Você está na página 1de 38

EXERCCIOS DE GENTICA VEGETAL

Material Gentico, Sntese de Protenas e Cdigo Gentico


1. Uma clula produz cerca de 4.000 protenas cada uma com 250 aminocidos, em mdia. Calcule o comprimento mnimo que deve ter o DNA desta clula, em nmero de nucleotdeos. 2. Um filamento simples com as seguintes bases nitrogenadas: ...AAAGTTCC... Pode-se saber se pertence aos RNAs ou ao DNA? Se for do DNA, qual o seu filamento complementar? Se se formasse um RNAm destes filamentos de que bases seria constitudo? 3. Dado um filamento simples de DNA...5T A C G G G T A T C A G C T G A T T 3...construa: (a) a cadeia de DNA complementar. (b) a cadeia de mRNA que seria formada do filamento dado. 4. Um filamento de DNA com a seguinte seqncia de bases ...ATTCCGATGC.. ser incorporado no DNA de uma clula, durante o processo de duplicao. Em qual setor do DNA da clula possvel que o fragmento dado possa se incorporar? 5. Usando a informao da Tabela de Cdons, determine quais so os seguimentos polipeptdicos formados a partir dos mRNAs dados a) AUGCCCGAGCCAAACGGUGGUUAA b) ...5AUGUUCCCGUCGACAGCCUAG3... c) ...5 AAAACCUGGAGAACCCAUUGA 3`... Considerando o filamento (a) apenas, possvel se determinar a polaridade deste mRNA? e do DNA? Se sim, quais sero?

6. Se uma protena tiver a seguinte seqncia de aminocidos: a) ..Arg - His- PF-.Met - Ile - Val - P.F. b) Met Ile- Asp Val Fen Leu P.F. - ... c) ... Arg - Ser - Ser - Tri - Gli - Tri - Ser d) Met - Arg - Ile - Tri - P.F - P.F PF - Met - His - Ser - P.F. Quais as seqncias de nucleotdeos no DNA, no mRNA e tRNA que correspondem em cada caso (cite apenas uma possvel em cada caso). Determine ainda a polaridade de cada um dos filamentos do DNA que possui a informao gentica. 7. Se um DNA tiver 45.363 nucleotdeos, pergunta-se: a) Quantos nucleotdeos o mRNA ter? b) Quantos tRNAs sero necessrios para a traduo? c) Quantos aminocidos a enzima ter? 8. Se um segmento curto de uma longa molcula de DNA tem a seguinte seqncia de pares de nucleotdeos: ...3`TTCTATCCGGCAGCTA 5`... ...5`AAGATAGGCCGTCGAT 3`.. Se o filamento ...5` 3`... do DNA servir de molde para a sntese de mRNA qual ser a sua seqncia de ribonucleotdeos? (b)D o ribonucleotdeo na extremidade ...5` da molcula de RNA assim transcrita. (c) Qual seria a sua resposta `a parte (b) se tivesse sido o filamento ...3` 5`... a servir de molde? 9. Se uma protena tiver a seguinte seqncia de aminocidos: MET HIS ILE HIS TRE LEU MET - PF A) Determine uma seqncia possvel de nucleotdeos para o mRNA correspondente a esta seqncia de aminocidos; B) Determinado o mRNA pergunta-se: Qual ser a seqncia polinucleotdica da cadeia de DNA com sentido? C) E quantos e quais so os anticdons dos tRNAs?

10. A distncia entre pares de bases no DNA de 3,4 angstrons. Qual o tamanho do DNA, em centmetros, do milho, se ele possui 1,36 x 1010 pb? E do fumo, j que ele tem 2,18 x 109 pb? Dados: 1 angstron = 10 10 m. 11. Em feijo (Phaseolus vulgaris L.) o gene da enzima mlica foi codificado e partes dele se encontram abaixo especificado Exon 1 Intron 1 5ATGAACTCGCAT GTCAAAT 3TACTTGAGCGTA CAGTTTA Exon 2 Intron 2 AAGTTG GTACCA TTCAAC CATGGA Exon 3 TGGATGCAGTTTTAG3 ACCTACGTCAAAATC5

O fio a ser usado nessa questo o que tem TIMINA na extremidade 3. A partir dessa informao: A) qual o RNAhn e o RNAm? B) quais os aminocidos que faro parte dessa enzima? C) quantos RNAt diferentes sero necessrios para essa sntese? D) considerando a fita sense, a que inicia por ADENINA na extremidade 5, se ocorrer uma deleo na 5 base e a adio de uma CITOSINA aps o 23 desoxirribonucleotdeo, qual ser a cadeia polinucleotdica a partir desse DNA mutado? (Fonte: WALTER, M. et al. Eur. J. Biochem. 224: 999-1009, 1994) 12. Em duas seqncias de bases nucleotdicas denominadas RNAm foram econtrados vrios cdons, entretanto a anlise da protena correspondente foi encontrado os mesmos aminocidos nas duas seqncias, assim como verificaram que havia o mesmo nmero de cdons e aminocidos. Por fim, foram indentificados cdons que permitiam o desligamento do RNA do ribossomo. Baseado nisso, a que propriedades do cdigo gentico correspondem os casos estudados? 13. Na cadeia de DNA abaixo descrita esto exemplificadas propriedades do cdigo gentico. Assinale os cdons que se relacionem com as propriedades e explique cada uma das que consta na seqncia TACGTGTCCAACTTGGCCGTAATC

A pgina seguinte possui a Tabela do Cdons (mRNA) para que os problemas que necessitem dela possam ser resolvidos.

TABELA DE CDONS (RNAm)

PRIMEIRA BASE

G GLICINA

SEGUNDA A AC. GLUTMICO AC. GLUTMICO AC. ASPRTICO AC. ASPRTICO LISINA LISINA ASPARAGINA ASPARAGINA GLUTAMINA GLUTAMINA HISTIDINA HISTIDINA FIM DE CADEIA FIM DE CADEIA TIROSINA TIROSINA

BASE C ALANINA ALANINA ALANINA ALANINA TREONINA TREONINA TREONINA TREONINA PROLINA PROLINA PROLINA PROLINA SERINA SERINA SERINA SERINA

U VALINA VALINA VALINA VALINA METIONINA (INICIO DE CADEIA) ISOLEUCINA ISOLEUCINA ISOLEUCINA LEUCINA LEUCINA LEUCINA LEUCINA LEUCINA LEUCINA FENILALANINA FENILALANINA

TERCEIRA BASE G A C U G A C U G A C U G A C U

GLICINA GLICINA GLICINA ARGININA

ARGININA SERINA SERINA ARGININA

ARGININA ARGININA ARGININA TRIPTOFANO

FIM DE CADEIA CISTENA CISTENA

14. Responda: A) O que so bases nucleotdicas e onde se encontram? B) O que so aminocidos e onde se encontram? C) H relao entre bases nucleotdicas e aminocidos? Se sim, qual? D) Quais as origens das bases nucleotdicas e dos aminocidos? E) Por que formado o prRNAm no interior do ncleo? F) Como o prRNAm se transforma em RNAm e por que? G) Qual o nucleotdeo do cdon que vai determinar, efetivamente, o aminocido que deve entrar na cadeia polipeptdica?

Mutaes e alteraes cromossmicas


15. Tendo a seguinte seqncia de DNA: TACTAGTAATGAGTACGACTGATC seu mRNA : a protena constituda dos seguintes resduos de aminocidos : Se houver a incluso, por ao de mutagnicos, do nucleotdeo ADENINA entre o quarto e o quinto desoxirribonucleotdeo, de quais resduos ser formada a cadeia proteca? Esta mutao de ponto alterou a estrutura primria da cadeia de protena? 16. Baseado no DNA da questo anterior: devido a ao dos mutagnicos qumicos houve a substituio da GUANINA na posio 6 por uma TIMINA. De quais resduos ficou formada a protena? Houve alterao na cadeia proteica? 17. Baseado no DNA da questo anterior, DNA mutante. Sabe-se que o DNA se duplica levando a mutao silenciosa. Verifique se, na prxima gerao, possvel aparecer a mutao a partir do RNAm sintetizado tendo como molde o novo fio complementar de DNA ao que foi formado com a mutao na questo 16.

18. A cor do pimento pode ser verde ou amarela. A cor verde dominante sobre a amarela, de forma que em todos os cruzamentos o alelo tem grande probabilidade de aparecer. Se cada alelo condiciona a produo de uma protena para a cor, atravs do DNA e se num dos fios de DNA houver a alterao de uma base nucleotdica que modifique a cor de verde para amarelo, qual ser a chance da cor verde aparecer novamente na segunda gerao aps a alterao nucleotdica? 19. Usando a informao da Tabela de Cdons realize em (a) uma transverso no 10 desoxirribonucleotdeo; em (b) uma transio no DNA que originou esse RNAm e em (c) ambas mutaes em cada ribonucleotdeo das extremidades e determine quais so os seguimentos polipeptdicos formados a partir dos mRNAs dados A) AUGCCCGAGCCAAACGGUGGUUAA B) ...5AUGUUCCCGUCGACAGCCUAG3... C) ...5 AAAACCUGGAGAACCCAUUGA 3`... D) Considerando o filamento (a) apenas, possvel se determinar a polaridade deste mRNA? E do DNA? 20. Considerando o caritipo com 2n = 8 cromossomos: ----------0------------------0--------------0-----------0--------------------0-----------------0---------0--------0--

Represente um nulissmico, um monossmico, um trissmico,um tetrassmico, um haplide, um triplide e um tetraplide. 21. Em trigo, considerando dois genes em cromossomos independentes, um para arista (A determina a presena e a ausncia) e outro para cor do gro (B determina cor creme e b cor branca), h possibilidade do aparecimento de aneuplides, naturalmente, provocando variabilidade na cultura, se o gro de plen mutado for detectado. Supondo que o gene para a presena de aristas esteja num cromossomo que foi perdido durante a meiose. O gro de plen, apesar da mutao continua frtil. Execute o cruzamento entre plantas com os dois marcadores genticos e descreva a freqncia fenotpica em F2. 22. Proponha o cruzamento entre plantas que possuam 2n=6 cromossomos, mas que uma seja portadora de uma trissomia em qualquer de um dos seus cromossomos. Faa o desenho da formao dos gametas. 23. Considerando o exemplo da cor do endosperma e que haja interao allica do tipo intermediria em sementes de milho, programe um cruzamento entre dois duplex e determine a sua proporo fenotpica, sabendo que R determina a presena de antocianina na aleurona e o alelo r condiciona a ausncia desse pigmento, e, ainda, que o gentipo Rrr condiciona gros pintados.

