Exercicios Resolvidos Sobre Dna e Rna

1ª Lista de Exercícios

Natureza e Função do Material Genético

1) Num organismo diplóide um pesquisador verificou que uma molécula de DNA continha 22% de GUANINA. Com base nesta informação determine qual o percentual de cada uma das outras bases. 2) Se o conteúdo de AT em uma molécula de DNA é de 36%, quais são os conteúdos de todas as bases? 3) Explique porque no experimento de Avery e colegas, o material tratado com DNAse não produziu colônias patogênicas. 4) Um vírus, cujo material consiste de uma fita de RNA, tem aproximadamente 22% de seus RNA nucleotídeos consistindo de URACIL. Qual é a frequência de ADENINA? 5) Se um RNAm sintético conter 35% de ADENINA e 65% de GUANINA posicionados ao longo do polinucleotídeo, que aminoácidos são esperados para serem incorporados no polipeptídeo e em que proporções? 6) É preparado um extrato celular com células pnemocócicas patogênicas. Que efeito terá a mistura desta cultura comum a de pnemococus não patogênicos se a primeira for submetida a tratamento com: a) Protease? b) RNAse? c) DNAse? 7) Que propriedades químicas possuem o DNA e as proteínas que permitem a marcação específica de uma ou outra destas macromoléculas com um isótopo radioativo? 8) Qual a contribuição do experimento realizado por Hershey e Chase para a Genética? Como o objetivo foi alcançado? 9) Considere uma partícula viral contendo uma molécula de 200.000 pb (pares de bases): a) Quantos nucleotídeos devem estar presentes? b) E quantos átomos de fósforo?

10) Foi demonstrado experimentalmente que a maioria das sequências altamente repetitivas de DNA de cromossomos eucariotos não são transcritas. O que isto indica a respeito da função deste tipo de DNA? 11) O que você entende por “orientação anti-paralela” das fitas de DNA? 12) Os ácidos nucleicos são constituídos por cadeias polinucleotídicas. Descreva resumidamente este tipo de composto. 13) Cite as principais diferenças entre RNA e DNA quanto à estrutura de nucleotídeos? 14) Quais as principais características da molécula de DNA? 15) Explique o que é e porque ocorre a complementariedade de bases nitrogenadas. 16) Se uma fita de desoxirribonuclease tiver 5’ATAAGCGTTAG 3’, como será a molécula de DNA? constituição

17) O DNA do fungo Neurospora crassa tem um conteúdo de A + T de 37%. Qual o conteúdo de cada uma das bases? 18) O DNA da bactéria “Bacillus hipoteticus” tem um conteúdo de T + C de 46%. Qual o conteúdo de cada uma das quatro bases? 19) Porque surgem os fragmentos de Okasaki? 20) Qual a importância do empacotamento do DNA e como ele se processa? 21) O isótopo radioativo do nitrogênio N15 pode ser usado para marcar radioativamente compostos que possuam nitrogênio na sua composição, como é o caso dos ácidos nucleicos. Uma cultura de Escherichia coli cresceu em um meio contendo exclusivamente N15 até que todo o DNA estivesse marcado. Então transferiu-se a colônia para um meio contendo nitrogênio comum N14 e deixou-se que crescesse por, exatamente, duas gerações. Fazendo-se então uma avaliação do DNA, quanto deveria ser encontrado contendo: a) Somente N15? b) Híbrido (uma fita N14 e outra N15)? c) Somente N14?

