Você está na página 1de 112



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

Gentica e evoluo Lista 1

1. (Ufrj 2001) Dois 'loci' de uma populao, cada um com dois gens alelos, sofrem a ao da seleo natural por muitas geraes, como mostrado nas tabelas abaixo. O coeficiente de seleo (S) indica os valores com que a seleo natural atua contra o gentipo. O valor adaptativo (W) representa os valores com que a seleo natural favorece o gentipo. Note que (W+S)=1.

Analise os dois heredogramas anteriores, considerando que o carter determinado por um nico par de genes, e responda s seguintes questes:

Qual dos gens, A ou B, apresentar a maior freqncia na populao? Explique.

a) Qual o padro de herana envolvido na determinao da caracterstica representada no heredograma 1 e no heredograma 2? Justifique sua resposta.

2. (Fuvest 95) Um homem afetado por uma doena gentica muito rara, de herana dominante, casa-se com uma mulher, no consangnea. Imagine que o casal tenha doze descendentes, seis filhos e seis filhas. Responda, justificando sua resposta, qual ser a proporo esperada de filhas e filhos afetados pela doena do pai no caso do gene em questo estar localizado. a) em um autossomo; b) no cromossomo X. 3. (Ufes 2001) Nos Estados Unidos, um grupo de cientistas do "Genetics & IVF Institute" vem testando um novo mtodo que permite a seleo dos espermatozides a partir de sua colorao, de acordo com a presena ou ausncia do cromossomo Y ('Microsort'). Tal mtodo, alm de satisfazer os anseios de vrios casais na escolha do sexo do filho, poder ser benfico quando utilizado por famlias portadoras de determinadas anomalias genticas. c) Considerando o heredograma n.1, calcule a chance de os indivduos III.1 e III.2 gerarem uma criana afetada do sexo masculino. 4. (Fuvest-gv 91) Uma populao humana foi testada quanto ao sistema MN de grupos sanguneos. Os dados obtidos compem a tabela a seguir: b) Em qual das duas situaes seria mais recomendado o uso da tcnica ('Microsort') para a escolha de um beb do sexo feminino? Por qu?


Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

8. (Ufmg 94) Esta figura representa uma clula humana na qual uma estrutura est indicada pela seta.

a) Quais as freqncias dos alelos M e N nessa populao? b) Essa populao est em equilbrio de Hardy-Weinberg para esse loco gnico? Com base na figura e em conhecimentos sobre o assunto,

5. (Fuvest 89) O daltonismo tem herana recessiva ligada ao X. Um indivduo anormal, com caritipo 47, XXY, era daltnico. Seus genitores tinham viso normal para cores. a) Qual genitor formou o gameta com 24 cromossomos? Explique. b) O erro ocorreu na primeira ou na segunda diviso da meiose? Explique.

a) CITE o nome da clula representada e sua principal funo. b) CITE o nome da estrutura indicada pela seta e JUSTIFIQUE a existncia da estrutura nessa clula. c) Utilizando a letra A para designar um conjunto de autossomos e as letras convencionalmente usadas para representar os cromossomos sexuais, CITE o nmero cromossmico dessa clula caso ela pertena a um indivduo normal e um indivduo cujo sexo no compatvel

6. (Fuvest 92) Com relao espcie humana, pergunta-se: a) Por que o pai quem determina o sexo da prole? b) Por que os filhos homens de pai hemoflico nunca herdam essa caracterstica do pai?

com a presena da estrutura indicada. d) DENOMINE a sndrome que designa o indivduo cujo sexo compatvel com a presena da estrutura indicada, mas no a possui.

9. (Ufpr 95) Em galinhas domsticas, o sexo feminino 7. (Uff 2002) Um geneticista, adotando o mesmo critrio utilizado para a montagem de caritipo da espcie humana, montou o caritipo de certa espcie animal desconhecida, conseguindo formar dez pares de cromossomos, restando, alm desses, dois cromossomos de tamanhos distintos. Considere o padro de determinao de sexo, nessa espcie desconhecida, igual ao do humano e determine: heterogamtico. Numa determinada raa, a colorao das penas uma caracterstica condicionada pelo gene C e ligada ao sexo. O alelo que determina a colorao carij dominante sobre o alelo para a cor branca. O cruzamento de uma galinha branca com um galo carij produziu somente aves carijs. Promovendo o intercruzamento destes descendentes, qual seria a proporo fenotpica esperada? Demonstre os cruzamentos.

a) quantos cromossomos existem, respectivamente, nos vulos, nos espermatozides e nas clulas musculares dessa espcie animal; b) o sexo a que pertence o animal da espcie em questo, justificando sua resposta.


Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

13. (Ufrj 2002) Certos tipos de cncer, em especial aqueles ligados s clulas do sangue, so tratados com transplantes de medula ssea. Nesses transplantes, uma parte da medula ssea de um doador sadio introduzida na coluna vertebral de um paciente cujas clulas da medula ssea foram previamente eliminadas com auxlio de drogas ou de radiao. Aps o transplante de medula possvel identificar os cromossomos de clulas de diversos rgos e tecidos. A tabela a seguir mostra os resultados da classificao dos cromossomos de 4 tecidos de um paciente submetido a transplante de

10. (Ufrj 97) Fazendeiros que criam gado leiteiro podem, atualmente, determinar o sexo dos embries logo aps a fertilizao, usando um "kit" que determina a presena do cromossomo Y. Se o embrio for fmea, reimplantado no tero da vaca. Caso contrrio, ele eliminado ou congelado para uso futuro. a) Para esses fazendeiros, qual a vantagem dessa prvia determinao do sexo dos embries? b) Por que o "kit" pesquisa somente a presena do cromossomo Y?

11. (Ufrj 98) Durante o processo de meiose ocorre a recombinao gnica, isto , a troca de seqncias de ADN entre cromossomos homlogos. Identifique o cromossomo humano que sofre menos recombinao. Justifique sua resposta.


12. (Ufrj 98) Na espcie humana existe um gene raro que causa a displasia ectodrmica anidrtica, que uma anomalia caracterizada pela ausncia das glndulas sudorparas. Esse gene se localiza no cromossomo sexual X. Algumas mulheres, portadoras desse gene em heterozigose, ficam com a pele toda manchada, formando um mosaico de manchas claras e escuras, quando se passa um corante sobre a pele. Com base nesses resultados, identifique o sexo do paciente e o sexo do doador. Justifique sua resposta.

14. (Ufrj 2004) O governo de uma sociedade totalitria decidiu conter a expanso demogrfica reduzindo a proporo de homens na populao.

Com esse objetivo, foi ento promulgada uma lei segundo a qual todas as mulheres que tivessem um filho homem no mais poderiam ter filhos. As demais mulheres poderiam continuar a ter filhos at que tivessem um filho homem.

a) Explique a formao dessas manchas do ponto de vista gentico. b) Por que esse mosaico no pode aparecer em um homem?

Essa lei atingir o objetivo desejado depois de algumas geraes? Justifique sua resposta.


Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

18. (Unesp 97) Uma revista publicou uma reportagem com o ttulo "Atleta com anomalia gentica faz operao para definir seu sexo e poder competir na classe feminina de jud". A matria dizia, ainda, que a jovem era um caso de pseudo-hermafroditismo, pois apresentava rgos sexuais internos masculinos e rgos sexuais externos femininos. Os testculos da atleta fora extirpados para que ela pudesse competir na equipe feminina de jud a) Que vantagem a atleta levaria sobre as demais competidoras se tivesse os testculos durante a competio?

15. (Ufu 99) Em uma 'Drosophila melanogaster', a determinao do sexo no feita simplesmente pela presena ou ausncia do cromossomo Y, mas por um balano gnico entre genes femininizantes e masculinizantes. Se o cromossomo X de uma fmea com caritipo 2AXX sofrer no-disjuno meitica e o vulo resultante com 2 cromossomos X for fecundado por um espermatozide normal, portador de um cromossomo Y, dando origem a um descendente com caritipo 2AXXY, pergunta-se:

a) Qual o sexo do descendente com caritipo 2AXXY?

b) Sabendo-se que ela foi considerada do sexo feminino, que testes citogenticos voc faria para comprovar esta afirmao?

b) Sabendo-se que o sexo da 'Drosophila melanogaster' pode ser definido por um ndice sexual (I.S.), qual a relao que expressa esse ndice? 19. (Fuvest 93) Um casal de no hemoflicos tem um filho com hemofilia. a) Qual a probabilidade de que uma filha desse casal apresente a c) Qual o ndice sexual (I.S.) do descendente acima referido? doena? b) Qual a probabilidade de que um outro filho desse casal seja 16. (Unesp 91) Na dcada de 40 descobriu-se que algumas clulas retiradas de mulheres apresentavam no ncleo interfsico, um pequeno corpsculo de cromatina intensamente corado. Este corpsculo conhecido hoje como cromatina sexual ou corpsculo de Barr. a) A que corresponde tal corpsculo e em que tipo de clulas (somticas ou germinativas) ele aparece? b) Qual a sua importncia e por que ele no ocorre nas clulas masculinas? 20. (Fuvest 94) Uma mulher portadora de um gene letal ligado ao sexo, que causa aborto espontneo. Supondo que quinze de suas gestaes se completem, qual o nmero esperado para crianas do sexo masculino, entre as que nascerem? Justifique sua resposta. tambm hemoflico? Justifique suas respostas.

17. (Unesp 93) A anlise dos ncleos interfsicos de clulas da mucosa oral de uma mulher, fenotipicamente normal, revelou a existncia de duas cromatinas sexuais em todos eles. Responda: a) Quantos cromossomos X tem esta mulher? b) Se ela se casar com um homem normal, qual a probabilidade de ter uma filha com constituio cromossmica igual sua?


Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

a) Sabendo que a doena em questo um caso de herana ligada ao sexo, formule a concluso do geneticista quanto possibilidade de o consultante transmitir a doena a seus descendentes diretos.

21. (Fuvest 2000) No heredograma a seguir, ocorrem dois meninos hemoflicos. A hemofilia tem herana recessiva ligada ao cromossomo X.

b) Calcule os valores correspondentes probabilidade de que o primo doente do consultante, ao casar com uma mulher normal, gere filhas e filhos afetados pela doena.

23. (Ufc 2002) Na espcie humana h algumas condies dominantes ligadas ao cromossomo X, embora sejam raras. A figura a seguir mostra o heredograma de um tipo de diabetes que leva a problemas no metabolismo do fosfato e dos carboidratos. a) Qual a probabilidade de que uma segunda criana de II - 4 e II 5 seja afetada?

b) Qual a probabilidade de II - 2 ser portadora do alelo que causa a hemofilia?

c) Se o av materno de II - 4 era afetado, qual era o fentipo da av materna? Justifique sua resposta.

22. (Uerj 2002) Um homem pertence a uma famlia na qual, h geraes, diversos membros so afetados por raquitismo resistente ao tratamento com vitamina D. Preocupado com a possibilidade de transmitir essa doena, consultou um geneticista que, aps constatar que a famlia reside em um grande centro urbano, bem como a inexistncia de casamentos consangneos, preparou o heredograma abaixo. Nele, o consultante est indicado por uma seta. a) A me do cruzamento I homozigota ou heterozigota? Justifique. b) Quais so os provveis gentipos dos indivduos II-2, III-4 e III-5? Com base no enunciado e na anlise do heredograma, responda:


Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

26. (Ufrj 2002) Uma das primeiras experincias de terapia gentica foi realizada com indivduos hemoflicos cujo gene para o fator VIII de coagulao era defeituoso. Na terapia foram retiradas clulas da pele do paciente. Estas clulas receberam cpias do gene normal para o fator VIII e foram posteriormente reintroduzidas no indivduo. Os resultados mostraram um aumento significativo na produo do fator VIII nos indivduos tratados.

24. (Ufes 96) MS (indivduo III) est grvida, tem vrios parentes com hemofilia clssica ou hemofilia A. Como no tem recursos para fazer o diagnstico pr-natal dessa doena pelo estudo do DNA fetal, procurou um geneticista. Ela quer obter mais informaes sobre a hemofilia A e conhecer, por meio das leis da probabilidade, o seu risco e tambm o de sua famlia de vir a ter uma criana com essa doena. a) Qual a principal caracterstica clnica da hemofilia A? Justifique por que esse sintoma clnico aparece nos afetados. b) Analise a rvore Genealgica de MS e informe: 1- risco de ela vir a ter uma criana hemoflica, considerando o seu casamento com um homem normal (indivduo III). 2- risco de sua prima (indivduo III) vir a ter uma outra criana hemoflica do mesmo casamento com o indivduo III.

Supondo que o indivduo tratado venha a ter filhos com uma mulher cujos genes para o fator VIII sejam defeituosos, existe possibilidade de nascimento de uma criana no hemoflica? Justifique sua resposta.

27. (Ufrn 99) Seguindo a representao a seguir

e considerando que os indivduos apresentam, simultaneamente, dois 25. (Ufrj 2000) A cor do plo dos gatos depende de um par de genes alelos situados no cromossomo X. Um deles responsvel pela cor preta e o outro pela cor amarela. Existe um terceiro gene autossmico (no localizado nos cromossomos sexuais) que responsvel pela cor branca. b) construa um heredograma no qual trs desses indivduos sejam os filhos biolgicos (legtimos) dos outros dois. Com essas informaes, explique por que o plo de uma gata pode ter trs cores, enquanto o plo de um gato s pode ter duas cores. c) discuta a possibilidade de uma mulher hemoflica e albina ser filha biolgica dos pais propostos no heredograma que voc construiu. a) indique os gentipos dos indivduos. caracteres genticos com mecanismos de herana distintos,


Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

29. (Ufv 99) Com o objetivo de reconstruir a histria familiar de um caso de herana de daltonismo, o heredograma a seguir comeou a ser elaborado para que fosse determinado o gentipo e, ou, fentipo dos indivduos. Sabendo-se que o loco do gene para o daltonismo est no cromossomo X, e ausente no Y, responda:

28. (Ufrn 2005) Os heredogramas a seguir representam duas famlias com doenas hereditrias distintas. A doena que acomete a famlia 1 provoca retardamento mental acentuado, enquanto que a da famlia 2 uma doena degenerativa fatal que aparece em torno dos 40 anos de idade.

a) Se os indivduos I - 1 e II - 5 so daltnicos, quantas pessoas A Aps analisar os heredogramas, atenda s solicitaes a seguir. a) Quais os tipos de herana envolvidos na transmisso das doenas de cada famlia? Justifique sua resposta. b) Considerando que a seleo natural pode eliminar doenas genticas, explique por que a doena da famlia 2 ainda poderia ser encontrada em indivduos da gerao VI (netos da gerao IV). c) Se os indivduos III - 1 e III - 4 vierem a se casar e ter filhos, podero ter uma menina normal homozigota? Justifique. b) O indivduo II - 5 poder ter irmo normal? Justifique. MAIS, neste heredograma, tambm devero apresentar este fentipo?

30. (Unesp 90) Na espcie humana, o nmero de mulheres afetadas pelo daltonismo baixo quando comparado com o nmero de homens afetados pela anomalia. Supondo-se que a freqncia de homens daltnicos nas populaes seja de 10%, responda: a) Por que o daltonismo raro nas mulheres? b) Quantas vezes os homens daltnicos so mais freqentes nas populaes do que as mulheres daltnicas?


Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

33. (Unesp 2003) O daltonismo comumente entendido como a incapacidade de enxergar as cores verde e/ou vermelha. A percepo de cores devida presena de diferentes tipos do pigmento retinol nos cones da retina. Nos indivduos daltnicos, alguns desses pigmentos no esto presentes, alterando a percepo das cores. Os genes que participam da sntese desses pigmentos localizam-se no cromossomo X. O daltonismo um carter recessivo. Um homem daltnico casou-se com uma mulher de viso normal em cuja famlia no havia relatos de casos de daltonismo. Este casal teve dois filhos: Joo e Maria. a) Qual a probabilidade de Joo ter herdado do pai o gene para daltonismo? Qual a probabilidade de Maria ter herdado do pai o gene para daltonismo?

31. (Unesp 98) A genealogia representada na figura de uma famlia com uma anomalia rara na espcie humana. Os crculos representam as mulheres e os quadrados, os homens. Os smbolos em escuro representam os indivduos com anomalia

b) Por que mais freqente encontrarmos homens daltnicos que Com base nessa genealogia, responda. a) Qual o tipo mais provvel da herana desta anomalia? Justifique. b) Tendo em vista o tipo de herana mais provvel, quais os gentipos dos indivduos II-4 e II-5? 34. (Unicamp 93) Uma mulher deu luz um menino com hemofilia. Como nenhum de seus parentes prximos era hemoflico, ela sups que o problema teria surgido porque o pai da criana trabalhava em 32. (Unesp 2003) Jos uma pessoa muito interessada na criao de gatos. Um de seus gatos apresenta hipoplasia testicular (testculos atrofiados) e totalmente estril. Jos procurou um veterinrio que, ao ver as cores preta e amarela do animal, imediatamente fez o seguinte diagnstico: trata-se de um caso de aneuploidia de cromossomos sexuais. As cores nos gatos domsticos so determinadas por um gene A (cor amarela) e outro gene P (cor preta), ambos ligados ao sexo, e o malhado apresenta os dois genes (A e P). 35. (Unicamp 2001) A determinao do sexo em peixes segue o sistema XY, como no ser humano. Um alelo de um lcus do cromossomo Y do peixe 'Lebistes' determina a ocorrncia de manchas na nadadeira dorsal. Um peixe macho com manchas na nadadeira foi cruzado com uma fmea sem manchas. uma usina nuclear e teria ficado exposto a radiaes que alteraram seu material gentico. A mulher tem razo? Justifique. mulheres daltnicas?

a) O que e qual o tipo de aneuploidia que o gato de Jos apresenta? b) Qual a explicao dada pelo veterinrio relacionando a anomalia com as cores do animal?

a) Quais so os fentipos de F e de F desse cruzamento?

b) Como seria o resultado em F e F se o alelo fosse dominante e estivesse no cromossomo X do macho? Demonstre atravs de um cruzamento.


Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

37. (Unirio 98) Uma doena humana rara introduzida em uma famlia quando uma mulher normal se casa com um homem afetado. Esse casal tem 5 filhos, 2 mulheres e 3 homens. Todas as filhas mulheres so afetadas por essa doena. Uma das filhas se casa com um homem normal e tem 7 filhos, sendo 4 homens, dos quais 2 so afetados, e 3 mulheres, das quais somente uma normal. O irmo mais velho, afetado pela doena, casa-se com uma mulher normal e tem 2 filhos, uma mulher afetada e um homem normal. A irm mais nova, tambm afetada pela doena, se casa com um homem normal e tem 3 filhos, uma moa normal e 2 homens, um normal e outro afetado. Observando a genealogia, pode-se dizer que o modo de herana mais provvel seja de herana ligada do X dominante. Justifique essa concluso, desenhe o heredograma dessa famlia considerando o gene (A) normal e o gene (a) mutado e apresente os

36. (Unifesp 2004) Um geneticista estudou dois grupos, I e II, portadores de uma doena gentica que se manifestava da seguinte maneira:

O pesquisador concluiu que no se tratava de uma doena com herana dominante ou recessiva ligada ao sexo, porm teve dvida se, se tratava de herana autossmica recessiva ou autossmica dominante com penetrncia incompleta. a) O que levou o pesquisador a concluir que no se tratava de herana ligada ao sexo? b) Por que o pesquisador teve dvida quanto ao tipo de herana autossmica?

provveis progenes, assim como a probabilidade de filhos afetados para o casamento entre os ltimos primos, a filha afetada do irmo mais velho e o filho afetado da irm mais nova. Para o heredograma, utilize a simbologia: quadrados e crculos brancos para, respectivamente, homens e mulheres normais, quadrados e crculos hachurados para homens e mulheres afetados.

38. (Uerj 2005) Os conhecimentos atuais de biologia celular, biologia molecular e engenharia gentica podem, muitas vezes, estabelecer com segurana o parentesco entre pessoas, mesmo quando elas pertencem a geraes afastadas entre si.


Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

39. (Fuvest 96) Numa populao de 100 pessoas, 36 so afetadas por uma doena gentica condicionada por um par de alelos de herana autossmica recessiva. a) Expresse, em fraes decimais, a freqncia dos genes dominantes e recessivos. b) Quantos indivduos so homozigotos? c) Suponha que nessa populao os cruzamentos ocorram ao acaso, deles resultando, em mdia, igual nmero de descendentes. Considere, tambm, que a caracterstica em questo no altera o valor adaptativo dos indivduos. Nessas condies, qual ser a porcentagem esperada de indivduos de fentipo dominante na prxima gerao? Justifique suas respostas mostrando como chegou aos resultados

O heredograma a seguir mostra os descendentes do casal Joo e

Atualmente, de toda essa famlia, apenas Maria e todos os seus bisnetos esto vivos, e se apresentaram para a identificao de herdeiros do casal citado. Por no haver documentos legais comprobatrios da relao de parentesco, nem ser possvel a coleta de material gentico dos membros falecidos da famlia, foi utilizada, dentre outras, a tcnica de identificao por meio do estudo do DNA extranuclear.


40. (Fuvest 2001) Um determinado gene de herana autossmica recessiva causa a morte das pessoas homozigticas aa ainda na infncia. As pessoas heterozigticas Aa so resistentes a uma doena infecciosa causada por um protozorio, a qual letal para as pessoas homozigticas AA.

Indique o nmero de: a) bisnetos do sexo masculino e do sexo feminino que poderiam ser identificados com aproximadamente 100% de certeza, por tcnicas que determinam a homologia entre amostras de DNA extranuclear, e justifique sua resposta; b) netos e bisnetos de Joo e Maria que possuram ou possuem o cromossomo Y idntico ao de Joo e justifique sua resposta.

Considere regies geogrficas em que a doena infecciosa endmica e regies livres dessa infeco. Espera-se encontrar diferena na freqncia de nascimento de crianas aa entre essas regies? Por qu?

41. (Uerj 2004) Segundo o Teorema de Hardy Weinberg, uma populao ideal deve atingir o equilbrio, ou estado esttico, sem grandes alteraes de seu reservatrio gentico. Em uma das ilhas do arquiplago de Galpagos, uma das condies estabelecidas por Hardy e Weinberg para populaes ideais foi seriamente afetada por uma erupo vulcnica ocorrida h cerca de cem mil anos. Esta erupo teria diminudo drasticamente a populao de jabutis gigantes da ilha. a) Cite duas das condies propostas por Hardy e Weinberg para que o equilbrio possa ser atingido. b) Defina o conceito de evoluo em funo da freqncia dos genes de uma populao e indique de que forma a diminuio da populao afetou a evoluo dos jabutis gigantes.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

46. (Ufrj 2002) O grupo sangneo MN determinado por dois alelos co-dominantes. A freqncia dos gentipos desse grupo sangneo foi amostrada em duas populaes humanas e os resultados so apresentados na tabela a seguir.

42. (Ufrj 96) A SOCIOBIOLOGIA procura explicar o comportamento dos indivduos em funo de sua herana gentica. Um dos instrumentos mais utilizados nesses estudos a pesquisa sobre o comportamento de gmeos univitelinos que foram criados em ambientes diferentes. Qual o princpio cientfico dessa abordagem experimental?

43. (Ufrj 97) Pela equao Hardy-Weinberg, p+ 2pq + q= 1, onde p e q so as freqncias de dois alelos. Com essa equao podemos calcular a freqncia de um gentipo sabendo a freqncia de um dos alelos, ou vice-versa, desde que a populao esteja em equilbrio. Numa determinada populao em equilbrio de Hardy-Weinberg nasceram 10.000 crianas; uma dessas crianas apresentou uma doena, a fenilcetonria, determinada por um gene autossmico recessivo. Calcule a freqncia de indivduos de fentipo normal portadores do gene causador da fenilcetonria nessa populao. Calcule a freqncia do alelo M nas duas populaes e determine se a populao da Europa como um todo uma populao panmtica, isto 44. (Ufrj 99) Uma populao vegetal que NO est em equilbrio de Hardy-Weinberg, composta por 500 indivduos. Desses, 420 so de flores vermelhas (fentipo dominante) e 80 so de flores brancas (fentipo recessivo). Dos 420 indivduos de flores vermelhas, 380 so homozigticos (VV) e 40 so heterozigticos (Vv). Determine a freqncia dos genes V e a freqncia dos genes v nessa populao. 47. (Ufrj 2008) O grfico a seguir mostra as freqncias dos gentipos de um locos que pode ser ocupado por dois alelos A e a. No grfico, p representa a freqncia do alelo A. , uma populao em que os casamentos ocorrem ao acaso. Justifique sua resposta.

45. (Ufrj 2000) A freqncia gnica de dois alelos em uma populao, numa dada gerao, foi de A= 80% e a=20%. Na gerao seguinte foi observada uma freqncia de A=60% e a=40%.

Alguns mecanismos evolutivos que alteram a freqncia dos genes so:

1) Seleo natural; 2) Taxa de mutao gnica; 3) Deriva ao acaso da freqncia gnica, principalmente em populaes pequenas. Calcule a freqncia dos gentipos AA, Aa, aa nos pontos determinados pela linha pontilhada. Justifique sua resposta. Qual das trs possibilidades apresentadas NO pode ser aceita para explicar a variao na freqncia dos genes citados? Justifique sua resposta.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

52. (Unicamp 94) A freqncia do gene i, que determina o grupo sangneo O, de 0,40 (40%) em uma populao em equilbrio. Em uma amostra de 1000 pessoas desta populao, quantas se espera encontrar com sangue do tipo O? Explique as etapas que voc seguiu para chegar resposta. Indique o gentipo das pessoas do grupo sangneo O.

48. (Ufrrj 2000) Numa determinada ilha existia uma populao animal com indivduos possuidores de uma caracterstica normal e indivduos possuidores de uma caracterstica recessiva, numa proporo de 10:1, respectivamente. Mas um desastre ambiental provocou a morte de todos os indivduos com a caracterstica recessiva, alterando de forma brusca a freqncia do gene recessivo na populao da ilha.

53. (Unirio 2002) Uma caracterstica fenotpica de uma populao, a) Aps o desastre pode-se afirmar que a freqncia do gene recessivo ser zero? Justifique sua resposta. como a cor amarela, determinada por um gene dominante. Esse gene tem um alelo que no produz essa caracterstica. Um estudo dessa populao determinou que a freqncia do fentipo amarelo b) Qual o nome dado a essa alterao brusca na freqncia gnica? era de 50% e NO SE SABE se essa populao est em equilbrio de Hardy-Weinberg. 49. (Ufv 96) Uma das maneiras de verificar se uma determinada espcie est ou no em evoluo fazer um estudo do patrimnio gentico de suas populaes. Usando o teorema de Hardy-Weinberg pode-se determinar as freqncias gnicas de uma populao e demonstrar se a espcie est em equilbrio, isto , em estado de noevoluo. Entretanto, para que uma populao se mantenha em equilbrio gentico necessrio que ela se enquadre em certas condies. Escreva quatro destas condies: 54. (Ufes 97) A cor da pelagem em coelhos determinada por uma srie de alelos mltiplos composta pelos genes C, c, c e c, responsveis pelos fentipos aguti, chinchila, himalaio e albino, respectivamente. A ordem de dominncia existente entre os genes C > c > c > c. Responda: a) Quais as propores fenotpicas e genotpicas esperadas na 50. (Unb 2000) Em uma populao, um determinado gene apresentase em duas formas, a dominante e a recessiva, sendo 36% dos indivduos recessivos. Considerando que tal populao se encontre em equilbrio gentico, podendo-se, portanto, aplicar o Princpio de Hardy-Weimberg, calcule, EM PORCENTAGEM, a freqncia do referido gene na populao. Despreze a parte fracionria de seu resultado, caso exista. prognie do cruzamento entre um coelho aguti (Cc) e um coelho chinchila (cc)? b) Como voc explicaria o aparecimento de coelhos albinos a partir de um cruzamento entre coelhos himalaios? Com base nessas informaes, no possvel saber a freqncia do gene para cor amarela. Explique.

51. (Unesp 2004) Considere duas populaes diferentes, 1 e 2, cada uma com 200 indivduos diplides, portanto, com 400 alelos. A populao 1 apresenta 90 indivduos com gentipo AA, 40 indivduos com gentipo Aa e 70 indivduos com gentipo aa. A populao 2 apresenta 45 indivduos com gentipo AA, 130 indivduos com gentipo Aa e 25 indivduos com gentipo aa. a) Qual a freqncia dos alelos A e a em cada uma das populaes? b) Qual delas tem a maioria dos indivduos homozigotos? Explique.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

57. (Unesp 99) Em abelhas, a cor do olho condicionada por uma srie de alelos mltiplos, constituda por cinco alelos, com a seguinte relao de dominncia:

55. (Ufjf 2006) As videiras podem produzir uvas de colorao vermelha, vinho, rosa e amarela. O cruzamento entre plantas com esses fentipos produziu as seguintes proles na gerao F1.


Uma rainha de olho marrom, porm, heterozigota para prola, produziu 600 ovos e foi inseminada artificialmente por espermatozides que portavam, em propores iguais, os cinco alelos. Somente 40% dos ovos dessa rainha foram fertilizados e toda a descendncia teve a mesma oportunidade de sobrevivncia. Em abelhas, existe um processo denominado partenognese.

a) O que partenognese? Em abelhas, que descendncia resulta Com base nos resultados apresentados, responda ao que se pede: a) Quantos alelos esto envolvidos na determinao do carter cor de fruto e qual a relao de dominncia entre eles? b) Qual a proporo genotpica e fenotpica do cruzamento entre plantas de fruto vinho do cruzamento parental (2) com plantas de fruto vinho do cruzamento parental (4)? c) Quantas plantas com frutos amarelos sero geradas, a partir de 200 sementes oriundas do cruzamento entre plantas de frutos vinho do cruzamento parental (4) com plantas de frutos rosa do cruzamento parental (2)? 58. (Unicamp 93) As abelhas vivem em colnias constitudas por indivduos de trs castas: a rainha, os zanges e as operrias. Sabendo-se que as fmeas frteis de 'Apis mellifera' tm 32 cromossomos, indique o nmero cromossmico dos indivduos de cada uma das castas e descreva como ocorre a diferenciao em castas nesses insetos. 56. (Ufrj 2000) Uma determinada caracterstica depende de um locus que possui 4 alelos (A1, A2, A3, A4). Outra caracterstica tambm depende de 4 genes (B1, B2 e C1, C2), porm so dois pares de alelos localizados em pares de cromossomos homlogos diferentes. TEXTO PARA A PRXIMA QUESTO (Pucmg 2003) O ciclo celular interrompido entre as fases G/S e G/mitose, e protenas especiais controlam a evoluo do ciclo celular das novas clulas. Entre S/G algumas protenas checam Um desses dois tipos de determinismo gentico apresenta um nmero maior de gentipos possveis na populao. Identifique esses gentipos. possveis falhas e erros na linha de produo, decidem se o ciclo celular avana ou paralisado iniciando um processo de destruio do material gentico, conhecido como APOPTOSE, ou morte celular espontnea. Portanto, a inativao de qualquer um dos componentes ou operadores do sistema de checagem ou de apoptose poderia provocar a proliferao contnua das clulas e possvel desenvolvimento de tumores cancerosos. Um exemplo observvel das conseqncias de apoptoses o descamar da pele aps sua exposio prolongada a radiao solar intensa. deste processo? b) Na inseminao realizada, qual o nmero esperado de machos e de fmeas na descendncia? Dos machos esperados, quantos tero o olho de cor marrom?



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

60. (Uerj 2002) Em uma experincia de fecundao "in vitro", 4 vulos humanos, quando incubados com 4 suspenses de espermatozides, todos igualmente viveis, geraram 4 embries, de acordo com a tabela abaixo.

59. Abaixo est transcrito um pequeno trecho de uma recente entrevista, concedida Revista Galileu pelo cientista Srgio Danilo Pena, da Universidade Federal de Minas Gerais, que liderou uma pesquisa gentica sobre a composio tnica do povo brasileiro.

GALILEU: " correta a noo de que a maior parte dos brasileiros tem algum antepassado com pai branco europeu e me negra ou ndia ?" PENA: ". Meu caso exatamente esse. Meu cromossomo Y europeu e meu DNA mitocondrial amerndio."

A resposta do geneticista aliada aos seus conhecimentos permite afirmar, EXCETO: a) O DNA do cromossomo Y e das mitocndrias apresenta genes que determinam a cor da pele humana. b) O DNA mitocondrial de origem materna. c) O cromossomo Y apresenta genes exclusivamente paternos. d) Pelo estudo acima, somente o genoma de indivduos do sexo masculino pode ser utilizado para a determinao da ancestralidade paterna. Considerando a experincia descrita, o grfico que indica as probabilidades de os 4 embries serem do sexo masculino o de nmero: a) 1 b) 2 c) 3 d) 4



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

63. (Fuvest 91) O grfico a seguir mostra a dinmica das freqncias do gene s, o qual determina a doena chamada siclemia ou anemia falciforme. Os homozigotos siclmicos morrem precocemente devido severa anemia; os heterozigotos sofrem de uma forma branda da anemia mas, por outro lado, so mais resistentes malria que os indivduos normais. O grfico refere-se ao perodo posterior erradicao da malria. Qual a explicao para o comportamento das curvas do grfico?

61. (Ufscar 2004) Os machos de abelha originam-se de vulos no fecundados e so haplides. As fmeas resultam da fuso entre vulos e espermatozides, e so diplides. Em uma linhagem desses insetos, a cor clara dos olhos condicionada pelo alelo recessivo a de um determinado gene, enquanto a cor escura condicionada pelo alelo dominante A. Uma abelha rainha de olhos escuros, heterozigtica Aa, foi inseminada artificialmente com espermatozides de machos de olhos escuros. Espera-se que a prole dessa rainha tenha a seguinte composio:

a) Diminuio da freqncia de mutao de S para s. b) Seleo contra os portadores do gene s. 62. (Unirio 2000) A reproduo da maioria dos seres vivos envolve um processo sexual onde se alternam os fenmenos de meiose e fecundao. No homem, a meiose gamtica, e a fecundao reconstitui a diploidia. Qual dos pares de gametas representados a seguir poder originar um zigoto que desenvolver um embrio normal do sexo masculino? c) Aumento da freqncia de mutao de S para s. d) Cruzamentos preferenciais entre pessoas anmicas. e) Cruzamentos preferenciais entre portadores de malria.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

65. (Uel 2007) Em uma populao de organismos diplides, foram encontrados quatro alelos diferentes para um determinado locus gnico, denominados S, S, S e S. A figura a seguir mostra,

64. (Fuvest-gv 92) A cor dos plos nas cobaias condicionada por uma srie de alelos mltiplos com a seguinte escala de dominncia:

C (preta) > C (marrom) > C (creme) > c (albino).

esquerda, as diferenas na seqncia de DNA que caracterizam cada um desses alelos e, direita, o par de cromossomos homlogos

Uma fmea marrom teve 3 ninhadas, cada uma com um macho diferente. A tabela a seguir mostra a constituio de cada ninhada.