24. Do cruzamento de um simplex com um duplex ambos tetraplides, qual o resultado em termos fenotpicos apresentados. Considere um gene qualquer com interao de dominncia, por exemplo, presena e ausncia de clorofila nas folhas, a presena dominante e a ausncia recessiva. 25. A presena de clorofila um dos genes considerados em anlises do nmero de cromossomos nas espcies. Espcies poliplides possuem mais clorofila e so mais verdes do que as diplides e essas mais verdes do que as haplides. Construa um esquema, usando desenho de cromossomos, desde um gro de plen cultivado, in vitro, de um indivduo autotetraplide. 26. As clulas de um progenitor masculino contm um par de cromossomos homlogos AA e um cromossomo B apenas, sem seu homlogo. Qual a constituio cromossmica de cada um dos quatro gametas produzidos numa diviso meitica completa? Analise todas as hipteses provveis. 27. Em batatas vrias ploidias podem ser encontradas e as plantas cruzadas entre si com o auxlio do melhorista. Plantas diploides de batata portando gene para folha lobada foram cruzadas com plantas tetraploides da mesma espcie, porm com folhas recortadas. Sendo a recortada dominante sobre a lobada, qual o tipo de folhas resultante desse cruzamento. Demonstre os gentipos de ambas as espcies, os gametas de cada genitor e o cruzamento. 28. No centro de origem de Hordeum (espcie de cevada) foram encontradas plantas cujas folhas produziam quantidades diferenciadas de protenas. Por exemplo, a espcie A produzia cerca de 840 g de protena glicolisada, enquanto que a espcie B produzia cerca de 210 g da mesma protena. Como essa protena produzida por apenas um alelo dominante do gene, o que se pode dizer sobre a constituio genotpica dessas duas espcies? Se houver cruzamento dessas espcies entre si, qual a quantidade prevista de protena a planta frtil capaz de produzir? 29. Responda: A) O que transverso e transio? No teu entendimento qual a mais prejudicial para o organismo? B) Conceitue mutao homozigtica e descreva o seu efeito no indivduo que a possui. C) Por que os poliplides so considerados bons colonizadores de ambientes nos quais os diplides no se adaptam? D) Nos indivduos poliplides ocorrem algumas alteraes fenotpicas. Exemplo disso so os estmatos e os cloroplastos. Relate o que acontece com essas estruturas citoplasmticas quando as clulas so poliplides.

30. Numa populao de Phaseolus lunatus foram encontradas clulas do arqueosporo com 43 cromossomos, enquanto que alguns vulos possuam 10 cromossomos. Se houver autofecundao que tipo de aneuplide poder ser formado? Explique o que levou a formao de aneuplides a partir de diplides normais. 31. Na evoluo de plantas foi comum a alopoliploidia seguido da autopoliploidia. Baseado nisso, quantas cromtides irms e centrmeros podem ser encontradas numa espcie resultante do cruzamento de duas outras que continham, respectivamente, A clulas meristemticas com 32 cromossomos e B clulas do endosperma com 96 cromossomos? 32. As plantas diplides produzem gametas normalmente e, na dupla fertilizao, originam o embrio e o endosperma. Utilizando ento o endosperma, amilceo (Su) e doce (su), para caracterizar tecidos triplides verifique qual a constituio genotpica do endosperma a partir do cruzamento entre plantas com fentipo amilceo x doce, sendo que o fentipo amilceo dominante sobre doce. 33. A cor amarela no endosperma do gro de milho dominante sobre a cor branca. O endosperma derivado da fecundao do mesocisto por um dos ncleos reprodutivos do gro de plen. Se a constituio gentica do mesocisto for yy e houver fecundao por outro y a cor ser branca. Entretanto, se o mesocisto for YY e for fecundado por Y ento a cor ser amarela. A intensidade da cor variar com a quantidade de alelos Y. Da mesma forma, o alelo Y soma 2,20 unidades de vitamina A/g (UVA/g) a quantidade bsica de 0,05 UVA/g nos gros de milho cuja combinao allica yyy. Determine a cor do gro e a quantidade de UVA/g usando todas as combinaes possveis a partir da fecundao do mesocisto pelo ncleo do gro de plen (Fonte: PATERNIANI, E. Gentica e melhoramento do milho. Cap.4. In: KRUG et al. Cultura e adubao do milho. So Paulo: Instituto Brasileiro de Potassa. 1966. p.109-151).

Mitose, Meiose, Monohibridismo, Dihibridismo e Polihibridismo


34. Considerem que uma planta possua 2n = 32 cromossomos, diga: A) B) C) D) Quantos cromossomos tero no final da mitose e da meiose? Quantas cromtides tem cada clula desse vegetal que sofre diviso? Quantos centrmeros uma clula dessa planta possui quando est em metfase? Quantos cromossomos tero as clulas me do gro de plen e quantos no micrsporo

35. Considerem que uma planta de soja possua 2n = 40 cromossomos, diga:

A) B) C) D)

Quantos cromossomos tero no final da mitose e da meiose? Quantas cromtides tm cada clula desse vegetal que sofre diviso? Quantos centrmeros possuem uma clula dessa planta que est em metfase? Quantos cromossomos tero as clulas-me do gro de plen e quantos no micrsporo?

As plantas de trigo possuem 2n =7x = 42 cromossomos, portanto, responda as mesmas perguntas da questo anterior para essa cultura. 36. Em Coleus blumei as clulas somticas so diplides e possuem 24 cromossomos. Quantos, de cada um dos seguintes, esto presentes em cada clula no estgio de mitose ou meiose indicados: (Fonte: BURNS, G. W. Gentica. Uma Introduo Hereditariedade, 1984. p.94). A) B) C) D) centrmeros na anfase? centrmeros na anfase I? cromtides na metfase I cromtides na anfase? E) cromossomos na anfase? F) cromossomos na metfase? G) cromossomos no final da telfase I e na telfase II?

37. Certa planta tem 8 cromossomos nas clulas de suas razes, um par metacntrico comprido, um par metacntrico curto, um par acrocntrico longo e um par acrocntrico curto. Em sua meiose quantos destes cromossomos aparecero nas clulas resultantes. Demonstre o processo por desenho. 38. Considere a existncia de um atraso cromossmico na meiose da planta da questo anterior, de forma que um cromossomo do par metacntrico comprido seja perdido. Como ficaro as clulas dos micrsporos, produzidas por meiose? 39. Responda: a) Estabelea uma relao entre a duplicao do DNA e as cromtides-irms. b) A formao de anexos vegetais, como gavinhas, por exemplo, ocorre devido alongamento da epiderme nas plantas que a possuem. Qual a origem celular desses acessrios nas plantas? c) No teu entendimento, qual a importncia da formao das ttrades na microsporognese? De onde, imediatamente, derivam? d) Quais os pontos semelhantes entre a microsporognese e a megasporognese? 40. Relacione todos diferentes gametas que podem ser produzidos pelos seguintes indivduos: a) AABBCc b) aaBbCc

10

c) AABbCcddEeFf d) AABBCCDDEEFFGGHHIi (Fonte: BURNS, G. W. Gentica. Uma Introduo Hereditariedade, 1984, p.95) 41. Responda: a) O que um indivduo, ou uma populao, homozigota? b) O que um indivduo, ou uma populao, heterozigota? 42. Um indivduo heterozigoto para dois pares de genes que esto situados no mesmo par cromossmico, A e B em um cromossomo com a e b situados no cromossomo homlogo. (a) Quantos e quais os gentipos gamticos esse indivduo pode produzir, caso no haja crossing-over? (b) Havendo crossing-over, quantos gentipos gamticos sero produzidos por esse indivduo? (c) Faa o mesmo raciocnio quando forem considerados 3 genes que estejam no mesmo cromossomo. (Fonte: BURNS,W. Gentica. Uma Introduo Hereditariedade, 1984. p.95) 43. A relao entre cromtides recombinadas e no recombinadas de, no mximo, 50 %. Quantas cromtides devero mostrar recombinao para que a relao chegue a 25% numa clula onde o nmero somtico 2n=24? 44. Um indivduo heterozigoto para os 4 pares de genes A, B, C e D. Os alelos A e B esto no mesmo par de cromossomos homlogos, enquanto que C e D esto juntos no outro par de homlogos. Preveja quais os tipos de gametas que esse indivduo produz considerando uma permuta entre A e B somente. Quais os tipos de gametas se em ambos cromossomos houver uma permuta? 45. Se indivduos da populao F2 com gentipos heterozigotos forem cruzados entre si a proporo de homozigoto e de heterozigoto na F3 se manter? Demonstre isso a partir do cruzamento das geraes paternais. 46. Em uma determinada planta o cruzamento, prpura x azul d uma prole com flores prpura e azul, em igual proporo, mas azul x azul d prole azul. (a) Caracterize os tipos dos cruzamentos que foram realizados e demonstre quais so os gentipos das plantas com flores azul e prpura? (b) Qual o fentipo dominante? (Fonte: BURNS, G. W. Gentica. Uma Introduo Hereditariedade, 1984, p.33) 47. Em cevada a presena e ausncia de aristas nos gros dependente de um gene K. K que determina a ausncia dominante sobre seu homlogo k que determina a presena das aristas. Variedades homozigotas com e sem aristas foram cruzadas entre si. (a) Qual o fentipo das plantas em F1 e a freqncia fenotpica em F2? (b) Como se poder determinar a constituio gentica das plantas em F2?

