Você está na página 1de 35

Exerccios do livro Gentica na agropecuria

Capitulo 2 Variao e seu significado biolgico



1 Porque a partir da existncia da variao que pode ocorrer a seleo natural ou artificial.
Tambm a partir da variao que pode ser estudado o modo como um carter herdado.

2 A variao gentica resultado da informao contida nos genes, que so repassados aos
descendentes. J a variao ambiental resultado dos efeitos do ambiente sobre o
desenvolvimento dos organismos e essa informao no est contida nos genes.

3 A variao entre os bezerros gentica, j que eles no so idnticos entre si, e ambiental
j que h fatores como a alimentao da vaca, que influenciam nos diferentes pesos
adquiridos pelos bezerros. Os leites tambm tm variao de peso tanto gentica, j que
cada leito vem de um vulo e em espermatozide diferentes, quanto ambiental, j que h
fatores como o local no tero onde o leito se desenvolve que influenciam no peso que ele
adquire.

4 A natureza da variao dos gros de milho gentica, pois cada gro possui um gentipo, e
ambiental, pois a localizao do gro na espiga pode influenciar no seu tamanho, por exemplo.
No caso do trigo, por ser uma espcie autgama, tem os gros genotipicamente iguais, e a
variao de natureza ambiental.

5 Conservar a variabilidade gentica de espcies de interesse para o Brasil: O profissional que
trabalha nesse centro realiza vrias atividades relacionadas a conservao de germoplasma,
como a prospeco, coleta, introduo dos acessos aos bancos, intercmbio e quarentena de
materiais, multiplicao e regenerao de materiais.

Capitulo 3 Gentica molecular

1 1. A + G = 20 + 30 = 50 DNA de fita dupla
T + C = 20 + 30 = 50

2. A + G =40 + 10 = 50 DNA de fita dupla
T + C = 40 + 10 = 50

3. RNA presena de uracila

4. RNA

5. A + G = 30 + 20 = 50 A T DNA de fita simples
T + C = 20 + 30 = 50 C G

2 Clula haplide -> 1,3 x 10^-12 g de DNA
A = 28 %
a) citosina = ?
A = 28% G + C = 100 56 = 44%
T = 28% =>56% C = 22%


b) 1 nucleotdeo P = 1,6 x 10^-24 x 330 1 dalton = 1,6 x 10 ^-24
P = 5,5 x 10 ^-22
Cl. somtica 1,3 x 10 ^-12 g x 2 = 2,6 x 10^-12

Nmero de nucleotdeos = 2,6 x 10^-12 / 5,5 x 10^-22
= 4,7 x 10^9 g
c) DNA de clula haplide
1nm = 10^-9 m
1A = 0,1 nm
3,4 A = 0,34 nm

Clula haplide = 2,35 x 10 ^9 nucleotdeos em cada fita = 1,17 x 10^9 nucleotdeos
Comprimento = 0,34 x 10^-9 x 1,17x10^9
c = 0,4 m

d) Significa que o DNA deve sofrer grande empacotamento e condensao, para que possa
preencher as dimenses da clula.

3 clula haplide = 2,35 x 10^9 nucleotdeos
Tipos de molcula = 4 ^n n= nmero de pares
0 Tipos = 4^(1,17 x 10^9) de nucleotdeos

4 a)

b) 200 aminocidos
200 cdons + 1 cdon metionina + 1 cdon sem sentido
202 x 3 = 606

2016 nucleotdeos
hnRNA = 1008 nucleotdeos
ntrons = 1008 606
ntrons = 402 nucleotdeos

5 Fita de DNA
20% A 20% T DNA dupla hlice
30% C 30% G A = 20 + 10 = 30/2 = 15%
40% G 40% C T = 20 + 10 = 30/2 = 15%
10% T 10% A G = 40 + 30 = 70/2 = 35%
C = 40 + 30 = 70/2 = 35%

6 genoma haplide
10^9 molculas de filerona
10^4vezes de transcrio do gene
RNAm traduzida = 10^9/10^4 = 10^5vezes
7 60 protenas ; 120 aminocidos = 120 cdons + 1 cdon metionina + 1 cdon finalizador =
122 cdons

122 x 60 = 7320 cdons 7320 x 3 (nucleotdeos) = 21960 nucleotdeos nos xons.

8 A presena de amido ou de acares solveis em gua pode ser resultado da ao de
diferentes enzimas na formao de agrupados de unidades de acar.

9 1212 bases no gen ( nos xons)
a) 1212 / 2 = 606 nucleotdeos no RNAm
606 / 3 = 202 cdons
202 1 cdon de terminao = 201 aminocidos

b) 606 bases RNAm
e) 201 RNAts
1 ribossomo

10- a) 5 AUGCACCGAAGAAUUCCACCACCACCACCAUAGA
b) 10, incluindo a metionina
c) 10x10 = 100 RNAt
10 molculas -> 10 ribossomos
d) met his arg aqrg ili pro pro pro pro pro
e) met his arg arg ili arg thr thr thr thr

Captulo 4 Organizao do material gentico e diviso celular

1 Na propagao assexuada, so gerados indivduos idnticos ao que lhes deu origem e na
propagao sexuada os indivduos gerados so resultado da unio de gametas de dois
genitores, sendo portanto d istintos.

2 Porque permite a formao de novas combinaes genticas entre alelos de diferentes
cromossomos e at mesmo dos mesmos cromossomos devido a permuta gentica.

3 a) 3 pares heterozigotos n = 3
Nmero de orientaes na metfase 1 = 2^(n-1) = 2^(3-1) = 4
4 orientaes

b) nmero de orientaes = 4
60 clulas clulas = 60 / 4 = 15

c) 60x4 = 240 gametas
tipos de gametas : 2^3 = 8
MDF = 240 / 8 = 30 gros de plen

d)2 = 8 tipos

4 Todos os alhos gerados a partir de um indivduo sero idnticos.

5 2048 orientaes
a) 2^(n-1) = 2048 2^11 = 2048
n = 11 + 1 = 12
genoma = x(nmero bsico) = 12

b) 2^12 = 4096 gametas diferentes

6 Porque isso um caso dereproiduo assexuada, onde a diviso celular para originar a
borbulha foi mittica, gerando clulas idnticas e assim os frutos so idnticos aos da planta
matriz.

7 a) 2^n = 2^20 40 cromossomos , n = 20
Probabilidade de um gameta igual ao que deu origem ao porco = 1 / 2^20

b) 2n = 40 -> n = 20 (10 pai; 10 me)
C = 20! / (15!x5!) x (1/2)^20
C = 15504 / 1048576
C = 1,48 %

8 Isso ocorre porque o burro um animal com 2n = 63 e como tem metade dos
cromossomos do jumento e metade da gua, o pareamento de homlogos na meiose no
ocorre, alem de haver um cromossomo sobrando, e assim no formam-se gametas viveis.

