Você está na página 1de 29

Genomas 1. Defina genoma e gene. Descreva a funo de cada um.

Genoma o conjunto de genes e sequncias intergnicas de DNA de todos os cromossomos de uma clula. FUNO: servir de repositrio replicativo da informao codificada pelo DNA que o constitui, seja ele de procarioto ou eucarioto. Genoma o conjunto de todo o material gentico. Gene a unidade fundamental da hereditariedade. uma sequncia de nucleotdeos de DNA que pode ser transcrita em uma verso de RNA. FUNO: guarda a informao para a transcrio e traduo de uma protena (DNA codificante) ou apenas para a transcrio de um RNA. 2. Diferencie genomas procariticos e eucariticos quanto ao tamanho, presena de regies no codificantes (introns e intergnicas), contedo gnico e estrutura dos genes. Genoma Eucarionte: Genoma nuclear de eucariontes: mais de um cromossomo. Clulas diploides - 2 conjuntos cromossmicos (animais e plantas). Clulas haploides 1 conjunto cromossmico (fungos e algas) ou de nmero aleatrio. Todos os cromossomos so diferentes, no h cromossomos homlogos, tamanho e contedo gnico diferentes. Regio codificadora dividida em introns e exons. Muito espao intergnico. Genoma Procarionte: Cromossomo nico circular. Uma ou mais cpias do mesmo cromossomo. Organizado no nucleide protenas associadas. Regio codificadora: contnua. Operons - ~ 25% do genoma procaritico. Pouco ou nenhum espao intergnico. 3. Alm do genoma principal, as clulas eucariticas possuem outros genomas. Onde so encontrados esses outros genomas. Compare esse genoma com o genoma principal de eucariotos e procariotos. *mitocndria* O genoma mitocondrial se restringe a uma fita de DNA circular na clula animal, sendo o sistema gentico mais simples conhecido, onde todos os nucleotdeos fazem parte de sequncias codificantes. Enquanto que o genoma principal de eucariotos e procariotos mais complexo. 4. Alguns procariotos possuem uma molcula de DNA acessria com funo diferente do genoma principal. Que molcula essa, qual sua funo e quais as consequencias para a clula que a hospeda. Essa molcula de DNA acessria o plasmdeo, capaz de se reproduzir independentemente do DNA cromossmico. Confere clula hospedeira resistncia a antibiticos e toxinas

5. Faa esquemas da estrutura geral dos genes: a. Procariticos b. Eucariticos c. Operon CADERNO 6. Defina exon e intron. xons: regies codificantes de RNAm (expressos em protenas). Introns: regies no codificantes do RNAm.

7. O que so seqncias regulatrias Sequncias regulatrias (ou regio reguladora) um segmento de DNA onde as protenas de unio ao DNA, tais como os fatores de transcrio se ligam preferencialmente. Encontram-se no genoma. Se localizam no incio e no fim da parte que transcrita (extremidades do RNA). Essas regies so importantes para que o processo de transduo possa ocorrer de modo correto. As sequncias que iniciam a fita de RNAm servem para posicionar corretamente os ribossomos para o incio da traduo. 8. O que so as seqncias intercalantes nos genes, conhecidos como introns? As regies no-codificantes que possuem funo regulatria se localizam no incio e no fim da parte que transcrita (extremidades do mRNA). Existem tambm seqncias de nucleotdeos no-codificantes na parte interna da fita de mRNA recm-transcrito. Essas seqncias no-codificantes (denominadas ntrons) aparecem intercaladas entre as regies do gene que codificam a cadeia polipeptdica. Os ntrons receberam esse nome porque, embora sejam regies transcritas (fazem parte do transcrito primrio), jamais sairo do ncleo. Por estarem situados entre as regies codificantes, os ntrons tambm so chamados de seqncias intervenientes ou intercalantes. Introns so regies no codificantes de um gene eucaritico que so transcritos na molcula de RNA

9. O que so famlias gnicas. Famlias gnicas so conjuntos de dois ou mais loci com seqncias similares de DNA. O genoma inclui vrias famlias gnicas. Alguns genes ocorrem em famlias , eles so idnticos ou muito similares e esto presentes em vrias cpias Podem estar numa mesma regio do cromossomo (mesmo locus) ou espalhado em vrios cromossomos (loci mltiplos). Os membros de uma famlia de genes pode surgir por permutao desigual, a qual gera uma cromtide com baixo, e uma com alto nmero de cpias. Muitas famlias gnicas so quase homogneas na seqncia do DNA e coletivamente produzem quantidades significantes de um mesmo produto. Em oposio, muitas famlias gnicas podem adquirir mutaes que impedem a transcrio ou a traduo, tornando-as pseudogenes no-funcionais.Muitas famlias gnicas contm pseudogenes, como por exemplo as famlias de genes humanos de globina alfa e beta

esto organizadas cada uma em um nico grupo que inclui genes pseudogenes

funcionais e

10. Descreva uma semelhana e uma diferena entre gene e pseudogene. Um pseudogene uma sequncia nucleotdica similar a um gene normal mas que no d como resultado um produto funcional, quer dizer, que no se expressa, ou seja os pseudogenes carecem dos promotores dos genes normais, no se expressam com normalidade. J os genes, so unidades transcricionais que possuem uma funo definida (guardar informao para transcrio e traduo de uma protena, DNA codificante ou apenas para a transcrio de um RNA). Sendo assim , o gene considerado funcional pois o RNA precisa ser produzido no momento e no lugar corretos no desenvolvimento de um organismo.

11. O genoma divido em regies com sequencias relacionadas a genes e sequencias no codificantes. Como cada regio pode ser subdividida. O genoma dividido em regies genicas denominada sequencias abertas de leitura que so localizados na mesma fita de DNA. Estas ainda podem ser separadas funcionalmente em quatro regies principais: a primeira a regio regulatria , a segunda regio promotora, a terceira regio codificadora ou codificante a finalmente a quarta , uma regio terminadora. A primeira, regio regulatria pode ser descrita como uma sequncia reguladora (tambm denominada regio reguladora ou "elemento regulador") um segmento de ADN onde as protenas de unio ao ADN, tais como os factores de transcrio, se ligam preferencialmente.J a segunda, regio promotora, compreende-se como sinais de iniciao da transcrio. A terceira, regio codificadora a onde se traduz uma protena. E , a quarta uma regio terminadora na qual encontra-se sinais de trmino de transcrio.

