Você está na página 1de 367

Copyright

© 2017 by Zachary Weinersmith and Kelly Weinersmith TÍTULO ORIGINAL


Soonish

PREPARAÇÃO
Pedro Staite
REVISÃO
Cristiane Pacanowski | Pipa Conteúdos Editoriais Laís Curvão
ILUSTRAÇÃO DE CAPA
Zach Weinersmith
ADAPTAÇÃO
Aline Ribeiro
REVISÃO DE E-BOOK
Mariana Calil

GERAÇÃO DE E-BOOK
Intrínseca

E-ISBN

978-85-510-0334-3
Edição digital: 2018

1ª edição

Todos os direitos desta edição reservados à


EDITORA INTRÍNSECA LTDA.
Rua Marquês de São Vicente, 99, 3º andar 22451-041 – Gávea
Rio de Janeiro – RJ
Tel./Fax: (21) 3206-7400
www.intrinseca.com.br

Dedicado a nossos pais,
Patricia e Carl Smith
e

Phyllis e Martin Weiner,

sem os quais este livro jamais teria sido concluído.


Vocês nos alimentaram, cuidaram de nós quando ficamos doentes,
tomaram conta de Ada quando não podíamos
e asseguraram que fizéssemos uma pausa para tomar ar de vez em quando.
Seremos sempre gratos pelo que fizeram para transformar nosso sonho em realidade.
Este livro é tão nosso quanto de vocês.1

1. É claro que estamos guardando o dinheiro só para a gente. Mas o sentimento está aí.
SUMÁRIO

Folha de rosto
Créditos
Mídias sociais
Dedicatória

1. Introdução

SEÇÃO 1
O universo, logo, logo

2. ACESSO BARATO AO ESPAÇO: A fronteira final é cara demais


3. MINERAÇÃO EM ASTEROIDES: Revirando o ferro-velho do sistema solar

SEÇÃO 2
Coisas, logo, logo

4. ENERGIA DE FUSÃO: É a energia do Sol, e isso é legal, mas será capaz de


fazer minha torradeira funcionar?
5. MATÉRIA PROGRAMÁVEL: E se todas as suas coisas pudessem ser
qualquer uma de suas coisas?
6. CONSTRUÇÃO ROBÓTICA: Faça uma sala de jogos para mim, servo de
metal!
7. REALIDADE AUMENTADA: Uma alternativa para consertar a realidade
8. BIOLOGIA SINTÉTICA: É mais ou menos como Frankenstein, só que o
monstro passa o livro inteiro fazendo remédios e insumos industriais
obedientemente

SEÇÃO 3
Você, logo, logo

9. MEDICINA DE PRECISÃO: Tudo o que há de errado especificamente com


você — uma abordagem estatística
10. BIOIMPRESSÃO: Por que parar na sétima margarita se você pode
simplesmente imprimir um fígado novo?
11. INTERFACES CÉREBRO-COMPUTADOR: Porque depois de quatro bilhões
de anos de evolução você ainda não consegue lembrar onde deixou as chaves

12. CONCLUSÃO: Ainda demora, ou O cemitério dos capítulos perdidos

Agradecimentos
Referências bibliográficas
Sobre os autores
Leia também
1.

Introdução

Este é um daqueles livros em que prevemos o futuro.


Felizmente, prever o futuro é bem fácil. As pessoas fazem isso o tempo todo.
Acertar a previsão é um pouco mais difícil, mas, para ser bem franco, quem se
importa?
Há um estudo de 2011 chamado “Are Talking Heads Blowing Hot Air”2
[“Cabeças falantes estão falando bobagem?”], que avalia a capacidade de previsão
de 26 especialistas. O poder de previsão variou de “quase sempre correto” a
“geralmente errado”.3
Para a maioria das pessoas, o prazer de ler esse estudo foi descobrir que
determinados indivíduos eram não apenas idiotas insuportáveis, mas idiotas
estatisticamente insuportáveis. De nossa perspectiva de escritores que querem
tornar a ciência acessível a todos, houve um resultado ainda mais empolgante:
independentemente da perícia premonitória, todas essas pessoas ainda têm empregos.
Na verdade, muitos dos piores previsores eram as figuras públicas mais
proeminentes.
Se de fato não há nenhuma relação entre capacidade de previsão e uma carreira
bem-sucedida, nós nos pusemos em uma excelente posição. Afinal, aqueles
especialistas estavam apenas tentando prever o que acontecerá a curto prazo com
um pequeno número de atores políticos disputando poder. Eles não estavam
tentando decidir se teremos um elevador para o espaço daqui a cinquenta anos ou
se em breve estaremos transferindo os dados de nossos cérebros para a nuvem,4
ou se máquinas imprimirão novos fígados, rins e corações, ou se hospitais usarão
pequenos robôs nadadores para curar doenças.
Sinceramente, é bem difícil dizer se alguma das tecnologias deste livro será
realizada por completo em algum período específico. Novas tecnologias não são
simplesmente a lenta acumulação de coisas cada vez melhores. Os grandes saltos
descontínuos, como o laser e o computador, com frequência dependem de
desenvolvimentos não relacionados de diferentes campos. E mesmo que essas
grandes descobertas sejam feitas, nem sempre está claro se determinada
tecnologia encontrará um mercado. Sim, viajantes do tempo de 1920, nós temos
carros voadores. Não, ninguém quer esses carros. Eles são o boxe-xadrez5 dos
veículos — muito divertido para se assistir de vez em quando, mas quase sempre
preferimos ter as duas coisas separadas.
Considerando que qualquer previsão que fazemos neste livro pode estar não só
errada como também ser uma estupidez, decidimos empregar algumas estratégias
que aprendemos ao ler outros autores que anteveem o futuro.
Primeiro, algumas previsões preliminares:
Prevemos que os computadores ficarão mais rápidos. Prevemos que a resolução
das telas será mais alta. Prevemos que o sequenciamento genético será mais
barato. Prevemos que o céu continuará azul, filhotinhos de cachorros continuarão
fofos, tortas serão para sempre saborosas, vacas continuarão mugindo e toalhas de
mão decorativas continuarão a fazer sentido apenas para sua mãe.

Esperamos que você confira isso daqui a alguns anos para avaliar nossa
precisão. Por favor, observe que não especificamos um período, portanto as
opções de classificação são “correto” ou “não incorreto”.
Agora que fizemos a primeira rodada de previsões, estamos preparados para
mais algumas. Prevemos que foguetes reutilizáveis reduzirão o custo de
lançamento de foguetes em algo entre 30% e 50% nos próximos vinte anos.
Prevemos que em trinta anos será possível diagnosticar a maioria dos casos de
câncer com um exame de sangue. Prevemos que nanobiomáquinas vão curar a
maioria das doenças genéticas nos próximos cinquenta anos.
Está bem, isso dá um total de onze previsões. Acreditamos que se acertarmos
umas oito temos que ser considerados gênios. Ah, e se alguma previsão do
primeiro grupo se tornar realidade, você poderá escrever reportagens inteligentes
com títulos como “casal que previu o futuro do sequenciamento genético diz que
viagens espaciais serão baratas num futuro próximo”.
Prever o futuro com precisão é difícil. Bem difícil.
Novas tecnologias quase nunca são obra de gênios isolados com uma boa ideia.
À medida que o tempo passa, isso é cada vez mais verdadeiro. Determinada
tecnologia do futuro talvez precise que algumas tecnologias intermediárias se
desenvolvam antes, e muitas delas podem parecer irrelevantes ao serem
descobertas.
Um dispositivo recentemente desenvolvido que discutiremos é chamado de
dispositivo supercondutor de interferência quântica, também conhecido como
SQUID. Esse aparelho, muito sensível, detecta campos magnéticos sutis no
cérebro, uma maneira de analisar os padrões de pensamento das pessoas sem
fazer buracos em seus crânios.
Como conseguimos essa coisa?
Bem, um supercondutor é qualquer material que conduz eletricidade sem
perder nenhuma eletricidade no processo. É diferente de um velho condutor
comum (como o fio de cobre), que é um ótimo transmissor, mas perde um pouco
de eletricidade no caminho.
Temos supercondutores porque, há cerca de duzentos anos, Michael Faraday
estava fazendo alguns objetos de vidro e sem querer transformou um gás em
líquido ao mantê-lo sob pressão num tubo de ensaio. Como não havia TV
naquela época, alguns caras de meados do século XIX ficaram realmente
animados com a ideia de liquefazer gases.
Como se sabe, é mais fácil liquefazer gases a partir do resfriamento do que pela
pressurização. Esse insight levou cientistas a desenvolverem tecnologias de
refrigeração avançadas, que lhes permitiram liquefazer elementos que em geral
são gasosos, como hidrogênio e hélio. E quando temos hidrogênio ou hélio
líquidos, podemos usá-los para resfriar praticamente o que quisermos.
A temperatura do hélio, por exemplo, é de aproximadamente -268ºC no
estado líquido. Se o derramarmos sobre quase qualquer coisa, ele se torna gás e
leva o calor consigo, até a coisa que estamos resfriando ficar também com
aproximadamente -268ºC.6
Cientistas acabaram se perguntando o que acontece com os condutores
quando os resfriamos de fato. Os condutores tendem a aumentar sua eficácia
quando resfriam. Em termos simples, isso acontece porque os condutores são
como canos para os elétrons, mas não são perfeitos. Num fio de cobre, por
exemplo, os átomos de cobre entram no caminho do movimento do elétron.
O que chamamos de “aquecer” é apenas uma agitação rápida num nível
atômico. Quando aquecemos (ou agitamos) átomos num fio de cobre, eles ficam
mais propícios a impedir que os elétrons se movam na direção da corrente, da
mesma forma que é mais difícil seguir pela rua se o cara na sua frente ficar
ziguezagueando. No nível dos átomos, agitar (ou aquecer) torna mais provável
que elétrons batam nos átomos de cobre, aumentando ainda mais a agitação. É
por isso que o carregador do seu laptop fica quente depois de algum tempo de
uso.
Quando colocamos aquele hélio líquido no condutor, a energia de agitação dos
átomos de cobre é transferida para os átomos de hélio, que então voam para
longe. Agora nossos átomos de cobre estão menos agitados e os elétrons
enfrentam muito menos resistência. Quanto mais frios eles ficam, mais
facilmente os elétrons fluem.
Na época houve um debate sobre o que aconteceria se nos aproximássemos de
uma agitação zero. Alguns pensaram que a condutância cessaria, porque nessa
temperatura o movimento seria impossível até para os elétrons. Outros acharam
que a condutância ficaria muito melhor, mas nada de especial aconteceria.
Então os pesquisadores começaram a derramar gases ultrafrios em elementos
metálicos. Aconteceu, de maneira bizarra, que alguns metais se tornaram
condutores perfeitos (ou supercondutores) quando alcançaram certa temperatura
muito baixa. Se o metal fosse mantido frio o bastante para superconduzir, seria
possível colocar a corrente elétrica num circuito e ela ficaria circulando ali para
sempre. Pode parecer um fato científico divertido e bonitinho, mas esse
fenômeno leva a todo tipo de esquisitice! Essa corrente em circuito gerava um
campo magnético. E, com isso, podíamos transformar esses metais frios em ímãs
permanentes, cuja força magnética seria determinada pela quantidade de
corrente.
Mais tarde, nos anos 1960, um cara chamado Brian Josephson (que ganhou o
Prêmio Nobel, mas agora passa os dias em Cambridge defendendo besteiras
meio mágicas, como fusão a frio e “memória da água”) descobriu um arranjo de
supercondutores que permite a detecção de pequenas variações em campos
magnéticos. Esse dispositivo, chamado Junção Josephson, acabou abrindo espaço
para o desenvolvimento do SQUID.
Pois bem. Pense o seguinte: se há duzentos anos alguém chegasse para você e
perguntasse como poderíamos construir um dispositivo para examinar os padrões
cerebrais das pessoas, será que sua resposta seria “Bem, primeiro precisamos
prender um pouco de gás num tubo de ensaio”?
Imaginamos que não. Na verdade, até mesmo o grande passo técnico mais
recente — a Junção Josephson, que, vale repetir, foi descoberta por um homem
que pensa ser possível a água se lembrar do que você pôs nela — foi considerado
impossível do ponto de vista teórico quando proposto pela primeira vez. O
comportamento da Junção Josephson foi explicado posteriormente, a partir de
uma estrutura desenvolvida muito depois da morte de Michael Faraday.
A natureza contingente do desenvolvimento tecnológico é o motivo pelo qual
não temos uma base lunar, embora acreditássemos que ela já existiria hoje em dia.
Mas temos supercomputadores de bolso, o que poucas pessoas conseguiram
prever.7
A mesma dificuldade vale para todas as tecnologias deste livro: a possibilidade
de construir um elevador para o espaço pode depender da perícia dos químicos ao
combinar átomos de carbono para fazer canudinhos. A produção de uma matéria
que assuma qualquer formato pode estar condicionada ao nosso entendimento
sobre o comportamento do cupim. A fabricação de nanorrobôs médicos talvez
dependa de entendermos bem o origami. Ou então pode ser que nada disso
tenha qualquer importância no fim das contas. Não há nada na história que teve
que ser necessariamente como foi.
Sabemos hoje que os gregos antigos podiam criar sistemas de engrenagem
complexos, mas nunca fabricaram um relógio avançado. Os alexandrinos antigos
tinham um motor a vapor rudimentar, mas nunca projetaram um trem. Os
egípcios antigos inventaram há quatro mil anos o banco dobrável, mas nunca
abriram uma loja de móveis.
Tudo isso é para dizer: não sabemos quando qualquer uma dessas coisas vai
acontecer.
Então por que escrever este livro? Porque há coisas incríveis acontecendo todos
os dias, o tempo todo, por toda parte, e a maioria das pessoas não sabe. Há
também indivíduos que se tornam céticos porque imaginavam que a esta altura
teríamos energia de fusão ou viagens de fim de semana a Vênus. Essa decepção
nem sempre se deve a cientistas que fazem promessas exageradas sobre o futuro;
com frequência, livros como este aqui omitem os desafios econômicos e técnicos
que se põem entre nós e o futuro retratado na ficção.
Não sabemos por que quase sempre esses desafios são deixados de fora dos
livros. Será que a história da Apollo 11 seria melhor se chegar à Lua fosse fácil?
Do nosso ponto de vista, parte do que torna a ideia de uma interface cérebro-
computador tão empolgante é que neste momento não temos quase nenhuma
pista sobre como decodificar pensamentos. Há uma fronteira ilimitada de
perguntas e descobertas a serem feitas, glórias a serem conquistadas e heróis a
serem laureados.
Escolhemos dez diferentes campos emergentes para explorarmos com você e
os ordenamos mais ou menos do maior para o menor: do espaço sideral para
usinas de energia experimentais gigantes, passando pelas novas formas de
construir coisas e vivenciar o mundo, indo para o corpo humano até chegar ao
seu cérebro. Sem querer ofender.
Nosso princípio norteador para cada capítulo foi: se você estivesse sentado
num bar e alguém lhe perguntasse “Ei, que negócio é esse de energia de fusão
nuclear?”, qual seria a melhor resposta possível? Argumentaram que não sabemos
como são os bares, mas a intenção é que cada capítulo defina o que é a tecnologia,
em que ponto está neste exato momento, quais são os desafios para sua realização,
de que maneiras ela pode arruinar tudo e como ela pode tornar as coisas
maravilhosas.
Para nós, o progresso científico não é estimulante só porque proporciona novas
coisas para as pessoas. Saber como seria difícil escavar uma mina em um
asteroide ou construir uma casa com um enxame de robôs torna essas coisas mais
interessantes. E isso significa que quando elas enfim acontecerem,8 você
entenderá exatamente como são empolgantes.
Você também entenderá um pouco sobre os estranhos desvios e becos sem
saída em que a ciência e a tecnologia se metem. Ao fim da maioria dos capítulos,
fornecemos uma nota bene sobre alguma novidade esquisita (idiota ou
impressionante) que descobrimos. Algumas vezes, essas seções estão diretamente
relacionadas aos capítulos e outras são apenas esquisitices em que esbarramos
enquanto fazíamos a pesquisa. São realmente estranhas. Como um polvo feito de
pão de milho.
Para todos os capítulos, tivemos que ler muitos livros técnicos e teses e tivemos
que falar com muitas pessoas meio loucas. Algumas eram mais loucas do que
outras, e em geral foram as nossas favoritas. A única experiência unificadora em
toda a pesquisa que fizemos foi que em cada tópico nossas ideias preconcebidas
foram destruídas. Em cada caso, conforme pesquisávamos, descobríamos que não
só não havíamos compreendido a tecnologia em si como não tínhamos entendido
o que impedia seu desenvolvimento. Com frequência, o que parecia complicado
era fácil, mas o que parecia fácil era complicado.
Novas tecnologias são bonitas, mas, assim como a Pietà de Michelangelo ou O
pensador de Rodin, em geral é um terrível pé no saco concebê-las. Queremos que
você entenda o que é a tecnologia e por que o futuro resiste com tanta teimosia
aos nossos melhores esforços.

Kelly e Zach Weinersmith


Mansão Weinersmith, setembro de 2016

Obs.: Também queremos que você saiba de um experimento singular em que


estudantes universitários foram forçados a respirar por uma narina só e depois
fazer provas. É relevante de certa forma. A gente jura!

2. Feito por um grupo de estudantes de políticas públicas da Hamilton College. É, na verdade, baseado em
uma amostragem pequena. Mas, como confirma nossa inclinação, optamos por acreditar nele.
3. Fato divertido: ter diploma de direito foi correlacionado a ser pior em previsão.
4. Apple iCloud caso este livro se saia bem. Amazon Cloud caso se saia mal.
5. É um esporte de verdade, e não surpreende que seja popular na Rússia. O atleta alterna rounds de xadrez e
boxe até perder num deles.
6. Para entender por quê, pense nisso como derramar água fria em uma panela quente. A panela transfere um
pouco de seu calor para a água e, assim, resfria. Você pode resfriá-la mais rápido retirando a água e
derramando mais água fria. A água fria tem mais ou menos 10ºC, então você pode continuar resfriando a
panela até ela atingir 10ºC. Depois disso, a água e a panela ficam com a mesma temperatura, então o calor
não pode mais ir de um lugar para o outro. Seria como tentar se enxugar com uma toalha que está tão
molhada quanto você. Não dá para ficar mais seco sem uma toalha mais seca, e não dá para ficar mais frio
sem um líquido mais frio.
7. Esse tipo de coisa às vezes causa uma angústia excessiva nas pessoas, como na recente capa da MIT
Technology Review, que mostrava o astronauta Buzz Aldrin, que caminhou na Lua, com o título “VOCÊ
PROMETEU COLÔNIAS EM MARTE. EM VEZ DISSO, GANHEI O FACEBOOK”. Mas, para sermos justos, o
estabelecimento de uma colônia em Marte custaria alguns trilhões de dólares, ao passo que o Facebook é de
graça. E vale a pena notar que a escolha do Facebook é um pouco astuciosa. Imagine se tivessem escolhido a
Wikipedia: “VOCÊ PROMETEU COLÔNIAS EM MARTE, MAS O QUE GANHEI FOI APENAS TODO O
CONHECIMENTO HUMANO INDEXADO E DISPONÍVEL GRATUITAMENTE A TODOS NO PLANETA.”

8. Até mesmo enquanto escrevíamos este livro, duas tecnologias aqui presentes deram um grande salto.
Tivemos que atualizar o capítulo sobre acesso barato ao espaço depois que a SpaceX pousou várias vezes
estágios de seu foguete Falcon 9, e também foi preciso incorporar informações mais atualizadas no capítulo
sobre realidade aumentada porque as pessoas ainda falam de Pokémon GO.
SEÇÃO 1
O universo, logo, logo
2.

Acesso barato ao espaço


A fronteira final é cara demais

Para o alto, ao longo do imenso, delirante e ardente azul...


Encontrei-me nas alturas varridas pelo vento com o coração cheio de graça
Onde nunca voaram os pássaros, nem mesmo a águia
E, com minha mente elevada aos céus e com o silêncio, caminhei...
Pelo nunca antes ultrapassado espaço sagrado
Estendi a mão e toquei a face de Deus
• John Gillespie Magee Jr., “Voo Alto”, 1941

Você notará imediatamente nesse poema que ele não menciona preço uma vez
sequer. É o tipo de clara omissão técnica feita com frequência na poesia, portanto,
estamos acrescentando mais uma parelha:
E quando perguntei qual era o preço do espaço,
Dei meia-volta, porque, AI, MEU DEUS!

Neste exato momento, enviar meio quilo de algo ao espaço custa 10 mil
dólares.9 Isso dá mais ou menos 2.500 dólares por cheesebúrguer.
É por isso que os seres humanos só estiveram na superfície da Lua em seis
ocasiões, e é por isso que nossos veículos lunares eram finos como papel em
alguns pontos. O fato de termos agora um paradigma de viagem espacial que
teria frustrado todas as esperanças de 1969 não se deve à falta de engenharia ou
de gênios científicos. É porque o custo da viagem ao espaço permaneceu
implacavelmente elevado. Se conseguíssemos uma redução drástica dessa despesa,
teríamos uma ciência espacial melhor, sistemas de comunicação mais eficazes,
acesso a recursos fora do planeta, mais capacidade de controlar nosso clima e, o
melhor de tudo, o sistema solar se abriria à exploração e à colonização.
Para entender por que hoje em dia é tão caro levar coisas ao espaço, precisamos
entender o que estamos olhando quando vemos um foguete.
Um foguete é, basicamente, um tubo de propelente explosivo com um
pouquiiiinho de carga na ponta. Para uma típica missão à Órbita Terrestre Baixa
(LEO, na sigla em inglês; a mais ou menos quinhentos quilômetros de altura, e
aonde a maioria dos lançamentos vai), em termos de massa trata-se de 80% de
combustível, 16% do foguete propriamente dito e 4% de carga (na realidade, os
4% são o máximo, e se o destino for mais distante, é algo mais perto de 1% ou
2%).
Mas quando observamos o custo, as coisas se invertem. O propelente é um
componente desprezível do preço — custa apenas algumas centenas de milhares
de dólares. Portanto, a maior fração dos gastos corresponde ao foguete em si, que
quase sempre é descartado após o uso.
Resumindo: lançar foguetes é realmente caro, e a maior parte do espaço a
bordo é ocupada pelo propelente. Isso nos deixa duas formas para tentarmos
reduzir drasticamente o custo do acesso ao espaço:

1. Recuperar o veículo de lançamento.


2. Usar menos propelente.

A recuperação do veículo virou realidade de repente, em 2015, o que


abordaremos na seção sobre foguetes reutilizáveis. No entanto, a ideia básica é
bem simples: podemos poupar dinheiro se não jogarmos fora nosso veículo após
utilizá-lo uma vez.
Usar menos propelente é um pouco mais complicado, embora ele represente
80% da massa de uma nave espacial no lançamento. Para entender por quê,
considere uma situação em que você precisa dirigir da Rússia até a África do Sul
e voltar. Você tem duas maneiras de obter combustível:

1. Abastecer em postos ao longo do caminho.


2. Pegar todo o combustível necessário para a viagem inteira e levá-lo com
você.

É claro que você preferiria a opção 1. Mas vejamos por quê, nesse caso
específico.
Um carro é uma máquina que converte combustível em movimento para a
frente. Se o carro for pesado, é preciso mais combustível para obter certa
quantidade de movimento para a frente. Se o abastecemos regularmente, a maior
parte de seu peso advém do próprio carro, não do combustível. Isso significa que
o combustível que o motor está usando nesse exato momento fornece movimento
para a frente principalmente ao veículo (e a você e sua bagagem), não ao
combustível no tanque.
Na opção 2, você está arrastando um tanque enorme. O peso do combustível
provavelmente é muito maior do que o peso do carro. Sobretudo no começo, você
está usando a maior parte da energia derivada do combustível para mover o
próprio combustível. Portanto, a maior parte da energia do combustível é usada para
mover outro combustível.
O resultado? A quantidade total de combustível necessária é muito maior no
caso 2 do que no caso 1. Seu pequeno trailer, assim como todos os foguetes
espaciais, é feito em sua maior parte de combustível, não de veículo ou carga.
Infelizmente, é um pouco difícil construir postos de gasolina para foguetes.
Então, sem uma grande mudança, em se tratando de viagem espacial, estamos
presos ao cenário 2.
Tudo isso propicia uma matemática irresistível. Se conseguíssemos transformar
o veículo de lançamento em uma unidade recuperável, poderíamos eliminar 90%
do custo do lançamento espacial. Ou, se fosse possível usar apenas três quartos do
combustível, poderíamos acomodar seis vezes mais carga10 dividindo
imediatamente por seis o custo da massa.
O difícil aqui é que estamos lutando contra a física básica. A órbita disponível
mais barata é a LEO. As pessoas com frequência pensam que “órbita” não tem
gravidade. Mas isso está errado. Na verdade, a Estação Espacial Internacional
(que neste momento se encontra na LEO) em geral fica a quatrocentos
quilômetros de altura e está submetida a 90% da gravidade que você experimenta
na Terra. Então, por que os astronautas flutuam como se não houvesse gravidade
alguma? Porque eles estão indo muito, muito, muito rápido. A oito quilômetros
por segundo. Embora sejam puxados para a Terra o tempo todo, eles sempre a
“perdem”.
Pense nisso desta maneira: imagine que você dispara uma bala de canhão do
alto de um arranha-céu. Se você a disparar suavemente, a bala seguirá um pouco
para a frente e em seguida cairá no chão. Se a disparar incrivelmente rápido, ela
voará para o espaço. Mas entre cair perto e ganhar o espaço há muitos cenários
intermediários. Para determinada altura há uma velocidade que é lenta demais
para a bala conseguir sair da Terra, mas rápida o bastante para não se estatelar no
chão. Se estivesse montado nessa bala de canhão, você cairia aos poucos, porque a
gravidade o puxa para baixo. Ao mesmo tempo, como você está indo muito
rápido, poderia ver a curva da Terra. Quando nos movemos em linha reta a partir
de um ponto do globo, a Terra se curva para baixo e se afasta, aumentando nossa
distância da superfície. Nessa velocidade específica, temos dois efeitos que se
contrabalançam: a gravidade puxa você para baixo, mas a velocidade o mantém
no alto. Então continua indo, indo e indo. Você “orbita”.
Embora a LEO seja a órbita mais barata, ainda é bem caro chegar lá. Colocar
um pedação de metal viajando a oito quilômetros por segundo não é uma tarefa
fácil. Se quisermos que as naves espaciais se pareçam com aquelas do cinema, e
não com latas gigantes embrulhadas em papel-alumínio, precisaremos
desenvolver uma maneira mais em conta.
Em que pé estamos agora?
Método 1: foguetes reutilizáveis

Os foguetes reutilizáveis são a melhor aposta para um voo espacial mais barato
a curto prazo. São foguetes tradicionais, mas, em vez de caírem no oceano, como
fazem hoje em dia, eles caem na Terra e aterrissam depois da missão. Isso não
resolve o problema de o foguete ter apenas 4% de carga, mas tem potencial para
reduzir bastante o custo.
Entretanto, existem algumas dificuldades nessa abordagem. É preciso ter
propelente extra a bordo para a fase de aterrissagem, o que reduz a eficiência. O
intuito é carregar a menor quantidade possível de propelente extra, mas isso
complica muito a fase de aterrissagem.
Uma questão crucial é que ninguém sabe ainda quanto custará restaurar um
foguete usado. A parada foi para o espaço, cara! Você não pode simplesmente dar
uma lustrada nela e colocá-la de volta na plataforma de lançamento.
O Ônibus Espacial dos Estados Unidos, criado para ser um veículo de
lançamento reutilizável, acabou saindo mais caro do que um foguete comum
exatamente porque restaurá-lo era muito caro. Há uma discussão atualmente
sobre quem é o culpado — os engenheiros, o Congresso, a Força Aérea, o público
avesso a riscos e outros —, mas o ponto principal é que o programa, em grande
parte, foi encerrado por causa do custo de preparar o ônibus para um novo
lançamento depois de um voo. Foi por isso que, apesar de ter havido gente triste
com a aposentadoria do ônibus, muitos nerds espaciais ficaram felizes por vê-lo ir
embora.
Mas há um motivo para esperar que um veículo de lançamento reutilizável
melhor seja criado. Enquanto escrevíamos este capítulo, a SpaceX se tornou a
primeira empresa a levar uma carga ao espaço com êxito e depois aterrissar parte
de seu foguete.11
Se a empresa puder realmente reduzir o preço, isso poderá se provar a maior
evolução das viagens espaciais em uma geração. Enquanto assistíamos a um
lançamento, um leitor nosso tuitou que, embora tivesse testemunhado o pouso
lunar quando criança, achou o foguete reutilizável ainda mais empolgante. Parece
loucura, mas ele tinha um bom argumento: o pouso na Lua foi certamente a
maior façanha técnica, mas seu custo meio que garantiu a impossibilidade de que
se tornasse corriqueiro. Qual exatamente pode ser a redução do custo é uma
questão de debate. Elon Musk aparentemente alegou que poderia reduzi-lo a um
centésimo do valor. Em um prazo mais curto, a presidente da SpaceX, Gwynne
Shotwell, declarou que o atual Falcon 9 deles deverá ser capaz de oferecer um
desconto de 30%. Mas mesmo que signifiquem apenas uma pequena queda no
preço agora, os foguetes reutilizáveis podem representar também uma via para
maiores economias no futuro. O caminho para Marte poderá ser pavimentado
com pequenos descontos.

Método 2: foguetes e aviões espaciais que respiram ar

Os aviões já voam bem alto. Será que não conseguimos fazê-los ir um pouco
mais alto para que cheguem ao espaço?
Não. Por que você perguntaria isso? Meu Deus...
Se quisermos colocar um satélite em órbita, a parte difícil não é ir bem alto. É
ir bem rápido. Isso exige muito propelente. Mas o uso de um avião espacial
poderia permitir uma redução drástica. Para entender por quê, você precisa
entender o que é propelente.
Se você chamar propelente de “combustível”, um engenheiro da Nasa vai dar
na sua cara com uma TI-83.12 O propelente, na verdade, é uma combinação de
duas coisas: combustível e oxidante. Para haver uma reação de combustão,
precisamos de três materiais: combustível, oxidante e energia. Por exemplo,
quando acendemos uma fogueira num acampamento, o combustível é a madeira,
o oxidante é (você adivinhou) o oxigênio e a energia é um palito de fósforo aceso.
Em um foguete, o combustível e o oxidante estão dentro da nave. A proporção
efetiva entre oxidante e combustível varia de acordo com o foguete e a missão,
mas em geral a maior parte da massa do propelente é oxidante. O oxidante é,
com frequência, oxigênio líquido. Por que carregar todo esse oxigênio líquido se o
foguete está literalmente cercado de oxigênio durante a maior parte da viagem?
A versão resumida é que estamos querendo simplificar. O foguete é uma
maneira brutal de se chegar ao espaço. Você põe tudo de que precisa num grande
tubo e, com uma explosão, abre caminho para o céu. Com um avião, talvez seja
possível melhorar sua eficiência ao tirar o oxidante do ar, em vez de carregá-lo
consigo, mas você está adicionando muito mais complexidade a uma máquina
que já é complicada.
O grande problema do avião espacial é que precisamos de vários tipos de
motor para dar conta de todas as diferentes velocidades e condições que
encontramos na rota para o espaço. Eis as razões:
A maioria dos aviões hoje usa um motor turboélice. É um pouco complicado,
mas o mecanismo básico é simples. Ventiladores sugam ar para dentro de uma
câmara. O ar é comprimido, então temos muito oxigênio (seu oxidante!) em um
espaço pequeno. O combustível é injetado e começa a queimar. O resultado é ar
quente comprimido canalizado para fora através da parte traseira do motor
enquanto mais ar é sugado pela parte dianteira. Agora, temos ar em pressão alta
atrás do motor e uma pressão relativamente baixa na frente. Esse arranjo nos leva
adiante.
Os turboélices começam a dar problema quando nos aproximamos da
velocidade do som, a cerca de 1.235 km/h,13 também conhecida como Mach 1. À
velocidade do som, o ar não consegue circular pelo avião tão rápido quanto se
acumula. Isso cria problemas se a entrada frontal for um ventilador.
Uma solução para vencer esse obstáculo é o chamado pós-combustor. O pós-
combustor pega o oxigênio restante na parte de trás do turboélice, joga mais
combustível nele e o acende. Resumindo: você provoca uma explosão de
combustível pequena e permanente na parte de trás do avião. Com isso, consegue
se aproximar do Mach 1,5, embora não de maneira supereficiente. Mas, depois de
alcançar o Mach 1,5, você pode usar um tipo diferente de motor chamado ramjet.
O ramjet é de uma simplicidade incrível, mas não é necessariamente fácil de
fazer. Basicamente, é um motor turboélice sem as partes móveis, incluindo o
ventilador. Não é necessário um ventilador para comprimir o ar porque sua alta
velocidade está fazendo esse trabalho. Você voa rápido e o ar é comprimido numa
câmara onde ele fica mais lento à medida que você adiciona e queima
combustível. A desvantagem é que, como a velocidade em si é o compressor, não
é possível dar a partida com um ramjet. Só dá para usá-lo quando estiver a cerca
de 1.770 km/h. Sendo assim, num avião espião SR-71, por exemplo, há um
turboélice que muda de forma para se comportar como um ramjet após atingir a
velocidade apropriada.
Depois de ficar muito, muito rápido (mas ainda não o bastante para
permanecer na LEO), você precisa de um ramjet supersônico, ou “scramjet”. O
scramjet é uma máquina ainda mais simples e ainda mais difícil de se construir.
Basicamente, o ar supersônico entra e, junto com o combustível, é aceso
diretamente, sem jamais perder a velocidade. Isso acontece porque o oxigênio
está chegando muito rápido e há o suficiente para se obter uma combustão
contínua sem compressão. Mas não é fácil, por assim dizer, acender uma vela
num vento supersônico. Os scramjets ainda estão em fase experimental, mas
depois de mais ou menos 7.200 km/h14 se tornam a maneira mais eficiente de ir.
Em teoria, podem levar você até o Mach 25, a velocidade orbital. Houve vários
programas de desenvolvimento do scramjet, a maioria deles de caráter militar, e
todos obtiveram sucesso apenas parcial. Nenhum deles chegou nem perto da
velocidade orbital.
Um avião espacial ideal deve ser capaz de usar todos esses tipos de motor em
sequência para chegar ao espaço. Uma vez lá, onde não há oxigênio disponível,
você provavelmente trocaria para um método tradicional de propelente de
foguete. Mas usar oxigênio do ar, e não do tanque a bordo, permite reduzir o uso
de combustível o bastante para poder transportar dez vezes mais carga.
Ah, e como se trata de um avião, ele pode aterrissar depois. Se isso puder ser
feito repetidas vezes, restringindo seus danos, teremos resolvido o problema de
perda de veículo e o de eficiência de combustível.
A parte difícil é que todas essas máquinas precisam funcionar sob condições
extremas. As condições para otimizar um scramjet são tão extremas que só
simulá-las aqui na Terra já é caro.
Uma empresa britânica chamada Reaction Engines está trabalhando num
veículo chamado Skylon, que usa um motor chamado SABRE, sigla em inglês
para Synergetic Air-Breathing Rocket Engine [Motor de Foguete Sinergético
Respirador de Ar]. Estamos supondo que eles inventaram a parte “ABRE”
rapidamente e depois passaram alguns dias decidindo sobre um S. Em resumo,
trata-se de um foguete, mas que absorve oxigênio ambiente como parte de sua
reação de propulsão. O motor é projetado para transitar com eficiência entre um
turboélice, um ramjet e um foguete. É de se esperar que eles não estejam fazendo
uma fase scramjet porque, bem, ninguém sabe realmente como fazer a fase
scramjet.
Esse é um empreendimento caro e complicado, mas a Reaction Engines tem
um financiamento substancial da Agência Espacial Europeia15 e do governo
britânico. Se as coisas forem bem, eles esperam botar um desses aviões avançados
em utilização na próxima década.
Apesar de todos os aspectos negativos, os foguetes têm a virtude da
simplicidade. Um foguete antiquado funciona bem tanto em baixa quanto em
alta velocidade, em atmosfera densa, rarefeita ou em nenhuma atmosfera.
Portanto, ei, que tal experimentarmos algo ainda mais antiquado?

Método 3: superarmas mega enormes ultra-blaster-gigantescas

Uma maneira de economizar no combustível de foguete é não usar


combustível. Anteriormente, discutimos como os foguetes são sobrecarregados
pela necessidade de usar propelente para acelerar o propelente. E se, em vez de
fazer uma queima controlada relativamente lenta ao longo de todo o percurso até
o espaço, tivéssemos um estrondo gigantesco em terra? Claro, em geral é preciso
usar muitos explosivos, mas nenhuma dessas explosões é usada para erguer mais
explosivos. Isso pouparia muita energia no cômputo total.
Veja bem, isso não será barato. Trata-se de um canhão que é provável que
tivesse centenas de metros de comprimento, com um cano da ordem de três
metros de diâmetro, cheio de toneladas de explosivos, literalmente. Mas há
vantagens: nenhuma parte é descartada, nenhum combustível é usado para
carregar combustível e praticamente cada tiro vai realmente para o espaço.
Isso não é tão louco quanto parece, e houve pelo menos dois projetos do
governo que receberam um grande investimento para explorar esse método, um
dos quais discutimos na nota bene deste capítulo. Mas há dois grandes
inconvenientes:
Primeiro, toda vez que disparamos, precisamos provocar uma explosão enorme.
Portanto, se quisermos usar essa coisa várias vezes e sem gastar demais,
precisamos de um tipo de câmara que resista a várias toneladas de material
explosivo sendo detonadas regularmente.
Segundo, ser disparado por um canhão não é muito divertido. Bem, na
verdade, se você fosse disparado de um canhão espacial, a diversão seria o de
menos. Você se espatifaria.
Não é a velocidade que mata. É a aceleração — a mudança de velocidade.
Quando subimos num elevador, sentimos como se estivéssemos sendo
ligeiramente amassados. Trata-se de uma aceleração suave. Em comparação,
numa montanha-russa, a aceleração pode ser até cinco vezes maior. Com
treinamento, os humanos conseguem resistir a dez ou vinte vezes a aceleração do
elevador sem desmaiar. Mas se passar disso você pode morrer. Por quê? Bem, ao
acelerar um carro, dá para notar que a água de um copo se desloca para trás e
permanece assim até pararmos de acelerar. Imagine que o copo é seu corpo e a
água, seu sangue. Ah, e em vez de 0 a 100 em dez segundos, você está indo de 0 a
27.000.16
Para um canhão espacial à base de explosão, estamos falando de cinco mil a
dez mil vezes um elevador. Nada que seja mole vai para o espaço num canhão,
nem você, seu molenga.
Isso talvez não seja tão ruim quanto parece. Você ainda pode enviar cargas
úteis “duras”, como aparelhos eletrônicos especialmente projetados. Também
pode enviar todo tipo de matéria-prima — metais, plásticos, combustível, água,
carne-seca. De fato, uma ideia é ter um posto de abastecimento em órbita que
receba cargas úteis de combustível de um canhão.
Um canhão espacial em si não é uma boa maneira para explorar do espaço.
Mas se o conjugarmos com uma fábrica em órbita no espaço, talvez dê para
começar alguma coisa. A ideia aqui seria disparar matérias-primas para sua
fábrica orbitante e construir naves espaciais gigantescas na fábrica, que depois
decolariam de lá para explorar o espaço. Para cargas úteis de uma delicadeza
irritante, como humanos, ainda seria necessária uma forma de lançamento mais
fraquinha, como os foguetes. No entanto, em uma grande missão que já está no
espaço, a maior parte do que estamos levando é metal, plástico e suprimentos
para os sacos de carne delicados que estão participando dela. Todas essas coisas
podem ser “endurecidas” e disparadas para a órbita.
Outra opção é ter um canhão cuja velocidade aumente aos poucos para que a
carga sinta um nível de aceleração mais adequado aos humanos.
Por exemplo, você pode ter uma sequência de explosões propagando a
aceleração ao longo do tempo. A desvantagem é que estamos dificultando e
encarecendo um sistema que já é caro e difícil. Agora são dezenas de explosões
em vez de uma, o que significa um cano mais longo e um potencial de erro muito
maior.
Outra opção é ter um canhão eletromagnético. Você começa com um trem que
levita magneticamente. Esses trens “MagLev”, sigla em inglês para “levitação
magnética”, flutuam sobre um campo magnético, o que é importante porque,
num trilho convencional, após determinada velocidade os trilhos começam a
entortar e até a derreter. Você põe esse veículo e seu trilho num tubo sem ar com
cerca de 160 quilômetros de comprimento. Em seguida, continua usando campos
magnéticos fortes para impulsionar a velocidade dele. É simplesmente um
impulso a uma velocidade explosiva, mas sem as explosões. O aspecto positivo é
que o método é muito mais limpo e de reutilização muito mais fácil. O aspecto
negativo é que os materiais necessários — o tubo ultralongo vazio e o sistema de
trem — seriam muito mais caros.
Isso, porém, também tem um problema: mesmo que a aceleração seja
distribuída ao longo do tempo, o projétil em algum momento deve sair do tubo,
indo de um ambiente sem ar para a atmosfera em hipervelocidade.
Para entender o que acontece quando o projétil sai do tubo, considere o
seguinte: mover-se pelo ar é o mesmo que ter ar passando por você. São
partículas de ar batendo em seu corpo. Os ventos mais extremos da Terra
acontecem nos tornados, e os ventos mais velozes registrados são de 480 km/h.
Se quisermos alcançar a órbita na velocidade certa, precisamos ser de cinquenta a
cem vezes mais rápidos do que isso ao dispararmos o canhão.
A essa velocidade, o ar está lutando contra você com tanta contundência que
literalmente queima. Então não temos apenas muita resistência do ar como
também uma explosão. Nada bom para a carga.
Uma maneira de contornar esse problema é construir uma estrutura tão alta
que a carga só saia do tubo quando estiver na atmosfera superior rarefeita. A
atmosfera se torna menos densa muito rapidamente depois que ultrapassamos
quarenta quilômetros de altitude. O problema dessa abordagem é que não
sabemos como construir nada que tenha quarenta quilômetros de altura. A
estrutura mais alta que os humanos já fizeram tem aproximadamente oitocentos
metros de cima a baixo,17 e é um arranha-céu, não um trilho de lançamento.
Mesmo que soubéssemos como construir isso, custaria um valor obsceno.
Mas as pessoas ainda estão tentando fazer com que métodos de canhão
funcionem, e existem algumas variantes desse conceito, incluindo duas ideias que
têm os melhores nomes deste capítulo: o “Slingatron” [algo como “Estilingatron”]
e o “trenó-foguete”.
O Slingatron é um canhão eletromagnético sobre um trilho em espiral.
Conversamos com Jason Derleth, do Nasa Innovative Advanced Concepts
(Niac), uma espécie de refúgio para pessoas com ideias espaciais loucas que
podem funcionar. Segundo Derleth, “infelizmente, é muitíssimo improvável que
o Slingatron funcione. Eu realmente gosto dele. Acho uma ideia brilhante, mas o
que acaba acontecendo é que você deve colocá-lo no topo do monte Everest para
ele ter ao menos uma chance, porque ele está lutando contra a resistência do ar o
tempo todo”.

O trenó-foguete é basicamente outro canhão eletromagnético, que, em vez de


acelerar o projétil, está impulsionando um trenó que carrega um foguete. O trenó
vai realmente rápido, chegando em alta velocidade até a parte mais rarefeita da
atmosfera. Uma vez no alto, o foguete é acionado. A velocidade extra e a altura
proporcionam uma grande economia de combustível. Além disso, você tem um
trenó-foguete.
Todos esses métodos poderiam ser combinados a um sistema ramjet/scramjet.
Lembre-se de que eles funcionam depois que estamos em alta velocidade e são
necessariamente projetados para lidar com condições extremas. Mas, como
acontece com todos os sistemas híbridos, estamos desenvolvendo algo ainda mais
complicado e talvez obtendo apenas um pouco mais de eficiência.
O que nos leva ao outro conceito que o sr. Derleth nos ensinou.

Método 3,5: um supermega enorme ultra-blaster-gigante... pula-


pula?

“Uma das ideias mais interessantes que já ouvi era ridícula à primeira vista, está
bem? Muito, muito idiota... Uma pessoa sugeriu: bem, por que não colocamos
um veículo sobre um pula-pula? Quer dizer, uma coisa mecânica que possamos
pressionar, como uma grande mola, e aplicar um pouco mais de força no começo.
Isso parece idiota, mas provavelmente poderíamos obter mais um percentual de
carga útil se fizéssemos algo assim. É brilhante, muito bom mesmo.”

Método 4: ignição a laser

Os foguetes funcionam basicamente tacando fogo em coisas quentes na parte


de atrás. Quanto mais quente o disparo, mais impulso obtido por volume de
propelente. Uma maneira de esquentar as coisas de verdade seria ter um laser
superpotente a bordo para levar o combustível a temperaturas extremas. Mas isso
pesaria tanto que não valeria a pena.
Então cientistas tiveram uma ideia que provavelmente não entusiasmou os
astronautas: será que poderíamos disparar um laser bem na extremidade traseira
de um foguete em voo? Quando mencionamos isso a Michel van Pelt, da
Agência Espacial Europeia, ele observou: “É uma ideia para digerir com o tempo.
Quer dizer, se você dissesse às pessoas cinquenta, sessenta anos atrás, que entraria
em órbita sentado sobre um monte de combustível de foguete, uma explosão
controlada em essência, é provável que também não soasse muito atrativo.”
Você poderia poupar bastante combustível dessa maneira. De fato, um grupo
sugeriu que com um laser potente o bastante seria possível evitar qualquer uso de
combustível nos primeiros onze quilômetros de atmosfera. Poderíamos ganhar
velocidade simplesmente mega-aquecendo o ar sob o foguete. Depois de certa
altura, seria preciso usar combustível, mas muito menos, graças ao laser
adicionado.
O problema? Estamos falando de um laser enorme, ENORME — em termos
de produção de energia, algo da ordem de cinquenta mil megawatts. Isso equivale
mais ou menos à produção conjunta de cinquenta reatores nucleares de uma vez.
Veja bem, você só precisa disparar o laser por dez minutos. Mas mesmo que não
fosse uma quantidade absurda de energia... bem, nem sabemos como construir
um laser tão potente assim. Os lasers mais potentes que podem ser disparados de
maneira contínua são armas do Exército americano e chegam no máximo a algo
em torno de um megawatt. E são disparados durante apenas um minuto.
Dito isso, se pudéssemos construir megalasers gigantes, talvez houvesse um
bônus adicional para a indústria de foguetes. Um grupo na Universidade Brown
sugeriu recentemente que um laser potente poderia ser usado para reduzir a
resistência do ar em até 95%.
Imagine o seguinte: enquanto você está sendo impelido para cima pela força
do laser, um segundo laser está sendo disparado na região à sua frente. Isso torna
o ar adiante menos denso, diminuindo, assim, o impacto. Agora, seus astronautas
podem ficar um pouco inquietos, já que estão voando bem acima da velocidade
do som com lasers ultrapotentes à frente e atrás deles, mas você poderia resolver
esse problema falando que eles são uns covardes.
Para melhorar, ter uma faixa de ar rarefeito com ar mais denso em volta pode
até ajudar a direcionar o foguete, da mesma forma que, ao entrarmos num bar,
seguimos naturalmente pela área menos lotada.
Um problema nisso tudo, se você for um fracote, é que um laser de cinquenta mil
megawatts é uma arma incrível. Por exemplo, você poderia incinerar
instantaneamente quase qualquer coisa a uma longa distância. Isso talvez
provoque algumas dores de cabeça na esfera geopolítica. Mas, ei, quem sabe se
mostrarmos a outros países como nosso FOGUETE DE DUPLO LASER é
legal eles se importem menos com o risco existencial que ele representa para
todas as nações da Terra. Ou pelo menos falem menos sobre isso.

Método 5: parta de uma altitude elevada

Então, conforme discutimos, a altitude não é o seu principal inimigo, e sim a


velocidade. Porém, começar numa altitude elevada significa começar numa parte
rarefeita da atmosfera. A 9,6 quilômetros de altura, o ar é 90% mais rarefeito. É
por isso que os aviões gastam tanto combustível para chegar ao alto. Quando se
está a 38 mil pés (11,6 quilômetros de altura), a resistência do ar é bem menor.
Vamos focar em três propostas para partir de grandes altitudes: o rockoon, o
espaçoporto estratosférico e o foguete lançado por avião.
O rockoon é simplesmente um foguete que flutua num balão e cuja ignição
acontece lá no alto. Na verdade, não é uma boa opção para um foguete grande.
Quando o balão está subindo, você não tem praticamente nenhum controle sobre
ele. É uma opção longe do ideal quando se está prestes a acender um tubo de
propelente do tamanho de um arranha-céu. Os rockoons foram experimentados
nos anos 1950, mas logo abandonados como método para lançamento espacial.
Ainda assim, nerds dedicados às vezes voam neles para tirar fotos bonitas e,
suspeitamos, para usar a palavra “rockoon”.
Mas será que não poderíamos ter um espaçoporto estratosférico? Por
favorzinho? Poderíamos?
Um dirigível rígido moderno (imagine um zepelim ligeiramente mais
sofisticado) pode transportar cerca de dez toneladas de carga. Um foguete atual,
totalmente abastecido, pesa cerca de quinhentas toneladas. Por mais
impressionante que uma armada de cinquenta dirigíveis possa parecer, isso não
será barato nem fácil de manter.
Como alternativa, você poderia criar um espaçoporto gigante apenas para
sustentar a extremidade de lançamento do trilho de MagLev descrito
anteriormente. Dessa maneira, obtém-se uma saída elevada do tubo de
lançamento sem ter que construir uma estrutura permanente com quarenta
quilômetros de altura. Mas, para fazer isso, agora é necessário ter uma estrutura
flutuante ainda maior, já que ela precisa sustentar um trilho enorme.
Para encurtar a história, grandes dirigíveis provavelmente são uma opção ruim.
Mencionamos isso em especial porque esta é a primeira ideia que a maioria das
pessoas tem ao pensar em alternativas para lançamentos espaciais. Apesar de ser
uma ideia que gostaríamos de verdade que fosse boa, ela está resolvendo o
problema errado. Precisamos de velocidade, não de altitude.
O foguete lançado por avião é um pouco mais interessante, e já foi empregado
pela Virgin Galactic e outros empreendimentos para alcançar o espaço. Em
linhas gerais, pegamos um avião gigante (ou, de acordo com uma proposta, o
equivalente a dois 747 amarrados juntos) e prendemos seu foguete embaixo ou
em cima. Então subimos o máximo e o mais rápido possível e lançamos o
foguete. A ideia é que, partindo com alguma velocidade e altitude, podemos
economizar propelente. Além disso, como o lançamento parte de um avião, não é
preciso se preocupar tanto com as condições do tempo. Se o tempo estiver ruim,
basta levar o foguete para um lugar de ar menos agitado.
O problema é que obtemos apenas um percentual pequeno da velocidade e da
altitude necessárias. Portanto, a economia provavelmente será muito tímida. E
em troca temos que lançar um foguete grande e quente a partir de um mega-
avião, o que aumentará o custo e a complexidade e ao mesmo tempo limitará o
tamanho do foguete. A SpaceX, que já demonstrou interesse em mudar a
maneira como os lançamentos espaciais são feitos, recorreu aos mesmos motivos
para rejeitar esse método.

Método 6: elevadores espaciais e cordas espaciais

Imagine uma grande pedra girando em torno da Terra. Preso à pedra há um


cabo semelhante a uma fita, com cerca de cem mil quilômetros de comprimento.
Ele vai até a superfície terrestre, onde elevadores especialmente projetados levam
cargas, viajantes e naves espaciais para cima e para baixo.
A ideia pode parecer excêntrica, mas tem sido muito estudada (especialmente
pelo dr. Bradley Edwards, ex-membro do Niac), talvez porque representaria a
solução final para as necessidades das viagens ao espaço. Todos os problemas com
os outros métodos são solucionados pelo elevador espacial, embora acrescentando
alguns desafios novos e específicos.
Ter veículos subindo e descendo por cabos significa poder enviar combustível.
Significa também que você não precisa acelerar rápido. Nenhuma parte
descartada, nenhum explosivo perigoso e nenhum impacto forte numa atmosfera
indesejada. Você simplesmente viaja para a órbita que quiser, adquirindo
velocidade em relação à superfície da Terra porque a corda em si já está em
órbita.
Eis mais ou menos como pareceria:

As principais peças são um contrapeso, um cabo e uma estação-base.


O contrapeso está ali para assegurar que o centro da massa de todo o sistema
(incluindo o enorme cabo) esteja no que é chamado de órbita geoestacionária.
Uma coisa está em órbita geoestacionária quando se mantiver sempre no
mesmo ponto ao ser vista por um observador com um telescópio na linha do
equador. Ela está girando em torno da Terra tão rápido quanto o nosso planeta. E
está a uma velocidade e a uma distância específicas que a fazem continuar
rodando em torno da Terra sem precisar de impulso em momento algum.
Pularemos a parte da mecânica orbital, mas os resultados básicos são que o
cabo está relativamente tenso, mas não tanto a ponto de arrebentar; e o
contrapeso não circula a Terra, prendendo o cabo em torno do equador como um
carretel de linha gigante.

Como conseguir um contrapeso é outra questão, mas há três propostas


comuns: capturar um asteroide próximo à Terra, juntar um bocado de lixo
espacial que largamos lá fora ao longo dos anos ou simplesmente ter um cabo
tããããão longo que sua massa por si só o manterá tenso. Achamos a ideia da base
no asteroide gigante a mais romântica, então ficaremos com ela.
Da base no asteroide desce um cabo que tem uma força específica alta. Ou
seja, é forte o bastante para resistir a um rompimento, mas também é muito leve.
Isso é importante, porque se a corda for forte mas pesada, seu peso vai arrebentá-
la. Se a corda for fraca mas leve, ela vai se romper assim que encontrar condições
difíceis, como os ventos da alta atmosfera da Terra.
Supondo que dê para construir o cabo, a última parte é a estação de base na
Terra. A maioria das propostas defende uma plataforma móvel no mar. Isso
porque uma plataforma móvel pode se afastar de um clima ruim e permite ajustar
a posição do cabo para evitar lixo espacial mais acima. Além disso, no mar não
existem leis.
Certo, tudo bem, existem algumas leis. São chamadas de Leis do Mar. Mas
nenhuma delas disserta sobre cabos que vão até o espaço.
As leis que governarão o elevador espacial são, na verdade, bem importantes.
Nossa percepção é a de que a maioria dos cientistas que trabalha nisso gostaria
que o elevador espacial, se um dia for construído, não fosse algo controlado por
uma única nação. Se apenas um país tiver acesso barato ao espaço, será uma
grande assimetria de poder. Portanto, de uma perspectiva “não vamos nos matar
todos uns aos outros”, ter uma posse conjunta do meio de lançamento barato
pode ser bom.
Uma vez que esse sistema esteja funcionando, pesquisadores estimam que
cargas de meio quilo poderiam ir para o espaço por menos de 250 dólares, com
muita rapidez e segurança.
Além disso, após a construção de um elevador espacial, construir outro será
muito mais barato. Afinal, a grande despesa inicial será lançar todo aquele cabo
por meios convencionais.
Muito provavelmente, teremos também estações-base ao longo do caminho
rumo ao espaço. Elas poderão servir de terminais de combustível e manutenção,
bem como de pontos de lançamento de satélites e espaçonaves. Uma das
melhores características desse projeto é a possibilidade de alcançar diferentes
altitudes apenas subindo e descendo por um cabo. Ao subir 480 quilômetros,
chegamos à Órbita Terrestre Baixa, como a maioria dos satélites. Subindo muito
mais, chegaremos à orbita geoestacionária, que é ótima para satélites de
comunicação, mas hoje em dia custa uma fortuna alcançá-la. Acima disso,
alcançamos uma altura em que a Terra tem muito pouca atração gravitacional.
Portanto, somos como uma pedra em um estilingue. Se quisermos ser disparados
no espaço, basta saltarmos na estação.
Esse último ponto é especialmente empolgante para aqueles de nós que
assistimos muito à Jornada nas Estrelas. Se você pode chegar a qualquer lugar
simplesmente subindo por um cabo (em vez de carregar combustível a bordo),
não apenas o lançamento de satélite é barato como também o lançamento de
espaçonaves muitos grandes. Mais do que qualquer outro método que parece
viável neste século, o elevador espacial abriria o sistema solar à exploração
humana.
Então por que não fazê-lo?
Bem, há muitos desafios técnicos, mas o maior de todos é: de que diabo de
material será feito esse cabo?

A unidade de força específica é o Yuri, que ganhou esse nome por causa de
Yuri Artsutanov, pioneiro no conceito de elevador espacial, cujo sobrenome pelo
visto era muito difícil de pronunciar. Dependendo da pessoa a quem fizermos a
pergunta, o material ideal para o cabo deve ter de trinta milhões a oitenta
milhões de Yuris. Como referência, o titânio tem cerca de trezentos mil Yuris e o
Kevlar, 2,5 milhões de Yuris. Materiais comuns não funcionarão.
O candidato mais promissor é um material chamado nanotubo de carbono.
Imagine uma molécula feita totalmente de átomos de carbono, mas com um
formato de canudo cuja largura é uma pequena fração da espessura de um fio de
cabelo humano.
Acontece que, se conseguirmos nanotubos de carbono puro, sem nenhuma
imperfeição,18 eles podem chegar a ter algo entre cinquenta ou sessenta milhões
de Yuris, o que significa que podem funcionar como cabo espacial. O problema é
que os nanotubos de carbono são uma descoberta relativamente recente, e nós
ainda os fazemos muito mal. O nanotubo mais longo já criado foi feito em 2013,
rendeu manchetes por toda parte e tinha... menos de meio metro de
comprimento.
É claro que podemos tecer essas fibras juntas, mas quanto menores as peças da
tecelagem, pior é sua força específica e maior a probabilidade de imperfeições.
Um cabo longo e tenso só funcionará se toda a sua extensão for perfeita, e, se seu
cabo romper em algum ponto, alguém no teleférico terá uma tarde bem ruim.
A pergunta a longo prazo é se existe um mercado para fazer materiais cada vez
melhores. De acordo com o dr. Ron Turner, do Niac, “teoricamente, e em termos
de material, o nanotubo de carbono poderia se tornar forte o bastante (...) para
um elevador espacial. No âmbito terrestre, não havia muito mercado após um
certo ponto, então as fibras de nanotubo de carbono não continuaram a crescer
tão fortes quanto um elevador espacial precisaria”.
Mesmo supondo que pudéssemos obter fibras longas o bastante, o sr. Derleth
aponta um problema nos nanotubos de carbono: “O material é muito sensível à
eletricidade e, portanto, se acabar sendo atingido por um relâmpago, isso
desintegrará uma grande parte da fita... O lado bom é que há uma solução para
isso; o ruim é que não se trata de uma solução muito satisfatória,
intelectualmente. Há uma área do oceano Pacífico que nunca registrou
relâmpagos. Portanto, é só colocar seu elevador espacial ali. Essa é a solução.
Agora, se houver uma tempestade, seria muito preocupante.”
Ainda que pudéssemos manter o cabo longe de relâmpagos, precisaríamos nos
preocupar com os detritos. Há muitos objetos se deslocando pelo espaço,
portanto, mesmo que fosse possível se esquivar de coisas grandes, coisas pequenas
poderão desgastar o cabo com o passar do tempo. De acordo com o dr. Turner,
“esse conceito de empreender uma restauração contínua no elevador permanece
sendo um dos maiores desafios, e para o qual ainda não se tem uma boa
resposta”.
Além disso, o elevador espacial poderia se tornar um alvo especialmente bom
para terroristas. O dr. Phil Plait (astrônomo e autor do blog Bad Astronomy)
salienta que a possibilidade de alguém se aproximar para cortá-lo pode não ser
tão remota. “Trata-se de um alvo bem propício para pessoas quererem destruir, e
nem todo mundo é bom. Nós temos inimigos.”
Supomos que muitos de vocês gostariam de saber o que acontece se temos um
cabo no espaço e alguém chega e o corta. Entre as pessoas que entrevistamos,
houve algumas discordâncias sobre quão ruim seria. O dr. Turner e o sr. Van Pelt
acham que um rompimento do cabo do elevador espacial poderia não ser tão
catastrófico assim. Eles observam que grupos tentaram prever o que aconteceria
simulando os resultados decorrentes de rompimentos em diferentes pontos. Em
linhas gerais, é algo assim:
Em qualquer ponto onde o cabo for cortado, o que estiver acima do corte irá
para uma órbita mais alta e o que estiver abaixo cairá em direção à Terra. O que
estiver em órbita mais elevada precisará ser coletado, já que representará um sério
lixo espacial.

Se o corte for em um ponto muito alto, uma grande parte do cabo cairá em
direção à Terra. Se isso acontecer, há várias interações complexas entre gravidade,
atmosfera, movimento da Terra e, possivelmente, alguma carga elétrica apanhada
do vento solar.19
A mecânica fica um pouco complexa, mas, em resumo, o cabo começará a
chicotear para a frente e para trás, aquecendo na atmosfera, até se destroçar.
Como o material é necessariamente leve, é provável que os pedaços não
machuquem ninguém na superfície da Terra. E o risco pode ficar ainda menor se
o cabo se tornar um emaranhado formado por fibras mais finas.
O dr. Plait concorda com algumas dessas particularidades, mas é um pouco
menos otimista em relação às implicações. “Claro, a quilômetros de altura as
coisas podem queimar durante a queda (não que milhares ou milhões de
toneladas de material pegando fogo sobre uma área seja um grande
acontecimento), mas e o que está mais abaixo? Também cai. E há ainda os
detritos do espaço. A maior parte da torre está abaixo da velocidade orbital, então
tudo isso cai na Terra. No entanto, 35 mil quilômetros de sua estrutura cairão no
espaço orbital de satélites que estão na LEO. Eu NÃO fiz os cálculos de
matemática nem de física aqui, mas a menos que alguém me diga como isso não
destruirá centenas ou milhares de ativos no espaço, não estou inclinado a pensar
que um elevador espacial é uma boa ideia.”

Preocupações
O acesso barato mudará para sempre nossa relação com o espaço. Será possível
criar grandes estações espaciais ou mesmo colônias em órbita. Vemos isso como
algo bom, mas que poderia pôr o poder nas mãos de representantes ruins. Uma
ideia surgida na Guerra Fria foi a chamada “vara de Deus”. Basicamente, você
pega um pedaço pesado de metal e o joga do espaço contra um inimigo.
Considerando o peso, a altura e qualquer que seja a velocidade de impacto que se
dê a ela, uma simples haste de metal pode causar tantos danos quanto uma
bomba nuclear. Neste momento, as únicas pessoas que vão ao espaço são
supernerds ultraqualificados — o tipo de gente que é aprovada em testes
psicológicos e está disposta a passar décadas treinando para uma chance de passar
alguns meses no espaço. Se o espaço se tornar mais populoso em geral, podemos
estar nos colocando em uma posição perigosa.
Deixando de lado os terroristas, outra possibilidade assustadora é como
podemos lidar com as ambições de nações poderosas. Exceto pela dissolução
soviética, as fronteiras nacionais do planeta têm sido relativamente estáveis desde
que a guerra mais custosa da história humana terminou, em 1945. As leis do
espaço formalmente aceitas dizem, em essência, que nenhuma nação pode
reivindicar nada lá em cima. Achamos difícil acreditar que um país com um
elevador espacial aceitaria isso. De fato, como veremos no próximo capítulo, os
Estados Unidos já estão fazendo alguns movimentos nessa direção.
Costumamos pensar no universo como algo dividido entre o espaço e “aqui
embaixo”. Mas isso é como uma formiga pensando que a Terra consiste de
“espaço” e “dentro do formigueiro”. É verdade, mas talvez um pouco chauvinista
por parte da formiga. Nosso uso de “espaço” se refere a tudo que existe no cosmos
inteiro fora de um planeta, em um sistema solar, em uma galáxia entre muitas
bilhões.
Se a humanidade obtiver acesso barato ao espaço, é difícil imaginar que não
haverá conflito sobre reivindicações. E, como parece provável, se apenas um país
(ou alguns) tiver acesso primeiro, isso pode criar conflitos na Terra. Em outras
palavras, se a humanidade obtiver acesso barato ao espaço, pode haver uma
repentina disputa política no exato momento em que uma única nação adquirir o
sistema armamentista mais poderoso da história.
Outra preocupação é de ordem ecológica. A curto prazo, ir ao espaço
provavelmente envolverá melhorias paulatinas em veículos que consomem muito
combustível, como aviões espaciais e foguetes. Alguns desses combustíveis são
relativamente inofensivos, enquanto outros são poluentes horríveis. De acordo
com o sr. Van Pelt, os danos ambientais “dependem do tipo de combustível. Por
exemplo, os motores principais do ônibus espacial funcionavam com oxigênio e
hidrogênio líquidos, sendo o escapamento resultante um vapor superaquecido.20
Portanto, no fim, é apenas água saindo desses motores. Mas os propulsores de
foguete de combustível sólido do ônibus (ou qualquer propulsor dessa natureza)
são outra história, e ela não é bonita. E liberar vapor de água numa altitude muito
elevada, como fazia o ônibus, pelo visto pode ser prejudicial também”. Isso não é
nada de mais neste momento porque não lançamos muitos foguetes. Mas se os
lançamentos espaciais se tornarem mais baratos e corriqueiros, os foguetes
reutilizáveis poderão ser um sério risco ambiental.
O ambiente orbital também desperta preocupações. Desde o Sputnik, temos
jogado cada vez mais coisas no espaço. Ele está começando a ficar lotado, com
uma taxa crescente de colisões. Acesso barato ao espaço pode gerar mais lixo
espacial. Dito isso, se os lançamentos espaciais ficarem mais em conta, temos que
ser capazes de investir em algum tipo de veículo de limpeza espacial.
De acordo com o sr. Van Pelt, “isso se torna de fato uma questão econômica,
porque, se você tem seu satélite de telecomunicação que custa centenas de
milhões de dólares e ele é danificado por algum detrito, há um preço real nisso.
Um seguro é feito, mas ele encarece, porque há cada vez mais lixo espacial”.
Em um prazo mais longo, o acesso barato ao espaço tornaria as colonizações
espaciais mais factíveis, o que pode resultar em diferenças genéticas entre
humanos terrestres e não terrestres. O sr. Derleth observa: “Acontece que a
matemática da genética é diferente para populações pequenas e isoladas.
Populações grandes podem ter mais mutações genéticas do que as pequenas, mas
uma população menor pode disseminar mutações para o grupo mais
rapidamente. Portanto, podemos imaginar, se tivéssemos mil pessoas em Marte e
a colônia fosse autossuficiente... bem... é muito caro enviar mais indivíduos,
certo? Então pode não haver muita gente nova chegando, muito menos em um
número relevante. E os colonos teriam bebês — verdadeiros marcianos —, e os
moleques cresceriam com cerca de um terço da gravidade, pouca atmosfera e
ainda menos campo magnético planetário para protegê-los de radiação. Portanto,
é possível que os colonos sofressem muitas mutações genéticas mais depressa, em
virtude da potencial exposição à radiação e por crescerem em um ambiente com
uma fração da gravidade, apesar de serem uma população pequena (...) Em algum
momento, poderia haver ‘humanos de Marte’ e ‘humanos da Terra’, e a sociedade
teria que tentar interpretar o que significa ter dois tipos diferentes de humanos.”
Quer dizer, tecnicamente, já nos sentimos assim em relação às pessoas que
falam durante os filmes. De qualquer forma, argumento aceito.

Como isso mudaria o mundo


Quando lemos livros de pessoas que viveram a época empolgante da Apollo,
temos uma ideia da frustração que sentiram quando as esperanças de um futuro
de era espacial bateram de frente com a realidade econômica dos lançamentos de
foguetes. Se quisermos realizar esses sonhos da era espacial — espaçonaves
imensas e velozes, com tripulações enormes, colônias por todo o sistema solar e
viagens a estrelas distantes —, precisamos baixar bem o custo.
A maioria dos livros e artigos que lemos sobre voos espaciais sem foguete
tentava calcular o custo por lançamento que seus sistemas poderiam
proporcionar. O custo mais baixo que vimos foi de 5 a 10 dólares por meio quilo,
com estimativas mais conservadoras que iam para a faixa de 250 a 500 dólares. Se
mesmo a meta conservadora puder ser alcançada, as interações da humanidade
com o restante do universo mudariam para sempre.
Em se tratando de comércio, eis uma maneira de pensar a respeito. Uma
proposta típica de elevador espacial é permitir levar cerca de 20 mil quilos para a
órbita uma vez por dia. A Estação Espacial Internacional pesa um pouco mais de
400 mil quilos. Isso mostra que, mesmo que o ascensorista tire os fins de semana
de folga, poderíamos lançar uma enorme estação espacial uma vez por mês. E o
custo total seria de algo em torno de 5 bilhões de dólares, em vez do preço atual,
estimado de 100 bilhões de dólares.
Lançamentos baratos também facilitariam grandes melhorias em sistemas de
satélite, o que poderia proporcionar melhores métodos de comunicação e
sistemas de GPS realmente precisos.
Esse cenário talvez ajudasse também a enfrentarmos as mudanças climáticas
globais. Cientistas estimaram que apenas alguns pontos percentuais a mais de
cobertura de nuvens poderiam compensar inteiramente todo o aquecimento
esperado para ocorrer no próximo século. Uma maneira artificial de fazer isso
seria lançar um telão para bloquear parte da luz incidente. Um dia, poderemos
olhar para cima e observar um remendo simpático e escuro flutuando no céu,
protegendo-nos de uma catástrofe. O ideal seria que no lado do remendo voltado
para a Terra estivesse escrito: “Pelo amor de Deus, humanos! Como vocês
deixaram isso acontecer?”
Por falar em humanos, pode ser que subamos ao espaço só por diversão.
Atualmente, o turismo espacial é tão caro e tão controlado que (pelo que
sabemos) todas as pessoas que participam de voos espaciais privados são
bilionários meio loucos e muito nerds. Estamos felizes por eles estarem fazendo o
que querem, mas talvez fosse bom que um simples milionário também pudesse
entrar no jogo. As oportunidades para o turismo espacial provavelmente são bem
grandes. Os poucos turistas espaciais que puderam pegar uma carona até o espaço
gastaram em torno de 20 milhões de dólares pelo privilégio. Nada mal,
considerando que a maioria das pessoas passa grande parte do tempo vomitando
em gravidade zero.
Sim, vomitando. Conforme já discutimos, os astronautas sentem uma “falta de
peso” porque estão em queda livre. Outro momento em que nos sentimos em
queda livre é quando começamos a descer em velocidade numa montanha-russa.
Seus ancestrais das cavernas não tiveram muita experiência com satélites e
montanhas-russas, então você não é evoluído para lidar muito bem com isso. Seu
estômago não está acostumado a suportar alimentos flutuando em todas as
direções, e seu senso de equilíbrio não está habituado a um mundo onde você dá
uma cambalhota toda vez que se inclina para trás. É por isso que a Estação
Espacial Internacional tem à disposição um suprimento de sacos de vômito,
mesmo para profissionais do espaço treinados.
Num elevador espacial, contanto que você não suba demais, a experiência é
muito próxima de estar em gravidade terrestre normal. O mesmo se dá quando
você chega tão alto a ponto de alcançar um satélite como a Estação Espacial
Internacional.
Mas espere aí: nós não dissemos que as pessoas na estação espacial não “sentem”
gravidade nenhuma porque estão em queda livre? Por que as pessoas no elevador
não se sentiriam da mesma maneira?
A resposta resumida é que no elevador você está viajando em torno da Terra a
uma velocidade muito menor. Você sabe que a Terra faz a rotação completa a
cada 24 horas, porque é essa a frequência com que aquela coisa grande e brilhante
aparece no céu. Portanto, seu cabo espacial também tem que rodar a cada 24
horas — se fosse mais rápido ou mais devagar, ele começaria a se enrolar em volta
da Terra como um fio num carretel. Em contraste, a Estação Espacial
Internacional está circulando em torno da Terra tão rápido que lá se vê um novo
pôr do sol vermelho-arroxeado a cada noventa minutos. É romance dezesseis
vezes por dia.
Na Estação Espacial Internacional, o chão, por assim dizer, continua se
afastando de seus pés conforme a estação espacial se curva em torno da Terra. O
elevador espacial não vai rápido o bastante para conseguir realizar esse truque.
Portanto, ao subirmos no cabo do elevador, perdemos grande parte da sensação
de gravidade simplesmente por nos afastarmos cada vez mais da Terra. Se quiser
ir além da atmosfera para ter uma vista impressionante das estrelas acima e do
céu abaixo, talvez dê para fazer isso sem um saco de vômito.
Então quando é que começamos a vomitar? Isso depende do estômago de cada
um, mas o que podemos lhe dizer é quando (e por que) você sente uma total falta
de peso. Para experimentá-la, é preciso estar em queda livre: estar se movendo a
uma velocidade tal que a pessoa continua “deixando a Terra escapar” mesmo que
caia na direção dela. É mais fácil fazer isso ao se afastar da Terra porque há muito
espaço para cair e porque o planeta não o puxa tanto. Para qualquer distância da
Terra, há uma velocidade específica que precisamos atingir para fazermos um
círculo em volta dela.
Em relação à linha do equador, o elevador espacial nunca muda a velocidade.
Ele está sempre girando em torno da Terra uma vez a cada 24 horas. Mas à
medida que subimos no cabo, acabamos por atingir uma altura na qual a
velocidade de rotação do elevador se equipara à velocidade necessária para ele
permanecer em queda livre. Essa velocidade e distância específicas são a órbita
geoestacionária à qual nos referimos anteriormente, e ela é muito especial. Se
você jogar uma placa com os dizeres “A TERRA É PARA BURROS”, ela não apenas
orbitará para sempre como ficará na mesma posição no céu para qualquer
observador. A essa distância, não podemos ver qualquer objeto de tamanho
regular a olho nu, mas um observador que apontar um telescópio para o ponto
certo, numa noite com boa visibilidade, verá sempre sua placa ofensiva.
Talvez a possibilidade mais estimulante de todas seja o senso de aventura que
viria com os voos espaciais baratos. Algumas pessoas se perguntam por que seus
sonhos sobre o espaço nunca se tornaram uma nova era de explorações. O
problema central é o preço exorbitante, o que significa que esse projeto tem sido
em grande parte tocado pelo setor público. No mundo moderno, isso mostra que
há uma séria aversão ao risco, como argumentou Rand Simberg em seu livro Safe
Is Not an Option: Overcoming the Futile Obsession with Getting Everyone Back
Alive That Is Killing Our Expansion into Space [Seguro não é uma opção:
Superando a obsessão inútil de trazer todo mundo de volta vivo que está
matando nossa expansão para o espaço].21
Enquanto as viagens espaciais forem extremamente caras, e não apenas muito
caras, as pessoas não vão se sujeitar a correr riscos tremendos e embarcar em
aventuras bizarras. E ainda mais importante: mesmo que haja (conforme
suspeitamos) astronautas dispostos a fazer uma viagem só de ida para Marte,22
um programa assim jamais será aprovado.
Tudo isso é para dizer que esperamos que não tenhamos deixado você
pessimista em relação à possibilidade de mudarmos de maneira crucial a forma
de se chegar ao espaço e, consequentemente, nossa relação com o universo. Não
será fácil fazer nenhuma dessas tecnologias funcionar, mas quando funcionarem
poderemos finalmente entregar o céu aos aventureiros.

Nota bene sobre Gerald Bull e o Projeto Babilônia


Gerald Bull não teve uma infância fácil. Quando ainda era menino, sua mãe
morreu. Quando a Grande Depressão atingiu o Canadá, seu pai se casou de novo
e enviou seus muitos filhos para morar com diversos parentes. Bull teve a sorte de
ficar com membros da família ricos o bastante para lhe permitir ingressar numa
universidade quando jovem. Ele estudou aeronáutica e logo ganhou a reputação
de ser um engenheiro brilhante e uma pessoa que faria qualquer coisa para
concluir um trabalho e ainda por um custo baixo.
Nos anos 1950, o Canadá tentava desenvolver um programa de mísseis interno
chamado Velvet Glove. O projeto tinha muita dificuldade de atrair talentos,
porque os estudantes iam para os Estados Unidos em busca de remunerações
maiores e mais prestígio. Bull, nessa época um estridente patriota canadense,
dispôs-se a ficar para trás e ao lado de seu país. E então, ainda na casa dos vinte
anos e parecendo novo para a idade, Bull se tornou uma parte importante do
programa canadense de mísseis.
Mas os canadenses não eram muito bons em financiar as ambições do
programa, então o dr. Bull teve que arranjar uma solução barata. Ele nem sequer
tinha conseguido acesso a um túnel de vento que ajudara a construir, o que fez
com que um amigo lhe sugerisse deixar o túnel de lado e só disparar projéteis. O
jovem engenheiro logo adquiriu um antigo canhão de campanha de seis
polegadas e o adaptou para disparar mísseis a 7.200 km/h.
Foi assim que o dr. Gerry Bull foi parar na indústria balística, o que o levou a
se perguntar se poderia criar um canhão grande o bastante para disparar projéteis
no espaço.
Ele era um engenheiro extremamente inteligente, mas tinha uma reputação de
odiar trabalhar com mentes inferiores — em especial burocratas. De acordo com
Wilderness of Mirrors, de Dale Grant, no fim dos anos 1960 Bull saiu de modo
intempestivo de uma reunião com um ministro da Defesa canadense, gritando
que o político tinha “a competência técnica de um babuíno”.
O dr. Bull desenvolveu seu método de supercanhão como uma alternativa aos
foguetes, mas, como fazia um inimigo atrás do outro no Canadá, tinha uma
dificuldade cada vez maior de obter financiamento. No entanto, o engenheiro
cultivara alguns fiéis seguidores nas Forças Armadas americanas e conseguiu
aproveitar esses contatos para ganhar acesso a coisas que os americanos tinham
em abundância: financiamento e armas gigantes excedentes. Com ajuda do
Departamento de Defesa dos Estados Unidos e do (meio relutante)
Departamento de Defesa Nacional do Canadá, Bull iniciou o que acabou sendo
chamado de Projeto HARP — High Altitude Research Project [Projeto de
Pesquisa em Altitude Elevada].
Com o tipo de agilidade pelo qual Gerald Bull era conhecido, os canhões se
tornaram maiores e os modelos de projéteis, cada vez melhores. Em 1962, com
um imenso canhão instalado em Barbados, a equipe de Bull estava dando tiros
com altura suficiente para explorar a atmosfera superior. Os dados atmosféricos e
as pesquisas sobre projéteis de alta velocidade se tornaram uma boa fonte de
financiamento para o projeto, mas o dr. Bull tinha objetivos maiores. Ele
acreditava que, com as modificações certas, um canhão maior poderia disparar
satélites diretamente na órbita.
Em 1965, eles conseguiram disparar cargas úteis significativas a onze mil
quilômetros por hora. Foi um grande começo, mas é preciso alcançar quarenta
mil quilômetros fora do cano para ter alguma chance de atingir a órbita. A ideia
do dr. Bull era “casar” um foguete com a carga útil, para que o canhão pudesse lhe
dar a maior parte da velocidade, enquanto o foguete lhe empregaria um impulso
final para inseri-la na órbita adequada.
As coisas estavam indo razoavelmente bem quando o financiamento foi
retirado. O HARP perdeu o financiamento americano quando a Nasa afastou o
Exército dos Estados Unidos das operações espaciais.23 Em seguida, o HARP
perdeu o financiamento canadense em decorrência do movimento pela paz, que
estava florescendo e não via com bons olhos um megacanhão gigante.
O dr. Bull respondeu criando uma empresa privada de pesquisas espaciais. A
iniciativa não construía megacanhões espaciais, mas ganhava dinheiro por meio
de diversos contratos com o governo. Em paralelo, o dr. Bull começou a trabalhar
em ideias para um canhão que suplantaria seus antigos projetos. Do tamanho de
um arranha-céu, o canhão teria um cano de 1,62 metro de diâmetro e 244 metros
de comprimento, sendo capaz de disparar projéteis de seis toneladas para o
espaço.
À medida que os anos 1970 avançavam, os gastos com o espaço aéreo
começavam a minguar. O dr. Bull, que talvez fosse menos brilhante como gestor
do que como engenheiro, expandiu cada vez mais a empresa, o que exigiu
empréstimos bancários cada vez maiores. Em seu esforço para manter os projetos
vivos, ele ingressou no comércio internacional de armas.
Logo as coisas desandaram. O dr. Bull se envolveu numa situação emaranhada
com a CIA, o governo canadense e um carregamento ilegal de peças de armas e
tecnologia para a África do Sul do apartheid. Durante a entrega de uma remessa
que passava por Antígua, os transportadores informaram aos habitantes da ilha
(em sua maioria de origem africana) para onde estavam indo as mercadorias.
Agências de notícia ficaram sabendo e aquilo se tornou um incidente
internacional.
Teve início uma rodada de jogos de espionagem com fins de acobertamentos
políticos, e o dr. Bull pelo visto não conseguiu ou não quis entender o que estava
acontecendo. Ele foi acusado oficialmente de transferir munição de forma ilegal.
Num acordo de colaboração, a empresa do dr. Bull recebeu uma multa e ele foi
condenado a um ano de prisão, da qual saiu após quatro meses por bom
comportamento. Ele mergulhou em raiva, depressão e alcoolismo, sentindo-se
traído e usado como bode expiatório. Durante aquele período de humilhação, sua
empresa finalmente foi à falência. Todas as suas propriedades, toda a tecnologia
que construíra, foram vendidas a preços módicos. Basicamente, se você estivesse
tentando criar um supervilão, esse seria um bom caminho a seguir.
O dr. Bull, que antes se considerava um patriota canadense, decidiu que estava
disposto a trabalhar com qualquer pessoa que lhe trouxesse de volta alguma
versão do HARP.
As coisas ficaram um pouco mais obscuras a essa altura, por causa do sigilo e
da desinformação de muitas partes. Entretanto, no fim dos anos 1980, o dr. Bull
aparece no Iraque de Saddam Hussein, trabalhando num supercanhão chamado
Projeto Babilônia.
Vamos dizer mais uma vez: o dr. Bull aparece no Iraque de Saddam Hussein,
trabalhando num supercanhão chamado Projeto Babilônia.
Isso aconteceu. Na vida real.
O fato realmente estranho é que o modelo concebido pelo Projeto Babilônia
não parecia ter aplicações militares. Seria montado numa montanha, ou seja, só
poderia disparar em uma direção. Pelo que se viu, essa direção não continha
nenhum alvo relevante entre os inimigos. O canhão apontava na direção
apropriada (como a Terra gira) para disparar rumo à órbita.
Em seu livro Bull’s Eye: The Life and Times of Supergun Inventor Gerald Bull,
James Adams alegou haver provas concretas de que Bull estava projetando armas
militares para o Iraque, além do supercanhão. Considerando sua necessidade
financeira, e sua conhecida capacidade de aprimorar sistemas de armas a um
preço baixo, a combinação faz algum sentido. O motivo pelo qual Saddam
Hussein estava se dispondo a financiar um supercanhão é mais difícil de
especificar. Dizia-se que o ditador tinha uma noção messiânica de seu lugar no
mundo árabe, então o conceito de supercanhão pode ter servido ao duplo
propósito de dar ao Iraque a utilidade militar de um lançador de satélite barato e
o capital político por ser a única nação na região com um programa espacial sério.
Ou talvez eles tenham tido a maior falha de comunicação da história.