Captulo 5 Mendelismo

1 a) Carter controlado por um gene ( monognico), sendo o alelo de semente lisa
dominante sobre o alelo da semente enrugada.

b) Possvel fecundao de plen com gentipo diferente de Aa.

c) sementes lisas = sementes AA = 1/3
sementes Aa = 2/3

300AA 300 = (1/3)x
X = 900 sementes

d) Sim, atravs do retrocruzamento entre o parental recessivo e os indivduos F1, onde espera-
se a freqncia de 1 liso : 1 enrugado.

e) Sementes lisas 1/3 AA ; 2/3 Aa

1/3 AA x AA = 100% AA

2/3 Aa x Aa -> AA = x 2/3 = 1/6
Aa = 2/4 x 2/3 = 1/3
Aa = 2/3 x = 1/6

AA = 2/6 + 1/6 = 3/6 fentipo lisas = 5/6
Aa = 2/6
aa = 1/6 enrugadas = 1/6

2 100% Aa ( 70% Aa e 30% AA)
Aa x Aa = 7/10 AA = x 7/10 = 7/40
Aa = 2/4 x 7/10 = 14/40
Aa x 7/10 = 7/40
3/10 AA x Aa
AA 3/10 x 2/4 = 6/40
Aa = 3/10 x 2/4 = 6/40

AA = 7/40 + 6/40 = 13/40 82,5 % lisa
Aa = 6/40 + 14/40 = 20/40 --|

Aa = 7/40 ->17,5 % enrugada

3 Realizar o cruzamento teste, ou seja, cruzas as galinhas de pescoo pelado com galinhas de
percoo com penas, que so homozigticas recessivas. Se no for produzido nenhum
descendente homozigoto recessivo, a galinha homozigota para pescoo pelado.

4 a) touro Mm ; Vaca A mm; Vaca B mm; Vaca C Mm

b) Mm x Mm
MMMm -> mochos
Realizar cruzamentos testes destes animais mochos com animais chifrudos e selecionar os
animais homozigticos e realizar cruzamento entre eles at atingir os 20 animais.

5 C -> folha crespa ; c -> folha lisa ;
Heterozigotos = (1/2)^g g = nmero de geraes com autofecundao
Het = ()^4 = 1/16

AA = aa = [1 (1/2)^g]/ 2

AA = aa = [1 1/16] = (15/16) / 2 = 15 / 32

Genotpicas: AA = 15/32 ; Aa = 1/16; aa = 15/32
Fenotpicas: folha crespa = 17/32; folha lisa = 15/32

6 Seriam mantidas as freqncias de F2 :
Genotpicas: AA = ; Aa = 2/4; aa =
Fenotpicas: folha crespa = ; folha lisa =

7 a) Carter monognico, sendo o alelo da folha normal dominante sobre o alelo da folha
batata.
b) 1 NN x nn ; 2- Nn x Nn ; 3 nn x nn ; 4 Nn x nn ; 5 NN x N_

8 a) Presume-se que o carter seja monognico, sendo o alelo do florescimento precoce
dominante sobre o alelo do florescimento tardio. Para que isso seja verdadeiro, a proporo
fenotpica na F2 deve ser 3:1.

F2 -> 281 p + 80 t = 361 -> 361 / 4 -> 90,25 -> 90,25 x 3 = 270,75



F2
observado
Esperado
r

Precoce
281
270,75
(10,25)/270,75 =
0,39
Tardio
80
90,25
(10,25)/ 90,25 =
1,16




1,55
G.L. = 130% > P>20%
R = O desvio no foi significativo, logo a hiptese de carter monognico verdadeira.
b) F2 -> 150 sementes com florescimento tardio
150 = (1/4)x x = 600 sementes9 O carter da cor do hipoctilo monognico, sendo a cor
rosa dominante sobre a cor verde e o carter do tipo de folha tambm monognico, sendo
que a folha normal dominante sobre a folha batata. Cada carter se expressa
independentemente um do outro, sendo que os alelos de cada gene se combinam na
proporo (3:1)(3:1) = 9:3:3:1

b)
F1:
BBVV x bbvv
F2:
BbVv x BbVv
RC1:
BbVv x BBVV
RC2:
BbVv x bbvv

10 a) Os resultados de F2 e de RC2
b) Na metfase I (onde ocorre a orientao dos cromossomos homlogos) e a anfase I ( onde
ocorre a segregao dos homlogos) da meiose. Gerao F1

11 arroz 2n = 24 12 pares
a) recessivos -> autofecundao de heterozigoto
()^12
b) gentipo heterozigoto (1/2)^12
c) fentipo (3/4)^12
d) (1/2)^2 = ou 2/8
AA = 3/8 aa = 3/8

Recessivos (3/8)^12
Gentipo (1/4)^12
Fentipo (3/8 + 2/8)^12 = (5/8)^12

12 B -> raiz marrom; b -> raiz branca
L -> fruto estreito; l -> fruto largo

B_L_ x bbll
40 f. estreitos Bb
Ll /_ bb

BbLL x bbll
Bb x bb
Bb -> 50% BbLl
Bb -> 50 % bbLl
13 T trote ; t marcha ; A baio ; a preto
Ttaa x TTAA = TtAa
Marchadores e baios ttAA

Realizar o cruzamento entre os heterozigotos TtAa e selecionar os animais ttA_. Realizar o
cruzamento teste entre estes indivduos e indivduos pretos e selecionar os que no geraram
nenhum indivduo preto.

14 BBCCTTNN x bbccttnn
F1 BbCcTtNn
a) bbccttnn (1/4)^4
b) b) B_C_T_N_ (3/4)^4
c) BbCcTtNn(1/2)^4
d) as mesmas

15- Bb (1/2)^3 = 1/8 BB = (1-1/8) /2 = 7/16

a) (7/16)^4
b) (7/16) + (2/16) = (9/16)^4
c) (1/8)^4

16 R -> resistente
r - > susceptvel
Rr x Rr
Rr -> 31/64
Rr -> 2/64 = 1/32 = (1/ 2^5)

5 autofecundaes

17 O alelo recessivo, pois dois indivduosno afetados geraram prole com indivduos
normais e afetados, indicando que so heterozigotos para o gene.

