1ª Lista de Exercícios

Natureza e Função do Material Genético

1) Num organismo diplóide um pesquisador verificou que uma molécula de DNA continha 22% de GUANINA. Com base nesta informação determine qual o percentual de cada uma das outras bases. 2) Se o conteúdo de AT em uma molécula de DNA é de 36%, quais são os conteúdos de todas as bases? 3) Explique porque no experimento de Avery e colegas, o material tratado com DNAse não produziu colônias patogênicas. 4) Um vírus, cujo material consiste de uma fita de RNA, tem aproximadamente 22% de seus RNA nucleotídeos consistindo de URACIL. Qual é a frequência de ADENINA? 5) Se um RNAm sintético conter 35% de ADENINA e 65% de GUANINA posicionados ao longo do polinucleotídeo, que aminoácidos são esperados para serem incorporados no polipeptídeo e em que proporções? 6) É preparado um extrato celular com células pnemocócicas patogênicas. Que efeito terá a mistura desta cultura comum a de pnemococus não patogênicos se a primeira for submetida a tratamento com: a) Protease? b) RNAse? c) DNAse? 7) Que propriedades químicas possuem o DNA e as proteínas que permitem a marcação específica de uma ou outra destas macromoléculas com um isótopo radioativo? 8) Qual a contribuição do experimento realizado por Hershey e Chase para a Genética? Como o objetivo foi alcançado? 9) Considere uma partícula viral contendo uma molécula de 200.000 pb (pares de bases): a) Quantos nucleotídeos devem estar presentes? b) E quantos átomos de fósforo?

10) Foi demonstrado experimentalmente que a maioria das sequências altamente repetitivas de DNA de cromossomos eucariotos não são transcritas. O que isto indica a respeito da função deste tipo de DNA? 11) O que você entende por “orientação anti-paralela” das fitas de DNA? 12) Os ácidos nucleicos são constituídos por cadeias polinucleotídicas. Descreva resumidamente este tipo de composto. 13) Cite as principais diferenças entre RNA e DNA quanto à estrutura de nucleotídeos? 14) Quais as principais características da molécula de DNA? 15) Explique o que é e porque ocorre a complementariedade de bases nitrogenadas. 16) Se uma fita de desoxirribonuclease tiver 5’ATAAGCGTTAG 3’, como será a molécula de DNA? constituição

17) O DNA do fungo Neurospora crassa tem um conteúdo de A + T de 37%. Qual o conteúdo de cada uma das bases? 18) O DNA da bactéria “Bacillus hipoteticus” tem um conteúdo de T + C de 46%. Qual o conteúdo de cada uma das quatro bases? 19) Porque surgem os fragmentos de Okasaki? 20) Qual a importância do empacotamento do DNA e como ele se processa? 21) O isótopo radioativo do nitrogênio N15 pode ser usado para marcar radioativamente compostos que possuam nitrogênio na sua composição, como é o caso dos ácidos nucleicos. Uma cultura de Escherichia coli cresceu em um meio contendo exclusivamente N15 até que todo o DNA estivesse marcado. Então transferiu-se a colônia para um meio contendo nitrogênio comum N14 e deixou-se que crescesse por, exatamente, duas gerações. Fazendo-se então uma avaliação do DNA, quanto deveria ser encontrado contendo: a) Somente N15? b) Híbrido (uma fita N14 e outra N15)? c) Somente N14?

