1ª Lista de Exercícios

Natureza e Função do Material Genético

1) Num organismo diplóide um pesquisador verificou que uma molécula de DNA continha 22% de GUANINA. Com base nesta informação determine qual o percentual de cada uma das outras bases. 2) Se o conteúdo de AT em uma molécula de DNA é de 36%, quais são os conteúdos de todas as bases? 3) Explique porque no experimento de Avery e colegas, o material tratado com DNAse não produziu colônias patogênicas. 4) Um vírus, cujo material consiste de uma fita de RNA, tem aproximadamente 22% de seus RNA nucleotídeos consistindo de URACIL. Qual é a frequência de ADENINA? 5) Se um RNAm sintético conter 35% de ADENINA e 65% de GUANINA posicionados ao longo do polinucleotídeo, que aminoácidos são esperados para serem incorporados no polipeptídeo e em que proporções? 6) É preparado um extrato celular com células pnemocócicas patogênicas. Que efeito terá a mistura desta cultura comum a de pnemococus não patogênicos se a primeira for submetida a tratamento com: a) Protease? b) RNAse? c) DNAse? 7) Que propriedades químicas possuem o DNA e as proteínas que permitem a marcação específica de uma ou outra destas macromoléculas com um isótopo radioativo? 8) Qual a contribuição do experimento realizado por Hershey e Chase para a Genética? Como o objetivo foi alcançado? 9) Considere uma partícula viral contendo uma molécula de 200.000 pb (pares de bases): a) Quantos nucleotídeos devem estar presentes? b) E quantos átomos de fósforo?

10) Foi demonstrado experimentalmente que a maioria das sequências altamente repetitivas de DNA de cromossomos eucariotos não são transcritas. O que isto indica a respeito da função deste tipo de DNA? 11) O que você entende por “orientação anti-paralela” das fitas de DNA? 12) Os ácidos nucleicos são constituídos por cadeias polinucleotídicas. Descreva resumidamente este tipo de composto. 13) Cite as principais diferenças entre RNA e DNA quanto à estrutura de nucleotídeos? 14) Quais as principais características da molécula de DNA? 15) Explique o que é e porque ocorre a complementariedade de bases nitrogenadas. 16) Se uma fita de desoxirribonuclease tiver 5’ATAAGCGTTAG 3’, como será a molécula de DNA? constituição

17) O DNA do fungo Neurospora crassa tem um conteúdo de A + T de 37%. Qual o conteúdo de cada uma das bases? 18) O DNA da bactéria “Bacillus hipoteticus” tem um conteúdo de T + C de 46%. Qual o conteúdo de cada uma das quatro bases? 19) Porque surgem os fragmentos de Okasaki? 20) Qual a importância do empacotamento do DNA e como ele se processa? 21) O isótopo radioativo do nitrogênio N15 pode ser usado para marcar radioativamente compostos que possuam nitrogênio na sua composição, como é o caso dos ácidos nucleicos. Uma cultura de Escherichia coli cresceu em um meio contendo exclusivamente N15 até que todo o DNA estivesse marcado. Então transferiu-se a colônia para um meio contendo nitrogênio comum N14 e deixou-se que crescesse por, exatamente, duas gerações. Fazendo-se então uma avaliação do DNA, quanto deveria ser encontrado contendo: a) Somente N15? b) Híbrido (uma fita N14 e outra N15)? c) Somente N14?