18 a) Os caracteres so controlados por um gene cada, sendo que em ambos, o fentipo
resistente o dominante.

b) IV

c) 3/8 resistente as 2 doenas
1/8 resistente a 1 e susceptvel a 2
1/8 resistente a 2 e susceptvel a 1
3/8 susceptivel as 2 doenas




Captulo 6 Interaes allicas e no allicas

1 Pena normal -> ff
Penas acentuadamente onduladas -> FF
Penas medianamente onduladas Ff

12 por ninhada
36 (18 Ff; 15 FF ; 3 ff)

Ff x Ff (1/4 FF; Ff; 1/4ff)

x 12 = 3 FF ; 3 ff
x 12 = 6 Ff

Ff x FF => = Ff ; FF -> x 12 = 6 FF e 6 Ff

FF = 6+3+6 = 15 Gentipos das galinhas : FF , Ff e ff
Ff = 6+6+6 = 18
ff = 3

2 m -> chifre
M -> mocho a) MmRr (3:1) x MmRr (1:2:1)

RR -> Vermelho 3 vermelho mocho : 6 mocho ruo : 3 mocho branco: 1 chifre
Rr -> ruo vermelho: 2 chifre ruo : 1 chifre branco.
Rr -> branco

b) F2 20 animais vermelhor e mochos homozigotos
MMRR = x = 1/16
20 = (1/16)x -> x = 320 animais

c) F2 RrMm 2/3
RrMM 1/3
2/3 Mm x MM 1/3
MM = 1/3 x 2/3 x 2/4 = 4/36
Mm = 4/36

2/3 Mm x Mm 2/3
MM = mm = 2/3 . 2/3 . = 4 / 36
Mm = 2/3 . 2/3 . 2/4 = 8/36

1/3 MM . MM 1/3
MM = 1/9 = 4/36
MM = 4/36 + 4/36 + 4/36 + 4/36 = 16/36
Mm= 4/36 + 8/36 + 4/36 = 16/36
Mm = 4/36

MMRR = . 16/36 = 16/144
MMRr = 2/4 . 16/36 = 32/144
MMrr = 16/144
mmRR = 4/144
MmRR = 16/144
mmRr = 8/144
MmRr = 32/144
Mmrr = 4/144
Mmrr = 16/144

Mocho vermelho = 16/144 + 16/144 = 32 / 144 = 4/18
Mocho ruo = 32/144 + 32/144 = 64/144 = 8/18
Mocho branco = 16/144 + 16/144 =32/144 = 4/18
Chifre vermelho = 4/144 = 1/36
Chifre ruo = 8/144 = 1/18
Chifre branco = 4/144 = 1/36

3 F2 11 vermelhos esfricos
20 vermelhos ovais
9 vermelhos alongados
21 rosas esfricos
39 rosas ovais
19 rosas alongadas
10 brancos esfricos
22 brancos ovais
11 brancos alongados

Corda raiz
Vermelhas : 40 1
Rosas: 19 2
Brancas: 43 1
Total: 162

Forma da raiz
Esfricos : 42 1
Ovais : 81 2
Alongados: 39 1
Total: 162

a)Dominncia parcial ou incompleta, indicado pelo fentipo do heterozigoto que
intermedirio aos dois homozigotos.
b) facilita, pois permite identificar os homozigotos
c) VVAA x vvaa ou VVaa x vvAA
d) 50 plantas vvaa=1/4 . = 1/16
50=(1/16)x -> x= 800 plantas

4 abbora : branca, amarela e verde
Puras brancas x puras verdes
F1 todas brancas -> AaBb
F2 42 brancas : 13 amarelas: 3 verdes -> 61
12:3:1

a) carter regulado por 2 genes que segregam independentemente, cada um com 2 alelos,
sendo o alelo A episttico dominante sobre o alelo B.
b) frutos amarelos
frutos brancos
27b : 16a : 16v -> 59
2: 1 : 1

AaBb x aaBb
AaBb + Aabb -> 2 brancos

aaBb -> 1 amarelo
aabb -> 1 verde

5 branca x branca ->100 prpura
245 -> 110 brancas : 135 prpuras
7:9

9 { P_V_
7 { P_ vv ; ppV_; ppvv
R: Carter controlado por 2 genes que se segregam independentemente um do outro, sendo a
interao entre eles do tipo epistasia recessiva dupla.

6 amarela, roxa ou branca
Roxa x branca
F2 : 9 roxas :3 amarelas : 4 brancas
9 { C_D_ -> roxo
3 { ccD_ -> amarelo
4 { C_dd -> branco ; ccdd -> branco

a) carter controlado por 2 genes que so independentes, sendo a interao do tipo epistasia
recessiva, sendo o alelo d episttico ao alelo C..
1d 1c
b) sub -----PI --------- PF
branco amarelo roxo

7
a) IiAAMm -> branco
IiaaMM -> branco
IIAAMM -> branco
iiAAMM -> prpura
iiAAmm -> vermelho

b)IiAaMm x IiAaMm
I_A_M_ = (3/4)^3 = 27/64
I_A_mm = (3/4)^2.1/4 = 9/64
I_aamm = . (1/4)^2 = 3/64
Iiaamm = 1/64
I_aaM_ = (3/4)^2.1/4 = 9/64
iiaaM_ = (1/4)^2.3/4 = 3/64
iiA_M_ = 9/64
iiA_mm = 3/64

branca = 52/64
prpura = 9/64
vermelho = 3/64

8 A + B
510 brancas : 176 purpuras
3:1
A autofecundada
76 purpuras : 58 brancas
9:7
PpVv x ppvv
Ppvv } B -> 3:1
PpVv } P
Ppvv; ppVV } B

a) PpVv x ppvv
b) ppvv
100% ppvv
100% branca

9 C 1 -> raa 1 ; C2 -> raa 2 } codominantes

Altura = A_B_ ; A_bb } alta
aaB_} mdia
aabb } baixa

a) AaBbC1C2 x aabbC1C2

b) Para o carter resistncia, o carcter monognico, com 2 alelos com codominancia. Para o
carter altura, controle de 2 genes independentes, sendo A e a, B e b os alelos de cada genes,
sendo A episttico dominante sobre B. Os 3 genes so independentes.

