P. 1
Exercicios Resolvidos Sobre Dna e Rna

Exercicios Resolvidos Sobre Dna e Rna

|Views: 14.338|Likes:
Publicado porDyvison Pimentel

More info:

Published by: Dyvison Pimentel on Apr 05, 2012
Direitos Autorais:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as DOC, PDF, TXT or read online from Scribd
See more
See less

05/11/2015

pdf

text

original

1ª Lista de Exercícios

Natureza e Função do Material Genético

1) Num organismo diplóide um pesquisador verificou que uma molécula de DNA continha 22% de GUANINA. Com base nesta informação determine qual o percentual de cada uma das outras bases. 2) Se o conteúdo de AT em uma molécula de DNA é de 36%, quais são os conteúdos de todas as bases? 3) Explique porque no experimento de Avery e colegas, o material tratado com DNAse não produziu colônias patogênicas. 4) Um vírus, cujo material consiste de uma fita de RNA, tem aproximadamente 22% de seus RNA nucleotídeos consistindo de URACIL. Qual é a frequência de ADENINA? 5) Se um RNAm sintético conter 35% de ADENINA e 65% de GUANINA posicionados ao longo do polinucleotídeo, que aminoácidos são esperados para serem incorporados no polipeptídeo e em que proporções? 6) É preparado um extrato celular com células pnemocócicas patogênicas. Que efeito terá a mistura desta cultura comum a de pnemococus não patogênicos se a primeira for submetida a tratamento com: a) Protease? b) RNAse? c) DNAse? 7) Que propriedades químicas possuem o DNA e as proteínas que permitem a marcação específica de uma ou outra destas macromoléculas com um isótopo radioativo? 8) Qual a contribuição do experimento realizado por Hershey e Chase para a Genética? Como o objetivo foi alcançado? 9) Considere uma partícula viral contendo uma molécula de 200.000 pb (pares de bases): a) Quantos nucleotídeos devem estar presentes? b) E quantos átomos de fósforo?

10) Foi demonstrado experimentalmente que a maioria das sequências altamente repetitivas de DNA de cromossomos eucariotos não são transcritas. O que isto indica a respeito da função deste tipo de DNA? 11) O que você entende por “orientação anti-paralela” das fitas de DNA? 12) Os ácidos nucleicos são constituídos por cadeias polinucleotídicas. Descreva resumidamente este tipo de composto. 13) Cite as principais diferenças entre RNA e DNA quanto à estrutura de nucleotídeos? 14) Quais as principais características da molécula de DNA? 15) Explique o que é e porque ocorre a complementariedade de bases nitrogenadas. 16) Se uma fita de desoxirribonuclease tiver 5’ATAAGCGTTAG 3’, como será a molécula de DNA? constituição

17) O DNA do fungo Neurospora crassa tem um conteúdo de A + T de 37%. Qual o conteúdo de cada uma das bases? 18) O DNA da bactéria “Bacillus hipoteticus” tem um conteúdo de T + C de 46%. Qual o conteúdo de cada uma das quatro bases? 19) Porque surgem os fragmentos de Okasaki? 20) Qual a importância do empacotamento do DNA e como ele se processa? 21) O isótopo radioativo do nitrogênio N15 pode ser usado para marcar radioativamente compostos que possuam nitrogênio na sua composição, como é o caso dos ácidos nucleicos. Uma cultura de Escherichia coli cresceu em um meio contendo exclusivamente N15 até que todo o DNA estivesse marcado. Então transferiu-se a colônia para um meio contendo nitrogênio comum N14 e deixou-se que crescesse por, exatamente, duas gerações. Fazendo-se então uma avaliação do DNA, quanto deveria ser encontrado contendo: a) Somente N15? b) Híbrido (uma fita N14 e outra N15)? c) Somente N14?

