Você está na página 1de 3

Estudo Dirigido: Caractersticas do Cdigo Gentico

Professores Daniela A. Silvestre e Antonio Dgas

O termo Cdigo Gentico muitas vezes utilizado de forma errnea para designar a sequncia de DNA de um organismo, que na verdade deveria ser chamado de Genoma. Por exemplo, no devemos usar a seguinte frase: Foi seqenciado o cdigo gentico completo do ser humano, e sim Foi sequenciado o genoma completo do ser humano. Na verdade, cdigo gentico a correspondncia entre os cdons (trincas de bases do RNA mensageiro) e os respectivos aminocidos que devem compor a estrutura primria de uma protena. Na prtica, uma tabela que estabelece a correspondncia entre cdons e aminocidos, como a da Figura 1. A Figura 2 uma lista de abreviaes dos nomes dos aminocidos.

Figura 1 Cdigo gentico eucarionte. First, second e third base in codon = Primeira, segunda e terceira base do cdon, respectivamente. Ex: Cdon AUG corresponde a Met (metionina). STOP = cdon de parada. Retirado de http://www.clcbio.com/scienceimages.

Figura 2 Lista de aminocidos e suas abreviaes (de 1 e 3 letras). Retirado de http://bioinformatica-na-escola.org

Esse cdigo tem trs caractersticas principais: 1. Conservado ou universal: a tabela a mesma para quase todos os organismos. H pequenas diferenas, por exemplo, entre procariontes e eucariontes, mas quase todas as correspondncias so mantidas.

2. Degenerado ou redundante: repare na tabela: para um mesmo aminocido (por exemplo, Leucina), pode haver vrios cdons (no exemplo, CUU, CUC, CUG, CUA, UUA, UUG). 3. Inequvoco ou sem superposio: por outro lado, cada cdon s se relaciona com um aminocido, nunca com mais de um (ex: CGA = somente Arginina). Em ltima anlise a informao contida no cdigo gentico serve como uma receita para a fabricao das protenas de uma clula e estas, por sua vez, so extremamente importantes para as funes celulares (aprendendo sobre as protenas vai perceber porque elas so to importantes para o metabolismo). A atividade a seguir tem como objetivo demonstrar o mecanismo da sntese de protenas, ou traduo, e a importncia do cdigo gentico neste processo.

Antes da aula providencie os materiais que so descritos a seguir, no Anexo: Simulando a Sntese Protica, leia as seguintes referncias e responda as questes que seguem (no necessrio ler todas as referncias). Bases da Biologia Celular e Molecular, De Robertis e Hibb, 3. Ed. Cap. 16 A Traduo do RNA-m, p.267 Fundamentos da Biologia Celular, B. Alberts e colaboradores, 3. Ed. Cap. 7 de DNA Protenas (foco nos itens De DNA a RNA e De RNA Protenas), p. 214 Gentica, G.W. Birus e P.J. Bottino, 6. Ed. Cap. 10 O Cdigo Gentico, p. 173 Introduo Gentica, Griffiths e colaboradores, 8. Ed. Cap. 8 RNA: Transcrio e Processamento, p. 245 Cap. 9 Protenas e sua Sntese, p. 263

QUESTES 1. 2. 3. 4. Explique quais so e qual a importncia de cada um dos tipos de RNA. Explique o que so cdons e anticdons. Explique o que so stop cdons e sua importncia. Explique os diferentes tipos de mutaes e suas implicaes para a sntese de uma protena. 5. Com a tabela da figura 1, traduza a seguinte sequncia de DNA. Lembre-se: o cdigo gentico relaciona RNA com protena, ento voc primeiro precisar transcrever essa fita de DNA em um RNA complementar a ele. ACCCTAGATGCTAGATCGAATGCTAGGATT 6. A fita de DNA acima sofreu uma mutao e a sequncia ficou como abaixo. Transcreva o RNA e traduza novamente. ACCCTAGATGCTAGGTCGAATGCTAGGATT 7. Em duas outras pessoas, o trecho de DNA acima sofreu mutaes diferente. Repita a operao. ATCCTAGATGCTAGATCGAATGCTAGGATT

ACCCTCGATGCTAGATCGAATGCTAGGATT 8. Para responder esta questo fundamental que voc tenha lido as referncias indicadas. Compare as protenas produzidas pelos trs indivduos (6, 7 e 8) com o normal (5) e em seguida complete a tabela abaixo, relacionando o tipo de mutao (nonsense, missense e silenciosa) com cada um dos casos (6,7 e 8). Para isso complete a tabela abaixo:

Tipo de mutao

No. da questo que apresenta a mutao (2, 3 ou 4)

Nonsense Missense Silenciosa

9. Qual dessas mutaes tem a ver com o fato do cdigo gentico ser degenerado ? Explique e justifique.

Durante a aula ser disponibilizado um material para utilizao pelos grupos.