12. O que so seqncias repetitivas do tipo satlite e quais os tipos de sequencias satlites. Caracterize cada um dos tipos. O DNA intergnico ou extragnico possue um DNA repetitivo o qual se divide em tandem ou clusters originando DNA satlite, DNA minisatlite e DNA microssatlite ou seja, as sequencias repetitivas do tipo satlite. Estas divises se caracterizam como: DNA satlite: so sequencias repetitivas em TANDEM (se repetem uma atrs de outra) Satlite: Funo de segragao altamente varivel entre indivduos repeties de 100 a 6.000 pb localizao nos centrmeros - funo na segregao cromossmica Telmeros. DNA estrutural DNA minissatlite: altamente varivel entre indivduos polimorfismo VNTR (nmero varivel de repeties em tandem) repeties de 5 a 50 pb teis no mapeamento genmico teste de paternidade datiloscopia do DNA (DNA Fingerprinting)

DNA microssatlite: repeties de 2 a 5 pb STR (Pequenas repeties em tandem) CA, AT e GC mais comuns (CA)n, onde n = 2 a 10 mais frequente das repeties genoma humano 50 mil a 100 mil blocos (CA)n polimrficos teste de paternidade datiloscopia do DNA (DNA Fingerprinting)

13. O que so elementos transponveis, quais os tipos e como so classificados aos intermedirios formados. Os elementos transponveis so sequncias de DNA que podem se mover no genoma e por isso so a principal fonte de mutaes espontneas. Estes se encontram na regio extragenicas e se dividem em transposons e retrotransposons.Os transposons movem-se no genoma via um intermedirio de DNA (corte-cola ou copia-cola) e os Retrotransposons (LINEs e SINEs) movem-se no genoma via um intermedirio de RNA mais comum. Os elementos transponveis (ETs), tambm so chamados de DNAs saltitantes! Mais detalhadamente: Transposons: Elementos de transposio - sequencias que se movem no genoma Genes saltadores Vrios tipos de transposons Rearranjos cria novas sequencias e altera outras Pode ser a maior fonte de mudana evolutiva no genoma Pode causar doena se interrompe um gene funcional Retrotransposons: LINEs e SINEs LINEs: Long interspersed nuclear elements remanescentes de retrovrus (transcriptase reversa, RNAseH) de 20.000 a 500.000 LINEs no genoma (~ 17% do genoma). Perto de 7.000 esto completos e uma pequena parte capaz de retrotransposio. L1 elemento LINE mais abundante (~100.000) SINEs: Short interspersed nuclear elements <500 bases produtos de transcrio reversa de tRNA, rRNA, ou small nuclear RNAs. No possui capacidade movel autnoma. Sequencia Alu mais comum (280 pb) ~ 1,500,000 copies no genoma (~ 11% do genoma).

14. Discuta sobre uma hiptese para a existncia de grandes regies no codificantes, ou regies intergnicas, no genoma de mamferos. A hiptese que justifica grandes regies intergnicas ou no codificantes se trata de um mecanismo de defesa uma vez que os elementos transponveis so sequncias

de DNA que podem se mover no genoma e por isso so a principal fonte de mutaes espontneas e com isso, grandes regies no codificantes fazem com que esses elementos no se expressem. Dez a 15 por cento do DNA humano so compostos pelos transposons Alu e Line-1. O grande nmero desses elementos, no genoma, propicia ampla oportunidade para recombinao homloga desigual, ocasionando delees ou duplicaes gnicas e mesmo alteraes mais complexas do material gentico.

15. A afirmativa O nmero de cromossomos dos organismos eucariticos maior quanto maior a complexidade do organismo incorreta, por qu? incorreta pois, no h relao clara entre o tamanho do genoma e a complexidade gentica.No entanto, entre os diferentes filos h a necessidade de um aumento mnimo do genoma, o que pode ser refletido em um aumento da complexidade anatmica e fisiolgica.

Estrutura dos cidos nuclicos 16. Como so denominados os monmeros de DNA? E do RNA? Quais as bases nitrogenadas encontradas no RNA e no DNA? Os monmeros de DNA e RNA so os nucleotdeos encontrados destes respectivamente. Na estrutura do DNA encontramos cido nuclico constitudo por nucleotdeos (monmeros), estes nucleotdeos possuem uma base nitrogenada purina (A, G) e pirimdica (T,C), possuem um acar (monossacardeo- pentosedesoxirribose) e um grupo fosfato . J na estrutura do RNA encontramos tambm cido nuclico constitudo por nucleotdeos (monmeros) porm nestes encontramos bases nitrogenadas purina (A,G) e pirimdica (U,C), possuem um acar ( monossacardeo- pentose- ribose) e possuem tambm um grupo fosfato. 17. Quais so as diferenas entre o DNA e o RNA? As diferenas entre DNA e RNA se do devido a associao dos diferentes nucleotdeos que se formam as macromolculas dos dois tipos de cidos nuclicos: o cido ribonuclico (RNA) e o cido desoxirribonuclico (DNA). Eles foram assim chamados em funo dos acar presente em suas molculas: O RNA contm o acar ribose e o DNA contm o acar desoxirribose.

Outra diferena importante entre as molculas de DNA e a de RNA diz respeito s bases nitrogenadas: no DNA, as bases so citosina, guanina, adenina e timina; no RNA, no lugar da timina, encontra-se a uracila. A importncia e o funcionamento dos cidos nuclicos.

Resumindo as diferenas entre DNA e RNA:

18. Quais so as bases pricas (ou purinas) e quais as pirimdicas (ou pirimidinas)? No DNA as bases pricas ou purinas so ( A, G) e pirimdicas ou pirimidinas ( C,T). J no RNA as bases pricas so (A,G) e as bases pirimidinas (C,T).

19. Nomeie as partes constituintes do nucleotdeo abaixo. Responda se encontrado no DNA ou no RNA e justifique sua resposta.

c
A- cidos fosfrico B- Adenina C- Ribosa (trifosfato de adenosina) encontrada no RNA pois possui o grupo OH na extremidade da ribosa , formando o acido ribonucleico.

20. Para diferenciar os carbonos participantes da molcula do acar dos carbonos que compem as bases nitrogenadas prinas e pirimdinas dos carbonos das pentoses, adiciona-se uma (linha) aos nmeros (1, 2, 3, 4 e 5). Portanto, os carbonos da pentose so denominados 1, 2, 3, 4 3 5. Numere os carbonos da pentose do nucleotdeo do esquema anterior.

21. Desenhe uma fita de RNA composta por 3 nucleotdeos, nomeia a ligao entre os nucleotdeos e indique a polaridade da molcula.

A ligao entre os nucleotdeos so ligaes fosfodisteres. A ligao covalente formada entre nucleotdeos conhecida como ligao fosfodister, pois o fosfato esterificado a duas unidades de ribose (no RNA) ou desoxi-ribose (no DNA). Sendo assim, cada nucleotdeo incorporado ao cido nuclico (DNA ou RNA) considerado um resduo de nucleotdeo. Sua polaridade 3 5.

22. Um determinado organismo possui 29% de bases de timina. Qual porcentagem de bases deste DNA de resduos de citosina? Explique. Possuimos 29% de bases de timina a qual se liga com bases adeninas sendo assim temos ento no total 58% de timina de adenina. Sendo assim: 100%- 58%= 42% os quais corresponde a 21% guanina e outros 21% de citosina.