Respostas da 1ª Lista de Exercícios 1.a) Haverá formação de células patogênicas. Conseguiram demonstrar que apenas o DNA penetra na célula infectada sendo transmitido à geração viral descendente.96%. 6.78%.78%. T = 18%.96%.27. Significa que as duas cadeias polinucleotídicas de uma mesma molécula de DNA são invertidas uma em relação à outra. b) Idem. 10. C = 32%. na mesma extremidade da outra será encontrado o radical oxidrila (da posição 3’). 9. não tendo.28%. c) Haverá formação de células não patogênicas. GGA . 2. acompanhando a trajetória dos vários componentes virais marcados radioativamente em um processo normal de infecção. portando. 4. AAG . Comprovaram que o material que possui atividade genética é o DNA. Que não codificam nenhum polipeptídeo.000. . Não se tem como determinar.4.78%.14. uma vez que o RNA é simples fita não sendo as bases pareadas. AGA . A = 28%. AAA .7. atividade genética. O DNA é rico em fósforo mas não possui enxofre. 3. T = 28%. C = 22%. 8. GAA 7. 7. isto é. G = 22%. b) Idem.96%. GAG . AGG . GGG . G = 32%.7.a) 400.14. 5.14. A = 18%. 11. se em uma extremidade de uma delas se encontrar o radical fosfato (que ocupa a posição 5’ do nucleotídeo).46%. enquanto que as proteínas são ricas em enxofre e não possuem fósforo. Porque a DNAse destrói o DNA da bactéria patogênica não permitindo que a bactéria apatogênica incorporasse o DNA da bactéria patogênica e se transformasse em bactéria patogênica.

21. Não é possível determinar uma vez que T e C não são complementares. C = 31. Ocorre em três etapas: espirilização das duas fitas.5%. na posição 3’ da pentose encontra-se uma oxidrila e na posição 5’ um fosfato.a) Nenhum. originando a dupla hélice. superespiralização da cadeia de nucleossomos. tendo perdido a oxidrila da posição 2’. c) 50%. . 16. É constituída por duas cadeias polinucleotídicas complementares uma à outra orientadas antiparalelamente espiraladas para a direita. 5’ ATAAGCGTTAG 3’ 3’ TATTCGCAATC 5’ 17. 13. embora a replicação ocorra de modo bidirecional. 15. A pentose do RNA é uma ribose enquanto que a do DNA é uma desoxiribose. b) 50%. A união dos vários nucleotídeos entre si é promovida por ligações fosfodiéster entre a oxidrila 3’ de um nucleotídeo e o grupamento fosfato 5’ do seguinte.5%. A união das bases entre as duas fitas de DNA é sempre específica ocorrendo os pareamentos C-G e T-A. formando uma dupla hélice. as DNApolimerases conseguem sintetizar apenas no sentido 5’ → 3’.12. 14.5%. O empacotamento é necessário para permitir que moléculas extremamente longas consigam caber em espaço exíguo (núcleo). com a participação das histonas. 19. A = 18. T = 18. Porque. o crescimento total 3’ → 5’ ocorre pela síntese de pequenos fragmentos 5’ → 3’ denominados fragmentos de Okasaki. 20. G = 31. Deste modo. 18. Tal especificidade é provocada pela habilidade de formação de pontes de hidrogênio (duas entre T e A e três entre C e G). formação de nucleossomos. No RNA encontra-se a pirimidina uracil que no RNA é substituída pela timina. Cada nucleotídeo é constituído por uma base cíclica nitrogenada ligada a uma pentose.5%.

MET .LYS a) Quais as sequências de nucleotídeos do RNA velho e novo? b) Que tipo de RNA é? c) Qual o nucleotídeo que foi adicionado e qual foi deletado? 6) Explique o processo de excisão de introns ou "SPLICING": .ALA .HIST .LYS para LYS . Quais as conclusões que podemos retirar desta informação? 4) Assumindo a sequência de nucleotídeos no DNA: 3' GTC 5' 5' CAG 3' Onde GTC é a fita molde: a) Que aminoácido é codificado por esta trinca? b) Se uma mutação ocorresse e como consequência transformasse a adenina para a forma tautomérica na replicação.ASN .SER .ALA .SER . enquanto que em mamíferos é de 45 nucleotídeos.ALA .LEU .HIST .LEU .VAL . que aminoácido seria codificado? 5) Uma única adição de nucleotídeos e uma deleção aproximadamente 15 pontos distantes do DNA causam a mudança na sequência de uma proteína de: LYS . transcrição e a tradução de procariontes e eucariontes? 2) Considere o segmento de fita de DNA abaixo: 3' AAAGAACGATGATTTCGGATT 5' a) Qual a sequência de bases do RNAm correspondente? b) Quantos tRNAs serão utilizados na síntese? c) Quais os anti-códons dos tRNAs acima considerados? d) Quantos aminoácidos poderão ser codificados? e) Qual a sequência de aminoácidos codificados? f) Considere que esta sequência sofra splicing e que os introns ocorram a cada 2 códons no hnRNA.2ª Lista de Exercícios Síntese Proteica 1) Quais as principais diferenças entre a replicação.ALA . quais seriam as respostas para as perguntas acima? 3) A taxa de replicação em bactérias corresponde a 450 nucleotídeos por segundo.PRO .

