1ª Lista de Exercícios

Natureza e Função do Material Genético

1) Num organismo diplóide um pesquisador verificou que uma molécula de DNA continha 22% de GUANINA. Com base nesta informação determine qual o percentual de cada uma das outras bases. 2) Se o conteúdo de AT em uma molécula de DNA é de 36%, quais são os conteúdos de todas as bases? 3) Explique porque no experimento de Avery e colegas, o material tratado com DNAse não produziu colônias patogênicas. 4) Um vírus, cujo material consiste de uma fita de RNA, tem aproximadamente 22% de seus RNA nucleotídeos consistindo de URACIL. Qual é a frequência de ADENINA? 5) Se um RNAm sintético conter 35% de ADENINA e 65% de GUANINA posicionados ao longo do polinucleotídeo, que aminoácidos são esperados para serem incorporados no polipeptídeo e em que proporções? 6) É preparado um extrato celular com células pnemocócicas patogênicas. Que efeito terá a mistura desta cultura comum a de pnemococus não patogênicos se a primeira for submetida a tratamento com: a) Protease? b) RNAse? c) DNAse? 7) Que propriedades químicas possuem o DNA e as proteínas que permitem a marcação específica de uma ou outra destas macromoléculas com um isótopo radioativo? 8) Qual a contribuição do experimento realizado por Hershey e Chase para a Genética? Como o objetivo foi alcançado? 9) Considere uma partícula viral contendo uma molécula de 200.000 pb (pares de bases): a) Quantos nucleotídeos devem estar presentes? b) E quantos átomos de fósforo?

10) Foi demonstrado experimentalmente que a maioria das sequências altamente repetitivas de DNA de cromossomos eucariotos não são transcritas. O que isto indica a respeito da função deste tipo de DNA? 11) O que você entende por “orientação anti-paralela” das fitas de DNA? 12) Os ácidos nucleicos são constituídos por cadeias polinucleotídicas. Descreva resumidamente este tipo de composto. 13) Cite as principais diferenças entre RNA e DNA quanto à estrutura de nucleotídeos? 14) Quais as principais características da molécula de DNA? 15) Explique o que é e porque ocorre a complementariedade de bases nitrogenadas. 16) Se uma fita de desoxirribonuclease tiver 5’ATAAGCGTTAG 3’, como será a molécula de DNA? constituição

17) O DNA do fungo Neurospora crassa tem um conteúdo de A + T de 37%. Qual o conteúdo de cada uma das bases? 18) O DNA da bactéria “Bacillus hipoteticus” tem um conteúdo de T + C de 46%. Qual o conteúdo de cada uma das quatro bases? 19) Porque surgem os fragmentos de Okasaki? 20) Qual a importância do empacotamento do DNA e como ele se processa? 21) O isótopo radioativo do nitrogênio N15 pode ser usado para marcar radioativamente compostos que possuam nitrogênio na sua composição, como é o caso dos ácidos nucleicos. Uma cultura de Escherichia coli cresceu em um meio contendo exclusivamente N15 até que todo o DNA estivesse marcado. Então transferiu-se a colônia para um meio contendo nitrogênio comum N14 e deixou-se que crescesse por, exatamente, duas gerações. Fazendo-se então uma avaliação do DNA, quanto deveria ser encontrado contendo: a) Somente N15? b) Híbrido (uma fita N14 e outra N15)? c) Somente N14?