23. Quando separadas, as duas fitas de uma dupla-hlice so idnticas? Explique. No uma vez que, as duas cadeias polinucleotdicas mantm-se unidas por pontes de hidrognio, que se estabelecem entre pares de bases especficos: adenina com timina e citosina com guanina. Assim, as duas cadeias que constituem um segmento

de DNA, so complementares entre si: onde em uma cadeia existir uma timina, na outra existir uma adenina, e onde em uma existir uma guanina, na outra existir uma citosina.Alm disso, o modelo prediz que as duas cadeias polinucleotdicas so antiparalelas, ou seja, elas tem polaridades opostas. As ligaes fosfodiester esto orientadas no sentido 3 => 5, ou seja, do carbono 3 de um nucleotdeo ao carbono 5 do nucleotdeo adjacente, enquanto que na fita complementar a orientao inversa, do carbono 5 ao 3 (5 => 3).

24. Quais os 3 tipos de conformao de DNA existem? Quais os naturais? Em que condies a conformao artificial encontrada? Os 3 tipos de conformao do DNA so : A-DNA, B-DNA e Z-DNA. A-DNA Os estudos de difrao de raios X de fibras de DNA revelaram uma forma diferente chamada A-DNA, que surge quando a umidade relativa reduzida abaixo de cerca de 75%. Isso ocorre porque os agrupamentos fosfato na hlice A ligam-se a menos molculas de gua do que os fosfatos no B-DNA, desta maneira a desidratao favorece a forma A. B-DNA O B-DNA tem a dupla hlice mais longa e mais fina. Para completar uma volta na hlice so necessrios 10 pares de bases.Em soluo, geralmente o DNA assume a conformao B. Quando h pouca gua disponvel para interagir com a dupla hlice, o DNA assume a conformao A-DNA. Z-DNA Alexander Rich descobriu um terceiro tipo de hlice de DNA quando analisava a estrutura CGCGCG.Esta conformao mais alongada e mais fina do que o BDNA.Foi observado que este hexanucleotdeo formava um dplex de filamentos antiparalelos mantidos juntos por pareamento de Watson-Crick.Para completar uma volta na hlice so necessrios 12 pares de bases. O DNA, em soluo com altas concentraes de ctions, assume a conformao Z-DNA. Em eucariotos o DNA tende a assumir a conformao Z-DNA devido a metilao do DNA. B-DNA e Z-DNA naturais A-DNA DNA artificial (DNA artificial)

Comparao entre DNA A, B e Z A B Z

Forma Dimetro da hlice Sentido da toro Pares de bases por volta da hlice Sulco Maior Sulco Menor

Mais larga 25,5 A Dextrorsa 11

Intermediria 23,7 A Dextrorsa 10,4

Mais estreita 18,4 A Sinistrorsa 12

Estreito e muito profundo Muito largo e raso

Largo e profundo Estreito e bem profundo

Achatado Muito estreito e profundo

A dupla hlice mantida unida por duas foras: * Por pontes de hidrognio formadas pelas bases complementares * Por interaes hidrofbicas, que foram as bases a se "esconderem" dentro da dupla hlice. Estudos recentes mostram que existem duas formas de DNA com a hlice girando para a direita, chamadas A-DNA e B-DNA, e uma forma que gira para a esquerda chamada Z-DNA. A diferena entre as duas formas que giram para a direita est na distncia necessria para fazer uma volta completa da hlice e no ngulo que as bases fazem com o eixo da hlice.

- B-DNA: Tem a dupla hlice mais longa e mais fina. Para completar uma volta na hlice so necessrios 10 pares de bases.

- A-DNA: Tem a forma mais curta e mais grossa. Para completar uma volta na hlice so necessrios 11 pares de bases. Em soluo, geralmente o DNA assume a conformao B. Quando h pouca gua disponvel para interagir com a dupla hlice, o DNA assume a conformao ADNA. Existe uma terceira forma de DNA que difere das duas anteriores, pois seu sentido de rotao para a esquerda, este tipo de DNA chamado de Z-DNA. Esta conformao mais alongada e mais fina do que o B-DNA. Para completar uma volta na hlice so necessrios 12 pares de bases. O DNA, em soluo com altas concentraes de ctions, assume a conformao Z-DNA.

Em eucariotos o DNA tende a assumir a conformao Z-DNA devido metilao do DNA. Metilao do DNA *Uma pequena frao dos resduos de citosina do DNA contm grupos metil ligados ao carbono 5 (5-metilcitosina). Estes grupos so adicionados por enzimas especficas, as DNA metilases, aps a incorporao dos resduos de citosina nas cadeias de DNA. *Resduos de adenina tambm podem ser metilados formando 6-metiladenina, por uma DNA metilase distinta. * Em procariotos, adenina metilada mais comum que citosina metilada. Em eucariotos, quase todos os resduos de citosina so metilados. *Quando as citosinas so metiladas, o equilbrio das trs formas de DNA (ADNA, B-DNA e Z-DNA) se desloca em favor do Z-DNA, influenciando na funo gnica. (NATURAL E ARTIFICIAL ???? ) **** 25. O equilbrio entre as foras de repulso e atrao fundamental para a plasticidade necessria para que a molcula de DNA possa cumprir seu papel. O esqueleto hidroflico de pentoses e grupos fosfato fornecem o carter cido ao polmero. Quais partes da molcula exercem as foras de repulso e coeso que sofre uma longa cadeia de DNA. Saiba exemplificar e explicar essa afirmativa. As foras de atrao so dadas pelas pontes de hidrognio e as ligaes fosfodisteres fazem foras de repulso. Se a fora de atrao fosse muito forte

no conseguiria separar e se fosse muito forte a fora de repulso no seria possvel uni-las

26. A molcula de DNA tem polaridade 5-3 e formada por duas fitas antiparalelas. Ao acar liga-se um grupo fosfato no carbono na posio 5. Um nucleotdeo como parte integrante de um cido nuclico tem um nico grupo fosfato, sendo, portanto um nucleotdeo monofosfato. Qual a extremidade onde monmeros so adicionados? Os cidos nucleicos podem estar organizados em cadeia simples ou dupla de nucletidos, unidos atravs da pentose de um e o grupo fosfato de outro: quando uma cadeia est em formao, cada novo nucletido liga-se seu grupo fosfato ao carbono 3 da pentose do ltimo nucletido da cadeia. Assim, sempre que um nucletido apresenta o seu carbono 3 livre pode ligar-se a outro. Por este motivo, as cadeias polinucleotdicas de DNA ou RNA crescem sempre no sentido 5 - 3.