11

48. Duas vacas pretas (Polled angus) foram cruzadas vrias vezes com o mesmo touro amarelo (Caracu). Da primeira resultaram 3 terneiros amarelos e 2 pretos. Da segunda obtiveram todos os 6 descendentes de cor preta. Determine a relao de dominncia e o gentipo de cada bovino mencionado. 49. Do cruzamento de vrias plantas de ervilhas, obtiveram-se os seguintes resultados? a) alta x alta = 324 altas e 110 baixas b) alta x baixa = 392 altas e 401 baixas c) alta x baixa = 427 altas Determine a relao de dominncia e o gentipo de cada vegetal. 50. STEWART (1960) estudando o tipo de herana que ocorre nas cores das brcteas em Poinstia (Euphorbia pulcherrima Wild) realizou cruzamentos diversos entre plantas que possuam flores com brcteas vermelhas com as que as apresentavam brancas, e obteve os seguintes resultados: Cor das brcteas Cruzamentos a) Ruth Ecke autopolinizao b) Ruth Ecke F2 c) White Ecke autopolinizao d) (White Ecke autop) X White Ecke e) White Ecke F2 f) White Ecke X Ruth Ecke g) (White Ecke x Ruth Ecke) X Ruth Ecke h) (White Ecke x Ruth Ecke) X white Ecke i) (White Ecke x Ruth Ecke) F2 Vermelhas 51 70 0 0 0 151 236 40 266 Brancas 0 0 59 78 115 1* 2* 37 96

* Valores desconsiderado para estabelecer alguma proporo. Provavelmente a ocorrncia de uma mutao, por isso deve ser desconsiderada para efeito de clculo. Baseado nos dados acima determine o alelo dominante e o gentipo de cada planta que fez parte dos cruzamentos. (Fonte: STEWART, R. N. The Journal of Heredity, 51(4), 1960). 51. Usando as combinaes superiores, diga qual o tamanho da populao necessria quando consideramos 4 pares de alelos envolvidos. E qual ser o nmero de fentipos de F2 supondo-se dominncia completa em todos os loci e ainda qual ser o nmero de gentipos em F2? Prediga ainda os resultados quando tivermos 5 e 6 pares de alelos envolvidos, para as mesmas perguntas.

12

52. Qual o nmero de fentipos seriam obtidas na prole de um cruzamento de Coleus blumei com gentipo DdIiWwYy, considerando: a) Dominncia completa em todos os loci? b) Co-dominncia em todos os loci? c) Dominncia completa nos dois primeiros e co-dominncia nos dois ltimos? 53. Responda: a) Qual a diferena entre a dominncia completa e a co-dominncia quanto ao nmero de fentipos que aparecem em F2? Justifique. b) Se dois indivduos da F2 com gentipos heterozigotos forem cruzados entre si, a proporo de F3 se manter como a da gerao anterior? Demonstre a partir de um cruzamento desde as geraes paternais. 54. Mendel cruzou ervilhas que produziam sementes lisas com ervilhas que produziam sementes rugosas. De um total de 9.324 sementes na F2, 6.474 eram lisas e 2.850 eram rugosas. Utilizando os smbolos Ww para os genes, responda: (a) qual o cruzamento P original; (b) quais so os gametas; (c) como a constituio genotpica e fenotpica da F1; (d) represente um cruzamentos de duas plantas F; (e) simbolise os gametas; (d) apresente os resultados para F2: fentipo, gentipo, freqncia genotpica e razo fenotpica. Faa o Teste de hiptese e aplique o Teste do Qui- quadrado. 55. A cor do tegumento dos gros de lentilhas (Lens culinares) marrom e verde e a forma do gro lisa e rugosa. A situao abaixo demonstra a segregao de F2 para a cor do tegumento e do retrocruzamento realizados. Baseado nesses dados, elabore hipteses de trabalho para ambos os cruzamentos e determine o intervalo da probabilidade (P) usando o teste do qui-quadrado para testar as hipteses. Marrom lisa Grupo F2 RC1 RC2 144 200 50 Fentipo Marrom rugosa Verde lisa 56 32 52 28 Verde rugosa

56. Em pssaros as penas sedosas so determinadas por um gene cujo efeito recessivo em relao aos de penas normais. (a) se de um cruzamento entre indivduos heterozigticos para tal gene se criassem 395 aves, quantos se espera que sejam sedosos e quantos normais? (b) se tivesse uma ave com penas normais, qual seria o caminho mais rpido para se determinar se ela heterozigtica ou homozigtica para tal gene?

13

57. Responda: a) O que significa teste de prognie? b) O que determina o teste do retrocruzamento? c) possvel se transferir genes de uma planta para outra atravs do cruzamento simples? Se sim, como isso se operaria? d) Por que necessria a utilizao de dados estatsticos em cruzamentos de plantas? e) Como se pode conceituar espcies de plantas? 58. Foram realizados cruzamentos entre linhagens homozigotas derivadas de cruzamentos entre as espcies Lycopersicon esculentum x L. peruvianum para estabelecer a herana para resistncia a murcha bacteriana em tomate (TSWV) e encontraram em F2 551 plantas resistentes e 163 suscetveis. O retrocruzamento com o pai suscetvel apresentou a proporo e 194: 222 (resistente: suscetvel) e com o pai resistente apenas 353 plantas todas resistentes. Usando o smbolo criado pelo autor, SW5, para resistncia a doena, determine o tipo de herana, diagrame os cruzamentos a partir a gerao paternal e teste os valores observados. 59. Foi estudada a herana da resistncia raa 73 de antracnose causada por Colletotrichum lindemuthianum em cultivares de feijo, no sul de Minas Gerais. Duas cultivares, suscetvel e resistente, foram utilizadas no cruzamento paternal. A F1 demonstrou resistncia raa 73 do patgeno e a F2 segregou na proporo de 155: 50. Determine se a proporo de carter mendeliano e diga qual o comportamento segregante da F1 com o progenitor resistente e com o suscetvel. O autor sugere que o gene para resistncia seja simbolizado por Co-6. (Fonte: PAULA Jr., T. et al. Revista Ceres. Viosa, 44(254): 480-487, 1997). 60. O alelo Ms do gene para macho esterilidade dominante sobre ms que determina fertilidade em gros de plen de milho. O alelo G determina a cor branca dos cotildones, enquanto que seu alelo recessivo g determina cotildones verdes. Baseado nesses dois genes determine a proporo de indivduos frteis a partir do cruzamento de uma planta MsMsGG com msmsgg. 61. O tegumento verde na semente da soja controlado pelo gene G, que dominante sobre g que determina tegumento amarelo. Esses mesmos genes controlam leso noclortica e clortica, respectivamente, quando a planta suscetvel a septoriose. Do cruzamento de uma planta de tegumento verde com outra de tegumento amarelo, qual a proporo de plantas com manchas clorticas e no-clorticas, se elas forem atacadas pela septoriose?

14

62. Responda: a) O que efeito de pleiotropia gnica? b) Sob o ponto de vista bioqumico molecular, como pode um gene participar de mais de um efeito fenotpico? 63. Quatro das plantas autofecundadas de F1 que Mendel observou segregavam para cor amarela e verde do tegumento da semente. A tabela abaixo demonstra o resultado: Plantas Sementes Amarelas Verdes 1 25 11 2 32 7 3 14 5 4 70 27

Determine a homogeneidade das quatro plantas para a proporo : e veja se possvel somar os dados para calcular o Qui-quadrado. 64. Em ervilhas de jardim o efeito do alelo para planta alta T dominante sobre o alelo para planta baixa t e o efeito do alelo para semente lisa S dominante sobre o alelo para rugosa s. Tambm se sabe que estes genes segregam-se independentemente. (a) que proporo fenotpica espera-se entre a descendncia de plantas da F1 altas e de sementes lisas cruzadas entre si (derivadas de genitores homozigticos para ambos os genes)? (b) haveria variao nos fentipos da gerao F se as plantas da F1 derivassem de pais Ttss com ttSS? (c) que resultados fenotpicos se esperariam do cruzamento entre plantas da F1 com plantas baixas e de sementes lisas? 65. Um lote de sementes foi obtido de duas populaes homozigotas cujas cores das flores eram brancas e amarelas. Em F2 resultaram 305 plantas com flores brancas e 97 amarelas. Aps o melhorista introduziu outro marcador gentico a essa populao e obteve 299 plantas normais e 131 plantas varigegadas. Sendo a branca dominante sobre amarela e normal sobre variegada qual a probabilidade de se aceitar a hiptese de genes independentes para ambas caractersticas juntas? 66. Dois genes independentes esto segregando numa populao de plantas. O gene para razes adventcias, recessivo, segregou em 32 razes adventcias e 97 razes normais. O outro gene que determina a presena de acleos, quando estudado sozinho, segregou em 35 plantas sem acleos, 78 com acleos pequenos e 30 com acleos longos. Se esses genes forem estudados juntos, na mesma populao, quantos se esperariam de cada fentipo numa populao de 2325 plantas?

15

67. MENEZES (1953) pesquisou a herana de caractersticas contrastantes em variedades de batata doce, como rama verde e arroxeada; casca branca e arroxeada e polpa branca e creme, na Seo de Gentica do Instituto de Ecologia e Experimentao Agrcola do Ministrio da Agricultura, no Rio de Janeiro e se obteve os seguintes resultados: Quadro 1 Herana da cor das ramas em F2 Cor das ramas Verde Arroxeada Quadro 2 - Herana da cor do tubrculo Cor do tubrculo Branco Arroxeado Quadro 3 - Herana da cor da polpa Cor da polpa Branca Creme

N de plantas 70 26

N de plantas 68 28

N de plantas 67 27

Baseado nessas trs tabelas defina a herana de cada uma das caractersticas. Proponha uma nomenclatura gentica e teste os valores pelo teste do 2. (Fonte: MENEZES, O B. Revista Ceres, 51:189-193, 1953). 68. Utilizando os dados da tabela abaixo (gerao F2) determine a independncia dos genes e os gentipos dos pais e da F1(Fonte: MENEZES, O B. Revista Ceres,51:189193,1953). Fentipos Raiz branca e polpa branca Raiz branca e polpa creme Raiz roxa e polpa branca Raiz roxa e polpa creme N de plantas 49 19 20 8

69. WANN e HILLS (1973) estudaram dois genes de natureza fisiolgica em tomate. Um responsvel pelo transporte de ferro (fer) e outro pelo de boro (btl), ambos recessivos. O quadro abaixo demonstra o nmero de plantas resutantes dos cruzamentos entre as linhagens

16

Cruzamentos Normal Cruzamento A F1 F2 BC1 BC2 Cruzamento B F1 F2 BC1 BC2 54 61 25 103 41 119

Fentipos/ n de plantas btl fer 28 278 30 27 35 38 -

btl/fer 85 52 12 34 -

Determine o gentipo dos pais e, a independncia dos genes no cruzamento B pelo teste do 2. (Fonte: WANN, E. V. e HILLS, W. A. The Journal of Heredity, 64: 370-371, 1973).

