou órgãos lesados. Em 1997. ( ) Um DNA recombinante pode ser obtido a partir da união de um segmento de DNA bacteriano com um segmento de DNA de um outro organismo. uma vez que o fenótipo é resultado do genótipo (DNA) mais as influências do ambiente. eles podem ser utilizados como vetores genéticos. (1). é INCORRETO afirmar que células-tronco a) retiradas de embriões congelados eliminam as questões éticas e religiosas associadas à obtenção de órgãos para transplantes. c) de adulto são capazes de se diferenciar em outro tipo de célula. (2) e finalmente é introduzido o núcleo da célula do atleta no ovócito enucleado. o núcleo foi considerado uma organela que apresentava as seguintes estruturas: um envoltório. e) I. II e III. "Ciência Hoje". IV . II e IV. eliminando o risco de rejeição imunológica. II. nŽ 195.Os estudos de clonagem podem ser proveitosos para o estabelecimento de relações filogenéticas entre os organismos fósseis e os atuais. para um maior aproveitamento dessas técnicas. desde que cultivadas sob condições adequadas. d) apenas III e IV. ( ) A partir de um segmento de DNA.1 om base nas informações desse esquema e em outros conhecimentos sobre o assunto. O embrião se desenvolverá. cientistas britânicos descobriram uma nova estrutura nuclear. Por muito tempo. RNA). c) apenas II. 2003 [adapt. de um organismo introduzido em uma bactéria.15. III e IV.5.] 1. Questão 1307 Analise este esquema relativo à obtenção de células-tronco: Questão 1308 Considerando o processo de clonagem do DNA.

No seu interior. obtêm-se plantas adultas. c) a função do retículo nucleoplasmático é semelhante à do retículo endoplasmático. a partir delas. muito menos produtivas. as células-tronco podem ser comparadas às células dos embriões. IV. b) gástrula. (2) Uma vantagem dessa técnica é que as plantas produzidas não são suscetíveis ao ataque de pragas. II. e) o envoltório nuclear é formado por duas membranas. julgue os itens adiante. pois as células podem ser manipuladas geneticamente e. c) nêurula. A partir de células de um morangueiro. Com base nessa informação. é INCORRETO afirmar que a) o núcleo é uma organela exclusiva das células eucarióticas. III. será a célula doadora do núcleo. principalmente para a obtenção de células-tronco. este . d) formação do celoma. do qual se retirou o núcleo celular. apenas. III e IV. Questão 1310 Os morangos de excelente qualidade que se encontram atualmente nos supermercados são produto principalmente de técnicas de propagação vegetativa "in vitro". c) I. 294 Com base no texto e em seus conhecimentos. e) formação da notocorda. originando zigotos igualmente distintos. Questão 1312 Considere as cinco situações seguintes. (1) As plantas obtidas de uma mesma cultura de tecidos são geneticamente iguais.1 genético de plantas. d) todo o DNA da nova célula formada na clonagem citada no texto. Essas técnica permite. V. (4).15. estruturas importantes no processo de tradução. enquanto estas se encontram na fase de a) mórula. Questão 1311 Um dos caminhos escolhidos pelos cientistas que trabalham com clonagens é desenvolver em humanos a clonagem terapêutica.juntamente com proteínas . Óvulos distintos são fecundados por espermatozóides também distintos. (4) Uma vez obtida uma variedade de morangueiro com as características ideais. pelo procedimento tradicional. faz-se uma cultura de tecidos e. apenas. b) o nucléolo é responsável pela síntese do RNA ribossômico.1. O gameta feminino (óvulo) de certos animais se desenvolve formando um novo indivíduo.5. a partir desta. d) I. podemos dizer que são processos de clonagem: a) I.forma os ribossomos. com o núcleo de uma célula somática retirada de um animal que se deseja copiar. seriam passadas para as plantas-filhas. Tomando-se como referência a definição genética de clone e considerando as situações descritas. sem que tenha sido fecundado. que é uma organela citoplasmática. apenas. Uma muda de violeta formada a partir de uma única folha que tenha sido destacada de outra planta e plantada em solo úmido e bem adubado. I. a eliminação de infecções virais presentes na planta-mãe e que. Quanto a este aspecto. Concepção de um organismo a partir da fusão de um óvulo não fecundado. IV e V. sendo que cada uma delas é composta por duas camadas de lipídios com proteínas inseridas. (3) A cultura de tecidos vegetais facilita o melhoramento . Formação de vários embriões a partir de um único zigoto. b) I e II. podem-se obter indivíduos adultos com características alteradas. por exemplo. que são células indiferenciadas que podem dar origem a qualquer tipo de tecido. entre elas as envolvidas nos processos de transcrição e replicação. estão presentes várias enzimas. II. apenas. não se justifica preservar as variedades silvestres.

Em seguida. maior. b) a composição química do DNA dos dinossauros é diferente das encontradas em espécies atuais. b) I e III. I. a) Obter células-tronco de embriões em fase de gástrula em vez de obtê-las da blástula. ali. na prática esse procedimento é extremamente improvável porque: a) seria necessário encontrar um genoma completo e conhecer sua ordem nos cromossomas. Os riscos ambientais da soja transgênica são pequenos. d) II e III. já que no cordão a diferenciação é menor e o número de células. Tanto nos clones quanto nos transgênicos. Questão 1313 Sobre a clonagem de seres e a criação de organismos geneticamente modificados (transgênicos). quando as células já estão mais diferenciadas. A planta está passando por testes de segurança nutricional e ambiental. Uma linhagem de soja transgênica requer a produção inicial de 200 plantas resistentes ao herbicida e destas são selecionadas as dez mais "estáveis". c) Conseguir células germinativas do ovário de uma fêmea adulta pois. Um grande inconveniente entre a clonagem e a produção de transgênicos é que ambas não permitem sobreposição. III. ou seja. a existência de clones apenas aumenta o número de representantes de um determinado nível trófico. elas estão menos diferenciadas do que as células germinativas nos testículos de um macho adulto. Estão corretas: a) I e II. Ecologicamente. e) Obter células do embrião em fase de blástula. quando ainda não é possível conseguir células tão indiferenciadas. d) Optar pela obtenção das células do cordão umbilical de recém-nascidos em vez de obtê-las da fase de gástrula. criar um clone transgênico. c) I e IV. Esses descendentes são submetidos a doses de herbicida três vezes superiores às aplicadas nas lavouras convencionais. de Steven Spielberg. b) Trabalhar apenas com embriões em vez de organismos adultos. e) III e IV. não foi possível. IV. a crítica recai sobre o fato de que não se sabe se os genes introduzidos irão se expressar exatamente como no organismo doador ou se irão ativar também alguns genes inativos do genoma do organismo receptor. IV e V. e) não existem técnicas para a inserção de fragmentos de DNA de uma espécie em outra. cientistas retiraram do intestino de insetos hematófagos fósseis moléculas de DNA de dinossauros. No caso dos transgênicos. ela já é conhecida e utilizada há certo tempo. em vez de obtê-las da gástrula ou do cordão umbilical. II. quando a indiferenciação é maior. considere as quatro afirmações seguintes. as cinco melhores são separadas e apenas uma delas é levada a testes de segurança. Questão 1315 No filme "Jurassic Park". II. Questão 1316 A Embrapa possui uma linhagem de soja transgênica resistente ao herbicida IMAZAPIR. inclusive na agricultura. com maior capacidade de gerar descendentes também resistentes. processo que exige cerca de três anos. já que ela não tem possibilidade de cruzamento com outras plantas e o perigo de polinização 295 . A clonagem de organismos tem se voltado mais para os animais porque. em uma cadeia alimentar. Questão 1314 Um pesquisador precisa obter células-tronco para iniciar experimentos em terapia gênica. c) as características do organismo se devem à estrutura primária das proteínas e não do DNA.e) I. pode haver também alteração de posições e de elementos na cadeia. até o momento. com relação às plantas. III. d) o DNA coletado sofre mutações durante o período em que ficou fossilizado. Apesar da eficiência proposta no filme. Aponte a alternativa que relaciona o procedimento e a justificativa corretos para que tal pesquisador tenha sucesso. A reconstituição dessas moléculas teria sido feita através da inserção de fragmentos de DNA de rã. uma vez que em adultos não existem células-tronco.

a) mutante e técnica de miscigenação. II. referentes à técnica utilizada para obtenção da Tracy. IV. III e IV. no seu patrimônio genético. apresenta baixo risco ambiental porque a) a resistência ao herbicida não é estável e assim não passa para as plantas-filhas. b) as doses de herbicida aplicadas nas plantas são 3 vezes superiores às usuais. Um organismo ao receber material genético de outra espécie. Questão 1320 Analise as informações abaixo: I. c) I. a seguir. Pense na batata (ou qualquer outra planta) como uma fábrica que produz a mesma substância (proteína. um dos pintores surrealistas mais importantes. A soja transgênica. ela começou a brilhar. d) a linhagem passou por testes nutricionais e após três anos foi aprovada. c) a capacidade da linhagem de cruzar com espécies selvagens é inexistente. mas o catálogo não possui a receita para isso. II e IV. Quando essa planta foi regada com a substância que o vaga-lume usa para produzir luz. c) mutante e técnica do DNA-recombinante. A técnica do DNA recombinante foi utilizada para obtenção de Tracy. passa a apresentar novas características.).15. d) transgênica e técnica do DNA-recombinante. O belga René Magritte (1896-1967). Para a ligação do DNA transplantado ao DNA hospedeiro a célula utiliza a ENZIMA LIGASE. e) II.5. d) I. As substâncias utilizadas para isolar o gene a ser transplantado são denominados ENZIMAS TRANSGÊNICAS. etc.cruzada com outro tipo de soja é de apenas 1%. deixou obras enigmáticas. III e IV. Caso você fosse escolher uma ilustração para um artigo sobre os transgênicos. A bactéria 'Bacillus thuringiensis' (Bt) contém um gene que leva à produção de uma enzima capaz de digerir o 296 1.2 Questão 1318 "Tracy é uma ovelha transgênica. Analise as afirmativas a seguir. estaria mais de acordo com esse tema tão polêmico? I. algodão colorido e cabras que produzem fatores de coagulação sangüínea humana. Uma saída é consultar os catálogos de outras espécies. respectivamente. ou modificado da mesma espécie. II e III. . capaz de produzir uma proteína humana cuja deficiência causa problema hepático e pulmonar". Questão 1317 Os transgênicos vêm ocupando parte da imprensa com opiniões ora favoráveis ora desfavoráveis. ou seja. já temos bactérias fabricando hormônios humanos. III. por exemplo. amido. Questão 1319 Uma planta de fumo foi produzida a partir de uma célula de fumo que havia recebido o gene responsável pela bioluminescência dos vaga-lumes. Estão corretas apenas as afirmativas: a) II e III. II. Suponha que você queira tomar a fábrica inexpugnável aos ataques de insetos. qual das obras de Magritte. e) transgênica e técnica de clonagem. e) a linhagem obtida foi testada rigorosamente em relação a sua segurança. b) I. segundo o texto. b) mutante e técnica de clonagem. Animal transgênico é aquele que recebe e incorpora genes de outra espécie. Assim. O catálogo com a receita para a produção dessas substâncias está no genoma. A planta de fumo e a técnica utilizada para obtê-la são denominadas.