VAL – LIS .PRO .GLU .ALA .TRP . coli um gene que especifica uma proteína.LIS . quais os aminoácidos que estariam presentes? 12) Como a transcrição é: a) Iniciada? b) Terminada? 13) Considerando-se a sequência de códons 5’ AUG CGA 3’ responda justificando: a) De que molécula do ácido nucleico faz parte? b) Qual o anti-códon correspondente? c) De que molécula a resposta b) faz parte? . na natureza.PRO .LIS . Porque esta taxa não é maior? Explique: 11) Considere a sequência de bases nitrogenadas abaixo como parte de uma molécula de ácido nucleico: 5' UGA . tanto na síntese de RNA quanto no processo de tradução do RNAm.CIS . você encontra as seguintes sequências: MUTANTE 1 . de aproximadamente 1 em 10000 nucleotídeos.AUG 3' a) De que ácido nucleico ela faz parte? b) Quais os outros ácidos nucleicos relacionados com tal sequência e suas respectivas bases nitrogenadas? c) Se da sequência dada resultar um segmento de proteína. Isolando os produtos enzimáticos mutantes.ARG .HIST Você obtém. encontrarmos uma frequência de erro. 8) Porque apenas 61 trincas (sequências de nucleotídeos) codificam aminoácidos? 9) Você está estudando em E.ALA .CIS .GLY .HIST MUTANTE 2 . para este gene.ALA .7) É verdadeira a afirmação? "Existe 1 (um) códon e anti-códon específico para cada tRNA".ALA .PRO .PRO MUTANTE 3 .CIS .TRP . Uma parte de sua sequência é: . uma série de mutantes que não mostram atividade enzimática.GLU .HIST Qual a base molecular para cada mutação? Qual é a sequência de DNA que especifica esta parte da proteína? 10) É comum.

um intron de 5 e outro exon de 6. . c) Após a deleção uma adição de timina após a sequência GG. 18) A fita não template (anti-sense) de um gene que tem a seguinte sequência: 5’ CCGGCTGATTTAGAAATGATGTTATATATAATATAATGTGCCCAATG 3’ Qual a constituição do polipeptídeo codificado por este gene? 19)Explique como o tRNA assegura a correta tradução de acordo com as leis do código genético. d) Como seria designado o resultado final? 21) Explique porque existem na natureza várias formas diferentes para um mesmo gene. enquanto que o mRNA é degradado rapidamente. qual o mRNA correspondente se a fita template for 3’ ð 5’? 15) Moléculas de rRNA são relativamente estáveis. 20) Considerando o molde 3’ TACCGGAATTGC 5’. qual a sequência de hnRNA? b) Dê o nucleotídeo da extremidade 5’ deste RNA. 16) Diga o que você sabe sobre as fitas sense e anti-sense do DNA.d) Qual a sequência template (sense ou molde) correspondente? e) E a não template? f) A que molécula as duas últimas respostas pertencem? 14) Em uma longa molécula de DNA isolou-se o seguinte segmento: 5’ ATCTTTAGGCTACAGGT 3’ 3’ TAGAAATCCGATGTCCA 5’ a) Se a fita sense for 5’ ð 3’. Discuta possíveis causas e consequências deste fato. 17) Discuta as principais características do código genético. Forneça os peptídeos produzidos considerando as seguintes situações: a) A molécula original do DNA. c) Considerando que a molécula de DNA é constituída por um exon de 6 nucleotídeos. b) A deleção da segunda citosina.