atividade genética.a) Haverá formação de células patogênicas. isto é. AGG . Porque a DNAse destrói o DNA da bactéria patogênica não permitindo que a bactéria apatogênica incorporasse o DNA da bactéria patogênica e se transformasse em bactéria patogênica.96%. A = 28%. O DNA é rico em fósforo mas não possui enxofre. portando. na mesma extremidade da outra será encontrado o radical oxidrila (da posição 3’). GGA . GAA 7.28%. 5. b) Idem.14. 8. Conseguiram demonstrar que apenas o DNA penetra na célula infectada sendo transmitido à geração viral descendente.78%.78%.96%. GAG .14. A = 18%. T = 18%. enquanto que as proteínas são ricas em enxofre e não possuem fósforo. 4. Que não codificam nenhum polipeptídeo.14. 9.7. 6. Não se tem como determinar. 7. GGG . acompanhando a trajetória dos vários componentes virais marcados radioativamente em um processo normal de infecção. AAA . 3. não tendo. G = 32%. AGA . b) Idem. C = 22%. 10. . 11. uma vez que o RNA é simples fita não sendo as bases pareadas. se em uma extremidade de uma delas se encontrar o radical fosfato (que ocupa a posição 5’ do nucleotídeo). G = 22%. c) Haverá formação de células não patogênicas.a) 400.Respostas da 1ª Lista de Exercícios 1. AAG .78%.4.27.96%. T = 28%. C = 32%. 2. Significa que as duas cadeias polinucleotídicas de uma mesma molécula de DNA são invertidas uma em relação à outra. Comprovaram que o material que possui atividade genética é o DNA.000.7.46%.

19. G = 31. embora a replicação ocorra de modo bidirecional. Porque. 15.12. tendo perdido a oxidrila da posição 2’. c) 50%. 16. O empacotamento é necessário para permitir que moléculas extremamente longas consigam caber em espaço exíguo (núcleo). b) 50%. 5’ ATAAGCGTTAG 3’ 3’ TATTCGCAATC 5’ 17.5%. com a participação das histonas. Deste modo. originando a dupla hélice.a) Nenhum. superespiralização da cadeia de nucleossomos. 21. A pentose do RNA é uma ribose enquanto que a do DNA é uma desoxiribose. T = 18. na posição 3’ da pentose encontra-se uma oxidrila e na posição 5’ um fosfato.5%.5%. 18. A = 18. Cada nucleotídeo é constituído por uma base cíclica nitrogenada ligada a uma pentose. formação de nucleossomos. Tal especificidade é provocada pela habilidade de formação de pontes de hidrogênio (duas entre T e A e três entre C e G). A união dos vários nucleotídeos entre si é promovida por ligações fosfodiéster entre a oxidrila 3’ de um nucleotídeo e o grupamento fosfato 5’ do seguinte. No RNA encontra-se a pirimidina uracil que no RNA é substituída pela timina. 20. as DNApolimerases conseguem sintetizar apenas no sentido 5’ → 3’. . formando uma dupla hélice. A união das bases entre as duas fitas de DNA é sempre específica ocorrendo os pareamentos C-G e T-A. 14.5%. É constituída por duas cadeias polinucleotídicas complementares uma à outra orientadas antiparalelamente espiraladas para a direita. Não é possível determinar uma vez que T e C não são complementares. 13. o crescimento total 3’ → 5’ ocorre pela síntese de pequenos fragmentos 5’ → 3’ denominados fragmentos de Okasaki. Ocorre em três etapas: espirilização das duas fitas. C = 31.

enquanto que em mamíferos é de 45 nucleotídeos.2ª Lista de Exercícios Síntese Proteica 1) Quais as principais diferenças entre a replicação. transcrição e a tradução de procariontes e eucariontes? 2) Considere o segmento de fita de DNA abaixo: 3' AAAGAACGATGATTTCGGATT 5' a) Qual a sequência de bases do RNAm correspondente? b) Quantos tRNAs serão utilizados na síntese? c) Quais os anti-códons dos tRNAs acima considerados? d) Quantos aminoácidos poderão ser codificados? e) Qual a sequência de aminoácidos codificados? f) Considere que esta sequência sofra splicing e que os introns ocorram a cada 2 códons no hnRNA.ALA .LYS para LYS . quais seriam as respostas para as perguntas acima? 3) A taxa de replicação em bactérias corresponde a 450 nucleotídeos por segundo.MET .SER .ASN .LEU . que aminoácido seria codificado? 5) Uma única adição de nucleotídeos e uma deleção aproximadamente 15 pontos distantes do DNA causam a mudança na sequência de uma proteína de: LYS .HIST .VAL .ALA . Quais as conclusões que podemos retirar desta informação? 4) Assumindo a sequência de nucleotídeos no DNA: 3' GTC 5' 5' CAG 3' Onde GTC é a fita molde: a) Que aminoácido é codificado por esta trinca? b) Se uma mutação ocorresse e como consequência transformasse a adenina para a forma tautomérica na replicação.ALA .SER .LEU .HIST .LYS a) Quais as sequências de nucleotídeos do RNA velho e novo? b) Que tipo de RNA é? c) Qual o nucleotídeo que foi adicionado e qual foi deletado? 6) Explique o processo de excisão de introns ou "SPLICING": .PRO .ALA .