70. Responda: a) Qual o objetivo de se testar os valores na segregao fenotpica de F2 pelo teste do qui-quadrado? b) Esse teste aplica-se somente a gerao F2 ou pode ser aplicado em outra gerao? Se sim, qual a gerao? 71. Plantas de milho resistentes a Helmintosporium turcicum possuem o alelo Ht do gene para resistncia. Da mesma forma o gene Rt determina a resistncia a P. sorghi e o gentipo ag ag condiciona plantas resistentes ao ataque de gafanhotos. Se plantas resistentes a todas as caractersticas so cruzadas com plantas suscetveis qual a probabilidade de, em F2, aparecer plantas suscetveis a Helmintosporium turcicum e resistentes aos demais fatores estudados? E qual a probabilidade de aparecerem plantas somente suscetveis ao ataque de gafanhotos? 72. Um pesquisador encontrou certas variedades de linho que mostram distintas resistncias a cepas especficas de um fungo chamado ferrugem do linho (Melampsora lini). Por exemplo, a variedade de linho 770B resistente raa 24 da ferrugem, porm suscetvel a raa 22, enquanto que a variedade Bombay resistente raa 22 e suscetvel a 24, para o mesmo fungo. O pesquisador cruzou ambas as variedades entre si e encontrou um hbrido resistente as raas 22 e 24, ao mesmo tempo. A gerao F2 produziu os seguintes fentipos, a partir dos cruzamentos de F1 x F1:

17

Raa 22 Resistente Raa 24 Suscetvel 32 9 (a) Proponha hipteses que expliquem a base gentica da resistncia ferrugem do linho, para cada uma das raas, independentemente. (b) Baseando-se em suas hipteses que valores se esperariam para as quatro categorias na F2? (c) Prove sua hiptese pelo teste do 2. (Fonte: SUZUKI, D. T. et al. Introduo Gentica. 4.ed. 1992, p.95). 73. Em 1901 Bateson realizou o primeiro estudo psmendeliano de um cruzamento que diferia em dois caracteres. Cruzou galinhas brancas Leghorn, com cristas grandes inteiras e de penas brancas com aves Indian Game com cristas pequenas em ervilha e de penas escuras. A F1 era branca com cristas em ervilha. Um cruzamento entre essas F1 resultaram na seguinte descendncia, em F2: 52 brancas, em ervilha, 17 brancas, inteiras, 14 escuras, em ervilha e 8 escuras, inteiras. (a) Determine a significncia ou no dos valores pelo teste do Qui-quadrado. (b) Que valores se esperariam para cada um dos tipos descritos? 74. Baseando-se nos dados do problema anterior, que fentipos e que proporo se esperaria obter se se cruzasse a F1 com: a) Com a raa White Leghorn ? b) Com a raa Indian Game? c) Com as da F2 com penas escuras e crista inteira? 75. Se a cor do tegumento dos gros de lentilha (Lens culinares) for marrom e verde e se a forma for redonda e rugosa, responda a seguinte situao: Considere 3 grupos A, B, C de lentilhas marrons e redondas. Cada grupo foi plantado e cruzado com plantas originadas de uma ervilha verde, rugosa. Exatamente 200 lentilhas resultante de cada cruzamento foram classificadas como se segue: Fentipo Marrom redonda Amarela rugosa Verde redonda Grupo A B C 101 200 50 99 53 52 45 Resistente 110 Suscetvel 43

Verde rugosa

Baseado nos dados do quadro acima, defina os gentipos das geraes paternais A, B e C e teste os valores pelo teste do qui-quadrado, determinando o intervalo da probabilidade (P).

18

76. Em soja h cultivares que possuem nodulao diferencial estirpe de Rhizobium. A cultivar A nodulada apenas pela raa 33, enquanto a cultivar B o pela 61. Das 3328 plantas obtidas na F2, quantas pode se dizer que no sero noduladas por nenhuma das raas. As plantas noduladas pela raa 33 possuem genes rj3 rj3 e plantas noduladas pela 61 apresentam genes rj4 rj4. Os alelos dominantes demonstram pouca ou nenhuma nodulao. Represente o cruzamento. 77. Responda: a) As descries genticas so feitas com base nos indivduos recessivos. Explique o porqu disso. b) O que so genes de ao independente? H outra forma de ao gnica? Se houver, qual ? 78. Dois genes determinam a resistncia raa 1 e 2 de Cercospora sojina. O gene Res1 e Res2 promovem a resistncia, respectivamente. Seus alelos recessivos determinam suscetibilidade. O cultivar Lincoln suscetvel raa 2, enquanto que o Kente a raa 1. Qual a probabilidade do aparecimento de plantas resistentes a ambas as raas numa populao de 10.000 plantas, originadas do cruzamento de hbridos provenientes de pais homozigotos resistente e suscetvel. 79. Pelo menos trs genes de ao independente esto envolvidos na resistncia a Puccinia coronata em aveia. As variedades resistentes raa 1 so Bond, Santa F, Victria e Landhafer, entretanto Bond e Victria so suscetveis raa 101, enquanto as outras so resistentes. Os gentipos que conferem suscetibilidade a raa 101 a resistncia raa 1 para a variedade Victria VVllmm e para resistncia as mesmas raa para a Landhafer vvLLmm. Qual a probabilidade de se obter resistncia as duas raas cruzando-se Victria, com Landhafer. (Fonte: POELHMAN, J. M. 1974. p.164). 80. Em tomateiros fruto vermelho R dominante sobre fruto amarelo r; fruto biloculado P dominante sobre fruto poliloculado p e fruto de pele lisa L dominante sobre fruto de pele rugosa l. Baseado nesses dados responda: a) Qual ser o fentipo da planta RrppLL? b) Qual ser(o) o(s) gentipo(s) de planta(s) com frutos vermelhos, poliloculados e de pele lisa? c) Se cruzarmos uma planta RrPpLl com outra idntica, quanto ao gentipo, que proporo de plantas descendentes espera-se que tenha: fruto vermelho, poliloculado e pele lisa? Fruto amarelo, biloculado e pele rugosa?

19

Interao Gnica Alelismo Mltiplo, Epistasia e Herana Citoplasmtica


81. Responda: a) O que significa interao allica? b) Quantos genes so necessrios para haver uma interao? c) O que significa interao gnica? d) Como se pode distinguir epistasia do dihibridismo? 82. A altura das plantas de soja pode ser condicionada por uma srie allica de genes. O alelo S determina altura reduzida; s altura normal e st altura aumentada, sendo a seguinte a ordem de dominncia: s > S > st. Realize o cruzamento entre uma planta normal, portadora do alelo para planta reduzida, com outra de altura tambm normal, porm portadora do alelo para aumentada, e diga quais os fentipos obtidos e em que freqncia. 83. A srie allica V participa da formao da cor das vagens, junto com os alelo A, aa e a. O gene V junto com aa e junto com a produz vagens estriadas e rosa normal, respectivamente; com A produz vagens amarelas, que tambm determinada por, vlae e v junto com aa e a, porm vlae- A- e vvA- produz vagens vermelhas. Partindo desses dados determine a cor das vagens, em F2 do seguinte cruzamento: VV aa aa x vlae vlae AA. (Fonte: MORAES, C. F. e VIEIRA, C. Revista Ceres.Viosa, 86(15):199-209, 1968). 84. Sabe-se que um par de alelos codominantes controla a cor da folha cotiledonar da soja. O gentipo homozigoto CgCg determina a cor verde escura, o gentipo CyCy determina folhas amarelas, sendo o heterozigoto verde claro. O homozigoto amarelo tem deficincia em clorofila que jamais chega maturidade. (a) Se plantas verde escuras so cruzadas com plantas verdes claras, quais sero as propores fenotpicas da descendncia em estgio de plntula e qual em estgio de planta adulta? (b) Se plantas verdes claras so cruzadas entre si, quais sero as propores fenotpicas da descendncia em plntula e em estgio adulto? 85. A forma e a cor de rabanetes so controladas por dois pares independentes de alelos que no apresentam dominncia; cada gentipo distinguvel fenotipicamente. A cor pode ser vermelha (RR) ou branca (R`R`) e prpura (RR`) e a forma pode ser longa (LL), oval (LL`) ou arredondada (L`L`). Usando o mtodo do quadrado de Punnet, esquematize um cruzamento entre rabanetes vermelhos, longos (RRLL) e brancos arredondados (R`R`L`L`) e apresente os resultados dos fentipos, gentipos e freqncia fenotpica da F2.

20

86. Determine a ordem de dominncia dos seguintes alelos P prpura, P1 turquesa e P2 azul, para flores boca-de-leo, cujos resultados dos cruzamentos esto na tabela abaixo: Cruzamentos 1 2 3 4 Genitores Prpura x azul Prpura x prpura Azul x azul Prpura x turquesa Descendncia Todas prpuras 76 prpuras e 25 turquesas Todas azuis 49 prpuras e 52 turquesas

87. Nas plantas denominadas dondiego de la noche (Mirabilis jalapa) o alelo para cor roxa das flores tem um efeito que incompletamente dominante sobre o seu homlogo branco. Se um cruzamento entre duas plantas produziu 18 plantas roxas, 32 plantas rosa e 15 brancas. (a) Elabore o teste de hipteses; (b) Teste os valores pelo teste do Qui-quadrado; e (c) Determine os gentipos e os fentipos dos progenitores. 88. Foram cruzadas duas linhagens de ervilhas de flores brancas produzindo uma F1 de flores prpuras. O cruzamento aleatrio entre a F1 produziu 96 plantas, 53 com flores prpuras e 43 com flores brancas. Pergunta-se: (a) Aproximadamente qual a proporo fenotpica da F2? (b) Que tipo de interao est envolvida? (c) Quais foram os provveis gentipos das linhagens parentais? (d) Se for aplicado o teste do qui-quadrado, haver significncia dos valores? 89. O plen de plantas de tomates virescentes (amarelecentos devido a deficincia e clorofila) foi utilizado para fecundar uma planta normal verde (com produo normal de clorofila). Todos os hbridos se apresentaram de cor verde normal. Ao cruzar um desses hbridos com uma planta de cor virescente se obteve uma prognie formada por 112 plantas verdes e 72 plantas virescentes. Que concluso se pode obter com tal resultado sobre o tipo de interao que est ocorrendo nesse caso? 90. Em populaes de feijo (Phaseolus vulgaris) dois genes aparecem para determinar a cor do tegumento das sementes. Na contagem das sementes imaturas foram encontrados os seguintes fentipos e suas quantidades: sementes esverdeadas 450 e sementes azuladas 150. Baseado nesses dados responda (a) que tipo de interao est ocorrendo? (b) qual a proporo fenotpica esperada para essa interao?

