Insect Science (2013) 20, 194–206, DOI 10.1111/j.1744-7917.2012.01522.

ORIGINAL ARTICLE

Diversity of secondary endosymbionts among different

putative species of the whitefly Bemisia tabaci

Xiao-Li Bing1 , Yong-Ming Ruan2 , Qiong Rao1 , Xiao-Wei Wang1 and Shu-Sheng Liu1
1
Ministry of Agriculture Key Laboratory of Agricultural Entomology, Institute of Insect Sciences, Zhejiang University, Hangzhou, 2 College
of Chemistry and Life Science, Zhejiang Normal University, Jinhua, Zhejiang Province, China

Abstract Endosymbionts are important components of arthropod biology. The white-

fly Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) is a cryptic species complex
composed of ≥28 putative species. In addition to the primary endosymbiont Portiera aley-
rodidarum, six secondary endosymbionts (S-endosymbionts), Hamiltonella, Rickettsia,
Wolbachia, Cardinium, Arsenophonus and Fritschea, have been identified in B. tabaci thus
far. Here, we tested five of the six S-endosymbiont lineages (excluding Fritschea) from
340 whitely individuals representing six putative species from China. Hamiltonella was
detected only in the two exotic invaders, Middle East-Asia Minor 1 (MEAM1) and Mediter-
ranean (MED). Rickettsia was absent in Asia II 1 and MED, scarce in Asia II 3 (13%),
but abundant in Asia II 7 (63.2%), China 1 (84.7%) and MEAM1 (100%). Wolbachia,
Cardinium and Arsenophonus were absent in the invasive MEAM1 and MED but mostly
abundant in the native putative species. Furthermore, phylogenetic analyses revealed that
some S-endosymbionts have several clades and different B. tabaci putative species can
harbor different clades of a given S-endosymbiont, demonstrating further the complexity
of S-endosymbionts in B. tabaci. All together, our results demonstrate the variation and
diversity of S-endosymbionts in different putative species of B. tabaci, especially between
invasive and native whiteflies.
Key words Arsenophonus, Cardinium, Hamiltonella, Rickettsia, whitefly, Wolbachia

Introduction hosts (Baumann, 2005; Rosell et al., 2010). On the other

Microbial endosymbionts are widespread in nature and
particularly prevalent in arthropods (Baumann, 2005).
Endosymbionts are divided into two general types: pri-
mary endosymbionts (P-endosymbionts) and secondary
endosymbionts (S-endosymbionts) (Baumann, 2005). P-
endosymbionts are known to be present in all host individ-
uals, vertically transmitted and provide essential nutrients
to the hosts. They have coevolved with insects for a long
time and have formed intimate relationships with their
Correspondence: Xiao-Wei Wang, Ministry of Agriculture
Key Laboratory of Agricultural Entomology, Institute of In-
sect Sciences, Zhejiang University, Hangzhou 310058, China.
Tel: +86 571 88982435; email: xwwang@zju.edu.cn
hand, the S-endosymbionts are facultative and both verti-
cally and horizontally transmitted (Chiel et al., 2009b;
Rosell et al., 2010; Sintupachee et al., 2006). Unlike
P-endosymbionts, S-endosymbionts make contributions
to the insect hosts as well as play negative roles in the
survival of hosts. For example, S-endosymbionts, such
as Rickettsia, Hamiltonella, Wolbachia, Regiella, Serra-
tia, can provide nutrients (Brownlie et al., 2009; Koga
et al., 2003), confer resistance to parasitic wasps and fun-
gal or viral pathogens (Ferrari et al., 2004; Haine, 2008;
Hedges et al., 2008; Oliver et al., 2003; Scarborough et al.,
2005; Teixeira et al., 2008; Vorburger et al., 2010) and
improve tolerance to heat stress (Montllor et al., 2002).
At the same time, S-endosymbionts such as Wolbachia,
Arsenophonus, Cardinium and Rickettsia are likely to be
parasitic rather than beneficial to the insect hosts. They


C 2012 The Authors 194
Insect Science 
C 2012 Institute of Zoology, Chinese Academy of Sciences

manipulate insects’ reproduction by forcing asexuality,
killing males, feminizing genetic males, and inducing cy-
toplasmic incompatibility (CI) together with parthenogen-
esis, with apparent selfish effect of assisting the spread
of their infections into host populations (Engelstädter &
Hurst, 2009; Werren, 1997; Werren et al., 2008).
The whitefly Bemisia tabaci (Gennadius) (Hemiptera:
Aleyrodoidea) is a worldwide pest and has caused con-
siderable damage to vegetable, flower, grain legume and
cotton production via direct feeding, excreting honeydew,
inducing host plant phytotoxic disorders, and transmit-
ting more than 120 plant viruses (Hogenhout et al., 2008;
Inbar & Gerling, 2008; Oliveira et al., 2001). Bemisia
tabaci is a cryptic species complex consisting of ≥28
morphologically indistinguishable putative species (here-
after “species”, De Barro et al., 2011; Hu et al., 2011; Liu
et al., 2012). While some species in this complex have a
limited host range and local distribution, others are more
invasive and cosmopolitan. The most notorious invasive B.
tabaci is the Middle East-Asia Minor 1 (MEAM1) species
(Liu et al., 2007), which was commonly referred to as the
B biotype and has been nominated as one of the world’s top
100 invasive species (http://www.issg.org/database/). An-
other whitefly species, Mediterranean (MED, commonly
known as the Q biotype), has emerged as the second inva-
sive B. tabaci, and has recently spread from the Mediter-
ranean region to many places around the world (Hu et al.,
2011; McKenzie et al., 2009; Rao et al., 2011).
Like other sap-feeding insects, B. tabaci harbours
P-endosymbionts, Candidatus Portiera aleyrodidarum
(Oceanospirillales), which locate in whitefly’s bacterio-
cytes (Baumann, 2005; Thao & Baumann, 2004), and
many S-endosymbionts, of which six have been iden-
tified to-date, including Hamiltonella (Enterobacteri-
aceae), Arsenophonus (Enterobacteriaceae), Wolbachia
(Rickettsiales), Rickettsia (Rickettsiales), Cardinium
(Bacteroidetes) and Fritschea (Chlamydiales) (Everett
et al., 2005; Gottlieb et al., 2006; Nirgianaki et al., 2003;
Thao et al., 2003; Thao & Baumann, 2004; Weeks et al.,
2003; Zchori-Fein & Brown, 2002). As more is known
about the diversity of S-endosymbionts in various popu-
lations/species of B. tabaci, efforts have been made to in-
vestigate their role in the ecology of insect hosts, in partic-
ular MEAM1 and MED, in the last several years. Several
S-endosymbionts have been reported to influence various
aspects of performance of their whitefly hosts, such as re-
sistance to parasitoids (Mahadav et al., 2008), thermotol-
erance (Brumin et al., 2011), ability of virus transmission
(Gottlieb et al., 2010), and susceptibility to insecticides
(Ghanim & Kontsedalov, 2009; Kontsedalov et al., 2008).
Himler et al. (2011) showed that Rickettsia-infection of