Paulo" de 03/07/1999. ao tipo de população e às suas riquezas naturais. Após a análise das informações acima. a) A batata geneticamente modificada é um alimento transgênico porque recebeu um genoma completo da bactéria. a partir do cruzamento com a bactéria. a toxina Bt é inofensiva aos seres humanos. O besouro ou a lagarta que se alimentar dela morrerá.intestinos dos insetos. genes de uma outra espécie. a) Associar o desenvolvimento socioeconômico de cada região às suas características de relevo. e com certeza não haverá ser humano sensível à ação biodigestora da toxina. A biotecnologia já encontrou bactérias ou vírus capazes de fazer essa transferência. b) Cultivar espécies com crescimento rápido e utilizar esses conhecimentos para planejar plantações economicamente viáveis. e) 100 %. IV. pois a toxina digere o intestino desses animais. uma nova espécie. Agora. d) Introduzir nas células de uma planta. A engenharia genética tem ferramentas bioquímicas para tirar cópias dessas páginas do genoma. tiradas do jornal de "Folha de S. b) A batata passou a ser um alimento transgênico porque foi cruzada com gametas oriundos da bactéria. Segundo os biotecnólogos. Questão 1322 A engenharia genética possibilitou a introdução do gene humano para a produção da insulina em bactérias. d) transgênicas. Assinale aquela que contém conceitos e informações científicas só disponíveis aos jovens. Questão 1321 A introdução de uma cópia de um gene humano no genoma do pronúcleo masculino de um zigoto originou uma ovelha transgênica. Quando uma célula meristemática for geneticamente modificada. isto é. Se essa ovelha for cruzada com um macho não-transgênico. assinale a alternativa correta. Para que isso fosse possível. ela poderá de transformar numa planta adulta que produzirá a toxina Bt. e) Podemos confiar na palavra dos biotecnólogos quando afirmam "A toxina Bt é inofensiva aos seres humanos". na última década do século XX. é preciso transferir esse gene para o genoma da batata. o que lhe conferiu resistência ao ataque de predadores. e) Imobilizar o gás carbônico tanto pelo processo de fotossíntese como por meio da fabricação de móveis. capaz de produzir hemoglobina. incluir o gene no genoma da batata. d) 75 %. pois sabemos que o genoma humano é homogêneo. b) clones. c) A batata geneticamente modificada é um alimento transgênico porque recebeu parte do genoma de uma outra espécie. VI. essa planta recebeu: a) os anticódons que determinam a seqüência de 297 . c) mutantes. As alternativas a seguir apresentam algumas atividades sugeridas para a melhoria da qualidade de vida humana e da saúde ambiental. d) A batata passou a ser uma alimento geneticamente modificado. Essas bactérias são consideradas a) puras. constituindo. b) 25 %. o que lhe conferiu resistência ao ataque de predadores. III. Questão 1324 Recentemente foi noticiada a criação de uma planta transgênica. Questão 1323 As questões ambientais têm sido motivo de preocupação sobretudo para as últimas gerações. cujos intestinos não oferecem condições para ela se manifestar. A planta inteira ficará impregnada com a toxina. c) 50 %. c) Estudar a dinâmica de crescimento e de regeneração natural das florestas tropicais. A qualidade do ar e a importância da preservação da biodiversidade constam da pauta das discussões da humanidade há muito tempo. V. fazendo com que os novos genes sejam incorporados a seus cromossomos. que porcentagem de descendentes portadores do gene humano espera-se obter? a) Zero.

por conseqüência. apenas. destaque a afirmação correta: a) O objetivo dos cientistas é criar novas espécies. III e IV. Questão 1327 As técnicas de manipulação genética. II . Atualmente. milho resistente a insetos IV. aumentando a produtividade e minimizando. e) os transgênicos simplificarão muitas cadeias alimentares. d) I e III. apenas. b) todos os países passarão a produzir soja. poucos assuntos geram tanta controvérsia como os produtos transgênicos. apenas. os alimentos transgênicos representam um tema de grande discussão. e) somente os aminoácidos usados nessa proteína.aminoácidos nessa proteína. Esta interferência do homem na natureza se dá por meio da engenharia genética. Estão corretas: a) I. Questão 1328 A engenharia genética causou uma revolução na biotecnologia. c) o fragmento de DNA. que apresentam uma grande incidência de pragas na agricultura. c) II e III. soja tolerante a herbicidas Desses produtos. insulina humana para uso de diabéticos III. A transferência de genes bacterianos para o genoma de uma planta amplamente cultivada e usada na alimentação animal e humana vem gerando. cuja seqüência de nucleotídeos determina a seqüência de aminoácidos da hemoglobina. IV . beneficiando o meio ambiente. questionamentos de cunho político. Questão 1326 Atualmente. Considere os quatro exemplos abaixo: I. Esses questionamentos justificam-se porque a) o custo dos transgênicos será certamente maior do que o dos produtos convencionais. diversos produtos biotecnológicos estão sendo comercializados. e) Os ambientalistas defendem o uso da engenharia genética pois os seus efeitos são totalmente previstos e controlados. b) I. d) O RNAm que carrega os aminoácidos usados na síntese de hemoglobina. c) não se conhecem os efeitos que os transgênicos podem ter na saúde das pessoas. Com o uso dessa variedade. não trazendo perigos para a humanidade.Não se sabe quais serão as possíveis conseqüências da ingestão desses alimentos. prejudicando os atuais exportadores. permitiram a criação do primeiro produto transgênico de grande impacto na agricultura: a soja resistente a um potente herbicida. o "round-up". Sobre este tema. I . Questão 1325 Atualmente. o uso de herbicidas. científico e filosófico. b) os ribossomos utilizados na produção dessa proteína. as técnicas de controle de pragas nas culturas de soja sofreram mudanças e os custos de produção diminuíram.Pode-se gerar um animal transgênico que tenha a capacidade de produzir maior quantidade de leite com menor taxa de gordura. II. d) A modificação genética dos alimentos consiste na transferência de material hereditário de um organismo para outro receptor. III e IV. e) II. eliminando todos os competidores do homem e dos animais que ele cria. II e IV. juntamente com produtos obtidos por meios tradicionais. III . d) eliminando-se as pragas da lavoura.Trata-se de alimentos fabricados com produtos geneticamente modificados. c) Modificar um organismo geneticamente significa cruzar espécies diferentes. considere as seguintes afirmações. porém. utilizadas para a obtenção de seres transgênicos. para se obter uma espécie nova que não ocorre naturalmente. muitas cadeias alimentares desaparecerão. batata resistente a viroses II. b) A aplicação da engenharia genética nos alimentos teve origem em países do terceiro mundo. gerando novas combinações genéticas. derivam exclusivamente de engenharia 298 .Os ecologistas temem que as plantas transgênicas possam afetar o equilíbrio ecológico. A esse respeito. apenas.

III. São Paulo: Abril. Há desvantagens SOMENTE em a) I b) II c) III d) I e II e) II e III Questão 1331 Os alimentos geneticamente modificados são uma realidade cotidiana. II e III d) I. entretanto. II e III.2 299 . pães. não transgênicas. tornando-se mais saborosos. Há. ano 36. a possibilidade de afetar insetos e outros animais do ecossistema. a insetos e a vírus. interferência na composição da diversidade local de insetos ocorre SOMENTE com a) I b) II c) III d) I e II e) I e III Questão 1330 Sementes transgênicas podem levar à produção de plantas resistentes a inseticidas. pés de milho cujas sementes produzem hormônios de crescimento humano. c) I e II somente. III. Há grãos transgênicos usados no preparo de bolachas. e) I. O processo de inserção de genes de uma espécie em outra é realizado com a ajuda de enzimas de restrição. Um transgênico possui em seu genoma um ou mais genes provenientes de outra espécie. III e IV Questão 1329 Obtiveram-se plantas transgênicas com as seguintes características: I.5.genética SOMENTE a) I e II b) III e IV c) I. o que aumenta e barateia a produção. ou então com melhores qualidades nutritivas. Toda essas plantas são úteis para a espécie humana. III e IV e) II. 1. p. algodoeiros cujas folhas se tornaram impalatáveis para a herbivoria. É possível que haja polinização entre uma planta transgênica com outras de uma mesma espécie. Questão 1332 A charge a seguir foi produzida num momento em que no Brasil se discutem as possíveis vantagens e desvantagens da liberação do plantio e comercialização de plantas transgênicas. massas. III. maionese. cereais. a necessidade de uso mais intenso de agrotóxicos.15. d) II e III somente. favorecendo a população mundial. b) II somente. Está correto o que se afirma em a) I somente. mostarda e papinhas para crianças. 100) Foram feitas as seguintes afirmações sobre organismos geneticamente modificados: I. II. n. ed. porém. ("Veja". 43. a possibilidade de transmitir seus genes de resistência a plantas de espécies aparentadas. óleo de soja. 1886. II. outras conseqüências que o seu cultivo pode acarretar entre as quais estão: I. tomateiros cujos frutos passam mais tempo amadurecendo no pé. II.

Questão 1335 Em revistas e em jornais. porque suas implicações são muito sérias. o homem poderá experimentar. podendo misturar o DNA de microorganismos. as torna resistentes a certos tipos de insetos. que produz uma toxina contra lagartas. b) Os defensores dos OGM enumeram a capacidade de aumento da produtividade agrícola. d) RNA mensageiro do coelho injetado no ovo se incorporou a um cromossomo e foi transmitido de célula a célula através de mitoses. O problema está em algumas de suas aplicações. são os principais riscos ambientais. oportunizando melhores condições ambientais e sociais. fumo. e) A poluição genética. regulamentados pelas normas de biossegurança. c) A bactéria 'Bacillus thuringiensis' (Bt) é um agente de controle biológico encontrado no solo. como grãos. pois a ingestão da planta não lhe fará mal. além de servirem para a alimentação. algodão. tornar os alimentos mais nutritivos e saudáveis e criar novos tipos de terapias e medicamentos. podem ser usados para produzir remédios. d) Se os insetos experimentarem. este tema não pode progredir na base do ser contra ou a favor. b) DNA do coelho injetado no ovo se incorporou a um cromossomo e foi transmitido de célula a célula através de mitoses. é correto afirmar: a) OGM são produtos obtidos pela transferência de gene entre espécies similares ou diferentes. A transferência do gene Bt para as variedades de milho. Mas. Isto envolve a natureza. A técnica de obtenção de organismos transgênicos produtores de proteínas humanas consiste em: a) remover artificialmente alguns nucleotídeos de uma molécula de DNA. b) retornar uma célula diferenciada ao estágio de indiferenciada. c) O que não é bom para os insetos pode não ser bom para os homens. redução do uso de agrotóxicos. a perda de biodiversidade. Nenhum cientista deixa de reconhecer o poder da tecnologia do DNA. Questão 1333 "Muito se tem falado sobre os transgênicos e praticamente todo mundo tem alguma opinião sobre o assunto. plásticos e combustíveis. Os camundongos que nascidos desses ovos apresentaram hemoglobina de coelho em suas hemácias. batata e soja. porém o uso dos OGM tornaria os pequenos agricultores independentes em relação às empresas fornecedoras de sementes.(Jornal da "Ciência" . e) DNA do coelho injetado no ovo se incorporou a um cromossomo e passou a conduzir a síntese de proteínas nessa célula. alterando assim o código genético do organismo. são constantes e cada vez mais freqüentes os noticiários sobre o uso de tecnologia transgênica com fim de obter proteínas de ação farmacológica ou mesmo proteínas terapêuticas humanas. porque: a) RNA mensageiro do coelho injetado no ovo passou a conduzir a síntese de proteínas nessa célula. é CORRETO afirmar: a) O que não faz mal para o homem não fará mal para os insetos. d) Vários tipos de alimentos. que gera um novo organismo por multiplicação.) Analisando-se a charge de acordo com os atuais conhecimentos biológicos. em 10 de outubro de 2003. produtos químicos. Nov/2003) Sobre os OGM (organismos geneticamente modificados). c) DNA do coelho injetado no ovo foi transcrito para o RNA ribossômico que conduziu a síntese de proteínas nessa célula. o aumento do uso de agrotóxicos e a perda da fertilidade natural do solo. a saúde humana e a economia. quando genes de coelhos foram injetados em ovos de camundongos que se desenvolveram no útero de fêmeas dessa espécie. favorecendo toda população mundial. o surgimento de ervas daninhas resistentes a herbicidas." ("Revista Galileu". 300 . Questão 1334 O primeiro organismo transgênico foi obtido por volta de 1981. leite e ovos.Edição 515. de animais e do homem. b) As plantas transgênicas são perigosas para a saúde animal. além de mais nutritivos. de plantas. implicações e incertezas.

