P. 1
Questões extras de Genetica e Evolução

Questões extras de Genetica e Evolução

|Views: 80.103|Likes:
uestões de Genética e Evolução. Saiba mais em salabioquimica.blogspot.com
uestões de Genética e Evolução. Saiba mais em salabioquimica.blogspot.com

More info:

Published by: Fabio Dias Magalhães on May 21, 2012
Direitos Autorais:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

02/03/2015

pdf

text

original

salabioquimica.blogspot.

com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO

Genética e evolução Lista 1
1. (Ufrj 2001) Dois 'loci' de uma população, cada um com dois gens alelos, sofrem a ação da seleção natural por muitas gerações, como é mostrado nas tabelas abaixo. O coeficiente de seleção (S) indica os valores com que a seleção natural atua contra o genótipo. O valor adaptativo (W) representa os valores com que a seleção natural favorece o genótipo. Note que (W+S)=1.

Analise os dois heredogramas anteriores, considerando que o caráter é determinado por um único par de genes, e responda às seguintes questões:

Qual dos gens, A‚ ou B‚, apresentará a maior freqüência na população? Explique.

a) Qual o padrão de herança envolvido na determinação da característica representada no heredograma 1 e no heredograma 2? Justifique sua resposta.

2. (Fuvest 95) Um homem afetado por uma doença genética muito rara, de herança dominante, casa-se com uma mulher, não consangüínea. Imagine que o casal tenha doze descendentes, seis filhos e seis filhas. Responda, justificando sua resposta, qual será a proporção esperada de filhas e filhos afetados pela doença do pai no caso do gene em questão estar localizado. a) em um autossomo; b) no cromossomo X. 3. (Ufes 2001) Nos Estados Unidos, um grupo de cientistas do "Genetics & IVF Institute" vem testando um novo método que permite a seleção dos espermatozóides a partir de sua coloração, de acordo com a presença ou ausência do cromossomo Y ('Microsort'). Tal método, além de satisfazer os anseios de vários casais na escolha do sexo do filho, poderá ser benéfico quando utilizado por famílias portadoras de determinadas anomalias genéticas. c) Considerando o heredograma n¡.1, calcule a chance de os indivíduos III.1 e III.2 gerarem uma criança afetada do sexo masculino. 4. (Fuvest-gv 91) Uma população humana foi testada quanto ao sistema MN de grupos sanguíneos. Os dados obtidos compõem a tabela a seguir: b) Em qual das duas situações seria mais recomendado o uso da técnica ('Microsort') para a escolha de um bebê do sexo feminino? Por quê?

1

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
8. (Ufmg 94) Esta figura representa uma célula humana na qual uma estrutura está indicada pela seta.

a) Quais as freqüências dos alelos M e N nessa população? b) Essa população está em equilíbrio de Hardy-Weinberg para esse loco gênico? Com base na figura e em conhecimentos sobre o assunto,

5. (Fuvest 89) O daltonismo tem herança recessiva ligada ao X. Um indivíduo anormal, com cariótipo 47, XXY, era daltônico. Seus genitores tinham visão normal para cores. a) Qual genitor formou o gameta com 24 cromossomos? Explique. b) O erro ocorreu na primeira ou na segunda divisão da meiose? Explique.

a) CITE o nome da célula representada e sua principal função. b) CITE o nome da estrutura indicada pela seta e JUSTIFIQUE a existência da estrutura nessa célula. c) Utilizando a letra A para designar um conjunto de autossomos e as letras convencionalmente usadas para representar os cromossomos sexuais, CITE o número cromossômico dessa célula caso ela pertença a um indivíduo normal e um indivíduo cujo sexo não é compatível

6. (Fuvest 92) Com relação à espécie humana, pergunta-se: a) Por que é o pai quem determina o sexo da prole? b) Por que os filhos homens de pai hemofílico nunca herdam essa característica do pai?

com a presença da estrutura indicada. d) DENOMINE a síndrome que designa o indivíduo cujo sexo é compatível com a presença da estrutura indicada, mas não a possui.

9. (Ufpr 95) Em galinhas domésticas, o sexo feminino é 7. (Uff 2002) Um geneticista, adotando o mesmo critério utilizado para a montagem de cariótipo da espécie humana, montou o cariótipo de certa espécie animal desconhecida, conseguindo formar dez pares de cromossomos, restando, além desses, dois cromossomos de tamanhos distintos. Considere o padrão de determinação de sexo, nessa espécie desconhecida, igual ao do humano e determine: heterogamético. Numa determinada raça, a coloração das penas é uma característica condicionada pelo gene C e é ligada ao sexo. O alelo que determina a coloração carijó é dominante sobre o alelo para a cor branca. O cruzamento de uma galinha branca com um galo carijó produziu somente aves carijós. Promovendo o intercruzamento destes descendentes, qual seria a proporção fenotípica esperada? Demonstre os cruzamentos.

a) quantos cromossomos existem, respectivamente, nos óvulos, nos espermatozóides e nas células musculares dessa espécie animal; b) o sexo a que pertence o animal da espécie em questão, justificando sua resposta.

2

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
13. (Ufrj 2002) Certos tipos de câncer, em especial aqueles ligados às células do sangue, são tratados com transplantes de medula óssea. Nesses transplantes, uma parte da medula óssea de um doador sadio é introduzida na coluna vertebral de um paciente cujas células da medula óssea foram previamente eliminadas com auxílio de drogas ou de radiação. Após o transplante de medula é possível identificar os cromossomos de células de diversos órgãos e tecidos. A tabela a seguir mostra os resultados da classificação dos cromossomos de 4 tecidos de um paciente submetido a transplante de

10. (Ufrj 97) Fazendeiros que criam gado leiteiro podem, atualmente, determinar o sexo dos embriões logo após a fertilização, usando um "kit" que determina a presença do cromossomo Y. Se o embrião for fêmea, é reimplantado no útero da vaca. Caso contrário, ele é eliminado ou congelado para uso futuro. a) Para esses fazendeiros, qual a vantagem dessa prévia determinação do sexo dos embriões? b) Por que o "kit" pesquisa somente a presença do cromossomo Y?

11. (Ufrj 98) Durante o processo de meiose ocorre a recombinação gênica, isto é, a troca de seqüências de ADN entre cromossomos homólogos. Identifique o cromossomo humano que sofre menos recombinação. Justifique sua resposta.

medula.

12. (Ufrj 98) Na espécie humana existe um gene raro que causa a displasia ectodérmica anidrótica, que é uma anomalia caracterizada pela ausência das glândulas sudoríparas. Esse gene se localiza no cromossomo sexual X. Algumas mulheres, portadoras desse gene em heterozigose, ficam com a pele toda manchada, formando um mosaico de manchas claras e escuras, quando se passa um corante sobre a pele. Com base nesses resultados, identifique o sexo do paciente e o sexo do doador. Justifique sua resposta.

14. (Ufrj 2004) O governo de uma sociedade totalitária decidiu conter a expansão demográfica reduzindo a proporção de homens na população.

Com esse objetivo, foi então promulgada uma lei segundo a qual todas as mulheres que tivessem um filho homem não mais poderiam ter filhos. As demais mulheres poderiam continuar a ter filhos até que tivessem um filho homem.

a) Explique a formação dessas manchas do ponto de vista genético. b) Por que esse mosaico não pode aparecer em um homem?

Essa lei atingirá o objetivo desejado depois de algumas gerações? Justifique sua resposta.

3

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
18. (Unesp 97) Uma revista publicou uma reportagem com o título "Atleta com anomalia genética faz operação para definir seu sexo e poder competir na classe feminina de judô". A matéria dizia, ainda, que a jovem era um caso de pseudo-hermafroditismo, pois apresentava órgãos sexuais internos masculinos e órgãos sexuais externos femininos. Os testículos da atleta fora extirpados para que ela pudesse competir na equipe feminina de judô a) Que vantagem a atleta levaria sobre as demais competidoras se tivesse os testículos durante a competição?

15. (Ufu 99) Em uma 'Drosophila melanogaster', a determinação do sexo não é feita simplesmente pela presença ou ausência do cromossomo Y, mas por um balanço gênico entre genes femininizantes e masculinizantes. Se o cromossomo X de uma fêmea com cariótipo 2AXX sofrer não-disjunção meiótica e o óvulo resultante com 2 cromossomos X for fecundado por um espermatozóide normal, portador de um cromossomo Y, dando origem a um descendente com cariótipo 2AXXY, pergunta-se:

a) Qual é o sexo do descendente com cariótipo 2AXXY?

b) Sabendo-se que ela foi considerada do sexo feminino, que testes citogenéticos você faria para comprovar esta afirmação?

b) Sabendo-se que o sexo da 'Drosophila melanogaster' pode ser definido por um índice sexual (I.S.), qual é a relação que expressa esse índice? 19. (Fuvest 93) Um casal de não hemofílicos tem um filho com hemofilia. a) Qual é a probabilidade de que uma filha desse casal apresente a c) Qual é o índice sexual (I.S.) do descendente acima referido? doença? b) Qual é a probabilidade de que um outro filho desse casal seja 16. (Unesp 91) Na década de 40 descobriu-se que algumas células retiradas de mulheres apresentavam no núcleo interfásico, um pequeno corpúsculo de cromatina intensamente corado. Este corpúsculo é conhecido hoje como cromatina sexual ou corpúsculo de Barr. a) A que corresponde tal corpúsculo e em que tipo de células (somáticas ou germinativas) ele aparece? b) Qual a sua importância e por que ele não ocorre nas células masculinas? 20. (Fuvest 94) Uma mulher é portadora de um gene letal ligado ao sexo, que causa aborto espontâneo. Supondo que quinze de suas gestações se completem, qual o número esperado para crianças do sexo masculino, entre as que nascerem? Justifique sua resposta. também hemofílico? Justifique suas respostas.

17. (Unesp 93) A análise dos núcleos interfásicos de células da mucosa oral de uma mulher, fenotipicamente normal, revelou a existência de duas cromatinas sexuais em todos eles. Responda: a) Quantos cromossomos X tem esta mulher? b) Se ela se casar com um homem normal, qual a probabilidade de ter uma filha com constituição cromossômica igual à sua?

4

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
a) Sabendo que a doença em questão é um caso de herança ligada ao sexo, formule a conclusão do geneticista quanto à possibilidade de o consultante transmitir a doença a seus descendentes diretos.

21. (Fuvest 2000) No heredograma a seguir, ocorrem dois meninos hemofílicos. A hemofilia tem herança recessiva ligada ao cromossomo X.

b) Calcule os valores correspondentes à probabilidade de que o primo doente do consultante, ao casar com uma mulher normal, gere filhas e filhos afetados pela doença.

23. (Ufc 2002) Na espécie humana há algumas condições dominantes ligadas ao cromossomo X, embora sejam raras. A figura a seguir mostra o heredograma de um tipo de diabetes que leva a problemas no metabolismo do fosfato e dos carboidratos. a) Qual é a probabilidade de que uma segunda criança de II - 4 e II 5 seja afetada?

b) Qual é a probabilidade de II - 2 ser portadora do alelo que causa a hemofilia?

c) Se o avô materno de II - 4 era afetado, qual era o fenótipo da avó materna? Justifique sua resposta.

22. (Uerj 2002) Um homem pertence a uma família na qual, há gerações, diversos membros são afetados por raquitismo resistente ao tratamento com vitamina D. Preocupado com a possibilidade de transmitir essa doença, consultou um geneticista que, após constatar que a família reside em um grande centro urbano, bem como a inexistência de casamentos consangüíneos, preparou o heredograma abaixo. Nele, o consultante está indicado por uma seta. a) A mãe do cruzamento I é homozigota ou heterozigota? Justifique. b) Quais são os prováveis genótipos dos indivíduos II-2, III-4 e III-5? Com base no enunciado e na análise do heredograma, responda:

5

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
26. (Ufrj 2002) Uma das primeiras experiências de terapia genética foi realizada com indivíduos hemofílicos cujo gene para o fator VIII de coagulação era defeituoso. Na terapia foram retiradas células da pele do paciente. Estas células receberam cópias do gene normal para o fator VIII e foram posteriormente reintroduzidas no indivíduo. Os resultados mostraram um aumento significativo na produção do fator VIII nos indivíduos tratados.

24. (Ufes 96) MS (indivíduo IIIˆ) está grávida, tem vários parentes com hemofilia clássica ou hemofilia A. Como não tem recursos para fazer o diagnóstico pré-natal dessa doença pelo estudo do DNA fetal, procurou um geneticista. Ela quer obter mais informações sobre a hemofilia A e conhecer, por meio das leis da probabilidade, o seu risco e também o de sua família de vir a ter uma criança com essa doença. a) Qual a principal característica clínica da hemofilia A? Justifique por que esse sintoma clínico aparece nos afetados. b) Analise a Árvore Genealógica de MS e informe: 1- risco de ela vir a ter uma criança hemofílica, considerando o seu casamento com um homem normal (indivíduo III‰). 2- risco de sua prima (indivíduo III„) vir a ter uma outra criança hemofílica do mesmo casamento com o indivíduo III….

Supondo que o indivíduo tratado venha a ter filhos com uma mulher cujos genes para o fator VIII sejam defeituosos, existe possibilidade de nascimento de uma criança não hemofílica? Justifique sua resposta.

27. (Ufrn 99) Seguindo a representação a seguir

e considerando que os indivíduos apresentam, simultaneamente, dois 25. (Ufrj 2000) A cor do pêlo dos gatos depende de um par de genes alelos situados no cromossomo X. Um deles é responsável pela cor preta e o outro pela cor amarela. Existe um terceiro gene autossômico (não localizado nos cromossomos sexuais) que é responsável pela cor branca. b) construa um heredograma no qual três desses indivíduos sejam os filhos biológicos (legítimos) dos outros dois. Com essas informações, explique por que o pêlo de uma gata pode ter três cores, enquanto o pêlo de um gato só pode ter duas cores. c) discuta a possibilidade de uma mulher hemofílica e albina ser filha biológica dos pais propostos no heredograma que você construiu. a) indique os genótipos dos indivíduos. caracteres genéticos com mecanismos de herança distintos,

6

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
29. (Ufv 99) Com o objetivo de reconstruir a história familiar de um caso de herança de daltonismo, o heredograma a seguir começou a ser elaborado para que fosse determinado o genótipo e, ou, fenótipo dos indivíduos. Sabendo-se que o loco do gene para o daltonismo está no cromossomo X, e ausente no Y, responda:

28. (Ufrn 2005) Os heredogramas a seguir representam duas famílias com doenças hereditárias distintas. A doença que acomete a família 1 provoca retardamento mental acentuado, enquanto que a da família 2 é uma doença degenerativa fatal que aparece em torno dos 40 anos de idade.

a) Se os indivíduos I - 1 e II - 5 são daltônicos, quantas pessoas A Após analisar os heredogramas, atenda às solicitações a seguir. a) Quais os tipos de herança envolvidos na transmissão das doenças de cada família? Justifique sua resposta. b) Considerando que a seleção natural pode eliminar doenças genéticas, explique por que a doença da família 2 ainda poderia ser encontrada em indivíduos da geração VI (netos da geração IV). c) Se os indivíduos III - 1 e III - 4 vierem a se casar e ter filhos, poderão ter uma menina normal homozigota? Justifique. b) O indivíduo II - 5 poderá ter irmão normal? Justifique. MAIS, neste heredograma, também deverão apresentar este fenótipo?

30. (Unesp 90) Na espécie humana, o número de mulheres afetadas pelo daltonismo é baixo quando comparado com o número de homens afetados pela anomalia. Supondo-se que a freqüência de homens daltônicos nas populações seja de 10%, responda: a) Por que o daltonismo é raro nas mulheres? b) Quantas vezes os homens daltônicos são mais freqüentes nas populações do que as mulheres daltônicas?

7

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
33. (Unesp 2003) O daltonismo é comumente entendido como a incapacidade de enxergar as cores verde e/ou vermelha. A percepção de cores é devida à presença de diferentes tipos do pigmento retinol nos cones da retina. Nos indivíduos daltônicos, alguns desses pigmentos não estão presentes, alterando a percepção das cores. Os genes que participam da síntese desses pigmentos localizam-se no cromossomo X. O daltonismo é um caráter recessivo. Um homem daltônico casou-se com uma mulher de visão normal em cuja família não havia relatos de casos de daltonismo. Este casal teve dois filhos: João e Maria. a) Qual a probabilidade de João ter herdado do pai o gene para daltonismo? Qual a probabilidade de Maria ter herdado do pai o gene para daltonismo?

31. (Unesp 98) A genealogia representada na figura é de uma família com uma anomalia rara na espécie humana. Os círculos representam as mulheres e os quadrados, os homens. Os símbolos em escuro representam os indivíduos com anomalia

b) Por que é mais freqüente encontrarmos homens daltônicos que Com base nessa genealogia, responda. a) Qual o tipo mais provável da herança desta anomalia? Justifique. b) Tendo em vista o tipo de herança mais provável, quais os genótipos dos indivíduos II-4 e II-5? 34. (Unicamp 93) Uma mulher deu à luz um menino com hemofilia. Como nenhum de seus parentes próximos era hemofílico, ela supôs que o problema teria surgido porque o pai da criança trabalhava em 32. (Unesp 2003) José é uma pessoa muito interessada na criação de gatos. Um de seus gatos apresenta hipoplasia testicular (testículos atrofiados) e é totalmente estéril. José procurou um veterinário que, ao ver as cores preta e amarela do animal, imediatamente fez o seguinte diagnóstico: trata-se de um caso de aneuploidia de cromossomos sexuais. As cores nos gatos domésticos são determinadas por um gene A (cor amarela) e outro gene P (cor preta), ambos ligados ao sexo, e o malhado apresenta os dois genes (A e P). 35. (Unicamp 2001) A determinação do sexo em peixes segue o sistema XY, como no ser humano. Um alelo de um lócus do cromossomo Y do peixe 'Lebistes' determina a ocorrência de manchas na nadadeira dorsal. Um peixe macho com manchas na nadadeira foi cruzado com uma fêmea sem manchas. uma usina nuclear e teria ficado exposto a radiações que alteraram seu material genético. A mulher tem razão? Justifique. mulheres daltônicas?

a) O que é e qual o tipo de aneuploidia que o gato de José apresenta? b) Qual a explicação dada pelo veterinário relacionando a anomalia com as cores do animal?

a) Quais são os fenótipos de F e de F‚ desse cruzamento?

b) Como seria o resultado em F e F‚ se o alelo fosse dominante e estivesse no cromossomo X do macho? Demonstre através de um cruzamento.

8

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
37. (Unirio 98) Uma doença humana rara é introduzida em uma família quando uma mulher normal se casa com um homem afetado. Esse casal tem 5 filhos, 2 mulheres e 3 homens. Todas as filhas mulheres são afetadas por essa doença. Uma das filhas se casa com um homem normal e tem 7 filhos, sendo 4 homens, dos quais 2 são afetados, e 3 mulheres, das quais somente uma é normal. O irmão mais velho, afetado pela doença, casa-se com uma mulher normal e tem 2 filhos, uma mulher afetada e um homem normal. A irmã mais nova, também afetada pela doença, se casa com um homem normal e tem 3 filhos, uma moça normal e 2 homens, um normal e outro afetado. Observando a genealogia, pode-se dizer que o modo de herança mais provável seja de herança ligada do X dominante. Justifique essa conclusão, desenhe o heredograma dessa família considerando o gene (A) normal e o gene (a) mutado e apresente os

36. (Unifesp 2004) Um geneticista estudou dois grupos, I e II, portadores de uma doença genética que se manifestava da seguinte maneira:

O pesquisador concluiu que não se tratava de uma doença com herança dominante ou recessiva ligada ao sexo, porém teve dúvida se, se tratava de herança autossômica recessiva ou autossômica dominante com penetrância incompleta. a) O que levou o pesquisador a concluir que não se tratava de herança ligada ao sexo? b) Por que o pesquisador teve dúvida quanto ao tipo de herança autossômica?

prováveis progenes, assim como a probabilidade de filhos afetados para o casamento entre os últimos primos, a filha afetada do irmão mais velho e o filho afetado da irmã mais nova. Para o heredograma, utilize a simbologia: quadrados e círculos brancos para, respectivamente, homens e mulheres normais, quadrados e círculos hachurados para homens e mulheres afetados.

38. (Uerj 2005) Os conhecimentos atuais de biologia celular, biologia molecular e engenharia genética podem, muitas vezes, estabelecer com segurança o parentesco entre pessoas, mesmo quando elas pertencem a gerações afastadas entre si.

9

salabioquimica.blogspot.com
Maria.

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
39. (Fuvest 96) Numa população de 100 pessoas, 36 são afetadas por uma doença genética condicionada por um par de alelos de herança autossômica recessiva. a) Expresse, em frações decimais, a freqüência dos genes dominantes e recessivos. b) Quantos indivíduos são homozigotos? c) Suponha que nessa população os cruzamentos ocorram ao acaso, deles resultando, em média, igual número de descendentes. Considere, também, que a característica em questão não altera o valor adaptativo dos indivíduos. Nessas condições, qual será a porcentagem esperada de indivíduos de fenótipo dominante na próxima geração? Justifique suas respostas mostrando como chegou aos resultados

O heredograma a seguir mostra os descendentes do casal João e

Atualmente, de toda essa família, apenas Maria e todos os seus bisnetos estão vivos, e se apresentaram para a identificação de herdeiros do casal citado. Por não haver documentos legais comprobatórios da relação de parentesco, nem ser possível a coleta de material genético dos membros falecidos da família, foi utilizada, dentre outras, a técnica de identificação por meio do estudo do DNA extranuclear.

numéricos.

40. (Fuvest 2001) Um determinado gene de herança autossômica recessiva causa a morte das pessoas homozigóticas aa ainda na infância. As pessoas heterozigóticas Aa são resistentes a uma doença infecciosa causada por um protozoário, a qual é letal para as pessoas homozigóticas AA.

Indique o número de: a) bisnetos do sexo masculino e do sexo feminino que poderiam ser identificados com aproximadamente 100% de certeza, por técnicas que determinam a homologia entre amostras de DNA extranuclear, e justifique sua resposta; b) netos e bisnetos de João e Maria que possuíram ou possuem o cromossomo Y idêntico ao de João e justifique sua resposta.

Considere regiões geográficas em que a doença infecciosa é endêmica e regiões livres dessa infecção. Espera-se encontrar diferença na freqüência de nascimento de crianças aa entre essas regiões? Por quê?

41. (Uerj 2004) Segundo o Teorema de Hardy Weinberg, uma população ideal deve atingir o equilíbrio, ou estado estático, sem grandes alterações de seu reservatório genético. Em uma das ilhas do arquipélago de Galápagos, uma das condições estabelecidas por Hardy e Weinberg para populações ideais foi seriamente afetada por uma erupção vulcânica ocorrida há cerca de cem mil anos. Esta erupção teria diminuído drasticamente a população de jabutis gigantes da ilha. a) Cite duas das condições propostas por Hardy e Weinberg para que o equilíbrio possa ser atingido. b) Defina o conceito de evolução em função da freqüência dos genes de uma população e indique de que forma a diminuição da população afetou a evolução dos jabutis gigantes.

10

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
46. (Ufrj 2002) O grupo sangüíneo MN é determinado por dois alelos co-dominantes. A freqüência dos genótipos desse grupo sangüíneo foi amostrada em duas populações humanas e os resultados são apresentados na tabela a seguir.

42. (Ufrj 96) A SOCIOBIOLOGIA procura explicar o comportamento dos indivíduos em função de sua herança genética. Um dos instrumentos mais utilizados nesses estudos é a pesquisa sobre o comportamento de gêmeos univitelinos que foram criados em ambientes diferentes. Qual o princípio científico dessa abordagem experimental?

43. (Ufrj 97) Pela equação Hardy-Weinberg, p£+ 2pq + q£= 1, onde p e q são as freqüências de dois alelos. Com essa equação podemos calcular a freqüência de um genótipo sabendo a freqüência de um dos alelos, ou vice-versa, desde que a população esteja em equilíbrio. Numa determinada população em equilíbrio de Hardy-Weinberg nasceram 10.000 crianças; uma dessas crianças apresentou uma doença, a fenilcetonúria, determinada por um gene autossômico recessivo. Calcule a freqüência de indivíduos de fenótipo normal portadores do gene causador da fenilcetonúria nessa população. Calcule a freqüência do alelo M nas duas populações e determine se a população da Europa como um todo é uma população panmítica, isto 44. (Ufrj 99) Uma população vegetal que NÃO está em equilíbrio de Hardy-Weinberg, é composta por 500 indivíduos. Desses, 420 são de flores vermelhas (fenótipo dominante) e 80 são de flores brancas (fenótipo recessivo). Dos 420 indivíduos de flores vermelhas, 380 são homozigóticos (VV) e 40 são heterozigóticos (Vv). Determine a freqüência dos genes V e a freqüência dos genes v nessa população. 47. (Ufrj 2008) O gráfico a seguir mostra as freqüências dos genótipos de um locos que pode ser ocupado por dois alelos A e a. No gráfico, p representa a freqüência do alelo A. é, uma população em que os casamentos ocorrem ao acaso. Justifique sua resposta.

45. (Ufrj 2000) A freqüência gênica de dois alelos em uma população, numa dada geração, foi de A= 80% e a=20%. Na geração seguinte foi observada uma freqüência de A=60% e a=40%.

Alguns mecanismos evolutivos que alteram a freqüência dos genes são:

1) Seleção natural; 2) Taxa de mutação gênica; 3) Deriva ao acaso da freqüência gênica, principalmente em populações pequenas. Calcule a freqüência dos genótipos AA, Aa, aa nos pontos determinados pela linha pontilhada. Justifique sua resposta. Qual das três possibilidades apresentadas NÃO pode ser aceita para explicar a variação na freqüência dos genes citados? Justifique sua resposta.

11

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
52. (Unicamp 94) A freqüência do gene i, que determina o grupo sangüíneo O, é de 0,40 (40%) em uma população em equilíbrio. Em uma amostra de 1000 pessoas desta população, quantas se espera encontrar com sangue do tipo O? Explique as etapas que você seguiu para chegar à resposta. Indique o genótipo das pessoas do grupo sangüíneo O.

48. (Ufrrj 2000) Numa determinada ilha existia uma população animal com indivíduos possuidores de uma característica normal e indivíduos possuidores de uma característica recessiva, numa proporção de 10:1, respectivamente. Mas um desastre ambiental provocou a morte de todos os indivíduos com a característica recessiva, alterando de forma brusca a freqüência do gene recessivo na população da ilha.

53. (Unirio 2002) Uma característica fenotípica de uma população, a) Após o desastre pode-se afirmar que a freqüência do gene recessivo será zero? Justifique sua resposta. como a cor amarela, é determinada por um gene dominante. Esse gene tem um alelo que não produz essa característica. Um estudo dessa população determinou que a freqüência do fenótipo amarelo b) Qual o nome dado a essa alteração brusca na freqüência gênica? era de 50% e NÃO SE SABE se essa população está em equilíbrio de Hardy-Weinberg. 49. (Ufv 96) Uma das maneiras de verificar se uma determinada espécie está ou não em evolução é fazer um estudo do patrimônio genético de suas populações. Usando o teorema de Hardy-Weinberg pode-se determinar as freqüências gênicas de uma população e demonstrar se a espécie está em equilíbrio, isto é, em estado de nãoevolução. Entretanto, para que uma população se mantenha em equilíbrio genético é necessário que ela se enquadre em certas condições. Escreva quatro destas condições: 54. (Ufes 97) A cor da pelagem em coelhos é determinada por uma série de alelos múltiplos composta pelos genes C, c¢, c£ e c¤, responsáveis pelos fenótipos aguti, chinchila, himalaio e albino, respectivamente. A ordem de dominância existente entre os genes é C > c¢ > c£ > c¤. Responda: a) Quais as proporções fenotípicas e genotípicas esperadas na 50. (Unb 2000) Em uma população, um determinado gene apresentase em duas formas, a dominante e a recessiva, sendo 36% dos indivíduos recessivos. Considerando que tal população se encontre em equilíbrio genético, podendo-se, portanto, aplicar o Princípio de Hardy-Weimberg, calcule, EM PORCENTAGEM, a freqüência do referido gene na população. Despreze a parte fracionária de seu resultado, caso exista. progênie do cruzamento entre um coelho aguti (Cc¢) e um coelho chinchila (c£c¤)? b) Como você explicaria o aparecimento de coelhos albinos a partir de um cruzamento entre coelhos himalaios? Com base nessas informações, não é possível saber a freqüência do gene para cor amarela. Explique.

51. (Unesp 2004) Considere duas populações diferentes, 1 e 2, cada uma com 200 indivíduos diplóides, portanto, com 400 alelos. A população 1 apresenta 90 indivíduos com genótipo AA, 40 indivíduos com genótipo Aa e 70 indivíduos com genótipo aa. A população 2 apresenta 45 indivíduos com genótipo AA, 130 indivíduos com genótipo Aa e 25 indivíduos com genótipo aa. a) Qual a freqüência dos alelos A e a em cada uma das populações? b) Qual delas tem a maioria dos indivíduos homozigotos? Explique.

12

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
57. (Unesp 99) Em abelhas, a cor do olho é condicionada por uma série de alelos múltiplos, constituída por cinco alelos, com a seguinte relação de dominância:

55. (Ufjf 2006) As videiras podem produzir uvas de coloração vermelha, vinho, rosa e amarela. O cruzamento entre plantas com esses fenótipos produziu as seguintes proles na geração F1.

marrom>pérola>neve>creme>amarelo.

Uma rainha de olho marrom, porém, heterozigota para pérola, produziu 600 ovos e foi inseminada artificialmente por espermatozóides que portavam, em proporções iguais, os cinco alelos. Somente 40% dos ovos dessa rainha foram fertilizados e toda a descendência teve a mesma oportunidade de sobrevivência. Em abelhas, existe um processo denominado partenogênese.

a) O que é partenogênese? Em abelhas, que descendência resulta Com base nos resultados apresentados, responda ao que se pede: a) Quantos alelos estão envolvidos na determinação do caráter cor de fruto e qual a relação de dominância entre eles? b) Qual a proporção genotípica e fenotípica do cruzamento entre plantas de fruto vinho do cruzamento parental (2) com plantas de fruto vinho do cruzamento parental (4)? c) Quantas plantas com frutos amarelos serão geradas, a partir de 200 sementes oriundas do cruzamento entre plantas de frutos vinho do cruzamento parental (4) com plantas de frutos rosa do cruzamento parental (2)? 58. (Unicamp 93) As abelhas vivem em colônias constituídas por indivíduos de três castas: a rainha, os zangões e as operárias. Sabendo-se que as fêmeas férteis de 'Apis mellifera' têm 32 cromossomos, indique o número cromossômico dos indivíduos de cada uma das castas e descreva como ocorre a diferenciação em castas nesses insetos. 56. (Ufrj 2000) Uma determinada característica depende de um locus que possui 4 alelos (A1, A2, A3, A4). Outra característica também depende de 4 genes (B1, B2 e C1, C2), porém são dois pares de alelos localizados em pares de cromossomos homólogos diferentes. TEXTO PARA A PRÓXIMA QUESTÃO (Pucmg 2003) O ciclo celular é interrompido entre as fases G•/S e G‚/mitose, e proteínas especiais controlam a evolução do ciclo celular das novas células. Entre S/G‚ algumas proteínas checam Um desses dois tipos de determinismo genético apresenta um número maior de genótipos possíveis na população. Identifique esses genótipos. possíveis falhas e erros na linha de produção, decidem se o ciclo celular avança ou é paralisado iniciando um processo de destruição do material genético, conhecido como APOPTOSE, ou morte celular espontânea. Portanto, a inativação de qualquer um dos componentes ou operadores do sistema de checagem ou de apoptose poderia provocar a proliferação contínua das células e possível desenvolvimento de tumores cancerosos. Um exemplo observável das conseqüências de apoptoses é o descamar da pele após sua exposição prolongada a radiação solar intensa. deste processo? b) Na inseminação realizada, qual o número esperado de machos e de fêmeas na descendência? Dos machos esperados, quantos terão o olho de cor marrom?

13

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
60. (Uerj 2002) Em uma experiência de fecundação "in vitro", 4 óvulos humanos, quando incubados com 4 suspensões de espermatozóides, todos igualmente viáveis, geraram 4 embriões, de acordo com a tabela abaixo.

59. Abaixo está transcrito um pequeno trecho de uma recente entrevista, concedida à Revista Galileu pelo cientista Sérgio Danilo Pena, da Universidade Federal de Minas Gerais, que liderou uma pesquisa genética sobre a composição étnica do povo brasileiro.

GALILEU: "É correta a noção de que a maior parte dos brasileiros tem algum antepassado com pai branco europeu e mãe negra ou índia ?" PENA: "É. Meu caso é exatamente esse. Meu cromossomo Y é europeu e meu DNA mitocondrial é ameríndio."

A resposta do geneticista aliada aos seus conhecimentos permite afirmar, EXCETO: a) O DNA do cromossomo Y e das mitocôndrias apresenta genes que determinam a cor da pele humana. b) O DNA mitocondrial é de origem materna. c) O cromossomo Y apresenta genes exclusivamente paternos. d) Pelo estudo acima, somente o genoma de indivíduos do sexo masculino pode ser utilizado para a determinação da ancestralidade paterna. Considerando a experiência descrita, o gráfico que indica as probabilidades de os 4 embriões serem do sexo masculino é o de número: a) 1 b) 2 c) 3 d) 4

14

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
63. (Fuvest 91) O gráfico a seguir mostra a dinâmica das freqüências do gene s, o qual determina a doença chamada siclemia ou anemia falciforme. Os homozigotos siclêmicos morrem precocemente devido à severa anemia; os heterozigotos sofrem de uma forma branda da anemia mas, por outro lado, são mais resistentes à malária que os indivíduos normais. O gráfico refere-se ao período posterior à erradicação da malária. Qual a explicação para o comportamento das curvas do gráfico?

61. (Ufscar 2004) Os machos de abelha originam-se de óvulos não fecundados e são haplóides. As fêmeas resultam da fusão entre óvulos e espermatozóides, e são diplóides. Em uma linhagem desses insetos, a cor clara dos olhos é condicionada pelo alelo recessivo a de um determinado gene, enquanto a cor escura é condicionada pelo alelo dominante A. Uma abelha rainha de olhos escuros, heterozigótica Aa, foi inseminada artificialmente com espermatozóides de machos de olhos escuros. Espera-se que a prole dessa rainha tenha a seguinte composição:

a) Diminuição da freqüência de mutação de S para s. b) Seleção contra os portadores do gene s. 62. (Unirio 2000) A reprodução da maioria dos seres vivos envolve um processo sexual onde se alternam os fenômenos de meiose e fecundação. No homem, a meiose é gamética, e a fecundação reconstitui a diploidia. Qual dos pares de gametas representados a seguir poderá originar um zigoto que desenvolverá um embrião normal do sexo masculino? c) Aumento da freqüência de mutação de S para s. d) Cruzamentos preferenciais entre pessoas anêmicas. e) Cruzamentos preferenciais entre portadores de malária.