96%. b) Idem. b) Idem. GAG .27. O DNA é rico em fósforo mas não possui enxofre. 7. 5.Respostas da 1ª Lista de Exercícios 1. Porque a DNAse destrói o DNA da bactéria patogênica não permitindo que a bactéria apatogênica incorporasse o DNA da bactéria patogênica e se transformasse em bactéria patogênica. T = 28%. GGG . na mesma extremidade da outra será encontrado o radical oxidrila (da posição 3’). .14. 6.a) 400. portando. 10. 11. 4. T = 18%. acompanhando a trajetória dos vários componentes virais marcados radioativamente em um processo normal de infecção.78%. C = 22%.7. AGA . Conseguiram demonstrar que apenas o DNA penetra na célula infectada sendo transmitido à geração viral descendente. atividade genética. se em uma extremidade de uma delas se encontrar o radical fosfato (que ocupa a posição 5’ do nucleotídeo).14. 9. 2.a) Haverá formação de células patogênicas.96%.14.000. isto é. A = 18%. GAA 7. uma vez que o RNA é simples fita não sendo as bases pareadas.46%.78%. 8. não tendo. AAG . Não se tem como determinar. 3. enquanto que as proteínas são ricas em enxofre e não possuem fósforo. A = 28%. C = 32%. GGA . Significa que as duas cadeias polinucleotídicas de uma mesma molécula de DNA são invertidas uma em relação à outra. Comprovaram que o material que possui atividade genética é o DNA.78%.96%. c) Haverá formação de células não patogênicas. AGG . Que não codificam nenhum polipeptídeo.7. AAA . G = 32%.28%. G = 22%.4.

No RNA encontra-se a pirimidina uracil que no RNA é substituída pela timina. 14. C = 31.5%. na posição 3’ da pentose encontra-se uma oxidrila e na posição 5’ um fosfato.a) Nenhum. Ocorre em três etapas: espirilização das duas fitas. . 20.12. o crescimento total 3’ → 5’ ocorre pela síntese de pequenos fragmentos 5’ → 3’ denominados fragmentos de Okasaki. 13. G = 31. 21. Deste modo. A = 18. b) 50%. embora a replicação ocorra de modo bidirecional. 18. O empacotamento é necessário para permitir que moléculas extremamente longas consigam caber em espaço exíguo (núcleo). 5’ ATAAGCGTTAG 3’ 3’ TATTCGCAATC 5’ 17. superespiralização da cadeia de nucleossomos. Porque. Cada nucleotídeo é constituído por uma base cíclica nitrogenada ligada a uma pentose. Não é possível determinar uma vez que T e C não são complementares. 15.5%. c) 50%. 16. formando uma dupla hélice. 19.5%. com a participação das histonas. É constituída por duas cadeias polinucleotídicas complementares uma à outra orientadas antiparalelamente espiraladas para a direita. Tal especificidade é provocada pela habilidade de formação de pontes de hidrogênio (duas entre T e A e três entre C e G). formação de nucleossomos.5%. as DNApolimerases conseguem sintetizar apenas no sentido 5’ → 3’. A união das bases entre as duas fitas de DNA é sempre específica ocorrendo os pareamentos C-G e T-A. T = 18. originando a dupla hélice. tendo perdido a oxidrila da posição 2’. A pentose do RNA é uma ribose enquanto que a do DNA é uma desoxiribose. A união dos vários nucleotídeos entre si é promovida por ligações fosfodiéster entre a oxidrila 3’ de um nucleotídeo e o grupamento fosfato 5’ do seguinte.

ASN .PRO .ALA . transcrição e a tradução de procariontes e eucariontes? 2) Considere o segmento de fita de DNA abaixo: 3' AAAGAACGATGATTTCGGATT 5' a) Qual a sequência de bases do RNAm correspondente? b) Quantos tRNAs serão utilizados na síntese? c) Quais os anti-códons dos tRNAs acima considerados? d) Quantos aminoácidos poderão ser codificados? e) Qual a sequência de aminoácidos codificados? f) Considere que esta sequência sofra splicing e que os introns ocorram a cada 2 códons no hnRNA.LYS para LYS .LEU . enquanto que em mamíferos é de 45 nucleotídeos.ALA .HIST .SER . Quais as conclusões que podemos retirar desta informação? 4) Assumindo a sequência de nucleotídeos no DNA: 3' GTC 5' 5' CAG 3' Onde GTC é a fita molde: a) Que aminoácido é codificado por esta trinca? b) Se uma mutação ocorresse e como consequência transformasse a adenina para a forma tautomérica na replicação.SER .ALA .HIST .VAL .MET . quais seriam as respostas para as perguntas acima? 3) A taxa de replicação em bactérias corresponde a 450 nucleotídeos por segundo.ALA .LEU .2ª Lista de Exercícios Síntese Proteica 1) Quais as principais diferenças entre a replicação. que aminoácido seria codificado? 5) Uma única adição de nucleotídeos e uma deleção aproximadamente 15 pontos distantes do DNA causam a mudança na sequência de uma proteína de: LYS .LYS a) Quais as sequências de nucleotídeos do RNA velho e novo? b) Que tipo de RNA é? c) Qual o nucleotídeo que foi adicionado e qual foi deletado? 6) Explique o processo de excisão de introns ou "SPLICING": .

