Você está na página 1de 1601

Ciências Agrárias

UNISA - Universidade de Santo Amaro

Avaliação da Proteina Surfactante em Pulmões de Bezerros


Clonados
RAFAEL GOUVEIA SANTOS(1)

CAIO RODRIGUES DOS SANTOS(2),PAULO CESAR MAIORKA(3)(Orientadores)


Ciências Agrárias
INTRODUÇÃO:
A clonagem ou transferência nuclear (TN) é uma biotécnica que permite a
geração de um organismo geneticamente idêntico a outro. Para isso, é utilizado
o núcleo de uma célula do individuo de interesse, o qual é transferido para um
oócito previamente enucleado (Campbell et al., 1996), para posterior
implantação uterina.
A maior limitação da clonagem de animais adultos é a extrema ineficiência em
produzir descendentes viáveis (Edwards et al., 2003), depois de uma década
após a clonagem do primeiro mamífero clonado a taxa de sucessos na geração
de indivíduos através de TN ainda é muito baixa. Diversas espécies de
mamíferos foram clonadas, porém a taxa de insucesso muito grande, a maioria
destes não conseguem sobreviver mais que 6 meses, sendo que malformações
é a principal causa de óbitos envolvendo estas animais (CHAVATTE – PALMER
et al.; 2004).
Embora esteja claro que as alterações placentárias estejam envolvidas pela
grande perda de animais durante a fase gestacional, estudos envolvendo
animais que vieram a óbito no período pós-natal foram realizados a fim de
esclarecer a causa mortis destes animais, dentre as diversas alterações
evidenciadas as cardiopulmonares foram as mais freqüentes (santo, Cr).
Hipertensão, atelectasia edema e congestão pulmonar são alterações
constantes em bovinos oriundos de TN. A deficiência de surfactante encontra-
se entre as principais suspeitas diagnósticas como causa de hipertensão
pulmonar (Hill et al., 1999).
O surfactante é produzido pelos pneumócitos do tipo II e é composto
primariamente por fosfolípides e proteínas, sendo os primeiros responsáveis por
diminuir a tensão superficial alveolar (Bleul, 2009). Quatro tipos protéicos foram
descritos em bovinos e designados como SP-A, SP-B, SP-C e SP-D (Takahashi
et al., 1990; Danlois et al., 2000). Trabalhos envolvendo a produção, distribuição
e quantificação de surfactante em bezerros oriundos de processos reprodutivos
naturais ou por TN, ainda são escassos na literatura (Danlois et al., 2000;
Danlois et al., 2003) bem como a correlação com as alterações pulmonares
descritas (CHAVATTE – PALMER et al.; 2004).
Além de descrever histologicamente as principais alterações pulmonares em
bezerros clonados, foram realizadas reações de imunoistoquímica para detectar
a produção e a quantificação da proteína Surfactante B nos pulmões dos

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

1
UNISA - Universidade de Santo Amaro

animais necropsiados.

OBJETIVO:
Estabelecer o envolvimento da Proteina Surfactante nas altas taxas de
mortalidae de fetos oriundos de TN no periodo pós natal, quantificando e
detectando a sua produção através de reações de imnuistoquímica.

METODOLOGIA:
Animais
Os animais são oriundos da fazenda Tambaú, localizada no município de
Tambaú, estado de São Paulo. Foram gerados no total 21 animais através da
técnica de TN. Para este procedimento foram utilizadas células somáticas de
um animal adulto doador do patrimônio genético, neste estudo a célula
empregada foi o fibroblasto. Dentre os 21 animais gerados, 13 vieram a óbito
ainda no período perinatal. Os animais que vieram a óbito foram encaminhados
para o Laboratório de Patologia Animal da Faculdade de Medicina Veterinária e
Zootecnia da Universidade de São Paulo onde foi realizado o exame
necroscópico.
Amostras
Foram colhidas amostras de tecido pulmonar de 13 animais oriundos de TN as
quais foram incluídas em parafina e seccionadas em cortes de 5 µm de
espessura, posteriormente transferidos para laminas de microscopia e para
lâminas próprias de reações imunoistoquímicas. Para o exame histológico
padrão foi utilizado o método de coloração HE.
Imunoistoquímica
Para a reação de imunoistoquímica, foi utilizado pulmão proveniente de animais
gerados por TN e como controles positivos e negativos foram utilizados pulmão
e musculatura cardíaca respectivamente, provenientes de um animal gerado por
reprodução natural. A recuperação antigênica foi feita com uma solução de tris-
EDTA (pH 9.0) e aquecidos em microondas por 12 minutos seguido pelo
bloqueio da atividade endógena a qual foi realizada com uma solução de
peróxido de hidrogênio (5%) em água destilada. Reações inespecíficas foram
bloqueadas com solução de leite desnatado (5%) em PBS (1%), a 37° C por 30.
O anticorpo primário polyclonal anti-proteina B surfactant (Millipore Corporation,
referência AB3780) foi diluído na razão 1:2000 em PBS 1%, para então realizar
a incubação das amostras, a qual foi realizada a 4°C overnight em câmara
úmida. Após a primeira incubação as amostras foram lavadas em PBS (1%)
com Tween 20 (0,05%) e incubadas com anticorpo secundário biotinilado suíno
anti-coelho (Dakocytomation, USA, referência K0690) por 30 minutos a
temperatura ambiente em câmara úmida. Procedeu-se 3 lavagens em PBS (1%)

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

2
UNISA - Universidade de Santo Amaro

com Tween 20 (0,05%) e incubação com o complexo estreptovidina peroxidase


(DakoCytomation, USA, referência K0690) por 30 minutos em temperatura
ambiente. A revelação foi feita com o cromógeno diaminobenzidina (DAB)
(Dakocytomation, USA, referência K3468) e a coloração de fundo com
hematoxilina.

RESUMO:
Histopatologia
A avaliação histopatológica revelou áreas de atelectasia pulmonar difusa
moderada caracterizadas por expansão incompleta dos sacos alveolares
principalmente de regiões periféricas, congestão capilar e distensão septal
alveolar, edema alveolar difuso moderado caracterizado por material de
coloração discretamente eosinofílica e aspecto homogêneo, além de enfisema
pulmonar. Bronquíolos terminais apresentaram moderada quantidade de
exsudato supurativo luminal, depósito de fibrina, além da presença de mecônio
caracterizado por material amorfo, refringente, homogêneo e de coloração
amarelo-acastanhada delineando predominantemente estruturas alveolares.
Trombos arteriais em organização foram visualizados aderidos à camada íntima
de artérias e arteríolas pulmonares, caracterizados por coloração fortemente
eosinofílica, apresentando em seus interiores seqüestro de neutrófilos
degenerados, além de múltiplos focos lobulares de imaturidade pulmonar
caracterizada por ausência de septação alveolar secundária, diminuição da
quantidade de sacos alveolares e aumento de celularidade intersticial.
Imunoistoquímica
A reação de imunoistoquímica realizada demonstrou que os pneumócitos do
tipo II estão produzindo a proteína Surfactante B, reações positivas envolvendo
o anticorpo SPB foram visualizadas margeando sacos alveolares e alvéolos,
como controle positivo, utilizamos tecido pulmonar provenientes de um animal
gerado por reprodução natural. A eficiência do anticorpo pode ser comprovada
pela reação negativa apresentada pelo controle negativo, no caso musculatura
cardíaca provenientes de um animal gerado por reprodução natural.
DISCUSSÃO
Todos os animais clonados examinados neste trabalho apresentaram
alterações pulmonares significativas e semelhantes às encontradas por outros
pesquisadores (Hill et al.,1999; Cibelli et al., 1998; Edwards et al., 2003).
Variados graus de atelectasia foram observados nos animais necropsiados em
nosso estudo e podem estar relacionados à quantidade de surfactante
disponível (Reynolds et al., 1965; Cotran et al., 1999).
O surfactante forma uma monocamada composta por fosfolipídeos e proteinas
sobre bronquíolos terminais e alvéolos (Bleul, 2009). Atua diminuindo a tensão
superficial alveolar permitindo a expansão e a ventilação dos pulmões do

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

3
UNISA - Universidade de Santo Amaro

neonato. Segundo (Hill et al., 2000) a deficiência de surfactante foi o que


provavelmente causou a incompleta expansão pulmonar em um dos bezerros
clonados por sua equipe, porém nos animais examinados neste trabalho pode
ser visualizado a presença de Surfactante no tecido pulmonar.
A deficiência de surfactante pulmonar tem origem multifatorial. Pode ser
causada por defeitos sintéticos primários (ausência total ou parcial ou síntese
anormal) ou existir em condições alheias a uma produção eficiente que alterem
sua disponibilidade e/ou constituição. A aspiração de líquido amniótico (Hill et
al.,2000), edema pulmonar, membrana hialina e aspiração de mecônio estão
entre as mais comumente encontradas em bezerros clonados.
A marcação positiva para a proteína B surfactante em amostras de pulmões de
bezerros clonados indica que há produção ativa da molécula por parte dos
pneumócitos do tipo II, ou seja, a deficiência não é causada por ausência total
de síntese e sim por uma diminuição na sua produção.
Excetuando-se as causas não relacionadas à síntese alterada, estudos
envolvendo a composição e atuação do surfactante em bovinos normais (Hall et
al., 1994) e apresentando sinais de estresse respiratório são limitados. Segundo
(Danlois et al., 2000), a concentração e proporção relativa dos constituintes do
surfactante em bezerros apresentando síndrome do estresse respiratório
encontravam-se alteradas. Em bezerros clonados não há estudos comprovando
este fato.
A atelectasia pode estar relacionada à produção de surfactante ineficiente ou
aspiração de fluído amniótico secundário a hipóxia fetal.
As regiões atelectásicas são inadequadas para a hematose gerando hipóxia
secundária e vasoconstrição local capaz de causar lesão ao revestimento
alveolar e gerar ou agravar condições pulmonares hipertensivas (Bleul, 2009). A
condição hipóxica gera dano celular com consequente edema pulmonar
(Wauer, 1997).
A presença de mecônio em bronquíolos e alvéolos de três bezerros
necropsiados altera a estabilidade da monocamanda surfactante, além de
induzir resposta inflamatória pulmonar aguda, encontrada em dois dos
bezerros, simulando, portanto uma condição de síntese insuficiente e não
disponibilidade (Lopez, 1992; Bleul, 2009), gerando ou agravando condições de
deficiência e hipertensão (Jubb et al., 2007), pneumonia intersticial atípica (Hill
et al., 1999) e reação inflamatória (Li et al., 2005).
Sinais de hipertensão pulmonar elevada associada ao ducto arterioso patente
tais como hipertrofia concêntrica do miocárdio ventricular direito, banda
moderadora e edema pulmonar, foram observados em nosso trabalho,
semelhantemente as encontradas por (Cibelli et al., 1998).
A hipertensão pulmonar decorre de anomalias cardiovasculares e pulmonares
congênitas ou adquiridas, nas quais ocorre um aumento no regime de pressão,
fluxo e/ou resistência arterial ou venosa na circulação pulmonar (Cotran et al.,

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

4
UNISA - Universidade de Santo Amaro

1999). No feto fisiologicamente normal existe certo grau de vasoconstrição


arterial pulmonar considerada normal. A resistência pulmonar pós-natal é
reduzida pela expansão pulmonar com ar e pelo efeito vasodilatador direto do
oxigênio sobre as arteríolas pulmonares (Hill et al., 1999). Condições hipóxicas,
tais como a atelectasia, podem induzir vasoconstrição arteriolar pulmonar
(Flanagan et al., 1994) gerando ou agravando estados hipertensivos em uma
espécie já susceptível a baixa saturação de oxigênio (Alexander et al., 1965).
A persistência do ducto arterioso (PDA), inicialmente não causa alterações
funcionais, porém, a exposição da circulação pulmonar a regimes volumétricos
e pressóricos aumentados e constantes gera um estado hipertensivo local e
hipertrofia e/ou dilatação cardíaca direita compensatória, além do
espessamento da banda moderadora (Cotran et al., 1999).

CONCLUSÃO:
A realização deste trabalho pode esclarecer que os animais oriundo de TN que
vieram a óbito no período pós-natal, produzem a proteína surfactante, porém
esta produção pode estar deficiente, culminando na grande quantidade de
animais com comprometimento cardiorespiratório. A grande quantidade de
liquido amniótico inspirado, provável causa de uma diluição do surfactante,
continua sendo uma das suspeitas nos quadros de atelectasia pulmonar.

REFERÊNCIA BIBLIOGRÁFICA:
1. Alexander AF, Will DH, Wolff WA (1965) Pulmonary vascular alterations
during recovery from bovine high mountain disease. Am. J. Vet. Res., 26, 1042-
1046.
2. Campbell KH, McWhir J, Ritchie WA, Wilmut I, (1996) Sheep cloned by
nuclear transfer from a cultured cell line. Nature, 380, 64-66.
3. Chavatte-Palmer P, Remy D, Cordonnier N, Richard C, Issenman H et al.
(2004) Health status of cloned cattle at different ages. Cloning Stem Cells, 6, 94-
100.
4. Cibelli JB, Stice SL, Golueke PJ, Kane JJ, Jerry J et al. (1998) Cloned
transgenic calves produced from nonquiescent fetal fibroblasts. Science, 280,
1256–1258.
5. Cotran RS, Vinay K, Tucker C (1999) Robbins Pathologic Basis of Disease,
6th edit. WB Saunder Company, 1425 p.
6. Danlois F, Zaltash S, Johansson J, Robertson B, Haagsman HP et al. (2000)
Very low surfactant protein C contents in newborn Belgian white and blue calves
with respiratory distress syndrome. Biochem. J., 351, 779–87.
7. Danlois F, Zaltash S, Johansson J, Robertson B, Haagsman HP et al (2003)
Pulmonary surfactant from healthy Belgian white and blue and Holstein Friesian

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

5
UNISA - Universidade de Santo Amaro

calves: biochemical and biophysical comparison. Vet. J., 165, 65–72.


8. Edwards JL, Schrick FN, McCracken MD, van Amnstel SR, Hopkins FM et al.
(2003) Cloning adult farm animals: a review of the possibilities and problems
associated with somatic cell nuclear transfer. Am. J. Reprod. Immunol., 50, 113-
123.
9. Flanagan MF, Fyler DC (1994) Cardiac disease. In: Neonatology:
Pathophysiology and Management of the Newborn Philadelphia, 4th edit. Avery
GB, Fletcher MA, MacDonald MG, Eds., J.B. Lippincort Co. pp. 521 – 526.
10. Guesdon JL, Ternynck T, Avrameas S (1979) The use of avidin-biotin
interaction in immunoenzymatic techniques. J Histochem Cytochem, 27, 1131.
11. Hall SB, Wang Z, Notter RH (1994) Separation of subfractions of the
hydrophobic components of the calf lung surfactant. J. Lipid. Res,. 35 (8), 1386-
1394.
12. Hill JR, Roussel AJ, Cibelli JB, Edwards JF, Hooper NL et al. (1999). Clinical
and pathologic features of cloned transgenic calves and fetuses (13 case
studies). Theriogenology, 51 (8), 1451 – 1465.
13. Hill JR, Winger QA, Long CR, Looney CR, Thompson JA et al. (2000)
Development rates of male bovine nuclear transfer embryos derived from adult
and fetal cells. Biology of Reproduction, 62 (5), 1135 – 1140.
14. Jobe A (1983) Respiratory distress syndrome: new therapeutic approaches
to a complex pathophysiology. Adv. Pediatr., 30, 93–130.
15. Jubb KVF, Kennedy PC, Palmer NC. Pathology of domestic animals (2007).
5th edit. WB Sauders Company, 2340 p.
16. Li S, Li Y, Du W, Zhang L, Yu S (2005) Aberrant gene expression of bovine
clones that die within two days after birth. Biology of Reproduction, 72 (2), 258 –
265.
17. Lopez A, Bildfell R (1992) Pulmonary inflammation associated with aspirated
meconium and epithelial cells in calves. Ve.t Pathol, 29, 104–11.
18. Park MR, Cho SK, Lee SY, Choi YJ, Park JY et al. (2005) A rare and often
unrecognized cerebromeningitis and hemodynamic disorder: a major cause of
sudden death in somatic cell cloned piglets. Proteomics, 5 (7), 1928 – 1939.
19. Reynolds EOR, Jacobson HN, Motoyama EK (1965) The effect of immaturity
and prenatal asphyxia on the lungs and pulmonary function of newborn lamb:
the experimental production of respiratory distress. Pediatrics, 35, 382–392.
20. Rubin LJ (1997) Primary pulmonary hypertension. N. Engl. J. Med. 336, 111.
21. Takahashi A, Waring AJ, Amirkhanian J, Fan B, Taeusch HW (1990)
Structure-function relationships of bovine pulmonary surfactant proteins: SP-B
and SP-C. Biochim Biophys Acta, 1044, 43–9.
22. Voelkel NF, Tuder RM (1995) Cellular and molecular mechanisms in the
pathogenesis of severe pulmonary hypertension. Eur. Resp. J. 8, 2129.
23. Wauer RR. Das atemnotsyndrom (ANS) (1997) In: Wauer RR, editor.
Surfactanttherapie Grundlagen, Diagnostik, Therapie. 2nd edit. Stuttgart

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

6
UNISA - Universidade de Santo Amaro

(Germany): Thieme p. 2–20.

________________________________________________________________
Trabalho realizado em conjunto com o laboratório de Neuropatologia
Experimental e Comparada do Departamento de Patologia da Faculdade de
Medicina Veterinára e Zootecnia da Universidade de São Paulo - USP, sob a
supervião do Prof. Dr. Paulo César Maiorka.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

7
UNISA - Universidade de Santo Amaro

Digestibilidade aparente de rações contendo misturas em


diferentes proporções de milho (Zea mays) e polpa cítrica
NATHÁLIA NOTARNICOLA DE MORAES(1), BRUNA DA SILVA MOREIRA(2)

CARLOS DE SOUSA LUCCI(3)(Orientadores)


Ciências Agrárias
INTRODUÇÃO:
Misturas concentradas para ruminantes em confinamento contêm na sua
totalidade pelo menos 50% de suas composições ocupadas por milho em
grãos, como fonte de energia. Atualmente o custo destes grãos tem aumentado
substancialmente, o que vem conduzido os criadores a empregar substitutos
como a polpa cítrica comercializada sob a forma de pellets. Levando em conta
que a alimentação representa uma parcela significativa no custo total da
produção de animais ruminantes, surge o interesse nos resultados deste
trabalho.
O milho há alguns séculos vem sendo utilizado diretamente na alimentação
humana e de animais domésticos. Sua importância não se restringe apenas ao
fato do grande volume produzido, mas também, ao importante papel sócio-
econômico que representa. Constitui inestimável fonte de matéria-prima básica
para a expressiva gama de produtos industrializados. Devido ao alto conteúdo
de carboidratos, principalmente amido, e de outros componentes como
proteínas, óleos e vitaminas, tornou-se um produto de relevante importância
comercial.
Existe grande variedade de cereais que podem ser utilizados na alimentação de
ruminantes. Ao longo dos anos, esses cereais têm sido substituídos por
ingredientes que constituem subprodutos da manipulação industrial. Sendo
ricos em energia, e provenientes da indústria alimentícia, essa substituição
justifica-se não somente pela disponibilidade de subprodutos de cereais
convencionais empregados para a alimentação humana mas, principalmente,
porque os ruminantes são capazes de usar esses subprodutos, muitas das
vezes poluidores, em alimentos de elevado valor nutritivo para seus organismos
.
No Brasil, onde a dieta é composta basicamente de forragem, sendo
generalizado o sistema de criações extensivas para os ruminantes, o fator
limitante está na ingestão de energia, considerado preponderante para o baixo
desempenho da pecuária nacional. Com a finalidade de melhorar tais
resultados, é indispensável o fornecimento de concentrados, objetivando dessa
forma maximizar a ingestão de energia digestível pelo animal. A inclusão de
grãos na ração é comumente feita para elevar os requerimentos energéticos, no
entanto, estes diminuem o conteúdo de fibra da dieta.
A polpa cítrica (PC) é um subproduto da fabricação de suco concentrado,

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

8
UNISA - Universidade de Santo Amaro

constituída de casca, sementes, bagaço e frutas descartadas disponibilizado no


mercado desde 1993. Nos últimos anos, tem sido utilizada como uma
alternativa ao milho em rações para ruminantes em confinamento (Santos et al.
2004). Trata-se de um alimento energético que apresenta menor teor de
proteína bruta que o milho em grão (13% inferior a do milho, segundo o NRC,
1996) que possui características diferenciadas quanto à fermentação ruminal,
caracterizando-se como um produto intermediário entre volumosos e
concentrados (Fegeros et al., 1995). Em geral, a polpa é caracterizada pela alta
digestibilidade da matéria seca, sendo superior até a do milho laminado e por
possuir características energéticas de concentrado, e fermentativas ruminais de
volumoso (Ezequiel, 2001). Bhattacharya & Harb (1973) e Schaibly & Wing
(1974) encontraram menores coeficientes de digestibilidade aparente da
proteína bruta na polpa cítrica, do que no milho em grão. A eficiência da síntese
de proteína microbiana também foi menor com a utilização da polpa cítrica na
dieta conforme rresultados obtidos por Highfill et al., 1987.
A polpa cítrica peletizada apresenta alto teor de pectina, que é um componente
da parede celular e é a substância que lhe confere alto valor energético. Devido
à presença da pectina, a polpa cítrica proporciona um ambiente ruminal mais
propício à degradação da fração fibrosa da dieta do que o milho em grão, que é
rico em amido (Wing, 1975; Van Soest, 1982; Fegeros et al., 1995). Assim, a
pectina se comporta como um carboidrato não-estrutural, tendo rápida e
extensiva degradação pelos microrganismos do rúmen, embora, quando se
trata de produtos finais da fermentação, assemelhe-se aos carboidratos
estruturais, proporcionando um padrão de ácidos graxos voláteis similar a dietas
contendo níveis significativos de volumosos. Maiores relações
acetato/propionato e maiores valores de pH foram obtidos por Ben-Ghedalia et
al. (1989), comparando dietas com polpa cítrica e cevada, ingrediente rico em
amido. Estes autores observaram que a digestibilidade dos constituintes da
parede celular arbinose, galactose, manose e xilose) é 16% superior nas rações
contendo polpa cítrica em relação àquelas contendo cevada e constituídas de
80% de concentrado, o que pode explicar a melhora na digestibilidade da fibra.
Por essas características, geralmente são obtidas maiores digestibilidades da
fração fibrosa de dietas com a participação da polpa cítrica, segundo
Bhattacharya & Harb, 1973; Pascual & Carmona, 1980; Fegeros et al., 1995 e
Menezes Jr. et al., 2000). Fegeros et al. (1995) estimaram o conteúdo
energético da polpa cítrica em 1,66 Mcal de energia líquida de produção por
quilograma de matéria seca, sendo que esse valor foi inferior ao citado pelo
NRC (1996). Pode ocorrer, no entanto, interferência do tipo da fruta e do
processamento utilizado na produção da polpa cítrica por pellets. A substituição
total do milho pela polpa cítrica em dietas com altos teores de concentrados
determinou diminuição das energias digestível e metabolizável, bem como na
retenção de compostos nitrogenados , segundo Bhattacharya & Harb, 1973.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

9
UNISA - Universidade de Santo Amaro

Observa-se desta forma que a polpa trata-se de um alimento energético que


possui características que a tornam um produto intermediário entre os alimentos
volumosos e alimentos concentrados.
Além da vantagem econômica em seu emprego como substituto do milho, a sua
época de produção é favorável. A safra da laranja é iniciada em maio e
concluída em janeiro, período que coincide com a entressafra de grãos como o
milho e com a época de escassez de forragem (CARVALHO, 1995). O ponto de
importância na alternativa de emprego da polpa em relação ao milho, como já
visto, é o fato da polpa cítrica peletizada apresentar elevado teor de pectina,
que lhe confere alto teor energético, em contraste com o elevado teor de amido
presente nos grãos de milho. Desta forma, a pectina comporta-se como se
fosse um componente não estrutural, embora a sua fermentação no rúmen
implique em proporções de ácidos graxos voláteis semelhante as encontradas
com a digestão de fibras estruturais . Tanto assim que observações práticas
criatórias tem levado a idéia que a adição de polpa à rações de ruminantes tem
resultado em menores incidências de problemas metabólicos, tais como a
acidose láctica e meteorismo, que acontecem frequentemente com o emprego
de elevadas quantidades de alimentos concentrados . Realmente em termos de
rúmen existem afirmativas de valor melhor para a polpa quando substitui o
milho: VAN SOEST (1982) sugere melhor padrão de fermentação no rúmen,
propiciando condições para a atuação das bactérias celulolíticas em rações
contendo polpa cítrica, facilitando a ação desses microorganismos à digestão
da parede celular de porções fibrosas das rações.
Apesar dessas considerações, experimentos que comparam a digestibilidade de
rações com polpa em substituição ao milho têm mostrado desvantagens para a
polpa: Martinez e Fernández (1980), utilizando rações contendo zero, 30 e 60%
de polpa cítrica na alimentação de cordeiros em confinamento, encontraram
ganhos de peso de 312 gramas, 272 gramas e 234 gramas por animal e por dia
, respectivamente. Esses autores concluíram que os ganhos de peso e as
conversões alimentares decresceram com a inclusão de polpa cítrica nas
rações.
BUENO et al. (2002) ao fornecerem quantidades crescentes de polpa cítrica
(máxima inclusão de 66,5%) para cabritos da raça Saanen, verificaram aumento
linear na digestibilidade da fibra em detergente neutro, e por BHATTACHARYA
& HARB (1973), que observaram aumento proporcional na digestibilidade da
porção fibrosa até o teor de 60%, na ração de ovinos, à medida que o milho foi
substituído pela polpa. FEGEROS et al. (1995), trabalhando com ovelhas
recebendo rações constituídas de feno e 30% de polpa cítrica, encontraram
valores de 87,2; 78,6; 52,7; 82,0; 93,2; e 83,1% para a digestibilidade aparente
das frações MO, MS, PB, EE, FB e ENN, respectivamente, verificando aumento
na digestibilidade da fibra bruta em rações contendo até 30% de polpa cítrica.
Muitos trabalhos apresentados na literatura não mostraram diferença na

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

10
UNISA - Universidade de Santo Amaro

digestibilidade dos diversos nutrientes quando empregados polpa cítrica em


comparação ao milho (Wing, 1975; Esteves et al., 1987; Brown & Johnson,
1991), mas os resultados ainda não são conclusivos. Schaibly & Wing (1974)
encontraram aumento das digestibilidades da matéria seca e da energia com a
substituição de até 2/3 da silagem de milho pela polpa cítrica, enquanto
Pinheiro et al. (2000) encontraram menores coeficientes de digestibilidade da
matéria seca, matéria orgânica, proteína bruta, energia bruta e fibra em
detergente neutro nos níveis 60 e 80% de substituição do milho pela polpa
cítrica, comparados com os níveis 40 e 100%, para bovinos recebendo dieta
composta com 50% de volumoso.

OBJETIVO:
Medir a digestibilidade de misturas concentradas contendo milho e polpa cítrica
em diferentes proporções no total do trato digestivo de ovinos.

METODOLOGIA:
Foram empregados seis ovinos machos, castrados, da raça Sulfock, com peso
aproximado de 35 kg e idade de 1 ano, que serviram ao experimento em um
delineamento estatístico de quadrado latino (change-over) (PIMENTEL
GOMES,1985) com dois grupos de três animais com os seguintes tratamentos:
A) 75% milho, 25% polpa cítrica
B) 50% milho, 50% polpa cítrica
C) 25% milho, 75%polpa cítrica

Foi empregado o seguinte esquema de distribuição de tratamentos aos seis


animais, considerando-se três subperíodos experimentais de 21 dias cada:

123 456
I–ABC BCA
II – B C A A B C
III – C A B C A B

No desenvolvimento do trabalho ao serem seguidos os três subperíodos


experimentais de 21 dias cada, os primeiros 14 dias foram destinados a
adaptação dos animais às diferentes dietas, e na última semana de cada
subperíodo foram feitas coletas totais de fezes para medir a digestibilidade
aparente. Foram analisados (AOAC, 1980): proteína bruta, extrato etéreo, fibra
bruta, matéria mineral, extrativos não nitrogenados sendo calculadas as taxas
de digestibilidade aparente dos seguintes grupos de nutrientes: proteína, extrato
etéreo, fibra e extrativos não nitrogenados.
As coletas de fezes foram executadas por cinco dias consecutivos. Ao final de

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

11
UNISA - Universidade de Santo Amaro

cada dia 20% do total das fezes colhidas por animal foi mantido em freezer,
fazendo-se uma amostra composta por indivíduo ao término dos cinco dias.
O arraçoamento dos animais foi feito com feno de coast cross como único
volumoso, na proporção de 40% da MS da ração, sendo os restantes 60%
compostos por misturas de farelo de soja como fonte protéica além de milho e
polpa cítrica, em diferentes proporções, como fontes energéticas. A alimentação
foi fornecida em duas partes: as 8:00h e as 15h. Durante as fases de colheita
de fezes, a ração no seu todo (alimentos volumosos e concentrados ) foram
restritos a 80% do consumido nos períodos de adaptação.

RESUMO:
Os valores de digestibilidade obtidos para valores de matéria seca foram:
84,500%, 79,667% e 76,500% respectivamente para os tratamentos A, B e C,
sendo encontrada diferença estatisticamente significativa entre tratamentos
(p=0,001) a medida em que a polpa cítrica entrou em maiores proporções nas
rações conforme a equação : 89,934- 0,130 X.
As digestibilidades obtidas para proteína bruta foram: 85,667% 82,000%e
75,833% respectivamente para os tratamentos A, B e C ,da mesma forma
menores (p=0,004) com quantidades de polpa cítrica mais elevadas nas
misturas, obedecendo à equação : 91,333- 0,154 X.
As digestibilidades obtidas para fibra bruta foram: 73,167%, 72,000% e
65,500% respectivamente para os tratamentos A, B e C e não diferiram
significativamente entre tratamentos (p=0,059), seguindo a equação de
regressão: 78,283 – 0,059X.
Para valores de digestibilidade do extrato etéreo, os coeficientes obtidos foram
87,667%, 85,333% e 80,167% respectivamente para os tratamentos A, B e C,
sendo encontrada diferença estatisticamente significativa entre tratamentos (p=
0,011), obedecendo à equação de regressão 92,935 - 0,109X e demonstrando
que para a gordura também a digestibilidade diminuiu com o ingresso de
quantidades mais elevadas de polpa cítrica.
Os valores de digestibilidade obtidos para valores de extrativos não
nitrogenados foram: 88,000%, 83,500% e 81,167% respectivamente para os
tratamentos A, B e C, sendo encontrada diferença estatisticamente significativa
entre tratamentos (p=0,027) a medida em que a polpa cítrica entrou em maiores
proporções nas rações conforme a equação : 92,933 – 0,109 X.
Considerando-se que a digestibilidade aparente abrange os processos
digestivos desenvolvidos no total do trato digestório, abordando por isto a
fermentação microbiana ruminal e a digestão enzimática nos intestinos, o milho
ao ingressar em maiores proporções na composição das diferentes rações
obteve maior sucesso em termos de digestibilidade. Um ponto a ser

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

12
UNISA - Universidade de Santo Amaro

considerado seria o escape de maior ou menor parte do milho da degradação


ruminal para a digestão nos intestinos através de amilase, quando alguns
trabalhos registram uma eficiência mais alta quando o amido é trabalhado
enzimaticamente ao invés de por bactérias ruminais amilolíticas.

CONCLUSÃO:
Nas condições deste experimento a substituição em porções crescentes do
milho pela polpa cítrica, em rações de ruminantes, conduziu a uma queda
gradativa da digestibilidade da matéria seca, extrato etéreo, extrativos não
nitrogenados e proteína das rações empregadas.

REFERÊNCIA BIBLIOGRÁFICA:
AOAC. Official Methods of Analysis. 1 led. Washington D.C. A.O.A C 1980
1051p.

BHATTACHARYA, A.N.; HARB, M. Dried citrus pulp as grain replacement for


Awassi lambs. Journal of Animal Science, v.36, n.6, p.1175-1180, 1973.

BUENO, M.S. et al. Effect of replacing corn with dehydrated citrus pulp in diets
of growing kids. Small Ruminant Research, v.46, p.179-185, 2002.

BEN-GHENDALIA et al. The effects of starch and pectin rich diets on


quantitative aspects of digestion in sheep. Animal Feed Science and
Technology, v.24, p.289-298, 1989.

EZEQUIEL, J. M. B. Uso da polpa cítrica na alimentação animal. III Simpósio


Goiano sobre Manejo e Nutrição de Bovinos, p. 329-346, 2001, Goiânia-GO.

FEGEROS, K.; ZERVAS, G.; STAMOULI, S.; APOSTOLAKI, E. Nutritive value of


dried citrus pulp and its effect on milk yield and milk composition of lactating
ewes. Journal of Dairy Science, v.78, p. 1116-21, 1995.

SANTOS, F.A.P.; PEREIRA, E.M.; PEDROSO, A.M. Suplementação energética


de bovinos de corte em confinamento. In: SIMPÓSIO SOBRE
BOVINOCULTURA DE CORTE, 5., Piracicaba, 2004. Anais. Piracicaba:
FEALQ, 2004. p.261-297.

VAN SOEST, P.J. Nutritional ecology of the ruminant. Corvallis: O& Books,
1982. 373p.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

13
UNISA - Universidade de Santo Amaro

________________________________________________________________
bru_vet@hotmail.com
natynomo@yahoo.com.br

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

14
UNISA - Universidade de Santo Amaro

Digestibilidade in situ de misturas em diferentes proporções de


milho (Zea mays) e polpa cítrica
BRUNA DA SILVA MOREIRA(1), NATHÁLIA NOTARNICOLA DE MORAES(2)

CARLOS DE SOUSA LUCCI(3)(Orientadores)


Ciências Agrárias
INTRODUÇÃO:
Misturas concentradas para ruminantes em confinamento contém normalmente
elevadas proporções de milho como fonte de energia. Atualmente os elevados
custos deste grão tem conduzido ao emprego de substitutos, entre estes a
polpa cítrica peletisada, considerando que a alimentação representa uma
parcela significativa no custo total da produção de carne, leite e lã obtida de
ruminantes. Surge daí o interesse deste trabalho.
O milho há alguns séculos vem sendo utilizado diretamente na alimentação
humana e de animais domésticos. Sua importância não se restringe apenas ao
fato do grande volume produzido mas também, ao importante papel sócio-
econômico que representa. Constitui inestimável fonte de matéria-prima básica
para a expressiva gama de produtos industrializados. Devido ao alto conteúdo
de carboidratos, principalmente amido, e de outros componentes como
proteínas, óleos e vitaminas, tornou-se um produto de relevante importância
comercial.
No Brasil, onde a dieta é composta basicamente de forragem, o fator limitante
está na ingestão de energia, considerado preponderante para o baixo
desempenho da pecuária nacional. Para melhorar tais resultados, é
indispensável o fornecimento de concentrados, objetivando dessa forma
maximizar a ingestão de energia digestível pelo animal.
A inclusão de grãos na ração é comumente feita para elevar os requerimentos
energéticos, no entanto, estes diminuem o conteúdo de fibra da dieta. A polpa
cítrica é um subproduto da fabricação de suco concentrado, constituída de
casca, sementes, bagaço e frutas descartadas. Nos últimos anos, tem sido
utilizada como possível alternativa ao milho em rações para ruminantes em
confinamento (Santos et al. 2004). É considerada um alimento fonte de energia
(sua energia é cerca de 13% inferior a do milho, segundo o NRC, 1996) que
possui características diferenciadas quanto à fermentação ruminal,
caracterizando-se como um produto intermediário entre volumosos e
concentrados (Fegeros et al., 1995). Em geral, a polpa é visualisada pela alta
digestibilidade da sua matéria seca, sendo superior até a do milho laminado.Ela
torna-se interessante por possuir características energéticas de concentrado, e
fermentativas ruminais próximas dos alimentos volumosos (Ezequiel, 2001).
Além da vantagem econômica, a sua época de produção é muito favorável ao
seu emprego . Como a safra da laranja é iniciada em maio e concluída em

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

15
UNISA - Universidade de Santo Amaro

janeiro, esse período coincide com a entressafra de grãos como o milho e com
a época de escassez de forragem (CARVALHO, 1995).
Martinez e Fernández (1980), utilizando rações contendo zero %, 30 % e 60 %
de polpa cítrica na alimentação de cordeiros em confinamento, encontraram
ganhos de peso de 312 gramas, 272 gramas e 234 gramas por animal por dia ,
respectivamente. Esses autores concluíram que o ganho de peso e a conversão
alimentar decresceram com a inclusão de polpa cítrica na ração.
Realmente em termos de rúmen existem afirmativas de valor melhor para a
polpa quando substitui o milho: VAN SOEST (1982) sugere melhor padrão de
fermentação no rúmen, propiciando condições para a atuação das bactérias
celulolíticas em rações contendo polpa citrica, facilitando a ação desses
microorganismos à digestão da parede celular de porções fibrosas das rações.
Apesar desseas considerações, alguns experimentos que comparam a
digestibilidade de rações com polpa em substituição ao milho tem mostrado
desvantagens para a polpa: Martinez e Fernández (1980), utilizando rações
contendo zero, 30 e 60% de polpa cítrica na alimentação de cordeiros em
confinamento, encontraram ganhos de peso de 312 gramas, 272 gramas e 234
gramas por animal e por dia, respectivamente. Esses autores concluíram que os
ganhos de peso e as conversões alimentares decresceram com a inclusão de
polpa cítrica nas rações.
Outros trabalhos no entanto demonstraram vantagens na adição de polpa à
misturas concentradas.BUENO et al. (2002) ao fornecerem quantidades
crescentes de polpa cítrica (máxima inclusão de 66,5%) para cabritos da raça
Saanen, verificaram aumento linear na digestiblidade da fibra em detergente
neutro, e por BHATTACHARYA & HARB (1973), que observaram aumento
proporcional na digestibilidade da porção fibrosa até o teor de 60%, na ração de
ovinos, à medida que o milho foi substituído pela polpa. FEGEROS et al. (1995),
trabalhando com ovelhas recebendo rações constituídas de feno e 30% de
polpa citrica, encontraram valores de 87,2; 78,6; 52,7; 82,0; 93,2; e 83,1% para
a digestibilidade aparente das frações MO, MS, PB, EE, FB e ENN,
respectivamente, verificando aumento na digestibilidade da fibra bruta em
rações contendo até 30% de polpa cítrica.
Ainda muitos outros trabalhos apresentados na literatura não mostraram
diferença na digestibilidade dos diversos nutrientes quando empregados polpa
cítrica em comparação ao milho (Wing, 1975; Esteves et al., 1987; Brown &
Johnson, 1991), mas os resultados ainda não são conclusivos. Schaibly & Wing
(1974) encontraram aumento das digestibilidades da matéria seca e da energia
com a substituição de até 2/3 da silagem de milho pela polpa cítrica, enquanto
Pinheiro et al. (2000) encontraram menores coeficientes de digestibilidade da
matéria seca, matéria orgânica, proteína bruta, energia bruta e fibra em
detergente neutro nos níveis 60 e 80% de substituição do milho pela polpa
cítrica, comparados com os níveis 40 e 100%, para bovinos recebendo dieta

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

16
UNISA - Universidade de Santo Amaro

composta com 50% de volumoso.


Procurando obter mais informações sobre a digestibiidade da polpa quando
medida no interior do rúmen, notam-se algumas afirmativas interessantes
quanto às variadas técnicas empregadas para essas medições. Evidentemente
a digestibilidade não é uma medida igualmente útil para todos os nutrientes; por
exemplo não se determina a digestibilidade dos minerais nem das vitaminas.
Neste caso realizam-se balanços minerais, determinando a ingestão total e a
eliminação total com a finalidade de medir a fração que realmente ficou retida
no corpo. Apesar destas variações, a digestibilidade tem sido aceita como uma
medida satisfatória do valor nutritivo dos alimentos, pois os dados obtidos são
válidos e nos dão realmente subsídios importantes para alimentação. Vários
são os métodos utilizados para serem determinadas as digestibilidades dos
nutrientes contidos nos alimentos. Neste sentido, são empregados métodos
diretos e indiretos, métodos “in vivo” e “in vitro”. Nas técnicas “in vivo” conta-se
a dos sacos de náilon contendo amostras do alimento a ser testado e incubação
desses sacos no interior do rúmen por diferentes períodos de tempo. Dentre as
técnicas in vitro ressalta-se a fermentação ruminal “in vitro”, dentre aquelas in
vivo ressalta-se adigestibilidade verdadeira, a digestibilidade com indicadores, e
a técnica de proporção ou relação (ANDRIGUETTO, 1986).
A metodologia de colocação de amostras de alimento no rúmen, através de
sacos, é relativamente antiga, tendo sido provavelmente idealizada por QUIN et
al. em 1938 , na África do Sul(citado por ORSKOV, 1980) O objetivo de Quin e
colaboradores foi estudar a desintegração de alimentos no interior do rumen.
Os autores usaram sacos cilíncricos confeccionados com seda natural, bastante
fina, que foram introduzidos através de uma fístula no rúmen de carneiros
adultos. A partir desta idéia básica outras técnicas foram propostas, segundo o
princípio de se utilizar o rúmen para o estudo da ação dos microorganismos
sobre diferentes substratos.
Atualmente a técnica "in situ" com sacos de náilon é bastante utilizada e
amplamente aceita, sendo um método relativamente rápido par determinar a
taxa de degradação dos constituintes dos alimentos no rúmen. Também permite
estimar a degradabilidade efetiva, corrigindo, pela taxa de passagem, os valores
da degradação potencial obtidos, conforme relatado por ORSKOW e
McDONALD (1979).
Com essa metodologia mede-se o desaparecimento dos componentes dos
alimentos após serem incubados no rúmen, em sacos de náilon, durante
diferentes períodos. Assume-se que esse desaparecimento é sinônimo de
degradação pelas bactérias presentes no órgão. A técnica tem por falha o fato
dos alimentos contidos nas amostras incubadas não serem submetidos à
salivação, à mastigação e à ruminação pelo animal, NOCEK (1988).

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

17
UNISA - Universidade de Santo Amaro

OBJETIVO:
Os objetivos do presente trabalho foram determinar,com emprego de ovinos
dotados de cânulas de rúmen, as digestibiidades ruminais ( in situ) da máteria
seca e proteína de misturas concentradas contendo diferentes proporções de
fontes energéticas milho e olpa cítrica, e matéria seca do feno de Coast cross,
único volumoso das rações.

METODOLOGIA:
Foram empregados seis ovinos machos, castrados, da raça Sulfock, com peso
aproximado de 35 kg e idade aproximda de 2 anos, todos os animais sendo
providos de cânulas de rúmen.
O delineamento estatístico empregado foi quadrado latino (change-over)
conforme PIMENTEL GOMES(1985) utilizando-se dois grupos de três animais
cada, com os seguintes tratamentos, ministrados de forma alternativa :
A) 75% milho, 25% polpa cítrica
B) 50% milho, 50% polpa cítrica
C) 25% milho, 75%polpa cítrica
Foi executado o o esquema apresentado a seguir, empregando-se os três
tratamentos em três subperíodos experimentais de 21 dias cada:

123456
I–ABC BCA
II – B C A A B C
III – C A B C A B
Nos últimos tres dias de cada subperíodo experimental foi desenvolvida a
técnica de sacos de náilon com a colocação de cerca de cinco gramas de
amostra das mistuas concentradas que corresponderam aos diferentes
tratamentos. Incubações dos sacos com amostras foram conduzidas no rúmen
por: zero h, 1 h, 3 h, 6 h, 12 h, 24 h e 48 h. AS analises foram realizadas
conforme prescrições de AOAC (1980) para : matéria seca e proteína bruta ,
sendo calculadas as taxas de digestibilidade in situ de cada um destes grupos
de nutrientes.
Paralelamente, em todos os animais foram incubados sacos de náilon contendo
amostras do feno de Coast cross (Cynodon dactylon) empegado como único
volumoso nesta experimentação. Aproximadamente cinco gramas de amostra
de feno, grosseiramente picado, foram introduzidas em cada saco.Nesta
situação a analise laboratorial determinou os teores de matéria seca, permitindo
o calculo de sua degrdabilidade Para o feno, os tempos de incubação foram de
zero h, 24 h., 48 h. e 72 horas. Em qualquer das situações foi adotado o
sistema de colocação, no rúmen, dos sacos com amostras em tempos
diferentes e retirada de todos simultaneamente.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

18
UNISA - Universidade de Santo Amaro

RESUMO:
Os resultados obtidos referem-se a taxas de degradabilidade efetiva calculadas
para valores de proteina bruta e mátria seca da mistura concentrada, bem como
de matéria seca do feno.
Para a proteina da mistura concentrada as taxas de degradabilidade foram
iguais a 62,32 %, 74,37% e 77,69 % respectivamente para os tratamentos A (25
% de polpa cítrica), B ( 50% de polpa cítrica) e C (75 % de polpa cítrica). Esses
valores mostraram-se significativamente diferentes (p=0,000) sendo detectada
regressão lineear com a equação 56,088 + 0,308 X). desta maneira, ficou
patente que o ingresso de maiores teores de polpa cítrica nas misturas
concentradas resultaram em taxas de degradabilidasde progressivamente mais
elevadas para a proteina. No tocante à matéria seca das misturas concentradas
foram detectadas, da mesma forma que para a proteína, diferenças
significantes entre tratamentos (p= 0,000) ,com as taxas de degradabilidade
iguais a 62.36, 64.80%; e 78.23% respectivamente para os tratamentos A ( 25
% de polpa cítrica ), B ( 50 % de polpa cítrica ) e C ( 75 % de polpa cítrica). Foi
detectada regressão linear com a equação : 52,60 + 0,317 X ) . Da mesma
forma com o ocorrido com a proteína das misturas concentradas, a
degradabilidade efetiva da matéria seca das misturas aumentou
progressivamente com o ingresso de maiores proporções de polpa nas
misturas. No que se refere à degradabilidade efetiva da matéria seca do feno,
empregado como único volumoso da ração, os valores encontrados foram
iguais a 44.56%, 47.31% e 47.91% respectivamente para os tratamentos A (
25% de polpa cítrica na mistua concentrada), B (50% de polpa cítrica na mistura
concentrada) e C ( 75% de polpa cíytrica na mistura concentrada) Houve
diferença significativa entre tratamentos ( p=0.086) detectgando regressão com
a equação : 43,25 + 0,07 X . Observa-se assim que a matéria seca do feno
também foi melhor degradada quando as roporções de polpa cítrica foram
progressivamente maiores nas misturas concentradas.

CONCLUSÃO:
O ingresso de quantidades maiores de polpa cítrica em misturas concentradas ,
em substituição ao milho em grãos, resultou em melhores digestibilidsades, no
interior do rúmen, não só para as frações matéria seca e roteina das misturas
concentradas, como também para a maaateria seca do feno, este empegado
como único volumoso nas rações de ovinos.

REFERÊNCIA BIBLIOGRÁFICA:
ANDRIGHETO, 1.; BAILONI, L.; COZZI, G.; TOLOSA, H. F~.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

19
UNISA - Universidade de Santo Amaro

Observations on in situ degradation offorage ceil in alfalfa and italian


rverass. Journal of Dair Science, v. 76, p. 2624-2631, 1993.

AOAC. Official Methods of Analysis. 1 led. Washington D.C. A.O.A C 1980


1051p.
EZEQUIEL, J. M. B. Uso da polpa cítrica na alimentação animal. III Simpósio
Goiano sobre Manejo e Nutrição de Bovinos, p. 329-346, 2001, Goiânia-GO.

FEGEROS, K.; ZERVAS, G.; STAMOULI, S.; APOSTOLAKI, E. Nutritive value of


dried citrus pulp and its effect on milk yield and milk composition of lactating
ewes. Journal of Dairy Science, v.78, p. 1116-21, 1995.

ORSKOV, E.R.; HOVELL, 1;'. D. DEB., MOULD, 1'. Uso de la tecnica de


la bolsa de nylon para la avaluacion de los alimentos. Prod. Animal
Trop.. v. n.. p213-233. 1980.

ORSKOV, E.R.; McDONALD, 1. The estimation of protem degradabilitv


in the rumen from incubation measurements weighted according to rate
of passage. Journal Agriculture Science. v. 92. p.499-503 1979.

SANTOS, F.A.P.; PEREIRA, E.M.; PEDROSO, A.M. Suplementação energética


de bovinos de corte em confinamento. In: SIMPÓSIO SOBRE
BOVINOCULTURA DE CORTE, 5., Piracicaba, 2004. Anais. Piracicaba:
FEALQ, 2004. p.261-297

________________________________________________________________
natynomo@yahoo.com.br

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

20
UNISA - Universidade de Santo Amaro

Programa de Controle Populacional Animal (PROCOPA):


Extensão Universitária Contribuindo para o Bem Estar Animal e
Controle de Zoonoses
NATHÁLIA NOTARNICOLA DE MORAES(1)

CELSO MARTINS PINTO(2),RAFAEL GARABET AGOPIAN(3),ADRIANA


CORTEZ(4)(Orientadores)
Ciências Agrárias
INTRODUÇÃO:
Em grande parte dos centros urbanos é essencial o controle populacional de
cães e gatos, pois com o maior número de animais nas ruas o risco de
zoonoses, acidentes de trânsito, agressão e danos a propriedade aumentam
(CARDIN, 1969; CARTER, 1990; CIAMPI &GARCIA, 1996).
As cadelas e gatas são animais pluríparos e sua gestação é curta, com
potencial de produção de proles numerosas que podem atingir a maturidade
sexual ao redor dos 6 meses de idade (Secretaria do Estado de Saúde de São
Paulo, 2006). Fatores que somados a falta de posse responsável dos
proprietários contribuem para o aumento da população de cães e gatos nas
ruas de forma descontrolada, dificultando o controle das zoonoses (VIEIRA,
2008), tais como a Leishmaniose Visceral e Raiva canina, que apresentam
grande impacto na Saúde Pública (REICHMANN, 2000, MINISTÉRIO DA
SAÚDE, 2003).
Uma maneira de contribuir para o controle de populações de cães e gatos é
diminuindo a natalidade destes animais, reduzindo assim os problemas
decorrentes do aumento de suas populações (REICHMANN, 2000).
Muitas técnicas para o controle populacional de pequenos animais estão sendo
implantadas como os métodos não-cirúrgicos na expectativa de controlar a
superpopulação, mas muitos fatores desfavoráveis foram observados nestes
métodos, os quais não proporcionam resultados satisfatórios (ALEXANDRE &
SHANE, 1994).
Os métodos não-cirúrgicos geralmente utilizados incluem a domiciliação
impedindo que o animal entre em contato com animais do sexo oposto, não
ocorrendo, portanto o acasalamento e o método químico, que consiste na
administração de medicamentos hormonais que interferem no ciclo reprodutivo
tornando, em geral, as fêmeas inférteis. Segundo Reichmann (2000), nenhum
desses métodos tem se mostrado eficiente por exigirem responsabilidade e
comprometimento dos proprietários.
A esterilização cirúrgica é eficiente, definitiva e segura, permitindo o controle
populacional imediatamente após sua realização (ALEXANDRE & SHANE,
1994). São geralmente procedimentos eletivos com o principal objetivo de evitar
estros e crias indesejadas (FOSSUM, 2001).

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

21
UNISA - Universidade de Santo Amaro

A técnica mais utilizada nas clínicas veterinárias para esterilização cirúrgica de


fêmeas é a Ovariohisterectomia, onde os ovários e o útero são removidos
(SLATTER, 2007). Migliari e Vuono (2000) propuseram a técnica de Ovário
Salpingo Histerectomia (OSH) modificada para diminuir o tempo cirúrgico e
melhorar a recuperação pós-operatória, condições fundamentais quando se
trabalha com esterilização em massa.
Em machos a orquiectomia tem sido a técnica mais utilizada para esterilização
cirúrgica e ainda pode modificar ou eliminar padrões de conduta característicos
dos machos, como por exemplo, diminuir a agressividade (NAVARRETE, 1997).
Em decorrência de novas legislações que impedem ou dificultam a utilização de
animais para fins didáticos (Lei nº 12.917, 2008; Lei nº 13.943, 2004) os
programas de esterilização cirúrgica de pequenos animais podem ser uma
oportunidade para a participação dos alunos de graduação com a finalidade de
colocá-los em situações práticas reais melhorando o processo de ensino e
aprendizagem.

OBJETIVO:
2.1 OBJETIVO GERAL

Descrever as atividades realizadas pelo Programa de Controle Populacional


Animal (PROCOPA), vinculado ao Núcleo de Atividades de Extensão da
Veterinária (NATEV) da Faculdade de Medicina Veterinária da Universidade de
Santo Amaro (UNISA).

2.2 OBJETIVOS ESPECÍFICOS

• Contribuir com o controle populacional de cães e gatos na comunidade


adjacente ao Campus I da UNISA.

• Aprimorar profissionalmente residentes do setor de cirurgia de pequenos


animais do Hospital Veterinário da Faculdade de Medicina Veterinária da
UNISA.

• Aprimoramento da formação acadêmica dos alunos de 1º a 9º semestres do


curso de medicina veterinária da UNISA.

METODOLOGIA:

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

22
UNISA - Universidade de Santo Amaro

3.1 PROCOPA

O PROCOPA é um programa permanente e gratuito de esterilização cirúrgica


realizado nas dependências do Campus I da UNISA que foi implementado em
Março de 2009. As atividades descritas no trabalho correspondem ao 1º
Semestre de 2009.

3.2 EQUIPES

A equipe para realização das atividades foi composta por:


a) Docentes, responsáveis pela coordenação e supervisão das atividades.
b) Residentes do setor de Clínica Cirúrgica de Pequenos Animais do Hospital
Veterinário da UNISA, responsáveis pela realização do ato cirúrgico.
c) Discentes fixos, responsáveis pela organização da sala, equipamentos e
materiais utilizados nas atividades e participação das atividades programadas.
d) Discentes rotativos participantes, na forma de revezamento, das atividades
programadas.

3.3 ESPAÇO FÍSICO

As atividades foram realizadas numa sala equipada e preparada para


atendimento cirúrgico. Este local foi dividido em 3 setores: pré-cirúrgico, trans-
cirúrgico e pós-cirúrgico.

3.4 ATIVIDADES

As atividades foram compostas por: cadastros dos animais, agendamento do


procedimento cirúrgico que compreendeu o pré-cirúrgico, trans-cirúrgico e pós-
cirúrgico.

3.4.1 Cadastro dos animais

Os cadastros dos animais foram realizados durante o programa “ UNISA em


Ação na Comunidade", que ocorreu no dia 28 de Março de 2009 no Campus I.

3.4.2 Agendamento dos procedimentos cirúrgicos

O agendamento e orientações pré-cirúrgicas foram realizados na semana do


procedimento cirúrgico.

Os itens 3.4.1 e 3.4.2 foram realizados por alunos do 1º ao 4º semestres.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

23
UNISA - Universidade de Santo Amaro

3.4.3 Pré-cirúrgico

Foi realizada a anamnese e exame físico do animal. Os animais considerados


hígidos foram submetidos ao protocolo anestésico para o ato cirúrgico.

3.4.3.1 Protocolo anestésico

• Medicação pré-anestésica (MPA):

- Caninos:
Foi administrado a MPA composta por Acepran 0,2% e Meperidina (50mg/mL)
nas doses de 0,1mg/Kg e 5mg/Kg , respectivamente, por via intramuscular.

- Felinos:
Foi administrado a MPA composta por Meperidina (50mg/mL) na dose de
5mg/Kg, por via intramuscular.

• Indução Anestésica:
Foi realizada indução anestésica, tanto para macho como para fêmea utilizando
Ketamina (50mg/mL), Midazolan (5mg/mL) e Fentanil com doses de 5 mg/kg;
0,5 mg/kg e 0,5 µg/kg respectivamente, por via intravenosa e a manutenção
anestésica por reaplicação em bolus de 20% da dose dos fármacos utilizados
para indução no caso de machos, e no caso de fêmeas com anestesia inalatória
a base de Isoflurano e Oxigenioterapia.
Nos machos foi realizado bloqueio local intratesticular com lidocaína 2% sem
vasoconstritor.

3.4.3.2 Preparação dos animais para ato cirurgico

Foi realizado tricotomia e higienização das regiões de acesso cirúrgico e


venoso, bem como canulação da veia cefálica para fluidoterapia e entubação
traqueal.

O item 3.4.3 foi realizado por alunos do 5º ao 9º semestres

3.4.4 Trans-cirúrgico

As fêmeas foram submetidas ao procedimento de OSH pela Técnica do Gancho


Modificada (Migliari e Vuono, 2000) e os machos à Orquiectomia aberta
(Fossum, 2005).

O item 3.4.4 foi realizado por residentes do Hospital Veterinário da UNISA,

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

24
UNISA - Universidade de Santo Amaro

auxiliados por alunos do 9º semestre.

3.4.5 Pós-cirúrgico

Foi realizada medicação analgésica e antibiótica nos seguintes protocolos:


• Fêmeas: Cloridrato de Tramadol (50mg/mL) na dose de 2mg/Kg e Penicilina
Benzatina (1200000UI) na dose de 48000 UI/Kg, por via subcutânea.
• Machos: Dipirona Sódica (500mg/mL) na dose de 25mg/kG e penicilina como
acima descrito.

Foi realizado proteção da ferida cirúrgica através de gaze e malha tubular.

O item 3.4.5 foi realizado por alunos do 3º ao 8º semestres.

3.5 ANÁLISE DOS RESULTADOS

A partir do cadastro dos animais que foram preenchidos pelos proprietários foi
realizada a epidemiologia descritiva das seguintes variáveis: Total de animais
esterilizados, total de fêmeas e machos esterilizados por espécie animal e idade
e participação dos alunos e residentes nas atividades.

RESUMO:
O PROCOPA foi idealizado para atender de maneira permanente e gratuita uma
demanda crescente, por esse serviço, da população carente do entorno do
Campus I da UNISA que era contemplada por Campanhas de Castrações
realizadas pelo menos uma vez por semestre pelo NATEV da FMV/UNISA
desde 2002.
Devido à experiência acumulada durante estes anos de trabalho junto à
comunidade, percebemos que o crescimento populacional de cães e gatos era
maior que a capacidade de atendimento dessa demanda, exigindo que a
freqüência e o número de animais atendidos nessas campanhas fosse cada vez
maior. Além disso, a necessidade de alternativas pedagógicas para melhorar o
processo de ensino-aprendizagem dos alunos da FMV e a adequação às Leis
que regulamentam a utilização dos animais em aulas práticas fez com que um
Programa permanente com a participação de alunos e residentes fosse
implementado.
Durante o Primeiro Semestre de 2009 foram atendidos um total de 62 animais,
sendo 32 machos e 30 fêmeas como sumariados no Quadro 1, dados que
corroboram o trabalho de PARANHOS (2002) que estudou a dinâmica

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

25
UNISA - Universidade de Santo Amaro

populacional desses animais no Município de São Paulo.


Esses dados sugerem a não interferência cultural dos proprietários nessa
comunidade quanto a esterilização cirúrgica de machos, visto que em atividade
semelhante realizada no interior do Estado de São Paulo o procedimento em
machos era associado ao comprometimento da virilidade masculina fazendo
com que os proprietários fossem mais resistentes a realização do ato cirúrgico.

Quadro 1: Número de fêmeas e machos esterilizados cirurgicamente pelo


PROCOPA na UNISA no 1º semestre de 2009.

ESPÉCIE MACHOS FÊMEAS TOTAL


CANINOS 12 (19,35%) 15 (24,20%) 27 (43,55%)
FELINOS 20 (32,25%) 15 (24,20%) 35 (56,45%)
TOTAL 32 (51,60%) 30 (48,40%) 62

Foi observado no Quadro 2 que 53/62, ou seja, 85,4% dos animais foram
esterilizados até os 2 anos de idade, ou seja, na sua fase inicial da vida
reprodutiva, o que contribui para uma maior efetividade no controle populacional
de cães e gatos. Esses dados diferem daqueles encontrados por Cárceres
(2004), que analisou o programa de esterilização canina e felina do Município
de São Paulo entre os anos de 2001 e 2003, e pode indicar uma
conscientização maior dos proprietários entorno do Campus I da UNISA quanto
ao problema da superpopulação dos animais de companhia, já que essa
atividade direcionada a essa comunidade já é realizada há vários anos.

Quadro 2: Idade dos animais esterilizados cirurgicamente pelo PROCOPA na


UNISA no 1º semestre de 2009.
IDADE CANINOS FELINOS
(MESES) MACHO FÊMEA MACHO FÊMEA TOTAL
N/C 3 3 3 9
31 1 2
41 2 3
5 1 12
613138
7 448
8 2 2
9 11
11 1 1
12 1 3 6 2 12
24 4 1 5
36 1 1 2

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

26
UNISA - Universidade de Santo Amaro

48 1 1 2
60 1 1
72 1 1 1 3
84 1 1
TOTAL 12 15 20 15 62

Não houve diferença quando foi comparado o número de animais atendidos


pelo PROCOPA com a média atendida em Campanhas promovidas pelo
NATEV (dados não mostrados), mas devido as atividades desenvolvidas pelo
PROCOPA serem realizadas de forma contínua houve um estreitamento das
relações entre a universidade e a comunidade adjacente.
No Quadro 3 estão descritos o número de alunos participantes das atividades
por semestre. Foi observada maior participação de alunos de 5° e 9° semestres,
isso pode estar associado ao maior interesse pelo programa por discentes que
estão cursando disciplinas correlacionadas com as atividades do PROCOPA,
tais como Semiologia, Técnica Cirúrgica, Anestesiologia, Patologia Cirúrgica e
Epidemiologia, transpondo o aprendizado teórico para uma aplicação prática,
permitindo maior vivência com a profissão e com o atendimento ao público. Isto
faz com que estes se tornem mais capazes de lidar com situações que
requerem conhecimento técnico e ações efetivas.
A participação dos Residentes Ingressantes do Setor de Cirurgia de Pequenos
Animais do HOVET/UNISA se torna fundamental a medida que esses podem
contribuir com o aprendizado técnico dos graduandos e cria uma oportunidade
de aprimoramento profissional pois eles adquirem maior destreza no
procedimento cirúrgico, já que na rotina do HOVET o número de cirurgias
realizadas com essa finalidade é menor.
A dinâmica de trabalho num programa de esterilização em massa explora a
capacidade dos alunos e residentes em trabalhar em equipe respeitando as
diferenças individuais e curriculares de cada um, auxiliando na formação de
profissionais e cidadãos diferenciados.
Considerando que cada vez mais o poder público está envolvido em
Programas dessa natureza, estes terão a capacidade de futuramente
estabelecerem parcerias com as Prefeituras Municipais, assim como ocorre no
Município de São Paulo.

Quadro 3: Número de alunos separados por semestre que participaram das


atividades do PROCOPA na UNISA no 1º semestre de 2009.

GRADUANDOS PARTICIPANTES DO PROCOPA


SEMESTRE 1º 3º 5º 7º 9º TOTAL
DISCENTES FIXOS 0 2 3 0 2 7
DISCENTES ROTATIVOS 2 4 12 1 7 26

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

27
UNISA - Universidade de Santo Amaro

TOTAL 2 6 15 1 9 33

CONCLUSÃO:
O Programa de Controle de Populacional Animal se mostrou viável envolvendo
a participação da estrutura acadêmica (professores, residentes e alunos) e a
comunidade promovendo a conscientização da população ao mesmo tempo em
que auxilia na formação de jovens profissionais.
Nessa atividade ocorreu o estreitamento da relação docente-discente
melhorando o processo de ensino-aprendizagem.
O PROCOPA deve ser aprimorado visando uma maior capacidade de
atendimento à população e atrelando programas educacionais de posse
responsável, bem estar animal e promoção de saúde com a finalidade de
contribuir efetivamente com o controle de natalidade da população de cães e
gatos.

REFERÊNCIA BIBLIOGRÁFICA:
ALEXANDER, S. A., SHANE, S. M. Characteristics of animals adopted from an
animal control center whose owners complied with a spaying / neutering
program. Journal of the American Veterinary Medical Association, v. 205, n. 3, p,
472-6, 1994.

CARDING, A.H. The significance and dynamics of stray dog populations with
special reference to the U.K. and Japan. Journal Small Animal Practice, v. 10, p.
419-446, 1969.

CARTER, C.N. Pet population control: another decade without solutions?


Journal of the American Veterinary Medical Association, Schaumburg, v.197,p,
192-195, 1990.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

28
UNISA - Universidade de Santo Amaro

CIAMPI, M.A.S.;GARCIA,GARCIA, R.C.M. Relatório técnico – campanha de


controle das populações de cães e gatos no município de Taboão da Serra, São
Paulo, Brasil. Arca Brasil – Associação Humanitária de Proteção e Bem-Estar
Animal e Prefeitura de Taboão da Serra, 1996.

FOSSUM, T. W. Cirurgia de pequenos animais. In: FOSSUM, T. W.; 2.ed., São


Paulo: Roca, p. 617-620, 2005.

MALM C. et al. Ovário-histerectomia: estudo experimental comparativo entre as


abordagens laparoscópica e aberta na espécie canina. Intra operatório-I.
Arquivo Brasileiro de Medicina Veteinária e .Zootecnia, v.56, n.4, p.457-466,
2004.

MIGLIARI, R.; VUONO, R.S. Ovário Salpingo Histerectomia em cadelas e gatas


– proposta de novos procedimentos. Revista educação continuada CRMV – SP,
V.3, fascículo 3, p 28 – 32, 2000.

MINISTÉRIO DA SAÙDE. Manual de Vigilância e Controle da Leishmaniose


Visceral. Normas e Manuais Técnicos. 120p, 2003.

NECULQUEO CÁRCERES, L. P. Estudo do programa de esterilização canina e


felina no Município de São Paulo, período 2001 a 2003, 83 f. Dissertação
(Mestrado em Medicina Veterinária) - Faculdade de Medicina Veterinária e
Zootecnia, Universidade de São Paulo, São Paulo, 2004.

PARANHOS, T.N. Estudo das populações canina e felina, em domicilio,


Municipio de São Paulo, 83 f. Dissertação (Mestrado em Saúde Pública) -
Faculdade de Saúde Pública, Universidade de São Paulo, São Paulo, 2002.

REICHMANN, M.L.A.B. et al., Educação e promoção da saúde no Programa de


Controle da Raiva, São Paulo, Instituto Pasteur, 2000.

SÃO PAULO. Lei nº 12.916, de 16 de abril de 2008. Dispõe sobre o controle da


reprodução de cães e gatos e dá providências correlatas. Diário Oficial Estado
de São Paulo, São Paulo, SP, v. 118, n. 72, 17 abr. 2008. Seção 1, p. 1-2.

SÃO PAULO. Lei nº 13.943, de 29 de dezembro de 2004. Proíbe a entrega de


animais capturados nas ruas para instituições e centros de pesquisa e ensino.
Diário Oficial Cidade de São Paulo, São Paulo, SP, v. 50, n. 2, 04 de jan. 2005.
Seção 1, p 32-33.

VIEIRA, A.M.L. Controle populacional de cães e gatos - Aspectos Técnicos e

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

29
UNISA - Universidade de Santo Amaro

Operacionais. Ciência Veteterinária nos Trópicos. Recife-PE, v. 11, suplemento


1,p.102-105, abril, 2008

________________________________________________________________
natynomo@yahoo.com.br

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

30
UNISA - Universidade de Santo Amaro

Reticulocitose e Reticulocitopenia Canina


AMANDA EVELYN CECCONI DA SILVA(1)

ELIZABETH BOHLAND(2)(Orientadores)
Ciências Agrárias
INTRODUÇÃO:
Os reticulócitos são células eritróides imaturas anucleadas com resquícios de
ribossomos e ácido ribonucleico (RNA) (COTTER, 2001). Foram descritos pela
primeira vez em 1865 por Wilhelm Heinrich Erb que detectou a presença de
grânulos intraeritrocitários (COWGILL, NEEL e GRINDEM, 2003). Possuem um
tamanho maior do que o eritrócito maduro (RILEY et al, 2001), porém somente
apresentam 20% de hemoglobina total quando comparado a uma hemácia
(GONZÁLEZ e SILVA, 2008).
Segundo Fernandez e Grindem (2006) estas células são periodicamente
liberadas na circulação a cada 14 dias permanecendo por dois a três dias na
Medula Óssea antes de entrar na corrente sanguínea por diapedese. (JAIN,
1993)
Quando liberadas na circulação, essas células contêm uma agregação de RNA,
sendo chamandas de “reticulócitos agregados”. Com o tempo, a quantidade de
RNA diminui a pequenos pontos ou manchas e essa célula mais velha é
denominada reticulócito ponteado (BUSH, 2004).
Cães respondem vigorosamente com reticulócitos agregados em anemias
regenerativas. Os reticulócitos ponteados são encontrados em uma
porcentagem tão inferior que não se torna necessário a sua diferenciação
(FERNANDEZ e GRINDEM, 2006).
Anemia é a diminuição da habilidade do sangue em suprir as necessidades
adequadas de oxigenação para o funcionamento metabólico. É caracterizada
pela redução do valor de hemoglobina, hematócrito ou contagem de eritrócitos
abaixo da referência em animais normalmente hidratados. A causa da anemia é
determinada pela evolução histórica do paciente, exame clínico e físico
juntamente com os resultados hematológicos laboratoriais. A determinação da
causa base da anemia é fundamental para o tratamento terapêutico e
prognóstico do paciente. (AIRD, 2000)
As anemias são classificadas quanto ao aspecto morfológico em: Macrocíticas
(hemácias de volume maior), Microcíticas (hemácias de volume reduzido) e
Normocíticas (hemácias de volume regular). Quanto às propriedades tintoriais
da hemoglobina: Normocrômicas (normal) ou Hipocrômicas (pálida) (LORENZI,
2006).
Em relação à resposta medular, esssas podem ser regenerativas, quando a
medula esta respondendo, ou seja, lançando células jovens (reticulócitos) na
circulação, ou arregenerativa, quando não se observa resposta medular face a

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

31
UNISA - Universidade de Santo Amaro

anemia.
As anemias regenerativas são assim classificadas por uma perda excessiva de
hemácias, porém a sua produção medular está preservada (GARCIA-
NAVARRO, 2005).
A reticulocitose (aumento do número de reticulócitos na circulação periférica)
ocorre somente nas anemias de causas extra-medulares (BUSH, 2004); como
nas hemorragias com evolução superior a três dias ou hemólise, onde a
reticulocitose ocorre de forma mais acentuada (BROCKUS e ANDREASEN,
2003) porque existem recursos de ferro e proteína para a eritropoiese
(FERNANDEZ e GRINDEM, 2006).
Anemias arregenerativas são extra ou intra-medulares (BROCKUS e
ANDREASEN, 2003). Normalmente são anemias medianas para severas com
complicação sistêmica secundária associada (WEISS e TVEDTEN, 2004) entre
elas: doença renal, doença hepática, perda crônica de sangue, endocrinopatias,
deficiências nutricionais (FERNANDEZ e GRINDEM, 2006). A anemia da
doença inflamatória (ADI) é a etiologia mais comum, sendo que compreende
várias afecções: doenças inflamatórias no geral, Infecções ou neoplasias.
(CANÇADO e CHIATTONE, 2002). As causas intra medulares podem ocorrer
por depressão ou falha total de sua função. (FERNANDEZ e GRINDEM, 2006).

OBJETIVO:
Justificativa: O objetivo geral do presente estudo foi avaliar o número de
reticulócitos do sangue de cães com valores do hemograma dentro da faixa de
normalidade e de cães anêmicos atendidos no no Hospital Veterinário da
Universidade de Santo Amaro no período de março a maio de 2009.

Objetivos específicos:
Avaliar o número relativo e absoluto de reticulócitos de cães anêmicos ou não
Avaliar o índice de produção de reticulócitos de cães anêmicos ou não
Avaliar a reticulocitose em função da classificação hematimétrica das anemias
Avaliar a reticulocitose em função do grau de anemia

METODOLOGIA:
Foram utilizadas 480 amostras sanguíneas de cães (machos e fêmeas de
várias raças e idades sendo hígidos ou enfermos) que foram atendidos no
Hospital Veterinário da Faculdade de Medicina Veterinária da Universidade de
Santo Amaro em um período de 3 meses.
As amostras sanguíneas foram coletadas através da punção da veia jugular
externa com auxílio de seringa e agulha e transferidas imediatamente para
tubos com anticoagulante EDTA em um volume final de meio (0,5) ml ou três ml

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

32
UNISA - Universidade de Santo Amaro

de acordo com o tamanho do tubo utilizado.


Após a coleta as amostras eram enviadas rapidamente ao Laboratório de
Análises Clínicas da Faculdade de Medicina Veterinária da Universidade de
Santo Amaro onde foi realizado o hemograma completo e contagem de
reticulócitos.
O hemograma completo era realizado pelo método manual: a contagem de
hemácias foi realizada após a diluição da amostra com líquido de Gower (1:200)
utilizando Câmara de Neubauer; o volume globular foi determinado pela técnica
do microhematócrito e a hemoglobina foi mensurada pelo método da
cianometahemoglobina. A partir desses dados pode-se obter os Índices
Hematimétricos: Volume Corpuscular Médio (VCM), Hemoglobina Corpuscular
Média (HCM) e Concentração de Hemoglobina Corpuscular Média (CHCM) e a
classificação das anemias.
Para a contagem de reticulócitos as amostras sanguíneas foram colocadas em
um tubo com azul de cresil de brilhante à 1% na proporção de 1:1 sendo
mantidas em repouso em temperatura ambiente por vinte minutos. Após este
período foi realizado um esfregaço sanguíneo que foi corado pelo método
rápido (panótico). Após a secagem das lâminas foi realizada a contagem de
reticulócitos em microscópio óptico utilizando a objetiva de imersão (x100).
Para obter o valor relativo dos reticulócitos, essas células imaturas foram
diferenciadas sobre mil hemácias em campos microscópicos homogêneos e
expressos em porcentagem.
O valor absoluto de reticulócitos foi calculado através da multiplicação do
percentual de reticulócitos encontrados com o número total de hemácias
(BIRGEL et al, 1982). O grau de reticulocitose relativa e absoluta foi estimado
em normal, baixo, moderado a marcado (WEISS e TVEDTEN, 2004; FELDMAN,
2000)
Para a determinação do índice de produção de reticulócitos (IPR) inicialmente
foi obtido o percentual de reticulócitos corrigidos, ou seja, percentual de
reticulócitos vezes o volume globular encontrado dividido pelo volume globular
médio da espécie (cão - 45%). O IPR foi calculado dividindo-se o percentual de
reticulócitos corrigidos pelo número de dias que o reticulócito permanece na
circulação periférica (cuja variação é de um a dois dias e meio em função do
valor de hematócrito obtido). Valores de IPR menores ou iguais a um foram
associados a processos não regenerativos, valores entre 1 e 2 levemente
regenerativos e superiores a 2 foram associados a processos regenerativos
(NELSON e COUTO, 2001).
Para a classificação dos animais quanto ao grau de anemia, foi utilizado o valor
do volume globular obtido, conforme FELDMAN (2000). Assim, os animais
foram classificados e divididos nos seguintes grupos: Grupo I - não anêmicos
(ht 37%), Grupo II - anemia leve (30 – 37 %), Grupo III – anemia moderada (20
– 29 %), Grupo IV – anemia severa a muito severa (menor ou igual a 19%).

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

33
UNISA - Universidade de Santo Amaro

RESUMO:
Das 480 amostras avaliadas, 17 foram excluídas do estudo pois os animais
apresentavam valores de hematócrito superior a 54%. O grupo de animais com
anemia severa a muito severa foi assim constituído devido ao pequeno número
de animais que apresentaram anemia muito severa (nove animais).

Das amostras analisadas, 253 eram provenientes de cães não anêmicos (ht 37)
– GRUPO I, 97 de animais com anemia leve (30 -37) – GRUPO II, 67 com
anemia moderada (20 – 29) – GRUPO III e 46 de anemias severa a muito
severas (<=a 19%) – GRUPO IV.
Avaliação do número relativo de reticulócitos de cães anêmicos ou não.
Considerando os valores absoluto (V.A.) e relativo (V.R.) de reticulócitos, os
valores médios e d.p para cada um dos grupos foram respectivamente, os
seguintes: Grupo I (não anêmicos): V.A. 35.344,7 +/- 30773,5 e V.R. 0,56 +/-
0,50; Grupo II (anemia leve): V.A. 40.647,4 +/- 40489,1 e V.R. 0,85 +/- 0,9;
Grupo III (anemia moderada): V.A. 72.179,1 +/- 58106,3 e V.R. 2,07 +/- 1,8 e,
Grupo IV (anemia severa a muito severa)V.A. 65439,13 +/- 45622,3 e V.R. 3,16
+/- 2,2.
Os animais não anêmicos apresentaram valores relativos de reticulócitos
inferiores a 4%, sendo que a maioria dos animais (84,2%) apresentaram valores
até 1% e o restante (15,8%) entre 1-4%. O valor médio e desvio padrão do
percentual de reticulócitos para esses cães foram de 0,56 +/- 0,5. Quando a
resposta medular foi analisada considerando o valor absoluto, resultados
semelhantes foram encontrados com 81,6% dos animais com valores inferiores
a 60.000 reticulócitos por microlitro de sangue e 18,4 % com valores entre
60.000 e 150.000 ret/µL de sangue.
Dentre os animais com anemia leve, também foi observado um maior número
de animais com valores relativos de reticulócitos inferior a 1% (74,2%); 24,7% -
entre 1 e 4% e 1,0% de animais entre 4,1 e 20% de V.R. Resultado bastante
semelhante foi encontrado quando considerado o valor absoluto dessas células.
Este padrão de resposta se alterou para os animais com anemia moderada
onde foi verificado que 37,3% com V.R. inferior a 1%; 50,7% dos animais
apresentaram um V.R. entre 1 e 4%; e 11,9% apresentaram resposta entre 4,1
e 20%. Considerados os valores absolutos, 46,3% não responderam a anemia,
46,3% mostraram resposta leve, 6% resposta moderada e 1,5 % marcada.
Entre os animais com anemia severa ou muito severa com percentuais de
resposta muito semelhantes aos valores encontrados acima (V.R. entre 1 e 4%:
47,8%; até 1%: 23,9% e, entre 4,1 e 20%: 28,3%. Analisando os resultados
acima foi observado que quanto maior a intensidade da anemia, maior foi a
magnitude da resposta medular, avaliada pelo Valor Relativo de Reticulócitos.
Os valores absolutos de reticulócitos desses animais tiveram comportamento

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

34
UNISA - Universidade de Santo Amaro

semelhante ao encontrado nas anemias moderadas, exceto para a resposta


marcada, que não foi verificada em nenhum dos animais desse grupo.
Estes resultados revelam que na anemia moderada, o número de hemácias tem
uma maior influência sobre o número absoluto de reticulócitos.
Em relação ao índice de produção de reticulócitos (IPR), os valores médios e
encontrados para todos os grupos foram inferiores a um, conforme podemos
observar a seguir: GRUPO I: 0,46 +/- 0,4; GRUPO II: 0,36 +/- 0,4, GRUPO III:
0,50 +/- 0,4 e GRUPO IV: 0,43 +/- 0,3. Avaliando a resposta por grupo,
verificamos que mais de 86% dos animais de cada grupo apresentou IPR igual
ou inferior a 1%. IPR entre 1 e 2 (indicativo de resposta leve) foi mais
expressivo nos grupos de animais com anemia moderada (13,4%) e nos
animais não anêmicos (9,5%). IPR acima de 2, ou seja, associado a processos
regenerativos, somente foi encontrado para uma pequena parcela doas animais
não anêmicos e levemente anêmicos, correspondentes a respectivos de 0,8% e
1% dos cães desses grupos.
Os resultados do IPR são discrepantes dos obtidos utilizando os Valores
relativos e absolutos, amplamente utilizados em Medicina Veterinária, e
precisam ser melhor avaliados, procurando verificar a utilidade dessa variável,
utilizada para a espécie humana, na avaliação da resposta medular de cães.
Alguns autores sugerem um maior estudo deste parâmetro, pois este ainda não
foi validado seu uso na Medicina Veterinária.
Considerando os Índices Hematimétricos, foi verificado que entre os animais
não anêmicos 90,9% apresentaram hemácias de tamanho e cor semelhante à
normalidade (normocíticas normocrômicas), 2,4% foram macrocíticas
normocrômicas e 6,7% normocíticas hipocrômicas.
Animais levemente anêmicos em sua maioria apresentaram anemias
normocíticas normocrômicas (90,7%) que também foram prevalentes nas
anemias moderadas em 77,6% dos cães desse grupo e em 34,8% dos animais
com anemias severas. As anemias normocíticas hipocrômicas ficaram em
segundo lugar na ocorrência em 5,2% dos casos de anemias leve; 13,4% das
moderadas e 10,9% das severas. Seguiram-se os casos de anemias
macrocíticas normocrômicas com 1% doas animais com anemias leves, 3% dos
que apresentaram anemia moderada e 14% das severas. As anemias
macrocíticas hipocrômicas, conhecidas como regenerativas, só foram
encontradas em 2,2% do total de animais do estudo ou 4,8% dos animais
anêmicos, tendo ocorrido com maior freqüência entre os animais com volume
globular inferior à 19%.

A partir destes valores foi possivel averiguar a grande variação entre as formas
de avaliação da resposta medular mais utilizadas de rotina (sendo que 17% das
amostras obtiveram valores divergentes.). A resposta regenerativa de
macrocitose e hipocromia baseada na avaliação dos índices hematimétricos

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

35
UNISA - Universidade de Santo Amaro

(somente foi confirmada com reticulocitose em 40% das amostras) deve ser
cuidadosamente analisada, principalmente quando utilizados métodos manuais
de contagem do número de hemácias.

CONCLUSÃO:
Os resultados mostraram que a contagem de reticulócitos é fundamental para a
melhor avaliação da resposta medular do paciente canino à anemia, devendo
porém ser interpretada em conjunto com os dados do exame físico e outros
exames complementares do paciente. E sempre que necessário a resposta
medular deverá ser avaliada por exames mais sensíveis como a citologia ou
biópsia de Medula óssea.

REFERÊNCIA BIBLIOGRÁFICA:
AIRD, Betsy, Clinical and Hematologic Manifestations of Anemia In: FELDMAN,
Bernard F.; ZINKL, Joseph G.; JAIN, Nemi C. Schalm’s Veterinary Hematology 5
ed. Philadelphia: Lippincott Williams & Wilkins, 2000. cap.25, 140-2

BIRGEL, E.H. et al. Patologia clínica veterinária. São Paulo: SPMV, 1982. 260p

BROCKUS, Charles W.; ANDREASEN, Claire B., Erythrocytes In: LATIMER,


Kenneth, S.; Mahaffey, Edward A.; Prasse, Keith W. Duncan & Prasse’s
Veterinary Laboratory Medicine: Clinical Pathology 4 ed. Iowa: Blackwell
Publishing, 2003. cap 1, 21-3

BUSH, B. M., Eritrócitos. In: _____. Interpretação de Resultados Laboratoriais


para clínica de pequenos animais 1 ed. São Paulo: Roca, 2004. cap. 2, 81-92

CANÇADO, Rodolfo D., CHIATTONE, Carlos S., Anemia de Doença Crônica.


Revista Brasileira de Hematologia e Hemoterapia, Rio de Janeiro, v. 24, n.2,
127-36, Abr. 2002

COTTER, Susan M., Reticulocytes. In: ______. Quick look series in Veterinary
Medicine: Hematology 1 ed. Jackson: Teton New Media, 2001. cap. 4, 8-9.

COWGILL, Elizabeth S.; NEEL, Jennifer A.; GRINDEM, Carol B., Clinical
application of reticulocyte counts in dog and cats. The Veterinary Clinics of North
America: Small Animal Practice, Philadelphia, v. 33, n. 6, 1223-44, Nov. 2003.