15

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
65. (Uel 2007) Em uma população de organismos diplóides, foram encontrados quatro alelos diferentes para um determinado locus gênico, denominados S¢, S£, S¤ e S¥. A figura a seguir mostra, à

64. (Fuvest-gv 92) A cor dos pêlos nas cobaias é condicionada por uma série de alelos múltiplos com a seguinte escala de dominância:

C (preta) > C (marrom) > C‚ (creme) > c (albino).

esquerda, as diferenças na seqüência de DNA que caracterizam cada um desses alelos e, à direita, o par de cromossomos homólogos

Uma fêmea marrom teve 3 ninhadas, cada uma com um macho diferente. A tabela a seguir mostra a constituição de cada ninhada.

(metafásicos) onde esse gene é encontrado. Diante dessas informações, se um único indivíduo desta população for escolhido ao acaso, qual combinação alelo/posição cromossômica poderia ser encontrada no par de cromossomos metafásicos deste indivíduo?

A partir desses dados é possível afirmar que o macho responsável pela ninhada: a) 1 era marrom homozigoto. b) 1 era preto homozigoto. c) 2 era albino heterozigoto. d) 2 era creme heterozigoto. e) 3 era marrom homozigoto.

GABARITO

1. O gene A‚, pois é um letal recessivo, ficando protegido da seleção natural quando em heterozigose, enquanto o gene B‚ e um letal dominante, sendo eliminado mesmo em dose simples.

2. a) 6 crianças b) Nenhum dos filhos será afetado (XaY) e todas as filhas (XAXa) serão afetadas.

3. a) O heredograma 1 apresenta o padrão típico da herança autossômica recessiva. Justifica-se pelo fato de indivíduos afetados (II.2 e IV.6) serem filhos de pais normais para o caráter em questão e o número de afetados de ambos os sexos ser aproximadamente o mesmo ao logo das gerações.

16

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
b) Masculino, porque os dois cromossomos restantes, os sexuais, são de tamanhos diferentes (X Y).

O heredograma 2 apresenta o padrão observado na herança recessiva ligada ao sexo. Justifica-se pelo fato de se observarem apenas homens afetados que seriam filhos de mulheres portadoras do gene recessivo ligado ao cromossomo X.

8. a) Glóbulo branco (neutrófilo) envolvido na defesa orgânica. b) Corpúsculo de Barr, ou cromatina sexual, observada em células

b) Seria recomendável a escolha de um filho do sexo feminino no caso apresentado na genealogia 2 pois, neste caso, seria muito menor a probabilidade da ocorrência do caráter em mulheres. Os indivíduos do sexo feminino seriam afetados somente se herdarem dois genes recessivos ligados ao X.

somáticas de mulheres. c) Normal: Mulher 2A + XX Anormal: Homem 2A + XXY (Síndrome de Klinefelter) d) Síndrome de Turner (Mulher 2A + X0)

9. P: (macho) ZßZß x ZöW (fêmea) c) Pais: Aa x aa | P(menina afetada) = 1/2 . 1/2 = 1/4 ou 25% F• x F•: (macho) ZßZö x ZßW (fêmea) 4. N¡. total de alelos na população = 12258 (cada pessoa tem dois alelos) F‚: 25% ZßZß, 25% ZßZö (machos) e 25% ZßW e 25% ZöW (fêmeas) N¡. de alelos M = 6613 N¡. de alelos N = 5645 10. a) Para o fazendeiro interessa possuir um rebanho só de vacas, pois ele está interessado no leite. freqüência do alelo M = 6613/12258 = 0,54 freqüência do alelo N = 5645/12258 = 0,46 b) A presença do cromossomo Y define o sexo, pois só machos têm esse cromossomo; já o cromossomo X existe nos machos e nas fêmeas. A população está em equilíbrio porque as freqüências se aproximam da distribuição binomial (p + q)£ = 1, sendo p a freqüência do alelo M e q a freqüência do alelo N. 11. O cromossomo Y. Há apenas uma troca de ADN entre o cromossomo Y (que é único no cariótipo do homem) e o cromossomo X, num pequeno trecho homólogo existente entre esses 5. a) A mãe, porque é portadora do gene em questão (XDXd). b) Na segunda divisão, pois o descendente herdou o cromossomo Xd duplicado de sua mãe. 12. a) A mulher que é heterozigota para esse gene, em função da inativação ao acaso de um dos cromossomos X, apresentará regiões 6. a) O homem pode produzir dois tipos de espermatozóides: com o cromossomo sexual X e com o cromossomo Y. b) O gene da hemofilia é ligado ao cromossomo X, que um homem herda de sua mãe. O filho homem herda de seu pai o cromossomo sexual Y. b) Os homens só têm um cromossomo X, que é sempre funcional e portador de apenas um dos dois genes. Se o cromossomo X do homem tiver o gene em questão, toda sua pele estará comprometida, 7. a) Nos óvulos e espermatozóides existem apenas 11 cromossomos, já as musculares terão 22 cromossomos. caso contrário toda sua pele será normal. da pele em que o gene normal será ativo e outras regiões em que o gene anormal será o gene ativo. cromossomos. F•: 50% ZßZß : 50% ZßW.

17

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
20. Das quinze gestações bem sucedidas dessa mulher, espera-se que cinco sejam do sexo masculino porque é de 50% a chance dos filhos homens herdarem o gene letal de sua mãe e não sobreviverem, como mostra o esquema a seguir.

13. As células sangüíneas são derivadas da medula óssea e, portanto, vieram de um doador do sexo feminino (XX). As células somáticas, que não são derivadas da medula, possuem o cariótipo masculino (XY), portanto o receptor é do sexo masculino.

14. A lei não alterará a proporção de homens na população. Para qualquer gestação haverá sempre 50% de probabilidade de nascer uma criança do sexo masculino e 50% do sexo feminino. Contudo, tal lei contribuirá para a redução da expansão demográfica, pois depois de duas gestações 3/4 das mulheres terão 2 ou menos filhos.

15. a) Fêmea excepcional.

b) I.S. = X/A, ou seja, relação entre o n¡. de cromossomos X e o n¡. de lotes autossômicos presentes no cariótipo do animal. 21. a) 1/4

c) I.S. = X/A = 2/2 = 1. Trata-se de uma fêmea.

16. a) Cromossomo X condensado em células somáticas de fêmeas de mamíferos. b) Identificação citológica do sexo. O homem só apresenta um cromossomo X que está permanentemente descondensado e geneticamente ativo.

b) 1/2

c) O fenótipo da avó materna era normal uma vez que sua filha (I 2), que recebeu o gene para hemofilia de seu pai, é normal.

22. a) O consultante não transmitirá a doença a seus filhos e filhas. 17. a) Esta mulher tem 3 cromossomos X, com cariótipo 47, XXX. b) 1/4 ou 25%. b) Filhas - 100% Filhos - 0% 18. a) Os testículos produzem testosterona, hormônio sexual masculino que, entre outros efeitos, aumenta a massa muscular. 23. a) As evidências de que a mãe é heterozigota podem ser comprovadas com base nos seguintes argumentos: Se a mãe fosse b) Teste da cromatina sexual (Corpúsculo de Barr). Mulheres apresentam em algumas células de todos os seus tecidos um cromossomo X que permanece condensado durante o período interfásico e podem ser visualizados no núcleo como um corpúsculo intensamente corado. b) Alelos: D - diabetes fosfato, d - normalidade homozigota todos os filhos e filhas seriam doentes, uma vez que o caráter é dominante. A mãe sendo heterozigota haverá uma proporção de 50% de filhos e filhas sadios (e vice-versa).

19. a) Zero, pois sendo o pai normal (XHY) não poderá ter filhas hemofílicas (XhXh). b) 50%, pois mulher portadora (XHXh) casada com homem normal (XHY) podem produzir metade dos filhos homens hemofílicos.

O indivíduo II-2 é uma mulher heterozigótica (XDXd), III-4 é um homem não afetado homozigoto para o alelo normal (XdY) e III-5 é um homem homozigoto para o alelo do diabetes fosfato (XDY).

18

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
28. a) Família I - herança dominante ligada ao X. Ocorre em todas as gerações. Os homens afetados transmitem a doença para todas as filhas. Família II - herança dominante autossômica. Ocorre em todas as gerações. Atinge indivíduos de ambos os sexos ou filhos afetados têm um genitor afetado.

24. a) Dificuldade em coagular o sangue em hemorragias e fragilidade capilar causando hematomas que não desaparecem naturalmente. A causa é a falta de um ou mais fatores envolvidos no processo de coagulação. b) 1 - 1/8 ou 12,5%, 2 - 1/4 ou 25%

25. Os genes para preto e para amarelo estão no cromossomo X. Como os gatos do sexo masculino têm apenas um cromossomo X, só poderão ter um dos genes ligados ao sexo, preto ou amarelo, além do gene autossômico. As fêmeas, que possuem dois cromossomos X, podem ter os dois alelos para cor, além do gene autossômico para a cor branca. 29. a) Serão também daltônicos os filhos homens de mulheres daltônicas, ou seja, os indivíduos II - 2, II - 3 e III - 4. 26. Não há possibilidade de nascer uma criança não hemofílica, pois ambos os pais são hemofílicos e a terapia genética altera somente células somáticas e os gametas são produzidos por células da linhagem germinativa. c) III - 1 sim, pois trata-se de mulher normal e portadora do gene para 27. a) 1. XhY aa 2. XHY aa 3. XhY A_ 4. XhXh A_ 5. XHX_ aa 30. a) Para ser daltônica a mulher deverá ter genótipo XhXh. Ora, se a freqüência de um gene (h) ligado ao cromossomo X é 10%, a freqüência dos dois genes no mesmo indivíduo é (10%)£. b) Observe o heredograma adiante: b) 10 x daltonismo. III - 4 não, trata-se de homem daltônico que transmitirá às suas filhas o alelo para daltonismo. b) Sim. II - 5 poderá ter irmão ou irmã normais se seus pais possuírem o alelo que determina a visão normal para as cores. b) Como a doença só se manifesta a partir dos 40 anos, o indivíduo pode reproduzir-se antes de a doença aparecer, transmitindo a característica aos descendentes.

31. a) A genealogia sugere um caso de herança recessiva ligada ao sexo. Justifica-se pelo fato de apresentar somente homens afetados que são filhos de mulheres portadoras do gene recessivo ligado ao cromossomo X. As filhas de homens afetados são portadoras e podem ter filhos afetados.

b) Dado que se trata de herança recessiva ligada ao sexo, os genótipos são: indivíduo II - 4 ë XAXa indivíduo II - 5 ë XAY c) A ocorrência de uma filha hemofílica e albina (XhXh aa) na descendência do casal, é possível como mostra o heredograma anterior.

32. a) Aneuploidia é uma aberração cromossômica numérica em que o portador apresenta determinados cromossomos a mais ou a menos. O gato de José apresenta uma trissomia (XXY) dos cromossomos sexuais.

19

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO

b) O macho normal (XY) não pode apresentar as duas cores, pois só possui um cromossomo sexual X. Deste modo, ou são pretos (XPY) ou amarelos (XAY). O veterinário explicou que o gato de José é preto e amarelo por ser portador do genótipo XPXAY. 36. a) Herança recessiva ligada ao sexo, o pai da mulher afetada no grupo II também seria afetado. Na Herança dominante ligado ao sexo, a filha da geração F1 do grupo I do homem afetado, também seria afetada. b) Pais normais com filho afetado poderia determinar a recessividade 33. a) A probabilidade de João ter herdado do pai o gene para daltonismo é zero, porque ele recebe do pai o cromossomo Y. Para Maria é 100%, porque ela recebe o cromossomo Xd do pai que é daltônico (XdY). b) O homem, sendo homozigoto, é daltônico quando apresenta o genótipo XdY. Sendo homozigota, a mulher daltônica possui genótipo XdXd. Para ter a anomalia, a mulher precisa de dois genes e o homem apenas um. 37. Observe o heredograma adiante: autossômica, porém a penetrância incompleta poderá fazer com que o heterozigoto desenvolva ou não a anomalia.

34. Não, porque o gene para a hemofilia, recessivo e ligado ao cromossomo X, estava presente justamente na mulher portadora. O Pai não poderia ser o responsável, pois transmite ao filho homem o cromossomo Y.

35. a) 100 % de machos com mancha na cauda e nenhuma fêmea com esta característica. A probabilidade de descendentes afetados do casamento entre os últimos primos (XAXa - XAY) será: b) A = gene que determina mancha a = gene que determina ausência de mancha 38. a) 2 do sexo masculino e 2 do sexo feminino. O cruzamento gerador dos F• seria: Nas condições propostas, homologias entre amostras de DNA só seriam possíveis se fossem comparadas amostras de origem XÞY × XòXò mitocondrial. Como as mitocôndrias dos embriões formados originam-se, na grande maioria dos casos, diretamente dos óvulos, só poderíamos obter aproximadamente 100% de homologia comparando o DNA mitocondrial de Maria com os de seus bisnetos e bisnetas cujas mães e avós sejam descendentes diretos de Maria. Filhas: 100% afetadas (XAXA, XAXa) Filhos: 50% afetados (XAY) e 50% normais (XaY).

b) 2 netos e 1 bisneto. O cromossomo Y é único e característico do sexo masculino. Esse cromossomo existe em cerca de 50% dos espermatozóides mas não em óvulos. Cromossomos Y homólogos ao de João serão encontrados, portanto, nos netos do sexo masculino descendentes dos

20

salabioquimica.blogspot.com
filhos destes netos.

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
Logo q£ = 0,0001; q = Ë(0,0001) = 0,01

filhos homens de João, e nos bisnetos de sexo masculino que sejam

39. a) freqüência do gene a = 0,60 freqüência do gene A = 0,40

Como p + q = 1, a freqüência do gene dominante é: 1 - 0,01 = 0,99

b) f(aa) + f(AA) = 0,36 + (0,40)£ = 0,42 42 pessoas com genótipo homozigoto

Como a freqüência do heterozigoto em uma população em equilíbrio é 2pq, a resposta é:

c) f(AA) + f(Aa) = 0,16 + 2.0,40.0,60 = 0,64 64 pessoas com fenótipo dominante

2 × 0,99 × 0,01 = 0,019 ou 1,9%

44. Nessa população temos 500 indivíduos e, conseqüentemente, 40. A freqüência de nascimentos de crianças aa será maior nas regiões em que a doença é endêmica. Nessas regiões haverá uma maior taxa de indivíduos heterozigotos, selecionados favoravelmente em relação aos indivíduos AA, pela presença do protozoário patogênico. Cruzamentos subseqüentes entre heterozigotos produzirão maior taxa de indivíduos aa. 45. A taxa de mutação gênica, pois os valores médios de mutação são 41. a) Duas dentre as condições: - não-ocorrência de migrações - não-ocorrência de mutações que introduzam novos genes - probabilidades iguais na escolha dos parceiros no processo de reprodução sexuada - número de indivíduos grande o suficiente para que eventos aleatórios não afetem as proporções estatísticas - não-sujeição dos genes alelos à seleção natural, tendo todos os indivíduos a mesma possibilidade de sobrevivência 47. O gráfico mostra que a freqüência do gene A é p = 0,60. Como p b) Alteração progressiva das freqüências gênicas em uma população. A população de jabutis ficou mais sujeita a variações gênicas aleatórias (deriva genética). + q = 1, temos que a freqüência do gene a é q = 0,40. Portanto, de acordo com o teorema de Hardy-Weinberg, a freqüência de AA é p£ = 0,36, a freqüência de Aa é 2pq = 0,48 e a freqüência de aa é q£ = 0,16 42. Gêmeos univitelinos são genéticamente idênticos e devem apresentar as mesmas características. Criados em ambientes distintos pode-se avaliar, com maior clareza, a influência do meio na expressão das características hereditárias. b) Oscilação genética. 43. Freqüência de homozigotos recessivos: 49. Condições para que haja equilíbrio genético: aa = 1/10000 = 0,0001 - cruzamentos ao acaso 48. a) Não. Entre os indivíduos com a característica normal poderão existir heterozigotos que são portadores do gene recessivo. 46. Europeus do Norte: M = 0,16 + (0,48/2) = 0,40. Europeus do Sul: M = 0,36 + (0,48/2) = 0,60. A população da Europa como um todo não está em equilíbrio de Hardy-Weinberg. Se os casamentos fossem ao acaso, a freqüência dos genes seriam iguais em todas as populações. 1/10§ e valores muito altos são de 1/10¤. Esses valores são incompatíveis com a variação observada de 20%. 1.000 genes (2 genes para cada indivíduo). A quantidade de genes v é 80×2=160 nos indivíduos vv e 40×1=40 nos indivíduos Vv. O total de genes v é, portanto, de 160+40=200. Como, no total, há 1.000 genes, a freqüência de v é de 20%. A freqüência de genes V é, então, de 80%.

21

salabioquimica.blogspot.com
- ausência de mutações. - ausência de seleção natural. - ausência de migrações.

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
Proporção fenotípica: 3 vinho : 1 rosa

- freqüências gênica e genotípica constantes.

Cruzamento 2 A£A¥ × A£A¤ ë Proporção genotípica: 1A£A£ : 1A£A¤ : 1A£A¥ : 1A¤A¥

50. f (A) = 40% f (a) = 60%

Proporção fenotípica: 3 vinho : 1 rosa

c) Cruzamentos 51. a) Nas duas populações a freqüência dos gametas são iguais, ou seja 55% para A e 45% para a. A£A¤ × A¤A¤ ë Proporção genotípica: 1A£A¤ : 1A¤A¤ Proporção fenotípica: 3 vinho : 1 rosa

b) A população 1 apresenta 160 homozigotos e a população 2 apresenta 70 homozigotos.

A£A¤ × A¤A¥ ë Proporção genotípica: 1A£A¤ : 1A£A¥ : 1A¤A¤ : 1A¤A¥ Proporção fenotípica: 1 vinho : 1 rosa

52. freqüência do gene i = 0,40 freqüência do genótipo ii = (0,40)£ = 0,16 = 16% Portanto, espera-se encontrar 160 pessoas em uma amostra de 1000 que serão do tipo O (genótipo ii). 56. Os genótipos são: 53. O fenótipo cor amarela engloba os genótipo AA e Aa. Se a população estiver em equilíbrio podemos assumir que AA = p£, mas se a população não estiver em equilíbrio não se pode assumir essa igualdade, e como não conhecemos a proporção de indivíduos Aa, não se pode saber a freqüência do gene A. A3A3; A3A4 54. a) Proporção fenotípica: 50% aguti : 50% chinchila A4A4 A2A2; A2A3; A2A4 A1A1; A1A2; A1A3; A1A4 Considerando os cruzamentos possíveis, não são produzidas plantas com frutos amarelos.

Proporção genotípica: 25% Cc£ : 25% Cc¤ : 25% c£c¢ : 25% c¤c¢

57. a) Partenogênese é o mecanismo de reprodução assexuada onde o óvulo evolui, sem fecundação, originando um organismo adulto completo. Em abelhas a partenogênese somente origina machos, os

b) Os coelhos himalaios parentais são heterozigotos para o gene que condiciona albinismo.

zangões.

b) Dos 600 ovos produzidos pela rainha, 40%, ou seja, 240 foram 55. a) Quatro alelos, sendo A¢ responsável pela cor vermelha, A£ pela cor vinho, A¤ pela cor rosa e A¥ pela cor amarela. A relação de dominância é A¢ dominante sobre A£, que é dominante sobre A¤ que, por sua vez, é dominante sobre A¥ (A¢ > A£ > A¤ > A¥). b) Cruzamento 1 A£A¤ × A£A¤ ë Proporção genotípica: 1A£A£ : 2A£A¤ : 1A¤A¤ 58. Rainha: 2n = 36, fêmea fértil e produzida a partir de larva fêmea alimentada com geléia real. fecundados e originaram fêmeas e 60%, ou seja, 360 ovos nãofecundados produzirão zangões. Sendo a rainha portadora dos alelos para marrom e pérola, espera-se 180 machos com olhos marrons e 180 machos com olhos de cor pérola.

22

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO

Operária: 2n = 36, fêmea estéril e produzida a partir de larva fêmea alimentada com mel e pólen.

Zangão: n = 18, macho fértil e produzido por partenogênese.

59. [A]

60. [A]

61. [D]

62. [B]

Lista 2
1. (Fuvest 2003) Uma espécie de lombriga de cavalo possui apenas um par de cromossomos no zigoto (2n = 2). Um macho dessa espécie, heterozigótico quanto a dois pares de alelos (Aa Bb) formou,

63. [B]

64. [D]

65. [A]

ao final da gametogênese, quatro tipos de espermatozóides normais com diferentes genótipos quanto a esses genes.

a) Qual é o número de cromossomos e o número de moléculas de DNA no núcleo de cada espermatozóide? b) Quais são os genótipos dos espermatozóides formados? c) Por que, a partir das informações fornecidas, não é possível estimar a proporção em que cada um dos quatro tipos de espermatozóides aparece? Explique.

23

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
4. (Ufrj 2006) Um pesquisador está estudando a genética de uma espécie de moscas, considerando apenas dois locos, cada um com dois genes alelos:

2. (Ufc 2007) Mendel não acreditava na mistura de caracteres herdados. De acordo com suas conclusões, a partir dos cruzamentos realizados com ervilhas do gênero 'Pisum', as características não se misturam, permanecem separadas e são transmitidas independentemente. HENIG, Robin. "O monge no jardim". Rio de Janeiro: Rocco, 2001.

loco 1 - gene A (dominante) ou gene a (recessivo); loco 2 - gene B (dominante) ou gene b (recessivo).

Cruzando indivíduos AABB com indivíduos aabb, foram obtidos a) Considerando as leis de Mendel para a hereditariedade, no momento da fecundação os cromossomos herdados dos progenitores se juntam, porém os alelos dos seus genes não se misturam. A partir dessa idéia, qual fenômeno explicaria a ocorrência de características intermediárias na progênie, que parecem ser uma mistura daquelas dos progenitores? b) Posteriormente, estudos de grupos de geneticistas indicaram que pode haver troca de material genético entre cromossomos homólogos herdados do pai e da mãe. Em que etapa isso pode ocorrer e como se chama este processo? 100% de indivíduos AaBb que, quando cruzados entre si, podem formar indivíduos com os genótipos mostrados na Tabela 1. Sem interação entre os dois locos, as proporções fenotípicas dependem de os referidos locos estarem ou não no mesmo cromossomo. Na Tabela 2, estão representadas duas proporções fenotípicas (casos 1 e 2) que poderiam resultar do cruzamento de dois indivíduos AaBb.

3. (Ufg 2005) Quatro irmãos, filhos legítimos de um mesmo casal, apresentam marcantes diferenças em suas características físicas.

Descreva três mecanismos biológicos potencialmente responsáveis por essa variabilidade genética e explique como atuam.

Identifique qual dos dois casos tem maior probabilidade de representar dois locos no mesmo cromossomo. Justifique sua resposta.

5. (Unifesp 2007) Considere dois genes e seus respectivos alelos: A e a; B e b. Em termos de localização cromossômica, explique o que significa dizer que esses dois genes a) segregam-se independentemente na formação dos gametas. b) estão ligados.

24

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
8. (Uerj 2008) Em certa espécie de ratos, o alelo dominante B determina que a cor do pêlo seja cinza, enquanto o genótipo recessivo bb determina uma pelagem preta. Em outro cromossomo, um lócus afeta uma etapa inicial na formação de qualquer dos pigmentos do pêlo. Nesse lócus, o alelo dominante A possibilita um desenvolvimento normal da cor, mas o genótipo recessivo aa bloqueia toda a produção de pigmento. Assim, ratos aa são todos albinos, independentemente do seu genótipo no lócus B. Do cruzamento de um rato macho de pelagem cinza com uma fêmea albina, cujo genótipo é aabb, 50% da prole foi albina, 25% preta e 25% cinza. Determine o genótipo do rato macho, justificando sua resposta.

6. (Fuvest 2004) As três cores de pelagem de cães labradores (preta, marrom e dourada) são condicionadas pela interação de dois genes autossômicos, cada um deles com dois alelos: "Ee" e "Bb". Os cães homozigóticos recessivos "ee" não depositam pigmentos nos pêlos e apresentam, por isso, pelagem dourada. Já os cães com genótipos "EE" ou "Ee" apresentam pigmento nos pêlos, que pode ser preto ou marrom, dependendo do outro gene: os cães homozigóticos recessivos "bb" apresentam pelagem marrom, enquanto os com genótipos "BB" ou "Bb" apresentam pelagem preta. Um labrador macho, com pelagem dourada, foi cruzado com uma fêmea preta e com uma fêmea marrom. Em ambos os cruzamentos, foram produzidos descendentes dourados, pretos e marrons. a) Qual é o genótipo do macho dourado, quanto aos dois genes mencionados? b) Que tipos de gameta e em que proporção esse macho forma? c) Qual é o genótipo da fêmea preta? d) Qual é o genótipo da fêmea marrom?

9. (Ufes 97) Analisando a via metabólica hipotética, temos que:

7. (Uerj 2001) As reações enzimáticas a seguir indicam a passagem metabólica que sintetiza pigmentos em uma planta.

O gene A é epistático sobre o gene B e, quando em homozigose recessiva (aa), impede a produção dos pigmentos rosa e vermelho, devido à não produção de enzima X. O gene B, em homozigose recessiva, impossibilita a conversão de pigmento rosa em vermelho. Os genes A e B são dominantes sobre os seus alelos. Responda: Considere as seguintes condições: a) No cruzamento entre indivíduos de genótipos AaBb×aabb, qual será a proporção fenotípica esperada na progênie? - para as enzimas A e B, os alelos A e B produzem enzimas funcionais, enquanto os alelos a e b produzem enzimas inativas; - uma única cópia funcional da enzima A ou da enzima B é suficiente para catalisar normalmente a sua respectiva reação. b) Quais são os possíveis genótipos para os indivíduos vermelhos? c) Quais os fenótipos esperados e suas respectivas proporções em F‚ obtidos a partir de parentais AABB × aabb?

Determine a proporção esperada entre as cores das plantas descendentes na primeira geração do cruzamento AaBb×AABb.

25

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
11. (Ufscar 2002) Na herança da cor do fruto da moranga, estão envolvidos dois pares de genes A/a e B/b. O gene B produz frutos amarelos, mas, na presença do gene A, ele é inibido e produz frutos brancos, como o seu alelo b. O indivíduo duplo recessivo produz frutos verdes. Uma planta homozigota, produtora de frutos amarelos, é cruzada com outra, produtora de frutos verdes. Uma planta, filha desse cruzamento, que será chamada de planta I, foi cruzada com

10. (Ufmg 94) Em camundongos, o tipo selvagem, encontrado comumente na natureza, apresenta pelagem de coloração acinzentada (aguti). Duas outras colorações são também observadas: preta e albina. Observe os dois pares de genes envolvidos e os fenótipos relativos aos tipos de coloração dos camundongos.

A _ B _ = Aguti

outra planta, II, produtora de frutos brancos. O cruzamento entre a planta I e a planta II produziu 4/8 de plantas com frutos brancos, 3/8

A _ bb

= Preto

de plantas com frutos amarelos e 1/8 de plantas com frutos verdes. Responda:

aaB _ e aabb = Albinos a) Que denominação se dá a este tipo de interação entre os genes A e Utilizando essas informações e seus conhecimentos, faça o que se pede. b) Quais os genótipos das plantas I e II? a) Do cruzamento entre camundongos preto e albino obtiveram-se 100% de camundongos aguti. DÊ os genótipos dos camundongos envolvidos no cruzamento. b) Do cruzamento de dois camundongos aguti obtiveram-se descendentes na seguinte proporção: 9 aguti: 3 pretos: 4 albinos. CITE todos os genótipos possíveis para os camundongos albinos obtidos e APRESENTE UMA EXPLICAÇÃO para a alteração da proporção 9:3:3:1 (esperada em cruzamento de diíbridos) para 9:3:4. c) CITE a probabilidade de se obterem camundongos pretos do cruzamento de albinos (duplo homozigotos) com aguti (duplo heterozigotos). 13. (Unicamp 98) Existe um gene em cobaias que suprime o efeito do gene que determina a coloração nesses animais. Esse gene está localizado em um cromossomo diferente daquele em que está o gene que determine a cor do animal. Cobaias albinas homozigotas foram cruzadas e todos os descendentes nasceram pretos. Como isto pode ser explicado, considerando-se que não ocorreu mutação? Justifique. 12. (Unesp 96) Numa dada planta, o gene B condiciona fruto branco e o gene A condiciona fruto amarelo, mas o gene B inibe a ação do gene A. O duplo recessivo condiciona fruto verde. Considerando que tais genes apresentam segregação independentemente um do outro, responda: a) Como se chama esse tipo de interação? b) Qual a proporção fenotípica correta entre os descendentes do cruzamento de plantas heterozigotas para esses dois pares de genes? B?

26

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
15. (Ufes 2002) Três grupos de alunos realizaram cruzamentos-testes entre plantas de tomate para o estudo de diferentes genes. Os grupos obtiveram os seguintes resultados:

14. (Fuvest 2002) O esquema a seguir representa, numa célula em divisão meiótica, dois pares de cromossomos com três genes em heterozigose: A/a, B/b e D/d. Nesses cromossomos, ocorreram as permutas indicadas pelas setas 1 e 2.

a) Indique o(s) grupo(s) que trabalhou (trabalharam) com genes a) Quanto aos pares de alelos mencionados, que tipos de gameta esta célula poderá formar? b) O que significa, em Genética, o termo ligação? Qual é a sua b) Que pares de alelos têm segregação independente? utilidade para a pesquisa científica? ligados, Justifique.

c) Calcule a distância, em unidades de mapa genético, entre os genes pesquisados pelos alunos do grupo G2.

27

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
18. (Fuvest 95) Um organismo, homozigoto para os genes A B C D, todos localizados em um mesmo cromossomo, é cruzado com outro, que é homozigoto recessivo para os mesmos alelos. O retrocruzamento de F1 (com o duplo recessivo) mostra os seguintes resultados:

16. (Ufv 2004) Considere que os genes autossômicos, identificados nos cromossomos (I e II), correspondam a aptidões para aprender biologia (B), matemática (M) e tocar guitarra (G). Em um dado loco, um indivíduo com genótipo recessivo não apresenta aptidão; um indivíduo heterozigoto apresenta aptidão mediana; e um indivíduo homozigoto dominante apresenta maior aptidão.

- não ocorreu permuta entre os genes A e C; - ocorreu 20% de permuta entre os genes A e B, 30% entre A e D; - ocorreu 10% de permuta entre os genes B e D.

a) Baseando-se nos resultados acima, qual é a seqüência mais provável desses 4 genes no cromossomo, a partir do gene A? b) Justifique sua resposta.

19. (Ufrj 2002) Considere a existência de dois locos em um indivíduo. Cada loco tem dois alelos "A" e "a" e "B" e "b", sendo que Com base nessas informações, faça o que se pede: a) Um casal (P1), formado por um indivíduo triplo homozigoto dominante e outro triplo homozigoto recessivo, poderá esperar descendentes (F1) com qual(is) genótipo(s)? b) Se um descendente (F1) se casar com um indivíduo sem aptidão para as três habilidades, qual a probabilidade desse casal ter uma criança com aptidão mediana para matemática? c) Qual o nome do mecanismo genético, proposto por Thomas Hunt Morgan, que permitiria ao casal do item b ter filhos com aptidão mediana para aprender biologia mas sem aptidão para tocar guitarra? d) Quais os locos cuja herança não resultará em proporções segregantes dentro dos padrões da segunda Lei de Mendel? e) Uma mãe sem aptidão para aprender biologia e tocar guitarra, mas com aptidão mediana para aprender matemática, terá 100% dos filhos(as) com aptidão no mínimo mediana para as três características, ao se casar com um indivíduo com genótipo: Esses resultados contrariam a segunda lei de Mendel ou lei da segregação independente? Justifique sua resposta. Um pesquisador cruzou um indivíduo "AaBb" com um indivíduo "aabb". A prole resultante foi: 40% AaBb 40% aabb 10% Aabb 10% aaBb O pesquisador ficou surpreso, pois esperava obter os quatro genótipos na mesma proporção, 25% para cada um deles. "A" e "B" são dominantes.

17. (Unicamp 96) Os locos gênicos A e B se localizam em um mesmo cromossomo, havendo 10 unidades de recombinação (morganídeos) entre eles. a) Como se denomina a situação mencionada? Supondo o cruzamento AB/ab com ab/ab b) Qual será a porcentagem de indivíduos AaBb na descendência? c) Qual será a porcentagem de indivíduos Aabb?

28

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO

20. (Ufrj 2007) Sabendo que a maioria das mutações é deletéria (prejudicial ao organismo), o evolucionista John Maynard-Smith escreveu sobre a meiose, durante a produção de gametas: "A meiose é o equivalente a ter dois carros, um com a transmissão quebrada, outro com o motor quebrado e, com eles, produzir um único carro que funcione". A figura a seguir ilustra um par de cromossomos homólogos duplicados (A e B), bem como as localizações dos alelos deletérios "M" (presente somente no cromossomo A) e "N" (presente somente no cromossomo B).

Um indivíduo que possui os cromossomos A e B poderá formar gametas que não sejam portadores dos alelos M e N? Justifique sua resposta.

21. (Unifesp 2005) Os locos M, N, O, P estão localizados em um mesmo cromossomo. Um indivíduo homozigótico para os alelos M, N, O, P foi cruzado com outro, homozigótico para os alelos m, n, o, p. A geração F• foi então retrocruzada com o homozigótico m, n, o, p. A descendência desse retrocruzamento apresentou 15% de permuta entre os locos M e N. 25% de permuta entre os locos M e O. 10% de permuta entre os locos N e O. Não houve descendentes com permuta entre os locos M e P.

Responda. a) Qual a seqüência mais provável desses locos no cromossomo? Faça um esquema do mapa genético desse trecho do cromossomo, indicando as distâncias entre os locos. b) Por que não houve descendentes recombinantes com permuta entre os locos M e P?

29

salabioquimica.blogspot.com
GABARITO

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO

1. a) No núcleo dos espermatozóides produzidos pelo verme seriam observados um cromossomo e, portanto, uma molécula de DNA. b) AB, Ab, aB e ab. c) Os genes estão em ligação fatorial e, não dispondo da freqüência de permutação ou da distância entre os citados genes, torna-se impossível prever a proporção de cada tipo de gameta formado pelo animal.

2. a) Realmente, os alelos não se misturam na fecundação, como afirmou Mendel. Porém, no fenômeno conhecido como DOMINÂNCIA INCOMPLETA, o fenótipo do indivíduo heterozigótico é intermediário entre os fenótipos dos dois indivíduos homozigóticos que lhe deram origem. b) A troca de material genético entre cromossomos herdados do pai e da mãe pode ocorrer na gametogênese, durante a meiose, na fase de prófase I. O processo é chamado de PERMUTAÇÃO ou "crossingover".