GLY . Uma parte de sua sequência é: .7) É verdadeira a afirmação? "Existe 1 (um) códon e anti-códon específico para cada tRNA".TRP .LIS .HIST MUTANTE 2 .HIST Você obtém.PRO MUTANTE 3 .ARG .LIS . Isolando os produtos enzimáticos mutantes.GLU . de aproximadamente 1 em 10000 nucleotídeos. para este gene.ALA .CIS .CIS . quais os aminoácidos que estariam presentes? 12) Como a transcrição é: a) Iniciada? b) Terminada? 13) Considerando-se a sequência de códons 5’ AUG CGA 3’ responda justificando: a) De que molécula do ácido nucleico faz parte? b) Qual o anti-códon correspondente? c) De que molécula a resposta b) faz parte? .PRO .VAL – LIS .ALA .TRP . encontrarmos uma frequência de erro. Porque esta taxa não é maior? Explique: 11) Considere a sequência de bases nitrogenadas abaixo como parte de uma molécula de ácido nucleico: 5' UGA .ALA . tanto na síntese de RNA quanto no processo de tradução do RNAm. coli um gene que especifica uma proteína.PRO . 8) Porque apenas 61 trincas (sequências de nucleotídeos) codificam aminoácidos? 9) Você está estudando em E.CIS .PRO . uma série de mutantes que não mostram atividade enzimática.HIST Qual a base molecular para cada mutação? Qual é a sequência de DNA que especifica esta parte da proteína? 10) É comum.GLU . você encontra as seguintes sequências: MUTANTE 1 .ALA .AUG 3' a) De que ácido nucleico ela faz parte? b) Quais os outros ácidos nucleicos relacionados com tal sequência e suas respectivas bases nitrogenadas? c) Se da sequência dada resultar um segmento de proteína. na natureza.

qual a sequência de hnRNA? b) Dê o nucleotídeo da extremidade 5’ deste RNA. um intron de 5 e outro exon de 6. enquanto que o mRNA é degradado rapidamente. 18) A fita não template (anti-sense) de um gene que tem a seguinte sequência: 5’ CCGGCTGATTTAGAAATGATGTTATATATAATATAATGTGCCCAATG 3’ Qual a constituição do polipeptídeo codificado por este gene? 19)Explique como o tRNA assegura a correta tradução de acordo com as leis do código genético. c) Após a deleção uma adição de timina após a sequência GG. 17) Discuta as principais características do código genético. d) Como seria designado o resultado final? 21) Explique porque existem na natureza várias formas diferentes para um mesmo gene. 16) Diga o que você sabe sobre as fitas sense e anti-sense do DNA. .d) Qual a sequência template (sense ou molde) correspondente? e) E a não template? f) A que molécula as duas últimas respostas pertencem? 14) Em uma longa molécula de DNA isolou-se o seguinte segmento: 5’ ATCTTTAGGCTACAGGT 3’ 3’ TAGAAATCCGATGTCCA 5’ a) Se a fita sense for 5’ ð 3’. c) Considerando que a molécula de DNA é constituída por um exon de 6 nucleotídeos. b) A deleção da segunda citosina. Forneça os peptídeos produzidos considerando as seguintes situações: a) A molécula original do DNA. qual o mRNA correspondente se a fita template for 3’ ð 5’? 15) Moléculas de rRNA são relativamente estáveis. 20) Considerando o molde 3’ TACCGGAATTGC 5’. Discuta possíveis causas e consequências deste fato.