27. Por que a sntese do DNA (e RNA) depende da participao de um nucleotdeo trifosfato? Porque no h adio de nucleotdeo no lado 5 da molcula? O grupo hidroxila do carbono-3 da pentose do primeiro nucleotdeo se liga ao grupo fosfato ligado hidroxila do carbono-5 da pentose do segundo nucleotdeo atravs de uma ligao fosfodister. Devido a esta formao a cadeia de DNA fica com uma direo determinada, isto , em uma extremidade temos livre a hidroxila do carbono-5 da primeira pentose e na outra temos livre a hidroxila do carbono-3 da ltima pentose, determinando que o crescimento do DNA se faa na direo de 5' para 3'. A reao de adio promovida por uma grande alterao favorvel de energia livre causada pela liberao do pirofosfato. Como a extremidade 5 da cadeia possui apenas um grupo fosfato que no permite essa reao de liberao de energia. Estrutura e compactao do DNA 28. Defina cromatina. Em que fase do ciclo celular encontrada. Cromatina o conjunto dos filamentos da molcula de DNA associado s histonas em diversos graus de condensao. A cromatina uniformemente dispersa (pouco condensada), no interior do ncleo, sem formar grumos. Em alguns pontos, a cromatina mostra o aspecto de filamentos. Tais filamentos so encontrados no ncleo INTERFSICO (nas fases G1, S e G2 do ciclo celular).

29. Diferencie eucromatina de heterocromatina quanto estrutura e funo. Cromatina possui nveis mdios de compactao do DNA no ncleo interfsico. Por isso, os diferentes nveis de compactao definem caractersticas distintas. Eucromatina: poro do material gentico no condensado ou muito pouco condensado. A forma menos condensada expe os genes permitindo sua expresso. Durante o ciclo celular geralmente sofre condensao e descondensao.

Heterocromatina: poro do material cromossmico altamente condensado. Contm poucos genes, e os genes compactados nesta regio so desligados pelo tipo e grau de compactao. Quando um gene que normalmente expresso na eucromatina reposicionado (experimentalmente) prximo a uma regio de heterocromatina, sua expresso suspensa (ou silenciada). Essas diferenas na expresso gnica constituem os efeitos posicionais e uma das caractersticas da heterocromatina.

FUNOOOO?????

30. O que so histonas e cite duas funes. Histonas so as principais protenas presentes nos nucleossomos. No papel estrutural, as histonas so responsveis pelo empacotamento do DNA no ncleo. Outra importante caracterstica no papel regulatrio que controla o acesso da maquinaria de transcrio. Essa regulao acontece quando h alterao na sua calda amino-terminal, que pode ser: acetilao, metilao, fosforilao e ubiquitinao, etc. Exemplo: Histonas desacetiladas a cromatina se fecha e h AUSNCIA de expresso gnica. Quando as histonas esto acetiladas h o desempacotamento da cromatina, ligao de fatores de transcrio e ATIVAO da expresso gnica. 31. O que so os nucleossomos? Nucleossomos o nome dado, nos seres eucariontes, unidade fundamental da cromatina. Consiste numa unidade de ADN, dividida em duas espirais, que se enrolam em torno de um disco proteico, constitudo por quatro pares de protenas chamadas histonas (H2A, H2B, H3 e H4). Na cromatina, a dupla hlice de DNA organiza-se em nucleossomos, que composto por um grupo proteico central, constitudo por quatro pares histonas ( ex:H2A, H2B, H3 e H4) onde o filamento de DNA se envolve dando duas voltas (cerca de 200 bp).

32. Qual o papel das histonas no empacotamento do DNA? As histonas desempenham importante papel, pois atravs da formao do disco protico (constitudo das quatro histonas principais) que iniciasse o processo de empacotamento do DNA. O nucleossomo corresponde a unidade bsica de empacotamento que d ao fio de DNA o aspecto de um colar de contas. Esse cordo sofre ento os outros estgios de enrolamento, at formar o cromossomo totalmente espiralizado, com o DNA totalmente compactado.

33. A estrutura das histonas esto intimamente relacionadas a funo da cromatina. Descreva dois tipos de modificao ps-traducionais sofrido pelas histonas que tenham consequencias para a funo do DNA no trecho onde esto essas histonas modificadas. Dois tipos de modificaes ps- traducionais seriam a fosforilao e a metilao. As modificaes ps-traducionais nas histonas influenciam a expresso gnica Fosforilao Em bioqumica, fosforilao a adio de um grupo fosfato (PO4) a uma protena ou outra molcula. A fosforilao um dos principais participantes nos mecanismos de regulao das protenas. importante nos mecanismos de reaes da qual participa o trifosfato de adenosina (ATP), que funciona como uma "moeda de energia" nas clulas dos organismos vivos. A energia obtida na respirao ou na fotossntese utilizada para

adicionar o grupo fosfato ao ADP (difosfato de adenosina) e convert-lo em ATP. Esta molcula armazena essa energia , que fica disposio da clula. A eliminao de um grupo fosfato no ATP ocorre com a liberao de 30,6kJ/mol. Papel estrutural: empacotamento do DNA no ncleo Papel regulatrio: compactao do DNA na mitose Metilao Metilao do DNA um processo pelo qual o grupos metil (CH3) so adicionados a determinados locais do DNA para impedir que ele seja destrudo por enzimas de restrio. Papel estrutural: formao da heterocromatina/eucromatina Papel regulatrio: regulao da expresso de genes HDM (demetilases de histonas) HMT (metil transferases de histonas) Replicao 34. Baseado na complementaridade e no antiparalelismo da molcula de DNA, desenhe a fita complementar do DNA: 5-GTACCATGCTAGGGTCTAGATATTCTGATAGCT-3. 3-CATGGTACGATCCCAGATCTATAAGACTATCGA-5 (fita complementar)

35. Qual a importncia da complementaridade da molcula de DNA durante a replicao?

Como a fita de DNA formada pelo pareamento de duas fitas simples, cada uma delas pode atuar como molde para determinar a sequencia de m nucleotdeos da sua fita complementar pelo pareamento das bases do DNA. Desse modo, a molcula de DNA de fita dupla precisamente copiada.Portanto, a complementaridade da fita molde importante para que a replicao ocorra com exatido, gerando duas molculas de DNA idnticas e sem mutaes.

36. Defina origem de replicao. Porque cada molcula de DNA em cromossomos eucariotos contm mltiplas origens de replicao? Origem de replicao ou Ori so regies especficas na sequncia nucleotdica da molcula de DNA ricas em A:T, onde protenas se ligam para abrir a dupla hlice de DNA para que a maquinaria de replicao possa atuar. Nos cromossomos de Eucariotos existem diversas regies Ori ativadas apenas uma vez a cada ciclo celular. A existncia de mltiplas Ori deve-se ao tamanho da molcula de DNA eucaritica.

Procariotos, plasmdeos e vrus tem apenas uma Ori que pode ser ativada mais de uma vez Exemplo de Ori: 5 TTAT(C/A)CA(C/A)A 3

37. Muitas origens de replicao foram caracterizadas por conter seqncias ricas em A:T. Esses ncleos ricos em A:T tm algum significado funcional? Qual? Sim, as origens de replicao so ricas em A: T pois essa ligao facilmente separada pelas protenas responsveis pela abertura da dupla fita. Essas sequncias podem ser constitudas por: - 4 sequncias repetidas com 9 pb cada 5 TTAT(C/A)CA(C/A)A 3 - 3 sequncias repetidas com 13 pb ricas em AT

38. Explique a figura abaixo.


a b c d e

A figura acima demonstra como o processo de replicao acontece em organismos de eucariotos. Exemplifica as mltiplas origens de replicao e demonstra que a replicao acontece em sentido bidirecional.