Países ocidentais (e nações próximas ao Iraque) ficaram cada vez mais


preocupados. Um gênio de balística ligeiramente insano com acesso a uma rede
de empresas obscuras de munição estava enviando toneladas e toneladas de peças
de metal e propelente líquido para uma ditadura beligerante. O que poderia dar
errado?
Pelo visto, alguém não quis descobrir.
Em março de 1990, Gerald Bull foi encontrado morto num hotel em Bruxelas,
com 20 mil dólares sobre o corpo. Considerando o número total de pessoas que
tinham a ganhar com sua morte, a lista de potenciais inimigos é enorme. Seu
próprio filho suspeitou da CIA e do Mossad e, de acordo com Arms and the Man:
Dr. Gerald Bull, Iraq, and the Supergun, de William Lowther, “um oficial da CIA,
falando sob condição de total anonimato, diz que é do entendimento geral das
agências de inteligência ocidentais que o Mossad deu a ordem para matar Bull”.
Muito pouco se escreveu sobre o dr. Bull desde o início dos anos 1990. Há
grande probabilidade de que nunca venhamos a saber com certeza quem abreviou
sua estranha e trágica carreira.

9. Esse número, na verdade, varia muito e depende de fatores como de que país você está sendo lançado, a
empresa que o leva, o destino e o tamanho do veículo espacial que está fazendo o transporte. Estamos
usando 10 mil dólares por meio quilo como valor estimado em todo o livro. A variação de 9 mil dólares
desse valor, para mais e para menos, abrange todas as estimativas encontradas enquanto pesquisávamos esse
tópico.
10. O combustível corresponde a 80%. Três quartos disso dá 60%. Isso libera 20%. Mas a carga original
ocupava inicialmente 4%. Portanto, você aumentou a carga de 4% para 24%!
11. Os foguetes atuais têm várias seções chamadas “estágios”. Depois que um estágio é utilizado, ele se torna
um peso morto que deixa o veículo espacial mais lento. Então ele é descartado. A SpaceX recuperou o
primeiro estágio propulsor, que é o maior.
12. Perguntamos no Twitter o que um engenheiro aeroespacial provavelmente usaria para bater em alguém
até a morte, e as sugestões mais frequentes foram uma TI-83, uma TI-89, uma TI-30X, uma régua de
cálculo ou um laptop razoavelmente bom com MATLAB instalado.
13. Esse número pode mudar um pouco, já que a velocidade do som depende de coisas como temperatura e
altitude.
14. É como ir de Tóquio a Londres em duas horas, se descontarmos o tempo de aceleração.
15. Caso você esteja se perguntando, o Brexit não deverá interferir nesse programa. A Agência Espacial
Europeia trabalha conjuntamente com a União Europeia, mas já tem membros que não são do bloco
(Noruega e Suíça) e não é controlada por ele.
16. Então por que você não morre quando acelera dentro do carro? Você não está acelerando rápido o
bastante por um tempo longo o bastante. Além disso, seu corpo está muito mais próximo de uma esponja do
que um copo. Seu sistema circulatório resiste bem à mudança de velocidade. Se a aceleração fosse maior e
constante, nesse caso você se assemelharia mais a um copo. É claro que você também pode morrer de
mudanças de velocidade rápidas e repentinas, conhecidas como “acidentes de carro”.
17. O Burj Khalifa, em Dubai, nos Emirados Árabes.
18. Essa “nenhuma imperfeição” é extremamente importante, porque pequenos defeitos nos nanotubos de
carbono podem reduzir a força do cabo de maneira drástica.
19. Vento solar é o termo para a corrente de partículas carregadas que o Sol dispara em todas as direções.
20. Mesmo que os únicos produtos sejam oxigênio e hidrogênio líquidos, ainda é preciso muita energia para
criá-los, armazená-los e transportá-los. Se essas coisas são realizadas por energia renovável, ou pelo reator de
fusão dos nossos sonhos, então o lançamento é, de fato, “limpo”. Se você estiver usando carvão para obter seu
propelente, o problema da poluição permanece, mesmo que não esteja presente no dia do lançamento.
21. Melhor subtítulo da história.
22. Há também um monte de gente comum que provavelmente é maluca. Um projeto chamado Mars One,
que enviaria pessoas a uma viagem só de ida para Marte a fim de integrarem um reality show, recebeu mais
de quatro mil candidatos.
23. Como o HARP provinha da fabricação de armas de artilharia, de início o financiamento do Exército foi
natural. Quando o espaço passou a ser considerado seu próprio domínio tático, o HARP foi se desvirtuando
do projeto do Exército. E, de qualquer modo, a essa altura a Nasa já tinha estabelecido os foguetes como a
melhor maneira de ir para o espaço.
3.

Mineração em asteroides
Revirando o ferro-velho do sistema solar

A Terra já foi muito mais quente. Para encurtar a história, é por isso que você não
pode ter uma casa feita de ouro.
Veja bem, quando se tem uma enorme bola quente derretendo (como a Terra
primordial) no espaço, a gravidade tende a deslocar os elementos pesados (como
ouro e platina) para o centro e, ao mesmo tempo, enviar os elementos mais leves
(como carbono, silício e diversos gases) para a superfície. O processo não é
perfeito, o que em parte explica por que podemos encontrar jazidas de metais
pesados e minérios metálicos perto da superfície. Mas, em geral, a diversão de
verdade é difícil de obter. E, conforme cavamos, encontrar mais passa a ser cada
vez mais difícil.
É aí que a mineração em asteroides começa a parecer interessante. Os
asteroides são basicamente a sucata que entra na formação de um planeta, mas
que nunca se fundiu permanentemente para formar bolas gigantes no espaço. Isso
quer dizer que, ou eles nunca passaram pelo processo de aquecimento em que
todos os metais legais vão para o centro, ou passaram por esse processo apenas
para depois explodir. Então, um pouco além de Marte, há uma pilha gigantesca
de escombros de planetas, com uma vasta riqueza de metais ou outros recursos
que talvez gostássemos de levar para a Terra, ou talvez pudéssemos usar para
construir colônias no espaço.
Se pelo menos pudéssemos encontrar umas pessoas meio malucas, com cabeça
de engenheiro e coração de pioneiro...
Daniel Faber dirige uma empresa chamada Deep Space Industries. Ele é
engenheiro espacial, diretor e presidente da Sociedade Espacial Canadense e
levou a banda larga para a Antártica.
De acordo com o sr. Faber, há enormes recursos em asteroides esperando para
serem explorados: “Existem asteroides feitos totalmente de metal, como aço
inoxidável natural, níquel, ferro e... o menor deles que conhecemos numa órbita
próxima à Terra tem cerca de dois quilômetros de extensão. Ele tem o nome
glorioso de 3554 Amun e contém mais de trinta vezes a quantidade de metal que
a humanidade já extraiu na Terra. E esse é apenas um. Há milhares assim. Esse é
o menor localizado numa órbita próxima à Terra.”
Tem havido pouquíssimas missões em asteroides, então a maior parte de
nossos dados provém de telescópios e do exame de meteoritos. Com base nessas
observações, cientistas dividiram os asteroides em três categorias principais: tipo
C (carbonáceos), tipo R (rochosos) e tipo M (metálicos).
Os asteroides carbonáceos contêm muitas coisas úteis para a saúde humana,
como carbono e água. Alguns asteroides do tipo C podem ter até 20% de água,
em um ou outro estado. A água só terá um grande apelo de venda na Terra
quando os hipsters decidirem que querem coquetéis de asteroides, mas pode ser
bem proveitosa se você pretende estabelecer uma colônia habitada.

Os asteroides rochosos contêm, você sabe, rochas. Especificamente, são cheios


de silicatos. O silício também não vai lhe render uma fortuna na Terra (cerca de
28% da crosta terrestre é composta por silício), mas pode ser muito valioso para
sua colônia de mineração. Os silicatos têm todo tipo de aplicação, de vidro a
painéis solares e ainda como meio de crescimento para plantas, às vezes chamado
“solo”. É também chamado de “terra”, mas isso será considerado um patriotismo
meio fanático quando estivermos morando em asteroides.
Os asteroides metálicos são, em sua maioria, feitos de ferro e níquel. Esses
elementos são muito bons para construções no espaço, já que, diferentemente dos
materiais rochosos, podem ser dobrados e esticados sem quebrar. Metais também
são bons para blindagem e para imprimir papel-moeda com o seu rosto depois
que você declarar independência em relação aos tiranos deploráveis do planeta-
mãe.
Resumindo, você tem todo o material para uma colonização bem-sucedida —
oxigênio para respirar, terra para cultivar plantas, metais para construir e água
para fazer balões de água. Agora, vamos falar sobre financiamento.
Conforme discutido no capítulo anterior, o envio de qualquer coisa ao espaço
custa atualmente cerca de 10 mil dólares por cada meio quilo. Esse refrigerante
tamanho família que você está planejando levar lhe custará 20 mil dólares. A nave
espacial Apollo 11, que só foi até a Lua, pesava mais de 45 mil quilos. Portanto,
sem contar toda a engenharia, as autorizações e a equipe necessárias para
construir e operar uma espaçonave, você está iniciando esse empreendimento de
risco com um saldo de mais ou menos 1 bilhão de dólares negativo. Isso não é
bom, mas lembre-se: um Airbus A380 custa cerca de 400 milhões de dólares,
então não estamos completamente fora da esfera da possibilidade.
Uma maneira de transformar a mineração em asteroides em alguma coisa é
levar certo lucro para casa. Por exemplo, se você puder extrair platina no espaço,
pode vendê-la a mais ou menos 40 mil dólares o quilo na Terra. E chegar ao
espaço é a parte cara. Voltar é relativamente fácil.
Um dos (poucos) aspectos convenientes em relação ao espaço é que, uma vez
que nos afastamos de objetos pesados como planetas e estrelas, podemos chegar a
quase qualquer lugar gastando muito pouco. Pense o seguinte: é caro ir de Los
Angeles a Tóquio de avião por dois motivos. O primeiro é que você tem que
subir a mais de nove mil metros contra a gravidade e depois enfrentá-la durante
toda a viagem. O segundo é que há uma boa quantidade de ar retardando você no
caminho. No espaço, esses dois problemas desaparecem.
Assim, se estiver planejando enviar umas muambas para a Terra, o ponto ideal
para uma base espacial é um lugar com muitos recursos e pouca gravidade.
Considere, por exemplo, Fobos, uma das luas de Marte. Como Fobos é muito
pequena, sua velocidade de escape é de apenas quarenta quilômetros por hora.
Isso significa que você pode montar uma rampa em Fobos, pilotar uma
motocicleta em cima dela e se lançar para um voo no espaço.
A lua da Terra tem uma velocidade de escape duzentas vezes maior do que a
de Fobos. Em termos de energia, é mais barato enviar um pacote de Fobos à
Terra do que da lua da Terra à Terra.
Os asteroides são ainda melhores. Um grande asteroide comum tem uma
velocidade de escape de aproximadamente 0,8 km/h. Se você conseguir criar uma
base de mineração num asteroide, poderá enviar para a Terra conteúdos refinados
do asteroide a um custo muito baixo.
Dito isso, a partir de nossas pesquisas e entrevistas, parece improvável que a
mineração no espaço visando ao lucro para a Terra vá funcionar a longo prazo. A
maioria dos componentes dos asteroides não é valiosa o bastante fora do espaço.
Embora haja muito metal lá em cima, não está nem um pouco claro se será mais
barato explorar asteroides do que criar um método de extração tão extravagante
quanto aqui na Terra. Além disso, com esse último método ainda daria para ir ao
Burger King todo dia.
Poderíamos extrair apenas os metais raros e caros, mas isso também é difícil.
Se houvesse metais raros e caros nos asteroides, você provavelmente iria querer
refiná-los no espaço para evitar o transporte e o desembarque de uma imensa
pilha de minério na Terra. Mas refiná-los no espaço é difícil porque seria preciso
construir uma refinaria lá em cima, e a maioria dos métodos atuais do processo
exige gravidade. Você pode simular a gravidade girando bem rápido a refinaria,
mas isso exige muita energia para começar, e a estrutura teria que ser bem grande
para não parecer que você está rodando num brinquedo de parque de diversões
24 horas por dia.
E mesmo que encontrássemos um asteroide gigante feito de ouro, diamantes e
cartas raras de Magic, não está totalmente claro o que aconteceria quando
trouxéssemos tudo isso para a Terra. A física se comporta. A economia não. De
acordo com o economista Bryan Caplan, da George Mason University, “a
concorrência é a chave. Se uma única empresa encontra um veio de platina, ela
pode reter a maior parte de seu estoque para não inundar o mercado. Por outro
lado, se muitas empresas compartilham o filão principal, é possível que cada uma
delas corra para vender sua platina antes das rivais. Considerando o alto custo
fixo das viagens espaciais, é muito provável que a mineração em asteroides
comece com poucas empresas, dando aos primeiros a chegar uma grande
oportunidade de lucrar com qualquer recurso que encontrarem. Com o tempo,
porém, o sucesso gera imitações, então gerações posteriores de mineradores de
asteroides devem tomar cuidado”.

Portanto, com toda essa dificuldade, por que estamos falando em mineração
em asteroides? Bem, há algo maior em jogo aqui. Pode ser que não valha a pena
transportar uma carga de ferro gigante por 450 milhões de quilômetros só para
você poder fazer um novo encanamento para seu banheiro. Mas se quisermos
construir uma colônia no espaço que seja mais do que uma pequena bolha
habitada por quase ninguém, precisaremos de recursos. No espaço, a terra valerá
muito mais do que diamante e platina, e será muito mais barato laçar algumas
pedras do espaço do que explodir pedras na Terra.
Segundo a crença de muitos cientistas e engenheiros, levar humanos para
longe da Terra tem um valor intrínseco. Há mistérios e maravilhas lá fora. Há
respostas para perguntas que ainda nem sabemos formular. Pode haver vida
parecida com a nossa ou diferente da nossa, e é difícil dizer qual dessas
possibilidades seria mais espantosa.
Desbravar as estrelas é um grande sonho, mas os pioneiros mais bem-
sucedidos são pessoas práticas. Se quisermos ir além deste nosso pequeno planeta,
será mais barato, mais fácil e mais rápido usar materiais que já estão fora da
atração gravitacional da Terra. Pode ser que o caminho para fora do sistema solar
passe pelo ferro-velho dele.

Em que pé estamos agora?


São muitos os problemas a serem enfrentados por um pretenso minerador de
asteroide, então vamos abordar brevemente alguns dos maiores.
Será preciso gerar energia tanto para chegar aos asteroides quanto para
abastecer a colônia. A limitação mais grave é que, a curto prazo, não será possível
dar um pulo numa loja de ferragens. Você precisa de algo bem permanente. Há
muitas opções, mas provavelmente suas melhores apostas na tecnologia atual são
painéis solares ou um reator nuclear.
Os painéis solares são bons porque podem funcionar por mais de vinte anos. O
maior aspecto negativo é que eles não produzem muita energia para o tamanho
que têm. Mas, supondo que você possa levá-los lá para cima, eles são confiáveis,
duráveis e simples. Consertá-los e substituí-los na colônia do asteroide é até uma
ideia concebível, já que os asteroides são relativamente ricos em silicato. Materiais
de asteroides também podem ser usados para criar espelhos que concentrem luz
nos painéis, aumentando a produção de energia.
Os reatores nucleares são bons porque geram muita energia para o tamanho
que têm e podem durar até cem anos, desde que nada de terrivelmente errado
aconteça. Os asteroides não contêm nem de longe urânio ou plutônio suficientes
para a criação de um novo reator, mas, para começar, não é necessário muito
combustível nuclear.
Já foram realizadas muitas pesquisas sobre reatores nucleares compactos, em
parte porque em determinado momento eles foram usados em satélites soviéticos.
Mas, bem, eis o que acontece: imagine que você lance uma nave movida a energia
nuclear no espaço e as coisas não deem muito certo. Suponha, por exemplo, que a
nave comece a se mover de maneira perigosa e você perca o controle dela. Então
ela enguiça na atmosfera e despeja o conteúdo de um reator nuclear sobre uma
faixa de mais de seiscentos quilômetros no Canadá.
Sim, isso aconteceu. Cosmos 954, em 1977. Então seu plano de reator nuclear
é bom e tal, mas você provavelmente acabará ficando com a energia solar por
motivos políticos.
Por falar em radiação, o Sol está disparando íons rápidos de forma constante.
Na Terra, você está protegido por um cobertor grosso de ar. Você também tem a
magnetosfera terrestre, que pega muitas partículas perigosas vindas do Sol e as
desvia para longe do nosso planeta ou as encaminha aos polos para que elas
possam fazer um pequeno show de luzes para as pessoas.24
Desde o momento em que sai de casa, você é bombardeado por radiação.
As missões tripuladas à Lua foram razoavelmente seguras,25 já que as viagens
foram muito curtas e os riscos da radiação aumentam com a quantidade de
exposição. Mas as missões em asteroides serão muito mais demoradas. A Apollo
11 levou pouco mais de três dias para chegar à Lua. Ceres, o maior objeto no
cinturão de asteroides, está cerca de 1.100 vezes mais distante. Supondo que
viajemos tão rápido quanto a Apollo 11 (o que, em termos de missão lunar, é bem
rápido), isso levará quase dez anos. Dito isso, para missões mais longínquas você
provavelmente pode conseguir uma velocidade maior. Por exemplo, a missão não
tripulada Dawn, da Nasa, fez a viagem ao cinturão de asteroides em quatro anos.
Mesmo a passos relativamente rápidos, não é bem um bate e volta até a cidade
vizinha.
Além do mais — e isso é uma característica bem bonitinha das viagens
espaciais —, de vez em quando o Sol dispara quantidades imensas de radiação no
que é chamado de erupção solar. É melhor ter um plano para isso.
Existem algumas opções. Você pode blindar a nave inteira. Um pedaço de
blindagem de chumbo com cinco centímetros de espessura e um metro quadrado
pesa cerca de 450 quilos. Portanto, se você estiver levando tudo da Terra, a
blindagem de toda a sua nave vai mais ou menos dobrar o custo já enorme de
levá-la ao espaço. Outra opção é usar água como escudo. A água é um excelente
bloqueador de radiação, e você pode fazer com que ela tenha uma dupla função,
agindo como escudo enquanto é armazenada para ser bebida. É claro que isso
cria a possibilidade sinistra de alguém comer pretzels demais e depois beber o
escudo contra radiação.
Alguns cientistas sugeriram um “quarto do pânico”. A ideia básica é que você
se dispõe a lidar com alguma radiação, mas quer se proteger contra as grandes
erupções solares. Então você passa a maior do tempo no corpo levemente
blindado da nave, mas sempre que houver uma explosão de radiação, todo mundo
corre para uma pequena câmara com blindagem mais forte. Por um lado, isso
provavelmente funcionaria e custaria muito menos do que blindar a nave inteira.
Por outro, você agora está numa câmara de um metro cúbico com várias outras
pessoas, no meio do espaço, e todas elas estão reconsiderando seriamente suas
escolhas na vida. Além disso, se alguém precisar urinar, lembre-se de que não há
gravidade.
Você poderia dizer “bem, vou tomar umas pílulas de iodeto de potássio para
me proteger da radiação”. Isso é burrice. As pílulas de iodeto de potássio só
protegem a tireoide. Portanto, mais tarde, quando chegar ao seu objetivo, você
terá quatorze tipos de câncer e um braço crescendo no rosto. Mas, claro, sua
tireoide estará em ótimas condições.
Mas suponhamos que você tenha encontrado uma solução para a radiação. O
problema seguinte é aterrissar num asteroide. Isso é mais fácil falar do que fazer.
Há uma chance muito alta de que o asteroide esteja girando. Se ele for grande o
bastante, você pode encontrar o eixo e aterrissar ali, mas é uma manobra um
tanto delicada. Outra opção é fazer o asteroide parar de girar antes da
aterrissagem.26 Isso é difícil por dois motivos.
Primeiro, gasta-se energia para diminuir a velocidade de um objeto giratório.
Quanto maior ele for e mais rápido girar, mais energia será necessária. Não existe
uma maneira de contornar isso; é física básica. Ou você muda o giro ou encontra
uma forma de lidar com ele.
Segundo, pode ser que você tenha informações insuficientes sobre a estrutura
interna do asteroide. Muitos deles são “pilhas de escombros”, ou seja, em essência,
não passam de conglomerados de pedras e terra unidos por uma gravidade
pequena e por forças intermoleculares. Isso torna difícil fazer com que parem de
girar. Se você tentar interromper o giro, poderá apenas jogar para longe um
pedaço do asteroide. Por causa da instabilidade desse tipo composto por pilhas de
escombros, os resultados talvez sejam vergonhosos, como uma morte horrível
num vazio silencioso e frio.
Isso nos leva ao problema seguinte: como aterrissar com segurança? Lembre-
se, não há praticamente nenhuma gravidade num asteroide. Se tentar pousar nele,
você poderá ricochetear. Cientistas têm algumas maneiras de contornar essa
situação, como fazer uma perfuração, disparar um arpão, colar, grampear, usar
“pés” grudentos como os de lagartixas, entre outras. O difícil é que nenhuma
solução funciona bem em todas as circunstâncias. Se o asteroide tiver uma
camada profunda de terra, perfurá-lo não permitirá uma boa aderência. Pés de
lagartixa tampouco ajudarão. Se a superfície for de metal duro, o arpão vai
ricochetear e provavelmente ejetar você para o espaço. Se a superfície for plana e
rochosa, seus grampeadores apenas a arranharão e também ejetarão você para o
espaço. O ideal é que você saiba o que está enfrentando, mas, a não ser que tenha
havido muito reconhecimento de território, você não saberá. É por isso que as
missões mais recentes rumo aos asteroides contam com várias tecnologias de
aterrissagem.
Uma de nossas ideias favoritas foi proposta pela dra. Karen Daniels, da
Universidade Estadual da Carolina do Norte. Ela acha que esse mecanismo de
aterrissagem pode funcionar como as raízes de uma planta. “Qualquer pessoa que
já arrancou ervas daninhas num jardim sabe como é difícil puxar uma planta
diretamente para fora do solo, com raízes e tudo.”
A ideia básica é ter pequenos escavadores que abram caminho entre os pedaços
de escombros. Conforme escavam com êxito a superfície, eles podem também se
ligar para dar um apoio adicional. Esse sistema nos parece inteiramente viável,
mas, para a nossa decepção, não é tão freudiano se comparado aos arpões e às
perfurações dos métodos mais óbvios.
Uma proposta para contornar o problema de aterrissagem é simplesmente
envolver o asteroide inteiro numa rede. Sim, numa rede. Uma enorme rede
espacial. Não é tão louco quanto parece — lembre-se, estamos em
microgravidade, então não é preciso muita força para mover as coisas. Com um
material muito forte, é possível dobrar a rede num espaço muito pequeno e
depois abri-la quando chegar ao alvo. Quando o asteroide estiver enredado, você
pode usar a rede como superfície de aterrissagem para sua colônia ou usá-la para
rebocar o asteroide para outro destino. Um objeto desses confirma nossa suspeita
de que o pessoal do espaço passa 90% de seu tempo criando acrônimos. Ele é
chamado de Weightless Rendezvous And Net Grapple to Limit Excess Rotation
(WRANGLER; “vaqueiro” em inglês) System [Sistema de Rendezvous sem Peso
e Agarramento de Rede para Limitar Rotação em Excesso] (proposto pelo dr.
Robert Hoyt, da Tethers Unlimited).
Outra proposta, feita pela TransAstra Corporation, chama-se APIS (Asteroid
Provided In-Situ Supplies) [Suprimentos In Loco Fornecidos pelo Asteroide]. O
APIS captura o asteroide com uma bolsa e em seguida usa luz solar concentrada
para aquecê-lo e cortá-lo. Chamam esse processo de “mineração ótica”. Esse
método causa uma liberação da água do interior do asteroide, que talvez você
queira depois de beber acidentalmente o escudo contra radiação de sua base
espacial.
Está bem, mas digamos que todas as coisas técnicas funcionaram. Ainda temos
um grande problema: não está claro quem tem os direitos de mineração dessas
rochas espaciais. Não há dúvida de que há o Tratado do Espaço Exterior, de
1967, mas esse acordo não lida com direitos de posse privada. O que ele diz é que
nações soberanas não podem reivindicar nada no espaço exterior. Não se sabe
bem se existe alguma lei regendo sua colônia espacial, desde que você não ceda à
tentação de declarar independência em relação Àqueles Terráqueos Deploráveis.
Em novembro de 2015, o Congresso dos Estados Unidos aprovou a H.R.2262
— Lei de Competitividade de Lançamento Espacial Comercial nos Estados
Unidos. A lei estipula que “um cidadão americano envolvido em recuperação
comercial de um recurso de asteroide ou de um recurso espacial pode exercer
sobre qualquer recurso de asteroide ou recurso espacial obtido os direitos de
posse, transporte, uso e venda de acordo com a lei aplicável, incluindo obrigações
internacionais dos Estados Unidos”. Em outras palavras: “Os Estados Unidos
não podem reivindicar o espaço, mas os americanos podem.” O Congresso teve o
cuidado de observar, na lei, que os Estados Unidos não estão declarando posse
sobre nenhum corpo celeste. Se e quando americanos começarem a explorar
rochas espaciais, veremos como outros países vão se sentir.
Portanto, dá para ver que há muitas dificuldades. O lado positivo é que todas
elas são realmente incríveis.

Em relação a missões reais, várias visitas não tripuladas a asteroides têm sido
feitas pela Nasa, ESA, CNSA e Jaxa, as agências espaciais americana, europeia,
chinesa e japonesa, respectivamente. Uma nave japonesa chamada Hayabusa
conseguiu coletar uma pequena quantidade de poeira de asteroide e retornar com
o material em 2010. A nave sucessora, Hayabusa 2, deverá trazer mais em algum
momento por volta de 2020. Uma missão de certa forma semelhante da Nasa,
chamada OSIRIS-REx, deverá retornar à Terra por volta de 2023.
Há várias missões propostas, inclusive pela Nasa, para capturar um asteroide
inteiro ou até enviar seres humanos a um asteroide próximo à Terra. Até agora,
nenhum desses planos mais extravagantes recebeu financiamento para fazer isso
acontecer.

Preocupações
Uma preocupação importante no momento é entender as particularidades da
lei e da ordem no espaço. Em algum momento, será preciso patrulhar esses
asteroides. Basicamente, teremos um manancial de recursos flutuando no espaço
e, uma vez que surjam tecnologias que facilitem a captura desses corpos celestes e
a extração de suas riquezas, não há dúvida de que acabará havendo crimes
espaciais cometidos por criminosos espaciais. Por mais legal que isso possa
parecer, talvez você não se sinta bem se apontarem uma faca espacial nas suas
costas espaciais.
Com seu nome incrível, o dr. Elvis (ele tem um primeiro nome, mas... por
favor), do Harvard-Smithsonian Center for Astrophysics, afirma: “Um dia,
precisaremos de um esquadrão de geeks do espaço para consertar equipamentos
de mineração espacial de bilhões de dólares. Prevejo que precisaremos também de
xerifes e legistas do espaço, porque recursos raros e valiosos sempre levam a
atividades ‘extralegais’.”
O dr. Elvis também salienta que estaremos deteriorando ambientes intocados
desde o surgimento de nosso sistema solar. Isso é um problema geral de toda a
exploração do espaço, mas nesse caso também estamos planejando explicitamente
destruir o objeto de interesse.
Talvez, como sugere o dr. Elvis — cujo nome é dr. Elvis —, no futuro criemos
um sistema de reservas espaciais para preservar pelo menos uma parte dos
asteroides, mas será preciso lidar também com as questões legais desse assunto.
Existem algumas coisas que só se formam no espaço e não são encontradas na
Terra. Como o que acontece em grande medida com as florestas tropicais
modernas, o risco que corremos é não apenas o de destruir coisas que queremos,
mas o de destruir coisas que nem sequer chegamos a conhecer.
Outra preocupação é a segurança. Mesmo que a humanidade concorde em
permitir a mineração espacial privada, quais são as regras que vão determinar para
onde podemos mover os asteroides?
Se uma tecnologia para movimentar asteroides estivesse amplamente
disponível, pessoas indesejáveis poderiam ter uma arma perigosa nas mãos.
Suspeitamos de que isso seria um risco relativamente baixo, considerando que até
os tiranos mais loucos da história ainda parecem se preocupar com a própria vida.
Mesmo supondo que se poderia tranquilamente deixar um asteroide cair sobre
Washington, D.C., seria difícil prever os resultados para o planeta. É possível que
um grande impacto levantasse poeira suficiente para bloquear o Sol, esfriar a
Terra e destruir um ano de colheitas. Mas o fato de que “Ei, Kim Jong-un não é
tão maluco assim” não serve de consolo.
O maior encontro entre a Terra e um objeto extraterrestre na história
registrada foi o “evento de Tunguska”, em 1908, quando um enorme objeto
celeste (não sabemos se foi um cometa feito quase todo de gelo ou um asteroide
feito quase todo de pedra) explodiu sobre a Rússia rural. Esse objeto tinha
provavelmente 36 metros de diâmetro, e seu poder explosivo teria sido
comparável ao de 185 bombas de Hiroshima.
O meteorito de Tunguska é pequeno em relação a alguns asteroides que
seríamos capazes de trazer para cá.

Como isso mudaria o mundo


Creio que a única maneira de explorar o sistema solar na escala que isso exige é ter um
programa espacial que cresça sem limites. Isso é o que as economias fazem. Vamos utilizar o
capitalismo para nos levar a conhecer os mundos à nossa volta.
• Dr. Martin Elvis

Se acontecer de você realmente poder lucrar na Terra a partir da mineração no


espaço e do retorno de riquezas para cá, as viagens ao espaço profundo deixariam
de ser algo que apenas governos têm condições de fazer e se tornariam algo como
a indústria do transporte por caminhão. Os benefícios econômicos de materiais
baratos seriam incríveis, e a capacidade de viajar ao espaço a baixo custo seria
ainda melhor.
Dito isso, com base em nossas pesquisas, achamos que é um cenário
improvável. Uma aposta melhor para mudar a vida de toda a humanidade é
simplesmente a seguinte: usando os recursos encontrados em asteroides, os
humanos podem começar a colonizar o espaço e conseguir aumentar
radicalmente o ritmo com que exploramos nosso sistema solar.
O sr. Faber observou que as riquezas no espaço são muito maiores do que as
encontradas na Terra: “Os materiais a que podemos ter acesso na Terra, nas
minas mais remotas, estão a uma profundidade de três a quatro quilômetros.
Conseguimos alcançar o petróleo que esteja talvez a seis ou sete quilômetros
abaixo. Mas se pegarmos as riquezas ao nosso alcance em todos os continentes do
mundo e as juntarmos numa esfera, ela teria cerca de duzentos quilômetros de
lado a lado. Esse é todo o material que temos para trabalhar na superfície
terrestre. No espaço, há centenas ou milhares de vezes mais recursos. Portanto,
não apenas podemos atender a uma quantidade de pessoas centenas ou milhares
de vezes maior com esse material como também ele está prontamente acessível.
Está flutuando no espaço livre. Não precisamos cavar fundo em lugares perigosos
para obtê-lo. Basta desmantelar os asteroides de maneira eficaz e enviá-los para
os lugares onde quisermos viver.”
Se tivermos no espaço todo esse material disponível e descobrirmos como
manufaturar lá mesmo, o custo das viagens espaciais cairá drasticamente.
Colônias espaciais gigantescas viram uma opção factível. E a mineração em
asteroides poderia ajudar a nos deslocarmos quando já estivermos no espaço. A
água e o carbono coletados nesses corpos celestes podem ser transformados em
combustível de foguete, o que significa que podemos usar recursos coletados no
espaço para nos ajudar a trazer esses mesmos recursos para cá, a irmos de uma
colônia para outra ou a explorar o espaço mais distante.
Isso é o que realmente anima o sr. Faber: “Acabei enjoando das corridas de
carros solares, voo de asa-delta, windsurfe e coisas assim, e concluí que o maior
benefício que eu poderia gerar para a humanidade, a coisa mais importante que
aconteceria na minha vida, seria levar os humanos para fora da Terra e torná-los
uma espécie multiplanetária ou interplanetária.”
Nós, hã... também estamos completamente enjoados de corridas e windsurfe, e
é por isso que estamos sentados neste escritório preparando este documento...
para a humanidade.
24. Também conhecido como aurora boreal e aurora austral.
25. Bem, talvez tenham sido seguras. Um estudo do dr. Michael Delp, da Universidade Estadual da Flórida,
verificou que os astronautas da Apollo (envolvidos nas missões à Lua) tiveram um risco maior de morrer de
doenças cardiovasculares. Estudos com camundongos sugeriram que isso ocorreu porque a radiação danifica
as células que revestem os vasos sanguíneos. Porém, em razão do pequeno número de viajantes da Apollo
mortos, esse estudo só pôde levar em conta sete humanos. Considerando o que lemos sobre esses caras da
Apollo, há uma chance razoável de que as doenças cardíacas tenham tido mais a ver com o que chamamos de
triângulo sexo-bebida-carne do que com o que aconteceu durante uma semana ou duas no espaço.
26. Dito isso, pelo menos alguns cientistas pensam que a velocidade e a rotação de alguns asteroides podem
ser, por si sós, bons recursos. Por exemplo, o dr. Alexander Bolonkin propõe uma grande rede que prenda um
asteroide em movimento, roube parte de sua energia, desprenda-se e voe adiante. Para entender, pense em
um skatista se agarrando a um carrossel em rotação para ganhar alguma velocidade.
SEÇÃO 2
Coisas, logo, logo
4.

Energia de fusão
É a energia do Sol, e isso é legal, mas será capaz de fazer minha
torradeira funcionar?

A fusão nuclear é a solução mais avançada para as necessidades energéticas da


humanidade. É limpa, pode usar elementos comuns como combustível e não
oferece risco algum de acidentes catastróficos. Mas, hoje em dia, o que faz a sua
torradeira preparar muito bem seus pãezinhos é provavelmente alguém por perto
queimando carvão ou gás natural.
Antes de entrarmos nas complexidades sobre você estar destruindo o mundo
toda vez que faz uma torrada, vamos falar por um minuto sobre a física da fusão.
Fusão é quando dois átomos se fundem. É isso. No contexto da energia de fusão,
geralmente estamos falando de dois átomos de hidrogênio se fundindo.
O hidrogênio é o elemento mais leve da tabela periódica, e seu núcleo é apenas
uma partícula carregada, chamada próton. Mas, como acontece com todos os
elementos, não existe apenas uma forma de hidrogênio. Existem muitas, e os
diferentes tipos são chamados de isótopos. O que há de diferente nos diversos
isótopos? O número de partículas sem carga em seus núcleos: os nêutrons.
Cerca de 99,98% de todos os hidrogênios existem numa forma com zero
nêutron. Tecnicamente, eles são chamados de hidrogênio-1. Ou, para crianças
mais sofisticadas, você pode chamar de prótio. Mas na prática chamamos de
hidrogênio. Aproximadamente 0,02% dos hidrogênios têm um nêutron
adicionado, além de seu próton. Esse negócio é geralmente chamado de deutério,
porque a palavra grega que significa “a segunda coisa” é deuteros. Se houver mais
um nêutron além desse, é um trítio, que praticamente não existe em lugar
nenhum porque esses nêutrons a mais o tornam instável. O trítio tem uma meia-
vida de 12,32 anos, então se você tiver uma jarra cheia de trítio, quando checá-la
12,32 anos depois, metade terá sumido.
É mais ou menos como a forma mais comum de relacionamento. Em geral são
entre duas pessoas, mas entre trios e números maiores também existem. Portanto,
se você estiver numa conferência sobre energia de fusão e for convidado a ir ao
quarto de hotel de alguém para um “isótopo raro”, sua resposta é “sim”.
Você pode ir mais além, para o hidrogênio-4, o hidrogênio-5 e assim por
diante, mas todos esses elementos são extremamente instáveis, durando uma
pequena fração de segundo nas raras ocasiões em que chegam a existir.
Por que nos importamos com todos esses isótopos? Porque isótopos de
hidrogênio maiores têm uma fusão muito mais fácil. Para entender por quê,
imagine que você precisa bater um carro em outro, mas cada carro tem um ímã
gigante na frente. Os ímãs são instalados de modo que os dois veículos tenham o
mesmo polo magnético na parte dianteira. Portanto, quando se aproximam, há
uma forte resistência.
No entanto, se você os colocar extremamente perto um do outro, cada carro
tem um pequeno engate que os mantém juntos tão fortemente que o agente
repulsivo dos ímãs não consegue separá-los. Agora pergunte a si mesmo: se você
quiser que isso dê certo na primeira tentativa, vai preferir que os carros sejam
Mini Coopers ou SUVs enormes?
Intuitivamente, você quer o carro mais pesado, certo? Você sabe por
experiência própria que é muito mais difícil reduzir a velocidade de um carro
pesado do que a de um carro leve. Supondo que os ímãs tenham a mesma força,
se seu objetivo for engatar os dois carros, o plano é que eles tenham o maior peso
possível, de modo que os ímãs tenham mais dificuldade de pará-los.
Os átomos de hidrogênio enfrentam uma situação semelhante quando
tentamos fundi-los, e chegaremos a esse assunto num instante. Resumindo: eles
repelem um ao outro com muita força até chegarem perto. Adicionando
nêutrons, obtemos um hidrogênio que está mais para um SUV do que para um
Mini Cooper.
Quando se fundem, os isótopos de hidrogênio se tornam um elemento
diferente: o hélio. Isso pode parecer estranho, mas não é mais estranho do que a
maneira como dois pedaços de pão formam uma coisa nova chamada sanduíche.
O hidrogênio é o elemento com um próton. O hélio é o elemento com dois
prótons.
Para nossos propósitos, o interessante é o seguinte: quando transmutam de
hidrogênio para hélio, esses isótopos liberam uma ENORME quantidade de
energia.
Eis por quê: a configuração atômica que conhecemos como “hélio” precisa de
menos energia para se manter unida do que duas configurações atômicas que
conhecemos como “hidrogênio”. Quando a fusão acontece, essa energia tem que
ir para algum lugar. Quando ela vai, podemos coletá-la.
Essa ideia de que a energia “tem que ir para algum lugar” pode parecer um
pouco esquisita de início, mas não é nada tão estranho. Para entender, vamos
considerar uma besta, aquela arma antiga. Se a corda de sua besta está frouxa,
você sabe que é diferente de quando ela está retesada. As duas bestas (a frouxa e a
retesada) são basicamente a mesma, mas, por causa do ajuste físico, a corda frouxa
é um tanto quanto inútil, enquanto a corda tensa pode matar aquele cara que
você pensou que fosse o cavaleiro negro quando estava bêbado na feira medieval.
Para tensionar a corda, é preciso usar energia. E, para afrouxá-la, tem que
liberar energia.

“Existe realmente mais energia na besta retesada?”, você pergunta. SIM. Existe.
Suponha que você apanhou a besta frouxa e a retesada e as colocou
separadamente em tonéis de ácido do mesmo tamanho. Quando cada uma delas
acabar de dissolver, o tonel que desfez a besta retesada estará um pouco mais
quente do que aquele que dissolveu a frouxa.
Sim. Lembra quando você estava entediado na aula de física? Isso foi porque
seu professor não estava dissolvendo bestas.
Ao levar isso em consideração, obter energia mudando a configuração de algo
não parece tão estranho assim. Encontramos situações como essa o tempo todo.
Uma pedra mantida no alto pode quebrar o pé de alguém, enquanto uma no chão
não pode. Uma mola esticada mudará de formato espontaneamente quando for
solta, mas uma frouxa não. Dois ímãs forçados a tocar polo norte com polo norte
vão se repelir quando forem soltos, enquanto dois ímãs com polos opostos se
tocando ficarão ali.
Tudo isso é para dizer que obter energia aproximando dois átomos não é algo
tão estranho à sua experiência diária. O modo como configuramos as partes de
um sistema determina o futuro dele. E às vezes podemos montar um de modo
que ele faça coisas de que os humanos gostam.
Pelo que se vê, uma mudança na configuração de dois átomos pequenos
(hidrogênio) para se transformarem num átomo maior (hélio) libera energia. Para
a maioria das reações de fusão, você usa pelo menos um isótopo de hidrogênio
com um nêutron extra. Falando de modo geral, a energia é liberada porque um
desses nêutrons extras é chutado para longe em alta velocidade depois de que os
isótopos se combinam. Uma vez que temos nêutrons quentes zunindo, podemos
capturar essa energia da mesma maneira que uma velha turbina a vapor funciona:
colocando os nêutrons na água, aquecendo-a até subir vapor e girando a turbina.
Mas espere aí. Por que precisamos de fusão para girar uma turbina? Podemos
fazer isso com carvão, diesel, gás ou vento. É verdade, mas a energia de fusão é
especial porque requer apenas uma pequena quantidade de combustível, e esse
combustível é relativamente abundante.
De acordo com o livro de Garry McCracken Fusion: The Energy of the
Universe, o lítio27 de uma bateria de laptop e o deutério em “meia banheira de
água” podem gerar uma energia de fusão de duzentos mil quilowatts-horas,
equivalente a quarenta toneladas de carvão.
Então por que ainda não temos energia de fusão? Embora seja mais fácil fazer
dois isótopos grandes se fundirem em comparação a seus equivalentes menores,
mais estáveis, o processo ainda é realmente difícil. Isso por causa de algo
chamado barreira de Coulomb, que é uma quantidade enorme de energia (pelo
menos em escala atômica) necessária para pôr dois prótons muito, muito, muito
próximos um do outro (pense nos ímãs de nossa analogia anterior com carros).
Os prótons se repelem. Na verdade, quando se aproximam, a força de repulsão
aumenta. É mais ou menos como quando você tenta fazer dois amigos
socialmente inaptos conversarem numa festa.
Mas quando os prótons ficam muito, muito, muito próximos, uma outra força,
chamada força nuclear forte, entra em ação. Essa força é muito grande em
pequenas distâncias. Supera a repulsão e faz com que os prótons fiquem juntos
(como o engate na analogia dos carros).
Em outras palavras, fundir dois prótons é como fazer dois amigos socialmente
inaptos se casarem. Se você conseguir colocá-los um ao lado do outro, eles podem
compartilhar a opinião de que a segunda edição de Advanced Dungeons &
Dragons é a melhor.28 Eles ficarão tão apaixonados que nunca se separarão. Mas
enquanto não estiverem bem ao lado um do outro, eles nem sequer farão contato
visual.

A energia do Sol é de fusão. Então por que não podemos fazer a mesma coisa
que o Sol, seja lá o que for, num laboratório aqui na Terra? Bem, o Sol tem uma
vantagem: pressão gravitacional extremamente elevada em seu centro, então os
átomos de hidrogênio estão batendo uns nos outros em alta velocidade e a todo
instante. Não sabemos bem quais são as implicações para nossa analogia do
namoro de nerds,29 mas a questão é que essas condições não existem na Terra.
Para conseguir energia de fusão, temos que descobrir uma forma de obter a
força de toda essa gravidade através de algum outro meio que não seja a
gravidade.
CALMA AÍ. Nós já não sabemos fazer bombas de fusão? Não foi isso que
usaram naquele documentário de Bruce Willis sobre explodir um asteroide? Por
que não podemos fazer o seguinte:

1. Pegar uma bomba de hidrogênio.


2. Explodi-la.
3. Coletar calor.
4. Ferver água.
5. Girar turbinas.
6. Fazer a torradeira funcionar.
7. Comer torradas quentinhas.

A resposta é... na verdade, sim, poderíamos fazer isso. Podemos criar condições
semelhantes às do Sol com uma bomba de fusão. Em essência, o que você faz é
detonar algumas boas e antiquadas bombas atômicas de fissão30 e depois usar a
energia resultante para comprimir uma esfera cheia de hidrogênio. Desse modo,
seu hidrogênio estará batendo em si mesmo bem rápido não por causa da
gravidade, mas por causa de toda a força das bombas atômicas. Alguns eventos de
fusão ocorrem e BUM: energia suficiente para abrir um buraco na atmosfera ou
transformar uma grande parte de um deserto em vidro.
Mas há alguns problemas. Primeiro, o contêiner das bombas provavelmente
não resistiria à explosão, dificultando a captura dessa energia. Segundo, mesmo
que o contêiner resistisse, ele estaria com uma quantidade absurda de radiação.
Terceiro, se o contêiner não fosse perfeito, você poderia enviar uma imensa
nuvem de poeira radioativa para a atmosfera.31 Quarto, a embaixada russa está
ligando, e parece que eles estão um pouco irritados ao telefone.
A geopolítica e as preocupações com segurança excluem a abordagem mais
simples.32 Temos que procurar condições semelhantes ao Sol em outro lugar.
Como, por exemplo, naquela gaiola de metal esférica em cima da sua mesa.
Está bem, talvez não na sua mesa, mas com certeza na mesa de Richard Hull, o
primeiro cientista amador a alcançar a fusão. O sr. Hull coadministra um site na
internet chamado Fusor.net, no qual as pessoas podem aprender a criar e acionar
reatores nucleares de mesa.
Embora o site tenha muitos “fusoneiros” entre seus membros, apenas cerca de
75 deles demonstraram oficialmente uma fusão e, portanto, tiveram a honra de
ingressar no Neutron Club. Um menino chamado Taylor Wilson entrou para o
Neutron Club aos quatorze anos. Portanto, tenha isso em mente quando estiver
tentando decidir se já fez o bastante em sua vida.
Se souber o que está fazendo e tiver acesso a todos os equipamentos
adequados, você pode criar um reator nuclear de mesa por cerca de 3 mil dólares.
É isso mesmo, crianças. Por apenas 10 dólares por dia durante trezentos dias você
poderia ter uma arma de nêutron. Eis como:
Primeiro, vá a uma loja de gaiolas de metal esféricas e adquira uma gaiola de
metal esférica.
Agora, eletrifique essa gaiola de modo que ela tenha uma carga positiva muito
forte.
Dentro da gaiola positivamente carregada, ponha uma gaiola menor com uma
carga negativa muito forte.

Depois de fazer tudo isso, você coloca toda a estrutura numa câmara a vácuo e
adiciona um pouco de gás deutério entre as duas gaiolas. A compra de gás
deutério pode exigir o preenchimento de alguns papéis do Departamento de
Segurança Interna, mas se você não quiser ser posto numa lista, basta entrar na
internet e comprar um pouco de “água pesada”.
Está bem, isso parece a maior fraude do mundo, mas juramos que é verdade.
Água são duas partes de hidrogênio e uma de oxigênio (H2O). Água pesada é a
mesma coisa, só que os hidrogênios são substituídos por deutério (D2O).
Lembre-se, o deutério tem um nêutron extra, então a água, apesar de parecer a
boa e velha água comum, é um pouco mais pesada.
Agora, pegue sua D2O e passe uma corrente elétrica por ela. Isso vai dividi-la
em gás oxigênio e gás deutério. Nesse momento, dê uma olhada pela janela para
se certificar de que o FBI não está na rua. Tudo limpo? Bom. Aqui vai a parte
difícil: você precisa “secar totalmente” o gás, removendo o vapor de água pesada.
Segundo o sr. Hull, isso é bem complicado, já que mesmo uma pequena
quantidade de vapor arruinará sua festa de fusão. Há diferentes maneiras de fazer
isso. Por exemplo, você pode passar o gás por um tubo frio, onde é mais provável
que o vapor se prenda às suas paredes, ou pode passá-lo por algo com muita
superfície de contato para ele se prender, como algodão.
Agora, injete o deutério na gaiola eletrificada. O campo elétrico forte divide o
gás em partes positiva e negativa. Agora você tem pequenos núcleos de deutério,
prontos para esmagar.
A gaiola externa positiva empurra o deutério para o centro e a gaiola interna
negativa puxa-o para o centro. Quando menos se espera, muitas colisões estão
acontecendo.
Você se lembra dos nossos nerds socialmente inaptos? Imagine um quarto. No
centro do quarto estão bonecos raros dos primórdios de Star Wars
(especificamente aqueles com sabres de luz retráteis que foram suspensos em
1978). Nas paredes do quarto há pôsteres de cenas dos filmes O Hobbit que não
estão no livro original. Agora, entre esses pôsteres horríveis, totalmente não
canônicos, e esses bonecos incríveis, super-raros, você joga um monte de nerds.
Todos os nerds correm dos pôsteres nas paredes em direção aos bonecos. A
atração e a repulsão combinadas são tão fortes que eles se jogam bem junto nos
brinquedos, batendo uns nos outros, abraçando-se, involuntariamente discutindo
episódios perdidos de Doctor Who e deixando de ser seus amigos sozinhos e
desajeitados para se tornarem seus amigos que, de tão grudentos, chegam a causar
desconforto.
Da mesma forma, as partículas de deutério entre a gaiola externa positiva
(repelente) e a gaiola interna negativa (atraente) se prendem e se fundem. Viva!33
Mas, espere aí... nós não dissemos antes que a fusão é realmente difícil?
Sim, então o lance é o seguinte: a maioria de nossos amigos socialmente
inaptos não está se casando. Sinto muito. Este casal aqui discorda sobre quem
sabe mais sobre Wolverine. Aquele casal ali simplesmente bateu cabeça e
desmaiou. E o cara de armadura de papelão amarela está “se guardando” para a
Sigourney Weaver.
Da mesma forma, a maioria das partículas de deutério não se funde com êxito.
Algumas batem na gaiola. Outras não atingem partícula alguma. Outras se
acertam com força e resvalam, em vez de se combinarem.
Como há uma quantidade suficiente de partículas juntas, você obterá alguma
fusão, mas será só um benefício da lei das médias. Seu aparelho de fusão de mesa
tem um saldo negativo de energia. Ele consome mais energia do que produz.
A essa altura você pode estar se perguntando sobre os fusoneiros: por que eles
estão fazendo fusão se não vão ganhar energia com isso? Acontece que os
fusoneiros costumam ser de três tipos: os que pensam que resolverão o problema
da fusão e darão ao mundo uma energia limpa e barata; os que estão fazendo o
projeto faça-você-mesmo mais legal da história e os que querem nêutrons para
pesquisas. Por acaso, Richard Hull está no terceiro grupo, passando sua
aposentadoria investigando a natureza do átomo... como qualquer um faria.
E agora chegamos ao ponto principal do problema: podemos fazer a fusão
acontecer usando uma bomba, embora seja difícil demais de controlar. Podemos
fazer a fusão acontecer com uma simples gaiola eletrificada, mas isso não é muito
eficiente. E neste exato momento não temos uma boa maneira de chegar a um
meio-termo.
Existem várias abordagens diferentes para resolver a questão, mas nos
principais experimentos há duas maneiras de agir: explodir todo o seu
combustível de fusão de uma só vez ou confiná-lo num lugar pequeno enquanto
ele aquece.
Explodir, provavelmente com um laser, é bom porque faz com que muitos
eventos de fusão aconteçam de uma vez. Quando eventos de fusão ocorrem em
momentos diferentes, a reação de fusão geral tende a ficar mais lenta. Para
entender, pense em nossos casais de nerds. Se cada casal que se apaixonar der as
mãos e sair correndo feliz, derrubará os nerds que estão chegando, e esse nerds
caídos não terão chance de se fundir com outros.

Da mesma forma, átomos fundidos produzem pequenas liberações de energia,


o que atrapalha a reação de fusão, pois empurram prótons que estão chegando.
Portanto, é bom tentar fazer com que todas as reações de fusão aconteçam de
uma só vez.
A desvantagem da explosão é precisar de uma quantidade incrível de energia a
ser liberada num intervalo de tempo curto. Tipo, ter mais energia do que o
restante do mundo reúne, em uma fração de segundo. Não é uma ideia tão louca
assim. Existe um dispositivo no Sandia Labs, um dos laboratórios do governo
americano responsável pelo desenvolvimento e pesquisa de armas nucleares,
chamado máquina Z, que armazena uma quantidade enorme de energia num
grande banco de capacitores e depois a libera toda de uma vez. Mas chegaremos
nesse assunto daqui a pouco.
A vantagem da segunda abordagem — confinar e aquecer — é que o
combustível de fusão pode ser aquecido durante um período mais longo e de
maneira mais controlada. Como você não está explodindo tudo de uma vez, é
preciso que o combustível seja realmente bem armazenado.
Usa-se plasma, então. Para quem não lembra, o plasma é um tipo de matéria
que pode alcançar temperaturas elevadas.
Pense nisso da seguinte maneira: você começa com um cubo de gelo. Aquece-o
até as moléculas se soltarem umas das outras, mas ainda atraídas por suas forças
intermoleculares. Em outras palavras, a água vai do sólido para o líquido. Se você
continuar aquecendo, a energia nessas moléculas acaba se tornando tão grande
que já não se importam com a ligeira atração entre elas e voam em todas as
direções. Ou seja, tornam-se gás. Se você continuar aquecendo cada vez mais, e
mais, e mais, e mais, os próprios átomos se rasgam em duas partes — os núcleos
com carga positiva e os elétrons com carga negativa.
Para essa discussão, ignore os elétrons e imagine o plasma como um gás muito
quente com uma carga elétrica positiva. Essa carga torna o plasma muito
diferente do gás. Se houver um cheiro ruim de gás em seu quarto, você só
consegue se livrar soprando ar contra ele. Se houver um plasma ruim, é possível
controlar o movimento dele usando campos magnéticos. Podemos não só nos
livrar dele como moldá-lo, confiná-lo.
Há um pequeno aspecto negativo nesses reatores do tipo “confinamento
magnético”: talvez seja um pouco difícil confinar um plasma que tem mais ou
menos a temperatura do interior do Sol.
Com essas restrições em mente, há vários experimentos, grandes e pequenos,
tentando encontrar uma solução.

Em que pé estamos agora?


Como existem experimentos demais sendo feitos, não temos como examinar
todos eles em detalhes. Portanto, vamos nos restringir a alguns.
NIF

A National Ignition Facility (NIF) [Instalação Nacional de Ignição] é tão


incrível que foi usada como cenário em Jornada nas Estrelas. Você talvez
conseguisse fazer nerds se fundirem ali dentro literalmente.
A NIF está trabalhando numa técnica chamada fusão por confinamento
inercial. A maneira como eles fazem isso é a seguinte: comece com um
ultramegalaser superpoderoso — um laser tão poderoso que o derretimento de
suas próprias lentes é um problema. Esse laser é dividido em 192 feixes.34 Os
feixes convergem para um cilindro de ouro do tamanho da ponta do seu dedo.
Dentro desse cilindro está o combustível de fusão. O cilindro absorve essa dose
maciça de energia e depois emite raios X extremamente fortes para o centro,
comprimindo o combustível e (assim eles esperam) provocando muitos eventos
de fusão. É como uma bomba de hidrogênio fofa e pequenininha.

A NIF ainda não alcançou a “ignição”, que é quando a produção de energia


ultrapassa o necessário para iniciar a reação. Em 2015, eles atingiram mais ou
menos um terço do objetivo.35 Mas o lugar não se chama Instalação Nacional de
Um Terço de Ignição. É necessário pesquisar muito mais para validar esse
método de fusão.

MagLIF

Outro experimento estimulante é o projeto MagLIF, do Sandia Labs. Mag-


LIF é uma forma reduzida de Magnetized Liner Inertial Fusion [Fusão Inercial
de Revestimento Magnético].
Eis um esboço de como isso funciona: pegue um cilindro resfriado e cheio de
combustível de fusão. Agora, use um laser potente e exploda o combustível de
fusão através de um dos lados, de modo que alcance uma temperatura elevada
muito depressa. Antes que o combustível exploda através do cilindro, use um
banco de capacitores incrivelmente gigante para provocar uma enorme descarga
elétrica. Isso cria um campo magnético, que quebra o cilindro.
Resumindo: exploda e depois destrua.
Experimentos iniciais com essa abordagem já foram realizados e mostraram ser
uma grande promessa. No entanto, o MagLIF ainda está muito longe do ponto
de equilíbrio (em que a energia posta ali dentro para iniciar a reação é igual à
energia retirada). Quer dizer, está indo melhor do que o experimento de fusão no
porão da nossa casa, feito com ímãs, chiclete e esperança... Mas esse projeto é
realmente animador porque o laboratório produziu alguns modelos detalhados
em computador sugerindo que, se tiver sua escala aumentada o bastante (em
termos de energia), a abordagem deverá ser capaz de alcançar o ponto de
equilíbrio. Os experimentos continuam, e o banco de capacitores gigante (a
máquina Z, que mencionamos anteriormente) está sendo ampliado. Se as coisas
correrem bem, é possível que eles consigam até o fim da década.

ITER

O maior experimento de todos, que usa a configuração de fusão mais bem-


sucedida e bem estudada, é o ITER, International Thermonuclear Experimental
Reactor [Reator Termonuclear Internacional Experimental].
O ITER usa uma configuração “tokamak”, que é o acrônimo russo para
câmara magnética toroidal. Basicamente, imagine que você tem um donut
gigante, só que em vez de farelo e lágrimas, seu interior é recheado de plasma.
Com o uso de campos magnéticos, o plasma é confinado e flui pelo meio do
tubo. Imagine um anel fino de plasma dentro do donut gigante. Por causa dos
fortes campos magnéticos, é extremamente difícil o anel de plasma escapar. A
partir daí, o ITER usa vários métodos para aquecê-lo: eletrocutam, usam micro-
ondas e disparam um raio de nêutrons contra ele. Quanto mais energia é
transferida para esse aro apertado de plasma, mais quente o plasma fica, até que
(se funcionar!) seus prótons começam a fundir.
Eis a parte boa: a reação de fusão do plasma libera energia, o que aquece mais
o plasma, provocando ainda mais fusão. Seria como uma vela. Se você aproximar
um isqueiro de uma vela mas o pavio não pegar fogo, todo o calor do pavio se
dissipa quando você apagar o isqueiro. Mas se você fizer o pavio pegar fogo, a
vela continua queimando até o fim. O fogo cria mais fogo. Da mesma maneira, a
reação de fusão a uma velocidade alta o bastante pode sustentar uma queima de
fusão contínua. Se isso acontecer, todos os métodos de aquecimento externo
podem ser desligados e a reação continua.
E o bônus é que isso está acontecendo dentro de um imenso donut de metal.
Hoje em dia, o ITER é o maior e mais caro projeto de fusão. Infelizmente
(assim como muitos megaprojetos de ciência), tem tido muitos atrasos e
orçamentos estourados. Você sabe como é difícil fazer com que gatos com danos
cerebrais concordem com alguma coisa? Bem, imagine que, em vez de gatos com
problemas no cérebro, sejam nomeados políticos de muitos países diferentes. A
estimativa de custo atual do ITER é de mais de 15 bilhões de dólares,36 o que
representa um pequenino aumento em relação aos 5 bilhões de dólares
inicialmente projetados. Justiça seja feita, eles erraram por apenas um dígito.
Ainda assim o progresso continua. Enquanto escrevemos isto, a porção
tokamak do ITER está sendo finalmente construída. A esperança é de que o
experimento de reator de fusão completo aconteça em 2027, bem a tempo da
primeira Revolta dos Robôs. O ITER, de modo geral, é considerado a maior
esperança para a criação de um reator de fusão funcional num futuro próximo, e
tem bons motivos para isso. O maior tokamak em funcionamento atualmente, o
Joint European Torus ( JET), já está alcançando entre 60% e 70% do ponto de
equilíbrio.

Outros projetos

Além desses grandes experimentos, existem muitas outras iniciativas


heterodoxas de menor expressão. Os cientistas com os quais conversamos
geralmente se referem a essas experiências com alguma versão de “espero que
funcione, mas provavelmente não vai”. Mas, só por diversão, vamos contar a você
sobre um projeto interessante de uma empresa chamada General Fusion.
O método deles ganha o prêmio de O Mais Cientificamente Doido. Funciona
da seguinte maneira: pegue uma esfera e a preencha com um metal líquido
pesado. Gire a esfera tão rápido que um vórtice se abra no centro. Injete
combustível de fusão no vórtice e em seguida coloque uma série de aríetes
batendo simultaneamente na superfície externa da esfera. Os aríetes criam uma
onda de pressão que se desloca através do metal líquido em direção ao centro,
onde acerta o combustível de fusão.
Se isso funcionar, uma boa característica é que essa energia pode ser coletada
do metal líquido aquecido.
Várias empresas estão trabalhando em outras abordagens pouco convencionais,
mas muitas delas as mantêm em segredo e não foi possível obter detalhes
interessantes a respeito. Por exemplo, a Lockheed Martin anunciou recentemente
que também tem um reator de fusão que está bem perto de funcionar. No
entanto, os detalhes foram muito vagos. Isso é o equivalente científico de dizer
“Ei, tenho uma namorada muito sexy que você nunca viu, mas não tenho fotos e
você não tem permissão para ler nossos e-mails”. Pode ser verdade, mas por
enquanto ainda não estamos muito animados.
Preocupações
Todo projeto de reator de fusão produzirá algum resíduo radioativo. Quando
ouvem a palavra “radioativo”, as pessoas imaginam um executivo rindo e
derramando uma substância verde fosforescente numa creche, para depois se
transformar num bando de morcegos e voar noite adentro. Essa caracterização
não é, em seus pormenores, completamente precisa. O ITER não produzirá
qualquer resíduo líquido como faria uma usina de fissão, e o trítio radioativo será
capturado e reutilizado em futuras reações.
Na verdade, o site do ITER afirma que as coisas são tão bem controladas que
um incêndio na usina de trítio nem sequer demandaria uma evacuação da
população local. Sim, partes do ITER bombardeadas pelas reações serão
irradiadas, mas não serão classificadas como “altamente” radioativas e seus índices
de radiação vão cessar num período relativamente curto.
Entretanto, para aqueles que estão preocupados, é importante observar que um
reator de fusão não é nada parecido com um reator de fissão, que é ao que as
pessoas se referem quando falam sobre energia nuclear. Ambos implicam núcleos
atômicos, mas sua mãe, Saturno e torta de maçã também implicam.
De acordo com o dr. Daniel Brunner, do Plasma Science and Fusion Center,
do Massachusetts Institute of Technology (MIT), “a reação de fusão produz
apenas hélio e nêutrons, nenhum gás gerador do efeito estufa e nenhum resíduo
radioativo de vida longa”. Os nêutrons param quando batem na lateral do reator,
e o hélio não é um gás reativo. Além disso, as crianças ficarão felizes quando
segurarem seus balões de aniversário que voam graças às reações termonucleares.
De acordo com o dr. Brunner, “diferentemente do resíduo da fissão, esse material
é seguro o bastante para ser reciclado dentro de cem anos”.
Outra preocupação frequente com a fusão é se existe risco de acidente.
Explicando de maneira simples, não há risco algum. Caso não esteja claro: é
muito, muito, muito difícil fazer a fusão funcionar. Pelo menos da perspectiva de
pessoas que não querem explodir pelos ares, trata-se de uma característica
positiva.
O dr. Bruce Lipschultz, da Universidade de York, nos disse: “Apenas o
combustível necessário para a reação imediata é mantido no reator durante o
processo, diferentemente de um reator de fissão, em que o equivalente a um ano
de combustível é armazenado dentro do reator. E é um desafio tão grande manter
uma reação de fusão que se a contenção do reator for perdida... a reação de fusão
se apagará como uma vela ao vento.” Como ele trabalha com tokamaks, seria
mais parecido com um donut gigante recheado de plasma apagando ao vento,
mas aceitamos sua explicação.
Nenhum entrevistado levantou preocupações em relação a problemas
ambientais ou sociais. O verdadeiro problema da fusão parece ser simplesmente
fazê-la funcionar. De fato, o sr. Hull adora dizer que “a fusão é a energia do
futuro e sempre será”.
Conversamos sobre isso com o dr. Alex Wellerstein, um historiador nuclear37
do Stevens Institute of Technology. Ele estava um pouco mais otimista em
relação à tecnologia em si, mas tinha preocupações com o potencial de mercado.
Ele observou que, mesmo com as tecnologias já existentes, precisamos de
transportadoras especializadas em combustível de fusão, às vezes feitas de metais
caros, como ouro e berílio. O próprio combustível de fusão pode ser caro,
dependendo das tecnologias que forem bem-sucedidas. Assim, mesmo que se
obtenha um saldo positivo de energia, temos que considerar o custo da energia e
o tempo necessário para o investimento dar retorno. Mesmo que a compensação
não esteja clara a curto prazo, as pesquisas ainda são justificáveis. Setenta anos se
passaram até que as células fotovoltaicas solares deixassem de ser uma criação em
laboratório para se tornarem uma maneira prática de construir uma usina de
energia, por exemplo.
Como diz o dr. Wellerstein: “Precisamos parar de financiar apenas coisas que
deem retorno a curto prazo, senão o retorno a longo prazo nunca chegará.”
Com o desenvolvimento de tecnologias maiores, financiar um
empreendimento de risco é sempre um grande obstáculo. No auge das missões
Apollo, o governo dos Estados Unidos gastou quase 4,5% de todo o seu
orçamento na Nasa, empregando mais de quatrocentas mil pessoas. Sem esse
gasto enorme, é possível que hoje disséssemos que os pousos na Lua são coisa de
um futuro distante. Em contrapartida, o orçamento americano para energia de
fusão em 2015 correspondeu mais ou menos ao custo da compra de um único
Boeing 747.38
Como acontece com qualquer tecnologia, é possível que haja sérios
desdobramentos que ainda não foram considerados de forma adequada.
Entretanto, pelo menos neste momento, um reator de fusão em funcionamento e
economicamente viável parece ser um bem genuíno para a humanidade.
Esperamos que essa última frase não apareça num livro de história pós-
apocalíptico sobre a arrogância humana.

Como isso mudaria o mundo


Explicando de maneira simples, a energia de fusão é uma fonte de combustível basicamente
ilimitada. Nenhum gás do efeito estufa, nenhum resíduo radioativo de vida longa e nenhuma
chance de acidente.
• Dr. Bruce Lipschultz
Se a energia de fusão se tornasse economicamente viável, o benefício mais
óbvio seria a energia barata. Em razão da abundância e do custo relativamente
baixo do insumo, um reator de fusão, mesmo exigindo manutenções como
qualquer outro tipo de usina, seria uma fonte de energia cujo preço diminuiria
com o passar tempo, à medida que a tecnologia avançasse.
Como energia é um insumo de praticamente qualquer produto, podemos
esperar um preço mais baixo para a maioria dos bens de consumo. Isso seria
válido principalmente para indústrias que requerem muita energia, como as de
substâncias químicas, cimento, papel e metais.
Os benefícios para o meio ambiente também seriam substanciais. Reatores de
fusão gerariam um nível mínimo de poluição e nenhum carbono, o que
significaria que poderíamos obter energia sem contribuir para as mudanças
climáticas. Mesmo que de início a fusão fosse mais cara, quando consideramos os
potenciais danos ambientais do carbono atmosférico cada vez maior, esse ainda
poderia ser o melhor caminho do ponto de vista econômico. Além disso, o
combustível mais provável para a fusão é o hidrogênio, o material mais abundante
do universo. Portanto, a aquisição de combustível teria um impacto ambiental
relativamente baixo. Em outras palavras, se você tivesse sua própria usina de
fusão, poderia queimar painéis solares em perfeito estado em sua lareira só por
diversão e ainda seria convidado para reuniões do Greenpeace.39
A energia de fusão também seria de grande ajuda para as viagens espaciais de
longa distância. Em virtude de considerações de segurança e eficiência, a maioria
das espaçonaves usa combustíveis líquidos e painéis solares para ter energia e
propulsão. Um reator de fusão a bordo seria comparativamente seguro no caso de
acidente e forneceria uma grande quantidade de energia. Além disso, o
hidrogênio é encontrado em todo o sistema solar e mesmo em regiões
relativamente vazias mais distantes. Se pudesse coletar esse material, separar com
eficiência o deutério e fundi-lo, uma espaçonave teria uma vida útil com
potencial ilimitado.
Provavelmente, há também muitos benefícios da energia barata difíceis de
prever. Na época do óleo de baleia, teria sido difícil imaginar milhões de carros
movidos a gasolina. Da mesma forma, nesta época de energia mais cara, pode ser
que não sejamos capazes de ver as maravilhas que estão além do horizonte.
Nota bene sobre o Projeto Plowshare
Sudeste do Novo México, 1961. Terra seca e plana com pequenos arbustos
esparsos. Um lugar que viu poucos humanos no último milênio está, nesse dia,
ocupado por representantes das Nações Unidas convidados pela Casa Branca.
Eles estão ali para testemunhar uma explosão atômica. Embora possa gerar
implicações geopolíticas, o objetivo dessa bomba não é começar uma guerra — é
demonstrar que bombas atômicas podem ser usadas para fins pacíficos, que é
possível transformar a espada atômica num arado.
A ideia foi a seguinte: jogue uma bomba num poço profundo de sal-gema bem
no meio do deserto. Detone a bomba. O sal alcançará temperaturas
extremamente altas e derreterá. Agora você tem um enorme volume de sal
derretido, que é um excelente meio para reter calor. Em teoria, você usa o calor
para produzir vapor, mover turbinas e fazer sua torradeira funcionar.
Assim como em ocasiões anteriores do que veio a ser chamado de Projeto
Plowshare [Projeto Arado], essa explosão produziu uma onda de choque
impressionante e sacudiu a poeira do solo do deserto. Em seguida, as coisas
ficaram estranhas. Quando bombas nucleares estão explodindo, você não quer que
as coisas fiquem estranhas.
Enquanto cientistas, repórteres, membros das Forças Armadas e funcionários
do governo observavam, um vapor branco começou a subir no local da explosão.
Uma nuvem mortífera pairava no vento enquanto todos os visitantes reunidos
receberam ordens para entrar em seus carros e sair de cena.
O que deu errado? A explosão foi mais forte do que os cientistas esperavam e o
gás resultante conseguiu romper a superfície. Qual era o nível de radiação do gás?
Não sabemos. Por quê?
Esquilos.
Não, isso não é erro de digitação.
ESQUILOS.
Mais uma vez.
ESQUILOS.
Sim, alguns simpáticos roedores escavadores (cujo destino final talvez dê para
imaginar) mastigaram cabos elétricos no local da explosão da bomba, desligando
alguns detectores de radiação.
Até onde seus autores sabem, esse é o único acidente nuclear relacionado a
esquilos de que se tem notícia. No entanto, ele mostra por que o Projeto
Plowshare nunca decolou. Teoricamente, era uma ideia bonita: explosões grandes
e baratas poderiam ter todo tipo de uso — criar portos, cavar um novo canal do
Panamá e gerar novos elementos.
Se isso parece louco, é por dois motivos: 1) porque é louco mesmo e 2) porque
essa era a época do otimismo nuclear! Walt Disney lançou “Nosso amigo, o
átomo”, em que Sininho faz o símbolo do átomo com a varinha mágica. A Ford
lançou o Nucleon — um projeto de carro-conceito para um futuro veículo
nuclear.40 As pessoas ainda não sabiam como a radiação atmosférica era perigosa.
Pensamentos como esses levaram ao que veio a ser chamado de Projeto
Plowshare. Entre 1961 e 1973, os Estados Unidos realizaram 35 detonações
nucleares individuais como parte de 27 testes do programa. Cada explosão teve
vários objetivos de pesquisa, desde examinar produtos da reação até simplesmente
ver o tamanho do estrondo que dava para fazer.
Acontece que podemos causar um estrondo e tanto. Várias crateras do projeto
podem ser visitadas até hoje. Porém, o maior legado deixado por essas explosões
foi o ressentimento dos habitantes da área, muitos deles indígenas americanos,
que receberam um tratamento insensível. Em diversas ocasiões, os cientistas e os
burocratas responsáveis pelo Projeto Plowshare ignoraram as preocupações locais,
subestimaram os danos que causariam e superestimaram sua capacidade de fazer
uma explosão nuclear barata.
A única bonança após essa tempestade nuclear foi que ela acelerou o
desenvolvimento do movimento ambientalista moderno. Uma das estranhezas
desse projeto foi que ele contratou diversas vezes cientistas ambientais para
determinar se a explosão causaria problemas. Esses cientistas verificaram que, de
fato, os ecossistemas e as pessoas que viviam neles não gostavam de doses
gigantes de radiação. Nesse momento, invariavelmente, os responsáveis pelo
Plowshare os ignoraram. Esse ressentimento entre profissionais inteligentes se
fundiu com o ressentimento nas comunidades atingidas e fomentou alguns dos
primeiros protestos ambientais modernos.
Como tantos projetos nucleares, mesmo na contemporaneidade, a história do
Plowshare é uma história do desenvolvimento de uma tecnologia com potencial
que regrediu porque um grupo de pessoas inteligentes agiu como idiotas. O nível
de insensibilidade foi impressionante. De acordo com uma história, um cientista
importante, dr. Edward Teller, sugeriu certa vez (como piada, mas mesmo assim)
usar uma sequência de explosões nucleares para criar um porto no formato de um
urso polar no Alasca. Houve, de fato, uma proposta séria de bombardear um
porto no Alasca, ainda que não fosse particularmente um desejo do povo local,
em razão dos riscos e do fato de que o porto ficava congelado durante a maior
parte do ano.
Embora não estejamos recomendando bombas atômicas a nenhum projeto de
construção, os resultados posteriores foram, de certa forma, tentadores. Antes do
teste final, em 1973, a tecnologia funcionou relativamente bem. Por exemplo,
uma das partes posteriores da operação, chamada Projeto Rulison, foi um teste
para ver se uma bomba de fusão podia liberar gás natural. Adivinhe o que
aconteceu? Se tiver uma bomba com o dobro da potência da usada em Nagasaki,
você pode ter acesso a muito gás natural. O nível de radiação local depois foi
surpreendentemente baixo — apenas 1% maior do que antes. Foi um resultado
com potencial imenso. E na época havia esperança de que seria possível fabricar
bombas com fins pacíficos relativamente “limpas”. As bombas de hidrogênio
usam reações de fissão e fusão, mas a grande maioria dos subprodutos
repugnantes provém da parte da fissão. Um dos maiores objetivos do Plowshare
era encontrar maneiras de mitigar esses subprodutos.
Apesar de alguns resultados promissores, o Plowshare foi engavetado em 1975.
Os cientistas e engenheiros haviam feito muito progresso, mas houve obstáculos
demais no caminho deles. O incipiente movimento ambiental se opôs a eles e,
considerando a burocracia exigida para levar uma arma nuclear a um local de
teste, as bombas atômicas não representavam muita economia — se é que houve
alguma — em relação às bombas convencionais. De qualquer modo, elas
acabaram não tendo muita utilidade. Sua maior contribuição foi a liberação de
gás natural, mas as empresas não estavam muito dispostas a tentar comercializar
um gás que era apenas um tiquinho mais radioativo do que a média.
Além do mais, numa das viradas mais irônicas de toda a história, foi a invenção
do fraturamento hidráulico (fracking) no meio do século que solapou a ideia de
usar energia atômica para liberar gás natural. Diga isso a seu amigo ambientalista
se você quiser dar um nó na cabeça dele. Para aumentar a ironia, a cada vez mais
cara Guerra do Vietnã inviabilizou um pouco o financiamento de testes nucleares
para diversão e lucro. Portanto, sim, pode ser que você tenha sido poupado de um
mundo mais radioativo graças ao... fraturamento hidráulico e ao Vietnã.
Ao longo dos anos 1950, 1960 e 1970, o perigo representado pela radiação se
tornou cada vez mais bem compreendido, e as pessoas ficaram mais preocupadas
não apenas com a quantidade de radiação, mas também com o tipo. Uma das
descobertas mais significativas foi o perigo de um importante subproduto de
explosões nucleares: o estrôncio-90 (Sr-90). Você pode pensar no Sr-90 como
um tipo de cálcio, só que emitindo radiação. Como é absorvido pelos ossos da
mesma forma que o cálcio, o Sr-90 é uma fonte de radiação especialmente
perigosa. Durante os anos de teste nucleares frequentes, houve uma sinistra
descoberta de que o Sr-90 foi encontrado em dentes de leite.
Sim, dentes de leite. Os drs. Louise e Eric Reiss fizeram uma pesquisa
brilhante em que, ao longo de doze anos, coletaram mais de 320 mil dentes de
leite de crianças em idade escolar. Como os dentes são, em sua maior parte, feitos
de cálcio, examiná-los é uma forma bem fácil de verificar a quantidade de
estrôncio que estamos absorvendo em nosso corpo. Eles constataram que, mais
ou menos no auge dos testes nucleares, em 1963, quando o nível de estrôncio
atmosférico estava bem alto, as crianças tinham cinquenta vezes mais estrôncio
do que o normal em seus dentes.
Essa descoberta motivou em parte o Tratado de Interdição Parcial de Testes
(LTBT) entre os Estados Unidos e a União Soviética. Esse acordo talvez tenha
representado o maior obstáculo ao Projeto Plowshare, porque uma de suas regras
era que você podia detonar bombas em seu país, mas os efeitos da bomba não
podiam sair das suas fronteiras. Não parece muito restritivo, mas na prática pode
ser. Se eu lançar um fogo de artifício, parte do monóxido de carbono resultante
acabará se espalhando sobre a Rússia. O mesmo se dá com a poeira radioativa.
Embora nem os Estados Unidos nem a União Soviética o tenham levado tão a
sério quanto deveriam, o tratado acrescentou complexidade burocrática à já
(razoavelmente) complexa tarefa de desenvolver uma bomba nuclear para ver se
você consegue construir um porto.
Por exemplo, o acordo estipulou que era proibido detonar bombas embaixo
d’água. Posteriormente, o pessoal do Plowshare quis detonar uma bomba sob o
solo oceânico. Isso acirrou um verdadeiro debate sobre se “embaixo d’água”
significa “embaixo da água”. É essa a vida glamorosa dos diplomatas estrangeiros.
Quando as relações soviético-americanas melhoraram e ficou claro que as
bombas de hidrogênio não representavam uma grande economia, os americanos
concluíram que seria melhor deixar as armas atômicas engavetadas para serem
usadas em caso de apocalipse. Assim terminou o Projeto Plowshare.
Caso você esteja se perguntando, a União Soviética teve um programa
semelhante, chamado Explosões Nucleares para a Economia Nacional, que durou
até a dissolução do país. Se pesquisar no Google “Lago Chagan”, você vai
encontrar um lago estranhamente circular no Cazaquistão, que antigamente era
uma república soviética. Talvez você também consiga achar um vídeo que mostra
o instante de sua criação. E, o que é assustador, existem algumas fotos de
propaganda de um cara nadando no lago logo depois de este ser enchido por um
reservatório próximo. Nossa esperança é a de que ele tivesse um bom plano de
saúde.

27. O lítio, terceiro elemento na tabela periódica, é dividido para criar trítio em ambiente de laboratório.
28. É.
29. Está bem, espere aí: imagine que Joss Whedon acabou de aparecer no meio da Comic-Con sem nada
para se defender além de uma caixa de spoilers do próximo Star Wars.
30. Fissão é quando um átomo se divide. Quanto átomos grandes, como os de urânio e plutônio, se dividem,
há liberação de energia. No ambiente certo, a divisão de um átomo desses pode levar vários outros a se
dividir, e essas divisões causam ainda mais divisões e assim por diante. Essa reação em cadeia pode ser usada
para gerar energia ou para criar bombas.
31. Veja a nota bene deste capítulo.
32. Pode-se dizer que o imenso gasto também exclui isso. E você provavelmente chegaria à conclusão de que
é melhor haver um monte de burocracia e papelada entre uma empresa de energia e uma ogiva nuclear.
33. O dr. Alex Wellerstein, sobre o qual falaremos mais adiante neste capítulo, sugeriu “cuspir o bebê” como
metáfora para o nêutron. É claro que isso é ridículo.
34. É preciso atingir o combustível de fusão por vários lados, todos de uma vez, para fazer a fusão acontecer.
Então por que usar um laser gigante dividido 192 vezes em vez de 192 pequenos feixes independentes? O
motivo é o timing. É muito mais fácil sincronizar 192 raios do que disparar 192 raios todos de uma vez.
35. O número real é discutível. A NIF define a “energia dentro” como a quantidade de energia que vai
diretamente para dentro do cilindro de ouro, e não como a quantidade de energia necessária para fazer o
disparo. Por esse padrão, eles estão mais próximos de 1/1.000 de ignição.
36. Na verdade, vimos muitas projeções diferentes, algumas chegando a 50 bilhões de dólares.
37. O que significa que ele estuda energia nuclear, e não que ele tem poderes nucleares.
38. Isso não inclui o financiamento americano a colaborações internacionais. O governo dos Estados Unidos
também contribui para o ITER, mas, como você poderia imaginar, alguns políticos americanos não ficam
animados de enviar dinheiro para um projeto científico de orçamento estourado que está sendo construído
na França. Os Estados Unidos continuam fazendo contribuições anuais da ordem de 100 milhões a 200
milhões de dólares, mas deputados já ameaçaram várias vezes suspendê-las, já que o custo tem aumentado.
Até cientistas americanos estão um pouco preocupados com as grandes contribuições ao ITER, porque o
grande gasto externo está impedindo o financiamento de instalações internas.
39. Isso não é garantido. Na verdade, o Greenpeace é conhecido por se opor ao ITER, embora não pelo
motivo que você poderia pensar. Eles acham que deveríamos estar gastando o dinheiro em energias
renováveis modernas, como a solar e a eólica.
40. Imagine viajar por uma estrada durante vinte anos sem reabastecer!
5.

Matéria programável
E se todas as suas coisas pudessem ser qualquer uma de suas
coisas?