C 2012 The Authors
Insect Science 
C 2012 Institute of Zoology, Chinese Academy of Sciences, 20, 194–206
Distribution of endosymbionts in Bemisia tabaci 195
MEAM1 in the USA increases host fitness substantially
and also causes a strong female bias in the host popula-
tion. The symbiont in this case functions as both mutualist
and reproductive manipulator for the host, with apparent
positive effects on host population increases as well the
symbiont spread in the field. The analyses of Thierry
et al. (2011) suggest that some S-endosymbionts may
even manipulate interbreeding between whitefly species.
While case studies on the functions of S-endosymbionts
in B. tabaci are only few up to now, they show clearly that
these symbionts can have a large and diverse impact on the
ecology of their hosts, and understanding of the functions
of S-endosymbionts will be essential in elucidating many
aspects of the ecology of species in the B. tabaci complex,
including the invasiveness of MEAM1 and MED.
One approach to studying the ecology and invasiveness
of alien species is to conduct comparative investigations
on invasive and native species, especially between alien
invaders and the native species that are directly affected
by the invasion. Recent studies on B. tabaci using this
approach have revealed remarkable differences in many
aspects of biology between invasive and native species,
such as host plant range (Xu et al., 2011; Zang et al.,
2006), mating behavior (Crowder et al., 2010; Liu et al.,
2007) and interactions with plant viruses (Jiu et al., 2007;
Liu et al., 2009). In view of the diverse impact of sym-
bionts on the biology of insects, including the B. tabaci
complex, we may expect that many of the differences in bi-
ology between alien and native species are associated with
the diversity and functions of symbionts. Several studies
have examined the prevalence and evolutionary status of
S-endosymbionts in the B. tabaci complex (Chiel et al.,
2007; Chu et al., 2011; Gueguen et al., 2010; Skaljac et al.,
2010). However, these reports focused mainly on the two
invasive species MEAM1 and MED, and so far little is
known about the diversity of symbionts in native species.
Knowledge of the diversity of S-endosymbionts in both
invasive and native whiteflies is essential in investigating
the functions of these bacteria, including their roles in
determining the invasiveness of some alien species.
A recent investigation indicates that, in addition to the
alien MEAM1 and MED, 13 native species of the B. tabaci
complex have been recorded from China (Hu et al., 2011).
Displacement of native species by the two invaders has
been widespread, but by 2009/2010 many of the native
species could still be detected occasionally in some re-
mote areas (Hu et al., 2011). The rich diversity of the B.
tabaci species complex in China provides a unique op-
portunity to conduct comparative studies between alien
and native whitefly species. In this study, we investigated
the distribution of five known S-endosymbionts, namely
196 X. L. Bing et al.
Table 1 Whiteflies used in this study and the accession numbers of their mitochondrial cytochrome oxidase 1 (mtCO1) sequences.
Putative species
No. Initial host plant
(biotype)
1 Asia II 1 (ZHJ2) Ipomoea batatas
2 Asia II 3 (ZHJ1) Glycine max
3 Asia II 7 (CV) Codiaeum variegatum
4 China 1 (ZHJ3) Ipomoea batatas
5 MEAM1 (B) Solanum melongena
6 MED (Q) Capsicum annuum
Hamiltonella, Rickettsia, Wolbachia, Cardinium and
Arsenophonus, among laboratory populations of four
native species, as well as the alien MEAM1 and
MED in China. In addition, phylogenetic analyses
of the S-endosymbionts recorded here with other S-
endosymbionts were conducted to discern their evolu-
tionary relationships. While the results of screening with
laboratory populations may only partially reflect the sit-
uation in the field, they provide a useful background for
investigating the functions of some symbionts, as well as
the diversity of symbionts in the whitefly species complex
in the field.
Materials and methods
Whitefly sampling and DNA extraction
Whitefly individuals were randomly collected from lab-
oratory populations of six species. The populations are
collected from 2004 to 2009 (Table 1). Stock cultures
of the six species were maintained on cotton, Gossyp-
ium hirsutum (Malvaceae) cv. Zhe-Mian 1793 in separate
climate chambers at 27 ± 1◦ C, 14 : 10 L : D cycle and
40%–60% relative humidity. Every three generations, the
purity of each population was monitored using the random
amplified polymorphic DNA-polymerase chain reaction
(RAPD-PCR) technique with H16 primer (De Barro &
Driver, 1997). When the cultures were sampled for sym-
biont screening in 2010–2011, they had been maintained
in the laboratory for 1–6years (15–60 generations).
For all samples, total DNA was extracted from indi-
vidual adult specimens (female : male ≈ 1 : 1) following
the methods of De Barro and Driver (1997) and Frohlich
et al. (1999). Individual adult whiteflies were placed on
parafilm and ground in 30 µL of ice-cold lysis buffer
with the round end of a sterile 0.2-mL PCR tube. Lysis
buffer was 10 mmol/L Tris pH8.4, including 50mmol/L
Insect Science
GenBank
Location Collection date
accession no.
Jiande, Hangzhou, Zhejiang Sep. 2004 AJ867557
Yuhang, Hangzhou, Zhejiang Apr. 2009 AJ867556
Tianhe, Guangzhou, Oct. 2007 EU192043
Guangdong
Yuhang, Hangzhou, Zhejiang Nov. 2009 GQ303180
Rui’an, Wenzhou, Zhejiang Sep. 2008 AJ867555
Yinzhou, Ningbo, Zhejiang Jun. 2009 GQ371165
KCl, 0.45% Tween 20, 0.2% gelatin, 0.45% Nonidet
P-40 and 60 mg/L proteinase K. Extracts were then in-
cubated at 65◦ C for 30 min and 100◦ C for 10 min prior
to a brief centrifugation (4000 × g) to pellet debris. The
aqueous supernatant was used as the source for PCR am-
plification. The quality of the DNA samples was con-
firmed by PCR amplification of a 0.7 kb fragment of
mitochondrial cytochrome oxidase 1 (mtCO1) gene of
the whitefly (Frohlich et al., 1999). The primers and
PCR procedures for mtCO1 amplification are listed in
Table 2.
Molecular identification of S-endosymbionts
and sequencing
Three hundred and forty individuals were screened for
endosymbiont infection using specific PCR primers tar-
geting the 16S ribosomal DNA (rDNA) gene for Portiera,
Hamiltonella, Cardinium, Wolbachia and Rickettsia and
the 23S rDNA gene for Arsenophonus (Table 2). PCR
analyses were conducted as described in Table 2 in
20 µL reaction mixtures containing 2 µL of DNA tem-
plate (concentration not determined), 0.2 mmol/L each
deoxynucleocide triphosphate, 0.2 µmol/L each primer,
1 × PCR buffer, and 1U Taq polymerase (Takara, Dalian,
China). Amplifications were performed in a DNA en-
gine PTC-200 Thermocycler (Bio-Rad, Hercules, CA,
USA). Amplified DNA products were separated elec-
trophoretically in 1% agarose gel with a 2-kb ladder
(Takara, Dalian, China), and GelRed (Biotium, Hayward,
CA, USA) stained bands were recorded using a Gel-Doc
2000 system (Bio-Rad, Hercules, CA, USA). All PCRs
included a negative control (sterile water instead of DNA)
to spot any DNA contamination, and a positive control to
prevent false negatives.
DNA from positive specimens of each infected species
was used for cloning and sequencing. PCR products were
gel-purified using the Agarose Gel DNA Purification Kit

C2012 The Authors

C 2012 Institute of Zoology, Chinese Academy of Sciences, 20, 194–206
 Distribution of endosymbionts in Bemisia tabaci 197

Table 2 Primers and corresponding polymerase chain reaction procedures used in this study.