39. A Replicao do DNA tem regras e mecanismos bsicos que se aplicam a procariotos e eucariotos. Quais so eles?

-o processo de replicao semi-conservativo - ocorre de maneira semi-descontnua - Fita contnua (leading strand) - Fita descontnua (lagging strand) -em sentido Bidirecional - tanto em procariotos quanto em eucariotos h origem de replicao, o que diferencia apenas o nmero de origens e quantas vezes esse mecanismo ativado durante o processo.

40. Esquematize uma forquilha de replicao e indique qual fita de DNA ser usada como molde para a sntese contnua e para a sntese descontnua das fitas filhas CADERNO.

41. Todas as DNA polimerases conhecidas, alm de sua atividade polimerase, tem capacidade de editorao (proofreading). Que tipo de atividade enzimtica responsvel pela editorao? Qual sua contribuio para a fidelidade do processo de replicao. Editorao a capacidade de corrigir a leitura. A atividade exonuclesica 35 a responsvel pela editorao. Essa atividade aumenta a fidelidade da leitura e evita erros.

42. Quais as polimerases que atuam no processo de replicao e descreva em que fase cada uma delas atua. DNA Polimerase I Atua em conjunto com a primase, retira os primers e preenche as lacunas; DNA Polimerase III Atua na sntese da nova fita. 43. Coloque as protenas e enzimas em ordem temporal de atuao no processo de replicao. DNA Pol I, ligase, fragmento de Okazaki, DNA Pol III, primer, helicase, primase. Helicase, Pol III, primase, primer, Pol I,ligase, fragmento de Okazaki, 44- Descreva a funo de cada um dos componentes do processo de replicao listados na questo anterior.

. HELICASE enzima com a funo de quebrar as pontes de hidrognio entre as bases para separar as fitas de DNA (gerando DNA fita simples e superhelicoidizao); DNA POLIMERASE III atua na sntese da nova fita; DNA POLIMERASE I Atua em conjunto com a primase, retira os primers e preenche as lacunas; PRIMER Indica onde o inicio da sintese do DNA; LIGASE liga os fragmentos de Okazaki; PRIMASE Sintetiza um iniciador de RNA (primer) complementar para a fita de DNA para que para que a DNA Polimerase possa estender a cadeia; FRAGMENTO DE OKAZAKI funo de gerar uma fita contnua
45.O avano de uma forquilha de replicao ao longo de uma molcula de DNA leva a superhelicoidao da dupla fita. Qual enzima atua para permitir o relaxamento da toro e qual seu mecanismo de ao A enzima que permite o relaxamento da toro a topoisomerase(DNA girase), para que o relaxamento da toro ocorra a helicase rompe uma das fitas do DNA, a fita rompida gira em torno da outra assim se distorcendo o que leva ao relaxamento do DNA.

46-Considerando a seqncia abaixo, e o sentido de polimerizao da esquerda para direita, aponte qual fita ser molde para a sntese da fita contnua e qual ser da descontnua. 5 AACTGGTCGATGCTATTGATCGATGCTAG 3 3 TTGACCAGCTACGATAACTAGCTACGATC 5 Levando o sentido de sntese de 5 3 e o de polimerizao da esquerda para a direita a fita inferior ser molde para sntese continua e a superior descontnua. 47-No processo de replicao, diferencie fica contnua, ou lder, da fita descontnua, ou lerda. A principal diferena esta no modo em que ocorre a sntese, devido ao sentido de sntese 53 e o sentido de polimerizao (esquerda-direira e vice-versa) , isso faz com que uma das fitas seja polimerizada de forma contnua e a outra de forma descontnua. 48-Uma das principais diferenas entre os cromossomos da maioria das bactrias e clulas eucariticas que os cromossomos dos eucariotos so lineares. A manuteno da integridade das extremidades dos cromossomos lineares demanda um tipo de replicao especfica que evita perdas sucessivas de DNA. Como so chamados esses terminais cromossmicos e explique como as extremidades so replicadas. Esses terminais so chamados de telmeros. A telomerase estica uma das extremidades. O uso do molde permite a extenso de uma unidade de repetio telomrica por vez. Aps a adio de vrias unidades de repetio extremidade 3' da fita contnua, a fita complementar descontnua pode ser completada pela ao do complexo polimerase a - primase, que vai estender uma fita complementar nova a partir de um primer adicionado de forma convencional

49-Qual a funo das nucleases. Diferencie exonuclease de endonuclease Nuclease um enzima que tem a funo de quebrar as ligaes entre os nucleotdeos. A diferena entre exonuclease e endonuclease que a exonuclease cliva ligaes fosfodister nas estremidades da cadeia e a endonuclease cliva ligaes fosfodiester no meio da cadeia.

Figura 1: Modelo de replicao telomrica no qual a enzima est representada apenas pelo seu RNA (em vermelho) e pelo stio cataltico da enzima, enquanto a extremidade 3'da fita contnua aparece em volta deste molde de RNA preto. O complexo ribonucleoprotico alonga a extremidade telomrica 3'da fita molde por um mecanismo repetido de transcrio reversa. A telomerase contm um RNA molde (vermelho) que pareia com a extremidade 3' da fita. O stio cataltico da telomerae (em verde) adiciona desoxirribonucleotdeos (em azul) usando a molcula de RNA como molde. Esta trnascrio reversa avana at a posio 35 do RNA (passo 1). Imagina-se ento que a fita recm sintetizada desliza sobre o molde de RNA, deixando um novo trecho de RNA livre para servir de molde (passo 2). A ala de DNA assim formada vai criando pareamentos entre suas bases. A fita de DNA estendida mais uma vez e o processo de deslizamento repetido (passos 3 e 4). Um nmero de telmeros assim adicionado

para garantir a integridade do cromossoma. O mecanismo de deslizamento provavelmente facilitado pela presena de pareamentos no Watson/Crick na ala.

. 50.Existe alguma relao envelhecimento celular? entre telomerase e cncer, e telomerase e

Existe relao nos dois casos. No caso do envelhecimento- a presena dessa enzima diminui o envelhecimento celular, existem estudos que dizem ser possvel reverter casos de atrofia de tecidos, induzindo a sntese de telomerase. Mas tambm devemos considerar que a quando se estimula a sntese de telomerase se inativa um gene supressor tumoral podendo levar a formao de tumores cancergenos. 51.Proponha uma forma de sntese de DNA em tubo de ensaio (in vitro) usando alguns dos componentes do processo de replicao que voc julgue essencial para tal fim. PESSOAL

Transcrio 52.O que so fatores de transcrio? O que so os fatores de transcrio basais? Fatores de transcrio so protenas que se ligam ao DNA de clulas eucariticas para permitir que haja uma ligao entre a enzima RNA-polimerase e o DNA, permitindo assim a transcrio e a futura traduo.