Quais das seguintes substituições se espera serem induzidas com maior frequência? Explique: a) Met > Val b) Lis > Trp c) Lis > Gln d) Pro > Arg e) Pro > Gln 23) Estudando uma mutação sem sentido em Escherichia coli um pesquisador verificou que a cadeia polipeptídica era terminada na posição relativa ao triptofano na cadeia normal. gln e lis. o pesquisador encontrou 6 diferentes tipos de revertentes. UAA ou UGA? Porquê? . cada um com diferente tipo de aminoácido na posição originalmente ocupada pelo triptofano: ser.22) O 5 bromouracil é um mutágeno químico análogo à timina que se caracteriza por induzir transições. Induzindo revertentes com agentes mutagênicos capazes de provocar substituições em um único par de bases cada um. thr. A mutação sem sentido estudada era UAG. glu. leu.

a) 5’ UUU CUU GCU ACU AAA GCC UAA 3’ b) 7 c) 3’ AAA GAA CGA UGA UUU CGG AUU 5’ d) 3 e) LIS . • Enzimas específicas de iniciação. enlongamento e terminação próprios de procariotos.AGU . sendo em seguida utilizada na síntese de proteínas e posteriormente degradada.CCA .a) GLN b) PRO 5.ARG . PROCARIONTES Replicação • Realizada no nucleoplasma.ARG .UCA .GCU . 4. • É bem mais complexo.ILE fa) 5’ UUU UUA AAC CA 3’ fb) 3 fc) 3’ AAA AAU UUG 5’ fd) 3 fe) LIS . enlongamento e terminação próprios de eucariotos.AAU .GCU . • Desenrrolamento do DNA por atuação de enzimas em uma ponta.FIM . Tradução • Enzimas específicas de iniciação.GLU . EUCARIONTES • Realizada no núcleo. ocorrendo uma série de modificações do RNA antes que ele possa servir no início do processo (introns e exons).AAA . Transcriçã • A molécula de RNA se o constitui mo mRNA propriamente dito. O tamanho da molécula de DNA de uma bactéria é menor e menos condensada que o DNA de um mamífero sendo que esta leva mais tempo para desenrolar a mesma quantidade de nucleotídeos que o DNA de procariotos.CUU .ASN .a) velho: AAA .Gabarito da 2ª Lista de Exercícios 1. 2.LEU 3. • Início em vários pontos no mesmo momento.FEN .

codificam o fim da síntese denominados sem sentido e não codificam nenhum aminoácido. 11.CCA . Portanto seu significado é exatamente o fim da síntese.GAA . 8.CAU . 6. c) Fim . Sim.MET . UAG. 7. após sua síntese sofre um processamento no qual serão cortadas as sequências que não estarão no mRNA final (introns).UGU . Mutante 1: GCA . O hnRNA.GCU . Caso pareie uma base incorreta há enzimas capazes de perceber este erro retirando a base que foi inserida erroneamente.AAA .3’ ACT TCA 5’.UGU .AUG . são reconhecidos pelos fatores de liberação de proteínas que promovem a ejecção das subunidades de ribossomos. UGA.AAA .GUC .UGA (mutação de ponto .UGG .a) mRNA b) DNA molde .AAA b) mRNA c) Deleção de A na segunda trinca de nucleptídeos e adição de G na sexta trina de nucleotídeos. 9.GGG .CAU (mutação de ponto ocorrendo primeiro transversão no terceiro par de bases e.GCU . embora cada aminoácido possa ter 1 a 4 anti-códons apropriados a ele. segundo.CAC . Porque 3 trincas UAA.CAU (mutação de sentido errado com adição de uma trinca errada) Mutante 2: GCA . assegurando o correto pareamento. Para cada um dos códons presentes em uma molécula de mRNA encontra-se uma molécula de tRNA com um único anti-códon complementar. Devido aos mecanismos de reparo capazes de restabelecer a integridade do DNA. O mRNA produzido pela transição em eucariotos é uma molécula com muito mais ribonucleotídeos que o necessário para a síntese de uma proteína ou enzima.transição) Mutante 3: GCA . Os segmentos de DNA transcritos que estarão efetivamente presentes no mRNA final são denominados exons.novo: AAA . transversão no segundo par de bases) 10. Cada anti-códon é específico para um dado aminoácido.CCA .UUA .CCA .GUG . Em vez disso. A processividade é de alta fidelidade não formando a ligação se não tiver a base correta.

