Você está na página 1de 3

Genomas

1. Defina genoma e gene. Descreva a funo de cada um.



2. Diferencie genomas procariticos e eucariticos quanto ao tamanho, presena de regies no
codificantes (introns e intergnicas), contedo gnico e estrutura dos genes.

3. Alm do genoma principal, as clulas eucariticas possuem outros genomas. Onde so
encontrados esses outros genomas. Compare esse genoma com o genoma principal de
eucariotos e procariotos.

4. Defina exon e intron.

5. O que so seqncias regulatrias

6. O genoma divido em regies com sequencias relacionadas a genes e sequencias no
codificantes. Como cada regio pode ser subdividida.

7. O que so seqncias repetitivas do tipo satlite.

8. O que so elementos transponveis, quais os tipos e como so classificados aos intermedirios
formados.

Estrutura dos cidos nuclicos

9. Nomeie as partes constituintes do nucleotdeo abaixo. Responda se encontrado no DNA ou no
RNA e justifique sua resposta.



10. Um determinado organismo possui 29% de bases de timina. Qual porcentagem de bases deste
DNA de resduos de citosina? Explique.

11. Quando separadas, as duas fitas de uma dupla-hlice so idnticas? Explique.

12. A molcula de DNA tem polaridade 5-3 e formada por duas fitas antiparalelas. Ao acar liga-
se um grupo fosfato no carbono na posio 5. Um nucleotdeo como parte integrante de um cido
nuclico tem um nico grupo fosfato, sendo, portanto um nucleotdeo monofosfato. Qual a
extremidade onde monmeros so adicionados?

Replicao

13. Baseado na complementaridade e no antiparalelismo da molcula de DNA, observe a sequencia
abaixo e:
5-GTACCATGCATTACGCGCGGCTAGCTAGTAGGGTCTAGATATTCTGATAGCT-3.
a
b
c
a) Escreva a fita complementar do DNA com sua polaridade


b) Supondo que esta seja a sequencia de uma fita codificante de um gene, escreva a sequencia
de RNA resultante



14. Muitas origens de replicao foram caracterizadas por conter seqncias ricas em A:T. Esses
ncleos ricos em A:T tm algum significado funcional? Qual?

15. Descreva a funo de cada um dos componentes do processo de replicao listados na questo
anterior.

16. Considerando a seqncia abaixo, e o sentido de polimerizao da esquerda para direita,
aponte qual fita ser molde para a sntese da fita contnua e qual ser da descontnua.
5 AACTGGTCGATGCTATTGATCGATGCTAG 3
3 TTGACCAGCTACGATAACTAGCTACGATC 5

17. Uma das principais diferenas entre os cromossomos da maioria das bactrias e clulas
eucariticas que os cromossomos dos eucariotos so lineares. A manuteno da integridade
das extremidades dos cromossomos lineares demanda um tipo de replicao especfica que evita
perdas sucessivas de DNA. Como so chamados esses terminais cromossmicos e explique
como as extremidades so replicadas.


Transcrio

18. Diferencie fatores de transcrio basal (ou geral) de fatores de transcrio especficos, levando
em considerao: o papel dos fatores de transcrio e as circunstncias os fatores especficos
so ativados.

19. Os componentes do complexo de transcrio basal ocorrem em todas as clulas? Justifique.

20. O que processamento de RNA e qual sua funo.

Traduo

21. Porque o cdigo gentico formado por trincas? Quantos aminocidos so especificados pelo
cdigo gentico? Quantas sequncias de aminocidos so possveis em um polipeptdeo de 146
aminocidos?

22. Sobre a seqncia de RNA abaixo, responda:
5- GCUAUGGCAAAACUGUGGGUACGCACUUAGGCAAUUCCUAAAAAAAAAAAAA-3
a.Que tipo de RNA esse?
b.Circule onde se inicia a sntese das protenas e risque onde esta termina.
c.Consulte uma tabela de correspondncia cdon-aminocido e d a seqncia de aa resultante de
sua traduo.
d.Quais as caractersticas que permitem sua classificao?
e.Qual o sentido em que traduzido?

23. Qual o nmero de cdons gerados a partir dos 4 nucleotdeos presentes na molcula de
mRNA? Quantos so codificantes? Qual a funo dos que no so codificantes?

24. O que significa universalidade do cdigo gentico?

25. Descreva brevemente o que acontece em cada uma das fases da sntese de protenas:
a. Ativao dos aminocidos
b. Iniciao
c. Alongamento
d. Terminao

26. O que significa no ambigidade do cdigo gentico?

27. Porque na clula eucaritica, diferente da clula procaritica, a traduo de um RNA no pode
ocorrer ao mesmo tempo em que este RNA transcrito?

28. Defina anti-codon.

29. Qual a funo dos fatores de alongamento da traduo?

30. Tenha em mos a tabela de correspondncia cdons-aminocidos, observe abaixo a seqncia
de DNA correspondente fita codificante de um gene e responda:
5-CGATCGACCTAGATGGATTCGATCGATTCGGAGCTAGGCTAGTCTAACTGATCG-3
a) Transcreva a molcula de RNA correspondente a este gene
b) Circule o cdon onde comea a sntese da protena (cdon de iniciao)
c) Sublinhe o cdon de iniciao (note que este cdon deve estar na mesma fase de leitura
usada para a sntese da protena)
d) Traduza a seqncia do RNA em protena