Induzindo revertentes com agentes mutagênicos capazes de provocar substituições em um único par de bases cada um. o pesquisador encontrou 6 diferentes tipos de revertentes. A mutação sem sentido estudada era UAG. UAA ou UGA? Porquê? . gln e lis. Quais das seguintes substituições se espera serem induzidas com maior frequência? Explique: a) Met > Val b) Lis > Trp c) Lis > Gln d) Pro > Arg e) Pro > Gln 23) Estudando uma mutação sem sentido em Escherichia coli um pesquisador verificou que a cadeia polipeptídica era terminada na posição relativa ao triptofano na cadeia normal. leu. glu.22) O 5 bromouracil é um mutágeno químico análogo à timina que se caracteriza por induzir transições. cada um com diferente tipo de aminoácido na posição originalmente ocupada pelo triptofano: ser. thr.

a) velho: AAA .ARG . • Desenrrolamento do DNA por atuação de enzimas em uma ponta.ARG . ocorrendo uma série de modificações do RNA antes que ele possa servir no início do processo (introns e exons). 2. Transcriçã • A molécula de RNA se o constitui mo mRNA propriamente dito.GCU . • É bem mais complexo.a) 5’ UUU CUU GCU ACU AAA GCC UAA 3’ b) 7 c) 3’ AAA GAA CGA UGA UUU CGG AUU 5’ d) 3 e) LIS . • Enzimas específicas de iniciação.CUU . Tradução • Enzimas específicas de iniciação. 4. O tamanho da molécula de DNA de uma bactéria é menor e menos condensada que o DNA de um mamífero sendo que esta leva mais tempo para desenrolar a mesma quantidade de nucleotídeos que o DNA de procariotos. enlongamento e terminação próprios de eucariotos.AGU . PROCARIONTES Replicação • Realizada no nucleoplasma.GCU .ASN .AAA . enlongamento e terminação próprios de procariotos.CCA .Gabarito da 2ª Lista de Exercícios 1.GLU .a) GLN b) PRO 5.AAU .LEU 3.ILE fa) 5’ UUU UUA AAC CA 3’ fb) 3 fc) 3’ AAA AAU UUG 5’ fd) 3 fe) LIS .FEN . • Início em vários pontos no mesmo momento.UCA . EUCARIONTES • Realizada no núcleo.FIM . sendo em seguida utilizada na síntese de proteínas e posteriormente degradada.

Devido aos mecanismos de reparo capazes de restabelecer a integridade do DNA. O mRNA produzido pela transição em eucariotos é uma molécula com muito mais ribonucleotídeos que o necessário para a síntese de uma proteína ou enzima.CCA . c) Fim .GAA . A processividade é de alta fidelidade não formando a ligação se não tiver a base correta.CAU (mutação de ponto ocorrendo primeiro transversão no terceiro par de bases e.a) mRNA b) DNA molde .MET .CAU (mutação de sentido errado com adição de uma trinca errada) Mutante 2: GCA .UGU . Portanto seu significado é exatamente o fim da síntese. após sua síntese sofre um processamento no qual serão cortadas as sequências que não estarão no mRNA final (introns).transição) Mutante 3: GCA .novo: AAA . codificam o fim da síntese denominados sem sentido e não codificam nenhum aminoácido. 8.GCU . Para cada um dos códons presentes em uma molécula de mRNA encontra-se uma molécula de tRNA com um único anti-códon complementar.UGA (mutação de ponto .AAA .3’ ACT TCA 5’. UGA. 6. Cada anti-códon é específico para um dado aminoácido. segundo.UGG . Em vez disso.GGG . 9.UGU .CAU .UUA . Mutante 1: GCA . 11. assegurando o correto pareamento.GCU . Caso pareie uma base incorreta há enzimas capazes de perceber este erro retirando a base que foi inserida erroneamente.CCA .AAA b) mRNA c) Deleção de A na segunda trinca de nucleptídeos e adição de G na sexta trina de nucleotídeos.AUG . UAG. Sim.GUG . embora cada aminoácido possa ter 1 a 4 anti-códons apropriados a ele. 7.CAC .GUC . O hnRNA. Os segmentos de DNA transcritos que estarão efetivamente presentes no mRNA final são denominados exons.AAA .CCA . são reconhecidos pelos fatores de liberação de proteínas que promovem a ejecção das subunidades de ribossomos. Porque 3 trincas UAA. transversão no segundo par de bases) 10.