mas existem sinais específicos de início e fim de tradução (dois códons de iniciação e três de determinação). Deste modo. d) 5’ TCGCAT 3’. Cada gene usa sempre a mesma fita como “sense” ou “template”. c) 5’ UAGAAAUGUCCA 3’. 15. 18.ALA .ISO.a) mRNA. 14. sendo complementar e antiparalelo. mesmo em diferentes espécies). 17. o que significa que cada aminoácido pode ser codificado por mais de um códon. a) 5’ UGGACAUCGGAUUUCUA 3’.MET .12.a) A RNA polimerase reconhece e acopla-se à sequência promotora do DNA. 19. mas genes diferentes podem ser copiados de diferentes fitas da mesma molécula. c) tRNA. b) A RNA polimerase reconhece uma sequência de terminação no DNA. Não existe qualquer tipo de separação entre códons contíguos nem sobreposições.ISO . O tRNA apresenta especificidade tanto para o aminoácido como para o códon. a correspondência corretamente sequenciada.ASP . desconectando-se deste 13. b) uracil. e) 5’ ATGCGA 3’.GLU . É degenerado. PRO . garante a inserção correta do aminoácido na cadeia polipeptídica. b) 5’ CAU 3’ e 5’ UCG 3’. mas não é ambíguo e é universal (cada códon codifica sempre o mesmo aminoácido.MET .TYR . . f) DNA. A sua degradação impede o acumulo excessivo tanto do próprio mRNA como também do seu produto específico.LEU . no momento em que este for requerido pelo organismo. 16.LEU . O código genético assegura a colinearidade de informações entre a molécula de DNA e a cadeia polipeptídica. A fita “sense” é a fita da molécula de DNA que serve de molde para a síntese de mRNA. enquanto que uma determinada molécula de mRNA só é necessária para a síntese de um determinado peptídeo. de acordo com a sequência de códons presentes no mRNA. isto é. O RNA é necessário permanentemente na célula pois participa de todo e qualquer processo de síntese.

TRE. c) MET . . 23.PRO.TRE. d) Mutação de sentido errado. UAG. As formas diferentes chamadas alelos. assegurando uma maior probabilidade de sobrevivência entre as espécies. 22.LEU . 21.a) MET .ALA .20. b) MET .LEU . porque é o único terminador que com apenas uma alteração pode originar os seis aminoácidos.PRO . pois é a única situação que envolve transição. surgem por mutação e são uma importante fonte de variabilidade e diversidade. Apenas MET > VAL.