6. a) macho dourado será eeBb b) 50% eB; 50% eb c) fêmea preta será EeBb d) fêmea marrom será Eebb

7. A proporção deverá ser de 3 de cor púrpura para 1 de cor vermelha.

8. AaBb Para que o macho seja cinza, deve apresentar, pelo menos, um alelo

3. Principais mecanismos de geração de variabilidade genética em famílias humanas: 1) recombinação (permutação) - troca de partes entre os cromossomos homólogos durante o processo de divisão meiótica. 2) segregação independente - separação aleatória dos cromossomos homólogos durante a divisão meiótica de cada célula germinativa (materna e paterna). 3) mutação - alteração na informação genética produzida por erros de duplicação do material genético ou por ação de agentes mutagênicos.

A e um alelo B. Como foi cruzado com uma fêmea albina (aabb) e existem tanto descendentes de pelagem preta (bb), quanto albinos (aa), o macho deve possuir os alelos a e b.

9. a) 25% vermelho (AaBb) 25% rosa (Aabb) 50% brancos (aaBb e aabb)

b) Indivíduos vermelhos serão: AABB ou AaBB ou AABb ou AaBb

4. O caso 2, que ocorre quando os dois locos estão no mesmo cromossomo, com permuta gênica entre eles. A proporção fenotípica 9:3:3:1 (caso 1) só ocorre quando os dois locos estão em cromossomos diferentes.

c) 9/16 vermelhos (A_B_) 3/16 rosa (A_bb) 4/16 brancos (3/16 aaBb e 1/16 aabb)

10. a) AAbb (preto) x aaBB (albino) ë AaBb (aguti) 5. a) Os genes estão localizados em cromossomos diferentes (figura 1). b) Albinos: aaBB, aaBb e aabb. Explicação: epistasia recessiva. c) 1/4 ou 25%

b) Os genes estão em "Linkage", ou seja, estão localizados no mesmo cromossomo (figura 2).

11. a) Epistasia dominante.

30

salabioquimica.blogspot.com
AaBb.

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
c) Os genes pesquisados pelo grupo G2 distam entre si 14 unidades de recombinação (UR), pois permutam com uma freqüência de 14%.

b) As plantas I e II apresentam, respectivamente, os genótipos aaBb e

12. a) Epistasia dominante. b) 12 brancos : 3 amarelos : 1 verde 16. a) Pais: BG/BG MM x bg/bg mm F•: Bg/Bg Mm 13. Trata-se de um caso de interação gênica do tipo epistasia recessiva. Assim temos dois pares de genes com segregação independente agindo da seguinte forma: b) Pais: Bb/Gg Mm x bg/bg mm P(filho Mm) = 50%

A - determina a produção de pigmento preto a - não determina a produção de pigmento I - permite a expressão do gene A i - em homozigose inibe a expressão do gene A

c) Ligação fatorial (linkage).

d) B e G.

e) BG/BG MM O cruzamento seria indicado por: 17. a) Ligação fatorial incompleta com freqüência de permutação Pais : AAii (albino) X aaII (albino) igual a 10%. b) AB/ab = 45% F•: 100% AaIi (pretas) c) Ab/ab = 5%

14. a) Tipos de gametas:

18. a) A seqüência, partindo-se do gene A, é ACBD ou DBCA.

1 - Ab D 2 - Ab d 3 - aB D 4 - aB d

b) A freqüência de permutação indica a distância dos genes no cromossomo: quanto maior a distância entre os genes maior a freqüência de permutação. O fato de não ter ocorrido permutação entre os genes A e C indica que eles devem estar muito próximos.

b) Pares de alelos com segregação independente: Aa e Bb com Dd.

19. Sim. A segunda lei de Mendel fala da segregação independente, o que só ocorre quando se consideram locos em cromossomos

15. a) Todos os grupos trabalharam com genes ligados no mesmo cromossomo. A recombinação gênica (crossig-over) não ocorre entre genes localizados em cromossomos diferentes.

diferentes.

20. Sim. A permutação ("crossing-over") possibilita que o alelo deletério de um membro do par de homólogos seja trocado pelo alelo

b) Ligação fatorial (ou linkage) refere-se a genes situados linearmente no mesmo cromossomo. Genes próximos permutam com menor freqüência, genes mais distantes apresentam maior taxa de recombinação. Deste modo, através da análise das taxas de recombinação, é possível ter-se uma noção relativa das distâncias entre os genes ligados. De posse das distâncias relativas pode-se, então, elaborar mapas cromossômicos.

normal do outro, formando uma cromátide sem alelos deletérios. Esta cromátide dará origem a cromossomos normais nos gametas.

21. a)

31

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO

O gene P não permutou com M porque, provavelmente, localiza-se muito próximo a ele, à sua direita ou à esquerda.

b) Quanto maior a distância entre dois genes, maior será a probabilidade de ocorrer permuta entre eles. Entre genes muito próximos, a probabilidade de ocorrer permuta é menor.

32

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
4. (Fuvest 94) Uma anomalia genética autossômica recessiva é condicionada por uma alteração na seqüência do DNA. Um homem portador dessa anomalia apresenta a seqüência timina-citosina-timina enquanto sua mulher, que é normal, apresenta a seqüência timinaadenina-timina. A análise do DNA de um filho do casal mostrou que ele é portador tanto da seqüência de bases do pai quanto da mãe. a) O filho terá a doença? Por quê? b) Qual a probabilidade de um outro filho do casal apresentar as duas seqüências iguais à da mãe?

Lista 3
1. (Ufjf 2007) O esquema a seguir ilustra de forma sintética o processo de formação de gametas (meiose) de um indivíduo de genótipo AaBb. a) Complete o esquema:

5. (Fuvest 95) Um homem afetado por uma doença genética muito rara, de herança dominante, casa-se com uma mulher, não consangüínea. Imagine que o casal tenha doze descendentes, seis filhos e seis filhas. Responda, justificando sua resposta, qual será a proporção esperada de filhas e filhos afetados pela doença do pai no caso do gene em questão estar localizado. a) em um autossomo; b) no cromossomo X.

b) Qual é a probabilidade deste indivíduo formar o gameta ab? Justifique sua resposta. c) Qual é a importância da meiose para a manutenção de uma espécie? d) Considere que os genes A e B estão envolvidos na determinação da cor das flores. O alelo A permite a formação de pigmentos e é dominante sobre o alelo a, que inibe a manifestação da cor. O alelo B determina a cor vermelha e é dominante sobre o alelo b, que determina a cor rosa. Se uma planta de flores vermelhas, oriunda das sementes de uma planta de flores brancas (aabb), é autofecundada, que fenótipos são esperados na descendência e em que proporções?

6. (Udesc 96) "Hormônios são proteínas cuja função é regular os complicados mecanismos do organismo - como o aumento e redução do peso do corpo (...) Em outubro, o geneticista Jeffrey Friediman (...) isolou o primeiro hormônio capaz de controlar o peso, chamado leptina. Ele é produzido por um gene que, quando funciona mal, o organismo ganha peso (...)". (In: "Superinteressante" - ano 10, n¡. 3, mar., 1996.)

Com base no texto, RESPONDA: a) Como se denomina o local que o gene ocupa nos cromossomos? b) Considerando de forma simplificada a existência de dois alelos para o gene da leptina, um normal (L) e outro mutante (L'), quantos genótipos diferentes são possíveis em humanos diplóides? Quais são eles? c) COMENTE sobre um mecanismo que pode levar à mutação gênica.

2. (Fuvest 91) No porquinho-da-índia existe um par de genes autossômicos que determina a cor da pelagem: o alelo dominante B determina a cor preta e o recessivo b, a cor branca. Descreva um experimento que possa evidenciar se um porquinho preto é homozigoto ou heterozigoto.

3. (Fuvest 93) Nos porquinhos-da-índia, a pelagem negra é dominante sobre a pelagem branca. Um criador tem um lote de porquinhos-da-índia negros, com o mesmo genótipo. O que deve fazer para descobrir se esses animais são homozigotos ou heterozigotos? Justifique sua resposta.

33

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
9. (Ufc 2006) Leia o texto a seguir.

7. (Ueg 2007) A fenilcetonúria é uma doença hereditária determinada por alelo recessivo. A pessoa afetada não consegue metabolizar o aminoácido fenilalanina e transformá-lo em tirosina. Sobre essa doença, responda ao que se pede. a) Qual a denominação dada ao fenômeno de múltipla expressão de um único gene, que ocorre na pessoa afetada por fenilcetonúria? b) Cite o que a pessoa afetada pode fazer para impedir as manifestações fenotípicas desse gene.

8. (Uerj 2007) No início do século XX, a transmissão das informações genéticas para os descendentes era explicada por algumas hipóteses sobre as leis da hereditariedade, como a mendeliana e a por mistura. Observe os esquemas:

"A Doença de Alzheimer (D.A.) (...) é uma afecção neurodegenerativa progressiva e irreversível, que acarreta perda de memória e diversos distúrbios cognitivos. Em geral, a D.A. de acometimento tardio, de incidência ao redor de 60 anos de idade, ocorre de forma esporádica, enquanto que a D.A. de acometimento precoce, de incidência ao redor de 40 anos, mostra recorrência familiar. (...) Cerca de um terço dos casos de D.A. apresentam familiaridade e comportam-se de acordo com um padrão de herança monogênica autossômica dominante. Estes casos, em geral, são de acometimento precoce e famílias extensas têm sido periodicamente estudadas." Smith, M.A.C. (Revista Brasileira de Psiquiatria, 1999)

Considerando o texto e o histórico familiar a seguir, responda ao que se pede. Histórico familiar: "Um rapaz cujas duas irmãs mais velhas, o pai e a avó paterna manifestaram Doença de Alzheimer de acometimento precoce."

Suponha que, em um indivíduo de uma população com reprodução sexuada, apareça, por mutação, um gene raro que confira ao seu portador características vantajosas. Indique, para cada uma das hipóteses representadas, se há ou não possibilidade de aumento da freqüência do gene mutante na descendência desse indivíduo e justifique suas respostas.

I. Montar o heredograma para o histórico familiar apresentado. II. Qual a probabilidade de o rapaz em questão também ser portador do gene responsável pela forma de acometimento precoce da doença? III. Quais indivíduos do heredograma são seguramente heterozigotos para esse gene? IV. Explicar o padrão de herança mencionado no texto.

34

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
12. (Ufrj 2003) Um pesquisador teve sucesso na integração de uma cópia do gene que codifica o hormônio do crescimento de rato (HCR) em um dos cromossomos autossômicos de uma célula-ovo de camundongo. A célula-ovo transgênica se desenvolveu, dando origem a um camundongo macho. Este camundongo transgênico foi cruzado com uma fêmea de camundongo normal, isto é, não portadora do gene HCR.

10. (Ufc 2007) Mendel não acreditava na mistura de caracteres herdados. De acordo com suas conclusões, a partir dos cruzamentos realizados com ervilhas do gênero 'Pisum', as características não se misturam, permanecem separadas e são transmitidas independentemente. HENIG, Robin. "O monge no jardim". Rio de Janeiro: Rocco, 2001.

a) Considerando as leis de Mendel para a hereditariedade, no momento da fecundação os cromossomos herdados dos progenitores se juntam, porém os alelos dos seus genes não se misturam. A partir dessa idéia, qual fenômeno explicaria a ocorrência de características intermediárias na progênie, que parecem ser uma mistura daquelas dos progenitores? b) Posteriormente, estudos de grupos de geneticistas indicaram que pode haver troca de material genético entre cromossomos homólogos herdados do pai e da mãe. Em que etapa isso pode ocorrer e como se chama este processo?

11. (Ufrj 99) A formação de uma característica fenotípica depende, em alguns casos, apenas de fatores genéticos. Em outros casos, prevalece a influência de fatores ambientais. Na maioria das vezes há uma interação entre fatores genéticos e ambientais. Um dos métodos utilizados para avaliar a importância relativa dos genes e dos fatores ambientais na formação de uma característica é o estudo comparativo entre irmãos gêmeos monozigóticos criados juntos e criados separados. A tabela a seguir, elaborada a partir de um grande número de pares de gêmeos, indica o grau de concordância de quatro características. Uma concordância significa que quando um irmão possui a característica, o outro também a possui.

Calcule a proporção esperada da prole destes camundongos que será portadora do gene que codifica o HCR. Justifique sua resposta.

Indique a característica que mais depende de fatores ambientais. Justifique sua resposta.

35

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
16. (Unesp 97) Em gatos, as cores marrom e branca dos pêlos têm sido descritas como devidas a, pelo menos, um par de genes. Considere o cruzamento de gatos homozigotos brancos e marrons. Qual a proporção fenotípica esperada em F• se a) o modo de herança for do tipo dominante? b) o modo de herança for do tipo co-dominante?

13. (Ufrj 2004) Um pesquisador observou que uma certa espécie de planta apresentava uma grande variação de produtividade relacionada à altitude onde a planta se desenvolvia. Em grandes altitudes, a produtividade era muito baixa; à medida que a altitude se aproximava do nível do mar, a produtividade aumentava. Ele, então, realizou um experimento em que sementes dessa espécie, coletadas em diversas altitudes, foram plantadas ao nível do mar em idênticas condições ambientais. Após algum tempo, a produtividade dessas plantas foi medida e apresentou os seguintes resultados:

17. (Unesp 2005) Suponha que você tenha em seu jardim exemplares da mesma espécie de ervilha utilizada por Mendel em seus experimentos. Alguns desses exemplares produzem sementes lisas e outros, sementes rugosas. Sabendo que a característica "lisa" das sementes da ervilha é determinada por um alelo dominante L, portanto por genótipos LL ou Ll e, sabendo ainda, que as flores são hermafroditas e que sementes produzidas por autofecundação são viáveis, a) planeje um cruzamento experimental entre flores de exemplares diferentes que lhe permita determinar se uma planta que produz sementes lisas é homozigota ou heterozigota para esse caráter. b) No caso de ocorrer autofecundação em uma planta que produz sementes lisas e é heterozigota, qual seria a proporção esperada de descendentes com sementes rugosas?

Identifique se é o componente genético ou o componente ambiental que predomina no condicionamento da produtividade dessas plantas. Justifique sua resposta.

14. (Ufv 96) Um determinado casal normal, mas heterozigoto para o albinismo, solicitou aconselhamento genético sobre a possibilidade de vir a ter crianças apresentando a condição albina. Qual a probabilidade desse casal ter: a) quatro crianças albinas? b) uma criança albina e do sexo feminino? c) uma criança normal, heterozigota e do sexo masculino? d) Represente o provável heredograma desse casal, admitindo-se que as suposições feitas nas letras (b) e (c) realmente se concretizem.

18. (Unicamp 91) Um criador de cabras, depois de muitos anos nesse ramo, observou que alguns dos animais de sua criação apresentavam uma característica incomum nos chifres. Como o criador poderia fazer para determinar se essa variação é decorrente de uma mutação genética ou de uma alteração causada por fatores ambientais?

19. (Unicamp 95) Em experimento feito no início do século, dois pesquisadores retiraram os ovários de uma cobaia albina e implantaram-lhe um ovário obtido de uma cobaia preta. Mais tarde, o animal foi cruzado com um macho albino e deu origem a uma prole toda preta. a) Sabendo-se que o albinismo é característica recessiva, como você explica esse resultado? b) Indique os genótipos da fêmea preta e da prole. c) Se fosse possível implantar os pêlos da fêmea preta na fêmea albina, em vez de transplantar o ovário, o resultado seria o mesmo? Justifique.

15. (Unesp 93) Recentemente, os meios de comunicação noticiaram o caso de uma mulher norte-americana que, impossibilitada de ter filhos por anomalia no útero, teve seu óvulo fertilizado "in vitro", e este foi implantado no útero de sua mãe. Assim, quem engravidou e deu à luz foi a mãe da referida mulher. Responda: a) Do ponto de vista genético, quem é a mãe da criança? Justifique. b) Qual a porcentagem de genes herdados da parturiente que se encontram no patrimônio genético da criança?

36

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
22. (Unicamp 2004) A herança da cor do olho na espécie humana geralmente é representada simplificadamente como um par de alelos, A (dominante, determinando cor castanha) e a (recessivo, determinando cor azul). Baseando-se nessa explicação, analise as afirmações abaixo, proferidas por casais em relação à cor dos olhos de seu bebê, verificando se elas têm fundamento. Justifique sua resposta. a) Afirmação de um casal de olhos azuis: "nosso bebê poderá ter olhos castanhos porque as avós têm olhos castanhos". b) Afirmação de um casal de olhos castanhos: "nosso bebê poderá ter olhos azuis porque o avô paterno tem olhos azuis".

20. (Unicamp 99) Em várias culturas vegetais, os programas de melhoramento utilizam a heterose (vigor do híbrido). Nesses programas são desenvolvidas linhagens homozigotas por meio de sucessivas gerações autofecundadas. Duas linhagens, homozigotas para alelos diferentes, são então cruzadas e produzem os híbridos, que, em geral, são mais vigorosos e mais produtivos que os parentais. a) Esses indivíduos híbridos são geneticamente iguais entre si? Explique. b) Se o agricultor utilizar as sementes produzidas pelo híbrido nos plantios subsequentes, o resultado não será o mesmo. Por quê?

21. (Unicamp 2001) Ao estudar a distribuição de uma espécie de planta da família dos girassóis em altitudes crescentes na costa oeste dos Estados Unidos, pesquisadores observaram que essas plantas apresentavam um gradiente decrescente de tamanho. Sementes dessas plantas foram coletadas nas várias altitudes e plantadas em uma mesma região localizada ao nível do mar. Após um determinado tempo de crescimento, as plantas resultantes foram medidas e os dados obtidos no experimento são mostrados no gráfico A.

23. (Fuvest 98) Em uma espécie de planta a forma dos frutos pode ser alongada, oval ou redonda. Foram realizados quatro tipos de cruzamento entre plantas dessa espécie e obtidos os seguintes resultados:

a) Explique o resultado obtido, expresso no gráfico A.

b) Se o resultado do experimento tivesse sido o representado no gráfico B, qual seria a interpretação?

a) Formule uma hipótese consistente com os resultados obtidos para explicar a herança da forma dos frutos nessa espécie. b) Represente os alelos por letras e indique os genótipos dos indivíduos parentais e dos descendentes no cruzamento IV.

37

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
26. (Unesp 91) Em gado, a cor da pelagem vermelha, ruão e branca, é controlada por genes codominantes, e o cruzamento de animais com chifres versus animais sem chifres, às vezes só origina prole sem chifres, e, em outros cruzamentos, aparecem os dois tipos em igual número. Um fazendeiro tem uma grande boiada constituída de animais vermelhos, ruões, brancos e sem chifres, os quais, ocasionalmente produzem prole com chifres. Utilizando apenas cruzamentos naturais, ou seja, sem recorrer à inseminação artificial, como o fazendeiro deverá proceder para estabelecer uma linhagem pura de animais brancos e sem chifres? Por que ele não conseguirá resolver o problema dos chifres rapidamente? 27. (Unicamp 2000) O gráfico a seguir mostra a mortalidade de mosquitos de uma determinada espécie quando expostos a diferentes concentrações de um inseticida. A resistência ou susceptibilidade ao inseticida é devida a um locus com dois alelos, A e A‚.

24. (Uff 2000) Considere uma certa espécie de planta que pode apresentar flores com três tipos de cor: azul, azul-claro e branca. Estas cores são determinadas por combinações de dois alelos de um único locus. Na expressão fenotípica de tais cores não há relação de dominância entre os alelos, sendo que a manifestação em homozigose de um dos alelos - aa, cor branca - é letal na fase adulta. Sabe-se que: - a flor de cor branca nunca se abre; - em um jardim de plantas com flores de cor azul não nascem plantas com flores de cor azul-claro.

a) Realizou-se o cruzamento entre as plantas com flores azul-claro e, a partir das sementes obtidas, formou-se um jardim. Determine a cor das flores que têm menor possibilidade de se abrirem neste jardim. Justifique a resposta.

b) Realizaram-se os cruzamentos possíveis entre as plantas com flores das cores mencionadas, presentes em igual quantidade. A partir das sementes obtidas, formou-se outro jardim. Determine a cor das flores que têm maior possibilidade de se abrirem neste jardim. Justifique a resposta.

25. (Ufrj 96) Em rabanetes, a forma da raiz é determinada por um par de genes alelos. Os fenótipos formados são três: arredondado, ovalado ou alongado. Cruzamentos entre plantas de raízes alongadas com plantas de raízes arredondadas produziram apenas indivíduos com raízes ovaladas. Em cruzamentos desses indivíduos ovalados entre si, foram obtidas quatrocentas sementes que foram plantadas em sementeiras individuais. Antes que as sementes germinassem, as sementeiras foram distribuídas a diversas pessoas; você recebeu uma delas. a) Qual a relação de dominância entre os caracteres em questão? b) Qual a probabilidade de que, na sua sementeira, venha a se desenvolver um rabanete de raiz ovalada? Justifique a sua resposta. a) Qual é o genótipo mais resistente? Como você chegou a essa conclusão?

b) Observando as três curvas, que conclusão se pode tirar sobre as relações de dominância entre os alelos deste locus? Explique.

c) Os indivíduos de cada um dos genótipos não se comportam da mesma forma quanto à resistência ao inseticida e, por isso, os pontos distribuem-se ao longo da curva. Essas diferenças podem ser atribuídas a efeitos pleiotrópicos de outros genes? Justifique sua resposta utilizando o conceito de efeito pleiotrópico.

38

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
29. (Ufc 96) A figura a seguir, adaptada da Folha de São Paulo de 17/03/96, mostra a transmissão do albinismo, de geração, na Família de Raimundo e Eleílde da Silva, moradores da ilha dos Lençóis, situada a oeste de São Luís, onde a freqüência de albinos é de 1,5 % e cinqüenta vezes maior do que entre o restante da população do Maranhão.

28. (Fuvest 2001) O heredograma a seguir representa uma família com pessoas afetadas por uma doença hereditária.

a) A doença tem herança dominante ou recessiva? Por quê?

b) A doença tem herança autossômica ou ligada ao cromossomo X? Por quê?

Analise a figura onde se admite que a pigmentação da pele é devida a um par de alelos (A,a). Os indivíduos I - 1, II - 6, V - 2, V - 3 e V - 5 são albinos. Responda, então: a) Que nome se dá ao aparecimento, numa dada geração, de uma característica expressa em antepassados remotos? b) O albinismo se deve a alelo dominante ou a alelo recessivo? Explique com base na figura. c) Qual a probabilidade de os indivíduos de pigmentação normal da geração V serem todos heterozigotos?

39

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
31. (Uff 97) O heredograma a seguir refere-se ao caso de braquidactilia. Identifique e justifique o tipo de herança.

30. (Ufes 2001) Nos Estados Unidos, um grupo de cientistas do "Genetics & IVF Institute" vem testando um novo método que permite a seleção dos espermatozóides a partir de sua coloração, de acordo com a presença ou ausência do cromossomo Y ('Microsort'). Tal método, além de satisfazer os anseios de vários casais na escolha do sexo do filho, poderá ser benéfico quando utilizado por famílias portadoras de determinadas anomalias genéticas.

Analise os dois heredogramas anteriores, considerando que o caráter é determinado por um único par de genes, e responda às seguintes questões:

32. (Uff 2004) O padrão de herança de uma doença, que se suspeita ser autossômica recessiva ou ligada ao sexo, foi analisada em três famílias diferentes (I, II e III), como representado nos heredogramas a seguir:

a) Qual o padrão de herança envolvido na determinação da característica representada no heredograma 1 e no heredograma 2? Justifique sua resposta.

b) Em qual das duas situações seria mais recomendado o uso da técnica ('Microsort') para a escolha de um bebê do sexo feminino? Por quê?

c) Considerando o heredograma n¡.1, calcule a chance de os indivíduos III.1 e III.2 gerarem uma criança afetada do sexo masculino.

a) Qual o tipo de herança da doença? Justifique sua resposta. b) Suponha que a mulher 3 da família I case-se com o homem 4 da família III. Qual a probabilidade de nascer uma criança doente? Justifique.

40

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
34. (Ufrj 2001) No heredograma abaixo a cor preta indica indivíduos com pelagem negra, fenótipo determinado por um gene autossômico dominante A. A cor branca indica pelagem branca determinada por um gene recessivo. Os indivíduos 5 e 8 devem ser considerados homozigotos (AA), a menos que haja evidência contrária.

33. (Ufjf 2002) Numa aula de genética, o professor lhe apresenta o heredograma a seguir, que mostra a ocorrência de uma anomalia causada pela ação de um par de genes (A e a) em várias gerações de uma família. Ao analisar os indivíduos afetados por esta anomalia, você conclui que se trata de uma herança autossômica dominante.

Baseando-se EXCLUSIVAMENTE no heredograma apresentado acima, responda: a) Por que a anomalia NÃO pode ser recessiva?

Qual a probabilidade de que o cruzamento entre o indivíduo 9 e o indivíduo 10 gere um indivíduo de pelagem branca?

b) Por que a anomalia NÃO pode ser ligada ao cromossomo X?

35. (Ufrj 2004) Os heredogramas A, B e C a seguir representam três famílias diferentes. Os círculos representam mulheres e os quadrados, homens. Quadrados ou círculos escuros representam indivíduos afetados por uma característica comum na população.

c) Qual a probabilidade de nascer uma criança afetada pela anomalia, se a mulher (4) da geração F3 tiver filhos com um homem que apresente essa anomalia?

a) Identifique os heredogramas que são compatíveis com uma herança autossômica recessiva. Justifique sua resposta para cada família. b) Determine se em algum dos casos apresentados existe herança ligada ao cromossomo Y. Justifique.

41

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
37. (Unesp 2002) Analise a genealogia, que apresenta indivíduos afetados por uma doença recessiva e indivíduos normais.

36. (Unesp 94) Na genealogia adiante, os indivíduos em escuro apresentam uma doença hereditária, enquanto os outros exibem fenótipo normal. Os círculos representam as mulheres e os quadrados, os homens.

a) Quais os indivíduos representados na genealogia que são obrigatoriamente heterozigotos?

Analise esta genealogia e responda. a) Esta doença hereditária é condicionada por gene dominante ou recessivo? b) Dos dez indivíduos que compõem esta genealogia, qual o único que não pode ter seu genótipo definido? Explique por quê. b) Qual a probabilidade de o casal formado pelos indivíduos II2 e II3 ter mais dois filhos, sendo ambos do sexo masculino e afetados?

38. (Unicamp 91) Uma determinada característica foi estudada em centenas de pares de gêmeos, tanto monozigóticos como dizigóticos. As diferenças registradas entre os irmãos dizigóticos foram praticamente da mesma magnitude que as encontradas entre os irmãos monozigóticos. Discuta a importância dos fatores genéticos na manifestação dessa característica.

42

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
42. (Ufrj 95) Em uma raça de cachorros, a cor do pêlo negro é determinada por um gene dominante (A) enquanto seu alelo (a) determina a cor branca. O tamanho do pêlo também é controlado por um par de genes, sendo o alelo dominante (B) para pêlo curto e o alelo recessivo (b) para pêlo longo. A tabela a seguir apresenta os fenótipos dos pais e os fenótipos das respectivas proles, após vários cruzamentos.

39. (Fuvest 94) Considere a figura a seguir que representa o resultado da primeira divisão meiótica de uma célula feminina:

a) Indique o genótipo do embrião formado a partir da fecundação do óvulo resultante dessa célula por um espermatozóide de um macho recessivo para os dois pares de genes considerados. b) Quais os possíveis genótipos dos filhos possíveis do mesmo casal?

40. (Fuvest 99) Em cobaias, a cor preta é condicionada pelo alelo dominante D e a cor marrom, pelo alelo recessivo d. Em um outro cromossomo, localiza-se o gene responsável pelo padrão da coloração: o alelo dominante M determina padrão uniforme (uma única cor) e o alelo recessivo m, o padrão malhado (preto / branco ou marrom / branco). O cruzamento de um macho de cor preta uniforme com uma fêmea de cor marrom uniforme produz uma ninhada de oito filhotes: 3 de cor preta uniforme, 3 de cor marrom uniforme, 1 preto e branco e 1 marrom e branco. a) Quais os genótipos dos pais? b) Se o filho preto e branco for cruzado com uma fêmea cujo genótipo é igual ao da mãe dele, qual a proporção esperada de descendentes iguais a ele?

a) Os genes para a cor e tamanho de pêlo estão no mesmo par de cromossomas? Justifique sua resposta. b) Quais são os genótipos mais prováveis dos pais em cada casal? Justifique sua resposta.

41. (Ufg 2005) Quatro irmãos, filhos legítimos de um mesmo casal, apresentam marcantes diferenças em suas características físicas.

Descreva três mecanismos biológicos potencialmente responsáveis por essa variabilidade genética e explique como atuam.

43

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
44. (Ufscar 2004) A figura mostra a segregação de dois pares de cromossomos homólogos na anáfase da primeira divisão meiótica de uma célula testicular de um animal heterozigótico quanto a dois genes. As localizações dos alelos desses genes, identificados pelas letras Aa e Bb, estão indicadas nos cromossomos representados no desenho.

43. (Ufrj 2006) Um pesquisador está estudando a genética de uma espécie de moscas, considerando apenas dois locos, cada um com dois genes alelos:

loco 1 - gene A (dominante) ou gene a (recessivo); loco 2 - gene B (dominante) ou gene b (recessivo).

Cruzando indivíduos AABB com indivíduos aabb, foram obtidos 100% de indivíduos AaBb que, quando cruzados entre si, podem formar indivíduos com os genótipos mostrados na Tabela 1. Sem interação entre os dois locos, as proporções fenotípicas dependem de os referidos locos estarem ou não no mesmo cromossomo. Na Tabela 2, estão representadas duas proporções fenotípicas (casos 1 e 2) que poderiam resultar do cruzamento de dois indivíduos AaBb.

a) Ao final da segunda divisão meiótica dessa célula, quais serão os genótipos das quatro células haplóides geradas? b) Considerando o conjunto total de espermatozóides produzidos por esse animal, quais serão seus genótipos e em que proporção espera-se que eles sejam produzidos?

45. (Unicamp 96) Suponha uma planta superior originada de um zigoto no qual dois dos pares de cromossomos, A e B, têm a constituição AA‚BB‚. a) Qual será a constituição cromossômica da planta adulta originada desse zigoto? Justifique. b) Se essa planta se reproduzir por autofecundação, a constituição cromossômica de seus descendentes será igual à da planta mãe? Justifique. Identifique qual dos dois casos tem maior probabilidade de representar dois locos no mesmo cromossomo. Justifique sua resposta.

44

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
49. (Ufrn 2005) Os heredogramas a seguir representam duas famílias com doenças hereditárias distintas. A doença que acomete a família 1 provoca retardamento mental acentuado, enquanto que a da família 2 é uma doença degenerativa fatal que aparece em torno dos 40 anos de idade.

46. (Unicamp 2003) Considere duas linhagens homozigotas de plantas, uma com caule longo e frutos ovais e outra com caule curto e frutos redondos. Os genes para comprimento do caule e forma do fruto segregam-se independentemente. O alelo que determina caule longo é dominante, assim como o alelo para fruto redondo.

a) De que forma podem ser obtidas plantas com caule curto e frutos ovais a partir das linhagens originais? Explique indicando o(s) cruzamento(s). Utilize as letras A, a para comprimento do caule e B, b para forma dos frutos. b) Em que proporção essas plantas de caule curto e frutos ovais serão obtidas?

47. (Unifesp 2007) Considere dois genes e seus respectivos alelos: A e a; B e b. Em termos de localização cromossômica, explique o que significa dizer que esses dois genes a) segregam-se independentemente na formação dos gametas. b) estão ligados. Após analisar os heredogramas, atenda às solicitações a seguir. a) Quais os tipos de herança envolvidos na transmissão das doenças de cada família? Justifique sua resposta. b) Considerando que a seleção natural pode eliminar doenças genéticas, explique por que a doença da família 2 ainda poderia ser encontrada em indivíduos da geração VI (netos da geração IV).

48. (Ufu 2007) Na espécie humana, assim como em todas as outras espécies de seres vivos, existem vários fenótipos dos quais as heranças provêm de um par de alelos com relação de dominância completa. Dentre esses fenótipos podem ser citados: 1) sensibilidade gustativa para feniltiocarbamida (PTC) é dominante sobre a não sensibilidade; 2) a forma do lobo da orelha, lobo solto é dominante sobre lobo aderente; 3) a capacidade de dobrar a língua é dominante sobre a incapacidade de fazê-lo. Um casal, cujo marido tem lobo da orelha aderente, é heterozigoto para a sensibilidade ao PTC e não é capaz de dobrar a língua. A esposa tem heterozigose para a forma do lobo da orelha, para a sensibilidade ao PTC e para a capacidade de dobrar a língua. Com base nesses conhecimentos, qual é a probabilidade deste casal ter uma criança masculina e com lobo da orelha aderente, não sensível ao PTC e não ser capaz de dobrar a língua?

50. (Unicamp 2004) A anemia falciforme é caracterizada por hemácias em forma de foice, em função da produção de moléculas anormais de hemoglobina, incapazes de transportar o gás oxigênio. Indivíduos com anemia falciforme são homozigotos (SS) e morrem na infância. Os heterozigotos (Ss) apresentam forma atenuada da anemia. Na África, onde a malária é endêmica, os indivíduos heterozigotos para anemia falciforme são resistentes à malária. a) Explique o que é esperado para a freqüência do gene S em presença da malária. E em ausência da malária? b) Qual é a explicação para o fato dos heterozigotos para anemia serem resistentes à malária?

45

salabioquimica.blogspot.com
GABARITO

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
4. a) Não, porque a seqüência herdada do pai é recessiva em relação à materna.

1. a)

b) A probabilidade de uma outra criança desse casal herdar as duas seqüências maternas é zero porque na fecundação há união das seqüências paterna e materna.

5. a) 6 crianças b) Nenhum dos filhos será afetado (XaY) e todas as filhas (XAXa) serão afetadas.

6. a) Locus gênico b) 3 genótipos - LL, LL' e L'L' c) Exposição às radiações ionizantes pode causar danos ao DNA.

b) P(ab) = P(a) × (b) = 1/2 × 1/2 = 1/4 c) O processo de formação de gametas (meiose) é importante porque promove a variabilidade genética e mantém constante o número cromossômico da espécie. d) Planta de flores vermelhas AaBb

7. a) Pleoitropia b) Dieta deficiente em fenilalanina

AaBb × AaBb (autofecundação) A_ B_ 9 vermelhas A_ bb 3 rosas AaB_ 3 brancas Aabb 1 branca

8. Hereditariedade mendeliana: há possibilidade, pois os genes são transmitidos inalteradamente para a próxima geração; pode haver mistura dos fenótipos dos genitores, mas não dos genes individualmente. Hereditariedade por mistura: não há possibilidade, pois esta hipótese propõe uma mescla de genes, não permitindo a seleção do gene mutante.