e) uma seqüência de DNA do elefante sofreu mutação devido à introdução do gene do vaga-lume em células daquele mamífero. foram introduzidos certos genes da hidra em ovos de planária. de maneira a integrar o material genético. Questão 1337 No vaga-lume há um gene que determina produção de luciferase. Desses ovos. c) uma seqüência de RNA do vagalume foi transferida para células do elefante. A tira de quadrinhos a seguir faz referência à manipulação de genes em laboratório. Através da engenharia genética. que porta a totalidade do genoma. seria possível produzir um rato a) sintético. da genética atual. representada na ilustração. levando à produção de luz.2 Se esse tipo de experimento realmente fosse concretizado. e) transgênico. Questão 1338 Em um experimento. que não possibilitou a produção de RNA e nem de luciferase. a partir do qual as células da planta produziram RNA e luciferase. a partir desta.5. c) os genes da hidra apresentaram transcrição no organismo da planária. c) incorporou um segmento de DNA do vaga-lume. O resultado desse experimento indica que a planta a) incorporou um segmento de RNA do vaga-lume. Com relação a esse experimento. d) o gene do vaga-lume controlou a produção de RNA e de proteína no interior das células do elefante. 1. enzima responsável pela oxidação da substância luciferina. a referida planta começou a emitir luz. b) híbrido. NÃO é correto afirmar que a) os genes da hidra se expressaram na planária.15. Após ser regada com solução de luciferina. c) clonado.2 través da técnica.5. foram isoladas moléculas de RNA e de proteína da hidra. obteve-se uma planta inteira. d) ocorreu tradução do código genético da hidra no organismo da planária. a partir do qual as células da planta produziram DNA e luciferase. a reativar os seus genes e gerar um novo ser. e) métodos biotecnológicos de cruzamentos seletivos para obtenção de novas espécies. poder-se-ia afirmar que a) o elefante e o vaga-lume são organismos transgênicos. d) introdução de um ou mais genes interessantes de uma espécie em célula hospedeira.c) induzir célula somática. b) apenas o vaga-lume é um organismo transgênico. Das células de vermes adultos. e) não expressou o gene do vaga-lume. que possibilitou às células da planta a produção de luciferase.15. d) transplantado. esse gene foi transferido para uma célula vegetal e. d) incorporou um segmento de DNA do vaga-lume. desenvolveram-se vermes portadores de tentáculos e de cnidoblastos com filamento urticante. Questão 1336 Responder à questão a seguir com base na ilustração. Questão 1339 1. 301 . b) incorporou um segmento de RNA do vaga-lume. e) a hidra e a planária nele utilizadas são organismos transgênicos. b) segmentos de DNA da hidra apresentaram capacidade de replicação durante a embriogênese da planária.

amido e proteínas em suas sementes ou melhorar a resistência das plantas a pestes e vírus ou ainda aumentar a sobrevivência destes organismos em ambientes adversos. serão expressas em culturas de bactérias contendo os plasmídios modificados.Questão 1340 Recentemente. a atividade da EPSP-sintase em extratos de folhas de diferentes tipos desse vegetal. após introduzidas em plasmídios. na ausência do inibidor. tornando-as resistentes a agentes químicos. alto poder de resistência a herbicidas. Estas passaram a apresentar a característica da canola transgênica. Estes novos segmentos de DNA introduzidos podem. ou seja. tornando-a resistente à inibição pelo herbicida glifosato. d) o RNA da canola transgênica foi transferido e incorporado ao genoma das ervas daninhas. para gerar uma nova planta com novas características. b) o pólen da canola transgênica transportou material genético para plantas silvestres.2 A curva que corresponde à razão entre as atividades de uma enzima da variedade transgênica e as atividades dessa mesma enzima da soja comum é a indicada pela seguinte letra: a) W b) X c) Y d) Z Questão 1344 Considere o texto a seguir: "Os alimentos transgênicos. em presença ou ausência de glifosato. é INCORRETO afirmar que a) as espécies de canola são transgênicas pois expressam genes que incorporaram de outras espécies. presente em praticamente todos os vegetais. Questão 1341 As técnicas modernas de biologia molecular têm permitido a inserção de segmentos novos de DNA em células vegetais. mas evita o crescimento de outros vegetais indesejáveis. produtos que sofreram 302 . por exemplo.15. gerar novas plantas com reservas modificadas de lipídios. Assim. e) as ervas daninhas passaram a produzir proteínas da canola transgênica. o tratamento com esse herbicida não prejudica o desenvolvimento de culturas de soja transgênica. As cópias. foram constatados casos de transporte de pólen de espécies de canola transgênica para plantas silvestres (ervas daninhas). Sobre esse fato. é modificada na soja transgênica. Essas cópias de DNA são sintetizadas em laboratório com o auxílio de uma preparação da enzima denominada de: a) RNA replicase b) RNA polimerase c) desoxirribonuclease d) transcriptase reversa Questão 1343 A enzima EPSP-sintase. nas mesmas condições experimentais. Estas novas plantas são exemplos de organismos criados por engenharia genética e são genericamente conhecidos como: a) reversos b) recessivos c) dominantes d) transgênicos Questão 1342 Para a clonagem em bactérias do hormônio do crescimento humano a partir de seu RNA mensageiro. Num estudo para a identificação da variedade transgênica de soja. As atividades da enzima nesses extratos. Observe o gráfico: 1. foi medida. é inicialmente necessário que sejam sintetizadas em laboratório cópias em DNA desse RNA. apresentaram o mesmo valor. em crescimento no meio apropriado. c) as espécies silvestres incorporaram e expressaram material genético da canola transgênica.5.

Pela leitura do texto anterior. em geral.5. b) a utilização de células vegetais diminui a possibilidade de contaminação humana por vírus animais.15. d) O RNA mensageiro. batizou de Alba a coelha transgênica que tem uma propriedade peculiar: seus olhos rosados e seus pêlos brancos ficam fluorescentes quando expostos à luz ultravioleta. plantas que produzem proteínas humanas..2 303 . Estas plantas são chamadas transgênicas. e) todas as plantas transgênicas são estéreis a partir da segunda geração mutante. corretamente.]. e) O DNA relacionado à síntese do GH pode ser obtido a partir do RNA mensageiro. presente naturalmente em medusas e que pode ser detectada sob luz ultravioleta. Considere estas informações e assinale a opção incorreta: a) O gene para a produção de GH é. c) Antes de se obter a planta produtora de GH é necessária a produção do DNA recombinante.alteração genética com o objetivo de melhorar a qualidade. o resultado mais trágico do uso de produtos transgênicos surgiu no Japão em 1989: 5000 pessoas ficaram doentes. d) as técnicas de transferência de genes por engenharia genética são altamente seguras. b) plantas transgênicas são aquelas cujos fenótipos se devem mais ao ambiente do que aos genes. 1. já ocupam prateleiras dos supermercados nos Estados Unidos e Canadá. na sigla em inglês). que: a) toda planta transgênica produz substâncias altamente tóxicas ao ser humano. obtiveram. Os benefícios [advindos de plantas transgênicas]. Eduardo Kac. introduzido no plasmídeo antes de sua introdução na célula vegetal. mas o consumidor não sabe disso: não há lei que obrigue os fabricantes a informar que o produto sofreu alteração genética. Questão 1345 Pesquisadores de alguns centros de pesquisa brasileiros. 6 de agosto de 1998). podem esconder riscos ainda não esclarecidos [. entre as quais o hormônio do crescimento (GH). os pesquisadores criaram um coelho que produz em todas as suas células a proteína GFP (proteína verde fluorescente. relacionado ao GH. c) manipulações genéticas podem alterar o funcionamento dos genes naturais de um organismo. Questão 1346 Os cientistas franceses que criaram animal transgênico e o artista brasileiro que fez a encomenda entram em conflito. (FOLHA DE SÃO PAULO. quando introduzido na célula vegetal é transcrito em DNA na presença da enzima transcriptase vegetal. recentemente. onde também não há obrigação de alertar o consumidor.. No Brasil. pode-se concluir. 1500 se tornaram permanentemente inválidas e 37 morreram". utilizando técnicas de engenharia genética. Para conferir essa característica particular. pois os resultados das experiências podem ser imprevisíveis. Até o momento. a multinacional Monsanto está tentando conseguir autorização do Ministério da Ciência e Tecnologia para produzir soja transgênica no país. Criador e artista já disputam a posse da "transcoelha". artista plástico brasileiro e professor de arte e tecnologia em Chicago. porém.

c) As enzimas de restrição agem em seqüências inespecíficas de DNA. como o de transformar células de bactérias. 304 . Dentre as afirmativas acima. que no processo de tradução origina a proteína GFP.com. e) Ainda não é possível produzir plantas com genes ativos de insetos. Assim sendo. Questão 1350 Analise as proposições a seguir.htm Considerando a tecnologia para obtenção de transgênicos.br/educacao/isaacelias/coelha. III) As células fluorescentes da coelha produzem RNA mensageiro. e) Injetar anticorpos produzidos contra o fator IGF-1. Nessas pesquisas. Questão 1348 O arroz dourado . b) Organismos que recebem e manifestam genes de outra espécie são denominados transgênicos. foi mostrada a existência de duas proteínas que atuam regulando o crescimento das células musculares: o fator de crescimento IGF-1 e a miostatina. sem deixar vestígios detectáveis em exames de sangue ou urina.produz ’-caroteno (vitamina A). utilizando técnicas aplicadas em terapia gênica. ("Scientific American Brasil". II) Apenas as células somáticas tiveram o gene que codifica a proteína GFP inserido em seu genoma. a) As enzimas de restrição hoje conhecidas são produzidas por diversas indústrias multinacionais. b) Injetar anticorpos produzidos contra a proteína miostatina. se executado uma única vez. b) aumenta o peristaltismo.geneticamente modificado . são feitas as seguintes afirmativas: I) A coelha Alba é considerada transgênica pois possui em seu genoma um segmento de DNA de medusa. Questão 1349 Através de técnicas da biologia celular. c) Introduzir nas células musculares nova cópia do gene do fator IGF-1. IV) A coelha transgênica foi produzida a partir da introdução de um núcleo extraído de uma célula de medusa em um óvulo de coelha cujo núcleo tenha sido anteriormente removido. d) diminui a formacao de coagulos. são vetores do DNA recombinante. O crescimento muscular é estimulado pelo fator IGF-1 e limitado pela miostatina. e CORRETO afirmar que o uso desse grão na alimentação humana resulta em benefício para a saúde porque ele a) previne alguns tipos de cegueira.daptado de: http://paginas. a partir de DNA viral. para que estas produzam substâncias que normalmente não seriam produzidas. c) evita o aparecimento do bocio. somente estão corretas: a) I e II b) I e III c) I e IV d) II e III e) III e IV Questão 1347 Recentes descobertas têm provocado grande discussão por poderem alterar o futuro do esporte. o homem tem desenvolvido grandes projetos. chamados de bacteriófagos. a) Introduzir nas células musculares novas cópias de RNA mensageiro que codifica o fator IGF-1. em indivíduos sedentários. d) Cromossomos circulares presentes no citoplasma de bactérias. tal como a insulina. Sobre este assunto. A partir desse conhecimento é possível modular o crescimento muscular por meio de vários procedimentos. referentes a diferentes questões de Genética. assinale a alternativa correta.terra. d) Injetar a proteína miostatina mutada que bloqueia a ação da miostatina normal por competir pelo seu receptor. 08/2004) Analise os procedimentos a seguir e aponte aquele que poderia promover o desenvolvimento mais duradouro da massa muscular.