53.Defina promotor e o que significa seqncia consenso da maquinaria basal de transcrio. Promotor uma regio presente em todos os genes que contm sequencias que indicam para a maquinaria de transcrio o inicio. Sequencia consenso da maquinaria basal de transcrio (composta por todas as protenas fatores de transcrio que atuam em todos os genes, senso TATA-BOX). Seqncia terica representada por nucleotdeo ou aminocido, na qual cada nucleotdeo ou aminocido o nico que ocorre com mais freqncia nesse stio nas diferentes sequncias que ocorrem nanatureza. A frase tambm se refere a uma seqncia real que se aproxima ao consenso terico. Um grupo conhecido como SEQNCIA CONSERVADA representado por uma seqncia consenso. Estruturas supersecundrias de protenas comumente observadas (MOTIVOS DE AMINOCIDOS) so freqentemente formadas por seqncias conservadas. 54.Quais as RNA polimerases conhecidas de clulas eucariticas e qual as funes conhecidas para cada uma delas? RNA Polimerase I, responsveis pela transcrio de genes que resultam em RNAs ribossomais.

RNA - Polimerase II, responsveis pela transcrio de genes que resultam em RNAs mensageiros. RNA Polimerase III, responsveis pela transcrio de genes que resultam em RNAs Transportadores 55.O que uma fase aberta de leitura (open reading frame - ORF)? Chama-se Fase de leitura aberta a cada uma das sequncias de DNA compreendidas entre um codo de incio (ATG) da traduo e um codo de terminao, descontando as sequncias que correspondem aos introns no caso de os haver.

56.A sntese de DNA tambm poder ser feita utilizando uma molcula de RNA como molde. Qual o nome da enima responsvel por esse tipo de processo? Onde so encontradas? Existe similares no genoma de mamferos? A transcriptase reversa. So encontrada em retrovrus. Sim, existe LINEs possuem uma similaridade a transcriptase reserva. Se reproduz e se multiplica pode ocasionar doenas: multaes. 57.Defina fita molde e fita codificadora. A fita molde a fita do DNA que serve de molde para a adio dos ribonucleotdeos do RNA que est sendo sintetizado. A maquinaria de transcrio reconhece a seqncia da fita molde e monta o RNA por complentaridade de bases. Como o RNA deve ser montado no sentido 5-3, a fita molde ser lida no sentido 3-5. Fita codificadora a que possui seqncia idntica ao do RNA sintetizado, com a exceo de ao invs de uracilas, possui timinas. lida no mesmo sentido da sntese do RNA, ou seja, 5-3. Exemplo:

58.A fita codificadora de um gene composto pela seqncia: 5 CCATGTTGACATGATACCATGATCACATGTATTTGACTAT 3.Qual a seqncia do RNA que ser sintetizado por esse gene? 5 GGUACAACUGUACUAUGGUACUAGUGUACAUAAACUGAUA 3 59..Quais seqncias encontradas no promotor bacteriano so reconhecidas pela RNA Pol e quais subunidades da enzima as reconhecem. As seqncias na fita codificadora que sinalizam o incio da transcrio so: TTGACA e TATAAT (TATA Box) em 35 e 10 nucleotdos antes do stio de incio, respectivamente. Estas seqncias so reconhecidas pelo fator da RNA-Polimerase

60.Explique o processo de terminao da transcrio em procariotos. Durante a transcrio, a RNA-Pol. encontra sinais de terminao, que a presena de seqncias invertidas na fita codificadora, por exemplo, ...GCCGCCAG...CTGGCGGC.... este trecho dobra-se (pois h a complementaridade de bases), formando o grampo de terminao. O stio de terminao uma seqncia de bases repetidas mais adiante do sinal de terminao. Pode ser, por exemplo, ...TTTT. Aps a terminao a RNA-Polimerase solta-se da fita de DNA e pode ligar-se novamente ao fator .

61.Quais os trs tipos principais de RNA celulares eucariticos? Qual a funo de cada classe? Por quais RNA polimerase cada classe sintetizado? mRNA RNA mensageiro, codifica protenas. PolimeraseII; Sintetizado pela RNA-

rRNA RNA robosomal, faz parte da estrutura do ribosomo e participa da sntese de protenas. Sintetizado pela RNA-Polimerase I; tRNA RNA transportador, participa da sntese de protenas como adaptador entre o mRNA e o aminocido. Sintetizado pela RNA-Polimerase III.

62.Compare os fatores de transcrio eucariticos ao fator sigma de procariotos. 63.Diferencie fatores de transcrio basal (ou geral) de fatores de transcrio especficos, levando em considerao: o papel dos fatores de transcrio e as circunstncias os fatores especficos so ativados.

64.A afirmativa Os genes so encontrados em apenas uma das fitas da molcula de DNA est incorreta. Justifique. No que os genes se encontram apenas em uma das fitas. O que acontece que para que ocorra a transcrio de uma cadeia gentica em RNAm s necessria uma delas.

65.Os componentes do complexo de transcrio basal ocorrem em todas as clulas? Justifique. ????????? 66.Qual a modificao crtica da RNA polimerase para que se inicie a transcrio? Para que se inicie a transcrio, necessrio que a RNA polimerase se ligue ao stio promotor. Assim, promove a abertura da dupla hlice do DNA e se move sob a sequncia do gene, dando origem ao RNA.

67.Para que um "enhancer" funcione, critico que ele esteja a uma distncia correta e em fase com o promotor? Ele funciona se invertido? Um promotor funciona corretamente se invertido (o gene controlado transcrito)? No, enhancers funcionam mesmo localizados em diferentes posies em relao ao promotor, e em eucariotos, tm funo mesmo a longas distncias. (FALTA RESPONDER SE O STIO PROMOTOR FUNCIONA SE INVERTIDO. ACREDITO QUE NO, POIS O STIO ATIVO DE CADA ENZIMA BEM ESPECFICO). 68.Defina processamento de RNA, sua funo e indique se ocorre em procariotos ou eucariotos ou ambos. O processamento do RNA ocorre tanto em procariotos quanto em eucariotos, embora o processo seja no seja exatamente igual. A transcrio consiste na sntese do RNA, a qual feita a partir de uma fita molde de DNA e tem como funo a codificao de diversos aminocidos e, consequentemente, protenas, que so vitais aos seres. (*Transcrio o processamento da fita de RNA a partir da fita de DNA molde) (*A transcrio em eucariontes bem mais complexa que em procariontes. Nos eucariontes a transcrio ocorre no ncleo, enquanto a traduo ocorre no citoplasma. J nos procariontes tal separao celular no existe, sendo os dois processos muito

bem acoplados no espao. A separao temporal e espacial desses dois processos nos eucariontes permite a eles uma melhor regulao da expresso gnica). 69.O que cap, onde ocorre e qual sua funo? CAP um nucleotdeo 7-metilguanilato unido por uma ligao 5-5 ao nucleotdeo inicial da cadeia de RNAm (assim no sobra extremidade 5 livre na cadeia de RNAm, e sim duas extremidades 3 livres). CAP apresenta papel importante na iniciao da sntese de protena, alm de proteger o transcrito de RNA nascente da degradao.