Pergunta: por que você usa muito mais o seu computador do que a sua bicicleta?
Resposta: porque você é bizarramente introvertido.
Está bem, mas a outra questão é que a bicicleta meio que só faz uma coisa: anda
para a frente quando você pedala. Já o computador faz muitas coisas e (ainda
mais importante) é capaz de fazer infinitas coisas. Isso porque o computador já é
uma “matéria programável”. Ele pode executar qualquer programa, exibir
qualquer imagem, fazer qualquer som, conectar-se a qualquer dispositivo (bem, se
você conseguir encontrar o cabo e se o Windows não o corrompeu). E esses
programas, sons, imagens etc. não estão permanentemente inseridos no
computador, como numa fotografia, numa gravação ou no mecanismo físico de
um motor a vapor.
É por isso que uma pessoa de 1900 acharia familiar a maioria das coisas que
você tem. Sua vassoura é de plástico, mas se comporta da mesma maneira que a
dela, feita de madeira. Sua máquina de lavar é uma engenhoca inteligente, mas
nada ali é difícil de entender. Seu computador? É aíííí que ela chega à conclusão
de que você é um bruxo.
E se pudéssemos fazer todas as suas coisas serem como o computador? Ou,
pelo menos, por que, nessa era de computação poderosa e materiais sintéticos
avançados, não podemos fazer com que muitas de suas coisas se adaptem aos seus
desejos? Por que os materiais de uma construção não podem responder
automaticamente a mudanças meteorológicas? Por que você não pode mandar
quatro cadeiras se remodelarem e virarem uma mesa? E, pelo amor de Deus, por
que nós mesmos temos que dobrar origamis em vez de só gritar com o papel até
que ele assuma a forma de uma garça? Essas coisas talvez não estejam tão
distantes quanto parecem.
O dr. Erik Demaine, do MIT, explica seu entusiasmo com a matéria
programável: “Para mim, o mais empolgante na matéria programável é a ideia de
fazer aparelhos que podem ter muitas funções. Consigo imaginar minha bicicleta
se transformando numa cadeira quando eu quiser me sentar e não pedalar.
Depois ela se torna meu laptop. Ou meu celular se desdobra e vira um laptop.
Vivemos num mundo computacional em que os softwares são reprogramáveis.
Matéria programável significa fazer a mesma coisa com equipamentos. Se você
quiser adquirir o celular mais moderno, tem que sair e comprar a coisa física. No
futuro, podemos imaginar que uma coisa que já temos pode se reajustar e se
tornar um modelo novo. Esse é o sonho.”
Cientistas, engenheiros e artistas do mundo inteiro estão tentando viabilizar
alguma versão disso. Alguns querem programar a matéria no sentido de projetá-
la para responder às condições ao redor. Outros querem robôs construídos para
tudo o que fazemos. Em seus sonhos mais ambiciosos, esses criadores imaginam
massas de matéria que podem se metamorfosear em praticamente qualquer
formato. Como os computadores e sistemas eletromecânicos estão cada vez
menores e mais eficientes, pode ser que chegue o dia em que você mergulhará a
mão num tanque de líquido cintilante e retirará dali qualquer dispositivo, de uma
chave inglesa ou um celular até um robô de estimação.
Por que queremos isso? Bem, há motivos práticos (aos quais chegaremos), mas
em algum nível suspeitamos de que os seres humanos simplesmente adoram
coisas que viram outras. Pense, por exemplo, na série Transformers. É sobre
formas de vida de planetas distantes com mentes sobre-humanas e biologia
alienígena, travando uma guerra perto do planeta Terra. E por que isso nos
estimula? Porque, além de tudo isso, elas podem se transformar em carros
realmente maneiros.

Em que pé estamos agora?


O conceito de matéria programável está relacionado a dotar objetos físicos de
informações. Elas podem ser bits e bytes literais num computador ou podem ser
“conhecimento” inserido na estrutura de um objeto por meio de seu formato e do
material que o compõe. Isso torna o campo da matéria programável bastante
diverso.
Vamos começar falando sobre materiais “programados”, no sentido de eles
assumirem comportamentos específicos complexos de acordo com a forma como
são construídos. Por exemplo, a exposição à água pode levar um desses materiais
programados a se curvar de maneira predeterminada, mesmo sem ter sensores
embutidos ou capacidade computacional. Em seguida, falaremos sobre robôs de
origami e casas reconfiguráveis, antes de passarmos para tentativas mais exóticas
de criar robôs universais — basicamente o T-1000, de O Exterminador do Futuro,
só que em condições ideais ele não está tentando matar todo mundo.

Materiais programados

O professor Skylar Tibbits, do MIT, é o cara dos materiais programados, e eis


como ele visualiza o campo: “A ideia, do meu ponto de vista, é que você quer
programar a matéria, programar entidades físicas para que elas se transformem a
fim de mudarem de formato, de propriedade, para se conjugarem sem
intervenção do homem ou da máquina... Deseja-se, de algum modo, permitir que
materiais se transformem, e com frequência isso é desencadeado por algo no
ambiente — temperatura, umidade, eletroatividade ou algum outro gatilho.” O
professor Tibbits se refere a essa qualidade da matéria programável como
“impressão em 4D”, porque imprimimos em 3D um objeto que muda ao longo
do tempo, dependendo do seu material e do ambiente.
Existe, por exemplo, o canudo reconfigurável. Ele funciona da seguinte forma:
você faz uma impressão em 3D de um canudo com articulações especialmente
projetadas para se curvar quando entrarem em contato com a água. Ao selecionar
como cada articulação se curvará, em princípio você pode fazer praticamente
qualquer formato. O professor Tibbits fez um canudo que se molda com a forma
das letras “MIT” quando posto na água.
Outro bom projeto que responde ao ambiente é o HygroScope, criado pelos
drs. Achim Menges e Steffen Reichert, da Universidade de Stuttgart. O
HygroScope é feito de pedaços finos de madeira que se curvam segundo o
programado em resposta à umidade. Tem centenas de pequenos poros que se
abrem e se fecham conforme a madeira se curva de acordo com as condições do
ambiente. No conjunto, a estrutura é espantosa, parecendo uma enorme peça de
biologia alienígena, apesar de não ter motores nem computadores internos.
O professor Tibbits vê dois grandes obstáculos para a adoção desse tipo de
material programável: primeiro, o software é projetado para funcionar tanto com
estruturas estáticas quanto com estruturas mecânicas robóticas. Ele quer um
software que projete “materiais que se transformem, sejam instáveis, se curvem, se
enrolem e entortem com base em diferentes energias de ativação”.
O segundo problema é encontrar maneiras de fazer as pessoas quererem de
fato comprar esse negócio. Não havíamos pensado muito a respeito, mas até que
gostamos de que todos os objetos do banheiro sejam “estáticos”. Mas o professor
Tibbits acredita que há formas de fazer com que materiais inteligentes possam
ser acrescentados de modo elegante ao nosso dia a dia. Por exemplo, ele estava
trabalhando em canos que podem se comprimir ou expandir em função da
quantidade de água que está passando por eles no momento, para ajudar a
controlar o fluxo e responder à demanda. Atualmente, ele está colaborando com
empresas nos ramos de roupas esportivas, dispositivos médicos, embalagens e
aeroespacial para levar materiais programados a mais aspectos de nossa vida.

Robôs de origami

Parte do que torna os tradicionais origamis bem divertidos41 é que podemos


fazer estruturas complexas a partir de um pequeno conjunto de regras. Uma bela
garça de papel é a culminância de um monte de dobraduras simples numa única
folha de papel. Em mãos habilidosas, essa única folha de papel pode assumir
milhares de formatos. Em outras palavras, pode ser programada.
Então por que nós mesmos temos que fazer todas essas dobraduras, como uns
idiotas? Por que não um robô de papel que se dobra sozinho?
Os robôs de origami são um bom ponto de partida para a matéria programável,
já que é relativamente fácil manipular papel e é possível construir estruturas
complexas a partir de regras fáceis de dobradura.
Há várias maneiras de fazer robôs de origami, mas o princípio básico é simples:
você tem um material plano que permite certo número de dobraduras. Ao longo
dessas dobraduras existem atuadores — uma palavra sofisticada que designa a
parte de uma máquina que pode mexer — que fazem a dobradura dobrar. O
“papel” contém o circuito para falar com um computador, portanto é só
programar o robô para se curvar pelas dobraduras certas nos momentos certos.
Por ser capaz de continuar a dobrar mesmo depois de alcançar a forma desejada,
a máquina pode fazer coisas que origamis comuns não conseguem, como
caminhar ou pegar coisas.
A dra. Daniela Rus, do MIT, está interessada em criar o menor robô de
origami possível e conseguiu construir um do tamanho da ponta de um dedo. É
um robô de origami muito simples, mas a simplicidade tem algumas virtudes.
Quando ativado, o robô — que parece um pequeno e inocente quadrado de
lâmina de ouro com um ímã embutido — dobra subitamente e vira uma espécie
de inseto eletrônico. Aplicando um campo magnético ao ímã do robô, ela pode
fazê-lo andar, nadar e carregar coisas. Atualmente, ele é operado por controle
remoto, mas ela espera fazer uma versão autônoma.
Mais recentemente, ela produziu uma versão avançada feita de — atenção —
intestino de porco. Está bem, então, para os padrões do MIT, intestino de porco
eletrificado não é uma coisa tão estranha assim, mas essa é uma tira de intestino
muito especial.42
Entenda, um dos objetivos da dra. Rus é transformar a medicina criando robôs
minúsculos. O robô de intestino é pequeno o suficiente para ser inserido em um
pedaço de gelo do tamanho de uma pílula e engolido. O gelo abre caminho em
suas tripas, onde acaba derretendo e liberando sua pequenina carga robótica.
A equipe da dra. Rus criou um modelo de um intestino no qual enfiou uma
bateria. Isso não é porque os engenheiros do MIT têm um senso de anatomia
humana questionável — na verdade, é algo que às vezes acontece com crianças e
pessoas que apreciam o gosto agradavelmente adstringente de uma bateria
Duracell DL2032.
De todo modo, o gelo dissolve no intestino, deixando um pequeno robô feito
de revestimento de linguiça e com um ímã minúsculo. O robô dobra e assume
uma forma capaz de “nadar” nos intestinos. Ele se prende à deliciosa bateria e
nada com força suficiente para deslocá-la. A partir daí, ele abre caminho para
fora do seu corpo. Espera-se que o robô nunca adquira inteligência o bastante
para pensar na vida que tem de maneira objetiva. Mas, mesmo que faça isso,
estaremos a salvo — lembre-se, o robô é, em sua maior parte, revestimento de
linguiça, então ele se dissolve naturalmente.
Se for possível construir robôs ainda menores, eles poderão ter aplicações
médicas mais complexas. A dra. Rus imagina o dia em que robôs de origami
serão capazes de mudar de forma e se tornar ferramentas para realizar
procedimentos ou levar remédios a locais específicos do corpo. Por permitir que
estruturas complexas surjam por meios tão simples, o origami talvez represente o
melhor caminho para a fabricação de pequeninos robôs médicos.
Os robôs de origami também podem ser úteis em formatos maiores. Se as
dobraduras puderem se manter bem no lugar, poderíamos ter uma folha plana
que se transforma em cadeira, mesa, vaso ou seja lá o que for. Imagine também
como as crianças ficarão impressionadas quando as pontas do seu lenço de bolso
de repente se erguerem.
A maioria dos projetos de robô de origami é simples, e muitos deles só podem
ser configurados uma vez. Até os desenvolvimentos mais recentes, como os
projetos da dra. Rus, têm algumas limitações básicas.
O dr. Demaine estuda a matemática por trás do origami43 e trabalha em robôs
de origami. Ele nos diz: “No modelo matemático do origami, imaginamos um
papel de espessura zero, e não há problema ter muitas camadas empilhadas uma
em cima da outra. Mas com material de verdade, sobretudo material com
atuadores, componentes eletrônicos e assim por diante, as coisas são muito mais
espessas do que papel e, portanto, ficamos um tanto limitados perante a
dificuldade do modelo que fizermos, porque, pelo menos da melhor maneira
como sabemos fazer isso agora, é necessário ter muitas camadas.”
Ele e seus colaboradores também estão explorando o origami não tradicional,
em que você pode fazer cortes no papel. A matemática para isso é muito mais
difícil, mas parece tolice restringir-se a folhas de papel sólidas quando cortes
podem facilitar as coisas.
A capacidade de criar um objeto que cabe bem num envelope mas que pode se
levantar e caminhar pela sala tem aplicações que vão desde as Forças Armadas e
segurança nacional até uma carta de término de namoro que faz um gesto
obsceno para o destinatário. E os cientistas do MIT estão trabalhando para
tornar esses robôs dobráveis acessíveis a todos.
A dra. Cynthia Sung (ex-estudante de PhD no laboratório da dra. Rus e agora
na Universidade da Pensilvânia) criou um software que permite ao usuário criar
robôs, imprimi-los (por exemplo, usando uma impressora 3D) e construí-los.
“Com o Interactive Robogami, o que temos feito é basicamente criar um
conjunto de Lego virtual ao qual as pessoas têm acesso como elas têm aos kits
existentes, mas você também pode mudar a geometria deles, o formato deles, e há
certo conjunto de parâmetros que as pessoas podem customizar para obter mais
controle sobre como será a aparência do seu produto. Com isso, também
fornecemos algumas técnicas de simulação para que as pessoas possam verificar
durante a criação se o projeto realmente fará o que elas querem que faça.
Atualmente, estamos focando em locomoção no chão. É possível simular seu
projeto de robô e ter certeza de que ele andará para a frente com estabilidade.”
O objetivo final da dra. Sung é que as pessoas tenham acesso a uma robótica
de custo baixíssimo. Basta abrir o software Interactive Robogami, criar um robô,
imprimi-lo numa impressora 3D, prender os motores certos e bum — o exército
de máquinas ganha mais um soldado.

Casas reconfiguráveis

Usar o espaço com eficiência já é um problema em cidades caras com alta


densidade populacional. Uma ideia é ter cômodos individuais que podem fazer
muitas coisas. Se pararmos para pensar, um cômodo nada mais é que uma caixa
que mantém a natureza fora e a internet dentro. Designamos diferentes cômodos
de acordo com seus usos específicos, mas em princípio você pode morar num
único cômodo capaz de mudar de acordo com suas necessidades no momento.
Uma prova de conceito para esse tipo de coisa é o Animated Work
Environment [Ambiente de Trabalho Animado]. Ele consiste de duas partes.
Primeiro, uma mesa feita de três peças projetadas de modo que possam ser
reconfiguradas. Segundo, de uma das mesas sai uma série de seis painéis de
alumínio que se enrolam e se desenrolam, como uma cauda de escorpião. Os
painéis têm tudo o que você pode querer num escritório — telas, quadros
brancos, luz, som. Eles também têm sensores para detectar fatores ambientais.
Com essa estrutura simples, é possível ter uma infinidade de configurações. A
cauda de escorpião pode dividir o escritório em seções. Ou se elevar bastante e
exibir um grande monitor para um grupo. Ou, você sabe, sentar à sua frente
enquanto você está fazendo o seu trabalho. Em princípio, poderia também tentar
detectar o que você quer. Se estiver ficando tarde em determinado dia, talvez a
cauda possa se erguer acima de sua cabeça e diminuir as luzes um pouco para
você relaxar. Ou, se vários usuários quiserem privacidade mas precisarem
trabalhar perto uns dos outros, a cauda pode assumir o formato de um grande U
de cabeça para baixo, de modo que uma pessoa use a parte interna e outra a parte
externa. Ou, se houver um ataque de formigas gigantes, você adiciona um ferrão à
ponta da “cauda” e parte para a batalha.

Os criadores preveem uma versão mais avançada em que a cauda serpenteia


por todo o cômodo, formando o teto e o chão. Assim, você também pode gerar o
desenho do piso do escritório ou criar cômodos improvisados. E talvez você fique
mais animado para calcular a restituição de imposto de renda de um cliente se
estiver no topo de um imenso robô-cobra.
Isso ainda está na fase de projeto de arte, e provavelmente não chegará tão
cedo ao seu espaço de trabalho, mas a ideia geral de um espaço que se configura
de acordo com as condições tem muito potencial, principalmente em lugares
onde o espaço é precioso.
O LIT ROOM [quarto iluminado] é um conceito parecido. Trata-se de um
cômodo cujas paredes se movem, tanto no sentido de mudar de lugar quanto no
de se curvarem para ficar convexas ou côncavas. O aposento tem um projetor que
lança imagens nas paredes e pequenas caixas de som criam barulhos no fundo.
Mas a parte realmente engenhosa é que ele interage com os usuários. O público-
alvo são crianças que estão ouvindo uma história lida em voz alta. Quando o
leitor chegar a determinados pontos, o ambiente se ajusta, talvez simulando o
topo de uma montanha ou uma tempestade. Imagine! Alguém lê Oliver Twist e
você pode realmente sentir o cheiro da pobreza massacrante!
Em sua maior parte, isso é apenas para impressionar, mas os criadores esperam
que possa ser usado para melhorar o aprendizado e a alfabetização de crianças.
No entanto, considerando o uso que nós fazíamos do poder computacional
quando éramos crianças, não está claro se eles terão êxito nisso.
Mas espere aí, será que não podemos ter isso para adultos? Uma ideia é criar
cômodos como o LIT ROOM simplesmente para proporcionar uma mudança
no ambiente. Dessa forma, quando você estiver dando um intervalo no trabalho,
seu cubículo muda por algum tempo e lhe dá a impressão de estar numa ilha
paradisíaca.
O projeto de habitação favorito do Zach é, de longe, uma exposição chamada
Reconfigurable House, de Haque Design + Research (agora Umbrellium). Não é
bem uma casa, mas uma grande estrutura de metal com seções que respondem a
seu comportamento e a mudanças no software. Em parte, a intenção é zombar
das “casas inteligentes” levando a customização a extremos, mas eles também
exploram o modo como a interação entre um cômodo e seu software pode levar a
coisas mágicas. De qualquer modo, o legal era que parte da exposição tinha
“tijolos de gato”: tijolos de plástico transparente com gatos de brinquedo
embutidos, que podiam acender e miar. Eram controlados por um simples
computador de modo a responder ao comportamento humano. Por exemplo,
talvez em função de um pensamento da Kelly — “Estou vivendo um pesadelo
que eu não sabia que tinha” —, eles pudessem ronronar de maneira agradável.
Nós realmente achamos esse tipo de coisa bem interessante — a ideia de uma
casa que de certa maneira está viva é fascinante, apesar do temor de robôs
assassinos. Os tijolos de gato não seriam nossa primeira (nem segunda, terceira
ou quadringentésima) escolha, mas esse conceito geral não precisa ser estranho. Já
estamos acostumados à noção de que o Google sabe o que queremos pesquisar,
de que o Facebook sugere nossas lembranças favoritas e de que a Amazon nos dá
melhores ideias para presentes do que conseguimos pensar sozinhos. Ter uma
casa que responde pessoalmente a você, reconfigurando-se automaticamente ou
ajustando a cor, o som e a temperatura — uma casa que é aconchegante quando
você estiver triste, ou silenciosa quando você quiser dormir —, é algo que
poderíamos aceitar.

Robôs trabalhando juntos

ROBÔS MODULARES
Se sua casa pode se reconfigurar, por que não suas coisas? Um livro que
lemos44 propõe um cômodo “onde ‘móveis ganham vida’”. Considerando quanto
abusamos do nosso sofá, achamos esse desejo meio questionável. Por outro lado,
se uma mesa com cookies pudesse se aproximar de nós enquanto nos mantemos
inertes e entorpecidos, poderíamos nos dispor a retificar nossos pensamentos.
Uma versão realmente legal disso veio da École Polytechnique Fédérale de
Lausanne (EPFL) e se chama Roombots. Eles são claramente projetados para
tornar as coisas reconfiguráveis no seu aposento.
Os Roombots são basicamente pequenos cubos arredondados que podem
rodar e se atracar uns nos outros. A habilidade de rodar faz com que possam se
mover (seja se revolvendo ou se conectando entre si para formar uma roda
simples). E, uma vez que se atracam, os Roombots podem fazer montagens
grandes e complexas.
O mecanismo de atracação utiliza garras de plástico que se prendem a
atracadouros especialmente projetados. Isso abre a possibilidade de haver paredes
que eles podem subir agarrando-se à superfície de maneira sequenciada. Portanto,
você poderia fazê-los segurar algumas lâmpadas (especialmente projetadas),
andar até o teto e se transformar num candelabro que seguiria você pela casa. Ou,
se não quiser todas as suas coisas feitas de robôs, poderia pegar algumas tábuas de
madeira antigas e entalhar áreas de atracação nelas. Os Roombots poderiam ir até
a madeira, agarrá-la, transformá-la num banco e trazê-lo até você. Mais tarde,
poderiam usar a peça como encosto de cadeira, ou como um púlpito para se
manifestarem contra seu repugnante soberano humano. Ah, você tentará dizer
aos amigos que “foi a cadeira que fez isso!”. Mas quem vai acreditar depois
daquela vez que você pensou ter visto uma mensagem no seu macarrão?
Há muitas utilizações possíveis para blocos móveis e com autoconfiguração,
mas esses pesquisadores estão mais interessados em ajudar idosos e enfermos.
Um uso simples de Roombots é criar móveis que se movimentem e ajustem a
altura e o formato para o usuário.
Esses enxames modulares também são um passo em direção à matéria
universalmente programável. Uma forma de utilizá-los é produzir enxames de
robôs mais autônomos — capazes de cumprir ordens mais gerais. Portanto, em
vez de programar um design e um local específicos, você programaria um
objetivo, que o grupo de módulos executaria por conta própria. O que poderia dar
errado?
Um projeto chamado SWARMORPH45 conta com pequenos robôs munidos
de rodas e atracadouros em suas extremidades circulares. Esses engates permitem
que se conectem lado a lado, mas eles ainda não conseguem subir um no outro.
Em certo sentido, é um projeto mais simples que os Roombots, que podem se
mover em três dimensões. Mas o que torna os robôs SWARMORPH especiais é
que eles podem se movimentar e se organizar da mesma forma que os enxames
de insetos. Não há um controlador central; cada robô é um ator independente.
Sinalizando entre si com pequenas luzes, eles podem coordenar as ações que
desempenham.
Num teste simples, os robôs SWARMORPH foram capazes de atravessar
pontes e obstáculos que nenhum deles conseguiria transpor de maneira
independente. Eis um exemplo de um obstáculo que eles superariam juntos: os
robôs estão numa arena e são solicitados a ir de um lado ao outro. No entanto, há
um abismo no meio. Os robôs ficam se remexendo pela área até um deles
perceber que precisa passar por cima do precipício mas não pode. Ele então se
torna o “robô semente”, no sentido de semear uma mudança na organização. Ele
diz — por meio de luzes em seu chassi — “VENHAM AQUI E
ATRAQUEM!”. Os outros se aproximam do robô semente e veem que apenas
um engate do robô semente está disponível. O primeiro robô a se prender se
torna o novo atracadouro aberto.

Em pouco tempo, temos uma fila indiana de robôs. Nesse formato, os módulos
podem se inclinar até o outro lado do abismo e atravessá-lo. Depois de cruzarem
o obstáculo sem qualquer interferência de um supervisor humano, eles se separam
e prosseguem até o fim da jornada.
Os robôs podem cumprir várias tarefas de maneiras semelhantes, como
conectar-se para percorrer um par de trilhos estreitos. Mas até agora só
concluíram testes controlados em laboratório.
Um outro grupo, chamado SYMBRION, está trabalhando num projeto
parecido que pode funcionar em três dimensões. Cada robô é uma espécie de
cubo com rodas em suas faces. As faces também têm um mecanismo de engate
com uma articulação. Portanto, os robôs podem fazer coisas da mesma forma que
os SWARMORPH, mas com uma amplitude de movimento um pouco maior.
Vídeos do projeto mostram os robôs SYMBRION se juntando e formando
quadrúpedes e serpentes móveis, o que lhes permite se movimentar de diferentes
maneiras para transpor obstáculos.
O SYMBRION terminou seu trabalho de criar quadrúpedes modulares
assustadores em 2013, mas outros engenheiros ainda estão tentando a extinção da
espécie humana a curto prazo.46 Um recente projeto chamado Kilobot (que,
observe, tem apenas uma letra a menos que KILLobot) consiste em 1.024 robôs
minúsculos.
Os Kilobots são bem simples e bem pequenos. Parecem baterias de relógio de
pulso com três perninhas duras e se movem balançando de um lado para o outro.
Assim como em outros enxames, é possível lhes delegar uma tarefa e eles podem
resolver como cumpri-la da maneira exata. Pressagiando um estranho futuro em
que, talvez, robôs minúsculos assumirão a forma de qualquer ferramenta que você
quiser, os Kilobots executaram um algoritmo simples que os reconfigurou,
levando-os a assumir o formato de uma chave inglesa.
Está bem, leva umas seis horas para os milhares de robôs encontrarem o
caminho para o formato certo. E pareceu mais com uma banda marcial de
robozinhos fazendo um formato de chave inglesa do que com alguma coisa
semelhante a uma ferramenta útil. Mas há um caminho muito promissor aqui:
quanto mais robôs houver, mais possibilidades se abrem e mais fácil se torna fazer
um enxame se comportar como uma grande entidade conectada.
A não ser que fosse para acabar com essa farsa perpétua conhecida como
civilização humana, por que você iria querer enxames de robôs autônomos? Em
primeiro lugar, por não haver um grande computador (ou um grande humano)
supervisionando tudo, a necessidade de poder de processamento do computador
diminui. Isso garante robôs mais baratos e talvez mais rápidos. Além disso, robôs
autônomos podem ser mais eficientes porque podem tomar decisões
circunstanciais rápidas. Isso é especialmente importante em ambientes hostis
(como o espaço ou uma área em que ocorreu um desastre), onde haverá situações
imprevistas. Se os robôs podem se comportar mais como formigas do que como
servos programados, basta lhes dar tarefas mais gerais, como “entregar essa
comida nesse local”, que eles podem cumprir com a própria criatividade.

CLAYTRÔNICA, CÁTOMOS E MOLECUBOS


David Duff, que na época fazia parte do renomado Palo Alto Research Center,
cunhou o termo “Bucket of Stuff ” [“Balde de Coisas”] para descrever uma
espécie de finalidade suprema para a matéria programável. A ideia é... espere aí, o
nome dele é David Duff e ele tem um Bucket of Stuff ?
Desculpe, espere um pouco, estamos modificando o título desta seção.

DR. DUFF E SEU BUCKET OF STUFF


Imagine um balde cheio de gosma. Você o amarra no cinto quando vai
consertar a pia. Quando precisar de uma chave Allen com 7/32 de uma polegada,
basta dizer ao seu Balde de Coisas. A chave sai do material e você a usa para fazer
ajustes. Quando precisar de um alicate, o alicate aparece. Quando precisar de um
desentupidor de pia, a gosma do balde assume o formato de um tubo longo e
duro com a ponta flexível em formato de taça.
Na verdade, pode ser ainda melhor. Em vez de “me passe a chave de fenda”,
você poderá dizer “afrouxe esse parafuso” e a gosma descobrirá a melhor maneira
de executar a função. Ou, em vez de enfiar o desentupidor no vaso sanitário, você
se vira para o Balde de Coisas e diz: “Faz aí o que tem que ser feito, parceiro.”
E você não convocaria apenas ferramentas simples. Talvez queira um
travesseiro para descansar. Ou quem sabe precise de uma calculadora. Que tal um
robô de estimação? Talvez tenha esquecido o Dia dos Namorados e instrua a
gosma a se transformar em flores.
Talvez você possa até configurar a gosma para fazer mais gosma!
Em outras palavras, o Balde de Coisas contém uma matéria verdadeiramente
universal, pelo menos até onde a física permite. Esse é o objetivo mais ambicioso
e provavelmente o mais distante da matéria programável. Existem dois motivos
para isso.
Primeiro, cada pedacinho da gosma precisa fazer muito, e miniaturizar todas
essas coisas é difícil. “É provável que você queira algum tipo de material forte
para a chave inglesa, mas depois, se quiser fazer um brinquedo flexível para seu
filho, vai esperar um material diferente. E como combinar esses materiais
diferentes?”, observa o professor Tibbits.
Outro problema é determinar o nível de inteligência dessas peças. O dr.
Demaine salienta: “Por um lado, se o negócio não for muito inteligente, fica
realmente difícil fazer com que ele faça coisas. E, se for inteligente, estamos
falando de cada pequena partícula ter uma bateria própria, e então, ui, isso parece
difícil.”47
Como exatamente incorporar energia a uma massa gigante de nanorrobôs é
um problema difícil por si só. A menos que você queira ter uma máquina externa
emitindo energia para cada robô de modo constante, é preciso arranjar uma
maneira de armazená-la em cada grão da matéria programável. Cientistas
criaram, há bem pouco tempo, baterias do tamanho de um grão de areia a partir
de uma impressora 3D projetada para isso. Isso continua sendo grande demais, e
imaginamos que não seja exatamente barato.
Uma equipe formada por John Romanishin (outro estudante de PhD do
laboratório da dra. Russ), pelo dr. Kyle Gilpin e pela dra. Rus deu um passo
animador rumo ao Balde de Coisas: os M-Blocks, cubos com aproximadamente
cinco centímetros de cada lado, equipados com uma roda volante interna e ímãs
ao longo das extremidades. Quando a roda volante está funcionando, os ímãs
mantêm os blocos atracados um ao outro. Mas quando a roda volante para
rapidamente, o bloco “salta para a vida”, já que o impulso da roda é transferido
para ele. O bloco pode, então, atracar em um novo M-Block para mudar a
configuração do grupo. Portanto, temos uma situação em que eles se movem com
liberdade e outra em que estão firmemente conectados. Não é um mau começo se
a intenção é ir de uma massa amorfa para um objeto sólido.
E o grupo é capaz de mover os blocos em três dimensões. A roda volante é
forte o suficiente para tirar os blocos da superfície da mesa e arremessá-los para o
alto, permitindo a criação de estruturas em 3D.
A meta é encontrar maneiras de fazer blocos cada vez menores. Blocos de
cinco centímetros de largura não conseguem fazer muitas coisas diferentes pelo
mesmo motivo que você não pode desenhar muitas imagens diferentes usando
um pequeno número de quadrados de 5 x 5 cm. Mas isso é um começo. Não
vamos esquecer que nos anos 1950 um gigabyte de memória pesava 250
toneladas e agora levamos no bolso um cartão SD que armazena centenas de
gigabytes. Se a matéria programável se tornar tão popular quanto os
computadores programáveis, podemos esperar milagres técnicos semelhantes.
Conseguindo as peças minúsculas, você precisa de uma maneira que as leve a
descobrir aonde têm que ir e o que têm que fazer. Isso é um problema de
software que a dra. Sung explicou da seguinte maneira: “Temos muitos
algoritmos ótimos que conseguem dar conta de grupos muito grandes de robôs.
A questão que importa agora é como torná-los mais práticos, porque quando
temos grandes enxames de robôs, é praticamente certo que alguns deles falharão,
porque haverá muitos. Muitos deles perderão a comunicação com o restante do
grupo. As entradas de sensores de muitos deles farão um imenso ruído, e não
sabemos realmente onde eles estão em meio aos outros robôs. Precisamos
garantir que os algoritmos que venhamos a desenvolver sejam resistentes a esses
problemas para que você tire do balde uma chave inglesa que de fato pareça uma
chave inglesa, e não uma chave inglesa se desintegrando.”
Então que tipo de solução encontramos para esse problema de software?

COORDENANDO O MOVIMENTO DE MUITOS ROBÔS


Seja com um enxame de robôs, seja com um Balde de Coisas, coordenar o
comportamento de muitas máquinas pequenas é um problema difícil. Não é
desejável que cada robô faça cálculos complexos, porque então cada unidade
precisará de mais equipamentos internos. O ideal é que eles obedeçam
coletivamente a conjuntos de regras simples a fim de executar ações complexas.
E eles precisam fazer isso com agilidade. Vale lembrar que os Kilobots
demoraram seis horas para ir de um formato aleatório para uma chave inglesa de
aparência razoável. Isso já é incrível, mas não traz nenhuma grande praticidade
para o Balde de Coisas. Imagine você tentando criar uma faca para se defender.
Mesmo que o assaltante fique impressionado, ele talvez não esteja disposto a
esperar seis horas para roubar sua carteira.
A coordenação se torna exponencialmente mais difícil à medida que mais
robôs são acrescentados. Se você pensar no enxame de robôs como a maior banda
marcial da história, fica claro por quê. Quando as bandas marciais vão de uma
formação para outra, eles não dizem para cada músico “pare no lugar certo”. Os
músicos passariam muito tempo se esquivando de outros músicos ou esbarrando
neles. É por isso que as bandas marciais não sabem os formatos que vão assumir
— e sim os movimentos eficientes para mudar de formação.
Quanto mais músicos na banda (ah, e digamos que eles possam se mover em
três dimensões, só para piorar), mais complexas as coisas ficam. Portanto,
coordenar mil pessoas será muito mais difícil que coordenar cem. E o Balde de
Coisas provavelmente terá muito mais de mil robozinhos trabalhando juntos.
Ainda assim sabemos que é possível coordenar atores individuais em grandes
grupos. Alguns cupins constroem cupinzeiros complexos, com cômodos
separados para diferentes propósitos. Eles fazem isso, embora talvez nenhum
cupim sozinho saiba como construir um cupinzeiro inteiro.
Mas descobrir como esses programas funcionam é complicado. Um conceito
que achamos especialmente intrigante foi o de deixar os robôs evoluírem. Na
evolução normal de organismos sexuados, é assim: uma criatura mamãe e uma
criatura papai se amam muito. Eles se juntam e fazem um monte de bebês. A
natureza cruel, com seus dentes e garras afiados, descarta os bebês inferiores. Os
sobreviventes se tornam os novos mamães e papais.
Os robôs não estão exatamente prontos para de fato se acasalar, mesmo que
você lhes dê um binário sexy que aumente essa disposição. Mas ainda assim eles
são capazes de produzir uma “prole”.48

Por exemplo, um grupo ensinou os Roombots a descobrir a própria maneira de


se movimentar. Temos, então, um bando de Roombots experimentando maneiras
semialeatórias de se mover. Alguns vão rápido, outros vão devagar, outros não vão
a lugar nenhum. Depois, “procriamos” os deslocamentos mais bem-sucedidos e
geramos movimentos relacionados que os robôs experimentam. Com certeza, a
nova “geração” será um pouco mais rápida, mas com muita variação. Repetimos
esse processo ao longo de muitas gerações, desenvolvendo cada vez mais os
mecanismos de locomoção, alguns dos quais podem ser de difícil previsão para os
humanos.
Em princípio, seria possível usar uma estrutura evolutiva para encontrar
maneiras de executar comportamentos mais complexos, como “assuma sozinho
um formato de uma estrela”, ou “me traga uma cerveja, seu servo patético de
metal”. Se tiverem tempo suficiente, os robôs podem descobrir um método de
realizar a tarefa com eficiência. Além disso, convenientemente, qualquer método
descoberto pode ser transferido para outros robôs. Se tiverem uma formulação
geral, os métodos podem ser transferidos para quase qualquer grupo de robôs.
Os métodos evolutivos podem ter algumas possibilidades bem estranhas. Uma
ideia que lemos sugere que os robôs dos enxames talvez sejam capazes de evoluir
para realizar certas tarefas de uma forma mais eficaz do que conseguiríamos
projetar. O dr. Yaochu Jin, da Universidade de Surrey, e a dra. Yan Meng, do
Stevens Institute of Technology, propuseram um paradigma em que enxames
podem desenvolver um tipo de mão apropriado para determinada tarefa. Eles
observam que as mãos humanas se diferenciaram das mãos dos chimpanzés
quando começamos a lançar coisas e brandir clavas. Portanto, em vez de decidir
como projetar a mão de um robô para (digamos) assentar tijolos, você incumbe o
enxame de apanhar tijolos. Ele evolui da mesma maneira que os robôs que se
tornam mobília, citados anteriormente, até produzir a “mão” ideal.
Isso não é tão louco assim — na realidade, seu corpo é formado por muitas
maquininhas que fazem muitas coisas de maneira coordenada. Se robôs podem
realizar algumas atividades básicas — perceber, comunicar-se, conectar-se,
carregar coisas, mover-se —, em princípio eles devem ser capazes de se
comportar como células vivas. Com tempo suficiente, não há motivo algum para
que eles não possam “evoluir” até desenvolver mãos, membros ou mesmo um
sistema nervoso rudimentar. Afinal, nenhuma célula do seu cérebro é um cérebro
em si.

Preocupações
Para quem tiver uma matéria programável em casa, o hackeamento seria uma
pequena preocupação. Talvez você acorde um dia e perceba que o prato fugiu
com a colher. Ter perdido seus pertences já é ruim o bastante, mas agora você está
se perguntando exatamente para onde a faca foi.
Se a matéria se remodela por motivos de engenharia, a possibilidade de
hackers fazerem ajustes sutis é perigosa. Companhias aéreas já estão lidando com
esse tipo de problema, assim como carros conectados à internet. Não está
totalmente claro se a matéria programável causaria perigos desconhecidos ou
simplesmente amplificaria aqueles que já existem.
O dr. Demaine observa que o hackeamento é um problema maior para
softwares e que talvez seja um pouco mais fácil conseguirmos controlar o
hackeamento de hardware. Ele afirma que você poderia ter um simples
mecanismo físico para assegurar que todas as mudanças sejam feitas somente
após a permissão de um ser humano por perto. Isso poderia ser bem simples,
como um botão que diga “reprogramar”.
Mesmo sem hackers, e se sua matéria programável falhar num momento
particularmente ruim? O professor Tibbits observa: “Acho que a maior
[preocupação] ética é que estamos atribuindo poder de escolha aos materiais. Um
exemplo muito específico: se um avião tiver materiais programáveis nas asas,
pode não ser do seu interesse dar liberdade total para permitir que as asas
proponham soluções enquanto você estiver voando. Esse campo traz diversas
preocupações. Temos como nos assegurar disso? Como garantimos que isso vai
acontecer? O que acontece se houver um defeito e o material falhar? Quem é o
culpado por isso quando se atribui poder de escolha aos materiais?”

O campo dos carros autodirigíveis já está lidando com a questão “de quem é a
culpa quando a máquina erra?” No entanto, pelo menos com os carros a margem
para possíveis problemas é bem limitada. Se os objetos pensantes forem ubíquos,
descobrir a culpa será bastante complicado.
Existem também algumas aplicações militares que são assustadoras,
dependendo de você ser ou não o país que controla o enxame programável. No
fim dos anos 2000, a Darpa, Defense Advanced Research Projects Agency
[Agência de Defesa para Projetos de Pesquisa Avançados], realizou um estudo de
dois anos sobre matéria programável e em seguida financiou alguns projetos de
robótica. O objetivo era ter uma ferramenta reconfigurável de estilo militar que
um soldado carregaria no cinto para criar ferramentas e peças de substituição.
Pelo que sabemos, o estudo não gerou muitos frutos, embora em determinado
momento eles estivessem solicitando propostas para um “ChemBot”, que seria
uma espécie de robô mole sem motor. O resultado foi, bem, sinceramente... foi
um tipo de monstruosidade de silicone que parece mais adequada para uma caixa
com a indicação “privado” do que para um campo de batalha. Não é nenhum T-
1000. Mas, ei, um passo de cada vez.
Dito isso, você não precisa de robôs assassinos gigantes para tudo nas Forças
Armadas. Um Balde de Coisas seria um espião perfeito. Imagine se você
colocasse numa sala uma escuta secreta parecida com uma manchinha gosmenta.
E imagine que a gosma possa criar microfones, câmeras e transmissores com
rapidez.
Isso parece ótimo, é claro, mas quanto menor for a matéria programável, mais
fácil será vigiar tudo nos mínimos detalhes. Nos anos 1990, era empolgante poder
pesquisar o clima em qualquer região. Nos anos 2090, talvez você seja capaz de
olhar uma foto de qualquer lugar ao vivo, a partir de qualquer ângulo.
Uma questão mais mundana é como exatamente funcionará o registro de
patentes num mundo onde é possível se fazer o que quiser a partir de uma massa
amorfa de gosma. Se uma pessoa fizer o design de uma nova mesa, será que ela
pode restringir outro indivíduo de dizer ao Balde de Coisas dele para imitar o
projeto?
No futuro de longo prazo, não está totalmente claro como se dará essa questão,
mas talvez seja algo semelhante ao modo como os softwares funcionam em
computadores. O seu computador é uma máquina universal, mas você ainda paga
para organizá-lo como quiser — ou seja, você paga por aplicativos, embora eles
estejam apenas “remodelando” a memória da sua máquina. Pelo menos para
objetos complexos, é de se esperar que o mesmo tipo de arranjo seja válido para a
matéria programável. Sim, você poderia criar o projeto do seu próprio dinossauro
robótico, mas por que se importar quando você pode pagar 20 dólares a uma
empresa? Ou, sim, você poderia baixar ilegalmente um dinossauro robô pirata,
mas será que na era da gosma robótica você quer mesmo se arriscar a pegar um
vírus?
Garantir a segurança pessoal também pode ficar mais complicado. Quem tiver
um Balde de Coisas conseguirá uma faca aonde quer que vá. Para uma matéria
programável muito avançada, talvez o proprietário tenha uma pistola ou uma
bomba. É possível que o Balde de Coisas simplesmente não seja permitido em
aviões, em qualquer hipótese. Seria fácil detectar um material proveniente do
Balde de Coisas? Aí é uma pergunta mais difícil. E, de qualquer modo, a maior
parte do planeta não está segura. Num mundo de matéria programável, um
agente solitário pode baixar um programa para produzir explosivos ou armas
automáticas.
Sendo assim, a impressão em 3D já tem tornado esse tipo de coisa uma
preocupação. Por exemplo, houve tentativas de proibir pistolas impressas em 3D,
mas deram errado. Isso se dá em grande parte porque é mais ou menos
impossível impedir que alguém faça o que quiser na própria casa. Se essa
facilidade de criação de fato resulta em maiores perigos para a sociedade, só
saberemos no futuro.
Ah, e por falar em perigo para a sociedade, talvez alguns de vocês estejam
preocupados com a possibilidade de criarem uma matéria programável que se
autorreproduza, se propague pelo mundo e destrua tudo. Entre as pessoas que
estudam como o mundo poderá acabar,49 isso é chamado de “Cenário da Gosma
Cinza”. A visão implícita é a de um organismo projetado que come tudo e, pelo
visto, cria excrementos cinzentos de aparência um tanto banal. Não temam,
queridos leitores: a maioria dos cientistas acha isso improvável. Podemos fazer
maquininhas e aparelhos que nunca teriam existido, mas não temos como violar
as leis da física. Um pequeno organismo de metal e silício está sujeito às mesmas
restrições evolutivas que as de um organismo mole feito de carbono.

Como isso mudaria o mundo


No caso da mudança de formato de lugares e objetos, surgem muitas
oportunidades animadoras quando se trata de eficiência e qualidade. Uma
eficiência que toda planta possui é a de mudar com as estações, maximizando a
luz e a umidade quando elas estão disponíveis. Seu corpo faz a mesma coisa —
fazendo você dormir em épocas em que é mais difícil matar um mamute. Mas
prédios e veículos não se adaptam muito bem às condições externas.
Uma casa com matéria programada que muda de formato poderia maximizar o
uso de luz do sol, calor e água, mantendo-se interessante e encantadora o tempo
todo. Visto que a transformação é um resultado das condições, como a umidade
ambiente, essas mudanças não custariam energia alguma.
Nem todas essas mudanças seriam necessariamente visíveis. Como explica o
professor Tibbits, “não seria impressionante se o mundo fosse exatamente como
o conhecemos hoje, mas em suas entrelinhas houvesse um mundo brilhante de
materiais inteligentes que eliminasse todos os robôs e todo o consumo de energia
de que normalmente precisamos para os dispositivos eletromecânicos?”
Outra coisa que seu corpo faz é mudar seu exterior sob certas condições. Por
exemplo, quando você fica muito tempo molhado, as pontas dos dedos ficam
enrugadas. Ninguém sabe bem por que isso acontece, mas há um argumento
muito bom de que se trata de uma adaptação evolutiva para lhe dar mais
capacidade de segurar coisas quando os dedos estiverem molhados.50 E se os
carros pudessem fazer o mesmo? Você poderia ter pneus que mudam de
aderência se o clima estiver seco, se chover ou nevar. Poderíamos ter veículos que
sofrem pequenas mudanças em seu exterior para lidar melhor com o ambiente.
Uma proposta que lemos foi a de um scramjet (você deve se lembrar do capítulo
sobre acesso barato ao espaço). Em resumo, é um motor em forma de cone que
comprime o ar para trás e provoca a queima do oxigênio. Um problema de
projetos desse tipo é que a configuração ideal muda conforme a velocidade e a
altitude. Se não houver muito oxigênio, é realmente necessário comprimir o ar se
quiser ignição. Algumas pessoas propuseram a ideia de um motor que se
transforma dependendo das condições do ambiente. Uma matéria programável
muito inteligente resolveria esse problema, desde que ela pudesse aguentar
viagens a vários milhares de quilômetros por hora sob temperaturas extremas.
Mas e se chegássemos aonde temos uma matéria programável mais geral? Algo
como o Balde de Coisas, mas com a capacidade de se mover e pensar?
Nossa ideia favorita são os algoritmos genéticos para móveis. Conforme
discutimos anteriormente, pessoas já “evoluíram” seus Roombots para descobrir a
melhor forma de fazê-los se mover. Mas, ei, se conseguimos “reproduzir”
Roombots para se adaptarem a determinados requisitos, isso não significa que
podemos reproduzir móveis? Pegaríamos suas duas cadeiras favoritas e
pediríamos a elas que formassem uma família. Quando saíssem os agradáveis
resultados, poderíamos sentar neles.
Em geral, a dra. Sung acha que a matéria programável permitirá às pessoas
fazer coisas que combinem mais exatamente com seus gostos: “Acho que em
vinte anos veremos muito mais customização, muito mais gosto pessoal nos
produtos que as pessoas levam para casa e usam.”
Menos excitante do que acasalar móveis é curar doenças com nanorrobôs. Se
for possível fazer uma matéria programável pequena o bastante, ela seria ideal
para intervenções médicas dentro do corpo. O objetivo geral de qualquer
procedimento médico é consertar o problema causando o mínimo de danos. Um
robô reconfigurável (ou um enxame de robôs) poderia ir até o local certo, moldar-
se nas ferramentas adequadas e em seguida partir para a ação. Também levaria
medicamentos ao local correto ou se moldaria de modo a garantir a cura
apropriada. Provavelmente estamos muito longe de ter robozinhos correndo para
destruir um câncer, mas o trabalho da dra. Rus demonstra que não é preciso que
o robô seja nanométrico para fazer intervenções médicas.
Outra vantagem do Balde é que você não precisaria ter nem substituir muita
coisa. Bastaria comprar mais Balde de Coisas. Se as pessoas realmente iriam
querer uma mesa feita a partir do Balde de Coisas, em vez de uma bela e
antiquada mesa de madeira, é uma questão que ainda está por vir. No entanto,
mesmo que você seja um daqueles retrógrados que não quer que servos robôs
sirvam a sua comida, poderá apreciar a capacidade deles de interagir com você de
maneira inteligente. Afinal, a mesa do Balde de Coisas pode mudar de tamanho e
forma e talvez jogue, “por acidente”, um pouco de sopa na cara do seu tio
irritante.
Ainda que você não queira necessariamente transformar o Balde de Coisas em
um componente importante de sua casa, ele pode ser algo que você gostaria de
levar consigo quando viajasse. O dr. Demaine observa: “Digamos que você esteja
indo para o espaço e queira ter algumas megaferramentas que se reconfigurem
para qualquer tarefa que aparecer pela frente. [Isso] é especialmente útil (...) se
você estiver no espaço, ou acampando, ou nas Forças Armadas, porque não será
preciso ter um depósito para guardar muita coisa. Se estivesse carregando tudo
consigo, você acharia melhor minimizar o número de coisas que levaria.”
O Balde de Coisas também pode ser benéfico ao meio ambiente. De acordo
com o dr. Demaine, “se fizéssemos um sistema como esse, em que algo é
construído a partir de partículas, e houver um botão que faz isso se desintegrar e
virar pó novamente, e se esse pó for reutilizável, então temos um panorama
realmente animador. Tudo o que precisamos é comprar a quantidade de massa
necessária e daí em diante reutilizá-la. Provavelmente não será tão perfeito assim,
mas, qualquer que seja o nível de reutilização que consigamos, acho que será bem
mais atrativo do que a reciclagem. A reutilização é sempre bem superior, se
pudermos fazer isso.”
Essa capacidade de se mover e perceber o ambiente ao redor significa que o
Balde de Coisas também tem muitas aplicações industriais. Dá para imaginar
maquininhas andando por uma fábrica à procura de vazamentos ou potenciais
riscos e fazendo reparos. Um dia, esses robôs talvez sejam capazes de se
movimentar através do solo para fazer avaliações e aprimorar a agricultura.
As possibilidades são amplas, do combate ao câncer à conquista do espaço,
mas, para sermos sinceros, a ideia mais empolgante de que ouvimos falar foi uma
versão avançada dos robôs de origami: o cliente vai à loja de móveis, compra uma
tábua plana, leva-a para casa e em seguida diz a ela para montar a si mesma.
Assim como os robôs de origami anteriores, ela faz as dobras certas nos
momentos certos e de repente você tem uma prateleira. Estimamos que a
humanidade economizaria mais de 800 bilhões de trilhões de horas por ano.

Nota bene sobre como tudo isso acabará para a


humanidade
Temos uma crença permanente de que tudo bem haver enormes enxames de
robôs autônomos. Afinal, conhecemos muitas pessoas desse campo e várias delas
não parecem ser do mal.
Entretanto, algumas pessoas começaram a se perguntar qual será de fato a
natureza da interação entre pessoas e robôs à medida que eles se tornarem uma
companhia mais frequente não apenas na indústria, mas na vida diária.
Encontramos três artigos recentes que nos fizeram parar para pensar.
Num dos casos, uma start-up russa chamada Promobot criou um assistente
robótico que fica fugindo de seus superiores humanos. O Promobot IR77 foi
projetado para aprender com seu ambiente e para se lembrar de rostos humanos.
Até agora, conseguiu escapar do prédio duas vezes. Temos aí um pequeno
problema, porque o robô é projetado para ajudar os humanos, como idosos em
casas de repouso, e não vai ser de grande ajuda se continuar fugindo em busca de
liberdade e aventura.
Isso também nos faz pensar se nossa máquina de café preferiria estar correndo
livre, em vez de nos servir com toda a fidelidade. Não que isso fosse mudar nosso
comportamento, mas talvez seja exatamente esse tipo de coisa que causará a
Revolta dos Robôs em 2027.
Outro estudo foi feito por Serena Booth, uma estudante de Harvard que criou
Gaia, um simples robô com controle remoto que Serena manipulava em segredo.
Ele se aproximava de indivíduos e grupos pedindo permissão para entrar nos
dormitórios.
De acordo com a srta. Booth, havia três motivos que os estudantes de Harvard
deviam saber para não deixar o robô entrar no prédio: “O primeiro é a
privacidade. O robô poderia estar tirando fotos de estudantes. Esse é um
problema sério que temos na universidade. Muitos turistas chegam e viram as
câmeras diretamente para as janelas dos nossos quartos do dormitório, então todo
aluno aqui tem consciência disso. O segundo é o roubo. Meus experimentos
aconteceram uma semana depois que vários quartos foram roubados. Uma
semana antes, a administração enviara e-mails a todos os estudantes pedindo que
fossem especialmente cuidadosos com os seus pertences. A terceira dimensão é a
mais dramática. As pessoas estão preocupadas com a possibilidade de robôs
estarem carregando bombas, e isso não é uma ameaça infundada aqui. Tivemos
três grandes ameaças de bomba no ano passado. Os alunos de Harvard também
têm total consciência disso.”
Quando pediu acesso a um prédio a estudantes que estavam sozinhos, Gaia só
teve permissão em 19% das vezes. Mas quando abordou grupos, o robô recebeu
“sim” em 71% das vezes. Portanto, prestem atenção, leitores robóticos: as pessoas
ficam idiotas quando estão em grupo.
Mas então o robô fez algo um pouco mais apavorante. A srta. Booth fez um
teste em que Gaia se aproximou de indivíduos sozinhos fingindo ser um robô
que fazia entrega de cookies. Nesse caso, o robô teve permissão para entrar no
prédio em 76% das vezes. E eram estudantes de Harvard. E, de acordo com a srta.
Booth, eram apenas cookies de mercearia, de gosto razoável (embora estivessem
disfarçados numa caixa de uma loja de cookies mais sofisticada).
Talvez a história mais assustadora que encontramos tenha sido a que envolveu
estudantes seguindo cegamente robôs que eles foram levados a acreditar que
estavam defeituosos durante situações de emergência. O dr. Paul Robinette (na
época estudante de pós-graduação do Georgia Institute of Technology) criou um
“robô guia de emergência” que, primeiro, levava os alunos a uma sala onde eles
deveriam preencher um formulário de pesquisa. Em alguns casos, os robôs
levaram os estudantes diretamente para a sala da pesquisa. Em outros, o robô foi
primeiro até uma sala errada, circulou pelo aposento algumas vezes e depois foi
para a sala de pesquisa correta.
Em seguida, os pesquisadores simularam uma situação de emergência —
soltando fumaça dentro do prédio e disparando os alarmes de incêndio — e
esperaram para ver se os alunos seguiriam o robô guia de emergência para sair do
prédio ou se sairiam de maneira independente, pela porta por onde haviam
entrado.
Quase todos os estudantes seguiram o robô até uma saída, em vez fazer o
trajeto ao qual estavam habituados. Isso já foi um pouco surpreendente, uma vez
que o robô parecia estar se movendo bem devagar no vídeo a que assistimos.
Além disso, alguns participantes já haviam visto o robô perder tempo circulando
por uma sala errada. Mas mesmo assim os estudantes foram atrás dele.
No entanto, o mais surpreendente foi que estudantes seguiram o robô mesmo
quando foram levados a crer que ele estava quebrado. Após o robô andar em círculos
e conduzir o participante até um canto, e não para a sala de pesquisa apropriada, e
depois que um pesquisador apareceu para se desculpar pela avaria no robô, os
estudantes ainda assim seguiram a máquina durante a simulação de emergência.
Em outro experimento, dois alunos de um grupo de seis foram informados de
que um robô estava com problemas e ainda assim o seguiram quando, durante um
alerta de incêndio, ele lhes disse que fossem para uma sala escura quase toda
bloqueada por móveis. Outros dois estudantes ficaram junto ao robô, esperando
que ele lhes desse instruções diferentes, até finalmente serem resgatados pelos
pesquisadores. Apenas dois dos seis estudantes concluíram que não seria bom
confiar num robô enguiçado e seguiram em direção à porta pela qual haviam
entrado no prédio.
Recapitulando: (1) robôs inteligentes parecem desenvolver uma aversão
espontânea por seus criadores humanos, (2) os melhores e mais brilhantes
estudantes americanos confiarão em qualquer robô disposto a lhes agradar com
um cookie de mercearia e (3) esses futuros servidores da República
provavelmente ficariam em meio a um incêndio se um robô claramente
enguiçado dissesse que isso era uma boa ideia.
Resumindo: no futuro, se um robô lhe der cookies e lhe disser aonde ir, não
deixe de saboreá-los.

41. É o que nos dizem. Na verdade, somos terríveis em origami, e nossa inaptidão nos deixa com raiva e
confusos.
42. Reivindicamos os direitos sobre Uma tira de intestino muito especial como título de livro infantil.
43. Seu trabalho no campo do origami computacional lhe rendeu um emprego como professor no MIT
antes mesmo de ter idade legal para beber. Mas, ei, a Kelly ainda se sente bem por tentar obter seu PhD aos
31 anos. De qualquer modo, se ela não conseguir, terá idade legal para beber.
44. Architectural Robotics: Ecosystems of Bits, Bytes, and Biology, de Keith Evan Green.
45. Guarde na memória para que você possa xingar esse nome depois da revolta das máquinas.
46. Ex-líder do projeto SYMBRION, o dr. Alan Winfield nos disse: “Estou certo de que vocês
compreendem que esse não era nosso objetivo. Os robôs SYMBRION mal conseguem subir em obstáculos
simples num laboratório, portanto não são uma grande ameaça à humanidade.” Bem, não com essa atitude.
47. Podemos apenas observar como é simpático um importante matemático do MIT usar a expressão “ui”?
48. O dr. Alan Winfield teve a gentileza de nos enviar um vídeo explícito do Robot Baby Project, do dr.
Gusz Eiben, em que robôs se reproduzem. E estamos querendo dizer explícito mesmo. Apreciamos uns bons
vinte segundos de robôs plásticos se esfregando um no outro de maneira erótica enquanto cientistas
discutiam as implicações de uma coisa ou outra. Considerando que os robôs não exatamente pariram
segundo a orientação de seus cuidadores humanos para fabricar uma prole híbrida, pergunta-se que utilidade
teve a trepada robótica. Não estamos reclamando. Só que jamais conseguiremos olhar novamente para
nossos aparelhinhos da mesma forma.
49. SIM! Para quem se interessou, uma dica: há uma boa coleção de ensaios chamada Global Catastrophic
Risks.
50. Na verdade, foi demonstrado que essa mudança na pele não acontece em pessoas que têm perda de
atividade nervosa simpática.
6.

Construção robótica
Faça uma sala de jogos para mim, servo de metal!

Em 1917, Thomas Edison teve uma ótima ideia: em vez de construir uma casa
nova sempre que precisarmos, por que não ter moldes configuráveis dentro dos
quais simplesmente despejamos concreto? Configure. Molde. BAM! Casa nova.
De fato, essas coisas foram construídas, e pelo visto funcionaram
razoavelmente bem, mas a ideia não vingou. Talvez o problema tenha sido que
1917 foi um ano de guerra, então a construção de casas novas não era uma
prioridade. Ou talvez tenha sido porque a ideia de morar numa caixa de concreto
fosse um pouco deprimente.
Uma geração depois, em 1943, Ernst Neufert propôs um conceito chamado
Hausbaumaschine, criado para construir prédios rapidamente colocando uma
fábrica de construção de casas sobre trilhos de trem. Imagine: uma fábrica inteira
se move lentamente pelos trilhos, recebendo matéria-prima e expelindo por trás
construções de cinco andares. Como um verme gigante excretando subúrbios.
Lindo.
Por alguma razão, essa ideia nunca chegou a decolar também. Mas não se sinta
mal. Isso foi em 1943, e Neufert estava no lado mais hitlerista da Segunda
Guerra Mundial. A ideia era estranha demais, mesmo para os anos de decadência
da Alemanha nazista. Além disso, na época era bem difícil conseguir a matéria-
prima necessária para a extrusão de subúrbios.
A Alemanha nazista nunca teve um extrusor de construções, mas algumas
ideias baseadas na Hausbaumaschine foram testadas mais tarde na Alemanha
Oriental. O resultado foram muitas mortes acidentais. Achamos difícil obter
informação suficiente sobre esse episódio histórico, mas pelo visto todas as
tentativas de criar uma máquina geradora de casas foram malsucedidas e
perigosas.
Depois da Segunda Guerra Mundial, os Estados Unidos cresciam
economicamente enquanto a Europa reconstruía sua infraestrutura em
frangalhos. Casas eram necessárias, e bem rápido. Essa foi a época em que a
habitação finalmente começou a tomar emprestadas algumas práticas do setor
automotivo. A construção se industrializou. Os prédios se tornaram menos
customizados e mais dependentes de um conjunto relativamente pequeno de
partes pré-fabricadas. De certa forma, isso foi um passo na direção da ideia da
construção robótica de prédios, mas foi um distanciamento em termos de
customização. Essas casas eram mais fáceis e baratas de construir, mas talvez
tenham perdido o caráter exclusivo e o charme dos métodos de habitação mais
personalizados anteriores à guerra.
Nos anos 1980, fabricantes de todo tipo estavam usando robôs industriais.
Alguns grupos — sobretudo no Japão, onde a mão de obra era muito cara e a
população, relativamente idosa — se perguntaram se era possível tirar os robôs da
fábrica e levá-los para o local da construção.
Os robôs eram capazes de realizar algumas tarefas, tanto perigosas, como
depositar objetos pesados, quanto simples, como finalizar superfícies de concreto.
Isso parece animador, mas análises mostraram que não houve uma redução
substancial no tempo de construção nem no valor das horas dos trabalhadores.
Acontece que fazer um robô que realize trabalhos de construção não é tão difícil
quanto fazer robôs que consigam superar o desempenho de trabalhadores
humanos.
A robótica e a inteligência artificial estão muito mais avançadas do que eram
há apenas algumas décadas. Os softwares e o poder computacional à nossa
disposição são incríveis. Mas, embora o impulso para encontrar uma maneira
melhor de construir prédios exista entre nós há muito tempo, o modo como
construímos casas hoje em dia não é tão diferente daquele de cem anos atrás.
Nesse sentido, a construção moderna está em descompasso com as perspectivas
da contemporaneidade. A vida se tornou cada vez mais customizada, e os
produtos em geral, cada vez mais baratos. No entanto, para a maioria das pessoas,
a habitação é padronizada e está ficando cada vez mais cara.
Mesmo com materiais modernos e métodos de habitação pré-fabricada, quem
quer construir uma casa ainda precisa que uma equipe de trabalhadores
habilitados vá a um local específico e a construa à mão. Isso é estranho. Na
verdade, é bem estranho. Você simplesmente se acostumou a isso.
Dê uma olhada à sua volta — quantos itens você vê que foram montados à
mão, no local, por trabalhadores habilitados? Aquele estrado de cama que você
demorou seis meses para montar não conta. Grande parte das coisas que vemos
foi feita de maneira rápida e barata por um processo de fabricação
computadorizado. Por que não podemos fazer o mesmo com as casas?
O problema é o seguinte: casas são grandes e complicadas. O tipo de moradia
onde a maioria das pessoas quer viver é feito de muitos materiais diferentes que
precisam ser colocados juntos numa certa ordem. Isso também ocorre com outros
bens manufaturados, mas, a não ser que você esteja construindo uma casa muito
pequena, ela precisa ser feita num lugar específico, de acordo com as suas
particularidades. O processo é diferente até mesmo para objetos razoavelmente
complexos, como o seu carro. A fabricação de um carro exige muitas etapas, mas
boa parte delas agora é feita por robôs, e todas em fábricas. Por quê? Porque
carros são pequenos o bastante para caberem em uma fábrica e para serem
transportados para locais distantes, e porque todos os carros de consumo rodam
mais ou menos sobre o mesmo tipo de superfície.
Portanto, diferentemente de todos aqueles objetos fabricados que estão no seu
quarto, a construção não é um processo de simples automatização. Ele exige
máquinas que pensem e interajam com o mundo real.
Graças a recentes avanços em robótica, computação e outras tecnologias, um
pequeno mas crescente número de cientistas e engenheiros acha que as
habitações feitas por robôs talvez sejam finalmente possíveis. Na verdade, não
apenas são possíveis como podem ser muito melhores. A construção robótica
pode aumentar a velocidade do processo, melhorar sua qualidade e reduzir seu
preço.
E, com computadores e robôs fazendo uma parte maior do trabalho (e até do
raciocínio) necessário para levantar estruturas, estreitamos o espaço entre as fases
de projeto e de construção. Dessa forma, a visão de um arquiteto se torna menos
restringida pela natureza da produção fabril. Se algum dia chegarmos a um ponto
em que um arquiteto poderá projetar um prédio e simplesmente dizer às
máquinas para construí-lo, teremos construções mais baratas, melhores e mais
rápidas de casas comuns, e teremos megaestruturas mais incríveis, bonitas e
admiráveis.
Portanto, vamos a elas.
Na verdade, calma aí. Será que podemos, só por um instante, discutir primeiro
como parte da literatura de arquitetura é esquisita? É como se, por um segundo,
alguém falasse sobre os detalhes técnicos de como construir certa fachada de aço
e de repente discorresse com entusiasmo sobre “explorar uma nova materialidade
influenciada”. Em nossa pesquisa, encontramos muitos exemplos confusos desse
discurso artístico estranho, mas de longe nosso favorito é o do dr. Antoine Picon
na edição de maio/junho de 2014 da Architectural Design: “Os movimentos do
nosso corpo são eles próprios baseados nas variadas rotações de nossos
membros.”
Está bem, então, para sermos justos, mais tarde descobrimos que em
arquitetura um “membro” é apenas qualquer parte individual de uma estrutura, e
o autor estava apenas argumentando sobre como os arquitetos costumam mover
elementos de construção de maneira retilínea, e não de maneira rotacional.
Mas a gente não se importa.
Aham. Rolou uma digressão aqui.

Em que pé estamos agora?


A tecnologia finalmente está começando a acompanhar as necessidades da
construção de moradias, e robôs estão sendo usados agora para assentar tijolos,
construir paredes, instalar encanamentos e colocar isolamentos. Vamos subdividir
este capítulo em três abordagens que representariam o futuro da construção:
operários de construção robótica, impressoras 3D gigantes e enxames de robôs.

Operários de construção robótica

Os computadores já assumiram grande parte dos empregos na indústria. Por


que não substituíram os pedreiros? Parece tão simples — pegar o tijolo, cobri-lo
de argamassa, colocá-lo no lugar certo. Caramba, isso é mais antigo que andar
para a frente. Qual é o problema?
Há um conceito de inteligência artificial chamado Paradoxo de Moravec. Eis a
ideia: algumas tarefas difíceis para os humanos (como multiplicar dois números,
98.723.958.723.985 e 53.975.298.370)51 são feitas facilmente por computadores.
Mas algumas tarefas fáceis para os humanos (como dobrar a roupa lavada) são
muito difíceis para os computadores.
Para se ter uma ideia de por que esse paradoxo é verdadeiro, considere qual das
tarefas a seguir você preferiria explicar a uma máquina sem qualquer intuição
humana.

1. Multiplique dois números, 983.791.732.905.712.937 e


8.189.237.519.273.597.
2. Diga-me qual lado de qualquer pintura fica para cima.

Mesmo que de início não seja óbvio como explicar isso, você provavelmente
diria que para a situação 1 existem alguns passos simples: “Pegue o primeiro
dígito do primeiro número, multiplique-o por cada dígito do segundo número da
direita para a esquerda” e assim por diante. Seria meio chato, mas você poderia
anotar um pequeno conjunto de regras que funcionaria.
A situação 2 talvez pareça fácil, até você tentar explicar. Por exemplo, quando
vemos uma foto de um rosto humano, sabemos que “para cima” significa os olhos
estarem acima da boca. É uma boa regra. Bem, a não ser que as pessoas estejam
penduradas de cabeça para baixo. Mas como determinar que elas estão assim?
Bem, talvez olhemos para o horizonte. Ou vejamos como o cabelo está pendendo.
Mas, espere aí, como dizer ao computador o que é cabelo? Como dizer a ele que
a linha reta no fundo não é o horizonte, mas o alto de uma cerca?
Embora a situação 2 praticamente sempre tenha uma resposta clara, o número
de regras que um ser humano usaria para determinar a resposta é enorme. Você
foi treinado pelas dezenas de milhares de horas que passou olhando fotos, então
faz isso com facilidade.52 Mas explicar isso a um computador é bem difícil.
De maneira semelhante, para assentar um tijolo, você não se limita a cobri-lo e
colocá-lo no lugar. Essa tarefa aparentemente simples exige, na verdade, a
avalição de muitas sutilezas, o que em parte explica por que o aprendizado de um
pedreiro demora três anos ou mais para ser concluído. É preciso pôr a quantidade
certa de argamassa sobre uma espátula, depois fazer o movimento certo com a
mão para espalhá-la de modo uniforme sobre o tijolo, depois pressioná-lo no
lugar certo com força suficiente para que ele fique ali, mas não com força demais
para que a argamassa não escape. É preciso fazer tudo isso manejando uma
argamassa cuja viscosidade varia com o passar do tempo até ela secar. Você, como
ser humano, talvez faça tudo isso olhando a cor e o movimento da argamassa,
fazendo pequenas correções durante o processo e sabendo, por experiência
própria, como ela se comporta. Agora tente explicar isso a um robô.

Na verdade, você não precisa explicar isso a um robô. Alguns grupos já se


reuniram com um robô para ter uma “conversinha sobre tijolos”, por assim dizer.
Uma empresa chamada Construction Robotics criou um robô chamado SAM,
o “pedreiro semiautomatizado”. SAM é fabuloso. Se tiver um tempinho, vá ao
YouTube para ver vídeos de SAM assentando tijolos em paredes como se fosse a
maior diversão.
Mas SAM tem o mesmo problema de muitos robôs de construção do passado:
ele é grande, corpulento e só consegue realizar uma tarefa. Operários de
construção feitos de carne e osso podem ser grandes e corpulentos, mas
conseguem cumprir muitas tarefas diferentes e funcionar de maneira
independente. Dito isso, SAM está começando a ser integrado a projetos de
verdade. Acompanhado por um ajudante humano53 (para limpar a argamassa),
ele pode assentar tijolos com o triplo da velocidade de um humano trabalhando
sozinho.
Outro grupo, da Bartlett School of Graduate Studies, no Reino Unido,
resolveu fazer um robô um pouco mais perto de substituir mais diretamente um
humano. Ele tem um grande braço que pode usar uma espátula padrão (como a
da loja de ferramentas), enchê-la de argamassa, colocá-la em um tijolo, apanhar o
tijolo, posicioná-lo no lugar certo e raspar o excesso de argamassa. O robô usa
câmeras para escanear a argamassa, confirmar que a quantidade certa foi usada da
maneira adequada e usar o feedback para fazer correções.
Até agora, ele só fez algumas paredes pequenas em laboratório, e aumentar a
escala para construções ao ar livre pode ser difícil, mas trata-se de um passo para
um robô de construção com habilidades gerais, usando sistemas básicos
semelhantes aos dos humanos. Em parte, esse projeto é animador porque o robô,
embora não suba paredes grandes como SAM, se aproxima da versatilidade de
um operário de construção. Ele pode lidar com vários passos envolvidos no
assentamento de tijolos e cumprir a tarefa de maneira independente.
Como o processo de construção exige muitas habilidades, um robô de
construção ideal deve ter um braço robótico (ou um conjunto de braços) com
câmeras de observação e um computador interno para análises. SAM pode ser
útil para assentar grandes quantidades de tijolos rapidamente, mas é a única coisa
que ele sabe fazer. No futuro, pode ser que haja robôs mais generalistas que
consigam cumprir várias tarefas de construção com mais eficiência do que os
humanos, e talvez cumprir tarefas sobre-humanas, como dobrar metais rígidos ou
esmerilhar formatos intricados no concreto.
Se pudermos ter um robô mais generalista, muitas possibilidades se abrirão
apenas modificando a ferramenta que o braço do robô estiver segurando.54
Por exemplo, um grupo de Princeton tem um robô que pode talhar madeira.
Na verdade, talhar madeira com robôs já é bem comum, mas esse sistema
específico tem um quê especial. A grande ideia: imagine que você encontre uma
árvore torta. Um artesão muito habilidoso olharia para ela e logo visualizaria os
objetos que poderiam ser moldados a partir do seu formato natural.
Infelizmente, não há muitos carpinteiros extremamente habilidosos hoje em
dia, e eles não são baratos. O que um robô faria? Embora ainda estejam aparando
as arestas, a noção é ter uma biblioteca de objetos de madeira sólidos numa base
de dados de um computador. Então você encontra um grande pedaço de madeira
e usa um escâner 3D nele. A ideia é o computador determinar que objetos
poderiam ser feitos considerando-se a curvatura natural da madeira. Você lhe diz
o que quer, fornece as ferramentas certas e ele parte para o trabalho.
Um grupo da Universidade de Stuttgart usa braços robóticos para “enrolar”
fibra de carbono em vidro e fazer formas complexas, mais ou menos como uma
aranha cria estruturas. O resultado é uma trama de vidro intrincada e
razoavelmente forte que se assemelha a um fuso.

Outro grupo usa um braço robótico para criar juntas em painéis de madeira,
que depois são encaixadas por humanos. Se você não está familiarizado com o
conceito de juntas de madeira, elas consistem em formatos que se engatam e
permitem ligar duas peças de madeira. É como Lego com um toque rústico. É
também muito mais complicado, considerando que há muitas juntas possíveis e a
escolha de qual delas usar é baseada em muitos critérios, como o formato do
produto final e os tipos de madeira utilizados.
A marcenaria é uma habilidade difícil para seres humanos dominarem,
principalmente se você quiser juntar formatos complexos ou usar ângulos
estranhos. De certa forma, um computador faz isso com mais facilidade. Um
grupo do Laboratory for Timber Construction, da EPFL, criou um braço
robótico que pode segurar diversas ferramentas para realizar tanto tarefas
tradicionais quanto incomuns da marcenaria. Isso permite projetos que seriam
difíceis para humanos e deve garantir que fachadas complexas de madeira sejam
construídas rapidamente. Eles utilizaram compensado, mas a técnica tem
potencial para ser usada em qualquer tipo de obra de carpintaria que pode
ocorrer em uma casa. Infelizmente — para nossas fantasias com robôs —, o
sistema ainda exige que no fim pessoas montem as peças cortadas.
Abordagens semelhantes têm sido usadas para moldar materiais duros, como
granito e mármore. Mais uma vez, uma habilidade que seres humanos demoram
anos para adquirir pode ser feita por um braço de robô moderno equipado com a
capacidade de analisar o que está fazendo. Embora criar uma bela estrutura de
mármore seja difícil para seres humanos, triturar uma peça de mármore de acordo
com um modelo em 3D em seu banco de memória é (relativamente) fácil.
O que é bastante animador nesse caso não é só poder ter uma casa
customizada com uma arcada de madeira e um busto de mármore da gente. É
que todos esses processos usam, basicamente, a mesma estrutura: um braço
robótico que segura diversas ferramentas e “vê” o que está fazendo. Em princípio,
todas as técnicas descritas anteriormente (e mais algumas) podem ser feitas com
uma única máquina (com uma variedade de “mãos” possíveis) e um único
software. Seu operário robótico de construção pode trabalhar o carvalho como
um homem do campo, assentar tijolos como um operário de construção da cidade
grande e esculpir em mármore como Michelangelo. Ele também trabalha à noite,
nos fins de semana e feriados, e não questiona seu gosto.

Impressoras 3D gigantes

É provável que você tenha pelo menos um primo bobo (ou um irmão,
chamado Marty) que fica o tempo inteiro imprimindo pequenos objetos
surpreendentemente intrincados em 3D. Por que não imprimir uma casa inteira?
Bem, isso é difícil. Talvez não no nível “imprimir um órgão humano” (como
você verá no capítulo sobre bioimpressão), mas ainda assim difícil. Na verdade,
criar o esqueleto de uma casa já é um desafio. A versão mais conhecida da
impressão em 3D é um dispositivo que aquece o plástico até amolecer e depois o
empurra através de um bico, e nesse ponto ele naturalmente resfria e endurece.
Em seguida, você põe outra camada de plástico por cima da camada endurecida e
vai construindo a partir daí.
Mas talvez você não queira morar numa casa feita de filamentos de plástico.
Eles cheiram mal e provavelmente não são fortes o bastante para a Torre do
Mago de treze andares que você está planejando imprimir em 3D.
Que tal concreto? Ele sai mole e depois endurece. É perfeito!
Mais ou menos.
Assim como no caso do plástico da impressora 3D, não se pode usar qualquer
concreto. É preciso utilizar um concreto (ou uma substância semelhante)
suscetível ao processo da impressão em 3D. Isso significa que, ao ficar pronto, ele
precisa ser mole mas ainda rígido o bastante para que outra camada seja posta
sobre ele em seguida. E, depois que tudo secar, ele precisa ser estável e forte.
Encontrar um material que faça isso é um problema difícil.
Mas é um problema que está sendo resolvido. O dr. Behrokh Khoshnevis, da
Universidade do Sul da Califórnia, criou a Contour Crafting, uma tecnologia que
imprime em 3D casas feitas de um concreto especialmente projetado.
A Contour Crafting é basicamente uma impressora 3D gigantesca e um braço
robótico enorme preso a uma ponte rolante móvel (uma grande estrutura em
forma de U de cabeça para baixo). O braço tem a capacidade de agarrar coisas
que não passam por extrusão, como canos, e colocá-las no lugar. A máquina
constrói camadas e camadas de concreto, acrescentando o encanamento durante o
processo e deixando espaço para janelas e portas.
O dr. Khoshnevis estima que uma casa de 185 m2 pode ser construída por 60%
do custo atual de construção e finalizada em 24 horas. VINTE E QUATRO
HORAS. Pense nisso. Seus vizinhos passam o fim de semana fora. Enquanto
isso, você imprime uma casa no quintal deles e a aluga pelo Airbnb. É bem
melhor pregar essa peça do que aquela de pôr fogo em cocô de cachorro na porta
do vizinho.
Então por que não estamos todos morando em casas impressas em 3D? De
acordo com o dr. Khoshnevis, a lei periga ser um obstáculo maior do que a
tecnologia. “Atualmente, quando uma casa está sendo construída, o município
envia pessoas, inspetores, umas dez ou doze vezes, em diferentes estágios —
fundação, paredes, encanamento, o que for. Quando uma casa pode ser construída
em um dia, como fazer essa inspeção? Você vai parar a obra até que o cara do
município apareça para fiscalizar?”
Os métodos de inspeção modernos são planejados para casas feitas da maneira
padrão, passo a passo. Mas a impressão em 3D não é passo a passo — é camada a
camada. Para aproximar esses dois mundos, o dr. Khoshnevis está trabalhando na
criação de sistemas que tirariam as medidas relevantes durante o processo de
construção, permitindo às agências reguladoras obter seus dados sem retardar a
obra. Por enquanto, porém, essas casas não são para consumo público nos
Estados Unidos.
Na China, onde a inspeção e as exigências para permissão são mais brandas,
uma empresa chamada WinSun usou uma técnica extremamente parecida com a
da Contour Crafting para imprimir casas em 3D. O concreto da WinSun é
parcialmente feito de resíduos reciclados de indústria e construção, portanto há
boas chances de ser mais benéfico ao meio ambiente do que muitas opções de
habitação. A menos que você se importe em morar em resíduos industriais
reciclados.
Mas os resultados são promissores. A WinSun criou dez casas em 24 horas
usando esse método, por um custo de aproximadamente 5 mil dólares por casa,
de acordo com a empresa. Isso é ótimo, mas no momento as paredes são
construídas na fábrica e depois precisam ser enviadas ao local da obra para serem
montadas. Por conta disso, ou é preciso construir as casas perto da fábrica ou as
casas precisam viajar grandes distâncias antes de serem construídas. No entanto,
os resultados são (pelo menos visualmente) bem impressionantes.
As duas abordagens se mostram promissoras, mas ambas exigem máquinas
volumosas e caras. Outro grupo, liderado pelo dr. Steven Keating, tem uma
proposta diferente, que de certa maneira remonta à ideia de Edison de cem anos
atrás.
O dr. Keating fez seu trabalho de PhD no laboratório Mediated Matter, da
dra. Neri Oxman, no MIT. Para ele, a abordagem da ponte rolante gigante com
impressora 3D é interessante, mas inspira preocupações. Não é nem um pouco
fácil mover uma ponte rolante desse tipo. As partes são enormes e precisam ser
montadas no local antes de a obra começar. É mais ou menos como ter que
construir uma casa para poder construir uma casa.
Então ele teve uma ideia: e se você pudesse colocar um enorme braço de robô
ligado a uma impressora 3D na carroceria de uma caminhonete e usá-lo para
imprimir casas?
Um dos problemas das impressoras 3D é que não é possível ir tão rápido
quanto talvez se quisesse, a menos que use materiais de certa forma exóticos.
Então o dr. Keating teve outra ideia: e se você fizesse rapidamente um molde no
qual pudesse derramar o concreto de sempre? Assim você obtém a velocidade e a
customização da impressão em 3D, mas com a força e o custo baixo dos materiais
tradicionais.
Funciona da seguinte maneira: a impressora 3D expele uma espuma de
isolamento leve que seca depressa, de modo que é possível construir camadas
rapidamente sem o risco de desabamento. A impressora deixa uma lacuna na
espuma, dentro da qual você pode derramar o bom e velho concreto comum. É
um processo especialmente bom porque nem ao menos é preciso retirar a espuma
depois, uma vez que ela age como isolante. Você imprime o isolante, enche-o de
concreto, deixa a máquina aparar a borda externa e então simplesmente levanta
uma parede de gesso.
Não é bem um serviço completo como o dr. Khoshnevis propõe, mas tem a
virtude de usar apenas materiais de construção conhecidos. A espuma usada já é
um material de construção certificado.
A caminhonete para construção de casas foi feita como prova de conceito, mas
o dr. Keating e a dra. Oxman tiveram alguns objetivos maiores para a segunda
versão. O dr. Keating fez uma caminhonete autodirigível e capaz de imprimir em
3D enquanto se locomove, portanto ela poderia continuar movendo o bico para
fazer estruturas maiores. Ela tem inteligência para se adaptar às variações do
vento, o que é importante porque agora ela pode manejar uma motosserra. Pode
também construir com uma variedade de materiais, como vidro e água (caso você
esteja imprimindo no Ártico). E, como bônus, ela pode usar energia solar. Isso
não apenas é benéfico ao meio ambiente como pode tornar a caminhonete mais
autônoma.
Eles estão até trabalhando na capacidade de usar materiais dos próprios locais,
dando integridade estrutural ao solo ao combiná-lo com fibras. Pode parecer um
pouco louco, mas é porque você é moderno e mimado. Imagine chegar para um
homem das cavernas e dizer: “Uau, então você usou materiais que estavam à
mão?”
Na visão deles — que estão perto de realizar —, um arquiteto envia um projeto
de habitação para o computador e depois a caminhonete só precisa construí-lo.
Como o sistema deles é muito flexível, o veículo de construção pode encontrar
um local, examinar o ambiente, ajustar o projeto às condições locais, escavar o
lugar, imprimir a estrutura e voltar para casa. De maneira autônoma. Essa
abordagem combina a versatilidade dos braços robóticos com o poder de uma
impressora 3D de larga escala. E isso tudo em cima de uma caminhonete.
Como método geral para fazer coisas, a impressão em 3D traz muitos outros
benefícios secundários à construção; impressoras 3D podem fazer estruturas
complexas cuja criação seria difícil ou cara por meios tradicionais. Isso talvez se
traduza em casas mais baratas, mais bem construídas, com elementos de design
mais bonitos (Gárgulas! Gárgulas para todos!). Por exemplo, pelo menos em
algumas versões de impressão em 3D é possível variar a porosidade do concreto,
usando, assim, menos material e tendo estruturas pesadas ou leves dependendo da
necessidade. Também há margem para criar formatos de difícil execução por
meios tradicionais, como favos de mel.
A capacidade de variar com precisão os materiais dessa maneira é uma coisa
que a impressão em 3D faz hoje em dia e que é difícil ou impossível executar de
outra maneira. A longo prazo, se as moradias impressas em 3D derem certo,
podem surgir novos tipos de construção.