FERNANDEZ, Fidelia R.; GRINDEM, Carol B., Reticulocyte Response In:


FELDMAN, Bernard F.; ZINKL, Joseph G.; JAIN, Nemi C. Schalm’s Veterinary
Hematology 5 ed. Philadelphia: Lippincott Williams & Wilkins, 2006. cap.19,

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

36
UNISA - Universidade de Santo Amaro

110-3

GONZÁLEZ, Félix Hilario Diaz; SILVA, Sérgio Ceroni, Hematologia Clínica,


Patologia Clínica Veterinária: Texto Introdutório. 1. Ed. Porto Alegre:
Universidade Federal do Rio Grande do Sul, 2008. cap.1, 11-2

JAIN, Nemi Chand, Erythrocyte Physiology and Changes in Disease. In: ______.
Essentials of Veterinary Hematology. 2. ed. Philadelphia: Lea & Febiger, 1993.
cap.7, 133-158

LORENZI, Therezinha F. Anemia Hematologia Propedêutica e clínica. 3 ed. São


Paulo: Editora Médica Científica, 2006. cap.3, 196

NELSON, R. W.; COUTO, C.G. Anemia. In: ____ Medicina Interna de Pequenos
Animais. 2ed. Rio de Janeiro: Guanabara Koogan. 2001 . Cap. 85, 910-20.

RILEY, Roger S. et al, Reticulocytes and Reticulocyte enumeration. Journal of


Clinical Laboratory Analysis, [S.L.], v.15, n.5, 267-94, 2001

WEISS, Douglas; TVEDTEN, Harold, Erythorocyte Disorders In: WILLARD,


Michael D.; TVEDTEN, Harold Small Animal Clinical Diagnosis by Laboratory
Methods 4 ed. Elsevier: Saunders, 2004. cap.3, 38-62

________________________________________________________________
1 Aluna da Graduação Universidade de Santo Amaro - UNISA
2 Professora Titutar II da Faculdade de Medicina Veterinária - Unisa

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

37
UNISA - Universidade de Santo Amaro

Ciências Biológicas

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

38
UNISA - Universidade de Santo Amaro

A influência da granulometria no sucesso de eclosão e tempo de


incubação dos ninhos das tartarugas marinhas Caretta caretta
(Linnaeus, 1758) e Lepidochelys olivacea (Eschscholtz, 1829) no
litoral norte da Bahia, Brasil
MARINA SUEMI NOMURA(1)

PAULO CESAR FONSECA GIANNINI(2)(Orientadores)


Ciências Biológicas
INTRODUÇÃO:
Das sete espécies de tartaruga marinha conhecidas, cinco ocorrem e
reproduzem-se no Brasil. São elas: Caretta caretta – Linnaeus, 1758; Chelonia
mydas - Linnaeus, 1758; Eretmochelys imbricata – Linnaeus, 1766;
Lepidochelys olivacea – Eschoscholtz, 1829 e Dermochelys coriácea –
Linnaeus, 1766. Essas cinco espécies incluem-se nas listas nacional e
internacional de fauna ameaçada de extinção.
As tartarugas marinhas somente saem do mar para a desova, geralmente
durante o período de primavera/verão em praias tropicais e subtropicais. O
acasalamento ocorre no mar, com a fecundação sendo interna. Uma mesma
fêmea pode realizar de três a cinco desovas em uma única temporada
reprodutiva. A desova ocorre geralmente no período da noite; a fêmea sobe à
praia, confecciona o ninho, que possui cerca de 0,5 m de profundidade, e nele
deposita uma média de 120 ovos. De 40 a 60 dias após a desova, os filhotes
nascem e deixam o ninho.
A razão sexual (proporção de indivíduos machos e fêmeas produzidos em cada
ninho) é dependente da temperatura de incubação. Temperaturas acima de
29ºC determinam o nascimento de fêmeas enquanto abaixo de 27ºC nascem
somente machos. A temperatura, dentro desse intervalo, que determina uma
proporção 1:1 entre fêmeas e machos é chamada de pivotal. O período de
determinação sexual controlado pela temperatura é um dos momentos mais
críticos para a vida desses animais; sendo assim, é necessário compreender os
fatores extrínsecos à biologia da incubação que controlam a temperatura e
outras variáveis físicas do microclima do ninho.
No Brasil, as desovas ocorrem desde o norte do estado do Rio de Janeiro até o
Rio Grande do Norte, encontrando-se as maiores concentrações no estado da
Bahia. O perigo de extinção das tartarugas marinhas no Brasil começou a ser
reconhecido em 1970. Seguiram-se, leis de proteção a esses animais. Em
1989, o IBAMA e a IUCN incluíram as cinco espécies de tartarugas marinhas
existente no país na lista oficial de espécies vulneráveis e/ou ameaçadas de
extinção.
O Projeto Tamar/ICMBio surgiu em 1980 e, ao longo de dois anos, realizou

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

39
UNISA - Universidade de Santo Amaro

levantamento das possíveis áreas de ocorrência de tartarugas marinhas por


todo litoral brasileiro. Hoje, o Projeto Tamar/ICMBio conta com 23 bases ao
longo do litoral continental do país, monitorando aproximadamente 1000km de
praias, além das atividades mantidas nas ilhas oceânicas. A Fundação Pró-
Tamar, instituição privada e sem fins lucrativos, foi criada em 1988 para ajudar
a levantar fundos e co-administrar o Projeto Tamar/ICMBio.
O estado da Bahia conta com quatro bases do Tamar/ICMBio, sendo
considerado importante ponto de desova de tartarugas marinhas, onde se
concentram 50% das desovas registradas no Brasil. Engloba a principal área de
desova de C.caretta e E.imbricata, com ocorrência de L.olivacea e C.mydas.
Possui também grande ocorrência de formas juvenis.
A Base Sítio do Conde-BA monitora uma extensão costeira de
aproximadamente 81km, limitada ao sul pelo rio Inhambupe (12°05'47,0"S /
037°41'10,5"W) e ao norte pelo rio Real (11°27'29,2"S /37°20'55,2"W). Outros
dois rios importantes na área são o Itariri e o Itapicuru. Ao longo da extensão da
base, são consideradas 12 praias, algumas porém sem limites morfológicos
(rios ou portões). De sul para norte, são elas: Ribeiro, Salinas, Barra do Itariri,
Corre Nu, Poças, Siribinha, Costa Azul, Lote, Vapor, Dunas, Coqueiros e
Mangue Seco. Estas praias agrupam-se em três arcos praiais, os quais têm os
rios mencionados como fronteiras. Nas praias de Barra do Itariri, Corre Nu,
Vapor, Dunas, Coqueiros e Mangue Seco, os ninhos que não sofrem
interferência humana são mantidos em situação natural (in situ); já nas demais
praias, os ninhos são transferidos para um cercado de incubação, e aí
monitorados diariamente.
O litoral norte da Bahia possui grande variedade de praias quanto às
características morfodinâmicas e sedimentológicas, o que propicia estudo
controlado das diferentes variáveis relacionadas com a interação entre as
tartarugas marinhas e as praias de reprodução. Do ponto de vista
morfodinâmico, as praias em geral classificam-se em: reflexivas, na qual há
intensa reflexão de energia de quebra de onda, e dissipativa, onde a energia de
quebra de onda se dissipa gradualemnte; a praia reflexiva é tipicamente
íngreme, com areias grossas e presença de berma no seu limite superior,
sendo favorecida por acúmulo na parte emersa e erosão ou ausência de areia
na zona submersa; a dissipativa é plana, com areias finas e sem berma, sendo
favorecida por erosão na parte emersa e deposição na zona submersa.
A granulação do substrato sedimentar onde os ovos das tartarugas marinhas
são depositados influencia o sucesso de eclosão, interferindo sobre o
desenvolvimento dos embriões. Destacam-se, sob este aspecto, três
parâmetros físico inter-relacionados: temperatura, difusão de gases e umidade.
A caracterização deste substrato é portanto, fundamental para a conservação e
concepção de estratégias de manejo dos ovos de tartarugas marinhas.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

40
UNISA - Universidade de Santo Amaro

OBJETIVO:
Este trabalho tem como objetivo avaliar as possíveis relações entre a
distribuição granulométrica nos ninhos das tartarugas marinhas C.caretta e
L.olivacea e o tempo de incubação e o sucesso de eclosão destas duas
espécies, em praias do litoral norte do Bahia, monitoradas pelo Projeto
Tamar/ICMBio Base Sítio do Conde.

METODOLOGIA:
A região de estudo pertence à base Sítio do Conde - BA, do Projeto
Tamar/ICMBio. Neste estudo, trabalhou-se com duas áreas, designadas parte
sul (Barra do Itariri e Corre Nu) e parte norte (Vapor, Dunas, Coqueiros e
Mangue Seco), cada qual corresponde a um arco praial contínuo. A parte sul
possui 14km de extensão, limitando-se a sul pelo rio Itariri e a parte norte
possui 23km, limitando-se a norte pelo rio Real. Entre as duas áreas há um
trecho de 28km de praias sem amostragem, onde se encontra o rio Itapicuru.
A coleta das amostras deu-se entre janeiro e março de 2008, somente em
ninhos in situ e para as duas espécies de maior abundância na área, C.caretta
e L.olivacea. O método utilizado foi o padrão do Projeto Tamar/ICMBio
(Marcovaldi & Marcovaldi, 1999). As praias foram monitoradas diariamente,
para a identificação de novas desovas e acompanhamento dos ninhos em
incubação, com abertura de ninhos caso verificada a eclosão dos filhotes.
Durante a abertura do ninho, identificou-se a espécie e coletou-se amostra do
sedimento arenoso situado imediatamente acima dos ovos. Cada amostra foi
condicionada em saco plásticos, devidamente identificado.
As amostras foram obtidas em duas baterias, a primeira com início na primeira
semana de janeiro e a segunda na primeira semana de fevereiro. Em cada
bateria, planejou-se coletar uma amostra por quilômetro de cada espécie.
Desse modo, ao final das duas baterias, contar-se-ia, no total, com 148
amostras. No entanto, não foi possível realizar todas as coletas, porque em
alguns quilômetros não ocorreram desovas no período de estudo; além disso,
houve desovas com interferência de predação animal. Ao final da coleta,
totalizaram-se 82 amostras. Destas, 26 foram coletadas na parte sul, sendo 14
de L.olivacea e 12 de C.caretta, e 56 na parte norte, sendo 32 de L.olivacea e
24 de C.caretta.
As atividades laboratoriais foram realizadas no Laboratório de Sedimentologia
do Instituto de Geociências da Universidade de São Paulo (Labsed-IG-USP).
Após secas, as amostras foram submetidas à análise granulométrica, no
equipamento Mastersizer 2000, da Malvern, o qual mede a difração de raios
laser para inferir o tamanho das partículas colocadas em suspensão na água ou
no ar. Para dispersão dos grãos foi utilizado o acessório Scirocco 2000,
indicado para amostras dominantemente arenáceas, o qual trabalha a seco.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

41
UNISA - Universidade de Santo Amaro

Os resultados granulométricos foram expressos na escala phi, onde phi é o log


negativo, na base 2, do diâmetro expresso em mm; desse modo, quanto mais
grossa a granulometria, menor é o valor em phi e vice-versa. Estes resultados
foram separados em quatro classes (phi): areia grossa (0,0-1,0), areia média
(1,0-2,0), areia fina (2,0-3,0) e areia muito fina (3,0-4,0). Calcularam-se as
medidas estatísticas (diâmetro médio, desvio padrão, assimetria e curtose) da
distribuição de frequências granulométricas, para cada amostra, pela técnica
analítica dos momentos de Pearson, através do programa Momento 4.1 de
Paulo C. F. Giannini e Daniel R. Nascimento Jr (2006).
Para avaliação dos resultados, foram utilizados dois métodos: o gráfico, que
consistiu na construção de diagramas de dispersão envolvendo as variáveis
granulométricas, biológicas (tempo de incubação e taxa de eclosão) e a
distância ao longo da costa; e o analítico, que envolveu a análise de correlação
linear entre estas mesmas variáveis. Ambos os métodos foram aplicados por
meio do programa Microsoft Office Excel 2007.
O coeficiente de correlação linear de Pearson (r) entre as variáveis analisadas
foi submetido a exame de nível de significância (p ou erro I), segundo teste t
Student. Apenas correlações com valores de p menores que 0,2 foram aceitos e
utilizadas para efeito de interpretação e discussão.
O método de McLaren & Bowles (1985) utilizado para inferir o sentido da deriva
litorânea longitudinal residual admite a existência de dois padrões de variação
combinada de três medidas estatísticas (diâmetro médio, desvio padrão e
assimetria), capazes de indicar inequivocamente o rumo de transporte. Estes
padrões de variação são: “mais fino, melhor selecionado, mais negativo” e “mais
grosso, melhor selecionado, mais positivo”.

RESUMO:
As praias da parte norte da área estudada (Mangue Seco e Coqueiros)
apresentam morfodinâmica intermediária-dissipativa a intermediária, entre os
estágio 2 a 4 de Wright et al. (1979), com variações ao longo de sua extensão.
Contêm campos de dunas ativas com até pouco mais de 1 km de comprimento
transversal à costa, localmente avizinhadas junto à praia por dunas frontais
incipientes. As praias da parte sul (Corre Nu e Barra do Itariri) possuem
morfodinâmica dominantemente dissipativa, com presença de arrecifes
bioclásticos (beach rocks) na antepraia. Entre as feições eólicas, predominam
dunas frontais incipientes, parte delas com falésias na face voltada para o mar.
Esta variação de morfodinâmica acompanha a redução de altura média de onda
da parte norte, quando comparada à parte sul.
Tanto nos ninhos de C.caretta como de L.olivacea, a tendência de variação
granulométrica ao longo dos dois setores de costa amostrados foi a mesma: as
areias tornam-se mais grossas em média (com menores valores em phi),

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

42
UNISA - Universidade de Santo Amaro

melhor selecionadas (com menor desvio padrão) e com assimetria da


distribuição de frequências mais positiva, rumo sul. Desse modo, pode-se
interpretar que o rumo dominante de deriva litorânea longitudinal residual nos
dois setores costeiros estudados, de acordo com a regra de McLaren & Bowles
(1985) é sul.
O engrossamento seletivo das areias de praia neste rumo deve-se a aumento
nas proporções de areia grossa e areia média, em detrimento do teor de areia
fina e, em dois dos agrupamentos de amostras estudados (C.caretta parte norte
e L.olivacea parte norte), em detrimento também da concentração de areia
muito fina.
Para L.olivacea, nas duas áreas, e C.caretta, na parte norte, o tempo de
incubação aumenta com o afinamento (crescimento de diâmetro médio em phi)
e com a piora da seleção granulométrica (aumento do desvio padrão); em
outros três dos agrupamentos de amostras estudados (C.caretta, em ambas as
partes, e L.olivacea, na parte norte), o tempo de incubação cai com o aumento
de assimetria.
A tendência para prolongamento da incubação com o afinamento da
granulometria é confirmado pelas variações de classes granulométricas nos
ninhos de L.olivacea, na parte sul, e de ambas as espécies, na parte norte; o
tempo de incubação aumenta com a diminuição nas proporções em massa de
areia grossa e areia média e com o aumento na proporção de areia fina e/ou
areia muito fina.
Em ambos os trechos de praia e para ambas as espécies, o tempo de
incubação aumenta significantemente no sentido sul-norte.
Em L.olivacea, na parte sul, e em C.caretta ao longo dos dois arcos praiais
estudados, a eclosão é favorecida por afinamento do diâmetro médio e piora de
seleção granulométrica.
Nos ninhos de L.olivacea da parte sul, bem como nos de C.caretta da parte
norte, a taxa de eclosão apresenta correlação negativa com as concentrações
das classes granulométricas mais grossas (areia grossa e areia média) e
positiva com as mais finas (areia fina e areia muito fina).
Para L.olivacea, na parte sul e C.caretta, na parte norte, a taxa de eclosão
aumenta no sentido sul-norte.
Para L.olivacea, na parte sul, encontrou-se aumento estatisticamente
significativo (p:0,2) da taxa de eclosão com o incremento do tempo de
incubação.
Foi observado que o rumo dominante de deriva litorânea longitudinal residual
nos trechos costeiros estudados é sul, indicado pelo engrossamento seletivo
das areias de praia, neste mesmo rumo, de acordo com o método de McLaren
& Bowles (1985).
Este comportamento granulométrico deve-se à progressiva perda de
sedimentos finos, seja rumo costa afora seja para a praia emersa, durante o

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

43
UNISA - Universidade de Santo Amaro

processo sucessivo de vaivém de arrebentação ou de espraiamento,


respectivamente.
Características da dinâmica e sedimentologia praial devem ser levadas em
consideração em estudos de incubação de ovos de tartarugas marinhas, pois
afetam diretamente as condições de microclima do ninho. No presente estudo,
detectou-se para as espécies L.olivacea, em ambas as áreas, e C.caretta, na
parte norte, o aumento do tempo de incubação com o afinamento do diâmetro
médio e a piora da seleção (diminuição do desvio padrão). Em outros três
agrupamentos de amostras estudados (C.caretta, em ambas as partes, e
L.olivacea, na parte norte), observou-se ainda correlação negativa do prazo de
incubação com a assimetria da curva de distribuição granulométrica.
De acordo com estudos prévios desovas realizadas em sedimentos
enriquecidos nas frações mais grossas apresentam temperatura média maior
que as situadas em sedimentos mais finos. A temperatura incluí-se entre os
principais parâmetros ambientais que influenciam a duração de incubação dos
ninhos, pois acelera o desenvolvimento embrionário e leva assim a períodos de
incubação mais curtos.
No presente estudo, o tempo de incubação da espécie L.olivacea, na parte sul,
aumentou com a diminuição do teor de areia grossa e areia média e com o
aumento do de areia fina. Na parte norte, o resultado foi semelhante,
adicionado de correlação direta com a classe areia muito fina. Estes resultados
são reforçados pelo aumento do tempo de incubação no sentido sul-norte, em
ambas as espécies, nos dois trechos estudados, visto que o engrossamento da
granulometria por efeito da deriva litorânea, ocorre, nesta região, no sentido
oposto. Resultados semelhantes, menor tempo de incubação em ninhos com
sedimentos mais grossos, já haviam sido encontrados em pesquisas realizadas
na costa do Espírito Santo.
Estudos prévios com tartarugas de água doce das espécies Podocnemis
expansa e Podocnemis unifilis demonstram analogamente que o tamanho do
sedimento influencia na duração da incubação. Areias mais grossas
apresentariam temperaturas maiores, promovendo a eclosão dos ninhos mais
cedo que aqueles localizados em areias mais finas.
Em L.olivacea, na parte sul, e C.caretta, ao longo das duas áreas estudadas, a
eclosão foi favorecida pelo aumento do diâmetro médio em phi (afinamento dos
grãos), de sul para norte. Estudo de taxa de eclosão em C.mydas, na Ilha de
Ascensão (Santa Helena), constatou a mesma correlação com o tamanho de
grãos, assim como para E.imbricata em Ilhéus, Bahia, onde o diâmetro médio
afetou o sucesso de eclosão, sendo que quanto maior o diâmetro em mm,
menor a taxa de eclosão.
O sucesso de eclosão e a mortalidade embrionária variam de acordo com
características ambientais durante o período de incubação, as quais são
influenciadas principalmente pela temperatura e pela umidade no interior do

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

44
UNISA - Universidade de Santo Amaro

ninho. Os substrato úmido aumentaria a porcentagem da taxa de eclosão em


C.caretta, desde que este não se encontre saturado em água. Como areias
mais finas propiciam a retenção maior e mais prolongada de umidade, o
afinamento de granulometria favorece indiretamente a eclosão.
Os estudo prévios sobre as desovas de P.unifilis demonstraram que o tamanho
do sedimento não afetou a porcentagem de eclosão. Já para P.expansa,
segundo mesmo trabalho, o sucesso de eclosão é favorecido pelo afinamento
do tamanho dos sedimentos. Estudos no estado da Bahia, com a espécie
C.caretta, mostraram que sedimentos praiais cuja distribuição granulométrica
apresenta alta concentração da fração areia fina otimizam o desenvolvimento e
nascimento de filhotes.

CONCLUSÃO:
Conclui-se, neste trabalho, que a granulometria das praias amostradas tem
influência no tempo de incubação e na taxa de eclosão das espécies de
tartarugas marinhas investigadas (C.caretta e L.olivacea). Esta influência não
pode ser analisada sem levar em consideração a variação de aporte e
morfodinâmica costeira ao longo das praias, uma vez que é esta variação que
determina a mudança de granulometria.
O rumo de deriva litorânea longitudinal no trecho de costa estudado é sul, o que
se reflete na melhora de seleção granulométrica, com engrossamento da areia
de praia, nesse mesmo rumo. Como consequência desse engrossamento, o
tempo de incubação diminui, juntamente com a taxa de eclosão, de norte para
sul.
Levando em consideração os resultados obtidos neste trabalho, os cercados de
incubação a serem construídos ou modificados, nesta área, devem ser
realizados de preferência na porção mais ao norte de cada arco praial, onde as
areias são relativamente mais finas e favoráveis à eclosão, porém deve-se levar
em consideração a mudança de temperatura, para que não altere a razão
sexual, uma das principais preocupações no manejo e conservação das
tartarugas marinhas.

REFERÊNCIA BIBLIOGRÁFICA:
McLAREN, P. & BOWLES, D., 1985. The effects of sediment transport on grain-
size distributions. Journal of Sedimentary Petrology, 55(4): 457-470.

MARCOVALDI, M.A. & MARCOVALDI, G.G., 1999. Marine turtles of Brazil: the
history and structure of Projeto TAMAR – IBAMA. Biological Conservation: v.91,
p. 35 – 41.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

45
UNISA - Universidade de Santo Amaro

WRIGHT, L.D.; CHAPPEL, J.; THOM, B.; BRADSHA, W.M. & COWELL, P.,
1979. Morphodynamics of reflective and dissipative beach and inshore systems:
South Austrália. Marine Geology, 32(1):105-140

________________________________________________________________
1-graduação em ciências biológicas da UNISA.

2-Professor Dr. Pós graduação do Instituto Geociências Universidade de São


Paulo.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

46
UNISA - Universidade de Santo Amaro

Análise comparativa de um projeto de Mecanismos de


Desenvolvimento Limpo e dois projetos de Produção Mais Limpa
de duas empresas do setor industrial
JANAINA OLIVEIRA COSTA(1)

SALETE REGINA VICENTINI(2)(Orientadores)


Ciências Biológicas
INTRODUÇÃO:
A partir da Revolução Industrial, iniciada na Inglaterra no século XVIII, a
poluição passou a ser um problema em algumas cidades. Esta revolução
representou a consolidação e a globalização do capitalismo, sistema sócio-
econômico atual, que proporciona o aumento da produção, do consumo de
bens materiais e da urbanização. Com o crescimento da produção e do
consumo, a pressão sobre os recursos naturais aumentou, gerando degradação
ambiental em todas as suas formas.
Os indicadores da degradação ambiental tornam-se alarmantes, à medida que
a capacidade de suporte do planeta é reduzida não só pela poluição, como
também pelo desmatamento, pela expansão da erosão, pela contaminação das
águas, pelo consumo exagerado de fontes de energia não-renováveis, e pelo
crescimento populacional. O crescimento da população pressiona o uso
crescente dos recursos naturais e contribui para perpetuar a pobreza, que por
sua vez gera problemas ambientais graves, especialmente nos países em
desenvolvimento.
Na década de 60, a crescente preocupação pública com as questões
ambientais fez com que muitos governos no mundo se sentissem pressionados
em achar soluções para conter a degradação ambiental e buscar o
desenvolvimento sustentável.
O desenvolvimento sustentável pode ser definido como o desenvolvimento que
procura satisfazer as necessidades da geração atual, sem comprometer a
capacidade das gerações futuras de satisfazerem as suas próprias
necessidades. Para isso, deve existir um processo contínuo de melhoria das
condições de vida, redução do uso de recursos naturais e minimização da
degradação ou dos desequilíbrios ambientais.
A Organização das Nações Unidas (ONU) começou a realizar conferências para
tratar dos problemas ambientais. A primeira delas, a Conferência das Nações
Unidas sobre Ambiente Humano, em Estocolmo na Suécia, em 1972, contou
com a participação de 113 países. A Estocolmo-72, como ficou conhecida,
tornou-se um marco e dela saíram frutos importantes como o Programa das
Nações Unidas sobre Meio Ambiente e Desenvolvimento - PNUMA. Para
discutir a intensificação das mudanças climáticas foi estabelecida a Convenção

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

47
UNISA - Universidade de Santo Amaro

do Clima na conferência Eco-92, que ocorreu no Rio de Janeiro em 1992


(MARTINS, 2002). Desde então, os países participantes têm se reunido em
Conferências das Partes (COPs) para discutir este assunto e tentar encontrar
soluções para o problema. A COP-3 foi uma das mais importantes, pois
estabeleceu o Protocolo de Kyoto, que propõe o Mecanismo de
Desenvolvimento Limpo (MDL), permitindo aos países industrializados de
financiar projetos de redução de emissões de Gases do Efeito Estufa (GEE) nos
países em desenvolvimento.
Em 1991, a Organização das Nações Unidas para o Desenvolvimento Industrial
(UNIDO) junto ao Programa das Nações Unidas para o Meio Ambiente e Centro
de Atividades do Programa de Meio Ambiente em Paris (UNEP/IEPAC)
iniciaram um projeto, onde foram criados os “Centros Nacionais de Tecnologias
Limpas” com o objetivo de desenvolver a Produção Mais Limpa ou P+L, que
significa a aplicação contínua de uma estratégia ambiental e tecnológica aos
processos produtivos, com o objetivo de aumentar a eficiência no uso de
matérias-primas e insumos, tendo como resultados a não-geração ou
minimização de resíduos nas empresas. Desse modo a P+L reduz os riscos
ambientais e traz benefícios econômicos para o empreendimento.
No Brasil, com o crescimento das atividades industriais, da geração de resíduos
e da poluição, os órgãos ambientais passaram a solicitar das empresas o
controle e o tratamento das emissões atmosféricas, resíduos sólidos e
efluentes. Com isso, as empresas começaram a busca de soluções e
alternativas inovadoras para o sistema produtivo, como os Mecanismos de
Desenvolvimento Limpo (MDL), as técnicas de Produção Mais Limpa (P+L), a
certificação da norma ISO 14000 e os Sistemas de Gestão Ambiental - SGA.

OBJETIVO:
O objetivo deste trabalho foi fazer uma análise comparativa entre um projeto de
Mecanismo de Desenvolvimento Limpo – MDL e dois projetos de Produção
Mais Limpa – P+L, em duas empresas do setor industrial, uma da área química
e a outra fabricante de eletrodomésticos, verificando os pontos de convergência
e divergências destes projetos; avaliando também a viabilidade de aplicação
destas técnicas conjuntamente e se estes projetos atendem ao conceito de
sustentabilidade.

METODOLOGIA:
A pesquisa foi feita com duas empresas do setor industrial. A empresa “A” é
uma empresa da área química, onde foi desenvolvido um projeto de MDL com o
objetivo de reduzir a emissão de óxido nitroso. O projeto consiste na instalação
de uma planta para a decomposição térmica de N2O originado da fabricação de

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

48
UNISA - Universidade de Santo Amaro

ácido adípico. O N2O é gerado como um subproduto do estágio de oxidação de


ácido nítrico, sendo emitido na corrente de gás residual. Com o projeto a
empresa esperava reduzir as emissões de GEE em aproximadamente 5,96
milhões de toneladas.
Já a empresa “B” fabrica eletrodomésticos e possui na unidade fabril de São
Paulo 2 projetos de P+L, um para a redução no volume e toxicidade de resíduos
e outro para a redução do consumo de água. No primeiro projeto para a
“redução no volume e toxicidade de resíduos sólidos gerados” na estação de
tratamento de efluente (ETE), foram adotadas medidas como a implantação, em
1998, de uma unidade de segregação de esmalte para evitar que os efluentes
da linha de esmaltação se misturassem com os demais líquidos encaminhados
para a ETE. O efluente líquido é segregado no setor de esmaltação, seguindo
para floculação e posterior adensamento. Na sequência, um filtro-prensa separa
a água clarificada, que segue para a ETE. O resíduo sólido resultante do
processo, formado unicamente por esmalte, fica retido na torta do filtro-prensa e
retorna à linha de produção como matéria-prima, sem que suas características
tenham sido alteradas. Além da implantação do sistema de reutilização, a
empresa mantém um contato permanente com os fornecedores de esmaltes,
visando à redução de metais pesados e outras substâncias tóxicas presentes
na matéria-prima. Para o outro projeto de redução do consumo de água, foi
implantado, em 1996, um sistema de reuso do efluente tratado que consiste de
sistema de filtragem, com vazão de 9 a 10m³/h, adaptado ao sistema de
tratamento de efluentes. O material filtrante é composto por areia isenta de ferro
que promove a retenção de contaminantes e eventuais partículas em
suspensão. Após o filtro há uma caixa d’água com 5m³ de capacidade, utilizada
para o armazenamento e duas bombas que bombeiam a água para o processo
industrial e sanitários. No processo industrial, a água é reutilizada: na lavagem
de piso; na remoção de tinta em pó, das peças eventualmente danificadas
antes do processo de queima; e no processo de desengraxe das peças.
A metodologia utilizada foi a de método comparativo através do levantamento
bibliográfico em artigos, livros e sites relacionados aos assuntos ambientais, de
MDL e de P+L. Também foi aplicado um questionário com 17 questões abertas
e fechadas, enviado para os responsáveis pelos projetos nas 2 empresas
pesquisadas.

RESUMO:
Sobre as motivações que levaram as empresas a implantar os projetos, as duas
empresas que responderam ao questionário puderam enumerar de 1 a 6 em
relação à importância de cada motivação citada; o número 1 foi considerado o
item mais importante e o item 6 o menos importante.
Nos resultados as duas empresas colocaram o mesmo item como mais
importante: “contribuir para o esforço global de combate à mudança climática”.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

49
UNISA - Universidade de Santo Amaro

A empresa “A” tem este item como motivação principal, pois segundo Lopes
(2002) o objetivo final dos projetos de MDL é a redução da emissão de gases
do efeito estufa (GEE) ou o aumento da remoção de CO2, já que estes gases
são os responsáveis pela intensificação das mudanças climáticas. E como
consta no Anexo A do Protocolo de Kyoto, um dos GEE é o Óxido Nitroso, o
qual a empresa “A” buscou reduzir.
A empresa “B” também tem esse item como principal, pois segundo o SENAI-
RS (2003), a P+L tem seu foco voltado para uma estratégia de redução
contínua da poluição e dos impactos ambientais através de reduções na fonte –
eliminando os resíduos e emissões dentro do processo produtivo ao invés de
tratá-los depois que foram gerados. Dessa forma, a P+L contribui também para
a redução de futuras emissões, como por exemplo de metano, com a
destinação de menores quantidades de resíduos.
Para as maiores influências para aplicação do projeto em determinado
processo, a empresa “A” escolheu o processo de maior geração de resíduos ou
emissões de gases.
Segundo Lopes (2002), as atividades de projetos de MDL devem estar
exclusivamente relacionadas a determinados tipos de GEE, como o óxido
nitroso (N2O), e aos setores/fontes de atividades, onde são gerados estes
gases.
A empresa que implantou a P+L escolheu como maior influência a
“possibilidade de redução do uso de recursos naturais”. A P+L além da
minimização de resíduos, busca também otimizar o uso de matérias-primas e
insumos. Através dessa otimização, os recursos naturais são “economizados”.
A conscientização ambiental na empresa também deve ser verificada para que
um projeto de MDL ou de P+L funcione de acordo com a sua proposta inicial e
que atenda as metas ambientais.
As duas empresas consideram importante a proteção ambiental como parte
integrante do processo. A empresa como um todo deve ter consciência
ambiental, do contrário o programa pode até ser implantado, mas não se pode
garantir quanto à sua continuidade.
Além da conscientização, a preocupação com proteção ambiental pode ser
avaliada até mesmo para a autorização de implantação do projeto. Segundo
Lopes (2002) para estabelecer a linha de base de atividade de projeto do MDL,
deve ser adotado o “Documento e referências sobre impactos ambientais”, que
se refere à documentação e às referências sobre os impactos que podem ser
causados pelas atividades de projetos. Os participantes da atividade de projeto
devem relatar quais impactos são considerados significativos, incluindo um
relatório de impacto ambiental e o termo de referência da avaliação de impacto
ambiental. Este documento será avaliado pela Comissão Interministerial sobre
Mudança Global do Clima - CIMGC para aprovação da implantação do projeto.
De acordo com o SENAI-RS (2003), a P+L elimina ou reduz a emissão de

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

50
UNISA - Universidade de Santo Amaro

poluentes para o meio ambiente, ao mesmo tempo em que aperfeiçoa o uso de


matérias-primas, água e energia. Desta forma, além de um efeito de proteção
ambiental de curto prazo, a P+L incrementa a eficiência do uso de recursos
naturais, gerando melhorias sustentáveis de longo prazo.
Sobre a necessidade de inovação e mudança tecnológica; e alterações no
processo produtivo, as duas empresas responderam de forma afirmativa para a
necessidade de inovação e de mudança tecnológica, como sendo fundamentais
para as aplicações dos projetos.
De acordo com o SENAI-RS (2003), as mudanças tecnológicas são orientadas
para as modificações de processo e de equipamentos. As mudanças
tecnológicas podem variar desde mudanças simples, que podem ser
implementadas num curto período, até mudanças complexas e onerosas, como
a substituição completa de um processo.
Tanto para a decomposição térmica de óxido nitroso na empresa “A”, quanto
para redução no consumo de água e de resíduos perigoso na empresa “B”,
existiram mudanças nos processos produtivos e aplicação de novas
tecnologias. Mesmo assim, a empresa “B” declarou que não houve alteração no
processo produtivo, pois apenas foi realizado o reaproveitamento de água e
matéria-prima.
Também foram avaliados a necessidade de acompanhamento da quantidade de
redução de emissões, resíduos, matéria-prima e insumos. E se a prevenção da
geração de resíduos; e a redução de matéria-prima e energia são almejadas.
Os resultados foram afirmativos para os dois projetos.
Lopes (2002) afirma que no MDL deve ser realizado um plano de
monitoramento, que inclui a forma de coleta e armazenamento de todos os
dados necessários para calcular a redução das emissões de gases de efeito
estufa, que tenham ocorrido dentro dos limites do projeto ou fora desses limites,
desde que sejam atribuíveis à atividade de projeto e dentro do período de
obtenção de créditos.
Na P+L os objetivos são relacionados à minimização de resíduos e do consumo
de matéria-prima, água e energia. A adoção da P+L teria como principal
objetivo o controle dos resíduos, através de controle e acompanhamento,
minimizando a poluição no ambiente.
Sobre as principais barreiras enfrentadas para a aplicação dos projetos nas
empresas, o entrevistado pode escolher até três alternativas, porém a empresa
“A” assinalou apenas uma alternativa, sendo esta a de “custos”.
As duas empresas citaram como uma das barreiras a questão dos custos,
porém quando se decide investir em P+L, ao comparar as mudanças que são
geradas na estrutura dos custos totais, com o passar do tempo os custos
diminuem significativamente. Esta redução ocorre devido aos benefícios
gerados a partir do aumento da eficiência dos processos e dos ganhos no
menor consumo de matérias-primas e energia, e na diminuição de resíduos e

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

51
UNISA - Universidade de Santo Amaro

emissões.
A concepção errônea foi citada pela empresa “B” nos itens “interpretação
limitada ou incorreta do conceito do projeto” e “experiência limitada com o
envolvimento dos colaboradores em projetos da empresa”, isto pode ser
solucionado com a informação e divulgação a todos os colaboradores sobre a
importância do projeto.
Deve ser instituída uma rede de agentes dentro da empresa para organizar
programas de P+L, capacitar e liderar empregados funcionais para a gestão de
projetos e acolher o conhecimento prático dos colaboradores com experiência
nos processos produtivos. Desse modo, a barreira da empresa a se limitar a
mudanças superficiais de curto prazo pode ser superada, criando chances de
uma melhoria contínua.
Em relação a parte financeira das implantações, como o beneficiamento
econômico com a redução de resíduos e emissões e à existência de
financiamento para a implantação da técnica, a empresa “A” declarou que
apesar de não existir um financiamento para investimentos no projeto, obtêm
benefícios com a redução das emissões de N2O. Na visão do responsável pelo
projeto a redução de emissões é normalmente um benefício econômico, em
razão das emissões serem provenientes das matérias-primas, desse modo, a
redução das emissões aumenta o rendimento do processo.
Para Lopes (2002) o setor privado tem grande oportunidade de participação no
MDL, pois o potencial para reduzir emissões nesse setor é significativo. Além
disso, este setor é receptor de fluxos crescentes de investimentos que podem
ser destinados às atividades de projeto de MDL.
Já na empresa “B” existe um financiamento para aplicação da técnica, o que se
torna uma dificuldade a menos para a implementação do projeto de P+L, pois o
maior problema que se enfrenta dentro de uma empresa é a falta de recursos.
Desta forma, a possibilidade de ganhos com as reduções e a existência de
fontes de financiamento facilitam a implantação.
Sobre a possibilidade de implantação conjunta das técnicas de MDL e P+L, a
empresa “A” declarou que os métodos são complementares, porém a P+L é
mais ampla ao passo que o MDL só pode ser aplicado em alguns casos
particulares, onde o projeto possa ser enquadrado dentro das regras do
Protocolo de Kyoto.
A empresa “B” declarou que a empresa lançou mercado brasileiro um
refrigerador de 15,8 kWh/mês, com foco no consumo de energia, com um gás
inócuo ao meio ambiente - o isobutano, fabricado dentro do conceito de P+L. O
projeto é da sede da empresa na Alemanha e foi submetido à UNFCCC (United
Nations Framework Conventionon Climate Change), tendo sua metodologia
reconhecida como MDL, podendo concorrer à aquisição de créditos de carbono.
A aplicação conjunta dessas técnicas só é possível se houver um bom
planejamento estratégico, que disponibilize recursos financeiros e de pessoal

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

52
UNISA - Universidade de Santo Amaro

especializado para que se possa estudar e viabilizar essa implantação; do


contrário o investimento na implantação conjunta pode não trazer retorno
financeiro.
Por último, para demonstrar quais os critérios dos projetos que podem ser
considerados parte da busca pelo desenvolvimento sustentável, a empresa “A”
citou: “obter incentivos financeiros e, ao mesmo tempo, reduzir a emissão de
gases que causam o aquecimento global estão completamente alinhados com a
noção de sustentabilidade, pois envolvem a proteção ao meio ambiente e a
geração de lucro para a empresa”.
Lopes (2002) cita como um dos requisitos do MDL que a atividade de projeto
contribua para o desenvolvimento sustentável do país no qual venha a ser
implantada.
Já a empresa “B” citou que um dos seus pilares estratégicos é voltado ao meio
ambiente e à comunidade. E que o durante projeto “o termo sustentabilidade
refere-se à medida que os resultados e as realizações da intervenção são
duradouros. Muitas vezes, as avaliações consideram a sustentabilidade das
mudanças institucionais, bem como os impactos socioeconômicos”.
Desse modo, é possível observar uma preocupação das empresas em ter
processos que poluam menos e que economizem recursos naturais, sem deixar
de lado os aspectos financeiros.

CONCLUSÃO:
Os projetos de MDL e P+L apresentaram as seguintes semelhanças: contribuir
para o esforço global de combate à mudança climática; preocupação ambiental
como parte integrante dos projetos e benefícios econômicos com as melhorias
obtidas.
As maiores dificuldades para implantação das técnicas foram: custos e falta de
informação sobre os temas, por isso, deve-se estabelecer um planejamento
com um período de divulgação e informação dos temas MDL e P+L para todos
os colaboradores da empresa, e apresentação de casos de sucesso para a
gerência ou diretoria.
O MDL criou a possibilidade dos países desenvolvidos cumprirem parte de suas
metas de redução de emissão financiando projetos de novas tecnologias,
produção mais limpa e de desenvolvimento sustentável nos países em
desenvolvimento. Isso prova que a P+L pode ser um instrumento usado para
que se possam atingir as metas no MDL.
O MDL e a P+L podem ser implantados em conjunto e contribuem para a
sustentabilidade.

REFERÊNCIA BIBLIOGRÁFICA:
LOPES, I. V. et. al. 2002. O mecanismo de Desenvolvimento Limpo - Guia de
orientação. Editora Fundação Getúlio Vargas. Rio de Janeiro. 90 p.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

53
UNISA - Universidade de Santo Amaro

MARTINS, J. P. S. 2002. A década desperdiçada: O Brasil, a Agenda 21 e a Rio


+ 10. Editora Komedi. Campinas. 200 p.

SENAI-RS - SERVIÇO NACIONAL DE APRENDIZAGEM INDUSTRIAL. 2003.


Implementação de Programas de Produção mais Limpa. UNIDO, UNEP, Centro
Nacional de Tecnologias Limpas (CNTL) – SENAI-RS. Porto Alegre. 42 p.
________________________________________________________________
Palavras-chave: Mecanismo de Desenvolvimento Limpo, Produção mais Limpa,
desenvolvimento sustentável.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

54
UNISA - Universidade de Santo Amaro

Análise da atividade antibacteriana e teores de fenóis totais e


flavonóides em extratos de Tithonia diversifolia (Hemsl.) A. Gray
(Asteraceae)
DANIELE COELHO GOMES LIMA(1)

MARCO AURELIO SIVERO MAYWORM(2)(Orientadores)


Ciências Biológicas
INTRODUÇÃO:
Uma planta medicinal pode ser definida como qualquer vegetal que produza,
em quantidade considerável, substâncias biologicamente ativas utilizadas direta
ou indiretamente como medicamento. Os princípios biologicamente ativos das
drogas procedem do metabolismo das plantas, constituindo-se, em muitos
casos, em respostas dos mecanismos de integração da planta com o ambiente.
A biodiversidade pode ser definida como a variedade e variabilidade existentes
entre os organismos vivos e as complexidades nas quais eles ocorrem. Uma
das principais características da diversidade é a distribuição relativa desigual
dos seus componentes no espaço geográfico, significando que a abundância de
espécie é variável em um determinado ambiente. A implicação óbvia disto
relaciona-se com a necessidade de serem tomadas medidas urgentes para a
conservação dos ecossistemas.
Por muito tempo, os recursos terapêuticos foram constituídos por minerais,
produtos de origem animal e principalmente por plantas e seus extratos. Ao
longo dos séculos o homem percebeu a existência de algo nas plantas que,
administrado sob diversas formas (chás, garrafadas, pós, etc.), era capaz de
resultar em reações benéficas á saúde.
Quimioterápicos e antibióticos podem ter ação antibacteriana, antifúngica e
antiviral, sendo que esta ação pode levar a inibição do crescimento, à
inativação, ou a morte do agente infeccioso. Os antibióticos e os
quimioterápicos interferem com diferentes atividades da célula bacteriana,
causando sua morte ou somente inibindo seu crescimento. Os primeiros são
chamados de bactericidas e os segundos chamados de bacteriostáticos.
Algumas drogas, tipicamente bacteriostáticas, podem ser bactericidas para
determinadas espécies de bactérias.

Metabólitos Secundários

Um dos fatores de extrema importância para a descoberta de princípios ativos


naturais consiste, principalmente, na interação entre a química e a
farmacologia.
Dá-se o nome de metabolismo ao conjunto de reações químicas que

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

55
UNISA - Universidade de Santo Amaro

continuamente estão ocorrendo em cada célula. A presença de enzimas


especifica garante certa direção a essas reações, estabelecendo o que se
denomina de rotas metabólicas. Os compostos químicos formados, degradados
ou transformados, são chamados de metabólitos. Estas reações que visam o
aproveitamento de nutrientes para satisfazer as exigências fundamentais da
célula, sendo considerados processos essenciais à vida, são chamadas de
metabolismo primário. Vegetais e microrganismos, apresentam todo arsenal
metabólico como, enzimas e coenzimas, capaz de produzir, transformar e
acumular inúmeras outras substâncias não relacionadas de forma direta á
manutenção da vida do organismo produtor, sendo definido como metabolismo
secundário. Estes produtos, não são necessariamente essenciais para o
organismo que os produz, mas garante vantagens para sua sobrevivência e
perpetuação em seu ecossistema.
Os Metabólitos secundários são elaborados através da biossíntese dos
compostos primários e apresentam uma grande importância ecológica para o
vegetal, como defesa contra herbívoros e microrganismos proteção contra
radiação UV, atração de polinizadores ou animais dispersores de sementes,
bem como a participação em interações alelopáticas.
Os principais grupos de Metabólitos secundários são os alcalóides, terpenóides
e fenóis entre outros quinonas, óleos voláteis, glicosídeos e flavonóides.
Os alcalóides são os mais potentes de todos os grupos químicos presentes.
Alcalóides são compostos nitrogenados farmacologicamente ativos e são
encontrados principalmente nas angiospermas. Na grande maioria possuem
caráter alcalino, mas apresentam exceções como a colchicina, piperina, oximas
e alguns sais quaternários. Muito se escreveu sobre a possível função dos
alcalóides nas plantas, sobre as razões de ocorrerem nelas. Algumas de suas
possíveis funções seriam como agentes venenosos que protegem a planta
contra insetos e herbívoros, produtos finais de reações de detoxificação que
representam um bloqueio metabólico de compostos que de outro modo seriam
nocivos à planta, reguladores de crescimento, substâncias de reservas capazes
de fornecer nitrogênio ou outro elemento necessário à planta.
Terpenóides são definidos como produtos naturais cuja estrutura pode ser
dividida em unidades menores de isopreno. Estes compostos são associados
em quase todas as interações possíveis que as plantas mantêm entre si e com
os demais microrganismos. Os sesquiterpenóides contêm três unidades de
isopreno, enquanto que tetraterpenóides ou carotenóides têm oito unidades. Os
sesquiterpenóides têm grande distribuição na natureza e formam a maior classe
de terpenóides, tratando-se de um grupo que apresenta grande espectro de
atividades biológicas, como atividade antitumoral e antimicrobiana.
Os compostos fenólicos possuem grande diversidade em suas estruturas, que
podem ser simples ou complexas. Dentre os compostos fenólicos estão às
ligninas e os taninos, polímeros de grande importância para os vegetais. Muitos

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

56
UNISA - Universidade de Santo Amaro

dos compostos são constituintes de óleos voláteis, sendo alguns aromatizantes


tradicionais, como o aldeído, na canela. Sob a forma de ácido gálico, os fenóis
atuam na defesa das plantas, participam na inter-relação entre animais e
vegetais, são agentes alelopáticos, atuando na inibição da germinação de
sementes.
Os taninos são definidos substâncias fenólicas solúveis em água, apresentando
habilidade de formar complexo insolúvel em água com alcalóides, gelatina,
entre outras proteínas.
Os taninos são divididos de acordo com os núcleos fenólicos existente em sua
composição e na maneira como se unem formando dois grupos principais: os
taninos hidrolisáveis que se dividem em dois subgrupos dependendo do ácido
derivado na hidrólise sendo os galitaninos (ácido gálico) e elagitaninos (ácido
elágico) e os taninos condensados que formam o outro grupo principal sendo
mais resistentes à hidrólise. Estes compostos são particularmente importantes
componentes gustativos, sendo responsável pela adstringência de muitos frutos
e produtos vegetais. A complexação entre taninos e proteínas é a base para
suas propriedades como fatores de controle de insetos, fungos e bactérias.
Flavonóides constitui um grupo de compostos polifenólicos complexo que
apresentam uma estrutura caracterizada por dois anéis aromáticos (A e B) e um
anel heterocíclico oxigenado (C). Compondo este grupo estão descritos mais de
4000 compostos fenólicos diferentes incluindo os subgrupos flavonóis, flavonas,
antocianinas e flavononas. Diversas funções são atribuídas aos flavonóides nas
plantas, dentre elas podem-se citar: proteção dos vegetais contra incidências de
raios ultravioleta e visível, além de proteção contra insetos, fungos, vírus e
bactérias, atração de animais com finalidade de polinização, antioxidante,
controle da ação de hormônios vegetais, agentes alelopáticos e inibidores de
enzimas. Os flavonóides agem na membrana do microrganismo, apresentando
atividade contra bactérias gram positivas.
Os óleos essenciais, também chamados óleos voláteis ou essências, são
misturas complexas de substâncias voláteis, lipofílicas, geralmente odoríferas e
líquidas. Quimicamente, a grande maioria dos óleos voláteis é constituída de
derivados fenilpropanóides ou de terpenóides que pode ter ação anti-séptica,
inibindo o crescimento de bactéria e fungos.
As quinonas são compostos orgânicos que podem ser considerados como
produtos da oxidação de fenóis, sua principal característica é a presença de
dois grupos carbonílicos que formam um sistema conjugado com pelo menos
duas ligações duplas. São pigmentos naturais utilizados como corantes
alimentares, possui uma ação laxante.

Atividade Antimicrobiana

O termo antimicrobiano é usado para descrever elementos que combatem

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

57
UNISA - Universidade de Santo Amaro

diretamente microrganismos causadores de doenças, ou que estimulem o corpo


no combate à infecção, fortalecendo o sistema imunológico.
As plantas têm sido fontes valiosas de produtos naturais que auxiliam na
manutenção da vida humana. O uso de extratos de plantas, com conhecimento
de suas propriedades antimicrobianas, tem importante significado em
tratamento terapêutico.
Com o conhecimento e o estabelecimento de métodos analíticos, iniciaram–se
as pesquisas com constituintes e atividades semelhantes em Pteridófitas,
Gimnospermas e Angiospermas. Verificando-se que grande número de plantas
floríferas apresentava propriedades antimicrobianas.
Extratos produzidos a partir de espécies de Amaranthaceae, Scrophulariaceae,
Alismataceae, Zingiberaceae, Plantaginaceae, Compositaceae, Lythraceae e
Verbenaceae apresentam atividades antibacteriana sobre microrganismos
Gram Positivos e Gram Negativo. Nos extratos foram encontrados esteróides,
saponinas, polifenóis e flavonóides.
Para desenvolver novos medicamentos os bacteriologistas partiram do principio
de que determinados produtos, capazes de livrar o homem de diversos males,
possuíam atividade bactericida ou bacteriostática. A esses princípios dá-se o
nome de antibióticos.
Nos últimos anos tem-se verificado um grande avanço cientifico envolvendo os
estudos químicos e farmacológicos de plantas medicinais que visam obter
novos compostos com propriedades terapêuticas.

Família Asteraceae

A família Asteraceae possui distribuição cosmopolita, sendo a maior família de


Eudicotiledônea, com aproximadamente 1600 gêneros e 23000 espécies. No
Brasil a família esta bem representada, ocorrendo aproximadamente 300
gêneros e 2000 espécies. Diversas plantas medicinais estão também incluídas
entre as Asteraceae, destacando-se a carqueja (Baccharis ssp), a camomila
(Matricaria recutita), o guaco (Mikania spp).
Muitas de suas espécies são ainda invasoras sendo consideradas agressivas
por produzirem substâncias que inibem ou retardam o crescimento de
competidores.
Entre os constituintes químicos encontrados nessa família destacam-se
triterpenos, esteróides, cumarinas, óleos voláteis, sesquiterpenóides,
flavonóides, alcalóides, entre outros.
Tithonia diversifolia (Hemsl.) A. Gray é um arbusto de textura semi-herbácea,
ereto, vigoroso, ramificado, de 1,5-2,5 m de altura com ramagem vigorosa mais
quebradiça, folhas inteiras ou lobadas e pubescente. Inflorescência terminais e
axilares com flores amarelas vistosas, reunidas em capitulo solitário grande,
semelhante ao girassol, formado durante os meses de outono-inverno, planta

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

58
UNISA - Universidade de Santo Amaro

rústica e pouco tolerante a baixa temperatura é indicada principalmente para


regiões tropicais e subtropicais do país. Multiplica-se por sementes que
germinam espontaneamente, formando mudas nas proximidades da planta
mãe.
Diversos trabalhos foram feitos com a família Asteraceae apresentando
atividades antimicrobianas.
Extrato de inflorescências de Calêndula (Calendula officinalis L.) mostrou
atividade bactericida, fungistática, virucida entre outras. Os principais
componentes seriam flavonóides, saponinas e carotenóides.

OBJETIVO:
O presente trabalho teve como objetivo estudar o potencial antibacteriano e
analisar os teores de fenóis totais de extratos etanólicos produzidos a partir de
folhas, caules e inflorescências de Tithonia diversifolia (Hemsl.) A.Gray
(Asteraceae).

METODOLOGIA:
Materiais

Amostras de folhas, caules e inflorescências de Tithonia diversifolia (Hemsl.)


A.Gray foram coletadas na região de Parelheiros, zona sul da região
metropolitana de São Paulo – SP, em uma área livre de adubos e agrotóxicos.
Amostras testemunhas foram coletadas e herborizadas segundo técnica de
FIDALGO & BONONI (1989) e depositadas no herbário da Universidade de
Santo Amaro sob n° 3801.

Determinação de Massa Seca das Amostras e dos Extratos

Para determinar o rendimento de massa seca, fragmentos de mesmo tamanho


de inflorescências, folhas e caules foram selecionadas em triplicata, pesadas
em balança analítica e colocadas para desidratar em estufa a 100º C, durante
12 horas. Depois, os fragmentos secos foram acondicionados em dessecador
fechado vácuo, para retirar o restante da umidade das amostras e estas foram
pesadas até atingir peso constante.
Os teores de massa seca de cada extrato foram obtidos utilizando-se amostras
de 1 mL (em duplicata), eliminando-se o solvente e mantendo-se em
dessecador até peso constante.

Produção de Extratos

As amostras foram fragmentadas e submersas em etanol P.A., sendo agitadas

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

59
UNISA - Universidade de Santo Amaro

a cada dia e o solvente trocado a cada 7 dias, perfazendo um total de 28 dias


de extração. Após a primeira extração (7º dia) o material foi triturado em
liquidificador e em seguida submerso novamente em etanol P.A. Após a quarta
extração (28º dias), o material com etanol foi aquecido a 70ºC durante duas
horas para uma melhor eficiência realizando-se a quinta e última extração. As
extrações foram feitas à temperatura ambiente e protegidas da luz, a fim de
evitar a fotooxidação dos compostos. Os extratos obtidos foram reunidos
constituindo os extratos etanólicos brutos, os quais foram concentrados sob
pressão reduzidas em rotaevaporador a 35ºC, a fim de se obter concentrações
a 1%, sendo armazenados em geladeira a temperatura entre 2 e 6ºC.

Amostras Microbianas

Neste trabalho foram utilizadas cepas-padrão de alta concentração de UFC


(Unidades Formadoras de Colônias), originárias de culturas do ATCC
(“American type culture collection”) adquiridas através do Instituto Adolfo Lutz
(IAL), e isolado clínico provenientes do Instituto de Ciências Biomédicas da
Universidade de São Paulo (ICB-USP) e do laboratório de microbiologia da
Universidade de Santo Amaro.
A atividade antibacteriana foi determinada pelo método de macrodiluição,
utilizando-se 8 cepas (Escherichia coli, Pseudomonas auriginosa,
Staphylococcus aureus, Salmonella Typhimurium, Klebsiella pneumoniae,
Bacillus subitilis, Enterococcus faecalis, Proteus mirabilis).
As bactérias foram estocadas em cultura com glicerol e mantidas a -20ºC para a
sua preservação até o momento do seu uso, quando foram ativadas em Caldo
TSB (Caldo de soja triptona) para crescimento e mantidas em estufa por 24
horas à temperatura de 37ºC.

Método de Macrodiluição em Caldo

Os testes de atividade antimicrobiana foram desenvolvidos segundo o método


de macrodiluição em caldo. Foram utilizados tubos de ensaio contendo 5 mL de
meio de cultivo. Os tubos foram autoclavados por 15 minutos a 121 ºC e em
seguida mantidos em estufa a 37 ºC por 24 horas, a fim de assegurar a
esterilidade dos mesmos. Nos tubos, foram depositadas concentrações
exponenciais (8 µg/mL a 2048 µg/mL) dos extratos produzidos a 1% e 100 µL
do inóculo padronizado em 1,5.108 UFC/mL, quantificado segundo 0,5 da
escala de McFarland. Os testes foram realizados em duplicata e mantidos em
estufa a 37 ºC por 24 horas. Quatro tubos foram utilizados como controle, sendo
dois negativos (tubo somente com meio de cultivo e outro tubo com meio de
cultivo e 100 µL de extrato) e dois controles positivos (tubo com meio de cultivo
e 100 µL de inóculo e o outro com meio de cultivo, 100 µL de inóculo e 100 µL

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

60
UNISA - Universidade de Santo Amaro

de solvente). A Concentração Inibitória Mínima (CIM) foi dada pela primeira


concentração onde houve inibição do crescimento microbiano.
As concentrações que inibiram o crescimento dos microrganismos foram
semeadas em ágar Mueller Hinton e incubadas em estufas por 24 horas a 37ºC.
A Concentração Bactericida Mínima (CBM) foi dada pela primeira concentração
de extrato onde não houve crescimento em placa.

Dosagem de Fenóis Totais

A análise dos fenóis totais de Tithonia diversifolia foi feita em duplicata,


utilizando-se balões volumétricos de 50 mL, aos quais foram adicionados 35 mL
de água deionizada, 50 µL de extrato etanólicos, 2,0 mL de Follin Cicauteau,
5,0 mL de solução saturada de carbonato de Sódio (NaCO3), e água
deionizada novamente completando-se o volume de 50 mL.
Os balões foram agitados para homogeneização do conteúdo e após 2 horas,
foram iniciadas as leituras em espectrofotômetro, medindo a absorbância em
760 nm, utilizando-se ácido tânico como padrão (100 mg/mL).

RESUMO:
O maior valor percentual de massa seca foi observado no extrato de folhas
(73,3%) e o menor valor no extrato de caules (23,3%). Quanto ao rendimento
dos extratos os maiores valores percentuais obtidos foram de inflorescências
(11%) e caules (10,8%) enquanto o menor rendimento foi obtido com o extrato
de folhas (5,5%).
Os valores de Concentração Inibitória Mínima (CIM) e de Concentração
Bactericida Mínima (CBM) utilizando extratos etanólicos de Tithonia diversifolia
produzidos a partir de inflorescências, folhas e caules, sobre cepas de
bactérias. Os extratos mostraram atividade contra todos os microrganismos
testados. O extrato de inflorescências apresentou os menores valores de CIM
sobre E. coli, P. mirabilis e S. Typhimurium (256 µg/mL) e menores valores de
CBM sobre E. coli, P. mirabilis e S. Typhimurium (512 µg/mL). O extrato de
folhas apresentou os menores valores de CIM sobre B. subtilis, E. coli, P.
mirabilis, S. aureus e S. Typhimurium (256 µg/mL) e os menores valores de
CBM sobre B. subtilis, E. coli, P. mirabilis, S. aureus, S. Typhimurium (512
µg/mL). O extrato caule apresentou valores de CIM (512 µg/mL) e CBM (1024
µg/mL) sobre todas as cepas testadas.
Os maiores teores de fenóis foram observados nos extratos de inflorescências
(1,55 mg/mL) e folhas (2,1mg/mL), enquanto o extrato de caules apresentou
baixo teor de fenóis (0,45 mg/mL).

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

61
UNISA - Universidade de Santo Amaro

CONCLUSÃO:
O extrato de folhas apresentou melhor atividade antibacteriana e maior
conteúdo fenólico.
A atividade antibacteriana do extrato caulinar deve estar relacionada com a
presença de outros compostos não mensurados neste trabalho. É possível
também que a presença de outros compostos como carotenóides em maiores
teores no extrato de inflorescências poderia estar atuando em sinergia, gerando
o efeito antibacteriano observado.

REFERÊNCIA BIBLIOGRÁFICA:
CASTRO, H.G. & FERREIRA, F.A. 2000. Contribuição ao estudo das plantas
medicinais: carqueja (Baccharis genistelloides). Viçosa, MG: UFV,
Departamento de Fitotecnia: 10p.

CECHINEL FILHO, V. & YUNES, R.A. 1998. Estratégias para Obtenção de


Compostos Farmacologicamente Ativos a partir de Plantas Medicinais.
Conceitos sobre Modificação Estrutural Otimização da Atividade. Química Nova
23: 99-105.

FIDALGO, O. & BONONI, Z.L.R. 1989. Técnica de coleta, preservação e


herborização de material botânica. Instituto de Botânica de São Paulo.
________________________________________________________________
Apoio financeiro: UNISA

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

62
UNISA - Universidade de Santo Amaro

Análise da expressão de GALECTINA-3 no tumor primário e sua


metástase linfonodal do carcinoma papilífero da tiróide
associada à mutação BRAF TI799A
NATÁLIA MARQUES BORGES(1)

MARCO AURELIO VAMONDES KULCSAR(2)(Orientadores)


Ciências Biológicas
INTRODUÇÃO:
O câncer no ser humano origina-se por alterações em genes responsáveis
pelo controle da proliferação celular, chamados genes supressores tumorais e
proto-oncogenes, mutações nestes últimos levam ao crescimento fora de
controle de células dando início a um tumor, passando a denominar-se
oncogenes.
No sistema endócrino o câncer ocorre principalmente na glândula tireóide. A
tireóide está localizada apoiando-se frouxamente sobre a traquéia anterior, na
altura da cartilagem cricóide, sendo formada por dois lobos laterais direito e
esquerdo, que em conjunto apresentam formato morfológico em forma de
borboleta. O principal papel da glândula tireoidiana é sintetizar hormônios para
o desenvolvimento e crescimento metabólico sendo que a função da glândula
está sob o controle do eixo hipotalâmico/ hipofisário. Os tumores malignos da
glândula tireóide originados das células foliculares podem ser classificados em
carcinomas foliculares, carcinoma papilífero e anaplásico, dentre os quais 90%
dos casos são de carcinoma papilífero. Já as células parafoliculares podem
originar os carcinomas medular. Diversos fatores ambientais contribuem para o
desenvolvimento do câncer de tireóide como radioatividade e fatores
nutricionais.
Análises em oncogenes vêm sendo utilizadas para identificar possíveis
mutações que levam as células a se proliferar constantemente, como as
mutações em RAS, GSP, TSH-R, rearranjo PAX-8/PPARý, rearranjo RET/PTC,
rearranjo TRK-T e a mutação BRAF, como possíveis marcadores moleculares
dos tumores da tireóide. Os tumores malignos da glândula tiroide se manifestam
como um nódulo do parênquima tiroidiano e podem ser classificados de acordo
com a sua morfologia, os originados das células parafoliculares o carcinoma
medular e, os originados das células foliculares carcinomas foliculares,
carcinoma papilífero e anaplásico ou carcinoma indiferenciado, sendo o
carcinoma papilífero (CPT) é o mais freqüente dos carcinomas da glândula
tiroide (KAWACHI, et al., 2000).
Dentre as alterações moleculares descritas no CPT, as mais prevalentes é a
mutação BRAFT1799A e a expressão aumentada da proteína galectina-3
(KAWACHI, et al., 2000) A mutação BRAFT1799A, observada em 45% e pode

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

63
UNISA - Universidade de Santo Amaro

esta relacionada ao pior prognóstico a mutação é utilizada como um marcador


tumoral. A galectina-3 é uma proteína monomérica de 30 Dka conhecida
também como Mac-2, CBP-35, IgEBP, CBP-30, RL-29, L-29, L-31, L34 e LBL é
uma das isoformas no qual são descrita em mamíferos galectinas 1 a 14
pertencente a família das lectinas que se ligam ao carboidrato ß-galactosídeos
(YOSHII et al., 2001).
A proteína galectina-3 pertence à família das lectinas solúveis que se ligam a
ß-galactosídeos e tem uma importante função na regulação do crescimento
celular, sendo detectada em diversos tecidos humano desempenhando diversas
funções fisiológica. Porém e em tumor primário e na metástase a expressão de
galectina-3 foi encontrada aumentada. Interessantemente, vários autores
mostraram a expressão de galectina-3 é observada em grande variedade de
carcinomas da tiroide, sendo predominantemente expressa em carcinoma
papilífero. A proteína é utilizada como um marcador tumoral na tiroide na
distinção de lesões benigna e maligna da glândula (YOSHII et al., 2001). Apesar
de amplamente estudado, não existe a associação entre galectina 3 e a
mutação BRAFT1799A.
O presente estudo tem como intuito analisar a expressão protéica da
galectina-3 em tumores primário na recidiva linfonodal metástatico de pacientes
operados com diagnóstico de carcinoma papilífero, associando com a presença
da mutação BRAFT1799A, como um potencial marcador de agressividade em
neoplasias de tireóide.

OBJETIVO:
Analisar a expressão de galectina-3 à presença e a ausência da mutação
BRAFT1799A em tumor primário e recidivo linfonodal metástatica de carcinoma
papilífero de tiroide

METODOLOGIA:
Extraímos DNA de blocos histológicos de 10µm de espessura obtidos 8
pacientes com diagnóstico de CPT recidivos e metastáticos os tecidos foram
desparafinizados e o DNA genômico foi extraído utilizando 200µl da solução lise
celular a 98ºC por 15 minutos no banho seco. Para extrair o DNA totalmente
puro foi adicionado 20µl de proteinase K para a degradação das proteínas,
seguido por uma adição de NaCl para precipitar as proteínas da solução. O
sobrenadante foi coletado para um eppendorf novo, em seguida o DNA será
precipitado com isopropanol e glicogênio. O pellet de DNA seguirá para uma
lavagem com etanol 70% e foi hidratado com água deionizada.
Para a detecção da mutação BRAFT1799A utilizamos o método PCR Nested.
O DNA foi amplificado em duas reações de PCR sucessivas na região que
contém o sítio de mutação BRAFT1799A e produto final foi analisado após

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

64
UNISA - Universidade de Santo Amaro

coloração do gel com brometo de etídeo e a presença de uma banda de 170 pb,
adicional a de 199 pb, a qual indicará a presença da mutação em heterozigose .
Como controle positivo da reação, utilizaremos a linhagem NPA de carcinoma
papilífero de tiroide, que é homozigota pra a mutação BRAF, cujo produto de
digestão enzimática gera predominância da banda de 170 pb. A técnica foi
adaptada para se tornar mais adequada. Utilizam-se duas reações de PCR em
seqüência, sendo que a segunda reação utiliza primers que amplificam um
fragmento específico dentro do fragmento já amplificado da primeira PCR, em
uma região que contém o sítio de mutação de BRAF.
O primeiro par de primers (Forward 5’-GACTCTAAGAAGAAAGATGAAGTAC-
3´) e o Reverse: 5´-GATTTTTGTGAATACTGGGAACTATGA- 3´) amplifica um
fragmento de 399 pares de base (pb). Posteriormente, este produto de 399 pb
foi amplificado pelo segundo PCR que gera um produto final de 199pb
(Forward: 5´-TAAAAATAGGTGATTTTGGTC TAGCTAGCTCTAG-3’ e o
Reverse: 5´-ACTATGAAAATACTATAGTTGAGA-3’). As condições da reação de
PCR será 950C x 1 minuto; 940C x 30 segundos, 580C x 30 segundos, 720C x
30 segundos por 40 ciclos e 720C x 10 minutos. O produto do segundo PCR
será digerido com XbaI por 16 horas a 370C.e o produto, aplicado em gel de
poliacrilamida 12%.
Para padronizar e agilizar os resultados obtidos com imunohistoquímica será
utilizada a técnica de Tissue MicroArray (TMA), uma técnica que permite a
realização de centenas ou milhares de análises simultâneas, diminuindo-se as
variáveis obtidas com reações separadas. O TMA será construído a partir de
um bloco de parafina vazio (receptor) para onde centenas ou milhares de
pequenos cilindros teciduais (diâmetro >= 0,6mm e altura de 3-4 mm) serão
transferidos de maneira coordenada, utilizando-se um equipamento específico.
As perfurações são realizadas uniformemente, por meio de coordenadas
cartesianas X,Y definidas, e cada amostra será perfurada em duplicata. Para
construir o TMA, utilizamos tecidos de recidiva de carcinoma papilífero de
tireóide e suas respectivas metástase.
Cortes histológicos do TMA com 3µm de espessura serão incubados com
anticorpo anti-galectina-3 overnight a 4ºC, seguida por incubação com anticorpo
secundário biotinilado. A reação será revelada pelo complexo
biotinaestreptoavidina – peroxidase e DAB, e contracorado com hematoxina de
Gill. A positividade da proteína foi observada na coloração marrom ao
microscópio, sendo intensificada das seguintes formas: (1) fraca (2) regular e
(3) forte. Sendo também analisada referente o seu local de concentração como
focal ou multifocal.

RESUMO:

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

65
UNISA - Universidade de Santo Amaro

Nesta serie de pacientes estudados observamos uma alta prevalência da


mutação BRAFT1799A , cerca de 75% dos pacientes. A expressão de
galectina-3 mostrou-se intens tanto nos tumores primários quanto nos
linfonodos metástaticos a (+++).
Analisamos a expressão de galectina-3 em tumor primário e recidivo linfonodal
metástatico de carcinoma papilífero de tiroide relacionando com a mutação
BRAFT1799A pelo método de imunohistoquímica. As analises de positividade
foram feitas por observadores distintos em microscópio de luz e foram
classificadas em (+) fraca, (++) regular (+++) forte de acordo com a intensidade
da coloração marrom. O valor médio de positividade foi obtido com os valores
de positividade atribuídos por 3 observadores diferentes.
Dentre os 8 casos de CPT analisados, 6 apresentavam-se positivos para a
mutação BRAFT1799A. Sendo que a galectina-3 estava presente em tecidos
positivos e negativos para a mutação BRAFT1799A . Dos 8 casos 7
apresentaram expressão forte e 1 caso negativo para a mutação apresentou a
expressão moderada .
Similarmente, as recidivas linfonodais (n=8) apresentaram um resultado
semelhante para a mutação (n=6). Nestes casos a expressão da galectina-3
apresentou-se forte em 7 casos, sendo em 1 caso negativo para a mutação e
expressão apresentou-se fraca. Os resultados estão demonstrados
graficamente nas figuras 3 e 4.

CONCLUSÃO:
Concluímos que a presença da galectina-3 pode esta associada a negatividade
e a positividade da mutação BRAFT1799A. No entanto o trabalho possa ser
melhor confirmado com trabalho futuros, e que do talvez possa indica que a
galectina-3 possa ser um potencial marcador de malignidade em carcinoma
papilífero quando associada a negatividade e a positividade da mutação
BRAFT1799A

REFERÊNCIA BIBLIOGRÁFICA:
Kimura, E.T; Nikiforova, M.N; Zhu,Z.; Knauf, J.A; Nikiforov, Y.E; Fagin, J.A. High
prevalence of BRAF mutations in thyroid cancer: genetic evidence for
constitutive activation of the RET/PTC-RAS-BRAF signaling pathway in papillary
thyroid carcinoma. Cancer Res, v.63, 2003 n° (7) p.1454-1457.

Yoshii. T, Inohara. H, Takenaka. Y, Honjo. Y, AkahaniI. S, Nomura. T, Raz. A,


Kubo. T, 2001. Galectin-3 maintains the transformed pheno-type of thyroid
papillary carcinoma cells vol. Int J Oncol. 2001 18, no4, p. 787-792 (30 ref.)

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

66
UNISA - Universidade de Santo Amaro

Kawachi, K; Matsushita, Y; Yonezawa S; Nakano, S; Shirao, K, Natsugoe, S; et


al. Galectin-3 expression in various thyroid neoplasms and its possible role in
metastasis formation. Hum Pathol, 2000

________________________________________________________________
Natalia Borges

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

67
UNISA - Universidade de Santo Amaro

ANÁLISE DAS POSTURAS DE TRABALHO DO PERIODONTISTA


COMO UM FATOR DE RISCO NO DESENVOLVIMENTO DE
POSSÍVEIS DISTÚRBIOS OSTEOMUSCULARES
MICHELLE STORCH CARDOSO LIMA(1)

CLAUDIA DIAS OLLAY(2)(Orientadores)


Ciências Biológicas
INTRODUÇÃO:
A literatura aponta inúmeros casos de doenças que alteram a saúde do
trabalhador. Para o desempenho das atividades laborais são adotadas
determinadas posturas, que poderão provocar o desgaste do corpo. A prática
clínica Odontológica pode impor sobrecargas ao organismo do cirurgião-
dentista, predispondo-o a lesões, principalmente as de ordem física.

OBJETIVO:
Analisar as posturas laborais dos Periodontistas como um fator de risco no
desenvolvimento de possíveis lesões osteomusculares que podem ser
ocasionadas em função de seu processo de trabalho.

METODOLOGIA:
Para realização desta pesquisa, foi estabelecido o critério de inclusão: alunos
matriculados no curso de Especialização em Periodontia da Universidade de
Santo Amaro em andamento no ano letivo de 2005 os quais, durante a análise
biomecânica, estavam realizando o procedimento de raspagem.
Foi verificado que o curso de Especialização em Periodontia era composto por
11 indivíduos. Porém, nos dias em que a análise biomecânica foi realizada, um
deles encontrava-se em procedimento de triagem e orientação aos seus
pacientes. Sendo assim, a amostra desta pesquisa foi composta por 10
indivíduos.
Nos meses de maio e junho de 2005, foi realizada a entrega do Termo de
Consentimento Pós-Informação, onde os participantes eram informados sobre o
objetivo geral desta pesquisa e assinavam um termo de ciência e concordância
quanto à sua participação. Desta maneira, logo em seguida, foi realizada a
aplicação do Questionário Geral, nos intervalos de suas atividades práticas e
teóricas, com o objetivo de conhecer a população a ser estudada. Após sua
aplicação, foram realizadas a tabulação e interpretação dos dados colhidos
mediante a construção de gráficos e tabelas no Microsoft Excel.
Posteriormente, foi realizado na Clínica de Especialidade da Universidade de
Santo Amaro, durante o mês de agosto de 2005, a análise biomecânica da

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

68
UNISA - Universidade de Santo Amaro

atividade laboral de cada participante desta pesquisa, através da observação de


sua atividade prática durante um atendimento de duração aproximadamente de
30 minutos.
Durante a análise biomecânica, foi utilizada a Ficha de Avaliação da Atividade
Laboral, baseada no questionário usado por CALDEVILLA (2002), como
protocolo para o registro de parâmetros biomecânicos. Além disso, foi realizado
o registro fotográfico das atividades com auxílio da câmera Sony Cyber Shot,
modelo digital P73, 4.1 mega pixels, apenas para fins ilustrativos.
Com os dados registrados na Ficha de Avaliação da Atividade Laboral, foram
realizadas a tabulação e interpretação dos mesmos mediante a construção de
tabelas no Microsoft Excel.

RESUMO:
Como pôde ser observado, a população estudada foi composta por 10
indivíduos. Deste total, 70,0% eram mulheres, e 30,0% homens.
Através da realização deste estudo, foi possível identificar o grande número de
participantes portadores de algum tipo de desconforto osteomuscular, que foi de
8 indivíduos, 80% do total.
Em estudo realizado por GASPAR e REGES (1999), os desconfortos
osteomusculares na coluna, ombros e pescoço são cada vez mais observados
no cotidiano do profissional em Odontologia.
De acordo com os resultados obtidos através do levantamento das localizações
de desconforto osteomuscular dos periodontistas analisados neste estudo,
pôde-se perceber que a informação da bibliografia acima repete-se.
Além disso, dos participantes que apresentavam desconforto osteomuscular, foi
identificado que todos eles (100,0%) apresentavam desconforto na coluna
cervical, 6 (75,0%) na coluna lombar, 2 (25,0%) na coluna torácica, 5 (62,5%)
nos ombros; 3 (37,5%) nos punhos; e 1 (12,5%) na escápula.
Conforme descrito nos resultados, todos os periodontistas analisados
realizavam a flexão do pescoço, com predomínio estático. De acordo com
CHAFFIN (1973) apud BARBOSA et al (2000), a flexão do pescoço até um
ângulo de 15º seria aceitável para a prevenção de fadiga muscular desta região
e do aparecimento de lesões osteomusculares. Além disso, a manutenção de
posturas estáticas na região cervical, configura-se como um problema para os
músculos desta região. Segundo um estudo realizado por LAWRENCE (1972)
apud NOGUEIRA (1983) afirmou que a degeneração dos discos intervertebrais
da região cervical é bastante comum entre cirurgiões-dentistas. Desta forma,
esses fatores podem explicar os resultados obtidos de que 100,0% dos
indivíduos analisados apresentavam desconforto osteomuscular na região do
pescoço.
Conforme observado nos resultados desta pesquisa, 75,0% dos indivíduos

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

69
UNISA - Universidade de Santo Amaro

analisados relataram possuir algum desconforto osteomuscular na região de


coluna lombar. Isto pode estar relacionado à postura adotada de flexão anterior
de tronco que estes periodontistas adotam durante a execução de suas
atividades práticas, no procedimento de raspagem. De acordo com COUTO
(1995) a flexão anterior de tronco, na posição sentada, acarreta uma tendência
de queda anterior do tronco devido a ação da gravidade. Portanto, para manter
o tronco na posição ereta, os músculos paravertebrais desenvolverão uma
contração estática para não permitir este deslocamento. Como estes músculos
estão firmemente fixados nos corpos vertebrais esta contração resultará em um
aumento da pressão intradiscal lombar, e, conforme descrito anteriormente,
pode provocar a degeneração discal desta região.
Durante o movimento de flexão do tronco e também do pescoço, ocorre uma
compressão assimétrica do disco intervertebral. A porção anterior do disco
apresenta-se sob pressão fazendo com que o núcleo pulposo desloque-se
posteriormente, já as fibras posteriores, alongam-se e entram em tensão. A
compressão do núcleo sobre as fibras posteriores, pode levar a degeneração
do disco, e posteriormente, a uma discopatia (COUTO, 1995; OLIVER, 1999).
Conforme demonstrados nos resultados, 62,5% dos periodontistas analisados
relataram possuir algum desconforto osteomuscular em ombros. Este índice
pode estar relacionado com a postura de abdução do ombro de predomínio
estático realizado por eles, durante a execução de suas atividades práticas.
Os tendões de certos músculos como o supra-espinhoso, o principal músculo
abdutor do ombro nos primeiros 60º deste movimento, possuem a parte
vascularizada e a não-vascularizada. Com o déficit de nutrição, os tendões
sofrem modificações histológicas com sinais de degeneração como células
mortas, depósitos de cálcio e microrrupturas das fibras de colágeno. Estes
sinais de degeneração são localizados principalmente nas partes não-
vascularizadas dos tendões (MENDES, 2003).
Segundo MENDES (2003), a abdução de ombro ao atingir um ângulo de 30°
provoca uma isquemia parcial nos vasos, que quando mantida por períodos
prolongados hipertrofiam as arteríolas e vênulas levando a um aumento de
pressão no músculo supra-espinhoso que ultrapassa o limiar de distúrbio da
circulação.
Portanto, como demostrado nos resultados desta pesquisa, a população
estudada encontra-se exposta aos riscos para o desenvolvimento de
tendinopatia, fadiga muscular e síndrome do impacto na região de ombro.

CONCLUSÃO:
Constatou-se que os desconfortos osteomusculares estão mais presentes na
região do pescoço, devido a flexão e a manutenção de posturas estáticas dos
músculos desta região e da abdução continuada dos ombros, fatores estes que
podem levar ao desenvolvimento de tendinopatias, fadiga muscular e síndrome

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

70
UNISA - Universidade de Santo Amaro

do impacto; a postura sentada por longa permanência é outro fator de risco que
pode levar a discopatias na região do tronco. Mediante o relatado, concluí-se
que através da análise biomecânica de 10 periodontistas em seus postos de
trabalho, durante a realização do procedimento de raspagem e dos resultados
obtidos, podemos afirmar que as posturas laborais adotadas são um fator de
risco e, portanto, possuem influência direta no desenvolvimento de possíveis
lesões osteomusculares. É importante salientar que a origem das lesões
osteomusculares relacionadas ao trabalho é multifatorial, ou seja, envolve
fatores psicossociais como o estresse, tensão, insatisfação profissional por
baixa remuneração; fatores individuais como sexo e idade; fatores ocupacionais
como os aspectos organizacionais, por exemplo, número de horas trabalhadas,
a não-realização de pausas, o número de atendimentos por dia, os
equipamentos de trabalho, tais como os que fornecem vibração e ruídos; o
próprio risco de acidentes, a contaminação e infecção oferecidos pela atividade
ocupacional, e ainda, a atitude postural adotada por cada profissional durante a
atividade laboral.
A Fisioterapia do Trabalho vem contribuindo para a proteção, promoção e
prevenção da saúde dos trabalhadores. Desta forma, pode também auxiliar os
periodontistas quanto a melhor forma de trabalho para a prevenção de doenças
ocupacionais, no sentido de orientar quanto a adoção da melhor postura de
trabalho, ou seja, postura que ofereça um menor gasto energético e menor risco
de lesão ocupacional; além de orientar quanto ao ajuste do mobiliário,
equipamento e instrumentos de trabalho no dia-a-dia laboral, e reforçar a
importância da organização do trabalho, no que se refere a importância das
pausas durante o trabalho e do número adequado de atendimentos por dia.

REFERÊNCIA BIBLIOGRÁFICA:
ANDERSSON, G. B. J.; CHAFFIN, D. B.; MARTIN, B. J. Biomecânica
Ocupacional. 1 ed. Belo Horizonte: Ergo, 2001. 579p.
BARBOSA, L. H.; STURION, H. C.; WALSH, I. A. P.; ALEM, M. E. R; GIL
COURY, H. J. C. Abordagem da Fisioterapia na Avaliação de melhorias
ergonômicas de um setor industrial. Revista Brasileira de Fisioterapia, São
Paulo, v. 4, n. 2, p. 83 – 92, 2000.
BARRETO, S. M.; SANTOS FILHO, S. B. Atividade ocupacional e prevalência
de dor osteomuscular em cirurgiões-dentistas de Belo Horizonte, Minas Gerais,
Brasil: contribuição ao debate sobre os distúrbios osteomusculares relacionados
ao trabalho. Caderno de Saúde Pública, Rio de Janeiro, v.17, n. 1, p.181-193,
jan./fev., 2001.
CALDEVILLA, F. Fatores posturais na ocorrência de lombalgia em operadores
de máquinas de uma montadora. São Paulo. 2002. 75p. Trabalho de Conclusão
de Curso - Faculdade de Fisioterapia, Universidade de Santo Amaro.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

71
UNISA - Universidade de Santo Amaro

CASTRO, S. L.; FIGLIOLI, M. D. Ergonomia aplicada à dentística. Avaliação da


postura e posições do cirurgião-dentista destro e da auxiliar odontológica em
procedimentos restauradores. Jornal Brasileiro de Clínica & Estética em
Odontologia, Curitiba, seção Ergonomia, v. 3, n. 14, p. 56-62, 1999.
COUTO, H. A. Ergonomia aplicada ao trabalho: O manual técnico da máquina
humana. 1 ed. Belo Horizonte: Ergo, 1995. v. I, 353p.
GASPAR, A. M. M.; REGES, R. V. Problemas cervicais do cirurgião-dentista.
ROBRAC, Goiânia, v. 8, n. 26, p. 45-48, 1999.
MENDES, R. Patologias do trabalho. 2 ed. São Paulo: Atheneu, 2003. v. II,
1924p.
PÉCORA, J. D.; SAQUY, P. C. A ergonomia e as doenças ocupacionais do
cirurgião-dentista. 1 ed. Ribeirão Preto: Dabi Atlante, 1994. 31p.
NOGUEIRA, D. P. Riscos Ocupacionais de Denistas e sua Prevenção. Revista
Brasileira de Saúde Ocupacional, São Paulo, v. 11, n. 41, p. 16-24,
jan./fev./mar., 1983.
OLIVER, J. Cuidados com as costas – um guia para terapeutas. 1 ed. São
Paulo: Manole, 1999. 162p.
________________________________________________________________
Palavras-chave: Postura de Trabalho; Distúrbios osteomusculares; Odontologia,
Riscos Ocupacionais

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

72
UNISA - Universidade de Santo Amaro

ANÁLISE DO COMPORTAMENTO AMBIENTAL DOS


COLABORADORES DE UMA EMPRESA QUIMICA COM
RELAÇÃO À COLETA SELETIVA DE LIXO EMPRESARIAL
NÚBIA CRUZ GÊNOVA(1)

SALETE REGINA VICENTINI(2)(Orientadores)


Ciências Biológicas
INTRODUÇÃO:
A partir do desenvolvimento tecnológico e da excessiva exploração dos
recursos naturais, o homem vem causando um grande desequilibrio ambiental
produzindo quantidades crescentes de resíduos originados em indústrias,
comércio, residências e outros, sem se preocupar com a destinação adequada
desses resíduos para conservar o meio ambiente. Para amenizar essa situação
as indústrias adotam as normas técnicas, fazendo com que elas reduzam a
quantidade de resíduos e que os gerados sejam manipulados de maneira
correta, sem que ocorra um grande impacto ao meio ambiente.
Os resíduos são constituídos por vários tipos de compostos no qual cada tipo
precisa de uma destinação diferenciada. Eles podem ser classificados como lixo
“seco” ou “úmido”. O lixo “seco” é composto por materiais recicláveis como
papel, vidro, lata, plástico etc. Entretanto, alguns materiais não são reciclados
por falta de mercado, como é o caso de vidros planos. O lixo “úmido”
corresponde à parte orgânica dos resíduos, como as sobras de alimentos,
cascas de frutas, que pode ser usada para compostagem, que é um método de
degradar a matéria orgânica biologicamente podendo ser realizado dentro de
casa, no qual o produto obtido pode ser utilizado como adubo.
Sendo assim, a reciclagem vem sendo, uma das melhores alternativas para o
tratamento de resíduos, onde é adotada a política dos 3 R`s que significa
reduzir, reutilizar e reciclar, pois desvia os resíduos sólidos que podem ser
reciclados de aterros sanitários ou lixões, reduzindo a criação e a utilização de
aterros e diminuindo os riscos ambientais proporcionados por esses resíduos.
Também pelo fato de diminuir o consumo de matéria prima, e caso o sistema de
coleta seletiva seja bem estruturado, pode se tornar uma atividade econômica
rentável, tanto para os trabalhadores quanto para os colaboradores.
Hoje, um dos grandes responsáveis pela poluição são os rejeitos industriais,
que são originários de resfriamentos, lavagens, descargas, extrações,
impregnações, tratamentos químicos, além de outros.
Para tentar amenizar esta situação, segundo Maroun (2006), as indústrias estão
adotando as normas técnicas (NBRs) tentando fazer com que suas indústrias
produzam menor quantidade de resíduos e os resíduos gerados sejam
manuseados, armazenados e direcionados de maneira correta, sem que haja

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

73
UNISA - Universidade de Santo Amaro

maior impacto ao meio ambiente.