  Annealing Product
Target gene Primer sequence (5 →3 ) References
temperature size (bp)

Random gene H16: TCTCAGCTGG 40◦ C – De Barro & Driver, 1997

B. tabaci C1-J-2195: TTGATTTTTTGGTCATCCAGAAGT 50◦ C 800 Frohlich et al., 1999
mtCO1 L2-N-3014: TCCAATGCACTAATCTGCCATATTA
Portiera 16S Por-F: TGCAAGTCGAGCGGCATCAT 60 ◦ C; 1000 Zchori-Fein &
rDNA Por-R: AAAGTTCCCGCCTTATGCGT 58◦ C Brown, 2002
Hamiltonella Ham-F: TGAGTAAAGTCTGGGAATCTGG 60◦ C 1000 Zchori-Fein &
16S rDNA Ham-R: CCCGGGAACGTATTCACCGTAG 58◦ C Brown, 2002
Rickettsia 16S Rb-F: GCTCAGAACGAACGCTATC 59◦ C 900 Gottlieb et al., 2006
rDNA Rb-R: GAAGGAAAGCATCTCTGC
Wolbachia 16S Wol-16S-F: CGGGGGAAAAATTTATTGCT 55◦ C 700 Chiel et al., 2007;
rDNA Wol-16S-R: AGCTGTAATACAGAAAGTAAA Heddi et al., 1999
Cardinium 16S Ch-F: TACTGTAAGAATAAGCACCGGC 57◦ C 400 Zchori-Fein et al., 2004
rDNA Ch-R: GTGGATCACTTAACGCTTTCG
Arsenophonus Ars23S-1: CGTTTGATGAATTCATAGTCAAA 60.5◦ C 900 Thao & Baumann, 2004
23S rDNA Ars23S-2: GGTCCTCCAGTTAGTGTTACCCAAC

ver. 2.0 and cloned into the pMD-18T plasmid vector
following the manufacturer’s instructions (Takara, Dalian,
China). For each gene, three clones were sequenced on
both strands of one endosymbiont in an ABI 3730DNA
analyzer. A total of 14 new sequences were deposited
in GenBank and their GenBank accession numbers are
JF795493 to JF795506.
Phylogenetic analysis
All sequences of 16S rDNA or 23S rDNA genes of vari-
ous bacteria used in this analysis were obtained from Gen-
Bank. The sequences were aligned using ClustalW (ver.
1.6) (Thompson et al., 1994). Phylogenetic trees were con-
structed with the maximum-likelihood (ML) method, the
BioNJ method and the Bayesian inference of phylogeny.
ML phylogenies were inferred using the software PhyML
(Guindon & Gascuel, 2003) with the program SeaView
(ver. 4) (Gouy et al., 2010). BioNJ phylogenies were also
done in SeaView (ver. 4) (Gouy et al., 2010). Bayesian
phylogenies were constructed using MrBayes (ver 3.1)
(Ronquist & Huelsenbeck, 2003). The best-fit substitution
model for each of the aligned sequences was selected with
the program Modeltest 3.7 (Posada & Crandall, 1998), us-
ing the Likelihood Ratio Test for each alignment. All five
trees were constructed using a HKY85 + gamma substi-
tution model for ML and Bayesian analyses, and HKY85
for BioNJ (Hasegawa et al., 1985). Bootstrap probabilities
were calculated by generating 1000 bootstrap replicates
for BioNJ and ML.
Results
PCR detection of S-endosymbionts in whiteflies
In the 340 adults from the six species examined,
Portiera was detected from each of the species. The
S-endosymbionts Hamiltonella, Rickettsia, Wolbachia,
Cardinium and Arsenophonus exhibited different infec-
tion rates in different species. In the 340 adults, 317
(93.2%) were detected with at least one kind of S-
endosymbiont, indicating that symbionts were very com-
mon. Each of the B. tabaci species harbored at least one
and up to four S-endosymbionts (Fig. 1). However, the
coexistence of Hamiltonella with Wolbachia, Cardinium
or Arsenophonus was not detected. Presence and preva-
lence of each endosymbiont varied considerably in differ-
ent species. Of the five S-endosymbionts four were found
in native species except Hamiltonella, which was detected
only in the two invasive species (Fig. 1). The infection
rate of Rickettsia varied from 14% in Asia II 3, 63.2% in
Asia II 7, 84.7% in China 1, to 100% in MEAM1; but
this bacterium was not detected in Asia II 1 and MED
(Fig. 1B). Wolbachia was detected in Asia II 1, Asia II
7 and China 1 with high infection rates from 85.7% to
100%; however, this bacterium was not detected in the re-
maining three species (Fig. 1C). Cardinium was detected
only in Asia II 3 and Asia II 7 while Arsenophonus was
detected only in Asia II 1, Asia II 3 and Asia II 7, and
infection rates in these cases varied from 28.9% to 78.9%
(Fig. 1D, E).


C 2012 The Authors
Insect Science 
C 2012 Institute of Zoology, Chinese Academy of Sciences, 20, 194–206
198 X. L. Bing et al.

A Hamiltonella B Rickettsia
40 38 40
100 100

Infection frequency (%)

Infection frequency (%)
98
80 80
38
60 60

40 40

20 20 50
76 45 38 74 36 38
0 0

1
1
As 1

ED

1
As 1

1
7

ED
As 3

As 3
M
na
ΙΙ

ΙΙ

na
ΙΙ

M
ΙΙ

ΙΙ

ΙΙ
M
EA

M
EA
ia

ia

ia
hi
ia

ia

ia

hi
As

As
C

M
C Wolbachia D Cardinium
36 38
100 100
Infection frequency (%)

Infection frequency (%)

98
80 80
38
60 60

40 40
45
20 20
45 40 38 36 98 40 38
0 0
1

1
1

1
7

7
ED

ED
3

3
ΙΙ

ΙΙ
na

na
ΙΙ

ΙΙ

M
ΙΙ

ΙΙ
M

M
EA

EA
ia

ia
ia

ia
ia

ia
hi

hi
As

As
As

As
As

As
C

C
M

M
E Arsenophonus
100
Infection frequency (%)

80 76

60 50 38

40

20
90 40 38
0
1
1

1
7

ED
3
ΙΙ

na
ΙΙ

M
ΙΙ

M
EA
ia

ia
ia

hi
As

As
As

Fig. 1 Infection frequencies of S-endosymbionts in six Bemisia tabaci species, Asia II 1, Asia II 3, Asia II 7, China 1, MEAM1 and
MED. (A) Hamiltonella; (B) Rickettsia; (C) Wolbachia; (D) Cardinium; and (E) Arsenophonus. Numbers above bars indicate sample
sizes.