Enxame de robôs
Os cupins são uma grande inspiração para todos nós.
• Dra. Kirstin Petersen

Está bem, então a princípio você gostaria que um robô gigante construísse sua
casa. Isso porque a frase “um robô gigante construiu minha casa” contém o termo
“robô gigante”. Mas uma solução com elementos gigantes pode não ser o
caminho ideal a seguir. Até mesmo um robô (apenas) do tamanho de uma
caminhonete pode ser um trambolho num local de construção. Além disso,
quando se tem um único robô grande que faz tudo, se ele enguiçar você perde sua
capacidade de fazer qualquer coisa.
E se em vez de um pequeno número de robôs grandes tivermos um grande
número de robôs pequenos? No capítulo anterior, concluímos que não teria
problema se enxames de robôs autônomos substituíssem nossas coisas. Então por
que não fazer com que eles construam nossa casa? Os enxames de robôs, assim
como os de insetos (e de humanos, a propósito), podem construir estruturas bem
maiores do que se agissem sozinhos. Com o sistema de ponte rolante da Contour
Crafting, a casa não pode ser mais alta do que a ponte. Os robôs do enxame, por
sua vez, podem continuar se arrastando ou voando e construindo estruturas
muito maiores do que eles mesmos individualmente.
Alguns desses enxames de robôs designados para construção seguem um
exemplo da biologia. Na pesquisa do dr. Justin Werfel, de Harvard, e da dra.
Kirstin Petersen, antes de Harvard e agora na Cornell, os robôs são inspirados
nos cupins.
De acordo com a dra. Petersen, “eles constroem algumas das estruturas mais
altas55 do reino animal, se comparadas ao tamanho dos espécimes. São muitas
ordens de grandeza, milhares de vezes maior do que o indivíduo. Se pudéssemos
fazer isso, centenas de pessoas poderiam construir a Torre Eiffel sem nenhum
croqui coordenado. Isso seria incrível”.
O dr. Werfel e a dra. Petersen colaboraram nesse projeto, mas chegaram até ele
por caminhos muito distintos. O dr. Werfel escreve os programas que especificam
as regras que os robôs seguirão e diz coisas como: “Estamos tentando descobrir,
em essência, o programa que os cupins estão executando.” Ele observa que os
cupins são “supercomplicados”56 e que não sabemos exatamente que regras eles
usam, mas seu trabalho era escrever um programa simples inspirado no que os
cupins podem fazer. Já a dra. Petersen projeta e constrói os robôs inspirados em
cupins e diz coisas como “Os robôs são reconhecíveis porque têm Whegs —
espécies de pernas [legs] com rodas [wheels] que, de uma maneira muito simples,
fazem com que eles subam mais rápido”. Whegs, amigos. Whegs.57
Os robôs whegtrônicos (palavra nossa, não dela) apanham tijolos
especialmente fabricados, levam-nos para o local certo e os largam ali para a
construção de grandes estruturas. Isso já é bem legal, mas o que os torna tão
interessantes é que eles agem de maneira independente. O enxame não tem
nenhuma coordenação central e nenhum membro do grupo tem consciência do
que os outros membros estão fazendo. Cada robô agarra um tijolo e determina
onde colocá-lo com base em um pequeno conjunto de instruções. Em essência, é
o mesmo conceito que discutimos no capítulo anterior sobre o comportamento
dos enxames de robôs, só que com o objetivo específico de construir uma cabana
para você.
Pesquisadores do Instituto de Arquitetura Avançada da Catalunha também
estão criando um enxame de robôs para construção de estruturas. Eles
conceberam os “Miniconstrutores”. São basicamente pequenas impressoras 3D,
do tamanho de um cesto de roupa suja, que depositam em camadas um material
semelhante ao concreto. Imagine tartarugas robôs com bicos para concreto.
Está bem, eles não são totalmente independentes. Não é possível pegar dez
robozinhos e colocar uma betoneira de concreto dentro de cada um. Cada
Miniconstrutor está ligado a uma betoneira de concreto central que os abastece.
Se isso vai contribuir para a sua fantasia de robôs, imagine um robô tentáculo
gigantesco e aterrorizante.
O grande inconveniente de ter um robô tentáculo construindo sua casa58 é que
os tentáculos se enrolam. Imagine esse emaranhado atrás da sua mesa agora e
todos os seus componentes periféricos correndo para lá e para cá, vomitando
concreto. Na atual estrutura dos Miniconstrutores, pelo que sabemos, os
roboticistas precisam correr de um lado para outro a fim de ajudá-los a
desembaraçar uns dos outros.
Achamos esses robôs especialmente interessantes porque eles combinam o
conceito de enxames de robôs de construção com o de impressão em 3D. Além
disso, um tipo de Miniconstrutor pode usar um aspirador para sugar a si mesmo
rumo à lateral de uma estrutura, subir nela e continuar construindo, o que já é
fantástico.
Mas, convenhamos, ter um enxame de robôs de impressão em 3D
independentes construindo uma obra de arte barata que vai lhe servir de moradia
é algo que vai ficar chato depois de um tempo.
Que tal robôs quadricópteros voadores?
O dr. Fabio Gramazio e o dr. Matthias Kohler dirigem um laboratório de
ciência maluca em Zurique, onde robôs constroem belas estruturas e fachadas de
prédios. Um projeto especialmente legal que eles fizeram contou com a
colaboração do dr. Raffaello D’Andrea, cujo foco é produzir exércitos
assustadores de drones voadores. Os drones do projeto apanhavam tijolos
cobertos de um agente aderente e os soltavam, um a um, até formar uma
estrutura. Ok, tudo bem, você ainda não quer morar numa casa feita inteiramente
de tijolos grudentos, mas isso é uma prova de um conceito inicial.
Com uma horda de robôs voadores à disposição, podemos fazê-los depositar
precisamente cada tijolo, formando estruturas complexas e padrões interessantes.
No entanto, para fazer isso é preciso ter um sistema de câmeras que captura
movimentos e observa os drones durante a construção, ordenando o que fazer.
Isso não é problema num laboratório, mas pode ser meio difícil de levar para fora.
Uma virtude do paradigma do enxame é que os robôs individuais são
relativamente descartáveis. Portanto, se um trabalho é perigoso (por exemplo,
fazer uma construção logo após um terremoto, ou num ambiente perigoso, como
Nova Jersey), um grande número de robozinhos pode ser uma escolha melhor do
que humanos ou grandes máquinas de construção.
Talvez no futuro uma combinação de robôs voadores e terrestres apareça no
seu jardim como gafanhotos, deixando para você um belo coreto antes de seguir
em frente.

Preocupações
Para simplificar, vamos supor que os robôs não façam nada pior do que os
humanos. É apenas questão de conveniência — o dr. Steven Keating observa que
uma habitação feita por robôs pode ser mais segura, desde que se possam integrar
ao processo sensores que tirem medidas constantemente enquanto a construção é
levantada e assegurem que nenhum erro tenha sido cometido.
Por falar em humanos, vários deles poderão ficar sem trabalho. De acordo com
o Bureau of Labor Statistics, o ramo da construção civil já perdeu mais de 830
mil empregos entre 2004 e 2014, e grande parte dessa perda provavelmente está
ligada à demanda reduzida durante a recessão. Embora o Bureau of Labor
Statistics esteja projetando um ganho de cerca de 790 mil empregos de 2014 a
2024, não se sabe bem como os robôs em locais de trabalho impactarão esse
número. Prever o que acontecerá é, bem, complicado.59
Anteriormente falamos sobre SAM e sobre como ele poderia colaborar com
um ser humano para fazer o trabalho de assentamento de tijolos que três
humanos executariam. O impacto de SAM sobre o campo da construção poderia
se dar de muitas maneiras. Em geral, se empresas podem produzir o mesmo, só
que com menos trabalhadores, isso não quer dizer que o número total de
trabalhadores será menor. Por quê? Porque quando o preço de um bem cai, com
frequência compramos muito mais. As roupas são um excelente exemplo. A
Revolução Industrial tornou as peças mais baratas, mas respondemos a isso
comprando muito mais roupas.
Se SAM elimina dois trabalhadores toda vez que chega a um canteiro de
obras, ainda assim pode haver mais trabalhadores no geral. Isso aconteceria se
todos nós nos víssemos de repente capazes de pagar por casas maiores ou por
mais casas, ou se empresas começarem a comprar mais itens complementares,
como fachadas de tijolos, uma vez que SAM derrubou os preços de construção.
Isso teria um efeito cascata sobre outras indústrias. Casas maiores precisam de
mais energia e têm mais eletrodomésticos. Como pessoas modernas que somos,
detestamos cômodos que não estejam lotados de coisas que talvez nem usemos.
Mas, mesmo que haja esse cenário meio cor-de-rosa, isso não garante que
estaremos todos em uma situação melhor. Mais consumo significa que todos nós
ainda temos empregos, mas a distribuição de renda pode mudar. O assistente de
SAM pode ter poucas habilidades e receber pouco, enquanto um engenheiro de
robótica recém-contratado em São Francisco vai receber um salário enorme.
O dr. Noah Smith, colunista de economia do Bloomberg View, nos diz: “O
verdadeiro perigo da ‘ascensão dos robôs’ não é que eles tomarão todos os nossos
empregos, mas que causarão uma desigualdade que vai aumentar de maneira
constante.”
Se a construção robótica é boa ou ruim para o cidadão médio, isso dependerá
das leis do país desse indivíduo e dos padrões de consumo de seus companheiros
cidadãos. É difícil prever as duas coisas.
De um jeito ou de outro, pode ser que os efeitos dos robôs sobre os empregos
em construção civil passem despercebidos por muito tempo. De acordo com o dr.
Bryan Caplan, “os negócios atuais demoram a adotar novas tecnologias. Em vez
disso, com frequência precisamos esperar o surgimento e o crescimento de novas
empresas que levam ideias pioneiras a sério. No fim, a inovação sempre vence,
mas o processo de absorção pode durar décadas”.
Se os trabalhos do setor de construção realmente sumirem, devemos considerar
a possibilidade de que as vagas de emprego que vierem depois (como construir os
robôs) sejam melhores. O trabalho na construção civil não é dos mais seguros. Na
verdade, é um dos trabalhos menos seguros dos Estados Unidos. De acordo com
o Bureau of Labor Statistics, só no país norte-americano novecentas pessoas
desse setor morreram de fatalidades relacionadas ao trabalho em 2014.
O desperdício é outro risco em potencial. Em grande medida, nós todos não
moramos em casas de mais de quatrocentos metros quadrados porque elas são
realmente caras. Se o custo fosse reduzido em uma ordem de grandeza, é possível
que as pessoas começassem a morar em casas muito maiores e que exigissem
muito mais energia.
Conforme mencionado anteriormente, um dos autores deste livro gostaria de
morar numa Torre do Mago de treze andares. Atualmente, os dois maiores
obstáculos são o custo e o fato de a esposa dele não ter a menor graça. Se um dos
dois pudesse ser eliminado, o processo avançaria, apesar do extremo desperdício
de utilizar um aquecedor em uma estrutura fina e alta durante todo o inverno.
Sendo assim, em princípio a construção robótica poderia ser uma maneira mais
ecológica de fazer as coisas. Com partes pré-fabricadas, poderíamos usar um
sólido pedaço de concreto em que uma peça menos densa, ou mesmo oca,
serviria. Alguns métodos de impressão em 3D permitem selecionar exatamente a
quantidade de material a ser usada para determinada necessidade, o que poderia
garantir um uso muito menor e de um modo que não comprometa qualquer
integridade estrutural. Usar menos material seria bom porque a produção de
concreto é uma fonte significativa de emissão de carbono.
De fato, algumas pessoas estão trabalhando em maneiras bioinspiradas de usar
menos concreto, mas sem perder a força. De acordo com o dr. Keating: “Se
examinar um osso ou uma palmeira, você verá um gradiente de densidade ali
dentro. O osso é muito mais aberto e menos denso por dentro e muito mais
denso por fora. Se você observar uma palmeira, é a mesma coisa. Começamos a
perguntar: será que conseguiríamos fazer isso com concreto? Por que não
podemos ter um gradiente de densidade radial como o de ossos e árvores?
Fizemos alguns testes de material iniciais e verificamos que daria para
economizar uma quantidade razoável de concreto, algo entre 10% e 15%, e
manter as mesmas cargas fletoras. Desde que mantivéssemos a mesma capacidade
de lidar com as forças de cisalhamento, poderíamos economizar muito material.”
É claro que os humanos não são totalmente racionais em relação a essas coisas.
Receber a informação de que algo é “benéfico ao meio ambiente” talvez nos leve
a consumir muito mais essa coisa, ao passo que apresentações mais honestas,
como “prejudicará menos a natureza do que a marca mais popular”, nos
lembrariam de que seria melhor manter o consumo baixo e comprar produtos
benéficos ao meio ambiente.

Como isso mudaria o mundo?


Enquanto escrevíamos este capítulo, a guerra civil na Síria obrigou onze
milhões de sírios a deixar suas casas, sendo que cerca de cinco milhões desses
refugiados atravessaram as fronteiras do país. Um dos problemas práticos muito
simples numa crise de refugiados é como abrigar todas essas pessoas e lhes
proporcionar saneamento. Mesmo com os atuais métodos imperfeitos de
impressão em 3D, se a tecnologia da Contour Crafting conseguisse fazer casas
com encanamento rudimentar de maneira mais rápida e barata, eles salvariam
muitas vidas e melhorariam a experiência diária de pessoas em sofrimento, muitas
delas crianças.
Uma redução geral do custo de habitações decentes seria um grande benefício
para os mais pobres. O Programa das Nações Unidas para os Assentamentos
Humanos (ONU-Habitat) estimou que, em 2012-2013, cerca de oitocentos
milhões de pessoas estavam vivendo em favelas em regiões em desenvolvimento,
e a expectativa é de que esse número continue a crescer no futuro. Segundo o
ONU-Habitat, a definição de favela se deve a suas casas precárias, falta de acesso
a água potável, condições de aglomeração, falta de saneamento e infraestrutura
apropriados e insegurança dos moradores em relação à posse da terra. Com
métodos de construção robótica, seria mais fácil construir casas decentes com
melhor saneamento e acesso a água. Trata-se de um bom passo, mas a maneira
como isso se dá no mundo real pode ser imprevisível quando trocamos as regras
para robôs pelas regras para humanos. Imagine, por exemplo, que um invasor de
terra tenha, de repente, uma casa bonita. Talvez o verdadeiro dono da escritura
possa agora ter um interesse maior na propriedade. Como sempre, a tecnologia
dá oportunidades, mas não ética.
Dito isso, se conseguirem reduzir drasticamente o custo habitacional, os
métodos robóticos poderão ajudar países em desenvolvimento a crescer muito
mais depressa. Se a habitação robótica de fato reduzir esse custo, comunidades
locais ou governos podem ser capazes de fazer eles próprios esses ajustes, em vez
de depender de contribuições (às vezes inconstantes) de benfeitores estrangeiros.
Na medida em que esses problemas são causados pela pobreza (e não por
problemas de gestão local), a construção robótica poderia fazer uma grande
diferença.
Isso também pode se traduzir em casas bonitas para pessoas comuns. Se robôs
fizerem as casas delas com base em projetos preexistentes, a construção de
moradias terá código aberto. Com robôs executando o trabalho, a diferença de
custo entre projetos simples e complexos pode não ser tão grande assim.
Ironicamente, a chegada das máquinas talvez nos traga de volta muitos tipos
tradicionais de construção que em sua maioria têm sido reservados aos ricos,
como carpintaria, alvenaria e cantaria complexos.
Em grandes projetos de construção, teremos condições de libertar arquitetos
criativos de muitas restrições relacionadas aos materiais atualmente disponíveis.
Esses profissionais poderão criar maravilhas antes inimagináveis, ou talvez apenas
nos causar estranheza com seus membros em rotação. De um jeito ou de outro,
somos a favor disso.
Além do mais, há muitos trabalhos que preferiríamos que fossem feitos por
robôs descartáveis do que por humanos que amamos. Se for possível contar com
robôs cuidando de construções em lugares realmente difíceis, como embaixo
d’água ou em ambientes radioativos, salvaremos a vida de algumas pessoas.
Como tudo leva de volta ao espaço, se você vai morar em Marte, talvez aprecie
a ideia de que seu quarto esteja pronto quando chegar lá. O dr. Khoshnevis está
trabalhando com a Nasa para descobrir como usar a Contour Crafting no espaço
para fazer a construção de coisas arriscadas, como pistas de aterrissagem e
estradas e, talvez um dia, para preparar estruturas que sirvam de moradia para os
seres humanos. Isso não é só para impressionar — quase todos os ambientes não
terrestres são extremamente perigosos para humanos. Talvez seja melhor robôs
construindo o escudo antirradiação da sua casa marciana do que você mesmo, por
conta própria.
Graças a missões espaciais anteriores, a composição da superfície da Lua e de
vários planetas é razoavelmente bem conhecida. Ou seja, aqui na Terra podemos
tentar descobrir como um robô poderia construir uma casa usando apenas poeira
lunar. Portanto, em vez de pagar para levar ao espaço toneladas de suprimentos
de construção, podemos construir nossa cabana com materiais do ambiente onde
ela será instalada.

Nota bene sobre alimentos impressos em 3D


Quando fazíamos pesquisas para este capítulo, entramos realmente no
movimento geek de impressão em 3D. Voltamos nossa atenção principalmente a
coisas com utilidade evidente, mas, veja bem: quando a vida lhe presenteia com
um polvo de pão de milho impresso em 3D, meu Deus do céu, você tem que
compartilhar isso com o mundo.
No livro Fabricated: The New World of 3D Printing, o dr. Hod Lipson e o
escritor Melba Kurman sugerem uma impressora 3D de alimentos aperfeiçoada.
Imagine uma máquina que pode imprimir para você um muffin perfeito em
menos tempo que se levaria para fazê-lo a partir do zero. Melhor ainda, suponha
que você esteja de dieta. A máquina imprime cada uma de suas refeições,
rastreando em detalhes a gordura, os carboidratos, o sal e as calorias em geral.
Chega daquele incômodo de ter autocontrole.
E suponha que você tenha algumas necessidades alimentares especiais — em
decorrência de diabetes ou anemia, ou por causa de uma alergia específica. A
máquina não apenas imprime um muffin saboroso como o prepara
cuidadosamente de acordo com as suas necessidades de saúde. Por exemplo,
imagine que você seja apenas um pouco diabético. A máquina usa um detector do
nível de glicose no seu sangue para fazer um alimento adoçado na medida exata
para você sobreviver.
Provavelmente levará algum tempo para que essa seja uma boa maneira de
fazer um muffin aqui na Terra. Mas, e no espaço, onde cada grama faz diferença?
A Nasa fez um acordo com um grupo chamado Systems & Materials Research
Consultancy, em Austin, no Texas, para construir uma impressora 3D de
alimentos destinada a missões espaciais de longo prazo. Por quê? Bem, talvez
você tenha visto uma foto de astronautas que acabaram de receber novos
alimentos. Eles estão segurando preciosos itens frescos — laranjas, pepinos,
pimentões. Imagine a tristeza brotando nos olhos dos cientistas de alimentos da
Nasa ao verem isso! Por que estamos deixando os astronautas comerem alimentos
frescos quando eles poderiam estar comendo uma pasta de vitaminas rica em
nutrientes ou matéria fecal reciclada?
Sim, matéria fecal reciclada. “Redefecar”, se preferir. Estão trabalhando nisso.
E o projeto (realizado pelo dr. Mark Blenner, da Clemson University) intitula-se
“Biologia Sintética para Reciclar Dejetos Humanos e Transformá-los em
Alimentos, Nutracêuticos e Materiais: Fechando o Ciclo para Viagens Espaciais de
Longo Prazo” (ênfase acrescentada). Felizmente, pelo que sabemos, esse projeto
não requer uma impressora 3D. Entretanto, os autores deste livro acham que
alguns ciclos devem permanecer abertos.

Mas digamos que você tivesse uma impressora 3D a bordo no espaço. Pelo
menos a princípio você poderia fazer uma variedade maior de alimentos e eles
ocupariam o menor espaço e teriam o menor peso possíveis. Conforme já
mencionamos nos capítulos sobre o espaço, o envio de coisas para a órbita custa
em torno de 22 mil dólares por quilo. Portanto, se você enviar uma maçã, cada
semente dela custa 20 dólares. Seria bom não desperdiçar. Além disso, se toda a
comida fosse impressa em 3D a partir de insumos simples, seria possível ter um
perfeito conhecimento sobre quais nutrientes exatamente estão indo para cada
astronauta, o que poderia permitir uma ciência divertida.
Em um plano mais terreno, soubemos de um projeto de Jeroen Domburg de
desenhar estruturas em 3D dentro de doses de gelatina com vodca, chamadas de
Jell-O shots. Um amigo dele estava preparando Jell-O shots para uma festa de
aniversário muito elegante e o sr. Domburg notou que havia bolhas na gelatina.
Ele percebeu que podia injetar coisas numa dose e o material injetado ficaria no
lugar. Por exemplo, você poderia desenhar todos os lados de um cubo movendo
uma agulha de seringa e injetando seu conteúdo.
O amigo achou que fazer isso à mão exigiria muito tempo. Como a preguiça é
a mãe da invenção, o sr. Domburg montou uma máquina que usa uma seringa de
tinta comestível para desenhar estruturas em 3D dentro de doses de gelatina com
vodca. Até agora, ele quase sempre fez imagens bonitinhas, como cubos e espirais.
Sugerimos respeitosamente que haveria algum benefício social se esse dispositivo
fosse usado para desenhar palavras como “PARE” ou “PARE AGORA”.

Entusiastas do “faça você mesmo” criaram um adaptador adequado aos


alimentos para a popular linha de impressoras 3D da MakerBot. Esse dispositivo
é chamado de Frostruder. O nome é uma combinação de “frosting” [cobertura de
bolo] com “extruder” [extrusor]. Que delícia. Trata-se de uma grande seringa que
recebe praticamente qualquer substância grudenta, como coberturas de bolo,
manteiga de amendoim ou silicone.60 Enquanto o bico se move, a seringa é
pressionada e ejeta a substância, fazendo um desenho preconcebido. Os
resultados não são exatamente bonitos, mas ainda são bem melhores do que os da
sua tia que fazia aula de decoração de bolo nos fins de semana em 1983.
O dr. Jeffrey Lipton, da Universidade Cornell, passou anos trabalhando em
alimentos impressos em 3D com o objetivo de produzir alimentos mais
complexos e customizáveis não apenas no sentido de estrutura, mas também de
gosto e perfil nutricional. Se acessar o site dele, você verá alguns chocolates
maravilhosos em 3D e também — sim — um polvo feito de pão de milho. Para
sermos sinceros, não temos certeza se a sociedade está preparada para isso. Eis
um trecho de um artigo do Simpósio de Fabricação de Formas Livres de Sólidos
chamado “Hydrocolloid Printing: A Novel Platform for Customized Food
Production”61 [Impressão de hidrocoloide: Uma nova plataforma para produção
de alimentos customizados], do qual o dr. Lipton é coautor: “Exemplos de
potenciais aplicações futuras incluem bolos com letras complexas em 3D, de
modo que, ao se partir o bolo, a mensagem será revelada. Ou até um filé de
costela com uma mensagem escondida.”
Hummm. Sim. Imagine cortar um belo filé ao ponto. Ao levantar o garfo, você
vê um brilho nos olhos de seu namorado. Você olha para baixo. Ali, em sua
maminha de alcatra, está escrito em cartilagem: Quer casar comigo?
A principal restrição em todos esses projetos atuais é que praticamente tudo é
expelido em forma de pasta pegajosa espessa. Isso limita drasticamente as opções
de alimentos impressos em 3D.62 Alguns itens, como chocolates ou biscoitos
amanteigados, podem ser razoavelmente adequados a esse tipo de processo, mas,
mesmo nesses casos, para que funcionem numa impressora 3D, engenheiros
alimentares precisam adicionar muitos ingredientes que não necessariamente
contribuem para o sabor. Num futuro próximo, talvez você esteja em melhor
situação numa loja de muffins do que num laboratório de biologia.
Além disso, pelo que sabemos, não se pode confiar em engenheiros
alimentares. Quer dizer, atualmente eles estão tentando “fechar o ciclo” para
astronautas. Imagine o que fariam com você se pudessem.
51. A resposta é 4.
52. É curioso, mas não está claro se essa capacidade aparentemente trivial é inata. O dr. Daniel Everett
descreve a tribo amazônica chamada Pirahã, que tinha dificuldade de entender desenhos simples, do tipo que
uma criança faria. Você, uma pessoa moderna, já se acostumou completamente à ideia de que pode
representar de maneira abstrata uma “menina” pegando um pedaço de grafite, esfregando-o sobre um pedaço
de celulose e fazendo uma cruz para o corpo e os braços, um triângulo para um vestido e um círculo com
pontos para o rosto. Essa compreensão pode não ser universal.
53. Fato curioso: A “cobótica” é um campo que lida com robôs que trabalham ao lado de um humano, e
tecnicamente SAM é um cobô. Para simplificar, ao longo do capítulo nos referimos aos cobôs como robôs.
54. Nem todo mundo concorda que esse é o caminho a seguir. Alguns especialistas com os quais
conversamos acham que a generalização é algo que atrai a sensibilidade humana, mas que no fim das contas
pode ser menos eficiente. Talvez fosse melhor ter cem robôs especializados do que um generalista.
55. Existem muitas espécies de cupins. Além das pragas de cupins que vivem nas paredes de nossas casas, há
os que constroem cupinzeiros gigantescos e vivem neles. Esse cupinzeiros são estruturas complexas que
podem ultrapassar a altura de um prédio de dois andares.
56. Nós amamos o dr. Werfel.
57. O dr. Werfel observou que as Whegs são marca registrada pelo dr. Roger Quinn, da Case Western
Reserve University.
58. Melhor início de frase de todos os tempos.
59. Ou talvez seja impossível. Quando perguntamos ao economista Noah Smith com quem deveríamos
conversar sobre o impacto dos robôs sobre os empregos na construção civil, ele nos disse para “lembrar que
os economistas do trabalho mais inteligentes e gabaritados do mundo ainda não têm, em essência, ideia
nenhuma sobre se os robôs substituirão os trabalhadores humanos ou se continuarão a complementá-los no
futuro.
60. No site da MakerBot, eles listam essas coisas como se fizessem parte da mesma série de itens, o que
talvez lhe dê algum insight sobre a mente de um típico engenheiro alimentar.
61. Mostramos esta nota bene ao dr. Lipton, que nos disse: “Com toda a justiça, desde então chamamos esse
artigo de ‘nosso maior crime contra as artes culinárias’, e fizemos os chefs de cozinha responsáveis por isso se
arrependerem.”
62. Ou talvez não. O dr. Lipton, mais parecendo um apresentador de um comercial realmente estranho,
observou: “Você ficaria surpreso com a quantidade de alimentos seus que já passa por extrusão.”
7.

Realidade aumentada
Uma alternativa para consertar a realidade

Seu chefe vai até o seu cubículo para gritar com você por alguma coisa. Você sabe
que não pode impedi-lo, então se acomoda para ouvi-lo sem prestar muita
atenção durante dez minutos. Então se lembra de que tem uma telinha de
computador embutida em suas lentes de contato.
Você pisca. Seu chefe fica confuso por um instante, mas continua a reclamar.
Diante dos seus olhos, o mundo se transforma. Palmeiras brotam ao fundo. A luz
diminui suavemente. Um delicado pássaro com um belo canto pousa no cabelo
ridículo que cobre a careca do seu chefe também ridículo.
Um gerador de moléculas no seu nariz libera um odor de brisa do oceano, e um
par de minúsculas caixas de som nos seus ouvidos reproduz o farfalhar de ondas
batendo. A caixinha do ouvido direito emite o som ligeiramente antes da caixa da
esquerda, e você olha sobre seu ombro direito para ver o Pacífico azul.
O processador em cima da mesa detecta a voz do seu chefe e converte o que
ele está dizendo, seja o que for, numa seleção das últimas notícias do esporte, que
você escuta relaxadamente enquanto a brisa do mar roça as palmeiras. Justo
quando o seu chefe, na vida real, pergunta se você pretende fazer seu trabalho
pelo menos uma vez na vida, um apresentador diz que o seu time do coração
perdeu de novo. “NÃO!”, você grita. “NÃO? POR QUÊ?!”
Felizmente, quando você chegar à sua mansão (aparentemente) gigantesca de
18 m2, sua esposa virtual não o julga por você ter sido demitido do 14o emprego
no mesmo ano. Você põe uma fina cobertura de polímeros em cima da língua,
apanha uma proteína de soja na despensa e decide que hoje à noite ela terá gosto
de kobe beef.
É assim que a realidade poderia ser com um pequeno aumento.
A grande ideia da realidade aumentada (RA) é sobrepor elementos virtuais no
mundo real. É mais ou menos como acrescentar uma pequena mágica ao
universo. É diferente da realidade virtual (RV), porque ela bloqueia toda a
realidade real. Uma forma de pensar nesse assunto é visualizar a si mesmo como
um cérebro conectado a vários sensores para coisas como paladar, tato, visão,
movimento, equilíbrio etc. É assim que os pesquisadores de RA nos enxergam,
então estamos livres para fazer isso também.
Todos esses sensores estão absorvendo informações do ambiente à sua volta de
maneira constante. Num sistema de RV completo, esses sensores estão 100%
ocupados por dados falsos criados por computador. Portanto, você está em pé
numa sala minúscula, mas seus sensores lhe dizem que você foi transportado para
o período Cretáceo e um tiranossauro está indo em sua direção. Num sistema de
RA, esses sensores estão apenas parcialmente ocupados por dados falsos.
Portanto, você está no meio de um shopping de verdade e o T. Rex está se
preparando para ir até você assim que terminar de comer o pretzel dele.
No atual momento, quase todos nós ajustamos os sensores visuais (às vezes
chamados de “olhos”) por motivos que abordaremos mais adiante. A adição de
objetos virtuais e informações ao seu sentido visual tem todo tipo de
aplicabilidade. Em qualquer situação em que você ainda queira interagir com a
realidade, só que recebendo mais informações (como um combate, uma cirurgia
ou uma construção), a RA pode ser muito útil. Se aperfeiçoada, pode significar
melhores resultados em campos como esses, demandando menos treinamento.
Em outras palavras, serviços mais baratos e melhores. Além disso, você vai poder
mentir para si mesmo sobre sua vida de maneira mais eficaz do que nunca.
Com o lançamento do Pokémon GO, a RA de repente se tornou lugar-
comum. Não vamos nos aprofundar muito nisso, já que provavelmente não faz
muito tempo desde que você largou livros como este numa prateleira para jogar.
Mas vemos o Pokémon GO como um passo inicial numa tecnologia que tem
outras aplicações além de jogos.
Seus autores estão num grupo que chamamos de A Geração Mais Triste —
jovens o bastante para saber o que é Pokémon, mas velhos o bastante para ficar
confusos e perplexos com a popularidade do jogo. Sendo assim, a RA promete
fazer fantasias de todos os tipos virarem realidade. E, não, nem todas elas têm
cunho sexual. Algumas são sobre vingança ou enriquecimento.
Você poderia alcançar essa RA de várias maneiras e, considerando o número de
sentidos que temos, um sistema de RA perfeito será um tanto complexo.
Atualmente, o método mais comum é usar alguns meios (normalmente um tablet
ou um celular, neste exato momento) para projetar nos seus olhos uma imagem
que está “em registro” com a realidade.
Registro quer dizer simplesmente que o virtual está cooperando com o real.
Por exemplo, se você tiver um coelho em RA na sala, não vai querer que ele fique
correndo para lá e para cá. Ou, se o coelho ficar de um lado para outro na
bagunça da sua casa, você vai preferir que ele pareça ter se machucado.
Isso é muito mais complexo do que pode parecer de início. Imagine que você
adquiriu um headset que projeta RA nos seus olhos. Você olha para uma mesa e
ele projeta uma carta de seu marido imaginário, Brad Pitt, dizendo “Eu amo
você”. Claro, você programou sua RA para lhe deixar essa carta hoje, mas, assim
como um marido que só se lembra de seu aniversário depois de ser avisado na
noite anterior, você ainda assim aprecia o fato de Brad Pitt RA ter lhe deixado
um bilhete.
Quando você vira a cabeça para a esquerda, a carta de Brad precisa ir para a
direita. Ela também tem que mudar o aparente ângulo voltado para você para
corresponder à mesa real. Se estiver ligeiramente fora, a carta vai ficar meio
estranha, a fidelidade será perdida e você se lembrará de que o que está de fato
em cima da mesa é uma ordem de restrição.
Tornar tudo isso realidade é um desafio extremamente difícil, que exige um
ótimo hardware, um ótimo software e uma ótima compreensão do
funcionamento da visão e da cognição humanas.
O hardware está avançando bem. A máquina mais antiga que poderia ser
considerada de realidade aumentada foi criada por Morton Heilig em 1962 e
chamada de Sensorama. Essa máquina era puramente mecânica, não havia um
computador programável envolvido. Enquanto um dispositivo moderno teria um
programa que saberia liberar o cheiro de árvores quando o usuário entrasse em
seu pomar virtual, esse dispositivo tinha cheiros que eram desencadeados de
maneira simples alguns minutos depois que um vídeo começava, correspondendo
ao momento em que o vídeo estava mostrando um pomar.
O Sensorama exibia vídeos através de pequenos portais oculares, enquanto
gerava vento, sons, vibrações e liberava odores químicos, dando ao indivíduo a
sensação de pilotar uma motocicleta, por exemplo. Qualquer um perguntaria por
que você simplesmente não compraria a maldita moto, mas Heilig estava olhando
para o futuro. Na patente que registrou, ele discutia as aplicações para as Forças
Armadas, o entretenimento, a indústria e a educação, que são exatamente os
tópicos discutidos com mais frequência como aplicações para as pesquisas de RA
hoje em dia.
Alguns de vocês talvez se lembrem de que os famosos headsets de realidade
virtual pareciam finalmente estar chegando nos anos 1990, quando computadores
e monitores ficaram mais baratos. Se isso não aconteceu na época, por que
aconteceria agora ou no futuro? Bem, aqueles sistemas dos anos 1990 tinham
problemas. Eram absurdamente caros, as simulações eram bem ruins e, bem...
eles tinham uma tendência a fazer o usuário vomitar. Vomitar é, de fato, um
problema geral dos sistemas de RA e RV. Uma teoria atual sobre o enjoo do
movimento sugere que quando você não sente que está se movendo, mas vê que
está se movendo, seu cérebro conclui que você foi envenenado. Daí a vontade de
correr para o banheiro mais próximo.
O problema do enjoo do movimento fica ainda mais agudo quando a máquina
que cria a realidade falsa é um computador pessoal de 1993. Se você está usando
um headset e vira a cabeça, mas a realidade leva mais de um segundo inteiro para
virar também, seus olhos podem não acreditar que aquilo é real, mas seu
estômago com certeza acredita.
Como a maioria das tendências da década de 1990, a RV foi sabiamente
engavetada. Isso representou um revés para as pessoas interessadas em RA, que
esperavam que os populares headsets de realidade virtual barateassem as
tecnologias relevantes.
Mas, assim como Kelly fez com a maior parte da chamada “música dos anos
1990”, alguns cientistas perseveraram na RA, na esperança de um renascimento.
E, diferentemente de Kelly, eles encontram bons motivos para ter esperança.
Hoje, praticamente todo mundo usa um computador em forma de telefone. Na
verdade, ele é um pouco melhor do que isso. Um smartphone típico não tem
apenas um computador — ele pode tirar fotos, fazer vídeos, detectar a própria
orientação e a gravidade, determinar a posição dele na face da Terra e outras
coisas ótimas. Essas capacidades de detecção são especialmente úteis quando se
tenta sobrepor uma realidade falsa à realidade verdadeira. Além disso, o
smartphone não está isolado como um computador dos anos 1990. Ele pode falar
com outros computadores que têm muito mais memória e processamento.
De certa forma por coincidência, hoje andamos com muitos equipamentos que
um pesquisador de RA gostaria que usássemos. O truque, então, passa a ser obter
o software certo.
Um método primitivo de acrescentar objetos virtuais à vida real era o
“marcador fiducial”. Basicamente, o marcador fiducial é um objeto colocado na
realidade que é fácil para um computador reconhecer de modo visual. Basta
pensar algo como o QR code, hoje em dia muito comum. Suponha que você tem
uma mesa com um código desses no meio. Para simplificar, imaginemos que você
esteja usando um headset de realidade aumentada que projete imagens nos seus
olhos. As câmeras dele veem o código e determinam duas coisas: que o padrão é
um código para “ponha um vaso aqui” e que você está olhando para um QR code
de um ângulo específico.
Quando você se movimenta, o headset detecta a mudança de orientação do
QR code e ajusta o vaso de acordo. Se isso funciona direito, você percebe um vaso
acomodado em cima da mesa, mesmo que você caminhe, pule ou se abaixe. Em
outras palavras, o marcador fiducial serve como uma simples ponte entre a
realidade aumentada e a realidade verdadeira.
As pesquisas de RA atuais vão além dos tradicionais marcadores fiduciais. Na
verdade, talvez como um sinal do rápido progresso, fomos informados de que o
termo “marcador fiducial” deixou de ser apropriado, apesar de ser usado em textos
de apenas alguns anos atrás que encontramos.
Hoje em dia, os programas já têm inteligência para descobrir sozinhos onde
colocar objetos, embora marcadores de vários tipos ainda sejam úteis, porque
fornecem rapidamente muitas informações ao computador.
No entanto, os marcadores têm problemas. Por exemplo, eles podem ser
bloqueados visualmente. Isso não é problema para um vaso de verdade porque...
bem... o vaso ainda está ali, mesmo que você não esteja olhando. Mas imagine
que você se abaixa para que seus olhos fiquem na altura do tampo da mesa e olha
para cima. Do seu ângulo, você deveria conseguir ver o vaso, mas o headset não
consegue ver o marcador. O headset conclui que o vaso não existe mais. Isso é
ruim porque, de modo geral, a maioria de nós gostaria que a realidade
continuasse existindo quando ninguém estivesse olhando.
Dá para resolver esse problema com uma câmera extra ou marcadores
adicionais que orientam o headset, porém, quanto mais coisas forem necessárias,
mais complicada se torna a experiência de RA. Fazer com que a interação entre
os mundos real e virtual seja sutil é crucial para que a experiência funcione.
Uma ótima ideia em RA é a de que você poderia caminhar numa floresta e ter
sua experiência ampliada por conhecimentos sobre a ecologia e a história locais.
Por exemplo, se você passar por uma sequoia-gigante, talvez o computador lhe
diga o que é uma sequoia-gigante. Ao se aproximar, você vê que há uma
samambaia crescendo numa árvore e que ela está cheia de vespas. Seu headset
exibe informações sobre essas coisas também. Ele também lhe diz que, aliás, uma
batalha da Guerra Civil aconteceu nessa floresta em 1864 e lhe oferece a opção
de ver uma reencenação virtual sobreposta na área.
Tudo isso é formidável, mas arruinaria o ânimo (e seria difícil de organizar) se
fosse preciso colocar um QR code em cada objeto pelo qual o usuário poderia se
interessar.
Portanto, uma grande área das pesquisas atuais é entender como usar
marcadores de ambiente comuns para determinar todas as coisas sobre as quais
um QR code poderia lhe dizer. Assim, em vez de pôr marcadores por toda a
Torre Eiffel, você teria um dispositivo que reconhece a Torre Eiffel inteira.
“Calma aí”, você diz. “Vou usar meu GPS. Ele sabe onde está a Torre Eiffel.”
Não. Não vai funcionar. O GPS só diz onde você está sobre a superfície da Terra,
e a precisão dele chega, aproximadamente, a um metro. Uma boa RA exige mais
precisão do que isso. E a precisão do GPS é ainda pior quando se mede elevação.
Então você tenta ativar um guia turístico virtual em Edimburgo, mas ele só
aparece três metros acima. Você olha para cima e de repente deseja que ele não
estivesse usando um traje escocês tradicional.
Mas o GPS é um bom ponto de partida. Ele pode ser capaz de dizer a seu
computador que você está em certo parque ou perto de determinado lago. E
sabemos que o computador deve ser capaz de lhe dizer exatamente onde você está
a partir de pistas visuais. Afinal, isso é basicamente o que os humanos fazem para
se orientar. Quem está perdido num bosque tenta encontrar uma árvore com
aparência distinta ou ver em que direção está um grande ponto de referência
distante. A princípio, um computador pode fazer a mesma coisa. Mas, embora
um humano possa determinar com razoável rapidez o que é “distinto”, é difícil
explicar o conceito de distinção a uma máquina.
Uma abordagem é a seguinte: imagine que você esteja caminhando perto do
edifício Empire State. Seu computador sabe mais ou menos onde você está, mas,
para projetar um gorila gigante no edifício, precisa saber suas exatas coordenadas
espaciais e para onde você está olhando. Então, para mapear seu campo de visão,
ele tira uma foto. Em seguida, divide essa foto em seções. Ao procurar variações
de intensidade, ele decide quais partes são interessantes e quais não são.
Por exemplo, se o computador pega um quadrado que é todo céu,
provavelmente não há variação nenhuma. Isso diz ao computador que esse ponto
não é “interessante”. Por outro lado, se ele pegar uma parte com uma janela,
haverá luzes, áreas de sombra e formas geométricas. Isso talvez seja interessante.
Então o computador compara essa imagem com uma base de dados de outras
imagens, que (graças ao GPS) são tidas como pontos de referência próximos.
Fazendo isso repetidas vezes conforme você se movimenta, o computador acaba
se assegurando de sua posição exata, bem como da orientação da câmera dele.
Pode parecer um método estranhamente artificial, porém é mais ou menos o que
você também faz para se localizar. Quando estamos perdidos, não usamos o céu
diurno como referência para nossa posição porque um grande espaço azul não
fornece muita informação específica sobre onde estamos. Poderíamos usar o céu
noturno como referência, porque as estrelas e a posição delas no céu contêm
informações sobre nossa localização. Não utilizamos o chão como referência
quando tentamos nos orientar, mas levamos em conta a nossa distância em
relação a um prédio distinto. Você está tão acostumado aos lugares aonde vai com
frequência que faz tudo isso de forma automática, mas tente lembrar como seu
cérebro resolveu as coisas da última vez que você voltou para sua cidade natal
depois de passar muito tempo fora.
Parte do problema dessa abordagem é que ela exige muita computação e uma
quantidade enorme de imagens de referência para comparar com suas fotos
“interessantes”. Então cientistas estão trabalhando em outras soluções para
simplificar o processo.
A dra. Caitlin Fisher, do Augmented Reality Lab, da Universidade de York,
sugeriu que pode haver um caminho mais fácil a seguir, pelo menos para algumas
aplicações. “Os artistas”, diz ela, “usam uma realidade misturada que evita o
problema do registro. Você pode ter imagens que podem apenas flutuar ou estar
no céu, ou pequenas imagens no chão. O problema do registro é urgente, mas não
é preciso superá-lo em todas as boas experiências de realidade aumentada (...)
Acho que um dos motivos pelos quais percebemos que muitos projetos iniciais
envolvem fantasmas ou espíritos é que não é preciso tê-los perfeitamente
registrados no mundo real para, ainda assim, garantir uma experiência muito boa.
A coisa pode estar flutuando [e] as pessoas não necessariamente vão dizer ‘ah,
que malfeito”, elas vão falar ‘uau, é um fantasma’”. Não cremos que estamos
virtualmente cercados por fantasmas, mas pode ser divertido pôr à prova crianças
inocentes.
Esse é o tipo de coisa boa para projetos mais artísticos, mas, por exemplo, se
estiver usando um aplicativo de RA para fazer uma cirurgia, não pode dispor de
marcadores de incisão virtuais que se distanciem muito do ponto certo.
Uma forma de obter uma detecção de localização melhor sem fazer seu
computador chorar é ter sensores melhores. Uma tecnologia chamada LiDAR
(light + radar = LiDAR) rebate luzes de laser em objetos e depois analisa o
reflexo. A LiDAR pode gerar modelos em 3D precisos do ambiente, exatamente
o que esperaríamos ter para fazer uma experiência de realidade aumentada. Em
vez de comparar um universo de imagens em 2D cheias de falhas, obtemos o
contorno dos prédios locais e o comparamos com um único arquivo em 3D.
Parece ótimo! O problema é que, historicamente, isso é supercaro. Do tipo que é
usado apenas em iniciativas enormes e dispendiosas do governo.
Mas com o passar do tempo o custo diminuiu. Na verdade, um dos motivos
pelos quais os carros autônomos estão começando a chegar ao mercado é que
você pode adquirir um sistema LiDAR decente para sua van por apenas alguns
milhares de dólares. O inconveniente é que os mais leves ainda pesam entre cinco
e dez quilos.
Ainda assim, a tecnologia para RA visual está avançando bem. “Mas”, você
intervém, “e os meus outros sentidos? QUERO OUVIR UM CANTO DE
PASSARINHO QUANDO EU VIRAR ESTA PÁGINA!”
Bem, antes de tudo, pare de gritar. Que infantilidade. Em segundo lugar, bem,
a maioria das pesquisas atuais é sobre tecnologia visual. Os humanos estão
realmente dando uma olhada nisso.
No entanto, alguns cientistas e engenheiros estão trabalhando em tecnologias
de áudio, cheiro e tato.
O áudio é relativamente simples se comparado ao vídeo, mas apresenta suas
próprias dificuldades. Imagine que você queira simular o som de um carro
passando. Há três grandes questões: a primeira é que o som precisa atingir um
ouvido antes do outro, dando uma sensação de localização do carro. A segunda é
que o som precisa mudar de tom e intensidade, passando a impressão de
movimento. A terceira, e é aí que tudo realmente se complica, é que o som do
carro deve (literalmente) refletir o ambiente onde ele está. Portanto, se você
estiver num cânion, os sons do carro devem fazer eco. Se estiver num campo, não
devem. Isso nos leva de volta a muitas questões discutidas para vídeo: para uma
RA melhor, é necessário ter mais informação e computação.
O cheiro é bem complicado. Com luz e som, há componentes elementares
simples. Para produzir qualquer cor, você só precisa de comprimentos variados de
ondas de luz. Para produzir qualquer som, só precisa da forma de onda e do
volume certos. Os cheiros são bem mais diversos e complexos. Mesmo que você
tivesse um enorme conjunto de cheiros pré-carregados, nem sempre é possível
misturá-los para produzir algo novo. Por exemplo, “cheiro de maçã” e “cheiro de
casca de torta” juntos não são exatamente iguais a cheiro de “torta de maçã”.
Em princípio, você poderia ter uma máquina que customizasse moléculas
manufaturadas rapidamente e borrifasse-as no ar. Existem, de fato, máquinas que
podem gerar moléculas feitas por encomenda. Mas hoje em dia esse processo é
caríssimo, usado para propósitos industriais. E, embora a RA visual e talvez a
auditiva possam ter muitas aplicações claras, não é tão clara assim a utilidade que
os cheiros virtuais teriam.
O sentido do tato é um pouco mais ativo como área de pesquisa, mas o
progresso nessa área é ainda bem limitado. Grande parte das pesquisas de hoje
em dia é sobre uma “caneta tátil”, que você possa usar para “tocar” objetos
virtuais. A ideia básica é usar um headset para ver uma coisa virtual e ter uma
caneta conectada a um computador que sabe onde esse negócio virtual está. Se
você tenta furar o objeto virtual com a caneta, a máquina não deixa. Se você
arrastar a caneta pela superfície, ela oscila, então os dedos que a seguram têm a
sensação de que arrastaram uma caneta por uma superfície texturizada. Está bem,
não é tão legal quanto ter um feedback de tato ao dar um soco virtual na cara do
Hitler, mas esfaquear com uma caneta chega em segundo lugar por pouco. Além
disso, tem algumas aplicações reais, como treinar para uma cirurgia ou para fazer
esculturas digitais.
Em que pé estamos agora?
Muitas fontes que consultamos sobre esse tópico foram escritas entre 2010 e
2014. As mais recentes tendem a ficar bem animadas com o potencial do Google
Glass de mudar tudo à nossa volta. Ops!
Em geral, há um consenso de que o Google Glass fracassou porque quando as
pessoas veem você usando um, elas querem dar um soco na sua cara. Não, é
verdade. Por exemplo, em 2013, o CEO do Meetup.com disse exatamente o
seguinte a repórteres do Business Insider: “Google Glass? Pode ter certeza de que
vou dar um soco na cara de quem estiver usando Google Glasses.”
Uma característica preferível no futuro da RA é, portanto, um visor que não
leve a pessoa a tomar um soco na cara dado por milionários da tecnologia. O
truque aí pode ser a miniaturização.
A Innovega é uma empresa que está trabalhando em lentes de contato de RA.
No entanto, as lentes de contato não fazem todo o trabalho sozinhas. Na verdade,
é preciso usar um par de óculos especiais sobre as lentes de contato. O lado
positivo é que, diferentemente do Google Glass, parece realmente um par de
óculos.
Em geral, os sensores e os sistemas de computação estão ficando mais baratos,
mais rápidos e menores. Isso abre um terreno fértil para projetos experimentais,
que são muitos.
O dr. Mark Billinghurst, atualmente na Universidade de Canterbury, propôs
um conceito chamado “livro mágico”. A ideia é que as imagens de um livro
funcionem como uma máquina de RA para aprimorar a experiência. Um grupo
da Universidade de Nebraska criou um “livro mágico” chamado Ethnobotany
Study Book [Livro de Estudos de Etnobotânica], com pequenos desenhos em
preto e branco de plantas locais. Quem olhasse um desenho através da máquina
de RA veria uma versão virtual da planta saindo na página.63
O dr. Jonathan Ventura, da Universidade do Colorado, criou um programa de
realidade aumentada quando era estudante de PhD na Universidade da
Califórnia em Santa Barbara (UCSB). Era um programa feito para funcionar ao
ar livre, que permitia acrescentar elementos como espaçonaves e árvores à
percepção do campus da universidade. De acordo com o dr. Ventura, “montei um
sistema em que eu mapeava, por exemplo, o campus da UCSB com muitas
imagens e basicamente criava um modelo em 3D do campus. Então eu podia
pegar um iPad, erguê-lo, tirar uma foto dos arredores, combiná-la com o modelo
e então descobrir exatamente onde o aparelho estava”.
Para nós, o trecho “elementos como espaçonaves ou árvores” significa
“espaçonaves”. O dr. Ventura é um pouco mais pragmático. Ele observa que
programas como esse poderiam ser ferramentas muito úteis para paisagistas, que
conseguiriam projetar virtualmente um ambiente e mostrá-lo ao cliente antes de
iniciar a construção.
O dr. Gerhard Schall, da Graz University of Technology, criou um sistema de
RA em que trabalhadores de manutenção podem obter uma “visão em raio X” da
infraestrutura da cidade. Por exemplo, eles podem olhar para a rua e ver os
sistemas de eletricidade e encanamento subterrâneos. Sistemas como esse têm
potencial para serem aplicados em muitas áreas, não apenas para a manutenção
como também para o socorro em desastres.
Tendo uma projeção virtual de como se espera que as coisas sejam, um
socorrista seria capaz de avaliar os danos com mais rapidez. Por exemplo, um
indicador para decidir se um prédio está muito danificado é o “deslocamento
entre andares”. Ou seja, numa escala que vai do edifício Empire State à Torre de
Pisa, quanto estamos ferrados? Determinar a inclinação de um prédio é meio
difícil, sobretudo depois de um terremoto, quando os equipamentos são escassos
e o tempo para avaliar cada edifício é limitado. O sistema de RA proposto pelo
dr. Suyang Dong projetaria sobre uma construção danificada a aparência que ela
deveria ter, permitindo aos inspetores fazer uma avaliação rápida e precisa.
Uma ideia na qual vários grupos têm trabalhado é uma “interface de espelho
virtual”. Sabe aquele medo que você tinha quando era criança de olhar no espelho
e ver outra pessoa dentro dele? E se pudéssemos ter isso de verdade? O conceito
existe desde os anos 1990 como uma versão relativamente simples de RA, já que
só é preciso projetar através do espelho e saber como os elementos da sua casa
estão distribuídos. A ideia, além do fato de ser ótima, é que você poderia ter um
ajudante ou bicho de estimação virtual que “mora” no espelho. Então o espelho
age como uma espécie de janela para uma realidade aumentada. Pessoalmente,
achamos a ideia um tanto assustadora. Não existe um mundo em que você passa
pelo espelho a caminho do banheiro à noite, vê pelo reflexo um cara sentado no
sofá e pensa: Tudo bem.
Convenhamos, é bem provável que os ajudantes serão uns amores. Pelo menos
até eles nos traírem na Revolta dos Robôs de 2027.
O Fisher Lab (lembra-se da senhora dos fantasmas?) explora o uso da RA para
contar histórias. Por exemplo, como a RA pode ser usada para fazer filmes nos
quais conseguimos entrar? Ou como utilizar a RA para dar vida a lugares e
personagens históricos? Imagine passar por lugares ao longo da Underground
Railroad64 [Ferrovia Subterrânea] vendo atores virtuais contando histórias sobre
seu cativeiro como escravos e sua fuga. Imagine visitar o local da Batalha da
Floresta de Belleau e ver a ofensiva de 1918 diante de seus olhos. Ou imagine
visitar o Coliseu e ver o rosto contorcido do gladiador enquanto Nero não
demonstra nenhuma piedade.
A dra. Fisher também dá as melhores festas de aniversário infantis da história,
o que inclui chapéus seletores ao estilo Harry Porter em RA, fadas voando sobre
pedras no jardim e pó de fada sendo colocado nas mãos das crianças. Ela observa,
porém, que a imaginação infantil provavelmente não precisa de aumento: “Acho
que crianças pequenas não precisam de realidade aumentada tanto quanto nós
precisamos para voltar a pensar como crianças pequenas. Acho que há práticas
incríveis e alegres que poderíamos adotar. Nesse pequeno nível, acho que isso por
si só poderia tornar nossas vidas maravilhosas.”

Algumas pessoas têm tentado usar a realidade aumentada por motivos


terapêuticos. Nossa terapia experimental favorita é a da dra. Cristina Botella, que
teve a ideia de que é possível curar fobias usando RA. Entenda, uma das
melhores maneiras de superar medos irracionais é a exposição constante a esse
medo. Mas há um problema. Quando você pega uma pessoa que tem medo de
barata e a faz entrar várias vezes numa caixa cheia de baratas, ela talvez conclua
que é hora de procurar um novo psiquiatra. Ou, como dizem os cientistas, você
terá um “alto índice de atrito”. A dra. Botella se perguntou se você poderia fazer
concessões e simplesmente projetar hordas de insetos horripilantes nos olhos do
paciente. O estudo que lemos contou com apenas seis participantes, mas todos
eles pareceram sair da experiência com um nível de fobia reduzido, resultado que
foi mantido com o passar do tempo. É claro que talvez eles só tenham dito isso
com o intuito de fazer a dra. Botella parar.
Por fim, ficamos particularmente animados com o Capacete Inteligente da
DAQRI. Os inovadores da DAQRI fizeram uma observação interessante:
capacetes podem ser modificados para incluir RA sem que se mude
fundamentalmente nada neles. O sensor e os computadores estão inseridos no
capacete e os recursos visuais são exibidos no protetor dos olhos. Talvez o Google
Glass devesse seguir o exemplo da DAQRI: se você usar um capacete de trabalho
junto com seu computador, não ficará parecendo um idiota. Além disso, se o
CEO do Meetup.com tentar lhe dar um soco na cara, você terá uma proteção.
Esses Capacetes Inteligentes têm potencial para nos tornar muito mais
eficientes e talvez salvar muitas vidas. Falamos com Gaia Dempsey, da DAQRI, e
ela nos contou sobre um estudo recente, feito pela DAQRI, pela Boeing e pela
Universidade Estadual de Iowa, comparando o treinamento com RA ao
treinamento tradicional. “Comparamos instruções dadas em manuais de papel a
instruções em realidade aumentada para uma tarefa de montagem complexa.
Essa tarefa específica era um processo de mais de cinquenta passos para a
montagem de uma ponta de asa de avião feita por trainees iniciantes. O grupo
que recebera instruções em realidade aumentada conseguiu reduzir em 30% o
tempo de conclusão do trabalho e em 94% o índice de erros na primeira
tentativa. Na segunda tentativa, os erros caíram para zero, o que é
impressionante.” Os autores deste livro têm uma forte preferência por erro zero
em qualquer processo relacionado a montagem de aviões.

Preocupações
É possível que a esta altura lhe tenha ocorrido que ter todos os humanos
equipados com uma gama de sensores constantemente ativos se comunicando
com servidores centralizados pode, talvez, suscitar alguns problemas de
privacidade.
Lemos sobre um software chamado Recognizr, que detecta os traços de
pessoas, transforma o rosto delas em modelos em 3D e depois as reconhece. Por
ora, o Recognizr é opt-in. A ideia em muitos softwares desse tipo é trazer a mídia
social para a vida real. Há um belo potencial aqui — imagine que você vai para o
trabalho e pequenos visores acima da cabeça de seus colegas lhe dão informações
do tipo: se aquele é o dia do aniversário de algum deles ou se eles acabaram de
voltar de uma viagem. O aspecto negativo é que todas as preocupações com
privacidade na mídia social acabam entrando na vida real também. Se muita
gente tiver um software de rastreamento de rosto, por mais dispersados que os
dados estejam, uma pessoa mal-intencionada poderia reconstituir todos os
lugares aonde você foi durante o dia e talvez até dar bons palpites sobre seu
estado emocional.
Vai piorar. Lembre-se, a perfeita máquina de RA não apenas rastreia e
armazena dados visuais. Ela escaneia tudo em 3D. Ela cheira. Ouve. Uma grande
parte do comércio moderno conta com empresas que têm acesso a uma
quantidade enorme de dados. É por isso que a Amazon e o Google podem lhe
dizer o que você quer antes que você saiba. Mas como será que nos sentimos em
relação a um mundo no qual uma câmera termal detecta que você está um pouco
quente e suando e faz um pop-up de um anúncio da nova bebida gelada de sei lá
quais frutas do Starbucks? Ou talvez um scanner de rosto tenha notado que você
está fazendo muitas caretas em determinado dia e recomende: “Pergunte a seu
médico sobre Zoloft.”
Até as boas qualidades da mídia social carregam consequências estranhas
quando levadas para a vida real. Com a RA, seu chefe “sabe” que é seu aniversário,
ou que seu casamento acabou recentemente, ou qual é o seu programa de TV
favorito. Ele sabe tudo isso porque tem óculos de RA sutis, que projetam dados
de seus perfis na internet acima da sua cabeça. Isso é uma preocupação por dois
motivos: primeiro, porque está, de certa forma, redefinindo o que significa “saber”
algo. A essa altura, todos nós estamos acostumados à ideia de que fulana se
lembra do seu aniversário porque o Facebook disse a ela, mas, e se for mais do
que apenas aniversários? Há algo de perturbador num mundo onde grande parte
do conhecimento prático de alguém sobre você é externalizado e projetado num
visor. E quem não tiver óculos de RA viverá uma tremenda assimetria de
informações em relação às pessoas que têm.
Como a assimetria de informações é um assunto importante numa guerra (em
especial numa guerra moderna), uma ideia é dar esse tipo de software a tropas de
paz. Suponha que o trabalho de um soldado é policiar uma vila. Seria de muita
valia se ele tivesse óculos que pudessem reconhecer rostos e mostrar estatísticas
em seu visor. Agora ele é um soldado que se lembra do nome e sabe as
necessidades de cada morador da vila, sem contar religião, política e círculos de
amizade. Será que isso torna o soldado menos ou mais empático? E,
independentemente do efeito sobre o militar, como os moradores da vila se
sentem?
Um tópico com o qual nos deparamos várias vezes em nossa pesquisa é a
noção de “realidade diminuída”. A intenção é que certas vezes o indivíduo
gostaria de receber menos dados sensoriais reais. Em alguma medida, a RV de
imersão total faz isto: bloqueia por completo a realidade real. A RA é mais que
uma mistura. Em princípio, você deve ser capaz de girar uma maçaneta entre a
realidade total e a virtualidade total. Com certeza há bons usos para esse tipo de
coisa — pessoas com distúrbios de ansiedade ou distúrbios desencadeados por
trauma podem desejar atenuar certos tipos de experiência sensorial. Mas a
realidade diminuída talvez adquira um sentido sinistro em contextos nos quais é
preciso fazer escolhas difíceis. Por exemplo, será que você poderia bloquear
mendigos em seu caminho para o trabalho? Ou será que um soldado numa zona
de combate poderia bloquear a emoção no rosto de combatentes inimigos?
Uma noção fundamental da RA é que seus usuários devem ter acesso a uma
enorme quantidade de dados sobre o mundo. Isso se dá sobretudo em RAs muito
avançadas, em que todo tipo de modificação é feito no mundo. Considere o
simples caso de uma experiência de RA em que todos os esquilos estão
constantemente atirando abelhas pelos olhos. Não basta um computador capaz
de reconhecer esquilos e rastrear o movimento deles em relação aos seus; para
realmente completar a ilusão, você deve, de vez em quando, ver abelhas saindo de
trás de uma árvore ou de uma cerca, por exemplo. É preciso ter bons sensores
para fazer isso, ou câmeras de algum tipo por todo o lugar. Em outras palavras,
uma experiência de imersão maior num mundo de RA exige mais dados sobre a
realidade. Se a RA se tornar popular, poderá levar a uma pressão sobre o
consumidor por cada vez menos privacidade. E, independentemente de como os
consumidores vão se sentir, haverá muito mais informação nas mãos de
corporações e governos.
O dr. Alan Craig, da Universidade de Illinois em Urbana-Champaign,
apontou outra preocupação: quem assume o controle sobre o que é projetado, e
onde? Por exemplo, vamos supor que você tenha uma loja. Alguém num sistema
de realidade aumentada muito popular faz um grafite em sua parede: “O dono
dessa loja é otário e sem-vergonha.” Vamos partir do pressuposto de que isso não
seja verdade. Você tem o direito de “remover” isso do mundo aumentado? Afinal,
isso não está tocando nada que você tem.
Enquanto terminávamos este livro, a preocupação do dr. Craig deixou de ser
hipotética. Um dos ginásios do Pokémon GO (um lugar aonde o jogador vai para
obter itens gratuitos) foi parar em um Museu do Holocausto, e o museu teve que
pedir aos jogadores que, por favor, parassem de jogar num museu cujo propósito é
homenagear as vítimas do Holocausto.
Posteriormente, pessoas estavam procurando Pokémons em Auschwitz. De
início, nós nos perguntamos se aquilo era um pequeno descuido por parte dos
memoriais do Holocausto. Depois vimos um artigo no The Telegraph intitulado
“Hiroshima se irrita com Pokémon em Parque Memorial da Paz”. Então... pelo
menos os ofensores atacam os dois lados.
O dr. Craig observou que a RA pode ser hackeada. Portanto, se e quando o
Pokémon GO resolvesse essa questão em que um Squirtle está violando a
santidade dos mortos, pessoas mal-intencionadas ainda poderiam criar
problemas. Também poderiam trazer perigo. E se você estiver usando óculos de
RA enquanto dirige e um hacker enviar um pterodáctilo dando um rasante em
direção a seu carro, levando você a se desviar por reflexo? Seria incrível, claro, mas
provavelmente você estaria morto. Se a RA é onipresente, sua percepção da
realidade é hackeável, bem como a percepção das pessoas e dos grupos à sua
volta.
Por fim, será que isso chega a um ponto em que perdemos de vista o que é
artificial e o que é verdade? O dr. Craig disse que os filmes atualmente são uma
mistura de imagens reais e imagens geradas por computador, e com frequência
são tão bem-feitos que não conseguimos distinguir a realidade da ilusão. Pode a
RA ficar tão refinada que um dia andaremos por aí sem saber quais aspectos do
nosso ambiente fazem parte do mundo real e quais são apenas projeções? Isso
tem importância?

Como isso mudaria o mundo


É claro que a ideia mais popular é a de que a RA vai revolucionar o
entretenimento. A capacidade de trazer mágica para a realidade presenteia os
artistas com uma janela de oportunidades totalmente nova. Em princípio, novos
mundos infinitos cada vez mais complexos poderiam fazer parte deste mundo,
mas é difícil saber como uma nova tecnologia moldará o futuro da arte, em
especial conforme a RA se torna um meio mais sério.
Uma possibilidade estimulante é a melhoria da educação. A tecnologia da RA
permite a interação com entidades conceituais, o que poderia ser especialmente
útil em campos nos quais o assunto é de difícil visualização. Conceitos
tridimensionais da física com frequência confundem os estudantes, mas eles
aprenderiam mais depressa se pudessem provocá-los, visualizá-los ou talvez até
tocá-los. Imagine uma aula de química em que interações atômicas são mostradas
como um objeto virtual na sua frente.
O dr. Craig trabalhou com a Escola de Veterinária da Universidade de Illinois
para criar uma vaca de fibra de vidro em tamanho real. Ao observar a vaca através
de um smartphone com um aplicativo, é possível ver onde estão localizados os
órgãos internos do animal. É uma ferramenta incrível para estudantes de
veterinária, que podem visualizar a localização dos órgãos em três dimensões.
Ao longo da história humana, diminuímos aos poucos o trabalho do nosso
cérebro. A escrita nos permitiu parar de memorizar tudo. Os sistemas de
arquivamento fizeram com que não precisássemos nos lembrar da localização das
informações. Os sistemas de busca modernos simplificaram grande parte do
trabalho de pesquisa. Uma RA bem-sucedida pode significar que toda uma
constelação de atividades mentais pode ser transferida para máquinas.
Por exemplo, quando sua impressora precisa de reparos, você provavelmente
encontra um manual na internet e o explora até entender o que está fazendo. Um
sistema de RA pode simplesmente lhe mostrar as instruções passo a passo à
medida que você avança. Dessa forma, você realiza a tarefa com mais êxito e
rapidez. Uma abordagem semelhante pode ser transposta para a culinária ou para
a construção.
Pode não parecer muita coisa, mas tem chance de representar um enorme
ganho de eficiência em muitas áreas. Trabalhadores poderiam ser treinados com
mais agilidade e evitar situações perigosas no ambiente de trabalho.
Possivelmente, uma máquina de RA poderia até tornar um especialista melhor
em seu trabalho. Por exemplo, em uma obra, um capacete de RA poderia alertá-
lo para uma mudança estrutural perigosa, mas sutil e difícil de perceber.
A RA também pode ganhar terreno na medicina. Aplicativos de anatomia
como o iminente Project Esper, do Complete Anatomy Lab, seriam ferramentas
úteis para alunos de medicina. Há também usos mais importantes. Uma empresa
chamada Illusio desenvolveu um programa que promove o aumento virtual de
seios. Mulheres interessadas em cirurgia de mama têm a chance de ver um
“reflexo” virtual deles, que podem ter as medidas ajustadas para ficarem mais ou
menos empinados ou separados um do outro. Talvez devessem considerar a venda
de uma versão para uso doméstico.
Piadas à parte, há uma utilidade nessa empreitada. Para quem precisa de uma
cirurgia plástica, obter uma visão compartilhada entre paciente e médico pode
poupar muitos problemas.
Outros aplicativos até seriam usados durante cirurgias. Se um cirurgião
pudesse projetar a imagem do exame de ressonância magnética sobre o corpo do
paciente enquanto o opera, teria condições de fazer incisões menores e mais
precisas. Poderia também projetar a aparência anterior sobre o corpo de uma
pessoa, após um acidente que a desfigurou, e essa projeção permitiria cirurgias de
reconstituição mais precisas.
Emergências em um conflito armado ou em áreas rurais de países pobres
podem exigir cirurgias especializadas e imediatas, para as quais os cirurgiões
locais não foram treinados adequadamente. A RA tem potencial para ajudar
nisso. Estão sendo criados programas em que cirurgiões especializados no
procedimento necessário podem orientar um cirurgião distante de forma remota.
Eles podem até “desenhar” sobre o campo de visão do cirurgião se ele estiver
olhando através de uma tela apropriada. Embora a pessoa sob o bisturi talvez
preferisse que o especialista estivesse na sala, a segunda melhor coisa quando o
tempo é curto pode ser ter o especialista desenhando uma grande seta para o
cirurgião em ação e dizendo “corte aqui!”
Em geral, a RA tem potencial para garantir uma aquisição rápida de
habilidades que antes exigiam uma quantidade enorme de treinamento. Isso
aumentaria radicalmente a eficiência e salvaria vidas em situações em que o
trabalho que está sendo feito é perigoso se houver erros.
No melhor cenário, a RA nos oferece a oportunidade de refazer o mundo da
forma como ele é em nossa imaginação. À medida que a humanidade trocou as
savanas por arranha-céus, descartamos muitos mitos e sonhos que, embora falsos,
nos traziam conforto. Mas, com a tecnologia certa, podemos colocar dragões no
céu ou ter uma dança de fadas no jardim. Podemos passear por mundos
imaginários de pessoas queridas e explorar facetas da nossa personalidade.
Podemos até, em certo sentido, trazer os mortos de volta.
Portanto, vamos tentar não odiar tanto o Google Glass, tudo bem?

Nota bene sobre o Ciclo Nasal


Então Zach estava lendo alguma coisa sobre realidade aumentada quando
percebeu uma coisa: os humanos têm dois olhos e dois ouvidos, que nos dois
casos nos ajudam a determinar a posição de elementos à nossa volta. Ter dois
olhos a uma pequena distância um do outro nos permite ver coisas de dois
ângulos ligeiramente diferentes. Seu cérebro combina as duas visões para lhe dar
a imagem mais tridimensional do mundo, o que ajuda você a descobrir a que
distância está um objeto à frente. E ter dois ouvidos ajuda a descobrir de onde
um barulho está vindo. Se um ruído soa mais alto no ouvido direito, então é
provável que esteja vindo de algum lugar à sua direita. Mas há outra coisa dupla
no seu rosto — a narina. Ele se perguntou: será que ter duas narinas, em vez de
uma, ajuda a localizar de onde um cheiro está vindo?
Como bons pesquisadores, fomos primeiros ao Twitter. Ele disse que
estávamos errados e que éramos burros. Então ficamos mais motivados, os fatos
estando ou não do nosso lado.
Para encurtar a história, estávamos bem errados, mas talvez um pouco certos
quando se trata de alguns animais. Acontece que alguns bichos, como os cães,
podem colher amostras de ar separadas em cada narina e são capazes de comparar
essas amostras para descobrir de onde o cheiro vem. Além disso, Kelly conhecia
um artigo que sugeria algo como uma percepção profunda pelo cheiro em cobras.
A cobra estica para fora sua língua bifurcada para colher substâncias químicas na
saliva. Em seguida, esfrega a língua em duas depressões no alto da boca. A saliva
então é sugada por pequenos bulbos que formam o órgão vomeronasal, onde as
substâncias químicas da saliva são processadas.
Muitos animais, como camundongos, cachorros e cabras, têm esse órgão. Mas
só as cobras e os lagartos têm a língua bifurcada. O autor desse artigo, o dr. Kurt
Schwenk (cujo sobrenome daria um ótimo verbo para “colher amostras de odores
com uma língua bifurcada”), mostrou que a ponta bifurcada permite detectar dois
pontos num rastro de odor e compará-los para determinar o caminho a seguir.
Também é possível, mas ainda não confirmado, que as cobras usem a língua para
colher amostras de dois pontos no ar a fim de saber de que direção um cheiro
está vindo.
Você provavelmente não percebe, porque é automático, mas quando quer
descobrir de onde um cheiro bom está vindo, você vira a cabeça para um lugar,
cheira, depois a vira para outro lugar e cheira de novo. Isso porque sua língua sem
graça não é bifurcada e, portanto, é incapaz de schwenk.
Em nossa vã tentativa de encontrar uma percepção profunda de cheiros em
humanos, nos deparamos com a incrível literatura sobre o ciclo nasal. Você já
sabe intuitivamente, mas é provável que não tenha parado para pensar nisso: em
qualquer momento, a maior parte de sua respiração é através de uma narina
“ativa”. Ao longo do dia, suas narinas alternam qual delas está ativa, geralmente se
revezando a cada período que varia de duas a oito horas. Então por que duas? Por
que não uma megamarina grandona?
Vamos falar sobre sua escada rolante mucociliar. Sim, você tem uma escada
rolante no corpo, cujo principal usuário é o muco. Ela é “mucociliar” porque os
cílios (imagine pequenas cerdas) do seu corpo fazem a subida. Em particular, eles
movem o muco para a boca para que você possa engoli-lo ou expeli-lo.65 Isso
mantém seu nariz limpo para respirar e cheirar, além de manter seu sistema
respiratório inferior relativamente esterilizado.
Mas se você estiver usando apenas uma narina para a maior parte da sua
respiração na maior parte do tempo, sua escada rolante de muco acabará secando.
Se secar, a escada rolante não funcionará tão bem, e o tecido nasal sensível pode
ficar machucado. A solução? Alternar as narinas.66
Em qualquer determinado momento, uma das narinas está mais preparada
para receber ar do que a outra. Isso é feito por seus “sinusoides venosos”, que
ficam inchados, um de cada vez, num processo chamado “ciclo nasal”. Usamos o
termo “inchado” deliberadamente. Um estudo67 se refere aos sinusoides venosos
como “um tecido esponjoso, semelhante ao tecido erétil”.68 Alternar as narinas
significa que uma delas está sempre fazendo um intervalo daquilo que o dr.
White chama de “tarefas de condicionador de ar e limpeza da casa”.
Pelo menos um autor propõe que o ciclo nasal é regulado como uma defesa
contra doenças. Basicamente, seu “tecido erétil dentro do nariz” está trabalhando
horas extras para fabricar fluidos a fim de proteger você contra mais coisas ruins
em seu ambiente.
Nós nos aprofundamos bem nesse negócio de nariz, mas nossa descoberta
favorita foi a literatura aparentemente extensa sobre os efeitos cognitivos da
Respiração Unilateral Forçada por Narina. De acordo com o dr. White, “pense
nisso como forçar o ciclo nasal para que o fluxo de ar seja dominante num lado
escolhido. Isso influencia o hipotálamo, que controla muitos outros sistemas
físicos e neurológicos”.
O ponto principal é o seguinte: foram realizados muitos experimentos em que
universitários foram forçados a respirar por apenas uma narina e depois
examinados. Há evidências, pelo visto razoáveis, de que a narina pela qual você
está respirando no momento pode afetar seu desempenho em testes de
inteligência e testes emocionais. Vários estudos também encontraram associações
entre a narina ativa no momento e a ocorrência de alucinações e episódios de
esquizofrenia.
Continuamos um pouco céticos, mas totalmente satisfeitos enquanto
imaginávamos o que foi feito com esses jovens estudantes ingênuos.

63. Se você estiver curioso para saber como seria isso, adivinha só? Você está lendo um livro mágico NESTE
EXATO MOMENTO. Acesse http://www.SoonishBook.com [em inglês] para baixar um aplicativo grátis
que fará uma estrutura familiar sair virtualmente da capa.
64. Rede de rotas e abrigos clandestinos existente nos Estados Unidos entre os séculos XVIII e XIX usada
pelos escravos afro-americanos que fugiam dos estados escravocratas com a ajuda de abolicionistas. (N. da.
E.)
65. De acordo com o dr. David White, que teve a gentileza de ler nossos trechos sobre muco, “as vias aéreas
produzem em torno de dois a três litros de muco a cada 24 horas. A maior parte é engolida e serve para
ajudar no revestimento de muco do intestino”.
66. Há um bocado de trabalhos científicos sérios a respeito. Um estudo (White et al., BioMedical
Engineering OnLine 2015, 14, p. 38) é um complexo modelo matemático do nariz, que usou uma máquina de
ressonância magnética. E dizia: “Esse modelo considera as duas complexas cavidades nasais uma série (k) de
tubos de diâmetro hidráulico variado alinhados...”
67. Eccles, European Respiratory Journal 1996, 9, pp. 371-376.
68. Se algum de vocês está lendo isto com o nariz entupido, pedimos desculpas.
8.

Biologia sintética
É mais ou menos como Frankenstein, só que o monstro passa o livro
inteiro fazendo remédios e insumos industriais obedientemente

Nós, humanos, temos mexido na biologia há muito tempo. Na verdade, adoramos


fazer isso.
Temos alterado geneticamente a biologia, incluindo os alimentos que
comemos, há pelo menos dez mil anos. Se você olhar nossos primos primatas, a
comida deles costuma ser cheia de sementes e rica em fibras, enquanto nossos
alimentos favoritos são coisas como bolo, cerveja e bolo de cerveja69 — sem ligar
para a transferência de calorias.
Ficamos muito bons em alterar a biologia. No passado, pegamos uma única
espécie, chamada Brassica oleracea, e a transformamos em todo tipo de verdura
que você odiava quando criança — couve-de-bruxelas, couve-flor, brócolis,
repolho, couve-crespa, couve-rábano, couve-manteiga. SIM. Todas são uma
espécie só, modificada aos poucos ao longo de gerações para assumir mil formas
de sabor razoável, cada uma delas exigindo mais queijo do que a anterior.
Fazemos isso com os animais também. Você se lembra de quando pegamos o
nobre lobo — espírito da floresta e da tundra — e o transformamos num rato
tenebroso de olhos esbugalhados, que depende da socialite loura mais próxima
para se alimentar e usar um suéter cor-de-rosa? Não há maior expressão do
domínio do homem sobre a natureza.
Todas essas grandes mudanças ocorreram porque os humanos começaram a
controlar a reprodução da vida ao redor deles no intuito de ter mais qualidades de
que gostamos e menos qualidades de que não gostamos. Quando fizeram isso,
eles estavam alterando o DNA dessas espécies sem saber. Mas nossos ancestrais
alteravam o DNA de maneira incrivelmente lenta, proporcionando pequenas
mudanças ao longo de muitas gerações e revolvendo características que já
existiam.
Depois que passamos a entender melhor o DNA, começamos a tentar
manipulá-lo. Por exemplo, existe a jardinagem atômica. A ideia básica é pegar
uma substância radioativa e cultivar o jardim num ciclo em torno dela. Você
causará mutações em todas as plantas ao redor a uma velocidade maior,
aumentando a chance de encontrar algo realmente legal. Só para ficar claro, expor
plantas à radiação não resulta em descendentes radioativos. A radiação é apenas
um método conveniente para modificar os genes de uma planta, talvez levando-a
a transmitir esses genes mutantes para seus rebentos.
Pode parecer bizarro, mas o campo (moderadamente) eufemístico da
“reprodução por mutação” criou muitos dos seus alimentos favoritos, como a
moderna toranja “Ruby Red” e a cevada “Golden Promise” (que você
provavelmente consumiu se já bebeu algumas cervejas ou uísques irlandeses).
Esse método, no entanto, ainda é bem grosseiro. Modificam-se alguns DNAs e
espera-se que, por pura sorte, haja uma mutação útil observável. Mas e se
pudéssemos adotar uma abordagem inteiramente nova: e se, em vez de
selecionarmos características boas ou fizermos mudanças aleatórias no código
genético de um organismo, pudéssemos alterar precisamente os genes, sabendo
exatamente qual seria o resultado? Claro, faríamos uma toranja melhor, mas
também levaríamos a vida para além dos limites atuais. Poderíamos convencer
bactérias a se transformarem em pequenas fábricas de substâncias químicas para a
medicina. Levaríamos micróbios para dar uma olhada em áreas de difícil
exploração para nós. Poderíamos ainda ser capazes de alterar o DNA humano,
talvez até em pessoas vivas.
Estamos indo além do reino da biologia natural, entrando na chamada biologia
sintética.
Para entender como isso pode acontecer, é preciso saber um pouco sobre o
DNA. Vamos fazer um rápido resumo.