28%.a) Haverá formação de células patogênicas. isto é. GGG .7. GAG . 9. AAA . Comprovaram que o material que possui atividade genética é o DNA. na mesma extremidade da outra será encontrado o radical oxidrila (da posição 3’). 7.000. uma vez que o RNA é simples fita não sendo as bases pareadas. G = 22%.14. AAG . Porque a DNAse destrói o DNA da bactéria patogênica não permitindo que a bactéria apatogênica incorporasse o DNA da bactéria patogênica e se transformasse em bactéria patogênica.96%. acompanhando a trajetória dos vários componentes virais marcados radioativamente em um processo normal de infecção. C = 22%. AGG . c) Haverá formação de células não patogênicas. Significa que as duas cadeias polinucleotídicas de uma mesma molécula de DNA são invertidas uma em relação à outra. A = 28%.78%. 4. C = 32%. . 11. enquanto que as proteínas são ricas em enxofre e não possuem fósforo. 2. GGA . T = 28%. G = 32%. 8. não tendo. AGA . Não se tem como determinar. 3.14. b) Idem. atividade genética. 10.a) 400. Conseguiram demonstrar que apenas o DNA penetra na célula infectada sendo transmitido à geração viral descendente. 5. A = 18%. portando. O DNA é rico em fósforo mas não possui enxofre. Que não codificam nenhum polipeptídeo.96%.78%.96%. b) Idem.7.Respostas da 1ª Lista de Exercícios 1. se em uma extremidade de uma delas se encontrar o radical fosfato (que ocupa a posição 5’ do nucleotídeo). 6. T = 18%. GAA 7.46%.78%.14.27.4.

5’ ATAAGCGTTAG 3’ 3’ TATTCGCAATC 5’ 17. 19.5%. 21. A = 18.12. o crescimento total 3’ → 5’ ocorre pela síntese de pequenos fragmentos 5’ → 3’ denominados fragmentos de Okasaki. formando uma dupla hélice. Porque. as DNApolimerases conseguem sintetizar apenas no sentido 5’ → 3’. . É constituída por duas cadeias polinucleotídicas complementares uma à outra orientadas antiparalelamente espiraladas para a direita. com a participação das histonas.5%. c) 50%. 15. originando a dupla hélice. Deste modo. 18. O empacotamento é necessário para permitir que moléculas extremamente longas consigam caber em espaço exíguo (núcleo). 13. tendo perdido a oxidrila da posição 2’.a) Nenhum. 20. A pentose do RNA é uma ribose enquanto que a do DNA é uma desoxiribose. 14. G = 31. embora a replicação ocorra de modo bidirecional.5%. Não é possível determinar uma vez que T e C não são complementares. formação de nucleossomos. Tal especificidade é provocada pela habilidade de formação de pontes de hidrogênio (duas entre T e A e três entre C e G). No RNA encontra-se a pirimidina uracil que no RNA é substituída pela timina. T = 18. Cada nucleotídeo é constituído por uma base cíclica nitrogenada ligada a uma pentose. A união das bases entre as duas fitas de DNA é sempre específica ocorrendo os pareamentos C-G e T-A.5%. superespiralização da cadeia de nucleossomos. C = 31. A união dos vários nucleotídeos entre si é promovida por ligações fosfodiéster entre a oxidrila 3’ de um nucleotídeo e o grupamento fosfato 5’ do seguinte. b) 50%. Ocorre em três etapas: espirilização das duas fitas. 16. na posição 3’ da pentose encontra-se uma oxidrila e na posição 5’ um fosfato.

HIST .2ª Lista de Exercícios Síntese Proteica 1) Quais as principais diferenças entre a replicação.ALA . transcrição e a tradução de procariontes e eucariontes? 2) Considere o segmento de fita de DNA abaixo: 3' AAAGAACGATGATTTCGGATT 5' a) Qual a sequência de bases do RNAm correspondente? b) Quantos tRNAs serão utilizados na síntese? c) Quais os anti-códons dos tRNAs acima considerados? d) Quantos aminoácidos poderão ser codificados? e) Qual a sequência de aminoácidos codificados? f) Considere que esta sequência sofra splicing e que os introns ocorram a cada 2 códons no hnRNA.LYS para LYS .LYS a) Quais as sequências de nucleotídeos do RNA velho e novo? b) Que tipo de RNA é? c) Qual o nucleotídeo que foi adicionado e qual foi deletado? 6) Explique o processo de excisão de introns ou "SPLICING": .ALA .HIST .ALA .ALA .LEU .SER .MET . quais seriam as respostas para as perguntas acima? 3) A taxa de replicação em bactérias corresponde a 450 nucleotídeos por segundo.PRO . Quais as conclusões que podemos retirar desta informação? 4) Assumindo a sequência de nucleotídeos no DNA: 3' GTC 5' 5' CAG 3' Onde GTC é a fita molde: a) Que aminoácido é codificado por esta trinca? b) Se uma mutação ocorresse e como consequência transformasse a adenina para a forma tautomérica na replicação.VAL . enquanto que em mamíferos é de 45 nucleotídeos.LEU . que aminoácido seria codificado? 5) Uma única adição de nucleotídeos e uma deleção aproximadamente 15 pontos distantes do DNA causam a mudança na sequência de uma proteína de: LYS .ASN .SER .