70.O que cauda poli-A, onde ocorre e qual sua funo? A cauda de poli-A constituda por uma sequencia de muitos nucleotdeos A (Adenina) na extremidade 3 da cadeia do RNAm. Provavelmente esta cauda desempenha vrias funes como auxlio na exportao do RNAm, sinal de reconhecimento para a traduo e estabilidade da molcula do RNAm. 71.Defina splicing, d sua funo e indique em que fase da transcrio ocorre.

. O Splicing do RNA consiste na remoo das regies no codificadoras (introns) do RNAm. Este processo ocorre com o objetivo de produzir uma molcula de RNA que codifica diretamente uma protena. Ocorre na fase de terminao da transcrio 72.Qual a funo dos snRNA no processo de splicing. Os snRNA se ligam protenas especficas formando as snRNP, que se unem as regies prximas s extremidades dos introns (essas regies so conservadas) para formar um grande complexo chamado de complexo de ribonucleoprotenas ou spliceossoma. O spliceossoma auxilia na remoo dos introns do RNAm precursor (imaturo), ou seja essencial no processo de splicing. 73.O que so microRNAs. Descreva duas de suas funes. Os microRNAs so pequenos RNAs, com cerca de 20 a 22 nucleotdeos, resultantes da clivagem de um RNA maior no codificante que possui uma estrutura secundria em gancho. Os miRNAs ligam-se ao complexo RISC (complexo de induo do silenciamento de RNA) e direcionam a clivagem de mRNAs com os quais tm complementaridade ou fazem represso da traduo ficando ligados ao mRNA impedindo a sua traduo pelo ribossomo.

Traduo 74.Porque o cdigo gentico formado por trincas? Quantos aminocidos so especificados pelo cdigo gentico? Quantas sequncias de aminocidos so possveis em um polipeptdeo de 146 aminocidos?

20 minocidos so codificados pelo cdigo gentico.

*
75.O que se entende por cdigo gentico degenerado e descreva usando os cdons que codificam para a leucina (Leu) como exemplo. Significa que um mesmo aa pode ser codificado por cdons diferentes variao da 3 base (exceto met e trip) LEU: CUU, CUC, CUA, CUG

76.Sobre a seqncia de RNA abaixo, responda: 5GCUAUGGCAAAACUGUGGGUACGCACUUAGGCAAUUCCUAAAAAAAAAAAAA3 a.Que tipo de RNA esse? RNA mensageiro b.Circule onde se inicia a sntese das protenas e risque onde esta termina. Circule AUG e grife UAG) c.D a seqncia de aa resultante de sua traduo e diga se um dipeptdeo, um peptdeo ou uma protena. A traduo se inicia em met (AUG) e termina em UAG. Observao da tabela de aminocidos, s colocar os nomes encontrados de acordo com as trincas de base. A sequncia um polipeptdeo. d.Quais as caractersticas que permitem sua classificao? A sequncia possui 8 aminocidos (octapeptdeos, seguindo a nomenclatura) e.Qual o sentido em que traduzido? 5------3 77.Cite 3 diferenas entre os ribossomos eucariticos, procariticos e mitocondriais. Ribossomo: maquinaria cataltica complexa feita a partir de mais de 50 protenas diferentes (protenas ribossomais) e diversas molculas de RNAs ribossomais (rRNAs). Os ribossomos eucariticos e procariticos so muito similares tanto em forma quanto em funo. Ambos so compostos de uma subunidade grande e uma pequena que se encaixam para formar um ribossomo completo. Os ribossomos mitocondriais so comparveis aos ribossomos procariticos em tamanho e sensibilidade a antibiticos, entretanto, os valores de sedimentao s varia nos diferentes filos. Os ribossomos eucariticos so maiores e mais complexos, possuindo quatro molculas de rRNA, enquanto os procariticos possuem apenas trs molculas de rRNA. Os ribossomos bacterianos operam mais rapidamente que ribossomos eucariticos. Ribossomos eucariticos necessitam de um quepe na extremidade 5 enquanto os procariticos iniciam a transcrio nos stios de ligao ao ribossomo, os quais podem estar localizados em qualquer ponto ao longo de uma molcula de mRNA, o que permite que as bactrias sintetizam mais de um tipo de protena a partir

de uma nica molcula de mRNA. A subunidade menor dos ribossomos eucariticos a 40S e dos procariticos a 30S 78.Qual o nmero de cdons gerados a partir dos 4 nucleotdeos presentes na molcula de mRNA? Quantos so codificantes? Qual a funo dos que no so codificantes? So gerados 64 cdons, que codificam apenas 20 aminocidos diferentes. Alguns tripletes de nucleotdeos nunca so usados, ou o cdigo redundante e alguns aminocidos so determinados por mais de um triplete.

79.O que significa universalidade do cdigo gentico e qual situao a universalidade no se aplica? Diz-se que o cdigo gentico universal, porque os cdons possuem o mesmo significado em quase todos os organismos. A universalidade no se aplica em mitocndrias, em alguns casos. UGA (stop cdon): codifica um outro aminocido em mitocndrias. 80. 81.Onde feita a sntese proteica na clula? Comente algumas diferenas entre as protenas sintetizadas em polirribossomos e no retculo endoplasmtico rugoso. A sntese protica feita no citoplasma, em polirribossomos. Os polirribossomos livres so responsveis pelas protenas que esto em soluo no citoplasma, que devem permanecer no citossol ou serem incorporadas no ncleo, mitocndrias, cloroplastos ou peroxissomos. As protenas sintetizadas nos polirribossomos aderidos s membranas do retculo endoplasmtico so aquelas destinadas a permanecer no prprio retculo, ser transportadas para o complexo de Golgi, formar lisossomos, compor membrana plasmtica ou serem secretadas da clula.

82.Em que extremidade do tRNA ligado o aminocido? Em qual nucleotdio o aa se liga? Qual a denominao geral das enzimas que fazem esse acoplamento? O aminocido ligado na extremidade 3 do tRNA. O aa se liga ao anticdon correspondente. Essas enzimas so denominadas aminoacil-tRNA-sintetases

83.Qual subnidade associa-se primeiro ao mRNA para a iniciao da sntese proteica? Qual o primeiro aminocido de toda protena? Como se chama esse aa em procariotos? Qual o anticdon encontrado no tRNA que carrega esse aminocido? A subunidade que se associa primeiro ao mRNA para a iniciao da sntese protica a 30S (menor). O primeiro aminocido de toda protena a Metionina, que codificada pelo cdon de iniciao AUG. Esse aminocido em procariotos chamado Formilmetionina (fmetionina). O anticdon encontrado no tRNA que carrega esse aminocido o UAC.