10 a) A cor da plumagem controlada por 3 genes
B) F1 100% brancas
F2 13/16 brancas; 3/16 coloridas

Captulo 8 Alelismo mltiplo
1 a) 2 alelos
NGD= 2(2+1)/2 ----> NGD = 3 gentipos

b) n de fentipos = m
n de fentipos = 2
c) n de fentipos = NGD
n de f = 3
d) m = 10 alelos
gentipos = 10(10+1)/2
gentipos = 55

10 fenotipos (dom completa)
55 fenotipos (dominncia incompleta)
e) 10 genotipos homozigotos

2 Porque um individuo diplide s pode ter no maximo 2 alelos

3 12 alelos
a) 12/2 = 6 indivduos
b) NGD = 12 (12+1)/2
NGD = 6.13 = 78 gentipos

4 5 alelos p^g > p5 > p 0 > pt > p
a) gentipos homozigotos = 5
gentipos heterozigotos = 5 (5-1)/2 = (5 .4)/2 = 10

b) 5 fenotipos
vagem prpura com suturas verdes
p^gp^g, p^gp5, p^gp0; p^gpt; p^gp
vagem verde com suturas prpuras
p5p5, p5p0; p5pt; p5p
vagem verde com sutura ventral prpura
p0p0; p0pt; p0p
vagem extremidade prpura
ptpt; ptp
vagem verde
pp

5 3 alelos (A, A, A)
A = A > A
a)Gho = 3 (3-1)/2 = 3
Gho =3
b) 3+1 = 4 fenotipos
c) A4>A5 = A6> A=A > A
Gho = 6 Ghe = 6 (6-1)/2 = 15
Fentipos = 6 + 2 = 8

6 R> rr
35% RR
20% rr
45% rr

RR x rr
Rr = 0,45 x 0,35 x 2
Rr = 31,5
Rr x rr
Rr = 0,45 x 0,45
Rr = 20,25 %
RR x RR
RR = 0,35 x 0,35
RR = 12,5%
rr x rr
rr = 0,2 . 0,2
rr = 4%
RR . rr
Rr = 0,35 . 0,2 . 2
Rr = 14%
rr . rr
rr = 0,2 . 0,45 x 2
rr = 18%

Fentipos
Vermelho = (RR, Rr, Rr) = 57,75%
Manchas averm (rr, rr) = 22%
Verm. Claro (rr) = 20,25 %

7 O segundo agricultor, pois utiliza diferentes cultivares, sendo que estas tm mais chances
de ter alelos de incompatibilidade diferentes, possibilitando maior nmero de fecundaes.
8 a) no se considera os homozigotos
NGD = NGhe = 6(6-1)/2
NGD = 15 gentipos

b) 2/n = 2/6 = 1/3 dos gametas abortaro.

10
a) S>S > S > S4
SS
SS
SS4

Cruzamentos = 3 = 9
3 cruza,emtps s]ap emtre os ,es,os gentipos, logo daro 100% de aborto.

3/9
b) Obter artificialmente indivduos homozigotos SS, SS, SS e S4S4 e utilizar duas delas para
obter hbridos. Plantar cada linhagem em fileiras alternadas. Como no poder ocorrer
autofecundao, nem fecundao entre indivduos da mesma linhagem, as sementes obtidas
sero todas hbridas, provenientes de fecundao aleatria.

11 a) Avaliar se ocorrer auto fecundao nestas plantas.
b) atravs de propagao assexuada ou atravs da autofecundao artificial, ondese retira a
extremidade dos pistilos ou se fecunda o plen antes da maturao dos pistilos.
c) Usar duas linhagens autoinconpatveis e planta-las em fileiras alternadas. Assim, s se ter
fecundao aleatria entre os 2 linhagens.

12 Realizaria cruzamentos entre indivduos homozigotos de diferentes fentipos. Se em
todos os cruzamentos ocorrer na gerao F a proporo de 3:1 ou 1:2:1, ocorre uma srie
allica. Se em um dos cruzamentos na gerao F2 a proporo for diferente, ocorrem mais de
um gene.

Captulo 9 Ligao, permuta gentica e pleiotropia

1 D = Planta alta
d = planta an
P = rugoso
p = liso

an lisa ddPp = 5 ; ddpp = 118 -> dp ; Ddpp = 5; DdPp = 161 -> DP ; total = 289

a) 72,25 para cada fentipo
b) Os genes so ligados, sendo a distncia entre os genes de 3,46 cM -> PG = 3,46

2 a)


b) 100 meicitos -> O nmero de clulas com permuta gentica 3,46 x 2 = 6,92. Ou seja,
aproximadamente 7 meicitos apresentaro permuta entre P e D.

3 I -> resistncia ao vrus da mancha anelar
C -> resistncia ao vrus do mosaico

IiCc x iicc
440 IiCc
450 iicc
151 Iicc
145 iiCc

Fa = (151 -145)/1186 = 25%

a) 25 cM
b)


Resistente aos 2 vrus

Suscetvel aos 2 vrus

Resistente apeas ao vrus da mancha anelar

Resistente apenas ao vrus do mosaico

c) Fase de atrao

4 R -> nodulao normal
R -> sem nodulao
F -> caule cilindrico
F -> caule fasciado
P1 RRFF x p2 rrff
F1 RrFf

e
c
x
R_F_
746,4
820
(13,6)/146,4 = 7,25
R_ff
248,8
228
1,13
rrF_
248,8
227
441/248,8 = 1,77
rrff
82,9
52
954,8/82,9 = 11,5



x = 22,25

a) De acordo com os resultados de x, percebe-se que os desvios foram altamente
significativos. Sendo assim, conclui-se que os genes no so independentes,esto no mesmo
cromossomo.
b) fase de atrao
c) FR = (68+72)/350 = 0,4 ou 40 cM

5 W -> preto fr -> folhas onduladas
w -> branco Fr -> folhas lisas
d = 34 cM

a)


F1

Wfr = 33%
wFr = 33%
wfr = 17%
WFr = 17%

Wfr / Wfr = 0,11
wFr / Wfr = 0,11
Wfr / wFr = 0,11
wFr / wFr = 0,11
Wfr / wfr = 0,056
wFr / wfr = 0,056
Wfr / WFr = 0,056
wFr / WFr = 0,056
wfr / wFr = 0,056
WFr / WFr = 0,029
wfr / Wfr = 0,056
WFr / wfr = 0,029
WFr / Wfr = 0,056
WFr / wFr = 0,056
wfr / wfr = 0,029
wfr / WFr = 0,029


APFL = 53,1%

APFO = 22,2 %

ABFL = 22,2%

ABFO = 2,9%


b)
APFO = 33%
APFL = 17%
ABFO = 17%
ABFL = 33%

6 P -> Pericarpo vermelho
p -> pericarpo incolor
ts2 -> sementes no pendo
Ts2 -> pendo normal

b)
FR 1 = 29 / 2422 FR 2 = 17/1207
FR1 = 1,19% FR 2 = 1,4%
a freqncia em mdia 1,29%

c)

P Ts2 = 49,35%
p Ts2 = 49,35%
p ts2 = 49,35%
P ts2 = 49,35%
P ts2 = 0,645
P Ts2 = 0,645%
p Ts2 = 0,645
p Ts2 = 0,645%

ppts2ts2 = 31,8%

q polpa verde
c casca verde
f fruto liso

F1 QqCcFf





F2



esp.
x
qqccff -> 42
420
0,009
QqCcFf -> 418
420
0,009
qqCcff - > 424
420
0,038
QqccFf -> 416
420
0,038

GL = 3
x=0,094

a e b) Os genes da cor da polpa e do tipo de fruto so ligados e inteiramente ligados, pois no
existem recombinantes entre elss. J o gene da cor da casca independente dos 2 genes.