53. em uma única gestação. c) a seleção de DNA mais adaptado existente numa determinada espécie. No caso ilustrado no esquema (figura 1). Nos últimos anos. d) a introdução de DNA em genomas das células dos vegetais já formados. ( ) Se dois pares de genes aditivos determinam a cor da pele no homem. Desenvolver variedades de plantas resistentes a herbicidas ou a insetos. a Argentina e o Canadá. é necessário que uma molécula produzida por um gene regulador (x) não reprima o gene operador (1). cinco classes fenotípicas podem ser observadas na população. a) Incorporação e expressão de gene humano que codifica insulina por bactérias. na produção de hormônios para a espécie humana. ( ) Por meios biotecnológicos. A probabilidade de uma mulher (AaBb). em testes laboratoriais para a detecção de gravidez em estágios muito precoces. por exemplo. da mesma espécie ou de outra espécie no genoma da espécie em estudo.) Vegetais modificados geneticamente são considerados transgênicos. como soja. batata. Da análise das afirmativas acima podemos assegurar que: a) apenas I está correta b) apenas II está correta c) apenas I e II estão corretas d) apenas II e III estão corretas e) I. em seu material genético. para ocorrer a transcrição das enzimas codificadas nos genes 2. 3 e 4 (estruturais). sendo os principais produtores os Estados Unidos.5. acidez do solo e escassez de água.2 ( ) Certos microorganismos podem ser manipulados em laboratório para incorporarem. apresentará fenilcetonúria. preocupação de longo prazo têm os ingleses. já ocupam cerca de 40 milhões de hectares. O DNA recombinante então obtido pode ser clonado e utilizado..) têm seu código genético alterado para ficarem mais viçosos ou resistentes a herbicidas e pragas. Desenvolver variedades de plantas que produzam frutos com melhor textura e de amadurecimento lento III. Questão 1353 Escolha a alternativa que apresenta um exemplo de transgenia.. Esses alimentos (. podem ser produzidos anticorpos monoclonais. algodão. b) a incorporação de RNAm na célula zigoto das espécies. ilustrado no esquema (figura 2). II. II e III estão corretas Questão 1352 "A reforma da natureza Em termos de cardápio diário. ( ) Considerando o operon da lactose. o país vem consumindo cada vez mais alimentos geneticamente modificados. dois filhos. Desenvolver variedades de plantas resistentes a geadas. reconhecidos como altamente específicos. e essa mutação determinar a produção de enzima não-funcional. 16/06/99. tomate e muitas outras.15. que mostram os objetivos da manipulação genética das plantas cultivadas. ( ) No homem. plantas transgênicas. ter.afirmativas a seguir. p. a chamada comida GM. Se ocorrer uma mutação em um determinado loco. um de fenótipo mulato-médio e o outro de fenótipo branco. diferentes genes participam do metabolismo dos aminoácidos fenilalanina e tirosina. 305 1. a pessoa expressará uma anomalia metabólica. Tais anticorpos podem ser empregados. cada um determinando a produção de uma enzima. milho." (Adaptado da revista VEJA. I. Sua obtenção se dá com a) o cruzamento de duas espécies distintas. é de 1/16. Considere as . casada com um homem (aabb). Questão 1351 Em todo o mundo. segmentos do DNA de outro organismo. por exemplo. de 'Escherichia coli'. e) a adição de DNA exógero manipulado.

) A citação anterior mostra avanços da Engenharia Genética. (3) Os debates atuais a respeito dos transgênicos resumem-se à questão da rotulagem. ( ) Uma importante fonte natural de vitamina A são os vegetais com pigmentos amarelos. p. resultante do cruzamento de duas variedades puras distintas. tanto por parte dos cientistas como dos governantes. e) Organismo mais vigoroso. deixando os vegetarianos confusos com a perspectiva de cruzar animais com plantas. Questão 1355 Foi transferido para plantas de arroz um gene que permite a produção e o acúmulo de vitamina A no grão das plantas transgênicas. a produzir esse hormônio. cientistas desenvolvem ovelhas "auto-tosquiáveis". ("CICLO VITAL". julgue os itens a seguir. que passam. 306 . na embalagem de alimentos produzidos com técnicas da biotecnologia. plantas e animais.V .V. (08) a produção de insulina. gens de galinha são introduzidos em batatas. A seqüência correta é a) V . ( ) A vitamina A foi introduzida no núcleo das células.14. e por isso não necessitam ser testados em outras espécies de animais.F. é uma das experiências bem sucedidas da transgenia. (01) Cientistas interferem na evolução natural das espécies. alterando geneticamente animais e plantas. (4) As técnicas de melhoramento genético tradicionais. como a poliploidização. podem ser consideradas exemplos de biotecnologia aplicada à fabricação de organismos transgênicos. Questão 1354 Porcos têm sido criados transgenicamente para que seus órgãos possam ser transplantados em homens. (2) Organismos geneticamente modificados podem ser resistentes a produtos químicos como herbicidas. Assinale a(s) proposição(ões) VERDADEIRA(S) sobre a transgenia e suas implicações com relação à saúde e ao meio ambiente.V .F . com muitos genes em heterozigose.F .b) Desenvolvimento de um organismo completo a partir de uma célula somática. Questão 1356 Acerca dos organismos transgênicos.. ou agir como inseticidas. vol. antes de chegarem ao homem. Assinale verdadeira (V) ou falsa (F) nas afirmativas a seguir. por isso o grão transgênico é mais nutritivo.V. originando múltiplos alelos para um mesmo locus. 1999. d) Gene que sofreu mutações. pois atuam como enzimas. como a cenoura. b) V . e) F . à obrigatoriedade da apresentação. 4. (02) Os genes alienígenas permitem ao organismo receptor produzir substâncias que nunca produziriam em condições naturais. de informação relativa à natureza transgênica do produto. a lã cai sozinha no devido tempo. (16) Os organismos transgênicos são aqueles que recebem segmentos de DNA da mesma espécie. c) V . isto é. (1) Transgênicos são organismos produzidos com a tecnologia do DNA recombinante. (32) É fundamental o estabelecimento de limites.F. ( ) As vitaminas são necessárias em grandes quantidades. que permite a inclusão de genes de organismos de espécies diferentes no genoma de bactérias.F .F. isto é. d) F . a partir de transferência de genes humanos para bactérias. para que as manipulações genéticas não resultem em impactos ambientais irreversíveis. c) Organismo que apresenta tanto estruturas reprodutoras masculinas quanto femininas.. (04) Os alimentos transgênicos não representam nenhuma ameaça à saúde humana. incontinentimente.

T. C e G) que compõem ambos os genomas. independentemente de sua classificação. Questão 1358 O primeiro transplante de genes bem sucedido foi realizado em 1981. com a mera troca de uma letra num gene.Paulo". do gene humano para produção do hormônio de crescimento. a duplicação de um conjunto de letras qualquer ou a deleção de outro. b) o DNA injetado nos camundongos poderia passar aos seus descendentes somente se fosse incorporado às células somáticas das fêmeas dos camundongos. e) o RNAm foi incorporado ao zigoto dos embriões em formação. mas não foi incorporado aos seus genomas. JÁ PODE SER FEITO COM SALIVA" "Novo teste pode." (O GLOBO. Questão 1359 Com relação à técnica de criação de organismos geneticamente modificados (transgênicos).09. desde que as espécies sejam do mesmo reino. se as espécies forem de classes diferentes. Essa diferença consiste na(o): a) seqüência de bases nitrogenadas. Gurdon e F. pode-se deduzir que a) o DNA injetado foi incorporado apenas às hemácias dos camundongos. c) os camundongos receptores dos genes do coelho tiveram suas hemácias modificadas.H. identificar a paternidade de uma pessoa sem a necessidade de coleta de sangue. ao se reproduzirem. o caderno Mais! do jornal "Folha de S. continua-se considerando que homens e chimpanzés são espécies diferentes. d) tipo de pentose existente. ("Folha de S. c) infectados. nós e esses grandes macacos africanos somos 99% iguais. Estes ratos são considerados a) isogênicos. Questão 1360 "EXAME DE PATERNIDADE. transmitiram os genes do coelho aos seus descendentes. 01. NO BRASIL.Questão 1357 A engenharia genética permitiu a introdução. Ruddle. e) clones. e) tipo de desoxirriboses presentes. d) os camundongos transgênicos. b) transgênicos. pela análise do DNA das células. os trechos de DNA que se traduzem em alguma função. e) é válida para todas as espécies. A partir destas informações. por J. Paulo" (07. em função das informações do texto.2005) A despeito da similaridade genética. d) é válida. resultando camundongos com hemoglobina de coelho em suas hemácias. a semelhança estrutural existente entre as moléculas de DNA é tomada por base para a identificação da paternidade. Essa afirmação a) não é válida. c) número de fosfatos contidos. que apresentam características diferentes. Questão 1361 CONSÓRCIO DECIFRA GENOMA DO CHIMPANZÉ. em ratos. Esse tipo de teste é particularmente indicado para bebês e crianças pequenas. c) é válida. As diferenças no DNA de humanos e chimpanzés são de apenas 4% dos quase 3 bilhões de bases (letras químicas A. levando à produção de ratos gigantes. mas não poderiam transmitir essa característica aos seus descendentes. 20/08/98) Nesse tipo de teste.2001) afirmou: "O que torna a técnica tão atrativa e produtora de ansiedade é que qualquer gene de qualquer espécie pode ser transferido para qualquer outra espécie". para obtenção de camundongos transgênicos. Quando se olha para os genes em si .W. pode-se dizer que a maior contribuição para a diferença fenotípica entre essas espécies seja devida à 307 .10. Desse modo. desde que as espécies sejam da mesma ordem. b) aspecto da dupla hélice presente. como a síntese de proteínas -. injetando genes da hemoglobina de coelho em zigotos de camundongos. b) não é válida.isto é. d) mutantes. se as espécies forem de filos diferentes. E boa parte dessas modificações se deu de maneira trivial ao longo dos cerca de 6 milhões de anos transcorridos desde o ancestral comum de ambos.

Bill Clinton. Pelas pesquisas realizadas até hoje no Projeto Genoma Humano. d) I e III apenas. São Paulo . Questão 1362 O anúncio do seqüenciamento do genoma humano. São afirmações CORRETAS: a) I. II. Questão 1364 Pelo Projeto Genoma Humano. e) o número correto de cromossomos da espécie humana. IV e V. o consórcio público internacional Projeto Genoma Humano (PGH) e a empresa norte-americana Celera. b) compreender mecanismos que tornam uma célula imortal. é capaz de inativá-lo. Se cada gene pode ser inativado por mutação. 308 . Questão 1365 Nos últimos dez anos. e) como ocorrem a duplicação e as mutações dos nucleotídeos. c) garantir a cura de todas as patologias humanas. genitalium' sobrevive sem utilizar alguns de seus genes. foram feitas algumas afirmações. b) a expressão dos genes. empenham-se no momento em descobrir a) a interação dos genes. com o intuito de verificar se todos esses genes eram essenciais para a sobrevivência dessa espécie." "Folha Ciência". I. c) quantidade de lócus gênicos. Tony Blair. d) quais nucleotídeos servem de molde para a síntese de RNAm. III.a) seqüência de bases nitrogenadas no DNA. II. b) quantidade de DNA presente no núcleo das células desses organismos. III. inclusive permitiu o estabelecimento de comparações genômicas com o intuito de analisar quais genes são típicos de um organismo e quais foram perdidos no processo evolutivo. o primeiro ministro britânico. c) II. 1. No experimento II. V. isto é. d) descobrir novos genes com funções ainda desconhecidas. c) a seqüência exata de nucleotídeos de cada gene. Em um laboratório. c) a seqüência de aminoácidos do DNA humano.5. e) seqüência de aminoácidos das proteínas.27/6/2000.3 Sobre esse experimento. que possui apenas 470 genes. que estão sendo desenvolvidos em centros de pesquisas de vários países. a ausência de crescimento significa que o gene B é essencial. d) expressão diferenciada dos genes. a era da genética. Quando um transposon é inserido aleatoriamente dentro de um gene. e os representantes dos grupos rivais. é possível. realizou-se um experimento com a bactéria 'Mycoplasma genitalium'. d) a seqüência de aminoácidos de todas as proteínas humanas. EXCETO: a) selecionar embriões com características desejáveis. II. a humanidade viverá uma nova era. IV e V apenas. Questão 1366 "O genoma humano foi mapeado e sua seqüência estabelecida pela primeira vez na história da humanidade. A bactéria 'M. Questão 1363 Os projetos genomas. No experimento I. em 21 de junho de 2000. b) I. como eles agem. significa que os cientistas determinaram a) a seqüência de nucleotídeos dos cromossomos humanos. b) todos os tipos de proteína codificados pelos genes humanos. o seqüenciamento do DNA revolucionou a ciência e gerou novos conhecimentos sobre seres procariotos e eucariotos. o genoma mínimo essencial pode ser determinado. o crescimento demonstra que o gene A não é essencial. IV e V apenas. IV.15. anunciaram ontem o presidente norte-americano.