(metafsicos) onde esse gene encontrado. Diante dessas informaes, se um nico indivduo desta populao for escolhido ao acaso, qual combinao alelo/posio cromossmica poderia ser encontrada no par de cromossomos metafsicos deste indivduo?

A partir desses dados possvel afirmar que o macho responsvel pela ninhada: a) 1 era marrom homozigoto. b) 1 era preto homozigoto. c) 2 era albino heterozigoto. d) 2 era creme heterozigoto. e) 3 era marrom homozigoto.


1. O gene A, pois um letal recessivo, ficando protegido da seleo natural quando em heterozigose, enquanto o gene B e um letal dominante, sendo eliminado mesmo em dose simples.

2. a) 6 crianas b) Nenhum dos filhos ser afetado (XaY) e todas as filhas (XAXa) sero afetadas.

3. a) O heredograma 1 apresenta o padro tpico da herana autossmica recessiva. Justifica-se pelo fato de indivduos afetados (II.2 e IV.6) serem filhos de pais normais para o carter em questo e o nmero de afetados de ambos os sexos ser aproximadamente o mesmo ao logo das geraes.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

b) Masculino, porque os dois cromossomos restantes, os sexuais, so de tamanhos diferentes (X Y).

O heredograma 2 apresenta o padro observado na herana recessiva ligada ao sexo. Justifica-se pelo fato de se observarem apenas homens afetados que seriam filhos de mulheres portadoras do gene recessivo ligado ao cromossomo X.

8. a) Glbulo branco (neutrfilo) envolvido na defesa orgnica. b) Corpsculo de Barr, ou cromatina sexual, observada em clulas

b) Seria recomendvel a escolha de um filho do sexo feminino no caso apresentado na genealogia 2 pois, neste caso, seria muito menor a probabilidade da ocorrncia do carter em mulheres. Os indivduos do sexo feminino seriam afetados somente se herdarem dois genes recessivos ligados ao X.

somticas de mulheres. c) Normal: Mulher 2A + XX Anormal: Homem 2A + XXY (Sndrome de Klinefelter) d) Sndrome de Turner (Mulher 2A + X0)

9. P: (macho) ZZ x ZW (fmea) c) Pais: Aa x aa | P(menina afetada) = 1/2 . 1/2 = 1/4 ou 25% F x F: (macho) ZZ x ZW (fmea) 4. N. total de alelos na populao = 12258 (cada pessoa tem dois alelos) F: 25% ZZ, 25% ZZ (machos) e 25% ZW e 25% ZW (fmeas) N. de alelos M = 6613 N. de alelos N = 5645 10. a) Para o fazendeiro interessa possuir um rebanho s de vacas, pois ele est interessado no leite. freqncia do alelo M = 6613/12258 = 0,54 freqncia do alelo N = 5645/12258 = 0,46 b) A presena do cromossomo Y define o sexo, pois s machos tm esse cromossomo; j o cromossomo X existe nos machos e nas fmeas. A populao est em equilbrio porque as freqncias se aproximam da distribuio binomial (p + q) = 1, sendo p a freqncia do alelo M e q a freqncia do alelo N. 11. O cromossomo Y. H apenas uma troca de ADN entre o cromossomo Y (que nico no caritipo do homem) e o cromossomo X, num pequeno trecho homlogo existente entre esses 5. a) A me, porque portadora do gene em questo (XDXd). b) Na segunda diviso, pois o descendente herdou o cromossomo Xd duplicado de sua me. 12. a) A mulher que heterozigota para esse gene, em funo da inativao ao acaso de um dos cromossomos X, apresentar regies 6. a) O homem pode produzir dois tipos de espermatozides: com o cromossomo sexual X e com o cromossomo Y. b) O gene da hemofilia ligado ao cromossomo X, que um homem herda de sua me. O filho homem herda de seu pai o cromossomo sexual Y. b) Os homens s tm um cromossomo X, que sempre funcional e portador de apenas um dos dois genes. Se o cromossomo X do homem tiver o gene em questo, toda sua pele estar comprometida, 7. a) Nos vulos e espermatozides existem apenas 11 cromossomos, j as musculares tero 22 cromossomos. caso contrrio toda sua pele ser normal. da pele em que o gene normal ser ativo e outras regies em que o gene anormal ser o gene ativo. cromossomos. F: 50% ZZ : 50% ZW.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

20. Das quinze gestaes bem sucedidas dessa mulher, espera-se que cinco sejam do sexo masculino porque de 50% a chance dos filhos homens herdarem o gene letal de sua me e no sobreviverem, como mostra o esquema a seguir.

13. As clulas sangneas so derivadas da medula ssea e, portanto, vieram de um doador do sexo feminino (XX). As clulas somticas, que no so derivadas da medula, possuem o caritipo masculino (XY), portanto o receptor do sexo masculino.

14. A lei no alterar a proporo de homens na populao. Para qualquer gestao haver sempre 50% de probabilidade de nascer uma criana do sexo masculino e 50% do sexo feminino. Contudo, tal lei contribuir para a reduo da expanso demogrfica, pois depois de duas gestaes 3/4 das mulheres tero 2 ou menos filhos.

15. a) Fmea excepcional.

b) I.S. = X/A, ou seja, relao entre o n. de cromossomos X e o n. de lotes autossmicos presentes no caritipo do animal. 21. a) 1/4

c) I.S. = X/A = 2/2 = 1. Trata-se de uma fmea.

16. a) Cromossomo X condensado em clulas somticas de fmeas de mamferos. b) Identificao citolgica do sexo. O homem s apresenta um cromossomo X que est permanentemente descondensado e geneticamente ativo.

b) 1/2

c) O fentipo da av materna era normal uma vez que sua filha (I 2), que recebeu o gene para hemofilia de seu pai, normal.

22. a) O consultante no transmitir a doena a seus filhos e filhas. 17. a) Esta mulher tem 3 cromossomos X, com caritipo 47, XXX. b) 1/4 ou 25%. b) Filhas - 100% Filhos - 0% 18. a) Os testculos produzem testosterona, hormnio sexual masculino que, entre outros efeitos, aumenta a massa muscular. 23. a) As evidncias de que a me heterozigota podem ser comprovadas com base nos seguintes argumentos: Se a me fosse b) Teste da cromatina sexual (Corpsculo de Barr). Mulheres apresentam em algumas clulas de todos os seus tecidos um cromossomo X que permanece condensado durante o perodo interfsico e podem ser visualizados no ncleo como um corpsculo intensamente corado. b) Alelos: D - diabetes fosfato, d - normalidade homozigota todos os filhos e filhas seriam doentes, uma vez que o carter dominante. A me sendo heterozigota haver uma proporo de 50% de filhos e filhas sadios (e vice-versa).

19. a) Zero, pois sendo o pai normal (XHY) no poder ter filhas hemoflicas (XhXh). b) 50%, pois mulher portadora (XHXh) casada com homem normal (XHY) podem produzir metade dos filhos homens hemoflicos.

O indivduo II-2 uma mulher heterozigtica (XDXd), III-4 um homem no afetado homozigoto para o alelo normal (XdY) e III-5 um homem homozigoto para o alelo do diabetes fosfato (XDY).



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

28. a) Famlia I - herana dominante ligada ao X. Ocorre em todas as geraes. Os homens afetados transmitem a doena para todas as filhas. Famlia II - herana dominante autossmica. Ocorre em todas as geraes. Atinge indivduos de ambos os sexos ou filhos afetados tm um genitor afetado.

24. a) Dificuldade em coagular o sangue em hemorragias e fragilidade capilar causando hematomas que no desaparecem naturalmente. A causa a falta de um ou mais fatores envolvidos no processo de coagulao. b) 1 - 1/8 ou 12,5%, 2 - 1/4 ou 25%

25. Os genes para preto e para amarelo esto no cromossomo X. Como os gatos do sexo masculino tm apenas um cromossomo X, s podero ter um dos genes ligados ao sexo, preto ou amarelo, alm do gene autossmico. As fmeas, que possuem dois cromossomos X, podem ter os dois alelos para cor, alm do gene autossmico para a cor branca. 29. a) Sero tambm daltnicos os filhos homens de mulheres daltnicas, ou seja, os indivduos II - 2, II - 3 e III - 4. 26. No h possibilidade de nascer uma criana no hemoflica, pois ambos os pais so hemoflicos e a terapia gentica altera somente clulas somticas e os gametas so produzidos por clulas da linhagem germinativa. c) III - 1 sim, pois trata-se de mulher normal e portadora do gene para 27. a) 1. XhY aa 2. XHY aa 3. XhY A_ 4. XhXh A_ 5. XHX_ aa 30. a) Para ser daltnica a mulher dever ter gentipo XhXh. Ora, se a freqncia de um gene (h) ligado ao cromossomo X 10%, a freqncia dos dois genes no mesmo indivduo (10%). b) Observe o heredograma adiante: b) 10 x daltonismo. III - 4 no, trata-se de homem daltnico que transmitir s suas filhas o alelo para daltonismo. b) Sim. II - 5 poder ter irmo ou irm normais se seus pais possurem o alelo que determina a viso normal para as cores. b) Como a doena s se manifesta a partir dos 40 anos, o indivduo pode reproduzir-se antes de a doena aparecer, transmitindo a caracterstica aos descendentes.

31. a) A genealogia sugere um caso de herana recessiva ligada ao sexo. Justifica-se pelo fato de apresentar somente homens afetados que so filhos de mulheres portadoras do gene recessivo ligado ao cromossomo X. As filhas de homens afetados so portadoras e podem ter filhos afetados.

b) Dado que se trata de herana recessiva ligada ao sexo, os gentipos so: indivduo II - 4 XAXa indivduo II - 5 XAY c) A ocorrncia de uma filha hemoflica e albina (XhXh aa) na descendncia do casal, possvel como mostra o heredograma anterior.

32. a) Aneuploidia uma aberrao cromossmica numrica em que o portador apresenta determinados cromossomos a mais ou a menos. O gato de Jos apresenta uma trissomia (XXY) dos cromossomos sexuais.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

b) O macho normal (XY) no pode apresentar as duas cores, pois s possui um cromossomo sexual X. Deste modo, ou so pretos (XPY) ou amarelos (XAY). O veterinrio explicou que o gato de Jos preto e amarelo por ser portador do gentipo XPXAY. 36. a) Herana recessiva ligada ao sexo, o pai da mulher afetada no grupo II tambm seria afetado. Na Herana dominante ligado ao sexo, a filha da gerao F1 do grupo I do homem afetado, tambm seria afetada. b) Pais normais com filho afetado poderia determinar a recessividade 33. a) A probabilidade de Joo ter herdado do pai o gene para daltonismo zero, porque ele recebe do pai o cromossomo Y. Para Maria 100%, porque ela recebe o cromossomo Xd do pai que daltnico (XdY). b) O homem, sendo homozigoto, daltnico quando apresenta o gentipo XdY. Sendo homozigota, a mulher daltnica possui gentipo XdXd. Para ter a anomalia, a mulher precisa de dois genes e o homem apenas um. 37. Observe o heredograma adiante: autossmica, porm a penetrncia incompleta poder fazer com que o heterozigoto desenvolva ou no a anomalia.

34. No, porque o gene para a hemofilia, recessivo e ligado ao cromossomo X, estava presente justamente na mulher portadora. O Pai no poderia ser o responsvel, pois transmite ao filho homem o cromossomo Y.

35. a) 100 % de machos com mancha na cauda e nenhuma fmea com esta caracterstica. A probabilidade de descendentes afetados do casamento entre os ltimos primos (XAXa - XAY) ser: b) A = gene que determina mancha a = gene que determina ausncia de mancha 38. a) 2 do sexo masculino e 2 do sexo feminino. O cruzamento gerador dos F seria: Nas condies propostas, homologias entre amostras de DNA s seriam possveis se fossem comparadas amostras de origem XY XX mitocondrial. Como as mitocndrias dos embries formados originam-se, na grande maioria dos casos, diretamente dos vulos, s poderamos obter aproximadamente 100% de homologia comparando o DNA mitocondrial de Maria com os de seus bisnetos e bisnetas cujas mes e avs sejam descendentes diretos de Maria. Filhas: 100% afetadas (XAXA, XAXa) Filhos: 50% afetados (XAY) e 50% normais (XaY).

b) 2 netos e 1 bisneto. O cromossomo Y nico e caracterstico do sexo masculino. Esse cromossomo existe em cerca de 50% dos espermatozides mas no em vulos. Cromossomos Y homlogos ao de Joo sero encontrados, portanto, nos netos do sexo masculino descendentes dos


filhos destes netos.

Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

Logo q = 0,0001; q = (0,0001) = 0,01

filhos homens de Joo, e nos bisnetos de sexo masculino que sejam

39. a) freqncia do gene a = 0,60 freqncia do gene A = 0,40

Como p + q = 1, a freqncia do gene dominante : 1 - 0,01 = 0,99

b) f(aa) + f(AA) = 0,36 + (0,40) = 0,42 42 pessoas com gentipo homozigoto

Como a freqncia do heterozigoto em uma populao em equilbrio 2pq, a resposta :

c) f(AA) + f(Aa) = 0,16 + 2.0,40.0,60 = 0,64 64 pessoas com fentipo dominante

2 0,99 0,01 = 0,019 ou 1,9%

44. Nessa populao temos 500 indivduos e, conseqentemente, 40. A freqncia de nascimentos de crianas aa ser maior nas regies em que a doena endmica. Nessas regies haver uma maior taxa de indivduos heterozigotos, selecionados favoravelmente em relao aos indivduos AA, pela presena do protozorio patognico. Cruzamentos subseqentes entre heterozigotos produziro maior taxa de indivduos aa. 45. A taxa de mutao gnica, pois os valores mdios de mutao so 41. a) Duas dentre as condies: - no-ocorrncia de migraes - no-ocorrncia de mutaes que introduzam novos genes - probabilidades iguais na escolha dos parceiros no processo de reproduo sexuada - nmero de indivduos grande o suficiente para que eventos aleatrios no afetem as propores estatsticas - no-sujeio dos genes alelos seleo natural, tendo todos os indivduos a mesma possibilidade de sobrevivncia 47. O grfico mostra que a freqncia do gene A p = 0,60. Como p b) Alterao progressiva das freqncias gnicas em uma populao. A populao de jabutis ficou mais sujeita a variaes gnicas aleatrias (deriva gentica). + q = 1, temos que a freqncia do gene a q = 0,40. Portanto, de acordo com o teorema de Hardy-Weinberg, a freqncia de AA p = 0,36, a freqncia de Aa 2pq = 0,48 e a freqncia de aa q = 0,16 42. Gmeos univitelinos so genticamente idnticos e devem apresentar as mesmas caractersticas. Criados em ambientes distintos pode-se avaliar, com maior clareza, a influncia do meio na expresso das caractersticas hereditrias. b) Oscilao gentica. 43. Freqncia de homozigotos recessivos: 49. Condies para que haja equilbrio gentico: aa = 1/10000 = 0,0001 - cruzamentos ao acaso 48. a) No. Entre os indivduos com a caracterstica normal podero existir heterozigotos que so portadores do gene recessivo. 46. Europeus do Norte: M = 0,16 + (0,48/2) = 0,40. Europeus do Sul: M = 0,36 + (0,48/2) = 0,60. A populao da Europa como um todo no est em equilbrio de Hardy-Weinberg. Se os casamentos fossem ao acaso, a freqncia dos genes seriam iguais em todas as populaes. 1/10 e valores muito altos so de 1/10. Esses valores so incompatveis com a variao observada de 20%. 1.000 genes (2 genes para cada indivduo). A quantidade de genes v 802=160 nos indivduos vv e 401=40 nos indivduos Vv. O total de genes v , portanto, de 160+40=200. Como, no total, h 1.000 genes, a freqncia de v de 20%. A freqncia de genes V , ento, de 80%.


- ausncia de mutaes. - ausncia de seleo natural. - ausncia de migraes.

Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

Proporo fenotpica: 3 vinho : 1 rosa

- freqncias gnica e genotpica constantes.

Cruzamento 2 AA AA Proporo genotpica: 1AA : 1AA : 1AA : 1AA

50. f (A) = 40% f (a) = 60%

Proporo fenotpica: 3 vinho : 1 rosa

c) Cruzamentos 51. a) Nas duas populaes a freqncia dos gametas so iguais, ou seja 55% para A e 45% para a. AA AA Proporo genotpica: 1AA : 1AA Proporo fenotpica: 3 vinho : 1 rosa

b) A populao 1 apresenta 160 homozigotos e a populao 2 apresenta 70 homozigotos.

AA AA Proporo genotpica: 1AA : 1AA : 1AA : 1AA Proporo fenotpica: 1 vinho : 1 rosa

52. freqncia do gene i = 0,40 freqncia do gentipo ii = (0,40) = 0,16 = 16% Portanto, espera-se encontrar 160 pessoas em uma amostra de 1000 que sero do tipo O (gentipo ii). 56. Os gentipos so: 53. O fentipo cor amarela engloba os gentipo AA e Aa. Se a populao estiver em equilbrio podemos assumir que AA = p, mas se a populao no estiver em equilbrio no se pode assumir essa igualdade, e como no conhecemos a proporo de indivduos Aa, no se pode saber a freqncia do gene A. A3A3; A3A4 54. a) Proporo fenotpica: 50% aguti : 50% chinchila A4A4 A2A2; A2A3; A2A4 A1A1; A1A2; A1A3; A1A4 Considerando os cruzamentos possveis, no so produzidas plantas com frutos amarelos.

Proporo genotpica: 25% Cc : 25% Cc : 25% cc : 25% cc

57. a) Partenognese o mecanismo de reproduo assexuada onde o vulo evolui, sem fecundao, originando um organismo adulto completo. Em abelhas a partenognese somente origina machos, os

b) Os coelhos himalaios parentais so heterozigotos para o gene que condiciona albinismo.


b) Dos 600 ovos produzidos pela rainha, 40%, ou seja, 240 foram 55. a) Quatro alelos, sendo A responsvel pela cor vermelha, A pela cor vinho, A pela cor rosa e A pela cor amarela. A relao de dominncia A dominante sobre A, que dominante sobre A que, por sua vez, dominante sobre A (A > A > A > A). b) Cruzamento 1 AA AA Proporo genotpica: 1AA : 2AA : 1AA 58. Rainha: 2n = 36, fmea frtil e produzida a partir de larva fmea alimentada com gelia real. fecundados e originaram fmeas e 60%, ou seja, 360 ovos nofecundados produziro zanges. Sendo a rainha portadora dos alelos para marrom e prola, espera-se 180 machos com olhos marrons e 180 machos com olhos de cor prola.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

Operria: 2n = 36, fmea estril e produzida a partir de larva fmea alimentada com mel e plen.

Zango: n = 18, macho frtil e produzido por partenognese.

59. [A]

60. [A]

61. [D]

62. [B]

Lista 2
1. (Fuvest 2003) Uma espcie de lombriga de cavalo possui apenas um par de cromossomos no zigoto (2n = 2). Um macho dessa espcie, heterozigtico quanto a dois pares de alelos (Aa Bb) formou,

63. [B]

64. [D]

65. [A]

ao final da gametognese, quatro tipos de espermatozides normais com diferentes gentipos quanto a esses genes.

a) Qual o nmero de cromossomos e o nmero de molculas de DNA no ncleo de cada espermatozide? b) Quais so os gentipos dos espermatozides formados? c) Por que, a partir das informaes fornecidas, no possvel estimar a proporo em que cada um dos quatro tipos de espermatozides aparece? Explique.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

4. (Ufrj 2006) Um pesquisador est estudando a gentica de uma espcie de moscas, considerando apenas dois locos, cada um com dois genes alelos:

2. (Ufc 2007) Mendel no acreditava na mistura de caracteres herdados. De acordo com suas concluses, a partir dos cruzamentos realizados com ervilhas do gnero 'Pisum', as caractersticas no se misturam, permanecem separadas e so transmitidas independentemente. HENIG, Robin. "O monge no jardim". Rio de Janeiro: Rocco, 2001.

loco 1 - gene A (dominante) ou gene a (recessivo); loco 2 - gene B (dominante) ou gene b (recessivo).

Cruzando indivduos AABB com indivduos aabb, foram obtidos a) Considerando as leis de Mendel para a hereditariedade, no momento da fecundao os cromossomos herdados dos progenitores se juntam, porm os alelos dos seus genes no se misturam. A partir dessa idia, qual fenmeno explicaria a ocorrncia de caractersticas intermedirias na prognie, que parecem ser uma mistura daquelas dos progenitores? b) Posteriormente, estudos de grupos de geneticistas indicaram que pode haver troca de material gentico entre cromossomos homlogos herdados do pai e da me. Em que etapa isso pode ocorrer e como se chama este processo? 100% de indivduos AaBb que, quando cruzados entre si, podem formar indivduos com os gentipos mostrados na Tabela 1. Sem interao entre os dois locos, as propores fenotpicas dependem de os referidos locos estarem ou no no mesmo cromossomo. Na Tabela 2, esto representadas duas propores fenotpicas (casos 1 e 2) que poderiam resultar do cruzamento de dois indivduos AaBb.

3. (Ufg 2005) Quatro irmos, filhos legtimos de um mesmo casal, apresentam marcantes diferenas em suas caractersticas fsicas.

Descreva trs mecanismos biolgicos potencialmente responsveis por essa variabilidade gentica e explique como atuam.

Identifique qual dos dois casos tem maior probabilidade de representar dois locos no mesmo cromossomo. Justifique sua resposta.

5. (Unifesp 2007) Considere dois genes e seus respectivos alelos: A e a; B e b. Em termos de localizao cromossmica, explique o que significa dizer que esses dois genes a) segregam-se independentemente na formao dos gametas. b) esto ligados.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

8. (Uerj 2008) Em certa espcie de ratos, o alelo dominante B determina que a cor do plo seja cinza, enquanto o gentipo recessivo bb determina uma pelagem preta. Em outro cromossomo, um lcus afeta uma etapa inicial na formao de qualquer dos pigmentos do plo. Nesse lcus, o alelo dominante A possibilita um desenvolvimento normal da cor, mas o gentipo recessivo aa bloqueia toda a produo de pigmento. Assim, ratos aa so todos albinos, independentemente do seu gentipo no lcus B. Do cruzamento de um rato macho de pelagem cinza com uma fmea albina, cujo gentipo aabb, 50% da prole foi albina, 25% preta e 25% cinza. Determine o gentipo do rato macho, justificando sua resposta.

6. (Fuvest 2004) As trs cores de pelagem de ces labradores (preta, marrom e dourada) so condicionadas pela interao de dois genes autossmicos, cada um deles com dois alelos: "Ee" e "Bb". Os ces homozigticos recessivos "ee" no depositam pigmentos nos plos e apresentam, por isso, pelagem dourada. J os ces com gentipos "EE" ou "Ee" apresentam pigmento nos plos, que pode ser preto ou marrom, dependendo do outro gene: os ces homozigticos recessivos "bb" apresentam pelagem marrom, enquanto os com gentipos "BB" ou "Bb" apresentam pelagem preta. Um labrador macho, com pelagem dourada, foi cruzado com uma fmea preta e com uma fmea marrom. Em ambos os cruzamentos, foram produzidos descendentes dourados, pretos e marrons. a) Qual o gentipo do macho dourado, quanto aos dois genes mencionados? b) Que tipos de gameta e em que proporo esse macho forma? c) Qual o gentipo da fmea preta? d) Qual o gentipo da fmea marrom?

9. (Ufes 97) Analisando a via metablica hipottica, temos que:

7. (Uerj 2001) As reaes enzimticas a seguir indicam a passagem metablica que sintetiza pigmentos em uma planta.

O gene A episttico sobre o gene B e, quando em homozigose recessiva (aa), impede a produo dos pigmentos rosa e vermelho, devido no produo de enzima X. O gene B, em homozigose recessiva, impossibilita a converso de pigmento rosa em vermelho. Os genes A e B so dominantes sobre os seus alelos. Responda: Considere as seguintes condies: a) No cruzamento entre indivduos de gentipos AaBbaabb, qual ser a proporo fenotpica esperada na prognie? - para as enzimas A e B, os alelos A e B produzem enzimas funcionais, enquanto os alelos a e b produzem enzimas inativas; - uma nica cpia funcional da enzima A ou da enzima B suficiente para catalisar normalmente a sua respectiva reao. b) Quais so os possveis gentipos para os indivduos vermelhos? c) Quais os fentipos esperados e suas respectivas propores em F obtidos a partir de parentais AABB aabb?

Determine a proporo esperada entre as cores das plantas descendentes na primeira gerao do cruzamento AaBbAABb.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

11. (Ufscar 2002) Na herana da cor do fruto da moranga, esto envolvidos dois pares de genes A/a e B/b. O gene B produz frutos amarelos, mas, na presena do gene A, ele inibido e produz frutos brancos, como o seu alelo b. O indivduo duplo recessivo produz frutos verdes. Uma planta homozigota, produtora de frutos amarelos, cruzada com outra, produtora de frutos verdes. Uma planta, filha desse cruzamento, que ser chamada de planta I, foi cruzada com

10. (Ufmg 94) Em camundongos, o tipo selvagem, encontrado comumente na natureza, apresenta pelagem de colorao acinzentada (aguti). Duas outras coloraes so tambm observadas: preta e albina. Observe os dois pares de genes envolvidos e os fentipos relativos aos tipos de colorao dos camundongos.

A _ B _ = Aguti

outra planta, II, produtora de frutos brancos. O cruzamento entre a planta I e a planta II produziu 4/8 de plantas com frutos brancos, 3/8

A _ bb

= Preto

de plantas com frutos amarelos e 1/8 de plantas com frutos verdes. Responda:

aaB _ e aabb = Albinos a) Que denominao se d a este tipo de interao entre os genes A e Utilizando essas informaes e seus conhecimentos, faa o que se pede. b) Quais os gentipos das plantas I e II? a) Do cruzamento entre camundongos preto e albino obtiveram-se 100% de camundongos aguti. D os gentipos dos camundongos envolvidos no cruzamento. b) Do cruzamento de dois camundongos aguti obtiveram-se descendentes na seguinte proporo: 9 aguti: 3 pretos: 4 albinos. CITE todos os gentipos possveis para os camundongos albinos obtidos e APRESENTE UMA EXPLICAO para a alterao da proporo 9:3:3:1 (esperada em cruzamento de dibridos) para 9:3:4. c) CITE a probabilidade de se obterem camundongos pretos do cruzamento de albinos (duplo homozigotos) com aguti (duplo heterozigotos). 13. (Unicamp 98) Existe um gene em cobaias que suprime o efeito do gene que determina a colorao nesses animais. Esse gene est localizado em um cromossomo diferente daquele em que est o gene que determine a cor do animal. Cobaias albinas homozigotas foram cruzadas e todos os descendentes nasceram pretos. Como isto pode ser explicado, considerando-se que no ocorreu mutao? Justifique. 12. (Unesp 96) Numa dada planta, o gene B condiciona fruto branco e o gene A condiciona fruto amarelo, mas o gene B inibe a ao do gene A. O duplo recessivo condiciona fruto verde. Considerando que tais genes apresentam segregao independentemente um do outro, responda: a) Como se chama esse tipo de interao? b) Qual a proporo fenotpica correta entre os descendentes do cruzamento de plantas heterozigotas para esses dois pares de genes? B?



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

15. (Ufes 2002) Trs grupos de alunos realizaram cruzamentos-testes entre plantas de tomate para o estudo de diferentes genes. Os grupos obtiveram os seguintes resultados:

14. (Fuvest 2002) O esquema a seguir representa, numa clula em diviso meitica, dois pares de cromossomos com trs genes em heterozigose: A/a, B/b e D/d. Nesses cromossomos, ocorreram as permutas indicadas pelas setas 1 e 2.

a) Indique o(s) grupo(s) que trabalhou (trabalharam) com genes a) Quanto aos pares de alelos mencionados, que tipos de gameta esta clula poder formar? b) O que significa, em Gentica, o termo ligao? Qual a sua b) Que pares de alelos tm segregao independente? utilidade para a pesquisa cientfica? ligados, Justifique.

c) Calcule a distncia, em unidades de mapa gentico, entre os genes pesquisados pelos alunos do grupo G2.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

18. (Fuvest 95) Um organismo, homozigoto para os genes A B C D, todos localizados em um mesmo cromossomo, cruzado com outro, que homozigoto recessivo para os mesmos alelos. O retrocruzamento de F1 (com o duplo recessivo) mostra os seguintes resultados:

16. (Ufv 2004) Considere que os genes autossmicos, identificados nos cromossomos (I e II), correspondam a aptides para aprender biologia (B), matemtica (M) e tocar guitarra (G). Em um dado loco, um indivduo com gentipo recessivo no apresenta aptido; um indivduo heterozigoto apresenta aptido mediana; e um indivduo homozigoto dominante apresenta maior aptido.

- no ocorreu permuta entre os genes A e C; - ocorreu 20% de permuta entre os genes A e B, 30% entre A e D; - ocorreu 10% de permuta entre os genes B e D.

a) Baseando-se nos resultados acima, qual a seqncia mais provvel desses 4 genes no cromossomo, a partir do gene A? b) Justifique sua resposta.

19. (Ufrj 2002) Considere a existncia de dois locos em um indivduo. Cada loco tem dois alelos "A" e "a" e "B" e "b", sendo que Com base nessas informaes, faa o que se pede: a) Um casal (P1), formado por um indivduo triplo homozigoto dominante e outro triplo homozigoto recessivo, poder esperar descendentes (F1) com qual(is) gentipo(s)? b) Se um descendente (F1) se casar com um indivduo sem aptido para as trs habilidades, qual a probabilidade desse casal ter uma criana com aptido mediana para matemtica? c) Qual o nome do mecanismo gentico, proposto por Thomas Hunt Morgan, que permitiria ao casal do item b ter filhos com aptido mediana para aprender biologia mas sem aptido para tocar guitarra? d) Quais os locos cuja herana no resultar em propores segregantes dentro dos padres da segunda Lei de Mendel? e) Uma me sem aptido para aprender biologia e tocar guitarra, mas com aptido mediana para aprender matemtica, ter 100% dos filhos(as) com aptido no mnimo mediana para as trs caractersticas, ao se casar com um indivduo com gentipo: Esses resultados contrariam a segunda lei de Mendel ou lei da segregao independente? Justifique sua resposta. Um pesquisador cruzou um indivduo "AaBb" com um indivduo "aabb". A prole resultante foi: 40% AaBb 40% aabb 10% Aabb 10% aaBb O pesquisador ficou surpreso, pois esperava obter os quatro gentipos na mesma proporo, 25% para cada um deles. "A" e "B" so dominantes.

17. (Unicamp 96) Os locos gnicos A e B se localizam em um mesmo cromossomo, havendo 10 unidades de recombinao (morgandeos) entre eles. a) Como se denomina a situao mencionada? Supondo o cruzamento AB/ab com ab/ab b) Qual ser a porcentagem de indivduos AaBb na descendncia? c) Qual ser a porcentagem de indivduos Aabb?



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

20. (Ufrj 2007) Sabendo que a maioria das mutaes deletria (prejudicial ao organismo), o evolucionista John Maynard-Smith escreveu sobre a meiose, durante a produo de gametas: "A meiose o equivalente a ter dois carros, um com a transmisso quebrada, outro com o motor quebrado e, com eles, produzir um nico carro que funcione". A figura a seguir ilustra um par de cromossomos homlogos duplicados (A e B), bem como as localizaes dos alelos deletrios "M" (presente somente no cromossomo A) e "N" (presente somente no cromossomo B).

Um indivduo que possui os cromossomos A e B poder formar gametas que no sejam portadores dos alelos M e N? Justifique sua resposta.

21. (Unifesp 2005) Os locos M, N, O, P esto localizados em um mesmo cromossomo. Um indivduo homozigtico para os alelos M, N, O, P foi cruzado com outro, homozigtico para os alelos m, n, o, p. A gerao F foi ento retrocruzada com o homozigtico m, n, o, p. A descendncia desse retrocruzamento apresentou 15% de permuta entre os locos M e N. 25% de permuta entre os locos M e O. 10% de permuta entre os locos N e O. No houve descendentes com permuta entre os locos M e P.

Responda. a) Qual a seqncia mais provvel desses locos no cromossomo? Faa um esquema do mapa gentico desse trecho do cromossomo, indicando as distncias entre os locos. b) Por que no houve descendentes recombinantes com permuta entre os locos M e P?



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

1. a) No ncleo dos espermatozides produzidos pelo verme seriam observados um cromossomo e, portanto, uma molcula de DNA. b) AB, Ab, aB e ab. c) Os genes esto em ligao fatorial e, no dispondo da freqncia de permutao ou da distncia entre os citados genes, torna-se impossvel prever a proporo de cada tipo de gameta formado pelo animal.

2. a) Realmente, os alelos no se misturam na fecundao, como afirmou Mendel. Porm, no fenmeno conhecido como DOMINNCIA INCOMPLETA, o fentipo do indivduo heterozigtico intermedirio entre os fentipos dos dois indivduos homozigticos que lhe deram origem. b) A troca de material gentico entre cromossomos herdados do pai e da me pode ocorrer na gametognese, durante a meiose, na fase de prfase I. O processo chamado de PERMUTAO ou "crossingover".

6. a) macho dourado ser eeBb b) 50% eB; 50% eb c) fmea preta ser EeBb d) fmea marrom ser Eebb

7. A proporo dever ser de 3 de cor prpura para 1 de cor vermelha.

8. AaBb Para que o macho seja cinza, deve apresentar, pelo menos, um alelo

3. Principais mecanismos de gerao de variabilidade gentica em famlias humanas: 1) recombinao (permutao) - troca de partes entre os cromossomos homlogos durante o processo de diviso meitica. 2) segregao independente - separao aleatria dos cromossomos homlogos durante a diviso meitica de cada clula germinativa (materna e paterna). 3) mutao - alterao na informao gentica produzida por erros de duplicao do material gentico ou por ao de agentes mutagnicos.