Phylogenetic analysis of S-endosymbionts in B. tabaci tant clades (Fig. 4). We note that the Wolbachia sequence
from China 1 is closely related to a sequence of the same
Nearly identical phylogenetic trees were produced for bacterium previously reported from Asia II 3 (Fig. 4). The
each of symbiont datasets by the ML, BioNJ and Bayesian Cardinium sequence from Asia II 7, according to the phy-
methods. For brevity, only the ML results are presented. logenetic tree, was far away from the one found in Asia II
Two Hamiltonella sequences obtained from MEAM1 and 3 and its whitefly neighbors (Fig. 5). The Arsenophonus
MED fell into the same clade of other whiteflies (Fig. 2). tree was constructed using 14 Arsenophonus 23S rDNA
Rickettsia sequences found in Asia II 3 and MEAM1 and sequences from whiteflies and two from other Sternorryn-
those found in Asia II 7 and China 1 fell into two dis- cha members. The three Arsenophonus sequences found
tinct clades (Fig. 3). Wolbachia sequences found in Asia from this study clearly fell within the Arsenophonus
II 1, Asia II 7 and China 1 were separated into three dis- species group and especially with other Arsenophonus

2012 The Authors 

C

Insect Science 
C 2012 Institute of Zoology, Chinese Academy of Sciences, 20, 194–206
 Distribution of endosymbionts in Bemisia tabaci 199

Aphis craccivora [AY136136]

0.82
81 Nippolachnus piri [FJ655538] Hamiltonella

Uroleucon ambrosiae [AF293622] 0.01

0.99
64 Uroleucon nigrotuberculatum [AY136162]
0.75
Chilomenes sexmaculatus [AJ272038]

Sitobion miscanthi [HM156639]

1.00 Cinara pinimaritimae [EU348313]

98
Acyrthosiphon pisum [AY907546]
0.9 8
78 Aphis fabae [DQ010009]
0.68
58 Periphyllus bulgaricus [AY136161]

Bemisia tabaci New World [AF400470]

Bemisia tabaci [AY264676]

0.99
99 Bemisia tabaci [AF400476]

Bemisia tabaci MEAM1 [AY264675]

0.93
74 Bemisia tabaci MEAM1 [AY860530]

Bemisia tabaci MEAM1 [AF400471]

0.87 Bemisia tabaci [Z11926]
67
Bemisia tabaci MEAM1
0.87
96 Bemisia tabaci [AF400475]

Bemisia tabaci MED

Escherichia coli [EU118103]

Fig. 2 Molecular phylogenetic placements of Hamiltonella from two Bemisia tabaci species, MEAM1 and MED, based on bacterial
16S gene sequences (1286 sites). Bootstrap values for the Bayesian posterior probabilities (>0.50) and maximum-likelihood analysis
(>50%; 1000 replicates) are shown at the nodes. The names of hosts and sequence accession numbers are shown in brackets. Sequences
obtained in this study are shown in bold.

sequences reported from B. tabaci (Fig. 6). However, the
power of the phylogenetic analysis to resolve relationships
among Arsenophonus strains collected to date is poor,
probably due to the intricacy of information characters in
the fast-evolving 23S rDNA sequence.
Discussion
In this study, we analyzed the infection frequencies of
five S-endosymbionts from four native and two invasive
species of the B. tabaci complex in China. We did not
find Fritschea in our preliminary screening experiments,
and due to the lack of a positive control Fritschea was not
considered in this study. Our results indicate substantial
variations in the diversity and infection frequency of S-
endosymbionts among the species, in particular between
alien invaders and native species (Fig. 1). The insect cul-
tures used in the screening had been maintained in the
laboratory for 1–6 years. It is possible that the long-term
maintenance of the populations in the laboratory had re-
sulted in evolutionary changes caused by selection or drift,
and thus the results do not reflect the situation in the field.
However, since the insect cultures had been maintained
under the same condition, the data should reflect, at least
in part, the diversity of S-endosymbionts among the dif-
ferent species in the field.
Among those five S-endosymbionts, Hamiltonella was
detected only in the two alien invaders (Fig. 1A). These
results were congruent with previous reports (Gueguen
et al., 2010; Ruan et al., 2006; Thierry et al., 2011).
Nevertheless, infection frequency of Hamiltonella var-
ied greatly between species and geographical locations
(Chiel et al., 2007; Chu et al., 2011; Gueguen et al., 2010;
Thierry et al., 2011). Rickettsia was found in all MEAM1
individuals screened in this study (Fig. 1B). This is not sur-
prising since the majority of reports recorded prevalence


C 2012 The Authors
Insect Science 
C 2012 Institute of Zoology, Chinese Academy of Sciences, 20, 194–206
200 X. L. Bing et al.

Diophrys sp. [AJ630204]

Rickettsia Dermacentor variabilis [U11014]
0.01 1.00
87 Acyrthosiphon pisum [U42084]

0.95 Acyrthosiphon pisum [AB196668]

83
Bemisia tabaci Asia II 3

1.00 Bemisia tabaci MEAM1 [DQ077707]

0.68 69
66
Bemisia tabaci MEAM1
0.98
75 Homo sapiens [L36099]

Liposcelis bostrychophila [DQ407743]

1.00
96 Uncultured Rickettsia sp. [FJ193876]
0.56
50
Dermacentor variabilis [U11016]
0.71
61 Homo sapiens [DQ150691]
0.55
59 Hyalomma truncatum [HM050274]
0.81 Rhipicephalus sanguineus [U11019]
64
Ornithodoros sonrai [GU937608]
1.00
1.00 Orientia tsutsugamushi [D38627]
100
1.00
98 Sitobion miscanthi [HM156649]
1.00
99 Bemisia tabaci Asia ll 7
1.00
99 Bemisia tabaci China 1

Fig. 3 Molecular phylogenetic placements of Rickettsia from four Bemisia tabaci species, Asia II 3, Asia II 7, China 1 and MEAM1,
based on bacterial 16S gene sequences (970 sites). Bootstrap values for the Bayesian posterior probabilities (>0.50) and maximum-
likelihood analysis (>50%; 1000 replicates) are shown at the nodes. The names of hosts and sequence accession numbers are shown in
brackets. Sequences obtained in this study are shown in bold.