Leia as proposições a seguir sobre o Projeto Genoma Humano. Questão 1369 Os avanços na área da biotecnologia permitiram melhores condições de assistência à saúde humana e animal. 309 . Questão 1367 Em um acidente. possibilitando a melhor compreensão dos diferentes fenótipos. vacinas. IV . II e IV. e) a sonda de DNA. foi possível preparar. d) a hibridização de DNA. III . com exceção das hemácias. março/93) Em relação a esse projeto." ("Ciência Hoje". d) apenas I.O seqüenciamento do genoma de outras espécies. hormônios e outros insumos terapêuticos. como o das bactérias ('Xylela fastidiosa'). amostras de DNA nuclear e mitocondrial de todos os mortos. c) o DNA recombinante. Sobre este tema. a partir de fragmentos de tecidos. algumas questões de cunho ético têm sido levantadas. como a hemofilia. ( ) O mapeamento gênico de um indivíduo permite informar se ele é portador ou não de genes causadores de doenças. b) apenas II e III. todas as quebras provocadas pela radiação solar. Ao lado dos inúmeros benefícios desse projeto. cada um de um casamento diferente. ( ) O gene para produção de insulina no homem pode ser clonado em bactérias que passam a produzir este hormônio. nos cromossomos humanos. ( ) O teste de paternidade com base no DNA deve ser realizado exclusivamente em indivíduos sem doenças sangüíneas. ( ) O Projeto Genoma visa a localizar. o método de produção do hormônio do crescimento envolve diretamente a) o seqüenciamento de DNA. o procedimento que pode afetar diretamente o equilíbrio genético de populações humanas é a) a detecção de indivíduos superdotados intelectualmente por meio de procedimentos laboratoriais. Uma das formas possíveis de identificar os despojos dos filhos dessa senhora consiste em verificar se existe homologia do: a) DNA mitocondrial da senhora com o DNA mitocondrial das vítimas b) DNA mitocondrial da senhora com o DNA nuclear das vítimas c) DNA nuclear do marido e do ex-marido da senhora com o DNA mitocondrial das vítimas d) DNA mitocondrial do marido e do ex-marido da senhora com o DNA mitocondrial das vítimas e) DNA nuclear da senhora com o DNA mitocondrial das vítimas Questão 1368 Os avanços da Engenharia Genética têm permitido o conhecimento mais amplo dos cromossomos. III e IV.O seqüenciamento do genoma humano determinou a posição exata e a função de cada gene. Na fase laboratorial. embora os corpos das vítimas fatais fiquem queimados e irreconhecíveis. e) todas as proposições. Questão 1370 "A nova tecnologia do DNA recombinante está permitindo que cientistas dos países do primeiro mundo desenvolvam um projeto denominado GENOMA. é de grande auxílio para o Projeto Genoma Humano. Considerando as proposições anteriores. c) apenas I. II . Faleceram no acidente dois filhos de uma senhora. b) a clonagem de células.O seqüenciamento do genoma humano possibilitará a identificação dos genes envolvidos em doenças e a criação de novas abordagens preventivas ou de tratamentos mais rápidos e eficazes. analise os itens abaixo. dos camundongos e ratos. pode-se afirmar que estão CORRETAS a) apenas I e II. I . especialmente no que se refere à produção de antibióticos. que tem por objetivo seqüenciar os cerca de 3 bilhões de bases nitrogenadas que compõem os cromossomos de um ser humano.O genoma humano pode ser seqüenciado a partir de qualquer célula do corpo.

ou de João (primo de Pedro). Para solucionar esse impasse. permitir traçar árvores familiares confiáveis.5. irmãos adotivos. e) de o DNA mitocondrial. por ser herdado do avô paterno. através das mitocôndrias existentes no citoplasma do ovócito da mãe. garantir um registro familiar que se mantém de geração a geração. permitir identificar a filiação com segurança. A Associação Civil "Avós da Praça de Maio" tem buscado localizar essas crianças com a finalidade de restituí-las a suas famílias legítimas. por ser herdado do avô materno. Antônio. d) de o DNA mitocondrial. aproximadamente. por ser herdado da avó materna.com. nega a paternidade da criança. para se hibridizarem. A escolha desse teste está relacionada com o fato a) de o DNA mitocondrial. vendidas ou abandonadas em orfanatos. EXCETO a) Aumento da produtividade na agricultura b) Compreensão mais ampla das doenças genéticas c) Determinação da posição de proteínas nos cromossomos d) Diagnóstico precoce de doenças hereditárias Questão 1372 Na Argentina. por ser herdado da avó paterna. empregando para isso testes de identificação genética. c) de o DNA mitocondrial. pois deveríamos ter hibridizado o DNA do pai com o da mãe. e o resultado foi o seguinte. que são possíveis. pois.ar) A comparação entre os DNAs mitocondriais de possíveis netos e avós tem sido um dos testes utilizados nesses processos de identificação de parentesco. por exemplo. b) de o DNA mitocondrial. 50% dos genes são herdados da mãe e 50%. seu ex-namorado. b) A criança é filha de Pedro. c) o emprego de testes genéticos como um novo critério para admissão a empregos. (Fonte: abuelasatournet. Um deles. permitir traçar árvores familiares confiáveis. atualmente. na verdade. por ser herdado das duas avós. através das mitocôndrias existentes no citoplasma do ovócito da mãe. envolveu a bactéria causadora da "praga do amarelinho". c) A criança é filha de João. através de uma mistura dos genes do pai e da mãe. Todas as alternativas apresentam benefícios de projetos que envolvem o seqüenciamento de genomas. e) Pedro e Paulo são. permitir traçar árvores familiares confiáveis. através das mitocôndrias existentes no citoplasma do ovócito da mãe. Questão 1373 Maria teve um filho e Pedro. o seqüenciamento completo do genoma humano foi anunciado pela comunidade científica internacional. Paralelamente. pois todos os resultados foram menores que 85%. a família de Maria resolveu fazer um teste de paternidade. alegando que o filho pode ser de Paulo (irmão de Pedro). Questão 1371 Alguns projetos de seqüenciamento genômico vêm sendo desenvolvidos por pesquisadores brasileiros.15. através das mitocôndrias existentes no citoplasma do espermatozóide do pai. ou ainda de um vizinho. e) o uso de testes pró-sintomáticos para a realização de seguros de vida. durante a ditadura militar iniciada em 1976. d) O teste não foi conclusivo. que atinge plantas cítricas. Essas crianças foram adotadas. mesmo na ausência dos pais. muitas crianças foram seqüestradas com seus pais ou nasceram em centros clandestinos de detenção.3 Assinale a alternativa que interpreta corretamente os resultados do teste. 310 . 1. d) o registro de patentes de seqüências do genoma humano para especulação mercadológica. pois.b) o aumento de seleção genética ou gamética artificial. os DNAs devem ser diferentes. a) A criança não é filha de nenhum dos supostos pais. do pai.

de cada gene no DNA de células diferenciadas. é CORRETO afirmar que: (01) o referido genoma está contido nos cromossomos. Questão 1375 O que se imaginava impossível acabou acontecendo antes do prazo previsto: após a elucidação da seqüência de DNA de vários organismos. que contém cromossomos das duas espécies.são possíveis de serem encontradas nesse mapeamento. d) o gene correspondente à proteína D está no cromossomo 4.. bem como pela sua habilidade em produzir as proteínas humanas hipotéticas A. Três linhagens somáticas híbridas designadas I. C e D quando o seqüenciamento é realizado a partir de RNA mensageiro. voltou a respirar.Questão 1374 Na década de 1960.. b) o gene correspondente à proteína B está no cromossomo 3. b) Apenas II. c) Apenas I e II.5. d) Apenas II e III.). ou ausência.O genoma humano tem organização diferente da organização do genoma da bactéria 'Xyllela fastidiosa'. a Guanina e a Uracila . e) a linhagem III contém o cromossomo 8.15. (08) esse mapeamento já permitiu aos cientistas saberem a localização de todos os genes humanos. o pregão eletrônico das empresas de alta tecnologia. Georges Barsky desenvolveu a técnica de hibridização somática. I . Por isso.A expressão dos genes humanos depende da presença.3 m relação à tabela é correto afirmar que a) o gene correspondente à proteína A está no cromossomo 1. II e III. p. identifica-se mais facilmente um gene. (16) um dos resultados possíveis dessa descoberta será a cura. causadora da praga do amarelinho nos laranjais. Com relação à organização genômica. II e III foram registradas para a presença ou ausência dos cromossomos humanos 1 até 8. no ano 2000. que se constitui em um grande passo no mapeamento de genes humanos. (. recentemente seqüenciado no Brasil.. e) I. .a Adenina. a Nasdaq. foi anunciado o seqüenciamento do genoma humano. III . O oxigênio foi dado pelo anúncio de que cientistas americanos tinham chegado ao fim do rastreamento de um dos sonhos da medicina nesta virada de século: o mapeamento do genoma humano. a Citosina. Com relação a esse assunto. (02) a molécula sequenciada é o DNA. considere as seguintes afirmações. Quais estão corretas? a) Apenas I. através da terapia gênica. Depois do susto provocado no começo da semana pelos percalços jurídicos da Microsoft. Duas células de origem diferente podem se fundir em uma única célula híbrida. 123." Trecho extraído do artigo: GENOMA: O PRIMEIRO ESBOÇO DO MAPA DA VIDA. no futuro. A tabela abaixo contém uma grade hipotética de dados usados para mapear genes em seus cromossomos humanos apropriados. (04) apenas quatro bases nitrogenadas . c) o gene correspondente à proteína C está no cromossomo 6... II . de algumas doenças genéticas. B. 10/04/2000.O genoma humano contém uma grande percentagem de seqüências de DNA que não codificam genes. "A revanche veio na quinta-feira [06/4] passada. Questão 1376 1. 311 . publicado na "Revista Época"...

Questão 1379 O texto a seguir apresenta os resultados do projeto de estudo do genoma da 'Xylella fastidiosa'. b) o número de proteínas que compõem os genes humanos. em países como a Inglaterra. eles (os pesquisadores) já decifraram 75% do código genético dessa bactéria. como em casos de estupros e assassinatos. aproximadamente. O conhecimento dessa seqüência permitirá determinar a) o número de cromossomos presentes nas células humanas. representado a seguir. b) código genético por seqüência de aminoácidos. Soma ( ) Questão 1378 Em junho de 2000. o teste de DNA surge como uma das grandes descobertas do mundo ocidental. O resultado do teste. é um dos fatores que dificulta sua utilização em larga escala pelos segmentos populacionais menos favorecidos economicamente. não sendo necessário obter informações do(a) filho(a) e de sua mãe. (32) a criação de bancos de dados. atualmente. "Superinteressante". que transferiu para as mulheres o controle da fertilidade. coletam-se amostras biológicas do suposto pai.Questão 1377 A revista "Época". (04) para uma investigação de paternidade. 1999. 312 . O título referiu-se a uma reportagem da qual foi extraído o trecho a seguir: Depois da pílula anticoncepcional. (adaptado) Uma modificação que poderia ser feita nesse texto. oferecem. uma vez que podem ser entendidos como uma violação da privacidade biológica dos indivíduos. do pai e dos filhos. como pele e ossos. a partir de testes de DNA. (02) o melhor material biológico para um teste de DNA é aquele extraído de núcleos de glóbulos brancos do sangue.. em 30/07/2001. foi anunciada a conclusão da fase do Projeto Genoma Humano em que se determinou a seqüência de. e) o número total de genes humanos e quais as proteínas codificadas por esses genes. d) o número de doenças que podem afligir a humanidade. a seqüência de substâncias que constituem os cerca de 2000 genes da cadeia de DNA. e as implicações dessa prática para os indivíduos e a sociedade em geral. ainda muito elevado no Brasil. é a substituição de a) seqüência de substâncias por seqüência de nucleotídeos. 3 bilhões de nucleotídeos do genoma humano. também podem ser utilizados. com a identificação genética de criminosos e suspeitos.. (08) os exames de investigação de paternidade. resultados com exatidão total. d) cadeia de DNA por cadeia de RNA. Outros acreditam que reflexos da descoberta vão alterar o universo das relações familiares. é CORRETO afirmar que: (01) os testes de DNA podem ser empregados para finalidades de investigação de paternidade e também para identificação de supostos criminosos. c) código genético por conjunto total de proteínas. anunciou em sua capa: "O DNA não falha".] a técnica só traz benefícios. do genoma do parasita". para torná-lo mais preciso. não restando qualquer questionamento ou dúvida sobre os diagnósticos apresentados. vem gerando grande polêmica. (16) o custo do exame de DNA. 13(1):63. mas outros tecidos. a partir de testes de DNA. Para muitos especialistas [. contém padrões dessas marcas de uma determinada família. no ano de 1999.. "Trabalhando sem parar desde o final de 1997. e) seqüência de substâncias por seqüência de aminoácidos. da fertilização "in vitro" e da barriga de aluguel. Esse teste baseia-se na identificação de marcas genéticas específicas que podem ser encontradas no DNA da mãe. c) quantas moléculas de DNA estão presentes nos cromossomos humanos. métodos que permitem a gravidez sem sexo. Jan. Questão 1380 O exame de paternidade tem sido muito utilizado na medicina forense. Sobre a utilização dos testes de DNA. A idéia é descobrir. ou seja. até abril.