A e um alelo B. Como foi cruzado com uma fmea albina (aabb) e existem tanto descendentes de pelagem preta (bb), quanto albinos (aa), o macho deve possuir os alelos a e b.

9. a) 25% vermelho (AaBb) 25% rosa (Aabb) 50% brancos (aaBb e aabb)

b) Indivduos vermelhos sero: AABB ou AaBB ou AABb ou AaBb

4. O caso 2, que ocorre quando os dois locos esto no mesmo cromossomo, com permuta gnica entre eles. A proporo fenotpica 9:3:3:1 (caso 1) s ocorre quando os dois locos esto em cromossomos diferentes.

c) 9/16 vermelhos (A_B_) 3/16 rosa (A_bb) 4/16 brancos (3/16 aaBb e 1/16 aabb)

10. a) AAbb (preto) x aaBB (albino) AaBb (aguti) 5. a) Os genes esto localizados em cromossomos diferentes (figura 1). b) Albinos: aaBB, aaBb e aabb. Explicao: epistasia recessiva. c) 1/4 ou 25%

b) Os genes esto em "Linkage", ou seja, esto localizados no mesmo cromossomo (figura 2).

11. a) Epistasia dominante.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

c) Os genes pesquisados pelo grupo G2 distam entre si 14 unidades de recombinao (UR), pois permutam com uma freqncia de 14%.

b) As plantas I e II apresentam, respectivamente, os gentipos aaBb e

12. a) Epistasia dominante. b) 12 brancos : 3 amarelos : 1 verde 16. a) Pais: BG/BG MM x bg/bg mm F: Bg/Bg Mm 13. Trata-se de um caso de interao gnica do tipo epistasia recessiva. Assim temos dois pares de genes com segregao independente agindo da seguinte forma: b) Pais: Bb/Gg Mm x bg/bg mm P(filho Mm) = 50%

A - determina a produo de pigmento preto a - no determina a produo de pigmento I - permite a expresso do gene A i - em homozigose inibe a expresso do gene A

c) Ligao fatorial (linkage).

d) B e G.

e) BG/BG MM O cruzamento seria indicado por: 17. a) Ligao fatorial incompleta com freqncia de permutao Pais : AAii (albino) X aaII (albino) igual a 10%. b) AB/ab = 45% F: 100% AaIi (pretas) c) Ab/ab = 5%

14. a) Tipos de gametas:

18. a) A seqncia, partindo-se do gene A, ACBD ou DBCA.

1 - Ab D 2 - Ab d 3 - aB D 4 - aB d

b) A freqncia de permutao indica a distncia dos genes no cromossomo: quanto maior a distncia entre os genes maior a freqncia de permutao. O fato de no ter ocorrido permutao entre os genes A e C indica que eles devem estar muito prximos.

b) Pares de alelos com segregao independente: Aa e Bb com Dd.

19. Sim. A segunda lei de Mendel fala da segregao independente, o que s ocorre quando se consideram locos em cromossomos

15. a) Todos os grupos trabalharam com genes ligados no mesmo cromossomo. A recombinao gnica (crossig-over) no ocorre entre genes localizados em cromossomos diferentes.


20. Sim. A permutao ("crossing-over") possibilita que o alelo deletrio de um membro do par de homlogos seja trocado pelo alelo

b) Ligao fatorial (ou linkage) refere-se a genes situados linearmente no mesmo cromossomo. Genes prximos permutam com menor freqncia, genes mais distantes apresentam maior taxa de recombinao. Deste modo, atravs da anlise das taxas de recombinao, possvel ter-se uma noo relativa das distncias entre os genes ligados. De posse das distncias relativas pode-se, ento, elaborar mapas cromossmicos.

normal do outro, formando uma cromtide sem alelos deletrios. Esta cromtide dar origem a cromossomos normais nos gametas.

21. a)



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

O gene P no permutou com M porque, provavelmente, localiza-se muito prximo a ele, sua direita ou esquerda.

b) Quanto maior a distncia entre dois genes, maior ser a probabilidade de ocorrer permuta entre eles. Entre genes muito prximos, a probabilidade de ocorrer permuta menor.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

4. (Fuvest 94) Uma anomalia gentica autossmica recessiva condicionada por uma alterao na seqncia do DNA. Um homem portador dessa anomalia apresenta a seqncia timina-citosina-timina enquanto sua mulher, que normal, apresenta a seqncia timinaadenina-timina. A anlise do DNA de um filho do casal mostrou que ele portador tanto da seqncia de bases do pai quanto da me. a) O filho ter a doena? Por qu? b) Qual a probabilidade de um outro filho do casal apresentar as duas seqncias iguais da me?

Lista 3
1. (Ufjf 2007) O esquema a seguir ilustra de forma sinttica o processo de formao de gametas (meiose) de um indivduo de gentipo AaBb. a) Complete o esquema:

5. (Fuvest 95) Um homem afetado por uma doena gentica muito rara, de herana dominante, casa-se com uma mulher, no consangnea. Imagine que o casal tenha doze descendentes, seis filhos e seis filhas. Responda, justificando sua resposta, qual ser a proporo esperada de filhas e filhos afetados pela doena do pai no caso do gene em questo estar localizado. a) em um autossomo; b) no cromossomo X.

b) Qual a probabilidade deste indivduo formar o gameta ab? Justifique sua resposta. c) Qual a importncia da meiose para a manuteno de uma espcie? d) Considere que os genes A e B esto envolvidos na determinao da cor das flores. O alelo A permite a formao de pigmentos e dominante sobre o alelo a, que inibe a manifestao da cor. O alelo B determina a cor vermelha e dominante sobre o alelo b, que determina a cor rosa. Se uma planta de flores vermelhas, oriunda das sementes de uma planta de flores brancas (aabb), autofecundada, que fentipos so esperados na descendncia e em que propores?

6. (Udesc 96) "Hormnios so protenas cuja funo regular os complicados mecanismos do organismo - como o aumento e reduo do peso do corpo (...) Em outubro, o geneticista Jeffrey Friediman (...) isolou o primeiro hormnio capaz de controlar o peso, chamado leptina. Ele produzido por um gene que, quando funciona mal, o organismo ganha peso (...)". (In: "Superinteressante" - ano 10, n. 3, mar., 1996.)

Com base no texto, RESPONDA: a) Como se denomina o local que o gene ocupa nos cromossomos? b) Considerando de forma simplificada a existncia de dois alelos para o gene da leptina, um normal (L) e outro mutante (L'), quantos gentipos diferentes so possveis em humanos diplides? Quais so eles? c) COMENTE sobre um mecanismo que pode levar mutao gnica.

2. (Fuvest 91) No porquinho-da-ndia existe um par de genes autossmicos que determina a cor da pelagem: o alelo dominante B determina a cor preta e o recessivo b, a cor branca. Descreva um experimento que possa evidenciar se um porquinho preto homozigoto ou heterozigoto.

3. (Fuvest 93) Nos porquinhos-da-ndia, a pelagem negra dominante sobre a pelagem branca. Um criador tem um lote de porquinhos-da-ndia negros, com o mesmo gentipo. O que deve fazer para descobrir se esses animais so homozigotos ou heterozigotos? Justifique sua resposta.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

9. (Ufc 2006) Leia o texto a seguir.

7. (Ueg 2007) A fenilcetonria uma doena hereditria determinada por alelo recessivo. A pessoa afetada no consegue metabolizar o aminocido fenilalanina e transform-lo em tirosina. Sobre essa doena, responda ao que se pede. a) Qual a denominao dada ao fenmeno de mltipla expresso de um nico gene, que ocorre na pessoa afetada por fenilcetonria? b) Cite o que a pessoa afetada pode fazer para impedir as manifestaes fenotpicas desse gene.

8. (Uerj 2007) No incio do sculo XX, a transmisso das informaes genticas para os descendentes era explicada por algumas hipteses sobre as leis da hereditariedade, como a mendeliana e a por mistura. Observe os esquemas:

"A Doena de Alzheimer (D.A.) (...) uma afeco neurodegenerativa progressiva e irreversvel, que acarreta perda de memria e diversos distrbios cognitivos. Em geral, a D.A. de acometimento tardio, de incidncia ao redor de 60 anos de idade, ocorre de forma espordica, enquanto que a D.A. de acometimento precoce, de incidncia ao redor de 40 anos, mostra recorrncia familiar. (...) Cerca de um tero dos casos de D.A. apresentam familiaridade e comportam-se de acordo com um padro de herana monognica autossmica dominante. Estes casos, em geral, so de acometimento precoce e famlias extensas tm sido periodicamente estudadas." Smith, M.A.C. (Revista Brasileira de Psiquiatria, 1999)

Considerando o texto e o histrico familiar a seguir, responda ao que se pede. Histrico familiar: "Um rapaz cujas duas irms mais velhas, o pai e a av paterna manifestaram Doena de Alzheimer de acometimento precoce."

Suponha que, em um indivduo de uma populao com reproduo sexuada, aparea, por mutao, um gene raro que confira ao seu portador caractersticas vantajosas. Indique, para cada uma das hipteses representadas, se h ou no possibilidade de aumento da freqncia do gene mutante na descendncia desse indivduo e justifique suas respostas.

I. Montar o heredograma para o histrico familiar apresentado. II. Qual a probabilidade de o rapaz em questo tambm ser portador do gene responsvel pela forma de acometimento precoce da doena? III. Quais indivduos do heredograma so seguramente heterozigotos para esse gene? IV. Explicar o padro de herana mencionado no texto.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

12. (Ufrj 2003) Um pesquisador teve sucesso na integrao de uma cpia do gene que codifica o hormnio do crescimento de rato (HCR) em um dos cromossomos autossmicos de uma clula-ovo de camundongo. A clula-ovo transgnica se desenvolveu, dando origem a um camundongo macho. Este camundongo transgnico foi cruzado com uma fmea de camundongo normal, isto , no portadora do gene HCR.

10. (Ufc 2007) Mendel no acreditava na mistura de caracteres herdados. De acordo com suas concluses, a partir dos cruzamentos realizados com ervilhas do gnero 'Pisum', as caractersticas no se misturam, permanecem separadas e so transmitidas independentemente. HENIG, Robin. "O monge no jardim". Rio de Janeiro: Rocco, 2001.

a) Considerando as leis de Mendel para a hereditariedade, no momento da fecundao os cromossomos herdados dos progenitores se juntam, porm os alelos dos seus genes no se misturam. A partir dessa idia, qual fenmeno explicaria a ocorrncia de caractersticas intermedirias na prognie, que parecem ser uma mistura daquelas dos progenitores? b) Posteriormente, estudos de grupos de geneticistas indicaram que pode haver troca de material gentico entre cromossomos homlogos herdados do pai e da me. Em que etapa isso pode ocorrer e como se chama este processo?

11. (Ufrj 99) A formao de uma caracterstica fenotpica depende, em alguns casos, apenas de fatores genticos. Em outros casos, prevalece a influncia de fatores ambientais. Na maioria das vezes h uma interao entre fatores genticos e ambientais. Um dos mtodos utilizados para avaliar a importncia relativa dos genes e dos fatores ambientais na formao de uma caracterstica o estudo comparativo entre irmos gmeos monozigticos criados juntos e criados separados. A tabela a seguir, elaborada a partir de um grande nmero de pares de gmeos, indica o grau de concordncia de quatro caractersticas. Uma concordncia significa que quando um irmo possui a caracterstica, o outro tambm a possui.

Calcule a proporo esperada da prole destes camundongos que ser portadora do gene que codifica o HCR. Justifique sua resposta.

Indique a caracterstica que mais depende de fatores ambientais. Justifique sua resposta.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

16. (Unesp 97) Em gatos, as cores marrom e branca dos plos tm sido descritas como devidas a, pelo menos, um par de genes. Considere o cruzamento de gatos homozigotos brancos e marrons. Qual a proporo fenotpica esperada em F se a) o modo de herana for do tipo dominante? b) o modo de herana for do tipo co-dominante?

13. (Ufrj 2004) Um pesquisador observou que uma certa espcie de planta apresentava uma grande variao de produtividade relacionada altitude onde a planta se desenvolvia. Em grandes altitudes, a produtividade era muito baixa; medida que a altitude se aproximava do nvel do mar, a produtividade aumentava. Ele, ento, realizou um experimento em que sementes dessa espcie, coletadas em diversas altitudes, foram plantadas ao nvel do mar em idnticas condies ambientais. Aps algum tempo, a produtividade dessas plantas foi medida e apresentou os seguintes resultados:

17. (Unesp 2005) Suponha que voc tenha em seu jardim exemplares da mesma espcie de ervilha utilizada por Mendel em seus experimentos. Alguns desses exemplares produzem sementes lisas e outros, sementes rugosas. Sabendo que a caracterstica "lisa" das sementes da ervilha determinada por um alelo dominante L, portanto por gentipos LL ou Ll e, sabendo ainda, que as flores so hermafroditas e que sementes produzidas por autofecundao so viveis, a) planeje um cruzamento experimental entre flores de exemplares diferentes que lhe permita determinar se uma planta que produz sementes lisas homozigota ou heterozigota para esse carter. b) No caso de ocorrer autofecundao em uma planta que produz sementes lisas e heterozigota, qual seria a proporo esperada de descendentes com sementes rugosas?

Identifique se o componente gentico ou o componente ambiental que predomina no condicionamento da produtividade dessas plantas. Justifique sua resposta.

14. (Ufv 96) Um determinado casal normal, mas heterozigoto para o albinismo, solicitou aconselhamento gentico sobre a possibilidade de vir a ter crianas apresentando a condio albina. Qual a probabilidade desse casal ter: a) quatro crianas albinas? b) uma criana albina e do sexo feminino? c) uma criana normal, heterozigota e do sexo masculino? d) Represente o provvel heredograma desse casal, admitindo-se que as suposies feitas nas letras (b) e (c) realmente se concretizem.

18. (Unicamp 91) Um criador de cabras, depois de muitos anos nesse ramo, observou que alguns dos animais de sua criao apresentavam uma caracterstica incomum nos chifres. Como o criador poderia fazer para determinar se essa variao decorrente de uma mutao gentica ou de uma alterao causada por fatores ambientais?

19. (Unicamp 95) Em experimento feito no incio do sculo, dois pesquisadores retiraram os ovrios de uma cobaia albina e implantaram-lhe um ovrio obtido de uma cobaia preta. Mais tarde, o animal foi cruzado com um macho albino e deu origem a uma prole toda preta. a) Sabendo-se que o albinismo caracterstica recessiva, como voc explica esse resultado? b) Indique os gentipos da fmea preta e da prole. c) Se fosse possvel implantar os plos da fmea preta na fmea albina, em vez de transplantar o ovrio, o resultado seria o mesmo? Justifique.

15. (Unesp 93) Recentemente, os meios de comunicao noticiaram o caso de uma mulher norte-americana que, impossibilitada de ter filhos por anomalia no tero, teve seu vulo fertilizado "in vitro", e este foi implantado no tero de sua me. Assim, quem engravidou e deu luz foi a me da referida mulher. Responda: a) Do ponto de vista gentico, quem a me da criana? Justifique. b) Qual a porcentagem de genes herdados da parturiente que se encontram no patrimnio gentico da criana?



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

22. (Unicamp 2004) A herana da cor do olho na espcie humana geralmente representada simplificadamente como um par de alelos, A (dominante, determinando cor castanha) e a (recessivo, determinando cor azul). Baseando-se nessa explicao, analise as afirmaes abaixo, proferidas por casais em relao cor dos olhos de seu beb, verificando se elas tm fundamento. Justifique sua resposta. a) Afirmao de um casal de olhos azuis: "nosso beb poder ter olhos castanhos porque as avs tm olhos castanhos". b) Afirmao de um casal de olhos castanhos: "nosso beb poder ter olhos azuis porque o av paterno tem olhos azuis".

20. (Unicamp 99) Em vrias culturas vegetais, os programas de melhoramento utilizam a heterose (vigor do hbrido). Nesses programas so desenvolvidas linhagens homozigotas por meio de sucessivas geraes autofecundadas. Duas linhagens, homozigotas para alelos diferentes, so ento cruzadas e produzem os hbridos, que, em geral, so mais vigorosos e mais produtivos que os parentais. a) Esses indivduos hbridos so geneticamente iguais entre si? Explique. b) Se o agricultor utilizar as sementes produzidas pelo hbrido nos plantios subsequentes, o resultado no ser o mesmo. Por qu?

21. (Unicamp 2001) Ao estudar a distribuio de uma espcie de planta da famlia dos girassis em altitudes crescentes na costa oeste dos Estados Unidos, pesquisadores observaram que essas plantas apresentavam um gradiente decrescente de tamanho. Sementes dessas plantas foram coletadas nas vrias altitudes e plantadas em uma mesma regio localizada ao nvel do mar. Aps um determinado tempo de crescimento, as plantas resultantes foram medidas e os dados obtidos no experimento so mostrados no grfico A.

23. (Fuvest 98) Em uma espcie de planta a forma dos frutos pode ser alongada, oval ou redonda. Foram realizados quatro tipos de cruzamento entre plantas dessa espcie e obtidos os seguintes resultados:

a) Explique o resultado obtido, expresso no grfico A.

b) Se o resultado do experimento tivesse sido o representado no grfico B, qual seria a interpretao?

a) Formule uma hiptese consistente com os resultados obtidos para explicar a herana da forma dos frutos nessa espcie. b) Represente os alelos por letras e indique os gentipos dos indivduos parentais e dos descendentes no cruzamento IV.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

26. (Unesp 91) Em gado, a cor da pelagem vermelha, ruo e branca, controlada por genes codominantes, e o cruzamento de animais com chifres versus animais sem chifres, s vezes s origina prole sem chifres, e, em outros cruzamentos, aparecem os dois tipos em igual nmero. Um fazendeiro tem uma grande boiada constituda de animais vermelhos, rues, brancos e sem chifres, os quais, ocasionalmente produzem prole com chifres. Utilizando apenas cruzamentos naturais, ou seja, sem recorrer inseminao artificial, como o fazendeiro dever proceder para estabelecer uma linhagem pura de animais brancos e sem chifres? Por que ele no conseguir resolver o problema dos chifres rapidamente? 27. (Unicamp 2000) O grfico a seguir mostra a mortalidade de mosquitos de uma determinada espcie quando expostos a diferentes concentraes de um inseticida. A resistncia ou susceptibilidade ao inseticida devida a um locus com dois alelos, A e A.

24. (Uff 2000) Considere uma certa espcie de planta que pode apresentar flores com trs tipos de cor: azul, azul-claro e branca. Estas cores so determinadas por combinaes de dois alelos de um nico locus. Na expresso fenotpica de tais cores no h relao de dominncia entre os alelos, sendo que a manifestao em homozigose de um dos alelos - aa, cor branca - letal na fase adulta. Sabe-se que: - a flor de cor branca nunca se abre; - em um jardim de plantas com flores de cor azul no nascem plantas com flores de cor azul-claro.

a) Realizou-se o cruzamento entre as plantas com flores azul-claro e, a partir das sementes obtidas, formou-se um jardim. Determine a cor das flores que tm menor possibilidade de se abrirem neste jardim. Justifique a resposta.

b) Realizaram-se os cruzamentos possveis entre as plantas com flores das cores mencionadas, presentes em igual quantidade. A partir das sementes obtidas, formou-se outro jardim. Determine a cor das flores que tm maior possibilidade de se abrirem neste jardim. Justifique a resposta.

25. (Ufrj 96) Em rabanetes, a forma da raiz determinada por um par de genes alelos. Os fentipos formados so trs: arredondado, ovalado ou alongado. Cruzamentos entre plantas de razes alongadas com plantas de razes arredondadas produziram apenas indivduos com razes ovaladas. Em cruzamentos desses indivduos ovalados entre si, foram obtidas quatrocentas sementes que foram plantadas em sementeiras individuais. Antes que as sementes germinassem, as sementeiras foram distribudas a diversas pessoas; voc recebeu uma delas. a) Qual a relao de dominncia entre os caracteres em questo? b) Qual a probabilidade de que, na sua sementeira, venha a se desenvolver um rabanete de raiz ovalada? Justifique a sua resposta. a) Qual o gentipo mais resistente? Como voc chegou a essa concluso?

b) Observando as trs curvas, que concluso se pode tirar sobre as relaes de dominncia entre os alelos deste locus? Explique.

c) Os indivduos de cada um dos gentipos no se comportam da mesma forma quanto resistncia ao inseticida e, por isso, os pontos distribuem-se ao longo da curva. Essas diferenas podem ser atribudas a efeitos pleiotrpicos de outros genes? Justifique sua resposta utilizando o conceito de efeito pleiotrpico.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

29. (Ufc 96) A figura a seguir, adaptada da Folha de So Paulo de 17/03/96, mostra a transmisso do albinismo, de gerao, na Famlia de Raimundo e Elelde da Silva, moradores da ilha dos Lenis, situada a oeste de So Lus, onde a freqncia de albinos de 1,5 % e cinqenta vezes maior do que entre o restante da populao do Maranho.

28. (Fuvest 2001) O heredograma a seguir representa uma famlia com pessoas afetadas por uma doena hereditria.

a) A doena tem herana dominante ou recessiva? Por qu?

b) A doena tem herana autossmica ou ligada ao cromossomo X? Por qu?

Analise a figura onde se admite que a pigmentao da pele devida a um par de alelos (A,a). Os indivduos I - 1, II - 6, V - 2, V - 3 e V - 5 so albinos. Responda, ento: a) Que nome se d ao aparecimento, numa dada gerao, de uma caracterstica expressa em antepassados remotos? b) O albinismo se deve a alelo dominante ou a alelo recessivo? Explique com base na figura. c) Qual a probabilidade de os indivduos de pigmentao normal da gerao V serem todos heterozigotos?



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

31. (Uff 97) O heredograma a seguir refere-se ao caso de braquidactilia. Identifique e justifique o tipo de herana.

30. (Ufes 2001) Nos Estados Unidos, um grupo de cientistas do "Genetics & IVF Institute" vem testando um novo mtodo que permite a seleo dos espermatozides a partir de sua colorao, de acordo com a presena ou ausncia do cromossomo Y ('Microsort'). Tal mtodo, alm de satisfazer os anseios de vrios casais na escolha do sexo do filho, poder ser benfico quando utilizado por famlias portadoras de determinadas anomalias genticas.

Analise os dois heredogramas anteriores, considerando que o carter determinado por um nico par de genes, e responda s seguintes questes:

32. (Uff 2004) O padro de herana de uma doena, que se suspeita ser autossmica recessiva ou ligada ao sexo, foi analisada em trs famlias diferentes (I, II e III), como representado nos heredogramas a seguir:

a) Qual o padro de herana envolvido na determinao da caracterstica representada no heredograma 1 e no heredograma 2? Justifique sua resposta.

b) Em qual das duas situaes seria mais recomendado o uso da tcnica ('Microsort') para a escolha de um beb do sexo feminino? Por qu?

c) Considerando o heredograma n.1, calcule a chance de os indivduos III.1 e III.2 gerarem uma criana afetada do sexo masculino.

a) Qual o tipo de herana da doena? Justifique sua resposta. b) Suponha que a mulher 3 da famlia I case-se com o homem 4 da famlia III. Qual a probabilidade de nascer uma criana doente? Justifique.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

34. (Ufrj 2001) No heredograma abaixo a cor preta indica indivduos com pelagem negra, fentipo determinado por um gene autossmico dominante A. A cor branca indica pelagem branca determinada por um gene recessivo. Os indivduos 5 e 8 devem ser considerados homozigotos (AA), a menos que haja evidncia contrria.

33. (Ufjf 2002) Numa aula de gentica, o professor lhe apresenta o heredograma a seguir, que mostra a ocorrncia de uma anomalia causada pela ao de um par de genes (A e a) em vrias geraes de uma famlia. Ao analisar os indivduos afetados por esta anomalia, voc conclui que se trata de uma herana autossmica dominante.

Baseando-se EXCLUSIVAMENTE no heredograma apresentado acima, responda: a) Por que a anomalia NO pode ser recessiva?

Qual a probabilidade de que o cruzamento entre o indivduo 9 e o indivduo 10 gere um indivduo de pelagem branca?

b) Por que a anomalia NO pode ser ligada ao cromossomo X?

35. (Ufrj 2004) Os heredogramas A, B e C a seguir representam trs famlias diferentes. Os crculos representam mulheres e os quadrados, homens. Quadrados ou crculos escuros representam indivduos afetados por uma caracterstica comum na populao.

c) Qual a probabilidade de nascer uma criana afetada pela anomalia, se a mulher (4) da gerao F3 tiver filhos com um homem que apresente essa anomalia?

a) Identifique os heredogramas que so compatveis com uma herana autossmica recessiva. Justifique sua resposta para cada famlia. b) Determine se em algum dos casos apresentados existe herana ligada ao cromossomo Y. Justifique.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

37. (Unesp 2002) Analise a genealogia, que apresenta indivduos afetados por uma doena recessiva e indivduos normais.

36. (Unesp 94) Na genealogia adiante, os indivduos em escuro apresentam uma doena hereditria, enquanto os outros exibem fentipo normal. Os crculos representam as mulheres e os quadrados, os homens.

a) Quais os indivduos representados na genealogia que so obrigatoriamente heterozigotos?

Analise esta genealogia e responda. a) Esta doena hereditria condicionada por gene dominante ou recessivo? b) Dos dez indivduos que compem esta genealogia, qual o nico que no pode ter seu gentipo definido? Explique por qu. b) Qual a probabilidade de o casal formado pelos indivduos II2 e II3 ter mais dois filhos, sendo ambos do sexo masculino e afetados?

38. (Unicamp 91) Uma determinada caracterstica foi estudada em centenas de pares de gmeos, tanto monozigticos como dizigticos. As diferenas registradas entre os irmos dizigticos foram praticamente da mesma magnitude que as encontradas entre os irmos monozigticos. Discuta a importncia dos fatores genticos na manifestao dessa caracterstica.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

42. (Ufrj 95) Em uma raa de cachorros, a cor do plo negro determinada por um gene dominante (A) enquanto seu alelo (a) determina a cor branca. O tamanho do plo tambm controlado por um par de genes, sendo o alelo dominante (B) para plo curto e o alelo recessivo (b) para plo longo. A tabela a seguir apresenta os fentipos dos pais e os fentipos das respectivas proles, aps vrios cruzamentos.

39. (Fuvest 94) Considere a figura a seguir que representa o resultado da primeira diviso meitica de uma clula feminina:

a) Indique o gentipo do embrio formado a partir da fecundao do vulo resultante dessa clula por um espermatozide de um macho recessivo para os dois pares de genes considerados. b) Quais os possveis gentipos dos filhos possveis do mesmo casal?

40. (Fuvest 99) Em cobaias, a cor preta condicionada pelo alelo dominante D e a cor marrom, pelo alelo recessivo d. Em um outro cromossomo, localiza-se o gene responsvel pelo padro da colorao: o alelo dominante M determina padro uniforme (uma nica cor) e o alelo recessivo m, o padro malhado (preto / branco ou marrom / branco). O cruzamento de um macho de cor preta uniforme com uma fmea de cor marrom uniforme produz uma ninhada de oito filhotes: 3 de cor preta uniforme, 3 de cor marrom uniforme, 1 preto e branco e 1 marrom e branco. a) Quais os gentipos dos pais? b) Se o filho preto e branco for cruzado com uma fmea cujo gentipo igual ao da me dele, qual a proporo esperada de descendentes iguais a ele?

a) Os genes para a cor e tamanho de plo esto no mesmo par de cromossomas? Justifique sua resposta. b) Quais so os gentipos mais provveis dos pais em cada casal? Justifique sua resposta.

41. (Ufg 2005) Quatro irmos, filhos legtimos de um mesmo casal, apresentam marcantes diferenas em suas caractersticas fsicas.

Descreva trs mecanismos biolgicos potencialmente responsveis por essa variabilidade gentica e explique como atuam.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

44. (Ufscar 2004) A figura mostra a segregao de dois pares de cromossomos homlogos na anfase da primeira diviso meitica de uma clula testicular de um animal heterozigtico quanto a dois genes. As localizaes dos alelos desses genes, identificados pelas letras Aa e Bb, esto indicadas nos cromossomos representados no desenho.

43. (Ufrj 2006) Um pesquisador est estudando a gentica de uma espcie de moscas, considerando apenas dois locos, cada um com dois genes alelos:

loco 1 - gene A (dominante) ou gene a (recessivo); loco 2 - gene B (dominante) ou gene b (recessivo).

Cruzando indivduos AABB com indivduos aabb, foram obtidos 100% de indivduos AaBb que, quando cruzados entre si, podem formar indivduos com os gentipos mostrados na Tabela 1. Sem interao entre os dois locos, as propores fenotpicas dependem de os referidos locos estarem ou no no mesmo cromossomo. Na Tabela 2, esto representadas duas propores fenotpicas (casos 1 e 2) que poderiam resultar do cruzamento de dois indivduos AaBb.

a) Ao final da segunda diviso meitica dessa clula, quais sero os gentipos das quatro clulas haplides geradas? b) Considerando o conjunto total de espermatozides produzidos por esse animal, quais sero seus gentipos e em que proporo espera-se que eles sejam produzidos?

45. (Unicamp 96) Suponha uma planta superior originada de um zigoto no qual dois dos pares de cromossomos, A e B, tm a constituio AABB. a) Qual ser a constituio cromossmica da planta adulta originada desse zigoto? Justifique. b) Se essa planta se reproduzir por autofecundao, a constituio cromossmica de seus descendentes ser igual da planta me? Justifique. Identifique qual dos dois casos tem maior probabilidade de representar dois locos no mesmo cromossomo. Justifique sua resposta.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

49. (Ufrn 2005) Os heredogramas a seguir representam duas famlias com doenas hereditrias distintas. A doena que acomete a famlia 1 provoca retardamento mental acentuado, enquanto que a da famlia 2 uma doena degenerativa fatal que aparece em torno dos 40 anos de idade.

46. (Unicamp 2003) Considere duas linhagens homozigotas de plantas, uma com caule longo e frutos ovais e outra com caule curto e frutos redondos. Os genes para comprimento do caule e forma do fruto segregam-se independentemente. O alelo que determina caule longo dominante, assim como o alelo para fruto redondo.

a) De que forma podem ser obtidas plantas com caule curto e frutos ovais a partir das linhagens originais? Explique indicando o(s) cruzamento(s). Utilize as letras A, a para comprimento do caule e B, b para forma dos frutos. b) Em que proporo essas plantas de caule curto e frutos ovais sero obtidas?

47. (Unifesp 2007) Considere dois genes e seus respectivos alelos: A e a; B e b. Em termos de localizao cromossmica, explique o que significa dizer que esses dois genes a) segregam-se independentemente na formao dos gametas. b) esto ligados. Aps analisar os heredogramas, atenda s solicitaes a seguir. a) Quais os tipos de herana envolvidos na transmisso das doenas de cada famlia? Justifique sua resposta. b) Considerando que a seleo natural pode eliminar doenas genticas, explique por que a doena da famlia 2 ainda poderia ser encontrada em indivduos da gerao VI (netos da gerao IV).

48. (Ufu 2007) Na espcie humana, assim como em todas as outras espcies de seres vivos, existem vrios fentipos dos quais as heranas provm de um par de alelos com relao de dominncia completa. Dentre esses fentipos podem ser citados: 1) sensibilidade gustativa para feniltiocarbamida (PTC) dominante sobre a no sensibilidade; 2) a forma do lobo da orelha, lobo solto dominante sobre lobo aderente; 3) a capacidade de dobrar a lngua dominante sobre a incapacidade de faz-lo. Um casal, cujo marido tem lobo da orelha aderente, heterozigoto para a sensibilidade ao PTC e no capaz de dobrar a lngua. A esposa tem heterozigose para a forma do lobo da orelha, para a sensibilidade ao PTC e para a capacidade de dobrar a lngua. Com base nesses conhecimentos, qual a probabilidade deste casal ter uma criana masculina e com lobo da orelha aderente, no sensvel ao PTC e no ser capaz de dobrar a lngua?

50. (Unicamp 2004) A anemia falciforme caracterizada por hemcias em forma de foice, em funo da produo de molculas anormais de hemoglobina, incapazes de transportar o gs oxignio. Indivduos com anemia falciforme so homozigotos (SS) e morrem na infncia. Os heterozigotos (Ss) apresentam forma atenuada da anemia. Na frica, onde a malria endmica, os indivduos heterozigotos para anemia falciforme so resistentes malria. a) Explique o que esperado para a freqncia do gene S em presena da malria. E em ausncia da malria? b) Qual a explicao para o fato dos heterozigotos para anemia serem resistentes malria?



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

4. a) No, porque a seqncia herdada do pai recessiva em relao materna.

1. a)

b) A probabilidade de uma outra criana desse casal herdar as duas seqncias maternas zero porque na fecundao h unio das seqncias paterna e materna.

5. a) 6 crianas b) Nenhum dos filhos ser afetado (XaY) e todas as filhas (XAXa) sero afetadas.

6. a) Locus gnico b) 3 gentipos - LL, LL' e L'L' c) Exposio s radiaes ionizantes pode causar danos ao DNA.

b) P(ab) = P(a) (b) = 1/2 1/2 = 1/4 c) O processo de formao de gametas (meiose) importante porque promove a variabilidade gentica e mantm constante o nmero cromossmico da espcie. d) Planta de flores vermelhas AaBb

7. a) Pleoitropia b) Dieta deficiente em fenilalanina

AaBb AaBb (autofecundao) A_ B_ 9 vermelhas A_ bb 3 rosas AaB_ 3 brancas Aabb 1 branca

8. Hereditariedade mendeliana: h possibilidade, pois os genes so transmitidos inalteradamente para a prxima gerao; pode haver mistura dos fentipos dos genitores, mas no dos genes individualmente. Hereditariedade por mistura: no h possibilidade, pois esta hiptese prope uma mescla de genes, no permitindo a seleo do gene mutante.

9. I. O heredograma correspondente ao histrico familiar descrito deve ter o seguinte aspecto:

9/16 vermelhas : 3/16 rosas : 4/16 brancas

2. Cruzando-se um porquinho preto (B_ ) com um recessivo (bb) . Se o resultado for 100% preto o porquinho analisado BB, se for 50% preto e 50% branco, o porquinho Bb.

3. Cruzando-se um porquinho preto (B_ ) com um recessivo (bb). Se o resultado for 100% preto o porquinho analisado BB, se for 50% preto e 50% branco, o porquinho Bb.