91.Hagiwara, um pesquisador japons indicou que a cor prpura da flor dondiego de dia
japons (Pharbitis nil) pode ser determinada por qualquer um de dois pares de genes separados, por exemplo A- bb ou aaB-. Quando esto presentes os alelos dominantes de ambos os pares de genes (A- B-) as flores so de cor azul e quando ambos so homozigotos recessivos (aa bb) so de cor escarlate. Desse modo se obteve uma F1 de cor azul cruzando-se dois tipos prpuras distintos AA bb x aa BB. Pergunta-se: a) Que fentipos e em que proporo se esperaria do curzamento da F1 com qualquer uma das flores paternais? b) Que fentipos e em que proporo se esperaria de um cruzamento de plantas F1s entre si? (Fonte: SUZUKI, D. T. et al. Introduo Gentica. 4.ed. Rio de Janeiro. Guanabara Koogan. l992. 633p.).

21

92. Duas variedades de milho doce com baixo teor de amido na semente foram cruzadas e
obtiveram sementes no translcidas (alto teor de amido normal). Uma das variedades apresenta o gene ae (amylo extender) e a outra variedade possui o gene wx (waxy). Determine: (a) o tipo de interao que est ocorrendo; (b) a frequncia fenotpica em F2. 93. Plantas boca-de-leo (Anthirrinun majus) possuem genes que condicionam a formao da flor terminal. O alelo Cen codifica um fator de transcrio que impede a expresso do alelo Flo, para a identidade floral. Plantas com gentipo CenCen flo flo so cruzadas com plantas cujo gentipo cencen FloFlo. Determine a proporo fenotpica em F2 quanto a presena e ausncia de flor terminal. 94. A cor branca em abboras determinada por um gene dominante W, e frutos coloridos por seu alelo recessivo w. Na presena de ww e de um alelo dominante, G, a cor amarela, mas quando G est ausente, isto , gg est presente, a cor verde. Digam quais sero os fentipos da F2 e as propores esperadas de um cruzamento entre uma planta com frutos brancos WWGG e uma com fruto verde wwgg. 95. Se for necessrio selecionar 30 abboras de cor branca, qual ser o total da populao de abboras necessrias para esta seleo? Se os frutos a serem selecionados forem verdes e na mesma quantidade, qual ser o total da populao? 96. Os genes du (dull) e su (sugary) condicionam aumento de 35 e 40% de amilose, em gros de milho, respectivamente. A combinao su du produz at 60% de amilose, porm quando o su est em homozigose h uma reduo na taxa de amido. Os genes alelos produzem 100% de amilose. Partindo do cruzamento de plantas SuSu dudu com susu DuDu qual ser a proporo em F2 quanto a produo de amido? (PATERNIANI, E. Gentica e melhoramento de milho. In. KRUG et al Cultura e adubao do milho. So Paulo: Instituto Brasileiro da Potassa. 1966 p.109-151.) 97. Outro alelo para a produo de amido nos gros de milho pode ser o ae (amylose extender) que junto como su (sugary) condiciona gros enrugados translcidos. No duplo recessivo o teor de amido alto. Do cruzamento de homozigotos de gros translcidos com no translcidos qual ser a proporo fenotpica em F2? Que tipo de interao est ocorrendo? (PATERNIANI, E. Gentica e melhoramento de milho. In. KRUG et al Cultura e adubao do milho. So Paulo: Instituto Brasileiro da Potassa. 1966 p.109-151). 98. Plantas de milho com gentipo para gros no translcidos foram cruzadas com plantas cujos gros possuem ausncia de amido. As primeiras plantas possuem alelo ae do gene amylose extender, enquanto que as segundas possuem o alelo wx, do gene waxy. Considerando que os gros no translcidos dominam os vazios, qual ser a proporo fenotpica em F2 para uma populao de 3200 plantas. Baseado no resultado dessa populao determine a independncia dos genes.

22

99. Dois genes diferentes atuam na absoro e na utilizao de ferro (Fe) em plantas de milho. O gene ys1 reduz a absoro de ferro nas pontas das razes, enquanto que o gene ys3 permite a absoro, mas acumula-o nas clulas das razes. Plantas com gentipo ys1ys1 que tiveram suas folhas pulverizadas com soluo de ferro ficaram verdes em 48 horas, j as plantas com gentipo ys3ys3 necessitaram de 6 dias para ficarem verdes. Baseado nesses dados o cruzamento de plantas verdes normais com plantas que tm deficincia na absoro e metabolizao do ferro, resultar em que quantidade, na gerao F2 numa populao de 2500 plantas de milho? (PATERNIANI, E. Gentica e melhoramento de milho. In. KRUG et al Cultura e adubao do milho. So Paulo: Instituto Brasileiro da Potassa. 1966 p.109-151). 100. Baseado nos dados anteriores qual ser o resultado em F2 de plantas que tem somente dificuldade na absoro de ferro, partindo do cruzamento de plantas normais com deficientes? 101. Baseado nos dados da tabela seguinte determine o(s) gentipo(s) possvel (ies) para os cruzamentos entre linhagens de lentilha considerando a cor do cotildone como caracterstica em estudo e utilizando a seguinte nomenclatura e relao: Yc condiciona cotildones vermelhos > yc que condiciona amarelo. Iyc no inibe nenhum dos alelos da cor > iyc que inibe os alelos da cor, produzindo cor verde dos cotildones. Freqncia fenotpica em F2 vermelha amarela verde a) vermelho x amarelo 154 61 0 b) verde x amarelo 0 160 41 c)amarelo x verde 0 145 36 d) vermelho x verde 109 43 35 e) verde x vermelho 121 41 37 (Fonte: SKLINKARD, A. E. The Journal of Heredity, 69:139-140, 1978). 102. Baseado nos dados da questo anterior. Em Lens esculentum a cor dos cotildones pode ser vermelha, amarela ou verde. O cruzamento de uma linhagem de cor verde com outra vermelha segregou, em F2, 121 gros de cor vermelha, 41 amarelos e 37 verdes (item e). Diga a que proporo fenotpica pertence a segregao acima. 103. Em Phaseolus lunatus existe o gene Ih, dominante, que ativador do gene Gr, dominante, para a cor marrom, em vagens maduras. O alelo ih, recessivo, inibidor da cor marrom, produzindo vagens verdes apenas. O alelo gr, recessivo, produz igualmente a cor verde, independente do ativador/inibidor. Das 1.782 vagens colhidas em F2, resultante do cruzamento de dois hbridos F1 marrons, quantas vagens tero cor verde e quais os gentipos e fentipos das geraes paternais? (Fonte: HONNA, S. et al. The Journal of Heredity, 59(4):243-244, 1968). Fentipo dos pais

23

104. O gene lw1 lw1 em homozigose apresenta fololos com borda ondulada, enquanto que os alelos complementares Lw1 Lw1 condicionam fololos normais, em plantas de soja. O gene T condiciona pubescncia marrom e t cinza, sendo esse episttico sobre lw1 lw1 e alterando a forma do fololo, de ondulado para normal. Determine a proporo, em F2 do cruzamento de uma planta com pubescncia cinza e fololos normais com outra de pubescncia marrom e fololos ondulados, ambas homozigotas para os dois genes. 105. Em algumas plantas, como no milho, h um gene recessivo em um cromossomo que se acha em homozigose. Juntamente a esse, outro gene dominante, em outro cromossomo, produzem plantas de cor branca estando em homozigose ou em heterozigose. Qualquer outra combinao allica resulta em plantas coloridas. Que propores de plantas brancas se obter entre a prognie de uma planta autofecundada, mas que seja heterozigota para ambos os genes?

106. Considere a seguinte rota biossinttica, controlada geneticamente, em uma planta: Gene A Enzima A Gene B Enzima B Gene C Enzima C

Po>>>>>>>>> P1>>> >>>>> P2 >>>>>>>>> P3 Suponha que o gene A controla a converso de um pigmento branco Po para outro branco P1; o alelo dominante A codifica a enzima necessria para catalisar esta converso, mas o alelo recessivo a, codifica uma enzima defeituosa (inativa). O gene B controla a converso do pigmento branco P1 para um pigmento cor de rosa P2, novamente o alelo dominante B produz a enzima necessria para a converso P1---P2, mas o alelo recessivo b produz uma enzima inativa. O alelo dominante C, de um terceiro gene, codifica uma enzima que catalisa a converso do pigmento P2 para um pigmento P3 vermelho, seu alelo recessivo c produz uma enzima alterada sem atividade. O alelo dominante D, de um quarto gene, produz um produto que inibe completamente a atividade da enzima C, isto , bloqueia a reao P2---P3. Seu alelo recessivo d produz um produto gnico defeituoso, que no bloqueia a reao P2---P3. Considere que a cor da flor determinada unicamente por estes quatro genes, e que eles se segregam independentemente. Na F2 de um cruzamento entre plantas com gentipo AAbbCCDD e plantas com gentipo aaBBccdd, qual a proporo esperada de plantas com (a) flores vermelhas? (b) flores cor de rosa? e (c) flores brancas?

24

107. Responda: a) O que macho-esterilidade? b) Que tipos de macho esterilidade existem? c) Que descoberta permitiu que a macho esterilidade se tornasse frtil d) A esterilidade citplasmtica influencia mais no gameta masculino ou no feminino? Por que? e) De onde derivam os hbridos simples de milho? 108. Demonstre como possvel se obter plantas com citoplasma macho estril e frteis a partir do cruzamento de plantas normais com plantas macho estreis. Construa o(s) cruzamento(s) explicando cada um dos passos e os valores percentuais dos fentipos em cada uma das geraes. 109. O milho comercial resulta de um "cruzamento duplo". Partindo-se de quatro cultivares endgamas (A,B,C,D) faz-se o cruzamento entre A e B pelo crescimento de duas linhagens juntas e com a remoo da "vassoura" da linhagem A, de forma que A no se autofecunde e, assim, recebe plen de B. Em outra localidade qualquer, segue-se o mesmo procedimento em relao a C e D. Geralmente o rendimento de sementes hbridas monocruzadas baixo porque os genitores endgamos no tm vigor hbrido e produzem espigas pequenas. As plantas que germinam de semente monocruzadas geralmente so hbridas vigorosas com espigas grandes e muitos gros. No desejvel que hbridos monocruzados se autofecundem porque este processo de endogamia comumente produz prognie menos vigorosa. Assim, o cruzamento duplo efetuado aplicando-se o plen do hbrido CD sobre o hbrido AB. O corte manual da "vassoura" um processo cansativo e muito caro. Existe um fator citoplasmtico que impede a produo de plen. Existe tambm um gene nuclear dominante R que pode restaurar a fertilidade das plantas no citoplasma do macho estril. Proponha um mtodo para eliminar o corte manual do pendo na produo de sementes comerciais hbridas por cruzamento duplo. (Fonte: STANSFIELD, W. Gentica. 2 ed. McGrawHill. 1985. p. 270). 110. Plantas de milho macho estril podem ser produzidas por intermdio de genes cromossmicos ou por fator citoplasmtico. (a) Pelo menos 20 genes diferentes para macho estril so conhecidos, e todos so recessivos, por qu? (b) Prediga os resultados F1 e F2 da polinizao de um macho geneticamente estril por um normal. (c) E de um macho citoplasmaticamente estril por um normal. 111. Dada uma semente de uma variedade de milho macho estril, como voc determinaria se a esterilidade gnica ou citoplasmtica?