LIS .GLU . de aproximadamente 1 em 10000 nucleotídeos.7) É verdadeira a afirmação? "Existe 1 (um) códon e anti-códon específico para cada tRNA".PRO MUTANTE 3 . uma série de mutantes que não mostram atividade enzimática. Porque esta taxa não é maior? Explique: 11) Considere a sequência de bases nitrogenadas abaixo como parte de uma molécula de ácido nucleico: 5' UGA . Uma parte de sua sequência é: . Isolando os produtos enzimáticos mutantes.CIS . quais os aminoácidos que estariam presentes? 12) Como a transcrição é: a) Iniciada? b) Terminada? 13) Considerando-se a sequência de códons 5’ AUG CGA 3’ responda justificando: a) De que molécula do ácido nucleico faz parte? b) Qual o anti-códon correspondente? c) De que molécula a resposta b) faz parte? . tanto na síntese de RNA quanto no processo de tradução do RNAm.PRO .ARG .HIST Qual a base molecular para cada mutação? Qual é a sequência de DNA que especifica esta parte da proteína? 10) É comum. você encontra as seguintes sequências: MUTANTE 1 . coli um gene que especifica uma proteína.CIS .ALA .GLY .HIST MUTANTE 2 .ALA .ALA . encontrarmos uma frequência de erro.PRO .AUG 3' a) De que ácido nucleico ela faz parte? b) Quais os outros ácidos nucleicos relacionados com tal sequência e suas respectivas bases nitrogenadas? c) Se da sequência dada resultar um segmento de proteína.HIST Você obtém.GLU . na natureza.LIS .TRP . para este gene.CIS . 8) Porque apenas 61 trincas (sequências de nucleotídeos) codificam aminoácidos? 9) Você está estudando em E.VAL – LIS .PRO .ALA .TRP .

Discuta possíveis causas e consequências deste fato. c) Considerando que a molécula de DNA é constituída por um exon de 6 nucleotídeos. Forneça os peptídeos produzidos considerando as seguintes situações: a) A molécula original do DNA. 16) Diga o que você sabe sobre as fitas sense e anti-sense do DNA. 17) Discuta as principais características do código genético. d) Como seria designado o resultado final? 21) Explique porque existem na natureza várias formas diferentes para um mesmo gene. qual o mRNA correspondente se a fita template for 3’ ð 5’? 15) Moléculas de rRNA são relativamente estáveis. c) Após a deleção uma adição de timina após a sequência GG. b) A deleção da segunda citosina. qual a sequência de hnRNA? b) Dê o nucleotídeo da extremidade 5’ deste RNA. 18) A fita não template (anti-sense) de um gene que tem a seguinte sequência: 5’ CCGGCTGATTTAGAAATGATGTTATATATAATATAATGTGCCCAATG 3’ Qual a constituição do polipeptídeo codificado por este gene? 19)Explique como o tRNA assegura a correta tradução de acordo com as leis do código genético.d) Qual a sequência template (sense ou molde) correspondente? e) E a não template? f) A que molécula as duas últimas respostas pertencem? 14) Em uma longa molécula de DNA isolou-se o seguinte segmento: 5’ ATCTTTAGGCTACAGGT 3’ 3’ TAGAAATCCGATGTCCA 5’ a) Se a fita sense for 5’ ð 3’. 20) Considerando o molde 3’ TACCGGAATTGC 5’. enquanto que o mRNA é degradado rapidamente. . um intron de 5 e outro exon de 6.