of Rickettsia in this species (Chiel et al., 2007; Chu et al.,
2011; Gueguen et al., 2010; Thierry et al., 2011). Rick-
ettsia was absent in the MED population in our study, and
this result is similar to those recorded for MED popula-
tions collected in Africa and some Mediterranean coun-
tries (Chu et al., 2011; Gueguen et al., 2010) but different
from those recorded for MED populations collected in
Israel and the USA (Himler et al., 2011). Three native
species of B. tabaci, Asia II 3, Asia II 7 and China 1, are
reported to be infected by Rickettsia for the first time.
The infection frequency of Wolbachia in MEAM1 and
MED varied greatly among populations in different places
(Chiel et al., 2007; Chu et al., 2011; Gueguen et al., 2010;
Li et al., 2007; Nirgianaki et al., 2003; Skaljac et al.,
2010). In our case, no infection of Wolbachia was de-
tected in either MEAM1 or MED (Fig. 1C). This result
contrasts with that of Chu et al. (2011) which reports
Wolbachia infection of both MEAM1 and MED in China,
although the frequencies of infection were generally low.
This disparity between our study and Chu et al. (2011)
may be due to the fact that different local populations
were screened in the two studies. It is also interesting to
note that in Chu et al. (2011) Wolbachia infection of both
MEAM1 and MED were recorded only in the earlier years
and then absent in 2009. Like those in some earlier reports
(Ahmed et al., 2010a; Ahmed et al., 2010b; Ruan et al.,
2006), frequencies of Wolbachia infection were generally
high in native whiteflies in our study. However, the na-
tive species Asia II 3, which was previously reported to
have Wolbachia (Ruan et al., 2006), was not discovered
to harbor this bacterium in this study (Fig. 1C). Car-
dinium has been recorded to be rare in invasive whiteflies
and more common in native whiteflies (Chu et al., 2011;
Gueguen et al., 2010; Thierry et al., 2011). In our study,
only the two native species Asia II 3 and Asia II 7 housed
Cardinium. Arsenophonus was commonly found in vari-
ous whitefly species (Thao & Baumann, 2004). However,
the infection frequencies of Arsenophonus in MEAM1
were generally low and even zero (Chiel et al., 2007; Chu
et al., 2011; Gueguen et al., 2010; Skaljac et al., 2010;
Thierry et al., 2011). Our results of no Arsenophonus in-
fection in MEAM1 seem to agree with the earlier records.
The MED population here did not harbor Arsenophonus;
however, MED populations in Israel and America have
been recorded to be infected with this bacterium (Chiel
et al., 2007; Chu et al., 2011). Three of the native species,
Asia II 1, Asia II 3 and Asia II 7, tested positive for
Arsenophonus.
A recent study by Gottlieb et al. (2010) indicates that the
presence of chaperonin GroEL proteins of Hamiltonella in
a MEAM1 population from Israel facilitates the whitefly
transmission of Tomato yellow leaf curl virus (TYLCV).


2012 The Authors
C

Insect Science 
C 2012 Institute of Zoology, Chinese Academy of Sciences, 20, 194–206
 Distribution of endosymbionts in Bemisia tabaci 201

Fig. 4 Molecular phylogenetic placements of Wolbachia from three Bemisia tabaci species, Asia II 1, Asia II 7 and China 1, based on
bacterial 16S gene sequences (634 sites). Bootstrap values for the Bayesian posterior probabilities (> 0.50) and maximum-likelihood
analysis (> 50%; 1000 replicates) are shown at the nodes. The names of hosts and sequence accession numbers are shown in brackets.
Sequences obtained in this study are shown in bold.

Further, that study recorded that the MED population in
Israel does not harbor Hamiltonella and is inefficient in
transmitting TYLCV. It is interesting to note that both
MEAM1 and MED in China have been recorded to har-
bor Hamiltonella with high frequencies (this study; Chu
et al., 2011) and both of them transmit TYLCV effi-
ciently in this country (Li et al., 2010). However, native
whitefly species that do not harbor Hamiltonella, such as
Asia II 1 and Asia II 3, are still able to transmit various
begomoviruses, including TYLCV, with high efficiency
(Jiu et al., 2006; Li et al., 2010; Liu et al., 2009). Thus
the role of Hamiltonella in virus transmission in the var-
ious species of the B. tabaci complex warrants further
investigation.
Phylogenetic analysis revealed that Rickettsia in white-
flies could be separated into two groups, suggesting that at
least two different species of Rickettsia exist in whiteflies
(Fig. 3). Rickettsia obtained in MEAM1 and Asia II 3 in
this study were close to that isolated in Israel, which was
reported to have relationships with whitefly resistance to
insecticides and immunoreactions against parasitic wasps
(Kontsedalov et al., 2008; Mahadav et al., 2008). A Rick-
ettsia strain that appears similar to the strain recorded in
MEAM1 in Israel was found in MEAM1 in the USA, and
the Rickettsia-infection of MEAM1 in the USA has been
shown to confer substantial fitness benefits to the whitefly
host (Himler et al., 2011). Interestingly, the association of
Rickettsia with MEAM1 in Israel does not confer much
fitness benefit to the host, even though the bacterium and
insect involved in the associations appear very similar to
those in the USA (Chiel et al., 2009a; Himler et al., 2011).
The reason for the disparity in the Rickettsia-MEAM1
associations between Israel and the USA is unknown, but
these case studies do illustrate the intricacy and specificity
in whitefly–symbiont interactions.
The “Rickettsia” bacteria found in China 1 and Asia II 7
are closely related to each other but are widely separated
from those recorded in MEAM1 and Asia II 3 (Fig. 3).
We have done a number of analyses on this bacterium and
this Orientia-like bacterium is probably a new symbiont


C 2012 The Authors
Insect Science 
C 2012 Institute of Zoology, Chinese Academy of Sciences, 20, 194–206
202 X. L. Bing et al.

Fig. 5 Molecular phylogenetic placements of Cardinium from two Bemisia tabaci species, Asia II 3 and Asia II 7, based on bacterial
16S gene sequences (397 sites). Bootstrap values for the Bayesian posterior probabilities (> 0.50) and maximum-likelihood analysis
(> 50%; 1000 replicates) are shown at the nodes. The names of hosts and sequence accession numbers are shown in brackets. Sequences
obtained in this study are shown in bold.