Questão 1383 Nos exames para teste de paternidade. Em setembro de 1997. será possível conhecer a seqüência de aminoácidos da proteína correspondente. por exemplo. pelo qual se pretende seqüenciar totalmente o DNA humano. o principal componente do sangue. nos últimos 2 anos chegaram ao fim vários seqüenciamentos do genoma de bactérias. julgue os itens a seguir. dos leucócitos e do plasma. d) dos leucócitos.288. principais células de defesa do sangue.3 Com o auxílio do texto. a partir de 313 om base neste resultado. sendo apenas um passo no conhecimento de nosso genoma. assinale a alternativa INCORRETA: a) I é filho biológico do casal. c) das hemácias. Questão 1384 O mapeamento de toda a seqüência de nucleotídeos existente nos 23 pares de cromossomos humanos a) é o que ainda falta fazer após a conclusão do projeto Genoma Humano em 2003. (1) As seqüências obtidas corresponderão exatamente ao DNA de qualquer pessoa. A esse respeito. julgue os itens que se seguem. (3) O projeto GENOMA tem levantado questões éticas. 1. comparando-se a seqüência de DNA de diferentes espécies. Para surpresa de muitos. e) significa decifrar o código genético. Questão 1382 Enquanto o projeto que visa seqüenciar completamente o genoma humano segue seu curso. (3) Pode-se fazer estudos da evolução das bactérias. o DNA. pelo eventual uso inadequado que se possa fazer do conhecimento obtido. mas não do plasma. foi publicada a seqüência do DNA da bactéria 'Escherichia coli. (1) O DNA da bactéria 'Escherichia coli' tem cerca de 9. e) dos leucócitos e das globulinas. é obtido a) das hemácias e dos leucócitos. obter a seqüência de bases nitrogenadas do DNA de todos os cromossomos de uma pessoa. (2) Para 38% dos genes. não se sabe a seqüência de amionoácidos da proteína. ou seja. b) das hemácias. c) V não pode ser filho biológico deste casal. (4) Todos os genes terão a mesma proporção de adenina e guanina. d) IV pode ser filho adotivo do casal.impressionam: são cerca de 4. a discriminação de pessoas. Questão 1385 Uma loja de animais mantinha para venda 4 exemplares de 'Ara ararauna' (arara azul-e-amarela) e alegava aos fiscais que os exemplares haviam nascido em cativeiro.2 milhões de moléculas de fosfato. c) é o que nos permitiria conhecer qual a real proporção de proteínas em relação às moléculas de DNA que possuímos. e) III é irmão biológico de I. (4) A 'Escherichia coli' pode produzir 8. (0) Uma vez obtida a seqüência de um gene.' Os números . b) é a condição necessária para se saber o número de moléculas de RNA existentes em nosso organismo. d) é o que foi conseguido pelos pesquisadores há alguns anos.5.6 milhões de pares de bases. (2) A seqüência de todos os cromossomos será do mesmo tamanho. Questão 1381 Está em andamento o projeto GENOMA.576 RNAs mensageiros diferentes. que só foi descoberto depois da conclusão do projeto Genoma Humano em 2003. e os genes que codificam proteínas são 4. b) II não é filho deste pai.15. 38% desses genes ainda não têm uma função conhecida. quando extraído do sangue. mas não das hemácias. como.

como a diabetes. que serão manipuladas.5. c) atuam como agentes de ligação entre DNA viral e . que podem ser visualizadas por tratamentos específicos (coloração. b) inibir a síntese de RNA a partir de DNA. O DNA foi extraído das células por processos químicos. Sobre essas enzimas é INCORRETO afirmar que: a) reconhecem seqüências específicas de bases nitrogenadas.um casal mantido em um criatório autorizado pelo IBAMA. Questão 1387 Enzimas de restrição são fundamentais à Engenharia Genética porque permitem a) a passagem de DNA através da membrana celular. b) inserindo cópias extras do alelo mutado. Questão 1388 Por sua capacidade de cortar o DNA em pontos específicos. colocado sobre um gel suporte e submetido à corrente elétrica. O padrão de bandas é exclusivo de cada indivíduo. d) apenas os exemplares 1 e 4. Questão 1386 As enzimas de restrição são as principais ferramentas bioquímicas empregadas em Engenharia Genética. Essa técnica tem por objetivo "corrigir o efeito da mutação" a) induzindo mutações nos genes responsáveis pela doença. Para esclarecer a questão. testes de laboratório utilizando a melatonina indicaram bons resultados para controlar o mal de Alzheimer. c) inibir a síntese de DNA a partir de RNA. ou "impressão digital de DNA". d) são utilizadas nos atuais testes de DNA. e) fazendo-se uso delas. a) os 4 exemplares. cortando o DNA em locais determinados. b) não existem em seres vivos. no futuro. originando fragmentos dessa molécula. o uso da terapia gênica. b) apenas os exemplares machos. por exemplo). Questão 1389 Duas doenças não infecciosas que preocupam o homem moderno são a diabetes e o mal de Alzheimer. por exemplo. Contudo. colheu-se uma amostra de sangue de cada um dos animais e fez-se um teste para determinação de paternidade pelo método do DNA-Fingerprint. Com relação a essas substâncias é correto afirmar que a) são altamente específicas. e) modificar seqüências de bases do DNA. A migração diferencial dos fragmentos forma bandas (faixas) de DNA no gel. d) permitem somente a ligação de pedaços de DNA de um mesmo tipo celular. e) apenas os exemplares 2 e 3. A identificação de genes responsáveis por diversas doenças. deixando somente as bases nitrogenadas. são utilizadas enzimas de restrição na engenharia genética. mantido pelo criador. b) removem os fosfatos e as pentoses. fragmentado com enzimas específicas. A ilustração apresenta o resultado do teste bacteriano.15. d) cortar DNA onde ocorrem seqüências específicas de bases. Enquanto a cura de diabetes está sendo pesquisada através da engenharia genética. Fragmentos menores migram mais rapidamente em direção a um dos pólos da corrente.4 Os resultados obtidos indicam que podem ser filhos do casal. pode possibilitar. raios X. pode-se isolar um único gene de um cromossomo. c) cada uma pode originar fragmentos de DNA com tamanhos diferentes. 314 1. c) apenas os exemplares fêmeas. os fiscais do IBAMA suspeitaram se esses exemplares teriam nascido em cativeiro ou se teriam sido capturados na natureza. sendo exclusivamente produtos da indústria química. e) impedem a clonagem de moléculas de DNA recombinante.

em bactérias. d) Terapia gênica de algumas doenças hereditárias. EXCETO a) Investigação de paternidade e criminalística. Questão 1393 A tecnologia do DNA recombinante permitiu a inserção e a expressão. Sobre a produção de organismos geneticamente modificados. e) Fragmentos de genes exógenos são inseridos no genoma das células hospedeiras por meio de plastídeos nucleares. e) auxiliar no processo de tradução do DNA. é correto afirmar: a) Fragmentos de DNA exógeno são inseridos no genoma de células hospedeiras por meio de plasmídeos. EXCETO a) Produção de parasitas das pragas b) Extração de inseticidas naturais c) Criação de comensais das pragas d) Produção de machos estéreis das pragas Questão 1395 Analise a figura a seguir. EXCETO a) Independência de pâncreas de animais para produção de insulina b) Obtenção de uma nova espécie de bactéria produtora de insulina humana c) Possibilidade de expressão em bactérias de outros genes de interesse médico d) Possibilidade de tratamento para pacientes com intolerância à insulina animal Questão 1394 Para minimizar o uso de inseticidas sintéticos na fruticultura e atender às normas de segurança alimentar da FAO ("Food and Agriculture Organization").c) substituindo o alelo mutado ou adicionando uma cópia correta do alelo. que representa um determinado experimento. b) reparar o DNA bacteriano que sofreu mutação deletéria. que são administrados a pacientes de todo o planeta. d) produzindo proteínas funcionais em organismos de outra espécie. d) O DNA endógeno é transferido para genomas hospedeiros por meio de plasmídeos mitocondriais. 1. em bactérias. estão sendo implantadas "biofábricas" de controle de pragas no Nordeste do Brasil. Todas as alternativas apresentam resultados esperados do êxito dessa técnica. b) O genoma exógeno é inserido no núcleo hospedeiro por meio de vetores protéicos conhecidos como plasmídeos. d) auxiliar no processo de transcrição do mRNA. de proteínas humanas de interesse médico. provavelmente: a) proteger as bactérias contra os vírus bacteriófagos. e) inibindo a expressão do gene mutado nas células secretoras da proteína. Os conhecimentos da área são aplicados com sucesso na produção industrial da insulina e do hormônio de crescimento. que têm a propriedade de cortar o DNA em pontos específicos. Questão 1392 Todas as alternativas apresentam aplicações da tecnologia do DNA recombinante nas duas últimas décadas. Questão 1390 A biotecnologia tornou possível a transferência de material genético entre os mais diversos organismos.5 315 . c) auxiliar no processo de duplicação do DNA. Questão 1391 As principais ferramentas empregadas na tecnologia do DNA recombinante são as enzimas de restrição.15. Essas "biofábricas" podem adotar todas as seguintes tecnologias. do gene humano responsável pela síntese da insulina. c) Produção. c) O DNA gênico endógeno é inserido no núcleo de células hospedeiras por meio de plastídeos funcionais. O papel biológico dessas enzimas bacterianas na natureza é. b) Recuperação de espécies extintas.5.

e) enzima de restrição. e) As enzimas de restrição quebram o DNA. b) hibridação intraespecífica. com genes de interesse.) Produção de DNA recombinante (plasmídio de uma bactéria/ gene do vaga-lume) 2) Introdução do DNA em célula de tabaco 3) Multiplicação da célula de tabaco com o gene do vaga-lume 4) Desenvolvimento de uma planta de tabaco com o gene do vaga-lume (planta que fluoresce) O experimento ilustrado é: a) produção de transgênicos. cromossomo circular e enzima de restrição.5 a) enzima de restrição. c) A utilização das enzimas de restrição permite separar moléculas de DNA de acordo com seu tamanho e carga elétrica. c) DNA recombinante. como a transcriptase reversa. Preocupado com os conteúdos da disciplina de Biologia. Os números 1. Com relação a esse tema. Cada colega lembrou um aspecto das aulas. RNA plasmidial e enzima transcriptase reversa.5. respectivamente: 1. b) enzima transcriptase reversa. Questão 1399 Pedro estava doente e perdeu uma semana de aulas. ( ) se duas diferentes moléculas de DNA forem cortadas por uma mesma enzima de restrição serão produzidos iguais conjuntos de fragmentos. d) enzima transcriptase reversa. já possibilitou a obtenção de resultados benéficos para a medicina e para outras áreas do conhecimento.15. e) amniocentese. conhecidas como enzimas de restrição. diferentes etapas são cumpridas em laboratório. d) eletroforese. ( ) são obtidos segmentos de DNA. principalmente a manipulação de bactérias. 2 e 3 indicam. d) A utilização de enzimas de restrição permite cortar o DNA nos locais onde reconhecem o ácido fosfórico. a extração e o rompimento de (2). a) As enzimas de restrição cortam o DNA apenas nos locais onde existem certas seqüências de bases nitrogenadas. soube pelos colegas que o assunto trabalhado fora Biotecnologia. Assinale a alternativa que apresenta. a forma de atuação dessas enzimas. Questão 1398 O Projeto genoma humano tem como objetivo determinar a seqüência de bases de todos os genes de nossa espécie. b) As enzimas de restrição cortam o DNA nos locais onde reconhecem o açúcar desoxirribose. entre as quais: a utilização de enzima do tipo (1). Questão 1397 Para um pesquisador transferir um gene de interesse. plasmídio e enzima de restrição. dispersas no citoplasma bacteriano e que têm replicação independente do cromossomo. ( ) a tecnologia do DNA recombinante (ou Engenharia Genética) fundamenta-se na fusão de "trechos" de DNA de diferentes organismos para a construção de DNA híbrido. corretamente. ( ) promove-se o corte de moléculas de DNA com o uso de enzimas que reconhecem seqüências nucleotídicas específicas no DNA. é verdadeiro afirmar que: ( ) são utilizadas pequenas porções circulares de DNA. separando-o sempre em nucleotídeos individuais. c) aconselhamento genético. Isto pode ser feito graças ao instrumental bioquímico da engenharia genética disponível nos dias de hoje. RNA plasmidial e enzima exonuclease. para o corte e a separação do segmento de DNA a ser estudado. Questão 1396 A manipulação genética de microorganismos. 316 . plasmídio e enzima ligase. como as enzimas bacterianas. através de cortes com exonucleases. e a inclusão em (2) do segmento obtido (gene isolado) com o auxílio de enzimas do tipo (3).