leu. Induzindo revertentes com agentes mutagênicos capazes de provocar substituições em um único par de bases cada um. glu. Quais das seguintes substituições se espera serem induzidas com maior frequência? Explique: a) Met > Val b) Lis > Trp c) Lis > Gln d) Pro > Arg e) Pro > Gln 23) Estudando uma mutação sem sentido em Escherichia coli um pesquisador verificou que a cadeia polipeptídica era terminada na posição relativa ao triptofano na cadeia normal. gln e lis. A mutação sem sentido estudada era UAG.22) O 5 bromouracil é um mutágeno químico análogo à timina que se caracteriza por induzir transições. thr. o pesquisador encontrou 6 diferentes tipos de revertentes. cada um com diferente tipo de aminoácido na posição originalmente ocupada pelo triptofano: ser. UAA ou UGA? Porquê? .

AAU .Gabarito da 2ª Lista de Exercícios 1.FIM . sendo em seguida utilizada na síntese de proteínas e posteriormente degradada. PROCARIONTES Replicação • Realizada no nucleoplasma. EUCARIONTES • Realizada no núcleo.ASN .GCU . 2. ocorrendo uma série de modificações do RNA antes que ele possa servir no início do processo (introns e exons). 4.CCA .AAA . • Enzimas específicas de iniciação.CUU .AGU . enlongamento e terminação próprios de eucariotos. O tamanho da molécula de DNA de uma bactéria é menor e menos condensada que o DNA de um mamífero sendo que esta leva mais tempo para desenrolar a mesma quantidade de nucleotídeos que o DNA de procariotos.LEU 3. enlongamento e terminação próprios de procariotos. Tradução • Enzimas específicas de iniciação.GLU . • É bem mais complexo.UCA .ARG .ARG .ILE fa) 5’ UUU UUA AAC CA 3’ fb) 3 fc) 3’ AAA AAU UUG 5’ fd) 3 fe) LIS .a) velho: AAA .GCU . • Início em vários pontos no mesmo momento.a) 5’ UUU CUU GCU ACU AAA GCC UAA 3’ b) 7 c) 3’ AAA GAA CGA UGA UUU CGG AUU 5’ d) 3 e) LIS . Transcriçã • A molécula de RNA se o constitui mo mRNA propriamente dito.FEN . • Desenrrolamento do DNA por atuação de enzimas em uma ponta.a) GLN b) PRO 5.

Caso pareie uma base incorreta há enzimas capazes de perceber este erro retirando a base que foi inserida erroneamente.CCA . embora cada aminoácido possa ter 1 a 4 anti-códons apropriados a ele.GCU . transversão no segundo par de bases) 10. Portanto seu significado é exatamente o fim da síntese.CCA . Os segmentos de DNA transcritos que estarão efetivamente presentes no mRNA final são denominados exons.a) mRNA b) DNA molde .UGU . UAG.3’ ACT TCA 5’.GCU . após sua síntese sofre um processamento no qual serão cortadas as sequências que não estarão no mRNA final (introns).GUC . UGA.CAU (mutação de ponto ocorrendo primeiro transversão no terceiro par de bases e.AUG . O mRNA produzido pela transição em eucariotos é uma molécula com muito mais ribonucleotídeos que o necessário para a síntese de uma proteína ou enzima. assegurando o correto pareamento.CCA .MET .UGG . são reconhecidos pelos fatores de liberação de proteínas que promovem a ejecção das subunidades de ribossomos.GAA . O hnRNA. 7.UUA . Em vez disso. A processividade é de alta fidelidade não formando a ligação se não tiver a base correta.GGG .CAC . 6. segundo.CAU (mutação de sentido errado com adição de uma trinca errada) Mutante 2: GCA .UGA (mutação de ponto . Para cada um dos códons presentes em uma molécula de mRNA encontra-se uma molécula de tRNA com um único anti-códon complementar.AAA .novo: AAA . 11.AAA . c) Fim . codificam o fim da síntese denominados sem sentido e não codificam nenhum aminoácido.UGU . Devido aos mecanismos de reparo capazes de restabelecer a integridade do DNA.AAA b) mRNA c) Deleção de A na segunda trinca de nucleptídeos e adição de G na sexta trina de nucleotídeos.GUG . Porque 3 trincas UAA. 9.transição) Mutante 3: GCA . Cada anti-códon é específico para um dado aminoácido. Sim.CAU . Mutante 1: GCA . 8.