25

Ligao Fatorial e Mapeamento Cromossmico


112. Represente a ligao fatorial por associao e por repulso. 113. Na Drosophila a forma de olhos no formato de rim produzida pelo gene recessivo k localizado no cromossomo 3. A cor de olhos alaranjada produzida pelo gene recessivo cd localizado no mesmo cromossomo. Entre estes dois loci encontra-se um terceiro locus com o alelo recessivo e que produz a cor bano para o corpo. Fmeas homozigotas com olhos k e de cor alaranjada so acasaladas com machos homozigotos com corpo bano. As fmeas tribridas de F1 so ento submetidas ao cruzamento-teste para produzirem a F2. Entre a prognie F2 de 4 000 indivduos encontramos os seguintes: 176l kidney, cardinal; 1773 ebony; 128 kidney, ebony; 138 cardinal; 97 kidney; 89 ebony, cardinal; 6 kidney, ebony, cardinal; 8 selvagem. Determine a maneira de ligao destes genes e faa uma estimativa das distncias no mapa. (Fonte: STANSFIELD, W. Gentica. 2. Ed. McGraw-Hill, 1985 p.151). 114. Em cevada h variedades com duas fileiras de sementes nas espigas, que dominante sobre a de seis fileiras. A cor marrom da lema dominante sobre a branca. Ambos os genes se encontram no grupo de ligao I, com 19,4% de recombinao. Usando os smbolos V para duas fileiras, v para seis fileiras, P para cor marrom da lema e p para branca, realize o cruzamento entre variedades homozigotas dominantes com recessivas para esses dois genes ligados, determinando a proporo fenotpica em F2. 115. Os tomates alongados so produzidos por plantas homozigotas para o gene recessivo a, os frutos redondos so produzidos pelo alelo dominante neste mesmo locus (A). A inflorescncia composta resultante de um outro gene recessivo c, a inflorescncia simples produzida pelo alelo dominante deste mesmo locus (C). Uma cultivar denominada Pera amarela (c/frutos alongados e de inflorescncia simples) cruzada com a cultivar Cacho de Uva (c/frutos redondos e de inflorescncia composta). As plantas da F1 so cruzadas aleatoriamente para produzirem a F2. Dentre os 259 descendentes da F2 verificaram 126 redondas, simples; 63 redondas, compostas; 66 longas, simples; 4 longas, compostas. Faa uma estimativa da quantidade de recombinao aplicando o mtodo da raiz quadrada. (Fonte: STANSFIELD, W. Gentica. 2. ed. McGraw-Hill, 1985 p. 161). 116. Tomate, a planta alta (d+) dominante sobre a planta an (d), e a forma esfrica do fruto (p+) dominante sobre a forma pra (p). Os genes para a altura e forma do fruto esto ligados com 20% de crossing-over". Uma certa planta alta e de fruto esfrico cruzada com uma planta an e fruto em forma de pra produziu 81 plantas altas com frutos esfricos; 79 ans com frutos em forma de pra; 22 altas com frutos em forma de pra e 17 ans com frutos esfricos. Outra planta alta com frutos esfricos cruzada com uma planta an com frutos em forma de pra produziu 21 altas com frutos esfricos; 18 ans com frutos esfricos; 5 altas com frutos em forma de pera e 4 ans

26

com frutos em forma de pra. (a) Represente o arranjo dos genes nos cromossomos destas duas plantas altas com frutos esfricos. (b) Se as plantas hbridas cruzadas entre si, que classes fenotpicas se poderia esperar e em que proporo? (c) Numa populao de 1.000 plantas, quantas, de cada fentipo, deveriam aparecer, aproximadamente? 117. O gro de milho colorido dominante sobre o incolor; gros lisos so dominantes sobre os contrados. Uma variedade pura, colorida, lisa cruzada com uma variedade incolor, contrada. Na F2 encontramos 73% coloridos, lisos; 2% coloridos, contrados; 2% incolores,lisos e 23% incolores, contrados. Aplicando o mtodo da raiz quadrada, faa uma estimativa da porcentagem de permuta entre estes dois genes. (Fonte: STANSFIELD, W. Gentica. 2. ed. McGraw-Hill, 1985 p. 174). 118. De posse dos dados abaixo verifique a significncia de P, pelo teste do quiquadrado, para as seguintes caractersticas derivadas de retrocruzamento em tomate, onde um dos genitores possui frutos com bico e o outro spalas curtas: Fentipos Normais Spalas curtas Frutos sem bico Spalas curtas e frutos sem bico Quantidades 89 25 30 81

119. Dois genes recessivos no terceiro grupo de ligao do milho produzem folhas enroladas e plantas ans, respectivamente. Uma planta enrolada pura polinizada por uma planta an pura. A prognie F2 consiste de 104 normais; 43 ans; 51 enroladas e 2 ans, enroladas. Aplicando o mtodo da raiz quadrada, faa uma estimativa da quantidade de recombinao que se verifica entre esse dois loci. (Fonte: STANSFIELD, W. Gentica. 2. ed. McGraw-Hill, 1985 p. 174). 120. Existe 21% de permuta entre os locus p e o locus c, nos ratos. Suponha que 150 ovcitos primrios fossem selecionados para estudo da freqncia de quiasmas nesta regio do cromossomo. Em quantos ovcitos poderamos prever que ocorresse um quiasma entre dois genes? (Fonte: STANSFIELD, W. Gentica. 2. Ed. McGraw-Hill, 1985 p. 169). 121. Um gene bifurcado forked - (f) faz com que as cerdas ou pelos curtos sejam envergados ou divididos na Drosophila. Um outro gene outstretched (od) resulta em asas disposta em ngulo reto com o corpo. Um terceiro gene chamada garnet (g) produz olhos de cor rsea nas moscas jovens. Fmeas do tipo selvagem heterozigotas em todos os trs loci foram cruzadas com machos homozigotos resultaram em : 57 garnet, outstreched; 419 garnet, forked; 60 forked; 1 outstreched, forked; 2 garnet; 439 outstreched; 13 selvagens ; 9 outstreched, garnet, forked: total de 1 000 indivduos. Mostre: (a) qual o gene mediano? (b) calcule a distncia-mapa e (c) qual grau de interferncia? (Fonte: STANSFIELD, W. Gentica. 2. ed. McGraw-Hill, 1985. p. 171).

27

122. Dois cruzamentos entre feijes, para se entender a herana do hbito de crescimento e a resposta ao fotoperodo, foram realizados. As variedades envolvidas, K e F so de hbito de crescimento determinado e de dias neutros e a variedade Gig tem hbito de crescimento indeterminado e de dias curtos. Os cruzamentos (1) K x Gig e (2) F x Gig foram realizados e as F2s mostraram a seguinte segregao: Segregao Tipo Parental Tipo Recombinante Precoce Det. Tardio Indet. Tardio Det. Precoce Indet. 61 109 6 49 53 83 5 26

Cruzamentos (1) K x Gig (2) F x Gig

(a) Determine a significncia ou no das segregaes, tendo por base a Teoria de Mendel. (b) Se houver significncia, qual a freqncia de ligao entre os genes? Considere que hbito indeterminado dominante sobre determinado e que tardio dominante sobre precoce. (Fonte: COYNE, D. P. The Journal of Heredity, 58(6), 1967). 123. Se a intensidade de ligao entre dois loci for de 48%, qual ser a taxa de crossingover entre eles? 124. Os genes a e b ligam-se com 20% de crossing-over. Um indivduo a+b+/a+b+ foi cruzado com um ab/ab. (a) Represente o cruzamento nos cromossomos mostrando os gametas produzidos por cada genitor e ilustre a F1; (b) Que gametas podem produzir a F1 e em que proporo? (c) Se a F1 for cruzada com o duplo recessivo, que prole podese esperar e em que proporo? (d) Este um exemplo de atrao ou repulso? 125. Se o cruzamento original no problema acima fosse a+b\a+b x ab+\ab+, esquematize (a) o arranjo dos marcadores genticos nos cromossomos da F1, (b) os gametas produzidos pela F1 e suas propores, e (c) os resultados esperados para o cruzamento- teste. (d) um exemplo de atrao ou repulso? 126. Em Phaseolus lunatus L. o gene que determina o hbito de crescimento D (indeterminado) dominante sobre d (determinado) e dista do da forma da folha Wl (lanceolada), que dominante sobre wl (ovalada) em 2.1% e do da cor do tegumento R (vermelho escuro), que dominante sobre r (vermelho) em 39,3%. Baseado nesses dados determine a freqncia de gametas que um trihbrido (F1) poder produzir, para constituir a populao F2. (Fonte: ALLARD, R. W. e CLEMENT, W. N. The Journal of Heredity 50(2):63-67, 1959.). 127. O alelo Ms, para macho esterilidade dominante sobre ms, para fertilidade. O alelo G determina a cor branca dos cotildones enquanto seu alelo recessivo g a determina verdes. Ambos os genes foram estudados em Phaseolus lunatus L. e distam um do outro 43,1 unidades de mapa. Qual a probabilidade, em 1.000 plantas serem todas