8 L e Cu = 16cM (1x)
L -> folha estreita
l -> folha larga
Cu -> folhas normais
cu -> folhas onduladas
(x2) W -> resistente ao fusarium
w -> suscetvel ao fusarium

a)
.
_cu = 42%
W = 50%
lCu = 42%
w = 50%
Lcu = 8%

lcu = 8%



LcuW = 21%
LCuW = 4%
_cuw = 21 %
L Cuw = 4%
lCuW = 21%
lcuW = 4%
lCuw = 21%
lcuW = 4%

b) llcu cuww


9 -
gl -> f. brilhantes
v -> virescentes
lg -> s/ lgula

PD =
Glgl Vv Lglg

glgl vv lglg


P1 =
Glgl vv lglg


P2 =
glgl Vv Lglg


I =
Glgl vv Lglg

glgl Vv lglg


II =
Glgl Vv lglg

glgl vv Lglg

I = 190/1000 = 19 cM
II = 413/1000 = 41,3 cM

a)


b) FPDE = (19 x 41,3)/100 -> FPDE = 7,84%

FPDO = (28 + 23)/1000 * 100
FPDO = 5,1 %

I = 1 (5,1/7,84) -> I = 1 0,65 -> I = 0,35
35% das pd no ocorrem



10

b) lu bm = 12cM
lu bv = 18cM
gl vp2 = 4cM
gl bm = 7cM
vp2 ps = 1cM
vp2 bm = 3cM

11
m folhas manchadas
d planta an
p fruto piloso



M e D





Mdp -> 0,022

MDP -> 0,455
MDP -> 0,022

mdp -> 0,455
MDp -> 0,022


mdP -> 0,022


MdP -> 0,001

MDP/ MDP = 20,7%
MDp -> 0,001




MdP/MdP = 10^-4%




pd = 0,002

b) mDP/ Mdp

MDP/MDP = 2,25 x 2,25 = 0,05%

12 -


a)


b) h a = 20cM
a id = 17,4cM

9,3% H a id = 20 % - 2,78/2 0,2 = 1 o/e
9,3% h A Id

8% H A id = 17,4% - 2,78/2 0,2 = 1 ob/3,48
8% h a Id

1,39% H a Id = 2,75 % 0,2 = (3,48 3,48)* o /3,48
1,39 h A id

31,3% H A Id = 62,6 % 3,48 * 0,2 = 3,48 o
31,3% h a id 0,696 3,48 = o
-2,78 = - o => o = 2,78

13 - a-> distribuio independente

12cM
a)
Cr1D1 = 9%
Cr1 D1 A = 4,5%
Cr1 d1 A = 20,5%
cr1d1 = 9%
Cr1 D1 a = 4,5%
Cr1 d1 a = 20,5%
Cr1d1 = 41%
cr1 d1 A = 4,5%
cr1 D1 A = 20,5%
cr1D1 = 41%
cr1 d1 a = 4,5%
cr1 D1 a = 20,5%

b) Cr1 D1 A / cr1 d1 a
P = 0,045

n = [log (1 0,95)] / log (1 0,045) = (log 0,05) / log 0,955 = - 1,3 / 0,019

n = 68,42 x 50
n = 3253 plantas

14 a) herana controlada por dois genes, sendo osalelos de resistncia dominantes sobre os
alelos de susceptibilidade, sendo que os dois genes esto no mesmo cromossomo.

b) realizar o cruzamento F2.


Captulo 10 Efeito do ambiente na expresso gnica

1 No himalaia a enzima codificada pelo alelo funcional funciona sob condies de baixa
temperatura, que so atingidas nas extremidades do coelho, limitando esse ambiente para as
demais partes corpreas do animal. O pelo ficar preto porque se estar criando o ambiente
propcio para a ao da enzima. Dessa forma, diz-se que o ambiente influencia na expresso do
fentipo.

2 a) A ao da clorofila s ocorre com a ao da luz. Como a grama nova no recebe luz
quando estava se formando, no foi produzida clorofila e a grama ficou branca.

b) Significa que essas plantas tem gentipo albino.
c) fenocpias.

3 a) as mdias das cultivares.
b) As mdias de todas as cultivares em cada local.
c) SQcl = 52279315,5
Sim, existe interalo gentipo x ambiente.

d) Avaliar como cada cultivar se comporta em cada ambiente.

4
Caldas -> mdia ( 1825; 2329; 2216 ; 2199 ) = 2069
Machado -> mdia (91; 595; 482; 465; 40) = 335

-1134

5 a) no houve interao.
b) houve interao do tipo complexa.
c) houve interao do tipo complexa.

6 a) Sim, pois h evidncia de que cada cultivar responde de forma diferente ao tipo de
cultivo.
b) Indica para que cultivares o cultivo mais indicado.

7 a) Sim, pois h vrios exemplos em que a maior mdia de um ano foi menor que a mdia
menor de outro ano.
b) Recomenda-se aos produtores utilizar plantas mais velhas para a produo.

8 a) a) A penetrncia do alelo dominante no completa.

b) O alelo dominante expressa uma enzima ativa a 27, mas no a 18C. Sendo assim, o alelo
tem vrios graus deexpressividade. O alelo tem penetrncia incompleta e expressividade
varivel.

9 Plantar cada grupo de sementes e avaliar se as sementes novas que estas sementes
produziro sero diferentes entre si.

10 Quer dizer que a suscetibilidade controlada por um gene que possui expressividade
varivel.

11 a) gentica, ambiental e gentica x ambiental.
B) Compreender que determinados gentipos so mais produtivos que outros de acordo com a
condio a que esto submetidos.

12 a) Ambiental, gentica e gentica x ambiental.
b) Conhecer qual espcie mais adaptada para cada regio.

13 Significa que esses alelos no se expressa em 100% dos indivduos que tem o gentipo aa
e que quando se expressa, possui vrias geraes do fentipo.

Captulo 12 Gentica quantitativa

1 a) 12 m 2
cm

12 x 20
F1 = 16m
1/256 = 1/(4^4) = 0,004

b) c = 20 12 = 8 m
c = 8 m : 8 = 1 m

c) F 1 -> 4 efetivos e 4 no efetivos
c = 8!/4!4! = 70

(70/256)*20.000 = 5468,75 plantas

d) A1 = B1 = C1 = D1 = 2,5 m
A2 = B2 = C2 = D2 = 1,5 m
P1 = A1A1 B1B1 C1C1 D1D1 = 20m
P2 = A2A2 B2B2 C2C2 D2D2 = 12m
F1 = A1A2 B1B2 C1C2 D1D2 = 16m
Como a interao aditiva, a heterose em F1 e F2 zero.