Os métodos de tratamento de resíduos mais utilizados pelas indústrias são:
Incineração, que consiste no processo de combustão ou queima controlada que
transforma sólidos, semi-sólidos, líquidos e gasosos em dióxido de carbono,
outros gases e água, com redução do volume e do peso iniciais.
Co-Processamento, que consiste na destruição térmica dos resíduos nos
processos de fabricação de cimento
Biopilha ou Landfarming, são sistemas de tratamento de resíduos que, através
de propriedades físicas e químicas do solo e de sua intensa atividade
microbiana, promovem a biodegradação, destoxificação, transformação e
imobilização dos constituintes dos resíduos tratados, minimizando o impacto
ambiental.
Reciclagem interna ou externa, podendo ser realizada dentro da própria
indústria ou através de empresas terceirizadas. Este tratamento consiste em
transformar os excedentes sólidos e torná-los insumo destinando-o aos
processos produtivos.
De acordo com Orth (2004), a destinação final dos resíduos é entendida como a
destinação dos resíduos sólidos para locais que possam permanecer por tempo
indeterminado no seu estado natural ou após ser transformado em material
adequado, sem causar dano ao meio ambiente e à saúde pública. O autor ainda
define como as principais formas de destinação a seguintes:
Aterro industrial, que corresponde a um confinamento dos resíduos em grandes
áreas projetadas para receber os tipos de resíduos correspondentes, no qual
tem que haver um sistema de drenagem e remoção de líquidos que percorrem
dos resíduos, sistema de tratamento do líquido percolado, sistema de
tratamento de gases que são liberados pelos resíduos, monitoramento de
águas subterrâneas e a impermeabilização com camadas de argila e material
polimérico de alta densidade.
Aterros sanitários, que corresponde a uma estrutura que possui sistema de
impermeabilização inferior, captação e tratamento de chorume (líquido poluente
gerado pela degradação do lixo). É a única estrutura que atende
completamente a legislação, e a gestão adequada dos resíduos.
Aterro Controlado (nos outros a segunda palavra ta minuscula), são áreas em
que os resíduos são lançados e, em geral, são apenas cobertos com materiais
inertes (terra ou argila). Não existem drenos de chorume ou de gases
combustíveis. Não sendo o correto mais corresponde a uma evolução do lixão.
Lixão, que corresponde a uma área onde os resíduos são lançados sem que
sejam adotadas quaisquer das providências mínimas de proteção do meio
ambiente. Trata-se de terrenos onde não há controle de entrada de resíduos.
Também são descartados resíduos industriais perigosos.
A prática de atividades voltadas à capacitação profissional por intermédio da
Educação Ambiental Não-Formal no espaço empresarial, além de cumprir o

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

74
UNISA - Universidade de Santo Amaro

Art.13 da Lei Federal 9795/99 que incentiva: “a participação de empresas


públicas e privadas no desenvolvimento de programas de educação ambiental
em parceria com a escola, a universidade e as organizações não-
governamentais;” (BRASIL, 1999), abre espaço aos funcionários para que
conheçam a problemática ambiental, incentivando-os a desenvolver um novo
método de pensamento para agir de forma integrada e polivalente frente aos
complexos problemas globais.
A Educação Ambiental na empresa também “conduz os profissionais a uma
mudança de comportamento e atitudes em relação ao meio ambiente interno e
externo das suas organizações”, despertando o interesse em cada funcionário
na “ação e busca de soluções concretas para os problemas ambientais que
ocorrem principalmente no seu dia-a-dia” .
A aplicação de EA em ambientes empresariais, através de metodologias que
envolvem investigação e planejamento participativo, como a produção de
material de comunicação utilizado em dinâmicas de implantação de gestão
ambiental, passa ser considerada como um instrumento indutor para a
preservação da qualidade de vida, pois constroem entre as pessoas valores
sociais, conhecimentos direcionados ao tema, atitudes e competências
“voltadas para a conquista e manutenção do direito ao Meio Ambiente
ecologicamente equilibrado”. Dentro das iniciativas da EA empresarial existem,
segundo (de acordo com) Simons (2006), três formatos diferentes para a
aplicação das metodologias, dentre elas o principal, pelo seu caráter impositivo,
destinado a preparar a organização para cumprir os itens propostos pela Norma
– International Standard Organization (ISO 14001), especificamente o item
4.4.2, que estabelece a prática de ações de caráter informativo sobre os
potenciais ou reais impactos ambientais relativos às atividades da empresa e a
importância dos benefícios da sua prevenção.
Hoje, a coleta seletiva é o principal e mais simples sistema de controle de um
importante aspecto ambiental da sociedade: os resíduos sólidos domésticos. O
lixo gerado pela população nas suas mais complexas áreas de atuação causa
dificuldades na forma de disposição e tratamento final. A coleta seletiva é
considerada com uma forma de preparo dos materiais para uma destinação
diferenciada dos resíduos potencialmente recicláveis, reduzindo, desta forma, o
encaminhamento para locais impróprios e sem a mínima estrutura para a sua
disposição final, como lixões a céu aberto ou terrenos baldios.

OBJETIVO:
Analisar o comportamento ambiental dos colaboradores de uma empresa
química, localizada no Estado de São Paulo, através de questionários
abordando a questão da Coleta Seletiva de Lixo no ambiente de trabalho, nas

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

75
UNISA - Universidade de Santo Amaro

áreas de administração e de produção.

METODOLOGIA:
O presente estudo foi aplicado em uma indústria química, localizada na zona
sul da cidade de São Paulo. Fundada em 1863, oferece ao mercado uma ampla
gama de produtos e serviços que abrange os campos da saúde, agricultura e
polímeros. Possui atividades nos cinco continentes e está no Brasil desde 1896,
possuindo cerca de 3.500 colaboradores.
A pesquisa foi realizada na forma de questionário, distribuído para os
colaboradores das áreas de administração (Marketing, Business Services e
Pesquisa & Desenvolvimento) e de produção (Pesagem, Formulação,
Embalagem Primária e Secundária). Antes de distribuir os questionários, houve
uma avaliação das questões junto aos Setores de Comunicação e Meio
Ambiente da empresa.
Os questionários foram compostos por 13 questões fechadas, que apresentam
um conjunto de alternativas para que apenas uma seja escolhida e uma
questão aberta, que possui um espaço em branco para que o questionado
responda expondo sua opinião sobre o assunto mencionado. Estes
questionários foram distribuídos para 100 colaboradores entre as áreas
apresentadas acima, por um período de um mês.
Os resultados foram analisados estatisticamente através do programa Microsoft
Office Excel 2007 e agrupados por grau de similaridade entre as questões.

RESUMO:
Foram obtidos oitenta questionários respondidos, sendo quarenta de cada área,
o que possibilitou entender os conhecimentos gerais e específicos a respeito da
coleta seletiva entre os setores, e ainda, o comportamento dos colaboradores, a
respeito da realização das práticas de separação de lixo adotadas na empresa,
em suas residências.
Quando perguntado se sabiam o que é coleta seletiva de lixo, 100% dos
colaboradores das áreas de administração e produção responderam que sim. A
partir disso, podemos verificar (questão 6) que em ambos os setores, 70% dos
colaboradores de administração e de produção conhecem a política dos 5 R´s.
Segundo Figueiredo (1995), além da coleta seletiva, é necessário que a
sociedade reconheça que somente a reciclagem não será a única medida para
resolver os problemas relacionados à destinação do lixo. Então seria necessário
aumentar programas que realcem as problemáticas causadas pela geração de
lixo, trabalhando a importância da sua separação na fonte para posterior
reciclagem e reutilização dos mesmos e o mais importante, apresentar medidas

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

76
UNISA - Universidade de Santo Amaro

para a redução de geração de lixo.


De acordo com Layrargues (2002), a reciclagem tem sido uma das melhores
alternativas para o tratamento dos resíduos, onde adota- se a política dos 3R´s
(reduzir, reutilizar e reciclar), diminuindo o consumo de matéria prima, e caso o
sistema de coleta seletiva seja bem estruturado, pode se tornar uma atividade
econômica rentável, tanto para os colaboradores quanto para a empresa.
Nesse caso, pode-se considerar que o programa adotado pela empresa, está
sendo divulgado e de acordo com as leis e normas vigentes à coleta seletiva de
lixo.
Na questão 7, 57,5% dos colaboradores da administração e 50% dos
colaboradores da produção responderam que fazem separação de lixo em suas
casas. Já na questão 8, 90% dos colaboradores da administração e 97,5% dos
colaboradores da produção, responderam que contribuem para a coleta seletiva
no ambiente de trabalho.
Pode-se observar que apenas alguns colaboradores adotam o hábito de
separação de lixo em suas casas. Segundo Piva & Filho (2003), as empresas
geralmente adotam o programa de Coleta Seletiva para controle de um dos
seus aspectos ambientais, que é a geração do lixo doméstico pelos seus
funcionários ou por algum tipo de processo produtivo. O Programa torna-se
necessário pelo fato de órgãos fiscalizadores como a CETESB, no caso do
Estado de São Paulo, Polícia Ambiental, Secretaria de Meio Ambiente,
Vigilância Sanitária, entre outros, que cobram ações de melhoria contínua para
a conservação ambiental, amparados pela lei federal 9.605/98 de crimes
ambientais. Esta lei, que obriga os fiscais envolvidos a promover medidas
necessárias à preservação, interrupção ou minoração do agravamento do dano
ambiental, que neste caso seria a disposição incorreta do lixo gerado pelos
funcionários.
No caso do lixo residencial, não há uma fiscalização tão presente quanto as que
ocorrem nas empresas, o que facilita o não comprometimento das pessoas com
relação à coleta seletiva de lixo.
Para Vieira (2003) a Educação Ambiental na empresa conduz os colaboradores
a uma mudança de comportamento e atitudes em relação ao meio ambiente
interno e externo das suas organizações, o que desperta o interesse em cada
colaborador na “ação e busca de soluções concretas para os problemas
ambientais que ocorrem principalmente no seu dia-a-dia”.
Pouco mais de 70% dos colaboradores da adminitração e 85% dos
colaboradores da produção, afirmam que há um programa que incentive a
diminuição dos resíduos gerados no ambiente de trabalho (questão 9). Quando
perguntado se a distribuição das lixeiras era ideal, 20% dos colaboradores da
administração e apenas 7,5% dos colaboradores da produção, não consideram
adequada a distribuição das lixeiras no ambiente de trabalho (questão 10).
De acordo com Maroun (2006), as empresas têm adotado as NBR´s, tentando

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

77
UNISA - Universidade de Santo Amaro

fazer com que sua empresa produza menor quantidade de resíduo e que eles
sejam manuseados, armazenados e por fim, direcionados de maneira correta,
sem que ocorra maior impacto ao meio ambiente. Garcia (2003) diz que as
empresas têm adotado a prática de coleta seletiva, recolhendo os resíduos
sólidos diferenciados em recipientes indicativos, encaminhando-os para
tratamentos, como a reciclagem, compostagem, reuso e/ou outras destinações.
O fato de não haver lixeiras no espaço de produção, para que não ocorra
contaminação dos produtos, não interfere na opinião dos colaboradores com
relação à distribuição das lixeiras.
Perante as respostas anteriores, verificou-se que os colaboradores estão bem
informados com relação à coleta seletiva de lixo, mesmo assim, em ambos os
setores, 97,5% dos colaboradores responderam, que seria eficaz aumentar a
divulgação sobre a importância da coleta seletiva (questão 12). Já na questão
13, quando perguntado se tinham conhecimento sobre um serviço terceirizado,
55% dos colaboradores da administração, responderam que não, contra 85%
dos colaboradores da produção que responderam que sim.

Sendo assim, a divulgação interna tem sido eficiente.

CONCLUSÃO:
Através dos resultados obtidos foi possível concluir que os colaboradores
questionados sabem o que é coleta seletiva e que em ambos os setores, têm
conhecimento sobre a política dos 5Rs. Mais de 50% realizam a coleta seletiva
em suas residências, e contribuem para a coleta seletiva no ambiente de
trabalho. Grande parte dos colaboradores afirma que há um programa que
incentive a diminuição dos resíduos gerados no ambiente de trabalho. Grande
parte dos colaboradores afirma que há um programa que incentive a diminuição
dos resíduos gerados no ambiente de trabalho. Na área administrativa, 20%
não consideram adequanda a distribuição dos coletores de lixo.
Grande parte dos colaboradores tem conheciemnto sobre as cores destinadas a
cada tipo de lixo. Na produção, 85% possuem conhecimento de como é
realizada a coleta seletiva dos resíduos gerados na empresa e do seviço
terceirizado que a empresa possui para esse tipo de coleta.
Colaboradores de ambas as áreas sentem falta da divulgação sobre a coleta
seletiva, assim como de ações para motivar essa prática no ambiente de
trabalho juntamente com a educação ambiental. Diante disso suger-se a
utilização empresarial, envolvendo os colaboradores em uma ação de
conhecimento pessoal e melhoria profissional.

REFERÊNCIA BIBLIOGRÁFICA:

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

78
UNISA - Universidade de Santo Amaro

ABNT, Associação Brasileira de normas e técnicas - NBR ISO 14001:2004


Sistemas da gestão ambiental Requisitos com orientações para uso
Environmental management systems - Requirements with guidance for use
Segunda edição. ABNT, 31.12.2004, 27 páginas
DAGNINO, R. S.. 2007. Resíduos Sólidos: Lixo ou Matéria - prima?.
Dissertação: Universidade Estadual de Campinas (UNICAMP). Campinas.
LAYRARGUES PP. 2000. Ideology and the environment: Business leaders
adopt a strategy of environmental.

________________________________________________________________
não há.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

79
UNISA - Universidade de Santo Amaro

Análise do perfil dos servidores públicos da Secretaria Municipal


do Verde e do meio Ambiente de São Paulo em relação aos
resíduos gerados no ambiente de trabalho com base na
Educação Ambiental
FABIANA ANGELIM CAMÕES(1)

SALETE REGINA VICENTINI(2)(Orientadores)


Ciências Biológicas
INTRODUÇÃO:
Dentre os diversos problemas ambientais mundiais, a questão do lixo é das
mais preocupantes e diz respeito a cada um de nós. Abordar a problemática da
produção e destinação do lixo no processo de educação é um desafio, cuja
solução passa pela compreensão do indivíduo como parte atuante no meio em
que vive, (Felix, 2007). Ainda segundo o autor a coleta seletiva é uma
metodologia que objetiva minimizar o desperdício de matéria prima e a
reciclagem de forma mais racional de gerir os resíduos sólidos urbanos. A
reciclagem, na sua essência, é uma maneira de educar e fortalecer nas
pessoas o vínculo afetivo com o meio ambiente, despertando o sentimento do
poder de cada um para modificar o meio em que vivem.
Segundo Quintas (2004) a questão do lixo pode ser trabalhada em programas
de educação ambiental desde a perspectiva do “lixo que não é lixo”, por meio
dos três R’s, até aquela que toma esta problemática como conseqüência de um
determinado tipo de relação sociedade - natureza, histórica e socialmente
construída, analisando desde as causas da sua existência até a destinação final
do resíduo e, ainda, buscando a construção coletiva de modos de compreendê-
la.
A separação dos materiais recicláveis cumpre um papel estratégico na gestão
integrada de resíduos sólidos sob vários aspectos: estimula o hábito da
separação do lixo na fonte geradora para o seu aproveitamento, promove a
educação ambiental voltada para a redução do consumo e do desperdício, gera
trabalho e renda e melhora a qualidade da matéria orgânica para a
compostagem. Entre as vantagens ambientais da coleta seletiva destacam-se: a
redução do uso de matéria-prima virgem e a economia dos recursos naturais
renováveis e não renováveis; a economia de energia no reprocessamento de
materiais se comparada com a extração e produção a partir de matérias-primas
virgens e da valorização das matérias-primas secundárias, e a redução da
disposição de lixo nos aterros sanitários e dos impactos ambientais
decorrentes. Os materiais recicláveis tornaram-se um bem disponível e o
recurso não natural em mais rápido crescimento. (Waite, 1995).
As empresas e pessoas preocupadas com a questão ambiental ou com vistas à

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

80
UNISA - Universidade de Santo Amaro

sustentabilidade, sabem plenamente que é por meio da educação e da


formação permanente que se estabelecem as grandes e efetivas mudanças,
pois levam a solução de problemas ambientais que afetam o futuro de todos,
não excluindo pobres ou ricos, países de primeiro mundo ou em
desenvolvimento.
Os procedimentos técnicos desenvolvidos e aplicados no campo ambiental
devem considerar de forma primaz as representações, valores e ações sociais
dos seres humanos. O posicionamento frente a questões de valores ou
participação coletiva, direcionado para a solução de problemas da comunidade,
deve ser o ponto de partida da EA, a qual deve ser contextualizada no tempo e
no espaço, valorizando o coletivo, a diversidade e o confronto das diferenças.

OBJETIVO:
Levantar o perfil dos servidores públicos da Secretaria Municipal do Verde e do
Meio Ambiente em São Paulo em relação aos hábitos a respeito dos resíduos
gerados no ambiente de trabalho com base na educação ambiental através da
aplicação de um questionário.

METODOLOGIA:
Para cumprir os objetivos propostos por este trabalho, foi realizada uma
pesquisa, através de um questionário aplicado aos servidores públicos da
Secretaria Municipal do Verde e do Meio Ambiente localizada em São Paulo,
com perguntas em relação a coleta seletiva de lixo, reciclagem, destinação final
dos resíduos entre outras questões pertinentes ao assunto a uma amostragem
de 150 pessoas, no qual 92 foram respondidos em anonimato.
As perguntas foram formuladas, basicamente, com o objetivo de conhecer os
hábitos dos funcionários públicos em relação à questão dos resíduos gerados
no ambiente de trabalho.
Pode-se definir o questionário como a técnica de investigação composta por um
número mais ou menos elevado de questões, apresentadas por escrito às
pessoas, tendo como objetivo o conhecimento de opiniões, crenças,
sentimentos, interesses, expectativas, situações vivenciadas, entre outros (Gil,
1999).

RESUMO:
Em geral observou-se que os resultados obtidos através da aplicação do
questionário foram bastante satisfatórios.
Verficou-se na primeira questão que 100% dos servidores públicos
questionados sabem o que é a coleta seletiva de lixo e 85% sabem que existem
os recipientes para a coleta seletiva no ambiente de trabalho e 43% considera

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

81
UNISA - Universidade de Santo Amaro

inadequada a distribuição das lixeiras.


Constata-se que 95% dos servidores públicos questionados já ouviram falar
sobre a recomendação para usar o princípio dos 3 R's na hora de consumir e
dar um destino ao resíduo que produz, e 86% deles fazem a separação dos
materiais recicláveis antes de jogá-los na lixeira sendo que 90% separam as
pilhas e baterias dos outros materiais, observa-se também que 98% dos
servidores públicos utilizam o papel reciclável no ambiente de trabalho.
Observou-se que 96% dos servidores questionados acreditam que seria eficaz
uma maior divulgação sobre a importância da coleta seletiva no ambiente de
trabalho e que apenas 10% deles não tem a preocupação e o hábito diário de
diminuir a quantidade de resíduos gerados. Verificou-se apenas uma questão
onde o resultado foi considerado insatisfatório, pois 72% dos servidores
públicos questionados não sabem para onde os resíduos gerados são
encaminhados após serem recolhidos, fazendo-se portanto trabalhar essa
questão através de informativos e palestras, tendo a Educação Ambiental como
um papel fundamental na conscientização e sensibilização das pessoas
envolvidas.
Constatou-se nos resultados que aproximadamente metade dos servidores
públicos, 57 % dos questionados acreditam que exista uma preocupação com a
melhoria constante das boas práticas relacionadas com o lixo, e que a rotina é o
principal obstáculo para isso. Na concepção geral dos servidores públicos da
Secretaria Municipal do Verde e do Meio Ambiente, a SVMA encontra-se no
estágio regular em termos de conscientização de seus funcionários voltada aos
bons hábitos em relação ao lixo.

CONCLUSÃO:
Podemos constatar nos resultados, que os servidores públicos em geral, têm
bons hábitos em relação aos resíduos gerados no ambiente de trabalho, mas
baseando-se na informação de que a maioria não sabe o destino final dado aos
resíduos produz, faz-se necessário um trabalho de conscientização,
esclarecendo a questão de destinação de resíduos como também o que devem
fazer com o mesmo, objetivando assim, evitar impactos negativos ao meio
ambiente e à saúde pública. Os resultados apresentados corroboram com Felix
(2007), onde ele afirma que para formar sujeitos ecológicos, o trabalho
educacional é, sem dúvida, um dos mais urgentes e necessários meios para
reverter essa situação, pois atualmente, grande parte dos desequilíbrios está
relacionada às condutas humanas geradas pelos apelos consumistas que
geram desperdícios, e pelo uso inadequado dos bens da natureza.
De acordo com Tavares (2002), se todos contribuem com a degradação
ambiental compartilham responsabilidades nesse sentido. Assim, dentro desses
processos participativos, deveriam ser realizados trabalhos de sensibilização
para as questões ambientais. Para Tavares (2002), vive-se hoje na era do

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

82
UNISA - Universidade de Santo Amaro

descartável, em uma sociedade consumista em que a maioria da população


considera inesgotáveis os recursos naturais e não considera o espaço público
como parte de seu meio ambiente, tornando grave a questão do descarte de
resíduos sólidos, “o lugar do lixo é no lixo”. Como o lixo é um problema cultural,
a mudança de atitude da população em geral, pode ser associada a uma
revolução cultural lenta, gradual e silenciosa. E talvez tenha que ser construída
nos pequenos espaços, nas ações miúdas e rotineiras da vida organizada
socialmente. Quando a informação se dispersa, faz e desfaz verdades
estabelecidas e é reconstruída.

REFERÊNCIA BIBLIOGRÁFICA:
FELIX, R.A.Z. Coleta seletiva em ambiente escolar. In: Revista eletrônica
Mestrado em Educação Ambiental. Fundação Universidade federal do Rio
Grande. ISSN 1517-1256, v.18, 2007.

GIL, Antonio Carlos. Métodos e técnicas de pesquisa social. São Paulo:


Atlas, 1999.

QUINTAS, J. S. Educação no processo de gestão ambiental: uma proposta de


educação ambiental transformadora e emancipatória. In: LAYRARGUES, P.
(Coord.). Identidades da educação ambiental brasileira. Brasília, DF, MMA,
Diretoria de Educação Ambiental, 2004.

TAVARES, M. G. O.; MARTINS, E. F.; GUIMARÃES, G. M. A. Educação


ambiental, estudo e intervenção do meio, 2005. Disponível em: www.campus-
pie.org/. Acesso em 29 de Setembro de 2009.

________________________________________________________________
Não há.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

83
UNISA - Universidade de Santo Amaro

Análise do Perfil sociambiental dos usuários do Parque


Ecológico Guarapiranga, São Paulo
MARIA CLEONICE GALDINO PEREIRA(1)

MARIA DO SOCORRO S PEREIRA LIPPI(2)(Orientadores)


Ciências Biológicas
INTRODUÇÃO:
1.Introdução

A Bacia Hidrográfica do Guarapiranga teve sua concessão para o represamento


em 1906 sob a supervisão do engenheiro americano M. M. Murtaugh, quando
foi iniciada a construção da Represa Guarapiranga, tendo seu término em 1909,
sob o comando do engenheiro Thomas Berry, ambos a serviço da “The São
Paulo Tramway, Light & Power Co”. conhecida como “Light”, uma empresa de
origem canadense que atuava na produção e distribuição de energia elétrica e
transporte coletivo (Mendes & Carvalho, 2000).
A Bacia Guarapiranga é o um dos principais Mananciais da Região
Metropolitana de São Paulo (RMSP), com uma área de drenagem de 636Km²,
abastecendo cerca de quatro milhões de pessoas localizadas na zona sudoeste
da capital paulista, abrangendo parcialmente os municípios de Cotia, Embu,
Juquitiba, São Lourenço da Serra e São Paulo (ISA, 2006).
O Parque Ecológico Guarapiranga (PEG) foi criado em 1989 (Decreto Estadual
nº 30.442) e inaugurado em 3 abril de 1999, pela Secretaria do Meio Ambiente
do Estado, ocupando 7% dos 28 km no entorno da Bacia Guarapiranga,
constitui uma área de preservação ambiental e de proteção contra ocupações
ilegais. Localizado no número 3.286 da Estrada da Riviera, no Bairro da Riviera
Paulista, na zona sul da capital Paulista, com 250,30 hectares. Uma das
maiores preocupações para criação do Parque foi a contenção das ocupações
irregulares, objetivando a proteção dos mananciais; preservação da fauna e
flora existentes; realizar atividades de Educação Ambiental e oferecer
alternativas de lazer à população (França, 2000; SMA, 2000; Campos Filho,
2003).

OBJETIVO:
2. Objetivos

O presente trabalho tem por objetivo analisar e estabelecer um perfil


socioambiental dos visitantes e usuários do Parque Ecológico Guarapiranga
(PEG), objetivos específicos:
Caracterizar os visitantes e usuários do PEG;

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

84
UNISA - Universidade de Santo Amaro

Realizar um estudo da percepção ambiental dos visitantes e usuários do PEG


Diagnosticar o objetivo da visita e do uso;
Contribuir para a elaboração do Plano de Manejo do Parque Ecológico
Guarapiranga.

METODOLOGIA:
3. Material e Métodos
3.1 Área de Estudo
O estudo será realizado no Parque Ecológico Guarapiranga, localizando na
Estrada do Riviera, 3286, bairro Riviera Paulista, zona sul da cidade de São
Paulo. O Parque possui uma área de uso intensivo com alguns equipamentos
de lazer, como pista de Cooper, e equipamentos de ginástica; espaços
destinados a atividades de Educação Ambiental; área verde extensa. Está
localizado às margens da represa Guarapiranga.
3.2 Público Alvo
O público alvo da pesquisa são adultos de ambos os sexos, visitantes e
usuários do Parque Ecológico Guarapiranga.

3.3 Coleta de Dados


A coleta de dados em campo foi realizada através de entrevistas, precedidas
de pré-teste.

3.3.1. Pré-Teste
O pré-teste tem por finalidade evidenciar possíveis falhas na redação do
questionário, tais como: complexidade das questões, imprecisão na redação,
desnecessidade nas questões e constrangimentos ao informante. O pré-texte
deve assegurar que o questionário esteja bem elaborado expressando clareza e
precisão dos termos (Gil, 1999).
Ainda, segundo o mesmo autor depois de redigido o instrumento de pesquisa,
mas antes de aplicado definitivamente, poderá passar por uma prova preliminar,
que poderá evidenciar possíveis falhas na redação do instrumento de pesquisa
tais como: complexidade das questões, imprecisão na redação,
desnecessidade das questões, constrangimentos ao informante, exaustão.
3.3.2 Entrevista
A entrevista é uma das técnicas de coleta de dados mais utilizada no âmbito
das Ciências Sociais, possibilitando analisar os mais diversos aspectos da vida
social, sendo eficiente para obtenção de dados em profundidade acerca do
comportamento humano, podendo os dados obtidos serem suscetíveis de
classificação e de quantificação. A pesquisa pode apresentar uma relação fixa
de perguntas, questões de âmbito fechada, aberta e dupla (Gil, 1999), utilizadas
neste trabalho.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

85
UNISA - Universidade de Santo Amaro

3.4 Análise dos dados


Após de interpretadas, as respostas foram agrupadas em categorias,
recebendo um tratamento quali-quantitativo, a fim de evidenciar os resultados
relativos aos objetivos específicos da pesquisa. Após a finalização do
tratamento dos dados, efetuaram-se as análises e a discussão dos resultados,
seguido das considerações finais (Gil, 1999).

RESUMO:
4.Resultados e Discussão

A pesquisa foi realizada nos finais de semana, no horário de funcionamento do


Parque, das 8h às 17h, em dias ensolarados e chuvosos, totalizando 100
entrevistas, com usuários e visitantes (frequentadores) do Parque Ecológico
Guarapiranga (PEG).
As questões iniciais que abordam idade, sexo e grau de escolaridade, indicam
um perfil dos freqüentadores do Parque Ecológico Guarapiranga, com faixa
etária entre 28 e 37 anos (40%), de sexo predominante feminino (70%),
masculino (30%), e com escolaridade, na sua maioria, nível médio (47%).
Dados de perfil observados em frequentadores de parques públicos do estado
de São Paulo apresentaram resultados iguais referentes ao grau de
escolaridade, com ensino médio 69%, no entanto apresentaram um perfil
masculino predominante com 59% (Whately, et al. 2008).
Analisando a figura 5 temos um número de indivíduos por residência de 5 ou
mais pessoas (32%), 3 pessoas (25%) e os que moram sozinhos com (3%).
Quanto a condição de emprego, a maioria dos entrevistados (62%) declararam
que estavam trabalhando no momento da pesquisa . A renda mensal familiar
dos entrevistados ficou em torno de 2 a 5 salários mínimos (42%) e de 1 a 2
salários mínimos, um percentual menor de 32%.
Em 2000 o Plano Municipal de Habitação identificou 1.241 loteamentos
irregulares dos quais 254 estão localizados em áreas de mananciais e que
abrigam 56.862 domicílios onde residem 216.588 pessoas, com renda média do
chefe familiar inferior a 5 salários mínimos (Santoro, Ferraro & Whately, 2009).
A relação de bairros obtida com as respostas, mostra uma grande variedade de
bairros cujos moradores frequentam o Parque Ecológico Guarapiranga, e com
maior incidência de usuários provenientes dos bairros, Jd. Rivieira (14%), Alto
do Rivieira (9%), Jd. Herculano (8%), Pq. Figueira Grande (7%), Jd. Nakamura
e Vila Bom Jardim (6%), Jd. Kagohara (5%), Guarapiranga, Jd. Ângela e Jd.
Vera Cruz (3%), Jd. Boa Esperança, Jd. Horizonte Azul, Jd. Novo Santo Amaro,
Jd. Santa Margarida, Parque Santo Antonio, e Vila Nagibe apresentaram (2%),
as demais localidades citadas 1%.
Esta grande disparidade de bairros no entorno da represa Guarapiranga é
resultado do uso e ocupação do solo, onde em 2003 cerca de 59% da Bacia

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

86
UNISA - Universidade de Santo Amaro

Hidrográfica da Guarapiranga teve seu território alterado por atividades


humanas, divididas entre usos antrópicos que ocupam 42% da área total da
Bacia, incluindo atividades agrícolas mineração, indústrias e áreas de lazer,
usos urbanos 17% resultante na ocupação urbana de alta densidade (ISA,
2006).
De acordo com os dados do IBGE (2007), estima-se que moram na Bacia
Guarapiranga 787.820 pessoas, em 1980 eram 332.064 e em 1991 cerca de
548.370 pessoas, com base nesses dados é possível verificar o crescimento
que a região vem sofrendo.
Os loteamentos irregulares, reunidos nos arredores do Reservatório
Guarapiranga apresentam precária infra-estrutura de saneamento sendo estes
lotes responsáveis por grande parte do crescimento da região (SMA & CEA,
2008).
Dentre as atividades mais praticadas no parque encontra-se o passeio
(21,18%), sendo o de maior ocorrência; foi observado um grande número de
familiares que levam as crianças nos finais de semana como forma de
entretenimento, sendo este recreação com a família (18,38%), alguns praticam
a caminhada (14,64%), outros simplesmente descansam (14,02%), contemplam
a natureza (13,40%) ou praticam esporte de quadra (4,98%). Na relação de
atividades ao responder o questionário o entrevistado do pôde optar por mais
de uma atividade.
Dados observados em avaliação às principais atividades realizadas nos
parques públicos de São Paulo apresentam que 68% dos freqüentadores
desenvolvem alguma atividade física como fazer caminhada, correr, fazer
ginástica, musculação e esportes de quadra; lazer ou cultura (35%) incluso
levar as crianças para brincar assim como passear; descanso e relaxamento
(17%) envolvendo observar a natureza ou respirar ar puro, a freqüência dos
usuários de parques públicos (35%) no estado de São Paulo é maior nos finais
de semana, a grande maioria vai para caminhar, correr ou simplesmente
descansar e outros para atividades como shows que parques oferecem próximo
a residência, ou até mesmo como uma oportunidade para passear pela cidade
um local diferente no final de semana (Whately,et al., 2008).

Buscando avaliar o conhecimento e entendimento dos frequentadores do PEG,


referente ao que é um parque ecológico, foi observado de acordo com as
respostas que a maioria dos entrevistados não compreendem a importância de
se ter um Parque Ecológico na região, a grande maioria respondeu sendo um
ponto de diversão para crianças e adultos (17,24%); um local de lazer (16,67%);
uma área verde (12,64%); o contato com a natureza (12,08%); ambiente
agradável (8,06%); um lugar que preserva a natureza e os animais (5,75%); um
local onde há atividades recreativas (5,17%); a união de plantas, animais e
água (4,03%); para outros um parque ecológico serve como instrumento de

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

87
UNISA - Universidade de Santo Amaro

ensino para a população abordando a conservação da natureza (2,30 %) e


apenas 1,15% dos entrevistados entendem ser um local que oferece educação
ambiental.
A criação do Parque Ecológico Guarapiranga teve como propósito a proteção
dos mananciais, a preservação da fauna e flora, conter as ocupações
irregulares desenvolvendo atividades de educação ambiental e oferecer
alternativas de lazer para a população (França, 2000).
A Educação Ambiental (EA), com sua abordagem interdisciplinar enfrenta
grandes desafios na formação de educadores. O maior desafio é introduzir a EA
de modo a não perder de vista as suas vivências e abordagens humanística e
transformadora, envolvendo a todos, comunidade e meio ambiente (Tristão,
2007).
A fim de levantar a percepção a respeito de meio ambiente foi relacionado as
respostas por categorias, em que para a maioria dos entrevistados 24,65 % a
natureza representa o meio ambiente; outros sendo um lugar sem poluição,
limpo (16,2 %); área verde (11,27 %); um local onde vivemos (10,56 %);
entrevistados que interpretam como o tudo (5,64 %) e aqueles que
responderam não saber (4,95 %).
Esses dados indicam que a percepção em relação ao meio não está no sentido
de que o ambiente construído também constitui o meio ambiente, prevalecendo
uma idéia naturalista.
Dados de percepção a respeito de meio ambiente foram observados com
alunos do ensino fundamental, para a maioria o meio ambiente é o lugar onde
vivemos (44,6%) e 33,7% dos alunos responderam ser simplesmente a
natureza (Pelicioni, 1998).
A maioria dos entrevistados, 63% não identificou problemas ambientais no
PEG; aqueles que identificaram 37% estão expressos por categoria.
A falta de cuidado com a represa foi o dado com maior percentual 33,33 %;
outros fatores como o lixo e poluição 16,68 %; o despejo de esgoto (12,5%); a
população em área de manancial (4,17%). É possível verificar a falta de
compreensão dos entrevistados em relação as respostas ao se referirem como
problema ambiental a falta de segurança ( 2,08%), assim como a falta de
organização do campo (de futebol) (2,08%).
A partir de 1980 o despejo de esgoto e a poluição difusa correspondente a todo
o tipo de resíduos que não sendo descartado e coletado adequadamente vão
para os corpos de água. A poluição da Represa Guarapiranga é causada
principalmente por despejo de esgotos, que são provenientes de residências,
de comércios, pequenas indústrias e de atividades agrícolas (SMA & CEA,
2008).

CONCLUSÃO:

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

88
UNISA - Universidade de Santo Amaro

5. Conclusões
Com a análise dos resultados apresentados é possível entender que os
freqüentadores do Parque Ecológico Guarapiranga trazem um perfil quanto a
percepção ambiental, em sua maioria, um caráter apenas social. A percepção
foi buscada de várias formas nas questões trabalhadas.
Há uma grande necessidade de informação ligada ao conhecimento referente
ao local onde se encontra o PEG, uma vez que os freqüentadores passem a
valorizar esse conhecimento torna-se fácil aspirar a importância em se ter um
Parque Ecológico próximo a residência, e passar a frequentá-lo com essência e
não simplesmente por recreação.
Foi observado durante a pesquisa um público variado em relação às intenções
de visitas ao PEG, ao buscar a utilização dos espaços. Dos entrevistados, os
usuários que vão ao Parque com maior frequência está ligado a alguma prática
esportiva; o outro público envolve os visitantes de primeira vez e aqueles que
vão ao menos uma vez ao mês, em geral é para um simples descanso; e em
sua maioria quer está em contato com o meio natural.
Nesta mesma abordagem o parque obteve uma avaliação boa de seus
espaços, no entanto há um grande número de frequentadores que
desconhecem várias atividades existentes no PEG, havendo uma necessidade
maior de divulgação.
Com a caracterização socioambiental dos freqüentadores do PEG é possível
conhecer a percepção do público e suas opiniões em relação aos espaços do
Parque, servindo como base para a criação de projetos e atividades no Parque
Ecológico Guarapiranga que respeitem as restrições que o local apresenta,
buscando atender as aspirações dos freqüentadores, pautados na Educação
Ambiental.
Os resultados apresentados neste trabalho farão parte do Plano de Manejo do
Parque Ecológico Guarapiranga, já em andamento.
Deste modo o caminho traçado pela Educação Ambiental deve ser lento
deixando conhecimento ao longo do percurso, ressaltando que em muitas vezes
é necessário retornar, pois essa aprendizagem é permanente.

REFERÊNCIA BIBLIOGRÁFICA:
6. Referências Bibliográficas

Brasil, 1981. LEI Nº 6.938 Dispõe sobre a Política Nacional do Meio Ambiente,
seus fins e mecanismos de formulação e aplicação, e dá outras providências.
Campos Filho, O.S. 2003. Parque Ecológico do Guarapiranga: um espaço de
lazer e preservação. In: http://www.ambiente.sp.gov.br (acessado em junho /

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

89
UNISA - Universidade de Santo Amaro

2008).

França, E. 2000. O Programa de Saneamento Ambiental e Recuperação


Urbana da Bacia do Guarapiranga e a Prefeitura de São Paulo. In: França,
Elizabete (coordenação). Guarapiranga: Recuperação Urbana e Ambiental no
Município de São Paulo. M. Carrilho Arquitetos. São Paulo:19-39

Gil, A. C. 1999. Métodos e Técnicas de Pesquisa Social. 5ª edição. Atlas. São


Paulo.

IBGE – Instituto Brasileiro de Geografia e Estatística. 2007. Dados do Censo


Demográfico. Disponível em: www.ibge.gov.br

ISA. Instituto Socioambiental 2006. Seminário Guarapiranga. Proposições de


ações prioritárias para garantir água de boa qualidade para o abastecimento
público. São Paulo. 171p.

Mendes, D. & Carvalho,M. C. de.2000. A Ocupação da Bacia Guarapiranga:


Perspectiva Histórico-Urbanística. In: França, Elizabete (coordenação).
Guarapiranga: Recuperação Urbana e Ambiental no Município de São Paulo. M.
Carrilho Arquitetos. São Paulo: 39-67

Pelicioni, A. F. 1998. Educação Ambiental na Escola – Um levantamento de


percepções e práticas de estudantes de primeiro grau a respeito de Meio
Ambiente e Problemas Ambientais. Dissertação para obtenção do titulo de
Mestre. Universidade de São Paulo. São Paulo. 118p.

Santoro,P.F.et al.2009. Mananciais: diagnóstico e políticas habitacionais.


Instituto Socioambiental. São Paulo.127p.

SMA - Secretaria do Meio Ambiente. 2000. Atlas das Unidades de Conservação


Ambiental do estado de São Paulo. São Paulo.

SMA & CEA, - Secretaria do Meio Ambiente e Coordenadoria de Educação


Ambiental. 2008. Caderno Ambiental Guarapiranga. Secretaria do Estado do
Meio Ambiente. São Paulo. 84p.

Tristão, M.. 2007. A Educação Ambiental e os espaços / tempos de formação.


In: Guera, A. F. S. & Taglieber, J. E. Educação Ambiental Fundamentos,
Praticas e Desafios. UNIVALI. Itajaí: 37-52

Whately, M. et al.2008. Parques urbanos municipais de São Paulo: subsídios

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

90
UNISA - Universidade de Santo Amaro

para a gestão. Instituto Socioambiental. São Paulo. 119p.

________________________________________________________________
Palavras chaves: Parque Ecológico Guarapiranga, Perfil Socioambiental,
Educação Ambiental.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

91
UNISA - Universidade de Santo Amaro

Analise do potencial fitotóxico de extratos etanólios de


Erechtites valerianaefolia (WOLF) DC.
ALEXANDRE EMANOEL MARTINS ZOMER(1)

MARCO AURELIO SIVERO MAYWORM(2)(Orientadores)


Ciências Biológicas
INTRODUÇÃO:
A utilização de herbicidas no controle químico de plantas daninhas é uma
prática comum na agricultura. Isso se deve, principalmente, ao fato de ser um
método eficiente e de baixo custo, sendo assim, outros métodos de controle têm
sido deixados de lado.
Anualmente, o mercado mundial de agroquímicos movimenta em torno de U$
30 bilhões, e no Brasil essa indústria tem crescido continuamente. Estima-se
que nos últimos anos a venda desses produtos no Brasil atingiu U$ 3 bilhões.
Um dos principais problemas associados ao uso de herbicidas é o
desenvolvimento de espécies resistentes aos mesmos, o que acarreta uma
contínua demanda por novos compostos químicos, que apresentem
mecanismos bioquímicos de ação diferente daquelas exercidas pelos herbicidas
atualmente em uso.
O controle de plantas invasoras pode ser efetuado através de compostos
naturais, provenientes do metabolismo secundário das plantas, capazes de
inibir a germinação ou o crescimento das mesmas. Estes compostos têm função
ecológica de defender a planta contra herbívoros, atraem polinizadores, atuam
como ferormônios e exercem atividade alelopática.
A variedade de atuação dos compostos secundários, principalmente na ação
alelopática, fizeram dos aleloquímicos um recurso para o desenvolvimento de
herbicidas naturais.
Diversos estudos estão sendo realizados através da alelopatia, na tentativa de
diminuir o uso de herbicidas. Estudos sobre substâncias alelopáticas e a
identificação das plantas que possuem princípios ativos capazes de causar
algum efeito é assunto de grande importância, tanto na utilização de extratos
capazes de inibir plantas daninhas na tentativa de diminuir o uso de herbicidas
comerciais, quanto na determinação de práticas culturais e de manejos mais
adequados que evitem a interferência destas substâncias no crescimento de
outras.
Os metabólitos secundários foram considerados, durante muito tempo, nada
mais do que subprodutos do metabolismo primário. Entretanto, o fato do vegetal
utilizar rotas biossintéticas elaboradas e com elevado gasto de energia,
conduziu à hipótese mais aceita atualmente de que estes compostos são
necessários para sobrevivência e preservação do vegeta. Foram reconhecidas
como funções de vários metabólitos secundários, a defesa contra herbívoros e

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

92
UNISA - Universidade de Santo Amaro

microrganismos, proteção contra raios UV, atração de polinizadores e


dispersores de sementes, bem como sua participação em efeitos alelopáticos.
Os metabólitos secundários produzidos pelas plantas constituem diversas
classes de compostos, entre as quais destacam-se alcalóides, terpenos, óleos
voláteis, saponinas, e compostos fenólicos como flavonóides, taninos, quinonas
e cumarinas.
Os alcalóides são compostos nitrogenados farmacologicamente ativos
encontrados predominantemente nas angiospermas. Constituem-se num vasto
grupo de metabólitos com grande diversidade estrutural, representando cerca
de 20% das substâncias naturais descritas. Sementes e frutos que continham
alcalóides agiam como fortes inibidores de germinação. Observou-se a ação
inibitória de diversos alcalóides na germinação de sementes de alface.
Os terpenóides formam um grande grupo de substâncias naturais cujas
moléculas estão envolvidas na maioria das possíveis interações entre plantas,
plantas e microrganismos e entre plantas e animais. Os monoterpenóides
caracterizam-se fundamentalmente por sua volatilidade e odor característico.
São utilizados como anestésicos, expectorantes e antitussígenos. São os
principais componentes dos óleos essenciais e muito estudados no ponto de
vista aleloquímico. Os monoterpenóides podem ser os principais responsáveis
pelos efeitos inibitórios de óleos essenciais. Os sesquiterpenóides formam a
maior classe dos terpenóides, apresentando atividade antipirética, antifebrífuga,
antimalárica, antiinflamatória e antiespasmódica. Óleos voláteis são misturas
complexas de substâncias voláteis lipofílicas, como os terpenóides. Plantas
medicinais que possuem óleos essenciais entre seus princípios ativos, têm-se
revelado promissoras no controle de plantas invasoras.
Saponinas constituem um grande grupo glicosídeo com estruturas esteroidais e
triterpênicas, capazes de produzir espuma em solução aquosa. Estes
compostos têm mostrado ação de lise celular e fungitóxica. As saponinas
presentes nas raízes de alfafa retardam o crescimento do algodão.
Os flavonóides são um grupo de compostos fenólicos de ampla ocorrência no
reino vegetal. Apresentam funções antioxidantes, proteção contra raios UV e
entrada de microrganismos, ação alelopática, entre outras. Em raízes de
macieira é encontrada a florizina, um flavonóide que inibe o crescimento das
plântulas da mesma espécie.
Taninos são substâncias fenólicas solúveis em água responsáveis pela
adstringência de frutos e outros produtos vegetais. São utilizados na medicina
popular no tratamento de reumatismo, hemorragias, queimaduras, processos
inflamatórios, entre outros. Os taninos apresentam ação inibitória em
germinação de sementes, crescimento das plantas e bactérias.
As quinonas são compostos orgânicos que podem ser considerados produtos
de oxidação de fenóis. Apresentam atividade laxante, e na planta atuam na
defesa contra insetos e patógenos. A juglona, uma naftoquinona presente na

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

93
UNISA - Universidade de Santo Amaro

nogueira, impede o crescimento de outras espécies debaixo da copa e na área


onde se desenvolvem as raízes da planta.
As cumarinas são heterosídeos solúveis em álcool, amplamente distribuídas
entre os vegetais podendo ser encontradas também em fungos e bactérias.
Apresentam ampla atividade farmacológica e ação alelopática. O psoraleno,
isolado de sementes e frutos de diversas espécies, inibe a germinação de
sementes de alface mesmo em concentrações muito baixas.
A ordem Asterales compreende nove famílias botânicas, das quais a família
Asteraceae (Compositae) é uma das mais importantes como fonte de espécies
vegetais de valor medicinal.
Na família predominam ervas ou subarbustos, menos frequentemente arbustos,
pequenas árvores ou lianas. Possui distribuição cosmopolita, sendo a maior
família de Eudicotiledoneas, com aproximadamente 1600 gêneros e 23.000
espécies. No Brasil a família é bem representada, ocorrendo aproximadamente
300 gêneros e 2000 espécies.
Entre os constituintes químicos encontrados nessa família destacam-se
triterpenos, cumarinas, óleos essenciais, sesquiterpenóides, lactonas,
flavonóides, entre outros.
A família Asteraceae pode ser considerada uma das mais importantes fontes de
espécies vegetais de interesse terapêutico, dado o grande número de plantas
pertencentes a ela que são usadas popularmente como medicamentos, muitas
das quais amplamente estudadas dos pontos de vista químico e farmacológico.
Erechtites valerianaefolia (Wolf) DC. (sinonímio Senecio valerianaefolius) é uma
espécie da família Asteraceae conhecida popularmente como capiçoba,
capiçoba-vermelha, caruru-amargoso, voadeira preta, erva gorda e maria-
gomes. É uma planta anual, herbácea, ereta de caule semi-suculento e mais ou
menos pigmentado de antocianina (algumas vezes muito escuro), levemente
pubescente, de 50-120 cm de altura, nativa do Brasil. Propaga-se
exclusivamente por sementes. Trata-se de planta daninha com alto teor de
matéria orgânica e boa fertilidade. Infesta lavouras, chegando a ser a única
espécie infestante. Ocorre em todo o país, contudo é mais frequente na planície
litorânea, onde é importante infestante de bananais.
Não foram encontrados até o momento trabalhos que avaliem o potencial
alelopático de Erechtites valerianaefolia.

OBJETIVO:
Este trabalho teve como objetivos analisar o potencial alelopático de extratos
foliares, caulinares e radiculares de Erechtites valerianaefolia, sobre a
germinação e crescimento de plântulas de alface (Lactuca sativa L.), e avaliar
os teores de flavonóides e açúcares totais dos extratos.

METODOLOGIA:

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

94
UNISA - Universidade de Santo Amaro

Amostras de folhas, caules e raízes de Erechtites valerianaefolia (Wolf) DC.


foram coletadas em uma propriedade localizada no bairro de Parelheiros,
município de São Paulo.
Amostras de folhas, caules e raízes foram fragmentadas e submersas em
etanol P.A., sendo agitadas diariamente e o solvente trocado a cada 7 dias,
perfazendo um total de 28 dias de extração. Após a terceira extração (21º dia),
os materiais foram triturados em liquidificador e, em seguida, submersos
novamente em etanol P.A. As extrações foram feitas à temperatura ambiente e
protegidas da luz, a fim de evitar a fotooxidação dos compostos. Os filtrados
obtidos foram reunidos, constituindo os extratos etanólicos bruto, os quais
foram concentrados sob pressão reduzida em rotaevaporador a 45°C, a fim de
obterem concentrações a 1%.
Os testes de ação alelopática foram desenvolvidos segundo método usual, em
triplicata. Em discos de papel de filtro com 9 cm de diâmetro, foram depositados
4 mL de extrato de forma uniforme. Para efeito de controle, em outros discos de
mesmo diâmetro foram depositados 4 mL de etanol P.A. Os discos
impregnados foram mantidos por 24 horas em estufa e dessecador para
eliminação do solvente. Após esse período, os discos de papel foram
depositados em placas de Petri previamente esterilizadas. Em cada placa foram
acrescentados 4 mL de água destilada e, após 1 hora, foram depositados 20
aquênios de alface (Lactuca sativa L.). As placas foram vedadas com filme
(PVC) e mantidas sob iluminação constante e temperatura ambiente pelo
período de cinco dias. A porcentagem de germinação e Índice de Velocidade de
Germinação (IVG) foram determinados diariamente, e no 4º dia foram medidos
os comprimentos do eixo hipocótilo-radicular e das folhas cotiledonares,
também foram determinados teores de flavonóides e açúcares totais.

RESUMO:
As massas fresca e seca das amostras analisadas, e o rendimento dos extratos
etanólicos obtidos a partir de folhas, caules e raízes de E. valerianaefolia. O
extrato foliar apresentou a maior porcentagem de massa seca total (62,4%), e
maior rendimento do extrato (2,9%). Os extratos caulinar e radicular
apresentaram porcentagem de massa seca total semelhante (54,2 e 51,5%,
respectivamente), contudo o rendimento do extrato caulinar foi maior (1,8%) em
relação ao extrato radicular (1,5%). Esses resultados indicam que o extrato
foliar possui, a princípio, maior quantidade de compostos solúveis em etanol.
As taxas de germinação, índice de velocidade de germinação (IVG) e
crescimento das plântulas de alface (Lactuca sativa L.) sobre os extratos
etanólicos de E. valerianaefolia. O extrato foliar apresentou maior efeito
alelopático, inibindo totalmente a germinação dos aquênios de alface. Sobre o
extrato radicular observou-se a menor taxa final de germinação (78,3%), em
relação ao controle e o extrato caulinar não afetou significativamente a taxa de

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

95
UNISA - Universidade de Santo Amaro

germinação final (93,3%).


Os índices de velocidade de germinação (IVG) dos extratos caulinar e radicular
(28,8 e 18,2, respectivamente) mostraram-se inferiores ao controle (41,0),
resultados esperados, uma vez que os extratos caulinar e radicular retardaram
a germinação dos aquênios observada no 1° dia de contagem.
As plântulas desenvolvidas sobre os extratos caulinar e radicular apresentaram
forte redução no comprimento médio do eixo hipocótilo-radicular (11,0 e 8,5
mm, respectivamente), em relação ao controle (41,1 mm).
O comprimento das folhas cotiledonares foi fortemente afetado pelo extrato
radicular, apresentando tamanho inferior à 3 mm, em relação ao controle (3,6
mm), enquanto o extrato caulinar não afetou significativamente o comprimento
das folhas cotiledonares (3,1 mm).
Os teores de flavonóides dos extratos de E. valerianaefolia. O extrato foliar
apresentou maior teor de flavonóides (0,92 mg/mL) em relação aos extratos
caulinar (0,21 mg/mL) e radicular (0,06 mg/mL).
O maior efeito alelopático apresentado pelo extrato foliar pode estar associado,
a princípio, ao maior teor de flavonóides presentes no extrato (0,92 mg/mL).
O maior teor de açúcares totais foi observado no extrato radicular (4,4 mg/mL) e
o menor teor foi observado no extrato foliar (1,2 mg/mL). Esses resultados
sugerem, a princípio, que o efeito alelopático apresentado pelo extrato radicular
pode ser creditado em parte ao teor elevado de açúcares, através de ação
osmótica.
Devido à diversidade de compostos que ocorrem em E. valerianaefolia pode-se
sugerir a ação de mais de um componente químico responsável pelo efeito
alelopático dos extratos, sendo que apenas o isolamento desses compostos e a
avaliação das suas atividades possibilitarão melhor entendimento dos
resultados aqui observados.

CONCLUSÃO:
Os resultados obtidos neste trabalho demonstraram que todos os extratos de
Erechtites valerianaefolia. apresentam ação alelopática, sendo que o extrato
foliar mostrou-se mais efetivo, inibindo totalmente a germinação das sementes
de alface (Lactuca sativa L), podendo ser uma fonte para a busca e isolamento
de novas substâncias que poderão ser utilizadas como herbicidas naturais.
Sendo assim, a partir deste trabalho, novas pesquisas poderão ser
desenvolvidas com o objetivo de dar continuidade aos estudos da espécie:

• Análise do potencial alelopático utilizando extratos com concentrações


menores que 1 %;

• Fracionamento do extrato etanólico bruto afim de obter extratos com


diferentes polaridades;

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

96
UNISA - Universidade de Santo Amaro

• Avaliação sazonal do potencial alelopático;

• Isolamento e identificação e isolamento de compostos presentes nos


extratos;

• Avaliação de outras atividades biológicas (antimicrobiana, antioxidante,


antifúngica, anticolinesterásica, inseticida, acaricida, etc.).

REFERÊNCIA BIBLIOGRÁFICA:
ALMEIDA, F.S. 1988. A alelopatia e as plantas. Fundação Instituto Agronômico
do Paraná. Londrina.

LORENZI, H. 2000. Plantas Daninhas do Brasil. Instituto Plantarum. Nova


Odessa.

MURAKAMI, C.; CARDOSO, F. L. & MAYWORM, M. A. S.. 2009. Potencial


fitotóxico de extratos foliares de Aloe arborescens Miller (Asphodelaceae)
produzidos em diferentes épocas do ano. Acta Botanica Brasilica 23(1): 111-
117
________________________________________________________________
Alelopatia; Fitoquimica; Erechtites valerianaefolia (WOLF) DC.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

97
UNISA - Universidade de Santo Amaro

APLICAÇÃO DE PRÁTICAS DE EDUCAÇÃO AMBIENTAL EM


CONDOMÍNIO RESIDENCIAL
MARIA CRISTIANA SANTOS(1)

MARIA DO SOCORRO S PEREIRA LIPPI(2)(Orientadores)


Ciências Biológicas
INTRODUÇÃO:
A atuação da Educação Ambiental, tanto nos processos formal como no
inoformal, é hoje, uma das principais ferramentasvoltadas para a solução de
problemas relacionados ao meio ambiente, considerando que a Educação
ambiental propicia uma visão da realidade como um sistema dinâmico, onde as
relações entre desenvolvimento e meio-ambiente, teoria e prática, pensamento
e ação são devidamente explicitados e entendidos, como consta no capítulo 36
da agenda 21:

“[...] tanto o ensino formal como o informal são indispensáveis para modificar a
atitude das pessoas, para que estas tenham capacidade de avaliar os
problemas do desenvolvimento sustentável e abordá-los. O ensino é também
fundamental para conferir consciência ambiental e ética, valores e atitudes,
técnicas e comportamentos em consonância com o desenvolvimento
sustentável e que favoreçam a participação pública efetiva nas tomadas de
decisão [...]” (Agenda 21, p. 239).

O analfabetismo ambiental levou a espécie humana a produzir pressões


insuportáveis sobre os sistemas naturais. Com isso, a capacidade de suporte
dos ecossistemas globais já foi superada. Estamos vivendo de retiradas
contínuas de uma poupança, na qual não fazemos nenhum depósito. A
velocidade de exploração das florestas e dos solos é, muitas vezes, superior à
capacidade de regeneração da natureza. Extrapolamos todos os limites que a
ignorância permite e como conseqüência, percebe-se a perda da qualidade de
vida, de uma forma generalizada, em todo o mundo que pode ser desde a perda
de uma cachoeira de água potável a um riacho que sumiu; de um recanto
destruído à violência dos assaltos e do desemprego; do empobrecimento
estético à erosão cultural (op. cit.).

A realização humana só pode ser o produto do trabalho coletivo, com a ação


política articulada e vinculada a práticas educativas que almejam a
concretização da cidadania plena e ecológica (Baeta et al., 2005).

Condomínios

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

98
UNISA - Universidade de Santo Amaro

A Lei Federal nº 4.591, de 16 de dezembro de 1964, regulamenta a organização


e administração dos condomínios. Cada condomínio deverá elaborar sua
convenção, bem como elaborar e aprovar seu regimento interno. Após o
registro da convenção no registro de imóveis, o regimento se torna obrigatório
para os proprietários, promitentes compradores, cessionários e promitentes
cessionários, tanto para os atuais quanto aos futuros.

A administração do condomínio está regulamentada no capítulo VI e deve ser


exercida por um síndico cujo mandato não poderá ser superior a 02 anos,
sendo que isto deve estar previsto na convenção do condomínio. O capítulo VII
dispõe sobre as assembléias extraordinárias que poderão ser convocadas pelo
próprio síndico ou por um quarto dos seus condomínios.

Tanto na Lei Federal nº 4.591, de 16 de dezembro de 1994, como nas


convenções dos condomínios, não se verifica expressa nenhuma
regulamentação ou orientação quanto aos acondicionamentos ou disposição
dos resíduos.

OBJETIVO:
Realizar um estudo do conhecimento e percepção ambiental dos moradores do
condomínio califórnia, investigar a aceitação do público-alvo sobre a
implantação de um Programa de Educação Ambiental voltado para o uso
racional de água, coleta de óleo de aozinha e coleta seletiva de resíduos
sólidos.

METODOLOGIA:
O trabalho foi desenvolvido no condomínio califórnia, localizado na Estrada do
Campo Limpo, 560, no bairro Campo Limpo, São Paulo,SP.

A pesquisa foi realizada com 43 moradores.

Foram utilizados questionários, buscando atingir o maior número possível de


moradores.

Os questionários foram avaliados a partir de tabelas das respostas e


posteriores análises destes dados ( Gil, 1999).

RESUMO:
Analisando a idade dos moradores, constatou-se que 30 pessoas possuíam
idade entre 18 e 40 anos, 10 pessoas pos´suíam idade entre 41 e 63 anos e

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

99
UNISA - Universidade de Santo Amaro

apenas 3 pessoas possuíam idade acima de 63 anos, sendo que a pessoa mais
velha possui 75 anos.

Metade da população mundial tem menos de 20 anos e 90% destes vivem em


países em desenvolvimento. Estima-se que, até 2050, a população irá aumentar
50%, atingindo 9 bilhões de pessoas (Caruso & Sobrinho, 2000). A pesquisa
mostrou que da totalidade dos entrevistados, 14 são do sexo feminino e 29 do
sexo masculino (figura 2), destes, 20 pessoas são as mais acessíveis e que
ficam a maior parte do dia em casa, representados pelas donas de casa,
aposentados e estudantes, devido às suas profissões, a maior parte dos
condôminos passam o dia fora, no trabalho e retornam à suas residências
somente no período noturno, representados por 05 vendedores, 01 auxiliar de
enfermagem, 01 comerciante, 04 administradores, 02 Técnicos, 01 auxiliar de
escritório, 01 Body Piercing, 01 Secretária, 01 Jornalista, 02 Professores, 02
Motoristas, 01 Policial e 01 Advogado.

Grande parte dos apartamentos são habitados por 1, 2 ou 3 pessoas, como


pude observar, muitos casais com um filho residem nos apartamentos. A média
de tamanho da família de uma dada população é um dado relevante muito
utilizado pelos planejadores das mais diversas áreas das atividades humanas
(Dias,2001).

Poucas pessoas separam e reciclam o lixo. A grande quantidade do lixo


domiciliar é jogado na lixeira central do condomínio, após recolhimento feito
porta a porta, pelos funcionários.

Como se não bastassem todos os problemas provocados pela poluição das


águas e do ar, o homem ainda precisa aprender a conviver com seus dejetos
sólidos, produzidos em grande quantidade por uma sociedade que se habituou
ao consumo desnecessário e exagerado (Almeida et. al, 1996).

Um número muito grande de condôminos não dá um destino adequado para


suas baterias de celular e pilhas usadas, apenas 3 pessoas descartam-nas em
lugares adequados.

No Brasil, não é preocupação prioritária a disposição final de pilhas e baterias


usadas. A grande maioria dos brasileiros não sabe que pilhas e baterias são
lixo químico, que podem causar danos sérios à saúde e que devem ter uma
destinação final diferenciada do lixo comum. A produção de pilhas é cerca de
670 milhões de unidades por ano, sendo basicamente de pilhas zinco-carvão e
alcalinas. Porém, muitos outros tipos de pilhas entram no país através da
importação de equipamentos eletrônicos (relógios, calculadoras, etc.),

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

100
UNISA - Universidade de Santo Amaro

eletroportáteis e brinquedos. Todas, entretanto, vão para no lixo comum


(www.lqes.iqm.unicamp.br). Devemos lembrar que as pilhas alcalinas brasileiras
já não contêm metais pesados perigosos (Dias, 2006).

O condomínio Residencial Califórnia, está localizado em uma região onde ainda


há área verde e muitas árvores, o que favorece a presença de pássaros, no
entanto, a pesquisa nos mostra que um número alto de pessoas não
conseguem ouvir pássaros e identificá-los. Apenas 9 pessoas conseguiram
classificar os pássaros que ouvem e o Bem-te-vi é o pássaro mais visto pelos
condôminos.Conforme Oliveira (2002), vivemos um momento de crise do
processo civilizatório, da necessidade de reconstrução de valores, pautados em
uma nova ética de promoção de vida, que releve a dignidade humana e repense
as relações dos seres humanos entre si e com a natureza.

Um número bastante significativo de moradores assistem programas sobre o


meio ambiente. A programação voltada para o meio ambiente está crescendo
cada vez mais e nos dias de hoje quase todos os canais já possuem alguma
programação que fale sobre meio ambiente.

Segundo Silva (2000), os meios de comunicação têm um importante papel a


cumprir na educação. Canclini (1995), diz que o poder da mídia é tão grande
que chega a substituir as formas de participação popular, como os sindicatos,
partidos políticos e as diversas associações. Porém entendemos que seja
utilizado de uma forma.

Conforme pesquisa, 11 pessoas gostariam da implantação da coleta seletiva,


não é um número muito expressivo, mas possuem a mesma opinião quanto a
existência de coletores distribuídos no condomínio, para que possam incentivar
mais pessoas a jogarem os lixos nos lugares adequados.

Conforme James (1997) os homens estão começando a perceber como vêm


tratando o planeta pelo uso descuidado de seus recursos, pela poluição e pelo
descaso para com seus delicados ciclos anuais. Começam a perceber, também,
que sua própria saúde e seu prazer de viver dependem das condições do meio
ambiente.

A maioria dos moradores, no total de 29 demonstraram motivação para


participar do Projeto de Educação Ambiental. Esta situação nos mostra que as
pessoas estão começando a preocupar-se com o problema das condições do
meio ambiente (James, 1997).

De acordo com visita monitorada e orientação do programa desenvolvido no

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

101
UNISA - Universidade de Santo Amaro

Conjunto Nacional, foi desenvolvida a seguinte proposta:

A - Conscientização Ambiental

Nas reuniões semanais de condomínio, será incluído o tema Meio Ambiente


com intuito de preservação e conservação dos recursos naturais. Serão
desenvolvidas atividades como filmes, jogos ambientais, gincanas e sempre
que possível, propostas para debates na tentativa de melhoria da qualidade de
vida dos condôminos, sem agressão ao meio ambiente. Estas atividades serão
ministradas por uma Bióloga voluntária.

Os principais tópicos trabalhados serão:

A água, uso correto e consciente, sem gastos desnecessários.

Mutirão para a plantação de mais áreas verdes, plantas e árvores frutíferas, que
por conseqüência trarão mais passarinhos para o condomínio.

Coleta seletiva: Palestras sobre a importância da colaboração de todos os


moradores, além de filmes e panfletos informativos.

Economia de energia elétrica.

B - Óleo de Cozinha

Para este resíduo - óleo de cozinha, contatamos a ONG Trevo, que deixará
recipientes de 30 litros para coleta semanal do óleo de cozinha.

Os recipientes estarão disponíveis na entrada principal de cada prédio.

C - Coleta Seletiva

Parte I
Implantação dos coletores, que estarão distribuídos em todo o condomínio.

Serão colocados folhetos em todos os prédios com todas as informações


necessárias para que os moradores possam depositar o lixo corretamente.

Parte II
Cada residência será munida por uma caixa plástica identificada, onde serão
depositados os materiais recicláveis. Os materiais deverão ser limpos e secos.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

102
UNISA - Universidade de Santo Amaro

Este material será recolhido por funcionários do condomínio como já se faz hoje
com o lixo.

Parte do material como latas, garrafas, papelão, entre outros serão vendidos
para uma ONG que trabalha com material para reciclagem, o restante será
recolhido pelo caminhão da coleta seletiva que já existe no bairro, o dinheiro
desta comercialização, será revertido para o condomínio, os condôminos
escolherão através de voto o que gostariam que fosse construído ou comprado
com o dinheiro arrecadado na venda dos reciclados.

CONCLUSÃO:
A educação para a cidadania representa a possibilidade de motivar e
sensibilizar as pesoas para transformar as diversas formas de participação em
potenciais caminhos de dinamização da sociedade e de concretização de uma
proposta de sociabilidade baseada na educação para a particiação (Jacobi,
2001).

De acordo com os resultados obtidos durante a realização deste trabalho doi


possível observar que grande parte dos condôminos não possuem
conhecimento da realidade sobre as questões ambientais urbanas mais
problemáticas.

A princípio, houve uma grande dificuldade quanto à aceitação dos condôminos


sobre a questão ambiental, mas ao término da pesquisa, após explicações no
sentido de conscientização, houve uma resposta positiva para a implantação do
Programa de Educação Ambiental, inclusive com boas sugestões.

Nas reuniões de condôminos será oferecido sempre alguma atividade que


reforce a conscientização ambiental dos moradores e os incentive cada vez
mais na colaboração da continuidade do Programa.

REFERÊNCIA BIBLIOGRÁFICA:
CARUSO, Antonio Carlos; SOBRINHO, Eduardo Jorge Martins Alves. 2000.
Educação Ambiental – Mudança de cultura. Tribunal de Contas do município de
São Paulo. Realização do Grupo Ambiental do TCMSP em parceria com SVMA.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

103
UNISA - Universidade de Santo Amaro

DIAS, Genebaldo Freire. 2001. Educação Ambiental: Princípios e práticas. 7ª


edição. Gaia. São Paulo,SP.

ALMEIDA, Aristides de; SÁBER, Aziz A.B.; SALUM, Carlos A. L.; ASSIS, Célia
de; SALATI, Enéas; BORNHEIM, Gerd A.; DAMINELLI, Mário. 1996. Ecologia a
qualidade da vida. 2ª edição. SESC. São Paulo, SP.
________________________________________________________________
No desenvolvimento deste trabalho não há notas de rodapé.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

104
UNISA - Universidade de Santo Amaro

As Sensações visuais e proprioceptivas na natação


CLEIA BISPO DOS SANTOS(1)

CLAUDIA STEFANINI(2)(Orientadores)
Ciências Biológicas
INTRODUÇÃO:
1 INTRODUÇÃO
Sendo a sensação a atividade dos receptores sensoriais e sua aferência ao
Sistema Nervoso Central e, a percepção a integração da informação sensorial
com a entrada dos dados do passado (MAGILL, 2000), pode-se associa-las às
habilidades motoras básicas da natação, como o equilíbrio, a respiração e a
propulsão.
Percepção não é a mesma coisa que sensação. Ainda que, popularmente,
muitas pessoas usem as duas palavras como sinônimas.
Sensação é o simples registro de estímulos físicos, através dos órgãos
sensoriais. Os sentidos meramente detectam fenômenos como luz (visão) e
som (audição), registrando-os seus neurônios e enviando-os para os centros
nervosos. As sensações são as matérias-primas, as sensações não são
produtos elaborados, trabalhados. Quando um treinador emite os sons de suas
instruções dirigidas aos atletas, enquanto o fenômeno sonoro estiver
transitando apenas pelos nervos auditivos, não se poderá dizer que houve
percepção - apenas, sensação.
A aula dada é apenas estimulo físico: enquanto o estimulo não for registrado,
transmitido para o cérebro e elaborado, não houve percepção.
Uma visão com defeitos produz sensações óticas imperfeitas, transmitindo
dados imprecisos para o cérebro. Informações incorretas só podem determinar
percepções viciadas: o processo perceptivo pode até estar bom, mas o que ele
fará será processar matéria prima de má qualidade, dando como conseqüência
aprendizagem irrealista.
Segundo Catteau e Garoff (1990), as habilidades motoras básicas do nado são
o equilíbrio, a respiração e a propulsão. Cada uma com sua característica e
função especifica para este esporte.
Tratando-se do equilíbrio verifica-se que todo nado é considerado simétrico (da
mesma proporção, da mesma regularidade de um todo). A propulsão simétrica
e axial revela-se menos desequilíbradora. O reequilíbrio é basicamente
garantido pelas pernas (que eventualmente neutralizam as oscilações criadas
pelas ações dos braços). O equilíbrio do nadador aproxima-se da posição
horizontal. A cabeça (exceto nos tempos respiratórios) fica visivelmente
estabilizada no eixo de deslocamento. (CATTEAU; GAROFF, 1990).
É preciso ainda observar a supressão das informações fornecidas pelas plantas
dos pés (tão importante para o equilíbrio do bípede). Sendo a gravidade

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

105
UNISA - Universidade de Santo Amaro

praticamente neutralizada pelo empuxo de Arquimedes, as variações do


equilíbrio tornam-se mais lentas.
Outro elemento da natação é a respiração. Na natação basicamente a
respiração esta ligada à ação dos braços, a brevidade da inspiração exige a
utilização da via bucal. A inspiração é um tempo forte e curto e a expiração, um
tempo fraco e longo.
Passa-se de um automatismo inato para um modo inverso que é adquirido:
expiração ativa e inspiração reflexa. A inspiração situa-se além da fase motora
da ação dos braços.
O elemento da propulsão é muito importante na natação. Ela é executada
basicamente pelos (membros superiores, 80% responsável pelo deslocamento
na água) e (membros inferiores, com apenas 20% de responsabilidade por esse
deslocamento). Tudo indica que cada um desses elementos o equilíbrio, a
respiração e a propulsão só têm valor e sentido quando integrado no conjunto.
Catteau e Garoff (1990) vão um pouco mais além com relação às esses
princípios, pois alguns autores consideram apenas os elementos de equilíbrio e
respiração, como elementos a abordar no processo de adaptação ao novo
meio.
Todavia, tradicionalmente são consideradas como componentes da adaptação
ao meio aquático, ou seja, como sendo habilidades aquáticas básicas: a
respiração, o equilíbrio - que inclui as rotações e os saltos - e a propulsão. Isto
é, serão considerados como elementos indispensáveis para uma posterior
abordagem de habilidades desportivas, no meio aquático, o domínio dos fatores
relacionados com o equilíbrio, a respiração e a propulsão.
Contudo, a estas habilidades aquáticas básicas, pode-se acrescentar os
lançamentos e as recepções, o ritmo, os reboques, a flutuação e a
familiarização inicial com o meio. Procura-se, nos estudos sobre o tema, uma
melhor sistematização destas habilidades. Assim, propuseram a abordagem
das rotações, dos deslocamentos (que incorporam a propulsão e os saltos), das
manipulações (que incluem os lançamentos e as recepções) e dos equilíbrios
(também abarcando as flutuações e a respiração).
Em outros estudos científicos sugere-se a abordagem nesta fase dos saltos,
das rotações, dos deslocamentos, do equilíbrio e, dos lançamentos e das
recepções. No entanto, segundo o autor em questão, são fatores essenciais
para a posterior prática da Natação numa perspectiva utilitária e desportiva, a
respiração, a flutuação e a propulsão.
Em síntese, aparentemente serão habilidades aquáticas básicas a serem
abordadas no decurso dos programas de adaptação ao meio aquático: o
equilíbrio, incluindo a flutuação e as rotações; a propulsão, onde se integram os
saltos; a respiração; e as manipulações, que também abrangem os
lançamentos e as recepções.
Quanto à investigação desta pesquisa, procurou-se mudar a luminosidade. Se

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

106
UNISA - Universidade de Santo Amaro

os olhos forem mantidos num baixo nível de luz durante certo tempo, eles ficam
mais sensíveis, e uma determinada luz permanecerá mais brilhante. Essa
"adaptação a escuridão" é rápida durante os primeiros segundos, e depois
branda.
As células receptoras, cones e bastonetes, adaptam-se em tempos diferentes: a
adaptação dos cones completa-se em cerca de sete minutos, ao passo que a
dos bastones continua por uma hora ou mais. É como se, em vez de uma,
tivesse duas retinas interligadas no olho.
Os mecanismos de adaptação ao escuro começam a ser agora entendidos
detalhadamente, graças principalmente aos engenhosos tecnicamente
brilhantes experimentos do fisiologista britânico W.A.H Rushton. Foi sugerido há
muitos anos que a adaptação se desvia à regeneração dos pigmentos visuais
descorados pela luz - esse descoramento estimulando, por algum processo
desconhecido, os receptores a transmitirem sinais elétrico ao nervo ópitico. A
rodopsina fotoquímica foi então extraída do olho de uma rã, sua densidade na
luz medida durante o descoramento e regeneração, e feita a comparação com
as curvas de adaptação humana ao escuro.
Parece também que o brilho deve estar relacionado ao montante de substância
fotoquímica a ser descorado. O que se fez foi medir a densidade da substância
fotoquímica no olho vivo, durante a adaptação ao escuro ou a qualquer luz
colorida. A técnica consiste essencialmente em fazer incidir um breve Flash de
luz sobre o olho e medir a quantidade de luz refletida nele, com uma célula
fotoelétrica muito sensível. No começo, parecia impossível fazer isso com o
olho humano, pois sobra muito pouca luz para ser refletida depois da quase
completa absorção pelas substâncias fotoquímicas e o pigmento preto
localizado atrás dos receptores.
Assim, o olho do gato foi usado, servindo a camada refletora da região
posterior, o tapetum, como espelho para refletir a luz na célula fotoelétrica. O
método funcionou com o olho do gato; e conseguiu-se depois torná-lo
suficientemente sensível para detectar e medir a luz muito tênue refletida do
olho humano. Apurou-se que havia descoramento das substâncias fotoquímicas
com a adaptação, embora fosse muito menor que o esperado. Detectou então
os três pigmentos sensíveis à cor por esse mesmo método, resultado que foi
confirmado pelo exame microscópico de cones isolados.

OBJETIVO:
2 OBJETIVOS
Esta pesquisa tem por objetivo comprovar a baixa qualidade proprioceptiva
visual em crianças de 10 a 12 anos, praticantes da natação a aproximadamente
6 meses.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

107
UNISA - Universidade de Santo Amaro

Interessou-se por verificar o rendimento dos indivíduos adaptando-se a


escuridão, tendo em vista o fato da visão ser a capacidade sensorial mais
importante.

METODOLOGIA:
3 METODOLOGIA
O presente estudo teve uma característica a pesquisa quase- experimental, pois
se propôs a identificar a qualidade proprioceptiva em indivíduos praticantes da
natação.
Segundo Santarem (2002), o método quase-experimental é assim denominado
quando o delineamento experimental não é possível e caracteriza-se pelo
estudo de casos ou grupos de casos, com a presença de uma variável a ser
estudada.
Para o autor, o design Quase-Experimental é uma aproximação do experimento
verdadeiro, contudo, a escolha não é aleatória e a variável independente,
apesar de ter sido manipulada, não foi pelo pesquisador.
Aproxima-se das pesquisas experimentais, embora não seja realizada por meio
da descrição aleatória dos sujeitos nos grupos. Tem um rigor considerável,
estabelecendo comparações entre grupos não equivalentes ou com os mesmos
sujeitos antes do tratamento.
O universo da pesquisa são crianças em idade escolar. A amostra é aleatória
não probabilística. Foram avaliadas 02 turmas de 05 crianças, totalizando 10
indivíduos, com idades entre 10 e 12 anos. Os mesmos são praticantes da
natação a aproximadamente 06 meses, com 02 aulas por semana e duração de
45 minutos cada.
Foi utilizado como instrumento de coleta de dados e informações um
questionário com perguntas fechadas e aplicado um teste sensorial, no qual foi
retirada a capacidade visual gradativamente. Os testes foram aplicados às
turmas de uma academia de natação de médio porte da zona sul da cidade de
São Paulo.
As avaliações foram efetuadas em uma piscina de 16m x 5m de largura e com
1,30 m de profundidade. Utilizou-se um questionário contendo 06 questões
objetivas e um óculos de mergulho com as lentes pintadas de preto pela
metade, outro pintado por inteiro e outro normal. O teste consistia em fazer o
trajeto estabelecido com os olhos abertos; depois com metade da visão
disponível (com os óculos escurecidos pela metade – apenas uma lente); e por
último com os olhos vendados (com óculos escurecidos).

RESUMO:
4 APRESENTAÇÃO DOS RESULTADOS

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

108
UNISA - Universidade de Santo Amaro

4.1 Com a visão totalmente disponível


Pode-se observar que 60% dos alunos pesquisados apresentaram o resultado
bom a ótimo e 40% do total apresentou o resultado regular.
TABELA 1: Resultado do teste com visão disponível
DESEMPENHO RESULTADO
Ótimo ou bom 60%
Regular 40%
Ruim 0%

4.2 Com a visão parcialmente disponível


Observou-se que nenhum aluno pesquisado apresentou o resultado bom ou
ótimo. Verificou-se que 70% apresentou o resultado regular e 30% do total
apresentou um resultado ruim.
TABELA 2: Resultado do teste com visão parcialmente disponível
DESEMPENHO RESULTADO
Ótimo ou bom 0%
Regular 70%
Ruim 30%

4.3. Com a visão totalmente indisponível


Verificou-se que 100% dos alunos não obtiveram um desempenho satisfatório.
Todos foram considerados ruins.
TABELA 3: Resultado do teste com visão totalmente indisponível
DESEMPENHO RESULTADO
Ótimo ou bom 0%
Regular 0%
Ruim 100%

5 DISCUSSÃO
Através de testes com níveis diferentes de dificuldades, observou-se que o
deslocamento em decúbito ventral sem a capacidade visual, não mantém o
mesmo desempenho de um deslocamento com a visão normal.
Observou – se também uma insegurança por parte dos praticantes da pesquisa,
no momento do deslocamento houve redução de velocidade, por serem
iniciantes tiveram um pouco mais de resistência nos primeiros movimentos
deixando de praticar a propriocepção, por este motivo muitos se perderão em
relação ao espaço, deixando de executar os movimentos.

CONCLUSÃO:
7 CONSIDERAÇÕES FINAIS

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

109
UNISA - Universidade de Santo Amaro

Para garantir percepções de acordo com seus objetivos, o treinador deve zelar
pelos órgãos sensoriais dos seus atletas. Os órgãos dos sentidos devem ser
examinados, periodicamente. Uma percepção espacial incorreta impede o atleta
de desenvolver uma boa visão de perspectiva, prejudicando sua performance,
nas jogadas em que seja exigida boa acuidade e precisão.
Outro equívoco a ser corrigido, com respeito às sensações, é sua confusão com
sentimentos. Sentimento não é registro de estímulos físicos, mas a expressão
de uma experiência afetiva. Assim, não é correto dizer sentimento de dor, mas
sensação de dor; como, também, o certo é dizer sentimento de perigo, ao invés
de sensação de perigo.
Portanto, pelo conhecimento de percepção, sabe-se que é certop defini-la como
sendo a organização e a interpretação das sensações, através dos recursos
mentais. Conseqüentemente, quanto melhor a capacidade psicológica do
individuo, no sentido de organizar suas sensações, preparando-as para serem
interpretadas, melhor a capacidade do individuo de aprender, a partir da sua
comunicação com o meio ambiente.
Pela analise dos dados coletados verifica-se que indivíduos de 10 a 12 anos
praticantes da natação aproximadamente a seis meses, ainda não possui uma
coordenação global das habilidades motoras desta modalidade, mesmo alguns
sendo praticantes de outros esportes.
Contudo, espera-se uma melhora gradativa dessas percepções, tendo em vista
o aperfeiçoamento da modalidade.

REFERÊNCIA BIBLIOGRÁFICA:
REFERÊNCIAS
CATTEAU, R. e GAROFF, G. O Ensino da Natação. 2ª ed. São Paulo: Manole,
1990.
MAGILL, R. Aprendizagem motora – conceitos e aplicações. São Paulo: Edgard
Blucher, 2000.
SANTAREM, J. M. Hipertrofia muscular aptidão física, saúde e qualidade de
vida. São Paulo, 2002. Disponível em: saudetotal.com acesso em: 23 de
setembro de 2009.