14. GAA 7. Que não codificam nenhum polipeptídeo.46%.96%. GAG . AAG . . 5.78%. AGG . AAA . b) Idem.7. AGA . acompanhando a trajetória dos vários componentes virais marcados radioativamente em um processo normal de infecção.Respostas da 1ª Lista de Exercícios 1. 2. 4.a) 400. GGG .7. 7. C = 32%. Significa que as duas cadeias polinucleotídicas de uma mesma molécula de DNA são invertidas uma em relação à outra. na mesma extremidade da outra será encontrado o radical oxidrila (da posição 3’).96%. 6.14. G = 32%. 10.a) Haverá formação de células patogênicas. não tendo. 11. C = 22%. b) Idem. Não se tem como determinar. atividade genética.28%. A = 28%. A = 18%.78%.000. c) Haverá formação de células não patogênicas. Comprovaram que o material que possui atividade genética é o DNA. 3. O DNA é rico em fósforo mas não possui enxofre. G = 22%. 8. portando. T = 28%. enquanto que as proteínas são ricas em enxofre e não possuem fósforo. GGA . Conseguiram demonstrar que apenas o DNA penetra na célula infectada sendo transmitido à geração viral descendente. T = 18%.14.78%. se em uma extremidade de uma delas se encontrar o radical fosfato (que ocupa a posição 5’ do nucleotídeo). 9.4. Porque a DNAse destrói o DNA da bactéria patogênica não permitindo que a bactéria apatogênica incorporasse o DNA da bactéria patogênica e se transformasse em bactéria patogênica. isto é. uma vez que o RNA é simples fita não sendo as bases pareadas.96%.27.

superespiralização da cadeia de nucleossomos. . Tal especificidade é provocada pela habilidade de formação de pontes de hidrogênio (duas entre T e A e três entre C e G). Não é possível determinar uma vez que T e C não são complementares. No RNA encontra-se a pirimidina uracil que no RNA é substituída pela timina. Porque. na posição 3’ da pentose encontra-se uma oxidrila e na posição 5’ um fosfato. 5’ ATAAGCGTTAG 3’ 3’ TATTCGCAATC 5’ 17. b) 50%. Ocorre em três etapas: espirilização das duas fitas. 15. originando a dupla hélice.12.5%.5%. O empacotamento é necessário para permitir que moléculas extremamente longas consigam caber em espaço exíguo (núcleo). 19.5%. formando uma dupla hélice. É constituída por duas cadeias polinucleotídicas complementares uma à outra orientadas antiparalelamente espiraladas para a direita. T = 18. o crescimento total 3’ → 5’ ocorre pela síntese de pequenos fragmentos 5’ → 3’ denominados fragmentos de Okasaki. Deste modo. c) 50%. com a participação das histonas. A = 18. C = 31.5%. 18.a) Nenhum. Cada nucleotídeo é constituído por uma base cíclica nitrogenada ligada a uma pentose. 20. A união das bases entre as duas fitas de DNA é sempre específica ocorrendo os pareamentos C-G e T-A. 16. tendo perdido a oxidrila da posição 2’. G = 31. A união dos vários nucleotídeos entre si é promovida por ligações fosfodiéster entre a oxidrila 3’ de um nucleotídeo e o grupamento fosfato 5’ do seguinte. 21. as DNApolimerases conseguem sintetizar apenas no sentido 5’ → 3’. A pentose do RNA é uma ribose enquanto que a do DNA é uma desoxiribose. 13. embora a replicação ocorra de modo bidirecional. 14. formação de nucleossomos.