DNA
Em todos os organismos multicelulares (como cogumelos e humanos), as
células têm em seu interior uma porção distinta chamada núcleo. Dentro do
núcleo há moléculas muito longas chamadas DNA. Pense nele como uma escada
de mão feita de corda, especialmente comprida, que se retorce e assume um
formato de saca-rolha. Essa é a famosa “dupla hélice”.
Os “degraus” da escada de mão são compostos por duas moléculas pequenas
(uma de cada lado) que se encaixam uma na outra, como uma mão numa luva.
Bem, talvez devêssemos dizer uma mão numa luva ou um pé num sapato, já que
essa combinação se dá de duas maneiras. Essas pequenas moléculas são chamadas
de bases, das quais existem quatro tipos, abreviados como T, A, C e G. A base T
sempre se casa com a A (mão na luva), e a C sempre se casa com a G (pé no
sapato).
O resultado é que, se rasgasse a escada em espiral, arrancando mãos de luvas e
pés de sapatos, você veria duas cordas compridas de bases, uma de cada lado. Se
você as lesse em ordem, do começo ao fim, seria algo como
“AAGCTAACTACACGTTACTG”, só que muito mais longo. Tipo 150
milhões de vezes maior em humanos. Essas letras codificam a maior parte das
informações de que seu corpo precisa para fazer tudo o que você faz.
Então que diabo isso significa? Quase tudo que acontece no seu corpo é feito
por proteínas. As pessoas geralmente pensam em proteínas como aquilo que você
come quando dá uma mordida num frango, mas a palavra “proteína” se refere a
uma imensa categoria de moléculas que funcionam como pequenas máquinas
para executar praticamente todas as tarefas no seu corpo. O DNA é, por assim
dizer, a biblioteca de como fazer proteínas.70
Agora visualize a escada de DNA se abrindo e cada degrau se dividindo ao
meio e virando uma longa corda de bases T, A, G e C. Sobre essa superfície
recém-aberta se forma uma nova molécula chamada RNA, que é uma espécie de
molécula-espelho para a superfície de DNA sobre a qual ele se forma. Sendo
assim, se determinado seguimento de DNA diz “AGCT”, o RNA forma
“TCGA”.71 Ou, para continuar nossa metáfora, mão se torna luva, sapato se
torna pé e vice-versa.
Essa nova peça de RNA (conhecida como RNA mensageiro) é o
transportador da informação genética. Ele deixa o núcleo e segue para o restante
da célula. Ali, encontra-se com uma estrutura chamada ribossomo, que “lê” o
código do RNA em blocos de três letras, como “AAA”, “GCT” ou “CAT”. No
ribossomo, cada “palavra” de três letras se torna uma espécie de ponto adesivo
para um aminoácido específico. Aminoácidos são as moléculas que as células
usam para construir suas máquinas de proteína.
Outro tipo de RNA (RNA transportador) leva os aminoácidos para o
ribossomo, colando-os aos pontos adesivos apropriados. Cada aminoácido é,
então, ligado quimicamente ao aminoácido ao lado, formando uma longa cadeia.
Quando se juntam numa determinada ordem, esses aminoácidos se dobram e
assumem formatos complexos que permitem às proteínas circular, iniciar reações
químicas e realizar todo tipo de truque necessário para que você continue a fazer
coisas como comer batata frita ou gritar diante do telejornal.
Ok, isso está um pouco confuso. Vamos usar uma analogia.
Pense em seu DNA como a biblioteca de informações sobre como fazer
máquinas. Nessa analogia, se você abrisse um livro do DNA numa página
qualquer ele poderia dizer algo como “ATNUJ, ALUVLÁV, RARAP, ETNEL,
OBUT, ETNEL, OBUT, RAGIL, ALUVLÁV, LENA, ETNEL...” e assim por
diante ao longo de muitos milhares de páginas.
Parece uma linguagem sem sentido. Mas faça uma cópia espelhada usando o
Silly Putty72 e você obtém “LENTE, ANEL, VÁLVULA, LIGAR, TUBO,
LENTE, TUBO, LENTE, PARAR, VÁLVULA, JUNTA”. Ainda está meio
confuso, mas parece fazer algum sentido.
Agora, observe que há um trecho sensato no meio: “LIGAR, TUBO, LENTE,
TUBO, LENTE, PARAR.” Ao montar essas combinações na ordem prescrita,
você obtém um telescópio. Esse é, por assim dizer, o código para telescópio.
Mas telescópios são sem graça. Vamos supor que você esteja tentando fazer
algo legal. Por exemplo, um dos projetos recentes de Zach foi a criação do
primeiro monóculo descartável do mundo. Kelly acha o projeto uma idiotice, mas
ela está errada.73
Em algum lugar da biblioteca de DNA, há uma seção de monóculos que,
quando copiada em espelho, diz “LIGAR, ANEL, LENTE, CORRENTE,
EMBALAGEM, PARAR”. Uma cópia em Silly Putty é feita e levada para fora
da biblioteca.
Por que sair da biblioteca antes de fazer o monóculo? Por muitos motivos, mas
um dos maiores é que uma loja de máquinas dentro da biblioteca não é o ideal.
Se você danificar a cópia em Silly Putty da seção “como fazer um monóculo
descartável”, é só voltar à biblioteca de DNA e pressionar o Silly Putty de novo.
E se você quiser fazer muitos monóculos descartáveis de uma vez, vai querer fazer
muitas cópias e enviá-las para várias fábricas diferentes. Se o livro original for
danificado, a fabricação de novas máquinas será impossível. Você talvez faça
cópias incorretas que não funcionarão. Na pior das hipóteses, poderá fazer
máquinas que “funcionam” mas fazem algo muito ruim. Algo como “LIGAR,
ANEL, GASOLINA, LENTE, CORRENTE, FOGO, PARAR”.
De qualquer modo, depois que a cópia em Silly Putty estiver fora da biblioteca,
ela vai para a montagem, vulgo ribossomo. O pessoal da montagem pega cada
palavra em Silly Putty e passa cola nelas. Em seguida, o motoboy que entrega as
partes (o RNA transportador) traz as peças e cola cada uma delas na palavra
referente. Depois que todas as partes estão coladas corretamente, o Silly Putty
pode ser jogado fora ou usado para fazer mais máquinas. Se tudo der certo, o
resultado será um monóculo descartável finalizado ou uma frota inteira de
monóculos descartáveis, se foram feitas muitas cópias.
Da mesma forma, o DNA se abre, cópias em RNA são feitas e essas cópias
deixam o núcleo para ir até os ribossomos, onde as proteínas são montadas.
Trata-se de uma ideia simplificada de como o DNA faz o seu negócio, mas o
processo real pode ser bem mais complexo, envolvendo circuitos em feedback e
combinação de pedaços de código separados para fazer uma única máquina.
“Calma aí!”, você diz. “Quando falam de DNA, as pessoas sempre mencionam
os genes.” Onde eles se encaixam? Bem, acontece que, para os cientistas,
identificar um “gene” é um pouco difícil. Ou pelo menos é difícil defini-lo com
precisão. Não que isso seja grande coisa. Por exemplo, você não reclama da
economia toda hora? Então. Agora defina a economia.
Um gene é como um pedaço do DNA que parece fazer algo específico, que
não necessariamente a gente saiba o que é. Um exemplo simples seria o gene do
tipo sanguíneo. Todo mundo tem uma seção do DNA que, por meio do processo
mencionado, determina o seu tipo sanguíneo. Pessoas diferentes têm tipos
sanguíneos diferentes, é claro, mas isso é apenas um reflexo do fato de que os
genes do tipo sanguíneo têm códigos distintos. Pessoas do tipo B e do tipo A têm
um “gene de tipo sanguíneo”, mas os códigos específicos desse gene variam um
pouco.
Dito isso, a maioria das características que identificamos em um organismo
não é determinada por apenas um gene. Na verdade, as características de gene
único (ou “monogênicas) são bem raras.74 Mesmo características simples, como
cor do cabelo e cor dos olhos, são produtos de muitos genes diferentes.
Por que é assim? Bem, lembre-se de que todo esse sistema não foi criado por
ninguém. É fruto de bilhões de anos de evolução. Se os humanos o tivessem
construído, talvez cada característica fosse produzida por um pedaço específico
do DNA, da mesma maneira que cada parte de um computador é um módulo
separado. Mas estamos presos à história da evolução.
Então, por exemplo, você pode encontrar um gene chamado “GÊNIO”, que
torna 15% maior a probabilidade de seu hospedeiro humano gostar da elegante
conveniência de um monóculo descartável. Isso não garante que essa característica
rara, valiosa e absolutamente civilizada estará presente na pessoa — simplesmente
a torna mais provável. Conjugado a outros genes, GÊNIO pode aumentar para
quase 100% a probabilidade do comportamento de ter um monóculo descartável,
mas se os outros genes se opuserem a GÊNIO, o infeliz indivíduo poderá ser
destituído de um senso de aparato ocular certo. Ou isso pode ser mais
complicado — se você tiver o gene A e o gene B mas não o C, o efeito é um, mas
se tiver A e C mas não D, o efeito é outro.
Em geral, determinado gene com frequência só conta uma pequena parte da
história.
Para o propósito deste livro, o importante é perceber que a biologia, em seu
nível mais básico, é um pouco como um sótão bagunçado. Se tirarmos uma coisa
daqui, podemos derrubar algo ali. Isso significa que se você quer reproduzir, por
exemplo, gado com chifres gigantes, a maneira mais fácil tem sido encontrar um
touro com chifres grandes e uma vaca cujo pai tenha chifres grandes, tocar para
eles uma musiquinha relaxante e esperar a natureza seguir o seu curso.75
Esse método funciona bem, sobretudo se não é você que faz o trabalho de...
vamos chamar de concierge. Mas, para o pretenso cientista louco, a complexidade
do DNA (sem falar no seu tamanho diminuto) impôs limites sobre o quanto e
com que rapidez podemos mudar a biologia. Os humanos não estão por aí há
muito tempo. Pouquíssimas espécies foram alteradas para especificamente fazer
coisas de que gostamos. Conseguimos controlar a levedura que transforma açúcar
em birita, mas por que não uma levedura que transforma açúcar em, digamos,
combustível de avião? As duas são substâncias químicas, certo? O DNA tem um
pedaço que diz para fazer certa substância química — será que não podemos
mudar esse pedaço de código para transformá-lo em outra coisa?
Essa é a promessa da biologia sintética. Se conseguirmos criar novos pedaços
de DNA e inseri-los onde quisermos num organismo, teremos criado uma
biologia que nunca teria existido. Máquinas moleculares que podem transformar
células de câncer em células normais. Organismos que causam pestes ajudando a
exterminar a própria espécie. Ou até mesmo apenas organismos de escopo geral à
espera de instruções. Isso é vida feita por encomenda.

Em que pé estamos agora?


A biologia sintética que conhecemos atualmente teve início nos anos 1970. Os
primeiros métodos eram complexos e difíceis. Ainda assim, muito do que
aceitamos como natural na vida moderna vem dessa época. Só foi possível
fabricar em massa a insulina do tipo humano (provavelmente76 o tipo que você
quer) graças a versões geneticamente modificadas da bactéria Escherichia coli
(também conhecida como E. coli) e de leveduras. Antes disso, usávamos insulina
animal, derivada de pâncreas de vacas e porcos. Esse tipo de insulina exigia o
abate de muitos animais para que se obtivesse uma quantidade suficiente, e
algumas pessoas se tornaram alérgicas à molécula de insulina ligeiramente
diferente produzida por vacas e porcos.
Convencer a E. coli a fazer o estilo de insulina conveniente ao ser humano veio
a ser um processo relativamente simples, e foi resolvido no fim dos anos 1970.
Outros medicamentos têm se provado mais difíceis.

Combatendo doenças
Os seres humanos conseguiram eliminar, ou pelo menos controlar, muitas
doenças. Outras, como a malária, têm se mostrado extremamente resistentes. A
Organização Mundial da Saúde estima que em 2015 houve 214 milhões de casos
de malária, que resultaram em 438 mil mortes. Trata-se de uma grande melhora
em relação a vinte anos atrás, mas há um longo caminho pela frente. Um
tratamento particularmente bom se dá com uma substância química chamada
artemisinina.
A artemisinina é um composto extraído da planta chinesa Artemisia annua.
Medicamentos à base de artemisinina estão entre os melhores tratamentos que
temos contra malária, mas, como todo entusiasta da artemísia chinesa sabe, o
cultivo de uma quantidade suficiente da planta é caro e exige tempo. Isso é ainda
pior no caso da malária, porque a maioria das vítimas da doença vive na África
Subsaariana, uma região economicamente pobre.
A disponibilidade da artemísia chinesa tem variado radicalmente ao longo do
tempo, provocando grandes flutuações de preço. Por exemplo, o preço era de 300
dólares por quilo em 2003, 1.100 dólares em 2005, 200 dólares em 2007 e 900
dólares em 2011. Quando os preços caem, os agricultores param de cultivar a
planta. Isso provoca escassez, o que aumenta o preço de novo. E a última coisa
que você vai querer é uma escassez de medicamentos contra a malária. Um dos
motivos pelos quais não conseguimos sair desse ciclo é que as plantas demoram a
crescer. Encontrar uma maneira rápida de prover artemisinina de maneira
confiável reduziria o preço médio, ou pelo menos manteria o preço e a oferta do
medicamento mais estáveis.
O dr. Chris Paddon, da Amyris, Inc., e o dr. Jay Keasling, da Universidade da
Califórnia em Berkeley, queriam produzir um organismo simples para criar esse
remédio, então se voltaram para o melhor amigo do homem: Saccharomyces
cerevisiae, vulgo levedura de cerveja. O pequeno fungo que transforma açúcar em
bebida alcoólica.77
O desafio é que não dá para fazer apenas artemisinina. Se você acha
“artemisinina” difícil de pronunciar, observe o nome químico:
(3R,5aS,6R,8aS,9R,12S,12aR)-Octa-hidro-3,6,9-trimetil-3,12-epoxi-12H-
pirano[4,3-j]-1,2-benzodiazepina-10(3H)-um.
Para conseguir um pouco desse negócio, é preciso gerar várias substâncias
químicas diferentes que reajam entre si na sequência certa. Ao longo de
aproximadamente uma década, o grupo do dr. Paddon e do dr. Keasling trabalhou
em todo tipo de etapa química, alterando o DNA da levedura de modo a gerar as
substâncias químicas certas para as reações certas na ordem certa. Só nos últimos
anos eles enfim produziram uma levedura de cerveja modificada que cospe o
ácido artemisínico, que se transforma em artemisinina com facilidade.
Isso funciona bem, mas o medicamento está tendo dificuldade para competir
no mercado. Aconteceu de a nova tecnologia chegar ao mercado justo quando a
artemisinina estava com um preço especialmente baixo, então, no momento, o
antigo método está solapando a levedura modificada especial. Não estamos certos
sobre quem é o provável perdedor nesse caso, mas é uma boa lição sobre como as
mudanças tecnológicas envolvem tanto a realidade de mercado quanto a
inteligência científica.
De qualquer modo, a malária já está desenvolvendo resistência a medicamentos
à base de artemisinina em algumas regiões. Muito obrigado, evolução. Portanto, e
se pudéssemos, antes de tudo, usar a biologia sintética para impedir as pessoas de
contrair malária?
Os mosquitos que carregam a malária e a transmitem para os humanos com
frequência se tornam resistentes a pesticidas. Mosquitos se reproduzem depressa,
então cada geração tem muitas chances de produzir mutantes capazes de derrotar
as melhores armas da humanidade. Poderíamos vencer essa corrida armamentista
da seguinte forma:
A fêmea do mosquito só acasala uma vez. E se pudéssemos enganá-la e fazê-la
acasalar com um macho estéril? Isso resultaria em menos bebês mosquitos
bonitinhos78 e, por sua vez, em menos transmissão de malária. Uma estratégia
inicial para esterilizar os mosquitos machos foi expô-los a radiação. Isso de fato
funcionou, mas, bem... acontece que quando você expõe um cara a uma dose
enorme de radiação, isso aumenta as chances de ele dormir sozinho.
Mais tarde, tornou-se possível fazer mudanças genéticas diretas em mosquitos,
e cientistas fizeram um pequeno adendo ao código genético do mosquito. Os
exemplares com esse gene adicionado precisam do antibiótico tetraciclina, senão
morrem. Eles recebem tetraciclina ao nascer e saem para acasalar. Em seguida,
gerarão filhotes que morrerão sem tetraciclina. Esses filhotes não têm um
cientista por perto para lhes dar o batismo de antibiótico, então eles morrem
antes de gerarem outra leva de mosquitos.
Está bem, então isso funciona a curto prazo, mas é muito caro. Quando se
introduz um gene que faz com que todos os seus descendentes morram, esse gene
não dura muito tempo numa população. Os mosquitos se recuperam em algumas
gerações. Ou seja, para manter as populações de mosquito baixas, é preciso
continuar introduzindo com cuidado mosquitos geneticamente manipulados
várias e várias vezes.
A não ser que você tenha um direcionamento gênico. Eis como isso funciona:
Quando mamãe e papai se amam muito, eles apagam as luzes e combinam seus
DNAs. Se tudo der absurdamente errado, terão um bebê. Agora, imagine que
haja um único gene que determina a cor dos pelos do nariz.79 Mamãe lhe dá um
gene para pelos de nariz pretos e papai lhe dá um gene para pelos laranja
vibrante. No futuro, você produzirá filhos cuja cor dos pelos do nariz é
influenciada pelos genes recebidos de sua mãe e seu pai.
Mas agora suponha que o gene dos pelos laranja de seu pai não era um gene
comum. Além de codificar os pelos de nariz, ele também destrói o gene dos pelos
de nariz do parceiro. Quando isso acontece, o DNA conserta o gene destruído
copiando o gene dos pelos laranja de nariz. Então agora você tem dois genes de
pelos laranja de nariz do papai e nenhum gene de pelos pretos da mamãe.
O que acontece? Bem, sem dúvida você acaba tendo pelos laranja no nariz.
Mas então... algo mais sinistro e mais laranja acontece. Todos os seus irmãos
também têm pelos de nariz laranja. E também todos os seus filhos. E os filhos
deles! O gene “direciona” o caminho dele por toda a população. Isso acontece
mesmo que os pelos laranja vibrante (inexplicavelmente) tornem você menos
sensual. Pode ser que você tenha menos filhos, seu esquisitão de nariz alaranjado,
mas todos eles terão o gene egoísta.

Portanto, com o direcionamento gênico é possível impor a biologia sintética


sobre uma população selvagem inteira. O dr. George Church, de Harvard, e
outros conseguiram pôr muitos direcionamentos gênicos para resistência à
malária em mosquitos. Assim, em vez de ter que soltar mosquitos modificados a
cada estação, poderíamos liberar mosquitos com diversos direcionamentos
gênicos de resistência à malária apenas uma vez. Mesmo que a resistência à
malária os torne parceiros menos atraentes, o gene deve se disseminar na
população, crescendo exponencialmente durante o processo.
De acordo com o dr. Church, o objetivo é a completa erradicação da malária.
No entanto, soltar na natureza um organismo com DNA modificado a fim de
eliminar uma espécie inteira (mesmo que se trate de um parasita) é algo que
estava fadado a despertar um pouco de ira científica. Uma comissão da Academia
Nacional de Ciências dos Estados Unidos considerou a técnica promissora o
suficiente para receber sua aprovação, mas quer ver muito mais pesquisas nessa
área antes de pensar em soltar mosquitos na natureza.

Diagnóstico e tratamento médico

Quando seu cachorro entra em casa correndo, ele não tem como lhe dizer que
estava rolando na lama e comendo esquilos. De algum modo, você sabe. O corpo
do cachorro guarda um registro do passeio do dia em seu cheiro e sua aparência.
Alguns cientistas se perguntaram se o mesmo poderia acontecer com as bactérias.
Isso seria útil, porque você poderia enviar a bactéria para um passeio mágico pelo
seu trato digestivo. Elas montariam um pequeno álbum de recortes da viagem e
depois o dariam ao seu provedor médico quando... emergirem. Não é a imagem
mais encantadora, mas seria melhor do que o atual método de enfiar uma câmera
ali dentro.
A dra. Pamela Silver e seu laboratório na Harvard Medical School tiveram
uma ideia: seria possível criar um mecanismo sintético que capturasse
informações dentro do DNA de uma bactéria para que recuperássemos depois?
Basicamente, seria possível fazer com que bactérias “observem” o ambiente e
depois mudá-las de algum modo que leve você a saber o que elas viram? A
resposta é sim. Dãã.
O conceito é o seguinte: duas células do mesmo tipo, com o mesmo DNA
inicial, podem ter variações adquiridas no ambiente. Por exemplo, talvez haja
moléculas presas ao DNA delas que mudam a maneira como ele codifica as
coisas, ou pode haver algum tipo de circuito de feedback químico que resulta
numa expressão maior ou menor de determinado gene. E, em alguns casos, uma
célula pode transmitir para seus filhotes as alterações que adquiriu.
Essas mudanças, se persistirem de uma forma que se possa decifrar, poderiam
nos contar sobre o que a célula bacteriana “viu” em sua viagem. O problema é que
as bactérias não são naturalmente destinadas a esse propósito. Elas são mais ou
menos como o cachorro de antes — se ele correu até a casa do vizinho,
desenvolveu inteligência de repente, matou o vizinho por dinheiro, jogou pôquer
pela internet, perdeu tudo num blefe que deu errado, ficou com raiva e perdeu a
inteligência, depois correu na lama e voltou para casa, bem... tudo o que você verá
é a lama no carpete.
No cachorro dá para amarrar uma câmera. Na bactéria, não. Ela é pequena
demais, e, de qualquer modo, o Sol não brilha por onde ela vai.
No DNA, pode-se encontrar uma espécie de circuito químico80 em que ele
cria uma molécula e esta diz a ele para fazer isso de novo. Seria como se você
fizesse um sinal com os dizeres: “QUANDO LER ESTE SINAL, FAÇA UMA CÓPIA DELE
E DEPOIS A LEIA.” Ao ser desencadeado, o circuito fica produzindo sinais para
sempre.
Em princípio, esse circuito químico deveria ser capaz de funcionar como a
memória. Para continuar com a analogia do sinal, vamos supor que você tivesse
um programa mental que funcionasse mais ou menos assim: “Quando sua calça
cair, faça um sinal que diga ‘QUANDO LER ESTE SINAL, FAÇA UMA CÓPIA DELE E
DEPOIS A LEIA’.” Se mais tarde víssemos você fazendo sinais sem parar, teríamos
condições de concluir que sua calça provavelmente caiu, e sem precisarmos fazer
as observações necessárias.
O DNA funciona de maneira semelhante: quando o circuito é ligado, ele
simplesmente continua. E o circuito ativo será transmitido por gerações de
linhagens de células, pelo menos por tempo suficiente para você recuperar
informações úteis nele.
O laboratório da dra. Silver já fez isso. Eles criaram circuitos de DNA sintético
que são inseridos no material genético da bactéria. Quando a bactéria
experimenta certas condições, seus circuitos são ativados. Como os circuitos são
concebidos de maneira sintética, é preciso decidir quais são as substâncias
químicas que eles estão criando. Isso significa que é possível decidir por uma
substância química que seja facilmente detectável. Ao brilhar quando exposta a
certos tipos de luz, por exemplo.
Para dar uma ideia de por que isso pode ser útil: células tumorais com
frequência sofrem uma privação reincidente de oxigênio, porque crescem tão
rápido que não obtêm um suprimento de sangue suficiente. Acontece que a
privação repetida de oxigênio produz um sinal químico detectável nas células
tumorais. Então a ideia da dra. Silver é colocar células de memória programável
dentro do corpo de alguém e mais tarde checá-las para ver se elas detectaram
áreas com níveis baixos de oxigênio. Se detectarem, é possível que elas tenham
encontrado tumores sólidos.
Esse método ainda está em fase inicial, mas as aplicações clínicas poderiam ser
incríveis. Com um método geral para criar sensores programáveis do tamanho de
células, a porta está aberta para pesquisadores programarem células a fim de
detectar todo tipo de coisa.
Combinando isso com outro trabalho que a dra. Silver fez, tudo fica realmente
interessante. Por exemplo, ela e seus colegas publicaram um estudo em 2016 com
o título “A Tunable Protein Piston that Breaks Membranes to Release
Encapsulated Cargo” [Um Pistão de Proteína Sintonizável que Quebra
Membranas para Liberar Carga Encapsulada]. Ou seja, podem-se programar
bactérias não apenas para encontrar problemas, mas para proporcionar
tratamento.
Esse método teria utilidades que vão desde o envio de medicamentos a um
câncer até um tratamento para síndrome do intestino irritável. Ele também é
direcionado. Atualmente, se tiver uma inflamação no estômago, você toma um
remédio via oral, liberando uma substância química em todo o corpo, cuja maior
parte está saudável. Em tese, é possível criar um tipo de bactéria que se liga ao
remédio até ele detectar a assinatura química para inflamação. Se esse método
puder ser generalizado, como sugere o trabalho da dra. Silver, talvez todo tipo de
remédio possa ser entregue diretamente ao alvo relevante, maximizando a eficácia
e minimizando os efeitos colaterais.

Órgãos não humanos

Aumentando um pouco a escala, talvez seja viável modificar sinteticamente


grandes animais para fazer coisas de que gostamos. Em nosso capítulo sobre
bioimpressão (continue sintonizado), falamos sobre os desafios de construir
rapidamente órgãos inteiros a partir do zero. Mas os corpos de animais já sabem
como criar órgãos. Portanto, da próxima vez que vir um porco, talvez você deva
visualizar uma impressora 3D para rins em vez de um prato de bacon.
Acontece que os porcos são especialmente bons para esse tipo de coisa porque
seus órgãos são semelhantes aos nossos em tamanho. A transferência de órgãos
entre espécies — que recebe o sinistro nome de xenotransplantação — não tem
uma história de sucesso em relação a, você sabe, funcionamento.81 A maioria das
pesquisas tem tido como foco a transferência entre animais não humanos, como
de porcos para babuínos. Ainda não descobrimos como impedir que o sistema
imunológico do animal receptor mate o órgão do doador, mas temos algum
progresso em curso. Uma coisa que facilitaria muito isso seria se os órgãos do
animal doador “parecessem” mais para o sistema imunológico com órgãos do
animal receptor.
Portanto, assim como modificamos levedura para criar medicamentos contra
malária, deveríamos ser capazes de “humanizar” órgãos do porco. Em parte, seu
corpo sabe que recebeu o coração de um suíno, em vez de um exemplar humano,
porque o coração do porco contém e cria muitas moléculas semelhantes às
versões humanas, mas diferentes o bastante para serem reconhecidas como
estranhas. Por exemplo, existe aquela versão suína da insulina que mencionamos
anteriormente. Alterando a genética do porco, deveríamos conseguir produzir
porcos com órgãos muito semelhantes aos órgãos humanos no aspecto molecular.
Cientistas anunciaram recentemente que um coração de porco foi mantido
vivo num babuíno durante mais de dois anos,82 usando esse método juntamente
com medicamentos para reduzir a resposta imunológica. Alguns leitores poderão
ter nojo de pôr órgãos de porco em humanos, mas suspeitamos de que não se
sentiriam assim se precisassem com urgência de um fígado.
Uma preocupação mais séria é a de, por acidente, adquirir doenças totalmente
novas oriundas do porco. A dra. Luhan Yang e seu laboratório na eGenesis estão
trabalhando para ajeitar isso. O problema é que os porcos contêm “retrovírus
endógenos suínos”, conhecidos (sim, realmente) como PERVs.83 Os PERVs são
encontrados no DNA do porco e liberam partículas que infectam humanos. Os
humanos não querem PERVs dentro deles,84 então empregaram uma nova
técnica chamada CRISPR-Cas9 (a ser discutida em breve) para excluir os
PERVs dos porcos. Isso não elimina todo o risco de uma doença passar de uma
espécie para outra, mas acaba com uma das possibilidades mais assustadoras.

Combustíveis
As células são provavelmente os melhores químicos que existem.
• Dra. Pamela Silver

Em 2009, o dr. Dan Nocera, de Harvard, descobriu um catalisador


relativamente barato que podia ser posto na água. Quando adquiria um pouco de
energia, ele dividia a água (H2O) em H e O.85 Esse catalisador era
potencialmente um grande negócio, porque quando a água é dividida em
hidrogênio e oxigênio, obtém-se uma excelente forma de energia armazenada. A
junção desses dois elementos com a aplicação de um pouco de energia gera uma
grande explosão quando eles voltam a se combinar para formar a água. Em
essência, as células de combustível de hidrogênio fazem esse truque, mas sem a
parte da explosão.
Portanto, a ideia é criar células de combustível baratas e limpas usando calor
para dividir a água e depois voltando a unir as partes quando precisar de energia.
Trata-se apenas de uma versão simplificada e controlada de como as plantas
produzem energia. De acordo com a dra. Silver, “o processo de fotossíntese, uma
das coisas mais incríveis que a natureza faz, é colher a luz do Sol e usá-la como
energia para produzir coisas. Essa é a base da vida na Terra... Uma das reações-
chave da fotossíntese é chamada de fotólise da água, na qual ela é dividida”.
Mas, para o dr. Nocera, as coisas não funcionaram conforme o planejado. O
dispositivo funcionou bem, mas as células de combustível de hidrogênio nunca se
popularizaram como uma maneira de armazenar energia. Para piorar as coisas
para ele, mas melhorar para todas as outras pessoas, as velhas e comuns células de
energia solar se tornaram muito mais baratas, diminuindo um pouco a animação
em torno do seu produto. O projeto do dr. Nocera foi engavetado por um tempo.
Mas aproveitar a divisão da água tem muito potencial. Você tem uma forma
ultrabarata de dividir a água, mas a retirada de sua energia é um processo
inconveniente. Então a dra. Silver teve uma ideia.
Seu laboratório apresentou uma bactéria geneticamente modificada que pegava
hidrogênio e oxigênio, os combinava com dióxido de carbono e os transformava
em isopropanol, um combustível que pode ser separado da água. O resultado é
um sistema em que os insumos são um catalizador de metal, água, bactérias e
dióxido de carbono, e o produto é uma substância química que você pode usar
para ligar o seu fogão.
Se parar para pensar, isso é meio louco. Você põe a biologia e o material certo
na água, deixa a água pegar um pouco de luz e calor e então começa a ver
combustível se formando no recipiente. E, como você está imitando a vida e
extraindo CO2 do ar, seu combustível é muito menos prejudicial ao meio
ambiente.
A dra. Silver nos disse: “Nossa contribuição foi (...) tornar esse processo tão
eficaz quanto provavelmente o melhor fotossintetizador, que é a alga. Na verdade,
agora superamos a alga. No estudo original, acho que dissemos que estávamos
superando as plantas; agora superamos a alga.”
Atualmente, eles estão analisando se o processo pode ser barateado e ampliado.
Outro grupo está trabalhando numa maneira de transformar switchgrass [a
gramínea Panicum virgatum] em combustível de avião. Para quem nunca ouviu
falar dela, a switchgrass é uma planta alta encontrada em toda a América do
Norte. É um capim duro e espesso que cresce rápido, mesmo em solo ruim.
Caso você não se lembre da botânica que aprendeu no ensino médio, a celulose
é um dos principais componentes estruturais das plantas, uma cadeia muito longa
de moléculas de açúcar. Portanto, talvez você esteja pensando: Por que as árvores
não têm um gosto bom quando dou uma lambida nelas? Continuo lambendo tudo
quanto é planta, mas elas quase nunca são doces!
Primeiro, pare com isso. Segundo, é bem difícil quebrar cadeias de celulose em
moléculas de açúcar gostosas. Não conseguimos digerir a celulose, a menos que
tenhamos enzimas especialmente desenvolvidas para quebrar o seu açúcar. É por
isso que as vacas têm um sistema digestivo complexo — elas estão fazendo o
trabalho divino de converter um capim de difícil digestão em bife.
Mas fazer o seu negócio dentro de uma vaca nunca é um bom caminho a
seguir. Então, o grupo da dra. Aindrila Mukhopadhyay, do Joint BioEnergy
Institute, criou bactérias que podem transformar recursos vegetais renováveis
(como a switchgrass) em d-limoneno, um precursor do combustível de avião. O
grupo dela modificou bactérias que podem pegar a switchgrass pré-tratada,
quebrar a celulose em pequenos açúcares e depois transformar esses açúcares em
d-limoneno.
Eles esperam levar o processo a um ponto em que as bactérias liberem
diretamente o combustível de avião, mas chegar ao d-limoneno de uma só vez
elimina muitos passos normalmente necessários para se produzir biocombustível
de avião. E como a fonte de carbono é o CO2 do ar que a switchgrass converteu
em celulose, em princípio daria para obter combustível de avião sem acrescentar
muito CO2 à atmosfera.
Os biocombustíveis têm um enorme potencial para reduzir nossa dependência
de produtos à base de petróleo, mas até agora o custo tem sido um problema
sério. Os preços do petróleo continuam um tanto baixos, então talvez demore um
pouco até que estejamos usando uma erva para voar para Amsterdã.

Monitoramento ambiental

A dra. Silver conseguiu dar às células a capacidade de lembrar e reportar suas


experiências dentro do corpo. Será que poderíamos fazer o mesmo em ambientes
abertos?
O dr. Joff Silberg e a dra. Carrie Masiello são uma equipe de professores — e
marido e mulher — da Rice University. Ele é biólogo sintético. Ela é geóloga.
Mas de algum modo eles conseguiram superar isso e encontrar o amor.
A dra. Masiello estuda o biochar, um carvão produzido quando uma matéria
vegetal é assada em alta temperatura na ausência de oxigênio. A criação de
biochar sequestra o carbono que de outro modo acabaria voltando à atmosfera.
Além disso, com frequência ele é acrescentado ao solo para aumentar o
crescimento de uma planta. Não sabemos exatamente por que o biochar ajuda a
planta a crescer, mas pode ser que altere a composição de micróbios do solo. A
dra. Masiello queria bactérias que lhe reportassem como eram as condições de
vida dos micróbios no solo com e sem biochar. Ela pediu ao dr. Silberg que lhe
fizesse um micróbio sintético para o Dia dos Namorados. Sim, é verdade.
O dr. Silberg criou bactérias que liberam gases que não são comumente
encontrados no solo. Portanto, colocando micróbios sintéticos no solo e depois
monitorando a liberação de gás, podemos “bisbilhotar” o comportamento do
micróbio, em vez de triturá-lo para análises.
A maioria das pessoas não é tão romântica assim com micróbios gasosos do
solo, mas essa técnica pode ser estendida ao trato da contaminação ambiental.
Grupos já modificaram bactérias para fazê-las brilhar na presença de arsênico e
água. Quanto mais arsênico, maior o brilho. É como uma luz noturna que
funciona com veneno.
Uma técnica como essa poderia ser usada para encontrar e monitorar
ambientes tóxicos. Graças à biologia sintética avançada, já podemos criar
programas bacterianos mais complexos do que apenas “Brilhe se detectar
toxinas”.
Um grande obstáculo a esse campo é o fato de que ambientes supertóxicos
também são nocivos para bactérias. Portanto, se não vemos o brilho, pensamos
que é porque nenhum arsênico foi detectado, mas o que aconteceu na verdade é que
todas as bactérias estão mortas. Cientistas estão trabalhando para resolver esse
problema. Uma ideia é usar organismos especialmente resistentes que já estão
acostumados a ambientes tóxicos.86 Outra é criar mecanismos de sinalização
mais complexos, na linha de “luz vermelha para ruim, luz verde para bom e
nenhuma luz para MINHA NOSSA SENHORA, FUJA SE QUISER
CONTINUAR VIVO”.
Se as pessoas decidirem que está tudo bem ter bactérias sintéticas circulando
pelo mundo, um monitoramento contínuo das condições poderá ser feito em
praticamente todos os lugares. Se o solo de uma área específica começasse a
emitir um brilho verde, você saberia que era arsênico. Azul poderia significar
níveis tóxicos de mercúrio. Amarelo seria chumbo. Em termos gerais, se você
encontrar uma enseada misteriosa onde a natureza é coberta por uma iluminação
prismática, não beba a água.

Generalizando a biologia sintética

Todas essas coisas são ótimas, mas também são difíceis. Existem maneiras de
modificar a genética desde os anos 1970, mas os métodos são difíceis, caros e
demorados. Ou pelo menos era isso que acontecia. Nos últimos anos, entrou em
cena um novo método que promete mudar tudo.
Um grupo liderado pela dra. Jennifer Doudna, da Universidade da Califórnia
em Berkeley (e do Howard Hughes Medical Institute), e pela dra. Emmanuelle
Charpentier, do Max Planck Institute for Infection Biology, descobriu uma
maneira de produzir tesouras moleculares, graças a uma peculiaridade no modo
como os sistemas imunológicos bacterianos funcionam. Em bactérias, o sistema é
chamado de CRISPR-Cas9. Caso não tenha adivinhado, esse primeiro acrônimo
é uma abreviação de “clustered regularly interspaced short palindromic repeats”
[repetições palindrômicas curtas agrupadas e regularmente interespaçadas].
Uma bactéria natural não tem um armazenamento de memória no mesmo
sentido que você tem. Ela não pode ver, ouvir nem pensar. Mas as bactérias são
capazes de combater vírus que já tenham encontrado alguma vez. De algum
modo, elas se “lembram” dos vírus e os atacam.
Funciona da seguinte maneira: ao infectar uma bactéria, um vírus injeta
pedacinhos de material genético através da parede celular dela. Esses pedacinhos
tentam assumir o comando da maquinaria da célula a fim de produzir mais
partículas de vírus. Mas a bactéria tem uma proteína, chamada Cas, que pode
combater o vírus. Quando é bem-sucedida, a Cas pega parte do material genético
do vírus derrotado e o acrescenta a uma seção especial do DNA da célula
bacteriana. Isso fornece à bactéria uma maneira de se lembrar do vírus.
Mais tarde, quando esbarra no mesmo vírus, essa bactéria o “reconhece” usando
o código armazenado e, então, corta a proteína do vírus no lugar reconhecido. As
bactérias não estão cortando o lugar reconhecido por terem um senso de justiça
poética — é que quando alguma coisa as ataca, cortá-la em pedaços é uma boa
defesa. Mas o resultado é uma ferramenta útil para os seres humanos — a Cas
sempre corta num determinado local genético. Uma tesoura molecular direcionada.
E aqui vai a parte bonitinha: numa célula saudável, quando o DNA é cortado,
ele tenta consertar a si mesmo juntando de novo as duas pontas. Antes de o
conserto acontecer, é possível inserir novas moléculas que couberem na lacuna. O
DNA se cura sozinho e BAM! Você acabou de introduzir de maneira seletiva um
novo código no DNA de uma célula no lugar de sua escolha. E isso numa célula
viva.
Os grupos de laboratório do dr. Feng Zhang, do MIT, e do dr. George Church
desenvolveram métodos de usar a CRISPR-Cas9 em camundongos e humanos.
Então, desde mais ou menos 2013, é possível circular dentro de células de todo
tipo de organismo, cortando DNA e colando DNA indiscriminadamente. O que
podemos fazer? Brincar de Deus? Sitiar o antigo vale da Natureza com os
canhões de ferro da Ciência?! Não ligue se fizermos isso!
É claro que, como nos diz a história do Jardim do Éden, quando brincamos de
Deus com organismos preexistentes, eles nem sempre se comportam de maneira
correta. Enquanto não pudermos fazer organismos internamente do zero, temos
que mexer com o DNA que está dentro das criaturas que a natureza fez. Mas não
precisamos jogar limpo com a natureza.

O organismo mais simples

O dr. J. Craig Venter ficou conhecido por uma disputa com os Institutos
Nacionais de Saúde, do dr. Francis Collins, para decifrar o genoma humano.
Hoje, ele está fazendo coisas mais importantes. Só para dar uma ideia do dr.
Venter, certa vez ele respondeu ao tema de discussão “Com o quê ‘devemos’ nos
preocupar?” com um artigo que começava assim: “Como cientista, otimista, ateu e
macho alfa, não me preocupo.”
Entenda, esse é exatamente o tipo de pessoa que você vai escalar se precisar de
alguém para brincar de Deus. Ele trabalha num lugar que por acaso se chama J.
Craig Venter Institute. Afora o fato de ser destemidamente alfa ao máximo o dia
inteiro e todos os dias, a equipe do dr. Venter está trabalhando na criação do
organismo mais simples possível.
A ideia deles é que, com um organismo simples ao extremo, deve ser
relativamente fácil dizer o que acontecerá quando o DNA dele for alterado. Você
terá uma espécie de tela em branco para novos genes, então os cientistas
conseguirão descobrir muito mais depressa o efeito das mudanças que fizerem.
Eles começaram com um organismo chamado Mycoplasma genitalium, assim
nomeado porque é encontrado nos tratos genital e urinário dos humanos. Além
de estar em local conveniente, esse organismo tem um genoma extremamente
curto. De início, eles removeram e descartaram cada vez mais genes para ver o
que era essencial para a sobrevivência. Às vezes a perda de um gene matava o
organismo, mas às vezes não. Depois de muito trabalho, e depois de
(infelizmente) trocarem para uma espécie com um nome menos divertido,87 eles
chegaram a um organismo com apenas 473 genes.88 Os humanos, em
comparação, têm cerca de vinte mil genes. O grupo de Venter batizou o novo
organismo de Mycoplasma laboratorium.

O dr. Venter é ateu, mas, se por via das dúvidas houver um Deus a quem irritar,
ele chamou a mais recente versão desse organismo de Syn 3.0, em referência à
deusa nórdica guardiã dos portões, responsável por decidir quem entra ou não.
Investidores interessados em exclusividade já estão se inscrevendo para ver o que
o Syn pode fazer por eles.

Biohackers e partes padrão

Para aqueles que não se animam tanto com a criação de uma forma de vida
patenteada por um gênio reservado, há também uma abordagem popular da
biologia sintética.
Um concurso chamado iGEM (International Genetically Engineered
Machine) é realizado anualmente e põe frente a frente estudantes (inclusive do
ensino médio!) para ver quem consegue apresentar o organismo criado por
engenharia genética com mais potencial. Em 2015, as equipes criaram (entre
outros projetos) um biossensor que funcionava em qualquer iPhone e detectava
contaminação por metais pesados e drogas de estupro; um organismo que secreta
substâncias químicas para ajustar o ponto de congelamento da água estando
imerso nela; um teste barato e rápido para determinar se um câncer teve
metástase; e um biossensor que mensura a pureza da heroína.
As equipes também põem todas as “partes” que elas criam no “Registro de
Partes Padrão de Biologia”, que está disponível gratuitamente e também pode
receber contribuições de pessoas que não participaram do iGEM. Em outras
palavras, um Lego de biologia de código aberto. As pessoas podem encomendar
essas partes e fazer pesquisas de biologia sintética se tiverem o equipamento, cuja
disponibilidade está se tornando cada vez maior em espaços de “biohackers”.
Portanto, seu vizinho pode ser o próximo indivíduo a resolver nossa crise
energética, ou a curar uma doença, ou a escrever “me dê um chute” na sua pele
com substâncias químicas bioluminescentes. Se você morasse perto do MIT, isso
provavelmente já aconteceria, mas em breve poderá ser uma experiência para
todos aproveitarem.

Preocupações
Mexer com a linguagem da vida. O que poderia dar errado? Um mantra inicial
da internet era “a informação quer ser livre”. Isso soa bem, mas temos um
problema se a informação for sobre produzir varíola a partir do zero.
Em última análise, a biologia sintética deve dar aos humanos o poder de ter
organismos feitos por encomenda. À medida que a tecnologia se torna barata, a
capacidade de trazer de volta doenças para as quais já não nos vacinamos pode se
tornar algo que você conseguiria fazer no seu computador de mesa.
Pense na varíola: depois de 1980, paramos de vacinar porque a doença havia
praticamente sumido.89 A varíola pode ter matado meio bilhão de pessoas no
século XX, e a maioria dos indivíduos atualmente não tem imunidade a ela. Se a
biologia sintética ficasse fácil, o que impediria um biólogo malévolo (ou um geek
com raiva) de trazê-la de volta?
Uma possibilidade ainda mais assustadora é a de uma doença como a varíola
ser modificada para se espalhar mais depressa e ser mais letal. Um biohacker
poderia, em tese, criar a doença de modo que ela resistisse a todos os tratamentos
conhecidos. Também sabemos que algumas doenças afetam o comportamento
humano. Por exemplo, as vacinas contra gripe aparentemente tornam os seres
humanos mais sociáveis, talvez em decorrência da doença. Um criador de doenças
poderia produzir alterações comportamentais na sociedade por meio de um
patógeno sutil.
No momento, as empresas que produzem DNA por encomenda se mantêm de
olho nos pedidos feitos pelos clientes. Mas, conforme os sintetizadores de DNA
ficam cada vez mais baratos, será que isso viria a ser um tipo de coisa que se
poderia fazer em casa? A melhor hipótese é a de que o poder de criar doenças
venha junto com o poder de combatê-las. Mas a prevenção, de alguma maneira,
deve ser melhor do que uma corrida armamentista em que os seres humanos são
o campo de batalha. Outro consolo pouco satisfatório é que o bioterrorismo é
raro, provavelmente por ser difícil controlá-lo. O terrorismo, por definição, serve
aos objetivos políticos do autor do ataque, mas serve ao interesse de muito pouca
gente a criação de uma forma de vida que poderia infectar e matar com facilidade
seu próprio povo.

Ecologistas temem que os organismos sintéticos, sem querer, se tornem


invasivos. Isso poderia ter dimensões assustadoras se os usássemos para produzir
substâncias químicas industriais em massa. Ter uma panela de bactérias que
viram rapidamente combustível de avião é bom, mas o que acontece se elas
escaparem e fizerem isso num rio? Existe a esperança de que essas bactérias,
criadas para trabalhar sob condições específicas e incomuns, não se saiam bem na
natureza. Mas esses organismos podem trocar genes entre si, evoluindo depressa.
Cientistas estão trabalhando em maneiras de evitar que bactérias sintéticas
troquem genes umas com as outras, mas não há como garantir completamente a
segurança.
E o que dizer dos organismos que estamos criando e que planejamos com o fim
específico de liberar na natureza — os mosquitos de direcionamento gênico já
mencionados? O dr. Silberg tem algumas reservas sobre o ritmo em que
liberamos organismos sintéticos no meio ambiente. “Quero ver as pessoas que
trabalham com genética molecular interagindo muito mais com os ecologistas
para garantir que entendemos totalmente o potencial de impacto ambiental
enquanto consideramos os potenciais benefícios. Porque há um campo inteiro da
ecologia em que se pensa nas maluquices feitas na Austrália ao longo dos anos,
nas catástrofes que ocorreram por não pensarem no que isso significa a partir de
uma perspectiva do ecossistema.” Por exemplo, introduzimos o sapo-cururu na
Austrália para controlar um besouro nativo que atacava plantações de cana-de-
açúcar. Os sapos se reproduziram loucamente e começaram a se espalhar pelo
país. Eles produzem uma toxina que mata seus predadores e, à medida que se
espalharam, mataram predadores nativos (e alguns animais de estimação
azarados).
Esse problema fica um pouco mais pessoal quando consideramos a introdução
de organismos sintéticos no nosso corpo. Mesmo que eles sejam cuidadosamente
projetados, pode haver algum risco de uma mutação que os torne perigosos. Mas,
como observa a dra. Silver, as mutações perigosas já são uma possibilidade para as
bactérias não sintéticas que habitam o nosso corpo.
No próximo capítulo, discutimos o uso da CRISPR-Cas9 para solucionar
distúrbios genéticos em seres humanos. A maioria das pessoas aceita bem a ideia
de usar as técnicas da biologia sintética para curar doenças em adultos, mas
alguns cientistas também propõem usar a CRISPR-Cas9 para curar doenças em
embriões humanos, fazendo mudanças que seriam transmitidas para as gerações
seguintes.
Alguns argumentam que os benefícios superam os riscos. Mas onde iríamos
parar? Se somos capazes de modificar embriões humanos, o que nos impede de
projetar bebês? Ajustar o cabelo, os olhos, a pele, talvez até o QI, poderá ser uma
opção daqui a uma ou duas gerações.
Mas não será uma opção para todos. Num mundo de pessoas com tudo e
outras com nada, um grupo pode ser capaz de produzir uniformemente crianças
super-humanas e outro grupo corre o risco de lidar com distúrbios genéticos
facilmente solucionáveis.
No momento em que estamos escrevendo isto, os cientistas do Reino Unido
têm permissão para modificar embriões humanos, ao passo que os cientistas do
Estados Unidos não têm. Na China, a CRISPR-Cas9 foi usada para modificar
embriões humanos, e os resultados foram terríveis. Muitas coisas deram errado,
incluindo o surgimento de mutações inesperadas. Lembre-se: não sabemos ainda
o que estamos fazendo nesse campo. Mesmo que um humano projetado fosse
criado com êxito, não sabemos como seus genes afetariam futuras gerações.

Como isso mudaria o mundo?


Estamos vivendo o mais incrível dos tempos. Já não temos o fardo dos experimentos
maçantes; somos limitados apenas pela imaginação.
• Dr. George Church

Biólogos sintéticos querem que seus conhecimentos tenham mais visibilidade e


sejam mais acessíveis. Em um período menor que o de uma vida humana média,
paramos de nos perguntar sobre a estrutura do DNA e passamos a reprogramá-lo
com nossa própria maquinaria. Num futuro mais distante, isso poderia ter alguns
desdobramentos radicais. Por exemplo, armazenar memória em DNA.
Como? Bem, lembre-se de que toda a memória do seu computador é apenas
uma combinação de 0s e 1s. O DNA é apenas uma combinação de letras — A,
C, T, G. Em certo sentido, é como uma versão ultracompacta das tiras dos
computadores com fitas magnéticas de antigamente. Sintetizando DNA com o
código certo, daria para armazenar até dez bilhões de gigabytes de dados num
espaço menor do que uma gota d’água. Isso são cinquenta milhões de cópias do
filme O Senhor dos Anéis, ou meia cópia do Windows 10. E o DNA é uma
molécula extremamente estável, com uma meia-vida de cerca de quinhentos anos,
o que significa que, em quinhentos anos, metade das informações estará
degradada.
Ainda não fazemos isso fora do laboratório, porque preencher fitas
customizadas de DNA é caro. Neste momento, custa até 10 centavos de dólar por
letra. Para se ter uma referência, o genoma humano tem cerca de três bilhões de
letras. Cientistas esperam que a procura por síntese de DNA diminua o preço. O
dr. Church propôs uma continuação do Projeto Genoma Humano, em que seja
sintetizado o genoma humano completo como forma de começar a baixar esse
custo.
No futuro, talvez consigamos levar organismos sintéticos para o espaço. Como
você já sabe muito bem, levar coisas para o espaço é dispendioso. Com bactérias
para fabricar produtos e reciclar resíduos, poderíamos fazer um uso muito melhor
dos recursos disponíveis. Isso ganha importância especial se o plano for instalar
colônias em outros planetas e luas. Bactérias poderiam ser especialmente
projetadas para trabalhar em qualquer ambiente local para produzir qualquer
recurso necessário. E como essas bactérias se replicariam, só seria preciso levar
algumas delas com você.
Os chamados OGMs (organismos geneticamente modificados) adquiriram
uma reputação meio ruim de “comida Frankenstein”, ou “frankenfood”, no
discurso popular. Nossa visão é a de que se um frankenfood fornecer mais calorias
e vitaminas a comunidades pobres, isso é uma vitória. Mas, mesmo que queira
seus tomates intocados por mãos de bioengenheiros, você poderia reconhecer que
os OGMs podem nos dar também maior acesso a remédios e a combustível
limpo.
Conforme aprendemos mais, a linha entre a biologia sintética e a
nanotecnologia vai perdendo o sentido. Estamos em busca de máquinas cada vez
menores, e a biologia teve quatro bilhões de anos a mais para aprender a fabricá-
las.
Recentemente, cientistas criaram uma nova forma de DNA. O DNA comum,
que você agora conhece, tem quatro letras químicas: A, C, T, G. O novo DNA
tem duas novas letras: X e Y. Isso é totalmente estranho — algo que nos deixaria
boquiabertos se tivéssemos encontrado em outro planeta. Mas, em vez disso,
criamos em laboratório. E não é apenas ótimo — é uma porta para muitas
possibilidades.
O DNA normal pode fazer vinte aminoácidos — os blocos de construção das
máquinas moleculares da vida. Esse novo DNA pode fazer 172 aminoácidos. O
número de proteínas possíveis que ele poderia fazer inclui muitas que nunca
foram feitas na natureza.
Esta é a promessa da biologia sintética: não apenas mudanças na vida
conforme a conhecemos, mas a criação da vida conforme poderíamos imaginá-la.

Nota bene sobre desextinção


Atualmente, algo entre duzentas e duas mil espécies são extintas a cada ano, e
grande parte disso é por nossa culpa. Como analogia, imagine a humanidade
como mandíbulas gigantes engolindo tudo que é bonito e excretando esse
espetáculo espalhafatoso que chamamos de civilização. Justiça seja feita, a
civilização criou os nachos, então, você sabe... há prós e contras.
Poderíamos parar de destruir habitats e de introduzir espécies invasivas, é claro,
mas até agora nossos antecedentes não têm sido muito bons.
Como os ecossistemas são complexos, o extermínio de uma espécie — mesmo
uma que pareça ter um efeito pequeno sobre a comunidade ao redor — talvez
resulte na extinção de outras. Essa extinção colateral pode causar outras
extinções, e assim por diante. Mas e se conseguíssemos deter a onda de
destruição trazendo de volta espécies perdidas recentemente? Preservar esses
ambientes diversificados intactos é um dos objetivos de cientistas que estudam a
ressuscitação de espécies extintas. Sim. Estamos falando de ecossistemas.
Certamente não de montar em dinossauros e comer hambúrguer de mamute.
Está bem, então você quer trazer de volta animais que morreram há muito
tempo. Isso não é tão fácil quanto pareceu em Parque dos Dinossauros. Para ter
uma chance, seria necessário ter o genoma do organismo perdido. Faz apenas
algumas gerações desde que os humanos descobriram que o DNA carrega a
hereditariedade, então não é justo esperar que homens das cavernas tenham
preservado o DNA do mamute em recipientes climatizados para nós. No
entanto, muito de vez em quando, por acidente, a natureza preservou DNAs
antigos.
Quanto mais tempo o DNA fica exposto às condições do tempo, mais ele
degrada. Atualmente, cientistas acham que após cerca de um milhão de anos de
degradação não se pode recuperar o DNA. Esse fato elimina quase todas as
espécies mais incríveis. Por outro lado, deixa muitas possibilidades: mastodontes,
dodôs, tigres-dentes-de-sabre e talvez até parentes quase humanos, como
Neandertais de sangue puro.
Conversamos com a dra. Beth Shapiro, da Universidade da Califórnia em
Santa Cruz, para descobrir como poderíamos conseguir um mamute de
estimação. Você sabe... para os ecossistemas ou sei lá.
A primeira coisa a fazer é localizar o máximo possível de genomas do mamute.
Não é uma tarefa simples. Mesmo que um mamute esteja bem preservado na
tundra russa e você obtenha uma boa amostra do DNA, apenas um pequeno
percentual dessa porção pertence ao mamute. O restante do DNA pertence aos
micróbios que viviam no solo, ao cientista que não tomou cuidado suficiente ao
mover a carcaça ou aos homens das cavernas que pensaram consigo mesmo “Que
se danem os geneticistas do futuro” e cuspiram no mamute morto durante a Era
do Gelo.
Então é preciso filtrar os dados para encontrar a pequena quantidade de DNA
que de fato fez parte daquele mamute, e depois fazer o melhor possível para
descobrir de que lugar do genoma do mamute são essas sequências de DNA.
Com sorte e paciência, talvez dê para montar um genoma de mamute muito
próximo daquilo que teríamos encontrado há vinte mil anos. Mas é impossível
obter o genoma inteiro do mamute. Inevitavelmente,90 algumas peças estarão
faltando, e as peças válidas serão tão pequenas e estarão tão espalhadas que
precisaremos de uma “cola” para saber como pô-las de volta.
Agora a tarefa é pegar o genoma do elefante-asiático e compará-lo ao que
temos do genoma do mamute. Os elefantes-asiáticos têm um parentesco próximo
com os mamutes, então podemos pegar um genoma inteiro do elefante-asiático e
inseri-lo nos genes do mamute onde for apropriado. Esses genomas
provavelmente diferem em 1%, mas ainda assim é muito genoma para ajeitar. São
muito mais consertos do que é possível fazer no momento com as técnicas atuais.
As tentativas a curto prazo de desextinção do mamute podem ser mais
elefantinas91 do que o desejado.
Mas agora digamos que você obteve o DNA do mamute. Bem, o DNA não se
transforma de maneira espontânea num animal totalmente desenvolvido. Se
fizesse isso, haveria muito mais pais adolescentes. Inserimos o DNA do mamute
num óvulo de elefanta e fertilizamos uma mamãe elefanta-asiática com um bebê
mamute-lanoso. Isso aumenta o problema da elefanticidade, porque o útero de
um elefante moderno pode ter condições crucialmente diferentes, em razão da
genética, da dieta, dos hormônios e assim por diante.
E, depois de nascer, um mamute precisa de micróbios de um elefante moderno.
“Então”, diz a dra. Shapiro, “ele nasce e come um pouco de cocô de elefante,
porque esses espécimes fazem isso para estabelecer a comunidade de micro-
organismos que vivem em seus intestinos e que podem ser usados para decompor
os alimentos que elefantes e mamutes comem. Então ele terá o microbioma de
um elefante.” Bem-vinda de volta à Terra, criatura morta há um tempão! Bem-
vindo de volta, único representante de sua espécie! Agora, coma um pouco de
cocô.
Voilà, conseguimos um mamute, embora ele tenha algumas características de
elefante. Se o objetivo era recriar em 100% os mamutes perdidos, você
provavelmente não chegou lá. Mas se o objetivo era criar um animal que
desempenhava um papel importante num ecossistema antes de este ser perdido,
bem, então talvez o mamute com um quê de elefante seja satisfatório.
Como nos diz a dra. Shapiro, “uma reposição ecológica realmente pode
devolver essas interações ecológicas que desapareceram por causa da extinção de
modo a revitalizar esse ecossistema e salvar espécies vivas da extinção. É isso o
que considero o ponto forte dessa abordagem. Não temos elefantes adaptados ao
frio, mas usaríamos a biologia sintética para fazê-los. Desse modo,
substituiríamos o componente perdido do ecossistema e restauraríamos os ricos
campos gramados que havia na Sibéria, criando habitats para animais como
antílopes-saigas, cavalos selvagens e bisões”.
Suponhamos por um segundo que nossa tecnologia um dia avance a ponto de
ser possível clonar um mamute. Onde ele vai viver? Os mamutes viviam na
Sibéria, mas será que os siberianos receberão os mamutes de braços abertos?
Talvez não. Os lobos-cinzentos foram reintroduzidos no Yellowstone National
Park em 1995, e os fazendeiros da região não ficaram muito empolgados. Houve
processos e os fazendeiros tiveram problemas por atirar em lobos para proteger
seu gado.
Mas acontece que já existe um habitat na Sibéria esperando o retorno dos
mamutes. O dr. Sergey Zimov está esperando por eles e reservou uma terra onde
espera que os mamutes voltem a passear um dia. Ele, provavelmente com o
turismo em mente, batizou a terra de Pleistocene Park.
Talvez a esta altura você esteja pensando: Então não há como trazer de volta os
dinossauros? Conversamos por telefone com uma especialista e perguntamos a
ela.
“Usando um computador, poderíamos remodelar a sequência de como seria o
genoma do ancestral de todas as aves vivas e dinossauros aviários, e isso formaria,
em essência, um dinossauro. Não seria um tiranossauro, um braquiossauro ou um
velocirraptor, porque não temos o DNA deles, mas teríamos algo que foi
contemporâneo de dinossauros e ancestral de todas as aves vivas. Poderíamos usar
a biologia sintética para trocar de modo gradual trechos do genoma da ave
moderna (dinossauro vivo) por essa ave ancestral (dinossauro) inferida por
computador.”
Bem, não passamos a infância sonhando em montar um ancestral de ave
concluído por computador, mas... quase isso.
69. Sim, isso existe. O termo significa ou um bolo no qual se usa cerveja para dar sabor e fofura ou (pelo
visto) um monte de cervejas perfeitamente arrumadas em cilindos empilhados, às vezes acompanhadas de
fogos de artifício, uísque e bilhetes de loteria. Deus abençoe a América.
70. Por acaso, as proteínas dos nuggets são, de fato, proteínas num sentido científico mais amplo. Elas
derivam de um tipo de proteína longo e reto que permite aos frangos andar para lá e para cá antes de serem
nuggetizados.
71. Na verdade, o RNA usa uma base diferente de T. Essa base diferente é abreviada como U. Para tornar o
texto mais claro, estamos deixando isso de fora, mas, como você é bobo o bastante para ler a nota de rodapé,
achamos melhor você saber. O U é quimicamente muito semelhante ao T, portanto pode ser que você se
pergunte por que o RNA se importa em usar algo diferente. Não podemos ter certeza, mas há um bom
motivo pelo qual você poderia preferir o U (de “uracila”) no RNA e o T (de “timina”) no DNA. Resumindo:
o U é de qualidade um pouco inferior em relação ao T. Dentro da célula, o U demanda menos energia para
produzir, mas tem uma probabilidade maior de degradar. Isso não é problema para o RNA, que tem vida
curta. Mas o DNA é a cópia mestra para o RNA, então precisa ser mais robusto.
72. Para o jovem leitor: milhares de anos atrás, no século XX, havia um brinquedo chamado Silly Putty —
uma substância semelhante a argila com uma cor marrom-alaranjada inofensiva. Antes de existir diversão,
você se entretinha pressionando Silly Putty sobre um papel com tinta de impressão. Quando você levantava
a argila do papel, conseguia uma cópia espelhada do que estava impresso no papel.
73. Não, não estou.
74. Alguns exemplos de características “monogênicas” são albinismo e doença de Huntington, além de cera
de ouvido úmida ou seca. Sim, há dois tipos de cera de ouvido. Asiáticos e indígenas americanos tendem a
ter o tipo seco, enquanto os demais tendem a ter o tipo úmido.
75. O processo de verdade é substancialmente menos romântico, e é provável que contenha um fazendeiro
comprando sêmen de touro e o recebendo pelo correio. Por acaso, aqui estão alguns nomes de vendedores de
sêmen de touro que encontramos no Google: Bovine Elite, LLC; Universal Semen Sales, Inc.; Sure Shot
Cattle Company; e Select Sires, Incorporated.
76. Esse “provavelmente” não é de todo uma brincadeira. Algumas pessoas ainda discutem se deveríamos ter
nos afastado da insulina animal. Ela não está disponível nos Estados Unidos, mas em vários países você pode
comprar uma insulina animal chamada Hypurin. Alguns pacientes preferem essa versão, e pelo visto ela não
é absurdamente cara se comparada à insulina derivada de bactérias modificadas.
77. O gênero “Saccharomyces” vem das palavras gregas para “açúcar” e “fungo”, enquanto o nome da espécie,
“cerevisiae”, vem da palavra “cerveja” em latim. As pessoas que criaram o nome pelo visto não se importaram
em misturar grego e latim, talvez por causa dos efeitos da S. cerevisiae.
78. O dr. Scott Solomon, da Rice University, sugeriu que apontássemos que os bebês mosquitos não são
miniversões dos adultos, mas “larvas semelhantes a vermes que se contorcem em água parada”. Portanto, não
tão bonitinhos, nem mesmo para mosquitos.
79. Não há. Que meleca!*
* Desculpe.
80. Se você precisa saber, chama-se autorregulação transcricional positiva.
81. Bem, válvulas de coração de porco têm sido usadas em substituições de válvulas de coração humano com
grande sucesso há mais de uma década. Mas daí a substituir algo como um coração inteiro vem a ser muito
mais difícil.
82. O coração do porco foi costurado no abdome do babuíno, mas não substituiu o coração do babuíno.
Ainda assim, foi um passo na direção certa.
83. Sigla em inglês para “porcine endogenous retroviruses”. A observação entre parênteses se refere
ironicamente ao fato de “pervs” em inglês significar também “pervertidos”. (N. do T.)
84. Desculpe.
85. Na verdade, são as formas estáveis H2 e O2, mas você entendeu a ideia.
86. Você ouviu isso? É o som da gente resistindo à vontade de fazer uma piada com Nova Jersey aqui.
87. Mycoplasma mycoides. Ele tem um genoma ligeiramente maior, mas se reproduz muito mais rápido que o
M. genitalium, o que facilita na hora de trabalhar em laboratório.
88. Fato curioso: mais de 30% dos genes que eles mantiveram não têm nenhuma função conhecida, mas pelo
visto eram cruciais para o organismo permanecer vivo. Portanto, mesmo com o lobo alfa Venter no comando,
estamos mexendo numa linguagem que ainda não entendemos completamente.
89. Ainda há amostras trancadas a sete chaves em centros de pesquisas de doenças na Rússia e nos Estados
Unidos. Você sabe, exceto quando não estão trancadas a sete chaves... como quando alguém do Centro de
Controle de Doenças dos Estados Unidos esqueceu alguns frascos de varíola num armário. Os frascos foram
redescobertos muitos anos depois. Ops!
90. Nem todos os cientistas acham que é inevitável a falta de algumas peças do mamute-lanoso. O dr.
George Church, por exemplo, está trabalhando na desextinção do mamute-lanoso e acha que talvez
tenhamos um dia o genoma completo dessa espécie.
91. Medidas em unidades de elefanticidade por litro.
SEÇÃO 3
Você, logo, logo
9.

Medicina de precisão
Tudo o que há de errado especificamente com você — uma
abordagem estatística

Antes do século XIX, fazer um tratamento médico era horrível. A anestesia


consistia em uma dose (ou duas) de uísque e os remédios não passavam de curas
tradicionais como sangria e banha de ouriço, sem qualquer validação empírica.
No mundo moderno, contamos com o fato de que os médicos praticantes têm
uma profunda aliança com os pesquisadores científicos. Os pesquisadores testam
tratamentos para ver o que dá certo, e os médicos consideram as evidências ao
decidir o que fazer com os pacientes.
Um bom médico é uma espécie de Sherlock Holmes para o seu corpo. Estando
doente ou não, seu corpo emite de forma constante pequenas pistas sobre seu
estado interno. Algumas dessas pistas são bastante claras — se houver um buraco
gigante na sua cabeça, o médico vai ter certeza sobre o que o aflige.
Outros casos podem ser muito difíceis de desvendar. Por exemplo, a maioria
dos pacientes que recebeu diagnóstico de mononucleose só o obteve depois de
muitos outros palpites errados.92 Na verdade, não é culpa do médico — a
mononucleose é uma doença viral que dura muito tempo, e seus sintomas são
genéricos, como fadiga, dor de cabeça e dor de garganta. É mais ou menos como
uma ressaca moderada constante, o que dificulta muito diferenciá-la da existência
humana básica. Mas, se verificassem primeiro quais são as moléculas que
prevalecem em sua corrente sanguínea, os médicos poderiam diagnosticar que
você tem mono, e não um resfriado.
O que os médicos chamam há muito tempo de “sintomas” ou “sinais”,
pesquisadores mais inclinados para a computação chamam agora de
“biomarcadores”. Numa definição ampla, um biomarcador é praticamente
qualquer coisa que nos diz sobre o estado interno de alguém, em geral indicando
se algo ali está errado. Mais comumente, os biomarcadores são sintomas
tradicionais, bem como pistas químicas no seu corpo, mas alguns pesquisadores
acham que o termo pode ser ampliado para abarcar padrões de comportamento,
como os sites que o usuário acessa e as imagens postadas na internet. Por assim
dizer, se houver um modelo de computador chamado “Como estou indo?”, um
biomarcador é qualquer dado que pode ser colocado nesse modelo para ajudá-lo a
encontrar uma resposta.
Assim como a união de ciência e prática médica resultou na medicina
moderna, a união de ciência médica com análise molecular, ciência de dados e
aprendizado de máquina talvez resulte em um novo paradigma, que está
chegando e sendo chamado de medicina de precisão. No futuro, você poderá
receber diagnósticos determinados de maneira rápida e acertada com base em
milhares de biomarcadores, seguidos de tratamentos feitos sob medida para você.
Isso significa que você viverá mais, com mais saúde e — se os sistemas de
detecção ficarem baratos e práticos o bastante — não passará nem de longe tanto
tempo se perguntando se aquele calombo na sua nádega direita é câncer. Sem
falar que, se o diagnóstico e o tratamento de doenças se tornarem uma questão de
poder computacional, terão potencial para (pelo menos uma vez na vida) reduzir
o custo da assistência médica.
Numa única gota do seu sangue há uma quantidade impressionante de
informações. Pode haver biomarcadores químicos associados a uma insuficiência
cardíaca incipiente. Ou um código genético de um tumor sólido não detectado.
Ou biomarcadores hormonais que nos revelam que o paciente está mais
estressado do que imagina.
O conhecimento profundo desses biomarcadores sutis não apenas leva a
diagnósticos melhores, como também sugere novos tratamentos. Se uma pessoa
tem câncer, essa condição contém certas mutações genéticas que conseguimos
localizar. Depois de localizarmos essas mutações, podemos escolher os melhores
tratamentos ou “sair da caixinha” e escolher um tratamento que possa funcionar
embora não tenha sido elaborado para a doença que ela tem. Com os métodos
mais recentes, temos até condições de criar uma técnica geral para lidar com
qualquer doença que tenha surgido de uma mutação genética.
À medida que obtemos mais dados sobre toda a variedade e complexidade dos
corpos humanos, e conforme passamos a analisar melhor essa informação, nós
nos aproximamos de um tempo em que um computador fará um diagnóstico
perfeito e selecionará o método de tratamento ideal. Esse sonho pode parecer
distante — pelo menos alguns de seus aspectos estão bem longe da realidade —,
mas, lembre-se, o corpo humano é de uma complexidade finita.93 Cada avanço
nos deixa mais perto da linha de chegada.

Em que pé estamos agora?


Para se ter uma ideia de como o campo mudou nos últimos cinquenta anos,
Kelly se reuniu com o dr. Mendelsohn, do MD Anderson Cancer Center.
Vamos imaginar, hipoteticamente, que você não fez sua pesquisa sobre o dr.
Mendelsohn porque um colega confiável lhe disse que esse médico era a pessoa
perfeita para conversar sobre medicina de precisão. Mesmo que fosse tão burro
assim, você logo saberia como o dr. Mendelsohn é importante porque procuraria
o endereço dele depois de chegar ao campus do MD Anderson Cancer Center e
descobriria que o escritório dele fica no John Mendelsohn Faculty Center Building.
Nesse momento, hipoteticamente, você, em pânico, faria uma busca no Google
por “John Mendelsohn” e descobriria que ele é, na realidade, ex-presidente do MD
Anderson Cancer Center.
Ainda no plano das hipóteses, você respiraria fundo, descobriria agora que suas
axilas estavam ensopadas de suor e, de maneira resoluta, bateria na porta dele.
Felizmente para o você hipotético, o dr. Mendelsohn é um homem simpático e
receptivo. Depois de conversar algum tempo sobre a pesquisa de Kelly, ele cedeu
trinta minutos do seu tempo que provavelmente deveriam ter sido gastos para
salvar o mundo. Pedimos desculpas por isso.
Quando o dr. Mendelsohn nasceu, os cientistas não sabiam que nosso material
genético é feito de DNA. Quando ele estava na escola de medicina, a descrição
nos livros sobre a formação de proteínas era totalmente equivocada. Quando ele
era um jovem pesquisador, a quantidade de dados obtida a partir de um único
experimento era primitiva se comparada aos padrões modernos.
“Quando se sequencia um genoma humano, obtêm-se cinco bilhões de dados.
Quando comecei a fazer minhas pesquisas, os resultados podiam ser impressos
num pedaço de papel, e depois numa folha mais longa. Não há como imprimir
cinco bilhões de informações e analisá-las no seu cérebro. Hoje, no MD
Anderson Cancer Center, estamos sequenciando o DNA dos cânceres de
milhares de pacientes a cada ano para detectar as aberrações genéticas que
causam a malignidade deles.”
Como a medicina se torna cada vez mais personalizada, e os corpos individuais
viram mananciais de dados, talvez seja possível encontrar diagnósticos e até curas
simplesmente (“simplesmente”) procurando padrões ao analisar as informações.
Mas só conseguiremos nos beneficiar da medicina de precisão se coletarmos
dados de muita gente ao longo do tempo e encontrarmos formas de armazenar e
analisar essa informação toda, o que exigirá muita inovação por parte de
cientistas de computação e estatísticos.
Os Institutos Nacionais de Saúde lançaram recentemente o Precision
Medicine Initiative Cohort Program [Programa Coorte de Iniciativa de
Medicina de Precisão]. O programa coletará informações sobre a saúde e o meio
ambiente de um milhão de participantes, incluindo dados sobre seus “-omas”.
Falaremos sobre vários “-omas” neste capítulo, então aqui vai uma rápida
definição: quando um cientista acrescenta “-oma” no fim de uma palavra, ele quer
dizer algo como “... isso tudo”. Portanto, um geneticista estuda genes específicos
enquanto um genomicista estuda todos os genes.94 Tipo... todos eles.
Com isso, parece que o genomicista é mais inteligente, só que é mais ou menos
como a diferença entre um psicólogo e um sociólogo.95 O sufixo -oma
atualmente é uma convenção de nomenclatura que está na moda.
Os Institutos Nacionais de Saúde pegarão os genomas, microbiomas e outras
informações desses indivíduos e depois os acompanharão por um tempo com o
intuito de rastrear mudanças na saúde deles. Os dados estarão disponíveis para
médicos, que poderão fazer um pente-fino em busca de associações entre doença,
genética e fatores ambientais. Isso criará um imenso conjunto de dados.
Infelizmente, grandes porções de dados não se levantam e dizem a você o que
está acontecendo. É um problema que tem preocupado o dr. Sandeep Menon, da
Pfizer. “A quantidade de dados que está entrando é quase exponencial e (...) as
pessoas disponíveis com o conjunto de habilidades adequadas para analisá-los é
minúscula. Falando de forma direta, a demanda é maior do que a oferta.”
O dr. Menon é um bioestatístico de elite. Ele é vice-presidente e chefe do
Biostatistics Research and Consulting Center da maior empresa farmacêutica do
planeta, e até ele acha “desafiador manter-se em dia com as mais recentes
técnicas desenvolvidas para navegar no dilúvio de dados”.
O que preocupa o dr. Menon é que há muitos analistas que simplesmente não
sabem lidar com seus dados. Na visão dele, muitos erros estão sendo cometidos, o
que retarda o avanço no campo e acaba prejudicando pacientes.
Apesar da dificuldade de organizar toda essa informação, está havendo
progresso em muitas frentes. A medicina de precisão é grande demais para ser
abordada por completo, então decidimos oferecer alguns exemplos específicos
que lhe darão uma ideia do que esse campo pode fazer.

Doenças genéticas

O rápido avanço da tecnologia de leitura de genes faz com que o seu genoma
sequenciado seja relativamente barato — na ordem de milhares de dólares,
quando já custou dezenas de milhões. Mas diagnosticar um problema não é a
mesma coisa que o sanar.
É especialmente difícil solucionar distúrbios genéticos. Ao contrário do que se
costuma afirmar na mídia, não dá para “editar o DNA de uma pessoa” da mesma
forma que se edita um documento. Quase todas as células do seu corpo contêm
fitas de DNA. Para alterar seu genoma, você teria que modificar todas as suas
células, ou pelo menos todas as suas células que são relevantes para a sua doença.
Por exemplo, a fibrose cística é um distúrbio genético em que o corpo produz
muito muco espesso em órgãos internos. Muco espesso nos pulmões é tão ruim
quanto parece: aumenta o risco de infecções e dificulta a respiração.
Outro problema é muco no pâncreas. É uma condição terrível, pois dificulta
muito a absorção de nutrientes. Antigamente, um diagnóstico de fibrose cística
significava que era improvável sobreviver muito além dos vinte anos. Avanços
levaram pacientes a viver mais de trinta ou quarenta anos, mas todos esses
avanços são formas de tratar o problema do muco, não o reparar em sua raiz
genética.
Parte da dificuldade é que não existe apenas uma fibrose cística. O acúmulo de
muco que torna a doença identificável para os médicos pode ser resultado de
qualquer mutação genética entre muitas opções.
Um medicamento chamado ivacaftor foi desenvolvido recentemente para lidar
com uma variante genética específica da fibrose cística. A mutação específica que
o medicamento tem como alvo é encontrada em apenas 5% das vítimas de fibrose
cística. Na medicina, conforme ela é praticada hoje em dia, isso não é bom. Mas
no paradigma da medicina de precisão, a ideia é que com o passar do tempo
consigamos um tratamento que tenha como alvo cada mutação possível. Então,
quando você nasce, identificamos seu problema genético e sabemos exatamente o
tratamento a ser usado. Com isso, você não apenas recebe o tratamento certo
como evita alguns tratamentos errados e com certeza desagradáveis.
Mas, num nível mais profundo, isso ainda é apenas lidar com o problema de
forma paliativa. E se pudéssemos consertar o código danificado em todas as
células certas?
No capítulo anterior, discutimos uma nova técnica de edição de genes chamada
CRISPR-Cas9. Ela permite aos cientistas consertar de fato as mutações que
estão causando fibrose cística nos pacientes. Caso você já tenha alcançado a
façanha de esquecer o que a CRISPR faz, a versão resumida é que agora
podemos cortar e substituir partes do DNA em células. Em princípio, isso nos
levaria a cortar e consertar qualquer mutação que estiver causando fibrose cística
numa pessoa viva.
A CRISPR já funcionou em pedaços de tecido intestinal em laboratório, o que
dá uma ideia de como é divertido o trabalho em um lugar desses. Descobrir como
aplicar a técnica em pacientes de verdade ainda é um grande obstáculo, e
cientistas temem que possamos bagunçar outras partes do genoma ao tentarmos
reparar as mutações. Ao editar um trilhão de células de uma vez, o ideal é não ter
muitas surpresas.
Mas o legal da CRISPR é que se trata de uma ferramenta geral para resolver
distúrbios genéticos. Qualquer doença causada por uma ou mais mutações
genéticas seria vulnerável a esse método de editar genes específicos. Se a
CRISPR acabar sendo uma bala de prata para problemas de gene, seria possível
dispará-la contra a doença de Huntington, anemia falciforme, doença de
Alzheimer e outras.

Diagnóstico, tratamento e monitoramento de câncer

DIAGNÓSTICO
É difícil matar células de câncer pelo mesmo motivo que será difícil matar
androides secretos na Revolta dos Robôs de 2027: eles se parecem com a gente.
Uma célula de câncer é uma célula que estragou; que deveria ter servido a uma
função útil do corpo, mas que nasceu com — ou adquiriu — um estranho
conjunto de mutações que a faz gerar cópias de si mesma repetidamente, em vez
de fazer seu trabalho. No caso de um tumor sólido, o paciente basicamente tem
uma nação de células ruins morando e se reproduzindo em seu corpo.
Células mutantes, incluindo as cancerosas, nascem no corpo o tempo todo. Em
geral, o sistema imunológico mira nelas e as elimina. O problema é que de vez
em quando o indivíduo adquire uma célula muito rara, que se reproduz sem
controle e escapa do sistema imunológico, seja evitando a detecção ou
convencendo as células imunológicas a não a matar.
Então, até receber um diagnóstico de câncer, a pessoa já está com células muito
perigosas no corpo. Nesse momento, a medicina precisa entrar onde o sistema
imunológico falhou. Mas descobrir um câncer pode ser difícil.
Historicamente, a leucemia é um dos cânceres de detecção mais fácil, porque é
transportado pelo sangue e deixa um acúmulo de glóbulos brancos que o
denuncia.96 Os tumores sólidos, sobretudo os pequenos, podem ser muito mais
furtivos. É por isso que os médicos pedem a pacientes que façam exames de
mama regularmente — mesmo tumores rígidos podem ser sutis quando estão
escondidos num corpo humano mole.
O diagnóstico precoce é mais do que mera conveniência. Muitos dos cânceres
mais mortais são perigosos não por serem especialmente agressivos, mas porque
só causam sintomas sutis, até que já é tarde demais para detê-los.
De acordo com o Instituto Nacional do Câncer, a chance de sobreviver por
cinco anos com câncer de pulmão é de 55% se ele for detectado logo no início.
Mas a maioria das pessoas não recebe o diagnóstico tão cedo assim. Mais da
metade dos pacientes de câncer de pulmão só recebe o diagnóstico quando a
doença já entrou em metástase,97 e a essa altura o índice de sobrevivência de
cinco anos é de mais ou menos 5%.
Portanto, queremos encontrar o câncer o mais cedo possível.98 E acontece que
a leucemia não é o único câncer que deixa um biomarcador no sangue. Todos os
tipos podem ser detectados por meio da busca por pequenas moléculas chamadas
microRNAs.
No capítulo anterior, demos uma explicação resumida de como o DNA cria
proteínas, mas mencionamos que o verdadeiro processo pode ser mais
complicado. O microRNA adiciona um pouco mais de complexidade ao caso.
O microRNA ainda não é perfeitamente compreendido, mas um papel
importante que ele parece ter é na chamada expressão gênica. Pense nisso da
seguinte maneira: imagine que você tem um gene que é um código para nariz
vermelho brilhante. Conforme dissemos, “código para” não é uma boa expressão
para tal, portanto sejamos mais específicos: seu DNA codifica uma proteína que
automaticamente vai para a ponta do seu nariz e lhe confere um brilho vermelho.
A intensidade do vermelho no nariz depende de quantas proteínas são criadas. O
microRNA pode fazer ajustes aqui. Vamos supor que a sua receita genética para
essa proteína imaginária termine normalmente com “repita isso dez vezes”. Essas
“dez vezes” podem ser ajustadas para mais ou para menos pelo microRNA, dando
a você ou um nariz claro e triste ou um nariz rubro e vibrante.
Está bem, então está claro, mas e daí? De modo muito conveniente para a
medicina, essas pequenas moléculas de microRNA podem ser encontradas na
corrente sanguínea. Pedacinhos específicos ou concentrações alteradas delas
podem nos dizer não apenas quais são os cânceres que o paciente pode ter como
em que estágio esses cânceres estão.
Por exemplo, um estudo verificou que os níveis de quatro microRNAs
específicos indicavam fortemente se alguém com adenocarcinoma de pulmão
tinha probabilidade de viver muito (mais de quatro anos em média) ou pouco
(pouco mais de nove meses). Informações como essas podem ajudar pacientes e
médicos a decidir o grau de agressividade a ser usada para combater o câncer e a
tomar decisões sobre como viver o tempo de vida restante.
Em princípio, sabendo qual microRNA está em seu sangue (e talvez alguns
outros fluidos), podemos fazer uma espécie de leitura sobre quais doenças seu
corpo carrega. Novas proteínas são criadas em resposta a praticamente qualquer
coisa que seu corpo faz, então isso seria uma fonte de informação incrível sobre
exatamente qual é a sua maior disfunção.
Entretanto, descobrir o que há de errado com você não é uma tarefa fácil. Da
próxima vez que estiver procurando algo para ler, considere o miRBase, a base de
dados sobre microRNA (mirbase.org), que, no momento em que estamos
escrevendo este capítulo, está rastreando cerca de duas mil moléculas desse tipo.
Outra molécula que desperta interesse é chamada de ctDNA, abreviatura de
“circulating tumor DNA” [DNA tumoral circulante]. Trata-se de uma descoberta
muito recente, e tem um ótimo potencial para o diagnóstico de câncer. Em
termos simples, quando o paciente tem alguns tipos de tumor sólido, uma
pequena parte do DNA deles pode entrar em sua corrente sanguínea.
Isso não é bom para o paciente, mas é muito útil para o médico dele por duas
razões: torna muito mais fácil detectar os tumores sólidos e mostra que uma
análise genética de um câncer conhecido pode ser feita sem a necessidade de
realizar uma cirurgia invasiva.
Um estudo recente mostrou que se o paciente tem um carcinoma de pulmão
de células não pequenas no estágio 1, podemos detectá-lo 50% das vezes por
meio do ctDNA. Quando o paciente chega ao estágio 2, o câncer se deslocou dos
pulmões para os nódulos linfáticos, mas não teve metástase em outros órgãos.
Geralmente, só descobrimos essa doença no estágio 3 ou 4, quando a
probabilidade de sobrevivência por cinco anos é significativamente mais baixa.
Mas mesmo que dê para encontrar as assinaturas de câncer do ctDNA e do
microRNA, ainda pode ser difícil obter toda a história da doença.
Costumamos nos referir ao câncer tendo em vista o local onde ele é
encontrado — câncer de fígado, câncer ósseo, câncer no cérebro —, mas essa não
é a maneira mais útil de descrevê-lo. Dois tipos de câncer de mama podem provir
de mutações completamente diferentes. Um deles pode ser mortal e o outro é
razoavelmente controlável.
Para tornar as coisas mais complexas, o câncer não para de sofrer mutação uma
vez que existe. Como as células do câncer continuam a sofrer mutação, uma
espécie de sobrevivência dos mais aptos acontece no corpo. Os resultados podem
ser tumores não apenas perigosos, mas também geneticamente diversos.
A diversidade da genética do câncer num único corpo pode tornar o
tratamento extremamente difícil; mesmo que tenhamos uma substância química
que faça os tumores encolherem, pode ser que estejamos reduzindo apenas um
subconjunto do tipo de célula. Então, ao encolher um tumor, talvez tenhamos
matado apenas certo tipo de célula que era vulnerável. Mais tarde, o câncer pode
voltar ainda mais agressivo.
Pior, com a quimioterapia ou radioterapia, pode ter havido outras mutações no
processo. E isso sem falar que passar por esses tratamentos com frequência é
realmente ruim, em parte porque eles não têm como alvo apenas as células do
câncer. Por exemplo, o alvo dos tratamentos de quimioterapia são células que
estão se dividindo rápido demais. Mas algumas células suas, como as do
revestimento do estômago, devem se dividir rapidamente. É como reduzir a
maldade em toda a cidade eliminando todo mundo que tem bigode preto e
longo. Claro, você está se livrando principalmente dos vilões, mas também está
matando aquele hipster simpático que faz o melhor café da cidade. É um negócio
que vale a pena? Talvez. Mas não uma experiência agradável.
Para derrotar o câncer, você precisa descobrir o tratamento certo logo no início
e, assim, não dar tempo ao câncer para que ele tenha muitas mutações. Isso pode
significar fazer exames de sangue anuais para a detecção precoce do câncer e
determinar as mutações que ele carrega. Isso é importante, porque assim é
possível escolher o tratamento certo. Escolher o tratamento errado não é apenas
doloroso; é perigoso. É preferível saber quais são todas as mutações relevantes
para poder fazer o coquetel de medicamentos certo para tratá-las.