________________________________________________________________
Tapetum¹: O Tapetum Lucidum (latim: Tapede brilhante) é a membrana
posicionada dentro do globo ocular de certos animais vertebrados, como cães e
gatos, capaz de refletir a luz que entra nos olhos e melhorar a visão do animal
em condições de baixa luminosidade.

Essa camada de células reflexivas é a responsável pelo brilho dos olhos desses
animais quando refletidos na luz durante a noite.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

110
UNISA - Universidade de Santo Amaro

Avaliação Comportamental de Puma concolor (Linnaeus, 1771)


cativo no Zoológico Municipal de Guarulhos utilizando Técnicas
de Enriquecimento Ambiental
FLAVIA REGINA SOUZA DE OLIVEIRA(1)

Ciências Biológicas
INTRODUÇÃO:
A contínua fragmentação dos habitats, a degradação de ecossistemas, a ação
predatória do ser humano por meio do abate e da captura, e a constante
ameaça à vida selvagem cooperam para que os felídeos selvagens corram alto
risco de extinção e tem deixado o cativeiro como uma das únicas opções para a
sobrevivência de várias espécies (OLIVEIRA, 1994; GENARO et al., 2001;
ADANIA et al., 2005). O cativeiro pode então exercer efeitos a longo, médio ou
curto prazo no comportamento dos animais. De maneira geral, os animais
passam a apresentar comportamentos não naturais a sua espécie,
denominados comportamentos anormais. O entediamento e o comportamento
estereotípico são bastante observados em animais cativos (BOSSO, 2008). A
estereotipia pode ser definida como um comportamento apresentado de
maneira exagerada e repetitiva que muitas vezes está associado ao tédio e as
disfunções comportamentais do animal (DANTZER E MORMED, 1983). O
cativeiro é caracterizado por alta densidade populacional, espaço limitado,
baixa pressão predatória, fácil acesso a comida e barreiras físicas inibindo a
dispersão e imigração (NEWBERRY, 1993). Uma das alternativas para a
conservação sadia da fauna e para melhorar a qualidade de vida de animais em
cativeiro é o enriquecimento ambiental que pode reduzir o estresse e ao mesmo
tempo aumentar o bem estar do animal e também propiciar aos animais a
possibilidade de expressarem comportamentos o mais próximo possível do
exibido em ambiente natural (HARE, 2000). O aumento de taxas reprodutivas, a
redução do estresse, a diminuição de distúrbios comportamentais, redução de
intervenções clínicas e da taxa de mortalidade são alguns benefícios do
enriquecimento ambiental (CARLSTEAD, 1994; SHEPHERDSON, 2000). Outra
grande importância do enriquecimento ambiental é no papel da conservação em
zoológicos, pois ele permite ao visitante observar os animais se comportando
naturalmente, deixando-o assim mais satisfeito e interessado, o que facilita
também a educação ambiental (BOSSO, 2008). A suçuarana é o segundo maior
felino do Brasil, de porte um pouco menor que a onça pintada. É um animal
solitário, terrestre e arborícola, de atividade crepuscular e noturna. Sua
distribuição geográfica estende-se do oeste do Canadá ao extremo sul do
continente sul-americano (exceto Andes). No Brasil ocorre em todas as regiões,

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

111
UNISA - Universidade de Santo Amaro

à exceção do sul do Rio Grande do Sul. Habita campos, florestas e montanhas


(EMBRAPA, 2008; NEX, 2008). Está presente na lista Oficial dos Mamíferos
Brasileiros Ameaçados de Extinção do IBAMA (Instituto Brasileiro do Meio
Ambiente e dos Recursos Naturais Renováveis).

OBJETIVO:
O presente trabalho teve como objetivo avaliar a influência das técnicas de
enriquecimento ambiental nos parâmetros comportamentais em um indivíduo de
suçuarana (Puma concolor) e verificar ocorrência da diminuição de
comportamentos estereotipados.

METODOLOGIA:
As observações foram divididas em três etapas: Pré-Enriquecimento (PRE),
Enriquecimento (DE) e Pós-Enriquecimento e totalizaram 90 horas onde os
comportamentos do animal foram registrados em uma ficha de campo
elaborada após a descrição do catálogo comportamental através do método de
amostragem animal focal com registro instantâneo com intervalo de um minuto.

RESUMO:
No comparativo das três etapas foi possível observar que no período da manhã
houve um declínio na expressão do comportamento Parado Inativo,
confirmando que quando é apresentado ao animal um aumento de chances de
escolha, o tempo de inatividade é reduzido. O comportamento Parado Ativo
apresentou significativo aumento comparando-se as fases de Pré e Pós-
Enriquecimento, este aumento pode ser atribuído ao fato de o animal
permanecer por mais tempo executando atividades consideradas naturais. O
pacing que é considerado um dos comportamentos que mais expressam a
condição de estresse de felinos mantidos em cativeiro, apesar de apresentar
aumento na fase de Enriquecimento, observou-se que no Pós-Enriquecimento
este comportamento praticamente não aparece. Houve um aumento gradual na
expressão co comportamento denominado Outros onde o animal passou a
apresentar comportamentos que não eram expressados, pode-se então
considerar que o enriquecimento ambiental proporcionou ao animal um
aumento do repertório comportamental.

CONCLUSÃO:
Os felinos interagem muito bem com odores e é através do olfato que
reconhecem se um objeto ou qualquer outra situação que lhes é apresentado é
ameaçador ou não.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

112
UNISA - Universidade de Santo Amaro

Neste estudo, foi possível observar que o animal reagiu muito bem ao
enriquecimento sensorial, diminuindo significativamente sua taxa de inatividade
entre as três etapas do estudo e aumentando o comportamento exploratório.
O comportamento pacing também obteve diminuição em sua expressão,
demonstrando que as técnicas de enriquecimento ambiental mostraram-se
eficazes na diminuição de comportamento estereotipado, porém, deve-se variar
a forma de realização do enriquecimento para tornar o cotidiano do animal mais
dinâmico e pouco previsível.
Estas respostas são importantes por indicarem uma possível melhora no bem
estar do animal, facilitando o manejo e tornando-o mais interessante para o
público podendo assim, incentivar as instituições a desenvolverem programas
de educação ambiental.

REFERÊNCIA BIBLIOGRÁFICA:
ADANIA, C. H., et al..2005. Studbook dos grandes felinos brasileiros. Livraria
Conceito. Jundiaí: 80 p.
BOSSO,P.L., 2008. Enriquecimento Ambiental. Disponível em
www.zoologico.sp.gov.br. Data de acesso: 28/11/2008.
CARLSTEAD, K..;SHEPHERDSON, D., 2000. Alleviating stress in zoo animals
with environmental enrichment. In: MOBERG, G.P.; MENCH, J.A. The Biology of
animal stress: basic principles and implications for animal welfare. CAB
International. Cap. 16, 337-354 p.
DANTZER, R., MORMED, P., 1983. The arousal properties of stereotypical
behavior. Applied Animal Ethology. Vol. 10, 233-244 p.
EMBRAPA (Empresa Brasileira de Pesquisa Agropecuária). Disponível em:
www.faunacps.cnpm.embrapa.br. Data de acesso: 16/12/2008.
GENARO, G., ADANIA, C.H., GOMES, M.S., 2001. Pequenos felinos brasileiros:
desconhecidos e ameaçados. Ciência Hoje. V.29. 34-39 p.
HARE, V.J., 2000. Environmental Enrichment Advancing Animal Care.
Universities Federation for Animal Welfare.
NEX (No extinction), Disponível em: www.nex.org.br. Data de acesso:
16/12/2008.
NEWBERRY, R. C., 1993. The space-time continnum and its relevance to farm
animals. Etologia, vol. 3, 219-234 p.
OLIVEIRA, T. G., 1994. Neotropical cats: Ecology and conservation. EDUFMA.
São Luís: 244p.

________________________________________________________________
Palavras chave: Comportamento; Enriquecimento Ambiental; Bem estar; Puma

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

113
UNISA - Universidade de Santo Amaro

concolor; Cativeiro; Estereotipado.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

114
UNISA - Universidade de Santo Amaro

Avaliação da degradação de corantes reativos da indústria têxtil


por quelantes de ferro produzidos por fungos basidiomicetos
JOSIE PARAIZO DE MELO(1)

VERA MARIA VALLE VITALI(2)(Orientadores)


Ciências Biológicas
INTRODUÇÃO:
1. INTRODUÇÃO

Diversos são os problemas ambientais que têm se agravado devido ao rápido


crescimento populacional e das atividades industriais. As conseqüências dessa
ação antrópica vêm tomando dimensões preocupantes, podendo ser notadas
através de alterações na qualidade do solo, ar e água.
A contaminação de águas naturais, sem dúvidas, tem sido um dos maiores
problemas da sociedade moderna. Segundo a Companhia de Saneamento do
estado de São Paulo (SABESP) em 2010, estima-se que a demanda de água
será superior a capacidade hídrica dos mananciais.
As indústrias têxteis são responsáveis pela geração de um alto volume de
resíduos recalcitrantes, entre eles os corantes, além da contaminação dos
recursos hídricos eles podem causar sérios problemas ambientais quando não
corretamente tratados.
Os efluentes têxteis caracterizam-se por serem altamente coloridos, devido à
presença de corantes que não se fixam na fibra durante o processo de
tingimento e são facilmente detectáveis a olho nu, mesmo em concentrações
tão baixas quanto 1ppm (1mg/L). Este fator apresenta vantagens e
desvantagens, pois uma pequena quantidade lançada de efluentes no ambiente
aquático pode causar acentuada mudança de coloração dos rios, e facilmente
detectada pela população.
O tratamento de efluentes têxteis torna-se assim uma prioridade, constituindo
um sério desafio à indústria têxtil e a organizações e empresas dedicadas ao
tratamento de águas residuais.
.
Há diversas formas de tratamento para os efluentes têxteis: físicos, químicos e
biológicos. A remoção de cor de efluentes utilizando técnicas físico-químicas
envolve coagulação, floculação e separação de líquidos e sólidos, que geram
bons resultados em corantes de enxofre e dispersivos. Todos esses processos
separam o corante da fase líquida, permanecendo e gerando altos volumes de
lodo necessitando de tratamento posterior.
Porém, a utilização dos processos tecnológicos para o tratamento de efluentes
não são muito eficientes ou apresentam um elevado custo, necessitando da
combinação de algumas metodologias complementares para se obter melhores

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

115
UNISA - Universidade de Santo Amaro

resultados.
Os microrganismos têm sido intensamente estudados com a finalidade de
remover compostos tóxicos do ambiente, e muitas pesquisas de degradação de
compostos químicos mostram vários microrganismos, entre eles alguns fungos,
extremamente versáteis em degradar substâncias recalcitrantes. A degradação
do efluente industrial depende de suas características químicas e de
microorganismos com aparatos metabólicos capazes de quebrar esses
compostos em moléculas menores. Os basidiomicetos são reconhecidos pelo
seu potencial em descolorir corantes têxteis. Além das enzimas ligninolíticas,
compostos de baixa massa molar, como mediadores e quelantes de ferro são
responsáveis pela descoloração.
Os quelantes de metais são compostos de baixa massa molar produzidos por
fungos e bactérias capazes de aumentar a disponibilidade de íons metálicos
para o metabolismo desses organismos. Os quelantes de ferro são os mais
estudados por aumentar a disponibilidade do Fe2+ íon, que se encontra
presente nos sítios ativos de muitas enzimas lignocelulolíticas, como lignina
peroxidase e manganês peroxidase no caso dos basidiomicetos.
O mecanismo de degradação dos compostos quelantes de íons férricos (Fe+3)
é de reduzi-los para íons ferrosos (Fe+2) que reagem com o peróxido de
hidrogênio (H2O2), em uma reação do tipo Fenton, produzindo radicais
hidroxilas, os quais são altamente oxidantes capazes de reagir tanto com a
lignina como com a celulose na parede celular. A vantagem é de proporcionar
reações redutoras de ferro estáveis permitindo a difusão do quelante e do H2O2
para o interior da parede celular da madeira, antes da reação produzir •OH, o
que protegeria a hifa fúngica dos efeitos deletérios do radical.

OBJETIVO:
2.OBJETIVO

Analisar a influência da mudança de pH para a faixa alcalina na produção de


quelantes de ferro nas diversas idades fisiológicas do fungo,simulando a
entrada do efluente têxtil no meio de cultura, e determinar a sua influência na
degradação dos corantes reativos utilizados na industria têxtil

METODOLOGIA:
3. MATERIAL E MÉTODOS
3.1. MATERIAL
3.1.1 Espécies fúngicas e meio de manutenção
Foram utilizadas as linhagens CCB 204 Peniophora cinerea e CCB 390 Trogia
buccinalis (Mont.) Pat. depositados na Coleção de Cultura de Basidiomicetos

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

116
UNISA - Universidade de Santo Amaro

(CCB) do Instituto de Botânica de São Paulo, mantidas em Extrato de Malte


Ágar 2% (MEA 2%) à 4°C.

3.1.2. Corantes sintéticos da indústria têxtil


Foram utilizados os corantes reativos: Cibacron Azul Brilhante H-GR, Cibacron
Vermelho FN-2BL e Cibacron Amarelo FN-2R.

3.1.3. Meio de Cultura - Extrato Malte 2% (ME 2%): em 1 litro de água destilada,
20 g de extrato de malte, 20 g de glicose e 1 g peptona bacteriológica (pH final
5).

3.2. MÉTODOS
3.2.1 Determinação do pico de máxima absorção
Para obter o pico de Max. de absorção para os corantes, preparou-se:0,01%
de cada corante e fez-se varredura no espectro no intervalo de onda de 400-
700nm.

3.2.2. Inoculação e cultivo dos fungos


Os fungos foram inoculados com seis discos de 5 mm de diâmetro com
crescimento micelial de 7 dias de incubação, em frascos de erlenmeyer de 500
mL com 100 mL de meio extrato de malte 2% (ME 2%) e incubados a 25°C no
período de 28 dias .Durante esse período, em intervalos de 7, 14, 21 e 28 dias,
lotes de três frascos inoculados tiveram o pH alterado entorno de 8,5 com
solução de hidróxido de sódio (NaOH) 2N. Antes e após a adição NaOH 2N, em
intervalos de 24, 48 e 72hs de incubação, alíquotas de 4 mL foram retiradas
para o monitorado de pH, produção de quelantes de ferro e enzimas oxidases e
peroxidases. Após a análise de 72hs, cada frasco de cultivo foi filtrado em papel
de filtro comum e o sobrenadante foi congelado para análises posteriores de
degradação de corante. Como controle abiótico foi utilizado meio de cultura sem
inóculo e controle fúngico meio inoculado e incubado por 28 dias sem alteração
de pH.
3.2.3 Parâmetros monitorados:
3.2.3.1. pH
Alíquotas de extratos livres de micélio foram utilizadas para determinar o pH.
3.2.3.2. Atividade de Peroxidase foi avaliada pelo aumento de absorbância
durante a oxidação do ABTS a 420 nm. A reação (em 1 mL) constituída de: 0,6
mL de extrato enzimático, 0,25 mL de tampão citrato-fosfato 50 mM, pH 4; 0,05
mL de peróxido de hidrogênio; e 0,1 mL de ABTS 5 mM.
3.2.3.3. Atividade de Oxidase
A atividade de oxidase foi avaliada utilizando a mesma metodologia descrita no
item 3.2.3.2, substituindo os 0,05 mL de peróxido de hidrogênio por água milliq.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

117
UNISA - Universidade de Santo Amaro

3.2.3.4 Detecção de compostos quelantes de ferro


Ensaio quantitativo de compostos quelantes de ferro foi determinado na
competição por ferro entre o complexo férrico do corante indicador Cromo
Azurol S (CAS) e de um quelante produzido pelo fungo.
3.2.3.4.5. Preparo da vidraria
Para remover traços de metais toda a vidraria foi mantida de molho em solução
de HCL 6M por uma noite, sendo em seguida enxaguada com água deionizada.
3.2.3.4.6. Solução de Cromo Azurol S (CAS)
A solução CAS foi preparada com 1,5 mL de FeCl3.6H2O 1 mM em solução de
HCl 10 mM e adicionado 7,5 mL de solução CAS a 2 mM. Em seguida, com
agitação baixa e constante, adicionou- se lentamente solução HDTMA
(Hexadeciltrimetilamonio) preparada com 6 mL de HDTMA 10 mM e acrescido
de 10 mL de água milliq. Em outro balão volumétrico de 100 mL foi colocado
4,307 g de piperazina anidra com 40 mL de água milliq e o pH foi ajustado para
5,6 com HCl concentrado. Adicionou a solução de CAS ao balão volumétrico,
mantendo agitação constante, e ajustou o volume para 100 mL com água milliq.
3.2.3.4.7. Ensaio da produção de quelantes de ferro
Um (1,0) mL do extrato fúngico foi misturado com 1,0 mL de solução de CAS,
incubados por 1 hora em temperatura ambiente, em seguida foram
determinadas as absorbâncias da amostra em espectro a 630 nm. O controle
negativo foi preparado com meio de cultura não-inoculado. A porcentagem de
quelantes produzidos foi calculada comparando a amostra com o controle
negativo.

3.2.3.8. Obtenção da fração de baixa massa molar


Os extratos das réplicas dos fungos foram colocados em um só frasco e
congelados, liofilizados, ressuspenso a 10% de seu volume inicial com água
MilliQ e ultrafiltrado em filtro de centrífuga com corte de 5 KDa a 3960 rpm por
100 min a 25ºC. O filtrado obtido foi conservado na geladeira enquanto
procediam-se os ensaios de descoloração dos corantes reativos da indústria
têxtil.
3.2.3.9. Degradação in vitro dos corantes reativos pela fração de baixa massa
molar que contém quelantes de ferro.
Cada corante reativo a 0,01% foi misturado à FBMM e incubado por 72 horas a
25°C. A descoloração dos corantes reativos foram avaliadas em intervalos de
24 horas, retirando da mistura reacional alíquotas de 0,1mL, diluídas 10 vezes
com água MiiliQ e analisadas pelas razões entre as absorbâncias determinadas
para cada corante e pelo espectro de absorção do efluente na região visível da
luz (400 -700nm). Como controle foi utilizado frasco não inoculado.

RESUMO:

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

118
UNISA - Universidade de Santo Amaro

4. RESULTADOS E DISCUSSÃO

A maioria dos processos biotecnológicos utilizando fungos basidiomicetos


baseia-se em seus produtos metabólicos, como enzimas e polissacarídeos. A
importância do aparato enzimático destes fungos está diretamente relacionada
com a bioconversão de resíduos lignocelulósicos em processos de
biorremediação de solos contaminados e no tratamento de efluentes das
indústrias papeleiras e têxteis.

Para os estudos de degradação de corantes têxteis, um dos parâmetros


importantes para ser avaliado é o comportamento dos fungos em pH alcalino,
característica do efluente têxtil e que possui grande influência sobre o
metabolismo desses organismos. Para isso foi avaliado o crescimento dos
fungos P. cinerea e T. buccinalis em meio extrato de malte 2% durante 28 dias
de incubação, e em intervalos de 7 dias foram alterados o pHs dos meios para
8,5 simulando o estresse alcalino proporcionado pelo efluente têxtil em
diferentes idades fisiológicas. Nesta situação foi possível observar a influência
do choque de pH quanto a atividade dos quelantes, das enzimas e de sua
capacidade em degradar os corantes têxteis.

No controle abiótico observou-se que o meio extrato de malte possui o pH em


torno de 5. Quando seu pH foi alterado para 8,5 com NaOH, o meio acidificou
em 48 horas devido ao tamponamento proporcionado pela matéria orgânica
existente em sua formulação. Com o envelhecimento do meio, observou-se que
o pH permaneceu próximo de 7.

Com o crescimento de P. cinerea e T. buccinalis, nos meios sem alteração do


pH, estes permaneceram na faixa de 4,5.
Nos meios com estresse alcalino P. cinerea nos cultivos com 7 e 14 dias
conseguiu acidificar o meio logo após a alteração do pH por NaOH, nos cultivos
com 21 e 28 dias necessitava de 24 horas para acertar o pH para o seu ótimo
metabólico. Já T. buccinalis necessitou de 24 horas para ajustar seu pH na
faixa ácida não importando a idade fisiológica. A capacidade em acidificar o
meio é decorrente da produção de ácidos orgânicos que são formados por meio
do metabolismo de açúcares e assim controlam o pH para seu ótimo de
crescimento e metabolismo.
Os dois fungos estudados são produtores de exsudados coloridos, que
durante o tempo de incubação vão tornando o meio de cultivo mais escuro para
o tom castanho. Esses exsudados prejudicaram as leituras das porcentagens
de unidade de CAS, porém, a adição de NaOH para produzir o estresse
alcalino, facilitou a leitura desta análise, possivelmente atuando na diminuição
da cor do exsudado no meio.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

119
UNISA - Universidade de Santo Amaro

Nos cultivos de P. cinerea, sem alteração de pH, a leitura de % de Cas foi só


possível na primeira semana de cultivo produzindo em torno de 45% de CAS.
Nos tratamentos com estresses alcalino observou-se a ação dos quelantes de
ferro em todo o período de cultivo, mas as maiores porcentagens obtidas foram
nas primeiras semanas. Com 7 dias de cultivo, após dois dias do estresse,
observou-se 60% de CAS, com 14 dias de incubação, após 24 horas do
estresse, observou-se no cultivo 70% de CAS que se manteve durante os
demais dias de monitoramento. Com o envelhecimento do cultivo observou-se
uma baixa recuperação na atividade dos quelantes após a alcalinização,
variando entre 10 a 20% de CAS e diminuindo na última semana do cultivo.
Em ambientes com pHs mais baixos favorecem a redução de ferro e a
produção de quelantes, e os nossos resultados mostram que a variação do pH
para alcalino não inativa a ação dos quelantes, visto que P. cinerea acidificou o
pH em torno de 4 em 24 horas nas idades fisiológicas de 7 e 14.
T. buccinalis cultivado no controle positivo apresentou o mesmo
comportamento de P. cinerea, a produção de exsudado impossibilitou a leitura
no espectrofotômetro. Apenas com 14 dias de incubação observou-se a ação
dos quelantes em torno de 30% de CAS. Os resultados mostram que T.
buccinalis, ao contrario de P. cinerea, apresentou atividade dos quelantes sobre
o corante, logo após o estresse alcalino. .
T. buccinalis apresentou predominância da atividade de peroxidases. As
oxidases apresentaram atividade baixa, variando entre 1 a 5 U/L.

A atividade de peroxidases durante o experimento variou de 400 a 1000 U/L


apresentando pico de atividade de 1600 U/L com 30 dias de incubação. Com o
estresse alcalino a atividade diminuiu em torno de 400 U/L com 7 e 14 dias de
incubação, reduzindo sua atividade em torno de 17% e comparando com o pico
de atividade, 30 dias de incubação, a redução foi de 45%, mostrando a
influência da idade fisiológica na recuperação da atividade.
P. cinerea também apresentou baixa atividade de oxidase, que variou entre 0
a 39 U/L durante o cultivo no meio controle. Com o estresse alcalino, não
recuperou a atividade. Enquanto no controle no intervalo de 14 a17 dias de
incubação observa-se o pico de atividade variando entre 25 a 38 U/L, o choque
de pH desativou a enzima.
A atividade de peroxidase variou de 0 a 200 U/L durante o cultivo no meio
controle, apresentaram vários picos de atividade com: 22 (185 U/L) e 30 (221
U/L) dias de incubação. Com a alteração do pH, nas diversas idades
fisiológicas, apenas o cultivo com 7 dias de incubação conseguiu recuperar a
atividade após 48 horas do choque de pH, nos demais períodos a atividade não
ultrapassou a 41 U/L , mostrando que o cultivo novo é capaz de absorver o
estresse alcalino e manter a atividade de peroxidase.
A degradação dos corantes pelas frações de baixa massa molar, com e sem

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

120
UNISA - Universidade de Santo Amaro

estresse alcalino, obtido por T. buccinalis e P. cinerea , variou de acordo com o


corante. As FBMM, que contém os quelantes de ferro, em todas as idades
fisiológicas, foram capazes de degradar o corante azul brilhante H-GR. A
degradação foi constatada pela inclinação na linha das razões entre as
absorbâncias do corante nos dois tratamentos e nas diferentes idades
fisiológicas.
A degradação de corantes pode ser monitorada durante o cultivo do fungo em
meio líquido, através da razão entre dois comprimentos de onda característicos
do corante, neste caso 630 e 500nm. Quando o metabolismo fúngico obtém
alguma modificação na molécula do corante, como a retirada de um radical, ou
a quebra em duas novas moléculas, ocorre uma mudança na absorbância do
pico característico do corante e as razões formam uma reta inclinada ao longo
do tempo. Quando as razões apresentam-se constantes, pode-se inferir que
não houve degradação.
A degradação do corante azul brilhante H-GR foi confirmada pelos valores de
descoloração. Os tratamentos com as frações obtidas nos cultivos de T.
buccinalis obtiveram % de descoloração variada em cada idade fisiológica: 7
dias sem estresse – 43,82%; 14 dias com estresse – 37,58% e 28 dias sem
estresse alcalino 12,02%. P. cinerea também apresenta porcentagens de
descoloração variando com a idade de cada tratamento: 7 dias com estresse-
42,52%; 14 dias com estresse - 27,75% e 28 dias sem estresse - 25,16%.
Para os corantes amarelo e vermelho não foi constatada degradação e nem
descoloração com a reação com a FBMM de T. buccinalis e P. cinerea.
As recalcitrâncias dos corantes vermelho FN-2BL e amarelo FN-2R devem-se a
suas estruturas moleculares classificadas como corantes azos e o azul brilhante
HG-R classifica-se como antraceno., molécula mais simples comparada com as
dos outros dois corantes.

CONCLUSÃO:
5. CONSIDERAÇÕES FINAIS
Os resultados obtidos neste trabalho constatou que a produção de quelantes de
ferro não foi inibida pelo estresse alcalino nos dois fungos, entre tanto, a
atividade enzimática é diminuída, e influenciará negativamente na descoloração
dos corantes quando se pensa no metabolismo todo atuando sobre o efluente.
Esses resultados indicam que para a utilização desses fungos em um processo
de tratamento de efluentes de têxteis é fundamental a manutenção da cultura
jovem no processo para garantir uma maior eficiência no processo de
degradação do efluente.

REFERÊNCIA BIBLIOGRÁFICA:

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

121
UNISA - Universidade de Santo Amaro

6.REFERÊNCIAS BIBLIOGRÁFICAS

BOURBONNAIS, R. & PAICE, M.G. 1988. Veratryl alcohol oxidases from the
lignin- degrading basidiomete Pleurotos sajor- caju. Biochemical Journal 255:
445- 450.
GLENN, P.K. & GOLD, M.H. 1983. Decolorization of Several Polymeric Dyes by
Lignin-degrading Basidiomycete Phanerochaete chrysosporium. Applied and
Envoironmental Microbiology, v. 45, f. 6, pp. 1741-1747.

KUNZ, A., PERALTA-ZAMORA, P., MORAES, S.G., DURÁN, D. 2002. Novas


tendências no tratamento de efluentes têxteis. Química Nova 25: 78-82.

________________________________________________________________
Sem notas de rodapé

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

122
UNISA - Universidade de Santo Amaro

AVALIAÇÃO DO POTENCIAL FITOTÓXICO DE EXTRATOS DE


ZINGIBER SPECTABILIS GRIFF. (ZINGIBERACEAE)
RAFAEL VICENTE DOS SANTOS(1)

MARCO AURELIO SIVERO MAYWORM(2)(Orientadores)


Ciências Biológicas
INTRODUÇÃO:
1. Introdução

1.1. Considerações gerais

As plantas e sua biodiversidade já geraram imensos benefícios diretos ao


homem, e esse potencial tem sido cada vez mais valorizado pelos meios
acadêmico e industrial (EHRLICH & WILSON, 1991; FERRO et al., 2006). Na
agricultura, o controle de plantas daninhas com herbicidas é uma prática
comum (VARGAS et al., 1999). Só o mercado mundial de herbicidas
movimentou 15 bilhões de dólares em 1997 (GRIMES, 1998).
Todavia, a exposição humana a herbicidas químicos configura um grave
problema de saúde pública em todo o mundo (OMS, 1990; KOH &
JEYARATNAM, 1996; KONRADSEN et al., 2003), além de drásticos impactos e
prejuízos ambientais (TOMITA & BEYRUTH, 2002; WASWA et al., 2002).
Portanto, há motivos mais que suficientes para se estudar alternativas eficazes
para substituição desses produtos químicos. Nesse sentido, inúmeros estudos
estão sendo realizados com respeito à alelopatia para o manejo e controle de
ervas daninhas (DURIGAN & ALMEIDA, 1993).

1.2. Alelopatia

Potencial alelopático, a princípio, refere-se à habilidade que uma planta tem de


inibir o desenvolvimento de outras plantas e microorganismos. De fato, o termo
alelopatia foi criado por MOLISCH (1937) e vem do grego Allelon (de um para
outro) e Pathós (sofrer). O efeito é realizado por biomoléculas chamadas
“aleloquímicos”, produzidas pelas plantas e lançadas por estas no ambiente
(RIZVI & RIZVI, 1992). Alelopatia foi definida por RICE (1984) da seguinte
forma: “qualquer efeito direto ou indireto, danoso ou benéfico que uma planta
exerce sobre outra pela produção de compostos químicos liberados no
ambiente”. Tais substâncias são em sua maioria provenientes do metabolismo
secundário das plantas (WALLER, 1999).
Tem havido atualmente um largo interesse por se conhecer e explorar os
compostos secundários das plantas para o desenvolvimento de novos
herbicidas, pesticidas, estimulantes e reguladores de crescimento (EINHELLIG,

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

123
UNISA - Universidade de Santo Amaro

1995). A atividade dos aleloquímicos já tem sido utilizada como alternativa para
os agrotóxicos. Na África do Sul, por exemplo, restos de pinheiro (Pinus patula),
eucalipto (Eucalyptus grandis) e acácia (Acacia mearnsii) foram usados contra
uma série de invasoras como buva (Conyza sumatrensis), trevo-dos-prados
(Trifolium sp.) e capim-quicé (Echinochloa utilis) (SCHUMANN et al., 1995). No
México, a incorporação ao solo de restos de bétula (Betula erecta), junco
(Juncus sp.) e alno (Alnus firmifolia) resultou em inibição aleloquímica contra as
invasoras pé-de-ganso (Chenopodium murale), trevo-de-cheiro (Melilotus
indicus), caruru-roxo (Amaranthus hybridus) e tradescância (Tradescantia
crassifolia) (ANAYA et al., 1987).
CHOU & KUO (1986) observaram que onde havia espécies de Leucena
(Leucaena leucocephala), poucas plantas invasoras cresciam; e extratos da
planta foram fitotóxicos tanto para espécies lenhosas quanto para herbáceas. A
incorporação ao solo de raízes e folhas em decomposição de joão-brandinho
(Piper sp.) e taquara (Olyra micrantha) inibiu o crescimento de plântulas de
alface, mostrando claramente que restos de vegetação (serrapilheira) podem
também ter efeito alelopático (BORGES et al., 1994).
Por outro lado, a alelopatia pode também representar algum problema para o
agricultor. A prática da “rotação de culturas” em agricultura é bastante difundida
no Brasil: em uma época do ano é plantada uma cultura e, em outra época,
outra cultura, de modo a não esgotar os recursos nutricionais do solo. No
entanto, este procedimento, por sinal muito recomendado, tem limitações, pois,
restos da cultura anterior incorporados ao solo podem desempenhar função
alelopática. Logo, dependendo da cultura subsequente, os efeitos podem ser
bastante prejudiciais, com diminuição acentuada do crescimento e da
produtividade (FERREIRA & AQUILA, 2000). Exemplificando, os restos da
cultura de trigo (Triticum sp.) retardaram o crescimento das plantas de algodão
(Gossypium sp.) (HICKS et al., 1989).
Já foi mencionado que o efeito da alelopatia é gerado por aleloquímicos e que a
maioria dessas substâncias é proveniente do metabolismo secundário das
plantas. Os terpenos, os fenóis e os compostos nitrogenados formam as três
principais classes de metabólitos secundários (TAIZ & ZEIGER, 1998). E dentre
esses compostos, os mais diretamente ligados à alelopatia são os terpenos e
fenóis (INDERJIT & DUKE, 2003). Ainda acerca dos terpenos: a subclasse dos
monoterpenos, constituintes frequentes dos óleos essenciais, está mais
diretamente ligada com os efeitos inibitórios (HARBORNE, 1980; RICE, 1984).

1.3. A família Zingiberaceae

A família Zingiberaceae é formada por 50 gêneros e 1100 espécies, originárias


das regiões asiáticas, das florestas tropicais e subtropicais, ocorrendo
preferencialmente em áreas sombreadas, ocasionalmente em terrenos mais

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

124
UNISA - Universidade de Santo Amaro

úmidos. É representada por plantas herbáceas perenes, aromáticas,


geralmente com rizomas dos quais nascem caules aéreos que transportam
folhas com larga bainha na base, envolvendo o caule (VIMALA et al., 1999;
SCHIMIDT, 2000). No Brasil, ocorre apenas um gênero: Renealmia, com 17
espécies, sendo a maioria nativa da Amazônia (SOUZA & LORENZI, 2005).
Algumas plantas da família são utilizadas desde a antiguidade como plantas
medicinais, como o gengibre (Zingiber officinale) cujo princípio ativo apresenta
ações estimulante, digestiva e antimicrobiana, contra a rouquidão e inflamação
da garganta, além de ser anti-reumática e antitrombótica (LORENZI & MATOS,
2002); e o açafrão (Curcuma longa L.), que possui propriedades anti-
hepatotóxica , antiinflamatória e hipoglicemiante e é utilizada para tratamento
de cálculo biliar e icterícia (LORENZI & MATOS, 2002).
Zingiber spectabilis Griff., conhecida popularmente por “sorvetão”, é uma planta
herbácea e aromática, adaptada às regiões tropicais e subtropicais, com folhas
alternas, de nervação paralelo-pinada, lâmina bem desenvolvida e larga bainha
na base, envolvendo o caule (VIMALA et al., 1999); as flores são protegidas por
brácteas vistosas de cor amarela com formato de uma colméia e, por causa
desta aparência e pela longa durabilidade, são muitas vezes cultivadas como
ornamentais (ZOGHBI et al., 2001).
Os óleos voláteis das inflorescências de Zingiber spectabilis são ricos em
&#946;-felandreno (45,3%), &#945;-pineno (13,4%), substância com
comprovada atividade fitotóxica (RANA DEVI et al., 1997) e &#946;-pineno
(11%). Os óleos voláteis de inflorescências são qualitativamente similares para
as folhas e hastes, mas as porcentagens são completamente diferentes, sendo
&#945;-pineno e &#946;-pineno os principais componentes de óleos voláteis
das folhas e hastes (VAHIRUA-LECHAT et al., 1996).

OBJETIVO:
2. Objetivos

Estudar o potencial fitotóxico dos extratos etanólicos obtidos a partir de folhas,


caule e brácteas jovens e maduras de Zingiber spectabilis Griff. sobre a
germinação e crescimento de plântulas de alface (Lactuca sativa L.).

METODOLOGIA:
3. Materiais e métodos

3.1 Materiais

Amostras de folhas, inflorescências (jovens e maduras) e rizomas de Zingiber

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

125
UNISA - Universidade de Santo Amaro

spectabilis Griff. Foram coletadas em população livre de agrotóxicos em


propriedade particular no bairro de Parelheiros, na zona sul da capital de São
Paulo. Amostras testemunhas foram coletadas, herborizadas e depositadas no
herbário da Universidade de Santo Amaro – UNISA em São Paulo.

3.2. Métodos

3.2.1 Produção de extratos

As amostras de folhas foram fragmentadas e submersas em etanol 99,5°GL,


sendo agitadas diariamente e o solvente trocado a cada sete dias, perfazendo
um total de 28 dias de extração. Após a primeira extração (7º dia), o material foi
triturado em liquidificador e, em seguida, submerso novamente em etanol
99,5°GL. Após o 28º dia, foi realizada a quarta e última extração a frio. As
extrações foram feitas à temperatura ambiente e protegidas da luz, a fim de
evitar a fotooxidação dos compostos. Os filtrados obtidos foram reunidos,
constituindo o extrato etanólico bruto que foi concentrado sob pressão reduzida
em rotaevaporador a 45°C, e conservado em geladeira a uma temperatura entre
4 e 8°C (RESCHKE et al., 2007).. Todas as etapas do processo de extração
foram repetidos para as inflorescências jovens e maduras e rizomas

3.2.2 Testes de ação alelopática

Os testes de ação alelopática dos extratos de Zingiber spectabilis Griff. foram


desenvolvidos segundo MURAKAMI et al. (2009) e em triplicatas. Em discos de
papel filtro com 9 cm de diâmetro, foram depositados 4mL de extrato de
maneira uniforme. Para efeito de controle, em outros discos de mesmo diâmetro
foram depositados 4mL de etanol 99,5°GL. Os discos impregnados foram
mantidos por 24 horas em um dessecador para que o extrato pudesse secar e
ser absorvido pelo papel filtro. Após esse período, os discos de papel filtro
foram depositados em placas de Petri (diâmetro 9 cm) previamente
esterilizadas. Em cada placa foram acrescentados 4mL de água destilada e,
após quatro horas, foram depositados 20 aquênios de alface (Lactuca sativa L.).
As placas foram vedadas com papel filme (PVC) e mantidas em ambiente com
iluminação constante e temperatura ambiente por um período de cinco dias. A
porcentagem de germinação e índice de velocidade de germinação (IVG) foram
avaliados a cada dia, e no último dia foram medidos ainda os comprimentos do
eixo hipocótilo-radicular das plântulas de alface.

RESUMO:
4. Resultados e discussão

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

126
UNISA - Universidade de Santo Amaro

Os extratos reduziram expressivamente o índice de IVG e o crescimento das


plântulas, embora não tenham afetado a taxa final de germinação (em torno de
90%). De fato, segundo FERREIRA & AQUILA (2000), as plântulas em
crescimento são mais sensíveis a aleloquímicos que os aquênios durante a
germinação, pois, as substâncias alelopáticas podem estimular o aparecimento
de plântulas anormais, sendo a necrose da radícula um dos sintomas mais
comuns. Os extratos de brácteas jovens, brácteas maduras e caule mostraram
maior toxicidade sobre o crescimento do eixo hipocótilo-radicular das plântulas
de alface (5mm, 9mm e 10mm, respectivamente).

CONCLUSÃO:
Todos os extratos foram fitotóxicos para as plântulas de alface.
Os extratos reduziram o crescimento das plântulas, embora não tenham
interferido na germinabilidade.

REFERÊNCIA BIBLIOGRÁFICA:
5. Bibliografia

ANAYA, A.L.; RAMOS, L.; CRUZ, R.; HERNANDEZ, J.G.; NAVA, V. 1987.
Perspectives on allelopathy in mexican tropical agroecosystems: a case study in
Tlaxcala. Journal of Chemical Ecology 13: 2083-2101.

BORGES, E.E.L.; SILVA, G.F.; LOPES, E.S. 1994. Avaliação de substâncias


alelopáticas em vegetação de uma floresta secundária. Revista Árvore 18: 275-
286.

CHOU, C.H.; KUO, Y.L. 1986. Allelopathic research of subtropical vegetation in


Taiwan. III. Allelopathic exclusion of understory by Leucaena leucocephala
(Lam.) de Wit. Journal of Chemical Ecology 12: 1431-1448.

DURIGAN, J.C.; ALMEIDA, F.L.S. 1993. Noções sobre a alelopatia. FUNEP.


Jaboticabal.

EHRLICH, P.R.; WILSON, E.O. 1991. Biodiversity studies: science and policy.
Science 253: 758-762.

EINHELLIG, F.A. 1995. Allelopathy: current status and future goals. In:
Allelopathy: organisms, processes and applications (INDERJIT; DARKSHINI,
K.M.M.; EINHELLIG, F.A. eds.). American Chemical Society. Washington.

FERREIRA, A.G.; ÁQUILA, M.E.A. 2000. Alelopatia: uma área emergente da

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

127
UNISA - Universidade de Santo Amaro

ecofisiologia. Revista brasileira de fisiologia vegetal 12 (edição especial): 176-


204.

FERRO, A.F.P.; BONACELLI, M.B.M.; ASSAD, A.L.D. 2006. Oportunidades


tecnológicas e estratégias concorrenciais de gestão ambiental: o uso
sustentável da biodiversidade brasileira. Gestão e Produção (UFSCAR) 13: 489-
501.

GRIMES, A. 1998. World agrochemical markets. Agrow Reports. Richmond.

HARBORNE, J.B. 1980. Plant phenolics. In: Secondary Plant Products (BELL,
E.A.; CHARLWOOD, B.V. eds.). Springer-Verlag. Berlin.

HICKS, S.K.; WENDT, C.W.; GANNAWAY, J.R.; BAKER, R.B. 1989.


Allelopathic effects of wheat straw on cotton germination, emergence and yield.
Crop Science 29: 1057-1061.

INDERJIT; DUKE, S.O. 2003. Ecophysiological aspects of allelopathy. Planta


217: 529-539.

KOH, D.; JEYARATNAM, J. 1996. Pesticide hazards in developing countries.


The Science of the Total Environment 188: 78-85.

KONRADSEN, F.; HOEK, W. COLE, D.C.; HUTCHINSON, G. DAISLEY, H.;


SINGH, S. EDDLESTON, M. 2003. Reducing acute poisoning in developing
countries: options for restricting the availability of pesticides. Toxicology 192 (2-
3): 249-261.

LORENZI, H.; MATOS, F.J.A. 2002. Plantas medicinais no Brasil: nativas e


exóticas cultivadas. Instituto Plantarum. Nova Odessa.

MOLISCH, H. 1937. Der einfluss einer pflanze auf die andere allelopathie.
Fischer. Jena.

MURAKAMI, C.; CARDOSO, F.L.; MAYWORM, M.A.S. 2009. Potencial fitotóxico


de extratos foliares de Aloe arborescens Miller (Asphodelaceae) produzidos em
diferentes épocas do ano. Acta Botanica Brasilica 23 (1): 111-117.

OMS - ORGANIZAÇÃO MUNDIAL DA SAÚDE. 1990. Public health impact of


pesticides used in agriculture. WHO/UNEP. Geneva.

RICE, E.L. 1984. Allelopathy. 2ªed. Academic Press. Nova Iorque.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

128
UNISA - Universidade de Santo Amaro

RIZVI, S.J.H.; RIZVI, V. 1992. Explotation of allelochemicals in improving crop


productivity. In: Allelopathy: Basic and applied aspects (RIZVI, S.J.H.; RIZVI, H.
eds.). Chapman & Hall. Londres.

RANA DEVI, S.; PELLISSIER, F.; PRASAD, M.N.V. 1997. Allelochemicals. In:
Plant ecophysiology (PRASAD, M.N.V. ed.). John Wiley & Sons. Nova Iorque.

RESCHKE, A.; MARQUES, L.M; MAYWORM, M.A.S. 2007. Atividade


antibacteriana de Ficus banjamina L. (Moraceae). Revista Brasileira de Plantas
Medicinais 9 (2): 67-70.

SCHUMANN, A.W.; LITTLE, K.M.; ECCLES, N.S. 1995. Supression of seed


germination and early seedling growth by plantation harvest residues. South
African Journal of Plant and Soil 12: 170-172.

SHIMIDT, D.F.N. 2000. Estudo químico, farmacológico e biológico dos rizomas


de Curcuma zedoaria (Zingiberaceae). Dissertação (mestrado), Universidade
Federal de Santa Catarina, Florianópolis.

SOUZA, V.C.; LORENZI, H. 2005. Botânica sistemática: guia ilustrado para


identificação das famílias de Angiospermas da flora brasileira, baseado em APG
II. Instituto Plantarum. Nova Odessa.

TAIZ L.; ZEIGER, F. 1998. Plant physiology. The Bejamin/Cumming publishing.


Redwood City.

TOMITA, R.Y.; BEYRUTH, Z. 2002. Toxicologia de agrotóxicos em ambiente


aquático. Biológico 64 (2): 135-142.

VAHIRUA-LECHAT; MENUT, C.; LAMATY, G.; BESSIERE, J.M. 1996. Aromatic


plants of French Polynesia. II. Composition of the essential oils of Zingiber
spectabilis Griff. J. Essent. Oil. Res. 8: 671-673.

VARGAS, L.; SILVA, A.A.; BORÉN, A. FERREIRA, F.A.; SEDYIAMA, T. 1999.


Histórico e mecanismos. In: Resistência de plantas daninhas a herbicidas
(VARGAS, L.; SILVA, A.A.; BORÉN, A. FERREIRA, F.A.; SEDYIAMA, T. eds.).
JARD Produções Gráficas. Viçosa.

VIMALA, S.; NORHANOM, S. V. & YADAV, M. 1999. Anti-tumor activity in


malaysian Ginger rhizobia used in traditional medicine. Br. J. Cancer. 80: 110-
116.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

129
UNISA - Universidade de Santo Amaro

WALLER, G.R. 1999. Introduction. In: Recent advances in allelopathy (MACIAS,


F.A.; GALINDO, J.C.G.; MOLINILLO, J.M.G.; CUTLER, H.G. eds.). Servicio de
Publicaciones de la Universidad de Cádiz. Cádiz.

WASWA, F.; GACHENE, C.K.K.; EGGERS, H. 2002. Assessment of erosion


damage in Ndome and Ghazi, Taita Taveta, Kenya: towards an integrated
erosion management approach. GeoJournal 56 (3): 201-212.

ZOGHBI, M.G.B.; MAIA, J.G.S.; ANDRADE, E.H.A. 2001. Aroma de flores na


Amazônia. Museu paraense Emilio Goeldi. Belém.
________________________________________________________________
Não há notas.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

130
UNISA - Universidade de Santo Amaro

Busca de inibidores para proteína antioxidante Ohr (Organic


Hydroperoxide Resistance Protein) de Xylella fastidiosa (Wells et
al., 1987)
NÁDILA MAGALHAES MILLAN(1)

LUIS EDUARDO SOARES NETTO(2)(Orientadores)


Ciências Biológicas
INTRODUÇÃO:
Radicais livres são moléculas com pelo menos um elétron desemparelhado em
sua órbita externa, estes podem ser produzidos nos organismos vivos, pela
transferência de elétrons, por meio de óxido-redução. Devido algumas espécies
não serem radicalares, como o peróxido de hidrogênio (H2O2), o oxigênio
singlete e os peróxidos orgânicos, utiliza-se o termo “espécies reativas de
oxigênio” (ROS - Reactive Oxygen Species). ROS são gerados em processos
da respiração mitocondrial, oxidação de lipídeos, metabolismo de poluentes e
medicamentos. Também há produção de ROS pelos cloroplastos, através do
processo de fotossíntese e, produção de H2O2 por peroxissomos, no processo
de fotorrespiração.
A formação de ROS é iniciada a partir do oxigênio molecular por etapas de
redução univalente, primeiramente a redução de O2 produz radical anion
superóxido (O2•-) que não consegue atravessar a membrana plasmática. Após
redução de O2•-, peróxido de hidrogênio (H2O2) é gerado e este por poder
atravessar as membranas, pode agir como molécula sinalizadora na defesa de
plantas. A redução acarreta a perda de mais um elétron de H2O2 e gera a ROS
mais reativa que é o radical hidroxila (•OH). As ROS induzem processos como a
oxidação de biomoléculas, como proteínas, lipídeos, ácidos nucléicos e
carboidratos, mudando as funções biológicas de tais moléculas.
Ao ser invadida por patógenos, como bactérias, as plantas desenvolvem vários
processos de defesa, entre os quais está o oxidative burst, processo no qual
ocorre a geração de espécies reativas de oxigênio, ROS, em grande
quantidade, causando um estresse oxidativo, ou seja, um desequilíbrio celular
onde há uma quantidade maior de oxidantes do que de antioxidantes. Este
processo ocorre através da ativação de componentes de oxidases, pré-
existentes no sistema vegetal, principalmente o mecanismo de ativação da
NADPH oxidase.
As células vegetais são aptas a produção de ROS, principalmente H2O2,
sendo esta produção regulada por luz, hormônios ou ferimentos. O H2O2
possui efeito antifúngico e antibacteriano, sendo tóxico à patógenos. Este
desempenha um papel fundamental na resposta de hipersensibilidade de
plantas, em relação a infecção por patógenos, tal defesa se trata de um

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

131
UNISA - Universidade de Santo Amaro

processo em que a invasão de patógenos incita o colapso das células do


hospedeiro.
Xylella fastidiosa é uma bactéria gram-negativa, não flagelada, de 0,1 a 0,3 ×
1,5 µm de tamanho, e seus patótipos geram várias doenças em plantas de
importância agrícola. Tais doenças são caracterizadas como emergentes, por
representarem uma ameaça ao continente americano, em regiões tropicais e
subtropicais, entre estas doenças há a Clorose Variegada dos Citros (CVC), a
qual surgiu pela primeira vez em 1980 no sul da América do Sul, registrada pela
primeira vez no Brasil em 1987.
Resultados de estudos demonstram que X. fastidiosa causa perturbações no
metabolismo do nitrogênio em citros, esta coloniza os vasos de xilema da planta
hospedeira, concentrando-se no pecíolo quando se trata de citros. O controle
da CVC está limitado à remoção por poda de ramos infectados, aplicação de
inseticidas e utilização de plantas sadias em novos pomares.
A planta, como citado acima, ao ser invadida por patógenos gera como sistema
de defesa, dentre outros, o oxidative burst, em que ROS são produzidas. Porém
X. fastidiosa possui um mecanismo de defesa antioxidante que entre
peroxirredoxinas, GSH peroxidase e catalases, há uma proteína pertencente a
uma família encontrada exclusivamente em bactérias, na maioria patogênica,
conhecida como Ohr (Organic hydroperoxide resistence).
Ohr possui massa molecular de 14,9 kDa, uma seqüência de aproximadamente
143 aminoácidos, dois resíduos de cisteína conservados (Cys-61 e Cys-125) e
sítio ativo muito hidrofóbico. O alinhamento de seqüências de genes de Ohr em
diferentes bactérias mostrou que as duas cisteínas são completamente
conservadas. Ohr é uma proteína dimérica, com estrutura na forma elíptica,
seus dois monômeros apresentam-se fortemente interligados, este é composto
por duas folhas betas e duas alfa hélices centrais, sendo seu sítio ativo formado
por seus dois resíduos de cisteína originados do mesmo monômero.
Ohr é sensível a peróxidos orgânicos, mas não a H2O2 e superóxidos, já que
sua expressão foi fortemente induzida por t-BHP (hidroperóxido de terc-butyla),
induzida fracamente em H2O2 e não sofreu indução por superóxidos. Estudos
demonstraram que Ohr foi mais eficiente na remoção de peróxidos orgânicos de
10 a 20 vezes em relação à remoção de H2O2. Sua expressão é regulada pela
proteína OhrR.
A sensibilidade de Ohr a peróxidos orgânicos é devida tal proteína ser uma
peroxidase tiól dependente, sendo envolvidos neste processo seus resíduos de
cisteína. No entanto, Ohr utiliza somente ditióis como substrato, como DTT e
DHLA, e não monotióis, de acordo com reação abaixo.

Ohr(&#8722;SS-)+R-(SH)2 &#8594; Ohr &#8722; [Cys-61]-SSR-SH &#8594;


Ohr &#8722; (SH)2+RSSR

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

132
UNISA - Universidade de Santo Amaro

Estudos à respeito do sito ativo da proteína Ohr demonstraram em seus


estudos que, além da hidrofobicidade, os possíveis substratos de Ohr deveriam
ser moléculas alongadas, portanto, o sistema gerado pela doação de elétrons a
partir de NADH, contendo lipoamida e lipoamida desidrogenase (Lpd)
demonstrou-se muito eficiente na caracterização da atividade peroxidásica de
Ohr. Tal sistema é representado a seguir:

NADH &#8594; lipoamida desidrogenase &#8594; lipoamida &#8594; Ohr


&#8594; peróxido

Devido à importância econômica em relação aos danos causados a agricultura


por X. fastidiosa são relevantes os estudos a respeito desta bactéria,
principalmente relacionados a busca de novos meios de combate a tal, sendo o
estudo a respeito da proteína Ohr importante no processo de produção de
drogas, pois a mesma apresenta características específicas, auxiliando neste
processo.

OBJETIVO:
Busca de inibidores para a enzima antioxidante Ohr de Xylella fastidiosa,
através da realização de ensaios enzimáticos a partir de compostos químicos
sintéticos. Selecionando assim, por triagens variadas, compostos que possuam
características inibitórias em relação à atividade enzimática da proteína Ohr.

METODOLOGIA:
As linhagens de bactérias utilizadas de X. fastidiosa para a clonagem e
expressão gênica foram BL21(DE3): [F-, amp T, hsdSb (rB- mb-), gal, dcm]
(DE3) (Novagen) e XL1-Blue: recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1
lac [F´ proAB lacIqZDM15 Tn10 (TetR)]: linhagem de clonagem (Stratagene).
Em meios de cultura LB, 1% de triptona, 1% de NaCl, 0,5% de extrato de
levedura; meios sólidos preparados com a adição de 2% de ágar e meios
seletivos como LB acrescido de ampicilina (100µg/ml), utilizando o plasmídeo
pET15b (5708 pb). A purificação foi realizada por cromatografia de afinidade a
níquel através do Kit His Trap, sendoque as seqüências dos genes clonados
foram amplificadas dos vetores de expressão utilizando primers específicos
para cada gene, depois de amplificados realizou-se a purificação do DNA e em
seguida as amostras foram quantificadas em gel de agarose 0,8%.
Através de ensaios de DTT oxidado uma série de 32 compostos, sintetizados
pelo Laboratório de Química Fina do Dr. Leandro Helgueira de Andrade no IQ-
USP, foi testada em relação ao efeito inibidor da atividade enzimática de Ohr.
A determinação da velocidade de oxidação de DTT foi possibilitada por esse
ensaio, na presença de Ohr e peróxido. O DTT (ditiól) é oxidado pela Ohr em

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

133
UNISA - Universidade de Santo Amaro

presença de um peróxido como substrato, demonstrando a produção de DTT


oxidado, mensurada por espectrofotômetro de leitora de placa em absorbância
de 310nm. A reação foi incubada a 37°C e iniciada com a adição de 20µL de t-
BHP 3,7mM em condições de tampão NaPO4 185mM, Triton 1,85%, BSA
1,85mg/mL, DTPA 1,85mM, Ohr 1,85µM e DTT 3,7mM. As amostras foram
testadas em concentrações finais inicialmente iguais a 0,1µM, 1µM, 10µM,
100µM e 1mM, porém tais concentrações foram modificadas de acordo com a
necessidade de testar a taxa de inibição de cada amostra. A partir dos gráficos
obtidos realizaram-se os cálculos de velocidade da atividade de Ohr.

RESUMO:
Como nos ensaios foram utilizadas concentrações variadas de cada composto,
para determinar o IC50 de inibição, e a concentração final de peróxido (t-BHP)
utilizado foi de 200µM, valores de concentração de compostos maiores do que
200µM podem inibir a atividade enzimática apenas pelo excesso de composto
na solução, causando possível precipitação e um resultado de inibição falso
positivo. Devido a tais aspectos, parâmetros foram estipulados para determinar
qual composto seria um possível inibidor de Ohr. Em relação a todas as
triagens realizadas, os compostos que inibiram 50% da atividade de Ohr,
chamado IC50, com concentração no ensaio igual ou menor que 100µM foram
selecionados como de alta taxa de inibição, os compostos que inibiram 50% da
atividade de Ohr com concentrações próximas a margem de 100µM e 300µM
foram considerados de média taxa de inibição, já os compostos que apenas
apresentaram inibição de 50% da atividade de Ohr, na maioria das triagens,
com concentrações acima de 300µM foram considerados de baixa taxa de
inibição.
Logo na primeira triagem realizada os resultados obtidos caracterizaram três
compostos com alta taxa de inibição, as amostras 6, 10 e 12. Os compostos 6 e
10 inibiram completamente a atividade da proteína Ohr , já o composto 12 inibiu
a atividade de Ohr com IC50 de aproximadamente 100 µM.
As amostras 1, 21, 22, 23, 24, 25, 28 e 29 apresentaram nível médio de inibição
de Ohr, pois demonstraram uma margem de IC50 entre 100µM e 1000µM.
Apesar dos compostos terem sido sintetizados sem nenhuma informação
referente ao sítio ativo da proteína Ohr, três amostras apresentaram resultados
satisfatórios referentes à inibição de Ohr. Os compostos 6, 10 e 12 que
apresentaram alta taxa de inibição da atividade de Ohr, possivelmente,
bloqueiam o sítio ativo de alguma forma impedindo a atividade enzimática, no
entanto, não se encaixam necessariamente neste. Baseados na estrutura
química dos compostos com diferentes níveis de eficiência de inibição
A partir da estrutura destes compostos serão realizadas varreduras virtuais,
com o propósito de sintetizar moléculas mais específicas ao sítio ativo de Ohr,

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

134
UNISA - Universidade de Santo Amaro

com estrutura compatível ao encaixe do sítio ativo da enzima, inibindo sua


ação, como a adição de cadeias longas de ácidos graxos, característica
essencial de possíveis substratos de Ohr. Além disso, novos compostos estão
sendo sintetizados e também serão testados em ensaios de DTT oxidado para
verificar possível inibição da atividade da proteína Ohr possibilitando a inibição
desta e, como conseqüência, sensibilizando o patógeno X. fastidiosa ao ataque
oxidativo concebido pela planta hospedeira.
O estudo referente à ação inibitória destes compostos químicos, relacionados à
atividade da proteína antioxidante Ohr, é essencial para a síntese de drogas
contra a bactéria patogênica X. fastidiosa, causadora de diversas doenças em
variadas espécies de plantas. Tal proteína é encontrada apenas em bactérias,
em sua maioria patogênica, como a X. fastidiosa, que causa danos importantes
no setor agrícola de muitos países, não sendo encontrada em plantas.
Além deste aspecto, Ohr é uma enzima com características estruturais e
funcionais únicas, como a respeito da hidrofobicidade de seu sítio ativo e de
sua atividade peroxidásica, sendo todos estes fatores em conjunto cruciais para
determinar a proteína antioxidante Ohr como alvo para a produção de drogas
contra bactéria patogênicas. Estudos mais específicos da atividade de Ohr e da
ação de compostos com caráter inibidor de sua atividade serão realizados
futuramente em próximas etapas, permitindo a síntese de compostos capazes
de inibirem a ação antioxidante de Ohr, sendo estes utilizados como agentes
farmacêuticos contra infecções em vegetais por X. fastidiosa.

CONCLUSÃO:
Os resultados gerais obtidos a partir das triagens dos ensaios de DTT oxidado
demonstraram que da série de 32 compostos testados 17 amostras
apresentaram baixa ou nenhuma taxa de inibição da atividade de Ohr. Os
resultados foram positivos em relação às amostras 6, 10 e 12 que apresentaram
alto poder de inibição, indicando compostos promissores, e nove amostras que
apresentaram nível médio de inibição, sendo estas as 1, 21, 22, 23, 24, 25, 28 e
29.
Estudos mais específicos da atividade de Ohr e da ação de compostos com
caráter inibidor de sua atividade serão realizados futuramente nas próximas
etapas, permitindo a síntese de compostos capazes de inibirem a ação
antioxidante de Ohr, sendo estes utilizados como agentes farmacêuticos contra
infecções em vegetais por X. fastidiosa.

REFERÊNCIA BIBLIOGRÁFICA:
BOLWELL, G.P. & WOJTASZEK, P. 1997. Mechanisms for the generation of
reactive species in plant defense – a broad perspective. Physiological and
Molecular Plant Pathology 51: 347-366.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

135
UNISA - Universidade de Santo Amaro

CHATTERJEE, S.; ALMEIDA, R.P.P. & LINDOW, S. Living in two worlds: The
plant and insect lifestyles of Xylella fastidiosa. Annu. Rev. Phytopathol. 46: 243-
271.

OLIVEIRA, M.A.; GUIMARAES, B.G.; CUSSIOL, J.R.R.; MEDRANO, F.J.;


GOZZO, F.C. & NETTO, L.E. 2006. Structural insights into enzyme-substrate
interaction and characterization of enzymatic intermediates of organic
hydroperoxide resistance protein from Xylella fastidiosa. J. Mol. Biol. 359: 433-
45.

________________________________________________________________
Nádila Magalhães Millan1,2, Andressa Yurie Silvestre Sakugawa2, Luis Eduardo
Soares Netto2
1- Curso de Ciências Biológicas, Universidade de Santo Amaro – UNISA.
2- Departamento de Genética e Biologia Evolutiva, Instituto de Biociências -
Universidade de São Paulo.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

136
UNISA - Universidade de Santo Amaro

CONCENTRAÇÃO DE METAIS EM SOLOS ADJACENTES À


AVENIDA MARGINAL DO RIO TIETÊ, SÃO PAULO
NATALIA CARDADEIRO E SILVA(1)

ANA MARIA GRACIANO FIGUEIREDO(2)(Orientadores)


Ciências Biológicas
INTRODUÇÃO:
A poluição atmosférica ocorre principalmente em áreas metropolitanas, onde o
ambiente natural encontra-se altamente degradado. Essa degradação é gerada
pela presença de diferentes tipos de poluentes atmosféricos, uma vez que
nessas áreas existe um maior aglomerado demográfico e grandes
concentrações de veículos e indústrias [1].

A poluição ambiental pode ser relacionada a vários fatores, como o crescimento


desordenado dos grandes centros urbanos e metrópoles, pela implantação de
indústrias, grande circulação de veículos automotores, desmatamento e
ocupações irregulares que poluem as águas, o ar e os solos [2].

O solo é parte altamente afetada em áreas urbanizadas, podendo afetar a biota.


Solo pode ser definido como um composto heterogêneo gerado a partir da
reorganização de um material original, como rochas, sedimentos ou outros
solos. Essa reorganização ocorre a partir de ações da atmosfera, trocas de
energia, ou até mesmo, ações biológicas, através de animais e vegetais. Cada
solo possui uma composição diferente e é formado por diferentes quantidades
de minérios, minerais, materiais orgânicos entre outras substancias; essa
grande diversidade dos solos muitas vezes está relacionada com a própria ação
antropogênica ou até mesmo, pode estar ameaçada pela mesma, uma vez que
as atividades humanas afetam diretamente o ambiente [3].

Desde o princípio da história humana, o solo tem sido utilizado como receptor
de substâncias resultantes da atividade humana. Com o surgimento de grandes
processos de transformação a partir da Revolução Industrial, a liberação
descontrolada de poluentes para o ambiente e sua conseqüente acumulação no
solo sofreu uma mudança drástica de forma e de intensidade, que pode ser
explicada pela utilização intensiva dos recursos naturais e também pelos
resíduos gerados no aumento das atividades urbanas, industriais e agrícolas
[3].

Os solos vicinais à Marginal do Rio Tietê, assim como os solos de muitas outras
áreas da cidade de São Paulo, provavelmente, já estão sob impacto do homem
e possivelmente sofreu alterações desde o inicio de sua utilização, tanto para o

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

137
UNISA - Universidade de Santo Amaro

trafego como para outras ações no passado [3].

OBJETIVO:
Este estudo tem como objetivo a caracterização química dos solos superficiais
adjacentes à Marginal do Rio Tietê, na Região Metropolitana de São Paulo, por
meio da técnica de análise por ativação com nêutrons instrumental (INAA), para
determinar elementos de interesse ambiental como As, Ba, Co, Cr, Sb e Zn em
amostras de solos coletadas ao longo de seu curso.

METODOLOGIA:

3.1. Área Estudada


A Região Metropolitana de São Paulo (RMSP) é formada por grandes centros
urbanos e industriais, e devido ao grande fluxo de moradores e trabalhadores,
apresenta diariamente tráfego intenso de veículos. A Rodovia SP-015 é um dos
principais, se não, o maior, acesso à RMSP e, portanto, possui sempre
congestionamentos e grande fluxo de veículos. Esta rodovia é constituída pelos
complexos viários da Marginal do Rio Pinheiro e da Marginal do Rio Tietê [4] A
Marginal do Rio Tietê é um importante eixo de trafego automotivo na cidade de
São Paulo, unindo as Zonas, Norte, Oeste e Leste [4].
3.2. Amostragem e Coleta
Foram coletados solos adjacentes a Marginal do Rio Tietê, que apresenta alta
densidade de tráfego na cidade de São Paulo, além de apresentar canteiros
que favorecem a coleta das amostras.
Dessa forma, foram coletadas 32 amostras de solo com auxilio de tubos de
PVC; os testemunhos foram coletados em oito pontos ao longo da Avenida e
apresentavam profundidade de 0-5cm. A posição de cada ponto foi
precisamente determinada durante o trabalho de campo, com ajuda de um GPS
(Geographic Positioning System) com uma exatidão de 10m.

Previamente à coleta da amostras, foi necessário protocolar na Companhia de


Engenharia de Tráfego (CET) do município, de São Paulo, junto ao
Departamento de Gestão de Eventos, um formulário de autorização (fornecido
pela CET). Foi necessário também um “Memorial Descritivo de Coleta”, onde foi
detalhada a proposta deste projeto de pesquisa, bem como os procedimentos
que foram utilizados na retirada do solo.

3.3. Preparo das Amostras


Em laboratório, após a retirada de gramíneas e outros tipos de vegetação
presentes nas amostras, foi feita a secagem em estufa a 40ºC, em béqueres, e
após a secagem, foi realizada a peneiração, sendo separada para análise a

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

138
UNISA - Universidade de Santo Amaro

fração 2 mm. As amostras foram moídas em moinho de ágata a uma


granulometria 75m. Após o preparo as amostras foram devidamente
acondicionadas, para a posterior análise com INAA.

3.4. Análise por Ativação com Nêutrons Instrumental (INAA)


Nesta técnica, o material em estudo é irradiado com feixes de nêutrons em um
reator nuclear, esses nêutrons são capturados pelos núcleos dos átomos
presentes na amostra, deixando-os instáveis e dando origem a isótopos
radioativos dos elementos presentes (Figura 2). Estes radionuclídeos são
identificados pela energia liberada (raios gama); denomina-se “pronto” aqueles
que são liberados no momento da irradiação e “atrasado” ou simplesmente
raios gama, aqueles que são liberados em decorrência do decaimento do
radionuclídeo e são acompanhados de partículas beta. Cada elemento irradiado
origina um radioisótopo com um tempo de decaimento próprio, podendo levar
de segundos até anos. Graças a isso, podemos determinar os elementos
presentes na amostra e a concentração do radioisótopo na amostra é
proporcional à intensidade da radiação gama emitida. Nas determinações
quantitativas, geralmente é usado o método comparativo. Amostra e padrão são
irradiados, em conjunto, nas mesmas condições, em um determinado fluxo de
nêutrons.

Quando a amostra é irradiada a atividade induzida, que pode ser medida em um


detector, é expressa através da equação geral da análise por ativação [5].A
concentração dos elementos em uma amostra pode ser calculada pela equação
1, desde que os parâmetros como: secção de choque, fluxo de nêutrons, tempo
de irradiação e meia-vida dos radioisótopos formados, sejam precisamente
conhecidos. A concentração da amostra é calculada comparando-se a atividade
do elemento na amostra à atividade do elemento no padrão (de concentração
conhecida). Para isso podemos relacionar a equação 1 obtida para o padrão de
referencia e para amostra

RESUMO:

Os resultados dos 6 elementos estudados (As, Ba, Co, Cr, Sb e Zn) nas 32
amostras analisadas por INAA podem ser observados na tabela 01, que indica
as faixas e médias para cada elemento aos longo dos oito pontos de coleta na
Avenida Marginal do Rio Tietê.

Tabela 01: Médias e faixas para cada elemento nos 8 pontos analisados.
P1 P2 P3 P4
Média Faixa Média Faixa Média Faixa Média Faixa
As 45,1 28 57 6,825 3 14,4 20,2875 4,8 7,3 7,6 2 18

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

139
UNISA - Universidade de Santo Amaro

Ba 377,5 499 312 642,25 355 801 591,125 668 906 578,75 477 664
Co 7,975 7,1 9,5 8,4 4 10,8 8,4339286 7 10,9 6,6875 5,9 7,55
Cr 112 100 124 133,675 56,7 167 134,63393 109,5 200 104,475 84,9 141
Sb 2,6925 1,37 3,9 3,6925 2,87 4,2 3,8446429 4,2 8,4 4,36 3,8 4,75
Zn 310,75 236 438 363,75 578 72 492,75 1225 633 565,75 489 698

P5 P6 P7 P8
Média Faixa Média Faixa Média Faixa Média Faixa
As 10,8 7 14,4 7,5 3,2 12,4 4,425 2 6,6 2,9 2 3,6
Ba 427,5 328 503 503,25 344 700 379 253 576 531,75 354 698
Co 5,3 4,4 6,8 6,225 4,2 10,2 5,5 3,8 6,4 5,7 5,2 6
Cr 97,525 72 138 53,65 10,6 72 64,975 48,5 101 61,2875 43,15 80
Sb 3,4 5,1 2,6 4 2,7 6 2,4825 1,93 2,6 2,75 1,6 4,5
Zn 546,75 412 711 375,25 242 500 343,5 242 526 303,25 208 470

A CETESB definiu valores orientadores para os metais pesados em solos no


estado de São Paulo; estes valores são apresentados na forma de relatórios
que devem ser revisados a cada 4 (quatro) anos. Desta maneira os valores
orientadores para solos e águas subterrâneas no estado de São Paulo são
definidos da seguinte forma:
Valor de Intervenção – é a concentração de determinada substância na qual
podem ocorrer risco potenciais, diretos e indiretos a saúde humana. Para isso
foram considerados cenários genéricos de exposição:
AGR – valor utilizado para avaliação de risco a saúde humana para áreas
agrícolas.
RES - valor utilizado para avaliação de risco a saúde humana para áreas
residenciais.
IND - valor utilizado para avaliação de risco a saúde humana para áreas
industriais.
PREV – concentração de determinada substância na qual podem ocorrer
alterações prejudiciais à qualidade do solo. Este valor indica a qualidade do
solo capaz de sustentar suas funções primárias [3].

Os valores obtidos foram comparados com os valores de intervenção fornecidos


pela CETESB . As concentrações de As ao longo da Avenida não apresentaram
valores significativos, suas concentrações se mantiveram em grande parte
abaixo dos valores de intervenção agrícola, e em sua maioria as concentrações
não chegam nem ao menos a afetar as características naturais do solo [3]. Nos
pontos 1 e 2 deve haver contaminação por pesticidas ou indústrias do ramo da

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

140
UNISA - Universidade de Santo Amaro

vidraria ou cimento, que utilizam o As e desta forma teriam contaminado o solo.

O Ba apresentou concentrações muito elevadas ao longo de toda a marginal do


Rio Tietê, o que indica um grande impacto gerado pelo homem. Seus valores
ultrapassaram os limites industriais estipulados pela CETESB, 2005. Estas
grandes concentrações podem estar relacionadas com pesticidas, grande
emprego na indústria de tijolos e vidros e até mesmo ao trafego de automóveis,
pois o Ba é empregado em componentes automotivos como lubrificantes .

Os valores de Co estiveram dentro dos limites estipulados pela CETESB, não


apresentando alterações em nenhum ponto de coleta.

O Cr, o Zn e o Sb apresentaram alterações em suas concentrações ao longo de


toda a Avenida. Suas concentrações estiveram acima dos limites de intervenção
agrícola, e até mesmo de intervenção residencial para o Zn no ponto 3; no
entanto, essas concentrações não chegam a ser tão altas quanto as do Ba.
Esses elementos são considerados associados ao tráfego, sendo liberados nos
gases de exaustão dos veículos. O Zn é também empregado na industria de
fertilizantes e pesticidas, podendo ser daí este valor elevado no ponto 3. Além
disso, o Zn é usado em óleos lubrificantes e está associado ao desgaste de
materiais constituintes dos automóveis, o que sugere origem veicular.

CONCLUSÃO:

Os resultados obtidos indicam uma grande contaminação dos solos da marginal


do Rio Tietê por diferentes metais, sugerindo ações antropogênicas.
Essas altas concentrações dos metais analisados podem afetar a saúde
humana, uma vez que estes elementos químicos estão disponíveis em uma
área de grande tráfego de automóveis, e de fácil acesso. Com uma baixa
umidade relativa do ar e o grande fluxo de automóveis estes elementos podem
se desprender do solo, e na forma de poeira afetar a saúde humana, gerando
complicações respiratórias e podendo até mesmo levar ao câncer.

Quanto às concentrações de Ba, que possivelmente estão relacionadas ao


tráfego, é simples traçar uma relação entre o congestionamento na área e os
elevados valores obtidos; no entanto, a presença de Ba pode estar associada
também a raticidas, apesar de sua utilização ter sido proibida pela ANVISA
(Agencia Nacional de Vigilância Sanitária) através da resolução 326, de 9 de
Novembro de 2005.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

141
UNISA - Universidade de Santo Amaro

REFERÊNCIA BIBLIOGRÁFICA:
[1] Teixeira, E. C.; Feltes, S. & Santana E. R. R. “Estudo das emissões de fontes
móveis na região metropolitana de Porto Alegre, Rio Grande do Sul”. Química
Nova, Vol.31 (2008).
[2] “Atlas Ambiental do Município de São Paulo” (2009)
http://atlasambiental.prefeitura.sp.gov.br/pagina.php?id=20.

[3] CETESB: “Valores orientadores para solos e águas subterrâneas no estado


de São Paulo” (2005)
http://www.cetesb.sp.gov.br/Solo/relatorios/tabela_valores_2005.pdf

[4] DER/SP-“ Departamento de Estradas de Rodagem do Estado de São Paulo -


Diretoria de Planejamento.” (2009)
http://www.der.sp.gov.br/malha/denominacoes.aspx?ler=rel_desc#rel_desc.

[5] De Soete, D.; Gigbels, R.; Hoste, J.. Nêutron Activation Analysis. London:
Wiley-Interscience, 1972.

________________________________________________________________
UNISA 2009 - São Paulo-SP-Brasil

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

142
UNISA - Universidade de Santo Amaro

CONDUTA DA ENFERMAGEM DIANTE DOS ASPECTOS SOCIAIS


RELACIONADOS À ORIENTAÇÃO JUNTO A MÃE
SOROPOSITIVO
ALESSANDRA VIEIRA DA SILVA(1)

VALDILEA ZORUB PASQUINI(2)(Orientadores)


Ciências Biológicas
INTRODUÇÃO:
Considerado a pandemia da atualidade, o Vírus da Imunodeficiência Adquirida
(HIV) e a Síndrome da Imunodeficiência Adquirida (AIDS), têm se configurado
como um dos mais sérios problemas de saúde pública, com alta taxa de morbi-
mortalidade, grande tendência de crescimento e propagação em diversos
territórios. (1)
A AIDS é uma doença fatal, que é possível a transmissão vertical do vírus, que,
quando ela ocorre, traz conseqüências ao binômio mãe-filho e família, e
considerando, também, que o profissional da área da saúde, em especial o
enfermeiro, tem importante papel no combate a epidemia de AIDS.
Como adverte a literatura, é possível a redução de aproximadamente 70% no
risco da Transmissão vertical com o uso do tratamento anti-retroviral na
gestação, trabalho de parto e parto e nos recém-nascidos alimentados
exclusivamente com fórmula infantil.
Mas a experiência de não amamentar para as mulheres é difícil, envolvendo
aspectos sociais que devem ser acompanhados.
A equipe de enfermagem por conter uns dos profissionais que passam a maior
parte do tempo com os pacientes, deve estar aberta para perceber os
sentimentos, atitudes e comportamentos e para que, além de esclarecerem as
condições clínicas e os cuidados gerais com a pessoa, possa estabelecer ainda
vínculo, interação junto à mãe soropositiva para o HIV mediado pelo encontro
(3) .

OBJETIVO:
Participação da enfermagem diante dos aspectos sociais relacionados à
orientação para não amamentar.

METODOLOGIA:
Pesquisa de revisão bibliográfica. dados coletados em consulta eletrônica e
livros didáticos referentes ao tema. Foram encontrados 33 artigos, dos quais 16
eram pertinentes ao tema, com um recorte temporal de 2000 a 2009. Os
critérios de inclusão abrangeram apenas os artigos que continham as seguintes

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

143
UNISA - Universidade de Santo Amaro

expressões: transmissão vertical do HIV, cuidados de enfermagem,


amamentação.

RESUMO:
A infecção aguda, também chamada de síndrome da infecção retroviral aguda
ou infecção primária, ocorre em cerca de 50% a 90% dos pacientes. Seu
diagnóstico é pouco realizado, devido ao baixo índice de suspeição, sendo, em
sua maioria, retrospectivo. O tempo entre a exposição e os sintomas é de cinco
a trinta dias. A história natural da infecção aguda caracteriza-se tanto por
viremia elevada, como por resposta imune intensa.

Os sintomas aparecem durante o pico da viremia e da atividade imunológica. As


manifestações clínicas podem variar desde quadro gripal até uma síndrome que
se assemelha à mononucleose. Além de sintomas de infecção viral, tais como:
febre, adenopatia, faringite, mialgia, artralgia, rash cutâneo maculopapular
eritematoso, ulcerações muco-cutâneas envolvendo mucosa oral, esôfago e
genitália, hiporexia, adinamia, cefaleia, fotofobia, hepatoesplenomegalia, perda
de peso, náuseas e vômitos. Os pacientes podem apresentar, ainda, candidíase
oral, neuropatia periférica, meningoencefalite asséptica e síndrome de Guillain-
Barré. Os achados laboratoriais inespecíficos são transitórios e incluem:
linfopenia seguida de linfocitose, presença de linfócitos atípicos, plaquetopenia
e elevação sérica das enzimas hepáticas. Os sintomas duram, em média, 14
dias, sendo o quadro clínico autolimitado. A ocorrência da síndrome de infecção
retroviral aguda clinicamente importante ou a persistência dos sintomas por
mais de 14 dias parecem estar relacionadas a uma evolução mais rápida para
AIDS.

Na fase assintomática o estado clínico básico é mínimo ou inexistente. Alguns


pacientes podem apresentar uma linfoadenopatia generalizada persistente,
"flutuante" e indolor. Portanto, a abordagem clínica nestes indivíduos, no início
de seu seguimento, prende-se a uma história clínica prévia, investigando
condições de base como hipertensão arterial sistêmica, diabetes, doença
pulmonar obstrutiva crônica (DPOC), doenças hepáticas, renais, pulmonares,
intestinais, doenças sexualmente transmissíveis, tuberculose e outras doenças
endêmicas, doenças psiquiátricas, uso prévio ou atual de medicamentos. Enfim,
situações que podem complicar ou serem agravantes em alguma fase de
desenvolvimento da doença pelo HIV. Histórico familiar, hábitos de vida, como
também uma avaliação do perfil emocional e psicossocial do paciente, seu nível
de entendimento e orientação sobre a doença são extremamente importantes.

Na fase sintomática o portador da infecção pelo HIV pode apresentar sinais e


sintomas inespecíficos e de intensidade variável, além de processos

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

144
UNISA - Universidade de Santo Amaro

oportunistas de menor gravidade, principalmente em pele e mucosas, sudorese,


fadiga, emagrecimento e trombocitopenia.

A Aids é a fase do espectro da infecção pelo HIV em que se instalam as


doenças oportunistas, que são as doenças que se desenvolvem em decorrência
de uma alteração imunitária do hospedeiro. Estas são geralmente de origem
infecciosa, porém várias neoplasias também podem ser consideradas
oportunistas.
Com base nos dados epidemiológicos e clínicos, a partir dos sintomas e sinais
mencionados, os profissionais de saúde poderão, ao determinar os riscos de
infecção pelo HIV em seus pacientes, ajudá-los a reconhecer esses riscos e
aconselhá-los para reduzi-los e para realizarem o teste anti-HIV. É importante
lembrar que, o tratamento adequado de outras DST, quando presentes, além de
romper a cadeia de transmissão, auxilia o prognóstico do portador da infecção
pelo HIV, visto que as DST facilitam a progressão para doença clínica.
Denomina-se transmissão vertical do HIV a situação em que a criança é
infectada pelo vírus da AIDS durante a gestação, o parto ou por meio da
amamentação,no entanto, a criança, filho de mãe infectada pelo HIV, tem a
oportunidade de não se infectar pelo HIV. Atualmente, existem medidas
eficazes para evitar o risco de transmissão, tais como: o diagnóstico precoce da
gestante infectada, o uso de drogas anti-retrovirais, o parto cesariano
programado, a suspensão do aleitamento materno, substituindo-o por leite
artificial (fórmula infantil) e outros alimentos, de acordo com a idade da criança.
Durante o pré-natal, toda gestante tem o direito e deve realizar o teste HIV.
Quanto mais precoce o diagnóstico da infecção pelo HIV na gestante, maiores
são as chances de evitar a transmissão para o feto. O tratamento é gratuito e
está disponível no SUS.

No país investe-se hoje maciçamente no incentivo à testagem anti-HIV no pré-


natal. A implantação dessa prática em meio à população feminina, durante a
gestação, abre um leque de vantagens, dentre as quais se destacam:
Diagnóstico precoce da infecção pelo HIV, com possibilidade de início do
tratamento, se for o caso, o que favorece o prognóstico da doença a curto,
médio e longo prazo, além do corte da cadeia de transmissão, com as medidas
preventivas adequadas.
Diagnóstico da infecção em consulta ambulatorial, multiprofissional, onde a
mulher é adequadamente aconselhada, orientada, e tem tempo e espaço para
se colocar diante da nova realidade. (2)
Possibilidade de iniciar o protocolo de profilaxia da transmissão vertical o mais
precocemente possível, garantindo os melhores resultados para a criança. É
importante ressaltar aqui que, nos serviços públicos, estão disponibilizados os
testes e os medicamentos necessários ao tratamento dos casos e à profilaxia

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

145
UNISA - Universidade de Santo Amaro

da transmissão do vírus para a criança.