SER .LEU .2ª Lista de Exercícios Síntese Proteica 1) Quais as principais diferenças entre a replicação.ASN .LEU . Quais as conclusões que podemos retirar desta informação? 4) Assumindo a sequência de nucleotídeos no DNA: 3' GTC 5' 5' CAG 3' Onde GTC é a fita molde: a) Que aminoácido é codificado por esta trinca? b) Se uma mutação ocorresse e como consequência transformasse a adenina para a forma tautomérica na replicação.ALA . quais seriam as respostas para as perguntas acima? 3) A taxa de replicação em bactérias corresponde a 450 nucleotídeos por segundo.ALA .LYS para LYS .HIST .PRO .MET . transcrição e a tradução de procariontes e eucariontes? 2) Considere o segmento de fita de DNA abaixo: 3' AAAGAACGATGATTTCGGATT 5' a) Qual a sequência de bases do RNAm correspondente? b) Quantos tRNAs serão utilizados na síntese? c) Quais os anti-códons dos tRNAs acima considerados? d) Quantos aminoácidos poderão ser codificados? e) Qual a sequência de aminoácidos codificados? f) Considere que esta sequência sofra splicing e que os introns ocorram a cada 2 códons no hnRNA. enquanto que em mamíferos é de 45 nucleotídeos.ALA .HIST .ALA .LYS a) Quais as sequências de nucleotídeos do RNA velho e novo? b) Que tipo de RNA é? c) Qual o nucleotídeo que foi adicionado e qual foi deletado? 6) Explique o processo de excisão de introns ou "SPLICING": . que aminoácido seria codificado? 5) Uma única adição de nucleotídeos e uma deleção aproximadamente 15 pontos distantes do DNA causam a mudança na sequência de uma proteína de: LYS .VAL .SER .

CIS .PRO .AUG 3' a) De que ácido nucleico ela faz parte? b) Quais os outros ácidos nucleicos relacionados com tal sequência e suas respectivas bases nitrogenadas? c) Se da sequência dada resultar um segmento de proteína. para este gene. Uma parte de sua sequência é: .GLY .TRP .PRO . quais os aminoácidos que estariam presentes? 12) Como a transcrição é: a) Iniciada? b) Terminada? 13) Considerando-se a sequência de códons 5’ AUG CGA 3’ responda justificando: a) De que molécula do ácido nucleico faz parte? b) Qual o anti-códon correspondente? c) De que molécula a resposta b) faz parte? .HIST Qual a base molecular para cada mutação? Qual é a sequência de DNA que especifica esta parte da proteína? 10) É comum.GLU .CIS . 8) Porque apenas 61 trincas (sequências de nucleotídeos) codificam aminoácidos? 9) Você está estudando em E.GLU .VAL – LIS .LIS .PRO .ALA . encontrarmos uma frequência de erro. uma série de mutantes que não mostram atividade enzimática.HIST MUTANTE 2 . coli um gene que especifica uma proteína.HIST Você obtém.ALA .TRP . Porque esta taxa não é maior? Explique: 11) Considere a sequência de bases nitrogenadas abaixo como parte de uma molécula de ácido nucleico: 5' UGA . tanto na síntese de RNA quanto no processo de tradução do RNAm.CIS .ALA .LIS . Isolando os produtos enzimáticos mutantes.ALA . você encontra as seguintes sequências: MUTANTE 1 .PRO MUTANTE 3 .ARG .7) É verdadeira a afirmação? "Existe 1 (um) códon e anti-códon específico para cada tRNA". de aproximadamente 1 em 10000 nucleotídeos. na natureza.

18) A fita não template (anti-sense) de um gene que tem a seguinte sequência: 5’ CCGGCTGATTTAGAAATGATGTTATATATAATATAATGTGCCCAATG 3’ Qual a constituição do polipeptídeo codificado por este gene? 19)Explique como o tRNA assegura a correta tradução de acordo com as leis do código genético. c) Após a deleção uma adição de timina após a sequência GG. enquanto que o mRNA é degradado rapidamente. . Forneça os peptídeos produzidos considerando as seguintes situações: a) A molécula original do DNA. um intron de 5 e outro exon de 6. qual o mRNA correspondente se a fita template for 3’ ð 5’? 15) Moléculas de rRNA são relativamente estáveis. 17) Discuta as principais características do código genético. qual a sequência de hnRNA? b) Dê o nucleotídeo da extremidade 5’ deste RNA. c) Considerando que a molécula de DNA é constituída por um exon de 6 nucleotídeos. Discuta possíveis causas e consequências deste fato. b) A deleção da segunda citosina. 20) Considerando o molde 3’ TACCGGAATTGC 5’.d) Qual a sequência template (sense ou molde) correspondente? e) E a não template? f) A que molécula as duas últimas respostas pertencem? 14) Em uma longa molécula de DNA isolou-se o seguinte segmento: 5’ ATCTTTAGGCTACAGGT 3’ 3’ TAGAAATCCGATGTCCA 5’ a) Se a fita sense for 5’ ð 3’. 16) Diga o que você sabe sobre as fitas sense e anti-sense do DNA. d) Como seria designado o resultado final? 21) Explique porque existem na natureza várias formas diferentes para um mesmo gene.