. 14. c) 5’ UAGAAAUGUCCA 3’. 17.LEU . mas não é ambíguo e é universal (cada códon codifica sempre o mesmo aminoácido. c) tRNA. a) 5’ UGGACAUCGGAUUUCUA 3’.ISO . A fita “sense” é a fita da molécula de DNA que serve de molde para a síntese de mRNA. garante a inserção correta do aminoácido na cadeia polipeptídica.ASP . e) 5’ ATGCGA 3’. PRO . A sua degradação impede o acumulo excessivo tanto do próprio mRNA como também do seu produto específico. de acordo com a sequência de códons presentes no mRNA.MET . Deste modo. 18. a correspondência corretamente sequenciada. Não existe qualquer tipo de separação entre códons contíguos nem sobreposições. É degenerado. Cada gene usa sempre a mesma fita como “sense” ou “template”. sendo complementar e antiparalelo. b) uracil. O RNA é necessário permanentemente na célula pois participa de todo e qualquer processo de síntese. 16. isto é. 15. 19.a) A RNA polimerase reconhece e acopla-se à sequência promotora do DNA. mas genes diferentes podem ser copiados de diferentes fitas da mesma molécula.12.TYR . d) 5’ TCGCAT 3’. o que significa que cada aminoácido pode ser codificado por mais de um códon. no momento em que este for requerido pelo organismo. O tRNA apresenta especificidade tanto para o aminoácido como para o códon. enquanto que uma determinada molécula de mRNA só é necessária para a síntese de um determinado peptídeo. mas existem sinais específicos de início e fim de tradução (dois códons de iniciação e três de determinação).a) mRNA.MET . b) A RNA polimerase reconhece uma sequência de terminação no DNA. b) 5’ CAU 3’ e 5’ UCG 3’.LEU .ALA . mesmo em diferentes espécies). desconectando-se deste 13.GLU .ISO. O código genético assegura a colinearidade de informações entre a molécula de DNA e a cadeia polipeptídica. f) DNA.

ALA . 21.LEU . 22. b) MET .20.TRE. UAG.a) MET . Apenas MET > VAL. surgem por mutação e são uma importante fonte de variabilidade e diversidade. As formas diferentes chamadas alelos.TRE. 23. assegurando uma maior probabilidade de sobrevivência entre as espécies. porque é o único terminador que com apenas uma alteração pode originar os seis aminoácidos.PRO. c) MET .PRO . . d) Mutação de sentido errado.LEU . pois é a única situação que envolve transição.