17. b) 5’ CAU 3’ e 5’ UCG 3’. isto é. O código genético assegura a colinearidade de informações entre a molécula de DNA e a cadeia polipeptídica. 15.GLU . c) 5’ UAGAAAUGUCCA 3’. O tRNA apresenta especificidade tanto para o aminoácido como para o códon. O RNA é necessário permanentemente na célula pois participa de todo e qualquer processo de síntese. a correspondência corretamente sequenciada. mas existem sinais específicos de início e fim de tradução (dois códons de iniciação e três de determinação).a) A RNA polimerase reconhece e acopla-se à sequência promotora do DNA. A sua degradação impede o acumulo excessivo tanto do próprio mRNA como também do seu produto específico. Cada gene usa sempre a mesma fita como “sense” ou “template”.LEU . Não existe qualquer tipo de separação entre códons contíguos nem sobreposições.ISO.12.MET .LEU . de acordo com a sequência de códons presentes no mRNA. mas não é ambíguo e é universal (cada códon codifica sempre o mesmo aminoácido. 14. PRO . 16.ALA . Deste modo. garante a inserção correta do aminoácido na cadeia polipeptídica. 19.a) mRNA. o que significa que cada aminoácido pode ser codificado por mais de um códon.TYR . d) 5’ TCGCAT 3’. a) 5’ UGGACAUCGGAUUUCUA 3’. b) A RNA polimerase reconhece uma sequência de terminação no DNA. desconectando-se deste 13. f) DNA. mesmo em diferentes espécies).ISO . no momento em que este for requerido pelo organismo. É degenerado. sendo complementar e antiparalelo. c) tRNA. A fita “sense” é a fita da molécula de DNA que serve de molde para a síntese de mRNA. enquanto que uma determinada molécula de mRNA só é necessária para a síntese de um determinado peptídeo. mas genes diferentes podem ser copiados de diferentes fitas da mesma molécula.ASP .MET . b) uracil. 18. e) 5’ ATGCGA 3’. .

LEU . As formas diferentes chamadas alelos. assegurando uma maior probabilidade de sobrevivência entre as espécies. d) Mutação de sentido errado. UAG.a) MET . pois é a única situação que envolve transição. 21. b) MET .ALA .PRO. 23. 22. .20.LEU .TRE.PRO . Apenas MET > VAL. c) MET .TRE. surgem por mutação e são uma importante fonte de variabilidade e diversidade. porque é o único terminador que com apenas uma alteração pode originar os seis aminoácidos.