tanto na síntese de RNA quanto no processo de tradução do RNAm.PRO .LIS .TRP .CIS . Porque esta taxa não é maior? Explique: 11) Considere a sequência de bases nitrogenadas abaixo como parte de uma molécula de ácido nucleico: 5' UGA .CIS .GLU .VAL – LIS . de aproximadamente 1 em 10000 nucleotídeos.PRO . quais os aminoácidos que estariam presentes? 12) Como a transcrição é: a) Iniciada? b) Terminada? 13) Considerando-se a sequência de códons 5’ AUG CGA 3’ responda justificando: a) De que molécula do ácido nucleico faz parte? b) Qual o anti-códon correspondente? c) De que molécula a resposta b) faz parte? .7) É verdadeira a afirmação? "Existe 1 (um) códon e anti-códon específico para cada tRNA".TRP .ALA .AUG 3' a) De que ácido nucleico ela faz parte? b) Quais os outros ácidos nucleicos relacionados com tal sequência e suas respectivas bases nitrogenadas? c) Se da sequência dada resultar um segmento de proteína. para este gene.CIS . Isolando os produtos enzimáticos mutantes.GLY .HIST MUTANTE 2 . uma série de mutantes que não mostram atividade enzimática.PRO .ALA . você encontra as seguintes sequências: MUTANTE 1 . encontrarmos uma frequência de erro.GLU .HIST Qual a base molecular para cada mutação? Qual é a sequência de DNA que especifica esta parte da proteína? 10) É comum.ALA .LIS . Uma parte de sua sequência é: . na natureza. 8) Porque apenas 61 trincas (sequências de nucleotídeos) codificam aminoácidos? 9) Você está estudando em E.PRO MUTANTE 3 . coli um gene que especifica uma proteína.ARG .ALA .HIST Você obtém.

c) Após a deleção uma adição de timina após a sequência GG. 18) A fita não template (anti-sense) de um gene que tem a seguinte sequência: 5’ CCGGCTGATTTAGAAATGATGTTATATATAATATAATGTGCCCAATG 3’ Qual a constituição do polipeptídeo codificado por este gene? 19)Explique como o tRNA assegura a correta tradução de acordo com as leis do código genético. um intron de 5 e outro exon de 6. d) Como seria designado o resultado final? 21) Explique porque existem na natureza várias formas diferentes para um mesmo gene. 17) Discuta as principais características do código genético. qual a sequência de hnRNA? b) Dê o nucleotídeo da extremidade 5’ deste RNA. Forneça os peptídeos produzidos considerando as seguintes situações: a) A molécula original do DNA. . 20) Considerando o molde 3’ TACCGGAATTGC 5’. qual o mRNA correspondente se a fita template for 3’ ð 5’? 15) Moléculas de rRNA são relativamente estáveis. b) A deleção da segunda citosina. 16) Diga o que você sabe sobre as fitas sense e anti-sense do DNA. Discuta possíveis causas e consequências deste fato. enquanto que o mRNA é degradado rapidamente. c) Considerando que a molécula de DNA é constituída por um exon de 6 nucleotídeos.d) Qual a sequência template (sense ou molde) correspondente? e) E a não template? f) A que molécula as duas últimas respostas pertencem? 14) Em uma longa molécula de DNA isolou-se o seguinte segmento: 5’ ATCTTTAGGCTACAGGT 3’ 3’ TAGAAATCCGATGTCCA 5’ a) Se a fita sense for 5’ ð 3’.