of B. tabaci. Because the Orientia-like bacterium was
detected with primers specifically designed for Rickettsia,
we temporarily described it as Rickettsia. We are doing
more analyses on this bacterium using molecular, cellular
and other approaches and hopefully we will be able to
clarify its taxonomic status in the near future.
Wolbachia, Cardinium and Arsenophonus are famous
for manipulating hosts’ reproduction, such as feminiz-
ing genetic males, parthenogenesis, male killing and CI
(Duron et al., 2008; Engelstädter & Hurst, 2009). These
three S-endosymbionts were recorded only in the native
whitefly species and their functions with these whitefly
hosts are entirely unknown. According to our phyloge-
netic analysis, Cardinium from B. tabaci Asia II 3 in this
study was close to those from Encarsia wasps which in-
duced parthenogenesis in their hosts (Zchori-Fein et al.,
2004). Cardinium from B. tabaci Asia II 7 was close to
Cardinium found in mites, which resulted in feminization
of haploid genetic male Brevipalpus phoenicis (Weeks
et al., 2001).
In summary, our results show substantial diversity of S-
endosymbionts in the six species of the B. tabaci complex
in China, especially between invasive and native whitefly
species. Multiple infections of several symbionts seem
more common in the native species than in the two in-
vasive species. In view of the important functions of S-
endosymbionts in insects in general and in whiteflies in
particular that were reported recently, the diversity of S-
endosymbionts revealed in this study indicates enormous
prospects of discovering new aspects of the B. tabaci
species complex through investigations of their associ-
ations with various S-endosymbionts.
Acknowledgments
We thank Di-Bing Sun, Jun-Min Li, Jia Wang and Wen-
Wu Zhou for suggestions. We also thank Jun-Bo Luan for
comments on the manuscript. Financial support for this
study was provided by the National Natural Science Foun-
dation of China (31021003, 31101437), Qianjiang Talent


C 2012 The Authors
Insect Science 
C 2012 Institute of Zoology, Chinese Academy of Sciences, 20, 194–206
 Distribution of endosymbionts in Bemisia tabaci 203

Fig. 6 Molecular phylogenetic placements of Arsenophonus from three Bemisia tabaci species, Asia II 1, Asia II 3 and Asia II 7, based
on bacterial 23S gene sequences (772 sites). Bootstrap values for the Bayesian posterior probabilities (> 0.50) and maximum-likelihood
analysis (> 50%; 1000 replicates) are shown at the nodes. The names of hosts and sequence accession numbers are shown in brackets.
Sequences obtained in this study are shown in bold.

Plan (2011R10012) and the National Basic Research Pro-
gram of China (2009CB119203).
Disclosure
The authors have no conflicts of interest, including spe-
cific financial interests and relationships and affiliations
relevant to the subject of this manuscript.
References
Ahmed, M.Z., Ren, S.X., Mandour, N.S., Greeff, J.M. and Qiu,
B.L. (2010a) Prevalence of Wolbachia supergroups A and
B in Bemisia tabaci (Hemiptera: Aleyrodidae) and some of
its natural enemies. Journal of Economic Entomology, 103,
1848–1859.
Ahmed, M.Z., Ren, S.X., Xue, X., Li, X.X., Jin, G. and Qiu,
B.L. (2010b) Prevalence of endosymbionts in Bemisia tabaci
populations and their in vivo sensitivity to antibiotics. Current
Microbiology, 61, 322–328.
Baumann, P. (2005) Biology of bacteriocyte-associated en-
dosymbionts of plant sap-sucking insects. Annual Review of
Microbiology, 59, 155–189.
Brownlie, J.C., Cass, B.N., Riegler, M., Witsenburg, J.J., Iturbe-
Ormaetxe, I., Mcgraw, E.A. and O’Neill, S.L. (2009) Evi-
dence for metabolic provisioning by a common invertebrate
endosymbiont, Wolbachia pipientis, during periods of nutri-
tional stress. PLoS Pathogens, 5, e1000368.
Brumin, M., Kontsedalov, S. and Ghanim, M. (2011) Rickettsia
influences thermotolerance in the whitefly Bemisia tabaci B
biotype. Insect Science, 18, 57–66.
Chiel, E., Gottlieb, Y., Zchori-Fein, E., Mozes-Daube, N., Katzir,
N., Inbar, M. and Ghanim, M. (2007) Biotype-dependent sec-
ondary symbiont communities in sympatric populations of
Bemisia tabaci. Bulletin of Entomological Research, 97, 407–
413.
Chiel, E., Inbar, M., Mozes-Daube, M., White, J.A., Hunter,
M.S. and Zchori-Fein, E. (2009a) Assessments of fitness