II. 50%

Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

III. Apenas o pai e as duas irms mais velhas do rapaz so seguramente heterozigotos para esse gene. IV. O padro de herana monognica autossmica dominante condicionado por um nico gene, no relacionado ao sexo, que se manifesta inclusive em indivduos heterozigotos, por ser dominante.

10. a) Realmente, os alelos no se misturam na fecundao, como afirmou Mendel. Porm, no fenmeno conhecido como DOMINNCIA INCOMPLETA, o fentipo do indivduo heterozigtico intermedirio entre os fentipos dos dois indivduos homozigticos que lhe deram origem. b) A troca de material gentico entre cromossomos herdados do pai e da me pode ocorrer na gametognese, durante a meiose, na fase de prfase I. O processo chamado de PERMUTAO ou "crossingover". 15. a) A mulher que no podia engravidar porque foi a doadora do vulo implantado em sua me. b) Em mdia 25% dos genes seriam herdados da av parturiente.

11. A caracterstica 2, pois gmeos com o mesmo padro gentico (univitelnicos) apresentam grau de concordncia menor em ambientes diferentes.

16. a) Se o padro da herana for dominante, em F os descendentes sero todos marrons ou todos brancos de acordo com o gene dominante.

12. A proporo de 50% (metade) da prole. Na formao dos gametas, os membros de um par de cromossomos homlogos so separados; portanto, s 50% dos gametas do pai sero portadores do gene do HCR. A me contribuir sempre com um cromossomo no portador do gene do HCR.

b) Na herana sem dominncia todos os descendentes devero apresentar uma cor intermediria entre marrom e branco.

17. a) Realizar um test-cross ou cruzamento-teste, ou seja cruzar a lisa com uma rugosa. Se a planta for homozigota o resultado ser 100% lisa. Se a planta for heterozigota o resultado ser 50% lisa e 50% rugosa.

13. O componente gentico predomina na determinao da produtividade das plantas. As plantas originadas em localidades altas mantiveram a baixa produtividade quando plantadas ao nvel do mar.

b) A proporo seria 1/4 ou 25%. 14. a) 1/256 b) 1/8 c) 1/4 d) Observe a figura a seguir: 19. a) A cobaia albina recebeu um ovrio de uma fmea preta homozigota e, portanto, todos os seus vulos tero o gene A para cor preta. 18. Cruzamento de animais que so portadores da caracterstica em questo e anlise da descendncia, ou seja, da primeira e segunda geraes. Se o carter reaparecer nos descendentes, hereditria.

b) A fmea preta tem gentipo AA e a prole 100% heterozigota (Aa).



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

24. a) Gentipos:

c) No. O animal teria somente seu fentipo alterado (cor dos plos) e continuaria a transmitir aos descendentes seus genes que no foram alterados.

Azul - AA; Azul-claro - Aa; Branca - aa; AA - 25%

20. a) Os hbridos so geneticamente idnticos pois so descendentes de linhagens homozigotas.

Aa - 50% aa - 25% de plantas que no apresentam flores abertas.

b) Sementes se formam atravs de um processo sexuado envolvendo recombinao gnica e combinaes cromossmicas na fecundao. Por isso produzem descendncia diferenciada.

Neste jardim, as flores que tm menor possibilidade de se abrirem so as de cor azul.

21. a) A caracterstica "tamanho das plantas" determinada geneticamente. Sementes coletadas em diferentes altitudes, colocadas para germinar todas ao nvel do mar, portanto nas mesmas condies, apresentaram fentipos distintos.

b) Possibilidades de cruzamentos:

1: AA AA - 100% de cor azul 2: AA Aa - 50% de cor azul e 50% de cor azul-claro

b) A curva do grfico B, permite a concluso de que a caracterstica "tamanho das plantas" dependente do ambiente, e no determinada geneticamente.

3: Aa Aa - aproximadamente 33,33% azul e 66,66% de cor azulclaro.

22. a) Falso, pois casal de olho azul, recessivo, no pode ter filho de olhos castanhos (dominante) b) Afirmao verdadeira desde que um dos avs maternos tambm transmita o gene recessivo para a me.

Neste jardim, as flores que tm maior possibilidade de se abrirem so as de cor azul.

25. a) No h dominncia entre os alelos que determinam a forma dos rabanetes. b) 50% pois os pais so heterozigotos e podem produzir descendentes na seguinte proporo: 25% arredondados, 50% ovalados e 25% alongados.

23. a) Os resultados obtidos nos cruzamentos entre os vegetais que produziram os frutos sugere um caso de herana sem dominncia (ou codominncia). O cruzamento de uma variedade longa (LL) com a variedade redonda (RR) produz 100% dos descendentes com um fentipo intermedirio, ou seja, os heterozigotos (LR) apresentam a forma ovalada.

26. Para obter prole 100% formada por animais brancos e sem chifres o fazendeiro dever selecionar um casal de animais brancos e sem chifres homozigotos para as duas caractersticas. O problema dos chifres demora a ser resolvido porque o carter presena de chifres recessivo e o criador teria dificuldade na identificao de animais sem chifres, condio dominante, homozigotos.

b) Alelos: L - fruto longo R - fruto redondo

Parentais: LR X LR Descendentes: 25% LL : 50% LR : 25% RR

27. a) O gentipo que confere ao inseto maior resistncia ao inseticida AA. A observao do grfico mostra que necessria maior concentrao do praguicida para elimin-lo.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

31. O heredograma sugere herana autossmica dominante pois h homens e mulheres igualmente afetados. A proporo de filhos afetados nas geraes II, III e IV mostra, aproximadamente, 50% de filhos afetados. Pais normais possuem descendentes 100% normais.

b) Co-dominncia ou Herana sem dominncia. O heterozigoto apresenta fentipo intermedirio entre os homozigotos.

c) O efeito pleiotrpico de outros genes pode explicar as diferenas de comportamento dos mosquitos frente ao inseticida. Genes que atuam sobre outras caractersticas podem agir tambm sobre a resistncia desses insetos aos praguicidas.

32. a) A herana autossmica recessiva. Este o nico tipo de herana que explica o fato de a filha 5 da famlia II ser doente.

28. a) Herana dominante. A filha II-2 normal, porm filha de pais afetados; isso demonstra que os pais so heterozigotos para a caracterstica.

b) Herana autossmica. Se o gene dominante para a anomalia estivesse ligado ao cromossomo X, a menina II-2 apresentaria obrigatoriamente a doena, j que herdaria de seu pai o cromossomo X portador do gene em questo.

b) A probabilidade de nascer uma criana doente de 50% ou 1/2. A mulher 3 da famlia I possui o gentipo heterozigoto (portadora do gene) e o homem 4 da famlia III, doente, possui o gentipo homozigoto recessivo. O cruzamento entre eles tem a probabilidade de gerar 50 % de indivduos com o gentipo heterozigoto, normais e 50% de indivduos com o gentipo homozigoto recessivo, doentes.

33. a) A anomalia no pode ser recessiva, pois os indivduos 7 e 8 da F, afetados pela anomalia, no poderiam ter filhos normais. 29. a) Expressividade recessiva b) Recessivo pois os pais IV - 1 e IV - 2 so normais e tm filhos albinos. c) 1/32

b) Se a anomalia fosse dominante e ligada ao cromossomo X, todas as filhas do casal 7 8 seriam afetadas.

30. a) O heredograma 1 apresenta o padro tpico da herana autossmica recessiva. Justifica-se pelo fato de indivduos afetados (II.2 e IV.6) serem filhos de pais normais para o carter em questo e o nmero de afetados de ambos os sexos ser aproximadamente o mesmo ao logo das geraes.

c) Sendo normal, a mulher em questo apresenta gentipo aa. Se tiver filhos com um homem afetado, duas possibilidades podem ocorrer:


mulher aa homem AA

100% dos filhos Aa e afetados pela anomalia O heredograma 2 apresenta o padro observado na herana recessiva ligada ao sexo. Justifica-se pelo fato de se observarem apenas homens afetados que seriam filhos de mulheres portadoras do gene recessivo ligado ao cromossomo X.


mulher aa homem Aa

50% dos filhos normais (aa) e 50% afetados (Aa)

b) Seria recomendvel a escolha de um filho do sexo feminino no caso apresentado na genealogia 2 pois, neste caso, seria muito menor a probabilidade da ocorrncia do carter em mulheres. Os indivduos do sexo feminino seriam afetados somente se herdarem dois genes recessivos ligados ao X.

34. O indivduo 9 heterozigoto com certeza. O indivduo 7 tem probabilidade de 2/3 de ser heterozigoto, o indivduo 10 de 1/2. Logo, a probabilidade de nascer um homozigoto recessivo do cruzamento 910 igual a:

c) Pais: Aa x aa | P(menina afetada) = 1/2 . 1/2 = 1/4 ou 25%

(2/3) (1/2) (14) = 2/24 ou 1/12.

35. a) Os heredogramas A e C so compatveis com herana autossmica recessiva. Em A os pais so heterozigotos e em C a me



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

41. Principais mecanismos de gerao de variabilidade gentica em famlias humanas: 1) recombinao (permutao) - troca de partes entre os cromossomos homlogos durante o processo de diviso meitica. 2) segregao independente - separao aleatria dos cromossomos homlogos durante a diviso meitica de cada clula germinativa (materna e paterna). 3) mutao - alterao na informao gentica produzida por erros de duplicao do material gentico ou por ao de agentes mutagnicos.

heterozigota ou homozigoto normal. Em B, ambos os pais devem ser heterozigotos autossmicos para uma caracterstica dominante.

b) No, em A o outro filho homem no foi afetado e nas outras famlias nenhum filho homem foi afetado.

36. a) Recessivo. b) A mulher III -1 no pode ter seu gentipo determinado com segurana porque fenotipicamente normal e filha de pais seguramente heterozigotos.

37. a) Heterozigotos (Aa): II-1, II-2, II-3 e II-4.

42. a) No, porque a prole do casal (I) aparece na proporo de 9:3:3:1, o que indica genes localizados em pares de cromossomos diferentes. b) aaBb x aaBb

b) Gerao parental: (II-2) Aa x Aa (II-3)

c) Gerao possvel:

43. O caso 2, que ocorre quando os dois locos esto no mesmo cromossomo, com permuta gnica entre eles. A proporo fenotpica 9:3:3:1 (caso 1) s ocorre quando os dois locos esto em cromossomos diferentes. (aa)

(AA, Aa, Aa) e 3/4 normais

1/4 afetados

44. a) 50% aB e 50% Ab. b) Devido ao fenmeno da segregao independente, sero formados espermatozides com os seguintes gentipos: AB - 25%, Ab - 25%, aB - 25% e ab - 25%

P (homem afetado) = 1/2 . 1/4 = 1/8 P (2 homens afetados) = 1/8 . 1/8 = 1/64

38. So fatores dependem fortemente da influncia ambiental para se manifestar. Os fatores hereditrios tm pouca importncia na expresso desta caracterstica estudada.

45. a) A planta adulta ter gentipo igual ao zigoto que lhe deu origem, ou seja, AABB porque todas as clulas do adulto so originadas por mitoses a partir do zigoto.

39. a) o ocito AAbb formar, na segunda diviso meitica, vulo do tipo Ab, que fecundado por um espermatozide ab produzir um embrio de gentipo Aabb.

b) Os descendentes podero ser iguais ou diferentes dos pais como mostrado a seguir:

AABB x AABB = b) A mulher de gentipo AaBb cruzando com um homem aabb poder ter filhos com os seguintes gentipos: AaBb, Aabb, aaBb, aabb.

propores genotpicas:

40. a) Macho: DdMm - Fmea: ddMm b) 1/4

1/16 AABB 2/16 AABB


2/16 AABB 4/16 AABB 1/16 AABB 2/16 AABB 1/16 AABB 2/16 AABB 1/16 AABB

Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

46. a) Alelos: A (longo), a (curto) B (redondo), b (oval) 48. Aabbcc AaBbCc Cruzando as linhagens homozigotas obtm-se a F, que intercruzada produzir, na F, plantas com caule curto e frutos ovais: Homem e aabbcc Cruzamentos: (1/2) (1/4) (1/2) (1/2) = 1/32

P: | F:

AAbb x aaBB

49. a) Famlia I - herana dominante ligada ao X. Ocorre em todas as geraes. Os homens afetados transmitem a doena para todas as filhas. Famlia II - herana dominante autossmica. Ocorre em todas as geraes. Atinge indivduos de ambos os sexos ou filhos afetados tm um genitor afetado.

AaBb x AaBb |

F: 9A_B_ : 3A_bb : 3aaB_ : 1aabb b) Como a doena s se manifesta a partir dos 40 anos, o indivduo pode reproduzir-se antes de a doena aparecer, transmitindo a caracterstica aos descendentes.

b) A proporo esperada de plantas com caule curto e frutos ovais (aabb) de 1/16.

47. a) Os genes esto localizados em cromossomos diferentes (figura 1).

50. a) Com a malria os indivduos ss tendem a morrer, em contrapartida, os Ss so imunes, aumentando a freqncia do S. Sem a malria os indivduos ss sobrevivem, diminuindo a freqncia do S. b) Indivduos Ss produzem hemcias normais e anormais. Estas anormais, no permitem a reproduo assexuada do protozorio.

b) Os genes esto em "Linkage", ou seja, esto localizados no mesmo cromossomo (figura 2).

Lista 4



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

4. (Ufrj) O daltonismo, ou cegueira para as cores, determinado por um gene localizado no cromossomo sexual X. O tipo de sangue, grupo ABO, determinado por trs alelos autossmicos: I, I, i. Uma mulher, com sangue tipo A e viso normal, ficou viva e casou pela segunda vez. Um dos maridos, Jos, tinha sangue AB e era daltnico; o outro marido, Paulo, tinha sangue A e viso normal. Com os dois maridos, a mulher teve cinco filhos na seguinte ordem: 1) homem, sangue A, daltnico; 2) homem, sangue O, daltnico;

1. (Fuvest) Nos anos 40, o famoso cineasta Charlie ChapIin foi acusado de ser o pai de uma criana, fato que ele no admitia. Os exames de sangue revelaram que a me era do grupo A, a criana do grupo B e Chaplin do grupo O. Ao final do julgamento, Chaplin foi considerado como sendo um possvel pai da criana. a) O veredicto aceitvel? Por qu? b) Na hiptese de Chaplin ter tido filhos com a referida mulher, de que tipos sangneos eles poderiam ser?

2. (Fuvest) Um tratamento utilizado para certos tipos de doenas do sangue a destruio completa da medula ssea do paciente e implante de clulas medulares sadias provenientes de um doador. Eugnio, cujo grupo sangneo A, recebeu um transplante de medula ssea de seu irmo Valentim, cujo grupo sangneo B, e a operao foi bem sucedida. a) Qual ser o grupo sangneo de Eugnio aps o transplante? Por qu? b) Sabendo-se que a me e a esposa de Eugnio tm sangue do tipo O, qual ser a probabilidade de um futuro filho do casal ter sangue do tipo A? E do tipo B?

3) mulher, sangue A, daltnica; 4) mulher, sangue B, viso normal; 5) mulher, sangue A, viso normal. Qual dos homens foi o primeiro marido? Justifique sua resposta.

5. (Ufrj) O sangue de Orlando aglutina quando colocado em presena de soro contendo imunoglobulinas ou aglutininas anti-A, e no aglutina quando colocado em presena de imunoglobulinas ou aglutininas anti-B. Orlando casa-se com Leila, que apresenta aglutinaes inversas. O casal tem um filho cujo sangue no aglutina em nenhum dos dois tipos de soro. a) Qual o gentipo dos pais?

3. (Udesc) "Os grupos sangneos so determinados pela presena ou ausncia de antgenos na superfcie das hemcias. No caso do Sistema ABO, os antgenos esto presentes no sangue dos grupos A, B, AB e ausentes no grupo O". ("Reserva estratgica de sangue", de Ricardo Lorzetto. CINCIA HOJE, SBPC, vol. 19/n. 113, set. 95, p. 58.)

b) Qual a probabilidade de esse casal ter uma criana cujo sangue aglutine nos dois tipos de soro? Justifique sua resposta. 6. (Ufrj) Pode-se usar o sistema ABO para "excluir" um suposto pai em uma investigao de paternidade. Para tal, basta determinar o gentipo e o fentipo do suposto pai e, por comparao com os fentipos e gentipos do filho e da me, verificar se o homem acusado pode ser considerado como um pai impossvel. A tabela a

a) O que so antgenos? b) Qual a importncia de se identificar a presena de antgenos eritrocitrios (presentes nas hemcias ou eritrcitos) no sangue humano?

seguir mostra os fentipos do filho e da me em trs casos.

Indique os fentipos dos pais que NO poderiam ser os pais biolgicos de cada caso.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

9. (Unb) Dois casais suspeitavam da troca de seus bebs no berrio da maternidade. Os casais e os bebs foram submetidos tipagem do sangue quanto ao sistema ABO, cujos resultados obtidos so

7. (Ufv) Nas quatro pessoas relacionadas a seguir, foram encontrados os seguintes tipos sangneos:

Joana - AB Cassilda - B Doaldo - O Saildo - A

mostrados na tabela adiante. Analisando-os, pode-se identificar os pais de cada beb.

Com base nesta relao, responda: a) Quem do grupo anterior NO possui os aglutinognios em suas hemcias? b) Por que Joana pode receber sangue de outros membros do grupo? c) Que tipo de aglutinina possuem Cassilda e Saildo, respectivamente?

8. (Ufv) Ao descobrir que seu gentipo era homozigoto, o Sr. Lalau (indivduo II-1) elaborou o seguinte heredograma sobre a herana de grupos sangneos do sistema ABO. Aps identificar os pais do beb n. 2, calcule a probabilidade, em porcentagem, de que um futuro irmo deste beb seja do sexo masculino e venha a ter tipo sangneo diferente do irmo. Despreze a parte fracionria do seu resultado, caso exista.

10. (Unicamp) Com base no heredograma a seguir, responda: a) Qual a probabilidade de o casal formado por 5 e 6 ter duas crianas com sangue AB Rh? b) Se o casal em questo j tiver uma criana com sangue AB Rh, qual a probabilidade de ter outra com os mesmos fentipos sangneos? Obs.: indique os passos que voc seguiu para chegar s respostas, em a e b. a) Identifique o grupo sangneo do indivduo I-1:

b) Qual o gentipo do indivduo II-5?

c) O Sr. Lalau poder ser receptor de sangue de seu genro para transfuso?

d) O indivduo III-5 NO poder ser de qual grupo sangneo?

e) No caso do casal III-3 e III-4 ter uma segunda criana, qual a probabilidade dela ser uma menina e do grupo sangneo "B"?



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

a) Complete o quadro a seguir com os gentipos e as reaes antignicas (represente com os sinais + e -) dos grupos sangneos indicados.

11. (Unicamp) O rei Salomo resolveu uma disputa entre duas mulheres que reclamavam a posse de uma criana. Ao propor dividir a criana ao meio, uma das mulheres desistiu. O rei ento concluiu que aquela que havia desistido era de fato a me verdadeira. Nos tribunais modernos, um juiz pode utilizar a anlise dos grupos sangneos e teste de DNA para ajudar a solucionar questes semelhantes. Analisando uma situao em que uma mulher de sangue A atribua a paternidade de seu filho de sangue O a um homem de sangue B, o juiz no pde chegar a nenhuma deciso conclusiva. a) Explique por qu. b) Qual deveria ser o grupo sangneo do homem para que a deciso pudesse ser conclusiva? c) Com base no teste de DNA, o juiz concluiu que o homem era pai da criana. Por que o teste de DNA permite tirar concluses to precisas em casos como este?

b) Embora 3 alelos distintos determinem os grupos sangneos ABO humanos, por que cada indivduo portador de somente dois alelos?

14. (Fuvest-gv) Uma populao humana foi testada quanto ao sistema 12. (Unicamp) Os grupos sangneos humanos podem ser classificados em 4 tipos: A, AB, B e O, pelo sistema ABO e, de acordo com o sistema Rh, como Rh e Rh-. a) Explique como o sangue de uma pessoa pode ser identificado em relao aos sistemas ABO e Rh. b) Explique por que uma pessoa com sangue tipo O doadora universal mas s pode receber sangue do tipo O, enquanto uma pessoa com sangue AB receptora universal mas no pode doar para os outros tipos. 13. (Unifesp) Um exemplo clssico de alelos mltiplos o sistema de grupos sangneos humano, em que o alelo I, que codifica para o antgeno A, co-dominante sobre o alelo I, que codifica para o antgeno B. Ambos os alelos so dominantes sobre o alelo i, que no codifica para qualquer antgeno. Dois tipos de soros, anti-A e anti-B, so necessrios para a identificao dos quatro grupos sangneos: A, B, AB e O. a) Quais as freqncias dos alelos M e N nessa populao? b) Essa populao est em equilbrio de Hardy-Weinberg para esse loco gnico? MN de grupos sanguneos. Os dados obtidos compem a tabela a seguir:

15. (Unicamp) Na eritroblastose fetal ocorre destruio das hemcias, o que pode levar recm-nascidos morte. a) Explique como ocorre a eritroblastose fetal. b) Como evitar sua ocorrncia? c) Qual o procedimento usual para salvar a vida do recm-nascido com eritroblastose fetal?



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

a) Os grficos a seguir mostram a variao da concentrao de anticorpos contra um determinado antgeno no sangue de uma pessoa, em funo do tempo, em duas condies: vacinao ou soroterapia.

16. (Ufrj) Nas transfuses sangneas, o doador deve ter o mesmo tipo de sangue que o receptor com relao ao sistema ABO. Em situaes de emergncia, na falta de sangue do mesmo tipo, podem ser feitas transfuses de pequenos volumes de sangue O para pacientes dos grupos A, B ou AB. Explique o problema que pode ocorrer se forem fornecidos grandes volumes de sangue O para pacientes A, B ou AB.

17. (Unesp) Um casal tem cinco filhos: Alex, Pedro, Mrio, rica e Ana. Dois dos irmos so gmeos univitelinos. rica, um dos gmeos, sofreu um acidente e precisa urgentemente de uma transfuso de sangue, e os nicos doadores disponveis so seus irmos. Na impossibilidade de se fazer um exame dos tipos sangneos, responda: a) Entre seus irmos, qual seria a pessoa mais indicada para ser o doador? b) Justifique sua resposta. 18. (Uerj) No quadro a seguir, as duas colunas da direita demonstram esquematicamente o aspecto "in vitro" das reaes no sangue dos indivduos de cada grupo sangneo ABO aos anti-A e Anti-B. Um dos grficos mostrados corresponde variao da concentrao de anticorpo antiofdico no sangue de uma pessoa mordida por uma serpente e tratada com uma dose do soro apropriado. Justifique por que esse tratamento deve ser feito logo aps a picada do animal e, por que, em casos mais graves, deve ser repetido a intervalos de tempo relativamente curtos.

b) Na eritroblastose fetal, a me produz anticorpos contra o fator Rh do filho. A doena s se manifesta, porm, a partir da segunda gravidez. Indique a condio que deve estar presente no feto para o desenvolvimento da eritroblastose em filhos de mulheres que no produzem fator Rh. Explique por que, mesmo nessas circunstncias, o primeiro filho nunca afetado.


1. a) No, porque a criana herdou o gene I de seu pai verdadeiro e a) Explique o fenmeno que ocorreria com as hemcias de um indivduo do grupo A ao receber sangue de um indivduo do grupo B. b) Sabe-se que o aglutinognio uma protena da membrana das hemcias. Explique por que a aglutinao no ocorreria se o aglutinognio fosse uma protena citoplasmtica. 19. (Uerj) A funo do sistema imunolgico a de defender o organismo contra invasores. Bactrias, vrus, fungos, tecidos ou rgos transplantados, e mesmo simples molculas, podem ser reconhecidos pelo organismo como agentes agressores. b) Eugnio geneticamente do grupo A, sendo filho de me O (ii), seu gentipo Ii. Casado com mulher O (ii) poder ter filhos dos 2. a) Eugnio passa a produzir hemcias do grupo B, j que teve sua medula ssea original completamente destruda antes do transplante. b) A (Ii) ou O (ii). no de Chaplin que pertencia ao grupo O (ii).



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

8. a) O indivduo I-1 pertence ao grupo B.

grupos A (Ii) e O (ii) com 50% de chances para cada grupo. A probabilidade de ter filhos do grupo B , portanto, igual a zero.

3. a) Antgenos so substncias orgnicas produzidas pelos seres vivos que se comportam como estranhos ao serem inoculados em outro organismo; gerando uma reao imunolgica.

b) O gentipo do indivduo II-5 Ii.

c) No. Lalau pertence ao grupo A e s poderia receber transfuso dos grupos A e O e seu genro pertence ao grupo B.

b) A identificao dos antgenos nas hemcias humanas tem a finalidade de se evitar transfuses incorretas. O receptor poder possuir anticorpos (aglutininas) especficos contra o antgeno doado, gerando a aglutinao dos glbulos vermelhos recebidos na transfuso. e) P(menina do grupo B) = 1/2 . 1/4 = 1/8. d) O indivduo III-5 no poder pertencer ao grupo AB pois pai de filho O.

4. Paulo foi o 1. marido e o pai dos dois primeiros filhos pois Jos do grupo AB e no poderia ter filhos do grupo O, como a segunda criana nascida desta mulher.

9. 37 %

10. a) P (AB) = 1/4 P (Rh) = 1/2

5. a) Orlando AO gametas A, O

P (ABRh) = 1/4 . 1/2 = 1/8 P (2 ABRh) = 1/8 . 1/8 = 1/64

b) 1/8 porque cada nascimento um evento independente.

11. a) Um homem do grupo sangneo B pode ser heterozigoto (Ii) e, portanto, pai de criana do grupo O (ii).

Leila BO gametas B, O

b) Se o homem fosse do grupo AB, com gentipo II, no poderia ser o pai de criana O (ii). c) O teste de DNA capaz de comparar as seqncias de bases nitrogenadas de "pais" e "filhos" com acerto de 99,9%. Se as

b) 1/4. As possibilidades de combinao dos alelos de aglutinognio entre os gametas de Orlando e Leila so: filho: (1/4) AB, (1/4) AO, (1/4) BO, (1/4) OO.

seqncias forem idnticas, o indivduo testado certamente o pai biolgico da criana.

12. a) Pode ocorrer atravs da tipagem sangnea e mistura com o Logo P (AB) representa 1/4. soro que contm os anticorpos de cada tipo sanguneo, na qual a aglutinao do sangue determina a presena do antgeno. 6. Caso 1 - pais impossveis - B e O Caso 2 - pai impossvel - 0 Caso 3 - pai impossvel - AB b) O grupo O apresenta todos os anticorpos, por isso no pode receber de outro tipo. O grupo AB apresenta todos os antgenos por isso no pode doar para nenhum outro tipo.

7. a) Doaldo. b) No possui aglutininas anti-A e anti-B. c) Cassilda: anti-A, Saildo: anti-B

13. a) Observe o quadro a seguir:



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

- banhos de luz para diminuir a ictercia causada pela destruio das hemcias fetais; - nutrio adequada para reverter o quadro de anemia.

16. O sangue do tipo O possui aglutininas anti-A e anti-B. Com transfuses de pequeno volume, essas aglutininas ficam muito diludas no sangue do receptor, o que no acarreta problemas. Por outro lado, se o volume do sangue O doado for grande, essas aglutininas atingem concentraes que provocam a aglutinao das hemcias do receptor, causando entupimento dos capilares e outros problemas decorrentes das transfuses incompatveis. b) Cada indivduo possui um par de cromossomos homlogos que, por sua vez, apresentam os genes alelos. 17. a) Ana. b) Gmeos univitelinos se originam partir de um nico ovo e so 14. N. total de alelos na populao = 12258 (cada pessoa tem dois alelos) genticamente idnticos. So do mesmo sexo e pertencem ao mesmo grupo sanguneo.

N. de alelos M = 6613 N. de alelos N = 5645

18. a) Sofreria a reao com as aglutininas A. b) Porque o aglutinognio no estaria acessvel s aglutininas.

freqncia do alelo M = 6613/12258 = 0,54 freqncia do alelo N = 5645/12258 = 0,46

19. a) Porque o soro antiofdico j apresenta os anticorpos apropriados prontos, produzidos em outro animal. Quando administrado logo aps a picada, atingem rapidamente nveis

A populao est em equilbrio porque as freqncias se aproximam da distribuio binomial (p + q) = 1, sendo p a freqncia do alelo M e q a freqncia do alelo N.

elevados no sangue, neutralizando prontamente a toxina da serpente. No entanto, esses nveis tambm caem rapidamente, como mostrado no grfico 1. Por essa razo, nos casos mais graves, a aplicao deve ser repetida at que toda a toxina inoculada seja neutralizada.

15. a) A eritroblastose fetal ocorre por incompatibilidade do fator Rh entre a me Rh-, sensibilizada por transfuso sangunea Rh ou atravs do parto de uma criana Rh, e o feto Rh. Os anticorpos (anti Rh) produzidos pela me sensibilizada destroem os glbulos vermelhos fetais. b) O feto deve ser capaz de produzir fator Rh, ou seja, ser Rh. Como a produo inicial de anticorpos pela me Rh- contra o fator Rh fetal pequena, esses anticorpos no chegaro a transpor com eficincia, na primeira gestao, a barreira placentria que separa a circulao materna da fetal. b) Pode-se evitar a ocorrncia da eritroblastose fetal atravs de injees de soro contendo anti-Rh. O anti-Rh destri os glbulos vermelhos fetais - com o antgeno Rh - que circulam no sangue materno.

c) O tratamento usual para a criana afetada pela doena consiste em: - transfuso Rh- em substituio ao sangue Rh que contm os anticorpos maternos;



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

Lista 5
TEXTO PARA AS PRXIMAS 2 QUESTES. (Uerj 2001) O experimento clssico de Meselson e Stahl, em 1957, demonstrou que a replicao do DNA era semiconservativa, ou seja, cada fita do DNA serve de molde para sua prpria duplicao, formando molculas de DNA idnticas original. Nesse experimento, os cientistas cultivaram clulas de 'Escherichia coli' inicialmente em presena de fonte de N (istopo de nitrognio leve), trocando, a seguir, por N (istopo pesado), que incorporado s bases nitrogenadas do DNA. Colheram, ento, amostras de DNA aps a primeira e a segunda geraes de clulas crescidas em N e analisaram essas amostras quanto densidade do DNA formado. Considere como PESADO o DNA dupla hlice marcado com N; como LEVE o marcado com N; como INTERMEDIRIO o marcado com N e N. 4. (Uerj 98) O grfico a seguir demonstra a distribuio citoplasmtica do nmero de ribossomas isolados e polirribossomas, em comparao com o nmero de cadeias polipeptdicas em formao durante um certo perodo de tempo.

1. Justifique por que, aps a troca da fonte de nitrognio, a primeira gerao de clulas foi totalmente constituda com DNA dupla hlice do tipo INTERMEDIRIO.

2. Calcule as propores dos trs tipos de DNA dupla hlice - LEVE, INTERMEDIRIO E PESADO - formados em clulas da segunda gerao, aps a troca da fonte de nitrognio. 3. (Fuvest 89) O desenho a seguir mostra a sntese de um polipeptdio a partir da molcula de DNA num certo organismo. Esse organismo um procarioto ou um eucarioto? Por qu? a) Defina a relao existente entre os ribossomas isolados e a formao das cadeias polipeptdicas. Justifique sua resposta. b) Descreva a estrutura das cadeias polipeptdicas e a dos polirribossomas. (Adaptado de ALBERTS, Bruce & outros. "Molecular biology of the cell". New York, Garland Publishing, 1994, p.239)



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

nitrogenadas devem existir neste DNA e em que propores? Justifique sua resposta.

5. (Unicamp 96) Um certo tipo de macromolcula destinada membrana plasmtica celular, depende de etapas nucleares e citoplasmticas para sua produo, de acordo com os percursos esquematizados a seguir:

9. (Fuvest 2004) Bactrias (Escherichia coli) foram cultivadas durante vrias geraes em um meio de cultura na qual toda a fonte de nitrognio era o istopo pesado N. De uma amostra dessas bactrias (amostra A), extraiu-se o DNA que foi submetido a uma tcnica de centrifugao que permite separar molculas de DNA de acordo com sua densidade. O restante das bactrias foi transferido para um meio de cultura em que todo o nitrognio disponvel era o istopo normal N. Retirou-se uma segunda amostra (amostra B), quando as bactrias completaram uma diviso celular nesse novo meio e uma terceira amostra (amostra C), quando as bactrias completaram duas divises celulares. O DNA das bactrias das amostras B e C foi tambm extrado e centrifugado.

a) Por que essas etapas comeam no ncleo? b) Qual a composio da macromolcula ao final do percurso I? E do percurso II? Esclarea a diferena, baseando-se nas funes das organelas citoplasmticas envolvidas em cada percurso.

6. (Unicamp 92) Ribossomos so formados por RNA e protenas, sintetizados pelos processos de transcrio e traduo, respectivamente. a) Onde esses processos ocorrem na clula eucaritica? b) O que acontecer com os processos de transcrio e traduo, se ocorrer uma inativao na Regio Organizadora do Nuclolo? Justifique. A figura mostra o resultado da centrifugao do DNA das trs 7. (Unesp 2003) Criadores e sitiantes sabem que a mula (exemplar fmea) e o burro (exemplar macho) so hbridos estreis que apresentam grande fora e resistncia. So o produto do acasalamento do jumento ('Equus asinus', 2n = 62 cromossomos) com a gua ('Equus caballus', 2n = 64 cromossomos). a) Quantos cromossomos tm o burro ou a mula? Justifique sua resposta. b) Considerando os eventos da meiose I para a produo de gametas, explique por que o burro e a mula so estreis. amostras de bactrias. a) Por que, na amostra B, todo o DNA tem uma densidade intermediria entre o que constitudo apenas por N e o que contm apenas N? b) Considerando que, na amostra C, a quantidade de DNA separada na faixa inferior X, que quantidade de DNA h na faixa superior?