Quais das seguintes substituições se espera serem induzidas com maior frequência? Explique: a) Met > Val b) Lis > Trp c) Lis > Gln d) Pro > Arg e) Pro > Gln 23) Estudando uma mutação sem sentido em Escherichia coli um pesquisador verificou que a cadeia polipeptídica era terminada na posição relativa ao triptofano na cadeia normal. Induzindo revertentes com agentes mutagênicos capazes de provocar substituições em um único par de bases cada um. cada um com diferente tipo de aminoácido na posição originalmente ocupada pelo triptofano: ser. thr. glu. gln e lis. o pesquisador encontrou 6 diferentes tipos de revertentes. UAA ou UGA? Porquê? . A mutação sem sentido estudada era UAG. leu.22) O 5 bromouracil é um mutágeno químico análogo à timina que se caracteriza por induzir transições.

LEU 3. 2.ARG . O tamanho da molécula de DNA de uma bactéria é menor e menos condensada que o DNA de um mamífero sendo que esta leva mais tempo para desenrolar a mesma quantidade de nucleotídeos que o DNA de procariotos.GCU . Tradução • Enzimas específicas de iniciação.a) GLN b) PRO 5. ocorrendo uma série de modificações do RNA antes que ele possa servir no início do processo (introns e exons). enlongamento e terminação próprios de procariotos.ARG .GCU .FEN . • Início em vários pontos no mesmo momento.Gabarito da 2ª Lista de Exercícios 1.UCA . PROCARIONTES Replicação • Realizada no nucleoplasma.CUU . • Enzimas específicas de iniciação.GLU .a) 5’ UUU CUU GCU ACU AAA GCC UAA 3’ b) 7 c) 3’ AAA GAA CGA UGA UUU CGG AUU 5’ d) 3 e) LIS . sendo em seguida utilizada na síntese de proteínas e posteriormente degradada.AGU . EUCARIONTES • Realizada no núcleo. enlongamento e terminação próprios de eucariotos. 4. • Desenrrolamento do DNA por atuação de enzimas em uma ponta.AAA .CCA . Transcriçã • A molécula de RNA se o constitui mo mRNA propriamente dito.a) velho: AAA . • É bem mais complexo.AAU .ASN .ILE fa) 5’ UUU UUA AAC CA 3’ fb) 3 fc) 3’ AAA AAU UUG 5’ fd) 3 fe) LIS .FIM .

CCA . A processividade é de alta fidelidade não formando a ligação se não tiver a base correta.AAA b) mRNA c) Deleção de A na segunda trinca de nucleptídeos e adição de G na sexta trina de nucleotídeos. Para cada um dos códons presentes em uma molécula de mRNA encontra-se uma molécula de tRNA com um único anti-códon complementar. Em vez disso.CAC . Caso pareie uma base incorreta há enzimas capazes de perceber este erro retirando a base que foi inserida erroneamente. embora cada aminoácido possa ter 1 a 4 anti-códons apropriados a ele.GUG .CCA .UGU . são reconhecidos pelos fatores de liberação de proteínas que promovem a ejecção das subunidades de ribossomos.3’ ACT TCA 5’.a) mRNA b) DNA molde .GUC . transversão no segundo par de bases) 10. 9.AAA .GCU .UGA (mutação de ponto . Porque 3 trincas UAA. Mutante 1: GCA .UGG . Sim.CAU (mutação de sentido errado com adição de uma trinca errada) Mutante 2: GCA .CAU . UGA. após sua síntese sofre um processamento no qual serão cortadas as sequências que não estarão no mRNA final (introns).GGG .AUG . Cada anti-códon é específico para um dado aminoácido. Portanto seu significado é exatamente o fim da síntese.UGU . UAG. 11. Devido aos mecanismos de reparo capazes de restabelecer a integridade do DNA. O mRNA produzido pela transição em eucariotos é uma molécula com muito mais ribonucleotídeos que o necessário para a síntese de uma proteína ou enzima. c) Fim .UUA . 8.GAA .CAU (mutação de ponto ocorrendo primeiro transversão no terceiro par de bases e.novo: AAA . 6.MET . codificam o fim da síntese denominados sem sentido e não codificam nenhum aminoácido. 7. assegurando o correto pareamento.AAA .transição) Mutante 3: GCA .GCU . segundo. Os segmentos de DNA transcritos que estarão efetivamente presentes no mRNA final são denominados exons. O hnRNA.CCA .