C 2012 The Authors
Insect Science 
C 2012 Institute of Zoology, Chinese Academy of Sciences, 20, 194–206
204 X. L. Bing et al.
effects by the facultative symbiont Rickettsia in the sweet-
potato whitefly (Hemiptera: Aleyrodidae). Annals of the En-
tomological Society of America, 102, 413–418.
Chiel, E., Zchori-Fein, E., Inbar, M., Gottlieb, Y., Adachi-
Hagimori, T., Kelly, S.E., Asplen, M.K. and Hunter, M.S.
(2009b) Almost there: Transmission routes of bacterial sym-
bionts between trophic levels. PLoS ONE, 4, e4767.
Chu, D., Gao, C., De Barro, P.J., Zhang, Y., Wan, F. and Khan,
I. (2011) Further insights into the strange role of bacterial
endosymbionts in whitefly, Bemisia tabaci: Comparison of
secondary symbionts from biotypes B and Q in China. Bulletin
of Entomological Research, 101, 477–486.
Crowder, D.W., Horowitz, A.R., De Barro, P.J., Liu, S.S.,
Showalter, A.M., Kontsedalov, S., Khasdan, V., Shargal, A.,
Liu, J. and Carriere, Y. (2010) Mating behaviour, life history
and adaptation to insecticides determine species exclusion
between whiteflies. Journal of Animal Ecology, 79, 563–570.
De Barro, P.J. and Driver, F. (1997) Use of RAPD PCR to dis-
tinguish the B biotype from other biotypes of Bemisia tabaci
(Gennadius) (Hemiptera: Aleyrodidae). Australian Journal of
Entomology, 36, 149–152.
De Barro, P.J., Liu, S.S., Boykin, L.M. and Dinsdale, A.B. (2011)
Bemisia tabaci: a statement of species status. Annual Review
of Entomology, 56, 1–19.
Duron, O., Bouchon, D., Boutin, S., Bellamy, L., Zhou, L.Q.,
Engelstadter, J. and Hurst, G.D. (2008) The diversity of repro-
ductive parasites among arthropods: Wolbachia do not walk
alone. BMC Biology, 6, 27.
Engelstädter, J. and Hurst, G.D.D. (2009) The ecology and evo-
lution of microbes that manipulate host reproduction. An-
nual Review of Ecology, Evolution, and Systematics, 40, 127–
149.
Everett, K.D.E., Thao, M.L., Horn, M., Dyszynski, G.E. and
Baumann, P. (2005) Novel chlamydiae in whiteflies and
scale insects: endosymbionts ‘Candidatus Fritschea bemisiae’
strain Falk and ‘Candidatus Fritschea eriococci’ strain Elm.
International Journal of Systematic and Evolutionary Micro-
biology, 55, 1581–1587.
Ferrari, J., Darby, A.C., Daniell, T.J., Godfray, H.C.J. and
Douglas, A.E. (2004) Linking the bacterial community in
pea aphids with host-plant use and natural enemy resistance.
Ecological Entomology, 29, 60–65.
Frohlich, D.R., Torres-Jerez, I., Bedford, I.D., Markham, P.G.
and Brown, J.K. (1999) A phylogeographical analysis of the
Bemisia tabaci species complex based on mitochondrial DNA
markers. Molecular Ecology, 8, 1683–1691.
Ghanim, M. and Kontsedalov, S. (2009) Susceptibility to insec-
ticides in the Q biotype of Bemisia tabaci is correlated with
bacterial symbiont densities. Pest Management Science, 65,
939–942.
Gottlieb, Y., Ghanim, M., Chiel, E., Gerling, D., Portnoy, V.,
Steinberg, S., Tzuri, G., Horowitz, A.R., Belausov, E., Mozes-
Insect Science 
C 2012 Institute of Zoology, Chinese Academy of Sciences, 20, 194–206
Daube, N., Kontsedalov, S., Gershon, M., Gal, S., Katzir, N.
and Zchori-Fein, E. (2006) Identification and localization of
a Rickettsia sp. in Bemisia tabaci (Homoptera: Aleyrodidae).
Applied and Environmental Microbiology, 72, 3646–3652.
Gottlieb, Y., Zchori-Fein, E., Mozes-Daube, N., Kontsedalov,
S., Skaljac, M., Brumin, M., Sobol, I., Czosnek, H., Vavre,
F., Fleury, F. and Ghanim, M. (2010) The transmission effi-
ciency of tomato yellow leaf curl virus by the whitefly Bemisia
tabaci is correlated with the presence of a specific symbiotic
bacterium species. Journal of Virology, 84, 9310–9317.
Gouy, M., Guindon, S. and Gascuel, O. (2010) SeaView ver-
sion 4: a multiplatform graphical user interface for sequence
alignment and phylogenetic tree building. Molecular Biology
and Evolution, 27, 221–224.
Gueguen, G., Vavre, F., Gnankine, O., Peterschmitt, M., Charif,
D., Chiel, E., Gottlieb, Y., Ghanim, M., Zchori-Fein, E. and
Fleury, F. (2010) Endosymbiont metacommunities, mtDNA
diversity and the evolution of the Bemisia tabaci (Hemiptera:
Aleyrodidae) species complex. Molecular Ecology, 19, 4365–
4378.
Guindon, S. and Gascuel, O. (2003) A simple, fast, and accurate
algorithm to estimate large phylogenies by maximum likeli-
hood. Systematic Biology, 52, 696–704.
Haine, E.R. (2008) Symbiont-mediated protection. Proceedings
of the Royal Society B: Biological Sciences, 275, 353–361.
Hasegawa, M., Kishino, H. and Yano, T.A. (1985) Dating of the
human ape splitting by a molecular clock of mitochondrial-
DNA. Journal of Molecular Evolution, 22, 160–174.
Heddi, A., Grenier, A.M., Khatchadourian, C., Charles, H. and
Nardon, P. (1999) Four intracellular genomes direct weevil
biology: nuclear, mitochondrial, principal endosymbiont, and
Wolbachia. Proceedings of the National Academy of Sciences
of the United States of America, 96, 6814–6819.
Hedges, L.M., Brownlie, J.C., O’ Neill, S.L. and Johnson, K.N.
(2008) Wolbachia and virus protection in insects. Science,
322, 702.
Himler, A.G., Adachi-Hagimori, T., Bergen, J.E., Kozuch, A.,
Kelly, S.E., Tabashnik, B.E., Chiel, E., Duckworth, V.E.,
Dennehy, T.J., Zchori-Fein, E. and Hunter, M.S. (2011) Rapid
spread of a bacterial symbiont in an invasive whitefly is driven
by fitness benefits and female bias. Science, 332, 254–256.
Hogenhout, S.A., Ammar, E.D., Whitfield, A.E. and
Redinbaugh, M.G. (2008) Insect vector interactions with per-
sistently transmitted viruses. Annual Review of Phytopathol-
ogy, 46, 327–359.
Hu, J., De Barro, P.J., Zhao, H., Wang, J., Nardi, F. and Liu, S.S.
(2011) An extensive field survey combined with a phyloge-
netic analysis reveals rapid and widespread invasion of two
alien whiteflies in China. PLoS ONE, 6, e16061.
Inbar, M. and Gerling, D. (2008) Plant-mediated interactions
between whiteflies, herbivores, and natural enemies. Annual
Review of Entomology, 53, 431–448.

2012 The Authors
C

Jiu, M., Zhou, X.P. and Liu, S.S. (2006) Acquisition and trans-
mission of two Begomoviruses by the B and a non-B bio-
type of Bemisia tabaci from Zhejiang, China. Journal of Phy-
topathology, 154, 587–591.
Jiu, M., Zhou, X.P., Tong, L., Xu, J., Yang, X., Wan, F.H. and Liu,
S.S. (2007) Vector-virus mutualism accelerates population
increase of an invasive whitefly. PLoS ONE, 2, e182.
Koga, R., Tsuchida, T. and Fukatsu, T. (2003) Changing part-
ners in an obligate symbiosis: a facultative endosymbiont can
compensate for loss of the essential endosymbiont Buchnera
in an aphid. Proceedings of the Royal Society of London B,
Biological Sciences, 270, 2543–2550.
Kontsedalov, S., Zchori-Fein, E., Chiel, E., Gottlieb, Y., Inbar,
M. and Ghanim, M. (2008) The presence of Rickettsia is
associated with increased susceptibility of Bemisia tabaci
(Homoptera: Aleyrodidae) to insecticides. Pest Management
Science, 64, 789–792.
Li, M., Hu, J.A., Xu, F.C. and Liu, S.S. (2010) Transmission of
Tomato Yellow Leaf Curl Virus by two invasive biotypes and
a Chinese indigenous biotype of the whitefly Bemisia tabaci.
International Journal of Pest Management, 56, 275–280.
Li, Z.X., Lin, H.Z. and Guo, X.P. (2007) Prevalence of Wol-
bachia infection in Bemisia tabaci. Current Microbiology, 54,
467–471.
Liu, J., Zhao, H., Jiang, K., Zhou, X.P. and Liu, S.S. (2009) Dif-
ferential indirect effects of two plant viruses on an invasive
and an indigenous whitefly vector: implications for competi-
tive displacement. Annals of Applied Biology, 155, 439–448.
Liu, S.S., Colvin, J. and De Barro, P.J. (2012) Species concepts
as applied to the whitefly Bemisia tabaci systematics: how
many species are there? Journal of Integrative Agriculture,
11, 176–186.
Liu, S.S., De Barro, P.J., Xu, J., Luan, J.B., Zang, L.S., Ruan,
Y.M. and Wan, F.H. (2007) Asymmetric mating interactions
drive widespread invasion and displacement in a whitefly.
Science, 318, 1769–1772.
Mahadav, A., Gerling, D., Gottlieb, Y., Czosnek, H. and Ghanim,
M. (2008) Parasitization by the wasp Eretmocerus mundus
induces transcription of genes related to immune response
and symbiotic bacteria proliferation in the whitefly Bemisia
tabaci. BMC Genomics, 9, 342.
Mckenzie, C., Hodges, G., Osborne, L.S., Byrne, F.J. and
Shatters, R.G. (2009) Distribution of Bemisia tabaci
(Hemiptera: Aleyrodidae) biotypes in Florida- investigating
the Q invasion. Journal of Economic Entomology, 102, 670–
676.
Montllor, C.B., Maxmen, A. and Purcell, A.H. (2002)
Facultative bacterial endosymbionts benefit pea aphids
Acyrthosiphon pisum under heat stress. Ecological Entomol-
ogy, 27, 189–195.
Nirgianaki, A., Banks, G.K., Frohlich, D.R., Veneti, Z., Braig,
H.R., Miller, T.A., Bedford, I.D., Markham, P.G., Savakis, C.