Explique os efeitos de cada uma das mutações abaixo no operon lac da Escherichia coli: a) Mutação no operador. d) Mutação em lac i. e) Uma mutação de sentido errado no primeiro gene estrutura. que impede a degradação de mRNA lac. impedindo a ligação do repressor. respectivamente.3ª Lista de Exercícios Regulação Gênica 1) Porque o mecanismo do triptofano é dito negativo e da lactose é dito positivo? 2) O modelo do operon. d) Presença de glicose no meio celular. serve para explicar a regulação gênica das enzimas que degradam a lactose em E. 3) Considerando os operons lac e trp como modelos de indução e repressão. Y. e) Mutação sem sentido em lac y. 5) Uma mutação é uma alteração na sequência de nucleotídeos de um gene. formulado por Jacob e Monod. b) As alterações ocorridas quando moléculas efetoras estão presentes. impedindo a sua mutação. mas ausentes em eucariotos. inibindo o acoplamento do repressor à lactose. isto implica que estes não controlam a expressão de seus genes? Justifique. 6) Diferencie repressores e indutores. um promotor ou um operador. . c) Uma mutação do tipo deleção de base nos genes estruturais (Z. coli. 4) Os operons. f) Mutação de localização desconhecida. descreva: a) A condição mais frequente de cada um destes operons. b) Mutação em lac i (gene regulador). b) Uma mutação do tipo substituição de bases silenciosa do gene operador (O). que regulam eficientemente a expressão de conjuntos de genes estruturais relacionados entre si são comuns em bactérias. A). Explique o que ocorre se houvesse: a) A presença de triptofano no meio celular. c) Mutação no promotor impedindo o acoplamento da RNA polimerase.

b) Na presença da galactose. . Descreva a sequência de processos: a) Na ausência da galactose.7) O operon lac é responsável pela produção de enzimas que participam da reação metabólica de síntese de triptofano e é constituído por 5 genes estruturais. Na ausência de triptofano ocorre síntese enzimática? Porquê? 8) Em Escherichia coli o operon da lactose compreende 3 genes estruturais: galk. cujos produtos estão envolvidos no metabolismo do açúcar galactose. um operador que responde à um complexo repressor/co-repressor. O seu gene regulador situa-se em um outro ponto do DNA. e um promotor. Galr codifica um repressor e a galactose é um indutor do sistema. galt e gale.

sintetizada pelo gene regulador. uma vez que comportam reações metabólicas muito mais complexas. inativando-o. A. inibindo o promotor. b) Lac . Este perde a capacidade de se ligar ao operador.O repressor sintetizado pelo gene regulador é inativo.É induzido pela lactose que. que não aceita a ligação da RNA polimerase. Y. Trp . Y.O operon permanece inativado porque a proteína repressora.O triptofano age como co-repressor que se liga ao repressor ativando-o. Não há tradução nem transcrição. Trp . estabelece um complexo com o repressor. e deste modo. d) O operon Lac não será ativado e não haverá produção das enzimas Z. o que faz com que haja transcrição e subsequente síntese enzimática. Sendo eficientemente tamponados contra a maioria das influências externas os eucariotos não necessitam de mecanismos de resposta direta mas. o que é assegurado pelos chamados “circuitos pré programados de expressão gênica”. também necessitam de sistemas de regulação gênica muito mais elaborados.Y. 4. inibindo o promotor. que comportam vários escalões de . quando presente. c) A lactose não será degradada pois haverá mutação de sentido errado não sendo formadas as enzimas Z. Nestes. Os operons são sistemas de regulação que respondem a estímulos diretos do meio externo. A lactose é indutora enquanto o triptofano é um repressor. não sendo capaz de se ligar ao sítio operador do operon. O complexo repressor/co-repressor ocupa o sítio operador. não há transcrição nem tradução. ocorrendo transcrição e tradução.a) Lac . Isto impede o acoplamento da RNA polimerase. e) A lactose não será degradada.Gabarito da 3ª Lista de Exercícios 1. liberando assim o promotor.a) No operon Lac seria indiferente. 3. 2. A. se liga ao sítio operador. A e degradação da lactose pois tanto o códon mutante como o original codificam o mesmo aminoácido não alterando a leitura. b) Haverá leitura dos genes Z. Porque o operon só estará atilado na presença de lactose ou desactivado na presença de triptofano. por outro lado. Logo a RNA polimerase acopla-se ao promotor.