b) 5’ CAU 3’ e 5’ UCG 3’. o que significa que cada aminoácido pode ser codificado por mais de um códon.12. d) 5’ TCGCAT 3’. 16. isto é.a) mRNA. a correspondência corretamente sequenciada. enquanto que uma determinada molécula de mRNA só é necessária para a síntese de um determinado peptídeo. f) DNA. A fita “sense” é a fita da molécula de DNA que serve de molde para a síntese de mRNA. 19. b) A RNA polimerase reconhece uma sequência de terminação no DNA. 15. É degenerado. . de acordo com a sequência de códons presentes no mRNA.ASP . desconectando-se deste 13. mas genes diferentes podem ser copiados de diferentes fitas da mesma molécula.a) A RNA polimerase reconhece e acopla-se à sequência promotora do DNA. Deste modo. mas existem sinais específicos de início e fim de tradução (dois códons de iniciação e três de determinação).LEU .ISO .ISO. A sua degradação impede o acumulo excessivo tanto do próprio mRNA como também do seu produto específico. Não existe qualquer tipo de separação entre códons contíguos nem sobreposições. O tRNA apresenta especificidade tanto para o aminoácido como para o códon. PRO . 17. e) 5’ ATGCGA 3’. c) tRNA. sendo complementar e antiparalelo.GLU .ALA . b) uracil. c) 5’ UAGAAAUGUCCA 3’. garante a inserção correta do aminoácido na cadeia polipeptídica.MET . a) 5’ UGGACAUCGGAUUUCUA 3’. O código genético assegura a colinearidade de informações entre a molécula de DNA e a cadeia polipeptídica. Cada gene usa sempre a mesma fita como “sense” ou “template”. no momento em que este for requerido pelo organismo.TYR .LEU . 18. mas não é ambíguo e é universal (cada códon codifica sempre o mesmo aminoácido. O RNA é necessário permanentemente na célula pois participa de todo e qualquer processo de síntese.MET . 14. mesmo em diferentes espécies).

ALA .LEU .20. 22. d) Mutação de sentido errado. surgem por mutação e são uma importante fonte de variabilidade e diversidade. assegurando uma maior probabilidade de sobrevivência entre as espécies. . 21. Apenas MET > VAL.a) MET .TRE.TRE. 23.LEU . c) MET . pois é a única situação que envolve transição.PRO .PRO. b) MET . As formas diferentes chamadas alelos. UAG. porque é o único terminador que com apenas uma alteração pode originar os seis aminoácidos.