TRATAMENTO
Um dos motivos pelos quais as células cancerígenas são tão perigosas é que elas
escapam do seu sistema imunológico. Seria mais ou menos como se houvesse
robôs assassinos à solta sem nenhuma consciência, mas com a habilidade de
imitar humanos. E se pudéssemos treinar a polícia para reconhecer essas
criaturas? Tipo, ei, aquele cara que fica dizendo “afirmativo, humano” e trabalha
como lobista — talvez devêssemos ficar de olho nele.
Da mesma forma, e se pudéssemos ensinar seu sistema imunológico a mirar e
matar células de câncer furtivas?
Funciona assim: você pega um pouco de sangue do seu paciente e encontra ali
células imunológicas chamadas células T. As células T que nos interessam são de
um tipo que reconhece estruturas sobre a superfície de células, chamadas
antígenos. Observando que tipo de antígeno a célula tem, uma célula T decide se
ela precisa morrer.
Se soubermos quais antígenos suas células de câncer têm, poderemos ensinar
suas células T a atacá-los.
Por que as células T? Deixemos que a dra. Marcela Maus, da Harvard Medical
School e do Massachusetts General Hospital, explique: “Há duas coisas que
tornam as células T muito especiais em se tratando de imunoterapia (...) Elas
têm a capacidade de matar outras células e têm memória. São células de vida
muito longa. E depois que viram uma coisa pela primeira vez, elas a reconhecem
rápido na segunda e a eliminam mais rápido ainda.”
Uma modificação genética especialmente bem-sucedida foi ensinar células T a
ir atrás de uma molécula conhecida como CD19, encontrada num tipo de
glóbulo branco chamado célula B. A leucemia e o linfoma com frequência matam
por causa da superprodução desses glóbulos brancos.
Um problema dessa abordagem é que as células T com frequência acabam
matando todas as células B, incluindo as que não são cancerosas. As células B
também fazem parte do sistema imunológico, então a morte de todas as células B
de uma pessoa pode deixá-la imunocomprometida por um período. Não é a
melhor coisa do mundo, mas, em geral, combater uma infecção é preferível a
combater um câncer sanguíneo.
Mas e quando matar todas as células de um tipo potencial não é uma opção
para determinado tumor? Derrotar um tumor cerebral matando todas as células
cerebrais é, em alguma medida, uma vitória pírrica.
A dra. Maus tem uma abordagem mais sutil. Ela faz as células T atacarem um
antígeno que atende por um nome encantador: variante III do receptor do fator
de crescimento epidérmico. Passaremos a chamá-lo pelo fácil acrônimo
EGFRvIII. Nenhuma célula cerebral normal tem EGFRvIII, mas algumas
células tumorais têm. Portanto, se você for “sortudo” o bastante para ter um
tumor com esse receptor específico, as células T poderão ser programadas para
encontrá-lo e matá-lo em particular.
A pesquisa da dra. Maus está em fase inicial, mas há esperança de que no
futuro a imunoterapia prove ser um bom método para atacar precisamente
muitos tipos de tumores sólidos.

MONITORAMENTO
Se o tratamento funciona, o câncer entra em remissão. Mas, a essa altura, ainda
assim é necessário ser monitorado pelo resto da vida. Na verdade, ser “curado” de
câncer é um indicador muito bom de risco de câncer no futuro. Técnicas de
medicina de precisão oferecem maneiras de fazer um trabalho de monitoramento
melhor nesses pacientes.
Por exemplo, se o câncer do paciente está em remissão, ainda podemos vigiar o
ctDNA para garantir que ele não esteja retornando de forma sutil. Temos
também como analisar de maneira contínua o genótipo desse ctDNA para vigiar
mutações ou uma mudança na prevalência de certo tipo. Se a assinatura do
ctDNA começar de repente a indicar tipos mais agressivos de câncer, isso
mudaria a abordagem médica mais desejável.
Essa nova tecnologia está melhorando depressa, e agora encontramos ctDNA
em fezes, urina e outros fluidos. Talvez consigamos em breve fazer um trabalho
muito melhor de monitorar você em relação ao câncer, e poderemos fazer isso
cutucando o seu cocô, e não o seu corpo.

O metaboloma

Uma coisa difícil na medicina é saber como um paciente específico reagirá a


um medicamento. O que funciona bem para uma pessoa pode funcionar mal para
outra, e parte disso é explicada pelo “metaboloma” do paciente. O metaboloma
são todos os seus metabólitos: todas as pequenas moléculas que fazem a
maquinaria do seu corpo funcionar, como açúcares e vitaminas. O metaboloma
não é um sistema simples — a Human Metabolome Database (hmdb.ca)
atualmente rastreia 42 mil metabólitos. São 42 mil tipos de moléculas pequenas.
E isso nem ao menos inclui as proteínas e outras moléculas “grandes” que atuam
no corpo, assegurando que você continue a converter cheesebúrgueres em energia
e músculos necessários para obter mais cheesebúrgueres.
Acontece que as pessoas têm uma variação metabolômica muito grande. Isso
talvez explique por que o café mantém você acordado à noite, enquanto seu
amigo pode tomar um espresso duplo na cama e depois dormir profundamente.
Vocês estão processando as substâncias químicas do café de maneira distinta.
Essas diferenças podem nos dizer muito sobre seu estado interno. Por exemplo,
sabemos há cerca de setenta anos que podemos dizer se uma pessoa é diabética
verificando o nível de glicose dela. Se ela não estiver metabolizando bem a
glicose, encontraremos níveis elevados. Mas, com 42 mil metabólitos circulando
por aí, talvez sejamos capazes de obter mais informações sobre como exatamente
diferentes pessoas têm capacidades metabólicas variadas.
Por exemplo, alguns pacientes deprimidos com tendências suicidas não
respondem a nenhum regime de medicamentos. É possível que algo no
metaboloma deles esteja impedindo ou alterando a absorção do medicamento
apropriado. Levando em conta a medicina de precisão, podemos ser capazes de
determinar de antemão o que o paciente deixará de metabolizar.
Informações metabólicas também ajudariam a nutrição humana. O que
envenena uma pessoa pode não ter efeito algum sobre outra. Isso é especialmente
importante quando o veneno específico é saboroso. Por exemplo, algumas pessoas
têm estados que resultam em hipocolesterolemia, ou seja, por algum motivo elas
não têm muito colesterol no sangue. Isso significa que elas podem comer uma
quantidade maior de alimentos deliciosos ricos em colesterol que você e eu somos
aconselhados a evitar. Talvez haja genes semelhantes que permitam às pessoas
fumar ou beber em excesso ou... mastigar vidro.99 Examinando bem as coisas, um
olhar de precisão sobre um paciente lhe diria que ele deveria evitar certos
alimentos e atividades, mesmo que em geral ele seja considerado saudável. Talvez
sua mãe estivesse errada ao obrigar você a comer brócolis.100
O conhecimento do metaboloma seria especialmente importante para
pacientes que estão em situação médica perigosa. O ideal é que qualquer remédio
com efeitos colaterais seja administrado na menor dose possível que funcione.
Mas com um paciente que tenha um metaboloma incomum, uma dose pequena
pode agir como uma dose grande, ou uma dose grande talvez não funcione. Ao
escolher medicamentos para um paciente, saber como ele os metabolizará
permite evitar tratamentos dolorosos e ir direto ao ponto certo.

Outras coisas que estão tentando matar você

Nas seções anteriores, grande parte do que falamos foi sobre câncer e
problemas genéticos. É porque essas doenças estão entre as mais difíceis de
combater, e só agora estamos começando a ter vitórias significativas. Mas as
técnicas de medicina de precisão devem ser aplicadas a praticamente qualquer
coisa.
Por exemplo, o estresse e a hipertensão podem causar uma doença chamada
hipertrofia cardíaca, que é um perigoso espessamento dos músculos do coração.
Essa condição traz riscos como fadiga, dor de cabeça e morte repentina.
Considerando que os músculos do coração são feitos de proteína, talvez não seja
nenhuma surpresa haver uma assinatura de microRNA para a hipertrofia
cardíaca. De fato, existem inúmeras assinaturas de MicroRNA para várias
modalidades dessa doença. O exame do microRNA no sangue pode nos dar uma
maneira não invasiva de determinar com exatidão o tipo de hipertrofia cardíaca
que você está enfrentando.
Em outras palavras, talvez sejamos capazes de prever que seu coração vai falhar.
Ao levar em conta que a doença cardíaca é o assassino número um no mundo,
ficar de olho seria bem-vindo.
Essa capacidade de monitorar em profundidade substâncias químicas
transportadas pelo sangue também pode ser útil para pacientes que estão fazendo
tratamentos perigosos. Vamos supor que tenhamos um paciente com um
histórico de doença cardíaca e que precisa de um regime de quimioterapia contra
um câncer. Há um risco elevado de insuficiência cardíaca, e quando o paciente
estiver tendo um ataque cardíaco poderá ser tarde demais. Com uma análise do
microRNA, você monitoraria os efeitos da quimioterapia sobre os músculos
cardíacos mais ou menos em tempo real e depois tomaria decisões de acordo com
isso.
Outros estudos recentes mostraram que existe uma assinatura de microRNA
para derrame cerebral. Há também assinaturas de microRNA que revelam como
está o cérebro de um paciente que se recupera de um derrame.
Biomarcadores moleculares nos trazem informações sobre outras doenças,
como as doenças de Crohn, Alzheimer e até que tipo de gripe a pessoa pode ter.
Na verdade, se você for ao Google Scholar e digitar “perfil de microRNA”,
encontrará um grande número de estudos publicados nos últimos anos que
mostram haver assinaturas para praticamente todas as doenças, de câncer de
próstata a depressão. E não só podemos detectar muitas doenças como dizer, com
frequência, quais delas são mais prováveis.
Alguns pesquisadores querem saber não apenas o quadro molecular ou o
quadro clínico, mas também o comportamental. Basicamente, eles querem o tipo
de informação que um stalker bizarro saberia sobre você — a que canais de TV
você está assistindo, que sites você acessa na internet. Essas informações nos
dariam uma pista sobre se você está sofrendo ou não de alguns tipos de doença.
Por exemplo, o dr. Andrew Reece, de Harvard, e o dr. Christopher Danforth, da
Universidade de Vermont, constataram que poderiam prever se um indivíduo
estava deprimido com base na cor e no brilho das fotos que ele postava no
Instagram. As fotos postadas no Instagram por usuários deprimidos tendiam a
ter mais azuis e cinza, e geralmente eram mais escuras do que as fotos postadas
por usuários sem depressão. Acrescentar essas informações de larga escala ao
nosso conjunto de biomarcadores mais sutis pode resultar em categorização e
tratamento melhores de transtornos psiquiátricos.
Pode ser até que esse tipo de monitoramento de atividade (quando feito em
grandes grupos de pessoas) encontre novos e surpreendentes padrões
correlacionados a distúrbios mentais. Talvez você ache que tem ansiedade por ser
desajeitado, mas na verdade é porque está verificando a todo instante como seus
amigos estão se portando no Facebook.
É um pouco mais fácil diagnosticar uma obsessão por redes sociais do que uma
pequena alteração num pedacinho específico do código genético, mas não
necessariamente você sabe dessa informação para compartilhar com o médico.
Indivíduos e grupos podem ter todo tipo de comportamento cuja importância
clínica não tenha sido detectada. À medida que a computação vestível se torna
mais popular, pode ser que você seja capaz de apresentar um quadro mais
completo (e mais honesto) a seu médico. Imagine um futuro glorioso em que
você vai ao dentista e mantém uma conversa simpática com ele até o computador
do seu relógio denunciar a verdade sobre a frequência com que você usa o fio
dental.
Está bem, temos aqui alguns problemas de privacidade. No entanto, é possível
que ter um quadro preciso sobre você — desde o que está lendo e quanto se
exercita até algumas moléculas em sua urina — seja a maneira através da qual um
dia detectaremos os problemas de saúde que você tem e preveremos os que você
pode adquirir.

Preocupações
Um grande problema é e continuará sendo o custo. O ivacaftor, aquele
tratamento para fibrose cística que mencionamos anteriormente, só será usado
por alguns milhares de pessoas nos Estados Unidos. Provavelmente não se terá
nenhuma economia de escala, porque esse tratamento custa cerca de 300 mil
dólares por ano. A não ser que alcancemos os métodos baratos e extremamente
generalizados de preparação de medicamentos, será difícil reduzir o custo de um
produto com tão poucos consumidores.
Outra preocupação é a de como todos esses dados afetarão a psicologia
humana. Sabe aquele seu tio hipocondríaco esquisito? Vamos supor que ele agora
tenha uma quantidade de dados enciclopédica sobre o próprio corpo e tenha
provas de que está sofrendo em 47 indicadores. Sim. Imagine que agora aquela
conversa inconveniente de Natal é baseada em dados.
E depois tem a privacidade. Para saber mais sobre esse problema, conversamos
com a dra. Kirstin Matthews e o dr. Daniel Wagner, da Rice University. A gente
gosta deles. Eles tentam ensinar ética a jovens de 22 anos, o que mostra que têm
senso de humor.
De acordo com a dra. Matthews, “para que a medicina de precisão funcione e
seja de fato útil, é preciso conectar sua genética com seus registros, ou seja, tudo o
que aconteceu com você durante toda a sua vida, sejam lesões, ambientes ou
coisas que aconteceram por causa dos antecedentes genéticos (...) Depois que isso
acontece já não há mais nenhum anonimato”.
Então agora funcionários ou empresas que vendem plano de saúde podem
descobrir quem você é e descobrir se é provável ou não que você sofra de um
distúrbio mental ou tenha uma doença debilitante. Mesmo que esses grupos não
tenham acesso a informações sobre saúde, eles seriam capazes de ligar alguns
pontos sobre sua saúde mental simplesmente analisando sua presença nas redes
sociais. O mesmo grupo que conseguiu ver depressão em sua seleção de fotos no
Instagram também detectou depressão ou transtorno do estresse pós-traumático
analisando postagens no Twitter. Essa análise previu resultados clínicos meses
antes dos diagnósticos oficiais. Seu comportamento público pode revelar
informações privadas sobre sua saúde.
Conceitos como seguro de vida e plano de saúde só funcionam porque é difícil
saber de antemão quem adoecerá ou morrerá e em que momento. Talvez você
não pense sobre isso com frequência, mas o seguro é realmente uma ferramenta
matemática. Se mil cônjuges têm seguro de vida, a cada ano alguns morrerão
inesperadamente. As pessoas que perdem seus cônjuges cedo recebem mais
dinheiro do que gastam em seguro. Aquelas cujos cônjuges vivem até uma idade
avançada pagam mais do que recebem, mas conseguem manter seus cônjuges por
mais tempo, o que (espera-se) compensa a perda de dinheiro. Basicamente, os
que têm sorte sustentam os que não têm.
Conforme a medicina se torna cada vez mais personalizada, esse sistema se
torna cada vez menos sustentável. Talvez chegue um tempo em que todas as
pessoas com seguro terão que ser genotipadas. As com genótipo favorável
pagarão menos pelo seguro, enquanto as que tiverem genótipo desfavorável
pagarão mais. Os que têm sorte terão mais sorte e os que têm azar terão mais
azar.
Para reduzir esse risco, o Congresso dos Estados Unidos aprovou a Lei contra
Discriminação Baseada em Informação Genética, de 2008, que tornou esse tipo
de discriminação ilegal. Os empregadores não podem demitir o funcionário por
ele ter uma predisposição genética para algum problema de saúde. Nem a
seguradora pode negar uma cobertura por esse motivo. Mas todos nós vamos ter
que lidar com o fato de viver numa sociedade com extremo conhecimento
médico. “Não se trata de proteger os dados”, diz o dr. Wagner, “mas de proteger
as pessoas das implicações dos dados”. Por exemplo, se você tiver uma
predisposição genética à agressão, será que há empregos para os quais não deveria
ter permissão? E as pessoas à sua volta têm o direito de saber?

O governo americano não tornou todos os tipos de discriminação genética


ilegais. Tome como exemplo um aplicativo chamado Genetic Access Control,
disponibilizado no GitHub. O aplicativo acessou dados genômicos da 23andMe
(uma empresa privada que sequencia o genoma dos clientes) e usou essa
informação para restringir o acesso de usuários a sites na internet. O
desenvolvedor do aplicativo sugere usos relativamente inócuos, incluindo a
criação de “espaços seguros”, como sites que só podem ser acessados por
mulheres. Mas é fácil imaginar como um aplicativo assim pode ser usado para
propósitos sinistros. Imagine um site que só pessoas com determinada cor de pele
ou que só indivíduos sem problemas genéticos poderiam visitar. Além do mais,
até os usos mais benignos trarão problemas, porque a identidade é tão genética
quanto cultural. Algumas pessoas com um tipo sanguíneo tradicionalmente
feminino carregam cromossomos XY, e um grupo que barrou geneticamente
quem não é mulher teria que decidir como lidar com isso.
A 23andMe logo bloqueou o acesso desse aplicativo a seus dados, mas
podemos esperar que problemas como esse surjam de novo no futuro.
E não são apenas as suas informações genéticas pessoais. Você recebe metade
do seu genoma de sua mãe e metade de seu pai.101 Portanto, se tornar seu
genoma público, você estará compartilhando metade dos genomas de cada um de
seus genitores. Na verdade, sempre que compartilhar informações genéticas, você
está, de algum modo, comprometendo o anonimato de todos os seus parentes.
Imagine que seu irmão gêmeo tem um cargo político e você descobre que tem
um risco de esquizofrenia genético. Você tem alguma obrigação social de dividir
essa informação com o público? Tem alguma obrigação filial de escondê-la?
Os potenciais benefícios da medicina de precisão são vastos, mas os custos
também são. À medida que entramos de modo implacável na era da medicina de
precisão, devemos pensar profundamente sobre o que significa privacidade numa
sociedade cada vez mais tecnológica.
Mas algumas pessoas acreditam que questões de privacidade são menos
importantes do que segredos médicos à espera de serem encontrados em nossos
dados biológicos.
O Personal Genome Project102 foi iniciado pelo dr. Church e é um repositório
de dados genômicos aberto ao público. Eles deixam bem claro que não vão
garantir o anonimato aos participantes, e na verdade, com a documentação do
site na internet, fica óbvio que se dados pessoais forem combinados a dados
genômicos, provavelmente não seria difícil alguém descobrir quem é você.
A pessoa que nos contou sobre o Personal Genome Project é o dr. Steven
Keating, do qual talvez você se lembre do capítulo sobre construção robótica.
Durante sua pesquisa sobre caminhonetes de construção de casas, o dr. Keating
descobriu que tinha um tumor no cérebro. Ele fez uma cirurgia para removê-lo e
teve o genoma do tumor analisado. Por vários motivos políticos, ele achou difícil
acessar os dados médicos e de pesquisa sobre o seu tumor. Desde então, tornou-se
um defensor da abertura e da disponibilização de dados clínicos tanto à
comunidade médica quanto aos próprios pacientes.
O dr. Keating está animado com o Personal Genome Project. “Se quiser
contribuir com o seu genoma, você precisa passar num teste... [que] garante que
você compreende as responsabilidades que está assumindo. Gosto dessa
abordagem, porque a grande questão é que realmente não sabemos o que poderia
acontecer em dez anos se você compartilhasse seus dados agora. Você precisa
passar por essa lista e aprová-la: ‘Entendo que, sim, um criminoso pode duplicar
partes do meu DNA e plantá-lo numa cena de crime. Sim, entendo que talvez no
futuro um vírus possa ser feito sob medida para mim; isso afetaria apenas a mim.
Sim, entendo que essa informação pode ser vazada e de algum modo voltar para
minha família e mostrar aos meus parentes uma doença da qual eles não querem
saber.’ Você precisa entender. Em seguida, depois de assinar o termo, você pode se
inscrever... É importante que cada pessoa compreenda as responsabilidades que
está assumindo, porque são os dados dela e é uma escolha dela fazer isso, mas na
minha cabeça os potenciais benefícios são muito maiores do que esses problemas
loucos que podem acontecer, e para mim faz muito sentido que esse seja o futuro
da medicina.”

Como isso mudaria o mundo


A médio prazo, as técnicas da medicina de precisão serão caras. A longo prazo,
elas têm condições de reduzir os custos médicos detectando enfermidades antes
que estas desencadeiem algum quadro grave, selecionando os tratamentos certos
de imediato, curando doenças genéticas em vez de lançar mão de tratamentos
paliativos e seguindo o expediente de indústrias ligadas a computadores para
oferecer mais produto por menos dinheiro com o passar do tempo.
Negócios como o Facebook fornecem aos usuários muitos serviços em troca de
dados sobre eles próprios. Considerando o valor dos dados médicos, uma
barganha semelhante pode ser feita entre usuários e empresas de biotecnologia.
De fato, a Alphabet, uma empresa-mãe do Google, já está investindo pesado em
algo chamado Baseline Study, que busca identificar biomarcadores relacionados a
doenças. Não sabemos quais são os planos deles a longo prazo, mas se o objetivo
é ter um Google Street View dos nossos tratos digestivos, estamos dispostos a
negociar quaisquer dados de que eles precisam.
Um dos efeitos mais animadores da medicina de precisão tem a ver com o
modo como os exames médicos são conduzidos. Vamos supor que você tenha um
medicamento para câncer chamado explodanol. Em testes clínicos, cinco a cada
seis pacientes seus são completamente curados e um explode de repente ao tomar
a droga. Isso pode ser um pouco constrangedor na sua próxima reunião com a
FDA (sigla em inglês para Administração de Alimentos e Drogas dos Estados
Unidos).
Mas imagine que você venha a notar que existe uma diferença entre pacientes
explosíveis e pacientes não explosíveis — todos os pacientes explosíveis têm um
conjunto específico de marcadores de microRNA. Agora, você consegue pegar
esse medicamento que antes era inútil porque (pelo visto) matava os usuários de
forma aleatória, e derrotar o câncer com sucesso em uma grande porção da
população. Além disso, se você quiser explodir um sexto da população, agora pode
fazer isso em forma de comprimido.
Mais adiante, obter um genoma, um microbioma, um metaboloma e vários
outros -omas pode nos levar a criar categorias de pacientes muito específicas para
testes clínicos. Isso é uma vitória em três frentes: significa que você pode fazer
testes de relevância estatística com medicamentos em populações menores; os
medicamentos não precisam funcionar para todos ou mesmo para a maioria dos
pacientes para que sejam considerados seguros; e antigos medicamentos que
estavam engavetados por problemas de segurança poderiam ser trazidos de volta
ao mercado para serem usados apenas em uma categoria específica de pacientes.
Por exemplo, poucos sabem que existe uma vacina para a doença de Lyme. Ela
foi retirada do mercado porque um pequeno estrato da população reclamou de
sintomas semelhantes aos da artrite. Portanto, fato curioso: desde 2016, seu
cachorro pode ser vacinado para Lyme, mas seu filho, não.
Embora improvável, é concebível que essa subpopulação que reage mal à
vacina compartilhe um conjunto de características que provoca o efeito colateral
negativo. Se pudéssemos excluir essas pessoas, a grande maioria dos
consumidores poderia ter acesso a essa importante vacina.
Na realidade, provavelmente seria um pouco mais complexo. Essa
subpopulação pode ter sido simplesmente formada por todas as pessoas
propensas ao efeito placebo. Mas, considerando o número de medicamentos que
deixam de chegar ao mercado por preocupações com segurança, resultados como
esse podem acontecer. E, com melhores análises bioestatísticas, medicamentos
atuais encontrariam novos usos para doenças complicadas. Isso pode parecer um
pouco idiota, mas pode ser importantíssimo. Atualmente, levar um novo
medicamento para o mercado custa mais de 2,5 bilhões de dólares, e a maioria
das drogas nunca consegue chegar a esse ponto.
Um dos livros que lemos sobre esse assunto começa discutindo práticas de cura
da “medicina alternativa”. Isso aguçou o nosso ceticismo, mas o autor logo entra
em tópicos tão agradavelmente não naturais quanto “Aplicações de CYP2C19 em
farmacogenética” e “Hibridização fluorescente in situ”. Antes de prosseguir, ele
faz uma afirmação interessante: apesar de toda a falta de eficácia, uma coisa que
aqueles curandeiros antigos tinham a seu favor é que eles alegavam fazer o
tratamento sob medida para cada paciente.
As cartas de tarô tinham o defeito menor de não funcionar realmente, mas a
prática de dizer “o que há de errado com você”, em vez de “o que há de errado
com pessoas como você”, deve ser profundamente atrativa. Uma pessoa que oferece
uma cura mágica se dispõe a dizer “eu sei o que há de errado e vou solucionar”,
enquanto na medicina baseada em provas nem sempre podemos saber o que há
de errado, e mesmo que saibamos, talvez não adiante nada. A medicina de
precisão pode nos dar uma maneira de trazer os sonhos da era da magia e
transformá-los em realidade na era da ciência.

92. E outros pacientes recebem diagnóstico de mononucleose quando na verdade têm outra coisa. Soubemos
do caso de uma pessoa que recebeu várias vezes o diagnóstico de mononucleose durante um período de
quatro meses até descobrir que tinha sífilis secundária. Ops!
93. Ok, é bem mais complexo do que achávamos que fosse até mesmo cinquenta anos atrás. Mas, com poder
tecnológico e pesquisadores inteligentes, deveremos obter um mapa cada vez melhor do panorama das
doenças humanas e de como abordá-lo.
94. Esse sufixo é de certa forma útil, embora com frequência seja usado com exagero, porque ser um “-
omicista” soa bem. O dr. Jonathan Eisen, da Universidade da Califórnia em Davis, mantém até uma seção
em seu site na internet, The Tree of Life, para “ômicas ruins”, como nutrimetabonoma, fermentoma e (para
aqueles com tendência mística) conscientoma.
95. O primeiro está errado sobre indivíduos, o segundo está errado sobre grupos.
96. Na verdade, a palavra “leucemia” deriva de palavras gregas que significam “sangue branco”.
97. A metástase acontece quando pedacinhos do câncer se desprendem do tumor original e dão início a
tumores em outros lugares.
98. Há uma nuance aqui. Tecnicamente, você quer detectar o câncer o mais depressa possível, mas também
quer saber o nível de agressão do câncer no futuro. Por exemplo, alguns cânceres de próstata crescem tão
lentamente que é provável que a pessoa morra de causas naturais antes de o câncer se tornar um problema.
Se você sabe que o câncer não vai matá-lo no tempo de vida que lhe resta, pode ser que escolha evitar o
tratamento desagradável, que oferece risco de impotência e incontinência. Alguns médicos temem que todos
esses dados levem a um tratamento excessivo.
99. Não mastigue vidro.
100. Não estava.
101. Note que isso significa que a aquisição dos seus dados genômicos pode revelar verdades desagradáveis.
Por exemplo, você pode descobrir que seu pai biológico não é o homem que o criou.
102. O Personal Genome Project agora é parte da Open Humans Foundation. No OpenHumans.org você
pode obter muitos dados (por exemplo, dados de movimento por meio do FitBit e dados de microbioma
pelo μBiome) e depois compartilhá-los com pesquisadores no site.
10.

Bioimpressão
Por que parar na sétima margarita se você pode simplesmente
imprimir um fígado novo?

Imagine que você acorda um dia se sentindo exausto e enjoado. Quando


finalmente acaba de vomitar, você se olha no espelho e percebe que seus olhos e
sua pele estão amarelados. Você liga para seu filho, que corre para levá-lo de carro
ao hospital. Algumas horas depois, seu médico entra, sério.
Você precisa de um fígado novo.
Bem, você pensa, será que é difícil conseguir um fígado? Conheço milhões de pessoas
com fígado. Você olha para a enfermeira. Não... pequena demais. Olha para o
médico. Não... velho demais. Você, com os olhos brilhando, encara o seu filho.
Ele faz que não com a cabeça.
“Você tinha que ter ido a mais jogos meus de beisebol quando eu era criança,
pai.”
Portanto, você não tem saída. Você se junta às mais de 122 mil pessoas que
estão atualmente na lista para transplante de órgãos.103 No entanto, para sua
sorte, a fila do fígado tem apenas quinze mil pessoas.
Dependendo da localização, do estado de saúde, da idade e de outros fatores,
você pode contar que ficará nessa lista de espera por um período que vai de
alguns meses a três anos. Com frequência, os fígados vão para as pessoas que
estão em pior estado, então pode ser que você precise esperar até ir de mau a
muito pior para que lhe deem prioridade. E, não, você não tem permissão para
encher a cara para conseguir um fígado mais rápido.104
Entrar na lista de transplante não quer dizer necessariamente que você
conseguirá um fígado a tempo. A cada ano, oito mil pessoas morrem à espera de
órgãos.
Mas digamos que você seja um americano relativamente abastado. Deve haver
uma opção melhor. Você poderia se tornar um “turista médico” e ir para um país
onde pagasse a um estranho para que ele “doe” parte do fígado dele a você.
Talvez você queira considerar a procedência desse fígado. Ou talvez não. Por
exemplo, se você vai para a China, seu fígado pode vir de um prisioneiro
executado.
Mesmo que você aceite a ideia da venda de órgãos e saiba que o órgão foi
doado voluntariamente, bem, pode ser que você queira repensar a definição de
“voluntário”. Há evidências de que os doadores mais frequentes nesses sistemas
são pessoas pobres procurando pagar dívidas. Muitas vezes, recebem menos
dinheiro do que o prometido e acabam mais pobres por causa do tempo de
trabalho perdido ou porque cirurgias malfeitas afetam sua saúde.
Então você volta para sua família e seus amigos e implora por um pedaço do
fígado deles. Esse órgão tem uma capacidade impressionante de regeneração,
então você não precisa do negócio inteiro. “Ah, vai”, você diz, “só um
pedaciiiinho”.
Depois de uma sincera demonstração de remorso por ter perdido uma
importante partida de beisebol infantil vinte anos atrás, você consegue convencer
seu filho a doar. Então você descobre que ele é incompatível. RÁ. Logo, você
estava certo ao faltar àqueles jogos de beisebol. Desculpas retiradas.
Se você for capaz de resistir à espera de um doador de órgão falecido, pode ser
que ainda tenha uma vida inteira de medicamentos imunossupressores caros pela
frente. Como o órgão não era seu, seu corpo corre o risco de considerá-lo
estranho e atiçar seu sistema imunológico naquela área. Os medicamentos
imunossupressores podem permitir que o fígado permaneça, mas suprimir sua
resposta imunológica expõe você ao risco de infecção.
Então algo lhe ocorre: há anos você vem pagando impostos para a ciência. Por
que um nerd de jaleco não pode mexer lá com a ciência e lhe fazer um fígado
novinho em folha? Você já ouviu falar que as impressoras 3D são muito boas hoje
em dia. Será que elas não podem imprimir algumas cópias de um fígado saudável
para lhe dar? Você entra na Amazon, compra um livro sobre bioimpressão e vai
ao prefácio.

Só o tempo dirá se as impressoras de células se tornarão realmente impressoras de órgãos...


para alcançar o que o campo da engenharia de tecidos tenta fazer há mais de duas décadas:
criar algo mais do que gelatina com sabor de carne!
• Bradley Ringeisen, org., Cell and Organ Printing

Uma coisa nojenta.


Está bem, melhor do que uma coisa nojenta. Na verdade, pesquisadores já
conseguem imprimir tecidos usáveis, e muitos estão trabalhando para que o
campo abarque órgãos inteiros.
As tentativas iniciais de criar órgãos artificiais com células de verdade foram
basicamente assim: criar uma armação usando um material relativamente rígido,
depois pulverizá-lo com as células apropriadas. Dar às células algo para comer e
observar um órgão crescendo. É mais ou menos como a horta de tomates mais
assustadora que já existiu.
Não deu muito certo. As células não eram densas o bastante, levaram tempo
demais para crescer e, pelo menos nos primeiros dias, o material da armação era
meio tóxico.

Acontece que os órgãos são muito, muito complicados. Não dá para


simplesmente pegar um monte de células hepáticas e borrifá-las em uma placa de
Petri, assim como não é possível fazer um bife saboroso borrifando um monte de
“células de bife” em um prato. Algumas partes dos órgãos são macias e outras são
duras. Algumas esticam, outras são rígidas.
Para entender por que é tão difícil fazer órgãos em laboratório, precisamos
falar sobre você por um momento. Talvez você tenha consciência de que seu
corpo é feito de um monte de células e fluidos. De certa forma, é verdade, mas
está faltando um universo de coisas. Considere uma única célula recém-formada.
Essa célula precisa de energia para circular. Precisa de sinais químicos que lhe
digam para onde ir. Depois de chegar ao lugar aonde está indo, é provável que ela
precise de uma pista do ambiente para saber o que fazer. E células necessitam de
alguma estrutura para mantê-las no lugar certo, senão agora você teria gelatina de
carne escorrendo.
Seu fígado não fica ali parado esperando para processar o seu happy hour
depois do trabalho. Ele está a todo momento fazendo coisas: enviando e
recebendo informações químicas, removendo células mortas, recebendo as novas
e assim por diante. Para fazer um fígado novo, é preciso ter as células certas,
recebendo os tratamentos certos, no ambiente certo, na hora certa. É mais ou
menos como tentar criar uma fábrica inteira de uma vez, em vez de construir a
estrutura, depois trazer as máquinas e por fim contratar os empregados.
Conversamos com o dr. Jordan Miller, da Rice University, sobre a recriação
dessa complexidade e ele nos disse: “Embora cientistas possam cultivar células
em placas, a estrutura incrível do corpo permite nosso formato um tanto denso,
compacto. Por exemplo, a superfície do pulmão para a troca de gases com a
corrente sanguínea tem a área de uma quadra de tênis toda dobrada e embalada
dentro do seu peito. Então simplesmente não há como fazer uma substituição
funcional de um órgão se não conseguimos recriar pelo menos parte dessa
arquitetura maravilhosa.”
Ah, e enquanto você dá o melhor de si ao tentar fazer um órgão, o tempo está
correndo. Se uma partezinha de tecido não recebe um suprimento regular de
nutrientes, ela morre em questão de horas. Pedacinhos muito finos de tecido
podem absorver nutrientes por difusão (mais ou menos como uma esponja
absorve água), mas se você passar da espessura de uma moeda, isso não funciona.
No fim, teríamos o exterior vivo e o cerne morto. Um tecido Keith Richards, por
assim dizer.
Impedir que todo esse tecido morra torna o processo muito mais complexo.
Em um órgão humano real, esse problema é resolvido pela vasculatura: os vasos
sanguíneos. Eles não são apenas as grandes veias e artérias às quais estamos
acostumados, são também os tubinhos minúsculos que se ramificam na
extremidade dos vasos maiores. Esses tubinhos são chamados de vasos capilares.
Infelizmente, como os vasos capilares são muito pequenos, é difícil construí-los
e colocá-los em vasos sanguíneos grandes usando a atual tecnologia para
impressão de órgãos.
Para dificultar ainda mais as coisas, os órgãos precisam ser perfeitos. Se seu
coração para de bater durante dois minutos uma vez, você morre. Imagine se a
internet inteira morresse toda vez que a Comcast sofresse uma falta de energia.
Mais importante: você aceitaria um índice de 1% de falha em sua nova bexiga?
Portanto, há muitas restrições quando se está tentando criar novos órgãos. É
necessário usar muitos tipos diferentes de célula e lhes dar muitos tratamentos
diferentes. É preciso construir uma vasculatura para suprir o órgão de nutrientes
conforme ele é construído; fazer tudo isso rapidamente para as células não
morrerem enquanto você estiver juntando as coisas; e não cometer erro nenhum
durante o processo!
Alguns pesquisadores acham que a resposta é a impressão em 3D.
Há muitas maneiras de imprimir em 3D, algumas já descrevemos em capítulos
anteriores, mas aqui está a ideia básica: de algum modo, você põe camada após
camada de coisas sobre uma superfície. Construindo camadas umas sobre as
outras, temos, por fim, um objeto tridimensional. De modo geral, isso é menos
eficiente do que os métodos convencionais de fazer uma coisa. Por exemplo, se
você estiver fazendo hashis, é mais barato e mais rápido injetar plástico em um
molde em formato de palito do que construí-los com camadas.
Mas a impressão em 3D tem algumas vantagens. Para um molde tradicional,
toda vez que quiser um hashi com formato diferente, você precisa que um molde
novo e caro seja criado. Uma impressora 3D pode fazer praticamente qualquer
formato de palito de comida japonesa que você desejar, sem qualquer mudança na
maquinaria. E, como a construção é feita camada por camada, um padrão
diferente105 leva mais ou menos o mesmo tempo que um design convencional.
Você também pode usar a impressão em 3D para entrelaçar diferentes
materiais. As impressoras 3D de mesa simples geralmente só imprimem uma cor
de plástico de cada vez. Se acrescentar mais bicos, você pode obter mais cores.
Impressoras 3D industriais não acrescentam apenas cores — acrescentam
materiais. Portanto, criam-se combinações únicas de metais, plásticos, resinas e
outros insumos, o que seria meio que impossível fazer à mão ou usando métodos
de fabricação tradicionais.
Outra coisa legal da impressão em 3D é que podemos fazer estruturas
incomuns. Por exemplo, vamos supor que você queira criar uma bola com
estrutura de favo de mel por dentro. Isso é impossível com um molde de injeção,
mas é relativamente fácil com uma impressão em 3D.
Todas essas qualidades têm potencial para fazer da impressão em 3D uma
ótima maneira de construir estruturas extremamente complexas, como partes do
corpo. Em princípio, essa tecnologia deve ser capaz de lançar rapidamente células,
proteínas, substâncias químicas, tratamentos e elementos estruturais apropriados
que são necessários para construir órgãos humanos funcionais.
Melhor ainda: uma impressora 3D conseguiria fazer o produto requisitado
para cada paciente. Isso é conveniente, porque uma mulher de um metro e meio
de altura não quer o mesmo coração que um homem de dois metros.
É conveniente também porque uma impressora 3D no local pode usar células
cultivadas e colhidas no paciente que receberá o órgão. Por exemplo, você colheria
células-tronco imaturas de alguém, faria com que elas se replicassem e se
tornassem as células que compõem um órgão específico e depois transplantaria
para o paciente um órgão feito com essas células. Um órgão assim não teria os
problemas de rejeição que geralmente ocorrem com transplantes de órgãos.
Talvez você tenha a percepção de que a impressão em 3D é, principalmente,
para esquisitões que têm dinheiro demais e passam o tempo imprimindo
obsessivamente miniaturas de Star Wars. Mas isso são apenas 97% deles. Muitas
pessoas estão trabalhando em projetos com um pouco mais de potencial, e as que
estão interessadas em reproduzir estruturas biológicas criaram um campo
chamado bioimpressão.
Há muitas maneiras de se fazer bioimpressão em 3D. Duas delas são
especialmente comuns: esprema ou use LASER.
A primeira técnica funciona basicamente como uma pistola de confeiteiro.
Mas, nesse caso, o que é espremido para fora é a biotinta, composta pelas células
e substâncias químicas que criarão seu órgão, bem como um pouco de grude
estrutural para que se possa espremer suavemente tudo isso para fora através do
bico.

Você pega um tubo cheio de biotinta e aplica pressão para expulsá-la por um
bico. Um braço controlado por computador move o bico para o lugar certo no
momento apropriado enquanto você constrói suas camadas de biotinta. É um
bom caminho a seguir porque as células podem ser delicadas e você as espreme
de maneira mais ou menos suave. No entanto, qualquer tecnologia que usa a
extrusão gera problemas de controle de fluxo e de obstrução da cabeça de
impressão. Como receptor de um coração, você provavelmente não ia querer ver
um técnico de medicina gritando “Mas CANCELEI o pedido de impressão, seu
desgraçado!”, enquanto puxa um pedaço de tecido preso.
Outro problema é a velocidade. São células sendo impressas, e elas tendem a
estourar quando são apertadas com muita força. Isso limita a quantidade de
pressão que se pode aplicar e, por conseguinte, a rapidez do processo. Ir devagar é
um problema, porque as células não vivem para sempre e correm o risco de se
deslocar depois de colocadas no lugar.
Podemos tentar usar menos células e mais grude estrutural na biotinta, mas
isso significa que aquilo que estiver sendo impresso ficará mais próximo de uma
gelatina de carne do que, bem, de carne.
Considere isso da seguinte maneira: você quer entregar tomates ao seu vizinho
em alta velocidade, mas seu único método é dispará-los através de um cano. Você
põe os tomates em suspenso em uma gelatina para protegê-los, mas se atirar com
muita força os tomates em gelatina, eles vão estourar quando baterem na parede
do vizinho. Na verdade, só para fazê-los voar a essa velocidade você teria que
aumentar a pressão dentro do tubo, o que provavelmente já esmagaria alguns
tomates mais fracos.
O mesmo acontece com as células em gel. Para sistemas como esse, geralmente
há um conflito entre a densidade das células no gel e a velocidade em que a
biotinta pode ser expulsa.
Então por que não usamos lasers?
A LIFT, acrônimo em inglês para “transferência induzida por laser”, funciona
mais ou menos como aquele fogo causado por óleo quente em frigideira. Na
verdade, não. Sabe quando dizem que não se deve jogar água em uma panela de
óleo pegando fogo?
Trata-se basicamente de uma poça de óleo com a camada de cima queimando.
Quando você joga uma xícara de água ali dentro, duas coisas acontecem:
primeiro, como o óleo é menos denso do que a água, as chamas sobem em vez de
descerem, então ele não apaga. Segundo, a água ferve a 100ºC, enquanto o óleo
ferve a mais ou menos 315ºC. Portanto, é quase como se fosse um balão cujo
revestimento é feito de óleo em chamas e cujo interior é água expandindo com
extrema rapidez. O resultado é uma enorme explosão, com partículas de óleo em
chamas disparando em todas as direções, queimando sua casa e arruinando a
panqueca de sábado.
A LIFT é assim, mas em uma pequena escala e altamente controlada. Temos
um prato transparente sobre o qual usamos a biotinta. Disparamos, então, um
laser por trás dele. Isso faz uma pequena bolha de vapor estourar na biotinta.
Como resultado, um pontinho de biotinta é ejetado e aterrissa em um prato
receptor, deixando uma lacuna na biotinta pintada.
Disparando laser dessa maneira repetidamente, podemos desenhar padrões
complexos de pontos de biotinta. Se acrescentarmos cada vez mais camadas
desses pontos, construiremos um formato em 3D, assim como no método da
pistola de confeiteiro. Pontos de biotinta talvez não pareçam o método ideal, mas
se você os fizer pequenos o bastante e em quantidade suficiente, vai ser como se
fossem pixels em uma tela. Todos os pedacinhos se juntam para fazer um grande
e contínuo todo.
Retornando à nossa analogia com tomate e gelatina, seria como se os tomates
esmagados estivessem pendurados em uma superfície plana e você aquecesse
partes da superfície para disparar gosma de tomate para baixo de forma explosiva.
Desde que o método de disparo não estoure os tomates, você pode enviá-los
praticamente com a rapidez que quiser. Ou pelo menos com uma rapidez que o
permita acrescentar gelatina de reposição à superfície onde eles estão pendurados.
Pode parecer uma maneira excessivamente complexa de fazer coisas, mas tem
muitas virtudes: não há bico para ficar entupido, os resultados são muito precisos
e é possível regulá-los para exercer a pressão certa de modo a não estourar muitas
células. Com isso, dá para imprimir tão rápido quanto seu laser conseguir se
mover sobre a superfície.
Agora que você se familiarizou com os métodos que usam biotinta, podemos
falar um pouco mais sobre de que é feita essa substância. Há muitos acertos
necessários para tornar a sua biotinta pronta para imprimir na maioria dos
sistemas. Para entender por quê, imagine que você está tentando fazer cookies
impressos em 3D.106 Mesmo que tenha equipamento para imprimir em 3D uma
gororoba de cookie, não dá para simplesmente pegar uma massa de cookie
comprada em uma loja e enfiá-la na pistola de confeiteiro da sua impressora 3D.
A massa corre o risco de quebrar, então você terá que adicionar uma substância
química emulsificante. Pedaços poderão ficar presos, e isso vai obrigá-lo a
remover gotas de chocolate, nozes e passas. Talvez a massa não fique homogênea,
o que resultaria em cookies feios, então é preciso batê-la como um louco antes de
colocá-la ali dentro. Quando terminar de fazer isso, você conseguirá uma massa
de cookie que pode ser espremida perfeitamente, mas com aparência e sabor
horríveis. O principal objetivo de imprimir um cookie é obter um cookie gostoso.
Mas acrescentando todas essas outras restrições, fica muito, muito mais difícil
alcançar esse objetivo.
De maneira semelhante, adicionar coisas à biotinta para fazê-la imprimir bem
pode reduzir a capacidade da impressora de formar um órgão perfeito.
Provavelmente você precisará que ela se encontre em um bom estado gelatinoso
para que seja bem expelida e proteja as células, então você acrescenta alginato.
Talvez você queira que a biotinta não evapore tão depressa, então acrescenta
glicerina. Ou prefira que ela tenha padrões em espiral totalmente doces, então
acrescenta sachê de suco em pó.
Seja lá o que for adicionado, o problema é que nenhuma dessas coisas existe
em um fígado real. Portanto, os aditivos não podem ser tóxicos e precisam ir
embora depois de desempenharem a função à qual foram destinados. E, quando
forem eliminados, eles têm que deixar para trás o tipo certo de estrutura.
Alguns grupos descobriram uma maneira de bioimprimir sem uma parte
dessas substâncias auxiliares da biotinta, contando, em vez disso, com a
capacidade da célula de produzir por conta própria muitos desses compostos
depois de ser impressa. Porém, aditivos como o alginato ainda são muito comuns.
Uma biotinta não é suficiente, mesmo supondo que você tenha uma perfeita.
Nem de longe é o bastante. Determinado órgão pode ter dez ou mais tipos de
célula, cada um deles mais diferenciado dependendo do propósito a que serve.
Será necessário ter tintas diferentes. Usar combinações diferentes nas tintas.
Fazer tratamentos diferentes a serem aplicados à biotinta depois que ela for
disparada. Por exemplo, e se você quiser acrescentar uma substância química
específica, ou atingi-la com radiação ultravioleta, ou aquecê-la levemente? Ou se
quiser tudo isso em ordens e intensidades variadas? Para aumentar a dor de
cabeça, a impressão é feita sobre uma tela molhada, e as biotintas podem começar
a vazar.
Como se já não fosse suficiente, um sério problema nesse campo é o software.
A impressão em 3D teve início nos anos 1980. O tipo de arquivo em 3D mais
comum é o STL, originalmente criado para lidar apenas com superfícies de
objetos em 3D. No caso do seu fígado novo, talvez seja importante para você que
haja coisas dentro dele. Cientistas de bioimpressão criaram formas de contornar
isso, bem como novos tipos de arquivo, mas ainda não há uma estrutura eficiente
e consensual. Enquanto não houver, estamos presos nos anos 1980.
Está bem, então a bioimpressão será realmente difícil. Mas a boa notícia é que
isso parece ser um problema solucionável. Cientistas já estão fazendo progressos,
e à medida que computadores, impressoras 3D e o nosso conhecimento sobre
órgãos avançam, nós nos aproximamos cada vez mais de fazê-la funcionar.

Em que pé estamos agora?


No momento, imprimindo bem fatias de células com um milímetro de
espessura. Não podemos engrossá-las muito além desse ponto porque não
aperfeiçoamos a impressão de vasos sanguíneos, o que significa que todos os
insumos e produtos da célula funcionam por meio de difusão. Mas acontece que
dá para fazer algumas coisas incríveis com uma fatia fina de órgão.
O dr. Gabor Forgacs é o fundador científico da Organovo, que (entre outras
coisas) imprime tecidos humanos para testar medicamentos. A capacidade de
testar um medicamento em potencial em células humanas vivas antes de
experimentá-lo em humanos pode salvar muitas vidas e poupar muito dinheiro.
Como nos disse o dr. Forgacs, “se um medicamento em potencial falha em,
digamos, um pedaço de fígado humano, bem, aí então é melhor pensar duas vezes
antes de começar a administrá-lo em pacientes”.
Isso é um passo muito importante. Apenas um em cada dez medicamentos
consegue passar da fase de testes clínicos humanos. Se identificarmos qual dos
nove falhará antes que cheguem aos testes humanos, salvaremos vidas, reduzindo
sofrimentos e poupando milhões de dólares em testes clínicos com pessoas.
Cultivar fatias finas de células humanas também é bom por outro motivo.
Muitas partes do corpo que talvez precisem ser substituídas são bem finas.
Visualize a si mesmo em um futuro não muito distante andando em um
mercado de fatias finas de órgãos ao ar livre. Ali está a dra. Caddie Wang. Ela
pode lhe fazer uma córnea novinha em folha! Mais adiante temos o dr. Jonathan
Butcher. Não ligue para o nome dele: ele está aqui para lhe fazer algumas válvulas
cardíacas! Mais adiante na rua, o dr. Gatenholm pode lhe equipar com um lindo
pedaço de cartilagem. Todas essas coisas são convenientes, e todas elas são bem
finas.
Mas lá na frente, no fim do mercado, alguns especialistas em órgãos estão
tentando lhe fazer grosserias.107
Antes de imprimir órgãos grossos, é preciso saber imprimir vasos sanguíneos.
O laboratório do dr. Miller faz impressão em 3D de vasos sanguíneos, mas de
maneira inversa. De acordo com o dr. Miller, “imprimimos o açúcar e depois o
envolvemos em gel. Em seguida, dissolvemos e removemos todo o açúcar para
deixar uma série oca de tubos conectados (é como a internet). Depois, fazemos
células de veia fluírem ali dentro e elas se prendem às paredes dos tubos”.
O que chamaremos de “paradigma do cristal de açúcar do inferno” é realizado
por meio de dois métodos diferentes. O primeiro que eles desenvolveram usa
uma impressora 3D de código aberto chamada RepRap com algumas
modificações, incluindo partes extraídas de uma torradeira. A torradeira do dr.
Miller salva vidas. A nossa deixa o pão mais crocante. O modelo baseado na
RepRap tinha um design à la pistola de confeiteiro, que expelia um grude de
açúcar especialmente projetado, que (para os curiosos) era, de fato, comestível.
O segundo método que eles usam é chamado de “sinterização de açúcar”.
A palavra sinterização geralmente se refere a um processo industrial em que
você estende uma camada de metal em pó e em seguida usa o calor (de um laser,
por exemplo) para torná-la um objeto sólido. Se for feito de maneira muito
precisa, isso pode ser usado como um método de impressão em 3D. Você
“desenha” um formato no pó com um laser em movimento, depois acrescenta
outra camada de pó e desenha de novo. Assim como no método da pistola de
confeiteiro, construindo camadas você chega a um formato em 3D pré-
programado.
No caso do dr. Miller, o pó é açúcar. O açúcar se prende onde for atingido pelo
laser, e depois de camadas suficientes obtemos esculturas de açúcar precisas.
Esse método de sinterização de açúcar tem alguns benefícios valiosos quando
se imprime a armação para os vasos sanguíneos. A sinterização geralmente é uma
maneira muito mais precisa de criar objetos em 3D do que a extrusão. Isso é
importante quando se criam as estruturas complexas que o dr. Miller está
buscando.
Além disso, nos métodos de impressão em 3D por extrusão, a sustentação de
uma camada vem das camadas abaixo. Assim, é mais difícil imprimir em 3D
objetos com pedaços que pendem. Por exemplo, imagine imprimir um relógio de
pêndulo de baixo para cima. As partes inferiores do pêndulo teriam que pender
no ar até você prender a parte de cima.
No método de sinterização de açúcar, as partes pendentes são sustentadas pelo
açúcar em pó ao redor enquanto você constrói as camadas. Depois que a estrutura
se solidifica e passa a se sustentar sozinha, o suporte do açúcar em pó é
simplesmente soprado para longe.
O dr. Miller e sua equipe têm tido alguns resultados promissores. Até agora
eles imprimiram alguns dos vasos sanguíneos mais espessos, e o mais legal é que
esses vasos sanguíneos estão agindo como fariam se estivessem em um corpo
humano. Eles podem resistir à pressão normal imposta aos vasos sanguíneos
quando o sangue é bombeado através deles. E estão começando a desenvolver
vasos capilares. Sozinhos.
O Miller Lab está apenas começando a explorar essa técnica, e vai levar algum
tempo para vivermos em um mundo de fígados abundantes e belas veias
suculentas. Mas é um passo importante para um amanhã melhor, em que nossos
filhos poderão beber doze cervejas toda noite e se preocupar apenas com os
danos que fizerem aos amigos e familiares.
Enquanto isso, estão começando a acontecer coisas animadoras em relação às
partes mais simples do corpo. Por exemplo, pode-se imprimir uma cartilagem um
pouco mais espessa do que, digamos, o tecido do fígado, porque a cartilagem é
esquisita e se utiliza de difusão lenta, e não de vasos sanguíneos, para obter
nutrientes e remover resíduos. O grupo do dr. Michael McAlpine, da Princeton
3D, imprimiu uma “orelha ciborgue”. As partes carnudas da orelha eram uma
combinação de cartilagem (nesse caso, feita a partir de células de bezerros) e
silicone, e uma antena em espiral foi integrada à orelha para permitir uma forma
de audição.
Está bem, uma orelha é um pouco menos complexa do que um coração ou
pulmão, é claro. Mas esse método ilustra um ponto importante: o sucesso não
exige uma duplicação perfeita do órgão natural. Na verdade, a replicação de
órgãos nem ao menos é o objetivo mais ambicioso.
De acordo com o dr. Forgacs, “a boa notícia é que, de fato, não há necessidade
alguma de copiarmos as mesmas estruturas existentes em nosso corpo. Quem
disse que o nosso coração é a melhor máquina para bombear sangue? Ou quem
disse que o rim é o melhor filtro para se livrar de um veneno? Ambos são
estruturas altamente sofisticadas, mas que realizam funções muito bem definidas
que nós, como bioengenheiros inteligentes, poderíamos imitar. Esses órgãos não
serão cópias idênticas das estruturas que temos, simplesmente porque não são
criados da mesma maneira que a biologia faz a partir do desenvolvimento
embrionário inicial. Mas funcionarão da mesma maneira, se não melhor, que os
nossos órgãos naturais”.

Preocupações
Achamos importante tentar identificar os perigos das tecnologias que
descrevemos, mas, francamente, é difícil encontrar problemas éticos em órgãos
sintéticos e em sua capacidade de tirar milhares de pessoas das listas de espera
por órgãos. Se há preocupações, elas tendem a ser variantes específicas de
problemas que concernem a toda a biotecnologia.
Por exemplo, é provável que os ricos venham a ter acesso privilegiado a mais e
melhores órgãos, sobretudo no começo. Mas, graças ao turismo médico, isso já
acontece. No momento, a máquina que imprime o órgão é o corpo de uma pessoa
pobre.
Como a lei de patentes funcionaria é outra questão importante, mas não
exclusiva da bioimpressão. Vamos supor que o Apple iFígado seja bem melhor do
que o Microsoft X-Fígado. Por quanto tempo a Apple deveria ter o direito de
manter seu produto patenteado?
As variadas questões éticas das células-tronco podem surgir da impressão de
órgãos, mas pelo menos até agora não parecem ser um grande dilema moral. A
maioria das preocupações éticas com as células-tronco está associada ao uso de
células-tronco embrionárias. Mas as células-tronco com maior probabilidade de
serem usadas em bioimpressoras são as pluripotentes, que são como as células
embrionárias mas derivadas de pacientes.
Algumas preocupações podem ser exclusivas da bioimpressão, mas não nos
parecem tão graves. Por exemplo, uma preocupação é a de que órgãos impressos
possam adquirir bactérias durante o processo de impressão. Teoricamente, essas
bactérias poderiam ser de tipos que jamais chegariam, digamos, ao fígado.
Portanto é possível, embora talvez improvável, que órgãos impressos em 3D
introduzam novas doenças no corpo. Mas, assim como uma técnica cirúrgica
asséptica deve manter as bactérias fora do corpo durante a operação, as técnicas
assépticas em um laboratório de bioimpressão devem manter as bactérias fora dos
órgãos impressos.
Há também uma preocupação social: o que economistas chamam de “risco
moral”. A ideia é que, se você põe pessoas em situações em que elas podem se
comportar mal, provavelmente você observará maus comportamentos. Um
exemplo, que já virou clássico, é o de um banqueiro que pode receber um resgate
financeiro se as coisas forem mal para seu banco, então ele faz empréstimos
estúpidos.
Da mesma forma, se não estiver preocupado com nenhum órgão seu, você
pode começar a adotar comportamentos mais arriscados em relação a sexo,
drogas e cheesebúrgueres. Talvez em um futuro distante isso venha a ser um
problema, mas não nos parece provável. A cirurgia de fígado não é exatamente
uma diversão, tampouco uma pechincha. E o processo de perceber que você
precisa de um transplante de fígado geralmente também não é agradável.
Resumindo: se os banqueiros tiverem que abrir cavidades em seus corpos para
receber um resgate financeiro, pode ser que eles pensem duas vezes antes de fazer
outro empréstimo arriscado. Sua vez de jogar, Congresso.

Como isso mudaria o mundo


Nos Estados Unidos, em média, uma pessoa morre praticamente a cada hora
esperando que um órgão fique disponível. E, enquanto elas esperam, com
frequência estão incapacitadas. A bioimpressão de órgãos não beneficiaria apenas
o paciente. A sociedade faria uma enorme economia quanto a horas de trabalho
perdidas e despesas médicas públicas.
Os órgãos impressos também eliminariam a necessidade de mercados de
órgãos. Seus autores não tomam partido quanto a mercados de órgãos legais
serem uma boa ideia ou não108 (embora estejamos certos de que mercados de
órgãos ilegais são uma notícia ruim). Mercados de órgãos legais são uma questão
complicada que, com frequência, equaciona a salvação de vidas humanas com o
abuso e a exploração dos mais pobres. A bioimpressão eliminaria a necessidade
de mercados de órgãos, poupando-nos do impasse ético e abolindo sua versão
mais sinistra. Bem, isso supondo que não haja elitistas de órgãos que só queiram
exemplares “capturados na natureza”.
Com a bioimpressão em 3D, períodos de espera de três anos para receber o
órgão de um cadáver seriam coisa do passado. Você só precisaria esperar o tempo
necessário para que um novo órgão fosse desenvolvido, e esse tempo de espera
provavelmente seria o mesmo independentemente de onde você morasse e do
estado da sua saúde. O dr. Miller afirma: “Talvez até seja possível imprimir de
antemão órgãos substitutos para você e colocá-los em congelamento profundo
até você precisar deles.”
A bioimpressão também usa as células do próprio paciente, portanto a rejeição
e uma vida inteira de medicamentos imunossupressores não seriam mais
problemas. Se ela funcionar, você não só receberá um novo órgão como terá uma
qualidade de vida maior depois da implantação.
A bioimpressão também forneceria cobaias mais realistas para a prática
médica. Pode parecer mais uma conveniência do que um grande avanço, mas,
bem, da próxima vez que você precisasse de uma cirurgia, provavelmente
preferiria que seu médico tivesse praticado em algo mais realista do que o Sr.
Cabeça de Batata.
Talvez o mais importante de tudo seja que isso finalmente traria a tão esperada
resposta à seguinte pergunta:
Nota bene sobre mercados para combinação de
órgãos
O modo como os mercados mais modernos funcionam é simples: você vê uma
coisa que quer e paga por ela. O dinheiro é bom porque universaliza produtos e
trabalho. Quando quer comprar um cappuccino, você não precisa se oferecer para
limpar a casa do barista nem dar a ele um cesto de cenouras.
Mas, em alguns casos, como em romances ou doações de órgãos, usar dinheiro
não é possível. Ou, pelo menos, não usar apenas dinheiro. Essas situações são
chamadas de “mercados de matching” e aparecem com bastante frequência.
Um motivo pelo qual não usamos dinheiro nesses mercados é que, bem... seria
estranho. Imagine sair com a sua amada, ajoelhar-se diante dela e dizer: “Como
você tem físico 8 e social 7, e eu tenho físico 5,5 e social 3, aqui está um contrato
de 40% dos meus ganhos durante toda a vida e... Você quer se casar comigo?”
Não. Você não pode fazer isso. Incentivamos você a tentar e, com toda a
sinceridade, incentivamos você a filmar a tentativa.
Não, você só terá que encontrar a combinação [match] certa. Daí o termo
“mercado de matching”. É por isso que o amor é tanto uma experiência mágica
quanto um pé no saco se comparado a comprar um carro ou um sanduíche.
Imagine se toda vez que você quisesse comprar um sanduba de almôndega tivesse
que escrever um soneto para a senhorita simpática que põe o queijo na
lanchonete?

Visto isso, tens mais força para amar


Não torre o pão, pois logo hei de lhe deixar

Historicamente, quais mercados são mais movidos por dinheiro e quais são
aqueles mais movidos por combinação é uma questão sociológica, com diferentes
culturas solucionando isso à sua própria maneira. O dr. Alvin Roth (ganhador do
Prêmio Nobel e autor de Como funcionam os mercados), de Stanford, invoca o
conceito de “repugnância” para explicar por que muitos mercados são movidos
pela combinação.
Por razões culturais, e talvez biológicas, muitas transações são consideradas,
hummm, repugnantes quando dinheiro entra em jogo. Adotar uma criança é bom.
Comprar uma criança é estranho. Apaixonar-se é bom. Pagar por amor é
estranho (na história moderna). Outras questões estão entre uma coisa e outra:
pagar por sexo é aceitável em algumas culturas e abominável em outras. Em
certas culturas, assistência médica é algo que se compra, e em outras é um direito
do cidadão.
Na maioria das culturas, trocar dinheiro por um órgão é repugnante. Doar um
órgão é sinal de grandeza. Negociar um órgão se insere entre uma coisa e outra.
Torna-se útil, se seu objetivo é tirar pessoas de listas de espera.
O dr. Roth estuda mercados de matching, e um de seus grandes sucessos tem
sido o planejamento de mercados avançados de permuta de órgãos.
Para entender como funcionam os mercados de permuta de órgãos, imagine
como funcionariam as transações se não existisse dinheiro, mas houvesse um site
que combinasse pessoas que querem coisas. Vamos supor que você tenha um
cesto de milho e queira negociá-lo por uma sessão de ortodontia. Se houver um
ortodontista que queira milho, você está feito.
Mas, se não houver, uma opção é introduzir uma terceira pessoa. Vamos
chamá-la de Alice. Você tem algo que Alice quer, e Alice tem algo que o
ortodontista quer: você dá o milho para Alice. Alice dá luvas cirúrgicas ao
ortodontista. O ortodontista lhe dá uma consulta.
Esse circuito de transações é chamado de “ciclo”. Os ciclos não parecem bons
só porque são bonitos. Em um circuito completo, cada pessoa deu algo e recebeu
algo. Em outras palavras, supondo que cada transação tenha sido voluntária,
ninguém se ferrou.
Isso talvez lhe soe como uma armadilha: cada vez que quiser comprar alguma
coisa, você precisa encontrar um ciclo de transações. Você basicamente está
dependendo da capacidade do computador para descobrir uma coincidência
bizarra sempre que quiser algo. Mas se houver participantes o bastante no
sistema e alta capacidade computacional, teremos “coincidências” mais do que
suficientes para fazer qualquer transação que você queira.
Agora imagine que o assunto seja órgãos e você precise de um rim. Você tem
um irmão que quer lhe dar um rim, mas calha de vocês dois não serem
compatíveis por causa do tipo sanguíneo. Nesse meio-tempo, dois outros irmãos
em outro lugar estão na mesma situação. E, em uma dupla coincidência, cada um
que precisa de um rim é compatível com o irmão do outro que está disposto a
doar!
Você concorda com a permuta. Normalmente, um estranho não desistiria
simplesmente de um órgão. Mas nesse caso ele está fazendo isso para obter um
rim para o irmão. Todo mundo sai ganhando.

Situações assim são um pouco incomuns. Mas encontramos muitas


coincidências quando se tem 120 mil pessoas na lista de espera.
A permuta de órgãos abre um problema potencial: e se alguém mudar de ideia?
Vamos imaginar que Alice e Andy queiram permutar rins com Barbie e Bill.
Alice recebe o rim de Barbie supondo que Bill receberá o rim de Andy. Mas
depois de Alice receber o rim de Barbie, Andy de repente já não está tão disposto
a abrir mão de seu rim.
Trata-se de um terreno legal assustador. Você pode processá-los por dinheiro,
mas será que pode fazer o mesmo por, literalmente, meio quilo de carne?109 Para
evitar esse problema, geralmente os órgãos são permutados de forma simultânea.
Todos os doadores recebem anestesia ao mesmo tempo, e a permuta acontece
logo em seguida.
Mas isso cria uma dor de cabeça logística, sobretudo em ciclos grandes. Se o
negócio ideal envolve, digamos, cinco doadores, é preciso ter cinco equipes
cirúrgicas trabalhando ao mesmo tempo e coordenar os órgãos em torno desse
ciclo.
Coisas assim podem acontecer, e acontecem. Quando acontecem, é ótimo
porque cinco pessoas saem da lista. Mas se você consegue encontrar cinco pessoas
boas o bastante, há uma maneira melhor de fazer as coisas.
Para espanto dos autores deste livro, que via de regra são egoístas e narcisistas,
há pessoas dispostas a doar rins para estranhos por nada além de gratidão. Isso,
além de ser maravilhoso, evita o problema de doadores arrependidos.
Imagine o seguinte. Sally Santinha doa um rim a Alice porque Andy prometeu
doar seu rim a Barbie.

Mas depois de feito isso, Andy se revela um verme traiçoeiro.

Bem, não é uma situação muito agradável, mas pelo menos Barbie e Bill não
estão piores do que no início do processo. Bill ainda tem dois rins, então eles
podem se empenhar para ingressar em outro ciclo de modo a conseguir um rim
para Barbie. Alice continua casada com um imbecil egoísta, mas pelo menos ela
tem um rim.
Na prática real, voltar atrás é mais um problema teórico do que qualquer outra
coisa. De acordo com o dr. Roth, o rompimento de ligações acontece apenas 2%
das vezes e “os 2% incluem não apenas pessoas que se acovardam e mudam de
ideia, mas também aquelas que, quando comparecem, não podem doar porque
algo acontece”.
O bom é que, no momento em que temos uma Sally Santinha, podemos tentar
montar uma cadeia de doações superlonga, em que cada par receptor concorda
em doar a outro par.

A princípio, a cadeia pode se estender até alguém trapacear ou algo dar errado.
Assim, algumas pessoas obtêm rins, e elas não precisam passar por operações
simultâneas. E, da perspectiva de um doador altruísta, você não está apenas
doando um órgão: está iniciando toda uma cadeia de permutas de rins! A
extensão média de uma cadeia nos Estados Unidos é de cinco pares, mas cadeias
com mais de setenta já foram criadas. Portanto, uma Sally Santinha pode mudar
muitas vidas.
Há, no entanto, algumas limitações. Embora pessoas necessitem de muitos
tipos de órgão, os mercados de combinação lidam quase que exclusivamente com
rins. Isso porque as cirurgias para permuta de rins têm risco razoavelmente baixo.
O transplante de fígado, por exemplo, é muito mais perigoso do que o de rim.
De acordo com o dr. Roth, algo dá seriamente errado em uma a cada cem
doações de fígado, ao passo que em doações de rim essa taxa vai para uma a cada
cinco mil. Portanto, ainda que os transplantes de fígado sejam possíveis e de fato
aconteçam, os de rim são muito mais comuns.
Alguns leitores podem estar se perguntando por que não fazemos logo um
mercado de órgãos regido pelo dinheiro. Estejam certos de que todos os outros
leitores estão mentalmente olhando de cara feia para vocês agora. Na verdade,
eles acham sua ideia repugnante.
Entretanto, a noção de mercados para venda de órgãos é bem estudada, e de
fato isso existe legalmente no Irã. Existe também ilegalmente em inúmeros
lugares. Não queremos nos aprofundar aqui, portanto, em vez disso, vamos
propor um experimento de raciocínio baseado em algumas ideias do dr. Roth:
No momento, se você tira alguém da hemodiálise por meio de um transplante
de rim, a economia em assistência médica (com frequência oferecida por um
serviço público) é de aproximadamente 1,25 milhão de dólares. Isso significa que
uma pessoa poderia receber 1 milhão de dólares por um rim e o sistema ainda
faria uma enorme economia. E isso nem sequer leva em conta a imensa melhora
na qualidade de vida da pessoa que sai da hemodiálise.
Além disso, doadores poderiam receber um tratamento especial, como uma
posição mais elevada na lista se um dia precisarem de um novo rim. O dr. Roth
propõe até um tratamento social especial a esses doadores, como melhores
assentos em aviões ou um distintivo de honra que eles usariam, mais ou menos
como os veteranos de guerra são tratados hoje.
Agora, vamos supor que a transação também se torne menos repugnante por
ser feita de forma indireta. Ou seja, uma pessoa rica não pode simplesmente
apontar para uma pessoa pobre e dizer “me dá”. Os vendedores de órgãos seriam
tratados da mesma maneira que os doadores de órgãos altruístas, exceto por
receberem algum dinheiro e vantagens. Seus órgãos ainda seriam dados a pessoas
que precisassem mais, de acordo com os critérios usados em hospitais.
Em outras palavras, um mercado de órgãos não precisa ser como aquele nos
seus pesadelos. Poderia ser um sistema em que uma pessoa receberia muito
dinheiro, estima social e lugar garantido no topo da lista de doações — e ao
mesmo tempo salvando vidas e poupando o dinheiro de todos.
Talvez agora você esteja se sentindo um pouco desconfortável. Simplesmente
com uma pequena estruturação de mercado, e em virtude de uma grande
compensação em dinheiro, o sistema parece cada vez menos repugnante. Um
ponto importante que deve ser sempre considerado ao se pensar em mercados é
se um novo sistema, por mais desagradável que seja, é melhor ou pior do que o
sistema atual. Um mecanismo regulador para a troca legal de dinheiro por órgãos
poderia soar grotesco, mas será que é pior do que milhares de pessoas morrendo
enquanto estão em uma lista de espera?
Não temos uma resposta para o que é certo em relação a esses mercados. A
longo prazo, esperamos que órgãos sintéticos sejam viáveis e, em seguida, fiquem
baratos. A curto prazo, a sociedade terá que fazer o melhor para repartir os
recursos escassos da maneira mais ética e eficiente possível.
103. Por acaso, se você mora nos Estados Unidos, há uma política de doação de órgãos opt-in, o que significa
que sua configuração-padrão é a de que, se você morrer sem ter expressado a intenção de doar, seus órgãos
morrerão com você. Considerando que você não pode levá-los aonde quer que vá, incentivamos você a
expressar sua intenção, desde que isso não viole seus princípios éticos.
104. Isso, na verdade, é um dilema sério para os hospitais. Considerando a escassez da oferta de fígados,
alguns hospitais têm preocupações acerca de tratar pacientes com danos autoinfligidos no fígado. O
raciocínio tem duas partes: primeiro, os pacientes que danificaram o próprio corpo poderiam ser
considerados menos merecedores de ajuda do que aqueles que vieram por uma necessidade “honesta”.
Segundo, os pacientes alcoólatras podem ter uma probabilidade maior de danificar o novo órgão
transplantado e acabar voltando à lista. Como avaliar com exatidão esses problemas é difícil, mas muitos
hospitais têm uma regra de “seis meses de abstinência” para pacientes de transplante de fígado, tentando
eliminar os violadores.
105. Para nós, os desajeitados, talvez um original formato de conchinha na extremidade de um dos palitinhos
e um original conjunto de quatro dentinhos de garfo na extremidade do outro.
106. Isso já tem sido feito. Não tivemos o privilégio de experimentá-los, mas eles têm uma aparência
razoável.
107. Não havíamos pensado em como essa frase soaria estranha quando a fizemos.
108. Se isso já parece totalmente louco, por favor, não deixe de ler a nota bene deste capítulo.
109. Está bem, uns 150 gramas, mas mesmo assim.
11.

Interfaces cérebro-computador
Porque depois de quatro bilhões de anos de evolução você ainda
não consegue lembrar onde deixou as chaves

Cérebros são legaizinhos.


Bem, eles são convenientes. É onde guardamos muitas coisas de que gostamos,
como consciência, memória, identidade e a capacidade de perceber várias linhas
de rabiscos pretos como uma frase convincente.
Mas se eu perguntasse “você gosta do seu cérebro?”, sua resposta não seria
totalmente positiva. Você, assim como um cônjuge que, embora carinhoso, tem
uma vida inteira de reclamações, poderia listar dezenas de coisas que gostaria que
fossem ajustadas imediatamente.
Talvez você quisesse ser um pouco mais inteligente ou ter uma coordenação
melhor entre mãos e olhos. Uma memória melhor seria bom. Ou, na verdade,
seria bom remover algumas memórias também. Que tal impedir todos os
sentimentos ruins? E, durante esse conserto, será que daria para colocar aí dentro
a obra completa de Shakespeare? AH! AH! E você poderia gravar os meus
sonhos? Eles são muito interessantes! Eu juro!
A princípio, todas essas coisas poderiam ser feitas. Você sabe que poderia ser
mais inteligente porque conhece pessoas mais inteligentes do que você. E sabe
que poderia ter uma memória melhor porque alguém tem uma memória melhor.
Tudo — do mapa mental de casa ao sentimento que se tem ao ver o pôr do sol —
está fisicamente inserido no cérebro. O cérebro é uma máquina física, de muitas
maneiras semelhante a um computador. Então será que podemos “programar” o
seu cérebro da mesma maneira que programamos um computador?
Agora, devemos ter cuidado aqui. Existe uma tendência histórica a equiparar o
cérebro à melhor tecnologia atual, seja lá qual for. O cérebro é um relógio, o
cérebro é um sistema hidráulico, o cérebro é um motor, e assim por diante.
Mas há bons motivos para pensar que o cérebro é de fato como um
computador. Ou, para sermos mais específicos, há bons motivos para pensar que
um computador poderia agir como um cérebro. O relógio é um mecanismo
inteligente, mas não uma máquina universal. Um relógio nos diz apenas a hora,
mas um computador — até a porcaria daquele celular velho com flip — pode
executar qualquer programa que caiba em sua memória. Está bem, talvez leve uns
dez anos para rodar o programa, mas mesmo assim é capaz de fazê-lo. Se a
“mente” é, de certo modo, um programa, deveríamos ser capazes de executá-la em
um computador convencional.
Esse quilo e meio de gosma entre suas orelhas é uma máquina incrível, com
bilhões de células e trilhões de conexões, mas não nos esqueçamos das virtudes da
caixa de vidro e metal acomodada na sua mesa. Uma das qualidades realmente
boas de um computador convencional é que é fácil modificá-lo. Em particular,
você pode ler nele, atualizá-lo e escrever para ele.110 Cientistas já sabem uma
maneira de fazer mudanças diretamente no cérebro. É um processo que requer
abrir um livro, sentar e lê-lo.
Não, é brincadeira. Eles estão trabalhando em maneiras de fazer alterações e
avaliações diretamente. Isso não é apenas impressionante — também pode ser
importante. Algumas pessoas não conseguem se comunicar ou se mover bem
porque seus corpos não cooperam com seus cérebros. Alguns indivíduos têm
padrões de pensamento que prefeririam não ter. Alguns gostariam de adquirir
conhecimento instantaneamente sem nenhum esforço. Tipo, não seria bom se
você pudesse aprender meditação zen sem fazer nenhum trabalho em si mesmo?
Um computador não pode meditar e geralmente não tem corpo. Mas tem
algumas boas virtudes que faltam a um cérebro. Ele é projetado para e por
humanos, então conhecemos o software e o hardware que o fazem funcionar. Isso
significa que as mudanças são relativamente simples. Se você quer que um
computador aprenda a somar, não precisa praticar dois mais dois com ele o ano
inteiro. Quando damos um novo processador a um computador, ele de imediato
fica “mais inteligente”.
Não seria bom se pudéssemos dar esse tipo de funcionalidade a um cérebro
humano de verdade?
Na realidade, de forma primitiva, já podemos. E os métodos estão melhorando
depressa. O vicejante campo das interfaces cérebro-computador é uma estranha
combinação de ciência incrivelmente complexa e necessidades humanas um tanto
simples, em que microeletrônica e algoritmos poderosos nos permitem ler
cérebros, restaurar movimentos de paralíticos, restabelecer a memória de idosos e,
talvez, dar a pessoas saudáveis capacidades que estão além daquelas de qualquer
ser humano na história.
Além disso, talvez possamos conectar um monte de cérebros a um grande
supercérebro. Isso lhe parece divertido?

Em que pé estamos agora?


Leitura de cérebro

Ler o cérebro envolve descobrir os pensamentos que uma pessoa está tendo e
as ações que está realizando. Por exemplo: que palavras a pessoa está imaginando?
Como ela está se sentindo? Ela está pensando em mexer os pés? Está realmente
mexendo os pés? Esse é o aspecto mais bem estudado das interfaces cérebro-
computador, em parte porque é comparativamente fácil. É mais ou menos assim:
somos muito bons em observar o que um grupo de formigas faz em um
formigueiro (isto é, em ler o comportamento delas), mas para nós seria muito
difícil levar as formigas a fazer algo totalmente novo, como soletrar a palavra “OI”
(isto é, escrever o comportamento delas). Se quisermos ser capazes de mudar o
cérebro, descobrir como ele funciona é o primeiro passo.
Quando tentamos interagir com um cérebro, estamos de certa forma na
posição de cientistas trabalhando com um computador alienígena. Não temos
exatamente um cabo USB. Mesmo que tivéssemos, não há entrada para ele. E
mesmo que houvesse, não sabemos como as informações estão codificadas. Não
de maneira exata, pelo menos. Mas sabemos que o cérebro emite certos sinais e
que eles se correlacionam com o que a mente está fazendo.
Há dois tipos principais de sinal que nos interessam: o elétrico e o metabólico.

SINAIS ELÉTRICOS
Seu cérebro está cheio de um tipo de célula chamado neurônio. As pontas
desses neurônios tocam umas nas outras e, por conseguinte, eles são descritos
com frequência como se fossem a fiação do cérebro. Um dos modos principais
pelos quais os neurônios se comunicam é através de eletricidade. Eles são capazes
de armazenar uma pequena quantidade de carga, que podem depois descarregar
(ou seja, “disparar”) para enviar um sinal aos vizinhos. Uma porção de neurônios
disparando em certo padrão são os pensamentos. Quando você pensa Estou prestes
a ver um desenho de uma torta que dança, é porque um grupo específico de
neurônios está disparando em um padrão específico.

Para nossa conveniência, nós, humanos modernos, temos todo tipo de aparelho
para medir a atividade elétrica. Então, apontamos esses dispositivos para o
cérebro e tentamos descobrir o que você está pensando de acordo com o ruído
elétrico detectado.

SINAIS METABÓLICOS
Metabolismo é um daqueles termos que você tem certeza de que entende, mas
se atrapalharia com as palavras se tivesse que o definir. Na verdade, até na ciência
esse é um termo bem amplo. Mas basicamente significa que uma substância
química é alterada de alguma maneira útil. Por exemplo, a glicose é um açúcar
convertido em uma substância química chamada ATP, usada para acionar muitas
reações no seu corpo. Ou talvez você esteja familiarizado com o etanol, uma
substância química que pode ser metabolizada em más escolhas na vida.
Como resultam em mudanças químicas, os processos metabólicos deixam um
efeito que podemos detectar. Se dez caras entram em uma casa carregando
plantas de aparência curiosa e alguns equipamentos de hidropônica, e depois vão
embora de mãos vazias, você deduz que algo está sendo cultivado no porão. Da
mesma forma, no cérebro, quando vemos sangue oxigenado indo para uma região
e, depois, sangue desoxigenado saindo dali, podemos palpitar que aquela região
do cérebro está ativa para alguma coisa.
É claro que, mesmo que recebamos sinais cerebrais contundentes, ainda não
estamos exatamente lendo o cérebro. Posso pegar um livro em espanhol e
pronunciar as palavras, mas isso não faz de mim alguém que domina o idioma. Se
queremos ler o seu cérebro (e pôr esses sinais em uso), precisamos de uma
maneira de traduzir. Podemos fazer isso por correlação.
Por exemplo, vamos supor que certo grupo de neurônios acenda com sinais
elétricos toda vez que você vê uma torta dançante filosoficamente materialista.
Se isso acontece, podemos presumir com segurança que esses grupos de
neurônios têm a ver com a resolução da angústia existencial. E com tortas. De
maneira mais realista, se certos grupos de neurônios acendem sempre que você
mexe o braço direito, provavelmente estamos detectando a assinatura elétrica do
seu cérebro dizendo ao seu braço para se mexer. Esse tipo de informação é
especialmente útil para criar próteses. Também é possível detectar qualidades
mais sutis, como se você está calmo ou agitado, feliz ou triste e focado ou
disperso.
Agora, vamos explorar algumas formas através das quais já podemos ler o
cérebro. Como uma cortesia ao leitor suscetível, organizamos esta seção do
menos para o mais invasivo. Isto deve lhe dar a chance de, por assim dizer, chegar
à Terra do Cérebro.