em 1988.anemia b) insulina ... uma das quatro empresas em todo o mundo e a única no hemisfério sul a deter a tecnologia de produção desta insulina.. Laura e Rafael.. a) DNA recombinante. que. plasmídio e transgene.15... reduzida.. Indivíduos submetidos a hemodiálises são injetados com essa proteína e apresentam sua . jan/99. plasmídeos são utilizados como vetores para a clonagem de genes.. d) apenas as afirmações de Rafael e Joana.. a) eritropoietina .coagulação d) fator VIII . Questão 1400 Assinale a alternativa que preenche corretamente as lacunas do parágrafo a seguir. Pedro conversou com a professora e constatou que estavam corretas a) apenas as afirmações de Eduardo. c) DNA. Os rins produzem esse hormônio. . 1.. em um plasmídio de bactéria.. na ordem em que aparecem.5. DNA recombinante. vetor.. Questão 1402 CHEGA AO MERCADO UM NOVO FÁRMACO INTEIRAMENTE DESENVOLVIDO NO PAÍS A insulina humana recombinante (IH-r).. vetor e plasmídio. estimula a divisão de células-tronco. Entre os importantes avanços conquistados pela tecnologia do DNA recombinante. o interferon e a calcitonina. está prestes a chegar ao mercado com o nome de Biohulin: a empresa BIOBRÁS.RAFAEL definiu proteoma como o conjunto de proteínas expressas pelo genoma.. deu início aos trabalhos... p.. plasmídio.leucocitose e) hormônio de crescimento . Uma parceria entre a BIOBRÁS e a Universidade de Brasília (UnB). clone e vetor. respectivamente. c) apenas as afirmações de Eduardo e Joana. b) apenas as afirmações de Mariana. . Com o auxílio do texto. para fins terapêuticos. Informe PADCT/Ministério da Ciência e Tecnologia. Ao voltar à escola. vetor. .. está a produção de .EDUARDO lembrou que a identidade genética individual pode ser estabelecida pela técnica DNA 'fingerprint'... . Esta conquista tecnológica permitirá o desenvolvimento de outros medicamentos.diabetes c) plasmina .. e) as afirmações de todos os colegas.7(com adaptações).. inicia em 1999 a comercialização do produto.... julgue os itens abaixo. os números 1.. d) DNA transgênico.. b) DNA recombinante. (1) As técnicas de engenharia genética permitem a 317 .5 om relação ao processo de clonagem gênica esquematizado acima. ou impressão digital genética. . que utiliza DNA codificante..Segundo LAURA. como o hormônio de crescimento. atuando sobre a medula óssea vermelha.De acordo com MARIANA. as enzimas de restrição são aquelas que podem cortar o DNA em pontos determinados. Ao grupo da UnB coube a parte de Biologia Molecular.esterilidade Questão 1401 A figura a seguir representa de forma esquemática o processo de clonagem de genes do "Mycobacterium tuberculosis". desenvolvendo clones de bactérias produtoras de insulina.. 2. DNA recombinante e organismo transgênico.JOANA relatou que vacinas genéticas são usadas para inocular nas pessoas microorganismos vivos transgênicos ou atenuados. Mariana e Laura. 3 e 4 representam. um dos mais significativos produtos do avanço científico nacional na área da engenharia genética.

htm) Enquanto as demais células do organismo só podem fazer parte de um tecido específico.com. eliminando as possibilidades de rejeição imunológica. Por essa razão seu uso para a cura de doenças é bastante promissor. Questão 1406 Observe o esquema.estadao. a "célula-tronco" tem a capacidade especial de se diferenciar e constituir diferentes tecidos no organismo. prática que.recombinação de genes entre organismos totalmente diferentes. cromossomicamente e geneticamente. d) o padrão de atividade dos genes. c) No Brasil não há permissão para o desenvolvimento de pesquisas com célula-tronco. portanto.6 318 .5. o "autotransplante". Por reprodução ela gera células. a) As células-filhas geradas por ela são cromossomicamente e geneticamente diferentes da célula-mãe originando. 1. (3) O Biohulin será um medicamento destinado ao tratamento de diabéticos. Questão 1405 Segundo a doutora Mayana Zats (USP) um estudo recente com células-tronco retiradas da medula e injetadas no coração da própria pessoa. e) a estrutura de genes específicos por mutações. Assinale a alternativa que aponta uma limitação do uso de célula-tronco para "possível e futura" cura de doenças genéticas. b) eliminarem os genes causadores da doença no tecido hospedeiro.br/educando/noticias/2004/mai/10/ 69. d) fundirem-se com o tecido hospedeiro. idênticas a si mesma. que mostra a diferenciação de células-tronco humanas nos elementos figurados indicados. ela deve receber altas doses dessa proteína. d) A célula-tronco só pode ser obtida por clonagem terapêutica. Questão 1404 Células-tronco são células indiferenciadas que têm a capacidade de se diferenciar em diversos tipos celulares. (adaptado de http://www. e) sofrerem diferenciação que as torna parte integrante e funcional do tecido hospedeiro. e) O Brasil não tem cientistas especializados para a realização desse tipo de pesquisa. tecidos diferentes daquele que se deseja. b) As células-filhas geradas são cromossomicamente e geneticamente iguais à célula-mãe inclusive no caso de haver gene "defeituoso". c) a quantidade de genes mitocondriais. b) a quantidade de genes nucleares. (2) Para que uma bactéria passe a produzir insulina humana. qualquer que seja a sua origem. segundo a Comissão Técnica Nacional de Biotecnologia (CTNBio).15. Questão 1403 A expectativa em torno da utilização das células-tronco decorre do fato de estas células a) incorporarem o genoma do tecido hospedeiro. a não ser nas doenças genéticas. c) alterarem a constituição genética do tecido hospedeiro. sugere uma melhora aparente do quadro clínico em pacientes com insuficiência cardíaca. (4) A partir da insulina produzida por bactérias. provoca mutações e malformações. Para que ocorra tal diferenciação. as células-tronco terão necessariamente que alterar a) o número de cromossomos. pode ser obtido o hormônio de crescimento.

I. II.Assinale a afirmativa INCORRETA. e III e) II. d) Na medula óssea de um adulto. b) todos os seus genes estão desligados. A alternativa que contém todas as afirmativas corretas é: a) I e II b) I e IV c) III e IV d) I. Questão 1409 Alguns tecidos do organismo humano adulto se regeneram constantemente por meio de um processo complexo e finamente regulado. c) Células-tronco podem ser encontradas em embriões. também. de embriões em sua fase 319 . que tem suas células destruídas e renovadas constantemente. à medida que se diferenciam. Existe um aumento gradual da capacidade de auto-renovação das células durante este processo. IV. A hematopoese resulta da diferenciação e da proliferação simultânea de células tronco que. II. assinale a afirmativa INCORRETA. Baseado nas informações anteriores e nos conhecimentos sobre o tema. III. em cordões umbilicais e também em diversos tecidos no indivíduo adulto. As células tronco têm grande poder de regeneração porque: a) têm todos os seus genes funcionando. Isso acontece com a pele. Células tronco hematopoéticas apresentam potencial para diferenciar-se em qualquer célula do sangue e também gerar outras células tronco. c) têm algo grau de especialização. a) Células-tronco são células capazes de se diferenciar dando origem a diversos tipos de células.15. d) Apenas 2 das células diferenciadas apresentam núcleo. b) A capacidade de diferenciação das células precursoras se deve à alteração na expressão gênica específica. com os epitélios intestinais e especialmente com o sangue.5. c) Plaquetas e hemáceas não apresentam capacidade de proliferação mitótica. Ele deseja descobrir maneiras de manipular os genes para obter melhores resultados terapêuticos ou estimular a formação artificial de tecidos. puderam formar tecido normal quando implantadas na região lesada do coração. como mostra o esquema a seguir: 1. a) A célula-tronco é pluripotente com capacidade de se diferenciar em diversos tipos celulares. Fonte: "O Estado de São Paulo".6 Um jovem biólogo de São Paulo descobriu porque as células-tronco do cordão umbilical são mais eficientes em transplantes do que as da medula óssea. 14/02/2006 Sobre esse assunto. existem células-tronco capazes de dar origem a células diferenciadas de todos os tecidos humanos. vão reduzindo sua potencialidade. considere as afirmativas a seguir. III. portador de lesão no miocárdio. e) não se reproduzem com facilidade. Ele encontrou um grupo de genes que seguem um mesmo mecanismo e são mais ativos em células do cordão. b) Pelo menos 3 tipos de células diferenciadas no esquema dado são encontradas no sangue. IV Questão 1410 Experimentos recentes indicam que células-tronco retiradas da medula óssea de um indivíduo adulto. As células-tronco podem ser retiradas. Questão 1408 A pesquisa com células tronco tem-se tornado de grande importância para recuperação de órgãos lesionados que não têm capacidade de regeneração de suas células. Questão 1407 BIÓLOGO MAPEIA GENES DO CORDÃO UMBILICAL. As diferentes linhagens hematopoéticas geradas no sistema apresentam altas taxas de proliferação. d) são pouco especializadas.

posteriormente estimulado para que se dividisse e virasse um embrião dentro da mãe adotiva.embrionária d) embrionária .A clonagem de células-tronco embrionárias pode ser utilizada com fins terapêuticos ou reprodutivos. como habitualmente.inicial de desenvolvimento. c) III. A origem do problema estava na produção de glóbulos vermelhos pela medula espinhal.) A partir do texto e do que se conhece sobre clonagem. é possível obter um outro clone que seja fêmea. respectivamente. d) Apenas II e III. c) Apenas I e II.As células-tronco retêm o potencial de dar origem a células-filhas mais especializadas.embrionária Questão 1411 Em março de 2005.15. e) I. que autoriza a pesquisa com células-tronco obtidas a partir de embriões humanos remanescentes de tratamentos de infertilidade armazenados por pelo menos três anos. casos incomuns de anemia começaram a chamar a atenção dos pesquisadores. Os cientistas tiraram material genético da célula e o colocaram em um óvulo esvaziado do seu núcleo. A tabela a seguir informa as características de algumas variáveis analisadas em células-tronco embrionárias e adultas. estão corretas: a) I. 03. A origem do problema estava na produção de glóbulos vermelhos a partir de células-tronco da medula óssea. apenas. A origem do problema estava relacionada à degeneração do baço. II e III. b) Apenas II. aquelas possíveis de serem aceitas pela comunidade científica. b) usando o mesmo pai genético. II. da raça Labrador. foi promulgada a Lei de Biossegurança.uma célula-tronco deve ter o poder de se renovar indefinidamente pela divisão celular.embrionária . apenas. isto é. podemos afirmar corretamente que: a) é possível obter células-tronco embrionárias usando-se células diferenciadas de um adulto. apenas. eram os idosos que apresentavam uma expressiva redução na taxa de hemoglobina. utilizando uma célula obtida da orelha do pai genético. é : a) embrionária . II e III. que nesses idosos deixou de produzir glóbulos vermelhos. e) I. O animal clonado. II . III. Questão 1412 Há vinte anos. c) o clone gerado terá o genótipo Afgham e o fenótipo Labrador e será do sexo masculino. Considerando hipóteses plausíveis.adulta . recebeu o nome de Snuppy . . III . II e III.2005. e nasceu 60 dias após.adulta . da raça Afgham.adulta b) adulta .08. Paulo". I.6 Considerando o uso terapêutico das células-tronco. 320 1. Questão 1413 Cientistas sul-coreanos clonam pela primeira vez um cachorro.5. ("Folha de S. considere as seguintes afirmações. a alternativa que indica o tipo de célula que possui a característica mais vantajosa para as variáveis I. Mais intrigante: a anemia dos idosos não cedia ao tratamento convencional.embrionária . Ao invés de adultos jovens.adulta c) embrionária . Sobre essas células. apenas. Quais estão corretas? a) Apenas I. d) I e II. Analise as hipóteses apresentadas pelos cientistas para tentar explicar esses casos incomuns. b) II. I .