84.Descreva brevemente o que acontece em cada uma das fases da sntese de protenas: a. Ativao dos aminocidos b. Iniciao c. Alongamento d. Terminao a) Ativao dos Aminocidos: um processo de seleo de aminocidos realizado por enzimas ativadoras, resultando compostos denominados aminoacil-adenilatos. Acredita-se mesmo que aja pelo menos uma enzima ativadora especfica para cada um dos aminocidos que devem ser incorporados para a fabricao da protena. b) Iniciao: envolve as reaes que precedem a formao da ligao peptdica. Requer a ligao do ribossomo ao mRNA, a formao de um complexo de iniciao contendo o primeiro aminoacil-tRNA. Trata-se de um processo relativamente lento em comparao com as restantes fases da sntese protica. c) Alongamento (ou elongao): inclui todas as reaes desde a sntese da primeira ligao peptdica, at adio do ltimo aminocido da cadeia polipeptdica. d) Terminao: A reao de terminao envolve a libertao do polipeptdo do ltimo tRNA, a expulso do tRNA do ribossomo, e a dissociao deste do mRNA. 85.Qual a funo da seqncia de Shine-Dalgarno? A sequncia de Shine-Dalgarno uma seco de nucleotdeos em uma molcula de mRNA procaritica, acima do local de incio da Traduo, que serve para unir ao RNA ribossmico e ento trazer o ribossomo ao cdon de incio no mRNA. 86.Aps formado o complexo de iniciao, o segundo aminocido ligado ao seu tRNA entra no passo seguinte com o auxlio do fator Tu. Qual o nome do fator que tem essa mesma funo em eucariotos? De onde estes fatores tiram a energia para encaixar o aminoacil-tRNA correto para o cdon presente no stio A? Em eucariotos o fator eIF-2 (eucariotic iniciation factor 2), tirando energia do GTP.(FERIFICAR RESPOSTA COM A PROFESSORA)

87.Qual o sentido em que so adicionados os aminocidos na cadeia polipeptdica nascente? Sentido 53. 88.Aps a transferncia do polipeptdio nascente para o aminoacil tRNA presente no stio A do ribossomo, ocorre a translocao do ribossomo pra o cdon seguinte. Qual a molcula que medeia a translocao em eucarioto e em procarioto, e qual a fonte de energia utilizada para realizar esse processo? Fonte de Energia: GTP.

89.Ao encontrar um cdon sem sentido o que ocorre com a sntese proteica? Qual o papel dos fatores de terminao?

O sinal para terminao dado por um cdon sem sentido (UAG, UAA) que entra no stio A. Os fatores de terminao libertam a cadeia polipeptdica e retiram o ltimo tRNA do stio P. O ribossomo fica livre para iniciar outra sntese. Na outra extremidade, medida que o mRNA tambm vai ficando livre, ele pode se associar a outro(s) ribossomo(s), formando uma estrutura alongada muito comum, que so os chamados polirribossomos. Esses polirribossomos aparecem normalmente na sntese de protenas de cadeia muito longa, onde so sintetizadas vrias molculas da protena ao mesmo tempo.

90.A mdia de massa de 20 aminocidos comuns por volta de 137 dltons. Calcule o comprimento aproximado de uma molcula de RNAm que codifica um polipeptdeo com uma massa de 65.760 dltons. Assuma que o polipeptdeo contm quantidade iguais de todos os aminocidos. ????? 91.Identifique trs tipos de RNA que esto envolvidos na traduo e liste as caractersticas e funo de cada um deles. Os trs tipos de RNA envolvido na traduo so : RNAm (mensageiro), RNAt (transportador) e RNAr (ribossmico): RNAm (cdon): o negativo do gene, formado por trincas de bases, determina a seqncia dos aminocidos na protena. RNAt (anticdon): carrega e entrega o aminocido correto para o ribossomo. Numa extremidade possui uma trinca de bases complementar ao cdon, na outra, o aminocido correspondente. RNAr: forma o ribossomo. Traduz os cdons numa seqncia de aminocidos. Une os aminocidos por ligaes peptdicas 92.Descreva o que traduo monocistrnica e policistrnica. Existe vantagem de uma sobre a outra? Qual?

A traduo policistrnica uma traduo realizada pelo RNA Policistrnico, na qual o RNA mensageiro que promove a sntese de mais de uma protena. J a traduo monocistrnica uma traduo realizada pelo RNA monocistronico, no qual Cada mRNA corresponde a transcrio de um nico gene. mRNA policistrnico, vrias ORFs, cada uma com RBS (stios de entrada do ribossomo) mRNA monocistrnico, interao entre protenas que se ligam a cauda poliA e protenas do Complexo de Iniciao Nos procariotos a traduo simultnea transcrio. Mais ainda, um mesmo mRNA pode ser traduzido por dezenas de ribossomos enfileirados, o que resulta num nmero elevado de cpias repetidas de uma protena a partir de uma nica molcula mensageira o que pode ser desvantajoso! Sendo assim existe maior vantagem traduo monocistronica pois esta no gera um elevado numero de copias muitas vezes desnecessrio.

CONFIRMAR!!!!!
93.O que significa universalidade do cdigo gentico? Diz-se que o cdigo gentico universal, porque os cdons possuem o mesmo significado em quase todos os organismos. (Os mesmos cdons de um aminocido nas bactrias corresponde a este nos mamferos). 94.O que significa no ambigidade do cdigo gentico? No existe ambigidade no cdigo gentico, porque um mesmo cdon no codificar dois aminocidos diferentes ao mesmo tempo.

95. Porque na clula eucaritica, diferente da clula procaritica, a traduo de um RNA no pode ocorrer ao mesmo tempo em que este RNA transcrito? 96 .Defina anti-codon. 97. Em que stio do ribossomo se liga o primeiro Met-tRNA? Quais as protenas envolvidas na iniciao da traduo?

98. Qual a funo dos fatores de alongamento da traduo? 99. Tenha em mos a tabela de correspondncia codons/aminocidos, observe abaixo a seqncia de DNA correspondente fita codificante de um gene e responda: 5CGATCGACCTAGATGGATTCGATCGATTCGGAGCTAGGCTAGTCTAACTGATCG3 a) Transcreva a molcula de RNA correspondente a este gene b) Circule o cdon onde comea a sntese da protena (cdon de iniciao) c) Sublinhe o cdon de iniciao (note que este cdon deve estar na mesma fase de leitura usada para a sntese da protena) d) Traduza a seqncia do RNA em protena

Formao complementar http://www.dnalc.org/resources/ http://www.ac-creteil.fr/biotechnologies/ http://www.johnkyrk.com/ http://www.ncbi.nlm.nih.gov/