8. (Fuvest 95) No DNA de um organismo, 18% das bases nitrogenadas so constitudas por citosina. Que outras bases



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO


Estas clulas formam um livro, conservado em tanques de nitrognio lquido que guarda informaes desconhecidas sobre a humanidade. Os captulos contam diferentes detalhes da saga do homem na terra: suas andanas pelos continentes, casamentos ancestrais e os ataques de doenas. (adaptado de, "O Globo")

a) Explique por que o processo de autoduplicao do DNA d significado hereditariedade permitindo revelar a histria da evoluo da humanidade. b) "... suas andanas pelos continentes, casamentos ancestrais e os ataques de doenas" podem ser estudados atravs de observaes de caractersticas morfolgicas e fisiolgicas da clula. Nomeie o processo atravs do qual o DNA capaz de controlar e interferir nas caractersticas morfolgicas e fisiolgicas da clula. 11. (Uerj 99) Em clulas eucariotas mantidas em cultura, adicionouse o nucleosdeo uridina marcado radioativamente com H ao meio de cultura. Aps algum tempo, as clulas foram transferidas para um novo meio que no continha o istopo. Amostras destas clulas foram retiradas 3, 15 e 90 minutos aps a transferncia, sendo, ento, colocadas em lmina de vidro, fixadas e submetidas a autoradiografia. Esse processo marca a posio aproximada do istopo dentro da clula, como representado no esquema a seguir. Explique por que, entre essas clulas: a) as caractersticas genotpicas so iguais; b) as caractersticas fenotpicas so diferentes. 12. (Uerj 2006) Num experimento, foram comparadas as caractersticas genotpicas e fenotpicas de clulas retiradas de um tecido de anfbio, ainda no estgio de girino, com as de clulas de tecido similar do mesmo indivduo aps atingir a idade adulta. b) Nomeie o compartimento celular que seria marcado, se o nucleosdeo radioativo usado fosse a timidina e justifique sua resposta. a) Cite o tipo de molcula qual a uridina se incorporou. Justifique sua resposta.

13. (Ufal 99) Para desempenhar sua funo como material hereditrio, o DNA possui duas propriedades. Identifique-as e descreva resumidamente cada uma delas.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

16. (Ufrj 96) O teste de tipagem de DNA revelou que nos seres humanos existe individualidade genmica. Isto significa que cada indivduo possui variaes discretas e caractersticas na seqncia de seu DNA, ou seja, a seqncia de nucleotdeos do DNA de cada pessoa nica (excetuando-se o caso de gmeos monozigticos).

14. (Uff 99) A mutao em um gene humano provoca cegueira. Com a utilizao de tcnicas de gentica clssica e molecular, verificou-se que este gene est localizado no genoma mitocondrial. Sabe-se que todas as mitocndrias dos indivduos afetados pela cegueira no possuem o gene normal, mas sim o gene mutado.

a) Informe a percentagem de filhas e filhos cegos de um casal: I) cuja mulher normal e o homem cego; II) cuja mulher cega e o homem normal.

Assim, a tipagem do DNA revela um padro de bandas que estvel (presente no DNA de todos os tecidos) e transmitido aos descendentes seguindo as leis de Mendel.

b) Justifique as respostas ao item a.

Graas a essas caractersticas possvel atualmente realizar testes de paternidade que comparam os padres de bandas de DNA das

15. (Ufrj 96) O genoma da bactria "Escherichia coli" tem um tamanho de 410 pares de nucleotdeos. J o genoma haplide humano tem 310 pares de nucleotdeos. Para replicar o genoma, antes da diviso celular, existe uma enzima, a DNA polimerase, cuja velocidade de reao equivalente a cerca de 800 nucleotdeos/s.

pessoas e revelam se um homem de fato o pai biolgico de uma outra pessoa.

Suponha agora a seguinte situao: um homem acusado de ser o pai de uma criana tenta burlar o teste de tipagem de DNA; um amigo o aconselha a receber uma transfuso de sangue 2 meses antes do teste

Assim, para replicar todo o genoma de uma bactria, a DNA polimerase consumiria cerca de 83 minutos e, para o genoma humano, aproximadamente 43 dias!

(em geral colhe-se o sangue como fonte de clulas nucleadas).

a) Qual a influncia da transfuso sugerida no resultado do exame? b) Que precaues podem ser tomadas para desmascarar a tentativa

Sabemos, no entanto, que o tempo de gerao da "E.coli" de cerca de 20 minutos, e que o tempo mdio de replicao de uma clula eucariota de 12 horas.

de fraude?

17. (Ufrj 99) A tipagem de DNA uma tcnica desenvolvida recentemente que permite identificar e estabelecer o grau de

Assumindo que a DNA polimerase apresenta uma velocidade de reao constante para todas as espcies analisadas, explique essa aparente contradio.

parentesco entre indivduos. Para se realizar uma anlise patrilnea, isto , a investigao dos ancestrais paternos, usa-se um marcador do cromossomo Y, que no se altera ao longo das geraes (salvo em casos de mutaes). Por outro lado, para uma anlise matrilnea (materna), lana-se mo do DNA mitocondrial. Por que o DNA mitocondrial deve ser usado para a anlise matrilnea?



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

21. (Ufrrj 99) Considerando as propriedades de duplicao do DNA, observe o resultado do experimento a seguir.

18. (Ufrj 2001) No ADN, a transcrio dos genes no est restrita a somente uma das suas cadeias. Para alguns genes, a seqncia de nucleotdeos transcrita pode estar em uma cadeia, ao passo que a seqncia do outro gene pode estar localizada na cadeia oposta. No entanto, sabe-se que no mesmo trecho nunca ocorre a transcrio simultnea das duas cadeias de uma molcula de ADN. Tal evento inibiria o processo da traduo.

1 etapa: Em uma cultura com N, obtm-se o crescimento de colnias de bactrias; aps esse crescimento promove-se o desenvolvimento de mais duas geraes, em cultura com N.

2 etapa: Extrai-se o DNA de todas as bactrias e obtm-se o seguinte Explique por que ocorreria a inibio da traduo se a transcrio de uma cadeia do ADN ocorresse ao mesmo tempo em que a transcrio da sua cadeia complementar, no mesmo trecho. - Cultura de crescimento com N: 300 molculas de DNA todas com N. 19. (Ufrj 2004) Estudos recentes compararam as seqncias completas de DNA mitocondrial de indivduos de vrias regies geogrficas do planeta. - Cultura de 1 gerao com N: 600 molculas de DNA todas com N e N. resultado:

Os resultados revelaram que a variabilidade gentica no DNA mitocondrial de indivduos africanos era quase o dobro da observada no DNA mitocondrial de no-africanos. Esses resultados foram importantes para corroborar a idia de que o ancestral comum mais recente do 'Homo sapiens' viveu na frica h cerca de 200.000 anos.

- Cultura de 2 gerao com N: 1200 molculas de DNA nas quais 600 com N e 600 com N e N.

Explique as porcentagens obtidas em todos os extratos das diferentes culturas no experimento. Justifique sua resposta.

Explique por que a maior diversidade do DNA mitocondrial apia a idia da origem africana do 'Homo sapiens'.

20. (Ufrj 2005) A soma das porcentagens de guanina e citosina em uma certa molcula de ADN igual a 58% do total de bases presentes.

a) Indique as porcentagens das quatro bases, adenina (A), citosina (C), guanina (G) e timina (T), nessa molcula. b) Explique por que impossvel prever a proporo de citosina presente no ARN mensageiro codificado por esse trecho de ADN.


a seguinte composio de bases:

Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

24. (Unicamp 97) Em 1952, Hershey e Chase cultivaram bactrias em meio de cultura contendo fsforo radioativo (P) e colocaram bacterifagos (vrus) para infectar essas clulas. Os novos

22. (Unesp 90) A anlise qumica de duas molculas de DNA revelou

Molcula A 23% de adenina, 23% de timina, 27% de citosina e 27% de guanina;

bacterifagos formados estavam marcados radioativamente. Estes bacterifagos marcados foram utilizados para infectar outras clulas bacterianas cultivadas sem a presena de fsforo radioativo. A marcao radioativa foi detectada dentro destas bactrias.

a) Como se explica que o fsforo radioativo tenha passado para o Molcula B 23% de adenina, 23% de timina, 27% de citosina e 27% de guanina. bacterifago? b) Como se explica que as bactrias cultivadas sem a presena de fsforo radioativo tenham sido marcadas? c) Se, em vez de fsforo, tivesse sido usado enxofre radioativo (S) para marcao de protenas, os resultados seriam os mesmos? Justifique. Com base nestes dados: a) O que se pode afirmar a respeito das semelhanas entre estas duas molculas de DNA? b) Justifique sua resposta. 25. (Unicamp 2005) Em 25 de abril de 1953, um estudo de uma nica pgina na revista inglesa "Nature" intitulado "A estrutura molecular dos cidos nuclicos", quase ignorado de incio, revolucionou para sempre todas as cincias da vida sejam elas do homem, rato, planta 23. (Unesp 97) A anlise qumica em amostras de cinco lminas com cidos nuclicos apresentou os seguintes resultados: ou bactria. James Watson e Francis Crick descobriram a estrutura do DNA, que permitiu posteriormente decifrar o cdigo gentico determinante para a sntese protica. 1. lmina: ribose 2. lmina: uracila 3. lmina: dupla-hlice 4. lmina: timina 5. lmina: 15% de guanina e 25% de citosina. a) Watson e Crick demonstraram que a estrutura do DNA se assemelha a uma escada retorcida. Explique a que correspondem os "corrimos" e os "degraus" dessa escada. b) Que relao existe entre DNA, RNA e sntese protica? c) Como podemos diferenciar duas protenas? a) Entre estas lminas, quais se referem a DNA? b) Justifique o resultado obtido com a 5. lmina. 26. (Unifesp 2003) Cientistas criaram em laboratrio um bacterifago (fago) composto que possui a cpsula protica de um fago T2 e o DNA de um fago T4. Aps esse bacterifago composto infectar uma bactria, os fagos produzidos tero

a) a cpsula protica de qual dos fagos? E o DNA, ser de qual deles? b) Justifique sua resposta.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

28. (Unirio 2002) A figura a seguir mostra um trecho da estrutura do cido desoxiribonuclico, ressaltando a interao entre as duas cadeias do polmero. Na figura, A, C, G & T representam as bases adenina, citosina, guanina e timina, respectivamente.

27. (Unifesp 2003) No heredograma seguinte, a pessoa A possui uma mutao no DNA de todas as suas mitocndrias, que faz com que a produo de energia para os msculos seja deficiente, ocasionando dificuldades motoras para os portadores do problema. Essa pessoa casou-se com outra, aparentemente normal. O casal (P) teve filhos (F1) e estes, por sua vez, tambm tiveram filhos (F2).

a) Copie o heredograma, pintando quais sero as pessoas afetadas pela doena em F1 e em F2 b) Justifique sua resposta.

As linhas pontilhadas indicam as pontes de hidrognio que so formadas entre as bases aminadas e que contribuem para manter unidas as duas cadeias do DNA. Essas pontes de hidrognio podem ser rompidas por calor, o que produz a dissociao das cadeias. Esse processo reversvel chama-se de desnaturao. A temperatura necessria para desnaturar o DNA depende de vrios fatores, mas um deles a composio dos nucleotdeos de um determinado DNA. Observe as duas seqncias de DNA a seguir e determine qual delas precisar de uma temperatura de desnaturao maior. Justifique a sua resposta.


2) GCTAGGCCGATGCGGCGTGGA CGATCCGGCTACGCCGCACCT 29. (Unitau 95) Considerando o modelo da estrutura molecular do DNA como representado na figura adiante, responda o que representam os componentes 1, 2 e 3, respectivamente.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

30. (Fuvest 92) De que maneira o DNA determina a seqncia de aminocidos das molculas de protenas? 31. (Fuvest 96) Uma doena gentica de herana dominante causada por mutaes em um gene localizado em um autossomo. Os indivduos A, B e C tm mutaes em um segmento de DNA desse gene, cuja seqncia normal est representada a seguir. Usando a tabela que relaciona alguns cdons aos respectivos aminocidos e considerando que a fita molde a ser transcrita aquela assinalada com a letra m, responda: a) Quais sero os segmentos de protenas produzidos, respectivamente, pelos indivduos A, B e C? b) Como ser o fentipo (normal ou afetado dos indivduos A, B e C? Por qu? Seqncia normal CAA AAC TGA GGA ATG CAT TTC (m) GTT TTG ACT CCT TAC GTA AAG Indivduo A CAA AAC TGA GGA ATT CAT TTC (m) GTT TTG ACT CCT TAA GTA AAG Indivduo CAT AAC TGA GGA ATG CAT TTC (m) GTA TTG ACT CCT TAC GTA AAG Indivduo CAA TAC TGA GGA ATG CAT TTC (m) GTT ATG ACT CCT TAC GTA AAG

32. (Ueg 2007) O esquema a seguir uma representao do cdigo gentico.

De acordo com o esquema apresentado, responda ao que se pede. a) O que o cdigo gentico? b) Explique por que se diz que ele degenerado.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

33. (Uff 2004) O fumo est relacionado ao aumento de risco para o cncer de pulmo. O hbito de fumar expe os fumantes a substncias com atividade carcinognica. O Benzo[a]pireno, um dos principais agentes carcinognicos presentes na fumaa do cigarro, tem a capacidade de promover mutaes no DNA levando a mudana da base Guanina para Timina. Suponha que um trecho da fita molde de DNA do gene X, representado a seguir, possa ser alterado em presena do Benzo[a]pireno, em um dos dois stios indicados na figura 1. Considere que o RNA mensageiro seja formado a partir das trincas mostradas no esquema da figura 1 a seguir. Indique as alteraes que ocorrero na sntese da protena X quando a mutao for localizada nos diferentes stios, justificando cada resposta com a utilizao do cdigo gentico da figura 2: b) Utilize um exemplo de alterao estrutural da globina humana (cadeia beta) para explicar como uma mutao pontual, do tipo substituio, pode afetar a sade e a qualidade de vida do portador dessa mutao.

35. (Ufrj 97) O ADN um polmero constitudo por vrios nucleotdeos e as protenas so polmeros constitudos por vrios aminocidos. Um gene constitudo por um nmero N de nucleotdeos que codifica uma protena constituda por P aminocidos. Por que sempre encontramos N > P?

36. (Ufrj 99) Com o auxlio da tabela do cdigo gentico representada a seguir, sempre possvel deduzir-se a seqncia de aminocidos de uma protena a partir da seqncia de nucleotdeos 34. (Ufg 2005) As globinas constituem um bom exemplo da importncia da informao gentica na estrutura primria e na funo das protenas. do seu gene, ou do RNA-m correspondentes.

a) Considere o segmento de DNA, cuja seqncia de nucleotdeos 5' - GTG - CAC - CTG - ACT - CCT - GAG - GAG - AAG - 3' e, utilizando-se da tabela do cdigo gentico apresentada a seguir, fornea o produto da sntese protica (polipeptdio parte da cadeia beta prevista para a globina humana).

Entretanto, o oposto no verdadeiro, isto , a partir da seqncia de aminocidos de uma protena, no se pode deduzir a seqncia de nucleotdeos do gene. Explique por qu.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

Analise a tabela e faa o que se pede: a) Cite o nome da enzima que catalisa a sntese de RNA mensageiro. b) Cite a seqncia do anticdon correspondente ao cdon de iniciao. c) Qual a seqncia de aminocidos que resultar da traduo da molcula de RNA mensageiro? Ver figura anterior. d) Qual a seqncia de aminocidos que resultar da traduo da mesma molcula de mRNA, aps uma deleo do TERCEIRO nucleotdeo?

37. (Ufv 2000) Considere a tabela abaixo, contendo cdigos de trincas de bases do DNA com os aminocidos correspondentes, para resolver os itens seguintes:

39. (Fuvest 2005) A seguir est representada a seqncia dos 13 primeiros pares de nucleotdios da regio codificadora de um gene. a) Determine a seqncia de bases do RNAm que foi utilizado para sintetizar o polipeptdeo esquematizado abaixo da tabela.

--- A T G A G T T G G C C T G ----- T A C T C A A C C G G A C ---

b) Se ocorresse uma substituio, por uma purina, na 3 base do cdigo correspondente ao 6. aminocido do polipeptdeo, qual seria o aminocido da tabela a ser incorporado?

A primeira trinca de pares de bases nitrogenadas esquerda, corresponde ao aminocido metionina. A tabela a seguir mostra alguns cdons do RNA mensageiro e os aminocidos codificados por cada um deles.

c) Qual anticdon correspondente ao novo aminocido incorporado? 38. (Ufv 2004) A tabela adiante representa uma verso fictcia do cdigo gentico. Entretanto, esse cdigo segue o padro do cdigo gentico universal, no qual trs bases codificam um aminocido.

a) Escreva a seqncia de bases nitrogenadas do RNA mensageiro, transcrito a partir desse segmento de DNA. b) Utilizando a tabela de cdigo gentico fornecida, indique a seqncia dos trs aminocidos seguintes metionina, no polipeptdio codificado por esse gene. c) Qual seria a seqncia dos trs primeiros aminocidos de um polipeptdio codificado por um alelo mutante desse gene, originado pela perda do sexto par de nucleotdios (ou seja, a deleo do par de bases T = A)?



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

40. (Uerj 2004) Analisando o genoma de alguns tipos de vrus formados por fita simples de RNA, encontramos aqueles que so RNA (-), como o do resfriado comum, e os que so RNA (+), como o da poliomielite. Observe que: - nos vrus RNA (-), apenas o RNA complementar a seu genoma capaz de funcionar como mensageiro na clula infectada; - nos vrus RNA (+), o genoma viral funciona diretamente como mensageiro; - ambos os vrus necessitam, para sua replicao, da enzima RNA replicase, que sintetiza um RNA complementar a um molde de RNA; - o gene da enzima RNA replicase est presente no genoma dos dois tipos de vrus, mas a enzima s encontrada nas partculas virais RNA (-). a) Explique por que necessrio, para sua replicao, que os vrus RNA (-) j contenham a enzima RNA replicase, enquanto os RNA (+) no precisam armazenar esta enzima. b) Apresente um argumento contrrio hiptese de que os vrus, devido simplicidade de sua estrutura, foram precursores das primeiras clulas. a) Quantas uracilas e quantas guaninas comporo a fita do RNA mensageiro transcrito do DNA ativado? b) Quantos aminocidos devero compor a cadeia de polipeptdeos 41. (Ufrj 97) Em um organismo pluricelular com vrios tecidos, como no caso dos seres humanos, todas as clulas possuem um genoma idntico. Analogamente, correto afirmar que os ARN mensageiros (ARNm) dos diferentes tecidos so todos idnticos? Justifique sua resposta 42. (Ufrj 98) Suponha um gene de um eucarioto responsvel pela sntese de uma protena. Nesse gene existem ntrons, ou seja, regies do ADN cujas informaes no esto presentes na protena em questo. As regies do ARN transcrito correspondentes aos ntrons so eliminadas aps o processo de transcrio.A figura a seguir representa o resultado de uma experincia de hibridao do ARN mensageiro com a cadeia de ADN que lhe deu origem e responda: a) Qual ser a seqncia do RNAm transcrito a partir deste DNA? b) O mesmo peptdio ser obtido a partir deste RNAm e do RNAm da fita complementar? Explique. GTA GCC TAG 44. (Unicamp 94) Considere um fragmento de DNA com a seguinte seqncia de bases: que ser formada? Justifique sua resposta. 43. (Unesp 2003) Em um segmento da cadeia ativa de DNA, que servir de molde para a fita de RNA mensageiro, h 30 timinas e 20 guaninas. No segmento correspondente da fita complementar do DNA h 12 timinas e 10 guaninas. Levando-se em considerao essas informaes, responda. A figura mostra cinco regies, identificadas por nmeros de 1 a 5. Quais dessas regies correspondem aos ntrons? Justifique sua resposta.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

48. (Fuvest-gv 91) Certos mutantes nutricionais do fungo Neurospora s conseguem crescer quando aminocidos so adicionados ao meio de cultura. Na tabela a seguir, o sinal (+) significa crescimento, e o sinal (-) significa ausncia de crescimento.

45. (Unifesp 2003) O jornal "Folha de S.Paulo" (23.09.2002) noticiou que um cientista espanhol afirmou ter encontrado protenas no ovo fssil de um dinossauro que poderiam ajud-lo a reconstituir o DNA desses animais.

a) Faa um esquema simples, formado por palavras e setas, demonstrando como, a partir de uma seqncia de DNA, obtm-se uma protena. b) A partir de uma protena, possvel percorrer o caminho inverso e chegar seqncia de DNA que a gerou? Justifique.

46. (Unirio 2002) Atualmente os genes podem ser desmembrados em trs classes diferentes: os genes que expressam mRNA que codificam polipeptdios diversos; os genes reguladores que codificam protenas que regulam outros genes; e uma terceira classe de genes que no codificam polipeptdios. Qual o produto final da classe de genes que no codificam polipeptdios? substrato (gene1) ornitina (gene2) 47. (Fuvest 93) O que so cidos nuclicos? Como atuam na sntese de protenas? Supondo que em cada mutante h apenas um gene alterado, explique o porqu do mutante Z s crescer quando se adiciona arginina ao meio de cultura. citrulina (gene3) arginina Sabe-se que as etapas que levam sntese da arginina so:



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

50. (Uerj 2007) Diversas tcnicas so utilizadas para determinar, em genes de uma clula eucariota, a seqncia de bases nitrogenadas codificantes, ou seja, aquela que define a estrutura primria da protena a ser sintetizada. A abordagem experimental mais freqente, hoje, consiste em, primeiramente, extrair os RNA-mensageiros da clula, sintetizar os seus DNA-complementares e, ento, proceder ao seqenciamento das bases presentes nesses DNA. Em uma bactria, no entanto, possvel determinar a seqncia codificante diretamente a partir de seu cromossomo. Explique o motivo pelo qual, em organismos eucariotos, prefervel utilizar o RNA-mensageiro para determinar a regio codificante do DNA.

49. (Uerj 2006) Para investigar possveis efeitos de uma determinada droga, utilizou-se uma cultura de clulas, qual foram adicionadas quantidades adequadas das seguintes substncias, marcadas com istopos: uridina C, timidina H e leucina N. Aps algum tempo, a droga foi tambm introduzida no meio de cultura. Ao longo do experimento, amostras das clulas foram coletadas a intervalos regulares. A incorporao dos istopos foi medida em uma preparao que contm os cidos nuclicos e as protenas da clula. Os resultados do experimento esto mostrados no grfico a seguir.

51. (Ufg 2007) Os grficos a seguir representam o efeito inibitrio de dois antibiticos (I e II) sobre a sntese protica em culturas de 'Staphylococcus aureus'. As setas nos grficos indicam o momento em que foram administrados os antibiticos nas culturas.

a) Considere as etapas de replicao, transcrio e traduo nas clulas analisadas. Indique se a droga interfere em cada uma dessas etapas e justifique suas respostas. b) As protenas, aps sintetizadas, adquirem uma conformao tridimensional. Cite duas ligaes ou interaes que atuam na manuteno da estrutura enovelada das protenas. Com base nos grficos, explique a atuao dos antibiticos I e II sobre a sntese protica.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

53. (Ufrj 2002) Nos procariotos, o sinal para o incio da sntese das protenas (traduo) geralmente sinalizado no ARNm pelo cdon AUG, que corresponde ao aminocido metionina. No entanto, alm do cdigo AUG, existe uma seqncia curta de nucleotdeos que

52. (Ufrj 95) Na espcie humana h dois tipos de hemoglobinas, conhecidas como hemoglobinas A e S, que diferem apenas em um aminocido:

Hemoglobina A: ...valina-histidina-leucina-treonina-prolina-cido glutmico...

antecede esse cdon. Essa seqncia, que chamada de ShineDalgarno, em homenagem aos pesquisadores que as detectaram, permite que o stio correto de iniciao da traduo seja selecionado.

Hemoglobina S: ...valina-histidina-leucina-treonina-prolina-x...

O diagrama a seguir ilustra a localizao dessa seqncia. A seqncia de Shine-Dalgarno est em vermelho e o cdon de iniciao, em azul.

Essa pequena diferena suficiente para determinar que uma pessoa portadora de hemoglobina S sofra de anemia falciforme.

Os cdons de RNA-m que codificam esses aminocidos so:

valina - GUU, GUG, GUC, GUA histidina - CAU, CAC leucina - UUG, UUA treonina - ACU, ACC, ACG, ACA prolina - CCU, CCC, CCG, CCA cido glutmico - GAG, GAA Explique a importncia desse duplo controle da iniciao para a A mutao pode ocorrer no ADN como mostra o esquema a seguir: traduo correta da mensagem contida no ARNm.

54. (Ufrj 2008) Se extrairmos o DNA total de clulas de msculo, bao e rim de um mesmo indivduo, verificaremos que os tecidos apresentam genomas idnticos. Os RNA mensageiros das clulas desses trs tecidos sero os mesmos? Justifique sua resposta.

a) Qual o aminocido que aparece, na hemoglobina S, no lugar do cido glutmico? Justifique sua resposta. b) Todas as clulas, a partir da clula que sofre a mutao, sero anmalas? Justifique sua resposta.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

55. (Ufscar 2005) Nos anos 50 e 60, quando se iniciavam as pesquisas sobre como o DNA codificava os aminocidos de uma protena, um grupo de pesquisadores desenvolveu o seguinte experimento:

- Sintetizaram uma cadeia de DNA com trs nucleotdeos repetidos muitas vezes em uma seqncia conhecida: ...AGCAGCAGCAGCAGCAGCAGCAGC... - Essa cadeia de DNA foi usada em um sistema livre de clulas, porm no qual haviam todos os componentes necessrios sntese protica, incluindo os diferentes aminocidos. - Nesse sistema, essa cadeia de DNA sempre produzia uma protena com um nico tipo de aminocido. Diferentes repeties do experimento demonstraram que at trs protenas diferentes poderiam ser produzidas, cada uma delas com um nico tipo de aminocido: serina ou alanina ou glutamina. b) Pode-se dizer que seqncias idnticas de aminocidos so sempre codificadas por seqncias idnticas de nucleotdeos? Justifique. a) Quantos nucleotdeos so necessrios para codificar a seqncia de aminocidos nas espcies 1 e 2? Justifique.

a) Por que as protenas obtidas possuam apenas um tipo de aminocido? b) Por que foram obtidos 3 tipos de protenas?

c) Considerando que as espcies 2, 3 e 4 se originaram da espcie 1, que tipo de mutao originou cada seqncia? 58. (Unicamp 2002) O esquema a seguir representa a seqncia de reaes que levam formao do pigmento da pelagem de uma

56. (Unicamp 98) O metabolismo celular controlado por uma srie de reaes em que esto envolvidas inmeras protenas. Uma mutao gnica pode determinar a alterao ou a ausncia de algumas dessas protenas, levando a mudanas no ciclo de vida da clula. a) Explique a relao que existe entre gene e protena. b) Por que podem ocorrer alteraes nas protenas quando o gene sofre mutao? c) Em que situao uma mutao no altera a molcula protica? 57. (Unicamp 2000) Abaixo esto esquematizadas as seqncias de aminocidos de um trecho de uma protena homloga, em quatro espcies prximas. Cada letra representa um aminocido.

espcie animal. Os genes autossmicos A, B e C so responsveis pela produo das enzimas A, B e C que atuam nesse processo metablico. Mutaes nos genes A, B e C produzem respectivamente os alelos recessivos a, b e c.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

60. (Unirio 2002) Sabe-se que a bactria 'E.coli' cresce mais rapidamente na presena da glicose (um monossacardeo) do que na presena de lactose (um dissacardeo). Isso se deve a dois fatos: primeiro, a lactose no to facilmente incorporada pelas bactrias; segundo, porque a lactose necessita ser hidrolisada pela enzima galactosidase em glicose e galactose. O grfico a seguir resultou de experimento em que 'E.coli' foi inoculada num meio contendo uma mistura de glicose e lactose. As curvas no grfico adiante representam a concentrao da enzima -galactosidase, a concentrao de glicose e o nmero de bactrias no meio de cultura em funo do tempo.

a) Do ponto de vista gentico, quantos tipos de albinismo podem ocorrer nessa espcie? Por qu?

b) Demonstre o fentipo esperado de um cruzamento entre animais de linhagens puras com dois tipos diferentes de albinismo.

c) possvel ocorrer uma mutao em um gene sem que se altere a enzima correspondente? Justifique.

59. (Unifesp 2006) Uma fita de DNA tem a seguinte seqncia de bases 5'ATGCGT3'. a) Considerando que tenha ocorrido a ao da DNA-polimerase, qual ser a seqncia de bases da fita complementar? b) Se a fita complementar for usada durante a transcrio, qual ser a seqncia de bases do RNA resultante e que nome recebe esse RNA se ele traduzir para sntese de protenas? 61. (G2) Descreva o experimento realizado por Hersey e Chase em 1952, conhecido como "experincia do liquidificador" na qual utilizaram istopos radioativos de enxofre (S) e de fsforo (P) para 'marcar' vrus parasitas de bactrias, bem como suas concluses a partir deste trabalho. Identifique as curvas da figura, correlacione os parmetros concentrao de -galactosidase, concentrao de glicose e nmero de bactrias e explique o comportamento da curva da enzima galactosidase.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

64. (Ufc 2008) Uma biotecnologia conhecida como "construo antisenso" (sem sentido) foi utilizada para a produo de tomate transgnico. A transformao gentica do tomateiro consistiu na incorporao (no genoma da planta) e na expresso de um segmento de DNA, que apresenta uma seqncia de nucleotdeos, complementar quela do gene natural. Esse gene natural codifica para a produo de uma enzima, essencial biossntese do etileno. Com base no exposto, responda as questes a seguir.

62. (Ufrj 2004) Aps tratar culturas de bactrias com doses de um agente mutagnico capaz de induzir uma nica mutao pontual (que afeta apenas um nucleotdeo por clula), analisou-se a seqncia de aminocidos de uma determinada protena em diversos mutantes gerados. Verificou-se que um desses mutantes produzia uma dada protena que diferia da original pela ausncia de 35 aminocidos em uma das extremidades da cadeia peptdica.

Explique como essa nica mutao pontual pode fazer com que a sntese da protena seja interrompida prematuramente. a) Qual o resultado da transcrio do gene natural (I) e do "gene antisenso" (II), presentes no segmento de DNA (molde) das plantas 63. (Ufrj 2007) As seqncias de RNA mensageiro a seguir codificam peptdeos com atividades biolgicas especficas. Suponha que mutaes no DNA tenham causado as seguintes mudanas nas duas molculas de mRNA (1 e 2). A tabela resumida do cdigo gentico mostra alguns cdons e seus aminocidos correspondentes. b) Segundo as regras de emparelhamento dos pares de bases, que fenmeno ocorrer como resultado do encontro, no citoplasma, entre esses dois RNA mensageiros, determinados no item anterior, e qual a conseqncia para o processo de traduo? modificadas, mostrado a seguir? 3'___ATTCGGC___TAAGCCG___TAAGCCG___5'(DNA)

c) A transformao gentica foi realizada de modo que a expresso do "gene anti-senso" ocorra apenas nos tecidos do ovrio floral. Qual o resultado final mais provvel de todo esse processo?

d) Qual a principal vantagem para os produtores de tomate que passarem a utilizar essas plantas transgnicas?

Em qual das mudanas (1 ou 2) h risco de perda ou de diminuio da atividade biolgica? Justifique sua resposta.

1. Na primeira gerao, cada hlice do DNA que contm N molda a sua hlice complementar usando bases com N. Forma-se, portanto, DNA dupla hlice do tipo intermedirio.

2. leve = zero intermedirio = 50% pesado = 50%

3. Procarioto porque no existe a carioteca separando o material gentico (DNA) do citoplasma, onde se localizam os ribossomos.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

10. a) O DNA produz cpias idnticas de si mesmo. b) Sntese protica.

4. a) Em ribossomos isolados no h sntese de cadeias polipeptdicas. O RNA mensageiro necessrio pois transmite a mensagem gentica para a sntese dos polipeptdeos.

11. a) Tipo de molcula: cido ribonuclico (RNA) b) Polipeptdeos so formados a partir do encadeamento de aminocidos. Polirribossomos so constitudos de ribossomos ligados ao RNA mensageiro. Justificativa: a uridina se incorpora ao cido ribonuclico. Este cido principalmente sintetizado no nuclolo, deslocando-se posteriormente para o citoplasma.

5. a) O ncleo contm DNA que comanda a produo das protenas atravs da sntese de RNA. b) Protenas e Glicoprotenas porque os ribossomos produzem as protenas que so associadas aos acares no Complexo de Golgi.

b) Compartimento: ncleo Justificativa: a timidina exclusiva do DNA, encontrado principalmente no ncleo.

12. a) Porque elas possuem DNA idnticos. 6. a) Transcrio no ncleo ao nvel dos cromossomos e traduo no citoplasma ao nvel dos ribossomos. b) Sem a regio organizadora do nuclolo no haver RNA ribossmico, matria-prima para a produo destes organides e, conseqentemente, cessar a sntese de protenas na clula. 13. REPLICAO: duplicao do material gentico (DNA), 7. a) Os animais tm 2n = 63 cromossomos, porque so resultantes da unio de espermatozide, com n = 31 cromossomos, e vulo, com n = 32 cromossomos. b) Os cromossomos so de 2 espcies diferentes e, portanto, no ocorre pareamento dos chamados cromossomos homlogos, impossibilitando a meiose e a gametognese. 14. a) TRANSCRIO: sntese de RNA, relacionada com o controle das atividades celulares atravs da sntese de protenas. relacionado com a transmisso das caractersticas hereditrias. b) Porque, embora essas clulas possuam o mesmo DNA, diferentes genes podem ser ativados ou no durante as etapas do desenvolvimento do indivduo.

8. Na fita dever existir 18% de guanina, 32% de adenina e 32% de timina.

I) filhas: 0% filhos: 0%

O DNA formado por uma dupla cadeia de polinucleotdeos. Sabendo-se que as cadeias so complementares e o pareamento sempre adenina com timina e citosina com guanina, a quantidade de citosina de ser igual a de guanina e a quantidade de adenina de ser igual a de timina.

II) filhas: 100% filhos: 100%

b) Em seres humanos, a herana do genoma mitocondrial , exclusivamente, materna, pois as mitocndrias do espermatozide no penetram no vulo. Portanto, o pai no transmitir esta

9. a) no tubo B a densidade intermediria devido a presena do istopo normal e do istopo pesado, dada a caracterstica do DNA ser semiconservativo. b) na faixa superior, h X de DNA, com densidade menor (istopo normal).

caracterstica (cegueira) para a sua prole. Por outro lado, no caso de a me ser afetada (cega), esta caracterstica ser transmitida para todos os seus filhos.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

A justificativa se baseia na propriedade semiconservativa da duplicao do DNA.