C 2012 The Authors
Insect Science 
C 2012 Institute of Zoology, Chinese Academy of Sciences, 20, 194–206
Distribution of endosymbionts in Bemisia tabaci 205
and Bourtzis, K. (2003) Wolbachia infections of the whitefly
Bemisia tabaci. Current Microbiology, 47, 93–101.
Oliveira, M.R.V., Henneberry, T.J. and Anderson, P. (2001) His-
tory, current status, and collaborative research projects for
Bemisia tabaci. Crop Protection, 20, 709–723.
Oliver, K.M., Russell, J.A., Moran, N.A. and Hunter, M.S.
(2003) Facultative bacterial symbionts in aphids confer resis-
tance to parasitic wasps. Proceedings of the National Academy
of Sciences of the United States of America, 100, 1803–1807.
Posada, D. and Crandall, K.A. (1998) MODELTEST: testing the
model of DNA substitution. Bioinformatics, 14, 817–818.
Rao, Q., Luo, C., Zhang, H., Guo, X. and Devine, G.J. (2011)
Distribution and dynamics of Bemisia tabaci invasive bio-
types in central China. Bulletin of Entomological Research,
101, 81–88.
Ronquist, F. and Huelsenbeck, J.P. (2003) MrBayes 3: Bayesian
phylogenetic inference under mixed models. Bioinformatics,
19, 1572–1574.
Rosell, R.C., Blackmer, J.L., Czosnek, H. and Inbar, M. (2010)
Mutualistic and dependent relationships with other organ-
isms. Bemisia: Bionomics and Management of a Global Pest
(eds. P.A. Stansly & S.E. Naranjos), pp. 161–183. Springer,
Netherlands.
Ruan, Y.M., Xu, J. and Liu, S.S. (2006) Effects of antibiotics
on fitness of the B biotype and a non-B biotype of the white-
fly Bemisia tabaci. Entomologia Experimentalis et Applicata,
121, 159–166.
Scarborough, C.L., Ferrari, J. and Godfray, H. (2005) Aphid pro-
tected from pathogen by endosymbiont. Science, 310, 1781.
Sintupachee, S., Milne, J.R., Poonchaisri, S., Baimai, V. and
Kittayapong, P. (2006) Closely related Wolbachia strains
within the pumpkin arthropod community and the potential
for horizontal transmission via the plant. Microbial Ecology,
51, 294–301.
Skaljac, M., Zanic, K., Ban, S.G., Kontsedalov, S. and Ghanim,
M. (2010) Co-infection and localization of secondary sym-
bionts in two whitefly species. BMC Microbiology, 10, 142.
Teixeira, L., Ferreira, Á. and Ashburner, M. (2008) The bac-
terial symbiont Wolbachia induces resistance to RNA viral
infections in Drosophila melanogaster. PLoS Biology, 6, e2.
Thao, M.L., Baumann, L., Hess, J.M., Falk, B.W., Ng, J.C.K.,
Gullan, P.J. and Baumann, P. (2003) Phylogenetic evidence
for two new insect-associated chlamydia of the family Simka-
niaceae. Current Microbiology, 47, 46–50.
Thao, M.L.L. and Baumann, P. (2004) Evidence for multi-
ple acquisition of Arsenophonus by whitefly species (Ster-
norrhyncha: Aleyrodidae). Current Microbiology, 48, 140–
144.
Thierry, M., Becker, N., Hajri, A., Reynaud, B., Lett, J.M.
and Delatte, H. (2011) Symbiont diversity and non-random
hybridization among indigenous (Ms) and invasive (B) bio-
types of Bemisia tabaci. Molecular Ecology, 20, 2172–2187.
206 X. L. Bing et al.
Thompson, J.D., Higgins, D.G. and Gibson, T.J. (1994)
CLUSTAL W: improving the sensitivity of progressive
multiple sequence alignment through sequence weighting,
position-specific gap penalties and weight matrix choice. Nu-
cleic Acids Research, 22, 4673–4680.
Vorburger, C., Gehrer, L. and Rodriguez, P. (2010) A strain of
the bacterial symbiont Regiella insecticola protects aphids
against parasitoids. Biology Letters, 6, 109–111.
Weeks, A.R., Marec, F. and Breeuwer, J.A.J. (2001) A mite
species that consists entirely of haploid females. Science, 292,
2479–2482.
Weeks, A.R., Velten, R. and Stouthamer, R. (2003) Incidence of
a new sex-ratio-distorting endosymbiotic bacterium among
arthropods. Proceedings of the Royal Society of London B
Biological Sciences, 270, 1857–1865.
Werren, J.H. (1997) Biology of Wolbachia. Annual Review of
Entomology, 42, 587–609.
Werren, J.H., Baldo, L. and Clark, M.E. (2008) Wolbachia: mas-
ter manipulators of invertebrate biology. Nature Reviews Mi-
crobiology, 6, 741–751.
Insect Science
Xu, J., Lin, K.K. and Liu, S.S. (2011) Performance on different
host plants of an alien and an indigenous Bemisia tabaci from
China. Journal of Applied Entomology, 135, 771–779.
Zang, L.S., Chen, W.Q. and Liu, S.S. (2006) Comparison of
performance on different host plants between the B bio-
type and a non-B biotype of Bemisia tabaci from Zhejiang,
China. Entomologia Experimentalis et Applicata, 121,
221–227.
Zchori-Fein, E. and Brown, J.K. (2002) Diversity of prokary-
otes associated with Bemisia tabaci (Gennadius) (Hemiptera:
Aleyrodidae). Annals of the Entomological Society of Amer-
ica, 95, 711–718.
Zchori-Fein, E., Perlman, S.J., Kelly, S.E., Katzir, N. and Hunter,
M.S. (2004) Characterization of a ‘Bacteroidetes’ symbiont
in Encarsia wasps (Hymenoptera: Aphelinidae): proposal of
‘Candidatus Cardinium hertigii’. International Journal of
Systematic and Evolutionary Microbiology, 54, 961–968.
Accepted March 28, 2012

2012 The Authors
C

C 2012 Institute of Zoology, Chinese Academy of Sciences, 20, 194–206