coli. f) Mutação de localização desconhecida. c) Mutação no promotor impedindo o acoplamento da RNA polimerase. formulado por Jacob e Monod. b) As alterações ocorridas quando moléculas efetoras estão presentes. que regulam eficientemente a expressão de conjuntos de genes estruturais relacionados entre si são comuns em bactérias. inibindo o acoplamento do repressor à lactose. serve para explicar a regulação gênica das enzimas que degradam a lactose em E.3ª Lista de Exercícios Regulação Gênica 1) Porque o mecanismo do triptofano é dito negativo e da lactose é dito positivo? 2) O modelo do operon. 3) Considerando os operons lac e trp como modelos de indução e repressão. d) Mutação em lac i. impedindo a sua mutação. c) Uma mutação do tipo deleção de base nos genes estruturais (Z. 6) Diferencie repressores e indutores. e) Mutação sem sentido em lac y. d) Presença de glicose no meio celular. mas ausentes em eucariotos. . descreva: a) A condição mais frequente de cada um destes operons. Explique os efeitos de cada uma das mutações abaixo no operon lac da Escherichia coli: a) Mutação no operador. isto implica que estes não controlam a expressão de seus genes? Justifique. 4) Os operons. Y. um promotor ou um operador. respectivamente. 5) Uma mutação é uma alteração na sequência de nucleotídeos de um gene. b) Mutação em lac i (gene regulador). e) Uma mutação de sentido errado no primeiro gene estrutura. que impede a degradação de mRNA lac. A). impedindo a ligação do repressor. Explique o que ocorre se houvesse: a) A presença de triptofano no meio celular. b) Uma mutação do tipo substituição de bases silenciosa do gene operador (O).

7) O operon lac é responsável pela produção de enzimas que participam da reação metabólica de síntese de triptofano e é constituído por 5 genes estruturais. b) Na presença da galactose. Na ausência de triptofano ocorre síntese enzimática? Porquê? 8) Em Escherichia coli o operon da lactose compreende 3 genes estruturais: galk. cujos produtos estão envolvidos no metabolismo do açúcar galactose. . O seu gene regulador situa-se em um outro ponto do DNA. um operador que responde à um complexo repressor/co-repressor. Galr codifica um repressor e a galactose é um indutor do sistema. e um promotor. Descreva a sequência de processos: a) Na ausência da galactose. galt e gale.

Não há tradução nem transcrição. Os operons são sistemas de regulação que respondem a estímulos diretos do meio externo. Este perde a capacidade de se ligar ao operador. estabelece um complexo com o repressor. Trp . Nestes. uma vez que comportam reações metabólicas muito mais complexas. b) Lac . liberando assim o promotor. Isto impede o acoplamento da RNA polimerase. Y. e deste modo.O repressor sintetizado pelo gene regulador é inativo.a) No operon Lac seria indiferente. b) Haverá leitura dos genes Z. que comportam vários escalões de . Porque o operon só estará atilado na presença de lactose ou desactivado na presença de triptofano. sintetizada pelo gene regulador. se liga ao sítio operador. A lactose é indutora enquanto o triptofano é um repressor. 2. 4. o que é assegurado pelos chamados “circuitos pré programados de expressão gênica”.É induzido pela lactose que. ocorrendo transcrição e tradução. inativando-o. quando presente. inibindo o promotor. c) A lactose não será degradada pois haverá mutação de sentido errado não sendo formadas as enzimas Z. e) A lactose não será degradada. inibindo o promotor. que não aceita a ligação da RNA polimerase.Y. A e degradação da lactose pois tanto o códon mutante como o original codificam o mesmo aminoácido não alterando a leitura. Sendo eficientemente tamponados contra a maioria das influências externas os eucariotos não necessitam de mecanismos de resposta direta mas. Y. por outro lado. Trp . A. 3. d) O operon Lac não será ativado e não haverá produção das enzimas Z.a) Lac . também necessitam de sistemas de regulação gênica muito mais elaborados.O operon permanece inativado porque a proteína repressora. O complexo repressor/co-repressor ocupa o sítio operador. A. não há transcrição nem tradução. o que faz com que haja transcrição e subsequente síntese enzimática.O triptofano age como co-repressor que se liga ao repressor ativando-o. não sendo capaz de se ligar ao sítio operador do operon.Gabarito da 3ª Lista de Exercícios 1. Logo a RNA polimerase acopla-se ao promotor.