9. I. O heredograma correspondente ao histórico familiar descrito deve ter o seguinte aspecto:

9/16 vermelhas : 3/16 rosas : 4/16 brancas

2. Cruzando-se um porquinho preto (B_ ) com um recessivo (bb) . Se o resultado for 100% preto o porquinho analisado é BB, se for 50% preto e 50% branco, o porquinho é Bb.

3. Cruzando-se um porquinho preto (B_ ) com um recessivo (bb). Se o resultado for 100% preto o porquinho analisado é BB, se for 50% preto e 50% branco, o porquinho é Bb.

46

salabioquimica.blogspot.com
II. 50%

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO

III. Apenas o pai e as duas irmãs mais velhas do rapaz são seguramente heterozigotos para esse gene. IV. O padrão de herança monogênica autossômica dominante é condicionado por um único gene, não relacionado ao sexo, que se manifesta inclusive em indivíduos heterozigotos, por ser dominante.

10. a) Realmente, os alelos não se misturam na fecundação, como afirmou Mendel. Porém, no fenômeno conhecido como DOMINÂNCIA INCOMPLETA, o fenótipo do indivíduo heterozigótico é intermediário entre os fenótipos dos dois indivíduos homozigóticos que lhe deram origem. b) A troca de material genético entre cromossomos herdados do pai e da mãe pode ocorrer na gametogênese, durante a meiose, na fase de prófase I. O processo é chamado de PERMUTAÇÃO ou "crossingover". 15. a) A mulher que não podia engravidar porque foi a doadora do óvulo implantado em sua mãe. b) Em média 25% dos genes seriam herdados da avó parturiente.

11. A característica 2, pois gêmeos com o mesmo padrão genético (univitelínicos) apresentam grau de concordância menor em ambientes diferentes.

16. a) Se o padrão da herança for dominante, em F• os descendentes serão todos marrons ou todos brancos de acordo com o gene dominante.

12. A proporção é de 50% (metade) da prole. Na formação dos gametas, os membros de um par de cromossomos homólogos são separados; portanto, só 50% dos gametas do pai serão portadores do gene do HCR. A mãe contribuirá sempre com um cromossomo não portador do gene do HCR.

b) Na herança sem dominância todos os descendentes deverão apresentar uma cor intermediária entre marrom e branco.

17. a) Realizar um test-cross ou cruzamento-teste, ou seja cruzar a lisa com uma rugosa. Se a planta for homozigota o resultado será 100% lisa. Se a planta for heterozigota o resultado será 50% lisa e 50% rugosa.

13. O componente genético predomina na determinação da produtividade das plantas. As plantas originadas em localidades altas mantiveram a baixa produtividade quando plantadas ao nível do mar.

b) A proporção seria 1/4 ou 25%. 14. a) 1/256 b) 1/8 c) 1/4 d) Observe a figura a seguir: 19. a) A cobaia albina recebeu um ovário de uma fêmea preta homozigota e, portanto, todos os seus óvulos terão o gene A para cor preta. 18. Cruzamento de animais que são portadores da característica em questão e análise da descendência, ou seja, da primeira e segunda gerações. Se o caráter reaparecer nos descendentes, é hereditária.

b) A fêmea preta tem genótipo AA e a prole é 100% heterozigota (Aa).

47

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
24. a) Genótipos:

c) Não. O animal teria somente seu fenótipo alterado (cor dos pêlos) e continuaria a transmitir aos descendentes seus genes que não foram alterados.

Azul - AA; Azul-claro - Aa; Branca - aa; AA - 25%

20. a) Os híbridos são geneticamente idênticos pois são descendentes de linhagens homozigotas.

Aa - 50% aa - 25% de plantas que não apresentam flores abertas.

b) Sementes se formam através de um processo sexuado envolvendo recombinação gênica e combinações cromossômicas na fecundação. Por isso produzem descendência diferenciada.

Neste jardim, as flores que têm menor possibilidade de se abrirem são as de cor azul.

21. a) A característica "tamanho das plantas" é determinada geneticamente. Sementes coletadas em diferentes altitudes, colocadas para germinar todas ao nível do mar, portanto nas mesmas condições, apresentaram fenótipos distintos.

b) Possibilidades de cruzamentos:

1•: AA × AA - 100% de cor azul 2•: AA × Aa - 50% de cor azul e 50% de cor azul-claro

b) A curva do gráfico B, permite a conclusão de que a característica "tamanho das plantas" é dependente do ambiente, e não determinada geneticamente.

3•: Aa × Aa - aproximadamente 33,33% azul e 66,66% de cor azulclaro.

22. a) Falso, pois casal de olho azul, recessivo, não pode ter filho de olhos castanhos (dominante) b) Afirmação verdadeira desde que um dos avós maternos também transmita o gene recessivo para a mãe.

Neste jardim, as flores que têm maior possibilidade de se abrirem são as de cor azul.

25. a) Não há dominância entre os alelos que determinam a forma dos rabanetes. b) 50% pois os pais são heterozigotos e podem produzir descendentes na seguinte proporção: 25% arredondados, 50% ovalados e 25% alongados.

23. a) Os resultados obtidos nos cruzamentos entre os vegetais que produziram os frutos sugere um caso de herança sem dominância (ou codominância). O cruzamento de uma variedade longa (LL) com a variedade redonda (RR) produz 100% dos descendentes com um fenótipo intermediário, ou seja, os heterozigotos (LR) apresentam a forma ovalada.

26. Para obter prole 100% formada por animais brancos e sem chifres o fazendeiro deverá selecionar um casal de animais brancos e sem chifres homozigotos para as duas características. O problema dos chifres demora a ser resolvido porque o caráter presença de chifres é recessivo e o criador teria dificuldade na identificação de animais sem chifres, condição dominante, homozigotos.

b) Alelos: L - fruto longo R - fruto redondo

Parentais: LR X LR Descendentes: 25% LL : 50% LR : 25% RR

27. a) O genótipo que confere ao inseto maior resistência ao inseticida é A‚A‚. A observação do gráfico mostra que é necessária maior concentração do praguicida para eliminá-lo.

48

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
31. O heredograma sugere herança autossômica dominante pois há homens e mulheres igualmente afetados. A proporção de filhos afetados nas gerações II, III e IV mostra, aproximadamente, 50% de filhos afetados. Pais normais possuem descendentes 100% normais.

b) Co-dominância ou Herança sem dominância. O heterozigoto apresenta fenótipo intermediário entre os homozigotos.

c) O efeito pleiotrópico de outros genes pode explicar as diferenças de comportamento dos mosquitos frente ao inseticida. Genes que atuam sobre outras características podem agir também sobre a resistência desses insetos aos praguicidas.

32. a) A herança é autossômica recessiva. Este é o único tipo de herança que explica o fato de a filha 5 da família II ser doente.

28. a) Herança dominante. A filha II-2 é normal, porém é filha de pais afetados; isso demonstra que os pais são heterozigotos para a característica.

b) Herança autossômica. Se o gene dominante para a anomalia estivesse ligado ao cromossomo X, a menina II-2 apresentaria obrigatoriamente a doença, já que herdaria de seu pai o cromossomo X portador do gene em questão.

b) A probabilidade de nascer uma criança doente é de 50% ou 1/2. A mulher 3 da família I possui o genótipo heterozigoto (portadora do gene) e o homem 4 da família III, doente, possui o genótipo homozigoto recessivo. O cruzamento entre eles tem a probabilidade de gerar 50 % de indivíduos com o genótipo heterozigoto, normais e 50% de indivíduos com o genótipo homozigoto recessivo, doentes.

33. a) A anomalia não pode ser recessiva, pois os indivíduos 7 e 8 da F‚, afetados pela anomalia, não poderiam ter filhos normais. 29. a) Expressividade recessiva b) Recessivo pois os pais IV - 1 e IV - 2 são normais e têm filhos albinos. c) 1/32

b) Se a anomalia fosse dominante e ligada ao cromossomo X, todas as filhas do casal 7× 8 seriam afetadas.

30. a) O heredograma 1 apresenta o padrão típico da herança autossômica recessiva. Justifica-se pelo fato de indivíduos afetados (II.2 e IV.6) serem filhos de pais normais para o caráter em questão e o número de afetados de ambos os sexos ser aproximadamente o mesmo ao logo das gerações.

c) Sendo normal, a mulher em questão apresenta genótipo aa. Se tiver filhos com um homem afetado, duas possibilidades podem ocorrer:

1.

mulher aa × homem AA

100% dos filhos Aa e afetados pela anomalia O heredograma 2 apresenta o padrão observado na herança recessiva ligada ao sexo. Justifica-se pelo fato de se observarem apenas homens afetados que seriam filhos de mulheres portadoras do gene recessivo ligado ao cromossomo X.

2.

mulher aa × homem Aa

50% dos filhos normais (aa) e 50% afetados (Aa)

b) Seria recomendável a escolha de um filho do sexo feminino no caso apresentado na genealogia 2 pois, neste caso, seria muito menor a probabilidade da ocorrência do caráter em mulheres. Os indivíduos do sexo feminino seriam afetados somente se herdarem dois genes recessivos ligados ao X.

34. O indivíduo 9 é heterozigoto com certeza. O indivíduo 7 tem probabilidade de 2/3 de ser heterozigoto, o indivíduo 10 de 1/2. Logo, a probabilidade de nascer um homozigoto recessivo do cruzamento 9×10 é igual a:

c) Pais: Aa x aa | P(menina afetada) = 1/2 . 1/2 = 1/4 ou 25%

(2/3) × (1/2) × (1×4) = 2/24 ou 1/12.

35. a) Os heredogramas A e C são compatíveis com herança autossômica recessiva. Em A os pais são heterozigotos e em C a mãe

49

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
41. Principais mecanismos de geração de variabilidade genética em famílias humanas: 1) recombinação (permutação) - troca de partes entre os cromossomos homólogos durante o processo de divisão meiótica. 2) segregação independente - separação aleatória dos cromossomos homólogos durante a divisão meiótica de cada célula germinativa (materna e paterna). 3) mutação - alteração na informação genética produzida por erros de duplicação do material genético ou por ação de agentes mutagênicos.

é heterozigota ou homozigoto normal. Em B, ambos os pais devem ser heterozigotos autossômicos para uma característica dominante.

b) Não, em A o outro filho homem não foi afetado e nas outras famílias nenhum filho homem foi afetado.

36. a) Recessivo. b) A mulher III -1 não pode ter seu genótipo determinado com segurança porque é fenotipicamente normal e filha de pais seguramente heterozigotos.

37. a) Heterozigotos (Aa): II-1, II-2, II-3 e II-4.

42. a) Não, porque a prole do casal (I) aparece na proporção de 9:3:3:1, o que indica genes localizados em pares de cromossomos diferentes. b) aaBb x aaBb

b) Geração parental: (II-2) Aa x Aa (II-3)

c) Geração possível:

43. O caso 2, que ocorre quando os dois locos estão no mesmo cromossomo, com permuta gênica entre eles. A proporção fenotípica 9:3:3:1 (caso 1) só ocorre quando os dois locos estão em cromossomos diferentes. (aa)

(AA, Aa, Aa) e 3/4 normais

1/4 afetados

44. a) 50% aB e 50% Ab. b) Devido ao fenômeno da segregação independente, serão formados espermatozóides com os seguintes genótipos: AB - 25%, Ab - 25%, aB - 25% e ab - 25%

P (homem afetado) = 1/2 . 1/4 = 1/8 P (2 homens afetados) = 1/8 . 1/8 = 1/64

38. São fatores dependem fortemente da influência ambiental para se manifestar. Os fatores hereditários têm pouca importância na expressão desta característica estudada.

45. a) A planta adulta terá genótipo igual ao zigoto que lhe deu origem, ou seja, AAB‚B‚ porque todas as células do adulto são originadas por mitoses a partir do zigoto.

39. a) o oócito AAbb formará, na segunda divisão meiótica, óvulo do tipo Ab, que fecundado por um espermatozóide ab produzirá um embrião de genótipo Aabb.

b) Os descendentes poderão ser iguais ou diferentes dos pais como é mostrado a seguir:

AABB x AABB = b) A mulher de genótipo AaBb cruzando com um homem aabb poderá ter filhos com os seguintes genótipos: AaBb, Aabb, aaBb, aabb.

proporções genotípicas:

40. a) Macho: DdMm - Fêmea: ddMm b) 1/4

1/16 A•A•B•B• 2/16 AABB‚

50

salabioquimica.blogspot.com
2/16 AA‚BB 4/16 AA‚BB‚ 1/16 AAB‚B‚ 2/16 AA‚B‚B‚ 1/16 A‚A‚BB 2/16 A‚A‚BB‚ 1/16 A‚A‚B‚B‚

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO

46. a) Alelos: A (longo), a (curto) B (redondo), b (oval) 48. Aabbcc × AaBbCc Cruzando as linhagens homozigotas obtém-se a F•, que intercruzada produzirá, na F‚, plantas com caule curto e frutos ovais: Homem e aabbcc Cruzamentos: (1/2) × (1/4) × (1/2) × (1/2) = 1/32

P: | F•:

AAbb x aaBB

49. a) Família I - herança dominante ligada ao X. Ocorre em todas as gerações. Os homens afetados transmitem a doença para todas as filhas. Família II - herança dominante autossômica. Ocorre em todas as gerações. Atinge indivíduos de ambos os sexos ou filhos afetados têm um genitor afetado.

AaBb x AaBb |

F‚: 9A_B_ : 3A_bb : 3aaB_ : 1aabb b) Como a doença só se manifesta a partir dos 40 anos, o indivíduo pode reproduzir-se antes de a doença aparecer, transmitindo a característica aos descendentes.

b) A proporção esperada de plantas com caule curto e frutos ovais (aabb) é de 1/16.

47. a) Os genes estão localizados em cromossomos diferentes (figura 1).

50. a) Com a malária os indivíduos ss tendem a morrer, em contrapartida, os Ss são imunes, aumentando a freqüência do S. Sem a malária os indivíduos ss sobrevivem, diminuindo a freqüência do S. b) Indivíduos Ss produzem hemácias normais e anormais. Estas anormais, não permitem a reprodução assexuada do protozoário.

b) Os genes estão em "Linkage", ou seja, estão localizados no mesmo cromossomo (figura 2).

Lista 4

51

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
4. (Ufrj) O daltonismo, ou cegueira para as cores, é determinado por um gene localizado no cromossomo sexual X. O tipo de sangue, grupo ABO, é determinado por três alelos autossômicos: IÞ, Iß, i. Uma mulher, com sangue tipo A e visão normal, ficou viúva e casou pela segunda vez. Um dos maridos, José, tinha sangue AB e era daltônico; o outro marido, Paulo, tinha sangue A e visão normal. Com os dois maridos, a mulher teve cinco filhos na seguinte ordem: 1) homem, sangue A, daltônico; 2) homem, sangue O, daltônico;

1. (Fuvest) Nos anos 40, o famoso cineasta Charlie ChapIin foi acusado de ser o pai de uma criança, fato que ele não admitia. Os exames de sangue revelaram que a mãe era do grupo A, a criança do grupo B e Chaplin do grupo O. Ao final do julgamento, Chaplin foi considerado como sendo um possível pai da criança. a) O veredicto é aceitável? Por quê? b) Na hipótese de Chaplin ter tido filhos com a referida mulher, de que tipos sangüíneos eles poderiam ser?

2. (Fuvest) Um tratamento utilizado para certos tipos de doenças do sangue é a destruição completa da medula óssea do paciente e implante de células medulares sadias provenientes de um doador. Eugênio, cujo grupo sangüíneo é A, recebeu um transplante de medula óssea de seu irmão Valentim, cujo grupo sangüíneo é B, e a operação foi bem sucedida. a) Qual será o grupo sangüíneo de Eugênio após o transplante? Por quê? b) Sabendo-se que a mãe e a esposa de Eugênio têm sangue do tipo O, qual será a probabilidade de um futuro filho do casal ter sangue do tipo A? E do tipo B?

3) mulher, sangue A, daltônica; 4) mulher, sangue B, visão normal; 5) mulher, sangue A, visão normal. Qual dos homens foi o primeiro marido? Justifique sua resposta.

5. (Ufrj) O sangue de Orlando aglutina quando colocado em presença de soro contendo imunoglobulinas ou aglutininas anti-A, e não aglutina quando colocado em presença de imunoglobulinas ou aglutininas anti-B. Orlando casa-se com Leila, que apresenta aglutinações inversas. O casal tem um filho cujo sangue não aglutina em nenhum dos dois tipos de soro. a) Qual o genótipo dos pais?

3. (Udesc) "Os grupos sangüíneos são determinados pela presença ou ausência de antígenos na superfície das hemácias. No caso do Sistema ABO, os antígenos estão presentes no sangue dos grupos A, B, AB e ausentes no grupo O". ("Reserva estratégica de sangue", de Ricardo Lorzetto. CIÊNCIA HOJE, SBPC, vol. 19/n¡. 113, set. 95, p. 58.)

b) Qual a probabilidade de esse casal ter uma criança cujo sangue aglutine nos dois tipos de soro? Justifique sua resposta. 6. (Ufrj) Pode-se usar o sistema ABO para "excluir" um suposto pai em uma investigação de paternidade. Para tal, basta determinar o genótipo e o fenótipo do suposto pai e, por comparação com os fenótipos e genótipos do filho e da mãe, verificar se o homem acusado pode ser considerado como um pai impossível. A tabela a

a) O que são antígenos? b) Qual a importância de se identificar a presença de antígenos eritrocitários (presentes nas hemácias ou eritrócitos) no sangue humano?

seguir mostra os fenótipos do filho e da mãe em três casos.

Indique os fenótipos dos pais que NÃO poderiam ser os pais biológicos de cada caso.

52

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
9. (Unb) Dois casais suspeitavam da troca de seus bebês no berçário da maternidade. Os casais e os bebês foram submetidos à tipagem do sangue quanto ao sistema ABO, cujos resultados obtidos são

7. (Ufv) Nas quatro pessoas relacionadas a seguir, foram encontrados os seguintes tipos sangüíneos:

Joana - AB Cassilda - B Doaldo - O Saildo - A

mostrados na tabela adiante. Analisando-os, pode-se identificar os pais de cada bebê.

Com base nesta relação, responda: a) Quem do grupo anterior NÃO possui os aglutinogênios em suas hemácias? b) Por que Joana pode receber sangue de outros membros do grupo? c) Que tipo de aglutinina possuem Cassilda e Saildo, respectivamente?

8. (Ufv) Ao descobrir que seu genótipo era homozigoto, o Sr. Lalau (indivíduo II-1) elaborou o seguinte heredograma sobre a herança de grupos sangüíneos do sistema ABO. Após identificar os pais do bebê n¡. 2, calcule a probabilidade, em porcentagem, de que um futuro irmão deste bebê seja do sexo masculino e venha a ter tipo sangüíneo diferente do irmão. Despreze a parte fracionária do seu resultado, caso exista.

10. (Unicamp) Com base no heredograma a seguir, responda: a) Qual a probabilidade de o casal formado por 5 e 6 ter duas crianças com sangue AB Rh®? b) Se o casal em questão já tiver uma criança com sangue AB Rh®, qual a probabilidade de ter outra com os mesmos fenótipos sangüíneos? Obs.: indique os passos que você seguiu para chegar às respostas, em a e b. a) Identifique o grupo sangüíneo do indivíduo I-1:

b) Qual o genótipo do indivíduo II-5?

c) O Sr. Lalau poderá ser receptor de sangue de seu genro para transfusão?

d) O indivíduo III-5 NÃO poderá ser de qual grupo sangüíneo?

e) No caso do casal III-3 e III-4 ter uma segunda criança, qual é a probabilidade dela ser uma menina e do grupo sangüíneo "B"?

53

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
a) Complete o quadro a seguir com os genótipos e as reações antigênicas (represente com os sinais + e -) dos grupos sangüíneos indicados.

11. (Unicamp) O rei Salomão resolveu uma disputa entre duas mulheres que reclamavam a posse de uma criança. Ao propor dividir a criança ao meio, uma das mulheres desistiu. O rei então concluiu que aquela que havia desistido era de fato a mãe verdadeira. Nos tribunais modernos, um juiz pode utilizar a análise dos grupos sangüíneos e teste de DNA para ajudar a solucionar questões semelhantes. Analisando uma situação em que uma mulher de sangue A atribuía a paternidade de seu filho de sangue O a um homem de sangue B, o juiz não pôde chegar a nenhuma decisão conclusiva. a) Explique por quê. b) Qual deveria ser o grupo sangüíneo do homem para que a decisão pudesse ser conclusiva? c) Com base no teste de DNA, o juiz concluiu que o homem era pai da criança. Por que o teste de DNA permite tirar conclusões tão precisas em casos como este?

b) Embora 3 alelos distintos determinem os grupos sangüíneos ABO humanos, por que cada indivíduo é portador de somente dois alelos?

14. (Fuvest-gv) Uma população humana foi testada quanto ao sistema 12. (Unicamp) Os grupos sangüíneos humanos podem ser classificados em 4 tipos: A, AB, B e O, pelo sistema ABO e, de acordo com o sistema Rh, como Rh® e Rh-. a) Explique como o sangue de uma pessoa pode ser identificado em relação aos sistemas ABO e Rh. b) Explique por que uma pessoa com sangue tipo O é doadora universal mas só pode receber sangue do tipo O, enquanto uma pessoa com sangue AB é receptora universal mas não pode doar para os outros tipos. 13. (Unifesp) Um exemplo clássico de alelos múltiplos é o sistema de grupos sangüíneos humano, em que o alelo IÞ, que codifica para o antígeno A, é co-dominante sobre o alelo Iß, que codifica para o antígeno B. Ambos os alelos são dominantes sobre o alelo i, que não codifica para qualquer antígeno. Dois tipos de soros, anti-A e anti-B, são necessários para a identificação dos quatro grupos sangüíneos: A, B, AB e O. a) Quais as freqüências dos alelos M e N nessa população? b) Essa população está em equilíbrio de Hardy-Weinberg para esse loco gênico? MN de grupos sanguíneos. Os dados obtidos compõem a tabela a seguir:

15. (Unicamp) Na eritroblastose fetal ocorre destruição das hemácias, o que pode levar recém-nascidos à morte. a) Explique como ocorre a eritroblastose fetal. b) Como evitar sua ocorrência? c) Qual o procedimento usual para salvar a vida do recém-nascido com eritroblastose fetal?

54

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
a) Os gráficos a seguir mostram a variação da concentração de anticorpos contra um determinado antígeno no sangue de uma pessoa, em função do tempo, em duas condições: vacinação ou soroterapia.

16. (Ufrj) Nas transfusões sangüíneas, o doador deve ter o mesmo tipo de sangue que o receptor com relação ao sistema ABO. Em situações de emergência, na falta de sangue do mesmo tipo, podem ser feitas transfusões de pequenos volumes de sangue O para pacientes dos grupos A, B ou AB. Explique o problema que pode ocorrer se forem fornecidos grandes volumes de sangue O para pacientes A, B ou AB.

17. (Unesp) Um casal tem cinco filhos: Alex, Pedro, Mário, Érica e Ana. Dois dos irmãos são gêmeos univitelinos. Érica, um dos gêmeos, sofreu um acidente e precisa urgentemente de uma transfusão de sangue, e os únicos doadores disponíveis são seus irmãos. Na impossibilidade de se fazer um exame dos tipos sangüíneos, responda: a) Entre seus irmãos, qual seria a pessoa mais indicada para ser o doador? b) Justifique sua resposta. 18. (Uerj) No quadro a seguir, as duas colunas da direita demonstram esquematicamente o aspecto "in vitro" das reações no sangue dos indivíduos de cada grupo sangüíneo ABO aos anti-A e Anti-B. Um dos gráficos mostrados corresponde à variação da concentração de anticorpo antiofídico no sangue de uma pessoa mordida por uma serpente e tratada com uma dose do soro apropriado. Justifique por que esse tratamento deve ser feito logo após a picada do animal e, por que, em casos mais graves, deve ser repetido a intervalos de tempo relativamente curtos.

b) Na eritroblastose fetal, a mãe produz anticorpos contra o fator Rh do filho. A doença só se manifesta, porém, a partir da segunda gravidez. Indique a condição que deve estar presente no feto para o desenvolvimento da eritroblastose em filhos de mulheres que não produzem fator Rh. Explique por que, mesmo nessas circunstâncias, o primeiro filho nunca é afetado.

GABARITO

1. a) Não, porque a criança herdou o gene Iß de seu pai verdadeiro e a) Explique o fenômeno que ocorreria com as hemácias de um indivíduo do grupo A ao receber sangue de um indivíduo do grupo B. b) Sabe-se que o aglutinogênio é uma proteína da membrana das hemácias. Explique por que a aglutinação não ocorreria se o aglutinogênio fosse uma proteína citoplasmática. 19. (Uerj) A função do sistema imunológico é a de defender o organismo contra invasores. Bactérias, vírus, fungos, tecidos ou órgãos transplantados, e mesmo simples moléculas, podem ser reconhecidos pelo organismo como agentes agressores. b) Eugênio é geneticamente do grupo A, sendo filho de mãe O (ii), seu genótipo é IÞi. Casado com mulher O (ii) poderá ter filhos dos 2. a) Eugênio passa a produzir hemácias do grupo B, já que teve sua medula óssea original completamente destruída antes do transplante. b) A (IÞi) ou O (ii). não de Chaplin que pertencia ao grupo O (ii).

55

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
8. a) O indivíduo I-1 pertence ao grupo B.

grupos A (IÞi) e O (ii) com 50% de chances para cada grupo. A probabilidade de ter filhos do grupo B é, portanto, igual a zero.

3. a) Antígenos são substâncias orgânicas produzidas pelos seres vivos que se comportam como estranhos ao serem inoculados em outro organismo; gerando uma reação imunológica.

b) O genótipo do indivíduo II-5 é IÞi.

c) Não. Lalau pertence ao grupo A e só poderia receber transfusão dos grupos A e O e seu genro pertence ao grupo B.

b) A identificação dos antígenos nas hemácias humanas tem a finalidade de se evitar transfusões incorretas. O receptor poderá possuir anticorpos (aglutininas) específicos contra o antígeno doado, gerando a aglutinação dos glóbulos vermelhos recebidos na transfusão. e) P(menina do grupo B) = 1/2 . 1/4 = 1/8. d) O indivíduo III-5 não poderá pertencer ao grupo AB pois é pai de filho O.

4. Paulo foi o 1¡. marido e é o pai dos dois primeiros filhos pois José é do grupo AB e não poderia ter filhos do grupo O, como a segunda criança nascida desta mulher.

9. 37 %

10. a) P (AB) = 1/4 P (Rh®) = 1/2

5. a) Orlando AO gametas A, O

P (ABRh®) = 1/4 . 1/2 = 1/8 P (2 ABRh®) = 1/8 . 1/8 = 1/64

b) 1/8 porque cada nascimento é um evento independente.

X

11. a) Um homem do grupo sangüíneo B pode ser heterozigoto (Ißi) e, portanto, pai de criança do grupo O (ii).

Leila BO gametas B, O

b) Se o homem fosse do grupo AB, com genótipo IÞIß, não poderia ser o pai de criança O (ii). c) O teste de DNA é capaz de comparar as seqüências de bases nitrogenadas de "pais" e "filhos" com acerto de 99,9%. Se as

b) 1/4. As possibilidades de combinação dos alelos de aglutinogênio entre os gametas de Orlando e Leila são: filho: (1/4) AB, (1/4) AO, (1/4) BO, (1/4) OO.

seqüências forem idênticas, o indivíduo testado certamente é o pai biológico da criança.

12. a) Pode ocorrer através da tipagem sangüínea e mistura com o Logo P (AB) representa 1/4. soro que contém os anticorpos de cada tipo sanguíneo, na qual a aglutinação do sangue determina a presença do antígeno. 6. Caso 1 - pais impossíveis - B e O Caso 2 - pai impossível - 0 Caso 3 - pai impossível - AB b) O grupo O apresenta todos os anticorpos, por isso não pode receber de outro tipo. O grupo AB apresenta todos os antígenos por isso não pode doar para nenhum outro tipo.

7. a) Doaldo. b) Não possui aglutininas anti-A e anti-B. c) Cassilda: anti-A, Saildo: anti-B

13. a) Observe o quadro a seguir:

56

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
- banhos de luz para diminuir a icterícia causada pela destruição das hemácias fetais; - nutrição adequada para reverter o quadro de anemia.

16. O sangue do tipo O possui aglutininas anti-A e anti-B. Com transfusões de pequeno volume, essas aglutininas ficam muito diluídas no sangue do receptor, o que não acarreta problemas. Por outro lado, se o volume do sangue O doado for grande, essas aglutininas atingem concentrações que provocam a aglutinação das hemácias do receptor, causando entupimento dos capilares e outros problemas decorrentes das transfusões incompatíveis. b) Cada indivíduo possui um par de cromossomos homólogos que, por sua vez, apresentam os genes alelos. 17. a) Ana. b) Gêmeos univitelinos se originam à partir de um único ovo e são 14. N¡. total de alelos na população = 12258 (cada pessoa tem dois alelos) genéticamente idênticos. São do mesmo sexo e pertencem ao mesmo grupo sanguíneo.

N¡. de alelos M = 6613 N¡. de alelos N = 5645

18. a) Sofreria a reação com as aglutininas A. b) Porque o aglutinogênio não estaria acessível às aglutininas.

freqüência do alelo M = 6613/12258 = 0,54 freqüência do alelo N = 5645/12258 = 0,46

19. a) Porque o soro antiofídico já apresenta os anticorpos apropriados prontos, produzidos em outro animal. Quando administrado logo após a picada, atingem rapidamente níveis

A população está em equilíbrio porque as freqüências se aproximam da distribuição binomial (p + q)£ = 1, sendo p a freqüência do alelo M e q a freqüência do alelo N.

elevados no sangue, neutralizando prontamente a toxina da serpente. No entanto, esses níveis também caem rapidamente, como mostrado no gráfico 1. Por essa razão, nos casos mais graves, a aplicação deve ser repetida até que toda a toxina inoculada seja neutralizada.

15. a) A eritroblastose fetal ocorre por incompatibilidade do fator Rh entre a mãe Rh-, sensibilizada por transfusão sanguínea Rh® ou através do parto de uma criança Rh®, e o feto Rh®. Os anticorpos (anti Rh®) produzidos pela mãe sensibilizada destroem os glóbulos vermelhos fetais. b) O feto deve ser capaz de produzir fator Rh, ou seja, ser Rh®. Como a produção inicial de anticorpos pela mãe Rh- contra o fator Rh fetal é pequena, esses anticorpos não chegarão a transpor com eficiência, na primeira gestação, a barreira placentária que separa a circulação materna da fetal. b) Pode-se evitar a ocorrência da eritroblastose fetal através de injeções de soro contendo anti-Rh. O anti-Rh destrói os glóbulos vermelhos fetais - com o antígeno Rh - que circulam no sangue materno.

c) O tratamento usual para a criança afetada pela doença consiste em: - transfusão Rh- em substituição ao sangue Rh® que contém os anticorpos maternos;

57

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO

Lista 5
TEXTO PARA AS PRÓXIMAS 2 QUESTÕES. (Uerj 2001) O experimento clássico de Meselson e Stahl, em 1957, demonstrou que a replicação do DNA era semiconservativa, ou seja, cada fita do DNA serve de molde para sua própria duplicação, formando moléculas de DNA idênticas à original. Nesse experimento, os cientistas cultivaram células de 'Escherichia coli' inicialmente em presença de fonte de ¢¥N (isótopo de nitrogênio leve), trocando, a seguir, por ¢¦N (isótopo pesado), que é incorporado às bases nitrogenadas do DNA. Colheram, então, amostras de DNA após a primeira e a segunda gerações de células crescidas em ¢¦N e analisaram essas amostras quanto à densidade do DNA formado. Considere como PESADO o DNA dupla hélice marcado com ¢¦N; como LEVE o marcado com ¢¥N; como INTERMEDIÁRIO o marcado com ¢¥N e ¢¦N. 4. (Uerj 98) O gráfico a seguir demonstra a distribuição citoplasmática do número de ribossomas isolados e polirribossomas, em comparação com o número de cadeias polipeptídicas em formação durante um certo período de tempo.

1. Justifique por que, após a troca da fonte de nitrogênio, a primeira geração de células foi totalmente constituída com DNA dupla hélice do tipo INTERMEDIÁRIO.

2. Calcule as proporções dos três tipos de DNA dupla hélice - LEVE, INTERMEDIÁRIO E PESADO - formados em células da segunda geração, após a troca da fonte de nitrogênio. 3. (Fuvest 89) O desenho a seguir mostra a síntese de um polipeptídio a partir da molécula de DNA num certo organismo. Esse organismo é um procarioto ou um eucarioto? Por quê? a) Defina a relação existente entre os ribossomas isolados e a formação das cadeias polipeptídicas. Justifique sua resposta. b) Descreva a estrutura das cadeias polipeptídicas e a dos polirribossomas. (Adaptado de ALBERTS, Bruce & outros. "Molecular biology of the cell". New York, Garland Publishing, 1994, p.239)

58

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
nitrogenadas devem existir neste DNA e em que proporções? Justifique sua resposta.

5. (Unicamp 96) Um certo tipo de macromolécula destinada à membrana plasmática celular, depende de etapas nucleares e citoplasmáticas para sua produção, de acordo com os percursos esquematizados a seguir:

9. (Fuvest 2004) Bactérias (Escherichia coli) foram cultivadas durante várias gerações em um meio de cultura na qual toda a fonte de nitrogênio era o isótopo pesado ¢¦N. De uma amostra dessas bactérias (amostra A), extraiu-se o DNA que foi submetido a uma técnica de centrifugação que permite separar moléculas de DNA de acordo com sua densidade. O restante das bactérias foi transferido para um meio de cultura em que todo o nitrogênio disponível era o isótopo normal ¢¥N. Retirou-se uma segunda amostra (amostra B), quando as bactérias completaram uma divisão celular nesse novo meio e uma terceira amostra (amostra C), quando as bactérias completaram duas divisões celulares. O DNA das bactérias das amostras B e C foi também extraído e centrifugado.

a) Por que essas etapas começam no núcleo? b) Qual é a composição da macromolécula ao final do percurso I? E do percurso II? Esclareça a diferença, baseando-se nas funções das organelas citoplasmáticas envolvidas em cada percurso.

6. (Unicamp 92) Ribossomos são formados por RNA e proteínas, sintetizados pelos processos de transcrição e tradução, respectivamente. a) Onde esses processos ocorrem na célula eucariótica? b) O que acontecerá com os processos de transcrição e tradução, se ocorrer uma inativação na Região Organizadora do Nucléolo? Justifique. A figura mostra o resultado da centrifugação do DNA das três 7. (Unesp 2003) Criadores e sitiantes sabem que a mula (exemplar fêmea) e o burro (exemplar macho) são híbridos estéreis que apresentam grande força e resistência. São o produto do acasalamento do jumento ('Equus asinus', 2n = 62 cromossomos) com a égua ('Equus caballus', 2n = 64 cromossomos). a) Quantos cromossomos têm o burro ou a mula? Justifique sua resposta. b) Considerando os eventos da meiose I para a produção de gametas, explique por que o burro e a mula são estéreis. amostras de bactérias. a) Por que, na amostra B, todo o DNA tem uma densidade intermediária entre o que é constituído apenas por ¢¥N e o que contém apenas ¢¦N? b) Considerando que, na amostra C, a quantidade de DNA separada na faixa inferior é X, que quantidade de DNA há na faixa superior?