o pesquisador encontrou 6 diferentes tipos de revertentes. cada um com diferente tipo de aminoácido na posição originalmente ocupada pelo triptofano: ser. thr. gln e lis. A mutação sem sentido estudada era UAG. Quais das seguintes substituições se espera serem induzidas com maior frequência? Explique: a) Met > Val b) Lis > Trp c) Lis > Gln d) Pro > Arg e) Pro > Gln 23) Estudando uma mutação sem sentido em Escherichia coli um pesquisador verificou que a cadeia polipeptídica era terminada na posição relativa ao triptofano na cadeia normal. Induzindo revertentes com agentes mutagênicos capazes de provocar substituições em um único par de bases cada um. glu.22) O 5 bromouracil é um mutágeno químico análogo à timina que se caracteriza por induzir transições. leu. UAA ou UGA? Porquê? .

EUCARIONTES • Realizada no núcleo.AGU .a) GLN b) PRO 5.ILE fa) 5’ UUU UUA AAC CA 3’ fb) 3 fc) 3’ AAA AAU UUG 5’ fd) 3 fe) LIS . O tamanho da molécula de DNA de uma bactéria é menor e menos condensada que o DNA de um mamífero sendo que esta leva mais tempo para desenrolar a mesma quantidade de nucleotídeos que o DNA de procariotos.a) velho: AAA .LEU 3. • Desenrrolamento do DNA por atuação de enzimas em uma ponta. • Início em vários pontos no mesmo momento. • Enzimas específicas de iniciação.FIM . enlongamento e terminação próprios de procariotos.ASN .AAA . Tradução • Enzimas específicas de iniciação.GCU . 4.ARG . ocorrendo uma série de modificações do RNA antes que ele possa servir no início do processo (introns e exons). enlongamento e terminação próprios de eucariotos.UCA .CCA . sendo em seguida utilizada na síntese de proteínas e posteriormente degradada.ARG .Gabarito da 2ª Lista de Exercícios 1.FEN . PROCARIONTES Replicação • Realizada no nucleoplasma. 2.GLU . • É bem mais complexo. Transcriçã • A molécula de RNA se o constitui mo mRNA propriamente dito.CUU .a) 5’ UUU CUU GCU ACU AAA GCC UAA 3’ b) 7 c) 3’ AAA GAA CGA UGA UUU CGG AUU 5’ d) 3 e) LIS .AAU .GCU .

Os segmentos de DNA transcritos que estarão efetivamente presentes no mRNA final são denominados exons.UUA . Para cada um dos códons presentes em uma molécula de mRNA encontra-se uma molécula de tRNA com um único anti-códon complementar.3’ ACT TCA 5’.GAA .CAC .GUG .AAA . são reconhecidos pelos fatores de liberação de proteínas que promovem a ejecção das subunidades de ribossomos. codificam o fim da síntese denominados sem sentido e não codificam nenhum aminoácido. O mRNA produzido pela transição em eucariotos é uma molécula com muito mais ribonucleotídeos que o necessário para a síntese de uma proteína ou enzima.CAU (mutação de ponto ocorrendo primeiro transversão no terceiro par de bases e. UAG. c) Fim .UGG . UGA. assegurando o correto pareamento.MET . Porque 3 trincas UAA.GCU .UGU . Caso pareie uma base incorreta há enzimas capazes de perceber este erro retirando a base que foi inserida erroneamente. 6. Em vez disso. Mutante 1: GCA .GCU . após sua síntese sofre um processamento no qual serão cortadas as sequências que não estarão no mRNA final (introns).CAU (mutação de sentido errado com adição de uma trinca errada) Mutante 2: GCA .UGU .CAU . transversão no segundo par de bases) 10.AUG . Devido aos mecanismos de reparo capazes de restabelecer a integridade do DNA.CCA .AAA b) mRNA c) Deleção de A na segunda trinca de nucleptídeos e adição de G na sexta trina de nucleotídeos.GUC .UGA (mutação de ponto . 9. 8.GGG . Sim. A processividade é de alta fidelidade não formando a ligação se não tiver a base correta. embora cada aminoácido possa ter 1 a 4 anti-códons apropriados a ele.CCA .AAA . 7.CCA . 11. Cada anti-códon é específico para um dado aminoácido.transição) Mutante 3: GCA . O hnRNA.a) mRNA b) DNA molde .novo: AAA . Portanto seu significado é exatamente o fim da síntese. segundo.