impedindo a ligação do repressor. 4) Os operons. um promotor ou um operador. 3) Considerando os operons lac e trp como modelos de indução e repressão. que regulam eficientemente a expressão de conjuntos de genes estruturais relacionados entre si são comuns em bactérias. b) As alterações ocorridas quando moléculas efetoras estão presentes. c) Uma mutação do tipo deleção de base nos genes estruturais (Z.3ª Lista de Exercícios Regulação Gênica 1) Porque o mecanismo do triptofano é dito negativo e da lactose é dito positivo? 2) O modelo do operon. Explique o que ocorre se houvesse: a) A presença de triptofano no meio celular. descreva: a) A condição mais frequente de cada um destes operons. isto implica que estes não controlam a expressão de seus genes? Justifique. e) Mutação sem sentido em lac y. Explique os efeitos de cada uma das mutações abaixo no operon lac da Escherichia coli: a) Mutação no operador. inibindo o acoplamento do repressor à lactose. respectivamente. formulado por Jacob e Monod. . d) Mutação em lac i. f) Mutação de localização desconhecida. b) Uma mutação do tipo substituição de bases silenciosa do gene operador (O). d) Presença de glicose no meio celular. que impede a degradação de mRNA lac. mas ausentes em eucariotos. b) Mutação em lac i (gene regulador). coli. 6) Diferencie repressores e indutores. A). Y. serve para explicar a regulação gênica das enzimas que degradam a lactose em E. 5) Uma mutação é uma alteração na sequência de nucleotídeos de um gene. impedindo a sua mutação. e) Uma mutação de sentido errado no primeiro gene estrutura. c) Mutação no promotor impedindo o acoplamento da RNA polimerase.

Na ausência de triptofano ocorre síntese enzimática? Porquê? 8) Em Escherichia coli o operon da lactose compreende 3 genes estruturais: galk. um operador que responde à um complexo repressor/co-repressor. cujos produtos estão envolvidos no metabolismo do açúcar galactose. O seu gene regulador situa-se em um outro ponto do DNA. galt e gale. e um promotor.7) O operon lac é responsável pela produção de enzimas que participam da reação metabólica de síntese de triptofano e é constituído por 5 genes estruturais. Descreva a sequência de processos: a) Na ausência da galactose. Galr codifica um repressor e a galactose é um indutor do sistema. . b) Na presença da galactose.

uma vez que comportam reações metabólicas muito mais complexas. Porque o operon só estará atilado na presença de lactose ou desactivado na presença de triptofano.O triptofano age como co-repressor que se liga ao repressor ativando-o. inibindo o promotor. A lactose é indutora enquanto o triptofano é um repressor.a) No operon Lac seria indiferente. Os operons são sistemas de regulação que respondem a estímulos diretos do meio externo.O operon permanece inativado porque a proteína repressora. Isto impede o acoplamento da RNA polimerase. 3.Gabarito da 3ª Lista de Exercícios 1. Y. Trp . se liga ao sítio operador. Trp . e) A lactose não será degradada. ocorrendo transcrição e tradução. inibindo o promotor. e deste modo. sintetizada pelo gene regulador. Sendo eficientemente tamponados contra a maioria das influências externas os eucariotos não necessitam de mecanismos de resposta direta mas. liberando assim o promotor. Este perde a capacidade de se ligar ao operador. estabelece um complexo com o repressor. o que faz com que haja transcrição e subsequente síntese enzimática. por outro lado. quando presente. A e degradação da lactose pois tanto o códon mutante como o original codificam o mesmo aminoácido não alterando a leitura. d) O operon Lac não será ativado e não haverá produção das enzimas Z. Y. não sendo capaz de se ligar ao sítio operador do operon. A. Logo a RNA polimerase acopla-se ao promotor.É induzido pela lactose que.O repressor sintetizado pelo gene regulador é inativo. que comportam vários escalões de . 4. também necessitam de sistemas de regulação gênica muito mais elaborados. c) A lactose não será degradada pois haverá mutação de sentido errado não sendo formadas as enzimas Z. Não há tradução nem transcrição. b) Lac . b) Haverá leitura dos genes Z. o que é assegurado pelos chamados “circuitos pré programados de expressão gênica”. A. inativando-o. O complexo repressor/co-repressor ocupa o sítio operador.Y. Nestes. que não aceita a ligação da RNA polimerase. não há transcrição nem tradução. 2.a) Lac .