descreva: a) A condição mais frequente de cada um destes operons. e) Uma mutação de sentido errado no primeiro gene estrutura. e) Mutação sem sentido em lac y. 4) Os operons. b) Mutação em lac i (gene regulador). Y. inibindo o acoplamento do repressor à lactose. respectivamente. que regulam eficientemente a expressão de conjuntos de genes estruturais relacionados entre si são comuns em bactérias. . d) Mutação em lac i. 3) Considerando os operons lac e trp como modelos de indução e repressão. um promotor ou um operador. serve para explicar a regulação gênica das enzimas que degradam a lactose em E. isto implica que estes não controlam a expressão de seus genes? Justifique. 5) Uma mutação é uma alteração na sequência de nucleotídeos de um gene.3ª Lista de Exercícios Regulação Gênica 1) Porque o mecanismo do triptofano é dito negativo e da lactose é dito positivo? 2) O modelo do operon. que impede a degradação de mRNA lac. impedindo a ligação do repressor. 6) Diferencie repressores e indutores. d) Presença de glicose no meio celular. mas ausentes em eucariotos. c) Uma mutação do tipo deleção de base nos genes estruturais (Z. b) As alterações ocorridas quando moléculas efetoras estão presentes. b) Uma mutação do tipo substituição de bases silenciosa do gene operador (O). Explique os efeitos de cada uma das mutações abaixo no operon lac da Escherichia coli: a) Mutação no operador. Explique o que ocorre se houvesse: a) A presença de triptofano no meio celular. impedindo a sua mutação. coli. f) Mutação de localização desconhecida. formulado por Jacob e Monod. c) Mutação no promotor impedindo o acoplamento da RNA polimerase. A).

O seu gene regulador situa-se em um outro ponto do DNA. um operador que responde à um complexo repressor/co-repressor. Na ausência de triptofano ocorre síntese enzimática? Porquê? 8) Em Escherichia coli o operon da lactose compreende 3 genes estruturais: galk. galt e gale. e um promotor. Galr codifica um repressor e a galactose é um indutor do sistema.7) O operon lac é responsável pela produção de enzimas que participam da reação metabólica de síntese de triptofano e é constituído por 5 genes estruturais. . Descreva a sequência de processos: a) Na ausência da galactose. b) Na presença da galactose. cujos produtos estão envolvidos no metabolismo do açúcar galactose.

c) A lactose não será degradada pois haverá mutação de sentido errado não sendo formadas as enzimas Z. Trp . liberando assim o promotor. estabelece um complexo com o repressor. que não aceita a ligação da RNA polimerase. 3. Os operons são sistemas de regulação que respondem a estímulos diretos do meio externo. sintetizada pelo gene regulador. d) O operon Lac não será ativado e não haverá produção das enzimas Z. o que faz com que haja transcrição e subsequente síntese enzimática. o que é assegurado pelos chamados “circuitos pré programados de expressão gênica”. Sendo eficientemente tamponados contra a maioria das influências externas os eucariotos não necessitam de mecanismos de resposta direta mas.É induzido pela lactose que. também necessitam de sistemas de regulação gênica muito mais elaborados. inibindo o promotor. não há transcrição nem tradução. Isto impede o acoplamento da RNA polimerase. Nestes. 2. b) Lac . O complexo repressor/co-repressor ocupa o sítio operador. Porque o operon só estará atilado na presença de lactose ou desactivado na presença de triptofano. ocorrendo transcrição e tradução. Y. A. Trp . 4. A lactose é indutora enquanto o triptofano é um repressor. Este perde a capacidade de se ligar ao operador.Gabarito da 3ª Lista de Exercícios 1.O triptofano age como co-repressor que se liga ao repressor ativando-o. A e degradação da lactose pois tanto o códon mutante como o original codificam o mesmo aminoácido não alterando a leitura.Y. não sendo capaz de se ligar ao sítio operador do operon. se liga ao sítio operador. e) A lactose não será degradada.O operon permanece inativado porque a proteína repressora. e deste modo. inibindo o promotor.a) No operon Lac seria indiferente. b) Haverá leitura dos genes Z. por outro lado. Não há tradução nem transcrição. inativando-o. A. que comportam vários escalões de . quando presente. Y.a) Lac . uma vez que comportam reações metabólicas muito mais complexas. Logo a RNA polimerase acopla-se ao promotor.O repressor sintetizado pelo gene regulador é inativo.