18 m ->6 efetivos e 2 no efetivos
c = 8!/(6!2!) = 28
(28/256)*20.000 = 21875 plantas

e ) 16m -> 4 efetivos e 4 no efetivos
A1A1 B1B1 C2C2 D2D2 X A2A2B2B2C1C1D1D1
F1 A1A2 B1B2 C1C2 D1D2
Produzir a mesma gerao F2 do cruzamento anterior.

f) 12 m -> 0,024%
1/x = 0,00024

x= 1/0,00024 4^x = 4166 = 4096
x = 4166
4^6 = 4096
6 genes -> 12 alelos - 8:12 = 0,66m

g) Que a medida que aumentam os alelos envolvidos no controle do carter, menor a
contribuio de cada um.

2 a) AA BB CC DD = 20 m
aa bb cc dd = 12 m
AA = Aa = BB = Bb = CC =Cc = DD = Dd = 5m
aa = bb = cc = dd = 3m

b) AA bb cc DD x aa BB CC dd
P 1 = 16 m P2 = 16
F1 -> Aa Bb Cc Dd
F1 = 20 m
Ocorrem 5 fentipos, com amplitude de 12 m 20 m

c) hF1 = 20 16
hF1 = 4m
F2 = F1 h/2
hF2 = hF1/2 = 4/2
hF2 = 2 m

3 a) J que a media dos pais igual a mdia de F1 e de F3, a interao do tipo aditiva.
b) 0,001 = 1/1024 = 1/(4^5)
n = 5 genes
c) 10 alelos C = 30 2 = 28 10 = 2,8 m
efetivo = 3 efetivo = 0,2

Nelore = A2A2 B2B2 C2C2 D2D2 E2E2
Holandesa = A1A1 B1B1 C1C1 D1D1 E1E1
Mestias = A1A2 B1B2 C1C2 D1D2 E1E2


a = efetivo
b = no efetivo

d) (a+b)^10 = 1/1024 = 30 c / a
10/1024 272 c / a
45/1024 = 24,4 c / a
120 / 1024 = 21,6 c / a
210 / 1024 = 18,8 c / a
252 / 1024 = 16 c / a
210/ 1024 = 13,2 c / a
120 / 1024 = 10,4 c / a
45 / 1024 = 7,6 c / a
10/1024 = 4,8 c / a
1/1024 = 2 c / a

(a + b)^10/2^10

e) 252/1024 * 2000 = 492,18 animais

4 F1 Aa BbC c Dd Ee Ff Gg Hh Ii Jj
(a + b)^20 / 2^20 = a^20 = 1 / 1048576

20 = 1/1048576 *
20 = 1 / 2097152 x
x = 41943040 animais

5 A = 30g / doa 8 genes com interao aditiva
B = 50g / dia
a) 50 30 = 20g / dia
20 16 = 1,25g / dia
(a + b)^16
A^16 50 g/dia
16A^15 B^1 48,75
120A^15 B^2 47,5
560A^13 B^3 46,25
1820A^12 B^4 45,00
4368A^11 B^5 43,75
8008A^10 B^6 42,5
11440A^9 B^7 41,25
12840A^8 B^8 40
11440 A^7 B^9 38,75
8008 A^6 B^10 37,5
4368 A^5 B^11 36,25
1820 A^4 B^12 35
560 A^3 B^13 33,75
120 A^2 B^14 32,5
16 A^1 B^15 31,25
B^16 30g/dia
total = 65536

b) dominante = 50 : 8 = 6,25g/dia lcus efetivo = 2,5 g/dia
30:8 = 3,75 g/dia

( a + b)^8 =
1(3/4)^8 = 6561/65536 = 50g/dia
8(3/4)^7(1/4)^1 = 17496/65536 = 47,5 g/dia
28(3/4)^6(1/4)^2 = 20412/65536 = 45 g/dia
56 (3/4)^5 (1/4)^3 = 13608/65536 = 42,5 g/dia
40 (3/4)^4 (1/4)^4 = 5670/65536 = 40 g/dia
56 (3/4)^3 (1/4)^5 = 1512/65536 = 37,5 g/dia
28 (3/4)^2 (1/4)^6 = 252/65536 = 35 g/dia
8 (3/4)^1 (1/4)^7 = 84 / 65536 = 32,5 g/dia
(1/4)^8 = 1/65536 = 30g/dia


6 produtividade -> 12 alelos aditivos
teor de protena -> 8 alelos aditivos
a) P = 1/(2^12) x 1/(2/8) = 1/(2^20) = 1 /1048616
P = 9 x 10^-5%

b) P = 1/(2^100)
c) Quanto mais genes esto envolvidos no controle do carter quantitativo, maior deve ser a
populao para se obter o fentipo desejado.
d) 2^10 = 1024 linhagens.

7 a) Porque alm de apresentar varincia ambiental e gentica, apresenta o maior nmero
de gentipos diferentes e portanto maior varincia gentica.
b) Porque apresentam varincia ambiental e gentica e menor nmero de gentipos
envolvidos.
c) Provavelmente interao aditiva.
d) n = (P1 - P2)^2/8 6 = (39,5 27,7)/8*16,01 = gene

variao ambiental = (8,1 + 4,34 + 3,83)/3 = 5,42

8 a) ha = variao GF2/ variao F2 = 16,01 / 21,43
herdabilidade = 74,71%

b) hr = (42,86 29,88)/ 21,43
hr = 60,6%

c) ds = 38 33,4
ds = 4,6%
GS = 4,6 * 0,606
GS = 2,78
GS% = 2,78/33,4
GS = 8,3%
d) Porque a herdabilidade no 100% e tambm porque h segregao dos heterozigotos.

9 a) (SG x H) (SG x H)
mdia = (SGSG + SGH + SGH + HH)/4 = (175,34 + 2*216,67+177,89)/4 = (175,34+ 433,34 +
177,85)/4 = 196,64 kg

b) Do plantel bimestio, pois este apresenta maior variao genotpica.

c) HH x HSG = HH + HSG + HH + HSG (3H 1SG)

3/8H ; 3/8 SG = HSG) * (3/4H SG)
7/18H; 1/8 SG = (3/4H ; SG) * H
d) HH * HSG = HH + HSG + HH + HSG
(555,78 350,58)/3 = 176,61

HSG H SG) = (3HH + HSG + 3SGH + SGSG)/4

(533,6 + 216,67 + 650,01 + 175,34)/8= 196,95kg
(3/4H 1/4SG)*H = (3*HH + SGH)/3 = 933,67 + 216,67 = 187,87kg ???