15. Vrias molculas de DNA-polimerase iniciam a replicao do DNA, simultneamente, em diversos stios do genoma denominados stios de origem de replicao.

22. A nica afirmao possvel, face aos dados, que as duas 16. a) A influncia pode ser crucial pois analisado o DNA fornecido por clulas nucleadas, como os glbulos brancos, que podem viver muitos anos e se duplicar ativamente. b) A fraude pode ser evitada colhendo-se clulas brancas da medula ssea vermelha do indivduo a ser testado. 23. a) Contm DNA as lminas de nmeros 3 e 4. b) As propores desiguais de citosina e guanina indicam a presena, 17. Durante a fertilizao, somente o DNA nuclear do espermatozide penetra no vulo. Por esse motivo, o DNA mitocondrial do zigoto necessariamente materno. 24. a) Os bacterifagos utilizam nucleotdeos que contm P da 18. Se houvesse a transcrio simultnea das cadeias complementares dos genes, as molculas de ARN sintetizadas tambm teriam seqncias complementares. Tal situao provocaria ento a formao de molculas de ARN de cadeia dupla, que no poderiam ser traduzidas nos ribossomas. c) No. Os vrus no injetam sua capa protica na clula bacteriana. 19. As mutaes ocorrem aleatoriamente, com uma taxa mdia constante. Logo, a variabilidade gentica diretamente proporcional antiguidade, o que confirma que nosso ancestral comum mais recente viveu na frica. 25. a) Os 'corrimos' correspondem a uma sucesso alternada de fosfato e desoxirribose (acar). Os 'degraus' so constitudos por 20. a) C = G = 29% e A = T = 21%. pares de bases nitrogenadas, unidas por pontes de hidrognio, onde adenina pareia com timina, e citosina com guanina. b) Porque a proporo de bases apresentada refere-se s duas cadeias da molcula de DNA, no sendo possvel determinar a proporo de citosina na cadeia que ser transcrita. b) O DNA realiza a transcrio, isto , produz o RNA mensageiro, que conduz os cdons para a sntese da protena nos ribossomos. O S radioativo entra na composio de protenas e no no DNA introduzido pelo vrus. b) Os bacterifagos injetam seu DNA com P no interior da bactria hospedeira, deixando-a marcada com radioatividade. bactria para construir seu material gentico (DNA). na quinta lmina, de um cido nuclico formado por uma hlice simples, podendo ser DNA ou RNA. molculas possuem as mesmas propores de bases nitrogenadas. Somente seriam idnticas se a ordenao das bases fosse exatamente a mesma nas duas molculas.

21. Cultura de crescimento N 100% de molculas de DNA com N.

c) As protenas podem ser diferenciadas pelo nmero, tipos e seqncias de seus aminocidos.

Cultura de 1 gerao 100% de molculas, cada uma com parte da hlice do DNA com N e parte com N.

26. a) Os bacteriofagos produzidos pela bactria infectada tero a cpsula protica e o DNA do fago T4. b) Durante a infeco, apenas o DNA do fago T4 penetra na bactria

Cultura de 2 gerao 50% de molculas com N e 50% com N - N.

hospedeira. O DNA do fago, passa a comandar a produo da nova linhagem viral.

27. a) Observe a figura a seguir:



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

32. a) a correspondncia entre as trincas de bases dos cdons e os aminocidos por eles codificados. b) Por que um nico aminocido pode ser codificado por mais de um cdon.

33. Quando a mutao for localizada:

a) no stio 1 A seqncia do DNA ser modificada pelo benzo[a]pireno de ATG para ATT levando, na transcrio, a formao de um RNAm com a b) O tipo de herana se justifica, pois apenas o DNA mitocondrial, presente no vulo (gameta feminino) ser transmitido descendncia. b) no stio 2 28. Na cadeia 2 h maior quantidade de pares CG. Devido a este fato, maior o nmero de pontes de hidrognio a serem rompidas, o que justifica a necessidade de uma temperatura de desnaturao mais elevada. A seqncia do DNA de CCG ser modificada para CCT levando na transcrio, a formao de um RNAm com a seqncia GGA ao invs de GGC. Nessa situao, a modificao de GGC para GGA no provocar alterao na protena; os dois cdons na traduo produzem uma protena com o aminocido glicina, nesta posio. 29. 1) cido fosfrico 2) Desoxirribose 3) Base nitrogenada 34. a) Produto da sntese protica (polipeptdio): val - his - leu - thr - pro - glu - glu - lys seqncia UAA ao invs de UAC. UAA um cdon de terminao, portanto, a mutao provocar a produo de uma protena menor.

30. O DNA um polinucleotdeo capaz de produzir o RNA mensageiro. Cada trs nucleotdeos (cdon) do RNAm ser traduzido por um aminocido ao nvel dos ribossomos.

b) Exemplo de mutao pontual no gene que codifica a cadeia da globina humana: substituio do nucleotdeo A por T no cdon correspondente ao cido glutmico. Conseqncia: anemia falciforme

31. a) Protena normal: Val - Leu - Tre - Pro - Tir - Val - Lis

- alterao estrutural do polipeptdio (substituio do cido glutmico pela valina); - alterao da funo da protena (globina); - reduo da capacidade de transporte de oxignio;

Indivduo A: Val - Leu - Tre - Pro Indivduo B: Val - Leu - Tre - Pro - Tir - Val - Lis Indivduo C: Val - Met - Tre - Pro - Tir - Val - Lis

- manifestao dos sintomas da anemia falciforme.

35. Com a descoberta do cdigo gentico sabe-se que um aminocido sempre codificado por trs nucleotdeos. Logo, o gene que codifica

b) A afetado porque produz uma protena menor. B normal, apesar da substituio de uma base nitrogenada no seu DNA, porque o cdigo gentico degenerado. C afetado porque possui um aminocido diferente em sua protena.

uma protena tem sempre maior nmero de nucleotdeos que de aminocidos. Sabe-se ainda que existem vrios nucleotdeos do gene que servem para a funo de regulao e no so transcritos.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

resulta principalmente da transcrio de genes diferentes, o que naturalmente produz uma composio de RNAm qualitativamente diferente de tecido para tecido.

36. Porque o cdigo gentico degenerado, isto , para um mesmo aminocido existem vrios cdons diferentes.

37. a) RNAm: UCC GUU AAU UCC GGC AAG 42. As regies 2 e 4. Essas regies formam alas justamente por no b) O cdon mutado, TTA, especificaria o terceiro aminocido da tabela. possurem as seqncias de nucleotdeos complementares, que foram eliminadas aps o processo de transcrio.

c) UUA

43. a) DNA cadeia complementar: 30A-20C-12T-10G

38. a) RNA-polimerase.

cadeia ativa: 30T-20G-12A-10C

b) UAC. RNA-mensageiro: 30A-20C-12U-10G c) W - A - T - S - O - N - E - C - R - I - C - K. Portador, o RNA-m ter 12 uracilas e 10 guaninas. d) A protena no ser formada, pois foi alterado o cdon de iniciao. b) A cadeia ativa apresenta 72 bases. Cada aminocido codificado por um cdon constitudo por 3 bases. Da conclumos que 72 bases 39. a) AUG AGU UGG CCU G formam 24 cdons que produziro uma cadeia polipeptdica com 24 aminocidos. b) Serina - triptofano - Prolina 44. a) CAU CGG AUC c) Metionina - Serina - Glicina b) Somente se formar o mesmo peptdeo se os cdons transcritos a 40. a) Para que o genoma RNA (-) seja expresso em protenas na clula infectada, primeiro necessrio que seja transcrito em RNA complementar, o que feito, apenas, pela RNA replicase, que no existe na clula. Desta forma, o prprio vrus ter de j possuir a enzima em sua estrutura. Os vrus RNA (+) j funcionam como mensageiros na clula infectada, sendo diretamente traduzidos em protenas virais, inclusive a RNA replicase. 45. a) Observe a figura a seguir: partir da fita complementar especificarem os mesmos aminocidos, devido degenerao do cdigo gentico.

b) Os vrus s existem em virtude de sua habilidade de utilizar a maquinaria metablica das clulas hospedeiras, direcionando-a para a formao de novas partculas virais. Portanto, os vrus s devem ter surgido aps o aparecimento das primeiras clulas.

41. No. Os tecidos de um mesmo organismo diferenciam-se pelas diferentes protenas que contm. Assim, a diferenciao dos tecidos



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

52. a) Valina, porque houve uma substituio (T x A) no codon do DNA correspondente a esse aminocido. b) No, porque aps a replicao do DNA semiconservativa.

b) No. Sendo o cdigo gentico degenerado, diferentes trincas de nucleotdeos especificam o mesmo aminocido.

46. Os genes que no codificam polipeptdeos transcrevem para produzir RNA ribossmico e RNA transportador. 53. Como o ARNm pode conter outros cdons AUG, alm do cdon de iniciao, a iniciao da traduo poderia ocorrer em qualquer 47. So molculas (DNA e RNA) que comandam, atravs da sntese de enzimas, todo o metabolismo celular. Segmentos de DNA (genes) transcrevem o RNAm que, nos ribossomos, associados ao RNAt realizam a traduo do cdigo gentico em uma protena. 54. No, porque a diferenciao celular envolve a expresso 48. Cada mutante possui um gene alterado. Z s cresce em meio com arginina, logo apenas o gene 3 do mutante Z apresenta alterao. 55. a) As protenas obtidas possuam apenas um tipo de aminocido 49. a) Replicao: no interfere; no h alteraes na incorporao de timidina marcada no DNA. Transcrio: no interfere; no h alterao na incorporao de uridina marcada no RNA. Traduo: interfere; esta etapa bloqueada porque h uma queda acentuada na incorporao de aminocido marcado na protena. b) O tipo de aminocido utilizado na produo da protena poder variar dependendo do local onde os ribossomos iniciam a traduo do cdigo gentico. O aminocido utilizado a serina quando a leitura comea no A, do cdon AGC. O aminocido a alanina quando a leitura comea no G, do cdon GCA. O aminocido utilizado a b) Duas dentre as ligaes ou interaes: - ponte dissulfeto - ponte de hidrognio - foras de van der Walls - interaes hidrofbicas - interaes eletrostticas 56. a) Gene um segmento do DNA localizado nos cromossomos. Possui um cdigo qumico representado por seqncias de bases nitrogenadas (adenina, guanina, citosina e timina). Cada trinca de bases capaz de codificar um aminocido de uma protena. A seqncia de trincas determinar a seqncia dos aminocidos de um 50. Os organismos eucariotos possuem ntrons, regies no codificantes em seu DNA, que sero eliminadas no processo de maturao do RNA-mensageiro, antes que ele seja traduzido em protena. b) Mutaes so modificaes na seqncia ou na composio das bases do DNA (gene) que podem causar a produo de uma protena alterada, ou mesmo a no produo da protena. 51. O antibitico I atua sobre a traduo, pois, ao ser administrado, reduz imediatamente a sntese protica. O antibitico II pode atuar inibindo a transcrio e/ou a replicao gnica, pois no momento da administrao at o incio da reduo da sntese protica, decorrem 20 minutos; isso significa que havia cido ribonuclico mensageiro sendo traduzido e produzindo protena. c) A substituio de uma base nitrogenada no DNA pode no causar nenhuma alterao na protena produzida pela clula porque o cdigo gentico degenerado, ou seja, um mesmo aminocido pode ser codificado por diferentes trincas de bases. polipeptdeo. glutamina, quando a leitura comea no C, do cdon CAG. porque o DNA utilizado apresentava um nico tipo de cdon (AGC). (transcrio) e a inativao de diferentes genes nos diversos rgos. regio onde houvesse um outro cdon AUG, o que geraria peptdeos truncados ou incompletos. A traduo s ocorre quando a seqncia de Shine-Dalgarno e o cdon AUG esto presentes.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

61. 1.) bactrias 'Escherichia coli' cultivadas em meio contendo P e S bactrias marcadas com os elementos radioativos.

57. a) So necessrios pelo menos 84 nucleotdeos pois cada aminocido de uma protena codificado por uma trinca de nucleotdeos.

b) No. Devido degenerao do cdigo gentico, um aminocido pode ser codificado por mais do que uma trinca de nucleotdeos.

2.) Vrus bacteriofagos parasitam as bactrias marcadas e ficam tambm marcados com P no DNA e S na cpsula protica.

c) A mutao que originou a espcie 2 foi uma SUBSTITUIO. Uma INVERSO produziu a alterao verificada na espcie 3 e uma DELEO acarretou o surgimento da espcie 4.

3.) Vrus marcados parasitam bactrias no marcadas.

4.) Antes da lise bacteriana o preparado levado ao liquidificador e centrifugado.

58. a) Do ponto de vista gentico, poderiam ocorrer trs tipos de albinismo, pois esto envolvidos trs pares de genes para a produo do pigmento no animal. Defeitos no gene A, impedem a formao do composto 1, interrompendo toda a cadeia de reaes que levam ao desenvolvimento da cor. Alteraes no gene B, acarretam a no formao do composto 2, resultando tambm na no formao da pigmentao. Mutaes no gene C, impedindo a sntese do composto 3, tambm causariam albinismo. Concluso: O DNA viral a substncia capaz de TRANSFORMAR as bactrias em "fbricas" de novos vrus bacteriofagos. Assim o DNA foi definitivamente identificado como sendo a substncia que controla a hereditariedade. 5.) O sobrenadante apresenta as cpsulas proticas marcadas com S e no precipitado h bactrias contendo DNA marcado com P.

b) Pais genotipicamente puros portadores de dois tipos distintos de albinismo:

62. A mutao deve ter alterado um cdon que codificava um aminocido transformando-o em um cdon de parada, que interrompe a leitura do ARNm pelo ribossoma.

AAbbCC x AABBcc 63. A mudana 2, pois essa a nica que provoca troca de Gerao: AABbCc - 100% pigmentados aminocidos. Essa troca altera a estrutura do peptdeo, o que pode alterar sua funo. c) Devido degenerao do cdigo gentico, um aminocido pode ser determinado por diferentes cdons. Assim, uma mutao em um gene, pode no causar qualquer alterao na protena codificada. b) b1. Emparelhamento dos RNA / Formao de RNA de fita dupla; 59. a) 3'TACGCA5'. b2. A traduo ser inibida; 64. a) (I): UAAGCCG; (II): AUUCGGC;

b) 5'AUGCGU3'. O RNA que ser utilizado na traduo o RNAm (RNA mensageiro).

c) No haver a sntese de etileno nos tecidos do fruto, e o fruto no amadurecer;

60. Os crculos pretos representam o nmero de bactrias; os crculos brancos representam a concentrao de glicose; os tringulos pretos a concentrao da enzima -galactosidase. Enquanto existe glicose no meio a -galactosidase est reprimida. Quando a glicose se esgota a expresso dessa enzima induzida.

d) Podero armazenar os frutos por mais tempo, depois de colhidos.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

campo? Que impactos o agronegcio causa na sociedade, na forma de desemprego, concentrao de renda e poder, xodo rural, contaminao da gua e do solo e destruio de biomas? Quanto tempo essa bonana vai durar, tendo em vista a exausto dos recursos naturais? O descuido socioambiental vai servir de argumento para a criao de barreiras no-tarifrias, como a que vivemos com a China na questo da soja contaminada por agrotxicos?"

Lista 6: Evoluo
TEXTO PARA A PRXIMA QUESTO (Ufg 2000) O texto que se segue foi extrado de "Xadrez, truco e outras guerras", de Jos Roberto Torero. Servimos-nos de algumas de suas estruturas para introduzir a(s) questo(es) seguintes.

"Os abutres, sbios animais que se alimentavam do mais farto dos pastos, j comeavam a sobrevoar a ala dos estropiados quando o General mandou que acampassem. Naquela tarde assaram trinta bois, quantidade nfima para abastecer os homens que ainda sobravam.... O plano dos comandantes era assaltar fazendas da regio e tomar-lhes o gado... noite a rao foi ainda mais escassa, e, para enganar a fome, fizeram-se fogueiras para assar as ltimas batatas e umas poucas razes colhidas pelo caminho. Como o frio tambm aumentava, surgiu um impasse: quem ficaria perto do fogo: os colricos, que logo morreriam, ou os sos, que precisavam recuperar as foras para a luta?" (TORERO, J. Roberto. "Xadrez, truco e outras guerras")

(Adaptado de Amlia Safatle e Flvia Pardini, Gros na Balana. "Carta Capital", 01/09/2004, p. 42.)

2. A contaminao por agrotxicos tambm mencionada no texto. A aplicao intensiva de agrotxicos a partir da dcada de 1940 aumentou a produtividade na agricultura. Atualmente, so produzidas e cultivadas plantas transgnicas, isto , geneticamente modificadas para serem resistentes ao de insetos. Um exemplo conhecido o milho geneticamente modificado com um gene da bactria 'Bacillus thuringensis' (Bt), o que lhe confere resistncia a ataques de insetos. Contudo, alguns pesquisadores tm observado que diferentes espcies de insetos adquirem resistncia s toxinas bioinseticidas produzidas por essas plantas. a) Explique como os insetos se tornam resistentes.

1. "O plano dos comandantes era assaltar fazendas da regio e tomarlhes o gado (...)"

b) Sabe-se que a aplicao intensiva de agrotxicos, como o DDT, pode afetar a cadeia alimentar tanto de ambientes aquticos como de solos. Explique por que isso ocorre.

Em algumas fazendas so introduzidas novas espcies, sem uma avaliao da capacidade adaptativa da espcie ao local. 3. (Ufes 96) A hiptese de que as mitocndrias se teriam originado de bactrias que, em algum momento do processo evolutivo, se a) Cite e explique 3 conseqncias positivas da introduo de novas espcies num determinado ambiente. b) Explique a relao existente entre desequilbrios ambientais e mutao. Exemplifique. associaram a uma clula eucariota, tem alguma sustentao cientfica. Cite trs argumentos que fundamentam essa hiptese.

TEXTO PARA A PRXIMA QUESTO (Unicamp 2007) "O agronegcio responde por um tero do PIB,

42% das exportaes e 37% dos empregos. Com clima privilegiado, solo frtil, disponibilidade de gua, rica biodiversidade e mo-deobra qualificada, o Brasil capaz de colher at duas safras anuais de gros. As palavras so do Ministrio da Agricultura e correspondem aos fatos. Essa , no entanto, apenas metade da histria. H uma srie de questes pouco debatidas: Como se distribui a riqueza gerada no


4. (Unesp 2000) Observe o esquema.

Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

a) Estabelea relaes entre a possvel conseqncia a seleo de uma nica variedade para plantio sobre a diversidade gentica do trigo cultivado naquela regio e sobre a capacidade do trigo de responder s alteraes ambientais. b) O aumento da concentrao de CO na atmosfera est relacionado a um fenmeno global que vem preocupando a comunidade cientfica e a sociedade em geral nos ltimos tempos. Comente os possveis efeitos dessa alterao global sobre a produo de gros da variedade de trigo mencionada. Qual a importncia da manuteno de banco de genes? 6. (Unicamp 2002) O mapa a seguir mostra os pases que renem em seus territrios 70% das espcies vegetais e animais existentes sobre

Um bilogo, ao analisar esse esquema hipottico, observou que as mitocndrias e cloroplastos originaram-se de um ancestral procarionte e se associaram a determinados tipos de clulas. As mitocndrias esto presentes no citoplasma de clulas animais, clulas vegetais e nos fungos, enquanto os cloroplastos so encontrados em clulas fotossintetizantes, estabelecendo-se entre eles relaes harmnicas de mutualismo.

a Terra. A maioria dos pases que apresenta megadiversidade est localizada nas regies tropicais.

Tendo-se como referncia estas informaes e o esquema, responda.

a) Que vantagens as mitocndrias oferecem s clulas hospedeiras e o que elas proporcionam s organelas? a) Que bioma comum maioria dos pases tropicais?

b) Quais as vantagens proporcionadas ao meio ambiente pelos cloroplastos? 5. (Unesp 2006) Na busca por uma maior produo de gros, agrnomos selecionaram artificialmente uma variedade de trigo que produzia 80% mais gros que as variedades at ento cultivadas. Essa variedade apresentava caule mais curto, de modo que a maior parte do nitrognio fornecido na forma de adubo era utilizada pela planta para a produo de gros. Em pouco tempo os agricultores de uma determinada regio abandonaram as variedades antigas e passaram a plantar apenas sementes dessa nova variedade. No entanto, no se sabia que a nova variedade era muito sensvel s flutuaes climticas, especialmente a altas temperaturas.

b) "A diversidade gera diversidade". Por que esta frase pode ser aplicada grande biodiversidade das regies tropicais?

c) Explique por que Madagascar, Indonsia e Filipinas apresentam, alm de grande biodiversidade, um elevado nmero de espcies que ocorrem apenas nesses locais.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

9. (Ueg 2007) A figura a seguir ilustra um importante processo que analisado por paleontlogos para o entendimento das variaes de complexidade e de diversidade de espcies.

7. (Unicamp 2000) Leia com ateno a tira a seguir:

a) Calvin no entende por que precisa estudar os morcegos. Esses animais, porm, tm funes biolgicas importantes nos ecossistemas. Cite duas dessas funes.

b) Calvin acredita que os morcegos so insetos porque, alm de consider-los nojentos, eles voam. No entanto, o que ele no sabe que asas de insetos e de morcegos no so estruturas homlogas, mas anlogas. Qual a diferena entre estruturas anlogas e homlogas?

Sobre esse processo, responda ao que se pede. a) Qual o processo em questo? b) De que forma esse processo pode contribuir para o entendimento da evoluo dos organismos?

c) D duas caractersticas exclusivas da classe a que pertencem os morcegos.

10. (Ufu 2001) Estudar a evoluo de um determinado grupo de organismos algo complexo, difcil mesmo. Como saber quais etapas evolutivas se sucederam na evoluo? O que veio primeiro? Nesse

8. (Unicamp 2001) Desde 1995 alguns estados norte-americanos esto excluindo o ensino da teoria de evoluo biolgica dos seus currculos escolares alegando, entre outras razes, que ningum estava presente quando a vida surgiu na Terra. Alguns cientistas defendem a teoria da evoluo argumentando que, se necessrio "ver para crer", ento no poderemos acreditar na existncia dos tomos, pois estes tambm no podem ser vistos. (Adaptado da "ISTO ", 25/08/1999.)

sentido os cientistas tm buscado na natureza provas da evoluo. Essas provas aparecem principalmente de duas maneiras bsicas. Pergunta-se: quais so essas duas maneiras principais pelas quais os cientistas tm estudado a evoluo?

a) Apresente trs evidncias que apiam a teoria da evoluo biolgica.

b) A mutao gnica considerada um dos principais fatores evolutivos. Por qu?



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

14. (Unicamp 2004) O melanismo industrial tem sido freqentemente citado como exemplo de seleo natural. Esse fenmeno foi observado em Manchester, na Inglaterra, onde, com a industrializao iniciada em 1850, o ar carregado de fuligem e outros poluentes provocou o desaparecimento dos liquens de cor esbranquiada que viviam no tronco das rvores. Antes da industrializao, esses liquens permitiam a camuflagem de mariposas da espcie 'Biston betularia' de cor clara, que eram predominantes. Com o desaparecimento dos liquens e escurecimento dos troncos pela fuligem, as formas escuras das mariposas passaram a predominar. a) Por que esse fenmeno pode ser considerado um exemplo de seleo natural? b) Como a mudana ocorrida na populao seria explicada pela teoria de Lamarck?

11. (Unicamp 95) Imagine que tenha sido elaborada a seguinte hiptese para explicar a extino dos dinossauros: Os dinossauros eram rpteis herbvoros que viveram no perodo Cambriano, h cerca de 600 milhes de anos. Nesse perodo surgiram as gimnospermas, que foram os primeiros vegetais a ocupar o ambiente Terrestre. Essas plantas possuam vasos pouco desenvolvidos, e por isso, a circulao de seiva elaborada atravs do xilema no era eficiente, causando a reteno de resduos metablicos txicos em suas folhas, flores e frutos. Os dinossauros incapazes de reconhecer o sabor amargo caracterstico das plantas txicas, alimentaram-se delas e morreram envenenados. H varias informaes erradas no texto acima. Indique trs delas e explique por que cada uma das afirmaes que voc selecionou errada.

12. (Fuvest 98) Mariposas da espcie 'Biston betularia' de cor escura (melnicas) eram raras em Manchester, Inglaterra, por volta de 1895. Predominavam os espcimes de cor clara, que se camuflavam sobre os liquens das cascas das rvores. Em 1950, porm, verificou-se que quase 90% das mariposas eram melnicas nas reas que se tornaram industriais, onde a fuligem negra produzida pelas fbricas recobriu o tronco das rvores. a) Explique esse aumento das mariposas melnicas entre 1895 e 1950 com base na seleo natural. b) Por que possvel afirmar que a colorao dessas mariposas um carter determinado geneticamente?

15. (Fuvest 97) a) comum ouvirmos a frase: "J tomei este antibitico tantas vezes que agora j no faz mais efeito." Esta afirmao pode ser verdadeira? Por qu? b) Costuma-se usar dois antibiticos diferentes no tratamento de certas doenas comuns, como a tuberculose, cujo agente causador j bem conhecido. Qual seria a forma biologicamente mais eficiente de administr-los: simultaneamente ou separadamente com um intervalo de 1 ms entre eles? Justifique sua resposta.

13. (Ufpr 95) Um levantamento populacional de borboletas realizado no final do sculo XVIII, no norte da Inglaterra, revelou um grande nmero de borboletas claras e uma minoria de cor escura, todas da mesma espcie. Um levantamento idntico, realizado 50 anos mais tarde, constatou uma inverso do quadro, sendo a maioria das borboletas encontradas de cor escura e apenas umas poucas de cor clara. Durante esse perodo de 50 anos, um grande nmero de indstrias se instalou na regio; seu combustvel, carvo, produzia uma acentuada poluio, caracterizada por uma cobertura fuliginosa negra, tanto nas construes como nas plantas. Como poderia ser explicada evolutivamente a mudana na proporo de borboletas claras e escuras?



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

16. (Uerj 2001) Foram introduzidas em dois frascos, que contm um mesmo meio de cultura, quantidades idnticas de um tipo de bactria. Aps algum tempo de incubao, adicionou-se, a apenas um dos frascos, um antibitico estvel, de uso freqente na clnica e cuja concentrao no se modificou durante todo o experimento. O grfico abaixo representa a variao do nmero de bactrias vivas no meio de cultura, em funo do tempo de crescimento bacteriano em cada frasco.

Explique por que ocorre variao na porcentagem de bactrias resistentes a antibiticos entre os anos de 1995 e 2000.

18. (Ufrj 2007) O grfico a seguir mostra como variou o percentual de cepas produtoras de penicilinase da bactria 'Neisseria gonorrhoeae' obtidas de indivduos com gonorria no perodo de 1980 a 1990. A penicilinase uma enzima que degrada a penicilina. A observao do grfico permite concluir que, no frasco em que se adicionou o antibitico, ocorreu uma grande diminuio no nmero de bactrias. Utilizando a teoria da seleo natural, explique o fato de essa populao ter voltado a crescer, aps a diminuio observada. 17. (Ufrj 2003) Visando a prevenir infeces, a adio de antibiticos na rao de animais domsticos tornou-se prtica comum em muitos pases. Ao longo dos anos, observou-se um aumento na porcentagem de bactrias que possuem genes que as tornam resistentes aos antibiticos, em detrimento das bactrias sensveis. A partir de 1998, o governo da Dinamarca proibiu o uso de antibiticos na rao de animais. Os grficos a seguir mostram a porcentagem de indivduos resistentes a antibiticos nas bactrias 'Enterococcus faecalis' e 'Enterococcus faecium' encontradas no trato digestivo de animais dinamarqueses nos anos de 1995 e 2000. Por que aumentou o nmero de cepas que produzem a penicilinase?



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

22. (Ufrj 2007) O valor adaptativo de um indivduo varia entre 0 e 1,0. Os valores extremos 0 e 1,0 indicam, respectivamente, indivduos eliminados pela seleo natural sem deixar descendentes e indivduos que contribuem com o maior nmero de descendentes para a gerao seguinte. Medies do valor adaptativo de indivduos portadores de seis gentipos, em duas populaes diferentes, revelaram os seguintes resultados:

19. (Unesp 90) O controle das doenas bacterianas infecciosas feito por antibiticos ainda no est totalmente resolvido. A cada medicamento produzido, verifica-se o aparecimento de linhagens de bactrias que no respondem ao tratamento. Diante desse fato, conclui-se que os antibiticos induzem o aparecimento de bactrias resistentes. Pergunta-se: a) Est correta esta concluso? b) Justifique a sua resposta.

20. (Ufes 96) A Siclemia ou Anemia Falciforme uma doena gentica grave em que os homozigotos SS, por s produzirem hemoglobina anormal do tipo S, apresentam anemia profunda e, se no tiverem um tratamento mdico eficiente, dificilmente atingiro a idade reprodutiva. No entanto, observa-se que a freqncia do gene S bastante alta na Grcia, frica e ndia, regies endmicas para a malria. a) Explique a relao entre a freqncia do gene S e a malria. b) Qual o agente etiolgico, o vetor e o ciclo de vida, no homem, do protozorio causador da malria? 23. (Uerj 97) Observe o grfico a seguir, que apresenta uma relao hipottica entre algumas das principais etapas da evoluo dos 21. (Ufrj 2001) Dois 'loci' de uma populao, cada um com dois gens alelos, sofrem a ao da seleo natural por muitas geraes, como mostrado nas tabelas abaixo. O coeficiente de seleo (S) indica os valores com que a seleo natural atua contra o gentipo. O valor adaptativo (W) representa os valores com que a seleo natural favorece o gentipo. Note que (W+S)=1. organismos, o esgotamento do on ferroso e as mudanas na percentagem de O na atmosfera. Dos genes "A" e "B", qual deveria apresentar maior freqncia? Justifique sua resposta.

No grfico o tempo medido em bilhes de anos Explique: a) por que a liberao de O ocorrida atravs da fotossntese, h cerca de 3 bilhes de anos, no acarretou, de imediato, aumento no nvel do oxignio atmosfrico. Qual dos gens, A ou B, apresentar a maior freqncia na populao? Explique. b) a relao entre o rpido acmulo de oxignio atmosfrico e a disseminao dos organismos aerbicos, de acordo com a Teoria Moderna da Evoluo.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

27. (Ufrj 95) O rato canguru um pequeno mamfero, comum no deserto americano, que consegue sobreviver nessa regio hostil graas s vrias adaptaes que possui: ele se alimenta base de sementes com elevado contedo de gordura, no possui glndulas sudorparas, tem hbitos noturnos e um focinho afilado e comprido. Essas caractersticas representam adaptaes do animal a um aspecto marcante de seu habitat. a) Identifique esse aspecto marcante. b) Escolha duas das quatro adaptaes citadas e explique como elas contribuem para a sobrevivncia do rato canguru.

24. (Uff 99) Um fazendeiro semeou trevos de variedade alta em uma rea cercada. Aps a semeadura reservou metade dessa rea para pasto de gado (rea A), ficando a outra metade isolada (rea B). Trs anos depois, um botnico removeu amostras de trevos de rea A e B, transplantando-as em um jardim experimental. Aps algum tempo, o botnico observou diferena no desenvolvimento das amostras transplantadas: grande proporo das retiradas da rea A era de planta rasteira, enquanto das retiradas da rea B, era de planta alta e vigorosa.

a) Assinale, nos parnteses correspondentes, toda alternativa que menciona um fator determinante da diferena observada pelo botnico. ( ) Ocorreu uma adaptao dos trevos ao local em que foram

28. (Ufrj 95) Vrios indivduos de uma planta foram introduzidos numa ilha muito grande. Como no existiam insetos que pudessem atacar a planta, ela rapidamente colonizou grandes espaos da ilha. Essas plantas possuem um "locus" com dois genes alelos A e A que, no momento da colonizao, tinha a mesma freqncia. Os alelos A e A atuam de forma diferente em duas caractersticas da planta, a saber, na capacidade de sobrevivncia nas condies climticas da ilha e na resistncia das plantas aos ataques dos insetos, como mostra a tabela a seguir:

semeados. ( ) Ocorreu o favorecimento de alguns gentipos em relao a

outros. ( ) Ocorreu a predominncia de indivduos com fentipos que

aumentavam sua sobrevivncia.

b) Explique cada escolha feita no item anterior.

25. (Ufg 2003) Os mamferos primitivos surgiram h milhes de anos. Por irradiao adaptativa, diferentes representantes dessa classe desenvolveram a capacidade de percorrer grandes distncias utilizando os membros posteriores ou inferiores. Por isso, certos animais desse grupo tornaram-se saltadores. Com relao s consideraes acima, a) explique a importncia da capacidade de saltar para a adaptao aos ambientes. b) relacione salto, mitocndria e ATP. Depois de 10 geraes dessas plantas na ilha, foi introduzida uma espcie de inseto que conseguia alimentar-se delas. 26. (Ufg 2006) Os registros fsseis evidenciam que a conquista do ambiente terrestre pelos seres vivos ocorreu na era paleozica, a partir do ambiente aqutico. a) Explique por que a conquista do ambiente terrestre pelos animais foi posterior dos vegetais. b) Explique duas caractersticas morfofisiolgicas que permitiram a ocupao do ambiente terrestre pelos animais. Com base nos dados da tabela, responda: a) O gene A desapareceu da populao antes da introduo do inseto? Justifique sua resposta. b) O gene A desaparece da populao depois da introduo do inseto? Justifique sua resposta.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

29. (Ufrj 99) Os machos de uma certa espcie de pssaros so territoriais, ou seja, so animais que delimitam e defendem a regio em que se instalam. Os mais fortes escolhem e ocupam os melhores territrios, dos quais expulsam qualquer outro macho que tente se aproximar. Na poca do acasalamento, as fmeas "passeiam" por todos os territrios e decidem com que macho vo procriar. O grfico a seguir mostra a ordem em que 10 machos dessa espcie foram escolhidos.

Identifique a regio em que h uma MENOR variedade de bicos e explique de que forma o padro de migrao destas aves favorece a sobrevivncia de seus filhotes.