Sim porque se tratando de um operon reprimível. Repressor . impedindo sua ligação ao operador. f) Acumulo de mRNA na célula. d) Idem. deprimindo assim o operon.é uma proteína sintetizada pelos genes reguladores e é específica para cada operon. é o triptofano. e a regulação processa-se tanto a nível de transcrição como de processamento de hnRNA. neste caso. c) O operon nunca se expressa. 5. Indutor . uma vez presente. portanto. 7.genes. forma um complexo com o repressor. 6. A sua função é ligar-se ao sítio operador inibindo a expressão do operon. impedindo a sua ligação ao operador. Logo haverá o acoplamento da RNA polimerase e a consequente transcrição e tradução do operon.a) O operon expressa-se continuamente. sempre degradando lactose.a) Galr sintetiza o repressor que se liga ao operador. e) Ocorre síntese da beta-galactosidase. 8. a ativação sempre ocorre em cadeia. .é uma molécula efetora que atua nos sistemas de indução e. que não aceita a ligação da RNA polimerase e. não há expressão do operon pois não haverá transcrição nem tradução. a sua expressão é contínua a menos que esteja presente o co-repressor específico que. b) Como indutor. mas a cadeia da beta-galactosídeo permease é sintetizada apenas até o ponto da mutação e não há síntese de betagalactosídeo transacetilase. isto provoca a inibição do promotor. b) Idem. a galactose liga-se ao repressor sintetizado por galr.

Quais os genótipos das células filhas? 9) Quantos tipos diferentes de gametas serão produzidos pelos seguintes genótipos. com distrofia muscular (gene recessivo. ligado ao X).4ª Lista de Exercícios Divisão Celular e Alterações Cromossômicas 1) Imagine 2 planta de genótipo AA e aa. na prófase I e prófase II em uma espécie caracterizada pelo genoma 2n=6. XXY). Como você sintetizaria um triplóide de genótipo Aaa? Esquematize: 2) Estudando os cromossomos de um cão macho. Quais os genótipos das células filhas? 8) Uma célula de genótipo Aa sofre meiose. 6) Em uma espécie cujo número haplóide é 19 quantos dos elementos abaixo devem haver em cada célula: a) Cromátide na metáfase I? b) Cromossomos na anáfase mitótica? c) Cromátides na metáfase II? d) Cromossomos no final da telófase II? 7) Uma célula de genótipo Aa sofre mitose. 4) Quantos cromossomos há nas células do intestino na anáfase II? 5) Como você sintetizaria um pentapoliplóide (5n)? Esquematize. se todos os genes estiverem situados em cromossomos diferentes? a) AA b) Aa c) AaBB d) AaBb e) AABbCC f) AaBBCcddEe . Qual foi o erro que deu origem a esse animal? Em qual dos pais ocorreu este erro? Por quê? 3) Esquematize e compare as células germinativas. descobriu-se que ele tinha um cromossomo Y e dois cromossomos X (cariótipo 79. Seus pais eram normais e sem distrofia muscular.

12) Em que estágio do ciclo celular ocorre a replicação do DNA? 13) Existem 40 cromossomos nas células somáticas do rato. Quantos cromossomos devem ser encontrados em: a) Um monossômico? b) Um trissômico? c) Um tetrassômico? d) Um trissômico duplo? e) Um nulissômico? f) Um monoplóide (ou haplóide)? g) Um triplóide? h) Um tetraplóide? 16) Considerando um cromossomo normal com a sequência de bandeamento 12345678 determine o tipo de alteração e o provável esquema de pareamento com o homólogo normal em cada uma das situações abaixo: a) 12365478 b) 125678 c) 1234345678 d) 12345876 . Ab. Se a aveia comum é um hexaplóide desta mesma série. aB e ab em igual proporção. considerando que os loci A. B e C se encontram todos no mesmo cromossomo e não ocorrem mecanismos de recombinação? 11) Um indivíduo produz os gametas AB.10) Quantos e quais os tipos de gametas podem ser produzidos pelo seguinte genótipo heterozigoto AaBbCc. a) Quantos cromossomos um rato deve receber de sua mãe? b) Qual o número haplóide do rato? 14) A aveia abssínia parece ser um tetraplóide com 28 cromossomos. quantos cromossomos deve possuir? 15) O número haplóide de um certo organismo é 12. a) Qual o seu genótipo? b) Os genes A e B encontram-se no mesmo cromossomo? Justifique.