uma vez presente. e a regulação processa-se tanto a nível de transcrição como de processamento de hnRNA. impedindo sua ligação ao operador. deprimindo assim o operon.a) Galr sintetiza o repressor que se liga ao operador. A sua função é ligar-se ao sítio operador inibindo a expressão do operon. mas a cadeia da beta-galactosídeo permease é sintetizada apenas até o ponto da mutação e não há síntese de betagalactosídeo transacetilase. isto provoca a inibição do promotor. Indutor . Sim porque se tratando de um operon reprimível. que não aceita a ligação da RNA polimerase e. 7. impedindo a sua ligação ao operador.é uma proteína sintetizada pelos genes reguladores e é específica para cada operon. 6. f) Acumulo de mRNA na célula. . a galactose liga-se ao repressor sintetizado por galr.a) O operon expressa-se continuamente. Logo haverá o acoplamento da RNA polimerase e a consequente transcrição e tradução do operon.genes.é uma molécula efetora que atua nos sistemas de indução e. Repressor . 8. sempre degradando lactose. 5. a sua expressão é contínua a menos que esteja presente o co-repressor específico que. b) Idem. d) Idem. e) Ocorre síntese da beta-galactosidase. neste caso. não há expressão do operon pois não haverá transcrição nem tradução. portanto. é o triptofano. b) Como indutor. c) O operon nunca se expressa. forma um complexo com o repressor. a ativação sempre ocorre em cadeia.

XXY). Como você sintetizaria um triplóide de genótipo Aaa? Esquematize: 2) Estudando os cromossomos de um cão macho. na prófase I e prófase II em uma espécie caracterizada pelo genoma 2n=6. com distrofia muscular (gene recessivo. Qual foi o erro que deu origem a esse animal? Em qual dos pais ocorreu este erro? Por quê? 3) Esquematize e compare as células germinativas. Seus pais eram normais e sem distrofia muscular. 4) Quantos cromossomos há nas células do intestino na anáfase II? 5) Como você sintetizaria um pentapoliplóide (5n)? Esquematize. descobriu-se que ele tinha um cromossomo Y e dois cromossomos X (cariótipo 79. Quais os genótipos das células filhas? 9) Quantos tipos diferentes de gametas serão produzidos pelos seguintes genótipos. se todos os genes estiverem situados em cromossomos diferentes? a) AA b) Aa c) AaBB d) AaBb e) AABbCC f) AaBBCcddEe . Quais os genótipos das células filhas? 8) Uma célula de genótipo Aa sofre meiose.4ª Lista de Exercícios Divisão Celular e Alterações Cromossômicas 1) Imagine 2 planta de genótipo AA e aa. 6) Em uma espécie cujo número haplóide é 19 quantos dos elementos abaixo devem haver em cada célula: a) Cromátide na metáfase I? b) Cromossomos na anáfase mitótica? c) Cromátides na metáfase II? d) Cromossomos no final da telófase II? 7) Uma célula de genótipo Aa sofre mitose. ligado ao X).

quantos cromossomos deve possuir? 15) O número haplóide de um certo organismo é 12. 12) Em que estágio do ciclo celular ocorre a replicação do DNA? 13) Existem 40 cromossomos nas células somáticas do rato. Quantos cromossomos devem ser encontrados em: a) Um monossômico? b) Um trissômico? c) Um tetrassômico? d) Um trissômico duplo? e) Um nulissômico? f) Um monoplóide (ou haplóide)? g) Um triplóide? h) Um tetraplóide? 16) Considerando um cromossomo normal com a sequência de bandeamento 12345678 determine o tipo de alteração e o provável esquema de pareamento com o homólogo normal em cada uma das situações abaixo: a) 12365478 b) 125678 c) 1234345678 d) 12345876 . a) Quantos cromossomos um rato deve receber de sua mãe? b) Qual o número haplóide do rato? 14) A aveia abssínia parece ser um tetraplóide com 28 cromossomos. a) Qual o seu genótipo? b) Os genes A e B encontram-se no mesmo cromossomo? Justifique. aB e ab em igual proporção.10) Quantos e quais os tipos de gametas podem ser produzidos pelo seguinte genótipo heterozigoto AaBbCc. B e C se encontram todos no mesmo cromossomo e não ocorrem mecanismos de recombinação? 11) Um indivíduo produz os gametas AB. Ab. Se a aveia comum é um hexaplóide desta mesma série. considerando que os loci A.