RESULTADOS:
A epidemia de AIDS no Brasil conta hoje com cerca de 474 mil casos
confirmados da doença e uma estimativa de cerca de 600 mil infectados
vivendo com HIV e AIDS. Do número total de casos identificados de 160 mil são
mulheres.
Anualmente, 3 milhões de mulheres dão à luz no Brasil. Segundo estudo
realizado em 2004, numa amostra representativa de parturientes de 15 a 49
anos de idade, de todas as regiões do país, a taxa de prevalência de mulheres
portadoras do HIV no momento do parto é de 0,42%, o que corresponde a uma
estimativa de cerca de 13 mil parturientes infectadas.
Estudos ainda revelam que as mulheres mais jovens têm mais percepção de
risco de infecção pelo HIV e que há precocidade no início de seu
relacionamento sexual. Essa condição repercute na rede de assistência à
mulher, pois o início das relações sexuais acarreta uma série de modificações
na sua situação de vida, expondo-a ao risco de gravidez e DST, dentre outras
intercorrências. E o papel de “cuidadoras” que as mulheres desempenham na
sociedade faz com que, para a maioria delas, a primeira responsabilidade seja
com a saúde de suas crianças e de outras pessoas da família, e por isso,
muitas vezes não se percebam sob risco (3).
A imagem da amamentação, de alguma maneira, tem povoado o mundo das
mulheres, enquanto símbolo representativo da maternidade, construído social e
culturalmente ao longo dos tempos, paradoxalmente tido como determinação
biológica da espécie. A amamentação não se esgota apenas em fatores
biológicos, mas abrange dimensões construídas culturalmente, socialmente e
historicamente. Para as mulheres, a AIDS é uma doença que afeta diretamente
a identidade social, sendo essa uma razão pela qual é em torno dos aspectos
sociais e morais nela implicados que se estabelece uma identidade de mulher
HIV positivo.É através do sofrimento imposto pelas restrições que a AIDS impõe
às mulheres, que elas se tornam capazes de reconhecerem-se umas nas
outras.
A equipe de enfermagem deve estar aberta para perceber os sentimentos,
atitudes e comportamentos e para que, além de esclarecer as condições
clínicas e os cuidados gerais com a pessoa, possa estabelecer ainda vínculo,
interação junto à mãe soropositiva para o HIV mediado pelo encontro.
A enfermagem é uma profissão que não exige somente o conhecimento de um
conjunto de técnicas específicas, pois em todos os setores, os enfermeiros são
solicitados a fornecer um cuidado integral, envolvendo os aspectos biológicos,
psicossociais e espirituais.
Cabe aos profissionais de saúde que assistem crianças expostas verticalmente
ao HIV sugerir a não amamentação e inserir na rotina de intervenções as

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

146
UNISA - Universidade de Santo Amaro

orientações sobre a alimentação adequada ao RN e aos gestores da instituição


compete garantir a aquisição da fórmula infantil.
Como recomendado, a mulher com diagnóstico de HIV deve ter sua lactação
inibida logo após o parto e não faça a doação do leite. Isto pode ser conseguido
com medidas mecânicas e farmacológicas.
O aleitamento cruzado e a doação também são contra-indicados. Portanto, as
crianças deverão ser alimentadas com leite artificial, mas, a partir do segundo
mês de idade, outros alimentos poderão ser introduzidos na alimentação
infantil.
O profissional deverá subsidiar a mulher de argumentos lógicos que lhe
possibilite explicar para familiares e outras pessoas de sua comunidade ou de
outro ciclo de sua relação, o fato de não estar amamentando, possibilitando-lhe
assim, atender sua vontade de manter em sigilo seu estado sorológico.
O HIV é excretado livre ou no interior das células no leite de mulheres
infectadas, que podem apresentar ou não sintomas da doença. A carga viral no
leite materno é um importante determinante do risco de transmissão. O
Ministério da Saúde contra-indica o aleitamento materno entre mulheres
infectadas pelo HIV (3).
As medidas mecânicas consistem em realizar a compressão das mamas
(enfaixamento), de forma cuidadosa, para não restringir os movimentos
respiratórios com conseqüente desconforto materno. Fisiologicamente o
enfaixamento das mamas exerce um controle local da glândula mamária, que é
compatível com a hipótese de o leite conter um inibidor secretado por ele
mesmo, que se acumula durante a estase, dentro do lúmem da glândula
mamária. Esta substância seria um peptídeo (inibidor de feedback da lactação)
que inibiria em nível local, de forma autócrina, a produção de leite. Essa
medida, isoladamente, tem sucesso em 80% dos casos, quando mantida pelo
período de sete a dez dias, evitando-se a manipulação e estimulação das
mamas.

CONCLUSÃO:
Acredita-se que a educação em saúde seja o melhor meio para os profissionais
obterem maior envolvimento com a clientela.
O enfermeiro, pela sua formação, está capacitado para atuar nesse processo,
pela sua função de educador e de cuidador.
São inúmeros desafios encontrados, o assunto evolui rapidamente, sendo
necessária a atuação constante para a assistência de enfermagem e a prática
profissional, que constitui a aplicação de ações e de informações cientificas
com objetivo da prevenção e tratamento.
Concluo que, os serviços de saúde devem estar organizados para esse
atendimento e a enfermeira obstetra, bem como os outros profissionais da

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

147
UNISA - Universidade de Santo Amaro

equipe pré-natal, estar envolvida na busca de soluções para as transformações


que a infecção pelo HIV trouxe para a assistência a saúde da gestante, do feto
e da família.

REFERÊNCIA BIBLIOGRÁFICA:
(1) Barroso ,Léa Maria Moura; e Galvão, Marli Teresinha Gimeniz. Avaliação de
atendimento prestado por profissionais da saúde a puerperas com hiv/aids.
Texto Contexto Enferm, Florianópolis, 2007 Jul-Set; 16(3): 463-9.

(2) Vaz, M.J.R.; Barros, S.M.O. Redução da transmissão vertical do HIV: desafio
para a assistência de enfermagem.Rev.latino-am.enfermagem, Ribeirão Preto,
v. 8, n. 2, p. 41-46, abril 2000.

(3) Moreno, C.C.G.S. et al. Mães HIV positivo e a não-amamentação. Rev.


Bras. Saúde Matern. Infant., Recife, 6 (2): 199-208, abr. / jun., 2006.

________________________________________________________________
Alessandra Vieira da Silva: Discente da graduação de enfermagem da Facenf -
Unisa.

Valdilea Zorub Pasquini: Docente da Facenf - Unisa.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

148
UNISA - Universidade de Santo Amaro

CULTIVO DE FIBROBLASTOS AUTÓLOGOS PARA O


PREENCHIMENTO FACIAL
DÉBORA GALDINO PINTO(1)

LILIAN PINEIRO EÇA(2)(Orientadores)


Ciências Biológicas
INTRODUÇÃO:
A pele, o maior órgão do corpo humano, reveste todo o organismo permitindo a
comunicação com o meio externo. Este órgão é composto por três camadas
distintas: epiderme, derme e a hipoderme (subcutânea) (SOUTO, 2006). É na
derme que se encontra os fibroblastos (BAILEY e cols., 1973), células de
interesse neste trabalho.
Os fibroblastos são células de origem mesenquimal localizadas em grande
quantidade na derme. São responsáveis pela formação e remodelação dos
tecidos conjuntivos propriamente ditos. A produção de componentes fibrilares,
não fibrilares e microfibrilas da matriz extracelular do tecido conjuntivo realizada
por estas células, proporcionam a sustentação estrutural e metabólica de outros
órgãos e tecidos, como a epiderme (MORAES e cols., 2005).
Na pele também estão presentes as células-tronco (MOORE & LEMISCHKA,
2006). Estruturas localizadas na derme, como o folículo piloso e a lâmina basal
são reservatórios de células precursoras. Estas células possuem
multipotencialidade, apresentando assim, potencial de diferenciação em
diferentes tipos celulares (YU, 2006; PAPINI, 2003).
As rítides e linhas de expressão facial são um dos parâmetros mais visíveis do
fenômeno fisiológico do envelhecimento cutâneo (ORIÁ e cols, 2003).
Desenvolvem-se ao decorrer dos anos por um processo natural do
envelhecimento cutâneo, que ocorre na mudança estrutural e funcional da
derme. A diminuição do número de fibroblastos e consequente diminuição da
produção de matriz extracelular prejudicam na sustentação, elasticidade e tônus
da epiderme (RESENDE e cols, 2006).
O uso de fibroblastos autólogos é uma vantagem no rejuvenescimento facial,
pois as células são do próprio paciente excluindo risco de rejeição. A partir das
exigências por um tratamento eficaz, seguro e com resultados positivos e
duradouros, visamos com este trabalho desenvolver nova metodologia na
reparação tecidual com a infusão de fibroblastos autólogos jovens em rítides e
em linhas de expressão através do cultivo celular.

OBJETIVO:
Promover a reparação tecidual da pele com a infusão de fibroblastos autólogos
jovens em rítides e em linhas de expressão através do cultivo celular.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

149
UNISA - Universidade de Santo Amaro

METODOLOGIA:
Isolamento dos fibroblastos

Foram selecionadas 3 mulheres, não fumantes, na faixa etária entre 45 a 65


anos.
Foi realizada biópsia da pele de 1 cm3 na região da virilha de cada paciente.
Optamos por esta região, pois é uma região que não recebe radiação direta e
outros fatores externos. Para a realização da biópsia a paciente recebeu
aplicação de anestésico local. O tecido coletado foi lavado ainda em ambiente
cirúrgico com PBS (Solução Salina Fosfato - LGC®) á 1% PE (Penicilina
Estreptomicina - LGC®) e transportado ao laboratório de cultivo celular em tubo
cônico contendo solução enzimática á 37ºC.
Em seguida, o tecido foi fragmentado e posteriormente transferido para garrafas
de cultura de 25 cm3. Após este procedimento foram adicionados 5 ml de meio
de cultivo 199 (M199) suplementado a 10% com soro humano (SH) e levado
para cultura em temperatura 37ºC, 5% CO2 com ar umidificado (KURU e cols,
1998).

Cultivo e expansão celular

Após a expansão foi padronizado um intervalo de dias fixos entre as trocas que
no caso deste trabalho é de quatro dias. A expansão dos fibroblastos foi feita
até a quarta passagem, pois desta forma não ocorre alteração genotípica das
células (GRAGNANI e cols, 2007).
Com a obtenção de 70% da confluência da cultura primária, a cultura foi
subcultivada no vigésimo dia após o início do cultivo das células. A realização
da subcultura ou passagem de células (pd) foi através do uso de Tripsina -
LGC®. Após, a solução de células foi transferida para tubo cônico e
centrifugado á 1500 rpm por 5 minutos, para a formação de um botão-pellet de
células. O pellet de células foi ressuspenso com 2 ml de PBS e dividido em 2
alíquotas sendo, 1ml para expansão e 1ml para infusão. A alíquota para
expansão foi transferida para uma garrafa de cultura de 75 cm3, contendo 10 ml
de M199 a 20% SH (KEIRA e cols, 2004).

Infusão dos fibroblastos nas rítides

O procedimento de infusão dos fibroblastos nas rítides foi realizado com auxílio
de seringa de 1 ml e agulha 30G ½, após o uso tópico da pomada anestésica
aplicada 30 minutos antes da infusão nas regiões escolhidas. Foi utilizado
algodão com solução antisséptica para assepsia do local da infusão.
A aplicação foi realizada com agulha em inclinação de 30º para penetração
retrógrada em todas as regiões com pele fina. O nível da aplicação é na derme

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

150
UNISA - Universidade de Santo Amaro

superior e média, com a finalidade de adicionar os fibroblastos em local correto


para que sintetizem suas substâncias da matriz extracelular com o máximo de
aproveitamento para melhora das rítides. As infusões foram realizadas nas
regiões frontais, periorbital, perioral, sulcos nasogenianos e sulcos lábio
genianos.
Para se obter resultados satisfatórios foram necessários no mínimo quatro
processos de infusão de fibroblastos nas linhas faciais, com intervalo definido
de acordo com o desenvolvimento da cultura de cada paciente, no mínimo de
15 dias.
A análise dos resultados de preenchimento foi realizada pelo método de
imagem (KENET, 2000). A aquisição das imagens foi realizada utilizando-se
câmera digital convencional que trabalham no espectro visível, buscando-se
assegurar que a iluminação e ângulos fossem uniformes e aproximadamente os
mesmos em todas as fotografias.

RESUMO:
Cultivo e expansão celular

As pacientes selecionadas foram submetidas à biópsia de 1 cm3 na região da


virilha. Este fragmento de tecido foi explantado e após seis dias de cultivo
primário, em garrafa de cultura de 25 cm3, foi observado uma monocamada de
células fibroblásticas.
Estas células foram cultivadas até atingir uma confluência de 70%, para
realização da primeira passagem celular (1 pd) e primeira infusão de
fibroblastos nas rítides faciais.
Para expansão do número de células, a cada 15 dias foi realizada a passagem
celular (pd). As células foram expandidas até a quarta passagem.

Viabilidade Celular

As células foram coradas com Trypan Blue e contadas em Câmara de


Neubauer. A viabilidade celular resultou em 98% de células viáveis (Figura 5).

Infusão dos fibroblastos nas rítides

Foram realizadas quatro infusões de fibroblastos nas rítides faciais, com


intervalo de 15 a 20 dias entre cada infusão nas pacientes. Após aplicação de
pomada anestésica, alíquota de x106 cél/ml foi colocada em uma seringa de 1
ml, e a agulha introduzida até a região da derme e aplicada à quantia de 0,1 ml
de solução de células em cada penetração. As infusões foram realizadas com
intervalo definido de acordo com o desenvolvimento da cultura de cada
paciente.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

151
UNISA - Universidade de Santo Amaro

O resultado do preenchimento variou de acordo com o metabolismo de cada


paciente.
As infusões foram realizadas nas regiões frontais, periorbital, perioral, sulcos
nasogenianos e sulcos lábio genianos. Após vinte dias da primeira infusão
houve o preenchimento de rítides na região periorbital,. Clinicamente foi
observado um preenchimento acentuado desta região, porém em algumas
pacientes não houve preenchimento significativo das rítides, mas uma melhora
na vitalidade da pele foi observada, supostamente em consequência da síntese
de matriz extracelular dos fibroblastos.

DISCUSSÃO

Os fibroblastos são células predominantemente encontradas nos tecidos


conectivos, são importantes nos mecanismos de reparação e remodelamento
tecidual (PAN e cols., 2006), e na produção de componentes essenciais, como
o colágeno (BAXTER e cols., 2002; RAE, 1981).
A perda de colágeno ocorre a partir de 30 anos, quando o corpo passa a perder
1% da proteína ao ano, prejudicando a elasticidade, firmeza e tônus da pele.
Estas mudanças originadas na derme estão relacionadas com a diminuição da
habilidade das células, particularmente os fibroblastos, em regenerar a matriz
extracelular (YAMAMOTO e cols., 2006; FREI e cols., 1998).
Com o envelhecimento o colágeno e elastina mudam qualitativamente e
quantitativamente. As alterações qualitativas refletem na alteração das
propriedades físicas das moléculas. O colágeno fica mais estável com o
envelhecimento, em consequência aumenta a rigidez dos tecidos e há maior
dificuldade de difusão dos nutrientes dos capilares para as células e dos
metabólitos das células para os capilares, o que ocasionaria deterioração
progressiva da função celular (PAPALÉO, 2002). A diminuição da quantidade
de colágeno e elastina no tecido epitelial é resultante de uma diminuição da
atividade metabólica e do número de fibroblastos (BAILEY e cols., 1998).
Os fibroblastos in vivo permanecem metabolicamente ativos por longo período
sem se dividir, mas podendo voltar ao ciclo celular em resposta a estímulos. Ao
longo da vida a alimentação não balanceada, estresse e doenças contribuem
para a ativação da quiescência dos fibroblastos e consequente aparecimento de
linhas de expressão facial e rítides. Os fibroblastos in vitro possuem alta
multiplicação, pois o ambiente é altamente controlado, sendo estimulados por
fatores de crescimento e substâncias necessárias para seu metabolismo, como
vitaminas e aminoácidos (SATO e cols., 1994). Os fatores de crescimento
expressos pelos fibroblastos decorrentes das sinalizações celulares são de
grande interesse no nível de regeneração tecidual (GUIRRO & GUIRRO, 2002).
Uma característica distinta do uso da cultura de fibroblastos autólogos é a
reparação de tecidos e órgãos dos próprios pacientes, com compatibilidade e

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

152
UNISA - Universidade de Santo Amaro

funcionalidade, sem que ocorram problemas com rejeições (IKADA, 2006).


Em nossos resultados podemos observar que o tempo para expansão celular
dos fibroblastos é relativo e esta relacionado com o metabolismo de cada
paciente, pois o ciclo celular pode ser prejudicado por fatores internos e
externos, o que justifica o tempo individual para cada expansão celular
(MORAES e cols., 2005). Durante o cultivo destas células ocorre a liberação de
fatores de crescimento de fibroblasto – FGF no meio e que são utilizados pelos
próprios fibroblastos e pelas células indiferenciadas (NAKASHIMA & AKAMINE,
2005).
As células indiferenciadas ao metabolizar o FGF, são estimuladas a
diferenciação gerando fibroblastos jovens. A obtenção de fibroblastos jovens é
importante neste trabalho, pois são células que possuem maior capacidade de
proliferação e síntese, contribuindo para um melhor resultado. Por tanto, a
aplicação dos fibroblastos diretamente na derme sobre as rítides ou linhas de
expressão, tem o intuito de estimular a produção de novas células, colágeno e
elastina e ainda incrementar a nutrição do local, agindo sobre os tecidos que se
encontram desnutridos e desvitalizados (GUIRRO & GUIRRO, 2002).
A infusão de fibroblastos jovens nas rítides contribui para ativação do
metabolismo celular cutâneo, pois a aplicação de células em alto potencial de
síntese e o processo inflamatório, causado pela introdução da agulha,
contribuem para a mobilização de células endoteliais, mastócitos, fibroblastos,
macrófagos, e células migratórias (leucócitos sanguíneos) (SPECTOR, 1980;
GUIRRO & GUIRRO, 2002).
Em nosso trabalho a região de melhor preenchimento das rítides foi a
periorbital, região esta que apresenta pele mais fina e de fácil preenchimento
quando comparado com a região perioral. Na região periorbital a quebra de pele
não é profunda, não necessitando de grande reposição de matriz extracelular,
obtendo-se assim, resultados satisfatórios e visíveis. As regiões perioral e sulco
apresentam grande profundidade necessitando de grande quantidade de matriz
para seu preenchimento, até mesmo nos tratamentos convencionais (ácido
hialurônico, toxina botulínica), porém muitas vezes ainda não satisfatório. Os
resultados não satisfatórios obtidos no preenchimento das rítides das pacientes
neste trabalho, onde não se observou mudanças visuais, podem estar
relacionados com a atividade metabólica individual de suas células e com as
regiões de grande profundidade de quebra. Pois em cada cultivo se obteve
número celular diferente, porém não significativos.
As linhas de expressão por sua enorme importância estética, particularmente no
sexo feminino, como sinal do desaparecimento da juventude, é motivo de
atenção especial e de procura de cuidados corretivos e tratamentos (ESTEVES
e cols., 1991). As pacientes submetidas ao protocolo de rejuvenescimento facial
através da infusão de fibroblastos nas rítides, obtiveram melhora da qualidade
do tecido cutâneo da face e atenuação das linhas de expressão, com

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

153
UNISA - Universidade de Santo Amaro

consequente melhora da auto-estima, satisfação pessoal e aparência estética.

CONCLUSÃO:
• Foi possível estabelecer um protocolo de cultura de fibroblastos de pele
humana, a partir de cultivo primário desses fibroblastos oriundos de um sítio da
virilha clinicamente saudável.
• A viabilidade celular acima de 90%, detectada através do método de exclusão
do corante Tripan Blue permite o uso destas células com segurança em
pesquisas posteriores.
• O resultado do procedimento de infusão de fibroblastos nas rítides sugere o
aumento do número celular e de matriz extracelular regendo a melhorar da
tonicidade cutânea e atenuação de linhas de expressão.

REFERÊNCIA BIBLIOGRÁFICA:
BAILEY, F. R.; COPENHAVER, W. M.; BUNGE, R. P.; BUNGE, M. B. 1973.
Histologia. 1. São Paulo: Ed. Edgar Blücher.

BAXTER, L. C.; FRAUCHIGER, V.; TEXTOR, M.; AP GWYNN, I.; RICHARDS,


R. G. 2002. Fibroblast and osteoblast adhesion and morphology on calcium
phosphate surfaces. Eur Cell Mater. v.4, 1-17.

ESTEVES, J.A.; BAPTISTA, A. P.; RODRIGO, F. G. 1991. Dermatologia. 1. ed.


São Paulo: Ed. Fundação Calouste Gulbenkan.

FREI, V; PERRIER, E; ORLY, I; HUC, A. 1988. Activation of fibroblast


metabolism in a dermal and skin equivalent model: a screening test for activity of
peptides. International Journal of Cosmetic Science. v. 20, 159-173.

GRAGNANI, A.; GIANNOCCARO, F. B.; SOBRAL, C. S.; FRANÇA, J. P.;


FERREIRA, L. M. 2007. Dimethylaminoethanol Affects the Viability of Human
Cultured Fibroblasts. Aesthetic Plastic Surgery, 31: 711 – 718.

GUIRRO, E.; GUIRRO, R. 2002. Fisioterapia Dermato-Funcional: fundamentos,


Recursos, Patologias; 3. ed. São Paulo: ED Manole.

IKADA, Y. 2006. Challenges in tissue engineering. Journal of the Royal Society


Interface. v.3, n.10, 589-601.

KEIRA, S. M; FERREIRA, L. M.; GRAGNANI, A.; DUARTE I. S.; SANTOS, I.A.N.


2004. Experimental model for fibroblast culture. Acta Cir Brás, V 19 Edição
especial, 11-16.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

154
UNISA - Universidade de Santo Amaro

KENET, R. D. 2000. Digital imaging in dermatology. Clinics in Dermatology.


V.13, 381–392.

KURU, L.; PARKAR, M. H.; GRIFFITHS, G. S.; NEWMAN, H. N.; OLSEN, I.


1998. Flow cytometry of gingival and periodontal ligament cells. J. Dent. Res.
Washington, v.77, n.4, 555-564.

MOORE, K. A.; LEMISCHKA, I. R. 2006. Stem Cells and Their Niches. Science.
311, 1880-1885.

MORAES, S. G.; JOAZEIRO, P. P. 2005. Fibroblasto. In: CARVALHO, H. F.;


COLLARES, C. B. Células – Uma abordagem multidisciplinar. 1ª ed. Barueri,
SP. Malone, 22 -33.

NAKASHIMA, M.; AKAMINE, A. 2005. The application of tissue engineering to


regeneration of pulp and dentin in Endodontics. J Endod, Baltimore, v. 31, no.
10, 711-718.

ORIÁ, R. B.; BRITO, G. A. C.; FERREIRA, F. V. A.; SANTANA, E. M.;


FERNANDES, M. R. 2003. Estudo das alterações relacionadas com a idade na
pele humana, utilizando métodos de histomorfometria e autofluorescência. An
Bras Dermatol, 78 (4): 425-34.

PAN, H.; JIANG, H. L.; CHEN, W. L. 2006. Interaction of dermal fibroblasts with
electrospun composite polymer scaffolds prepared from dextran and polylactide
coglycolide. Biomaterials, v.27, n.17, 3209-3220.

PAPALÉO, N. M. 2002. Gerontologia: A Velhice e o Envelhecimento em Visão


Globalizada; 1. São Paulo: Ed. Atheneu.

PAPINI, S., CECCHETTI, D., CAMPANI, D., FITZGERALD, W., GRIVEL, J. C.,
CHEN, S., MARGOLIS, L.; REVOLTELLA, R. P. 2003. Isolation and Clonal
Analysis of Human Epidermal Keratinocyte Stem Cells in Long-Term Culture.
Stem Cells, 21:481-494.

RESENDE, D. M.; BACHION, M. M.; ARAÚJO, L. A. O. 2006. Integridade da


pele prejudicada em idosos: estudo de ocorrência numa comunidade atendida
pelo Programa Saúde da Família. Acta paul. enferm. São Paulo, 19 (2).

SATO, J. D.; HAYASHI, I.; HAYASHI, J.; HOSHI, H.; KAWAMOTO, T.;
MCKEEHAN, W. L.; MATSUDA, R.; MATSUZAKI, K.; MILLS, K. H. G.;
OKAMOTO, T.; SERRERO, G.; SUSSMAN, D. J.; KAN, M. 1994. Specific cell

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

155
UNISA - Universidade de Santo Amaro

types and their requirements. In: DAVIS, J. M. (Ed.). Basic Cell Culture: a
practical approach. Oxford University Press: New York. 181-222.

SOUTO, L. R. M.; REHDER, J.; VASSALLO, J.; CINTRA, M. L.; KRAEMER, M.


H. S.; PUZZI, M. B. 2006. Model for human skin reconstructed in vitro composed
of associated dermis and epidermis. Med J. 124(2):71-6.

SPECTOR, W. G. 1980. An Introduction to General Pathology. Churchill


Livingstone, 2nd edition, 17-26.

YAMAMOTO, Y; OBAYASHI, K; OKANO, Y; SATOH, Y; MASAKI, H.;


FUNASAKA, Y. 2006. Efficacy of thermal stimulation on wrinkle removal via the
enhancement of collagen synthesis. Journal of Dermatological Science
Suplement. v. 2, S39-S49.

YU, H., FANG, D.; KUMAR S. M.; LI, L.; NGUYEN, T. K., ACS, G.;HERLYN M.;
XU, X. 2006. Isolation of a Novel Population of Multipotent Adult Stem Cells from
Human Hair Follicles. American Journal of Pathology, vol. 168, No. 6
________________________________________________________________
Universidade de Santo Amaro - UNISA e Instituto de Pesquisas de Células
Tronco - IPCTRON.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

156
UNISA - Universidade de Santo Amaro

EFEITOS DA PRIVAÇÃO AGUDA DE SONO TOTAL SOBRE A


EVOCAÇÃO DE UMA TAREFA DISCRIMINATIVA EM
CAMUNDONGOS
LUCIANO FERNANDES DOS SANTOS(1)

LUCIENNE COLOMBO MARTINI(2),LUCIENNE COLOMBO MARTINI(3)(Orientadores)


Ciências Biológicas
INTRODUÇÃO:
Recentemente, relatamos que a privação aguda de sono total (PST) por 6 horas
imediatamente antes da sessão de treino induz amnésia em camundongos
submetidos à tarefa de esquiva discriminativa em labirinto em cruz elevado (ED-
LCE). Nesse cenário, enquanto a maioria da privação de sono encontrada em
nossa sociedade é a privação de sono total, seus efeitos sobre a evocação da
memória ainda permanecem desconhecidos.

OBJETIVO:
O objetivo do presente estudo foi investigar os efeitos da PST por 6h
consecutivas sobre a evocação de camundongos na ED-LCE.

METODOLOGIA:
Camundongos Swiss machos com 03 meses foram submetidos à sessão de
treino na ED-LCE (1). Esse modelo animal consiste em expor os animais a um
labirinto em cruz elevado modificado, no qual durante a sessão de treino, eles
recebem um estímulo aversivo (luz e jato de ar frio) quando entram no braço
fechado aversivo (Av) – mas não quando entram no braço fechado não-aversivo
(NAv). Simultaneamente, os camundongos evitam os dois braços abertos (Ab)
do aparelho. Então, aprendizado e memória são avaliados pela comparação
entre os tempos de permanência nos braços fechados Av e NAv nas sessões
de treino e de teste, respectivamente. A ansiedade é avaliada pela porcentagem
de tempo de permanência nos braços abertos e a atividade locomotora é
avaliada pelo número total de entradas em todos os braços do aparelho. Dessa
forma, os camundongos foram treinados na ED-LCE. Dez dias após o treino, os
camundongos foram privados agudamente de sono total por 6 horas
consecutivas (grupo PST) ou foram mantidos em suas gaiolas moradia (grupo
controle – CTRL). A PST teve início às 7h e término às 13h e o método da
“interferência gentil” (gentle handling)(2) foi empregado. Imediatamente após o
término da PST, os camundongos foram testados.

RESUMO:
Durante a sessão de treino, não foram verificadas diferenças entre os grupos,

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

157
UNISA - Universidade de Santo Amaro

demonstrando que ambos apresentaram níveis basais semelhantes de


aquisição, emocionalidade e atividade locomotora. Na sessão de teste, a
ANOVA de duas vias seguida pelo teste de Duncan revelou que enquanto o
grupo CTRL evitou significativamente o braço fechado Av, o grupo PST
apresentou exploração semelhante de ambos os braços fechados. Ainda nessa
sessão, o grupo PST apresentou um aumento no número total de entradas.
Tomados em conjunto, nossos resultados sugerem que a PST por 6h foi capaz
de promover déficits de evocação de uma tarefa associativa (esquiva
discriminativa) em camundongos. Tais resultados estão de acordo com diversos
trabalhos que evidenciam os efeitos deletérios da privação de sono,
especialmente o sono paradoxal (3), sobre as diversas fases de formação da
memória.

CONCLUSÃO:
Nossos resultados demonstraram que a privação aguda de sono total por 6
horas – uma condição mais translacional de privação prolongada de sono – é
capaz de induzir déficits de evocação em camundongos em uma tarefa de
esquiva discriminativa, bem como aumentar a atividade locomotora de
camundongos.

REFERÊNCIA BIBLIOGRÁFICA:
1. SILVA, R.H.; FRUSSA-FILHO, R. The plus-maze discriminative avoidance
task: a new model to study memory-anxiety interactions. Effects of
chlordiazepoxide and caffeine. J. Neurosci. Methods. 102:117-25, 2000.
2. TOBLER, I.; DEBOER, T.; FISCHER, M. Sleep and sleep regulation in normal
and prion protein-deWcient mice. J.Neurosci. 17:1869-79, 1997.
3. ALVARENGA, T.A.; PATTI, C.L.; ANDERSEN, M.L.; SILVA, R.H.;
CALZAVARA, M.B.; LOPEZ, G.B.; FRUSSA-FILHO, R.; TUFIK, S. Paradoxical
sleep deprivation impairs acquisition, consolidation, and retrieval of a
discriminative avoidance task in rats. Neurobiol. Learn. Mem. 90:624-32, 2008.

________________________________________________________________
Co-autores: Leandro Sanday (b), Karina Agustini Zanin (b,c), Helaine Arrais
Fernandes (b,c), Monica Levy Andersen (c), Sérgio Tufik (c), Camilla de Lima
Patti (b,c), Roberto Frussa Filho (b)

(a) Faculdade de Farmácia da Universidade de Santo Amaro, Departamentos


de (b) Farmacologia e de (c) Psicobiologia da Universidade Federal de São
Paulo

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

158
UNISA - Universidade de Santo Amaro

Eficiência das armadilhas de interceptação e queda (Pitfall)


durante o levantamento da Herpetofauna do Parque Ecológico
Guarapiranga
RENATO AUGUSTO MARTINS(1)

ELIANA DE OLIVEIRA SERAPICOS(2)(Orientadores)


Ciências Biológicas
INTRODUÇÃO:
Os anfíbios e répteis constituem o que chamamos de herpetofauna. Formam
um grupo proeminente em quase todas as taxocenoses terrestres. Atualmente,
cerca de 6.347 espécies de anfíbios já foram descritas em todo mundo e, mais
de 8.000 espécies de répteis. Mais de 80% da diversidade da herpetofauna
ocorre em regiões tropicais. Os ambientes florestais são extremamente ricos em
espécies de anfíbios e répteis, principalmente, anuros, lagartos e serpentes.
As armadilhas de interceptação e queda podem ser utilizadas em vários tipos
de estudo, incluindo levantamento de riqueza, comparação de abundância
relativa, estudos que envolvem marcação e captura, estudos sobre
sazonalidade e amostragens de presas potenciais de carnívoros. Este tipo de
armadilha otimiza o esforço amostral e captura espécies raras e de difícil
visualização, pois intercepta os animais ao longo do seu curso de
deslocamento, conduzindo-os para as cercas-guias e, posteriormente, para
dentro dos baldes.

OBJETIVO:
O objetivo deste trabalho é verificar a eficiência das armadilhas de
interceptação e queda (Pitfalls), identificando taxonomicamente e quantificando
a herpetofauna do Parque Ecológico Guarapiranga/SP.

METODOLOGIA:
De acordo com a metodologia de Cechin & Martins (2000) os estudos devem
ser adaptados, principalmente quanto a quantidade e dimensão de seus
recipientes utilizados. Sendo assim em cada área de amostragem foi instalada
uma linha de armadilhas contendo 4 baldes ( 105 litros ) conectados por 10m de
cerca-guia (Fig. 1) e 1 metro de recuo em cada extremidade (com 50 cm de
altura e aproximadamente 10 cm abaixo da superfície) (Fig.2), resultando em
séries de 32 m de extensão cada, totalizando 2 linhas, 8 baldes e 64 m de
cerca-guia. A cerca guia passa sobre a região central de cada balde.
Os referidos baldes foram perfurados para drenagem da água de chuva,
eventualmente acumulada. No interior de cada balde foi colocada uma placa de

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

159
UNISA - Universidade de Santo Amaro

isopor (20 x 20 x 1,0 cm), funcionando como superfície de apoio em dias


chuvosos. As amostragens dos anfíbios e répteis foram realizadas em 8
campanhas de 32 dias, tardes e noites nos meses de Março à Outubro.
Durante a amostragem (cada campanha), os baldes permaneceram abertos por
quatro noites seguidas e as armadilhas foram inspecionadas diariamente. Este
cuidado foi tomado para evitar possíveis efeitos de sazonalidade climática e
predação entre as espécies coletadas.
Além disso, alguns répteis foram amostrados fortuitamente através de captura
realizada pelos colaboradores do Parque Ecológico Guarapiranga. Todos
exemplares de répteis foram medidos, sexados e soltos.

RESUMO:
Ao longo do período de estudo e considerando o método conjuntamente à
captura realizada por colaboradores do Parque Ecológico Guarapiranga, foram
coletados 12 exemplares de 4 espécies de anfíbios e 15 exemplares de 8
espécies de répteis. Todos os anfíbios capturados nos pitfalls pertencem à
ordem Anura distribuídas entre três famílias (Leptodactylidae, Craugastoridae e
Brachycephalidae). Entre as 7 espécies de répteis, foram coletados 6 serpentes
(5 da família Colubrídae e 1 da família Viperídae) e três lagartos pertencentes a
família Leiosauridae.
Os pontos 1 e 2 foram compostos por 4 baldes: A,B,C e D. A abundância do
total de exemplares capturados no ponto 1, foi de 5 exemplares, já no ponto 2
foram capturados 7 exemplares. É importante ressaltar a eficiência do balde B
no ponto 2, onde chegou a capturar 4 indivíduos. Há também dois indivíduos,
Haddadus binotatus e Leptodactylus marmoratus,,que foram coletados nos
intervalos das armadilhas. Ambos encostados e pareados à cerca-guia, onde
possivelmente cairiam nas armadilhas.
Muitos anfíbios da Mata Atlântica dependem da integridade da floresta para a
sua sobrevivência. O desmatamento os expõe à luz direta do sol, levando à
dessecação de seus corpos e reduzindo a disponibilidade de abrigos e a oferta
de alimentos. Felizmente, a Região do Parque Ecológico Guarapiranga está em
recuperação, aos poucos e gradativamente, pois a região antes de se tornar um
Parque Ecológico, havia sido totalmente desmatada e transformada em
fazendas, conseqüentemente em pastos. Este desmatamento reflete nas
espécies capturadas nesse estudo. Mesmo que as espécies sejam de áreas
florestadas, todas as espécies são consideradas “resistentes” a impactos, e
tipicamente espécies nativas da Mata Atlântica. O estudo foi realizado entre os
meses de Janeiro a Outubro de 2009. Contudo, a instalação das armadilhas de
interceptação e queda só foi realizada no mês de março (final da estação
chuvosa). Os meses de abril, maio, junho, julho e agosto representam a estação

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

160
UNISA - Universidade de Santo Amaro

de seca, período em que as condições climáticas são desfavoráveis aos


encontros ocasionais com anfíbios e répteis. Este fato se deve, principalmente,
às baixas temperaturas e escassez de alimento.
A partir de setembro, onde se inicia a estação chuvosa, os dias são mais
longos, quentes, e mais úmidos, o que demonstrou uma maior abundância das
espécies. Além de se tratar do período reprodutivo destas espécies. Estes
resultados poderiam ser mais representativos se este ano (2009) não tivesse
sido
atípico, já que neste período houve uma quantidade de chuva muito maior
quando comparado às medidas pluviométricas dos anos anteriores, refletindo
também na baixa temperatura, com médias de 15°C. Em algumas noites de
trabalho de campo foi registrada uma mínima de 8°C no interior da área de
estudo no
Parque Ecológico Guarapiranga.

CONCLUSÃO:
Os pitfall’s (armadilha de interceptação e queda), se revelaram uma
metodologia eficiente, pois permite uma padronização para este tipo de análise,
ou pelo menos quando se trata de espécies de hábito terrestre e semi-fossorial.
O ponto 2 (mais úmido) teve uma coleta de dados mais representativa que no
ponto 1. Este resultado evidencia a escolha de ambiente pelos anfíbios anuros,
já que são animais mais sensíveis ao processo de dessecação.
A metodologia não se mostrou eficiente para captura de serpentes. Contudo,
este resultado pode ter sido reflexo da variação do clima atípico no período de
estudo.

REFERÊNCIA BIBLIOGRÁFICA:
CECHIN, S.Z. & MARTINS, M. 2000. Eficiência de armadilhas de queda (pitfall
traps) em amostragens de anfíbios e répteis no Brasil. Rev. Bras. Zool. 17:729-
740

LIEBERG, S.A. 2003. Análise sucessional de fragmentos florestais urbanos e


delimitações de trilhas como instrumento de gestão e manejo no programa de
uso público do Parque Ecológico do Guarapiranga, São Paulo. Tese de
Doutorado. Instituto de Biociências. UNESP.

MALAGOLI, L.R. 2008. Anfíbios do município de São Paulo: histórico,


conhecimento atual e desafios para a conservação.Capítulo III. In: MALAGOLI,
L.R.; BAJESTEIRO, F.B.; WHATELY, M. Além do concreto: contribuições para a

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

161
UNISA - Universidade de Santo Amaro

proteção da biodiversidade paulistana. 1ª ed. Instituto Socioambiental. São


Paulo: 204 – 231.

________________________________________________________________
Palavras-chave: Pitfall, Herpetofauna, Parque Ecológico Guarapiranga.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

162
UNISA - Universidade de Santo Amaro

EFICIÊNCIA DE ESTUDO DO MEIO COMO FERRAMENTA DE


APRENDIZAGEM NO ENSINO FUNDAMENTAL II E MÉDIO
ANDREA CRISTHIANE MARTINS(1)

MARIA DO SOCORRO S PEREIRA LIPPI(2)(Orientadores)


Ciências Biológicas
INTRODUÇÃO:
Ao olharmos a história do Ensino das Ciências, constata-se que este vem
acontecendo de forma tradicional desde o final da Segunda Guerra Mundial.
Após esse período, houveram tentativas de mudanças em sua estrutura
curricular, porém não se falava ainda sobre alterações na metodologia de
ensino. Na década de 60, com a Guerra Fria, diversas mudanças políticas e
sociais implicaram em grandes alterações no ensino desta disciplina,
vinculando o processo intelectual a investigação científica Nesse mesmo
período surgiram os Centros de Ciências, que em sua maioria eram vinculados
às Universidades e que buscavam a produção de materiais didáticos,
entretanto, percebeu-se a necessidade de pesquisar novas formas de ensinar.
A partir desse momento algumas escolas, por iniciativa de seus professores,
passaram a desenvolver atividades que despertavam uma postura investigativa,
baseada na observação direta dos fenômenos e a elucidação de problemas,
entre elas destaca-se o Estudo do Meio. As primeiras manifestações
semelhantes aos Estudos do Meio surgiram nas escolas conhecidas como
anarquistas, presentes no início do século XX. Estas defendiam a construção
de uma escola em que o diálogo e os debates deveriam estar presentes, e esse
tipo de atividade de observação do meio do qual eram integrantes favoreciam
as reflexões sobre desigualdades e injustiças presentes na sociedade e
despertariam iniciativas para saná-las, todavia esse tipo de ensino logo foi
reprimido juntamente com o movimento anarquista. Já na década de 60, com o
advento das novas propostas escolares essas atividades voltaram a surgir,
agora nas escolas Vocacionais e Experimentais e na Escola de Aplicação da
Faculdade de Filosofia, Ciências e Letras da Universidade de São Paulo. O
Estudo do Meio possui etapas que vão desde a preparação ao processo de
desenvolvimento que busca com resultado a compreensão da realidade. Nos
Parâmetros Curriculares Nacionais o Estudo do Meio é definido como um
método que em virtude do contato com a realidade auxilia na construção do
conhecimento, permitindo que se atue no cotidiano social através de atividades
dentro e fora do espaço escolar. Assim através de concepções coletivas e
individuais os alunos tornam-se capazes de promover atitudes e resolver
problemas. A idéia de se estudar a realidade vai de encontro com o ensino
tradicional que utiliza-se de cópias muitas vezes sem sentido, ou do processo
de decorar fatos e regras, que inibe a formação de um raciocínio em que o

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

163
UNISA - Universidade de Santo Amaro

estudante não está envolvido na construção do pensar, deixando sua educação


sem sentido. Além disso, leva em conta as vivências e histórias de cada
educando valorizando-o com ser humano e cidadão. Além de aumentar a
percepção em relação ao meio, esse tipo de atividade promove outros aspectos
importantes na vivência do educando, instigando-o no processo de
planejamento e desenvolvendo seus aspectos individuais em relação ao seu
lado moral e social. Nessas atividades fica bem clara a integração que há entre
todas as áreas de estudo e a necessidade de uma visão interdisciplinar para
melhor compreensão do mundo, além de permitir o aumento da proximidade
entre professor aluno e entre os próprios alunos. A definição do espaço a ser
investigado pode surgir de várias demandas: professores, currículos e temas
significativos em um determinado momento. Além do espaço, um tema e uma
questão problemática precisam nortear esse trabalho. Em virtude disso,
percebe-se a necessidade cada vez maior de investir em pesquisas
relacionadas ao estudo do meio, principalmente tendo o aluno como foco
dessas investigações, uma vez que existem poucos trabalhos que visam provar
os benefícios e a importância desse tipo de metodologia no cotidiano escolar.

OBJETIVO:
Assim o objetivo geral desse trabalho é Investigar a eficiência do Estudo do
Meio como ferramenta de aprendizagem no Ensino Fundamental e Médio.
Como objetivos específicos visa-se caracterizar possíveis roteiros para
atividades de estudo do meio, verificar as recordações dos alunos em relação a
este e identificar os conteúdos adquiridos durante a atividade comparando com
a proposta pedagógica dos professores.

METODOLOGIA:
O publico escolhido para este estudo foram os alunos de uma escola da Rede
Particular de Ensino, localizada na Zona Sul do município de São Paulo. Como
este é um estudo recordatório, após a definição de quais seriam os estudos do
meio avaliados, optou-se por questionar sempre os alunos que se encontravam
em uma série subsequente a que a atividade se destinava. As séries
investigadas compreenderam os 7°Anos/ 6ªsérie do Fundamental II e 2ª e 3ª
séries do Ensino Médio. Esta escolha intercalada buscou abranger os dois
segmentos nas diversas idades que contemplam a formação desse aluno. Os
Estudos do Meio, na escola em questão, são previamente definidos em sua
maioria nas reuniões de planejamento desenvolvidas no início do ano letivo em
conjunto com todas as unidades que fazem parte desse grupo de ensino. A
partir do levantamento de quais saídas foram realizadas no ano de 2008, optou-
se pelos seguintes estudos do meio para serem averiguados: Céu – Centro de
Estudos do Universo – Brotas – São Paulo; Cidade de Parati; Hopi Hari. A
análise dos estudos dos meios dividiu-se em três etapas para cada um deles,

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

164
UNISA - Universidade de Santo Amaro

sempre levando–se em conta as características peculiares dessa atividade bem


como os aspectos cognitivos pertencentes a cada série avaliada. Etapa 1 –
Caracterização do Estudo do Meio: A caracterização ocorreu através da análise
de todo o processo de construção do roteiro, descrevendo-se as atividades e
programações propostas. Etapa 2 – Elaboração dos Questionários: Em busca
de facilitar a aplicação dos questionários bem como otimizá-los na sua
aplicação, elaborou-se um questionário único, com perguntas abertas e
fechadas para que tanto um aluno de Fundamental II quanto o de Ensino Médio
conseguissem respondê-lo. Para evitar que as respostas fossem induzidas uma
mescla entre as perguntas abertas e fechadas foi utilizada. O método Survey
cujo um dos seus principais objetivos é descrever os relatos de uma população
utilizando-se de instrumentos predefinidos, no caso deste estudo a aplicação de
um questionário pessoal, serviu como parâmetros para a sua construção. Um
pré-teste foi realizado em uma aluna a fim de identificar se esse estava claro em
sua proposta. Etapa 3 – Aplicação dos questionários: A aplicação do
questionário ocorreu em parte das salas correspondentes as séries escolhidas,
já que nem todas estavam disponíveis para o estudo devido aos problemas de
atraso nos conteúdos, enfrentados pelo recesso escolar ampliado em virtude da
Gripe H1N1. Inclusive, sendo este um dos motivos que excluiu uma das salas
de ser entrevistada, uma vez que todos os seus alunos esta se encontravam
ausentes devido há um caso positivo detectado entre eles. Não houve a
necessidade de assinatura de um termo de consentimento, porque em nenhum
momento os alunos ou a escola foi identificada, evitando assim a exposição da
imagem de ambos. Etapa 4 – Análise dos resultados: Para análise dos
resultados utilizou-se metodologias de análise de conteúdo quantitativa e
qualitativa como propõem Gobbi e Simão (2005). A mescla de metodologias foi
necessária uma vez que nas respostas abertas a determinação de categorias
ocorreu proposta de acordo com os critérios definidos pela pesquisa. Os dados
finais desta análise foram organizados de forma sistemática e comparativa, de
forma que se estabeleceu uma hierarquização dos resultados obtidos.

RESUMO:
O CEU Centro de Estudos do Universo , está inserido na Fazenda Estância
Peraltas que fica localizada em Brotas interior de São Paulo. O Objetivo Geral
dessa proposta pedagógica, segundo seus professores idealizadores, é
demonstrar ao estudante que o conhecimento não está compartimentalizado,
interligando as disciplinas de Arte, História, Geografia, Ciências, Espanhol e
Matemática. Através dessa interdisciplinaridade o aluno obterá informações
sobre o processo de desenvolvimento do homem, sua relação com o meio
ambiente e a preocupação com a postura investigadora na busca de aprimorar
seus conhecimentos e agindo em benefício da preservação do ambiente nos
seus espaços geográfico, histórico e social. Como conteúdos espera-se que

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

165
UNISA - Universidade de Santo Amaro

além de aprimorar a postura investigativa e incentivar uma consciência


interdisciplinar o aluno, compreenda a importância da astronomia para situar-se
e orientar-se nos diversos espaços, entenda a importância do estudo dos astros
para os povos do passado e respeite às relações interpessoais e à preservação
do meio ambiente. Sobre a saída pedagógica de Parati, este município esta
localizado no extremo sul do estado do Rio de Janeiro, esta saída foi realizada
em parceria com uma empresa de Ecoturismo, a Terranativa, que organiza todo
o roteiro da viagem, em conjunto com os professores, fornecendo monitores
que auxiliarão durante toda a atividade. O objetivo geral deste Estudo do Meio é
consolidar aquilo que foi aprendido nas aulas teórico-expositivas das disciplinas
relacionadas, transpondo este conhecimento às atividades práticas de campo,
por meio de observação de aspectos biológicos, geográficos, históricos,
culturais, artísticos, entre outros, bem como promover a interdisciplinaridade
entre todas as áreas envolvidas. Como conteúdos espera-se que o aluno
identifique a estrutura histórica que envolve a cidade de Parati, discuta a
respeito de desenvolvimento sustentável, a partir da identificação dos recursos
naturais presentes nos biomas identificados. Entenda os níveis de Organização
dos Seres Vivos, sua formação e obtenção de energia, níveis tróficos, cadeia e
teia alimentar, ciclo biogeoquímicos, grupos vegetais. Já o Hopi Hari é um
parque de diversões, localizado em Vinhedo. Tem por objetivo desenvolver
conceitos de física relacionados aos brinquedos, obter auxílio da disciplina de
matemática e identificar no corpo humano quais as sensações experimentadas
pelos brinquedos do parque. Foram entrevistados 27 alunos do 7°Ano/ 6ªSérie
do Ensino Fundamental II; 35 da 2ª série e 36 da 3ª série ambos do Ensino
Médio. Apesar da diversão e lazer estarem muito associados a este tipo de
ferramenta didática, entre os entrevistados aproximadamente 77% deles
relacionaram suas primeiras lembranças do Estudo do Meio em questão com
conteúdos de aprendizagem, já os outros 33% referiam-se às atividades de
lazer.
Quando questionados acerca das disciplinas envolvidas com a saída ao CEU,
nenhum aluno se recordou de todas as que estavam inseridas segundo o
material disponibilizado aos alunos pelos professores, porém 46% disseram que
as disciplinas de Ciências, Geografia e História estavam relacionadas. Sugere-
se que isso tenha ocorrido em virtude de uma associação feita com os
professores que foram de fato ao estudo. Já sobre Parati, 43% dos alunos
descreveram todas as disciplinas relacionadas ao estudo, Português, Biologia,
História e Geografia. Em relação ao Hopi-Hari, o resultado ficou em 77% de
acerto, para Matemática, Física e Biologia, em virtude de ser um número
reduzido de disciplinas e um local bem específico para aplicação de
determinadas matérias. No que diz respeito aos conteúdos pertinentes a cada
disciplina envolvida, todos os alunos nas três saídas relacionaram corretamente
o que havia sido abordado, apenas diferenciando-se no grau de profundidade

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

166
UNISA - Universidade de Santo Amaro

de suas respostas. Em relação a sua preparação para o Estudo do meio, 50%


dos alunos, disseram utilizar-se das aulas preparatórias realizadas em sala de
aula pelos professores, 20% fazem uma pesquisa pessoal do local ou do
conteúdo e 18% alegaram que não se preparam. Para os alunos do 7°Ano/
6ªsérie, aproximadamente 60% acreditam que o relacionamento com os
colegas fica muito melhor após a realizam da viagem, estreitando amizades que
já existiam e conhecendo novos amigos. Para a 2ªsérie do Ensino Médio, 50%
concluíram que as amizades são ampliadas e melhoradas com esse tipo de
atividade. Já para o 3ª série do Ensino Médio, apenas 30% disseram que o
relacionamento entre os colegas fica melhor. Isto pode acontecer nesse último
caso devido a essa saída ser menor que as outras apenas 1 dia, não permitindo
que por exemplo os mais tímidos possam encontrar tempo para se
relacionarem. Entre os melhores estudos do meio que já participaram, Parati foi
o mais mencionado, sendo a Aprendizagem o principal motivo de escolha pelos
alunos. Estes acreditam que Parati é um dos melhores locais para ser aprender
na prática, principalmente os conteúdos de Biologia. Foram mencionadas
também as saídas a Minas Gerais e Brasília realizadas no Ensino Fundamental
II por essas turmas, equilibrando-se os motivos entre aprendizagem, diversão e
fortalecimento das amizades. No Ensino Fundamental II, a saída mais citada foi
a de Araraquara, que diferentemente do Ensino Médio, seu principal motivo de
escolha, foi a possibilidade de fazer novas amizades e reforçar as já existentes.
Por fim, entre as sugestões de locais para realização de novos Estudos do Meio
envolvendo a Biologia/Ciências, os mais citados foram a Floresta Amazônica e
a cidade de Bonito.

CONCLUSÃO:
: Assim, conclui-se que a utilização do Estudo do Meio como ferramenta
didática para o ensino de Biologia/Ciências é positiva, pois os alunos
conseguem absorver e relacionar os conteúdos a essas práticas sendo dessa
forma uma ferramenta eficaz no processo de aprendizagem desse indivíduo,
uma vez que em virtude do processo investigativo que o envolve o educando
utiliza-se de sua experiência para formular diversos conceitos. Constatou-se
também, que os três roteiros avaliados são condizentes com o que se espera
desenvolver nessas atividades propostas, podendo ser inseridos nos
planejamentos escolares das disciplinas de Biologia/Ciências. E que o Estudo
do Meio é uma ferramenta importante para o desenvolvimento pessoal do
aluno, permitindo com que ele aprenda a trabalhar em grupos e a se relacionar
com pessoas diferentes a sua volta auxiliando assim na formação deste como
indivíduo dentro de um contexto social.

REFERÊNCIA BIBLIOGRÁFICA:
Silva, C. R.; Gobbi, B. C. & Simão, A. A. 2005. O Uso da análise de conteúdo

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

167
UNISA - Universidade de Santo Amaro

como uma ferramenta para a pesquisa qualitativa: descrição e aplicação do


método. Revista Organizações Rurais & Agroindustriais, 7 (1). p 70-81.
________________________________________________________________
1. Estudo do Meio; Didática; Biologia/Ciências.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

168
UNISA - Universidade de Santo Amaro

Enriquecimento Ambiental com duas espécies de Felídeos


cativos do gênero Panthera (Oken,1816)
DANILO DA COSTA SILVA(1)

ELIANA DE OLIVEIRA SERAPICOS(2)(Orientadores)


Ciências Biológicas
INTRODUÇÃO:
Pode-se definir comportamento animal como tudo o que um indivíduo for capaz
de fazer, até mesmo movimentos denominados de tanatose, que para a
percepção humana o indivíduo aparenta não fazer absolutamente nada.
Na natureza, dependendo da espécie, os animais passam a maior parte do
tempo à procura de seus alimentos, evitando predadores, procurando e
disputando parceiros para acasalar. Tendo em cada atividade uma nova
experiência e oportunidade para tomarem decisões e aprenderem com as suas
escolhas. No cativeiro, os animais têm seus alimentos fornecidos todos os dias
nos mesmos horários e são protegidos contra interações competitivas. Isso
pode fazer com que os indivíduos desenvolvam comportamentos alterados e
bem diferenciados daqueles que teriam na natureza. No entanto, animais da
mesma espécie, sexo e idade podem responder diferentemente aos estímulos
ambientais.
As estereotipias podem ser quantitativas como a superatividade ou qualitativas
como, os comportamentos que o indivíduo não apresentaria em natureza. Como
comportamentos qualitativos e sinais de bem-estar sub-ótimos, podemos citar a
caminhada sem objetivo, mastigação falsa, ingestão de água em excesso,
forrageamento mesmo após ter se alimentado, masturbação, regurgitação
alimentar seguida de reingestão, coprofagia, auto-mutilação, agressividade,
frustração, abanar a cabeça, medo, pacing, enrolar a língua e engolir ar.
A definição de bem-estar animal é vista pelas três seguintes abordagens, que
são: o estado psicológico do animal, quando o bem-estar é definido em função
dos sentimentos e emoções; o funcionamento biológico, quando as funções
orgânicas estão em equilíbrio; e por fim, de respostas fisiológicas anormais e a
vida natural que neste caso, assume-se que os animais deveriam ser mantidos
em ambientes próximos ao seu habitat natural, tendo liberdade para
desenvolver suas características e capacidades naturais, dentre elas a
expressão do comportamento.
Os ambientes cativos devem oferecer aos animais oportunidades para
expressarem seus comportamentos naturais ou semelhantes a este, através de
uma boa ambientação no recinto com árvores, troncos, piscinas e objetos
novos.
O enriquecimento ambiental ou comportamental é uma ciência que prevê um
ambiente mais complexo e interativo criado para melhorar a qualidade de vida

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

169
UNISA - Universidade de Santo Amaro

dos animais, possibilitando a estes expressarem um comportamento mais


próximo possível do exibido no meio natural. É também uma forma de otimizar o
espaço disponível para os animais cativos, promovendo uma maior interação
destes com o ambiente, respeitando as características da espécie em questão.
O enriquecimento pode reduzir estresse enquanto aumenta o bem-estar do
animal. Porém, não basta encher o ambiente de novos estímulos, deve-se
considerar o significado de cada um deles e a definição de como eles devem
ser úteis para melhorar a vida dos animais. Para tanto, é muito importante
conhecer bem o comportamento da espécie, de modo a proporcionar aos
animais estímulos biologicamente relevantes. Outra importância do
enriquecimento ambiental é o papel na conservação em zoológicos, pois ele
permite ao visitante observar os animais se comportando naturalmente,
deixando-os assim, mais satisfeitos e interessados, o que facilita o trabalho de
educação ambiental.
Na prática, o enriquecimento ambiental consiste na introdução de variedades
criativas, originais e simples nos recinto. O enriquecimento pode ser: físico, com
a implantação de novos itens no recinto como troncos e galhos; sensorial,
estimulando os cinco sentidos dos animais; cognitivo, com dispositivo mecânico
para os animais manipularem e estimular as capacidades intelectuais; social,
proporcionando relações intra ou inter-específica; e alimentar que é o mais
utilizado e proporciona aos animais uma das situações mais comuns na
natureza, que é a procura pelo seu próprio alimento.
A família Felidae é dividida em duas subfamílias: Felinae e Pantherinae,
representadas em 13 gêneros e 36 espécies. A maioria dos representantes
desta família possui hábitos crepusculares/noturnos, solitários e com a
necessidade de habitar grandes territórios, fazendo com que esses vivam em
baixa densidade. Estes animais possuem corpo flexível e musculoso, além de
membros robustos e fortes. As patas são providas de garras fortes, afiadas e
retráteis.
O gênero Panthera Oken, 1816 compreende representantes de felídeos de
grande porte, como: leão (Panthera leo), leopardo (Panthera pardus), onça-
pintada (Panthera onca) e o tigre (Panthera tigris). Todas descritas por
Linnaeus em 1758. Uma característica comum a todos os representantes de
Panthera, além do porte, que caracteriza esse gênero, é o fato de poderem
rugir.
Quase todos os felídeos selvagens estão classificados sob algum grau de
ameaça e algumas espécies são vistas como criticamente em perigo de
extinção. As principais causas dessas ameaças são a redução e a
fragmentação de seu habitat, além da contínua pressão vinda da caça, ou seja,
todas relacionadas diretamente à ação antrópica.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

170
UNISA - Universidade de Santo Amaro

OBJETIVO:
Este estudo teve como objetivo observar o comportamento de duas espécies de
felídeos pertencentes ao gênero Panthera, mantidos em cativeiro antes, durante
e após atividades de enriquecimento ambiental, no Zoológico Municipal de
Guarulhos/SP, a fim de analisar possíveis estereotipias. Qualificar e quantificar
os comportamentos e comparar o comportamento entre machos e fêmeas de
Panthera leo e Panthera onca durante as análises. Implantar atividades de
enriquecimento ambiental visando diminuir possíveis eventos comportamentais
estereotipados.

METODOLOGIA:
O presente trabalho foi desenvolvido no Zoológico Municipal de Guarulhos
(ZMG). Foram observados quatro indivíduos de Felídeos do gênero Panthera,
sendo um casal de Panthera leo e um casal de Panthera onca. O macho de
Panthera leo, foi a óbito antes que terminasse as observações.
Os métodos de observação utilizados foram o Ad libitum e o Animal Focal. O Ad
Libitum teve duração de 30 horas, sendo 15 horas para cada espécie, onde os
indivíduos foram observados, tendo os seus comportamentos registrados à
vontade e em seqüência. Essa etapa foi importante para realizar um
levantamento dos comportamentos, para a formulação do catálogo
comportamental, qualificando assim, os comportamentos. Após montar o
catálogo comportamental específico de Panthera leo e Panthera onca, foi
elaborada a ficha de campo. O método Animal Focal foi utilizado nas três
etapas: a) antes enriquecimento (AE) com observação e a quantificação de
dados etológicos; b) durante o enriquecimento (DE) onde foram implantados os
itens de enriquecimento, quantificando também os atos comportamentais; c)
pós-enriquecimento (PE), com quantificação dos atos comportamentais sem a
presença de enriquecimento.
As atividades de observação foram padronizadas previamente e ocorreram no
período matutino e vespertino, sempre no mesmo horário, sendo 2 horas para
cada período do dia, com 1 hora para cada espécie, totalizando 4 horas de
observação diária. A cada 30 segundos de observação, no time, era registrado
o que os indivíduos, macho e fêmea, de cada espécie, estavam fazendo de
forma simultânea.
Para cada etapa de observação (AE, DE e PE), o período de estudo foi de 20
dias, totalizando assim 80 horas de observações para cada etapa, 240 horas de
observação no final do experimento e 120 horas de observação para cada
espécie, sendo 40 horas para cada etapa.
No final de cada observação, eram obtidos 121 registros, sendo que o primeiro
era eliminado, pois ainda estava ocorrendo a habituação entre o observador
com a ficha de campo e com os animais. Deste modo, eram passados apenas
120 comportamentos para a Tally Shett (planilha controle).

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

171
UNISA - Universidade de Santo Amaro

Na etapa de enriquecimento, foram implantados itens visando envolver todas as


cinco categorias. Todos os itens foram avaliados previamente, inclusive pela
equipe técnica científica do ZMG, a fim de promover total segurança para os
indivíduos.
Os itens de enriquecimento eram colocados uma vez ao dia, pela manhã e
permaneciam até um dia no recinto, sendo retirados no dia seguinte pela
manhã, com exceção das folhas, feno ou outros itens naturais, os quais serviam
como novo substrato para os indivíduos.

RESUMO:
Neste estudo foram qualificados 51 atos comportamentais para Panthera leo e
61 para Panthera onca que foram agrupados em 10 categorias, sendo elas:
Alimentação; Atividades Individuais; Atividades Sociais, que foi dividida em não
afiliativos (comportamentos aparentemente prejudiciais ao convívio social),
afiliativos (comportamentos benéficos para o convívio social), e play, nos caso
de Panthera onca que ainda apresentam esse tipo de comportamento;
Descanso, que também foi dividido em quatro subcategorias, sendo repouso,
dormindo, sentado e pausa; Interação Visual; Locomoção; Manutenção;
Vocalização; Não Visível e Outros.
Com as etapas AE, DE e PE, foi possível levantar o registro de 52.800 atos
comportamentais, sendo 24.000 para Panthera leo e 28.800 para Panthera
onca. Houve a diferença de 4.800 registros, pois não foi possível observar o
macho de Panthera leo, na etapa PE devido ao seu óbito.

Panthera leo
A categoria alimentação teve aumento na etapa DE devido à implantação dos
enriquecimentos alimentares. O macho mais observava a fêmea na interação
com os enriquecimentos e descansava do que participava das atividades em si.
Fato este, semelhante como ocorre na natureza, uma vez que as fêmeas
exploram mais o ambiente enquanto o macho fica em alerta para defendê-lo. O
macho se alimentava de itens do enriquecimento quando a fêmea carregava a
estrutura que continha a recompensa e deixava cair, ou quando ela já estava
saciada.
Comportamentos bem diversificados compunham a categoria atividades
individuais. Essa categoria foi aumentada. O ato esfregar-se, no caso do macho
no período matutino, foi estimulado pelos enriquecimentos sensoriais, quando
foram utilizadas essências e principalmente odores de outros animais. A
freqüência da interação do macho com os enriquecimentos sensoriais era
relativamente alta, porém era mais freqüente quando solto, durante o registro
fotográfico e não durante a observação. No período vespertino, o macho se
esfregava sempre após vocalizar, ou antes, de afiar as garras no tronco. Com a

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

172
UNISA - Universidade de Santo Amaro

aplicação do enriquecimento, houve também um aumento do ato farejar tanto


pro macho quanto pra fêmea, porém esse comportamento se mostrou
equivalente ao forragear, onde a fêmea procurava ir atrás das recompensas
escondidas, conseqüentemente, uma maior exploração do recinto. O aumento
da utilização do recinto é considerado como sendo a quarta meta do
enriquecimento ambiental.
A categoria atividades sociais para Panthera leo, só foi possível fazer o registro
comportamental dos indivíduos convivendo socialmente nas duas primeiras
etapas, devido ao óbito do macho. A falta do convívio social na última etapa
para a fêmea desencadeou inúmeros comportamentos prejudiciais a ela, como
o pacing. Devido ao fato dos leões serem os únicos felídeos sociais, o convívio
solitário, aparentemente pode ser prejudicial, sendo importante a manutenção
de mais de um indivíduo em cativeiro. Nessa categoria, um ato benéfico ao
convívio social que teve a freqüência aumentada nos dois períodos na etapa
DE, sendo executado pelos dois indivíduos, indicando aproximação e melhor
convívio social, foi o grooming. Este ato é um indicativo de conforto e harmonia
no convívio social.
Descanso teve um aumento. Provavelmente os animais ficavam em estado de
repouso ou dormindo dentro do cambeamento. E passaram então a exibir esse
comportamento na área de exposição. Essa categoria era a segunda mais
expressiva para os dois animais mesmo antes da aplicação do enriquecimento,
sendo esse um comportamento normal ao meio natural, pois cerca de 80% do
dia, para os leões é dedicado a dormir, ou descansar.
Os animais interagiam visualmente. Dentro da categoria interação visual o ato
comportamental mais expressivo é o olhar em direção ao cambeamento, mais
comum no período vespertino, devido ao fato de estarem esperando a
alimentação. O público, muitas vezes, procura chamar a atenção dos animais,
fazendo barulho e em alguns casos, atirando objetos. Cadeira de rodas,
carrinho de bebê e mochilas, são exemplos que chamam a atenção dos animais
e em alguns casos, desencadeavam também o pacing, principalmente na
fêmea. O impacto do público pode ser considerado negativo no comportamento
dos animais cativos, pois é a única variável imprevisível pelo animal. Ao
contrário da hora da alimentação e a limpeza do recinto, a intensidade do
público e o comportamento dos mesmos, são imprevisíveis.
Na categoria locomoção, se enquadra o único comportamento estereotipado
para os animais, o pacing, que para a fêmea, sempre tinha algum motivo
aparente para a sua realização. Com a morte do macho, a fêmea passou a
fazer pacing sem motivo aparente. Assim que era solta, já se aproximava do
tanque e iniciava o ato. Esse foi um dos comportamentos alterados pela
ausência do macho. O pacing é considerado como sendo um comportamento
relacionado à irritabilidade.
O ato grooming, que se enquadra na categoria manutenção, teve um aumento

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

173
UNISA - Universidade de Santo Amaro

de freqüência na etapa DE nos dois períodos e para os dois indivíduos. Esse


ato é um indicativo de conforto e a ausência desse está relacionada à
comportamentos estereotipados. Este ato teve uma queda na freqüência na
etapa PE.
A vocalização era freqüente no período vespertino, quando os animais
esperavam pela alimentação. O macho era o indivíduo que mais vocalizava, e a
fêmea, apenas o acompanha em alguns momentos. A vocalização para o
macho era seqüenciada e alta. O ultimo rugido era o mais forte. O rugido é a
forma de comunicação positiva, de defesa ou ataque que os felinos utilizam. Na
etapa PE, com o óbito do macho, o ato vocalizar para a fêmea foi mais
freqüente. Porém, não foi muito registrada essa alteração, pois muitas vezes a
vocalização da fêmea, era curta e de aparência rouca, de tanto que ela
vocalizava, não estando no time.
Os indivíduos costumavam ficar não visível em dias quentes, devido ao
substrato do cambeamento ser de cimento queimado e mais fresco. Era comum
entrarem para o cambeamento quando a taxa de visitação era alta, sendo essa
uma forma de se privar do público e o cambeamento funcionava como um ponto
de fuga. O ponto de fuga é importante, pois os animais nem sempre querem ser
vistos. Esta categoria foi a que mais teve alteração durante a etapa DE, caindo
quase que pela metade em relação à primeira etapa. Os animais passaram
mais tempo visíveis e aproveitando mais a área do recinto. No período matutino,
essa maior permanência na área de exposição se deve as novidades que os
animais encontravam no recinto. No período vespertino, os animais
permaneciam ativos no cambeamento, esperando pela alimentação.
Na categoria outros, foram inclusos comportamentos que não foram observados
no Ad libitum. Alguns comportamentos foram freqüentes na etapa AE, mas
outros bem diferentes apareceram na etapa DE.

Panthera onca
A categoria alimentação teve aumento devido aos enriquecimentos alimentares
e a aplicação dos enriquecimentos influenciou também na categoria atividades
individual, aumentando os atos farejar e esfregar-se para o macho e a fêmea.
Os itens de enriquecimento aumentaram as atividades de brincadeira e
brincadeira social, permanecendo a freqüência deste ato alta também na etapa
PE. O ato de brincar estimula a capacidade cognitiva e motora dos animais,
além de aproximá-los.
Os indivíduos de Panthera onca, possuem um convívio social harmonioso, sem
brigas ou comportamentos prejudiciais a esse tipo de convívio. Apenas foram
dois os atos comportamentais não afiliativos observados: o de expulsar e o
afastar-se do outro. O grooming social foi um comportamento bem freqüente,
porém, com pouca duração, não sendo registrado. Tanto o grooming social,
quando o individual, era realizado em dias chuvosos, ou quando os animais se

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

174
UNISA - Universidade de Santo Amaro

molhavam no tanque. Porém, essa prática passou a ser freqüente na etapa DE.
O ato tentativa de monta, que se enquadra na categoria atividades social. Ele
sempre era realizado de forma incorreta, ao contrário. Algumas ocorrências
desse comportamento eram seqüenciadas pelo pacing devido à tentativa
frustrada de monta.
A categoria descanso nas três etapas, foi a mais freqüente para os dois
indivíduos em todos os períodos e etapas.
As onças interagiam visualmente bem mais que os leões. Todas as atividades
do público e dos animais de recintos próximos chamavam a atenção dos
indivíduos. Na natureza, espécies diferentes constantemente possuem algum
tipo de contato, seja por vocalização, odores ou até mesmo visual. No
zoológico, esse tipo de interação pode ser positiva, porém, deve-se evitar o
contato entre presa e predador, o que pode gerar estresse na presa.
O pacing, ora tinha uma causa aparente, como no caso da frustração na
tentativa de monta e na alta taxa da presença de público, ora não tinha
nenhuma causa aparente.
A vocalização foi a categoria menos expressiva, sendo a freqüência maior para
o macho na primeira etapa. A vocalização não tinha uma causa aparente.
Os registros da categoria não visível eram realizados quando os indivíduos
estavam fora do alcance de visão do observador, devido ao alto número de
público, ou quando os animais, mais comumente repousavam atrás dos troncos.
Para a categoria outros, foram inclusos comportamentos que não foram
observados no ad libitum, ou que apareceram na etapa DE.

CONCLUSÃO:
Todos os quatro indivíduos interagiram com os enriquecimentos. As fêmeas das
duas espécies foram as que mais interagiram. O macho de Panthera leo,
interagiu menos com os enriquecimentos que pediam um pouco mais de
esforço, sendo os sensoriais o que mais o agradava. A fêmea de Panthera leo
teve interação com todos os enriquecimentos, ultrapassando expectativas. No
caso de Panthera onca, após serem soltos, sempre era o macho que primeiro
chegava aos enriquecimentos. A fêmea ficava observando durante um tempo,
mas logo se aproximava e começava a interagir com o enriquecimento. Em
muitos casos, os dois interagiam juntos.
Embora atividades de enriquecimento ambiental sejam comuns nos dias de
hoje, a maioria dos zoológicos brasileiros não desenvolvem Programas de
Enriquecimento Ambiental como atividades rotineiras. Por isso, torna-se
importante o estudo e a aplicação de técnicas de enriquecimento, além do
acompanhamento cuidadoso dos resultados e a sua posterior divulgação, para
que um número cada vez maior de instituições possa fazer uso dessas técnicas
em benefício dos animais.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

175
UNISA - Universidade de Santo Amaro

Muitas vezes, enriquecimentos simples e sem custo, podem surtir efeitos


satisfatórios, como as folhas de palmeira e feno com odor de outros animais,
assim como foi utilizado no presente trabalho.
O público, durante a interação dos animais com os enriquecimentos, ficava
satisfeito por verem os animais ativos e interagindo, muitos ainda se mostravam
curiosos e freqüentemente faziam perguntas. Sendo assim, a atividade de
enriquecimento, é um bom momento para desenvolver atividades de educação
ambiental.
O uso de enriquecimento ambiental influencia positivamente o comportamento
dos animais, aumentando o repertório comportamental e comportamentos de
bem estar, como o grooming, contribuindo positivamente para a conservação
das espécies cativas.

REFERÊNCIA BIBLIOGRÁFICA:
ALTMANN, J. 1974. Observational study of behavior: sampling methods.
Behavior, 49(3): 227-267.

NOWAK, R.M. 1999. Walker’s mammals of the world. Baltimore, The Johns
Hopkins University Press, vol. 1, 6th ed., 836p.

YOUNG, R. J. 2003. Environmental enrichment for captive animals. Blackwell


Science. Oxford. 228p.

________________________________________________________________
Palavras chave: Enriquecimento Ambiental; Panthera; Comportamento; Bem-
estar animal.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

176
UNISA - Universidade de Santo Amaro

Envelhecimento e qualidade de vida da mulher no climatério.


MONIQUE LORYS ARAÚJO DE SIQUEIRA(1)

IRENE CORTINA(2)(Orientadores)
Ciências Biológicas
INTRODUÇÃO:
O envelhecimento, antes considerado um fenômeno, hoje faz parte da realidade
das sociedades. O mundo envelhece e o Brasil também, com previsão para
2025, de mais ou menos 32 milhões de pessoas com mais de 60 anos.
Teremos então entre estes, uma população mais jovem, que são os
“envelhescentes”, os idosos, os muito idosos ou idosos em velhice avançada.
As mulheres tem uma expectativa de vida maior que a dos homens, em média 7
anos a mais, com agravos naturais desta fase do ciclo vital, iniciados com o
climatério .
O modelo de referência para quase tudo que se relacione ao sucesso, beleza,
sensualidade e valorização da mulher em nossa sociedade é a juventude. ¹
Em outras culturas, em que a maturidade, a personalidade e a inteligência são
capitais mais valiosos, o medo de envelhecer não é tão grande quanto no Brasil
¹
Para as mulheres, envelhecer tem um significado completamente diferente do
que para os homens. São elas que se preocupam mais com corpo e com o
relacionamento na velhice. A contagem progressiva é inevitável. A cada instante
estamos ficando mais velhos. A questão é como encaramos esse processo.
Muitos associam esta fase à inatividade, às dificuldades e ao fim da vida. E é
por isso que muita gente tem medo de envelhecer. ¹
Envelhecer é mais do que natural. É um processo biopsicossocial gradativo de
diversas transformações, ocorridas ao longo da existência do indivíduo. ¹

OBJETIVO:
Investigar o significado do climatério como uma etapa do ciclo vital da mulher,
identificar as alterações físicas, psíquicas, emocionais e sociais no climatério,
e propor ações de promoção em saúde à mulher na fase do climatério.

METODOLOGIA:
Estudo de revisão bibliográfica de caráter descritivo e qualitativo de fontes
secundárias, onde foram expostos assuntos de saúde pública e histórico
sociais, encontrados em bases de dados SCIELLO, BDENF, pesquisas
científicas, trabalhos de conclusão de cursos e revistas on-line no período de
abril de 2001 a julho de 2009, usando como descritores as palavras; mulher,

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

177
UNISA - Universidade de Santo Amaro

envelhecimento e climatério.

RESUMO:
Climatério

O climatério é definido pela Organização Mundial da Saúde como uma fase


biológica da vida e não um processo patológico, que compreende a transição
entre o período reprodutivo e o não reprodutivo da vida da mulher. 2 É o
período que abrange a fase em que os hormônios ovarianos e gonadotróficos
hipofisários deixam de ser fabricados progressivamente. Caracteriza-se por
amenorréia e ou ciclos menstruais irregulares, até cessarem completamente. A
alteração hormonal não é abrupta, acontece gradualmente de forma regressiva
e pode levar anos, acarretando alterações físicas, biológicas e psíquicas
importantes, afetando a qualidade de vida da mulher. 3 A menopausa é um
marco dessa fase, correspondendo ao último ciclo menstrual, somente
reconhecida depois de passados 12 meses da sua ocorrência e acontece
geralmente em torno dos 48 aos 50 anos de idade.2
Utilizando o índice de Kupperman citamos os “11” principais sintomas: Ondas
de calor na face e pescoço "fogachos", sudorese noturna, insônia, suores
repentinos, sangramentos irregulares, cefaléias, alterações vasomotoras e
psicoemocionais, atrofia vaginal, instabilidade conjugal afetada pela
insegurança feminina. Estes variam de uma mulher para outra, ocasionados
pelos distúrbios hormonais femininos "estrogênios e progesterona", e é
importante saber que nem todas as mulheres reagem igualmente a este novo
período de sua vida, definido como: mudança de vida. 3

Principais agravos à saúde da mulher envelhescente no climatério.

Além do fato concreto da interrupção dos ciclos menstruais, as mulheres nessa


fase podem apresentar aumento das taxas de colesterol, doenças
cardiovasculares, Diabetes mellitus, neoplasias benignas e malignas,
obesidade, distúrbios urinários, osteoporose e doenças auto-imunes. 2
Estes agravos, que não apresentam relação direta com a diminuição da função
ovariana, podem, no entanto, provocar uma mudança na imagem que a mulher
tem de si, levando-a a insegurança e ansiedade. 2
Trataremos a seguir sobre dois temas dentre os agravos no período do
climatério em que iremos nos aprofundar no presente estudo. São eles a
sexualidade e a osteoporose. 2

Sexualidade

O envelhecimento sexual é um dos fatores mais freqüentemente apontados

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

178
UNISA - Universidade de Santo Amaro

como fonte de angústia para mulheres e homens nessa fase da vida. Os


conflitos são mais freqüentes no ocidente do que em outras culturas como a
oriental, principalmente devido à desvalorização dos indivíduos mais maduros,
incluindo as mulheres após a menopausa. 2
As modificações orgânicas que ocorrem na mulher durante o climatério não
obrigatoriamente implicam na diminuição do prazer, mas podem influenciar a
resposta sexual, que pode ser mais lenta. Em outras palavras, as alterações
fisiológicas que ocorrem, pouco influem sobre a sexualidade, entretanto, podem
limitar qualitativa e quantitativamente a resposta erótica. 2
As mulheres no climatério, mais freqüentemente após a menopausa, podem
apresentar uma lubrificação vaginal menos intensa e mais demorada, sendo
necessário, às vezes, um maior estímulo sexual. É possível ocorrer também um
adelgaçamento dos tecidos vaginais, que pode levar à dor nas relações
sexuais, tornando a perspectiva do sexo com penetração, motivo de ansiedade
e de falta de satisfação. 2
O declínio da função hormonal ovariana no climatério determina modificações
significativas nos órgão genitais internos e externos que podem influenciar a
resposta sexual. O maior efeito da deficiência estrogênica sobre a pelve é a
diminuição do fluxo sanguíneo, que pode promover alterações no aparelho
genital. Os pêlos pubianos tornam se escassos, há redução de parte do tecido
adiposo dos grandes lábios e retração dos pequenos lábios e do clitóris. As
alterações observadas na vagina devido à diminuição dos níveis estrogênicos
são, freqüentemente, mais marcantes do que as da genitália externa. 2

Osteoporose

A osteoporose é considerada pela Organização Mundial da Saúde (OMS) como


a “Epidemia Silenciosa do Século”, atualmente um problema de saúde pública
no mundo inteiro devido ao aumento na expectativa de vida das populações.
Afeta indivíduos de maior idade, de ambos os sexos, principalmente mulheres
após a menopausa, que também apresentam mais fraturas. No Brasil, somente
uma a cada três pessoas com osteoporose é diagnosticada e destas somente
uma em cada cinco recebe algum tipo de tratamento. A osteoporose se
desenvolve como decorrência de uma desordem de remodelação óssea. 2
Na formação óssea vários são os fatores que influenciam, sendo os nutricionais
e os hormonais os de maior importância. As vitaminas D, A e C, além do Cálcio,
Magnésio, Boro, Manganês e vitamina K são imprescindíveis para a formação
de massa óssea. As deficiências de sais minerais, vitaminas essenciais e
proteínas na alimentação acarretam distúrbios na função osteoblástica. Os
hormônios sexuais femininos (estrogênios), de algum modo desempenham um
papel importante na determinação da velocidade de maturação do tecido ósseo.
2

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

179
UNISA - Universidade de Santo Amaro

A densitometria mineral óssea (DMO) é o exame de referência para o


diagnóstico da osteoporose realizada pela avaliação da coluna lombar, do colo
do fêmur, e antebraço, segundo os critérios da OMS. Deverá ser realizada em
mulheres consideradas de alto risco para osteoporose e de apresentar fratura. 2
Em uso experimental, os estrogênios têm demonstrado que induzem um
aumento da osteogênese, aparentemente devido a uma inibição na função de
reabsorção do PTH (paratormônio). Baseado nesse efeito sobre a reabsorção
óssea, os estrogênios são ainda utilizados no tratamento da osteoporose. 2

Ações de promoção à saúde e prevenção dos agravos.

O tratamento pela administração de hormônios visa, em especial, combater os


sintomas vasomotores, o ressecamento vaginal, que causa a dispareunia (dor
na penetração) e da pele, preservar a massa óssea, melhorar o sono, impedir a
deteriorização da função cognitiva e estimular a libido. Os medicamentos mais
usados na terapia hormonal são os estrogênicos e os progestógenos. 2
Os efeitos colaterais da terapia hormonal são: Dor nas mamas, cólicas
abdominais, alterações de humor, fadiga, depressão, irritabilidade, alterações
na pele, ganho de peso, ansiedade e dores generalizadas, náuseas, distúrbios
gastrointestinais (quando utilizados por via oral), sensibilidade mamária, dor de
cabeça, retenção de líquido, edema; provável estímulo a leiomiomas e
endometriose sendo dependentes da dose e do medicamento usado. 2
Para prevenção da osteoporose podemos enfatizar que os nutrientes mais
diretamente associados com a prevenção da perda óssea são o cálcio e a
vitamina D. A vitamina D está presente em alimentos como leite e seus
derivados e nos ovos, mas a sua melhor fonte é a exposição ao sol, que ativa a
pró-vitamina D. O consumo de cálcio deve ser estimulado durante a infância e
adolescência para que haja uma boa formação do tecido ósseo, essencial na
prevenção da osteoporose. A principal fonte de cálcio é o leite e seus
derivados, porém para o adulto deve ser incentivado o consumo desses
alimentos desnatados, para não exceder o consumo de gordura animal. Vale
ressaltar que a prática de atividade física também aumenta a absorção de
cálcio. 2
A fitoterapia é uma terapêutica caracterizada pelo uso das plantas medicinais e
suas diferentes formas farmacêuticas, sem a utilização de substâncias ativas
isoladas, ainda que de origem vegetal. Conceitualmente, fitoterápico é todo
medicamento obtido empregando-se exclusivamente matérias-primas ativas
vegetais. É caracterizado pelo conhecimento da eficácia e dos riscos de seu
uso, assim como pela reprodutibilidade e constância de sua qualidade. A sua
eficácia e segurança são validadas por meio de levantamentos
etnofarmacológicos de utilização, documentações técnico-científicas em
publicações ou ensaios clínicos. Para o climatério descompensado,

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

180
UNISA - Universidade de Santo Amaro

particularmente, existem fitoterápicos com propriedades estimulantes sobre os


receptores hormonais específicos (receptores beta), melhorando assim, as
manifestações clínicas apresentadas. O grande diferencial desses fitoterápicos
é a sua ação altamente seletiva, sendo considerados os Moduladores Seletivos
dos Receptores Estrogênicos (SERMs), o que fazem com que tais substâncias
tenham baixíssimos índices de efeitos colaterais.2
Terapias alternativas naturais têm sido buscadas e seriam capazes de
proporcionar os benefícios da TRH sem provocar efeitos colaterais e sem
contra-indicações, como exemplo o gérmen de soja (isoflavona). Estudos
evidenciam que a isoflavona diminui a intensidade e a freqüência dos sintomas
vasomotores em mulheres na menopausa. A dieta rica em soja parece também
ser benéfica para o sistema cardiovascular, pelo efeito favorável sobre o efeito
lipídico. 3
A prática regular de exercício físico resulta em muitos benefícios para
organismo, melhorando a capacidade cardiovascular e respiratória, promovendo
o ganho de massa óssea, a diminuição da pressão arterial em hipertensas, a
melhora na tolerância à glicose e na ação da insulina. Portanto, as mulheres
devem ser encorajadas a realizar atividade física regularmente. 2
É de fundamental importância que haja um equilíbrio entre a ingestão de
calorias e o gasto energético para que ocorra a redução de peso. O exercício
escolhido pela mulher no climatério deve ser agradável, acessível e fácil de
fazer, contribuindo assim para seu bem-estar, auto-estima e regularidade. São
recomendadas atividades de variadas naturezas, dando-se prioridade aos
exercícios aeróbicos (caminhada, natação, hidroginástica) e à musculação,
desde que devidamente orientados por profissionais. 2
Os exercícios físicos estimulam a secreção de endorfinas hipotalâmicas,
substâncias estas envolvidas na termoregulação hipotalâmica, reduzindo os
sintomas vasomotores. Salienta ainda que promova o fortalecimento muscular,
a manutenção da mobilidade articular além de menor acúmulo de gordura. A
atividade física contribui ainda para a melhora da imagem corporal, aumentando
a auto-estima feminina. 3

CONCLUSÃO:
Este estudo enfatizou a importância de uma assistência humanizada as
mulheres envelhescentes. Entendemos que essas mulheres passam por
inúmeras transformações biológicas, psíquicas e sociais. São transformações
normais que fazem parte do envelhecimento, devido à deficiência hormonal que
acomete as mulheres no período do climatério e da menopausa. Devido ao
aumento da expectativa de vida das mulheres no contexto mundial, se insere
um urgente estímulo à investigação e estudos sobre o fenômeno,
proporcionando assim um melhor atendimento, compreensão e orientação das

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

181
UNISA - Universidade de Santo Amaro

pacientes que vivenciam esse momento, sabendo que a aceitação contribui


favoravelmente para uma menor sintomatologia climatérica.
O papel do Enfermeiro no desenvolvimento de qualidade de vida das mulheres
que vivenciam esse período é importante, pois o mesmo possui um amplo leque
de atividades que pode desempenhar na promoção da saúde das pacientes,
sendo primeiramente acolhedor, educador e orientador. Espera-se que esse
estudo ofereça uma maior consistência teórica e técnica quando ao
entendimento da mulher no climatério.
No atual contexto mundial onde a globalização e a longevidade preconizam a
beleza, a qualidade de vida e o envelhecimento ativo, o Enfermeiro deve ser
participante, e envolvido com as ações desenvolvidas por outros profissionais
da saúde.