8. (Fuvest 95) No DNA de um organismo, 18% das bases nitrogenadas são constituídas por citosina. Que outras bases

59

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO

10. (Uerj 97) CÉLULAS IMORTAIS CONTAM AOS CIENTISTAS HISTÓRIA DA EVOLUÇÃO DA HUMANIDADE

Estas células formam um livro, conservado em tanques de nitrogênio líquido que guarda informações desconhecidas sobre a humanidade. Os capítulos contam diferentes detalhes da saga do homem na terra: suas andanças pelos continentes, casamentos ancestrais e os ataques de doenças. (adaptado de, "O Globo")

a) Explique por que o processo de autoduplicação do DNA dá significado à hereditariedade permitindo revelar a história da evolução da humanidade. b) "... suas andanças pelos continentes, casamentos ancestrais e os ataques de doenças" podem ser estudados através de observações de características morfológicas e fisiológicas da célula. Nomeie o processo através do qual o DNA é capaz de controlar e interferir nas características morfológicas e fisiológicas da célula. 11. (Uerj 99) Em células eucariotas mantidas em cultura, adicionouse o nucleosídeo uridina marcado radioativamente com H¤ ao meio de cultura. Após algum tempo, as células foram transferidas para um novo meio que não continha o isótopo. Amostras destas células foram retiradas 3, 15 e 90 minutos após a transferência, sendo, então, colocadas em lâmina de vidro, fixadas e submetidas a autoradiografia. Esse processo marca a posição aproximada do isótopo dentro da célula, como representado no esquema a seguir. Explique por que, entre essas células: a) as características genotípicas são iguais; b) as características fenotípicas são diferentes. 12. (Uerj 2006) Num experimento, foram comparadas as características genotípicas e fenotípicas de células retiradas de um tecido de anfíbio, ainda no estágio de girino, com as de células de tecido similar do mesmo indivíduo após atingir a idade adulta. b) Nomeie o compartimento celular que seria marcado, se o nucleosídeo radioativo usado fosse a timidina e justifique sua resposta. a) Cite o tipo de molécula à qual a uridina se incorporou. Justifique sua resposta.

13. (Ufal 99) Para desempenhar sua função como material hereditário, o DNA possui duas propriedades. Identifique-as e descreva resumidamente cada uma delas.

60

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
16. (Ufrj 96) O teste de tipagem de DNA revelou que nos seres humanos existe individualidade genômica. Isto significa que cada indivíduo possui variações discretas e características na seqüência de seu DNA, ou seja, a seqüência de nucleotídeos do DNA de cada pessoa é única (excetuando-se o caso de gêmeos monozigóticos).

14. (Uff 99) A mutação em um gene humano provoca cegueira. Com a utilização de técnicas de genética clássica e molecular, verificou-se que este gene está localizado no genoma mitocondrial. Sabe-se que todas as mitocôndrias dos indivíduos afetados pela cegueira não possuem o gene normal, mas sim o gene mutado.

a) Informe a percentagem de filhas e filhos cegos de um casal: I) cuja mulher é normal e o homem é cego; II) cuja mulher é cega e o homem é normal.

Assim, a tipagem do DNA revela um padrão de bandas que é estável (presente no DNA de todos os tecidos) e é transmitido aos descendentes seguindo as leis de Mendel.

b) Justifique as respostas ao item a.

Graças a essas características é possível atualmente realizar testes de paternidade que comparam os padrões de bandas de DNA das

15. (Ufrj 96) O genoma da bactéria "Escherichia coli" tem um tamanho de 4×10§ pares de nucleotídeos. Já o genoma haplóide humano tem 3×10ª pares de nucleotídeos. Para replicar o genoma, antes da divisão celular, existe uma enzima, a DNA polimerase, cuja velocidade de reação é equivalente a cerca de 800 nucleotídeos/s.

pessoas e revelam se um homem é de fato o pai biológico de uma outra pessoa.

Suponha agora a seguinte situação: um homem acusado de ser o pai de uma criança tenta burlar o teste de tipagem de DNA; um amigo o aconselha a receber uma transfusão de sangue 2 meses antes do teste

Assim, para replicar todo o genoma de uma bactéria, a DNA polimerase consumiria cerca de 83 minutos e, para o genoma humano, aproximadamente 43 dias!

(em geral colhe-se o sangue como fonte de células nucleadas).

a) Qual a influência da transfusão sugerida no resultado do exame? b) Que precauções podem ser tomadas para desmascarar a tentativa

Sabemos, no entanto, que o tempo de geração da "E.coli" é de cerca de 20 minutos, e que o tempo médio de replicação de uma célula eucariota é de 12 horas.

de fraude?

17. (Ufrj 99) A tipagem de DNA é uma técnica desenvolvida recentemente que permite identificar e estabelecer o grau de

Assumindo que a DNA polimerase apresenta uma velocidade de reação constante para todas as espécies analisadas, explique essa aparente contradição.

parentesco entre indivíduos. Para se realizar uma análise patrilínea, isto é, a investigação dos ancestrais paternos, usa-se um marcador do cromossomo Y, que não se altera ao longo das gerações (salvo em casos de mutações). Por outro lado, para uma análise matrilínea (materna), lança-se mão do DNA mitocondrial. Por que o DNA mitocondrial deve ser usado para a análise matrilínea?

61

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
21. (Ufrrj 99) Considerando as propriedades de duplicação do DNA, observe o resultado do experimento a seguir.

18. (Ufrj 2001) No ADN, a transcrição dos genes não está restrita a somente uma das suas cadeias. Para alguns genes, a seqüência de nucleotídeos transcrita pode estar em uma cadeia, ao passo que a seqüência do outro gene pode estar localizada na cadeia oposta. No entanto, sabe-se que no mesmo trecho nunca ocorre a transcrição simultânea das duas cadeias de uma molécula de ADN. Tal evento inibiria o processo da tradução.

1• etapa: Em uma cultura com ¢¦N, obtém-se o crescimento de colônias de bactérias; após esse crescimento promove-se o desenvolvimento de mais duas gerações, em cultura com ¢¥N.

2• etapa: Extrai-se o DNA de todas as bactérias e obtém-se o seguinte Explique por que ocorreria a inibição da tradução se a transcrição de uma cadeia do ADN ocorresse ao mesmo tempo em que a transcrição da sua cadeia complementar, no mesmo trecho. - Cultura de crescimento com ¢¦N: 300 moléculas de DNA todas com ¢¦N. 19. (Ufrj 2004) Estudos recentes compararam as seqüências completas de DNA mitocondrial de indivíduos de várias regiões geográficas do planeta. - Cultura de 1• geração com ¢¥N: 600 moléculas de DNA todas com ¢¦N e ¢¥N. resultado:

Os resultados revelaram que a variabilidade genética no DNA mitocondrial de indivíduos africanos era quase o dobro da observada no DNA mitocondrial de não-africanos. Esses resultados foram importantes para corroborar a idéia de que o ancestral comum mais recente do 'Homo sapiens' viveu na África há cerca de 200.000 anos.

- Cultura de 2• geração com ¢¥N: 1200 moléculas de DNA nas quais 600 com ¢¥N e 600 com ¢¦N e ¢¥N.

Explique as porcentagens obtidas em todos os extratos das diferentes culturas no experimento. Justifique sua resposta.

Explique por que a maior diversidade do DNA mitocondrial apóia a idéia da origem africana do 'Homo sapiens'.

20. (Ufrj 2005) A soma das porcentagens de guanina e citosina em uma certa molécula de ADN é igual a 58% do total de bases presentes.

a) Indique as porcentagens das quatro bases, adenina (A), citosina (C), guanina (G) e timina (T), nessa molécula. b) Explique por que é impossível prever a proporção de citosina presente no ARN mensageiro codificado por esse trecho de ADN.

62

salabioquimica.blogspot.com
a seguinte composição de bases:

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
24. (Unicamp 97) Em 1952, Hershey e Chase cultivaram bactérias em meio de cultura contendo fósforo radioativo (¤£P) e colocaram bacteriófagos (vírus) para infectar essas células. Os novos

22. (Unesp 90) A análise química de duas moléculas de DNA revelou

Molécula A 23% de adenina, 23% de timina, 27% de citosina e 27% de guanina;

bacteriófagos formados estavam marcados radioativamente. Estes bacteriófagos marcados foram utilizados para infectar outras células bacterianas cultivadas sem a presença de fósforo radioativo. A marcação radioativa foi detectada dentro destas bactérias.

a) Como se explica que o fósforo radioativo tenha passado para o Molécula B 23% de adenina, 23% de timina, 27% de citosina e 27% de guanina. bacteriófago? b) Como se explica que as bactérias cultivadas sem a presença de fósforo radioativo tenham sido marcadas? c) Se, em vez de fósforo, tivesse sido usado enxofre radioativo (¤¦S) para marcação de proteínas, os resultados seriam os mesmos? Justifique. Com base nestes dados: a) O que se pode afirmar a respeito das semelhanças entre estas duas moléculas de DNA? b) Justifique sua resposta. 25. (Unicamp 2005) Em 25 de abril de 1953, um estudo de uma única página na revista inglesa "Nature" intitulado "A estrutura molecular dos ácidos nucléicos", quase ignorado de início, revolucionou para sempre todas as ciências da vida sejam elas do homem, rato, planta 23. (Unesp 97) A análise química em amostras de cinco lâminas com ácidos nucléicos apresentou os seguintes resultados: ou bactéria. James Watson e Francis Crick descobriram a estrutura do DNA, que permitiu posteriormente decifrar o código genético determinante para a síntese protéica. 1¡. lâmina: ribose 2¡. lâmina: uracila 3¡. lâmina: dupla-hélice 4¡. lâmina: timina 5¡. lâmina: 15% de guanina e 25% de citosina. a) Watson e Crick demonstraram que a estrutura do DNA se assemelha a uma escada retorcida. Explique a que correspondem os "corrimãos" e os "degraus" dessa escada. b) Que relação existe entre DNA, RNA e síntese protéica? c) Como podemos diferenciar duas proteínas? a) Entre estas lâminas, quais se referem a DNA? b) Justifique o resultado obtido com a 5¡. lâmina. 26. (Unifesp 2003) Cientistas criaram em laboratório um bacteriófago (fago) composto que possui a cápsula protéica de um fago T2 e o DNA de um fago T4. Após esse bacteriófago composto infectar uma bactéria, os fagos produzidos terão

a) a cápsula protéica de qual dos fagos? E o DNA, será de qual deles? b) Justifique sua resposta.

63

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
28. (Unirio 2002) A figura a seguir mostra um trecho da estrutura do ácido desoxiribonucléico, ressaltando a interação entre as duas cadeias do polímero. Na figura, A, C, G & T representam as bases adenina, citosina, guanina e timina, respectivamente.

27. (Unifesp 2003) No heredograma seguinte, a pessoa A possui uma mutação no DNA de todas as suas mitocôndrias, que faz com que a produção de energia para os músculos seja deficiente, ocasionando dificuldades motoras para os portadores do problema. Essa pessoa casou-se com outra, aparentemente normal. O casal (P) teve filhos (F1) e estes, por sua vez, também tiveram filhos (F2).

a) Copie o heredograma, pintando quais serão as pessoas afetadas pela doença em F1 e em F2 b) Justifique sua resposta.

As linhas pontilhadas indicam as pontes de hidrogênio que são formadas entre as bases aminadas e que contribuem para manter unidas as duas cadeias do DNA. Essas pontes de hidrogênio podem ser rompidas por calor, o que produz a dissociação das cadeias. Esse processo reversível chama-se de desnaturação. A temperatura necessária para desnaturar o DNA depende de vários fatores, mas um deles é a composição dos nucleotídeos de um determinado DNA. Observe as duas seqüências de DNA a seguir e determine qual delas precisará de uma temperatura de desnaturação maior. Justifique a sua resposta.

1) ACTTTAAAGATATTTACTTAAA TGAAATTTC TATAAATGAATTT

2) GCTAGGCCGATGCGGCGTGGA CGATCCGGCTACGCCGCACCT 29. (Unitau 95) Considerando o modelo da estrutura molecular do DNA como representado na figura adiante, responda o que representam os componentes 1, 2 e 3, respectivamente.

64

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO

30. (Fuvest 92) De que maneira o DNA determina a seqüência de aminoácidos das moléculas de proteínas? 31. (Fuvest 96) Uma doença genética de herança dominante é causada por mutações em um gene localizado em um autossomo. Os indivíduos A, B e C têm mutações em um segmento de DNA desse gene, cuja seqüência normal está representada a seguir. Usando a tabela que relaciona alguns códons aos respectivos aminoácidos e considerando que a fita molde a ser transcrita é aquela assinalada com a letra m, responda: a) Quais serão os segmentos de proteínas produzidos, respectivamente, pelos indivíduos A, B e C? b) Como será o fenótipo (normal ou afetado dos indivíduos A, B e C? Por quê? Seqüência normal CAA AAC TGA GGA ATG CAT TTC (m) GTT TTG ACT CCT TAC GTA AAG Indivíduo A CAA AAC TGA GGA ATT CAT TTC (m) GTT TTG ACT CCT TAA GTA AAG Indivíduo CAT AAC TGA GGA ATG CAT TTC (m) GTA TTG ACT CCT TAC GTA AAG Indivíduo CAA TAC TGA GGA ATG CAT TTC (m) GTT ATG ACT CCT TAC GTA AAG

32. (Ueg 2007) O esquema a seguir é uma representação do código genético.

De acordo com o esquema apresentado, responda ao que se pede. a) O que é o código genético? b) Explique por que se diz que ele é degenerado.

65

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO

33. (Uff 2004) O fumo está relacionado ao aumento de risco para o câncer de pulmão. O hábito de fumar expõe os fumantes a substâncias com atividade carcinogênica. O Benzo[a]pireno, um dos principais agentes carcinogênicos presentes na fumaça do cigarro, tem a capacidade de promover mutações no DNA levando a mudança da base Guanina para Timina. Suponha que um trecho da fita molde de DNA do gene X, representado a seguir, possa ser alterado em presença do Benzo[a]pireno, em um dos dois sítios indicados na figura 1. Considere que o RNA mensageiro seja formado a partir das trincas mostradas no esquema da figura 1 a seguir. Indique as alterações que ocorrerão na síntese da proteína X quando a mutação for localizada nos diferentes sítios, justificando cada resposta com a utilização do código genético da figura 2: b) Utilize um exemplo de alteração estrutural da globina humana (cadeia beta) para explicar como uma mutação pontual, do tipo substituição, pode afetar a saúde e a qualidade de vida do portador dessa mutação.

35. (Ufrj 97) O ADN é um polímero constituído por vários nucleotídeos e as proteínas são polímeros constituídos por vários aminoácidos. Um gene é constituído por um número N de nucleotídeos que codifica uma proteína constituída por P aminoácidos. Por que sempre encontramos N > P?

36. (Ufrj 99) Com o auxílio da tabela do código genético representada a seguir, é sempre possível deduzir-se a seqüência de aminoácidos de uma proteína a partir da seqüência de nucleotídeos 34. (Ufg 2005) As globinas constituem um bom exemplo da importância da informação genética na estrutura primária e na função das proteínas. do seu gene, ou do RNA-m correspondentes.

a) Considere o segmento de DNA, cuja seqüência de nucleotídeos é 5' - GTG - CAC - CTG - ACT - CCT - GAG - GAG - AAG - 3' e, utilizando-se da tabela do código genético apresentada a seguir, forneça o produto da síntese protéica (polipeptídio parte da cadeia beta prevista para a globina humana).

Entretanto, o oposto não é verdadeiro, isto é, a partir da seqüência de aminoácidos de uma proteína, não se pode deduzir a seqüência de nucleotídeos do gene. Explique por quê.

66

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
Analise a tabela e faça o que se pede: a) Cite o nome da enzima que catalisa a síntese de RNA mensageiro. b) Cite a seqüência do anticódon correspondente ao códon de iniciação. c) Qual a seqüência de aminoácidos que resultará da tradução da molécula de RNA mensageiro? Ver figura anterior. d) Qual a seqüência de aminoácidos que resultará da tradução da mesma molécula de mRNA, após uma deleção do TERCEIRO nucleotídeo?

37. (Ufv 2000) Considere a tabela abaixo, contendo códigos de trincas de bases do DNA com os aminoácidos correspondentes, para resolver os itens seguintes:

39. (Fuvest 2005) A seguir está representada a seqüência dos 13 primeiros pares de nucleotídios da região codificadora de um gene. a) Determine a seqüência de bases do RNAm que foi utilizado para sintetizar o polipeptídeo esquematizado abaixo da tabela.

--- A T G A G T T G G C C T G ----- T A C T C A A C C G G A C ---

b) Se ocorresse uma substituição, por uma purina, na 3• base do código correspondente ao 6¡. aminoácido do polipeptídeo, qual seria o aminoácido da tabela a ser incorporado?

A primeira trinca de pares de bases nitrogenadas à esquerda, corresponde ao aminoácido metionina. A tabela a seguir mostra alguns códons do RNA mensageiro e os aminoácidos codificados por cada um deles.

c) Qual é anticódon correspondente ao novo aminoácido incorporado? 38. (Ufv 2004) A tabela adiante representa uma versão fictícia do código genético. Entretanto, esse código segue o padrão do código genético universal, no qual três bases codificam um aminoácido.

a) Escreva a seqüência de bases nitrogenadas do RNA mensageiro, transcrito a partir desse segmento de DNA. b) Utilizando a tabela de código genético fornecida, indique a seqüência dos três aminoácidos seguintes à metionina, no polipeptídio codificado por esse gene. c) Qual seria a seqüência dos três primeiros aminoácidos de um polipeptídio codificado por um alelo mutante desse gene, originado pela perda do sexto par de nucleotídios (ou seja, a deleção do par de bases T = A)?

67

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO

40. (Uerj 2004) Analisando o genoma de alguns tipos de vírus formados por fita simples de RNA, encontramos aqueles que são RNA (-), como o do resfriado comum, e os que são RNA (+), como o da poliomielite. Observe que: - nos vírus RNA (-), apenas o RNA complementar a seu genoma é capaz de funcionar como mensageiro na célula infectada; - nos vírus RNA (+), o genoma viral funciona diretamente como mensageiro; - ambos os vírus necessitam, para sua replicação, da enzima RNA replicase, que sintetiza um RNA complementar a um molde de RNA; - o gene da enzima RNA replicase está presente no genoma dos dois tipos de vírus, mas a enzima só é encontrada nas partículas virais RNA (-). a) Explique por que é necessário, para sua replicação, que os vírus RNA (-) já contenham a enzima RNA replicase, enquanto os RNA (+) não precisam armazenar esta enzima. b) Apresente um argumento contrário à hipótese de que os vírus, devido à simplicidade de sua estrutura, foram precursores das primeiras células. a) Quantas uracilas e quantas guaninas comporão a fita do RNA mensageiro transcrito do DNA ativado? b) Quantos aminoácidos deverão compor a cadeia de polipeptídeos 41. (Ufrj 97) Em um organismo pluricelular com vários tecidos, como no caso dos seres humanos, todas as células possuem um genoma idêntico. Analogamente, é correto afirmar que os ARN mensageiros (ARNm) dos diferentes tecidos são todos idênticos? Justifique sua resposta 42. (Ufrj 98) Suponha um gene de um eucarioto responsável pela síntese de uma proteína. Nesse gene existem íntrons, ou seja, regiões do ADN cujas informações não estão presentes na proteína em questão. As regiões do ARN transcrito correspondentes aos íntrons são eliminadas após o processo de transcrição.A figura a seguir representa o resultado de uma experiência de hibridação do ARN mensageiro com a cadeia de ADN que lhe deu origem e responda: a) Qual será a seqüência do RNAm transcrito a partir deste DNA? b) O mesmo peptídio será obtido a partir deste RNAm e do RNAm da fita complementar? Explique. GTA GCC TAG 44. (Unicamp 94) Considere um fragmento de DNA com a seguinte seqüência de bases: que será formada? Justifique sua resposta. 43. (Unesp 2003) Em um segmento da cadeia ativa de DNA, que servirá de molde para a fita de RNA mensageiro, há 30 timinas e 20 guaninas. No segmento correspondente da fita complementar do DNA há 12 timinas e 10 guaninas. Levando-se em consideração essas informações, responda. A figura mostra cinco regiões, identificadas por números de 1 a 5. Quais dessas regiões correspondem aos íntrons? Justifique sua resposta.

68

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
48. (Fuvest-gv 91) Certos mutantes nutricionais do fungo Neurospora só conseguem crescer quando aminoácidos são adicionados ao meio de cultura. Na tabela a seguir, o sinal (+) significa crescimento, e o sinal (-) significa ausência de crescimento.

45. (Unifesp 2003) O jornal "Folha de S.Paulo" (23.09.2002) noticiou que um cientista espanhol afirmou ter encontrado proteínas no ovo fóssil de um dinossauro que poderiam ajudá-lo a reconstituir o DNA desses animais.

a) Faça um esquema simples, formado por palavras e setas, demonstrando como, a partir de uma seqüência de DNA, obtém-se uma proteína. b) A partir de uma proteína, é possível percorrer o caminho inverso e chegar à seqüência de DNA que a gerou? Justifique.

46. (Unirio 2002) Atualmente os genes podem ser desmembrados em três classes diferentes: os genes que expressam mRNA que codificam polipeptídios diversos; os genes reguladores que codificam proteínas que regulam outros genes; e uma terceira classe de genes que não codificam polipeptídios. Qual o produto final da classe de genes que não codificam polipeptídios? substrato ë (gene1) ë ornitina ë (gene2) ë 47. (Fuvest 93) O que são ácidos nucléicos? Como atuam na síntese de proteínas? Supondo que em cada mutante há apenas um gene alterado, explique o porquê do mutante Z só crescer quando se adiciona arginina ao meio de cultura. citrulina ë (gene3) ë arginina Sabe-se que as etapas que levam à síntese da arginina são:

69

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
50. (Uerj 2007) Diversas técnicas são utilizadas para determinar, em genes de uma célula eucariota, a seqüência de bases nitrogenadas codificantes, ou seja, aquela que define a estrutura primária da proteína a ser sintetizada. A abordagem experimental mais freqüente, hoje, consiste em, primeiramente, extrair os RNA-mensageiros da célula, sintetizar os seus DNA-complementares e, então, proceder ao seqüenciamento das bases presentes nesses DNA. Em uma bactéria, no entanto, é possível determinar a seqüência codificante diretamente a partir de seu cromossomo. Explique o motivo pelo qual, em organismos eucariotos, é preferível utilizar o RNA-mensageiro para determinar a região codificante do DNA.

49. (Uerj 2006) Para investigar possíveis efeitos de uma determinada droga, utilizou-se uma cultura de células, à qual foram adicionadas quantidades adequadas das seguintes substâncias, marcadas com isótopos: uridina ¢¥C, timidina ¤H e leucina ¢¦N. Após algum tempo, a droga foi também introduzida no meio de cultura. Ao longo do experimento, amostras das células foram coletadas a intervalos regulares. A incorporação dos isótopos foi medida em uma preparação que contém os ácidos nucléicos e as proteínas da célula. Os resultados do experimento estão mostrados no gráfico a seguir.

51. (Ufg 2007) Os gráficos a seguir representam o efeito inibitório de dois antibióticos (I e II) sobre a síntese protéica em culturas de 'Staphylococcus aureus'. As setas nos gráficos indicam o momento em que foram administrados os antibióticos nas culturas.

a) Considere as etapas de replicação, transcrição e tradução nas células analisadas. Indique se a droga interfere em cada uma dessas etapas e justifique suas respostas. b) As proteínas, após sintetizadas, adquirem uma conformação tridimensional. Cite duas ligações ou interações que atuam na manutenção da estrutura enovelada das proteínas. Com base nos gráficos, explique a atuação dos antibióticos I e II sobre a síntese protéica.

70

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
53. (Ufrj 2002) Nos procariotos, o sinal para o início da síntese das proteínas (tradução) é geralmente sinalizado no ARNm pelo códon AUG, que corresponde ao aminoácido metionina. No entanto, além do código AUG, existe uma seqüência curta de nucleotídeos que

52. (Ufrj 95) Na espécie humana há dois tipos de hemoglobinas, conhecidas como hemoglobinas A e S, que diferem apenas em um aminoácido:

Hemoglobina A: ...valina-histidina-leucina-treonina-prolina-ácido glutâmico...

antecede esse códon. Essa seqüência, que é chamada de ShineDalgarno, em homenagem aos pesquisadores que as detectaram, permite que o sítio correto de iniciação da tradução seja selecionado.

Hemoglobina S: ...valina-histidina-leucina-treonina-prolina-x...

O diagrama a seguir ilustra a localização dessa seqüência. A seqüência de Shine-Dalgarno está em vermelho e o códon de iniciação, em azul.

Essa pequena diferença é suficiente para determinar que uma pessoa portadora de hemoglobina S sofra de anemia falciforme.

Os códons de RNA-m que codificam esses aminoácidos são:

valina - GUU, GUG, GUC, GUA histidina - CAU, CAC leucina - UUG, UUA treonina - ACU, ACC, ACG, ACA prolina - CCU, CCC, CCG, CCA ácido glutâmico - GAG, GAA Explique a importância desse duplo controle da iniciação para a A mutação pode ocorrer no ADN como mostra o esquema a seguir: tradução correta da mensagem contida no ARNm.

54. (Ufrj 2008) Se extrairmos o DNA total de células de músculo, baço e rim de um mesmo indivíduo, verificaremos que os tecidos apresentam genomas idênticos. Os RNA mensageiros das células desses três tecidos serão os mesmos? Justifique sua resposta.

a) Qual é o aminoácido que aparece, na hemoglobina S, no lugar do ácido glutâmico? Justifique sua resposta. b) Todas as células, a partir da célula que sofre a mutação, serão anômalas? Justifique sua resposta.

71

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO

55. (Ufscar 2005) Nos anos 50 e 60, quando se iniciavam as pesquisas sobre como o DNA codificava os aminoácidos de uma proteína, um grupo de pesquisadores desenvolveu o seguinte experimento:

- Sintetizaram uma cadeia de DNA com três nucleotídeos repetidos muitas vezes em uma seqüência conhecida: ...AGCAGCAGCAGCAGCAGCAGCAGC... - Essa cadeia de DNA foi usada em um sistema livre de células, porém no qual haviam todos os componentes necessários à síntese protéica, incluindo os diferentes aminoácidos. - Nesse sistema, essa cadeia de DNA sempre produzia uma proteína com um único tipo de aminoácido. Diferentes repetições do experimento demonstraram que até três proteínas diferentes poderiam ser produzidas, cada uma delas com um único tipo de aminoácido: serina ou alanina ou glutamina. b) Pode-se dizer que seqüências idênticas de aminoácidos são sempre codificadas por seqüências idênticas de nucleotídeos? Justifique. a) Quantos nucleotídeos são necessários para codificar a seqüência de aminoácidos nas espécies 1 e 2? Justifique.

a) Por que as proteínas obtidas possuíam apenas um tipo de aminoácido? b) Por que foram obtidos 3 tipos de proteínas?

c) Considerando que as espécies 2, 3 e 4 se originaram da espécie 1, que tipo de mutação originou cada seqüência? 58. (Unicamp 2002) O esquema a seguir representa a seqüência de reações que levam à formação do pigmento da pelagem de uma

56. (Unicamp 98) O metabolismo celular é controlado por uma série de reações em que estão envolvidas inúmeras proteínas. Uma mutação gênica pode determinar a alteração ou a ausência de algumas dessas proteínas, levando a mudanças no ciclo de vida da célula. a) Explique a relação que existe entre gene e proteína. b) Por que podem ocorrer alterações nas proteínas quando o gene sofre mutação? c) Em que situação uma mutação não altera a molécula protéica? 57. (Unicamp 2000) Abaixo estão esquematizadas as seqüências de aminoácidos de um trecho de uma proteína homóloga, em quatro espécies próximas. Cada letra representa um aminoácido.

espécie animal. Os genes autossômicos A, B e C são responsáveis pela produção das enzimas A, B e C que atuam nesse processo metabólico. Mutações nos genes A, B e C produzem respectivamente os alelos recessivos a, b e c.

72

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
60. (Unirio 2002) Sabe-se que a bactéria 'E.coli' cresce mais rapidamente na presença da glicose (um monossacarídeo) do que na presença de lactose (um dissacarídeo). Isso se deve a dois fatos: primeiro, a lactose não é tão facilmente incorporada pelas bactérias; segundo, porque a lactose necessita ser hidrolisada pela enzima ’galactosidase em glicose e galactose. O gráfico a seguir resultou de experimento em que 'E.coli' foi inoculada num meio contendo uma mistura de glicose e lactose. As curvas no gráfico adiante representam a concentração da enzima ’-galactosidase, a concentração de glicose e o número de bactérias no meio de cultura em função do tempo.

a) Do ponto de vista genético, quantos tipos de albinismo podem ocorrer nessa espécie? Por quê?

b) Demonstre o fenótipo esperado de um cruzamento entre animais de linhagens puras com dois tipos diferentes de albinismo.

c) É possível ocorrer uma mutação em um gene sem que se altere a enzima correspondente? Justifique.

59. (Unifesp 2006) Uma fita de DNA tem a seguinte seqüência de bases 5'ATGCGT3'. a) Considerando que tenha ocorrido a ação da DNA-polimerase, qual será a seqüência de bases da fita complementar? b) Se a fita complementar for usada durante a transcrição, qual será a seqüência de bases do RNA resultante e que nome recebe esse RNA se ele traduzir para síntese de proteínas? 61. (G2) Descreva o experimento realizado por Hersey e Chase em 1952, conhecido como "experiência do liquidificador" na qual utilizaram isótopos radioativos de enxofre (S¤¦) e de fósforo (P¤£) para 'marcar' vírus parasitas de bactérias, bem como suas conclusões a partir deste trabalho. Identifique as curvas da figura, correlacione os parâmetros concentração de ’-galactosidase, concentração de glicose e número de bactérias e explique o comportamento da curva da enzima ’galactosidase.

73

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
64. (Ufc 2008) Uma biotecnologia conhecida como "construção antisenso" (sem sentido) foi utilizada para a produção de tomate transgênico. A transformação genética do tomateiro consistiu na incorporação (no genoma da planta) e na expressão de um segmento de DNA, que apresenta uma seqüência de nucleotídeos, complementar àquela do gene natural. Esse gene natural codifica para a produção de uma enzima, essencial à biossíntese do etileno. Com base no exposto, responda as questões a seguir.

62. (Ufrj 2004) Após tratar culturas de bactérias com doses de um agente mutagênico capaz de induzir uma única mutação pontual (que afeta apenas um nucleotídeo por célula), analisou-se a seqüência de aminoácidos de uma determinada proteína em diversos mutantes gerados. Verificou-se que um desses mutantes produzia uma dada proteína que diferia da original pela ausência de 35 aminoácidos em uma das extremidades da cadeia peptídica.

Explique como essa única mutação pontual pode fazer com que a síntese da proteína seja interrompida prematuramente. a) Qual o resultado da transcrição do gene natural (I) e do "gene antisenso" (II), presentes no segmento de DNA (molde) das plantas 63. (Ufrj 2007) As seqüências de RNA mensageiro a seguir codificam peptídeos com atividades biológicas específicas. Suponha que mutações no DNA tenham causado as seguintes mudanças nas duas moléculas de mRNA (1 e 2). A tabela resumida do código genético mostra alguns códons e seus aminoácidos correspondentes. b) Segundo as regras de emparelhamento dos pares de bases, que fenômeno ocorrerá como resultado do encontro, no citoplasma, entre esses dois RNA mensageiros, determinados no item anterior, e qual a conseqüência para o processo de tradução? modificadas, mostrado a seguir? 3'___ATTCGGC___TAAGCCG___TAAGCCG___5'(DNA)

c) A transformação genética foi realizada de modo que a expressão do "gene anti-senso" ocorra apenas nos tecidos do ovário floral. Qual o resultado final mais provável de todo esse processo?

d) Qual a principal vantagem para os produtores de tomate que passarem a utilizar essas plantas transgênicas?

GABARITO
Em qual das mudanças (1 ou 2) há risco de perda ou de diminuição da atividade biológica? Justifique sua resposta.

1. Na primeira geração, cada hélice do DNA que contém ¢¥N molda a sua hélice complementar usando bases com ¢¦N. Forma-se, portanto, DNA dupla hélice do tipo intermediário.

2. leve = zero intermediário = 50% pesado = 50%

3. Procarioto porque não existe a carioteca separando o material genético (DNA) do citoplasma, onde se localizam os ribossomos.

74

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
10. a) O DNA produz cópias idênticas de si mesmo. b) Síntese protéica.

4. a) Em ribossomos isolados não há síntese de cadeias polipeptídicas. O RNA mensageiro é necessário pois transmite a mensagem genética para a síntese dos polipeptídeos.

11. a) Tipo de molécula: ácido ribonucléico (RNA) b) Polipeptídeos são formados a partir do encadeamento de aminoácidos. Polirribossomos são constituídos de ribossomos ligados ao RNA mensageiro. Justificativa: a uridina se incorpora ao ácido ribonucléico. Este ácido é principalmente sintetizado no nucléolo, deslocando-se posteriormente para o citoplasma.

5. a) O núcleo contém DNA que comanda a produção das proteínas através da síntese de RNA. b) Proteínas e Glicoproteínas porque os ribossomos produzem as proteínas que são associadas aos açúcares no Complexo de Golgi.

b) Compartimento: núcleo Justificativa: a timidina é exclusiva do DNA, encontrado principalmente no núcleo.

12. a) Porque elas possuem DNA idênticos. 6. a) Transcrição no núcleo ao nível dos cromossomos e tradução no citoplasma ao nível dos ribossomos. b) Sem a região organizadora do nucléolo não haverá RNA ribossômico, matéria-prima para a produção destes organóides e, conseqüentemente, cessará a síntese de proteínas na célula. 13. REPLICAÇÃO: duplicação do material genético (DNA), 7. a) Os animais têm 2n = 63 cromossomos, porque são resultantes da união de espermatozóide, com n = 31 cromossomos, e óvulo, com n = 32 cromossomos. b) Os cromossomos são de 2 espécies diferentes e, portanto, não ocorre pareamento dos chamados cromossomos homólogos, impossibilitando a meiose e a gametogênese. 14. a) TRANSCRIÇÃO: síntese de RNA, relacionada com o controle das atividades celulares através da síntese de proteínas. relacionado com a transmissão das características hereditárias. b) Porque, embora essas células possuam o mesmo DNA, diferentes genes podem ser ativados ou não durante as etapas do desenvolvimento do indivíduo.