28

frteis e com cotildones brancos, partindo do cruzamento de dois heterozigotos para ambos os genes em fase de associao? (Fonte: ALLARD, R. W. e CLEMENT, W. N. The Journal of Heredity, 50(2):63-67, 1959.). 128. Em milho, uma planta F1 completamente heterozigota era vermelha e tinha sementes normais. Esta planta foi cruzada com uma planta verde que tinha semente Tassel (ts). Foram obtidos os seguintes resultados: vermelha, normal 124; vermelha tassel 126; verde, normal 125; e verde, tassel 123. (a) Isto indica ligao? (b) Se indica, qual a percentagem de permuta? (c) Se no, mostre que a freqncia e recombinao maior que 50%. (d) Esquematize o cruzamento mostrando o arranjo dos marcadores genticos nos cromossomos. 129. Em cromossomos de Prmula sinensis L. foram encontrados os seguintes genes e suas distncias: S-B = 7,6; S-G = 33,5; S-L = 37,0; B-G =31,0; B-L = 35,7 e G-L = 3,3. Baseado nesses dados construa um mapa cromossmico, demonstrando quais os genes mais extremos. 130. Os seguintes quatro pares de genes esto ligados no cromossomo 2 do tomate: Aw, aw - caules prpura, verde Dil,dil - folhas verde normal, verde claro O,o - fruto oval, esfrico Wo,wo - folhas lanudas, lisas 131. As freqncias de crossing encontradas em uma srie de cruzamentos-teste de dois pares foram: wo-o 14%; wo-dil 9%; wo-aw 20%; dil-o 6%; dil-aw 12%; o-aw 7%. Qual a seqncia destes genes no cromossomo 2? Diga por que a freqncia de crossing de dois pares wo-aw no maior? (Fonte: BURNS, G. W. Gentica. Uma introduo hereditariedade. Interamericana. 5. ed. 1984. p.137). 132. De posse do seguinte mapa gentico do milho: ______________________________________________________________ lg1 gl2 B sk ts1 v4
21,3 8,6 6,9 12,9 7,3

Determine a freqncia de gametas para F2, do cruzamento de dois F1 considerando apenas os trs primeiros genes. (Fonte: BURNS, G. W. Gentica. Uma introduo hereditariedade. Interamericana. 5.ed. 1984. p.137). 133. Utilizando o mapa gentico da questo anterior determine a quantidade de indivduos esperados para F2, num total de 10.000, que corresponderia a cada um dos gentipos. Considere apenas os dois ltimos genes do mapa, sendo que o gene ts1

29

produz sementes tassel e o seu alelo Ts1 sementes normais e o gene v4 produz folhas brilhantes e seu alelo V4 folhas normais. 134. Baseado no mapa cromossmico abaixo, calcule a interferncia, sendo que somente 39 indivduos, em 5.000, so duplos recombinantes. sc_________ec____________cv 9,1 10,9

135. Os seis genes representados abaixo pertencem planta de milho e esto dispostos nos cromossomos 1 e 8. Demonstre (a) dois genes independentes, (b) dois genes ligados com comportamento independente, (c) dois genes com possibilidade de serem herdados juntos (d) a quantidade de indivduos cujo gentipo v16v16 M18 m18 e (e) calcule a interferncia entre os 3 primeiros genes do cromossomo 1, sendo que 10 indivduos em 6125 so duplos recombinantes. Cr1 sr__vp5__________________ms__________________________br 0 1 23 81 Cr 8 v16______________m8 0 14

Gentica Quantitativa e Herana Polignica


136. A freqncia mendeliana numa populao de sementes foi de 5.474 sementes lisas e 2.850 rugosas. (a) Calcule a freqncia que cada alelo se encontra na populao e (b) verifique se a populao est em equilbrio de Hardy-Weimberg. 137. O albinismo em plantas determinado por um par de alelos aa e a pigmentao normal por um alelo A: (a) Qual o gentipo do indivduo albino? (b) Qual o fentipo de um indivduo heterozigoto? (c) Quais os gentipos dos indivduos de pigmentao normal? (d) Calcule as freqncias, allica e genotpica, sendo que o nmero de plantas albinas, numa populao de 15.000, de 83. 138. Em cebolas a cor do bulbo pode ser roxa devido ao alelo dominante A e amarela devido ao alelo recessivo a. Numa populao com 20.000 plantas (a) qual ser a freqncia do alelo a populao? (b) Qual o nmero de plantas com bulbos roxos e gentipo homozigoto que ocorrem entre as 20.000 plantas? Total de bulbos amarelos 1850.

30

139. Em 6.000 plantas de uma espcie foram identificadas as seguintes quantidades, segundo a cor das flores: Brancas 520 Vermelho-brancas 2630 Vermelhas 2850

(a) Verifique se a populao est em equilbrio de Hardy-Weimberg. (b) Determine as freqncias allicas e genotpicas na populao. (b) Se a contagem fenotpica da questo anterior tivesse fornecido os seguintes dados, mesmo nas 6.000 plantas: Brancas 100 Vermelho-brancas 2830 Vermelhas 3070

(c) A populao atual se manteria em equilbrio de Hardy-Weimberg? (d) Caso estivesse fora do equilbrio, quais sero as novas freqncias, allica e genotpica, da populao em equilbrio? 140. Na planta conhecida como maravilha, a cor da flor pode ser vermelha V1V1, rosa V1V2 ou branca V2V2. Em uma populao panmtica composta por 5.000 plantas foram encontradas 225 com flores brancas. (a) Quais as freqncias dos alelos V1 e V2 nessa populao? (b) Entre os 5.000 indivduos, quais os nmeros esperados de plantas com flores vermelhas e rosas? 141. Utilizando os dados do problema anterior, se o jardineiro coletar sementes apenas das plantas de flores rosa para formar novo jardim, quais sero as freqncias fenotpicas esperadas, para os fentipos acima? 142. Se numa populao forem encontrados 345 rabanetes vermelhos, 297 rabanetes brancos e 136 rabanetes de cor prpura, responda: (a) Esta populao est em equilbrio de Hardy-Weimberg? (b) Quais sero as freqncias dos gentipos acima expostos? (c) Se no estiver em equilbrio qual ser a nova populao que estar em equilbrio? Dados RR rabanetes vermelhos; RR rabanetes prpuras e RR rabanetes brancos. 143. Uma populao est constituda pelos seguintes fentipos e suas quantidades: folhas estreitas 996, folhas largas 965 e folhas intermedirias 224. (a) Verifique se essa populao est em equilbrio de Hardy-Weimberg. (b) Determine as frequncias allicas e genotpicas caso no esteja em equilbrio. (c) A nova populao aps cultivo ficou contituda por folhas estreitas 552, folhas largas 520 e folhas intermedirias 1045. Verifique se essa ltima populao pode ser a mesma da prevista pelos clculos matemticos. (Utilize um teste de frequncias).

31

144. Uma amostra de 20 plantas de uma determinada populao foi medida em cm como se segue: 18, 21, 20, 23, 20, 21, 20, 19, 20, 17, 21, 20, 22, 20, 21, 20, 22, 19, 23, 19. Calcule (a) a mdia; (b) a varincia e (c) o desvio padro. (Fonte: GARDNER, E. J. Gentica. 5. ed, Interamericana p.344. 1975). 145. Calcule os mesmos dados para a populao seguinte: 7, 10, 12, 9, 10, 12, 9, 10, 11, 8, 12, 10, 10, 9, 11, 10, 9, 10 e 11. (Fonte: GARDNER, E. J. Gentica. 5. ed, Interamericana. p.344. 1975). 146. Em um rebanho de gado trs caracteres diferentes mostrando distribuio contnua so estudados: Caracteres Comprimento da tbia Comprimento do pescoo Varincias F2 Ambiental 310,2 248,1 292,2 130,4 Teor de gordura 106 53

Calcule a herdabilidade. Diga em qual caracterstica a seleo mais eficiente. 147. As mdias e as varincias do tempo de florescimento de duas variedades parentais de trigo e prognie de seus cruzamentos foram estudadas por ALLARD e mostradas a seguir: Progenitores P1 (precoce) P2 (tardia) F1 F2 RC1 RC2 Mdias 12,99 27,61 25.40 21.20 15.63 23,88 Varincias 11,036 10,320 5.237 40,35 17,352 34,288

Calcule a heterose, os componentes da varincia, a herdabilidade ampla e restrita do carter. (Fonte: ALLARD, R. W. Princpios do melhoramento gentico das plantas. Edgar Blcher Ltda. p. 86. 1971). 148. Uma amostra de 40 plantas foi tomada ao acaso de cada uma das populaes. Os dados representando as quatro amostras dos 40 indivduos so fornecidos a seguir:

PA 75 74 72 72 73 71 72 71 76 73 72 72 72 70 71 72 71 73 74 73 73 72 71 72 72 74 73 72 71 72 73 72 74 71 72 73 75 70 72 76

32

PB 58 55 56 56 53 55 55 57 54 55 56 55 58 57 55 56 55 57 55 57 56 57 55 55 56 57 55 54 59 57 55 55 58 56 57 54 53 56 58 56 F1 60 65 63 61 65 50 62 63 61 60 63 64 64 61 62 63 65 62 64 62 60 59 61 62 61 60 63 62 60 63 60 65 64 61 62 64 64 61 62 64 F2 69 66 62 60 63 67 72 64 61 63 62 63 60 59 64 63 56 62 62 65 64 73 60 65 57 64 63 70 68 62 71 63 65 66 64 58 61 65 62 64 De posse dos dados acima calcule a heterose, as varincias relativas s populaes e a herdabilidade no sentido amplo. (Fonte: GARDNER, E. J. Gentica. 5. ed. Interamericana p.340. 1975).

149. Responda: A) Qual a relao entre herdabilidade e a manifestao do carter nas geraes seguintes? B) O que mede a heterose? C) Em quais condies possvel aparecer a heterose na gerao F1?