REFERÊNCIA BIBLIOGRÁFICA:
1 – Mouta C. Estilo de viver - Medo de envelhecer sem neuroses. Publicado em:
20.11.2008. Citado em 01.10.09. Disponível em:
http://msn.bolsademulher.com/estilo/materia/medo_de_envelhecer/55332/3

2 – Ministério da saúde – Secretaria de atenção à saúde. Manual de atenção à


mulher no climatério / Menopausa. Série A, Normas e manuais técnicos, Série
direitos sexuais e direitos reprodutivos – Brasília Distrito federal, caderno 9,
2008.

3 – Aragão CO, assistência de Enfermagem à mulher no climatério:


Enfrentamento feminino das alterações biopsicossociais. Publicação em: 06
julho 2007. Citado em: 01.outubro.09
Disponível em: http://www.webartigos.com/articles/20889/1/assistencia-de-
enfermagem-a-mulher-no-climaterio-enfrentamento-feminino-das-alteracoes-
biopsicossociais/pagina1.html

________________________________________________________________
1 - Aluna concluinte do curso de graduação de Enfermagem da Universidade de
Santo Amaro UNISA – São Paulo/SP
Monique_lorys@msn.com
2 - Orientadora e Enfermeira – Mestre em Gerontologia Social – Docente do
Curso de Graduação de Enfermagem da universidade de Santo Amaro UNISA -
São Paulo/SP

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

182
UNISA - Universidade de Santo Amaro

Estudo comparativo de constituintes nutricionais e do teor de


mercúrio total, cádmio e chumbo em peixes comercializados
para consumo humano na cidade de Cubatão litoral de São
Paulo – ênfase à relação: ingestão de mercúrio e práticas
alimentares
BÁRBARA CORTOPASSI FONSECA(1)

DEBORAH INES TEIXEIRA FAVARO(2)(Orientadores)


Ciências Biológicas
INTRODUÇÃO:
A região de Cubatão é considerada um pólo industrial e como decorrência
dessas atividades, ocorre degradação ambiental. Apesar das indústrias locais
possuírem programas para controlar a poluição, o histórico ambiental negativo
da região resultou numa carga poluente superior à capacidade de assimilação
(Nascimento et al., 2006).
De acordo com CETESB (2003), o município de Cubatão é tradicionalmente
industrial. Em meados do século XX, a cidade de Cubatão foi escolhida para
receber a instalação de várias indústrias (químicas, petroquímicas,
siderúrgicas), devido a sua proximidade tanto da capital quanto do porto de
Santos.
A localização do município (muito próximo à Serra do Mar) interfere na
circulação atmosférica local. A presença de inúmeras indústrias poluidoras,
associadas a esse fator, gera um acúmulo de poluentes, que podem ficar
confinados junto à Serra, gerando graves conseqüências ambientais. As áreas
industriais encontram-se praticamente cercadas pela Serra do Mar. Esse fato
vem sendo amenizado nos últimos anos, com a instalação de filtros e com a
fiscalização mais efetiva tanto do setor público quanto das próprias empresas.
O acumulo de poluentes pode acarretar também em poluição hídrica, motivo
pelo qual o Rio Perequê é monitorado regularmente, uma vez que esse rio é
utilizado como área de lazer pela população. Esses fatos deixaram o município
com poucos atrativos turísticos, portanto, ele não sofre nenhuma conseqüência
devida à população flutuante, fato comum nos demais municípios do litoral
(CETESB, 2003).
Os cuidados em relação à poluição têm se concentrado na propriedade de que
muitos poluentes (como metais pesados) possuem a capacidade de se
acumular no ambiente, podendo ser transportados via cadeia alimentar para
diversos níveis tróficos. Este efeito culmina com a ocorrência das maiores taxas
de contaminação nos níveis mais altos da cadeia trófica. Entre as atividades
industriais que geram resíduos no Pólo Industrial de Cubatão, destaca-se a
indústria siderúrgica de base, por utilizar metais diretamente como matéria

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

183
UNISA - Universidade de Santo Amaro

prima, liberando para o meio ambiente ampla variedade de produtos poluentes


(Nascimento et al., 2006).
O acumulo de poluentes devido à atividade industrial na região pode acarretar
em poluição hídrica (CETESB, 2003).
Hoje em dia os peixes constituem-se em importante fonte de estudo, pois
podem absorver e acumular em seus organismos contaminantes de grande
interesse por causa dos seus efeitos tóxicos nos próprios peixes e nos
organismos que os consomem, como o próprio ser humano.

OBJETIVO:
O objetivo do trabalho foi avaliar o teor de mercúrio (Hg), cádmio (Cd) e chumbo
(Pb) em peixes, bem como determinar alguns micronutrientes (Ca, K, Na, Se e
Zn) e outros elementos traço (As, Br, Co, Cr e Rb) em músculos de pescados
mais consumidos pela população de Cubatão, estado de São Paulo.

METODOLOGIA:
Neste estudo as seguintes espécies carnívoras foram analisadas: Corvina
(Micropogonias furnieri), Perna de Moça (Menticirrhus americanus), Pescada
(Macrodon ancylodon) e planctívoras, Sardinha (Sardinella braziliensis) e
Tainha (Mugil liza), num total de 58 amostras. Todas as espécies foram
adquiridas em peixarias locais da região. As amostras compradas foram
avaliadas quanto aos indicadores de qualidade para pescados e caracteres
organolépticos externos (olhos, guelras e escamas). Após a classificação,
pesagem e medição e retirada dos músculos, as amostras foram filetadas e
separadas.
As amostras foram secas em estufa ventilada a 45°C até peso constante. Após
a secagem, os músculos foram triturados e homogeneizados. Todas as
amostras, após esta secagem, foram armazenadas em refrigerador até a sua
utilização.

Os elementos traço foram determinados por meio da técnica de Analise por


Ativação com Nêutrons (NAA), os elementos tóxicos (Cd e Pb) por
espectrometria de absorção atômica com forno de grafite (GF AAS) e Hg total,
por meio da técnica de espectrometria de absorção atômica com geração de
vapor frio (CV AAS). Os métodos foram validados, em termos de precisão e
exatidão, por meio da análise de materiais de referência com valores
certificados para os elementos estudados.

RESUMO:
Os intervalos de concentração (peso úmido) para os elementos analisados nas
espécies foram: As (392 – 3330 µg kg-1); Br (2,0 – 9,5 mg kg-1); Ca (108 –
2311 mg kg-1); Co (1,0 – 21,8 µg kg-1); Cr (0,01 – 0,32 mg kg-1); K (2823 –

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

184
UNISA - Universidade de Santo Amaro

4436 mg kg-1); Na (256 – 3039 mg kg-1); Rb (0,22 – 2,3 mg kg-1); Se (290 -


6257 µg kg-1) e Zn (1,6 – 17,9 mg kg -1).

Quanto aos teores de Hg, os resultados apresentaram uma grande variação de


concentração entre os indivíduos da mesma espécie e entre as espécies
analisadas. Dentre as espécies analisadas, a Corvina foi a que apresentou os
maiores valores de Hg total (41 a 348 µg kg-1). Em seguida, as espécies Perna-
de-Moça (43 a 184 µg kg-1), Pescada (12 a 62 µg kg-1), Sardinha (26 a 135 µg
kg-1) e Tainha (3 a 23 µg kg-1).

Para os elementos tóxicos Cd e Pb, os intervalos de concentração obtidos


foram : Cd (2,00 - 44,6 µg kg-1) e Pb (21,5 – 1069 µg kg-1). Esses resultados
são preliminares.

CONCLUSÃO:
O método de NAA e o método de CV AAS permitiram determinar as
concentrações dos elementos com exatidão e precisão adequada, conforme
confirmadas pela análise dos materiais de referência utilizados. Concluiu-se que
a espécie que apresentou os maiores valores de concentração para os
micronutrientes (Ca, Fe, K, Na, Se, Zn) foi a Sardinha. A espécie Corvina
apresentou valores similares para Ca e maiores para Se. Com relação ao As
observou-se que as espécies Sardinha, Corvina e Tainha apresentaram valores
médios de concentrações que excederam o limite estabelecido pela ANVISA de
1000 µg kg-1 (ANVISA, 1998).
Verificou-se que nenhuma das espécies predadoras (Corvina, Perna de Moça e
Pescada) nem as espécies não predadoras (Sardinha e Tainha), excederam os
limites da legislação brasileira para Hg (ANVISA, 1998), estando próprias para o
consumo humano.
Podemos concluir, parcialmente, que a espécie Corvina apresentou altos
valores para Cd e Pb, sendo a espécie Perna de Moça a que apresentou o
maior valor para Pb. As demais espécies analisadas apresentaram baixos
valores para esses elementos.
Os resultados obtidos sugerem que a espécie Corvina pode ser usada como
bioindicador, pois acumula metais e permanece no estuário até a idade adulta,
indicando assim as condições da região onde vive.

REFERÊNCIA BIBLIOGRÁFICA:
ANVISA - Agência Nacional de Vigilância Sanitária. 1998. Legislação Brasileira -
Portaria nº 685. Brasília. 5 p.

CETESB - Companhia de Tecnologia de Saneamento Básico Ambiental. 2003.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

185
UNISA - Universidade de Santo Amaro

Relatório de Qualidade das Águas Litorâneas do Estado de São Paulo -


Balneabilidade das Praias. São Paulo. 72p.

NASCIMENTO, S. M.; FARIAS, L. A.; CURCHO, M.R.M.; BRAGA, E.S.;


FAVARO, D. I. T. 2009. Estudo Comparativo De Constituintes Nutricionais E Do
Teor De Mercúrio Total Em Peixes Comercializados Na Cidade De Cananéia,
Litoral De São Paulo. International Nuclear Atlantic Conference - INAC. Rio de
Janeiro. 12p.

________________________________________________________________
Agradeço ao CNPq pelo apoio finaceiro.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

186
UNISA - Universidade de Santo Amaro

Estudo da atividade fitotóxica de extratos foliares de Piper spp


L. (Piperaceae)
RODRIGO SILVA MACEDO(1)

MARCO AURELIO SIVERO MAYWORM(2)(Orientadores)


Ciências Biológicas
INTRODUÇÃO:
Durante séculos foram descobertas muitas formas de utilização das plantas
medicinais e suas virtudes terapêuticas, esse conhecimento representou e
ainda representa o único recurso terapêutico para muitas comunidades e
grupos étnicos. Os conhecimentos populares contribuíram tanto para a inclusão
de espécies vegetais como plantas medicinais eficazes, quanto para a direção
de estudos científicos voltados para a obtenção de novos medicamentos (DI
STASI, 1996).
Desde os primórdios, o homem recorre às plantas para solucionar suas
enfermidades. Registros de 4.000 anos a.C. indicam o uso da papoula, Papaver
somniferum e da ulmária, Filipendula ulmaria para amenizar a dor das mulheres
no parto. Povos da Grécia e Roma antigas já tinham conhecimento dos efeitos
farmacológicos de Atropa belladona, para fins sedativos e até mesmo
envenenamento. Os egípcios utilizavam a dedaleira, Digitalis purpurea como
diuréticos. Na América do Sul, indígenas confeccionavam flechas com efeitos
paralisantes através da abutua, Chondodrendon tomentosum, e missionários
espanhóis enviados para colonizar a América, descobriram e divulgaram por
toda a Europa, os efeitos antimaláricos de Chichona (HOSTETTMANN et al.,
2003).
Com os avanços da ciência puderam-se criar métodos para a síntese de
compostos, com grande importância fisiológica nos animais, principalmente no
homem, e isso contribuiu para a formação de fármacos para a medicina do
século XX (HOSTETTMANN et al., 2003).
A biodiversidade em sua distribuição relativa possibilita a variação dos
componentes químicos entre as populações, tal qual os microorganismos, as
plantas produzem grandes variações de compostos químicos, fornecendo uma
ampla gama de produtos de importância na economia, pois as oportunidades
para a descoberta e identificação dos novos fármacos aumenta com a
diversidade de espécies, como os fitoterápicos que são preparados apenas com
plantas medicinais e os fitofármacos que são substâncias extraídas de plantas
podendo apresentar aplicação farmacêutica (GUERRA & NODARI, 2004).
Muitas espécies nativas vêm sendo utilizadas como fonte de recursos
medicamentosos para curar, amenizar ou diminuir os efeitos patológicos da
população através da medicina popular, utilizando plantas de fácil acesso como
Baccharis (carqueja), Bauhinia (pata-de-vaca), Cecropia (embaúba), Piper

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

187
UNISA - Universidade de Santo Amaro

(pariparoba) e Passiflora (maracujá) (REIS et al., 2004). Fitoterápicos,


usualmente são utilizados de forma preventiva, problemas gastrintestinais e
circulatórios e distúrbios nervosos como a insônia (CALIXTO, 2001).
Plantas medicinais são exemplos do Reino Vegetal que sintetizam em seus
metabolismos primários e secundários substâncias ativas utilizadas como
medicamentos (CASTRO et al., 2004).
A restrição dos metabólitos secundários na natureza deve-se à forma de
especialização de cada espécie para se adaptar às condições do meio em que
vivem ao longo do tempo, habilitando às plantas a terem funções específicas
não necessariamente essenciais para os organismos que as produzem (GROS
et al., 1985).
No Meio, as plantas recorrem à estratégias químicas para competir pelos
recursos disponíveis. Na elaboração destas estratégias, produzem
aleloquímicos, metabólitos secundários especiais que podem ser armazenados
em diversos órgãos vegetais, que serão liberados no ambiente (MALHEIRO &
PERES, 2001).
Os aleloquímicos podem ser liberados no ambiente através da lixiviação dos
compostos químicos pela chuva ou orvalho, pela exsudação direta das raízes,
pela liberação de substâncias voláteis, e pela queda de partes das plantas no
solo que ao serem decompostas, alteram o desenvolvimento de outras espécies
(MALHEIROS & PERES, 2001), afetando-as em suas funções vitais, tais como,
absorção de nutrientes, regulação de crescimento, e que vão desde a inibição
da fotossíntese até a respiração.
Piperaceae é uma família bastante comum nas formações florestais brasileiras,
particularmente na mata atlântica, onde as espécies de Piper são pequenos
arbustos ou árvores, sublenhosos, facilmente reconhecidas mesmo em estado
vegetativo, pela presença de nós gemiculados e folhas geralmente alternas. No
estado reprodutivo, encontra-se inflorescência do tipo espiga ou racemo. Seus
frutos são bagas ou drupas. Pertencem a esta família algumas plantas
utilizadas como medicinais: o falso-jaborandi (Piper spp), além de plantas
utilizadas como condimentos, como a pimenta-do-reino (Piper nigrum). Inclui até
oito gêneros e aproximadamente 2000 espécies. No Brasil, ocorrem cinco
gêneros e aproximadamente 500 espécies (SOUZA & LORENZI, 2005).

OBJETIVO:
Este trabalho visou estudar a atividade fitotóxica de extratos etanólicos de
folhas de Piper mollicomum (Kunth), P. richardiifolium (Kunth) e P. xylosteoides
(Kunth) Steud.

METODOLOGIA:
Amostras de folhas de Piper mollicomum (Kunth), P. richardiifolium (Kunth), P.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

188
UNISA - Universidade de Santo Amaro

xylosteoides (Kunth) Steud. foram coletadas em área preservada de Mata


Atlântica e amostras testemunhas foram herborizadas, segundo o método de
FIDALGO & BONONI (1989) e depositadas no Herbário da Universidade de
Santo Amaro, sob os vouchers Affonso 169, Affonso 170 e Affonso 171,
respectivamente.
Amostras de folhas foram fragmentadas e submersas em etanol P.A. Cada
amostra foi agitada diariamente, sendo o solvente trocado a cada sete dias,
totalizando 28 dias de extração. Todas as extrações foram feitas à temperatura
ambiente, protegidas de luz, e os solventes contendo as substâncias extraídas,
foram reunidos constituindo os extratos etanólicos. Os extratos foram
concentrados, sob pressão reduzida em rotaevaporador a 40ºC, a fim de obter
soluções com concentrações a 1%, sendo armazenados entre 4 e 8°C
(RESCKHE et al.,2007).
Os testes de ação fototóxica foram desenvolvidos segundo MURAKAMI et al.,
(2009), em triplicata. Foram depositados 4 mL de extrato em forma uniforme
sobre discos de papel de filtro com 9 cm de diâmetro. Para efeito controle,
foram depositados 4 mL de etanol P.A. em outros discos de mesmo diâmetro
mantidos por 24 horas em estufa e dessecador para a eliminação dos
solventes. Após esse período, os discos foram depositados em placa de Petri
nas quais foram em seu interior 3mL de água destilada esterilizada e, após 1
hora, foram depositados em cada placa, 20 sementes. Foram utilizadas neste
trabalho, sementes de alface (Lactuca sativa), rúcula (Eruca sativa) e couve
(Brassica oleracea). As placas foram vedadas com película de PVC e mantidas
sob iluminação constante e temperatura ambiente pelo período de sete dias. A
porcentagem de germinação e índice de Velocidade de Germinação (IVG) foi
determinada diariamente, e no 7º dia foram medidos os comprimentos do eixo
hipocótilo-radicular e das folhas cotiledonares.
As leituras foram feitas no 1º, 4º e 7º dia de germinação. O IVG foi calculado
com a média dos valores obtidos para as repetições de acordo com MAGUIRE
(1962), sob a fórmula abaixo:

IVG = G1/N1 + G2/N2 + ... + Gn/Nn


G = Número de Sementes germinadas; N = Dia da Contagem.

RESUMO:
A tabela 1 apresenta as taxas de germinação e crescimento de plântulas de
couve (Brassica oleracea), rúcula (Eruca sativa) e alface (Lactuca sativa) sobre
os extratos etanólicos produzidos a partir de folhas das espécies estudadas.
Todos os extratos reduziram a germinação das espécies alvos no primeiro dia
de contagem em relação aos respectivos controles, destacando o extrato de P.
mollicomum sobre as sementes de couve, o extrato de P. richardiifolium sobre

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

189
UNISA - Universidade de Santo Amaro

as sementes de rúcula e o extrato de P. mollicomum sobre os aquênios de


alface.
Na avaliação feita no último dia de contagem os três extratos afetaram
fortemente a germinação final das sementes de rúcula, e os extratos de P.
mollicomum e P. xylosteoides a germinação dos aquênios de alface. As
sementes de couve foram menos afetadas pelos extratos das espécies
estudadas. Tais resultados afetaram os valores de IVG observados. Os
menores valores de IVG foram observados com extratos de P. richardiifolium
sobre rúcula (0,5) e P. mollicomum sobre alface (0,1).
Os extratos de P. mollicomum e P. richardiifolium inibiram fortemente o
desenvolvimento do eixo hipocótilo-radicular (EHR) e das folhas cotiledonares
(tamanho inferior à 3 mm) das espécies alvos. O extrato de P. xylosteoides
afetou fortemente o comprimento do EHR, porém não afetou expressivamente o
comprimento das folhas cotiledonares das espécies alvo.
O maior efeito fitotóxico apresentado pelo extrato de P. richardiifolium sobre
couve e pelo extrato de P. mollicomum sobre alface, pode estar associado, a
princípio, pelo maior teor de fenóis totais presentes nesses extratos (2,2 e 2,3
mg/mL, respectivamente). REIGOSA et al., (1999) propuseram que altas
concentrações de compostos fenólicos inibiam a germinação, porém os mesmo
compostos em baixar concentrações a estimulam. Tal estimulação da
germinação pôde ser observado nos testes com os extratos de P. xylosteoides
sobre couve e alface, que apresentaram germinação próxima aos valores dos
respectivos controles.
Comumente as espécies da Família Piperaceae apresentam atividade
fitotóxica. O extrato aquoso de P. dilatatum afetou o crescimento de plântulas
de alface, impedindo o crescimento das plântulas e extratos aquosos (3%) de P.
aduncum e P. tectonifolium geraram taxas de germinação elevadas (63,7 e
95%, respectivamente), das sementes de alface (OLIVEIRA et al., 2007).
CAMPOS (2001) testou a atividade alelopática sob sementes de alface
(Lactuca sativa) utilizando extratos aquosos, metanólicos e hexânicos
produzidos a partir das folhas de Piper xylosteoides. Nos extratos hexânicos
observou-se forte ação alelopática, não havendo germinação; nos extratos
metanólicos, um aumento na taxa de germinação de 48,8%. DOURADO (2002)
observou os efeitos fitotóxicos dos extratos etanólicos das folhas de Piper
xylosteoides, no qual obteve germinação de 3,35% dos aquênios testados. O
presente trabalho obteve 73,35% de germinação no sétimo dia. Os divergentes
resultados podem ser associados à diferença sazonal dos períodos de coleta.

CONCLUSÃO:
Os resultados apresentados neste trabalho demonstram que os extratos
etanólicos foliares de Piper mollicomum, P. richardiifolium e P. xylosteoides

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

190
UNISA - Universidade de Santo Amaro

possuem atividade fitotóxica.

REFERÊNCIA BIBLIOGRÁFICA:
CALIXTO, J. B. Medicamentos Fitoterápicos. IN: YUNES, R. A. & CALIXTO, J.
B.; 2001. Plantas medicinais sob a ótica da moderna química medicinal.
Universidade do Oeste de Santa Catarina. Chapecó, Argos. 297-315p.

CAMPOS, A. M. G. 2001. Variações sazonais no potencial alelopático de


extratos foliares de espécies de Piper L. (Piperaceae). Monografia apresentada
a Universidade de Santo Amaro para obtenção do título de Bacharel em
Ciências Biológicas. São Paulo.

CASTRO, H. G.; OLIVEIRA, L. O.; BARBOSA, L. C. A.; FERREIRA, F. A.;


SILVA, D. J. H.; MOSQUIM, P. R.; NASCIMENTO, E. A. 2004. Teor e
composição do óleo essencial de cinco acessos de mentrasto. Química Nova
21: 99-105.

DI STASI, L. C. 1996. Plantas medicinais arte e ciência. Ed. UNESP. São Paulo.

DOURADO, R. S. 2002. Efeito da concentração e tempo de exposição sobre a


ação alelopática do extrato etanólico de Piper xylosteoides (Kunth) Steud
(Piperaceae). Monografia apresentada a Universidade de Santo Amaro para
obtenção do título de Bacharel em Ciências Biológicas. São Paulo.

FIDALGO, O. & BONONI, V. L. R. 1989. Técnicas de coleta e herborização de


material botânico. Instituto de Botânica do estado de São Paulo. São Paulo.

GROS, E. G.; POMILIO, A. B.; SELDES, A. M.; BURTON, G. 1985. Introduccion


al estúdio de los productos naturales. Washington: The General Secretariat of
the Organization of American States. 196p.

GUERRA, M. P. & NODARI, R. O. Biodiversidade: Aspectos biológicos,


geográficos, locais e éticos. 2004. In: SIMÕES, C. M. O.; SCHENKEL, E. P.;
GOSMANN, G.; de MELLO, J. C. P.; MENTZ, L. A.; PETROVICK, P. R.;
Farmacognosia: da planta ao medicamento. Editora da UFRGS/Editora da
UFSC. 5ª edição. Porto Alegre/Florianópolis. 13 -1102p.

HOSTETTMAN, K; QUEIROZ, E. F. & VIEIRA, P. C. 2003. Princípios ativos de


plantas superiores. Edufscar. São Paulo. 301p.

MAGUIRE, J. D. 1962. Speed of germination-aid in selection and evaluation for


seedling emergence and vigor. CropScience 2: 176-177.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

191
UNISA - Universidade de Santo Amaro

MALHEIROS, A.; & PERES, M. T. L. P. 2001. Alelopatia: Interações químicas


entre espécies. IN: YUNES, R. A. & CALIXTO, J. B.; Plantas medicinais sob a
ótica da moderna química medicinal. Universidade do Oeste de Santa Catarina.
Chapecó, Argos. 301p.

MURAKAMI, C.; CARDOSO, F. L.; MAYWORM, M. A. S. 2009. Potencial


fitotóxico de extratos foliares de Aloe arborescens Miller (Asphodelaceae)
produzidos em diferentes épocas do ano. Acta Botanica Brasílica 23: 111-117.

OLIVEIRA, S. C. C.; LUSTOSA, F. L. F.; ROMEIRO, L. A. 2007. Efeito


alelopático de extrato aquoso de Piper aduncum L. e Piper tectoniifolium Kunth
na germinação e crescimento de Lactuca sativa L. Revista Brasileira de
Biociências 5: 849-851.

REIGOSA, M. J.; SOUTO, X. M.; GONZÁLEZ, L. 1999. Effect of phenolic


compounds on the germination of six weeds species. Plant Growth Regulation
28: 83-88.

REIS, M. S.; MARIOT, A.; STEENBOCK, W. Diversidade e domesticação de


plantas medicinais. 2004. In: SIMÕES, C. M. O.; SCHENKEL, E. P.; GOSMANN,
G.; de MELLO, J. C. P.; MENTZ, L. A.; PETROVICK, P. R.; Farmacognosia: da
planta ao medicamento. Editora da UFRGS/Editora da UFSC. 5ª edição. Porto
Alegre/Florianópolis. 45-1102P.

RESCHKE, A.; MARQUES, L. M. & MAYWORM, M. A. S. 2007. Atividade


antibacteriana de Fícus benjamina L. (Moraceae). Revista Brasileira de Plantas
Medicinais 9: 67-70.

SOUZA, V.C & LORENZI, H. Botânica sistemática. Guia ilustrado para


identificação das famílias de angiospermas da flora brasileira, baseado em APG
II. 2005. Instituto Plantarum de estudos da flora LMTD.

________________________________________________________________
Palavras chaves: Piperaceae, Piper, atividade fitotóxica, alelopatia

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

192
UNISA - Universidade de Santo Amaro

Estudo do potencial antifúngico de espécies de


Melastomataceae
JOSÉ ADRIANO PINHEIRO(1)

MARCO AURELIO SIVERO MAYWORM(2)(Orientadores)


Ciências Biológicas
INTRODUÇÃO:
A biodiversidade das plantas constitui a principal fonte de biomoléculas para a
produção de uma gama de produtos de importância econômica, sendo que
muitas destas biomoléculas constituem moldes para síntese de um grande
número de fármacos, porém é relativamente pequena a porcentagem utilizada
pelo homem (1 a 10%), podendo haver um grande número de plantas com
potencial medicinal ainda não estudado (COWAN, 1999).
As chances para a identificação de produtos com possível utilização econômica
aumentam com a diversidade de espécies, e o Brasil é o país com maior
diversidade genética vegetal do mundo, com mais de 55.000 espécies
catalogadas de um total estimado entre 350.000 e 550.000 espécies (GUERRA
& NODARI, 2004).
Em análises feitas por MORENO et al. (2004) com 88 espécies nativas da
região de mata atlântica, mostraram que 56 espécies apresentaram alguma
atividade biológica, indício de que o estudo fitoquímico da vegetação nessa
região pode produzir resultados promissores para uma aplicação direta, ou
servir para o desenvolvimento de novos produtos.
Os Metabólitos secundários são compostos químicos de estrutura relativamente
complexa, que cumprem funções específicas em cada ser vivo, tais como
proteção contra raios UV, predação, desidratação e atração para polinização,
Segundo MULLER et al. (2002) produtos secundários produzidos pelas plantas
são biossintetizados em várias organelas celulares, porém são estocados em
estruturas especificas como ductos, vacúolos, parede celular e superfícies
cerosas como forma de proteger os processos metabólicos da planta de seus
efeitos tóxicos. Para serem facilmente liberados, geralmente estão localizados
em áreas onde agem na defesa de vários órgãos, como por exemplo, as
superfícies das folhas, frutos, próximo da epiderme, e são liberados para o meio
por vários mecanismos como exsudação radicular, decomposição de resíduos
foliares, lixiviação e volatilização.

Os compostos fenólicos são os mais freqüentemente encontrados e dentre eles,


os mais abundantes entre as plantas estão os flavonóides, comuns em plantas
superiores, biossintetizados a partir de fenilpropanóides. Possuem 15 carbonos
no núcleo fundamental, e constituem uma classe importante de polifenóis
(RICE, 1984). Muitos deles apresentam atividades antioxidante, antiinflamatória

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

193
UNISA - Universidade de Santo Amaro

e antibacteriana que têm um grande potencial de exploração na área cosmética


(PERRUCHON, 2002). Também são utilizados em escala industrial para a
produção de inseticidas, corantes, aromatizantes e medicamentos
(MARASCHIN & VERPROOTE, 1999).
Os flavonóides são polifenóis encontrados com relativa abundância entre os
metabólitos secundários vegetais que possuem funções para as plantas como
proteção contra raios ultravioletas, contra microrganismos, ação alelopática,
entre outras (ALMEIDA, 1988). A florizina, um flavonóide encontrado em raízes
de Pyrus malus, inibe o crescimento das plântulas da mesma espécie
(ZUANAZZI & MONTANA, 2003).
Quinonas são compostos orgânicos que podem ser considerados como
produtos de oxidação de fenóis, e que são responsáveis pelas atividades
bactericida, antifúngica e antitumoral de extratos de Kigelia pinnata
(HOUGHTON et al., 1994).
CARVALHO et al. (2003) observaram que fenóis como hidroquinonas como
ocorre em Juglans regia que excreta juglona, uma naftoquinona, inibem a
germinação de sementes e crescimento de fungos e bactérias.
SOUTO et al. (1994) relataram que fragmentos de espécies como Quercus
robur, Pinus radiata e Acacia melanoxylon geram inibição de crescimento e
desenvolvimento de sementes de alface e o efeito alelopático é devido
principalmente a compostos fenólicos.
Os terpenóides são classificados de acordo com a quantidade de unidades de
isopreno (monoterpenóides, triterpenóides, sesquiterpenóides entre outros) e
apresentam algumas funções protetoras como: antimicrobiana, antifúngicas,
antivirais e outros atuam como aleloquímicos (VICKERY & VICKERY, 1981).
Segundo ROBBERS et al. (1997), terpenóides extraídos de Artemisia
absinthium possuem ação alelopatica.
Em Eucalyptus. globulus, E. viminalis e E. baxteri foram encontrados vários
compostos como fenóis, terpenóides, glicosédeos e óleos voláteis que agem
como potentes aleloquímicos (ALVES et al.,1999).
Taninos são compostos fenólicos responsáveis pela adstringência de muitos
frutos e outros produtos vegetais. São solúveis em água formando complexos
insolúveis com alcalóides, gelatinas e outras proteínas (SANTOS & MELLO,
2004).
DJIPA et al. (2000) comprovando a ação antimicrobiana de extratos de
Syzygium cumini sobre vários microrganismos, entre eles, Staphylococcus
aureus, verificaram que esta propriedade foi devida à alta concentração de
taninos (77 a 83%).
Os óleos essenciais são, em geral, misturas complexas de substâncias voláteis,
lipofílicas, geralmente odoríferas e líquidas (SIMÕES & SPITZER, 2004).
MACHADO et al. (2003) avaliando 14 extratos de plantas medicinais brasileiras,
utilizadas no tratamento de doenças infecciosas, quanto ao seu potencial

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

194
UNISA - Universidade de Santo Amaro

antimicrobiano frente a microrganismos resistentes de importância médica,


demonstraram que os óleos essenciais de várias delas eram responsáveis pela
atividade antimicrobiana.
O óleo essencial das sementes de Caryocar brasiliense mostrou bioatividade
em testes de suscetibilidade sobre isolados de Candida neoformans e
Paracoccidioides brasiliensis (CABRERA & KLEIN, 1980).
Os alcalóides formam um grupo heterogêneo de substâncias orgânicas, com
anel heterociclico contendo nitrogênio. São potentes inibidores de germinação,
encontrado em plantas como tabaco, café e cacau (ALMEIDA, 1988). Alcalóides
como a cocaína, cafeína, codeína, escopolamina, efedrina entre outros
possuem também ação alelopática (EVENARI, 1949).
Nos últimos anos, vem aumentando o número de infecções invasivas causadas
por espécies de Candida, causadoras de micoses superficiais ou invasivas em
seres humanos (DIGNANI et al., 2003).
Espécies fitopatogênicas como Cladosporium cladosporioides que atacam
cajueiros (MENDES, 1998) e Cladosporium sphaerospermum que é uma
espécie comum e cosmopolita, ocorrendo como invasor secundário em diversas
partes de plantas, como rizosfera do feijão, e sementes de arroz e milho (HOOG
& GARRO, 1995), causa vários problemas para a agricultura. Isto obriga o uso
de produtos antifúngicos que podem provocar efeitos colaterais verificados com
antifúngicos sintéticos (KULBRERG, 1997).
Tendo em vista o aumento das infecções fúngicas bem como a necessidade de
novos agentes antifúngicos na agricultura para evitar perdas incalculáveis na
produção agrícola (ZACCHINO, 2001). Para isto, compostos com propriedades
antifúngicas extraídos da vegetação nativa poderiam constituir uma alternativa
terapêutica (ALVES et al., 2000).
Os compostos fenólicos são um importante grupo de substâncias que possuem
comprovada ação antifúngica e esta pode ocorrer pela inativação de sistemas
enzimáticos do microrganismo envolvidos na produção de energia e na síntese
de componentes estruturais (PORTE & GODOY, 2001).
De acordo com SOUZA & LORENZI (2005), Melastomataceae compõe-se de
ervas, arbustos ou árvores, menos freqüentemente epífitas. Possui distribuição
predominantemente pantropical, incluindo cerca de 200 gêneros e 5.000
espécies. No Brasil ocorrem cerca de 70 gêneros e 1.000 espécies, sendo
comuns na floresta atlântica algumas espécies de Leandra, Miconia e
Tibouchina. O uso econômico da família concentra-se em espécies
ornamentais, como Medinilla magnifica, a Schizocentron elegans , Tibouchina
clavata e Tibouchina granulosa.
Cerca de um quarto das espécies de Melastomataceae pertence ao gênero
Miconia, que ocorre desde o sul do México até o norte da Argentina e Uruguai,
este gênero pode ser reconhecido pelas folhas largas, inflorescências
geralmente terminais e frutos bacácios (GOLDENBERG, 2004). São comuns em

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

195
UNISA - Universidade de Santo Amaro

áreas de florestas e em cerrados, onde se destacam Miconia albicans e Miconia


stenostachya (SOUZA & LORENZI, 2005).
Miconia cabucu Hoehne possui porte arbóreo de 6 a 10 metros de altura,
apresenta folhas ovais, inflorescência com tricomas, florescendo entre agosto e
setembro e fruto do tipo baga, ocorrendo desde São Paulo até Santa Catarina
(GOLDENBERG, 2004).
O gênero Tibouchina conta com aproximadamente 250 espécies, concentradas
especialmente no Brasil (PERALTA, 2002). Na Mata Atlântica é uma planta
tipicamente pioneira, de ampla distribuição (DOMINGOS, 1998). Tibouchina
fothergillae (DC.) Cogn é um arbusto de altura média de 1,5 metros com ramos
cilíndricos, folhas membranáceas, flores solitárias terminais e dicásio,
possuindo frutos do tipo cápsula ovóide. Ocorrem em Minas Gerais, Paraná, Rio
de Janeiro e São Paulo, florescendo e frutificando em quase todos os meses do
ano (SILVA & AFFONSO, 2005). Tibouchina sellowiana Cogn. apresenta porte
arbustivo a arbóreo com até 5 metros de altura, com ramos cilíndricos ou
levemente tetragonais, folhas coriáceas, frutos em cápsula ovóide. Pode ser
encontrada em Minas Gerais, Rio de Janeiro, São Paulo, Paraná, Rio Grande
do Sul e Santa Catarina, florescendo e frutificando de fevereiro a junho.
O gênero Leandra, possui cerca de 200 espécies, distribuídas pela região
neotropical e regiões subtropicais, desde o México e Antilhas até o norte da
Argentina. Caracteriza-se por apresentar inflorescências terminais e/ou pseudo-
axilares, botões florais de ápice agudo a acuminado e frutos carnosos do tipo
bacídio, políspermicos (BAUMGRATZ & SOUZA, 2005).
O gênero Behuria mostra-se em geral uma distribuição bastante reduzida,
muitas vezes ocorrendo em uma única localidade, sendo dentro destas
localidades pouco numeroso em indivíduos (BRADE, 1956). Behuria insignis
Cham. é encontrada no estado de São Paulo e Paraná, habitando subosques
de mata pluvial e caracteriza-se por apresentar porte arbóreo com flores
hexâmeras e cápsulas loculicidas (BAUMGRATZ, 2000).
Algumas espécies são utilizadas na medicina popular como Comolia
veronicaefolia, Loreya mespiloides e Miconia aplostachya são utilizadas como
anti-sépticas e cicatrizantes de feridas (CAVALCANTE & FRIKEL, 1973) Para
tratamento contra úlceras são utilizadas Lasiandra mutabilis (MOREIRA, 1871),
Melastoma pauciflora (MOREIRA, 1862) e Miconia aplostachya (CAVALCANTE
& FRIKEL, 1973).
Extratos de Miconia albicans apresentaram forte atividade alelopática,
reduzindo a velocidade de crescimento das plântulas de alface e gergelim
(GATTIL, 2007).
GORLA & PERES (1997) observaram que extratos aquosos de Miconia albicans
apresentaram efeito inibitório sobre a germinação e principalmente no
crescimento radicular de sementes de tomate e pepino, e segundo os autores, a
presença de alcalóides, glicosídeos saponínicos, glicosídeos cardiotóxicos e

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

196
UNISA - Universidade de Santo Amaro

taninos poderiam justificar os resultados observados.


CELLOTO et al. (2003) estudando o potencial antimicrobiano de espécies de
Melastomataceae, verificou que os extratos de Miconia albicans, M. rubiginosa
e M. stenostachya obtiveram forte atividade contra Candida albicans,
Escherichia coli, Pseudomonas aeruginosa, Proteus mirabilis e Salmonella,
sendo o efeito observado principalmente devido a presença de triterpenos.
O extrato de Trembleya laniflora também apresentou atividade antimicrobianna
frente a linhagens de Staphylococcus aureus e Micrococcus luteus (VENTURA
et al., 2007).
Outras atividades biológicas ainda são encontradas com espécies de
Melastomataceae como antiviral em Melastoma alabathrium (DÉVÉHAT et al.,
2002), efeito citotóxico em Plasmodium falciparum por Dissotis brazzae
(OMULOKOLI et al.,1997), atividade analgésica de Miconia rubiginosa
(SPESSOTO et al., 2003) e potencial anticâncer de Miconia lepidota
(GUNATILAKA et al.,2001). Da mesma forma que alguns compostos como os
flavonóides, dentre eles os derivados de quercetina também são descritos por
MIMURA et al. (2004) em espécies do gênero Huberia, taninos em espécies de
Melastoma, Monochaetum e Bredia por YOSHIBA et al, (1994), terpenos em
Henriettella (CALDERÓN et al., 2002), além de antocianidinas em Tibouchina
(TERAHARA, 1993). Porém comparando a outras famílias de plantas, as
espécies de Melastomataceae ainda são pouco exploradas do ponto de vista
fitoquímico.

OBJETIVO:
O presente trabalho teve como objetivo estudar o potencial antifúngico de
estratos foliares de Miconia cabucu Hoehne, Tibouchina fothergillae (DC.)
Cogn., T. sellowiana Cogn., Leandra cardiophylla Cogn, L. cordigera Cogn. e
Behuria insignis Cham. (Melastomataceae).

METODOLOGIA:
Foram coletadas folhas maduras de Miconia cabucu Hoehne, Tibouchina
fothergillae (DC.) Cogn., T.sellowiana Cogn., Leandra cardiophylla Cogn., L.
cordigera Cogn. e Behuria insignis Cham. em área preservada no sul do
município de São Paulo. Amostras testemunhas foram coletadas e herborizadas
segundo técnica de FIDALGO & BONONI (1984) e depositadas no herbário da
Universidade de Santo Amaro.
Para determinar o rendimento de massa seca das amostras coletadas foram
selecionados três fragmentos de tamanho uniforme, em triplicata, pesados
imediatamente em balança analítica e desidratados em estufa à vácuo , a
100ºC, durante 12 horas. Posteriormente, os fragmentos secos foram

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

197
UNISA - Universidade de Santo Amaro

acondicionados em dissecador fechado a vácuo até peso constante.


Amostras de folhas foram fragmentadas e submersas em etanol P.A, sendo
agitadas diariamente e o solvente trocado a cada 7 dias, perfazendo um total de
28 dias de extração. Após a primeira extração, o material foi triturado e
submerso em etanol P.A. As extrações foram feitas à temperatura ambiente e
protegidas da luz, a fim de evitar a fotooxidação dos compostos. Os extratos
obtidos foram reunidos, constituindo os extratos etanólicos brutos, os quais
foram concentrados sob pressão reduzida em evaporador rotativo a 45°C, e
tendo suas concentrações acertadas a 1% (BERNARD et al., 1995 –
modificado).
Alíquotas de 400 µg do extrato etanólico foram aplicadas em placa
cromatográfica de sílica gel 60 F254 (0,2 mm, Merck). O controle positivo é a
nistatina (5mg/mL). As placas cromatográficas foram eluídas com CHCl3:
MeOH (9:1, v/v). Após a eluição e secagem, as cromatoplacas foram reveladas
com uma suspensão de esporos de Cladosporium cladosporioides Fresen de
Vries, SPC 140 e Cladosporium sphaerospermum Penzig, SPC 491 em uma
solução de glicose e sais minerais e incubada a 28 °C por 48 horas (HOMANS
& FUCHS, 1970). A atividade aparece como halos brancos (indicativos de
inibição do crescimento do fungo), sobre um fundo de coloração verde escura.
Cepas dos dois fungos são mantidas no Instituto de Botânica/ Secretaria do
Meio Ambiente, em meio de batata-dextrose-ágar.
Para a determinação dos fenóis totais confeccionou-se uma curva padrão em
duplicata, utilizando-se balões volumétricos de 50 mL, aos quais foram
acrescidos 35 mL de água destilada, solução aquosa de ácido tânico em teores
conhecidos (25 a 300 µg), 2,0 mL de reagente de Follin Ciocauteau, 5,0 mL de
solução saturada de carbonato de sódio (Na2CO3) e água destilada até
completar o volume para 50mL. Os balões foram homogeneizados e após duas
horas, se procedereu a leitura em espectrofotômetro a 760nm (SALGADO,
2004).

RESUMO:
A tabela 2 apresenta as massas fresca e seca das folhas e o rendimento em
peso seco (P.S.) de cada extrato. Observaram-se maiores porcentagens de
massa seca total em T. fothergillae (92,6%) e L. cordigera (81,3%), e a menor
em Miconia cabucu (67,5%). Os maiores rendimentos dos extratos foram
obtidos em Tibouchina sellowiana (13,1%) e Leandra cordigera (12,0%) e os
menores com os extratos de T. fothergillae (6,2%) e B. insignis (6,3%),
provavelmente devido esses materiais possuírem, respectivamente, maiores e
menores teores de compostos solúveis em etanol.
A tabela 3 apresenta os teores de fenóis totais, flavonóides e açúcares totais

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

198
UNISA - Universidade de Santo Amaro

obtidos nos extratos das espécies estudadas. Os extratos de T. sellowiana, M.


cabucu e T. fothergillae apresentaram os maiores teores de fenóis totais (19,3,
10,9 e 10,2 mg/mL, respectivamente). Os maiores teores de flavonóides foram
observados em L. cardiophylla (1,6 mg/mL), T. fothergillae (0,9 mg/mL) e L.
cordigera (0,8 mg/mL). Os maiores teores de açúcares totais foram observados
nos extratos de T. fothergillae (5,4 mg/mL), L. cardiophylla (4,4 mg/mL) e M.
cabucu (3,6 mg/mL).
RODRIGUES et al. (2007) analisando extrato metanólico de Miconia cabucu
verificaram a presença de compostos como biflavonóide, quercetina, miricetina
e kaempferol. Em Lavoisiera foram encontrados flavonóis glicosilados derivados
de canferol e quercetina (BOMFIM-PATRÍCIO et al., 2001).
As figuras 2 e 3 apresentam os resultados da atividade antifúngica dos extratos
sobre Cladosporium cladosporioides e C. sphaerospermum, respectivamente.
As cromatografias mostram que não houve ação antifúngica para estes
esporos, determinada pela ausência de halos brancos nas colunas
cromatográficas, observado com a nistatina, substância padrão utilizada.
Segundo LOPES et al. (2008) mostrou que apenas 26,5% de 34 extratos
testados contra Cladosporium cladosporioides e C. sphaerospermum foram
ativos, sendo que apenas um deles apresentou forte atividade fungicida.

CONCLUSÃO:
Os resultados apresentados neste trabalho demonstraram que os extratos
analisados embora não tenham apresentado atividade antifúngica frente às
cepas de Cladosporium.

REFERÊNCIA BIBLIOGRÁFICA:
ALMEIDA, F. S. 1988. A alelopatia em plantas. Londrina, IAPAR ( Circular, 53).
60 p.

ALVES, T. M. A.; SILVA, A. F.; BRANDÃO, M.; GRANDI, T. S.; SMÂNIA, E. F.


SMÂNIA, J. R. A.; ZANI, C. L. 2000. Biological screening of Brazilian medicinal
plants. Memórias do Instituto Oswaldo Cruz 95: 367-373.

BAUMGRATZ, J. F. A. 2000. Two new species of Huberia (Melastomataceae:


Merianieae) from Brazil. Brittonia 52: 24-33.

BAUMGRATZ, J. F. A. & SOUZA, M. L. D. R. 2005. Novas espécies de Leandra


Raddi (Melastomataceae) para o Estado de São Paulo, Brasil. Acta Botanica
Brasílica 19 (3): 561-566.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

199
UNISA - Universidade de Santo Amaro

BERNARD, C. B.; KRISHNAMURTY, H.G.; CHAURET, D.; DURST, T.;


PHILOGENE, B.J.R.; SANCHEZ-VINDAS, P.; HASBUN, C.; POVEDA, L.; SAN
ROMAN, L.; ARNASON, J.T. 1995. Insecticidal defenses of Piperaceae from the
neotropics. Journal of Chemical Ecology 2: 801-815.

BOMFIM-PATRÍCIO, M. C.; SALATINO, A.; MARTINS, A. B.; WURDACK, J. J.;


SALATINO, M. L. F. 2001. Flavonoids of Lavoisiera , Microlicia and Trembleya
(Melastomataceae) and their taxonomic meaning. Biochem Syst Ecol. 2: 711-
726.

BRADE, A. C. 1956. Melastomataceae novae IV. Arquivos do Jardim Botânico


do Rio de Janeiro 4: 213-228.

CABRERA, A. L.; KLEIN, R. M. 1980. Compostas. Tribo: Vernoniae. In: Reitz.


Revista Flora Ilustrada Catarinense. Itajai-SC. Imprensa Oficial do Estado de
Santa Catarina.v. 3, p. 224-408.

CALDERÓN, A. I.; TERREAUX, C.; SCHENK, K.; PATTISON, P.; BURDETTE,


J. E.; PEZZUTO, J. M.; GUPTA, M. P.; HOSTETTMANN, K. 2002. Isolation and
structure elucidation of an isoflavone and a sesterterpenoic acid from
Henriettella fascicularis. J. Nat. Prod. 65: 1749-1753.

________________________________________________________________
Palavra-chave: Melastomataceae, antifungico, extrato

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

200
UNISA - Universidade de Santo Amaro

Estudo do potencial antimicrobiano de extratos foliares de


espécies de Melastomataceae
JOSÉ ADRIANO PINHEIRO(1)

MARCO AURELIO SIVERO MAYWORM(2)(Orientadores)


Ciências Biológicas
INTRODUÇÃO:
A biodiversidade das plantas constitui a principal fonte de biomoléculas para a
produção de uma gama de produtos de importância econômica, sendo que
muitas destas biomoléculas constituem moldes para síntese de um grande
número de fármacos, porém é relativamente pequena a porcentagem utilizada
pelo homem (1 a 10%), podendo haver um grande número de plantas com
potencial medicinal ainda não estudado (COWAN, 1999).
As chances para a identificação de produtos com possível utilização econômica
aumentam com a diversidade de espécies, e o Brasil é o país com maior
diversidade genética vegetal do mundo, com mais de 55.000 espécies
catalogadas de um total estimado entre 350.000 e 550.000 espécies (GUERRA
& NODARI, 2004).
Em análises feitas por MORENO et al. (2004) com 88 espécies nativas da
região de mata atlântica, mostraram que 56 espécies apresentaram alguma
atividade biológica, indício de que o estudo fitoquímico da vegetação nessa
região pode produzir resultados promissores para uma aplicação direta, ou
servir para o desenvolvimento de novos produtos.

2.2. Metabólitos secundários

Os Metabólitos secundários são compostos químicos de estrutura relativamente


complexa, que cumprem funções específicas em cada ser vivo, tais como
proteção contra raios UV, predação, desidratação e atração para polinização,
Segundo MULLER et al. (2002) produtos secundários produzidos pelas plantas
são biossintetizados em várias organelas celulares, porém são estocados em
estruturas especificas como ductos, vacúolos, parede celular e superfícies
cerosas como forma de proteger os processos metabólicos da planta de seus
efeitos tóxicos. Para serem facilmente liberados, geralmente estão localizados
em áreas onde agem na defesa de vários órgãos, como por exemplo, as
superfícies das folhas, frutos, próximo da epiderme, e são liberados para o meio
por vários mecanismos como exsudação radicular, decomposição de resíduos
foliares, lixiviação e volatilização.

Os compostos fenólicos são os mais freqüentemente encontrados e dentre eles,


os mais abundantes entre as plantas estão os flavonóides, comuns em plantas

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

201
UNISA - Universidade de Santo Amaro

superiores, biossintetizados a partir de fenilpropanóides. Possuem 15 carbonos


no núcleo fundamental, e constituem uma classe importante de polifenóis
(RICE, 1984). Muitos deles apresentam atividades antioxidante, antiinflamatória
e antibacteriana que têm um grande potencial de exploração na área cosmética
(PERRUCHON, 2002). Também são utilizados em escala industrial para a
produção de inseticidas, corantes, aromatizantes e medicamentos
(MARASCHIN & VERPROOTE, 1999).
Os flavonóides são polifenóis encontrados com relativa abundância entre os
metabólitos secundários vegetais que possuem funções para as plantas como
proteção contra raios ultravioletas, contra microrganismos, ação alelopática,
entre outras (ALMEIDA, 1988). A florizina, um flavonóide encontrado em raízes
de Pyrus malus, inibe o crescimento das plântulas da mesma espécie
(ZUANAZZI & MONTANA, 2003).
Quinonas são compostos orgânicos que podem ser considerados como
produtos de oxidação de fenóis, e que são responsáveis pelas atividades
bactericida, antifúngica e antitumoral de extratos de Kigelia pinnata
(HOUGHTON et al., 1994).
CARVALHO et al. (2003) observaram que fenóis como hidroquinonas como
ocorre em Juglans regia que excreta juglona, uma naftoquinona, inibem a
germinação de sementes e crescimento de fungos e bactérias.
SOUTO et al. (1994) relataram que fragmentos de espécies como Quercus
robur, Pinus radiata e Acacia melanoxylon geram inibição de crescimento e
desenvolvimento de sementes de alface e o efeito alelopático é devido
principalmente a compostos fenólicos.
Os terpenóides são classificados de acordo com a quantidade de unidades de
isopreno (monoterpenóides, triterpenóides, sesquiterpenóides entre outros) e
apresentam algumas funções protetoras como: antimicrobiana, antifúngicas,
antivirais e outros atuam como aleloquímicos (VICKERY & VICKERY, 1981).
Segundo ROBBERS et al. (1997), terpenóides extraídos de Artemisia
absinthium possuem ação alelopatica.
Em Eucalyptus. globulus, E. viminalis e E. baxteri foram encontrados vários
compostos como fenóis, terpenóides, glicosédeos e óleos voláteis que agem
como potentes aleloquímicos (ALVES et al.,1999).
Taninos são compostos fenólicos responsáveis pela adstringência de muitos
frutos e outros produtos vegetais. São solúveis em água formando complexos
insolúveis com alcalóides, gelatinas e outras proteínas (SANTOS & MELLO,
2004).
DJIPA et al. (2000) comprovando a ação antimicrobiana de extratos de
Syzygium cumini sobre vários microrganismos, entre eles, Staphylococcus
aureus, verificaram que esta propriedade foi devida à alta concentração de
taninos (77 a 83%).
Os óleos essenciais são, em geral, misturas complexas de substâncias voláteis,

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

202
UNISA - Universidade de Santo Amaro

lipofílicas, geralmente odoríferas e líquidas (SIMÕES & SPITZER, 2004).


MACHADO et al. (2003) avaliando 14 extratos de plantas medicinais brasileiras,
utilizadas no tratamento de doenças infecciosas, quanto ao seu potencial
antimicrobiano frente a microrganismos resistentes de importância médica,
demonstraram que os óleos essenciais de várias delas eram responsáveis pela
atividade antimicrobiana.
O óleo essencial das sementes de Caryocar brasiliense mostrou bioatividade
em testes de suscetibilidade sobre isolados de Candida neoformans e
Paracoccidioides brasiliensis (CABRERA & KLEIN, 1980).
Os alcalóides formam um grupo heterogêneo de substâncias orgânicas, com
anel heterociclico contendo nitrogênio. São potentes inibidores de germinação,
encontrado em plantas como tabaco, café e cacau (ALMEIDA, 1988). Alcalóides
como a cocaína, cafeína, codeína, escopolamina, efedrina entre outros
possuem também ação alelopática (EVENARI, 1949).
As primeiras descrições sobre o uso de antimicrobianos datam de 3000 anos
atrás, pela utilização por médicos chineses de bolores para tratar inflamações e
feridas infeccionadas. A ação dos bolores provavelmente é explicada pela
produção natural de antibióticos produzidos pelos fungos, o qual não se sabia
ao certo na época (TAVARES, 1996). Esta ação também foi percebida por
Alexandre Fleming quando observou halos de inibição provocados pelo fungo
identificado mais tarde como Penicilium notatum em placas contendo a bactéria
Staphylococus aureus, a partir daí com a identificação da substância produzida
pelo fungo com ação bactericida, penicilina, culminou a partir de 1929 o inicio
da era moderna de antibióticos (PELCZAR et al., 1996).
Nos últimos anos muitos trabalhos vêm sendo realizados em busca de plantas
com atividade antimicrobiana, que corresponde a uma das importantes
utilizações das plantas com fins medicinais pelas populações (BABU et al.,
1997).
A necessidade de produzir novas drogas sintéticas ou naturais antibióticas está
no fato de que as bactérias possuem a capacidade genética em adquirir e
transmitir resistência aos antibióticos aplicados (SOUZA, 1998).
Os flavonóides já são descritos como potentes metabólitos retirados das plantas
para este fim, sua ação se deve por sua capacidade de se complexar com
proteínas extracelulares e solúveis, também por se agruparem com
peptídeoglicanos da parede celular bacteriana, podendo causar rompimentos
na membrana dos microrganismos (COWAN, 1999).
Substâncias como os óleos essenciais estão citados em diversos trabalhos
como potentes compostos presentes nas plantas como responsáveis pelas
atividades antimicrobianas observadas (KELSEY et al., 1984; GALLI et al.,
1985; GERGIS et al., 1990; ZOGHBI et al., 1998).
De acordo com SOUZA & LORENZI (2005), Melastomataceae compõe-se de
ervas, arbustos ou árvores, menos freqüentemente epífitas. Possui distribuição

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

203
UNISA - Universidade de Santo Amaro

predominantemente pantropical, incluindo cerca de 200 gêneros e 5.000


espécies. No Brasil ocorrem cerca de 70 gêneros e 1.000 espécies, sendo
comuns na floresta atlântica algumas espécies de Leandra, Miconia e
Tibouchina. O uso econômico da família concentra-se em espécies
ornamentais, como Medinilla magnifica, a Schizocentron elegans , Tibouchina
clavata e Tibouchina granulosa.
Cerca de um quarto das espécies de Melastomataceae pertence ao gênero
Miconia, que ocorre desde o sul do México até o norte da Argentina e Uruguai,
este gênero pode ser reconhecido pelas folhas largas, inflorescências
geralmente terminais e frutos bacácios (GOLDENBERG, 2004). São comuns em
áreas de florestas e em cerrados, onde se destacam Miconia albicans e Miconia
stenostachya (SOUZA & LORENZI, 2005).
Miconia cabucu Hoehne possui porte arbóreo de 6 a 10 metros de altura,
apresenta folhas ovais, inflorescência com tricomas, florescendo entre agosto e
setembro e fruto do tipo baga, ocorrendo desde São Paulo até Santa Catarina
(GOLDENBERG, 2004).
O gênero Tibouchina conta com aproximadamente 250 espécies, concentradas
especialmente no Brasil (PERALTA, 2002). Na Mata Atlântica é uma planta
tipicamente pioneira, de ampla distribuição (DOMINGOS, 1998). Tibouchina
fothergillae (DC.) Cogn é um arbusto de altura média de 1,5 metros com ramos
cilíndricos, folhas membranáceas, flores solitárias terminais e dicásio,
possuindo frutos do tipo cápsula ovóide. Ocorrem em Minas Gerais, Paraná, Rio
de Janeiro e São Paulo, florescendo e frutificando em quase todos os meses do
ano (SILVA & AFFONSO, 2005). Tibouchina sellowiana Cogn. apresenta porte
arbustivo a arbóreo com até 5 metros de altura, com ramos cilíndricos ou
levemente tetragonais, folhas coriáceas, frutos em cápsula ovóide. Pode ser
encontrada em Minas Gerais, Rio de Janeiro, São Paulo, Paraná, Rio Grande
do Sul e Santa Catarina, florescendo e frutificando de fevereiro a junho.
O gênero Leandra, possui cerca de 200 espécies, distribuídas pela região
neotropical e regiões subtropicais, desde o México e Antilhas até o norte da
Argentina. Caracteriza-se por apresentar inflorescências terminais e/ou pseudo-
axilares, botões florais de ápice agudo a acuminado e frutos carnosos do tipo
bacídio, políspermicos (BAUMGRATZ & SOUZA, 2005).
O gênero Behuria mostra-se em geral uma distribuição bastante reduzida,
muitas vezes ocorrendo em uma única localidade, sendo dentro destas
localidades pouco numeroso em indivíduos (BRADE, 1956). Behuria insignis
Cham. é encontrada no estado de São Paulo e Paraná, habitando subosques
de mata pluvial e caracteriza-se por apresentar porte arbóreo com flores
hexâmeras e cápsulas loculicidas (BAUMGRATZ, 2000).

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

204
UNISA - Universidade de Santo Amaro

OBJETIVO:
O presente trabalho teve como objetivo estudar o potencial antimicrobiano de
extratos foliares de Miconia cabucu Hoehne, Tibouchina fothergillae (DC.)
Cogn., T. sellowiana Cogn., Leandra cardiophylla Cogn, L. cordigera Cogn. e
Behuria insignis Cham. (Melastomataceae).

METODOLOGIA:
Foram coletadas folhas maduras de Miconia cabucu Hoehne, Tibouchina
fothergillae (DC.) Cogn., T.sellowiana Cogn., Leandra cardiophylla Cogn., L.
cordigera Cogn. e Behuria insignis Cham. em área preservada no sul do
município de São Paulo. Amostras testemunhas foram coletadas e herborizadas
segundo técnica de FIDALGO & BONONI (1984) e depositadas no herbário da
Universidade de Santo Amaro.
Para determinar o rendimento de massa seca das amostras coletadas foram
selecionados três fragmentos de tamanho uniforme, em triplicata, pesados
imediatamente em balança analítica e desidratados em estufa à vácuo , a
100ºC, durante 12 horas. Posteriormente, os fragmentos secos foram
acondicionados em dissecador fechado a vácuo até peso constante.

Amostras de folhas foram fragmentadas e submersas em etanol P.A, sendo


agitadas diariamente e o solvente trocado a cada 7 dias, perfazendo um total de
28 dias de extração. Após a primeira extração, o material foi triturado e
submerso em etanol P.A. As extrações foram feitas à temperatura ambiente e
protegidas da luz, a fim de evitar a fotooxidação dos compostos. Os extratos
obtidos foram reunidos, constituindo os extratos etanólicos brutos, os quais
foram concentrados sob pressão reduzida em evaporador rotativo a 45°C, e
tendo suas concentrações acertadas a 1% (BERNARD et al., 1995 –
modificado).
Os microrganismos foram estocados em cultura com glicerol e mantidos à
temperatura de -10ºC para sua preservação até o momento do seu uso, quando
foram ativados utilizando-se Caldo TSB (caldo de soja Triptona) para as
bactérias e Caldo BHI (infusão de coração e cérebro) para C. albicans, para o
crescimento e foram mantidas em estufa por 24 horas à temperatura de 37ºC.
Foram utilizadas cepas-padrão de alta concentração de Unidades Formadoras
de Colônias (UFC), originárias de cultura do ATCC (“American Type Culture
Collection”), adquiridas através do instituto Adolfo Lutz (IAL) e isolados clínicos
obtidos do Instituto de Ciências Biomédicas – USP (ICB/USP) e do Hospital
Geral do Grajaú – UNISA (HGG/UNISA)
Para a determinação dos fenóis totais confeccionou-se uma curva padrão em
duplicata, utilizando-se balões volumétricos de 50 mL, aos quais foram
acrescidos 35 mL de água destilada, solução aquosa de ácido tânico em teores
conhecidos (25 a 300 µg), 2,0 mL de reagente de Follin Ciocauteau, 5,0 mL de

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

205
UNISA - Universidade de Santo Amaro

solução saturada de carbonato de sódio (Na2CO3) e água destilada até


completar o volume para 50mL. Os balões foram homogeneizados e após duas
horas, se procedereu a leitura em espectrofotômetro a 760nm (SALGADO,
2004).

RESUMO:
A tabela 2 apresenta as massas fresca e seca das folhas e o rendimento em
peso seco (P.S.) de cada extrato. Observaram-se maiores porcentagens de
massa seca total em T. fothergillae (92,6%) e L. cordigera (81,3%), e a menor
em Miconia cabucu (67,5%). Os maiores rendimentos dos extratos foram
obtidos em Tibouchina sellowiana (13,1%) e Leandra cordigera (12,0%) e os
menores com os extratos de T. fothergillae (6,2%) e B. insignis (6,3%),
provavelmente devido esses materiais possuírem, respectivamente, maiores e
menores teores de compostos solúveis em etanol.
A tabela 3 apresenta os teores de fenóis totais, flavonóides e açúcares totais
obtidos nos extratos das espécies estudadas. Os extratos de T. sellowiana, M.
cabucu e T. fothergillae apresentaram os maiores teores de fenóis totais (19,3,
10,9 e 10,2 mg/mL, respectivamente). Os maiores teores de flavonóides foram
observados em L. cardiophylla (1,6 mg/mL), T. fothergillae (0,9 mg/mL) e L.
cordigera (0,8 mg/mL).
A tabela 5 apresenta os resultados obtidos nos testes de atividade
antimicrobiana, determinando a Concentração Inibitória Mínima (CIM) e a
Concentração Microbicida Mínima (CMM). Os menores valores de CIM foram
observados com o extrato de M. cabucu sobre C. albicans (256 µg/mL), com o
extrato de T. fothergillae sobre B. subtilis, E. coli, P. mirabilis, P. aeruginosa e S.
aureus (512 µg/mL) e com o extrato de T. sellowiana sobre B. subtilis, E.
faecalis, K. pneumoniae, P. aeruginosa, S. Typhimurium e C. albicans (512
µg/mL).
A tabela 6 mostra que os menores valores de CIM observados com o extrato de
L. cardiophylla sobre E. faecalis, K. pneumoniae, P. mirabilis, P. aeruginosa, S.
Typhimurium, S. aureus e C. albicans (512 µg/mL), com o extrato de L.
cordigera sobre P. aeruginosa (256 µg/mL), B. subtilis, K. pneumoniae, S.
Typhimurium, S. aureus e C. albicans (512 µg/mL), e o extrato de B. insignis
apenas sobre C. albicans (512 µg/mL).
De modo geral os extratos com maior potencial inibitório foram os de M. cabucu
e L. cordigera inibindo respectivamente C. albicans e P. aeroginosa com 256
µg/mL. Os resultados de CMM foram pouco expressivos, sendo a cepa de E.
faecalis mostrando-se resistente a quatro dos extratos testados nas
concentrações avaliadas.
Extratos etanólicos de M. albicans e M. rubiginosa apresentaram atividade
antimicrobiana contra S. aureus, K. pneumoniae e C. albicans, e M. stenotachya

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

206
UNISA - Universidade de Santo Amaro

sobre C. albicans, porém os extratos não mostraram atividade contra E.


faecalis, P. mirabilis e Salmonella sp. (CELOTTO et al., 2003) semelhantemente
ao observado neste trabalho.
Segundo ALICE et al. (1995) Tibouchina asperior e Leandra australis
apresentam flavonóides, saponinas, taninos e triterpenos. Os flavonóides são
conhecidos por sua atividade antimicrobiana, que é devida, principalmente, a
sua capacidade de complexar-se com proteínas extracelulares de bactérias,
podendo romper sua membrana citoplasmática (COWAN, 1999). Deste modo o
teor mais elevado de flavonóides observado no extrato de L. cardiophylla, pode
ter contribuído para o efeito antimicrobiano observado sobre as bactérias
condicionadas a este extrato.
Taninos são compostos que agem contra bactérias como S. aureus e S.
pneumoniae, mesmo em concentrações mínimas (CASTRO et al., 1999), tais
substâncias foram observados por YOSHIDA et al. (1999) em Tibouchina
semidecandra.
Apesar dos extratos mostrarem atividade inibitória sobre várias cepas testadas,
em concentrações baixas, os mesmos mostraram-se pouco eficientes como
microbicidas, observando-se tal efeito apenas em concentrações mais elevadas

CONCLUSÃO:
Os resultados apresentados neste trabalho demonstraram que os extratos
analisados apresentam expressiva atividade antimicrobiana com M. cabucu e L.
cordigera.

REFERÊNCIA BIBLIOGRÁFICA:
CARVALHO, J. C. T.; GOSMANN, G. & SCHENKEL, E. P. 2003. Compostos
fenólicos simples e heterosídeos. In: SIMÕES, C. M. O.; SCHENKEL, E. P.;
COSMANN, G.; MELLO, J. C. P.; MENTZ, L. A. & PETROVICK, P. R. (eds.).
Farmacologia da planta ao medicamento. Ed. UFSC. Florianópolis.

CAVALCANTE, P.B. & FRIKEL, P. 1973. A farmacopéia tiriyó/ Estudo étno-


botânico. Belém: Gráfica Falangola Editora LTDA.. 157 p.
• CELLOTO, A. C.; NAZARIO, D. Z.; SPESSOTO, M. A.; MARTINS, C. H. G.;
CUNHA, W. R.; Braz. J. 2003. Avaliação da atividade antimicrobiana in vitro de
extratos brutos de três espécies de Miconia. Braz. J. Microbiol. 34: 339- 340.
COWAN, M. M. 1999. Plants products as Antimicrobial Agents. Clin. Microbiol.
Rev.12: 564-582.

• DÉVÉHAT, F. L.; BAKHTIAR, A.; BÉZIVIN, C.; AMOROS, M.; BOUSTIE, J.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

207
UNISA - Universidade de Santo Amaro

2002. Antiviral and cytotoxic activities of some Indonesian plants. Fitoterapia 73:
400-405.

DIGNANI, M. C.; SOLOMKIN, J.S.; ANAISSIE, E. Candida. IN: ANAISSIE, E.;


MCGINNIS, M.R.; PFALLER, M.A. 2003. Medical Mycology. 1ª Edição, Churchill
Livingstone, Filadélfia, p. 195-239.

DJIPA, C. D.; DELMEE, M.; QUENTIN-LECLERCQ, J. 2000. Antimicrobial


Activity of bark extracts of Syzygium jambos (Myrtaceae). J Ethnopharmacol. 71:
307-313.

DUBOIS, M.; GILLES, K. A.; HAMILTON, J. K.; REBERS, P. A. SMITH, F. 1956.


Colorimetric method for determination of sugars and related substances. Anal.
Chem. 28: 350-356.

________________________________________________________________
Palavras chave: Melastomataceae, antimicrobiano, extrato

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

208
UNISA - Universidade de Santo Amaro

Estudo estrutural da distribuição das fibras da matriz


extracelular na pele da Lontra (Lontra longicaudis OLFERS,
1818).
FAGNER LEITAO DE MENEZES(1)

NILSA REGINA DAMACENO(2)(Orientadores)


Ciências Biológicas
INTRODUÇÃO:
Introdução:
A lontra neotropical (Lontra longicaudis) é um mamífero da família Mustelidae
de hábitos semi-aquáticos, de ampla distribuição geográfica, ocorrendo no
México, América Central e América do Sul, até o norte da Argentina. No Brasil,
só não ocorre nas porções mais áridas do nordeste devido ao fato de
apresentar adaptações morfológicas e fisiológicas para vida em habitat semi-
aquático.
As lontras ocupam diversos tipos de ambientes aquáticos, tanto água doce (rios
e lagos) como água salgada (lagunas, baías e enseadas). Sua ocorrência está
relacionada diretamente com a presença de substratos duros, que formam
costões rochosos, que servem para abrigo. São encontradas,
preferencialmente, em cursos d’ água de fluxo rápido e cristalino, alimentam-se
principalmente de peixes e crustáceos, podendo ser observadas solitárias ou
em pares, durante o dia ou à noite. É um animal de corpo alongado, patas
curtas com membranas interdigitais, cauda longa e adaptada para propulsão na
água.
A maioria dos estudos sobre a Lontra longicaudis restringe-se aos seus hábitos
alimentares. Devido à redução crescente de seu habitat e comercialização de
sua pele é considerada uma espécie ameaçada de extinção. Existem poucas
informações a respeito de detalhes da organização tecidual dos seus órgãos e
aparelhos, o que pode dificultar a elaboração de medidas que visem seu
manejo e conservação.
Os mamíferos aquáticos exibem uma série de adaptações anatômicas nos
vários sistemas e na forma externa do corpo, uma vez que o ambiente aquático
impõe uma série de desafios a esses animais cujos ancestrais estavam
adaptados à vida em terra.
A pele é um constituinte fundamental para a sobrevivência de qualquer espécie,
uma vez que sua morfologia está intimamente relacionada com o meio em que
vive.
A pele constitui a interface de contato com o ambiente, seja ele aquático ou
terrestre e deve promover camuflagem, proteção à abrasão e às injúrias,
bloquear raios ultravioletas solares e auxiliar na termorregulação.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

209
UNISA - Universidade de Santo Amaro

De modo geral, nos mamíferos, a pele é relativamente espessa, particularmente


a derme (a partir da qual se confecciona o couro), porém sua espessura varia
de acordo com a espécie e com a localização no corpo, sendo que em algumas
espécies, ocorrem também modificações sazonais. A epiderme é espessada
onde o pêlo é esparso e também nas áreas sujeitas a pressão e à abrasão.
A derme localiza-se sob a epiderme e está constituída pela camada papilar
(delgada, formada por tecido conjuntivo frouxo, que forma as papilas dérmicas)
e pela camada reticular (mais profunda e espessa constituída por tecido
conjuntivo denso).
Os tecidos conjuntivos são responsáveis pelo estabelecimento e manutenção
da forma do corpo. Esse papel mecânico é dado por um conjunto de moléculas
extracelulares que conectam as células e órgãos entre si, dando desta maneira,
suporte ao organismo.
A matriz extracelular é constituída por fibras e substância fundamental amorfa
que preenche os espaços entre as células e as fibras do tecido conjuntivo. A
substância amorfa é um complexo viscoso e altamente hidrofílico de
macromoléculas aniônicas (glicosaminoglicanos e proteoglicanos) e
glicoproteínas multiadesivas (laminina, fibronectina, entre outras) que se ligam a
proteínas receptoras (integrinas) presentes na superfície de células, bem como
interagem com os elementos fibrilares.
As fibras da matriz extracelular são divididas em dois sistemas de acordo com a
sua natureza química: o sistema colagênico (cujas fibras são conhecidas por
conter colágeno) e o sistema elástico. Em mamíferos, colágenos são
responsáveis pela força e tensão dos tecidos, enquanto que a elastina e os
proteoglicanos são essenciais para a resiliência da matriz (Montes, 1996). A
quantidade relativa de cada um desses componentes varia significativamente
com a idade e com o tipo de tecido conjuntivo em questão. Mudanças na
estrutura da matriz extracelular alteram especificamente a morfogênese celular,
o funcionamento da célula, proliferação, diferenciação e processos de
migração.
Os colágenos constituem uma família de proteínas fibrosas bem características,
encontradas em todos os animais multicelulares, produzidas por diversos tipos
de células, e que se distinguem em composição química, propriedades físicas,
organização estrutural, distribuição nos tecidos e funções. São as proteínas
mais abundantes nos mamíferos, constituindo cerca de 25% da sua massa
protéica total.
Atualmente são conhecidos mais de 20 diferentes tipos de colágeno. Os
principais tipos de colágeno encontrados nos tecidos conjuntivos são os tipos I,
II, III, IV, V e VII. Dentre estes, com exceção do colágeno IV, todos os tipos
formam fibrilas, cujas estriações transversais típicas, facilmente identificadas
nas micrografias eletrônicas, são conseqüência do arranjo das moléculas de
colágeno.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

210
UNISA - Universidade de Santo Amaro

As fibras colágenas são constituídas principalmente por colágeno tipo I e são


abundantes em localizações sujeitas a grandes forças de tensão. Observadas
sob microscopia de luz, as fibras colágenas são acidófilas, corando-se em
róseo pela técnica da hematoxila-eosina e em vermelho pela técnica do
picrossirius. As fibras colágenas apresentam forte birrefringência de coloração
vermelho-amarelada quando coradas pelo picrossírius e examinadas ao
microscópio de polarização.
O colágeno III, por sua vez, é o principal constituinte das fibras reticulares, que
são de difícil visualização em microscopia de luz quando coradas pela
hematoxilina-eosina, devido à sua pequena espessura, sendo facilmente
identificadas pela técnica da impregnação argêntica e por sua birrefringência
fraca e esverdeada quando coradas pelo picrossírius e observadas sob luz
polarizada.
Observações em pele de mamíferos mostraram que o colágeno tipo III é
encontrado frequentemente na camada papilar da derme enquanto que o
colágeno tipo I predomina na camada reticular (Junqueira et al., 1983).
O sistema elástico compreende três tipos distintos de fibras: as elásticas
propriamente ditas, as elaunínicas e as oxitalânicas. Do ponto de vista ultra-
estrutural, fibras elásticas apresentam-se compostas por um cerne de elastina
(que aparece como um material amorfo e homogêneo) rodeado por
microfibrilas, ricas em fibrilina de 10 – 12 nm de diâmetro (Montes, 1996).
Durante o desenvolvimento de uma fibra elástica, um feixe contendo somente
microfibrilas aparece primeiro e, em seguida, ocorre à deposição do material
amorfo (elastina) por entre as microfibrilas até que a fibra elástica atinja sua
completa maturação. A elastina representa por volta de 90% total da fibra
elástica madura, e foi reconhecida ao microscópio óptico há mais de um século
por causa das suas propriedades características de coloração.
No entanto, em certos compartimentos teciduais, é possível observar somente
feixes de microfibrilas e sem a elastina (conhecidos como fibras oxitalânicas) ou
ainda encontram-se feixes de microfibrilas contendo áreas esparsas de elastina
(conhecidos como fibras elaunínicas). Estas fibras, mesmo no seu estado
adulto, não apresentarão depósito de elastina. Estas observações mostram que
nem todas os feixes de microfibrilas estão destinados a servir como “guias” para
a deposição de elastina, dando origem a uma fibra elástica, podendo ser
entidades microfibrilares independentes no tecido conjuntivo. As fibras do
sistema elástico interagem com muitos componentes extracelulares,
especialmente com as fibras colágenas.
Do ponto de vista biomecânico, a proteína elastina é responsável pelas
propriedades elásticas da fibra elástica; as microfibrilas, por sua vez, são
praticamente inelásticas e fornecem resistência a forças tênseis.
A pele humana é um excelente exemplo de tecido no qual coexistem os três
tipos de fibras do sistema elástico: na derme papilar, especificamente na região

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

211
UNISA - Universidade de Santo Amaro

da junção dermo-epidérmica, aparecem fibras oxitalânicas formadas por feixes


de microfibrilas com 10 a 12 nm de diâmetro. Na derme reticular, predominam
as grossas fibras elásticas, enquanto que na interface entre derme papilar e
reticular observa-se um plexo de fibras elaunínicas (Cotta-Pereira et al., 1976).

OBJETIVO:
Objetivos:
Este estudo teve como objetivo a análise qualitativa da distribuição das fibras
dos sistemas colagênico e elástico na pele da Lontra longicaudis.

METODOLOGIA:
Metodologia:
As amostras do tegumento da pele de uma lontra (Lontra longicaudis) originária
de Buenos Aires, Argentina, foram obtidas no ano de 1994 e fazem parte do
acervo do Laboratório de Biologia Celular da Faculdade de Medicina da
Universidade de São Paulo. O material se encontra emblocado em parafina.
Cortes de 4µm foram obtidos em micrótomo Leica RM2065 e corados com
hematoxilina eosina para estudo da estrutura histológica geral. Para o estudo
das fibras do sistema colagênico, foi utilizado o método da picrossírius
polarização; para revelar a presença e distribuição das fibras do sistema
elástico utilizou-se a técnica Resorcina-fucsina de Weigert com oxidação prévia
do corte histológico, que cora simultaneamente todos os tipos de fibras do
sistema elástico.
As observações foram realizadas em microscópio óptico Nikon com e sem luz
polarizada e as imagens digitais foram obtidas com o auxílio do programa de
análises de imagens digitais Image Pro-Plus (Media Cybernetics, USA)
acoplado a um microscópio de luz Nikon Opitphot.

RESUMO:
Resultados:
Através da análise microscópica a epiderme da pele da lontra (Lontra
longicaudis) mostrou-se delgada formada por 4 a 5 camadas de células
constituindo um epitélio estratificado pavimentoso queratinizado; a derme
apresenta um grande número de folículos pilosos e glândulas sebáceas imersas
no tecido conjuntivo. Não foram observadas glândulas sudoríparas. O tecido
conjuntivo apresentou-se com uma distribuição heterogênea seguindo as
diferentes camadas teciduais observadas na derme.
Na camada papilar é possível observar, nos preparados corados com
picrossírius e analisados sob luz polarizada, a presença de delgadas fibras de

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

212
UNISA - Universidade de Santo Amaro

colágeno tipo III organizadas em duas disposições preferenciais; nas regiões de


papila dérmica propriamente dita as fibras de colágeno III apresentam-se como
uma rede delicada de finas fibras coradas fracamente birrefringentes de
coloração esverdeada. Nas regiões mais retilíneas da derme papilar (ou seja,
no espaço interpapilar) as fibras de colágeno apresentam-se dispostas
paralelamente entre si e à membrana basal epitelial.
Na maior parte da derme reticular foi possível observar, nos preparados
corados com picrossírius e estudados sob luz polarizada, a presença de grande
quantidade de fibras colágenas grossas, fortemente birrefringentes de
coloração vermelho-amarelada, características de colágeno tipo I, dispostas
como uma densa trama de feixes nas três direções do espaço.
Na região mais profunda da derme, já em contato com a hipoderme, as fibras
colágenas do tipo I aparecem formando um estrato de fibras paralelas entre si.
A hipoderme, por sua vez, é rica em finas fibras de colágeno tipo III localizadas
nos septos de tecido conjuntivo que sustentam as células adiposas e os vasos
sanguíneos.
Em relação às fibras do sistema elástico, é possível identificar fibras finas,
correspondente às fibras oxitalânicas, que se inserem na lâmina basal epitelial.
Pode-se notar também a presença de fibras elásticas grossas na derme papilar.
Na derme reticular observa-se rede de fibras elásticas que, de modo geral,
acompanha a distribuição das fibras colagênicas, apresentando portanto perfis
em cortes transversais oblíquos e longitudinais. Chama a atenção o fato que, ao
redor dos folículos pilosos, existe uma grande quantidade de fibras do sistema
elástico.
Na região profunda da derme reticular, em co-localização com o estrato de
fibras colágenas paralelas entre si, é possível observar grande quantidade de
fibras elásticas dispostas paralelamente às fibras colágenas. Na hipoderme
ocorrem escassos perfis de fibras do sistema elástico.

Discussão:
A caracterização da morfologia do tecido, assim como da distribuição das fibras
do sistema colagênico e elástico na pele da lontra foi facilmente realizada
devido à existência de critérios morfológicos e histoquímicos especifícos.
A distribuição das fibras dos sistemas colagênico e elástico na pele da lontra
apresentou-se diferente tanto da de mamíferos terrestres quanto de outros
mamíferos ou animais aquáticos,
Sabe-se que as propriedades mecânicas dos tecidos decorrem em grande parte
dos componentes da matriz extracelular, principalmente da relação entre
elastina e colágeno, que conferem respectivamente a elasticidade e a
resistência. Nossos achados são, portanto, compatíveis com a hipótese de que
os sistemas colagênico e elástico co-evoluíram de modo a acomodar a
diversidade funcional (Montes, 1996). Sabendo que a distribuição destas fibras

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

213
UNISA - Universidade de Santo Amaro

em tecidos dinâmicos, como a pele, tem um papel central na biomecânica do


órgão e que as fibras colágenas fornecem resistência às forças tênseis, sugere-
se que as fibras elásticas propriamente ditas distribuídas ao longo da trama
colágena sejam responsáveis pela recuperação plástica do colágeno após o
estiramento
A distribuição das fibras que contém colágeno na derme papilar da lontra é
peculiar, uma vez que, intercaladas às finas fibras reticulares típicas da derme
papilar, aparecem feixes de fibras colagênicas paralelas entre si. Desta forma
na região papilar o colágeno se organiza formando linhas paralelas ao longo da
pele do animal. Pode-se especular que esta distribuição tem relação direta à
capacidade de natação eficiente destes animais, uma vez que criam-se linhas
hidrodinâmicas na pele que podem facilitar o deslizamento na água.
As fibras do sistema elástico apresentaram uma distribuição semelhante ao
demonstrado pela literatura, como por exemplo, na pele humana (Cotta-Pereira,
1984), no sentido que as fibras mais finas, correspondentes às fibras
oxitalânicas (inelásticas) estão localizadas na região superficial inserindo-se na
membrana basal (conferindo adesividade à junção dermo-epidérmica),
enquanto que as camadas mais profundas apresentam maior concentração de
fibras elásticas grossas. Porém, diferentemente da pele humana e da maioria
dos mamíferos terrestres, na pele da lontra ocorrem perfis de fibras elásticas
grossas na camada papilar.
A faixa de tecido conjuntivo denso, localizada próxima à hipoderme, rica em
fibras colágenas e elásticas paralelas entre si pode funcionar como uma
estrutura de interação biomecânica entre a pele e musculatura subjacente,
adaptando a pele às vigorosas contrações musculares durante a natação.
Ao redor dos folículos pilosos existe uma grande quantidade de fibras do
sistema elástico e o estudo aprofundado desta distribuição, a nível ultra-
estrutural, seria enriquecedor para esclarecer aspectos relativos à mobilidade
dos pelos na pele.