10 a) media = (V4 + V5)/2 = (27,1 + 25,6)/2 = 26,35
h = 29,7 26,35
h = 3,35
media = (25,6 + 18,8)/2 = 22,2
h = 27,9- 22,2
h = 5,7

b) F2 4:5 = 29,7 3,35/2 = 28,02
F2 5:6 = 27,9 5,7/2 = 25,05

d) (V1 * V2 ) * V3 = (V1V3 + V2V3)/2 = (26,8 + 28,6)/2 = 27,4
(V1*V2)*V3 = 27,7 (F1)
(V1V3 + V2V3) = (V1V3 + V2V3)(V1V3 + V2V3)
F2 = 21,7 + 107,2 + 53,2 + 115,6 + 114,4 + 28,3
F2 = 27,5

(V4*V5)*V3 = 1/2V4V3 + 1/2V5V3 = (28,5 + 27,4)/2 = 27,95
(V4*V2 + V5V3)*(V4V3 + V5V3)
F2 = 28,2 + 114 + 59,4 + 115,6 + 109,6 + 25,6 = 452,4/16
F2 = 28,27

e) (V1V2)*(V5V6) = (V1V5 + V1V6 + V2V5 + V2V6)/4

F1 = (25,1 + 22 + 28,7 + 26,2)/4 = 25,5

F2 = 21,7 + 28,3 + 25,6 + 18,8 + 53,2 + 50,2 + 44 + 57,4 + 52,4 + 55,8 = 407,4
F2 = 25,46

11 a) NHD = 3n!/4!(n-4)! = 6
NHD = (3*6!)/ 4!(2!) = (3*5*6)/1*2 = 45

b) AB + BC + BE + CE

c) (B*C)(A*E) = BA + BE + CA + CE = (7,12 + 6,85 + 6,35 + 6,4)/4
F1 = 6,68

F2 = 1,4 + 1,35 + 1,26 + 1,3 + 14,24 + 12,28 + 13,6 + 12,8 + 12,7 + 13,7
F2 = 5,29
A redio ser de 20,8% . Essa reduo ocorre porque na gerao F2 h segregao e
recombinao dos genes, e a freqncia de locos em heterozigose reduzida metade. Em
conseqncia a heterose manifestada na gerao F1 reduzida tambm em 50%.
h = 6,1 5,29 = 1,41 = 21%

12 a) n = (3 * l!)/ 4!(l-4!)
n= (3*5!)/4!(5-4!) = > n = 3*5 = 15 HD
b) (A*D)(B*C)

Captulo 13 Gentica de populaes

1 a) B1B1 0,086
B1B2 0,458
B2B2 0,476

B1 = 0,086 + 0,438/2
B2 = 0,476 + 0,219 = 0,695

B1 = 0,086 + 0,219 = 0,305

b) p = (0,305) = 0,093 6000 =
2pq = 2*0,305 x 0,695 = 0,424
q = (0,695) = 0,48


obs
esp
x
BB
516
558
3,16
BB
2628
25442,77
BB
2856
2880
0,2


Gl = 2
x= 6,13**
A populao no est em equilbrio.
2 2000 125 brancas
a) VV = 0,0625
V = 0,25
V = 1- 0,25 = 0,75

b) vermelhas VV = 0,5625 * 2000
VV = 1125 plantas
rosas = VV = 2* 0,25 * 0,75
VV = 0,375 * 2000 = 750 plantas

3 VV V = 0,5 ; V = 0,5
VV = 0,25
VV = 2 * 0,5* 0,5 = 0,5
VV = 0,25
1 branca 2 rosas 1 vermelho

4 1200 -> 48 bb
a) bb = 0,04 B 0,834
b = 0,2 b = 0,166
B = 0,8 vermelho- brancas : 1200 * (1,66)
v b = 1200 * 0,0275
v b = 33 animais

b) q = q / ( 1 + q0) = 0,2 / 1,2 = 0,166

5 BB 0,64 * 1200 = 768 ->0,66
Bb 0,32 * 1200 = 384 -> 0,33
total = 1152

0,33 Bb * Bb 0,33
bb = * 0,33 * 0,33
bb -> 0,027 ou 2,7%

6 A -> roxo ; a -> amarelo W = 10.000.
a) amarelo = 1600 / 10.000
aa = 0,16
a = 0,4

b) A -> 0,6
AA -> 0,36 * 10.000
raas homozigotas -> 3600 plantas

c) q = q / (1 + 5q) -> q = 0,4 / [1+ (5*0,4)] -> q = 0,4/(1+2) = 0,4 / 3 -> q = 0,13
aa = 0,017 ou 1,7%

7 aa -> 0,49% -> 0,0049
t = ?
a -> 0,09
t = 1/0,07 - 1/ 0,13

t = 14,29 7,69 = 7 geraes

8 Na popula~~ao com 0,49 % de plantas com bulbos amarelos.

9 2400 gros
a) brancas -> 1176 / 240 -> 0,49 y = 0,7 -> y = 0,3
enrugadas -> 808 / 2400 -> 0,34 su = 0,58 Su = 0,42
b) homozigotas lisas e amarelas
YY = (0,3) = 0,09 SuSuYY = 0,01584 = 1,58%
SuSu = 0,1764

10 a) q = 0,7 / (1+0,7) = 0,7/1,7
y = 0,41
Y = 0,59

q = 0,58 / (1 + 0,58) = 0,58 / 1,58
su = 0,37
Su = 0,63

b) Y = 0,59
Su = 0,63
y = 0,41
su = 0,57

YYSuSu = 0,3481 *0,3969 = 0,14

YySuSu = 0,4838 * 0,3969 = 0,19

YySusu = 0,4838 * 0,4662 = 0,2255

YYSusu = 0,3481 * 0,4662 = 0,1623

total = 71,78%

11 Y -> branca ; y = amarela
20.000 -> 64% com razes brancas
5000 sementes de YY
36% amarela
0,36 -> y = 0,6 y = 1,0
M = 5.000/25.000 = 0,2

q1 = q0 + M (qm - q0)
q1 = 0,6 + 0,2 (1-0,6)
q1 = 0,6 + 0,2*0,4
q1 = 0,6 + 0,08
q1 = 0,68
yy = 0,4624 -> 46,24%

Captulo 16 Efeito materno e herana extracromossmica

1 a) R -> direita F1 -> esquerda
r -> esquerda F2 -> direita
pai -> RR F2 -> RR; Rr; rr
me rr
F1 Rr

b) fenotpica 3 direitas 1 esquerda
genotpica 38 RR ; 2/8 Rr ; 3/8 rr

2 Realizar cruzamentos reprocos. Se for visto que o fentipo de F1 no depende do fentipo
da me, so genes nucleares. Se depender do fentipo da me, efeito materno a herana
citoplasmtica. Nesse caso, se em cruzamentos seguintes, houver persistncia do fentipo, a
herana citoplasmtica. Se no houver, efeito materno. Se em vrios cruzamentos o
fentipo no aparecer em nenhum, houve influncia ambiental.