b) As características fenotípicas. Este fenômeno é considerado uma translocação simples balanceada. quando um dos cromossomos 5 apresenta a falta de um segmento no seu braço curto ocorre uma anomalia conhecida como “cri du chat” e três cópias do braço curto levam à morte logo após o nascimento. . Se uma pessoa portadora de translocação simples se casa com um companheiro normal.17) O cromossomo 1 da Drosophila possui a sequência gênica ABCDEF e o cromossomo 2 a sequência MNOPQR. determine o resultado esperado. portanto. considerando: a) As características cromossômicas. 18) Classifique os arranjos cromossômicos simbolizados abaixo: a) n b) 2n c) 2n + 1 d) 2n − 1 e) 2n + 2 f) 3n g) 4n h) 2n + 1 + 1 i) 2n − 2 19) Suponha que parte do braço curto de um cromossomo 5 da espécie humana se ligue não reciprocamente ao braço longo do cromossomo 13. Determine o tipo de alteração ocorrida e todas as possibilidades de segregação durante a gametogênese. Uma alteração cromossômica resultou nos arranjos ABCPQR e MNODEF. uma vez que todo o material genético está presente e o fenótipo é. normal. Contudo.

porque se estivessem no mesmo cromossomo a formação dos quatro tipos de gametas seria devida à ocorrência de permuta. Se não ocorrer recombinação entre eles. a) 76. 5. Cruzamento entre um 8n + 2n ou 4n + 6n. permanecerão os mesmos cromossomos: ABC e abc. 3. Mutação. c) 26. Fase S. que não ocorre em todas as células e as proporções seriam diferenciadas. b) 2. No intestino são células somáticas que sofrem apenas mitose e não meiose. b) 20. Prófase I: número de cromossomos = 6 e número de cromátides = 12. 10. 2. 14. d) 26. 42. d) 19. d) 4. Ela pode ser heterozigota sendo fenotipicamenete normal. Prófase II: Número de cromossomos = 3 e número de cromátides = 6. basta a presença de apenas um gene recessivo para que manifeste a doença. Todos Aa 8. 15. e) 22. O pai só fornece Y não tendo como passar a distrofia. . b) 25. b) 76. h) 48. f) 12.a) 23. 11.a) 1. Para o macho.a) AaBb. 13.Gabarito da 4ª Lista de Exercícios 1. 12. a) 20. 7. 6. No intestino não ocorre anáfase II. Cruzamento entre AA e aa induzindo mutação nos genes aa (fazendo com que permaneçam ligados). g) 36. c) 38. e) 2. 9. 50% A e 50% a. O erro ocorreu na mãe onde houve ligação dos cromossomos que não se separaram durante a meiose. b) Não. f) 8. 4. c) 2.

a) Inversão intercalar heterozigota.a) Características cromossômicas: 1 normal: 1 translocado simples balanceado: 1 portador de deleção heterozigoto do braço curto do cromossomo 5: 1 portador de duplicação heterozigota do braço curto do cromossomo 5.a) Haploidia ou monoploidia. h) Dupla Trissomia. b) Deleção intercalar heterozigota. d) Inversão terminal heterozigota. Translocação recíproca heterozigota. d) Monossomia. 18. e) Tetrassomia. b) Diploidia.16. MNODEF. c) Trissomia. MNOPQR. MNODEF. 17. c) Duplicação intercalar heterozigota. MNOPQR. ABCDEF. MNOPQR. MNOPQR. g) Tetraploidia. MNODEF. i) Nulissomia. ABCDEF. 19. ABCPQR. . ABCPQR. b)1 “cri du chat”: 2 normais: 1 morte precoce. Possíveis gametas: ABCDEF. f) Triploidia.

Sign up to vote on this title
UsefulNot useful