c) O operon nunca se expressa. neste caso. e a regulação processa-se tanto a nível de transcrição como de processamento de hnRNA. mas a cadeia da beta-galactosídeo permease é sintetizada apenas até o ponto da mutação e não há síntese de betagalactosídeo transacetilase. b) Como indutor. Repressor .a) Galr sintetiza o repressor que se liga ao operador. Sim porque se tratando de um operon reprimível. impedindo a sua ligação ao operador.a) O operon expressa-se continuamente. 7. é o triptofano. não há expressão do operon pois não haverá transcrição nem tradução. 8. portanto. forma um complexo com o repressor. e) Ocorre síntese da beta-galactosidase. 5. sempre degradando lactose.genes. A sua função é ligar-se ao sítio operador inibindo a expressão do operon. a ativação sempre ocorre em cadeia. impedindo sua ligação ao operador.é uma molécula efetora que atua nos sistemas de indução e. . b) Idem. Indutor . 6. a galactose liga-se ao repressor sintetizado por galr. Logo haverá o acoplamento da RNA polimerase e a consequente transcrição e tradução do operon. d) Idem. uma vez presente. deprimindo assim o operon. que não aceita a ligação da RNA polimerase e. isto provoca a inibição do promotor. a sua expressão é contínua a menos que esteja presente o co-repressor específico que. f) Acumulo de mRNA na célula.é uma proteína sintetizada pelos genes reguladores e é específica para cada operon.

Como você sintetizaria um triplóide de genótipo Aaa? Esquematize: 2) Estudando os cromossomos de um cão macho. ligado ao X). XXY).4ª Lista de Exercícios Divisão Celular e Alterações Cromossômicas 1) Imagine 2 planta de genótipo AA e aa. Quais os genótipos das células filhas? 8) Uma célula de genótipo Aa sofre meiose. 6) Em uma espécie cujo número haplóide é 19 quantos dos elementos abaixo devem haver em cada célula: a) Cromátide na metáfase I? b) Cromossomos na anáfase mitótica? c) Cromátides na metáfase II? d) Cromossomos no final da telófase II? 7) Uma célula de genótipo Aa sofre mitose. descobriu-se que ele tinha um cromossomo Y e dois cromossomos X (cariótipo 79. Qual foi o erro que deu origem a esse animal? Em qual dos pais ocorreu este erro? Por quê? 3) Esquematize e compare as células germinativas. Seus pais eram normais e sem distrofia muscular. 4) Quantos cromossomos há nas células do intestino na anáfase II? 5) Como você sintetizaria um pentapoliplóide (5n)? Esquematize. Quais os genótipos das células filhas? 9) Quantos tipos diferentes de gametas serão produzidos pelos seguintes genótipos. na prófase I e prófase II em uma espécie caracterizada pelo genoma 2n=6. se todos os genes estiverem situados em cromossomos diferentes? a) AA b) Aa c) AaBB d) AaBb e) AABbCC f) AaBBCcddEe . com distrofia muscular (gene recessivo.

Quantos cromossomos devem ser encontrados em: a) Um monossômico? b) Um trissômico? c) Um tetrassômico? d) Um trissômico duplo? e) Um nulissômico? f) Um monoplóide (ou haplóide)? g) Um triplóide? h) Um tetraplóide? 16) Considerando um cromossomo normal com a sequência de bandeamento 12345678 determine o tipo de alteração e o provável esquema de pareamento com o homólogo normal em cada uma das situações abaixo: a) 12365478 b) 125678 c) 1234345678 d) 12345876 .10) Quantos e quais os tipos de gametas podem ser produzidos pelo seguinte genótipo heterozigoto AaBbCc. B e C se encontram todos no mesmo cromossomo e não ocorrem mecanismos de recombinação? 11) Um indivíduo produz os gametas AB. Ab. aB e ab em igual proporção. considerando que os loci A. 12) Em que estágio do ciclo celular ocorre a replicação do DNA? 13) Existem 40 cromossomos nas células somáticas do rato. quantos cromossomos deve possuir? 15) O número haplóide de um certo organismo é 12. a) Qual o seu genótipo? b) Os genes A e B encontram-se no mesmo cromossomo? Justifique. a) Quantos cromossomos um rato deve receber de sua mãe? b) Qual o número haplóide do rato? 14) A aveia abssínia parece ser um tetraplóide com 28 cromossomos. Se a aveia comum é um hexaplóide desta mesma série.