8. Na fita deverá existir 18% de guanina, 32% de adenina e 32% de timina.

I) filhas: 0% filhos: 0%

O DNA é formado por uma dupla cadeia de polinucleotídeos. Sabendo-se que as cadeias são complementares e o pareamento é sempre adenina com timina e citosina com guanina, a quantidade de citosina de ser igual a de guanina e a quantidade de adenina de ser igual a de timina.

II) filhas: 100% filhos: 100%

b) Em seres humanos, a herança do genoma mitocondrial é, exclusivamente, materna, pois as mitocôndrias do espermatozóide não penetram no óvulo. Portanto, o pai não transmitirá esta

9. a) no tubo B a densidade é intermediária devido a presença do isótopo normal e do isótopo pesado, dada a característica do DNA ser semiconservativo. b) na faixa superior, há X de DNA, com densidade menor (isótopo normal).

característica (cegueira) para a sua prole. Por outro lado, no caso de a mãe ser afetada (cega), esta característica será transmitida para todos os seus filhos.

75

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
A justificativa se baseia na propriedade semiconservativa da duplicação do DNA.

15. Várias moléculas de DNA-polimerase iniciam a replicação do DNA, simultâneamente, em diversos sítios do genoma denominados sítios de origem de replicação.

22. A única afirmação possível, face aos dados, é que as duas 16. a) A influência pode ser crucial pois é analisado o DNA fornecido por células nucleadas, como os glóbulos brancos, que podem viver muitos anos e se duplicar ativamente. b) A fraude pode ser evitada colhendo-se células brancas da medula óssea vermelha do indivíduo a ser testado. 23. a) Contém DNA as lâminas de números 3 e 4. b) As proporções desiguais de citosina e guanina indicam a presença, 17. Durante a fertilização, somente o DNA nuclear do espermatozóide penetra no óvulo. Por esse motivo, o DNA mitocondrial do zigoto é necessariamente materno. 24. a) Os bacteriófagos utilizam nucleotídeos que contém ¤£P da 18. Se houvesse a transcrição simultânea das cadeias complementares dos genes, as moléculas de ARN sintetizadas também teriam seqüências complementares. Tal situação provocaria então a formação de moléculas de ARN de cadeia dupla, que não poderiam ser traduzidas nos ribossomas. c) Não. Os vírus não injetam sua capa protéica na célula bacteriana. 19. As mutações ocorrem aleatoriamente, com uma taxa média constante. Logo, a variabilidade genética é diretamente proporcional à antiguidade, o que confirma que nosso ancestral comum mais recente viveu na África. 25. a) Os 'corrimãos' correspondem a uma sucessão alternada de fosfato e desoxirribose (açúcar). Os 'degraus' são constituídos por 20. a) C = G = 29% e A = T = 21%. pares de bases nitrogenadas, unidas por pontes de hidrogênio, onde adenina pareia com timina, e citosina com guanina. b) Porque a proporção de bases apresentada refere-se às duas cadeias da molécula de DNA, não sendo possível determinar a proporção de citosina na cadeia que será transcrita. b) O DNA realiza a transcrição, isto é, produz o RNA mensageiro, que conduz os códons para a síntese da proteína nos ribossomos. O ¤¦S radioativo entra na composição de proteínas e não no DNA introduzido pelo vírus. b) Os bacteriófagos injetam seu DNA com ¤£P no interior da bactéria hospedeira, deixando-a marcada com radioatividade. bactéria para construir seu material genético (DNA). na quinta lâmina, de um ácido nucléico formado por uma hélice simples, podendo ser DNA ou RNA. moléculas possuem as mesmas proporções de bases nitrogenadas. Somente seriam idênticas se a ordenação das bases fosse exatamente a mesma nas duas moléculas.

21. Cultura de crescimento ¢¦N ë 100% de moléculas de DNA com ¢¦N.

c) As proteínas podem ser diferenciadas pelo número, tipos e seqüências de seus aminoácidos.

Cultura de 1• geração ë 100% de moléculas, cada uma com parte da hélice do DNA com ¢¦N e parte com ¢¥N.

26. a) Os bacteriofagos produzidos pela bactéria infectada terão a cápsula protéica e o DNA do fago T4. b) Durante a infecção, apenas o DNA do fago T4 penetra na bactéria

Cultura de 2• geração ë 50% de moléculas com ¢¥N e 50% com ¢¥N - ¢¦N.

hospedeira. O DNA do fago, passa a comandar a produção da nova linhagem viral.

27. a) Observe a figura a seguir:

76

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
32. a) É a correspondência entre as trincas de bases dos códons e os aminoácidos por eles codificados. b) Por que um único aminoácido pode ser codificado por mais de um códon.

33. Quando a mutação for localizada:

a) no sítio 1 A seqüência do DNA será modificada pelo benzo[a]pireno de ATG para ATT levando, na transcrição, a formação de um RNAm com a b) O tipo de herança se justifica, pois apenas o DNA mitocondrial, presente no óvulo (gameta feminino) será transmitido à descendência. b) no sítio 2 28. Na cadeia 2 há maior quantidade de pares CG. Devido a este fato, é maior o número de pontes de hidrogênio a serem rompidas, o que justifica a necessidade de uma temperatura de desnaturação mais elevada. A seqüência do DNA de CCG será modificada para CCT levando na transcrição, a formação de um RNAm com a seqüência GGA ao invés de GGC. Nessa situação, a modificação de GGC para GGA não provocará alteração na proteína; os dois códons na tradução produzem uma proteína com o aminoácido glicina, nesta posição. 29. 1) Ácido fosfórico 2) Desoxirribose 3) Base nitrogenada 34. a) Produto da síntese protéica (polipeptídio): val - his - leu - thr - pro - glu - glu - lys seqüência UAA ao invés de UAC. UAA é um códon de terminação, portanto, a mutação provocará a produção de uma proteína menor.

30. O DNA é um polinucleotídeo capaz de produzir o RNA mensageiro. Cada três nucleotídeos (códon) do RNAm será traduzido por um aminoácido ao nível dos ribossomos.

b) Exemplo de mutação pontual no gene que codifica a cadeia da globina humana: substituição do nucleotídeo A por T no códon correspondente ao ácido glutâmico. Conseqüência: anemia falciforme

31. a) Proteína normal: Val - Leu - Tre - Pro - Tir - Val - Lis

- alteração estrutural do polipeptídio (substituição do ácido glutâmico pela valina); - alteração da função da proteína (globina); - redução da capacidade de transporte de oxigênio;

Indivíduo A: Val - Leu - Tre - Pro Indivíduo B: Val - Leu - Tre - Pro - Tir - Val - Lis Indivíduo C: Val - Met - Tre - Pro - Tir - Val - Lis

- manifestação dos sintomas da anemia falciforme.

35. Com a descoberta do código genético sabe-se que um aminoácido é sempre codificado por três nucleotídeos. Logo, o gene que codifica

b) A é afetado porque produz uma proteína menor. B é normal, apesar da substituição de uma base nitrogenada no seu DNA, porque o código genético é degenerado. C é afetado porque possui um aminoácido diferente em sua proteína.

uma proteína tem sempre maior número de nucleotídeos que de aminoácidos. Sabe-se ainda que existem vários nucleotídeos do gene que servem para a função de regulação e não são transcritos.

77

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
resulta principalmente da transcrição de genes diferentes, o que naturalmente produz uma composição de RNAm qualitativamente diferente de tecido para tecido.

36. Porque o código genético é degenerado, isto é, para um mesmo aminoácido existem vários códons diferentes.

37. a) RNAm: UCC GUU AAU UCC GGC AAG 42. As regiões 2 e 4. Essas regiões formam alças justamente por não b) O códon mutado, TTA, especificaria o terceiro aminoácido da tabela. possuírem as seqüências de nucleotídeos complementares, que foram eliminadas após o processo de transcrição.

c) UUA

43. a) DNA ýcadeia complementar: 30A-20C-12T-10G

38. a) RNA-polimerase.

þ ÿcadeia ativa: 30T-20G-12A-10C

b) UAC. RNA-mensageiro: 30A-20C-12U-10G c) W - A - T - S - O - N - E - C - R - I - C - K. Portador, o RNA-m terá 12 uracilas e 10 guaninas. d) A proteína não será formada, pois foi alterado o códon de iniciação. b) A cadeia ativa apresenta 72 bases. Cada aminoácido é codificado por um códon constituído por 3 bases. Daí concluímos que 72 bases 39. a) AUG AGU UGG CCU G formam 24 códons que produzirão uma cadeia polipeptídica com 24 aminoácidos. b) Serina - triptofano - Prolina 44. a) CAU CGG AUC c) Metionina - Serina - Glicina b) Somente se formará o mesmo peptídeo se os códons transcritos a 40. a) Para que o genoma RNA (-) seja expresso em proteínas na célula infectada, é primeiro necessário que seja transcrito em RNA complementar, o que é feito, apenas, pela RNA replicase, que não existe na célula. Desta forma, o próprio vírus terá de já possuir a enzima em sua estrutura. Os vírus RNA (+) já funcionam como mensageiros na célula infectada, sendo diretamente traduzidos em proteínas virais, inclusive a RNA replicase. 45. a) Observe a figura a seguir: partir da fita complementar especificarem os mesmos aminoácidos, devido à degeneração do código genético.

b) Os vírus só existem em virtude de sua habilidade de utilizar a maquinaria metabólica das células hospedeiras, direcionando-a para a formação de novas partículas virais. Portanto, os vírus só devem ter surgido após o aparecimento das primeiras células.

41. Não. Os tecidos de um mesmo organismo diferenciam-se pelas diferentes proteínas que contêm. Assim, a diferenciação dos tecidos

78

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
52. a) Valina, porque houve uma substituição (T x A) no codon do DNA correspondente a esse aminoácido. b) Não, porque após a replicação do DNA é semiconservativa.

b) Não. Sendo o código genético degenerado, diferentes trincas de nucleotídeos especificam o mesmo aminoácido.

46. Os genes que não codificam polipeptídeos transcrevem para produzir RNA ribossômico e RNA transportador. 53. Como o ARNm pode conter outros códons AUG, além do códon de iniciação, a iniciação da tradução poderia ocorrer em qualquer 47. São moléculas (DNA e RNA) que comandam, através da síntese de enzimas, todo o metabolismo celular. Segmentos de DNA (genes) transcrevem o RNAm que, nos ribossomos, associados ao RNAt realizam a tradução do código genético em uma proteína. 54. Não, porque a diferenciação celular envolve a expressão 48. Cada mutante possui um gene alterado. Z só cresce em meio com arginina, logo apenas o gene 3 do mutante Z apresenta alteração. 55. a) As proteínas obtidas possuíam apenas um tipo de aminoácido 49. a) Replicação: não interfere; não há alterações na incorporação de timidina marcada no DNA. Transcrição: não interfere; não há alteração na incorporação de uridina marcada no RNA. Tradução: interfere; esta etapa é bloqueada porque há uma queda acentuada na incorporação de aminoácido marcado na proteína. b) O tipo de aminoácido utilizado na produção da proteína poderá variar dependendo do local onde os ribossomos iniciam a tradução do código genético. O aminoácido utilizado é a serina quando a leitura começa no A, do códon AGC. O aminoácido é a alanina quando a leitura começa no G, do códon GCA. O aminoácido utilizado é a b) Duas dentre as ligações ou interações: - ponte dissulfeto - ponte de hidrogênio - forças de van der Walls - interações hidrofóbicas - interações eletrostáticas 56. a) Gene é um segmento do DNA localizado nos cromossomos. Possui um código químico representado por seqüências de bases nitrogenadas (adenina, guanina, citosina e timina). Cada trinca de bases é capaz de codificar um aminoácido de uma proteína. A seqüência de trincas determinará a seqüência dos aminoácidos de um 50. Os organismos eucariotos possuem íntrons, regiões não codificantes em seu DNA, que serão eliminadas no processo de maturação do RNA-mensageiro, antes que ele seja traduzido em proteína. b) Mutações são modificações na seqüência ou na composição das bases do DNA (gene) que podem causar a produção de uma proteína alterada, ou mesmo a não produção da proteína. 51. O antibiótico I atua sobre a tradução, pois, ao ser administrado, reduz imediatamente a síntese protéica. O antibiótico II pode atuar inibindo a transcrição e/ou a replicação gênica, pois no momento da administração até o início da redução da síntese protéica, decorrem 20 minutos; isso significa que havia ácido ribonucléico mensageiro sendo traduzido e produzindo proteína. c) A substituição de uma base nitrogenada no DNA pode não causar nenhuma alteração na proteína produzida pela célula porque o código genético é degenerado, ou seja, um mesmo aminoácido pode ser codificado por diferentes trincas de bases. polipeptídeo. glutamina, quando a leitura começa no C, do códon CAG. porque o DNA utilizado apresentava um único tipo de códon (AGC). (transcrição) e a inativação de diferentes genes nos diversos órgãos. região onde houvesse um outro códon AUG, o que geraria peptídeos truncados ou incompletos. A tradução só ocorre quando a seqüência de Shine-Dalgarno e o códon AUG estão presentes.

79

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
61. 1¡.) bactérias 'Escherichia coli' cultivadas em meio contendo P¤£ e S¤¦ ë bactérias marcadas com os elementos radioativos.

57. a) São necessários pelo menos 84 nucleotídeos pois cada aminoácido de uma proteína é codificado por uma trinca de nucleotídeos.

b) Não. Devido à degeneração do código genético, um aminoácido pode ser codificado por mais do que uma trinca de nucleotídeos.

2¡.) Vírus bacteriofagos parasitam as bactérias marcadas e ficam também marcados com P¤£ no DNA e S¤¦ na cápsula protéica.

c) A mutação que originou a espécie 2 foi uma SUBSTITUIÇÃO. Uma INVERSÃO produziu a alteração verificada na espécie 3 e uma DELEÇÃO acarretou o surgimento da espécie 4.

3¡.) Vírus marcados parasitam bactérias não marcadas.

4¡.) Antes da lise bacteriana o preparado é levado ao liquidificador e centrifugado.

58. a) Do ponto de vista genético, poderiam ocorrer três tipos de albinismo, pois estão envolvidos três pares de genes para a produção do pigmento no animal. Defeitos no gene A, impedem a formação do composto 1, interrompendo toda a cadeia de reações que levam ao desenvolvimento da cor. Alterações no gene B, acarretam a não formação do composto 2, resultando também na não formação da pigmentação. Mutações no gene C, impedindo a síntese do composto 3, também causariam albinismo. Conclusão: O DNA viral é a substância capaz de TRANSFORMAR as bactérias em "fábricas" de novos vírus bacteriofagos. Assim o DNA foi definitivamente identificado como sendo a substância que controla a hereditariedade. 5¡.) O sobrenadante apresenta as cápsulas protéicas marcadas com S¤¦ e no precipitado há bactérias contendo DNA marcado com P¤£.

b) Pais genotipicamente puros portadores de dois tipos distintos de albinismo:

62. A mutação deve ter alterado um códon que codificava um aminoácido transformando-o em um códon de parada, que interrompe a leitura do ARNm pelo ribossoma.

AAbbCC x AABBcc 63. A mudança 2, pois essa é a única que provoca troca de Geração: AABbCc - 100% pigmentados aminoácidos. Essa troca altera a estrutura do peptídeo, o que pode alterar sua função. c) Devido à degeneração do código genético, um aminoácido pode ser determinado por diferentes códons. Assim, uma mutação em um gene, pode não causar qualquer alteração na proteína codificada. b) b1. Emparelhamento dos RNA / Formação de RNA de fita dupla; 59. a) 3'TACGCA5'. b2. A tradução será inibida; 64. a) (I): UAAGCCG; (II): AUUCGGC;

b) 5'AUGCGU3'. O RNA que será utilizado na tradução é o RNAm (RNA mensageiro).

c) Não haverá a síntese de etileno nos tecidos do fruto, e o fruto não amadurecerá;

60. Os círculos pretos representam o número de bactérias; os círculos brancos representam a concentração de glicose; os triângulos pretos a concentração da enzima ’-galactosidase. Enquanto existe glicose no meio a ’-galactosidase está reprimida. Quando a glicose se esgota a expressão dessa enzima é induzida.

d) Poderão armazenar os frutos por mais tempo, depois de colhidos.

80

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
campo? Que impactos o agronegócio causa na sociedade, na forma de desemprego, concentração de renda e poder, êxodo rural, contaminação da água e do solo e destruição de biomas? Quanto tempo essa bonança vai durar, tendo em vista a exaustão dos recursos naturais? O descuido socioambiental vai servir de argumento para a criação de barreiras não-tarifárias, como a que vivemos com a China na questão da soja contaminada por agrotóxicos?"

Lista 6: Evolução
TEXTO PARA A PRÓXIMA QUESTÃO (Ufg 2000) O texto que se segue foi extraído de "Xadrez, truco e outras guerras", de José Roberto Torero. Servimos-nos de algumas de suas estruturas para introduzir a(s) questão(ões) seguintes.

"Os abutres, sábios animais que se alimentavam do mais farto dos pastos, já começavam a sobrevoar a ala dos estropiados quando o General mandou que acampassem. Naquela tarde assaram trinta bois, quantidade ínfima para abastecer os homens que ainda sobravam.... O plano dos comandantes era assaltar fazendas da região e tomar-lhes o gado... À noite a ração foi ainda mais escassa, e, para enganar a fome, fizeram-se fogueiras para assar as últimas batatas e umas poucas raízes colhidas pelo caminho. Como o frio também aumentava, surgiu um impasse: quem ficaria perto do fogo: os coléricos, que logo morreriam, ou os sãos, que precisavam recuperar as forças para a luta?" (TORERO, J. Roberto. "Xadrez, truco e outras guerras")

(Adaptado de Amália Safatle e Flávia Pardini, Grãos na Balança. "Carta Capital", 01/09/2004, p. 42.)

2. A contaminação por agrotóxicos também é mencionada no texto. A aplicação intensiva de agrotóxicos a partir da década de 1940 aumentou a produtividade na agricultura. Atualmente, são produzidas e cultivadas plantas transgênicas, isto é, geneticamente modificadas para serem resistentes à ação de insetos. Um exemplo conhecido é o milho geneticamente modificado com um gene da bactéria 'Bacillus thuringensis' (Bt), o que lhe confere resistência a ataques de insetos. Contudo, alguns pesquisadores têm observado que diferentes espécies de insetos adquirem resistência às toxinas bioinseticidas produzidas por essas plantas. a) Explique como os insetos se tornam resistentes.

1. "O plano dos comandantes era assaltar fazendas da região e tomarlhes o gado (...)"

b) Sabe-se que a aplicação intensiva de agrotóxicos, como o DDT, pode afetar a cadeia alimentar tanto de ambientes aquáticos como de solos. Explique por que isso ocorre.

Em algumas fazendas são introduzidas novas espécies, sem uma avaliação da capacidade adaptativa da espécie ao local. 3. (Ufes 96) A hipótese de que as mitocôndrias se teriam originado de bactérias que, em algum momento do processo evolutivo, se a) Cite e explique 3 conseqüências positivas da introdução de novas espécies num determinado ambiente. b) Explique a relação existente entre desequilíbrios ambientais e mutação. Exemplifique. associaram a uma célula eucariota, tem alguma sustentação científica. Cite três argumentos que fundamentam essa hipótese.

TEXTO PARA A PRÓXIMA QUESTÃO (Unicamp 2007) "O agronegócio responde por um terço do PIB,

42% das exportações e 37% dos empregos. Com clima privilegiado, solo fértil, disponibilidade de água, rica biodiversidade e mão-deobra qualificada, o Brasil é capaz de colher até duas safras anuais de grãos. As palavras são do Ministério da Agricultura e correspondem aos fatos. Essa é, no entanto, apenas metade da história. Há uma série de questões pouco debatidas: Como se distribui a riqueza gerada no

81

salabioquimica.blogspot.com
4. (Unesp 2000) Observe o esquema.

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
a) Estabeleça relações entre a possível conseqüência a seleção de uma única variedade para plantio sobre a diversidade genética do trigo cultivado naquela região e sobre a capacidade do trigo de responder às alterações ambientais. b) O aumento da concentração de CO‚ na atmosfera está relacionado a um fenômeno global que vem preocupando a comunidade científica e a sociedade em geral nos últimos tempos. Comente os possíveis efeitos dessa alteração global sobre a produção de grãos da variedade de trigo mencionada. Qual a importância da manutenção de banco de genes? 6. (Unicamp 2002) O mapa a seguir mostra os países que reúnem em seus territórios 70% das espécies vegetais e animais existentes sobre

Um biólogo, ao analisar esse esquema hipotético, observou que as mitocôndrias e cloroplastos originaram-se de um ancestral procarionte e se associaram a determinados tipos de células. As mitocôndrias estão presentes no citoplasma de células animais, células vegetais e nos fungos, enquanto os cloroplastos são encontrados em células fotossintetizantes, estabelecendo-se entre eles relações harmônicas de mutualismo.

a Terra. A maioria dos países que apresenta megadiversidade está localizada nas regiões tropicais.

Tendo-se como referência estas informações e o esquema, responda.

a) Que vantagens as mitocôndrias oferecem às células hospedeiras e o que elas proporcionam às organelas? a) Que bioma é comum à maioria dos países tropicais?

b) Quais as vantagens proporcionadas ao meio ambiente pelos cloroplastos? 5. (Unesp 2006) Na busca por uma maior produção de grãos, agrônomos selecionaram artificialmente uma variedade de trigo que produzia 80% mais grãos que as variedades até então cultivadas. Essa variedade apresentava caule mais curto, de modo que a maior parte do nitrogênio fornecido na forma de adubo era utilizada pela planta para a produção de grãos. Em pouco tempo os agricultores de uma determinada região abandonaram as variedades antigas e passaram a plantar apenas sementes dessa nova variedade. No entanto, não se sabia que a nova variedade era muito sensível às flutuações climáticas, especialmente a altas temperaturas.

b) "A diversidade gera diversidade". Por que esta frase pode ser aplicada à grande biodiversidade das regiões tropicais?

c) Explique por que Madagascar, Indonésia e Filipinas apresentam, além de grande biodiversidade, um elevado número de espécies que ocorrem apenas nesses locais.

82

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
9. (Ueg 2007) A figura a seguir ilustra um importante processo que é analisado por paleontólogos para o entendimento das variações de complexidade e de diversidade de espécies.

7. (Unicamp 2000) Leia com atenção a tira a seguir:

a) Calvin não entende por que precisa estudar os morcegos. Esses animais, porém, têm funções biológicas importantes nos ecossistemas. Cite duas dessas funções.

b) Calvin acredita que os morcegos são insetos porque, além de considerá-los nojentos, eles voam. No entanto, o que ele não sabe é que asas de insetos e de morcegos não são estruturas homólogas, mas análogas. Qual a diferença entre estruturas análogas e homólogas?

Sobre esse processo, responda ao que se pede. a) Qual o processo em questão? b) De que forma esse processo pode contribuir para o entendimento da evolução dos organismos?

c) Dê duas características exclusivas da classe a que pertencem os morcegos.

10. (Ufu 2001) Estudar a evolução de um determinado grupo de organismos é algo complexo, difícil mesmo. Como saber quais etapas evolutivas se sucederam na evolução? O que veio primeiro? Nesse

8. (Unicamp 2001) Desde 1995 alguns estados norte-americanos estão excluindo o ensino da teoria de evolução biológica dos seus currículos escolares alegando, entre outras razões, que ninguém estava presente quando a vida surgiu na Terra. Alguns cientistas defendem a teoria da evolução argumentando que, se é necessário "ver para crer", então não poderemos acreditar na existência dos átomos, pois estes também não podem ser vistos. (Adaptado da "ISTO É", 25/08/1999.)

sentido os cientistas têm buscado na natureza provas da evolução. Essas provas aparecem principalmente de duas maneiras básicas. Pergunta-se: quais são essas duas maneiras principais pelas quais os cientistas têm estudado a evolução?

a) Apresente três evidências que apóiam a teoria da evolução biológica.

b) A mutação gênica é considerada um dos principais fatores evolutivos. Por quê?

83

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
14. (Unicamp 2004) O melanismo industrial tem sido freqüentemente citado como exemplo de seleção natural. Esse fenômeno foi observado em Manchester, na Inglaterra, onde, com a industrialização iniciada em 1850, o ar carregado de fuligem e outros poluentes provocou o desaparecimento dos liquens de cor esbranquiçada que viviam no tronco das árvores. Antes da industrialização, esses liquens permitiam a camuflagem de mariposas da espécie 'Biston betularia' de cor clara, que eram predominantes. Com o desaparecimento dos liquens e escurecimento dos troncos pela fuligem, as formas escuras das mariposas passaram a predominar. a) Por que esse fenômeno pode ser considerado um exemplo de seleção natural? b) Como a mudança ocorrida na população seria explicada pela teoria de Lamarck?

11. (Unicamp 95) Imagine que tenha sido elaborada a seguinte hipótese para explicar a extinção dos dinossauros: Os dinossauros eram répteis herbívoros que viveram no período Cambriano, há cerca de 600 milhões de anos. Nesse período surgiram as gimnospermas, que foram os primeiros vegetais a ocupar o ambiente Terrestre. Essas plantas possuíam vasos pouco desenvolvidos, e por isso, a circulação de seiva elaborada através do xilema não era eficiente, causando a retenção de resíduos metabólicos tóxicos em suas folhas, flores e frutos. Os dinossauros incapazes de reconhecer o sabor amargo característico das plantas tóxicas, alimentaram-se delas e morreram envenenados. Há varias informações erradas no texto acima. Indique três delas e explique por que cada uma das afirmações que você selecionou é errada.

12. (Fuvest 98) Mariposas da espécie 'Biston betularia' de cor escura (melânicas) eram raras em Manchester, Inglaterra, por volta de 1895. Predominavam os espécimes de cor clara, que se camuflavam sobre os liquens das cascas das árvores. Em 1950, porém, verificou-se que quase 90% das mariposas eram melânicas nas áreas que se tornaram industriais, onde a fuligem negra produzida pelas fábricas recobriu o tronco das árvores. a) Explique esse aumento das mariposas melânicas entre 1895 e 1950 com base na seleção natural. b) Por que é possível afirmar que a coloração dessas mariposas é um caráter determinado geneticamente?

15. (Fuvest 97) a) É comum ouvirmos a frase: "Já tomei este antibiótico tantas vezes que agora já não faz mais efeito." Esta afirmação pode ser verdadeira? Por quê? b) Costuma-se usar dois antibióticos diferentes no tratamento de certas doenças comuns, como a tuberculose, cujo agente causador já é bem conhecido. Qual seria a forma biologicamente mais eficiente de administrá-los: simultaneamente ou separadamente com um intervalo de 1 mês entre eles? Justifique sua resposta.

13. (Ufpr 95) Um levantamento populacional de borboletas realizado no final do século XVIII, no norte da Inglaterra, revelou um grande número de borboletas claras e uma minoria de cor escura, todas da mesma espécie. Um levantamento idêntico, realizado 50 anos mais tarde, constatou uma inversão do quadro, sendo a maioria das borboletas encontradas de cor escura e apenas umas poucas de cor clara. Durante esse período de 50 anos, um grande número de indústrias se instalou na região; seu combustível, carvão, produzia uma acentuada poluição, caracterizada por uma cobertura fuliginosa negra, tanto nas construções como nas plantas. Como poderia ser explicada evolutivamente a mudança na proporção de borboletas claras e escuras?

84

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO

16. (Uerj 2001) Foram introduzidas em dois frascos, que contêm um mesmo meio de cultura, quantidades idênticas de um tipo de bactéria. Após algum tempo de incubação, adicionou-se, a apenas um dos frascos, um antibiótico estável, de uso freqüente na clínica e cuja concentração não se modificou durante todo o experimento. O gráfico abaixo representa a variação do número de bactérias vivas no meio de cultura, em função do tempo de crescimento bacteriano em cada frasco.

Explique por que ocorre variação na porcentagem de bactérias resistentes a antibióticos entre os anos de 1995 e 2000.

18. (Ufrj 2007) O gráfico a seguir mostra como variou o percentual de cepas produtoras de penicilinase da bactéria 'Neisseria gonorrhoeae' obtidas de indivíduos com gonorréia no período de 1980 a 1990. A penicilinase é uma enzima que degrada a penicilina. A observação do gráfico permite concluir que, no frasco em que se adicionou o antibiótico, ocorreu uma grande diminuição no número de bactérias. Utilizando a teoria da seleção natural, explique o fato de essa população ter voltado a crescer, após a diminuição observada. 17. (Ufrj 2003) Visando a prevenir infecções, a adição de antibióticos na ração de animais domésticos tornou-se prática comum em muitos países. Ao longo dos anos, observou-se um aumento na porcentagem de bactérias que possuem genes que as tornam resistentes aos antibióticos, em detrimento das bactérias sensíveis. A partir de 1998, o governo da Dinamarca proibiu o uso de antibióticos na ração de animais. Os gráficos a seguir mostram a porcentagem de indivíduos resistentes a antibióticos nas bactérias 'Enterococcus faecalis' e 'Enterococcus faecium' encontradas no trato digestivo de animais dinamarqueses nos anos de 1995 e 2000. Por que aumentou o número de cepas que produzem a penicilinase?

85

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
22. (Ufrj 2007) O valor adaptativo de um indivíduo varia entre 0 e 1,0. Os valores extremos 0 e 1,0 indicam, respectivamente, indivíduos eliminados pela seleção natural sem deixar descendentes e indivíduos que contribuem com o maior número de descendentes para a geração seguinte. Medições do valor adaptativo de indivíduos portadores de seis genótipos, em duas populações diferentes, revelaram os seguintes resultados:

19. (Unesp 90) O controle das doenças bacterianas infecciosas feito por antibióticos ainda não está totalmente resolvido. A cada medicamento produzido, verifica-se o aparecimento de linhagens de bactérias que não respondem ao tratamento. Diante desse fato, conclui-se que os antibióticos induzem o aparecimento de bactérias resistentes. Pergunta-se: a) Está correta esta conclusão? b) Justifique a sua resposta.

20. (Ufes 96) A Siclemia ou Anemia Falciforme é uma doença genética grave em que os homozigotos SS, por só produzirem hemoglobina anormal do tipo S, apresentam anemia profunda e, se não tiverem um tratamento médico eficiente, dificilmente atingirão a idade reprodutiva. No entanto, observa-se que a freqüência do gene S é bastante alta na Grécia, África e Índia, regiões endêmicas para a malária. a) Explique a relação entre a freqüência do gene S e a malária. b) Qual é o agente etiológico, o vetor e o ciclo de vida, no homem, do protozoário causador da malária? 23. (Uerj 97) Observe o gráfico a seguir, que apresenta uma relação hipotética entre algumas das principais etapas da evolução dos 21. (Ufrj 2001) Dois 'loci' de uma população, cada um com dois gens alelos, sofrem a ação da seleção natural por muitas gerações, como é mostrado nas tabelas abaixo. O coeficiente de seleção (S) indica os valores com que a seleção natural atua contra o genótipo. O valor adaptativo (W) representa os valores com que a seleção natural favorece o genótipo. Note que (W+S)=1. organismos, o esgotamento do íon ferroso e as mudanças na percentagem de O‚ na atmosfera. Dos genes "A‚" e "B‚", qual deveria apresentar maior freqüência? Justifique sua resposta.

No gráfico o tempo é medido em bilhões de anos Explique: a) por que a liberação de O‚ ocorrida através da fotossíntese, há cerca de 3 bilhões de anos, não acarretou, de imediato, aumento no nível do oxigênio atmosférico. Qual dos gens, A‚ ou B‚, apresentará a maior freqüência na população? Explique. b) a relação entre o rápido acúmulo de oxigênio atmosférico e a disseminação dos organismos aeróbicos, de acordo com a Teoria Moderna da Evolução.

86

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
27. (Ufrj 95) O rato canguru é um pequeno mamífero, comum no deserto americano, que consegue sobreviver nessa região hostil graças às várias adaptações que possui: ele se alimenta à base de sementes com elevado conteúdo de gordura, não possui glândulas sudoríparas, tem hábitos noturnos e um focinho afilado e comprido. Essas características representam adaptações do animal a um aspecto marcante de seu habitat. a) Identifique esse aspecto marcante. b) Escolha duas das quatro adaptações citadas e explique como elas contribuem para a sobrevivência do rato canguru.

24. (Uff 99) Um fazendeiro semeou trevos de variedade alta em uma área cercada. Após a semeadura reservou metade dessa área para pasto de gado (área A), ficando a outra metade isolada (área B). Três anos depois, um botânico removeu amostras de trevos de área A e B, transplantando-as em um jardim experimental. Após algum tempo, o botânico observou diferença no desenvolvimento das amostras transplantadas: grande proporção das retiradas da área A era de planta rasteira, enquanto das retiradas da área B, era de planta alta e vigorosa.

a) Assinale, nos parênteses correspondentes, toda alternativa que menciona um fator determinante da diferença observada pelo botânico. ( ) Ocorreu uma adaptação dos trevos ao local em que foram

28. (Ufrj 95) Vários indivíduos de uma planta foram introduzidos numa ilha muito grande. Como não existiam insetos que pudessem atacar a planta, ela rapidamente colonizou grandes espaços da ilha. Essas plantas possuem um "locus" com dois genes alelos A e A‚ que, no momento da colonização, tinha a mesma freqüência. Os alelos A e A‚ atuam de forma diferente em duas características da planta, a saber, na capacidade de sobrevivência nas condições climáticas da ilha e na resistência das plantas aos ataques dos insetos, como mostra a tabela a seguir:

semeados. ( ) Ocorreu o favorecimento de alguns genótipos em relação a

outros. ( ) Ocorreu a predominância de indivíduos com fenótipos que

aumentavam sua sobrevivência.

b) Explique cada escolha feita no item anterior.

25. (Ufg 2003) Os mamíferos primitivos surgiram há milhões de anos. Por irradiação adaptativa, diferentes representantes dessa classe desenvolveram a capacidade de percorrer grandes distâncias utilizando os membros posteriores ou inferiores. Por isso, certos animais desse grupo tornaram-se saltadores. Com relação às considerações acima, a) explique a importância da capacidade de saltar para a adaptação aos ambientes. b) relacione salto, mitocôndria e ATP. Depois de 10 gerações dessas plantas na ilha, foi introduzida uma espécie de inseto que conseguia alimentar-se delas. 26. (Ufg 2006) Os registros fósseis evidenciam que a conquista do ambiente terrestre pelos seres vivos ocorreu na era paleozóica, a partir do ambiente aquático. a) Explique por que a conquista do ambiente terrestre pelos animais foi posterior à dos vegetais. b) Explique duas características morfofisiológicas que permitiram a ocupação do ambiente terrestre pelos animais. Com base nos dados da tabela, responda: a) O gene A‚ desapareceu da população antes da introdução do inseto? Justifique sua resposta. b) O gene A• desaparece da população depois da introdução do inseto? Justifique sua resposta.