31. (Ufrj 2006) No processo evolutivo, centenas de espcies podem ser criadas em um tempo relativamente curto. Esse fenmeno conhecido como radiao adaptativa. No grupo dos rpteis, ocorreu uma grande radiao adaptativa aps o aparecimento da fecundao O eixo das ordenadas indica a seqncia em que os machos foram escolhidos e o eixo das abscissas indica a qualidade dos territrios. a) O que determina a escolha preferencial dos machos pelas fmeas? b) Qual o mecanismo evolutivo que explica esse padro? 30. (Ufrj 2003) O I.V. um indicador da variedade de formas e tamanhos dos bicos de grupos de espcies de aves. Quanto maior o I.V. de um grupo de espcies, maior a variedade dos bicos. O grfico a seguir relaciona o I.V. das espcies de aves de duas regies (A e B) porcentagem de espcies de cada regio que migra para outros locais do planeta durante a poca de reproduo e criao dos filhotes. interna e do ovo amnitico; muitas espcies desse grupo surgiram e ocuparam o habitat terrestre. Explique por que o ovo amnitico facilitou a ocorrncia dessa radiao adaptativa. 32. (Unicamp 2000) A fauna de fundo de cavernas caracterizada por turbelrios, minhocas, sanguessugas, muitos crustceos e insetos, aracndeos e caramujos. Os vertebrados so representados por peixes, salamandras e morcegos. Os morcegos se refugiam na caverna durante o dia. Geralmente os animais so despigmentados e os peixes so cegos. Muitos insetos, miripodes e aracndeos tm pernas e antenas desmesuradas, no raro densamente revestidas de cerdas. Alguns besouros tm cerdas distribudas pelo corpo todo. A umidade constante de especial importncia; geralmente os animais so estenotermos. O alimento raro, a escurido completa, faltam vegetais.


BRASIL, 1943)

Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

variaes nos oscilogramas entre populaes simptricas e aloptricas? Justifique sua resposta.

(Adaptado de Mello Leito, C. ZOOGEOGRAFIA DO

a) Pode-se dizer que foi a falta de luz que fez com que os peixes ficassem cegos? Explique sua resposta do ponto de vista evolutivo.

35. (Ufrj 98) De acordo com o modelo de Lynn Margulis, as mitocndrias, antes de serem organelas celulares, eram organismos procariontes aerbicos de vida livre.

b) No texto so citadas adaptaes que permitem aos animais sobreviverem nesse ambiente. Identifique uma delas e explique a sua funo.

Eventualmente, ao longo da evoluo, esses organismos foram endocitados por clulas eucariotas anaerbias, permanecendo no citoplasma e passando a replicar-se a, em sincronia com as clulas hospedeiras.

c) Construa uma cadeia alimentar de trs nveis trficos que pode ocorrer em cavernas, utilizando as informaes do texto.

Essa associao teria ento criado clulas mais eficientes, capazes de gerar mais molculas de ATP por mol de glicose. De acordo com esse modelo, qual foi a principal presso seletiva para

33. (Unifesp 2006) consenso na Cincia que a vida surgiu e se diversificou na gua e, somente depois, os organismos conquistaram o ambiente terrestre. Considere os seguintes grupos de animais: porferos, moluscos, aneldeos, artrpodes e cordados. Considere os seguintes grupos de plantas: algas verdes, brifitas, pteridfitas, gimnospermas e angiospermas. a) Quais deles j existiam antes da conquista do ambiente terrestre? b) Cite duas adaptaes que permitiram s plantas a conquista do ambiente terrestre.

que as clulas "adotassem" as mitocndrias?

36. (Ufrj 2008) Com o surgimento da fotossntese, grandes concentraes de oxignio passaram a se acumular na atmosfera. Esse acmulo foi um dos eventos cruciais para a evoluo da vida na Terra, pois, em concentraes elevadas, o oxignio extremamente reativo e pode causar danos aos componentes celulares. Aceita-se que a evoluo das clulas eucariticas se deu por endossimbiose; por esse motivo, as mitocndrias (presentes nas clulas de protistas, fungos, animais e plantas) e os cloroplastos

34. (Unirio 2002) Duas espcies de pererecas (A e B) podem ser encontradas em simpatria ou em alopatria. As vocalizaes (espcie de canto na poca da reproduo) podem ser gravadas e os sons transformados em grficos (oscilogramas).

(presentes nas clulas de plantas e protistas) so descendentes de diferentes procariontes integrados s clulas primitivas por processos de fagocitose. Na evoluo da clula eucaritica por endossimbiose, qual evento deve ter ocorrido primeiro: a aquisio de mitocndrias ou a aquisio de cloroplastos? Justifique sua resposta.

37. (Unicamp 2003) Uma das hipteses mais aceitas para explicar a origem das mitocndrias sugere que estas organelas se originaram de bactrias aerbicas primitivas, que estabeleceram uma relao de simbiose com uma clula eucarionte anaerbica primitiva. a) D uma caracterstica comum a bactrias e mitocndrias que apoie a hiptese acima. b) Qual seria a vantagem dessa simbiose para a bactria? E para a clula hospedeira? Considerando que as vocalizaes variam em funo da localidade em que as espcies se encontram, que agente evolutivo explica as c) Que outra organela considerada tambm de origem simbitica?



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

Imediatamente, antes de cada aplicao, contou-se a quantidade de mosquitos vivos, em cada viveiro. Os resultados esto apresentados nos grficos a seguir:

38. (Uerj 2008) A lisozima, enzima com atividade bactericida, encontrada em fluidos corporais humanos como saliva, soro sangneo, lgrima e leite. O boi e o lmure, animais no aparentados, secretam essa enzima em seus estmagos. A tabela a seguir mostra as modificaes ocorridas na estrutura primria da lisozima desses dois animais, em relao humana.

Avalie as diferenas de resistncia dos mosquitos de cada grupo ao malation, propondo uma explicao para o diferente comportamento Essas modificaes, no encontradas em nenhum ancestral comum ao boi e ao lmure, permitiram lisozima desempenhar sua funo em um ambiente acidificado. Cite e defina o tipo de evoluo que explica a semelhana na estrutura primria da lisozima do boi e do lmure. 39. (Uff 2004) Foram coletados 1.000 exemplares do mosquito 'Anopheles culifacies', de ambos os sexos, em cada uma de duas regies denominadas A e B, bastante afastadas entre si. Em uma delas, a agricultura intensivamente praticada. Esses mosquitos foram mantidos em dois viveiros adequados. Os dois grupos foram aspergidos com doses iguais do inseticida sinttico malation, sendo esta aplicao repetida aps intervalos regulares de tempo. 40. (Uflavras 97) "Dona Gertrudes tinha no seu quintal uma horta de couves. Toda vez que apareciam lagartas comendo as folhas de couve ela ia at o armazm do seu Z-do-Adubo, e comprava o inseticida "terror-das-lagartas" receitado por ele. No entanto, a cada ano que passava, ela percebia que o "remdio" fazia menos efeito, mesmo que ela aumentasse a dose recomendada." Explique, sucintamente, usando os conceitos de: EVOLUO, MUTAO GNICA, SELEO NATURAL e MUDANA AMBIENTAL, o que ocorreu na horta de dona Gertrudes, supondo, para responder pergunta, que o produto no estivesse adulterado. desses grupos. Indique qual das regies deve ser a agrcola.

41. (Fuvest 91) "Para o homem poder suportar a intensa radiao solar nos trpicos, as clulas de sua pele adquiriram a capacidade de fabricar muita melanina."

Esta uma frase lamarckista. Critique-a com base no pensamento darwinista.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

47. (Uerj 2006) Considere as proposies a seguir, relacionadas ao conceito de evoluo das espcies.

42. (Unesp 2007) Aquecimento j provoca mudana em gene animal. Algumas espcies animais esto se modificando geneticamente para se adaptar s rpidas mudanas climticas no espao de apenas algumas geraes, afirmam cientistas. ("Folha de S.Paulo", 09.05.2006.)

I) O filsofo grego Anaximandro, que viveu por volta de 500 a.C., acreditava que os humanos evoluram a partir de seres aquticos parecidos com peixes. Esses seres teriam abandonado a gua para se

O texto pressupe uma interpretao darwinista ou lamarckista do processo evolutivo? Justifique.

adaptar vida terrestre por encontrarem melhores condies neste ambiente. II) Em 400 a.C., outro grego, Empdocles, propunha que homens e

43. (Unicamp 94) "Os antepassados dos golfinhos tinham patas, que, de tanto serem usadas para a natao, foram se transformando em nadadeiras." a) A frase acima est de acordo com a teoria de Lamarck ou com a teoria de Darwin? Justifique, relacionando a teoria escolhida com a frase. b) Por que a frase est em desacordo com a teoria no escolhida?

animais no surgiram como indivduos completos, mas como partes de um corpo que se juntaram ao acaso, formando criaturas estranhas e fantsticas. Algumas delas, incapazes de se reproduzir, foram extintas, enquanto outras prosperaram. III) Sabe-se que mutaes neutras, ou seja, aquelas que no alteram substancialmente a atividade biolgica da protena modificada, tendem a se acumular naturalmente a intervalos de tempo longos, porm estatisticamente regulares.

44. (Fuvest 89) "De maneira geral, os machos mais vigorosos, que apresentam maior adaptao ao lugar que ocupam na natureza, deixam maior nmero de descendentes." Essa afirmao de Charles Darwin, em A ORIGEM DAS ESPCIES. a) Qual a idia fundamental da teoria darwinista contida na afirmao? b) Relacione a afirmao de Darwin com o fenmeno da delimitao de territrio, largamente observado entre os animais vertebrados. a) Aponte, para cada proposio dos primeiros evolucionistas citados, Anaximandro e Empdocles, a teoria evolutiva formulada no sculo XIX que a ela mais se assemelha e justifique sua resposta. b) Explique a aplicao do conhecimento das estruturas primrias de um mesmo tipo de protena, encontrada em diferentes espcies de seres vivos, em estudos evolutivos.

45. (Fuvest 95) Uma populao de bactrias foi colocada em um meio de cultura saturado de um determinado antibitico. A maioria das bactrias morreu. No entanto, algumas sobreviveram e deram origem a linhagens resistentes a este antibitico. a) Explique o processo segundo a teoria lamarckista de evoluo. b) Explique o processo segundo a teoria darwinista de evoluo.

46. (Fuvest-gv 91) Um trecho de um trabalho cientfico diz o seguinte: "Quando o antibitico foi adicionado cultura de bactrias, apenas algumas sobreviveram. As sobreviventes se reproduziram e sua descendncia era resistente ao antibitico." Como Lamarck teria interpretado esse trecho? E Darwin?



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

vista cientfico, que expliquem a presena de peixes em lagoas desse tipo.

48. (Ufc 2007) Peter e Rosemary Grant so pesquisadores norteamericanos que estudam os tentilhes, pssaros comedores de sementes que vivem numa ilha do arquiplago de Galpagos. Esses pesquisadores observaram a modificao do tamanho mdio do bico dessas aves devido disponibilidade de sementes de tamanhos diferentes, das quais esses pssaros se alimentam. Quando h produo abundante de sementes, a espcie residente de tentilhes ('Geospiza fortis') prefere se alimentar de sementes menores. J em perodo de escassez de alimento, os pssaros dessa espcie que apresentam bicos mais largos passam a se alimentar de sementes maiores, as quais no so acessveis aos indivduos dessa populao que apresentam bicos menores. Em 1977, ocorreu uma seca de grande intensidade, que reduziu a produo de sementes. Texto adaptado de "Bicos sob medida". "Cincia Hoje" set. 2006.

50. (Ufrj 95) Leia com ateno as seguintes informaes:

INFORMAO I: O nmero de espcies de insetos que comem plantas na regio tropical , aproximadamente, trs vezes maior que o de espcies que comem plantas na regio temperada. INFORMAO II: As plantas produzem substncias, como os alcalides, que so txicas para muitas espcies de insetos que se alimentam de plantas.

Um estudo mostrou que 35% das espcies de plantas da regio tropical produzem alcalides, enquanto apenas 15% das espcies de plantas da zona temperada produzem essa substncia. Explique o mecanismo evolutivo que, possivelmente, gerou essa

a) Em relao ao tamanho do bico, o que seria esperado acontecer com a populao de tentilhes residentes, aps a seca de 1977, segundo a teoria da evoluo de Darwin? b) Que processo evolutivo estaria ocorrendo nesse evento? c) Posteriormente, a situao climtica da ilha se normalizou e a oferta de sementes tornou-se abundante. Porm, em 1982, um outro fato ocorreu: uma outra espcie de tentilho ('Geospiza magnirostris') chegou ilha. Esta espcie invasora tambm se alimenta do mesmo tipo de sementes que a espcie de tentilhes residentes e apresenta um porte mais avantajado e bicos maiores. Que tipo de relao ecolgica se estabeleceria entre a espcie residente e a invasora? d) Aps novos perodos de seca, que ocorreram em 2004 e 2005, o que se espera que acontea com a populao de tentilhes residente, em relao ao tamanho dos bicos, sabendo-se que os indivduos com bico menor so mais eficientes em se alimentar de sementes menores? Analise a situao, tambm, segundo a teoria da evoluo de Darwin.

diferena percentual entre as plantas das duas regies.

51. (Ufrj 97) Os dois cartuns de Garry Larson, apresentados a seguir, ilustram duas vises diferentes do processo evolutivo:

No cartum A, movidos pelo excesso de populao, vrios animais atiram-se ao mar realizando assim um suicdio coletivo. Um dos animais, entretanto, possui uma bia. No cartum B, algumas criaturas aquticas jogavam beisebol e, por acidente, a bola foi lanada terra.

49. (Ufes 96) Na caatinga existem lagoas temporrias que so formadas apenas durante o curto perodo de chuvas. Nessas lagoas existem algumas espcies de peixes conhecidas por "peixes das nuvens" ou "peixes anuais". O ciclo de vida desses peixes, de pequeno tamanho, est ajustado s alteraes ambientais entre os perodos seco e chuvoso. Apresente hipteses plausveis, do ponto de

Para que o jogo prossiga preciso que algum recupere a bola. Qual dos cartuns d uma interpretao lamarckista do processo evolutivo e qual d uma interpretao darwinista? Justifique sua resposta.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

56. (Unesp 2003) Darwin ajuda luta contra AIDS Charles Darwin aprovaria. O novo tratamento contra a AIDS, em desenvolvimento na Universidade Harvard, promete um raro avano no combate doena. Mas, melhor ainda, pela primeira vez uma terapia est levando a srio a teoria da evoluo darwiniana, baseada no princpio da seleo natural (...). A equipe da Universidade resolveu testar o que aconteceria se uma populao de vrus fosse

52. (Unesp 90) Em algumas ilhas do arquiplago de Galpagos, so encontrados cactos rasteiros, cujas flores ficam prximas ao cho, no sendo constatada a presena de iguanas terrestres. Nas ilhas onde vivem os iguanas, os cactos so arborescentes e suas flores encontram-se localizadas distantes do cho. Como voc explica esses fatos, segundo as teorias evolutivas de Lamarck e Darwin?

53. (Unesp 93) Considere as seguintes afirmaes: 1) "O gafanhoto verde porque vive na grama". 2) "O gafanhoto vive na grama porque verde". Na sua opinio, qual afirmao seria atribuda a Darwin e qual seria atribuda a Lamarck? Justifique sua resposta.

submetida a vrias drogas, AZT, DDI e Piridinona, que atacassem o mesmo alvo. O alvo a enzima transcriptase reversa, que o HIV usa (...) para integrar seu genoma ao da clula infectada. (...). O resultado foi revolucionrio (...), o vrus acabou perdendo a capacidade de se multiplicar. (...). O tratamento s eficaz quando as drogas so ministradas conjuntamente (...)

54. (Unesp 95) Tanto para Lamarck como para Darwin, o ambiente tinha um papel importante no processo evolutivo. a) Qual dos dois cientistas admitia que o ambiente seleciona a variao mais adaptativa? b) Qual o pensamento do outro cientista sobre o papel do ambiente no processo evolutivo?

("Folha de S.Paulo", 28.02.1993.)

Lembre-se de que cada droga reconhece e atua sobre uma regio especfica da enzima transcriptase reversa, e que as enzimas dependem de sua composio de aminocidos e estrutura espacial para exercer sua funo. a) Do ponto de vista evolutivo, e considerando a ao da seleo,

55. (Unesp 2002) Analise o texto a seguir, extrado da revista "Newsweek":

explique o que ocorreria com a populao viral se fosse utilizada uma nica droga.

"Cientistas da Inglaterra e dos Estados Unidos fazem um alerta contra o uso exagerado de antibiticos. De tanto serem bombardeadas com penicilinas e inmeros tipos de antibiticos, as bactrias resistentes prevalecero sobre as normais e, portanto, estamos a caminho de um desastre mdico".

b) Por que o tratamento s se mostrou eficaz com a administrao conjunta das trs drogas?

57. (Unicamp 92) Em uma determinada espcie, flores amarelas representam uma adaptao bem sucedida em relao a um certo polinizador. Todos os indivduos atuais dessa espcie apresentam

a) Como Darwin explicaria o aumento progressivo, entre as bactrias, de formas resistentes a antibiticos?

flores amarelas, mas, h muito tempo atrs, existiram flores de outras cores. Cite a teoria que explica esse fato e descreva o processo que levou existncia de uma nica cor para as flores dessa espcie.

b) Segundo os princpios neodarwinistas, por que estamos a caminho de um desastre mdico?



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

61. (Fuvest 2002) Em conseqncia do aparecimento de uma barreira geogrfica, duas populaes de uma mesma espcie ficaram isoladas por milhares de anos, tornando-se morfologicamente distintas uma da outra.

58. (Unicamp 98) Em 1950, o vrus mixoma foi introduzido em uma regio da Austrlia para controlar o grande aumento de coelhos europeus. O primeiro surto de mixomatose matou 99,8 % dos coelhos infectados. O surto seguinte matou 90%. No terceiro surto somente 40 a 60% dos coelhos infectados morreram e a populao voltou a crescer novamente. O vrus transmitido por mosquitos que s picam coelhos vivos. O declnio da mortalidade dos coelhos foi atribudo a fatores evolutivos. a) Do ponto de vista evolutivo, o que ocorreu com a populao de coelhos? b) Como os mosquitos podem ter contribudo para diminuio da mortalidade dos coelhos? b) Cite as duas situaes que podem ocorrer no caso de as populaes voltarem a entrar em contato pelo desaparecimento da barreira geogrfica. Em que situao se considera que houve especiao? a) Como se explica o fato de as duas populaes terem se tornado morfologicamente distintas no decorrer do tempo?

59. (Fuvest 97) Explique, de acordo com a teoria sinttica da evoluo, as adaptaes mencionadas nos textos a seguir. a) Durante o longo inverno da regio rtica, a plumagem de certas aves e a pelagem de certos mamferos tornam-se brancas, voltando a adquirir colorao escura no incio da primavera. b) Algumas espcies de anfbio e de inseto apresentam cores e desenhos marcantes que, ao invs de escond-las, as destacam do ambiente e chamam a ateno de possveis predadores.

62. (Fuvest 2005) A seguir so mostradas duas propostas de rvores filogenticas (I e II) para diversos grupos de animais invertebrados e fotos de animais (a, b, c), pertencentes a alguns desses grupos.

60. (Fuvest 99) O desenvolvimento da Gentica, a partir da redescoberta das leis de Mendel, em 1900, permitiu a reinterpretao da teoria da evoluo de Darwin. Assim, na dcada de 1940, formulou-se a teoria sinttica da evoluo.

a) Indique em qual das rvores os animais das fotos a e b so mais proximamente aparentados sob o ponto de vista evolutivo. Justifique sua resposta. b) Cite um outro animal includo no grupo taxonmico, mostrado nas rvores, ao qual pertence o animal da foto c. c) Quanto ao modo de respirao, qual dos trs animais (a, b, c) apresenta menor adaptao vida em terra firme? Por qu?

Interprete o diagrama acima, de acordo com essa teoria. a) Que fator evolutivo est representado pela letra A? b) Que mecanismos produzem recombinao gnica? c) Que fator evolutivo est representado pela letra B?



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

64. (Ufrj 2002) O grfico representa a taxa de pares de alelos em heterozigose em trs espcies diferentes de animais.

63. (Ufc 99) "Em 1997, no municpio de Monte Alto, noroeste de So Paulo, foram encontrados fsseis de uma espcie ainda desconhecida de dinossauros, pertencente famlia dos titanossauros, que viveu h 85 milhes de anos. A diferena entre o dinossauro de Monte Alto e as trs dezenas de titanossauros j identificadas est na forma das vrtebras do animal, nunca antes vista. Alm disso, os pesquisadores j constataram que o novo titanossauro, um adulto em seus 15 metros de comprimento e 15 toneladas, era menor e mais leve do que os espcimes encontrados na Argentina, que chegavam a medir 25 metros e a pesar 25 toneladas. Segundo Reinaldo Bertini, professor da Universidade Estadual Paulista (Unesp), 'isso mostra que os dinossauros dessa regio do Brasil provavelmente evoluram de maneira distinta dos de outras reas da Amrica do Sul'." (Revista VEJA, 12 de agosto de 1998)

Qual das trs espcies ter menor probabilidade de sobreviver se o ambiente em que vive for alterado? Justifique sua resposta.

De acordo com a teoria darwinista, os dinossauros de Monte Alto e da Argentina tiveram um ancestral comum. Para os neodarwinistas, mecanismos evolutivos de VARIAO, DIREO e ESPECIAO atuaram sobre os dois grupos, levando-os a caminhos evolutivos distintos. 65. (Ufrj 2005) Um txon classificado como parafiltico quando inclui alguns, mas no todos, descendentes de um ancestral comum. Um txon polifiltico contm membros com mais de um ancestral, e um txon monofiltico inclui todos os descendentes de um nico ancestral comum. Com base no exposto acima: Observe o diagrama a seguir: a) Cite dois mecanismos responsveis pelo surgimento de VARIAES nos dois grupos de dinossauros (do Brasil e da Argentina).

b) Cite o mecanismo evolutivo que DIRECIONOU a formao distinta dos dois grupos.

c) Cite o mecanismo responsvel pela especiao.

No diagrama, o conjunto DEF exemplo de uma dessas trs classificaes; BCD, de outra; e AB representa um exemplo de um terceiro tipo. Identifique-as.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

69. (Ufu 99) Muitas espcies de insetos, principalmente de mariposas, imitam com suas cores e formas do corpo folhas secas ou amareladas da vegetao. Essa estratgia de defesa, conhecida como camuflagem, adaptativa para esses animais. Presumindo-se que, quando as mariposas surgiram, todas eram marrons e no tinham nenhuma caracterstica especial que as tornassem parecidas com uma folha, poderamos supor que essas mariposas teriam surgido da seguinte maneira: Na descendncia de um grupo de mariposas, podem ter surgido indivduos mutantes que apresentavam alguma caracterstica que os tornassem diferentes dos outros e mais parecidos com uma folha,

66. (Ufrj 2006) Um mecanismo de especiao que ocorre em plantas, mas raro em animais, comea com a hibridao, ou seja, o cruzamento de indivduos de duas espcies diferentes. Alguns hbridos no so estreis. Quando os hbridos cruzam somente entre si, podem gerar uma nova espcie ao longo do tempo. Quando os cruzamentos ocorrem entre hbridos, e tambm entre eles e as espcies ancestrais, no se forma uma nova espcie. Por que o cruzamento com as espcies ancestrais impede a especiao em decorrncia da hibridao?

67. (Ufrn 2000) A figura abaixo mostra vrias espcies de peixes da Famlia dos cicldeos.

como uma variao na cor, uma mancha ou um detalhe da borda das asas. Estas mariposas passaram a deixar mais descendentes que as outras da populao, por serem menos predadas. Ao longo das geraes, outras recombinaes e mutaes foram surgindo, sendo que caractersticas que deixassem as mariposas mais parecidas com uma folha seca, portanto mais difceis de serem encontradas por predadores orientados visualmente, continuaram a ser selecionadas positivamente. Isso possivelmente continua ocorrendo e, por esse motivo, encontramos mariposas que imitam to perfeitamente folhas.

Com base em seus conhecimentos de evoluo e no texto acima, responda: Explique como os fatores evolutivos atuaram na variabilidade morfolgica de suas cabeas.

a) Como pode ser caracterizado o argumento acima dentre os diferentes tipos de pensamento evolutivo?

68. (Ufscar 2003) A moderna teoria da evoluo admite que a fonte primria da variabilidade dos seres vivos a mutao gnica.

b) Aponte DUAS caractersticas no texto que fundamentem o argumento.

a) Como se pode definir mutao gnica em termos moleculares? b) Por que mutaes em clulas germinativas so mais importantes para a espcie do que aquelas que ocorrem em outras clulas do corpo?



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

73. (Fuvest 96) Entre os ces domsticos encontramos uma grande diversidade morfolgica (p. ex.: Fox, So Bernardo, Doberman, Poodle e muitos outros). J entre os ces selvagens (Cachorro-domato, Lobo-guar), a diversidade muito menor.

70. (Unicamp 95) Escolha a frase que corresponde ao conceito atual de evoluo e d, para cada uma das outras duas, a razo de no a ter escolhido:

I. A evoluo resulta da modificao das populaes e no dos indivduos.

a) Como se explica, em termos evolutivos, essa diferena? b) Que nvel taxonmico atribumos grande diversidade encontrada dentro de cada grupo de animais domsticos? Por qu?

II. A evoluo ocorrer tanto mais rapidamente quanto mais os indivduos se modificarem para se adaptar ao ambiente.

c) Por que os ces "vira-latas" so, em mdia, mais resistentes a doenas que os ces com pedigree?

III. Os indivduos que vencem a "luta pela sobrevivncia" so os que determinam o rumo da evoluo, no importando se produzem descendentes e quantos eles so.

74. (Fuvest 2000) Os fatos a seguir esto relacionados ao processo de formao de duas espcies a partir de uma ancestral:

I. Acmulo de diferenas genticas entre as populaes. 71. (Unicamp 99) Aves que no voam so nativas da frica (avestruzes), Amrica do Sul (emas), Austrlia (emus e casuares) e Nova Zelndia (kiwi). a) Considerando que essas aves tm um ancestral comum, como se pode explicar a distribuio atual pelos diferentes continentes? b) Que processos provocaram a diferenciao dos animais dessas regies? b) Que mecanismos so responsveis pelas diferenas genticas entre as populaes? 72. (Unifesp 2007) Em 1839, um nico exemplar de figo-da-ndia, planta da famlia dos cactos, foi levado do Brasil para a Austrlia, onde essas plantas no existiam. Em 40 anos, quatro milhes de hectares daquele pas estavam cobertos pela planta e, depois de 90 anos, essa rea era de 25 milhes de hectares. No final da dcada de 1990, algumas plantas de figo-da-ndia foram trazidas da Austrlia para o Brasil para que seu plen fosse inoculado em flores das plantas daqui, visando aproveitamento econmico dos resultados. Depois de algum tempo, porm, verificou-se que essas plantas inoculadas com plen das plantas australianas no produziam frutos. a) Considerando que clima, solo e condies fsicas do ambiente entre a Austrlia e o Brasil so semelhantes e que ambos possuem biomas com caractersticas parecidas, elabore uma hiptese para explicar por que na Austrlia o figo-da-ndia invadiu uma rea to grande, enquanto aqui isso no ocorreu. b) Como voc explica que plantas brasileiras submetidas polinizao com plen de plantas australianas, no final da dcada de 1990, no tenham produzido frutos? a) Explique sucintamente como as duas populaes podem ter-se tornado morfologicamente distintas no decorrer do tempo. b) No caso de as duas populaes voltarem a entrar em contato, pelo desaparecimento da barreira geogrfica, o que indicaria que houve especiao? 76. (Uff 2005) Diferentes espcies de peixes herbvoros marinhos do mesmo gnero so encontradas nas regies tropicais do Oceano Atlntico, tanto na costa do Continente Americano, quanto na costa do Continente Africano. 75. (Fuvest 2005) Devido ao aparecimento de uma barreira geogrfica, duas populaes de uma mesma espcie ficaram isoladas por milhares de anos, tornando-se morfologicamente distintas. c) Qual a importncia do isolamento reprodutivo no processo de especiao? a) Qual a seqncia em que os fatos anteriores acontecem na formao das duas espcies? II. Estabelecimento de isolamento reprodutivo. III. Aparecimento de barreira geogrfica.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

77. (Ufrj 2003) Alguns anfbios possuem venenos que tm por base compostos qumicos alcalides. Os alcalides obtidos a partir dessas espcies vm sendo utilizados em pesquisas biomdicas, por causa de suas propriedades farmacolgicas. Os cientistas acreditam que o conhecimento das relaes evolutivas (filogenticas) dos anfbios pode auxiliar na escolha das espcies a serem estudadas na busca de novos alcalides. A figura a seguir mostra as relaes evolutivas entre cinco espcies de anfbios. As espcies 'Phyllobates terribilis' e 'Epipedobates tricolor' apresentam alcalides, enquanto a espcie 'Rana palmipes' no possui este tipo de substncia.

Aps estudos sobre este grupo, foi possvel elaborar o diagrama e o quadro a seguir, onde espcies supostamente distintas foram representadas por diferentes letras.

a) Considerando os mecanismos de especiao, como poderia ser explicado o surgimento das espcies C e D a partir de uma espcie ancestral? b) Das espcies citadas, qual delas mais se assemelha espcie ancestral? c) Que tipo de relao/interao ecolgica pode ocorrer entre D e E? Justifique sua resposta. Identifique qual das duas espcies, A ou B, deveria ser estudada primeiro pelos cientistas na busca por alcalides de interesse farmacolgico. Justifique sua resposta.

78. (Ufrj 2005) Indivduos de espcies diferentes podem viver em simpatria, ou seja, viver no mesmo lugar ao mesmo tempo, conservando-se como espcies diferentes, pois so isolados reprodutivamente. Indivduos de duas subespcies da mesma espcie apresentam diferenas genticas caractersticas de cada subespcie, mas no apresentam isolamento reprodutivo.

Duas subespcies podem viver em simpatria, mantendo-se como subespcies diferentes? Justifique sua resposta.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

81. (Ufv 2000) O processo de especiao dos seres vivos acompanhado, ao longo do tempo, por modificaes das freqncias gnicas de suas populaes.

79. (Ufrj 2006) Os tigres de dentes-de-sabre so mamferos extintos. Esses animais possuam caninos superiores muito desenvolvidos, em forma de sabre. Um fato menos conhecido que houve vrias espcies de mamferos placentrios com dentes-de-sabre. O diagrama a seguir mostra a filogenia provvel dos tigres de dentesde-sabre placentrios 'Barbourofelis' e 'Smilodon'.

a) Basicamente, como a seleo natural interfere nessas modificaes?

b) Alm dos mecanismos da seleo natural, cite DOIS exemplos, reconhecidos evolutivamente, de fatores que interferem nessas modificaes.

82. (Unesp 92) Considere os esquemas 1 e 2 a seguir, representativos das populaes A e B em dois momentos diferentes.

A presena da caracterstica dentes-de-sabre em 'Barbourofelis' e 'Smilodon' representa um caso de homologia ou de analogia? Justifique sua resposta.

80. (Ufrrj 99) Embora sejam popularmente chamados de "ursos", na realidade o urso castanho de origem europia, 'Ursus arctos'; o urso preto americano, 'Euarctos americanus'; e o urso polar branco, 'Thalarctos maritimus', so animais distintos. Em um primeiro momento, a situao seria como representado em 1, aps um determinado perodo de tempo, a representao seria como mostra o esquema 2: a) Se fosse possvel o encontro do urso castanho com o urso polar, um suposto acasalamento resultaria em reproduo? Justifique. Compare os dois esquemas e responda: a) O que representa a regio hachurada no esquema 1? b) O que poderia ter ocorrido com os indivduos correspondentes a b) Explique por que ocorreu a diferenciao entre esses animais? essa regio, no esquema 2?



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

diferena na freqncia de nascimento de crianas aa entre essas regies? Por qu?

83. (Unesp 2003) As populaes A, B, C e D vivem em quatro regies geogrficas diferentes. Quando os indivduos dessas populaes foram colocados juntos, cruzaram-se e os resultados obtidos foram os seguintes:

86. (Uerj 2004) Segundo o Teorema de Hardy Weinberg, uma populao ideal deve atingir o equilbrio, ou estado esttico, sem grandes alteraes de seu reservatrio gentico. Em uma das ilhas do arquiplago de Galpagos, uma das condies estabelecidas por Hardy e Weinberg para populaes ideais foi seriamente afetada por uma erupo vulcnica ocorrida h cerca de cem mil anos. Esta erupo teria diminudo drasticamente a populao de jabutis gigantes da ilha. a) Cite duas das condies propostas por Hardy e Weinberg para que o equilbrio possa ser atingido. b) Defina o conceito de evoluo em funo da freqncia dos genes de uma populao e indique de que forma a diminuio da populao

a) O que se pode concluir do fato de os cruzamentos A B, A D e B D terem produzido descendentes frteis? Que fator inicial poderia ter dado origem s populaes A, B, C e D? b) Que nome se d s espcies diferentes que vivem numa mesma regio geogrfica? Indique um exemplo de animais vertebrados que, quando cruzados entre si, produzem descendentes estreis.

afetou a evoluo dos jabutis gigantes.

87. (Ufrj 2004) Estudos recentes compararam as seqncias completas de DNA mitocondrial de indivduos de vrias regies geogrficas do planeta.

Os resultados revelaram que a variabilidade gentica no DNA 84. (Unicamp 97) Em um arquiplago ocenico, todas as ilhas so habitadas por aves de um mesmo gnero. Cada ilha possui uma nica espcie deste gnero e as diferenas morfolgicas principais entre elas so o tamanho e o formato do bico. a) Qual foi a primeira etapa desse processo de especiao? b) Que presso seletiva deve ter determinado a presena de aves com bicos diferentes em diferentes ilhas? c) Qual seria o procedimento para confirmar que as aves encontradas nas diferentes ilhas so de fato espcies diferentes? Explique por que a maior diversidade do DNA mitocondrial apia a idia da origem africana do 'Homo sapiens'. 88. (Unesp 2006) Analise a lista: Carl Line (Lineu) - (17071778)Natureza dos Estudos Desenvolvidos Props um modelo para a classificao biolgica moderna baseado 85. (Fuvest 2001) Um determinado gene de herana autossmica recessiva causa a morte das pessoas homozigticas aa ainda na infncia. As pessoas heterozigticas Aa so resistentes a uma doena infecciosa causada por um protozorio, a qual letal para as pessoas homozigticas AA. nas semelhanas e diferenas entre estruturas dos seres vivos. mitocondrial de indivduos africanos era quase o dobro da observada no DNA mitocondrial de no-africanos. Esses resultados foram importantes para corroborar a idia de que o ancestral comum mais recente do 'Homo sapiens' viveu na frica h cerca de 200.000 anos.