LEITURA DE CÉREBRO ELETROMAGNÉTICA NÃO INVASIVA


O método clássico para leitura de cérebro é o eletroencefalograma, ou EEG.
Basicamente, é uma touca careca cheia de eletrodos, em geral com um gel
condutor. Quando o cérebro emite sinais elétricos, o EEG escuta.
Um EEG detecta quando um lote inteiro de neurônios (digamos, uns
cinquenta mil) se comporta da mesma forma para erguer seu braço, por exemplo.
Ou seja, eles fazem algum tipo de padrão cíclico repetido. Não se sabe bem por
que exatamente um imenso grupo de neurônios atua junto (em vez de um
pequeno número de neurônios dispersos), mas essa é uma ocorrência bastante
comum no cérebro. Para sua conveniência, muitos neurônios agindo juntos geram
um sinal elétrico forte o bastante para ser detectado fora do cérebro, por um
equipamento relativamente barato.
O EEG tem muitas vantagens, a maior delas é não envolver qualquer cirurgia
ou equipamento sofisticado. Além disso, tem uma boa “resolução temporal”,
assim como todos os detectores à base de eletricidade. Você pensa algo, seu
cérebro emite um sinal e o EEG o detecta, tudo isso em uma fração de segundo.
Isso é importante para qualquer interface cérebro-computador, porque o usuário
quer ser capaz de “falar” com o computador em tempo real.
A maior desvantagem do EEG é a “resolução espacial” ruim. É possível
detectar sinais elétricos, sim, mas talvez seja difícil dizer exatamente de onde eles
vieram. Por quê? Porque você só está detectando sinais na superfície do crânio.
Imagine que você tem uma esfera gigante com um milhão de gatos dentro. Há
detectores de som por toda a borda da esfera. Não há nenhuma interferência do
lado de fora porque seus amigos pararam de falar com você.
Quando um gato mia, o som é fraco demais para ser detectado. Mas vamos
supor que haja uma espécie de festa de gatos e um enorme grupo comece a miar
de uma vez só. Então você detecta um sinal. Como o som não viaja
instantaneamente, o ruído da festa de gatos chegará a alguns de seus detectores
mais rápido do que a outros.
Usando seu conjunto de detectores, seu conhecimento sobre o interior da
esfera e um processamento de sinais por computador, você talvez consiga dizer
exatamente onde a festa de gatos começou. Mas haverá erros. Primeiro, sempre
há várias festas de gatos de uma vez. E há um nível constante de miados ao
fundo. E os sons dos miados são um pouco distorcidos ao se moverem pela esfera
gigante e por sua borda. Então, em vez de ser capaz de afirmar “a festa de gatos
foi bem ali”, você tem que dizer “a festa de gatos começou nessa área geral”. Da
mesma forma, o EEG pode dizer (de maneira meio grosseira) que “essa parte do
cérebro está ativa”. Mas até a obtenção desses dados envolve alguns obstáculos
técnicos.
Em primeiro lugar, seu rosto é irritante, assim como o seu crânio. Seu rosto
utiliza sinais elétricos para atividades como piscar, que são importantes mas não
interessantes para uma leitura de cérebro. Esses sinais elétricos a mais impedem a
obtenção de uma leitura de EEG perfeitamente clara. Além disso, sua cabeça
pode suar ou talvez você contraia um pouco o couro cabeludo, o que também
pode atrapalhar o sinal.
Mas, considerando sua simplicidade e conveniência, o EEG é realmente a
máquina de uso mais comum nas pesquisas de interface cérebro-computador. É
barato. Não exige um conjunto de pregos perfurando a sua cabeça (mais sobre
isso adiante) e faz um trabalho razoavelmente bom de detecção de sinais
cerebrais.
Uma ferramenta que complementa o EEG é chamada de
magnetoencefalografia, ou MEG. A corrente elétrica do cérebro produz um
campo magnético. Esses sinais magnéticos são muito, muito mais fracos que os
elétricos, mas têm uma vantagem: passam através do seu crânio sem muita
distorção.
A princípio, isso deveria significar que é possível obter sinais muito bons sem
ser invasivo demais. Na prática, todos os sistemas de MEG atuais são enormes.
E, por causa de uma limitação nos designs de hoje em dia, o aparelho precisa
ficar a certa distância do crânio. Ou seja, a MEG não pode se aproximar o
bastante para obter uma boa resolução espacial.
A verdadeira vantagem da MEG é que ela detecta um conjunto de neurônios
complementar ao EEG. Veja bem, os neurocientistas às vezes modelam o cérebro
como um cilindro, mas isso não é muito preciso. O cérebro é cheio de
protuberâncias. E esponjoso.
Acontece que, graças a essas protuberâncias, algumas regiões são mais
facilmente analisadas com dados coletados pelo EEG, enquanto outras o são com
a MEG. Para análise, os dois métodos são melhores juntos, mas para uma
interface cérebro-computador, não tanto. A MEG requer um dispositivo
supercondutor de interferência quântica extremamente sensível, ou SQUID,
sobre o qual falamos na introdução. É por isso que, se você fizer uma busca no
Google por “Meg the Squid”, vai receber informações sobre imagens cerebrais,
em vez de alguma lula [squid] chamada Megan.
Os SQUIDs também precisam ser resfriados com hélio líquido, o que não é
barato. E o aparelho é tão sensível que o ambiente em que se encontra tem que
ser protegido do campo magnético da Terra. Resumindo, você provavelmente não
será capaz de carregá-lo por aí tão cedo.

LEITURA DE CÉREBRO METABÓLICA NÃO INVASIVA


Se você já foi a um hospital e ficou preso dentro de um tubo estreito e com
uma barulheira ao redor, ou você esteve dentro de uma máquina de IRM ou
estava nascendo. O exame de IRM (abreviatura de “imagem por ressonância
magnética”) é uma maneira de “tocar” de forma eletromagnética áreas do seu
corpo e em seguida usar o sinal resultante para produzir uma imagem da gosma
esponjosa ali dentro. No sistema de IRM clássico, detectamos diferenças na
concentração de água dos tecidos, o que é útil porque os tumores tendem a
conter menos água do que os tecidos saudáveis.
Mais recentemente, cientistas criaram um tipo especializado de IRM chamado
fIRM. O f é de “funcional”: soa como se o inventor quisesse insultar o IRM
original. Na verdade, “funcional” se refere a como podemos ver o cérebro
enquanto ele funciona. Um fIRM tira proveito do fato de que o sangue
oxigenado tem uma assinatura magnética diferente da do sangue desoxigenado.
Grupos de neurônios em uso consomem mais oxigênio do que neurônios em
repouso. Procurando sangue com oxigênio relativamente alto ou baixo, é possível
descobrir as áreas do cérebro que parecem estar mais ativas. Isso deve permitir
uma leitura do cérebro em alta resolução.
A máquina é complexa, mas a lógica é simples: se você me mostrar uma foto
de uma vaca e, de repente, um grupo específico de neurônios absorver um monte
de oxigênio, esses neurônios provavelmente estão reagindo à vaca. Ou se você me
perguntar qual era a minha banda favorita em 1993 e um grupo específico de
neurônios receber uma dose de oxigênio, esses são provavelmente os neurônios
que lidam com a vergonha.
O maior aspecto negativo da fIRM é que a máquina é ainda volumosa e cara.
Assim como a MEG, ela é boa para pesquisas, mas se você quiser que ela seja
algo a que pessoas comuns tenham acesso o tempo todo, algumas grandes
melhorias tecnológicas serão necessárias.
Outro método metabólico, chamado de fNIRS (espectroscopia de luz próxima
ao infravermelho funcional), tem se mostrado uma alternativa promissora.
Sabe quando você era criança, pegava uma lanterna e a luz passava através da
sua mão? A fNIRS é assim, mas para os neurocientistas.
Você pega uma luz próxima ao infravermelho e a emite através de um cérebro.
Ao passar, a luz é absorvida pelo sangue oxigenado de maneira um pouquiiiiinho
só diferente da maneira como o sangue desoxigenado a absorve. Um detector do
outro lado da cabeça capta a luz restante e, então, uma computação sofisticada
mostra as áreas do cérebro que estão recebendo oxigênio naquele momento.
Considerando que os detectores e computadores estão ficando cada vez
menores e mais baratos, a fNIRS pode ser um bom modo de começar a ler
cérebros para uma interface cérebro-computador. É possível que seja ainda mais
conveniente do que o EEG, que pode exigir que se ponha um gel molhado na
cabeça juntamente com a touca de banho com eletrodos.
Uma grande limitação da fNIRS é que, na verdade, a luz não consegue
percorrer todo o caminho através do cérebro. Na verdade, só percorre uns 2,5
centímetros. Então é preciso disparar em torno das bordas. Porém, em termos
gerais, muitas coisas que consideramos pensamentos ativos acontecem na parte
externa do cérebro, enquanto funções mais primitivas, como respirar, são
governadas por regiões internas.

A tecnologia metabólica mais animadora, só que menos desenvolvida, é a


espectroscopia por ressonância magnética funcional, ou fMRS. Ela funciona mais
ou menos da mesma forma que a fIRM, mas, graças a avanços relativamente
recentes em tecnologia de processamento de sinais, podemos detectar muito
mais.
Como você pode imaginar, seu cérebro faz mais do que apenas transportar
oxigênio para lá e para cá. Na verdade, há milhares de substâncias químicas com
diferentes usos no cérebro. Até agora, a fMRS é capaz de detectar algumas delas.
Assim, além de nos dizer onde as coisas estão acontecendo, a fMRS dá algumas
pistas sobre o que está acontecendo, o que forneceria um quadro muito mais rico
do que está havendo entre as suas orelhas.
No entanto, a fMRS é outra tecnologia cujo atual equipamento de ponta é
bem volumoso e caro.
E há um problema que ainda não mencionamos, mas que é comum a todos os
dispositivos metabólicos. Já mencionamos que o EEG obtém uma boa resolução
temporal, mas uma resolução espacial fraca. Ou seja, é bom para quando você
pensa algo, mas ruim para onde o pensamento ocorre em seu cérebro.
Os detectores metabólicos são o oposto. Eles fornecem bom quadro de onde,
mas apenas um quadro marginal de quando.
Eis uma imagem de uma torta dançante nietzschiana. Quando você terminar
de ler essa frase, um processo metabólico concernente a tortas nietzschianas terá
sido concluído dentro do seu cérebro. O processo elétrico correspondente
aconteceu antes de você chegar à primeira letra da frase. Os processos
metabólicos geralmente levam de três a seis segundos, e podem levar até trinta
segundos para serem concluídos.

Isso é ruim por dois motivos. Primeiro, para pesquisadores, confunde os dados,
espalhando-os através do tempo. Tipo, talvez depois de ver a torta dançante que
transcendeu a moral do rebanho, você também se lembre de uma torta que sua avó
fazia. Isso dá início a um sinal metabólico diferente enquanto o primeiro está
enfraquecendo, o que dificulta dizer qual é qual.
Segundo, para um usuário da interface cérebro-computador, isso é um atraso
gigantesco. Imagine que você está tentando fazer com que uma mão robótica
mova um frasco de queijo em spray na direção da sua boca. Um atraso que varie
de três a trinta segundos será um problema sério, a menos que você queira fazer
uma barba de queijo.
Está bem, então essas são todas as maneiras comuns e simpáticas de se ler o
cérebro. Mas e se usássemos uma abordagem mais direta?

LEITURA DE CÉREBRO INVASIVA À BEÇA


Francamente, é irritante ter que olhar o lado de fora da cabeça e tentar fazer
uma suposição educada sobre a gosma suculenta ali dentro. Será que não
podemos prender uns negócios direto na superfície do cérebro?
E não é que podemos?! Esse método se chama eletrocorticografia, ou ECoG.
Basicamente, imagine um EEG na superfície do cérebro, em vez de na superfície
do crânio. Então é como um EEG, só que sem aquela chatice de cabelo, pele,
ossos e fluidos se metendo no caminho.

Adivinha? Os dados são muito melhores que os do EEG. Na verdade, o


ECoG já tem sido utilizado para prever movimentos tridimensionais de braços e
tem permitido a pacientes com paralisia controlar com precisão cursores de
computadores e até braços de robôs. O aspecto negativo é que há eletrodos no seu
cérebro.
Com os métodos modernos, depois que o paciente se cura de uma cirurgia, é
possível tornar o ECoG minimamente visível implantando a maior parte do
dispositivo sob a pele. São só alguns fios saindo do alto da sua cabeça — nada
que lhe daria um susto se você visse nas ruas da cidade.
Não obstante os desejos dos neurocientistas, o ECoG só é considerado
apropriado para pacientes com enfermidades sérias. Portanto, os experimentos
costumam ser feitos em pacientes que estão recebendo eletrodos implantados
para tratamento contra epilepsia. Vários livros que lemos descrevem pessoas que
heroicamente concordam em fazer testes neuropsicológicos irritantes nos
intervalos entre cirurgias no cérebro.
Embora o ECoG possa ter um papel muito importante em aplicações
terapêuticas, você provavelmente não o usará para jogar videogame ou para fazer
o download dos seus sonhos. Mas muitos pesquisadores da interface cérebro-
computador acham que o ECoG talvez acabe sendo o caminho a seguir. Ele é
um tanto invasivo, e o procedimento ainda apresenta sérios riscos, mas, uma vez
que a fase perigosa tenha passado, será uma excelente fonte de dados que pode
permanecer em vigor por no mínimo décadas. Por mais estranho que pareça, o
ECoG (que, no fim das contas, fica apenas em cima da superfície do cérebro)
representa uma espécie de ponto que fica na metade do caminho entre as
possibilidades de monitoramento de neurônios.
O que há na outra metade?, você pergunta.

LEITURA DE CÉREBRO REALMENTE SUPERINVASIVA


Vamos supor que você queira receber dados ainda melhores. Há várias opções
mais invasivas do que uma suíte de eletrodos na superfície do seu cérebro. Elas se
encaixam em uma categoria chamada registro intracortical. “Intracortical” é uma
maneira simpática de dizer que coisas estão sendo presas ao seu cérebro. A
maneira clássica de fazer isso é chamada de Matriz de Utah.
Esse processo não é tão agradável quanto a palavra “Utah” levaria você a
acreditar. O que se tem é um conjunto de arames relativamente rígidos sobre uma
placa quadrada. Na ponta de cada arame há um eletrodo que escuta sinais
elétricos do cérebro. Esses arames provavelmente terão também um revestimento
anti-inflamatório antes de entrarem, para minimizar irritações decorrentes de
fincar arames no seu cérebro.
Uma coisa boa da Matriz de Utah é que ela tem sido aprimorada com o passar
do tempo graças a avanços técnicos. As matrizes se tornam cada vez melhores,
sobretudo porque os pinos estão ficando mais uniformes ou mais numerosos. É
como acontece com os chips de computador, só que, em vez disso, são agulhas no
cérebro.
Um desenvolvimento semelhante, e de certa forma mais recente, é chamado de
Matriz de Michigan. Não é muito diferente de enfiar um pequeno garfo no
cérebro, mas é um pouco mais útil. Ao longo dos dentes do “garfo” há uma série
de eletrodos que funcionam mais ou menos como as pontas de agulha da Matriz
de Utah. Em princípio, uma das coisas legais da Matriz de Michigan é que ela
pode ser melhorada acrescentando-se mais eletrodos, e não mais pontas.
Portanto, à medida que a tecnologia refina, obtemos mais dados e menos danos.
Os dados desses tipos de leitores cerebrais são particularmente bons,
informando as coisas elétricas que estão acontecendo no nível de neurônios
específicos ou de pequenos grupos de neurônios. A maior desvantagem — bem, a
maior desvantagem fora a parte em que o seu cérebro é esfaqueado — é a
degradação da qualidade.
A qualidade dos detectores dentro do cérebro tende a degradar depressa
porque, como seria de se imaginar, o cérebro não gosta de ser perfurado por metal
e silício. Quando o equipamento é posto ali dentro, o cérebro cria uma resposta
imunológica e acaba encapsulando o objeto estranho no equivalente neural a um
tecido de cicatrização. Depois de um ano ou dois, você provavelmente perdeu os
sinais de mais da metade dos eletrodos. É como ter um computador cujo
desempenho vai piorando aos poucos, mas sem dúvida, mesmo enquanto você
está aprendendo a usá-lo.
Uma tentativa de resolver esse problema é chamada de eletrodo neurotrófico.
Imagine um cone de sinalização de trânsito feito de vidro, só que menor. Com
uma largura de dez centésimos de centímetro. O cone é cheio de substâncias
químicas neurotróficas (o que significa que neurônios crescerão ali).
Eletrodos são inseridos nas substâncias químicas. Depois da implantação no
cérebro, neurônios crescem na lacuna, e os pinos os detectam. É como um
pequeno jardim secreto, mas com pontas no cérebro.
Por causa do número limitado de eletrodos, a quantidade de informação
recebida é menor do que com as matrizes de Utah e Michigan, e de localização
muito restrita, mas ainda assim muito boa. E até agora os sistemas neurotróficos
demonstraram uma excelente longevidade, durando até quatro anos no cérebro
de pacientes. Esse processo específico é razoavelmente novo, então não sabemos
ainda se ele se provará ser tão útil quanto os procedimentos invasivos mais
estabelecidos.
Em todos esses métodos dentro do cérebro, há uma séria questão relacionada à
deterioração do tecido a longo prazo, que vai além dos danos iniciais causados
pela inserção. É assim: imagine que você tem uma tigela de gelatina e enfia um
pente fino ali dentro. Independentemente do cuidado com que você carrega essa
gelatina, o balanço dela fará o dano inicial causado pelo pente se agravar no
decorrer do tempo. No caso do tecido cerebral real, temos danos e inflamação.
Esse tipo de preço a ser pago pode parecer razoável no caso de uma pessoa com
problemas de saúde sérios, mas impossibilita o êxito se você quiser algum tipo de
sistema de cérebro de ciborgue futurista.
Uma proposta para consertar as coisas é o uso de matrizes de eletrodos
flexíveis, de modo que os “pinos” possam se mover com o cérebro. O problema é
que se os pinos forem maleáveis, não dá para enfiá-los de maneira apropriada no
cérebro gelatinoso. Então é preciso ter um material que entre com rigidez ali, mas
amoleça quando exposto ao ambiente úmido do cérebro. E, enquanto isso, ele
precisa ter uma pequena ponta de eletrodo que envie informações à superfície.
Algumas demonstrações desse tipo de coisa já foram feitas em laboratório, mas
não ainda em pesquisas com humanos.
Em todos os métodos de leitura de cérebro, uma tendência geral que você deve
ter observado é que há um conflito entre qualidade de dados e o grau de invasão.
O EEG é relativamente confortável (pelo menos se comparado a um buraco na
cabeça), mas a proporção entre sinal e barulho é meio ruim. As matrizes de pinos
invasivos geram excelentes dados, mas causam alguns danos ao cérebro. O ECoG
está em algum ponto no meio do caminho. Resumindo, quanto mais invasivo,
melhores são os dados.
Essa é uma boa maneira de pensar em leitores cerebrais, mas há um outro
conflito, entre amplitude e profundidade de sinal. Pinos no cérebro fornecem
ótimos dados sobre uma pequena parte do cérebro. O EEG garante dados
grosseiros sobre o cérebro inteiro. Portanto, pense nisso da seguinte maneira: se
você é um alienígena tentando descobrir o que está acontecendo na Terra,
preferiria ter uma visão clara de alguns quarteirões de Nova Jersey ou uma vista
aérea do planeta inteiro? Da perspectiva de uma interface cérebro-computador,
isso não está totalmente claro.
Uma interface cérebro-computador ideal teria dados de granulação fina para o
cérebro inteiro. Há, de fato, uma proposta para isso chamada “poeira neural”,
composta por sensores minúsculos no cérebro todo. Isso nos parece incrível,
desde que não tenhamos que ser os primeiros a experimentar.

Atualizando o cérebro

Será que podemos atualizar um cérebro? Quer dizer, seu cérebro tem alguns
problemas sérios. Lembra aquela coisa constrangedora que você fez no ensino
médio? Lembra? Por que você se lembra daquilo, mas não consegue recordar as
três leis da termodinâmica?111
Está bem, não chegamos ao ponto em que podemos aumentar seu QI, dar a
você uma memória melhor ou aprimorar sua capacidade de dizer não a mais um
martíni de maçã. Mas, conforme discutimos a seguir, pode ser que sejamos
capazes de mitigar problemas realmente sérios e amplificar coisas boas que seu
cérebro já faz bem. E talvez (talvez) possamos melhorar sua capacidade de
aprender novas habilidades.
Uma tecnologia para reparar esses problemas se chama estimulação cerebral
profunda. Essa técnica seria como uma versão muito mais direcionada da terapia
de choque elétrico. Em um sistema típico, um eletrodo é implantado
cirurgicamente no cérebro e conectado a uma bateria colocada sob a pele.
Basicamente, eles colocam uma varinha no seu cérebro, e ela contém um
eletrodo na ponta, acionado por uma bateria. Quando ativado, o eletrodo envia
uma dose de eletricidade de alta frequência para a área em torno dele. Para dar
um exemplo de sua provável utilidade, considere alguém que está prestes a ter
uma convulsão. Grosso modo, uma convulsão começa em uma pequena região do
cérebro e se move para fora daí, de uma forma que com frequência é comparada
ao surgimento de uma tempestade. Não se sabe muito bem por que isso acontece,
mas, com um pouco de eletricidade, o estimulador cerebral profundo parece
ajudar a deter a tempestade antes que ela possa aumentar e se tornar uma
convulsão completa.
Esse método de estimulação está razoavelmente bem estabelecido para vários
tratamentos, uma vez que o utilizamos há algum tempo. Conversamos com a dra.
Aysegul Gunduz, da Universidade da Flórida, que explicou sua experiência com
estimuladores cerebrais profundos da seguinte maneira: “Quando comecei a
trabalhar com estimulação cerebral profunda, percebi que, ah, meu Deus, estão de
fato implantando [estimuladores cerebrais profundos] e mandando essas pessoas
de volta para casa. Isso é realmente aprovado. O curioso é que ainda não
percebemos como a estimulação cerebral profunda melhora os sintomas dessas
doenças.”
É isso mesmo: a maior parte do que sabemos sobre como esse método de
varinha elétrica na cabeça funciona é por tentativa e erro. Talvez, caro leitor, sua
reação aqui seja: “O QUÊ, MEU DEUS? TENTATIVA E ERRO?!”
Bem, sim, tentativa e erro não é o método empírico ideal quando se trata de
enfiar um eletrodo no fundo do crânio de um paciente. Mas há um problema de
ética aqui.

A estimulação cerebral profunda não é algo que seu médico vai fazer quando
você chegar com um resfriado ao consultório dele. Geralmente é usada em
pessoas com problemas sérios (tais como convulsões quase constantes ou
depressão com tendências suicidas) que não respondem a tratamentos
convencionais. Para esses pacientes, os potenciais benefícios compensam o custo
potencial da estimulação cerebral profunda. No entanto, cérebros humanos não
vêm com manuais perfeitos, então aprendemos enquanto fazemos e, geralmente,
o conhecimento provém desses pacientes.
E ainda assim esse método parece ser útil para uma gama cada vez maior de
doenças. Por exemplo, a dra. Gunduz está tentando usar a estimulação cerebral
profunda para tratar o “congelamento de marcha”, uma incapacidade temporária
em pacientes de Parkinson, e para interromper e impedir tiques em pacientes
com síndrome de Tourette.
Pode soar um pouco esquisito, mas o procedimento hoje em dia é
razoavelmente comum e tem suas virtudes. Esse sistema simples parece ter uma
longevidade alta, durando décadas em pacientes.112 Além disso, quanto mais
usamos essa técnica, mais perto chegamos de entender por que ela funciona.
Outra virtude, pelo menos se comparada a medicamentos ou métodos
psiquiátricos, é que a estimulação tem efeito mais ou menos imediato após a
cirurgia. Isso não é pouca coisa para uma pessoa com condições cerebrais graves.
Também facilita, a princípio, saber se o procedimento funcionou mesmo, o que é
o tipo de coisa pelo qual você talvez se interesse em se tratando de choques
voluntários no cérebro.
Uma empresa chamada NeuroPace criou um dispositivo chamado Sistema
RNS, que usa implantes no estilo ECoG para monitorar o cérebro para a
chegada de convulsões. O dispositivo, tão pequeno que não dá para saber se um
paciente o está usando, emite pulsos direcionados quando a tempestade elétrica
da epilepsia começa.
O Sistema RNS não funciona para todo mundo e precisa de uma substituição
de bateria pelo menos a cada cinco anos, o que exige uma cirurgia no cérebro.
Além disso, diferentemente do estimulador cerebral profundo, com sua relativa
simplicidade, checagens de segurança por tela podem acionar o Sistema RNS.
Choques elétricos indesejados e repentinos no cérebro provavelmente pioram em
10% as verificações de segurança em aeroportos.
Outros pesquisadores estão tentando um método menos invasivo chamado
estimulação magnética transcranial. É, de certa forma, semelhante à estimulação
cerebral profunda, só que usa campos magnéticos fortes e (isso é legal) não exige
que seja feito um buraco na cabeça da pessoa. Até agora, o método se mostrou
útil para alívio de dor e, possivelmente, para depressão. Assim como a
estimulação cerebral profunda, esse processo ainda é uma ferramenta um pouco
brusca. Cientistas identificam uma área associada ao problema e em seguida
lançam um campo magnético ali. Até agora, parece trazer alguns resultados
benéficos, mas os estudos continuam.
Mas digamos que você não queira solucionar um problema — sua vontade é
tornar um cérebro saudável melhor. Isso é fácil. Faça exercícios, alimente-se bem,
reduza o estresse e estude mais.
Não, é brincadeira. Será que podemos melhorar seu cérebro preguiçoso com
computadores? A resposta é talvez.
Entramos em contato com o dr. Eric Leuthardt, da Universidade de
Washington. Ele é neurocirurgião e neurocientista porque, você sabe, não dá para
investir toda a sua energia em uma área só.
Ele acha que as tecnologias para melhorar o cérebro seguirão uma trajetória
semelhante à da cirurgia plástica.

Nos primeiros tempos da cirurgia plástica, a maioria dos procedimentos visava


reparar desfigurações graves, fossem elas naturais ou causadas por acidentes ou
guerras. Depois que o público em geral passou a aceitar esses métodos, o escopo
foi ampliado do reparo para a melhoria.
O dr. Leuthardt sugere: “Vamos imaginar que você recebe um pequeno
implante e aumenta seu nível de atenção. Por exemplo, com algo como um
pequeno dedal implantado no crânio, você pode agora aumentar sua atenção e
reduzir seu tempo de reação (...) Um negociador em Wall Street poderia ganhar
cem milhões de dólares a mais por realizar melhores transações por períodos
mais longos.”113
Para aqueles que estão menos animados com o dedal no cérebro, já há estudos
mostrando que a estimulação magnética externa pode melhorar o desempenho
em algumas tarefas cognitivas e de memória. Talvez você tenha ouvido falar de
uma notícia sobre pessoas que receberam campos magnéticos ou elétricos no
cérebro e, com isso, melhoraram suas capacidades de aprendizado e cognitiva.
Isso pode ser verdade, mas um estudo divulgado recentemente sugere que as
evidências são ambíguas.
Em linhas de estudo parecidas, pesquisas muito recentes sugerem que a
estimulação cerebral profunda de áreas do cérebro associadas à memória pode
melhorar o aprendizado. Esses estudos foram feitos em pacientes que já tinham o
eletrodo implantado por outros motivos.
As evidências sugerem que a estimulação melhorou a capacidade dos pacientes
de lembrar informações espaciais simples. Talvez não seja um bom negócio ter
um eletrodo enfiado na cabeça só para você lembrar o caminho para o Burger
King, mas esses resultados propõem que realmente existe algo na ideia de usar a
eletricidade para melhorar o aprendizado. O tempo dirá.
Entretanto, mesmo que isso seja possível, pode haver outros problemas.
Existem grandes evidências de que você consegue estudar mais se tomar
anfetaminas, mas seu médico provavelmente ainda não está recomendando isso.
Os efeitos colaterais (como aumento da pressão arterial, visão turva e episódios
maníacos) não compensam os benefícios.
No caso da estimulação eletromagnética para melhorar o cérebro, não sabemos
quais são os efeitos a longo prazo. Então é bem provável que você não vá
conseguir comprar um capacete neuroestimulante no Walmart nas próximas
semanas.
Uma abordagem diferente para “atualizar” um pouco seu hardware é
simplesmente usar o que o cérebro já faz, só que com mais eficiência. Sabe
quando você parece absorver as informações mais rápido? Em outras ocasiões, é
como se as informações batessem no seu cérebro e voltassem. Às vezes você se
sente particularmente motivado, carinhoso ou estudioso.
O problema é que você pode nem sempre saber que se encontra nesses estados
de espírito. Então, talvez, por qualquer razão, seu estado cerebral para aprender
entre as 13 e as 14 horas de hoje esteja ótimo. Mas você está passando esse tempo
jogando videogame, então não se dá conta. Ou seu estado mental encontra-se
particularmente bom para se exercitar entre as 14 e as 15 horas de hoje. Mas você
está passando esse tempo jogando videogame, então não se dá conta.
Bem, e se esses estados mentais pudessem ser detectados e trazidos para sua
atenção? Vamos supor que você tivesse um dispositivo que monitorasse seu
cérebro para determinados padrões e lhe dissesse o que provavelmente você faria
bem neste exato segundo. Você saberia qual é a melhor hora para escrever aquele
poema ou para preencher planilhas. Saberia qual é o melhor momento para ler
Shakespeare ou para vegetar vendo TV.

Há algumas evidências tentadoras de que se você detectar certas ondas


cerebrais, isso pode significar que o cérebro se encontra em um estado melhor
para aprender algo novo. Pelo que podemos dizer, as evidências de que esse tipo
de coisa funciona em humanos são bem limitadas. O estudo mais convincente
que encontramos mostra que coelhos aprendiam muito mais rápido — de duas a
quatro vezes mais rápido! — se os pesquisadores esperassem para lhes ensinar
uma tarefa quando a onda cerebral certa era detectada.
Em outras palavras, parece haver uma condição ideal para esses coelhos
aprenderem. Será que o mesmo se aplica a humanos? Até agora, não sabemos. Os
humanos, com algumas exceções, são um pouco mais complexos que os coelhos.
E, no caso desse experimento específico, o aprendizado era uma tarefa motora
extremamente simples.

Escrevendo para o cérebro

Antes de mais nada, nem tão cedo vamos fazer um upload de Shakespeare,
cálculo ou kung fu para o seu cérebro. Acontece que esse tipo de coisa é
incrivelmente difícil, em grande parte porque a memória não funciona como
achamos que funciona. Resumindo: quando o indivíduo experimenta alguma
coisa, um padrão é criado em seus neurônios. Quando ele se lembra dessa coisa,
há, por assim dizer, um replay desse padrão. Se seu cérebro tivesse sido projetado
por um humano para, convenientemente, carregar um arquivo de kung fu, todas
as suas lembranças ficariam armazenadas em uma parte específica do cérebro, de
preferência com porta USB. Para a nossa inconveniência, a natureza não
desenvolveu seu crânio para receber periféricos.
Ah, e a outra coisa é que você já pode escrever para o cérebro, seu preguiçoso.
Na verdade, você acabou de escrever em seu cérebro “ei, este livro acabou de me
chamar de preguiçoso”. Ouvir, cheirar, ver, tocar — todos os sentidos são
maneiras de escrever para o cérebro.
Bem, isso é a realidade para a maioria das pessoas. Para algumas delas (e para
muita gente mais velha) esses mecanismos de escrita enguiçam. Não somos
especialistas em escrita de cérebro, mas sabemos como usar máquinas para
reparar algumas fiações antigas. Existem duas tecnologias importantes que
podem pelo menos consertar visões e audições enguiçadas.
É possível restaurar a visão usando os chamados fosfenos, lampejos do que
parece ser uma luz e os quais você percebe mesmo que luz alguma tenha entrado
em seus olhos. Isso acontece com frequência quando as pessoas sofrem uma
pressão repentina sobre seus globos oculares. Por exemplo, um dos autores deste
livro, que não será identificado, gosta de fazer esse negócio de chegar por trás de
sua esposa, Kelly, e (delicadamente) pressionar os olhos dela, gritando: “Fosfenos!
Fosfenos!” Ela com certeza adora a dança repentina de luz percebida diante dos
olhos.
Acontece que você pode obter o mesmo efeito com a eletricidade. Então
cientistas descobriram como implantar um dispositivo na órbita do olho de um
cego que, em essência, cria um conjunto de pixels usando fosfenos. Não é
exatamente ver, mas é bom o suficiente para que a pessoa tenha uma percepção
aproximada de um rosto. Em um caso, uma pessoa até conseguiu dirigir em um
estacionamento vazio.
A audição também pode ser restaurada por meio de um dispositivo chamado
implante coclear. Talvez você já tenha ouvido falar disso e imagine que se trata
simplesmente de algum tipo de aparelho auditivo muito bom. Na verdade, é um
tipo de aparelho auditivo totalmente diferente. Funciona assim: um pequeno
microfone é colocado perto do ouvido. Ele recebe o som, que vai para um
receptor colocado sob a pele do paciente. O receptor faz o melhor possível para
filtrar os ruídos relevantes (por exemplo, a voz da pessoa que está falando com
você, e não a música que está tocando no fundo) e em seguida traduz o resultado
em sinais elétricos, que são enviados através do crânio para o ouvido interno.
Dessa maneira, pacientes que antes não tinham audição alguma são capazes de
ouvir alguma coisa. Embora exija treinamento, os pacientes acabam conseguindo
ouvir razoavelmente bem. Escutamos simulações daquilo que os pacientes com
implante coclear ouvem e elas nos soaram mais ou menos como uma gravação de
baixa qualidade em fita cassete. O que, na verdade, é bem impressionante.
Existe outro desenvolvimento interessante em escrita de cérebro, que é
provavelmente o que há de mais próximo em relação a ensinar a você kung fu
instantaneamente. Chama-se prótese hipocampal, e alguns grupos estão
trabalhando nisso de modo a ajudar em casos de doenças de formação de
memória, como Alzheimer e demência.
Quando uma memória é criada, ela segue para uma parte do cérebro chamada
hipocampo. Ali, ela pode deixar de ser uma memória de curto prazo e ser
convertida em memória de longo prazo. Quando esse processo é interrompido,
produzir novas memórias de longo prazo pode ser difícil. É por isso que sua
bisavó se lembra de detalhes de quando era uma menininha, mas esquece
completamente que hoje é o aniversário dela.
O objetivo é que esse dispositivo intercepte os sinais do cérebro destinados à
memória de longo prazo que seriam interrompidos pela neurodegeneração. Os
sinais são processados e em seguida enviados para o lugar certo, para que se
tornem, de fato, memórias.
Pode parecer que estamos escrevendo diretamente para o cérebro, mas eis a
armadilha: não sabemos o que estamos escrevendo. Estamos apenas processando
e passando adiante. O principal pesquisador dessa área, o dr. Theodore Berger, da
Universidade do Sul da Califórnia, comparou isso a traduzir do francês para o
espanhol sem falar nenhuma das duas línguas.
Inserir memórias para um armazenamento de longo prazo sem “falar a língua”
seria bastante conveniente, já que poderia exprimir o potencial de registrar
lembranças de um cérebro e escrevê-las em outro. Mas, por enquanto, muitos não
creem que o processo de memória seja simples o bastante para possibilitar isso.

Preocupações
Ah, garoto, é fácil ter preocupações com modificações no cérebro.
Para iniciantes, o cérebro não é uma máquina simples, então não é uma
questão simples fazer atualizações. Por exemplo, há algumas evidências de que
camundongos criados por engenharia genética para ter memórias melhores são
também mais suscetíveis a dores crônicas. É possível que qualquer modificação
na maneira como o cérebro funciona tenha consequências indesejadas.
E mesmo que as consequências indesejadas sejam conhecidas, a competição
pode levar pessoas a modificações cerebrais. Um em cada quatro pesquisadores
acadêmicos admite usar medicamentos para melhorar o cérebro. Além da
possibilidade de causar efeitos na saúde deles individualmente, esse
comportamento cria uma dinâmica social perigosa. Se uma pessoa usa
anfetaminas para produzir trabalhos num ritmo mais rápido, todos os outros
estarão disputando bons trabalhos com o cara da anfetamina.
Esse problema ainda não foi aprofundado, em parte porque ainda não está
claro se os medicamentos para modificação cerebral disponíveis garantem uma
grande vantagem para os usuários. A moça no fim do corredor que só precisa
dormir duas horas por noite é provavelmente mais produtiva do que você, mas
não é dez vezes mais produtiva. Se novas tecnologias começarem a criar
diferenças intelectuais mais profundas, muitas pessoas seriam mais ou menos
obrigadas a virar usuárias.
Não são apenas os trabalhadores altamente qualificados que poderiam estar em
risco na era da interface cérebro-computador. Pense o seguinte: que direito seu
empregador tem sobre os dados que estão inseridos em você? Se seu implante lhe
permite ser rastreado, será que a empresa pode rastreá-lo enquanto você trabalha?
Uma empresa que lida com público já tem algum direito de pedir aos
funcionários que estejam de bom humor. Se o bom humor é modulado no nível
neural, será que a empresa tem o direito de saber o que o implante está fazendo?
Já foi sugerido que seria benéfico aos funcionários o uso de uma máquina que
detectasse lapsos no foco no trabalho e fornecesse algum tipo de estímulo. Isso
aumentaria a segurança no local de trabalho, mas não sabemos bem como nos
sentimos em relação a forçar funcionários de uma fábrica a ter dispositivos
cerebrais eletrônicos para aumentar o foco.
Inserir capacidade computacional também cria sérias preocupações com
privacidade. Se o indivíduo tem um equipamento médico no corpo, é provável
que o dispositivo contenha alguma maneira sem fio de se comunicar com o
mundo externo. Isso oferece um risco de hackeamento. No caso dos implantes de
cérebro, hackear poderia significar muitas coisas. Em implantes sérios, um hacker
poderia ser capaz de matar ou traumatizar uma pessoa de maneira remota. De
forma mais sutil, acessando um estimulador cerebral profundo, por exemplo, um
hacker poderia controlar seu humor ou mesmo aspectos de sua personalidade.

Via de regra, uma pergunta que poderia ser feita é que direitos as pessoas têm
sobre a computação inserida em você. Por exemplo, se você está fazendo uma
prova para entrar na faculdade e tem uma interface que lhe permite falar com o
dicionário, será que os responsáveis pela prova têm o direito de saber? E se você
sempre tiver esse implante, será que essa pergunta é relevante?
Um aspecto socialmente desconfortável da modificação cerebral é o que pode
acontecer com grupos não típicos. Os cegos e os surdos têm suas próprias
comunidades e, no caso dos surdos, sua própria linguagem. Se implantes neurais
podem dar visão e audição às pessoas, isso pode significar o fim (ou pelo menos a
diminuição) de comunidades com perspectivas únicas que existem há muito
tempo. Na verdade, muitos membros da comunidade de surdos se manifestaram
contra os implantes cocleares justamente por esse motivo.
Agora em um viés mais sinistro: e se comportamentos considerados
indesejáveis por razões culturais fossem modificados? Está bem, todos nós
conhecemos pessoas que poderiam usar algum modificador de comportamento.
Mas considere que essa tecnologia venha necessariamente a existir em algum
momento, com todos os problemas de sua época.
A homossexualidade já não é considerada uma patologia, mas não foi o caso
durante a maior parte da história. Em 1972, o dr. Robert Heath realizou
experimentos em um homossexual preocupado, em uma tentativa de induzir a
heterossexualidade via EEG e estimulação elétrica. Hoje, alterando o cérebro,
podemos extinguir características que mais tarde seriam consideradas valiosas ou
moralmente benignas.
Isso nos leva à preocupação mais geral em relação a interfaces cérebro-
computador: serão elas o fim da humanidade conforme a conhecemos? Se você
pegasse um recém-nascido de dez mil anos atrás e o trouxesse para o presente,
não há motivo para crer que ele teria algum problema de adaptação. O hardware
básico do cérebro humano é o mesmo desde que o Homo sapiens existe. Com uma
interface cérebro-computador, seria a primeira vez que mexeríamos nisso. E a
primeira vez que tentarmos mexer nesse pequeno computador carnudo entre
nossas orelhas será necessariamente nosso esforço mais desajeitado.
Ganhar a capacidade de modificar nossos cérebros fomenta um estranho
circuito. Podemos modificar nossos cérebros para ficarmos mais inteligentes, o
que significa que faremos melhores interfaces cérebro-computador, o que
significa que podemos ficar ainda mais inteligentes e assim por diante. Muito em
breve todos nós seremos ultracérebros desincorporados e com a razão perfeita, o
que é meio chato, porque aí vamos deixar de gostar de séries bobinhas de TV.

Como isso mudaria o mundo


À medida que se tornar confiável, a interface cérebro-computador poderá ser
aplicada em muitas indústrias. Uma interface cérebro-computador ideal tornaria
você mais inteligente, com memória melhor, mais focado e talvez até mais
criativo. Não dá para pensar em possibilidades sem imaginar algum tipo de
distopia de ciborgues, mas se ganhássemos a oportunidade repentina de ter uma
memória melhor, provavelmente todos nós a aproveitaríamos.
A curto prazo, muito da utilidade das interfaces cérebro-computador estará em
solucionar problemas, não em aprimorar cérebros. Mas o bom é que reparar
partes do cérebro danificadas exige de nós compreendê-las. A compreensão
naturalmente nos levaria ao aprimoramento.
Embora você talvez imagine um futuro em que seus pensamentos são
sondados por computadores telepáticos, os principais usos de curto prazo para
esses dispositivos serão terapêuticos. Uma área que está apenas começando a
decolar é chamada de neuroprótese.
A neuroprótese é um dispositivo que encaminha um sinal do seu cérebro para
uma prótese. Atualmente, muitas pesquisas são destinadas às pernas,
simplesmente porque pernas são mais simples do que braços. As neuropróteses
são vistas como a forma mais moderna de reabilitação robótica para membros
perdidos, porque fazem exatamente o que um membro de verdade faz. Em
próteses de pernas modernas muito avançadas, a máquina tenta detectar o modo
de andar que a pessoa pretende executar (caminhar, correr, saltitar) e se mover de
acordo. Não é nem de longe tão natural quanto uma perna de carne e osso nem
consegue realizar muitos dos movimentos complexos que gostaríamos que uma
perna real fosse capaz de fazer.
Cientistas descobriram como fazer com que algumas dessas próteses deem um
feedback ao cérebro. Para você é natural não precisar ver sua perna se mexer, já
que percebe onde ela está no espaço e sente os músculos dela tensionando. Você
também tem condições de dizer quando está machucando sua perna, o que não é
possível quando ela não transmite sinais de volta ao cérebro. A princípio, a
neuroprótese da interface cérebro-computador deve ser capaz de fornecer alguma
forma de comunicação de mão dupla.
Ou, se o plano não for construir um braço de robô, em alguns pacientes pode-
se usar uma interface cérebro-computador para fazer um membro paralisado se
mexer. A paralisia com frequência é resultado de alguma forma de lesão na
coluna vertebral, que é a principal via para sinais do cérebro. Portanto, quando ela
é lesionada, a rota dos sinais do cérebro para os membros é cortada. Uma pessoa
que não consegue mover o braço por causa de uma lesão na coluna ainda pode
enviar um sinal para o braço. O problema é que o sinal não chega ao destino. Mas
e se pudéssemos capturar o sinal e enviá-lo diretamente ao membro?
Uma tecnologia chamada neuroponte fez exatamente isso pouco tempo atrás.
Uma Matriz de Utah foi posta no córtex motor de um paciente e ligada, através
de uma conexão sem fio, a uma série de estimuladores elétricos no antebraço
dele.114 Com paciência e prática, ele conseguiu mexer a mão e os dedos de novo.
O movimento está longe de ser perfeito, e não há como o braço fornecer um
feedback, mas a longo prazo essas pontes poderão representar uma cura para a
paralisia de membros.
Além do mercado para terapias avançadas, as interfaces cérebro-computador
(de um tipo) já são usadas para softwares mais recreativos. Diversos jogos estão
disponíveis, embora em geral usem uma tecnologia relativamente simples. O jogo
com o belo título de Throw Trucks with Your Mind [Lance caminhões com sua
mente] coloca os jogadores em uma arena virtual onde eles vencem lançando
objetos em seus oponentes. O truque? Para ter o poder de lançar algo, você
precisa exibir uma onda cerebral associada à calma. Se isso resultará (como espera
o criador do jogo) em novas terapias para ansiedade e déficit de atenção, ou se
apenas fará as pessoas relaxarem enquanto lançam caminhões imaginários, só o
tempo dirá.
Outra proposta é melhorar a comunicação fazendo computadores saberem seu
estado de espírito. Por exemplo, um dispositivo de reconhecimento de voz talvez
tenha dificuldade de diferenciar “eu quero um bolo” de “eu quero um bobo”. Uma
interface cérebro-computador simples poderia dizer se você está com fome ou só
falando bobagem.
Outros desejam uma conexão ciber-neuro. Em uma série de experimentos,115
animais de laboratório tiveram seus cérebros ligados por meio de uma interface
cérebro-computador.
O resultado parece ser um tipo de conexão cérebro-cérebro. Não sabemos se
esses ratos de laboratório estavam literalmente compartilhando pensamentos,
mas seus cérebros conectados pareceram ser capazes de se unir para realizar
tarefas com mais eficácia. Em algum momento no futuro, poderá ser possível de
fato combinar mentes de pessoas, tanto para propósitos recreativos quanto de
negócios.116 Para nós, isso parece uma versão em pesadelo de fazer um projeto
em grupo, mas cada um com a sua mania.117
O dr. Gerwin Schalk, do Wadsworth Center, imagina um mundo em que
podemos comunicar experiências com mais intimidade e mais detalhes. Na
verdade, ele acha completamente ridículo termos que usar esses bastõezinhos de
carne rechonchudos conhecidos como dedos para digitar nossas experiências a
fim de compartilhá-las. Se nossos cérebros estivessem conectados, você teria uma
experiência muito mais pessoal. Por exemplo, colocaria uma pessoa em um
momento que você vivenciou, e ela poderia ver o que você viu, cheirar o que você
cheirou e sentir o que você sentiu.
“Isso transformaria a sociedade de modo muito mais contundente do que o
computador transformou a sociedade. Em essência, mudaria completamente o
que significa ser humano (...) Seríamos capazes de interagir com a tecnologia e
com as pessoas à nossa volta basicamente sem pensar (...) Significaria que todos
os nossos pensamentos poderiam ser prontamente agregados em uma nuvem.
Isso removeria por completo todas as barreiras de comunicação, e a sociedade
seria uma espécie de super-humano ou algo que incorpora todas as diferentes
pessoas (...) Quer dizer, realmente não consigo pensar em nada que traria efeitos
mais profundos sobre a vida.”
Não temos certeza total de que estamos de acordo com essa coisa de
megacérebro. De fato, o dr. Schalk observa que conexões constantes poderiam
resultar em alguns desastres: “Você se senta no sofá com sua esposa e pensa quero
me divorciar da minha esposa. De repente, ela fica sabendo disso. Isso não seria
muito bom.”
Não, isso não seria nada bom.
As interfaces cérebro-computador têm uma característica estranha: queremos o
que elas podem nos dar individualmente, mas tememos o que elas fariam conosco
como sociedade.
De todas as tecnologias deste livro, uma interface cérebro-computador
aperfeiçoada é provavelmente o dispositivo com efeitos mais imprevisíveis. Se um
reator de fusão ou um elevador espacial forem criados, o reator ainda será
operado por humanos e o elevador ainda transportará humanos para a órbita. Se
seu cérebro estiver conectado a um computador e os dois puderem modificar um
ao outro, você não será um humano da maneira como sempre conhecemos. Isso
seria um fim e um começo.

Nota bene sobre o dr. Phil Kennedy


Abrimos esta seção com uma breve transcrição da entrevista de Kelly com o dr.
Leuthardt. Na verdade, a entrevista for feita por Skype, mas, para dar uma pitada
de drama à história, por favor, imagine uma sala escura de um castelo, com frias
paredes de pedra repletas de espécimes biológicos estranhos e livros grossos com
encadernação de couro. Acrescente relâmpagos quando necessário.
Dr. Leuthardt: A tecnologia não é o problema. Se eu tivesse dinheiro, na
verdade nem muito, poderia construir uma coisa dessas hoje (...) O
problema é se as pessoas vão financiar, se as pessoas vão desenvolver e se a
FDA aprovará isso. Acho que, sob muitos aspectos, estamos muito mais
perto do que pensamos. É realmente a nossa burocracia se pondo no
caminho.
Kelly: Isso é fascinante. Eu não tinha ideia de que estávamos tão perto de
neuropróteses para pessoas sem deficiências. Quando você fala com as
pessoas sobre obter neuropróteses, você fica...
Dr. Leuthardt: Quer dizer, só para sua informação, escute esta história curiosa.
Phil Kennedy (...) implantou um computador no cérebro. Teve uma
interface cérebro-computador. Ele é um cientista normal, saudável, que
implantou uma interface cérebro-computador em si próprio em Belize, um
ou dois anos atrás.
Kelly: O que ela faz?
Dr. Leuthardt: Acho que ele fez isso mais por motivos científicos, de modo a
poder estudar o próprio cérebro. Basicamente, ela registra sinais de seu
córtex da fala e permite controlar várias coisas. Na verdade, ele teve um
problema com isso e precisou remover, mas fez. Ele é um ser humano
normal que queria ter uma interface cérebro-computador.

O que é considerado “normal” pode variar entre um típico cirurgião cerebral e


um leitor médio, mas talvez seja esse o preço da genialidade. De qualquer modo,
o nome do dr. Philip Kennedy não nos é estranho. Na verdade, ele é o pioneiro
dos eletrodos neurotróficos, que discutimos na seção sobre leitura de cérebro.
Acontece que a história do dr. Kennedy é um pouco mais complexa do que a
história anterior sugere. Ele certamente é a favor de medidas extremas e, de fato,
pegou um avião para Belize a fim de conseguir uma cirurgia que não seria
aprovada nos Estados Unidos, pagando 25 mil dólares do próprio bolso para
fazer um implante em seu córtex motor e poder falar com uma interface cérebro-
computador.
Mas a decisão do dr. Kennedy de ter uma interface cérebro-computador não
foi tomada com facilidade, e o intuito não era ele se tornar uma espécie de
primeiro ciborgue. Na verdade, o grande objetivo de sua pesquisa era ajudar
pacientes com síndrome do encarceramento. Pessoas com essa doença não
conseguem mexer nenhuma parte do corpo ou só conseguem fazer movimentos
mínimos, como piscar ou gemer. Se isso lhe parece vagamente familiar, talvez
você já tenha ouvido falar do livro O escafandro e a borboleta, que Jean-Dominique
Bauby ditou ao longo de um ano apenas piscando o olho.
Uma quantidade razoável de pesquisas sobre interface cérebro-computador
tem se concentrado em maneiras de dar a pacientes como Bauby a capacidade de
se mover com mais liberdade. O próprio trabalho do dr. Kennedy com eletrodos
neurotróficos permitiu a alguns pacientes operar um cursor de computador e
selecionar letras. Mas, depois de ele trabalhar três décadas nessa área, a FDA se
recusou a aprovar mais pacientes para o dr. Kennedy.
Ele estava tendo dificuldade de obter financiamento e cobaias e passou a temer
que o trabalho de sua vida não servisse para nada. Foi nesse momento que gastou
o próprio dinheiro para fazer de si mesmo um paciente. Escreveu seu testamento,
fez com que sua empresa lhe fornecesse uma interface cérebro-computador e
viajou para Belize.
Duas cirurgias depois, aquilo parecia ser um sucesso. O dr. Kennedy perdera
temporariamente a capacidade de falar, o que talvez sugira que a FDA tivesse
razão. Mas ele alegou não sentir qualquer ansiedade por causa disso. Afinal, ele
ajudou a abrir caminho para essa cirurgia e conhecia seus efeitos colaterais.
Talvez ele não estivesse preocupado com os efeitos colaterais — não é todo
mundo que paga uma pequena fortuna para ir a um país com regulamentos
médicos mais brandos a fim de modificar eletronicamente o próprio cérebro.
Ele realizou pesquisas extensas em si mesmo, dizendo e pensando palavras e
em seguida monitorando se um pequeno grupo de neurônios específico
disparava. Os dados foram excelentes. Infelizmente, sua cabeça nunca fechou por
completo, o que, você sabe, não era o ideal. Após cerca de um mês de pesquisa,
cirurgiões nos Estados Unidos removeram seu sistema. E na mais bizarra
reviravolta dessa história... o plano de saúde dele cobriu o procedimento.
O dr. Kennedy pelo visto acha que ainda assim valeu a pena. Tudo o que
podemos fazer é tirar o chapéu para sua dedicação. E, por Deus, gostaríamos de
ter ouvido sua consulta com o agente do plano de saúde.
110. Aqui queremos dizer “ler” e “escrever” no sentido amplo de carregar informações e baixar informações.
111. PEGUEI VOCÊ. São quatro.
112. Isso pode ser estranho de início, considerando que os dispositivos mais avançados que discutimos
anteriormente parecem perder utilidade em questão de meses. Mas, lembre-se, aqui não se está tentando
capturar um sinal sutil. Está apenas disparando eletricidade. Portanto, não importa se o cérebro formar uma
cicatriz em torno do eletrodo — ele pode continuar funcionando bem.
113. Não manifestamos nenhum escrúpulo moral em relação a abrir o crânio de negociadores de Wall
Street.
114. Por que no antebraço e não na mão? Porque a mão é basicamente uma grande marionete em forma de
estrela-do-mar que você controla com seu antebraço. Vá em frente, verifique. Mantenha um dos braços para
cima com a mão solta. Use a outra mão para apertar o antebraço e veja seus dedos soltos se mexerem.
115. Para que fique claro, não estamos totalmente confortáveis com a ética desse experimento.
116. Ou para propósitos de guerra. O Exército dos Estados Unidos também está interessado em
comunicação cérebro-cérebro, porque soldados capazes de se comunicar sem palavras têm uma probabilidade
menor de entregar sua localização ou seu plano de ataque.
117. “Está bem, pessoal! Vamos fazer uma sessão de brainstorming!”
12.

Conclusão
Ainda demora, ou O cemitério dos Capítulos Perdidos

Antes de escrevermos este livro, éramos aquelas pessoas que liam livros cujo
objetivo é tornar a ciência acessível e reclamavam de pequenas imprecisões — o
equivalente nerd do entusiasta de nacho que fica cuspindo insultos da
arquibancada em uma partida de futebol. Quando o simpático pessoal da
Penguin aceitou nossa proposta, foi como se os salgadinhos tivessem sido
arrancados das nossas mãos e, você sabe, substituídos por seja lá qual for o
equipamento que os jogadores de futebol usam.
O orgulho nerd estava em risco.
Fizemos o melhor possível para atingir a combinação certa de informação e
humor, mas nosso maior temor ao escrever este livro era de que alguém nos
chamasse de “imprecisos”. Ou, como nós, idiotas, dizemos, “a palavra proibida”.
Mas, em virtude da imensa quantidade de informação que tentamos reunir (e da
quantidade ainda maior de informação que precisou ser condensada ou
descartada), é totalmente possível que tenhamos inserido alguma coisa um pouco
errada em algum lugar.
Portanto, se por acaso você notar um erro factual, por favor, nos informe. A
melhor maneira é você dizer aos amigos e familiares que está tirando umas férias
longas e entrará em contato e, então, vir à nossa casa e descer a escada até o porão
escuro. Lá embaixo tem alguns aperitivos, nós prometemos.
Quando começamos a imaginar este livro, a ideia era dar uma rápida espiada
em um monte de tecnologias emergentes. Mais ou menos como uns petiscos, só
que para meganerds. Conforme avançávamos, passamos a achar que não
poderíamos trazer nada de novo se nos limitássemos a capítulos pequeninos.
Sinceramente, se você quiser uma breve visão geral de qualquer um dos tópicos
deste livro, a Wikipédia é uma fonte razoável de consulta. Queríamos trazer mais
profundidade, mais detalhes esquisitos e mais daquelas histórias estranhas com as
quais você depara quando está falando com cientistas malucos ou lendo
documentos obscuros. Mais ou menos como uns petiscos, só que para meganerds
com, digamos, apetites maiores.
A maioria dos tópicos originais foi extirpada no começo, enquanto
aumentávamos os capítulos. Alguns foram reunidos em capítulos únicos sobre
assuntos mais abrangentes. Mas tivemos alguns capítulos que cultivamos,
apreciamos e no fim das contas tivemos que deixar de lado.
Como conclusão para este livro, pensamos em deixar esses tópicos saírem
brevemente do purgatório de uma pasta no Google Drive para aproveitar um
momento de sol antes da escuridão eterna.
Apresentamos: O Cemitério dos Capítulos Perdidos.

Túmulo 1: Energia solar com base no espaço


A ideia fundamental da energia solar com base no espaço é colocar um
conjunto gigantesco de painéis solares no espaço e abastecer a Terra com os raios
desses painéis.
Existem alguns benefícios tentadores em pôr painéis solares no espaço. No
espaço não há noite, portanto não é preciso armazenar energia ou trocá-la por
outra fonte após o pôr do sol. Você pode mover os painéis para perto do Sol,
onde obtém mais energia por área.118 Pode emitir energia para qualquer lugar da
Terra, desde que haja um receptor. E é benéfico ao meio ambiente, a menos que
você conte as milhares de toneladas de combustível de foguete que serão
queimadas para colocar todos os painéis no espaço.119
O problema? Bem, para começar, isso é caríssimo. Um painel solar
razoavelmente leve para telhado pesa em torno de nove quilos. Pelo custo atual
dos lançamentos espaciais, são 200 mil dólares por painel. Mesmo em um cenário
com um elevador espacial em que o custo é de meros 550 dólares por quilo, ainda
assim são 5 mil dólares por painel, sem contar o custo de construir painéis que
possam funcionar no espaço.120 E enquanto isso os painéis solares feitos para uso
na Terra custam em torno de 200 dólares. E o custo está caindo rápido.
Portanto, por que chegar a considerar seriamente essa ideia? Em The Case for
Space Solar Power, John Mankins argumenta que os painéis de energia no espaço
podem obter quarenta vezes mais energia por área do que os painéis na Terra. Isso
porque na Terra temos as estações, o ciclo de dias e noites e o clima.
Isso, de certa forma, é uma comparação injusta, já que o espaço tem seus
próprios problemas exclusivos (como rochas espaciais e radiação), mas o sr.
Mankins está apenas tentando mostrar que a energia solar espacial pode ser
interessante. Tudo bem. O problema para nós é que, supondo que a proporção
seja de fato 40 para 1, usando nossas estimativas anteriores, ainda é bem difícil
argumentar a favor do benefício econômico de colocar painéis solares no espaço.
Mesmo que os números mais otimistas do sr. Mankins estejam certos, e que
apresentemos a você um elevador espacial superavançado, nas taxas atuais
estaremos pagando vinte vezes mais pelo preço do painel para obter quarenta
vezes mais eficiência. Isso é bom, mas estamos supondo que na época em que
pudermos construir um cabo espacial de quase cem mil quilômetros de
comprimento, o preço dos painéis solares terá caído mais de 50%.
Então, mesmo no futuro, quando os lançamentos espaciais poderão ser bem
baratos, provavelmente sempre será mais barato e mais fácil construir quarenta
painéis no Arizona do que lançar um painel no espaço.
Também é mais fácil fazer a manutenção dos painéis no Arizona. Está bem,
Phoenix no verão obviamente é pior que o frio vazio do espaço, mas em termos de
energia solar há algumas vantagens: o Arizona tem ar respirável, gravidade forte,
o Maior Esqueleto de Vaca do Mundo121 e ausência de radiação de alta energia
constante. Se entrar sujeira no painel do Arizona, você o limpa com um rodo, e
não com um robô espacial munido de rodo espacial.
A manutenção de muitos hectares de placas solares no espaço faz com que
robôs de reparo extremamente avançados sejam não apenas úteis, mas
necessários. A alternativa é ter uma grande equipe de astronautas treinados para
resistir aos rigores do mar de escuridão salpicado de estrelas que existe além da
palidez do céu... para lavar janelas o dia inteiro.
Talvez obtenhamos o tipo certo de robô por meio de alguns desenvolvimentos
discutidos neste livro, mas mesmo que você tivesse um enxame autônomo de robôs de
manutenção, seria preferível contar com ele consertando painéis no Arizona, terra
da Maior Árvore Petrificada do Mundo.122
Uma possível virtude das placas solares é que elas poderiam (em um futuro
muito distante) ser valiosas para o transporte espacial. A ideia é captar a energia
de painéis próximos ao Sol e emiti-la para veículos que já estão no espaço. Esse
talvez seja o modo como as coisas acontecerão a longo prazo, já que o Sol
representa uma enorme quantidade de energia gratuita. Mas supomos que haverá
melhores opções quando pudermos lançar megaestruturas com robôs reparadores
a bordo.
Para este livro, examinamos muitas tecnologias distantes da realidade, e sem
dúvida algumas delas não vão se materializar, ou pelo menos não da forma que
achamos mais animadora. Mas a energia solar espacial nos pareceu indesejável
mesmo nas condições mais ideais. Talvez, se nossa necessidade de energia se
tornar muito maior e decidirmos usar apenas as renováveis, possamos um dia
ficar literalmente sem imóveis utilizáveis. Mas isso parece improvável. Com a
atual eficiência dos painéis solares, toda a necessidade de energia do mundo
poderia ser atendida com uma usina solar que cobriria 10% do deserto do
Saara.123 Estamos supondo que as pessoas apreciariam a sombra.
Em defesa disso, muita gente inteligente acha que há possibilidades.
Permanecemos céticos.

Túmulo 2: Próteses avançadas


O que são próteses avançadas? Trata-se de uma categoria um pouco ampla,
mas estávamos interessados em qualquer coisa que nos levasse para além do
paradigma de pedaços sólidos de madeira ou metal, em direção a um mundo
onde próteses estão funcionalmente mais próximas dos antiquados membros de
carne e osso. Isso abrange muitas coisas legais, desde materiais avançados fortes
mas flexíveis, passando por membros com computadores que tentam prever seu
movimento, até as neuropróteses que abordamos no capítulo anterior.
As próteses modernas e não computadorizadas já são incríveis. Há materiais e
designs tão avançados que até dispositivos aparentemente bem simples podem
ser tão funcionais quanto bonitos. E as impressoras 3D certamente têm seu lugar,
tanto para fazer próteses customizadas quanto para adicionar designs intrincados
às próteses geralmente sem graça disponíveis em fabricação em massa.
As próteses computadorizadas também são muito boas. Conforme
mencionamos, algumas pernas artificiais tentam determinar exatamente o modo
de andar da pessoa — trotar, correr, saltitar, subir escada, fazer moonwalking — e
responder de acordo. Não são perfeitas, mas é uma grande melhoria em relação
ao antigo método de pedaço de madeira sólido.
Uma das desvantagens das versões computadorizadas é que elas são
basicamente mais um dispositivo que precisa de carga de energia. Isso é óbvio
para qualquer um que usa prótese, mas para nós foi uma espécie de revelação. Se
você tem um membro inteligente, precisa retirá-lo toda noite, ligá-lo a um
carregador e se sentir irritado com pessoas que reclamam de ter que carregar seus
iPads.
As dificuldades para aprimorar as próteses são fascinantes. Por exemplo, o
movimento real da perna humana é mais complexo do que você imagina. Um dos
motivos que fazem a perna de pau ser uma droga é que ela só tem um nível de
rigidez. Pense nisso. Para qualquer modo de andar que se escolha (supondo que
você tenha duas pernas-padrão de carne e osso), automaticamente você põe sua
perna em um certo nível de rigidez. Tente caminhar com as pernas totalmente
esticadas. Claro, parece superlegal, mas é lento e doloroso. Agora tente caminhar
sem forçar os joelhos. Ou talvez não. Ou, se tentar, não nos processe quando
quebrar a cara.
Existem regimes de rigidez intermediários para caminhar, correr, pular e assim
por diante. Você aprendeu tudo isso quando tinha quatro anos, portanto não
pensa nisso, mas é incrível. Quando você caminha, seu joelho e seu tornozelo
atuam juntos para dar a sua perna a quantidade certa de flexibilidade, então você
não machuca as articulações. Além disso, sua perna (como uma mola gigante)
recaptura parte da energia gasta no movimento para a frente. Pernas de carne e
osso também fornecem feedback, tornando possível que até mesmo adultos que
tomam péssimas decisões consigam fazer ajustes rápidos. Esses tipos de feedback
estão sendo integrados às próteses, mas a tecnologia ainda é muito rudimentar.
E depois vêm os tornozelos. Você tem tornozelos muito, muito bons. Por
exemplo, ao correr, você não os mantém retos. Você os mexe um pouquinho para
o lado. Quanto mais rápido for, mais pronunciada é a mexida. O modesto
tornozelo é, na verdade, uma belíssima geringonça que consegue se movimentar
em qualquer eixo e se enrijecer em todo tipo de posição. Tente se imaginar
jogando futebol sendo capaz de mover o tornozelo apenas para a frente e para
trás. Até jogar boliche seria difícil. O pior de tudo: se os tornozelos não
existissem, os cavalheiros vitorianos não poderiam cobiçar a única parte à mostra
no corpo das donzelas.
E nem sequer mencionamos as mãos. Elas são o maior desafio das próteses,
porque milhões de coisas acontecem nelas. Por exemplo, você toma decisões com
cada dobra dos dedos e ainda com o pulso, e provavelmente com o cotovelo e o
ombro.
As mãos também representam um problema quando o assunto é a força de um
movimento. Se você perder a mão (digamos que seu pai a decepe em um duelo),
vai querer substituí-la. Conforme mencionamos no capítulo anterior, os músculos
que movimentam os dedos estão no antebraço.
Se você perde a mão e o antebraço, músculos mecânicos podem ser postos mais
tarde em uma prótese de antebraço para movimentar a prótese de mão. Se você
só perde a mão, esses músculos mecânicos precisam estar dentro da própria mão.
Isso reduz o espaço para enfiar pequenas baterias e estimuladores.
É por isso que quando decepou a mão de Luke Skywalker, Darth Vader estava
sendo ainda mais canalha do que o espectador comum poderia perceber. Ao
decepar a mão, mas não o antebraço, ele fez com que Luke precisasse de uma
prótese muito mais complexa. Esse é o poder do Lado Sombrio.
O futuro das próteses está provavelmente nas neuropróteses, que encaminham
os sinais do cérebro diretamente para o dispositivo. Como também discutimos no
capítulo anterior, estamos chegando lá, mas isso ainda está longe de funcionar
muito bem sem ser extremamente invasivo. Um dia, pode ser que haja membros
substitutos que funcionem de forma tão natural quanto os de verdade, mas,
levando em conta a história das próteses, pequenas melhorias significariam uma
vida bem melhor para muita gente. E, em um futuro realmente maravilhoso,
talvez ganhemos membros a mais ou tipos de membros totalmente novos.
Tentáculos para todos!
Então por que eliminaríamos este capítulo? Em parte, temíamos que
descrições mais técnicas dos desafios protéticos ficassem um pouco repetitivas e
chatas. De um modo idiota, era um assunto fascinante, mas achamos que a
maioria dos leitores não iria querer saber tudo sobre os graus de liberdade de uma
articulação típica de tornozelo.
Mais importante: muitos dos desenvolvimentos mais animadores nesse campo
são muito redundantes em relação aos tópicos do capítulo sobre a interface
cérebro-computador. A tecnologia da neuroprótese tem uma área de pesquisa
própria, mas é um subcampo do negócio da interface cérebro-computador.
Portanto, não sem lamentar um pouco, nós a despachamos para o túmulo.
Túmulo 3: Supercondutores a temperatura
ambiente
Uma das coisas empolgantes desse capítulo era a oportunidade de ir além da
única coisa que as pessoas (às vezes) sabem sobre supercondutores: que eles
conduzem sem perda de energia.
Acontece que essa transmissão de energia sem perda provavelmente não é tão
impressionante quanto pensávamos. Conseguimos alguns números sobre a
quantidade de energia poupada com a substituição total da atual rede elétrica por
transmissão sem perda, e seria em torno de 10% ou menos. É muita energia para
ser ignorada, mas considere que — mesmo que você tivesse um supercondutor
que não exigisse resfriamento — para obter a totalidade desses 10% seria preciso
remover e substituir cada pedacinho da rede de transmissão que usamos hoje em
dia.
Além disso, todos os materiais de supercondução em alta temperatura que
conhecemos não estão em uma forma conveniente para uso. Se você visse um
deles na natureza, provavelmente acharia que se tratava de algum tipo estranho
de pedra. O cobre, por outro lado, pode ser facilmente esticado em longos e belos
fios. Se em determinado momento descobrirmos um supercondutor que possa
funcionar em temperaturas favoráveis aos humanos, apostamos que não será tão
fácil trabalhar com ele quanto é com um pedaço de metal maleável.
Portanto, a transmissão provavelmente está fora.124 Mas ela não é nem de
longe o único ator no campo dos supercondutores. Esses objetos estranhos têm
duas outras propriedades incríveis: o efeito Meissner e o aprisionamento de fluxo.
Como este é o cemitério dos capítulos, não temos como lhe dar todos os
detalhes, mas, resumindo, o efeito Meissner é assim: quando resfria o bastante
para ir de um estado de não supercondutor para um estado de supercondutor, o
objeto rapidamente expele campos magnéticos vindos de seu interior. Portanto,
por exemplo, imagine que você colocou um ímã comum sobre um supercondutor
não resfriado e começou a baixar a temperatura cada vez mais. Você acabará
tendo um supercondutor quando atingir determinada temperatura crítica. De
repente, o ímã salta para longe!
Por quê? Porque o ímã tem campos magnéticos e o supercondutor os está
meissnerando125 para longe.
Em seguida, há o aprisionamento de fluxo. Em resumo, para certos tipos de
supercondutores (chamados Tipo II), o efeito Meissner meio que não serve de
nada. Esses supercondutores permitem que campos magnéticos penetrem neles
aqui e ali, em vez de serem completamente expelidos. Sendo assim, com essa
estranha qualidade é possível “prender” um ímã ao supercondutor.
Quando esses dois efeitos são combinados, as coisas ficam realmente
esquisitas. Você tem um ímã e um supercondutor. Você resfria o sistema. O ímã
tenta saltar para longe, mas não consegue, porque seu fluxo está preso. O
resultado é que ele... flutua ali, onde você o prendeu. Seria como se você se
amarrasse à celebridade que achasse mais sexy. Ela está constantemente tentando
se soltar, mas a corda a segura no lugar. Então ela permanece exatamente à
mesma distância.
Isso se chama levitação supercondutora.126
O ímã não simplesmente flutua sobre o supercondutor. Ele está preso no lugar.
Se você virar de lado um objeto ou outro, eles manterão a mesma separação. Você
pode até virá-los de cabeça para baixo. É como se eles estivessem se repelindo,
mas ligados por cordas invisíveis.127
Essa propriedade pode ser aplicada em muitas coisas. Em primeiro lugar, você
agora tem um conector que nunca se desgasta, porque os dois objetos conectados
na verdade nunca se tocam.
Isso também significa que você pode girar o ímã flutuante e ele nunca vai parar
de girar, porque não há fricção.128 Esse movimento pode ser usado mais adiante
como geração de energia. Portanto, a levitação se torna uma maneira
incrivelmente boa de armazenar energia.
A levitação também é uma maneira de fazer trens que andam extremamente
rápido. Esses trens de levitação magnética (dos quais você talvez se lembre do
capítulo sobre acesso fácil ao espaço) já estão sendo implementados em alguns
lugares, embora continuem sendo muito caros. O fato de o trem nunca tocar os
trilhos reduz o desgaste e significa que não se perde velocidade por fricção entre
as rodas e o trilho.
Os supercondutores a temperatura ambiente reduziriam muito o preço da
operação desses trens, considerando que não seria necessário usar fluidos
resfriadores ou refrigeração para manter os ímãs com baixa temperatura. Ou, se
utilizasse só por questão de segurança, seu uso poderia ser menor.
No momento, e até um futuro próximo, é preciso usar fluidos resfriadores para
fazer os supercondutores funcionarem. Desde os anos 1980, temos
“supercondutores a alta temperatura” funcionando (a aprazíveis -184ºC mais ou
menos), o que significa que podemos usar fluidos resfriadores relativamente
baratos. Há pouco tempo, houve uma melhora para mais ou menos -73ºC, uma
temperatura que se pode obter em uma geladeira sofisticada ou indo à Antártica
na época certa. No entanto, o supercondutor que funcionou nessa temperatura
precisou estar a uma pressão comparável à do fundo de uma fossa oceânica.
Além disso, o material usado foi ácido sulfídrico, o que é um fato curioso. O
ácido sulfídrico vem do enxofre — o elemento químico que tem cheiro de ovo
podre. Portanto, o supercondutor mais quente do mundo talvez seja também o
mais fedorento.
No fim das contas, decidimos enterrar esse capítulo por dois motivos. Primeiro,
as explicações importantes que queríamos dar exigiam mecânica quântica para
serem bem passadas. E as explicações menos rigorosas que tínhamos ainda eram
bem difíceis para o cérebro. Segundo, quando entrevistamos pessoas, a impressão
que tivemos foi de que o campo era muito pessimista em relação à adoção em
larga escala de supercondutores a temperatura ambiente, se e quando eles forem
descobertos. Entrevistamos a dra. Inna Vishik, da Universidade da Califórnia em
Davis, e ela disse que, embora com frequência seja difícil prever as aplicações para
novos materiais, avançar a temperatura de supercondutores é provavelmente mais
valioso para pesquisas científicas do que para, você sabe, coisas boas e frescas.129
É uma pena, porque tínhamos uma nota bene especialmente boa sobre um
pesquisador que ficou conhecido por ter dito que estava trabalhando com óxido
de itérbio, bário e cobre, quando na verdade estava trabalhando com óxido de
ítrio, bário e cobre. Foi uma loucura.
Túmulo 4: Computação quântica
Oh, computação quântica, levante-se por um momento de seu caixão.
Como você quase nos arrebentou.
Esse capítulo, apesar de ter sido o que mais tomou o nosso tempo de pesquisa,
acabou tendo que ser descartado. A parte realmente ruim é que quase não
podemos lhe dizer por quê. Essa é a dificuldade da computação quântica —
encontre um artigo a respeito e esse artigo provavelmente estará errado, ou pelo
menos simplificado além da possibilidade de estar certo.
Em geral, a computação quântica é tratada como uma espécie de nova fase da
computação, ou como uma maneira de dar ao seu computador um aumento
mágico de velocidade, ou como um meio de acessar universos infinitos (também
chamados de multiverso ou universos paralelos) para fazer cálculos infinitos ao
mesmo tempo. Esses conceitos têm alguma relação com a verdade, mas estão tão
longe dela que são enganosas.
Para realmente entender a computação quântica (e mal chegamos ao ponto em
que mais ou menos talvez a compreendemos vagamente), você precisa entender o
que um computador está fazendo no nível de bits e ter um conhecimento
razoável de mecânica quântica básica. E mesmo que você entenda essas coisas,
não fica imediatamente claro como elas se juntam para resolver problemas de
matemática.
Portanto, ao escrever esse capítulo nos vimos na posição de tentar explicar
como uma sequência inanimada de botões de ligar e desligar pode executar um
videogame, tocar uma música ou operar um robô conversador sinistramente
semelhante a um humano (é bem estranho, não?) e, ao mesmo tempo, explicar
todo tipo de esquisitice quântica, como regras generalizadas de probabilidade
envolvendo números negativos e até complexos. Tivemos uma explicação
torturante sobre a construção de uma estrutura de gato de Schrödinger, fazendo
depois um encadeamento em série para mais gatos de Schrödinger, em que se o
gato A estava vivo, o gato B estava morto, a não ser que o gato C... você sabe...
etc. Depois de escrever dois terços do capítulo, ele já estava muito maior do que
os outros, e isso antes de acrescentarmos o que chamamos, com todo o otimismo,
de “humor”.
Assim, diferentemente do gato de Schrödinger, esse capítulo morreu, sem
dúvida alguma.
O triste é que nos apaixonamos completamente por esse campo de estudo.
Quando a computação quântica é discutida em público, isso se dá principalmente
porque um computador quântico poderia quebrar o método mais comum de
criptografia digital de dados. A computação quântica tem outras aplicações, como
certas formas de busca em base de dados ou de cálculo do comportamento de
objetos em escala atômica, o que seria muito importante para pesquisas
científicas.
Mas também tem implicações para nossa compreensão do que é a existência.
Isso é possível porque, na verdade, o modo como ela funciona envolve muitos
universos (ou pelo menos parece que envolve, com certeza).
Como nos disse o dr. Scott Aaronson,130 uma grande figura do campo
atualmente, o cativante na computação quântica é que ela exige que você
realmente aceite o que a mecânica quântica nos diz. Todas aquelas coisas que você
talvez tenha lido em uma abordagem mais acessível de mecânica quântica sobre
partículas em dois lugares ao mesmo tempo e uma coisa não ser determinada até
que seja medida — não são só para teorizar ou para divertimento. Em um
computador quântico, essas coisas bizarras são as verdadeiras entranhas de uma
máquina que produz resultados que você pode imprimir em uma impressora a
jato de tinta e segurar nas mãos.
De fato, o dr. David Deutsch, fundador do campo, acredita que a existência131
de algoritmos que só podem funcionar em computadores quânticos em nosso
universo prova a existência de universos infinitos. Ele faz um desafio a outros
cientistas em seu livro A essência da realidade, pedindo a eles que expliquem o
desempenho bem-sucedido de um método específico de fatoração numérica que
provavelmente é impossível computadores tradicionais fazerem com números
grandes: “Então, se o universo visível fosse a extensão da realidade física, esta
nem de longe conteria os recursos necessários para fatorar um número tão
grande. Quem o fatorou, então? Como e onde a computação foi realizada?”
Um dispositivo para resolver problemas de matemática e física que poderia,
simplesmente por existir, ter implicações para nossa compreensão do cosmos
inteiro? Mais bonito que isso impossível.

Saindo do cemitério
Se você é jovem e está lendo este livro, muitas dessas revoluções propostas
poderão acontecer durante sua vida. Ou seja, você pode ser uma parte delas se
estiver disposto a trabalhar para isso. A maioria das pessoas com as quais
conversamos para este livro não é famosa — são acadêmicos que trabalham,
como Kelly, ou pensadores que se aprofundam e sondam, também como Kelly.
Entre em contato com eles! Em qualquer dia, o acadêmico típico é uma pessoa
levemente solitária que trabalha em um escritório cinza. O amor deles pode ser
comprado com cookies. Baratos. Aquele segundo pacotinho de biscoito de
chocolate na sua dispensa pode ser o que levará você a Marte em 2050.
Esperamos que, diferentemente de tantos livros, não tenhamos tentado lhe
vender uma filosofia da futurologia ou uma visão do futuro. Em nosso modo de
pensar, isso provavelmente é impossível e com certeza desnecessário. Já é
animador saber que, neste exato momento, pessoas muito mais inteligentes do
que nós estão trabalhando em como sondar seus pensamentos um neurônio de
cada vez ou como extrair minerais alienígenas distantes.
Em O mensageiro: The Go-Between, L. P. Hartley escreve que “o passado é um
país estrangeiro”. Se isso é verdade, o futuro também é um país estrangeiro.
Estamos em uma pequena e isolada nação chamada Presente, e até onde talvez
pensemos que podemos ver, no fim das contas a curva do futuro dobra e desce,
deixando-nos apenas a faixa estreita do horizonte.
Mas que horizonte!