mas genes diferentes podem ser copiados de diferentes fitas da mesma molécula. O RNA é necessário permanentemente na célula pois participa de todo e qualquer processo de síntese. b) uracil. O tRNA apresenta especificidade tanto para o aminoácido como para o códon. c) 5’ UAGAAAUGUCCA 3’.ISO . A sua degradação impede o acumulo excessivo tanto do próprio mRNA como também do seu produto específico.a) mRNA. o que significa que cada aminoácido pode ser codificado por mais de um códon. Não existe qualquer tipo de separação entre códons contíguos nem sobreposições. d) 5’ TCGCAT 3’. enquanto que uma determinada molécula de mRNA só é necessária para a síntese de um determinado peptídeo. c) tRNA. desconectando-se deste 13. PRO .12. garante a inserção correta do aminoácido na cadeia polipeptídica.LEU . b) 5’ CAU 3’ e 5’ UCG 3’. 17. a correspondência corretamente sequenciada.ASP .MET . b) A RNA polimerase reconhece uma sequência de terminação no DNA. f) DNA. É degenerado. 15. de acordo com a sequência de códons presentes no mRNA. 16.a) A RNA polimerase reconhece e acopla-se à sequência promotora do DNA. 19. 14. Cada gene usa sempre a mesma fita como “sense” ou “template”. sendo complementar e antiparalelo.LEU .MET .TYR .ALA . O código genético assegura a colinearidade de informações entre a molécula de DNA e a cadeia polipeptídica. isto é. A fita “sense” é a fita da molécula de DNA que serve de molde para a síntese de mRNA. a) 5’ UGGACAUCGGAUUUCUA 3’.ISO. e) 5’ ATGCGA 3’. Deste modo. mas existem sinais específicos de início e fim de tradução (dois códons de iniciação e três de determinação).GLU . no momento em que este for requerido pelo organismo. . mesmo em diferentes espécies). 18. mas não é ambíguo e é universal (cada códon codifica sempre o mesmo aminoácido.

a) MET .TRE. porque é o único terminador que com apenas uma alteração pode originar os seis aminoácidos. As formas diferentes chamadas alelos. b) MET . 22. Apenas MET > VAL. UAG. surgem por mutação e são uma importante fonte de variabilidade e diversidade. .LEU .20. assegurando uma maior probabilidade de sobrevivência entre as espécies.LEU . 21. d) Mutação de sentido errado. pois é a única situação que envolve transição. c) MET .PRO. 23.PRO .TRE.ALA .