4 . a) PP e pp b) Pp e Pp c) Pp e PPP d) Pp e PPp e) PP e Ppp Questão 1418 Os meios de comunicação têm noticiado. usados como fonte na síntese 321 . d) Lavar. Com base no texto e nos conhecimentos sobre o tema. Os órgãos envolvidos com a saúde pública têm mostrado preocupação constante com a dieta do povo brasileiro. Com relação à surucucu. Recentemente. 2 . carboidratos. A ingestão de proteínas é importante. e com água limpa. freqüentemente. muito bem. pesquisadores brasileiros da FIOCRUZ foram pioneiros em utilizar células-tronco da medula óssea de um paciente que apresentava insuficiência cardíaca devido a uma doença parasitária.O princípio ativo do seu veneno provoca intensa dor no local da inoculação. A doença parasitária a que esse texto se refere é a a) amebíase. II.Pertence ao gênero Crotalus e seu veneno tem ação neurotóxica e homolítica. gorduras. I. d) doença de Chagas. como proteínas. 3 . podendo haver gangrena. b) malária. As sementes resultantes devem apresentar embrião e endosperma. Questão 1414 A cólera é uma doença infecciosa causada por uma bactéria descoberta em 1884. respectivamente. frutas. e) febre amarela. que posteriormente recebeu o nome de 'Vibrio cholerae'. causando desidratação. legumes e verduras antes de comê-los. 2 e 4 c) 3 e 4 d) 1 e 4 e) 2. a) Beber somente água filtrada ou fervida. especialmente no caso de se utilizar torniquetes. c) Tomar vacina tríplice periodicamente. assinale aquela que NÃO é medida de prevenção desta doença. Essa bactéria ataca o intestino humano fazendo com que o organismo elimine grande quantidade de água e sais minerais. principalmente verduras e peixes. as lesões coronarianas reduziram-se a um nível mínimo. bife e salada" está sendo substituído por comidas industrializadas e com alto teor calórico. considere as afirmativas a seguir. pois o tradicional prato de "feijão. pois elas serão degradadas em aminoácidos. Questão 1415 Células-tronco vêm sendo utilizadas com sucesso para amenizar os sintomas de pacientes com insuficiência cardíaca devida a infarto do miocárdio. e) o ambiente celular do Labrador alterou a expressão genotípica do núcleo transplantado. que o Brasil está se tornando um país de obesos. arroz. Questão 1416 Um sério risco a que está exposto o trabalhador rural em nosso país é o de acidentes com animais peçonhentos. b) Lavar as mãos com sabão antes das refeições e ao deixar o sanitário. Estima-se que o consumo de feijão e de arroz caiu em torno de 30% nos últimos anos. Dentre estes um dos mais temíveis e agressivos do gênero é a cobra surucucu. e) Evitar comer alimentos crus. Com o tratamento.Pertence ao gênero Bothrops e seu veneno tem potente ação neurotóxica e coagulante. c) doença do sono. 3 e 4 Questão 1417 Uma planta feminina de angiosperma com genótipo PP foi cruzada com uma masculina pp. O prato tradicionalmente consumido pelo brasileiro apresenta elementos essenciais ao metabolismo.d) o núcleo do óvulo inserido em uma célula de orelha anucleada origina uma fêmea Labrador. Dentre as alternativas a seguir. considere as proposições: 1 .Seu veneno tem ação proteolítica e coagulante e o antiofídico específico é o soro antibotrópico. As proposições que estão corretas são as indicadas por: a) 2 e 3 b) 1. vitaminas e sais minerais.

um paciente teve que se submeter a uma cirurgia que removeu uma parte do seu corpo. o acidentado deve ser imobilizado na horizontal e utilizar um colar cervical para ser transportado até um hospital. c) infecciosa. d) podem dar origem a linfócitos T que. d) I. pois essas moléculas preservam. c) II e IV. II .Após um acidente como o ocorrido com Reeve. porque no interior da coluna vertebral está a medula óssea vermelha. boa parte da energia gasta para a sua síntese. razão pela qual questiona-se o consumo de alimentos transgênicos. Reeve. c) secretam substâncias que inibem o crescimento celular. c) II e III são corretas. na forma de energia química. e) podem dar origem a todos os diferentes tipos de células sangüíneas. apenas no sistema nervoso central. que causa problemas de coagulação sanguínea. Estão corretas apenas as afirmativas: a) I e III. Questão 1421 Em outubro de 2004 faleceu o ator cinematográfico Christopher Reeve. que ficou famoso por interpretar o "Super-Homem". b) o diafragma. Os carboidratos e lipídios da dieta são fonte importante de energia para os organismos. e) II. Questão 1422 A hemofilia se caracteriza por ser uma doença: a) adquirida. Marque a alternativa correta. Questão 1420 O tratamento da leucemia por meio dos transplantes de medula óssea tem por princípio a transferência de células-tronco da medula de um indivíduo sadio para o indivíduo afetado. d) o pâncreas. analise as afirmativas a seguir. e) contagiosa.das proteínas codificadas pelo organismo. Com relação ao assunto abordado. que causa problemas de coagulação sanguínea. A parte retirada era a) o fígado.A utilização do colar cervical não evita lesões no sistema nervoso periférico. por sua vez. d) congênita. causada por um vírus e transmitida por mosquitos. O sistema nervoso periférico poderá ficar inativo. d) Apenas III e correta. se houver comprometimento no sistema nervoso central. b) hereditária. I . II e III. e) o baço. 322 . se houver suspeita de lesão na coluna vertebral. de onde são retiradas células da massa celular interna (células tronco) que têm capacidade de regenerar órgãos lesados. III e IV. IV. era um ativista a favor das pesquisas com clonagem terapêutica para obtenção de células tronco. c) a hipófise. b) I e III são corretas. cujo sintoma é o excesso de açúcar no sangue e a falta de insulina. já que foram diferenciadas em outra pessoa.A clonagem terapêutica por transferência nuclear permite a obtenção de blastocistos. Tal procedimento fundamenta-se no fato de que essas células-tronco a) podem ser usadas para a clonagem de células sadias do paciente. Recuperou-se e passou a viver normalmente. após um acidente. ingerem os leucócitos em excesso. b) não serão afetadas pela doença. Os ácidos nucléicos ingeridos são incorporados ao DNA do organismo. cuja lesão pode levar à paralisia. III. a) I e II são corretas. Questão 1419 Após um traumatismo. III . que ficou tetraplégico em 1995 ao cair de um cavalo. que causa má formação dos ossos. b) I e IV.

d) Os glóbulos brancos que saem dos capilares podem realizar fagocitose. Nesse sentido. pode apresentar um quadro inflamatório. e) capacidade de reprodução e hereditariedade. especula-se sobre os mecanismos envolvidos na determinação do sexo dos humanos. um modo como essas células do sangue podem realizar seu papel de defesa. quando ocorre a fusão dos núcleos masculino e feminino. ( ) O exame de urina da mãe é uma técnica usada na identificação do sexo do futuro bebê. A partir dos estudos sobre herança mendeliana. Acreditava-se que o sexo do embrião era definido por fatores como a nutrição materna. como ocorre na China. que apresenta os cromossomos sexuais X e Y no núcleo de suas células germinativas. identificando a presença do cromossomo sexual por meio da análise do citoplasma. porque detecta as células fetais existentes no líquido amniótico e na placenta. de forma esquemática. Com base nos conhecimentos sobre o tema. é correto afirmar: a) O sexo genético é determinado na fecundação. a de defesa contra microrganismos é realmente notável. d) consumo de energia e renovação contínua da matéria.11 ssinale a afirmativa INCORRETA. pois envolve um grupo de células especializadas. a) Os neutrófilos são glóbulos brancos capazes de atravessar as paredes dos capilares sangüíneos. c) manutenção da homeostase e alto nível de individualidade. invadido por células sangüíneas e bactérias. estes são distribuídos entre os espermatozóides. b) A destruição de bactérias que invadem o tecido conjuntivo depende de moléculas enzimáticas produzidas pelos glóbulos vermelhos. b) elevado grau de organização e execução das funções vitais. . divisão celular e comportamento dos cromossomos na meiose. analise as afirmativas adiante: ( ) A opção por indivíduos do sexo masculino pode ser justificada por sua menor suscetibilidade a doenças genéticas e por apresentarem um par de genes localizados nos cromossomos X e Y.Questão 1423 O sangue pode realizar várias funções no nosso corpo. c) O tecido conjuntivo. comprovou-se que a determinação do sexo decorre de uma constituição cromossômica específica.10. após a meiose. A figura a seguir mostra. ( ) A tentativa de aborto por meio da ingestão de poções 323 1. ( ) Na espécie humana o sexo da prole é determinado pelo pai. Dentre elas. processo que engloba bactérias invasoras. b) Os cromossomos autossômicos são os responsáveis pela determinação do sexo genético do indivíduo. d) O embrião XX desenvolverá testículos e o embrião XY desenvolverá ovários. duas dessas características assumem maior importância para a preservação da vida no planeta. São elas: a) composição química complexa e estado coloidal. Questão 1426 Atualmente muitos casais têm-se interessado em escolher o sexo do futuro filho. Questão 1425 Desde a época de Aristóteles. Essa escolha é importante para estes casais uma vez que a constatação de um feto do sexo feminino pode provocar a decisão de um aborto não-natural. onde os pais muitas vezes optam pelo nascimento de um único filho do sexo masculino. e) O sexo genético é determinado pelo número de cromossomos X presentes no embrião. c) A probabilidade de o genitor masculino produzir gametas do tipo Y é maior que a do tipo X. que determinam uma maior longevidade para o indivíduo. Questão 1424 Embora a continuidade da vida na Terra dependa substancialmente de todo o elenco de características que definem os sistemas viventes.

julho de 2003. Panek. Um suco de uva transforma-se em vinho e um repelente mingau de cevada e centeio torna-se uísque ou cerveja. no 195. 324 . (Adaptado de Anita D.33. Isto só é possível graças à tecnologia a) de clonagem de organismos. mas promover a má-formação do corpo do bebê e comprometer a saúde da mãe. v. como contra a hepatite B. na fabricação tanto de pães quanto de vinhos.vegetais ou de outras drogas abortivas pode não eliminar o feto. As leveduras mais usadas hoje. Esta vacina consiste do antígeno de superfície do vírus da hepatite B produzido em células de levedura. e) do RNA in vitro. Questão 1427 A levedação do pão e a fermentação alcoólica são as primeiras tecnologias de que se têm notícia. Em todos esses casos o 'trabalho' é feito por uma levedura (um tipo de fungo). em um processo usado há milênios pela humanidade para obter alimento e prazer. p. b) de células-tronco. Ciência Hoje. d) do teste do DNA.62) Atualmente as leveduras têm sido usadas para produzir vacinas. c) do DNA recombinante. são as do gênero 'Saccharomyces'.

You're Reading a Free Preview

Descarregar
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->