CONCLUSÃO:
Conclusões:
A distribuição das fibras da matriz extracelular não é homogênea nas diversas
localizações do tecido conjuntivo da derme da lontra e alguns dos seus
aspectos parecem estar relacionados à maior eficiência natatória, como o
arranjo linear do colágeno na derme papilar e a faixa de tecido fibroelástico na
região profunda da derme reticular.

REFERÊNCIA BIBLIOGRÁFICA:
Cotta-Pereira, G.; Del-Caro, L.M e Montes, G.S. 1984. Distribution of elastic

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

214
UNISA - Universidade de Santo Amaro

system fibers in hyaline and fibrous cartilages of the rat. Acta anatômica 119:
80-85.

Junqueira, L.C.U.; Montes G.S.; Martins J.E.C. e Joazeiro, P.P. 1983. Dermal
collagen distribution. A histochemical and ultrastructural study. Histochemistry
79: 397-402.

Montes, G.S. 1996. Structural biology of the fibres of the collagenous and elastic
systems. Cell Biology Internacional 20: 15-27.

________________________________________________________________
Fagner L. de Menezes¹; Marcelo A. Ferreira2, Mariana M. Veras3, Claudia N.
Battlehner2, Elia G. Caldini2, Nilsa R. Damaceno-Rodrigues2.

1-Curso de Ciências Biológicas da Universidade Santo Amaro. 2-Laboratório de


Biologia Celular, 3-Laboratório de Poluição Atmosférica Experimental,
Departamento de Patologia, Faculdade de Medicina da Universidade de São
Paulo, Brasil.

Palavras-chave: Pele, matriz extracelular, fibras do sistema colagênico, fibras


do sistema elástico, mamífero semi-aquático, Mustelidae.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

215
UNISA - Universidade de Santo Amaro

ESTUDO HISTÓLOGICO E HISTOQUÍMICO DA GLÂNDULA DE


DUVERNOY DE OXYBELIS FULGIDUS
VALERIA DE SOUZA LEITE(1)

ELIANA DE OLIVEIRA SERAPICOS(2)(Orientadores)


Ciências Biológicas
INTRODUÇÃO:
LEITE, V.S. & SERAPICOS, E.O. Estudo histológico e histoquímico da glândula
de Duvernoy de Oxybelis fulgidus (Daudim, 1803) Serpentes – Colubridae.

A Família Colubridae é considerada a maior e mais diversificada família de


serpentes, pode ter hábitos variados e uma ampla distribuição geográfica.
Essas serpentes apresentam dentição do tipo opistóglifa e produzem uma
secreção tóxica proveniente da glândula de Duvernoy, localizada na região
supralabial, posteriormente aos olhos. A função dessa glândula está
relacionada à alimentação dessas serpentes, pois a substância secretada pode
auxiliar na imobilização e captura de presas, lubrificação do alimento, higiene
bucal, além de desempenhar funções digestivas e de anti-putrefação do
alimento. Acidentes ofídicos envolvendo serpentes não-peçonhentas têm sido
registrados. Estes acidentes foram causados por colubrídeos opistóglifos, entre
eles, Clelia clelia, Clelia plumbea, Philodryas olfersii e Philodryas patagoniensis.
No Brasil, por exemplo, cerca de 40% dos acidentes registrados no Hospital
Vital Brasil, em São Paulo, são causados por serpentes não-peçonhentas.
Porém, até o presente momento pouco se sabe sobre a epidemiologia dos
acidentes causados por colubrídeos.

OBJETIVO:
Objetivos

Este trabalho teve como objetivo realizar estudos histológicos e histoquímicos


da glândula de Duvernoy de Oxybelis fulgidus, visando contribuir para futuros
estudos epidemiológicos de colubrídeos opistóglifos.

METODOLOGIA:
Matérias e métodos

Para o desenvolvimento deste estudo foi utilizado um espécime de Oxybelis


fulgidus pertencente à Família Colubridae, com dentição opistóglifa.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

216
UNISA - Universidade de Santo Amaro

Este espécime foi capturado na cidade de Lageado (Tocantins), durante o


Resgate de Fauna para a implantação de Usina Hidrelétrica. Posteriormente, foi
destinado a Coleção Herpetológica “Alphonse Richard Hoge” do Laboratório de
Herpetologia do Instituto Butantan, o qual foi identificado e classificado
taxonomicamente por profissionais especializados. Em seguida, foi eutanasiado
de acordo com os protocolos de ética e bem-estar animal e tombado na referida
Coleção sob o registro IBSP: 65.814.

Vale ressaltar que, este indivíduo não foi eutanasiado especificamente para o
desenvolvimento deste estudo, assim sendo, utilizamos material proveniente do
espécime que necessariamente seria depositado em Coleção Científica, visto a
impossibilidade técnica de reintroduzí-lo na natureza, ou em outras áreas, sob
risco de desequilíbrio ecológico.

Após a eutanásia do espécime, a glândula de Duvernoy foi coletada e fixada


em líquido Bouin para posterior processamento histológico. Em seguida, esta
serpente foi catalogada e depositada na Coleção Herpetológica do Instituto
Butantan. O processo de fixação mantém a morfologia e a composição dos
tecidos da glândula, pois insolubiliza as proteínas responsáveis pelas estruturas
das células e dos tecidos. Em seguida, o material passou por uma etapa de
desidratação, que consiste na remoção da água dos tecidos através de álcool
etílico absoluto. Logo depois, o álcool foi substituído por uma sustância química
chamada Xilol, esta etapa é conhecida como diafanização, onde a substância
química torna os tecidos translúcidos. Após a diafanização com Xilol, iniciou-se
o processo de impregnação pela parafina, onde o Xilol foi substituído pela
parafina fundida numa estufa de 60°C. Então o tecido foi colocado em uma
placa de Leuckart que continha parafina fundida. Desta forma, a parafina
solidificou em temperatura ambiente, formando um bloco de parafina com o
tecido em seu interior, esta etapa é conhecida como inclusão.

Depois da inclusão em parafina, seguimos com a microtomia do bloco de


parafina á 5 µm de espessura. Em seguida, ocorreu a desparafinização dos
cortes e hidratação com concentração decrescente de álcool etílico até água
destilada.

Os cortes foram submetidos à coloração pelos métodos de rotina como


hematoxilina-eosina (H/E) E Tricômico de Mallory. Também foram utilizados
métodos histoquímicos para a observação de determinadas substâncias
químicas secretadas pela glândula de Duvernoy.

Em seguida, realizamos a montagem das lâminas com resina sintética Entellan


(Merck), onde as análises das lâminas foram feitas em Microscópio Óptico.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

217
UNISA - Universidade de Santo Amaro

RESUMO:
RESULTADOS HISTOLÓGICOS

O método hematoxillina/eosina (H/E) quando aplicado à glândula de Duvernoy


corou em róseo o citoplasma das células serosas, e em azul o núcleo dessas
células evidenciando assim a posição basal em que se encontravam. O mesmo
método evidenciou em róseo as células que constituem os ductos excretores, o
epitélio estratificado e o conteúdo acidófilo presente no interior dos ductos.

Na glândula supralabial o método de coloração H/E corou em azul (roxo) o


núcleo das células mucosas e em róseo o tecido conjuntivo que circunda a
referida glândula.

O método de rotina Tricômico de Mallory evidenciou em azul o tecido


conjuntivo que reveste externamente a glândula de Duvernoy, subdivide a
glândula em lóbulos e circunda os túbulos secretores, os quais foram corados
em vermelho. Os vasos sanguíneos e os nervos presentes na glândula de
Duvernoy também se coraram em vermelho. O epitélio estratificado que reveste
internamente os ductos excretores corou-se em vermelho evidenciando a
presença de células mucosas e serosas. O método em questão corou em azul
os septos de tecido conjuntivo que circundam a glândula supralabial, e em
vermelho os túbulos secretores, evidenciando assim a presença de células
serosas.

RESULTADOS DOS MÉTODOS HISTOQUÍMICOS

Na glândula de Duvernoy de Oxybelis fulgidus, as células serosas que


constituem os túbulos secretores reagiram negativamente ao método Alcian
Blue (pH 2,5), fracamente positivo nos ductos excretores e moderadamente
positivo na glândula supralabial demonstrando assim, a presença de
mucopolissacarídeos ácidos.

O método P.A.S. quando aplicado sobre a glândula de Duvernoy, reagiu de


forma negativa nos túbulos secretores e moderadamente positivo nas células
dos ductos excretores e no conteúdo da luz dos mesmos, Já em relação à
glândula supralabial, as células mucosas dos túbulos secretores reagiram
fortemente positiva ao método, constatando a presença de
mucopolissacarídeos neutros.

As células serosas dos túbulos secretores da glândula de Duvernoy não

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

218
UNISA - Universidade de Santo Amaro

reagiram ao método P.A.S. + Alcian Blue (pH 2,5 ). As células mucosas


presentes nos ductos excretores reagiram de forma moderadamente positiva ao
mesmo método histoquímico. Em relação à glândula supralabial, as células
mucosas que constituem os túbulos secretores coraram-se fortemente ao
método PAS + Alcian Blue, evidenciando assim, a presença de
mucopolissacarídeos neutros e ácidos. Vale ressaltar que foi observada uma
leve predominância dos mucopolissacarídeos neutros.

Quando aplicado o método P.A.S + amilase salivar, as células dos túbulos


secretores da glândula de Duvernoy reagiram negativamente, enquanto as
células mucosas dos ductos excretores e o seu conteúdo reagiram
moderadamente positivo. Nas células mucosas da glândula supralabial foi
observada uma forte positividade ao método, confirmando a presença dos
mucopolissacarídeos neutros, assim como nas células mucosas dos ductos
excretores da glândula de Duvernoy, visto que, a enzima amilase tem a função
de digerir o glicogênio quando presente nas células.

O método Azul de Bromofenol quando aplicado na glândula de Duvernoy


coraram, de forma moderadamente positiva, as células serosas dos túbulos
secretores, indicando então, a presença de proteínas. As células dos ductos
excretores reagiram de forma negativa ao método do Azul de Bromofenol,
Contudo, a secreção presente na luz dos ductos excretores reagiu fracamente
positiva. Em relação à glândula supralabial, não foi observada positividade ao
Azul de Bromofenol.

DISCUSSÃO

Duvernoy, em 1832, foi o primeiro autor a descrever e diferenciar a glândula


supralabial, denominando-a de “Glande Venimeuse”.
TAUB,( 1967) descreveu quatro tipos básicos de glândula de Duvernoy, em
relação à histologia, a primeira é a glândula predominantemente constituída por
células mucosas, a segunda é constituída predominantemente por células
serosas intercaladas por células mucosas sendo denominada de seromucosa
(mista), a terceira é constituída por células mucosas intercaladas por células
serosas, sendo denominada mucoserosa, e a última é constituída
exclusivamente por células serosas.

No presente estudo caracterizamos a glândula de Duvernoy de Oxybelis


fulgidus como seromucosa, devido à predominância de células de natureza
serosa sobre as células mucosas. Estes resultados também foram
apresentados por RENNER & SABÓIA-MORAIS (2000) em estudos com Clelia

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

219
UNISA - Universidade de Santo Amaro

clelia, por SERAPICOS & MERUSSE (2006) com Phimophis guerrini,


Thamnodynastes strigatus e Tomodon dorsatus e por SALOMÃO (1991) com
Philodryas olfersii.

A predominância de células serosas demonstra que a glândula de Duvernoy


produz enzimas e proteínas, sugerindo um caráter tóxico à secreção produzida
(SERAPICOS & MERUSSE 2006).

Os colubrídeos que possuem a glândula de Duvernoy constituída por células


predominantemente mucosas subjugam suas presas por constricção,
diferentemente dos colubrídeos que possuem a glândula de Duvernoy
constituída predominantemente por células serosas, estes subjugam as suas
presas por envenenamento (TAUB, 1967). O fato da glândula de Duvernoy de
Oxybelis fulgidus apresentar-se caracterizada como seromucosa, explicaria a
relação da referida glândula com o hábito alimentar deste animal, pois a
espécie Oxybelis fulgidus se alimenta preferencialmente de aves, necessitando
assim de uma secreção mais tóxica para subjugar suas presas por
envenenamento.

A função da glândula de Duvernoy está diretamente relacionada à


alimentação dos colubrídeos, pois a presença de células serosas auxilia na
imobilização e captura das presas, na lubrificação do alimento, na higiene
bucal, e ainda desempenham funções digestivas e de anti-putrefação do
alimento (TAUB, 1967; ZAGO, 1971; SALOMÃO, 1991; SERAPICOS &
MERUSSE, 2006).

Neste estudo foi observado que a glândula de Duvernoy de Oxybelis fulgidus é


constituída por túbulos secretores, de natureza serosa, ductos excretores
constituídos por células epiteliais e poucas células mucosas. Estes dados
também foram constatados por ZAGO (1971) em estudos com Xenodon
merremii e Philodryas patagoniensis, em Clelia clelia (RENNER, 2000) e por
SERAPICOS & MERUSSE (2006) com Phimophis guerrini, Thamnodynastes
strigatus e Tomodon dorsatus.

As células que constituem os túbulos secretores da glândula supralabial são


exclusivamente mucosas. Estes dados também foram constatados por
ZALISKO (1992) em estudos com Boiga irregularis e por SERAPICOS &
MERUSSE (2006) em Philodryas patagoniensis, Philodryas olfersii, Oxyrhopus
guibei, Phimophis guerrini, Thamnodynastes strigatus e Tomodon dorsatus.

Em relação à histoquímica da glândula de Duvernoy de Oxybelis fulgidus, foi


observado que o método Alcian Blue pH 2,5 reagiu fracamente nas células dos

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

220
UNISA - Universidade de Santo Amaro

ductos excretores, o que indica que estes também apresentam poucas células
de natureza mucosa, já nos túbulos secretores reagiu negativamente ao
método. Na glândula supralabial, foi observada uma reação moderadamente
positiva indicando a presença de mucopolissacarídeos ácidos, sugerindo assim,
se tratar de uma glândula de natureza mucosa, resultados semelhantes foram
constatados por RENNER & SABÓIA MORAIS (2000) em estudos com Clelia
clelia e por SERAPICOS & MERUSSE (2006) em estudos com Philodryas
patagoniensis, Philodryas olfersii, Oxyrhopus guibei, Phimophis guerrini,
Thamnodynastes strigatus e Tomodon dorsatus.

A presença de mucopolissacarídeos neutros foi evidenciada nas células dos


túbulos secretores da glândula supralabial e nas células dos ductos excretores
da glândula de Duvernoy através do método P.A.S. Este fato indica que as
células mucosas da glândula supralabial secretam tal substância para auxiliar
na lubrificação e deglutição do alimento (KARDONG, 1982). Contudo, a reação
negativa nas células dos túbulos secretores da glândula de Duvernoy, em
relação aos mucopolissacarídeos neutros, deve-se à presença de células de
caráter seroso.

Nos ductos excretores da glândula de Duvernoy e nas células dos túbulos


secretores da glândula supralabial constatou-se a presença de
mucopolissacarídeos neutros e ácidos, evidenciada após a reação PAS + Alcian
Blue pH 2,5, porém houve uma leve predominância de mucopolissacarídeos
neutros, devido ao caráter mucoso tanto das células que constituem os ductos
excretores da glândula de Duvernoy quanto as que constituem túbulos
secretores da glândula supralabial. Estudos com Philodryas olfersii, Philodryas
patagoniensis, Oxyrhopus guibei, Phimorphis guerrini, Tomodon dorsatus e
Thamnodynastes strigatus (SERAPICOS & MERUSSE, 2006) demonstraram
resultados semelhantes.

O tratamento com o método P.A.S.+ amilase salivar, evidenciou a presença de


mucopolissacarídeos neutros nas células dos ductos excretores da glândula de
Duvernoy e nas células mucosas que constituem a glândula supralabial. Se a
positividade observada na reação P.A.S. fosse devida à presença de glicogênio,
este teria sido digerido pela enzima amilase salivar. Contudo, a reação após
tratamento, dos cortes histológicos, pela amilase salivar, permaneceu positiva.
Os túbulos secretores da glândula de Duvernoy reagiram de forma negativa ao
método em questão. RENNER (2000) em estudos com Clelia clelia, também
evidenciou positividade ao P.A.S nos ductos excretores da glândula de
Duvernoy, mesmo após o tratamento com a enzima amilase salivar. Resultados
semelhantes foram obtidos por ZAGO (1971) com Philodryas patagoniensis,
onde os ductos excretores da glândula de Duvernoy e os túbulos da glândula

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

221
UNISA - Universidade de Santo Amaro

supralabial continuaram reativos ao método P.A.S, evidenciando assim como


neste estudo, a presença de mucopolissacarídeos neutros. SALOMÃO (1991)
em estudos com Phylodryas olfersii, não observou a presença de glicogênio nos
túbulos secretores da glândula supralabial que apresentavam células mucosas,
pois continuaram reativos ao método P.A.S.

Os resultados histoquímicos obtidos neste estudo podem estar relacionados


ao hábito alimentar especialista da espécie Oxybelis fulgidus descrito por
VALADÃO (et al., 2006). De acordo com o autor, foram realizados estudos
envolvendo a predação de aves por Oxybelis fulgidus demonstrando que a
espécie Oxybelis fulgidus utiliza a estratégia de captura denominada espreita,
seguida de bote, onde a serpente apreende a cabeça da presa pela boca
utilizando o método de envenenamento para subjugar a mesma.

As serpentes não-peçonhentas são erroneamente consideradas inofensivas.


No Brasil, cerca de 40% dos acidentes registrados no Hospital Vital Brasil do
Instituto Butantan em São Paulo, são causados por serpentes consideradas
não- peçonhentas (ZALISKO & KARDONG, 1992; SILVA & BUONONATO,
1983/84; RENNER & SABÓIA-MORAIS, 2000; SERAPICOS & MERUSSE,
2006).

Alguns gêneros de colubrídeos opistóglifos responsáveis por acidentes no


Brasil têm sido relatados na literatura cientifica, como Erythrolamprus
(MARTINS, 1916), Thamnodynastes (MARTINS, 1916; DIAZ et al., 2004)
Philodryas (MARTINS, 1916; SILVA & BUONONATO, 1983/84; RIBEIRO et al.,
1999), Clelia (PINTO et al., 1991), e Boiruna (SANTOS-COSTA et al., 2000).

As células dos túbulos secretores da glândula de Duvernoy apresentaram


reação moderadamente positiva ao método azul de Bromofenol, demonstrando
a presença de proteínas, assim como os estudos de ZALISKO (1992) com
Boiga irregularis). As proteínas compõem cerca de 90% do peso seco da
secreção tóxica (veneno) das serpentes. Tal positividade sugere uma certa
toxicidade da secreção produzida pela glândula de Duvernoy de Oxybelis
fulgidus, já que esta espécie necessita de uma secreção mais tóxica para
subjugar as suas presas por envenenamento, pois a presa por, ser uma ave,
dificulta o processo de captura.

Contudo, a espécie Oxybelis fulgidus poderia eventualmente provocar graves


acidentes em seres humanos, devido à toxicidade de sua secreção. No entanto,
até o presente momento nenhum acidente foi relatado envolvendo a serpente
Oxybelis fulgidus, pois pouco se sabe sobre a biologia da espécie Oxybelis
fulgidus, bem como os mecanismos relacionados ao seu aparelho de veneno.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

222
UNISA - Universidade de Santo Amaro

Este estudo abordou características histológicas e histoquímicas da glândula de


Duvernoy da referida espécie, visando contribuir para futuros estudos
epidemiológicos.

CONCLUSÃO:
CONSIDERAÇÕES FINAIS

Este estudo abordou características histológicas e histoquímicas da glândula


de Duvernoy de Oxybelis fulgidus, um colubrídeo opistóglifo, com hábito
alimentar especialista.

Através dos resultados obtidos neste estudo, podemos classificar a glândula


de Duvernoy de Oxybelis fulgidus como seromucosa, devido à predominância
de células de natureza serosa em seus túbulos secretores e a presença de
células mucosas nos ductos excretores.

A glândula supralabial desta espécie é constituída por células mucosas, sendo


então caracterizada como uma glândula exclusivamente mucosa, devido a forte
reatividade aos métodos histoquímicos à ela aplicados, os quais evidenciaram a
presença de mucopolissacarídeos ácidos e neutros.

O método Azul de Bromofenol evidenciou a presença de proteínas presentes


nas células dos túbulos secretores da glândula de Duvernoy, este fato sugere a
toxicidade dessa secreção. O mesmo não foi observado na glândula supralabial
devido ao caráter mucoso da glândula.

Deste modo, o caráter tóxico da glândula de Duvernoy de Oxybelis fulgidus


está diretamente associado ao hábito especialista desta espécie, que pode
causar eventualmente acidentes graves em seres humanos.

Assim fazem-se necessários a continuidade de estudos sobre os colubrídeos


considerados não-peçonhentos, a fim de contribuir para futuros estudos
epidemiológicos.

REFERÊNCIA BIBLIOGRÁFICA:
RENNER, M.F. 1999. Caracterização enzimática do veneno e estudo histológico
da glândula de Duvernoy de Clelia clelia plúmbea (Wield, 1820) (Serpentes:
Colubridae - Xenodontinae). Porto Alegre, 84p. Dissertação (Mestrado) –

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

223
UNISA - Universidade de Santo Amaro

Faculdade de Biociências, Pontifícia Universidade Católica do rio Grande do


Sul.

RENNER, M.F. & SABOIA-MORAIS, S.M.T. 2000. Estudo histológico da


glândula de Duvernoy de Clelia clelia plúmbea (Wield) (Serpentes: Colubridae -
Xenodontinae). Revista Brasileira de Zoologia, 17(3): 583-588.

SALOMÃO, M.G. 1991. Estrutura e secreção das glândulas de Duvernoy de


Sibynomorphus mikanii (Colubridae, Didsadinae) e Philodryas olfersii
(Colubridae, Xenodontidae), e das glândulas de veneno de Bothrops jararaca
(Viperidae, Crotalinae) e Micrurus frontalis (Elapidae, Elapinae) e a influência
dos estados de alimentação e jejum. São Paulo, 122p. Tese (Doutorado).
Departamento de Fisiologia do Instituto de Biociências, Universidade de São
Paulo.

SERAPICOS, E.O. & MEIRUSSE, J.L.B. 2006. Morfologia e Histoquímica das


glândulas de Duvernoy e supralabial de seis espécies de colubrídeos
opistoglifodontes (Serpentes, Colubridae). Papéis Avulsos de Zoologia, 46 (15):
187 -195.

SILVA, M.V. & BOUNONATO, M.A. 1983/84. Relato clínico de envenenamento


humano por Philodryas ofersii. Memórias do Instituto Butantan, 47/48: 12-26.

KARDONG, K.V. 1982. The evolution of the venom apparatus in snakes from
colubrids to viperids to elapids. Memórias do Instituto Butantan. 46: 105-118.

TAUB, A.M. 1967. Comparative histological studies on Duvernoy’s gland of


colubrid snakes. Bulletin of the American Museum Natural History, New York,
138: 1- 50.

VALADÃO, R.M.; SEGALLA, A.R. & NASCIMENTO, G.A., 2007. Predação de


Turdus leucomelas (aves muscicapidae) por Oxybelis fulgidus (Squamata:
Colubridae) na estação ecológica Serra das Araras, província serrana, Mato
Grosso. Anais do VIII Congresso de Ecologia do Brasil, Caxambu, M.G.

ZAGO, D.A. 1971. Estudo morfológico e histoquímico de glândulas salivares


relacionadas com a evolução da função venenosa nos ofídios. Tese de
Doutorado. Depto. de Histologia e Embriologia do Instituto de Ciências
Biomédicas, Universidade de São Paulo. 69p.

ZALISKO, E.J. & KARDONG, K.V. 1992. Histology and histochemistry of the
Duvernoy’s gland of the brown tree snake, Boiga irregularis. Copeia, 1992: 791-

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

224
UNISA - Universidade de Santo Amaro

799.

________________________________________________________________
GLANDULA DE DUVERNOY DE O. FULGIDUS

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

225
UNISA - Universidade de Santo Amaro

Estudo preliminar da mastofauna terrestre do Parque Ecológico


do Guarapiranga
MADILENE ALVES DE MIRANDA(1)

LILIAN ELAINE RAMPIM(2)(Orientadores)


Ciências Biológicas
INTRODUÇÃO:
Em 1500 durante a chegada dos primeiros europeus ao Brasil, a Mata Atlântica
cobria 15% do território brasileiro com uma área equivalente a 1.306.421 Km²,
cobrindo total ou parcialmente 17 estados brasileiros: Alagoas, Bahia, Ceará,
Espírito Santo, Goiás, Minas Gerais, Mato Grosso do Sul, Paraíba,
Pernambuco, Piauí, Paraná, Rio de Janeiro, Rio Grande do Norte, Rio Grande
do Sul, Santa Catarina, Sergipe e São Paulo. Atualmente esse bioma está
reduzido a menos de 8% de sua área original, com áreas dispostas de modo
esparso, ao longo da costa brasileira e no interior das regiões Sul e Sudeste,
assim como fragmentos no sul dos estados de Goiás e Mato Grosso do Sul e no
interior dos estados do Nordeste. Após tantos ciclos de utilização insustentável
a Mata Atlântica se encontra na posição de segundo bioma mais ameaçado de
extinção no mundo, perdendo apenas para as Ilhas de Madagascar, onde esse
bioma já está quase extinto. A perda da floresta levou consigo uma diversidade
incalculável, muitas espécies de fauna que eram desconhecidas cientificamente
e que jamais poderemos saber como eram e viviam. Além da fragmentação e
destruição dos seus habitats, os animais da Mata Atlântica sofrem com a caça
predatória, a venda de produtos e animais precedente da caça, a captura ilegal
(tráfico) e introdução de espécies exóticas no território nacional, que acabam
competindo com as espécies nativas. Todos esses problemas são ameaças a
esses animais, porém o mais agressivo e desumano é o tráfico. Além de
prejudicar a biodiversidade, não traz retorno financeiro ao país e não resolve a
questão sócio-econômica. Uma das medidas importantes para a preservação
das comunidades biológicas é o estabelecimento das áreas legalmente
protegidas, que se por um lado só a legislação e a aquisição de terras, por si
só, não asseguram a preservação do habitat, por outro, representam um
importante ponto de partida. Quando se fala de Floresta Atlântica, as unidades
de conservação tornam-se ainda mais importantes já que esse bioma foi quase
extinto pela ação do próprio homem. O Parque Ecológico do Guarapiranga
(PEG) é uma importante Unidade de Conservação, que tem por objetivo
preservar fauna e flora, recuperação do meio ambiente e o desenvolvimento de
atividades de educação ambiental, além ser uma opção de recreação e lazer
para a população da região do entorno e auxiliar na contenção das ocupações
irregulares. Atualmente são conhecidas no mundo cerca de 4.800 espécies de
mamíferos. O terceiro país no mundo que apresenta mais mamíferos é o Brasil,

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

226
UNISA - Universidade de Santo Amaro

com aproximadamente 460 espécies. No entanto essa diversidade biológica é


pouco conhecida.Os mamíferos são os vertebrados que apresentam maior
amplitude de tamanho corporal e têm grande variedade morfológica; é o único
táxon de vertebrados que apresenta formas tão diferenciadas, umas das outras,
como uma baleia e um morcego, suas características e adaptações
morfológicas os distinguem com facilidade de outros grupos animais e permite
que ocupem os ambientes aéreo, aquático e terrestre sendo que neste último
podem apresentar o hábito de vida fossorial, arborícola e terrícola. A ocupação
do território também varia, pois algumas espécies são restritas às áreas mais
preservadas e outras espécies adaptadas aos grandes centros urbanos
Possuem o corpo revestido por pêlos, embora possam ser reduzidos ou
ausentes em alguns indivíduos como as baleias, possuem capacidade de
manutenção da temperatura (endotérmicos) e as glândulas mamárias
responsáveis pelo nome dado a essa classe de vertebrados que são de
primordial importância para os mamíferos já que o leite, produto da glândula
mamária é o único alimento dos filhotes na primeira parte da vida pós-parto.
São representantes importantes no equilíbrio de ecossistemas e na
manutenção da biodiversidade através da dispersão e predação de sementes,
polinização de flores e predação de outros animais entre outros, regulando
assim comunidades animais e vegetais.Constituem o grupo com que os seres
humanos mais se familiarizam São sem dúvidas animais carismáticos que
sempre despertaram o interesse humano, tanto pela sua diversidade, beleza e
utilidade, quanto pelos problemas que podem causar. Os roedores são
utilizados nas áreas médicas e biológicas para o treinamento de profissionais e
também podem se tornar poderosas pragas urbanas. Os indígenas do Brasil
possuíam animais selvagens, que amansavam e mantinham em suas aldeias,
como animais de estimação. São de grande importância para a vida do homem
e sem dúvidas o grupo de maior interesse econômico, constituem em grandes
auxiliares paro o trabalho, fonte de alimentação fornecendo carne e leite, além
do couro e muitos outros produtos necessários para nossa vida moderna.O
Brasil é o país que mais possui espécies ameaçadas de extinção em todo o
mundo, constituindo 69 espécies de mamíferos ameaçados, e muitos deles se
encontram na Mata Atlântica. A degradação cada vez mais acentuada dos
habitats traz sérias conseqüências para a conservação desse grupo, causando
muitas vezes um processo irreversível de extinção das espécies. Entre os
grupos mais ameaçados nesse bioma podemos citar os marsupiais, primatas,
carnívoros e ungulados. Com base no que já foi colocado, torna-se visível a
importância das áreas de proteção ambiental para a preservação das inúmeras
espécies de mamíferos. O Parque Ecológico do Guarapiranga é uma área de
refúgio para aves, anfíbios répteis e mamíferos. O estudo dessa área torna-se
importante para que se tenha conhecimento da ocorrência e diversidade
faunística desse fragmento de Mata Atlântica, que é utilizada por diversos

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

227
UNISA - Universidade de Santo Amaro

animais para viver. E para que através deste estudo seja possível promover a
preservação destes animais e fornecer informações para elaboração de um
futuro plano de manejo do parque.

OBJETIVO:
O presente trabalho teve como objetivo realizar o levantamento preliminar das
espécies de mamíferos não-voadores do PEG através de métodos diretos e
indiretos.

METODOLOGIA:
O estudo foi realizado dentro dos limites do Parque Ecológico do Guarapiranga,
localizado na Estrada do Riviera, Zona Sul do município de São Paulo, á
margem esquerda da represa Guarapiranga, entre as coordenadas geográficas,
23°41’50” e 23°43’33” de latitude sul e 46°44’39” de longitude oeste. O clima
predominante na região é o tropical úmido com temperaturas médias entre 16°C
e 23°C, os índices pluviométricos estão entre 1600 e 2000 milímetros anuais
com teores elevados de umidade do ar. A direção predominante dos ventos é
SW-NE. O estudo preliminar das espécies de mamíferos não voadores de
médio e grande porte foi realizado no período de abril a agosto de 2009
efetuando um esforço amostral decorrente de três saídas mensais, durante o
período de 5 meses resultando na montagem de 360 parcelas de areia. Os
pontos de coletas de dados foram delimitados em uma área restrita do parque,
em duas trilhas principais nomeadas como sendo: Trilha A e Trilha B (Figura 5).
Foram utilizados dois métodos primordiais de observação: registro de pegadas
em parcelas de areia e entrevistas. Também foi levado em consideração o
eventual avistamento desses animais. Foi utilizado o método de uso de parcelas
de areia para o registro das pegadas dos possíveis mamíferos ocorrentes na
região. Este se mostra um método eficiente para a observação de variação,
freqüência de ocorrência de espécies de mamíferos terrestres e no
levantamento rápido de riqueza de espécies desses animais. Foi utilizado o
método de uso de parcelas de areia para o registro das pegadas dos possíveis
mamíferos ocorrentes na região. Este se mostra um método eficiente para a
observação de variação, freqüência de ocorrência de espécies de mamíferos
terrestres e no levantamento rápido de riqueza de espécies desses animais.

RESUMO:
Através do método de busca ativa foram registradas 7 ordens distribuídas em
10 famílias e 10 espécies: gambá-de-orelha-preta (Didelphis aurita), sagüi-de-
tufos-brancos (Callithrix jacchus), veado-catingueiro (Mazama gouazoupira),
tapeti (Sylvilagus brasilensis), cachorro- doméstico (Canis familiaris), gato-
doméstico (Felis catus), cavalo (Eqqus Caballus), búfalo (Bubalus bubalis),
esquilo (Sciurus ingrami) e capivara (Hydrochoerus hydrochaeris). O método de

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

228
UNISA - Universidade de Santo Amaro

registro de pegadas em parcelas de areia permitiu a identificação das espécies


que ocorrem com maior freqüência no parque. Foram identificadas 4 ordens
divididas em 5 famílias e 5 espécies: gambá-de-orelha-preta (Didelphis aurita),
veado-catingueiro (Mazama gouazoupira), tapeti (Sylvilagus brasilensis),
cachorro-doméstico (Canis familiaris), gato-doméstico (Felis catus). As
entrevistas realizadas com os visitantes, moradores vizinhos e funcionários
foram de grande importância para o estudo preliminar das espécies que
ocorrem no parque. Como resultado das entrevistas, foram identificadas 8
ordens distribuídas em 17 famílias e 28 espécies: gambá-de-orelha-preta
(Didelphis aurita), cuíca (Gracilinanus microtarsus), catita (Marmosa murina),
cuíca (Marmosops incanus), catita (Monodelphis sorex), tatu-galinha (Dasypus
novemcinctus), tatu-peba (Euphractus sexicntus), tatu-bola (Tolypeutes
matacus), sagui-de-tufos-brancos (Callithrix jacchus), sagui-de-tufos-pretos
(Callithrix penicillata), macaco-prego (Cebus nigritus) cachorro-doméstico(Canis
familiaris), cachorro-do-mato (Cerdoncyon thous), furão (Galictis cuja), gato-
doméstico (Felis catus), veado-catingueiro (Mazama gouazoupira), esquilo
(Sciurus aestuans), ouriço-cacheiro (Sphiggurus villosus), preá (Cavia aperea),
porquinho-da-índia (Cavia porcellus), capivara (Hydrochoerus hydrochaeris),
cotia (Dasyprocta azarae), ratão-do-banhado (Myocastor coypus), paca (Aguti
paca), tapeti (Sylvilagus brasiliensis), coelho-doméstico (Oryctolagus cuniculus),
cavalo (Equus cabalus), búfalo (Bubalus bubalis).O número de mamíferos
registrados no presente trabalho foi o esperado para a região, levando em
consideração o alto grau de urbanização do local. Trabalhos parecidos com
este obtiveram resultados semelhantes como, Andrade et al. (2008) que
registrou 21 espécies na mata nativa e arredores na região de Rancho Alegre,
PR e Prado et al.(2008) que obteve como resultado o registro de 23 espécies de
mamíferos num fragmento de Mata Atlântica em Minas Gerais. Porém há
trabalhos que apresentam números maiores de registros, o que se dá pelo fato
de serem áreas maiores com maior grau de preservação além do uso de
metodologias mais abrangentes (armadilhas convencionais e armadilhas
fotográficas) como no trabalho realizado por Reis et al. (2008) que teve como
resultado principal o levantamento de 85 espécies de mamíferos na fazenda
Monte alegre em Telêmaco Borba, Paraná. A ocorrência de espécies
domésticas registradas no parque (cachorro, gato, cavalo, búfalo, e coelho),
pôde ser atribuída à alta densidade populacional no seu entorno, e a facilidade
com que os mesmos adentram na região do parque, já que este não possui
todo seu entorno delimitado por barreiras físicas. Como relatado por
funcionários, búfalos são criados livremente na rua e acabam invadindo as
áreas do parque; assim como cavalos que vagam em busca de alimento. Os
coelhos domésticos são criados pela Polícia Florestal ao lado do parque, de
onde acabam fugindo e buscando novas áreas para viver e forragear, e este
pode ser um grande competidor para o tapeti. No entanto o animal doméstico

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

229
UNISA - Universidade de Santo Amaro

de maior ocorrência no PEG é o cachorro e o de menor ocorrência é o gato.


Ocorre ainda o fato de pessoas utilizarem o parque para abandonar animais de
estimação como foi relatado por um funcionário, que observou um porquinho-
da-índia completamente domesticado no parque. As entrevistas realizadas
durante o estudo preliminar foram de grande importância para o conhecimento
de espécies que não seriam registradas na metodologia de campo. Também foi
de grande importância para ciência de possíveis espécies extintas do parque,
sendo este um método também amplamente utilizado, inclusive por Rocha-
Mendes et al. (2005). No entanto pode não ser muito confiável, pois os
entrevistados podem ter apenas o conhecimento popular ou até mesmo
fantasioso, causando confusão na identificação exata das espécies (Andrade et
al. 2008). Algumas espécies citadas nas entrevistas levam a crer que muitos
animais existentes no parque não foram registrados pelos métodos de busca
ativa e registro de pegadas, dessa forma o método de entrevistas se mostrou
bastante eficiente, para conhecimento de espécies como o furão, que não foi
registrado no decorrer do estudo. Esse pequeno carnívoro é um importante
predador de pequenos mamíferos, roedores, répteis e invertebrados, dessa
forma contribui para o controle dessas espécies Auricchio e Auricchio (2006). O
constante encontro de armadilhas, caçadores e incêndios provocados no
parque são indicativos da atividade de caça no passado e que permanecem até
os dias atuais (Negrão et al. 2008), que contribuem para fortes desequilíbrios na
fauna do PEG. De acordo com Aguiar et al. (2005): “A caça é um dos motivos
para o declínio de fauna”. Esse pode ser o provável motivo da extinção de
animais não-registrados nas buscas diretas e indiretas (mencionados apenas
nas entrevistas de moradores e funcionários “antigos”), entre eles o cachorro do
mato (Cerdocyon thous), macaco prego (Cebus Sp.) e ouriço-cacheiro
(Sphiggurus villosus). Esses animais sofrem com a caça intensa em várias
regiões do Brasil.

CONCLUSÃO:
O Parque Ecológico do Guarapiranga apresenta sua fauna de mamíferos
bastante alterada, como conseqüência da grande concentração populacional no
seu entorno.
O parque não é capaz de abrigar mamíferos de grande porte em função da
intensa atividade antrópica na região, e devido á pouca extensão territorial do
mesmo, afinal mamíferos de grande porte necessitam de uma extensão
territorial maior.
Para minimizar os impactos já existentes se faz necessário a elaboração de um
plano de manejo do parque, que deve utilizar as metodologias apresentadas
nesse trabalho, entre outras mais específicas e elaboradas, sendo
recomendado ainda o uso de armadilhas fotográficas para possibilitar o registro
de grupos de diferentes espécies e hábitos, e dessa forma, promover a

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

230
UNISA - Universidade de Santo Amaro

proteção da fauna existente nesse local.


O uso de barreiras físicas na área do no parque, como grades ou muros é de
grande utilidade impedindo ou dificultando a entrada de espécies domésticas.
O aumento na fiscalização dessa área e até mesmo um trabalho em conjunto
da Polícia Florestal e os vigilantes do PEG, pode auxiliar na diminuição de
caçadores e armadilhas encontradas no local.
Um trabalho de educação ambiental se faz necessário nos limites do PEG,
como ferramenta de conscientização da população (visitantes, moradores
vizinhos e funcionários), além de auxiliar na diminuição do abandono de animais
no parque, e também controlar de maneira educativa a oferta de alimentos para
as espécies ocorrentes na região.

REFERÊNCIA BIBLIOGRÁFICA:
Barbosa, L. M. 1999. Plano de Gestão do Parque Ecológico do Guarapiranga-
fase 1. Secretaria do Meio Ambiente. São Paulo. 55p.

Campalini, M. e Prochnow, M. 2006. Mata Atântica- Uma rede pela floresta,


RMA, Brasília,334 p.

Reis, N.R.; Peracchi, A.L.; Pedro, W.A.; Lima, I.P. 2006. Mamíferos do Brasil,
UEL. Londrina. 437p.
________________________________________________________________
Palavras-chave: mamíferos, Mata Atlântica, fauna, parque.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

231
UNISA - Universidade de Santo Amaro

Estudos Estruturais e Conformacionais da Histatina-5 e seu


Análogo, TOACº-Histatina-5: Interação com Íons Metálicos e
Sistemas Biomiméticos
EDIVANIA PAIVA BASTOS(1)

SHIRLEY SCHREIER(2)(Orientadores)
Ciências Biológicas
INTRODUÇÃO:
As histatinas pertencem a uma família de peptídeos catiônicos ricos em
Histidinas, secretados pelas glândulas salivares de humanos e primatas
superiores. Histatina-5 (Hst-5) possui alta atividade antifúngica. Hst-5 tem a
capacidade de se ligar a íons zinco (Zn2+) e cobre (Cu2+) presentes na saliva
e, no solvente menos polar, trifluoroetanol (TFE), adota conformação alfa-
helicoidal.

OBJETIVO:
Com o objetivo de contribuir para a compreensão do mecanismo de ação da
Hst-5, foi estudado o efeito do pH, de TFE e da interação com íons metálicos
sobre as propriedades conformacionais do peptídeo.

METODOLOGIA:
Materiais: Hst-5 foi obtida pelo método de síntese em fase sólida. Cloretos de
Mn2+, Cu2+ e Zn2+ foram obtidos da Labsynth.
Métodos: Espectros de fluorescência foram obtidos no espectrofluorímetro
Hitachi F-4500; para monitorar a fluorescência da tirosina, o comprimento de
onda foi 275 nm, e o espectro de emissão obtido foi entre 285 e 400 nm. Para
monitorar a fluorescência do tirosinato, o comprimento de onda de excitação foi
292 nm, e o espectro de emissão obtido ficou entre 305 e 400 nm. Espectros de
CD foram obtidos no espectropolarímetro Jobin Yvon CD6 entre 190 e 260 nm,

RESUMO:
Efeito do pH: O espectro de fluorescência da Hst-5 foi sensível à variação de
pH, refletindo de forma mais intensa o processo de ionização das tirosinas. A
presença de vários resíduos carregados levou a uma diminuição do pK do
grupamento fenólico. Espectros de CD mostraram que o peptídeo em solução
aquosa possui uma conformação flexível. Mesmo sem levar à aquisição de
estrutura, os espectros mostram que a variação de pH promove flutuações
conformacionais relacionadas à variação de carga do peptídeo.
Efeito do TFE: Espectros de CD indicam a aquisição de estrutura alfa-helicoidal
em presença de TFE.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

232
UNISA - Universidade de Santo Amaro

Efeito da interação com os íons Cu2+, Zn2+ e Mn2+: A adição de íons


metálicos levou à diminuição da fluorescência da Hst-5. O efeito foi mais
pronunciado para o Cu2+ .O estudo do efeito do pH na interação Cu2+-Hst-5
mostrou que o íon promove a ionização da(s) tirosina(s) já a pH 7,6 .
Espectros de CD não revelaram alterações conformacionais significativas
devidas à interação com os íons; porém, a complexação em 70% de TFE levou
à perda da estrutura alfa-helicoidal .

CONCLUSÃO:
Os resultados mostram que a conformação da Hst-5 pode ser modulada pelo
pH, pela polaridade do ambiente e pela interação com íons metálicos. Esses
resultados indicam que interações eletrostáticas são as principais responsáveis
pela ligação dos peptídeos às micelas, devido à sua carga superficial. Essas
propriedades poderiam estar envolvidas no mecanismo de ação do peptídeo, e
este pode futuramente servir como modelo para o desenvolvimento de novas
drogas antimicrobianas.

REFERÊNCIA BIBLIOGRÁFICA:
Oppenheim, F. G. et al. (1988) J. Biol. Chem 263: 7472-7477.
Ruissen, A.L.A. et. al (2001) Biochem. J 356: 361-368.
Gusman, M. et al. (2001) Biochim. Biophys Acta 1545: 86-95.
Brewer et.al. (1998) Biochem. Cell Biol. 76, 247-256.
Merrifield (1963) J. Am. Chem. Soc. 85, 2149-2154.

________________________________________________________________
Palavras-chave: Histatina-5, peptídeos antimicrobianos, TOAC, técnicas
espectroscópicas, íons metálicos, membranas modelo.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

233
UNISA - Universidade de Santo Amaro

Estudos Estruturais e Conformacionais da Histatina-5 e seu


Análogo, TOACº-Histatina-5: Interação com Metais e Sistemas
Biomiméticos
EDIVANIA PAIVA BASTOS(1)

SHIRLEY SCHREIER(2)(Orientadores)
Ciências Biológicas
INTRODUÇÃO:
As histatinas pertencem a uma família de peptídeos catiônicos ricos em
resíduos de Histidina, secretados pelas glândulas salivares de humanos e
primatas superiores. Histatina-5 (Hst-5) possui alta atividade antifúngica. Hst-5
tem a capacidade de se ligar a íons zinco (Zn2+) e cobre (Cu2+) presentes na
saliva e, no solvente menos polar, trifluoroetanol (TFE), adota conformação alfa-
helicoidal.

OBJETIVO:
Este trabalho tem o objetivo de contribuir para a compreensão do mecanismo
de ação da Hst-5, foi estudado o efeito do pH, de TFE e da interação com íons
metálicos sobre as propriedades conformacionais do peptídeo.

METODOLOGIA:
Materiais: Hst-5 foi obtida pelo método de síntese em fase sólida. Cloretos de
Mn2+, Cu2+ e Zn2+ foram obtidos da Labsynth.
Métodos: Espectros de fluorescência foram obtidos no espectrofluorímetro
Hitachi F-4500; para monitorar a fluorescência da tirosina, o comprimento de
onda foi 275 nm, e o espectro de emissão obtido foi entre 285 e 400 nm. Para
monitorar a fluorescência do tirosinato, o comprimento de onda de excitação foi
292 nm, e o espectro de emissão obtido ficou entre 305 e 400 nm. Espectros de
CD foram obtidos no espectropolarímetro Jobin Yvon CD6 entre 190 e 260 nm,

RESUMO:
Efeito do pH: O espectro de fluorescência da Hst-5 foi sensível à variação de
pH, refletindo de forma mais intensa o processo de ionização das tirosinas. A
presença de vários resíduos carregados levou a uma diminuição do pK do
grupamento fenólico. Espectros de CD mostraram que o peptídeo em solução
aquosa possui uma conformação flexível. Mesmo sem levar à aquisição de
estrutura, os espectros mostram que a variação de pH promove flutuações

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

234
UNISA - Universidade de Santo Amaro

conformacionais relacionadas à variação de carga do peptídeo.


Efeito do TFE: Espectros de CD indicam a aquisição de estrutura alfa-helicoidal
em presença de TFE.
Efeito da interação com os íons Cu2+, Zn2+ e Mn2+: A adição de íons
metálicos levou à diminuição da fluorescência da Hst-5. O efeito foi mais
pronunciado para o Cu2+ .O estudo do efeito do pH na interação Cu2+-Hst-5
mostrou que o íon promove a ionização da(s) tirosina(s) já a pH 7,6 .
Espectros de CD não revelaram alterações conformacionais significativas
devidas à interação com os íons; porém, a complexação em 70% de TFE levou
à perda da estrutura alfa-helicoidal .

CONCLUSÃO:
Os resultados mostram que a conformação da Hst-5 pode ser modulada pelo
pH, pela polaridade do ambiente e pela interação com íons metálicos. Esses
resultados indicam que interações eletrostáticas são as principais responsáveis
pela ligação dos peptídeos às micelas, devido à sua carga superficial. Essas
propriedades poderiam estar envolvidas no mecanismo de ação do peptídeo, e
este pode futuramente servir como modelo para o desenvolvimento de novas
drogas antimicrobianas.

REFERÊNCIA BIBLIOGRÁFICA:
Oppenheim, F. G. et al. (1988) J. Biol. Chem 263: 7472-7477.
Ruissen, A.L.A. et. al (2001) Biochem. J 356: 361-368.
Gusman, M. et al. (2001) Biochim. Biophys Acta 1545: 86-95.
Brewer et.al. (1998) Biochem. Cell Biol. 76, 247-256.
Merrifield (1963) J. Am. Chem. Soc. 85, 2149-2154.

________________________________________________________________
Palavras-chave: Histatina-5, peptídeos antimicrobianos, TOAC, técnicas
espectroscópicas, íons metálicos, membranas modelo.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

235
UNISA - Universidade de Santo Amaro

Expressão do RNAm para iNOS e arginase em macrófagos


murinos estimulados in vitro com Bordetella pertussis
PRISCILA IAMASHITA(1)

MONAMARIS MARQUES BORGES(2)(Orientadores)


Ciências Biológicas
INTRODUÇÃO:
A Coqueluche é uma doença altamente contagiosa do trato respiratório
humano, sendo uma das principais causas de mortalidade infantil em alguns
países em desenvolvimento. A doença prevalece onde a assistência médica é
inadequada sendo que sua progressão se dá devido à falta de oferta de
antimicrobianos. Apesar da ampla cobertura vacinal, essa bactéria continua
sendo um grave risco para a saúde humana, pois sua incidência vem
aumentando mesmo em populações vacinadas. Esse fenômeno pode ter
ocorrido devido a uma diminuição na cobertura vacinal, alterações na qualidade
da vacina e até adaptação envolvendo estruturas de fatores de virulência do
agente causador. Segundo a Organização Mundial da Saúde (2003), estima-se
que 50 milhões de casos e 300.000 mortes ocorrem todos os anos.
Embora seja considerada doença típica de recém nascidos, vários trabalhos
demonstraram que crianças maiores, adultos e adolescentes podem se infectar
passando como portadores assintomáticos, o que agrava ainda mais a
transmissão da doença causando sérios riscos de saúde pública.
A patogênese desta infecção respiratória é pouco conhecida, sendo
caracterizada pela produção excessiva de muco podendo ocorrer morte celular,
broncopneumonia, edema pulmonar e hemorragia focal. Desconhece-se, por
exemplo, o que ocorre no ambiente intracelular dos fagócitos e quais
mecanismos antimicrobianos são desencadeados inviabilizando o crescimento
de B. pertussis no ambiente intracelular.
O agente causador da coqueluche é um cocobacilo Gram-negativo denominado
Bordetella pertussis, isolado em 1906 por Bordet e Gengou. Essa bactéria
infecta o trato respiratório humano, possui uma série de fatores de virulência
classificados em adesinas e toxinas. A hemaglutinina filamentosa (Fha) é a
adesina mais importante devido possibilitar a adesão da bactéria tanto em
células do epitélio respiratório como aos macrófagos. Esta bactéria além de
possuir especificidade por células ciliadas do epitélio respiratório pode também
invadir diversos tipos celulares, incluindo células fagocíticas, quando então
passa por uma fase intracelular sendo capaz de modular a resposta inflamatória
do hospedeiro.
Entre as toxinas, três são as mais importantes: toxina pertussis (PT), toxina
adenilato ciclase (ACT) e toxina traqueal. Outras toxinas são freqüentemente
mencionadas como a toxina dermonecrótica e lipopolissacarídeos (LPS), sem

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

236
UNISA - Universidade de Santo Amaro

que haja evidência direta de sua participação na patogênese da coqueluche.


Esses fatores de virulência certamente estão envolvidos no controle de
atividade imune das células fagocíticas tendo reflexo na sobrevida do
microrganismo e na resposta imune desenvolvida durante a infecção.
O curso normal da infecção inicia-se com a entrada das bactérias pelas vias
aéreas, através de gotículas derivadas da tosse de uma pessoa infectada. O
patógeno adere às células epiteliais ciliadas da traquéia e nasofaringe, depois
se replica e coloniza áreas adjacentes. Toxinas secretadas pelo microrganismo
danificam o revestimento epitelial, resultando na perda de células ciliadas, o
que induz a tosse característica.
Os macrófagos possuem papel importante na regulação do sistema imune
devido a sua dupla função de defesa. Uma delas é na resposta imune inata
onde diversos receptores são utilizados para reconhecer e promover o processo
de fagocitose e posteriormente na fase adaptativa, atuando como células
acessórias. Após fagocitose estas células liberam mediadores pró-inflamatórios
dentre eles reativos intermediários do oxigênio e nitrogênio além de TNF-a que
contribuem para a morte do microrganismo fagocitado, além de colaborar com o
desenvolvimento do processo inflamatório e reparação tecidual.
Macrófagos e outros tipos de células são capazes de sintetizar óxido nítrico
(NO) através da ativação da óxido nítrico sintase (NOS). NO é gerado pela
conversão da L-arginina em L-citrulina pela NOS, que existe em três isoformas.
Sendo duas constitutivas denominadas cNOS: NOS neuronal (NOS I) e NOS
endotelial (NOS III) e uma induzível chamada iNOS (NOS II). A iNOS tem um
papel importante como mediador microbicida, tumoricida, além de outros
processos fisiopatológicos. Uma vez induzida é capaz de produzir NO por longo
tempo podendo também lesar células vizinhas saudáveis. Este mecanismo é
responsável pela maioria dos processos inflamatórios e autoimunes.
O aumento da expressão de iNOS nas células se dá em resposta a vários
estímulos pró-inflamatórios dentre eles citocinas e produtos microbianos como
LPS enquanto sua inibição ocorre na presença de citocinas anti-inflamatórias. A
regulação de iNOS pode ocorrer em vários níveis: transcrição do gene, pós-
transcrição envolvendo a translocação do RNAm, devido a estabilidade do
RNAm, depende também da disponibilidade de substrato, além da presença de
vários cofatores que atuam inibindo iNOS o que envolve vários sinais de
transdução. Nos macrófagos a expressão do gene iNOS é regulada
principalmente a nível de transcrição. Uma das respostas características de
iNOS ocorre durante a ativação de macrófagos murinos por interferon-g (IFN-g)
ou LPS em que as células se expõem para o indutor seguido pela ativação da
transcrição desse gene, com conseqüente acúmulo do seu RNAm
correspondente.
Um dos fatores que controlam negativamente a síntese de iNOS em
macrófagos é o aumento da atividade de arginase, uma vez que estas duas

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

237
UNISA - Universidade de Santo Amaro

enzimas competem pelo mesmo substrato L-arginina para a produção de NO e


uréia, respectivamente.
Arginase existe em duas formas, a citosólica (AI) altamente expressa no fígado
envolvida com a síntese de uréia e arginase mitocondrial (AII) envolvida na
biossíntese de poliaminas, nos aminoácidos ornitina, prolina e glutamato, no
processo inflamatório, entre outros.
Estudos in vitro têm mostrado que citocinas do tipo Th2 e Th3 podem induzir a
expressão de arginase I (AI) em macrófagos. Arginase I também pode ser
induzida em macrófagos expostos a LPS e análogos de cAMP.
Sabe-se que alguns microrganismos como Helicobacter pillori e Leishmania
induzem a presença de arginase I inibindo a expressão de iNOS para garantir
sua sobrevivência na célula hospedeira.

OBJETIVO:
Analisar a expressão de iNOS e arginase I em macrófagos ativados in vitro por
B. pertussis, afim de compreendermos as estratégias utilizadas pela bactéria no
início da invasão celular e regulação da resposta imune.

METODOLOGIA:
BACTÉRIAS: Bordetella pertussis cepa 18323 foi cultivada a 35°C em meio
sólido Bordet-Gengou (BG) suplementado com 25% de sangue de carneiro e
cefalexina (20 µg/ml), utilizada na fase exponencial de crescimento, período que
corresponde a 48-72 horas de cultivo. Após este período, as colônias de
bactérias foram obtidas por lavagem da camada de ágar com solução salina
tamponada com fosfato (PBS), transferidas para um tubo de centrífuga e
lavadas com meio de cultura apropriado. Controles para excluir a presença de
outras bactérias foram realizados utilizando-se a Coloração de Gram.
OBTENÇÃO DE ANTÍGENO SOLÚVEL DE B. Pertussis: Após o cultivo em meio
BG, as bactérias foram expandidas em meio líquido Stainer & Scholte (SS) a
35,5°C sob agitação por 24 h. As bactérias foram centrifugadas a 8000 rpm, 10
min, 4°C sendo o sobrenadante e o sedimento separados. O sedimento
contendo as bactérias foi inativado por 60 min a 56°C e após duas lavagens
com PBS pH 7,2 as bactérias foram ressuspensas em tampão de sonicação,
composto por fosfato de sódio (50 mM) e cloreto de sódio (0,3 M) pH 8,0 na
presença de inibidor de protease PMSF (1 mM). Posteriormente foram rompidas
no sonicador Sonic Desmembrator 550 (Fisher Scientific) a 4°C por cinco ciclos
de 1 min com 30 s de intervalo, repetido sete vezes. Este material obtido foi
centrifugado a 15.000 rpm, 4°C para separação da fração solúvel dos restos
celulares. A parte solúvel obtida foi filtrada em membrana de 0,22 mm,
alíquotada e estocada a -70°C até o momento de uso. Este material foi

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

238
UNISA - Universidade de Santo Amaro

posteriormente utilizado nos ensaios para ativação dos macrófagos.


ANIMAIS: Por ensaio, foram utilizados 4 camundongos C57BL/6 com 6 a 8
semanas de idade, peso 22 a 28 g provenientes do Biotério da Faculdade de
Medicina ou Medicina Veterinária da USP. Estes animais foram mantidos em
biotério convencional por curto período de tempo. Os camundongos foram
sacrificados através da exposição ao CO2. A seguir, foram extraídos o fêmur e
a tíbia para a obtenção das células medulares que será a origem de
macrófagos a serem utilizados.
CULTIVO DE CÉLULAS L929: Células L929 foram cultivadas em meio RPMI
contendo 10% de soro fetal bovino, penicilina (50 U/ml) e estreptomicina (50
mg/ml), sendo mantidas por sete dias a 37°C, 5% de CO2. Após este período o
sobrenadante foi utilizado para cultivo e diferenciação das células obtidas de
medula óssea. O sobrenadante de células L929 contém o fator estimulador de
colônias de macrófagos M-CSF, fornecendo uma alternativa para a
diferenciação e proliferação de células progenitoras da medula óssea em
macrófagos maduros in vitro.
ISOLAMENTO E DIFERENCIAÇÃO DE MACRÓFAGOS DERIVADOS DE
MEDULA ÓSSEA MURINA (MfDM): Os macrófagos derivados de medula óssea
foram obtidos a partir do fêmur e da tíbia de camundongos C57BL/6, em
seguida foram removidas as hemácias através de lise com o tampão (ACK).
Posteriormente as células foram lavadas por centrifugação em PBS e
finalmente diluídas na concentração adequada em RPMI completo
suplementado com 10 % de soro fetal bovino inativado (SFB), sobrenadante de
célula L929, penicilina e estreptomicina (50 U/ml e 50 mg/ml, respectivamente).
No sétimo dia as células já diferenciadas foram lavadas com PBS pH 7.2, para
a remoção das células não aderentes, e cultivadas em meio RPMI completo na
ausência de L929 para o início do experimento.
ATIVAÇÃO DOS MACRÓFAGOS:As células foram ativadas por 6 e 24 horas
com 30 mg/ml de antígeno (Ag) obtido do lisado bacteriano na presença ou não
de IFN-g &#61480;(1000 pg/ml) e na presença ou não de L-NOHA (1 mM).
Grupos controle usando macrófagos não ativados foram incluídos. O
sobrenadante foi colhido para dosar NO e as células aderentes utilizadas para
extração de RNA a ser utilizado nas reações de RT-PCR. Grupos paralelos
foram realizados para ensaio de viabilidade celular.
DOSAGEM DE ÓXIDO NÍTRICO (NO): Os sobrenadantes das culturas foram
utilizados para análise da produção de nitrito (NO2-) pelos macrófagos murinos,
utilizando o método de Griess. Uma quantidade de 50 µl de cada grupo foi
transferida para uma placa de 96 poços. Foi acrescentado a tais
sobrenadantes, a mesma quantidade de Sulfanilamida a 1% e de NED (a-
naftiletilenodiamina) a 0,1%, incubados por 10 min a temperatura ambiente. A
absorbância foi lida a 550 nm em leitor de microplacas Multiskan EX
(Labsystems). A concentração de NO2- foi avaliada por meio de uma curva de

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

239
UNISA - Universidade de Santo Amaro

calibração (100 a 1,5 mM), usando nitrito de sódio (NaNO2) como padrão. A
produção de nitrito (NO2-) na cultura celular reflete o nível de óxido nítrico (NO)
uma vez que o nitrito é produto intermediário da reação.
ENSAIO DE VIABILIDADE CELULAR: Foi utlizada a coloração com MTT para
avaliar a sobrevivência e a proliferação celular. As células (3 x 105
células/poço) foram incubadas por 24 horas em placa de 48 poços e meio de
cultura RPMI suplementado com 10% de SFB, penicilina (50 U/ml) e
estreptomicina (50 µg/ml) à temperatura de 37ºC em estufa de CO2. Os
macrófagos foram cultivados na ausência ou presença de Ag (30 mg/ml) e de
IFN-ý (1000 pg/ml). Para controles de morte celular foi utilizado 0,1% Triton X-
100. Ao final do período de incubação foi adicionado MTT (5 mg/ml)
correspondendo a 10% do volume total do sobrenadante, de acordo com o
protocolo modificado de Vitral et al.. As culturas foram incubadas por 4 horas a
37°C e posteriormente os cristais formados na reação foram solubilizados com
HCl 0,1 N em isopropanol e a reação incubada por 15 min à temperatura
ambiente. A densidade óptica foi realizada 550 nm em leitor de microplacas
Multiskan EX (Labsystems). O MTT (3-(4,5-dimetiltiazol-2yl)-2,5-difenil brometo
de tetrazolina) é um sal de tetrazolium solúvel em água. Ao ser clivado pela
enzima mitocondrial, desidrogenase succínica, origina cristais de formazan de
coloração violeta solúveis apenas em solvente específico.
EXTRAÇÃO DE RNA E RT-PCR: As células aderentes foram lavadas com PBS
e posteriormente lisadas com 1 ml de reagente Trizol (Invitrogen) de acordo
com as instruções do fabricante. O material foi transferido para microtubo e
posteriormente o RNA total foi precipitado com isopropanol em seguida lavado
com etanol a 75% e ressuspenso em H20 RNase free. A qualidade do RNA
obtido foi avaliada através de eletroforese em gel de agarose 1% em TBE 1x e
corado com brometo de etídeo. A quantificação e a pureza foram determinadas
através da espectrofotometria. O RNA foi tratado com DNase I (Invitrogen)
visando eliminar possíveis contaminações de DNA genômico. 2 mg de RNA de
cada amostra foram tratados com 2U de DNAse I por 15 min a temperatura
ambiente. A enzima foi inativada pela adição de 2 ml de uma solução de EDTA
25 mM seguida de uma incubação a 65ºC por 10 min. Os RNAs tratados com
DNase I foram submetidos à transcrição reversa utilizando a enzima
SuperScriptä III (First-Strand Synthesis System for RT-PCR, Invitrogen). Assim
foi obtido o DNA complementar (cDNA) que serviria posteriormente como molde
para amplificação pela reação em cadeia pela polimerase (PCR). Para todas as
amostras foram realizadas reações sem transcriptase reversa, a fim de se
excluir a eventual contaminação por DNA genômico. As reações de PCR semi-
quantitativo foram realizadas em um volume final de 20 ml contendo 1/10 dos
produtos de RT, 0,4 mM de cada primer, 200 mM de desoxinucleotídeos
trifosfatados (dNTP), 1,5 U de Taq polimerase (Invitrogen), 1,0 mM de MgCl2
para iNOS e 1,5 mM para b-actina e arginase. Para a amplificação foi utilizado o

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

240
UNISA - Universidade de Santo Amaro

termociclador Gene Amp PCR System 9700 (Aplied Bio Systems) e as


seguintes condições foram adotadas: desnaturação inicial de 5 min a 94°C,
seguida de 30 ou 28 ciclos que incluem a seguinte seqüência: 94oC por 45 s
(desnaturação), 58°C por 45 s (anelamento), 72°C por 1 min (extensão), e um
ciclo final de extensão a 72°C por 5 min. Os produtos de amplificação foram
analisados por eletroforese horizontal em gel de agarose 2% em TAE 1x,
corado com brometo de etídio e visualizados através de luz UV. Foram
utilizados os seguintes primers forward e reverse, respectivamente, para iNOS:
5’-AGGAAGAAATGCAGGAGATG-3’ e 5’- CACCTGCTCCTGGCTCAAG-3’
(253-bp); arginase: 5’- TTCTGGGAGGCCTATCTTAC -3’ e 5’-
CCAAGGTTAAAGCCACTGCC-3’ (162-bp); e b-actina: 5’-
ACTACATTCAATTCCATCAT-3’ e 5’-CGATCCACACACAGTACTTG-3’ e 5’-
CGATCCACACAGAGTACTTG-3’ (196-bp). ENSAIO DE DENSITOMETRIA:
Após a visualização em UV, os géis foram fotografados e as imagens
armazenadas em formatos digitalizados utilizando o sistema de captura de
imagem AlphaEaseFC (Alpha Imager 2200). As imagens foram impressas
tornando-se disponível para análise em GS-800 Calibrated Densitometer (Bio-
Rad), sendo a intensidade das bandas quantificadas e normalizadas através do
método de densitometria, utilizando o programa Quantity One (Bio-Rad).

RESUMO:
PRODUÇÃO DE NO POR MACRÓFAGOS: Foram feitas as médias de 2
experimentos independentes, após 6 ou 24 h de incubação. A adição de Ag não
favoreceu significativamente o aumento de nitrito apesar da complexidade deste
antígeno bacteriano. O grupo estimulado com Ag associado ao tratamento com
a citocina IFN-g teve a máxima produção de nitrito. Este grupo foi utilizado
como controle positivo de expressão de iNOS nos ensaios de RT-PCR. A
adição do inibidor de arginase (L-NOHA) na presença do Ag aumentou a
produção de nitrito sugerindo contribuição desta enzima no controle da
produção de NO2- . A produção de nitrito ocorre quando há ativação e
expressão da enzima iNOS, cujo produto final é medido pela presença de nitrito.
VIABILIDADE CELULAR: Para confirmar a viabilidade das células e excluir
problemas que pudessem ocorrer no cultivo celular durante a realização dos
experimentos, foi feito um controle de viabilidade das diversas amostras a
serem utilizadas na reação de RT-PCR utilizando a coloração das células pelo
método do MTT. Há formação de precipitados de formazan devido a presença
da enzima succinato desidrogenase, esta ocorre apenas em células viáveis.
Como controle de morte celular usamos 0,1% de Triton X-100. A adição do
antígeno bacteriano não alterou significativamente a viabilidade das células a
serem utilizadas na reação de RT-PCR.
ANÁLISE DA EXPRESSÃO DE INOS E ARGINASE: Foram feitos ensaios
utilizando 28 para iNOS e 30 ciclos de amplificação para arginase e &#946;-

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

241
UNISA - Universidade de Santo Amaro

actina. Após 6 horas de estímulo com Ag de Bordetella pertussis, houve pouco


aumento da expressão do RNAm para iNOS. Enquanto com 24 horas não
houve aumento significativo. Para arginase I, o grupo ativado com Ag após 6
horas houve redução na expressão do RNAm. Em 24 h de ativação, o RNAm
para arginase teve um aumento expressivo. Foram apresentados os resultados
através de produtos de RT-PCR. O grupo adicional controle usando macrófagos
estimulados com antígeno na presença de IFN-g expressou as duas enzimas.
QUANTIFICAÇÃO POR DENSITOMETRIA: Os produtos de RT-PCR foram
quantificados por densitometria através do cálculo de expressão relativa das
amostras. O valor da densidade óptica de cada amostra foi dividida pelo valor
do gene endógeno, &#946;-actina. Para o cálculo da proporção entre as
amostras dos grupos tratados com Ag de B. pertussis com os grupos controle,
foi dividido o valor de densidade óptica do primeiro pelo segundo. Os dados
mostraram que tanto com 6 quanto 24 h, arginase se expressou mais do que
iNOS. Porém, a adição de Ag de B. pertussis após 6 horas, foi capaz de
aumentar o dobro da expressão de iNOS, enquanto para arginase a expressão
diminuiu. Já com 24 h, iNOS não teve aumento significativo após ativação,
enquanto arginase aumentou. Esses resultados sugerem que houve controle de
expressão de uma enzima sobre a outra pelo fato dessas enzimas competirem
pelo mesmo substrato L-arginina.

CONCLUSÃO:
Estes dados sugerem que a arginase I pode controlar a expressão de iNOS
neste modelo.

REFERÊNCIA BIBLIOGRÁFICA:
CARBONETTI, N.H.. 2007. Immunomodulation in the pathogenesis of Bordetella
pertussis infection and disease. Curr Opin Pharmacol. 7: 272-8.
CHAKRAVORTTY, D. & HENSEL, M.. 2003. Inducible nitric oxide synthase and
control of intracellular bacterial pathogens. Microbes Infect. 5: 621-7.
DURANTE, W.; JOHNSON, F.K. & JOHNSON, R.A.. 2007. Arginase: a critical
regulator of nitric oxide synthesis and vascular function. Clin Exp Pharmacol
Physiol. 34: 906-11.

________________________________________________________________
Financiamento: UNISA, Fapesp, Cnpq (Bolsa Pibic) e Instituto Butantan.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

242
UNISA - Universidade de Santo Amaro

Geração de linhagens sensoras de morte celular via ativação de


caspase 3 - Apoptose
FERNANDA DE OLIVEIRA ARAÚJO GIANNACCARI(1)

EUGENIA COSTANZI(2)(Orientadores)
Ciências Biológicas
INTRODUÇÃO:
TERAPIA GÊNICA
A terapia gênica baseia-se na transferência de genes terapêuticos para as
células do paciente. Essa transferência gênica pode ser feita por meio de
diversos veículos ou vetores. A adequação dos vetores é de fundamental
importância para o sucesso da terapia gênica.
A terapia gênica hoje possui grande foco no tratamento de câncer e tem sido
considerada uma das mais promissoras estratégias no combate de tecidos
tumorais. Independentemente do tipo histológico, todos os tumores tem em
comum a perda do controle da proliferação celular. Entre as mais promissoras
estratégias de terapia gênica do câncer está a introdução de genes que
promovem a morte celular, diretamente nas células tumorais, incluindo aqui os
genes supressores de tumor (como p53) e genes com efeito tóxico ou suicidas
(como tk).

MORTE CELULAR - APOPTOSE


A morte celular é um aspecto importante para diversos processos fisiológicos,
portanto o desequilíbrio de suas funções pode ser um fator que caracteriza
inúmeras doenças humanas. Em muitos casos, o desenvolvimento e a
manutenção dos organismos estão diretamente envolvidos com os processos
de morte celular, que no passado eram conhecidos como processos de caráter
exclusivamente degenerativo que ocorriam em situações de lesão ou estresse
celular.
A apoptose é um processo caracterizado pela compactação da célula inteira,
incluindo o núcleo. Durante o processo as células emitem brotamentos
citoplasmáticos chamados de corpos apoptóticos, estes são rapidamente
fagocitados por macrófagos teciduais sem gerar qualquer reação inflamatória.
Os principais mediadores da morte celular por apoptose são as caspases.
As caspases são cisteíno-proteases capazes de clivar substratos que possuam
resíduos de ácido aspártico. Essas enzimas são ativadas nas células
sinalizadas para morrerem por apoptose. Até hoje são conhecidas 14 caspases
humanas, sendo que 6 participam do processo de apoptose e são divididas em
dois grupos: as indutoras (caspases 8 e 9), que dão início à cascata proteolítica
e as efetoras (caspases 3, 6 e 7), que clivam substratos específicos. Existem
duas vias de ativação da apoptose: a via extrínseca ou via dos receptores de

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

243
UNISA - Universidade de Santo Amaro

morte celular e a via intrínseca ou via mitocondrial.


Apesar da diversidade de características presentes nos tecidos tumorais, todos
os cânceres apresentam uma enorme capacidade de proliferação e resistência
a apoptose. Muitas vezes essa resistência a morte celular ocorre devido à perda
de função da proteína supressora de tumor p53. Quando os tumores p53
negativos foram examinados em relação à morte celular, ficou claro que o
número de células que entram em apoptose é muito baixo em relação aos
tecidos normais, o que contribui para o agressivo crescimento tumoral. Em uma
situação de estresse celular, onde há lesão do DNA, a molécula p53 é
fosforilada tornando-se mais estável. Então p53 passa a atuar como um fator de
transcrição induzindo a síntese de p21. Esta, por sua vez, inibe a atividade de
quinases dependentes de ciclina e consequentemente a fosforilação de pRb e a
liberação dos fatores E2Fs (responsáveis pela síntese de DNA), impedindo a
continuidade do ciclo normal da célula. Além disso, há indícios de que a
proteína p53 é capaz de induzir proteínas pró-apoptóticas como BAX, CD95
entre outras. Muitas drogas anticâncer possuem melhor desempenho em
células que expressam p53 selvagem. Esses fatores apontam para p53 como
um forte candidato a gene terapêutico.

PROTEÍNAS BIOFLUORESCENTES
A descoberta das proteínas fluorescentes (PFs) tem revolucionado os estudos
dentro da biologia celular, tornando possível o estudo in vitro e in vivo de
eventos biológicos em células e tecidos vivos em tempo real e de forma não
invasiva. A aplicação das PFs se estende a diversas áreas da pesquisa como
câncer, biologia do desenvolvimento, expressão gênica, angiogênese e
imunologia, entre outros, porém não há um campo que não foi tocado e
transformado pela possibilidade de acompanhar processos biológicos em tempo
real. Estas pesquisas podem se beneficiar da eficiência da marcação
fluorescente de células únicas, tecidos e animais inteiros.
A green fluorescent protein (GFP) foi a primeira PF geneticamente codificada,
foi isolada da água-viva Aequorea Victoria e exibe auto-fluorescência verde
após excitação com luz azul. A GFP serviu de protótipo para o desenvolvimento
de novas categorias de sensores biológicos. Hoje há um amplo espectro de
mutantes e variantes filogenéticas de GFP que dão um resultado multicolorido
aos experimentos com células vivas. As PFs na faixa do infravermelho são
tecnologicamente mais adequadas para detecção profunda de imagens in vivo.
Na faixa do infravermelho, a PF dsRed, derivada do coral Discosoma sp, possui
excitação e emissão nos comprimentos de 558nm e 583nm, respectivamente e
vem servindo como modelo para a construção de outras variações de PFs.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

244
UNISA - Universidade de Santo Amaro

PROTEÍNA MTF: SENSOR DE APOPTOSE


A proteína de fusão MTF é formada por três proteínas repórteres diferentes: a
proteína fluorescente vermelha (mRFP1), a HSV 1-sr39 truncado
timidina quinase (TK) e a Firefly luciferase (FL). Estas proteínas encontram-se
ligadas por um polipeptídio reconhecido como substrato específico para
caspase- 3, chamado DEVD (Ac-Asp-Glu-Val-Asp). Após a clivagem do motivo
DEVD por caspase-3 as três proteínas marcadoras são ativadas. A fusão MTF
pode ser usada na visualização de apoptose (em resposta a ação de caspase
3) através de três diferentes sistemas de imagem: biofluorescência (mRFP1),
bioluminescência (FL) e tomografia por emissão de positrões, PET (TK) (Ray et
al, 2008).
A mRFP1 (monomeric red fluorescent protein), é uma nova versão de PF
derivada da dsRED, além de ser monomérica, possui uma maturação rápida e
uma mínima interferência com o marcador GFP e seus derivados.
Luciferase é uma enzima catalisadora da luciferina. O gene Firefly luciferase
(FL), usado na construção da fusão MTF, foi isolado do lampirídeo norte-
americano Photinus pyralis. Esta enzima, quando no processo de oxidação de
seu substrato (luciferina-D) emite energia na forma de luz.
A HSV 1-sr39 (Tk) é a versão mutante truncada do vírus herpes simplex 1 (HSV
1) com o gene da timidina kinase. Este funciona como um gene marcador da
localização da expressão da timidina quinase (TK) de modo direto, não invasivo
e in vivo por tomografia de emissão de positrões (PET). PET baseia-se numa
recente tecnologia da medicina nuclear, onde se utiliza radionuclídeos
biológicos para detectar locais onde o metabolismo está aumentado, como no
caso de tumores.
Linhagens celulares expressando a fusão MTF são linhagens sensoras da
ativação da caspase-3. Estas células individualmente ou nos tumores de
animais podem ser utilizadas como um versátil instrumento para mostrar de
forma eficiente e não invasiva, a eficácia de medicamentos e também servir de
ferramenta para o teste de novas terapias.

OBJETIVO:
Neste estudo, foi proposta a criação de linhagens sensoras de apoptose
mediada pela ativação de caspase 3, usando como marcador a expressão da
proteína fluorescente na faixa do infravermelho mRFP1 mediada pelo vetor
MTF. As funcionalidades das linhagens sensoras criadas puderam ser
analisadas através da observação dos efeitos de diversos tratamentos indutores
de morte celular, incluindo tratamentos virais e tratamentos quimioterápicos

METODOLOGIA:

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

245
UNISA - Universidade de Santo Amaro

Linhagens celulares: Todas foram mantidas em meio DMEM, Dulbecco’s


Modified Eagle Medium, (Invitrogen) suplementado com 10% de soro bovino
fetal (Hyclone), em atmosfera úmida com 5% de CO2 sob temperatura de 370C.
Ambas as linhagens U87 e U251 foram estabelecidas a partir de amostras de
glioblastoma humano e são portadoras dos fenótipos Rb+/p53sel/p16- e
Rb+/p53mut/p16-, respectivamente.
Preparação dos plasmídeos: O vetor pcDNA 3.1 – MTF (gentilmente cedido
pelo Dr. Gambhir, Stanford University) foi preparado seguindo protocolo clássico
de transformação de bactérias DH5 alfa (Sambrook et al, 1989). As preparações
de plasmídeos puros foram realizadas utilizando o Kit Plasmid Mid QIAGEN®
seguindo instruções do fabricante. Determinação da absorbância a 260nm foi
aplicada para quantificação (µg/µl) das preparações. Relação entre as leituras
de absorbância 260nm/280nm serviu para determinar o grau de pureza das
produções (valores entre 1,7-2,0). A identidade de restrição dos plasmídeos foi
confirmada através de fracionamento em gel eletroforese (agarose 0,8% em
tampão TAE), após digestão com as enzimas de restrição Hind III, Xho I e Hind
III + Xba I por 2 horas a 37º C.

Transfecção e Seleção: O método de trasfecção foi lipofecção (transfecção por


lipossomos), utilizando o reagente Lipofectamina 2000 (Invitrogen®), de acordo
com o protocolo do fabricante. Brevemente, ao redor de 1x105células/poço
foram plaqueadas em bandeja de 24 poços. Após 24 horas o meio de cultura
original de plaqueamento (DMEM com 10% de soro bovino fetal) foi trocado
pelo meio Opti-MEM® (Invitrogen®) livre de soro e antibióticos. Utilizamos 0,8µg
do vetor pMTF/poço e 2µl de Lipofectamina 2000. 24 horas após a lipofecção,
foram adicionados as culturas 600µg/ml do antibiótico G418 (Invitrogen®), um
derivado da geneticina. Entre 7-10 dias todas as células da placa controle (não
lipofectada) morreram, indicando o término da seleção. O vetor MTF carrega o
gene Neo, que confere resistência ao antibiótico G418, assim apenas as células
transfectadas com o vetor MTF sobreviveram a seleção. As culturas foram
mantidas sob seleção por mais 7-10 dias e expandidas. Amostras das novas
linhagens U87MTF e U251MTF foram congeladas e armazenadas a -80oC.

Ensaio da análise funcional do vetor MTF na linhagem U87MTF tratada com


estaurosporina: Células U87MTF foram plaqueadas e tratadas com 100nM/ml
de estaurosporina por 96 horas. Células com fluorescência vermelha, resultado
da expressão da proteína biofluorescente mRFP1, ativada após clivagem do
sítio DEVD por caspase 3, foram observadas quantitativamente e
qualitativamente, respectivamente utilizando FACS (Fluorescent activated cell
sorting) e microscopia confocal. Para as análises de FACS as células foram
removidas das placas com tripsina, centrifugadas e lavadas em PBS. O pellet
de células foi ressuspenso em 500µl de paraformaldeído 1% em PBS e

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

246
UNISA - Universidade de Santo Amaro

mantidas a 4oC até o momento da análise. A fluorescência foi detectada na


faixa de 559-700nm, utilizando filtro de excitação entre 503-550nm e emissão
600-700nm. Imagens de células em apoptose foram capturadas sob
microscopia confocal realizada diretamente nas placas de cultura com as
células vivas.

Aplicação das linhagens sensoras U87MTF e U251MTF no monitoramento de


morte celular induzida pelo tratamento com os adenovírus Adp53: Células das
linhagens U87MTF e U251MTF foram plaqueadas, por volta de 1 X104
células/poço em bandejas de 12 poços. Em determinados poços as células
foram transduzidas com os adenovírus portadores do gene supressor de tumor
p53, Adp53 (MOI 100) e em outros poços as células foram transduzidas com os
adenovírus controle AdLacZ (MOI 100). 24 horas após a transdução o meio de
cultura contendo os vírus foi trocado por meio fresco. As amostras foram
analisadas por meio de microscopia confocal e FACS.

Ensaio de análise de morte celular induzida pelos adenovírus Adp53 combinado


com o tratamento de cisplatina: As mesmas linhagens celulares foram
plaqueadas, aproximadamente 1 x104 células/poço em uma bandeja de 12
poços. As células foram transduzidas com Adp53 (MOI 100) ou com o controle
AdLac-Z (MOI 100). 24 horas depois o meio de cultura contendo os vírus foi
trocado por meio fresco. 48 horas depois da transdução foi administrada uma
dose de 30µM de cisplatina em cada poço. As células foram analisadas por
microscopia confocal ensaio quantitativo foi realizado via FACS As amostras
foram coletadas e analisadas 48 horas após a adição de cisplatina.

RESUMO:
Análise funcional do vetor MTF a partir do tratamento com estaurosporina:
Os resultados obtidos através de citometria de fluxo e microscopia confocal a
laser a partir do ensaio da análise funcional do vetor MTF nas linhagens
U87MTF e U251MTF tratadas com estaurosporina sob concentração de 100nM,
mostram que houve a emissão de fluorescência vermelha, resultado da
atividade da proteína mRFP1 após a clivagem do peptídio DEVD, substrato da
caspase 3, o que indica que a estaurosporina possui um efeito indutor de
apoptose via caspase 3 e este efeito pode ser detectado em células humanas
de glioma através do sensor MTF. Em ambas as linhagens, observa-se o
aumento da intensidade da fluorescência vermelha, 47,4% e 26,2%
respectivamente na U87MTF e U251MTF, após tratamento com o agente
químico.
Também foi possível observar nas imagens obtidas das culturas tratadas com
estaurosporina, intensa mudança na morfologia celular. Após passarem por

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

247
UNISA - Universidade de Santo Amaro

tratamento com estaurosporina, as células apresentam diminuição no volume e


alta condensação da matriz citoplasmática e da cromatina. Já foi observado que
a inibição da proteína quinase C é um dos principais fatores que contribui para
a alteração na morfologia de células tratadas com estaurosporina.
Já se conhece bem que a estaurosporina é um potente indutor de morte celular
em diversas linhagens celulares. Porém ainda não está bem estabelecido o
mecanismo pelo qual a estaurosporina age, sabe-se que existe influência sobre
a fosforilação da pRB, uma proteína supressora de tumor e que a apoptose é
induzida pela via intrínseca. A estaurosporina induz apoptose em células de
glioma por intermédio das caspases 2 e 3. A ativação destas enzimas, resulta
na clivagem proteolítica de PARP (substrato da caspase 3) e então na
apoptose.