87

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO

29. (Ufrj 99) Os machos de uma certa espécie de pássaros são territoriais, ou seja, são animais que delimitam e defendem a região em que se instalam. Os mais fortes escolhem e ocupam os melhores territórios, dos quais expulsam qualquer outro macho que tente se aproximar. Na época do acasalamento, as fêmeas "passeiam" por todos os territórios e decidem com que macho vão procriar. O gráfico a seguir mostra a ordem em que 10 machos dessa espécie foram escolhidos.

Identifique a região em que há uma MENOR variedade de bicos e explique de que forma o padrão de migração destas aves favorece a sobrevivência de seus filhotes.

31. (Ufrj 2006) No processo evolutivo, centenas de espécies podem ser criadas em um tempo relativamente curto. Esse fenômeno é conhecido como radiação adaptativa. No grupo dos répteis, ocorreu uma grande radiação adaptativa após o aparecimento da fecundação O eixo das ordenadas indica a seqüência em que os machos foram escolhidos e o eixo das abscissas indica a qualidade dos territórios. a) O que determina a escolha preferencial dos machos pelas fêmeas? b) Qual o mecanismo evolutivo que explica esse padrão? 30. (Ufrj 2003) O I.V. é um indicador da variedade de formas e tamanhos dos bicos de grupos de espécies de aves. Quanto maior o I.V. de um grupo de espécies, maior a variedade dos bicos. O gráfico a seguir relaciona o I.V. das espécies de aves de duas regiões (A e B) à porcentagem de espécies de cada região que migra para outros locais do planeta durante a época de reprodução e criação dos filhotes. interna e do ovo amniótico; muitas espécies desse grupo surgiram e ocuparam o habitat terrestre. Explique por que o ovo amniótico facilitou a ocorrência dessa radiação adaptativa. 32. (Unicamp 2000) A fauna de fundo de cavernas é caracterizada por turbelários, minhocas, sanguessugas, muitos crustáceos e insetos, aracnídeos e caramujos. Os vertebrados são representados por peixes, salamandras e morcegos. Os morcegos se refugiam na caverna durante o dia. Geralmente os animais são despigmentados e os peixes são cegos. Muitos insetos, miriápodes e aracnídeos têm pernas e antenas desmesuradas, não raro densamente revestidas de cerdas. Alguns besouros têm cerdas distribuídas pelo corpo todo. A umidade constante é de especial importância; geralmente os animais são estenotermos. O alimento é raro, a escuridão é completa, faltam vegetais.

88

salabioquimica.blogspot.com
BRASIL, 1943)

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
variações nos oscilogramas entre populações simpátricas e alopátricas? Justifique sua resposta.

(Adaptado de Mello Leitão, C. ZOOGEOGRAFIA DO

a) Pode-se dizer que foi a falta de luz que fez com que os peixes ficassem cegos? Explique sua resposta do ponto de vista evolutivo.

35. (Ufrj 98) De acordo com o modelo de Lynn Margulis, as mitocôndrias, antes de serem organelas celulares, eram organismos procariontes aeróbicos de vida livre.

b) No texto são citadas adaptações que permitem aos animais sobreviverem nesse ambiente. Identifique uma delas e explique a sua função.

Eventualmente, ao longo da evolução, esses organismos foram endocitados por células eucariotas anaeróbias, permanecendo no citoplasma e passando a replicar-se aí, em sincronia com as células hospedeiras.

c) Construa uma cadeia alimentar de três níveis tróficos que pode ocorrer em cavernas, utilizando as informações do texto.

Essa associação teria então criado células mais eficientes, capazes de gerar mais moléculas de ATP por mol de glicose. De acordo com esse modelo, qual foi a principal pressão seletiva para

33. (Unifesp 2006) É consenso na Ciência que a vida surgiu e se diversificou na água e, somente depois, os organismos conquistaram o ambiente terrestre. Considere os seguintes grupos de animais: poríferos, moluscos, anelídeos, artrópodes e cordados. Considere os seguintes grupos de plantas: algas verdes, briófitas, pteridófitas, gimnospermas e angiospermas. a) Quais deles já existiam antes da conquista do ambiente terrestre? b) Cite duas adaptações que permitiram às plantas a conquista do ambiente terrestre.

que as células "adotassem" as mitocôndrias?

36. (Ufrj 2008) Com o surgimento da fotossíntese, grandes concentrações de oxigênio passaram a se acumular na atmosfera. Esse acúmulo foi um dos eventos cruciais para a evolução da vida na Terra, pois, em concentrações elevadas, o oxigênio é extremamente reativo e pode causar danos aos componentes celulares. Aceita-se que a evolução das células eucarióticas se deu por endossimbiose; por esse motivo, as mitocôndrias (presentes nas células de protistas, fungos, animais e plantas) e os cloroplastos

34. (Unirio 2002) Duas espécies de pererecas (A e B) podem ser encontradas em simpatria ou em alopatria. As vocalizações (espécie de canto na época da reprodução) podem ser gravadas e os sons transformados em gráficos (oscilogramas).

(presentes nas células de plantas e protistas) são descendentes de diferentes procariontes integrados às células primitivas por processos de fagocitose. Na evolução da célula eucariótica por endossimbiose, qual evento deve ter ocorrido primeiro: a aquisição de mitocôndrias ou a aquisição de cloroplastos? Justifique sua resposta.

37. (Unicamp 2003) Uma das hipóteses mais aceitas para explicar a origem das mitocôndrias sugere que estas organelas se originaram de bactérias aeróbicas primitivas, que estabeleceram uma relação de simbiose com uma célula eucarionte anaeróbica primitiva. a) Dê uma característica comum a bactérias e mitocôndrias que apoie a hipótese acima. b) Qual seria a vantagem dessa simbiose para a bactéria? E para a célula hospedeira? Considerando que as vocalizações variam em função da localidade em que as espécies se encontram, que agente evolutivo explica as c) Que outra organela é considerada também de origem simbiótica?

89

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
Imediatamente, antes de cada aplicação, contou-se a quantidade de mosquitos vivos, em cada viveiro. Os resultados estão apresentados nos gráficos a seguir:

38. (Uerj 2008) A lisozima, enzima com atividade bactericida, é encontrada em fluidos corporais humanos como saliva, soro sangüíneo, lágrima e leite. O boi e o lêmure, animais não aparentados, secretam essa enzima em seus estômagos. A tabela a seguir mostra as modificações ocorridas na estrutura primária da lisozima desses dois animais, em relação à humana.

Avalie as diferenças de resistência dos mosquitos de cada grupo ao malation, propondo uma explicação para o diferente comportamento Essas modificações, não encontradas em nenhum ancestral comum ao boi e ao lêmure, permitiram à lisozima desempenhar sua função em um ambiente acidificado. Cite e defina o tipo de evolução que explica a semelhança na estrutura primária da lisozima do boi e do lêmure. 39. (Uff 2004) Foram coletados 1.000 exemplares do mosquito 'Anopheles culifacies', de ambos os sexos, em cada uma de duas regiões denominadas A e B, bastante afastadas entre si. Em uma delas, a agricultura é intensivamente praticada. Esses mosquitos foram mantidos em dois viveiros adequados. Os dois grupos foram aspergidos com doses iguais do inseticida sintético malation, sendo esta aplicação repetida após intervalos regulares de tempo. 40. (Uflavras 97) "Dona Gertrudes tinha no seu quintal uma horta de couves. Toda vez que apareciam lagartas comendo as folhas de couve ela ia até o armazém do seu Zé-do-Adubo, e comprava o inseticida "terror-das-lagartas" receitado por ele. No entanto, a cada ano que passava, ela percebia que o "remédio" fazia menos efeito, mesmo que ela aumentasse a dose recomendada." Explique, sucintamente, usando os conceitos de: EVOLUÇÃO, MUTAÇÃO GÊNICA, SELEÇÃO NATURAL e MUDANÇA AMBIENTAL, o que ocorreu na horta de dona Gertrudes, supondo, para responder à pergunta, que o produto não estivesse adulterado. desses grupos. Indique qual das regiões deve ser a agrícola.

41. (Fuvest 91) "Para o homem poder suportar a intensa radiação solar nos trópicos, as células de sua pele adquiriram a capacidade de fabricar muita melanina."

Esta é uma frase lamarckista. Critique-a com base no pensamento darwinista.

90

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
47. (Uerj 2006) Considere as proposições a seguir, relacionadas ao conceito de evolução das espécies.

42. (Unesp 2007) Aquecimento já provoca mudança em gene animal. Algumas espécies animais estão se modificando geneticamente para se adaptar às rápidas mudanças climáticas no espaço de apenas algumas gerações, afirmam cientistas. ("Folha de S.Paulo", 09.05.2006.)

I) O filósofo grego Anaximandro, que viveu por volta de 500 a.C., acreditava que os humanos evoluíram a partir de seres aquáticos parecidos com peixes. Esses seres teriam abandonado a água para se

O texto pressupõe uma interpretação darwinista ou lamarckista do processo evolutivo? Justifique.

adaptar à vida terrestre por encontrarem melhores condições neste ambiente. II) Em 400 a.C., outro grego, Empédocles, propunha que homens e

43. (Unicamp 94) "Os antepassados dos golfinhos tinham patas, que, de tanto serem usadas para a natação, foram se transformando em nadadeiras." a) A frase acima está de acordo com a teoria de Lamarck ou com a teoria de Darwin? Justifique, relacionando a teoria escolhida com a frase. b) Por que a frase está em desacordo com a teoria não escolhida?

animais não surgiram como indivíduos completos, mas como partes de um corpo que se juntaram ao acaso, formando criaturas estranhas e fantásticas. Algumas delas, incapazes de se reproduzir, foram extintas, enquanto outras prosperaram. III) Sabe-se que mutações neutras, ou seja, aquelas que não alteram substancialmente a atividade biológica da proteína modificada, tendem a se acumular naturalmente a intervalos de tempo longos, porém estatisticamente regulares.

44. (Fuvest 89) "De maneira geral, os machos mais vigorosos, que apresentam maior adaptação ao lugar que ocupam na natureza, deixam maior número de descendentes." Essa afirmação é de Charles Darwin, em A ORIGEM DAS ESPÉCIES. a) Qual a idéia fundamental da teoria darwinista contida na afirmação? b) Relacione a afirmação de Darwin com o fenômeno da delimitação de território, largamente observado entre os animais vertebrados. a) Aponte, para cada proposição dos primeiros evolucionistas citados, Anaximandro e Empédocles, a teoria evolutiva formulada no século XIX que a ela mais se assemelha e justifique sua resposta. b) Explique a aplicação do conhecimento das estruturas primárias de um mesmo tipo de proteína, encontrada em diferentes espécies de seres vivos, em estudos evolutivos.

45. (Fuvest 95) Uma população de bactérias foi colocada em um meio de cultura saturado de um determinado antibiótico. A maioria das bactérias morreu. No entanto, algumas sobreviveram e deram origem a linhagens resistentes a este antibiótico. a) Explique o processo segundo a teoria lamarckista de evolução. b) Explique o processo segundo a teoria darwinista de evolução.

46. (Fuvest-gv 91) Um trecho de um trabalho científico diz o seguinte: "Quando o antibiótico foi adicionado à cultura de bactérias, apenas algumas sobreviveram. As sobreviventes se reproduziram e sua descendência era resistente ao antibiótico." Como Lamarck teria interpretado esse trecho? E Darwin?

91

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
vista científico, que expliquem a presença de peixes em lagoas desse tipo.

48. (Ufc 2007) Peter e Rosemary Grant são pesquisadores norteamericanos que estudam os tentilhões, pássaros comedores de sementes que vivem numa ilha do arquipélago de Galápagos. Esses pesquisadores observaram a modificação do tamanho médio do bico dessas aves devido à disponibilidade de sementes de tamanhos diferentes, das quais esses pássaros se alimentam. Quando há produção abundante de sementes, a espécie residente de tentilhões ('Geospiza fortis') prefere se alimentar de sementes menores. Já em período de escassez de alimento, os pássaros dessa espécie que apresentam bicos mais largos passam a se alimentar de sementes maiores, as quais não são acessíveis aos indivíduos dessa população que apresentam bicos menores. Em 1977, ocorreu uma seca de grande intensidade, que reduziu a produção de sementes. Texto adaptado de "Bicos sob medida". "Ciência Hoje" set. 2006.

50. (Ufrj 95) Leia com atenção as seguintes informações:

INFORMAÇÃO I: O número de espécies de insetos que comem plantas na região tropical é, aproximadamente, três vezes maior que o de espécies que comem plantas na região temperada. INFORMAÇÃO II: As plantas produzem substâncias, como os alcalóides, que são tóxicas para muitas espécies de insetos que se alimentam de plantas.

Um estudo mostrou que 35% das espécies de plantas da região tropical produzem alcalóides, enquanto apenas 15% das espécies de plantas da zona temperada produzem essa substância. Explique o mecanismo evolutivo que, possivelmente, gerou essa

a) Em relação ao tamanho do bico, o que seria esperado acontecer com a população de tentilhões residentes, após a seca de 1977, segundo a teoria da evolução de Darwin? b) Que processo evolutivo estaria ocorrendo nesse evento? c) Posteriormente, a situação climática da ilha se normalizou e a oferta de sementes tornou-se abundante. Porém, em 1982, um outro fato ocorreu: uma outra espécie de tentilhão ('Geospiza magnirostris') chegou à ilha. Esta espécie invasora também se alimenta do mesmo tipo de sementes que a espécie de tentilhões residentes e apresenta um porte mais avantajado e bicos maiores. Que tipo de relação ecológica se estabeleceria entre a espécie residente e a invasora? d) Após novos períodos de seca, que ocorreram em 2004 e 2005, o que se espera que aconteça com a população de tentilhões residente, em relação ao tamanho dos bicos, sabendo-se que os indivíduos com bico menor são mais eficientes em se alimentar de sementes menores? Analise a situação, também, segundo a teoria da evolução de Darwin.

diferença percentual entre as plantas das duas regiões.

51. (Ufrj 97) Os dois cartuns de Garry Larson, apresentados a seguir, ilustram duas visões diferentes do processo evolutivo:

No cartum A, movidos pelo excesso de população, vários animais atiram-se ao mar realizando assim um suicídio coletivo. Um dos animais, entretanto, possui uma bóia. No cartum B, algumas criaturas aquáticas jogavam beisebol e, por acidente, a bola foi lançada à terra.

49. (Ufes 96) Na caatinga existem lagoas temporárias que são formadas apenas durante o curto período de chuvas. Nessas lagoas existem algumas espécies de peixes conhecidas por "peixes das nuvens" ou "peixes anuais". O ciclo de vida desses peixes, de pequeno tamanho, está ajustado às alterações ambientais entre os períodos seco e chuvoso. Apresente hipóteses plausíveis, do ponto de

Para que o jogo prossiga é preciso que alguém recupere a bola. Qual dos cartuns dá uma interpretação lamarckista do processo evolutivo e qual dá uma interpretação darwinista? Justifique sua resposta.

92

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
56. (Unesp 2003) Darwin ajuda luta contra AIDS Charles Darwin aprovaria. O novo tratamento contra a AIDS, em desenvolvimento na Universidade Harvard, promete um raro avanço no combate à doença. Mas, melhor ainda, pela primeira vez uma terapia está levando a sério a teoria da evolução darwiniana, baseada no princípio da seleção natural (...). A equipe da Universidade resolveu testar o que aconteceria se uma população de vírus fosse

52. (Unesp 90) Em algumas ilhas do arquipélago de Galápagos, são encontrados cactos rasteiros, cujas flores ficam próximas ao chão, não sendo constatada a presença de iguanas terrestres. Nas ilhas onde vivem os iguanas, os cactos são arborescentes e suas flores encontram-se localizadas distantes do chão. Como você explica esses fatos, segundo as teorias evolutivas de Lamarck e Darwin?

53. (Unesp 93) Considere as seguintes afirmações: 1) "O gafanhoto é verde porque vive na grama". 2) "O gafanhoto vive na grama porque é verde". Na sua opinião, qual afirmação seria atribuída a Darwin e qual seria atribuída a Lamarck? Justifique sua resposta.

submetida a várias drogas, AZT, DDI e Piridinona, que atacassem o mesmo alvo. O alvo é a enzima transcriptase reversa, que o HIV usa (...) para integrar seu genoma ao da célula infectada. (...). O resultado foi revolucionário (...), o vírus acabou perdendo a capacidade de se multiplicar. (...). O tratamento só é eficaz quando as drogas são ministradas conjuntamente (...)

54. (Unesp 95) Tanto para Lamarck como para Darwin, o ambiente tinha um papel importante no processo evolutivo. a) Qual dos dois cientistas admitia que o ambiente seleciona a variação mais adaptativa? b) Qual o pensamento do outro cientista sobre o papel do ambiente no processo evolutivo?

("Folha de S.Paulo", 28.02.1993.)

Lembre-se de que cada droga reconhece e atua sobre uma região específica da enzima transcriptase reversa, e que as enzimas dependem de sua composição de aminoácidos e estrutura espacial para exercer sua função. a) Do ponto de vista evolutivo, e considerando a ação da seleção,

55. (Unesp 2002) Analise o texto a seguir, extraído da revista "Newsweek":

explique o que ocorreria com a população viral se fosse utilizada uma única droga.

"Cientistas da Inglaterra e dos Estados Unidos fazem um alerta contra o uso exagerado de antibióticos. De tanto serem bombardeadas com penicilinas e inúmeros tipos de antibióticos, as bactérias resistentes prevalecerão sobre as normais e, portanto, estamos a caminho de um desastre médico".

b) Por que o tratamento só se mostrou eficaz com a administração conjunta das três drogas?

57. (Unicamp 92) Em uma determinada espécie, flores amarelas representam uma adaptação bem sucedida em relação a um certo polinizador. Todos os indivíduos atuais dessa espécie apresentam

a) Como Darwin explicaria o aumento progressivo, entre as bactérias, de formas resistentes a antibióticos?

flores amarelas, mas, há muito tempo atrás, existiram flores de outras cores. Cite a teoria que explica esse fato e descreva o processo que levou à existência de uma única cor para as flores dessa espécie.

b) Segundo os princípios neodarwinistas, por que estamos a caminho de um desastre médico?

93

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
61. (Fuvest 2002) Em conseqüência do aparecimento de uma barreira geográfica, duas populações de uma mesma espécie ficaram isoladas por milhares de anos, tornando-se morfologicamente distintas uma da outra.

58. (Unicamp 98) Em 1950, o vírus mixoma foi introduzido em uma região da Austrália para controlar o grande aumento de coelhos europeus. O primeiro surto de mixomatose matou 99,8 % dos coelhos infectados. O surto seguinte matou 90%. No terceiro surto somente 40 a 60% dos coelhos infectados morreram e a população voltou a crescer novamente. O vírus é transmitido por mosquitos que só picam coelhos vivos. O declínio da mortalidade dos coelhos foi atribuído a fatores evolutivos. a) Do ponto de vista evolutivo, o que ocorreu com a população de coelhos? b) Como os mosquitos podem ter contribuído para diminuição da mortalidade dos coelhos? b) Cite as duas situações que podem ocorrer no caso de as populações voltarem a entrar em contato pelo desaparecimento da barreira geográfica. Em que situação se considera que houve especiação? a) Como se explica o fato de as duas populações terem se tornado morfologicamente distintas no decorrer do tempo?

59. (Fuvest 97) Explique, de acordo com a teoria sintética da evolução, as adaptações mencionadas nos textos a seguir. a) Durante o longo inverno da região ártica, a plumagem de certas aves e a pelagem de certos mamíferos tornam-se brancas, voltando a adquirir coloração escura no início da primavera. b) Algumas espécies de anfíbio e de inseto apresentam cores e desenhos marcantes que, ao invés de escondê-las, as destacam do ambiente e chamam a atenção de possíveis predadores.

62. (Fuvest 2005) A seguir são mostradas duas propostas de árvores filogenéticas (I e II) para diversos grupos de animais invertebrados e fotos de animais (a, b, c), pertencentes a alguns desses grupos.

60. (Fuvest 99) O desenvolvimento da Genética, a partir da redescoberta das leis de Mendel, em 1900, permitiu a reinterpretação da teoria da evolução de Darwin. Assim, na década de 1940, formulou-se a teoria sintética da evolução.

a) Indique em qual das árvores os animais das fotos a e b são mais proximamente aparentados sob o ponto de vista evolutivo. Justifique sua resposta. b) Cite um outro animal incluído no grupo taxonômico, mostrado nas árvores, ao qual pertence o animal da foto c. c) Quanto ao modo de respiração, qual dos três animais (a, b, c) apresenta menor adaptação à vida em terra firme? Por quê?

Interprete o diagrama acima, de acordo com essa teoria. a) Que fator evolutivo está representado pela letra A? b) Que mecanismos produzem recombinação gênica? c) Que fator evolutivo está representado pela letra B?

94

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
64. (Ufrj 2002) O gráfico representa a taxa de pares de alelos em heterozigose em três espécies diferentes de animais.

63. (Ufc 99) "Em 1997, no município de Monte Alto, noroeste de São Paulo, foram encontrados fósseis de uma espécie ainda desconhecida de dinossauros, pertencente à família dos titanossauros, que viveu há 85 milhões de anos. A diferença entre o dinossauro de Monte Alto e as três dezenas de titanossauros já identificadas está na forma das vértebras do animal, nunca antes vista. Além disso, os pesquisadores já constataram que o novo titanossauro, um adulto em seus 15 metros de comprimento e 15 toneladas, era menor e mais leve do que os espécimes encontrados na Argentina, que chegavam a medir 25 metros e a pesar 25 toneladas. Segundo Reinaldo Bertini, professor da Universidade Estadual Paulista (Unesp), 'isso mostra que os dinossauros dessa região do Brasil provavelmente evoluíram de maneira distinta dos de outras áreas da América do Sul'." (Revista VEJA, 12 de agosto de 1998)

Qual das três espécies terá menor probabilidade de sobreviver se o ambiente em que vive for alterado? Justifique sua resposta.

De acordo com a teoria darwinista, os dinossauros de Monte Alto e da Argentina tiveram um ancestral comum. Para os neodarwinistas, mecanismos evolutivos de VARIAÇÃO, DIREÇÃO e ESPECIAÇÃO atuaram sobre os dois grupos, levando-os a caminhos evolutivos distintos. 65. (Ufrj 2005) Um táxon é classificado como parafilético quando inclui alguns, mas não todos, descendentes de um ancestral comum. Um táxon polifilético contém membros com mais de um ancestral, e um táxon monofilético inclui todos os descendentes de um único ancestral comum. Com base no exposto acima: Observe o diagrama a seguir: a) Cite dois mecanismos responsáveis pelo surgimento de VARIAÇÕES nos dois grupos de dinossauros (do Brasil e da Argentina).

b) Cite o mecanismo evolutivo que DIRECIONOU a formação distinta dos dois grupos.

c) Cite o mecanismo responsável pela especiação.

No diagrama, o conjunto DEF é exemplo de uma dessas três classificações; BCD, de outra; e AB representa um exemplo de um terceiro tipo. Identifique-as.

95

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
69. (Ufu 99) Muitas espécies de insetos, principalmente de mariposas, imitam com suas cores e formas do corpo folhas secas ou amareladas da vegetação. Essa estratégia de defesa, conhecida como camuflagem, é adaptativa para esses animais. Presumindo-se que, quando as mariposas surgiram, todas eram marrons e não tinham nenhuma característica especial que as tornassem parecidas com uma folha, poderíamos supor que essas mariposas teriam surgido da seguinte maneira: Na descendência de um grupo de mariposas, podem ter surgido indivíduos mutantes que apresentavam alguma característica que os tornassem diferentes dos outros e mais parecidos com uma folha,

66. (Ufrj 2006) Um mecanismo de especiação que ocorre em plantas, mas é raro em animais, começa com a hibridação, ou seja, o cruzamento de indivíduos de duas espécies diferentes. Alguns híbridos não são estéreis. Quando os híbridos cruzam somente entre si, podem gerar uma nova espécie ao longo do tempo. Quando os cruzamentos ocorrem entre híbridos, e também entre eles e as espécies ancestrais, não se forma uma nova espécie. Por que o cruzamento com as espécies ancestrais impede a especiação em decorrência da hibridação?

67. (Ufrn 2000) A figura abaixo mostra várias espécies de peixes da Família dos ciclídeos.

como uma variação na cor, uma mancha ou um detalhe da borda das asas. Estas mariposas passaram a deixar mais descendentes que as outras da população, por serem menos predadas. Ao longo das gerações, outras recombinações e mutações foram surgindo, sendo que características que deixassem as mariposas mais parecidas com uma folha seca, portanto mais difíceis de serem encontradas por predadores orientados visualmente, continuaram a ser selecionadas positivamente. Isso possivelmente continua ocorrendo e, por esse motivo, encontramos mariposas que imitam tão perfeitamente folhas.

Com base em seus conhecimentos de evolução e no texto acima, responda: Explique como os fatores evolutivos atuaram na variabilidade morfológica de suas cabeças.

a) Como pode ser caracterizado o argumento acima dentre os diferentes tipos de pensamento evolutivo?

68. (Ufscar 2003) A moderna teoria da evolução admite que a fonte primária da variabilidade dos seres vivos é a mutação gênica.

b) Aponte DUAS características no texto que fundamentem o argumento.

a) Como se pode definir mutação gênica em termos moleculares? b) Por que mutações em células germinativas são mais importantes para a espécie do que aquelas que ocorrem em outras células do corpo?

96

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
73. (Fuvest 96) Entre os cães domésticos encontramos uma grande diversidade morfológica (p. ex.: Fox, São Bernardo, Doberman, Poodle e muitos outros). Já entre os cães selvagens (Cachorro-domato, Lobo-guará), a diversidade é muito menor.

70. (Unicamp 95) Escolha a frase que corresponde ao conceito atual de evolução e dê, para cada uma das outras duas, a razão de não a ter escolhido:

I. A evolução resulta da modificação das populações e não dos indivíduos.

a) Como se explica, em termos evolutivos, essa diferença? b) Que nível taxonômico atribuímos à grande diversidade encontrada dentro de cada grupo de animais domésticos? Por quê?

II. A evolução ocorrerá tanto mais rapidamente quanto mais os indivíduos se modificarem para se adaptar ao ambiente.

c) Por que os cães "vira-latas" são, em média, mais resistentes a doenças que os cães com pedigree?

III. Os indivíduos que vencem a "luta pela sobrevivência" são os que determinam o rumo da evolução, não importando se produzem descendentes e quantos eles são.

74. (Fuvest 2000) Os fatos a seguir estão relacionados ao processo de formação de duas espécies a partir de uma ancestral:

I. Acúmulo de diferenças genéticas entre as populações. 71. (Unicamp 99) Aves que não voam são nativas da África (avestruzes), América do Sul (emas), Austrália (emus e casuares) e Nova Zelândia (kiwi). a) Considerando que essas aves têm um ancestral comum, como se pode explicar a distribuição atual pelos diferentes continentes? b) Que processos provocaram a diferenciação dos animais dessas regiões? b) Que mecanismos são responsáveis pelas diferenças genéticas entre as populações? 72. (Unifesp 2007) Em 1839, um único exemplar de figo-da-índia, planta da família dos cactos, foi levado do Brasil para a Austrália, onde essas plantas não existiam. Em 40 anos, quatro milhões de hectares daquele país estavam cobertos pela planta e, depois de 90 anos, essa área era de 25 milhões de hectares. No final da década de 1990, algumas plantas de figo-da-índia foram trazidas da Austrália para o Brasil para que seu pólen fosse inoculado em flores das plantas daqui, visando aproveitamento econômico dos resultados. Depois de algum tempo, porém, verificou-se que essas plantas inoculadas com pólen das plantas australianas não produziam frutos. a) Considerando que clima, solo e condições físicas do ambiente entre a Austrália e o Brasil são semelhantes e que ambos possuem biomas com características parecidas, elabore uma hipótese para explicar por que na Austrália o figo-da-índia invadiu uma área tão grande, enquanto aqui isso não ocorreu. b) Como você explica que plantas brasileiras submetidas à polinização com pólen de plantas australianas, no final da década de 1990, não tenham produzido frutos? a) Explique sucintamente como as duas populações podem ter-se tornado morfologicamente distintas no decorrer do tempo. b) No caso de as duas populações voltarem a entrar em contato, pelo desaparecimento da barreira geográfica, o que indicaria que houve especiação? 76. (Uff 2005) Diferentes espécies de peixes herbívoros marinhos do mesmo gênero são encontradas nas regiões tropicais do Oceano Atlântico, tanto na costa do Continente Americano, quanto na costa do Continente Africano. 75. (Fuvest 2005) Devido ao aparecimento de uma barreira geográfica, duas populações de uma mesma espécie ficaram isoladas por milhares de anos, tornando-se morfologicamente distintas. c) Qual é a importância do isolamento reprodutivo no processo de especiação? a) Qual é a seqüência em que os fatos anteriores acontecem na formação das duas espécies? II. Estabelecimento de isolamento reprodutivo. III. Aparecimento de barreira geográfica.

97

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
77. (Ufrj 2003) Alguns anfíbios possuem venenos que têm por base compostos químicos alcalóides. Os alcalóides obtidos a partir dessas espécies vêm sendo utilizados em pesquisas biomédicas, por causa de suas propriedades farmacológicas. Os cientistas acreditam que o conhecimento das relações evolutivas (filogenéticas) dos anfíbios pode auxiliar na escolha das espécies a serem estudadas na busca de novos alcalóides. A figura a seguir mostra as relações evolutivas entre cinco espécies de anfíbios. As espécies 'Phyllobates terribilis' e 'Epipedobates tricolor' apresentam alcalóides, enquanto a espécie 'Rana palmipes' não possui este tipo de substância.

Após estudos sobre este grupo, foi possível elaborar o diagrama e o quadro a seguir, onde espécies supostamente distintas foram representadas por diferentes letras.

a) Considerando os mecanismos de especiação, como poderia ser explicado o surgimento das espécies C e D a partir de uma espécie ancestral? b) Das espécies citadas, qual delas mais se assemelha à espécie ancestral? c) Que tipo de relação/interação ecológica pode ocorrer entre D e E? Justifique sua resposta. Identifique qual das duas espécies, A ou B, deveria ser estudada primeiro pelos cientistas na busca por alcalóides de interesse farmacológico. Justifique sua resposta.

78. (Ufrj 2005) Indivíduos de espécies diferentes podem viver em simpatria, ou seja, viver no mesmo lugar ao mesmo tempo, conservando-se como espécies diferentes, pois são isolados reprodutivamente. Indivíduos de duas subespécies da mesma espécie apresentam diferenças genéticas características de cada subespécie, mas não apresentam isolamento reprodutivo.

Duas subespécies podem viver em simpatria, mantendo-se como subespécies diferentes? Justifique sua resposta.

98

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
81. (Ufv 2000) O processo de especiação dos seres vivos é acompanhado, ao longo do tempo, por modificações das freqüências gênicas de suas populações.

79. (Ufrj 2006) Os tigres de dentes-de-sabre são mamíferos extintos. Esses animais possuíam caninos superiores muito desenvolvidos, em forma de sabre. Um fato menos conhecido é que houve várias espécies de mamíferos placentários com dentes-de-sabre. O diagrama a seguir mostra a filogenia provável dos tigres de dentesde-sabre placentários 'Barbourofelis' e 'Smilodon'.

a) Basicamente, como a seleção natural interfere nessas modificações?

b) Além dos mecanismos da seleção natural, cite DOIS exemplos, reconhecidos evolutivamente, de fatores que interferem nessas modificações.

82. (Unesp 92) Considere os esquemas 1 e 2 a seguir, representativos das populações A e B em dois momentos diferentes.

A presença da característica dentes-de-sabre em 'Barbourofelis' e 'Smilodon' representa um caso de homologia ou de analogia? Justifique sua resposta.

80. (Ufrrj 99) Embora sejam popularmente chamados de "ursos", na realidade o urso castanho de origem européia, 'Ursus arctos'; o urso preto americano, 'Euarctos americanus'; e o urso polar branco, 'Thalarctos maritimus', são animais distintos. Em um primeiro momento, a situação seria como representado em 1, após um determinado período de tempo, a representação seria como mostra o esquema 2: a) Se fosse possível o encontro do urso castanho com o urso polar, um suposto acasalamento resultaria em reprodução? Justifique. Compare os dois esquemas e responda: a) O que representa a região hachurada no esquema 1? b) O que poderia ter ocorrido com os indivíduos correspondentes a b) Explique por que ocorreu a diferenciação entre esses animais? essa região, no esquema 2?

99

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
diferença na freqüência de nascimento de crianças aa entre essas regiões? Por quê?

83. (Unesp 2003) As populações A, B, C e D vivem em quatro regiões geográficas diferentes. Quando os indivíduos dessas populações foram colocados juntos, cruzaram-se e os resultados obtidos foram os seguintes:

86. (Uerj 2004) Segundo o Teorema de Hardy Weinberg, uma população ideal deve atingir o equilíbrio, ou estado estático, sem grandes alterações de seu reservatório genético. Em uma das ilhas do arquipélago de Galápagos, uma das condições estabelecidas por Hardy e Weinberg para populações ideais foi seriamente afetada por uma erupção vulcânica ocorrida há cerca de cem mil anos. Esta erupção teria diminuído drasticamente a população de jabutis gigantes da ilha. a) Cite duas das condições propostas por Hardy e Weinberg para que o equilíbrio possa ser atingido. b) Defina o conceito de evolução em função da freqüência dos genes de uma população e indique de que forma a diminuição da população

a) O que se pode concluir do fato de os cruzamentos A × B, A × D e B × D terem produzido descendentes férteis? Que fator inicial poderia ter dado origem às populações A, B, C e D? b) Que nome se dá às espécies diferentes que vivem numa mesma região geográfica? Indique um exemplo de animais vertebrados que, quando cruzados entre si, produzem descendentes estéreis.

afetou a evolução dos jabutis gigantes.

87. (Ufrj 2004) Estudos recentes compararam as seqüências completas de DNA mitocondrial de indivíduos de várias regiões geográficas do planeta.

Os resultados revelaram que a variabilidade genética no DNA 84. (Unicamp 97) Em um arquipélago oceânico, todas as ilhas são habitadas por aves de um mesmo gênero. Cada ilha possui uma única espécie deste gênero e as diferenças morfológicas principais entre elas são o tamanho e o formato do bico. a) Qual foi a primeira etapa desse processo de especiação? b) Que pressão seletiva deve ter determinado a presença de aves com bicos diferentes em diferentes ilhas? c) Qual seria o procedimento para confirmar que as aves encontradas nas diferentes ilhas são de fato espécies diferentes? Explique por que a maior diversidade do DNA mitocondrial apóia a idéia da origem africana do 'Homo sapiens'. 88. (Unesp 2006) Analise a lista: Carl Linée (Lineu) - (17071778)Natureza dos Estudos Desenvolvidos Propôs um modelo para a classificação biológica moderna baseado 85. (Fuvest 2001) Um determinado gene de herança autossômica recessiva causa a morte das pessoas homozigóticas aa ainda na infância. As pessoas heterozigóticas Aa são resistentes a uma doença infecciosa causada por um protozoário, a qual é letal para as pessoas homozigóticas AA. nas semelhanças e diferenças entre estruturas dos seres vivos. mitocondrial de indivíduos africanos era quase o dobro da observada no DNA mitocondrial de não-africanos. Esses resultados foram importantes para corroborar a idéia de que o ancestral comum mais recente do 'Homo sapiens' viveu na África há cerca de 200.000 anos.