. 4) Os operons. e) Mutação sem sentido em lac y. mas ausentes em eucariotos. 3) Considerando os operons lac e trp como modelos de indução e repressão. impedindo a sua mutação. inibindo o acoplamento do repressor à lactose. impedindo a ligação do repressor. Explique o que ocorre se houvesse: a) A presença de triptofano no meio celular. Y. um promotor ou um operador. 6) Diferencie repressores e indutores. coli. respectivamente. c) Uma mutação do tipo deleção de base nos genes estruturais (Z. formulado por Jacob e Monod. A). f) Mutação de localização desconhecida. 5) Uma mutação é uma alteração na sequência de nucleotídeos de um gene. b) Uma mutação do tipo substituição de bases silenciosa do gene operador (O). isto implica que estes não controlam a expressão de seus genes? Justifique. c) Mutação no promotor impedindo o acoplamento da RNA polimerase. d) Mutação em lac i. Explique os efeitos de cada uma das mutações abaixo no operon lac da Escherichia coli: a) Mutação no operador. descreva: a) A condição mais frequente de cada um destes operons. e) Uma mutação de sentido errado no primeiro gene estrutura. serve para explicar a regulação gênica das enzimas que degradam a lactose em E. b) As alterações ocorridas quando moléculas efetoras estão presentes. que impede a degradação de mRNA lac. b) Mutação em lac i (gene regulador). d) Presença de glicose no meio celular. que regulam eficientemente a expressão de conjuntos de genes estruturais relacionados entre si são comuns em bactérias.3ª Lista de Exercícios Regulação Gênica 1) Porque o mecanismo do triptofano é dito negativo e da lactose é dito positivo? 2) O modelo do operon.

7) O operon lac é responsável pela produção de enzimas que participam da reação metabólica de síntese de triptofano e é constituído por 5 genes estruturais. Galr codifica um repressor e a galactose é um indutor do sistema. O seu gene regulador situa-se em um outro ponto do DNA. cujos produtos estão envolvidos no metabolismo do açúcar galactose. b) Na presença da galactose. e um promotor. Na ausência de triptofano ocorre síntese enzimática? Porquê? 8) Em Escherichia coli o operon da lactose compreende 3 genes estruturais: galk. um operador que responde à um complexo repressor/co-repressor. Descreva a sequência de processos: a) Na ausência da galactose. galt e gale. .

que comportam vários escalões de . inibindo o promotor. se liga ao sítio operador. Este perde a capacidade de se ligar ao operador. inibindo o promotor. Trp . Trp . c) A lactose não será degradada pois haverá mutação de sentido errado não sendo formadas as enzimas Z.Gabarito da 3ª Lista de Exercícios 1.O repressor sintetizado pelo gene regulador é inativo.a) No operon Lac seria indiferente. por outro lado. Y. não sendo capaz de se ligar ao sítio operador do operon. A lactose é indutora enquanto o triptofano é um repressor. d) O operon Lac não será ativado e não haverá produção das enzimas Z. e deste modo. O complexo repressor/co-repressor ocupa o sítio operador. ocorrendo transcrição e tradução. Sendo eficientemente tamponados contra a maioria das influências externas os eucariotos não necessitam de mecanismos de resposta direta mas. A. quando presente.O operon permanece inativado porque a proteína repressora. 4. b) Haverá leitura dos genes Z. A e degradação da lactose pois tanto o códon mutante como o original codificam o mesmo aminoácido não alterando a leitura.É induzido pela lactose que. que não aceita a ligação da RNA polimerase. inativando-o. b) Lac . Isto impede o acoplamento da RNA polimerase. o que faz com que haja transcrição e subsequente síntese enzimática.a) Lac .Y. o que é assegurado pelos chamados “circuitos pré programados de expressão gênica”. uma vez que comportam reações metabólicas muito mais complexas. sintetizada pelo gene regulador. 2. e) A lactose não será degradada. não há transcrição nem tradução. Os operons são sistemas de regulação que respondem a estímulos diretos do meio externo. liberando assim o promotor. também necessitam de sistemas de regulação gênica muito mais elaborados. Y. Não há tradução nem transcrição. 3. estabelece um complexo com o repressor. Logo a RNA polimerase acopla-se ao promotor. Porque o operon só estará atilado na presença de lactose ou desactivado na presença de triptofano. Nestes. A.O triptofano age como co-repressor que se liga ao repressor ativando-o.