150. As distribuies das freqncias para o comprimento da corola nas geraes paternais,F1 e F2 num cruzamento entre variedades de Nicotiana longiflora so fornecidos na tabela abaixo: Gerao P1 P1 P1 Mdias da gerao P2 P2 Nmero de plantas 125 49 37 88 47 Mdia 40,5 40,6 39,8 93,2 93,4 Desvio Padro 1,75 2,00 1,01 2,29 2,23

33

P2 Mdias da gerao F'1 F2 F2 Mdias da gerao

24 173 211 233

92,1 63,5 47,5 69,8

2,70 2,92 5,91 6,79

Com esses dados calcule a heterose de F1 . As varincias ambiental e gentica e a herdabilidade no sentido amplo. (Fonte: ALLARD, R. W. Princpios do melhoramento gentico das plantas. Edgar Blcher Ltda. p.62. 1971) 151. As mdias e as varincias do comprimento (cm) da raiz seminal relativas a herana da tolerncia toxidez de alumnio em arroz foram estudas por FERREIRA et al (l997) e esto sumarizadas abaixo: Geraes P1 (IAC899) -suscetvel P2 (Guapor)-resistente F1 F2 RC1 RC2 Mdias 0,960 7,622 5,608 5,373 4,051 5,161 Varincias 0,193 3,476 0,806 7,191 5,041 6,651

Baseado nesses dados: (a) Determine o tipo de ao que est envolvendo essa caracterstica; (b) Calcule as varincias devido ao carter comprimento da raiz seminal; (c) Calcule as herdabilidades e (d) O nmero de poligenes, se possvel, que estejam determinando o comprimento da raiz seminal. (Fonte: FERREIRA, R. P. et al. Pesq. Agropec. Bras., 35(5), 1997). 152. Uma seleo de 72 indivduos foi realizada em F2 e o clculo de sua mdia foi de 7,87. (a) Calcule o ganho de seleo e (b) Prediga a mdia da populao melhorada aps esse ciclo de seleo. (Fonte: FERREIRA, R. P. et al. Pesq. Agropec. Bras., 35(5), 1997). 153. Partindo de dados arbitrrios duas variedades de trigo foram anotadas por um perodo de tempo (dias) que gastavam para florescer. A variedade X = 13 dias e a variedade Y = 27,6 dias. De um levantamento efetuado em 5.540.000 plantas da F2, 86 plantas floresceram em 13 dias ou menos. (a) Quantos pares de alelos provavelmente esto contribuindo para o florescimento precoce? (b) Se 88 plantas desta mesma gerao apresentasse florescimento tardio, significaria que se tem o mesmo nmero de alelos contribuintes? 154. Duas variedades homozigotas de Nicotiana longiflora apresentam o comprimento mdio da corola de 40,5 mm e 93 mm. A mdia dos hbridos da F1 destas 2 variedades foi de comprimento intermedirio. Entre 444 plantas da F2, 25

34

apresentavam plantas to pequenas ou to grandes como as variedades parentais. (a)Qual o nmero de alelos que segregam na populao e (b) Qual a contribuio de cada um? 155. Se trs genes que segregam independentemente, com dois alelos cada um, por exemplo Aa, Bb e Cc e determinam a altura de uma populao de plantas, de modo que a presena do alelo representado pela letra maiscula condiciona aumento de 2 centmetros numa altura bsica de 2 centmetros. (a) D a altura que se esperaria na F1 de um cruzamento de populaes homozigticas AABBCC (14 cm) x aabbcc (2 cm). (b) Que proporo da F2 teria a mesma altura de ambos os pais e da F1? 156. Se os alelos da questo anterior tivessem efeito dominante apenas. Por exemplo, AB- C- = 8 cm. Quais seriam as respostas aos itens (a) e (b) da questo anterior?Nas galinhas da raa Bantan cujo gentipo aabbccDD pesam aproximadamente 800 gramas. As da raa Hamburguesa, AABBCCdd pesam 1.350 gramas. Os genes que determinam o peso so polmeros, tanto A como B determinam um aumento de 60% sobre o peso mnimo de 615gramas, quando em homozigose e 38% quando em heterozigose; os genes C e D produzem um aumento de 50% quando em homozigose e 25% em heterozigose. Em resumo tem-se: Homozigotos AA BB CC DD 60% 60% 50% 50% Aa Bb Cc Dd Heterozigotos 38% 38% 25% 25%

(a) Qual o provvel peso dos descendentes do cruzamento entre Bantan e Hamburguesa? (b) Determine os pesos das aves que se pode obter dos descendentes do cruzamento entre os gentipos: AaBbCCdd x aabbCCdd. 157. Suponha que dois pares de genes com dois alelos cada um, Aa e Bb, determinam numa populao a altura das plantas de forma aditiva. O homozigoto AABB tem uma altura de 50 centmetros e o homozigoto aabb mede 30 centmetros. (a) Qual a altura da F1 do cruzamento dessa populao homozigticas? (b) Que fentipos se esperam obter em F2? (c) Qual ser a freqncia de plantas com 40 centmetros de altura? 158. Num cruzamento de variedades de trigo com gros vermelhos e brancos 1/64 das plantas da F2 possuam gros to intensamente coloridos quanto aos do tipo parental vermelho e 1/64 tinham gros brancos. Cerca de 62/64 estavam entre os extremos parentais. Como pode ser explicada a diferena nos resultados desta F2? (Fonte: GARDNER, E. J. Gentica. 5. Ed. Interamericana p.343. 1975).

35

Fatores que afetam as freqncias allicas


159. A freqncia do alelo recessivo w1 numa populao de aveia, de 0,45, resultante de uma seleo genotpica realizada em F2 contra esse alelo. O pesquisador necessita introduzir 460 sementes em sua populao de 4570 sementes melhoradas. Calcule a nova freqncia desse alelo e quantas sementes com o fentipo w1w1 estaro presentes na nova populao? 160. Utilizando os dados do problema 123 deste volume responda: Se o agricultor realizar cinco geraes de seleo visando a obteno de um cultivar que produza apenas bulbos roxos, qual a proporo esperada de plantas que ainda apresentaro bulbos amarelos na populao descendente, em equilbrio? 161. Partindo desta populao melhorada do item acima, quantos ciclos de seleo ainda devero ser realizados para se obter uma nova populao em que apenas 0,64% das plantas possuem bulbos amarelos? 162. Em milho a textura do gro pode ser lisa (Su-) ou enrugada (su su). A cor amarela do gro devido ao alelo Y e a branca ao alelo y. Em uma populao em equilbrio foi tomada uma amostra de 2.400 gros, sendo 816 lisos e amarelos, 776 lisos e brancos, 408 enrugados e amarelos e 400 enrugados e brancos. (a) Quais so as freqncias dos alelos Su e Y nessa populao? (b) Qual a freqncia esperada de indivduos homozigticos lisos e amarelos? 163. Utilizando os dados do problema anterior responda: (a) Quais sero as novas freqncias allicas para os dois caracteres se forem eliminadas todas as sementes enrugadas ou brancas? (b) Qual ser a freqncia de sementes lisas e amarelas aps a populao atingir novamente o equilbrio? 164. Considerando os dados do problema 124 o pesquisador necessitou de maior variabilidade gentica em sua populao. Para tanto solicitou ao Centro de Origem da cultura que trabalha o envio de 10.000 sementes cujas flores so vermelhas. Aps a introduo desse germoplasma quais sero as novas freqncias allicas e qual a nova populao equilibrada na qual o pesquisador ir trabalhar? 165. Numa populao melhorada de soja em que as cores das sementes so creme e amarela clara, o pesquisador introduziu 1500 sementes de cor amarela clara, que o gentipo recessivo. A freqncia do alelo amarelo claro na instituio doadora de 0,48. (a) Qual ser a nova freqncia allica para essa cor na populao aps introduo e (b) qual a quantidade de plantas com esse fentipo que aparecer na populao total. Dados: Populao Inicial: sementes de cor creme - 2.552 e sementes de cor amarelo claro - 2.448. Total - 5.000 plantas.

36

ESTUDO DIRIGIDO GENTICA DE POPULAES


1. Defina a) Frequncia allica b) Frequncia genotpica A cor do bulbo em cebola pode ser branca, amarela ou creme. Essa herana monognica controla por um par de alelos (gene) apresentando dominncia incompleta. Gentipo II Ii Ii Fentipo Bulbo branco Bulbo creme Bulbo amarelo

Se em um campo existirem distribudas ao acaso 2000 plantas, sendo 100 bulbos brancos, 1000 bulbos creme e 900 bulbos amarelos, como sero as distribuies genotpica dos fentipos? Fentipo Brancos Cremes Amarelos TOTAL Quantidade n1 =100 n2 =1000 n3 = 900 N = Gentipos

A frequncia genotpica ento obtida da seguinte forma: a) Frequncia dos alelos II = n1/N ou nmero de gentipos II/nmero total de indivduos Fentipo Brancos Cremes Amarelos TOTAL Gentipo/Smbolo P Q R Valores Freq. Genotpicas

37

A partir desses dados pode-se determinar a frequncia do alelo I ser representada, a partir de agora, por p e a frequncia do alelo i ser representada por q, sendo que a frequncia allica dos fentipos estudados p + q = 1,0 Pelo que foi apresentado pode-se escrever que: Nos indivduos II, homozigoto dominante, existem ....... alelos I, por isso o nmero de indivduos com este gentipo deve ser multiplicado por ........ Nos indivduos heterozigotos Ii, metade do gentipo ....., portanto o nmero deve ser multiplicado por ...... A diviso por 2N porque .......................................................................................... O nmero de alelos totais : Frequncia allica I = p = (2n1 + n2)/2N ou ......................... ou P + Q/2 Frequncia allica i = q = (2n3 + n2)/2N ou .......................... ou R + Q/2 Colocando os valores nominais tem-se ento as frequncias dos alelos I = p = (2. i = q = (2 . )/ )/

Substituindo na outra frmula: I = p = ....................... + ............../2 i = q = ........................ + ............../2 Equilbrio genotpico das populaes ou Equilbrio de Hardy-Weimberg As propriedades genticas de uma populao so definidas pelas suas frequncias ............................... e ................................... Consideremos ento as seguintes frequncias: Alelos Frequncias I P i Q II X Gentipos Ii Y Ii z

38

Destes indivduos so formados dois tipos de gametas, aqueles contendo o alelo ....... e .......... O resultado do acasalamento ir depender da combinao aleatria de gametas e a frequncia genotpica dos zigotos ser (considerando os valores j calculados): I (p) I (p) i (q) Ento, aps uma gerao de acasalamentos ao acaso, as novas frequncias genotpicas da populao sero: II Frequncias A partir dessas frequncias possvel estimar as novas frequncias allicas. A frequncia do alelo I = pI obtida pela seguinte expresso: pI = x + y, onde x ....................................................... qi = z + y, onde z ......................................................., ambas frequncias na nova populao. Sendo assim, nas sucessivas geraes de acasalamentos ao acaso (panmixia) a frequncia allica deve ser a mesma e, evidentemente a frequncia genotpica no ser alterada. Esse fenmeno conhecido por Equilbrio de Hardy-weimberg. A lei diz: Em uma populao grande, que se reproduz ao acaso e onde no h migrao, seleo ou mutao, pois todos os indivduos so igualmente frteis e viveis tanto as frequncias allicas como as genotpicas se mantm constante de gerao a gerao. Utilizando a mesma populao anterior, se o agricultor colheu o mesmo nmero de sementes de cada umas das plantas e as semeou no ano seguinte, aps uma gerao de cruzamentos ao acaso, qual ser a proporo de cada tipo de bulbo nesse novo plantio? Gentipos II Ii ii Frequncias genotpicas 2 p = 2pq = q2 = Frequncias allicas I=p= I=q= Quantidade de bulbos em 2000 plantas Cremes = Amarelos = Brancos = Gentipos Ii Ii i (q)