Uma alteração cromossômica resultou nos arranjos ABCPQR e MNODEF. portanto. Este fenômeno é considerado uma translocação simples balanceada. Se uma pessoa portadora de translocação simples se casa com um companheiro normal. . considerando: a) As características cromossômicas. b) As características fenotípicas. Contudo. Determine o tipo de alteração ocorrida e todas as possibilidades de segregação durante a gametogênese. normal.17) O cromossomo 1 da Drosophila possui a sequência gênica ABCDEF e o cromossomo 2 a sequência MNOPQR. quando um dos cromossomos 5 apresenta a falta de um segmento no seu braço curto ocorre uma anomalia conhecida como “cri du chat” e três cópias do braço curto levam à morte logo após o nascimento. 18) Classifique os arranjos cromossômicos simbolizados abaixo: a) n b) 2n c) 2n + 1 d) 2n − 1 e) 2n + 2 f) 3n g) 4n h) 2n + 1 + 1 i) 2n − 2 19) Suponha que parte do braço curto de um cromossomo 5 da espécie humana se ligue não reciprocamente ao braço longo do cromossomo 13. determine o resultado esperado. uma vez que todo o material genético está presente e o fenótipo é.

Se não ocorrer recombinação entre eles. g) 36. d) 19. Cruzamento entre AA e aa induzindo mutação nos genes aa (fazendo com que permaneçam ligados). c) 38. 5. 2. No intestino não ocorre anáfase II. e) 2. Mutação. 12.a) 23. 15. c) 2. 13. 4. basta a presença de apenas um gene recessivo para que manifeste a doença. . 11. b) 2. O pai só fornece Y não tendo como passar a distrofia. 7. 42. Fase S. No intestino são células somáticas que sofrem apenas mitose e não meiose. c) 26. f) 8. porque se estivessem no mesmo cromossomo a formação dos quatro tipos de gametas seria devida à ocorrência de permuta. b) Não. a) 76. b) 25. 14. Prófase I: número de cromossomos = 6 e número de cromátides = 12. 9. Cruzamento entre um 8n + 2n ou 4n + 6n. 10. que não ocorre em todas as células e as proporções seriam diferenciadas. f) 12.a) AaBb. d) 26. h) 48. d) 4. Para o macho. Ela pode ser heterozigota sendo fenotipicamenete normal. 6. 50% A e 50% a. b) 20. Todos Aa 8.a) 1. O erro ocorreu na mãe onde houve ligação dos cromossomos que não se separaram durante a meiose. Prófase II: Número de cromossomos = 3 e número de cromátides = 6. permanecerão os mesmos cromossomos: ABC e abc. b) 76. e) 22.Gabarito da 4ª Lista de Exercícios 1. a) 20. 3.

e) Tetrassomia. MNOPQR. ABCDEF. MNOPQR. c) Duplicação intercalar heterozigota. MNODEF. Possíveis gametas: ABCDEF.a) Haploidia ou monoploidia.a) Características cromossômicas: 1 normal: 1 translocado simples balanceado: 1 portador de deleção heterozigoto do braço curto do cromossomo 5: 1 portador de duplicação heterozigota do braço curto do cromossomo 5. 17. g) Tetraploidia. b) Diploidia. d) Inversão terminal heterozigota. c) Trissomia. ABCPQR. Translocação recíproca heterozigota. MNOPQR. MNODEF.a) Inversão intercalar heterozigota. h) Dupla Trissomia. ABCDEF. b)1 “cri du chat”: 2 normais: 1 morte precoce. i) Nulissomia. 19. b) Deleção intercalar heterozigota. 18. MNOPQR. MNODEF. f) Triploidia.16. d) Monossomia. ABCPQR. .

Sign up to vote on this title
UsefulNot useful