6.é uma proteína sintetizada pelos genes reguladores e é específica para cada operon. que não aceita a ligação da RNA polimerase e. 8. neste caso. . 5. e a regulação processa-se tanto a nível de transcrição como de processamento de hnRNA. a galactose liga-se ao repressor sintetizado por galr. e) Ocorre síntese da beta-galactosidase. b) Idem. portanto. Indutor . isto provoca a inibição do promotor. impedindo a sua ligação ao operador.a) O operon expressa-se continuamente. f) Acumulo de mRNA na célula.a) Galr sintetiza o repressor que se liga ao operador. a sua expressão é contínua a menos que esteja presente o co-repressor específico que.genes. impedindo sua ligação ao operador. deprimindo assim o operon. A sua função é ligar-se ao sítio operador inibindo a expressão do operon. mas a cadeia da beta-galactosídeo permease é sintetizada apenas até o ponto da mutação e não há síntese de betagalactosídeo transacetilase. b) Como indutor. forma um complexo com o repressor. Repressor . uma vez presente.é uma molécula efetora que atua nos sistemas de indução e. Logo haverá o acoplamento da RNA polimerase e a consequente transcrição e tradução do operon. não há expressão do operon pois não haverá transcrição nem tradução. é o triptofano. c) O operon nunca se expressa. 7. d) Idem. Sim porque se tratando de um operon reprimível. a ativação sempre ocorre em cadeia. sempre degradando lactose.

Como você sintetizaria um triplóide de genótipo Aaa? Esquematize: 2) Estudando os cromossomos de um cão macho. 6) Em uma espécie cujo número haplóide é 19 quantos dos elementos abaixo devem haver em cada célula: a) Cromátide na metáfase I? b) Cromossomos na anáfase mitótica? c) Cromátides na metáfase II? d) Cromossomos no final da telófase II? 7) Uma célula de genótipo Aa sofre mitose. Quais os genótipos das células filhas? 9) Quantos tipos diferentes de gametas serão produzidos pelos seguintes genótipos. descobriu-se que ele tinha um cromossomo Y e dois cromossomos X (cariótipo 79. com distrofia muscular (gene recessivo. na prófase I e prófase II em uma espécie caracterizada pelo genoma 2n=6. se todos os genes estiverem situados em cromossomos diferentes? a) AA b) Aa c) AaBB d) AaBb e) AABbCC f) AaBBCcddEe . Qual foi o erro que deu origem a esse animal? Em qual dos pais ocorreu este erro? Por quê? 3) Esquematize e compare as células germinativas.4ª Lista de Exercícios Divisão Celular e Alterações Cromossômicas 1) Imagine 2 planta de genótipo AA e aa. XXY). 4) Quantos cromossomos há nas células do intestino na anáfase II? 5) Como você sintetizaria um pentapoliplóide (5n)? Esquematize. ligado ao X). Seus pais eram normais e sem distrofia muscular. Quais os genótipos das células filhas? 8) Uma célula de genótipo Aa sofre meiose.

B e C se encontram todos no mesmo cromossomo e não ocorrem mecanismos de recombinação? 11) Um indivíduo produz os gametas AB.10) Quantos e quais os tipos de gametas podem ser produzidos pelo seguinte genótipo heterozigoto AaBbCc. Se a aveia comum é um hexaplóide desta mesma série. considerando que os loci A. quantos cromossomos deve possuir? 15) O número haplóide de um certo organismo é 12. aB e ab em igual proporção. a) Qual o seu genótipo? b) Os genes A e B encontram-se no mesmo cromossomo? Justifique. Quantos cromossomos devem ser encontrados em: a) Um monossômico? b) Um trissômico? c) Um tetrassômico? d) Um trissômico duplo? e) Um nulissômico? f) Um monoplóide (ou haplóide)? g) Um triplóide? h) Um tetraplóide? 16) Considerando um cromossomo normal com a sequência de bandeamento 12345678 determine o tipo de alteração e o provável esquema de pareamento com o homólogo normal em cada uma das situações abaixo: a) 12365478 b) 125678 c) 1234345678 d) 12345876 . a) Quantos cromossomos um rato deve receber de sua mãe? b) Qual o número haplóide do rato? 14) A aveia abssínia parece ser um tetraplóide com 28 cromossomos. Ab. 12) Em que estágio do ciclo celular ocorre a replicação do DNA? 13) Existem 40 cromossomos nas células somáticas do rato.