Considere regiões geográficas em que a doença infecciosa é endêmica e regiões livres dessa infecção. Espera-se encontrar

100

salabioquimica.blogspot.com
Comentários

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
Seus trabalhos fundaram as bases da biologia molecular e sem suas propostas revolucionárias não seriam possíveis os testes de paternidade, os estudos sobre os genomas, os transgênicos e a clonagem.

A proposta de classificação de Lineu foi logo deixada de lado pelos biólogos, uma vez que hoje a espécie é tomada como ponto de partida para classificação.

Robert Kock (1843-1910) Natureza dos Estudos Desenvolvidos Kock tornou-se muito conhecido pelos seus trabalhos sobre origem da vida, defendendo a geração espontânea. Comentários Suas pesquisas na área da medicina levaram-no à descoberta do bacilo da tuberculose.

a) Selecione, entre os cientistas citados, um, para o qual a descrição da natureza dos estudos desenvolvidos, esteja correta, e outro, cuja descrição da natureza dos estudos desenvolvidos esteja errada. Neste último caso, justifique por que a descrição está errada. b) Considerando os dois cientistas escolhidos em (a), responda se os comentários apresentados, sobre os estudos que eles desenvolveram, condizem com a realidade. Justifique sua resposta.

Gregor Mendel (1822-1884) Natureza dos Estudos Desenvolvidos Seus trabalhos sobre a transmissão de características hereditárias não foram valorizados de imediato pela comunidade científica, logo após a sua publicação. Comentários As descobertas de Mendel forneceram elementos importantes para a formulação das teorias neodarwinistas sobre o processo evolutivo.

89. (Unicamp 2003) A figura a seguir representa uma árvore filogenética do Filo Chordata. Cada retângulo entre os ramos representa o surgimento de novidades evolutivas compartilhadas por todos os grupos dos ramos acima dele.

Charles Darwin (1809-1882) Natureza dos Estudos Desenvolvidos Publicou o livro "A Origem das Espécies", no qual propõe um mecanismo consistente para explicar o processo evolutivo. Comentários Os estudos de Mendel foram decisivos para que Darwin elaborasse a teoria da evolução e sugerisse como se dá o processo de seleção natural. a) O retângulo I indica, portanto, que todos os cordados apresentam caracteres em comum. Cite 2 destes caracteres. b) Cite uma novidade evolutiva que ocorreu no retângulo II e uma que ocorreu no retângulo III. Explique por que cada uma delas foi importante para a irradiação dos cordados.

James Watson (1928- ) Natureza dos Estudos Desenvolvidos Juntamente com Francis Crick (1916-2004) inventou uma técnica que permitiu manipular a molécula de DNA, iniciando assim a era da engenharia genética. Comentários

101

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
GABARITO

90. (Unifesp 2002) A banana que utilizamos na alimentação tem origem por partenocarpia, fenômeno em que os frutos são formados sem que tenha ocorrido fecundação. Existem, porém, bananas selvagens que se originam por fecundação cruzada. 1. a) A espécie introduzida e adaptada ao novo ambiente ocupará determinado nicho ecológico. Se predador, atuará no controle do a) Uma pessoa perceberia alguma diferença ao comer uma banana partenocárpica e uma banana originada por fecundação cruzada? Justifique. número de presas. Sendo presa, pode alimentar um número maior de predadores. Caso seja um produtor, poderá servir de alimento aos consumidores primários.

b) Qual dos dois tipos de bananeira teria maior sucesso na colonização de um novo ambiente? Justifique.

b) Desequilíbrios ambientais podem favorecer o aumento de variações produzidas casualmente por mutações. Exemplo: mariposas melânicas adaptadas em regiões cujas árvores acham-se cobertas pela

91. (Uerj 98) CAVERNA DA ROMÊNIA ABRIGA ANIMAIS QUE VIVEM SEM AR

fuligem produzida pela atividade industrial.

2. a) Mutações e recombinações gênicas geram variabilidade, (...) Ela é formada por conjuntos de corredores extremamente estreitos. Em alguns deles não há oxigênio. Os pesquisadores disseram que as espécies encontradas são muito resistentes e sobrevivem com quantidades de ar fatais para outros seres vivos. (O GLOBO, 26/12/96) b) O D.D.T é um organoclorado pouco degradável, portanto apresenta efeito acumulativo. Pode ser aplicado no ambiente terrestre a) Cite a função do oxigênio na cadeia respiratória e, com base na Teoria Sintética da Evolução, explique como os seres anaeróbicos conseguiram sobreviver no ambiente das cavernas. b) Se afirmamos que as espécies que viviam na caverna começaram a sofrer adaptações para conseguirem sobreviver sob as novas condições, estamos fazendo alusão a uma teoria evolutiva. Cite o nome dessa teoria e justifique sua resposta. 4. a) Mitocôndrias são responsáveis pela oxidação de compostos orgânicos, fenômeno que libera a energia necessária ao funcionamento celular. As células "hospedeiras" fornecem as 92. (Fuvest 99) É comum o cruzamento entre jumento e égua para se obter o híbrido conhecido como burro. Este apesar de seu vigor físico, é estéril. a) Sabendo-se que o número diplóide de cromossomos do jumento é 62 e o da égua 64, quantos cromossomos devem estar presentes em cada célula somática do burro? b) Com base no conceito biológico de espécie, o jumento e a égua pertencem à mesma espécie? Por quê? b) Cloroplastos são organóides responsáveis pela fotossíntese. Através deste processo bioquímico são produzidas as substâncias orgânicas que mantém as cadeias e teias alimentares dos ecossistemas terrestres e aquáticos. Além disso, o consumo de dióxido de carbono e a produção de oxigênio contribuem para a manutenção da composição da atmosfera terrestre. condições apropriadas para a sobrevivência e reprodução destes organóides. 3. Mitocôndrias possuem DNA, RNA, produzem suas proteínas e são capazes de se autoduplicar. e, posteriormente, contaminar o ambiente aquático. portanto existem insetos não-resistentes e resistentes. As toxinas agem selecionando os insetos resistentes e eliminando os não-resistentes (seleção natural).

102

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
- bioquímica comparada; - existência de estruturas vestigiais; - homologias; - embriologia comparada.

5. a) Uma única variedade de trigo diminui a probabilidade de adaptação, no caso de alterações ambientais. Com maior número de variedades, a chance de algumas sobreviverem às alterações é maior.

b) O efeito estufa é uma alteração que poderia levar esta variedade a extinção. Um banco de genes garante a variabilidade genética. b) A mutação gênica é a fonte de novos genes, o que determina a variabilidade dentro dos grupos biológicos, sobre a qual age a seleção 6. a) Floresta pluvial tropical. natural.

b) Nas florestas tropicais a grande diversidade de condições abióticas tais como temperatura, umidade, luminosidade, relevo etc., favorece a diversificação de inúmeras espécies que podem ocupar diferentes nichos ecológicos.

9. a) Fossilização b) A seqüência de fósseis nas diversas camadas de rochas, das mais antigas às mais recentes, mostra uma composição bem diferenciada, havendo um aumento gradativo em complexidade e diversidade. Essa seqüência representa uma mudança gradual nas espécies de épocas

c) Ilhas se constituem em ambientes propícios para a evolução de espécies exclusivas, pois estão isoladas geograficamente dos continentes.

diferentes.

10. O estudo comparado de registros fósseis e a análise comparativa das seqüências de bases nitrogenadas do DNA de espécies distintas

7. a) Os morcegos que se alimentam de néctar de flores contribuem para a polinização. Dispersam sementes as espécies frugívoras. Os insetívoros controlam as populações de insetos dos quais se alimentam.

pode permitir a determinação do grau de parentesco evolutivo.

11. Os dinossauros são répteis que surgiram no Período Triássico, da Era Mesozóica há cerca de 200 milhões de anos. As coníferas surgiram há cerca de 280 milhões de anos, no Período Permiano da

b) Homólogos são órgãos que possuem a mesma origem embrionária, independentemente de sua função. Ex: Asas dos morcegos e asas das aves.

Era Paleozóica. Possuem vasos condutores eficientes para o transporte de seiva elaborada, o floema e não há evidências de que produziam substâncias tóxicas que os répteis herbívoros não pudessem identificar pelo sabor.

Análogos são órgãos que possuem a mesma função, independentemente de sua origem embrionária. Ex: Asas dos morcegos e asa dos insetos. 12. a) O escurecimento das árvores pela fuligem favoreceu as mariposas escuras que, camufladas, puderam sobreviver à ação dos predadores. Com maiores chances de sobrevivência e de reprodução, c) São características exclusivas dos animais da classe Mamíferos: as mariposas melânicas puderam aumentar em número neste período.

- pêlos - glândulas mamárias, sebáceas e sudoríparas - músculo diafragma - placenta - hemácias anucleadas

b) É possível verificar que se trata de um caráter hereditário através de cruzamentos e da análise da descendência. O caráter em questão se comporta de acordo com as leis de Mendel.

13. As borboletas melânicas se adaptaram melhor ao ambiente escurecido pela fuligem. As variedades claras são alvos mais fáceis

8. a) Evidências da evolução biológica: - fósseis;

de seus predadores quando pousadas sob um fundo escuro.

103

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
21. O gene A‚, pois é um letal recessivo, ficando protegido da seleção natural quando em heterozigose, enquanto o gene B‚ e um letal dominante, sendo eliminado mesmo em dose simples.

14. a) as mariposas camufladas são pouco vistas pelo predador, determinando uma seleção natural pelo meio ambiente. b) Segundo Lamarck, as mariposas claras se transformariam em escuras e transmitiriam esta característica para os seus descendentes.

22. O gene B‚ da população 2. O gene B‚ fica protegido da seleção 15. a) A afirmação é verdadeira pois os antibióticos podem agir como agentes selecionadores de bactérias resistentes. nos heterozigotos e, por isso, sua freqüência é maior que zero. Na população 1, todos os genes A• são eliminados a cada geração, logo sua freqüência será zero. b) A aplicação de dois antibióticos simultaneamente é mais eficaz pois um potencializa a ação do outro (sinergismo). 23. a) Porque todo O‚ produzido nesta época se combinou com o íon ferroso até o esgotamento deste. 16. Ao acrescentar-se o antibiótico, as bactérias sensíveis foram eliminadas. Os microorganismos geneticamente resistentes, que haviam em pequeno número, foram selecionados e cresceram normalmente. 24. a) (x) Ocorreu uma adaptação dos trevos ao local em que foram semeados. 17. Até 1998 a administração de antibióticos eliminaram grande parte das bactérias sensíveis, favorecendo a multiplicação das bactérias resistentes. Os dados relativos ao ano 2000 mostram um aumento na proporção de bactérias sensíveis, indicando que elas possuem características que as favorecem na competição com as resistentes na ausência de antibióticos. b) A diferença entre os dois grupos de plantas observados pelo botânico em seu jardim experimental indica a ocorrência de seleção 18. O uso crescente da penicilina criou um ambiente em que a seleção natural favoreceu as cepas resistentes, cuja freqüência aumentou com o tempo. no grupo A. Isto contribuiu para a adaptação das plantas ao meio ambiente (área em que o gado pastava), favoreceu alguns genótipos e promoveu o predomínio de fenótipos (plantas rasteiras) que aumentaram a sobrevivência da espécie (trevos). 19. Não. Os antibióticos selecionam as linhagens de bactérias resistentes, eliminando apenas as sensíveis. 25. a) facilidade para alcançar a presa e fugir dos predadores (x) Ocorreu o favorecimento de alguns genótipos em relação a outros. (x) Ocorreu a predominância de indivíduos com fenótipos que aumentavam sua sobrevivência. b) O acúmulo de O‚ representou uma mudança ambiental que favoreceu os organismos mais adaptados à aerobiose.

20. a) Os indivíduos portadores do gene S são resistentes à Malária.

b) o salto exige um esforço maior, o que promove uma maior produção de energia, liberada pelo ATP, produzidas na mitocôndria.

b) Agente etiológico: 'Plasmodium sp.' Vetor: fêmeas infectadas do mosquito-prego (Gen. Anopheles) 26. a) Os animais, por serem heterotróficos, necessitavam de ambiente com disponibilidade de alimentos orgânicos que somente se Resumo do ciclo vital: Homem (hospedeiro intermediário) ë Mosquito (hospedeiro definitivo) ë Homem. tornaram disponíveis com a colonização do continente pelos vegetais, que são autotróficos e capazes de sintetizar substâncias orgânicas a partir de substâncias inorgânicas (água, gás carbônico e sais minerais) e energia solar. Nesse processo, os vegetais liberam o oxigênio para a atmosfera, transformando-a de redutora para oxidante, condição propícia para os animais aproveitarem de maneira

104

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
30. Região A. A forma e o tamanho dos bicos das aves estão relacionados ao tipo de alimentação. Aves com bicos semelhantes tendem a competir por alimento. A migração de várias espécies reduz a competição na época da reprodução, quando a demanda por alimento é maior.

mais eficiente os carboidratos na respiração aeróbica. Além disso, a combinação de moléculas de oxigênio, formando o ozônio, permitiu que raios ultravioleta fossem filtrados, diminuindo a incidência desse tipo de radiação sobre a superfície terrestre.

b) Poderão ser escolhidas duas destas opções, entre outras: 1. Desenvolvimento de exoesqueleto quitinoso, impermeável à água, para evitar dessecação do corpo quando em contato com a atmosfera. 2. Desenvolvimento de escamas epidérmicas recobrindo o corpo, como no caso dos répteis, para evitar dessecação quando em contato com a atmosfera. 3. Desenvolvimento de sistema de locomoção adequado à ocupação do novo ambiente (patas e/ou asas), permitindo a busca de novas fontes de alimentos e novos habitats, bem como a fuga para longe dos predadores. 4. Desenvolvimento de respiração traqueal, pulmonar e cutânea adequadas à ocupação do novo ambiente. 5. Desenvolvimento de fecundação interna e o ovo revestido por "casca" para proteção contra dessecação. b) Pernas desmesuradas permitem aos animais cavernícolas o deslocamento rápido com a finalidade de atacar e evadir-se de predadores; abundância de cerdas determinam grande capacidade de 27. a) Escassez de água. percepção sensorial do ambiente escuro de cavernas. 32. a) A falta de luz não pode fazer com que os peixes fiquem cegos. Esta seria uma explicação lamarckista, ou seja, o ser vivo pode se modificar ativamente em resposta às mudanças ambientais. O ambiente escuro das cavernas selecionou os peixes cegos. Tais peixes devem apresentar outras características que os adaptam muito bem a este tipo de ambiente. 31. Os ovos dos répteis protegem os embriões da desidratação e permitem a reprodução fora do ambiente aquático, possibilitando a colonização dos ambientes terrestres.

b) As sementes fornecem gordura que pode ser oxidada para repor a água perdida. Ausência de glândulas sudoríparas impede a perda de água pela sudorese no calor do deserto. À noite a temperatura do deserto cai, evitando o calor diurno e conseqüente desidratação. O focinho afilado e comprido também evita a perda de água.

c) Crustáceos ë Peixes ë Sanguessugas

33. a) Poríferos, moluscos, anelídeos, artrópodes e cordados possuíam representantes no meio aquático. Considerando as plantas, existiam as algas verdes.

28. a) Não, porque os heterozigotos (AA‚) são resistentes aos insetos predadores. b) Não, porque os heterozigotos (AA‚) são capazes de sobreviver nas condições climáticas da ilha.

b) - cutículas e estômatos; - tubo polínico; - tecido vascular; - raiz, caule e folhas.

29. a) O macho que detém o território de melhor qualidade é escolhido primeiro. b) As fêmeas que escolhem os machos que ocupam os melhores territórios têm, evolutivamente, mais chance de criar sua prole; a seleção natural, portanto, deve ter favorecido aquelas fêmeas com maior capacidade de analisar a qualidade do território ocupado por um macho.

34. Seleção Natural. A vocalização serve para atrair as fêmeas da própria espécie para o acasalamento, evitando acasalamentos entre indivíduos de espécies diferentes. As populações alopátricas têm vocalizações mais semelhantes do que as populações simpátricas. No primeiro caso não há possibilidade de atrair indivíduos da outra espécie, já no segundo caso, onde as espécies ocupam a mesma área, a seleção natural favorece a maior diferenciação do canto.

105

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
resistência ao praguicida foi conferida aos animais através de MUTAÇÃO GÊNICA, fenômeno casual e espontâneo que determina a variabilidade entre os indivíduos de uma mesma espécie.

35. A pressão seletiva foi o gradual acúmulo de oxigênio na atmosfera, produzido por organismos fotossintetizadores. Nessas circunstâncias, o oxigênio seria tóxico para as células que não pudessem utilizá-lo e, assim, as células que adquiriram as mitocôndrias tinham mais chance de sobreviver. Além disso, puderam catabolizar a glicose mais eficientemente através das vias oxidativas.

41. As células da pele não adquiriram a capacidade de produzir a melanina devido a intensa radiação solar. Segundo a teoria darwinista os indivíduos que produzem mais melanina são adaptados, ao contrário dos que produzem pouca, que são menos adaptados.

36. A aquisição de mitocôndrias, pois ela permitiu a utilização (consumo) do oxigênio produzido pelos cloroplastos. Além disso, as mitocôndrias estão presentes em fungos, plantas e animais, e os cloroplastos, somente em plantas, indicando que a aquisição de mitocôndrias aconteceu antes da separação entre animais e plantas, isto é, em um ancestral comum a ambos. 43. a) Lamarck porque preconiza que as "patas" do golfinho se transformaram em nadadeiras, pelo uso exagerado, para se adaptar ao ambiente aquático. 37. a) Bactérias e mitocôndrias apresentam DNA e RNA e, conseqüentemente, capacidade de crescimento e autoduplicação. b) No interior da célula hospedeira as bactérias recebem nutrientes e ficam protegidas. Em contrapartida, fornecem moléculas de ATP, produzidas durante a respiração aeróbica. c) Cloroplastos. 44. a) Os seres vivos mais adaptados vencem a competição pelos recursos do meio e deixam maior número de descendentes. 38. Convergência evolutiva ou convergência adaptativa. Evolução de uma característica semelhante em duas ou mais espécies, de modo independente, para permitir a adaptação a um ambiente comum. 45. a) Segundo a teoria lamarckista os antibióticos induziram a resistência em algumas bactérias. 39. No experimento realizado, os mosquitos da região B mostraramse muito mais resistentes ao inseticida do que os da região A. Os mosquitos da região B, ao contrário dos mosquitos da região A, já devem ter tido contato com o malation em período anterior ao experimento, o que desencadeou um processo de seleção artificial induzido pelo homem, tendo os mosquitos sensíveis já sido eliminados anteriormente. Desta forma, a maioria dos mosquitos coletados na área B já possuíam resistência ao agrotóxico e se reproduziram sem problemas. A região B deve ser, então, a região agrícola. 47. a) A proposição de Anaximandro pode ser genericamente comparável à de Lamarck: os órgãos e estruturas dos seres vivos se 40. Dona Gertrudes pode observar a EVOLUÇÃO da população de lagartas em sua horta. A MUDANÇA AMBIENTAL provocada pelo inseticida utilizado acabou por SELECIONAR lagartas resistentes. A desenvolvem ou se atrofiam em função da influência ambiental e do uso ou desuso desses órgãos. 46. Lamarck teria afirmado que as bactérias desenvolveram e transmitiram a resistência ao antibiótico a seus descendentes. Darwin afirmaria que o antibiótico selecionou as variedades resistentes. Estas se multiplicam produzindo mais bactérias resistentes. b) Segundo a teoria darwinista os antibióticos agem como agentes selecionadores, portanto sobrevivem as bactérias resistentes. b) Vertebrados capazes de delimitar e defender seu território conseguem se acasalar com maior número de fêmeas. b) A frase está em desacordo com a teoria de Darwin porque os golfinhos foram selecionados nesse ambiente, dentre as variações produzidas pelos seus ancestrais. 42. A interpretação é lamarckista, pois sugere que o animal se modifique para se adaptar às mudanças ambientais.

106

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
51. O cartum A representa a evolução darwinista, isto é, na população existia um indivíduo com uma mutação - a bóia - que permitirá sua sobrevivência e possivelmente a sobrevivência da sua espécie. No cartum B, está implícito que a necessidade condicionará a evolução, isto é, para recuperar a bola os animais aquáticos

A proposição de Empédocles antecipou os princípios fundamentais da teoria da seleção natural de Darwin: ocorrem alterações nos seres vivos, mas apenas os organismos modificados que são mais aptos sobrevivem e se reproduzem.

b) Uma maior ou menor diferença entre as estruturas primárias de um tipo de proteína encontrada em várias espécies indicam um maior ou menor número de mutações ocorridas. A quantidade de mutações, por sua vez, é proporcional ao tempo decorrido desde que tais espécies se originaram de um ancestral comum.

eventualmente terão que invadir o ambiente terrestre. Esta é uma visão tipicamente lamarckista.

52. Segundo Lamarck os cactos conseguem se modificar para evitar os iguanas. Segundo Darwim os iguanas selecionaram as variedades de cactos capazes de produzir flores acima do solo.

48. a) Segundo a teoria de Darwin, seria esperado que o número de indivíduos da espécie residente com bico mais largo aumentasse, pois eles conseguiriam se alimentar das sementes maiores; conseqüentemente, apresentariam uma chance maior de sobrevivência e de reprodução, produzindo um maior número de descendentes. Os indivíduos com bicos menores teriam menor quantidade de sementes à disposição, pois não conseguiriam se alimentar das sementes maiores e muitos morreriam de fome, o que ocasionaria um menor número de descendentes. Assim, é esperado que haja um aumento no tamanho médio do bico da população de tentilhões residentes. b) O processo evolutivo envolvido é a seleção natural. c) Com o estabelecimento da competição por alimento, os tentilhões invasores, que possuem bico maior, teriam vantagem em relação à obtenção das sementes maiores. O número de indivíduos com bico maior, da espécie nativa, tenderá a diminuir. d) Os indivíduos de bico menor se alimentarão das sementes menores disponíveis e aumentarão o número de descendentes. Assim, o tamanho médio do bico dos tentilhões residentes diminuiria. b) Segundo a teoria sintética da evolução (neodarwinismo) surgem, naturalmente, como resultado de mutações, linhagens de bactérias resistentes aos antibióticos. Deste modo, após décadas de seleção, os medicamentos usualmente aplicados se tornariam inócuos, pois seriam preservados diversos tipos de microorganismos resistentes. 49. Os peixes capazes de completar seu ciclo vital num curto intervalo de tempo em que há chuvas foram selecionados neste tipo de ambiente. 56. a) Do ponto de vista evolutivo, o uso de uma única droga aumentaria a probabilidade de serem selecionadas linhagens virais resistentes a esse medicamento, anulando o seu efeito. 50. Nas regiões tropicais as espécies de insetos herbívoros mais numerosas se alimentam das plantas que não produzem os alcalóides evitando as que o produzem. Mais adaptadas, as que fabricam os alcalóides, deixam maior número de descendentes. 57. Os vegetais que produzem flores amarelas, dentre outras variações, foram mais bem sucedidos e puderam deixar maior b) O uso conjunto das três drogas pode ocasionar mudanças nos aminoácidos, na estrutura espacial da enzima, no seu centro ativo, etc., inativando a enzima e melhorando a eficácia do tratamento. 55. a) Os antibióticos selecionaram as bactérias naturalmente resistentes, eliminando as sensíveis. b) Lamarck acreditava que o ambiente determinava o rumo da evolução criando "necessidades" e os seres vivos se modificariam para atendê-las. 54. a) Charles Darwin. 53. A frase 1 é lamarckista porque sugere que os gafanhotos se tornaram verdes para viver na grama. A frase 2 é darwinista porque indica que os gafanhotos verdes levam vantagem (camuflagem) sobre os de outras cores. Estes seriam eliminados pelos predadores.

107

salabioquimica.blogspot.com
polinizador.

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
c) Animal b. Os anelídeos terrestres possuem respiração cutânea e, por este motivo, precisam manter a pele sempre úmida para poder

número de descendentes já que foram selecionados pelo tipo de

58. a) Os coelhos foram submetidos a um processo de seleção natural, ou seja, foram eliminados os animais sensíveis e preservados os resistentes que puderam recuperar o tamanho da população.

realizar eficientemente as trocas gasosas com o ambiente.

63. a) VARIAÇÕES hereditárias são resultantes de mutações, recombinações gênicas, combinações cromossômicas na

b) Os mosquitos vetores contribuíram para a sobrevivência dos coelhos transmitindo entre os indivíduos desta população formas atenuadas do vírus mixoma.

gametogênese e na fecundação.

b) A SELEÇÃO NATURAL e a DERIVA GENÉTICA (ACASO) direcionaram a formação distinta dos dois grupos em ambientes

59. a) Aves e mamíferos geneticamente capazes de trocar, respectivamente, penas e pêlos, têm maiores chances de sobrevivência em ambientes onde ocorrem grandes contrastes entre as estações primaveril e invernal.

diferentes.

c) A ESPECIAÇÃO é conseqüência da seleção diferenciada a partir de uma população ancestral. Seus componentes, através de migrações, se isolaram geograficamente e, após muitas gerações,

b) Cores e desenhos marcantes podem servir de advertência aos predadores pois indicam que a "possível" presa possui sabor desagradável ou veneno. É característica favorável pois pode garantir a sobrevivência dos anfíbios e insetos que apresentam tais características.

foram fixadas novas variações que resultaram em isolamento reprodutivo.

64. Os chitas ou guepardos, pois sua baixa heterozigose indica reduzida variabilidade genética. Essa reduzida variabilidade pode dificultar a adaptação a um novo ambiente.

60. a) "A" representa MUTAÇÕES b) Crossig-over e segregação cromossômica na meiose. c) "B" representa a SELEÇÃO NATURAL. 66. Porque sem isolamento reprodutivo o cruzamento dos híbridos 61. a) A seleção natural diferencial, ocorrida durante milhares de anos, resultou nas diferenças morfológicas observadas nas populações isoladas geográficamente. 67. A variabilidade morfológica da cabeça dos peixes é o resultado de mutações e recombinações gênicas, submetidas ao efeito da b) As populações formarão raças geográficas de uma mesma espécie caso as diferenças resultantes da seleção natural não impeçam o livre cruzamento e a produção de descendência fértil. Ao contrário, se for interrompido o fluxo gênico entre os indivíduos das populações, devido aos mecanismos que levam ao isolamento reprodutivo, podese considerar que houve especiação. 68. a) A mutação gênica é uma alteração na seqüência de bases do DNA. b) Porque, através das células germinativas, as mutações passam para os gametas e, conseqüentemente, afetam as próximas gerações. seleção natural, em seus respectivos ambientes. com as espécies ancestrais mantém o fluxo gênico. 65. DEF é monofilético. BCD é polifilético. AB é parafilético.

62. a) Árvore I. Os diplópodes (a) e as minhocas (b) apresentam neste cladograma um ancestral comum (Annelida) mais próximo.

69. a) Teoria sintética da evolução biológica.

b) Surgimento de variações a partir de mutações e recombinações b) Aranhas e escorpiões. genéticas.

108

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
b) O processo de especiação é evidenciado pelo isolamento reprodutivo, fenômeno que interrompe o fluxo gênico entre as populações.

70. A frase I está de acordo com o conceito moderno de evolução biológica. Na frase II aparece a idéia Lamarckista de que os seres se modificam para se adaptar às condições ambientais. A frase III também não está de acordo, pois preconiza que qualquer ser vivo que vença a luta pela sobrevivência poderia produzir descendência.

76. a) As populações da espécie ancestral foram isoladas geograficamente. Depois, as populações isoladas acumularam diferenças genéticas, resultantes de mutações e seleção natural. Por

71. a) Teoria da Deriva Continental. b) Isolamento geográfico, seleção natural e isolamento reprodutivo (especiação).

fim, essas diferenças foram acumuladas até que as populações não conseguiram produzir descendentes férteis, ou seja, sofreram isolamento reprodutivo e, portanto, podem ser consideradas espécies distintas.

72. a) Ocorrência de um nicho disponível, falta de competidores, predadores e parasitas. b) A espécie E.

b) Ocorreu o isolamento geográfico, que provavelmente, levou a um isolamento reprodutivo. Ocorreu o processo de especiação.

c) Competição interespecífica. As espécies D e E ocorrem no mesmo continente, se alimentam do mesmo tipo de algas, têm o mesmo habitat e período de alimentação, ou seja, nicho ecológico

73. a) Os cães domésticos passam por uma seleção artificial enquanto os selvagens são naturalmente selecionados pelo meio. b) Raças ou subespécies, porque podem produzir descendência fértil. c) Os vira-latas apresentam maior variabilidade e resistência porque se cruzam ao acaso.

semelhante, disputando, portanto, os mesmos recursos do meio.

77. Espécie B. As espécies 'P. terribilis' e 'E. tricolor' são evolutivamente mais próximas entre si, isto é, possuem um ancestral comum que não é compartilhado com 'R. palmipes' (espécie que não apresenta veneno) nem com a espécie A. A característica de interesse

74. a) A seqüência de fatos é: III, I e II.

(presença de veneno) compartilhada pelas duas primeiras espécies pode ter surgido em seu ancestral comum mais próximo. Nesse caso,

b) As diferenças genéticas observadas são o resultado de mutações, recombinações gênicas, combinações cromossômicas na formação de gametas e da fecundação, característica da reprodução sexuada. A seleção natural é a responsável pela fixação das características adaptativas.

é provável que todos os descendentes deste mesmo ancestral compartilhem tal característica, incluindo, assim, a espécie B.

78. Não. Em simpatria, sem isolamento reprodutivo, ocorreria um fluxo gênico que eliminaria as diferenças genéticas existentes entre essas subespécies.

c) O isolamento reprodutivo impede o fluxo gênico entre os indivíduos das populações que, então, passam a constituir espécies diferentes. 79. Analogia. Os ancestrais de cada um desses animais não possuíam essa característica, que surgiu posteriormente. Os dentes de sabre surgiram independentemente nos dois grupos, após a separação dos 75. a) As modificações observadas nas populações isoladas geograficamente são devidas à seleção natural diferencial atuando sobre as variações produzidas por mutações e recombinações gênicas. 80. a) Não. Os ursos castanhos e polares pertencem a espécies e a gêneros diferentes, o que impossibilita um acasalamento com reprodução. ancestrais de 'Nimravidae' e 'Felidae'.

109

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
- probabilidades iguais na escolha dos parceiros no processo de reprodução sexuada - número de indivíduos grande o suficiente para que eventos

b) Essa diferenciação é conseqüência de um longo isolamento geográfico ocorrido há milhares de anos.

81. a) A seleção natural "escolhe" os organismos mais adaptados em determinado ambiente.

aleatórios não afetem as proporções estatísticas - não-sujeição dos genes alelos à seleção natural, tendo todos os indivíduos a mesma possibilidade de sobrevivência

b) Mutações, recombinações gênicas, oscilação genética e isolamento reprodutivo. b) Alteração progressiva das freqüências gênicas em uma população. A população de jabutis ficou mais sujeita a variações gênicas 82. a) Sobreposição de nichos ecológicos implicando em competição entre as duas populações pelos recursos do meio. b) Eliminação ou ocupação de nicho ecológico distinto. 87. As mutações ocorrem aleatoriamente, com uma taxa média constante. Logo, a variabilidade genética é diretamente proporcional 83. a) Os cruzamentos citados produziram descendentes férteis, pois as populações A, B e D pertencem à mesma espécie. O fator inicial que originou as populações A, B, C e D foi o ISOLAMENTO GEOGRÁFICO. 88. a) Correta: Charles Darwin. Errada: Robert Kock. b) Espécies diferentes que habitam a mesma região geográfica são denominadas SIMPÁTRICAS. O cruzamento entre o jumento e a égua produz a mula, animal vigoroso, porém estéril. b) Os comentários sobre Charles Darwin não condizem com a realidade, já que Darwin não utilizou os trabalhos de Mendel. 84. a) Isolamento geográfico. b) Tipo de alimento disponível em cada ilha. c) Cruzamentos e análise da descendência. Se não produzem descendentes, ou estes são estéreis ou inviáveis, já ocorreu o isolamento reprodutivo que determina a formação de espécies diferentes. 89. a) Todos os representantes do filo cordados apresentam um tubo neural dorsal, notocorda e fendas na faringe, em algum estágio de seu ciclo vital. b) O retângulo II indica o desenvolvimento de patas, o que 85. A freqüência de nascimentos de crianças aa será maior nas regiões em que a doença é endêmica. Nessas regiões haverá uma maior taxa de indivíduos heterozigotos, selecionados favoravelmente em relação aos indivíduos AA, pela presença do protozoário patogênico. Cruzamentos subseqüentes entre heterozigotos produzirão maior taxa de indivíduos aa. 90. a) A banana produzida por partenocarpia não apresenta sementes, 86. a) Duas dentre as condições: - não-ocorrência de migrações - não-ocorrência de mutações que introduzam novos genes pois seus óvulos não foram fecundados. As bananas selvagens possuem sementes já que seus óvulos foram fecundados. representou um avanço evolucionário fundamental para a conquista do meio terrestre. O retângulo III representa o aparecimento do ovo com casca, provido de anexos embrionários como o âmnio, o alantóide e o cório. Estas estruturas permitiram o desenvolvimento no meio aéreo e, portanto, a conquista definitiva do meio terrestre. Os comentários sobre Robert Kock são verdadeiros, já que foi descobridor do bacilo da tuberculose. Justificativa: Trabalhou com o bacilo da tuberculose e não com a origem da vida. à antiguidade, o que confirma que nosso ancestral comum mais recente viveu na África. aleatórias (deriva genética).

110

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO
A teoria de Lamarck afirma que os seres vivos sofrem modificações adaptativas impostas em função das alterações ambientais, independentemente de seu genótipo.

b) A bananeira produtora de sementes apresenta maior variabilidade genética, estando, por este motivo, mais capacitada para se adaptar às mudanças ambientais.

91. a) O oxigênio é o aceptor final de elétrons na cadeia respiratória. Os seres possuem características herdadas geneticamente. Essas características possibilitaram sua adaptação e reprodução nas condições ambientais da caverna.

92. a) 63 cromossomos. b) Não. Os ancestrais do burro já se encontram em isolamento reprodutivo pois produzem descendência estéril.

b) Teoria evolutiva de Lamarck.

111

salabioquimica.blogspot.com

Prof. Fabio Dias Magalhães salabioquimica@gmail.com CURSO GENÉTICA E EVOLUÇÃO

112

You're Reading a Free Preview

Descarregar
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->