Considere regies geogrficas em que a doena infecciosa endmica e regies livres dessa infeco. Espera-se encontrar



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

Seus trabalhos fundaram as bases da biologia molecular e sem suas propostas revolucionrias no seriam possveis os testes de paternidade, os estudos sobre os genomas, os transgnicos e a clonagem.

A proposta de classificao de Lineu foi logo deixada de lado pelos bilogos, uma vez que hoje a espcie tomada como ponto de partida para classificao.

Robert Kock (1843-1910) Natureza dos Estudos Desenvolvidos Kock tornou-se muito conhecido pelos seus trabalhos sobre origem da vida, defendendo a gerao espontnea. Comentrios Suas pesquisas na rea da medicina levaram-no descoberta do bacilo da tuberculose.

a) Selecione, entre os cientistas citados, um, para o qual a descrio da natureza dos estudos desenvolvidos, esteja correta, e outro, cuja descrio da natureza dos estudos desenvolvidos esteja errada. Neste ltimo caso, justifique por que a descrio est errada. b) Considerando os dois cientistas escolhidos em (a), responda se os comentrios apresentados, sobre os estudos que eles desenvolveram, condizem com a realidade. Justifique sua resposta.

Gregor Mendel (1822-1884) Natureza dos Estudos Desenvolvidos Seus trabalhos sobre a transmisso de caractersticas hereditrias no foram valorizados de imediato pela comunidade cientfica, logo aps a sua publicao. Comentrios As descobertas de Mendel forneceram elementos importantes para a formulao das teorias neodarwinistas sobre o processo evolutivo.

89. (Unicamp 2003) A figura a seguir representa uma rvore filogentica do Filo Chordata. Cada retngulo entre os ramos representa o surgimento de novidades evolutivas compartilhadas por todos os grupos dos ramos acima dele.

Charles Darwin (1809-1882) Natureza dos Estudos Desenvolvidos Publicou o livro "A Origem das Espcies", no qual prope um mecanismo consistente para explicar o processo evolutivo. Comentrios Os estudos de Mendel foram decisivos para que Darwin elaborasse a teoria da evoluo e sugerisse como se d o processo de seleo natural. a) O retngulo I indica, portanto, que todos os cordados apresentam caracteres em comum. Cite 2 destes caracteres. b) Cite uma novidade evolutiva que ocorreu no retngulo II e uma que ocorreu no retngulo III. Explique por que cada uma delas foi importante para a irradiao dos cordados.

James Watson (1928- ) Natureza dos Estudos Desenvolvidos Juntamente com Francis Crick (1916-2004) inventou uma tcnica que permitiu manipular a molcula de DNA, iniciando assim a era da engenharia gentica. Comentrios



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO


90. (Unifesp 2002) A banana que utilizamos na alimentao tem origem por partenocarpia, fenmeno em que os frutos so formados sem que tenha ocorrido fecundao. Existem, porm, bananas selvagens que se originam por fecundao cruzada. 1. a) A espcie introduzida e adaptada ao novo ambiente ocupar determinado nicho ecolgico. Se predador, atuar no controle do a) Uma pessoa perceberia alguma diferena ao comer uma banana partenocrpica e uma banana originada por fecundao cruzada? Justifique. nmero de presas. Sendo presa, pode alimentar um nmero maior de predadores. Caso seja um produtor, poder servir de alimento aos consumidores primrios.

b) Qual dos dois tipos de bananeira teria maior sucesso na colonizao de um novo ambiente? Justifique.

b) Desequilbrios ambientais podem favorecer o aumento de variaes produzidas casualmente por mutaes. Exemplo: mariposas melnicas adaptadas em regies cujas rvores acham-se cobertas pela


fuligem produzida pela atividade industrial.

2. a) Mutaes e recombinaes gnicas geram variabilidade, (...) Ela formada por conjuntos de corredores extremamente estreitos. Em alguns deles no h oxignio. Os pesquisadores disseram que as espcies encontradas so muito resistentes e sobrevivem com quantidades de ar fatais para outros seres vivos. (O GLOBO, 26/12/96) b) O D.D.T um organoclorado pouco degradvel, portanto apresenta efeito acumulativo. Pode ser aplicado no ambiente terrestre a) Cite a funo do oxignio na cadeia respiratria e, com base na Teoria Sinttica da Evoluo, explique como os seres anaerbicos conseguiram sobreviver no ambiente das cavernas. b) Se afirmamos que as espcies que viviam na caverna comearam a sofrer adaptaes para conseguirem sobreviver sob as novas condies, estamos fazendo aluso a uma teoria evolutiva. Cite o nome dessa teoria e justifique sua resposta. 4. a) Mitocndrias so responsveis pela oxidao de compostos orgnicos, fenmeno que libera a energia necessria ao funcionamento celular. As clulas "hospedeiras" fornecem as 92. (Fuvest 99) comum o cruzamento entre jumento e gua para se obter o hbrido conhecido como burro. Este apesar de seu vigor fsico, estril. a) Sabendo-se que o nmero diplide de cromossomos do jumento 62 e o da gua 64, quantos cromossomos devem estar presentes em cada clula somtica do burro? b) Com base no conceito biolgico de espcie, o jumento e a gua pertencem mesma espcie? Por qu? b) Cloroplastos so organides responsveis pela fotossntese. Atravs deste processo bioqumico so produzidas as substncias orgnicas que mantm as cadeias e teias alimentares dos ecossistemas terrestres e aquticos. Alm disso, o consumo de dixido de carbono e a produo de oxignio contribuem para a manuteno da composio da atmosfera terrestre. condies apropriadas para a sobrevivncia e reproduo destes organides. 3. Mitocndrias possuem DNA, RNA, produzem suas protenas e so capazes de se autoduplicar. e, posteriormente, contaminar o ambiente aqutico. portanto existem insetos no-resistentes e resistentes. As toxinas agem selecionando os insetos resistentes e eliminando os no-resistentes (seleo natural).



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

- bioqumica comparada; - existncia de estruturas vestigiais; - homologias; - embriologia comparada.

5. a) Uma nica variedade de trigo diminui a probabilidade de adaptao, no caso de alteraes ambientais. Com maior nmero de variedades, a chance de algumas sobreviverem s alteraes maior.

b) O efeito estufa uma alterao que poderia levar esta variedade a extino. Um banco de genes garante a variabilidade gentica. b) A mutao gnica a fonte de novos genes, o que determina a variabilidade dentro dos grupos biolgicos, sobre a qual age a seleo 6. a) Floresta pluvial tropical. natural.

b) Nas florestas tropicais a grande diversidade de condies abiticas tais como temperatura, umidade, luminosidade, relevo etc., favorece a diversificao de inmeras espcies que podem ocupar diferentes nichos ecolgicos.

9. a) Fossilizao b) A seqncia de fsseis nas diversas camadas de rochas, das mais antigas s mais recentes, mostra uma composio bem diferenciada, havendo um aumento gradativo em complexidade e diversidade. Essa seqncia representa uma mudana gradual nas espcies de pocas

c) Ilhas se constituem em ambientes propcios para a evoluo de espcies exclusivas, pois esto isoladas geograficamente dos continentes.


10. O estudo comparado de registros fsseis e a anlise comparativa das seqncias de bases nitrogenadas do DNA de espcies distintas

7. a) Os morcegos que se alimentam de nctar de flores contribuem para a polinizao. Dispersam sementes as espcies frugvoras. Os insetvoros controlam as populaes de insetos dos quais se alimentam.

pode permitir a determinao do grau de parentesco evolutivo.

11. Os dinossauros so rpteis que surgiram no Perodo Trissico, da Era Mesozica h cerca de 200 milhes de anos. As conferas surgiram h cerca de 280 milhes de anos, no Perodo Permiano da

b) Homlogos so rgos que possuem a mesma origem embrionria, independentemente de sua funo. Ex: Asas dos morcegos e asas das aves.

Era Paleozica. Possuem vasos condutores eficientes para o transporte de seiva elaborada, o floema e no h evidncias de que produziam substncias txicas que os rpteis herbvoros no pudessem identificar pelo sabor.

Anlogos so rgos que possuem a mesma funo, independentemente de sua origem embrionria. Ex: Asas dos morcegos e asa dos insetos. 12. a) O escurecimento das rvores pela fuligem favoreceu as mariposas escuras que, camufladas, puderam sobreviver ao dos predadores. Com maiores chances de sobrevivncia e de reproduo, c) So caractersticas exclusivas dos animais da classe Mamferos: as mariposas melnicas puderam aumentar em nmero neste perodo.

- plos - glndulas mamrias, sebceas e sudorparas - msculo diafragma - placenta - hemcias anucleadas

b) possvel verificar que se trata de um carter hereditrio atravs de cruzamentos e da anlise da descendncia. O carter em questo se comporta de acordo com as leis de Mendel.

13. As borboletas melnicas se adaptaram melhor ao ambiente escurecido pela fuligem. As variedades claras so alvos mais fceis

8. a) Evidncias da evoluo biolgica: - fsseis;

de seus predadores quando pousadas sob um fundo escuro.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

21. O gene A, pois um letal recessivo, ficando protegido da seleo natural quando em heterozigose, enquanto o gene B e um letal dominante, sendo eliminado mesmo em dose simples.

14. a) as mariposas camufladas so pouco vistas pelo predador, determinando uma seleo natural pelo meio ambiente. b) Segundo Lamarck, as mariposas claras se transformariam em escuras e transmitiriam esta caracterstica para os seus descendentes.

22. O gene B da populao 2. O gene B fica protegido da seleo 15. a) A afirmao verdadeira pois os antibiticos podem agir como agentes selecionadores de bactrias resistentes. nos heterozigotos e, por isso, sua freqncia maior que zero. Na populao 1, todos os genes A so eliminados a cada gerao, logo sua freqncia ser zero. b) A aplicao de dois antibiticos simultaneamente mais eficaz pois um potencializa a ao do outro (sinergismo). 23. a) Porque todo O produzido nesta poca se combinou com o on ferroso at o esgotamento deste. 16. Ao acrescentar-se o antibitico, as bactrias sensveis foram eliminadas. Os microorganismos geneticamente resistentes, que haviam em pequeno nmero, foram selecionados e cresceram normalmente. 24. a) (x) Ocorreu uma adaptao dos trevos ao local em que foram semeados. 17. At 1998 a administrao de antibiticos eliminaram grande parte das bactrias sensveis, favorecendo a multiplicao das bactrias resistentes. Os dados relativos ao ano 2000 mostram um aumento na proporo de bactrias sensveis, indicando que elas possuem caractersticas que as favorecem na competio com as resistentes na ausncia de antibiticos. b) A diferena entre os dois grupos de plantas observados pelo botnico em seu jardim experimental indica a ocorrncia de seleo 18. O uso crescente da penicilina criou um ambiente em que a seleo natural favoreceu as cepas resistentes, cuja freqncia aumentou com o tempo. no grupo A. Isto contribuiu para a adaptao das plantas ao meio ambiente (rea em que o gado pastava), favoreceu alguns gentipos e promoveu o predomnio de fentipos (plantas rasteiras) que aumentaram a sobrevivncia da espcie (trevos). 19. No. Os antibiticos selecionam as linhagens de bactrias resistentes, eliminando apenas as sensveis. 25. a) facilidade para alcanar a presa e fugir dos predadores (x) Ocorreu o favorecimento de alguns gentipos em relao a outros. (x) Ocorreu a predominncia de indivduos com fentipos que aumentavam sua sobrevivncia. b) O acmulo de O representou uma mudana ambiental que favoreceu os organismos mais adaptados aerobiose.

20. a) Os indivduos portadores do gene S so resistentes Malria.

b) o salto exige um esforo maior, o que promove uma maior produo de energia, liberada pelo ATP, produzidas na mitocndria.

b) Agente etiolgico: 'Plasmodium sp.' Vetor: fmeas infectadas do mosquito-prego (Gen. Anopheles) 26. a) Os animais, por serem heterotrficos, necessitavam de ambiente com disponibilidade de alimentos orgnicos que somente se Resumo do ciclo vital: Homem (hospedeiro intermedirio) Mosquito (hospedeiro definitivo) Homem. tornaram disponveis com a colonizao do continente pelos vegetais, que so autotrficos e capazes de sintetizar substncias orgnicas a partir de substncias inorgnicas (gua, gs carbnico e sais minerais) e energia solar. Nesse processo, os vegetais liberam o oxignio para a atmosfera, transformando-a de redutora para oxidante, condio propcia para os animais aproveitarem de maneira



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

30. Regio A. A forma e o tamanho dos bicos das aves esto relacionados ao tipo de alimentao. Aves com bicos semelhantes tendem a competir por alimento. A migrao de vrias espcies reduz a competio na poca da reproduo, quando a demanda por alimento maior.

mais eficiente os carboidratos na respirao aerbica. Alm disso, a combinao de molculas de oxignio, formando o oznio, permitiu que raios ultravioleta fossem filtrados, diminuindo a incidncia desse tipo de radiao sobre a superfcie terrestre.

b) Podero ser escolhidas duas destas opes, entre outras: 1. Desenvolvimento de exoesqueleto quitinoso, impermevel gua, para evitar dessecao do corpo quando em contato com a atmosfera. 2. Desenvolvimento de escamas epidrmicas recobrindo o corpo, como no caso dos rpteis, para evitar dessecao quando em contato com a atmosfera. 3. Desenvolvimento de sistema de locomoo adequado ocupao do novo ambiente (patas e/ou asas), permitindo a busca de novas fontes de alimentos e novos habitats, bem como a fuga para longe dos predadores. 4. Desenvolvimento de respirao traqueal, pulmonar e cutnea adequadas ocupao do novo ambiente. 5. Desenvolvimento de fecundao interna e o ovo revestido por "casca" para proteo contra dessecao. b) Pernas desmesuradas permitem aos animais caverncolas o deslocamento rpido com a finalidade de atacar e evadir-se de predadores; abundncia de cerdas determinam grande capacidade de 27. a) Escassez de gua. percepo sensorial do ambiente escuro de cavernas. 32. a) A falta de luz no pode fazer com que os peixes fiquem cegos. Esta seria uma explicao lamarckista, ou seja, o ser vivo pode se modificar ativamente em resposta s mudanas ambientais. O ambiente escuro das cavernas selecionou os peixes cegos. Tais peixes devem apresentar outras caractersticas que os adaptam muito bem a este tipo de ambiente. 31. Os ovos dos rpteis protegem os embries da desidratao e permitem a reproduo fora do ambiente aqutico, possibilitando a colonizao dos ambientes terrestres.

b) As sementes fornecem gordura que pode ser oxidada para repor a gua perdida. Ausncia de glndulas sudorparas impede a perda de gua pela sudorese no calor do deserto. noite a temperatura do deserto cai, evitando o calor diurno e conseqente desidratao. O focinho afilado e comprido tambm evita a perda de gua.

c) Crustceos Peixes Sanguessugas

33. a) Porferos, moluscos, aneldeos, artrpodes e cordados possuam representantes no meio aqutico. Considerando as plantas, existiam as algas verdes.

28. a) No, porque os heterozigotos (AA) so resistentes aos insetos predadores. b) No, porque os heterozigotos (AA) so capazes de sobreviver nas condies climticas da ilha.

b) - cutculas e estmatos; - tubo polnico; - tecido vascular; - raiz, caule e folhas.

29. a) O macho que detm o territrio de melhor qualidade escolhido primeiro. b) As fmeas que escolhem os machos que ocupam os melhores territrios tm, evolutivamente, mais chance de criar sua prole; a seleo natural, portanto, deve ter favorecido aquelas fmeas com maior capacidade de analisar a qualidade do territrio ocupado por um macho.

34. Seleo Natural. A vocalizao serve para atrair as fmeas da prpria espcie para o acasalamento, evitando acasalamentos entre indivduos de espcies diferentes. As populaes aloptricas tm vocalizaes mais semelhantes do que as populaes simptricas. No primeiro caso no h possibilidade de atrair indivduos da outra espcie, j no segundo caso, onde as espcies ocupam a mesma rea, a seleo natural favorece a maior diferenciao do canto.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

resistncia ao praguicida foi conferida aos animais atravs de MUTAO GNICA, fenmeno casual e espontneo que determina a variabilidade entre os indivduos de uma mesma espcie.

35. A presso seletiva foi o gradual acmulo de oxignio na atmosfera, produzido por organismos fotossintetizadores. Nessas circunstncias, o oxignio seria txico para as clulas que no pudessem utiliz-lo e, assim, as clulas que adquiriram as mitocndrias tinham mais chance de sobreviver. Alm disso, puderam catabolizar a glicose mais eficientemente atravs das vias oxidativas.

41. As clulas da pele no adquiriram a capacidade de produzir a melanina devido a intensa radiao solar. Segundo a teoria darwinista os indivduos que produzem mais melanina so adaptados, ao contrrio dos que produzem pouca, que so menos adaptados.

36. A aquisio de mitocndrias, pois ela permitiu a utilizao (consumo) do oxignio produzido pelos cloroplastos. Alm disso, as mitocndrias esto presentes em fungos, plantas e animais, e os cloroplastos, somente em plantas, indicando que a aquisio de mitocndrias aconteceu antes da separao entre animais e plantas, isto , em um ancestral comum a ambos. 43. a) Lamarck porque preconiza que as "patas" do golfinho se transformaram em nadadeiras, pelo uso exagerado, para se adaptar ao ambiente aqutico. 37. a) Bactrias e mitocndrias apresentam DNA e RNA e, conseqentemente, capacidade de crescimento e autoduplicao. b) No interior da clula hospedeira as bactrias recebem nutrientes e ficam protegidas. Em contrapartida, fornecem molculas de ATP, produzidas durante a respirao aerbica. c) Cloroplastos. 44. a) Os seres vivos mais adaptados vencem a competio pelos recursos do meio e deixam maior nmero de descendentes. 38. Convergncia evolutiva ou convergncia adaptativa. Evoluo de uma caracterstica semelhante em duas ou mais espcies, de modo independente, para permitir a adaptao a um ambiente comum. 45. a) Segundo a teoria lamarckista os antibiticos induziram a resistncia em algumas bactrias. 39. No experimento realizado, os mosquitos da regio B mostraramse muito mais resistentes ao inseticida do que os da regio A. Os mosquitos da regio B, ao contrrio dos mosquitos da regio A, j devem ter tido contato com o malation em perodo anterior ao experimento, o que desencadeou um processo de seleo artificial induzido pelo homem, tendo os mosquitos sensveis j sido eliminados anteriormente. Desta forma, a maioria dos mosquitos coletados na rea B j possuam resistncia ao agrotxico e se reproduziram sem problemas. A regio B deve ser, ento, a regio agrcola. 47. a) A proposio de Anaximandro pode ser genericamente comparvel de Lamarck: os rgos e estruturas dos seres vivos se 40. Dona Gertrudes pode observar a EVOLUO da populao de lagartas em sua horta. A MUDANA AMBIENTAL provocada pelo inseticida utilizado acabou por SELECIONAR lagartas resistentes. A desenvolvem ou se atrofiam em funo da influncia ambiental e do uso ou desuso desses rgos. 46. Lamarck teria afirmado que as bactrias desenvolveram e transmitiram a resistncia ao antibitico a seus descendentes. Darwin afirmaria que o antibitico selecionou as variedades resistentes. Estas se multiplicam produzindo mais bactrias resistentes. b) Segundo a teoria darwinista os antibiticos agem como agentes selecionadores, portanto sobrevivem as bactrias resistentes. b) Vertebrados capazes de delimitar e defender seu territrio conseguem se acasalar com maior nmero de fmeas. b) A frase est em desacordo com a teoria de Darwin porque os golfinhos foram selecionados nesse ambiente, dentre as variaes produzidas pelos seus ancestrais. 42. A interpretao lamarckista, pois sugere que o animal se modifique para se adaptar s mudanas ambientais.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

51. O cartum A representa a evoluo darwinista, isto , na populao existia um indivduo com uma mutao - a bia - que permitir sua sobrevivncia e possivelmente a sobrevivncia da sua espcie. No cartum B, est implcito que a necessidade condicionar a evoluo, isto , para recuperar a bola os animais aquticos

A proposio de Empdocles antecipou os princpios fundamentais da teoria da seleo natural de Darwin: ocorrem alteraes nos seres vivos, mas apenas os organismos modificados que so mais aptos sobrevivem e se reproduzem.

b) Uma maior ou menor diferena entre as estruturas primrias de um tipo de protena encontrada em vrias espcies indicam um maior ou menor nmero de mutaes ocorridas. A quantidade de mutaes, por sua vez, proporcional ao tempo decorrido desde que tais espcies se originaram de um ancestral comum.

eventualmente tero que invadir o ambiente terrestre. Esta uma viso tipicamente lamarckista.

52. Segundo Lamarck os cactos conseguem se modificar para evitar os iguanas. Segundo Darwim os iguanas selecionaram as variedades de cactos capazes de produzir flores acima do solo.

48. a) Segundo a teoria de Darwin, seria esperado que o nmero de indivduos da espcie residente com bico mais largo aumentasse, pois eles conseguiriam se alimentar das sementes maiores; conseqentemente, apresentariam uma chance maior de sobrevivncia e de reproduo, produzindo um maior nmero de descendentes. Os indivduos com bicos menores teriam menor quantidade de sementes disposio, pois no conseguiriam se alimentar das sementes maiores e muitos morreriam de fome, o que ocasionaria um menor nmero de descendentes. Assim, esperado que haja um aumento no tamanho mdio do bico da populao de tentilhes residentes. b) O processo evolutivo envolvido a seleo natural. c) Com o estabelecimento da competio por alimento, os tentilhes invasores, que possuem bico maior, teriam vantagem em relao obteno das sementes maiores. O nmero de indivduos com bico maior, da espcie nativa, tender a diminuir. d) Os indivduos de bico menor se alimentaro das sementes menores disponveis e aumentaro o nmero de descendentes. Assim, o tamanho mdio do bico dos tentilhes residentes diminuiria. b) Segundo a teoria sinttica da evoluo (neodarwinismo) surgem, naturalmente, como resultado de mutaes, linhagens de bactrias resistentes aos antibiticos. Deste modo, aps dcadas de seleo, os medicamentos usualmente aplicados se tornariam incuos, pois seriam preservados diversos tipos de microorganismos resistentes. 49. Os peixes capazes de completar seu ciclo vital num curto intervalo de tempo em que h chuvas foram selecionados neste tipo de ambiente. 56. a) Do ponto de vista evolutivo, o uso de uma nica droga aumentaria a probabilidade de serem selecionadas linhagens virais resistentes a esse medicamento, anulando o seu efeito. 50. Nas regies tropicais as espcies de insetos herbvoros mais numerosas se alimentam das plantas que no produzem os alcalides evitando as que o produzem. Mais adaptadas, as que fabricam os alcalides, deixam maior nmero de descendentes. 57. Os vegetais que produzem flores amarelas, dentre outras variaes, foram mais bem sucedidos e puderam deixar maior b) O uso conjunto das trs drogas pode ocasionar mudanas nos aminocidos, na estrutura espacial da enzima, no seu centro ativo, etc., inativando a enzima e melhorando a eficcia do tratamento. 55. a) Os antibiticos selecionaram as bactrias naturalmente resistentes, eliminando as sensveis. b) Lamarck acreditava que o ambiente determinava o rumo da evoluo criando "necessidades" e os seres vivos se modificariam para atend-las. 54. a) Charles Darwin. 53. A frase 1 lamarckista porque sugere que os gafanhotos se tornaram verdes para viver na grama. A frase 2 darwinista porque indica que os gafanhotos verdes levam vantagem (camuflagem) sobre os de outras cores. Estes seriam eliminados pelos predadores.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

c) Animal b. Os aneldeos terrestres possuem respirao cutnea e, por este motivo, precisam manter a pele sempre mida para poder

nmero de descendentes j que foram selecionados pelo tipo de

58. a) Os coelhos foram submetidos a um processo de seleo natural, ou seja, foram eliminados os animais sensveis e preservados os resistentes que puderam recuperar o tamanho da populao.

realizar eficientemente as trocas gasosas com o ambiente.

63. a) VARIAES hereditrias so resultantes de mutaes, recombinaes gnicas, combinaes cromossmicas na

b) Os mosquitos vetores contriburam para a sobrevivncia dos coelhos transmitindo entre os indivduos desta populao formas atenuadas do vrus mixoma.

gametognese e na fecundao.

b) A SELEO NATURAL e a DERIVA GENTICA (ACASO) direcionaram a formao distinta dos dois grupos em ambientes

59. a) Aves e mamferos geneticamente capazes de trocar, respectivamente, penas e plos, tm maiores chances de sobrevivncia em ambientes onde ocorrem grandes contrastes entre as estaes primaveril e invernal.


c) A ESPECIAO conseqncia da seleo diferenciada a partir de uma populao ancestral. Seus componentes, atravs de migraes, se isolaram geograficamente e, aps muitas geraes,

b) Cores e desenhos marcantes podem servir de advertncia aos predadores pois indicam que a "possvel" presa possui sabor desagradvel ou veneno. caracterstica favorvel pois pode garantir a sobrevivncia dos anfbios e insetos que apresentam tais caractersticas.

foram fixadas novas variaes que resultaram em isolamento reprodutivo.

64. Os chitas ou guepardos, pois sua baixa heterozigose indica reduzida variabilidade gentica. Essa reduzida variabilidade pode dificultar a adaptao a um novo ambiente.

60. a) "A" representa MUTAES b) Crossig-over e segregao cromossmica na meiose. c) "B" representa a SELEO NATURAL. 66. Porque sem isolamento reprodutivo o cruzamento dos hbridos 61. a) A seleo natural diferencial, ocorrida durante milhares de anos, resultou nas diferenas morfolgicas observadas nas populaes isoladas geogrficamente. 67. A variabilidade morfolgica da cabea dos peixes o resultado de mutaes e recombinaes gnicas, submetidas ao efeito da b) As populaes formaro raas geogrficas de uma mesma espcie caso as diferenas resultantes da seleo natural no impeam o livre cruzamento e a produo de descendncia frtil. Ao contrrio, se for interrompido o fluxo gnico entre os indivduos das populaes, devido aos mecanismos que levam ao isolamento reprodutivo, podese considerar que houve especiao. 68. a) A mutao gnica uma alterao na seqncia de bases do DNA. b) Porque, atravs das clulas germinativas, as mutaes passam para os gametas e, conseqentemente, afetam as prximas geraes. seleo natural, em seus respectivos ambientes. com as espcies ancestrais mantm o fluxo gnico. 65. DEF monofiltico. BCD polifiltico. AB parafiltico.

62. a) rvore I. Os diplpodes (a) e as minhocas (b) apresentam neste cladograma um ancestral comum (Annelida) mais prximo.

69. a) Teoria sinttica da evoluo biolgica.

b) Surgimento de variaes a partir de mutaes e recombinaes b) Aranhas e escorpies. genticas.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

b) O processo de especiao evidenciado pelo isolamento reprodutivo, fenmeno que interrompe o fluxo gnico entre as populaes.

70. A frase I est de acordo com o conceito moderno de evoluo biolgica. Na frase II aparece a idia Lamarckista de que os seres se modificam para se adaptar s condies ambientais. A frase III tambm no est de acordo, pois preconiza que qualquer ser vivo que vena a luta pela sobrevivncia poderia produzir descendncia.

76. a) As populaes da espcie ancestral foram isoladas geograficamente. Depois, as populaes isoladas acumularam diferenas genticas, resultantes de mutaes e seleo natural. Por

71. a) Teoria da Deriva Continental. b) Isolamento geogrfico, seleo natural e isolamento reprodutivo (especiao).

fim, essas diferenas foram acumuladas at que as populaes no conseguiram produzir descendentes frteis, ou seja, sofreram isolamento reprodutivo e, portanto, podem ser consideradas espcies distintas.

72. a) Ocorrncia de um nicho disponvel, falta de competidores, predadores e parasitas. b) A espcie E.

b) Ocorreu o isolamento geogrfico, que provavelmente, levou a um isolamento reprodutivo. Ocorreu o processo de especiao.

c) Competio interespecfica. As espcies D e E ocorrem no mesmo continente, se alimentam do mesmo tipo de algas, tm o mesmo habitat e perodo de alimentao, ou seja, nicho ecolgico

73. a) Os ces domsticos passam por uma seleo artificial enquanto os selvagens so naturalmente selecionados pelo meio. b) Raas ou subespcies, porque podem produzir descendncia frtil. c) Os vira-latas apresentam maior variabilidade e resistncia porque se cruzam ao acaso.

semelhante, disputando, portanto, os mesmos recursos do meio.

77. Espcie B. As espcies 'P. terribilis' e 'E. tricolor' so evolutivamente mais prximas entre si, isto , possuem um ancestral comum que no compartilhado com 'R. palmipes' (espcie que no apresenta veneno) nem com a espcie A. A caracterstica de interesse

74. a) A seqncia de fatos : III, I e II.

(presena de veneno) compartilhada pelas duas primeiras espcies pode ter surgido em seu ancestral comum mais prximo. Nesse caso,

b) As diferenas genticas observadas so o resultado de mutaes, recombinaes gnicas, combinaes cromossmicas na formao de gametas e da fecundao, caracterstica da reproduo sexuada. A seleo natural a responsvel pela fixao das caractersticas adaptativas.

provvel que todos os descendentes deste mesmo ancestral compartilhem tal caracterstica, incluindo, assim, a espcie B.

78. No. Em simpatria, sem isolamento reprodutivo, ocorreria um fluxo gnico que eliminaria as diferenas genticas existentes entre essas subespcies.

c) O isolamento reprodutivo impede o fluxo gnico entre os indivduos das populaes que, ento, passam a constituir espcies diferentes. 79. Analogia. Os ancestrais de cada um desses animais no possuam essa caracterstica, que surgiu posteriormente. Os dentes de sabre surgiram independentemente nos dois grupos, aps a separao dos 75. a) As modificaes observadas nas populaes isoladas geograficamente so devidas seleo natural diferencial atuando sobre as variaes produzidas por mutaes e recombinaes gnicas. 80. a) No. Os ursos castanhos e polares pertencem a espcies e a gneros diferentes, o que impossibilita um acasalamento com reproduo. ancestrais de 'Nimravidae' e 'Felidae'.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

- probabilidades iguais na escolha dos parceiros no processo de reproduo sexuada - nmero de indivduos grande o suficiente para que eventos

b) Essa diferenciao conseqncia de um longo isolamento geogrfico ocorrido h milhares de anos.

81. a) A seleo natural "escolhe" os organismos mais adaptados em determinado ambiente.

aleatrios no afetem as propores estatsticas - no-sujeio dos genes alelos seleo natural, tendo todos os indivduos a mesma possibilidade de sobrevivncia

b) Mutaes, recombinaes gnicas, oscilao gentica e isolamento reprodutivo. b) Alterao progressiva das freqncias gnicas em uma populao. A populao de jabutis ficou mais sujeita a variaes gnicas 82. a) Sobreposio de nichos ecolgicos implicando em competio entre as duas populaes pelos recursos do meio. b) Eliminao ou ocupao de nicho ecolgico distinto. 87. As mutaes ocorrem aleatoriamente, com uma taxa mdia constante. Logo, a variabilidade gentica diretamente proporcional 83. a) Os cruzamentos citados produziram descendentes frteis, pois as populaes A, B e D pertencem mesma espcie. O fator inicial que originou as populaes A, B, C e D foi o ISOLAMENTO GEOGRFICO. 88. a) Correta: Charles Darwin. Errada: Robert Kock. b) Espcies diferentes que habitam a mesma regio geogrfica so denominadas SIMPTRICAS. O cruzamento entre o jumento e a gua produz a mula, animal vigoroso, porm estril. b) Os comentrios sobre Charles Darwin no condizem com a realidade, j que Darwin no utilizou os trabalhos de Mendel. 84. a) Isolamento geogrfico. b) Tipo de alimento disponvel em cada ilha. c) Cruzamentos e anlise da descendncia. Se no produzem descendentes, ou estes so estreis ou inviveis, j ocorreu o isolamento reprodutivo que determina a formao de espcies diferentes. 89. a) Todos os representantes do filo cordados apresentam um tubo neural dorsal, notocorda e fendas na faringe, em algum estgio de seu ciclo vital. b) O retngulo II indica o desenvolvimento de patas, o que 85. A freqncia de nascimentos de crianas aa ser maior nas regies em que a doena endmica. Nessas regies haver uma maior taxa de indivduos heterozigotos, selecionados favoravelmente em relao aos indivduos AA, pela presena do protozorio patognico. Cruzamentos subseqentes entre heterozigotos produziro maior taxa de indivduos aa. 90. a) A banana produzida por partenocarpia no apresenta sementes, 86. a) Duas dentre as condies: - no-ocorrncia de migraes - no-ocorrncia de mutaes que introduzam novos genes pois seus vulos no foram fecundados. As bananas selvagens possuem sementes j que seus vulos foram fecundados. representou um avano evolucionrio fundamental para a conquista do meio terrestre. O retngulo III representa o aparecimento do ovo com casca, provido de anexos embrionrios como o mnio, o alantide e o crio. Estas estruturas permitiram o desenvolvimento no meio areo e, portanto, a conquista definitiva do meio terrestre. Os comentrios sobre Robert Kock so verdadeiros, j que foi descobridor do bacilo da tuberculose. Justificativa: Trabalhou com o bacilo da tuberculose e no com a origem da vida. antiguidade, o que confirma que nosso ancestral comum mais recente viveu na frica. aleatrias (deriva gentica).



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO

A teoria de Lamarck afirma que os seres vivos sofrem modificaes adaptativas impostas em funo das alteraes ambientais, independentemente de seu gentipo.

b) A bananeira produtora de sementes apresenta maior variabilidade gentica, estando, por este motivo, mais capacitada para se adaptar s mudanas ambientais.

91. a) O oxignio o aceptor final de eltrons na cadeia respiratria. Os seres possuem caractersticas herdadas geneticamente. Essas caractersticas possibilitaram sua adaptao e reproduo nas condies ambientais da caverna.

92. a) 63 cromossomos. b) No. Os ancestrais do burro j se encontram em isolamento reprodutivo pois produzem descendncia estril.

b) Teoria evolutiva de Lamarck.



Prof. Fabio Dias Magalhes salabioquimica@gmail.com CURSO GENTICA E EVOLUO