3 O carter tem herana com efeito materno.

4 Se nos cruzamentos posteriores a F1 persistir, o fentipo determinado pela me, a herana
citoplasmtica. Se aparecer um fentipo diferente em uma gerao, a herana por genes
nucleares que sofrem efeito materno.

5- (amargo) * (doce) ; (doce) * (amargo)
F1 doce -> amargo F1 -> amargo

a) o carter determinado por genes nucleares que sofrem influncia de protenas presentes
no citoplasma da me no inicio do desenvolvimento da planta.

b) DD * dd dd * DD
F1 Dd coce -> amargo F1 Dd amargo

c) F2 : DD : 2Dd : dd F2 : DD : 2 Dd : dd
jovenstodas amargas jovens: todas amargas
adultas 3 amargas : 1 doce adultas: 3 amargas : 1 doce

6 a) Sim, pois nos dois cruzamentos o fentipo de F1 igual ao fentipo da me.

b) Caso seja controlado por um gene nuclear, e o fentipo dominante seja 50g, na gerao f2,
j que h efeito materno, ser expressado o fentipo do gentipo de F1, ou seja, peso 50g. Se
for gerana extracromossomica, no 1 cruzamento F2 continuar com 18 g e no 2 cruzamento
F2 ter 50g.

7 a) alelo cromossmico. A verde ; a amarela;
AA * aa AA * aa
F1 Aa -> verde F1 : Aa -> verde
fator citoplasmtico.
A * a a * A
F1 : A verde F1 : a amarelo.
b) cromossmico
Aa * aa Aa * AA
RC1 Aa ; aa F1 : Aa; AA
1 verde : 1 amarelo 100% verde
fator citoplasmtico

A * a a * A
RC1: 100% verde RC1: 100% amarelo.

c) alelo cromossmico
Aa * Aa
3 verdes : 1 amarelo
fator citoplasmtico.
A * A a * a
F2 : 100% verde F2 : 100% amarelo

d) Aa * Aa (cromossmico)
R : 3 verdes : 1 amarelo

A * a
R: 100% verdes
a * A
R: 100% amarelos.

8 - FAAL * FNAC
F1 FAAL
F2: 309 FAAL 87 FAAC
100% folhas amarelas
3 cristas longas; 1 crista curta
FNAC * FAAL
F1 : FNAL
F
328 FNAL: 107FNAC
3 Cristas longas : 1 crista curta.
100% folhas verdes.

O carter do tipo de crista controlado por um gene nuclear que no sofre efeito materno,
sendo crista longa dominante sobre crista curta. J a cor da folha determinada por um gene
citoplasmtico, j que sempre que a me possui uma cor de folha, seus descendentes tero a
mesma cor.

9 a) LVV * Lvv
F1 : LVv ->verde 100%
F2 : LVV ; LVv; Lvv
3 verdes: 1 amarelo

b) l vv * L VV
F1: L Vv -> verde 100%
F2 LVV ; LVv ; Lvv
3 verdes : 1 amarelo

c) LVV * L vv
F1 LVv 100% verde
F2 LVV ; LVv; Lvv
3 verdes : 1 amarelo

d) L vv * L VV
F1 LVv 100% amarelo
F2 LVV ; LVv; Lvv
100% amarelo

e) LVv * LVv
LVV ; LVv; Lvv
3 verdes : 1 amarelo

f) L Vv * L Vv
C : LVV ; L Vv; L vv
100% amarelo.

10 a) Herana citoplasmtica.
b) 1 100% branco
2 100% verde
3 plantas verdes, variegadas e brancas.
4 100% branco.

11 Realizar cruzamentos recprocos e observar se os descendentes possuem o fentipo da
me.

12 Realizar o cruzamento entre uma planta feminina com o gene mitocondrial da macho-
esterilidade e a linhagem desejada e ao obter os descendentes com o gene da macho-
esterilidade, usar sempre as plantas femininas para cruzar com machos das linhagens puras,
at obter em uma gerao Fn os descendentes com quase 100% da origem da linhagem
desejada.

13 a) M, Rf, rf M1 -> gene da macho-esterilidade.

b) mRfRf * Mrfrf

c) A ( S rfrf ) * B ( N RfRf) C ( S rfrf) * D ( N rfrf)
AB (S Rfrf) CD ( S rfrf)

(A*B)(C*D) (S Rfrf)
50% frtil.

d) A linhagem promissora macho-frtil, se obtida de populao sem o alelo restaurados, a sua
constituio deve ser rfrf(N). Atravs de retrocruzamentos sucessivos com uma planta macho-
estril, transfere-se o gentipo da linhagem desejada para o citoplasma macho-estril. Desse
modo, consegue-se a linhagem desejada com a constituio macho-estril. Ocruzamento delas
ir produzir sempre a linhagem macho-estril.

14 Se for sempre a me que transmitir a doena aos descendentes.
15 Herana citoplasmtica, pois s as fmeas transmitem aos filhos.

Captulo 17 - Biotecnologia

1 A possibilidade de se resolver problemas no solucionados pelo melhoramento
convencional, a possibilidade de se propagar rapidamente plantas, a obteno de plantas
puras ou sem patgenos de maneira simples e sem passar por muitas fecundaes e sem
utilizar herbicidas, a possibilidade de utilizar genes de interesse de qualquer espcie para
introduzir em uma planta, entre outros.
2 A totipotncia das clulas. Qual o meio de cultivo apropriado para a multiplicao de cada
espcie. A cultura de tecidos funciona como clonagem quando a partir de um grupo de clulas
so obtidas vrios clones daquela planta e como parte de variabilidade quando se aproveita a
variao gerada pela rpida multiplicao de clulas, sem que estas se regenerem em plantas.

3 Principalmente alteraes cromossmicas, resultantes das muitas divises celulares

4 A fuso de protoplastos e a transformao gentica.

5 B) A enzima EcoRI, pois produz fragmentos com pontas coesivas que podem se ligar a
outras com as mesmas pontas complementares.
c) EcoRI : 6 nucleotdeos = (1/4)^4 = 1/4096
1/4096 x 10^8 = 24414 fragmentos.

Hae III 4 nucleotdeos : (1/4)^4 = 1/256
1/256 x 10^8 = 390625 fragmentos.

6 A engenharia gentica, pois permite direcionar com maior especificidade qual gene ser
inserido no DNA vegetal. Na variao semaclonal, as mutaes que surgem so desconhecidas
e muitas vezes deletrias. Na fuso dos protoplastos, as variaes so conhecidas mas no se
tem 100% de certeza se o hbrido somtico ir possuir todas elas