Sim porque se tratando de um operon reprimível. . Repressor . portanto. impedindo sua ligação ao operador. a ativação sempre ocorre em cadeia. que não aceita a ligação da RNA polimerase e. mas a cadeia da beta-galactosídeo permease é sintetizada apenas até o ponto da mutação e não há síntese de betagalactosídeo transacetilase. impedindo a sua ligação ao operador. A sua função é ligar-se ao sítio operador inibindo a expressão do operon. b) Como indutor.a) Galr sintetiza o repressor que se liga ao operador. é o triptofano. 6. neste caso.genes.a) O operon expressa-se continuamente. f) Acumulo de mRNA na célula. Logo haverá o acoplamento da RNA polimerase e a consequente transcrição e tradução do operon. forma um complexo com o repressor. a sua expressão é contínua a menos que esteja presente o co-repressor específico que. b) Idem. isto provoca a inibição do promotor. sempre degradando lactose. 7. 8. uma vez presente. e a regulação processa-se tanto a nível de transcrição como de processamento de hnRNA. c) O operon nunca se expressa. deprimindo assim o operon. 5.é uma molécula efetora que atua nos sistemas de indução e. não há expressão do operon pois não haverá transcrição nem tradução. d) Idem.é uma proteína sintetizada pelos genes reguladores e é específica para cada operon. Indutor . e) Ocorre síntese da beta-galactosidase. a galactose liga-se ao repressor sintetizado por galr.

Qual foi o erro que deu origem a esse animal? Em qual dos pais ocorreu este erro? Por quê? 3) Esquematize e compare as células germinativas. Como você sintetizaria um triplóide de genótipo Aaa? Esquematize: 2) Estudando os cromossomos de um cão macho. com distrofia muscular (gene recessivo. na prófase I e prófase II em uma espécie caracterizada pelo genoma 2n=6. Seus pais eram normais e sem distrofia muscular. se todos os genes estiverem situados em cromossomos diferentes? a) AA b) Aa c) AaBB d) AaBb e) AABbCC f) AaBBCcddEe .4ª Lista de Exercícios Divisão Celular e Alterações Cromossômicas 1) Imagine 2 planta de genótipo AA e aa. 4) Quantos cromossomos há nas células do intestino na anáfase II? 5) Como você sintetizaria um pentapoliplóide (5n)? Esquematize. Quais os genótipos das células filhas? 8) Uma célula de genótipo Aa sofre meiose. ligado ao X). XXY). Quais os genótipos das células filhas? 9) Quantos tipos diferentes de gametas serão produzidos pelos seguintes genótipos. 6) Em uma espécie cujo número haplóide é 19 quantos dos elementos abaixo devem haver em cada célula: a) Cromátide na metáfase I? b) Cromossomos na anáfase mitótica? c) Cromátides na metáfase II? d) Cromossomos no final da telófase II? 7) Uma célula de genótipo Aa sofre mitose. descobriu-se que ele tinha um cromossomo Y e dois cromossomos X (cariótipo 79.

Se a aveia comum é um hexaplóide desta mesma série. considerando que os loci A. aB e ab em igual proporção. B e C se encontram todos no mesmo cromossomo e não ocorrem mecanismos de recombinação? 11) Um indivíduo produz os gametas AB. a) Quantos cromossomos um rato deve receber de sua mãe? b) Qual o número haplóide do rato? 14) A aveia abssínia parece ser um tetraplóide com 28 cromossomos.10) Quantos e quais os tipos de gametas podem ser produzidos pelo seguinte genótipo heterozigoto AaBbCc. quantos cromossomos deve possuir? 15) O número haplóide de um certo organismo é 12. Ab. Quantos cromossomos devem ser encontrados em: a) Um monossômico? b) Um trissômico? c) Um tetrassômico? d) Um trissômico duplo? e) Um nulissômico? f) Um monoplóide (ou haplóide)? g) Um triplóide? h) Um tetraplóide? 16) Considerando um cromossomo normal com a sequência de bandeamento 12345678 determine o tipo de alteração e o provável esquema de pareamento com o homólogo normal em cada uma das situações abaixo: a) 12365478 b) 125678 c) 1234345678 d) 12345876 . 12) Em que estágio do ciclo celular ocorre a replicação do DNA? 13) Existem 40 cromossomos nas células somáticas do rato. a) Qual o seu genótipo? b) Os genes A e B encontram-se no mesmo cromossomo? Justifique.