Aplicação das linhagens sensoras U87MTF e U251MTF no monitoramento de


morte celular induzida pelo tratamento com os adenovírus Adp53:
Células sensoras das linhagens U87MTF e U251MTF foram utilizadas para
avaliar o efeito do tratamento de remediação da expressão de p53 utilizando
como veículo de transferência gênica o adenovírus Adp53 (MOI de 100). Para
avaliar o efeito do gene supressor de tumor p53, foi usado como controle os
adenovírus AdLacZ (MOI de 100), portadores do gene LacZ (beta-lactosidase).
Já se sabe que os adenovírus são considerados vetores bem adaptados para
os protocolos de transferência de genes supressores de tumor.
A partir da observação dos resultados obtidos das análises de FACS e
microscopia confocal, onde foi possível visualizar a expressão da proteína
mRFP1, pode-se concluir que a presença do transgene selvagem p53 induziu a
ativação de caspase 3 nas linhagens estudadas. Porém, Nas células sensoras
U87MTF não foi visualizada nenhuma célula expressando mRFP1 no momento
da captura das imagens no microscópio confocal, apesar do FACS detectar um
aumento na intensidade de fluorescência vermelha nas célula tratadas com os
adenovírus Adp53 (intensidade de fluorescência igual a 39,52) em relação ao
controle AdLacZ (intensidade de fluorescência igual 34,695).
As células U251 carregam a cópia mutada de p53 e as células U87 possuem
cópia selvagem de p53, o que pode causar resistência ao efeito pró-apoptótico
de p53 exógeno.
Apesar do tratamento baseado na transferência do gene p53 ser uma
estratégia eficiente, garantindo inibição da proliferação celular em diversos tipos
de tumores, existem situações em que p53 pode não ser a melhor escolha
como agente terapêutico, pois é provável que tumores portadores da cópia
selvagem de p53 desenvolvam um mecanismo capaz de inativar a função
antiproliferativa de p53, logo a introdução de uma nova cópia deste gene pode
ter um efeito limitado nestes tumores (Strauss & Costanzi-Strauss, 2004).

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

248
UNISA - Universidade de Santo Amaro

Ensaio de análise de morte celular induzida pelos adenovírus Adp53


combinados com o tratamento de cisplatina:
Foi realizado um ensaio de morte celular induzida pelos adenovírus Adp53 (MOI
de 100) combinados com o tratamento de cisplatina sob concentração de 30µM,
utilizando as linhagens sensoras U87MTF e U251MTF.
Os resultados indicam um aumento de aproximadamente 50% na intensidade
de fluorescência vermelha emitida pelas células U87MTF tratadas com Adp53
em combinação com a cisplatina, em comparação com as células U87MTF
tratadas AdLac e cisplatina.
A partir da observação dos resultados obtidos através das análises de FACS e
microscopia confocal, é possível constatar que nas células da linhagem
U251MTF os dois tratamentos mostraram-se eficientes na indução da atividade
de caspase-3.
A transferência do gene p53 para células tumorais pode não só inibir a divisão
celular e induzir apoptose, como pode ser útil para sensibilizar as células
tumorais aos tratamentos radio e quimioterápicos. O tratamento com a
combinação de Adp53 mais cisplatina resulta num significante aumento da
fosforilação de p53 exógeno em células de glioma com cópia de p53 selvagem.
A incapacidade de fosforilação de p53 selvagem endógena quando exposta a
drogas danificadoras de DNA como a cisplatina, sugere uma deficiência na
recepção de sinais ou uma indisponibilidade da p53 endógena em receber
esses sinais, pois quando há p53 exógena, esta é fosforilada mediante ao
estresse sofrido pelo DNA.
A expressão de p53 selvagem é um fator essencial para o efeito citotóxico da
cisplatina em células de glioma, pois a sensibilidade ao quimioterápico é
aumentada.

CONCLUSÃO:
Neste estudo foi testada uma versátil ferramenta sensora da ativação de
caspase 3, capaz de detectar a morte celular de forma não invasiva e em tempo
real, em células vivas únicas ou em tumores inteiros por meio da expressão de
mRFP1: fluorescência vermelha. Com sucesso o vetor MTF foi preparado e as
linhagens celulares sensoras U87MTF e U251MTF foram geradas. A expressão
da proteína mRFP1 foi capaz de mostrar a eficiência de agentes terapêuticos
em induzir morte celular por apoptose em células de glioblastoma.
Este sistema sensor de caspase 3 pode vir a servir como uma promissora
ferramenta em testes com drogas pró-apoptóticas, sendo capaz de relatar a
eficiência ou a despistagem destas drogas.

REFERÊNCIA BIBLIOGRÁFICA:

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

249
UNISA - Universidade de Santo Amaro

Ray P, De A, Patel M & Gambhir S S, 2008. Monitoring Caspase-3 Activation


with a Multimodality Imaging Sensor in Living Subjects. Clin Cancer Res. 14:
(18), p. 5801 – 5809

Sambrook J, Fristch E F & Maniats T. 1989 Molecular Cloning: A


Laboratory Manual. 2ª edition. Cold Spring Harbor Laboratory Press. New York

Strauss B E & Costanzi-Strauss E, 2004. Terapia Gênica. Cap 38. In: Ferreira C
G & Rocha J C. Oncologia Molecular. 1ª edição. Atheneu. São Paulo. p. 437-
446

________________________________________________________________
sem notas de rodapé.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

250
UNISA - Universidade de Santo Amaro

HISTÓRICO LITERÁRIO DA DOENÇA DE CHAGAS NO BRASIL -


COMEMORAÇÃO DOS 100 ANOS
HUMBERTO MUNIZ DE SOUZA RAMOS(1), JULIANO JOSE PRIMO RIBEIRO(2)

CAROLINA GUILHERME P BEYRODT DE AMORIM(3),CELIDÉIA APARECIDA COPPI


VAZ(4),MARIA REGINA ANDRADE DE AZEVEDO(5)(Orientadores)
Ciências Biológicas
INTRODUÇÃO:
O Brasil, em 2009, realiza uma grande celebração, em comemoração ao
centenário da descoberta da Doença de Chagas, identificada e descrita pelo
médico e pesquisador do Instituto Oswaldo Cruz, Carlos Chagas, que
apresentou ao mundo médico e científico a doença parasitária humana que
representa hoje uma das mais importantes endemias do Brasil e América
Latina, que registra anualmente 810000 novos casos.
O Mal de Chagas é uma parasitose causada pela picada de um inseto
popularmente conhecido como barbeiro, porém a etiologia da doença é
relacionada ao Trypanosoma cruzi, protozoário flagelado da ordem
Kinetoplastida e família Trypanosomatidae, hospedeiro intermediário de
mamíferos, no qual provoca a patologia, e hospedeiros definitivos de
numerosas espécies de artrópodes hemípteros hematófagos da família
Reduviidae e subfamília Triatominae, entre elas o barbeiro (Triatoma
rubrofasciata).
Considerada inicialmente apenas como endemia rural, pelo hábito do vetor se
alojar em locais escuros em casas de pau a pique, sua transmissão pode
ocorrer através da transfusão de sangue e órgãos. Portela-Lindoso & Shikanai-
Yasuda (2003) comentam que os dados do senso Sorológico Nacional,
realizado de 1975 a 1980, indicam 4,2% de prevalência de Chagas em área
rurais, diminuindo para 2,7% na população geral brasileira e aumentando para
3,1% com a inclusão do estado de São Paulo.
A elevada importância da doença chagásica nos grandes centros urbanos deve-
se principalmente aos elevados fluxos migratórios do campo para a cidade
grande o que instaura de modo inequívoco a importância da patologia em
termos de Saúde Pública, embora seja até os dias atuais, uma doença
negligenciada pelo sistema público de saúde.

OBJETIVO:
Descrever um panorama histórico global da Doença de Chagas com a
visualização de aspectos epidemiológicos e aspectos ligados à Medicina
Transfusional, uma vez que em 2009 são completados 100 anos da descrição
da doença realizada pelo Dr. Carlos Chagas.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

251
UNISA - Universidade de Santo Amaro

METODOLOGIA:
Foi realizada revisão bibliográfica sistemática de publicações sobre Doença de
Chagas de 1990 até os dias atuais em bases de dados eletrônicas.
A avaliação crítica e revisão dos textos das publicações ocorreram através de
discussões entre os autores onde foi considerada a relevância da publicação
em face ao panorama da evolução epidemiológica da doença e do centenário
do Mal de Chagas.

RESUMO:
Embora a Doença de Chagas seja inicialmente proveniente de regiões rurais, é
uma patologia que alcançou um elevado número de enfermos, principalmente
pelo alto fluxo migratório da população rural para as regiões urbanas. Logo é
possível avaliar que somado a este fator, as vias de transmissão provocam a
multiplicação no número de casos, seja devido à transmissão vetorial, vertical
ou através de transfusões (cerca de 33% dos casos, de acordo com Shikanai-
Yasuda et al. (1990)).

CONCLUSÃO:
A educação sanitária, eliminação do vetor e desenvolvimento de métodos
sorológicos para a identificação da parasitose são essenciais para a eliminação
da doença.
Atualmente o risco residual para transmissão transfusional da Doença de
Chagas na cidade de São Paulo é 1/1000000. Mas o desenvolvimento de novas
tecnologias para eliminação de patógenos como detergentes e radiação
“Psoralen” são ferramentas que possibilitam a garantia da segurança
transfusional.

REFERÊNCIA BIBLIOGRÁFICA:
Centenário de Conquistas e Desafios (FIOCRUZ - Publicaç~]ao Virtual
Especial): http://www.fiocruz.br/ccs/media/RM19%20-%20pag%2024-45%20-
%20Especial%20Chagas.pdf (Acessado em Jul/2009).
Barrias ES, Dutra J da MF, de Carvalho TMU. Papel das Proteínas Rabs na
Invasão de Formas Tripomastigotas do Trypanosoma cruzi na Linhagem A431
Transfectadas com Rabs-GFP. Centro de Ciências da Saúde. XXVII Jornada
Giulio Massarani de Iniciação Científica, Artística e Cultural, UFRJ. p.38.
Portela-Lindoso AA, Shikanai-Yasuda MA. Doença de Chagas Crônica: do
xenodiagnóstico e hemocultura a reação em cadeia da polimerase. Rev. Saúde
Pública 37(1) p.107-15. 2003.
Werneck G. Epidemiologia Descritiva: qualidade das informações e pesquisa
nos serviços de saúde. Revista do Sistema Público de Saúde do Brasil 18(3)
2009. p.205-07.
Gontijo ED, de Andrade GMQ, Santos SE, Galvão LM da C, Moreira EF, Pinto

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

252
UNISA - Universidade de Santo Amaro

FS, et al. Neonatal Screening Program for the Infection by Trypanosoma Cruzi in
Minas Gerais, Brazil: Congenital Transmission and Tracking of the Endemic
Areas. Revista do Sistema Público de Saúde do Brasil 18(3) 2009. p.243-54.
________________________________________________________________
Trabalho realizado em parceria da Graduação e da Pós-Graduação (Mestrado
Profissionalizante).

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

253
UNISA - Universidade de Santo Amaro

IDENTIDADE AMBIENTAL DOS ALUNOS DA ESCOLA E.E. PROF.


CARLOS AYRES: A Educação Ambiental como formadora do
sujeito ecológico
AMANDA DE SÁ SILVA(1)

SALETE REGINA VICENTINI(2)(Orientadores)


Ciências Biológicas
INTRODUÇÃO:
INTRODUÇÃO

Na Conferência da Universidade de Keel, Grã-Bretanha em 1965, o termo


Educação Ambiental foi citado pela primeira vez. Nesse mesmo encontro foi
estabelecido que, a Educação Ambiental deveria fazer parte da educação de
todos os cidadãos. Isso mostrou que as autoridades estavam começando a se
preocupar com a interação da sociedade com meio ambiente de elas vivem, o
que já foi um bom começo, mas nessa época poucos países aderiram a essa
prática (DIAS, 2004). A primeira Conferência Internacional sobre Meio
Ambiente, aconteceu em 1972 em Estocolmo, Suécia, três anos depois foi
realizada a Conferencia de Belgrado organizado pela UNESCO. Nessa ocasião
foi escrita a Carta de Belgrado, que entre outras coisas, prega um novo sistema
econômico, novas tecnologias e uma reforma no sistema educacional, visando
à diminuição da degradação do meio ambiente natural e social. Em 1977 a
Educação Ambiental foi tema da Conferência de Tbilisi capital de Geórgia, onde
foram esclarecidos os princípios, objetivos e estratégias para o desenvolvimento
de uma Educação Ambiental transformadora (DIAS, 2004).
Em 1992, ocorreu a Conferência da ONU sobre Desenvolvimento Sustentável e
Meio Ambiente, a Rio-92. Nessa conferência foi criado o Tratado de Educação
Ambiental para sociedade sustentável, que é ainda utilizada do Brasil
(CARVALHO, 2008) e a Agenda 21 Global, que consiste em vários planos de
ação para o século XXI (o que deu nome à agenda) em 40 capítulos, foi
assinado por 179 países (MMA, 2009).
A Educação Ambiental já podia ser percebida no Brasil antes da
institucionalização do governo federal. Os movimentos conservacionistas
começaram nos anos 70 junto com a luta pela liberdade democrática, mas as
manifestações eram bem isoladas somente na sociedade civil. Também nessa
época os primeiros cursos de especialização em Educação Ambiental foram
criados (ProNEA, 2005), já nos anos 80, com o fim da ditadura no Brasil e a
abertura políticas novos movimentos sociais foram se formando, entre ele o
ecologismo (CARVALHO 2008).
A Rio-92 foi realizada no Brasil onde representantes de várias nações

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

254
UNISA - Universidade de Santo Amaro

assumiram o compromisso de trabalhar em prol da justiça, igualdade e do


equilíbrio ambiental (PCN, 1998). A agenda 21 foi elaborada na conferência, é
como se fosse um passo a passo para a realização dos compromissos criados
na Rio-92 (TOMAZELLO & FERREIRA, 2001).
A lei sancionada pelo presidente Fernando Henrique Cardoso em 27 de abril de
1999. “Dispõe sobre a educação ambiental, institui a Política Nacional de
Educação Ambiental e dá outras providências.” A Política Nacional de
Educação Ambiental mostra a importância vital que a Educação Ambiental tem
para o desenvolvimento de uma sociedade saudável, com capacidade de
utilizar os recursos naturais de forma responsável através da prática da
Educação Ambiental, que deveria ser inserida em todos os níveis de ensino.
Na luta pelo saber ecológico devemos observar o nosso entorno mais sem
esquecer de nos auto-observar. Devemos fazer críticas mais também nos auto-
criticar, pois ver os problemas externos é relativamente fácil, difícil é
observarmos que no meio que convivemos ocorrem os mesmo problemas. Para
que a Educação Ambiental seja uma realidade cada um deve começar fazendo
sua “ecologia”, devemos reformular nossas teorias, nossos conhecimentos. E
essa reformulação do saber começa na escola (PCN, 1998).
Segundo Carvalho, (2005) educador ambiental não necessita ser um sujeito
ecológico, porém a identidade ecológica que uma pessoa adquire na vida faz
com que o sujeito queira se tornar um educador ambiental, mas por outro lado
há pessoas que começam a trabalhar com Educação Ambiental e aos poucos
se transformam em sujeitos ecológicos. Isso deveria acontecer com os
professores da rede educacional brasileira, para que as novas gerações tenham
uma identidade ecológica. Nos cursos de capacitação em Educação Ambiental
para formação de uma identidade ecológica, é importante trabalhar também
uma nova identidade pessoal e profissional dos educadores, para isso os
cursos devem se envolver com a vida dos professores, “suas experiências, seus
projetos de vida, suas condições de existência, suas expectativas sociais”.
O PCN auxilia as escolas na elaboração dos projetos educativos, para melhora
do convívio escolar, visando o trabalho com temas sociais ou também
denominados temas transversais como meio ambiente, ética, pluralidade
cultural, orientação sexual, trabalho e consumo entre outro temas que a
população considere relevante para uma realidade (ProNea, 2005).

OBJETIVO:
OBJETIVO
Objetivo geral:

Analisar as práticas da Educação Ambiental do corpo docente, na escola Prof º


Carlos Ayres através de questionários, abordando questões ambientais,

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

255
UNISA - Universidade de Santo Amaro

identificando temas que mais conscientizam o corpo discente.

Objetivo específico:

•Conferir a opinião dos alunos sobre os ambientes onde habitam e o que


poderia tornar esses ambientes melhores.

•Verificar se há algum tipo de programa ligado a Educação Ambiental na escola


e quais os incentivos que MEC proporciona para o exercício da Educação
Ambiental.

•Analisar a opinião dos alunos a cerca do que seria o meio ambiente e o que
poderiam fazer para minimizar os problemas ambientais nos locais.

METODOLOGIA:
METODOLOGIA DA PESQUISA

A pesquisa foi realizada na forma de questionário, sendo distribuídos para os


professores, diretor e alunos de 5 ° a 8 ° série da escola E.E. Professor Carlos
Ayres, que fica localizada no bairro Parque das Nações, São Paulo – SP e tem
população de alunos estimada em 2.500.
Nas pesquisas sociais, o número de elementos é muito elevado, por essa razão
é comum utilizar a técnica de amostragem, assim os resultados da pesquisa
estão baseado em uma pequena fração dos elementos em questão. A
amostragem foi feita através de questionários, que impedem que a avaliação do
pesquisador seja feita com base no aspecto pessoal do entrevistado, mas
também não tem garantia de que todas as questões serão respondidas, assim
diminuindo o número de amostras (Gil, 1999).
Os questionários modificados de PELICIONI, 2000 foram compostos por 25
questões abertas, fechadas e dependentes. Nas questões deixa-se um espaço
em branco para que o entrevistado responda o que quiser. Já as fechadas
apresentam um conjunto de alternativas para que sejam escolhidas uma ou
mais questões, e as dependentes, uma questão depende da resposta da outra
(Gil, 1999). Os questionários foram distribuídos para 100 alunos, 25 para cada
série, que foram escolhidos aleatoriamente pelos professores. Antes de

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

256
UNISA - Universidade de Santo Amaro

realizarmos uma análise dos resultados, foi feita uma filtragem dos
questionários, na qual foram retirados os que estavam preenchidos de forma
incompleta, restando assim 90 alunos, para que através dos resultados fosse
realizada a análise, a fim de estabelecer de que forma a Educação Ambiental é
trabalhada com os alunos (PELICIONI, 2000). O questionário para os
professores contendo 15 perguntas fora disponibilizado para todos os docentes,
oferecendo preferência para a área biológica, com maior facilidade de
desenvolver atividades ambientais com os alunos e foi respondido pelos que
quiseram participar da pesquisa. O questionário dirigido para diretório da escola
foi entregue na secretaria da mesma. Os resultados foram tabulados
manualmente e as respostas foram agrupadas por grau de similaridade entre as
questões.

RESUMO:
RESULTADOS E DISCUSSÃO

As respostas do questionário passado para os alunos 5 ª a 8 ª da escola Prof º


Carlos Ayres foram analisadas em grupos de acordo com o grau de similaridade
das questões.
Pouco mais de 77% dos da 5 ª série, gostariam de mudar algo em suas
casas, entre esses uma parte considerável faria mudanças na aparência de
seus quartos. Pouco mais de 20% estão satisfeitos com suas moradias, por isso
não mudariam nada. Dos alunos da 6 ª série, 47% fariam mudanças em suas
casas para torná-las um lugar melhor para se viver, sendo que a maioria está
satisfeita com sua moradia, portanto não expressou a vontade de realizar
mudanças. Entre os alunos da 7 ª série, 68% sentem a necessidade de fazer
modificações em suas casas, contra 32% que não vêem necessidade de tais
mudanças.
Entre os alunos da 5 ª série, 86% dos alunos gostam da rua onde moram.
Somente pouco mais de 13% não gostam da rua em que estão localizadas suas
casas. Um considerável número de alunos disse gostar das suas ruas por
causa da presença de amizades no local. A maior parte dos alunos da 6 ª série,
89,5%, estão satisfeitos com a rua onde moram, dos 13,6% dos alunos da 7 ª
série, parte deles gosta de sua rua devido à presença de pessoas queridas.
Dos alunos da 8 ª ,29,2% não gostam da rua em que moram,alguns deles por
causa da poluição sonora causada por vizinhos.
Todos os alunos da 5 ª série disseram gostar do bairro em que moram,
principalmente pela presença de um grande número de comércio presente no
local. Dos alunos da 6 ª série, 89,5% gostam do seu bairro pela presença de
amigos e conhecidos e de comércio, entre os 10,5% que não gostam do bairro,

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

257
UNISA - Universidade de Santo Amaro

o principal motivo apresentado foi a violência. Entre os alunos da 7 ª série, 92%


estão satisfeitos com o bairro, apenas 8% não gostam do bairro devido a
violência. Dos alunos da 8 ª série, 75% dos alunos disseram gostar de seus
bairro, 25% dos alunos não gostam do bairro em que moram, devido a violência
e a falta de segurança.
Um grande número de alunos que respondeu ao questionário, disse gostar da
escola em que estuda devido à presença de amigos, de bons professores e de
quadras esportivas. 100% dos alunos que participaram da pesquisa acreditam
que algo poderia ser feito para que o ambiente escolar se tornasse melhor.
A maioria dos alunos da 5 ª e 6 ª séries, gostaria que a escola fosse mais
limpa e de melhorar a qualidade, tanto de materiais didáticos quanto a estrutura
física das salas, que os professores deixassem da faltar às aulas, que as
refeições e o local onde se alimentam fossem melhores e que houvessem aulas
extracurriculares (como aula da canto e teatro). Os alunos da 7 ª série, além
melhoras na estrutura física da escola, gostariam que houvessem mais
atividades ligadas a esporte e que os alunos colaborassem com a limpeza da
escola. Entre os alunos da 8 ª série, alguns gostariam que houvesse um piscina
para que tivessem aula de natação, que fossem construídas mais áreas de
lazer, que a qualidade da comida servida nas refeições melhorasse e que fosse
servido café da manhã para os alunos que estudam no primeiro horário.
Todos os resultados apresentados até este momento dizem respeito ao meio
ambiente do aluno, não meio ambiente natural, mas sim ao meio ambiente
social, pois de acordo com Santos, (2001) a Educação Ambiental deve ser
primeiramente trabalhada localmente com problemas ambientais que estão
próximos dos alunos, para que os mesmos se sintam parte do problema, para
que busquem soluções para melhorar as condições ambientais e a qualidade
de vida nos ambientes que habitam. Muitos desses jovens não estão satisfeitos
com as condições no ambientes que habitam, ou gostariam que algo fosse feito
para torná-los melhores como melhorar as condições de habitação, segurança,
mais áreas de lazer.
De acordo com Souchou et al., (2003) devemos compreender melhor a
realidade do aluno, assim devemos adaptar os trabalhos de Educação
Ambiental com a real situação de vida do aluno, conforme Dias, (2004) é
necessário que se faça uma analise das condições socioeconômicas de cada
local para que a abordagem das questões ambientais sejam bem assimiladas.
Todos os alunos acham importante preservar o meio ambiente. Parte dos
alunos da 5 ª série, disseram que é importante preservar o meio ambiente para
que o mesmo não fique sujo e para manter vivos os animais e as plantas.
Alguns dos alunos da 6 ª série, pensam que preservar o meio ambiente é
importante para que as pessoas continuem vivas ou para que as pessoas não
fiquem doentes. Parte dos alunos 7 ª e 8 ª séries, se mostraram preocupados
com o futuro e com as condições ambientais para as novas gerações.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

258
UNISA - Universidade de Santo Amaro

Os alunos que responderam os questionários estão aprendendo sobre a


fisiologia vegetal, sobre a biosfera, a importância de manter as plantas vivas,
fazer a reutilização de matérias recicláveis, a não jogar lixo no chão, a preservar
o meio ambiente, sobre a biodiversidade, as conseqüências do desmatamento,
sobre poluição do ar, a fazer economia de água e energia elétrica e sobre a
floresta Amazônica.
Foram agrupados os resultados dos questionários direcionados para os
professores e diretores.
As três professoras que responderam, acreditam que a escola é um bom lugar
para se desenvolver a Educação Ambiental. Todos os professores acreditam
que a escola é um ambiente adequado para trabalhar temas ambientais, mas
uma das professoras não se sente preparada para o desenvolvimento do tema
pela falta de material pedagógico. Somente uma das professoras conhecia os
Parâmetros Curriculares Nacionais (PCN).
A escola tem um projeto de reciclagem que é organizado pelos professores,
coordenadores e com a colaboração dos funcionários da escola e tem recebido
materiais didáticos do MEC relacionados a água, que segundo a diretora são
mal aproveitados. Ainda segundo a diretora as capacitações ligadas ao tema
ambiental são realizadas na diretoria de ensino, mas nem todos os professores
comparecem.
O que parece estar faltando é a capacitação em Educação ambiental. Somente
uma das professoras se mostrou realmente interessada no tema ambiental e
duas disseram que incluem questões ligadas a Educação Ambientais em suas
aulas. A capacitação em Educação Ambiental para os professores da rede
estadual é realizada pela diretoria de ensino de cada região. Segundo Carvalho,
(2004) esse tipo de capacitação tem como objetivo mudar a identidade do
professor, tornando-o um sujeito ecológico, e que possa aplicar a Educação
Ambiental de forma adequada que Segundo Medina, (2001) deve se trabalhar a
problemática ambiental que gradativa do local para o global (esses problemas
ambientais foram identificados pelos docentes em uma das questões).
A falta ou pequena quantidade de material pedagógico relacionado às questões
ambientais não é um grande obstáculo. Os educadores devem buscar formas
alternativas porém sempre focando para que os alunos se vejam como parte da
problemática ambiental. Somente uma das professoras conhece o PCN. Os
Parâmetros curriculares Nacionais são como um guia que orienta a melhor
forma de trabalhar as disciplinas em sala de aula. Os projetos de Educação
Ambiental desenvolvidos na escola devem contar com a participação de todos,
desde o diretor até os funcionários da cozinha, mas deve contar principalmente
com a participação dos alunos, então por isso eles devem estar envolvidos com
a escolha do projeto.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

259
UNISA - Universidade de Santo Amaro

CONCLUSÃO:
CONCLUSÕES

Ficou claro que pequenas mudanças podem melhorar o meio ambiente dos
alunos, através da Educação Ambiental que visa não só a conservação
ambiental, mas também a qualidade de vida das pessoas. Para que isso ocorra
é necessário que cobremos dos políticos o cumprimento das promessas para
tornar a vida da população melhor, que os mesmos fazem nas campanhas
eleitorais, mas geralmente são esquecidas após a candidatura. Todos nos
temos que cobrar dos políticos que cumpram os projetos das campanhas, pois
nada fizermos a realidade do nosso país não mudará. Os alunos se mostram
preocupados com as questões da problemática ambiental que conseguem
identificar no meio ambiente, mas o tema é pouco aproveitado na escola. O
único programa de Educação Ambiental conta com a participação de poucos.
Podemos observar através respostas dos questionários que a Educação
Ambiental tem sido trabalhada de forma muito reducionista, devido o não
aproveitamento dos cursos de capacitação oferecidos pela diretoria de ensino,
que não são feitos pelo corpo docente, pois não são obrigatórios, além disso, as
indicações do PCN, que servem como orientação para o cumprimento do
PNEA, não são utilizadas na escola. Todo o corpo docente com o auxilio do
MEC deve trabalhar para que o PNEA seja cumprido, pois como uma lei o
cumprimento da mesma é um obrigação.

REFERÊNCIA BIBLIOGRÁFICA:
REFERÊNCIAS BIBLIOGRÁFICAS

CARVALHO, Isabel Cristina de Moura. 2005. A invenção do sujeito ecológico:


identidade e subjetividade na formação dos educadores ambientais. In: SATO,
Michéle. CARVALHO, & Isabel Cristina de Moura. Educação Ambiental:
pesquisa e desafios. Artmed. Porto Alegre, 51-63 p.

CARVALHO, Isabel Cristina de Moura. 2008. Educação ambiental: a formação


do sujeito ecológico. 3 ed. Cortez. São Paulo, 256 p.

DIAS, Genebaldo Freire. 2004. Educação ambiental: princípios e práticas. 9 ed.


Gaia. São Paulo, 550 p.

GIL, Antonio Carlos. 1999. Métodos e técnicas de pesquisa social. 5 ed. Atlas.
São
Paulo, 206 p.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

260
UNISA - Universidade de Santo Amaro

MEDINA, Naná Mininni, 2001. A formação dos professores em Educação


Ambiental. In: Secretaria de Educação Fundamental. Panorama de educação
ambiental no ensino fundamental. Brasília, 149 p

MMA. Ministério do Meio Ambiente. 2009. Rio 92. www.mma.go.br, data de


acesso 28/09/2009

PCN. Parâmetros curriculares Nacionais. 1997. Parâmetros curriculares


Nacionais: Educação Ambiental / Secretaria de Educação Fundamental.
Brasília. 436 p.

ProNEA. Programa Nacional de Educação Ambiental 2005. Programa Nacional


de Educação Ambiental / Ministério do Meio Ambiente, Diretoria de Educação
Ambiental; Ministério da Educação. Coordenação Geral de Educação
Ambiental: Ministério de Meio Ambiente. 3 ed. Brasília, 102 p.

SANTOS, Silvia Aparecida Martins. 2001. Reflexão sobre o panorama da


Educação Ambiental no ensino fundamental. In: Secretaria de Educação
Fundamental. Panorama de educação ambiental no ensino fundamental.
Brasília, 149p

SOUCHOU et al. 2003. Educação Ambiental: seis proposições para agirmos


como cidadãos. Instituto Pólis. São Paulo, 216p

TOMAZELLO & FERREIRA, Maria Guiomar Carneiro, e Tereza Raquel das


Chagas. 2001. Educação ambiental: que critérios adotar para avaliar a
adequação pedagógica de seus projetos. Ciência & Educação; n.2, v.7: 199-
207p.

________________________________________________________________
LISTA DE SIGLAS

MEC – Ministério de Educação e Cultura


MMA - Ministério do Meio Ambiente
ONU - Organização das Nações Unidas
PCN - Parâmetros curriculares Nacionais
PNEA - Política Nacional de Educação Ambiental
ProNEA - Programa Nacional de Educação Ambiental
Sema - Secretaria Especial do Meio Ambiente
UNESCO - Organização das Nações Unidas para a Educação, a Ciência e a
Cultura

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

261
UNISA - Universidade de Santo Amaro

Impacto da Pesca Artesanal sobre as Tartarugas Marinhas no


Município de Ubatuba, São Paulo.
NATALIA MIRANDA ZANETTI(1)

LUCIANA REZE BERNARDI(2),ELIANA DE OLIVEIRA SERAPICOS(3)(Orientadores)


Ciências Biológicas
INTRODUÇÃO:
As tartarugas marinhas pertencem à Classe Reptilia, Ordem dos Testudines,
que diferencia das demais por possuir uma série de características altamente
especializadas nas quais não ocorre em nenhum outro grupo de vertebrados.
Esses animais existem há mais de 150 milhões de anos, resistindo a muitas
mudanças geológicas do planeta; se originaram na terra, mas se modificaram
para uma vida marinha. Para isso, desenvolveram adaptações como diminuição
do número de vértebras, fusão das costelas para uma melhor resistência,
leveza e diminuição da carapaça, se tornando hidrodinâmica para auxiliar na
natação; patas transformadas em nadadeiras, e o desenvolvimento de uma
glândula, próxima do olho, para remover o excesso de sal.
Em todo o mundo existem sete espécies de tartarugas marinhas conhecidas,
distribuídas em 2 famílias: Cheloniidae e Dermochelydae. Dentre as espécies
Brasileiras estão: tartaruga-verde (Chelonia mydas), tartaruga-de-pente
(Eritmochelys imbricata), tartaruga-de-couro (Dermochelys coriacea) e tartaruga
cabeçuda (Caretta-caretta).
As tartarugas marinhas respiram por pulmões, porém podem permanecer
algumas horas embaixo d’água, prendendo a respiração. Para isso, o
organismo funciona lentamente, o coração bate devagar, fenômeno este
chamado braquicardia, em que o fornecimento de oxigênio é auxiliado por um
tipo de respiração acessória, feita pela faringe e pela cloaca. Possuem os
sentidos da visão, audição e do olfato extremamente desenvolvidos, além de
uma grande capacidade de orientação. Como animais migratórios, isso é
aqueles que se movimentam em busca de comida ou para chegar a suas áreas
de reprodução (embora as verdadeiras razões da migração não sejam bem
compreendidas), as tartarugas marinhas constituem um recurso compartilhado
por muitas nações, passando a vida toda no mar e subindo às praias somente
para desovar, sempre nas mesmas praias que nasceram.
O consumo humano de tartarugas marinhas e seus ovos é um hábito cultural
de muitas comunidades litorâneas em todo o mundo. A captura intencional
geralmente envolve a coleta ilegal de ovos para alimentação e para o comércio,
além da matança da fêmea ovopositora para o consumo de sua carne e
utilização do casco para fins comerciais.
No Brasil até o final dos anos 70, não existia qualquer programa de
conservação à fauna marinha. Os estudos sobre tartarugas marinhas eram

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

262
UNISA - Universidade de Santo Amaro

escassos, principalmente quando comparados aos países como México,


Suriname e Costa Rica, que desenvolviam pesquisa há bastante tempo. Por
serem animais internacionalmente conhecidos, devido a seus hábitos
migratórios, o Brasil sofreu uma crescente pressão internacional no sentido de
criar uma legislação para proteção desses animais marinhos assim como
programas conservacionistas. Em 1980 o Instituto de Meio Ambiente e
Recursos Renováveis (IBAMA), como é conhecido hoje, estabeleceu a criação
das Unidades de Conservação no mar, assim como a implementação de
projetos específicos de proteção às espécies marinhas em extinção. Como
resultante foram criadas Reservas Biológicas como de Atol das Rocas, projetos
Peixe boi-marinho e o TAMAR (Tartarugas Marinhas). Porém, apesar do Brasil
contar com leis que protegem as tartarugas marinhas e também contar com um
grande projeto conservacionista como o projeto Tamar/IBAMA, estes animais se
encontram ameaçados. Atualmente todas as espécies se encontram na Lista
Vermelha Internacional de Espécies Ameaçadas de acordo com a União
Internacional para a Conservação da Natureza, C. caretta, C. mydas e L.
olivacea são consideradas espécies em perigo de extinção e D. coriacea e E.
imbricata, espécies criticamente ameaçadas. Da mesma forma, estes animais
constam na lista brasileira de espécies ameaçadas de extinção do Ministério do
Meio Ambiente, sendo C. caretta e C. mydas consideradas vulneráveis, E.
imbricata e L. olivacea em perigo, e D. coriácea criticamente em perigo. Por
tudo, estes animais requerem esforços de cooperação nacionais e
internacionais para sua preservação.
No Brasil a arte de pesca de cerco flutuante se destaca pelo elevado número de
capturas de tartarugas marinhas. Por esse motivo e por tantos outros ligados à
pesca, é que o projeto TAMAR criou em 2001 o “Plano de Ação para a Redução
da Captura Incidental de Tartarugas Marinhas pela Atividade Pesqueira” que
tem como objetivo diminuir a incidência de tartarugas capturadas e mortas pela
atividade pesqueira através da coleta de informações e pesquisas sobre as
artes de pesca que mais capturam tartarugas e proposição de medidas
mitigadoras, como a substituição de determinadas técnicas por outras menos
predatórias. Ações que abrange todo litoral Brasileiro. Para diminuir o número
das pescas incidentais é fundamental, primeiramente, ter conhecimento sobre o
tipo de aparelho de pesca utilizado, a localização dos sítios e os tipos de iscas
utilizadas, possibilitando posteriormente tomar medidas para evitar os
incidentes.

OBJETIVO:
Este trabalho teve como objetivo descrever sucintamente as diferentes artes
de pesca artesanais que se capturam incidentalmente tartarugas marinhas em
duas praias localizadas no município de Ubatuba, litoral norte de São Paulo, por

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

263
UNISA - Universidade de Santo Amaro

meio de entrevistas informais com a população caiçara, tendo em vista a


importância em se conhecer melhor seus hábitos, principalmente no que condiz
a pesca incidental das tartarugas.

METODOLOGIA:
O estudo foi desenvolvido nas praias da Enseada e Picinguaba no município
de Ubatuba, localizado no extremo norte do litoral paulista, fazendo divisa com
a cidade de Parati (RJ), Caraguatatuba, Natividade da Serra, São Luiz do
Paraitinga, Cunha (SP), e Oceano Atlântico O município é composto por 78
praias continentais totalizando 53 km de extensão, além de 17 ilhas, 9 ilhotas e
10 Lages .
A cidade de Ubatuba possui a maior orla marítima dentre os quatro municípios
do litoral norte paulista, com cerca de 712km², encontrando-se mais adensado
na sua parte sul, da divisa de Caraguatatuba até a sede do município. O
município está totalmente inserido dentro do Parque Estadual da Serra do Mar,
com cerca de 90% de seus remanescentes de Mata Atlântica preservados. Na
Vila de Picinguaba encontramos muitas comunidades caiçaras e pouca
estrutura básica, como saneamento, transporte, atendimento médico, por outro
lado, a praia da Enseada é bem urbanizada, com presença de comércios, casas
de veraneio, hotéis e poucos pescadores artesanais, que exercem também, a
maricultura.
O presente trabalho consistiu em efetuar entrevistas informais junto aos
pescadores das áreas pré-determinadas entre os meses de Abril a Julho de
2009. Foram duas visitas por mês (com exceção de dois finais de semana,
devido às condições meteorológicas). As entrevistas foram realizadas sempre
no final da tarde, depois da pesca. Na maioria das vezes eu me apresentava e
iniciava uma conversa informal sobre o assunto, outras vezes com a permissão
do nativo, utilizava o questionário pré-elaborado. Os pescadores tinham muito
receio em responder as perguntas devido à freqüente fiscalização ambiental no
município em relação à pesca, visto que Ubatuba possui uma grande área
protegida, principalmente Picinguaba que pertence ao Parque Estadual da
Serra do Mar, Núcleo de Preservação Integral que pertence a Fundação
Florestal. Além de Projeto TAMAR que realiza monitoramento de tartarugas na
região.
Os entrevistados viabilizaram informações sobre o número aproximado de
indivíduos de tartarugas marinhas capturadas, local, dados sobre o animal
como classificação taxonômica, tipo de pesca, conhecimento que o pescador
tem sobre esses animais e qual importância lhes são dadas, idade do pescador,
se exerce outra atividade econômica além da pesca e o seu grau de
escolaridade, coletando dados de forma qualitativa. Para a identificação
taxonômica das espécies foram utilizadas fotos das cinco espécies ocorrentes
na costa Brasileira.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

264
UNISA - Universidade de Santo Amaro

RESUMO:
A espécie descrita pelos pescadores (através de observações das fotos) com
maior freqüência de aparições e captura incidental nos dois tipos de rede é a
Chelonia mydas, (comunicação oral) que é denominada por eles como tartaruga
pequena ou tartaruga verde. Houve também, citações à tartaruga Eretmochelys
imbricata, conhecida com Bicuda ou três pontas. A Caretta caretta foi citadas
em menor número em relação às outras, e identificada geralmente como
tartaruga-amarela (linguagem local). Dermochelys coriacea, foi citada por
alguns pescadores como um animal pouco freqüente e somente nas regiões
profundas de mar aberto, não sendo capturada na pesca artesanal. A espécie
Lepidochelys olivacea não foi citada por nenhum pescador. Houve algumas
divergências com os nomes citados pelos entrevistados. A tartaruga-verde
(Chelonia mydas) é a mais abundante na região. De acordo com alguns
trabalhos a dieta desses animais é onívora, se alimentando na sua grande
maioria de moluscos e macroalgas. Na Praia do Lázaro, em Ubatuba,
descreveram a atividade alimentar de C. mydas como sendo diurna, por isso
podemos observar esses animais facilmente perto de costões e sobre lajes
durante o dia. Esses costões apresentam abundância em algas, com
características semelhantes como se pode observar nas praias estudadas. A
praia da Enseada possui um significativo número de moluscos, pois além da
pesca, alguns pescadores exercem a maricultura.
Segundo os entrevistados os animais possuem tamanho médio de 50 a 80cm
e, pesando em torno de 10 kg, portanto segundo a literatura são considerados
juvenis.
A arte de pesca artesanal que captura maior quantidade de tartarugas
marinhas na praia da Picinguaba, segundo os pescadores, é o cerco flutuante.
Consiste em uma rede circular, constando de duas partes: a casa (que é o
reservatório submerso), assentada ao fundo e preso por “poitas”, e o caminho,
preso ao costão rochoso. Essa arte de pesca é passiva, de baixo impacto que
captura o pescado vivo, resultando em um produto de boa qualidade. É
específica à captura de espécies pelágicas e demerso-pelágicas. O cerco
flutuante tem uma grande contribuição na captura incidental de tartarugas na
região. Porém, contrário de outras modalidades de pesca possui baixo impacto,
quase não há mortes.
Na praia da Enseada os pescadores disseram não utilizar-se dos cercos. Os
resultados então foram para a rede de espera. As redes de espera, de emalhar,
galão ou engancho são confeccionadas de uma panagem retangular cujo
comprimento pode variar de 20 e 30 metros ou até mesmo 100 metros e cuja
altura é de 1 a 3 metros. A panagem é estendida entre duas linhas ou cordões:
uma linha superior munida de flutuadores e uma inferior, com um lastro ou
chumbada. Graças aos flutuadores e ao lastro, a panagem mantém-se

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

265
UNISA - Universidade de Santo Amaro

verticalmente na água. Os peixes ficam emalhados pelo opérculo e sem


possibilidade de escapar. Muitos peixes são capturados por ficarem emalhados
pela parte central do corpo e outros porque o fio da rede se envolve com o osso
maxilar ou com os dentes.
Estas redes são geralmente lançadas à noite e recolhidas de manhã, porque
apanham muito mais peixe de noite do que de dia. Apesar dos entrevistados
não citarem o uso do equipamento de rede de arrasto de fundo, muitos
pescadores se utilizam deste meio para a pesca de camarão (Camarão-rosa e
Camarão sete-barbas).

CONCLUSÃO:
A tartaruga D. coriacea só foi observada em Picinguaba o que pode indicar
que os pescadores da enseada permanecem em águas rasas e os de
Picinguada vão para águas mais profundas possivelmente pescar com rede de
arrasto. O cerco flutuante é uma arte de pesca onde captura incidentalmente
grande quantidade de tartarugas marinhas, porém exerce baixo impacto com
relação a mortalidades, pois os animais são mantido vivos até a despesca. O
uso dessa arte de pesca então, deveria ser estimulado pelos órgãos
responsáveis, pois com isso favoreceria a conservação das tartarugas e de
outras espécies marinhas, além de preservar a cultura pesqueira local.
O número de tartarugas marinhas observadas pelos pescadores atualmente é
bem menor que há 50 anos. Porém, segundo os caiçaras, já se observa um
aumento significativo nas aparições em relação há 20 anos, quando eram mais
freqüentes os casos de matanças de tartarugas para alimentação e venda nas
praias de Ubatuba.
São muitos os fatores que determinam a maior mortalidade de tartarugas
marinhas, a pesca é um dos principais, então, um maior conhecimento da parte
dos pescadores para com esses animais é fator importante para sua
conservação. Programas como o Projeto TAMAR são indispensáveis para
ajudar nesse processo, por meio de educação ambiental, pesquisa e
monitoramento.

REFERÊNCIA BIBLIOGRÁFICA:
FELDMAN, F. 2003. São Paulo também tem TAMAR: Em Ubatuba fica uma das
principais bases do projeto TAMAR/IBAMA no Brasil. Revista do TAMAR. 6. 1-
28.

FRAZIER, J. G., 2001. Aramadilha: Algumas artes de pesca ameaçam as


tartarugas marinhas nas áreas de alimentação. Revista Tamar.4. 1-24.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

266
UNISA - Universidade de Santo Amaro

MÁRQUEZ, M. R., 1990. Sea turtle of the world an annotated and illustrated
catalogue of sea turtle species known to date. Fao Species Catalogue. 125p.

________________________________________________________________
Natalia Miranda Zanetti.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

267
UNISA - Universidade de Santo Amaro

Incidência de coccídeas e helmintos em psitacídeos


provenientes do tráfico de animais silvestres
GABRIELA TURINO MENDES(1), MICHELLE SALZMANN MONTEIRO(2), AMANDA LIE
ITO(3), NAYARA DALILA COSTA(4), SILVIA BEATRIZ DIAS ALVES PORTELA(5)

CELSO MARTINS PINTO(6),ADRIANA CORTEZ(7)(Orientadores)


Ciências Biológicas
INTRODUÇÃO:
A manutenção de aves em cativeiro implica em questões ambientais que
necessitam ser criteriosamente analisados quanto á sobrevivência e
persistência de agentes transmissíveis. Os animais capturados na natureza e
que são conduzidos ao cativeiro sem os necessários procedimentos de
adaptação tornam-se excepcionalmente suscetíveis aos agentes infecciosos
devido á falta de resistência imunológica, estresse e manejo inadequado, além
de desnutrição que quase sempre os acompanha até o ponto final do comércio
ilegal. O tráfico dos animais silvestres no Brasil, especialmente de aves das
ordens passeriformes e psitaciformes, representa fonte permanente de animais
ilegalmente comercializados. Estas aves tornam-se vítimas de inúmeras formas
de maus tratos e falhas de manejo, levando-as á condição de suscetíveis ás
infecções, como as helmintoses e coccidioses. O SOS FAUNA, entidade não-
governamental de proteção animal, desenvolve projetos e atividades de resgate
dos animais vítimas do comércio ilegal, bem como a recuperação, reabilitação e
reintrodução á natureza das mesmas. Quando do resgate, os animais são
mantidos em cativeiro por um período de quarentena, durante o qual são feitos
exames diversos para a verificação de infecções que possam acometê-los. Os
exames coproparasitológicos são realizados para a pesquisa de ovos de
helmintos e oocisto de coccídeas, especialmente de Eimeria spp. , tão comuns
nestas situações. O presente projeto visa o estudo da ocorrência de helmintos e
coccídeas nos psitacídeos apreendidos do comércio ilegal e conduzidos ao
SOS FAUNA , para a verificação de incidência dos mesmos nestes grupos de
aves nas condições em que são mantidos quando de quarentena e a citação de
tratamentos clínicos que se fizerem necessários.
Coccídias:
As principais coccídias que podemos encontrar em psitacídeos são as do
Gênero Eimeria, que faz parte do Filo Protozoa, Subfilo Sporozoa, Classe
Coccidia e Família Eimeriidae. A doença causada por este parasito é
denominada Coccidiose. A Eimeria sp. é encontrada nas células epiteliais do
intestino. (URQUHART et al, 1998).
A Eimeria sp. tem distribuição cosmopolita. Epidemiologicamente, seus oocistos
são altamente resistentes, persistindo no ambiente até por anos. Estes
protozoários são altamente hospedeiro-especificos, sendo que após a infecção

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

268
UNISA - Universidade de Santo Amaro

há produção de imunidade espécie-especifica (URQUHART et al, 1998).


Após debelarem a infecção, as aves atingidas podem se recuperar e continuar
eliminando oocistos no ambiente, condição que as caracteriza como portadores
convalescentes (URQUHART et al, 1998).
Nas fezes de aves infectadas há eliminação de oocistos não esporulado, que
em condições ambientais favoráveis se esporula e se torna infectante. A
infecção ocorre com a ingestão do oocisto esporulado, que então se dirige para
os enterócitos aonde ocorre a reprodução tanto sexuada quanto assexuada,
que gera lesão em epitélio e dificulta a função intestinal (FILHO,2006).
A Eimeria sp. produz alterações na mucosa intestinal, cuja gravidade está
relacionada a densidade parasitária e a localização dos parasitas na mucosa.
Após a ruptura das células contendo esquizontes ou gamontes, o tecido em
geral recupera lentamente sua morfologia básica. Ocorre em algumas espécies
lesões superficiais do epitélio e a destruição das vilosidades intestinais, o que
pode causar diminuição da absorção de nutrientes e conseqüente deficiência da
conversão alimentar e aparece como sintoma clínico a diminuição de peso e
problemas de crescimento. (URQUHART et al, 1998).
O diagnóstico baseia-se no exame post-mortem de algumas aves acometidas.
Apesar dos oocistos poderem ser detectados nos exames de fezes, seria
errado fazer o diagnóstico com base apenas nessas evidências, pois o maior
efeito patogênico em geral ocorre antes da produção de oocistos, e
dependendo do hospedeiro envolvido, a presença de grandes quantidades de
oocistos não está necessariamente relacionada a graves alterações patológicas
no intestino, já que há espécies apatogênicas (URQUHART et al, 1998).
Depois de feito o diagnóstico, o tratamento deve ser instituído o mais breve
possível, sendo as sulfonamidas as drogas mais amplamente utilizadas
(FOREYT, 2001).
As alternativas de controle baseiam-se no uso de compostos anticoccídios na
ração ou na água e nas práticas de manejo adequado, como manter a cama
dos animais limpa, de utilizar sempre bebedouros que impeçam que a água
atinja a cama, com os comedouros e bebedouros do tipo e altura que não
possam ser contaminados por dejeções e manter boa ventilação para reduzir a
umidade no aviário ou gaiola (URQUHART et al, 1998).
Nematodas:
Nematodas são helmintos que parasitam diversos tecidos do corpo dos animais,
sendo que nas aves a maioria infecta o trato gastrintestinal, provocando vários
distúrbios que interferem no crescimento, desenvolvimento e bem estar animal,
podendo causar diarréia, destruição e lesão do epitélio intestinal, prostração,
hiporexia, anorexia, diminuição da conversão alimentar e retardamento do
crescimento entre outros distúrbios.
O controle, em geral, se baseia em um bom manejo e uso periódico de
vermífugos. O diagnóstico consiste basicamente em exame de fezes (técnica

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

269
UNISA - Universidade de Santo Amaro

para pesquisa de ovos leves- flutuação água/éter), contagem de ovos, exame


post-mortem (necropsia: presença de helmintos). O tratamento se faz através
de anti-helmínticos que sejam eficientes para cada tipo de helminto.
Alguns dos nematóides que podem ser encontrados nos intestinos de aves são:
Trichostrongylus tenuis, Strongyloides sp., Ascaridia sp., Heterakis sp. e
Capillaria spp. (URQUHART et al, 1998).

OBJETIVO:
Verificar a ocorrência de coccídeas e helmintos em psitacídeos provenientes do
tráfico de animais silvestres que chegaram a ONG SOS Fauna no ano de 2008.

METODOLOGIA:
Para a realização desse trabalho foram utilizados três recintos de psitacídeos
sendo dois de Amazona aestiva (recintos 1 e 2) e um de Aratinga aurea
(Recinto 3), provenientes do tráfico e que foram alojados no SOS FAUNA.
Foram realizadas três coletas, sendo a primeira realizada no dia 29/04/08, a
segunda no dia 02/10/08 e a terceira no dia 11/11/08. Foram coletados ”pools”
de fezes diretamente do piso dos recintos, sendo estas depositadas em
coletores universais e devidamente identificados. Durante a coleta, os
responsáveis utilizaram os equipamentos de proteção individual que era
composto de luvas e máscaras descartáveis, avental de manga comprida e
sacolas plásticas nos pés (propé), que eram descartadas após a saída de cada
recinto. As amostras foram transportadas em caixa de isopor com gelo
reciclável previamente resfriado e colocadas no mesmo dia no refrigerador sob
temperatura de aproximadamente 4ºC. O processamento das amostras foi
realizado um dia após a coleta no laboratório de parasitologia veterinária na
Faculdade de Medicina Veterinária da Universidade de Santo Amaro. Foram
realizados dois métodos de exame coproparasitológico: Método de Willis que é
utilizado para a pesquisa de ovos leves e oocistos de coccídeas e o Método da
centrifuga-sedimentação em água-eter adaptado utilizado na pesquisa de
estruturas pesadas (Ferreira et al.,1962).

RESUMO:
Recinto 1: Amazona aestiva
Foram coletadas três “pools” amostrais, sendo que só foi observado Ascaridia
sp. (+) na terceira amostra do dia 02 de outubro de 2008 e Eimeria sp. (++) na
amostra 2 do dia 11 de novembro de 2008, ambas encontradas no método de
Willis.
Recinto 2: Aratinga aurea
Foram coletados três “pools” amostrais, sendo que foi observado nas amostras
2 e 3 do dia 29 de abril de 2008 respectivamente, Eimeria sp. (+) e
Strongyloides sp. (+); e nos dias 2 de outubro e 11 de novembro de 2008, na

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

270
UNISA - Universidade de Santo Amaro

terceira amostra foi encontrado Ascaridia sp. (+) todas encontradas pelo método
de Willis.
Recinto 3: Amazona aestiva contendo 5 aves
Foi coletado um “pool” amostral, sendo observado na primeira coleta Eimeria
sp. (+) e na terceira coleta a presença de Ascaridia sp. (+) ambas no método de
Willis.

CONCLUSÃO:
Nos resultados obtidos nesse estudo, foram encontrados, de um total de vinte e
uma amostras, quatro amostras com presença de ovos de Ascaridia sp., em
três amostras a presença de oocistos de Eimeria sp. e em uma amostra ovos de
Strongyloides sp. e no restante das amostras não encontrou-se parasitas nos
métodos utilizados.
O helminto Ascaridia sp. é um verme intestinal potencialmente patogênico
observado em aves domésticas e silvestres jovens, causando enterite catarral à
hemorrágica, podendo levar á oclusão intestinal e morte. A forma de infecção
pode ser por ovos livres no solo, pelo reservatório (ave assintomática), ou por
hospedeiro de transporte (URQUHART et al, 1998). Assim sendo, a infecção
adquirida pelas aves e diagnosticada no presente estudo tem uma importante
participação ambiental.
Os helmintos do Gênero Strongyloides são vermes capiliformes de intestino
delgado e ceco das aves. No ambiente desenvolve-se larvas e depois machos e
fêmeas adultos de vida livre, e em determinadas condições ambientais as larvas
de terceiro estágio podem infectar os hospedeiros por penetração cutânea,
provocando reações eritematosas, ou por ingestão e migração via sangue
venoso. No intestino delgado e ceco, causa enterite catarral, com diminuição da
digestão e absorção de nutrientes. As larvas são susceptíveis às condições
climáticas extremas (URQUHART et al, 1998).
Em estudo de aves silvestres realizado no estado de Pernambuco, encontrou
maior prevalência de Capillaria sp. e Coccídeas (FREITAS et al,2002). No
estado de São Paulo, no Zooparque da cidade de Itatiba foram encontrados em
fezes de aves silvestres parasitas dos gêneros Capillaria sp., Ascaridia sp. e
Eimeria sp. (HOFSTATTER et. al).
Comparando os resultados deste trabalho com o estudo realizado em
Pernambuco, verificamos a ocorrência comum de Coccídeas. No estudo
realizado no Zooparque da cidade de Itatiba, foi constatado a presença de
Ascaridia sp. e Eimeria sp. coincidindo com os achados desta pesquisa. Nos
dois trabalhos citados foi encontrado Capillaria sp. o que não foi observado em
nossas amostras. Em contrapartida, o Gênero Strongyloides foi encontrado em
nossas coletas, o que não foi detectado nos trabalhos acima.
No trabalho constatamos uma maior incidência de patógenos nas amostras
coletadas próximas a porta e também nas áreas cobertas dos recintos. Através

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

271
UNISA - Universidade de Santo Amaro

disto, podemos presumir que a presença de agentes parasitários podem estar


relacionados com o carreamento destes através dos tratadores, que tem acesso
a vários recintos, podendo transportar esses agentes através dos calçados, das
roupas, luvas e materiais usados para higienização do recinto.
Outra hipótese seria a menor incidência de luz solar nas áreas cobertas,
ocasionando maior umidade desses locais e facilitando a sobrevivência de ovos
e oocistos desses agentes parasitários, já que o sol contribui sendo um
desinfetante natural, desfavorecendo a permanência dos patógenos.
Outro fator predisponente é por essas aves serem provenientes do tráfico,
sofrendo estresse pelo impacto de serem retiradas do seu habitat, pela
superpopulação e más condições de manejo durante o transporte e resgate,
resultando numa maior suscetibilidade para o desenvolvimento de doenças
infecciosas, parasitárias entre outras.
Para diminuir as possibilidades de infecção e reinfecção dos animais no recinto,
são necessários métodos de prevenção e controle, tais como o uso de
pedilúvio, separação dos materiais usados em cada recinto, realização de
quarentena dos animais recém chegados, fornecer alimentação equilibrada,
diminuir fatores de estresse, usar compostos anticoccídeos na ração e na água,
uso periódico de vermífugos e diminuir a densidade populacional.
Concluimos que as péssimas condições de vida das aves vítimas do tráfico
resultam numa maior susceptibilidade para o desenvolvimento de doenças
infecciosas, parasitárias, entre outras, especialmente as infecções helmínticas e
por protozoários intestinais, como as encontradas no presente estudo por
Ascaridia sp., Strongyloides sp. e Eimeria sp.

REFERÊNCIA BIBLIOGRÁFICA:
1.FOREYT, W. Veterinary Parasitology: Reference
Manual. 5 Ed. Iowa State University
Press. Estados Unidos. 2001. p 679-681.
2.RENCTAS (2002) 1º relatório nacional sobre o tráfico de fauna
silvestre. Brasília: Rede Nacional de Combate ao Tráfico
de Animais Silvestres (RENCTAS).
3.SICK, H. (1997) Ornitologia Brasileira. Rio de Janeiro: Ed.
Nova Fronteira.
4.JOSEPH, V. 2003. Infections and parasitic of captive passerines. Semin. Avian
Exotic Pet Med. 12(1):21-28
5. FREITAS, M et al (2002). Parásitos gastrointestinales de aves silvestres en
cautiveiro en el estado de Pernambuco, Brasil. Parasitol Latinoam 57:50-54 -
FLAP
6. HOFSTATTER, P et al (). Levantamento de parasitos intestinais em aves

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

272
UNISA - Universidade de Santo Amaro

mantidas no zooparque de Itatiba, São Paulo. Departamento de parasitologia,


IB, UNICAMP/Zooparque de Itatiba.
7. FILHO, R. L. A., Saúde Aviária e doenças, São Paulo, editora Roca, 2006, pp
256-260.
8. FORTES, E., Parasitologia Veterinária, 3° edição, Editora Cone, 1997.
9. SLOSS, M.W., ZAJAC, A., KEMP, R.L., Parasitologia Clínica Veterinária, 6º
edição, Editora Manole LTDA., 1999.
10. URQUHART, G. M. et al, Parasitologia Veterinária, 2ª edição, editora
Guanabara Koogan, 1996.

________________________________________________________________
Tabela dos resultados e imagens presentes no trabalho original.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

273
UNISA - Universidade de Santo Amaro

INFECÇÃO NATURAL POR ESPÉCIES DE PLASMÓDIOS, EM


ANOFELINOS CAPTURADOS NA MATA ATLÂNTICA DO ESTADO
DO ESPÍRITO SANTO, POR MEIO DA REAÇÃO EM CADEIA DA
POLIMERASE (PCR)
ELIANE FERNANDES JANEZ(1)

ROSELY DOS SANTOS MALAFRONTE(2)(Orientadores)


Ciências Biológicas
INTRODUÇÃO:
1. INTRODUÇÃO

1.1- Malária

A malária é uma doença conhecida desde a antiguidade, cuja provável origem


foi na África, espalhando-se pelas áreas tropicais e subtropicais de todo o
mundo (Pessôa & Martins, 1988). Devido à crença de que sua causa se dava
pelos miasmas e emanações dos pântanos, o nome da doença teve sua origem
da expressão italiana “mal aire” (Korolkovas & Burckhalter, 1982) a qual
significa mal ar ou ar insalubre (Rey, 1991). A malária chegou provavelmente às
Américas, através de uma expansão à Europa e Ásia e da migração humana
(Bruce-Chwatt, 1985; Stringer & Andrews, 1988).
Sua incidência é maior nas regiões tropicais e subtropicais, principalmente nas
zonas alagadas de cursos d’água, rios, represas, lagos ou lagoas (Pessôa &
Martins, 1988).
A cada ano, estima-se que 300 a 500 milhões de pessoas sejam infectadas e
que em média, 1,5 a 2,7 milhões de pessoas chegam a óbito. Dessa forma, a
malária continua sendo uma das principais doenças parasitárias (Guerrant &
Blackwood, 1999). A maior incidência ocorre em países subdesenvolvidos e em
desenvolvimento, principalmente no continente africano, com 90% dos casos
notificados. O Brasil e a Índia, além da África, apresentam alta ocorrência dessa
parasitose (WHO, 1997).

1.2 - Malária no Brasil

No Brasil, é considerada relevante, principalmente na Região Amazônica


(Sallum et al., 2008). Apresentando aproximadamente 99% dos casos, tal
quadro é consequência do influxo migratório para a região, problemas
relacionados a escassos recursos econômicos, , entre outros, os quais tornam o
seu controle muito difícil (Voorham et al., 1993).
Na região extra-amazônica a maior parte dos casos é importada por meio de

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

274
UNISA - Universidade de Santo Amaro

migrantes provenientes do norte do país ou de viajantes que estiveram em


áreas endêmicas do Brasil e do exterior. No entanto, um pequeno número de
casos é autóctone, relacionado a um nicho ecológico bastante peculiar (Deane,
1992) já que existem áreas da região sudeste e sul, principalmente aquelas cuja
vegetação é formada por Mata Atlântica, que possuem focos residuais (SUCEN,
2009).

1.2.1- Malária na Mata Atlântica

Casos autóctones de malária residual, relacionados à Mata Atlântica e a regiões


litorâneas recobertas por ela (Rio de Janeiro, São Paulo e Espírito Santo) foram
objetos de estudos recentes. Estes casos apresentam sintomatologia bastante
atípica: a parasitemia geralmente é muito baixa e os indivíduos são na maioria
das vezes oligossintomáticos (Carvalho et al., 1988; SUCEN, 1993; SUCEN,
1995).
Esta malária é denominada de “malária bromeliana” porque nestas regiões,
diferentemente dos anofelinos encontrados na Região Amazônica, os vetores
responsáveis pela transmissão da doença (Anopheles (Kerteszia) cruzii e
Anopheles (K.) bellator) desenvolvem-se nas águas acumuladas nos verticílios
das folhas de bromélias, encontradas na Mata Atlântica (Rachou, 1958;
Forattini, 1962; Forattini et al., 1986).

1.2.2- Malária no Estado do Espírito Santo

O Estado do Espírito Santo registra anualmente cerca de 100 casos de malaria,


dos quais 10 a 30 são autóctones. Estes casos ocorrem na Mata Atlântica do
Espírito Santo e na região montanhosa do Estado, ao longo de um semicírculo
centrado em Vitória. São registrados principalmente em nove municípios, com
aproximadamente 5.343 km² e uma população de 215.000 habitantes. A
topografia é irregular, há pequenas montanhas com altura média de 800 metros
e vales estreitos. Os principais municípios atingidos são: Santa Leopoldina,
Santa Maria do Jetibá, Domingos Martins, Viana, Marechal Floriano, Alfredo
Chaves, Venda Nova do Imigrante e Santa Tereza (Rezende et al., 2009)
A malária autóctone notificada, ao contrário do que ocorre no Estado de São
Paulo, exibe sintomatologia muito semelhante à malária causada por
Plasmodium vivax, embora casos de malária assintomática e anticorpos contra
as variantes da proteína circunsporozoíta (CSP) de P. vivax também foram
relatados (Cerrutti et al., 2007).

OBJETIVO:
2. OBJETIVO

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

275
UNISA - Universidade de Santo Amaro

Analisar a infecção natural, por espécies de plasmódios, na fauna anofélica


capturada no município de Santa Tereza, bem como identificar as espécies de
plasmódios por meio da reação em cadeia da polimerase, com “primers”
desenhados a partir de sequências da região que codifica para o gene 18s do
DNAr (Win et al., 2002).

METODOLOGIA:
3. MATERIAIS E MÉTODOS

3.1- Capturas de Anofelinos

Os anofelinos foram capturados pelo período de um ano (fevereiro de 2007-


2008). As capturas ocorram no município de Santa Tereza (19º56’12’’S,
40º’35’28’’W e 656 metros), estado do Espírito Santo. Este município, dentre as
regiões montanhosas, apresentou nos últimos anos, maior incidência de
malária, sendo por esse motivo, objeto de estudo.
As capturas foram conduzidas pela equipe local da FUNASA. As espécies
foram enviadas ao Laboratório de Entomologia da Faculdade de Saúde Pública
da Universidade de São Paulo para a sua identificação.

3.1.1- Coleta

As capturas foram realizadas em dois pontos denominados: fixo e móvel. O


ponto fixo foi determinado pela equipe de campo em Valsugana Velha,
enquanto que os pontos móveis foram determinados a partir da ocorrência de
casos de malária durante o período de estudo. Para a captura dos anofelinos
foram utilizados dois tipos de armadilhas: armadilhas luminosas tipo CDC e
barraca de Shannon (Shannon, 1939).

3.1.2- Anofelinos

As espécies de anofelinos identificadas foram enviadas ao Instituto de Medicina


Tropical, da Universidade de São Paulo, para realização da técnica de PCR.

3.2- Técnicas Moleculares

3.2.1- Extração de DNA de anofelinos

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

276
UNISA - Universidade de Santo Amaro

DNA de “pool” de até 10 anofelinos/tubo foi extraído conforme protocolo


preconizado por Oskam et al. (1996) com pequenas modificações. O DNA foi
estocado em freezer até o momento de ser utilizado para a PCR.

3.2.2- PCR de mosquitos

O protocolo utilizado para a PCR foi desenvolvido por Kimura et al. (1997) e
modificado por Win et al. (2002). Ele baseia-se em duas reações sequenciais
onde a primeira emprega “primers” gênero-específico, que amplificam um
fragmento de aproximadamente 130 pares de base (pb) do gene que codifica o
rRNA 18s do Plasmodium. Uma segunda reação foi realizada com o “primer”
espécie-específico em combinação com cada um dos “primers” reversos
espécie-específicos para Plasmodium vivax, P. falciparum e P. malariae.
As amostras foram submetidas à eletroforese em gel de agarose a 1,5% em
tampão TBE. Após a corrida, o gel corado em brometo de etídio foi
fotodocumentado em aparelho “eagle eye” da Stratagene.

RESUMO:
4. RESULTADOS

4.1- Anofelinos registrados na Mata Atlântica do município de Santa Tereza,


Espírito Santo
.
Foram capturados 120 mosquitos: 20 por meio da armadilha de CDC e 100 por
meio da barraca de Shannon. Os anofelinos identificados foram: 10 An.
albitarsis Lynch Arribalzaga, 1878; 1 An. argyritarsis Robineau-desvoidy, 1827;
1 An. braziliensis Chagas, 1907; 32 An. cruzii ; 11 An. evansae Brèthes, 1926; 3
An. galvaoi Causey, Deane & Deane, 1943; 9 An. lutzi Cruz, 1901; 12 An.
parvus Chagas, 1907 e 18 An. strodei Root, 1926; os 23 restantes não foram
identificados, ao nível de espécie, sendo dessa forma, descartados.
An. (K) cruzii (32%) foi a espécie com maior frequência na barraca de
Shannon, seguida de An. (N) strodei (19%) e An. (N) parvus (14%).
Em armadilha luminosa tipo CDC, An. cruzii também ocorreu com maior
frequência e as demais, ocorreram em igual densidade.
No mês de fevereiro de 2007 a espécie mais coletada foi An. cruzii, bem como
no mesmo mês, em 2008.
A espécie predominante nos dois pontos de captura foi An. cruzii, contribuindo
com 20,61% e 12, 37% nos pontos fixo e móvel, respectivamente.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

277
UNISA - Universidade de Santo Amaro

4.2- Infectividade
Para a técnica de PCR, foram utilizados tanto DNA individual como em “pool”
de até 10 insetos/ tubo.
Como controles positivos foram utilizados DNA de Plasmodium vivax e de
cultivo de P. falciparum, ambos da SUCEN (Superintendência de Controle de
Endemias). DNA de Plasmodium malariae não foi utilizado como controle
positivo por não se ter este em mãos.
Todos os anofelinos capturados foram negativos em PCR, para as três
espécies de plasmódios.

5. DISCUSSÃO

A malária extra-amazônica, devido a sua característica residual, sempre foi


colocada em segundo plano pelos órgãos de controle. Dados recolhidos pela
Vigilância Ambiental do Sistema Único de Saúde, durante o período de 1985 até
2006 demonstram a totalidade de 4.870 casos autóctones e importados de
malária registrados no Espírito Santo (Natal, 2007). A maioria dos casos
notificados ocorreram nos municípios situados na área montanhosa do mesmo
Estado, sendo An. cruzii Dyar & Knab, 1908 subgênero Kerteszia Theobald
1905, um vetor em potencial no local (Rezende et al., 2005).
O Estado do Espírito Santo notificou em 2008, 122 casos de malária autóctone
(CVE, 2009), sendo que a maioria destes ocorreram no município de Santa
Tereza. Este fato levou os pesquisadores nos últimos anos, a escolher este
município para a realização dos estudos.
As coletas dos anofelinos foram conduzidas pela equipe local da FUNASA. As
armadilhas utilizadas para as capturas foram as luminosas tipo CDC e barraca
de Shannon. Observou-se diferença na quantidade de mosquitos capturados
em ambas as armadilhas. A maioria foi capturada próximo às residências. An.
cruzii, subgênero Kerteszia, por exemplo, teve maior frequência nesse tipo de
armadilha. Este resultado corrobora com Luz et al. (1979), que relata já ter
ocorrido a captura de algumas fêmeas do subgênero Kerteszia dentro das
matas e nas proximidades de domicílios. Porém, segundo Corrêa (1961),
apesar de An. cruzii ser um mosquito antropofílico, este possui hábitos
exofílicos, isto é, alimenta-se preferencialmente fora dos domicílios. Na
armadilha tipo CDC a espécie mais capturada também foi An. cruzii. Zavortink
(1973) relatou que An. cruzii foi bem adaptado a habitats de montanha, bem
como outras espécies do subgênero Kerteszia.
Os anofelinos, após as capturas, foram enviados ao Laboratório de
Entomologia da Faculdade de Saúde Pública da USP para as identificações.
Após as identificações, estes foram enviados ao Laboratório de Protozoologia
do Instituto de Medicina Tropical para a realização das identificações de sua
infecção natural por meio de técnicas moleculares. Utilizou-se o DNA genômico

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

278
UNISA - Universidade de Santo Amaro

desses anofelinos para realizar a PCR. Observou-se que das nove espécies
ensaiadas, isto é, de 97 mosquitos utilizados, todas apresentaram resultado
negativo.
A fim de se facilitar e melhorar a sensibilidade/especificidade do diagnóstico,
novas técnicas acabaram sendo desenvolvidas. Vários pesquisadores optaram
por utilizar técnicas de biologia molecular, em particular a PCR. Esta técnica
tem se prestado ao diagnóstico das espécies de plasmódios em seres humanos
(Snounou et al., 1993a, b; Kimura et al., 1997; Rubio et al., 1999; Win et al.,
2002) e a sua utilização em mosquitos de campo foi avaliada (Arez et al., 1997).
Neste trabalho, utilizamos “primers” desenhados a partir de sequências
conservadas de DNA ribossômico (18S) e a técnica utilizada é a do nested PCR
que se mostra mais sensível que a técnica convencional.
Pouca informação a respeito da infectividade dos anofelinos capturados nas
Matas Atlânticas brasileiras está disponível em literatura.
Relatos dos anos 40 demonstraram o encontro de infecção natural por
plasmódios em anofelinos do subgênero Kerteszia capturados na região
sudeste do Brasil (Rachou, 1958). Dows et al. (1943) também relatam que An.
bellator Dyar & Knab, 1906 consegue se infectar artificialmente com P.
falciparum Welch, 1897.
Rezende et al. (2009), em estudo na mesma região deste projeto, no período
de 2004 a 2006, por meio da técnica de PCR e com quantidade superior de
anofelinos (2.290) obtiveram uma taxa mínima de infecção para An. cruzii de
0,5% para P. vivax. A porcentagem proporcionalmente maior de anofelinos
infectados pode ser explicada pelo uso de técnica mais sensível que ELISA.
Como podemos observar, a taxa de infectividade nos anofelinos destas
regiões que apresentam malária residual é baixa. Sendo assim, embora
frustrante, o não encontro de anofelinos infectados nestas áreas do Estado do
Espírito Santo está dentro das expectativas deste estudo.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

279
UNISA - Universidade de Santo Amaro

CONCLUSÃO:
Conclusão inclusa na discussão

REFERÊNCIA BIBLIOGRÁFICA:
6. REFERÊNCIAS BIBLIOGRÁFICAS

AREZ A.P.; PALSSON, K.; PINTO, J.; FRANCO, A.S.; DINIS, J.; JAENSON,
T.G.; SNOUNOU, G.; ROSARIO, V.E.1997. Transmission of mixed malaria
species and strains by mosquitoes, as detected by PCR, in a study area in
Guinea-Bissau. Parassitologia, 39: 65-70.
BRUCE-CHWATT, L.J. 1985. Essential Malariology. 2.ed. , Willian Heinemann
Medical Books. London. 354p.
CARVALHO, M.E.; GLASSER, C.M.; CIARAVOLO, R.M.C.; ETZEL, A.;
SANTOS, L.A.; FERREIRA, C.S. 1988. Sorologia de malária vivax no foco
Aldeia dos índios, município de Peruíbe, Estado de São Paulo, 1984 a 1986.
Cad. Saúde Pública, R.J., 4: 276-92.
CVE – CENTRO DE VIGILÂNCIA EPIDEMIOLÓGICA. 2009. Malária. Disponível
em: http://www.cve.saude.sp.gov.br/htm/zoo/malaria_dados.html. Acesso em:
25/10/2009.
CERUTTI-JR, C.; BOULOS, M.; COUTINHO, A.F.; HATAB, M.C.L.D.;
FALQUETO, A.; REZENDE, H.R.; DUARTE, A.M.R.C.; COLLINS, W.;
MALAFRONTE, R.S. 2007. Epidemiologic aspects of the malaria transmission
cicle in na area of very low incide in Brazil. Mal. J., 6: 33.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

280
UNISA - Universidade de Santo Amaro

CORRÊA, R.R.1961. Observações sobre o vôo de Anopheles (Kerteszia) cruzii


e do An. (Ker.) bellator, vetores de malária. Arq. Hyg. Saúde Públ., 26: 333-42.
DEANE, L.M. Simian malaria in Brazil.1992. Mem. Inst. Oswaldo Cruz, Rio J.,
87: 1-20.
DOWNS, W.G.; GILLETTE, H.P.S.; SHANNON, R.C.1943. A Malaria survey of
Trinidad and Tobago. J. N. Malaria Soc., 2: 5.
FORATTINI, O.P. 1962. Entomologia Médica. 6. ed., v.4. Edgard Blucher. São
Paulo. 662p.
FORATTINI, O.P.; GOMES, A.; NATAL, D.; SANTOS, J.L.F. 1986. Observações
sobre a atividade de mosquitos Culicidae em matas primitivas da planície e
perfis epidemiológicos de vários ambientes do Vale do Ribeira, São Paulo,
Brasil. Rev. Saúde Pública, 20: 178-203.
GUERRANT, R.L. & BLACKWOOD, B.L. 1999. Threats to global health and
survival: the growing crises of tropical infectious diseases - our "unfinished
agenda". Clinical and Infective Diseases, 28(5): 966-986.
GREENWOOD, B. & MUTABINGWA, T. 2002. Malaria in 2002. Nature, 415:
670- 72.
KOROLKOVAS, C.J.; BURCKHALTER, M.C. 1982. Epidemiologia e Saúde. São
Paulo, p.19-26.
KIMURA, M.; KANEKO, O.; LIU, Q.; KAWAMOTO, F.; WATAYA, Y.; OTANI, S.;
YAMAGUCHI, Y.; TANABE, K. 1997. Identification of the four species of human
parasites by nested PCR that targets variant sequences in the small subunit
rRNA gene. Parasitol. International, 46: 91-5.
LUZ, E.; CONSOLIM, J.; VIEIRA, A.M.; BORBA, A.M. 1979. Alguns aspectos
epidemiológicos da persistência de transmissão de malária no litoral
paranaense. I – Idade fisiológica de Anopheles cruzii (Díptera, Culicidae). Arq.
Biol. Tecnol., 22: 68-88.
NATAL, D. ; URBINATTI, P.; MALAFRONTE, R.S. ; REZENDE, H.R. CERUTTI-
JR, C.; SALLUM, M.A.M. 2007. First record of Anopheles (Anopheles) costai
Fonseca & Ramos, 1939 in Espirito Santo state, Brazil. Rev. Inst. Med. trop. S.
Paulo, 49 (5): 323-326.
PESSÔA, S. B. & MARTINS, A.V. 1988. Malária. In: PESSÔA, S.M. &
MARTINS, A. V. Parasitologia Médica. 11. ed. Guanabara. Rio de Janeiro: cap.
7, p.150- 72.
RACHOU, R.G. 1958. Anofelinos no Brasil: comportamento das espécies
vetoras de malária. Rev. Bras. Malariol. Doenças Trop., 10: 145-81.
REZENDE, H.R.; CERUTTI-JR, C.; SANTOS, C.B. 2005. Aspectos atuais da
distribuição geográfica de Anopheles (Kerteszia) cruzii Dyar & Knab, 1908 no
Estado do Espírito Santo, Brasil. Entomología y Vectores, 12: 123–26.
REZENDE, H.R.; SOARES, R.M.; CERUTTI-JR, C.; ALVES, I.C.; NATAL, D.;
URBINATTI, P.R.; YAMASAKI, T.; FALQUETO, A.; MALAFRONTE, R.S. 2009.
Entomological Characterization and Natural Infection of Anophelines in an Area

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

281
UNISA - Universidade de Santo Amaro

of the Atlantic Forest with Autochthonous Malaria Cases in Mountainous Region


of Espírito Santo State, Brazil. Neotropical Entomology, 38 (2): 272-280.
REY, L. 2001. Parasitologia. 3. ed. Rio de Janeiro, Guanabara Koogan. 856p.
REY, L. 2002. Bases da Parasitologia Médica. Rio de Janeiro. Guanabara
Koogan. 410p.
RUBIO, J.M.; BENITO, A.; ROCHE, J.; BERZOSA, P.J.; GARCIA, M.L.; MICÓ,
M.; EDU, M.; ALVAR, J. 1999. Semi-nested, multiplex polymerase chain reaction
for detection of human malaria parasites and evidence of Plasmodium vivax
infection in equatorial guinea. Am. J. Trop. Med., 60: 183-87.
SALLUM, M.A.M.; URBINATTI, P.R.; MALAFRONTE, R.S.; REZENDE, H.R.;
CERUTTI-JR, C.; NATAL, D. 2008. Primeiro registro de Anopheles (Kerteszia)
homunculus Komp (Diptera, Culicidae) no Estado do Espírito Santo, Brasil. Rev.
Bras. de Entomol. 52(4): 671-673.
SHANNON, R. C. 1939. Methods for collecting and feeding mosquitoes in jungle
yellow fever studies. Am. J. Trop. Med., 19:131-138.
SNOUNNOU, G.; VIRIYAKOSOL, S.; JARRA, W.; THAITHONG, S.; BROWN, K.
N.1993a. Identification of the four human malaria parasite species in field
samples by the polymerase chain reaction and detection of a high prevalence of
mixed infection. Mol. Biochem. Parasitol., 58: 283-92.
SNOUNNOU, G.; VIRIYAKOSOL S.; Z.H.U.; X. P.; JARRA, W.; PINHEIRO, L.;
ROSÁRIO, V. E.; THAITHONG, S.; BROWN, K. N. 1993b. High sensitivity of
detection of human malaria parasites by the use of nested polymerase chain
reaction. Mol. Bioch. Parasitol., 1: 315-20.
STRINGER, P.; ANDREWS, L. S. 1988. Histórico da Malária. São Paulo, p. 45-
48.
SUCEN - SUPERINTENDÊNCIA DE CONTROLE DE ENDEMIAS. 1993.
Relatório de foco de Malária, Engenheiro Ferraz. São Paulo.
SUCEN - SUPERINTENDÊNCIA DE CONTROLE DE ENDEMIAS. 1995.
Avaliação do Programa de Controle de Malária. Estado de São Paulo - período
de 1992 a 1994. São Paulo.
SUCEN - SUPERINTENDÊNCIA DE CONTROLE DE ENDEMIAS. 2009.
Disponível em: http://www.sucen.sp.gov.br/doencas/index.htm. Acesso em:
23/03/2009. São Paulo, SP.
VOORHAM, J.; VAN OS, N.; VAN DER KAAY, H.J. 1993. Reappearance of
Plasmodium malariae in Suriname? Trans. Roy. Soc. Trop. Med. Hyg., 87: 243-
44.
WIN, T.T.; LIN, K.; MIZUNO, S.; ZHOU, M.; LIU, Q.; FERREIRA, M.U.;
TANTULAR, I.S.; KOJIMA, S.; ISHII, A.; KAWAMOTO, F. 2002. Wide distribution
of Plasmodium ovale in Myanmar. Trop. Med. Int. Health, 7 (3): 231-239.
ZAVORTINK, T.J. 1973. Mosquito studies (Diptera, Culicidae). XXIX. A review of
the subgenus Kerteszia of Anopheles. Contrib. Am. Entomol. Inst. (Ann Arbor),
9: 1-54.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

282
UNISA - Universidade de Santo Amaro

________________________________________________________________
Sem notas de rodapé

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

283
UNISA - Universidade de Santo Amaro

LEVAMENTO DE PLANTAS MEDICINAIS UTILIZADAS PELA


COMUNIDADE DO JARDIM CAMPESTRE, EMBÚ-GUAÇÚ, SP
VAGNER FRANCISCO LUCIANO DE SOUZA(1)

MARCO AURELIO SIVERO MAYWORM(2)(Orientadores)


Ciências Biológicas
INTRODUÇÃO:
Desde os mais antigos tempos, os seres humanos utilizam plantas e outros
meios naturais para curar doenças e cicatrizar ferimentos. Muitas civilizações
passadas têm suas próprias referências históricas às plantas medicinais.
Nos documentos mais remotos a fitoterapia era vista como “presente dos
deuses” e estava ligada a magia. No que diz respeito à documentação escrita
do uso das plantas como remédio, a primeira menção é encontrada na obra
chinesa Pen Ts´ao ou “A Grande Fitoterapia” de Shen Nung, em 2800 a.C.
contando mais de 360 espécies, incluindo Ephedra sinica, usada até hoje como
fonte de efedrina (ELDIN & DUNFORD, 2000).
As plantas pelas suas propriedades terapêuticas ou tóxicas adquiriram uma
fundamental importância na medicina popular e devido a isto se tornaram objeto
de estudo na tentativa de descobrir novas fontes de princípios ativos. Mesmo
com grandes descobertas existentes, medicamentos industrializados e a
tecnologia atual, diversas comunidades, principalmente as mais afastadas das
áreas urbanas, ainda utilizam as plantas medicinais como fontes alternativas
para cura seus males.
Em 2300 a.C., os egípcios, assírios e hebreus já cultivavam diversas ervas e
chegavam a criar purgantes, vermífugos, diuréticos, cosméticos e especiarias
para a cozinha, além de líquidos e gomas utilizadas no embalsamento de
múmias (MARTINS et al., 1995).
Assírios elaboravam águas aromáticas, tinturas e ungüentos, enquanto os
hebreus que conheciam muitos segredos das ervas medicinais, empregavam
em seus rituais religiosos e sacrifícios, plantas como a mirra da qual se obtinha
o incenso.
Os árabes deram também grande contribuição na área médica e na difusão de
diversas plantas medicinais na costa do mediterrâneo, desenvolvendo intensas
pesquisas que resultaram em vastos conhecimentos na farmacopéia de todos
os tempo. Dentre os principais médicos árabes estão Avicena (978-1037), que
se tornou mais famoso como médico, que Hipocrates e Galeno.
Já Na Idade Média, a medicina e o conhecimento sofreram um longo período
de estagnação. Na época as obras de Dioscórides, Columela, Galeno e Plínio
eram consultas obrigatórias, ocorrendo ainda o emprego da medicina dos
signos que postulava a cura de determinadas partes do corpo por meio das
plantas, que lhe fossem semelhantes.

12º Congresso de Iniciação Científica, 6ª mostra de Pós-Graduação

284
UNISA - Universidade de Santo Amaro

Os primeiros europeus que chegaram ao Brasil depararam com uma grande


quantidade de plantas medicinais em uso pelas inúmeras tribos que aqui viviam.
Por intermédio dos pajés, o c