normal. quando um dos cromossomos 5 apresenta a falta de um segmento no seu braço curto ocorre uma anomalia conhecida como “cri du chat” e três cópias do braço curto levam à morte logo após o nascimento. 18) Classifique os arranjos cromossômicos simbolizados abaixo: a) n b) 2n c) 2n + 1 d) 2n − 1 e) 2n + 2 f) 3n g) 4n h) 2n + 1 + 1 i) 2n − 2 19) Suponha que parte do braço curto de um cromossomo 5 da espécie humana se ligue não reciprocamente ao braço longo do cromossomo 13.17) O cromossomo 1 da Drosophila possui a sequência gênica ABCDEF e o cromossomo 2 a sequência MNOPQR. portanto. Contudo. Este fenômeno é considerado uma translocação simples balanceada. Se uma pessoa portadora de translocação simples se casa com um companheiro normal. uma vez que todo o material genético está presente e o fenótipo é. Determine o tipo de alteração ocorrida e todas as possibilidades de segregação durante a gametogênese. considerando: a) As características cromossômicas. determine o resultado esperado. b) As características fenotípicas. Uma alteração cromossômica resultou nos arranjos ABCPQR e MNODEF. .

c) 2. f) 12. 14. que não ocorre em todas as células e as proporções seriam diferenciadas. 11. h) 48. No intestino não ocorre anáfase II. Cruzamento entre um 8n + 2n ou 4n + 6n. c) 26. Fase S. Para o macho. No intestino são células somáticas que sofrem apenas mitose e não meiose. b) 25. 6. a) 76. Ela pode ser heterozigota sendo fenotipicamenete normal. porque se estivessem no mesmo cromossomo a formação dos quatro tipos de gametas seria devida à ocorrência de permuta. basta a presença de apenas um gene recessivo para que manifeste a doença. 9. Se não ocorrer recombinação entre eles. b) 2. 4. O erro ocorreu na mãe onde houve ligação dos cromossomos que não se separaram durante a meiose. e) 2. c) 38. b) Não. permanecerão os mesmos cromossomos: ABC e abc. d) 19. 50% A e 50% a. 42. O pai só fornece Y não tendo como passar a distrofia.a) AaBb. 3. f) 8. 10. b) 20. 12. d) 4. b) 76. 15. 5. Mutação. 7.a) 23.a) 1. Prófase I: número de cromossomos = 6 e número de cromátides = 12. Prófase II: Número de cromossomos = 3 e número de cromátides = 6. Cruzamento entre AA e aa induzindo mutação nos genes aa (fazendo com que permaneçam ligados). e) 22. 13. Todos Aa 8. 2. . d) 26. g) 36. a) 20.Gabarito da 4ª Lista de Exercícios 1.

19. c) Trissomia. Translocação recíproca heterozigota.a) Características cromossômicas: 1 normal: 1 translocado simples balanceado: 1 portador de deleção heterozigoto do braço curto do cromossomo 5: 1 portador de duplicação heterozigota do braço curto do cromossomo 5. ABCDEF. d) Inversão terminal heterozigota. g) Tetraploidia. ABCDEF. Possíveis gametas: ABCDEF. MNODEF.a) Haploidia ou monoploidia. ABCPQR. f) Triploidia. i) Nulissomia. 17.16. e) Tetrassomia. b)1 “cri du chat”: 2 normais: 1 morte precoce.a) Inversão intercalar heterozigota. . 18. b) Deleção intercalar heterozigota. ABCPQR. b) Diploidia. MNODEF. MNOPQR. MNOPQR. c) Duplicação intercalar heterozigota. MNOPQR. MNODEF. d) Monossomia. MNOPQR. h) Dupla Trissomia.

Sign up to vote on this title
UsefulNot useful