portanto. uma vez que todo o material genético está presente e o fenótipo é. Contudo.17) O cromossomo 1 da Drosophila possui a sequência gênica ABCDEF e o cromossomo 2 a sequência MNOPQR. quando um dos cromossomos 5 apresenta a falta de um segmento no seu braço curto ocorre uma anomalia conhecida como “cri du chat” e três cópias do braço curto levam à morte logo após o nascimento. determine o resultado esperado. b) As características fenotípicas. normal. considerando: a) As características cromossômicas. Determine o tipo de alteração ocorrida e todas as possibilidades de segregação durante a gametogênese. Uma alteração cromossômica resultou nos arranjos ABCPQR e MNODEF. Se uma pessoa portadora de translocação simples se casa com um companheiro normal. 18) Classifique os arranjos cromossômicos simbolizados abaixo: a) n b) 2n c) 2n + 1 d) 2n − 1 e) 2n + 2 f) 3n g) 4n h) 2n + 1 + 1 i) 2n − 2 19) Suponha que parte do braço curto de um cromossomo 5 da espécie humana se ligue não reciprocamente ao braço longo do cromossomo 13. Este fenômeno é considerado uma translocação simples balanceada. .

Prófase II: Número de cromossomos = 3 e número de cromátides = 6. Para o macho. b) 25. 13. porque se estivessem no mesmo cromossomo a formação dos quatro tipos de gametas seria devida à ocorrência de permuta. No intestino não ocorre anáfase II. Cruzamento entre AA e aa induzindo mutação nos genes aa (fazendo com que permaneçam ligados). 9. 11. Todos Aa 8. que não ocorre em todas as células e as proporções seriam diferenciadas. Prófase I: número de cromossomos = 6 e número de cromátides = 12. 14. Ela pode ser heterozigota sendo fenotipicamenete normal. O pai só fornece Y não tendo como passar a distrofia. permanecerão os mesmos cromossomos: ABC e abc. c) 38.Gabarito da 4ª Lista de Exercícios 1. b) 2. 15. 10. d) 19. 50% A e 50% a. b) Não. c) 2. Se não ocorrer recombinação entre eles. c) 26. 12.a) AaBb. 7. 3. d) 26. 2. Fase S. 4. 42. f) 12. a) 20. f) 8. 6. b) 20. No intestino são células somáticas que sofrem apenas mitose e não meiose. .a) 23. Cruzamento entre um 8n + 2n ou 4n + 6n. Mutação. e) 2. h) 48.a) 1. d) 4. g) 36. 5. e) 22. b) 76. O erro ocorreu na mãe onde houve ligação dos cromossomos que não se separaram durante a meiose. basta a presença de apenas um gene recessivo para que manifeste a doença. a) 76.

a) Haploidia ou monoploidia. b) Diploidia. b) Deleção intercalar heterozigota. ABCDEF. MNOPQR. ABCPQR. b)1 “cri du chat”: 2 normais: 1 morte precoce. c) Trissomia. . MNOPQR. 18. d) Monossomia. f) Triploidia. MNODEF. h) Dupla Trissomia. g) Tetraploidia. ABCPQR. 19. 17.a) Características cromossômicas: 1 normal: 1 translocado simples balanceado: 1 portador de deleção heterozigoto do braço curto do cromossomo 5: 1 portador de duplicação heterozigota do braço curto do cromossomo 5. Translocação recíproca heterozigota. MNOPQR. Possíveis gametas: ABCDEF. ABCDEF. MNOPQR.a) Inversão intercalar heterozigota. MNODEF. e) Tetrassomia. i) Nulissomia. MNODEF.16. c) Duplicação intercalar heterozigota. d) Inversão terminal heterozigota.

You're Reading a Free Preview

Descarregar
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->