b) As características fenotípicas. uma vez que todo o material genético está presente e o fenótipo é. determine o resultado esperado. normal. . 18) Classifique os arranjos cromossômicos simbolizados abaixo: a) n b) 2n c) 2n + 1 d) 2n − 1 e) 2n + 2 f) 3n g) 4n h) 2n + 1 + 1 i) 2n − 2 19) Suponha que parte do braço curto de um cromossomo 5 da espécie humana se ligue não reciprocamente ao braço longo do cromossomo 13. Contudo. Determine o tipo de alteração ocorrida e todas as possibilidades de segregação durante a gametogênese. Uma alteração cromossômica resultou nos arranjos ABCPQR e MNODEF. Este fenômeno é considerado uma translocação simples balanceada. portanto. quando um dos cromossomos 5 apresenta a falta de um segmento no seu braço curto ocorre uma anomalia conhecida como “cri du chat” e três cópias do braço curto levam à morte logo após o nascimento. Se uma pessoa portadora de translocação simples se casa com um companheiro normal. considerando: a) As características cromossômicas.17) O cromossomo 1 da Drosophila possui a sequência gênica ABCDEF e o cromossomo 2 a sequência MNOPQR.

Prófase II: Número de cromossomos = 3 e número de cromátides = 6. f) 12. e) 2. g) 36. Se não ocorrer recombinação entre eles. porque se estivessem no mesmo cromossomo a formação dos quatro tipos de gametas seria devida à ocorrência de permuta. O erro ocorreu na mãe onde houve ligação dos cromossomos que não se separaram durante a meiose. 7. 6. Cruzamento entre um 8n + 2n ou 4n + 6n. b) 2. 9. 3. f) 8. Todos Aa 8.a) 1. . h) 48. b) 76. Ela pode ser heterozigota sendo fenotipicamenete normal. e) 22. c) 2. 13. c) 26. 10. c) 38. 11. 4.a) AaBb. permanecerão os mesmos cromossomos: ABC e abc. a) 76. que não ocorre em todas as células e as proporções seriam diferenciadas.Gabarito da 4ª Lista de Exercícios 1. Cruzamento entre AA e aa induzindo mutação nos genes aa (fazendo com que permaneçam ligados). d) 4. 42. 2. b) 20. Fase S.a) 23. O pai só fornece Y não tendo como passar a distrofia. d) 19. b) Não. a) 20. Mutação. 12. b) 25. Para o macho. 5. d) 26. 50% A e 50% a. 14. 15. No intestino não ocorre anáfase II. No intestino são células somáticas que sofrem apenas mitose e não meiose. Prófase I: número de cromossomos = 6 e número de cromátides = 12. basta a presença de apenas um gene recessivo para que manifeste a doença.

a) Características cromossômicas: 1 normal: 1 translocado simples balanceado: 1 portador de deleção heterozigoto do braço curto do cromossomo 5: 1 portador de duplicação heterozigota do braço curto do cromossomo 5. d) Inversão terminal heterozigota. h) Dupla Trissomia. MNODEF. MNOPQR. e) Tetrassomia. MNODEF.16. 19.a) Inversão intercalar heterozigota. Translocação recíproca heterozigota. ABCPQR. MNOPQR. f) Triploidia. ABCDEF. MNOPQR. b) Diploidia. c) Trissomia. 18. b) Deleção intercalar heterozigota. b)1 “cri du chat”: 2 normais: 1 morte precoce. 17. MNOPQR. ABCDEF. ABCPQR. g) Tetraploidia. MNODEF. . c) Duplicação intercalar heterozigota. i) Nulissomia. d) Monossomia. Possíveis gametas: ABCDEF.a) Haploidia ou monoploidia.

Sign up to vote on this title
UsefulNot useful