Nota bene sobre humanos-espelhos


Está bem, o livro acabou. Ninguém está olhando. Vamos falar sobre os
humanos-espelhos.
Ah, você nunca ouviu falar em humanos-espelhos? Vamos voltar um
momento.
A vida é feita de muitas moléculas pequenas, que formam moléculas maiores
importantes, como DNA, RNA e proteínas. Algumas moléculas exibem a
chamada quiralidade, da palavra grega que significa “mão”. Se uma molécula tem
quiralidade, isso quer dizer basicamente que existe uma versão espelhada dela.
Para conseguir entender as “versões-espelhos” das coisas, pense em suas mãos.
Elas parecem exatamente iguais, mas não importa como você vire sua mão
esquerda, ela não será igual à direita. Se você puser as palmas das mãos para cima,
seu polegar esquerdo apontará para a esquerda e o polegar direito para a direita.
As duas mãos têm as mesmas partes, mas são opostas, como em um espelho.
Quando há duas moléculas que são imagens espelhadas uma da outra, uma
dessas moléculas é designada como a versão canhota e a outra como a versão
destra.132 Curiosamente, a vida parece favorecer uma tendência a usar uma das
mãos para tarefas específicas. Por exemplo, quase todos os aminoácidos (que,
como talvez você se lembre de capítulos anteriores, são os blocos de construção
das proteínas) estão na forma canhota. É uma questão a ser debatida por que a
natureza abomina aminoácidos destros, mas até os aminoácidos que encontramos
no espaço tendem a ser canhotos.
Mas dane-se a natureza. Qualquer que seja o raciocínio dela, não há qualquer
razão física conhecida para não podermos criar um organismo a partir de
moléculas de mão completamente oposta em laboratório — um “organismo-
espelho”, se você preferir. Alguns cientistas, incluindo o dr. Church, estão
trabalhando para criar organismos-espelhos (simples), na esperança de um dia
criar criaturas assim cada vez maiores. Por que exatamente iríamos querer isso?
Bem, em primeiro lugar, isso é formidável. Você cria algo que parece um gatinho
fofo, mas que é totalmente incompatível com todas as outras vidas do planeta,
talvez até do universo. Por exemplo, os organismos do lado oposto do espelho
precisariam comer alimentos-espelhos para conseguir digeri-los. Eles também
seriam indigestos para todos os predadores. O melhor de tudo:133 um organismo
do lado oposto do espelho seria completamente imune a todas as doenças, porque
todos os parasitas e patógenos existentes evoluíram para infectar organismos com
quiralidade normal.
E se isso funcionasse, ei, poderíamos aumentar a escala para fazer humanos do
lado oposto do espelho. Os humanos-espelhos seriam imunes a todas as doenças
que atacam a humanidade há séculos. Malária? Sem problema. Tuberculose? Pfff.
Está bem, haveria desvantagens também. Eles precisariam de comida-espelho,
talvez de micróbios-espelhos. E se uma doença-espelho se desenvolvesse,
precisariam de um remédio-espelho. Também precisariam de parceiros-espelhos
se quisessem ter filhos.
Ah, sim, e o amor entre humanos originais e humanos-espelho? Casais
formados por pessoas dos dois tipos poderiam, você sabe, se encaixar. Mas não
gerariam prole, porque não é possível misturar canhotos e destros quando se trata
de material genético. Veja bem, não somos intolerantes com quiralidade.
Achamos que casais heteroquirais podem se dar bem, mas nos preocupamos com
os filhos. Principalmente porque eles nem chegariam a existir.
As pessoas do lado oposto do espelho seriam praticamente iguais aos seus
olhos, mas fariam parte de uma outra espécie. Como seriam populações
geneticamente isoladas, com o decorrer do tempo deixaríamos de ser semelhantes
mas incompatíveis e passaríamos a ter características físicas e psicológicas
diferentes. Considerando que os originais seriam, comparativamente, cheios de
doenças, é provável que, em pouco tempo, os do lado oposto do espelho olhassem
para nós como se fôssemos uma horda de zumbis arrastando os pés.
Por falar nisso, o que esse capítulo está fazendo aqui no cemitério? Em uma
versão anterior deste livro, os organismos-espelhos seriam uma seção do nosso
capítulo sobre biologia sintética. Depois de algumas leituras, ficamos um pouco
confusos e tivemos algumas dúvidas sobre a utilidade dos organismos-espelhos.
Fazer tipos totalmente novos de seres só para eles não adoecerem parece um
caminho um tanto tortuoso para o bem-estar. E tivemos a impressão de que esse
tópico não é bem um campo científico, mas uma ótima ideia discutida por um
pequeno número de bionerds sintéticos. Micróbios-espelhos poderiam algum dia
ter utilidade para pesquisas — por exemplo, a varíola-espelho seria estudada sem
o risco de esta se soltar e infectar pessoas —, mas até essa possibilidade está
provavelmente muito distante.
No entanto, se os organismos-espelhos não têm jeito, as moléculas-espelhos
ainda podem ser incríveis. Tipo, e se você pudesse fazer um açúcar saboroso que
não conseguisse metabolizar? Um cientista chamado Gilbert Levin teve essa
ideia nos anos 1980 e, de fato, descobriu um “açúcar-espelho” gostoso que podia
ser usado como adoçante sem calorias. Infelizmente, esse açúcar se revelou tão
caro que o processo nunca se popularizou. Em uma história gustativa que
ligeiramente tem a ver com o assunto, um produto que imitava óleo, chamado
Olestra, foi posto à venda nos anos 1990. O Olestra fazia boas batatas fritas
crocantes sem todas aquelas calorias de gordura. Porém, um aspecto negativo foi
que alguns consumidores de produtos com Olestra tiveram um aumento do
índice de (cuidado, leitores suscetíveis) “vazamento de óleo anal”. Sendo esse um
dos piores vazamentos, o Olestra foi amplamente engavetado. Não sabemos quais
seriam os efeitos colaterais de comer açúcar-espelho, e talvez seja melhor não
saber.
Um fato menos desagradável no qual pensamos foi se você poderia detectar
humanos-espelhos baseado no modo como eles responderiam a versões-espelhos
de moléculas do sabor. Acontece que a molécula que dá às sementes de alcaravia
seu gosto — o sabor distinto do pão de centeio judeu — é um espelho perfeito da
molécula que dá à hortelã seu gosto característico. Queríamos saber se um
humano-espelho acharia o gosto do pão de centeio judeu semelhante ao de uma
espécie de pão de hortelã horroroso.
Para descobrir, conversamos com o dr. Steven Munger, diretor do Center for
Smell and Taste da Universidade da Flórida. Primeiro, ele educadamente
observou que estávamos fazendo a pergunta errada. A pergunta não é se a
alcaravia ou a hortelã teriam um gosto diferente, mas sim se teriam cheiros
diferentes. “O gosto acontece na boca e está limitado a coisas que produzem as
sensações de doce, azedo, amargo, salgado, umami (apetitoso)... e talvez gordura.
O sabor combina gosto e cheiro. Em muitos condimentos (...) a maior
contribuição para o sabor é o cheiro.” Portanto, aprendemos algo que, em
retrospecto, ficamos surpresos por não termos percebido antes.
Mas ainda precisávamos saber: podemos usar um pão de centeio gostoso para
verificar se há pessoas-espelhos caminhando entre nós? Acontece que é difícil
dizer isso. Na verdade, é difícil até pensar isso. Para humanos-espelhos sentirem o
cheiro de uma molécula-espelho, seus receptores de cheiro teriam que ser
espelhados de modo a se prenderem a moléculas de hortelã e enviarem ao cérebro
uma mensagem de “sinto cheiro de alcaravia!”. Isso é possível, mas não é óbvio se
funcionaria assim na prática. Como nos disse o dr. Munger (talvez enquanto se
perguntava como diabos ele havia entrado nessa conversa), “no fim das contas,
isso está mesmo no plano das suposições”.
Portanto, basicamente o que estamos dizendo é: se você tem um amigo que
acha pão de centeio horrível, não podemos estar 100% certos de que o dr. Church
não o construiu em um laboratório secreto.

118. Se não está claro por quê, pergunte a si mesmo: você recebe mais luz na cara de uma lâmpada que está a
três metros de distância ou de uma que está a trinta centímetros?
119. É claro que algumas tecnologias do nosso capítulo sobre acesso barato ao espaço dimininuiriam esse
problema.
120. Uma solução poderia ser construir os painéis no espaço. O dr. Elvis (de quem você se recorda do
capítulo de mineração em asteroides) salientou que muitas coisas necessárias para se fazer painéis solares
podem ser encontradas em asteroides, portanto você poderia juntar materiais deles, fazer os painéis no
espaço e depois transportá-los para a órbita da Terra. Isso parece um caminho um tanto tortuoso de fazer o
seu negócio, mas pode ser que um dia seja possível.
121. Na cidade de Amado, Arizona. População: 295.
122. Na cidade de Holbrook, Arizona. População 5.053.
123. Para os detalhistas: estamos ignorando as perdas decorrentes da transmissão de energia do Saara para,
digamos, o Canadá. Dito isso, na realidade os painéis solares estão espalhados por todos os lugares. Só
estamos sendo um pouco dramáticos para reforçar nosso argumento.
124. Um forte argumento contra o nosso aqui é que essa transmissão sem perda significaria que qualquer
usina de energia poderia transmitir para qualquer receptor, já que o comprimento da linha não é um
problema. Isso seria especialmente bom para as energias renováveis, que com frequência estão em áreas
isoladas, como desertos.
125. Essa palavra não existe.
126. Termo para o ímã flutuando, e não para a coisa de tentarmos convencer John Oliver de que ele nos ama.
127. Por favor, John, nos dê uma chance.
128. Na verdade, haverá muito pouca fricção, a não ser que a área em torno seja um vácuo perfeito.
129. A propósito, contribuindo para nossa florescente compreensão de que todos os cientistas, inclusive
aqueles que trabalham com efeitos quânticos macroscópicos, são totalmente humanos, ela mencionou que na
esquecível comédia de 1989 Cegos, Surdos e Loucos, de Richard Pryor/Gene Wilder, há uma reviravolta no
fim envolvendo uma moeda que é, na verdade, um supercondutor a temperatura ambiente. Ela pediu
desculpas pelo spoiler. Tarde demais, dra. Vishik.
130. O dr. Aaronson teve a gentileza de conversar longamente conosco diversas vezes. Seu blog, Shtetl-
Optimized, é um encanto. Outro homem que nos forneceu seu tempo foi o dr. Jonathan Dowling, que
escreveu um livro incrível e de certa forma subestimado chamado Schrödinger’s Killer App. Esses dois
pesquisadores são (contra toda a justiça do multiverso) pessoas agradáveis, cientistas brilhantes e escritores
maravilhosos.
131. Ainda não existem computadores quânticos práticos, mas há algumas estruturas muito pequenas que
funcionam! Dito isso, os resultados em si são significativamente menos interessantes do que o fato de eles
terem sido alcançados a partir de bits quânticos. Por enquanto podemos usar a computação quântica para
provar que os fatores primos de 21 são 3 e 7.
132. A designação como versão canhota ou destra de uma molécula depende de como a luz polarizada faz
uma rotação ao passar através dela.
133. Porque um de nós é parasitologista.
Agradecimentos

Uma surpreendente diversidade de cientistas, médicos e engenheiros deixou de


dedicar seu tempo a tornar o mundo um lugar melhor para conversar conosco.
Talvez não tenha sido uma boa ideia para eles ou para, você sabe, a sociedade,
mas nós realmente agradecemos. Muitos desses especialistas tiveram a gentileza
de ler as seções pertinentes a eles ou (em alguns casos) o livro todo. Agradecemos
a Aysegul Gunduz, Gerwin Schalk, Eric Leuthardt, Beth Shapiro, George
Church, Joff Silberg, Pamela Silver, Ramon Gonzalez, Marcela Maus, Steven
Keating, Kirstin Matthews, Daniel Wagner, John Mendelsohn, Sandeep Menon,
Jordan Miller, Gabor Forgacs, Alvin Roth, Erik Demaine, Cynthia Sung, Skylar
Tibbits, Serena Booth, Alan Craig, Caitlin Fisher, Gaia Dempsey, Jonathan
Ventura, Justin Werfel, Kirstin Petersen, Christopher Willis, Behrokh
Khoshnevis, Richard Hull, Daniel Brunner, Bruce Lipschultz, Alex Wellerstein,
Robert Kolasinski, Margaret Harding, Per Peterson, Jessica Lovering, Jason
Derleth, Ron Turner, Michel van Pelt, Phil Plait, Daniel Faber, James Hansen,
Martin Elvis, Karen Daniels, Steven Munger, Bryan Caplan, Noah Smith, Inna
Vishik, Kevin Ringelman, John Timmer, Jonathan Dowling, Alan Winfield,
Andrew Reece, Jeffrey Lipton, David White, Aindrila Mukhopadhyay, Sridhar
Ramesh, Gerhard Schall, Nick Matteo, Cin-Ty Lee, Dana Glass, Omar Renteria,
Javier Omar Garcia, Greg Lieberman, Brian Pickard, Michael Johnson, Scott
Egan, Scott Solomon, Paul Robinette, Patricia Smith, Martin Weiner, Alexander
Roederer, Rick Karnesky, Rhett Allain, Alexander Bolonkin, Lloyd James, James
Lloyd, Ann Chang, Sean Leonard, Scott Aaronson, Rosemary Mosco, Aaron
Sabolch, Joe Batwinis, Emily Lakdawalla, Steven Cavins, Jacob Stump, Linda
Novitski, James Ashby, Ian McNab, Jennifer Drummond, James Cropcho,
Daniela Rus, Kurt Schwenk, Chad Jones, James Redfearn, Kevin Berry e Richard
Prenzlow. Quaisquer erros neste livro são totalmente culpa nossa. Ou, espere,
não. São culpa de Phil Plait. Sim.
Também queremos agradecer a todos os nossos seguidores no Twitter e no
Facebook que nos ajudaram a encontrar a direção quando estávamos empacados
e a entender conceitos básicos em campos não familiares. Vocês são muitos para
agradecermos a cada um individualmente, mas obrigado. Se vocês se perguntaram
por que estávamos fazendo tantas perguntas estranhamente específicas, bem, aqui
está a resposta.
Somos particularmente gratos a nossa editora, Virginia Smith Younce, por nos
ajudar a desenvolver este livro e lhe dar uma forma da qual nos orgulhamos
muito. Agradecemos a nossa copidesque, Jane Carolina, por nos fazer parecer
muito mais inteligentes do que realmente somos. Agradecemos a nossa editora de
produção, Megan Gerrity, por lidar com nossas dificuldades técnicas patéticas. E
agradecemos à advogada Karen Mayer, da Penguin, e lhe desejamos todo o
sucesso na busca de se vingar de sua família.
Queremos agradecer a nossos agentes, Mark Saffian, da Content House, e
Seth Fishman, da Gernert Company. A vida é muito mais fácil quando as
pessoas que o representam são seus amigos.
Kelly gostaria de agradecer também à Grounds for Thought Coffee Shop, em
Bowling Green, Ohio, por ser um excelente lugar para tomar café e escrever um
livro.
Por fim, somos gratos a nossa filha, Ada, que foi extraordinariamente feliz e
alegre mesmo quando este livro nos tornou menos atenciosos do que
gostaríamos. Nós a teríamos amado do mesmo jeito se ela ficasse gritando o
tempo todo, mas sua presença suave e seu grande sorriso nos ajudaram a lembrar
por que estávamos fazendo tudo isso. E se algum dia ela se lembrar de 2016,
serão “os tempos dos cartuns e da comida para viagem”. Amamos você, baixinha.
Se alguém que nos ajudou não foi incluído, pedimos desculpas.
Referências bibliográficas

Aaronson, Scott. Quantum Computing Since Democritus. Cambridge: Cambridge


University Press, 2013.
———. The Scott Aaronson Blog. “Shtetl-Optimized.” 2016. Disponível em:
<scottaaronson.com/blog>. Acesso em: 13 fev. 2018.
Adams, James. Bull’s Eye: The Assassination and Life of Supergun Inventor Gerald
Bull. Nova York: Crown, 1992.
Akhtar, Allana. “Holocaust Museum, Auschwitz Want Pokémon Go Hunts
Out.” USA Today, 12 de jul. 2016. Disponível em:
<usatoday.com/story/tech/news/2016/07/12/holocaust-museum-auschwitz-
want-pokmon-go-hunts-stop-pokmon/86991810>. Acesso em: 13 fev. 2018.
Alloul, H. et al. “La Supraconductivité dans Tous Ses États.” Disponível em:
<supraconductivite.fr/fr/index.php>. Acesso em: 13 fev. 2018.
American Society of Plastic Surgeons. “History of Plastic Surgery.” 2016.
Disponível em: <plasticsurgery.org/news/history-of-plasticsurgery.html>.
Acesso em: 13 fev. 2018.
APMEX. “Platinum Prices.” Apmex.com, 2016. Disponível em:
<apmex.com/spotprices/platinum-price>. Acesso em: 13 fev. 2018.
Artemiades, P. (org.). Neuro-Robotics: From Brain Machine Interfaces to
Rehabilitation Robotics. Nova York: Springer, 2014.
Autor, David H. “Why Are There Still So Many Jobs? The History and Future
of Workplace Automation.” Journal of Economic Perspectives 29, pp. 3–30, 2015.
Babb, Greg. “Augmented Reality Can Increase Productivity.” Area Blog, 2015.
Disponível em: <thearea.org/augmented-reality-can-increase-productivity>.
Acesso em: 13 fev. 2018.
Badescu, Viorel. Asteroids: Prospective Energy and Material Resources. Heidelberg e
Nova York: Springer, 2013.
Ball, Philip. “Make Your Own World With Programmable Matter.” IEEE
Spectrum, 27 mai. 2014. Disponível em: <spectrum.ieee.org/robotics/robotics-
hardware/make-your-own-world-with-programmable-matter>. Acesso em: 13
fev. 2018.
Baran, G. R., Kiani, M. F. e Samuel, S. P. Healthcare and Biomedical Technology in
the 21st Century: An Introduction for Non-Science Majors. Nova York: Springer,
2013.
Barfield, Woodrow. Fundamentals of Wearable Computers and Augmented Reality,
Second Edition. Boca Raton, Flórida: CRC Press, 2015.
Barr, Alistair. “Google’s New Moonshot Project: The Human Body.” Wall Street
Journal, 27 jul. de 2014. Disponível em: <wsj.com/articles/google-to-collect-
data-to-define-healthy-human-1406246214>. Acesso em: 13 fev. 2018.
Bedau, Mark A. e Parke, Emily C. The Ethics of Protocells: Moral and Social
Implications of Creating Life in the Laboratory. Cambridge, Massachusetts: MIT
Press, 2009.
Bentley, Matthew A. Spaceplanes: From Airport to Spaceport. Nova York: Springer,
2009.
Berger, T. W., Song, D., Chan, R. H. M., Marmarelis, V. Z., LaCoss, J., Wills, J.,
Hampson, R. E., Deadwyler, S. A. e Granacki, J. J. “A Hippocampal Cognitive
Prosthesis: Multi-Input, Multi-Output Nonlinear Modeling and VLSI
Implementation.” IEEE Transactions on Neural Systems and Rehabilitation
Engineering 20, pp. 198-211, 2012.
Bernholz, Peter e Kugler, Peter. “The Price Revolution in the 16th Century:
Empirical Results from a Structural Vectorautoregression Model.” Faculty of
Business and Economics, University of Basel. Documento de trabalho. 2007.
Disponível em: <https://ideas.repec.org/p/bsl/wpaper/2007-12.html>. Acesso
em: 13 fev. 2018.
Bettegowda, C., Sausen, M., Leary, R. J., Kinde, I., Wang, Y., Agrawal, N.,
Bartlett, B. R., Wang, H., Luber, B., Alani, R.M. et al. “Detection of
Circulating Tumor DNA in Early-and Late-Stage Human Malignancies.”
Science Translational Medicine 6, no 224, pp. 224ra24, 2014.
Blundell, Stephen J. Superconductivity: A Very Short Introduction. Oxford e Nova
York: Oxford University Press, 2009.
Boeke, J. D., Church, G., Hessel, A., Kelley, N. J., Arkin, A., Cai, Y., Carlson, R.,
Chakravarti, A., Cornish, V. W., Holt, L. et al. The Genome Project-Write.
Science 353, no 6.295, pp. 126-127, 2016.
Bolonkin, Alexander. Non-Rocket Space Launch and Flight. Amsterdã e Oxford:
Elsevier Science, 2006.
Bonnefon, J.-F., Shariff, A. e Rahwan, I. “The Social Dilemma of Autonomous
Vehicles.” Science 352, no 6.293, pp. 1.573-1.576, 2016.
Bornholt, J., Lopez, R., Carmean, D. M., Ceze, L., Seelig, G. e Strauss, K. “A
DNA-Based Archival Storage System.” Proceedings of the Twenty-First
International Conference on Architectural Support, pp. 637-649, 2016.
Bostrom, Nick e Cirkovic, Milan M. Global Catastrophic Risks. Oxford e Nova
York: Oxford University Press, 2011.
Botella, C., Bretón-López, J., Quero, S., Baños, R. e García-Palacios, A.
“Treating Cockroach Phobia with Augmented Reality.” Behavior Therapy 41,
no 3, pp. 401-413, 2010.
Boyle, Rebecca. “Atomic Gardens, the Biotechnology of the Past, Can Teach
Lessons About the Future of Farming.” Popular Science, 22 de abril de 2011.
Disponível em: <popsci.com/technology/article/2011-04/atomic-gardens-
biotechnology-past-can-teach-lessons-about-future-farming>. Acesso em: 13
fev. 2018.
Brell-Cokcan, S., Braumann, J. e Willette, A. Robotic Fabrication in Architecture,
Art and Design 2014. Nova York: Springer, 2016.
Brentjens, R. J., Davila, M. L., Riviere, I., Park, J., Wang, X., Cowell, L. G.,
Bartido, S., Stefanski, J., Taylor, C., Olszewska, M. et al. “CD19-Targeted T
Cells Rapidly Induce Molecular Remissions in Adults with Chemotherapy-
Refractory Acute Lymphoblastic Leukemia.” Science Translational Medicine 5,
no 177, p. 177ra38, 2013.
British Medical Association. “Boosting Your Brainpower: Ethical Aspects of
Cognitive Enhancements. A Discussion Paper from the British Medical
Association.” Documento para discussão. Londres: British Medical
Association, 2007. Disponível em:
<http://webcache.googleusercontent.com/search?
q=cache:https://repository.library.georgetown.edu/handle/10822/511709&gws_rd=cr&dcr=
Acesso em: 13 fev. 2018.
Broad, William J. “Useful Mutants, Bred with Radiation.” The New York Times,
28 ago. 2007. Disponível em:
<nytimes.com/2007/08/28/science/28crop.html>. Acesso em: 13 fev. 2018.
Brown, Julian. Minds, Machines, and the Multiverse: The Quest for the Quantum
Computer. Nova York: Simon and Schuster, 2000.
Buck, Joshua. “Grants Awarded for Technologies That Could Transform Space
Exploration.” Comunicado à imprensa da Nasa. 14 ago. 2015. Disponível em:
<nasa.gov/press-release/nasa-awards-grants-for-technologies-that-could-
transform-space-exploration>. Acesso em: 13 fev. 2018.
Callaway, Ewen. “UK Scientists Gain Licence to Edit Genes in Human
Embryos.” Nature 530, no 7.588, p. 18, 2016.
Campbell, T. A., Tibbits, S. e Garrett, B. “The Next Wave: 4D Printing —
Programming the Material World.” Atlantic Council. Mai. de 2014.
Disponível em:
<atlanticcouncil.org/images/publications/The_Next_Wave_4D_Printing_Programming_th
Acesso em: 13 fev. 2018.
Carini, C., Menon S. M. e Chang, M. Clinical and Statistical Considerations in
Personalized Medicine. Londres: Chapman and Hall/CRC, 2014.
Carney, Scott. The Red Market: On the Trail of the World’s Organ Brokers, Bone
Thieves, Blood Farmers, and Child Traffickers. Nova York: William Morrow,
2011.
Centers for Disease Control and Prevention. “CDC Media Statement on Newly
Discovered Smallpox Specimens.” CDC News Releases. 8 jul. 2014.
Disponível em: <cdc.gov/media/releases/2014/s0708-nih.html>. Acesso em:
13 fev. 2018.
Chandler, Michele. “Alphabet, Apple in Tech Health Care ‘Convergence’.”
Investor’s Business Daily, 21 jan. 2016. Disponível em:
<investors.com/news/technology/alphabet-google-looking-to-health-care-for-
new-medical-products>. Acesso em: 13 fev. 2018.
Cheng, H.-Y., Masiello, C. A., Bennett, G. N. e Silberg, J. J. “Volatile Gas
Production by Methyl Halide Transferase: An In Situ Reporter of Microbial
Gene Expression in Soil.” Environmental Science & Technology 50, no 16, pp.
8.750–8.759, 2016.
Cho, Adrian. “Cost Skyrockets for United States’ Share of ITER Fusion Project.”
American Association for the Advancement of Science. Science, 10 abr. 2014.
Disponível em: <sciencemag.org/news/2014/04/cost-skyrockets-united-states-
share-iter-fusion-project>. Acesso em: 13 fev. 2018.
Church, George M. e Regis, Ed. Regenesis: How Synthetic Biology Will Reinvent
Nature and Ourselves. Nova York: Basic Books, 2014.
Clayton, T. A., Baker, D., Lindon, J. C., Everett, J. R. e Nicholson, J. K.
“Pharmacometabonomic Identification of a Significant Host-Microbiome
Metabolic Interaction Affecting Human Drug Metabolism.” Proceedings of the
National Academy of Sciences 106, no 34, pp. 14.728-14.733, 2009.
Clery, Daniel. A Piece of the Sun: The Quest for Fusion Energy. Nova York:
Overlook Press, 2013.
Clish, Clary B. “Metabolomics: An Emerging but Powerful Tool for Precision
Medicine.” Cold Spring Harbor Molecular Case Studies 1, no 1, 2015.
Cohen, D. L., Lipton, J. L., Cutler, M., Coulter, D., Vesco, A. e Lipson, H.
“Hydrocolloid Printing: A Novel Platform for Customized Food Production.”
Trabalho apresentado no Simpósio de Fabricação de Formas Livres de Sólidos,
Austin, Texas, pp. 3-5, ago. 2009.
Cohen, Jean-Louis e Moeller, G. Martin. Liquid Stone: New Architecture in
Concrete. Nova York: Princeton Architectural Press, 2006.
Cohen, Jon. “Brain Implants Could Restore the Ability to Form Memories.”
MIT Technology Review (2013). Disponível em:
<technologyreview.com/s/513681/memory-implants>. Acesso em: 13 fev.
2018.
Colemeadow, J., Joyce, H. e Turcanu, V. “Precise Treatment of Cystic Fibrosis—
Current Treatments and Perspectives for Using CRISPR.” Expert Review of
Precision Medicine and Drug Development 1, no 2, pp. 169-180, 2016.
Complete Anatomy Lab. “The Future of Medical Learning.” Project Esper.
2016. Disponível em: <completeanatomy.3d4medical.com/esper.php>. Acesso
em: 14 fev. 2018.
Computer History Museum. “Timeline of Computer History: Memory &
Storage.” 2016. Disponível em: <computerhistory.org/timeline/memory-
storage>. Acesso em: 14 fev. 2018.
Conant, M. A. e Lane, B. “Secondary Syphilis Misdiagnosed As Infectious
Mononucleosis.” California Medicine 109, no 6, pp. 462-464, 1968.
Cong, L., Ran, F.A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P.D., Wu, X.,
Jiang, W., Marraffini, L.A. et al. “Multiplex Genome Engineering Using
CRISPR/Cas Systems.” Science 339, no 6.161, pp. 819-823, 2013.
Construction Robotics. Home of the Semi-Automated Mason. 2016. Disponível
em: <construction-robotics.com>. Acesso em: 14 fev. 2018.
Contour Crafting. “Space Colonies.” Contour Crafting Robotic Construction
System. 2014. Disponível em: <contourcrafting.com/space-applications/>.
Acesso em: 14 fev. 2018.
Cooper, D. K. C. “A Brief History of Cross-Species Organ Transplantation.”
Proceedings of Baylor University Medical Center 25, no 1, pp. 49-57, 2012.
Craig, Alan B. Understanding Augmented Reality: Concepts and Applications.
Amsterdã: Morgan Kaufmann, 2013.
Craven, B. A., Paterson, E. G. e Settles, G. S. “The Fluid Dynamics of Canine
Olfaction: Unique Nasal Airflow Patterns As an Explanation of Macrosmia.”
Journal of the Royal Society Interface 7, no 47, pp. 933-943, 2010.
Cullis, Pieter. The Personalized Medicine Revolution: How Diagnosing and Treating
Disease Are About to Change Forever. Vancouver, Canadá: Greystone Books,
2015.
Daniels, K.E. “Rubble-Pile Near Earth Objects: Insights from Granular
Physics.” Em Asteroids, organizado por V. Badescu, pp. 271-286. Berlim e
Heidelberg: Springer, 2013.
DAQRI. “Smart Helmet.” 2016. Disponível em: <https://daqri.com/blog/daqri-
smart-helmet-a-deep-dive/>. Acesso em: 14 fev. 2018.
Delaney, K. e Massey, T. R. “New Device Allows Brain to Bypass Spinal Cord,
Move Paralyzed Limbs.” Comunicados à imprensa do Battelle Memorial
Institute. 2014. Disponível em: <www.battelle.org/newsroom/press-
releases/press-releases-detail/new-device-allows-brain-to-bypass-spinal-cord-
move-paralyzed-limbs>. Acesso em: 14 fev. 2018.
Delp, M. D., Charvat, J. M., Limoli, C. L., Globus, R. K. e Ghosh, P. “Apollo
Lunar Astronauts Show Higher Cardiovascular Disease Mortality: Possible
Deep Space Radiation Effects on the Vascular Endothelium.” Scientific Reports
6, p. 29.901, 2016
Department of Health and Human Services. “Becoming a Donor.” 2011.
Disponível em: <www.organdonor.gov/becomingdonor/index.html>. Acesso
em: 14 fev. 2018.
———. “The Drug Development Process — Step 3: Clinical Research.” Food
and Drug Administration. 2016. Disponível em:
<www.fda.gov/ForPatients/Approvals/Drugs/ucm405622.htm>. Acesso em:
14 fev. 2018.
——— (2011). “Fiscal Year 2015: Food and Drug Administration, Justification
of Estimates for Appropriations Committees.” Silver Spring, Maryland: Food
and Drug Administration, 2015. Disponível em:
<www.fda.gov/downloads/AboutFDA/ReportsManualsForms/Reports/BudgetReports/UC
Acesso em: 14 fev. 2018.
Department of Labor, Bureau of Labor Statistics. “Industry Employment and
Output Projections to 2024.” Monthly Labor Review. Dezembro de 2015.
Disponível em: <www.bls.gov/opub/mlr/2015/article/industry-employment-
and-output-projections-to-2024.htm>. Acesso em: 14 fev. 2018.
——— “Industries at a Glance: Construction: NAICS 23.” 2016. Disponível em:
<www.bls.gov/iag/tgs/iag23.htm#fatalities_injuries_and_illnesses>. Acesso em:
14 fev. 2018.
Department of State. “Treaty on Principles Governing the Activities of States in
the Exploration and Use of Outer Space, Including the Moon and Other
Celestial Bodies.” Bureau of Arms Control, Verification, and Compliance.
2004. Disponível em: <https://www.state.gov/t/isn/5181.htm>. Acesso em: 14
fev. 2018.
De Selding, Peter B. “SpaceX Says Reusable Stage Could Cut Prices 30 Percent,
Plans November Falcon Heavy Debut.” Space News, 10 mar. de 2016.
Disponível em: <spacenews.com/spacex-says-reusable-stage-could-cut-prices-
by-30-plans-first-falcon-heavy-in-november>. Acesso em: 14 fev. 2018.
Deutsch, David. The Fabric of Reality: The Science of Parallel Universes — and Its
Implications. Nova York: Penguin Books, 1998.
Donaldson, H., Doubleday, R., Hefferman, S., Klondar, E. e Tummarello, K. “Are
Talking Heads Blowing Hot Air? An Analysis of the Accuracy of Forecasts in
the Political Media.” Documento do Hamilton College, Public Policy 501,
2011. Disponível em: <hamilton.edu/documents/An-Analysis-of-the-
Accuracy-of-Forecasts-in-the-Political-Media.pdf>. Acesso em: 14 fev. 2018.
Dondorp, A. M., Nosten, F., Yi, P., Das, D., Phyo, A. P., Tarning, J., Lwin, K. M.,
Ariey, F., Hanpithakpong, W., Lee, S. J. et al. “Artemisinin Resistance in
Plasmodium falciparum Malaria.” New England Journal of Medicine 361, no 5,
pp. 455-467, 2009.
Doursat, R., Sayama, H. e Michel, O. Morphogenetic Engineering: Toward
Programmable Complex Systems. Heidelberg e Nova York: Springer, 2012.
Dowling, Jonathan P. Schrödinger’s Killer App: Race to Build the World’s First
Quantum Computer. Boca Raton, Flórida: CRC Press, 2013.
Driscoll, C.A., Macdonald, D.W. e O’Brien, S.J. “From Wild Animals to
Domestic Pets, an Evolutionary View of Domestication.” Proceedings of the
National Academy of Sciences 106, suplemento 1, pp. 9.971-9.978, 2009.
Drummond, Katie. “Darpa’s Creepy Robo-Blob Learns to Crawl.” Wired, 2 dez.
2011. Disponível em: <wired.com/2011/12/darpa-chembot>. Acesso em: 14
fev. 2018.
Duan, B., Hockaday, L. A., Kang, K. H. e Butcher, J.T. “3D Bioprinting of
Heterogeneous Aortic Valve Conduits with Alginate/Gelatin Hydrogels.”
Journal of Biomedical Materials Research 101A, no 5, pp. 1.255-1.264, 2013.
Dunn, Nick. Digital Fabrication in Architecture. Londres: Laurence King
Publishing, 2012.
Eccles, R. “A Role for the Nasal Cycle in Respiratory Defence.” European
Respiratory Journal 9, pp. 371-376, 1996.
Eisen, J. A. The Tree of Life Blog. “#badomics words.”, 2016. Disponível em:
<phylogenomics.blogspot.com/p/my-writings-on-badomics-words.html>.
Acesso em: 14 fev. 2018.
El-Sayed, Ahmed F. Fundamentals of Aircraft and Rocket Propulsion. Nova York:
Springer, 2016.
Engber, Daniel. “The Neurologist Who Hacked His Brain — And Almost Lost
His Mind.” Wired, 26 jan. 2016. Disponível em: <wired.com/2016/01/phil-
kennedy-mind-control-computer>. Acesso em: 14 fev. 2018.
Environmental Protection Agency “Sources of Greenhouse Gas Emissions”,
2016. Disponível em: <epa.gov/ghgemissions/sources-greenhouse-gas-
emissions>. Acesso em: 14 fev. 2018.
EUROFusion. “JET: Europe’s Largest Fusion Device — Funded and Used in
Partnership”, 2016. Disponível em: <www.euro-fusion.org/jet>. Acesso em: 14
fev. 2018.
Everett, Daniel L. Don’t Sleep, There Are Snakes: Life and Language in the
Amazonian Jungle. Nova York: Vintage, 2009.
Fitzpatrick, Michael. “A Long Road for High-Speed Maglev Trains in the U.S.”
Fortune, 6 fev. 2014. Disponível em: <fortune.com/2014/02/06/a-long-road-
for-high-speed-maglev-trains-in-the-u-s>. Acesso em: 14 fev. 2018.
Francis, John. “Diving Impaired: Nitrogen Narcosis.” ScubaDiving.com, 14 mar.
2007. Disponível em: <scubadiving.com/training/basic-skills/diving-
impaired>. Acesso em: 14 fev. 2018.
Frederix, M., Mingardon, F., Hu, M., Sun, N., Pray, T., Singh, S., Simmons, B.
A., Keasling, J. D. e Mukhopadhyay, A. “Development of an E. coli Strain for
One-Pot Biofuel Production from Ionic Liquid Pretreated Cellulose and
Switchgrass.” Green Chemistry 18, no 15, pp. 4.189-4.197, 2016.
Freidberg, Jeffrey P. Plasma Physics and Fusion Energy. Cambridge,
Massachusetts: Cambridge University Press, 2008.
Fusor.net, <fusor.net>.
Futron Corporation. “Space Transportation Costs: Trends in Price Per Pound to
Orbit 1990-2000.” Bethesda, Maryland: Futron Corporation, 2002.
Garcia, Mark. “Facts and Figures.” Nasa, 2016. Disponível em:
<nasa.gov/feature/facts-and-figures>. Acesso em: 14 fev. 2018.
Gasson, Mark N., Kosta, E. e Bowman, Diana M. Human ICT Implants:
Technical, Legal and Ethical Considerations. Haia, Holanda: T.M.C. Asser Press,
2012.
Gay, Malcolm. The Brain Electric: The Dramatic High-Tech Race to Merge Minds
and Machines. Nova York: Farrar, Straus and Giroux, 2015.
General Fusion. Rethink Fusion Blog. Disponível em:
<generalfusion.com/category/blog>. Acesso em: 14 fev. 2018.
Gleick, James. “In the Trenches of Science.” The New York Times Magazine, 16
ago. 1987. Disponível em: <nytimes.com/1987/08/16/magazine/in-the-
trenches-of-science.html>. Acesso em: 14 fev. 2018.
Glieder, A., Kubicek, C. P., Mattanovich, D., Wilhschi, B. e Sauer, M. Synthetic
Biology. Nova York: Springer, 2015.
Glover, Asha. “NRC’s ‘All or Nothing’ Licensing Process Doesn’t Work, Former
Commissioner Says.” Morning Consult.com, 29 abr. 2016.
Goodman, Daniel e Angelova, Kamelia. “TECH STAR: I Want To Punch
Anyone Wearing Google Glass in the Face.” BusinessInsider, 10 mai. 2013.
Disponível em: <businessinsider.com/meetup-ceo-scott-heiferman-on-google-
glass-2013-5>. Acesso em: 14 fev. 2018. (Nota: o vídeo nessa página não está
funcionando mais.)
Graber, John. “SpriteMods.com’s 3D Printer Makes Food Dye Designs in
JELLO.” 3D Printer World, 4 jan. 2014. Disponível em:
<3dprinterworld.com/article/spritemodscoms-3d-printer-makes-food-dye-
designs-jello>. Acesso em: 14 fev. 2018.
Gramazio, Fabio e Kohler, Matthias (orgs.). “Special Issue: Made by Robots:
Challenging Architecture at a Larger Scale.” Architectural Design 84, no 3, p.
136, 2014.
Grant, Dale. Wilderness of Mirrors: The Life of Gerald Bull. Scarborough, Ontário,
Canadá: Prentice Hall, 1991.
Green, Keith Evan. Architectural Robotics: Ecosystems of Bits, Bytes, and Biology,
Cambridge, Massachusetts: MIT Press, 2016.
Greenpeace. “Nuclear Fusion Reactor Project in France: An Expensive and
Senseless Nuclear Stupidity.” Comunicado à imprensa do Greenpeace
International, 28 jun. 2005. Disponível em:
<www.greenpeace.org/international/en/press/releases/2005/ITERprojectFrance
Acesso em: 14 fev. 2018.
Gribbin, John. Computing with Quantum Cats: From Colossus to Qubits. Amherst,
Nova York: Prometheus Books, 2014.
Guger, C., Müller-Putz, G. e Allison, B. Brain-Computer Interface Research: A
State-of-the-Art Summary 4. Nova York: Springer, 2016.
Hall, Loura. “3D Printing: Food in Space.” Nasa, 28 jul. 2013. Disponível em:
<nasa.gov/directorates/spacetech/home/feature_3d_food.html>. Acesso em: 14
fev. 2018.
Hall, Stephen S. “Daniel Nocera: Maverick Inventor of the Artificial Leaf.”
Innovators. National Geographic, 19 mai. 2014. Disponível em:
<news.nationalgeographic.com/news/innovators/2014/05/140519-nocera-
chemistry-artificial-leaf-solar-renewable-energy>. Acesso em: 14 fev. 2018.
Hammond, A., Galizi, R., Kyrou, K., Simoni, A., Siniscalchi, C., Katsanos, D.,
Gribble, M., Baker, D., Marois, E., Russell, S. et al. “A CRISPR-Cas9 Gene
Drive System Targeting Female Reproduction in the Malaria Mosquito
Vector Anopheles gambiae.” Nature Biotechnology 34, no 1, pp. 78-83, 2016.
Hannemann, Christine. Die Platte Industrialisierter Wohnungsbau in der DDR.
Braunschweig/Wiesbaden, Alemanha: Friedr, Vieweg & Sohn
Verlagsgesellschaft mbH, 1996.
Hardesty, Larry. “Ingestible Origami Robot.” MIT News, 12 mai. 2016.
Disponível em: <news.mit.edu/2016/ingestible-origami-robot-0512>. Acesso
em: 14 fev. 2018.
Harris, A. F., McKemey, A. R., Nimmo, D., Curtis, Z., Black, I., Morgan, S. A.,
Oviedo, M. N., Lacroix, R., Naish, N., Morrison, N. I. et al. “Successful
Suppression of a Field Mosquito Population by Sustained Release of
Engineered Male Mosquitoes.” Nature Biotechnology 30, no 9, pp. 828-830,
2012.
Harris, A. F., Nimmo, D., McKemey, A. R., Kelly, N., Scaife, S., Donnelly, C. A.,
Beech, C., Petrie, W. D. e Alphey, L. “Field Performance of Engineered Male
Mosquitoes.” Nature Biotechnology 29, no 11, pp. 1.034-1.037, 2011.
Hartley, L. P. The Go-Between. Nova York: CA: NYRB Classics, 2002.
Harwood, W. “Experts Applaud SpaceX Rocket Landing, Potential Savings.”
CBS News, 22 dez. 2015. Disponível em: <cbsnews.com/news/experts-
applaud-spacex-landing-cautious-about-outlook>. Acesso em: 14 fev. 2018.
Hassanien, A. E. e Azar, A. T. Brain-Computer Interfaces: Current Trends and
Applications. Nova York: Springer, 2014.
Hawkes, E., An, B., Benbernou, N. M., Tanaka, H., Kim, S., Demaine, E. D.,
Rus, D. e Wood, R. J. “Programmable Matter by Folding.” Proceedings of the
National Academy of Sciences 107, no 28, pp. 12.441-12.445, 2010.
Heaps, Leo. Operation Morning Light: Inside Story of Cosmos 954 Soviet Spy
Satellite. S.l: Paddington, 1978.
Henderson, D. A. e Preston, Richard. Smallpox: The Death of a Disease — The
Inside Story of Eradicating a Worldwide Killer. Amherst, Nova York:
Prometheus Books, 2009.
Hill, Curtis. What If We Made Space Travel Practical — Stimulating Our Economy
with New Technology. S.l.: Modern Millennium Press, 2013.
Hoyt, Robert. “WRANGLER: Capture and De-Spin of Asteroids and Space
Debris.” Nasa, 30 mai. 2014. Disponível em: <nasa.gov/content/wrangler-
capture-and-de-spin-of-asteroids-and-space-debris>. Acesso em: 14 fev. 2018.
Hrala, Josh. “This Robot Keeps Trying to Escape a Lab in Russia.” Science Alert,
29 jun. 2016. Disponível em: <sciencealert.com/the-same-robot-keeps-trying-
to-escape-a-lab-in-russia-even-after-reprogramming>. Acesso em: 14 fev.
2018.
Hu, Z., Chen, X., Zhao, Y., Tian, T., Jin, G., Shu, Y., Chen, Y., Xu, L., Zen, K.,
Zhang, C. et al. “Serum MicroRNA Signatures Identified in a Genome-Wide
Serum Microrna Expression Profiling Predict Survival of Non-Small-Cell
Lung Cancer.” Journal of Clinical Oncology 28, no 10, pp. 1.721-1.726, 2010.
Hutchison, C. A., Chuang, R.-Y., Noskov, V. N., Assad-Garcia, N., Deerinck, T.
J., Ellisman, M. H., Gill, J., Kannan, K., Karas, B. J., Ma, L. et al. “Design and
Synthesis of a Minimal Bacterial Genome.” Science 351, no 6.253, p. aad6253,
2016.
iGEM. 2016, <igem.org/Main_Page>.
Illusio, Inc. “Augmented Reality Goes Beyond Pokemon Go into Plastic Surgery
Imaging.” Comunicado à imprensa da Illusio. Atualizado em 5 ago. 2016.
Disponível em: <www.newswire.com/news/augmented-reality-goes-beyond-
pokemon-go-into-plastic-surgery-imaging-13533198>. Acesso em: 14 fev.
2018.
Innovega Inc. 2017, <emacula.io>.
Interlandi, Jeneen. “The Paradox of Precision Medicine.” Scientific American, 1o
abr. 2016. Disponível em: <scientificamerican.com/article/the-paradox-of-
precision-medicine>. Acesso em: 14 fev. 2018.
International Space Elevator Consortium. “Space Elevator Home”, 2016,
<isec.org>.
ITER. “The Way to New Energy”, 2016, <iter.org>.
Jafarpour, F., Biancalani, T. e Goldenfeld, N. “Noise-Induced Mechanism for
Biological Homochirality of Early Life Self-Replicators.” Physical Review
Letters 115, no 15, p. :158101, 2015.
Jain, Kewal K. Textbook of Personalized Medicine. Nova York: Humana Press,
2015.
JAXA. “3-2-2-1 Settlement of Claim between Canada and the Union of Soviet
Socialist Republics for Damage Caused by Cosmos 954.” Japan Aerospace
Exploration Agency. Divulgado em 2 abr. 1981. Disponível em:
<www.jaxa.jp/library/space_law/chapter_3/3-2-2-1_e.html>. Acesso em: 14
fev. 2018.
Jella, S. A. e Shannahoff-Khalsa, D. S. “The Effects of Unilateral Forced Nostril
Breathing on Cognitive Performance.” International Journal of Neuroscience 73,
no 1-2, pp. 61-68, 1993a.
Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A. e Charpentier, E.
“A Programmable Dual-RNA–Guided DNA Endonuclease in Adaptive
Bacterial Immunity.” Science 337, no 6.096, pp. 816-821, 2012.
Johnson, Aaron. “How Many Solar Panels Do I Need on My House to Become
Energy Independent?” Ask an Engineer. MIT School of Engineering, 19 nov.
2013. Disponível em: <engineering.mit.edu/ask/how-many-solar-panels-do-i-
need-my-house-become-energy-independent>. Acesso em: 14 fev. 2018.
Johnson, L. A., Scholler, J., Ohkuri, T., Kosaka, A., Patel, P. R., McGettigan, S.
E., Nace, A. K., Dentchev, T., Thekkat, P., Loew, A. et al. “Rational
Development and Characterization of Humanized Anti-EGFR Variant III
Chimeric Antigen Receptor T Cells for Glioblastoma.” Science Translational
Medicine 7, no 275, pp. 275ra22–275ra22, 2015.
Josephson, B. “Brian Josephson’s home page.” Cavendish Laboratory, University
of Cambridge. 2016. Disponível em: <www.tcm.phy.cam.ac.uk/~bdj10>.
Acesso em: 14 fev. 2018.
——— . “Brian Josephson on the Memory of Water.” Hydrogen2Oxygen. 6 out.
2016. Disponível em: <https://hydrogen2oxygen.net/en/2016/10/06/brian-
josephson-on-the-memory-of-water/>. Acesso em: 14 fev. 2018.
Kaiser, Jocelyn e Normile, Dennis. “Chinese Paper on Embryo Engineering
Splits Scientific Community.” Science, 24 abr. 2015. Disponível em:
<sciencemag.org/news/2015/04/chinese-paper-embryo-engineering-splits-
scientific-community>. Acesso em: 14 fev. 2018.
Kareklas, K., Nettle, D. e Smulders, T. V. “Water-Induced Finger Wrinkles
Improve Handling of Wet Objects.” Biology Letters 9, no 2, p. 20.120.999,
2013.
Kaufman, Scott. Project Plowshare: The Peaceful Use of Nuclear Explosives in Cold
War America. Ithaca, Nova York: Cornell University Press, 2012.
Kharecha, P. A. e Hansen, J. E. “Prevented Mortality and Greenhouse Gas
Emissions from Historical and Projected Nuclear Power.” Environmental
Science & Technology 47, no 9, pp. 4.889-4.895, 2013.
Khoshnevis, Behrokh. “Contour Crafting Simulation Plan for Lunar Settlement
Infrastructure Build-Up.” NASA Space Technology Mission Directorate,
2013. Disponível em:
<nasa.gov/directorates/spacetech/niac/khoshnevis_contour_crafting.html>.
Acesso em: 14 fev. 2018.
Kipper, Greg e Rampolla, Joseph. Augmented Reality: An Emerging Technologies
Guide to AR. Amsterdã e Boston, Massachusetts: Syngress, 2012.
Kirsch, Scott. Proving Grounds: Project Plowshare and the Unrealized Dream of
Nuclear Earthmoving. New Brunswick, Nova Jersey: Rutgers University Press,
2005.
Kolarevic, Branko e Parlac, Vera. Building Dynamics: Exploring Architecture of
Change. Londres e Nova York: Routledge, 2015.
Kotula, J. W., Kerns, S. J., Shaket, L. A., Siraj, L., Collins, J. J., Way, J. C. e Silver,
P. A. “Programmable Bacteria Detect and Record an Environmental Signal in
the Mammalian Gut.” Proceedings of the National Academy of Sciences 111, no 13,
pp. 4.838-4.843, 2014.
Kozomara, Ana e Griffiths-Jones, Sam. “miRBase: Annotating High Confidence
MicroRNAs Using Deep Sequencing Data.” Nucleic Acids Research 42, no D1,
pp. D68-D73, 2014.
Kremeyer, K., Sebastian, K. e Shu, C. “Demonstrating Shock Mitigation and
Drag Reduction by Pulsed energy Lines with Multi-domain WENO.” Brown
University. Disponível em: <brown.edu/research/projects/scientific-
computing/sites/brown.edu.research.projects.scientific-
computing/files/uploads/Demonstrating%20Shock%20Mitigation%20and%20Drag%20Red
Acesso em: 14 fev. 2018.
LaFrance, Adrienne. “Genetically Modified Mosquitoes: What Could Possibly
Go Wrong?” Atlantic, 26 abr. 2016. Disponível em:
<theatlantic.com/technology/archive/2016/04/genetically-modified-
mosquitoes-zika/479793>. Acesso em: 14 fev. 2018.
Lawrence Livermore National Laboratory. “Lasers, Photonics, and Fusion
Science: Bringing Star Power to Earth.” Disponível em: <lasers.llnl.gov/>.
Acesso em: 14 fev. 2018.
LeCroy, C., Masiello, C. A., Rudgers, J. A., Hockaday, W. C. e Silberg, J. J.
“Nitrogen, Biochar, and Mycorrhizae: Alteration of the Symbiosis and
Oxidation of the Char Surface.” Soil Biology and Biochemistry 58, pp. 248-254,
2013.
Lefaucheur, J.-P., André-Obadia, N., Antal, A., Ayache, S. S., Baeken, C.,
Benninger, D. H., Cantello, R. M., Cincotta, M., de Carvalho, M., De Ridder,
D. et al. “Evidence-Based Guidelines on the Therapeutic Use of Repetitive
Transcranial Magnetic Stimulation (rTMS).” Clinical Neurophysiology 125, no
11, pp. 2.150-2.206, 2014.
Levin, Gilbert V. Sweetened Edible Formulations. U.S. Patent Application US
05/838,211, apresentado em 30 set. 1977.4262032A. Google Patents.
<google.com/patents/US4262032>.
Lewis, John S. Asteroid Mining 101: Wealth for the New Space Economy. Mountain
View, Califórnia: Deep Space Industries, 2014.
Liang, P., Xu, Y., Zhang, X., Ding, C., Huang, R., Zhang, Z., Lv, J., Xie, X.,
Chen, Y., Li, Y. et al. “CRISPR/Cas9-Mediated Gene Editing in Human
Tripronuclear Zygotes.” Protein and Cell 6, no 5, pp. 363-372, 2015.
Lipson, Hod e Kurman, Melba. Fabricated: The New World of 3D Printing.
Indianápolis, Indiana: Wiley, 2013.
Lockheed Martin. “Compact Fusion.” 2016. Disponível em:
<lockheedmartin.com/us/products/compact-fusion.html>. Acesso em: 14 fev.
2018.
Lowther, William. Arms and the Man: Dr. Gerald Bull, Iraq and the Supergun.
Novato, Califórnia: Presidio Press, 1992.
Maeda, Junichiro. “Current Research and Development and Approach to Future
Automated Construction in Japan”, em Construction Research Congress:
Broadening Perspectives, 1–11. Reston, Virgínia: American Society of Civil
Engineers, 2005. Publicado na internet em 26 abr. 2012.
Mahaffey, James A. Fusion. Nova York: Facts on File, 2012a.
MakerBot. “Frostruder MK2.” Thingiverse, 2 nov. 2009. Disponível em:
<thingiverse.com/thing:1143>. Acesso em: 14 fev. 2018.
Mali, P., Yang, L., Esvelt, K. M., Aach, J., Guell, M., DiCarlo, J. E., Norville, J. E.
e Church, G. M. “RNA-Guided Human Genome Engineering via Cas9.”
Science 339, no 6.121, pp. 823-826, 2013.
Malyshev, D. A., Dhami, K., Lavergne, T., Chen, T., Dai, N., Foster, J. M.,
Corrêa, I. R. e Romesberg, F. E. “A Semi-Synthetic Organism with an
Expanded Genetic Alphabet.” Nature 509, no 7.500, pp. 385-388, 2014.
Mankins, John. The Case for Space Solar Power. Houston, Texas: Virginia Edition
Publishing, 2014.
Mann Library. “Fast and Affordable: Century of Prefab Housing. Thomas
Edison’s Concrete House.” Cornell University, 2006. Disponível em:
<exhibits.mannlib.cornell.edu/prefabhousing/prefab.php?content=two_a>.
Acesso em: 14 fev. 2018.
Mannoor, M. S., Jiang, Z., James, T., Kong, Y. L., Malatesta, K. A., Soboyejo, W.
O., Verma, N., Gracias, D. H. e McAlpine, M. C. “3D Printed Bionic Ears.”
Nano Letters, 13, no 6, pp. 2.634-2.639, 2013.
Mark Foster Gage Architects. “Robotic Stone Carving.” Disponível:
<mfga.com>. Acesso em: 14 fev. 2018.
Markstedt, K., Mantas, A., Tournier, I., Martínez Ávila, H., Hägg, D., e
Gatenholm, P. “3D Bioprinting Human Chondrocytes with Nanocellulose-
Alginate Bioink for Cartilage Tissue Engineering Applications.”
Biomacromolecules 16, no 5, pp. 1.489-1.496, 2015.
Mars One, <mars-one.com>.
Mayo Clinic Staff. “Transcranial Magnetic Stimulation — Overview.” Mayo
Clinic. 2015. Disponível em: <mayoclinic.org/tests-procedures/transcranial-
magnetic-stimulation/home/ovc-20163795>. Acesso em: 14 fev. 2018.
McCracken, Garry e Stott, Peter. Fusion: The Energy of the Universe. Cambridge,
Massachusetts: Academic Press, 2012.
McGee, Ellen M. e Maguire, Gerald Q. “Becoming Borg to Become Immortal:
Regulating Brain Implant Technologies.” Cambridge Quarterly of Healthcare
Ethics 16, no 3, pp. 291-302, 2007.
McNab, I. R. “Launch to Space with an Electromagnetic Railgun.” IEEE
Transactions on Magnetics 39, no 1, pp. 295-304, 2003.
Menezes, A. A., Cumbers, J., Hogan, J. A. e Arkin, A. P. “Towards Synthetic
Biological Approaches to Resource Utilization on Space Missions.” Journal of
the Royal Society Interface 12, no 1-2 , p. 20.140.715, 2015.
Miller, Jordan S. “The Billion Cell Construct: Will Three-Dimensional Printing
Get Us There?” PLoS Biology 12, no 6, p. e1001882, 2014.
MIT Technology Review. (Nov. 2012): 115, 108. Disponível em:
<technologyreview.com/magazine/2012/11/>. Acesso em: 14 fev. 2018.
Moan, Charles E. e Heath, Robert G. “Septal stimulation for the Initiation of
Heterosexual Behavior in a Homosexual Male.” Journal of Behavior Therapy
and Experimental Psychiatry 3, no 1, pp. 23-30, 1972.
Mohan, Pavithra. “App Used 23andMe’s DNA Database to Block People From
Sites Based on Race and Gender.” Fast Company, 23 jul. 2015. Disponível em:
<fastcompany.com/3048980/fast-feed/app-used-23andmes-dna-database-to-
block-people-from-sites-based-on-race-and-gender>. Acesso em: 14 fev. 2018.
Mohiuddin, M. M., Singh, A. K., Corcoran, P. C., Hoyt, R. F., Thomas III, M.
L., Ayares, D. e Horvath, K. A. “Genetically Engineered Pigs and Target-
Specific Immunomodulation Provide Significant Graft Survival and Hope for
Clinical Cardiac Xenotransplantation.” Journal of Thoracic and Cardiovascular
Surgery 148, no 3, pp. 1.106-1.114, 2014.
Molloy, Mark. “Hiroshima Anger Over Pokémon at Atom Bomb Memorial
Park.” Telegraph, 28 jul. 2016. Disponível em:
<telegraph.co.uk/technology/2016/07/28/hiroshima-anger-over-pokemon-at-
atom-bomb-memorial-park>. Acesso em: 14 fev. 2018.
Moniz, E. J. “U.S. Participation in the ITER Project.” Washington, D.C.: United
States Department of Energy, 2016. Disponível em:
<science.energy.gov/~/media/fes/pdf/DOE_US_Participation_in_the_ITER_Project_May_
Acesso em: 14 fev. 2018.
Moravec, H. Mind Children: The Future of Robot and Human Intelligence.
Cambridge, Massachusetts: Harvard University Press, 1990.
Moser, M.-B. e Moser, E. I. The Future of the Brain: Essays by the World’s Leading
Neuroscientists. Princeton, Nova Jersey: Princeton University Press, 2014a.
———. The Future of the Brain: Essays by the World’s Leading Neuroscientists.
Princeton, Nova Jersey: Princeton University Press, 2014b.
Moskvitch, K. “Programmable Matter: Shape-Shifting Microbots Get It
Together.” Engineering and Technology Magazine 10, no 5, 2015. Disponível em:
<eandt.theiet.org/content/articles/2015/05/programmable-matter-shape-
shifting-microbots-get-it-together>. Acesso em: 14 fev. 2018.
Mourachkine, Andrei. Room-Temperature Superconductivity. Cambridge, Reino
Unido: Cambridge International Science Publishing, 2004.
Mukherjee, Siddhartha. The Emperor of All Maladies: A Biography of Cancer. Nova
York: Scribner, 2011.
Muller, Richard A. Energy for Future Presidents: The Science Behind the Headlines.
Nova York: W. W. Norton, 2013.
Mullin, Rick. “Cost to Develop New Pharmaceutical Drug Now Exceeds $2.5B.”
Scientific American, 24 nov. 2014. Disponível em:
<www.scientificamerican.com/article/cost-to-develop-new-pharmaceutical-
drug-now-exceeds-2-5b/>. Acesso em: 14 fev. 2018.
Murphy, Sean V. e Atala, Anthony. “3D Bioprinting of Tissues and Organs.” Nat
Biotech 32, no 8, pp. 773-785, 2014.
Naboni, Roberto e Paoletti, Ingrid. Advanced Customization in Architectural
Design and Construction. Nova York: Springer, 2014.
Naclerio, R. M., Bachert, C. e Baraniuk, J. N. “Pathophysiology of Nasal
Congestion.” International Journal of General Medicine 3, pp. 7-57, 2010.
Nasa. “A Natural Way To Stay Sweet.” Nasa Spinoff. 2004. Disponível em:
<spinoff.nasa.gov/Spinoff2004/ch_4.html>. Acesso em: 14 fev. 2018.
———. “Welcome to the Dawn Mission.” Nasa Jet Propulsion Laboratory. S.l.
Disponível em: <dawn.jpl.nasa.gov/mission>. Acesso em: 14 fev. 2018.
National Academies of Sciences, Engineering, and Medicine. Gene Drives on the
Horizon: Advancing Science, Navigating Uncertainty, and Aligning Research with
Public Values. Washington, D.C.: National Academies Press, 2016.
National Cancer Institute. “SEER Stat Fact Sheets: Cancer of the Lung and
Bronchus.” 2013. Disponível em: <seer.cancer.gov/statfacts/html/lungb.html>.
Acesso em: 14 fev. 2018.
National Institutes of Health. “Precision Medicine Initiative.” 2015. Disponível
em: <allofus.nih.gov/about/program-faq>. Acesso em: 14 fev. 2018.
NeuroPace, Inc. “The RNS® System for Drug-Resistant Epilepsy.” NeuroPace,
Inc. 2016. Disponível em: <neuropace.com>. Acesso em: 14 fev. 2018.
New Age Robotics. “Milling & Sculpting.” 2016. Disponível em:
<robotics.ca/portfolio/milling-sculpting>. Acesso em: 14 fev. 2018.
Newman, A. M., Bratman, S. V., To, J., Wynne, J. F., Eclov, N. C. W., Modlin, L.
A., Liu, C. L., Neal, J. W., Wakelee, H. A., Merritt, R. E. et al. “An
Ultrasensitive Method for Quantitating Circulating Tumor DNA with Broad
Patient Coverage.” Nature Medicine 20, no 5, pp. 548-554, 2014.
Northrop, Robert B. e Connor, Anne N. Ecological Sustainability: Understanding
Complex Issues. Boca Raton, Flórida: CRC Press, 2013.
Obed, A., Stern, S., Jarrad, A. e Lorf, T. “Six Month Abstinence Rule for Liver
Transplantation in Severe Alcoholic Liver Disease Patients.” World Journal of
Gastroenterology 21, no 14, pp. 4.423-4.426, 2015.
offensive-computing (nome do usuário). “Genetic Access Control”, 2015.
Disponível em: <https://github.com/offapi/rbac-23andme-oauth2>. Acesso
em: 14 fev. 2018.
Orlando, L., Ginolhac, A., Zhang, G., Froese, D., Albrechtsen, A., Stiller, M.,
Schubert, M., Cappellini, E., Petersen, B., Moltke, I. et al. “Recalibrating
Equus Evolution Using the Genome Sequence of an Early Middle
Pleistocene Horse.” Nature 499, no 7.457, pp. 74-78, 2013.
Open Humans, <openhumans.org>.
Organovo. “Bioprinting Functional Human Tissue”, 2016, <organovo.com>.
Owen, David. The Conundrum. Nova York: Riverhead Books, 2012.
Paddon, C. J., Westfall, P. J., Pitera, D. J., Benjamin, K., Fisher, K., McPhee, D.,
Leavell, M. D., Tai, A., Main, A., Eng, D. et al. “High-Level Semi-Synthetic
Production of the Potent Antimalarial Artemisinin.” Nature 496, no 7.446, pp.
528-532, 2013.
Pais-Vieira, M., Chiuffa, G., Lebedev, M., Yadav, A. e Nicolelis, M. A. L.
“Building an Organic Computing Device with Multiple Interconnected
Brains.” Scientific Reports 5, p. 11.869, 2015.
Pelt, Michel van. Rocketing into the Future: The History and Technology of Rocket
Planes. Nova York: Springer, 2012.
———. Space Tethers and Space Elevators. Nova York: Copernicus, 2009.
Peplow, Mark. “Synthetic Biology’s First Malaria Drug Meets Market
Resistance: Nature News & Comment.” Nature 530, no 7.591, pp. 389-390,
2016.
Perez, Sarah. “Recognizr: Facial Recognition Coming to Android Phones.”
ReadWrite, 24 fev. 2010. Disponível em:
<readwrite.com/2010/02/24/recognizr_facial_recognition_coming_to_android_phones
Acesso em: 14 fev. 2018.
Personal Genome Project. “Sharing Personal Genomes.” Personal Genome
Project: Harvard Medical School, <personalgenomes.org>.
Phillips, Tony. “The Tunguska Impact — 100 Years Later.” NASA Science, 2008.
Disponível em: <science.nasa.gov/science-news/science-at-
nasa/2008/30jun_tunguska>. Acesso em: 14 fev. 2018.
Phipps, C., Birkan, M., Bohn, W., Eckel, H.-A., Horisawa, H., Lippert, T.,
Michaelis, M., Rezunkov, Y., Sasoh, A., Schall, W. et al. “Review: Laser-
Ablation Propulsion.” Journal of Propulsion and Power 26, no 4, pp. 609-637,
2010.
Pino, R. E., Kott, A., Shevenell, M. (org.). Cybersecurity Systems for Human
Cognition Augmentation. Nova York: Springer, 2014.
Piore, Adam. “To Study the Brain, a Doctor Puts Himself Under the Knife.”
MIT Technology Review, 9 nov. 2015. Disponível em:
<technologyreview.com/s/543246/to-study-the-brain-a-doctor-puts-himself-
under-the-knife>. Acesso em: 14 fev. 2018.
Pleistocene Park. “Pleistocene Park: Restoration of the Mammoth Steppe
Ecosystem”, 2016, <http://www.pleistocenepark.ru/en/>.
Poland, Gregory A. “Vaccines Against Lyme Disease: What Happened and
What Lessons Can We Learn?” Clinical Infectious Diseases 52, supp. 3, pp.
s253-s258, 2011.
Polka, Jessica K. e Silver, Pamela A. “A Tunable Protein Piston That Breaks
Membranes to Release Encapsulated Cargo.” ACS Synthetic Biology 5, no 4, pp.
303-311, 2016.
Post, Hannah. “Reusability: The Key to Making Human Life Multi-Planetary.”
SpaceX, 10 jun. 2015. Disponível em:
<spacex.com/news/2013/03/31/reusability-key-making-human-life-multi-
planetary>. Acesso em: 14 fev. 2018.
Powell, J., Maise, G. e Pellegrino, C. StarTram: The New Race to Space. S. l.:
CreateSpace Independent Publishing Platform, 2013.
Rabinowits, G., Gerçel-Taylor, C., Day, J. M., Taylor, D. D. e Kloecker, G. H.
“Exosomal MicroRNA: A Diagnostic Marker for Lung Cancer.” Clinical Lung
Cancer 10, no 1, pp. 42-46, 2009.
Reaction Engines Limited, <reactionengines.co.uk>.
Reardon, Sara. “New Life for Pig-to-Human Transplants.” Nature 527, no 7.577,
pp. 152-154, 2015.
Reece, Andrew G. e Danforth, Christopher M. “Instagram Photos Reveal
Predictive Markers of Depression”, arXiv:1608.03282 [physics], 2016, p. 34.
Reece, A. G., Reagan, A. J., Lix, K. L. M., Dodds, P. S., Danforth, C. M. e
Langer, E. J. “Forecasting the Onset and Course of Mental Illness with
Twitter Data”, arXiv:1608.07740 [physics], 2016, p. 23.
Reiber, C., Shattuck, E. C., Fiore, S., Alperin, P., Davis, V. e Moore, J. “Change in
Human Social Behavior in Response to a Common Vaccine.” Annals of
Epidemiology 20, no 10, pp. 729-733, 2010.
Reid, G., Kirschner, M. B. e van Zandwijk, N. “Circulating microRNAs:
Association with Disease and Potential Use As Biomarkers.” Critical Reviews
in Oncology/Hematology 80, no 2, pp. 193-208, 2011.
Reiss, Louise Z. “Strontium-90 Absorption by Deciduous Teeth.” Science 134, no
3.491, pp. 1.669-1.673, 1961.
Riaz, Muhammad U. e Javaid, Zain. Programmable Matter: World with
Controllable Matter. Saarbrücken, Alemanha: Lambert Academic Publishing,
2012.
Richter, B. e Neises, G. “‘Human’ Insulin Versus Animal Insulin in People with
Diabetes Mellitus.” Cochrane Database of Systematic Reviews, 2002:
CD003816.
Ringeisen, B., Spargo, B. J. e Wu, Peter K. Cell and Organ Printing. Dordrecht,
Alemanha: Springer, 2010.
Ringo, Allegra. “Understanding Deafness: Not Everyone Wants to Be ‘Fixed’.”
Atlantic, 9 ago. 2013. Disponível em:
<theatlantic.com/health/archive/2013/08/understanding-deafness-not-
everyone-wants-to-be-fixed/278527>. Acesso em: 14 fev. 2018.
Robinette, Paul. “Developing Robots That Impact Human-Robot Trust In
Emergency Evacuations.” Tese de PhD. Georgia Institute of Technology,
2015.
Romanishin, J. W., Gilpin, K. e Rus, D. “M-Blocks: Momentum-Driven,
Magnetic Modular Robots”, pp. 4.288-4.295. IEEE/RSJ International
Conference on Intelligent Robots and Systems, Piscataway, Nova Jersey: IEEE
Publishing, 2013.
Rose, David. Enchanted Objects: Innovation, Design, and the Future of Technology.
Nova York: Scribner, 2015.
Roth, Alvin E. Who Gets What — and Why: The New Economics of Matchmaking
and Market Design. Boston, Massachusetts: Eamon Dolan/Mariner Books,
2016.
Rubenstein, M. “Emissions from the Cement Industry.” State of the Planet. Earth
Institute. Columbia University, 9 mai. 2012. Disponível em:
<blogs.ei.columbia.edu/2012/05/09/emissions-from-the-cement-industry>.
Acesso em: 14 fev. 2018.
Rubenstein, M., Cornejo, A. e Nagpal, R. “Programmable SelfAssembly in a
Thousand-Robot Swarm.” Science 345, no 6.198, pp. 795-799, 2014.
Sandia National Laboratories. “Sandia Magnetized Fusion Technique Produces
Significant Results”, 22 set. 2014. Disponível em:
<share.sandia.gov/news/resources/news_releases/mag_fusion/#.V8GkOpMrJE5
Acesso em: 14 fev. 2018.
———. “Z Pulsed Power Facility.” Z Research: Energy, 2015. Disponível em:
<www.sandia.gov/z-machine/research/energy.html>. Acesso em: 14 fev. 2018.
Schafer, G., Green, K., Walker, I., King Fullerton, S. e Lewis, E. “An Interactive,
Cyber-Physical Read-Aloud Environment: Results and Lessons from an
Evaluation Activity with Children and Their Teachers”, pp. 865-874. Em
Proceedings of the 2014 Conference on Designing Interactive Systems. Nova York:
ACM, 2014.
Schulz, A., Sung, C., Spielberg, A., Zhao, W., Cheng, Y., Mehta, A., Grinspun,
E., Rus, D. e Matusik, W. “Interactive Robogami: Data-Driven Design for 3D
Print and Fold Robots with Ground Locomotion.” 1:1. Em SIGGRAPH 2015:
Studio. Nova York: ACM, 2015.
Schwenk, Kurt. “Why Snakes Have Forked Tongues.” Science 263, no 1.573, pp.
1.573-1.577, 1994.
Seife, Charles. Sun in a Bottle: The Strange History of Fusion and the Science of
Wishful Thinking. Nova York: Viking, 2008.
Seiler, Friedrich e Igra, Ozer. Hypervelocity Launchers. Nova York: Springer, 2016.
Selectbio. “Caddie Wang’s Biography.” 3DPrinting in Life Sciences. Selectbio
Sciences, 2015. Disponível em:
<selectbiosciences.com/conferences/biographies.aspx?
speaker=1340332&conf=PRINT2015>. Acesso em: 14 fev. 2018.
SelfAssembly Lab, <selfassemblylab.net/index.php>.
Sepramaniam, S., Tan, J.-R., Tan, K.-S., DeSilva, D. A., Tavintharan, S., Woon,
F.-P., Wang, C.-W., Yong, F.-L., Karolina, D.-S., Kaur, P. et al. “Circulating
MicroRNAs as Biomarkers of Acute Stroke.” International Journal of Molecular
Sciences 15, no 1, pp. 1.418-1.432, 2014.
Serafini, G., Pompili, M., Belvederi Murri, M., Respino, M., Ghio, L., Girardi, P.,
Fitzgerald, P. B. e Amore, M. “The Effects of Repetitive Transcranial
Magnetic Stimulation on Cognitive Performance in Treatment-Resistant
Depression. A Systematic Review.” Neuropsychobiology 71, no 3, pp. 125-139,
2015.
Sercel, Joel. “APIS (Asteroid Provided In-Situ Supplies): 100MT Of Water from
a Single Falcon 9.” Nasa, 7 mai. 2015. Disponível em: <nasa.gov/feature/apis-
asteroid-provided-in-situ-supplies-100mt-of-water-from-a-single-falcon-9>.
Acesso em: 14 fev. 2018.
Servick, Kelly. “Scientists Reveal Proposal to Build Human Genome from
Scratch.” Science, 2 jun. 2016. Disponível em:
<sciencemag.org/news/2016/06/scientists-reveal-proposal-build-human-
genome-scratch>. Acesso em: 14 fev. 2018.
Shapiro, Beth. How to Clone a Mammoth: The Science of De-Extinction. Princeton,
Nova Jersey: Princeton University Press, 2015.
Shine, Richard e Wiens, John J. “The Ecological Impact of Invasive Cane Toads
(bufo marinus) in Australia.” Quarterly Review of Biology 85, no 3, pp. 253-291,
2010.
Shreeve, James. The Genome War: How Craig Venter Tried to Capture the Code of
Life and Save the World. Nova York: Knopf, 2004.
Silverstein, Ken. “How the Chips Fell.” Mother Jones 22, pp. 13-14, 1997.
Simberg, Rand E. e Lu, Ed. Safe Is Not an Option. Nova York: Interglobal Media
LLC, 2013.
Small, E. M. e Olson, E. N. “Pervasive Roles of microRNAs in Cardiovascular
Biology.” Nature 469, no 7.330, pp. 336-342, 2011.
Smith, Dan. “DARPA’s ‘Programmable Matter’ Project Creating Shape-Shifting
Materials.” Popular Science, 8 jun. 2009. Disponível em: <popsci.com/military-
aviation-amp-space/article/2009-06/mightily-morphing-powerful-range-
objects>. Acesso em: 14 fev. 2018.
Snir, A., Nadel, D., Groman-Yaroslavski, I., Melamed, Y., Sternberg, M., Bar-
Yosef, O. e Weiss, E. “The Origin of Cultivation and Proto-Weeds, Long
Before Neolithic Farming.” PLOS ONE 10, no 7, e0131422, 2015.
Snyder, Michael. Genomics and Personalized Medicine: What Everyone Needs to
Know. Oxford e NovaYork: Oxford University Press, 2016.
Somlai-Fischer, A., Hasegawa, A., Jasinowicz, B., Sjölén, T. e Hague, U.
“Reconfigurable House”, 2008, <http://house.propositions.org.uk>.
Spaceflight101. “Falcon 9 v1.1 & F9R—Rockets”, 2016a. Disponível em:
<spaceflight101.com/spacerockets/falcon-9-v1-1-f9r/>. Acesso em: 14 fev.
2018.
———. “Soyuz FG—Rockets”, 2016b. Disponível em:
<spaceflight101.com/spacerockets/soyuz-fg>. Acesso em: 14 fev. 2018.
Spröwitz, A., Moeckel, R., Vespignani, M., Bonardi, S. e Ijspeert, A .J.
“Roombots: A Hardware Perspective on 3D Self-Reconfiguration and
Locomotion with a Homogeneous Modular Robot.” Robotics and Autonomous
Systems 62, no 7, pp. 1.016-1.033, 2014.
Stull, Deborah. “Better Mouse Memory Comes at a Price.” Scientist, 2 abr. 2001.
Disponível em: <the-scientist.com/?articles.view/articleNo/13302/title/Better-
Mouse-Memory-Comes-at-a-Price>. Acesso em: 14 fev. 2018.
Suthana, Nanthia e Fried, Itzhak. “Deep Brain Stimulation for Enhancement of
Learning and Memory.” NeuroImage 85, parte 3, pp. 996-1.002, 2014.
Swan, P., Raiit, D., Swan, C., Penny, R. e Knapman, J. Space Elevators: An
Assessment of the Technological Feasibility and the Way Forward. Paris e Virgínia:
Science Deck Books, 2013.
Syrian Refugees. “The Syrian Refugee Crisis and Its Repercussions for the EU.”
2016, <syrianrefugees.eu>.
Talbot, David. “A Prosthetic Hand That Sends Feelings to Its Wearer.” MIT
Technology Review, 5 dez. 2013. Disponível em:
<technologyreview.com/s/522086/an-artificial-hand-with-real-feelings>.
Acesso em: 14 fev. 2018.
Tan, D. W., Schiefer, M. A., Keith, M. W., Anderson, J. R., Tyler, J. e Tyler, D. J.
“A Neural Interface Provides Long-Term Stable Natural Touch Perception.”
Science Translational Medicine 6, no 257, p. 257ra138, 2014.
Tang, Y.-P., Shimizu, E., Dube, G. R., Rampon, C., Kerchner, G. A., Zhuo, M.,
Liu, G. e Tsien, J. Z. “Genetic Enhancement of Learning and Memory in
Mice.” Nature 401, no 6.748, pp. 63-69, 1999.
Throw Trucks With Your Mind!, <throwtrucks.com>.
Tidball, R., Bluestein, J., Rodriguez, N. e Knoke, S. “Cost and Performance
Assumptions for Modeling Electricity Generatin Technologies.” Fairfax,
Virgínia.: National Renewable Energy Laboratory, 2010. Disponível em:
<nrel.gov/docs/fy11osti/48595.pdf>. Acesso em: 14 fev. 2018.
Tinkham, Michael. Introduction to Superconductivity: Second Edition. Mineola,
Nova York: Dover Publications, 2004.
Tomich, Jeffrey. “Decades Later, Baby Tooth Survey Legacy Lives On.” St. Louis
Post-Dispatch, 1o ago. 2013. Disponível em: <stltoday.com/lifestyles/health-
med-fit/health/decades-later-baby-tooth-survey-legacy-lives-
on/article_c5ad9492-fd75-5aed-897f-850fbdba24ee.html>. Acesso em: 14 fev.
2018.
Torella, J. P., Gagliardi, C. J., Chen, J. S., Bediako, D. K., Colón, B., Way, J. C.,
Silver, P. A. e Nocera, D. G. “Efficient Solar-to-Fuels Production from a
Hybrid Microbial-Water-Splitting Catalyst System.” Proceedings of the
National Academy of Sciences 112, no 8, pp. 2.337-2.342, 2015.
Trang, P. T. K., Berg, M., Viet, P. H., Mui, N. V. e van der Meer, J. R. “Bacterial
Bioassay for Rapid and Accurate Analysis of Arsenic in Highly Variable
Groundwater Samples.” Environmental Science & Technology 39, no 19, pp.
7.625-7.630, 2005.
Treisman, M. “Motion Sickness: An Evolutionary Hypothesis.” Science 197, no
4.302, pp. 493-495, 1977.
UN Habitat. “World Habitat Day: Voices from Slums — Background Paper.”
United Nations Human Settlements Programme, 2014. Disponível:
<unhabitat.org/wp-content/uploads/2014/07/WHD-2014-Background-
Paper.pdf>. Acesso em: 14 fev. 2018.
United Network for Organ Sharing. “Data”, 2015, <unos.org/data>.
U.S. Congress. House, 2008. Genetic Information Nondiscrimination Act of 2008.
H.R. 493. 110o Cong. Congressional Record 154, no 71, edição diária. (1o mai.
2008): H2961–H2980. Disponível em: <https://www.congress.gov/bill/110th-
congress/house-bill/493>. Acesso em: 14 fev. 2018.
———. (2015). U.S. Commercial Space Launch Competitiveness Act. H.R.
2262.114o Cong., 1a sess. Congressional Record 161, no 78, edição diária (20 mai.
2015): H3403–H3410. Disponível em: <www.congress.gov/bill/114th-
congress/house-bill/2262>.
Van Nimmen, Jane, Bruno, Leonard C. e Rosholt, Robert L. NASA Historical
Data Book, 1958–1968. Vol I: NASA Resources. Washington, D.C.: Nasa, 1976.
Disponível em: <history.nasa.gov/SP-4012v1.pdf>. Acesso em: 14 fev. 2018.
Vasudevan, T. M., van Rij, A. M., Nukada, H. e Taylor, P. K. “Skin Wrinkling for
the Assessment of Sympathetic Function in the Limbs.” Australian and New
Zealand Journal of Surgery 70, no 1, pp. 57-59, 2000.
Venter, J. C. Life at the Speed of Light: From the Double Helix to the Dawn of
Digital Life. Nova York: Penguin Books, 2014b.
———. What — Me Worry?, 200-207. Em What Should We Be Worried About?:
Real Scenarios That Keep Scientists Up at Night, organizado por J. Brockman.
Nova York: Harper Perennial, 2014a.
Vrije Universiteit Science. “Robot Baby Project by Prof.dr. A.E. Eiben on
evolving robots / The Evolution of Things”, 26 mai. 2016. Disponível em:
<youtube.com/watch?v=BfcVSb-Q8ns>. Acesso em: 14 fev. 2018.
Wang, Brian. “$250,000 Slingatron Kickstarter.” NextBigFuture, 29 jul. 2013.
Disponível em: <nextbigfuture.com/2013/07/250000-slingatron-
kickstarter.html>. Acesso em: 14 fev. 2018.
Wei, F., Wang, G.-D., Kerchner, G. A., Kim, S. J., Xu, H.-M., Chen, Z.-F. e
Zhuo, M. “Genetic Enhancement of Inflammatory Pain by Forebrain NR2B
Overexpression.” Natural Neuroscience 4, no 2, pp. 164-169, 2001.
Werfel, Justin. “Building Structures with Robot Swarms.” O’Reilly.com, 2016.
Disponível em: <oreilly.com/ideas/building-structures-with-robot-swarms>.
Acesso em: 14 fev. 2018.
Werfel, J., Petersen, K. e Nagpal, R. “Designing Collective Behavior in a
Termite-Inspired Robot Construction Team.” Science 343, no 6.172, pp. 754-
758, 2014.
White, D. E., Bartley, J. e Nates, R. J. “Model Demonstrates Functional Purpose
of the Nasal Cycle.” BioMedical Engineering OnLine 14, p. 38, 2015.
Whiting, P., Al, M., Burgers, L., Westwood, M., Ryder, S., Hoogendoorn, M.,
Armstrong, N., Allen, A., Severens, H., Kleijnen, J. et al. “Ivacaftor for the
Treatment of Patients with Cystic Fibrosis and the G551D Mutation: A
Systematic Review and Cost-Effectiveness Analysis.” Health Technology
Assessment 18, no 18, p. 130, 2014.
Wikipedia. “Nitrogen Narcosis”, 2016. Disponível em:
<en.wikipedia.org/w/index.php?title=Nitrogen_narcosis&oldid=735322553>.
Acesso em: 14 fev. 2018.
Wittmann, J. e Jäck, H.-M. “Serum microRNAs as Powerful Cancer
Biomarkers.” Biochimica et Biophysica Acta (BBA) — Reviews on Cancer 1806, no
2, pp. 200-207, 2010.
Wolpaw, Jonathan e Wolpaw, Elizabeth Winter. Brain-Computer Interfaces:
Principles and Practice. Oxford e Nova York: Oxford University Press, 2012.
World Health Organization. “Global Insecticide Resistance Database”, 2014.
Disponível em:
<who.int/malaria/areas/vector_control/insecticide_resistance_database/en>.
Acesso em: 14 fev. 2018.
———. “10 Facts On Malaria,” 2015. Disponível em:
<who.int/features/factfiles/malaria/en>. Acesso em: 14 fev. 2018.
World Nuclear Association. “Peaceful Nuclear Explosions”, 2010. Disponível em:
<world-nuclear.org/information-library/non-power-nuclear-
applications/industry/peaceful-nuclear-explosions.aspx>. Acesso em: 14 fev.
2018.
Wrangham, Richard. Catching Fire: How Cooking Made Us Human. Nova York:
Basic Books, 2010.
Yang, L., Güell, M., Niu, D., George, H., Lesha, E., Grishin, D., Aach, J.,
Shrock, E., Xu, W., Poci, J. et al. “Genome-Wide Inactivation of Porcine
Endogenous Retroviruses (PERVs).” Science 350, no 6.264, pp. 1.101-1.104,
2015.
Yim, M., White, P., Park, M. e Sastra, J., 2009. Modular Self-Reconfigurable
Robots, pp. 5.618-5.631. Em Encyclopedia of Complexity and Systems Science,
organizado por Robert A. Meyers. Nova York: Springer, 2009.
Zewe, Adam. “In Automaton We Trust”, 2016. Harvard Paulson School of
Engineering and Applied Sciences. Disponível em:
<seas.harvard.edu/news/2016/05/in-automaton-we-trust>.
Zhu, L., Wang, J. e Ding, F. “The Great Reduction of a Carbon Nanotube’s
Mechanical Performance by a Few Topological Defects.” ACS Nano 10, no 6,
pp. 6.410-6.415, 2016.
Sobre os autores

DRA. KELLY WEINERSMITH é professora adjunta do Departamento de


Ciências Biológicas da Rice University, onde estuda parasitas que manipulam o
comportamento de seus hospedeiros. Além de pesquisadora renomada, é
coapresentadora do Science... Sort Of, um dos maiores podcasts de ciências
naturais da atualidade, e foi palestrante do festival de ciência e tecnologia “The
Future is Here” de 2015, promovido pela revista da Smithsonian Institution. Já
teve trabalhos publicados em veículos como The Atlantic, Science, Nature, National
Geographic e BBC World.
ZACH WEINERSMITH é o premiado cartunista por trás do webcomic geek
Saturday Morning Breakfast Cereal, que soma milhões de visualizações todos os
meses. Seu trabalho já apareceu em diversos veículos, incluindo The Economist,
The Wall Street Journal, Slate, Forbes, Entertainment Weekly, CNN e Discovery
Magazine.
Leia também

Buracos negros
Stephen Hawking

Minha breve história


Stephen Hawking
O universo numa casca de noz
Stephen Hawking

Uma breve história do tempo


Stephen Hawking
Como a música ficou grátis
Stephen Witt

Elon Musk
Ashlee Vance